code
stringlengths
5
1.03M
repo_name
stringlengths
5
90
path
stringlengths
4
158
license
stringclasses
15 values
size
int64
5
1.03M
n_ast_errors
int64
0
53.9k
ast_max_depth
int64
2
4.17k
n_whitespaces
int64
0
365k
n_ast_nodes
int64
3
317k
n_ast_terminals
int64
1
171k
n_ast_nonterminals
int64
1
146k
loc
int64
-1
37.3k
cycloplexity
int64
-1
1.31k
-- -- Copyright 2014, NICTA -- -- This software may be distributed and modified according to the terms of -- the BSD 2-Clause license. Note that NO WARRANTY is provided. -- See "LICENSE_BSD2.txt" for details. -- -- @TAG(NICTA_BSD) -- {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE TypeSynonymInstances #-} module CapDL.PrintUtils where import CapDL.Model import Text.PrettyPrint import Data.Maybe (fromMaybe) import Data.Word import qualified Data.Set as Set import Numeric listSucc :: Enum a => [a] -> [a] listSucc list = init list ++ [succ (last list)] class (Show a, Eq a) => Printing a where isSucc :: a -> a -> Bool num :: a -> Doc instance Printing Word where isSucc first second = succ first == second num n = int (fromIntegral n) instance Printing [Word] where isSucc first second = listSucc first == second num ns = hsep $ punctuate comma (map num ns) hex :: Word -> String hex x = "0x" ++ showHex x "" --Horrible hack for integral log base 2. logBase2 :: Word -> Int -> Int logBase2 1 i = i logBase2 n i = logBase2 (n `div` 2) (i+1) showID :: ObjID -> String showID (name, Nothing) = name showID (name, Just num) = name ++ "[" ++ show num ++ "]" maybeParens text | isEmpty text = empty | otherwise = parens text maybeParensList text = maybeParens $ hsep $ punctuate comma $ filter (not . isEmpty) text prettyBits bits = num bits <+> text "bits" prettyMBits mbits = case mbits of Nothing -> empty Just bits -> prettyBits bits prettyLevel l = text "level" <> colon <+> num l --Is there a better way to do this? prettyVMSize vmSz = if vmSz >= 2^20 then num (vmSz `div` (2^20)) <> text "M" else num (vmSz `div` (2^10)) <> text "k" prettyPaddr :: Maybe Word -> Doc prettyPaddr Nothing = empty prettyPaddr (Just p) = text "paddr:" <+> (text $ hex p) prettyPortsSize :: Word -> Doc prettyPortsSize size = num (size `div` (2^10)) <> text "k ports" prettyAddr :: Word -> Doc prettyAddr addr = text "addr:" <+> num addr prettyIP :: Maybe Word -> Doc prettyIP Nothing = empty prettyIP (Just ip) = text "ip:" <+> num ip prettySP :: Maybe Word -> Doc prettySP Nothing = empty prettySP (Just sp) = text "sp:" <+> num sp prettyElf :: Maybe String -> Doc prettyElf Nothing = empty prettyElf (Just elf) = text "elf:" <+> text elf prettyPrio :: Maybe Integer -> Doc prettyPrio Nothing = empty prettyPrio (Just prio) = text "prio:" <+> (text $ show prio) prettyMaxPrio :: Maybe Integer -> Doc prettyMaxPrio Nothing = empty prettyMaxPrio (Just max_prio) = text "max_prio:" <+> (text $ show max_prio) prettyCrit :: Maybe Integer -> Doc prettyCrit Nothing = empty prettyCrit (Just crit) = text "crit:" <+> (text $ show crit) prettyMaxCrit :: Maybe Integer -> Doc prettyMaxCrit Nothing = empty prettyMaxCrit (Just max_crit) = text "max_crit:" <+> (text $ show max_crit) prettyDom :: Integer -> Doc prettyDom dom = text "dom:" <+> (text $ show dom) prettyExtraInfo :: Maybe TCBExtraInfo -> Doc prettyExtraInfo Nothing = empty prettyExtraInfo (Just (TCBExtraInfo addr ip sp elf prio max_prio crit max_crit)) = hsep $ punctuate comma $ filter (not . isEmpty) [prettyAddr addr, prettyIP ip, prettySP sp, prettyElf elf, prettyPrio prio, prettyMaxPrio max_prio, prettyCrit crit, prettyMaxCrit max_crit] prettyInitArguments :: [Word] -> Doc prettyInitArguments [] = empty prettyInitArguments init = text "init:" <+> brackets (hsep $ punctuate comma $ map num init) prettyDomainID :: Word -> Doc prettyDomainID dom = text "domainID:" <+> num dom prettyPeriod :: Maybe Word -> Doc prettyPeriod Nothing = empty prettyPeriod (Just period) = text "period:" <+> (text $ show period) prettyDeadline :: Maybe Word -> Doc prettyDeadline Nothing = empty prettyDeadline (Just deadline) = text "deadline:" <+> (text $ show deadline) prettyExecReq :: Maybe Word -> Doc prettyExecReq Nothing = empty prettyExecReq (Just exec_req) = text "exec_req:" <+> (text $ show exec_req) prettyFlags :: Maybe Integer -> Doc prettyFlags Nothing = empty prettyFlags (Just flags) = text "flags:" <+> (text $ show flags) prettySCExtraInfo :: Maybe SCExtraInfo -> Doc prettySCExtraInfo Nothing = empty prettySCExtraInfo (Just (SCExtraInfo period deadline exec_req flags)) = hsep $ punctuate comma $ filter (not . isEmpty) [prettyPeriod period, prettyDeadline deadline, prettyExecReq exec_req, prettyFlags flags] prettyPCIDevice :: (Word, Word, Word) -> Doc prettyPCIDevice (pci_bus, pci_dev, pci_fun) = num pci_bus <> colon <> num pci_dev <> text "." <> num pci_fun prettyObjParams obj = case obj of Endpoint -> text "ep" AsyncEndpoint -> text "aep" TCB _ extra dom init -> text "tcb" <+> maybeParensList [prettyExtraInfo extra, prettyDom dom, prettyInitArguments init] CNode _ 0 -> text "irq" --FIXME: This should check if the obj is in the irqNode CNode _ bits -> text "cnode" <+> maybeParensList [prettyBits bits] Untyped mbits -> text "ut" <+> maybeParensList [prettyMBits mbits] ASIDPool {} -> text "asid_pool" PT {} -> text "pt" PD {} -> text "pd" Frame vmSz paddr -> text "frame" <+> maybeParensList [prettyVMSize vmSz, prettyPaddr paddr] IOPT _ level -> text "io_pt" <+> maybeParensList [prettyLevel level] IOPorts size -> text "io_ports" <+> maybeParensList [prettyPortsSize size] IODevice _ dom pci -> text "io_device" <+> maybeParensList [prettyDomainID dom, prettyPCIDevice pci] VCPU {} -> text "vcpu" SC extra -> text "sc" <+> maybeParensList [prettySCExtraInfo extra] capParams [] = empty capParams xs = parens (hsep $ punctuate comma xs) successiveWordsUp :: [Maybe Word] -> [Word] successiveWordsUp [] = [] successiveWordsUp [Just x] = [x] successiveWordsUp ls@((Just first):(Just second):xs) | succ first == second = first:(successiveWordsUp (tail ls)) | otherwise = [first] successiveWordsDown :: [Maybe Word] -> [Word] successiveWordsDown [] = [] successiveWordsDown [Just x] = [x] successiveWordsDown ls@((Just first):(Just second):xs) | first == succ second = first:(successiveWordsDown (tail ls)) | otherwise = [first] successiveWords :: [Maybe Word] -> [Word] successiveWords [] = [] successiveWords list = if length up == 1 then down else up where up = successiveWordsUp list down = successiveWordsDown list breakSuccessive :: [Maybe Word] -> [[Word]] breakSuccessive [] = [] breakSuccessive list = range:(breakSuccessive (drop (length range) list)) where range = successiveWords list prettyRange :: [Word] -> Doc prettyRange [x] = num x prettyRange range = num (head range) <> text ".." <> num (last range) prettyRanges :: [Maybe Word] -> Doc prettyRanges range = hsep $ punctuate comma $ map prettyRange ranges where ranges = breakSuccessive range prettyBrackets :: [Maybe Word] -> Doc prettyBrackets [Nothing] = empty prettyBrackets list = brackets (prettyRanges list) prettyParemNum t n = [text t <> colon <+> num n] maybeNum t 0 = [] maybeNum t n = prettyParemNum t n maybeBadge = maybeNum "badge" prettyRight _ Read = text "R" prettyRight _ Write = text "W" prettyRight True Grant = text "X" prettyRight False Grant = text "G" maybeRightsList _ [] = [] maybeRightsList isFrame xs = [hcat (map (prettyRight isFrame) xs)] maybeRights isFrame r = maybeRightsList isFrame (Set.toList r) maybeGuard = maybeNum "guard" maybeGSize = maybeNum "guard_size" portsRange ports = [text "ports:" <+> prettyBrackets (map Just (Set.toList ports))] zombieNum n = [text "zombie" <> colon <+> num n] printAsid (high, low) = text "(" <> num high <> text ", " <> num low <> text ")" prettyAsid asid = [text "asid:" <+> printAsid asid] maybeAsid Nothing = [] maybeAsid (Just asid) = prettyAsid asid maybeCapParams :: Cap -> Doc maybeCapParams cap = case cap of EndpointCap _ badge rights -> capParams (maybeBadge badge ++ maybeRights False rights) AsyncEndpointCap _ badge rights -> capParams (maybeBadge badge ++ maybeRights False rights) ReplyCap _ -> capParams [text "reply"] MasterReplyCap _ -> capParams [text "master_reply"] CNodeCap _ guard gsize -> capParams (maybeGuard guard ++ maybeGSize gsize) FrameCap _ rights asid cached -> capParams (maybeRights True rights ++ maybeAsid asid ++ (if cached then [] else [text "uncached"])) PTCap _ asid -> capParams (maybeAsid asid) PDCap _ asid -> capParams (maybeAsid asid) ASIDPoolCap _ asid -> capParams (prettyAsid asid) IOPortsCap _ ports -> capParams (portsRange ports) _ -> empty printCap :: Cap -> Doc printCap cap = case cap of NullCap -> text "null" IOSpaceMasterCap -> text ioSpaceMaster ASIDControlCap -> text asidControl IRQControlCap -> text irqControl DomainCap -> text domain SchedControlCap -> text schedControl _ -> text $ fst $ objID cap sameName :: ObjID -> ObjID -> Bool sameName (first, _) (second, _) = first == second sameParams :: Cap -> Cap -> Bool sameParams cap1 cap2 = case (cap1, cap2) of ((EndpointCap _ b1 r1), (EndpointCap _ b2 r2)) -> b1 == b2 && r1 == r2 ((AsyncEndpointCap _ b1 r1), (AsyncEndpointCap _ b2 r2)) -> b1 == b2 && r1 == r2 ((CNodeCap _ g1 gs1), (CNodeCap _ g2 gs2)) -> g1 == g2 && gs1 == gs2 ((FrameCap _ r1 a1 c1), (FrameCap _ r2 a2 c2)) -> r1 == r2 && a1 == a2 && c1 == c2 ((PTCap _ a1), (PTCap _ a2)) -> a1 == a2 ((PDCap _ a1), (PDCap _ a2)) -> a1 == a2 _ -> True sameCapName :: Cap -> Cap -> Bool sameCapName first second | not (hasObjID first) || not (hasObjID second) = False | snd (objID first) == Nothing || snd (objID second) == Nothing = False | otherwise = sameName (objID first) (objID second) sameCap :: Cap -> Cap -> Bool sameCap first second = sameCapName first second && sameParams first second class Arrayable a where isSameArray :: a -> a -> Bool instance Arrayable Cap where isSameArray = sameCap instance Arrayable ObjID where isSameArray = sameName sameArray :: (Printing a, Arrayable b) => [(a, b)] -> [(a, b)] sameArray [] = [] sameArray [x] = [x] sameArray ls@(x@(slot1, first):(slot2, second):xs) | isSameArray first second && isSucc slot1 slot2 = x:(sameArray (tail ls)) | otherwise = [x] same :: Printing a => (ObjID, KernelObject a) -> (ObjID, KernelObject a) -> Bool same (name1, obj1) (name2, obj2) = if (hasSlots obj1 && hasSlots obj2) then sameName name1 name2 && slots obj1 == slots obj2 else sameName name1 name2 prettyArch ARM11 = text "arm11" prettyArch IA32 = text "ia32"
smaccm/capDL-tool
CapDL/PrintUtils.hs
bsd-2-clause
10,632
2
14
2,221
4,114
2,045
2,069
243
15
{-# OPTIONS -fglasgow-exts #-} ----------------------------------------------------------------------------- {-| Module : QStyleOptionGraphicsItem.hs Copyright : (c) David Harley 2010 Project : qtHaskell Version : 1.1.4 Modified : 2010-09-02 17:02:20 Warning : this file is machine generated - do not modify. --} ----------------------------------------------------------------------------- module Qtc.Gui.QStyleOptionGraphicsItem ( QqStyleOptionGraphicsItem(..) ,QqStyleOptionGraphicsItem_nf(..) ,qexposedRect, exposedRect ,levelOfDetail ,qsetExposedRect, setExposedRect ,setLevelOfDetail ,qStyleOptionGraphicsItem_delete ) where import Foreign.C.Types import Qth.ClassTypes.Core import Qtc.Enums.Base import Qtc.Classes.Base import Qtc.Classes.Qccs import Qtc.Classes.Core import Qtc.ClassTypes.Core import Qth.ClassTypes.Core import Qtc.Classes.Gui import Qtc.ClassTypes.Gui class QqStyleOptionGraphicsItem x1 where qStyleOptionGraphicsItem :: x1 -> IO (QStyleOptionGraphicsItem ()) instance QqStyleOptionGraphicsItem (()) where qStyleOptionGraphicsItem () = withQStyleOptionGraphicsItemResult $ qtc_QStyleOptionGraphicsItem foreign import ccall "qtc_QStyleOptionGraphicsItem" qtc_QStyleOptionGraphicsItem :: IO (Ptr (TQStyleOptionGraphicsItem ())) instance QqStyleOptionGraphicsItem ((QStyleOptionGraphicsItem t1)) where qStyleOptionGraphicsItem (x1) = withQStyleOptionGraphicsItemResult $ withObjectPtr x1 $ \cobj_x1 -> qtc_QStyleOptionGraphicsItem1 cobj_x1 foreign import ccall "qtc_QStyleOptionGraphicsItem1" qtc_QStyleOptionGraphicsItem1 :: Ptr (TQStyleOptionGraphicsItem t1) -> IO (Ptr (TQStyleOptionGraphicsItem ())) class QqStyleOptionGraphicsItem_nf x1 where qStyleOptionGraphicsItem_nf :: x1 -> IO (QStyleOptionGraphicsItem ()) instance QqStyleOptionGraphicsItem_nf (()) where qStyleOptionGraphicsItem_nf () = withObjectRefResult $ qtc_QStyleOptionGraphicsItem instance QqStyleOptionGraphicsItem_nf ((QStyleOptionGraphicsItem t1)) where qStyleOptionGraphicsItem_nf (x1) = withObjectRefResult $ withObjectPtr x1 $ \cobj_x1 -> qtc_QStyleOptionGraphicsItem1 cobj_x1 qexposedRect :: QStyleOptionGraphicsItem a -> (()) -> IO (QRectF ()) qexposedRect x0 () = withQRectFResult $ withObjectPtr x0 $ \cobj_x0 -> qtc_QStyleOptionGraphicsItem_exposedRect cobj_x0 foreign import ccall "qtc_QStyleOptionGraphicsItem_exposedRect" qtc_QStyleOptionGraphicsItem_exposedRect :: Ptr (TQStyleOptionGraphicsItem a) -> IO (Ptr (TQRectF ())) exposedRect :: QStyleOptionGraphicsItem a -> (()) -> IO (RectF) exposedRect x0 () = withRectFResult $ \crectf_ret_x crectf_ret_y crectf_ret_w crectf_ret_h -> withObjectPtr x0 $ \cobj_x0 -> qtc_QStyleOptionGraphicsItem_exposedRect_qth cobj_x0 crectf_ret_x crectf_ret_y crectf_ret_w crectf_ret_h foreign import ccall "qtc_QStyleOptionGraphicsItem_exposedRect_qth" qtc_QStyleOptionGraphicsItem_exposedRect_qth :: Ptr (TQStyleOptionGraphicsItem a) -> Ptr CDouble -> Ptr CDouble -> Ptr CDouble -> Ptr CDouble -> IO () levelOfDetail :: QStyleOptionGraphicsItem a -> (()) -> IO (Double) levelOfDetail x0 () = withDoubleResult $ withObjectPtr x0 $ \cobj_x0 -> qtc_QStyleOptionGraphicsItem_levelOfDetail cobj_x0 foreign import ccall "qtc_QStyleOptionGraphicsItem_levelOfDetail" qtc_QStyleOptionGraphicsItem_levelOfDetail :: Ptr (TQStyleOptionGraphicsItem a) -> IO CDouble instance Qmatrix (QStyleOptionGraphicsItem a) (()) where matrix x0 () = withQMatrixResult $ withObjectPtr x0 $ \cobj_x0 -> qtc_QStyleOptionGraphicsItem_matrix cobj_x0 foreign import ccall "qtc_QStyleOptionGraphicsItem_matrix" qtc_QStyleOptionGraphicsItem_matrix :: Ptr (TQStyleOptionGraphicsItem a) -> IO (Ptr (TQMatrix ())) qsetExposedRect :: QStyleOptionGraphicsItem a -> ((QRectF t1)) -> IO () qsetExposedRect x0 (x1) = withObjectPtr x0 $ \cobj_x0 -> withObjectPtr x1 $ \cobj_x1 -> qtc_QStyleOptionGraphicsItem_setExposedRect cobj_x0 cobj_x1 foreign import ccall "qtc_QStyleOptionGraphicsItem_setExposedRect" qtc_QStyleOptionGraphicsItem_setExposedRect :: Ptr (TQStyleOptionGraphicsItem a) -> Ptr (TQRectF t1) -> IO () setExposedRect :: QStyleOptionGraphicsItem a -> ((RectF)) -> IO () setExposedRect x0 (x1) = withObjectPtr x0 $ \cobj_x0 -> withCRectF x1 $ \crectf_x1_x crectf_x1_y crectf_x1_w crectf_x1_h -> qtc_QStyleOptionGraphicsItem_setExposedRect_qth cobj_x0 crectf_x1_x crectf_x1_y crectf_x1_w crectf_x1_h foreign import ccall "qtc_QStyleOptionGraphicsItem_setExposedRect_qth" qtc_QStyleOptionGraphicsItem_setExposedRect_qth :: Ptr (TQStyleOptionGraphicsItem a) -> CDouble -> CDouble -> CDouble -> CDouble -> IO () setLevelOfDetail :: QStyleOptionGraphicsItem a -> ((Double)) -> IO () setLevelOfDetail x0 (x1) = withObjectPtr x0 $ \cobj_x0 -> qtc_QStyleOptionGraphicsItem_setLevelOfDetail cobj_x0 (toCDouble x1) foreign import ccall "qtc_QStyleOptionGraphicsItem_setLevelOfDetail" qtc_QStyleOptionGraphicsItem_setLevelOfDetail :: Ptr (TQStyleOptionGraphicsItem a) -> CDouble -> IO () instance QsetMatrix (QStyleOptionGraphicsItem a) ((QMatrix t1)) where setMatrix x0 (x1) = withObjectPtr x0 $ \cobj_x0 -> withObjectPtr x1 $ \cobj_x1 -> qtc_QStyleOptionGraphicsItem_setMatrix cobj_x0 cobj_x1 foreign import ccall "qtc_QStyleOptionGraphicsItem_setMatrix" qtc_QStyleOptionGraphicsItem_setMatrix :: Ptr (TQStyleOptionGraphicsItem a) -> Ptr (TQMatrix t1) -> IO () qStyleOptionGraphicsItem_delete :: QStyleOptionGraphicsItem a -> IO () qStyleOptionGraphicsItem_delete x0 = withObjectPtr x0 $ \cobj_x0 -> qtc_QStyleOptionGraphicsItem_delete cobj_x0 foreign import ccall "qtc_QStyleOptionGraphicsItem_delete" qtc_QStyleOptionGraphicsItem_delete :: Ptr (TQStyleOptionGraphicsItem a) -> IO ()
keera-studios/hsQt
Qtc/Gui/QStyleOptionGraphicsItem.hs
bsd-2-clause
5,799
0
12
741
1,324
681
643
-1
-1
{-# LANGUAGE DefaultSignatures #-} {-# LANGUAGE RankNTypes #-} module Arbitrary.Arbitrary ( Arbitrary1(..), genNel, smaller, maybeGen, genScope, genVar ) where import Bound import Control.Applicative import Data.List.NonEmpty hiding (fromList) import Data.Map import Data.Monoid import Data.Void import Prelude.Extras import Test.QuickCheck import Test.QuickCheck.Function import Test.QuickCheck.Instances -- Orphans instance (Arbitrary a, Arbitrary b) => Arbitrary (Var a b) where arbitrary = oneof [ B <$> arbitrary, F <$> arbitrary ] instance (Arbitrary b,Arbitrary v,Arbitrary1 f,Functor f) => Arbitrary (Scope b f v) where arbitrary = Scope . fmap (fmap lower1) <$> arbitrary1 instance Arbitrary a => Arbitrary (NonEmpty a) where arbitrary = genNel arbitrary genNel :: Gen a -> Gen (NonEmpty a) genNel g = (:|) <$> g <*> listOf g -- | Combinator for decreasing the size of a generator. Should be used when -- generating tree structures, as relying on probability to terminate them -- can lead to excessive memory consumption. smaller :: Gen a -> Gen a smaller g = sized $ \n -> resize (n`div`3) g maybeGen :: Applicative f => Maybe (Gen a) -> [Gen (f a)] maybeGen Nothing = [] maybeGen (Just g) = [ pure <$> g ] -- | Given a definite generator for bound varibles, and an optional one for -- free variables, definitely generates Vars. genVar :: Gen b -> Maybe (Gen a) -> Gen (Var b a) genVar gb Nothing = B <$> gb genVar gb (Just ga) = oneof [ B <$> gb , F <$> ga ] -- | As genVar, but allows for the possibility that bound variables cannot -- be generated, either. Potentially useful for generating well-scoped -- terms. genVar' :: Maybe (Gen b) -> Maybe (Gen a) -> Maybe (Gen (Var b a)) genVar' (Just gb) mga = Just $ genVar gb mga genVar' Nothing (Just ga) = Just (F <$> ga) genVar' Nothing Nothing = Nothing -- | Generates scopes with a definite supply of bound variables. The -- higher-order generator must be able to handle a lack of free variables. genScope :: Gen b -> (forall z. Maybe (Gen z) -> Gen (f z)) -> Maybe (Gen a) -> Gen (Scope b f a) genScope gb gf mga = Scope <$> gf (Just . genVar gb . Just $ gf mga) -- | As genScope, but with the possibility of no bound variables. genScope' :: Maybe (Gen b) -> (forall z. Maybe (Gen z) -> Gen (f z)) -> Maybe (Gen a) -> Gen (Scope b f a) genScope' mgb gf mga = Scope <$> gf (genVar' mgb . Just $ gf mga) -- Higher-order arbitrary class Arbitrary1 f where arbitrary1 :: Arbitrary a => Gen (f a) default arbitrary1 :: Arbitrary (f a) => Gen (f a) arbitrary1 = arbitrary instance Arbitrary a => Arbitrary1 ((,) a) instance Arbitrary1 Maybe instance Arbitrary1 [] instance Arbitrary a => Arbitrary1 (Either a) instance (Arbitrary1 f, Arbitrary u) => Arbitrary (Lift1 f u) where arbitrary = Lift1 <$> arbitrary1
PipocaQuemada/ermine
tests/properties/Arbitrary/Arbitrary.hs
bsd-2-clause
2,836
0
12
557
988
508
480
50
1
-- http://www.codewars.com/kata/5410c0e6a0e736cf5b000e69 module Hamming where hamming :: String -> String -> Int hamming a b = length $ filter id $ zipWith (/=) a b
Bodigrim/katas
src/haskell/6-Hamming-Distance.hs
bsd-2-clause
166
0
7
26
48
26
22
3
1
{-# LANGUAGE OverloadedStrings #-} module Routes where import Control.Applicative import Control.Monad.Except (ExceptT, forM_, runExceptT, liftIO, throwError, when) import qualified Data.Aeson as Json import qualified Data.Binary as Binary import qualified Data.ByteString.Char8 as BS import qualified Data.ByteString.Lazy.Char8 as LBS import qualified Data.Either as Either import qualified Data.List as List import qualified Data.Map as Map import qualified Text.Read as Read import Snap.Core import Snap.Util.FileServe import Snap.Util.FileUploads import System.Directory import System.FilePath import qualified Elm.Compiler.Module as Module import qualified Elm.Docs as Docs import qualified Elm.Package as Pkg import qualified Elm.Package.Description as Desc import qualified Elm.Package.Paths as Path import qualified GitHub import qualified NewPackageList import qualified NativeWhitelist import qualified PackageSummary as PkgSummary import qualified ServeFile packages :: Snap () packages = ifTop (redirect' "/" 301) <|> route [ (":user/:name", package) ] <|> serveDirectory "packages" package :: Snap () package = do user <- getParameter "user" Right name <- getParameter "name" Right let pkg = Pkg.Name user name ifTop (ServeFile.pkgOverview pkg) <|> route [ ("latest", redirectToLatest pkg) , (":version", servePackageInfo pkg) ] servePackageInfo :: Pkg.Name -> Snap () servePackageInfo name = do version <- getParameter "version" Pkg.versionFromString let pkgDir = packageRoot name version exists <- liftIO $ doesDirectoryExist pkgDir when (not exists) pass ifTop (ServeFile.pkgDocs name version Nothing) <|> serveModule name version serveModule :: Pkg.Name -> Pkg.Version -> Snap () serveModule name version = do request <- getRequest let potentialName = BS.unpack (rqPathInfo request) let docsDir = packageRoot name version </> "docs" exists <- liftIO $ doesFileExist (docsDir </> potentialName <.> "json") when (not exists) pass case Module.dehyphenate potentialName of Nothing -> pass Just moduleName -> ServeFile.pkgDocs name version (Just moduleName) redirectToLatest :: Pkg.Name -> Snap () redirectToLatest name = do rawVersions <- liftIO (getDirectoryContents (packageDirectory </> Pkg.toFilePath name)) case Either.rights (map Pkg.versionFromString rawVersions) of [] -> httpStringError 404 $ "Could not find any versions of package " ++ Pkg.toString name versions -> do let latestVersion = last (List.sort versions) let url = "/packages/" ++ Pkg.toUrl name ++ "/" ++ Pkg.versionToString latestVersion ++ "/" request <- getRequest redirect (BS.append (BS.pack url) (rqPathInfo request)) -- DIRECTORIES packageDirectory :: FilePath packageDirectory = "packages" packageRoot :: Pkg.Name -> Pkg.Version -> FilePath packageRoot name version = packageDirectory </> Pkg.toFilePath name </> Pkg.versionToString version documentationPath :: FilePath documentationPath = "documentation.json" -- REGISTER MODULES register :: Snap () register = do name <- getParameter "name" Pkg.fromString version <- getParameter "version" Pkg.versionFromString verifyVersion name version let directory = packageRoot name version liftIO (createDirectoryIfMissing True directory) uploadFiles directory description <- Desc.read (directory </> Path.description) result <- liftIO $ runExceptT $ do verifyWhitelist (Desc.natives description) (Desc.name description) splitDocs directory case result of Right () -> liftIO $ do PkgSummary.add description NewPackageList.addIfNew description Left err -> do liftIO (removeDirectoryRecursive directory) httpStringError 400 err verifyVersion :: Pkg.Name -> Pkg.Version -> Snap () verifyVersion name version = do maybeVersions <- liftIO (PkgSummary.readVersionsOf name) case maybeVersions of Just localVersions | version `elem` localVersions -> httpStringError 400 ("Version " ++ Pkg.versionToString version ++ " has already been registered.") _ -> return () publicVersions <- GitHub.getVersionTags name case version `elem` publicVersions of True -> return () False -> httpStringError 400 ("The tag " ++ Pkg.versionToString version ++ " has not been pushed to GitHub.") verifyWhitelist :: Bool -> Pkg.Name -> ExceptT String IO () verifyWhitelist allowNatives name = case allowNatives of False -> return () True -> do whitelist <- liftIO NativeWhitelist.read case name `elem` whitelist of True -> return () False -> throwError (whitelistError name) whitelistError :: Pkg.Name -> String whitelistError name = "You are trying to publish a project that has native modules, but this is not\n\ \permitted for now.\n\ \\n\ \Writing native modules is very important because it will let the Elm community\n\ \cover the whole web platform with nice community-driven packages. That said,\n\ \it introduces many ways to break the guarantees provided by Elm, so it is very\n\ \important that these packages are written in a reliable way.\n\ \\n\ \Essentially, it is clear that this is very important, but also clear that we do\n\ \not have a good mechanism for making sure everyone can write reliable native\n\ \modules. This is one of the big issues getting focused on in upcoming releases.\n\ \\n\ \For now, there is review process to expidite certain things, but it is badly\n\ \backed up. If you really cannot wait a few months before publishing, please\n\ \open an issue with the title:\n\ \\n\ \ \"Native review for " ++ Pkg.toString name ++ "\"\n\ \\n\ \at <https://github.com/elm-lang/package.elm-lang.org/issues>. The issue should\n\ \link to the relevant repository and provide sufficient context for evaluation.\n\ \But keep in mind that the review process is significantly backed up! The\n\ \priority is on making reviews unnecessary, and in the meantime, the fewer\n\ \special exceptions the better." -- UPLOADING FILES uploadFiles :: FilePath -> Snap () uploadFiles directory = handleFileUploads "/tmp" defaultUploadPolicy perPartPolicy (handleParts directory) where perPartPolicy info = if Map.member (partFieldName info) filesForUpload then allowWithMaximumSize $ 2^(19::Int) else disallow filesForUpload :: Map.Map BS.ByteString FilePath filesForUpload = Map.fromList [ ("documentation", documentationPath) , ("description", Path.description) , ("readme", "README.md") ] handleParts :: FilePath -> [(PartInfo, Either PolicyViolationException FilePath)] -> Snap () handleParts _dir [] = return () handleParts dir ((info, eitherPath) : parts) = case (eitherPath, Map.lookup (partFieldName info) filesForUpload) of (Right tempPath, Just targetPath) -> do liftIO $ do contents <- BS.readFile tempPath BS.writeFile (dir </> targetPath) contents handleParts dir parts _ -> do mapM (writePartError . snd) parts httpStringError 404 $ "Files " ++ documentationPath ++ " and " ++ Path.description ++ " were not uploaded." writePartError :: Either PolicyViolationException FilePath -> Snap () writePartError part = case part of Right _ -> return () Left exception -> writeText (policyViolationExceptionReason exception) splitDocs :: FilePath -> ExceptT String IO () splitDocs directory = do json <- liftIO (LBS.readFile (directory </> documentationPath)) case Json.decode json of Nothing -> throwError "The uploaded documentation is invalid." Just docs -> liftIO $ forM_ (docs :: [Docs.Documentation]) $ \doc -> do let name = Module.hyphenate (Docs.moduleName doc) let docPath = directory </> "docs" </> name <.> "json" createDirectoryIfMissing True (directory </> "docs") LBS.writeFile docPath (Json.encode doc) -- FETCH ALL AVAILABLE VERSIONS versions :: Snap () versions = do name <- getParameter "name" Pkg.fromString versions <- liftIO (PkgSummary.readVersionsOf name) writeLBS (Binary.encode versions) -- UPDATE REMOTE PACKAGE CACHES allPackages :: Snap () allPackages = do maybeValue <- getParam "since" maybeVersion <- fmap BS.unpack <$> getParam "elm-package-version" let allPackagesPath = case maybeVersion of Just "0.16" -> PkgSummary.allPackages Nothing -> PkgSummary.allPackages Just _ -> PkgSummary.allPackagesOld let maybeString = fmap BS.unpack maybeValue needsUpdate <- case Read.readMaybe =<< maybeString of Nothing -> return True Just remoteTime -> do localTime <- liftIO (getModificationTime allPackagesPath) return (remoteTime < localTime) if needsUpdate || maybeVersion == Just "0.16" then serveFile allPackagesPath else writeLBS "null" -- FETCH RESOURCES documentation :: Snap () documentation = fetch documentationPath description :: Snap () description = fetch Path.description fetch :: FilePath -> Snap () fetch filePath = do name <- getParameter "name" Pkg.fromString version <- getParameter "version" Pkg.versionFromString let target = packageRoot name version </> filePath exists <- liftIO $ doesFileExist target case exists of True -> serveFile target False -> httpError 404 "That library and version is not registered." -- HELPERS getParameter :: BS.ByteString -> (String -> Either String a) -> Snap a getParameter param fromString = do maybeValue <- getParam param let notFoundMsg = "could not find parameter named " ++ BS.unpack param let eitherString = maybe (Left notFoundMsg) (Right . BS.unpack) maybeValue case fromString =<< eitherString of Right value -> return value Left problem -> httpError 400 $ BS.concat [ "problem with parameter '", param, "': ", BS.pack problem ] httpStringError :: Int -> String -> Snap a httpStringError code msg = httpError code (BS.pack msg) httpError :: Int -> BS.ByteString -> Snap a httpError code msg = do modifyResponse $ setResponseCode code writeBS msg finishWith =<< getResponse
mgold/package.elm-lang.org
src/backend/Routes.hs
bsd-3-clause
10,942
17
25
2,748
2,673
1,308
1,365
242
5
{-# LANGUAGE OverloadedStrings #-} module Main where import SlackBot.Config import SlackBot.Bot main :: IO () main = readConf "bot.cfg" >>= run
Lepovirta/slackbot
src/Main.hs
bsd-3-clause
146
0
6
23
37
21
16
6
1
{-# LANGUAGE TypeOperators, MultiParamTypeClasses, FunctionalDependencies #-} {-# LANGUAGE BangPatterns #-} -- | This module provides data structures for Ethernet frames -- as well as parsers and unparsers for Ethernet frames. module Nettle.Ethernet.EthernetFrame ( -- * Data types EthernetFrame(..) , EthernetBody(..) , EthernetHeader(..) , EthernetTypeCode , ethTypeVLAN , ethTypeIP , ethTypeARP , ethTypeLLDP , ethTypeIPv6 , ethType8021X , ethTypePaneDP , typeEth2Cutoff , VLANPriority , VLANID , eth_ip_packet , eth_ip_tcp_packet , eth_ip_udp_packet , foldEthernetFrame , foldEthernetBody -- * Parsers and unparsers , getEthernetFrame , getEthHeader , getEthHeader2 , putEthHeader , putEthFrame -- * ARP frames , arpQuery , arpReply ) where import Nettle.Ethernet.EthernetAddress import Nettle.IPv4.IPPacket import Nettle.IPv4.IPAddress import Nettle.Ethernet.AddressResolutionProtocol import qualified Data.ByteString as B import Data.Binary import Data.Binary.Get import Data.Word import Data.Bits import Control.Monad import Control.Monad.Error import Data.HList import qualified Data.Binary.Strict.Get as Strict import qualified Nettle.OpenFlow.StrictPut as Strict import qualified Data.Binary.Get as Binary -- | An Ethernet frame is either an IP packet, an ARP packet, or an uninterpreted @ByteString@. -- Based on http://en.wikipedia.org/wiki/File:Ethernet_Type_II_Frame_format.svg type EthernetFrame = EthernetHeader :*: EthernetBody :*: HNil data EthernetBody = IPInEthernet !IPPacket | ARPInEthernet !ARPPacket | PaneDPInEthernet Word64 Word16 | UninterpretedEthernetBody !B.ByteString deriving (Show,Eq) foldEthernetFrame :: (EthernetHeader -> EthernetBody -> a) -> EthernetFrame -> a foldEthernetFrame f (HCons h (HCons b HNil)) = f h b foldEthernetBody :: (IPPacket -> a) -> (ARPPacket -> a) -> (B.ByteString -> a) -> EthernetBody -> a foldEthernetBody f g h (IPInEthernet x) = f x foldEthernetBody f g h (ARPInEthernet x) = g x foldEthernetBody f g h (UninterpretedEthernetBody x) = h x withFrame :: HList l => (EthernetBody -> Maybe l) -> EthernetFrame -> Maybe (EthernetHeader :*: l) withFrame f frame = foldEthernetFrame (\h b -> fmap (hCons h) (f b)) frame fromIPPacket :: EthernetBody -> Maybe IPPacket fromIPPacket = foldEthernetBody Just (const Nothing) (const Nothing) fromARPPacket :: EthernetBody -> Maybe (ARPPacket :*: HNil) fromARPPacket = foldEthernetBody (const Nothing) (\x -> Just (hCons x HNil)) (const Nothing) eth_ip_packet :: EthernetFrame -> Maybe (EthernetHeader :*: IPPacket) eth_ip_packet = withFrame fromIPPacket eth_ip_tcp_packet :: EthernetFrame -> Maybe (EthernetHeader :*: IPHeader :*: TCPHeader :*: HNil) eth_ip_tcp_packet = withFrame $ fromIPPacket >=> withIPPacket fromTCPPacket eth_ip_udp_packet :: EthernetFrame -> Maybe (EthernetHeader :*: IPHeader :*: UDPHeader :*: B.ByteString :*: HNil) eth_ip_udp_packet = withFrame $ fromIPPacket >=> withIPPacket fromUDPPacket eth_arp_packet :: EthernetFrame -> Maybe (EthernetHeader :*: ARPPacket :*: HNil) eth_arp_packet = withFrame fromARPPacket data EthernetHeader = EthernetHeader { destMACAddress :: !EthernetAddress, sourceMACAddress :: !EthernetAddress, typeCode :: !EthernetTypeCode } | Ethernet8021Q { destMACAddress :: !EthernetAddress, sourceMACAddress :: !EthernetAddress, typeCode :: !EthernetTypeCode, priorityCodePoint :: !VLANPriority, canonicalFormatIndicator :: !Bool, vlanId :: !VLANID } deriving (Read,Show,Eq) type VLANPriority = Word8 -- | Ethernet type code, determines the type of payload carried by an Ethernet frame. type EthernetTypeCode = Word16 type VLANID = Word16 arpQuery :: EthernetAddress -- ^ source hardware address -> IPAddress -- ^ source IP address -> IPAddress -- ^ target IP address -> EthernetFrame arpQuery sha spa tpa = hCons hdr (hCons (ARPInEthernet ( body)) hNil) where hdr = EthernetHeader { destMACAddress = broadcastAddress , sourceMACAddress = sha , typeCode = ethTypeARP } body = ARPQuery (ARPQueryPacket { querySenderEthernetAddress = sha , querySenderIPAddress = spa , queryTargetIPAddress = tpa } ) arpReply :: EthernetAddress -- ^ source hardware address -> IPAddress -- ^ source IP address -> EthernetAddress -- ^ target hardware address -> IPAddress -- ^ target IP address -> EthernetFrame arpReply sha spa tha tpa = hCons hdr (hCons (ARPInEthernet ( body)) hNil) where hdr = EthernetHeader { destMACAddress = tha , sourceMACAddress = sha , typeCode = ethTypeARP } body = ARPReply (ARPReplyPacket { replySenderEthernetAddress = sha , replySenderIPAddress = spa , replyTargetEthernetAddress = tha , replyTargetIPAddress = tpa } ) -- | Parser for Ethernet frames. getEthernetFrame :: Strict.Get EthernetFrame getEthernetFrame = do hdr <- {-# SCC "getEthHeader" #-} getEthHeader -- r <- Strict.remaining case typeCode hdr of v | v == ethTypeIP -> do ipPacket <- getIPPacket return $ hCons hdr (hCons (IPInEthernet ipPacket) hNil) v | v == ethTypeARP -> do mArpPacket <- getARPPacket case mArpPacket of Just arpPacket -> return $ hCons hdr (hCons (ARPInEthernet arpPacket) hNil) Nothing -> error "cannot decode arp packet" v | v == ethTypePaneDP -> do switchID <- Strict.getWord64be portID <- Strict.getWord16be return (hCons hdr (hCons (PaneDPInEthernet switchID portID) hNil)) v | v == ethTypeIPv6 -> do bs <- Strict.getByteString ipv6HeaderLen -- let's pretend options don't exist... return (hCons hdr (hCons (UninterpretedEthernetBody bs) hNil)) v | v == ethType8021X -> do bs <- Strict.getByteString eth8021xHeaderLen -- let's ignore the body for now... return (hCons hdr (hCons (UninterpretedEthernetBody bs) hNil)) otherwise -> error $ "unknown ethernet type code: " ++ show (typeCode hdr) -- | Parser for Ethernet headers. getEthHeader2 :: Binary.Get EthernetHeader getEthHeader2 = do dstAddr <- getEthernetAddress2 srcAddr <- getEthernetAddress2 tcode <- Binary.getWord16be if tcode < typeEth2Cutoff then error "don't know how to parse this kind of ethernet frame" else if (tcode == ethTypeVLAN) then do x <- Binary.getWord16be etherType <- Binary.getWord16be let pcp = fromIntegral (shiftR x 13) let cfi = testBit x 12 let vid = clearBits x [12,13,14,15] return (Ethernet8021Q dstAddr srcAddr etherType pcp cfi vid) else return (EthernetHeader dstAddr srcAddr tcode) getEthHeader :: Strict.Get EthernetHeader getEthHeader = do dstAddr <- getEthernetAddress srcAddr <- getEthernetAddress tcode <- Strict.getWord16be if tcode >= typeEth2Cutoff then if (tcode /= ethTypeVLAN) then return (EthernetHeader dstAddr srcAddr tcode) else do x <- Strict.getWord16be etherType <- Strict.getWord16be let pcp = fromIntegral (shiftR x 13) let cfi = testBit x 12 let vid = clearBits x [12,13,14,15] return (Ethernet8021Q dstAddr srcAddr etherType pcp cfi vid) else Strict.zero {-# INLINE getEthHeader #-} -- | Unparser for Ethernet headers. putEthHeader :: EthernetHeader -> Strict.Put putEthHeader (EthernetHeader dstAddr srcAddr tcode) = do putEthernetAddress dstAddr putEthernetAddress srcAddr Strict.putWord16be tcode putEthHeader (Ethernet8021Q dstAddr srcAddr tcode pcp cfi vid) = do putEthernetAddress dstAddr putEthernetAddress srcAddr Strict.putWord16be ethTypeVLAN Strict.putWord16be x Strict.putWord16be tcode where x = let y = shiftL (fromIntegral pcp :: Word16) 13 y' = if cfi then setBit y 12 else y in y' + fromIntegral vid putEthFrame :: EthernetFrame -> Strict.Put putEthFrame (HCons hdr (HCons body HNil)) = do putEthHeader hdr case body of IPInEthernet ipPacket -> error "put method NYI for IP packets" ARPInEthernet arpPacket -> error "put method NYI for ARP packets" UninterpretedEthernetBody bs -> Strict.putByteString bs PaneDPInEthernet switchID portID -> do Strict.putWord64be switchID Strict.putWord16be portID -- Best source for list: https://en.wikipedia.org/wiki/EtherType ethTypeIP, ethTypeARP, ethTypeLLDP, ethTypeVLAN, ethTypeIPv6, ethType8021X, typeEth2Cutoff :: EthernetTypeCode ethTypeIP = 0x0800 ethTypeARP = 0x0806 ethTypeLLDP = 0x88CC ethTypeVLAN = 0x8100 ethTypeIPv6 = 0x86DD ethType8021X = 0x888E typeEth2Cutoff = 0x0600 ethTypePaneDP :: EthernetTypeCode ethTypePaneDP = 0x0777 ipv6HeaderLen = 40 eth8021xHeaderLen = 4 clearBits :: Bits a => a -> [Int] -> a clearBits = foldl clearBit
brownsys/nettle-openflow
src/Nettle/Ethernet/EthernetFrame.hs
bsd-3-clause
10,089
46
21
3,029
2,171
1,156
1,015
227
7
{-# LANGUAGE TypeOperators, TemplateHaskell #-} ----------------------------------------------------------------------------- -- | -- Module : Data.Dimensions.SI -- Copyright : (C) 2013 Richard Eisenberg -- License : BSD-style (see LICENSE) -- Maintainer : Richard Eisenberg (rae@cs.brynmawr.edu) -- Stability : experimental -- Portability : non-portable -- -- This module defines SI dimensions. The names of SI dimensions conform to -- <http://www.bipm.org/utils/common/documents/jcgm/JCGM_200_2012.pdf>. ----------------------------------------------------------------------------- module Data.Dimensions.SI where import Data.Metrology.Poly import Data.Metrology.TH declareDimension "Length" declareDimension "Mass" declareDimension "Time" declareDimension "Current" declareDimension "Temperature" declareDimension "AmountOfSubstance" declareDimension "LuminousIntensity" -- | A plane angle is dimensionless; alternatively, it has dimension -- length/length. It would be wrong to divide 2 meters by 1 -- meter and conclude that the quantity is 2 radians or degrees. To make -- plane angle safe to use, we define it as a fundamental dimension. declareDimension "PlaneAngle" -- | As we did for plane angle, we must make solid angle a fundamental -- dimension to avoid programming mistakes. -- -- A solid angle is a measure of the amount of the field of view from some -- particular point that a given object covers. declareDimension "SolidAngle" type Area = Length :^ Two type Volume = Length :^ Three type Velocity = Length :/ Time type Acceleration = Velocity :/ Time type Wavenumber = Length :^ MOne type Density = Mass :/ Volume type SurfaceDensity = Mass :/ Area type SpecificVolume = Volume :/ Mass type CurrentDensity = Current :/ Area type MagneticStrength = Current :/ Length type Concentration = AmountOfSubstance :/ Volume type Luminance = LuminousIntensity :/ Area type Frequency = Time :^ MOne type Force = Mass :* Acceleration type Pressure = Force :/ Area type Energy = Force :* Length type Power = Energy :/ Time type Charge = Current :* Time type ElectricPotential = Power :/ Current type Capacitance = Charge :/ ElectricPotential type Resistance = ElectricPotential :/ Current type Conductance = Current :/ ElectricPotential type MagneticFlux = ElectricPotential :* Time type MagneticFluxDensity = MagneticFlux :/ Area type Inductance = MagneticFlux :/ Current type LuminousFlux = LuminousIntensity type Illuminance = LuminousIntensity :/ Area type Kerma = Area :/ (Time :^ Two) type CatalyticActivity = AmountOfSubstance :/ Time type Momentum = Mass :* Velocity type AngularVelocity = PlaneAngle :/ Time
goldfirere/units
units-defs/Data/Dimensions/SI.hs
bsd-3-clause
3,189
0
7
930
408
241
167
44
0
{- (c) The University of Glasgow 2006 (c) The GRASP/AQUA Project, Glasgow University, 1992-1998 \section[TcBinds]{TcBinds} -} {-# LANGUAGE CPP, RankNTypes, ScopedTypeVariables #-} {-# LANGUAGE FlexibleContexts #-} module TcBinds ( tcLocalBinds, tcTopBinds, tcRecSelBinds, tcValBinds, tcHsBootSigs, tcPolyCheck, tcVectDecls, addTypecheckedBinds, chooseInferredQuantifiers, badBootDeclErr ) where import {-# SOURCE #-} TcMatches ( tcGRHSsPat, tcMatchesFun ) import {-# SOURCE #-} TcExpr ( tcMonoExpr ) import {-# SOURCE #-} TcPatSyn ( tcInferPatSynDecl, tcCheckPatSynDecl , tcPatSynBuilderBind ) import DynFlags import HsSyn import HscTypes( isHsBootOrSig ) import TcSigs import TcRnMonad import TcEnv import TcUnify import TcSimplify import TcEvidence import TcHsType import TcPat import TcMType import Inst( deeplyInstantiate ) import FamInstEnv( normaliseType ) import FamInst( tcGetFamInstEnvs ) import TyCon import TcType import Type( mkStrLitTy, tidyOpenType, mkTyVarBinder ) import TysPrim import TysWiredIn( cTupleTyConName ) import Id import Var import VarSet import VarEnv( TidyEnv ) import Module import Name import NameSet import NameEnv import SrcLoc import Bag import ListSetOps import ErrUtils import Digraph import Maybes import Util import BasicTypes import Outputable import PrelNames( gHC_PRIM, ipClassName ) import TcValidity (checkValidType) import UniqFM import qualified GHC.LanguageExtensions as LangExt import Control.Monad #include "HsVersions.h" {- ********************************************************************* * * A useful helper function * * ********************************************************************* -} addTypecheckedBinds :: TcGblEnv -> [LHsBinds Id] -> TcGblEnv addTypecheckedBinds tcg_env binds | isHsBootOrSig (tcg_src tcg_env) = tcg_env -- Do not add the code for record-selector bindings -- when compiling hs-boot files | otherwise = tcg_env { tcg_binds = foldr unionBags (tcg_binds tcg_env) binds } {- ************************************************************************ * * \subsection{Type-checking bindings} * * ************************************************************************ @tcBindsAndThen@ typechecks a @HsBinds@. The "and then" part is because it needs to know something about the {\em usage} of the things bound, so that it can create specialisations of them. So @tcBindsAndThen@ takes a function which, given an extended environment, E, typechecks the scope of the bindings returning a typechecked thing and (most important) an LIE. It is this LIE which is then used as the basis for specialising the things bound. @tcBindsAndThen@ also takes a "combiner" which glues together the bindings and the "thing" to make a new "thing". The real work is done by @tcBindWithSigsAndThen@. Recursive and non-recursive binds are handled in essentially the same way: because of uniques there are no scoping issues left. The only difference is that non-recursive bindings can bind primitive values. Even for non-recursive binding groups we add typings for each binder to the LVE for the following reason. When each individual binding is checked the type of its LHS is unified with that of its RHS; and type-checking the LHS of course requires that the binder is in scope. At the top-level the LIE is sure to contain nothing but constant dictionaries, which we resolve at the module level. Note [Polymorphic recursion] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~ The game plan for polymorphic recursion in the code above is * Bind any variable for which we have a type signature to an Id with a polymorphic type. Then when type-checking the RHSs we'll make a full polymorphic call. This fine, but if you aren't a bit careful you end up with a horrendous amount of partial application and (worse) a huge space leak. For example: f :: Eq a => [a] -> [a] f xs = ...f... If we don't take care, after typechecking we get f = /\a -> \d::Eq a -> let f' = f a d in \ys:[a] -> ...f'... Notice the the stupid construction of (f a d), which is of course identical to the function we're executing. In this case, the polymorphic recursion isn't being used (but that's a very common case). This can lead to a massive space leak, from the following top-level defn (post-typechecking) ff :: [Int] -> [Int] ff = f Int dEqInt Now (f dEqInt) evaluates to a lambda that has f' as a free variable; but f' is another thunk which evaluates to the same thing... and you end up with a chain of identical values all hung onto by the CAF ff. ff = f Int dEqInt = let f' = f Int dEqInt in \ys. ...f'... = let f' = let f' = f Int dEqInt in \ys. ...f'... in \ys. ...f'... Etc. NOTE: a bit of arity anaysis would push the (f a d) inside the (\ys...), which would make the space leak go away in this case Solution: when typechecking the RHSs we always have in hand the *monomorphic* Ids for each binding. So we just need to make sure that if (Method f a d) shows up in the constraints emerging from (...f...) we just use the monomorphic Id. We achieve this by adding monomorphic Ids to the "givens" when simplifying constraints. That's what the "lies_avail" is doing. Then we get f = /\a -> \d::Eq a -> letrec fm = \ys:[a] -> ...fm... in fm -} tcTopBinds :: [(RecFlag, LHsBinds Name)] -> [LSig Name] -> TcM (TcGblEnv, TcLclEnv) -- The TcGblEnv contains the new tcg_binds and tcg_spects -- The TcLclEnv has an extended type envt for the new bindings tcTopBinds binds sigs = do { -- Pattern synonym bindings populate the global environment (binds', (tcg_env, tcl_env)) <- tcValBinds TopLevel binds sigs $ do { gbl <- getGblEnv ; lcl <- getLclEnv ; return (gbl, lcl) } ; specs <- tcImpPrags sigs -- SPECIALISE prags for imported Ids ; let { tcg_env' = tcg_env { tcg_imp_specs = specs ++ tcg_imp_specs tcg_env } `addTypecheckedBinds` map snd binds' } ; return (tcg_env', tcl_env) } -- The top level bindings are flattened into a giant -- implicitly-mutually-recursive LHsBinds tcRecSelBinds :: HsValBinds Name -> TcM TcGblEnv tcRecSelBinds (ValBindsOut binds sigs) = tcExtendGlobalValEnv [sel_id | L _ (IdSig sel_id) <- sigs] $ do { (rec_sel_binds, tcg_env) <- discardWarnings $ tcValBinds TopLevel binds sigs getGblEnv ; let tcg_env' = tcg_env `addTypecheckedBinds` map snd rec_sel_binds ; return tcg_env' } tcRecSelBinds (ValBindsIn {}) = panic "tcRecSelBinds" tcHsBootSigs :: [(RecFlag, LHsBinds Name)] -> [LSig Name] -> TcM [Id] -- A hs-boot file has only one BindGroup, and it only has type -- signatures in it. The renamer checked all this tcHsBootSigs binds sigs = do { checkTc (null binds) badBootDeclErr ; concat <$> mapM (addLocM tc_boot_sig) (filter isTypeLSig sigs) } where tc_boot_sig (TypeSig lnames hs_ty) = mapM f lnames where f (L _ name) = do { sigma_ty <- solveEqualities $ tcHsSigWcType (FunSigCtxt name False) hs_ty ; return (mkVanillaGlobal name sigma_ty) } -- Notice that we make GlobalIds, not LocalIds tc_boot_sig s = pprPanic "tcHsBootSigs/tc_boot_sig" (ppr s) badBootDeclErr :: MsgDoc badBootDeclErr = text "Illegal declarations in an hs-boot file" ------------------------ tcLocalBinds :: HsLocalBinds Name -> TcM thing -> TcM (HsLocalBinds TcId, thing) tcLocalBinds EmptyLocalBinds thing_inside = do { thing <- thing_inside ; return (EmptyLocalBinds, thing) } tcLocalBinds (HsValBinds (ValBindsOut binds sigs)) thing_inside = do { (binds', thing) <- tcValBinds NotTopLevel binds sigs thing_inside ; return (HsValBinds (ValBindsOut binds' sigs), thing) } tcLocalBinds (HsValBinds (ValBindsIn {})) _ = panic "tcLocalBinds" tcLocalBinds (HsIPBinds (IPBinds ip_binds _)) thing_inside = do { ipClass <- tcLookupClass ipClassName ; (given_ips, ip_binds') <- mapAndUnzipM (wrapLocSndM (tc_ip_bind ipClass)) ip_binds -- If the binding binds ?x = E, we must now -- discharge any ?x constraints in expr_lie -- See Note [Implicit parameter untouchables] ; (ev_binds, result) <- checkConstraints (IPSkol ips) [] given_ips thing_inside ; return (HsIPBinds (IPBinds ip_binds' ev_binds), result) } where ips = [ip | L _ (IPBind (Left (L _ ip)) _) <- ip_binds] -- I wonder if we should do these one at at time -- Consider ?x = 4 -- ?y = ?x + 1 tc_ip_bind ipClass (IPBind (Left (L _ ip)) expr) = do { ty <- newOpenFlexiTyVarTy ; let p = mkStrLitTy $ hsIPNameFS ip ; ip_id <- newDict ipClass [ p, ty ] ; expr' <- tcMonoExpr expr (mkCheckExpType ty) ; let d = toDict ipClass p ty `fmap` expr' ; return (ip_id, (IPBind (Right ip_id) d)) } tc_ip_bind _ (IPBind (Right {}) _) = panic "tc_ip_bind" -- Coerces a `t` into a dictionry for `IP "x" t`. -- co : t -> IP "x" t toDict ipClass x ty = HsWrap $ mkWpCastR $ wrapIP $ mkClassPred ipClass [x,ty] {- Note [Implicit parameter untouchables] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ We add the type variables in the types of the implicit parameters as untouchables, not so much because we really must not unify them, but rather because we otherwise end up with constraints like this Num alpha, Implic { wanted = alpha ~ Int } The constraint solver solves alpha~Int by unification, but then doesn't float that solved constraint out (it's not an unsolved wanted). Result disaster: the (Num alpha) is again solved, this time by defaulting. No no no. However [Oct 10] this is all handled automatically by the untouchable-range idea. Note [Inlining and hs-boot files] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Consider this example (Trac #10083): ---------- RSR.hs-boot ------------ module RSR where data RSR eqRSR :: RSR -> RSR -> Bool ---------- SR.hs ------------ module SR where import {-# SOURCE #-} RSR data SR = MkSR RSR eqSR (MkSR r1) (MkSR r2) = eqRSR r1 r2 ---------- RSR.hs ------------ module RSR where import SR data RSR = MkRSR SR -- deriving( Eq ) eqRSR (MkRSR s1) (MkRSR s2) = (eqSR s1 s2) foo x y = not (eqRSR x y) When compiling RSR we get this code RSR.eqRSR :: RSR -> RSR -> Bool RSR.eqRSR = \ (ds1 :: RSR.RSR) (ds2 :: RSR.RSR) -> case ds1 of _ { RSR.MkRSR s1 -> case ds2 of _ { RSR.MkRSR s2 -> SR.eqSR s1 s2 }} RSR.foo :: RSR -> RSR -> Bool RSR.foo = \ (x :: RSR) (y :: RSR) -> not (RSR.eqRSR x y) Now, when optimising foo: Inline eqRSR (small, non-rec) Inline eqSR (small, non-rec) but the result of inlining eqSR from SR is another call to eqRSR, so everything repeats. Neither eqSR nor eqRSR are (apparently) loop breakers. Solution: when compiling RSR, add a NOINLINE pragma to every function exported by the boot-file for RSR (if it exists). ALAS: doing so makes the boostrappted GHC itself slower by 8% overall (on Trac #9872a-d, and T1969. So I un-did this change, and parked it for now. Sigh. -} tcValBinds :: TopLevelFlag -> [(RecFlag, LHsBinds Name)] -> [LSig Name] -> TcM thing -> TcM ([(RecFlag, LHsBinds TcId)], thing) tcValBinds top_lvl binds sigs thing_inside = do { let patsyns = getPatSynBinds binds -- Typecheck the signature ; (poly_ids, sig_fn) <- tcAddPatSynPlaceholders patsyns $ tcTySigs sigs ; _self_boot <- tcSelfBootInfo ; let prag_fn = mkPragEnv sigs (foldr (unionBags . snd) emptyBag binds) -- ------- See Note [Inlining and hs-boot files] (change parked) -------- -- prag_fn | isTopLevel top_lvl -- See Note [Inlining and hs-boot files] -- , SelfBoot { sb_ids = boot_id_names } <- self_boot -- = foldNameSet add_no_inl prag_fn1 boot_id_names -- | otherwise -- = prag_fn1 -- add_no_inl boot_id_name prag_fn -- = extendPragEnv prag_fn (boot_id_name, no_inl_sig boot_id_name) -- no_inl_sig name = L boot_loc (InlineSig (L boot_loc name) neverInlinePragma) -- boot_loc = mkGeneralSrcSpan (fsLit "The hs-boot file for this module") -- Extend the envt right away with all the Ids -- declared with complete type signatures -- Do not extend the TcIdBinderStack; instead -- we extend it on a per-rhs basis in tcExtendForRhs ; tcExtendLetEnvIds top_lvl [(idName id, id) | id <- poly_ids] $ do { (binds', (extra_binds', thing)) <- tcBindGroups top_lvl sig_fn prag_fn binds $ do { thing <- thing_inside -- See Note [Pattern synonym builders don't yield dependencies] ; patsyn_builders <- mapM tcPatSynBuilderBind patsyns ; let extra_binds = [ (NonRecursive, builder) | builder <- patsyn_builders ] ; return (extra_binds, thing) } ; return (binds' ++ extra_binds', thing) }} ------------------------ tcBindGroups :: TopLevelFlag -> TcSigFun -> TcPragEnv -> [(RecFlag, LHsBinds Name)] -> TcM thing -> TcM ([(RecFlag, LHsBinds TcId)], thing) -- Typecheck a whole lot of value bindings, -- one strongly-connected component at a time -- Here a "strongly connected component" has the strightforward -- meaning of a group of bindings that mention each other, -- ignoring type signatures (that part comes later) tcBindGroups _ _ _ [] thing_inside = do { thing <- thing_inside ; return ([], thing) } tcBindGroups top_lvl sig_fn prag_fn (group : groups) thing_inside = do { -- See Note [Closed binder groups] closed <- isClosedBndrGroup $ snd group ; (group', (groups', thing)) <- tc_group top_lvl sig_fn prag_fn group closed $ tcBindGroups top_lvl sig_fn prag_fn groups thing_inside ; return (group' ++ groups', thing) } -- Note [Closed binder groups] -- ~~~~~~~~~~~~~~~~~~~~~~~~~~~ -- -- A mutually recursive group is "closed" if all of the free variables of -- the bindings are closed. For example -- -- > h = \x -> let f = ...g... -- > g = ....f...x... -- > in ... -- -- Here @g@ is not closed because it mentions @x@; and hence neither is @f@ -- closed. -- -- So we need to compute closed-ness on each strongly connected components, -- before we sub-divide it based on what type signatures it has. -- ------------------------ tc_group :: forall thing. TopLevelFlag -> TcSigFun -> TcPragEnv -> (RecFlag, LHsBinds Name) -> IsGroupClosed -> TcM thing -> TcM ([(RecFlag, LHsBinds TcId)], thing) -- Typecheck one strongly-connected component of the original program. -- We get a list of groups back, because there may -- be specialisations etc as well tc_group top_lvl sig_fn prag_fn (NonRecursive, binds) closed thing_inside -- A single non-recursive binding -- We want to keep non-recursive things non-recursive -- so that we desugar unlifted bindings correctly = do { let bind = case bagToList binds of [bind] -> bind [] -> panic "tc_group: empty list of binds" _ -> panic "tc_group: NonRecursive binds is not a singleton bag" ; (bind', thing) <- tc_single top_lvl sig_fn prag_fn bind closed thing_inside ; return ( [(NonRecursive, bind')], thing) } tc_group top_lvl sig_fn prag_fn (Recursive, binds) closed thing_inside = -- To maximise polymorphism, we do a new -- strongly-connected-component analysis, this time omitting -- any references to variables with type signatures. -- (This used to be optional, but isn't now.) -- See Note [Polymorphic recursion] in HsBinds. do { traceTc "tc_group rec" (pprLHsBinds binds) ; when hasPatSyn $ recursivePatSynErr binds ; (binds1, thing) <- go sccs ; return ([(Recursive, binds1)], thing) } -- Rec them all together where hasPatSyn = anyBag (isPatSyn . unLoc) binds isPatSyn PatSynBind{} = True isPatSyn _ = False sccs :: [SCC (LHsBind Name)] sccs = stronglyConnCompFromEdgedVerticesUniq (mkEdges sig_fn binds) go :: [SCC (LHsBind Name)] -> TcM (LHsBinds TcId, thing) go (scc:sccs) = do { (binds1, ids1) <- tc_scc scc ; (binds2, thing) <- tcExtendLetEnv top_lvl closed ids1 (go sccs) ; return (binds1 `unionBags` binds2, thing) } go [] = do { thing <- thing_inside; return (emptyBag, thing) } tc_scc (AcyclicSCC bind) = tc_sub_group NonRecursive [bind] tc_scc (CyclicSCC binds) = tc_sub_group Recursive binds tc_sub_group rec_tc binds = tcPolyBinds top_lvl sig_fn prag_fn Recursive rec_tc closed binds recursivePatSynErr :: OutputableBndr name => LHsBinds name -> TcM a recursivePatSynErr binds = failWithTc $ hang (text "Recursive pattern synonym definition with following bindings:") 2 (vcat $ map pprLBind . bagToList $ binds) where pprLoc loc = parens (text "defined at" <+> ppr loc) pprLBind (L loc bind) = pprWithCommas ppr (collectHsBindBinders bind) <+> pprLoc loc tc_single :: forall thing. TopLevelFlag -> TcSigFun -> TcPragEnv -> LHsBind Name -> IsGroupClosed -> TcM thing -> TcM (LHsBinds TcId, thing) tc_single _top_lvl sig_fn _prag_fn (L _ (PatSynBind psb@PSB{ psb_id = L _ name })) _ thing_inside = do { (aux_binds, tcg_env) <- tc_pat_syn_decl ; thing <- setGblEnv tcg_env thing_inside ; return (aux_binds, thing) } where tc_pat_syn_decl :: TcM (LHsBinds TcId, TcGblEnv) tc_pat_syn_decl = case sig_fn name of Nothing -> tcInferPatSynDecl psb Just (TcPatSynSig tpsi) -> tcCheckPatSynDecl psb tpsi Just _ -> panic "tc_single" tc_single top_lvl sig_fn prag_fn lbind closed thing_inside = do { (binds1, ids) <- tcPolyBinds top_lvl sig_fn prag_fn NonRecursive NonRecursive closed [lbind] ; thing <- tcExtendLetEnv top_lvl closed ids thing_inside ; return (binds1, thing) } ------------------------ type BKey = Int -- Just number off the bindings mkEdges :: TcSigFun -> LHsBinds Name -> [Node BKey (LHsBind Name)] -- See Note [Polymorphic recursion] in HsBinds. mkEdges sig_fn binds = [ (bind, key, [key | n <- nonDetEltsUFM (bind_fvs (unLoc bind)), Just key <- [lookupNameEnv key_map n], no_sig n ]) | (bind, key) <- keyd_binds ] -- It's OK to use nonDetEltsUFM here as stronglyConnCompFromEdgedVertices -- is still deterministic even if the edges are in nondeterministic order -- as explained in Note [Deterministic SCC] in Digraph. where no_sig :: Name -> Bool no_sig n = noCompleteSig (sig_fn n) keyd_binds = bagToList binds `zip` [0::BKey ..] key_map :: NameEnv BKey -- Which binding it comes from key_map = mkNameEnv [(bndr, key) | (L _ bind, key) <- keyd_binds , bndr <- collectHsBindBinders bind ] ------------------------ tcPolyBinds :: TopLevelFlag -> TcSigFun -> TcPragEnv -> RecFlag -- Whether the group is really recursive -> RecFlag -- Whether it's recursive after breaking -- dependencies based on type signatures -> IsGroupClosed -- Whether the group is closed -> [LHsBind Name] -- None are PatSynBind -> TcM (LHsBinds TcId, [TcId]) -- Typechecks a single bunch of values bindings all together, -- and generalises them. The bunch may be only part of a recursive -- group, because we use type signatures to maximise polymorphism -- -- Returns a list because the input may be a single non-recursive binding, -- in which case the dependency order of the resulting bindings is -- important. -- -- Knows nothing about the scope of the bindings -- None of the bindings are pattern synonyms tcPolyBinds top_lvl sig_fn prag_fn rec_group rec_tc closed bind_list = setSrcSpan loc $ recoverM (recoveryCode binder_names sig_fn) $ do -- Set up main recover; take advantage of any type sigs { traceTc "------------------------------------------------" Outputable.empty ; traceTc "Bindings for {" (ppr binder_names) ; dflags <- getDynFlags ; let plan = decideGeneralisationPlan dflags bind_list closed sig_fn ; traceTc "Generalisation plan" (ppr plan) ; result@(tc_binds, poly_ids) <- case plan of NoGen -> tcPolyNoGen rec_tc prag_fn sig_fn bind_list InferGen mn -> tcPolyInfer rec_tc prag_fn sig_fn mn bind_list CheckGen lbind sig -> tcPolyCheck prag_fn sig lbind -- Check whether strict bindings are ok -- These must be non-recursive etc, and are not generalised -- They desugar to a case expression in the end ; checkStrictBinds top_lvl rec_group bind_list tc_binds poly_ids ; traceTc "} End of bindings for" (vcat [ ppr binder_names, ppr rec_group , vcat [ppr id <+> ppr (idType id) | id <- poly_ids] ]) ; return result } where binder_names = collectHsBindListBinders bind_list loc = foldr1 combineSrcSpans (map getLoc bind_list) -- The mbinds have been dependency analysed and -- may no longer be adjacent; so find the narrowest -- span that includes them all -------------- -- If typechecking the binds fails, then return with each -- signature-less binder given type (forall a.a), to minimise -- subsequent error messages recoveryCode :: [Name] -> TcSigFun -> TcM (LHsBinds TcId, [Id]) recoveryCode binder_names sig_fn = do { traceTc "tcBindsWithSigs: error recovery" (ppr binder_names) ; let poly_ids = map mk_dummy binder_names ; return (emptyBag, poly_ids) } where mk_dummy name | Just sig <- sig_fn name , Just poly_id <- completeSigPolyId_maybe sig = poly_id | otherwise = mkLocalId name forall_a_a forall_a_a :: TcType forall_a_a = mkSpecForAllTys [runtimeRep1TyVar, openAlphaTyVar] openAlphaTy {- ********************************************************************* * * tcPolyNoGen * * ********************************************************************* -} tcPolyNoGen -- No generalisation whatsoever :: RecFlag -- Whether it's recursive after breaking -- dependencies based on type signatures -> TcPragEnv -> TcSigFun -> [LHsBind Name] -> TcM (LHsBinds TcId, [TcId]) tcPolyNoGen rec_tc prag_fn tc_sig_fn bind_list = do { (binds', mono_infos) <- tcMonoBinds rec_tc tc_sig_fn (LetGblBndr prag_fn) bind_list ; mono_ids' <- mapM tc_mono_info mono_infos ; return (binds', mono_ids') } where tc_mono_info (MBI { mbi_poly_name = name, mbi_mono_id = mono_id }) = do { mono_ty' <- zonkTcType (idType mono_id) -- Zonk, mainly to expose unboxed types to checkStrictBinds ; let mono_id' = setIdType mono_id mono_ty' ; _specs <- tcSpecPrags mono_id' (lookupPragEnv prag_fn name) ; return mono_id' } -- NB: tcPrags generates error messages for -- specialisation pragmas for non-overloaded sigs -- Indeed that is why we call it here! -- So we can safely ignore _specs {- ********************************************************************* * * tcPolyCheck * * ********************************************************************* -} tcPolyCheck :: TcPragEnv -> TcIdSigInfo -- Must be a complete signature -> LHsBind Name -- Must be a FunBind -> TcM (LHsBinds TcId, [TcId]) -- There is just one binding, -- it is a Funbind -- it has a complete type signature, tcPolyCheck prag_fn (CompleteSig { sig_bndr = poly_id , sig_ctxt = ctxt , sig_loc = sig_loc }) (L loc (FunBind { fun_id = L nm_loc name , fun_matches = matches })) = setSrcSpan sig_loc $ do { traceTc "tcPolyCheck" (ppr poly_id $$ ppr sig_loc) ; (tv_prs, theta, tau) <- tcInstType (tcInstSigTyVars sig_loc) poly_id -- See Note [Instantiate sig with fresh variables] ; mono_name <- newNameAt (nameOccName name) nm_loc ; ev_vars <- newEvVars theta ; let mono_id = mkLocalId mono_name tau skol_info = SigSkol ctxt (mkPhiTy theta tau) skol_tvs = map snd tv_prs ; (ev_binds, (co_fn, matches')) <- checkConstraints skol_info skol_tvs ev_vars $ tcExtendIdBndrs [TcIdBndr mono_id NotTopLevel] $ tcExtendTyVarEnv2 tv_prs $ setSrcSpan loc $ tcMatchesFun (L nm_loc mono_name) matches (mkCheckExpType tau) ; let prag_sigs = lookupPragEnv prag_fn name ; spec_prags <- tcSpecPrags poly_id prag_sigs ; poly_id <- addInlinePrags poly_id prag_sigs ; let bind' = FunBind { fun_id = L nm_loc mono_id , fun_matches = matches' , fun_co_fn = co_fn , bind_fvs = placeHolderNamesTc , fun_tick = [] } abs_bind = L loc $ AbsBindsSig { abs_sig_export = poly_id , abs_tvs = skol_tvs , abs_ev_vars = ev_vars , abs_sig_prags = SpecPrags spec_prags , abs_sig_ev_bind = ev_binds , abs_sig_bind = L loc bind' } ; return (unitBag abs_bind, [poly_id]) } tcPolyCheck _prag_fn sig bind = pprPanic "tcPolyCheck" (ppr sig $$ ppr bind) {- Note [Instantiate sig with fresh variables] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ It's vital to instantiate a type signature with fresh variables. For example: type T = forall a. [a] -> [a] f :: T; f = g where { g :: T; g = <rhs> } We must not use the same 'a' from the defn of T at both places!! (Instantiation is only necessary because of type synonyms. Otherwise, it's all cool; each signature has distinct type variables from the renamer.) -} {- ********************************************************************* * * tcPolyInfer * * ********************************************************************* -} tcPolyInfer :: RecFlag -- Whether it's recursive after breaking -- dependencies based on type signatures -> TcPragEnv -> TcSigFun -> Bool -- True <=> apply the monomorphism restriction -> [LHsBind Name] -> TcM (LHsBinds TcId, [TcId]) tcPolyInfer rec_tc prag_fn tc_sig_fn mono bind_list = do { (tclvl, wanted, (binds', mono_infos)) <- pushLevelAndCaptureConstraints $ tcMonoBinds rec_tc tc_sig_fn LetLclBndr bind_list ; let name_taus = [ (mbi_poly_name info, idType (mbi_mono_id info)) | info <- mono_infos ] sigs = [ sig | MBI { mbi_sig = Just sig } <- mono_infos ] infer_mode = if mono then ApplyMR else NoRestrictions ; mapM_ (checkOverloadedSig mono) sigs ; traceTc "simplifyInfer call" (ppr tclvl $$ ppr name_taus $$ ppr wanted) ; (qtvs, givens, ev_binds) <- simplifyInfer tclvl infer_mode sigs name_taus wanted ; let inferred_theta = map evVarPred givens ; exports <- checkNoErrs $ mapM (mkExport prag_fn qtvs inferred_theta) mono_infos ; loc <- getSrcSpanM ; let poly_ids = map abe_poly exports abs_bind = L loc $ AbsBinds { abs_tvs = qtvs , abs_ev_vars = givens, abs_ev_binds = [ev_binds] , abs_exports = exports, abs_binds = binds' } ; traceTc "Binding:" (ppr (poly_ids `zip` map idType poly_ids)) ; return (unitBag abs_bind, poly_ids) } -- poly_ids are guaranteed zonked by mkExport -------------- mkExport :: TcPragEnv -> [TyVar] -> TcThetaType -- Both already zonked -> MonoBindInfo -> TcM (ABExport Id) -- Only called for generalisation plan InferGen, not by CheckGen or NoGen -- -- mkExport generates exports with -- zonked type variables, -- zonked poly_ids -- The former is just because no further unifications will change -- the quantified type variables, so we can fix their final form -- right now. -- The latter is needed because the poly_ids are used to extend the -- type environment; see the invariant on TcEnv.tcExtendIdEnv -- Pre-condition: the qtvs and theta are already zonked mkExport prag_fn qtvs theta mono_info@(MBI { mbi_poly_name = poly_name , mbi_sig = mb_sig , mbi_mono_id = mono_id }) = do { mono_ty <- zonkTcType (idType mono_id) ; poly_id <- mkInferredPolyId qtvs theta poly_name mb_sig mono_ty -- NB: poly_id has a zonked type ; poly_id <- addInlinePrags poly_id prag_sigs ; spec_prags <- tcSpecPrags poly_id prag_sigs -- tcPrags requires a zonked poly_id -- See Note [Impedence matching] -- NB: we have already done checkValidType, including an ambiguity check, -- on the type; either when we checked the sig or in mkInferredPolyId ; let poly_ty = idType poly_id sel_poly_ty = mkInfSigmaTy qtvs theta mono_ty -- This type is just going into tcSubType, -- so Inferred vs. Specified doesn't matter ; wrap <- if sel_poly_ty `eqType` poly_ty -- NB: eqType ignores visibility then return idHsWrapper -- Fast path; also avoids complaint when we infer -- an ambiguouse type and have AllowAmbiguousType -- e..g infer x :: forall a. F a -> Int else addErrCtxtM (mk_impedence_match_msg mono_info sel_poly_ty poly_ty) $ tcSubType_NC sig_ctxt sel_poly_ty (mkCheckExpType poly_ty) ; warn_missing_sigs <- woptM Opt_WarnMissingLocalSignatures ; when warn_missing_sigs $ localSigWarn Opt_WarnMissingLocalSignatures poly_id mb_sig ; return (ABE { abe_wrap = wrap -- abe_wrap :: idType poly_id ~ (forall qtvs. theta => mono_ty) , abe_poly = poly_id , abe_mono = mono_id , abe_prags = SpecPrags spec_prags}) } where prag_sigs = lookupPragEnv prag_fn poly_name sig_ctxt = InfSigCtxt poly_name mkInferredPolyId :: [TyVar] -> TcThetaType -> Name -> Maybe TcIdSigInst -> TcType -> TcM TcId mkInferredPolyId qtvs inferred_theta poly_name mb_sig_inst mono_ty | Just (TISI { sig_inst_sig = sig }) <- mb_sig_inst , CompleteSig { sig_bndr = poly_id } <- sig = return poly_id | otherwise -- Either no type sig or partial type sig = checkNoErrs $ -- The checkNoErrs ensures that if the type is ambiguous -- we don't carry on to the impedence matching, and generate -- a duplicate ambiguity error. There is a similar -- checkNoErrs for complete type signatures too. do { fam_envs <- tcGetFamInstEnvs ; let (_co, mono_ty') = normaliseType fam_envs Nominal mono_ty -- Unification may not have normalised the type, -- (see Note [Lazy flattening] in TcFlatten) so do it -- here to make it as uncomplicated as possible. -- Example: f :: [F Int] -> Bool -- should be rewritten to f :: [Char] -> Bool, if possible -- -- We can discard the coercion _co, because we'll reconstruct -- it in the call to tcSubType below ; (binders, theta') <- chooseInferredQuantifiers inferred_theta (tyCoVarsOfType mono_ty') qtvs mb_sig_inst ; let inferred_poly_ty = mkForAllTys binders (mkPhiTy theta' mono_ty') ; traceTc "mkInferredPolyId" (vcat [ppr poly_name, ppr qtvs, ppr theta' , ppr inferred_poly_ty]) ; addErrCtxtM (mk_inf_msg poly_name inferred_poly_ty) $ checkValidType (InfSigCtxt poly_name) inferred_poly_ty -- See Note [Validity of inferred types] ; return (mkLocalIdOrCoVar poly_name inferred_poly_ty) } chooseInferredQuantifiers :: TcThetaType -- inferred -> TcTyVarSet -- tvs free in tau type -> [TcTyVar] -- inferred quantified tvs -> Maybe TcIdSigInst -> TcM ([TyVarBinder], TcThetaType) chooseInferredQuantifiers inferred_theta tau_tvs qtvs Nothing = -- No type signature (partial or complete) for this binder, do { let free_tvs = closeOverKinds (growThetaTyVars inferred_theta tau_tvs) -- Include kind variables! Trac #7916 my_theta = pickCapturedPreds free_tvs inferred_theta binders = [ mkTyVarBinder Inferred tv | tv <- qtvs , tv `elemVarSet` free_tvs ] ; return (binders, my_theta) } chooseInferredQuantifiers inferred_theta tau_tvs qtvs (Just (TISI { sig_inst_sig = sig -- Always PartialSig , sig_inst_wcx = wcx , sig_inst_theta = annotated_theta , sig_inst_skols = annotated_tvs })) | Nothing <- wcx = do { annotated_theta <- zonkTcTypes annotated_theta ; let free_tvs = closeOverKinds (tyCoVarsOfTypes annotated_theta `unionVarSet` tau_tvs) ; traceTc "ciq" (vcat [ ppr sig, ppr annotated_theta, ppr free_tvs]) ; return (mk_binders free_tvs, annotated_theta) } | Just wc_var <- wcx = do { annotated_theta <- zonkTcTypes annotated_theta ; let free_tvs = closeOverKinds (tyCoVarsOfTypes annotated_theta `unionVarSet` tau_tvs) my_theta = pickCapturedPreds free_tvs inferred_theta -- Report the inferred constraints for an extra-constraints wildcard/hole as -- an error message, unless the PartialTypeSignatures flag is enabled. In this -- case, the extra inferred constraints are accepted without complaining. -- NB: inferred_theta already includes all the annotated constraints inferred_diff = [ pred | pred <- my_theta , all (not . (`eqType` pred)) annotated_theta ] ; ctuple <- mk_ctuple inferred_diff ; writeMetaTyVar wc_var ctuple ; traceTc "completeTheta" $ vcat [ ppr sig , ppr annotated_theta, ppr inferred_theta , ppr inferred_diff ] ; return (mk_binders free_tvs, my_theta) } | otherwise -- A complete type signature is dealt with in mkInferredPolyId = pprPanic "chooseInferredQuantifiers" (ppr sig) where spec_tv_set = mkVarSet $ map snd annotated_tvs mk_binders free_tvs = [ mkTyVarBinder vis tv | tv <- qtvs , tv `elemVarSet` free_tvs , let vis | tv `elemVarSet` spec_tv_set = Specified | otherwise = Inferred ] -- Pulling from qtvs maintains original order mk_ctuple [pred] = return pred mk_ctuple preds = do { tc <- tcLookupTyCon (cTupleTyConName (length preds)) ; return (mkTyConApp tc preds) } mk_impedence_match_msg :: MonoBindInfo -> TcType -> TcType -> TidyEnv -> TcM (TidyEnv, SDoc) -- This is a rare but rather awkward error messages mk_impedence_match_msg (MBI { mbi_poly_name = name, mbi_sig = mb_sig }) inf_ty sig_ty tidy_env = do { (tidy_env1, inf_ty) <- zonkTidyTcType tidy_env inf_ty ; (tidy_env2, sig_ty) <- zonkTidyTcType tidy_env1 sig_ty ; let msg = vcat [ text "When checking that the inferred type" , nest 2 $ ppr name <+> dcolon <+> ppr inf_ty , text "is as general as its" <+> what <+> text "signature" , nest 2 $ ppr name <+> dcolon <+> ppr sig_ty ] ; return (tidy_env2, msg) } where what = case mb_sig of Nothing -> text "inferred" Just sig | isPartialSig sig -> text "(partial)" | otherwise -> empty mk_inf_msg :: Name -> TcType -> TidyEnv -> TcM (TidyEnv, SDoc) mk_inf_msg poly_name poly_ty tidy_env = do { (tidy_env1, poly_ty) <- zonkTidyTcType tidy_env poly_ty ; let msg = vcat [ text "When checking the inferred type" , nest 2 $ ppr poly_name <+> dcolon <+> ppr poly_ty ] ; return (tidy_env1, msg) } -- | Warn the user about polymorphic local binders that lack type signatures. localSigWarn :: WarningFlag -> Id -> Maybe TcIdSigInst -> TcM () localSigWarn flag id mb_sig | Just _ <- mb_sig = return () | not (isSigmaTy (idType id)) = return () | otherwise = warnMissingSignatures flag msg id where msg = text "Polymorphic local binding with no type signature:" warnMissingSignatures :: WarningFlag -> SDoc -> Id -> TcM () warnMissingSignatures flag msg id = do { env0 <- tcInitTidyEnv ; let (env1, tidy_ty) = tidyOpenType env0 (idType id) ; addWarnTcM (Reason flag) (env1, mk_msg tidy_ty) } where mk_msg ty = sep [ msg, nest 2 $ pprPrefixName (idName id) <+> dcolon <+> ppr ty ] checkOverloadedSig :: Bool -> TcIdSigInst -> TcM () -- Example: -- f :: Eq a => a -> a -- K f = e -- The MR applies, but the signature is overloaded, and it's -- best to complain about this directly -- c.f Trac #11339 checkOverloadedSig monomorphism_restriction_applies sig | not (null (sig_inst_theta sig)) , monomorphism_restriction_applies , let orig_sig = sig_inst_sig sig = setSrcSpan (sig_loc orig_sig) $ failWith $ hang (text "Overloaded signature conflicts with monomorphism restriction") 2 (ppr orig_sig) | otherwise = return () {- Note [Partial type signatures and generalisation] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ If /any/ of the signatures in the gropu is a partial type signature f :: _ -> Int then we *always* use the InferGen plan, and hence tcPolyInfer. We do this even for a local binding with -XMonoLocalBinds, when we normally use NoGen. Reasons: * The TcSigInfo for 'f' has a unification variable for the '_', whose TcLevel is one level deeper than the current level. (See pushTcLevelM in tcTySig.) But NoGen doesn't increase the TcLevel like InferGen, so we lose the level invariant. * The signature might be f :: forall a. _ -> a so it really is polymorphic. It's not clear what it would mean to use NoGen on this, and indeed the ASSERT in tcLhs, in the (Just sig) case, checks that if there is a signature then we are using LetLclBndr, and hence a nested AbsBinds with increased TcLevel It might be possible to fix these difficulties somehow, but there doesn't seem much point. Indeed, adding a partial type signature is a way to get per-binding inferred generalisation. We apply the MR if /all/ of the partial signatures lack a context. In particular (Trac #11016): f2 :: (?loc :: Int) => _ f2 = ?loc It's stupid to apply the MR here. This test includes an extra-constraints wildcard; that is, we don't apply the MR if you write f3 :: _ => blah Note [Validity of inferred types] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ We need to check inferred type for validity, in case it uses language extensions that are not turned on. The principle is that if the user simply adds the inferred type to the program source, it'll compile fine. See #8883. Examples that might fail: - the type might be ambiguous - an inferred theta that requires type equalities e.g. (F a ~ G b) or multi-parameter type classes - an inferred type that includes unboxed tuples Note [Impedence matching] ~~~~~~~~~~~~~~~~~~~~~~~~~ Consider f 0 x = x f n x = g [] (not x) g [] y = f 10 y g _ y = f 9 y After typechecking we'll get f_mono_ty :: a -> Bool -> Bool g_mono_ty :: [b] -> Bool -> Bool with constraints (Eq a, Num a) Note that f is polymorphic in 'a' and g in 'b'; and these are not linked. The types we really want for f and g are f :: forall a. (Eq a, Num a) => a -> Bool -> Bool g :: forall b. [b] -> Bool -> Bool We can get these by "impedance matching": tuple :: forall a b. (Eq a, Num a) => (a -> Bool -> Bool, [b] -> Bool -> Bool) tuple a b d1 d1 = let ...bind f_mono, g_mono in (f_mono, g_mono) f a d1 d2 = case tuple a Any d1 d2 of (f, g) -> f g b = case tuple Integer b dEqInteger dNumInteger of (f,g) -> g Suppose the shared quantified tyvars are qtvs and constraints theta. Then we want to check that forall qtvs. theta => f_mono_ty is more polymorphic than f's polytype and the proof is the impedance matcher. Notice that the impedance matcher may do defaulting. See Trac #7173. It also cleverly does an ambiguity check; for example, rejecting f :: F a -> F a where F is a non-injective type function. -} {- ********************************************************************* * * Vectorisation * * ********************************************************************* -} tcVectDecls :: [LVectDecl Name] -> TcM ([LVectDecl TcId]) tcVectDecls decls = do { decls' <- mapM (wrapLocM tcVect) decls ; let ids = [lvectDeclName decl | decl <- decls', not $ lvectInstDecl decl] dups = findDupsEq (==) ids ; mapM_ reportVectDups dups ; traceTcConstraints "End of tcVectDecls" ; return decls' } where reportVectDups (first:_second:_more) = addErrAt (getSrcSpan first) $ text "Duplicate vectorisation declarations for" <+> ppr first reportVectDups _ = return () -------------- tcVect :: VectDecl Name -> TcM (VectDecl TcId) -- FIXME: We can't typecheck the expression of a vectorisation declaration against the vectorised -- type of the original definition as this requires internals of the vectoriser not available -- during type checking. Instead, constrain the rhs of a vectorisation declaration to be a single -- identifier (this is checked in 'rnHsVectDecl'). Fix this by enabling the use of 'vectType' -- from the vectoriser here. tcVect (HsVect s name rhs) = addErrCtxt (vectCtxt name) $ do { var <- wrapLocM tcLookupId name ; let L rhs_loc (HsVar (L lv rhs_var_name)) = rhs ; rhs_id <- tcLookupId rhs_var_name ; return $ HsVect s var (L rhs_loc (HsVar (L lv rhs_id))) } tcVect (HsNoVect s name) = addErrCtxt (vectCtxt name) $ do { var <- wrapLocM tcLookupId name ; return $ HsNoVect s var } tcVect (HsVectTypeIn _ isScalar lname rhs_name) = addErrCtxt (vectCtxt lname) $ do { tycon <- tcLookupLocatedTyCon lname ; checkTc ( not isScalar -- either we have a non-SCALAR declaration || isJust rhs_name -- or we explicitly provide a vectorised type || tyConArity tycon == 0 -- otherwise the type constructor must be nullary ) scalarTyConMustBeNullary ; rhs_tycon <- fmapMaybeM (tcLookupTyCon . unLoc) rhs_name ; return $ HsVectTypeOut isScalar tycon rhs_tycon } tcVect (HsVectTypeOut _ _ _) = panic "TcBinds.tcVect: Unexpected 'HsVectTypeOut'" tcVect (HsVectClassIn _ lname) = addErrCtxt (vectCtxt lname) $ do { cls <- tcLookupLocatedClass lname ; return $ HsVectClassOut cls } tcVect (HsVectClassOut _) = panic "TcBinds.tcVect: Unexpected 'HsVectClassOut'" tcVect (HsVectInstIn linstTy) = addErrCtxt (vectCtxt linstTy) $ do { (cls, tys) <- tcHsVectInst linstTy ; inst <- tcLookupInstance cls tys ; return $ HsVectInstOut inst } tcVect (HsVectInstOut _) = panic "TcBinds.tcVect: Unexpected 'HsVectInstOut'" vectCtxt :: Outputable thing => thing -> SDoc vectCtxt thing = text "When checking the vectorisation declaration for" <+> ppr thing scalarTyConMustBeNullary :: MsgDoc scalarTyConMustBeNullary = text "VECTORISE SCALAR type constructor must be nullary" {- Note [SPECIALISE pragmas] ~~~~~~~~~~~~~~~~~~~~~~~~~ There is no point in a SPECIALISE pragma for a non-overloaded function: reverse :: [a] -> [a] {-# SPECIALISE reverse :: [Int] -> [Int] #-} But SPECIALISE INLINE *can* make sense for GADTS: data Arr e where ArrInt :: !Int -> ByteArray# -> Arr Int ArrPair :: !Int -> Arr e1 -> Arr e2 -> Arr (e1, e2) (!:) :: Arr e -> Int -> e {-# SPECIALISE INLINE (!:) :: Arr Int -> Int -> Int #-} {-# SPECIALISE INLINE (!:) :: Arr (a, b) -> Int -> (a, b) #-} (ArrInt _ ba) !: (I# i) = I# (indexIntArray# ba i) (ArrPair _ a1 a2) !: i = (a1 !: i, a2 !: i) When (!:) is specialised it becomes non-recursive, and can usefully be inlined. Scary! So we only warn for SPECIALISE *without* INLINE for a non-overloaded function. ************************************************************************ * * tcMonoBinds * * ************************************************************************ @tcMonoBinds@ deals with a perhaps-recursive group of HsBinds. The signatures have been dealt with already. Note [Pattern bindings] ~~~~~~~~~~~~~~~~~~~~~~~ The rule for typing pattern bindings is this: ..sigs.. p = e where 'p' binds v1..vn, and 'e' may mention v1..vn, typechecks exactly like ..sigs.. x = e -- Inferred type v1 = case x of p -> v1 .. vn = case x of p -> vn Note that (f :: forall a. a -> a) = id should not typecheck because case id of { (f :: forall a. a->a) -> f } will not typecheck. Note [Instantiate when inferring a type] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Consider f = (*) As there is no incentive to instantiate the RHS, tcMonoBinds will produce a type of forall a. Num a => a -> a -> a for `f`. This will then go through simplifyInfer and such, remaining unchanged. There are two problems with this: 1) If the definition were `g _ = (*)`, we get a very unusual type of `forall {a}. a -> forall b. Num b => b -> b -> b` for `g`. This is surely confusing for users. 2) The monomorphism restriction can't work. The MR is dealt with in simplifyInfer, and simplifyInfer has no way of instantiating. This could perhaps be worked around, but it may be hard to know even when instantiation should happen. There is an easy solution to both problems: instantiate (deeply) when inferring a type. So that's what we do. Note that this decision is user-facing. We do this deep instantiation in tcMonoBinds, in the FunBind case only, and only when we do not have a type signature. Conveniently, the fun_co_fn field of FunBind gives a place to record the coercion. We do not need to do this * for PatBinds, because we don't have a function type * for FunBinds where we have a signature, bucause we aren't doing inference -} data MonoBindInfo = MBI { mbi_poly_name :: Name , mbi_sig :: Maybe TcIdSigInst , mbi_mono_id :: TcId } tcMonoBinds :: RecFlag -- Whether the binding is recursive for typechecking purposes -- i.e. the binders are mentioned in their RHSs, and -- we are not rescued by a type signature -> TcSigFun -> LetBndrSpec -> [LHsBind Name] -> TcM (LHsBinds TcId, [MonoBindInfo]) tcMonoBinds is_rec sig_fn no_gen [ L b_loc (FunBind { fun_id = L nm_loc name, fun_matches = matches, bind_fvs = fvs })] -- Single function binding, | NonRecursive <- is_rec -- ...binder isn't mentioned in RHS , Nothing <- sig_fn name -- ...with no type signature = -- In this very special case we infer the type of the -- right hand side first (it may have a higher-rank type) -- and *then* make the monomorphic Id for the LHS -- e.g. f = \(x::forall a. a->a) -> <body> -- We want to infer a higher-rank type for f setSrcSpan b_loc $ do { rhs_ty <- newOpenInferExpType ; (co_fn, matches') <- tcExtendIdBndrs [TcIdBndr_ExpType name rhs_ty NotTopLevel] $ -- We extend the error context even for a non-recursive -- function so that in type error messages we show the -- type of the thing whose rhs we are type checking tcMatchesFun (L nm_loc name) matches rhs_ty ; rhs_ty <- readExpType rhs_ty -- Deeply instantiate the inferred type -- See Note [Instantiate when inferring a type] ; let orig = matchesCtOrigin matches ; rhs_ty <- zonkTcType rhs_ty -- NB: zonk to uncover any foralls ; (inst_wrap, rhs_ty) <- addErrCtxtM (instErrCtxt name rhs_ty) $ deeplyInstantiate orig rhs_ty ; mono_id <- newLetBndr no_gen name rhs_ty ; return (unitBag $ L b_loc $ FunBind { fun_id = L nm_loc mono_id, fun_matches = matches', bind_fvs = fvs, fun_co_fn = inst_wrap <.> co_fn, fun_tick = [] }, [MBI { mbi_poly_name = name , mbi_sig = Nothing , mbi_mono_id = mono_id }]) } tcMonoBinds _ sig_fn no_gen binds = do { tc_binds <- mapM (wrapLocM (tcLhs sig_fn no_gen)) binds -- Bring the monomorphic Ids, into scope for the RHSs ; let mono_infos = getMonoBindInfo tc_binds rhs_id_env = [ (name, mono_id) | MBI { mbi_poly_name = name , mbi_sig = mb_sig , mbi_mono_id = mono_id } <- mono_infos , case mb_sig of Just sig -> isPartialSig sig Nothing -> True ] -- A monomorphic binding for each term variable that lacks -- a complete type sig. (Ones with a sig are already in scope.) ; traceTc "tcMonoBinds" $ vcat [ ppr n <+> ppr id <+> ppr (idType id) | (n,id) <- rhs_id_env] ; binds' <- tcExtendLetEnvIds NotTopLevel rhs_id_env $ mapM (wrapLocM tcRhs) tc_binds ; return (listToBag binds', mono_infos) } ------------------------ -- tcLhs typechecks the LHS of the bindings, to construct the environment in which -- we typecheck the RHSs. Basically what we are doing is this: for each binder: -- if there's a signature for it, use the instantiated signature type -- otherwise invent a type variable -- You see that quite directly in the FunBind case. -- -- But there's a complication for pattern bindings: -- data T = MkT (forall a. a->a) -- MkT f = e -- Here we can guess a type variable for the entire LHS (which will be refined to T) -- but we want to get (f::forall a. a->a) as the RHS environment. -- The simplest way to do this is to typecheck the pattern, and then look up the -- bound mono-ids. Then we want to retain the typechecked pattern to avoid re-doing -- it; hence the TcMonoBind data type in which the LHS is done but the RHS isn't data TcMonoBind -- Half completed; LHS done, RHS not done = TcFunBind MonoBindInfo SrcSpan (MatchGroup Name (LHsExpr Name)) | TcPatBind [MonoBindInfo] (LPat TcId) (GRHSs Name (LHsExpr Name)) TcSigmaType tcLhs :: TcSigFun -> LetBndrSpec -> HsBind Name -> TcM TcMonoBind tcLhs sig_fn no_gen (FunBind { fun_id = L nm_loc name, fun_matches = matches }) = do { mono_info <- tcLhsId sig_fn no_gen name ; return (TcFunBind mono_info nm_loc matches) } tcLhs sig_fn no_gen (PatBind { pat_lhs = pat, pat_rhs = grhss }) = do { let bndr_names = collectPatBinders pat ; mbis <- mapM (tcLhsId sig_fn no_gen) bndr_names -- See Note [Existentials in pattern bindings] ; let inst_sig_fun = lookupNameEnv $ mkNameEnv $ bndr_names `zip` map mbi_mono_id mbis ; traceTc "tcLhs" (vcat [ ppr id <+> dcolon <+> ppr (idType id) | mbi <- mbis, let id = mbi_mono_id mbi ] $$ ppr no_gen) ; ((pat', _), pat_ty) <- addErrCtxt (patMonoBindsCtxt pat grhss) $ tcInfer $ \ exp_ty -> tcLetPat inst_sig_fun pat exp_ty $ return () -- mapM (lookup_info inst_sig_fun) bndr_names ; return (TcPatBind mbis pat' grhss pat_ty) } tcLhs _ _ other_bind = pprPanic "tcLhs" (ppr other_bind) -- AbsBind, VarBind impossible ------------------- data LetBndrSpec = LetLclBndr -- We are going to generalise, and wrap in an AbsBinds -- so clone a fresh binder for the local monomorphic Id | LetGblBndr TcPragEnv -- Generalisation plan is NoGen, so there isn't going -- to be an AbsBinds; So we must bind the global version -- of the binder right away. -- And here is the inline-pragma information instance Outputable LetBndrSpec where ppr LetLclBndr = text "LetLclBndr" ppr (LetGblBndr {}) = text "LetGblBndr" tcLhsId :: TcSigFun -> LetBndrSpec -> Name -> TcM MonoBindInfo tcLhsId sig_fn no_gen name | Just (TcIdSig sig) <- sig_fn name = -- A partial type signature on a FunBind, in a mixed group -- e.g. f :: _ -> _ -- f x = ...g... -- Just g = ...f... -- Hence always typechecked with InferGen; hence LetLclBndr -- -- A compelete type sig on a FunBind is checked with CheckGen -- and does not go via tcLhsId do { inst_sig <- tcInstSig sig ; the_id <- newSigLetBndr no_gen name inst_sig ; return (MBI { mbi_poly_name = name , mbi_sig = Just inst_sig , mbi_mono_id = the_id }) } | otherwise = -- No type signature, plan InferGen (LetLclBndr) or NoGen (LetGblBndr) do { mono_ty <- newOpenFlexiTyVarTy ; mono_id <- newLetBndr no_gen name mono_ty ; return (MBI { mbi_poly_name = name , mbi_sig = Nothing , mbi_mono_id = mono_id }) } ------------ newSigLetBndr :: LetBndrSpec -> Name -> TcIdSigInst -> TcM TcId newSigLetBndr (LetGblBndr prags) name (TISI { sig_inst_sig = id_sig }) | CompleteSig { sig_bndr = poly_id } <- id_sig = addInlinePrags poly_id (lookupPragEnv prags name) newSigLetBndr no_gen name (TISI { sig_inst_tau = tau }) = newLetBndr no_gen name tau newLetBndr :: LetBndrSpec -> Name -> TcType -> TcM TcId -- In the polymorphic case when we are going to generalise -- (plan InferGen, no_gen = LetLclBndr), generate a "monomorphic version" -- of the Id; the original name will be bound to the polymorphic version -- by the AbsBinds -- In the monomorphic case when we are not going to generalise -- (plan NoGen, no_gen = LetGblBndr) there is no AbsBinds, -- and we use the original name directly newLetBndr LetLclBndr name ty = do { mono_name <- cloneLocalName name ; return (mkLocalId mono_name ty) } newLetBndr (LetGblBndr prags) name ty = addInlinePrags (mkLocalId name ty) (lookupPragEnv prags name) ------------------- tcRhs :: TcMonoBind -> TcM (HsBind TcId) tcRhs (TcFunBind info@(MBI { mbi_sig = mb_sig, mbi_mono_id = mono_id }) loc matches) = tcExtendIdBinderStackForRhs [info] $ tcExtendTyVarEnvForRhs mb_sig $ do { traceTc "tcRhs: fun bind" (ppr mono_id $$ ppr (idType mono_id)) ; (co_fn, matches') <- tcMatchesFun (L loc (idName mono_id)) matches (mkCheckExpType $ idType mono_id) ; return ( FunBind { fun_id = L loc mono_id , fun_matches = matches' , fun_co_fn = co_fn , bind_fvs = placeHolderNamesTc , fun_tick = [] } ) } tcRhs (TcPatBind infos pat' grhss pat_ty) = -- When we are doing pattern bindings we *don't* bring any scoped -- type variables into scope unlike function bindings -- Wny not? They are not completely rigid. -- That's why we have the special case for a single FunBind in tcMonoBinds tcExtendIdBinderStackForRhs infos $ do { traceTc "tcRhs: pat bind" (ppr pat' $$ ppr pat_ty) ; grhss' <- addErrCtxt (patMonoBindsCtxt pat' grhss) $ tcGRHSsPat grhss pat_ty ; return ( PatBind { pat_lhs = pat', pat_rhs = grhss' , pat_rhs_ty = pat_ty , bind_fvs = placeHolderNamesTc , pat_ticks = ([],[]) } )} tcExtendTyVarEnvForRhs :: Maybe TcIdSigInst -> TcM a -> TcM a tcExtendTyVarEnvForRhs Nothing thing_inside = thing_inside tcExtendTyVarEnvForRhs (Just sig) thing_inside = tcExtendTyVarEnvFromSig sig thing_inside tcExtendTyVarEnvFromSig :: TcIdSigInst -> TcM a -> TcM a tcExtendTyVarEnvFromSig sig_inst thing_inside | TISI { sig_inst_skols = skol_prs, sig_inst_wcs = wcs } <- sig_inst = tcExtendTyVarEnv2 wcs $ tcExtendTyVarEnv2 skol_prs $ thing_inside tcExtendIdBinderStackForRhs :: [MonoBindInfo] -> TcM a -> TcM a -- Extend the TcIdBinderStack for the RHS of the binding, with -- the monomorphic Id. That way, if we have, say -- f = \x -> blah -- and something goes wrong in 'blah', we get a "relevant binding" -- looking like f :: alpha -> beta -- This applies if 'f' has a type signature too: -- f :: forall a. [a] -> [a] -- f x = True -- We can't unify True with [a], and a relevant binding is f :: [a] -> [a] -- If we had the *polymorphic* version of f in the TcIdBinderStack, it -- would not be reported as relevant, because its type is closed tcExtendIdBinderStackForRhs infos thing_inside = tcExtendIdBndrs [ TcIdBndr mono_id NotTopLevel | MBI { mbi_mono_id = mono_id } <- infos ] thing_inside -- NotTopLevel: it's a monomorphic binding --------------------- getMonoBindInfo :: [Located TcMonoBind] -> [MonoBindInfo] getMonoBindInfo tc_binds = foldr (get_info . unLoc) [] tc_binds where get_info (TcFunBind info _ _) rest = info : rest get_info (TcPatBind infos _ _ _) rest = infos ++ rest {- Note [Existentials in pattern bindings] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Consider (typecheck/should_compile/ExPat): data T where MkT :: Integral a => a -> Int -> T and suppose t :: T. Which of these pattern bindings are ok? E1. let { MkT p _ = t } in <body> E2. let { MkT _ q = t } in <body> E3. let { MkT (toInteger -> r) _ = t } in <body> Well (E1) is clearly wrong because the existential 'a' escapes. What type could 'p' possibly have? But (E2) is fine, despite the existential pattern, because q::Int, and nothing escapes. Even (E3) is fine. The existential pattern binds a dictionary for (Integral a) which the view pattern can use to convert the a-valued field to an Integer, so r :: Integer. An easy way to see all three is to imagine the desugaring. For (2) it would look like let q = case t of MkT _ q' -> q' in <body> We typecheck pattern bindings as follows: 1. In tcLhs we bind q'::alpha, for each variable q bound by the pattern, where q' is a fresh name, and alpha is a fresh unification variable; it will be the monomorphic verion of q that we later generalise It's very important that these fresh unification variables alpha are born here, not deep under implications as would happen if we allocated them when we encountered q during tcPat. 2. Still in tcLhs, we build a little environment mappting "q" -> q':alpha, and pass that to tcLetPet. 3. Then tcLhs invokes tcLetPat to typecheck the patter as usual: - When tcLetPat finds an existential constructor, it binds fresh type variables and dictionaries as usual, and emits an implication constraint. - When tcLetPat finds a variable (TcPat.tcPatBndr) it looks it up in the little environment, which should always succeed. And uses tcSubTypeET to connect the type of that variable with the expected type of the pattern. And that's it! The implication constraints check for the skolem escape. It's quite simple and neat, and more exressive than before e.g. GHC 8.0 rejects (E2) and (E3). ************************************************************************ * * Generalisation * * ********************************************************************* -} data GeneralisationPlan = NoGen -- No generalisation, no AbsBinds | InferGen -- Implicit generalisation; there is an AbsBinds Bool -- True <=> apply the MR; generalise only unconstrained type vars | CheckGen (LHsBind Name) TcIdSigInfo -- One FunBind with a signature -- Explicit generalisation; there is an AbsBindsSig -- A consequence of the no-AbsBinds choice (NoGen) is that there is -- no "polymorphic Id" and "monmomorphic Id"; there is just the one instance Outputable GeneralisationPlan where ppr NoGen = text "NoGen" ppr (InferGen b) = text "InferGen" <+> ppr b ppr (CheckGen _ s) = text "CheckGen" <+> ppr s decideGeneralisationPlan :: DynFlags -> [LHsBind Name] -> IsGroupClosed -> TcSigFun -> GeneralisationPlan decideGeneralisationPlan dflags lbinds closed sig_fn | unlifted_pat_binds = NoGen | has_partial_sigs = InferGen (and partial_sig_mrs) | Just (bind, sig) <- one_funbind_with_sig = CheckGen bind sig | mono_local_binds closed = NoGen | otherwise = InferGen mono_restriction where binds = map unLoc lbinds partial_sig_mrs :: [Bool] -- One for each parital signature (so empty => no partial sigs) -- The Bool is True if the signature has no constraint context -- so we should apply the MR -- See Note [Partial type signatures and generalisation] partial_sig_mrs = [ null theta | TcIdSig (PartialSig { psig_hs_ty = hs_ty }) <- mapMaybe sig_fn (collectHsBindListBinders lbinds) , let (_, L _ theta, _) = splitLHsSigmaTy (hsSigWcType hs_ty) ] has_partial_sigs = not (null partial_sig_mrs) unlifted_pat_binds = any isUnliftedHsBind binds -- Unlifted patterns (unboxed tuple) must not -- be polymorphic, because we are going to force them -- See Trac #4498, #8762 mono_restriction = xopt LangExt.MonomorphismRestriction dflags && any restricted binds mono_local_binds ClosedGroup = False mono_local_binds _ = xopt LangExt.MonoLocalBinds dflags -- With OutsideIn, all nested bindings are monomorphic -- except a single function binding with a signature one_funbind_with_sig | [lbind@(L _ (FunBind { fun_id = v }))] <- lbinds , Just (TcIdSig sig) <- sig_fn (unLoc v) = Just (lbind, sig) | otherwise = Nothing -- The Haskell 98 monomorphism restriction restricted (PatBind {}) = True restricted (VarBind { var_id = v }) = no_sig v restricted (FunBind { fun_id = v, fun_matches = m }) = restricted_match m && no_sig (unLoc v) restricted (PatSynBind {}) = panic "isRestrictedGroup/unrestricted PatSynBind" restricted (AbsBinds {}) = panic "isRestrictedGroup/unrestricted AbsBinds" restricted (AbsBindsSig {}) = panic "isRestrictedGroup/unrestricted AbsBindsSig" restricted_match (MG { mg_alts = L _ (L _ (Match _ [] _ _) : _ )}) = True restricted_match _ = False -- No args => like a pattern binding -- Some args => a function binding no_sig n = noCompleteSig (sig_fn n) isClosedBndrGroup :: Bag (LHsBind Name) -> TcM IsGroupClosed isClosedBndrGroup binds = do type_env <- getLclTypeEnv if foldUFM (is_closed_ns type_env) True fv_env then return ClosedGroup else return $ NonClosedGroup fv_env where fv_env :: NameEnv NameSet fv_env = mkNameEnv $ concatMap (bindFvs . unLoc) binds bindFvs :: HsBindLR Name idR -> [(Name, NameSet)] bindFvs (FunBind { fun_id = f, bind_fvs = fvs }) = [(unLoc f, fvs)] bindFvs (PatBind { pat_lhs = pat, bind_fvs = fvs }) = [(b, fvs) | b <- collectPatBinders pat] bindFvs _ = [] is_closed_ns :: TcTypeEnv -> NameSet -> Bool -> Bool is_closed_ns type_env ns b = b && nameSetAll (is_closed_id type_env) ns -- ns are the Names referred to from the RHS of this bind is_closed_id :: TcTypeEnv -> Name -> Bool -- See Note [Bindings with closed types] in TcRnTypes is_closed_id type_env name | Just thing <- lookupNameEnv type_env name = case thing of ATcId { tct_info = ClosedLet } -> True -- This is the key line ATcId {} -> False ATyVar {} -> False -- In-scope type variables AGlobal {} -> True -- are not closed! _ -> pprPanic "is_closed_id" (ppr name) | otherwise = True -- The free-var set for a top level binding mentions -- imported things too, so that we can report unused imports -- These won't be in the local type env. -- Ditto class method etc from the current module ------------------- checkStrictBinds :: TopLevelFlag -> RecFlag -> [LHsBind Name] -> LHsBinds TcId -> [Id] -> TcM () -- Check that non-overloaded unlifted bindings are -- a) non-recursive, -- b) not top level, -- c) not a multiple-binding group (more or less implied by (a)) checkStrictBinds top_lvl rec_group orig_binds tc_binds poly_ids | any_unlifted_bndr || any_strict_pat -- This binding group must be matched strictly = do { check (isNotTopLevel top_lvl) (strictBindErr "Top-level" any_unlifted_bndr orig_binds) ; check (isNonRec rec_group) (strictBindErr "Recursive" any_unlifted_bndr orig_binds) ; check (all is_monomorphic (bagToList tc_binds)) (polyBindErr orig_binds) -- data Ptr a = Ptr Addr# -- f x = let p@(Ptr y) = ... in ... -- Here the binding for 'p' is polymorphic, but does -- not mix with an unlifted binding for 'y'. You should -- use a bang pattern. Trac #6078. ; check (isSingleton orig_binds) (strictBindErr "Multiple" any_unlifted_bndr orig_binds) -- Complain about a binding that looks lazy -- e.g. let I# y = x in ... -- Remember, in checkStrictBinds we are going to do strict -- matching, so (for software engineering reasons) we insist -- that the strictness is manifest on each binding -- However, lone (unboxed) variables are ok ; check (not any_pat_looks_lazy) (unliftedMustBeBang orig_binds) } | otherwise = traceTc "csb2" (ppr [(id, idType id) | id <- poly_ids]) >> return () where any_unlifted_bndr = any is_unlifted poly_ids any_strict_pat = any (isUnliftedHsBind . unLoc) orig_binds any_pat_looks_lazy = any (looksLazyPatBind . unLoc) orig_binds is_unlifted id = case tcSplitSigmaTy (idType id) of (_, _, rho) -> isUnliftedType rho -- For the is_unlifted check, we need to look inside polymorphism -- and overloading. E.g. x = (# 1, True #) -- would get type forall a. Num a => (# a, Bool #) -- and we want to reject that. See Trac #9140 is_monomorphic (L _ (AbsBinds { abs_tvs = tvs, abs_ev_vars = evs })) = null tvs && null evs is_monomorphic (L _ (AbsBindsSig { abs_tvs = tvs, abs_ev_vars = evs })) = null tvs && null evs is_monomorphic _ = True check :: Bool -> MsgDoc -> TcM () -- Just like checkTc, but with a special case for module GHC.Prim: -- see Note [Compiling GHC.Prim] check True _ = return () check False err = do { mod <- getModule ; checkTc (mod == gHC_PRIM) err } unliftedMustBeBang :: [LHsBind Name] -> SDoc unliftedMustBeBang binds = hang (text "Pattern bindings containing unlifted types should use an outermost bang pattern:") 2 (vcat (map ppr binds)) polyBindErr :: [LHsBind Name] -> SDoc polyBindErr binds = hang (text "You can't mix polymorphic and unlifted bindings") 2 (vcat [vcat (map ppr binds), text "Probable fix: add a type signature"]) strictBindErr :: String -> Bool -> [LHsBind Name] -> SDoc strictBindErr flavour any_unlifted_bndr binds = hang (text flavour <+> msg <+> text "aren't allowed:") 2 (vcat (map ppr binds)) where msg | any_unlifted_bndr = text "bindings for unlifted types" | otherwise = text "bang-pattern or unboxed-tuple bindings" {- Note [Compiling GHC.Prim] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Module GHC.Prim has no source code: it is the host module for primitive, built-in functions and types. However, for Haddock-ing purposes we generate (via utils/genprimopcode) a fake source file GHC/Prim.hs, and give it to Haddock, so that it can generate documentation. It contains definitions like nullAddr# :: NullAddr# which would normally be rejected as a top-level unlifted binding. But we don't want to complain, because we are only "compiling" this fake mdule for documentation purposes. Hence this hacky test for gHC_PRIM in checkStrictBinds. (We only make the test if things look wrong, so there is no cost in the common case.) -} {- ********************************************************************* * * Error contexts and messages * * ********************************************************************* -} -- This one is called on LHS, when pat and grhss are both Name -- and on RHS, when pat is TcId and grhss is still Name patMonoBindsCtxt :: (OutputableBndrId id, Outputable body) => LPat id -> GRHSs Name body -> SDoc patMonoBindsCtxt pat grhss = hang (text "In a pattern binding:") 2 (pprPatBind pat grhss) instErrCtxt :: Name -> TcType -> TidyEnv -> TcM (TidyEnv, SDoc) instErrCtxt name ty env = do { let (env', ty') = tidyOpenType env ty ; return (env', hang (text "When instantiating" <+> quotes (ppr name) <> text ", initially inferred to have" $$ text "this overly-general type:") 2 (ppr ty') $$ extra) } where extra = sdocWithDynFlags $ \dflags -> ppWhen (xopt LangExt.MonomorphismRestriction dflags) $ text "NB: This instantiation can be caused by the" <+> text "monomorphism restriction."
vTurbine/ghc
compiler/typecheck/TcBinds.hs
bsd-3-clause
74,628
0
19
22,559
11,759
6,161
5,598
820
8
module Main where import Control.Monad.Reader (runReaderT) import Lib import qualified Options.Applicative as OA main :: IO () main = do cmd <- OA.execParser (OA.info (OA.helper <*> programOpts) programInfo) runReaderT (interpret cmd) defaultGlobalOptions
muhbaasu/pfennig-cli
app/Main.hs
bsd-3-clause
283
0
13
59
86
47
39
8
1
{-# LANGUAGE TypeFamilies #-} import Bitmap import Control.Applicative import Control.Arrow data RGB8 = RGB8 Int Int Int deriving (Show, Eq, Ord) data Image = Image { imageX :: Int, imageY :: Int, getImg :: [[RGB8]] } deriving Show instance TwoDImage Image where type TwoDImageColor Image = RGB8 new c w h = return $ Image 0 0 $ replicate h $ replicate w c fromColorList = return . Image 0 0 toColorList = return . getImg getSize = return . (length . head &&& length) . getImg getXY = return . (imageX &&& imageY) setXY img (x, y) = return img { imageX = x, imageY = y } getPixel = return . ((!!) <$> ((!!) <$> getImg <*> imageY) <*> imageX) setPixel img c = return $ img { getImg = getImg img `set` imageY img $ (getImg img !! imageY img) `set` imageX img $ c } instance Color RGB8 where fromRGB8 r g b = RGB8 (fromIntegral r) (fromIntegral g) (fromIntegral b) toRGB8 (RGB8 r g b) = (fromIntegral r, fromIntegral g, fromIntegral b) set :: [a] -> Int -> a -> [a] set xs i x = take i xs ++ [x] ++ drop (i + 1) xs getSample, getGradation :: IO Image getSample = readBMPFile "tmp/out/sample.bmp" getGradation = readBMPFile "tmp/out/grad.bmp"
YoshikuniJujo/binary-file
examples/testBitmap.hs
bsd-3-clause
1,158
2
14
234
500
268
232
-1
-1
-- | Defines a monad for transfer functions. module Language.Python.TypeInference.Analysis.TFMonad ( goFlowInsensitive, TFState, TF, simpleTransferFunction, callTransferFunction, getType, getTypeWithDefault, setType, removeType, getAllFromL, removeFromL, extractFromL, getGlobalTypes, modifyType, modifyAttribute, cpType, mvType, clsAttr, instAttr, classOfInstance ) where import Control.Monad.State hiding (join) import Data.Map (Map) import Data.Maybe (catMaybes, fromMaybe, listToMaybe) import Language.Analysis.DFA.Lattice import Language.Analysis.DFA.MonotoneFramework import Language.Python.TypeInference.Analysis.MapLattice import Language.Python.TypeInference.Analysis.TypeLattice import Language.Python.TypeInference.CFG.CFG import qualified Data.Map as Map import qualified Data.Set as Set -- | Use flow-insensitive analysis for the identifier? goFlowInsensitive :: Bool -> Identifier -> Bool goFlowInsensitive _ (ClassIdentifier _) = True goFlowInsensitive _ (InstanceIdentifier _) = True goFlowInsensitive _ (Name (ExternalScope _) _) = True goFlowInsensitive True (Name (ModuleScope _) _) = True goFlowInsensitive _ _ = False -- | State used and changed by transfer functions. data TFState = TFState { tfsL :: L, tfsGlobalL :: L, tfsChangedGlobalL :: Bool, tfsUsedGlobalL :: Bool, tfsFiModuleScope :: Bool } initialTFState :: Bool -> L -> L -> TFState initialTFState fiModuleScope l gl = TFState l gl False False fiModuleScope -- | Monad for transfer functions. type TF = State TFState -- | Create a 'SimpleTransferFunction' given a flag specifying if -- flow-insensitive analysis for module-scope identifiers is used, and a -- computation in the 'TF' monad. simpleTransferFunction :: Bool -> TF () -> SimpleTF L simpleTransferFunction fiModuleScope tf = f where f :: L -> L -> (L, Maybe L, Bool) f l gl = let TFState l' gl' changedGL usedGL _ = execState tf (initialTFState fiModuleScope l gl) maybeGL' = if changedGL then Just gl' else Nothing in (l', maybeGL', usedGL) -- | Create a 'CallTransferFunction' given a flag specifying if -- flow-insensitive analysis for module-scope identifiers is used, and a -- computation in the 'TF' monad. callTransferFunction :: Bool -> TF ([Label], Bool) -> CallTF L callTransferFunction fiModuleScope tf = f where f :: L -> L -> ([Label], Bool, L, Maybe L, Bool) f l gl = let ((fs, d), TFState l' gl' changedGL usedGL _) = runState tf (initialTFState fiModuleScope l gl) maybeGL' = if changedGL then Just gl' else Nothing in (fs, d, l', maybeGL', usedGL) setChangedGlobalL, setUsedGlobalL :: TF () setChangedGlobalL = modify $ \s -> s { tfsChangedGlobalL = True } setUsedGlobalL = modify $ \s -> s { tfsUsedGlobalL = True } -- | Retrieve the type for an identifier. getType :: Identifier -> TF (Maybe UnionType) getType i = do fiModuleScope <- gets tfsFiModuleScope let useGlobal = goFlowInsensitive fiModuleScope i lookHere = if useGlobal then tfsGlobalL else tfsL when useGlobal setUsedGlobalL l <- gets lookHere return $ Map.lookup i l -- | Retrieve the type for an identifier; return 'bot' if the identifier is not -- in the lattice value. getTypeWithDefault :: UnionType -> Identifier -> TF UnionType getTypeWithDefault def i = do mt <- getType i return $ fromMaybe def mt -- | Set the type for an identifier. setType :: Identifier -> UnionType -> TF () setType i t = do fiModuleScope <- gets tfsFiModuleScope let useGlobal = goFlowInsensitive fiModuleScope i f s = if useGlobal then let l = tfsGlobalL s t' = t `join` Map.findWithDefault bot i l in s {tfsGlobalL = Map.insert i t' l } else s {tfsL = Map.insert i t (tfsL s)} when useGlobal setChangedGlobalL modify f -- | Remove identifier/type. removeType :: Identifier -> TF () removeType i = do fiModuleScope <- gets tfsFiModuleScope let useGlobal = goFlowInsensitive fiModuleScope i f s = s {tfsL = Map.delete i (tfsL s)} unless useGlobal (modify f) -- | Retrieve the mappings for all identifier that match a predicate from the -- lattice value. The global lattice value is not used. getAllFromL :: (Identifier -> Bool) -> TF [(Identifier, UnionType)] getAllFromL p = do l <- gets tfsL return $ filter (p . fst) (Map.toList l) -- | Remove the mappings for identifiers that match a predicate from the -- lattice value. The global lattice value is not used. removeFromL :: (Identifier -> Bool) -> TF () removeFromL p = do s <- get let l = tfsL s (_, b) = Map.partitionWithKey (\k _ -> p k) l put $ s { tfsL = b } -- | Remove and return the mappings for identifiers that match a predicate from -- the lattice value. The global lattice value is not used. extractFromL :: (Identifier -> Bool) -> TF (Map Identifier UnionType) extractFromL p = do s <- get let l = tfsL s (a, b) = Map.partitionWithKey (\k _ -> p k) l put $ s { tfsL = b } return a -- | Return the mappings for identifiers that match a predicate from the global -- lattice value. getGlobalTypes :: (Identifier -> Bool) -> TF (Map Identifier UnionType) getGlobalTypes p = do l <- gets tfsGlobalL setUsedGlobalL return $ Map.filterWithKey (\k _ -> p k) l -- | Modify the type for the identifier. modifyType :: Identifier -> (UnionType -> UnionType) -> TF () modifyType i f = do mt <- getType i case mt of Nothing -> return () Just t -> setType i (f t) -- | Update the type of an expression of the form /identifier.attribute/. modifyAttribute :: Identifier -> String -> (UnionType -> UnionType) -> TF () modifyAttribute i attr f = do mt <- getType i case mt of Nothing -> return () Just UTyTop -> return () Just (UTy s) -> do types <- mapM g (Set.toList s) setType i (joinAll types) where g :: ValueType -> TF UnionType -- reference types: modify corresponding global type instead g t@(ClassType (ClsRef classId)) = do modifyAttribute (ClassIdentifier classId) attr f return $ oneType t g t@(InstanceType (InstRef classId)) = do modifyAttribute (InstanceIdentifier classId) attr f return $ oneType t -- class and instance types: modify attribute g (ClassType (ClsTy classId sup env)) = return $ oneType $ ClsTy classId sup (updEnv env) g (InstanceType (InstTy cls env)) = return $ oneType $ InstTy cls (updEnv env) g _ = return bot updEnv = Map.alter (Just . f') attr f' Nothing = f bot f' (Just t) = f t -- | @cpType from to@ sets the type of @to@ to the type of @from@. cpType :: Identifier -> Identifier -> TF () cpType from to = do mt <- getType from case mt of Just t -> setType to t Nothing -> return () -- | @cpType from to@ sets the type of @to@ to the type of @from@ and removes -- the entry for @from@. mvType :: Identifier -> Identifier -> TF () mvType from to = do mt <- getType from case mt of Just t -> do removeType from setType to t Nothing -> return () -- | Look up the attribute in the given class type (and the types of its -- superclasses). clsAttr :: String -> ClassType -> TF (Maybe UnionType) clsAttr name (ClsRef classId) = do mt <- getType $ ClassIdentifier classId case mt of Nothing -> return Nothing Just UTyTop -> return $ Just UTyTop Just (UTy s) -> do let helper :: ValueType -> TF (Maybe UnionType) helper (ClassType ct) = clsAttr name ct helper _ = return $ Just bot list <- mapM helper (Set.toList s) case catMaybes list of [] -> return Nothing ts -> return $ Just $ joinAll ts clsAttr name (ClsTy _ sup env) = case Map.lookup name env of (Just t) -> return $ Just t Nothing -> do attrs <- mapM (clsAttr name) sup return $ listToMaybe $ catMaybes attrs -- | Look up the attribute in the given instance type (and its class type). instAttr :: String -> InstanceType -> TF (Maybe UnionType) instAttr name (InstRef classId) = do mt <- getType $ InstanceIdentifier classId case mt of Nothing -> return Nothing Just UTyTop -> return $ Just UTyTop Just (UTy s) -> do let helper :: ValueType -> TF (Maybe UnionType) helper (InstanceType it) = instAttr name it helper _ = return $ Just bot list <- mapM helper (Set.toList s) case catMaybes list of [] -> return Nothing ts -> return $ Just $ joinAll ts instAttr name (InstTy cls env) = case Map.lookup name env of (Just t) -> return $ Just t Nothing -> clsAttr name cls -- | Get the class type for an instance type. classOfInstance :: InstanceType -> TF ClassType classOfInstance (InstTy classType _) = return classType classOfInstance (InstRef classId) = do mt <- getType $ InstanceIdentifier classId let Just (UTy s) = mt [InstanceType (InstTy classType _)] = Set.toList s return classType
lfritz/python-type-inference
python-type-inference/src/Language/Python/TypeInference/Analysis/TFMonad.hs
bsd-3-clause
10,458
19
25
3,535
2,778
1,401
1,377
186
8
{-# OPTIONS_GHC -fno-warn-unused-imports #-} {-| Module : Game.GoreAndAsh.Sync Description : Gore&Ash high-level networking core module Copyright : (c) Anton Gushcha, 2015-2016 License : BSD3 Maintainer : ncrashed@gmail.com Stability : experimental Portability : POSIX The core module contains high-level networking API for Gore&Ash. It allows to perform automatic synchronzation of states on clients and server using a special EDSL. Example of embedding: TODO ADD THIS Important note, the system tries to use channel id 1 for service messages, but fallbacks to default channel if there is only one channel allocated in network module. Check initalization of network module, client and server allocated channels count must match. -} module Game.GoreAndAsh.Sync( SyncT , runSyncT -- * Options , SyncRole(..) , SyncOptions , syncOptionsRole , syncOptionsChannel , syncOptionsCollectionsChannel , syncOptionsResolveDelay , defaultSyncOptions -- * API , SyncName , SyncItemId , SyncMonad(..) , ClientSynced(..) , serverRejected , conditional , syncWithNameWith , syncWithName , syncUnregisterName , syncUnregisterNames -- ** Server side , syncToClientManual , syncToClient , syncToClientsManual , syncToClients , syncToAllClients , sendToClient , sendToClients , sendToAllClients , sendToClientMany , sendToClientsMany , sendToAllClientsMany , syncFromClient , syncFromClients , syncFromAllClients , receiveFromClient , receiveFromClients , receiveFromAllClients -- ** Client side , syncToServer , syncFromServerWith , syncFromServer , sendToServer , sendToServerMany , receiveFromServer -- ** Prediction , predict , predictMaybe , predictM , predictMaybeM , predictInterpolateM -- * Collections , hostCollection , hostSimpleCollection , remoteCollection ) where import Game.GoreAndAsh.Sync.API as X import Game.GoreAndAsh.Sync.Collection as X import Game.GoreAndAsh.Sync.Module as X import Game.GoreAndAsh.Sync.Options as X import Game.GoreAndAsh.Sync.Predict as X
Teaspot-Studio/gore-and-ash-sync
src/Game/GoreAndAsh/Sync.hs
bsd-3-clause
2,096
0
5
383
224
158
66
57
0
{-# LANGUAGE AllowAmbiguousTypes #-} {-# LANGUAGE DeriveFunctor #-} {-# LANGUAGE DeriveFoldable #-} {-# LANGUAGE DeriveTraversable #-} {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} {-# LANGUAGE ScopedTypeVariables #-} {-# LANGUAGE StandaloneDeriving #-} {-# LANGUAGE UndecidableInstances #-} module Data.FAlgebra.Tree ( module Data.FAlgebra.Base , TreeF(..) , Tree(..) , _node , _left , _right , _children , preorder , inorder , postorder , branch , leaf , empty , left , right ) where import Prelude hiding (reverse) import Data.FAlgebra.Base import Data.FAlgebra.Annotation import Data.Foldable import Data.Proxy import Data.Traversable import Control.Applicative hiding (empty) import Lens.Micro -- |Functor for trees with values on internal nodes. data TreeF a b = Empty | Branch a b b deriving (Eq, Show, Ord) deriving instance Functor (TreeF a) deriving instance Foldable (TreeF a) deriving instance Traversable (TreeF a) -- |Traversal for the value of a node. _node :: Applicative f => LensLike f (TreeF a b) (TreeF a' b) a a' _node _ Empty = pure Empty _node f (Branch a b1 b2) = fmap (\a' -> Branch a' b1 b2) (f a) {-# INLINE _node #-} -- |Traversal for the left branch of a node. Can't change type because left and right need to stay the same type. _left :: Applicative f => LensLike' f (TreeF a b) b _left _ Empty = pure Empty _left f (Branch a b1 b2) = fmap (\b1' -> Branch a b1' b2) (f b1) {-# INLINE _left #-} -- |Traversal for the right branch of a node. Can't change type because left and right need to stay the same type. _right :: Applicative f => LensLike' f (TreeF a b) b _right _ Empty = pure Empty _right f (Branch a b1 b2) = fmap (Branch a b1) (f b2) {-# INLINE _right #-} -- |Traversal for both children of a node. _children :: Applicative f => LensLike f (TreeF a b) (TreeF a b') b b' _children _ Empty = pure Empty _children f (Branch a b1 b2) = Branch a <$> f b1 <*> f b2 {-# INLINE _children #-} -- |Sequence root and then both branches preorder :: Applicative g => TreeF (g a) (g b) -> g (TreeF a b) preorder Empty = pure Empty preorder (Branch a b1 b2) = Branch <$> a <*> b1 <*> b2 -- |Sequence the left branch, then the root, then the right branch inorder :: Applicative g => TreeF (g a) (g b) -> g (TreeF a b) inorder Empty = pure Empty inorder (Branch a b1 b2) = (\x y z -> Branch y x z) <$> b1 <*> a <*> b2 -- |Sequence both branches and then the root postorder :: Applicative g => TreeF (g a) (g b) -> g (TreeF a b) postorder Empty = pure Empty postorder (Branch a b1 b2) = (\x y z -> Branch z x y) <$> b1 <*> b2 <*> a newtype Tree a = Tree { runTree :: Fix (TreeF a) } deriving instance Show (Fix (TreeF a)) => Show (Tree a) -- TODO: Reduce boilerplate for newtypes instance (Functor f, FAlgebra f (Fix (TreeF a))) => FAlgebra f (Tree a) where alg = Tree . alg . fmap runTree instance (Functor f, FCoalgebra f (Fix (TreeF a))) => FCoalgebra f (Tree a) where coalg = fmap Tree . coalg . runTree instance Functor Tree where fmap f = Tree . fmapFix (over _node f) . runTree -- |Create a tree from its node and its children branch :: FAlgebra (TreeF a) t => a -> t -> t -> t branch a b1 b2 = alg $ Branch a b1 b2 -- |Create a leaf (a tree with empty children) leaf :: forall a t. FAlgebra (TreeF a) t => a -> t leaf a = branch a e e where e = alg (Empty :: TreeF a t) -- |Create an empty tree. Using this is a bit tricky due to the ambiguous type. empty :: forall a t. FAlgebra (TreeF a) t => t empty = alg (Empty :: TreeF a t) -- |Get the left branch of a tree left :: forall a t. FCoalgebra (TreeF a) t => t -> t left t = case (coalg t :: TreeF a t) of Empty -> t Branch _ l _ -> l -- |Get the right branch of a tree right :: forall a t. FCoalgebra (TreeF a) t => t -> t right t = case (coalg t :: TreeF a t) of Empty -> t Branch _ _ r -> r instance FAlgebra (TreeF a) Size where alg Empty = 0 alg (Branch _ b1 b2) = 1 + b1 + b2
bhamrick/fixalgs
Data/FAlgebra/Tree.hs
bsd-3-clause
4,058
0
10
917
1,445
754
691
89
2
{-# LANGUAGE FlexibleContexts #-} module Database.PostgreSQL.Simple.Lifted.Transaction ( -- * Transaction handling withTransaction , withTransactionLevel , withTransactionMode , withTransactionSerializable , withTransactionModeRetry , begin , beginMode , beginLevel , commit , rollback -- * Defaults , PS.defaultTransactionMode , PS.defaultIsolationLevel , PS.defaultReadWriteMode -- * Savepoint , withSavepoint , releaseSavepoint , rollbackToSavepoint , rollbackToAndReleaseSavepoint , newSavepoint -- * Predicates , PS.isSerializationError , PS.isNoActiveTransactionError , PS.isFailedTransactionError -- * Data types , TransactionMode(..) , IsolationLevel(..) , ReadWriteMode(..) ) where import Control.Exception (SomeException, fromException) import Control.Exception.Lifted ( mask , onException , catch , throwIO , try ) import Database.PostgreSQL.Simple (SqlError) import Database.PostgreSQL.Simple.Types (Savepoint) import Database.PostgreSQL.Simple.Transaction ( TransactionMode(..) , IsolationLevel , ReadWriteMode ) import qualified Database.PostgreSQL.Simple.Transaction as PS import Database.PostgreSQL.Simple.Lifted.PostgresClient withTransaction :: (PostgresClient m) => m a -> m a withTransaction = withTransactionMode PS.defaultTransactionMode withTransactionLevel :: (PostgresClient m) => IsolationLevel -> m a -> m a withTransactionLevel lvl = withTransactionMode PS.defaultTransactionMode { PS.isolationLevel = lvl } begin :: (PostgresClient m) => m () begin = liftPSGClient $ PS.beginMode PS.defaultTransactionMode beginLevel :: (PostgresClient m) => IsolationLevel -> m () beginLevel = liftPSGClient . PS.beginLevel beginMode :: (PostgresClient m) => TransactionMode -> m () beginMode = liftPSGClient . PS.beginMode commit :: (PostgresClient m) => m () commit = liftPSGClient PS.commit rollback :: (PostgresClient m) => m () rollback = liftPSGClient PS.commit withTransactionMode :: (PostgresClient m) => TransactionMode -> m a -> m a withTransactionMode mode act = mask $ \restore -> do beginMode mode r <- restore act `onException` rollback commit return r withTransactionSerializable :: (PostgresClient m) => m a -> m a withTransactionSerializable = withTransactionModeRetry TransactionMode { isolationLevel = PS.Serializable , readWriteMode = PS.ReadWrite } PS.isSerializationError withTransactionModeRetry :: (PostgresClient m) => TransactionMode -> (SqlError -> Bool) -> m a -> m a withTransactionModeRetry mode shouldRetry act = mask $ \restore -> retryLoop $ try $ do a <- restore act commit return a where retryLoop :: (PostgresClient m) => m (Either SomeException a) -> m a retryLoop act' = do beginMode mode r <- act' case r of Left e -> do rollback case fmap shouldRetry (fromException e) of Just True -> retryLoop act' _ -> throwIO e Right a -> return a withSavepoint :: (PostgresClient m) => m a -> m a withSavepoint body = mask $ \restore -> do sp <- newSavepoint r <- restore body `onException` rollbackToAndReleaseSavepoint sp releaseSavepoint sp `catch` \err -> if PS.isFailedTransactionError err then rollbackToAndReleaseSavepoint sp else throwIO err return r releaseSavepoint :: (PostgresClient m) => Savepoint -> m () releaseSavepoint s = liftPSGClient (`PS.releaseSavepoint` s) rollbackToSavepoint :: (PostgresClient m) => Savepoint -> m () rollbackToSavepoint s = liftPSGClient (`PS.rollbackToSavepoint` s) rollbackToAndReleaseSavepoint :: (PostgresClient m) => Savepoint -> m () rollbackToAndReleaseSavepoint s = liftPSGClient (`PS.rollbackToAndReleaseSavepoint` s) newSavepoint :: (PostgresClient m) => m Savepoint newSavepoint = liftPSGClient PS.newSavepoint
onurzdg/clicklac
src/Database/PostgreSQL/Simple/Lifted/Transaction.hs
bsd-3-clause
4,447
0
17
1,295
1,064
571
493
124
3
{-# LANGUAGE TypeFamilies, TypeSynonymInstances, FlexibleInstances, MultiParamTypeClasses, FlexibleContexts, RankNTypes, GADTs, OverloadedStrings #-} module QueryArrow.Cypher.BuiltIn where import QueryArrow.Syntax.Term import QueryArrow.Cypher.Cypher import Data.Map.Strict (fromList) import QueryArrow.ListUtils (subset) import Control.Monad.Trans.State.Strict (get, put) import Data.Convertible (convert) import Data.Monoid ((<>)) cypherBuiltIn :: (String -> PredName) -> CypherBuiltIn cypherBuiltIn lookupPred = CypherBuiltIn ( fromList [ (lookupPred "le", \ [arg1, arg2] -> return (cwhere (CypherCompCond "<=" arg1 arg2 Pos))), (lookupPred "lt", \ [arg1, arg2] -> return (cwhere (CypherCompCond "<" arg1 arg2 Pos))), (lookupPred "eq", \ [arg1, arg2] -> do (a, b, repmap, rvars0, env0, ptm) <- get let rvars = map convert rvars0 let env = map convert env0 let fv2 = fv arg2 if fv2 `subset` env then case arg1 of CypherVarExpr v -> if v `elem` env then return (cwhere (CypherCompCond "=" arg1 arg2 Pos)) else if v `elem` rvars then do put (a, b, repmap <> cypherVarExprMap v arg2, rvars0, env0, ptm) return mempty else return mempty _ -> do let fv1 = fv arg1 if fv1 `subset` env then return (cwhere (CypherCompCond "=" arg1 arg2 Pos)) else error "eq: first argument is not a variable and contains free variables" else error "eq: second argument contains free variables" ), (lookupPred "like_regex", \ [arg1, arg2] -> return (cwhere (CypherCompCond "=~" arg1 arg2 Pos))), (lookupPred "like", \[arg1, arg2] -> return (cwhere (CypherCompCond "=~" arg1 (wildcardToRegex arg2) Pos))), (lookupPred "regex_replace", \[arg1, arg2, arg3, CypherVarExpr v] -> do (a, b, repmap, rvars, env, ptm) <- get put (a,b, repmap <> cypherVarExprMap v (CypherAppExpr "replace" [arg1, arg2, arg3]), rvars, env, ptm) -- currently only do non regex replace return mempty), (lookupPred "substr", \[arg1, arg2, arg3, CypherVarExpr v] -> do (a, b, repmap, rvars, env, ptm) <- get put (a,b, repmap <> cypherVarExprMap v (CypherAppExpr "substr" [arg1, arg2, arg3]), rvars, env, ptm) return mempty), (lookupPred "replace", \[arg1, arg2, arg3, CypherVarExpr v] -> do (a, b, repmap, rvars, env, ptm) <- get put (a,b, repmap <> cypherVarExprMap v (CypherAppExpr "replace" [arg1, arg2, arg3]), rvars, env, ptm) return mempty), (lookupPred "concat", \[arg1, arg2, CypherVarExpr v] -> do (a, b, repmap, rvars, env, ptm) <- get put (a,b, repmap <> cypherVarExprMap v (CypherInfixExpr "+" arg1 arg2), rvars, env, ptm) return mempty), (lookupPred "add", \[arg1, arg2, CypherVarExpr v] -> do (a, b, repmap, rvars, env, ptm) <- get put (a,b, repmap <> cypherVarExprMap v (CypherInfixExpr "+" arg1 arg2), rvars, env, ptm) return mempty), (lookupPred "sub", \[arg1, arg2, CypherVarExpr v] -> do (a, b, repmap, rvars, env, ptm) <- get put (a,b, repmap <> cypherVarExprMap v (CypherInfixExpr "-" arg1 arg2), rvars, env, ptm) return mempty), (lookupPred "mul", \[arg1, arg2, CypherVarExpr v] -> do (a, b, repmap, rvars, env, ptm) <- get put (a,b, repmap <> cypherVarExprMap v (CypherInfixExpr "*" arg1 arg2), rvars, env, ptm) return mempty), (lookupPred "div", \[arg1, arg2, CypherVarExpr v] -> do (a, b, repmap, rvars, env, ptm) <- get put (a,b, repmap <> cypherVarExprMap v (CypherInfixExpr "/" arg1 arg2), rvars, env, ptm) return mempty), (lookupPred "strlen", \[arg1, CypherVarExpr v] -> do (a, b, repmap, rvars, env, ptm) <- get put (a,b, repmap <> cypherVarExprMap v (CypherAppExpr "length" [arg1]), rvars, env, ptm) return mempty), (lookupPred "in", \ [arg1, arg2] -> return (cwhere (CypherCompCond "in" arg1 arg2 Pos))), (lookupPred "ge", \ [arg1, arg2] -> return (cwhere (CypherCompCond ">=" arg1 arg2 Pos))), (lookupPred "gt", \ [arg1, arg2] -> return (cwhere (CypherCompCond ">" arg1 arg2 Pos))), (lookupPred "ne", \ [arg1, arg2] -> return (cwhere (CypherCompCond "<>" arg1 arg2 Pos))), (lookupPred "not_like_regex", \ [arg1, arg2] -> return (cwhere (CypherCompCond "=~" arg1 arg2 Neg))) ]) wildcardToRegex :: CypherExpr -> CypherExpr wildcardToRegex a = foldl (\a (x, y) -> CypherAppExpr "replace" [a, CypherStringConstExpr x, CypherStringConstExpr y]) a [("\\", "\\\\"), (".", "\\."), ("*", "\\*"), ("%", ".*"), ("_", ".")] -- incomplete
xu-hao/QueryArrow
QueryArrow-db-cypher/src/QueryArrow/Cypher/BuiltIn.hs
bsd-3-clause
5,614
0
24
2,017
1,847
1,026
821
89
6
{-# OPTIONS -fno-cse #-} {-# LANGUAGE NamedFieldPuns #-} -- -fno-cse is needed for GLOBAL_VAR's to behave properly ----------------------------------------------------------------------------- -- -- GHC Driver -- -- (c) The University of Glasgow 2005 -- ----------------------------------------------------------------------------- module DriverPipeline ( -- Run a series of compilation steps in a pipeline, for a -- collection of source files. oneShot, compileFile, -- Interfaces for the batch-mode driver linkBinary, -- Interfaces for the compilation manager (interpreted/batch-mode) preprocess, compileOne, compileOne', link, -- Exports for hooks to override runPhase and link PhasePlus(..), CompPipeline(..), PipeEnv(..), PipeState(..), phaseOutputFilename, getPipeState, getPipeEnv, hscPostBackendPhase, getLocation, setModLocation, setDynFlags, runPhase, exeFileName, mkExtraObjToLinkIntoBinary, mkNoteObjsToLinkIntoBinary, maybeCreateManifest, runPhase_MoveBinary, linkingNeeded, checkLinkInfo ) where #include "HsVersions.h" import PipelineMonad import Packages import HeaderInfo import DriverPhases import SysTools import HscMain import Finder import HscTypes hiding ( Hsc ) import Outputable import Module import UniqFM ( eltsUFM ) import ErrUtils import DynFlags import Config import Panic import Util import StringBuffer ( hGetStringBuffer ) import BasicTypes ( SuccessFlag(..) ) import Maybes ( expectJust ) import ParserCoreUtils ( getCoreModuleName ) import SrcLoc import FastString import LlvmCodeGen ( llvmFixupAsm ) import MonadUtils import Platform import TcRnTypes import Hooks import Exception import Data.IORef ( readIORef ) import System.Directory import System.FilePath import System.IO import Control.Monad import Data.List ( isSuffixOf ) import Data.Maybe import System.Environment import Data.Char -- --------------------------------------------------------------------------- -- Pre-process -- | Just preprocess a file, put the result in a temp. file (used by the -- compilation manager during the summary phase). -- -- We return the augmented DynFlags, because they contain the result -- of slurping in the OPTIONS pragmas preprocess :: HscEnv -> (FilePath, Maybe Phase) -- ^ filename and starting phase -> IO (DynFlags, FilePath) preprocess hsc_env (filename, mb_phase) = ASSERT2(isJust mb_phase || isHaskellSrcFilename filename, text filename) runPipeline anyHsc hsc_env (filename, fmap RealPhase mb_phase) Nothing Temporary Nothing{-no ModLocation-} Nothing{-no stub-} -- --------------------------------------------------------------------------- -- | Compile -- -- Compile a single module, under the control of the compilation manager. -- -- This is the interface between the compilation manager and the -- compiler proper (hsc), where we deal with tedious details like -- reading the OPTIONS pragma from the source file, converting the -- C or assembly that GHC produces into an object file, and compiling -- FFI stub files. -- -- NB. No old interface can also mean that the source has changed. compileOne :: HscEnv -> ModSummary -- ^ summary for module being compiled -> Int -- ^ module N ... -> Int -- ^ ... of M -> Maybe ModIface -- ^ old interface, if we have one -> Maybe Linkable -- ^ old linkable, if we have one -> SourceModified -> IO HomeModInfo -- ^ the complete HomeModInfo, if successful compileOne = compileOne' Nothing (Just batchMsg) compileOne' :: Maybe TcGblEnv -> Maybe Messager -> HscEnv -> ModSummary -- ^ summary for module being compiled -> Int -- ^ module N ... -> Int -- ^ ... of M -> Maybe ModIface -- ^ old interface, if we have one -> Maybe Linkable -- ^ old linkable, if we have one -> SourceModified -> IO HomeModInfo -- ^ the complete HomeModInfo, if successful compileOne' m_tc_result mHscMessage hsc_env0 summary mod_index nmods mb_old_iface maybe_old_linkable source_modified0 = do let dflags0 = ms_hspp_opts summary this_mod = ms_mod summary src_flavour = ms_hsc_src summary location = ms_location summary input_fn = expectJust "compile:hs" (ml_hs_file location) input_fnpp = ms_hspp_file summary mod_graph = hsc_mod_graph hsc_env0 needsTH = any (xopt Opt_TemplateHaskell . ms_hspp_opts) mod_graph needsQQ = any (xopt Opt_QuasiQuotes . ms_hspp_opts) mod_graph needsLinker = needsTH || needsQQ isDynWay = any (== WayDyn) (ways dflags0) isProfWay = any (== WayProf) (ways dflags0) -- #8180 - when using TemplateHaskell, switch on -dynamic-too so -- the linker can correctly load the object files. let dflags1 = if needsLinker && dynamicGhc && not isDynWay && not isProfWay then gopt_set dflags0 Opt_BuildDynamicToo else dflags0 debugTraceMsg dflags1 2 (text "compile: input file" <+> text input_fnpp) let basename = dropExtension input_fn -- We add the directory in which the .hs files resides) to the import path. -- This is needed when we try to compile the .hc file later, if it -- imports a _stub.h file that we created here. let current_dir = takeDirectory basename old_paths = includePaths dflags1 dflags = dflags1 { includePaths = current_dir : old_paths } hsc_env = hsc_env0 {hsc_dflags = dflags} -- Figure out what lang we're generating let hsc_lang = hscTarget dflags -- ... and what the next phase should be let next_phase = hscPostBackendPhase dflags src_flavour hsc_lang -- ... and what file to generate the output into output_fn <- getOutputFilename next_phase Temporary basename dflags next_phase (Just location) let extCore_filename = basename ++ ".hcr" -- -fforce-recomp should also work with --make let force_recomp = gopt Opt_ForceRecomp dflags source_modified | force_recomp || isNothing maybe_old_linkable = SourceModified | otherwise = source_modified0 object_filename = ml_obj_file location let always_do_basic_recompilation_check = case hsc_lang of HscInterpreted -> True _ -> False e <- genericHscCompileGetFrontendResult always_do_basic_recompilation_check m_tc_result mHscMessage hsc_env summary source_modified mb_old_iface (mod_index, nmods) case e of Left iface -> do details <- genModDetails hsc_env iface MASSERT(isJust maybe_old_linkable) return (HomeModInfo{ hm_details = details, hm_iface = iface, hm_linkable = maybe_old_linkable }) Right (tc_result, mb_old_hash) -> -- run the compiler case hsc_lang of HscInterpreted -> case ms_hsc_src summary of HsBootFile -> do (iface, _changed, details) <- hscSimpleIface hsc_env tc_result mb_old_hash return (HomeModInfo{ hm_details = details, hm_iface = iface, hm_linkable = maybe_old_linkable }) _ -> do guts0 <- hscDesugar hsc_env summary tc_result guts <- hscSimplify hsc_env guts0 (iface, _changed, details, cgguts) <- hscNormalIface hsc_env extCore_filename guts mb_old_hash (hasStub, comp_bc, modBreaks) <- hscInteractive hsc_env cgguts summary stub_o <- case hasStub of Nothing -> return [] Just stub_c -> do stub_o <- compileStub hsc_env stub_c return [DotO stub_o] let hs_unlinked = [BCOs comp_bc modBreaks] unlinked_time = ms_hs_date summary -- Why do we use the timestamp of the source file here, -- rather than the current time? This works better in -- the case where the local clock is out of sync -- with the filesystem's clock. It's just as accurate: -- if the source is modified, then the linkable will -- be out of date. let linkable = LM unlinked_time this_mod (hs_unlinked ++ stub_o) return (HomeModInfo{ hm_details = details, hm_iface = iface, hm_linkable = Just linkable }) HscNothing -> do (iface, _changed, details) <- hscSimpleIface hsc_env tc_result mb_old_hash let linkable = if isHsBoot src_flavour then maybe_old_linkable else Just (LM (ms_hs_date summary) this_mod []) return (HomeModInfo{ hm_details = details, hm_iface = iface, hm_linkable = linkable }) _ -> case ms_hsc_src summary of HsBootFile -> do (iface, changed, details) <- hscSimpleIface hsc_env tc_result mb_old_hash hscWriteIface dflags iface changed summary touchObjectFile dflags object_filename return (HomeModInfo{ hm_details = details, hm_iface = iface, hm_linkable = maybe_old_linkable }) _ -> do guts0 <- hscDesugar hsc_env summary tc_result guts <- hscSimplify hsc_env guts0 (iface, changed, details, cgguts) <- hscNormalIface hsc_env extCore_filename guts mb_old_hash hscWriteIface dflags iface changed summary -- We're in --make mode: finish the compilation pipeline. let mod_name = ms_mod_name summary _ <- runPipeline StopLn hsc_env (output_fn, Just (HscOut src_flavour mod_name (HscRecomp cgguts summary))) (Just basename) Persistent (Just location) Nothing -- The object filename comes from the ModLocation o_time <- getModificationUTCTime object_filename let linkable = LM o_time this_mod [DotO object_filename] return (HomeModInfo{ hm_details = details, hm_iface = iface, hm_linkable = Just linkable }) ----------------------------------------------------------------------------- -- stub .h and .c files (for foreign export support) -- The _stub.c file is derived from the haskell source file, possibly taking -- into account the -stubdir option. -- -- The object file created by compiling the _stub.c file is put into a -- temporary file, which will be later combined with the main .o file -- (see the MergeStubs phase). compileStub :: HscEnv -> FilePath -> IO FilePath compileStub hsc_env stub_c = do (_, stub_o) <- runPipeline StopLn hsc_env (stub_c,Nothing) Nothing Temporary Nothing{-no ModLocation-} Nothing return stub_o -- --------------------------------------------------------------------------- -- Link link :: GhcLink -- interactive or batch -> DynFlags -- dynamic flags -> Bool -- attempt linking in batch mode? -> HomePackageTable -- what to link -> IO SuccessFlag -- For the moment, in the batch linker, we don't bother to tell doLink -- which packages to link -- it just tries all that are available. -- batch_attempt_linking should only be *looked at* in batch mode. It -- should only be True if the upsweep was successful and someone -- exports main, i.e., we have good reason to believe that linking -- will succeed. link ghcLink dflags = lookupHook linkHook l dflags ghcLink dflags where l LinkInMemory _ _ _ = if cGhcWithInterpreter == "YES" then -- Not Linking...(demand linker will do the job) return Succeeded else panicBadLink LinkInMemory l NoLink _ _ _ = return Succeeded l LinkBinary dflags batch_attempt_linking hpt = link' dflags batch_attempt_linking hpt l LinkStaticLib dflags batch_attempt_linking hpt = link' dflags batch_attempt_linking hpt l LinkDynLib dflags batch_attempt_linking hpt = link' dflags batch_attempt_linking hpt panicBadLink :: GhcLink -> a panicBadLink other = panic ("link: GHC not built to link this way: " ++ show other) link' :: DynFlags -- dynamic flags -> Bool -- attempt linking in batch mode? -> HomePackageTable -- what to link -> IO SuccessFlag link' dflags batch_attempt_linking hpt | batch_attempt_linking = do let staticLink = case ghcLink dflags of LinkStaticLib -> True _ -> platformBinariesAreStaticLibs (targetPlatform dflags) home_mod_infos = eltsUFM hpt -- the packages we depend on pkg_deps = concatMap (map fst . dep_pkgs . mi_deps . hm_iface) home_mod_infos -- the linkables to link linkables = map (expectJust "link".hm_linkable) home_mod_infos debugTraceMsg dflags 3 (text "link: linkables are ..." $$ vcat (map ppr linkables)) -- check for the -no-link flag if isNoLink (ghcLink dflags) then do debugTraceMsg dflags 3 (text "link(batch): linking omitted (-c flag given).") return Succeeded else do let getOfiles (LM _ _ us) = map nameOfObject (filter isObject us) obj_files = concatMap getOfiles linkables exe_file = exeFileName staticLink dflags linking_needed <- linkingNeeded dflags staticLink linkables pkg_deps if not (gopt Opt_ForceRecomp dflags) && not linking_needed then do debugTraceMsg dflags 2 (text exe_file <+> ptext (sLit "is up to date, linking not required.")) return Succeeded else do compilationProgressMsg dflags ("Linking " ++ exe_file ++ " ...") -- Don't showPass in Batch mode; doLink will do that for us. let link = case ghcLink dflags of LinkBinary -> linkBinary LinkStaticLib -> linkStaticLibCheck LinkDynLib -> linkDynLibCheck other -> panicBadLink other link dflags obj_files pkg_deps debugTraceMsg dflags 3 (text "link: done") -- linkBinary only returns if it succeeds return Succeeded | otherwise = do debugTraceMsg dflags 3 (text "link(batch): upsweep (partially) failed OR" $$ text " Main.main not exported; not linking.") return Succeeded linkingNeeded :: DynFlags -> Bool -> [Linkable] -> [PackageId] -> IO Bool linkingNeeded dflags staticLink linkables pkg_deps = do -- if the modification time on the executable is later than the -- modification times on all of the objects and libraries, then omit -- linking (unless the -fforce-recomp flag was given). let exe_file = exeFileName staticLink dflags e_exe_time <- tryIO $ getModificationUTCTime exe_file case e_exe_time of Left _ -> return True Right t -> do -- first check object files and extra_ld_inputs let extra_ld_inputs = [ f | FileOption _ f <- ldInputs dflags ] e_extra_times <- mapM (tryIO . getModificationUTCTime) extra_ld_inputs let (errs,extra_times) = splitEithers e_extra_times let obj_times = map linkableTime linkables ++ extra_times if not (null errs) || any (t <) obj_times then return True else do -- next, check libraries. XXX this only checks Haskell libraries, -- not extra_libraries or -l things from the command line. let pkg_map = pkgIdMap (pkgState dflags) pkg_hslibs = [ (libraryDirs c, lib) | Just c <- map (lookupPackage pkg_map) pkg_deps, lib <- packageHsLibs dflags c ] pkg_libfiles <- mapM (uncurry (findHSLib dflags)) pkg_hslibs if any isNothing pkg_libfiles then return True else do e_lib_times <- mapM (tryIO . getModificationUTCTime) (catMaybes pkg_libfiles) let (lib_errs,lib_times) = splitEithers e_lib_times if not (null lib_errs) || any (t <) lib_times then return True else checkLinkInfo dflags pkg_deps exe_file -- Returns 'False' if it was, and we can avoid linking, because the -- previous binary was linked with "the same options". checkLinkInfo :: DynFlags -> [PackageId] -> FilePath -> IO Bool checkLinkInfo dflags pkg_deps exe_file | not (platformSupportsSavingLinkOpts (platformOS (targetPlatform dflags))) -- ToDo: Windows and OS X do not use the ELF binary format, so -- readelf does not work there. We need to find another way to do -- this. = return False -- conservatively we should return True, but not -- linking in this case was the behaviour for a long -- time so we leave it as-is. | otherwise = do link_info <- getLinkInfo dflags pkg_deps debugTraceMsg dflags 3 $ text ("Link info: " ++ link_info) m_exe_link_info <- readElfSection dflags ghcLinkInfoSectionName exe_file debugTraceMsg dflags 3 $ text ("Exe link info: " ++ show m_exe_link_info) return (Just link_info /= m_exe_link_info) platformSupportsSavingLinkOpts :: OS -> Bool platformSupportsSavingLinkOpts os | os == OSSolaris2 = False -- see #5382 | otherwise = osElfTarget os ghcLinkInfoSectionName :: String ghcLinkInfoSectionName = ".debug-ghc-link-info" -- if we use the ".debug" prefix, then strip will strip it by default findHSLib :: DynFlags -> [String] -> String -> IO (Maybe FilePath) findHSLib dflags dirs lib = do let batch_lib_file = if gopt Opt_Static dflags then "lib" ++ lib <.> "a" else mkSOName (targetPlatform dflags) lib found <- filterM doesFileExist (map (</> batch_lib_file) dirs) case found of [] -> return Nothing (x:_) -> return (Just x) -- ----------------------------------------------------------------------------- -- Compile files in one-shot mode. oneShot :: HscEnv -> Phase -> [(String, Maybe Phase)] -> IO () oneShot hsc_env stop_phase srcs = do o_files <- mapM (compileFile hsc_env stop_phase) srcs doLink (hsc_dflags hsc_env) stop_phase o_files compileFile :: HscEnv -> Phase -> (FilePath, Maybe Phase) -> IO FilePath compileFile hsc_env stop_phase (src, mb_phase) = do exists <- doesFileExist src when (not exists) $ throwGhcExceptionIO (CmdLineError ("does not exist: " ++ src)) let dflags = hsc_dflags hsc_env split = gopt Opt_SplitObjs dflags mb_o_file = outputFile dflags ghc_link = ghcLink dflags -- Set by -c or -no-link -- When linking, the -o argument refers to the linker's output. -- otherwise, we use it as the name for the pipeline's output. output -- If we are dong -fno-code, then act as if the output is -- 'Temporary'. This stops GHC trying to copy files to their -- final location. | HscNothing <- hscTarget dflags = Temporary | StopLn <- stop_phase, not (isNoLink ghc_link) = Persistent -- -o foo applies to linker | isJust mb_o_file = SpecificFile -- -o foo applies to the file we are compiling now | otherwise = Persistent stop_phase' = case stop_phase of As _ | split -> SplitAs _ -> stop_phase ( _, out_file) <- runPipeline stop_phase' hsc_env (src, fmap RealPhase mb_phase) Nothing output Nothing{-no ModLocation-} Nothing return out_file doLink :: DynFlags -> Phase -> [FilePath] -> IO () doLink dflags stop_phase o_files | not (isStopLn stop_phase) = return () -- We stopped before the linking phase | otherwise = case ghcLink dflags of NoLink -> return () LinkBinary -> linkBinary dflags o_files [] LinkStaticLib -> linkStaticLibCheck dflags o_files [] LinkDynLib -> linkDynLibCheck dflags o_files [] other -> panicBadLink other -- --------------------------------------------------------------------------- -- | Run a compilation pipeline, consisting of multiple phases. -- -- This is the interface to the compilation pipeline, which runs -- a series of compilation steps on a single source file, specifying -- at which stage to stop. -- -- The DynFlags can be modified by phases in the pipeline (eg. by -- OPTIONS_GHC pragmas), and the changes affect later phases in the -- pipeline. runPipeline :: Phase -- ^ When to stop -> HscEnv -- ^ Compilation environment -> (FilePath,Maybe PhasePlus) -- ^ Input filename (and maybe -x suffix) -> Maybe FilePath -- ^ original basename (if different from ^^^) -> PipelineOutput -- ^ Output filename -> Maybe ModLocation -- ^ A ModLocation, if this is a Haskell module -> Maybe FilePath -- ^ stub object, if we have one -> IO (DynFlags, FilePath) -- ^ (final flags, output filename) runPipeline stop_phase hsc_env0 (input_fn, mb_phase) mb_basename output maybe_loc maybe_stub_o = do let dflags0 = hsc_dflags hsc_env0 -- Decide where dump files should go based on the pipeline output dflags = dflags0 { dumpPrefix = Just (basename ++ ".") } hsc_env = hsc_env0 {hsc_dflags = dflags} (input_basename, suffix) = splitExtension input_fn suffix' = drop 1 suffix -- strip off the . basename | Just b <- mb_basename = b | otherwise = input_basename -- If we were given a -x flag, then use that phase to start from start_phase = fromMaybe (RealPhase (startPhase suffix')) mb_phase isHaskell (RealPhase (Unlit _)) = True isHaskell (RealPhase (Cpp _)) = True isHaskell (RealPhase (HsPp _)) = True isHaskell (RealPhase (Hsc _)) = True isHaskell (HscOut {}) = True isHaskell _ = False isHaskellishFile = isHaskell start_phase env = PipeEnv{ pe_isHaskellishFile = isHaskellishFile, stop_phase, src_filename = input_fn, src_basename = basename, src_suffix = suffix', output_spec = output } -- We want to catch cases of "you can't get there from here" before -- we start the pipeline, because otherwise it will just run off the -- end. -- -- There is a partial ordering on phases, where A < B iff A occurs -- before B in a normal compilation pipeline. let happensBefore' = happensBefore dflags case start_phase of RealPhase start_phase' -> when (not (start_phase' `happensBefore'` stop_phase)) $ throwGhcExceptionIO (UsageError ("cannot compile this file to desired target: " ++ input_fn)) HscOut {} -> return () debugTraceMsg dflags 4 (text "Running the pipeline") r <- runPipeline' start_phase hsc_env env input_fn maybe_loc maybe_stub_o -- If we are compiling a Haskell module, and doing -- -dynamic-too, but couldn't do the -dynamic-too fast -- path, then rerun the pipeline for the dyn way let dflags = extractDynFlags hsc_env -- NB: Currently disabled on Windows (ref #7134, #8228, and #5987) when (not $ platformOS (targetPlatform dflags) == OSMinGW32) $ do when isHaskellishFile $ whenCannotGenerateDynamicToo dflags $ do debugTraceMsg dflags 4 (text "Running the pipeline again for -dynamic-too") let dflags' = dynamicTooMkDynamicDynFlags dflags hsc_env' <- newHscEnv dflags' _ <- runPipeline' start_phase hsc_env' env input_fn maybe_loc maybe_stub_o return () return r runPipeline' :: PhasePlus -- ^ When to start -> HscEnv -- ^ Compilation environment -> PipeEnv -> FilePath -- ^ Input filename -> Maybe ModLocation -- ^ A ModLocation, if this is a Haskell module -> Maybe FilePath -- ^ stub object, if we have one -> IO (DynFlags, FilePath) -- ^ (final flags, output filename) runPipeline' start_phase hsc_env env input_fn maybe_loc maybe_stub_o = do -- Execute the pipeline... let state = PipeState{ hsc_env, maybe_loc, maybe_stub_o = maybe_stub_o } evalP (pipeLoop start_phase input_fn) env state -- --------------------------------------------------------------------------- -- outer pipeline loop -- | pipeLoop runs phases until we reach the stop phase pipeLoop :: PhasePlus -> FilePath -> CompPipeline (DynFlags, FilePath) pipeLoop phase input_fn = do env <- getPipeEnv dflags <- getDynFlags let happensBefore' = happensBefore dflags stopPhase = stop_phase env case phase of RealPhase realPhase | realPhase `eqPhase` stopPhase -- All done -> -- Sometimes, a compilation phase doesn't actually generate any output -- (eg. the CPP phase when -fcpp is not turned on). If we end on this -- stage, but we wanted to keep the output, then we have to explicitly -- copy the file, remembering to prepend a {-# LINE #-} pragma so that -- further compilation stages can tell what the original filename was. case output_spec env of Temporary -> return (dflags, input_fn) output -> do pst <- getPipeState final_fn <- liftIO $ getOutputFilename stopPhase output (src_basename env) dflags stopPhase (maybe_loc pst) when (final_fn /= input_fn) $ do let msg = ("Copying `" ++ input_fn ++"' to `" ++ final_fn ++ "'") line_prag = Just ("{-# LINE 1 \"" ++ src_filename env ++ "\" #-}\n") liftIO $ copyWithHeader dflags msg line_prag input_fn final_fn return (dflags, final_fn) | not (realPhase `happensBefore'` stopPhase) -- Something has gone wrong. We'll try to cover all the cases when -- this could happen, so if we reach here it is a panic. -- eg. it might happen if the -C flag is used on a source file that -- has {-# OPTIONS -fasm #-}. -> panic ("pipeLoop: at phase " ++ show realPhase ++ " but I wanted to stop at phase " ++ show stopPhase) _ -> do liftIO $ debugTraceMsg dflags 4 (ptext (sLit "Running phase") <+> ppr phase) (next_phase, output_fn) <- runHookedPhase phase input_fn dflags r <- pipeLoop next_phase output_fn case phase of HscOut {} -> whenGeneratingDynamicToo dflags $ do setDynFlags $ dynamicTooMkDynamicDynFlags dflags -- TODO shouldn't ignore result: _ <- pipeLoop phase input_fn return () _ -> return () return r runHookedPhase :: PhasePlus -> FilePath -> DynFlags -> CompPipeline (PhasePlus, FilePath) runHookedPhase pp input dflags = lookupHook runPhaseHook runPhase dflags pp input dflags -- ----------------------------------------------------------------------------- -- In each phase, we need to know into what filename to generate the -- output. All the logic about which filenames we generate output -- into is embodied in the following function. phaseOutputFilename :: Phase{-next phase-} -> CompPipeline FilePath phaseOutputFilename next_phase = do PipeEnv{stop_phase, src_basename, output_spec} <- getPipeEnv PipeState{maybe_loc, hsc_env} <- getPipeState let dflags = hsc_dflags hsc_env liftIO $ getOutputFilename stop_phase output_spec src_basename dflags next_phase maybe_loc getOutputFilename :: Phase -> PipelineOutput -> String -> DynFlags -> Phase{-next phase-} -> Maybe ModLocation -> IO FilePath getOutputFilename stop_phase output basename dflags next_phase maybe_location | is_last_phase, Persistent <- output = persistent_fn | is_last_phase, SpecificFile <- output = case outputFile dflags of Just f -> return f Nothing -> panic "SpecificFile: No filename" | keep_this_output = persistent_fn | otherwise = newTempName dflags suffix where hcsuf = hcSuf dflags odir = objectDir dflags osuf = objectSuf dflags keep_hc = gopt Opt_KeepHcFiles dflags keep_s = gopt Opt_KeepSFiles dflags keep_bc = gopt Opt_KeepLlvmFiles dflags myPhaseInputExt HCc = hcsuf myPhaseInputExt MergeStub = osuf myPhaseInputExt StopLn = osuf myPhaseInputExt other = phaseInputExt other is_last_phase = next_phase `eqPhase` stop_phase -- sometimes, we keep output from intermediate stages keep_this_output = case next_phase of As _ | keep_s -> True LlvmOpt | keep_bc -> True HCc | keep_hc -> True _other -> False suffix = myPhaseInputExt next_phase -- persistent object files get put in odir persistent_fn | StopLn <- next_phase = return odir_persistent | otherwise = return persistent persistent = basename <.> suffix odir_persistent | Just loc <- maybe_location = ml_obj_file loc | Just d <- odir = d </> persistent | otherwise = persistent -- ----------------------------------------------------------------------------- -- | Each phase in the pipeline returns the next phase to execute, and the -- name of the file in which the output was placed. -- -- We must do things dynamically this way, because we often don't know -- what the rest of the phases will be until part-way through the -- compilation: for example, an {-# OPTIONS -fasm #-} at the beginning -- of a source file can change the latter stages of the pipeline from -- taking the LLVM route to using the native code generator. -- runPhase :: PhasePlus -- ^ Run this phase -> FilePath -- ^ name of the input file -> DynFlags -- ^ for convenience, we pass the current dflags in -> CompPipeline (PhasePlus, -- next phase to run FilePath) -- output filename -- Invariant: the output filename always contains the output -- Interesting case: Hsc when there is no recompilation to do -- Then the output filename is still a .o file ------------------------------------------------------------------------------- -- Unlit phase runPhase (RealPhase (Unlit sf)) input_fn dflags = do output_fn <- phaseOutputFilename (Cpp sf) let flags = [ -- The -h option passes the file name for unlit to -- put in a #line directive SysTools.Option "-h" , SysTools.Option $ escape $ normalise input_fn , SysTools.FileOption "" input_fn , SysTools.FileOption "" output_fn ] liftIO $ SysTools.runUnlit dflags flags return (RealPhase (Cpp sf), output_fn) where -- escape the characters \, ", and ', but don't try to escape -- Unicode or anything else (so we don't use Util.charToC -- here). If we get this wrong, then in -- Coverage.addTicksToBinds where we check that the filename in -- a SrcLoc is the same as the source filenaame, the two will -- look bogusly different. See test: -- libraries/hpc/tests/function/subdir/tough2.lhs escape ('\\':cs) = '\\':'\\': escape cs escape ('\"':cs) = '\\':'\"': escape cs escape ('\'':cs) = '\\':'\'': escape cs escape (c:cs) = c : escape cs escape [] = [] ------------------------------------------------------------------------------- -- Cpp phase : (a) gets OPTIONS out of file -- (b) runs cpp if necessary runPhase (RealPhase (Cpp sf)) input_fn dflags0 = do src_opts <- liftIO $ getOptionsFromFile dflags0 input_fn (dflags1, unhandled_flags, warns) <- liftIO $ parseDynamicFilePragma dflags0 src_opts setDynFlags dflags1 liftIO $ checkProcessArgsResult dflags1 unhandled_flags if not (xopt Opt_Cpp dflags1) then do -- we have to be careful to emit warnings only once. unless (gopt Opt_Pp dflags1) $ liftIO $ handleFlagWarnings dflags1 warns -- no need to preprocess CPP, just pass input file along -- to the next phase of the pipeline. return (RealPhase (HsPp sf), input_fn) else do output_fn <- phaseOutputFilename (HsPp sf) liftIO $ doCpp dflags1 True{-raw-} input_fn output_fn -- re-read the pragmas now that we've preprocessed the file -- See #2464,#3457 src_opts <- liftIO $ getOptionsFromFile dflags0 output_fn (dflags2, unhandled_flags, warns) <- liftIO $ parseDynamicFilePragma dflags0 src_opts liftIO $ checkProcessArgsResult dflags2 unhandled_flags unless (gopt Opt_Pp dflags2) $ liftIO $ handleFlagWarnings dflags2 warns -- the HsPp pass below will emit warnings setDynFlags dflags2 return (RealPhase (HsPp sf), output_fn) ------------------------------------------------------------------------------- -- HsPp phase runPhase (RealPhase (HsPp sf)) input_fn dflags = do if not (gopt Opt_Pp dflags) then -- no need to preprocess, just pass input file along -- to the next phase of the pipeline. return (RealPhase (Hsc sf), input_fn) else do PipeEnv{src_basename, src_suffix} <- getPipeEnv let orig_fn = src_basename <.> src_suffix output_fn <- phaseOutputFilename (Hsc sf) liftIO $ SysTools.runPp dflags ( [ SysTools.Option orig_fn , SysTools.Option input_fn , SysTools.FileOption "" output_fn ] ) -- re-read pragmas now that we've parsed the file (see #3674) src_opts <- liftIO $ getOptionsFromFile dflags output_fn (dflags1, unhandled_flags, warns) <- liftIO $ parseDynamicFilePragma dflags src_opts setDynFlags dflags1 liftIO $ checkProcessArgsResult dflags1 unhandled_flags liftIO $ handleFlagWarnings dflags1 warns return (RealPhase (Hsc sf), output_fn) ----------------------------------------------------------------------------- -- Hsc phase -- Compilation of a single module, in "legacy" mode (_not_ under -- the direction of the compilation manager). runPhase (RealPhase (Hsc src_flavour)) input_fn dflags0 = do -- normal Hsc mode, not mkdependHS PipeEnv{ stop_phase=stop, src_basename=basename, src_suffix=suff } <- getPipeEnv -- we add the current directory (i.e. the directory in which -- the .hs files resides) to the include path, since this is -- what gcc does, and it's probably what you want. let current_dir = takeDirectory basename paths = includePaths dflags0 dflags = dflags0 { includePaths = current_dir : paths } setDynFlags dflags -- gather the imports and module name (hspp_buf,mod_name,imps,src_imps) <- liftIO $ case src_flavour of ExtCoreFile -> do -- no explicit imports in ExtCore input. m <- getCoreModuleName input_fn return (Nothing, mkModuleName m, [], []) _ -> do buf <- hGetStringBuffer input_fn (src_imps,imps,L _ mod_name) <- getImports dflags buf input_fn (basename <.> suff) return (Just buf, mod_name, imps, src_imps) -- Take -o into account if present -- Very like -ohi, but we must *only* do this if we aren't linking -- (If we're linking then the -o applies to the linked thing, not to -- the object file for one module.) -- Note the nasty duplication with the same computation in compileFile above location <- getLocation src_flavour mod_name let o_file = ml_obj_file location -- The real object file -- Figure out if the source has changed, for recompilation avoidance. -- -- Setting source_unchanged to True means that M.o seems -- to be up to date wrt M.hs; so no need to recompile unless imports have -- changed (which the compiler itself figures out). -- Setting source_unchanged to False tells the compiler that M.o is out of -- date wrt M.hs (or M.o doesn't exist) so we must recompile regardless. src_timestamp <- liftIO $ getModificationUTCTime (basename <.> suff) source_unchanged <- liftIO $ if not (isStopLn stop) -- SourceModified unconditionally if -- (a) recompilation checker is off, or -- (b) we aren't going all the way to .o file (e.g. ghc -S) then return SourceModified -- Otherwise look at file modification dates else do o_file_exists <- doesFileExist o_file if not o_file_exists then return SourceModified -- Need to recompile else do t2 <- getModificationUTCTime o_file if t2 > src_timestamp then return SourceUnmodified else return SourceModified let extCore_filename = basename ++ ".hcr" PipeState{hsc_env=hsc_env'} <- getPipeState -- Tell the finder cache about this module mod <- liftIO $ addHomeModuleToFinder hsc_env' mod_name location -- Make the ModSummary to hand to hscMain let mod_summary = ModSummary { ms_mod = mod, ms_hsc_src = src_flavour, ms_hspp_file = input_fn, ms_hspp_opts = dflags, ms_hspp_buf = hspp_buf, ms_location = location, ms_hs_date = src_timestamp, ms_obj_date = Nothing, ms_textual_imps = imps, ms_srcimps = src_imps } -- run the compiler! result <- liftIO $ hscCompileOneShot hsc_env' extCore_filename mod_summary source_unchanged return (HscOut src_flavour mod_name result, panic "HscOut doesn't have an input filename") runPhase (HscOut src_flavour mod_name result) _ dflags = do location <- getLocation src_flavour mod_name setModLocation location let o_file = ml_obj_file location -- The real object file hsc_lang = hscTarget dflags next_phase = hscPostBackendPhase dflags src_flavour hsc_lang case result of HscNotGeneratingCode -> return (RealPhase next_phase, panic "No output filename from Hsc when no-code") HscUpToDate -> do liftIO $ touchObjectFile dflags o_file -- The .o file must have a later modification date -- than the source file (else we wouldn't get Nothing) -- but we touch it anyway, to keep 'make' happy (we think). return (RealPhase StopLn, o_file) HscUpdateBoot -> do -- In the case of hs-boot files, generate a dummy .o-boot -- stamp file for the benefit of Make liftIO $ touchObjectFile dflags o_file return (RealPhase next_phase, o_file) HscRecomp cgguts mod_summary -> do output_fn <- phaseOutputFilename next_phase PipeState{hsc_env=hsc_env'} <- getPipeState (outputFilename, mStub) <- liftIO $ hscGenHardCode hsc_env' cgguts mod_summary output_fn case mStub of Nothing -> return () Just stub_c -> do stub_o <- liftIO $ compileStub hsc_env' stub_c setStubO stub_o return (RealPhase next_phase, outputFilename) ----------------------------------------------------------------------------- -- Cmm phase runPhase (RealPhase CmmCpp) input_fn dflags = do output_fn <- phaseOutputFilename Cmm liftIO $ doCpp dflags False{-not raw-} input_fn output_fn return (RealPhase Cmm, output_fn) runPhase (RealPhase Cmm) input_fn dflags = do let hsc_lang = hscTarget dflags let next_phase = hscPostBackendPhase dflags HsSrcFile hsc_lang output_fn <- phaseOutputFilename next_phase PipeState{hsc_env} <- getPipeState liftIO $ hscCompileCmmFile hsc_env input_fn output_fn return (RealPhase next_phase, output_fn) ----------------------------------------------------------------------------- -- Cc phase -- we don't support preprocessing .c files (with -E) now. Doing so introduces -- way too many hacks, and I can't say I've ever used it anyway. runPhase (RealPhase cc_phase) input_fn dflags | any (cc_phase `eqPhase`) [Cc, Ccpp, HCc, Cobjc, Cobjcpp] = do let platform = targetPlatform dflags hcc = cc_phase `eqPhase` HCc let cmdline_include_paths = includePaths dflags -- HC files have the dependent packages stamped into them pkgs <- if hcc then liftIO $ getHCFilePackages input_fn else return [] -- add package include paths even if we're just compiling .c -- files; this is the Value Add(TM) that using ghc instead of -- gcc gives you :) pkg_include_dirs <- liftIO $ getPackageIncludePath dflags pkgs let include_paths = foldr (\ x xs -> ("-I" ++ x) : xs) [] (cmdline_include_paths ++ pkg_include_dirs) let gcc_extra_viac_flags = extraGccViaCFlags dflags let pic_c_flags = picCCOpts dflags let verbFlags = getVerbFlags dflags -- cc-options are not passed when compiling .hc files. Our -- hc code doesn't not #include any header files anyway, so these -- options aren't necessary. pkg_extra_cc_opts <- liftIO $ if cc_phase `eqPhase` HCc then return [] else getPackageExtraCcOpts dflags pkgs framework_paths <- if platformUsesFrameworks platform then do pkgFrameworkPaths <- liftIO $ getPackageFrameworkPath dflags pkgs let cmdlineFrameworkPaths = frameworkPaths dflags return $ map ("-F"++) (cmdlineFrameworkPaths ++ pkgFrameworkPaths) else return [] let split_objs = gopt Opt_SplitObjs dflags split_opt | hcc && split_objs = [ "-DUSE_SPLIT_MARKERS" ] | otherwise = [ ] let cc_opt | optLevel dflags >= 2 = [ "-O2" ] | optLevel dflags >= 1 = [ "-O" ] | otherwise = [] -- Decide next phase let next_phase = As False output_fn <- phaseOutputFilename next_phase let more_hcc_opts = -- on x86 the floating point regs have greater precision -- than a double, which leads to unpredictable results. -- By default, we turn this off with -ffloat-store unless -- the user specified -fexcess-precision. (if platformArch platform == ArchX86 && not (gopt Opt_ExcessPrecision dflags) then [ "-ffloat-store" ] else []) ++ -- gcc's -fstrict-aliasing allows two accesses to memory -- to be considered non-aliasing if they have different types. -- This interacts badly with the C code we generate, which is -- very weakly typed, being derived from C--. ["-fno-strict-aliasing"] let gcc_lang_opt | cc_phase `eqPhase` Ccpp = "c++" | cc_phase `eqPhase` Cobjc = "objective-c" | cc_phase `eqPhase` Cobjcpp = "objective-c++" | otherwise = "c" liftIO $ SysTools.runCc dflags ( -- force the C compiler to interpret this file as C when -- compiling .hc files, by adding the -x c option. -- Also useful for plain .c files, just in case GHC saw a -- -x c option. [ SysTools.Option "-x", SysTools.Option gcc_lang_opt , SysTools.FileOption "" input_fn , SysTools.Option "-o" , SysTools.FileOption "" output_fn ] ++ map SysTools.Option ( pic_c_flags -- Stub files generated for foreign exports references the runIO_closure -- and runNonIO_closure symbols, which are defined in the base package. -- These symbols are imported into the stub.c file via RtsAPI.h, and the -- way we do the import depends on whether we're currently compiling -- the base package or not. ++ (if platformOS platform == OSMinGW32 && thisPackage dflags == basePackageId then [ "-DCOMPILING_BASE_PACKAGE" ] else []) -- We only support SparcV9 and better because V8 lacks an atomic CAS -- instruction. Note that the user can still override this -- (e.g., -mcpu=ultrasparc) as GCC picks the "best" -mcpu flag -- regardless of the ordering. -- -- This is a temporary hack. See #2872, commit -- 5bd3072ac30216a505151601884ac88bf404c9f2 ++ (if platformArch platform == ArchSPARC then ["-mcpu=v9"] else []) -- GCC 4.6+ doesn't like -Wimplicit when compiling C++. ++ (if (cc_phase /= Ccpp && cc_phase /= Cobjcpp) then ["-Wimplicit"] else []) ++ (if hcc then gcc_extra_viac_flags ++ more_hcc_opts else []) ++ verbFlags ++ [ "-S" ] ++ cc_opt ++ [ "-D__GLASGOW_HASKELL__="++cProjectVersionInt ] ++ framework_paths ++ split_opt ++ include_paths ++ pkg_extra_cc_opts )) return (RealPhase next_phase, output_fn) ----------------------------------------------------------------------------- -- Splitting phase runPhase (RealPhase Splitter) input_fn dflags = do -- tmp_pfx is the prefix used for the split .s files split_s_prefix <- liftIO $ SysTools.newTempName dflags "split" let n_files_fn = split_s_prefix liftIO $ SysTools.runSplit dflags [ SysTools.FileOption "" input_fn , SysTools.FileOption "" split_s_prefix , SysTools.FileOption "" n_files_fn ] -- Save the number of split files for future references s <- liftIO $ readFile n_files_fn let n_files = read s :: Int dflags' = dflags { splitInfo = Just (split_s_prefix, n_files) } setDynFlags dflags' -- Remember to delete all these files liftIO $ addFilesToClean dflags' [ split_s_prefix ++ "__" ++ show n ++ ".s" | n <- [1..n_files]] return (RealPhase SplitAs, "**splitter**") -- we don't use the filename in SplitAs ----------------------------------------------------------------------------- -- As, SpitAs phase : Assembler -- This is for calling the assembler on a regular assembly file (not split). runPhase (RealPhase (As with_cpp)) input_fn dflags = do -- LLVM from version 3.0 onwards doesn't support the OS X system -- assembler, so we use clang as the assembler instead. (#5636) let whichAsProg | hscTarget dflags == HscLlvm && platformOS (targetPlatform dflags) == OSDarwin = do -- be careful what options we call clang with -- see #5903 and #7617 for bugs caused by this. llvmVer <- liftIO $ figureLlvmVersion dflags return $ case llvmVer of Just n | n >= 30 -> SysTools.runClang _ -> SysTools.runAs | otherwise = return SysTools.runAs as_prog <- whichAsProg let cmdline_include_paths = includePaths dflags let pic_c_flags = picCCOpts dflags next_phase <- maybeMergeStub output_fn <- phaseOutputFilename next_phase -- we create directories for the object file, because it -- might be a hierarchical module. liftIO $ createDirectoryIfMissing True (takeDirectory output_fn) ccInfo <- liftIO $ getCompilerInfo dflags let runAssembler inputFilename outputFilename = liftIO $ as_prog dflags ([ SysTools.Option ("-I" ++ p) | p <- cmdline_include_paths ] -- See Note [-fPIC for assembler] ++ map SysTools.Option pic_c_flags -- We only support SparcV9 and better because V8 lacks an atomic CAS -- instruction so we have to make sure that the assembler accepts the -- instruction set. Note that the user can still override this -- (e.g., -mcpu=ultrasparc). GCC picks the "best" -mcpu flag -- regardless of the ordering. -- -- This is a temporary hack. ++ (if platformArch (targetPlatform dflags) == ArchSPARC then [SysTools.Option "-mcpu=v9"] else []) ++ (if any (ccInfo ==) [Clang, AppleClang, AppleClang51] then [SysTools.Option "-Qunused-arguments"] else []) ++ [ SysTools.Option "-x" , if with_cpp then SysTools.Option "assembler-with-cpp" else SysTools.Option "assembler" , SysTools.Option "-c" , SysTools.FileOption "" inputFilename , SysTools.Option "-o" , SysTools.FileOption "" outputFilename ]) liftIO $ debugTraceMsg dflags 4 (text "Running the assembler") runAssembler input_fn output_fn return (RealPhase next_phase, output_fn) -- This is for calling the assembler on a split assembly file (so a collection -- of assembly files) runPhase (RealPhase SplitAs) _input_fn dflags = do -- we'll handle the stub_o file in this phase, so don't MergeStub, -- just jump straight to StopLn afterwards. let next_phase = StopLn output_fn <- phaseOutputFilename next_phase let base_o = dropExtension output_fn osuf = objectSuf dflags split_odir = base_o ++ "_" ++ osuf ++ "_split" let pic_c_flags = picCCOpts dflags -- this also creates the hierarchy liftIO $ createDirectoryIfMissing True split_odir -- remove M_split/ *.o, because we're going to archive M_split/ *.o -- later and we don't want to pick up any old objects. fs <- liftIO $ getDirectoryContents split_odir liftIO $ mapM_ removeFile $ map (split_odir </>) $ filter (osuf `isSuffixOf`) fs let (split_s_prefix, n) = case splitInfo dflags of Nothing -> panic "No split info" Just x -> x let split_s n = split_s_prefix ++ "__" ++ show n <.> "s" split_obj :: Int -> FilePath split_obj n = split_odir </> takeFileName base_o ++ "__" ++ show n <.> osuf let assemble_file n = SysTools.runAs dflags ( -- We only support SparcV9 and better because V8 lacks an atomic CAS -- instruction so we have to make sure that the assembler accepts the -- instruction set. Note that the user can still override this -- (e.g., -mcpu=ultrasparc). GCC picks the "best" -mcpu flag -- regardless of the ordering. -- -- This is a temporary hack. (if platformArch (targetPlatform dflags) == ArchSPARC then [SysTools.Option "-mcpu=v9"] else []) ++ -- See Note [-fPIC for assembler] map SysTools.Option pic_c_flags ++ [ SysTools.Option "-c" , SysTools.Option "-o" , SysTools.FileOption "" (split_obj n) , SysTools.FileOption "" (split_s n) ]) liftIO $ mapM_ assemble_file [1..n] -- Note [pipeline-split-init] -- If we have a stub file, it may contain constructor -- functions for initialisation of this module. We can't -- simply leave the stub as a separate object file, because it -- will never be linked in: nothing refers to it. We need to -- ensure that if we ever refer to the data in this module -- that needs initialisation, then we also pull in the -- initialisation routine. -- -- To that end, we make a DANGEROUS ASSUMPTION here: the data -- that needs to be initialised is all in the FIRST split -- object. See Note [codegen-split-init]. PipeState{maybe_stub_o} <- getPipeState case maybe_stub_o of Nothing -> return () Just stub_o -> liftIO $ do tmp_split_1 <- newTempName dflags osuf let split_1 = split_obj 1 copyFile split_1 tmp_split_1 removeFile split_1 joinObjectFiles dflags [tmp_split_1, stub_o] split_1 -- join them into a single .o file liftIO $ joinObjectFiles dflags (map split_obj [1..n]) output_fn return (RealPhase next_phase, output_fn) ----------------------------------------------------------------------------- -- LlvmOpt phase runPhase (RealPhase LlvmOpt) input_fn dflags = do ver <- liftIO $ readIORef (llvmVersion dflags) let opt_lvl = max 0 (min 2 $ optLevel dflags) -- don't specify anything if user has specified commands. We do this -- for opt but not llc since opt is very specifically for optimisation -- passes only, so if the user is passing us extra options we assume -- they know what they are doing and don't get in the way. optFlag = if null (getOpts dflags opt_lo) then map SysTools.Option $ words (llvmOpts ver !! opt_lvl) else [] tbaa | ver < 29 = "" -- no tbaa in 2.8 and earlier | gopt Opt_LlvmTBAA dflags = "--enable-tbaa=true" | otherwise = "--enable-tbaa=false" output_fn <- phaseOutputFilename LlvmLlc liftIO $ SysTools.runLlvmOpt dflags ([ SysTools.FileOption "" input_fn, SysTools.Option "-o", SysTools.FileOption "" output_fn] ++ optFlag ++ [SysTools.Option tbaa]) return (RealPhase LlvmLlc, output_fn) where -- we always (unless -optlo specified) run Opt since we rely on it to -- fix up some pretty big deficiencies in the code we generate llvmOpts ver = [ "-mem2reg -globalopt" , if ver >= 34 then "-O1 -globalopt" else "-O1" -- LLVM 3.4 -O1 doesn't eliminate aliases reliably (bug #8855) , "-O2" ] ----------------------------------------------------------------------------- -- LlvmLlc phase runPhase (RealPhase LlvmLlc) input_fn dflags = do ver <- liftIO $ readIORef (llvmVersion dflags) let opt_lvl = max 0 (min 2 $ optLevel dflags) -- iOS requires external references to be loaded indirectly from the -- DATA segment or dyld traps at runtime writing into TEXT: see #7722 rmodel | platformOS (targetPlatform dflags) == OSiOS = "dynamic-no-pic" | gopt Opt_PIC dflags = "pic" | not (gopt Opt_Static dflags) = "dynamic-no-pic" | otherwise = "static" tbaa | ver < 29 = "" -- no tbaa in 2.8 and earlier | gopt Opt_LlvmTBAA dflags = "--enable-tbaa=true" | otherwise = "--enable-tbaa=false" -- hidden debugging flag '-dno-llvm-mangler' to skip mangling let next_phase = case gopt Opt_NoLlvmMangler dflags of False -> LlvmMangle True | gopt Opt_SplitObjs dflags -> Splitter True -> As False output_fn <- phaseOutputFilename next_phase liftIO $ SysTools.runLlvmLlc dflags ([ SysTools.Option (llvmOpts !! opt_lvl), SysTools.Option $ "-relocation-model=" ++ rmodel, SysTools.FileOption "" input_fn, SysTools.Option "-o", SysTools.FileOption "" output_fn] ++ [SysTools.Option tbaa] ++ map SysTools.Option fpOpts ++ map SysTools.Option abiOpts ++ map SysTools.Option sseOpts ++ map SysTools.Option avxOpts ++ map SysTools.Option avx512Opts ++ map SysTools.Option stackAlignOpts) return (RealPhase next_phase, output_fn) where -- Bug in LLVM at O3 on OSX. llvmOpts = if platformOS (targetPlatform dflags) == OSDarwin then ["-O1", "-O2", "-O2"] else ["-O1", "-O2", "-O3"] -- On ARMv7 using LLVM, LLVM fails to allocate floating point registers -- while compiling GHC source code. It's probably due to fact that it -- does not enable VFP by default. Let's do this manually here fpOpts = case platformArch (targetPlatform dflags) of ArchARM ARMv7 ext _ -> if (elem VFPv3 ext) then ["-mattr=+v7,+vfp3"] else if (elem VFPv3D16 ext) then ["-mattr=+v7,+vfp3,+d16"] else [] ArchARM ARMv6 ext _ -> if (elem VFPv2 ext) then ["-mattr=+v6,+vfp2"] else ["-mattr=+v6"] _ -> [] -- On Ubuntu/Debian with ARM hard float ABI, LLVM's llc still -- compiles into soft-float ABI. We need to explicitly set abi -- to hard abiOpts = case platformArch (targetPlatform dflags) of ArchARM _ _ HARD -> ["-float-abi=hard"] ArchARM _ _ _ -> [] _ -> [] sseOpts | isSse4_2Enabled dflags = ["-mattr=+sse42"] | isSse2Enabled dflags = ["-mattr=+sse2"] | isSseEnabled dflags = ["-mattr=+sse"] | otherwise = [] avxOpts | isAvx512fEnabled dflags = ["-mattr=+avx512f"] | isAvx2Enabled dflags = ["-mattr=+avx2"] | isAvxEnabled dflags = ["-mattr=+avx"] | otherwise = [] avx512Opts = [ "-mattr=+avx512cd" | isAvx512cdEnabled dflags ] ++ [ "-mattr=+avx512er" | isAvx512erEnabled dflags ] ++ [ "-mattr=+avx512pf" | isAvx512pfEnabled dflags ] stackAlignOpts = case platformArch (targetPlatform dflags) of ArchX86_64 | isAvxEnabled dflags -> ["-stack-alignment=32"] _ -> [] ----------------------------------------------------------------------------- -- LlvmMangle phase runPhase (RealPhase LlvmMangle) input_fn dflags = do let next_phase = if gopt Opt_SplitObjs dflags then Splitter else As False output_fn <- phaseOutputFilename next_phase liftIO $ llvmFixupAsm dflags input_fn output_fn return (RealPhase next_phase, output_fn) ----------------------------------------------------------------------------- -- merge in stub objects runPhase (RealPhase MergeStub) input_fn dflags = do PipeState{maybe_stub_o} <- getPipeState output_fn <- phaseOutputFilename StopLn liftIO $ createDirectoryIfMissing True (takeDirectory output_fn) case maybe_stub_o of Nothing -> panic "runPhase(MergeStub): no stub" Just stub_o -> do liftIO $ joinObjectFiles dflags [input_fn, stub_o] output_fn return (RealPhase StopLn, output_fn) -- warning suppression runPhase (RealPhase other) _input_fn _dflags = panic ("runPhase: don't know how to run phase " ++ show other) maybeMergeStub :: CompPipeline Phase maybeMergeStub = do PipeState{maybe_stub_o} <- getPipeState if isJust maybe_stub_o then return MergeStub else return StopLn getLocation :: HscSource -> ModuleName -> CompPipeline ModLocation getLocation src_flavour mod_name = do dflags <- getDynFlags PipeEnv{ src_basename=basename, src_suffix=suff } <- getPipeEnv -- Build a ModLocation to pass to hscMain. -- The source filename is rather irrelevant by now, but it's used -- by hscMain for messages. hscMain also needs -- the .hi and .o filenames, and this is as good a way -- as any to generate them, and better than most. (e.g. takes -- into account the -osuf flags) location1 <- liftIO $ mkHomeModLocation2 dflags mod_name basename suff -- Boot-ify it if necessary let location2 | isHsBoot src_flavour = addBootSuffixLocn location1 | otherwise = location1 -- Take -ohi into account if present -- This can't be done in mkHomeModuleLocation because -- it only applies to the module being compiles let ohi = outputHi dflags location3 | Just fn <- ohi = location2{ ml_hi_file = fn } | otherwise = location2 -- Take -o into account if present -- Very like -ohi, but we must *only* do this if we aren't linking -- (If we're linking then the -o applies to the linked thing, not to -- the object file for one module.) -- Note the nasty duplication with the same computation in compileFile above let expl_o_file = outputFile dflags location4 | Just ofile <- expl_o_file , isNoLink (ghcLink dflags) = location3 { ml_obj_file = ofile } | otherwise = location3 return location4 ----------------------------------------------------------------------------- -- MoveBinary sort-of-phase -- After having produced a binary, move it somewhere else and generate a -- wrapper script calling the binary. Currently, we need this only in -- a parallel way (i.e. in GUM), because PVM expects the binary in a -- central directory. -- This is called from linkBinary below, after linking. I haven't made it -- a separate phase to minimise interfering with other modules, and -- we don't need the generality of a phase (MoveBinary is always -- done after linking and makes only sense in a parallel setup) -- HWL runPhase_MoveBinary :: DynFlags -> FilePath -> IO Bool runPhase_MoveBinary dflags input_fn | WayPar `elem` ways dflags && not (gopt Opt_Static dflags) = panic ("Don't know how to combine PVM wrapper and dynamic wrapper") | WayPar `elem` ways dflags = do let sysMan = pgm_sysman dflags pvm_root <- getEnv "PVM_ROOT" pvm_arch <- getEnv "PVM_ARCH" let pvm_executable_base = "=" ++ input_fn pvm_executable = pvm_root ++ "/bin/" ++ pvm_arch ++ "/" ++ pvm_executable_base -- nuke old binary; maybe use configur'ed names for cp and rm? _ <- tryIO (removeFile pvm_executable) -- move the newly created binary into PVM land copy dflags "copying PVM executable" input_fn pvm_executable -- generate a wrapper script for running a parallel prg under PVM writeFile input_fn (mk_pvm_wrapper_script pvm_executable pvm_executable_base sysMan) return True | otherwise = return True mkExtraObj :: DynFlags -> Suffix -> String -> IO FilePath mkExtraObj dflags extn xs = do cFile <- newTempName dflags extn oFile <- newTempName dflags "o" writeFile cFile xs let rtsDetails = getPackageDetails (pkgState dflags) rtsPackageId SysTools.runCc dflags ([Option "-c", FileOption "" cFile, Option "-o", FileOption "" oFile] ++ map (FileOption "-I") (includeDirs rtsDetails)) return oFile -- When linking a binary, we need to create a C main() function that -- starts everything off. This used to be compiled statically as part -- of the RTS, but that made it hard to change the -rtsopts setting, -- so now we generate and compile a main() stub as part of every -- binary and pass the -rtsopts setting directly to the RTS (#5373) -- mkExtraObjToLinkIntoBinary :: DynFlags -> IO FilePath mkExtraObjToLinkIntoBinary dflags = do when (gopt Opt_NoHsMain dflags && haveRtsOptsFlags dflags) $ do log_action dflags dflags SevInfo noSrcSpan defaultUserStyle (text "Warning: -rtsopts and -with-rtsopts have no effect with -no-hs-main." $$ text " Call hs_init_ghc() from your main() function to set these options.") mkExtraObj dflags "c" (showSDoc dflags main) where main | gopt Opt_NoHsMain dflags = empty | otherwise = vcat [ ptext (sLit "#include \"Rts.h\""), ptext (sLit "extern StgClosure ZCMain_main_closure;"), ptext (sLit "int main(int argc, char *argv[])"), char '{', ptext (sLit " RtsConfig __conf = defaultRtsConfig;"), ptext (sLit " __conf.rts_opts_enabled = ") <> text (show (rtsOptsEnabled dflags)) <> semi, case rtsOpts dflags of Nothing -> empty Just opts -> ptext (sLit " __conf.rts_opts= ") <> text (show opts) <> semi, ptext (sLit " __conf.rts_hs_main = rtsTrue;"), ptext (sLit " return hs_main(argc, argv, &ZCMain_main_closure,__conf);"), char '}', char '\n' -- final newline, to keep gcc happy ] -- Write out the link info section into a new assembly file. Previously -- this was included as inline assembly in the main.c file but this -- is pretty fragile. gas gets upset trying to calculate relative offsets -- that span the .note section (notably .text) when debug info is present mkNoteObjsToLinkIntoBinary :: DynFlags -> [PackageId] -> IO [FilePath] mkNoteObjsToLinkIntoBinary dflags dep_packages = do link_info <- getLinkInfo dflags dep_packages if (platformSupportsSavingLinkOpts (platformOS (targetPlatform dflags))) then fmap (:[]) $ mkExtraObj dflags "s" (showSDoc dflags (link_opts link_info)) else return [] where link_opts info = hcat [ text "\t.section ", text ghcLinkInfoSectionName, text ",\"\",", text elfSectionNote, text "\n", text "\t.ascii \"", info', text "\"\n", -- ALL generated assembly must have this section to disable -- executable stacks. See also -- compiler/nativeGen/AsmCodeGen.lhs for another instance -- where we need to do this. (if platformHasGnuNonexecStack (targetPlatform dflags) then text ".section .note.GNU-stack,\"\",@progbits\n" else empty) ] where info' = text $ escape info escape :: String -> String escape = concatMap (charToC.fromIntegral.ord) elfSectionNote :: String elfSectionNote = case platformArch (targetPlatform dflags) of ArchARM _ _ _ -> "%note" _ -> "@note" -- The "link info" is a string representing the parameters of the -- link. We save this information in the binary, and the next time we -- link, if nothing else has changed, we use the link info stored in -- the existing binary to decide whether to re-link or not. getLinkInfo :: DynFlags -> [PackageId] -> IO String getLinkInfo dflags dep_packages = do package_link_opts <- getPackageLinkOpts dflags dep_packages pkg_frameworks <- if platformUsesFrameworks (targetPlatform dflags) then getPackageFrameworks dflags dep_packages else return [] let extra_ld_inputs = ldInputs dflags let link_info = (package_link_opts, pkg_frameworks, rtsOpts dflags, rtsOptsEnabled dflags, gopt Opt_NoHsMain dflags, map showOpt extra_ld_inputs, getOpts dflags opt_l) -- return (show link_info) -- generates a Perl skript starting a parallel prg under PVM mk_pvm_wrapper_script :: String -> String -> String -> String mk_pvm_wrapper_script pvm_executable pvm_executable_base sysMan = unlines $ [ "eval 'exec perl -S $0 ${1+\"$@\"}'", " if $running_under_some_shell;", "# =!=!=!=!=!=!=!=!=!=!=!", "# This script is automatically generated: DO NOT EDIT!!!", "# Generated by Glasgow Haskell Compiler", "# ngoqvam choHbogh vaj' vIHoHnISbej !!!!", "#", "$pvm_executable = '" ++ pvm_executable ++ "';", "$pvm_executable_base = '" ++ pvm_executable_base ++ "';", "$SysMan = '" ++ sysMan ++ "';", "", {- ToDo: add the magical shortcuts again iff we actually use them -- HWL "# first, some magical shortcuts to run "commands" on the binary", "# (which is hidden)", "if ($#ARGV == 1 && $ARGV[0] eq '+RTS' && $ARGV[1] =~ /^--((size|file|strip|rm|nm).*)/ ) {", " local($cmd) = $1;", " system("$cmd $pvm_executable");", " exit(0); # all done", "}", -} "", "# Now, run the real binary; process the args first", "$ENV{'PE'} = $pvm_executable_base;", -- ++ pvm_executable_base, "$debug = '';", "$nprocessors = 0; # the default: as many PEs as machines in PVM config", "@nonPVM_args = ();", "$in_RTS_args = 0;", "", "args: while ($a = shift(@ARGV)) {", " if ( $a eq '+RTS' ) {", " $in_RTS_args = 1;", " } elsif ( $a eq '-RTS' ) {", " $in_RTS_args = 0;", " }", " if ( $a eq '-d' && $in_RTS_args ) {", " $debug = '-';", " } elsif ( $a =~ /^-qN(\\d+)/ && $in_RTS_args ) {", " $nprocessors = $1;", " } elsif ( $a =~ /^-qp(\\d+)/ && $in_RTS_args ) {", " $nprocessors = $1;", " } else {", " push(@nonPVM_args, $a);", " }", "}", "", "local($return_val) = 0;", "# Start the parallel execution by calling SysMan", "system(\"$SysMan $debug $pvm_executable $nprocessors @nonPVM_args\");", "$return_val = $?;", "# ToDo: fix race condition moving files and flushing them!!", "system(\"cp $ENV{'HOME'}/$pvm_executable_base.???.gr .\") if -f \"$ENV{'HOME'}/$pvm_executable_base.002.gr\";", "exit($return_val);" ] ----------------------------------------------------------------------------- -- Look for the /* GHC_PACKAGES ... */ comment at the top of a .hc file getHCFilePackages :: FilePath -> IO [PackageId] getHCFilePackages filename = Exception.bracket (openFile filename ReadMode) hClose $ \h -> do l <- hGetLine h case l of '/':'*':' ':'G':'H':'C':'_':'P':'A':'C':'K':'A':'G':'E':'S':rest -> return (map stringToPackageId (words rest)) _other -> return [] ----------------------------------------------------------------------------- -- Static linking, of .o files -- The list of packages passed to link is the list of packages on -- which this program depends, as discovered by the compilation -- manager. It is combined with the list of packages that the user -- specifies on the command line with -package flags. -- -- In one-shot linking mode, we can't discover the package -- dependencies (because we haven't actually done any compilation or -- read any interface files), so the user must explicitly specify all -- the packages. linkBinary :: DynFlags -> [FilePath] -> [PackageId] -> IO () linkBinary = linkBinary' False linkBinary' :: Bool -> DynFlags -> [FilePath] -> [PackageId] -> IO () linkBinary' staticLink dflags o_files dep_packages = do let platform = targetPlatform dflags mySettings = settings dflags verbFlags = getVerbFlags dflags output_fn = exeFileName staticLink dflags -- get the full list of packages to link with, by combining the -- explicit packages with the auto packages and all of their -- dependencies, and eliminating duplicates. full_output_fn <- if isAbsolute output_fn then return output_fn else do d <- getCurrentDirectory return $ normalise (d </> output_fn) pkg_lib_paths <- getPackageLibraryPath dflags dep_packages let pkg_lib_path_opts = concatMap get_pkg_lib_path_opts pkg_lib_paths get_pkg_lib_path_opts l | osElfTarget (platformOS platform) && dynLibLoader dflags == SystemDependent && not (gopt Opt_Static dflags) = let libpath = if gopt Opt_RelativeDynlibPaths dflags then "$ORIGIN" </> (l `makeRelativeTo` full_output_fn) else l rpath = if gopt Opt_RPath dflags then ["-Wl,-rpath", "-Wl," ++ libpath] else [] -- Solaris 11's linker does not support -rpath-link option. It silently -- ignores it and then complains about next option which is -l<some -- dir> as being a directory and not expected object file, E.g -- ld: elf error: file -- /tmp/ghc-src/libraries/base/dist-install/build: -- elf_begin: I/O error: region read: Is a directory rpathlink = if (platformOS platform) == OSSolaris2 then [] else ["-Wl,-rpath-link", "-Wl," ++ l] in ["-L" ++ l] ++ rpathlink ++ rpath | osMachOTarget (platformOS platform) && dynLibLoader dflags == SystemDependent && not (gopt Opt_Static dflags) && gopt Opt_RPath dflags = let libpath = if gopt Opt_RelativeDynlibPaths dflags then "@loader_path" </> (l `makeRelativeTo` full_output_fn) else l in ["-L" ++ l] ++ ["-Wl,-rpath", "-Wl," ++ libpath] | otherwise = ["-L" ++ l] let lib_paths = libraryPaths dflags let lib_path_opts = map ("-L"++) lib_paths extraLinkObj <- mkExtraObjToLinkIntoBinary dflags noteLinkObjs <- mkNoteObjsToLinkIntoBinary dflags dep_packages pkg_link_opts <- do (package_hs_libs, extra_libs, other_flags) <- getPackageLinkOpts dflags dep_packages return $ if staticLink then package_hs_libs -- If building an executable really means making a static -- library (e.g. iOS), then we only keep the -l options for -- HS packages, because libtool doesn't accept other options. -- In the case of iOS these need to be added by hand to the -- final link in Xcode. else other_flags ++ package_hs_libs ++ extra_libs -- -Wl,-u,<sym> contained in other_flags -- needs to be put before -l<package>, -- otherwise Solaris linker fails linking -- a binary with unresolved symbols in RTS -- which are defined in base package -- the reason for this is a note in ld(1) about -- '-u' option: "The placement of this option -- on the command line is significant. -- This option must be placed before the library -- that defines the symbol." pkg_framework_path_opts <- if platformUsesFrameworks platform then do pkg_framework_paths <- getPackageFrameworkPath dflags dep_packages return $ map ("-F" ++) pkg_framework_paths else return [] framework_path_opts <- if platformUsesFrameworks platform then do let framework_paths = frameworkPaths dflags return $ map ("-F" ++) framework_paths else return [] pkg_framework_opts <- if platformUsesFrameworks platform then do pkg_frameworks <- getPackageFrameworks dflags dep_packages return $ concat [ ["-framework", fw] | fw <- pkg_frameworks ] else return [] framework_opts <- if platformUsesFrameworks platform then do let frameworks = cmdlineFrameworks dflags -- reverse because they're added in reverse order from -- the cmd line: return $ concat [ ["-framework", fw] | fw <- reverse frameworks ] else return [] -- probably _stub.o files let extra_ld_inputs = ldInputs dflags -- Here are some libs that need to be linked at the *end* of -- the command line, because they contain symbols that are referred to -- by the RTS. We can't therefore use the ordinary way opts for these. let debug_opts | WayDebug `elem` ways dflags = [ #if defined(HAVE_LIBBFD) "-lbfd", "-liberty" #endif ] | otherwise = [] let thread_opts | WayThreaded `elem` ways dflags = let os = platformOS (targetPlatform dflags) in if os == OSOsf3 then ["-lpthread", "-lexc"] else if os `elem` [OSMinGW32, OSFreeBSD, OSOpenBSD, OSNetBSD, OSHaiku, OSQNXNTO, OSiOS] then [] else ["-lpthread"] | otherwise = [] rc_objs <- maybeCreateManifest dflags output_fn let link = if staticLink then SysTools.runLibtool else SysTools.runLink link dflags ( map SysTools.Option verbFlags ++ [ SysTools.Option "-o" , SysTools.FileOption "" output_fn ] ++ map SysTools.Option ( [] -- Permit the linker to auto link _symbol to _imp_symbol. -- This lets us link against DLLs without needing an "import library". ++ (if platformOS platform == OSMinGW32 then ["-Wl,--enable-auto-import"] else []) -- '-no_compact_unwind' -- C++/Objective-C exceptions cannot use optimised -- stack unwinding code. The optimised form is the -- default in Xcode 4 on at least x86_64, and -- without this flag we're also seeing warnings -- like -- ld: warning: could not create compact unwind for .LFB3: non-standard register 5 being saved in prolog -- on x86. ++ (if sLdSupportsCompactUnwind mySettings && not staticLink && (platformOS platform == OSDarwin || platformOS platform == OSiOS) && case platformArch platform of ArchX86 -> True ArchX86_64 -> True ArchARM {} -> True _ -> False then ["-Wl,-no_compact_unwind"] else []) -- '-no_pie' -- iOS uses 'dynamic-no-pic', so we must pass this to ld to suppress a warning; see #7722 ++ (if platformOS platform == OSiOS && not staticLink then ["-Wl,-no_pie"] else []) -- '-Wl,-read_only_relocs,suppress' -- ld gives loads of warnings like: -- ld: warning: text reloc in _base_GHCziArr_unsafeArray_info to _base_GHCziArr_unsafeArray_closure -- when linking any program. We're not sure -- whether this is something we ought to fix, but -- for now this flags silences them. ++ (if platformOS platform == OSDarwin && platformArch platform == ArchX86 && not staticLink then ["-Wl,-read_only_relocs,suppress"] else []) ++ o_files ++ lib_path_opts) ++ extra_ld_inputs ++ map SysTools.Option ( rc_objs ++ framework_path_opts ++ framework_opts ++ pkg_lib_path_opts ++ extraLinkObj:noteLinkObjs ++ pkg_link_opts ++ pkg_framework_path_opts ++ pkg_framework_opts ++ debug_opts ++ thread_opts )) -- parallel only: move binary to another dir -- HWL success <- runPhase_MoveBinary dflags output_fn unless success $ throwGhcExceptionIO (InstallationError ("cannot move binary")) exeFileName :: Bool -> DynFlags -> FilePath exeFileName staticLink dflags | Just s <- outputFile dflags = case platformOS (targetPlatform dflags) of OSMinGW32 -> s <?.> "exe" _ -> if staticLink then s <?.> "a" else s | otherwise = if platformOS (targetPlatform dflags) == OSMinGW32 then "main.exe" else if staticLink then "liba.a" else "a.out" where s <?.> ext | null (takeExtension s) = s <.> ext | otherwise = s maybeCreateManifest :: DynFlags -> FilePath -- filename of executable -> IO [FilePath] -- extra objects to embed, maybe maybeCreateManifest dflags exe_filename | platformOS (targetPlatform dflags) == OSMinGW32 && gopt Opt_GenManifest dflags = do let manifest_filename = exe_filename <.> "manifest" writeFile manifest_filename $ "<?xml version=\"1.0\" encoding=\"UTF-8\" standalone=\"yes\"?>\n"++ " <assembly xmlns=\"urn:schemas-microsoft-com:asm.v1\" manifestVersion=\"1.0\">\n"++ " <assemblyIdentity version=\"1.0.0.0\"\n"++ " processorArchitecture=\"X86\"\n"++ " name=\"" ++ dropExtension exe_filename ++ "\"\n"++ " type=\"win32\"/>\n\n"++ " <trustInfo xmlns=\"urn:schemas-microsoft-com:asm.v3\">\n"++ " <security>\n"++ " <requestedPrivileges>\n"++ " <requestedExecutionLevel level=\"asInvoker\" uiAccess=\"false\"/>\n"++ " </requestedPrivileges>\n"++ " </security>\n"++ " </trustInfo>\n"++ "</assembly>\n" -- Windows will find the manifest file if it is named -- foo.exe.manifest. However, for extra robustness, and so that -- we can move the binary around, we can embed the manifest in -- the binary itself using windres: if not (gopt Opt_EmbedManifest dflags) then return [] else do rc_filename <- newTempName dflags "rc" rc_obj_filename <- newTempName dflags (objectSuf dflags) writeFile rc_filename $ "1 24 MOVEABLE PURE " ++ show manifest_filename ++ "\n" -- magic numbers :-) -- show is a bit hackish above, but we need to escape the -- backslashes in the path. runWindres dflags $ map SysTools.Option $ ["--input="++rc_filename, "--output="++rc_obj_filename, "--output-format=coff"] -- no FileOptions here: windres doesn't like seeing -- backslashes, apparently removeFile manifest_filename return [rc_obj_filename] | otherwise = return [] linkDynLibCheck :: DynFlags -> [String] -> [PackageId] -> IO () linkDynLibCheck dflags o_files dep_packages = do when (haveRtsOptsFlags dflags) $ do log_action dflags dflags SevInfo noSrcSpan defaultUserStyle (text "Warning: -rtsopts and -with-rtsopts have no effect with -shared." $$ text " Call hs_init_ghc() from your main() function to set these options.") linkDynLib dflags o_files dep_packages linkStaticLibCheck :: DynFlags -> [String] -> [PackageId] -> IO () linkStaticLibCheck dflags o_files dep_packages = do when (platformOS (targetPlatform dflags) `notElem` [OSiOS, OSDarwin]) $ throwGhcExceptionIO (ProgramError "Static archive creation only supported on Darwin/OS X/iOS") linkBinary' True dflags o_files dep_packages -- ----------------------------------------------------------------------------- -- Running CPP doCpp :: DynFlags -> Bool -> FilePath -> FilePath -> IO () doCpp dflags raw input_fn output_fn = do let hscpp_opts = picPOpts dflags let cmdline_include_paths = includePaths dflags pkg_include_dirs <- getPackageIncludePath dflags [] let include_paths = foldr (\ x xs -> "-I" : x : xs) [] (cmdline_include_paths ++ pkg_include_dirs) let verbFlags = getVerbFlags dflags let cpp_prog args | raw = SysTools.runCpp dflags args | otherwise = SysTools.runCc dflags (SysTools.Option "-E" : args) let target_defs = [ "-D" ++ HOST_OS ++ "_BUILD_OS=1", "-D" ++ HOST_ARCH ++ "_BUILD_ARCH=1", "-D" ++ TARGET_OS ++ "_HOST_OS=1", "-D" ++ TARGET_ARCH ++ "_HOST_ARCH=1" ] -- remember, in code we *compile*, the HOST is the same our TARGET, -- and BUILD is the same as our HOST. let sse_defs = [ "-D__SSE__=1" | isSseEnabled dflags ] ++ [ "-D__SSE2__=1" | isSse2Enabled dflags ] ++ [ "-D__SSE4_2__=1" | isSse4_2Enabled dflags ] let avx_defs = [ "-D__AVX__=1" | isAvxEnabled dflags ] ++ [ "-D__AVX2__=1" | isAvx2Enabled dflags ] ++ [ "-D__AVX512CD__=1" | isAvx512cdEnabled dflags ] ++ [ "-D__AVX512ER__=1" | isAvx512erEnabled dflags ] ++ [ "-D__AVX512F__=1" | isAvx512fEnabled dflags ] ++ [ "-D__AVX512PF__=1" | isAvx512pfEnabled dflags ] backend_defs <- getBackendDefs dflags cpp_prog ( map SysTools.Option verbFlags ++ map SysTools.Option include_paths ++ map SysTools.Option hsSourceCppOpts ++ map SysTools.Option target_defs ++ map SysTools.Option backend_defs ++ map SysTools.Option hscpp_opts ++ map SysTools.Option sse_defs ++ map SysTools.Option avx_defs -- Set the language mode to assembler-with-cpp when preprocessing. This -- alleviates some of the C99 macro rules relating to whitespace and the hash -- operator, which we tend to abuse. Clang in particular is not very happy -- about this. ++ [ SysTools.Option "-x" , SysTools.Option "assembler-with-cpp" , SysTools.Option input_fn -- We hackily use Option instead of FileOption here, so that the file -- name is not back-slashed on Windows. cpp is capable of -- dealing with / in filenames, so it works fine. Furthermore -- if we put in backslashes, cpp outputs #line directives -- with *double* backslashes. And that in turn means that -- our error messages get double backslashes in them. -- In due course we should arrange that the lexer deals -- with these \\ escapes properly. , SysTools.Option "-o" , SysTools.FileOption "" output_fn ]) getBackendDefs :: DynFlags -> IO [String] getBackendDefs dflags | hscTarget dflags == HscLlvm = do llvmVer <- figureLlvmVersion dflags return $ case llvmVer of Just n -> [ "-D__GLASGOW_HASKELL_LLVM__="++show n ] _ -> [] getBackendDefs _ = return [] hsSourceCppOpts :: [String] -- Default CPP defines in Haskell source hsSourceCppOpts = [ "-D__GLASGOW_HASKELL__="++cProjectVersionInt ] -- --------------------------------------------------------------------------- -- join object files into a single relocatable object file, using ld -r joinObjectFiles :: DynFlags -> [FilePath] -> FilePath -> IO () joinObjectFiles dflags o_files output_fn = do let mySettings = settings dflags ldIsGnuLd = sLdIsGnuLd mySettings osInfo = platformOS (targetPlatform dflags) ld_r args cc = SysTools.runLink dflags ([ SysTools.Option "-nostdlib", SysTools.Option "-Wl,-r" ] ++ (if any (cc ==) [Clang, AppleClang, AppleClang51] then [] else [SysTools.Option "-nodefaultlibs"]) ++ (if osInfo == OSFreeBSD then [SysTools.Option "-L/usr/lib"] else []) -- gcc on sparc sets -Wl,--relax implicitly, but -- -r and --relax are incompatible for ld, so -- disable --relax explicitly. ++ (if platformArch (targetPlatform dflags) == ArchSPARC && ldIsGnuLd then [SysTools.Option "-Wl,-no-relax"] else []) ++ map SysTools.Option ld_build_id ++ [ SysTools.Option "-o", SysTools.FileOption "" output_fn ] ++ args) -- suppress the generation of the .note.gnu.build-id section, -- which we don't need and sometimes causes ld to emit a -- warning: ld_build_id | sLdSupportsBuildId mySettings = ["-Wl,--build-id=none"] | otherwise = [] ccInfo <- getCompilerInfo dflags if ldIsGnuLd then do script <- newTempName dflags "ldscript" writeFile script $ "INPUT(" ++ unwords o_files ++ ")" ld_r [SysTools.FileOption "" script] ccInfo else if sLdSupportsFilelist mySettings then do filelist <- newTempName dflags "filelist" writeFile filelist $ unlines o_files ld_r [SysTools.Option "-Wl,-filelist", SysTools.FileOption "-Wl," filelist] ccInfo else do ld_r (map (SysTools.FileOption "") o_files) ccInfo -- ----------------------------------------------------------------------------- -- Misc. -- | What phase to run after one of the backend code generators has run hscPostBackendPhase :: DynFlags -> HscSource -> HscTarget -> Phase hscPostBackendPhase _ HsBootFile _ = StopLn hscPostBackendPhase dflags _ hsc_lang = case hsc_lang of HscC -> HCc HscAsm | gopt Opt_SplitObjs dflags -> Splitter | otherwise -> As False HscLlvm -> LlvmOpt HscNothing -> StopLn HscInterpreted -> StopLn touchObjectFile :: DynFlags -> FilePath -> IO () touchObjectFile dflags path = do createDirectoryIfMissing True $ takeDirectory path SysTools.touch dflags "Touching object file" path haveRtsOptsFlags :: DynFlags -> Bool haveRtsOptsFlags dflags = isJust (rtsOpts dflags) || case rtsOptsEnabled dflags of RtsOptsSafeOnly -> False _ -> True -- Note [-fPIC for assembler] -- When compiling .c source file GHC's driver pipeline basically -- does the following two things: -- 1. ${CC} -S 'PIC_CFLAGS' source.c -- 2. ${CC} -x assembler -c 'PIC_CFLAGS' source.S -- -- Why do we need to pass 'PIC_CFLAGS' both to C compiler and assembler? -- Because on some architectures (at least sparc32) assembler also choses -- relocation type! -- Consider the following C module: -- -- /* pic-sample.c */ -- int v; -- void set_v (int n) { v = n; } -- int get_v (void) { return v; } -- -- $ gcc -S -fPIC pic-sample.c -- $ gcc -c pic-sample.s -o pic-sample.no-pic.o # incorrect binary -- $ gcc -c -fPIC pic-sample.s -o pic-sample.pic.o # correct binary -- -- $ objdump -r -d pic-sample.pic.o > pic-sample.pic.o.od -- $ objdump -r -d pic-sample.no-pic.o > pic-sample.no-pic.o.od -- $ diff -u pic-sample.pic.o.od pic-sample.no-pic.o.od -- -- Most of architectures won't show any difference in this test, but on sparc32 -- the following assembly snippet: -- -- sethi %hi(_GLOBAL_OFFSET_TABLE_-8), %l7 -- -- generates two kinds or relocations, only 'R_SPARC_PC22' is correct: -- -- 3c: 2f 00 00 00 sethi %hi(0), %l7 -- - 3c: R_SPARC_PC22 _GLOBAL_OFFSET_TABLE_-0x8 -- + 3c: R_SPARC_HI22 _GLOBAL_OFFSET_TABLE_-0x8
hferreiro/replay
compiler/main/DriverPipeline.hs
bsd-3-clause
98,996
3
31
34,515
16,063
8,127
7,936
-1
-1
{-# OPTIONS_GHC -fno-warn-orphans #-} {-# LANGUAGE DataKinds #-} {-# LANGUAGE KindSignatures #-} {-# LANGUAGE TypeOperators #-} {-# LANGUAGE QuasiQuotes #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE ExistentialQuantification #-} module ClassHierarchy where import Ivory.Language import Ivory.Compile.C.CmdlineFrontend import Control.Monad -------------------------------------------------------------------------------- [ivory| -- Three structs defined in the quasiquoter, a base struct and two that'll -- extend it. struct StanagBase { paramA :: Stored IBool } -- Annoyingly, the fields are in the same global namespace, so we give unique names to the fields pointing to the base struct. struct StanagBaseMsg1 { base1 :: Struct StanagBase ; paramC :: Stored IFloat } struct StanagBaseMsg2 { base2 :: Struct StanagBase ; paramD :: Stored IFloat } |] -- A Haskell class that has a method 'getBase'. Given a reference to a struct, -- getBase returns the base state. -- -- XXX This is boilerplate that might be generated... class (IvoryStruct sym) => ExtendBase sym where getBase :: forall ref s . ( IvoryExpr (ref s (Struct sym)) , IvoryExpr (ref s (Struct "StanagBase")) , IvoryRef ref ) => ref s (Struct sym) -> ref s (Struct "StanagBase") -- For the parent, it's just a noop (identity). instance ExtendBase "StanagBase" where getBase = id -- Otherwise, we dereference the base field. instance ExtendBase "StanagBaseMsg1" where getBase ref = ref ~> base1 instance ExtendBase "StanagBaseMsg2" where getBase ref = ref ~> base2 -- A polymorphic procedure Ivory macro for references to objects in the -- hierachy. Note: this cannot be a C function (or we'd have to specialize it -- for each use type). getBaseVal :: ExtendBase sym => Ref s (Struct sym) -> Ivory eff IBool getBaseVal ref = do let r = getBase ref deref (r ~> paramA) -- A procedure that makes use of the polymorphism. Regardless of whehter the -- reference is to a parent or child, we can use the 'getBaseVal' Ivory -- function. bar :: Def ([ Ref s (Struct "StanagBase") , Ref s (Struct "StanagBaseMsg1") , Ref s (Struct "StanagBaseMsg2") ] :-> IBool) bar = proc "bar" $ \r0 r1 r2 -> body $ do b0 <- getBaseVal r0 b1 <- getBaseVal r1 b2 <- getBaseVal r2 ret (b0 .&& b1 .&& b2) makeCCode :: IO () makeCCode = runCompiler [cmodule] [] opts where opts = initialOpts { outDir = Nothing, constFold = True } cmodule = package "Module" $ do defStruct (Proxy :: Proxy "StanagBase") defStruct (Proxy :: Proxy "StanagBaseMsg1") defStruct (Proxy :: Proxy "StanagBaseMsg2") incl bar
Hodapp87/ivory
ivory-examples/examples/ClassHierarchy.hs
bsd-3-clause
2,709
0
13
580
510
267
243
45
1
{-# LANGUAGE ScopedTypeVariables #-} import Test.QuickCheck import Algebra import Data.List (nub) import System.Random (Random(..)) import Data.Text (Text) import qualified Data.Text as T (pack) import Data.Time (fromGregorian) import Data.Time.Clock (UTCTime(..), secondsToDiffTime) import Control.Monad (replicateM) newtype QCRelvar = QCRelvar Relvar deriving Show -- for QuickCheck's relvars generation newtype QCMatchingRelvar = QCMatchingRelvar (Relvar, Relvar) deriving Show -- relvars with same attributes newtype QCDisjointRelvar = QCDisjointRelvar (Relvar, Relvar) deriving Show -- relvars with disjoint attributes newtype QCOverlappingRelvar = QCOverlappingRelvar (Relvar, Relvar) deriving Show -- relvars with overlapping attributes, but not disjoint instance Arbitrary QCRelvar where arbitrary = QCRelvar <$> (sized genRelvar) instance Arbitrary QCMatchingRelvar where arbitrary = QCMatchingRelvar <$> (sized genMatchingRelvars) instance Arbitrary QCDisjointRelvar where arbitrary = QCDisjointRelvar <$> (sized genDisjointRelvars) instance Arbitrary QCOverlappingRelvar where arbitrary = QCOverlappingRelvar <$> (sized genOverlappingRelvars) -- TODO: code genOverlappingRelvars main :: IO () main = do let mxsss = 1000 -- increase for more tests. putStrLn "\nprop00 - test simple relvar generation" quickCheckWith stdArgs { maxSuccess = mxsss } prop00 putStrLn "\nprop01 - union r r == r" quickCheckWith stdArgs { maxSuccess = mxsss } prop01 putStrLn "\nprop02 - intersect r r == r" quickCheckWith stdArgs { maxSuccess = mxsss } prop02 putStrLn "\nprop03 - card of minus r r == 0" quickCheckWith stdArgs { maxSuccess = mxsss } prop03 putStrLn "\nprop04 - (r1 \\ r2) union (r1 intersect r2) == r1" quickCheckWith stdArgs { maxSuccess = mxsss } prop04 putStrLn "\nprop05 - card r1 + card r2 >= card (r1 `union` r2)" quickCheckWith stdArgs { maxSuccess = mxsss } prop05 putStrLn "\nprop06 - (card r1) `min` (card r2) >= card (r1 `intersection` r2)" quickCheckWith stdArgs { maxSuccess = mxsss } prop06 putStrLn "\nprop07 - card (r1 `times` r2) == (card r1) * (card r2) for disjoint relations" quickCheckWith stdArgs { maxSuccess = mxsss } prop07 -- TODO: ADD more tests -- ====================== -- == properties -- ====================== -- TODO: add dee and dum tests -- make sure that relvar function works prop00 :: QCRelvar -> Bool prop00 (QCRelvar r) = (card r) >= 0 -- self union is identity prop01 :: QCRelvar -> Bool prop01 (QCRelvar r) = union r r == r -- self intersection is identity prop02 :: QCRelvar -> Bool prop02 (QCRelvar r) = intersection r r == r -- self difference has no rows prop03 :: QCRelvar -> Bool prop03 (QCRelvar r) = (card $ minus r r) == 0 -- (r1 \\ r2) union (r1 intersect r2) == r1 prop04 :: QCMatchingRelvar -> Bool prop04 (QCMatchingRelvar (r1, r2)) = union (minus r1 r2) (intersection r1 r2) == r1 -- card r1 + card r2 >= card r1 `union` r2 prop05 :: QCMatchingRelvar -> Bool prop05 (QCMatchingRelvar (r1, r2)) = (card r1 + card r2) >= card (r1 `union` r2) -- (card r1) `min` (card r2) >= card r1 `intersection` r2 prop06 :: QCMatchingRelvar -> Bool prop06 (QCMatchingRelvar (r1, r2)) = (card r1 `min` card r2) >= card (r1 `intersection` r2) -- card (r1 `times` r2) == (card r1) * (card r2) for disjoint relations prop07 :: QCDisjointRelvar -> Bool prop07 (QCDisjointRelvar (r1, r2)) = card (r1 `times` r2) == (card r1) * (card r2) -- ====================== -- == generators -- ====================== const_MAXCOL = 5 -- maximum column # generated const_MAXROW = 5 -- maximum row # generated -- | single Relvar generator. -- >>> sample (arbitrary :: Gen QCRelvar) genRelvar :: Int -> Gen Relvar genRelvar s = sized $ \s -> do coln <- choose (1, const_MAXCOL) lbls <- suchThat (vectorOf coln (listOf1 (arbitrary :: Gen Char))) (\xs-> not $ hasDups xs) tys <- vectorOf coln (arbitrary :: Gen TypeRep) rown <- choose (0, s `min` const_MAXCOL) es <- genElems $ map genElem tys ess <- replicateM rown $ genElems $ map genElem tys return $ relvar lbls tys ess -- | Matching Relvars generator. genMatchingRelvars :: Int -> Gen (Relvar, Relvar) genMatchingRelvars s = sized $ \s -> do coln <- choose (1, const_MAXCOL) lbls <- suchThat (vectorOf coln (listOf1 (arbitrary :: Gen Char))) (\xs-> not $ hasDups xs) tys <- vectorOf coln (arbitrary :: Gen TypeRep) rown1 <- choose (0, s `min` const_MAXCOL) rown2 <- choose (0, s `min` const_MAXCOL) ess1 <- replicateM rown1 $ genElems $ map genElem tys ess2 <- replicateM rown2 $ genElems $ map genElem tys ess2' <- case (ess1++ess2) of [] -> return [] othewise -> listOf $ elements $ (ess1 ++ ess2) -- garantees that r2 sometime has common rows as r1 let r1 = relvar lbls tys ess1 r2 = relvar lbls tys ess2' return $ (r1, r2) -- | Disjoint Relvars generator. genDisjointRelvars :: Int -> Gen (Relvar, Relvar) genDisjointRelvars s = sized $ \s -> do coln1 <- choose (1, const_MAXCOL) coln2 <- choose (1, const_MAXCOL) lbls <- suchThat (vectorOf (coln1+coln2) (listOf1 (arbitrary :: Gen Char))) (\xs-> not $ hasDups xs) let lbls1 = take coln1 lbls lbls2 = drop coln1 lbls tys1 <- vectorOf coln1 (arbitrary :: Gen TypeRep) tys2 <- vectorOf coln2 (arbitrary :: Gen TypeRep) rown1 <- choose (0, s `min` const_MAXCOL) rown2 <- choose (0, s `min` const_MAXCOL) ess1 <- replicateM rown1 $ genElems $ map genElem tys1 ess2 <- replicateM rown2 $ genElems $ map genElem tys2 let r1 = relvar lbls1 tys1 ess1 r2 = relvar lbls2 tys2 ess2 return $ (r1, r2) -- TODO: code this. -- | Overlapping Relvars generator. genOverlappingRelvars :: Int -> Gen (Relvar, Relvar) genOverlappingRelvars s = sized $ \s -> do return (dum,dum) ------------------------- -- Elem functions ------------------------- -- | from a given TypeRep create the corresponding Gen Elem genElem :: TypeRep -> Gen Elem genElem t | (t == tyB) = B <$> (arbitrary :: Gen Bool) | (t == tyC) = C <$> choose ('a', 'z') | (t == tyS) = S <$> (arbitrary :: Gen String) | (t == tyT) = T <$> (arbitrary :: Gen Text) | (t == tyI) = I <$> choose (-10, 10) | (t == tyJ) = J <$> choose (-10, 10) | (t == tyD) = D <$> choose (-10.0, 10.0) | (t == tyDD) = DD <$> elements [fromGregorian 2016 1 1 ,fromGregorian 2016 6 1 ,fromGregorian 2016 12 1] | (t == tyDT) = let time = UTCTime {utctDay = fromGregorian 2016 1 1, utctDayTime = secondsToDiffTime (3600*1)} in DT <$> elements [time ,time {utctDayTime = secondsToDiffTime (3600*2)} ,time {utctDayTime = secondsToDiffTime (3600*3)}] | otherwise = elements [Nil] -- | need to convert a [Gen Elem] into a Gen [Elem] genElems :: [Gen a] -> Gen [a] genElems (g:[]) = do x <- g return [x] genElems (g:gs) = do x <- g xs <- genElems gs return ([x] ++ xs) genElems _ = undefined ------------------------- -- Text functions ------------------------- instance Arbitrary Text where arbitrary = T.pack <$> (arbitrary :: Gen String) ------------------------- -- TypeRep functions ------------------------- -- TODO : add tests with non-basics Elem (eg R r, A a...) rndtys = [tyB,tyC,tyS, tyT,tyI,tyJ,tyD,tyDD,tyDT] --removing temporarily tyBS rndtysrng = map (/(fromIntegral $ length rndtys)) [1.0, 2.0..] instance Random TypeRep where randomR (x,y) g = case (randomR (0,1) g) of (r::Double,g') | r < rndtysrng !! 0 -> (rndtys !! 0, g') | r < rndtysrng !! 1 -> (rndtys !! 1, g') | r < rndtysrng !! 2 -> (rndtys !! 2, g') | r < rndtysrng !! 3 -> (rndtys !! 3, g') | r < rndtysrng !! 4 -> (rndtys !! 4, g') | r < rndtysrng !! 5 -> (rndtys !! 5, g') | r < rndtysrng !! 6 -> (rndtys !! 6, g') | r < rndtysrng !! 7 -> (rndtys !! 7, g') | r < rndtysrng !! 8 -> (rndtys !! 8, g') -- | r < rndtysrng !! 9 -> (rndtys !! 9, g') | otherwise -> (rndtys !! length rndtys, g') random g = case (random g) of (r::Double,g') | r < rndtysrng !! 0 -> (rndtys !! 0, g') | r < rndtysrng !! 1 -> (rndtys !! 1, g') | r < rndtysrng !! 2 -> (rndtys !! 2, g') | r < rndtysrng !! 3 -> (rndtys !! 3, g') | r < rndtysrng !! 4 -> (rndtys !! 4, g') | r < rndtysrng !! 5 -> (rndtys !! 5, g') | r < rndtysrng !! 6 -> (rndtys !! 6, g') | r < rndtysrng !! 7 -> (rndtys !! 7, g') | r < rndtysrng !! 8 -> (rndtys !! 8, g') -- | r < rndtysrng !! 9 -> (rndtys !! 9, g') | otherwise -> (rndtys !! length rndtys, g') instance Arbitrary TypeRep where arbitrary = elements rndtys -- choose (tyB, tyBS) ------------------------- -- Local functions ------------------------- -- True if duplicates exist. hasDups :: [String] -> Bool hasDups xs = length xs > (length $ nub xs)
JAnthelme/relation-tool
test/Spec.hs
bsd-3-clause
9,557
0
16
2,630
3,016
1,582
1,434
157
2
module Lexer ( lexMap, LexHgram ) where import qualified Data.Text as T import qualified Data.Map as M import Text.Parsec import Data.Char import Data.List type LexHgram = M.Map T.Text Int lexMap :: T.Text -> LexHgram lexMap t = case parse lexer "" t of (Left err) -> M.empty (Right l) -> M.fromList . map (\x->(head x, length x)) . group . sort $ l lexer::Parsec T.Text st [T.Text] lexer = optional cDelimeter *> many (lexeme <* cDelimeter) <* eof lexeme::Parsec T.Text st T.Text lexeme = T.pack <$> many1 ( satisfy (not . isCDelimeter) ) cDelimeter:: Parsec T.Text st [Char] cDelimeter = many1 $ satisfy isCDelimeter isCDelimeter:: Char -> Bool isCDelimeter = not. isAlpha --isCDelimeter c = (isSpace c ) || (isPunctuation c)
mmx1/tokenGen
src/Lexer.hs
bsd-3-clause
754
0
16
147
291
157
134
21
2
{-# LANGUAGE DeriveGeneric, KindSignatures, TemplateHaskell, QuasiQuotes, FlexibleInstances, TypeOperators, TypeSynonymInstances, MultiParamTypeClasses, FunctionalDependencies, OverlappingInstances, ScopedTypeVariables, EmptyDataDecls, DefaultSignatures, ViewPatterns, UndecidableInstances, FlexibleContexts, StandaloneDeriving, IncoherentInstances, DeriveDataTypeable #-} module MRP.Commands where import qualified Data.ByteString as BS import Language.C.Simple.CType import Language.C.Simple.CType.Build.TH import TypeLevel.NaturalNumber import Language.C.Simple.Evaluator import Foreign.C.Types import Data.Default type Id = CInt type Size = CInt type Offset = CInt data IdMissing = IdMissing { id_missing_id :: Id } data ResourceEnv = ResourceEnv { resources :: [(Id, BS.ByteString)] } deriving(Show, Eq) data CreateInput = CreateInput { create_input_id :: Id, create_input_size :: Size } data CreateOutput = CreateOutput data CreateError = CreateOutCapacity | CreateOutOfMemory type CreateCommand = Command CreateInput CreateOutput CreateError data DeleteInput = DeleteInput { delete_input_id :: Id } data DeleteOutput = DeleteOutput type DeleteError = IdMissing type DeleteCommand = Command DeleteInput DeleteOutput DeleteError data GetInput = GetInput { get_input :: Id } data GetOutput = GetOutput { get_output_bytes :: BS.ByteString } type GetError = IdMissing type GetCommand = Command GetInput GetOutput GetError data PutInput = PutInput { put_input_id :: Id, put_input_data :: BS.ByteString } data PutOutput = PutOutput type PutError = IdMissing type PutCommand = Command PutInput PutOutput PutError data RunInput n a = RunInput { run_input_offset :: [Offset] , run_input_offset_count :: Int, run_input_command :: a } deriving(Show, Eq) data RunError a = RunFixupIdNotFound | RunFixupOffsetOutofBounds | RunCommandError a instance Default (RunError a) where def = RunFixupIdNotFound data RunCommand a = RunCommand { runCommandCmd :: a, runCommandOffets :: [Offset] } data ResourceCommand = C CreateCommand | D DeleteCommand | G GetCommand | P PutCommand --data ResourceCommandOutput n a =
jfischoff/minimal-resource-protocol
src/MRP/Commands.hs
bsd-3-clause
2,606
0
11
759
444
272
172
63
0
-- | Dynamically lookup up values from modules and loading them. module DynamicLoading ( #ifdef GHCI -- * Force loading information forceLoadModuleInterfaces, forceLoadNameModuleInterface, forceLoadTyCon, -- * Finding names lookupRdrNameInModule, -- * Loading values getValueSafely, lessUnsafeCoerce #endif ) where #ifdef GHCI import Linker ( linkModule, getHValue ) import SrcLoc ( noSrcSpan ) import Finder ( findImportedModule, cannotFindModule ) import DriverPhases ( HscSource(HsSrcFile) ) import TcRnDriver ( getModuleInterface ) import TcRnMonad ( initTc, initIfaceTcRn ) import LoadIface ( loadUserInterface ) import RdrName ( RdrName, Provenance(..), ImportSpec(..), ImpDeclSpec(..) , ImpItemSpec(..), mkGlobalRdrEnv, lookupGRE_RdrName, gre_name ) import RnNames ( gresFromAvails ) import PrelNames ( iNTERACTIVE ) import DynFlags import HscTypes ( HscEnv(..), FindResult(..), ModIface(..), lookupTypeHscEnv ) import TypeRep ( TyThing(..), pprTyThingCategory ) import Type ( Type, eqType ) import TyCon ( TyCon ) import Name ( Name, nameModule_maybe ) import Id ( idType ) import Module ( Module, ModuleName ) import Panic ( GhcException(..), throwGhcException ) import FastString import ErrUtils import Outputable import Exception import Data.Maybe ( mapMaybe ) import GHC.Exts ( unsafeCoerce# ) -- | Force the interfaces for the given modules to be loaded. The 'SDoc' parameter is used -- for debugging (@-ddump-if-trace@) only: it is shown as the reason why the module is being loaded. forceLoadModuleInterfaces :: HscEnv -> SDoc -> [Module] -> IO () forceLoadModuleInterfaces hsc_env doc modules = (initTc hsc_env HsSrcFile False iNTERACTIVE $ initIfaceTcRn $ mapM_ (loadUserInterface False doc) modules) >> return () -- | Force the interface for the module containing the name to be loaded. The 'SDoc' parameter is used -- for debugging (@-ddump-if-trace@) only: it is shown as the reason why the module is being loaded. forceLoadNameModuleInterface :: HscEnv -> SDoc -> Name -> IO () forceLoadNameModuleInterface hsc_env reason name = do let name_modules = mapMaybe nameModule_maybe [name] forceLoadModuleInterfaces hsc_env reason name_modules -- | Load the 'TyCon' associated with the given name, come hell or high water. Fails if: -- -- * The interface could not be loaded -- * The name is not that of a 'TyCon' -- * The name did not exist in the loaded module forceLoadTyCon :: HscEnv -> Name -> IO TyCon forceLoadTyCon hsc_env con_name = do forceLoadNameModuleInterface hsc_env (ptext (sLit "contains a name used in an invocation of loadTyConTy")) con_name mb_con_thing <- lookupTypeHscEnv hsc_env con_name case mb_con_thing of Nothing -> throwCmdLineErrorS dflags $ missingTyThingError con_name Just (ATyCon tycon) -> return tycon Just con_thing -> throwCmdLineErrorS dflags $ wrongTyThingError con_name con_thing where dflags = hsc_dflags hsc_env -- | Loads the value corresponding to a 'Name' if that value has the given 'Type'. This only provides limited safety -- in that it is up to the user to ensure that that type corresponds to the type you try to use the return value at! -- -- If the value found was not of the correct type, returns @Nothing@. Any other condition results in an exception: -- -- * If we could not load the names module -- * If the thing being loaded is not a value -- * If the Name does not exist in the module -- * If the link failed getValueSafely :: HscEnv -> Name -> Type -> IO (Maybe a) getValueSafely hsc_env val_name expected_type = do forceLoadNameModuleInterface hsc_env (ptext (sLit "contains a name used in an invocation of getValueSafely")) val_name -- Now look up the names for the value and type constructor in the type environment mb_val_thing <- lookupTypeHscEnv hsc_env val_name case mb_val_thing of Nothing -> throwCmdLineErrorS dflags $ missingTyThingError val_name Just (AnId id) -> do -- Check the value type in the interface against the type recovered from the type constructor -- before finally casting the value to the type we assume corresponds to that constructor if expected_type `eqType` idType id then do -- Link in the module that contains the value, if it has such a module case nameModule_maybe val_name of Just mod -> do linkModule hsc_env mod return () Nothing -> return () -- Find the value that we just linked in and cast it given that we have proved it's type hval <- getHValue hsc_env val_name value <- lessUnsafeCoerce (hsc_dflags hsc_env) "getValueSafely" hval return $ Just value else return Nothing Just val_thing -> throwCmdLineErrorS dflags $ wrongTyThingError val_name val_thing where dflags = hsc_dflags hsc_env -- | Coerce a value as usual, but: -- -- 1) Evaluate it immediately to get a segfault early if the coercion was wrong -- -- 2) Wrap it in some debug messages at verbosity 3 or higher so we can see what happened -- if it /does/ segfault lessUnsafeCoerce :: DynFlags -> String -> a -> IO b lessUnsafeCoerce dflags context what = do debugTraceMsg dflags 3 $ (ptext $ sLit "Coercing a value in") <+> (text context) <> (ptext $ sLit "...") output <- evaluate (unsafeCoerce# what) debugTraceMsg dflags 3 $ ptext $ sLit "Successfully evaluated coercion" return output -- | Finds the 'Name' corresponding to the given 'RdrName' in the context of the 'ModuleName'. Returns @Nothing@ if no -- such 'Name' could be found. Any other condition results in an exception: -- -- * If the module could not be found -- * If we could not determine the imports of the module lookupRdrNameInModule :: HscEnv -> ModuleName -> RdrName -> IO (Maybe Name) lookupRdrNameInModule hsc_env mod_name rdr_name = do -- First find the package the module resides in by searching exposed packages and home modules found_module <- findImportedModule hsc_env mod_name Nothing case found_module of Found _ mod -> do -- Find the exports of the module (_, mb_iface) <- getModuleInterface hsc_env mod case mb_iface of Just iface -> do -- Try and find the required name in the exports let decl_spec = ImpDeclSpec { is_mod = mod_name, is_as = mod_name , is_qual = False, is_dloc = noSrcSpan } provenance = Imported [ImpSpec decl_spec ImpAll] env = mkGlobalRdrEnv (gresFromAvails provenance (mi_exports iface)) case lookupGRE_RdrName rdr_name env of [gre] -> return (Just (gre_name gre)) [] -> return Nothing _ -> panic "lookupRdrNameInModule" Nothing -> throwCmdLineErrorS dflags $ hsep [ptext (sLit "Could not determine the exports of the module"), ppr mod_name] err -> throwCmdLineErrorS dflags $ cannotFindModule dflags mod_name err where dflags = hsc_dflags hsc_env wrongTyThingError :: Name -> TyThing -> SDoc wrongTyThingError name got_thing = hsep [ptext (sLit "The name"), ppr name, ptext (sLit "is not that of a value but rather a"), pprTyThingCategory got_thing] missingTyThingError :: Name -> SDoc missingTyThingError name = hsep [ptext (sLit "The name"), ppr name, ptext (sLit "is not in the type environment: are you sure it exists?")] throwCmdLineErrorS :: DynFlags -> SDoc -> IO a throwCmdLineErrorS dflags = throwCmdLineError . showSDoc dflags throwCmdLineError :: String -> IO a throwCmdLineError = throwGhcException . CmdLineError #endif
nomeata/ghc
compiler/main/DynamicLoading.hs
bsd-3-clause
8,124
0
24
2,110
1,446
763
683
1
0
{-# OPTIONS_GHC -fno-warn-type-defaults #-} import Data.Either (isLeft) import Data.Map (fromList) import Test.Hspec (Spec, describe, it, shouldBe, shouldSatisfy) import Test.Hspec.Runner (configFastFail, defaultConfig, hspecWith) import DNA (count, nucleotideCounts) main :: IO () main = hspecWith defaultConfig {configFastFail = True} specs specs :: Spec specs = describe "nucleotide-count" $ do -- As of 2016-07-27, there was no reference file -- for the test cases in `exercism/x-common`. let x `matches` y = x `shouldBe` Right y let x `matchesMap` y = x `shouldBe` (Right . fromList) y describe "count" $ do it "empty dna strand has no adenosine" $ count 'A' "" `matches` 0 it "repetitive cytidine gets counted" $ count 'C' "CCCCC" `matches` 5 it "counts only thymidine" $ count 'T' "GGGGGTAACCCGG" `matches` 1 it "validates nucleotides" $ count 'X' "GACT" `shouldSatisfy` isLeft it "validates strand" $ count 'G' "GACYT" `shouldSatisfy` isLeft describe "nucleotideCounts" $ do it "empty dna strand has no nucleotides" $ nucleotideCounts "" `matchesMap` [ ('A', 0) , ('C', 0) , ('G', 0) , ('T', 0) ] it "repetitive-sequence-has-only-guanosine" $ nucleotideCounts "GGGGGGGG" `matchesMap` [ ('A', 0) , ('C', 0) , ('G', 8) , ('T', 0) ] it "counts all nucleotides" $ nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC" `matchesMap` [ ('A', 20) , ('C', 12) , ('G', 17) , ('T', 21) ] it "validates strand" $ nucleotideCounts "GPAC" `shouldSatisfy` isLeft
vaibhav276/exercism_haskell
nucleotide-count/test/Tests.hs
mit
2,230
0
14
953
487
267
220
42
1
{-# LANGUAGE DataKinds #-} {-# LANGUAGE DefaultSignatures #-} {-# LANGUAGE DeriveFunctor #-} {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE GADTs #-} {-# LANGUAGE MultiParamTypeClasses #-} {-# LANGUAGE OverloadedStrings #-} {-# LANGUAGE PartialTypeSignatures #-} {-# LANGUAGE RankNTypes #-} {-# LANGUAGE RecordWildCards #-} {-# LANGUAGE ScopedTypeVariables #-} {-# LANGUAGE StandaloneDeriving #-} {-# LANGUAGE TemplateHaskell #-} {-# LANGUAGE TupleSections #-} {-# LANGUAGE TypeOperators #-} {-# LANGUAGE TypeInType #-} {-# LANGUAGE UndecidableInstances #-} {-# LANGUAGE UnicodeSyntax #-} {-# OPTIONS_GHC -Wextra -Wno-unused-imports -Wno-unticked-promoted-constructors -Wno-type-defaults -Wno-missing-signatures #-} module Main where import Control.Compose import Control.Lens hiding (children, pre) import Control.Monad.IO.Class import Data.Foldable import Data.Monoid import Data.Sequence (Seq) import qualified Data.Sequence as S import Prelude.Unicode (.:) = (.) ∘ (.) data I x = I { unI ∷ x } data HB = HB { _s ∷ String, _children ∷ [HB] } -- | HBE { _s ∷ String, _children ∷ [HB] } -- | HBR { _s ∷ String, _children ∷ [HB] } deriving (Show) makeLenses ''HB walk ∷ (a ~ HB, Monad m) ⇒ ([Int] → a → m ()) → a → m () walk action f = loop [0] f where loop trace f = do action trace f sequence $ zip (f^.children) [0..] <&> \(f', n) → loop (n:trace) f' pure () dump ∷ (a ~ HB, MonadIO m) ⇒ (a ~ HB ⇒ a → String) → a → m () dump ppf = walk (liftIO .: (\trace f' → putStrLn $ (concat $ take (length trace - 1) (repeat " ")) <> (show $ head trace) <> " " <> ppf f')) data Derived x = W (x, HB) -- Derived ~ W ~ Dynamic deriving Show instance Functor Derived where fmap f (W (x, xs)) = W (f x, xs) instance Applicative Derived where pure x = W (x, HB "vboxEnd" []) W (f, fhb@(HB fhbn _)) <*> W (x, (HB xhbn xhbr)) = W (f x, HB ("(ER "<>fhbn<>xhbn<> ")") (fhb : xhbr)) -- W (_, (HB l _)) <*> W (_, (HB r _)) = error $ "HB "<>l<>" <*> HB "<>r -- W (_, (HB l _)) <*> W (_, (HB r _)) = error $ "HB "<>l<>" <*> HB "<>r -- W (_, (HB l _)) <*> W (_, (HB r _)) = error $ "HB "<>l<>" <*> HB "<>r -- W (_, (HB l _)) <*> W (_, (HB r _)) = error $ "HB "<>l<>" <*> HB "<>r -- pure x = W (mempty, constDyn (x, Holo.vbox [])) -- W (fsubs, fvals) <*> W (xsubs, xvals) = -- W $ (,) -- (zipDynWith (<>) fsubs xsubs) -- (zipDynWith ((\(f, fhb@Item{..}) -- ( x, xhb)→ -- (f x, fhb { hiChildren = hiChildren <> [xhb] }))) -- fvals xvals) class (MonadIO m, Show a) ⇒ Liftable m a where lift ∷ a → (m :. Derived) a lift x = O ∘ pure ∘ W $ (x, HB "hbox" [ HB "val" [] , HB (show x) []]) instance MonadIO m ⇒ Liftable m String type C = [] fromL ∷ [x] → C x fromL = id toL ∷ C x → [x] toL = id data Travable f x = Travable (C (f x)) pre ∷ (Monad m, x ~ String, m ~ IO) ⇒ Travable (m :. Derived) x pre = Travable $ fromL $ lift <$> ["a", "b", "c", "d" -- , "e", "f", "g", "h", "i", "j", "k" ] tsequence ∷ Applicative f ⇒ Travable f x → f (Travable I x) tsequence (Travable s) = Travable ∘ (I <$>) <$> sequenceA s post ∷ (Monad m, x ~ String, m ~ IO) ⇒ (m :. Derived) (Travable I x) post = tsequence pre main ∷ IO () main = do let O act = post (W (Travable s, hb)) ← act putStrLn $ show $ unI <$> toL s dump _s hb
deepfire/mood
experiments/lifted-record-holotree/Main.hs
agpl-3.0
3,815
4
19
1,157
1,091
593
498
79
1
-- Copyright (C) 2016 Red Hat, Inc. -- -- This library is free software; you can redistribute it and/or -- modify it under the terms of the GNU Lesser General Public -- License as published by the Free Software Foundation; either -- version 2.1 of the License, or (at your option) any later version. -- -- This library is distributed in the hope that it will be useful, -- but WITHOUT ANY WARRANTY; without even the implied warranty of -- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU -- Lesser General Public License for more details. -- -- You should have received a copy of the GNU Lesser General Public -- License along with this library; if not, see <http://www.gnu.org/licenses/>. module BDCS.KeyValue(findKeyValue, formatKeyValue, getKeyValue, insertKeyValue, keyValueListToJSON) where import Control.Monad.IO.Class(MonadIO) import Data.Aeson((.=), object, toJSON) import Data.Aeson.Types(KeyValue) import Data.List(partition) import qualified Data.Map.Strict as Map import qualified Data.Text as T import Database.Esqueleto import BDCS.DB import BDCS.KeyType {-# ANN findKeyValue ("HLint: ignore Use ." :: String) #-} findKeyValue :: MonadIO m => KeyType -> Maybe T.Text -> Maybe T.Text -> SqlPersistT m (Maybe (Key KeyVal)) findKeyValue k v e = firstKeyResult $ select $ from $ \kv -> do where_ $ kv ^. KeyValKey_value ==. val k &&. kv ^. KeyValVal_value ==? v &&. kv ^. KeyValExt_value ==? e limit 1 return $ kv ^. KeyValId formatKeyValue :: KeyVal -> T.Text formatKeyValue KeyVal{..} = let rhs = case (keyValVal_value, keyValExt_value) of (Just v, Nothing) -> T.concat [ " = ", v ] (Just v, Just e) -> T.concat [ " = (", v, ", ", e, ")" ] _ -> "" in T.concat [ T.pack $ show keyValKey_value, rhs ] getKeyValue :: MonadIO m => Key KeyVal -> SqlPersistT m (Maybe KeyVal) getKeyValue key = firstEntityResult $ select $ from $ \kv -> do where_ $ kv ^. KeyValId ==. val key limit 1 return kv insertKeyValue :: MonadIO m => KeyType -> Maybe T.Text -> Maybe T.Text -> SqlPersistT m (Key KeyVal) insertKeyValue k v e = insert (KeyVal k v e) keyValueListToJSON :: KeyValue t => [KeyVal] -> [t] keyValueListToJSON lst = let isLabelKey (LabelKey _) = True isLabelKey _ = False -- We want to handle LabelKeys differently from all other KeyTypes, so first let's sort them out. (labelKvs, otherKvs) = partition (isLabelKey . keyValKey_value) lst -- Convert LabelKeys into tuples of ("labels", json). All LabelKeys will have the same first value -- in their tuple - the string "labels". This assumes that LabelKeys do not store values or extended -- values. If they start doing that, this will have to change. labelVals = map (\kv -> (T.pack "labels", [toJSON $ keyValKey_value kv])) labelKvs -- Convert all other KeyTypes into tuples of (key, json). otherVals = map (\kv -> (asText $ keyValKey_value kv, [toJSON kv])) otherKvs -- A single list can have many KeyVals with the same key (think about rpm-provides and requires -- especially). We use an intermediate map to turn it into a list of (key, [json1, json2, ...]) tuples. -- Both types get handled the same way here. labelMap = Map.fromListWith (++) labelVals otherMap = Map.fromListWith (++) otherVals -- If there's only one KeyVal for a given key, strip the list out before converting it to a -- json list object. Otherwise, everything will end up in a list. -- -- On the other hand, we don't do anything to LabelKeys. This means labels will always end up -- in a list named "labels". pairs = map (\(k, v) -> case v of [hd] -> k .= hd _ -> k .= v) (Map.toList otherMap) ++ map (uncurry (.=)) (Map.toList labelMap) in [T.pack "keyvals" .= object pairs]
atodorov/bdcs
src/BDCS/KeyValue.hs
lgpl-2.1
4,106
0
17
1,092
849
459
390
-1
-1
{-# LANGUAGE NoImplicitPrelude #-} {-# LANGUAGE TemplateHaskell #-} {-# LANGUAGE OverloadedStrings #-} module Stack.Constants.Config ( distDirFromDir , workDirFromDir , distRelativeDir , imageStagingDir , projectDockerSandboxDir , configCacheFile , configCabalMod , buildCacheFile , testSuccessFile , testBuiltFile , hpcRelativeDir , hpcDirFromDir , objectInterfaceDirL , templatesDir ) where import Stack.Prelude import Stack.Constants import Stack.Types.Compiler import Stack.Types.Config import Stack.Types.PackageIdentifier import Path -- | Output .o/.hi directory. objectInterfaceDirL :: HasBuildConfig env => Getting r env (Path Abs Dir) objectInterfaceDirL = to $ \env -> -- FIXME is this idomatic lens code? let workDir = view workDirL env root = view projectRootL env in root </> workDir </> $(mkRelDir "odir/") -- | The filename used for dirtiness check of source files. buildCacheFile :: (MonadThrow m, MonadReader env m, HasEnvConfig env) => Path Abs Dir -- ^ Package directory. -> m (Path Abs File) buildCacheFile dir = liftM (</> $(mkRelFile "stack-build-cache")) (distDirFromDir dir) -- | The filename used to mark tests as having succeeded testSuccessFile :: (MonadThrow m, MonadReader env m, HasEnvConfig env) => Path Abs Dir -- ^ Package directory -> m (Path Abs File) testSuccessFile dir = liftM (</> $(mkRelFile "stack-test-success")) (distDirFromDir dir) -- | The filename used to mark tests as having built testBuiltFile :: (MonadThrow m, MonadReader env m, HasEnvConfig env) => Path Abs Dir -- ^ Package directory -> m (Path Abs File) testBuiltFile dir = liftM (</> $(mkRelFile "stack-test-built")) (distDirFromDir dir) -- | The filename used for dirtiness check of config. configCacheFile :: (MonadThrow m, MonadReader env m, HasEnvConfig env) => Path Abs Dir -- ^ Package directory. -> m (Path Abs File) configCacheFile dir = liftM (</> $(mkRelFile "stack-config-cache")) (distDirFromDir dir) -- | The filename used for modification check of .cabal configCabalMod :: (MonadThrow m, MonadReader env m, HasEnvConfig env) => Path Abs Dir -- ^ Package directory. -> m (Path Abs File) configCabalMod dir = liftM (</> $(mkRelFile "stack-cabal-mod")) (distDirFromDir dir) -- | Directory for HPC work. hpcDirFromDir :: (MonadThrow m, MonadReader env m, HasEnvConfig env) => Path Abs Dir -- ^ Package directory. -> m (Path Abs Dir) hpcDirFromDir fp = liftM (fp </>) hpcRelativeDir -- | Relative location of directory for HPC work. hpcRelativeDir :: (MonadThrow m, MonadReader env m, HasEnvConfig env) => m (Path Rel Dir) hpcRelativeDir = liftM (</> $(mkRelDir "hpc")) distRelativeDir -- | Package's build artifacts directory. distDirFromDir :: (MonadThrow m, MonadReader env m, HasEnvConfig env) => Path Abs Dir -> m (Path Abs Dir) distDirFromDir fp = liftM (fp </>) distRelativeDir -- | Package's working directory. workDirFromDir :: (MonadReader env m, HasEnvConfig env) => Path Abs Dir -> m (Path Abs Dir) workDirFromDir fp = view $ workDirL.to (fp </>) -- | Directory for project templates. templatesDir :: Config -> Path Abs Dir templatesDir config = configStackRoot config </> $(mkRelDir "templates") -- | Relative location of build artifacts. distRelativeDir :: (MonadThrow m, MonadReader env m, HasEnvConfig env) => m (Path Rel Dir) distRelativeDir = do cabalPkgVer <- view cabalVersionL platform <- platformGhcRelDir wc <- view $ actualCompilerVersionL.to whichCompiler -- Cabal version, suffixed with "_ghcjs" if we're using GHCJS. envDir <- parseRelDir $ (if wc == Ghcjs then (++ "_ghcjs") else id) $ packageIdentifierString $ PackageIdentifier cabalPackageName cabalPkgVer platformAndCabal <- useShaPathOnWindows (platform </> envDir) workDir <- view workDirL return $ workDir </> $(mkRelDir "dist") </> platformAndCabal -- | Docker sandbox from project root. projectDockerSandboxDir :: (MonadReader env m, HasConfig env) => Path Abs Dir -- ^ Project root -> m (Path Abs Dir) -- ^ Docker sandbox projectDockerSandboxDir projectRoot = do workDir <- view workDirL return $ projectRoot </> workDir </> $(mkRelDir "docker/") -- | Image staging dir from project root. imageStagingDir :: (MonadReader env m, HasConfig env, MonadThrow m) => Path Abs Dir -- ^ Project root -> Int -- ^ Index of image -> m (Path Abs Dir) -- ^ Docker sandbox imageStagingDir projectRoot imageIdx = do workDir <- view workDirL idxRelDir <- parseRelDir (show imageIdx) return $ projectRoot </> workDir </> $(mkRelDir "image") </> idxRelDir
MichielDerhaeg/stack
src/Stack/Constants/Config.hs
bsd-3-clause
5,012
0
13
1,226
1,238
640
598
116
2
module Generate.JavaScript.Ports (incoming, outgoing) where import qualified Data.List as List import Generate.JavaScript.Helpers import AST.Type as T import qualified AST.Variable as Var import Language.ECMAScript3.Syntax data JSType = JSNumber | JSBoolean | JSString | JSArray | JSObject [String] typeToString :: JSType -> String typeToString tipe = case tipe of JSNumber -> "a number" JSBoolean -> "a boolean (true or false)" JSString -> "a string" JSArray -> "an array" JSObject fields -> "an object with fields '" ++ List.intercalate "', '" fields ++ "'" _Array :: String -> Expression () _Array functionName = useLazy ["Elm","Native","Array"] functionName _List :: String -> Expression () _List functionName = useLazy ["Elm","Native","List"] functionName _Maybe :: String -> Expression () _Maybe functionName = useLazy ["Elm","Maybe"] functionName check :: Expression () -> JSType -> Expression () -> Expression () check x jsType continue = CondExpr () (jsFold OpLOr checks x) continue throw where jsFold op checks value = foldl1 (InfixExpr () op) (map ($ value) checks) throw = obj ["_U","badPort"] `call` [ string (typeToString jsType), x ] checks = case jsType of JSNumber -> [typeof "number"] JSBoolean -> [typeof "boolean"] JSString -> [typeof "string", instanceof "String"] JSArray -> [instanceof "Array"] JSObject fields -> [jsFold OpLAnd (typeof "object" : map member fields)] incoming :: CanonicalType -> Expression () incoming tipe = case tipe of Aliased _ t -> incoming t App (Type v) [t] | Var.isSignal v -> obj ["_P","incomingSignal"] <| incoming t _ -> ["v"] ==> inc tipe (ref "v") inc :: CanonicalType -> Expression () -> Expression () inc tipe x = case tipe of Lambda _ _ -> error "functions should not be allowed through input ports" Var _ -> error "type variables should not be allowed through input ports" Aliased _ t -> inc t x Type (Var.Canonical Var.BuiltIn name) | name == "Int" -> from JSNumber | name == "Float" -> from JSNumber | name == "Bool" -> from JSBoolean | name == "String" -> from JSString where from checks = check x checks x Type name | Var.isJson name -> x | Var.isTuple name -> incomingTuple [] x | otherwise -> error "bad type got to incoming port generation code" App f args -> case f : args of Type name : [t] | Var.isMaybe name -> CondExpr () (equal x (NullLit ())) (_Maybe "Nothing") (_Maybe "Just" <| inc t x) | Var.isList name -> check x JSArray (_List "fromArray" <| array) | Var.isArray name -> check x JSArray (_Array "fromJSArray" <| array) where array = DotRef () x (var "map") <| incoming t Type name : ts | Var.isTuple name -> incomingTuple ts x _ -> error "bad ADT got to incoming port generation code" Record _ (Just _) -> error "bad record got to incoming port generation code" Record fields Nothing -> check x (JSObject (map fst fields)) object where object = ObjectLit () $ (prop "_", ObjectLit () []) : keys keys = map convert fields convert (f,t) = (prop f, inc t (DotRef () x (var f))) incomingTuple :: [CanonicalType] -> Expression () -> Expression () incomingTuple types x = check x JSArray (ObjectLit () fields) where fields = (prop "ctor", ctor) : zipWith convert [0..] types ctor = string ("_Tuple" ++ show (length types)) convert n t = ( prop ('_':show n) , inc t (BracketRef () x (IntLit () n)) ) outgoing :: CanonicalType -> Expression () outgoing tipe = case tipe of Aliased _ t -> outgoing t App (Type v) [t] | Var.isSignal v -> obj ["_P","outgoingSignal"] <| outgoing t _ -> ["v"] ==> out tipe (ref "v") out :: CanonicalType -> Expression () -> Expression () out tipe x = case tipe of Aliased _ t -> out t x Lambda _ _ | numArgs > 1 && numArgs < 10 -> func (ref ('A':show numArgs) `call` (x:values)) | otherwise -> func (foldl (<|) x values) where ts = T.collectLambdas tipe numArgs = length ts - 1 args = map (\n -> '_' : show n) [0..] values = zipWith inc (init ts) (map ref args) func body = function (take numArgs args) [ VarDeclStmt () [VarDecl () (var "_r") (Just body)] , ret (out (last ts) (ref "_r")) ] Var _ -> error "type variables should not be allowed through input ports" Type (Var.Canonical Var.BuiltIn name) | name `elem` ["Int","Float","Bool","String"] -> x Type name | Var.isJson name -> x | Var.isTuple name -> ArrayLit () [] | otherwise -> error "bad type got to outgoing port generation code" App f args -> case f : args of Type name : [t] | Var.isMaybe name -> CondExpr () (equal (DotRef () x (var "ctor")) (string "Nothing")) (NullLit ()) (out t (DotRef () x (var "_0"))) | Var.isArray name -> DotRef () (_Array "toJSArray" <| x) (var "map") <| outgoing t | Var.isList name -> DotRef () (_List "toArray" <| x) (var "map") <| outgoing t Type name : ts | Var.isTuple name -> let convert n t = out t $ DotRef () x $ var ('_':show n) in ArrayLit () $ zipWith convert [0..] ts _ -> error "bad ADT got to outgoing port generation code" Record _ (Just _) -> error "bad record got to outgoing port generation code" Record fields Nothing -> ObjectLit () keys where keys = map convert fields convert (f,t) = (PropId () (var f), out t (DotRef () x (var f)))
avh4/elm-compiler
src/Generate/JavaScript/Ports.hs
bsd-3-clause
6,496
0
20
2,340
2,298
1,118
1,180
155
10
module SubHask.Category.HMatrix where import GHC.Prim import Control.DeepSeq import Data.Typeable import qualified Prelude as P import qualified Data.Vector.Generic as VG import qualified Data.Vector.Generic.Mutable as VGM import qualified Data.Vector.Storable as VS import qualified Numeric.LinearAlgebra as LA import SubHask.Algebra import SubHask.Category import SubHask.Category.Trans.Linear import SubHask.Internal.Prelude ------------------------------------------------------------------------------- data family HMatrix a b data instance HMatrix (VS.Vector a) (VS.Vector a) = Matrix (LA.Matrix a) instance Category HMatrix where
abailly/subhask
src/SubHask/Category/HMatrix.hs
bsd-3-clause
652
0
9
78
142
92
50
-1
-1
main = drawingOf(path[start, end]) start :: Point start = (0, 0) end :: Point end = [2, -4]
three/codeworld
codeworld-compiler/test/testcase/test_pointType/source.hs
apache-2.0
94
0
8
20
55
32
23
5
1
module Inter.Logged where -- $Id$ import qualified Control.SQL import System.IO logged :: String -> IO a -> IO a logged msg act = do Control.SQL.logged ( msg ++ " ..." ) x <- act Control.SQL.logged ( "... " ++ msg ) return x
Erdwolf/autotool-bonn
trial/src/Inter/Logged.hs
gpl-2.0
248
0
9
66
92
47
45
9
1
<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE helpset PUBLIC "-//Sun Microsystems Inc.//DTD JavaHelp HelpSet Version 2.0//EN" "http://java.sun.com/products/javahelp/helpset_2_0.dtd"> <helpset version="2.0" xml:lang="ru-RU"> <title>Правила пассивного сканирования — бета-версия | ZAP-расширение </title> <maps> <homeID>top</homeID> <mapref location="map.jhm"/> </maps> <view> <name>TOC</name> <label>Содержание</label> <type>org.zaproxy.zap.extension.help.ZapTocView</type> <data>toc.xml</data> </view> <view> <name>Index</name> <label>Индекс</label> <type>javax.help.IndexView</type> <data>index.xml</data> </view> <view> <name>Search</name> <label>Поиск</label> <type>javax.help.SearchView</type> <data engine="com.sun.java.help.search.DefaultSearchEngine"> JavaHelpSearch </data> </view> <view> <name>Favorites</name> <label>Избранное</label> <type>javax.help.FavoritesView</type> </view> </helpset>
thc202/zap-extensions
addOns/pscanrulesBeta/src/main/javahelp/org/zaproxy/zap/extension/pscanrulesBeta/resources/help_ru_RU/helpset_ru_RU.hs
apache-2.0
1,091
78
69
162
570
284
286
-1
-1
import Data.List main :: IO () main = print $ length $ show (foldl' (*) 1 [1..100000] :: Integer)
ghc-android/ghc
testsuite/tests/perf/space_leaks/space_leak_001.hs
bsd-3-clause
100
0
9
21
52
28
24
3
1
{- Copyright (C) 2012 Christopher Walker <http://gsd.uwaterloo.ca> Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. -} -- | Generates simple graph and CVL graph representation for a Clafer model in GraphViz DOT. module Language.Clafer.Generator.Graph (genSimpleGraph, genCVLGraph, traceAstModule, traceIrModule) where import Language.Clafer.Common(fst3,snd3,trd3) import Language.Clafer.Front.Absclafer {-import Language.Clafer.Front.Mapper(range)-} import Language.Clafer.Intermediate.Tracing import Language.Clafer.Intermediate.Intclafer import Language.Clafer.Generator.Html(genTooltip) import qualified Data.Map as Map import Data.Maybe import Prelude hiding (exp) -- | Generate a graph in the simplified notation genSimpleGraph :: Module -> IModule -> String -> Bool -> String genSimpleGraph m ir name showRefs = cleanOutput $ "digraph \"" ++ name ++ "\"\n{\n\nrankdir=BT;\nranksep=0.3;\nnodesep=0.1;\ngraph [fontname=Sans fontsize=11];\nnode [shape=box color=lightgray fontname=Sans fontsize=11 margin=\"0.02,0.02\" height=0.2 ];\nedge [fontname=Sans fontsize=11];\n" ++ b ++ "}" where b = graphSimpleModule m (traceIrModule ir) showRefs -- | Generate a graph in CVL variability abstraction notation genCVLGraph :: Module -> IModule -> String -> String genCVLGraph m ir name = cleanOutput $ "digraph \"" ++ name ++ "\"\n{\nrankdir=BT;\nranksep=0.1;\nnodesep=0.1;\nnode [shape=box margin=\"0.025,0.025\"];\nedge [arrowhead=none];\n" ++ b ++ "}" where b = graphCVLModule m $ traceIrModule ir -- Simplified Notation Printer -- --toplevel: (Top_level (Boolean), Maybe Topmost parent, Maybe immediate parent) graphSimpleModule :: Module -> Map.Map Span [Ir] -> Bool -> String graphSimpleModule (Module _ []) _ _ = "" graphSimpleModule (Module _ (x:xs)) irMap showRefs = graphSimpleDeclaration x (True, Nothing, Nothing) irMap showRefs ++ graphSimpleModule (Module noSpan xs) irMap showRefs graphSimpleDeclaration :: Declaration -> (Bool, Maybe String, Maybe String) -> Map.Map Span [Ir] -> Bool -> String graphSimpleDeclaration (ElementDecl _ element) topLevel irMap showRefs = graphSimpleElement element topLevel irMap showRefs graphSimpleDeclaration _ _ _ _ = "" graphSimpleElement :: Element -> (Bool, Maybe String, Maybe String) -> Map.Map Span [Ir] -> Bool -> String graphSimpleElement (Subclafer _ clafer) topLevel irMap showRefs = graphSimpleClafer clafer topLevel irMap showRefs graphSimpleElement (ClaferUse _ name _ _) topLevel irMap _ = if snd3 topLevel == Nothing then "" else "\"" ++ fromJust (snd3 topLevel) ++ "\" -> \"" ++ graphSimpleName name topLevel irMap ++ "\" [arrowhead=vee arrowtail=diamond dir=both style=solid constraint=true weight=5 minlen=2 arrowsize=0.6 penwidth=0.5 ];\n" graphSimpleElement _ _ _ _ = "" graphSimpleElements :: Elements -> (Bool, Maybe String, Maybe String) -> Map.Map Span [Ir] -> Bool -> String graphSimpleElements (ElementsEmpty _) _ _ _ = "" graphSimpleElements (ElementsList _ es) topLevel irMap showRefs = concatMap (\x -> graphSimpleElement x topLevel irMap showRefs ++ "\n") es graphSimpleClafer :: Clafer -> (Bool, Maybe String, Maybe String) -> Map.Map Span [Ir] -> Bool -> String {-graphSimpleClafer (Clafer _ _ _ _ _ _ _ _) _ _ _ = ""-} graphSimpleClafer (Clafer s abstract gCard id' super' crd init' es) topLevel irMap showRefs | fst3 topLevel == True = let {tooltip = genTooltip (Module noSpan [ElementDecl noSpan (Subclafer noSpan (Clafer noSpan abstract gCard id' super' crd init' es))]) irMap; uid' = getDivId s irMap} in "\"" ++ uid' ++ "\" [label=\"" ++ (head $ lines tooltip) ++ "\" URL=\"#" ++ uid' ++ "\" tooltip=\"" ++ htmlNewlines tooltip ++ "\"];\n" ++ graphSimpleSuper super' (True, Just uid', Just uid') irMap showRefs ++ graphSimpleElements es (False, Just uid', Just uid') irMap showRefs | otherwise = let (PosIdent (_,ident')) = id' in graphSimpleSuper super' (fst3 topLevel, snd3 topLevel, Just ident') irMap showRefs ++ graphSimpleElements es (fst3 topLevel, snd3 topLevel, Just ident') irMap showRefs graphSimpleSuper :: Super -> (Bool, Maybe String, Maybe String) -> Map.Map Span [Ir] -> Bool -> String graphSimpleSuper (SuperEmpty _) _ _ _ = "" graphSimpleSuper (SuperSome _ superHow setExp) topLevel irMap showRefs = let {parent [] = "error"; parent (uid'@('c':xs):xss) = if '_' `elem` xs then uid' else parent xss; parent (_:xss) = parent xss; super' = parent $ graphSimpleSetExp setExp topLevel irMap} in if super' == "error" then "" else "\"" ++ fromJust (snd3 topLevel) ++ "\" -> \"" ++ parent (graphSimpleSetExp setExp topLevel irMap) ++ "\"" ++ graphSimpleSuperHow superHow topLevel irMap showRefs graphSimpleSuperHow :: SuperHow -> (Bool, Maybe String, Maybe String) -> Map.Map Span [Ir] -> Bool -> String graphSimpleSuperHow (SuperColon _) topLevel _ _ = " [" ++ if fst3 topLevel == True then "arrowhead=onormal constraint=true weight=100];\n" else "arrowhead=vee arrowtail=diamond dir=both style=solid weight=10 color=gray arrowsize=0.6 minlen=2 penwidth=0.5 constraint=true];\n" graphSimpleSuperHow (SuperArrow _) topLevel _ showRefs = " [arrowhead=vee arrowsize=0.6 penwidth=0.5 constraint=true weight=10 color=" ++ refColour showRefs ++ " fontcolor=" ++ refColour showRefs ++ (if fst3 topLevel == True then "" else " label=" ++ (fromJust $ trd3 topLevel)) ++ "];\n" graphSimpleSuperHow (SuperMArrow _) topLevel _ showRefs = " [arrowhead=veevee arrowsize=0.6 minlen=1.5 penwidth=0.5 constraint=true weight=10 color=" ++ refColour showRefs ++ " fontcolor=" ++ refColour showRefs ++ (if fst3 topLevel == True then "" else " label=" ++ (fromJust $ trd3 topLevel)) ++ "];\n" refColour :: Bool -> String refColour True = "lightgray" refColour False = "transparent" graphSimpleName :: Name -> (Bool, Maybe String, Maybe String) -> Map.Map Span [Ir] -> String graphSimpleName (Path _ modids) topLevel irMap = unwords $ map (\x -> graphSimpleModId x topLevel irMap) modids graphSimpleModId :: ModId -> (Bool, Maybe String, Maybe String) -> Map.Map Span [Ir] -> String graphSimpleModId (ModIdIdent _ posident) _ irMap = graphSimplePosIdent posident irMap graphSimplePosIdent :: PosIdent -> Map.Map Span [Ir] -> String graphSimplePosIdent (PosIdent (pos, id')) irMap = getUid (PosIdent (pos, id')) irMap {-graphSimpleCard _ _ _ = "" graphSimpleConstraint _ _ _ = "" graphSimpleDecl _ _ _ = "" graphSimpleInit _ _ _ = "" graphSimpleInitHow _ _ _ = "" graphSimpleExp _ _ _ = "" graphSimpleQuant _ _ _ = "" graphSimpleGoal _ _ _ = "" graphSimpleSoftConstraint _ _ _ = "" graphSimpleAbstract _ _ _ = "" graphSimpleGCard _ _ _ = "" graphSimpleNCard _ _ _ = "" graphSimpleExInteger _ _ _ = ""-} graphSimpleSetExp :: SetExp -> (Bool, Maybe String, Maybe String) -> Map.Map Span [Ir] -> [String] graphSimpleSetExp (ClaferId _ name) topLevel irMap = [graphSimpleName name topLevel irMap] graphSimpleSetExp (Union _ set1 set2) topLevel irMap = graphSimpleSetExp set1 topLevel irMap ++ graphSimpleSetExp set2 topLevel irMap graphSimpleSetExp (UnionCom _ set1 set2) topLevel irMap = graphSimpleSetExp set1 topLevel irMap ++ graphSimpleSetExp set2 topLevel irMap graphSimpleSetExp (Difference _ set1 set2) topLevel irMap = graphSimpleSetExp set1 topLevel irMap ++ graphSimpleSetExp set2 topLevel irMap graphSimpleSetExp (Intersection _ set1 set2) topLevel irMap = graphSimpleSetExp set1 topLevel irMap ++ graphSimpleSetExp set2 topLevel irMap graphSimpleSetExp (Domain _ set1 set2) topLevel irMap = graphSimpleSetExp set1 topLevel irMap ++ graphSimpleSetExp set2 topLevel irMap graphSimpleSetExp (Range _ set1 set2) topLevel irMap = graphSimpleSetExp set1 topLevel irMap ++ graphSimpleSetExp set2 topLevel irMap graphSimpleSetExp (Join _ set1 set2) topLevel irMap = graphSimpleSetExp set1 topLevel irMap ++ graphSimpleSetExp set2 topLevel irMap {-graphSimpleEnumId :: EnumId -> (Bool, Maybe String, Maybe String) -> Map.Map Span [Ir] -> String graphSimpleEnumId (EnumIdIdent posident) _ irMap = graphSimplePosIdent posident irMap graphSimpleEnumId (PosEnumIdIdent _ posident) topLevel irMap = graphSimpleEnumId (EnumIdIdent posident) topLevel irMap-} -- CVL Printer -- --parent is Maybe the uid of the immediate parent graphCVLModule :: Module -> Map.Map Span [Ir] -> String graphCVLModule (Module _ []) _ = "" graphCVLModule (Module _ (x:xs)) irMap = graphCVLDeclaration x Nothing irMap ++ graphCVLModule (Module noSpan xs) irMap graphCVLDeclaration :: Declaration -> Maybe String -> Map.Map Span [Ir] -> String graphCVLDeclaration (ElementDecl _ element) parent irMap = graphCVLElement element parent irMap graphCVLDeclaration _ _ _ = "" graphCVLElement :: Element -> Maybe String -> Map.Map Span [Ir] -> String graphCVLElement (Subclafer _ clafer) parent irMap = graphCVLClafer clafer parent irMap graphCVLElement (ClaferUse _ name _ _) parent irMap = if parent == Nothing then "" else "?" ++ " -> " ++ graphCVLName name parent irMap ++ " [arrowhead = onormal style = dashed constraint = false];\n" {-graphCVLElement (PosClaferUse s _ _ _) parent irMap = if parent == Nothing then "" else "?" ++ " -> " ++ getUseId s irMap ++ " [arrowhead = onormal style = dashed constraint = false];\n"-} graphCVLElement (Subconstraint _ constraint) parent irMap = graphCVLConstraint constraint parent irMap graphCVLElement _ _ _ = "" graphCVLElements :: Elements -> Maybe String -> Map.Map Span [Ir] -> String graphCVLElements (ElementsEmpty _) _ _ = "" graphCVLElements (ElementsList _ es) parent irMap = concatMap (\x -> graphCVLElement x parent irMap ++ "\n") es graphCVLClafer :: Clafer -> Maybe String -> Map.Map Span [Ir] -> String {-graphCVLClafer (Clafer _ _ _ _ _ _ _) _ _ = ""-} graphCVLClafer (Clafer s _ gCard _ super' crd _ es) parent irMap = let {{-tooltip = genTooltip (Module [ElementDecl (Subclafer (Clafer abstract gCard id' super' crd init' es))]) irMap;-} uid' = getDivId s irMap; gcrd = graphCVLGCard gCard parent irMap; super'' = graphCVLSuper super' parent irMap} in "\"" ++ uid' ++ "\" [URL=\"#" ++ uid' ++ "\" label=\"" ++ dropUid uid' ++ super'' ++ (if choiceCard crd then "\" style=rounded" else " [" ++ graphCVLCard crd parent irMap ++ "]\"") ++ (if super'' == "" then "" else " shape=oval") ++ "];\n" ++ (if gcrd == "" then "" else "g" ++ uid' ++ " [label=\"" ++ gcrd ++ "\" fontsize=10 shape=triangle];\ng" ++ uid' ++ " -> " ++ uid' ++ " [weight=10];\n") ++ (if parent==Nothing then "" else uid' ++ " -> " ++ fromJust parent ++ (if lowerCard crd == "0" then " [style=dashed]" else "") ++ ";\n") ++ graphCVLElements es (if gcrd == "" then (Just uid') else (Just $ "g" ++ uid')) irMap graphCVLSuper :: Super -> Maybe String -> Map.Map Span [Ir] -> String graphCVLSuper (SuperEmpty _) _ _ = "" graphCVLSuper (SuperSome _ superHow setExp) parent irMap = graphCVLSuperHow superHow ++ concat (graphCVLSetExp setExp parent irMap) graphCVLSuperHow :: SuperHow -> String graphCVLSuperHow (SuperColon _) = ":" graphCVLSuperHow (SuperArrow _) = "->" graphCVLSuperHow (SuperMArrow _) = "->>" graphCVLName :: Name -> Maybe String -> Map.Map Span [Ir] -> String graphCVLName (Path _ modids) parent irMap = unwords $ map (\x -> graphCVLModId x parent irMap) modids graphCVLModId :: ModId -> Maybe String -> Map.Map Span [Ir] -> String graphCVLModId (ModIdIdent _ posident) _ irMap = graphCVLPosIdent posident irMap graphCVLPosIdent :: PosIdent -> Map.Map Span [Ir] -> String graphCVLPosIdent (PosIdent (pos, id')) irMap = getUid (PosIdent (pos, id')) irMap graphCVLConstraint :: Constraint -> Maybe String -> Map.Map Span [Ir] -> String {-graphCVLConstraint (Constraint _) _ _ = ""-} graphCVLConstraint (Constraint s exps') parent irMap = let body' = htmlNewlines $ genTooltip (Module noSpan [ElementDecl noSpan (Subconstraint noSpan (Constraint noSpan exps'))]) irMap; uid' = "\"" ++ getExpId s irMap ++ "\"" in uid' ++ " [label=\"" ++ body' ++ "\" shape=parallelogram];\n" ++ if parent == Nothing then "" else uid' ++ " -> \"" ++ fromJust parent ++ "\";\n" graphCVLCard :: Card -> Maybe String -> Map.Map Span [Ir] -> String graphCVLCard (CardEmpty _) _ _ = "1..1" graphCVLCard (CardLone _) _ _ = "0..1" graphCVLCard (CardSome _) _ _ = "1..*" graphCVLCard (CardAny _) _ _ = "0..*" graphCVLCard (CardNum _ (PosInteger (_, n))) _ _ = n ++ ".." ++ n graphCVLCard (CardInterval _ ncard) parent irMap = graphCVLNCard ncard parent irMap graphCVLNCard :: NCard -> Maybe String -> Map.Map Span [Ir] -> String graphCVLNCard (NCard _ (PosInteger (_, num)) exInteger) parent irMap = num ++ ".." ++ graphCVLExInteger exInteger parent irMap graphCVLExInteger :: ExInteger -> Maybe String -> Map.Map Span [Ir] -> String graphCVLExInteger (ExIntegerAst _) _ _ = "*" graphCVLExInteger (ExIntegerNum _ (PosInteger(_, num))) _ _ = num graphCVLGCard :: GCard -> Maybe String -> Map.Map Span [Ir] -> String graphCVLGCard (GCardInterval _ ncard) parent irMap = graphCVLNCard ncard parent irMap graphCVLGCard (GCardEmpty _) _ _ = "" graphCVLGCard (GCardXor _) _ _ = "1..1" graphCVLGCard (GCardOr _) _ _ = "1..*" graphCVLGCard (GCardMux _) _ _ = "0..1" graphCVLGCard (GCardOpt _) _ _ = "" {-graphCVLDecl _ _ _ = "" graphCVLInit _ _ _ = "" graphCVLInitHow _ _ _ = "" graphCVLExp _ _ _ = "" graphCVLQuant _ _ _ = "" graphCVLGoal _ _ _ = "" graphCVLSoftConstraint _ _ _ = "" graphCVLAbstract _ _ _ = ""-} graphCVLSetExp :: SetExp -> Maybe String -> Map.Map Span [Ir] -> [String] graphCVLSetExp (ClaferId _ name) parent irMap = [graphCVLName name parent irMap] graphCVLSetExp (Union _ set1 set2) parent irMap = graphCVLSetExp set1 parent irMap ++ graphCVLSetExp set2 parent irMap graphCVLSetExp (UnionCom _ set1 set2) parent irMap = graphCVLSetExp set1 parent irMap ++ graphCVLSetExp set2 parent irMap graphCVLSetExp (Difference _ set1 set2) parent irMap = graphCVLSetExp set1 parent irMap ++ graphCVLSetExp set2 parent irMap graphCVLSetExp (Intersection _ set1 set2) parent irMap = graphCVLSetExp set1 parent irMap ++ graphCVLSetExp set2 parent irMap graphCVLSetExp (Domain _ set1 set2) parent irMap = graphCVLSetExp set1 parent irMap ++ graphCVLSetExp set2 parent irMap graphCVLSetExp (Range _ set1 set2) parent irMap = graphCVLSetExp set1 parent irMap ++ graphCVLSetExp set2 parent irMap graphCVLSetExp (Join _ set1 set2) parent irMap = graphCVLSetExp set1 parent irMap ++ graphCVLSetExp set2 parent irMap {-graphCVLEnumId (EnumIdIdent posident) _ irMap = graphCVLPosIdent posident irMap graphCVLEnumId (PosEnumIdIdent _ posident) parent irMap = graphCVLEnumId (EnumIdIdent posident) parent irMap-} choiceCard :: Card -> Bool choiceCard (CardEmpty _) = True choiceCard (CardLone _ )= True choiceCard (CardInterval _ nCard) = case nCard of NCard _ (PosInteger (_, low)) exInteger -> choiceCard' low exInteger where choiceCard' low exInteger = if low == "0" || low == "1" then case exInteger of ExIntegerAst _ -> False ExIntegerNum _ (PosInteger (_, high)) -> high == "0" || high == "1" else False choiceCard _ = False lowerCard :: Card -> String lowerCard crd = takeWhile (/= '.') $ graphCVLCard crd Nothing Map.empty --Miscellaneous functions dropUid :: String -> String dropUid uid' = let id' = rest $ dropWhile (\x -> x /= '_') uid' in if id' == "" then uid' else id' rest :: String -> String rest [] = [] rest (_:xs) = xs getUid :: PosIdent -> Map.Map Span [Ir] -> String getUid (PosIdent (pos, id')) irMap = if Map.lookup (getSpan (PosIdent (pos, id'))) irMap == Nothing then id' else let IRPExp pexp = head $ fromJust $ Map.lookup (getSpan (PosIdent (pos, id'))) irMap in findUid id' $ getIdentPExp pexp where {getIdentPExp (PExp _ _ _ exp') = getIdentIExp exp'; getIdentIExp (IFunExp _ exps') = concatMap getIdentPExp exps'; getIdentIExp (IClaferId _ id'' _) = [id'']; getIdentIExp (IDeclPExp _ _ pexp) = getIdentPExp pexp; getIdentIExp _ = []; findUid name (x:xs) = if name == dropUid x then x else findUid name xs; findUid name [] = name} getDivId :: Span -> Map.Map Span [Ir] -> String getDivId s irMap = if Map.lookup s irMap == Nothing then "Uid not Found" else let IRClafer iClaf = head $ fromJust $ Map.lookup s irMap in _uid iClaf {-getSuperId :: Span -> Map.Map Span [Ir] -> String getSuperId s irMap = if Map.lookup s irMap == Nothing then "Uid not Found" else let IRPExp pexp = head $ fromJust $ Map.lookup s irMap in sident $ exp pexp-} getUseId :: Span -> Map.Map Span [Ir] -> String getUseId s irMap = if Map.lookup s irMap == Nothing then "Uid not Found" else let IRClafer iClaf = head $ fromJust $ Map.lookup s irMap in _sident $ _exp $ head $ _supers $ _super iClaf getExpId :: Span -> Map.Map Span [Ir] -> String getExpId s irMap = if Map.lookup s irMap == Nothing then "Uid not Found" else let IRPExp pexp = head $ fromJust $ Map.lookup s irMap in _pid pexp {-while :: Bool -> [IExp] -> [IExp] while bool exp' = if bool then exp' else []-} htmlNewlines :: String -> String htmlNewlines "" = "" htmlNewlines ('\n':xs) = "&#10;" ++ htmlNewlines xs htmlNewlines (x:xs) = x:htmlNewlines xs cleanOutput :: String -> String cleanOutput "" = "" cleanOutput (' ':'\n':xs) = cleanOutput $ '\n':xs cleanOutput ('\n':'\n':xs) = cleanOutput $ '\n':xs cleanOutput (' ':'<':'b':'r':'>':xs) = "<br>"++cleanOutput xs cleanOutput (x:xs) = x : cleanOutput xs
juodaspaulius/clafer-old-customBNFC
src/Language/Clafer/Generator/Graph.hs
mit
20,265
0
19
5,018
5,302
2,694
2,608
213
7
module RenameMeToo where import {-# SOURCE #-} RenameMe data Even = Zero | Odd Odd y = False
antalsz/hs-to-coq
examples/tests/RenameMeToo.hs
mit
97
0
6
22
25
16
9
4
1
{-# LANGUAGE NamedFieldPuns #-} module Game.World.Gen.Frequency ( getDistribution , roomTypeFreqDist , roomSizeFreqDist ) where import System.Random import Data.Maybe import Game.World.Gen.Types import Control.Lens data FreqDist a b = FreqDist { freqDist :: [(a, b)] } getDistribution :: (Show b, Num b, Ord b, Random b) => FreqDist a b -> GenContext a getDistribution freq = do g <- use stateRndGen let (res, g') = _getDistribution g freq stateRndGen .= g' return res _getDistribution :: (Show b, Num b, Ord b, Random b, RandomGen g) => g -> FreqDist a b -> (a, g) _getDistribution g FreqDist { freqDist } = (result, g') where range = (0, (sum . map snd $ freqDist) - 1) (randVal, g') = randomR range g result = fromJust . fst $ foldr findResult (Nothing, 0) freqDist findResult (a, b) (Nothing, s) = if s + b > randVal then (Just a, 0) else (Nothing, s + b) findResult _ (Just res, _) = (Just res, 0) roomTypeFreqDist :: FreqDist RoomType Int roomTypeFreqDist = FreqDist [ (DefaultRoom, 9 :: Int) , (BossRoom, 1) ] roomSizeFreqDist :: RoomType -> FreqDist RoomSize Int roomSizeFreqDist DefaultRoom = FreqDist [ (RoomSize 2 2, 1 :: Int) , (RoomSize 2 3, 1) , (RoomSize 2 4, 1) , (RoomSize 3 2, 1) , (RoomSize 3 3, 1) , (RoomSize 3 4, 1) , (RoomSize 4 2, 1) , (RoomSize 4 3, 1) , (RoomSize 4 4, 1) ] -- | Boss rooms are always big roomSizeFreqDist BossRoom = FreqDist [ (RoomSize 4 4, 1) ] initTest :: IO StdGen initTest = newStdGen
mfpi/q-inqu
Game/World/Gen/Frequency.hs
mit
1,664
0
12
491
634
350
284
50
3
module InterBasics where import Data.Char type Input = [String] type Output = [String] type RawInput = [Char] type RawOutput = [Char] {- Contains various auxilliary functions and definitions for Input/output Version 1.0 18 September 1989 Version 2.0 25 May 2017 Simon Thompson, Computing Lab., Univ. of Kent. sjt@ukc.ac.uk -} {- The fundamental type definitions Note that we have chosen to consider Input and Output as consisting of streams of Strings rather than streams of Char. Conversion to and from the ``raw'' versions is trivial: RawInput is split at newlines, and RawOutput is the result of concatenating the String forming the output stream. (Note that this means that we are explicit about the placing of newlines etc. -} newline,space,tab :: Char newline = '\n' space = ' ' tab = '\t' stdin :: [Char] stdin = "/dev/tty" {- Some sensible names. Note that stdin names standard Input as a file. -} split :: RawInput -> Input gen_split :: Char -> RawInput -> Input {- split splits RawInput into lines. Defined in terms of the more general gen_split which splits Input at occurrences of its first argument, a Character. Following these definitions we have two more general ones, developed in the course of writing a text processing system. They are more general in that they allow 1. splitting on more than one Character 2. multiple occurrences of the splitting Characters to be treated in a similar way to single occurrences. -} split = gen_split newline gen_split ch l = aux_split ch [] l where aux_split ch sofar (a:rest) | a == ch = rever sofar : gen_split ch rest | otherwise = aux_split ch (a:sofar) rest aux_split ch sofar [] = [ rever sofar ] {- Splitting lists into lists of lists according to membership of a `split_set' Lists can be split into sublists in two slightly different ways, depending on how we treat repeated occurrences of members of the split_set. We can either treat a repetition as delimiting an empty list, as we do in `cut', or we can treat repetitions as single instances, which we do in `simple_cut'. Both flavours have their uses. -} cut :: Eq a => [a] -> [a] -> [[a]] cut splitSet [] = [] cut splitSet (a:x) = cut_aux [] (a:x) where cut_aux l [] | l /= [] = [l] | otherwise = [] cut_aux l (a:x) | not (elem a splitSet) = cut_aux (l++[a]) x | otherwise = l : (cut_aux [] x) simple_cut :: Eq a => [a] -> [a] -> [[a]] simple_cut splitSet [] = [] simple_cut splitSet (a:x) = cut_aux [] (a:x) where cut_aux l [] | l/=[] = [l] | otherwise = [] cut_aux l (a:x) | not (elem a splitSet) = cut_aux (l++[a]) x | l /= [] = l : (cut_aux [] x) | otherwise = cut_aux [] x {- An auxilliary function : an efficient reversing function based on shunting -} rever :: [a] -> [a] rever l = shunt l [] shunt :: [a] -> [a] -> [a] shunt [] m = m shunt (a:x) m = shunt x (a:m) join :: Output -> RawOutput {- join joins lines, and is an alias for concat. -} join = concat -- from the standard envt. {- Dealing with basic types, of numbers and Characters. -} numeric :: Char -> Bool -- To test for particular alpha :: Char -> Bool -- kinds of Character. alphanumeric :: Char -> Bool numeric = Data.Char.isDigit -- from the standard envt. alpha = Data.Char.isLetter -- ditto. alphanumeric ch = alpha ch || numeric ch {- Testing for Strings consisting of particular kinds of Character Note that the empty String is classed as being in the respective classes. -} numeric_String :: String -> Bool alpha_String :: String -> Bool alphanumeric_String :: String -> Bool integer_String :: String -> Bool numeric_String = foldr (&&) True . map numeric alpha_String = foldr (&&) True . map alpha alphanumeric_String = foldr (&&) True . map alphanumeric integer_String x = numeric_String x || ( head x == '-' && numeric_String (tail x) ) {- Converting Strings to numbers and vice versa. The empty numeric String is translated as zero. -} string_posint :: String -> Int string_int :: String -> Int string_posint = conv_aux . rever where conv_aux (a:x) | numeric a = (ord a - ord '0') + 10 * conv_aux x | otherwise = error "String_posint found non-numeric Character" conv_aux [] = 0 string_int (a:x) | numeric a = string_posint (a:x) | a == '-' = - (string_posint x) | otherwise = error "unexpected first Character to String_int" string_int [] = 0 num_String :: Integer -> String num_String = show -- A standard function
simonjohnthompson/Interaction
InterBasics.hs
mit
6,103
0
12
2,566
1,122
587
535
79
2
module Data.Monetary.USD where -- Representation of US dollars as rational numbers -- 2015-12-07: Corrected read parse errors for stupid (AAPL) numbers like: $.12 import qualified Data.ByteString.Char8 as B import Data.Monoid import Control.Presentation import Data.Monetary.Currency import Database.PostgreSQL.Simple.FromField import Database.PostgreSQL.Simple.ToField import Database.PostgreSQL.Simple.Types -- Spraken dollars, mang! data USD = USD Rational deriving Eq -- one line of declaration followed by HOW many lines of instantiation? instance Ord USD where USD x <= USD y = x <= y instance Show USD where show (USD x) = '$':laxmi 2 x instance Read USD where readsPrec _ ('$':val) = [(mknMoney USD ('0':val), "")] instance FromField USD where fromField f bs = USD . toRational <$> fromDoubleField f bs fromDoubleField :: FieldParser Double fromDoubleField f bs = maybe (returnError UnexpectedNull f "") (pure . read . B.unpack) bs instance ToField USD where toField = toField . doubledown doubledown :: USD -> Double doubledown (USD d) = fromRational d -- *Main> read "$.12" :: USD ~> $0.12 -- *Main> read "$1.12" :: USD ~> $1.12 -- *Main> read "$0.12" :: USD ~> $0.12 -- okay, how hard was that AAPL? -- e.g.: http://investor.apple.com/dividends.cfm instance Raw USD where rep (USD x) = laxmi 2 x instance Currency USD where value (USD x) = x -- so Price-types are copointed ... instance Num USD where d1 - d2 = USD $ value d1 - value d2 negate dollar = USD $ 0.0 - value dollar d1 + d2 = USD $ value d1 + value d2 d1 * d2 = USD $ value d1 * value d2 abs dollar = USD $ abs (value dollar) signum dollar = USD $ signum (value dollar) fromInteger x = USD (fromInteger x) instance Fractional USD where d1 / d2 = USD $ value d1 / value d2 fromRational = USD instance Monoid USD where mempty = USD 0 (USD a) `mappend` (USD b) = USD $ a + b -- because when you mappend dollars they are summed.
geophf/1HaskellADay
exercises/HAD/Data/Monetary/USD.hs
mit
1,967
0
10
396
601
310
291
38
1
module Language.Brainfuck.Py2Bf.BfpointerSpec where import Test.Hspec import Language.Brainfuck.Py2Bf.Bf import Language.Brainfuck.Py2Bf.Bfpointer spec :: Spec spec = describe "Bfpcode" runSpec hello :: Bfpcode hello = Bfpcode [ Addp 0 9 , Whilep 0 [ Addp 1 8, Addp 2 11, Addp 3 5, Addp 0 (-1) ] , Putp 1 , Addp 2 2, Putp 2, Addp 2 7, Putp 2, Putp 2 , Addp 2 3, Putp 2, Addp 3 (-1), Putp 3 , Addp 3 (-12), Putp 3, Addp 2 8, Putp 2 , Addp 2 (-8), Putp 2, Addp 2 3, Putp 2 , Addp 2 (-6), Putp 2, Addp 2 (-8), Putp 2 , Addp 3 1, Putp 3 ] runSpec :: Spec runSpec = it "runs Bfpcode correctly" $ runString hello `shouldBe` "Hello, world!"
itchyny/py2bf.hs
test/Language/Brainfuck/Py2Bf/BfpointerSpec.hs
mit
709
0
11
201
325
173
152
23
1
module Main (main) where import qualified Examples.Rpc.CalculatorClient import qualified Examples.Rpc.CalculatorServer import qualified Examples.Rpc.EchoClient import qualified Examples.Rpc.EchoServer import qualified Examples.Serialization.HighLevel.Read import qualified Examples.Serialization.HighLevel.Write import qualified Examples.Serialization.LowLevel.Read import qualified Examples.Serialization.LowLevel.Write import Data.List (intercalate) import System.Environment (getArgs) import System.Exit (exitFailure) import System.IO (hPutStrLn, stderr) main :: IO () main = do args <- getArgs case args of ["calculator-client"] -> Examples.Rpc.CalculatorClient.main ["calculator-server"] -> Examples.Rpc.CalculatorServer.main ["echo-client"] -> Examples.Rpc.EchoClient.main ["echo-server"] -> Examples.Rpc.EchoServer.main ["highlevel-read"] -> Examples.Serialization.HighLevel.Read.main ["highlevel-write"] -> Examples.Serialization.HighLevel.Write.main ["lowlevel-read"] -> Examples.Serialization.LowLevel.Read.main ["lowlevel-write"] -> Examples.Serialization.LowLevel.Write.main _ -> usageErr usageErr :: IO () usageErr = do hPutStrLn stderr ("Usage: run-capnp-example ( " ++ intercalate " | " [ "calculator-client" , "calculator-server" , "echo-client" , "echo-server" , "highlevel-read" , "highlevel-write" , "lowlevel-read" , "lowlevel-write" ] ++ " )" ) exitFailure
zenhack/haskell-capnp
examples/cmd/Main.hs
mit
1,695
0
12
438
321
197
124
42
9
module Haskeleton.TestBench (benchmarks) where import Haskeleton.Test import Criterion benchmarks :: [Benchmark] benchmarks = [ bench "main" (nfIO main) ]
Moredread/haskeleton-test
benchmark/Haskeleton/TestBench.hs
mit
166
0
8
30
46
27
19
6
1
{-# htermination eltsFM_LE :: (Ord a, Ord k) => FiniteMap (Either a k) b -> (Either a k) -> [b] #-} import FiniteMap
ComputationWithBoundedResources/ara-inference
doc/tpdb_trs/Haskell/full_haskell/FiniteMap_eltsFM_LE_10.hs
mit
117
0
3
23
5
3
2
1
0
{-# htermination minusFM :: FiniteMap Float b1 -> FiniteMap Float b2 -> FiniteMap Float b1 #-} import FiniteMap
ComputationWithBoundedResources/ara-inference
doc/tpdb_trs/Haskell/full_haskell/FiniteMap_minusFM_6.hs
mit
112
0
3
18
5
3
2
1
0
module Battleship.Swallow.Test (swallowSuite) where import Test.Tasty (testGroup, TestTree) import Test.Tasty.HUnit import Battleship.Swallow swallowSuite :: TestTree swallowSuite = testGroup "Swallow" [testCase "swallow test" testSwallow] testSwallow :: Assertion testSwallow = "something" @=? swallow "some" "thing"
sgrove/battlehaskell
test/Battleship/Swallow/Test.hs
mit
328
0
7
43
78
45
33
10
1
{-# LANGUAGE PatternSynonyms #-} -- For HasCallStack compatibility {-# LANGUAGE ImplicitParams, ConstraintKinds, KindSignatures #-} {-# OPTIONS_GHC -fno-warn-unused-imports #-} module JSDOM.Generated.AudioNode (connect, connectParam, disconnect, getContext, getNumberOfInputs, getNumberOfOutputs, setChannelCount, getChannelCount, setChannelCountMode, getChannelCountMode, setChannelInterpretation, getChannelInterpretation, AudioNode(..), gTypeAudioNode, IsAudioNode, toAudioNode) where import Prelude ((.), (==), (>>=), return, IO, Int, Float, Double, Bool(..), Maybe, maybe, fromIntegral, round, realToFrac, fmap, Show, Read, Eq, Ord, Maybe(..)) import qualified Prelude (error) import Data.Typeable (Typeable) import Data.Traversable (mapM) import Language.Javascript.JSaddle (JSM(..), JSVal(..), JSString, strictEqual, toJSVal, valToStr, valToNumber, valToBool, js, jss, jsf, jsg, function, asyncFunction, new, array, jsUndefined, (!), (!!)) import Data.Int (Int64) import Data.Word (Word, Word64) import JSDOM.Types import Control.Applicative ((<$>)) import Control.Monad (void) import Control.Lens.Operators ((^.)) import JSDOM.EventTargetClosures (EventName, unsafeEventName, unsafeEventNameAsync) import JSDOM.Enums -- | <https://developer.mozilla.org/en-US/docs/Web/API/AudioNode.connect Mozilla AudioNode.connect documentation> connect :: (MonadDOM m, IsAudioNode self, IsAudioNode destination) => self -> destination -> Maybe Word -> Maybe Word -> m () connect self destination output input = liftDOM (void ((toAudioNode self) ^. jsf "connect" [toJSVal destination, toJSVal output, toJSVal input])) -- | <https://developer.mozilla.org/en-US/docs/Web/API/AudioNode.connect Mozilla AudioNode.connect documentation> connectParam :: (MonadDOM m, IsAudioNode self) => self -> AudioParam -> Maybe Word -> m () connectParam self destination output = liftDOM (void ((toAudioNode self) ^. jsf "connect" [toJSVal destination, toJSVal output])) -- | <https://developer.mozilla.org/en-US/docs/Web/API/AudioNode.disconnect Mozilla AudioNode.disconnect documentation> disconnect :: (MonadDOM m, IsAudioNode self) => self -> Maybe Word -> m () disconnect self output = liftDOM (void ((toAudioNode self) ^. jsf "disconnect" [toJSVal output])) -- | <https://developer.mozilla.org/en-US/docs/Web/API/AudioNode.context Mozilla AudioNode.context documentation> getContext :: (MonadDOM m, IsAudioNode self) => self -> m AudioContext getContext self = liftDOM (((toAudioNode self) ^. js "context") >>= fromJSValUnchecked) -- | <https://developer.mozilla.org/en-US/docs/Web/API/AudioNode.numberOfInputs Mozilla AudioNode.numberOfInputs documentation> getNumberOfInputs :: (MonadDOM m, IsAudioNode self) => self -> m Word getNumberOfInputs self = liftDOM (round <$> (((toAudioNode self) ^. js "numberOfInputs") >>= valToNumber)) -- | <https://developer.mozilla.org/en-US/docs/Web/API/AudioNode.numberOfOutputs Mozilla AudioNode.numberOfOutputs documentation> getNumberOfOutputs :: (MonadDOM m, IsAudioNode self) => self -> m Word getNumberOfOutputs self = liftDOM (round <$> (((toAudioNode self) ^. js "numberOfOutputs") >>= valToNumber)) -- | <https://developer.mozilla.org/en-US/docs/Web/API/AudioNode.channelCount Mozilla AudioNode.channelCount documentation> setChannelCount :: (MonadDOM m, IsAudioNode self) => self -> Word -> m () setChannelCount self val = liftDOM ((toAudioNode self) ^. jss "channelCount" (toJSVal val)) -- | <https://developer.mozilla.org/en-US/docs/Web/API/AudioNode.channelCount Mozilla AudioNode.channelCount documentation> getChannelCount :: (MonadDOM m, IsAudioNode self) => self -> m Word getChannelCount self = liftDOM (round <$> (((toAudioNode self) ^. js "channelCount") >>= valToNumber)) -- | <https://developer.mozilla.org/en-US/docs/Web/API/AudioNode.channelCountMode Mozilla AudioNode.channelCountMode documentation> setChannelCountMode :: (MonadDOM m, IsAudioNode self, ToJSString val) => self -> val -> m () setChannelCountMode self val = liftDOM ((toAudioNode self) ^. jss "channelCountMode" (toJSVal val)) -- | <https://developer.mozilla.org/en-US/docs/Web/API/AudioNode.channelCountMode Mozilla AudioNode.channelCountMode documentation> getChannelCountMode :: (MonadDOM m, IsAudioNode self, FromJSString result) => self -> m result getChannelCountMode self = liftDOM (((toAudioNode self) ^. js "channelCountMode") >>= fromJSValUnchecked) -- | <https://developer.mozilla.org/en-US/docs/Web/API/AudioNode.channelInterpretation Mozilla AudioNode.channelInterpretation documentation> setChannelInterpretation :: (MonadDOM m, IsAudioNode self, ToJSString val) => self -> val -> m () setChannelInterpretation self val = liftDOM ((toAudioNode self) ^. jss "channelInterpretation" (toJSVal val)) -- | <https://developer.mozilla.org/en-US/docs/Web/API/AudioNode.channelInterpretation Mozilla AudioNode.channelInterpretation documentation> getChannelInterpretation :: (MonadDOM m, IsAudioNode self, FromJSString result) => self -> m result getChannelInterpretation self = liftDOM (((toAudioNode self) ^. js "channelInterpretation") >>= fromJSValUnchecked)
ghcjs/jsaddle-dom
src/JSDOM/Generated/AudioNode.hs
mit
5,634
0
13
1,063
1,249
690
559
95
1
{-| Module: Y2015.D16 Description: Advent of Code Day 16 Solutions. License: MIT Maintainer: @tylerjl Solutions to the day 16 set of problems for <adventofcode.com>. -} module Y2015.D16 (findAunt, findRealAunt) where import Data.List (maximumBy) import Data.Map.Strict (Map, differenceWith, differenceWithKey, fromList, size) type Aunt = Map String Int -- |Finds the real Aunt given altered targeting criteria findRealAunt :: String -- ^ Raw input of list of Aunts -> Int -- ^ Id of the gifting Aunt findRealAunt = findGifter (size . differenceWithKey match gifter) where match "cats" target candidate = candidate `gtNothing` target match "trees" target candidate = candidate `gtNothing` target match "pomeranians" target candidate = target `gtNothing` candidate match "goldfish" target candidate = target `gtNothing` candidate match _ target candidate = candidate `sameNothing` target gtNothing a b | a > b = Nothing | otherwise = Just a -- |Given a list of Aunts, find the Id of the gifting Aunt. findAunt :: String -- ^ Raw input of list of Aunts -> Int -- ^ Id of the gifting Aunt findAunt = findGifter (size . differenceWith sameNothing gifter) sameNothing :: (Eq a) => a -> a -> Maybe a sameNothing a b | a == b = Nothing | otherwise = Just a findGifter :: (Aunt -> Int) -> String -> Int findGifter f aunts = snd . maximumBy (flip compare) $ zip (map f (toAunts aunts)) [1..] gifter :: Aunt gifter = toAunt $ words ("Sue 0: children: 3 cats: 7 samoyeds: 2 " ++ "pomeranians: 3 akitas: 0 vizslas: 0 " ++ "goldfish: 5 trees: 3 cars: 2 perfumes: 1") toAunts :: String -> [Aunt] toAunts = map (toAunt . words) . lines . filter (/= ',') toAunt :: [String] -> Aunt toAunt (_:_:traits) = fromList $ toPair traits where toPair (x:y:ys) = (init x, read y) : toPair ys toPair _ = [] toAunt _ = fromList []
tylerjl/adventofcode
src/Y2015/D16.hs
mit
2,070
0
10
580
544
289
255
34
5
{-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE OverloadedStrings #-} {-| Module : Network.WebexTeams Copyright : (c) Naoto Shimazaki 2017,2018 License : MIT (see the file LICENSE) Maintainer : https://github.com/nshimaza Stability : experimental This module provides types and functions for accessing Cisco Webex Teams REST API. The module is designed to improve type safety over the API. Each entity is separately typed. JSON messages contained in REST responses are decoded into appropriate type of Haskell record. JSON messages sent in REST requests are encoded only from correct type of record. Some Webex Teams REST API return list of objects. Those APIs require HTTP Link Header based pagination. Haskell functions for those APIs automatically request subsequent pages as needed. = Examples @ -- Sending a message to a room. let auth = Authorization "your authorization token" roomId = RoomId "Room ID your message to be sent" messageText = MessageText "your message" message = CreateMessage (Just roomId) Nothing Nothing (Just messageText) Nothing Nothing createEntity auth def createMessage >>= print . getResponseBody -- Obtaining detail of a user. let personId = PersonId "your person ID" getDetail auth def personId >>= print . getResponseBody -- Obtaining membership of a room as stream of object representing each membership relation. let filter = MembershipFilter yourRoomId Nothing Nothing runConduit $ streamListWithFilter auth def filter .| takeC 200 .| mapM_C print -- Create a room. let createRoom = CreateRoom "Title of the new room" Nothing createEntity auth def createRoom >>= print . getResponseBody -- Delete a room. deleteRoom auth def roomId >>= print . getResponseBody @ = List and steaming The 'WebexTeams' module doesn't provide streaming API for REST response returning list of entities. It is because the author of the package wants to keep it streaming library agnostic. Instead, it provides 'ListReader' IO action to read list responses with automatic pagenation. Streaming APIs can be found in separate packages like webex-teams-pipes or webex-teams-conduit. = Support for Lens This package provides many of records representing objects communicated via Webex Teams REST API. Those records are designed to allow create lenses by Control.Lens.TH.makeFields. Following example creates overloaded accessors for 'Person', 'Room' and 'Team'. @ makeFields ''Person makeFields ''Room makeFields ''Team @ You can access 'personId', 'roomId' and 'teamId' via overloaded accessor function 'id' like this. @ let yourPersonId = yourPerson ^. id yourRoomId = yourRoom ^. id yourTeamId = yourTeam ^. id @ This package does not provide pre-generated lenses for you because not everyone need it but you can make it by yourself so easily as described. -} module Network.WebexTeams ( -- * Types -- ** Class and Type Families WebexTeamsFilter , WebexTeamsListItem , ToResponse -- ** Common Types , Authorization (..) , CiscoSparkRequest (..) , WebexTeamsRequest (..) , Timestamp (..) , ErrorCode (..) , ErrorTitle (..) , Errors (..) -- ** People related types , Person (..) , PersonId (..) , Email (..) , DisplayName (..) , NickName (..) , FirstName (..) , LastName (..) , AvatarUrl (..) , Timezone (..) , PersonStatus (..) , PersonType (..) , PersonList (..) , PersonFilter (..) , CreatePerson (..) , UpdatePerson (..) -- ** Room related types , Room (..) , RoomId (..) , RoomTitle (..) , RoomType (..) , SipAddr (..) , RoomList (..) , RoomFilter (..) , RoomFilterSortBy (..) , CreateRoom (..) , UpdateRoom (..) -- ** Membership related types , Membership (..) , MembershipId (..) , MembershipList (..) , MembershipFilter (..) , CreateMembership (..) , UpdateMembership (..) -- ** Message related types , Message (..) , MessageId (..) , MessageText (..) , MessageHtml (..) , MessageMarkdown (..) , FileUrl (..) , MessageList (..) , MessageFilter (..) , MentionedPeople (..) , CreateMessage (..) -- ** Team related types , TeamName (..) , TeamId (..) , Team (..) , TeamList (..) , CreateTeam (..) , UpdateTeam (..) -- ** Team Membership related types , TeamMembership (..) , TeamMembershipId (..) , TeamMembershipList (..) , TeamMembershipFilter (..) , CreateTeamMembership (..) , UpdateTeamMembership (..) -- ** Organization related types , Organization (..) , OrganizationId (..) , OrganizationDisplayName (..) , OrganizationList (..) -- ** License related types , License (..) , LicenseId (..) , LicenseName (..) , LicenseUnit (..) , LicenseList (..) , LicenseFilter (..) -- ** Role related types , Role (..) , RoleId (..) , RoleName (..) , RoleList (..) -- * Functions -- ** Getting detail of an entity , getDetail , getDetailEither -- ** Streaming response of List API with auto pagenation , ListReader , getListWithFilter , getTeamList , getOrganizationList , getRoleList , streamEntityWithFilter , streamTeamList , streamOrganizationList , streamRoleList -- ** Creating an entity , createEntity , createEntityEither -- ** Updating an entity , updateEntity , updateEntityEither -- ** Creating default filter spec from mandatory field , defaultMessageFilter , defaultTeamMembershipFilter -- ** Deleting an entity , deleteRoom , deleteMembership , deleteMessage , deleteTeam , deleteTeamMembership ) where import Conduit (ConduitT, yieldMany) import Control.Monad.IO.Class (MonadIO, liftIO) import Data.Aeson (FromJSON, ToJSON) import Data.ByteString (ByteString) import Data.ByteString.Char8 as C8 (unpack) import Data.Default (Default (def)) import Data.IORef (IORef, newIORef, readIORef, writeIORef) import Data.Maybe (catMaybes, maybeToList) import Data.Monoid ((<>)) import Data.Text (Text) import Data.Text.Encoding (encodeUtf8) import Network.HTTP.Simple import Network.URI (URIAuth (..)) import Network.WebexTeams.Internal import Network.WebexTeams.Types -- | Authorization string against Webex Teams API to be contained in HTTP Authorization header of every request. newtype Authorization = Authorization ByteString deriving (Eq, Show) -- | Wrapping 'Request' in order to provide easy default value specifically for Webex Teams public API. data WebexTeamsRequest = WebexTeamsRequest { webexTeamsRequestRequest :: Request -- ^ Holds pre-set 'Request' for REST API. , webexTeamsRequestScheme :: String -- ^ Should be "https:" in production. , webexTeamsRequestAuthority :: URIAuth -- ^ Authority part of request URI. } deriving (Show) -- | Type synonym for backward compatibility. type CiscoSparkRequest = WebexTeamsRequest -- | Common part of 'Request' against Webex Teams API. webexTeamsBaseRequest :: Request webexTeamsBaseRequest = addRequestHeader "Content-Type" "application/json; charset=utf-8" $ setRequestPort 443 $ setRequestHost "api.ciscospark.com" $ setRequestSecure True $ defaultRequest -- | Default parameters for HTTP request to Webex Teams REST API. instance Default WebexTeamsRequest where def = WebexTeamsRequest webexTeamsBaseRequest "https:" $ URIAuth "" "api.ciscospark.com" "" -- | Add given Authorization into request header. addAuthorizationHeader :: Authorization -> Request -> Request addAuthorizationHeader (Authorization auth) = addRequestHeader "Authorization" ("Bearer " <> auth) -- | Building common part of 'Request' for List APIs. makeCommonListReq :: WebexTeamsRequest -- ^ Common request components -> ByteString -- ^ API category part of REST URL path -> WebexTeamsRequest makeCommonListReq base@WebexTeamsRequest { webexTeamsRequestRequest = req } path = base { webexTeamsRequestRequest = setRequestPath ("/v1/" <> path) $ setRequestMethod "GET" req } {-| Common worker function for List APIs. It accesses List API with given 'Request', unwrap result into list of items, stream them to Conduit pipe and finally it automatically accesses next page designated via HTTP Link header if available. -} streamList :: (MonadIO m, WebexTeamsListItem i) => Authorization -> WebexTeamsRequest -> ConduitT () i m () streamList auth (WebexTeamsRequest req scheme uriAuth) = do res <- httpJSON $ addAuthorizationHeader auth req yieldMany . unwrap $ getResponseBody res streamListLoop auth res scheme uriAuth -- | Processing pagination by HTTP Link header. streamListLoop :: (MonadIO m, FromJSON a, WebexTeamsListItem i) => Authorization -> Response a -> String -> URIAuth -> ConduitT () i m () streamListLoop auth res scheme uriAuth = case getNextUrl res >>= validateUrl scheme uriAuth >>= (\url -> parseRequest $ "GET " <> C8.unpack url) of Nothing -> pure () Just nextReq -> do nextRes <- httpJSON $ addAuthorizationHeader auth nextReq yieldMany . unwrap $ getResponseBody nextRes streamListLoop auth nextRes scheme uriAuth -- | Get list of entities with query parameter and stream it into Conduit pipe. It automatically performs pagination. {-# DEPRECATED streamEntityWithFilter "Use getListWithFilter or streamListWithFilter of webex-teams-conduit" #-} streamEntityWithFilter :: (MonadIO m, WebexTeamsFilter filter, WebexTeamsListItem (ToResponse filter)) => Authorization -> WebexTeamsRequest -> filter -> ConduitT () (ToResponse filter) m () streamEntityWithFilter auth base param = streamList auth $ setQeuryString $ makeCommonListReq base (apiPath param) where setQeuryString comm@WebexTeamsRequest { webexTeamsRequestRequest = req } = comm { webexTeamsRequestRequest = setRequestQueryString (toFilterList param) req } -- | List of 'Team' and stream it into Conduit pipe. It automatically performs pagination. {-# DEPRECATED streamTeamList "Use getTeamList or streamTeamList of webex-teams-conduit" #-} streamTeamList :: MonadIO m => Authorization -> WebexTeamsRequest -> ConduitT () Team m () streamTeamList auth base = streamList auth $ makeCommonListReq base teamsPath -- | Filter list of 'Organization' and stream it into Conduit pipe. It automatically performs pagination. {-# DEPRECATED streamOrganizationList "Use getOrganizationList or streamOrganizationList of webex-teams-conduit" #-} streamOrganizationList :: MonadIO m => Authorization -> WebexTeamsRequest -> ConduitT () Organization m () streamOrganizationList auth base = streamList auth $ makeCommonListReq base organizationsPath -- | List of 'Role' and stream it into Conduit pipe. It automatically performs pagination. {-# DEPRECATED streamRoleList "Use getRoleList or streamRoleList of webex-teams-conduit" #-} streamRoleList :: MonadIO m => Authorization -> WebexTeamsRequest -> ConduitT () Role m () streamRoleList auth base = streamList auth $ makeCommonListReq base rolesPath {-| 'ListReader' is IO action returned by functions for list API ('getListWithFilter', 'getTeamList' etc). It is containing URL inside to be accessed. When you call the IO action, it accesses to Webex Teams REST API, parse next page URL if available, then return new IO action. The new IO action contains list of responded items and new URL for next page so you can call the new IO action to get the next page. Following example demonstrates how you can get all items into single list. @ readAllList :: ListReader i -> IO [i] readAllList reader = go [] where go xs = reader >>= \chunk -> case chunk of [] -> pure xs ys -> go (xs <> ys) @ Note that this example is only for explaining how 'ListReader' works. Practically you should not do the above because it eagerly creates entire list. You should use streaming APIs instead. Streaming APIs are available via webex-teams-conduit and webex-teams-pipes package. -} type ListReader a = IO [a] {-| Returns common worker function 'ListReader' for List APIs. ListReader accesses List API with given 'Request' then return responded list of items. ListReader also keeps next URL if response is pagenated and next page is available. Next call of ListReader causes another List API access for the next page. ListReader returns [] when there is no more page. -} getList :: (MonadIO m, WebexTeamsListItem i) => Authorization -> WebexTeamsRequest -> m (ListReader i) getList auth wxReq = liftIO $ listReader <$> newIORef (Just wxReq) where listReader :: WebexTeamsListItem i => IORef (Maybe WebexTeamsRequest) -> ListReader i listReader wxReqRef = do maybeReq <- readIORef wxReqRef case maybeReq of Nothing -> pure [] Just (WebexTeamsRequest req scheme uriAuth) -> do res <- httpJSON $ addAuthorizationHeader auth req writeIORef wxReqRef $ do maybeUrl <- getNextUrl res maybeValidUrl <-validateUrl scheme uriAuth maybeUrl maybeNextReq <- parseRequest $ "GET " <> C8.unpack maybeValidUrl pure (WebexTeamsRequest maybeNextReq scheme uriAuth) rr <- readIORef wxReqRef pure . unwrap $ getResponseBody res -- | Get list with query parameter. getListWithFilter :: (MonadIO m, WebexTeamsFilter filter, WebexTeamsListItem (ToResponse filter)) => Authorization -> WebexTeamsRequest -> filter -> m (ListReader (ToResponse filter)) getListWithFilter auth base param = getList auth $ setQeuryString $ makeCommonListReq base (apiPath param) where setQeuryString comm@WebexTeamsRequest { webexTeamsRequestRequest = req } = comm { webexTeamsRequestRequest = setRequestQueryString (toFilterList param) req } -- | Return 'ListReader' for 'Team'. getTeamList :: MonadIO m => Authorization -> WebexTeamsRequest -> m (ListReader Team) getTeamList auth base = getList auth $ makeCommonListReq base teamsPath -- | Return 'ListReader' for 'Team'. getOrganizationList :: MonadIO m => Authorization -> WebexTeamsRequest -> m (ListReader Organization) getOrganizationList auth base = getList auth $ makeCommonListReq base organizationsPath -- | Return 'ListReader' for 'Team'. getRoleList :: MonadIO m => Authorization -> WebexTeamsRequest -> m (ListReader Role) getRoleList auth base = getList auth $ makeCommonListReq base rolesPath makeCommonDetailReq :: WebexTeamsRequest -- ^ Common request components. -> Authorization -- ^ Authorization string against Webex Teams API. -> ByteString -- ^ API category part of REST URL path. -> Text -- ^ Identifier string part of REST URL path. -> Request makeCommonDetailReq (WebexTeamsRequest base _ _) auth path idStr = setRequestPath ("/v1/" <> path <> "/" <> encodeUtf8 idStr) $ setRequestMethod "GET" $ addAuthorizationHeader auth $ base {-| Get details of a Webex Teams entity. Obtaining detail of an entity identified by key. The key can be a value in one of following types: 'PersonId', 'RoomId', 'MembershipId', 'MessageId', 'TeamId', 'TeamMembershipId', 'OrganizationId', 'LicenseId', 'RoleId'. API is automatically selected by type of the key. A JSONException runtime exception will be thrown on an JSON parse errors. -} getDetail :: (MonadIO m, WebexTeamsDetail key) => Authorization -- ^ Authorization string against Webex Teams API. -> WebexTeamsRequest -- ^ Predefined part of 'Request' commonly used for Webex Teams API. -> key -- ^ One of PersonId, RoomId, MembershipId, MessageId, TeamId, TeamMembershipId, -- OrganizationId, LicenseId and RoleId. -> m (Response (ToResponse key)) getDetail auth base entityId = httpJSON $ makeCommonDetailReq base auth (apiPath entityId) (toIdStr entityId) -- | Get details of a Webex Teams entity. A Left value will be returned on an JSON parse errors. getDetailEither :: (MonadIO m, WebexTeamsDetail key) => Authorization -> WebexTeamsRequest -> key -> m (Response (Either JSONException (ToResponse key))) getDetailEither auth base entityId = httpJSONEither $ makeCommonDetailReq base auth (apiPath entityId) (toIdStr entityId) makeCommonCreateReq :: ToJSON a => WebexTeamsRequest -> Authorization -> ByteString -> a -> Request makeCommonCreateReq (WebexTeamsRequest base _ _) auth path body = setRequestBodyJSON body $ setRequestPath ("/v1/" <> path) $ setRequestMethod "POST" $ addAuthorizationHeader auth $ base {-| Create a Webex Teams entity with given parameters. Creating a new entity of Webex Teams such as space, team, membership or message. REST API path is automatically selected by type of createParams. A JSONException runtime exception will be thrown on an JSON parse errors. -} createEntity :: (MonadIO m, WebexTeamsCreate createParams) => Authorization -- ^ Authorization string against Webex Teams API. -> WebexTeamsRequest -- ^ Predefined part of 'Request' commonly used for Webex Teams API. -> createParams -- ^ One of 'CreatePerson', 'CreateRoom', 'CreateMembership', 'CreateMessage', -- 'CreateTeam' and 'CreateTeamMembership'. -> m (Response (ToResponse createParams)) createEntity auth base param = httpJSON $ makeCommonCreateReq base auth (apiPath param) param -- | Create a Webex Teams entity with given parameters. A Left value will be returned on an JSON parse errors. createEntityEither :: (MonadIO m, WebexTeamsCreate createParams) => Authorization -> WebexTeamsRequest -> createParams -> m (Response (Either JSONException (ToResponse createParams))) createEntityEither auth base param = httpJSONEither $ makeCommonCreateReq base auth (apiPath param) param makeCommonUpdateReq :: ToJSON a => WebexTeamsRequest -> Authorization -> ByteString -> a -> Request makeCommonUpdateReq (WebexTeamsRequest base _ _) auth path body = setRequestBodyJSON body $ setRequestPath ("/v1/" <> path) $ setRequestMethod "PUT" $ addAuthorizationHeader auth $ base {-| Update a Webex Teams entity with given parameters. Creating a new entity of Webex Teams such as space, team, or membership. REST API path is automatically selected by type of updateParams. A JSONException runtime exception will be thrown on an JSON parse errors. -} updateEntity :: (MonadIO m, WebexTeamsUpdate updateParams) => Authorization -- ^ Authorization string against Webex Teams API. -> WebexTeamsRequest -- ^ Predefined part of 'Request' commonly used for Webex Teams API. -> updateParams -- ^ One of 'UpdatePerson', 'UpdateRoom', 'UpdateMembership', -- 'UpdateTeam' and 'UpdateTeamMembership'. -> m (Response (ToResponse updateParams)) updateEntity auth base param = httpJSON $ makeCommonUpdateReq base auth (apiPath param) param -- | Update a Webex Teams entity with given parameters. A Left value will be returned on an JSON parse errors. updateEntityEither :: (MonadIO m, WebexTeamsUpdate updateParams) => Authorization -> WebexTeamsRequest -> updateParams -> m (Response (Either JSONException (ToResponse updateParams))) updateEntityEither auth base param = httpJSONEither $ makeCommonUpdateReq base auth (apiPath param) param makeCommonDeleteReq :: Authorization -- ^ Authorization string against Webex Teams API. -> Request -- ^ Common request components. -> ByteString -- ^ API category part of REST URL path. -> Text -- ^ Identifier string part of REST URL path. -> Request makeCommonDeleteReq auth base path idStr = setRequestPath ("/v1/" <> path <> "/" <> encodeUtf8 idStr) $ setRequestMethod "DELETE" $ addAuthorizationHeader auth $ base -- | Polymorphic version of delete. Intentionally not exposed to outside of the module. deleteEntity :: (MonadIO m, WebexTeamsDetail key) => Authorization -- ^ Authorization string against Webex Teams API. -> WebexTeamsRequest -- ^ Predefined part of 'Request' commonly used for Webex Teams API. -> key -- ^ One of PersonId, RoomId, MembershipId, MessageId, TeamId, TeamMembershipId. -> m (Response ()) deleteEntity auth (WebexTeamsRequest base _ _) entityId = httpNoBody $ makeCommonDeleteReq auth base (apiPath entityId) (toIdStr entityId) -- | Deletes a room, by ID. deleteRoom :: MonadIO m => Authorization -- ^ Authorization string against Webex Teams API. -> WebexTeamsRequest -- ^ Predefined part of 'Request' commonly used for Webex Teams API. -> RoomId -- ^ Identifier of a space to be deleted. -> m (Response ()) deleteRoom = deleteEntity -- | Deletes a membership, by ID. deleteMembership :: MonadIO m => Authorization -- ^ Authorization string against Webex Teams API. -> WebexTeamsRequest -- ^ Predefined part of 'Request' commonly used for Webex Teams API. -> MembershipId -- ^ Identifier of a space to be deleted. -> m (Response ()) deleteMembership = deleteEntity -- | Deletes a message, by ID. deleteMessage :: MonadIO m => Authorization -- ^ Authorization string against Webex Teams API. -> WebexTeamsRequest -- ^ Predefined part of 'Request' commonly used for Webex Teams API. -> MessageId -- ^ Identifier of a space to be deleted. -> m (Response ()) deleteMessage = deleteEntity -- | Deletes a team, by ID. deleteTeam :: MonadIO m => Authorization -- ^ Authorization string against Webex Teams API. -> WebexTeamsRequest -- ^ Predefined part of 'Request' commonly used for Webex Teams API. -> TeamId -- ^ Identifier of a space to be deleted. -> m (Response ()) deleteTeam = deleteEntity -- | Deletes a teamMembership, by ID. deleteTeamMembership :: MonadIO m => Authorization -- ^ Authorization string against Webex Teams API. -> WebexTeamsRequest -- ^ Predefined part of 'Request' commonly used for Webex Teams API. -> TeamMembershipId -- ^ Identifier of a space to be deleted. -> m (Response ()) deleteTeamMembership = deleteEntity
nshimaza/cisco-spark-api
webex-teams-api/src/Network/WebexTeams.hs
mit
23,047
0
20
5,336
3,369
1,862
1,507
316
2
module MarkovChain ( runMarkovChain , step , stepUntilAbsorption , SystemState , MarkovChain ) where import Control.Monad.Reader import Data.Matrix import TransitionMatrix import MC type SystemState = Int type MarkovChain = ReaderT TransitionMatrix MC -- | Take one step: transition from a state to another step :: SystemState -> MarkovChain (Maybe SystemState) step state = do matrix_ <- ask let probs = getCol state $ toMatrix matrix_ lift $ sampleUniformV probs actWhileM :: Monad m => a -> (a -> m (Maybe a)) -> m [a] actWhileM initialState act = do newState <- act initialState case newState of Nothing -> return [] Just s -> do rest <- actWhileM s act return (s:rest) -- | Take steps until we hit absorption stepUntilAbsorption :: SystemState -> MarkovChain [SystemState] stepUntilAbsorption initialState = actWhileM initialState step runMarkovChain :: ReaderT r m a -> r -> m a runMarkovChain = runReaderT
arekfu/markov-chains
src/MarkovChain.hs
mit
970
0
14
202
289
146
143
29
2
{-# LANGUAGE OverloadedStrings #-} module Main (main) where import MPD import MPD.Core import MPD.Commands.Parser import Control.Applicative import qualified Data.Attoparsec.ByteString as A import qualified Data.ByteString as SB import Criterion.Main main = defaultMain [ bench "boolP" $ nf (A.parseOnly boolP) "0" , bench "floatP" $ nf (A.parseOnly floatP) "1337.25" , bench "intP" $ nf (A.parseOnly intP) "1337" , bench "textP" $ nf (A.parseOnly textP) "foo" , bench "dateP" $ nf (A.parseOnly dateP) "2014-05-16T17:33:26Z" , bench "field/single" $ nf (A.parseOnly (fieldP "key" intP)) "key: 1337\n" , bench "field/compound" $ nf (A.parseOnly ((,,) <$> fieldP "a" boolP <*> fieldP "b" floatP <*> fieldP "c" intP)) "a: 1\nb: 2.5\nc: 42\n" , bench "field/complex" $ do let p = (,,) <$> fieldP "a" boolP <*> fieldP "b" floatP <*> fieldP "c" intP s = SB.concat (replicate 1000 "a: 1\nb: 2.5\nc: 42\n") nf (A.parseOnly $ A.many1 p) s ]
joachifm/nanompd
bench/ParseBench.hs
mit
1,084
0
16
294
352
180
172
30
1
{-# htermination show :: (Show a, Show k) => (Either a k) -> String #-}
ComputationWithBoundedResources/ara-inference
doc/tpdb_trs/Haskell/full_haskell/Prelude_show_11.hs
mit
72
0
2
15
3
2
1
1
0
import System.IO import System.Exit import XMonad import XMonad.Hooks.DynamicLog import XMonad.Hooks.ManageDocks import XMonad.Hooks.ManageHelpers import XMonad.Hooks.SetWMName import XMonad.Layout.Fullscreen import XMonad.Layout.NoBorders import XMonad.Layout.Spiral import XMonad.Layout.Tabbed import XMonad.Util.Run(spawnPipe) import XMonad.Util.EZConfig(additionalKeys) import qualified XMonad.StackSet as W import qualified Data.Map as M ------------------------------------------------------------------------ -- Terminal -- The preferred terminal program, which is used in a binding below and by -- certain contrib modules. -- myTerminal = "terminator" ------------------------------------------------------------------------ -- Workspaces -- The default number of workspaces (virtual screens) and their names. -- myWorkspaces = ["1:web","2:terms","3:code","4:misc","5:vm"] ++ map show [6..9] ------------------------------------------------------------------------ -- Window rules -- Execute arbitrary actions and WindowSet manipulations when managing -- a new window. You can use this to, for example, always float a -- particular program, or have a client always appear on a particular -- workspace. -- -- To find the property name associated with a program, use -- > xprop | grep WM_CLASS -- and click on the client you're interested in. -- -- To match on the WM_NAME, you can use 'title' in the same way that -- 'className' and 'resource' are used below. -- myManageHook = composeAll [ resource =? "desktop_window" --> doIgnore , className =? "Galculator" --> doFloat , className =? "Steam" --> doFloat , className =? "Gimp" --> doFloat , resource =? "gpicview" --> doFloat , className =? "MPlayer" --> doFloat , className =? "Vlc" --> doFloat , className =? "Skype" --> doFloat --, className =? "Chromium" --> doShift "1:web" , className =? "Thunderbird" --> doShift "1:web" --, className =? "Subl3" --> doShift "3:code" , className =? "VirtualBox" --> doShift "5:vm" , isFullscreen --> (doF W.focusDown <+> doFullFloat)] ------------------------------------------------------------------------ -- Layouts -- You can specify and transform your layouts by modifying these values. -- If you change layout bindings be sure to use 'mod-shift-space' after -- restarting (with 'mod-q') to reset your layout state to the new -- defaults, as xmonad preserves your old layout settings by default. -- -- The available layouts. Note that each layout is separated by |||, -- which denotes layout choice. -- myLayout = avoidStruts ( Tall 1 (3/100) (1/2) ||| Mirror (Tall 1 (3/100) (1/2)) ||| tabbed shrinkText tabConfig ||| Full ||| spiral (6/7)) ||| noBorders (fullscreenFull Full) ------------------------------------------------------------------------ -- Colors and borders -- Currently based on the ir_black theme. -- myNormalBorderColor = "#222222" myFocusedBorderColor = "#EE9A00" -- Colors for text and backgrounds of each tab when in "Tabbed" layout. tabConfig = defaultTheme { activeBorderColor = "#7C7C7C", activeTextColor = "#EE9A00", activeColor = "#222222", inactiveBorderColor = "#7C7C7C", inactiveTextColor = "#bbbbbb", inactiveColor = "#222222" } -- Color of current window title in xmobar. xmobarTitleColor = "#FFB6B0" -- Color of current workspace in xmobar. xmobarCurrentWorkspaceColor = "#EE9A00" -- Width of the window border in pixels. myBorderWidth = 1 ------------------------------------------------------------------------ -- Key bindings -- -- modMask lets you specify which modkey you want to use. The default -- is mod1Mask ("left alt"). You may also consider using mod3Mask -- ("right alt"), which does not conflict with emacs keybindings. The -- "windows key" is usually mod4Mask. -- myModMask = mod4Mask myKeys conf@(XConfig {XMonad.modMask = modMask}) = M.fromList $ ---------------------------------------------------------------------- -- Custom key bindings -- -- Start a terminal. Terminal to start is specified by myTerminal variable. [ ((modMask .|. shiftMask, xK_Return), spawn $ XMonad.terminal conf) -- Lock the screen using xscreensaver. , ((modMask .|. controlMask, xK_l), spawn "xscreensaver-command -lock") -- Launch dmenu via yeganesh. -- Use this to launch programs without a key binding. , ((modMask, xK_r), spawn "exe=`dmenu_path_c | yeganesh` && eval \"exec $exe\"") -- Take a screenshot in select mode. -- After pressing this key binding, click a window, or draw a rectangle with -- the mouse. , ((modMask, xK_Print), spawn "~/.xmonad/bin/select-screenshot") -- Take full screenshot in multi-head mode. -- That is, take a screenshot of everything you see. , ((modMask .|. shiftMask, xK_Print), spawn "~/.xmonad/bin/screenshot") -- Mute volume. , ((modMask .|. controlMask, xK_m), spawn "amixer -q set Master toggle") -- Decrease volume. , ((modMask .|. controlMask, xK_j), spawn "amixer -q set Master 10%-") -- Increase volume. , ((modMask .|. controlMask, xK_k), spawn "amixer -q set Master 10%+") -------------------------------------------------------------------- -- "Standard" xmonad key bindings -- -- Close focused window. , ((modMask, xK_q), kill) -- Cycle through the available layout algorithms. , ((modMask, xK_space), sendMessage NextLayout) -- Reset the layouts on the current workspace to default. , ((modMask .|. shiftMask, xK_space), setLayout $ XMonad.layoutHook conf) -- Resize viewed windows to the correct size. , ((modMask, xK_n), refresh) -- Move focus to the next window. , ((modMask, xK_Tab), windows W.focusDown) -- Move focus to the next window. , ((modMask, xK_Left), windows W.focusUp) -- Move focus to the previous window. , ((modMask, xK_Right), windows W.focusDown) -- Move focus to the next window. , ((modMask, xK_j), windows W.focusDown) -- Move focus to the previous window. , ((modMask, xK_k), windows W.focusUp) -- Move focus to the master window. , ((modMask, xK_m), windows W.focusMaster ) -- Swap the focused window and the master window. , ((modMask, xK_Return), windows W.swapMaster) -- Swap the focused window with the next window. , ((modMask .|. shiftMask, xK_Left), windows W.swapUp ) -- Swap the focused window with the previous window. , ((modMask .|. shiftMask, xK_Right), windows W.swapDown ) -- Swap the focused window with the next window. , ((modMask .|. shiftMask, xK_j), windows W.swapDown ) -- Swap the focused window with the previous window. , ((modMask .|. shiftMask, xK_k), windows W.swapUp ) -- Shrink the master area. , ((modMask, xK_h), sendMessage Shrink) -- Expand the master area. , ((modMask, xK_l), sendMessage Expand) -- Push window back into tiling. , ((modMask, xK_t), withFocused $ windows . W.sink) -- Increment the number of windows in the master area. , ((modMask, xK_comma), sendMessage (IncMasterN 1)) -- Decrement the number of windows in the master area. , ((modMask, xK_period), sendMessage (IncMasterN (-1))) -- Toggle the status bar gap. -- TODO: update this binding with avoidStruts, ((modMask, xK_b), -- Quit xmonad. , ((modMask .|. shiftMask, xK_q), io (exitWith ExitSuccess)) -- Restart xmonad. , ((modMask .|. shiftMask, xK_r), restart "xmonad" True) ] ++ -- mod-[1..9], Switch to workspace N -- mod-shift-[1..9], Move client to workspace N [((m .|. modMask, k), windows $ f i) | (i, k) <- zip (XMonad.workspaces conf) [xK_1 .. xK_9] , (f, m) <- [(W.greedyView, 0), (W.shift, shiftMask)]] ++ -- mod-{w,e,r}, Switch to physical/Xinerama screens 1, 2, or 3 -- mod-shift-{w,e,r}, Move client to screen 1, 2, or 3 [((m .|. modMask, key), screenWorkspace sc >>= flip whenJust (windows . f)) | (key, sc) <- zip [xK_w, xK_e] [0..] , (f, m) <- [(W.view, 0), (W.shift, shiftMask)]] ------------------------------------------------------------------------ -- Mouse bindings -- -- Focus rules -- True if your focus should follow your mouse cursor. myFocusFollowsMouse :: Bool myFocusFollowsMouse = False myMouseBindings (XConfig {XMonad.modMask = modMask}) = M.fromList $ [ -- mod-button1, Set the window to floating mode and move by dragging ((modMask, button1), (\w -> focus w >> mouseMoveWindow w)) -- mod-button2, Raise the window to the top of the stack , ((modMask, button2), (\w -> focus w >> windows W.swapMaster)) -- mod-button3, Set the window to floating mode and resize by dragging , ((modMask, button3), (\w -> focus w >> mouseResizeWindow w)) -- you may also bind events to the mouse scroll wheel (button4 and button5) ] ------------------------------------------------------------------------ -- Status bars and logging -- Perform an arbitrary action on each internal state change or X event. -- See the 'DynamicLog' extension for examples. -- -- To emulate dwm's status bar -- -- > logHook = dynamicLogDzen -- ------------------------------------------------------------------------ -- Startup hook -- Perform an arbitrary action each time xmonad starts or is restarted -- with mod-q. Used by, e.g., XMonad.Layout.PerWorkspace to initialize -- per-workspace layout choices. -- -- By default, do nothing. myStartupHook = return () ------------------------------------------------------------------------ -- Run xmonad with all the defaults we set up. -- main = do xmproc <- spawnPipe "/usr/bin/xmobar ~/.xmonad/xmobarrc" xmonad $ defaults { logHook = dynamicLogWithPP $ xmobarPP { ppOutput = hPutStrLn xmproc , ppTitle = xmobarColor xmobarTitleColor "" . shorten 100 , ppCurrent = xmobarColor xmobarCurrentWorkspaceColor "" , ppSep = " "} , manageHook = manageDocks <+> myManageHook , startupHook = setWMName "LG3D" } ------------------------------------------------------------------------ -- Combine it all together -- A structure containing your configuration settings, overriding -- fields in the default config. Any you don't override, will -- use the defaults defined in xmonad/XMonad/Config.hs -- -- No need to modify this. -- defaults = defaultConfig { -- simple stuff terminal = myTerminal, focusFollowsMouse = myFocusFollowsMouse, borderWidth = myBorderWidth, modMask = myModMask, workspaces = myWorkspaces, normalBorderColor = myNormalBorderColor, focusedBorderColor = myFocusedBorderColor, -- key bindings keys = myKeys, mouseBindings = myMouseBindings, -- hooks, layouts layoutHook = smartBorders $ myLayout, manageHook = myManageHook, startupHook = myStartupHook }
black-puppydog/dotfiles_crvs
xmonad.symlink/xmonad.darrhya.hs
mit
11,104
0
16
2,300
1,813
1,113
700
152
1
{-# LANGUAGE StandaloneDeriving, ViewPatterns #-} ----------------------------------------------------------------------------- -- | -- Module : Mezzo.Model.Types -- Description : Mezzo music types -- Copyright : (c) Dima Szamozvancev -- License : MIT -- -- Maintainer : ds709@cam.ac.uk -- Stability : experimental -- Portability : portable -- -- Types modeling basic musical constructs at the type level. -- ----------------------------------------------------------------------------- module Mezzo.Model.Types ( -- * Note properties PitchClass (..) , Accidental (..) , OctaveNum (..) , Duration (..) -- ** Singleton types for note properties , PC (..) , Acc (..) , Oct (..) , Dur (..) -- * Pitches , PitchType (..) , Pit (..) , type (=?=) , type (<<=?) , type (<<?) -- * Harmonic types , Mode (..) , ScaleDegree (..) , DegreeType (..) , KeyType (..) , RootType (..) , Mod (..) , ScaDeg (..) , KeyS (..) , Deg (..) , Root (..) , RootToPitch , PitchToNat , Sharpen , Flatten , Dot , HalfOf , FromRoot , FromSilence , FromTriplet -- * Specialised musical vector types , Voice , Partiture -- * Intervals , IntervalSize (..) , IntervalClass (..) , IntervalType (..) , MakeInterval -- ** Singleton types for interval properties , IC (..) , IS (..) , Intv (..) -- * Operations , OctPred , OctSucc , HalfStepsUpBy , HalfStepsDownBy , RaiseBy , LowerBy , RaiseAllBy , LowerAllBy , RaiseAllBy' , LowerAllBy' , RaiseByOct , LowerByOct , RaiseAllByOct , TransposeUpBy , TransposeDownBy ) where import GHC.TypeLits import Data.Proxy import Mezzo.Model.Prim import Mezzo.Model.Reify infixl 3 <<=? infixl 3 <<? ------------------------------------------------------------------------------- -- Note properties -- The "minimum complete definition" for musical notes and rests. ------------------------------------------------------------------------------- -- | The diatonic pitch class of the note. data PitchClass = C | D | E | F | G | A | B -- | The accidental applied to a note. data Accidental = Natural | Flat | Sharp -- | The octave where the note resides (middle C is Oct4). data OctaveNum = Oct_1 | Oct0 | Oct1 | Oct2 | Oct3 | Oct4 | Oct5 | Oct6 | Oct7 | Oct8 -- | The duration of the note (a whole note has duration 32). type Duration = Nat ---- Singleton types for note properties -- | The singleton type for 'PitchClass'. data PC (pc :: PitchClass) where PC :: Primitive pc => PC pc -- | The singleton type for 'Accidental'. data Acc (acc :: Accidental) where Acc :: Primitive acc => Acc acc -- | The singleton type for 'Octave'. data Oct (oct :: OctaveNum) where Oct :: Primitive oct => Oct oct -- | The singleton type for 'Duration'. data Dur (dur :: Duration) where Dur :: Primitive dur => Dur dur ------------------------------------------------------------------------------- -- Pitches -- Encapsulates the pitch class, accidental and octave of a note. ------------------------------------------------------------------------------- -- | The type of pitches. data PitchType where -- | A pitch made up of a pitch class, an accidental and an octave. Pitch :: PitchClass -> Accidental -> OctaveNum -> PitchType -- | Silence, the pitch of rests. Silence :: PitchType -- | The singleton type for pitches. data Pit (p :: PitchType) where Pit :: Primitive p => Pit p ------------------------------------------------------------------------------- -- Harmonic types ------------------------------------------------------------------------------- -- | The mode of a key: major or minor. data Mode = MajorMode | MinorMode -- | The seven scale degrees. data ScaleDegree = I | II | III | IV | V | VI | VII data DegreeType = Degree ScaleDegree Accidental OctaveNum -- | The of a scale, chord or piece. data KeyType = Key PitchClass Accidental Mode -- | The root of a chord. data RootType where -- | A pitch constructs a diatonic root. PitchRoot :: PitchType -> RootType -- | A key and a scale degree constructs a scalar root. DegreeRoot :: KeyType -> DegreeType -> RootType -- | The singleton type for 'Mode'. data Mod (m :: Mode) = Mod -- | The singleton type for 'ScaleDegree' data ScaDeg (sd :: ScaleDegree) = ScaDeg -- | The singleton type for 'KeyType'. data KeyS (k :: KeyType) = KeyS data Deg (d :: DegreeType) = Deg -- | The singleton type for 'Root'. data Root (r :: RootType) where Root :: Primitive r => Root r -- | Convert a root to a pitch. -- -- Note: the default octave for scalar roots is 'Oct2'. type family RootToPitch (dr :: RootType) :: PitchType where RootToPitch (PitchRoot p) = p RootToPitch (DegreeRoot (Key pc acc m) (Degree sd dacc oct)) = HalfStepsUpBy (Pitch pc acc oct) (DegreeOffset m sd dacc) -- | Calculate the semitone offset of a scale degree in a given mode. type family DegreeOffset (m :: Mode) (d :: ScaleDegree) (a :: Accidental) where DegreeOffset MajorMode I Natural = 0 DegreeOffset MajorMode II Natural = 2 DegreeOffset MajorMode III Natural = 4 DegreeOffset MajorMode IV Natural = 5 DegreeOffset MajorMode V Natural = 7 DegreeOffset MajorMode VI Natural = 9 DegreeOffset MajorMode VII Natural = 11 DegreeOffset MinorMode I Natural = 0 DegreeOffset MinorMode II Natural = 2 DegreeOffset MinorMode III Natural = 3 DegreeOffset MinorMode IV Natural = 5 DegreeOffset MinorMode V Natural = 7 DegreeOffset MinorMode VI Natural = 8 DegreeOffset MinorMode VII Natural = 10 DegreeOffset m sd Flat = (DegreeOffset m sd Natural) - 1 DegreeOffset m sd Sharp = (DegreeOffset m sd Natural) + 1 -- | Sharpen a root. type family Sharpen (r :: RootType) :: RootType where Sharpen r = PitchRoot (HalfStepUp (RootToPitch r)) -- | Flatten a root. type family Flatten (r :: RootType) :: RootType where Flatten r = PitchRoot (HalfStepDown (RootToPitch r)) -- | Halve a type-level natural. type family HalfOf (n :: Nat) :: Nat where HalfOf 0 = 0 HalfOf 1 = 0 HalfOf 8 = 4 HalfOf 32 = 16 HalfOf n = 1 + (HalfOf (n - 2)) -- | Form a dotted duration. type family Dot (d :: Duration) :: Duration where Dot 1 = TypeError (Text "Can't have dotted thirty-seconds.") Dot n = n + HalfOf n -- | Create a new partiture with one voice of the given pitch. type family FromRoot (r :: RootType) (d :: Nat) :: Partiture 1 d where FromRoot r d = ((RootToPitch r) +*+ d) :-- None -- | Create a new partiture with one voice of silence. type family FromSilence (d :: Nat) :: Partiture 1 d where FromSilence d = (Silence +*+ d) :-- None -- | Create a new partiture with a triplet of three notes. type family FromTriplet (d :: Nat) (r1 :: RootType) (r2 :: RootType) (r3 :: RootType) :: Partiture 1 (d + HalfOf d + HalfOf d) where FromTriplet d r1 r2 r3 = FromRoot r1 d +|+ FromRoot r2 (HalfOf d) +|+ FromRoot r3 (HalfOf d) ------------------------------------------------------------------------------- -- Type specialisations ------------------------------------------------------------------------------- -- | A 'Voice' is made up of a sequence of pitch repetitions. type Voice l = OptVector PitchType l -- | A 'Partiture' is made up of a fixed number of voices. type Partiture n l = Matrix PitchType n l ------------------------------------------------------------------------------- -- Intervals ------------------------------------------------------------------------------- -- | The size of the interval. data IntervalSize = Unison | Second | Third | Fourth | Fifth | Sixth | Seventh | Octave -- | The class of the interval. data IntervalClass = Maj | Perf | Min | Aug | Dim -- | The type of intervals. data IntervalType where -- | An interval smaller than 13 semitones, where musical rules -- can still be enforced. Interval :: IntervalClass -> IntervalSize -> IntervalType -- | An interval larger than 13 semitones, which is large enough -- so that dissonance effects are not significant. Compound :: IntervalType -- | The singleton type for 'IntervalSize'. data IS (is :: IntervalSize) = IS -- | The singleton type for 'IntervalClass'. data IC (ic :: IntervalClass) = IC -- | The singleton type for 'IntervalType'. data Intv (i :: IntervalType) = Intv ------------------------------------------------------------------------------- -- Interval construction ------------------------------------------------------------------------------- -- | Make an interval from two arbitrary pitches. type family MakeInterval (p1 :: PitchType) (p2 :: PitchType) :: IntervalType where MakeInterval Silence Silence = TypeError (Text "Can't make intervals from rests.") MakeInterval Silence p2 = TypeError (Text "Can't make intervals from rests.") MakeInterval p1 Silence = TypeError (Text "Can't make intervals from rests.") MakeInterval p1 p2 = If (p1 <<=? p2) (MakeIntervalOrd p1 p2) (MakeIntervalOrd p2 p1) -- | Make an interval from two ordered pitches. type family MakeIntervalOrd (p1 :: PitchType) (p2 :: PitchType) :: IntervalType where -- Handling base cases. MakeIntervalOrd p p = Interval Perf Unison ---- Base cases from C. MakeIntervalOrd (Pitch C Flat o) (Pitch C Natural o) = Interval Aug Unison MakeIntervalOrd (Pitch C Natural o) (Pitch C Sharp o) = Interval Aug Unison MakeIntervalOrd (Pitch C Natural o) (Pitch D Flat o) = Interval Min Second MakeIntervalOrd (Pitch C acc o) (Pitch D acc o) = Interval Maj Second MakeIntervalOrd (Pitch C acc o) (Pitch E acc o) = Interval Maj Third MakeIntervalOrd (Pitch C acc o) (Pitch F acc o) = Interval Perf Fourth MakeIntervalOrd (Pitch C acc o) (Pitch G acc o) = Interval Perf Fifth MakeIntervalOrd (Pitch C acc o) (Pitch A acc o) = Interval Maj Sixth MakeIntervalOrd (Pitch C acc o) (Pitch B acc o) = Interval Maj Seventh ---- Base cases from F. MakeIntervalOrd (Pitch F Flat o) (Pitch F Natural o) = Interval Aug Unison MakeIntervalOrd (Pitch F Natural o) (Pitch F Sharp o) = Interval Aug Unison MakeIntervalOrd (Pitch F Natural o) (Pitch G Flat o) = Interval Min Second MakeIntervalOrd (Pitch F acc o) (Pitch G acc o) = Interval Maj Second MakeIntervalOrd (Pitch F acc o) (Pitch A acc o) = Interval Maj Third MakeIntervalOrd (Pitch F acc o) (Pitch B acc o) = Interval Aug Fourth MakeIntervalOrd (Pitch F acc o1) (Pitch C acc o2) = IntervalOrCompound o1 o2 (Interval Perf Fifth) MakeIntervalOrd (Pitch F acc o1) (Pitch D acc o2) = IntervalOrCompound o1 o2 (Interval Maj Sixth) MakeIntervalOrd (Pitch F acc o1) (Pitch E acc o2) = IntervalOrCompound o1 o2 (Interval Maj Seventh) ---- Base cases from A. MakeIntervalOrd (Pitch A Flat o) (Pitch A Natural o) = Interval Aug Unison MakeIntervalOrd (Pitch A Natural o) (Pitch A Sharp o) = Interval Aug Unison MakeIntervalOrd (Pitch A Natural o) (Pitch B Flat o) = Interval Min Second MakeIntervalOrd (Pitch A acc o) (Pitch B acc o) = Interval Maj Second MakeIntervalOrd (Pitch A acc o1) (Pitch C acc o2) = IntervalOrCompound o1 o2 (Interval Min Third) MakeIntervalOrd (Pitch A acc o1) (Pitch D acc o2) = IntervalOrCompound o1 o2 (Interval Perf Fourth) MakeIntervalOrd (Pitch A acc o1) (Pitch E acc o2) = IntervalOrCompound o1 o2 (Interval Perf Fifth) MakeIntervalOrd (Pitch A acc o1) (Pitch F acc o2) = IntervalOrCompound o1 o2 (Interval Min Sixth) MakeIntervalOrd (Pitch A acc o1) (Pitch G acc o2) = IntervalOrCompound o1 o2 (Interval Min Seventh) -- Handling perfect and augmented octaves. MakeIntervalOrd (Pitch C acc o1) (Pitch C acc o2) = IntervalOrCompound o1 o2 (Interval Perf Octave) MakeIntervalOrd (Pitch C Natural o1) (Pitch C Sharp o2) = IntervalOrCompound o1 o2 (Interval Aug Octave) MakeIntervalOrd (Pitch C Flat o1) (Pitch C Natural o2) = IntervalOrCompound o1 o2 (Interval Aug Octave) MakeIntervalOrd (Pitch F acc o1) (Pitch F acc o2) = IntervalOrCompound o1 o2 (Interval Perf Octave) MakeIntervalOrd (Pitch F Natural o1) (Pitch F Sharp o2) = IntervalOrCompound o1 o2 (Interval Aug Octave) MakeIntervalOrd (Pitch F Flat o1) (Pitch F Natural o2) = IntervalOrCompound o1 o2 (Interval Aug Octave) MakeIntervalOrd (Pitch A acc o1) (Pitch A acc o2) = IntervalOrCompound o1 o2 (Interval Perf Octave) MakeIntervalOrd (Pitch A Natural o1) (Pitch A Sharp o2) = IntervalOrCompound o1 o2 (Interval Aug Octave) MakeIntervalOrd (Pitch A Flat o1) (Pitch A Natural o2) = IntervalOrCompound o1 o2 (Interval Aug Octave) -- Handling accidental first pitch. MakeIntervalOrd (Pitch C Flat o) (Pitch pc2 acc o) = Expand (MakeIntervalOrd (Pitch C Natural o) (Pitch pc2 acc o)) MakeIntervalOrd (Pitch C Sharp o) (Pitch pc2 acc o) = Shrink (MakeIntervalOrd (Pitch C Natural o) (Pitch pc2 acc o)) MakeIntervalOrd (Pitch F Flat o) (Pitch E Sharp o) = Interval Min Second MakeIntervalOrd (Pitch F Flat o) (Pitch E Natural o) = Interval Dim Second MakeIntervalOrd (Pitch E Natural o) (Pitch F Flat o) = Interval Dim Second MakeIntervalOrd (Pitch F Flat o) (Pitch pc2 acc o) = Expand (MakeIntervalOrd (Pitch F Natural o) (Pitch pc2 acc o)) MakeIntervalOrd (Pitch F Sharp o) (Pitch pc2 acc o) = Shrink (MakeIntervalOrd (Pitch F Natural o) (Pitch pc2 acc o)) MakeIntervalOrd (Pitch A Flat o) (Pitch pc2 acc o) = Expand (MakeIntervalOrd (Pitch A Natural o) (Pitch pc2 acc o)) MakeIntervalOrd (Pitch A Sharp o) (Pitch pc2 acc o) = Shrink (MakeIntervalOrd (Pitch A Natural o) (Pitch pc2 acc o)) -- Handling accidental second pitch. MakeIntervalOrd (Pitch C Natural o) (Pitch pc2 Sharp o) = Expand (MakeIntervalOrd (Pitch C Natural o) (Pitch pc2 Natural o)) MakeIntervalOrd (Pitch C Natural o) (Pitch pc2 Flat o) = Shrink (MakeIntervalOrd (Pitch C Natural o) (Pitch pc2 Natural o)) MakeIntervalOrd (Pitch F Natural o) (Pitch pc2 Sharp o) = Expand (MakeIntervalOrd (Pitch F Natural o) (Pitch pc2 Natural o)) MakeIntervalOrd (Pitch F Natural o) (Pitch pc2 Flat o) = Shrink (MakeIntervalOrd (Pitch F Natural o) (Pitch pc2 Natural o)) MakeIntervalOrd (Pitch A Natural o) (Pitch pc2 Sharp o) = Expand (MakeIntervalOrd (Pitch A Natural o) (Pitch pc2 Natural o)) MakeIntervalOrd (Pitch A Natural o) (Pitch pc2 Flat o) = Shrink (MakeIntervalOrd (Pitch A Natural o) (Pitch pc2 Natural o)) -- Handling the general case. MakeIntervalOrd (Pitch pc1 acc1 o) (Pitch pc2 acc2 o) = MakeIntervalOrd (HalfStepDown (Pitch pc1 acc1 o)) (HalfStepDown (Pitch pc2 acc2 o)) MakeIntervalOrd (Pitch pc1 acc1 o1) (Pitch pc2 acc2 o2) = If (NextOct o1 o2) (MakeIntervalOrd (HalfStepDown (Pitch pc1 acc1 o1)) (HalfStepDown (Pitch pc2 acc2 o2))) Compound -- Handling erroneous construction (shouldn't happen). MakeIntervalOrd _ _ = TypeError (Text "Invalid interval.") -- | Shrink an interval. type family Shrink (i :: IntervalType) :: IntervalType where Shrink (Interval Perf Unison) = TypeError (Text "Can't diminish unisons.1") Shrink (Interval Perf is) = Interval Dim is Shrink (Interval Min is) = Interval Dim is Shrink (Interval Maj is) = Interval Min is Shrink (Interval Aug Unison) = Interval Perf Unison Shrink (Interval Aug Fourth) = Interval Perf Fourth Shrink (Interval Aug Fifth) = Interval Perf Fifth Shrink (Interval Aug Octave) = Interval Perf Octave Shrink (Interval Aug is) = Interval Maj is Shrink (Interval Dim Unison) = TypeError (Text "Can't diminish unisons.2") Shrink (Interval Dim Second) = TypeError (Text "Can't diminish unisons.3") Shrink (Interval Dim Fifth) = Interval Perf Fourth Shrink (Interval Dim Sixth) = Interval Dim Fifth Shrink (Interval Dim is) = Interval Min (IntSizePred is) Shrink Compound = Compound -- | Expand an interval. type family Expand (i :: IntervalType) :: IntervalType where Expand (Interval Perf Octave) = Interval Aug Octave Expand (Interval Perf is) = Interval Aug is Expand (Interval Maj is) = Interval Aug is Expand (Interval Min is) = Interval Maj is Expand (Interval Dim Unison) = TypeError (Text "Can't diminish unisons.4") Expand (Interval Dim Fourth) = Interval Perf Fourth Expand (Interval Dim Fifth) = Interval Perf Fifth Expand (Interval Dim Octave) = Interval Perf Octave Expand (Interval Dim is) = Interval Min is Expand (Interval Aug Third) = Interval Aug Fourth Expand (Interval Aug Fourth) = Interval Perf Fifth Expand (Interval Aug Seventh) = Interval Aug Octave Expand (Interval Aug Octave) = Compound Expand (Interval Aug is) = Interval Maj (IntSizeSucc is) Expand Compound = Compound ------------------------------------------------------------------------------- -- Enumerations and orderings -- Implementation of enumerators and ordering relations for applicable types. ------------------------------------------------------------------------------- -- | Convert a pitch to a natural number (equal to its MIDI code). type family PitchToNat (p :: PitchType) :: Nat where PitchToNat Silence = TypeError (Text "Can't convert a rest to a number.") PitchToNat (Pitch C Natural Oct_1) = 0 PitchToNat (Pitch C Sharp Oct_1) = 1 PitchToNat (Pitch D Flat Oct_1) = 1 PitchToNat (Pitch C Natural Oct1) = 24 PitchToNat (Pitch C Natural Oct2) = 36 PitchToNat (Pitch C Natural Oct3) = 48 PitchToNat (Pitch C Natural Oct4) = 60 PitchToNat (Pitch C Natural Oct5) = 72 PitchToNat (Pitch C Natural Oct6) = 84 PitchToNat p = 1 + PitchToNat (HalfStepDown p) -- | Convert a natural number to a suitable pitch. -- Not a functional relation, so usage is not recommended. type family NatToPitch (n :: Nat) where NatToPitch 0 = Pitch C Natural Oct_1 NatToPitch 1 = Pitch C Sharp Oct_1 NatToPitch n = HalfStepUp (NatToPitch (n - 1)) -- | Greater than or equal to for pitches. type family (p1 :: PitchType) <<=? (p2 :: PitchType) :: Bool where p <<=? p = True (Pitch pc1 acc oct) <<=? (Pitch pc2 acc oct) = ClassToNat pc1 <=? ClassToNat pc2 (Pitch pc acc oct) <<=? (Pitch pc Sharp oct) = True (Pitch pc Sharp oct) <<=? (Pitch pc acc oct) = False (Pitch pc Flat oct) <<=? (Pitch pc acc oct) = True (Pitch pc acc oct) <<=? (Pitch pc Flat oct) = False (Pitch E Sharp oct) <<=? (Pitch F Flat oct) = False (Pitch F Flat oct) <<=? (Pitch E Sharp oct) = True (Pitch B Sharp oct) <<=? (Pitch C Flat oct') = If (NextOct oct oct') False ((Pitch B Natural oct) <<=? (Pitch C Flat oct')) (Pitch C Flat oct) <<=? (Pitch B Sharp oct') = If (NextOct oct' oct) True ((Pitch C Natural oct) <<=? (Pitch B Sharp oct')) (Pitch pc1 acc1 oct) <<=? (Pitch pc2 acc2 oct) = ClassToNat pc1 <=? ClassToNat pc2 (Pitch pc1 acc1 oct1) <<=? (Pitch pc2 acc2 oct2) = OctToNat oct1 <=? OctToNat oct2 p1 <<=? p2 = PitchToNat p1 <=? PitchToNat p2 -- | Greater than for pitches. type family (p1 :: PitchType) <<? (p2 :: PitchType) where p <<? p = False p1 <<? p2 = (p1 <<=? p2) -- | Enharmonic equality of pitches. type family (p :: PitchType) =?= (q :: PitchType) :: Bool where Silence =?= Silence = True Silence =?= _ = False _ =?= Silence = False Pitch pc acc oct =?= Pitch pc acc oct = True Pitch C Flat o1 =?= Pitch B Natural o2 = o1 .~. OctSucc o2 Pitch C Natural o1 =?= Pitch B Sharp o2 = o1 .~. OctSucc o2 Pitch E Natural oct =?= Pitch F Flat oct = True Pitch E Sharp oct =?= Pitch F Natural oct = True Pitch F Flat oct =?= Pitch E Natural oct = True Pitch F Natural oct =?= Pitch E Sharp oct = True Pitch B Natural o1 =?= Pitch C Flat o2 = OctSucc o1 .~. o2 Pitch B Sharp o1 =?= Pitch C Natural o2 = OctSucc o1 .~. o2 Pitch pc1 Sharp oct =?= Pitch pc2 Flat oct = ClassSucc pc1 .~. pc2 Pitch pc1 Flat oct =?= Pitch pc2 Sharp oct = pc1 .~. ClassSucc pc2 _ =?= _ = False -- | Convert an octave to a natural number. type family OctToNat (o :: OctaveNum) :: Nat where OctToNat Oct_1 = 0 OctToNat Oct0 = 1 OctToNat Oct1 = 2 OctToNat Oct2 = 3 OctToNat Oct3 = 4 OctToNat Oct4 = 5 OctToNat Oct5 = 6 OctToNat Oct6 = 7 OctToNat Oct7 = 8 OctToNat Oct8 = 9 -- | Convert a natural number to an octave. type family NatToOct (n :: Nat) :: OctaveNum where NatToOct 0 = Oct_1 NatToOct 1 = Oct0 NatToOct 2 = Oct1 NatToOct 3 = Oct2 NatToOct 4 = Oct3 NatToOct 5 = Oct4 NatToOct 6 = Oct5 NatToOct 7 = Oct6 NatToOct 8 = Oct7 NatToOct 9 = Oct8 NatToOct _ = TypeError (Text "Invalid octave.") -- | Increase the octave by the given number. type family IncreaseOctave (o :: OctaveNum) (n :: Nat) :: OctaveNum where IncreaseOctave o n = NatToOct (OctToNat o + n) -- | Decrease the octave by the given number. type family DecreaseOctave (o :: OctaveNum) (n :: Nat) :: OctaveNum where DecreaseOctave o n = NatToOct (OctToNat o - n) -- | Increment an octave. type family OctSucc (o :: OctaveNum) :: OctaveNum where OctSucc o = IncreaseOctave o 1 -- | Decrement an octave. type family OctPred (o :: OctaveNum) :: OctaveNum where OctPred o = DecreaseOctave o 1 -- | Returns True if the successor of o1 is o2. type family NextOct (o1 :: OctaveNum) (o2 :: OctaveNum) :: Bool where NextOct Oct_1 Oct0 = True NextOct Oct0 Oct1 = True NextOct Oct1 Oct2 = True NextOct Oct2 Oct3 = True NextOct Oct3 Oct4 = True NextOct Oct4 Oct5 = True NextOct Oct5 Oct6 = True NextOct Oct6 Oct7 = True NextOct Oct7 Oct8 = True NextOct _ _ = False -- | Returns i if o2 is after o2, otherwise returns Compound. type family IntervalOrCompound (o1 :: OctaveNum) (o2 :: OctaveNum) (i :: IntervalType) :: IntervalType where IntervalOrCompound o1 o2 int = If (NextOct o1 o2) int Compound -- | Convert a pitch class to a natural number. type family ClassToNat (pc :: PitchClass) :: Nat where ClassToNat C = 0 ClassToNat D = 1 ClassToNat E = 2 ClassToNat F = 3 ClassToNat G = 4 ClassToNat A = 5 ClassToNat B = 6 -- | Convert a natural number to a pitch class. -- Numbers are taken modulo 7: e.g. 8 corresponds to the pitch 8 mod 7 = 1 = D type family NatToClass (n :: Nat) :: PitchClass where NatToClass 0 = C NatToClass 1 = D NatToClass 2 = E NatToClass 3 = F NatToClass 4 = G NatToClass 5 = A NatToClass 6 = B NatToClass n = NatToClass (n - 7) -- | Increase the pitch class by a given number. type family IncreaseClass (pc :: PitchClass) (n :: Nat) :: PitchClass where IncreaseClass pc n = NatToClass (ClassToNat pc + n) -- | Decrease the pitch class by a given number. type family DecreaseClass (pc :: PitchClass) (n :: Nat) :: PitchClass where DecreaseClass pc n = NatToClass (ClassToNat pc - n) -- | Increment a pitch class. type family ClassSucc (pc :: PitchClass) :: PitchClass where ClassSucc pc = IncreaseClass pc 1 -- | Decrement a pitch class. type family ClassPred (pc :: PitchClass) :: PitchClass where ClassPred pc = DecreaseClass pc 1 -- | Convert an interval size to a natural number. type family IntSizeToNat (is :: IntervalSize) :: Nat where IntSizeToNat Unison = 0 IntSizeToNat Second = 1 IntSizeToNat Third = 2 IntSizeToNat Fourth = 3 IntSizeToNat Fifth = 4 IntSizeToNat Sixth = 5 IntSizeToNat Seventh = 6 IntSizeToNat Octave = 7 -- | Convert a natural number to an interval size. type family NatToIntSize (n :: Nat) :: IntervalSize where NatToIntSize 0 = Unison NatToIntSize 1 = Second NatToIntSize 2 = Third NatToIntSize 3 = Fourth NatToIntSize 4 = Fifth NatToIntSize 5 = Sixth NatToIntSize 6 = Seventh NatToIntSize 7 = Octave NatToIntSize _ = TypeError (Text "Invalid interval size.") -- | Increase the interval size by a given number. type family IncreaseIntSize (is :: IntervalSize) (n :: Nat) :: IntervalSize where IncreaseIntSize is n = NatToIntSize (IntSizeToNat is + n) -- | Decrease the interval size by a given number. type family DecreaseIntSize (is :: IntervalSize) (n :: Nat) :: IntervalSize where DecreaseIntSize is n = NatToIntSize (IntSizeToNat is - n) -- | Increment an interval size. type family IntSizeSucc (is :: IntervalSize) :: IntervalSize where IntSizeSucc is = IncreaseIntSize is 1 -- | Decrement an interval size. type family IntSizePred (is :: IntervalSize) :: IntervalSize where IntSizePred is = DecreaseIntSize is 1 -- | Calculate the width of an interval in half-steps. type family IntervalWidth (i :: IntervalType) :: Nat where IntervalWidth (Interval Dim Unison) = TypeError (Text "Can't diminish unisons.") IntervalWidth (Interval Perf Unison) = 0 IntervalWidth (Interval Aug Unison) = 1 IntervalWidth (Interval Dim Fourth) = 4 IntervalWidth (Interval Perf Fourth) = 5 IntervalWidth (Interval Aug Fourth) = 6 IntervalWidth (Interval Dim Fifth) = 6 IntervalWidth (Interval Perf Fifth) = 7 IntervalWidth (Interval Aug Fifth) = 8 IntervalWidth (Interval Dim Octave) = 11 IntervalWidth (Interval Perf Octave) = 12 IntervalWidth (Interval Aug Octave) = 13 IntervalWidth (Interval Maj Second) = 2 IntervalWidth (Interval Maj Third) = 4 IntervalWidth (Interval Maj Sixth) = 9 IntervalWidth (Interval Maj Seventh) = 11 IntervalWidth (Interval Aug is) = IntervalWidth (Interval Maj is) + 1 IntervalWidth (Interval Min is) = IntervalWidth (Interval Maj is) - 1 IntervalWidth (Interval Dim is) = IntervalWidth (Interval Maj is) - 2 -- | Move a pitch up by a semitone. type family HalfStepUp (p :: PitchType) :: PitchType where HalfStepUp Silence = Silence HalfStepUp (Pitch B Flat o) = Pitch B Natural o HalfStepUp (Pitch B acc o) = Pitch C acc (OctSucc o) HalfStepUp (Pitch E Flat o) = Pitch E Natural o HalfStepUp (Pitch E acc o) = Pitch F acc o HalfStepUp (Pitch pc Flat o) = Pitch pc Natural o HalfStepUp (Pitch pc Natural o) = Pitch pc Sharp o HalfStepUp (Pitch pc Sharp o) = Pitch (ClassSucc pc) Natural o -- | Move a pitch down by a semitone. type family HalfStepDown (p :: PitchType) :: PitchType where HalfStepDown Silence = Silence HalfStepDown (Pitch C Sharp o) = Pitch C Natural o HalfStepDown (Pitch C acc o) = Pitch B acc (OctPred o) HalfStepDown (Pitch F Sharp o) = Pitch F Natural o HalfStepDown (Pitch F acc o) = Pitch E acc o HalfStepDown (Pitch pc Flat o) = Pitch (ClassPred pc) Natural o HalfStepDown (Pitch pc Natural o) = Pitch pc Flat o HalfStepDown (Pitch pc Sharp o) = Pitch pc Natural o -- | Move a pitch up by the specified number of semitones. type family HalfStepsUpBy (p :: PitchType) (n :: Nat) :: PitchType where HalfStepsUpBy p 0 = p HalfStepsUpBy p n = HalfStepUp (HalfStepsUpBy p (n - 1)) -- | Move a pitch down by the specified number of semitones. type family HalfStepsDownBy (p :: PitchType) (n :: Nat) :: PitchType where HalfStepsDownBy p 0 = p HalfStepsDownBy p n = HalfStepDown (HalfStepsDownBy p (n - 1)) -- | Raise a pitch by an interval. type family RaiseBy (p :: PitchType) (i :: IntervalType) :: PitchType where RaiseBy Silence _ = Silence RaiseBy _ Compound = TypeError (Text "Can't shift by compound interval") RaiseBy p (Interval Min is) = HalfStepDown (HalfStepsUpBy p (IntervalWidth (Interval Min is) + 1)) RaiseBy p (Interval Dim is) = HalfStepDown (HalfStepsUpBy p (IntervalWidth (Interval Dim is) + 1)) RaiseBy p i = HalfStepsUpBy p (IntervalWidth i) -- | Lower a pitch by an interval. type family LowerBy (p :: PitchType) (i :: IntervalType) :: PitchType where LowerBy Silence _ = Silence LowerBy _ Compound = TypeError (Text "Can't shift by compound interval") LowerBy p (Interval Maj is) = HalfStepUp (HalfStepsDownBy p (IntervalWidth (Interval Maj is) + 1)) LowerBy p (Interval Aug is) = HalfStepUp (HalfStepsDownBy p (IntervalWidth (Interval Aug is) + 1)) LowerBy p i = HalfStepsDownBy p (IntervalWidth i) -- | Raise all pitches in a voice by an interval. type family RaiseAllBy (ps :: Voice l) (i :: IntervalType) :: Voice l where RaiseAllBy End _ = End RaiseAllBy (p :* d :- ps) i = RaiseBy p i :* d :- RaiseAllBy ps i -- | Raise multiple pitches by an interval. type family RaiseAllBy' (ps :: Vector PitchType n) (i :: IntervalType) :: Vector PitchType n where RaiseAllBy' None _ = None RaiseAllBy' (p :-- ps) i = RaiseBy p i :-- RaiseAllBy' ps i -- | Lower all pitches in a voice by an interval. type family LowerAllBy (ps :: Voice l) (i :: IntervalType) :: Voice l where LowerAllBy End _ = End LowerAllBy (p :* d :- ps) i = LowerBy p i :* d :- LowerAllBy ps i -- | Lower multiple pitches by an interval. type family LowerAllBy' (ps :: Vector PitchType n) (i :: IntervalType) :: Vector PitchType n where LowerAllBy' None _ = None LowerAllBy' (p :-- ps) i = LowerBy p i :-- LowerAllBy' ps i -- | Raise a pitch by an octave. type family RaiseByOct (p :: PitchType) :: PitchType where RaiseByOct p = RaiseBy p (Interval Perf Octave) -- | Lower a pitch by an octave. type family LowerByOct (p :: PitchType) :: PitchType where LowerByOct p = LowerBy p (Interval Perf Octave) type family RaiseAllByOct (ps :: Voice l) :: Voice l where RaiseAllByOct v = RaiseAllBy v (Interval Perf Octave) -- | Transpose a partiture up by the given interval. type family TransposeUpBy (p :: Partiture n l) (i :: IntervalType) :: Partiture n l where TransposeUpBy _ Compound = TypeError (Text "Can't transpose by compound interval.") TransposeUpBy None i = None TransposeUpBy (v :-- vs) i = RaiseAllBy v i :-- TransposeUpBy vs i -- | Transpose a partiture down by the given interval. type family TransposeDownBy (p :: Partiture n l) (i :: IntervalType) :: Partiture n l where TransposeDownBy _ Compound = TypeError (Text "Can't transpose by compound interval.") TransposeDownBy None i = None TransposeDownBy (v :-- vs) i = LowerAllBy v i :-- TransposeDownBy vs i ------------------------------------------------------------------------------- -- Primitive instances ------------------------------------------------------------------------------- instance Primitive Oct_1 where type Rep Oct_1 = Int ; prim o = 0 ; pretty o = "_5" instance Primitive Oct0 where type Rep Oct0 = Int ; prim o = 12 ; pretty o = "_4" instance Primitive Oct1 where type Rep Oct1 = Int ; prim o = 24 ; pretty o = "_3" instance Primitive Oct2 where type Rep Oct2 = Int ; prim o = 36 ; pretty o = "__" instance Primitive Oct3 where type Rep Oct3 = Int ; prim o = 48 ; pretty o = "_ " instance Primitive Oct4 where type Rep Oct4 = Int ; prim o = 60 ; pretty o = " " instance Primitive Oct5 where type Rep Oct5 = Int ; prim o = 72 ; pretty o = "' " instance Primitive Oct6 where type Rep Oct6 = Int ; prim o = 84 ; pretty o = "''" instance Primitive Oct7 where type Rep Oct7 = Int ; prim o = 96 ; pretty o = "'3" instance Primitive Oct8 where type Rep Oct8 = Int ; prim o = 108; pretty o = "'4" instance Primitive C where type Rep C = Int ; prim p = 0 ; pretty p = "C" instance Primitive D where type Rep D = Int ; prim p = 2 ; pretty p = "D" instance Primitive E where type Rep E = Int ; prim p = 4 ; pretty p = "E" instance Primitive F where type Rep F = Int ; prim p = 5 ; pretty p = "F" instance Primitive G where type Rep G = Int ; prim p = 7 ; pretty p = "G" instance Primitive A where type Rep A = Int ; prim p = 9 ; pretty p = "A" instance Primitive B where type Rep B = Int ; prim p = 11; pretty p = "B" instance Primitive Natural where type Rep Natural = Int ; prim a = 0 ; pretty a = " " instance Primitive Flat where type Rep Flat = Int ; prim a = -1 ; pretty a = "b" instance Primitive Sharp where type Rep Sharp = Int ; prim a = 1 ; pretty a = "#" -- "Equality constraints are literally magic." -- - Michael Gale, 2017 instance (IntRep pc, IntRep acc, IntRep oct) => Primitive (Pitch pc acc oct) where type Rep (Pitch pc acc oct) = Int prim p = prim (PC @pc) + prim (Acc @acc) + prim (Oct @oct) pretty p = pretty (PC @pc) ++ pretty (Acc @acc) ++ pretty (Oct @oct) instance (IntRep sd, IntRep acc, IntRep oct) => Primitive (Degree sd acc oct) where type Rep (Degree sd acc oct) = Int prim _ = prim (ScaDeg @sd) + prim (Acc @acc) + prim (Oct @oct) pretty _ = pretty (ScaDeg @sd) ++ pretty (Acc @acc) ++ pretty (Oct @oct) instance Primitive Silence where type Rep Silence = Int ; prim s = 60 ; pretty s = "~~~~" instance IntRep p => Primitive (Root (PitchRoot p)) where type Rep (Root (PitchRoot p)) = Int prim r = prim (Pit @p) pretty r = pretty (Pit @p) -- Modes instance Primitive MajorMode where type Rep MajorMode = Bool ; prim m = True ; pretty m = "Major" instance Primitive MinorMode where type Rep MinorMode = Bool ; prim m = False ; pretty m = "minor" -- Scale degrees instance Primitive I where type Rep I = Int ; prim d = 0 ; pretty d = "I" instance Primitive II where type Rep II = Int ; prim d = 1 ; pretty d = "II" instance Primitive III where type Rep III = Int ; prim d = 2 ; pretty d = "III" instance Primitive IV where type Rep IV = Int ; prim d = 3 ; pretty d = "IV" instance Primitive V where type Rep V = Int ; prim d = 4 ; pretty d = "V" instance Primitive VI where type Rep VI = Int ; prim d = 5 ; pretty d = "VI" instance Primitive VII where type Rep VII = Int ; prim d = 6 ; pretty d = "VII" instance (IntRep pc, IntRep acc, BoolRep mo) => Primitive (Key pc acc mo) where type Rep (Key pc acc mo) = [Int] prim k = (+ (prim (PC @pc) + prim (Acc @acc))) <$> baseScale where baseScale = if (prim (Mod @ mo)) then [0, 2, 4, 5, 7, 9, 11] else [0, 2, 3, 5, 7, 8, 10] pretty k = pretty (PC @pc) ++ pretty (Acc @acc) ++ " " ++ pretty (Mod @mo) instance (IntRep p, RootToPitch (DegreeRoot k deg) ~ p, Primitive deg, Primitive k) => Primitive (DegreeRoot k deg) where type Rep (DegreeRoot k deg) = Int prim r = prim (Pit @p) pretty r = pretty (Deg @deg) instance IntRep p => Primitive (PitchRoot p) where type Rep (PitchRoot p) = Int prim p = prim (Pit @p) pretty p = pretty (Pit @p) instance KnownNat n => Primitive n where type Rep n = Int prim = fromInteger . natVal pretty (natVal -> 1) = "Th" pretty (natVal -> 2) = "Si" pretty (natVal -> 3) = "Si." pretty (natVal -> 4) = "Ei" pretty (natVal -> 6) = "Ei." pretty (natVal -> 8) = "Qu" pretty (natVal -> 12) = "Qu." pretty (natVal -> 16) = "Ha" pretty (natVal -> 24) = "Ha." pretty (natVal -> 32) = "Wh" pretty (natVal -> 48) = "Wh." pretty (natVal -> n) = ":" ++ show n -- Intervals ---- Interval classes instance Primitive Maj where type Rep Maj = Int -> Int prim _ = id pretty _ = "Maj" instance Primitive Min where type Rep Min = Int -> Int prim _ = pred pretty _ = "Min" instance Primitive Perf where type Rep Perf = Int -> Int prim _ = id pretty _ = "Perf" instance Primitive Aug where type Rep Aug = Int -> Int prim _ = (+ 1) pretty _ = "Aug" instance Primitive Dim where type Rep Dim = Int -> Int prim _ 2 = 0 prim _ 4 = 2 prim _ 5 = 4 prim _ 7 = 6 prim _ 9 = 7 prim _ 11 = 9 prim _ 12 = 11 pretty _ = "Dim" ---- Interval sizes instance Primitive Unison where type Rep Unison = Int prim _ = 0 pretty _ = "1" instance Primitive Second where type Rep Second = Int prim _ = 2 pretty _ = "2" instance Primitive Third where type Rep Third = Int prim _ = 4 pretty _ = "3" instance Primitive Fourth where type Rep Fourth = Int prim _ = 5 pretty _ = "4" instance Primitive Fifth where type Rep Fifth = Int prim _ = 7 pretty _ = "5" instance Primitive Sixth where type Rep Sixth = Int prim _ = 9 pretty _ = "6" instance Primitive Seventh where type Rep Seventh = Int prim _ = 11 pretty _ = "7" instance Primitive Octave where type Rep Octave = Int prim _ = 12 pretty _ = "8" instance (FunRep Int Int ic, IntRep is) => Primitive (Interval ic is) where type Rep (Interval ic is) = Int prim _ = prim (IC @ic) (prim (IS @ is)) pretty _ = pretty (IC @ic) ++ " " ++ pretty (IS @is)
DimaSamoz/mezzo
src/Mezzo/Model/Types.hs
mit
37,677
0
13
9,488
11,980
6,354
5,626
-1
-1
{-# htermination (succChar :: Char -> Char) #-} import qualified Prelude data MyBool = MyTrue | MyFalse data List a = Cons a (List a) | Nil data Char = Char MyInt ; data MyInt = Pos Nat | Neg Nat ; data Nat = Succ Nat | Zero ; primCharToInt :: Char -> MyInt; primCharToInt (Char x) = x; fromEnumChar :: Char -> MyInt fromEnumChar = primCharToInt; primMinusNat :: Nat -> Nat -> MyInt; primMinusNat Zero Zero = Pos Zero; primMinusNat Zero (Succ y) = Neg (Succ y); primMinusNat (Succ x) Zero = Pos (Succ x); primMinusNat (Succ x) (Succ y) = primMinusNat x y; primPlusNat :: Nat -> Nat -> Nat; primPlusNat Zero Zero = Zero; primPlusNat Zero (Succ y) = Succ y; primPlusNat (Succ x) Zero = Succ x; primPlusNat (Succ x) (Succ y) = Succ (Succ (primPlusNat x y)); primPlusInt :: MyInt -> MyInt -> MyInt; primPlusInt (Pos x) (Neg y) = primMinusNat x y; primPlusInt (Neg x) (Pos y) = primMinusNat y x; primPlusInt (Neg x) (Neg y) = Neg (primPlusNat x y); primPlusInt (Pos x) (Pos y) = Pos (primPlusNat x y); psMyInt :: MyInt -> MyInt -> MyInt psMyInt = primPlusInt; pt :: (a -> c) -> (b -> a) -> b -> c; pt f g x = f (g x); primIntToChar :: MyInt -> Char; primIntToChar x = Char x; toEnumChar :: MyInt -> Char toEnumChar = primIntToChar; succChar :: Char -> Char succChar = pt toEnumChar (pt (psMyInt (Pos (Succ Zero))) fromEnumChar);
ComputationWithBoundedResources/ara-inference
doc/tpdb_trs/Haskell/basic_haskell/succ_4.hs
mit
1,381
0
13
309
622
332
290
35
1
import Haste import Haste.Prim import Haste.Foreign import Haste.DOM import Haste.Events import Haste.Ajax import Control.Monad import Control.Applicative clearBox box val _ = do s <- getProp box "value" if s == val then setProp box "value" "" >> return () else return () fillBox box val _ = do s <- getProp box "value" if null s then setProp box "value" val >> return () else return () setClickToClear (id', val) = withElem id' $ \box -> do onEvent box Focus (clearBox box val) onEvent box Blur (fillBox box val) return () getDataURL = ffi $ toJSStr "(function(s,f){var reader=new FileReader();reader.readAsDataURL(document.getElementById(s).files[0]);reader.onload=function(){f(reader.result);};})" :: String -> (String -> IO ()) -> IO () onSubmitResultReturn :: Maybe String -> IO () onSubmitResultReturn (Just s) = alert s buildPara [] = return [] buildPara (s:ss) = do val <- withElem s $ \e -> getProp e "value" (:) <$> return (s, val) <*> buildPara ss submit = getDataURL "adPic" onDataURLReady onDataURLReady dataURL = do paras <- (:) <$> return ("adPic", dataURL) <*> buildPara ["ownerName", "ownerContact", "ownerType", "isJoined", "captcha"] ajaxRequest POST "/api/advertisement/insertApplication" paras onSubmitResultReturn return () onCaptchaVerified :: Maybe String -> IO () onCaptchaVerified Nothing = alert "Internal Error!" onCaptchaVerified (Just "1") = submit onCaptchaVerified (Just "0") = alert "验证码错误" onSubmit _ = do captcha <- withElem "captcha" $ \box -> getProp box "value" ajaxRequest GET ("/api/captcha/verify?code=" ++ captcha) noParams onCaptchaVerified return () main = do let textboxList = [("ownerName", "申请人姓名..."), ("ownerContact", "联系方式..."), ("captcha", "计算两数相乘结果...")] forM_ textboxList setClickToClear withElem "btn_submit" $ \btn -> onEvent btn Click onSubmit return ()
sqd/NNEZArtFestival2015Sys
backend/frontend/e/ads_apply.hs
mit
1,960
0
11
358
660
324
336
47
2
module Algebra.Rewriting where import Algebra.Base import Algebra.Display import Algebra.Suspension import Algebra.Symbol import Data.List ( intersperse ) import Data.Map ( Map ) import qualified Data.Map as Map import Util.Display import Util.Numeric import Util.String.Align import qualified Util.Unicode as U import qualified Util.Unicode.Greek as Greek import qualified Util.Unicode.Latin as Latin p = mergeMonomials g :: Function g m | m == 1 = placeholders .+. (p [T alpha :* 1]) | otherwise = placeholders .+. front .+. back where front = p [T gamma :* n, T (beta_ r) :* 1] back = p [(T $ only1 $ R $ Recurrence Latin.G (Suspension g n)) :* 3] (n, r) = m `divMod` 2 placeholders = p $ emptyConstantTerms [Sym Greek.Alpha :. Nothing, Sym Greek.Beta :. (Just 0), Sym Greek.Beta :. (Just 1), Sym Greek.Gamma :. Nothing ] fib :: Function fib 1 = p $ [constantTerm 1] fib 2 = p $ [constantTerm 1] fib n = fib' .+. fib'' where fib' = p [(T $ only1 $ R $ Recurrence Latin.F (Suspension fib (n - 1))) :* 1] fib'' = p [(T $ only1 $ R $ Recurrence Latin.F (Suspension fib (n - 2))) :* 1] h :: Function h m | m == 1 = placeholders .+. (p [T alpha :* 1]) | otherwise = placeholders .+. front .+. back where front = p [T (gamma_ r) :* n, T (beta_ r) :* 1] back = distributeMOverP (constantTerm 4) (h n) (n, r) = m `divMod` 2 placeholders = p $ emptyConstantTerms [Sym Greek.Alpha :. Nothing, Sym Greek.Beta :. (Just 0), Sym Greek.Beta :. (Just 1), Sym Greek.Gamma :. (Just 0), Sym Greek.Gamma :. (Just 1) ] alpha = only1 $ SC $ Sym Greek.Alpha :. Nothing alpha_ n = only1 $ SC $ Sym Greek.Alpha :. (Just n) beta = only1 $ SC $ Sym Greek.Beta :. Nothing beta_ n = only1 $ SC $ Sym Greek.Beta :. (Just n) gamma = only1 $ SC $ Sym Greek.Gamma :. Nothing gamma_ n = only1 $ SC $ Sym Greek.Gamma :. (Just n) printTable :: Function -> Integer -> IO () printTable f n = do let results = map (display . f) [1..n] formattedResults = alignAtChar '+' results formattedNs = alignAtChar '+' $ map show {--(`showPowerRemainder` 2)--} [1..n] table = zipWith (\a b -> a ++ " | " ++ b) formattedNs formattedResults putStrLn $ unlines table
sgord512/Algebra
Algebra/Rewriting.hs
mit
2,677
0
16
957
1,015
528
487
55
1
module Primitive where import Numerical import Vec3 import Ray import Material import Container import Data.List import Data.Maybe import Control.Applicative import Control.DeepSeq data Primitive = Sphere { surface :: C3 Material , isSource :: Bool , origin :: Vec , radius :: Flt } | Plane { surface :: C3 Material , normal :: Vec , distance :: Flt } | Triangle { surface :: C3 Material , vert0 :: Vec , vert1 :: Vec , vert2 :: Vec , edge0 :: Vec , edge1 :: Vec , normal :: Vec } deriving (Eq, Show) instance NFData Primitive where rnf (Sphere a b c d) = a `deepseq` b `deepseq` c `deepseq` d `deepseq` () rnf (Plane a b c) = a `deepseq` b `deepseq` c `deepseq` () rnf (Triangle a b c d e f g) = a `deepseq` b `deepseq` c `deepseq` d `deepseq` e `deepseq` f `deepseq` g `deepseq` () constructTriangle :: C3 Material -> Vec -> Vec -> Vec -> Primitive constructTriangle mat v0 v1 v2 = Triangle mat v0 v1 v2 e0 e1 (normalize (cross e0 e1)) where e0 = v1 - v0 e1 = v2 - v0 findNormal :: Primitive -> Vec -> Vec findNormal (Sphere _ _ orig _) point = normalize $ point - orig findNormal (Plane _ norm _) _ = norm findNormal (Triangle _ _ _ _ _ _ norm) _ = norm intersection :: Primitive -> Ray -> Maybe Flt intersection (Sphere _ _ orig rad) (Ray position direction) = if disc > 0 then Just $ -(b + sqrt disc) / (2 * a) else Nothing where disc = (b * b) - (4 * a * c) a = dot direction direction b = 2 * dot direction pSubOrigin c = dot pSubOrigin pSubOrigin - (rad * rad) pSubOrigin = position - orig intersection (Plane _ norm dist) (Ray position direction) = if det /= 0 && e > 0 then Just e else Nothing where det = dot norm direction e = (dist - dot norm position) / det intersection (Triangle _ v0 _ _ e0 e1 _) (Ray position direction) | -epsilon < det && det < epsilon = Nothing | u < 0 || 1 < u = Nothing | v < 0 || 1 < u + v = Nothing | otherwise = Just $ invdet * dot e1 qvec where epsilon = 0.000001 det = dot e0 pvec pvec = cross direction e1 u = invdet * dot tvec pvec tvec = position - v0 invdet = 1 / det v = invdet * dot direction qvec qvec = cross tvec e0 reflectFromPrimitive :: Primitive -> Ray -> Ray reflectFromPrimitive prim ray@(Ray position direction) = reflectRay ray nor pos where nor = findNormal prim pos pos = position + (direction * dist) dist = pure $ fromMaybe 0 inter inter = intersection prim ray closest :: Ray -> [Primitive] -> Maybe Primitive closest r primitives = if null filtered then Nothing else Just prim where zipped = zip primitives (map (`intersection` r) primitives) filtered = filter (\ (_, x) -> isJust x && fromJust x > 0.00001) zipped (prim, _) = minimumBy (\ (_, x) (_, y) -> compare x y) filtered
reuk/rayverb
src/Primitive.hs
gpl-2.0
3,846
0
12
1,739
1,205
649
556
86
3
-- No main, hsExpand should not accept this. fib 0 = 1 fib 1 = 1 fib n = fib (n-1) + fib (n-2)
uvthenfuv/HsExpand
tests/test2.hs
gpl-2.0
96
0
8
25
50
25
25
3
1
module Language.Pepa.Transform.Rules.Apply ( applyRulesToModel ) where {- Standard Library Modules Imported -} import Control.Monad ( foldM ) import qualified Data.Map as Map import Data.Map ( Map ) {- External Library Modules Imported -} {- Local Modules Imported -} import Language.Pepa.Transform.Rules.Syntax ( Rules , Rule ( .. ) , ComponentName , Pattern ( .. ) , ActionsPattern ( .. ) , PatternVariable , ExprPattern ( .. ) , Replacement , patternVariables , replacementVariables ) import qualified Language.Pepa.QualifiedName as QualifiedName import Language.Pepa.QualifiedName ( QualifiedName ( .. ) ) import Language.Pepa.Rates ( RateExpr ( .. ) ) import qualified Language.Pepa.Syntax as Pepa import Language.Pepa.Syntax ( ParsedModel ( .. ) , ParsedComponent ( .. ) , CooperationSet ( .. ) , ParsedAction ( .. ) , nameOfAction ) import qualified Language.Pepa.Print as PepaPrint import qualified Language.Pepa.MainControl as MainControl import Language.Pepa.MainControl ( MainControl ) import qualified Language.Pepa.Utils as Utils import qualified Language.Pepa.Compile.PartEval as PartEval {- End of Module Imports -} {-| Apply a set of transformation rules to a model -} applyRulesToModel :: ParsedModel -> Rules -> MainControl ParsedModel applyRulesToModel pModel rules = do tModel <- foldM applyRuleToModel pModel rules let logKey = "transformed-model" logInfo = PepaPrint.hprintPepaModel tModel MainControl.valueResult tModel logKey logInfo {-| Apply a single transformation rule to a model -} applyRuleToModel :: ParsedModel -> Rule -> MainControl ParsedModel applyRuleToModel pModel rule | not $ null undefinedVars = MainControl.resultError undefinedErr | otherwise = do newModel <- mTransformed -- So if we managed to apply the rule to the model -- (if we didn't the mTransformed will just be a 'failed' -- main control and this bit doesn't get evaluated) -- then we must return a model which contains all the -- original definitions plus the new ones. In addition -- system equation should be the new one, so we use 'const' -- here and give the newModel first. return $ Pepa.combineModels const newModel pModel where mTransformed = applyRule $ modelSystemEqn pModel pattern = rulePattern rule replacement = ruleReplace rule patternVars = patternVariables pattern replaceVars = replacementVariables replacement undefinedVars = filter (\t -> not $ elem t patternVars) replaceVars undefinedErr = unlines [ "The rule cannot be applied because the following" , "pattern variables are used in the replacement but" , "not defined within the pattern:" , Utils.mkCSlist $ map QualifiedName.getOrigName undefinedVars ] -- We return a 'Maybe ParsedComponent', if we cannot apply -- the rule to the given component then we return 'Nothing' -- This also allows us to say whether we have applied a rule -- which should only be applied a once (or a given number). applyRule :: ParsedComponent -> MainControl ParsedModel applyRule component | Just env <- matchPattern component pattern = -- If the pattern currently matches then no problem we can just -- blend in the replacement and we're done. blendReplacement env replacement | (Cooperation left actions right) <- component , leftResult <- applyRule left , rightResult <- applyRule right = -- In this case we already know that we don't currently -- match the pattern but either the left or the right -- might. NOTE: that we do not use the new right if the -- left matches the pattern. if MainControl.hasResult leftResult -- The left matches so we do not care about the right then do leftModel <- leftResult let newComp = Cooperation (modelSystemEqn leftModel) actions right return $ leftModel { modelSystemEqn = newComp } else if MainControl.hasResult rightResult -- Okay the left didn't match but the right does then do rightModel <- rightResult let newComp = Cooperation left actions (modelSystemEqn rightModel) return $ rightModel { modelSystemEqn = newComp } -- Okay neither has completed so we may just return an -- error. I'm concatenating the errors this way otherwise -- (if we said simply "fail Cooperation left right doesn't match") -- then we would always get the error that system equation -- doesn't match. else leftResult >> rightResult | (ProcessArray comp size mActions) <- component = do newComp <- applyRule comp let array = ProcessArray (modelSystemEqn newComp) size mActions return $ newComp { modelSystemEqn = array } | otherwise = -- This is the final catch all case which will include -- component identifiers that haven't matched the pattern. -- Here we have nothing left to try so we return 'Nothing' fail "Pattern could not be matched" -- 'matchPattern' must return an environment since some of the -- component matched by the pattern may be reused in the -- replacement by means of a pattern variable. We return -- 'Nothing' to indicate that the pattern failed to match -- and Just Environment to indicate that it succeeded. -- Note that of course the returned environment may well -- be empty. matchPattern :: ParsedComponent -> Pattern -> Maybe Environment matchPattern component (VarPat ident) = -- Of course a pattern variable matches any component return $ addComponent emptyEnvironment ident component matchPattern (IdProcess compId) (IdentPat patId) | refersTo patId compId = return emptyEnvironment | otherwise = fail "Wrong component name" matchPattern (Cooperation left actions right) (CoopPat pLeft pActions pRight) = -- Notice if the pattern fails to match here we do not -- descent into the left and right components to see if the -- pattern matches there, 'applyRule' will take care of that -- we simply state whether the pattern matches currently. do leftEnv <- matchPattern left pLeft rightEnv <- matchPattern right pRight actEnv <- matchActions actions pActions return $ addActionMap (unionEnvironments leftEnv rightEnv) actEnv matchPattern (ProcessArray comp size mActions) (ArrayPat compPat sizePat mActionsPat) = -- TODO: Currently we don't match the size but we should and -- will of course need to in order to implement size changing. do compEnv <- matchPattern comp compPat exprEnv <- matchExprPattern size sizePat let env = addExprMap compEnv exprEnv case (mActions, mActionsPat) of (Nothing, Nothing) -> return env (Just _, Nothing) -> fail "process array actions don't match" (Nothing, Just _) -> fail "process array actions don't match" (Just a1, Just a2) -> do actEnv <- matchActions (ActionSet a1) a2 return $ addActionMap env actEnv -- So basically at this point we have determined that the pattern -- does not match matchPattern (IdProcess _) _pattern = fail "comp doesn't match" matchPattern (Cooperation _ _ _ ) _pattern = fail "comp doesn't match" matchPattern (ProcessArray _ _ _) _pattern = fail "comp doesn't match" matchPattern (Hiding _ _) _pattern = fail "comp doesn't match" -- Now the errors, that is sequential components found in the -- system equation. matchPattern (PrefixComponent _ _) _pattern = error errorMsg matchPattern (ComponentSum _ _) _pattern = error errorMsg matchPattern (CondBehaviour _ _) _pattern = error errorMsg matchPattern (StopProcess) _pattern = error errorMsg errorMsg = "matchPattern serious error: " ++ "sequential component in system equation" -- Matching the set of actions, the same as 'matchPattern' but -- for a set of actions. matchActions :: CooperationSet -> ActionsPattern -> Maybe ActionMap matchActions (ActionSet actions) (AnyActions ident pActions) | all (\t -> elem t actionNames) pActions = return mapping | otherwise = fail failMsg where mapping = Map.singleton ident nonExplict failMsg = "Explicit actions in pattern not matched" -- These are the action in 'actions' but not mentioned -- explicitly in the pattern and hence those that the -- pattern variable should be mapped to. nonExplict = ActionSet $ filter (not . isExplicit) actions isExplicit :: ParsedAction -> Bool isExplicit action = elem (nameOfAction action) pActions actionNames = map nameOfAction actions matchActions (ActionSet actions) (Actions pActions) | not $ equalSetLists actionNames pActions = fail "Actions do not match" | otherwise = return Map.empty where actionNames = map nameOfAction actions -- So basically currently a wildcard can only be matched by a -- pattern variable without any explicit actions. matchActions (WildCard) (AnyActions ident []) = return $ Map.singleton ident WildCard -- So this could technically match but for now we'll -- assume that the author of the rule meant explicitly -- those actions. Potentially we could do this but it -- is quite awkward and requires a process action map. matchActions WildCard (AnyActions _ident _acts) = fail "Actions do not match" matchActions (WildCard) (Actions _pActions) = fail "Actions do not match" -- A utility function which tests if two lists define -- the same set. We do not care if an item occurs multiple -- times. equalSetLists :: Eq a => [a] -> [a] -> Bool equalSetLists l1 l2 = -- All of the elements of l1 are in l2 (all (\e -> elem e l2) l1) && -- And all of the elements of l2 are in l1 (all (\e -> elem e l1) l2) -- The same as 'matchPattern' but for expressions. matchExprPattern :: RateExpr -> ExprPattern -> Maybe ExpressionMap matchExprPattern (Cconstant i) (ConstantPat j) | i == j = return Map.empty | otherwise = fail "Pattern does not match" matchExprPattern (Creal d) (RealPattern e) | d == e = return Map.empty | otherwise = fail "Pattern does not match" matchExprPattern expr (AnyExpr var) = return $ Map.singleton var expr -- So here we go a bit wrong, we must decide what to do with -- compound expressions. We should at least match Cadd with -- PlusPattern etc. However what about (3) with (2 + 1), not very -- useful I agree, but what about about (3) with (?a + 1) where -- ?a is mapped to 2. We should be able to write this. matchExprPattern _expr _pattern = fail "Pattern does not match" -- To make the replacement we must transform the parsed replacement -- into a parsed component. Note that currently we only support -- straightforward dropping into place but in time we should allow -- the pattern to match on some names and hence we need to replace -- those names in the replacement. That may mean that here we -- need to take in an environment. blendReplacement :: Environment -> Replacement -> MainControl ParsedModel blendReplacement env (VarPat ident) = do component <- newComp return $ Pepa.emptyModel component where newComp = maybe failVal return $ lookupComp env ident failVal = fail failMsg failMsg = unwords [ "Not found:", QualifiedName.textual ident ] blendReplacement _env (IdentPat ident) = return $ Pepa.emptyModel (IdProcess ident) blendReplacement env (CoopPat left actionsPattern right) = do newLeft <- blendReplacement env left newRight <- blendReplacement env right actions <- blendActions env actionsPattern let combineF l r = Cooperation l actions r return $ Pepa.combineModels combineF newLeft newRight blendReplacement env (ArrayPat comp size Nothing) = do newComp <- blendReplacement env comp newSize <- blendExpression env size let array = ProcessArray (modelSystemEqn newComp) newSize Nothing return $ newComp { modelSystemEqn = array } blendReplacement env (ArrayPat comp size (Just actPat)) = do newComp <- blendReplacement env comp newSize <- blendExpression env size coopSet <- blendActions env actPat -- Instead we could probably just get the action set of the array -- component. However it would be better to allow it in GENERAL -- for the array syntax if we're going to allow it at all here. array <- case coopSet of ActionSet newActions -> return $ ProcessArray (modelSystemEqn newComp) newSize (Just newActions) WildCard -> fail failMsg return $ newComp { modelSystemEqn = array } where failMsg = "You cannot have a wildcard cooperation set in an array" blendReplacement env (PartEval compRep) = do smallModel <- blendReplacement env compRep -- We need to combine the model returned with the original -- model since the original model will have all the process -- definitions and this one not necessarily. We use 'const' -- as the combining function since we want the blended component -- to be the actual system equation that gets partially -- evaluated. let fullModel = Pepa.combineModels const smallModel pModel PartEval.partEvalPepaModel fullModel -- The same as 'blendReplacement' but for a set of actions. blendActions :: Environment -> ActionsPattern -> MainControl CooperationSet blendActions _env (Actions actions) = return $ ActionSet $ map Action actions blendActions env (AnyActions var pActions) = do coopSet <- maybe failVal return $ lookupActions env var case coopSet of -- This is kind of questionable, certainly if wildcard doesn't -- include pActions, then it is wrong, but then in that case you -- have made a broken PEPA model by attempting to cooperate on -- an activity you do not perform. WildCard -> return WildCard ActionSet acts -> return $ ActionSet $ acts ++ (map Action pActions) where failVal = fail failMsg failMsg = unwords [ "Could not match action set" ] -- The same as 'blendReplacement' and 'blendActions' but for an -- expression usually occuring as the size portion of a process array blendExpression :: Environment -> ExprPattern -> MainControl RateExpr blendExpression env (AnyExpr var) = maybe failVal return $ lookupExpr env var where failVal = fail failMsg failMsg = unwords [ "No such variable: ", QualifiedName.textual var ] blendExpression _env (ConstantPat i) = return $ Cconstant i blendExpression _env (RealPattern d) = return $ Creal d blendExpression env (PlusPattern left right) = do newLeft <- blendExpression env left newRight <- blendExpression env right return $ Cadd newLeft newRight blendExpression env (MinusPattern left right) = do newLeft <- blendExpression env left newRight <- blendExpression env right return $ Csub newLeft newRight blendExpression env (MultPattern left right) = do newLeft <- blendExpression env left newRight <- blendExpression env right return $ Cmult newLeft newRight -- A utility function to test whether a component name within -- a rule refers to a component name within the model. refersTo :: ComponentName -> QualifiedName -> Bool refersTo = QualifiedName.sameOrigName {- The type 'Environment' captures what we return when a pattern matches a component. If the pattern contains a pattern variable (ie. something that matches anything) then we add whatever is in that position in the matched component to the environment. We need several maps because a pattern variable may match against different parts of the model. Notice that this also allows us to have the same pattern variable mapped more than once depending on where it occurs in the pattern and the replacement, you can for example write; "?P[?P][?P] ==> ?P[?P + 1][?P,a]" although we don't really advertise this fact as it seems not to be particularly robust. -} data Environment = Environment { envActions :: ActionMap , envComponents :: ComponentMap , envExpressions :: ExpressionMap } -- The types of maps included in an environment type ActionMap = Map PatternVariable CooperationSet type ComponentMap = Map PatternVariable ParsedComponent type ExpressionMap = Map PatternVariable RateExpr {- The empty environment what is returned when the pattern matches completely and no pattern variables are used. -} emptyEnvironment :: Environment emptyEnvironment = Environment { envActions = Map.empty , envComponents = Map.empty , envExpressions = Map.empty } -- Lookup a pattern variable which we expect to be mapped to a list -- of actions. lookupActions :: Environment -> PatternVariable -> Maybe CooperationSet lookupActions env var = Map.lookup var $ envActions env -- Lookup a pattern variable which we expect to be mapped to an expression -- because it has occurred in an expression place in the replacement, for -- example the size of an array. lookupExpr :: Environment -> PatternVariable -> Maybe RateExpr lookupExpr env var = Map.lookup var $ envExpressions env -- Lookup a pattern variable which we expect to be mapped to a component lookupComp :: Environment -> PatternVariable -> Maybe ParsedComponent lookupComp env var = Map.lookup var $ envComponents env -- Unify together two environments, to be honest we should really check -- that any pattern variable is not defined more than once at the same -- type. As mentioned above we can define the same pattern variable to -- map against say a component and a set of actions, but we do not wish -- to allow for example: "?P || ?P" as a pattern as it's not clear what -- we should do at this point. unionEnvironments :: Environment -> Environment -> Environment unionEnvironments e1 e2 = Environment { envActions = Map.union (envActions e1) (envActions e2) , envComponents = Map.union (envComponents e1) (envComponents e2) , envExpressions = Map.union (envExpressions e1) (envExpressions e2) } -- Having made an action map, add it to the given environment -- As above we should make sure we are not overridding any -- pattern variables already mapped to an action. addActionMap :: Environment -> ActionMap -> Environment addActionMap env am = env { envActions = Map.union (envActions env) am } -- Having made an expression mapping add it to the given environement -- Similarly we should not allow ourselves to overide and existing -- mapping from a pattern variable to an expression. addExprMap :: Environment -> ExpressionMap -> Environment addExprMap env em = env { envExpressions = Map.union (envExpressions env) em } -- Add the given component to the given environment. -- Once again we should check that no mapping from the given pattern -- variable to a component already exists. addComponent :: Environment -> PatternVariable -> ParsedComponent -> Environment addComponent env pvar comp = env { envComponents = Map.insert pvar comp $ envComponents env }
allanderek/ipclib
Language/Pepa/Transform/Rules/Apply.hs
gpl-2.0
20,562
0
17
5,612
3,358
1,732
1,626
257
37
{-# LANGUAGE TemplateHaskell, DeriveDataTypeable #-} module SAT.Param where -- $Id$ import SAT.Types import Autolib.Reader import Autolib.ToDoc import Autolib.Set import Data.Typeable data Param = Param { vars :: Set Variable , clauses :: Int -- ^ anzahl (empfohlen: 3.5 * variablen) } deriving ( Typeable ) p :: Int -> Param p n = let f = 3.5 :: Double in Param { vars = mkSet $ take n $ do c <- [ 'p' .. ] ; return $ read [c] , clauses = round $ f * fromIntegral n } $(derives [makeReader, makeToDoc] [''Param]) -- local variables: -- mode: haskell -- end:
Erdwolf/autotool-bonn
src/SAT/Param.hs
gpl-2.0
614
4
14
158
187
105
82
16
1
-- 18/03/16 -- Lorenzo Jose Lamas -- Algebra I -- Labo -- suma x y = x + y doble x = 2* x normaVectorial v1 v2 = sqrt (v1^2 + v2^2) funcionConstante8 x = 8 respuestaATodo = 42 -- Primera parte todo piola ! unoSiCero n | n == 0 = 1 | otherwise= 0 -- Medio compliqueti la sintaxis jajaj signo n | n > 0 = 1 | n == 0 = 0 | n < 0 = (-1) -- costo pero salio valorAbsoluto x = sqrt(x^2) maximo2 v1 v2 | v1 > v2 = v1 | v1 < v2 = v2 | v1 == v2 = v1 -- Y ahora ... maximo3 v1 v2 v3 = maximum [v1,v2,v3] -- Es trampa ?? esPositivo n | n >= 0 = True | otherwise = False esPar n | even n = True | otherwise = False esPar1 x = (div x 2) * 2 == x -- Div es el cons esPar2 x = (mod x 2) == 0 yLogico1 x y = x && y yLogico True True = True yLogico True False = False yLogico False True = False yLogico False False = False yLogico2 True True = True yLogico2 x y = False yLogico3 False _ = False yLogico3 _ y = y f n1 n2 n3 | n2 < 10 = n1 | n2 >= 10 = n1 + n3 nand x y = not (x && y) unaRaiz a b c = ( (-b) + sqrt(b^2 - 4*a*c) ) / (2*a) unaRaiz1 a b c | (b^2 - 4*a*c) < 0 = error "No hay raices reales" | (b^2 - 4*a*c) >= 0 = ( (-b) + sqrt(b^2 - 4*a*c) ) / (2*a) pitagoras a b c = c^2 == a^2 + b^2
lorenzojlamas/ejercicios
1.hs
gpl-3.0
1,242
0
14
363
703
350
353
37
1
module Main (main) where import Options.Applicative import Data.Monoid ((<>)) import Folgerhs.Stage import Folgerhs.Speakers (speakers) import Folgerhs.Presence (presence) import Folgerhs.Animate (animation) data Config = Presence FilePath Bool | Speakers FilePath | Animate FilePath Int Bool Line config :: Parser Config config = hsubparser ( command "presence" ( info presenceConfig (progDesc "Line-by-line on stage presence as CSV") ) <> command "animate" ( info animateConfig (progDesc "Animated character interaction") ) <> command "speakers" ( info speakersConfig (progDesc "Speech ratio per character") ) ) presenceConfig :: Parser Config presenceConfig = Presence <$> strArgument ( metavar "FILENAME" <> help "File to parse" ) <*> switch ( long "without-unnamed" <> help "Exclude unnamed characters") speakersConfig :: Parser Config speakersConfig = Speakers <$> strArgument ( metavar "FILENAME" <> help "File to parse" ) animateConfig :: Parser Config animateConfig = Animate <$> strArgument ( metavar "FILENAME" <> help "File to parse" ) <*> option auto ( long "rate" <> value 10 <> metavar "RATE" <> help "Lines per second") <*> switch ( long "without-unnamed" <> help "Exclude unnamed characters") <*> strOption ( long "seek-line" <> value "0" <> metavar "ACT.SCENE.LINE" <> help "Start animation from given line") execute :: Config -> IO () execute (Presence f wu) = presence f wu execute (Speakers f) = speakers f execute (Animate f lps wu sl) = animation f lps wu sl main :: IO () main = execParser opts >>= execute where desc = "Example usage of the toolset for Folger Shakespeare Library's TEI-encoded plays" opts = info (helper <*> config) ( progDesc desc <> fullDesc )
SU-LOSP/folgerhs
app/Folgerhs/Main.hs
gpl-3.0
2,056
0
13
625
518
259
259
57
1
{-| Module : Parameter Description : PhotoVideotex parameter generator Copyright : (c) Frédéric BISSON, 2014 License : GPL-3 Maintainer : zigazou@free.fr Stability : experimental Portability : POSIX This module allows to generate parameters for photo videotex. All parameters are not useful with the Minitel. -} module Minitel.Generate.Photo.Parameter ( mResetToDefault , intParm , normParm , enumParm , mFieldLength , mFullScreenDisplay , mSourceAspectRatio , mPhotoAreaLocation , mPhotoAreaSize , mPicturePlacement , mClearPhotoArea , mSourcePictureComments , mSourcePictureDimensions , mSourcePixelDensityStf , mSourcePixelDensityVal , mSourceSweepDirection , mDCImages , Component(ComponentRGB, ComponentYCrCb, ComponentCMYK, ComponentY) , mSourceComponentDescription , mSourceComponentDataPrecision , mSourceComponentOrder , mSourceLevelAssignmentFix , mSourceLevelAssignment , JPGHierarchical(NonHierarchical, Hierarchical) , JPGTransform(DCT, DPCM) , JPGOrder(Sequential, Progressive) , JPGCoding(Huffman, Arithmetic) , mJPEGCodingMode , mEncodingTableManagement , mApplicationMarkerCodesAssignment , TranslationMode( NoTranslation , NoTranslationExceptUS , Encoding3in4 , Shift8bits , Shift7bits , NoTranslationExceptSp ) , mTranslationModeEncoding ) where import Minitel.Constants.Photo import Minitel.Type.MNatural import Minitel.Type.MString -- | Convert an Int into a field length mFieldLength :: Int -> MString mFieldLength i | i < 0 = error "Negative number !" | i < 32 = [mnat i] | otherwise = mnat (0x40 + hi):mFieldLength lo where (hi, lo) = divMod i 32 -- * Parameters -- Parameters are MString composed of -- - a parameter type -- - a field length -- - the parameter value -- | Boolean parameter boolParm :: Bool -> MString boolParm True = [pBoolean] ++ mFieldLength 1 ++ [0x01] boolParm False = [pBoolean] ++ mFieldLength 1 ++ [0x00] -- | Integer parameter intParm :: Int -> MString intParm i | i < -8192 = error "Number below -8192" | i > 8191 = error "Number above 8191" | otherwise = [pInteger] ++ mFieldLength 2 ++ [mnat byte1, mnat byte2] where cpl = if i < 0 then 16384 + i else i (byte1, byte2) = (div cpl 128, mod cpl 128) -- | Float parameter normParm :: Float -> MString normParm n | n < -1 = error "Number below -1" | n > 1 = error "Number above 1" | otherwise = [pNormalised] ++ mFieldLength 2 ++ [mnat byte1, mnat byte2] where cpl = round $ if n < 0 then 16384 + (1 + n) * 4096 else n * 4096 (byte1, byte2) = divMod cpl 128 class Enumeration en where enumToMNat :: en -> MNat -- | Enumeration parameter enumParm :: (Enumeration a) => a -> MString enumParm i = [pEnumeration] ++ mFieldLength 1 ++ [enumToMNat i] -- * Parameter Status Attribute -- | Reset to default values mResetToDefault :: Bool -> MString mResetToDefault b = rtd ++ boolParm b -- * Picture Display Attributes -- | Full screen display mFullScreenDisplay :: Bool -> MString mFullScreenDisplay b = fsd ++ boolParm b -- | Source aspect ratio mSourceAspectRatio :: Int -> Int -> MString mSourceAspectRatio araw arah = asr ++ intParm araw ++ intParm arah -- | Photo area location -- The location is given as a percentage of the screen width\/height mPhotoAreaLocation :: Float -> Float -> MString mPhotoAreaLocation loch locv = loc ++ normParm loch ++ normParm locv -- | Photo area size -- The size is given as a percentage of the screen width\/height mPhotoAreaSize :: Float -> Float -> MString mPhotoAreaSize sizw sizh = pas ++ normParm sizw ++ normParm sizh -- | Picture placement -- Picture placement inside the photo area mPicturePlacement :: Int -> Int -> Float -> Float -> MString mPicturePlacement refh refv offh offv = ppl ++ intParm refh ++ intParm refv ++ normParm offh ++ normParm offv -- | Clear photo area -- Useful for pictures handling transparency mClearPhotoArea :: Bool -> MString mClearPhotoArea b = cpa ++ boolParm b -- * Source Picture Attributes -- | Source picture comments -- TODO: implement source picture comments mSourcePictureComments :: Int -> Int -> MString mSourcePictureComments = undefined -- | Source picture dimensions mSourcePictureDimensions :: Int -> Int -> MString mSourcePictureDimensions nph npv = pds ++ intParm nph ++ intParm npv -- | Density STF data DensityStf = Density422625 | Density422525 | Density211625 | Density211525 | DensityCIF | DensityNA instance Enumeration DensityStf where enumToMNat Density422625 = 0x01 enumToMNat Density422525 = 0x02 enumToMNat Density211625 = 0x03 enumToMNat Density211525 = 0x04 enumToMNat DensityCIF = 0x05 enumToMNat DensityNA = 0x06 -- | Density unit data DensityUnit = PixelsPerInch | PixelsPerCm | PixelsPerMm instance Enumeration DensityUnit where enumToMNat PixelsPerInch = 0x01 enumToMNat PixelsPerCm = 0x02 enumToMNat PixelsPerMm = 0x03 -- | Source pixel density STF mSourcePixelDensityStf :: DensityStf -> MString mSourcePixelDensityStf density = pid ++ enumParm density -- | Source pixel density Values mSourcePixelDensityVal :: Int -> Int -> Int -> Int -> DensityUnit -> MString mSourcePixelDensityVal phnum phden pvnum pvden densityUnit = pid ++ intParm phnum ++ intParm phden ++ intParm pvnum ++ intParm pvden ++ enumParm densityUnit -- | Vertical sweep data VerticalSweep = TopToBottom | BottomToTop instance Enumeration VerticalSweep where enumToMNat TopToBottom = 0x01 enumToMNat BottomToTop = 0x02 -- | Horizontal sweep data HorizontalSweep = LeftToRight | RightToLeft instance Enumeration HorizontalSweep where enumToMNat LeftToRight = 0x01 enumToMNat RightToLeft = 0x02 -- | Source sweep direction mSourceSweepDirection :: VerticalSweep -> HorizontalSweep -> MString mSourceSweepDirection sdir sdil = swd ++ enumParm sdir ++ enumParm sdil -- | DCI inages mDCImages :: Bool -> MString mDCImages b = dci ++ boolParm b -- * Source Signal Attributes -- | Component -- The Minitel only supports ComponentY data Component = ComponentRGB | ComponentYCrCb | ComponentCMYK | ComponentY instance Enumeration Component where enumToMNat ComponentRGB = 0x01 enumToMNat ComponentYCrCb = 0x02 enumToMNat ComponentCMYK = 0x03 enumToMNat ComponentY = 0x04 -- | Source component description mSourceComponentDescription :: Component -> MString mSourceComponentDescription com = scd ++ enumParm com -- | Source component data precision mSourceComponentDataPrecision :: Int -> MString mSourceComponentDataPrecision cpt = cdp ++ intParm cpt -- | Source component order mSourceComponentOrder :: Int -> MString mSourceComponentOrder cor = cmo ++ intParm cor -- | Level assignment data LevelAssignment = CCIR6011 instance Enumeration LevelAssignment where enumToMNat CCIR6011 = 0x01 -- | Source level assignment fix mSourceLevelAssignmentFix :: MString mSourceLevelAssignmentFix = las ++ enumParm CCIR6011 -- | Source level assignment mSourceLevelAssignment :: Int -> Int -> MString mSourceLevelAssignment low hi = las ++ intParm low ++ intParm hi -- * Source Coding Algorithm data JPGHierarchical = NonHierarchical | Hierarchical data JPGTransform = DCT | DPCM data JPGOrder = Sequential | Progressive data JPGCoding = Huffman | Arithmetic -- | JPEG coding mode mJPEGCodingMode :: JPGHierarchical -> JPGTransform -> JPGOrder -> JPGCoding -> MString mJPEGCodingMode h t o c = jpg ++ intParm (ih + it + io + ic) where ih = case h of NonHierarchical -> 0x00 Hierarchical -> 0x01 it = case t of DCT -> 0x00 DPCM -> 0x02 io = case o of Sequential -> 0x00 Progressive -> 0x04 ic = case c of Huffman -> 0x00 Arithmetic -> 0x08 -- | Table type data TableType = TableQuantisation | TableHuffman instance Enumeration TableType where enumToMNat TableQuantisation = 0x01 enumToMNat TableHuffman = 0x02 -- | Table management data TableManagement = LoadDefaultTable | UseCurrentTable | TableWillBeTransferred instance Enumeration TableManagement where enumToMNat LoadDefaultTable = 0x01 enumToMNat UseCurrentTable = 0x02 enumToMNat TableWillBeTransferred = 0x03 -- | Encoding table management mEncodingTableManagement :: TableType -> Int -> TableManagement -> MString mEncodingTableManagement ttp tid tst = etm ++ enumParm ttp ++ intParm tid ++ enumParm tst -- | Application marker data ApplicationMarker = AnimatedImages | ColourPaletteDefinition | ToBeAllocated02 | ToBeAllocated03 | ToBeAllocated04 | ToBeAllocated05 | ToBeAllocated06 | ToBeAllocated07 | ToBeAllocated08 | ToBeAllocated09 | ToBeAllocated0A | ToBeAllocated0B | ToBeAllocated0C | ToBeAllocated0D | ToBeAllocated0E | ToBeAllocated0F instance Enumeration ApplicationMarker where enumToMNat AnimatedImages = 0x00 enumToMNat ColourPaletteDefinition = 0x01 enumToMNat ToBeAllocated02 = 0x02 enumToMNat ToBeAllocated03 = 0x03 enumToMNat ToBeAllocated04 = 0x04 enumToMNat ToBeAllocated05 = 0x05 enumToMNat ToBeAllocated06 = 0x06 enumToMNat ToBeAllocated07 = 0x07 enumToMNat ToBeAllocated08 = 0x08 enumToMNat ToBeAllocated09 = 0x09 enumToMNat ToBeAllocated0A = 0x0A enumToMNat ToBeAllocated0B = 0x0B enumToMNat ToBeAllocated0C = 0x0C enumToMNat ToBeAllocated0D = 0x0D enumToMNat ToBeAllocated0E = 0x0E enumToMNat ToBeAllocated0F = 0x0F -- | Application marker code assignment mApplicationMarkerCodesAssignment :: ApplicationMarker -> MString mApplicationMarkerCodesAssignment mak = ama ++ enumParm mak -- * Transmission Channel Attributes -- | Translation mode data TranslationMode = NoTranslation | NoTranslationExceptUS | Encoding3in4 | Shift8bits | Shift7bits | NoTranslationExceptSp instance Enumeration TranslationMode where enumToMNat NoTranslation = 0x00 enumToMNat NoTranslationExceptUS = 0x01 enumToMNat Encoding3in4 = 0x02 enumToMNat Shift8bits = 0x03 enumToMNat Shift7bits = 0x04 enumToMNat NoTranslationExceptSp = 0x05 -- | Translation mode encoding mTranslationModeEncoding :: TranslationMode -> MString mTranslationModeEncoding tmod = tme ++ enumParm tmod
Zigazou/HaMinitel
src/Minitel/Generate/Photo/Parameter.hs
gpl-3.0
11,461
0
12
3,161
2,204
1,192
1,012
240
5
module Examples where import Triangulation import TriangulationCxtObject import StandardCoordinates import Data.TrieSet as Set import FaceLattice import ParseJvx -- | Figure 1 in "Normal surfaces in topologically finite 3-manifolds (Tillmann)" fig1 :: Triangulation fig1 = triang [( 0 ./ tABD, 0 ./ oBCD)] eightComplement = triang [ ( 0 ./ tABC, 1 ./ oDBC) , ( 0 ./ tABD, 1 ./ oACD) , ( 0 ./ tACD, 1 ./ oACB) , ( 0 ./ tBCD, 1 ./ oBAD) ] tt2 :: Triangulation tt2 = triang [( 0 ./ tACD, 1 ./ oCBD)] tt3 :: Triangulation tt3 = triang [( 1 ./ tABD, 1 ./ oDBC)] standard3Sphere :: Triangulation standard3Sphere = convertToTriangulation [(1,2,3,4),(0,2,3,4),(0,1,3,4),(0,1,2,4),(0,1,2,3)] -- standard3Sphere = fromRight $ mkTriangulationG tets gluings -- where -- tets = subsetsSized 4 (Set.fromList [1::Int .. 5]) -- -- -- gluings = [ (tet,tri,tet',g,tri') | -- -- tet <- tets, -- tet' <- tets, -- tet /= tet', -- tri <- allTriangles, -- let verts = [ Set.elemAt (fromEnum v) tet | v <- vertexList tri ], -- g <- allS3, -- tri' <- allTriangles, -- let verts' = [ Set.elemAt (fromEnum v) tet' | v <- vertexList (packOrderedFace g tri') ], -- Set.fromList verts == Set.fromList verts' -- ] tt10 = triang [ ( 0 ./ tABD, 0 ./ oBCD) , ( 0 ./ tABC, 0 ./ oACD) ] tt11 = triang [ ( 0 ./ tABD, 0 ./ oBCD) , ( 0 ./ tABC, 0 ./ oDAC) ] phs = fromRight $ mkTriangulation [0..89] [ ( 1 ./ tABC, 0 ./ oABC) , ( 3 ./ tABC, 2 ./ oABC) , ( 4 ./ tABC, 0 ./ oABD) , ( 4 ./ tABD, 2 ./ oABD) , ( 3 ./ tABD, 1 ./ oABD) , ( 6 ./ tABC, 5 ./ oABC) , ( 8 ./ tABC, 7 ./ oABC) , ( 9 ./ tABC, 7 ./ oABD) , ( 8 ./ tABD, 5 ./ oABD) , ( 9 ./ tABD, 6 ./ oABD) , (10 ./ tABC, 0 ./ oACD) , (10 ./ tABD, 5 ./ oACD) , ( 6 ./ tACD, 1 ./ oACD) , (12 ./ tABC, 11 ./ oABC) , (14 ./ tABC, 13 ./ oABC) , (15 ./ tABC, 13 ./ oABD) , (14 ./ tABD, 11 ./ oABD) , (15 ./ tABD, 12 ./ oABD) , (16 ./ tABC, 11 ./ oACD) , (12 ./ tACD, 2 ./ oACD) , (16 ./ tABD, 3 ./ oACD) , (18 ./ tABC, 17 ./ oABC) , (17 ./ tABD, 7 ./ oACD) , (19 ./ tABC, 18 ./ oABD) , (19 ./ tABD, 8 ./ oACD) , (20 ./ tABC, 17 ./ oACD) , (18 ./ tACD, 13 ./ oACD) , (20 ./ tABD, 14 ./ oACD) , (22 ./ tABC, 21 ./ oABC) , (21 ./ tABD, 10 ./ oACD) , (22 ./ tABD, 4 ./ oACD) , (23 ./ tABC, 20 ./ oACD) , (23 ./ tABD, 9 ./ oACD) , (21 ./ tACD, 19 ./ oACD) , (22 ./ tACD, 15 ./ oACD) , (23 ./ tACD, 16 ./ oACD) , (25 ./ tABC, 24 ./ oABC) , (27 ./ tABC, 26 ./ oABC) , (26 ./ tABD, 24 ./ oABD) , (28 ./ tABC, 25 ./ oABD) , (28 ./ tABD, 27 ./ oABD) , (29 ./ tABC, 0 ./ oBCD) , (31 ./ tABC, 30 ./ oABC) , (30 ./ tABD, 29 ./ oABD) , (31 ./ tABD, 1 ./ oBCD) , (33 ./ tABC, 32 ./ oABC) , (34 ./ tABC, 24 ./ oACD) , (32 ./ tABD, 25 ./ oACD) , (34 ./ tABD, 33 ./ oABD) , (36 ./ tABC, 35 ./ oABC) , (37 ./ tABC, 35 ./ oABD) , (36 ./ tABD, 2 ./ oBCD) , (37 ./ tABD, 3 ./ oBCD) , (39 ./ tABC, 38 ./ oABC) , (40 ./ tABC, 26 ./ oACD) , (38 ./ tABD, 27 ./ oACD) , (40 ./ tABD, 39 ./ oABD) , (41 ./ tABC, 32 ./ oACD) , (42 ./ tABC, 33 ./ oACD) , (42 ./ tABD, 41 ./ oABD) , (38 ./ tACD, 29 ./ oACD) , (39 ./ tACD, 4 ./ oBCD) , (35 ./ tACD, 34 ./ oACD) , (40 ./ tACD, 36 ./ oACD) , (30 ./ tACD, 28 ./ oACD) , (41 ./ tACD, 31 ./ oACD) , (42 ./ tACD, 37 ./ oACD) , (44 ./ tABC, 43 ./ oABC) , (45 ./ tABC, 5 ./ oBCD) , (45 ./ tABD, 43 ./ oABD) , (44 ./ tABD, 6 ./ oBCD) , (46 ./ tABC, 24 ./ oBCD) , (47 ./ tABC, 25 ./ oBCD) , (47 ./ tABD, 43 ./ oACD) , (46 ./ tABD, 44 ./ oACD) , (26 ./ tBCD, 7 ./ oBCD) , (48 ./ tABC, 8 ./ oBCD) , (48 ./ tABD, 27 ./ oBCD) , (46 ./ tACD, 9 ./ oBCD) , (49 ./ tABC, 28 ./ oBCD) , (49 ./ tABD, 47 ./ oACD) , (50 ./ tABC, 48 ./ oACD) , (50 ./ tABD, 45 ./ oACD) , (50 ./ tACD, 49 ./ oACD) , (52 ./ tABC, 51 ./ oABC) , (53 ./ tABC, 51 ./ oABD) , (52 ./ tABD, 43 ./ oBCD) , (53 ./ tABD, 44 ./ oBCD) , (54 ./ tABC, 51 ./ oACD) , (56 ./ tABC, 55 ./ oABC) , (55 ./ tABD, 54 ./ oABD) , (56 ./ tABD, 52 ./ oACD) , (57 ./ tABC, 54 ./ oACD) , (57 ./ tABD, 53 ./ oACD) , (59 ./ tABC, 58 ./ oABC) , (61 ./ tABC, 60 ./ oABC) , (62 ./ tABC, 58 ./ oABD) , (60 ./ tABD, 59 ./ oABD) , (62 ./ tABD, 61 ./ oABD) , (58 ./ tACD, 10 ./ oBCD) , (59 ./ tACD, 29 ./ oBCD) , (63 ./ tABC, 55 ./ oACD) , (63 ./ tABD, 60 ./ oACD) , (61 ./ tACD, 56 ./ oACD) , (63 ./ tACD, 30 ./ oBCD) , (57 ./ tACD, 31 ./ oBCD) , (62 ./ tACD, 45 ./ oBCD) , (64 ./ tABC, 51 ./ oBCD) , (64 ./ tABD, 11 ./ oBCD) , (52 ./ tBCD, 12 ./ oBCD) , (66 ./ tABC, 65 ./ oABC) , (65 ./ tABD, 64 ./ oACD) , (66 ./ tABD, 53 ./ oBCD) , (68 ./ tABC, 67 ./ oABC) , (32 ./ tBCD, 13 ./ oBCD) , (67 ./ tABD, 33 ./ oBCD) , (68 ./ tABD, 14 ./ oBCD) , (70 ./ tABC, 69 ./ oABC) , (69 ./ tABD, 67 ./ oACD) , (68 ./ tACD, 65 ./ oACD) , (70 ./ tABD, 66 ./ oACD) , (69 ./ tACD, 34 ./ oBCD) , (70 ./ tACD, 46 ./ oBCD) , (47 ./ tBCD, 15 ./ oBCD) , (71 ./ tABC, 54 ./ oBCD) , (72 ./ tABC, 71 ./ oABD) , (72 ./ tABD, 64 ./ oBCD) , (73 ./ tABC, 55 ./ oBCD) , (73 ./ tABD, 35 ./ oBCD) , (56 ./ tBCD, 36 ./ oBCD) , (73 ./ tACD, 71 ./ oACD) , (74 ./ tABC, 72 ./ oACD) , (74 ./ tABD, 37 ./ oBCD) , (74 ./ tACD, 16 ./ oBCD) , (75 ./ tABC, 17 ./ oBCD) , (76 ./ tABC, 18 ./ oBCD) , (77 ./ tABC, 75 ./ oABD) , (77 ./ tABD, 76 ./ oABD) , (65 ./ tBCD, 38 ./ oBCD) , (78 ./ tABC, 39 ./ oBCD) , (78 ./ tABD, 66 ./ oBCD) , (75 ./ tACD, 40 ./ oBCD) , (71 ./ tBCD, 19 ./ oBCD) , (76 ./ tACD, 57 ./ oBCD) , (72 ./ tBCD, 48 ./ oBCD) , (78 ./ tACD, 77 ./ oACD) , (67 ./ tBCD, 58 ./ oBCD) , (68 ./ tBCD, 59 ./ oBCD) , (60 ./ tBCD, 20 ./ oBCD) , (75 ./ tBCD, 61 ./ oBCD) , (76 ./ tBCD, 41 ./ oBCD) , (79 ./ tABC, 62 ./ oBCD) , (79 ./ tABD, 42 ./ oBCD) , (79 ./ tACD, 77 ./ oBCD) , (81 ./ tABC, 80 ./ oABC) , (80 ./ tABD, 69 ./ oBCD) , (82 ./ tABC, 70 ./ oBCD) , (82 ./ tABD, 81 ./ oABD) , (80 ./ tACD, 21 ./ oBCD) , (83 ./ tABC, 22 ./ oBCD) , (83 ./ tABD, 81 ./ oACD) , (84 ./ tABC, 78 ./ oBCD) , (84 ./ tABD, 83 ./ oACD) , (84 ./ tACD, 82 ./ oACD) , (80 ./ tBCD, 73 ./ oBCD) , (85 ./ tABC, 63 ./ oBCD) , (85 ./ tABD, 81 ./ oBCD) , (86 ./ tABC, 23 ./ oBCD) , (86 ./ tABD, 85 ./ oACD) , (86 ./ tACD, 82 ./ oBCD) , (87 ./ tABC, 49 ./ oBCD) , (87 ./ tABD, 85 ./ oBCD) , (87 ./ tACD, 83 ./ oBCD) , (88 ./ tABC, 50 ./ oBCD) , (88 ./ tABD, 74 ./ oBCD) , (88 ./ tACD, 79 ./ oBCD) , (89 ./ tABC, 88 ./ oBCD) , (89 ./ tABD, 87 ./ oBCD) , (89 ./ tACD, 86 ./ oBCD) , (89 ./ tBCD, 84 ./ oBCD) ]
DanielSchuessler/hstri
Examples.hs
gpl-3.0
7,696
0
9
3,023
3,461
2,046
1,415
205
1
module Export ( writeMatlabFile ) where import System.IO import Text.Printf writeMatlabFile :: String -> [(Double, Double, Double)] -> IO () writeMatlabFile fileName dynamics = do fileHdl <- openFile fileName WriteMode hPutStrLn fileHdl "dynamics = [" mapM_ (hPutStrLn fileHdl . sirAggregateToString) dynamics hPutStrLn fileHdl "];" hPutStrLn fileHdl "susceptible = dynamics (:, 1);" hPutStrLn fileHdl "infected = dynamics (:, 2);" hPutStrLn fileHdl "recovered = dynamics (:, 3);" hPutStrLn fileHdl "totalPopulation = susceptible(1) + infected(1) + recovered(1);" hPutStrLn fileHdl "susceptibleRatio = susceptible ./ totalPopulation;" hPutStrLn fileHdl "infectedRatio = infected ./ totalPopulation;" hPutStrLn fileHdl "recoveredRatio = recovered ./ totalPopulation;" hPutStrLn fileHdl "steps = length (susceptible);" hPutStrLn fileHdl "indices = 0 : steps - 1;" hPutStrLn fileHdl "figure" hPutStrLn fileHdl "plot (indices, susceptibleRatio.', 'color', 'blue', 'linewidth', 2);" hPutStrLn fileHdl "hold on" hPutStrLn fileHdl "plot (indices, infectedRatio.', 'color', 'red', 'linewidth', 2);" hPutStrLn fileHdl "hold on" hPutStrLn fileHdl "plot (indices, recoveredRatio.', 'color', 'green', 'linewidth', 2);" hPutStrLn fileHdl "set(gca,'YTick',0:0.05:1.0);" hPutStrLn fileHdl "xlabel ('Time');" hPutStrLn fileHdl "ylabel ('Population Ratio');" hPutStrLn fileHdl "legend('Susceptible','Infected', 'Recovered');" hClose fileHdl sirAggregateToString :: (Double, Double, Double) -> String sirAggregateToString (susceptibleCount, infectedCount, recoveredCount) = printf "%f" susceptibleCount ++ "," ++ printf "%f" infectedCount ++ "," ++ printf "%f" recoveredCount ++ ";"
thalerjonathan/phd
coding/papers/pfe/testing/src/Export.hs
gpl-3.0
1,741
0
10
271
333
149
184
37
1
{-# OPTIONS_GHC -XFlexibleInstances -XTypeSynonymInstances #-} {- Channel basics for HSH Copyright (C) 2004-2008 John Goerzen <jgoerzen@complete.org> Please see the COPYRIGHT file -} {- | Module : HSH.Channel Copyright : Copyright (C) 2006-2009 John Goerzen License : GNU LGPL, version 2.1 or above Maintainer : John Goerzen <jgoerzen@complete.org> Stability : provisional Portability: portable Copyright (c) 2006-2009 John Goerzen, jgoerzen\@complete.org -} module HSH.Channel (Channel(..), chanAsString, chanAsBSL, chanAsBS, chanToHandle, Channelizable(..) ) where import qualified Data.ByteString.Lazy as BSL import qualified Data.ByteString as BS import qualified Data.ByteString.Lazy.Char8 as BSLC import System.IO import Control.Concurrent {- | The main type for communicating between commands. All are expected to be lazy. -} data Channel = ChanString String | ChanBSL BSL.ByteString | ChanHandle Handle chanAsString :: Channel -> IO String chanAsString (ChanString s) = return s chanAsString (ChanBSL s) = return . bsl2str $ s chanAsString (ChanHandle h) = hGetContents h chanAsBSL :: Channel -> IO BSL.ByteString chanAsBSL (ChanString s) = return . str2bsl $ s chanAsBSL (ChanBSL s) = return s chanAsBSL (ChanHandle h) = BSL.hGetContents h chanAsBS :: Channel -> IO BS.ByteString chanAsBS c = do r <- chanAsBSL c let contents = BSL.toChunks r return . BS.concat $ contents {- | Writes the Channel to the given Handle. If the first parameter is True, do this in a separate thread and close the handle afterwards. -} chanToHandle :: Bool -> Channel -> Handle -> IO () chanToHandle close c h = if close then forkIO (dumpChanToHandle c h >> hClose h) >> return () else dumpChanToHandle c h where dumpChanToHandle (ChanString s) h = hPutStr h s dumpChanToHandle (ChanBSL s) h = BSL.hPut h s dumpChanToHandle (ChanHandle srchdl) desthdl = BSL.hGetContents srchdl >>= BSL.hPut desthdl class Channelizable a where toChannel :: a -> Channel instance Channelizable String where toChannel = ChanString instance Channelizable BSL.ByteString where toChannel = ChanBSL instance Channelizable Handle where toChannel = ChanHandle instance Channelizable BS.ByteString where toChannel bs = ChanBSL . BSL.fromChunks $ [bs] str2bsl :: String -> BSL.ByteString str2bsl = BSLC.pack bsl2str :: BSL.ByteString -> String bsl2str = BSLC.unpack
jgoerzen/hsh
HSH/Channel.hs
lgpl-2.1
2,663
0
11
673
572
301
271
48
4
-- DyreExample.hs -- module DyreExample ( dyreExample ) where import qualified Config.Dyre as Dyre confError cfgMessage error = "Error:" ++ error ++ "\n" ++ cfgMessage realMain message = do putStrLn "Entered Main Function" putStrLn message dyreExample = Dyre.wrapMain Dyre.defaultParams { Dyre.projectName = "dyreExample" , Dyre.showError = confError , Dyre.realMain = realMain }
dmp1ce/dyreExampleCabal
src/DyreExample.hs
unlicense
404
0
7
76
98
54
44
10
1
module LSystem.Interprets ( InterpretFunc, InterpretFuncMapped, avibleInterprets, InterpretInstruction(..), InstructionMap, parseIMap, interpretLSystemRaw ) where import Data.Map import Data.Char import Data.Maybe import LSystem.Utils import LSystem.DataTypes import LSystem.Expressions (isTrueInDoubleLogic) import LSystem.ShowReadUtils ---------------------------------------------------------------------------------------------------- -- | Type of interpret function. type InterpretFunc = InstructionMap -> [SymbolDouble] -> String -- | Type of interpret function with mapped instructions. type InterpretFuncMapped = [SymbolDouble] -> String -- | Map of file extensions to aviable interprets. Key (extension) is lowercase. avibleInterprets :: Map String InterpretFunc avibleInterprets = fromList [ ("txt", interpretLSystemRaw), ("svg", interpretLSystemToSvg) ] ---------------------------------------------------------------------------------------------------- -- | Type for map symbol to instruction. data InterpretInstruction = DoNothing | DrawLineForward | MoveForward | TurnLeft | TurnRight | StartBranch | CompleteBranch | SpecialInstruction String deriving (Show, Read, Eq, Ord) -- type ReadS a = String -> [(a, String)] -- | Reads InterpretInstruction from given string. If nothing was readed by default read function, -- whole string is considered as name of special instruction (if not empty). readJustInterpretInstruction :: ReadS InterpretInstruction readJustInterpretInstruction str = if Prelude.null str then [] else let defRead = reads str in if Prelude.null defRead then [(SpecialInstruction name, "") | (name, "") <- lex str] else defRead type InstructionMap = Map Symbol InterpretInstruction -- | Tries to parse instruction association to symbol from each given element of list. -- If even one association filed to parse, nothing is returned. parseIMap :: [String] -> Maybe InstructionMap parseIMap strLines = parseIAssocAcc empty $ filterNonEmpty strLines parseIAssocAcc :: InstructionMap -> [String] -> Maybe InstructionMap parseIAssocAcc acc [] = Just acc parseIAssocAcc acc strLines = do (symbol, ii) <- parseIAssoc $ head strLines parseIAssocAcc (insert symbol ii acc) (tail strLines) -- | Tries to parse interpret instruction assoc to symbol. parseIAssoc :: String -> Maybe (Symbol, InterpretInstruction) parseIAssoc str = maybeHead [(symbol, instr) | (symbol, rest) <- reads str, (instr, "") <- readJustInterpretInstruction rest] ---------------------------------------------------------------------------------------------------- -- | Type synonim for interpret inner function which takes old iState, new iState, its state and -- symbol and produces tuple with newest interpret state (which will be same as new iState if no -- special instructions are recognised) and its new state. type InterpretInnerFunc a = InstructionMap -> InterpretState -> InterpretState -> a -> SymbolDouble -> Maybe (InterpretState, a) data InterpretState = InterpretState { is_x :: Double, is_y :: Double, is_angle :: Double, is_previous :: Maybe InterpretState, -- | min x, min y, max x, max y is_extremes :: (Double, Double, Double, Double) } -- | Default instance of InterpretState (everything zero). emptyIState :: InterpretState emptyIState = InterpretState 0 0 0 Nothing (0, 0, 0, 0) -- | Main interpret loop, counts new iState and gives all data to user func. interpretSymbols :: InstructionMap -> (InterpretState, a) -> InterpretInnerFunc a-> [SymbolDouble] -> Maybe (InterpretState, a) interpretSymbols _ oldState _ [] = Just oldState interpretSymbols iMap (oldIState, oldCustState) interpretFunc (s:ss) = do newIState <- interpretBasicInstr iMap oldIState s newState <- interpretFunc iMap oldIState newIState oldCustState s interpretSymbols iMap newState interpretFunc ss -- | Interprets known instructions in common way. Real interprets do not have to do this dirty job. interpretBasicInstr :: InstructionMap -> InterpretState -> SymbolDouble -> Maybe InterpretState interpretBasicInstr iMap is (SymbolDouble symbol params) = case Data.Map.lookup symbol iMap of Just instruction -> let InterpretState x y angle prevState ex = is paramsLen = length params in case instruction of DrawLineForward -> if paramsLen >= 1 then let newX = x + cos (degToRad angle) * head params newY = y + sin (degToRad angle) * head params in Just $ InterpretState newX newY angle prevState $ countExtremes newX newY ex else Nothing MoveForward -> if paramsLen >= 1 then let newX = x + cos (degToRad angle) * head params newY = y + sin (degToRad angle) * head params in Just $ InterpretState newX newY angle prevState $ countExtremes newX newY ex else Nothing TurnLeft -> if paramsLen >= 1 then Just $ InterpretState x y (angle + head params) prevState ex else Nothing TurnRight -> if paramsLen >= 1 then Just $ InterpretState x y (angle - head params) prevState ex else Nothing StartBranch -> Just $ InterpretState x y angle (Just is) ex CompleteBranch -> if isJust prevState then let InterpretState px py pa ps _= fromJust prevState in Just $ InterpretState px py pa ps ex -- copy new extrems to old instance else Nothing _ -> Just is Nothing -> Just is -- | Takes new X and new Y with extremes and counts new extremes. countExtremes :: Double -> Double -> (Double, Double, Double, Double) -> (Double, Double, Double, Double) countExtremes x y (minX, minY, maxX, maxY) = (min minX x, min minY y, max maxX x, max maxY y) ---------------------------------------------------------------------------------------------------- -- | The most primitive L-system interpret, it just convert given symbols to string. interpretLSystemRaw :: InterpretFunc interpretLSystemRaw _ [] = "" interpretLSystemRaw iMap (s:ss) = show s ++ interpretLSystemRaw iMap ss ---------------------------------------------------------------------------------------------------- -- | Interprets given symbols with respect to given instrunction mapping as SVG image. interpretLSystemToSvg :: InterpretFunc interpretLSystemToSvg _ [] = "" interpretLSystemToSvg iMap ss = case interpretSymbols iMap (emptyIState, emptySvgState) svgInterpretFunc ss of Just (iState, svgState) -> getSvgData iState $ closeSvgPolyline svgState Nothing -> [] svgInterpretFunc :: InterpretInnerFunc SvgState svgInterpretFunc iMap oldIState newIState svgState (SymbolDouble symbol params) = case Data.Map.lookup symbol iMap of Just instruction -> let InterpretState oldX oldY _ _ _ = oldIState InterpretState newX newY _ _ _ = newIState in case instruction of DrawLineForward -> let newSvgState = if isLineOpened svgState then svgState else addPointToSvgPolyline svgState (oldX, oldY) in Just (newIState, addPointToSvgPolyline newSvgState (newX, newY)) MoveForward -> Just (newIState, closeSvgPolyline svgState) CompleteBranch -> Just (newIState, closeSvgPolyline svgState) SpecialInstruction instr -> svgInterpretSpecial newIState svgState params instr _ -> Just (newIState, svgState) -- unhandled instructions, do nothing by default Nothing -> Just (newIState, svgState) -- unknown symbol, do nothing -- | Interprets svg special instruction. svgInterpretSpecial :: InterpretState -> SvgState -> [Double] -> String -> Maybe (InterpretState, SvgState) svgInterpretSpecial iState svgState params instr = let InterpretState x y _ _ _ = iState in case instr of "StartPolyline" -> Just (iState, openSpecSvgPolyline svgState) "RecordPolylineVertex" -> Just (iState, addSpecPointToSvgPolyline svgState (x, y)) "EndPolyline" -> do newSvgState <- closeSpecSvgPolyline svgState $ checkNthParam isTrueInDoubleLogic 1 params Just (iState, newSvgState) _ -> Just (iState, svgState) -- unknown instruction, do nothing -- | Calls given function on n-th param. If count of params is less than n, False is returned. checkNthParam :: (Double -> Bool) -> Int -> [Double] -> Bool checkNthParam func n params = let ps = take n params in if length ps == n then func $ last ps else False -- | State of SVG interpret. data SvgState = SvgState { svgs_finishedLines :: [PolylineD], svgs_openedLine :: PolylineD, svgs_openedLineSpec :: PolylineD, svgs_lineSpecStack :: [PolylineD] } type PointD = (Double, Double) type PolylineD = [PointD] -- | Empty instance of SvgState. emptySvgState :: SvgState emptySvgState = SvgState [] [] [] [] isLineOpened :: SvgState -> Bool isLineOpened (SvgState {svgs_openedLine = opened}) = not $ Prelude.null opened addPointToSvgPolyline :: SvgState -> PointD -> SvgState addPointToSvgPolyline (SvgState finLines curLine specLine specStack) p = SvgState finLines (p:curLine) specLine specStack -- | Closes polyline only if it is opened (can be called on state with alredy closed polyline). closeSvgPolyline :: SvgState -> SvgState closeSvgPolyline (SvgState finLines curLine specLine specStack) = if Prelude.null curLine then SvgState finLines [] specLine specStack else SvgState (curLine:finLines) [] specLine specStack openSpecSvgPolyline :: SvgState -> SvgState openSpecSvgPolyline (SvgState finLines curLine specLine specStack) = SvgState finLines curLine [] (specLine:specStack) addSpecPointToSvgPolyline :: SvgState -> PointD -> SvgState addSpecPointToSvgPolyline (SvgState finLines curLine specLine specStack) p = SvgState finLines curLine (p:specLine) specStack -- | Ends current special polyline and if second parametr is True, polyline is also closed (first -- and last points are connected). closeSpecSvgPolyline :: SvgState -> Bool -> Maybe SvgState closeSpecSvgPolyline (SvgState finLines curLine specLine specStack) close = if Prelude.null specStack then Nothing else if Prelude.null specLine then Just $ SvgState finLines curLine (head specStack) (tail specStack) else let newLine = if close then last specLine : specLine else specLine in Just $ SvgState (newLine:finLines) curLine (head specStack) (tail specStack) getSvgData :: InterpretState -> SvgState -> String getSvgData _ (SvgState [] _ _ _) = "" getSvgData (InterpretState _ _ _ _ extremes) (SvgState finLines _ _ _) = showsSvgHeader . showsBeginOfSvg extremes . showsCustAll showsSvgPoliline (endOfSvg++) finLines $ "" showsSvgPoliline :: PolylineD -> ShowS showsSvgPoliline line = ("<polyline points=\""++) . foldr (\ pt acc -> showsPointPair pt . acc) ("\" />\n"++) line showsPointPair :: PointD -> ShowS showsPointPair (x, y) = shows (round2 x) . (',':) . shows (round2 y) . (' ':) -- | Header of SVG file (DOCTYPE, ...) showsSvgHeader :: ShowS showsSvgHeader = ("<?xml version=\"1.0\" standalone=\"no\"?>\n"++) . ("<!DOCTYPE svg PUBLIC \"-//W3C//DTD SVG 1.1//EN\""++) . (" \"http://www.w3.org/Graphics/SVG/1.1/DTD/svg11.dtd\">\n"++) -- | Takes extremes and returns SVG start tag with viewBox attribute. showsBeginOfSvg :: (Double, Double, Double, Double) -> ShowS showsBeginOfSvg (minX, minY, maxX, maxY) = ("<svg viewBox=\""++) . shows (round2 $ minX - 1) . (' ':) . shows (round2 $ minY - 1) . (' ':) . shows (round2 $ maxX - minX + 2) . (' ':) . shows (round2 $ maxY - minY + 2) . ("\" xmlns=\"http://www.w3.org/2000/svg\" version=\"1.1\">\n"++) . ("<g fill=\"none\" stroke=\"#000000\" stroke-width=\"2\" stroke-linejoin=\"bevel\">\n"++) -- | SVG end tag endOfSvg :: String endOfSvg = "</g>\n</svg>"
NightElfik/L-systems-in-Haskell
src/LSystem/Interprets.hs
unlicense
12,803
0
22
3,213
2,875
1,524
1,351
208
13
-- Copyright 2020 Google LLC -- -- Licensed under the Apache License, Version 2.0 (the "License"); -- you may not use this file except in compliance with the License. -- You may obtain a copy of the License at -- -- http://www.apache.org/licenses/LICENSE-2.0 -- -- Unless required by applicable law or agreed to in writing, software -- distributed under the License is distributed on an "AS IS" BASIS, -- WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. -- See the License for the specific language governing permissions and -- limitations under the License. module Main where import Control.Monad (guard) import Sub.Foo (foo) main = guard (foo == 3)
google/cabal2bazel
bzl/tests/hierarchical/Sub/FooTest.hs
apache-2.0
684
0
7
119
52
36
16
4
1
data RPS = Rock | Paper | Scissors shoot :: RPS -> RPS -> String shoot Paper Rock = "Paper Beats Rock" shoot Rock Scissors = "Rock Beats Scissors" shoot Scissors Paper = "Scissors Beats Paper" shoot Scissors Rock = "Scissors Loses to Rock " shoot Paper Scissors = "Paper Loses to Scissors" shoot Rock Paper = "Rock Loses to Paper" shoot _ _ = "Error"
hungaikev/learning-haskell
RockPaperScissors.hs
apache-2.0
357
0
6
72
97
50
47
9
1
{-# LANGUAGE CPP, ScopedTypeVariables #-} module FileCons (Cons, openHandle, closeHandle, newCons, newInt, isPair, first, second, setFirst, setSecond, int, getPtr, list, toList, nth, shw, cmpr, cmpr2, encodeString, decodeString, dlookup, lookupSingle, dinsert, deleteFindMin, deleteFindMax, delete, depth, size) where import System.IO.Unsafe import Control.Monad import Data.Bits import Data.Char import Foreign.Ptr import Foreign.ForeignPtr import Foreign.Storable import Data.IORef import System.IO import Control.Exception import System.IO.MMap import Prelude hiding (catch) -- This module stores a single value in a file. The value is a tree structure like Lisp's -- conses. The value in the file can be changed while sharing structure with values -- that were once in the file. data Cons = Cons !FilePath !(IORef (Ptr Int, Int, Int)) !Int deriving Eq openHandle path = do (p, _, sz) <- mmapFileForeignPtr path ReadWrite Nothing ref <- newIORef (p, sz, sz) let cons = Cons path ref 0 when (sz == 0) $ newCons (newInt cons 0) (newInt cons 0) `seq` return () return cons closeHandle (Cons _ ref _) = do (p, _, _) <- readIORef ref freeForeignPtr p -- Functions for building and taking apart values. newCons cons@(Cons path ref i) (Cons path2 _ j) #ifdef DEBUG | path /= path2 = error "newCons: have to come from same file" #endif | otherwise = unsafePerformIO $ do (p, used, sz) <- readIORef ref (p, sz) <- if used + 8 > sz then do {-fl <- openBinaryFile path ReadWriteMode hSetFileSize fl (toInteger (sz + 100)) hClose fl-} freeForeignPtr p (p, _, sz) <- mmapFileForeignPtr path ReadWrite (Just (0, sz + 100)) return (p, sz) else return (p, sz) withForeignPtr p $ \p -> do poke (p `plusPtr` used) i poke (p `plusPtr` (used + 4)) j writeIORef ref (p, used + 8, sz) return (Cons path ref used) {-# INLINE newCons #-} newInt (Cons path ref _) n #ifdef DEBUG | n < 0 = error "newInt: has to be non-negative" #endif | otherwise = Cons path ref (-(n + 1)) {-# INLINE newInt #-} isPair (Cons _ _ i) = i >= 0 {-# INLINE isPair #-} first c@(Cons path ref i) #ifdef DEBUG | i < 0 = error $ "first: not a pair: " ++ show (int c) #endif | otherwise = do (p, _, _) <- readIORef ref n <- withForeignPtr p $ \p -> peek (p `plusPtr` i) return (Cons path ref n) {-# INLINE first #-} second c@(Cons path ref i) #ifdef DEBUG | i < 0 = error $ "second: not a pair: " ++ show (int c) #endif | otherwise = do (p, _, _) <- readIORef ref n <- withForeignPtr p $ \p -> peek (p `plusPtr` (i + 4)) return (Cons path ref n) {-# INLINE second #-} int c@(Cons _ _ i) #ifdef DEBUG | i >= 0 = error $ "int: not an int: " ++ unsafePerformIO (shw c) #endif | otherwise = -(i + 1) {-# INLINE int #-} getPtr (Cons _ _ i) #ifdef DEBUG | i < 0 = error $ "getPtr: not a pointer: " ++ show i #endif | otherwise = i {-# INLINE getPtr #-} setFirst c@(Cons path ref i) (Cons path2 _ j) #ifdef DEBUG | i < 0 = error $ "setFirst: not a pair: " ++ show (int c) | path /= path2 = error "setFirst: have to come from same file" #endif | otherwise = do (p, used, _) <- readIORef ref #ifdef DEBUG if i >= used then error "setFirst: invalid ptr" else #endif withForeignPtr p $ \p -> poke (p `plusPtr` i) j {-# INLINE setFirst #-} setSecond c@(Cons path ref i) (Cons path2 _ j) #ifdef DEBUG | i < 0 = error $ "setSecond: not a pair: " ++ show (int c) | path /= path2 = error "setSecond: have to come from same file" #endif | otherwise = do (p, used, _) <- readIORef ref #ifdef DEBUG if i >= used then error "setSecond: invalid ptr" else #endif withForeignPtr p $ \p -> poke (p `plusPtr` (i + 4)) j {-# INLINE setSecond #-} list [x] = newCons x (newInt x 0) list (x:xs) = newCons x (list xs) toList = rec [] where rec acc cons = if isPair cons then do x <- first cons s <- second cons rec (x : acc) s else return (reverse acc) nth 0 cons = first cons nth n cons = second cons >>= nth (n - 1) {-# INLINE nth #-} padWithZeros s = s ++ replicate (3 - length s `mod` 3) '\0' {-# INLINE padWithZeros #-} removeZeros s = reverse (dropWhile (=='\0') (reverse s)) {-# INLINE removeZeros #-} pack (c1 : c2 : c3 : xs) = (shiftL c1 16 .|. shiftL c2 8 .|. c3) : pack xs pack [] = [] unpack (n:ns) = shiftR n 16 : (shiftR n 8 .&. 255) : (n .&. 255) : unpack ns unpack [] = [] encodeString hdl s = list $ map (newInt hdl) $ pack $ map ord $ padWithZeros s decodeString cons = liftM (removeZeros . map chr . unpack . map int) (toList cons) {-# INLINE decodeString #-} shw cons = if isPair cons then do f <- first cons >>= shw s <- second cons >>= shw return $ "Cons (" ++ f ++ ") (" ++ s ++ ")" else return $ show (int cons) cmpr s c = liftM (compare s) (decodeString c) cmpr2 c c2 = liftM2 compare (decodeString c) (decodeString c2) -- Dictionary operations, adapted from Data.Map dlookup cmp k k2 t | isPair t = do f <- first t val <- nth 1 t ord <- cmp k f case ord of LT -> do v2 <- nth 2 t >>= dlookup cmp k k2 ord2 <- cmp k2 f case ord2 of LT -> return v2 EQ -> return $ v2 ++ [val] GT -> liftM (\v3 -> v2 ++ val : v3) (nth 3 t >>= dlookup cmp k k2) EQ -> do ord2 <- cmp k2 f case ord2 of LT -> return [] EQ -> return [val] GT -> liftM (val:) (nth 3 t >>= dlookup cmp k k2) GT -> nth 3 t >>= dlookup cmp k k2 | otherwise = return [] lookupSingle cmp k t = do referent <- first t if isPair referent then do f <- first referent ord <- cmp k f case ord of LT -> second referent >>= second >>= lookupSingle cmp k EQ -> return t GT -> second referent >>= second >>= second >>= lookupSingle cmp k else return t dinsert cmp kx x t = do referent <- first t if isPair referent then do val <- first referent ord <- cmp kx val case ord of LT -> second referent >>= second >>= dinsert cmp kx x GT -> second referent >>= second >>= second >>= dinsert cmp kx x EQ -> do second referent >>= \s -> setFirst s x else setFirst t (list [kx, x, newInt x 0, newInt x 0]) deleteFindMin t = do l <- first t >>= second >>= second r <- first t >>= second >>= second >>= second fl <- first l fr <- first r if isPair fl then deleteFindMin l else do k <- first t >>= first x <- first t >>= second >>= first setFirst t fr return (k, x) deleteFindMax t = do l <- first t >>= second >>= second r <- first t >>= second >>= second >>= second fl <- first l fr <- first r if isPair fr then deleteFindMax r else do k <- first t >>= first x <- first t >>= second >>= first setFirst t fl return (k, x) delete cmpr k t = do referent <- first t when (isPair referent) $ do l <- second referent >>= second r <- second referent >>= second >>= second fl <- first l fr <- first r k2 <- first referent val <- first referent >>= second ord <- cmpr k k2 case ord of LT -> delete cmpr k l GT -> delete cmpr k r EQ -> if isPair fl then do (k, x) <- deleteFindMax l setFirst referent k setFirst val x else if isPair fr then do (k, x) <- deleteFindMin r setFirst referent k setFirst val x else setFirst t (newInt t 0) depth idx = if isPair idx then liftM2 (\x y -> 1 + max x y) (nth 2 idx >>= depth) (nth 3 idx >>= depth) else return 0 size idx = if isPair idx then liftM2 (+) (nth 2 idx >>= size) (nth 3 idx >>= size) else return 1
jacinabox/Indexing
FileCons - Copy.hs
bsd-2-clause
7,702
95
20
2,129
3,338
1,647
1,691
-1
-1
-------------------------------------------------------------------------------- -- | -- Module : Graphics.Rendering.OpenGL.Raw.NV.TextureExpandNormal -- Copyright : (c) Sven Panne 2013 -- License : BSD3 -- -- Maintainer : Sven Panne <svenpanne@gmail.com> -- Stability : stable -- Portability : portable -- -- All tokens from the NV_texture_expand_normal, see -- <http://www.opengl.org/registry/specs/NV/texture_expand_normal.txt>. -- -------------------------------------------------------------------------------- module Graphics.Rendering.OpenGL.Raw.NV.TextureExpandNormal ( -- * Tokens gl_TEXTURE_UNSIGNED_REMAP_MODE ) where import Graphics.Rendering.OpenGL.Raw.Core32 gl_TEXTURE_UNSIGNED_REMAP_MODE :: GLenum gl_TEXTURE_UNSIGNED_REMAP_MODE = 0x888F
mfpi/OpenGLRaw
src/Graphics/Rendering/OpenGL/Raw/NV/TextureExpandNormal.hs
bsd-3-clause
783
0
4
91
48
38
10
5
1
{-# LANGUAGE RankNTypes, NamedFieldPuns, RecordWildCards #-} module Distribution.Server.Features.PackageCandidates ( PackageCandidatesFeature(..), PackageCandidatesResource(..), initPackageCandidatesFeature, CandidateRender(..), CandPkgInfo(..), ) where import Distribution.Server.Framework import Distribution.Server.Features.PackageCandidates.Types import Distribution.Server.Features.PackageCandidates.State import Distribution.Server.Features.PackageCandidates.Backup import Distribution.Server.Features.Core import Distribution.Server.Features.Upload import Distribution.Server.Features.Users import Distribution.Server.Features.TarIndexCache import Distribution.Server.Packages.Types import Distribution.Server.Packages.Render import Distribution.Server.Packages.ChangeLog import Distribution.Server.Packages.Readme import qualified Distribution.Server.Users.Types as Users import qualified Distribution.Server.Users.Group as Group import qualified Distribution.Server.Framework.BlobStorage as BlobStorage import qualified Distribution.Server.Packages.PackageIndex as PackageIndex import Distribution.Server.Packages.PackageIndex (PackageIndex) import qualified Distribution.Server.Framework.ResponseContentTypes as Resource import Distribution.Server.Util.ServeTarball import Distribution.Text import Distribution.Package import Data.Version import Data.Function (fix) import Data.List (find) import Data.Time.Clock (getCurrentTime) import qualified Data.Vector as Vec data PackageCandidatesFeature = PackageCandidatesFeature { candidatesFeatureInterface :: HackageFeature, candidatesCoreResource :: CoreResource, candidatesResource :: PackageCandidatesResource, -- queries queryGetCandidateIndex :: forall m. MonadIO m => m (PackageIndex CandPkgInfo), postCandidate :: ServerPartE Response, postPackageCandidate :: DynamicPath -> ServerPartE Response, putPackageCandidate :: DynamicPath -> ServerPartE Response, doDeleteCandidate :: DynamicPath -> ServerPartE Response, uploadCandidate :: (PackageId -> Bool) -> ServerPartE CandPkgInfo, publishCandidate :: DynamicPath -> Bool -> ServerPartE UploadResult, checkPublish :: PackageIndex PkgInfo -> CandPkgInfo -> Maybe ErrorResponse, candidateRender :: CandPkgInfo -> IO CandidateRender, lookupCandidateName :: PackageName -> ServerPartE [CandPkgInfo], lookupCandidateId :: PackageId -> ServerPartE CandPkgInfo } instance IsHackageFeature PackageCandidatesFeature where getFeatureInterface = candidatesFeatureInterface -- There can also be build reports as well as documentation for proposed -- versions. -- These features check for existence of a package in the *main* index, -- but it should be possible to hijack their indices to support candidates, -- perhaps by them having a Filter for whether a package-version exists -- (since they don't need any other info than the PackageId). -- Unfortunately, some problems exist when both a candidate and actual version -- of the same package exist simultaneously, so may want to hook into -- UploadFeature's canUploadPackage to ensure this won't happen, and to -- force deletion on publication. {- Mapping: candidatesPage -> corePackagesPage candidatePage -> corePackagePage candidateCabal -> coreCabalFile candidateTarball -> corePackageTarball candidatesUri -> indexPackageUri candidateUri -> corePackageUri candidateTarballUri -> coreTarballUri candidateCabalUri -> coreCabalUri -} data PackageCandidatesResource = PackageCandidatesResource { packageCandidatesPage :: Resource, publishPage :: Resource, deletePage :: Resource, packageCandidatesUri :: String -> PackageName -> String, publishUri :: String -> PackageId -> String, deleteUri :: String -> PackageId -> String, -- TODO: Why don't the following entries have a corresponding entry -- in CoreResource? candidateContents :: Resource, candidateChangeLog :: Resource, candidateChangeLogUri :: PackageId -> String } -- candidates can be published at any time; there can be multiple candidates per package -- they can be deleted, but it's not required data CandidateRender = CandidateRender { candPackageRender :: PackageRender, renderWarnings :: [String], hasIndexedPackage :: Bool } -- URI generation (string-based), using maps; user groups initPackageCandidatesFeature :: ServerEnv -> IO (UserFeature -> CoreFeature -> UploadFeature -> TarIndexCacheFeature -> IO PackageCandidatesFeature) initPackageCandidatesFeature env@ServerEnv{serverStateDir} = do candidatesState <- candidatesStateComponent serverStateDir return $ \user core upload tarIndexCache -> do let feature = candidatesFeature env user core upload tarIndexCache candidatesState return feature candidatesStateComponent :: FilePath -> IO (StateComponent AcidState CandidatePackages) candidatesStateComponent stateDir = do st <- openLocalStateFrom (stateDir </> "db" </> "CandidatePackages") initialCandidatePackages return StateComponent { stateDesc = "Candidate packages" , stateHandle = st , getState = query st GetCandidatePackages , putState = update st . ReplaceCandidatePackages , resetState = candidatesStateComponent , backupState = \_ -> backupCandidates , restoreState = restoreCandidates } candidatesFeature :: ServerEnv -> UserFeature -> CoreFeature -> UploadFeature -> TarIndexCacheFeature -> StateComponent AcidState CandidatePackages -> PackageCandidatesFeature candidatesFeature ServerEnv{serverBlobStore = store} UserFeature{..} CoreFeature{ coreResource=core@CoreResource{packageInPath, packageTarballInPath} , queryGetPackageIndex , updateAddPackage } UploadFeature{..} TarIndexCacheFeature{packageTarball, findToplevelFile} candidatesState = PackageCandidatesFeature{..} where candidatesFeatureInterface = (emptyHackageFeature "candidates") { featureDesc = "Support for package candidates" , featureResources = map ($ candidatesCoreResource) [ corePackagesPage , corePackagePage , coreCabalFile , corePackageTarball ] ++ map ($ candidatesResource) [ publishPage , candidateContents , candidateChangeLog ] , featureState = [abstractAcidStateComponent candidatesState] } queryGetCandidateIndex :: MonadIO m => m (PackageIndex CandPkgInfo) queryGetCandidateIndex = return . candidateList =<< queryState candidatesState GetCandidatePackages candidatesCoreResource = fix $ \r -> CoreResource { -- TODO: There is significant overlap between this definition and the one in Core corePackagesPage = resourceAt "/packages/candidates/.:format" , corePackagePage = resourceAt "/package/:package/candidate.:format" , coreCabalFile = (resourceAt "/package/:package/candidate/:cabal.cabal") { resourceDesc = [(GET, "Candidate .cabal file")] , resourceGet = [("cabal", serveCandidateCabal)] } , corePackageTarball = (resourceAt "/package/:package/candidate/:tarball.tar.gz") { resourceDesc = [(GET, "Candidate tarball")] , resourceGet = [("tarball", serveCandidateTarball)] } , indexPackageUri = \format -> renderResource (corePackagesPage r) [format] , corePackageIdUri = \format pkgid -> renderResource (corePackagePage r) [display pkgid, format] , corePackageNameUri = \format pkgname -> renderResource (corePackagePage r) [display pkgname, format] , coreTarballUri = \pkgid -> renderResource (corePackageTarball r) [display pkgid, display pkgid] , coreCabalUri = \pkgid -> renderResource (coreCabalFile r) [display pkgid, display (packageName pkgid)] , packageInPath , packageTarballInPath , guardValidPackageId = void . lookupCandidateId , guardValidPackageName = void . lookupCandidateName , lookupPackageName = fmap (map candPkgInfo) . lookupCandidateName , lookupPackageId = fmap candPkgInfo . lookupCandidateId } candidatesResource = fix $ \r -> PackageCandidatesResource { packageCandidatesPage = resourceAt "/package/:package/candidates/.:format" , publishPage = resourceAt "/package/:package/candidate/publish.:format" , deletePage = resourceAt "/package/:package/candidate/delete.:format" , candidateContents = (resourceAt "/package/:package/candidate/src/..") { resourceGet = [("", serveContents)] } , candidateChangeLog = (resourceAt "/package/:package/candidate/changelog") { resourceGet = [("changelog", serveChangeLog)] } , packageCandidatesUri = \format pkgname -> renderResource (packageCandidatesPage r) [display pkgname, format] , publishUri = \format pkgid -> renderResource (publishPage r) [display pkgid, format] , deleteUri = \format pkgid -> renderResource (deletePage r) [display pkgid, format] , candidateChangeLogUri = \pkgid -> renderResource (candidateChangeLog candidatesResource) [display pkgid, display (packageName pkgid)] } postCandidate :: ServerPartE Response postCandidate = do pkgInfo <- uploadCandidate (const True) seeOther (corePackageIdUri candidatesCoreResource "" $ packageId pkgInfo) (toResponse ()) -- POST to /:package/candidates/ postPackageCandidate :: DynamicPath -> ServerPartE Response postPackageCandidate dpath = do name <- packageInPath dpath pkgInfo <- uploadCandidate ((==name) . packageName) seeOther (corePackageIdUri candidatesCoreResource "" $ packageId pkgInfo) (toResponse ()) -- PUT to /:package-version/candidate -- FIXME: like delete, PUT shouldn't redirect putPackageCandidate :: DynamicPath -> ServerPartE Response putPackageCandidate dpath = do pkgid <- packageInPath dpath guard (packageVersion pkgid /= Version [] []) pkgInfo <- uploadCandidate (==pkgid) seeOther (corePackageIdUri candidatesCoreResource "" $ packageId pkgInfo) (toResponse ()) -- FIXME: DELETE should not redirect, but rather return ServerPartE () doDeleteCandidate :: DynamicPath -> ServerPartE Response doDeleteCandidate dpath = do candidate <- packageInPath dpath >>= lookupCandidateId guardAuthorisedAsMaintainer (packageName candidate) void $ updateState candidatesState $ DeleteCandidate (packageId candidate) seeOther (packageCandidatesUri candidatesResource "" $ packageName candidate) $ toResponse () serveCandidateTarball :: DynamicPath -> ServerPartE Response serveCandidateTarball dpath = do pkgid <- packageTarballInPath dpath guard (pkgVersion pkgid /= Version [] []) pkg <- lookupCandidateId pkgid case pkgLatestTarball (candPkgInfo pkg) of Nothing -> errNotFound "Tarball not found" [MText "No tarball exists for this package version."] Just (tarball, (uploadtime,_uid)) -> do let blobId = pkgTarballGz tarball cacheControl [Public, NoTransform, maxAgeMinutes 10] (BlobStorage.blobETag blobId) file <- liftIO $ BlobStorage.fetch store blobId return $ toResponse $ Resource.PackageTarball file blobId uploadtime --withFormat :: DynamicPath -> (String -> a) -> a --TODO: use something else for nice html error pages serveCandidateCabal :: DynamicPath -> ServerPartE Response serveCandidateCabal dpath = do pkg <- packageInPath dpath >>= lookupCandidateId guard (lookup "cabal" dpath == Just (display $ packageName pkg)) let (fileRev, (utime, _uid)) = pkgLatestRevision (candPkgInfo pkg) cabalfile = Resource.CabalFile (cabalFileByteString fileRev) utime return $ toResponse cabalfile uploadCandidate :: (PackageId -> Bool) -> ServerPartE CandPkgInfo uploadCandidate isRight = do guardAuthorised_ [InGroup uploadersGroup] regularIndex <- queryGetPackageIndex -- ensure that the user has proper auth if the package exists (uid, uresult, tarball) <- extractPackage $ \uid info -> processCandidate isRight regularIndex uid info now <- liftIO getCurrentTime let (UploadResult pkg pkgStr _) = uresult pkgid = packageId pkg cabalfile = CabalFileText pkgStr uploadinfo = (now, uid) candidate = CandPkgInfo { candPkgInfo = PkgInfo { pkgInfoId = pkgid, pkgMetadataRevisions = Vec.singleton (cabalfile, uploadinfo), pkgTarballRevisions = Vec.singleton (tarball, uploadinfo) }, candWarnings = uploadWarnings uresult, candPublic = True -- do withDataFn } void $ updateState candidatesState $ AddCandidate candidate let group = maintainersGroup (packageName pkgid) liftIO $ Group.addUserToGroup group uid return candidate -- | Helper function for uploadCandidate. processCandidate :: (PackageId -> Bool) -> PackageIndex PkgInfo -> Users.UserId -> UploadResult -> IO (Maybe ErrorResponse) processCandidate isRight state uid res = do let pkg = packageId (uploadDesc res) if not (isRight pkg) then uploadFailed "Name of package or package version does not match" else do pkgGroup <- Group.queryUserGroup (maintainersGroup (packageName pkg)) if packageExists state pkg && not (uid `Group.member` pkgGroup) then uploadFailed "Not authorized to upload a candidate for this package" else return Nothing where uploadFailed = return . Just . ErrorResponse 403 [] "Upload failed" . return . MText publishCandidate :: DynamicPath -> Bool -> ServerPartE UploadResult publishCandidate dpath doDelete = do packages <- queryGetPackageIndex candidate <- packageInPath dpath >>= lookupCandidateId -- check authorization to upload - must already be a maintainer uid <- guardAuthorised [InGroup (maintainersGroup (packageName candidate))] -- check if package or later already exists case checkPublish packages candidate of Just failed -> throwError failed Nothing -> do -- run filters let pkgInfo = candPkgInfo candidate uresult = UploadResult (pkgDesc pkgInfo) (cabalFileByteString (pkgLatestCabalFileText pkgInfo)) (candWarnings candidate) time <- liftIO getCurrentTime let uploadInfo = (time, uid) success <- updateAddPackage (packageId candidate) (pkgLatestCabalFileText pkgInfo) uploadInfo (fmap fst $ pkgLatestTarball pkgInfo) --FIXME: share code here with upload -- currently we do not create the initial maintainer group etc. if success then do -- delete when requested: "moving" the resource -- should this be required? (see notes in PackageCandidatesResource) when doDelete $ updateState candidatesState $ DeleteCandidate (packageId candidate) return uresult else errForbidden "Upload failed" [MText "Package already exists."] -- | Helper function for publishCandidate that ensures it's safe to insert into the main index. checkPublish :: PackageIndex PkgInfo -> CandPkgInfo -> Maybe ErrorResponse checkPublish packages candidate = do let pkgs = PackageIndex.lookupPackageName packages (packageName candidate) candVersion = packageVersion candidate case find ((== candVersion) . packageVersion) pkgs of Just {} -> Just $ ErrorResponse 403 [] "Publish failed" [MText "Package name and version already exist in the database"] Nothing -> Nothing ------------------------------------------------------------------------------ candidateRender :: CandPkgInfo -> IO CandidateRender candidateRender cand = do users <- queryGetUserDb index <- queryGetPackageIndex let pkg = candPkgInfo cand changeLog <- findToplevelFile pkg isChangeLogFile >>= either (\_ -> return Nothing) (return . Just) readme <- findToplevelFile pkg isReadmeFile >>= either (\_ -> return Nothing) (return . Just) let render = doPackageRender users pkg return $ CandidateRender { candPackageRender = render { rendPkgUri = rendPkgUri render ++ "/candidate" , rendChangeLog = changeLog , rendReadme = readme}, renderWarnings = candWarnings cand, hasIndexedPackage = not . null $ PackageIndex.lookupPackageName index (packageName cand) } ------------------------------------------------------------------------------ -- Find all candidates for a package (there may be none) -- It is not an error if a package has no candidates, but it is an error -- when the package itself does not exist. We therefore check the Core -- package database to check if the package exists. lookupCandidateName :: PackageName -> ServerPartE [CandPkgInfo] lookupCandidateName pkgname = do guardValidPackageName core pkgname state <- queryState candidatesState GetCandidatePackages return $ PackageIndex.lookupPackageName (candidateList state) pkgname -- TODO: Unlike the corresponding function in core, we don't return the -- "latest" candidate when Version is empty. Should we? -- (If we change that, we should move the 'guard' to 'guardValidPackageId') lookupCandidateId :: PackageId -> ServerPartE CandPkgInfo lookupCandidateId pkgid = do guard (pkgVersion pkgid /= Version [] []) state <- queryState candidatesState GetCandidatePackages case PackageIndex.lookupPackageId (candidateList state) pkgid of Just pkg -> return pkg _ -> errNotFound "Candidate not found" [MText $ "No such candidate version for " ++ display (packageName pkgid)] {------------------------------------------------------------------------------- TODO: everything below is an (almost) direct duplicate of corresponding functionality in PackageContents. We could factor this out, although there isn't any "interesting" code here, except differences in http cache control. -------------------------------------------------------------------------------} -- result: changelog or not-found error serveChangeLog :: DynamicPath -> ServerPartE Response serveChangeLog dpath = do pkg <- packageInPath dpath >>= lookupCandidateId mChangeLog <- liftIO $ findToplevelFile (candPkgInfo pkg) isChangeLogFile case mChangeLog of Left err -> errNotFound "Changelog not found" [MText err] Right (fp, etag, offset, name) -> do cacheControl [Public, maxAgeMinutes 5] etag liftIO $ serveTarEntry fp offset name -- TODO: We've already loaded the contents; refactor -- return: not-found error or tarball serveContents :: DynamicPath -> ServerPartE Response serveContents dpath = do pkg <- packageInPath dpath >>= lookupCandidateId mTarball <- liftIO $ packageTarball (candPkgInfo pkg) case mTarball of Left err -> errNotFound "Could not serve package contents" [MText err] Right (fp, etag, index) -> serveTarball (display (packageId pkg) ++ " candidate source tarball") ["index.html"] (display (packageId pkg)) fp index [Public, maxAgeMinutes 5] etag
chrisdotcode/hackage-server
Distribution/Server/Features/PackageCandidates.hs
bsd-3-clause
20,803
0
21
5,328
3,879
2,046
1,833
315
10
{-| /NOTE/: This module is preliminary and may change at a future date. This module is intended to help converting a list of tags into a tree of tags. -} module Text.HTML.TagSoup.Tree ( TagTree(..), tagTree, parseTree, parseTreeOptions, ParseOptions(..), flattenTree, renderTree, renderTreeOptions, RenderOptions(..), transformTree, universeTree ) where import Text.HTML.TagSoup (parseTags, parseTagsOptions, renderTags, renderTagsOptions, ParseOptions(..), RenderOptions(..)) import Text.HTML.TagSoup.Type import Control.Arrow import GHC.Exts (build) data TagTree str = TagBranch str [Attribute str] [TagTree str] | TagLeaf (Tag str) deriving (Eq,Ord,Show) instance Functor TagTree where fmap f (TagBranch x y z) = TagBranch (f x) (map (f***f) y) (map (fmap f) z) fmap f (TagLeaf x) = TagLeaf (fmap f x) -- | Convert a list of tags into a tree. This version is not lazy at -- all, that is saved for version 2. tagTree :: Eq str => [Tag str] -> [TagTree str] tagTree = g where g :: Eq str => [Tag str] -> [TagTree str] g [] = [] g xs = a ++ map TagLeaf (take 1 b) ++ g (drop 1 b) where (a,b) = f xs -- the second tuple is either null or starts with a close f :: Eq str => [Tag str] -> ([TagTree str],[Tag str]) f (TagOpen name atts:rest) = case f rest of (inner,[]) -> (TagLeaf (TagOpen name atts):inner, []) (inner,TagClose x:xs) | x == name -> let (a,b) = f xs in (TagBranch name atts inner:a, b) | otherwise -> (TagLeaf (TagOpen name atts):inner, TagClose x:xs) _ -> error "TagSoup.Tree.tagTree: safe as - forall x . isTagClose (snd (f x))" f (TagClose x:xs) = ([], TagClose x:xs) f (x:xs) = (TagLeaf x:a,b) where (a,b) = f xs f [] = ([], []) parseTree :: StringLike str => str -> [TagTree str] parseTree = tagTree . parseTags parseTreeOptions :: StringLike str => ParseOptions str -> str -> [TagTree str] parseTreeOptions opts str = tagTree $ parseTagsOptions opts str flattenTree :: [TagTree str] -> [Tag str] flattenTree xs = build $ flattenTreeFB xs flattenTreeFB :: [TagTree str] -> (Tag str -> lst -> lst) -> lst -> lst flattenTreeFB xs cons nil = flattenTreeOnto xs nil where flattenTreeOnto [] tags = tags flattenTreeOnto (TagBranch name atts inner:trs) tags = TagOpen name atts `cons` flattenTreeOnto inner (TagClose name `cons` flattenTreeOnto trs tags) flattenTreeOnto (TagLeaf x:trs) tags = x `cons` flattenTreeOnto trs tags renderTree :: StringLike str => [TagTree str] -> str renderTree = renderTags . flattenTree renderTreeOptions :: StringLike str => RenderOptions str -> [TagTree str] -> str renderTreeOptions opts trees = renderTagsOptions opts $ flattenTree trees -- | This operation is based on the Uniplate @universe@ function. Given a -- list of trees, it returns those trees, and all the children trees at -- any level. For example: -- -- > universeTree -- > [TagBranch "a" [("href","url")] [TagBranch "b" [] [TagLeaf (TagText "text")]]] -- > == [TagBranch "a" [("href","url")] [TagBranch "b" [] [TagLeaf (TagText "text")]]] -- > ,TagBranch "b" [] [TagLeaf (TagText "text")]] -- -- This operation is particularly useful for queries. To collect all @\"a\"@ -- tags in a tree, simply do: -- -- > [x | x@(TagBranch "a" _ _) <- universeTree tree] universeTree :: [TagTree str] -> [TagTree str] universeTree = concatMap f where f t@(TagBranch _ _ inner) = t : universeTree inner f x = [x] -- | This operation is based on the Uniplate @transform@ function. Given a -- list of trees, it applies the function to every tree in a bottom-up -- manner. This operation is useful for manipulating a tree - for example -- to make all tag names upper case: -- -- > upperCase = transformTree f -- > where f (TagBranch name atts inner) = [TagBranch (map toUpper name) atts inner] -- > f x = [x] transformTree :: (TagTree str -> [TagTree str]) -> [TagTree str] -> [TagTree str] transformTree act = concatMap f where f (TagBranch a b inner) = act $ TagBranch a b (transformTree act inner) f x = act x
ChristopherKing42/tagsoup
Text/HTML/TagSoup/Tree.hs
bsd-3-clause
4,310
0
15
1,065
1,255
664
591
56
7
{-# LANGUAGE DoAndIfThenElse #-} module ThetaReduction(thetaReduction) where import Control.Applicative import Data.List import Term import VarEnvironment data MarkedTerm = MLam Int String MarkedTerm | MApp MarkedTerm MarkedTerm | MVar String --deriving Show -- Uses alpha equivalence instance Eq MarkedTerm where (MVar x) == (MVar y) = x == y (MApp m n) == (MApp p q) = m == p && n == q (MLam _ x m) == (MLam _ y n) | x == y = m == n | otherwise = m == substitute (y `AssignTo` MVar x) n _ == _ = False -- TODO: Fix the repeated code for freeVars, substitute instance TermClass MarkedTerm where freeVars (MLam _ x t) = filter (/= x) $ freeVars t freeVars (MApp x y) = nub $ freeVars x ++ freeVars y freeVars (MVar x) = [x] substitute (x `AssignTo` t) (MVar y) | x == y = t | otherwise = MVar y substitute (x `AssignTo` t) (MApp m n) = MApp (substitute (x `AssignTo` t) m) (substitute (x `AssignTo` t) n) substitute (x `AssignTo` t) (MLam i y m) | x == y = MLam i y m | otherwise = MLam i y (substitute (x `AssignTo` t) m) ------ 1. Computing term M1 ------ label :: Term -> [String] -> Int -> MarkedTerm label (Var x) _ _ = MVar x label (Lambda x m) acts i | x `elem` acts = MLam i x $ label m acts i | otherwise = MLam 1 x $ label m acts i label (App m n) acts i = label m acts i `MApp` label n (act n) 3 markTerm :: Term -> MarkedTerm markTerm t = label t (act t) 2 unmarkTerm :: MarkedTerm -> Term unmarkTerm (MLam _ x m) = Lambda x (unmarkTerm m) unmarkTerm (MApp m n) = App (unmarkTerm m) (unmarkTerm n) unmarkTerm (MVar x) = Var x ------ 2. Computing term M2 ------ -- The order of thetas is because of theta2 being monadic theta :: MarkedTerm -> Environment MarkedTerm theta = theta2 . theta4 . theta3 . theta1 where theta1 ((MLam 1 x n `MApp` p) `MApp` q) = MLam 1 x (n `MApp` q) `MApp` p theta1 t = t theta2 (MLam 3 x (MLam 1 y n `MApp` p)) = do v <- newVar "var" w <- newVar "var" let n' = substitute (y `AssignTo` (MVar v `MApp` MVar x)) n p' = substitute (x `AssignTo` MVar w) p return $ MLam 1 v (MLam 3 x n') `MApp` MLam 3 w p' theta2 t = return t theta3 (n `MApp` (MLam 1 x p `MApp` q)) = MLam 1 x (n `MApp` p) `MApp` q theta3 t = t theta4 (MLam 1 x (MLam 2 y n) `MApp` p) = MLam 2 y $ MLam 1 x n `MApp` p theta4 t = t thetaReduction' :: MarkedTerm -> Environment MarkedTerm thetaReduction' t = do t' <- thetaRec =<< theta t if t /= t' then thetaReduction' t' else return t where thetaRec (MVar x) = return $ MVar x thetaRec (MApp m n) = MApp <$> (theta m >>= thetaRec) <*> (theta n >>= thetaRec) thetaRec (MLam i x m) = MLam i x <$> (theta m >>= thetaRec) -- Point-free version of it is not nice. thetaReduction :: Term -> Term thetaReduction t = evalInEnvironment [] $ do t' <- markTerm <$> makeUniqueVars t unmarkTerm <$> thetaReduction' t'
projedi/type-inference-rank2
src/ThetaReduction.hs
bsd-3-clause
3,040
0
17
852
1,367
696
671
68
5
{-# language CPP #-} -- | = Name -- -- VK_KHR_maintenance4 - device extension -- -- == VK_KHR_maintenance4 -- -- [__Name String__] -- @VK_KHR_maintenance4@ -- -- [__Extension Type__] -- Device extension -- -- [__Registered Extension Number__] -- 414 -- -- [__Revision__] -- 2 -- -- [__Extension and Version Dependencies__] -- -- - Requires Vulkan 1.1 -- -- [__Deprecation state__] -- -- - /Promoted/ to -- <https://www.khronos.org/registry/vulkan/specs/1.2-extensions/html/vkspec.html#versions-1.3-promotions Vulkan 1.3> -- -- [__Contact__] -- -- - Piers Daniell -- <https://github.com/KhronosGroup/Vulkan-Docs/issues/new?body=[VK_KHR_maintenance4] @pdaniell-nv%0A<<Here describe the issue or question you have about the VK_KHR_maintenance4 extension>> > -- -- == Other Extension Metadata -- -- [__Last Modified Date__] -- 2021-10-25 -- -- [__Interactions and External Dependencies__] -- -- - Promoted to Vulkan 1.3 Core -- -- - Requires SPIR-V 1.2 for @LocalSizeId@ -- -- [__Contributors__] -- -- - Lionel Duc, NVIDIA -- -- - Jason Ekstrand, Intel -- -- - Spencer Fricke, Samsung -- -- - Tobias Hector, AMD -- -- - Lionel Landwerlin, Intel -- -- - Graeme Leese, Broadcom -- -- - Tom Olson, Arm -- -- - Stu Smith, AMD -- -- - Yiwei Zhang, Google -- -- == Description -- -- @VK_KHR_maintenance4@ adds a collection of minor features, none of which -- would warrant an entire extension of their own. -- -- The new features are as follows: -- -- - Allow the application to destroy their -- 'Vulkan.Core10.Handles.PipelineLayout' object immediately after it -- was used to create another object. It is no longer necessary to keep -- its handle valid while the created object is in use. -- -- - Add a new -- <https://www.khronos.org/registry/vulkan/specs/1.3-extensions/html/vkspec.html#limits-maxBufferSize maxBufferSize> -- implementation-defined limit for the maximum size -- 'Vulkan.Core10.Handles.Buffer' that /can/ be created. -- -- - Add support for the SPIR-V 1.2 @LocalSizeId@ execution mode, which -- can be used as an alternative to @LocalSize@ to specify the local -- workgroup size with specialization constants. -- -- - Add a guarantee that images created with identical creation -- parameters will always have the same alignment requirements. -- -- - Add new 'getDeviceBufferMemoryRequirementsKHR', -- 'getDeviceImageMemoryRequirementsKHR', and -- 'getDeviceImageSparseMemoryRequirementsKHR' to allow the application -- to query the image memory requirements without having to create an -- image object and query it. -- -- - Relax the requirement that push constants must be initialized before -- they are dynamically accessed. -- -- - Relax the interface matching rules to allow a larger output vector -- to match with a smaller input vector, with additional values being -- discarded. -- -- - Add a guarantee for buffer memory requirement that the size memory -- requirement is never greater than the result of aligning create size -- with the alignment memory requirement. -- -- == New Commands -- -- - 'getDeviceBufferMemoryRequirementsKHR' -- -- - 'getDeviceImageMemoryRequirementsKHR' -- -- - 'getDeviceImageSparseMemoryRequirementsKHR' -- -- == New Structures -- -- - 'DeviceBufferMemoryRequirementsKHR' -- -- - 'DeviceImageMemoryRequirementsKHR' -- -- - Extending -- 'Vulkan.Core11.Promoted_From_VK_KHR_get_physical_device_properties2.PhysicalDeviceFeatures2', -- 'Vulkan.Core10.Device.DeviceCreateInfo': -- -- - 'PhysicalDeviceMaintenance4FeaturesKHR' -- -- - Extending -- 'Vulkan.Core11.Promoted_From_VK_KHR_get_physical_device_properties2.PhysicalDeviceProperties2': -- -- - 'PhysicalDeviceMaintenance4PropertiesKHR' -- -- == New Enum Constants -- -- - 'KHR_MAINTENANCE_4_EXTENSION_NAME' -- -- - 'KHR_MAINTENANCE_4_SPEC_VERSION' -- -- - Extending -- 'Vulkan.Core10.Enums.ImageAspectFlagBits.ImageAspectFlagBits': -- -- - 'IMAGE_ASPECT_NONE_KHR' -- -- - Extending 'Vulkan.Core10.Enums.StructureType.StructureType': -- -- - 'STRUCTURE_TYPE_DEVICE_BUFFER_MEMORY_REQUIREMENTS_KHR' -- -- - 'STRUCTURE_TYPE_DEVICE_IMAGE_MEMORY_REQUIREMENTS_KHR' -- -- - 'STRUCTURE_TYPE_PHYSICAL_DEVICE_MAINTENANCE_4_FEATURES_KHR' -- -- - 'STRUCTURE_TYPE_PHYSICAL_DEVICE_MAINTENANCE_4_PROPERTIES_KHR' -- -- == Promotion to Vulkan 1.3 -- -- Functionality in this extension is included in core Vulkan 1.3, with the -- KHR suffix omitted. The original type, enum and command names are still -- available as aliases of the core functionality. -- -- == Issues -- -- None. -- -- == Version History -- -- - Revision 1, 2021-08-18 (Piers Daniell) -- -- - Internal revisions -- -- - Revision 2, 2021-10-25 (Yiwei Zhang) -- -- - More guarantees on buffer memory requirements -- -- == See Also -- -- 'DeviceBufferMemoryRequirementsKHR', 'DeviceImageMemoryRequirementsKHR', -- 'PhysicalDeviceMaintenance4FeaturesKHR', -- 'PhysicalDeviceMaintenance4PropertiesKHR', -- 'getDeviceBufferMemoryRequirementsKHR', -- 'getDeviceImageMemoryRequirementsKHR', -- 'getDeviceImageSparseMemoryRequirementsKHR' -- -- == Document Notes -- -- For more information, see the -- <https://www.khronos.org/registry/vulkan/specs/1.3-extensions/html/vkspec.html#VK_KHR_maintenance4 Vulkan Specification> -- -- This page is a generated document. Fixes and changes should be made to -- the generator scripts, not directly. module Vulkan.Extensions.VK_KHR_maintenance4 ( pattern STRUCTURE_TYPE_PHYSICAL_DEVICE_MAINTENANCE_4_FEATURES_KHR , pattern STRUCTURE_TYPE_PHYSICAL_DEVICE_MAINTENANCE_4_PROPERTIES_KHR , pattern STRUCTURE_TYPE_DEVICE_BUFFER_MEMORY_REQUIREMENTS_KHR , pattern STRUCTURE_TYPE_DEVICE_IMAGE_MEMORY_REQUIREMENTS_KHR , pattern IMAGE_ASPECT_NONE_KHR , getDeviceBufferMemoryRequirementsKHR , getDeviceImageMemoryRequirementsKHR , getDeviceImageSparseMemoryRequirementsKHR , DeviceBufferMemoryRequirementsKHR , DeviceImageMemoryRequirementsKHR , PhysicalDeviceMaintenance4FeaturesKHR , PhysicalDeviceMaintenance4PropertiesKHR , KHR_MAINTENANCE_4_SPEC_VERSION , pattern KHR_MAINTENANCE_4_SPEC_VERSION , KHR_MAINTENANCE_4_EXTENSION_NAME , pattern KHR_MAINTENANCE_4_EXTENSION_NAME ) where import Data.String (IsString) import Vulkan.Core13.Promoted_From_VK_KHR_maintenance4 (getDeviceBufferMemoryRequirements) import Vulkan.Core13.Promoted_From_VK_KHR_maintenance4 (getDeviceImageMemoryRequirements) import Vulkan.Core13.Promoted_From_VK_KHR_maintenance4 (getDeviceImageSparseMemoryRequirements) import Vulkan.Core13.Promoted_From_VK_KHR_maintenance4 (DeviceBufferMemoryRequirements) import Vulkan.Core13.Promoted_From_VK_KHR_maintenance4 (DeviceImageMemoryRequirements) import Vulkan.Core13.Promoted_From_VK_KHR_maintenance4 (PhysicalDeviceMaintenance4Features) import Vulkan.Core13.Promoted_From_VK_KHR_maintenance4 (PhysicalDeviceMaintenance4Properties) import Vulkan.Core10.Enums.ImageAspectFlagBits (ImageAspectFlags) import Vulkan.Core10.Enums.ImageAspectFlagBits (ImageAspectFlagBits(IMAGE_ASPECT_NONE)) import Vulkan.Core10.Enums.StructureType (StructureType(STRUCTURE_TYPE_DEVICE_BUFFER_MEMORY_REQUIREMENTS)) import Vulkan.Core10.Enums.StructureType (StructureType(STRUCTURE_TYPE_DEVICE_IMAGE_MEMORY_REQUIREMENTS)) import Vulkan.Core10.Enums.StructureType (StructureType(STRUCTURE_TYPE_PHYSICAL_DEVICE_MAINTENANCE_4_FEATURES)) import Vulkan.Core10.Enums.StructureType (StructureType(STRUCTURE_TYPE_PHYSICAL_DEVICE_MAINTENANCE_4_PROPERTIES)) -- No documentation found for TopLevel "VK_STRUCTURE_TYPE_PHYSICAL_DEVICE_MAINTENANCE_4_FEATURES_KHR" pattern STRUCTURE_TYPE_PHYSICAL_DEVICE_MAINTENANCE_4_FEATURES_KHR = STRUCTURE_TYPE_PHYSICAL_DEVICE_MAINTENANCE_4_FEATURES -- No documentation found for TopLevel "VK_STRUCTURE_TYPE_PHYSICAL_DEVICE_MAINTENANCE_4_PROPERTIES_KHR" pattern STRUCTURE_TYPE_PHYSICAL_DEVICE_MAINTENANCE_4_PROPERTIES_KHR = STRUCTURE_TYPE_PHYSICAL_DEVICE_MAINTENANCE_4_PROPERTIES -- No documentation found for TopLevel "VK_STRUCTURE_TYPE_DEVICE_BUFFER_MEMORY_REQUIREMENTS_KHR" pattern STRUCTURE_TYPE_DEVICE_BUFFER_MEMORY_REQUIREMENTS_KHR = STRUCTURE_TYPE_DEVICE_BUFFER_MEMORY_REQUIREMENTS -- No documentation found for TopLevel "VK_STRUCTURE_TYPE_DEVICE_IMAGE_MEMORY_REQUIREMENTS_KHR" pattern STRUCTURE_TYPE_DEVICE_IMAGE_MEMORY_REQUIREMENTS_KHR = STRUCTURE_TYPE_DEVICE_IMAGE_MEMORY_REQUIREMENTS -- No documentation found for TopLevel "VK_IMAGE_ASPECT_NONE_KHR" pattern IMAGE_ASPECT_NONE_KHR = IMAGE_ASPECT_NONE -- No documentation found for TopLevel "vkGetDeviceBufferMemoryRequirementsKHR" getDeviceBufferMemoryRequirementsKHR = getDeviceBufferMemoryRequirements -- No documentation found for TopLevel "vkGetDeviceImageMemoryRequirementsKHR" getDeviceImageMemoryRequirementsKHR = getDeviceImageMemoryRequirements -- No documentation found for TopLevel "vkGetDeviceImageSparseMemoryRequirementsKHR" getDeviceImageSparseMemoryRequirementsKHR = getDeviceImageSparseMemoryRequirements -- No documentation found for TopLevel "VkDeviceBufferMemoryRequirementsKHR" type DeviceBufferMemoryRequirementsKHR = DeviceBufferMemoryRequirements -- No documentation found for TopLevel "VkDeviceImageMemoryRequirementsKHR" type DeviceImageMemoryRequirementsKHR = DeviceImageMemoryRequirements -- No documentation found for TopLevel "VkPhysicalDeviceMaintenance4FeaturesKHR" type PhysicalDeviceMaintenance4FeaturesKHR = PhysicalDeviceMaintenance4Features -- No documentation found for TopLevel "VkPhysicalDeviceMaintenance4PropertiesKHR" type PhysicalDeviceMaintenance4PropertiesKHR = PhysicalDeviceMaintenance4Properties type KHR_MAINTENANCE_4_SPEC_VERSION = 2 -- No documentation found for TopLevel "VK_KHR_MAINTENANCE_4_SPEC_VERSION" pattern KHR_MAINTENANCE_4_SPEC_VERSION :: forall a . Integral a => a pattern KHR_MAINTENANCE_4_SPEC_VERSION = 2 type KHR_MAINTENANCE_4_EXTENSION_NAME = "VK_KHR_maintenance4" -- No documentation found for TopLevel "VK_KHR_MAINTENANCE_4_EXTENSION_NAME" pattern KHR_MAINTENANCE_4_EXTENSION_NAME :: forall a . (Eq a, IsString a) => a pattern KHR_MAINTENANCE_4_EXTENSION_NAME = "VK_KHR_maintenance4"
expipiplus1/vulkan
src/Vulkan/Extensions/VK_KHR_maintenance4.hs
bsd-3-clause
10,976
0
8
2,016
604
450
154
-1
-1
{-| Module : Database.Relational.Delete Description : Definition of DELETE_FROM. Copyright : (c) Alexander Vieth, 2015 Licence : BSD3 Maintainer : aovieth@gmail.com Stability : experimental Portability : non-portable (GHC only) -} {-# LANGUAGE AutoDeriveTypeable #-} module Database.Relational.Delete ( DELETE(..) ) where data DELETE a = DELETE a
avieth/Relational
Database/Relational/Delete.hs
bsd-3-clause
376
0
6
75
28
19
9
4
0
module Experiments.StateParser where import Control.Monad.State.Lazy data Token = OpenParen | CloseParen | Letter Char deriving (Eq, Show) data AST = Group [AST] | Expression [Char] deriving (Eq, Show) type ParserState = State [Token] AST charLex :: Char -> Token charLex c = case c of '(' -> OpenParen ')' -> CloseParen _ -> Letter c myLex :: String -> [Token] myLex text = fmap charLex text myParse :: ParserState myParse = do tokens <- get case tokens of OpenParen:rest -> do put rest myParse CloseParen:rest -> do put rest return $ Expression [] (Letter c):rest -> do put rest parsed <- myParse case parsed of Expression chars -> return $ Expression (c : chars) Group _ -> error "shouldn'g get an AST here" [] -> error "shouldn't hit this"
rumblesan/haskell-experiments
src/Experiments/StateParser.hs
bsd-3-clause
878
0
18
263
304
153
151
37
5
-- -- Finder.hs -- module Finder where import Data.ByteString.Char8 as BS (ByteString, hGetLine) import Data.Map as Map (Map, elems, empty, insert, lookup) import System.IO import System.Process type FingerPrint = ByteString findSame :: [FilePath] -> IO [[FilePath]] findSame fs = do fps <- mapM getFingerPrint4 fs let es = Map.elems $ foldl insertItem Map.empty (zip fps fs) return $ filter (\x -> length x > 1) es insertItem :: Map FingerPrint [FilePath] -> (FingerPrint, FilePath) -> Map FingerPrint [FilePath] insertItem m x = Map.insert k l m where k = fst x l = toList x (Map.lookup k m) toList :: (FingerPrint, FilePath) -> Maybe [FilePath] -> [FilePath] toList x Nothing = [snd x] toList x (Just l) = (snd x:l) getFingerPrint :: Int -> FilePath -> IO FingerPrint getFingerPrint r f = do (sin, sout, serr, ph) <- runInteractiveCommand command waitForProcess ph fp <- BS.hGetLine sout return fp where geo = (show r) ++ "x" ++ (show r) size = r * r * 3 command = "convert -define jpeg:size=" ++ geo ++ " -filter Cubic -resize " ++ geo ++ "! " ++ f ++ " PPM:- | tail -c " ++ (show size) getFingerPrint4 = getFingerPrint 4
eijian/picfinder
src/Finder-r1.hs
bsd-3-clause
1,219
0
13
292
476
251
225
31
2
{-# LANGUAGE CPP #-} {-# LANGUAGE ConstraintKinds #-} {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} {-# LANGUAGE Rank2Types #-} {-# LANGUAGE ScopedTypeVariables #-} {-# LANGUAGE TypeFamilies #-} {-# LANGUAGE UndecidableInstances #-} {-# LANGUAGE LambdaCase #-} #ifdef USE_TEMPLATE_HASKELL {-# LANGUAGE TemplateHaskell #-} #endif module Reflex.Dom.Old ( MonadWidget , El , ElConfig (..) , elConfig_namespace , elConfig_attributes , _el_clicked , _el_element , _el_events , addVoidAction , AttributeMap , Attributes (..) , buildElement , buildElementNS , buildEmptyElement , buildEmptyElementNS , elDynHtml' , elDynHtmlAttr' , elStopPropagationNS , elWith , elWith' , emptyElWith , emptyElWith' , namedNodeMapGetNames , nodeClear , onEventName , schedulePostBuild , text' , unsafePlaceElement , WidgetHost , wrapElement ) where import Control.Arrow (first) #ifdef USE_TEMPLATE_HASKELL import Control.Lens (makeLenses, (%~), (&), (.~), (^.)) #else import Control.Lens (Lens, Lens', (%~), (&), (.~), (^.)) #endif import Control.Monad import Control.Monad.Fix import Control.Monad.IO.Class import Control.Monad.Reader import Control.Monad.Ref import Data.Default import Data.Dependent.Map as DMap import Data.Functor.Misc import Data.Map (Map) import qualified Data.Map as Map import Data.Set (Set) import qualified Data.Set as Set import Data.Text (Text) import qualified GHCJS.DOM.Element as Element import GHCJS.DOM.EventM (EventM) import GHCJS.DOM.NamedNodeMap as NNM import GHCJS.DOM.Node (getFirstChild, getNodeName, removeChild) import GHCJS.DOM.Types (liftJSM, JSM, IsHTMLElement, IsNode) import qualified GHCJS.DOM.Types as DOM import Reflex.Class import Reflex.Dom.Builder.Class import Reflex.Dom.Builder.Immediate import Reflex.Dom.Widget.Basic import Reflex.Host.Class import Reflex.PerformEvent.Class import Reflex.PostBuild.Class import Reflex.TriggerEvent.Class data ElConfig attrs = ElConfig { _elConfig_namespace :: Maybe Text , _elConfig_attributes :: attrs } instance attrs ~ Map Text Text => Default (ElConfig attrs) where def = ElConfig { _elConfig_namespace = Nothing , _elConfig_attributes = mempty } #ifdef USE_TEMPLATE_HASKELL makeLenses ''ElConfig #else elConfig_namespace :: Lens' (ElConfig attrs1) (Maybe Text) elConfig_namespace f (ElConfig a b) = (\a' -> ElConfig a' b) <$> f a {-# INLINE elConfig_namespace #-} elConfig_attributes :: Lens (ElConfig attrs1) (ElConfig attrs2) attrs1 attrs2 elConfig_attributes f (ElConfig a b) = (\b' -> ElConfig a b') <$> f b {-# INLINE elConfig_attributes #-} #endif type MonadWidgetConstraints t m = ( DomBuilder t m , DomBuilderSpace m ~ GhcjsDomSpace , MonadFix m , MonadHold t m , MonadSample t (Performable m) , MonadReflexCreateTrigger t m , PostBuild t m , PerformEvent t m , MonadIO m , MonadIO (Performable m) #ifndef ghcjs_HOST_OS , DOM.MonadJSM m , DOM.MonadJSM (Performable m) #endif , TriggerEvent t m , HasDocument m , MonadRef m , Ref m ~ Ref IO , MonadRef (Performable m) , Ref (Performable m) ~ Ref IO ) class MonadWidgetConstraints t m => MonadWidget t m instance MonadWidgetConstraints t m => MonadWidget t m type WidgetHost m = Performable m type El = Element EventResult GhcjsDomSpace addVoidAction :: MonadWidget t m => Event t (WidgetHost m ()) -> m () addVoidAction = performEvent_ type AttributeMap = Map Text Text buildElement :: (MonadWidget t m, Attributes m attrs t) => Text -> attrs -> m a -> m (RawElement (DomBuilderSpace m), a) buildElement = buildElementNS Nothing buildEmptyElement :: (MonadWidget t m, Attributes m attrs t) => Text -> attrs -> m (RawElement (DomBuilderSpace m)) buildEmptyElement elementTag attrs = fst <$> buildElementNS Nothing elementTag attrs blank buildEmptyElementNS :: (MonadWidget t m, Attributes m attrs t) => Maybe Text -> Text -> attrs -> m (RawElement (DomBuilderSpace m)) buildEmptyElementNS ns elementTag attrs = fst <$> buildElementNS ns elementTag attrs blank buildElementNS :: (MonadWidget t m, Attributes m attrs t) => Maybe Text -> Text -> attrs -> m a -> m (RawElement (DomBuilderSpace m), a) buildElementNS ns elementTag attrs child = first _element_raw <$> buildElementInternal ns elementTag attrs child class Attributes m attrs t where buildElementInternal :: MonadWidget t m => Maybe Text -> Text -> attrs -> m a -> m (Element EventResult (DomBuilderSpace m) t, a) instance Attributes m (Map Text Text) t where buildElementInternal ns elementTag attrs child = do let cfg = def & elementConfig_namespace .~ ns buildElementCommon elementTag child =<< addStaticAttributes attrs cfg addStaticAttributes :: Applicative m => Map Text Text -> ElementConfig er t (DomBuilderSpace m) -> m (ElementConfig er t (DomBuilderSpace m)) addStaticAttributes attrs cfg = do let initialAttrs = Map.fromList $ first (AttributeName Nothing) <$> Map.toList attrs pure $ cfg & elementConfig_initialAttributes .~ initialAttrs instance PostBuild t m => Attributes m (Dynamic t (Map Text Text)) t where buildElementInternal ns elementTag attrs child = do let cfg = def & elementConfig_namespace .~ ns buildElementCommon elementTag child =<< addDynamicAttributes attrs cfg addDynamicAttributes :: PostBuild t m => Dynamic t (Map Text Text) -> ElementConfig er t (DomBuilderSpace m) -> m (ElementConfig er t (DomBuilderSpace m)) addDynamicAttributes attrs cfg = do modifyAttrs <- dynamicAttributesToModifyAttributes attrs return $ cfg & elementConfig_modifyAttributes .~ fmap mapKeysToAttributeName modifyAttrs buildElementCommon :: MonadWidget t m => Text -> m a -> ElementConfig er t (DomBuilderSpace m) -> m (Element er (DomBuilderSpace m) t, a) buildElementCommon elementTag child cfg = element elementTag cfg child onEventName :: IsHTMLElement e => EventName en -> e -> EventM e (EventType en) () -> JSM (JSM ()) onEventName = elementOnEventName schedulePostBuild :: (PostBuild t m, PerformEvent t m) => WidgetHost m () -> m () schedulePostBuild w = do postBuild <- getPostBuild performEvent_ $ w <$ postBuild text' :: MonadWidget t m => Text -> m DOM.Text text' s = _textNode_raw <$> textNode (def & textNodeConfig_initialContents .~ s) instance HasAttributes (ElConfig attrs) where type Attrs (ElConfig attrs) = attrs attributes = elConfig_attributes instance HasNamespace (ElConfig attrs) where namespace = elConfig_namespace elWith :: (MonadWidget t m, Attributes m attrs t) => Text -> ElConfig attrs -> m a -> m a elWith elementTag cfg child = snd <$> elWith' elementTag cfg child elWith' :: (MonadWidget t m, Attributes m attrs t) => Text -> ElConfig attrs -> m a -> m (Element EventResult (DomBuilderSpace m) t, a) elWith' elementTag cfg = buildElementInternal (cfg ^. namespace) elementTag $ cfg ^. attributes emptyElWith :: (MonadWidget t m, Attributes m attrs t) => Text -> ElConfig attrs -> m () emptyElWith elementTag cfg = void $ emptyElWith' elementTag cfg emptyElWith' :: (MonadWidget t m, Attributes m attrs t) => Text -> ElConfig attrs -> m (Element EventResult (DomBuilderSpace m) t) emptyElWith' elementTag cfg = fmap fst $ elWith' elementTag cfg $ return () {-# DEPRECATED _el_clicked "Use 'domEvent Click' instead" #-} _el_clicked :: Reflex t => Element EventResult d t -> Event t () _el_clicked = domEvent Click {-# DEPRECATED _el_element "Use '_element_raw' instead" #-} _el_element :: El t -> RawElement GhcjsDomSpace _el_element = _element_raw {-# DEPRECATED _el_events "Use '_element_events' instead; or, if possible, use 'domEvent' instead to retrieve a particular event" #-} _el_events :: Element er d t -> EventSelector t (WrapArg er EventName) _el_events = _element_events {-# DEPRECATED _el_keypress "Use 'domEvent Keypress' instead" #-} _el_keypress :: Reflex t => El t -> Event t Word _el_keypress = domEvent Keypress {-# DEPRECATED _el_scrolled "Use 'domEvent Scroll' instead" #-} _el_scrolled :: Reflex t => El t -> Event t Double _el_scrolled = domEvent Scroll wrapElement :: forall t m. MonadWidget t m => (forall en. DOM.HTMLElement -> EventName en -> EventM DOM.Element (EventType en) (Maybe (EventResult en))) -> DOM.HTMLElement -> m (El t) wrapElement eh e = do let h :: (EventName en, GhcjsDomEvent en) -> JSM (Maybe (EventResult en)) h (en, GhcjsDomEvent evt) = runReaderT (eh e en) evt wrapRawElement (DOM.toElement e) $ (def :: RawElementConfig EventResult t (DomBuilderSpace m)) { _rawElementConfig_eventSpec = def { _ghcjsEventSpec_handler = GhcjsEventHandler h } } unsafePlaceElement :: MonadWidget t m => DOM.HTMLElement -> m (Element EventResult (DomBuilderSpace m) t) unsafePlaceElement e = do placeRawElement $ DOM.toElement e wrapRawElement (DOM.toElement e) def namedNodeMapGetNames :: DOM.NamedNodeMap -> JSM (Set Text) namedNodeMapGetNames self = do l <- NNM.getLength self Set.fromList <$> forM (take (fromIntegral l) [0..]) ( NNM.itemUnchecked self >=> getNodeName) nodeClear :: IsNode self => self -> JSM () nodeClear n = do mfc <- getFirstChild n case mfc of Nothing -> return () Just fc -> do _ <- removeChild n fc nodeClear n elStopPropagationNS :: forall t m en a. (MonadWidget t m) => Maybe Text -> Text -> EventName en -> m a -> m a elStopPropagationNS ns elementTag en child = do let f = GhcjsEventFilter $ \_ -> do return (stopPropagation, return Nothing) cfg = (def :: ElementConfig EventResult t (DomBuilderSpace m)) & namespace .~ ns & elementConfig_eventSpec . ghcjsEventSpec_filters %~ DMap.insert en f snd <$> element elementTag cfg child elDynHtmlAttr' :: (DOM.MonadJSM m, MonadWidget t m) => Text -> Map Text Text -> Dynamic t Text -> m (Element EventResult GhcjsDomSpace t) elDynHtmlAttr' elementTag attrs html = do let cfg = def & initialAttributes .~ Map.mapKeys (AttributeName Nothing) attrs (e, _) <- element elementTag cfg $ return () postBuild <- getPostBuild performEvent_ $ liftJSM . Element.setInnerHTML (_element_raw e) <$> leftmost [updated html, tag (current html) postBuild] return e elDynHtml' :: MonadWidget t m => Text -> Dynamic t Text -> m (Element EventResult GhcjsDomSpace t) elDynHtml' elementTag = elDynHtmlAttr' elementTag mempty
reflex-frp/reflex-dom
reflex-dom-core/src/Reflex/Dom/Old.hs
bsd-3-clause
10,483
0
18
1,935
3,178
1,633
1,545
-1
-1
module Main where import Graphics.Gloss data Var = X | F | Plus | Minus | Lf | Rt deriving (Eq) data Turtle = Turtle { position:: (Float, Float), angle:: Float} deriving (Show) data Config = Config { graphic:: Turtle, history:: [Turtle] } deriving (Show) class Changer a where mutateConfig :: a -> Config -> Config instance Changer Var where mutateConfig var (Config (Turtle (x,y) rotation ) h) = Config (Turtle (mutatePos (x,y)) (mutateAngle rotation)) (mutateHistory h) where (mutatePos, mutateAngle, mutateHistory) = case var of F -> (goOn, id, id) Plus -> (id, turnRight, id) Minus -> (id, turnLeft, id) Lf -> (id, id, push) Rt -> (restorePos, restoreAngle, tail) X -> (id, id, id) goOn (x,y) = (x + branch * cos rotation, y + branch * sin rotation) turnRight angle' = angle' - 25 * (pi / 180) turnLeft angle' = angle' + 25 * (pi / 180) push h = Turtle (x,y) rotation : h restorePos _ = position (head h) restoreAngle _ = angle (head h) axiom :: [Var] axiom = [X] transformVar :: Var -> [Var] transformVar X = [F, Minus, Lf, Lf, X, Rt, Plus, X, Rt, Plus, F, Lf, Plus, F, X, Rt,Minus,X] transformVar F = [F, F] transformVar Lf = [Lf] transformVar Rt = [Rt] transformVar Minus = [Minus] transformVar Plus = [Plus] transformList :: [Var] -> [Var] transformList = concatMap transformVar algas :: [[Var]] algas = iterate transformList axiom algasAtStep n = algas !! n makeConfigList :: (Changer v) => [Config] -> v -> [Config] makeConfigList configs var = mutateConfig var (head configs) :configs configLevel :: Int -> [Config] configLevel n = foldl makeConfigList [c0] (algasAtStep n) positionsLevel :: Int -> [(Float, Float)] positionsLevel n = reverse $ map (position . graphic ) (configLevel n) nearCouples :: [a] -> [[a]] nearCouples [] = [] nearCouples [x] = [] nearCouples [x,y] = [[x,y]] nearCouples (x:y:z:xs) = [x,y]: [y,z] : nearCouples (z:xs) type Segment = [(Float, Float)] noSameDest :: [Segment] -> [Segment] noSameDest (seg:segs) = seg : noSameDest (filter (noSameDest' seg) segs) where noSameDest' seg' seg = last seg /= last seg' noSameDest [] = [] coloredLines n = Pictures $ map (\(color, line) -> color line ) $ zip colors myLines where myLines = map Line $ noSameDest (nearCouples (positionsLevel n)) c0 = Config (Turtle (0,-500) (pi/4)) [] branch = 5 colors = Color (makeColorI 158 191 109 255) : colors backColor = makeColorI 10 50 10 255 main = display (InWindow "Nice Window" (1400, 1400) (20, 20)) backColor (coloredLines 6)
edoardo90/lsystem
src/FractalTree.hs
bsd-3-clause
2,913
0
12
881
1,206
666
540
58
1
{-# LANGUAGE GADTs #-} {-# LANGUAGE Rank2Types #-} {-# LANGUAGE ScopedTypeVariables #-} module Control.Alternative.Freer ( Alt , runAlt , liftAlt , hoistAlt , retractAlt ) where import Control.Applicative -- | A purely formal Alternative structure over a functor, where -- no particular constraints are made on the behaviour of -- 'Or', 'Some' and 'Many'. data Alt f a where Pure :: a -> Alt f a Lift :: f a -> Alt f a Ap :: Alt f a -> Alt f (a -> b) -> Alt f b Empty :: Alt f a Or :: Alt f a -> Alt f a -> Alt f a Some :: Alt f a -> Alt f [a] instance Functor f => Functor (Alt f) where fmap f (Pure a) = Pure $ f a fmap f (Lift g) = Lift $ fmap f g fmap f (Ap x g) = x `Ap` fmap (f .) g fmap _ Empty = Empty fmap f (Or a b) = Or (f <$> a) (f <$> b) fmap f (Some l) = f . (:[]) <$> l instance Functor f => Applicative (Alt f) where pure = Pure {-# INLINE pure #-} (Pure f) <*> y = fmap f y Empty <*> _ = Empty (Ap a f) <*> y = Ap a (flip <$> f <*> y) y <*> f = Ap f y instance Functor f => Alternative (Alt f) where empty = Empty a <|> b = Or a b some = Some many x = some x <|> empty runAlt :: forall f g a. Alternative g => (forall x. f x -> g x) -> Alt f a -> g a runAlt phi f = retractAlt $ hoistAlt phi f liftAlt :: Functor f => f a -> Alt f a liftAlt = Lift hoistAlt :: forall f g a. (forall x. f x -> g x) -> Alt f a -> Alt g a hoistAlt _ (Pure a) = Pure a hoistAlt f (Lift g) = Lift $ f g hoistAlt f (Ap x g) = Ap (hoistAlt f x) (hoistAlt f g) hoistAlt _ Empty = Empty hoistAlt f (Or a b) = Or (hoistAlt f a) (hoistAlt f b) hoistAlt f (Some a) = Some $ hoistAlt f a -- | Interpret the free alternative over f using the Alternative semantics for f. retractAlt :: Alternative f => Alt f a -> f a retractAlt (Pure a) = pure a retractAlt (Lift f) = f retractAlt (a `Ap` f) = retractAlt a <**> retractAlt f retractAlt Empty = empty retractAlt (Or a b) = retractAlt a <|> retractAlt b retractAlt (Some a) = some $ retractAlt a
seagate-ssg/options-schema
src/Control/Alternative/Freer.hs
bsd-3-clause
2,007
0
11
528
961
482
479
54
1
{-# language MultiParamTypeClasses, FlexibleInstances, FlexibleContexts, UndecidableInstances#-} -- Finger tree half spine, amortized O(1) access to head (push/pop) , O(log n) access to elements (peek) module HFT (F(E),push,pop,Peek(peek),P(..)) where import Control.Applicative import Data.List import Data.Maybe data T a = S !Int a | B !Int a a deriving Show class Peek s b c where peek :: Int -> s b -> Maybe c instance Peek T c c where peek 0 (S _ x) = Just x peek 0 (B _ x _) = Just x peek 1 (B _ x y) = Just y peek _ _ = Nothing instance Peek T a c => Peek T (T a) c where peek n (S k x) = peek n x peek n (B k x y) | n < px = peek n x | otherwise = peek (n - px) y where px = power x class Power a where power :: a -> Int instance Power (T a) where power (S k _) = k power (B k _ _) = k newtype P a = P {unP :: a} deriving (Eq,Show) instance Power (P a) where power _ = 1 data F a = F (T a) (F (T a)) | E deriving Show push :: Power a => a -> F a -> F a push x = let px = power x f E = F (S px x) E f (F (S py y) e) = F (B (px + py) x y) e f (F b e) = F (S px x) $ push b e in f pop :: Power a => F a -> Maybe (a, F a) pop E = Nothing pop (F (B _ x y) e) = Just (x, F (S (power y) y) e) pop (F (S _ x) e) = Just (x, maybe E (uncurry F) $ pop e) instance Peek T a b => Peek F a b where peek n E = Nothing peek n (F x e) = peek n x <|> peek (n - power x) e -- naive push 10 * 10^6 elements to an F and random access them all main = do let s = map P is is = [1..10000000::Int] let t = foldl' (flip push) E $ s print . sum . map (\s -> unP $ fromJust (peek s t :: Maybe (P Int))) $ is
paolino/hft
HFT.hs
bsd-3-clause
1,750
0
17
563
944
476
468
56
3
{-# LANGUAGE DataKinds #-} {-# LANGUAGE NamedFieldPuns #-} {-# LANGUAGE OverloadedStrings #-} {-# LANGUAGE ScopedTypeVariables #-} {-# LANGUAGE TypeOperators #-} module SAWScript.Heapster.JudgmentTranslation.Examples ( testJudgmentTranslation, ) where import Data.Functor.Const import Data.Parameterized.Classes import Data.Parameterized.Context import Lang.Crucible.LLVM.MemModel import Lang.Crucible.Types import SAWScript.Heapster.JudgmentTranslation import SAWScript.Heapster.Permissions import SAWScript.Heapster.TypeTranslation import SAWScript.TopLevel import Verifier.SAW.OpenTerm import Verifier.SAW.Term.Pretty type ExampleContext = EmptyCtx ::> LLVMPointerType 64 permInLeft :: ValuePerm ExampleContext (LLVMPointerType 64) permInLeft = ValPerm_LLVMPtr knownRepr [ (LLVMFieldShapePerm (LLVMFieldPerm { llvmFieldOffset = 0 , llvmFieldSplitting = SplExpr_All , llvmFieldPerm = ValPerm_True } ) ) ] Nothing permInRight :: ValuePerm ExampleContext (LLVMPointerType 64) permInRight = ValPerm_Eq (PExpr_LLVMWord knownRepr (PExpr_BV knownRepr [] 0)) permIn :: ValuePerm ExampleContext (LLVMPointerType 64) permIn = ValPerm_Or permInLeft permInRight permOutLeft :: ValuePerm ExampleContext (LLVMPointerType 64) permOutLeft = ValPerm_LLVMPtr knownRepr [] Nothing permOutRightInsideExists :: ValuePerm (ExampleContext ::> BVType 64) (LLVMPointerType 64) permOutRightInsideExists = ValPerm_Eq (PExpr_LLVMWord knownRepr (PExpr_Var (nextPermVar (incSize zeroSize)))) permOutRight :: ValuePerm ExampleContext (LLVMPointerType 64) permOutRight = ValPerm_Exists (BVRepr knownRepr) permOutRightInsideExists permOut :: ValuePerm ExampleContext (LLVMPointerType 64) permOut = ValPerm_Or permOutLeft permOutRight -- | For debugging purposes, a simpler example proving the left side: -- ValPerm_LLVMPtr shapes Nothing |- ValPerm_LLVMPtr [] Nothing examplePermElimLeft :: PermElim AnnotIntro ExampleContext examplePermElimLeft = Elim_Done leftAnnotIntro where permSetSpecOut :: PermSetSpec EmptyCtx ExampleContext permSetSpecOut = [ PermSpec zeroSize (PExpr_Var (nextPermVar zeroSize)) permOutLeft ] -- permInLeft |- permOutLeft leftAnnotIntro :: AnnotIntro ExampleContext leftAnnotIntro = AnnotIntro { introInPerms = extendPermSet emptyPermSet knownRepr permInLeft , introOutPerms = permSetSpecOut , introProof = leftIntro } -- permInLeft |- permOutLeft leftIntro :: PermIntro ExampleContext leftIntro = -- permInLeft |- permOutLeft Intro_LLVMPtr (nextPermVar zeroSize) -- permInLeft |- empty $ Intro_Done examplePermElimRight :: PermElim AnnotIntro ExampleContext examplePermElimRight = Elim_Done rightAnnotIntro where permSetSpecOut :: PermSetSpec EmptyCtx ExampleContext permSetSpecOut = [ PermSpec zeroSize (PExpr_Var (nextPermVar zeroSize)) permOutRight ] -- permInRight |- permOutRight rightAnnotIntro :: AnnotIntro ExampleContext rightAnnotIntro = AnnotIntro { introInPerms = extendPermSet emptyPermSet knownRepr permInRight , introOutPerms = permSetSpecOut , introProof = rightIntro } -- permInRight |- permOutRight rightIntro :: PermIntro ExampleContext rightIntro = -- permInRight |- permOutRight Intro_Exists (BVRepr (knownRepr :: NatRepr 64)) (PExpr_BV knownRepr [] 0) permOutRightInsideExists -- permInRight |- ValPerm_Eq (PExpr_LLVMWord knownRepr (PExpr_Var (nextPermVar (incSize zeroSize)))) $ Intro_Eq (EqProof_Refl (PExpr_LLVMWord (knownRepr :: NatRepr 64) (PExpr_BV knownRepr [] 0))) -- permInRight |- permOut $ Intro_Done examplePermElim :: PermElim AnnotIntro ExampleContext examplePermElim = Elim_Or (nextPermVar zeroSize) leftBranch rightBranch permSetSpecOut :: PermSetSpec EmptyCtx ExampleContext permSetSpecOut = [ PermSpec zeroSize (PExpr_Var (nextPermVar zeroSize)) permOut ] -- permInLeft |- permOut leftBranch :: PermElim AnnotIntro ExampleContext leftBranch = Elim_Done leftAnnotIntro -- permInLeft |- permOut leftAnnotIntro :: AnnotIntro ExampleContext leftAnnotIntro = AnnotIntro { introInPerms = extendPermSet emptyPermSet knownRepr permInLeft , introOutPerms = permSetSpecOut , introProof = leftIntro } -- permInLeft |- permOut leftIntro :: PermIntro ExampleContext leftIntro = -- permInLeft |- permOut Intro_OrL permOutRight -- permInLeft |- permOutLeft $ Intro_LLVMPtr (nextPermVar zeroSize) -- permInLeft |- empty $ Intro_Done -- permInRight |- permOut rightBranch :: PermElim AnnotIntro ExampleContext rightBranch = Elim_Done rightAnnotIntro -- permInRight |- permOut rightAnnotIntro :: AnnotIntro ExampleContext rightAnnotIntro = AnnotIntro { introInPerms = extendPermSet emptyPermSet knownRepr permInRight , introOutPerms = permSetSpecOut , introProof = rightIntro } -- permInRight |- permOut rightIntro :: PermIntro ExampleContext rightIntro = -- permInRight |- permOut Intro_OrR permOutLeft -- permInRight |- permOutRight $ Intro_Exists (BVRepr (knownRepr :: NatRepr 64)) (PExpr_BV knownRepr [] 0) permOutRightInsideExists -- permInRight |- ValPerm_Eq (PExpr_LLVMWord knownRepr (PExpr_Var (nextPermVar (incSize zeroSize)))) $ Intro_Eq (EqProof_Refl (PExpr_LLVMWord (knownRepr :: NatRepr 64) (PExpr_BV knownRepr [] 0))) -- permInRight |- permOut $ Intro_Done emptyInfo :: BlocksInfo EmptyCtx emptyInfo = BlocksInfo { entryPoints = [] } llvmPointerType :: OpenTerm llvmPointerType = typeTranslate'' (LLVMPointerRepr (knownRepr :: NatRepr 64)) permInTypeLeft :: OpenTermCtxt ExampleContext -> OpenTerm permInTypeLeft typeEnvironment = typeTranslate typeEnvironment permInLeft permInTypeRight :: OpenTermCtxt ExampleContext -> OpenTerm permInTypeRight typeEnvironment = typeTranslate typeEnvironment permInRight permInType :: OpenTermCtxt ExampleContext -> OpenTerm permInType typeEnvironment = typeTranslate typeEnvironment permIn permOutTypeLeft :: OpenTermCtxt ExampleContext -> OpenTerm permOutTypeLeft typeEnvironment = typeTranslate typeEnvironment permOutLeft permOutTypeRight :: OpenTermCtxt ExampleContext -> OpenTerm permOutTypeRight typeEnvironment = typeTranslate typeEnvironment permOutRight permOutType :: OpenTermCtxt ExampleContext -> OpenTerm permOutType typeEnvironment = typeTranslate typeEnvironment permOut scaffold :: ValuePerm ExampleContext (LLVMPointerType 64) -> ValuePerm ExampleContext (LLVMPointerType 64) -> PermElim AnnotIntro ExampleContext -> OpenTerm scaffold pIn pOut permElim = lambdaOpenTerm "v" (typeTranslate'' (LLVMPointerRepr (knownRepr :: NatRepr 64))) $ \ v -> let typeEnvironment :: Assignment (Const OpenTerm) ExampleContext = extend empty (Const v) in lambdaOpenTerm "vp" (typeTranslate typeEnvironment pIn) $ \ vp -> let jctx = JudgmentContext { typeEnvironment , permissionSet = extendPermSet emptyPermSet knownRepr pIn , permissionMap = extend empty (Const vp) , catchHandler = Nothing } in let permSetSpecOut = [PermSpec zeroSize (PExpr_Var $ nextPermVar zeroSize) pOut] in judgmentTranslate' emptyInfo jctx (typeTranslatePermSetSpec typeEnvironment permSetSpecOut) permElim translateExamplePermElimLeft :: OpenTerm translateExamplePermElimLeft = scaffold permInLeft permOutLeft examplePermElimLeft translateExamplePermElimRight :: OpenTerm translateExamplePermElimRight = scaffold permInRight permOutRight examplePermElimRight translateExamplePermElimDisjOutL :: OpenTerm translateExamplePermElimDisjOutL = scaffold permInLeft permOut (Elim_Done leftAnnotIntro) translateExamplePermElimDisjOutR :: OpenTerm translateExamplePermElimDisjOutR = scaffold permInRight permOut (Elim_Done rightAnnotIntro) translateExamplePermElim :: OpenTerm translateExamplePermElim = scaffold permIn permOut examplePermElim testJudgmentTranslation :: TopLevel () testJudgmentTranslation = do sc <- getSharedContext io $ do let test term = putStrLn . showTerm =<< completeOpenTerm sc term {- putStrLn "Testing llvmPointerType" test llvmPointerType putStrLn "Testing permInType" test $ lambdaOpenTerm "v" llvmPointerType $ \ v -> permInType (extend empty (Const v)) putStrLn "Testing permOutType" test $ lambdaOpenTerm "v" llvmPointerType $ \ v -> permOutType (extend empty (Const v)) putStrLn "Testing permInTypeLeft" test $ lambdaOpenTerm "v" llvmPointerType $ \ v -> permInTypeLeft (extend empty (Const v)) putStrLn "Testing permOutTypeLeft" test $ lambdaOpenTerm "v" llvmPointerType $ \ v -> permOutTypeLeft (extend empty (Const v)) putStrLn "Testing translating examplePermElimLeft" test $ translateExamplePermElimLeft putStrLn "Testing permInTypeRight" test $ lambdaOpenTerm "v" llvmPointerType $ \ v -> permInTypeRight (extend empty (Const v)) putStrLn "Testing permOutTypeRight" test $ lambdaOpenTerm "v" llvmPointerType $ \ v -> permOutTypeRight (extend empty (Const v)) putStrLn "Testing translating examplePermElimRight" test $ translateExamplePermElimRight putStrLn "\nTranslating (ptr(0 |-> (W,true)) |- (ptr() \\/ exists x.eq(x))" test $ translateExamplePermElimDisjOutL putStrLn "\nTranslating (eq(0) |- (ptr() \\/ exists x.eq(x))" test $ translateExamplePermElimDisjOutR -} putStrLn "\nTranslating x:(ptr(0 |-> (W,true)) \\/ eq(0)) |- x:(ptr() \\/ exists y.eq(y))" test $ translateExamplePermElim -- EXAMPLE to write: -- -- (ValPerm_LLVMPtr shapes ... \/ eq(PExpr_LLVMWord zero)) -> -- (ValPerm_LLVMPtr [] Nothing) \/ (exists (x : ), PExpr_LLVMWord x) -- -- PermElim AnnotIntro (EmptyCtx ::> LLVMPointerType 64)
GaloisInc/saw-script
heapster-saw/src/Verifier/SAW/Heapster/archival/JudgmentTranslation/Examples.hs
bsd-3-clause
9,844
0
21
1,681
1,651
873
778
146
1
module FRP.Sodium.GameEngine2D.Orientation where data Orientation = OrientationUp | OrientationDown | OrientationLeft | OrientationRight | OrientationUpMirrored | OrientationDownMirrored | OrientationLeftMirrored | OrientationRightMirrored deriving (Eq, Ord, Show, Enum)
the-real-blackh/sodium-2d-game-engine
FRP/Sodium/GameEngine2D/Orientation.hs
bsd-3-clause
410
0
6
165
55
34
21
10
0
module CaesarEncode where import Data.Char (ord, chr) caesarEncode :: Int -> String -> String caesarEncode t = map f where f c | ord 'a' <= ord c && ord 'z' >= ord c = chr $ (t + ord c - ord 'a') `mod` 26 + ord 'a' | ord 'A' <= ord c && ord 'Z' >= ord c = chr $ (t + ord c - ord 'A') `mod` 26 + ord 'A' | True = c
abhinav-mehta/CipherSolver
src/CaesarEncode.hs
bsd-3-clause
342
2
15
108
191
92
99
8
1
-- -- AF.hs --- GPIO Alternate Function aliases -- -- Copyright (C) 2013, Galois, Inc. -- All Rights Reserved. -- module Ivory.BSP.STM32F405.GPIO.AF where import Ivory.BSP.STM32.Peripheral.GPIOF4.RegTypes -- These are funky because i did it all with copy paste and regexps based on the -- gpio.h in hwf4. Yeah, disgusting, I know. -- Types ----------------------------------------------------------------------- gpio_af_rtc_50hz :: GPIO_AF gpio_af_mc0 :: GPIO_AF gpio_af_tamper :: GPIO_AF gpio_af_swj :: GPIO_AF gpio_af_trace :: GPIO_AF gpio_af_tim1 :: GPIO_AF gpio_af_tim2 :: GPIO_AF gpio_af_tim3 :: GPIO_AF gpio_af_tim4 :: GPIO_AF gpio_af_tim5 :: GPIO_AF gpio_af_tim8 :: GPIO_AF gpio_af_tim9 :: GPIO_AF gpio_af_tim10 :: GPIO_AF gpio_af_tim11 :: GPIO_AF gpio_af_i2c1 :: GPIO_AF gpio_af_i2c2 :: GPIO_AF gpio_af_i2c3 :: GPIO_AF gpio_af_spi1 :: GPIO_AF gpio_af_spi2 :: GPIO_AF gpio_af_spi3 :: GPIO_AF gpio_af_uart1 :: GPIO_AF gpio_af_uart2 :: GPIO_AF gpio_af_uart3 :: GPIO_AF gpio_af_i2s3ext :: GPIO_AF gpio_af_uart4 :: GPIO_AF gpio_af_uart5 :: GPIO_AF gpio_af_uart6 :: GPIO_AF gpio_af_can1 :: GPIO_AF gpio_af_can2 :: GPIO_AF gpio_af_tim12 :: GPIO_AF gpio_af_tim13 :: GPIO_AF gpio_af_tim14 :: GPIO_AF gpio_af_otg_fs :: GPIO_AF gpio_af_otg_hs :: GPIO_AF gpio_af_eth :: GPIO_AF gpio_af_fsmc :: GPIO_AF gpio_af_otg_hs_fs :: GPIO_AF gpio_af_sdio :: GPIO_AF gpio_af_dcmi :: GPIO_AF gpio_af_eventout :: GPIO_AF -- Definitions ----------------------------------------------------------------- gpio_af_rtc_50hz = gpio_af0 gpio_af_mc0 = gpio_af0 gpio_af_tamper = gpio_af0 gpio_af_swj = gpio_af0 gpio_af_trace = gpio_af0 gpio_af_tim1 = gpio_af1 gpio_af_tim2 = gpio_af1 gpio_af_tim3 = gpio_af2 gpio_af_tim4 = gpio_af2 gpio_af_tim5 = gpio_af2 gpio_af_tim8 = gpio_af3 gpio_af_tim9 = gpio_af3 gpio_af_tim10 = gpio_af3 gpio_af_tim11 = gpio_af3 gpio_af_i2c1 = gpio_af4 gpio_af_i2c2 = gpio_af4 gpio_af_i2c3 = gpio_af4 gpio_af_spi1 = gpio_af5 gpio_af_spi2 = gpio_af5 gpio_af_spi3 = gpio_af6 gpio_af_uart1 = gpio_af7 gpio_af_uart2 = gpio_af7 gpio_af_uart3 = gpio_af7 gpio_af_i2s3ext = gpio_af7 gpio_af_uart4 = gpio_af8 gpio_af_uart5 = gpio_af8 gpio_af_uart6 = gpio_af8 gpio_af_can1 = gpio_af9 gpio_af_can2 = gpio_af9 gpio_af_tim12 = gpio_af9 gpio_af_tim13 = gpio_af9 gpio_af_tim14 = gpio_af9 gpio_af_otg_fs = gpio_af10 gpio_af_otg_hs = gpio_af10 gpio_af_eth = gpio_af11 gpio_af_fsmc = gpio_af12 gpio_af_otg_hs_fs = gpio_af12 gpio_af_sdio = gpio_af12 gpio_af_dcmi = gpio_af13 gpio_af_eventout = gpio_af15
GaloisInc/ivory-tower-stm32
ivory-bsp-stm32/src/Ivory/BSP/STM32F405/GPIO/AF.hs
bsd-3-clause
2,823
0
4
636
428
264
164
82
1
module Magic.Color ( CombColor (..) , colorless , colors , Color1 (..) , fromColor1 , Color2 (..) , color2 , splitColor2 , fromColor2 ) where import Prelude import Data.Maybe -- CombColor data CombColor = CombColor { isWhite :: Bool , isBlue :: Bool , isBlack :: Bool , isRed :: Bool , isGreen :: Bool } deriving (Eq) colorless :: CombColor colorless = CombColor False False False False False colors :: CombColor -> [Color1] colors c = mapMaybe (($c) . maybeColor) [White ..] fromColors :: [Color1] -> CombColor fromColors (White:cs) = (fromColors cs) { isWhite = True } fromColors (Blue :cs) = (fromColors cs) { isBlue = True } fromColors (Black:cs) = (fromColors cs) { isBlack = True } fromColors (Red :cs) = (fromColors cs) { isRed = True } fromColors (Green:cs) = (fromColors cs) { isGreen = True } maybeColor :: Color1 -> CombColor -> Maybe Color1 maybeColor White x = if isWhite x then Just White else Nothing maybeColor Blue x = if isBlue x then Just Blue else Nothing maybeColor Black x = if isBlack x then Just Black else Nothing maybeColor Red x = if isRed x then Just Red else Nothing maybeColor Green x = if isGreen x then Just Green else Nothing -- Color1 data Color1 = White | Blue | Black | Red | Green deriving (Eq, Enum) fromColor1 :: Color1 -> CombColor fromColor1 White = CombColor True False False False False fromColor1 Blue = CombColor False True False False False fromColor1 Black = CombColor False False True False False fromColor1 Red = CombColor False False False True False fromColor1 Green = CombColor False False False False True -- Color2 data Color2 = WU | WB | UB | UR | BR | BG | RG | RW | GW | GU deriving (Eq, Enum) color2 :: Color1 -> Color1 -> Maybe Color2 color2 White Blue = Just WU color2 White Black = Just WB color2 Blue Black = Just UB color2 Blue Red = Just UR color2 Black Red = Just BR color2 Black Green = Just BG color2 Red Green = Just RG color2 Red White = Just RW color2 Green White = Just GW color2 Green Blue = Just GU color2 x y | x == y = Nothing | otherwise = color2 y x splitColor2 :: Color2 -> (Color1, Color1) splitColor2 WU = (White, Blue ) splitColor2 WB = (White, Black) splitColor2 UB = (Blue , Black) splitColor2 UR = (Blue , Red ) splitColor2 BR = (Black, Red ) splitColor2 BG = (Black, Green) splitColor2 RG = (Red , Green) splitColor2 RW = (Red , White) splitColor2 GW = (Green, White) splitColor2 GU = (Green, Blue ) fromColor2 :: Color2 -> CombColor fromColor2 WU = fromColors [White, Blue ] fromColor2 WB = fromColors [White, Black] fromColor2 UB = fromColors [Blue , Black] fromColor2 UR = fromColors [Blue , Red ] fromColor2 BR = fromColors [Black, Red ] fromColor2 BG = fromColors [Black, Green] fromColor2 RG = fromColors [Red , Green] fromColor2 RW = fromColors [Red , White] fromColor2 GW = fromColors [Green, White] fromColor2 GU = fromColors [Green, Blue ] -- Show isntances -- vim: set expandtab:
mkut/libmtg
Magic/Color.hs
bsd-3-clause
3,183
0
9
836
1,153
622
531
94
6
{- This module offers a basic parse for the HaCoTeB project. It will create one single AST node from the entire section containing all the text with no mark-up and no formatting. Useful for debugging and as a safe fallback. -} module HaCoTeB.Parse.BasicParse (basicParse) where import HaCoTeB.Types basicParse :: [String] -> Section basicParse = TextSection . SimpleContent . unwords
mihaimaruseac/HaCoTeB
src/HaCoTeB/Parse/BasicParse.hs
bsd-3-clause
388
0
6
63
43
26
17
4
1
{-# LANGUAGE DeriveDataTypeable #-} {-# LANGUAGE DeriveFoldable #-} {-# LANGUAGE DeriveFunctor #-} {-# LANGUAGE DeriveGeneric #-} {-# LANGUAGE DeriveTraversable #-} {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE GeneralizedNewtypeDeriving #-} {-# LANGUAGE NoMonomorphismRestriction #-} {-# LANGUAGE OverloadedStrings #-} {-# LANGUAGE UndecidableInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} {-# LANGUAGE GADTs #-} {-# LANGUAGE PatternGuards #-} -- | This module contains the data types, operations and -- serialization functions for representing Fixpoint's -- implication (i.e. subtyping) and well-formedness -- constraints in Haskell. The actual constraint -- solving is done by the `fixpoint.native` which -- is written in Ocaml. module Language.Fixpoint.Types.Sorts ( -- * Embedding to Fixpoint Types Sort (..) , Sub (..) , FTycon, TCEmb , sortFTycon , intFTyCon, boolFTyCon, realFTyCon, numFTyCon -- TODO: hide these , intSort, realSort, boolSort, strSort, funcSort , listFTyCon , isListTC , fTyconSymbol, symbolFTycon, fTyconSort , fApp, fApp', fAppTC , fObj , sortSubst , functionSort , mkFFunc ) where import qualified Data.Binary as B import Data.Generics (Data) import Data.Typeable (Typeable) import GHC.Generics (Generic) import Data.Hashable import Data.List (foldl') import Control.DeepSeq import Data.Maybe (fromMaybe) import Language.Fixpoint.Types.Names import Language.Fixpoint.Types.PrettyPrint import Language.Fixpoint.Types.Spans import Language.Fixpoint.Misc import Text.PrettyPrint.HughesPJ import qualified Data.HashMap.Strict as M newtype FTycon = TC LocSymbol deriving (Eq, Ord, Show, Data, Typeable, Generic) type TCEmb a = M.HashMap a FTycon intFTyCon, boolFTyCon, realFTyCon, funcFTyCon, numFTyCon, strFTyCon, listFTyCon :: FTycon intFTyCon = TC $ dummyLoc "int" boolFTyCon = TC $ dummyLoc "bool" realFTyCon = TC $ dummyLoc "real" numFTyCon = TC $ dummyLoc "num" funcFTyCon = TC $ dummyLoc "function" strFTyCon = TC $ dummyLoc strConName listFTyCon = TC $ dummyLoc listConName isListConName :: LocSymbol -> Bool isListConName x = c == listConName || c == listLConName --"List" where c = val x isListTC :: FTycon -> Bool isListTC (TC z) = isListConName z fTyconSymbol :: FTycon -> Located Symbol fTyconSymbol (TC s) = s symbolFTycon :: LocSymbol -> FTycon symbolFTycon c | isListConName c = TC $ fmap (const listConName) c | otherwise = TC c fApp :: Sort -> [Sort] -> Sort fApp = foldl' FApp fAppTC :: FTycon -> [Sort] -> Sort fAppTC = fApp . fTyconSort fApp' :: Sort -> ListNE Sort fApp' = go [] where go acc (FApp t1 t2) = go (t2 : acc) t1 go acc t = t : acc fObj :: LocSymbol -> Sort fObj = fTyconSort . TC sortFTycon :: Sort -> Maybe FTycon sortFTycon FInt = Just intFTyCon sortFTycon FReal = Just realFTyCon sortFTycon FNum = Just numFTyCon sortFTycon (FTC c) = Just c sortFTycon _ = Nothing functionSort :: Sort -> Maybe ([Int], [Sort], Sort) functionSort s | null is && null ss = Nothing | otherwise = Just (is, ss, r) where (is, ss, r) = go [] [] s go vs ss (FAbs i t) = go (i:vs) ss t go vs ss (FFunc s1 s2) = go vs (s1:ss) s2 go vs ss t = (reverse vs, reverse ss, t) ---------------------------------------------------------------------- ------------------------------- Sorts -------------------------------- ---------------------------------------------------------------------- data Sort = FInt | FReal | FNum -- ^ numeric kind for Num tyvars | FFrac -- ^ numeric kind for Fractional tyvars | FObj Symbol -- ^ uninterpreted type | FVar !Int -- ^ fixpoint type variable | FFunc !Sort !Sort -- ^ function | FAbs !Int !Sort -- ^ type-abstraction | FTC FTycon | FApp Sort Sort -- ^ constructed type deriving (Eq, Ord, Show, Data, Typeable, Generic) {-@ FFunc :: Nat -> ListNE Sort -> Sort @-} mkFFunc :: Int -> [Sort] -> Sort mkFFunc i ss = go [0..i-1] ss where go [] [s] = s go [] (s:ss) = FFunc s $ go [] ss go (i:is) ss = FAbs i $ go is ss go _ _ = error "cannot happen" -- foldl (flip FAbs) (foldl1 (flip FFunc) ss) [0..i-1] instance Hashable FTycon where hashWithSalt i (TC s) = hashWithSalt i s instance Hashable Sort newtype Sub = Sub [(Int, Sort)] deriving (Generic) instance Fixpoint Sort where toFix = toFixSort toFixSort :: Sort -> Doc toFixSort (FVar i) = text "@" <> parens (toFix i) toFixSort FInt = text "int" toFixSort FReal = text "real" toFixSort FFrac = text "frac" toFixSort (FObj x) = toFix x toFixSort FNum = text "num" toFixSort t@(FAbs _ _) = toFixAbsApp t toFixSort t@(FFunc _ _)= toFixAbsApp t toFixSort (FTC c) = toFix c toFixSort t@(FApp _ _) = toFixFApp (fApp' t) toFixAbsApp t = text "func" <> parens (toFix n <> text ", " <> toFix ts) where Just (vs, ss, s) = functionSort t n = length vs ts = ss ++ [s] toFixFApp :: ListNE Sort -> Doc toFixFApp [t] = toFixSort t toFixFApp [FTC c, t] | isListTC c = brackets $ toFixSort t toFixFApp ts = parens $ intersperse space (toFixSort <$> ts) instance Fixpoint FTycon where toFix (TC s) = toFix s ------------------------------------------------------------------------- -- | Exported Basic Sorts ----------------------------------------------- ------------------------------------------------------------------------- boolSort, intSort, realSort, strSort, funcSort :: Sort boolSort = fTyconSort boolFTyCon strSort = fTyconSort strFTyCon intSort = fTyconSort intFTyCon realSort = fTyconSort realFTyCon funcSort = fTyconSort funcFTyCon fTyconSort :: FTycon -> Sort fTyconSort c | c == intFTyCon = FInt | c == realFTyCon = FReal | c == numFTyCon = FNum | otherwise = FTC c ------------------------------------------------------------------------ sortSubst :: M.HashMap Symbol Sort -> Sort -> Sort ------------------------------------------------------------------------ sortSubst θ t@(FObj x) = fromMaybe t (M.lookup x θ) sortSubst θ (FFunc t1 t2) = FFunc (sortSubst θ t1) (sortSubst θ t2) sortSubst θ (FApp t1 t2) = FApp (sortSubst θ t1) (sortSubst θ t2) sortSubst θ (FAbs i t) = FAbs i (sortSubst θ t) sortSubst _ t = t instance B.Binary FTycon instance B.Binary Sort instance B.Binary Sub instance NFData FTycon instance NFData Sort instance NFData Sub instance Monoid Sort where mempty = FObj "any" mappend t1 t2 | t1 == mempty = t2 | t2 == mempty = t1 | t1 == t2 = t1 | otherwise = errorstar $ "mappend-sort: conflicting sorts t1 =" ++ show t1 ++ " t2 = " ++ show t2
rolph-recto/liquid-fixpoint
src/Language/Fixpoint/Types/Sorts.hs
bsd-3-clause
7,288
0
10
1,958
2,039
1,078
961
178
4
{-# LANGUAGE CPP #-} {-# LANGUAGE OverloadedStrings #-} {-# LANGUAGE ScopedTypeVariables #-} -- | This widget listens on DBus for Log events from XMonad and -- displays the formatted status string. To log to this widget using -- the excellent dbus-core library, use code like the following: -- -- > import DBus.Client.Simple -- > main = do -- > session <- connectSession -- > emit session "/org/xmonad/Log" "org.xmonad.Log" "Update" [toVariant "msg"] -- -- There is a more complete example of xmonad integration in the -- top-level module. module System.Taffybar.XMonadLog {-# DEPRECATED "Use TaffyPager instead. This module will be removed." #-} ( -- * Constructor xmonadLogNew, -- * Log hooks for xmonad.hs dbusLog, dbusLogWithPP, -- * Styles taffybarPP, taffybarDefaultPP, taffybarColor, taffybarEscape ) where import Codec.Binary.UTF8.String ( decodeString ) import DBus ( toVariant, fromVariant, Signal(..), signal ) import DBus.Client ( listen, matchAny, MatchRule(..), connectSession, emit, Client ) import Graphics.UI.Gtk hiding ( Signal ) import XMonad import XMonad.Hooks.DynamicLog -- | This is a DBus-based logger that can be used from XMonad to log -- to this widget. This version lets you specify the format for the -- log using a pretty printer (e.g., 'taffybarPP'). dbusLogWithPP :: Client -> PP -> X () dbusLogWithPP client pp = dynamicLogWithPP pp { ppOutput = outputThroughDBus client } -- | A DBus-based logger with a default pretty-print configuration dbusLog :: Client -> X () dbusLog client = dbusLogWithPP client taffybarDefaultPP taffybarColor :: String -> String -> String -> String taffybarColor fg bg = wrap t "</span>" . taffybarEscape where t = concat ["<span fgcolor=\"", fg, if null bg then "" else "\" bgcolor=\"" ++ bg , "\">"] -- | Escape strings so that they can be safely displayed by Pango in -- the bar widget taffybarEscape :: String -> String taffybarEscape = escapeMarkup -- | The same as the default PP in XMonad.Hooks.DynamicLog taffybarDefaultPP :: PP taffybarDefaultPP = #if MIN_VERSION_xmonad_contrib(0, 12, 0) def { #else defaultPP { #endif ppCurrent = taffybarEscape . wrap "[" "]" , ppVisible = taffybarEscape . wrap "<" ">" , ppHidden = taffybarEscape , ppHiddenNoWindows = taffybarEscape , ppUrgent = taffybarEscape , ppTitle = taffybarEscape . shorten 80 , ppLayout = taffybarEscape } -- | The same as xmobarPP in XMonad.Hooks.DynamicLog taffybarPP :: PP taffybarPP = taffybarDefaultPP { ppCurrent = taffybarColor "yellow" "" . wrap "[" "]" , ppTitle = taffybarColor "green" "" . shorten 40 , ppVisible = wrap "(" ")" , ppUrgent = taffybarColor "red" "yellow" } outputThroughDBus :: Client -> String -> IO () outputThroughDBus client str = do -- The string that we get from XMonad here isn't quite a normal -- string - each character is actually a byte in a utf8 encoding. -- We need to decode the string back into a real String before we -- send it over dbus. let str' = decodeString str emit client (signal "/org/xmonad/Log" "org.xmonad.Log" "Update") { signalBody = [ toVariant str' ] } setupDbus :: Label -> IO () setupDbus w = do let matcher = matchAny { matchSender = Nothing , matchDestination = Nothing , matchPath = Just "/org/xmonad/Log" , matchInterface = Just "org.xmonad.Log" , matchMember = Just "Update" } client <- connectSession listen client matcher (callback w) callback :: Label -> Signal -> IO () callback w sig = do let [bdy] = signalBody sig status :: String Just status = fromVariant bdy postGUIAsync $ labelSetMarkup w status -- | Return a new XMonad log widget xmonadLogNew :: IO Widget xmonadLogNew = do l <- labelNew (Nothing :: Maybe String) _ <- on l realize $ setupDbus l widgetShowAll l return (toWidget l) {-# DEPRECATED xmonadLogNew "Use taffyPagerNew instead." #-}
Undeterminant/taffybar
src/System/Taffybar/XMonadLog.hs
bsd-3-clause
4,193
0
12
1,042
764
424
340
67
2
{-# LANGUAGE ExistentialQuantification #-} {-# language DataKinds #-} {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} {-# LANGUAGE OverloadedStrings #-} {-# LANGUAGE QuasiQuotes #-} {-# LANGUAGE TemplateHaskell #-} {-# LANGUAGE TypeFamilies #-} {-# LANGUAGE UndecidableInstances #-} {-# LANGUAGE StandaloneDeriving #-} {-# LANGUAGE DerivingStrategies #-} {-# LANGUAGE RecordWildCards #-} {-# LANGUAGE GeneralizedNewtypeDeriving #-} module JSONTest where import Control.Monad.IO.Class (MonadIO) import Data.Aeson hiding (Key) import qualified Data.Vector as V (fromList) import Test.HUnit (assertBool) import Test.Hspec.Expectations () import Database.Persist import Database.Persist.Postgresql.JSON import PgInit share [mkPersist persistSettings, mkMigrate "jsonTestMigrate"] [persistLowerCase| TestValue json Value deriving Show |] cleanDB :: (BaseBackend backend ~ SqlBackend, PersistQueryWrite backend, MonadIO m) => ReaderT backend m () cleanDB = deleteWhere ([] :: [Filter TestValue]) emptyArr :: Value emptyArr = toJSON ([] :: [Value]) insert' :: (MonadIO m, PersistStoreWrite backend, BaseBackend backend ~ SqlBackend) => Value -> ReaderT backend m (Key TestValue) insert' = insert . TestValue matchKeys :: (Show record, Show (Key record), MonadIO m, Eq (Key record)) => [Key record] -> [Entity record] -> m () matchKeys ys xs = do msg1 `assertBoolIO` (xLen == yLen) forM_ ys $ \y -> msg2 y `assertBoolIO` (y `elem` ks) where ks = entityKey <$> xs xLen = length xs yLen = length ys msg1 = mconcat [ "\nexpected: ", show yLen , "\n but got: ", show xLen , "\n[xs: ", show xs, "]" , "\n[ys: ", show ys, "]" ] msg2 y = mconcat [ "key \"", show y , "\" not in result:\n ", show ks ] setup :: IO TestKeys setup = asIO $ runConn_ $ do void $ runMigrationSilent jsonTestMigrate testKeys teardown :: IO () teardown = asIO $ runConn_ $ do cleanDB shouldBeIO :: (Show a, Eq a, MonadIO m) => a -> a -> m () shouldBeIO x y = liftIO $ shouldBe x y assertBoolIO :: MonadIO m => String -> Bool -> m () assertBoolIO s b = liftIO $ assertBool s b testKeys :: (Monad m, MonadIO m) => ReaderT SqlBackend m TestKeys testKeys = do nullK <- insert' Null boolTK <- insert' $ Bool True boolFK <- insert' $ toJSON False num0K <- insert' $ Number 0 num1K <- insert' $ Number 1 numBigK <- insert' $ toJSON (1234567890 :: Int) numFloatK <- insert' $ Number 0.0 numSmallK <- insert' $ Number 0.0000000000000000123 numFloat2K <- insert' $ Number 1.5 -- numBigFloatK will turn into 9876543210.123457 because JSON numBigFloatK <- insert' $ toJSON (9876543210.123456789 :: Double) strNullK <- insert' $ String "" strObjK <- insert' $ String "{}" strArrK <- insert' $ String "[]" strAK <- insert' $ String "a" strTestK <- insert' $ toJSON ("testing" :: Text) str2K <- insert' $ String "2" strFloatK <- insert' $ String "0.45876" arrNullK <- insert' $ Array $ V.fromList [] arrListK <- insert' $ toJSON [emptyArr,emptyArr,toJSON [emptyArr,emptyArr]] arrList2K <- insert' $ toJSON [emptyArr,toJSON [Number 3,Bool False] ,toJSON [emptyArr,toJSON [Object mempty]] ] arrFilledK <- insert' $ toJSON [Null, Number 4, String "b" ,Object mempty, emptyArr ,object [ "test" .= [Null], "test2" .= String "yes"] ] arrList3K <- insert' $ toJSON [toJSON [String "a"], Number 1] arrList4K <- insert' $ toJSON [String "a", String "b", String "c", String "d"] objNullK <- insert' $ Object mempty objTestK <- insert' $ object ["test" .= Null, "test1" .= String "no"] objDeepK <- insert' $ object ["c" .= Number 24.986, "foo" .= object ["deep1" .= Bool True]] objEmptyK <- insert' $ object ["" .= Number 9001] objFullK <- insert' $ object ["a" .= Number 1, "b" .= Number 2 ,"c" .= Number 3, "d" .= Number 4 ] return TestKeys{..} data TestKeys = TestKeys { nullK :: Key TestValue , boolTK :: Key TestValue , boolFK :: Key TestValue , num0K :: Key TestValue , num1K :: Key TestValue , numBigK :: Key TestValue , numFloatK :: Key TestValue , numSmallK :: Key TestValue , numFloat2K :: Key TestValue , numBigFloatK :: Key TestValue , strNullK :: Key TestValue , strObjK :: Key TestValue , strArrK :: Key TestValue , strAK :: Key TestValue , strTestK :: Key TestValue , str2K :: Key TestValue , strFloatK :: Key TestValue , arrNullK :: Key TestValue , arrListK :: Key TestValue , arrList2K :: Key TestValue , arrFilledK :: Key TestValue , objNullK :: Key TestValue , objTestK :: Key TestValue , objDeepK :: Key TestValue , arrList3K :: Key TestValue , arrList4K :: Key TestValue , objEmptyK :: Key TestValue , objFullK :: Key TestValue } deriving (Eq, Ord, Show) specs :: Spec specs = afterAll_ teardown $ do beforeAll setup $ do describe "Testing JSON operators" $ do describe "@>. object queries" $ do it "matches an empty Object with any object" $ \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. Object mempty] [] [objNullK, objTestK, objDeepK, objEmptyK, objFullK] `matchKeys` vals it "matches a subset of object properties" $ -- {test: null, test1: no} @>. {test: null} == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. object ["test" .= Null]] [] [objTestK] `matchKeys` vals it "matches a nested object against an empty object at the same key" $ -- {c: 24.986, foo: {deep1: true}} @>. {foo: {}} == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. object ["foo" .= object []]] [] [objDeepK] `matchKeys` vals it "doesn't match a nested object against a string at the same key" $ -- {c: 24.986, foo: {deep1: true}} @>. {foo: nope} == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. object ["foo" .= String "nope"]] [] [] `matchKeys` vals it "matches a nested object when the query object is identical" $ -- {c: 24.986, foo: {deep1: true}} @>. {foo: {deep1: true}} == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. (object ["foo" .= object ["deep1" .= True]])] [] [objDeepK] `matchKeys` vals it "doesn't match a nested object when queried with that exact object" $ -- {c: 24.986, foo: {deep1: true}} @>. {deep1: true} == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. object ["deep1" .= True]] [] [] `matchKeys` vals describe "@>. array queries" $ do it "matches an empty Array with any list" $ \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. emptyArr] [] [arrNullK, arrListK, arrList2K, arrFilledK, arrList3K, arrList4K] `matchKeys` vals it "matches list when queried with subset (1 item)" $ -- [null, 4, 'b', {}, [], {test: [null], test2: 'yes'}] @>. [4] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. toJSON [4 :: Int]] [] [arrFilledK] `matchKeys` vals it "matches list when queried with subset (2 items)" $ -- [null, 4, 'b', {}, [], {test: [null], test2: 'yes'}] @>. [null,'b'] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. toJSON [Null, String "b"]] [] [arrFilledK] `matchKeys` vals it "doesn't match list when queried with intersecting list (1 match, 1 diff)" $ -- [null, 4, 'b', {}, [], {test: [null], test2: 'yes'}] @>. [null,'d'] == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. toJSON [emptyArr, String "d"]] [] [] `matchKeys` vals it "matches list when queried with same list in different order" $ -- [null, 4, 'b', {}, [], {test: [null], test2: 'yes'}] @>. -- [[],'b',{test: [null],test2: 'yes'},4,null,{}] == True \TestKeys {..} -> runConnAssert $ do let queryList = toJSON [ emptyArr, String "b" , object [ "test" .= [Null], "test2" .= String "yes"] , Number 4, Null, Object mempty ] vals <- selectList [TestValueJson @>. queryList ] [] [arrFilledK] `matchKeys` vals it "doesn't match list when queried with same list + 1 item" $ -- [null,4,'b',{},[],{test:[null],test2:'yes'}] @>. -- [null,4,'b',{},[],{test:[null],test2: 'yes'}, false] == False \TestKeys {..} -> runConnAssert $ do let testList = toJSON [ Null, Number 4, String "b", Object mempty, emptyArr , object [ "test" .= [Null], "test2" .= String "yes"] , Bool False ] vals <- selectList [TestValueJson @>. testList] [] [] `matchKeys` vals it "matches list when it shares an empty object with the query list" $ -- [null,4,'b',{},[],{test: [null],test2: 'yes'}] @>. [{}] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. toJSON [Object mempty]] [] [arrFilledK] `matchKeys` vals it "matches list with nested list, when queried with an empty nested list" $ -- [null,4,'b',{},[],{test:[null],test2:'yes'}] @>. [{test:[]}] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. toJSON [object ["test" .= emptyArr]]] [] [arrFilledK] `matchKeys` vals it "doesn't match list with nested list, when queried with a diff. nested list" $ -- [null,4,"b",{},[],{"test":[null],"test2":"yes"}] @>. -- [{"test1":[null]}] == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. toJSON [object ["test1" .= [Null]]]] [] [] `matchKeys` vals it "matches many nested lists when queried with empty nested list" $ -- [[],[],[[],[]]] @>. [[]] == True -- [[],[3,false],[[],[{}]]] @>. [[]] == True -- [null,4,"b",{},[],{"test":[null],"test2":"yes"}] @>. [[]] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. toJSON [emptyArr]] [] [arrListK,arrList2K,arrFilledK, arrList3K] `matchKeys` vals it "matches nested list when queried with a subset of that list" $ -- [[],[3,false],[[],[{}]]] @>. [[3]] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. toJSON [[3 :: Int]]] [] [arrList2K] `matchKeys` vals it "doesn't match nested list againts a partial intersection of that list" $ -- [[],[3,false],[[],[{}]]] @>. [[true,3]] == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. toJSON [[Bool True, Number 3]]] [] [] `matchKeys` vals it "matches list when queried with raw number contained in the list" $ -- [null,4,"b",{},[],{"test":[null],"test2":"yes"}] @>. 4 == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. Number 4] [] [arrFilledK] `matchKeys` vals it "doesn't match list when queried with raw value not contained in the list" $ -- [null,4,"b",{},[],{"test":[null],"test2":"yes"}] @>. 99 == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. Number 99] [] [] `matchKeys` vals it "matches list when queried with raw string contained in the list" $ -- [null,4,"b",{},[],{"test":[null],"test2":"yes"}] @>. "b" == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. String "b"] [] [arrFilledK, arrList4K] `matchKeys` vals it "doesn't match list with empty object when queried with \"{}\" " $ -- [null,4,"b",{},[],{"test":[null],"test2":"yes"}] @>. "{}" == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. String "{}"] [] [strObjK] `matchKeys` vals it "doesnt match list with nested object when queried with object (not in list)" $ -- [null,4,"b",{},[],{"test":[null],"test2":"yes"}] @>. -- {"test":[null],"test2":"yes"} == False \TestKeys {..} -> runConnAssert $ do let queryObject = object [ "test" .= [Null], "test2" .= String "yes"] vals <- selectList [TestValueJson @>. queryObject ] [] [] `matchKeys` vals describe "@>. string queries" $ do it "matches identical strings" $ -- "testing" @>. "testing" == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. String "testing"] [] [strTestK] `matchKeys` vals it "doesnt match case insensitive" $ -- "testing" @>. "Testing" == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. String "Testing"] [] [] `matchKeys` vals it "doesn't match substrings" $ -- "testing" @>. "test" == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. String "test"] [] [] `matchKeys` vals it "doesn't match strings with object keys" $ -- "testing" @>. {"testing":1} == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. object ["testing" .= Number 1]] [] [] `matchKeys` vals describe "@>. number queries" $ do it "matches identical numbers" $ -- 1 @>. 1 == True -- [1] @>. 1 == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. toJSON (1 :: Int)] [] [num1K, arrList3K] `matchKeys` vals it "matches numbers when queried with float" $ -- 0 @>. 0.0 == True -- 0.0 @>. 0.0 == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. toJSON (0.0 :: Double)] [] [num0K,numFloatK] `matchKeys` vals it "does not match numbers when queried with a substring of that number" $ -- 1234567890 @>. 123456789 == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. toJSON (123456789 :: Int)] [] [] `matchKeys` vals it "does not match number when queried with different number" $ -- 1234567890 @>. 234567890 == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. toJSON (234567890 :: Int)] [] [] `matchKeys` vals it "does not match number when queried with string of that number" $ -- 1 @>. "1" == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. String "1"] [] [] `matchKeys` vals it "does not match number when queried with list of digits" $ -- 1234567890 @>. [1,2,3,4,5,6,7,8,9,0] == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. toJSON ([1,2,3,4,5,6,7,8,9,0] :: [Int])] [] [] `matchKeys` vals describe "@>. boolean queries" $ do it "matches identical booleans (True)" $ -- true @>. true == True -- false @>. true == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. toJSON True] [] [boolTK] `matchKeys` vals it "matches identical booleans (False)" $ -- false @>. false == True -- true @>. false == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. Bool False] [] [boolFK] `matchKeys` vals it "does not match boolean with string of boolean" $ -- true @>. "true" == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. String "true"] [] [] `matchKeys` vals describe "@>. null queries" $ do it "matches nulls" $ -- null @>. null == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. Null] [] [nullK,arrFilledK] `matchKeys` vals it "does not match null with string of null" $ -- null @>. "null" == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson @>. String "null"] [] [] `matchKeys` vals describe "<@. queries" $ do it "matches subobject when queried with superobject" $ -- {} <@. {"test":null,"test1":"no","blabla":[]} == True -- {"test":null,"test1":"no"} <@. {"test":null,"test1":"no","blabla":[]} == True \TestKeys {..} -> runConnAssert $ do let queryObject = object ["test" .= Null , "test1" .= String "no" , "blabla" .= emptyArr ] vals <- selectList [TestValueJson <@. queryObject] [] [objNullK,objTestK] `matchKeys` vals it "matches raw values and sublists when queried with superlist" $ -- [] <@. [null,4,"b",{},[],{"test":[null],"test2":"yes"},false] == True -- null <@. [null,4,"b",{},[],{"test":[null],"test2":"yes"},false] == True -- false <@. [null,4,"b",{},[],{"test":[null],"test2":"yes"},false] == True -- [null,4,"b",{},[],{"test":[null],"test2":"yes"}] <@. -- [null,4,"b",{},[],{"test":[null],"test2":"yes"},false] == True \TestKeys {..} -> runConnAssert $ do let queryList = toJSON [ Null, Number 4, String "b", Object mempty, emptyArr , object [ "test" .= [Null], "test2" .= String "yes"] , Bool False ] vals <- selectList [TestValueJson <@. queryList ] [] [arrNullK,arrFilledK,boolFK,nullK] `matchKeys` vals it "matches identical strings" $ -- "a" <@. "a" == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson <@. String "a"] [] [strAK] `matchKeys` vals it "matches identical big floats" $ -- 9876543210.123457 <@ 9876543210.123457 == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson <@. Number 9876543210.123457] [] [numBigFloatK] `matchKeys` vals it "doesn't match different big floats" $ -- 9876543210.123457 <@. 9876543210.123456789 == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson <@. Number 9876543210.123456789] [] [] `matchKeys` vals it "matches nulls" $ -- null <@. null == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson <@. Null] [] [nullK] `matchKeys` vals describe "?. queries" $ do it "matches top level keys and not the keys of nested objects" $ -- {"test":null,"test1":"no"} ?. "test" == True -- [null,4,"b",{},[],{"test":[null],"test2":"yes"}] ?. "test" == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?. "test"] [] [objTestK] `matchKeys` vals it "doesn't match nested key" $ -- {"c":24.986,"foo":{"deep1":true"}} ?. "deep1" == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?. "deep1"] [] [] `matchKeys` vals it "matches \"{}\" but not empty object when queried with \"{}\"" $ -- "{}" ?. "{}" == True -- {} ?. "{}" == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?. "{}"] [] [strObjK] `matchKeys` vals it "matches raw empty str and empty str key when queried with \"\"" $ ---- {} ?. "" == False ---- "" ?. "" == True ---- {"":9001} ?. "" == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?. ""] [] [strNullK,objEmptyK] `matchKeys` vals it "matches lists containing string value when queried with raw string value" $ -- [null,4,"b",{},[],{"test":[null],"test2":"yes"}] ?. "b" == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?. "b"] [] [arrFilledK,arrList4K,objFullK] `matchKeys` vals it "matches lists, objects, and raw values correctly when queried with string" $ -- [["a"]] ?. "a" == False -- "a" ?. "a" == True -- ["a","b","c","d"] ?. "a" == True -- {"a":1,"b":2,"c":3,"d":4} ?. "a" == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?. "a"] [] [strAK,arrList4K,objFullK] `matchKeys` vals it "matches string list but not real list when queried with \"[]\"" $ -- "[]" ?. "[]" == True -- [] ?. "[]" == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?. "[]"] [] [strArrK] `matchKeys` vals it "does not match null when queried with string null" $ -- null ?. "null" == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?. "null"] [] [] `matchKeys` vals it "does not match bool whe nqueried with string bool" $ -- true ?. "true" == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?. "true"] [] [] `matchKeys` vals describe "?|. queries" $ do it "matches raw vals, lists, objects, and nested objects" $ -- "a" ?|. ["a","b","c"] == True -- [["a"],1] ?|. ["a","b","c"] == False -- [null,4,"b",{},[],{"test":[null],"test2":"yes"}] ?|. ["a","b","c"] == True -- ["a","b","c","d"] ?|. ["a","b","c"] == True -- {"a":1,"b":2,"c":3,"d":4} ?|. ["a","b","c"] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?|. ["a","b","c"]] [] [strAK,arrFilledK,objDeepK,arrList4K,objFullK] `matchKeys` vals it "matches str object but not object when queried with \"{}\"" $ -- "{}" ?|. ["{}"] == True -- {} ?|. ["{}"] == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?|. ["{}"]] [] [strObjK] `matchKeys` vals it "doesn't match superstrings when queried with substring" $ -- [null,4,"b",{},[],{"test":[null],"test2":"yes"}] ?|. ["test"] == False -- "testing" ?|. ["test"] == False -- {"test":null,"test1":"no"} ?|. ["test"] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?|. ["test"]] [] [objTestK] `matchKeys` vals it "doesn't match nested keys" $ -- {"c":24.986,"foo":{"deep1":true"}} ?|. ["deep1"] == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?|. ["deep1"]] [] [] `matchKeys` vals it "doesn't match anything when queried with empty list" $ -- ANYTHING ?|. [] == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?|. []] [] [] `matchKeys` vals it "doesn't match raw, non-string, values when queried with strings" $ -- true ?|. ["true","null","1"] == False -- null ?|. ["true","null","1"] == False -- 1 ?|. ["true","null","1"] == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?|. ["true","null","1"]] [] [] `matchKeys` vals it "matches string array when queried with \"[]\"" $ -- [] ?|. ["[]"] == False -- "[]" ?|. ["[]"] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?|. ["[]"]] [] [strArrK] `matchKeys` vals describe "?&. queries" $ do it "matches anything when queried with an empty list" $ -- ANYTHING ?&. [] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?&. []] [] flip matchKeys vals [ nullK , boolTK, boolFK , num0K, num1K, numBigK, numFloatK , numSmallK, numFloat2K, numBigFloatK , strNullK, strObjK, strArrK, strAK , strTestK, str2K, strFloatK , arrNullK, arrListK, arrList2K , arrFilledK, arrList3K, arrList4K , objNullK, objTestK, objDeepK , objEmptyK, objFullK ] it "matches raw values, lists, and objects when queried with string" $ -- "a" ?&. ["a"] == True -- [["a"],1] ?&. ["a"] == False -- ["a","b","c","d"] ?&. ["a"] == True -- {"a":1,"b":2,"c":3,"d":4} ?&. ["a"] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?&. ["a"]] [] [strAK,arrList4K,objFullK] `matchKeys` vals it "matches raw values, lists, and objects when queried with multiple string" $ -- [null,4,"b",{},[],{"test":[null],"test2":"yes"}] ?&. ["b","c"] == False -- {"c":24.986,"foo":{"deep1":true"}} ?&. ["b","c"] == False -- ["a","b","c","d"] ?&. ["b","c"] == True -- {"a":1,"b":2,"c":3,"d":4} ?&. ["b","c"] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?&. ["b","c"]] [] [arrList4K,objFullK] `matchKeys` vals it "matches object string when queried with \"{}\"" $ -- {} ?&. ["{}"] == False -- "{}" ?&. ["{}"] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?&. ["{}"]] [] [strObjK] `matchKeys` vals it "doesn't match superstrings when queried with substring" $ -- [null,4,"b",{},[],{"test":[null],"test2":"yes"}] ?&. ["test"] == False -- "testing" ?&. ["test"] == False -- {"test":null,"test1":"no"} ?&. ["test"] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?&. ["test"]] [] [objTestK] `matchKeys` vals it "doesn't match nested keys" $ -- {"c":24.986,"foo":{"deep1":true"}} ?&. ["deep1"] == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?&. ["deep1"]] [] [] `matchKeys` vals it "doesn't match anything when there is a partial match" $ -- "a" ?&. ["a","e"] == False -- ["a","b","c","d"] ?&. ["a","e"] == False -- {"a":1,"b":2,"c":3,"d":4} ?&. ["a","e"] == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?&. ["a","e"]] [] [] `matchKeys` vals it "matches string array when queried with \"[]\"" $ -- [] ?&. ["[]"] == False -- "[]" ?&. ["[]"] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?&. ["[]"]] [] [strArrK] `matchKeys` vals it "doesn't match null when queried with string null" $ -- THIS WILL FAIL IF THE IMPLEMENTATION USES -- @ '{null}' @ -- INSTEAD OF -- @ ARRAY['null'] @ -- null ?&. ["null"] == False \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?&. ["null"]] [] [] `matchKeys` vals it "doesn't match number when queried with str of that number" $ -- [["a"],1] ?&. ["1"] == False -- "1" ?&. ["1"] == True \TestKeys {..} -> runConnAssert $ do str1 <- insert' $ toJSON $ String "1" vals <- selectList [TestValueJson ?&. ["1"]] [] [str1] `matchKeys` vals it "doesn't match empty objs or list when queried with empty string" $ -- {} ?&. [""] == False -- [] ?&. [""] == False -- "" ?&. [""] == True -- {"":9001} ?&. [""] == True \TestKeys {..} -> runConnAssert $ do vals <- selectList [TestValueJson ?&. [""]] [] [strNullK,objEmptyK] `matchKeys` vals
paul-rouse/persistent
persistent-postgresql/test/JSONTest.hs
mit
30,939
0
32
10,584
6,842
3,524
3,318
448
1
{-# LANGUAGE TypeApplications #-} module Lamdu.Sugar.Convert.PostProcess ( Result(..), def, expr , makeScheme ) where import qualified Control.Lens as Lens import Data.Property (MkProperty') import qualified Data.Property as Property import Hyper import Hyper.Syntax.Scheme (saveScheme) import Hyper.Unify (UVar) import Hyper.Unify.Generalize (generalize) import Lamdu.Calc.Infer (runPureInfer) import qualified Lamdu.Calc.Term as V import qualified Lamdu.Calc.Type as T import qualified Lamdu.Data.Definition as Definition import qualified Lamdu.Debug as Debug import Lamdu.Expr.IRef (DefI, ValI, HRef) import qualified Lamdu.Expr.IRef as ExprIRef import qualified Lamdu.Expr.Load as ExprLoad import qualified Lamdu.Sugar.Convert.Input as Input import qualified Lamdu.Sugar.Convert.Load as Load import Revision.Deltum.Transaction (Transaction) import qualified Revision.Deltum.Transaction as Transaction import Lamdu.Prelude type T = Transaction data Result = GoodExpr | BadExpr (Pure # T.TypeError) makeScheme :: Load.InferOut m -> Either (Pure # T.TypeError) (Pure # T.Scheme) makeScheme (Load.InferOut inferredVal inferContext) = generalize (inferredVal ^. hAnn . Input.inferredTypeUVar) >>= saveScheme & runPureInfer @(V.Scope # UVar) V.emptyScope inferContext <&> (^. _1) def :: Monad m => Load.InferFunc (HRef m) -> Debug.Monitors -> DefI m -> T m Result def infer monitors defI = do loadedDef <- ExprLoad.def defI <&> void case loadedDef ^. Definition.defBody of Definition.BodyBuiltin {} -> pure GoodExpr Definition.BodyExpr defExpr -> ExprIRef.globalId defI & Load.inferDef infer monitors defExpr >>= makeScheme & \case Left err -> BadExpr err & pure Right scheme -> GoodExpr <$ ( loadedDef & Definition.defType .~ scheme & Definition.defBody . Definition._BodyExpr . Definition.exprFrozenDeps .~ Definition.pruneDefExprDeps defExpr & Definition.defBody . Lens.mapped %~ (^. hAnn . ExprIRef.iref) & Transaction.writeIRef defI ) expr :: Monad m => Load.InferFunc (HRef m) -> Debug.Monitors -> MkProperty' (T m) (Definition.Expr (ValI m)) -> T m Result expr infer monitors prop = do defExprLoaded <- ExprLoad.defExpr prop -- TODO: This is code duplication with the above Load.inferCheckDef -- & functions inside Load itself let inferred = Load.inferDefExpr infer monitors defExprLoaded case inferred of Left err -> BadExpr err & pure Right _ -> GoodExpr <$ Property.modP prop (Definition.exprFrozenDeps .~ Definition.pruneDefExprDeps defExprLoaded)
lamdu/lamdu
src/Lamdu/Sugar/Convert/PostProcess.hs
gpl-3.0
3,092
0
26
947
760
417
343
-1
-1
{-# LANGUAGE DataKinds #-} {-# LANGUAGE DeriveGeneric #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE GeneralizedNewtypeDeriving #-} {-# LANGUAGE LambdaCase #-} {-# LANGUAGE NoImplicitPrelude #-} {-# LANGUAGE OverloadedStrings #-} {-# LANGUAGE RecordWildCards #-} {-# LANGUAGE TypeFamilies #-} {-# OPTIONS_GHC -fno-warn-unused-imports #-} -- Module : Network.AWS.ELB.CreateLBCookieStickinessPolicy -- Copyright : (c) 2013-2014 Brendan Hay <brendan.g.hay@gmail.com> -- License : This Source Code Form is subject to the terms of -- the Mozilla Public License, v. 2.0. -- A copy of the MPL can be found in the LICENSE file or -- you can obtain it at http://mozilla.org/MPL/2.0/. -- Maintainer : Brendan Hay <brendan.g.hay@gmail.com> -- Stability : experimental -- Portability : non-portable (GHC extensions) -- -- Derived from AWS service descriptions, licensed under Apache 2.0. -- | Generates a stickiness policy with sticky session lifetimes controlled by -- the lifetime of the browser (user-agent) or a specified expiration period. -- This policy can be associated only with HTTP/HTTPS listeners. -- -- When a load balancer implements this policy, the load balancer uses a -- special cookie to track the backend server instance for each request. When -- the load balancer receives a request, it first checks to see if this cookie -- is present in the request. If so, the load balancer sends the request to the -- application server specified in the cookie. If not, the load balancer sends -- the request to a server that is chosen based on the existing load balancing -- algorithm. -- -- A cookie is inserted into the response for binding subsequent requests from -- the same user to that server. The validity of the cookie is based on the -- cookie expiration time, which is specified in the policy configuration. -- -- For more information, see <http://docs.aws.amazon.com/ElasticLoadBalancing/latest/DeveloperGuide/US_StickySessions.html#US_EnableStickySessionsLBCookies Enabling Duration-Based Session Stickiness> in the /Elastic Load Balancing Developer Guide/. -- -- <http://docs.aws.amazon.com/ElasticLoadBalancing/latest/APIReference/API_CreateLBCookieStickinessPolicy.html> module Network.AWS.ELB.CreateLBCookieStickinessPolicy ( -- * Request CreateLBCookieStickinessPolicy -- ** Request constructor , createLBCookieStickinessPolicy -- ** Request lenses , clbcspCookieExpirationPeriod , clbcspLoadBalancerName , clbcspPolicyName -- * Response , CreateLBCookieStickinessPolicyResponse -- ** Response constructor , createLBCookieStickinessPolicyResponse ) where import Network.AWS.Prelude import Network.AWS.Request.Query import Network.AWS.ELB.Types import qualified GHC.Exts data CreateLBCookieStickinessPolicy = CreateLBCookieStickinessPolicy { _clbcspCookieExpirationPeriod :: Maybe Integer , _clbcspLoadBalancerName :: Text , _clbcspPolicyName :: Text } deriving (Eq, Ord, Read, Show) -- | 'CreateLBCookieStickinessPolicy' constructor. -- -- The fields accessible through corresponding lenses are: -- -- * 'clbcspCookieExpirationPeriod' @::@ 'Maybe' 'Integer' -- -- * 'clbcspLoadBalancerName' @::@ 'Text' -- -- * 'clbcspPolicyName' @::@ 'Text' -- createLBCookieStickinessPolicy :: Text -- ^ 'clbcspLoadBalancerName' -> Text -- ^ 'clbcspPolicyName' -> CreateLBCookieStickinessPolicy createLBCookieStickinessPolicy p1 p2 = CreateLBCookieStickinessPolicy { _clbcspLoadBalancerName = p1 , _clbcspPolicyName = p2 , _clbcspCookieExpirationPeriod = Nothing } -- | The time period in seconds after which the cookie should be considered -- stale. Not specifying this parameter indicates that the sticky session will -- last for the duration of the browser session. clbcspCookieExpirationPeriod :: Lens' CreateLBCookieStickinessPolicy (Maybe Integer) clbcspCookieExpirationPeriod = lens _clbcspCookieExpirationPeriod (\s a -> s { _clbcspCookieExpirationPeriod = a }) -- | The name associated with the load balancer. clbcspLoadBalancerName :: Lens' CreateLBCookieStickinessPolicy Text clbcspLoadBalancerName = lens _clbcspLoadBalancerName (\s a -> s { _clbcspLoadBalancerName = a }) -- | The name of the policy being created. The name must be unique within the set -- of policies for this load balancer. clbcspPolicyName :: Lens' CreateLBCookieStickinessPolicy Text clbcspPolicyName = lens _clbcspPolicyName (\s a -> s { _clbcspPolicyName = a }) data CreateLBCookieStickinessPolicyResponse = CreateLBCookieStickinessPolicyResponse deriving (Eq, Ord, Read, Show, Generic) -- | 'CreateLBCookieStickinessPolicyResponse' constructor. createLBCookieStickinessPolicyResponse :: CreateLBCookieStickinessPolicyResponse createLBCookieStickinessPolicyResponse = CreateLBCookieStickinessPolicyResponse instance ToPath CreateLBCookieStickinessPolicy where toPath = const "/" instance ToQuery CreateLBCookieStickinessPolicy where toQuery CreateLBCookieStickinessPolicy{..} = mconcat [ "CookieExpirationPeriod" =? _clbcspCookieExpirationPeriod , "LoadBalancerName" =? _clbcspLoadBalancerName , "PolicyName" =? _clbcspPolicyName ] instance ToHeaders CreateLBCookieStickinessPolicy instance AWSRequest CreateLBCookieStickinessPolicy where type Sv CreateLBCookieStickinessPolicy = ELB type Rs CreateLBCookieStickinessPolicy = CreateLBCookieStickinessPolicyResponse request = post "CreateLBCookieStickinessPolicy" response = nullResponse CreateLBCookieStickinessPolicyResponse
kim/amazonka
amazonka-elb/gen/Network/AWS/ELB/CreateLBCookieStickinessPolicy.hs
mpl-2.0
5,829
0
9
1,096
484
301
183
61
1
-- by Kirill Elagin largest_number :: [Int] -> String largest_number as = concat (map show as) -- write your code here main :: IO () main = do _ <- getLine as <- fmap (map read . words) getLine putStrLn $ largest_number as
xunilrj/sandbox
courses/coursera-sandiego-algorithms/algorithmic-toolbox/assignment002/largest_number/largest_number.hs
apache-2.0
232
0
11
52
88
43
45
7
1
{- This example takes logstash messages from a redis queue and stores them into elasticsearch. It will print to stdout all errors. -} module Main where import System.Environment (getArgs) import Control.Monad (when) import Data.Conduit import qualified Data.Conduit.List as CL import Data.Conduit.ElasticSearch import Data.Conduit.Redis import Logstash.Message import Control.Monad.IO.Class (liftIO) import Data.Aeson import qualified Data.ByteString.Char8 as BS import qualified Data.ByteString.Lazy.Char8 as BSL import Data.Maybe (mapMaybe) import Data.Conduit.Misc endsink :: (MonadResource m) => Either (LogstashMessage, Value) Value -> m () endsink (Left x) = liftIO (print x) endsink _ = return () main :: IO () main = do args <- getArgs when (length args /= 5) (error "Usage: redis2es redishost redisport redislist eshost esport") let [redishost, redisport, redislist, eshost, esport] = args runResourceT $ redisSource redishost (read redisport) (BS.pack redislist) 100 1 $= concatFlush 100 -- convert to a flush conduit $= mapFlushMaybe (decode . BSL.fromStrict) -- decode the json messages $= groupFlush -- regroup lists $= esConduit Nothing (BS.pack eshost) (read esport) "logstash" -- send to ES $$ CL.mapM_ (mapM_ endsink)
bartavelle/hslogstash
examples/RedisToElasticsearch.hs
bsd-3-clause
1,362
0
16
297
354
196
158
28
1
module Types ( Point, Line, IPoint, ILine ) where type Point = (Double,Double) type Line = (Point,Point) type IPoint = (Int,Point) type ILine = (IPoint,IPoint)
mainland/dph
icebox/examples/delaunay/Types.hs
bsd-3-clause
165
0
5
30
66
44
22
5
0
{- (c) The GRASP/AQUA Project, Glasgow University, 1992-1998 \section[StgSyn]{Shared term graph (STG) syntax for spineless-tagless code generation} This data type represents programs just before code generation (conversion to @Cmm@): basically, what we have is a stylised form of @CoreSyntax@, the style being one that happens to be ideally suited to spineless tagless code generation. -} {-# LANGUAGE CPP #-} module StgSyn ( GenStgArg(..), GenStgTopBinding(..), GenStgBinding(..), GenStgExpr(..), GenStgRhs(..), GenStgAlt, AltType(..), UpdateFlag(..), isUpdatable, StgBinderInfo, noBinderInfo, stgSatOcc, stgUnsatOcc, satCallsOnly, combineStgBinderInfo, -- a set of synonyms for the most common (only :-) parameterisation StgArg, StgTopBinding, StgBinding, StgExpr, StgRhs, StgAlt, -- a set of synonyms to distinguish in- and out variants InStgArg, InStgTopBinding, InStgBinding, InStgExpr, InStgRhs, InStgAlt, OutStgArg, OutStgTopBinding, OutStgBinding, OutStgExpr, OutStgRhs, OutStgAlt, -- StgOp StgOp(..), -- utils topStgBindHasCafRefs, stgArgHasCafRefs, stgRhsArity, isDllConApp, stgArgType, stripStgTicksTop, pprStgBinding, pprStgTopBindings ) where #include "HsVersions.h" import GhcPrelude import CoreSyn ( AltCon, Tickish ) import CostCentre ( CostCentreStack ) import Data.ByteString ( ByteString ) import Data.List ( intersperse ) import DataCon import DynFlags import FastString import ForeignCall ( ForeignCall ) import Id import IdInfo ( mayHaveCafRefs ) import Literal ( Literal, literalType ) import Module ( Module ) import Outputable import Packages ( isDllName ) import Platform import PprCore ( {- instances -} ) import PrimOp ( PrimOp, PrimCall ) import TyCon ( PrimRep(..), TyCon ) import Type ( Type ) import RepType ( typePrimRep1 ) import Unique ( Unique ) import Util {- ************************************************************************ * * \subsection{@GenStgBinding@} * * ************************************************************************ As usual, expressions are interesting; other things are boring. Here are the boring things [except note the @GenStgRhs@], parameterised with respect to binder and occurrence information (just as in @CoreSyn@): -} -- | A top-level binding. data GenStgTopBinding bndr occ -- See Note [CoreSyn top-level string literals] = StgTopLifted (GenStgBinding bndr occ) | StgTopStringLit bndr ByteString data GenStgBinding bndr occ = StgNonRec bndr (GenStgRhs bndr occ) | StgRec [(bndr, GenStgRhs bndr occ)] {- ************************************************************************ * * \subsection{@GenStgArg@} * * ************************************************************************ -} data GenStgArg occ = StgVarArg occ | StgLitArg Literal -- | Does this constructor application refer to -- anything in a different *Windows* DLL? -- If so, we can't allocate it statically isDllConApp :: DynFlags -> Module -> DataCon -> [StgArg] -> Bool isDllConApp dflags this_mod con args | platformOS (targetPlatform dflags) == OSMinGW32 = isDllName dflags this_mod (dataConName con) || any is_dll_arg args | otherwise = False where -- NB: typePrimRep1 is legit because any free variables won't have -- unlifted type (there are no unlifted things at top level) is_dll_arg :: StgArg -> Bool is_dll_arg (StgVarArg v) = isAddrRep (typePrimRep1 (idType v)) && isDllName dflags this_mod (idName v) is_dll_arg _ = False -- True of machine addresses; these are the things that don't -- work across DLLs. The key point here is that VoidRep comes -- out False, so that a top level nullary GADT constructor is -- False for isDllConApp -- data T a where -- T1 :: T Int -- gives -- T1 :: forall a. (a~Int) -> T a -- and hence the top-level binding -- $WT1 :: T Int -- $WT1 = T1 Int (Coercion (Refl Int)) -- The coercion argument here gets VoidRep isAddrRep :: PrimRep -> Bool isAddrRep AddrRep = True isAddrRep LiftedRep = True isAddrRep UnliftedRep = True isAddrRep _ = False -- | Type of an @StgArg@ -- -- Very half baked because we have lost the type arguments. stgArgType :: StgArg -> Type stgArgType (StgVarArg v) = idType v stgArgType (StgLitArg lit) = literalType lit -- | Strip ticks of a given type from an STG expression stripStgTicksTop :: (Tickish Id -> Bool) -> StgExpr -> ([Tickish Id], StgExpr) stripStgTicksTop p = go [] where go ts (StgTick t e) | p t = go (t:ts) e go ts other = (reverse ts, other) {- ************************************************************************ * * \subsection{STG expressions} * * ************************************************************************ The @GenStgExpr@ data type is parameterised on binder and occurrence info, as before. ************************************************************************ * * \subsubsection{@GenStgExpr@ application} * * ************************************************************************ An application is of a function to a list of atoms [not expressions]. Operationally, we want to push the arguments on the stack and call the function. (If the arguments were expressions, we would have to build their closures first.) There is no constructor for a lone variable; it would appear as @StgApp var []@. -} data GenStgExpr bndr occ = StgApp occ -- function [GenStgArg occ] -- arguments; may be empty {- ************************************************************************ * * \subsubsection{@StgConApp@ and @StgPrimApp@---saturated applications} * * ************************************************************************ There are specialised forms of application, for constructors, primitives, and literals. -} | StgLit Literal -- StgConApp is vital for returning unboxed tuples or sums -- which can't be let-bound first | StgConApp DataCon [GenStgArg occ] -- Saturated [Type] -- See Note [Types in StgConApp] in UnariseStg | StgOpApp StgOp -- Primitive op or foreign call [GenStgArg occ] -- Saturated. Type -- Result type -- We need to know this so that we can -- assign result registers {- ************************************************************************ * * \subsubsection{@StgLam@} * * ************************************************************************ StgLam is used *only* during CoreToStg's work. Before CoreToStg has finished it encodes (\x -> e) as (let f = \x -> e in f) -} | StgLam [bndr] StgExpr -- Body of lambda {- ************************************************************************ * * \subsubsection{@GenStgExpr@: case-expressions} * * ************************************************************************ This has the same boxed/unboxed business as Core case expressions. -} | StgCase (GenStgExpr bndr occ) -- the thing to examine bndr -- binds the result of evaluating the scrutinee AltType [GenStgAlt bndr occ] -- The DEFAULT case is always *first* -- if it is there at all {- ************************************************************************ * * \subsubsection{@GenStgExpr@: @let(rec)@-expressions} * * ************************************************************************ The various forms of let(rec)-expression encode most of the interesting things we want to do. \begin{enumerate} \item \begin{verbatim} let-closure x = [free-vars] [args] expr in e \end{verbatim} is equivalent to \begin{verbatim} let x = (\free-vars -> \args -> expr) free-vars \end{verbatim} \tr{args} may be empty (and is for most closures). It isn't under circumstances like this: \begin{verbatim} let x = (\y -> y+z) \end{verbatim} This gets mangled to \begin{verbatim} let-closure x = [z] [y] (y+z) \end{verbatim} The idea is that we compile code for @(y+z)@ in an environment in which @z@ is bound to an offset from \tr{Node}, and @y@ is bound to an offset from the stack pointer. (A let-closure is an @StgLet@ with a @StgRhsClosure@ RHS.) \item \begin{verbatim} let-constructor x = Constructor [args] in e \end{verbatim} (A let-constructor is an @StgLet@ with a @StgRhsCon@ RHS.) \item Letrec-expressions are essentially the same deal as let-closure/let-constructor, so we use a common structure and distinguish between them with an @is_recursive@ boolean flag. \item \begin{verbatim} let-unboxed u = an arbitrary arithmetic expression in unboxed values in e \end{verbatim} All the stuff on the RHS must be fully evaluated. No function calls either! (We've backed away from this toward case-expressions with suitably-magical alts ...) \item ~[Advanced stuff here! Not to start with, but makes pattern matching generate more efficient code.] \begin{verbatim} let-escapes-not fail = expr in e' \end{verbatim} Here the idea is that @e'@ guarantees not to put @fail@ in a data structure, or pass it to another function. All @e'@ will ever do is tail-call @fail@. Rather than build a closure for @fail@, all we need do is to record the stack level at the moment of the @let-escapes-not@; then entering @fail@ is just a matter of adjusting the stack pointer back down to that point and entering the code for it. Another example: \begin{verbatim} f x y = let z = huge-expression in if y==1 then z else if y==2 then z else 1 \end{verbatim} (A let-escapes-not is an @StgLetNoEscape@.) \item We may eventually want: \begin{verbatim} let-literal x = Literal in e \end{verbatim} \end{enumerate} And so the code for let(rec)-things: -} | StgLet (GenStgBinding bndr occ) -- right hand sides (see below) (GenStgExpr bndr occ) -- body | StgLetNoEscape (GenStgBinding bndr occ) -- right hand sides (see below) (GenStgExpr bndr occ) -- body {- %************************************************************************ %* * \subsubsection{@GenStgExpr@: @hpc@, @scc@ and other debug annotations} %* * %************************************************************************ Finally for @hpc@ expressions we introduce a new STG construct. -} | StgTick (Tickish bndr) (GenStgExpr bndr occ) -- sub expression -- END of GenStgExpr {- ************************************************************************ * * \subsection{STG right-hand sides} * * ************************************************************************ Here's the rest of the interesting stuff for @StgLet@s; the first flavour is for closures: -} data GenStgRhs bndr occ = StgRhsClosure CostCentreStack -- CCS to be attached (default is CurrentCCS) StgBinderInfo -- Info about how this binder is used (see below) [occ] -- non-global free vars; a list, rather than -- a set, because order is important !UpdateFlag -- ReEntrant | Updatable | SingleEntry [bndr] -- arguments; if empty, then not a function; -- as above, order is important. (GenStgExpr bndr occ) -- body {- An example may be in order. Consider: \begin{verbatim} let t = \x -> \y -> ... x ... y ... p ... q in e \end{verbatim} Pulling out the free vars and stylising somewhat, we get the equivalent: \begin{verbatim} let t = (\[p,q] -> \[x,y] -> ... x ... y ... p ...q) p q \end{verbatim} Stg-operationally, the @[x,y]@ are on the stack, the @[p,q]@ are offsets from @Node@ into the closure, and the code ptr for the closure will be exactly that in parentheses above. The second flavour of right-hand-side is for constructors (simple but important): -} | StgRhsCon CostCentreStack -- CCS to be attached (default is CurrentCCS). -- Top-level (static) ones will end up with -- DontCareCCS, because we don't count static -- data in heap profiles, and we don't set CCCS -- from static closure. DataCon -- Constructor. Never an unboxed tuple or sum, as those -- are not allocated. [GenStgArg occ] -- Args stgRhsArity :: StgRhs -> Int stgRhsArity (StgRhsClosure _ _ _ _ bndrs _) = ASSERT( all isId bndrs ) length bndrs -- The arity never includes type parameters, but they should have gone by now stgRhsArity (StgRhsCon _ _ _) = 0 -- Note [CAF consistency] -- ~~~~~~~~~~~~~~~~~~~~~~ -- -- `topStgBindHasCafRefs` is only used by an assert (`consistentCafInfo` in -- `CoreToStg`) to make sure CAF-ness predicted by `TidyPgm` is consistent with -- reality. -- -- Specifically, if the RHS mentions any Id that itself is marked -- `MayHaveCafRefs`; or if the binding is a top-level updateable thunk; then the -- `Id` for the binding should be marked `MayHaveCafRefs`. The potential trouble -- is that `TidyPgm` computed the CAF info on the `Id` but some transformations -- have taken place since then. topStgBindHasCafRefs :: GenStgTopBinding bndr Id -> Bool topStgBindHasCafRefs (StgTopLifted (StgNonRec _ rhs)) = topRhsHasCafRefs rhs topStgBindHasCafRefs (StgTopLifted (StgRec binds)) = any topRhsHasCafRefs (map snd binds) topStgBindHasCafRefs StgTopStringLit{} = False topRhsHasCafRefs :: GenStgRhs bndr Id -> Bool topRhsHasCafRefs (StgRhsClosure _ _ _ upd _ body) = -- See Note [CAF consistency] isUpdatable upd || exprHasCafRefs body topRhsHasCafRefs (StgRhsCon _ _ args) = any stgArgHasCafRefs args exprHasCafRefs :: GenStgExpr bndr Id -> Bool exprHasCafRefs (StgApp f args) = stgIdHasCafRefs f || any stgArgHasCafRefs args exprHasCafRefs StgLit{} = False exprHasCafRefs (StgConApp _ args _) = any stgArgHasCafRefs args exprHasCafRefs (StgOpApp _ args _) = any stgArgHasCafRefs args exprHasCafRefs (StgLam _ body) = exprHasCafRefs body exprHasCafRefs (StgCase scrt _ _ alts) = exprHasCafRefs scrt || any altHasCafRefs alts exprHasCafRefs (StgLet bind body) = bindHasCafRefs bind || exprHasCafRefs body exprHasCafRefs (StgLetNoEscape bind body) = bindHasCafRefs bind || exprHasCafRefs body exprHasCafRefs (StgTick _ expr) = exprHasCafRefs expr bindHasCafRefs :: GenStgBinding bndr Id -> Bool bindHasCafRefs (StgNonRec _ rhs) = rhsHasCafRefs rhs bindHasCafRefs (StgRec binds) = any rhsHasCafRefs (map snd binds) rhsHasCafRefs :: GenStgRhs bndr Id -> Bool rhsHasCafRefs (StgRhsClosure _ _ _ _ _ body) = exprHasCafRefs body rhsHasCafRefs (StgRhsCon _ _ args) = any stgArgHasCafRefs args altHasCafRefs :: GenStgAlt bndr Id -> Bool altHasCafRefs (_, _, rhs) = exprHasCafRefs rhs stgArgHasCafRefs :: GenStgArg Id -> Bool stgArgHasCafRefs (StgVarArg id) = stgIdHasCafRefs id stgArgHasCafRefs _ = False stgIdHasCafRefs :: Id -> Bool stgIdHasCafRefs id = -- We are looking for occurrences of an Id that is bound at top level, and may -- have CAF refs. At this point (after TidyPgm) top-level Ids (whether -- imported or defined in this module) are GlobalIds, so the test is easy. isGlobalId id && mayHaveCafRefs (idCafInfo id) -- Here's the @StgBinderInfo@ type, and its combining op: data StgBinderInfo = NoStgBinderInfo | SatCallsOnly -- All occurrences are *saturated* *function* calls -- This means we don't need to build an info table and -- slow entry code for the thing -- Thunks never get this value noBinderInfo, stgUnsatOcc, stgSatOcc :: StgBinderInfo noBinderInfo = NoStgBinderInfo stgUnsatOcc = NoStgBinderInfo stgSatOcc = SatCallsOnly satCallsOnly :: StgBinderInfo -> Bool satCallsOnly SatCallsOnly = True satCallsOnly NoStgBinderInfo = False combineStgBinderInfo :: StgBinderInfo -> StgBinderInfo -> StgBinderInfo combineStgBinderInfo SatCallsOnly SatCallsOnly = SatCallsOnly combineStgBinderInfo _ _ = NoStgBinderInfo -------------- pp_binder_info :: StgBinderInfo -> SDoc pp_binder_info NoStgBinderInfo = empty pp_binder_info SatCallsOnly = text "sat-only" {- ************************************************************************ * * \subsection[Stg-case-alternatives]{STG case alternatives} * * ************************************************************************ Very like in @CoreSyntax@ (except no type-world stuff). The type constructor is guaranteed not to be abstract; that is, we can see its representation. This is important because the code generator uses it to determine return conventions etc. But it's not trivial where there's a module loop involved, because some versions of a type constructor might not have all the constructors visible. So mkStgAlgAlts (in CoreToStg) ensures that it gets the TyCon from the constructors or literals (which are guaranteed to have the Real McCoy) rather than from the scrutinee type. -} type GenStgAlt bndr occ = (AltCon, -- alts: data constructor, [bndr], -- constructor's parameters, GenStgExpr bndr occ) -- ...right-hand side. data AltType = PolyAlt -- Polymorphic (a lifted type variable) | MultiValAlt Int -- Multi value of this arity (unboxed tuple or sum) -- the arity could indeed be 1 for unary unboxed tuple | AlgAlt TyCon -- Algebraic data type; the AltCons will be DataAlts | PrimAlt PrimRep -- Primitive data type; the AltCons (if any) will be LitAlts {- ************************************************************************ * * \subsection[Stg]{The Plain STG parameterisation} * * ************************************************************************ This happens to be the only one we use at the moment. -} type StgTopBinding = GenStgTopBinding Id Id type StgBinding = GenStgBinding Id Id type StgArg = GenStgArg Id type StgExpr = GenStgExpr Id Id type StgRhs = GenStgRhs Id Id type StgAlt = GenStgAlt Id Id {- Many passes apply a substitution, and it's very handy to have type synonyms to remind us whether or not the substitution has been applied. See CoreSyn for precedence in Core land -} type InStgTopBinding = StgTopBinding type InStgBinding = StgBinding type InStgArg = StgArg type InStgExpr = StgExpr type InStgRhs = StgRhs type InStgAlt = StgAlt type OutStgTopBinding = StgTopBinding type OutStgBinding = StgBinding type OutStgArg = StgArg type OutStgExpr = StgExpr type OutStgRhs = StgRhs type OutStgAlt = StgAlt {- ************************************************************************ * * \subsubsection[UpdateFlag-datatype]{@UpdateFlag@} * * ************************************************************************ This is also used in @LambdaFormInfo@ in the @ClosureInfo@ module. A @ReEntrant@ closure may be entered multiple times, but should not be updated or blackholed. An @Updatable@ closure should be updated after evaluation (and may be blackholed during evaluation). A @SingleEntry@ closure will only be entered once, and so need not be updated but may safely be blackholed. -} data UpdateFlag = ReEntrant | Updatable | SingleEntry instance Outputable UpdateFlag where ppr u = char $ case u of ReEntrant -> 'r' Updatable -> 'u' SingleEntry -> 's' isUpdatable :: UpdateFlag -> Bool isUpdatable ReEntrant = False isUpdatable SingleEntry = False isUpdatable Updatable = True {- ************************************************************************ * * \subsubsection{StgOp} * * ************************************************************************ An StgOp allows us to group together PrimOps and ForeignCalls. It's quite useful to move these around together, notably in StgOpApp and COpStmt. -} data StgOp = StgPrimOp PrimOp | StgPrimCallOp PrimCall | StgFCallOp ForeignCall Unique -- The Unique is occasionally needed by the C pretty-printer -- (which lacks a unique supply), notably when generating a -- typedef for foreign-export-dynamic {- ************************************************************************ * * \subsection[Stg-pretty-printing]{Pretty-printing} * * ************************************************************************ Robin Popplestone asked for semi-colon separators on STG binds; here's hoping he likes terminators instead... Ditto for case alternatives. -} pprGenStgTopBinding :: (OutputableBndr bndr, Outputable bdee, Ord bdee) => GenStgTopBinding bndr bdee -> SDoc pprGenStgTopBinding (StgTopStringLit bndr str) = hang (hsep [pprBndr LetBind bndr, equals]) 4 (pprHsBytes str <> semi) pprGenStgTopBinding (StgTopLifted bind) = pprGenStgBinding bind pprGenStgBinding :: (OutputableBndr bndr, Outputable bdee, Ord bdee) => GenStgBinding bndr bdee -> SDoc pprGenStgBinding (StgNonRec bndr rhs) = hang (hsep [pprBndr LetBind bndr, equals]) 4 (ppr rhs <> semi) pprGenStgBinding (StgRec pairs) = vcat $ whenPprDebug (text "{- StgRec (begin) -}") : map (ppr_bind) pairs ++ [whenPprDebug (text "{- StgRec (end) -}")] where ppr_bind (bndr, expr) = hang (hsep [pprBndr LetBind bndr, equals]) 4 (ppr expr <> semi) pprStgBinding :: StgBinding -> SDoc pprStgBinding bind = pprGenStgBinding bind pprStgTopBindings :: [StgTopBinding] -> SDoc pprStgTopBindings binds = vcat $ intersperse blankLine (map pprGenStgTopBinding binds) instance (Outputable bdee) => Outputable (GenStgArg bdee) where ppr = pprStgArg instance (OutputableBndr bndr, Outputable bdee, Ord bdee) => Outputable (GenStgTopBinding bndr bdee) where ppr = pprGenStgTopBinding instance (OutputableBndr bndr, Outputable bdee, Ord bdee) => Outputable (GenStgBinding bndr bdee) where ppr = pprGenStgBinding instance (OutputableBndr bndr, Outputable bdee, Ord bdee) => Outputable (GenStgExpr bndr bdee) where ppr = pprStgExpr instance (OutputableBndr bndr, Outputable bdee, Ord bdee) => Outputable (GenStgRhs bndr bdee) where ppr rhs = pprStgRhs rhs pprStgArg :: (Outputable bdee) => GenStgArg bdee -> SDoc pprStgArg (StgVarArg var) = ppr var pprStgArg (StgLitArg con) = ppr con pprStgExpr :: (OutputableBndr bndr, Outputable bdee, Ord bdee) => GenStgExpr bndr bdee -> SDoc -- special case pprStgExpr (StgLit lit) = ppr lit -- general case pprStgExpr (StgApp func args) = hang (ppr func) 4 (sep (map (ppr) args)) pprStgExpr (StgConApp con args _) = hsep [ ppr con, brackets (interppSP args) ] pprStgExpr (StgOpApp op args _) = hsep [ pprStgOp op, brackets (interppSP args)] pprStgExpr (StgLam bndrs body) = sep [ char '\\' <+> ppr_list (map (pprBndr LambdaBind) bndrs) <+> text "->", pprStgExpr body ] where ppr_list = brackets . fsep . punctuate comma -- special case: let v = <very specific thing> -- in -- let ... -- in -- ... -- -- Very special! Suspicious! (SLPJ) {- pprStgExpr (StgLet srt (StgNonRec bndr (StgRhsClosure cc bi free_vars upd_flag args rhs)) expr@(StgLet _ _)) = ($$) (hang (hcat [text "let { ", ppr bndr, ptext (sLit " = "), ppr cc, pp_binder_info bi, text " [", whenPprDebug (interppSP free_vars), ptext (sLit "] \\"), ppr upd_flag, text " [", interppSP args, char ']']) 8 (sep [hsep [ppr rhs, text "} in"]])) (ppr expr) -} -- special case: let ... in let ... pprStgExpr (StgLet bind expr@(StgLet _ _)) = ($$) (sep [hang (text "let {") 2 (hsep [pprGenStgBinding bind, text "} in"])]) (ppr expr) -- general case pprStgExpr (StgLet bind expr) = sep [hang (text "let {") 2 (pprGenStgBinding bind), hang (text "} in ") 2 (ppr expr)] pprStgExpr (StgLetNoEscape bind expr) = sep [hang (text "let-no-escape {") 2 (pprGenStgBinding bind), hang (text "} in ") 2 (ppr expr)] pprStgExpr (StgTick tickish expr) = sdocWithDynFlags $ \dflags -> if gopt Opt_SuppressTicks dflags then pprStgExpr expr else sep [ ppr tickish, pprStgExpr expr ] pprStgExpr (StgCase expr bndr alt_type alts) = sep [sep [text "case", nest 4 (hsep [pprStgExpr expr, whenPprDebug (dcolon <+> ppr alt_type)]), text "of", pprBndr CaseBind bndr, char '{'], nest 2 (vcat (map pprStgAlt alts)), char '}'] pprStgAlt :: (OutputableBndr bndr, Outputable occ, Ord occ) => GenStgAlt bndr occ -> SDoc pprStgAlt (con, params, expr) = hang (hsep [ppr con, sep (map (pprBndr CasePatBind) params), text "->"]) 4 (ppr expr <> semi) pprStgOp :: StgOp -> SDoc pprStgOp (StgPrimOp op) = ppr op pprStgOp (StgPrimCallOp op)= ppr op pprStgOp (StgFCallOp op _) = ppr op instance Outputable AltType where ppr PolyAlt = text "Polymorphic" ppr (MultiValAlt n) = text "MultiAlt" <+> ppr n ppr (AlgAlt tc) = text "Alg" <+> ppr tc ppr (PrimAlt tc) = text "Prim" <+> ppr tc pprStgRhs :: (OutputableBndr bndr, Outputable bdee, Ord bdee) => GenStgRhs bndr bdee -> SDoc -- special case pprStgRhs (StgRhsClosure cc bi [free_var] upd_flag [{-no args-}] (StgApp func [])) = sdocWithDynFlags $ \dflags -> hsep [ ppr cc, pp_binder_info bi, if not $ gopt Opt_SuppressStgFreeVars dflags then brackets (ppr free_var) else empty, text " \\", ppr upd_flag, ptext (sLit " [] "), ppr func ] -- general case pprStgRhs (StgRhsClosure cc bi free_vars upd_flag args body) = sdocWithDynFlags $ \dflags -> hang (hsep [if gopt Opt_SccProfilingOn dflags then ppr cc else empty, pp_binder_info bi, if not $ gopt Opt_SuppressStgFreeVars dflags then brackets (interppSP free_vars) else empty, char '\\' <> ppr upd_flag, brackets (interppSP args)]) 4 (ppr body) pprStgRhs (StgRhsCon cc con args) = hcat [ ppr cc, space, ppr con, text "! ", brackets (interppSP args)]
ezyang/ghc
compiler/stgSyn/StgSyn.hs
bsd-3-clause
28,778
0
16
8,139
4,023
2,164
1,859
340
4
-- | -- Module : Test.LeanCheck -- Copyright : (c) 2015-2020 Rudy Matela -- License : 3-Clause BSD (see the file LICENSE) -- Maintainer : Rudy Matela <rudy@matela.com.br> -- -- LeanCheck is a simple enumerative property-based testing library. -- -- A __property__ is a function returning a 'Bool' that should be 'True' for -- all possible choices of arguments. Properties can be viewed as a -- parameterized unit tests. -- -- -- To check if a property 'holds' by testing up to a thousand values, -- we evaluate: -- -- > holds 1000 property -- -- 'True' indicates success. 'False' indicates a bug. -- -- For example: -- -- > > import Data.List (sort) -- > > holds 1000 $ \xs -> length (sort xs) == length (xs::[Int]) -- > True -- -- To get the smallest 'counterExample' by testing up to a thousand values, -- we evaluate: -- -- > counterExample 1000 property -- -- 'Nothing' indicates no counterexample was found, -- a 'Just' value indicates a counterexample. -- -- For instance: -- -- > > import Data.List (union) -- > > counterExample 1000 $ \xs ys -> union xs ys == union ys (xs :: [Int]) -- > Just ["[]","[0,0]"] -- -- The suggested values for the number of tests to use with LeanCheck are -- 500, 1 000 or 10 000. LeanCheck is memory intensive and you should take -- care if you go beyond that. -- -- The function 'check' can also be used to test and report counterexamples. -- -- > > check $ \xs ys -> union xs ys == union ys (xs :: [Int]) -- > *** Failed! Falsifiable (after 4 tests): -- > [] [0,0] -- -- -- Arguments of properties should be instances of the 'Listable' typeclass. -- 'Listable' instances are provided for the most common Haskell types. -- New instances are easily defined (see 'Listable' for more info). module Test.LeanCheck ( -- * Checking and testing holds , fails , exists -- ** Boolean (property) operators , (==>) -- ** Counterexamples and witnesses , counterExample , counterExamples , witness , witnesses -- ** Reporting , check , checkFor , checkResult , checkResultFor -- * Listing test values , Listable(..) -- ** Listing constructors , cons0 , cons1 , cons2 , cons3 , cons4 , cons5 , cons6 , cons7 , cons8 , cons9 , cons10 , cons11 , cons12 , delay , reset , ofWeight , addWeight , suchThat -- ** Combining tiers , (\/) , (\\//) , (><) , productWith -- ** Manipulating tiers , mapT , filterT , concatT , concatMapT , deleteT , normalizeT , toTiers -- ** Automatically deriving Listable instances , deriveListable , deriveListableCascading -- ** Specialized constructors of tiers , setCons , bagCons , noDupListCons , mapCons -- ** Products of tiers , product3With , productMaybeWith -- * Listing lists , listsOf , setsOf , bagsOf , noDupListsOf , products , listsOfLength -- ** Listing values , tiersFloating , tiersFractional , listIntegral , (+|) -- * Test results , Testable , results ) where import Test.LeanCheck.Basic import Test.LeanCheck.Tiers import Test.LeanCheck.Derive import Test.LeanCheck.IO
rudymatela/llcheck
src/Test/LeanCheck.hs
bsd-3-clause
3,130
0
5
707
300
226
74
68
0
module Main where import CV.Image import CV.Features import CV.Drawing import CV.ImageOp import CV.Bindings.Types import CV.Transforms import Utils.GeometryClass import Utils.Point import System.Environment main = do Just x <- getArgs >>= loadImage . head let y = rotate (pi/4) x lst = getMSER (unsafeImageTo8Bit x) Nothing defaultMSERParams lsty = getMSER (unsafeImageTo8Bit y) Nothing defaultMSERParams result lst x = x <## [drawLinesOp 1 1 $ polyline ctr | ctr <- lst] print lst saveImage "mser.png" $ montage (2,1) 2 [result (take 100 lst) x ,result (take 100 lsty) y] polyline pts = pts `zip` tail pts
TomMD/CV
examples/mser.hs
bsd-3-clause
676
0
13
162
245
126
119
20
1
{-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE TypeSynonymInstances #-} {-# LANGUAGE GeneralizedNewtypeDeriving #-} module Infer ( Constraint, TypeError(..), Subst(..), inferTop, constraintsExpr ) where import Env import Type import Syntax import Control.Monad.Except import Control.Monad.State import Control.Monad.RWS import Control.Monad.Identity import Data.List (nub) import qualified Data.Map as Map import qualified Data.Set as Set ------------------------------------------------------------------------------- -- Classes ------------------------------------------------------------------------------- -- | Inference monad type Infer a = (RWST Env -- Typing environment [Constraint] -- Generated constraints InferState -- Inference state (Except -- Inference errors TypeError) a) -- Result -- | Inference state data InferState = InferState { count :: Int } -- | Initial inference state initInfer :: InferState initInfer = InferState { count = 0 } type Constraint = (Type, Type) type Unifier = (Subst, [Constraint]) -- | Constraint solver monad type Solve a = ExceptT TypeError Identity a newtype Subst = Subst (Map.Map TVar Type) deriving (Eq, Ord, Show, Monoid) class Substitutable a where apply :: Subst -> a -> a ftv :: a -> Set.Set TVar instance Substitutable Type where apply _ (TCon a) = TCon a apply (Subst s) t@(TVar a) = Map.findWithDefault t a s apply s (t1 `TArr` t2) = apply s t1 `TArr` apply s t2 ftv TCon{} = Set.empty ftv (TVar a) = Set.singleton a ftv (t1 `TArr` t2) = ftv t1 `Set.union` ftv t2 instance Substitutable Scheme where apply (Subst s) (Forall as t) = Forall as $ apply s' t where s' = Subst $ foldr Map.delete s as ftv (Forall as t) = ftv t `Set.difference` Set.fromList as instance Substitutable Constraint where apply s (t1, t2) = (apply s t1, apply s t2) ftv (t1, t2) = ftv t1 `Set.union` ftv t2 instance Substitutable a => Substitutable [a] where apply = map . apply ftv = foldr (Set.union . ftv) Set.empty instance Substitutable Env where apply s (TypeEnv env) = TypeEnv $ Map.map (apply s) env ftv (TypeEnv env) = ftv $ Map.elems env data TypeError = UnificationFail Type Type | InfiniteType TVar Type | UnboundVariable String | Ambigious [Constraint] | UnificationMismatch [Type] [Type] ------------------------------------------------------------------------------- -- Inference ------------------------------------------------------------------------------- -- | Run the inference monad runInfer :: Env -> Infer Type -> Either TypeError (Type, [Constraint]) runInfer env m = runExcept $ evalRWST m env initInfer -- | Solve for the toplevel type of an expression in a given environment inferExpr :: Env -> Expr -> Either TypeError Scheme inferExpr env ex = case runInfer env (infer ex) of Left err -> Left err Right (ty, cs) -> case runSolve cs of Left err -> Left err Right subst -> Right $ closeOver $ apply subst ty -- | Return the internal constraints used in solving for the type of an expression constraintsExpr :: Env -> Expr -> Either TypeError ([Constraint], Subst, Type, Scheme) constraintsExpr env ex = case runInfer env (infer ex) of Left err -> Left err Right (ty, cs) -> case runSolve cs of Left err -> Left err Right subst -> Right $ (cs, subst, ty, sc) where sc = closeOver $ apply subst ty -- | Canonicalize and return the polymorphic toplevel type. closeOver :: Type -> Scheme closeOver = normalize . generalize Env.empty -- | Unify two types uni :: Type -> Type -> Infer () uni t1 t2 = tell [(t1, t2)] -- | Extend type environment inEnv :: (Name, Scheme) -> Infer a -> Infer a inEnv (x, sc) m = do let scope e = (remove e x) `extend` (x, sc) local scope m -- | Lookup type in the environment lookupEnv :: Name -> Infer Type lookupEnv x = do (TypeEnv env) <- ask case Map.lookup x env of Nothing -> throwError $ UnboundVariable x Just s -> do t <- instantiate s return t letters :: [String] letters = [1..] >>= flip replicateM ['a'..'z'] fresh :: Infer Type fresh = do s <- get put s{count = count s + 1} return $ TVar $ TV (letters !! count s) instantiate :: Scheme -> Infer Type instantiate (Forall as t) = do as' <- mapM (\_ -> fresh) as let s = Subst $ Map.fromList $ zip as as' return $ apply s t generalize :: Env -> Type -> Scheme generalize env t = Forall as t where as = Set.toList $ ftv t `Set.difference` ftv env ops :: Map.Map Binop Type ops = Map.fromList [ (Add, (typeInt `TArr` (typeInt `TArr` typeInt))) , (Mul, (typeInt `TArr` (typeInt `TArr` typeInt))) , (Sub, (typeInt `TArr` (typeInt `TArr` typeInt))) , (Eql, (typeInt `TArr` (typeInt `TArr` typeBool))) ] infer :: Expr -> Infer Type infer expr = case expr of Lit (LInt _) -> return $ typeInt Lit (LBool _) -> return $ typeBool Var x -> lookupEnv x Lam x e -> do tv <- fresh t <- inEnv (x, Forall [] tv) (infer e) return (tv `TArr` t) App e1 e2 -> do t1 <- infer e1 t2 <- infer e2 tv <- fresh uni t1 (t2 `TArr` tv) return tv Let x e1 e2 -> do env <- ask t1 <- infer e1 let sc = generalize env t1 t2 <- inEnv (x, sc) (infer e2) return t2 Fix e1 -> do t1 <- infer e1 tv <- fresh uni (tv `TArr` tv) t1 return tv Op op e1 e2 -> do t1 <- infer e1 t2 <- infer e2 tv <- fresh let u1 = t1 `TArr` (t2 `TArr` tv) u2 = ops Map.! op uni u1 u2 return tv If cond tr fl -> do t1 <- infer cond t2 <- infer tr t3 <- infer fl uni t1 typeBool uni t2 t3 return t2 inferTop :: Env -> [(String, Expr)] -> Either TypeError Env inferTop env [] = Right env inferTop env ((name, ex):xs) = case (inferExpr env ex) of Left err -> Left err Right ty -> inferTop (extend env (name, ty)) xs normalize :: Scheme -> Scheme normalize (Forall _ body) = Forall (map snd ord) (normtype body) where ord = zip (nub $ fv body) (map TV letters) fv (TVar a) = [a] fv (TArr a b) = fv a ++ fv b fv (TCon _) = [] normtype (TArr a b) = TArr (normtype a) (normtype b) normtype (TCon a) = TCon a normtype (TVar a) = case Prelude.lookup a ord of Just x -> TVar x Nothing -> error "type variable not in signature" ------------------------------------------------------------------------------- -- Constraint Solver ------------------------------------------------------------------------------- -- | The empty substitution emptySubst :: Subst emptySubst = mempty -- | Compose substitutions compose :: Subst -> Subst -> Subst (Subst s1) `compose` (Subst s2) = Subst $ Map.map (apply (Subst s1)) s2 `Map.union` s1 -- | Run the constraint solver runSolve :: [Constraint] -> Either TypeError Subst runSolve cs = runIdentity $ runExceptT $ solver st where st = (emptySubst, cs) unifyMany :: [Type] -> [Type] -> Solve Subst unifyMany [] [] = return emptySubst unifyMany (t1 : ts1) (t2 : ts2) = do su1 <- unifies t1 t2 su2 <- unifyMany (apply su1 ts1) (apply su1 ts2) return (su2 `compose` su1) unifyMany t1 t2 = throwError $ UnificationMismatch t1 t2 unifies :: Type -> Type -> Solve Subst unifies t1 t2 | t1 == t2 = return emptySubst unifies (TVar v) t = v `bind` t unifies t (TVar v) = v `bind` t unifies (TArr t1 t2) (TArr t3 t4) = unifyMany [t1, t2] [t3, t4] unifies t1 t2 = throwError $ UnificationFail t1 t2 -- Unification solver solver :: Unifier -> Solve Subst solver (su, cs) = case cs of [] -> return su ((t1, t2): cs0) -> do su1 <- unifies t1 t2 solver (su1 `compose` su, (apply su1 cs0)) bind :: TVar -> Type -> Solve Subst bind a t | t == TVar a = return emptySubst | occursCheck a t = throwError $ InfiniteType a t | otherwise = return $ (Subst $ Map.singleton a t) occursCheck :: Substitutable a => TVar -> a -> Bool occursCheck a t = a `Set.member` ftv t
yupferris/write-you-a-haskell
chapter7/poly_constraints/src/Infer.hs
mit
8,175
0
15
2,054
3,140
1,615
1,525
205
9
{- | Module : $Header$ Description : generic mixfix analysis, using an Earley parser Copyright : Christian Maeder and Uni Bremen 2003-2005 License : GPLv2 or higher, see LICENSE.txt Maintainer : Christian.Maeder@dfki.de Stability : experimental Portability : portable Generic mixfix analysis, using an Earley parser The grammer has a single non-terminal for terms (the double underscore). A rule of the grammer carries an identifier, a precedence number, and the actual token list of the identifier to match against the input token list.. The parser can be instantiated for any term type. A function parameter determines how applications from identifiers and arguments are constructed. -} module Common.Earley ( Rule , TokRules , Rules (..) , emptyRules , partitionRules -- * special tokens for special ids , varTok , exprTok , parenId , exprId , varId , tupleId , unitId , protect , listRules , mixRule , getTokenPlaceList , getPlainPolyTokenList , getPolyTokenList -- * resolution chart , Chart , mixDiags , solveDiags , ToExpr , rules , addRules , initChart , nextChart , getResolved ) where import Common.AS_Annotation import Common.GlobalAnnotations import Common.Id import Common.Prec import Common.Result import Common.Utils (nubOrd) import Control.Exception import Data.List import Data.Maybe import qualified Data.Map as Map import qualified Data.Set as Set -- | take the difference of the two input lists take (length l2 - length l1) l2 takeDiff :: [a] -> [b] -> [b] takeDiff l1 l2 = zipWith const l2 $ dropPrefix l1 l2 {- | update token positions. return remaining positions -} setToksPos :: [Token] -> Range -> ([Token], Range) setToksPos (h : ts) (Range (p : ps)) = let (rt, rp) = setToksPos ts (Range ps) in (h {tokPos = Range $ if isPlace h then [p, p] else [p]} : rt, rp) setToksPos ts ps = (ts, ps) reverseRange :: Range -> Range reverseRange = Range . reverse . rangeToList {- | update positions in 'Id'. return remaining positions -} setPlainIdePos :: Id -> Range -> (Id, Range) setPlainIdePos (Id ts cs _) ps = if null cs then let (newTs, restPs) = setToksPos ts ps in (Id newTs cs nullRange, restPs) else let (toks, pls) = splitMixToken ts (front, ps2) = setToksPos toks ps ps2PL = rangeToList ps2 (newCs, ps3, ps4) = if isNullRange ps2 then error "setPlainIdePos2" else foldl ( \ (prevCs, seps, restPs) a -> let (c1, qs) = setPlainIdePos a restPs qsPL = rangeToList qs in if isNullRange qs then error "setPlainIdePos1" else (c1 : prevCs, Range (head qsPL : rangeToList seps), Range (tail qsPL))) ([], Range [head ps2PL], Range (tail ps2PL)) cs (newPls, ps7) = setToksPos pls ps4 in (Id (front ++ newPls) (reverse newCs) (reverseRange ps3), ps7) {- no special index type anymore (assuming not much more development) the info Int denotes fast precedence -} data Item a = Item { rule :: Id -- the rule to match , info :: Int -- additional precedence info for 'rule' , lWeight :: Id -- weights for lower precedence pre- and postfixes , rWeight :: Id -- given by the 'Id's itself , posList :: Range -- positions of Id tokens , args :: [a] -- collected arguments are in reverse order , ambigArgs :: [[a]] -- field for ambiguities , ambigs :: [[a]] -- field for ambiguities , rest :: [Token] -- part of the rule after the "dot" , index :: Int -- index into the Table/input string } -- | the non-terminal termStr :: String termStr = "(__)" -- | builtin terminals commaTok, termTok, oParenTok, cParenTok :: Token commaTok = mkSimpleId "," -- for list elements termTok = mkSimpleId termStr oParenTok = mkSimpleId "(" cParenTok = mkSimpleId ")" listTok :: Token listTok = mkSimpleId "[]" -- impossible token protectTok :: Token protectTok = mkSimpleId "()" -- impossible token -- | token for a fixed (or recursively resolved) operator expression exprTok :: Token exprTok = mkSimpleId "(op )" -- | token for a fixed (or recursively resolved) argument expression varTok :: Token varTok = mkSimpleId "(var )" -- | parenthesis around one place parenId :: Id parenId = mkId [oParenTok, placeTok, cParenTok] -- | id for tuples with at least two arguments tupleId :: Id tupleId = mkId [oParenTok, placeTok, commaTok, placeTok, cParenTok] -- | id for the emtpy tuple unitId :: Id unitId = mkId [oParenTok, cParenTok] -- | see 'exprTok' exprId :: Id exprId = mkId [exprTok] -- | see 'varTok' varId :: Id varId = mkId [varTok] listId :: (Id, Id) -> Id listId (f, c) = Id [listTok] [f, c] nullRange isListId :: Id -> Bool isListId (Id ts _ _) = not (null ts) && head ts == listTok -- | interpret placeholders as literal places protect :: Id -> Id protect i = Id [protectTok] [i] nullRange unProtect :: Id -> Maybe Id unProtect (Id ts cs _) = case cs of [i] -> case ts of [tok] | tok == protectTok -> Just i _ -> Nothing _ -> Nothing -- | get the token list for a mixfix rule getPolyTokenList :: Id -> [Token] getPolyTokenList = getGenPolyTokenList termStr -- | get the plain token list for prefix applications getPlainPolyTokenList :: Id -> [Token] getPlainPolyTokenList = getGenPolyTokenList place type Rule = (Id, Int, [Token]) mkItem :: Int -> Rule -> Item a mkItem ind (ide, inf, toks) = Item { rule = ide , info = inf , lWeight = ide , rWeight = ide , posList = nullRange , args = [] , ambigArgs = [] , ambigs = [] , rest = toks , index = ind } -- | extract tokens with the non-terminal for places getTokenPlaceList :: Id -> [Token] getTokenPlaceList = getTokenList termStr -- | construct a rule for a mixfix mixRule :: Int -> Id -> Rule mixRule b i = (i, b, getTokenPlaceList i) asListAppl :: ToExpr a -> Id -> [a] -> Range -> a asListAppl toExpr i ra br | isListId i = let Id _ [f, c] _ = i mkList [] ps = toExpr c [] ps mkList (hd : tl) ps = toExpr f [hd, mkList tl ps] ps in mkList ra br | elem i [typeId, exprId, parenId, varId] = case ra of [arg] -> arg _ -> error "asListAppl" | otherwise = toExpr i ra br -- | construct the list rules listRules :: Int -> GlobalAnnos -> [Rule] listRules inf g = let lists = list_lit $ literal_annos g listRule co toks = (listId co, inf, toks) in concatMap ( \ (bs, (n, c)) -> let (b1, b2, cs) = getListBrackets bs e = Id (b1 ++ b2) cs nullRange in (if e == n then [] -- add b1 ++ b2 if its not yet included by n else [listRule (c, n) $ getPlainTokenList e]) ++ [listRule (c, n) (b1 ++ [termTok] ++ b2), listRule (c, n) (b1 ++ [termTok, commaTok, termTok] ++ b2)] ) $ Map.toList lists type Table a = Map.Map Int [Item a] lookUp :: Table a -> Int -> [Item a] lookUp ce k = Map.findWithDefault [] k ce -- | recognize next token (possible introduce new tuple variable) scanItem :: (a -> a -> a) -> (a, Token) -> Item a -> [Item a] scanItem addType (trm, t) p@Item { rest = ts, args = pArgs, posList = pRange } = case ts of [] -> [] hd : tt -> let q = p { posList = case rangeToList $ tokPos t of [] -> pRange ps@(po : _) -> Range $ (if null tt then last ps else po) : rangeToList pRange } r = q { rest = tt } in if hd == t || t == exprTok && hd == varTok then if t == commaTok then case tt of sd : _ | sd == termTok -> -- tuple or list elements separator [ r, q { rest = termTok : ts } ] _ -> [r] else if elem t [exprTok, varTok, typeInstTok] then [r { args = trm : pArgs }] else if t == typeTok then case (tt, pArgs) of ([], [arg]) -> [q { rest = [], args = [addType trm arg] }] _ -> error "scanItem: typeTok" else [r] else [] scan :: (a -> a -> a) -> (a, Token) -> [Item a] -> [Item a] scan f = concatMap . scanItem f mkAmbigs :: ToExpr a -> Item a -> [a] mkAmbigs toExpr p@Item { args = l, ambigArgs = aArgs } = map ( \ aas -> fst $ mkExpr toExpr p { args = takeDiff aas l ++ aas } ) aArgs addArg :: GlobalAnnos -> ToExpr a -> Item a -> Item a -> Item a addArg ga toExpr argItem@Item { ambigs = ams, posList = aRange } p@Item { args = pArgs, rule = op, posList = pRange, ambigs = pAmbs , rest = pRest} = let (arg, _) = mkExpr toExpr argItem newAms = mkAmbigs toExpr argItem q = case pRest of _ : tl -> p { rest = tl , posList = case rangeToList aRange of [] -> pRange qs@(h : _) -> Range $ (if null tl then last qs else h) : rangeToList pRange , args = arg : pArgs , ambigs = (if null newAms then ams else newAms : ams) ++ pAmbs } _ -> error "addArg" in if isLeftArg op pArgs then q { lWeight = getNewWeight ALeft ga argItem op } else if isRightArg op pArgs then q { rWeight = getNewWeight ARight ga argItem op } else q -- | shortcut for a function that constructs an expression type ToExpr a = Id -> [a] -> Range -> a mkExpr :: ToExpr a -> Item a -> (a, Range) mkExpr toExpr Item { rule = orig, posList = ps, args = iArgs } = let rs = reverseRange ps (ide, qs) = if isListId orig then (orig, rs) else setPlainIdePos (fromMaybe orig $ unProtect orig) rs in (asListAppl toExpr ide (reverse iArgs) qs, rs) reduce :: GlobalAnnos -> Table a -> ToExpr a -> Item a -> [Item a] reduce ga table toExpr itm = map (addArg ga toExpr itm) $ filter (checkPrecs ga itm) $ lookUp table $ index itm getWeight :: AssocEither -> Item a -> Id getWeight side = case side of ALeft -> lWeight ARight -> rWeight getNewWeight :: AssocEither -> GlobalAnnos -> Item a -> Id -> Id getNewWeight side ga = nextWeight side ga . getWeight side -- | check precedences of an argument and a top-level operator. checkPrecs :: GlobalAnnos -> Item a -> Item a -> Bool checkPrecs ga argItem@Item { rule = arg, info = argPrec } Item { rule = op, info = opPrec, args = oArgs } = checkPrec ga (op, opPrec) (arg, argPrec) oArgs $ flip getWeight argItem reduceCompleted :: GlobalAnnos -> Table a -> ToExpr a -> [Item a] -> [Item a] reduceCompleted ga table toExpr = foldr (mergeItems . reduce ga table toExpr) [] . filter (null . rest) recReduce :: GlobalAnnos -> Table a -> ToExpr a -> [Item a] -> [Item a] recReduce ga table toExpr items = let reduced = reduceCompleted ga table toExpr items in if null reduced then items else recReduce ga table toExpr reduced `mergeItems` items complete :: ToExpr a -> GlobalAnnos -> Table a -> [Item a] -> [Item a] complete toExpr ga table items = let reducedItems = recReduce ga table toExpr $ reduceCompleted ga table toExpr items in reducedItems ++ items doPredict :: [Item a] -> ([Item a], [Item a]) doPredict = partition ( \ Item { rest = ts } -> not (null ts) && head ts == termTok) ordItem :: Item a -> Item a -> Ordering ordItem Item { index = i1, rest = r1, rule = n1 } Item { index = i2, rest = r2, rule = n2 } = compare (i1, r1, n1) (i2, r2, n2) ambigItems :: Item a -> Item a -> Item a ambigItems i1@Item { ambigArgs = ams1, args = as1 } Item { ambigArgs = ams2, args = as2 } = i1 { ambigArgs = case ams1 ++ ams2 of [] -> [as1, as2] ams -> ams } mergeItems :: [Item a] -> [Item a] -> [Item a] mergeItems [] i2 = i2 mergeItems i1 [] = i1 mergeItems (i1 : r1) (i2 : r2) = case ordItem i1 i2 of LT -> i1 : mergeItems r1 (i2 : r2) EQ -> ambigItems i1 i2 : mergeItems r1 r2 GT -> i2 : mergeItems (i1 : r1) r2 type TokRules = Token -> Set.Set Rule -- | the whole state for mixfix resolution data Chart a = Chart { prevTable :: Table a , currIndex :: Int , currItems :: ([Item a], [Item a]) , rules :: Rules , addRules :: TokRules , solveDiags :: [Diagnosis] } {- | make one scan, complete, and predict step. The first function adds a type to the result. The second function filters based on argument and operator info. If filtering yields 'Nothing' further filtering by precedence is applied. -} nextChart :: (a -> a -> a) -> ToExpr a -> GlobalAnnos -> Chart a -> (a, Token) -> Chart a nextChart addType toExpr ga st term@(_, tok) = let table = prevTable st idx = currIndex st igz = idx > 0 (cItems, sItems) = currItems st Rules cRules sRules = rules st pItems = if null cItems && igz then sItems else map (mkItem idx) (Set.toList $ Set.union sRules $ addRules st tok) ++ sItems scannedItems = scan addType term pItems nextTable = if null cItems && igz then table else Map.insert idx (map (mkItem idx) (Set.toList cRules) ++ cItems) table completedItems = complete toExpr ga nextTable $ sortBy ordItem scannedItems nextIdx = idx + 1 in if null pItems && igz then st else st { prevTable = nextTable , currIndex = nextIdx , currItems = doPredict completedItems , solveDiags = [ Diag Error ("unexpected mixfix token: " ++ tokStr tok) $ tokPos tok | null scannedItems ] ++ solveDiags st } -- | add intermediate diagnostic messages mixDiags :: [Diagnosis] -> Chart a -> Chart a mixDiags ds st = st { solveDiags = ds ++ solveDiags st } -- | postfix and prefix rules data Rules = Rules { postRules :: Set.Set Rule , scanRules :: Set.Set Rule } emptyRules :: Rules emptyRules = Rules { postRules = Set.empty , scanRules = Set.empty } -- | presort rules partitionRules :: [Rule] -> Rules partitionRules l = let (p, s) = partition ( \ (_, _, ts) -> null ts || head ts == termTok) l in Rules (Set.fromList p) $ Set.fromList s -- | create the initial chart initChart :: TokRules -> Rules -> Chart a initChart adder ruleS = Chart { prevTable = Map.empty , currIndex = 0 , currItems = ([], []) , rules = ruleS , addRules = adder , solveDiags = [] } -- | extract resolved result getResolved :: (a -> ShowS) -> Range -> ToExpr a -> Chart a -> Result a getResolved pp p toExpr st = let (predicted, items') = currItems st ds = solveDiags st items = if null items' && null ds then predicted else items' in case items of [] -> assert (not $ null ds) $ Result ds Nothing _ -> let (finals, r1) = partition ((0 ==) . index) items (result, r2) = partition (null . rest) finals in case result of [] -> let expected = if null r2 then filter (not . null . rest) r1 else r2 withpos = filter (not . isNullRange . posList) expected (q, errs) = if null withpos then (p, expected) else (concatMapRange (reverseRange . posList) withpos, withpos) in Result (Diag Error ("expected further mixfix token: " ++ show (take 5 $ nubOrd $ map (tokStr . head . rest) errs)) q : ds) Nothing [har] -> case ambigs har of [] -> case mkAmbigs toExpr har of [] -> Result ds $ Just $ fst $ mkExpr toExpr har ambAs -> Result (showAmbigs pp p (take 5 ambAs) : ds) Nothing ams -> Result (map (showAmbigs pp p) (take 5 ams) ++ ds) Nothing _ -> Result (showAmbigs pp p (map (fst . mkExpr toExpr) result) : ds) Nothing showAmbigs :: (a -> ShowS) -> Range -> [a] -> Diagnosis showAmbigs pp p as = Diag Error ("ambiguous mixfix term\n " ++ showSepList (showString "\n ") pp (take 5 as) "") p
keithodulaigh/Hets
Common/Earley.hs
gpl-2.0
16,209
11
29
4,776
5,339
2,882
2,457
355
10