text
stringlengths 1
3.78M
| meta
dict |
|---|---|
[The role of disturbances in the hormonal signaling systems in etiology and pathogenesis of diabetes mellitus].
The role of disturbances in the hormonal signaling systems of brain and peripheral tissues in etiology and pathogenesis of diabetes mellitus (DM) of the types 1 and 2 is discussed. Available data confirming the hypothesis of central genesis of some forms of DM caused by disturbances in the brain neurotransmitter systems are presented. It is concluded that the study of disturbances in the hormonal signaling systems is a promising approach for development of new strategies of DM treatment, based on correction of these disturbances in the CNS and the periphery.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Brian Kramer – All Will Be Lost (Mixtape)
Brian Kramer is back at it again with 6 brand new bootlegs all worth downloading. Brian Kramer has been making a name for himself in the last year putting out nothing but quality bootlegs which has helped further develop his fan base. Check out the two tracks below and click here to download the rest.
|
{
"pile_set_name": "Pile-CC"
}
|
Rio Hondo
Río Hondo (Spanish for "deep river") or Hondo River may refer to:
Rivers
Rio Hondo (Belize), a river which forms much of the border between Belize and Mexico
Rio Hondo (Puerto Rico), a river in Puerto Rico
Rio Hondo (California), a tributary of the Los Angeles River in California, U.S.
Rio Hondo College, a college named after the California river
Rio Hondo (Northern New Mexico), a river in the northern part of New Mexico, U.S.
Rio Hondo (Southern New Mexico), a river in the southern part of New Mexico, U.S.
Places
Termas de Río Hondo, a city in the Santiago del Estero province, Argentina
Rio Hondo, a barrio in Consolación del Sur, Cuba
Río Hondo, Zacapa, a municipality in Zacapa department, Guatemala
Río Hondo, Los Santos, a corregimiento in Panama
Rio Hondo, a barrio in Zamboanga City, Philippines
Rio Hondo, Texas, a township in Texas, U.S.
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Q:
How to use find and exec to execute multiple commands
I have such a need:
In the directory video, I need to
find ./video -type f | while read myfile; do
tmp=`basename $myfile` #example.mp4
tmp="${tmp/.mp4/.html}" #example.html
cp index.html "$tmp"
sed -i '' "s#sceneFilePath:.*#sceneFilePath: \"$myfile\",#g" $tmp
#done;
Here is my directory:
dir
|--- video
| |--- example.mp4
|--- index.html
|--- generateHtml.sh
generateHtml.sh is just like above.
Here is what it does:
find the example.mp4 file in video, then cp index.html example.html and change a string in the example.html.
It works well.
But now for some path and name of .mp4 files, there are some special characters, such as &, , -. It doesn't seem that while read works for these cases.
I've heard that find -exec can handle all of special characters but I don't know how to use it for this case.
A:
See Using Find for detailed discussion.
find ./video -type f -print0 | while IFS= read -r -d '' myfile; do
tmp=$(basename "$myfile") #example.mp4 -- consider also tmp=${myfile##*/}
tmp="${tmp%.mp4}.html" #example.html
sed "s#sceneFilePath:.*#sceneFilePath: \"$myfile\",#g" \
<index.html >"$tmp"
done
Note:
-print0 is used on the find end, and IFS= read -r -d '' is used on the read end; this ensures that all possible filenames (including names with newlines, including names with leading or trailing whitespace) are supported.
The former substitution, which replaced the first instance of .mp4 anywhere in the filename with .html, has been replaced with one which strips .mp4 off the end of the filename, and appends .html.
"$myfile" is quoted in invoking basename. This was your most substantial immediate bug in the original code, as previously a filename could be split into multiple separate arguments to basename.
$() is used instead of backticks. This modern (and yes, POSIX-compliant) command substitution syntax can be easily nested and has much clearer semantics for backslash escapes within.
sed -i, which is nonstandard and nonportable (the above was valid for MacOS but not for GNU), is unneeded here; one can skip the cp and do the transform in-line.
|
{
"pile_set_name": "StackExchange"
}
|
788 F.Supp. 539 (1992)
Homer BRANCH, et al., Plaintiffs,
v.
MOBIL OIL CORPORATION, Citation Oil and Gas Corporation, Texaco, Inc., and Atlantic Richfield Company, Defendants.
No. CIV-90-723-R.
United States District Court, W.D. Oklahoma.
March 13, 1992.
Gina L. Hendryx, John W. Norman, Norman & Edem, Robert N. Barnes, Patranell Britten, Roy Short, Jacqueline M. Short, Stack & Barnes, Oklahoma City, Okl., Phillip R. Scott, Waurika, Okl., for plaintiffs.
Gary W. Davis, Paul D. Trimble, L. Mark Walker, Crowe & Dunlevy, George E. Sneed, Verland E. Behrens, R. Steven Haught, Daugherty, Bradford, Fowler & Moss, Oklahoma City, Okl., J. Randall Miller, Moyers, Martin, Santee, Imel & Tetrick, Tulsa, Okl., Randle Jones, Denver, Colo., for defendants.
ORDER
DAVID L. RUSSELL, District Judge.
Before the Court is yet another motion by Defendant Atlantic Richfield Company ("ARCO"), this time a motion to dismiss *540 Plaintiffs' Third Amended Complaint for failure to join what Defendant contends are non-diverse indispensable parties to Plaintiffs' claim for unjust enrichment.
Defendant ARCO's argument proceeds as follows. A claim for unjust enrichment is a quasi-contract claim which is based in contract. Defendant ARCO and other owners in the Healdton One Unit are either partners or joint venturers, according to Plaintiffs. Plaintiffs' claim against ARCO for unjust enrichment is based upon an implied contract with the partnership or joint venture. Rule 19, F.R.Civ.P., requires that all partners or joint venturers must be joined where the relief sought is based on contract, citing Federal Resources Corp. v. Shoni Uranium Corp., 408 F.2d 875, 878-79 (10th Cir.1969) and Purcel v. Wells, 236 F.2d 469, 472 (10th Cir.1956).
The Court agrees with Plaintiffs that the alleged conduct of Defendants which Plaintiffs claim unjustly enriched Defendants is delictual rather than contractual in nature. The conduct is expressly alleged to be negligence and negligence per se. See Third Amended Complaint at ¶¶ 25-28. As a remedy for such alleged conduct, Plaintiffs seek disgorgement of gains flowing from Defendants' alleged wrongdoing, in the form of the money saved by Defendants by not complying with state law and Oklahoma Corporation Commission rules and regulations. Disgorgement is a restitutionary remedy or remedy for restitution. See Warren v. Century Bankcorporation, Inc., 741 P.2d 846, 852 (Okla.1987). See also Tull v. United States, 481 U.S. 412, 424, 107 S.Ct. 1831, 1839, 95 L.Ed.2d 365, 377 (1987). The underlying basis for disgorgement and other restitutionary remedies or tools like quasi-contracts is the prevention of unjust enrichment.[1]See Warren v. Century Bankcorporation, Inc., 741 P.2d at 852 & nn. 19 & 21. "[R]estitution may be sought in contract actions, tort actions, statutory actions and others...." D. Dobbs, Law of Remedies § 4.1 at 223 (1973). See also 1 Palmer, The Law of Restitution § 1.1, p. 2 (1978).
Plaintiffs' claim for unjust enrichment against ARCO for conduct occurring after formation of the Healdton One Unit is either limited to that amount by which Defendant ARCO as a unit owner has been unjustly enriched, i.e., to that amount of expenses attributable to ARCO's unit interest which were saved, in which event ARCO's and other unit interest owners' potential liability must be considered several, not joint, or is for the amount by which the unit has been unjustly enriched, in which case because the conduct which is the basis of the claim is tortious in nature, the unit owners' potential liability as principals of the operator is joint and several. Cf. Phoenix Airline Services, Inc. v. Metro Airlines, Inc., 194 Ga.App. 120, 390 S.E.2d 219, 225-26 (1989) (dicta) (the theoretical basis for imposition of joint and several liability on joint tortfeasors "would appear to be of doubtful applicability where the sole purpose of the award is to prevent unjust enrichment rather than to compensate the claimant for actual loss"), rev'd on other grounds, 260 Ga. 584, 397 S.E.2d 699 (1990). See generally 3 Am.Jur.2d Agency § 280; 59A Am.Jur.2d Partnership § 712. In neither situation are all of the unit owners necessary or indispensable parties under Rule 19, F.R.Civ.P. See generally 7 C. Wright, A. Miller & M. Kane, Federal Practice and Procedure § 1623 (1966) at pp. 342-345.
Defendant Atlantic Richfield Company's motion to dismiss Plaintiffs' Complaint for failure to join indispensable parties under Rule 19 is DENIED.
IT IS SO ORDERED.
NOTES
[1] Plaintiffs' Third Amended Complaint does not use the term quasi-contract.
|
{
"pile_set_name": "FreeLaw"
}
|
I don't like to "check" homework, because I understand that a select few don't
need it. However, if I don't atleast check to see if a student has attempted
it, everyone will classify themself as one of the select few. So I have a
middle ground. I check homework about 2 times a week. (It's unannounced. Sort
of like a pop homework check.) This gives me an idea of a student's homework
habits. I count it as a small portion of their grade (not more than 10%)
because that's the motivation for most of my students. I'll point out patterns
to individuals as needed, but for the most part, I let them make their choice,
whatever it may be. Then after the grading period, I create a scatterplot of
averages vs. homework. We then talk about what the data represents and have a
good review of other math topics. At the end, I offer a suggestion for those
who would like to improve their average - Do more homework! I hate to stand
over them to say this, but I'd rather it be a revelation that homework it
important. For most, this scatter plot works. (Of course a few catch on that
if homework it weighted into the average, it will have some affect on the
average!)
This material is based upon work supported by the
National Science Foundation under Grant DUE-0226284.
Any opinions, findings, and conclusions or recommendations
expressed in this material are those of the author(s)
and do not necessarily reflect the views of the
National Science Foundation.
|
{
"pile_set_name": "Pile-CC"
}
|
How to build optically active alpha-amino acids.
Various methodologies published in the literature dealing with alpha-amino carboxylic acid asymmetric synthesis are presented in a digest form. In each case, only some recent or most typical works are mentioned.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
// Jest Snapshot v1, https://goo.gl/fbAQLP
exports[`RadioButton by default renders correctly 1`] = `
<label class="vnt-radio">
<input type="radio" name="radio" class="vnt-radio__input"> <span class="vnt-radio__icon"></span> <span class="vnt-radio__text">Radio</span></label>
`;
exports[`RadioButton can be checked and disabled renders correctly 1`] = `
<label class="vnt-radio" checked="checked">
<input type="radio" disabled="disabled" name="radio" class="vnt-radio__input"> <span class="vnt-radio__icon"></span> <span class="vnt-radio__text">Radio</span></label>
`;
exports[`RadioButton can be checked renders correctly 1`] = `
<label class="vnt-radio" checked="checked">
<input type="radio" name="radio" class="vnt-radio__input"> <span class="vnt-radio__icon"></span> <span class="vnt-radio__text">Radio</span></label>
`;
exports[`RadioButton can be disabled renders correctly 1`] = `
<label class="vnt-radio">
<input type="radio" disabled="disabled" name="radio" class="vnt-radio__input"> <span class="vnt-radio__icon"></span> <span class="vnt-radio__text">Radio</span></label>
`;
exports[`RadioButton can have content set using slot 1`] = `
<label class="vnt-radio">
<input type="radio" name="radio" class="vnt-radio__input"> <span class="vnt-radio__icon"></span> <span class="vnt-radio__text"><span>Custom content</span></span>
</label>
`;
exports[`RadioButton can have name attribute rendered correctly 1`] = `
<label class="vnt-radio">
<input type="radio" name="groupedRadios" class="vnt-radio__input"> <span class="vnt-radio__icon"></span> <span class="vnt-radio__text">Radio</span></label>
`;
|
{
"pile_set_name": "Github"
}
|
Two important new studies challenge the controversial hypothesis that venous congestion--chronic cerebrospinal venous insufficiency (CCSVI)--contributes to the development of multiple sclerosis (MS). This theory has resulted in many MS patients receiving experimental endovascular angioplasty, a treatment for MS unproven by clinical trials. The studies refuting the CCSVI theory with the first negative medical evidence on the subject, are available today in Annals of Neurology, a journal published by Wiley-Blackwell on behalf of the American Neurological Association.
For nearly 150 years it has been known that focal MS lesions tend to develop around cerebral veins that are thought to the portal by which inflammatory cells targeting myelin enter the brain. However, a 2009 study by Zamboni et al. offered an alternative theory suggesting that chronically impaired venous drainage (blood flow) from the central nervous system--a term that he labeled Chronic Cerebrospinal Venous Insufficiency or CCSVI--leads to MS development.1 Zamboni et al. also claimed that endovascular angioplasty was markedly effective in MS patients.2 Zamboni's work gained much attention in the press, especially their report that ultrasound diagnosis of CCSVI perfectly matched an MS diagnosis with 100% sensitivity and 100% specificity.
"These two papers should add a note of caution for MS patients and physicians who are contemplating interventions for possible venous abnormalities based on the findings of Zamboni. At this time, the theory must be considered unconfirmed and unproven. Such interventions carry risk, and several people have already been harmed by the inappropriate application of venous angioplasty and stenting for MS," says Stephen L. Hauser, M.D., the Robert A. Fishman Distinguished Professor and Chair of the Department of Neurology at the University of California, San Francisco, and editor-in-chief of the Annals of Neurology. A previously published review of the evidence in the Annals by Khan et al. noted that treatment procedures, based upon these findings, have included placing stents in the jugular veins of MS patients which led to serious injury in some cases.
In the current issue of the Annals, Florian Doepp, M.D., and colleagues in Germany performed an extended extra- and trans-cranial color-coded sonography study on 56 MS patients (36 female; 20 male) and 20 control subjects (12 female; 8 male). The analysis included extra-cranial venous blood volume flow (BVF), internal jugular vein (IJV) flow analysis during Valsalva maneuver (VM), as well as tests included in the CCSVI criteria.
Results showed that blood flow direction was normal in all participants, excluding one subject with relapsing-remitting MS. Furthermore, the research team noted that blood volume flow (BVF) in both groups were equal in the supine body position. In summary, the researchers determined that none of the study participants fulfilled more than one criterion for CCSVI.
"Our results call into question the existence of CCSVI in a large proportion of patients with MS," said Dr. Doepp. "We did not find supporting evidence that cerebral venous congestion plays a significant role in the development of MS. Further studies are needed to clarify the difference between MS patients and healthy subjects in blood volume flow regulation," concluded Dr. Doepp.
A second study by researchers at Umeå University in Sweden also concluded that CCSVI does not contribute to the development of MS. The Swedish research team led by Peter Sundström, M.D., Ph.D., tested the vital component of the CCSVI theory--the obstructed IJV flow--in 21 MS patients and 20 healthy controls using magnetic resonance imaging with phase contrast (PC-MRI).
"Using PC-MRI, we were not able to reproduce the findings by Zamboni et al. which suggest CCSVI contributes to the development of MS," said Dr. Sundström. The researchers found no significant differences between the MS group and control group relating to total IJV blood flow. "Our study found no support for using endovascular procedures such as angioplasty or stenting to treat MS patients," Dr. Sundström affirmed.
MS is an inflammatory disease of the central nervous system in which lesions (plaques) form in the white matter of the brain and destroy the myelin sheath around nerve fibers. Initial symptoms of MS--typically blurred or double vision, muscle weakness, sensory changes, or difficulty with balance--usually appear between the ages of 20 and 40. The course can be relapsing-remitting or relentlessly progressive, and if untreated results in permanent neurologic disability in most affected individuals. MS affects 2.5 million individuals worldwide, making it one of the most common neurological disorders and causes of disability in young adults.
About the Journal:Annals of Neurology, the official journal of the American Neurological Association and the Child Neurology Society, publishes articles of broad interest with potential for high impact in understanding the mechanisms and treatment of diseases of the human nervous system. All areas of clinical and basic neuroscience, including new technologies, cellular and molecular neurobiology, population sciences, and studies of behavior, addiction, and psychiatric diseases are of interest to the journal.
About Wiley-Blackwell:
Wiley-Blackwell is the international scientific, technical, medical, and scholarly publishing business of John Wiley & Sons, with strengths in every major academic and professional field and partnerships with many of the world's leading societies. Wiley-Blackwell publishes nearly 1,500 peer-reviewed journals and 1,500+ new books annually in print and online, as well as databases, major reference works and laboratory protocols. For more information, please visit www.wileyblackwell.com.
Disclaimer: AAAS and EurekAlert! are not responsible for the accuracy of news releases posted to EurekAlert! by contributing institutions or for the use of any information through the EurekAlert system.
|
{
"pile_set_name": "Pile-CC"
}
|
Mouse leukemia cells bearing TL surface antigens escape from destruction in mice immunized against those antigens, but the same cells are effectively killed when other antigens (e.g., H-2) serve as targets. Correlating with escape is the tendency for TL plus tumor cells to acquire resistance to TL antibody-\and guinea pig complement-mediated lysis following exposure to TL alloantiserum (antigen modulation or evasion). Evasion also affects some mouse lymphomas expressing murine leukemia virus major envelope glycoprotein, MuLV gp70. Evasion-positive tumors grow in all syngeneic mice immunized against gp70 by passive immunization with xenoantisera, whereas evasion-negative tumors are rejected by some immunized mice and growth is markedly suppressed in others. Evasion-positive and -negative variants of FLC745 and RBL-5 lymphomas are being studied to establish the relationship between antigen evasion and tumor escape. Xenoantisera, mouse antisera, and monoclonal antibodies to gp70 and other MuLV components expressed on the cell surface will be utilized, and evasion of cytolysis will be measured in a radiochromium release assay. Antigen lateral mobility, antibody-induced antigen aggregation, and steric hindrance of complement binding (guinea pig Clq) are apparently responsible for evasion. Factors not directly related to antigen evasion include: (1)\quantitative representation of target antigens before and during antibody sensitization and quantitative aspects of antibody binding; (2)\manner of antigen presentation at the cell surface, molecular associations, and molecular and ultrastructural organization; and (3)\differences in detected antigen specificities. Defense mechanisms involved in rejection of evasion-negative tumors are being examined, and a fully homologous (mouse antisera and complement) antigen evasion assay is being developed. Short-term gp70 antigen evasion appears to result from lateral mobility/aggregation of gp70 molecules influenced by surface membrane dynamics, motile cell activity, and cytoskeletal elements as well as antibody binding. There is no apparent involvement of complement (C3), differences in gp70 antigenicity, surface representation or configuration, differential cell sensitivity to complement lysis, or different cell growth characteristics. (IS)
|
{
"pile_set_name": "NIH ExPorter"
}
|
Transcriptional regulation by infliximab therapy in Kawasaki disease patients with immunoglobulin resistance.
Infliximab (IFX), a known monoclonal antibody against tumor necrosis factor-α (TNF-α), is used to treat Kawasaki disease (KD) patients with intravenous immunoglobulin (IVIG) resistance. The transcriptional modulation of inflammation following IFX therapy has not been reported in KD patients. We investigated the transcript abundance profiles in whole blood obtained from eight IVIG-resistant KD subjects treated with IFX therapy using microarray platforms and compared them with those in initially IVIG-responsive subjects. A pathway analysis was performed using WikiPathways to search for the biological pathways of the transcript profiles. Four transcripts changed by IFX therapy were subsequently validated using quantitative real-time polymerase chain reaction. The pathway analysis showed the reduced abundance of transcripts in the nucleotide-binding oligomerization domain, matrix metalloproteinase (MMP), and inflammatory cytokine pathways and the increased abundance of transcripts in the T-cell receptor, apoptosis, TGF-β, and interleukin-2 pathways. Additionally, the levels of four transcripts (peptidase inhibitor-3, MMP-8, chemokine receptor-2, and pentraxin-3) related to KD vasculitis and IVIG resistance decreased after IFX therapy. The administration of IFX was associated with both the signaling pathways of KD inflammation and several transcripts related to IVIG resistance factors. These findings provide strong theoretical support for the use of IFX in KD patients with IVIG resistance.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
ISTANBUL - Turkish President Recep Tayyip Erdogan on Friday continued to chart a collision course with Washington over Iran. Erdogan is categorically ruling out enforcing American sanctions intended to put Iran in an economic straitjacket.
"It is impossible for us to cancel relations with Iran with regard to oil and natural gas. We will continue to buy our natural gas from there," Erdogan said to reporters Friday, while returning from the United Nations General Assembly. Turkey is Iran's second-largest importer of natural gas.
"The importance [of] this announcement is economic," said Iran expert Jamshid Assadi of France's Burgundy Business School. "Any income in Tehran's situation is very welcome by the regime, which is increasingly starved of funds."
President Donald Trump talks with reporters after arriving at Joint Base Andrews, Sept. 26, 2019, in Maryland.
President Donald Trump imposed sweeping sanctions on Tehran after withdrawing the United States from an international nuclear accord with Iran. Dubbed a "maximum pressure campaign" by Trump, White House officials indicated they want to cut Iran's energy exports to zero.
"The American grand strategy in the region, is not on the same line as Turkey's foreign policy, not now and not in the past," said international relations professor Huseyin Bagci of Ankara's Middle East Technical University. "Turkey will not go against Iran; we will not be Iran's enemy. Competitor yes, but never its enemy."
Erdogan acknowledged U.S. sanctions are impacting trade with Iran, saying Turkish private companies have curtailed oil purchases from the Islamic nation to avoid punitive measures. Speaking anonymously, a European banker said internationally-operating Turkish companies would not risk being hit with U.S. sanctions for trading with Iran.
Even so, the Turkish president is pledging to step up bilateral trade. "On this issue [trade] especially and many other issues, we will continue our relations with Iran," said Erdogan.
FILE - Turkish liras, center, featuring images of Turkish Republic founder Mustafa Kemal Ataturk, among other foreign currency, Istanbul, June 8, 2015.
Last week, Erdogan reportedly discussed with Iranian President Hasan Rouhani a goal of tripling bilateral trade, which currently stands at $10 billion. The discussions focused on ways to use domestic currencies — the Turkish lira and Iranian rial — as a means of evading U.S. sanctions that prohibit the use of the dollar in trade transactions with Iran.
"Turkey will circumvent and break U.S. sanctions against Iran, just as they have done in the past," said Bagci, "because Ankara does not believe it's bound by those sanctions. This will likely result in U.S. sanctions against Turkey, but Turkey is ready for that."
Erdogan told Fox News on Wednesday, "Sanctions have been avoided in the past. I, for one, know that sanctions have never solved anything."
Last year, a New York Court convicted and jailed a senior banking executive of the Turkish state-owned Halkbank for violating U.S. sanctions on Iran.
A street vendor sells roasted chestnuts in front of a branch of Halkbank in central Istanbul, Turkey, Jan. 10, 2018.
U.S. authorities are still considering whether to impose a fine against Halkbank, which analysts say could run into the billions of dollars. The size of any potential penalty is widely seen as leverage Washington has over Ankara.
Undaunted, Erdogan told reporters Friday he was aware his stance could invite punitive measures from Washington. Analysts note the Turkish president had already irked Washington by casting doubt over claims Tehran was responsible for an attack earlier this month on Saudi Arabia oil refining facilities.
"If we just place the entire burden on Iran, it won't be the right way to go. Because the evidence available does not necessarily point to that fact," Erdogan said Wednesday.
Saudi Colonel Turki al-Malki displays pieces of what he said were Iranian cruise missiles and drones recovered from the attack site that targeted Saudi Aramco's facilities, during a press conference in Riyadh, Sept. 18, 2019.
Several key European countries are backing Washington's belief that Tehran is behind the attack.
Ankara's strong backing of Tehran comes as Erdogan is trying to build regional support for his plan to repatriate as many as two million Syrian refugees.
Erdogan envisages relocating the refugees to a so-called "safe zone" in northeast Syria currently controlled by the YPG, a Syrian Kurdish militia. Ankara designates the YPG as terrorists, and Turkish forces are poised to push the militia 40 kilometers back from Turkey's frontier.
Iranian President Hassan Rouhani speaks during the Cabinet meeting in Tehran, Iran, Sept. 18, 2019.
Speaking in Ankara earlier this month, Rouhani insisted refugees be returned to their home towns, not repatriated en masse.
"Rouhani is saying to Turkey, that it will not support Ankara's plan of the mass returning of refugees, "said international relations lecturer Soli Ozel of Istanbul's Kadir Has University.
"Damascus and Tehran are perfectly happy that millions of Sunni Arabs, which oppose Damascus, are out of Syria," he added.
Analysts suggest Tehran will not soften its stance.
"Tehran will not just change its stance over Syria and refugees because Ankara is opposing U.S. sanctions, that is just a dream," said Bagci.
Despite Ankara and Tehran backing opposing sides in the Syrian civil war, the two countries, along with Moscow, say they want an end to the conflict.
Ankara's cooperation with Moscow on Syria has alarmed Washington. Turkey's purchase of Russia's S-400 missile system prompted Washington to suspend sales of the U.S. F-35 fighter jets. Turkish companies were also excluded from the warplane's construction.
|
{
"pile_set_name": "OpenWebText2"
}
|
Note: The League Table link opens the league tables page of the East of Scotland F.A. site in a new window.
Watt’s season ended with a whimper at Duns. Without four of the players who had played in Saturday’s win over Ormiston, the Watt side was again an unbalanced proposition and half the fourteen-player squad were Under-20 eligible, but there was hope that the makeshift side might be a match for a Dingers team playing its sixth game in twelve days and which has been calling in favours from former players to fill the shirts. The New Hawthorn Park pitch has been the issue here, the surface having been waterlogged throughout much of the winter, causing many postponements. It has dried out now, but is in poor condition, with its defects now being exacerbated by the number of home games Duns is having to play to catch up on its fixtures.
Watt started brightly enough. A corner in the fourth minute of play found the head of Chris Donnelly at the far post, but although he made a good connection, the ball struck a defender before reaching goal. A minute later, a fine passing move on the left between Donnelly and Anton Dowds took the ball deep into the home penalty area, but when the ball was set back by Donnelly to Dowds close to goal, Dowds slipped it carefully past the goalkeeper but past the far post.
So far, so good – but, sad to say, these early adventures were as good as it got for the Watt. A warning came in the tenth minute when Craig Saunders had to move quickly across goal to keep out a ball swung in from the left by Luke Strangeways following a corner kick. Watt was fortunate that the ball fell to a defender, George Windram, who was up for the corner, and he blazed the ball over the bar.
Dowds had another opportunity when he picked up a poor clearance and moved past a couple of opponents into the box, but his shot was blocked and when play moved to the other end of the pitch, the home side took the lead. The ball was moved inside from the left wing and Daniel Pattenden made a telling intrusion, injecting pace on the edge of the area to carry the ball forward and play it through to Jordan Lauder, who was unmarked in good position in front of goal and fired the ball into the corner of the net to the left of Saunders.
The Watt defence, lacking in experience and height, was struggling whenever Duns won a corner kick and Lauder had two heading opportunities in quick succession. The first was directed off the turf into the hands of Saunders and the second cleared the crossbar.
Watt’s best chance of the half seemed to have arrived when Donnelly accepted a throw-in from the left and nursed the ball across the pitch until he could time a pass to put Dunn in the clear. The pacy winger went into the penalty box, but his first touch on the uneven surface was a poor one and
Sean Robertson stretched to make a good recovery tackle and divert the ball for a corner kick.
The pitch also appeared to defeat Donnelly a few minutes later when a good pass put him in on the left side of the penalty box. Working his way forward, he never did seem to get the ball to sit in a position to strike it and eventually walked into a tackle.
Just before half-time, an excellent pass by Max Allison put Dunn in possession on the right. He cut into the box and seemed ready to move the ball on to his left foot for a shot, but the insistent calling of Donnelly changed his mind and he cut the ball back. The striker was in good space on the edge of the area, but his shot struck the player whom Dunn had been about to sidestep and went behind for only a corner.
Laurenson’s corner kick, not for the first time, landed close to goal amongst the feet of the players, but once again there was no Watt foot to knock the ball home before a home defender could clear it.
There was some hope in Watt ranks that Duns might begin to tire as we went into the second half, but it was the visiting side that appeared lacklustre as Duns took command. Six minutes after the restart, Duns swept forward. Players on both sides advanced towards the Watt goal like a tidal wave, with a suspicion of marginal offside more than once as the ball was passed out to the right wing. When it came back inside again, Strangeways struck it firmly into the corner of the goal.
Three minutes later, things got even worse for the Watt. A ball played down the right seemed to present no great problem for Jack Daniel, but he took his time, unaware that Pattenden was catching up fast. Daniel later admitted he didn’t see Pattenden at all, but as he went to play the ball, just inside the side line of the penalty area, the forward was going past him and he found himself playing his leg instead. It was an unfortunate penalty to concede, but no doubt Daniel learned his lesson and will make no assumptions in similar situations in future. Lauder sent Saunders the wrong way with the penalty to make it 3 – 0 to the home side.
Daniel made a much more positive contribution a few minutes later, surging out of defence and playing an accurate pass to Donnelly on the right. Donnelly found substitute Liam Walker deep inside the penalty box and when Walker took the unusual course of laying the ball back to a position well outside the area, Laurenson came tearing in and fired in a tremendous first-time shot. Unfortunately, he didn’t pick a line to take the ball right up into the corner of the goal and Duns goalkeeper Phil Smith was able to dive to his left and turn the ball away.
With quarter of an hour left, Watt got a toehold in the game with a goal from the unlikely source of right-back Alex Scott. A cross from the right by Walker came back across the penalty area and Scott ran in to drive the ball into the corner of the net.
At last, Watt had the ascendancy and it seemed possible that if another goal could be obtained quickly, an unlikely point could be on the cards. Donnelly picked up the ball in the right-back position and sent a fine pass down the right for Walker, whose cross was knocked behind for a corner kick, but the Duns defence held out and the moment passed. In pushing forward, Watt took some chances at the back towards the end and might well have conceded again, but the closest to another goal was when Pattenden’s shot from Lauder’s pass was touched over the bar by Saunders.
After a run of five consecutive defeats, it was a somewhat daunting prospect to face a side that had been on a good run until recently and had gone past Watt in the league table with five games still in hand. As it turned out, this was a comfortable victory and might have been so even had Ormiston not been reduced to ten men with the score at 1 – 0.
That view is based on the fact that throughout the game there was a lot of space for the Watt players to use, but is contradicted by the fact that they often didn’t seem to know how to use it. The situation does sometimes arise that there are too many choices for the man on the ball and the Watt players failed to identify the right option on too many occasions.
Watt started purposefully and Anton Dowds came close in the first minute, but an even better chance was passed up soon after by Chris Donnelly, found by Dowds with a pass from the left. Donnelly opened up his body and steered the ball towards the open side of goal, but failed to get enough purchase on the ball and Andrew Jack saved low to his left.
The Watt remained on the offensive, however, and took the lead two minutes later. Sean Campbell timed his intrusion perfectly to carry the ball clear of the visitors’ defence and as Jack advanced, he drove the ball past him into goal.
There was an opportunity to increase the lead four minutes later when Harry Warner was played in on a run towards the left side of the penalty box. He was in a good shooting position, but when Donnelly called for the pass, Warner lacked the conviction to deny his senior partner and go for goal, instead trying to find Donnelly with a pass inside which was never going to reach its target due to the closer presence of a defender.
A minute later, Donnelly popped up on the right and sent in a fine cross, but Campbell, in good position, allowed the ball to slide off his head. It ran to Warner on the left side and he was called offside, which was perhaps as well, as he sliced the ball over the bar anyway.
Dowds was the next to threaten, surging across the pitch into a shooting position, but he dragged his effort across goal and past the post.
After the spell of attacking by the home side, Ormiston got hold of the ball and came down the left side, Pieyan Khosrowpour firing in a shot from the edge of the area which Saunders only just kept out, turning the ball away via the post for a corner kick. Soon, however, Watt was back in the visitors’ area, Ryan Higgins managing to get a touch to take the ball past Jack, but being unable to catch it before it went over the by-line.
Another Watt attack should have brought the second goal, but when Dowds latched on to Donnelly’s pass and took the ball close to Jack, he sent his shot past the goalkeeper but with insufficient momentum to take it into goal and a defender recovered to retrieve it.
Just before the half-hour, an imaginative cross-field run by Campbell was picked out by a fine pass by Neil Laurenson, but as the midfielder went clear, Jack ran from his goal and tripped him before he could reach the penalty area. Jack was sent off, being replaced in goal by Ferguson, but all the Watt gained was a free kick on the edge of the area and from that, Donnelly put the ball over the fence and out of the ground.
Another scoring chance came about through more good work by Campbell, who won two tackles in quick succession to send Dowds away on the right. Seeing the substitute goalkeeper coming towards him, Dowds tried an early shot, but Ferguson did well, saving above his head.
As half-time approached, Laurenson again provided the telling pass, setting Donnelly loose on the left. The roles from the earlier chance were reversed, but when Donnelly cut the ball back to find Dowds, the position was even better. Dowds, however, contrived to slice the ball past the left-hand post.
Two minutes later, Laurenson repeated the trick, sending Donnelly down the left again. This time the striker needed no assistance and he drew out Ferguson and slipped the ball past him to put the Watt two goals ahead at last.
Early in the second half, Higgins shot just over from Campbell’s layoff, then after a quickly-taken free kick Donnelly stretched to put the ball into the side netting before Laurenson went down the left and set up Campbell for a shot which went just past the post.
The pressure eventually told with a third goal just after the hour. Jamie Hume’s ball into the box landed at the feet of Donnelly, who performed a swift turn and knocked a left-foot shot into the corner of the goal.
It seemed a matter now of how many Watt would score, but perhaps the effects of their bad run still weighed on the minds of the players, as four minutes later they conceded a soft goal. Alexander Dimitrov dragged the ball through a series of weak challenges and sent in a shot towards the corner of the net The ball struck someone’s leg and dribbled into the opposite side of the goal.
Suddenly we all felt the nervousness of the Watt defenders. Could they possibly blow such a strong position? It was always possible and Ormiston sensed a chance to achieve something extraordinary. Cam Dunn, who had come on as a substitute, tried to relieve the anxiety with a trademark left-wing run, but he worked his way in too close to goal before attempting a cutback and the ball was blocked behind. Soon Watt was under pressure again and Khosrowpour had a great chance to reduce the arrears further, but sent his shot just past the post.
Dunn rashly conceded a free kick in a dangerous position and the ball was sent across the Watt goalmouth, requiring just a touch to take it in. Khosrowpour sent in another shot, this time from just outside the box, but Saunders grasped the ball gratefully.
There had been almost twenty minutes of anxiety before Watt eventually made the points safe with a fourth goal. It was an expert finish by Max Allison, who had started the game at right-back and had moved into midfield when Alex Scott came on. Reminding us of a similar goal scored in a previous game, Allison showed great composure, timing his run to perfection to accept a pass from Donnelly, accelerating past the last defender and stroking the ball past Ferguson. It all looks so simple when it’s done properly.
Watt tried to put the icing on the cake with another goal, but when Dowds drove the ball across goal from the left, Dunn was not close enough to the far post to finish. He gathered the ball, however, and brought it back into the penalty area, where Ferguson made a fine diving save to deny him.
After a first half in which Heriot-Watt competed well and might have considered the basis for a victory, the brittle morale of the team was demonstrated by the way in which it fell apart after going behind early in the second period.
Early exchanges were favourable to the Watt, with Sean Campbell having the ball at his feet twice during a goalmouth scramble initiated when Neil Laurenson drove to the by-line and cut the ball back firmly. The ball was eventually turned behind for a corner and the chance disappeared.
There were few efforts on goal in the first half-hour and more, with Chris Donnelly’s left-foot effort from Fraser Wilson’s pass coming as close as any, but just passing the post.
Neil Robb had to be withdrawn after suffering a painful ankle injury, Scott Munro coming on with Laurenson pushing forward into midfield and this switch worked in the Watt’s favour six minutes from half-time with a fine opening goal. Donnelly tricked two defenders with a turn in between them and accelerated down the right before cutting into the area. Laurenson called for the ball to be played back to him on the edge of the area and when Donnelly obliged, he sent a firm right-foot shot into the top corner of the net.
There wasn’t long until half-time, but Watt was unable to maintain its lead until the interval. Three minutes after scoring, the visitors conceded a simple goal, a cross from the left finding Scott Coleman in plenty of space in the centre of the penalty area to head into the corner of the net.
The Watt was seldom in the game in the second half. Tynecastle started on the front foot, coming close from a good run and shot by left-back Robbie McIntyre, the best player afield on the day. Watt tried to respond and Wilson turned well on a head-flick by Donnelly, but his shot was blocked.
Eight minutes into the second period, Tynecastle went ahead. A ball was angled into the box from the left and Dean Crabbe popped up to steer it past the left hand of Craig Saunders.
Six minutes later, it was all over as a contest when Watt conceded again. A corner was initially repulsed, but with lots of players defending the area of the post, Martyn Robinson fired high into the net from an improbable angle.
Goals continued to come at regular intervals after this. Watt made a mess of trying to play out from defence and conceded a corner. The ball was played out of the area, but played back to the edge of the box where Mark Leslie controlled it and fired it into goal. This one was contentious, as the Watt defence was pouring out when the ball reached the scorer. The referee seemed to indicate as his view that there were three players offside, but Leslie was not one of them.
A demoralised Watt defence conceded a fifth goal two minutes after this when a cutback from close to the corner flag was driven home by Robinson, but after this, Watt took a bit of a grip and tried to do some attacking. A long clearance by Saunders was laid off by Wilson with a good cushion header into the path of Donnelly, but the striker’s first touch took the ball further right and he was obliged to play it across goal in search of a colleague. A Tynecastle boot was first to the ball to send it behind for a corner.
Former Watt player Calvin Muttitt, who had come on as a substitute for the home side, was giving a very lively performance up front and he set up a sixth goal for Tynecastle with a run to the by-line and a cutback which was turned in by Robinson to complete his hat-trick. Muttitt might have had a goal of his own when he made a good run through the middle and was well found by a forward pass. Muttitt did seem to have gone slightly too early and was probably about a yard offside, but he got away with it and it took a fine save by Saunders to keep out his volley.
Deep into stoppage time, we had the ironic situation of a free kick being awarded for a foul on Donnelly. Throughout the game, the referee had studiously ignored the manhandling of the Watt striker, especially at corner kicks, and had even cautioned Donnelly for a mistimed tackle, but in the last minute of the match he ruled for the striker for the first time, Donnelly’s drive through the centre of the Tynecastle defence having been ended by a challenge on the edge of the penalty area which was by no means the clearest foul perpetrated on him during the game. Donnelly took the kick himself, struck it into the defensive wall and got his foot to the rebound to send in a rather gentle effort which struck a defender and the post and rolled over the goal-line to give the Watt a late consolation.
Watt coped well with the league leaders in the early stages of the game and at this stage there was no suggestion of what was to follow later. The first goal arrived after twenty-five minutes’ play and Leith added a second before half-time.
The Watt coaching staff looked for an improvement in the second half, but the loss of a soft goal shortly after the restart gave the home side further confidence and sapped that of the Watt side. Leith played with freedom and purpose as the Watt passing deteriorated. In a half littered with mistakes, the demoralised visitors conceded four more to make this a night to try to forget.
Top-scorer Chris Donnelly was confined to the bench, having suffered an ankle knock, and Watt started with Fraser Wilson leading the attack.
It took some time for the visitors to get up to tempo and there were some nervous moments early on. Eventually the Watt settled into the game, however, and with Max Allison making penetrating runs from deep positions, created several chances to score before half-time.
It was all square at the interval, however, and the Watt lost momentum in the second half, giving the ball away frequently and failing to threaten the Burntisland goal. Even the introduction of Donnelly for the last half-hour failed to stimulate the visiting attack.
Shippy, which had caused problems throughout the game with long throws into the Watt penalty box, secured the points with a goal late in the game. Finn Watt attempted to head a long ball back to Craig Saunders and Kevin Masson nipped in to send a lob over the goalkeeper into the net.
A fuller report on the game, courtesy of the Burntisland Shipyard website:
A late strike from top scorer Kevin Masson was enough to see the Shipyard take all three points against Heriot Watt University at a sometimes snowy Recreation Park. In a game of few clear cut chances it was the home team that had the most and best opportunities and ultimately deserved their victory. Graeme Haywood, Pete Bell and Ewan Henderson came in for Andy Macdonald, Scott Devaney and Stephen Stark in three changes that manager Raymond Drury was forced to make after Monday night’s defeat to Lothian Thistle HV.
The Shippy came flying out of the traps and almost took the lead in the first few seconds when Henderson was played in on the right hand side of the box and his lofted effort drifted just wide of the far post. The big striker was involved again four minutes later when he headed wide from an Iain Millar long throw.
The Watt hit back in the eighth minute when Shippy keeper Mark Rowbotham had to save low at his near post as Sean Campbell tried his luck from a narrow angle. Heriot-Watt keeper Craig Saunders then had to react quickly as an Adam Doig strike took a deflection on its way to goal. The rest of the first half saw neither team create much in the way of goal scoring opportunities though Heriot-Watt shaded possession.
The visitors had the first attempt of the second half when Chris Lane drove narrowly wide from all of 25 yards in the 52nd minute. Masson drove a shot across the face of goal and just wide of the far post after a deft lay off by Henderson.
Millar’s long throw was a threat and Masson headed over from one in the 71st minute. Saunders then pulled off the save of the match when at full stretch he pushed away an angled Henderson drive from around 12 yards. At the other end Rowbotham saved from Neil Robb as the Watt showed they were more than capable of getting the opening goal.
In the 84th minute the Heriot-Watt defence allowed a long ball to bounce in the box and Masson was able to latch onto the ball but his lobbed effort narrowly cleared the bar. Amazingly the same scenario developed a minute later and this time Masson made no mistake as he lofted the ball over Saunders and into the back of the net. The Shippy were able to see out the remaining minutes without any real threat on their goal and went on to gain a well merited win.
.
Season 2015 – 2016: Match 31
East of Scotland League
2nd April 2016
CIVIL SERVICE STROLLERS 2 HERIOT-WATT UNIVERSITY 0
A Watt side bearing little relation to the team which played against Strollers in December – only Ryan Higgins, Chris Donnelly and Neil Laurenson were common to the starting line-ups – found the experience and competence of the Strollers too much to overcome. It is fair enough to point out that University sides always have to overcome adverse circumstances and can never expect to field a consistent team for long, but it should be recognised that the problems this season have been exceptional and that we are now calling on players who never expected to wear a First Team strip.
Two more players made their debuts in this game – Josh Mawji, who played the whole game at right back, and Murdo MacIver, given some playing time as a late substitute. It must be stressed that all the players who have been asked to step into the breach have done well – David Dunnett being the latest to step up to a regular place and to look quite at home in his role – but as was said in the dressing-room after the game, the Strollers were a team; the Watt a collection of individuals. How could it be otherwise when more and more changes are forced on the Head Coach for every game?
This one came at a particularly adverse time: during the Easter holidays. Several players went home for the break, adding to the problems of an exceptional injury list. Another aspect which may not be generally realised, but which has a big effect at times like these, is that we have a lower number of graduates in the squad than at any time in the last decade. With David Kerr, Michael Connor and Ronnie Napier, all of whom played earlier in the season, no longer involved, only Neil Laurenson and Chris Donnelly are graduates who are regulars in the team. Not only does this bring the side’s lack of experience into focus, it means that we lose a greater proportion of the squad when holidays intervene. To top it off, Jamie Hume was added to the injury list after Wednesday’s game against Tynecastle.
All right – enough tears in the beer. What is great news for the Watt is that we have this season an exceptional crop of new players. The new intake, most of whom have been involved with the Under-20 side this season, shows enormous promise. Already we have seen Jack Daniel, Max Allison, Liam Walker, Anton Dowds, Sean Campbell and Fraser Wilson appearing regularly in the East of Scotland League, but several more of the Under-20 squad have also featured in the First Team at one time or another and so far we have seen little or nothing at First Team level of talents such as Adam Breen, Chris Lane, Thomas Maher and Gregoire Dawirs, all of whom will surely feature in future seasons. In this match, we had Ruaridh Macvinish and Scott Munro to add to Allison, Campbell, Wilson and Walker. From the Amateur side, in addition to Dunnett and the recently-promoted Neil Robb, there were Mawji and MacIver.
As so often over the last month or so, the biggest conundrum for Head Coach Ian Little was what to do about central defence. Dunnett would fill one berth, but who else should be there, and what overall shape should be adopted? The solution for this occasion was to put Allison into the middle with Mawji and Laurenson wide. Higgins played in the anchor role in midfield, supporting Robb and Macvinish, with Campbell and Munro on the flanks and Donnelly up top. Loan goalkeeper Connor Wallace replaced regular custodian Craig Saunders, who was attending a wedding (not his own, we are assured).
The lack of experience of playing together in this defensive formation was apparent from the start . During the first half the Strollers were able to make effective runs into the heart of the Watt rearguard with some regularity and the opening goal was not long in coming. Six minutes had been played when a simple move on the left opened up the Watt defence with ease. Mathew Cunningham made a strong run to the by-line, cut inside and played the ball back for Jordan Finnie to ram it into goal from close range.
There were further near things before the Watt defence achieved a degree of cohesion: a good run by Alexander Brown set up a chance for Jack Downie, who shot narrowly past; then Finnie came close again, shooting across goal and just past the far post.
Eventually, Watt began to settle into the game and in the nineteenth minute there was a considerable scramble in the home penalty area following a corner, but when it was cleared, the Strollers, who make a speciality of counterattacking, moved quickly on to the offensive and won a free kick close to the Watt penalty area. When the kick was thumped into the defensive wall, Finnie recovered the ball and when it was returned to the box, Mawji did well, working it away to safety.
Finnie was again instrumental in creating danger for Watt when he slipped through a pass for Cunningham, but Allison showed great judgment in his positioning to keep the ball moving away from goal and get in a block to turn it behind.
Donnelly went on a trademark run just before half-time, hurdling tackles as he went, but just outside the penalty box he was felled by a foul challenge from Marc Milligan, who was cautioned. Campbell’s free kick was struck with power and passed the wall of defenders, but Stuart Burnside dived to his left and got both arms up to provide a strong block.
The Watt defence had slowly come together as the half progressed, but Mr Little clearly felt that there was still too much of a risk and at half-time he introduced Finn Watt, on the bench for the first time since returning from injury. Allison was moved forward into midfield, with Macvinish the unlucky player who was withdrawn.
Right from the restart, Donnelly went on another foray deep into Strollers’ territory, reaching the by-line, but unfortunately he was still going too fast to control his cross and it went behind.
In a frantic phase of play, Donnelly’s near-post header from Campbell’s left-side corner was saved by Burnside; then, in another swift counterthrust, Finnie seemed to be through on Connor Wallace but was foiled at the last second by a challenge from Watt.
Donnelly’s head-on gave Campbell a chance, but Burnside was out very fast and nipped the ball away from Campbell’s feet as he sought to poke it past him. Robb then did well to intrude, collect the ball and exchange passes with Campbell as he ran into the area. Robb then played the ball forward for Donnelly, but as the striker attempted to volley it, an alert challenge blocked the ball and Burnside was able to grasp it.
Finnie then got loose on the right and shot firmly towards the near post area, but Wallace was in good position to turn the ball round the post. Then, when Finnie was brought down two metres outside the penalty box, David Stewart’s shot was touched over the bar by Wallace.
A good header into the box by Robb gave a chance to the newly-arrived Wilson, but after a good first touch, he seemed to lose his footing and the ball ran past the post.
Into the last ten minutes of the game and there was still a single goal separating the teams. Watt tried hard to get back on level terms, with Donnelly picking up a pass to turn and shoot, but seeing his effort pass across goal and miss the far post. Robb then made a fine run down the left and cut inside along the by-line, but although he got to around the six-yard box, he seemed unable to pick an option and was tackled and dispossessed.
With five minutes left to play, the clinching goal came via the penalty spot. Strollers’ substitute Chris Milligan, who had been lively since his introduction, went down the left and took the ball inside Mawji. As he went into the box and was confronted by Dunnett, he feinted towards the line, then cut back inside. Dunnett’s trailing foot was available and Milligan went over it to sprawl on the turf. Most referees would probably have agreed with the penalty decision, but the loud noise produced by the impact of one boot on another confirmed the impression that Milligan, travelling at pace, had instigated the collision against a stationary foot. Anyway, a penalty it was and Finnie despatched it, despite a valiant effort by Wallace, who got a touch on the ball as it headed for the corner of the net.
It was hard to see the Watt coming back from a two-goal deficit in the last five minutes, but a mention must go to a smart piece of play by the Strollers. Gaining a corner deep into stoppage time, they appeared to be going to work the “keep it in the corner” move which invariably gets messy, provokes reckless tackling and often results in an outcome unwelcome to the team trying to execute it.
Strollers took a short corner and moved the ball back towards the corner flag, but then worked it back out again and kept possession as they moved the ball from one wing to the other. Eventually, it came to Finnie, who went into the box and fired in a shot to the near post area which Wallace was obliged to turn behind for another corner. A much more intelligent approach to keeping the ball and seeing out the game.
Watt’s disastrous home record continued with yet another single-goal defeat. It is now five months since the team enjoyed a home win. In that time, there have been five defeats and a draw, most of them against mid-table opponents. Civil Service Strollers, Coldstream, Hawick Royal Albert, Craigroyston and now Tynecastle have found the Riccarton synthetic to their liking, with the sole home point in that time coming from a draw against Stirling University II. By contrast, none of the five league games played away from home in the same period has resulted in defeat, Watt having beaten Craigroyston, Spartans II and Eyemouth United, and drawn with Lothian Thistle Hutchison Vale and Peebles Rovers. It is perhaps fortunate that Watt has only one home fixture left this season (against Ormiston on the 30th of April), but five away games. We can only hope that the sequence continues on Saturday when the Watt visits Christie Gillies Park to take on Civil Service Strollers.
The Watt started brightly in this game and attacked from the first whistle without coming close to creating a clear chance on goal. After withstanding the pressure, Tynecastle took the lead after twenty-one minutes’ play. A cross from the left drew Craig Saunders from his goal and when Stewart Adams made a clever run across the line of the ball and dummied it, Saunders was wrong-footed and the ball ran past him into the corner of the goal. Adams has been given the credit for the goal, but he didn’t appear to get a touch and the player who crossed the ball was probably the last to touch it.
Chris Donnelly found space a few minutes later, collected the ball and ran at the centre of the visitors’ defence, but with Ryan Ferguson pursuing him closely as he approached the advancing Craig Cockburn, Donnelly lost control of the ball and Cockburn was able to thump the ball away.
Donnelly had another couple of forays towards the visitors’ goal before half-time, shooting into the side net from wide on the right, then collecting an excellent pass from Liam Walker to go down the left and cut inside only for a vigilant defender to block his shot on the edge of the box.
After the interval, Watt looked reinvigorated and there were several good passing moves which breached the Tynecastle back line. Donnelly’s pass put Neil Robb into the penalty area, but the ball was on his left side and he may not have trusted his left foot for a shot. In trying to adjust, he played the ball once too often and a little too firmly, enabling Cockburn to dive on it. Then a good run by Sean Campbell took him past several players and when he was tackled, Neil Laurenson swung in a cross. Donnelly got up between the two centre backs, but he didn’t time his header quite right and the ball faded past the post.
From a quickly-taken free kick on the left, Walker sent in a cross which he sliced, almost to good effect, as a scrambling Cockburn couldn’t reach the ball as it slipped only just past the far post. Tynecastle mounted a swift attack after this, with Robbie McIntyre’s firm shot forcing Saunders into a diving save.
Another good intrusion by Donnelly created a chance for Walker and when his cross was turned behind, Campbell’s corner kick found the head of David Dunnett. The defender had to check his run, however, and the ball went upwards to land on top of the goal.
A good turn and pass by Robb sent Campbell into the box, but he couldn’t shake off Ryan Hall and Cockburn was out quickly to grasp his attempt to link with Donnelly.
Finally, half-way through the second half, Watt got the goal their play had promised. Ryan Higgins got the break of the ball on the edge of the box and kept his head to sidestep Cockburn and roll the ball into goal from eight metres.
The equaliser galvanised Tynecastle into more assertive action and five minutes later the visitors took the lead again. A long pass down the right tempted Saunders from his goal, but he had little chance of reaching the ball first. With the action at the far end of the ground, your correspondent was unable to identify the players involved, but the man who took it round the goalkeeper centred it to where two team-mates waited. There were two Watt defenders as well, though; one blocked the initial shot and the other diverted the follow-up over the bar. It seemed like a miraculous escape, but when the corner was delivered to the far post, Ferguson rose to head the ball firmly down and into goal. Some on the Watt side claimed that Jamie Hume had been held down by the scorer and prevented from jumping, but the goal stood and Watt trailed once more.
Five minutes after that, things got worse. The luckless Hume was again involved, penalised for a challenge after a cross into the Watt box. Adams fired the penalty kick into the corner of the goal, assisted in his selection by Saunders diving slightly too soon.
Straight from the kick-off after this goal, Donnelly went on an amazing run, penetrating on the left, then turning across the line of the penalty area, dribbling past one man after another. Eventually, finding himself running out of space to get in a shot as he continued towards the right, he turned and drove the ball towards goal, but William Mitchell was right in the way and blocked the shot almost immediately it was struck.
Although it now looked fairly desperate for the Watt, they kept battling away and trying to create opportunities and with two minutes of regulation time left, the deficit was cut back again to one by a truly sensational goal. Donnelly had launched himself time and again at the Tynecastle defence and when the ball came to him, a long way out with most of his opponents between him and his target, he set off again, coaxing the ball through challenge after challenge in a direct line towards goal. When he got close to the penalty area and was confronted by the last line of defenders, he stabbed the ball past them into the box – perhaps too far, we thought, as Cockburn sprinted from his goal – but then, with a searing burst of speed, Donnelly reached the ball as the goalkeeper stooped to gather it and deftly scooped it over him to allow it to run into the corner of the goal.
It was a goal which will live long in the memory of those who saw it and it was worthy of winning any match – but it didn’t win this one, or even secure a point. Into stoppage time, with the Watt attacking in pursuit of the one goal now needed to secure a point, Alex Scott cut inside and slipped a pass into the area to give Donnelly another opportunity, but as the striker turned and accelerated, a superb tackle stopped him in the act of shooting. From the resultant corner, Scott sent in a good header, but Cockburn got across his goal to turn the ball round the post again. When Laurenson’s second corner fell amongst the players on the far side of the box and Jack Daniel’s effort was blocked, the Watt ran out of time and opportunities.
It has often been remarked how cruel the fates can be to those who are already bearing a burden and Eyemouth will bear testimony to the truth of the adage. Still struggling to find their first point of the season, the Berwickshire club’s players put great effort into this game, but injuries to key players severely affected their chances and will be worrying manager Gary Scott ahead of their Alex Jack Cup Final, in which United takes on the might of Leith Athletic in just a fortnight’s time.
The first half produced chances for both sides. Watt began with an attack in which Ryan Higgins drove into the box and set up Ruaridh Macvinish for a drive from the left side, but Adam Mutch saved with his feet. Eyemouth right-back Alan Speirs was alert to chance to send in a first-time shot when the ball fell to him when an attempted clearance was blocked, but again the goalkeeper was equal to the situation, Craig Saunders catching the ball above his head.
Eyemouth’s first injury problem came as early as the twelfth minute. Chris Donnelly turned outside the area and drove forward, but when the ball was cleared, home centre-back Gordon McInnes was still on the ground. It took him some time to get back to his feet and as he limped off, clearly in pain, it was hard to see him taking further part in the game, but after a couple of minutes he was back to the fray. They make them tough down Eyemouth way.
Shortly after this, things got worse for the Fishermen. Donnelly got round the defence on the Watt left and worked his way inside. Just as he raised his head to try to pick a cutback, he was pushed over from the rear. After the previous week’s late equaliser at Peebles, this was the second time in less than half an hour’s play that the Watt had been given the gift of a penalty kick after an obvious but inexplicable foul. Donnelly didn’t dwell on the motivation of the perpetrator, but simply drove the kick into the corner of the goal as the goalkeeper went the other way.
A good clearing header by Ross Wylie when a corner from the left was headed on at the near post kept the deficit to one and soon Eyemouth was on the attack. A silly foul by Robb gave Lewis Mitchell the chance to play the ball into the danger area. Dean Walker knocked it into the net, but the referee was in good position to cut short his celebrations with an offside decision.
Walker was not to be denied, however, and two minutes later he was celebrating again. The Watt defence was still organising when United worked a short corner move and when Sean Campbell played the ball towards the far post, Walker stabbed it towards goal. Saunders grabbed the ball and pulled it back into his arms, but again Mr Smith was on the spot to judge correctly that it had crossed the line before being pulled back.
The Watt defence was looking fragile and Speirs had a chance on the turn after another corner was allowed to go loose, but Saunders was in position to clutch the ball.
After these alarms, Watt went back ahead. Robb was brought down on the Watt right and when Macvinish delivered a good free kick, Robb timed his run perfectly to direct a firm header past the left hand of Mutch into the corner of the goal.
Eyemouth sought to respond quickly and Paddy Tillbrook struck a half-volley from the edge of the area, but again found Saunders in the right place to make the catch. Wylie then became the next Eyemouth player to suffer an injury, jarring his knee and having to be replaced by Max Scott.
The home side might have equalised again when a good move on the left ended in a precise cross by Tom Wyman which Walker headed just over. Campbell then won a challenge and drove into the penalty box but dragged his shot wide of the post.
A good pass by Jamie Hume picked out Donnelly on the edge of the area, but when he turned and shot, Mutch saved well, diving to his right to turn the ball away for a corner.
Two minutes from half-time, Eyemouth suffered another significant injury. With one central defender already hurt, his partner became the next casualty. Jason Anderson’s challenge on Donnelly, as he tried a hook shot after bringing down a pass on his chest, was a brave one, but the defender paid for his courage by jarring his ankle in the collision which resulted. He also stayed on the pitch, but during the second half it became increasingly obvious that every movement required was giving him great discomfort.
The home side finished the first half on the attack and Jack Daniel was forced into a rather desperate intervention which took the ball on to the top of his own crossbar and behind. From the resulting corner, Speirs got in a header at the near post, but the ball slipped just over the bar.
Within two minutes of the resumption, Tillbrook had come close after a good move on the left gave him a shooting opportunity, but his shot passed just over the junction of post and bar. Soon, however, the Watt began to dominate. Liam Walker couldn’t have come any closer than he did when he took advantage of defensive hesitation to nip the ball away and bring it inside along the line of the penalty area to send in a right-foot shot which struck the post to Mutch’s right, rebounded across the face of goal and curled out of play past the other post.
McInnes at last gave up the struggle against his injury at this point and was replaced by Anthony Howden. It is to be hoped that the bravery of both McInnes and Anderson in playing on under injury does not mean that they are out of action for longer as a result, as they are both important players for United.
No sooner had McInnes left the contest than the Watt lead was increased. Hume tried a shot from all of forty metres and a deflection early in its trajectory took it for a corner on the right. When Neil Laurenson swung in the kick to the near post area, Donnelly was off his mark and leaping high to send a well-judged header past Mutch and high into the net.
Another Laurenson cross gave Robb another heading chance shortly after this; Mutch, diving low to his right, turned the ball aside and Donnelly did his best to turn it back on goal but the angle was too narrow.
Good work by Macvinish created another chance when he worked his way across the pitch and found Walker on the left. Walker cut inside and sent in another good right-foot shot which was touched over the bar by Mutch. Again, Laurenson used his left foot to good effect, sending in a corner which this time went over the head of Donnelly for Hume to head home.
United seems to have the capability to ignore goals conceded and play with the same spirit and despite the unpromising scoreline the players did not allow their heads to go down. A fine attack ended in a fierce shot by Howden for which he had high hopes, but Saunders showed his shot-stopping prowess with a superb diving save to get a firm right hand to the ball and turn it round the post.
Wyman became the latest Eyemouth player to suffer an injury, hurting his arm, but he resumed after treatment. Speirs got in another effort on goal, narrowly missing with a header from a free kick, but with twenty minutes left to play, Watt turned the knife with two goals in a minute.
A good pass by Max Allison picked out Donnelly, who laid it off to his right for Anton Dowds, newly on as a substitute. Dowds measured his shot, took the ball in his stride and sent an unstoppable drive in off the far post. A minute later, another crisp drive, this time sent in by Macvinish from the edge of the area, found the same corner of the net.
Eyemouth’s never-say-die attitude was commendable and after David Dunnett had blocked the ball after good work on the edge of the Watt area had set up an opportunity, Scott drove in the rebound, forcing Saunders to leap to touch the ball over the bar. The corner was a good one, requiring a touch from the big goalkeeper to take it out to the far side away from goal.
After Tillbrook became the latest home player to be forced off by injury, manager Gary Scott deputising, Eyemouth’s increasing defensive immobility as Anderson’s injury took its toll enabled the visitors to add a final goal with six minutes to play. Allison made a good tackle and passed to Dowds, who turned and accelerated between two defenders to slip the ball past Mutch and complete the scoring.
Whitestone Park was declared playable for this fixture, but that perhaps reflects the desperation to get on with the league programme more than the actual state of affairs. There was no water lying on the pitch and the surface was flat enough at the start of the game, but it was so soft that after a very short time, large divots dotted the pitch and the heaviness of the going made constructive football difficult.
As Watt’s injury problems continue, it was once more an unfamiliar-looking selection, with three players promoted from the LEAFA Amateur team included. Neil Robb was making his first start for the First Team this season, Ollie Spence his second and David Dunnett was playing East of Scotland football for the first time, partnering Jack Daniel in the centre of defence, Jamie Hume having joined Finn Watt, Adam Woolven and David Kerr on the list of central defenders unavailable for selection.
Neil Laurenson did good work early on, hooking clear a dangerous diagonal cross which had been headed on around the penalty spot, but Watt began to settle and Chris Donnelly made a great run through the Rovers defence in twelve minutes. Donnelly’s cutback found Sean Campbell, whose shot from close range looked a scorer until somehow Darren Walker managed to get a hand to the ball.
Peebles responded well and the lively Brendan Edwards just missed with a shot from the edge of the penalty area. The home side came close again a few minutes later when Paul Murray drove through a square-looking home defence. He sent a well-judged lob towards goal, but saw Craig Saunders stretch up a long arm to knock the ball into the air and catch it as it fell. Saunders saved his side again a couple of minutes later with another fine stop, but the Watt defence was fortunate that Daniel Rennie’s first touch on the rebound took the ball into a position that made it difficult to shoot and eventually it was scrambled clear.
A goal seemed to be coming for the Rovers and it arrived half-way through the first half. The ball was worked across from right to left and when it reached Rennie, he cleverly returned it to the other side of the goal to give Murray a tap-in.
Peebles stepped up the pressure to try to make the outcome secure at an early stage and within the space of a few minutes James Young came close with a shot and then with a header.
Just before the half-hour, Spence succumbed to the recurrence of a knee problem and was replaced by Liam Walker, but soon the home side was applying more pressure, with a hook shot coming off the bar. Watt survived this torrid spell and after Alex Scott stopped another attack with a good tackle, a ball played upfield gave Walker a chance to use his pace. He ran clear of the pursuit, but sent his shot against the legs of his namesake in the Peebles goal.
This was the signal for a spell of Watt attacking, however, and for a time the visitors applied some pressure, with Campbell combining with Max Allison to win a corner on the left, but before the interval the defence was struggling again to resist the Peebles attack. Saunders made yet another superb save, diving to get his hand to a close-range header, but he could do nothing about Young’s shot which came off the foot of the post.
It was the Watt goalkeeper to the rescue again early in the second half when Kenneth Munro drove in a firm shot through a crowd of players in the penalty area, only for Saunders to throw out a right hand and block the ball away. It was a crucial save, as a minute later the scores were level. A diagonal ball put Liam Walker away again and this time as Darren Walker advanced towards him, he played the ball away to the left. It was too tight an angle for a shot, but Walker sent in a perfect left-foot cross to the far post, where Robb arrived to head the ball into the net from close in.
Survival had been the theme for the Watt early on, but as the game went on, it had become increasingly balanced and now Watt looked as likely to score as their opponents, especially with the pace of Walker and Donnelly a constant threat to a defence which continued to play rather a high line on a pitch made for balls over the top.
Ruaridh Macvinish had replaced the injured Scott and his shot was deflected for a corner on the hour. Shortly after this, Donnelly collected the ball in midfield and sped down the right, hampered by a series of challenges by Robert Johnstone. Robb was lurking in an area similar to that which had got him his earlier goal, but this time the attempted cross was deflected behind.
Just as things were beginning to look promising for the Watt, the home side scored again. A cross from the Peebles left was headed up rather than out and Young performed an overhead kick to send the ball into the postage-stamp corner.
Watt had plenty of the ball now against a Peebles side on which the heavy pitch had taken a toll. A good move involving Donnelly and Watt substitute Anton Dowds gave a shooting chance to Campbell, but on the turn he was unable to generate the power needed to trouble the goalkeeper.
Peebles still had the capability to cause problems and a shot by Edwards was turned round the post by Saunders before Macvinish was on hand to kick a header off the line from the resultant corner.
With two minutes of regulation time to play, Campbell received a painful clip on the ankle in a challenge by Edwards and when the free kick was sent into the Peebles box, a defender unaccountably knocked the ball down with his hand. It was a clear, if puzzling, penalty and Donnelly gratefully accepted the gift with a low drive past Walker to secure a point.
Watt had one final scare when a cross from the left found Edwards in space, but Campbell came in quickly to apply pressure and the shot was sliced wide.
For the third time in four games, Watt lost 2 – 1. This time, the Club tumbled out of the King Cup for this season, but it was gratifying to push the reigning league champions so close with a squad which contained no fewer than eight Under-20s. Indeed, the starting eleven contained three players who had played ninety minutes at Prestonpans the night before and the bench contained two others who had played the full game and another who had played most of it.
During the first half, Watt kept a good shape and took whatever chances they could find to test the Lothian defence. Fraser Wilson came close to giving the visitors the lead half-way through the first period, accepting a crossfield pass and deftly flicking the ball over the head of his marker, but John Gilbertson read the danger and was off his line in a flash to block the shot with his right arm.
The Watt goal came under siege for a spell around the half-hour, but Sean Campbell was alert to get to the ball first when a low cross flashed across the goalmouth and Alex Scott was in position to kick clear from near the post when a corner was headed towards goal.
Having had few moments of anxiety during the first half, Watt fell behind with the last action before the half-time whistle. A foul by Scott on the touchline enabled a free kick to be delivered into the goalmouth. The ball brushed a head in the middle of the penalty area and came to Alan McDonagh at volley height. McDonagh is the scourge of the Watt, as he always seems to get on the scoresheet when playing against us, and he met the ball sweetly to steer it past the right hand of Craig Saunders and high into the net.
Watt started the second half with inventive work by Chris Donnelly which produced a corner, but when Lothian cleared the ball, they mounted a counter-attack to devastating effect. As the ball was moved from man to man across the Watt defence from left to right, Lothian always seemed to have the extra player. When the ball arrived at the feet of the last man in the chain, Willis Hare, he struck it with great power and accuracy across Saunders into the far corner of the goal to put his side two goals ahead.
Wilson, who had played a lot of football within the space of a few hours, was replaced by Neil Robb and the substitute quickly made his mark with some confident running and passing. Campbell was also relieved of further duties shortly after, with Ruaridh Macvinish joining Robb in a diminutive but effective midfield pairing.
With around twenty minutes to play, Watt had an escape when Saunders was only able to block a corner and Scott Taylor-Mackenzie fired the ball over from close range, but a minute later the Watt was back in the game. A free kick on the right was superbly dummied by Scott to enable Max Allison to send in a cross. It arrived at the feet of Donnelly, who must have been surprised to have had time to bring the ball down, turn and fire an accurate shot just inside the post to Gilbertson’s right.
The goal made a huge change to the game. Lothian, who had previously been confident and relaxed, immediately felt the strain, showing anxiety in their play and in their calls to each other. Robb seized on a ball played inside by Donnelly, but the penalty area was crowded and his shot was deflected behind.
Watt remained on the offensive for most of the rest of the game, without managing to create any clear-cut chances as Lothian tried to run down the clock, but the sight of Robb outjumping McDonagh to head the ball forward showed how much effort the visitors were putting into the game. In the end, it wasn’t enough and time ran out on a valiant effort.
All the old adages about character emerging in adversity were proved true again at Ainslie Park. One could only gape at the Watt team selection for this game. A squad already depleted by many injuries had lost several more important players: from the previous Saturday’s squad, we were missing Connor Godsell, Mark Hamill, Michael Connor, Bruce Hay and above all, Adam Woolven, injury having brought to an end his superb record of having played every minute of every game to this point throughout the season.
There was no return for Jack Daniel, Harry Warner or Martin Green and added to the continued absences of Finn Watt, David Kerr, Rob Service, Jamie Forsyth, Cam Dunn, Stevie Wright, Ronnie Napier and Alex Scott (and the loss of Elliot Sutherland), the depredations on the playing strength of the squad have been almost unbelievable. In the circumstances, it was fortunate indeed for the Watt to have such a pool of talent available as the Club’s Under-20 squad provides – and somewhat providential that the Riccarton floodlights comprehensively failed a safety inspection this week, putting paid to the Under-20 League fixture due for the Friday evening – but when facing a Spartans squad containing players of the experience of Danny O’Donnell, Michael Bruce and Donal Henretty, it was always possible that the youngsters would find the occasion overwhelming.
Not a bit of it. The Watt starting line-up contained five Under-20s and there were two more on the bench, but you could never have suspected the lack of experience from the performance given by the team. Andrew Imray and Ollie Spence made their First Team debuts, as did Thomas Maher when he came on as substitute. At no time in the match did the resolve of the young side waver and Sean Campbell, on his second start for the top team, showed the spirit of the lads by coming forward to rattle the crossbar with a shot from distance in the last ten minutes.
The first half was tight and tense, with the home side having the bulk of possession, but the Watt defence, well marshalled by Jamie Hume, looked calm and organised. The Watt might have had a chance on the break in eleven minutes, but when Chris Donnelly knocked the ball into space behind Bruce, the defender brought him down crudely and decisively. It was the second bad foul perpetrated by Bruce in the early stages of the game and although this one was committed forty metres from goal, the space in front of Donnelly meant that had he escaped the clutches of the defender he would certainly have had a goalscoring opportunity, but a caution was the sanction applied by the referee.
A splendid tackle by Imray set the Watt on the front foot a few minutes later, the ball moving rapidly out to Donnelly on the left. He advanced into the box and fired in a cross which resulted in the concession of a corner. Then a fine move on the right, again involving Donnelly, put Campbell behind the home defence, but his attempted cutback to Fraser Wilson was anticipated and cut out.
On the half-hour, Spartans produced their best move so far, with good passing and movement on the right taking the tricky Sean Stewart into the danger area to find Blair Atkinson, who drove in a shot to the near post area. Craig Saunders had anticipated that the striker would go across goal with his shot and had started to move to his right, but he managed to thrust out his left hand and block the ball by the post for Hume to clear.
Wilson, recently returned from a knee injury, rejoined the ranks of the injured five minutes before half-time with a recurrence of his knee problem and was replaced by Liam Walker. Watt finished the half positively, a bright move bringing a chance on the edge of the area for Anton Dowds. There were so many defenders massed in front of him that it hardly seemed possible to create space for a shot, but Dowds somehow managed it, although Ross Gilpin gathered his low drive.
Spartans introduced two substitutes at half-time, Henretty and Jordan Brown replacing Stewart and Paul Dickson. This was no bad news for the Watt, as Stewart had been the man who looked most likely to create problems for the visitors’ defence, and it may be that he had taken a knock. Without him, the Spartans, despite having a lot of possession, seldom ruffled the composure of the Watt back line.
In fact, the early stages of the second half were decisive in the match, as the Watt scored twice in three minutes. The catalyst for the first goal, coming five minutes after the restart, was a superb kick-out by Saunders, which fell into the stride of Donnelly as he sped to the right. Donnelly reached the penalty box and, despite being hampered by two defenders, managed to get in a shot which was blocked by Gilpin. The rebound fell for Walker, whose effort was also blocked, and Campbell was on hand to be the third to try a drive. Again, the ball was blocked and again it returned to Walker, but having seen three attempts to pass the goalkeeper with power fail, he sent a chip of the most delicate kind over the prone Gilpin to the corner of the net.
Two minutes later, Dowds set up a second, winning the ball in midfield and sending a great pass to Donnelly on the right wing. Donnelly got close to the corner and had the confidence to wait for the right moment. He waited and waited, in fact, with defenders unwilling to commit themselves – but then suddenly darted to the line and drove the ball hard and low across goal. Spence had read the situation and moved forward to prod the ball in from close range.
A minute later, Mark Gair found space and fired in a shot from distance which passed over the bar by a narrow margin, but soon another excellent clearance by Saunders had Donnelly tearing at the home defence again, this time speeding down the left. His cross soared over the group in the middle, but was retrieved by Campbell. When his cross was headed out, it was retrieved by Dowds, with Ryan Higgins and Neil Laurenson retaining possession, but when Laurenson sent the ball down the line, Donnelly was ruled offside.
Spartans had a period of pressure around the hour mark, but the Watt defence coped well with repeated thrusts following a free kick from the left and Spence bravely cleared under pressure. Brad Raiker recovered the ball but his shot from distance was a wild one.
Henretty and Chris Anderson combined on the edge of the Watt penalty box, but Saunders was in good position to grasp Anderson’s shot. Raiker then got in a drive which Saunders touched behind and Hume headed the corner out of harm’s way for a throw on the far side.
Watt survived this torrid spell and pushed forward again. When Campbell was fouled in the middle of the Spartans half of the field, the ball was touched to Dowds for a shot, but the distance was too great for him to generate enough power to trouble Gilpin.
With twenty minutes left to play came perhaps the nearest thing to a goal for Spartans. The ball ricocheted through the Watt defence and Henretty turned to try to prod a volley past Saunders, but the big goalkeeper was out just in time to spread himself and get a touch to keep the ball out.
Ten minutes from time, another searching run by Donnelly carried the ball into home territory before he turned and found Campbell in good position. The young man, finding himself in space, pushed the ball in front of him and ran forward to strike a shot which flew over the head of Gilpin and struck the crossbar hard before bouncing back into play.
Spartans began to fire the ball forward as time ran away and a long ball succeeded in putting Atkinson behind the Watt defence, but his half-volley lob landed on the roof of the net.
Thomas Maher had come on for the Watt and showed plenty of confidence in dribbling the ball out of defence deep into stoppage time. He looked as if he would be caught out by one of two Spartans players bearing down on him, but managed to find a gap through which he played a superb pass to Campbell on the right. Campbell sped upfield into the home penalty area and fired in a shot which was blocked by Gilpin. Donnelly was in attendance, but the ball didn’t come his way and was knocked behind for a corner, although with little time left, that was almost as good for the Watt, which kept its clean sheet to record a notable victory.
There were many excellent players for the Watt on the day, but some come in for special mention. Surely Andrew Imray will retain his first-team jersey after a mature and determined performance. He defended well but never lost the opportunity to make good passes when he had the ball at his feet. His partnership with Jamie Hume looks to be one on which the Watt defence can be built.
Anton Dowds had a fine match in the middle of the park, working hard and supplying the pass which led to the clinching goal. His Under-20 colleague, Sean Campbell, gave a mature midfield show, covering huge amounts of ground to make a barrier which Spartans always had to try to pass in order to approach the Watt goal, but still being positive enough to support the attack whenever possible; he was on hand to take a shot leading up to the first goal as well as having that late shot against the bar. The mercurial Liam Walker also made a notable contribution; as well as chalking up another goal, his pace and unpredictability worried the home defence. Ollie Spence ran himself into the ground but was still on hand to give himself a moment to remember with the second goal.
Of the first-team regulars, Chris Donnelly showed that he is about more than scoring goals (although he nearly scored on several occasions) and his drive and determination made him so hard to handle. He had a vital hand in both Watt goals and generally gave the home defence no rest. Craig Saunders had the satisfaction of another clean sheet and although he’s had harder afternoons, he made two vital stops, was in good position to make other saves look easy and made a considerable contribution to the attacking effort with some precise kicking to pick out the runs of Donnelly, including the kick which began the move which brought the first goal.
The report on the Under-20 game on the Friday evening says that the Under-20s, having suffered a rather undeserved defeat in their previous home game, this time lost deservedly. Oddly enough, for the First Team, the story is exactly the same. Having gone down 2 – 1 to Hawick Royal Albert the previous week in a game in which they perhaps deserved better, the Watt capitulated by the same score to Craigroyston and could not complain about the result.
It all started so well, too. With six minutes on the clock, ace scorer Chris Donnelly got back on the goals trail. In the Hawick game, Donnelly had drawn a blank for the first time in a league game he’s started this season, but it didn’t take him long to find the net in this match, side-stepping a defender to lash in a left-foot shot which Paul Tansey was unable to prevent finding the top corner of the net.
Great start – but by the time another six minutes had been played, the Watt was trailing. Greig Tulloch equalised, heading in from close range following a corner, and in twelve minutes came what turned out to be the winning goal.
This time, the Watt could feel hard done by. Max Allison, jumping for a header on the Watt left, was barged by one Craigroyston player into the shoulder of another, but as this happened, his arm apparently came up and struck the ball. The referee’s angle didn’t help him to see the foul on Allison and he awarded the free kick to the visitors. As often happens in such circumstances, a goal resulted. A cross to the far post was headed back across goal by Craig Dickson and Keith Buckley headed home from close to the goal line.
As the Watt defence continued to look porous, Craigie might have scored again when a good pass inside Mark Hamill enabled Chris Inglis to send in a dangerous cross, but the ball was scrambled away.
Watt responded with a cross by Donnelly which went over the players in the penalty box and was retrieved by Allison, who crossed to the far post where a diving header by Bruce Hay missed the target.
Watt’s defensive formation, with Neil Laurenson the latest player to be tried as a central partner for Adam Woolven, was not working well and changes were made, with Allison moving into the centre, Laurenson going to left-back and Hamill moving forward. This improved the balance and half-time was reached without further mishap.
Watt tried to get back on terms in the second half, but their efforts were seldom concerted and it was left to individuals to take on the visitors’ rearguard. Donnelly, with a good take and turn, ran at the Craigroyston defence, but with little in the way of support he was forced on a diagonal and when he took a shot there were three players between him and the goal and the attempt was blocked away.
Head Coach Ian Little did his best to vary the pattern, introducing Scott Munro, Sean Campbell and Liam Walker to the proceedings, but the Watt’s attacking efforts continued to be sporadic and disjointed in the main, although one good move produced a chance when Allison linked with Donnelly, whose pass into the box gave Ryan Higgins a sight of goal, but the Craigroyston defence was vigilant and the best the Watt could get was a corner, from which Walker tried a difficult header on the turn and sent the ball over the bar.
In the last few minutes of the match, Craigie threatened to steal another goal on the break, a dangerous low cross from Inglis just eluding Buckley at the near post and Chris Rooney at the far side. When Craig Saunders caught a cross, Inglis bundled him over the line. It was an obvious foul, but it seemed surprising for someone the size of Inglis to be able to move a man as substantial as Saunders. The game finished with the ball at Watt’s defensive end of the pitch.
Chris Donnelly was back in his familiar role in attack for the Watt as they took on a revitalised Hawick side which seems sure this season to attain its best league position for many years.
Donnelly wasted no time in threatening the Albert goal, either, cutting in from the left in the first minute, but he sent his shot high and wide.
With thirteen minutes on the clock, Watt came desperately close to opening the scoring. Michael Connor’s free kick curved round the visitors’ defensive wall and thudded against the inside of the post to the right of Kyle Rankin before rebounding across goal back into play.
Watt maintained the pressure and a good move which started with Connor and went through Harry Warner, Max Allison, Jamie Hume and Chris Donnelly, put Anton Dowds in possession on the left side of the area, but a good tackle by Ryan Stevenson saved the situation for Hawick.
Warner’s testing cross a minute later forced a defender into heading against his own crossbar and a few minutes later the same player did well again on the right, finding Donnelly, who laid the ball off to Connor in good position, but his shot was deflected behind.
In a rare foray forward by the visitors, Josh Morris sent a shot across goal and out on the far side and after this, the Albert began to assert themselves more. Following a corner on the left, Mark McEwen got in a header on goal, although Craig Saunders easily grasped the ball, and this was the prelude to a sustained spell of Hawick attacking which ended in Andrew Laidlaw cutting in from the right and sending a left-foot shot wide of the post.
Five minutes before the interval, a long kick-out by Saunders was well anticipated by Donnelly, who got ahead of his marker and headed on to Dowds. Dowds returned the ball to Donnelly, who was cutting into the box, but rather than taking the shot he opted to try to find Warner at the other side of the goal and his pass was overhit and went past.
Nine minutes into the second half, Watt took the lead with a goal of superb quality. Max Allison made a darting run through midfield and released a pass to Donnelly. Allison kept going forward and received the return from Donnelly on the edge of the box, whereupon he accelerated past two defenders and placed an accurate shot past Rankin’s right hand into the corner of the net. Timing, passing and execution had all been perfect and the goal was a thing of beauty – probably the Watt’s best of the season. What a pity it wasn’t a winner.
Eight minutes later, another huge kick from Saunders created a chance for the Watt. Warner, tearing down the right, got ahead of his marker and drove in a shot towards the near post. Rankin got down well to turn the ball round the post. The kick was directed towards the edge of the area and Donnelly laid it back for Connor, whose shot went narrowly past.
It was all going rather well for the Watt, but a great shock was lying in wait. The lead lasted just ten minutes and in the space of two more minutes, Watt found themselves behind.
The equaliser was a personal disappointment for Allison. Having scored his first goal in East of Scotland football ten minutes before, he must have been on a high, but when a cross from the right overshot the far post and came down where he was standing, all that changed. Allison tried to control the ball whilst facing across goal. It bounced away from him, right in front of Cameron MacFarlane, a few steps from goal. MacFarlane aimed a kick at the ball and Saunders, trying to read his intention, dived to his left, but there was scarcely any contact and the ball bounced gently into goal around where Saunders had been standing.
Two minutes later, a bad pass in midfield gave the ball away and Hawick poured forward again. Morris got the break of the ball in a tackle on the edge of the area and poked the ball under Saunders as he advanced to give his side an unexpected lead.
Watt Head Coach Ian Little tried to freshen up his attack with substitutions, but it took the Watt some time to get its rhythm back and it was into the last ten minutes before any meaningful chances were created. Around that time came the moment that told the Watt that it wasn’t going to be its day.
Liam Walker, one of the subs, went flying down the right, caught the ball just in time and played it to the near post area, to which the predatory Donnelly had made a run. Donnelly reached the ball and turned it across goal away from the area to which Rankin was diving, but the ball struck the foot of the goalkeeper and shot across goal to a position where it could be cleared.
In the remaining minutes, Watt never came as close again and after thirteen consecutive victories against the Albert, defeat was their lot on this occasion.
It must be said that this Hawick Royal Albert side is an entirely different proposition from some we have encountered in the course of the last decade. The side looked much fitter and better organised and had a number of impressive performers – not the least of whom was former Watt player Ryan Stevenson, who seems to have found his best position at right back. Having said all that, most Watt watchers felt that their team deserved better in this game and was worth at least a point. But this is football – you win on goals, not on points. Watt conceded two and could only score one, so that’s a defeat. Well done to the Albert and we’ll try again against Craigroyston next Saturday.
Watt’s unbeaten start to the new year continued with this narrow win on what is likely to be the club’s last visit to St Mark’s Park before Craigroyston decamps to the Junior ranks for next season.
St Mark’s has never been an easy venue from which to take points and the Watt has had many a hard battle there before, but it must be said that on this occasion there was an atmosphere of hostility which considerably exceeded anything we have previously experienced at this ground. In years past, some teams had a policy of trying to intimidate student sides, but over the last decade or so, Watt teams have shown such resistance to these tactics that it has largely disappeared from its games. This match was a bit of a throwback to the old days.
The only goal came early, Neil Laurenson’s eleventh-minute corner landing right on the head of Watt’s goal machine, Chris Donnelly, who maintained his record of scoring in every league game he has started by nodding home for his twenty-fifth of the season in all competitions.
Watt was generally comfortable for the rest of the first half and might have increased its lead when Jamie Hume’s through pass enabled Harry Warner to take the ball into the box, but on his left foot he could only find the side net.
Watt had something of a reprieve when a ball fired in from the right was spilled by Craig Saunders. The goalkeeper fell forward on to the ball, but it was kicked out of his hands into goal. Fortunately, the referee was in good position to see the infringement.
Craigroyston came out for the second half with renewed purpose and won their first corner of the match when David Kerr was harried into playing the ball behind. Watt cleared the corner kick and broke forward quickly, but Warner overhit his return pass to Donnelly and the chance of a counterattack was lost.
Craig Dickson led a drive through the middle and when he was tackled, the ball ran to Steven Moncur, who drove in a shot from the edge of the area, but the ball slipped past the post. A header by Stewart Fisher from Ewan Macintosh’s free kick also came close.
Warner had another chance to give the Watt extra breathing space when Martin Green’s pass put him through, but instead of taking the shot at the first opportunity, he tried to let the ball run further across his body and it ran away from him. In the end, he had to lunge to get in a shot at all and he sliced the ball wide.
There was still fully half an hour left to play and Craigroyston’s sporadic raids were becoming more frequent. Ryan Higgins did well to head a corner out of the danger area whilst under pressure, but soon the ball was back at the visitors’ end and when they were unable to clear their lines, the ball was sent across the goalmouth. Greig Tulloch lunged in but managed to send the ball over the bar from inside the six-yard box, although the referee saved his blushes with an offside call.
As the game entered its final phase with still just the one goal separating the teams, Craigie increased the pressure. A corner from the right was pawed away by Saunders from close to goal and Watt defenders struggled to get the ball out of the area. Eventually a shot came in from the edge of the box, but Saunders showed good handling to gather.
Watt had a good spell in which Green sent a free kick just over the bar and Jamie Hume tried to catch out goalkeeper Paul Tansey with a backheel. The best chance was created by substitute Liam Walker, who did well to get past Stewart Fisher and sweep the ball in low from the left. It passed behind Donnelly and Scott Davies had a chance at the far post, but he failed to control the ball.
The referee had tolerated a level of dispute throughout the game and had continued to make his own judgments, but the increasing stridency of the dissent led to a number of cautions for Craigroyston players late in the game. Walker was unlucky enough to pick up a booking too, when the ball bounced up and struck his arm. This also gave Craigie a free kick close to the corner of the box. Chris Inglis tried to bend it in at the post, but Saunders got down to turn the ball away for a corner.
The game finished on a sour note when Steven Tognieri, who had earlier been booked for a foul on Laurenson, tripped Higgins and was cautioned for a second time. Few referees would have hesitated to send off the player, but Tognieri was so incensed that he released a volley of invective which earned him a second red card. There was just time for a final dissent caution before the final whistle brought an end to proceedings.
The win kept the Watt in a high position in the table and although most other teams have games in hand, they can’t all win all of them. Watt must simply do its best to maintain a high success rate and see what that achieves at the end of the season.
The remainder of this match was rather overshadowed by an incident which happened as early as the third minute. The home midfield gave the ball away and Neil Laurenson pushed it through to connect with the run of Chris Donnelly. Just inside the penalty area, Donnelly tried to shoot past the advancing Kevin Swain, but the goalkeeper got there at around the same time and his forearm took the full force of Donnelly’s shot. He knew at once that something had given way and an ambulance was called. After a delay of almost twenty minutes, the game restarted with Liam O’Donnell taking over the gloves. It would have been a disappointing injury at any time, but a few days before a Scottish Cup Fourth Round tie with Celtic awaiting the outcome was just the worst time possible for this most unfortunate accident to happen and sympathy for Kevin Swain was expressed on all sides.
From the recommencement of proceedings, the sharp home attackers gave the Watt defence a tough time and Mathew Joint headed just over following a cross from the dangerous Willis Hare, but when the first goal came, it was for the visitors. Substitute goalkeeper O’Donnell’s attempted clearance was blocked by Donnelly and the ball rebounded off the pitch over O’Donnell’s head into goal.
The lead lasted for fourteen minutes. Jack Daniel was unlucky to get the faintest of touches on a rather wild cross from the left, resulting in a corner, and when Max Allison’s header reached the edge of the penalty area, Darren Smith drove the ball into the net past the left hand of Craig Saunders.
The champions continued to press during the remainder of the first half, with Hare looking particularly lively. Kevin Brown headed a cross past the post from close quarters, then Hare cut inside to fire a shot across goal. In the last minute of the half, Scott Gormley rolled the ball across the face of the Watt goal but Smith was just too late to arrive on the scene.
Smith switched to the right for the start of the second half and the home side continued to push forward. Smith’s clever cross was met by Scott Taylor-Mackenzie on a run across the area, but when he tried to flick the ball in at the near post, Saunders produced an outstanding save to divert it behind.
Just before the hour, Lothian eventually went ahead for the first time. Hare stepped inside from the right and lofted the ball into the box, where Gormley knocked it over the advancing Saunders and into goal.
There was little change to the pattern of the game, with the home side pressing forward and Watt seeking to defend effectively and hit on the break. Taylor-Mackenzie was keen to support his attack whenever possible and three times during the second half was able to come short to the point of the penalty box to take a shot following a short corner. The first two efforts failed to trouble Saunders but the third attempt was well struck and the big goalkeeper made a marvellous double save, blocking out the shot, then diverting the ball behind when Smith pounced on the rebound to fire in a shot from close range.
As the game entered its final phase, the Watt was increasingly able to escape from its defensive straitjacket and trouble the home defence. A nice touch by Donnelly gave Harry Warner a chance to run into the penalty area, but he was tackled before he could get away his shot. Then a fine pass by substitute Martin Green gave Laurenson the chance to send in a low cross from the left, but the ball eluded both Donnelly and Warner.
A minute later, Warner picked up a crossfield pass from Laurenson to win a corner on the right. Laurenson’s corner kick was headed down by Adam Woolven but blocked near the line by the thigh of a Lothian player.
With Scott Davies on to support Donnelly in attack, the Watt pushed forward again in search of an equaliser. Woolven showed superb judgment to secure the ball on the right touchline and find Donnelly, whose pass inside gave Davies a shooting chance, but the first-time shot was well saved by O’Donnell, diving to his left.
With a minute of regulation time left, persistence paid off for the Watt side. The tireless Allison supported on the right and drove forward to the by-line before playing the ball towards the near post, where Davies applied a touch to take the ball into goal.
It was a tough one to take for the home side. In trying to get a game on to warm up for a major cup tie, they had lost their well-regarded goalkeeper to injury and been deprived of two league points due to a late equaliser. It is to their credit that they accepted the events of the day in such a sporting manner.
Watt lined up for the first match of the new year with several key players missing and still a long way from a settled side. Harry Warner made his first start since the fourth of August, playing on the right side of midfield and Max Allison started a first-team game for the first time, coming in at right back. Scott Davies also made his first start of the season, partnering the returning Chris Donnelly in attack. Another player starting a match for the first time in a while was Mark Hamill, who had last been included in an Alex Jack Cup tie at Duns on the third of October. But in his position as usual was the ever-dependable Adam Woolven, who has played every minute of every match so far this season. Adam clearly takes a justifiable pride in having established himself as a regular first-team player. Some of the absentees may find a lesson in that attitude and that commitment.
Having again been forced to put together a side as best he could, Head Coach Ian Little would no doubt have been satisfied with a draw at the end of this game against a Stirling side featuring eight of the players who started the previous meeting of the sides in August. He might certainly have taken a draw after watching a first half in which his side once again scored first before losing its way and trailing at the interval. By the end of the game, however, the Watt was giving at least as good as it got and indeed might well have won the match.
Watt started the game on the front foot and an early corner from the right gave Scott Davies a chance at the back post. He rose well for the header but a defender deflected it behind. A minute later, Craig Saunders had an awkward situation to deal with, Joe Greig’s punt from distance threatening to drop over his head and under the bar, but in somewhat ungainly fashion the goalkeeper managed to get a hand to the ball to divert it over the crossbar.
Watt took the lead in the fourteenth minute after winning another corner on the left. Michael Connor’s kick curled beyond the far post, but David Kerr quickly moved to head the ball back towards goal and Sam MacLean pushed it behind. The next corner was from the right and Mark Hamill bent it in dangerously towards the back of the goal. The slightest of touches from the head of Chris Donnelly was enough to send the ball into the corner of the goal.
Peter Lynch came on to replace the injured Greig at right-back for Stirling and continued his predecessor’s support for his attack and his delivery of quality crosses.
The Watt lead lasted just ten minutes. The home midfield was finding it difficult to contain the forward surges of the visitors and David McCaughie was one of the chief driving forces. McCaughie picked up the ball some thirty metres from goal, strode forward to his right and fired a superb reverse shot across Saunders, striking the inside of the post and shooting across goal into the other corner.
Woolven’s pass picked out the run of Neil Laurenson, whose low cross on the run reached MacLean just before Donnelly could get to the locus, but this was an isolated attack in what was increasingly becoming a rearguard action for Watt. Ryan Higgins was caught in possession not far from his own penalty box and Rory MacEwan stepped up to send in a rasping shot which brought a splendid save from Saunders, diving to his right to turn the ball round the post. The resultant corner brought more problems for the home defence, the ball bouncing off the top of the bar and coming back into play before Watt eventually got it out of the danger area.
McCaughie showed his shooting power again with an effort ten minutes from the interval, but this time Saunders was able to watch it pass the post; however three minutes later the visitors took the lead. A simple passing move found striker David Collins moving to the right across the penalty area. Collins took his shot quickly and this perhaps provoked Saunders into committing himself early to a dive. There was no great power in the shot, but it was very accurate and despite his size, the Watt goalkeeper was unable to reach the ball as it rolled inside the post. Was there time for Saunders to have taken a couple of quick steps before making his dive? We’ll never know, but it seemed possible, although such a judgment may be a little hard on the big man.
There were no changes of personnel at half-time, but Ian Little’s talk seemed to have found its target, as Watt looked brighter in the early stages of the second half. Harry Warner’s fine pass gave Donnelly a chance, but Lynch’s well-timed tackle snuffed out the danger. Saunders was unsighted when Michael McAnespie fired in a low shot from distance, but although he saw it late, the goalie saved low to his left.
Donnelly threatened the Stirling defence again with a run from left to right, but his reverse shot was angled slightly too much and passed the post to MacLean’s right. Davies then set up Connor for a shot from twenty-five metres but although it was well struck, MacLean was right in line.
MacLean spilled a low cross from the Watt left and Donnelly pounced on the loose ball but had to turn through a full circle to get a left-foot shot away and sent it wide.
With Bruce Hay and Anton Dowds on to support the forward effort, Watt pressed forward again. Warner’s cross found Dowds coming in from the left, but his first touch took the ball too close to MacLean and the goalkeeper was out quickly to block.
Watt’s final change was to bring on Connor Godsell at right back and push Allison into midfield. Within a minute, the scores were level, Donnelly running into the space between his marker and the advancing goalkeeper to chest the ball past MacLean into goal.
With quarter of an hour left, it was anyone’s game now and the play surged from end to end. Watt cleared a free kick and drove forward, with Donnelly thwarted by a touch from MacLean which diverted the ball past the post.
A good cross from the Stirling right was headed by MacEwan over the head of Saunders, only for the goalkeeper to stretch back and touch the ball on to the bar and over.
Kerr has been nursing a hamstring problem for the last month, but although he might have succumbed and been replaced at half-time in this match, he battled on and was an important player in the closing stages. From the corner resulting from Saunders’s save, the ball curled towards the far post and two Stirling players closed in to finish off, but Kerr got his head to the ball to take it out of harm’s way for a throw. After two important tackles, this was the third significant intervention Kerr had made in the space of a few minutes.
With two minutes of regulation time left, there was a dramatic incident at the other end. A similar cross to the one which had produced the equaliser found Donnelly again between defender and advancing goalkeeper. He leaped prodigiously to get his head to the ball and played it past MacLean, who then clattered him painfully on the side of the head. It was one of those situations in which everyone holds their breath waiting for the referee’s decision, but when no whistle sounded, the game went on. A defender reached the ball in front of the goal-line and played it out to the edge of the area, where Dowds struck the ball towards the unguarded goal with ferocious power – much harder than was necessary, in fact – but with not quite enough accuracy. It rattled off the crossbar and came back into play.
Should the Watt have had a penalty? It was absolutely clear that Donnelly had played the ball before the goalkeeper struck him and equally clear that MacLean had come out to try to get at the ball. Presumably referee Mr Doyle’s decision was that no intentional infringement had been committed and as Donnelly could not have reached the ball first, he had not been prevented from doing so. There is little doubt that it would have been given as a foul anywhere else on the pitch, but Mr Doyle was in good position to see the incident and as he is almost certainly the best young referee currently performing at this grade and had had another fine match, the Watt were content to accept his judgment.
This was a game that neither side wanted to play, but the decision by the League to force this game on them at short notice and for no discernible benefit left the clubs no alternative but to get on with it.
Both sides were significantly understrength, but although neither had much to substantiate a belief in a positive outcome, the visitors were probably the more pessimistic. Despite fielding its youngest side ever, the Watt should have been able to do better after taking an early lead. The Streamers had been obliged to cobble together a side as best they could, including the recruitment of a triallist goalkeeper on the morning of the game, so all credit goes to them for a cohesive and disciplined performance, orchestrated from midfield by Des Sutherland, who used his gamecraft and endeavour to telling effect.
The Watt was thankful for its youth side in fulfilling this fixture. Of its squad of fourteen, half had played for the Under-20s this season or are eligible to do so; and the only players over the age of twenty-one in the starting eleven were Craig Saunders and Neil Laurenson. Nevertheless, whilst there were two players making first-team debuts and others who hadn’t played much, there should have been enough experience to make more of a game of it than the Watt managed to do. Perhaps it’s the difference in style between Under-20 and first-team football that made it so difficult for this line-up to gel.
Actually, the Watt started the match reasonably well and took the lead after nine minutes’ play, Cameron Ross producing a goal similar to the one he had scored for the Under-20s in his previous outing. Receiving the ball on the right side of the park just inside the Coldstream half, Ross turned and accelerated past his marker, sped to the edge of the penalty area and fired the ball past the right hand of Coldstream’s loanee goalkeeper.
The goal might have settled the Watt, but it was a false dawn, as the side’s understandable lack of organisation began to become evident. Ross’s early goal may have had a retrograde effect on his play, as after scoring he became much less direct and frequently dallied on the ball, giving the visitors’ defence time to regroup.
The Watt defence was also lacking in cohesion and this caused the shape of the game to change in the last quarter of an hour before the interval. On the half-hour mark, two of the more experienced players in the side (albeit both are only twenty), Adam Woolven and Adam Kerlin, were culpable as the Streamers drew level. Woolven misjudged the flight of a cross from the right and jumped for a header he couldn’t reach; Kerlin failed to cover, staying too wide and leaving Ash Langford, the only forward in the picture, time to bring the ball down on his chest, run in on Saunders and send an emphatic drive into the top corner of the net.
Eight minutes later, Coldstream took the lead. A pass from the left was struck by Langford at the edge of the penalty area. Ryan Higgins dived to try to block, but when the ball struck his arm, a penalty was awarded. This time we’re not going to make our customary rant about the way in which ball striking hand is interpreted by referees these days; Higgins did have his hands above his head and seemed to be doing an impression of a goalkeeper. Hagen Steele sent Saunders the wrong way from the spot.
Just before half-time came a killer third goal. A free kick from the centre of the park found the right side of the Watt defence fast asleep and Danny Simpson had time and space in which to bring the ball down and send it past Saunders as he came towards his near post.
With Connor Godsell on at right back, shortly followed by Harry Warner on the right wing, with Sean Campbell moving to the left side, Watt tried to get back into the game in the second half, but Coldstream kept it tight at the back and the Watt lacked the guile to break down the visiting defence. The triallist goalkeeper worked effectively and kicked well, but only had one direct shot to deal with in the whole of the second half and the game simply ebbed away to a quiet conclusion. An improvised scoop shot from Sutherland and a Langford free kick which passed just over were the Streamers’ closest attempts in this period, whilst for the Watt, the two closest things came right at the end: a dangerous free kick from Laurenson which was well punched clear by the goalkeeper and a shot from the same player which cleared the bar.
A slow start gave the Watt a lot to do to get back into this game and the three-goal disparity between the teams’ scores at half-time was not an unfair reflection on first half play overall, but at the end of the match it was another frustrating narrow defeat in which once again the Watt was left to rue refereeing decisions which went against the side. They say these things even themselves out over a season, but if that is true the Watt will be looking forward to the second half of the programme, because the season so far has produced a number of decisions which have gone unjustly against the Riccarton men and have cost league points.
From the start of this game, Civil Service was the livelier side and its movement and passing was far better than that of the Watt. The first minute of the game brought a shot from David Stewart from Matthew Cunningham’s lay-off, but Craig Saunders was in position to save. Watt had a good move on the right at the end of which Adam Kerlin’s deflected cross reached Neil Laurenson, but his attempted shot was blocked away for a corner. Mikey Connor’s inswinger was tricky for Stuart Burnside to deal with and he palmed the ball over the bar for another corner, but Strollers cleared that and soon took control again.
The opening goal came after ten minutes, Jordan Finnie doing well to hook the ball over his shoulder and in off the underside of the bar when Saunders’ punch failed to clear the penalty box.
Watt responded with another move on the right at the end of which Chris Donnelly sent the ball back for Jack Daniel to race forward and fire in a powerful shot from distance which Burnside had to dive to turn round the post.
The game’s defining moment arrived after fourteen minutes. Strollers had broken upfield and although Ian Ballantyne had made a weak connection at the end of a sweeping move, the ball had stayed alive and come out towards the edge of the penalty area. Adam Woolven got in a good tackle on Stewart to send the ball out of play, but when the players’ boots then audibly met and Stewart fell, the referee decided, to the amazement of the Strollers’ bench as much as that of the Watt, that a penalty kick was in order. Saunders got a hand to Stewart’s low kick to his left but was unable to keep it out and visitors led by two goals.
Another decent Watt move failed to produce work for Burnside when the alert Strollers defence smothered Laurenson’s attempt to get in a shot, before the Civil Service lead rose to three in the twenty-eighth minute. The ball was played wide to Chris Milligan and again Saunders got a glove to the shot but was unable to prevent it entering the goal.
Mr Smith is generally a calm and sensible referee, but in this match he did seem to make some curious decisions. Just after the half-hour, Donnelly was fouled and sought the ball in order to take the free kick promptly. It was normal for the Strollers throughout the game to try to prevent the restart of the game by removing the ball from the locus and one of the visiting players did that. Donnelly tried to recover it and there was a certain amount of pushing and shoving, shared about equally between the players, but when the referee brought out his yellow card, it was shown only to the Watt striker, not to the Strollers player who had very clearly been guilty of the cautionable offence of delaying the restart of play as Donnelly did his best to get the game going again. The Strollers accepted this as carte blanche to continue their policy and proceeded to delay every restart by the Watt for the remainder of the game. A caution went to one of their players for this offence in the third minute of stoppage time at the end of the match.
Watt managed to stabilise things in the remainder of the first half. Anton Dowds had a good turn and shot, but although the ball was heading for just inside the post, the distance from which the shot was taken was such that Burnside had time to get across his goal and make the save.
Cam Dunn replaced Mikey Connor at half-time, with Jamie Hume moving forward into midfield, being replaced by Jack Daniel in central defence with Neil Laurenson moving to left-back. Watt looked immediately more potent with the lively Dunn marauding down the left. A good cross in the first minute of the second half found Fraser Wilson in good position, but the ball bounced up on him and he couldn’t get his shot away.
Following a free kick on the right, Kerlin’s accurate cross found the head of Dunn in front of goal, but he allowed his header to slide away past the post. Strollers’ substitute David Middlemass had an opportunity from a cutback just after this, but shot wide.
With Sean Campbell on for his first-team debut, replacing Dowds in midfield, Watt grabbed a goal back in the seventieth minute. A free kick from the right made its way across the box to Dunn, who fired a shot back across goal and inside the post to Burnside’s left.
Five minutes later, the deficit was down to one. A long diagonal pass picked out Dunn on the left wing. He took the ball past a defender and played it in to the near post area, where Donnelly finessed it past Burnside from close range.
Watt was right back in the game now and play was becoming quite open, suggesting that chances might arise when the ball was worked forward, but the Strollers defended stoutly and clear-cut opportunities were few. One almost arose for Wilson when Dunn played the ball across from the left, but when Wilson ran on to the ball, Barry Milven got in a superb challenge to take it away for a corner. It wasn’t Woolven’s day, as just as the corner kick was struck, he was prevented from contesting the ball due to being abruptly taken out of the play by the arm of a defender at about the same place in the penalty box where he had been penalised for his first-half challenge. Unfortunately for the Watt, this foul went unnoticed and the game ebbed away without further significant events.
There are many less competent referees than Mr Smith – we have seen quite a few of them this season – and in general he did not have an especially poor game, but it has to be said that this game turned on two decisions which Watt partisans have to regard as poor ones. At the end of the match, the referee himself seemed to realise it had not been his finest hour. It could be argued that Watt’s improved showing in the second half did not fully compensate for the superiority of the Strollers in the first and that the home side’s play over the full match did not deserve any better, but football matches are not decided on the quality of play or on which side might be judged the more deserving of the victory. Whether the Watt deserved a better result or not, the bald fact is that the outcome of this match was determined by the decisions made concerning two penalty-box incidents. The foul on Woolven late on might not have been easy to spot from the referee’s view of a crowded penalty area, but there was no such difficulty with the award that was made. In penalising Woolven’s challenge, the referee simply did not seem to realise that the player had played the ball at all.
Watt faced its toughest assignment of the season so far, an away cup tie at prominent Lowland League side Spartans, with perhaps the thinnest squad so far this term. Regular left-back Jack Daniel was added to the long list of the unavailable and Under-20 defender Andrew Imray was unable to take the opportunity to join the squad. Rodrigo Almeida’s International Clearance has yet to come through and Stevie Wright sustained a bad injury in training this week. Mikey Connor returned to midfield for his first game for seven weeks and three of the Under-20 side which had visited Ainslie Park the evening before occupied places on an incomplete bench.
Nevertheless, the Watt side started the game with purpose, stroking the ball around confidently and with six minutes on the clock came desperately close to opening the scoring. A flowing move through midfield ended with a layoff by Neil Laurenson which put Anton Dowds in on the edge of the penalty area. Dowds had perhaps just too much time to gather himself and he struck the ball with ferocious power but just a shade too high and it rebounded back into play from the crossbar.
When you come close and don’t score, you just know what is going to happen next and it duly did a minute later. Dean Horribine got to the line and forced Connor Godsell to concede a corner. David Kerr headed out the kick at the near post, but when it was played into the box again, Eddie Malone glanced a header past the grasp of Craig Saunders into goal.
The roles were reversed around the twenty-minute mark as Kerr’s well-timed tackle prevented Aaron Murrell getting in a shot from good position. Having survived this attempt on its citadel, Watt grabbed an equalising goal shortly afterwards. Chris Donnelly cut in from the right and as he ran across the line of the penalty box, fired in a left-foot shot. As he had been obliged to strike the ball square to his line of travel, he had little control over the exact direction, but the height was perfect and the ball was on track to go in just under the bar. It was directly over the head of Blair Carswell, however, and the Spartans goalkeeper rose to tip the ball over the bar. The corner was delivered deep and Adam Woolven was in perfect position to head downwards across Carswell into the corner of the net for that elusive first goal he’s been seeking for quite a while.
Spartans moved ahead again nine minutes from the interval. Murrell held off a defender, moved to the edge of the penalty area and struck a shot which flew into the top corner close to which Saunders was standing. It was a strike of stunning power and accuracy and the goalkeeper, who is in excellent form, simply had no time to make an attempt at saving it.
Three minutes later, Spartans scored again to make their position secure. This one was a bit annoying. Throughout the half, the home forwards had lost no opportunity to hit the deck in the penalty box and when Conner Duthie ran across the box parallel to goal, he was undoubtedly seeking a foot to fall over. He found that of Godsell, duly fell over it and gained a penalty award which Murrell despatched.
Murrell’s quick-time double ended his contribution, as he was replaced at half-time by Robbie Ross, but Watt’s bolt was shot and it was now a question of damage limitation. Spartans added a fourth on the hour when Saunders came off his line but got nowhere near the ball before Keith Murray secured it to chassis round the ’keeper and roll the ball home.
Nine minutes later, a run to the corner flag by Alan Brown was climaxed by a superb cross which was ideal for Ross, who applied a firm header back towards the near post as Saunders tried to cover across goal.
Five minutes later, Saunders saved well, turning a shot round the post to give Spartans a corner on the right and from the kick, Ewan Saunderson headed over. For Watt, Chris Donnelly fired in a shot from twenty-five metres, but it was a metre too high.
Close to time, Mark Hamill made a goal-saving tackle as Keith Murray moved the ball in from the left. Watt moved the ball forward and Donnelly beat a defender and the advancing Carswell to get a touch to the ball, take it past the goalkeeper and slip it into goal to put a slightly better gloss on the final score.
Shipyard finished last season strongly, but although there have been no wholesale changes to its squad, this season has gone much less well for the Fife club so far. It was worth bearing in mind, however, that although it had lost its last seven matches before arriving at Riccarton, the previous five had all been single-goal defeats, so there was the cautionary thought in Watt minds that Shippy might be close to a breakthrough. Watt had Craig Saunders in goal again after recovering from injury in time to take over from Alín Roman, himself injured last week.
The game started in startling fashion, Watt taking the lead within the opening minute. The first attack was built down the right and when Anton Dowds squared the ball, the Shippy defence was posted missing as Chris Donnelly rolled it into the net.
Burntisland settled to some neat attacking football and when Darrell Anthony tried to bore his way into the Watt penalty box and was brought down, Dean Robertson’s well-struck free kick dipped just too late, landing on top of the net.
Donnelly’s pass found Steven Wright on the Watt right wing; his near-post centre eluded Cam Dunn, but an attempted clearance struck the referee and fell for Donnelly to send in a curling shot just wide of the post.
The visitors were taking every opportunity to test Saunders and a shot from Anthony had the Watt goalkeeper diving low to his right to push the ball away. Shortly after this, a pass from Ryan Higgins gave Dowds a shooting chance. As Jordan Mushet advanced towards him, Dowds went for the chip, but missed the target.
Wright’s left-wing corner was headed over by David Kerr and Shipyard attacked next with Ewan Fotheringham’s controlled shot caught just under the bar by Saunders.
Watt went two up in the twenty-second minute with a goal which shows how simple football can be sometimes. Adam Woolven was faced with a situation on the Watt right in which a clearance was needed from close to the touchline. He took care to get the ball forward as far as possible by playing it parallel to the line and when it reached Dowds, he headed it on. Whether or not the ball was intended for Donnelly is unclear, but it fell perfectly into his stride, enabling him to race through to trick Mushet, pass him to his right and slide the ball into the empty goal.
Shippy was still playing some tidy, co-ordinated football and the Watt defence had to be alert. Fotheringham was a threat on the right and he ran on to a pass from Robertson to play on the volley an inviting ball into the danger area, but to his despair no man in white was in position to attack it.
Dowds was supplying some clever passes and he sent Donnelly away with a well-timed ball to the left, but Ben Saunders was quickly on the case to get the ball away for a corner. Dowds held the ball for Donnelly’s run again a few minutes later and gave the striker the chance for a first-half hat-trick, but Donnelly’s first touch took the ball back towards Saunders and he promptly got a foot to the ball to send it back in the direction of Mushet.
There were two more opportunities for Shipyard before half-time. The first fell to Ewan Henderson, who quickly sized up a bouncing ball twenty metres from goal and sent in a strong half-volley which passed just over the bar; then Gavin Sullivan’s free kick was caught by Saunders above his head.
Early in the second half, Donnelly slipped the ball to Dowds, but his attempted shot screwed well wide of the goal.
Five minutes into the second period, Anthony was sent off for a stamp on Donnelly and this probably had a decisive influence on the game. Anthony had been one of Burntisland’s liveliest attacking players and his removal put a lot of weight on the remaining midfielders, who gradually tired, giving Watt time and space.
Much of the attacking after this was done by the home side. Donnelly had a close-range heading opportunity from Wright’s cross, but headed straight at Mushet. Then Connor Godsell’s cross was headed in the air and fell for Donnelly, who took the ball down on his chest and sent a half-volley just over the bar.
Around the half-way mark in the second half, a dangerous low centre by Dunn was turned behind for a corner. When Wright’s kick from the left came into the penalty box, Kerr rose to send a powerful header into goal and give the Watt a secure three-goal lead.
The next good chance, however, fell to Shipyard and it was perhaps the visitors’ best opportunity in the match. Careless defending on the Watt left enabled Shippy to work the ball inside and when it reached Henderson in space and he turned and drove in a solid shot, a goal was expected, but a deflection took the ball behind for a corner.
With quarter of an hour still to go, there was a passage of play during which a goal for the Watt was expected with every moment, but somehow Shipyard managed to keep the ball out. A diagonal pass put Wright into the penalty box and it looked as if he was set to score at last, but Mushet’s right foot denied him. As Liam Walker pounced on the loose ball, we were sure it was going in anyway, but another heroic block by a defender protected the goal again; but the rebound this time went to Donnelly, so surely he would score – but no, Mushet was there again, pushing the ball away for a throw-in. When that was taken, Wright had another shooting opportunity, but Mushet got down by his post to save again.
Mushet’s determination to prevent further goals was again evident a few minutes later when after Donnelly’s run at the visitors’ defence was halted, the ball ran to Walker, who sent in a fierce drive, only to see the goalkeeper soar to tip the ball over the bar. The resultant corner was headed towards goal, cleared off the line and when Woolven headed it back in again, was smuggled round the post.
This was the prelude to a most unfortunate incident. As Wright was in the process of taking the kick, the referee blew his whistle to delay proceedings so he could have a word with a couple of players indulging in some petting in the six-yard box. When the ball arrived at Graeme Haywood, he volleyed it, apparently in an attempt to play it back towards the corner-flag, but as the ball was spinning, it went in an entirely different direction and disappeared over the fence. The referee took a dim view of this and as Haywood had previously been cautioned for dissent, he had to endure a bizarre dismissal. Three minutes later, a third Shippy player was sent off when Andy MacDonald, who had also been booked for dissent, made contact with Donnelly with such severity that the impact was easily audible on the sidelines.
These red cards reduced Shippy to eight players, but as they both happened in the final eight minutes of the match, they had no material affect on the result. Watt did add a fourth goal, however, when a nice ball by Mark Hamill to the near post area was turned home by Donnelly to complete his hat-trick and give him a total of ten goals in the last seven games.
Watt’s third visit to Recreation Park since August produced the team’s best result from their worst performance.
In the first half, Watt played away from the pavilion and into the inevitable wind, but held their own pretty well for most of the time. An early take and turn by Chris Donnelly gave him a shooting opportunity, but from a tight angle he was looking for a space that wasn’t there between Andrew Jack and his post. In another good breakout a minute later, Donnelly’s lay-off found Liam Walker, who sent in a dangerous cross which was headed behind for a corner. When the corner-kick was delivered into the six-yard box, it fell amongst the feet, but no Watt player was near enough to take advantage. The ball was half-cleared, but played in again by Adam Woolven and Donnelly headed over the bar.
Steven Wright was next to have a go from a tight angle, but Jack blocked his attempt. As Watt continued to see plenty of the ball, Wright’s corner was a good one, but Donnelly had to step back smartly to reach it. Leaning back, he headed over.
After this Watt attacking, Ormiston came close to a goal when a header by Andrew Jones from a corner-kick was cleared off the line by Woolven and cleared by Neil Laurenson. A good cross from the left gave Johnathan Edmond a heading opportunity. He put that one well past, but it was only a sighter, as his next chance came thumping back off the bar. Good defending by Connor Godsell, making his East of Scotland debut, dealt with a dangerous cross by Nicky Cairns at the cost of a corner. The corner-kick was curled right into the goalmouth, but Alín Roman got a good punch to the ball to send it away from the danger area.
Ormiston was on top now and Roman dealt well with a shot from distance by Cameron Milne before making a superb diving save to get an arm to a piledriver from Michael Osborne.
Towards half-time, Watt broke upfield following a clearance by Woolven. Donnelly hooked the ball on towards Walker, but Jack was out quickly to kick the ball away. Watt maintained the momentum, however, and when the ball was played back into the penalty area, Donnelly’s quick take and turn was too sharp for his marker, who bundled him to the ground to concede a penalty. Donnelly dusted himself down and drove the ball high into the net to give the Watt a lead at half-time.
With the wind in the favour of the visitors in the second half, we looked forward to a lot of Watt possession and the goals to cement victory, but that was never the story. Watt seldom got a grip of the game in the second half and after equalising on the hour, Ormiston should have gone on to win the game. An injury towards half-time severely limited Roman’s movement from that time on, but he still managed some important saves to help his side retain a point.
It might all have been different if Walker had been a little quicker to seize on the chance given to him by a short passback at the start of the half, but he was a little hesitant and Jack sped out from his goal to clear in front of the Watt forward. Walker had another chance to create a real scoring opportunity just after this when put away down the right by Woolven, but with Donnelly and Laurenson advancing inside the penalty box, Walker’s centre passed harmlessly along the corridor between the goalkeeper and the players running in and past the far post.
Watt had a let-off when Alan Morgan’s fierce shot was saved by Roman. The rebound was knocked in by Osborne, but from an offside position. Osborne then got past David Kerr on the right to set up a chance for Jones, but the winger’s shot was inaccurate.
The equaliser came from a corner which was headed out from the near-post area. Morgan got hold of the ball and fired it towards goal and when it got stuck in the crowd moving through the penalty area, Chris Cairney was the first to size up the situation. He knocked the ball forward and as Roman came towards him, managed to nudge it past the ’keeper and into goal.
Ormiston was well in the ascendancy now and Osborne, who is as hardworking and able as he is cantankerous, turned sharply on the edge of the area to whip in a shot which Roman saved brilliantly, touching the ball on to the bar with his fingertips. The corner which followed this was half-cleared and as Woolven pursued it to the edge of the area, the ball was thumped against him from no distance. This resulted in Ormiston players wildly claiming for some time afterwards that a penalty should have been awarded for handling. This was bizarre, because Woolven did not have his hands in a high position, it was far from certain that the ball had struck any part of his arms and there could be no serious suggestion that he had played the ball deliberately with any part of his anatomy. It is regrettable that the change to the way in which the rule against handling is now implemented has ensured that many such impassioned but spurious claims are made.
There were a few efforts on goal in the last ten minutes, mostly from the energetic Osborne, but none came very close to changing the scoreline. At the final whistle, the Ormiston players were frustrated and had a right to be, as they certainly had the better of the second half and might well have won the game, but Roman’s courage was rewarded.
At Netherdale, where the team had turned in its best performance last season in beating Rovers in the same competition, the Watt started brightly, with Stevie Wright trying an ambitious volley on the run from Martin Green’s crossfield pass. Ronnie Napier’s penetrating run then gave Green a shooting chance and his effort wasn’t far off target.
There was some alarm for the visitors when a free kick from Dean McColm was played across the fact of the Watt goal by Sean Guiney, but goalkeeper Alín Roman, making his debut as a replacement for the injured Craig Saunders, watched carefully as the ball went past the post.
After a mix-up in the Watt defence, with Neil Laurenson caught in possession, Jamie Gibson fired in a strong shot which rose just over the bar, before Guiney had another attempt, driving a shot past the post from the edge of the area.
After surviving these attempts on goal, Watt went up the park and took the lead with a simply-executed goal. Liam Walker picked up the ball on the left and protected it until Chris Donnelly made a run across the box. Walker then rolled an accurate pass inside to connect with the run and Donnelly whipped the ball across Mark Wilson into the far corner of the net.
Seven minutes later, Donnelly had the chance to score again when, turning quickly on to Ryan Higgins’s pass, his shirt was pulled, resulting in a penalty. Donnelly is normally reliable from twelve yards, but on this occasion, perhaps seeing Wilson incline to his right, he changed his mind as he approached the ball and pushed it further to his left than he intended. The ball slipped past the post and the score stayed as it was.
Gala pushed forward seeking an equaliser and following a corner from the right, Colin Galbraith sent in a volley from a very tight angle, but drove the ball too high. A few minutes later, however, after McColm had made ground through the centre of the Watt defence, Scott Main played the ball into the danger area and from a tight angle, Ryan Clapperton fired it into the net.
Clapperton tried for a second goal a few minutes later, but from twenty metres sent his shot narrowly over the bar.
Napier’s fine pass gave Walker a chance to reprise the move that had brought the Watt’s earlier goal. This time it was Laurenson who made the run into the box, but he was closely marshalled and couldn’t get in a shot.
Gibson outpaced David Kerr into the left side of the Watt penalty area, but Roman got both hands to his cutback and Higgins was on hand to clear the danger. As Rovers counterattacked following the breakdown of a Watt free-kick move in the last minute of the half, another good run by McColm threatened the visitors’ goal, but Adam Woolven was on hand to get in a vital touch to carry the ball for a corner kick.
Early in the second half, the Watt goal had a narrow escape when the skilful and inventive Clapperton played a pass towards Ross Lamb, but the ball bounced up too high for good control and the chance was lost. Play switched to the other end and Green headed a Napier free-kick just past the post from fifteen metres.
Five minutes into the second period, Watt went back in front. Laurenson’s pass found Walker on the edge of the area and he deceived his marker and stroked the ball under the advancing Wilson and into goal.
Watt threatened to increase its lead eight minutes later when a dangerous free-kick was feathered on by the head of Donnelly and Woolven, at a tight angle but very close to goal, hooked the ball over the bar.
With eighteen minutes left to play, it was all square again. Woolven made what seemed to be a perfectly fair tackle near the touchline on the Gala right, but when as a result of the challenge his opponent fell down, a free-kick was awarded. This seemed surprising, as Mr Cairns is not an over-fussy referee; he had refereed well and had not generally been inclined to penalise honest challenges which succeeded in playing the ball. The kick was perfectly flighted into the Watt box and centre-back Ian Chalmers rose to head into goal from close range.
Another good attempt by Clapperton was pushed out towards the corner flag by Roman, but shortly after this Clapperton was forced to leave the fray after taking the full force of an attempted clearance from Kerr in the face from very close range.
Watt seemed to have a good opportunity when Donnelly found substitute Anton Dowds in space on the edge of the Rovers area, but Dowds unaccountably dallied and tried to return the ball to Donnelly. An interception brought the opportunity to an end.
As the last nervous minutes of the cup tie ebbed away, McCord’s dangerous corner kick was played on by Roman to the far side, from where the ball was blazed high and wide by David Bonnar. Woolven stepped forward to win a good challenge in the Gala half and get the ball forward to Napier, who was fouled, but the free kick came to nothing.
Green had worked like a Trojan all day and was still there with a successful tackle in the last minute of the game to enable Donnelly to win a corner; then he sent in a superb left-foot cross to give late substitute Fraser Wilson a chance to win the game at the last gasp, but Wilson was unable to get enough purchase on the ball to direct it down and into goal.
The last action of the ninety minutes was back at the Watt end, where Woolven was again alert to get in front of a Gala man and prevent the possibility of a shot.
Extra time never seems as long as the last half-hour of a game and these two periods of fifteen minutes slipped away quietly. The Gala substitutes were imposing themselves, with Woolven again stepping in to deny Callum Jardine as he went down the right and Jack Daniel getting in ahead of the same player to steer the ball back to Roman. Stuart Noble sent in a good effort from distance and didn’t miss by much. Every corner won by Rovers was now being curled into the goalmouth, but Roman was working well, punching away when under pressure and denying any clear opportunities to the home side.
In the second half of extra time, Watt showed more attacking intent. Donnelly took down a long pass from Kerr and swivelled to fire a shot a couple of feet over the bar. Then, when Mark Hamill took advantage of a mistake in the home defence to find Donnelly, his cross picked out Laurenson around the penalty spot. By the time Laurenson had brought the ball down on his chest, however, a defender had closed in and a corner was the best he could get. When the corner-kick came in, Donnelly found space to send in a header, but he was straining to reach the ball and couldn’t control its direction.
Dowds then exchanged passes with Donnelly to move into the penalty box, but the ball wouldn’t sit properly for him and his shot was a rather awkward affair, ending in the side net.
Dowds sent in a corner from the left to which Donnelly, speeding across the box, got a touch. Wilson couldn’t quite reach the ball, but Napier turned it back to Dowds, who gave Donnelly the chance to surge past Chalmers and fire in a shot which Wilson did well to reach with his right hand and turn behind. The corner, driven long, was headed down by Wilson to Laurenson. His shot was blocked and Hamill put the rebound over the bar.
Bonnar had the last effort of the match, driving across the pitch, but his shot was more or less on the same trajectory as his run, which meant it finished well wide of the post.
So the game went to a decider on “kicks from the penalty mark”. Watt went first and Laurenson started things off with a confident left-foot kick high to Wilson’s right. McColm was first up for Gala and although his kick was well struck, Roman dived to his right to make a fine save. Donnelly, Kerr and Napier found the net for Watt and Gibson, Noble and Aitchison did likewise for Rovers, so when Dowds stepped forward, the score was 4 – 3 in Watt’s favour. Dowds drove his kick hard to Wilson’s right, but the goalkeeper brought off a splendid save, diverting the ball against the post and out. Scott Main was last of the ten and put plenty of power into his kick, but too much loft and it smashed against the crossbar to put the Watt through to a second-round visit to Ainslie Park to play Spartans.
At the impressively-enhanced Home Park – we particularly admired the imaginative development of the east end of the ‘Pivvy’ and the neat little covered enclosure named in honour of Morain Scott – Watt’s self-destructive talents were on view again as once more three goals were not enough to gain any points.
The match started as it meant to go on – Watt had a fine chance in the first minute of the game before conceding in the second. Chris Donnelly’s superb pass in the first attack put Liam Walker in behind right-back Ben Maxwell, but his low centre was too close to goalkeeper Willie Stewart, who gratefully dived to grab the ball before it could reach Donnelly.
The Streamers then carried the ball up the left side of the pitch and a fine cross was just right for Ash Langford, who peeled off his marker, retreating a yard or two to gather the ball, take it inside two defenders and tuck a left-foot shot into the corner of the net.
Cam Dunn responded with a driving run across the pitch and sent the ball out to Walker again, but this time his low cross was too sharp for Donnelly and went behind off his ankles. Then Craig Saunders was on hand to block with his feet and prevent Langford reprising his previous goal – and we’d still only been playing five minutes.
It gradually got a bit less hectic, but after quarter of an hour’s play, a long pass from Ryan Higgins gave Walker his best opportunity to date. The ball went over the head of Maxwell and left Walker with only the advancing Stewart to beat. Walker did stab the ball past the goalkeeper, but so softly that a retreating defender was able to get to the ball before it could reach the goal.
Within another minute, Watt came close again. Walker’s pass found Donnelly and he played the ball on for Fraser Wilson to shoot, but he pulled his first-time effort just past the post.
A good clearing header by Jack Daniel was picked up by Coldstream midfielder Jay Wilson, who drove into the box and cut the ball in towards the near post area, where it was turned behind. Following the corner, the home side maintained pressure on the Watt goal for some time. Higgins got in a good block and eventually Hagen Steele drove the ball past the post.
It’s always difficult for referees without assistants to get the offside calls right and it’s often the case that the better the timing, the more offside the player looks. This was Dunn’s fate as he latched on to a defence-splitting pass on the edge of the Coldstream penalty box and was halted by an offside call, although Streamers officials, with a better view of the incident than the referee, were honest enough to disagree.
Daniel Simpson, who was a problem for the Watt defence throughout, sent over a dangerous cross from near the corner-flag on the right, but again it was Higgins who was in position to clear the immediate danger by heading behind.
Adam Woolven almost put his side in trouble when he heeded calls to tell him he had plenty of time. Woolven slowed down, his judgment of the backpass he was attempting was affected and he underhit the pass. Saunders was coming out of his goal but stopped when he realised he wasn’t going to get there before Langford; however, rather than play the available ball, the striker elected to try for a penalty, leaving the ball alone in order to fall over Saunders. The referee was awake to this ruse and cautioned Langford.
The Watt goal had a very narrow escape when Steele’s shot after a powerful run to the line was blocked by Saunders and defenders clustered round quickly to prevent Paul Hossack despatching the rebound. There was another similar episode before half-time, with Higgins again getting in an important block after Des Sutherland’s subtle pass created a shooting chance for Steele. The rebound was played across the goalmouth, but two Streamers players lurking by the far post were unable to make contact.
Watt made it through to the interval without further mishap, but after half-time fell further behind. Four minutes after the break, a foul by David Kerr brought a free kick forty metres from the Watt goal. When the ball was played in to the area, Simpson led the charge and headed the ball on the bounce into the top corner of the goal.
Six minutes later, the cause looked lost as Coldstream added a third. Good combination play on the left between Simpson and Sutherland ended with the latter playing the ball inside to Steele, who placed a firm side-foot shot into the net.
Four minutes after the loss of this goal, the Watt began an unlikely revival. In attempting an acrobatic clearance, Maxwell injured himself and there was a delay as he received treatment. The game restarted with a throw by Jack Daniel and when the ball reached Walker, his cross to the far post was headed back across Stewart by Donnelly, whose had peeled off his marker in much the same way as Langford had done for Coldstream’s opener.
Two minutes later, it looked as if it was unimportant. When Coldstream attacked on the right and moved into the Watt penalty box, the ball was driven against the arm of Kerr. He claimed that not only was the contact unintentional but he was actually over the by-line and off the pitch at the time, but a penalty was awarded and Kerr booked for “deliberate handling”. We have often ranted before about how referees are encouraged to interpret the rule on handling nowadays and will refrain from endangering the stability of the blood pressure by reviewing the matter again. On this occasion, however, the Watt was given a let-off when Langford drove the penalty kick over the bar.
Almost immediately, Watt surged to the other end. Higgins drove into the box and was almost surrounded by Coldstream players when he came down after a challenge from behind. Donnelly took the penalty and fired the ball firmly into the top of the goal to cut the deficit to one.
With fresh legs on in the shape of Adam Kerlin and Scott Davies, Watt was in full cry now and with seventy minutes played, won a corner on the right. Neil Laurenson’s kick reached the edge of the six yard box, but there was such a crowd in the goalmouth that Donnelly had to step back to head the ball towards goal. It took a deflection off Wilson and Stewart got a hand to the ball, but it finished up in the goal and the scores were level. The official match record attributes an own goal to Wilson.
For five or six minutes after this, the momentum was all with the visiting side. Dunn cut in from the right, used Donnelly as a decoy and fired in a low shot from twenty-five metres that Stewart dived to turn round the post. Following the corner, the ball was played in from the point of the penalty box and hit the post. It was then played across to Dunn, around the penalty spot, but he leaned back and shot over the bar.
There was plenty of space in the Coldstream defence for the pacy Watt forwards to exploit, but some of the passing was careless: Dunn played the ball too far ahead of Davies and the ball ran to the goalkeeper; Walker had unmarked players to right and left but tried to find Davies with a straight pass through the middle.
Eventually, with about ten minutes left to play, Kerr was penalised near the by-line on the Coldstream left and when Wilson played the free kick into the box, Jason Inglis sent a header into goal to put the home side back in front.
Watt responded by bringing on Martin Green, sending Dunn to the left and Davies to the right. This was logical enough, but Davies always looks at his most dangerous when played through the middle and he didn’t feature much after this.
The coup de grâce was administered with a couple of minutes of regulation time to play. It immediately followed an incredibly long period for which no match ball was available. There had been three or four balls around during the game, but when the ball being used was sent to somewhere from which it could not be promptly returned, it was clear that no effort had been made to recover those which had previously gone “over the wall”. A delay of a few seconds is not unusual, but time seemed to stretch on and on as we waited for one of the match balls to make an appearance. Coldstream has a tightly enclosed pitch affording plenty of opportunity for balls to be temporarily lost and the Club must surely take steps to ensure that this sort of thing doesn’t happen regularly, especially when it is one goal ahead and there is little time left to play.
When a ball was eventually produced, Coldstream launched it into the Watt box. Saunders blocked a shot, but the ball kept pinging around the area until it reached Sutherland, who fired it into the net to put an end to the Watt’s hopes.
We have had occasion before to remark on the worrying tendency for the Watt team this season to build a good lead and then self-destruct, but this example will go down as the type descriptor. Three times two goals ahead and with a penalty saved with the scores back to parity, the Watt still managed to concede another goal to lose this game. It could only be the Alex Jack Cup.
To be fair, the Watt side had a very makeshift look, especially in defence. With David Kerr and Adam Kerlin having joined the ranks of the absentees, Ryan Higgins was drafted into an unfamiliar right-back berth and Jack Daniel joined Adam Woolven in the centre of defence as his fourth different partner already this season. Nevertheless, Watt started well and took the lead after ten minutes. A powerful run by Anton Dowds outflanked the Duns defence on the right and he cut the ball across for Martin Green to send a careful sidefoot shot into goal.
Chris Donnelly was finding plenty of space behind a Duns defence playing rather a high line and a good ball from Neil Laurenson put him in with a chance, but Sean Robertson narrowed the angle to make the save. The Duns goalkeeper was out quickly to deny Donnelly again a few minutes later after another fine pass by Laurenson enabled Green to play the ball inside.
Half-way through the first half, Watt increased their lead when Dowds played the ball through from a deep position. This time there was a long way for Robertson to come and Donnelly got there first to nip the ball past the goalkeeper and find the net.
Having established this lead, the Watt set about giving some of it back. Three minutes later, a straight ball down the middle caused hesitation in the Watt defence. Daniel Pattenden showed none, however, speeding through to steer the ball past Craig Saunders.
Two minutes later, Watt spurned a glorious chance to restore its two-goal advantage. A free kick was played into the Duns penalty box and when Donnelly hooked the ball across goal, Dowds knocked it down for Green, close to Robertson’s left-hand post. With his back to goal, Green clipped the ball on, but at such an angle that it went right across goal and out on the other side.
Duns then had a great chance for an equaliser as Pattenden’s diagonal run into the area left him with a clear shooting opportunity, but his shot to the reverse corner lacked the power to beat Saunders, who dived to his right and stretched out a long arm to get a hand to the ball.
Almost every attack was producing a chance and at the end of a good run on the right, Cam Dunn delivered another shooting opportunity to Donnelly, but his first-time effort was saved by the vigilant Robertson.
Donnelly’s break through the middle of the field gave him a position from which to play in Dowds, but his pass was not accurate enough and gave Robertson a chance to arrive at the same time as the Watt man and an inconclusive tussle ended with the ball striking the corner flag.
Half-time was reached without either side taking any more of the possibilities arising to add to the score, but five minutes into the second half, Watt went two in front again, Dunn knocking the ball in from close range after Laurenson’s cross from a quickly-taken short corner was missed by the crowd at the near post. But once again it took only two minutes for the Watt to give away their improved position. Mark Hamill committed a foul on the Duns right and Jordan Lauder headed the free kick firmly into the net.
A minute later, Watt had a good chance to rebuild its two-goal lead, but when Woolven’s beautifully-weighted pass put Donnelly through, he tried to find Green to his left and Kieran Lee turned the ball behind.
On the hour mark, Duns brought all three substitutes into play, but ten minutes later, Watt scored again. Laurenson’s fierce drive from Green’s pass following a good break by Dunn was superbly tipped over by Robertson, but when Laurenson’s subsequent corner was played back out to the edge of the penalty area, Laurenson took the ball on the volley to send the ball rocketing into the postage-stamp corner for a memorable goal.
For a third time, the Watt had established a two-goal lead and for the third time it was quickly surrendered. Within two minutes of the restart, a corner was conceded on the Duns left and when the near-post group allowed the ball to pass by, Steve McHoul lunged in to force it over the line.
This time, the Watt was not to be the next side to score. Four minutes later, Donnelly chased a ball down the right but Robertson came out of his box to clear down the line. The ball was picked up by Pattenden and switched across to the right, from where Mike Robinson easily moved into the area and fired a low shot across Saunders to tie the scores.
Another four minutes on, and still ten minutes from the end of regulation time, a Duns player ran into the right side of the Watt box, came into a collision with a defender and went down. A penalty was awarded, but when Lauder drove the ball low on a line just inside the post to Saunders’ left, the big ’keeper reprised his save against Edinburgh University earlier in the week, blocking the ball away with a firm hand.
It was to no avail. Five minutes later, a barge by Woolven thirty metres from goal enabled Duns to play the ball into the box and again Lauder was there to steer a header into goal.
Just on the ninety minutes, Watt gained a corner on the left and Ronnie Napier’s kick reached Dunn on the right side of the box. As he tried to move inside, he was challenged and came down. It seemed a clear case for a penalty, but none was awarded and the possibility of extra time disappeared. There were lots of players in the vicinity at the time of the incident, so the most likely explanation seems to be that the referee, though nearby, was unsighted.
In any case, had the match gone to extra time, there is nothing to suggest that the result would have been any different. Having scored three times in the last twenty minutes or so of the game, the momentum was decisively with Duns, who would surely have gone on to score again. We wish them and their opponents, Eyemouth United, a good match in the semi-final.
On the occasion of the Club’s 70th Anniversary celebrations, the Watt was pleased to scrape a victory against opponents who are never easy to subdue.
Indeed, it was the visitors who drew first blood. With eight minutes played, Rui Paulino went down the left and his cross found Sean Robertson running in unmarked to bullet a header into goal from around six metres.
Five minutes later, Chris Donnelly had a great opportunity to level when played in on the right side, but unaccountably took much too long to get away a shot and Paul Tansey blocked the ball away.
Watt had the greater part of possession as the game went on and equalised just after the half-hour. Not for the first time this season, a strong clearance by Adam Woolven turned out to be a perfect pass and on this occasion Anton Dowds benefited, holding off a defender to steer the ball into the corner of the net.
Penalty appeals were turned down a couple of minutes later when Fraser Wilson took the ball past a defender and seemed to be barged off the ball, but Watt could have taken the lead with half-time approaching when Michael Connor’s flighted pass picked out Donnelly, who squared the ball for Wilson, but the big striker’s effort lacked conviction and a defender turned the ball behind.
Donnelly was in the action again early in the second period, blazing high and wide after Tansey had blocked his first effort. Two minutes later, a more controlled effort from the striker came much closer: when Wilson’s good work on the right provided the ball to Donnelly, his shot across goal struck the far post.
Half-way through the second half, Watt had a glorious chance to go ahead. Neil Laurenson’s superb pass sent Wilson away on the right and when he delivered an excellent cross to the far post, Dowds had only to head downwards to score – but he headed upwards and over.
With the remaining time down to little more than a quarter of an hour, Watt got the breakthrough they craved. A corner swung in from the left by Connor was headed sharply down by Woolven and as the Duns defence hesitated, Donnelly crashed the ball in off the underside of the bar. Luke Strangeways was blamed by some Duns followers for being slow to clear, but this seemed a little harsh, as Donnelly’s instincts in front of goal are razor-sharp.
Ten minutes later, the most controversial decision of the season to date might have cost the Watt two points. A corner from the Duns left was played into the goalmouth. The Watt cover looked adequate, but it was static and when Strangeways ran in to get his head to the ball from close range, he was unmarked. The header went fairly straight at Saunders, however, and the goalkeeper blocked it with his arms with Ryan Higgins providing cover behind him. When the referee’s whistle sounded, we wondered if the ball had struck an arm and a penalty had been awarded, but in fact Mr Macaulay had judged the ball to be over the line and had awarded a goal.
The judgment was later disproved by pictures provided by a photographer with the Duns party and it may be safely assumed that the Watt would have nursed a sense of grievance had the game finished all square, but three minutes later, the matter was put right. Donnelly challenged along with a defender for a free kick played in by Ronnie Napier and the ball continued across the penalty box. Laurenson came in from the far side and met it with a well-timed volley into the roof of the net.
Duns hadn’t finished yet and Saunders was required to make a good save from Daniel Pattenden in stoppage time, but the Watt held on to put the gloss on their celebrations.
Watt kept a rare clean sheet in this rather low-key affair and gladly accepted the three points provided by Chris Donnelly’s characteristic goal.
There should really have been an early penalty for the Watt in this game, Cammy Stevenson’s feet being swept from under him as he came in along the by-line. Mr Thomson has deservedly earned a reputation as an official who does his best to let the game flow and who will permit strong challenges within the laws, but Stevenson was clearly brought down and the feeling amongst watchers was that perhaps it was a little too early in the match for a penalty award.
Although as the game progressed, the Watt defence seldom came under serious pressure, it was similarly difficult for the visiting forward players to create clear chances against a resolute Hawick defence. Donnelly’s pace and trickery are always likely to pose problems for defenders, however, and when his diagonal run resulted in a corner in the thirteenth minute, he headed the kick back across goal to where Martin Green was positioned, close to the post. The ball might have gone in had Green avoided it, but he chose to head it and from a metre or so from goal managed to find the crossbar.
Watt had the better of play as the half wore on, but when former Watt favourite Ryan Stevenson got his head to Kyle Rankin’s long kick-out, Craig Saunders had to stretch to touch the ball round the post.
This was an isolated incident, however, and just before the half-hour the Watt went in front. Green found Donnelly on the left and he battled past his marker towards goal. When Rankin advanced, Donnelly managed to slip the ball past him with a precise shot from a tight angle.
Five minutes from half-time, Green managed to surpass his earlier close-range miss. A free kick was played low into the goalmouth and when two Watt players failed to make contact, the ball ran on to Green, unmarked near the far post a couple of metres from goal. He stretched out a leg and knocked the ball back across goal into the grateful hands of Rankin.
Sloppy defending in the last minute before half-time might have been costly for Watt. A weak shot from Cameron McFarlane should have been held by Saunders, but he pushed it behind and as Albert continued on the attack, a challenge near the by-line might brought claims for a penalty.
In a largely uneventful second half, Watt created few chances. In the best of them, Neil Laurenson’s fine pass sent Donnelly away on the left, but when his cutback found Mark Hamill in the box, the full-back leant back and skied his shot.
Apart from that, it was largely a matter of trying not to concede. Saunders did well to get a good punch on the ball in an awkward situation when it came off the top of the bar and dropped back towards earth very close to goal; following a corner, Hawick centre-half Mark McEwen thumped the ball across the face of goal from close range; near the end, Gavin Pettigrew’s free kick was just too high, although Saunders, being uncertain, touched it higher to make sure.
This remarkable match certainly gave the spectators their money’s worth, supplying drama right to the last kick, but it demonstrated the Watt’s growing tendency to trip up in matches that appear to be won, a feature which must be of concern to the coaching team.
Watt started this game in assured fashion and raced into a two-goal lead within the first half-hour. Then, when a third goal was scored soon after half-time, it seemed that victory was assured. Rovers did not get on to the scoreboard until the seventy-fourth minute of the match and although there was a considerable amount of stoppage time, that still represents a considerable collapse from the home side, which required a last-gasp equaliser to rescue a point.
Scott Sutherland had shown some early intent for Peebles, coming close with a header from a Daniel McAleavy corner, then being stopped in the act of shooting by a fine tackle from Adam Woolven, but it was the Watt which took the lead in the twenty-second minute. Neil Laurenson came in from the left to latch on to Cammy Stevenson’s pass and score with a right-foot shot.
Eight minutes later, Watt scored again; a corner swung to the back post was headed back across goal by Woolven and Fraser Wilson steered the ball between Darren Walker and his post.
Jason Darling sent a scorching drive just over the bar as Peelbes sought a way back into the match, but Watt came very close to a third goal when, after good work on the right, Stevenson sent over a cross which Laurenson struck powerfully for goal, only to see Walker save superbly, touching the ball over the bar.
Rovers applied pressure to the Watt defence early in the second half, but when Woolven sent a lusty clearance upfield, the visiting defence was caught out as the ball fell perfectly for Wilson, who ran on to slam the ball past the left hand of Walker and give the Watt a three-goal lead.
Wilson came close again a few minutes later with a chip from Michael Connor’s pass, but the ball landed on top of the goal net. Gradually, Peebles began to ramp up the pressure, with Watt’s attacks becoming more infrequent. In one good move, Connor’s pass found Martin Green, but when he moved the ball on, Stevenson was forced a little wide, resulting in his shot rising just over the bar.
Twenty minutes into the second half, Peebles brought on Brendan Edwards in place of Sutherland and pushed Paul Murray up front. This proved to be a game-changing alteration, as Murray’s skill and running troubled the Watt defenders for the rest of the match.
It might not have mattered, however, had Wilson been able to convert a chance to complete his hat-trick five minutes later. Connor’s excellent pass sent him in on goal and it seemed he had only to pass Walker to score, but his shot went past the near post.
Three minutes later, the Peebles fightback began. A Daniel McAleavy corner from the left found Dale Richardson beyond the far post and his header went over the hands of Craig Saunders and into the net.
Peebles took great encouragement from the goal, but the Watt was still attacking with purpose, with Wilson’s strong running continuing to trouble defenders. His cutback found Connor on the edge of the area, but the shot was well blocked.
With nine minutes of regulation time to play, Murray cut in from the right and passed across the penalty area to Edwards. He tried to shape a curling shot towards the far post, but got the contact completely wrong and the ball would have gone some yards past had not Watt defender Jack Daniel made an involuntary movement with his foot and played it into the corner of the goal.
It was a most unfortunate occurrence, but there was only one goal in it now and Peebles pressed forward enthusiastically. Just two minutes later, the scores were level. Murray, now a highly potent force, cut in from the left this time and got the curling shot attempted by his team-mate exactly right. Saunders had no chance of reaching the ball as it curved perfectly inside the post to his left as he dived.
Watt was now walking in a nightmare, but Chris Donnelly, returning from injury as a substitute, tried hard to remedy matters with a shot which Walker saved well and a header which went across goal and just past. Then, as Watt pressed, the inevitable happened: a big clearance from defence fell into the stride of Murray and when he sped into the area and went down under the first challenge, the referee, from a distance of half the pitch away, awarded the penalty. Daniel McAleavy, pumped up almost beyond belief, fired the kick low into the corner of the net and was then cautioned for remarks directed to the sidelines.
A minute later, a throw on the Watt right was sent in to Rob Service, whose legs were promptly swept from under him by a rash challenge in the Peebles box. Action stopped for a second or two as players and spectators alike awaited the surely-inevitable whistle, but the players had to continue as the realisation dawned that no whistle was going to sound.
Cautions for two Rovers players followed as the visitors tried to see out time and when Laurenson curled a free kick into the area, Walker had to rescue Richardson with a tremendous save, touching the ball against the bar when the centre-half played it towards his own goal.
What will be will be, however, and in the last action of the game, Watt substitute Liam Walker sped down the left and swept the ball across. As Wilson waited in the middle to turn it into goal, Richardson spared him the necessity by reaching the ball first and this time not even Darren Walker could prevent it from finding the net.
The League leaders proved at Riccarton that they will provide a stiff challenge for any team in the East of Scotland League this season. Watt stuck by their task manfully, but the hastily-assembled side found it difficult to cope with the touch, movement and co-ordination of an Athletic side which, though young, has at its core a nucleus of players well used to playing together and confident in each other.
Leith attacked from the off and Neil Laurenson saved his side with just five minutes played, clearing from close to goal when Craig Saunders was rounded by James Hainey.
Left-winger Scott Wilson was giving the Watt defence some trouble and shot just past after cutting in from the wing. A few minutes later the same player reached the by-line and swept over a low cross which just eluded two Leith players closing in towards the far post.
With twenty minutes played, a rash challenge by Anton Dowds resulted in a free-kick ten metres inside the Watt half. The Watt defence did well to clear the kick, but Ryan Higgins was unable to retain possession in midfield and Robbie Mason drove into the left side of the box. When he played the ball into a central area, a clumsy challenge by Liam Walker produced a penalty decision. Mason struck the kick high into the net to the right of Saunders to give Athletic the lead.
More penetrative running by Wilson on the Leith left threatened the Watt goal again, but his curling shot should have been held by Saunders instead of being parried out to Hainey, but the goalkeeper redeemed himself with a good save, although in any case offside was awarded.
Watt’s best attack so far came in twenty-five minutes, but Walker’s cross failed to find a team-mate.
Ten minutes before half-time, the Watt got back on level terms. Cammy Stevenson was pushed over twenty metres from the corner flag on the Watt right and when Michael Connor played in a searching free kick, Stevenson’s run at the near post distracted goalkeeper Iain Gordon. The ball continued across goal and went in at the far post.
Leith pressed again and when Gary Black sent in a good cross, Mason fired the ball back across goal but missed the target. Then, with the last move of the half, a sharp thrust down the left, a pass inside set up the shot for Kerr Allan, but somehow Saunders managed to get his right arm to the ball and knock it over the bar.
Adam Woolven’s alert intervention cleared the danger in the first minute of the second half as Daniel Simpson drove into the penalty box, but the Watt settled comfortably into the second half and a good run by Neil Laurenson supplied Stevenson with the chance to pick out Dowds, but he was unable to control the ball and the chance was lost.
A well-timed tackle by Alex Scott halted another Simpson intrusion into the Watt area at the expense of a corner, following which Allan’s header was cleared by Dowds.
Twenty minutes into the half, Watt had a chance when a clearance following a corner left Stevenson with a chance to hook the ball past an exposed Gordon, but in trying to bring the ball from behind himself he was unable to generate enough power to take the ball past the goalkeeper.
A minute later, the Watt found themselves behind. Wilson took advantage of some indecisive defending to fire in a shot. Saunders blocked the ball but couldn’t hold it and Mason knocked in the rebound off the underside of the bar.
Now chasing the game, Watt did everything possible to put pressure on the visitors’ defence. A good attack ended with Dowds winning a corner on the right, but nothing came of it. With extra resources committed to attack, Watt was vulnerable to Leith pace on the break and Laurenson’s excellent intrusion denied Grant Burns following an incisive move down the right. Burns came close again from the corner which resulted, driving in a fierce shot which was stopped by Saunders and cleared by Connor.
A good counterattack by the Watt followed the breakdown of a Leith attack, with Connor’s pass finding Stevenson on the left. He played in Dowds, but his pass to Fraser Wilson found the striker in an offside position.
With two minutes to play, Leith sealed the match with a penalty goal. Sean Murphy, with his back to goal, was challenged by Laurenson. Murphy seemed to be leaning so far back that had Laurenson not been behind him he’d have fallen on his own account, but when he came to ground the award was given and Burns slammed the kick into the top corner of the goal.
The Watt started this game in sparkling fashion and had the ball in the net twice in the first four minutes. The first came when Anton Dowds turned the ball home after a sweeping move on the right, but this was disallowed for offside. This verdict was later seriously called into question by the Watt players, but in any case just a minute later the ball was fired home for a second time and this time there was no doubt. A fine move started by Alex Scott ended with the ball being laid in front of Adam Kerlin and he slammed the ball high into the net.
Craig Saunders has well over a hundred appearances for the Watt to his credit, but this was surely his finest performance to date and we lost count of the number of vital interventions he produced during the match. The first brilliant save was in the tenth minute, when he soared to his left to touch a powerful shot from Chris Anderson over the bar.
Watt got lucky a little after this when a free kick penetrated the defensive wall, struck the post to Saunders’ left and spun across goal, missing all obstacles to go past the post on the other side.
As the visitors kept up the pressure, a fierce drive from Gerry Rossi was blocked by Saunders and when Ewan Saunderson put the rebound into goal off the far post, he was ruled offside.
Two more tremendous saves from Saunders preserved the Watt goal as he stopped close-range headers from Anderson and Andy Howat, before the Watt went further ahead. Chris Donnelly timed his run to the left to connect with a pass from Mark Hamill. He then took the ball past Saunderson and bored into the penalty box. When Ross Gilpin advanced, Donnelly stretched to play the ball off the goalkeeper and poke the rebound past him.
Five minutes before half-time came the first penalty awarded to Spartans. Blair Atkinson worked his way along the by-line towards the Watt goal, but appeared to be on his way down before David Kerr’s challenge. Kerr had been a little rash, however, in making a tackle in such a position and had given the referee a decision to make. The verdict went against the Watt. Saunders, however, was equal to even this test, throwing himself to his left to divert Sean Stewart’s kick away along the by-line for Adam Woolven to play the ball behind.
Unfortunately for Saunders and his team-mates, their goal was breached before the safety of the half-time dressing-room could be reached. With a minute of the first period remaining, a cross from the left which was curling out of play was inadvertently touched by Hamill. The ball fell in front of Anderson so close to goal that he only had to prod it to turn it in.
The Watt defence maintained its vigilance at the start of the second half, with a timely tackle by Woolven preventing Howat from breaking through, and soon Watt was back on the attack, with Donnelly picking up a good pass by Liam Walker to drive towards goal from the left. Iain Thomson tackled Donnelly and Danny O’Donnell slammed the ball behind, but strangely the decision was a goal kick and the referee also turned a blind eye to Thomson pushing Donnelly’s head into the pitch as he rose to a kneeling position.
Kerr had suffered an earlier injury and was replaced by Finn Watt, with Stevie Wright coming on in place of Kerlin.
With around twenty minutes to play, a lovely passing move from the home side ended with Donnelly moving on to the ball on the right side of the penalty box. He got his shot away, but Thomson’s very late challenge badly injured the Watt striker. Thomson escaped with a caution, perhaps because the referee reckoned that as Donnelly had already struck the ball it didn’t count as a goalscoring opportunity by the time the challenge came in, but a penalty was awarded. Donnelly is the Watt’s usual penalty-taker, but as he was unfit to take any further part in the game, Anton Dowds took the responsibility and made a fine job of it, giving Gilpin no chance to save and putting Watt 3 – 1 ahead.
As the game wore on, Spartans stepped up their endeavour, seeking a route back into contention. Following a corner with eight minutes of normal time left, the ball was played to Keith Boyes, who sent in a shot from the right side of the box. The ball struck the post to the left of the diving Saunders and rebounded on to the goalkeeper’s back. Spartans substitute Harry Girdwood won the scramble to connect with the loose ball and hacked it over the line to reduce the gap to one.
As Spartans sought an equaliser, a good strike from twenty-five metres by Atkinson slipped past the post. Then, a minute into stoppage time, Stewart’s run on the right created a chance for Boyes, but after taking careful aim he sliced his shot past the far post.
A minute later, the Watt was in despair. The Spartans forwards were doing their best to get into the penalty area whenever possible and when Atkinson came in from the left, in desperation he threw himself across the hip of the nearest Watt defender. There was a sense of disbelief when the referee awarded another penalty, which was duly despatched by Howat to level the scores.
The sense of injustice felt by the Watt players was palpable, but things almost got worse as a move on the right broke down and Spartans poured forward. Girdwood struck a firm shot from the edge of the area, but Saunders was still on top form and reached the ball high to his left to push it on to the bar. Stewart came in from the right to pick up the rebound, but Saunders was already back on his feet and saved that too, although offside was awarded.
With Spartans still pushing for a winning goal, Girdwood won a corner on the left. When the cross came in, it was headed on to the far side and Dowds managed to prevent it going behind for another corner, playing it towards the sideline. Hamill sped after it and played it down the line to Walker, who tricked his marker and set off down the left. He cut inside two retreating defenders and as a third came to challenge, sent in a shot which took just enough deflection off the defender’s boot to spin neatly over the head of Gilpin and under the bar. The referee blew the full-time whistle.
Thistle Vale arrived at Riccarton with the intimidating record of successive wins over Tynecastle and Craigroyston, good-quality opponents from last season’s Premier Division, in which thirteen goals had been scored and none conceded. The Saughton side amply demonstrated their abilities in this match too, but a battling Watt side kept the score to a respectable level and at one point in the second half looked as if they might give their illustrious opponents a fight for the points.
The visitors forced the pace from the start, but Watt resisted with great resolution and seldom looked in serious bother until LTHV suddenly made the breakthrough half-way through the first half. The goal was a personal disaster for Watt goalkeeper Craig Saunders, whose form has otherwise been excellent during the season to date. Eddie Mearns sent in a shot from outside the area – a dipping effort aimed at getting the ball over the ’keeper’s head. Saunders seemed to expect more force than there was in the shot and when he tried to guide the ball over the bar, he managed only to parry it up in the air. By the worst sort of luck, the ball’s descent carried it towards goal, under the bar and over the line before Saunders could scoop it out.
Watt tried to make a quick response and after good work by Chris Donnelly and Mark Hamill, Fraser Wilson sent the ball wide to Anton Dowds, who squared the ball from close to the by-line, but Kevin Swain swept the ball clear with his foot.
A well-judged cross which eluded Calvin Muttitt gave Willis Hare a chance to play the ball in for Scott Moffat, but from good position he shot wide. The tricky Hare was a problem for the Watt defence, but when he cut the ball back from the line, Adam Woolven had read the situation and cut out the ball.
Since the opening goal, the Watt defence was looking vulnerable and the LTHV attack more confident and with 34 minutes on the clock, a second goal was added. It was a simple affair, Dean Cummings playing a wall pass on the edge of the area to fire the ball past Saunders’ right hand from fifteen metres.
Two minutes later, it was three for the visitors. Saunders saved the first effort, but Moffat was on hand to poke the ball over the goalkeeper and into the net.
Watt needed to get a grip on things and Neil Laurenson tried to set up a response with a fine pass to Liam Walker on the right. His low centre was just out of reach for Dowds.
Watt was still coming under severe pressure and Saunders made an outstanding save to prevent Moffat scoring again when he drove Darren Smith’s cutback towards goal. Jamie Hume then got his head in the way of a shot to deflect the ball for a corner.
Hare threatened again, shooting from the edge of the area, but a deflection helped Saunders to collect and Watt reached the break without further damage.
The interval steadied the Watt and the second half started quietly, but just before the hour, the home side became the first team to score against the champions this season. A free kick was taken short to Wilson, who went down the right and sent a low centre across goal for Donnelly to steer the ball home at the far side of the six-yard box.
Watt enjoyed a good spell after this and Dowds came close to putting Donnelly through with a smart backheel, but Swain was quickly out to deny the striker.
Neil Laurenson dived recklessly into a challenge and received a caution. Both sides made substitutions as the game entered its final phase.
With ten minutes left to play, good running by Donnelly on the left took him into the penalty area. He played the ball a little too far in front of himself and as Swain ran out, he played it off the goalkeeper. Laurenson got on to the rebound and as he tried to carry the ball away from Swain, the goalkeeper dived in from behind him to try to get a touch. Laurenson went over and the referee, construing this as simulation, issued him with a second caution which ended the match for him.
With further substitutes on, Watt tried to see out the game without conceding further goals, but with two minutes of normal time left, the ball was worked inside from the LTHV left and laid back to Cummings, who found the corner of the goal from around eight metres.
There was a last-minute panic about the floodlights, but when that was sorted, the first match on Watt’s new 3G pitch got under way. Player availability was the best of the season so far and Head Coach Ian Little chose an attacking line-up, using Neil Laurenson and Liam Walker in wide positions with Anton Dowds and Chris Donnelly up front.
On a fine late-summer evening, with the midgies helping to ensure the players kept on the move, the new surface seemed superb and both sides played good passing football in the early stages. Watt had the ball in the net after eight minutes when Donnelly flattened his run to find space and pick up a through ball from Dowds, but when he rounded Kieran Davidson and played the ball towards goal, Liam Walker was given offside when he tapped it over the line.
After that, play was pretty even until the half-hour mark. Walker’s low cross eluded Dowds and Donnelly, then his cutback was driven by Dowds against a defender, while good work on the Eyemouth right was thwarted when Mark Hamill played the ball off Jake Rutherford and behind.
Steven Wright, who was having a good game in the Watt midfield, created the opportunity from which Watt opened the scoring after half an hour’s play. Wright burst on to a loose ball and drove forward to send a pass to Laurenson, who played the ball first time into the path of Donnelly, who had again lost his marker and had plenty of time to slip the ball past Davidson into goal.
Watt began to dominate after this, with Walker featuring in much of the attacking play. He got loose again on the right, but his cross fell between Donnelly and Dowds and was cleared. Then Dowds crossed from the left and Donnelly hooked the ball back across goal, from where it was headed behind for a corner.
United took the chance to attack whenever they could and Aiden Lauder fired in a crisp drive from the point of the penalty area which Saunders was unable to catch and had to bundle behind for a corner, but when Laurenson and Higgins combined to clear the corner kick and Alex Scott intercepted an attempt to build again on the Eyemouth left, Wright played the telling pass once more, threading the ball through for Donnelly to move in close to goal and square the ball for Walker to tap in and put the Watt two goals up.
Watt was playing with confidence now and added a third goal before half-time. Saunders’ accurate throw found Hamill on the left. He played the ball up to Donnelly, whose marker, Tom Wyman, got his head to the ball but could only play it upwards. When it came down again, Donnelly controlled it and played it square to where Walker was waiting in space to slip the ball past the exposed Davidson.
Two minutes after half-time, Walker completed his first East of Scotland hat-trick with a fine goal. The ball spun out wide to the Watt right and the tireless Donnelly was on to it quickly. He cut it back to Walker, who had taken up a position on the right side of the penalty box. Walker sent a defender the wrong way and, turning, sent a right-foot shot with deadly accuracy across goal beyond the despairing dive of Davidson and just inside the far post. It was a memorable moment for the young man, who is taking the step up to East of Scotland senior football in his stride.
Walker might have had another two minutes later, but his touch was slightly too heavy and when Davidson blocked the ball out to Dowds, Donnelly shot over.
Donnelly almost claimed his second of the evening four minutes after this, when a good pass from Laurenson put him away on the left and his shot hit the base of the post and spun past.
Another good pass by Laurenson gave Donnelly the opportunity to attack again from the left soon after this and although hampered all the way by Shaun Ford, he kept his balance but drove his shot into the side net.
Several substitutions by both sides disrupted the flow a little and there were few incidents of note for a time, but as we went into the last quarter of an hour, that changed abruptly. Martin Green had been brought on to play on the left side of the Watt midfield, a position he had commented was unfamiliar to him, but when he was found by a pass by Hamill, he showed he had some idea of what to do. As Green ran swiftly into the left side of the box, we looked for the cross which might pick out Donnelly or Dowds, but as the angle tightened, Green simply hammered a left-foot shot high into the net, giving Davidson no chance at all. For the second time in the half, the game had been illuminated with a goal of quality.
The Fishermen battled away, with the industrious and skilful Rutherford at the heart of much of their best work, but it was centre back Ford who came closest, powering in a shot from around thirty-five metres. It may have been going just over the bar, but Saunders could take no chances and turned it over to make sure. From the resultant corner kick, the ball reached Ford again, standing a few yards beyond the far post, but he snatched at the chance and skied it.
Five minutes from time, Watt concluded the scoring with a sixth goal. Dowds saw the chance and set off on a run, inviting Donnelly to play him in. When Donnelly did so, Dowds was clear of the defence and advanced on Davidson, but most unselfishly played the ball to his left and allowed Donnelly to roll the ball into goal.
For the opening match of the East of Scotland League programme, Watt visited Airthrey Estate to try to rectify an anomalous but unpalatable statistic. Since the creation of the Lowland League, at which point Stirling University and Spartans cloned their football teams and achieved the remarkable feat of simultaneously moving and staying put, two matches had been played between Heriot-Watt and the Stirling second string which plays in the East of Scotland League. Those matches were played during a season in which the Watt was not at its strongest and it lost both, making Stirling University II the only team in current of past membership of the League against which the Watt had a zero success ratio. The record against the Stirling First Team is much better!
By the end of the match, the sad statistic had been eradicated, but it had taken a battling performance to get the single point which the Watt achieved in a match full of interest and in which the result was in doubt right to the end.
Indeed, Watt could scarcely have made a worse start to the game, conceding two goals in the first ten minutes – but in an even shorter time the deficit had been made good. The scores remained tied well into the second half, but then the Watt fell behind again, before once more fighting back to equalise.
The game started off at a fast pace and continued that way. With just two minutes played, a long ball down the right was headed behind by Adam Woolven, perhaps unnecessarily. When the kick sailed over the heads to the far post, it came off the thigh of Mark Hamill, who was guarding the post, and Liam Allison lashed it into the roof of the net.
Watt tried to respond quickly and a shot from Ryan Higgins was just wide of the post. Hamill’s cross then troubled the home defence and when Steven Wright linked with Fraser Wilson to set up Chris Donnelly for a shot, the equaliser seemed imminent, but goalkeeper Tim Hughes reacted superbly to reach the ball and turn it round the post.
This was an important save, as a minute later Stirling scored again, moving the ball much too easily down the left, then inside, with players always in space. When the ball was rolled in front of Andrew MacDonald, he had no difficulty in placing a low shot with the inside of his right foot past Craig Saunders and into the corner of the goal.
This was a severe blow, but the Watt spent no time dwelling on their misfortunes and grabbed a goal back within a minute. A lofted ball down the middle of the park was headed on well by Wilson for Donnelly to run in on goal. Although being hampered all the way by the attentions of Jack Mooney, Donnelly kept his balance to steer the ball past the left hand of Hughes.
Six minutes later, the scores were level again. The goal followed a good move on the Watt right involving Cammy Stevenson and Alex Scott, who combined with Higgins to enable Wright to cross. The ball came off the leg of a defender and Liam Walker instantly despatched it into goal.
Stevenson’s reckless challenge gave Stirling a free kick some 35 metres from goal, but the wall did its job when the shot came in from Blair Munn. Donnelly led the counter-attack through the centre of the pitch, but when he laid the ball off to Walker, his first touch was too heavy and Hughes was able to gather, albeit with some difficulty.
Another dangerous thrust on the Stirling left found Hamill alert to deny the opportunity when the ball was swung across and Higgins blocked another effort from Munn as Stirling kept up the pressure.
Wright’s excellent first-time pass came close to creating a scoring opportunity, with Walker doing well to hold off the challenge of Vilyan Komitski and play the ball across to Donnelly, but when the striker drove in a shot from around eight metres, he was again denied by Hughes, who dived to his left to divert the ball past the post.
Watt looked the more dangerous side now and when Woolven’s cross was played back across goal, Donnelly laid it back for Wilson to shoot, but his effort slid past the post. The next opportunity was from a free kick played into the Stirling area. Wilson played it through and Donnelly got the call to let it run on, but instead of trying a first-time shot, Stevenson tried to work a clearer chance and was tackled.
As half-time approached, Wilson held up a ball out of defence and flicked it on for the run of Donnelly, but there was a lot of ground for the pace merchant to make up and when he reached the box he was travelling at such speed that he lost a bit of control and in trying to strike the ball as it bounced up, he screwed his shot wide.
In the last minute of the half, Stirling had its best effort for some time, MacDonald coming in from the right to drive in a powerful shot towards the top corner, but Saunders had his angles right and dived high to his left to block the ball behind. Munn’s long corner was volleyed by Rory McEwan back in the direction from which it had come, giving Munn a second chance to find a colleague. This time he played it short to Lewis McKenzie inside the Watt penalty box. The ball bounced high and McKenzie turned and very clearly used his arm to bring it round before playing it across the area, but amazingly the referee did not seem to recognise this and allowed Allison to take a shot which hammered off the underside of the bar. Had the ball gone in, the Watt would have suffered a major injustice in falling behind right at the end of the first half, so it was with some relief that the players went off for the break.
For the first twenty minutes of the second half, there was little to choose between the sides and the game was played mainly in midfield, but it suddenly sparked into life again. Hamill’s corner from the left was headed out as far as Wright, who exchanged passes with Hamill before crossing to the far side of the goal, from where the ball was played back across to Donnelly. Once again, Donnelly slammed the ball towards goal from close range and once again Hughes was there to deny him, reading the direction of the ball in an instant and actually catching it.
As on a previous occasion, Hughes’ heroics brought a swift dividend, for two minutes later Stirling went ahead again. Allison broke through on the left and sent a low cross into the area. The first attempt to shoot was blocked, but McEwan got his foot to the rebound to poke it under Saunders as he advanced.
Anton Dowds and Neil Laurenson were brought on to give fresh impetus to the Watt attack and they soon began to make their contributions. Dowds showed good footwork and sent a fine pass through to the scampering Donnelly, but on this occasion the striker failed to gather in the ball as he ran.
The next Watt attack was more productive. Wright chipped a delicate free kick on to the chest of Dowds, just inside the penalty area. Dowds controlled the ball, moved to his left across the area, swivelled and fired a powerful shot past the left hand of Hughes into the corner of the net for the best goal of the game.
Dowds almost doubled his money two minutes later, running on to a through ball before Hughes could reach it and taking it past the goalkeeper, but he was travelling too fast and at too steep an angle to sent the ball into goal and by the time he had turned and crossed, Hughes had recovered his ground and made the catch.
Donnelly, whose inspiration and endeavour seems to build throughout a match, almost clinched the three points for the Watt in stoppage time with a marvellous piece of imagination and improvisation. Saunders’ clearance was headed inside by Laurenson and as Donnelly accelerated after it with two defenders to cope with, there seemed no immediate threat to the Stirling goal, but the striker had noticed that Hughes had advanced towards the edge of his area and as he ran across the pitch, Donnelly stretched out a leg to clip the ball between the two defenders with the inside of his foot. He got plenty of power into his shot and the ball went past Hughes, but the angle wasn’t quite right and the ball slipped a foot or so past the post.
The sides had met just a fortnight before in the Qualifying League, but there were numerous changes to both teams for this Qualifying Cup tie. Watt’s new Head Coach, Ian Little, had decided to view the proceedings from the pitch and listed himself on the right side of midfield alongside Ryan Higgins and Martin Green. Jamie Hume came in to partner Adam Woolven in central defence and in the absence of Alex Scott, Lars Holmen filled the right-back berth.
Ormiston was the first to draw blood after Mark Hamill’s challenge just outside the penalty area was penalised. Watt had a four-man wall, but Michael Osborne fairly hammered the ball past them into the far corner of the net.
Half-way through the first half, things got worse for the Watt. Chris Donnelly’s attempt at fancy footwork in the middle of the park didn’t come off and he lost the ball. It was quickly moved forward and Andrew Jones found Osborne on the left. Moving into the penalty area, Osborne drove the ball into the small gap between Craig Saunders and his near post.
Donnelly seemed to feel a personal responsibility to redress the balance and from the restart went on a tremendous run through the middle of the park and across the Ormiston defence to the right. He played the ball to the near post area but Cammy Stevenson was beaten to it and the best that Watt could get was a corner.
Ormiston was still making the better chances and Osborne came close again with a header from a corner, but eventually the Watt began to impose some pressure with shots from Donnelly and Ryan Higgins.
Two down at half-time, Watt replaced Green and Stevenson with Stevie Wright and Anton Dowds and within two minutes had a goal back. Gareth Gray was unable to cut out a pass to Donnelly, who went past the defender to slip the ball past Derek Robertson in the Ormiston goal.
Unfortunately for the Watt, this bright start to the half was undone two minutes later. Saunders, normally so reliable with the ball at his feet, received a pass from the right and tried to play it on first-time to Hamill, wide on the left, but he didn’t get nearly enough purchase on the ball and left Chris Robertson with a tap-in to make it 3 – 1.
As Ormiston sought to put the tie beyond Watt’s reach, Saunders dived to his right to save a shot from Osborne. Watt responded with a thrust on the right which brought a corner. Hume looked as if he was timing his run well to reach the kick, but the communication channels weren’t working and before Hume could reach the ball, Donnelly leaned back and headed the ball over the bar.
Ormiston still carried a threat going forward and after Jones narrowly missed with a chip for the far corner, Johnathan Edmond tested Saunders with a drive which the big goalkeeper turned round the post.
In the Watt’s last available change, Fraser Wilson replaced Little. A fine pass by Dowds picked out Walker on the left. His first touch was good, but Johnny Malcolm was in quickly to knock the ball away for a corner. Wright’s kick was played behind by Ross Ferguson as the home defence looked anxious.
As the match entered its last twenty minutes, Edmond had a close-range opportunity as he ran across goal to meet a bouncing ball which deceived the Watt defenders, but he headed over the bar. Watt went straight up the pitch and when Dowds headed on to Walker, his low cross was met by Donnelly at the far post. His shot passed Robertson but came flush off the far post and landed in the ’keeper’s arms.
Watt was trying desperately to get a goal and reduce the deficit to one and Dowds had a close-range header blocked, but Ormiston still had the capability to trouble the visitors’ defence and there were two close things in quick succession before Saunders grasped Osborne’s header low to his right.
The strength and running of Wilson had made a difference in attack for Watt and with five minutes of normal time left he got behind the Ormiston defence, driving into the box from the left. Gray pulled him down, conceding a penalty and gaining first use of the showers. Donnelly made a tidy job from the spot.
Watt had at last brought the gap back to a single goal, but although there were three minutes of stoppage time, there were no further meaningful chances and the home side hung on to go through for a trip to Meadowbank to face Edinburgh City in the Second Round.
The Watt’s last match on the pitch which has been its home since the construction of the Brydson Arena was played on a bright August afternoon with the grass looking wonderful. It was a game of some drama and many goals. Given the final score, it is no surprise that there were also many mistakes and ultimately the result was determined by one of the worst.
Despite having lost its previous two Qualifying League ties, the Watt still had a chance of progressing to the League Cup if a two-goal winning margin could be achieved, but after four minutes of this match, the task had become greater. Coldstream’s veteran attacking midfielder, Des Sutherland, still carries a potent threat and when a cross was headed out of the area towards him, he controlled it on his chest and drove the ball on the drop into the top corner to the right of Craig Saunders. It was a fine finish and there was nothing for it but to admire the skill of the marksman.
Four minutes later, however, the Watt was back on level terms. A poor clearance by Streamers’ goalkeeper Luc Glasper gave Cammy Stevenson an opportunity which he gladly accepted.
A penetrating pass by Ryan Higgins put Adam Kerlin in on the right to advance on Glasper, but from a tightish angle he blazed the ball over the bar to squander a good opportunity.
Stevie Wright won the ball well to drive forward and find Chris Sellar on the right, but with Glasper advancing, Sellar couldn’t decide whether or not to try to take the ball past him and finally put in a poor cross which Stevenson reached but could only fire well over the bar.
Watt enjoyed a good spell of attacking, with three corners in quick succession, from the last of which Chris Donnelly headed just over. Then a visiting defender was cautioned for bringing down Donnelly as he bored in from the left side and when Stevenson drove the free kick to the near post area, it seemed to come off the post and shoot across goal. Kerlin played it back into the mix, but when Stevenson’s shot was blocked, Coldstream broke quickly and it took a good tackle from Kerlin to halt the advance.
After all this pressure, the Watt fell behind again. Wright committed a needless foul, for which he was cautioned, some thirty metres from goal and when Jay Wilson played the ball to the far post, only one Watt defender went back with the clutch of Coldstream players who flooded the box. When the ball was headed back across goal, any one of a number of players might have applied the finish, but Sutherland hooked the ball home for his second goal.
The Watt’s period of ascendancy was over and Coldstream dominated the remainder of the half. Ash Langford headed over from close range, then Sutherland set up James Scott for a shot which Saunders did well to save low to his left. A sally forward by Sellar and Donnelly finished with a cross by Sellar which Donnelly stretched to head just past the post, but before half-time things had got worse for the Watt. Langford, coming into possession twenty metres out and side-on to the goal, flicked up the ball and struck it perfectly into the same patch of net which had been used by Sutherland for the visitors’ first goal. Once again, one could only admire the expertise of the scorer.
The second half started as the first had finished and Adam Woolven’s alert intervention took the ball off the toe of Liam Wallace as he lined up a shot. Then Sutherland’s shot was well covered by Saunders, but the goalkeeper could do nothing to prevent the Streamers going further ahead when the Watt defence was outflanked on the left and the ball was rolled inside for Scott to score easily.
The situation was now looking dire for the home team: three goals adrift of a rampant Coldstream side with around forty minutes still to play. Gradually, however, the Watt began to settle and play some decent football. A good move involving several players brought a corner when Sellar hooked the ball wide to Wright, whose dangerous cross aimed for Stevenson had to be intercepted. Martin Green’s well-flighted corner was headed down by Woolven at the far post and blocked back to Sellar, but his shot from the edge of the area lacked the power to trouble Glaspin.
A good switch of play by Sutherland put Stuart Spence away on the Coldstream left. He went past Kerlin and the Watt player brought him down blatantly. It was a caution, but could have been worse.
Half-way through the second half, Sellar was replaced by Liam Walker and the young man didn’t take long to make his mark. A good ball out of defence by Green picked out Donnelly on the left. He outstripped the tiring Sutherland, cut into the box and played the ball across goal for Walker to apply a light touch and deflect the ball into goal off the far post.
Suddenly it was the Watt which was in the driving seat and the Streamers began to look weary. Craig Heugh and Hagen Steele were brought into the action to provide fresh legs, while for the Watt, Fraser Wilson came into the attack and Scott Munro into midfield.
We reached the last ten minutes and there were still plenty of goals left in this game. First of all, Donnelly won a superb header in midfield and Wilson headed the ball into the path of the pacy striker as he drove forward again, showing a great turn of pace to reach the penalty area and fire a left-foot shot between Glaspin and his near post.
The deficit was only one now and the Watt could sense an opportunity, but four minutes later a mix-up in defence proved decisive. Steele crossed from near the corner flag on the right and David Kerr tried to chest the ball down for Saunders to collect, but as the two Watt players left it to each other, the Watt’s regular persecutor, John Crawford, was able to stretch out a leg and poke the ball into goal.
It was a ridiculous goal to lose, but the great-hearted Donnelly was still giving up nothing and a minute from the end of regulation time he once again brought the gap back to one goal. Walker’s lay-off enabled Donnelly to leave the left side of the Coldstream defence standing and fire the ball across Glaspin into the far corner.
With Donnelly in full flow and the visitors’ defence looking out on its feet, it really did look as if the Watt could get something from the match yet if there were only time for yet another goal. As the match went into stoppage time, Donnelly accepted the ball from a throw-in on the left, backheeled it past a defender and powered into the box again, but was stopped at the cost of a corner. Wright’s kick was a long one and although Woolven got the top of his head to the ball, he could not control its direction and the ball slipped past. It was the Watt’s last chance on the Riccarton grass.
With about half the squad still unavailable, the Watt side which contested this match at the home of the side which led the League for most of last season included few names familiar from last season and in reality was no match for a slick Athletic side which attacked with variety and pace.
The Leith side is itself a youthful one, but already it has significant East of Scotland experience and is a well-organised unit. Good touch and movement are its hallmarks and although the Watt missed some good chances to score in this match, a two-goal defeat was acceptable, as Leith came close on numerous occasions and things could have been worse. Having said that, the Watt side put up a spirited display and played some decent football when it could get the space to do so.
An early chance for Chris Donnelly came from a long clearance by Craig Saunders. Judging the bounce well, Donnelly slipped inside his marker, but as he was preparing to shoot, his pocket was picked by a defender arriving quickly on the scene.
Donnelly was again involved a few minutes later as Watt made progress on the left. Stevie Wright moved into position to accept a pass inside and swept a precise long pass out to Harry Warner on the right, but the excellent LA3 got in a tackle to concede the corner.
Leith took the lead after sixteen minutes’ play. Bursting through a couple of feeble attempts to tackle, James Hainey reached the edge of the area and unleashed a superb left-foot shot which soared high past Saunders’ left hand into the top corner of the goal.
Saunders was a little fortunate not long after this when his misjudged clearance was quickly returned for Lewis Martin to shoot. Saunders managed to block with his legs and to his relief the ball looped up into the air and fell into his arms.
Athletic was stretching the Watt defence in wide positions, with the pacy Martin and Stephen Baigan troubling Mark Hamill and Alex Scott. When Baigan set up Sean Murphy to send the ball low across the face of the Watt goal, Hamill did well to deny Martin.
As half-time approached, Adam Kerlin’s square pass enabled Wright to get in a shot, but his shooting position was cramped and although his direction was good he was unable to generate enough power to trouble Leith goalkeeper Neil Fairnie. Cammy Stevenson then executed a good turn and cross from the right, but the ball passed just over the head of Warner as he came in from the other side.
Five minutes into the second half, the Watt had their best chance of the game. Warner set the ball back for Donnelly to strike from around twenty metres. The ball swerved in the air and Fairnie could only block it back out. Stevenson was charging in and got to the scene a little too soon, as he had to try to improvise a shot before the ball was past him. The ball struck Fairnie again and Stevenson had another rebound to deal with, but his off-balance effort was cut out near the post by a returning defender.
Two minutes after this, the Watt had a big let-off when Kyle Fee’s free kick was headed against the bar by Alan Murray and from the rebound Steven Glynn headed against the bar and over.
David Kerr, who had been cautioned earlier, lived dangerously with a foul on the edge of the Watt area, but Saunders dealt well with Scott Wilson’s shot, diving to his left to push the ball well away from goal.
Donnelly, who had dropped into the “hole”, allowing Stevenson to go forward, was relishing his midfield duties and made a good run through the centre of the pitch, but with Warner available on the left he tried a very difficult pass to Stevenson and the Leith defence mopped up.
Another good save by Saunders from Martin’s free kick set the Watt surging forward again, Stevenson timing his jump perfectly to head on for Donnelly’s run, but when he received the return pass as he sped in on the right, his first-time shot was somewhat ambitious and missed the target by a distance.
With twenty minutes to play, the home side added a second goal, which had been threatened for some time. A cross-field pass picked out Martin on the right and although Hamill did his best to time his challenge to block the shot, Martin was clever enough to hold his shot until Hamill was committed before ramming the ball just inside the far post.
Leith came close again when Fee’s corner curled into the near post area; Ryan Higgins did well to head the ball against the underside of the bar and Saunders swiped it clear of the players closing in. Again, Watt swept quickly to the other end, but with Liam Walker coming in from the left, Stevenson chose to shoot and his shot faded across goal.
Leith substitute Steven Froude surged into the Watt penalty box and it took the combined efforts of Kerr and Saunders to thwart him, but soon the Watt pressed forward again with another good right-wing break. The attack was sustained for some time, Martin Green winning a corner after Stevenson was eased off the ball as he jumped close to goal, but when Leith cleared the corner kick, players poured forward and it looked like a problem for the Watt. Froude took the shot, but Warner, who had tracked back at pace, threw himself in to divert the ball behind.
A tiring Watt defence was given an uncomfortable last ten minutes. A driving run on the right by Gary Black ended with a pass clipped inside into the stride of Martin, who shot first-time of the half-volley, missing the post by a small margin. Several corners were conceded in quick succession and Murray shaved both posts with headers, but Watt lasted out without further mishap.
Eight minutes of slackness at the end of the first half cost the Watt the points in the opening Qualifying Cup match at Recreation Park.
Playing into a stiff breeze, Watt held its own for the first half-hour. An early turn and shot from the edge of the area by Chris Sellar cleared the bar by only a few inches as Watt looked lively from the start. The home side responded with a driving run through the middle of the pitch by George Cunningham, ending in a shot from distance which missed the junction of post and bar by a foot or so.
Michael Osborne was Ormiston’s most creative force and his shot from the left was securely taken by Craig Saunders. Then a good move on the Watt left involving Adam Woolven and Mark Hamill resulted in Ryan Higgins winning a corner. When Adam Kerlin’s kick was played to the edge of the area, Harry Warner drove in a low shot but this was blocked somewhere in the forest of legs in the penalty box.
Further shots by Lee Cochrane and by Osborne failed to find the target for Ormiston and with almost half an hour played, Watt took the lead with a fine goal. Cammy Stevenson accepted a throw on the left, turned his man and swept the ball across from the line. Warner had made a well-timed run and when the ball reached him, he turned his foot and directed a precise shot past the left hand of Jamie Walton into the far corner of the net.
Saunders was tested by shots from Anton McKillop and the persistent Osborne, but there was no warning of the suddent capitulation of the Watt defence in the last few minutes of the first half. Mikey Hamilton started it, darting on to a quickly-taken free kick and outflanking the right side of the Watt defence. The angle was tight and there may have been a deflection, but his shot went past the right hand of Saunders and into goal for an equaliser.
Two minutes later, Ormiston led when at the end of a fluent move on the right, Osborne cut the ball back into the danger area. It was not well cleared and Johnathan Edmond struck a shot which was deflected precisely into the spot between the outstretched hand of Saunders and the post to his left.
In the last minute of the half, the Watt defence was at sixes and sevens in trying to deal with McKillop’s free kick. A shot came in from close range and Saunders got his body in the way, allowing a defender to turn the ball behind. When the corner was played in, however, there was more indecisive defending and George Cunningham was able to play the ball through the ruck of players and under Saunders to give the home team a 3 – 1 interval lead.
In the early part of the second half, the main thing on the minds of players and spectators alike was the weather. A hard, sleety rain fell steadily, drenching everyone unable to escape to cover.
Chris Donnelly, held back from a starting position due to a niggling injury, replaced Chris Sellar in attack a few minutes into the second half, but with sixty-two minutes played, Ormiston went further ahead when Gareth Gray rose unchallenged to send a firm header into the net.
By this time, the rain had relented somewhat and the Watt sent on its last two substitutes, Stevie Wright and Ronnie Napier.
As the match entered its last twenty minutes, the visitors made it a contest again, reprising the trick earlier performed by their opponents by scoring two goals inside three minutes. Firstly, Napier ran on to a ball down the right, advanced into the box, drew out Walton and slipped the ball inside for Warner to finish; then Warner did it all for himself, running through to win a ball for which he was second-favourite, then turning to fire the ball under Walton to complete his hat-trick.
There was time enough for Watt to seek an equaliser and Warner had yet another chance to shoot when the ball came back to him after Donnelly had chased down a ball which Walton was trying to gather, but this time the shot was blocked.
Wright had the next opportunity, the ball running to him on the edge of the area after Stevenson was tackled, but although he struck a crisp shot, Walton dived to his left to turn the ball away and when Warner played the ball back in towards goal, a defender blocked it, enabling the goalkeeper to collect.
The best chance of all came to Stevenson, but having latched on to a pass in the inside-left channel and taken the ball past the advancing Walton, his angle was tight and when he shot the ball slipped past the far post.
It was certainly a day to remember for young Harry Warner. No-one can recall a player scoring a hat-trick on his East of Scotland debut for the Watt before. What a pity the feat was achieved in defeat.
|
{
"pile_set_name": "Pile-CC"
}
|
Does your school or office block access to music sites? Looking for unblocked music services? Here are some recommendations for some great music streaming sites and an explanation on how you can access them from anywhere in the world!
In this blog, we’ll tell you about:
Exciting news for all you music lovers out there! If your school or office restricts access to free music streaming, and you’d like to learn how to unblock music services, read on. We’ll tell you exactly how you can listen to music on any music streaming site, no matter where you are!
It’s unbelievably easy to unblock music! Just simply:
Pick your desired music service – We’ve done the hard part for you and assembled an all-you-need-to-know list to enjoy unblocked music services.
Unblock Music Anywhere – Get a new IP address, and bypass any restrictions at school or work so you can connect to your desired service.
If you’d like to compare streaming services, overcome restrictions set in place by your school or office, and learn how to access any Geo-restricted content from anywhere in the world safely and securely, we’ll tell you everything you need to know below! (Hint: Our VPN apps can help!)
Overview of Popular Music Streaming Services
Before you get ready to enjoy and unblock music, here’s a helpful summary of the best streaming music services out there:
Bonus: Don’t forget that you can also find most music and create your own playlists on YouTube! They even offer different Mixes, which is like a radio. Be sure to use a VPN to access YouTube from your location. Read our full guide on how to unblock music on YouTube anywhere in the world.
As you can see, there are tons of options out there when it comes to streaming music services. Many even have free music streaming options! For example, if you decide to download Spotify, check out this video of Spotify Tricks You Need To Try:
Have any additional music services to recommend? Please share them with us in the comments!
Unblocked Music Anywhere with SaferVPN
If you’re in a country or location where the above services are unavailable, you may run into a message like this when trying to accessing them:
But a VPN can help! So exactly how can you access free music streaming services?
The way it works is that the website or app can determine your IP address, which tells them your exact location. If you simply hide your IP address, their servers can’t know your true location. So with a VPN, all you need is a click of a button to connect, and you can unblock music and access any music service, website or app you want, anywhere you are!
*Keep in mind, when registering, a streaming music service might ask for your location or country. If they do, just fill in the country whose server you’re connected to.
Here’s a simple step-by-step guide to unblock music on your favorite streaming sites:
Get a SaferVPN plan, or start your free trial if you don’t have an account yet. Connect to a vpn server located in the country where your desired music service is available. Access your desired music service, and you’ll see that it works just as if you were in a country that streams it freely. You can now unblock music from anywhere!
Here’s our short video if you’d like to see the action for yourself how easy it is to unblock any site with SaferVPN:
If you don’t have SaferVPN yet, we offer a 30-Day Money Back Guarantee, so you’ve got nothing to lose! or try SaferVPN for free so you can easily unblock music streaming services and even download Spotify from anywhere in the world!
Have any more questions about what can you access and how SaferVPN works? Connect with us on social media, or send us an email at support@safervpn.com. We’re here for you 24/7.
Start your free VPN trial, and get access to any unblocked music you want, wherever you are!
|
{
"pile_set_name": "OpenWebText2"
}
|
This directory contains the implementations of lower-level forms of the bulk invocation functions:
* `bulk_invoke_executor`
* `bulk_async_executor`
* `bulk_then_executor`
These work like the regular `bulk_invoke` etc. functions, but take an executor
as a parameter rather than an execution policy. The implementation of
higher-level forms of `bulk_invoke` and friends lower onto these functions.
|
{
"pile_set_name": "Github"
}
|
Ali Al-Rashid
Ali Al-Rashid is a member of the Kuwaiti National Assembly, representing the second district. Born in 1967, Al-Rashid worked as a lawyer before being elected to the National Assembly in 2003. Al-Rashid affiliated with the liberal National Democratic Alliance, but left the coalition on November 23, 2008.
Opposed Severing Ties with Denmark, Europe
On November 6, 2006, the parliament voted 22-15 to approve severing diplomatic ties with Denmark over the Jyllands-Posten Muhammad cartoons controversy and spending about US$50 (€39.20) million to defend the prophet's image in the West. Both votes were nonbinding, meaning the Cabinet does not have to abide by them. Al-Rashid voted against cutting diplomatic ties, arguing that Muslims have to be positive and remember that it were some individuals, not governments, who insulted the Prophet Muhammad. Al-Rashid was quoted as saying, "We here in Kuwait curse Christians in many of our mosques, should those (Christian) countries boycott Kuwait?"
Against Bailing Out Debtors
On December 19, 2006, parliament voted 39-20 to reject a bill that would have seen the government write off $27bn of its citizens' private debts. Al-Rashid voted against the bill, accusing its proponents of succumbing to pressure by constituents so that they would be re-elected: "It is very easy for me to become a hero and to forget Kuwait, public money, the interest of our children and future generations."
Human Rights Abuses "Made Up"
on May 13, 2007, Al-Rashid, who heads parliament’s human rights committee, was quoted as saying that servant abuse is an “exception” and some maids “make up” stories of abuse to get out of their contracts. However, he conceded the government must act more quickly to guarantee prompt payment of laborers and punish companies that “harm Kuwait’s reputation,” by not meeting their obligations.
Defended Education Minister Nouria al-Subeih
On January 22, 2008, the parliament voted 27-19, with two abstentions, against the impeachment of Education Minister Nouria al-Subeih.
In the lead-up to the vote, Saleh Ashour, Ali Al-Daqbaashi, Musallam AlـBarrak and Hussein Muzyed spoke against the minister while Al-Rashid, Khalaf Al-Enezi, Mohammed Al-Sager, and Adel Al-Saraawi spoke in her defense.
Subeih had to defend herself against allegations that she had attempted to deceive the nation when she denied a press report that three male students had been sexually assaulted by an Asian worker at a state school. She explained she had been misinformed and issued an apology.
Islamist lawmaker Saad al-Shreih also accused Subeih of not showing enough respect for Islam when she did not punish a 14-year-old girl who had allegedly drawn a cross on her religion text book and scribbled notes on it that she hated Islam. The minister told the house there was no evidence the girl had actually done that and so she was just referred to counseling. Shreih, however, still managed to gather the requisite signatures of ten lawmakers to force the no-confidence vote.
Pro-Coeducation
Coeducation in Kuwait has been a contentious issue since the rise of the Islamists in parliament in the 1990s.
In 1996, conservative Kuwaiti lawmakers banned coed classes at the state universities and technical colleges, include Kuwait University. The ban prohibited mixing of the sexes in classes, libraries, cafeterias, labs and extracurricular activities at Kuwait University. Compliance was lax until lawmakers grilled Education Minister Misaed Haroun about it in April 1997, and he committed to full segregation by the end of the next school year.
In 2000, when foreign universities were first allowed to open branches in Kuwait, the ban was extended to those institutions as well.
On February 6, 2008, Al-Rashid proposed a bill that would allow men and women to take classes together in Kuwaiti universities, which would reverse the 12-year-old ban on coeducation. On the topic, Al-Rashid said: "Kuwait University was established in the 1960s as a co-ed university. Segregating students only came in 1996. If we are to go back to the origin of things, Kuwait University then is originally a co-ed facility. Religion is clear about this subject."
On the same day that he proposed the bill, Al-Rashid allegedly received a death threat. According to Al-Rashid, an angry man left a threatening message at Al-Rashid's office. "If he doesn't withdraw the bill, seven bullets will settle the matter," Al-Rashid described the caller as saying in the course of an insult-filled rant. Al-Rashid said police told him they arrested a suspect and he was being interrogated. Soon afterwards, police told Al-Rashid that they had apprehended and were interrogating a suspect in the threat, a retired civil servant.
According to Al-Rashid, university teachers and officials have complained it has been difficult and costly to teach male and female students separately. Among Kuwait’s neighbors, state universities are coed in Bahrain and Oman, but segregated in Saudi Arabia, Qatar and the United Arab Emirates. Conservative lawmakers want to extend the ban to foreign primary and secondary schools. Kuwaiti primary and secondary schools are already gender segregated.
On February 28, 2008, political activist and Kuwait University professor Dr Mohammad Dohaim Al-Deferi slammed Al-Rashid's push for coeducation, arguing that even prominent figures like US President George W Bush supported the idea of establishing schools that segregated the sexes. He further argued that MPs should concentrate more on other important issues and implement developmental plans, instead of attracting undue attention toward silly issues that are not beneficial.
Supports Government Funds for College Tuition
On September 28, 2008, Al-Rashid, along with MPs Abdullah Al-Roumi, and Adel Al-Saraawi have proposed a draft law which suggests that the government fund Kuwaiti students' higher education at private colleges. According to the bill, the government would bear half of the expenses for students enrolled in private universities in Kuwait, excluding Kuwait University.
External links
Michele Dunne's interview of Al-Rashid
References
Category:1967 births
Category:Living people
Category:Members of the National Assembly of Kuwait
Category:National Democratic Alliance (Kuwait) politicians
Category:Speakers of the National Assembly of Kuwait
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Powder Ridge Returns for 2013-14 Ski Season
by Viktoria Sundqvist
(page 1 of 3)
The work never seems to stop. Generators hum, hammers bang, saws spin and workers plant grass seed and carry old shelving out of buildings. Pick-up trucks drive up and down a dirt road. Bobcats dig where 1,400 parking spaces will soon be. With just about a month left to go before lights are set to come back on at Powder Ridge Mountain Park & Resort in Middlefield, time is running out.
“We will be open for the season,” vows Sean Hayes, the new owner, on a warm day in October. “We may not have all the services we would like, but we will be open.”
One of five ski areas in Connecticut, Powder Ridge offers a 525-foot vertical drop and a 2,000-foot run with 22 trails, from bunny hills to black diamonds. It’s the only ski resort in the state with a full half-pipe.
The southernmost ski area in New England—to some mostly known for its failed rock festival in 1970—has been closed since 2007, when owner Whitewater Mountain Resorts filed for bankruptcy. The town of Middlefield bought it for $2.55 million in December 2008 at a foreclosure auction. Four years later Hayes, who also owns Brownstone Exploration & Discovery Park in Portland, was able to acquire the resort from the town for $700,000 after voters overwhelmingly approved the deal via referendum.
As part of the deal, Hayes agreed to invest at least $2 million in permanent improvements to the property. His plan was to invest up to $5 million if necessary.
“I’m nuts,” he says about his decision to buy the place. However, with all the synergies between a ski area and his Portland water park, Hayes says he couldn’t resist the challenge. “They are only nine miles apart. We can reach 23 million people within a 90-mile radius.” Between the two properties, he’ll be offering full-time work for almost 200, including cooks, waitstaff, lift operators and ski instructors.
Hayes is passionate about his vision to restore the long-vacant Powder Ridge into a full-service resort, leveraging the unique attributes of the terrain like when he transformed a Portland quarry into an exciting adventure park. He describes the project as a “continuing vision that evolves when you get into it.”
“I’m a sculptor,” he says. “I’m the happiest when I’m on a bulldozer.” Plus, having the winter off was just “too much relaxation.” (Brownstone operates from May through September; Powder Ridge will be open from October through March, offering leaf-peeping tours starting next fall.)
When complete, Powder Ridge will offer skiing, snowboarding, mountain biking, obstacle courses, a swimming pool, hiking, tubing and a scenic parking area. The 19,000-square-foot lodge will have retail shops, and Hayes says he hopes it will be a place where parents don’t just drop kids off but stay to shop and watch the family ski on TVs in the base lodge.
“We will feature three levels of eating,” he says, laying out the floor plans: A market area on the first level with The Ridgeside Tavern bar and mountain views on upper levels, topped by a more formal full-size restaurant, Fire at the Ridge, headed up by celebrity chef Kevin Cottle, former executive chef for Jordan Caterers and a first runner up on Gordon Ramsay’s TV cooking competition “Hell’s Kitchen.” Hayes is hopeful the restaurant will be open by New Year’s Eve.
|
{
"pile_set_name": "Pile-CC"
}
|
<?php
namespace oasis\names\specification\ubl\schema\xsd\CommonBasicComponents_2;
/**
* @xmlNamespace urn:oasis:names:specification:ubl:schema:xsd:CommonBasicComponents-2
* @xmlType TaxExclusiveAmountType
* @xmlName TaxExclusiveAmount
* @var oasis\names\specification\ubl\schema\xsd\CommonBasicComponents_2\TaxExclusiveAmount
*/
class TaxExclusiveAmount extends TaxExclusiveAmountType
{
} // end class TaxExclusiveAmount
|
{
"pile_set_name": "Github"
}
|
Q:
AngularJS execution order with `$q` -- Chaining Promises
Following Approach works:
$q.when()
.then(checkCookieToken) // check if cookie already exists e.g. in cookie
.then(setHeader) // set Header with REST-Token e.g from cookie
.then(checkTokenOnline) // if not OK logout
.then(getMenu) // if previous OK get navigation menu
.then(getDataResource) // set ngResource
.then(getData); // and query it
4 Questions:
1) If e.g. checkTokenOnline is not OK, I don't want to execute the rest functions, how can I quit (exit, break, whatever,..) at this point?
2) How can I set some of them parallel and some of them serial ?
3) How can I transfer data between them?
4) How can I make the following function dependend from its previous result?
A:
You are asking how to chain functions in promises.
3) How can I transfer data between them?
4) How can I make the following function depend on its previous result?
Return data (or a promise) for the next function in the chain:
var p2 = p1.then ( function (data) {
var nextData = someFn(data);
return nextData;
});
var p3 = p2.then ( function (nextData) {
var nextData2 = someOtherFn(nextData);
return nextData2;
});
//return for further chaining
return p3;
1) If e.g. checkTokenOnline is not OK, I don't want to execute the rest functions, how can I quit (exit, break, whatever,..) at this point?
To reject a promise, have your function throw an error. The chain will skip all the .then methods until you supply an error handler.
var p2 = p1.then ( function checkTokenOnline (response) {
if ( isBadFn(response) {
throw error;
} else {
return nextData;
}
}) .then ( someFn
) .then ( someOtherFn
) .catch ( function (error) {
// someFn and someOtherFn skipped
//log error
throw error;
});
//return for further chaining
return p2;
2) How can I set some of them parallel and some of them serial ?
To make two functions run in parallel, make two promises. Use $q.all to wait for them both to complete.
var p1 = $q.when ( fn1() );
var p2 = $q.when ( fn2() );
var p3 = $q.all ( [p1, p2] );
var p4 = p3.then ( function (responseList) {
var response1 = responseList[0];
var response2 = responseList[1];
return something;
}). catch ( function (error) {
//log error
throw error;
});
//return for further chaining
return p4;
Be aware that $q.all is not resilient. If any promise throws an error, the .then method will be skipped and only the first error will go to the .catch method.
The rule of thumb for functional programming is always return something.
Useful links
AngularJS $q Reference - Chaining promises
You're Missing the Point of Promises.
Ninja Squad -- Traps, anti-patterns and tips about AngularJS promises
|
{
"pile_set_name": "StackExchange"
}
|
Effects of various neuroleptics on rabbit hyperthermia induced by N, N-Dimethyltryptamine (DMT) and d-amphetamine.
The effects of various neuroleptics were studied on N, N-dimethyltryptamine (DMT, 3.2 mg/kg) and d-amphetamine (3.2 mg/kg) induced hyperthermia in the rabbit. Complete dose-effect curves were obtained. The order of potency for antagonism of DMT-induced hyperthermia was: methiothepin greater than octoclothepin greater than or equal to oxyprothepin greater than perathiepin greater than dokloxythepin greater than mianserine greater than loxapine greater than oxypertine greater than chlorpromazine greater than pipamperone greater than fluphenazine greater than thiothixene greater than haloperidol greater than molindone. The order of potency for antagonism of d-amphetamine hyperthermia was: haloperidol greater than chlorpromazine greater than oxypertine greater than octoclothepin and methiothepin. For these five drugs, the order of potency for antagonism of amphetamine hyperthermia was the reverse of the order for antagonism of DMT hyperthermia. Methiothepin reduced d-amphetamine-induced hyperthermia effectively at a very high dose (0.32 mg/kg) and variably at lower doses. The results indicate that neuroleptics differ markedly in their specificity of antagonism of DMT and d-amphetamine which may act through different neurotransmitter mechanisms (tryptaminergic vs. adrenergic).
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Sewanee Students Attend the Global South Summit
On November 11, undergraduate sustainability fellow Joanna Parkman ’14 traveled to Nashville to attend the two-day Global South Summit. Shari Balouchi ’15 joined her, and both students participated in the Summit Fellows Program, thanks to nominations and generous funding by the Babson Center for Global Commerce.
The Global South Summit, sponsored by the Cumberland Center’s Global Action Platform, focused on the creation of abundance through innovation in three major areas, including food, health, and prosperity. Parkman elected to attend the series of lectures concentrating on food systems, agriculture, nutrition, and hunger issues. She had the opportunity to meet the former president ofHeifer International, a World Bank representative from the Global Agriculture and Food Security Program, and the director of the UC Davis Agricultural Sustainability Institute, among many other key leaders in the field.
Plenary speaker Dr. Howard-Yana Shapiro discussed the importance of “uncommon collaborations” between diverse stakeholders, citing Mars Inc.’s cacao (cocoa) research as a model. Shapiro described how he led a team composed of IBM, the USDA, and university researchers in sequencing the cacao genome. Of particular note is the project’s emphasis on publicly accessible, open source data. As Shapiro stated, there will be no intellectual property restrictions on the information. He also stressed the project’s benefits for farmers, consumers, and corporations, alike, as the sequence will aid in breeding disease-resistant and higher yielding cacao trees. Through theSustainable Cocoa Initiative, Mars Inc. has committed to sustainably source its entire cacao supply from certified farms by 2020.
In the first panel discussion, “Building an Abundant Ecosystem for Food: Finding Consensus on What is Good Food,” Michael Dimok, the president of national food movement organizer, Roots of Change, challenged attendees to change the way they conceptualize food systems. He elaborated, advocating for a departure from the industrial format with which most have come to view agricultural production. Instead of this flawed perspective (one that aims to eliminate diversity), Dimok urged the adoption of a biological paradigm allowing for evolution and adaptation. This session also brought to light the difficulties in defining “sustainability,” a term that inherently attracts multiple interpretations. For example, passing a farm on to one’s offspring does not necessarily mean that the operation qualifies as ecologically sustainable.
In a session entitled “New Enterprise Models for Food,” Mark Cackler, the manager of the Agriculture and Environmental Services Department for the World Bank, suggested that agriculture presents unparalleled opportunities for sustainability, as “the only sector that can remove carbon from the atmosphere”. Furthermore, he stated that farmers compose the largest group of private sector actors, so their voices will be critical in shaping future food policy.
Finally, in the panel discussion on Sustainable sourcing Models for the Food Chain, Jeff Pfitzer the program director for Gaining Ground, Chattanooga’s local food initiative, outlined challenges specifically facing the local food movement. He cited price, convenience, and awareness as three major barriers for widespread local purchasing in communities like Nashville or Chattanooga. Pfitzer called for the development of communication and information systems that can provide consumers with more confidence in their choices.
|
{
"pile_set_name": "Pile-CC"
}
|
Original Sinsuality Tour
The Original Sinsuality Tour is the eighth concert tour by American singer-songwriter Tori Amos, undertaken during the summer of 2005 in support of her album The Beekeeper. The tour featured Amos playing solo concerts in Europe, North-America and Australia. The complete recordings of six concerts have since been released as The Original Bootlegs. The tour was noted for prominently featuring cover versions of other artists' songs. Amos would play new covers at every concert, most of them suggested by fans.
Songs played
Amos is known for changing her setlist every time she performs. It is notable that the lead single from her album release at the time, "Sleeps with Butterflies" was played only rarely, despite being a hit on Triple-A radio and getting television promotion.
These are the songs she performed more than 20% of the time.
Amber Waves
Barons of Suburbia
The Beekeeper
Bells for Her
Blood Roses
Carbon
Cars and Guitars
China
Cloud on My Tongue
Cool on Your Island
Cooling
Crucify
Goodbye Pisces
Hey Jupiter
Horses
Icicle
Jamaica Inn
Leather
Liquid Diamonds
Marianne
Mother Revolution
Original Sinsuality
Parasol
Rattlesnakes
The Power of Orange Knickers
Putting the Damage On
Silent All These Years
Space Dog
Spring Haze
Sweet the Sting
Take to the Sky
Tear in your Hand
Toast
Yes, Anastasia
Winter
Tour dates
References
Category:2005 concert tours
Category:Tori Amos concert tours
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Three people were shot at a back-to-school peace picnic held at a playground in Chicago on Saturday night.
A fourth person was beaten up at the event that was held to promote peace and community.
The picnic, which took place at Seward Park on the city’s North Side, was off to a safe start, but onlookers say the mood quickly turned when a group of young men showed up and started fighting.
“It’s senseless and should have never happened,” event organizer Raymond Hatcher told reporters. “We were doing well. Everything was going swell and then a group of guys who were not associated with us, came to the event intoxicated.”
“We were doing well. Everything was going swell and then a group of guys who were not associated with us, came to the event intoxicated.” — Raymond Hatcher, organizer of Chicago "peace picnic"
Hatcher, who puts on the event that is attended by hundreds of people every year, shook his head as police roped off the area with red crime-scene tape.
Nineteen-year-old Trayvon Hatcher came with his two nephews to the park on Saturday.
“Everyone was trying to get away,” he told reporters.
Hatcher said when he heard the shots, he grabbed his nephews and left.
Saturday’s incident was one of several shootings that have rocked Chicago over the weekend.
On Friday, as the city girded itself for another weekend of mayhem and bloodshed, a shooting left seven people hurt, including a 3-year-old boy.
The youngster was one of 25 people shot in Chicago over a span of roughly 14 hours from Friday afternoon to early Saturday.
A 27-year-old man was killed after being shot in the chest and arm around 3 p.m. Friday on Chicago's South Side, according to the Chicago Tribune.
Police say the child was hit in his left shin in the Englewood neighborhood on the South Side. He was transported to a children’s hospital and was in stable condition.
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
Name of the Minimum value in a named vector
I have a named vector:
v <- c("morning"=80, "noon"=20, "night"=40)
printing min(v) gives
[1] 20
I want to get this instead:
noon
20
Is there a simple way?
A:
v[which.min(v)] will give you the output you listed. But if you just want the name, and not the value, then do names(v)[which.min(v)].
|
{
"pile_set_name": "StackExchange"
}
|
Complex effects of interleukin 6 on clonogenic blast cell growth in acute myeloblastic leukemia.
The present in vitro study shows how interleukin (IL)-6 modulates clonogenic blast cell growth in complex ways in acute myeloblastic leukemia when used either as a single factor or in different hematopoietic growth factor combinations. In the presence of IL-6, the colony numbers in culture assay decreased to 50 +/- 29% from the basal values (p < 0.001) in 10 cases and increased to 384 +/- 278% of the basal values (p < 0.01) in 5. The inhibitory effect of IL-6 on blast cell colony formation was retained when IL-6 was combined with granulocyte colony stimulating factor, but was lost if IL-6 was used in combination with mast cell growth factor, IL-3, granulocyte-macrophage colony stimulating factor, or IL-4. The stimulatory effect of IL-6 was diminished in the presence of granulocyte colony stimulating factor, but preserved in the presence of other growth factor combinations. IL-6 had a neutral effect on colony growth in 7 cases with acute myeloblastic leukemia. In these cases, however, IL-6 stimulated significantly clonogenic cell growth if combined with mast cell growth factor or granulocyte-macrophage colony stimulating factor.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Cart
New Year Choco Cake
₹1090
All you need is a glowing chocolate cake to bring more excitement in the festive New Year moment. Have a look at this mesmerizing chocolate cream cake and order it for your upcoming New Year party. The ravishing cherries on top of the cake have enhanced the great looks. Just contemplate a year’s lessons and hug the New Year with a bite of this cake.
|
{
"pile_set_name": "Pile-CC"
}
|
Smoking Prevalence Among Users of Primary Healthcare Units in Brazil: The Role of Religiosity.
The objective of this cross-sectional study is to examine the association between religious involvement and tobacco use in a large representative sample of users of primary healthcare units of Ribeirão Preto, Southeast Brazil. Current and past smoking habits were determined among 1055 users of primary healthcare units. Participants' religiosity was measured using the DUREL questionnaire. The prevalence of smoking among men was 16.8% [95% confidence interval (CI) 12.0-22.5] and among women was 12.6% (95% CI 10.4-15.0). Among the current smokers, 40.9% were light smokers, 24.6% were moderate smokers, and 34.5% were heavy smokers. The mean number of cigarettes smoked per day was 13.5. Respondents who have a religion had a lower smoking prevalence than people who had no religion. Current smoking prevalence tended to be higher among people who do not practice their religion than people who practice their religion. Smoking status is also associated with self-reported religiosity, organizational religious activity and some aspects of intrinsic religiosity. Religiosity is an important factor in influencing the smoking behavior in Brazilian users of the public health services.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Early intraneuronal accumulation and increased aggregation of phosphorylated Abeta in a mouse model of Alzheimer's disease.
The progressive accumulation of extracellular amyloid plaques in the brain is a common hallmark of Alzheimer's disease (AD). We recently identified a novel species of Aβ phosphorylated at serine residue 8 with increased propensity to form toxic aggregates as compared to non-phosphorylated species. The age-dependent analysis of Aβ depositions using novel monoclonal phosphorylation-state specific antibodies revealed that phosphorylated Aβ variants accumulate first inside of neurons in a mouse model of AD already at 2 month of age. At higher ages, phosphorylated Aβ is also abundantly detected in extracellular plaques. Besides a large overlap in the spatiotemporal deposition of phosphorylated and non-phosphorylated Aβ species, fractionized extraction of Aβ from brains revealed an increased accumulation of phosphorylated Aβ in oligomeric assemblies as compared to non-phosphorylated Aβ in vivo. Thus, phosphorylated Aβ could represent an important species in the formation and stabilization of neurotoxic aggregates, and might be targeted for AD therapy and diagnosis.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Preventing unintended pregnancies and improving contraceptive use among young adult women in a rural, Midwestern state: health promotion implications.
Despite high rates of unintended pregnancy among women aged 18 to 30 years, little research has been conducted to understand the factors associated with their contraceptive use. Eighteen focus groups were conducted with young adult women (N = 106) who were mostly white, non-Hispanic. Results suggested that contraceptive use was negatively affected by low contraceptive knowledge; use of alcohol; a lack of planning for sex; a misperception of the likelihood of pregnancy; forgetting to use contraceptives; and concerns about side effects, cost, and confidentiality. Women liked the peace of mind that using contraceptives gave them and the benefits of regular periods from some hormonal methods. Implications for reducing unintended pregnancies through interventions are offered.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Supreme Court Acknowledges “Unconscious Prejudice.”
Thursday’s blockbuster opinion in the Texas Department of Housing and Community Affairs v. Inclusive Communities Project case will be primarily and justly remembered for interpreting the Fair Housing Act to include a disparate-impact cause of action. In anti-discrimination law, “disparate treatment” requires an intent to discriminate, while “disparate impact” can allow a plaintiff to win even in the absence of discriminatory intent. For instance, if an entity has a policy that disproportionately affects a protected group, it has to justify that disparity even in the absence of any allegation of discriminatory intent. If it cannot produce such a justification, it will lose. As many progressives have already noted, this interpretation of the FHA is a big win, as discriminatory intent is often difficult to prove.
While less obvious, however, there is a passage in the FHA case that can also be counted as a potential win for progressives. On Page 17 of the slip opinion, Justice Anthony Kennedy writes, “Recognition of disparate-impact liability under the FHA also plays a role in uncovering discriminatory intent: It permits plaintiffs to counteract the unconscious prejudices and disguised animus that escape easy classification as disparate treatment.” (Emphasis mine.) Disparate impact has long been seen as a way of proving “disguised animus”—so that is nothing new. However, the idea that disparate impact can be used to get at “unconscious prejudices” is, to my knowledge, an idea new to a Supreme Court majority opinion.
The idea of “unconscious prejudice” is that one can have prejudices of which one is unaware that nonetheless drive one’s actions. It has been kicking around in academia for years. As Mahzarin Banaji and Anthony Greenwald discuss in Blindspot: Hidden Biases of Good People, Greenwald created the test to assess such unconscious biases in 1994. This test can now be found at implicit.harvard.edu. Since taking academia by storm, it has migrated over to industry—companies ranging from Google to Pfizer have laudably adopted it to assist in making their workplaces more inclusive.
|
{
"pile_set_name": "Pile-CC"
}
|
Lego is taking its girls out of their pink-bricked houses and putting them in the laboratory.
The Denmark-based toymaker has announced it will produce a series of minifigure sets featuring female characters conducting scientific research. The three-figure Lego series, titled “Research Institute,” depicts women as chemists, astronomers and paleontologists. The chemist is depicted in a lab, the astronomer looks through a telescope and the paleontologist is shown examining dinosaur bones. Lego said it will aim to have the figures in stores by August 2014.
“Research Institute” won the latest Lego Ideas contest, which allows fans to submit their custom Lego kit designs in the hopes they will become full Lego products. Kits must gather at least 10,000 supporters on Lego’s Kickstarter-like contest website before they are submitted for consideration. Lego then chooses one kit to produce.
Ellen Kooijman, a geochemist from Sweden, designed the minifigure kit. “As a female scientist I had noticed two things about the available Lego sets: a skewed male/female minifigure ratio and a rather stereotypical representation of the available female figures,” she wrote in a blog post last year, shortly after the project hit its 10,000-supporter goal. “It seemed logical that I would suggest a small set of female minifigures in interesting professions to make our Lego city communities more diverse.”
Kooijman’s proposal languished on the Lego Ideas site for more than a year before social media gave it the push it needed. The project was posted in May 2012, and had 2,500 supporters slightly over a year later, on June 4, 2013. Then Twitter took notice, and the project’s supporters skyrocketed up to 10,000 in a matter of six days.
The three final minifigure selections – an astronomer, chemist and a paleontologist – were just a few of many possibilities Kooijman included in her pitch. “The motto of these Scientists is clear: explore the world and beyond!” she wrote on her Lego Ideas page.
The toys are a break from Lego’s longstanding approach of producing pink and purple Lego kits for its female audience. Lego currently has two female-oriented lines on its website: a “Disney Princess” series and a “Friends” line that includes toys such as “Stephanie’s Beach House,” “Summer Riding Camp” and “Stephanie’s Outdoor Bakery.”
The female minifigure set was selected over kits based on popular franchises, including "the Legend of Zelda," "Adventure Time," "Back to the Future," "Sherlock" and the anime series "Macross." It was also chosen over a Japanese architecture-themed kit.
Past Lego Ideas winners include a "Ghostbusters" 30th anniversary kit, a Lego version of the Mars rover Curiosity and a replica of the DeLorean time machine from the movie "Back to the Future."
|
{
"pile_set_name": "OpenWebText2"
}
|
At least some of the tablet-loving public picked up a Surface Pro this weekend. Those earliest of early adopters have discovered an unpleasant limitation, however: the vaunted pen input doesn't have complete support in important apps. Microsoft is using only an official driver without any current option to install an alternative, leaving artists without eraser or pressure support in creative industry staples such as Adobe Photoshop. While there's no immediate fix, a Microsoft spokesperson tells us that it's working with the "necessary partners" to expose full pen functionality; we've reached out to Adobe as well, and will let you know if it's one of the chosen few. In the meantime, Surface artisans who need full pen recognition may want to consider an add-on tablet as a stopgap. Read Microsoft's full statement after the break.
Update: Adobe tells us it's "working with [its] partners to explore the possibility" of support, which suggests that we'll need to be patient.
[Thanks, John]
|
{
"pile_set_name": "OpenWebText2"
}
|
It’s almost a relief now that Stan Van Gundy, for whatever silly reason, was never able to nab a full-time spot as an NBA analyst on national TV. He would have been fantastic, alternating X’s-and-O’s education with hilarious rants about stupid arena giveaways and other NBA minutiae. He would have left a cranky void in the TV landscape whenever some smart team finally hired him back into the league.
Detroit became that team on Tuesday after Van Gundy blew away franchise higher-ups with his preparation — his vision for the team, his evaluation of each player, and his plan for overhauling the Pistons’ moribund culture, according to a high-level team source. Detroit got the jump on Van Gundy ahead of Golden State, and by the time he met with the Warriors, he had the Detroit option in the bag, according to several league sources. The Pistons had hired a search firm to spit out a list of candidates, but in the end, they disregarded that list when it became clear they had a shot at SVG.
The Pistons are paying Van Gundy $35 million over five seasons to act as both coach and the team’s top front-office decision-maker, according to both Yahoo (which broke the news) and ESPN.com. The salary cap does not apply to head coaches, and there are only a half-dozen or so guys who really move the needle. If you can get one of them, you should do it, even if it’s pricey. Van Gundy is one of those guys.
The dual role Van Gundy will play is tricky. Lots of high-profile guys have officially had both the coach and GM titles, including Don Nelson, Larry Brown, Gregg Popovich, Pat Riley, and Doc Rivers right now in Los Angeles. Popovich relinquished the official GM role in San Antonio but still shares final say in every personnel decision. The lines can be blurry, especially with powerful and long-tenured coaches. Doug Collins didn’t have the GM title in Philly, but he was calling most of the shots, which made it doubly hilarious when he ripped his own players after a frustrating loss in 2013 — as if Collins the coach had been unfamiliar with the limitations of the players Collins the de facto GM had picked.
Guys who wear both hats must be wary of chasing short-term wins over long-term health. Brown was the top power broker during his time in Charlotte, and he loaded the Bobcats with aging vets on bloated long-term deals in pursuit of fleeting mediocrity. Rivers the GM signed players Rivers the coach liked and/or feared in Boston five years ago.
But Van Gundy should be insulated from these dangers. The team will hire a full-time front-office steward, and Van Gundy has reportedly pushed for Otis Smith, his former GM in Orlando, to snag that role. Smith’s track record in Orlando is discouraging, though it’s hard to tell who made the final call on a desperate series of expensive moves the team made in a candy-addled attempt to win Dwight Howard’s schoolgirl affection. The dynamic will be different this time around if Van Gundy has veto power over Smith, and with a very capable front-office staff below those two.
The five-year deal also gives Van Gundy security to think big-picture for a franchise that badly needs that kind of thinking. No team has had a more miserable last half-decade. Detroit is about to make its fifth straight appearance on the lottery dais, and the Pistons have been at or near the bottom of the NBA in attendance since the breakup of their championship core. They are the only team to rank below the league’s average in both points scored and allowed per possession in each of the last five seasons, per NBA.com. In short, they have been bad at almost everything.
Joe Dumars, the team’s deposed GM and architect of that title team, cycled through a gazillion coaches as the Pistons flailed around; the recent expiration of Lawrence Frank’s old contract barely saved the Pistons the indignity of paying four head coaches at once next season — Frank, Maurice Cheeks, John Loyer, and now Van Gundy. (Side note: Could another team besides the Lakers and Cavs send Mike Brown a $1 check, just so we can say three different teams are paying Mike Brown not to coach them? Seriously: If Brown is back in the league next season as an assistant, he needs to check into coaching rehab. He would officially love coaching too much. Just collect those checks and spend a year on the beach.)
And yet, the Pistons are not a total shit show — not even close. They are actually pretty lean going forward, and they have a potential franchise centerpiece in Andre Drummond. The idea of Van Gundy doing for Drummond what he did for a young Dwight Howard should terrify the league. They could have as much as $22.5 million in cap room this summer, and still about $12 million once you account for Greg Monroe’s cap hold. In other words: Detroit could search the market for some badly needed shooting while Monroe hangs in restricted free agency, and then move on Monroe when the market dictates its path.
Detroit could have a pile of cap room next summer even if it re-signs Monroe to a maximum deal, while big contracts for Josh Smith, Monroe, and Drummond are set to overlap for only one season — and that is after the expiration of Brandon Jennings’s current deal. One more move to consider: Detroit owes Charlotte a first-round pick, but the Pistons will keep that pick this year if it falls within the top eight. Detroit enters next week’s lottery snugly in that no. 8 spot.
Monroe and his agent, David Falk, will want a max contract, and the Pistons are right to play hardball. That’s how you use restricted free agency, especially for a strange player like Monroe, who has not proven worthy of what would be a $15 million–per-year commitment. He’s a low-post behemoth with quick feet, a hungry appetite for rebounds, and good passing skills for his position. Throw this dude the ball on the low block and he’ll get buckets and double-teams.
The knock on Monroe is that he has struggled badly on defense, his midrange shot is bricky, and his development stalled out this season as Cheeks and Loyer juggled an incongruous mix of three bigs in Monroe, Drummond, and Smith. Opponents outscored Detroit by nearly 6.5 points per 48 minutes when those three played together, making for one of the worst heavy-usage trios in the league among teams that were actually trying to win games — something the Pistons weren’t really trying to do once it became clear they would miss the playoffs. Detroit just never developed any coherence on that end. Monroe is slow traversing large spaces and low to the ground, Drummond is (like most young players) out of sorts, Smith can’t chase wing players anymore, and Jennings is the James Harden of point guards.
The Pistons did not appear to have much of a scheme. They changed the way they defended the pick-and-roll almost on a game-to-game basis, sometimes asking Monroe to jump way out to corral ball handlers — something he’s just not equipped to do. There was no five-man coordination among players. Nobody helped the helper, and defenders on the weak side had no clue what to do against a pick-and-roll or in response to a double-team on the block. The Pistons were the opposite of “on a string.” They just lit the string on fire.
Detroit had more success playing two of the three bigs and sitting the other. Counting only lineups that logged at least 25 minutes, the Pistons actually managed a positive scoring margin with the Smith-Monroe and Monroe-Drummond pairings, per NBA.com. But that last one, so important to Detroit’s future, didn’t play enough minutes together — and when they did it was it was interrupted by Smith hoisting awful midrange jumpers.
Detroit nudged Smith toward his worst habits by shoehorning him in at small forward, where he had to spend time away from the basket in an attempt to “space the floor.” But the team let him jack up shots with no accountability, and Smith bricked his way to one of the worst perimeter shooting seasons in modern league history. With the exception of a couple early-season benchings under Cheeks, the coaches did nothing.
That will change with Van Gundy working under a five-year deal. He prizes shot selection, on both ends. If you violate his rules repeatedly, you are coming out of the game. He doesn’t care about your status or salary.
And there will be rules. Van Gundy has historically stressed packing the paint on defense, protecting the 3-point line, avoiding gambles, and forcing midrange jumpers — analytically savvy tenets he implemented before analytics were cool. His teams typically force very few turnovers and clean the defensive glass; he stops scrimmages to point out when players gamble out of scheme for steals.
He’ll likely have Monroe and especially Drummond hang back near the paint, as Howard mostly did in Orlando. There will be a strict system the team uses night-to-night, with only minor tweaks for each opponent. The team will be insanely well prepared.
Van Gundy’s Orlando teams were ahead of the curve in chucking lots of 3s, and he has been pigeonholed as a 3-point zealot. That’s not exactly true. In Orlando, Van Gundy molded his offense around Howard’s pick-and-roll gravity and the skill set of Rashard Lewis (playing under a massive contract Van Gundy likely would not have approved). His Miami teams with Shaquille O’Neal played a bigger brand of ball, with more of the inside-out game you’d expect from a Shaq team. Still, Van Gundy gets the importance of the 3, and finding more outside shooting will be his first priority. Detroit over the last two seasons has already shown it can be an enormously powerful offensive force running Drummond on the pick-and-roll with shooting around him. Expect more of that.
Even Van Gundy’s Miami teams ranked poorly in offensive rebounding, and Van Gundy has always emphasized getting back on defense over crashing the glass.
“Stan studies the game, and he found offensive rebounding just isn’t important to winning,” says Steve Clifford, the Bobcats head coach and a Van Gundy assistant in Orlando. “Stealing the ball and creating turnovers are not usually factors in winning big.”
It will be interesting to see how that works in Detroit, which led the league in offensive rebounding rate last season and forced a decent amount of turnovers. It’s possible the roster is the rare sort that could excel at both transition defense and on the offensive glass: Let Drummond and Monroe go wild while everyone else gets back.
Van Gundy is malleable, to a degree, and much more analytics-friendly than people think. That misconception is partly Van Gundy’s fault. He has made himself into a friendly sort of cartoon character, mocking the silly fringes of analytics with a mustachioed old-school gruffness. But he’s really just suspicious of blind trust in numbers generated by people who don’t know the nuances of the game — the responsibilities of each player in his scheme, how an opponent’s system works, and how a particular player fits within a particular roster. It’s hard to credit and blame players accurately if you don’t know that stuff.
That does not make Van Gundy hostile toward analytics. He has told the Pistons he would like to expand the use of analytics for both coaching and personnel evaluation, a team source says. As previously mentioned, his teams have naturally played an analytically friendly style, and Van Gundy is a smart, curious guy who wants to know what the numbers say.
He has famously clashed with two behemoth centers in O’Neal and Howard. O’Neal called Van Gundy a “master of panic,” and Howard suggested Van Gundy maintain a sunnier disposition on the sideline. He has gained a reputation as a grating type. But most of his players, at least the ones I’ve talked to, don’t feel that way. A lot of guys loved playing for Van Gundy, even with his pouting perfectionism. If you’re a pro, devoted to your craft, Van Gundy can be a godsend.
Look, there’s a ton of work to be done here. Drummond is still very young. Jennings hasn’t worked out, and has just two years left on his deal at an affordable price. If he’s not the answer at point guard, he’s not unmovable, either. Monroe’s free agency is a massive organizational moment, especially since he’s so much closer in age to Drummond than Smith. The Monroe-Drummond pairing is a more natural long-term foundation than Drummond and Smith, with Smith being eight years older than Drummond.
But Smith’s trade value has never been lower. Still, the Pistons should be targeting teams with room to spend, their own trade pieces and/or cap room, and foolish motivation to win right now — the Lakers, Knicks, and Nets come to mind. The Pelicans have a couple of ugly contracts linked to perimeter players, but they’ve expressed no real interest in Smith, according to league sources. Detroit might be stuck.
That would complicate the Monroe equation. A max-level deal might be an overpay, but with the cap set to skyrocket over the next three or four years, maybe it’s on overpay you make if the alternative is losing Monroe for nothing or dumping him in a blah sign-and-trade. But it’s possible Van Gundy, so interesting in perfect spacing, might view Drummond as the only keeper here.
Detroit is in the early stages of legitimate rebuilding, which says a lot about how bad the past five years have been. But Van Gundy is the kind of guy a team should trust with that process.
|
{
"pile_set_name": "OpenWebText2"
}
|
---
abstract: 'Motivated by Gentzen’s disjunction elimination rule in his Natural Deduction calculus and reading inequalities with meet in a natural way, we conceive a notion of distributivity for join-semilattices. We prove that it is equivalent to a notion present in the literature. In the way, we prove that those notions are linearly ordered. We finally consider the notion of distributivity in join-semilattices with arrow, that is, the algebraic structure corresponding to the disjunction-conditional fragment of intuitionistic logic.'
author:
- |
Rodolfo C. [E]{}rtola-Biraben$^1$, Francesc Esteva$^2$, and Lluís Godo$^2$\
$^1$ CLE - State University of Campinas\
13083-859 Campinas, São Paulo, Brazil\
$^2$ IIIA - CSIC, 08193 Bellaterra, Spain
title: 'On distributive join-semilattices'
---
Introduction
============
Different notions of distributivity for semilattices have been proposed in the literature as a generalization of the usual distributive property in lattices. As far as we know, notions of distributivity for semilattices have been given, in chronological order, by Grätzer and Schmidt [@GS] in 1962, by Katriňák [@K] in 1968, by Balbes [@B] in 1969, by Schein[@S] in 1972, by Hickman [@H] in 1984, and by Larmerová and Rachnek [@LR] in 1988. Following the names of its authors, we will use the terminology GS-, K-, B-, S$_n$-, H-, and LR-distributivity, respectively.
In this paper, motivated by Gentzen’s disjunction elimination rule in his Natural Deduction calculus, and reading inequalities with meet in a natural way, we conceive another notion of distributivity for join-semilattices, that we call ND-distributivity. We aim to find out whether it is equivalent to any of the notions already present in the literature. In doing so, we also compare the different notions of distributivity for join-semilattices we have found. Namely, we see that the given notions imply each other in the following linear order:
GS $\Rightarrow$ K $\Rightarrow$ (H $\Leftrightarrow$ LR $\Leftrightarrow$ ND) $\Rightarrow$ B $\Rightarrow \cdots$ S$_n
\Rightarrow$ S$_{n-1} \Rightarrow \cdots$ S$_3 \Rightarrow$ S$_2$,
and we also provide countermodels for the reciprocals.
Additionally, we show that H-distributivity may be seen as a very natural translation of a way to define distributivity for lattices, fact that will provide more motivation for the use of that notion. Note that Hickman used the term mild distributivity for H-distributivity.
The paper is structured as follows. After this introduction, in Section 2 we provide some notions and notations that will be used in the paper. In Section 3 we show how to arrive to our notion of ND-distributivity for join-semilattices. In Section 4 we compare the different notions of distributivity for join-semilattices that appear in the literature. We prove that one of those is equivalent to the notion of ND-distributivity found in Section 3. Finally, in Section 5 we consider what happens with the different notions of distributivity considered in Section 4 when join-semilattices are expanded with a natural version of the relative meet-complement.
Preliminaries
=============
In this section we provide the basic notions and notations that will be used in the paper.
Let ${\bf{J}} = (J; \leq)$ be a poset. For any $S \subseteq J$, we will use the notations $S^l$ and $S^u$ to denote the set of lower and upper bounds of $S$, respectively. That is,
- $S^l = \{x \in J: x \leq s$, for all $s \in S \}$ and
$S^u = \{x \in J: s \leq x$, for all $s \in S \}$.
\[BL\] Let ${\bf{J}} = (J; \leq)$ be a poset. For all $a, b, c \in J$ the following statements are equivalent:
- for all $x \in J$, if $x \leq a$ and $x \leq b$, then $x \leq c$,
- $\{a, b\}^l \subseteq \{c\}^l$,
- $c \in \{a, b\}^{lu}$.
A poset ${\bf{J}} = (J; \leq)$ is a [*join-semilattice*]{} (resp. meet-semilattice) if $\sup\{a, b\}$ (resp. $\inf\{a, b\}$) exists for every $a, b \in J$. A poset ${\bf{J}} = (J; \leq)$ is a lattice if it is both a join- and a meet-semilattice. As usual, the notations $a \vee b$ (resp. $a \wedge b$) shall stand for $\sup\{ a, b\}$ (resp. $\inf\{a, b \}$).
Given a join-semilattice ${\bf{J}} = (J; \leq)$, we will use the following notions:
- ${\bf{J}}$ is *downwards directed* iff for any $a, b \in J$, there exists $c \in J$ such that $c \leq a$ and $c \leq b$.
- A non empty subset $I \subseteq J$ is said to be an [*ideal*]{} iff\
(1) if $x,y \in I$, then $x\vee y \in I$ and\
(2) If $x \in I$ and $y \leq x$, then $y \in I$.
- The principal ideal generated by an element $a \in A$, noted $(a]$, is defined by $(a] = \{x \in A : x \leq a\}$.
- $Id({\bf{J}})$ will denote the set of all ideals of ${\bf{J}}$.
- $Id_{fp}({\bf{J}})$ will denote the subset of ideals that are intersection of a finite set of principal ideals, that is, $Id_{fp}({\bf{J}}) = \{(a_1] \cap \dots \cap (a_k] : a_1,...a_k \in J\}$.
In this paper we are concerned with various notions of distributivity for join-semilattices, all of them generalizing the usual notion of distributive lattice, that is, a lattice ${\bf{J}} = (J; \leq)$ is distributive if the following equation holds true for any elements $a, b, c \in J$:
- $a \land (b \lor c) = (a \land b) \lor (a \land c)$ (equivalently, $a \lor (b \land c) = (a \lor b) \land (a \lor c)$).
There are several equivalent formulations of this property, in particular we mention the following ones that are relevant for this paper:
- for all $a, b, c \in J$, if $a \lor b = a \lor c$ and $a \land b = a \land c$ then $ b = c$.
- for any two ideals $I_1, I_2$ of $\bf J$, the ideal $I_1 \lor I_2$ generated by their union is defined by $I_1 \lor I_2 = \{ a \lor b : a \in I_1, b \in I_2\}.$
- the set $Id({\bf{J}})$ of ideals of $\bf J$ is a distributive lattice.
For the case of semilattices, several non-equivalent generalizations of these conditions can be found in the literature, already mentioned in the introduction. However, as expected, all of them turn to be equivalent to usual distributivity in the case of lattices.
The class of distributive lattices form a variety (that is, an equational class). In contrast, in any sense of distributivity for join-semilattices that coincides with usual distributivity in the case of a lattice, the class of distributive join-semilattices is not even a quasi-variety. Indeed, consider the distributive lattice in Figure \[Fdjns\]. Taken as a join-semilattice, the set of black-filled nodes is a sub join-semilattice, that is clearly a non-distributive lattice (a diamond). Thus, it is neither distributive as a join-semilattice. This proves that the class of distributive (in any sense that coincides with usual distributivity in the case of a lattice) join-semilattices is not closed by subalgebras, and hence it is not a quasi-variety.
\[ht\]
=\[draw, circle, fill=white, minimum size=4pt, inner sep=0pt, label distance=0.5mm\]
(0,0) node (0) \[fill=black\] ; (-1.3,1.3) node (1) ; (0,1.3) node (2) ; (1.3,1.3) node (3) ; (-1.3,2.6) node (4) \[fill=black\] \[label=left:a\] ; (0,2.6) node (5) \[fill=black\] \[label=right:b\] ; (1.3,2.6) node (6) \[fill=black\] \[label=right:c\] ; (0,3.9) node (7) \[fill=black\] ; (0)–(1)–(4)–(2)–(0)–(3)–(6)–(2) (1)–(5)–(3) (4)–(7)–(6) (5)–(7);
Distributivity and Natural Deduction {#DaND}
====================================
Let us consider the disjunction-fragment of intuitionistic logic in the context of Gentzen’s Natural Deduction calculus (see [@Ge p. 186]). It has the following introduction rule for $\vee$ and an analogous one with $\mathfrak{B}$ as only premiss:
and the following disjunction elimination rule:
The last rule may be read as saying that if $\mathfrak C$ follows from $\mathfrak A$ and $\mathfrak C$ follows from $\mathfrak B$, then $\mathfrak C$ follows from $\mathfrak A \vee B$, so reflecting what is usually called “proof by cases”. It is possible to give an algebraic translation in the context of a join-semilattice ${\bf{J}} = (J; \leq)$:
for all $a, b, c \in J$, if $a \leq c$ and $b \leq c$, then $a \vee b \leq c$,
which is easily seen to be one of the conditions stating that $\vee$ is the supremum of $a$ and $b$. Now, the last rule is usually employed in a context with a fourth formula $\mathfrak H$:
In the context of a lattice ${\bf{L}} = (L; \leq)$, we would give the following algebraic translation:
- for all $h, a, b, c \in L$,
if $h \wedge a \leq c$ and $h \wedge b \leq c$, then $h \wedge (a \vee b) \leq c$.
It is easily seen that [**(D$_{\wedge \vee}$)**]{} is equivalent to the usual notion of distributivity for lattices. Now, the natural question arises how to give an algebraic translation of [**($\vee$E)**]{} if only $\vee$ is available, for example, if we are in the context of a join-semilattice. Considering that an inequality $u \land v \leq w$ in a lattice ${\bf{L}} = (L; \leq)$ is equivalently expressed as the first order statement
for all $x \in L$, if $x \leq u$ and $x \leq v$ then $x \leq w$,
we may write [**[(D$_{\wedge \vee}$)]{}**]{} in the context of a join-semilattice ${\bf{J}} = (J; \leq)$ as follows:
- for all $h, a, b, c \in J$,
IF for all $x \in J$ (if $x \leq h$ and $x \leq a$, then $x \leq c)$ and
for all $x \in J$ (if $x \leq h$ and $x \leq b$, then $x \leq c)$,
THEN for all $x \in J$ (if $x \leq h$ and $x \leq a \vee b$, then $x \leq c$).
Alternatively, using the equivalence between parts (i) and (ii) in Lemma \[BL\], we may write
- for all $h, a, b, c \in J$,
if $\{h,a\}^l \cup \{h,b\}^l \subseteq \{c\}^l$, then $\{h,a \vee b\}^l \subseteq \{c\}^l$.
Yet, using the equivalence between parts (ii) and (iii) in Lemma \[BL\], we may also alternatively write
- for all $h, a, b, c \in J$,
if $ c \in \{h,a\}^{lu} \cup \{h,b\}^{lu}$, then $c \in \{h,a \vee b\}^{lu}$.
Accordingly, given the above logical motivation, it is natural to consider the following notion of distributivity for join-semilattices.
A join-semilattice ${\bf{J}} = (J; \leq)$ is called ND-distributive (ND for Natural Deduction) if it satisfies [**[(D$_{\vee}$)]{}**]{}.
Now, it happens that there are many different (and non-equivalent) notions of distributivity for semilattices. This is not new:
> “The concept of distributivity permits different non-equivalent generalizations from lattices to semilattices.” (see [@S])
So, it is natural to inquire whether the given notion of ND-distributivity for join-semilattices is equivalent to any of the notions already present in the literature and, if so, to which. In what follows we will solve that question. In doing so, we will also compare the different notions of distributivity for join-semilattices that we have found.
In this paper, given our logical motivation, we restrict ourselves to study the distributivity property in join-semilattices, but an analogous path could be followed for meet-semilattices or even for posets.
*Let us note that the following rule (reflecting proof by three cases) is equivalent to [**($\vee$E)**]{}:*
Indeed, it implies [**($\vee$E)**]{} taking $\mathfrak C = \mathfrak B$. Also, the following derivation shows that it may be derived using [**($\vee$E)**]{} twice:
Different notions of distributivity for join-semilattices {#SDN}
=========================================================
In the following subsections we consider and compare the notions of distributivity for semilattices we have found in the literature. Some authors have presented their notion for the case of meet-semilattices and others for join-semilattices. We will make things uniform and, motivated by the logical considerations in the previous section, we will choose to consider join-semilattices.
We emphasize that all the distributivity notions for semilattices (and posets) proposed in the literature are generalizations of the distributivity property for lattices, in fact, when restricted to lattices all these notions coincide.
GS-distributivity
-----------------
The following seems to be the most popular definition of distributivity for join-semilattices.
\[GSd\] A join-semilattice ${\bf{J}} = (J; \leq)$ is GS-distributive iff
- for all $a, b, x \in J$, if $x \leq a \vee b$, then there exist $a', b' \in J$ such that $a' \leq a$, $b' \leq b$, and $x = a' \vee b'$.
In order to visualize it, see Figure \[Dmsl\]. The given definition seems to have appeared for the first time in [@GS p. 180, footnote 4]. It also appears in many other places, e.g., in [@Gr Sect. II.5.1, pp. 167-168].
\[ht\]
=\[draw, circle, fill=white, minimum size=4pt, inner sep=0pt, label distance=1mm\]
(0,0) node (x) \[label=right: $x$\] – ++(90:1.5 cm) node (ab) \[label=above: $a \vee b$\] – ++(225:1.4142 cm) node (a) \[label=left: $a$\] – ++(45:1.4142 cm) – ++(315:1.4142 cm) node (b) \[label=right: $b$\] ;
(b)–(1,-1) node () \[label=right: $b'$\] – ++ (x) – ++ (-1,-1) node () \[label=left: $a'$\] – ++ (a);
Next, note that [**(GS)**]{} implies that every pair elements has a lower bound. In fact, we have the following equivalence.
\[E1\] Let ${\bf{J}} = (J; \leq)$ be a join-semilattice. Then, the following two statements are equivalent:
\(i) Every pair of elements has a lower bound.
\(ii) for all $a, b, x \in J$, if $x \leq a \vee b$, then there exist $a', b' \in J$ such that $a' \leq a$, $b' \leq b$, and $a' \vee b' \leq x$.
\(i) $\Rightarrow$ (ii) Suppose $x \leq a \vee b$. Let $a'$ be a lower bound of $\{ a, x\}$ and $b'$ be a lower bound of $\{ b, x\}$. Then, $a' \leq a$ and $b' \leq b$. Also, $a' \leq x$ and $b' \leq x$, which implies that $a' \vee b' \leq x$.
\(ii) $\Rightarrow$ (i) Let $a, b \in J$. We have $a \leq a \vee b$. Then, by hypothesis, there exist $a' \leq a$, $b' \leq b$ such that $a' \vee b' \leq a$. As $b' \leq a' \vee b'$, it follows that $b' \leq a$. Then, $b' \leq a, b$. That is, $b'$ is a lower bound of $\{ a, b\}$.
This proposition shows that every GS-distributive join-semilattice is downward directed. This implies, as it is shown in [@Gr], that the ideal $I \lor J$, generated by the union of two ideals $I, J$, is defined as in the case of distributive lattices, namely, $$I \lor J = \{ a \lor b : a \in I, b \in J\}.$$
As a consequence, it follows that the ideals of a (GS)-distributive join-semilattice ${\bf{J}}$ form a lattice that will be denoted by $Id({\bf{J}})$, and Grätzer proves in [@Gr p. 168] the following characterization result.
\[dJedi\] Let ${\bf{J}}$ be a join-semilattice. Then, ${\bf{J}}$ is (GS)-distributive iff $Id({\bf{J}})$ is distributive.
K-distributivity
----------------
The concept given in the following definition is similar to the one in [**(GS)**]{}.
\[Kd\] A join-semilattice ${\bf{J}} = (J; \leq)$ is K-distributive iff
- for all $a, b, x \in J$, if $x \leq a \vee b$, $x \nleq a$ and $x \nleq b$, then there exist $a', b' \in J$ such that $a' \leq a$, $b' \leq b$, and $x = a' \vee b'$.
In order to visualize, see again Figure \[Dmsl\]. The given definition seems to have appeared for the first time in [@K Definition 4, p. 122]. It also appears, for example, in [@H p. 167].
It turns out that, from the very definition, GS-distributivity implies K-distributivity. In fact, as noted in [@K 1.5, p. 122-123], it is the case that GS-distributivity is equivalent to K-distributivity plus the condition that every pair of elements has a lower bound (that is, downward directed). Therefore, the following proposition makes clear the relationship between GS- and and K-distributivity.
GS-distributivity implies K-distributivity, but not conversely.
The most simple counter-example showing that the reciprocal does not hold is the join-semilattice in Figure \[KGS\], that is not downward directed. Indeed, the given join-semilattice is K-distributive, as the only way to satisfy the antecedent of [**(K)**]{} is to take $1 \leq a \vee b$, but then the consequent is also true. On the other hand, it is not (GS)-distributive, as we have $a \leq a \vee b$ and, however, there are no $a' \leq a$, $b' \leq b$ such that $a' \vee b' = a$.
\[ht\]
=\[draw, circle, fill=black, minimum size=4pt, inner sep=0pt, label distance=1mm\]
(0,0) node (a) \[label=left: $a$\] – ++(45:1cm) node (1) \[label=right: $1$\] – ++(315:1cm) node (b) \[label=right: $b$\] ;
Finally, analogously to Proposition \[dJedi\], we have the following characterisation of K-distributivity via ideals, a proof of which may be found in [@K p. 123].
\[Kiff\] Let ${\bf{J}}$ be a join-semilattice. Then, ${\bf{J}}$ is (K)-distributive iff $Id({\bf{J}}) \cup \{\emptyset\}$ is distributive.
H-distributivity
----------------
In [@H] Hickman introduces the concept of [*mildly distributive*]{} meet-semilattices as those meet-semilattices whose lattice of their strong ideals is distributive. In [@H Theorem 2.5, p. 290] it is stated that it is equivalent to the following statement: [^1]
- for all $n$ and $x, a_1, \cdots, a_n$,
IF for all $b$ (if $a_1 \leq b, \cdots, a_n \leq b$, then $x \leq b)$,
THEN there exists $(x \wedge a_1) \vee \cdots \vee (x \wedge a_n)$ and $x \leq (x \wedge a_1) \vee \cdots \vee (x \wedge a_n)$.
The given conditional may be seen as a translation of the following version of distributivity for lattices:
IF $x \leq a_1 \vee \cdots \vee a_n$, THEN $x \leq (x \wedge a_1) \vee \cdots \vee (x \wedge a_n)$.
In the case of a join-semilattice ${\bf{J}} = (J; \leq)$ and using quantifiers, [**(H)**]{} may be rendered as follows:
- for all $n$ and $x, a_1, \dots, a_n \in J$,
IF $x \leq a_1 \vee \cdots \vee a_n$,
THEN for all $y$, if for all $i=1, \ldots, n$ (for all $z$, IF $z \leq x$ and $z \leq a_i$, THEN $z \leq y$) then $x \leq y$
that is in turn equivalent to:
- for all $n$ and $x, a_1, \dots, a_n \in J$,
IF $x \leq a_1 \vee \cdots \vee a_n$,
THEN for all $y$, if (for all $z$, IF $z \leq x$ and ($z \leq a_1$ or …or $z \leq a_n$), THEN $z \leq y$) then $x \leq y$.
Using set-theoretic notation, [**(H)**]{} may also be rendered as follows:
- for all $n$ and $x, a_1, \dots, a_n \in J$,
if $x \leq a_1 \vee \cdots \vee a_n$, then $x \in (\{x, a_1 \}^l \cup \cdots \cup \{x, a_n \}^l)^{ul}$.
At this point, the reader may wonder whether the number $n$ of arguments is relevant or whether two arguments are enough. Let us settle this question. Firstly, with that in mind, consider
- for all $x, a_1, \dots , a_n, c$,
if $\{x,a_1\}^l \cup \cdots \cup \{x,a_n\}^l \subseteq \{c \}^l$, then $\{x,a_1 \vee \cdots \vee a_n \}^l \subseteq \{c\}^l$.
Now, let us state the following fact.
[**(D$_{\vee_n}$)**]{} is equivalent to [**(C)**]{}.
$\Rightarrow$) Suppose $x \leq a_1 \vee \cdots \vee a_n$ and $y \in (\{x,a_1\}^l \cup \cdots \cup \{x,a_n\}^l)^u$. Our goal is to see that $x \leq y$. Take $c=y$ and apply [**(D$_{\vee_n}$)**]{}. Then we have $\{x\}^l = \{x,a_1 \vee \cdots \vee a_n \}^l \subseteq \{y\}^l$, and hence $x \leq y$. $\Leftarrow$) Suppose $\{x,a_1\}^l \cup \{x,a_2\}^l \cup \cdots \cup \{x,a_n\}^l \subseteq \{c \}^l$. We have to prove that, if $y \leq x$ and $y \leq a_1 \vee \cdots \vee a_n$ then $y \leq c$. Now, using [**(C)**]{}, and the assumptions $y \leq x$ and $y \leq a_1 \vee \cdots \vee a_n$ it follows that $y \in (\{x,a_1\}^l \cup \cdots \cup \{x,a_n\}^l)^{ul}$. But since $\{x,a_1\}^l \cup \{x,a_2\}^l \cup \cdots \cup \{x,a_n\}^l \subseteq \{c \}^l$, we also have $y \in (\{x,a_1\}^l \cup \cdots \cup \{x,a_n\}^l)^{ul} \subseteq \{c\}^{lul} = \{c\}^l$. Hence $y \leq c$.
In turn, let us see that [**(D$_{\vee_n}$)**]{} is equivalent to [**(D$_\vee$)**]{}, which proves that having more than two arguments does not make any difference.
[**(D$_{\vee_n}$)**]{} is equivalent to [**(D$_\vee$)**]{}.
We just prove that [**(D$_\vee$)**]{} implies [**(D$_{\vee_3}$)**]{}, the reciprocal being immediate. Let us suppose $\{h,a_1\}^l \cup \{h, a_2\}^l \cup \{x, a_3\}^l \subseteq \{c \}^l$. Then, we get both $\{h,a_1\}^l \subseteq \{c \}^l$ and $\{h, a_2\}^l \cup \{x,a_3\}^l \subseteq \{c \}^l$, the last of which, using [**(D$_\vee$)**]{}, implies that $\{h, a_2 \vee a_3 \}^l \subseteq \{c \}^l$, which, together with the first, using [**(D$_\vee$)**]{} again, finally implies that $\{h, a_1 \vee a_2 \vee a_3 \}^l \subseteq \{c \}^l$.
As a consequence, H-distributivity coincides with the notion of DN-distributivity for join-semilattices introduced in Section \[DaND\]. Accordingly, we have the following proposition.
\[Hd\] A join-semilattice ${\bf{J}} = (J; \leq)$ is H-distributive iff it is ND-distributive.
Analogously to Propositions \[dJedi\] and \[Kiff\], we also have a characterization of H-distributivity for join-semilattices in terms of distributivity of a sublattice of their ideals. This appears as Corollary 2.4 in [@H p. 290]), where $Id_{fp}({\bf{J}})$ denotes the set $\{(a_1] \cap \dots \cap (a_k] : a_1,...a_k \in J \}$, that is, the set of ideals that are intersection of a finite set of principal ideals of the join-semilattice ${\bf{J}}=(J; \leq)$.
\[Hiff\] Let ${\bf{J}}$ be a join-semilattice. Then, ${\bf{J}}$ is H-distributive iff $Id_{fp}({\bf{J}})$ is distributive.
Let us now compare H- with K-distributivity.
\[KH\] Let ${\bf{J}} = (J; \leq)$ be a join-semilattice. Then, K-distributivity implies H-distributivity.
Suppose
- for all $x \in J$, if $x \leq h$ and $x \leq a$, then $x \leq c$ and
- for all $x \in J$, if $x \leq h$ and $x \leq b$, then $x \leq c$.
Further, suppose both (S1) $x \leq h$ and (S2) $x \leq a \vee b$. The goal is to prove $x \leq c$. Let us suppose that $x \leq a$. Then, using (x1) and (S1), it follows that $x \leq c$. The case $x \leq b$ is analogous using (x2). Finally, suppose both $x \nleq a$ and $x \nleq b$. Using (K) and (S2) it follows that there exist $a', b' \in J$ such that $a' \leq a$, $b' \leq b$, and (F) $x = a' \vee b'$, which implies $a' \leq x$, which using (S1) gives $a' \leq h$. As we also have $a' \leq a$, using (x1) we get $a' \leq c$. Reasoning analogously, we get $b' \leq c$. So, using (F) it follows that $x \leq c$.
The reciprocal of Proposition \[KH\] does not hold considering the model in Figure \[HK\] (with the understanding that there is no element in the white node). The given model appears as a poset in [@Go Figure 2.7, p. 37].[^2] We provide a proof using the characterization of K- and H-distributivity by their ideals (Propositions \[Kiff\] and \[Hiff\]).
\[ht\]
=\[draw, circle, fill=black, minimum size=4pt, inner sep=0pt, label distance=1mm\]
(0,0) node (x1) \[label=left: $x_1$\] ; (x1)–(3,1) node (y1) \[label=right: $y_1$\] ; (y1)–(3,2) node (y2) \[label=right: $y_2$\] ; (y2)–(3,3) node (y3) \[label=right: $y_3$\] ; (y3)–(3,4); (3, 5) node (c) \[label=right: $c$\] ; (c)–(4,6) node (a) \[label=right: $a$\] ; (a)–(3,7) node (top) \[label=right: $1$\] ;
(top)–(0,6) node (e) \[label=above: $e$\] ; (e)–(1,5) node (d) \[label=right: $d$\] ; (d)–(a); (c)–(2,6) node (b) \[label=right: $b$\] ; (b)–(top); (e)–(-1,5) node (f) \[label=left: $f$\] ; (b)–(f); (f)–(0,4) node (df) \[fill=white\] ; (c)–(df); (d)–(df);
(0,3)–(0,2) node (x3) \[label=left: $x_3$\] ; (x3)–(0,1) node (x2) \[label=left: $x_2$\] ; (x2)–(x1); (x2)–(y2); (x3)–(y3);
H-distributivity does not imply K-distributivity.
Let us characterize the sets $Id_{fp}(J)$ and $Id(J)$, where $(J, \leq)$ is the join-semilattice of Figure \[HK\]. An easy computation proves, on the one hand, that $Id_{fp}(J)$ is isomorphic to the ordered set of Figure \[HK\] plus the ideal $I_{\overline{x}} = (f] \wedge (d]$, whose elements are $\{x_i : i \in w\}$, that does not exist in the original join-semilattice. On the other hand, $Id(J)$ is the set of ideals in $Id_{fp}(J)$ plus the ideal ${I}_{\overline{y}}$ generated by the set $\{y_i : i \in w\}$, that is, the ideal with elements ${I}_{\overline{y}} = \{y_i : i \in w\} \cup \{x_i : i \in w\}$. Clearly, this ideal is not a finite intersection of principal ideals. Both $Id_{fp}(J)$ and $Id(J)$ are lattices. Moreover, it is obvious that $Id_{fp}(J)$ is a distributive lattice and thus the join-semilattice of the example is H-distributive. But this is not the case for $Id(J)$, since it has a sublattice isomorphic to the pentagon formed by the elements $(a]$, $(d]$, $(c]$, ${I}_{\overline{y}}$, and ${I}_{\overline{x}}$. Thus, the join-semilattice of the example is not K-distributive.
It is natural to ask whether it is possible to find a finite example in order to prove the reciprocal of Proposition \[KH\]. Let us see that the answer is negative.
For finite join-semilattices, H-distributivity and K-distributivity coincide.
Consider a finite H-distributive join-semilattice. We want to see that it is K-distributive. Accordingly, suppose $x \leq a \vee b$, $x \nleq a$, and $x \nleq b$. It is natural to consider $\bigvee \{ a, x\}^l$ and $\bigvee \{ b, x\}^l$ as candidates for $a'$ and $b'$ in the definition of K-distributivity. Now, in order to do that, we first need to prove that the sets $\{ a, x\}^l$ and $\{ b, x\}^l$ are not empty. Suppose, say, $\{ a, x\}^l = \emptyset$. Then, we have :
- - for all $y$, if $y \leq x$ and $y \leq a$, then $y \leq b$ (as $\{ a, x\}^l = \emptyset$),
- for all $y$, if $y \leq x$ and $y \leq b$, then $y \leq b$,
- $x \leq x$, and
- $x \leq a \vee b$.
So, using H-distributivity, it follows that $x \leq b$, a contradiction.
Having proved that both $\{ a, x\}^l \neq \emptyset$ and $\{ b, x\}^l \neq \emptyset$, let us note that both $\bigvee \{ a, x\}^l$ and $\bigvee \{ b, x\}^l$ exist, due to having a finite structure. Next, let us see that $\bigvee \{ a, x\}^l =$ inf $\{ a, x \}$ (analogously, $\bigvee \{ b, x\}^l =$ inf $\{ b, x \}$). It is clear that both $\bigvee \{ a, x\}^l \leq a$ and $\bigvee \{ a, x\}^l \leq x$. Now, suppose $y \leq a, x$. Then, $y \in \{ a, x\}^l$, and so, $y \leq \bigvee \{ a, x\}^l$, as desired.
It remains to be seen that 1) inf $\{ a, x \} \leq a$, 2) inf $\{ b, x \} \leq b$, and 3) $x =$ inf$\{ a, x \} \vee$ inf$\{ b, x \}$. Now, 1) and 2) are easy to see. Regarding 3), as we have both that inf$\{ a, x \} \leq x$ and sup $\{ b, x \} \leq x$, it follows that inf$\{ a, x \} \ \vee$ inf$\{ b, x \} \leq x$. Finally, observe that the inequality $x \leq$ inf$\{ a, x \} \ \vee$ inf$\{ b, x \}$ follows from
- - for all $y$, if $y \leq x$ and $y \leq a$, then $y \leq$ inf$\{ a, x \} \ \vee$ inf$\{ b, x \}$,
- for all $y$, if $y \leq x$ and $y \leq b$, then $y \leq$ inf$\{ a, x \} \ \vee$ inf$\{ b, x \}$,
- $x \leq x$, and
- $x \leq a \vee b$,
using H-distributivity.
In fact, it is easy to observe that in the case of a finite join-semilattice $J$, the sets of ideals $Id(J)$ and $Id_{fp}(J)$ coincide since, for any two elements $a, b$, either there is no lower bound, that is, $\{a, b\}^l = \emptyset$, or there exists their meet $a \land b = \bigvee \{ a, b\}^l$.
LR-distributivity
-----------------
Larmerová-Rachnek version of distributivity (see [@LR]) was given for posets, as we next see.
\[LRPd\] A poset ${\bf{P}} = (P; \leq)$ is *LR-distributive* iff
- for all $a, b, c \in P$, $(\{ c, a \}^l \cup \{ c, b \}^l)^{ul} = (\{ c \} \cup \{ a, b \}^u)^l$.
In the given definition, it is enough to take one inclusion. Indeed, given a poset ${\bf{P}} = (P; \leq)$ and $a, b, c \in P$, it is always the case that $(\{ c, a \}^l \cup \{ c, b \}^l)^{ul} \subseteq (\{ c \} \cup \{ a, b \}^u)^l$.
It is natural to ask for LR-distributivity in the case of a join-semilattice. The following definition follows from the fact that in a join-semilattice ${\bf{J}} = (J, \leq)$ it holds that $(\{ c \} \cup \{ a, b \}^u)^l = \{ c, a \vee b \}^l$.
\[LRJd\] A join-semilattice ${\bf{J}} = (J, \leq)$ is *LR-distributive* iff
- for all $a, b, c \in J$, $\{ c, a \vee b \}^l \subseteq (\{ c, a \}^l \cup \{ c, b \}^l)^{ul}$.
Now, it can be seen that LR-distributivity is equivalent to H-distributivity, and hence to the condition [**[(D$_{\vee}$)]{}**]{} as well.
Let ${\bf{J}} = (J; \leq)$ be a join-semilattice. Then the following conditions are equivalent:
- ${\bf{J}}$ satisfies [**(LR)**]{},
- ${\bf{J}}$ satisfies [**(H)**]{},
- ${\bf{J}}$ satifies [**[(D$_{\vee}$)]{}.**]{}
The equivalence between (ii) and (iii) is Prop. \[Hd\]. Let us prove that [**(LR)**]{} implies [**(H)**]{}. Suppose
- (x1) for all $x \in J$, if $x \leq h$ and $x \leq a$, then $x \leq c$,
(x2) for all $x \in J$, if $x \leq h$ and $x \leq b$, then $x \leq c$, $x \leq h$ and $x \leq a \vee b$.
Then, the last two inequalities imply $x \in \{ c, a \vee b \}^l$. So, using [**(LR)**]{} we get that $x \in (\{ c, a \}^l \cup \{ c, b \}^l)^{ul}$. That is, for all $y \in J$, if $y \in (\{ c, a \}^l \cup \{ c, b \}^l)^u$, then $x \leq y$. Now, it should be clear that (x1) and (x2) imply that $c \in (\{ c, a \}^l \cup \{ c, b \}^l)^u$. So, $x \leq c$, as desired.
Now, let us see that [**(H)**]{} implies [**(LR)**]{}. Suppose $x \in \{ h, a \vee b \}^l$, that is, (H1) $x \leq h$ and (H2) $x \leq a \vee b$. In order to get our goal, that is, $x \in (\{ h, a \}^l \cup \{ h, b \}^l)^{ul}$, let us suppose that (S) $y \in (\{ h, a \}^l \cup \{ h, b \}^l)^u$ and try to derive $x \leq y$. Now, (S) means that for all $z \in J$, if $z \in (\{ h, a \}^l \cup \{ h, b \}^l$, then $z \in y$, that is,
- (y1) for all $z \in J$, if $z \leq h$ and $z \leq a$, then $z \leq y$ and
(y2) for all $z \in J$, if $z \leq h$ and $z \leq b$, then $z \leq y$.
Now, using [**(H)**]{}, (y1), (y2), (H1), and (H2), we get our goal, that is, $x \leq y$.
B-distributivity
----------------
The following definition seems to have appeared for the first time in [@B Theorem 2.2. (i), p. 261].
\[Bd\] A join-semilattice ${\bf J} = (J; \leq)$ is *B-distributive* iff
- for all $n, a_1, a_2, \dots, a_n, x \in J$, if $a_1 \wedge a_2 \wedge \cdots \wedge a_n$ exists, then also $(x \vee a_1) \wedge (x \vee a_2) \wedge \cdots \wedge (x \vee a_n)$ exists and equals $x \vee (a_1 \wedge a_2 \wedge \cdots \wedge a_n)$.
We have the following fact.
\[HB\] Let ${\bf{J}} = (J; \leq)$ be a join-semilattice. Then, H-distributivity implies B-distributivity.
Let us have a H-distributive join semilattice $J$ and let us take $a, b, x \in J$ (the general case follows by induction). Let us suppose that $a \wedge b$ exists in $J$. Then, also $x \vee (a \wedge b)$ exists in $J$. Our goal is to see that $x \vee (a \wedge b) =$ inf $\{x \vee a, x \vee b \}$. It is clear that $x \vee (a \wedge b) \leq x \vee a, x \vee b$. Now, suppose both (F1) $y \leq x \vee b$ and (F2) $y \leq x \vee a$. We have to see that $y \leq x \vee (a \wedge b)$. It immediately follows that
- (x1) for all $w \in J$, if $w \leq x \vee b$ and $w \leq x$, then $w \leq x \vee (a \wedge b)$.
Now, suppose (F3) $w \leq x \vee b$ and (F4) $w \leq a$. Then, we have both
- (x1’) for all $y \in J$, if $y \leq a$ and $y \leq x$, then $y \leq x \vee (a \wedge b)$, and
(x2’) for all $y \in J$, if $y \leq a$ and $y \leq b$, then $y \leq x \vee (a \wedge b)$.
So, applying H-distributivity to (F3), (F4), (z1’), and (x2’), we have $w \leq x \vee (a \wedge b)$. That is, we have proved
- (x2) for all $w \in J$, if $w \leq x \vee b$ and $w \leq a$, then $w \leq x \vee (a \wedge b)$.
Using H-distributivity, (F1), (F2), (x1) and (x2), it finally follows that $y \leq x \vee (a \wedge b)$, as desired.
The reciprocal of Proposition \[HB\] does not hold as may be seen in Figure \[BH\].
\[ht\]
=\[draw, circle, fill=black, minimum size=4pt, inner sep=0pt, label distance=1mm\]
(0,0) node (a)\[label=left: $a$\] – ++(45:1.4142cm) node (1)\[label=right:$1$\] – ++(270:1cm) node (b)\[label=right:$b$\] – ++(90:1cm) – ++(315:1.4142cm) node (d)\[label=right: $c$\] ;
Observe also that the lattice $Id_{fp}(J)$, for $J$ being the join-semilattice of Figure \[BH\], is not distributive since it is a diamond.
S$_n$-distributivity
--------------------
The following definition seems to have appeared for the first time in [@S].
\[Sd\] A join-semilattice $(J; \leq)$ is said to be *S$_n$-distributive* for $n$ a natural number, $2 \leq n$, iff
- for all $a_1, a_2, \dots, a_n, x \in J$, if $a_1 \wedge a_2 \wedge \cdots \wedge a_n$ exists, then also $(x \vee a_1) \wedge (x \vee a_2) \wedge \cdots \wedge (x \vee a_n)$ exists and equals $x \vee (a_1 \wedge a_2 \wedge \cdots \wedge a_n)$.
It is easy to see that B-distributivity implies $S_n$-distributivity, for any $n \geq 2$. It is also clear that for any $n \geq 2$, $S_{n+1}$ implies $S_n$. On the other hand, we have that for no natural $n \geq 2$ it holds that $S_n$-distributivity implies B-distributivity. In fact, it was proved that for any $n \geq 2$, $S_n$ does not imply $S_{n+1}$ (see [@Ke]), where infinite models using the real numbers are provided. As in the case of GS- and H-distributivity, it is natural to ask whether, for example, finite models are possible. As in the cases just mentioned, the answer is negative as already proved in [@SCLS Theorem 7.1, p. 1071]. In [@SA Theorem, p. 26] it is also proved that it is not possible to find infinite wellfounded models.
Therefore, so far we have seen that, in the case of a join-semilattice, we have the following chain of implications:
[**(GS)**]{} $\Rightarrow$ [**(K)**]{} $\Rightarrow$ [**(H)**]{} $\Leftrightarrow$ [**(LR)**]{} $\Leftrightarrow$ [**(ND)**]{} $\Rightarrow$ [**(B)**]{} $\Rightarrow \cdots$ [**(S$_n$)**]{} $\Rightarrow$ [**(S$_{n-1}$)**]{} $\Rightarrow \cdots$ [**(S$_2$)**]{}.
Join-semilattices with arrow
============================
The expansion of semilattices with an arrow operation has been well studied in the literature in the case of meet-semilattices under the name of relatively pseudo-complemented semilattices (see, for example, [@Gr]). However, as far as we know, the expansion of join-semilattices with an arrow has not received much attention, see, for instance, [@Chajda; @Chajda2]. In this section we deal with distributivity of join-semilattices expanded with an arrow operation.
A join-semilattice with arrow is a structure $(J; \leq, \to)$ where $(J; \leq)$ is a join-semilattice and the arrow $\to$ is a binary operation such that for all $a, b \in J$:
$a \to b = \max \{c \in J:$ for all $x \in J$, if $x \leq a$ and $x \leq c$, then $x \leq b \}$.
The existence of the $\to$ operation is clearly equivalent to the requirement that $\to$ satisfies the following two conditions:
($\to$E) for all $x \in J$, if $x \leq a$ and $x \leq a \to b $, then $x \leq b$,
($\to$I) for all $c \in J$, IF for all $x \in J$, if $x \leq a$ and $x \leq c$, then $x \leq b$, THEN $c \leq a \to b$.
The idea of defining arrow in a poset was already present in [@Ha] (see Definition 4, where the author uses the terminology of Brouwer poset and also proves that a poset with arrow is LR-distributive). Moreover, the author, using LR-notation, defines $a \to b =$ max $\{c \in J: \{a,c\}^l \subseteq \{b\}^l\}$.
In a lattice, or even in a meet-semilattice, arrow coincides with the usual relative meet-complement. This follows from the fact that, as previously mentioned, the inequality $a \wedge x \leq b$ is equivalent to the following universal quantification: for all $y$, if $y \leq a$ and $y \leq x$, then $y \leq b$. By the way, we prefer to use “arrow” instead of “relative meet-complement”, because the meet is not present.
As is well known, a lattice with a relative meet-complement (that is in fact a Heyting algebra) is distributive (see [@S1] or [@S2]). The natural question arises whether a join-semilattice with arrow is distributive in any of the senses considered in Section \[SDN\]. The answer is negative in the case of (GS)-distributivity, as the join-semilattice in Figure \[jsl1\] has arrow and is not GS-distributive.
\[ht\]
=\[draw, circle, fill=white, minimum size=4pt, inner sep=0pt, label distance=1mm\]
(0,0) node (a) \[label=left: $a$\]
– ++(45:1cm) node (1) \[label=above: $1$\] – ++(315:1cm) node (b) \[label=right:$b$\] ;
$\to$ a b 1
------- --- --- ---
a 1 b 1
b a 1 1
1 a b 1
A similar question in the case of K-distributivity has also a negative answer, as the the join-semilattice in Figure \[jsl2\], already given in Figure \[HK\], has arrow and is not K-distributive.
\[ht\]
=\[draw, circle, fill=black, minimum size=4pt, inner sep=0pt, label distance=1mm\]
(0,0) node (x1) \[label=left: $x_1$\] ; (x1)–(3,1) node (y1) \[label=right: $y_1$\] ; (y1)–(3,2) node (y2) \[label=right: $y_2$\] ; (y2)–(3,3) node (y3) \[label=right: $y_3$\] ; (y3)–(3,4); (3, 5) node (c) \[label=right: $c$\] ; (c)–(4,6) node (a) \[label=right: $a$\] ; (a)–(3,7) node (top) \[label=right: $1$\] ;
(top)–(0,6) node (e) \[label=above: $e$\] ; (e)–(1,5) node (d) \[label=right: $d$\] ; (d)–(a); (c)–(2,6) node (b) \[label=right: $b$\] ; (b)–(top); (e)–(-1,5) node (f) \[label=left: $f$\] ; (b)–(f); (f)–(0,4) node (df) \[fill=white\] ; (c)–(df); (d)–(df);
(0,3)–(0,2) node (x3) \[label=left: $x_3$\] ; (x3)–(0,1) node (x2) \[label=left: $x_2$\] ; (x2)–(x1); (x2)–(y2); (x3)–(y3);
$\to$ $x_1$ $x_2$ $x_n$ $y_1$ $y_2$ $y_n$ f d e c b a 1
------- ------- ------- ------- ------- ------- ------- --- --- --- --- --- --- ---
$x_1$ 1 1 1 1 1 1 1 1 1 1 1 1 1
$x_2$ $y_1$ 1 1 $y_1$ 1 1 1 1 1 1 1 1 1
$x_n$ $y_1$ $y_2$ 1 $y_1$ $y_2$ 1 1 1 1 1 1 1 1
$y_1$ e e e 1 1 1 e e e 1 1 1 1
$y_2$ e e e $y_1$ 1 1 e e e 1 1 1 1
$y_n$ $x_1$ $x_2$ e $y_1$ $y_2$ 1 1 1 1 1 1 1 1
f $y_1$ $y_2$ $y_n$ $y_1$ $y_2$ $y_n$ 1 a 1 c 1 a 1
d $y_1$ $y_2$ $y_n$ $y_1$ $y_2$ $y_n$ b 1 1 b b 1 1
e $y_1$ $y_2$ $y_n$ $y_1$ $y_2$ $y_n$ b a 1 c b a 1
c $x_1$ $x_2$ $x_n$ $y_1$ $y_2$ $y_n$ e e e 1 1 1 1
b $x_1$ $x_2$ $x_n$ $y_1$ $y_2$ $y_n$ e d e a 1 a 1
a $x_1$ $x_2$ $x_n$ $y_1$ $y_2$ $y_n$ f e e b b 1 1
1 $x_1$ $x_2$ $x_n$ $y_1$ $y_2$ $y_n$ f d e c b a 1
The case of H-distributivity is different, as we see next.
Every join-semilattice expanded with arrow is H-distributive.
Let ${\bf J} = (J; \leq)$ be a join-semilattice with arrow. Take $a, b, c, h \in J$. Suppose
- (x1) for all $x \in J$, if $x \leq h$ and $h \leq a$, then $h \leq c$ and
(x2) for all $x \in J$, if $x \leq h$ and $x \leq b$, then $x \leq c$.
Take $y \in J$ and suppose
- (F1) $y \leq h$ and
(F2) $y \leq a \vee b$.
Now, using ($\to$I), (x1) implies $a \leq h \to c$ and (x2) implies $b \leq h \to c$. These inequalities together with (F2) imply $y \leq h \to c$, which, using (F1) and ($\to$E), gives $y \leq c$.
Analogously to what happens when considering lattices, in the finite case we have the following fact.
\[fHd\] Every finite H-distributive join-semilattice has arrow.
Let ${\bf J} = (J; \leq)$ be a finite H-distributive join-semilattice. Due to finiteness, $c_1 \vee c_2 \vee \cdots \vee c_n = \bigvee \{c \in J:$ for all $x \in J$, if $x \leq a$ and $x \leq c$, then $x \leq b \}$ exists, for any $a, b\in J$. It is clear that for any $c_i, 1 \leq i \leq n$, it holds that
- \(F) for all $x$, if $x \leq a$ and $x \leq c_i$, then $x \leq b$.
Now, let us see that $c_1 \vee c_2 \vee \cdots \vee c_n$ is in fact $a \to b$.
First, let us see that $c_1 \vee c_2 \vee \cdots \vee c_n \in \{c \in J:$ for all $x \in J$, if $x \leq a$ and $x \leq c$, then $x \leq b \}$. That is, we have to see that
- \(T) for all $x \in J$, if $x \leq a$ and $x \leq c_1 \vee c_2 \vee c_n$, then $x \leq b$.
Now, (T) clearly follows from (F) by H-distributivity.
Secondly, let us take $c \in J$ such that for all $x \in J$, if $x \leq a$ and $x \leq c$, then $x \leq b$. Then, obviously, $c \in \{c \in J:$ for all $x \in J$, if $x \leq a$ and $x \leq c$, then $x \leq b \}$. Then, $c \leq c_1 \vee c_2 \cdots \vee c_n$, as $c_1 \vee c_2 \vee \cdots \vee c_n = \bigvee \{c \in J:$ for all $x \in J$, if $x \leq a$ and $x \leq c$, then $x \leq b \}$.
Finally, the natural question arises whether the class of join-semilattices expanded with arrow forms a variety or at least a quasi variety. The following example proves that the answer is negative. Indeed, consider the distributive lattice in Figure \[B9\], which is the direct product ${\bf J} = (L \times L; \leq)$ where $L = \{0, \tfrac{1}{2}, 1\}$. It is clear that we can define in ${\bf J}$ an arrow $\to$, in fact, ${\bf J}^* = (L \times L; \leq, \to)$ becomes a Heyting algebra. Now, consider ${\bf J}^*$ as a join-semilattice with arrow, and observe that the set $B$ of elements represented by black nodes in the figure is the domain of a subalgebra $(B; \leq, \to)$ of ${\bf J}^*$, since both $\lor$ and $\to$ are closed on $B$. However, the join-semilattice $(B, \leq)$ is not distributive (it contains a pentagon), and moreover the arrow operation is not defined for all pairs of elements. In particular, $(\tfrac{1}{2}, \tfrac{1}{2}) \Rightarrow (0, 0)$ is not defined since the set $$\{ (c, d) \in B : \forall (x,y) \in B, \mbox{if } (x, y) \leq (c, d) \mbox{ and }(x, y) \leq (\tfrac{1}{2}, \tfrac{1}{2}) \mbox{, then } (x, y) \leq (0, 0) \}$$ has no maximum.
\[ht\]
=\[draw, circle, fill=black, minimum size=4pt, inner sep=0pt, label distance=0.5mm\]
(0,0) node (00) \[label=right:[(0,0)]{}\] ; (-1,1)node (0m) \[label=left:[(0,$\tfrac{1}{2}$)]{}\] \[fill=white\] ; (-2,2)node (01) \[label=left:[(0,1)]{}\] \[\]; (1,1) node (m0) \[label=right:[($\tfrac{1}{2}$,0)]{}\] \[fill=white\] ; (2,2) node (10) \[label=right:[(1,0)]{}\] ; (0,2) node (mm) \[label=right:[($\tfrac{1}{2}$,$\tfrac{1}{2}$)]{}\] ; (-1,3)node (m1) \[label=left:[($\tfrac{1}{2}$,1)]{}\]; (1,3) node (1m) \[label=right:[(1,$\tfrac{1}{2}$]{})\]; (0,4) node (11) \[label=right:[(1,1)]{}\];
(00)–(0m)–(01)–(11)–(1m)–(10)–(m0)–(00) (0m)–(mm)–(1m) (m0)–(mm)–(m1);
Conclusions
===========
In this paper we have proposed a notion of distributivity for join-semilattices with logical motivations related to Gentzen’s disjunction elimination rule in the $\{\lor, \to\}$-fragment of intuitionistic logic, and we have compared it to other notions of distributivity for join-semilattices proposed in the literature.
There are a number of open problems that we plan to address as future research. In particular we can mention the following ones:
- As for the logical motivation, similar to the $\bf (\lor E)$ rule in Section 3, one can consider the following rule with two contexts:
This rule also has a natural algebraic translation in the case of join-semilattices. The question arises whether it is equivalent to the condition [**[(D$_{\vee}$)]{}**]{} or if it leads to a different one.
- Distributive lattices are charecterized by their lattice of ideals. In the case of join-semillatices, there are similar characterizations for GS-, K- and H-distributivity, but not for B- and S$_n$distributivity. The question is whether B- and S$_n$-distributive join-semilattices can be characterized by means of their ideals.
- In [@Chajda3] the authors generalize the well-known characterisation of distributive lattices in terms of forbidden sublattices (diamond and pentagon) to distributive posets, also identifying the set of forbidden subposets. A similar study for distributive join-semilattices is an open question.
Acknowledgments {#acknowledgments .unnumbered}
---------------
The authors acknowledge partial support by the H2020 MSCA-RISE-2015 project SYSMICS. Esteva and Godo also acknowledge the FEDER/MINECO project TIN2015-71799-C2-1-P.
[9]{}
Balbes, R. A representation theory for prime and implicative semilattices. ** Trans. Amer. Math. Soc. [**[136]{}**]{} (1969), 261-267.
I. Chajda, J. Rachnek. Forbidden Configurations for Distributive and Modular Ordered Sets. [*Order*]{} 5, 407-423, 1989.
I. Chajda, R. Halaš, and J. Kühr. [*Semilattice structures*]{}. Research and Exposition in Mathematics, 30. Heldermann Verlag, Lemgo, 2007.
I. Chajda, H. Länger. Relatively pseudocomplemented posets. [*Mathematica Bohemia*]{}, 2017 (Doi: 10.21136/MB.2017.0037-16).
Gentzen, G. Untersuchungen über das logische Schließen I. *Mathematische Zeitschrift*, [**[39]{}**]{} (1934), 176-210.
González, Luciano J. Topological dualities and completions for (distributive) partially ordered sets. PhD Thesis.
Grätzer, G. Lattice Theory: Foundation. Springer/Birkhäuser (2011).
Grätzer, G., Schmidt, E. On congruence lattices of lattices. *Acta Math. Acad. Sci. Hungar.* [**[13]{}**]{} (1962), 179-185.
Halaš, R. Pseudocomplemented ordered sets. *Archivum Mathematicum (Brno)* [**[29]{}**]{} (1993), 153-160.
Hickman, R. Mildly distributive semilattices. *J. Austral. Math Soc. (Series A)* [**[36]{}**]{} (1984), 287-315.
Katriňák, T. Pseudokomplementäre Halbverbände. *Mat. Časopis* [**[18]{}**]{} (1968), 121-143.
Kearns, K. The Class of Prime Semilattices is Not Finitely Axiomatizable. *Semigroup Forum* [**[55]{}**]{} (1997), 133-134.
Larmerová, Jana and Rachnek, Jirí. Translations of distributive and modular ordered sets. *Acta Universitatis Palackianae Olomucensis Facultas Rerum Naturalium Mathematica XXVII*, [**[91]{}**]{} (1988), 13-23.
Schein, B. On the definition of distributive semilattices. *Algebra universalis* [**[2]{}**]{} (1972), 1-2.
Serra Alves, C. Distributivity and wellfounded semilattices. *Portugaliae Mathematica* [**[52]{}**]{}(1) (1995), 25-27.
Shum, K. P., Chan, M. W., Lai, C. K., and So, K. Y. Characterizations for prime semilattices. *Can. J. Math.*, [**[37]{}**]{}(6) (1985), 1059-1073.
Skolem, T. Untersuchungen über die Axiome des Klassenkalküls und über Produktations- und Summationsprobleme, welche gewisse Klassen von Aussagen betreffen, *Skrifter uitgit av Videnskapsselskapet i Kristiania, I*, Matematisk-naturvidenskabelig klasse, No. 3, 1-37, 1919.
Skolem, T. *Selected Works in Logic*. Edited by Jens Erik Fenstad, Universitetforlaget, Oslo, 1970.
[^1]: Note that the original Hickman’s statement can be misleading since the condition “there exists $(x \wedge a_1) \vee (x \wedge a_2) \vee \cdots \vee (x \wedge a_n)$” is missing.
[^2]: We thank the author of that paper for communicating this example.
|
{
"pile_set_name": "ArXiv"
}
|
The Government is trying to buy the referendum, but we don't know what the electoral brown envelope contains, if indeed it contains anything. By Michael Taft.
It is better not to be cynical. But this Government is not only making it easy to be cynical, they are practically making it mandatory. We now read that the Government is preparing the economy for a sustained and substantial investment programme in an anticipation of a U-turn by the EU. That this has been announced only days before the referendum...what timing, what fortune.
“Government departments have been told to draw up lists of capital projects with potential to create thousands of jobs for which funding would be sought if EU leaders agree on the package at the meeting to be held a week before polling day here.”
“He (the Taoiseach) is drawing up the list, which would create thousands of jobs on road, rail, housing, school, health, broadband and water projects.”
This will be a new experience. The Government cut €750 million in capital projects last year. They intend to cut capital projects by approximately €600 million next year, with an additional €150 million the following year. Over the lifetime of this Dáil, the Government has announced that it will cut public investment by 32% in real terms (after inflation). These cuts, according to the Department of Finance, will slash direct employment by nearly 13,000, not counting the downstream effect.
So at the very same time that the Government is cutting investment and jobs, it is drawing up investment lists to create thousands of jobs. Anyone think this is contradictory?
What are the sources for all this new funding? Three have been named.
The European Investment Bank: this would certainly be helpful if more capital was pumped into the EIB, which co-finances and provides loans at competitive interest rates for a range of physical and social infrastructural projects. Whether member-states would put in this capital or the ECB could be induced to do so remains an issue. However, it should be noted that where the loan is to the State, the State has to put up half the investment (see here for a proposed school building programme) – so extra Exchequer resources will be needed. It should also be noted that EIB funding can take up to 12 to 18 months from application to start-up activity with Ireland having to join a queue. Currently, there is only the one programme being appraised.
Project Bonds: This is a pilot-project by the EU and essentially involves supporting private companies tendering from public authorities. These bonds would replace traditional bank lending. This would involve public support for the private component in essentially public-private partnerships in commercial activities. While this could have some impact – especially in commercial telecommunications and energy activities – it will be limited as ultimately intended in getting non-banking private markets to provide debt financing.
Unspent Structural Funds: The EU Commission has proposed that €82 billion worth of unspent structural funds be re-allocated and spent. However, there is a catch – states would only be able to re-allocate the structural funds they themselves did not spend. It would not be transferable from one state to another (though this could change). I don’t know how much unspent structural funds Ireland has, but it’s not likely to be much.
All of this shouldn’t be dismissed but clearly it is limited – both in the scope of activities that can be funded, the amounts involved and the time-lag. A progressive government would exploit these programmes as ‘additionality’ – additional to a public-led investment programme from our own resources.
And here’s where we get to the root of the Government’s cynicism. They are pursuing a highly deflationary programme – planning €8.6 billion in cuts and tax increases up to 2015. They claim they will off-set against this an unknown amount of reflationary investment measures which can only be drawn down over the medium-term under limited conditions (including additional borrowing) and limited scope. All the while, the Government’s budgets are tearing demand out of the economy now, dampening employment growth now and undermining domestic businesses now.
The Government is trying to buy the referendum. However, unlike good ol’ fashioned general election buy-outs, we don’t know what the electoral brown envelope contains, if it contains anything.
The Government is robbing impoverished Peter but only giving crumbs to starving Paul. {jathumbnailoff}
notesonthefront.typepad.com
Image top: andrewrennie.
|
{
"pile_set_name": "OpenWebText2"
}
|
Hearing deficiencies can range from partial hearing impairment to complete hearing loss. Often, an individual's hearing ability varies across the range of audible sound frequencies, and many individuals have hearing impairments with respect to only certain frequencies. For example, an individual's hearing loss may be greater at higher frequencies than at lower frequencies.
Hearing aids have been developed to compensate for hearing losses in individuals. Conventionally, hearing aids detect sound with the use of a microphone, which turns the sound into an analog signal. The analog signal must then be converted into a digital representation, such that it can be processed by a digital signal processor, as configured by an audiologist, to shape the sounds to compensate for the user's hearing deficiencies. However, in some instances, noise from the acoustic environment may interfere with the user's hearing experience.
In the following description, the use of the same reference numerals in different drawings indicates similar or identical items.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Loafer (disambiguation)
A loafer is a type of shoe.
Loafer may refer to:
Film and television
Loafer (1973 film), Bollywood film starring Dharmendra and Mumtaz
Loafer (1996 film), Bollywood film starring Anil Kapoor and Juhi Chawla
Loafer (2011 film), Oriya film starring Babushan, Archita Sahu and Budhaditya
Loafer (2013 film), Nepali film
Loafer (2015 film), Telugu film starring Varun Tej, Disha Patani, Revathi and Posani Krishna Murali
People
Loafer Band, a band of Sioux people
See also
LowFER, low-frequency experimental radio
Slacker, a person who habitually avoids work
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Former K-1 Fighter Hong Man Choi Booked for Assaulting Woman in Korea Featured
Former K-1 and DREAM fighter Hong Man Choi (Choi Hong-Man in Korea) has apparently found himself in some legal trouble this week after a report came out that he purportedly assaulted her in his bar on October 8th while arguing over a bill. The woman claims that Choi had overcharged her and began to argue with Choi over the sum on the bill, which then escalated into a heated argument and ended with Choi punching her in the head. She waited until the next day and posted the complaint against Choi on an internet police portal.
Police have questioned Choi, who admitted that there was an argument with the female customer. The customer then began hurling insults at the former K-1 fighter before he claimed he could not take the abuse anymore and that he "pushed her just a little bit."
Choi regrets pushing the woman, but insists that if she continues to claim that he punched her that he will pursue legal action of his own against the slander. He is so insistent that he only shoved her and didn't punch her that he has gone as far as to claim he'll retire from K-1 if he is lying. [source]
Dave Walsh has been covering MMA and Kickboxing since 2007 before changing his focus solely to Kickboxing in 2009, launching what was the only English-language site dedicated to giving Kickboxing similar coverage to what MMA receives. He was the co-founder of HeadKickLegend and now LiverKick. He resides in Albuquerque, New Mexico where he works as a writer of all trades.
His second novel, Terminus Cycle, is available now via Kindle and Paperback.
|
{
"pile_set_name": "Pile-CC"
}
|
As Americans work to file their taxes, Congress is setting to work on a package of expired tax credits this spring to enrich a few energy technologies at the expense of federal taxpayers.
Sens. Charles Grassley, R-Iowa, and Ron Wyden, D-Ore., of the Senate Finance Committee last week introduced a bill that would retroactively renew 26 tax credits that expired at the start of 2018.
The Grassley-Wyden bill would carry those tax credits through 2019 even though they were intentionally left out of the Tax Cuts and Jobs Act and past omnibus spending deals.
Called the Tax Extender and Disaster Relief Act of 2019, the legislation carves out favors for a few odds and ends such as race horses, motor sports complexes, and medical expenses.
But most of the bill gives special breaks to energy companies that produce biofuels, electric and fuel cell vehicles, and certain boutique renewable energy technologies, including biomass and geothermal.
Targeted tax credits have become a popular way for government to award special treatment and artificially attract private-sector interest to politically favored and well-connected industries.
In short, they’re nothing more than subsidies doled out through the tax code. Not only is this fiscally irresponsible, but Congress also does no service to these energy technologies and companies in the long run by subsidizing them.
It’s bad enough that several years of lobbying by these special interests appears to be working. Rather than getting closer to a free energy sector, that’s unfortunately business as usual for Washington.
But it’s another thing altogether to see some in Congress all too willing to hand out subsidies apparently unsolicited by lobbyists. How efficient.
As reported by E&E News, some Democrats on the Senate Finance Committee are angling to add wind and solar tax credits to a larger tax extenders package like the one introduced by Grassley and Wyden.
On these, Republicans and Democrats reached a compromise in the 2015 omnibus spending bill to extend credits one more time and put them on a schedule to sunset in 2022, a decision that diverted over $14 billion to the green energy industry. From the beginning, these credits (like those in the Grassley-Wyden bill) were designed to be temporary but have expired, been extended, re-extended, and retroactively extended for decades.
Finally, it seemed that Washington had had enough, and the wind and solar industries could no longer claim they were infant industries in the face of falling costs and industry growth.
Fast forward four years to now.
About the wind production tax credit, the wind industry said: “The wind industry agreed to an orderly phase-out of the production tax credit. … We aren’t actively asking for an extension to our PTC.”
And the solar industry said of the solar investment tax credit: “We have not asked for an extension of the ITC.”
And yet now, that compromise could mean nothing if Democrats have their way.
There is some hope of responsible action winning out. Grassley, historically a champion of wind subsidies, said: “We made that decision in 2015. I think it would be wrong for me to go back on my word.”
But one has to ask: What will it take to get the rest of Congress to keep a promise?
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
How can I change the height of mathematical equations in Microsoft Word 2013?
How can I change the height of mathematical equations in Microsoft Word 2013?
Example: I would like to change the height of the following selected equation:
to have the same the height as the following selected equation:
I use Microsoft Word 2013 on Windows 7 SP1 x64 Ultimate. I cannot use LaTeX (constrained by my editor).
Here is the file from which I took the example (Google preview isn't able to show mathematical equations so it needs to be downloaded).
A:
Go to the end of the equation that has too large of a gap under it.
Hit the "Delete" key to bring the equation below up and directly onto the end of it:
Then to put it back on it's own line use Shift+Enter.
Using Shift+Enter will force a "Line break", instead of the "Paragraph break" Word likes to use when you hit Enter, thus reducing the gap:
|
{
"pile_set_name": "StackExchange"
}
|
Q:
parse a ini like file with ruby
I have a file in the following format:
[X:10]
[Y:20]
# many of them, they are test parameters
C = 1
A = 1234
B = 12345
....
# many of them, they are test cases
# new test parameters
[X:20]
[Y:40]
# new test cases
C = 1
A = 1234
B = 12345
...
It is a test framework. The header (section on [] set the parameters and then the following fields are test cases)
I parse them today in C. So basically i do the following (as usual in C):
while(fgets(....)
if(!strcmp(keyword,"[X"))
x = atoi(value);
however I would like to port it to ruby, in a ruby way: organizing it as classes.
I would like to know if there is any framework (ini parses, doesnt help) to do it.. any idea, framework (treetop, citrus are kind of overkill) or snippet that could help me?
I though something like:
class TestFile
attr_accessor :sections
def parse
end
end
# the test parameters value
class Section
attr_accessor :entries, foo,bar.. # all accessible fields
end
# the test cases
class Entry
attr_accessor #all accessible fields
end
then I could use it like:
t = TestFile.new "mytests.txt"
t.parse
t.sections.first
=>
<Section:0x000000014b6b70 @parameters={"X"=>"128", "Y"=>"96", "Z"=>"0"}, @cases=[{"A"=>"14", "B"=>"1", "C"=>"2598", "D"=>"93418"},{"A"=>"12", "B"=>"3", "C"=>"2198", "D"=>"93438"}]
any help or direction?
A:
Here's what I came up with. First, the usage:
t = Testfile.new('ini.txt')
t.parse
t.sections.count
#=>2
t.sections.first
#=> #<Section:0x00000002d74b30 @parameters={"X"=>"10", "Y"=>"20"}, @cases={"C"=>"1", "A"=>"1234", "B"=>"12345"}>
As you can see, I made the Section contain both the parameters and the cases--just a judgement call, it could be done other ways. The implementation:
class Testfile
attr_accessor :filename, :sections
def initialize(filename)
@sections = []
@filename = filename
end
def parse
@in_section = false
File.open(filename).each_line do |line|
next if line =~ /^#?\s*$/ #skip comments and blank lines
if line.start_with? "["
if not @in_section
@section = Section.new
@sections << @section
end
@in_section = true
key, value = line.match(/\[(.*?):(.*?)\]/).captures rescue nil
@section.parameters.store(key, value) unless key.nil?
else
@in_section = false
key, value = line.match(/(\w+) ?= ?(\d+)/).captures rescue nil
@section.cases.store(key, value) unless key.nil?
end
end
@sections << @section
end
end
class Section
attr_accessor :parameters, :cases
def initialize
@parameters = {}
@cases = {}
end
end
Most of this code is the parsing. It looks for a line beginning with [ and creates a new Section object (unless it is already parsing a section). Any other non-comment line is parsed as a test case.
|
{
"pile_set_name": "StackExchange"
}
|
All People's Party
The All People's Party may refer to:
All People's Party (Bhutan)
All People's Party (Namibia)
All People's Party (Nigeria)
All People's Party (UK)
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Relaxed rrn expression and amino acid requirement of a Corynebacterium glutamicum rel mutant defective in (p)ppGpp metabolism.
The stringent response in Corynebacterium glutamicum was investigated. Sets of rrn-cat fusions were constructed in their native chromosomal position to examine the effects of amino acid starvation in a rel(+) strain and a Deltarel mutant defective in (p)ppGpp metabolism. The expression of the six rrn operons in the rel(+) control was stringently regulated and reduced to 79% upon induction of amino acid starvation. The Deltarel mutant displayed a relaxed regulation and was unable to reduce the rrn expression under amino acid depletion conditions. In addition, the Deltarel mutant grew more slowly in minimal medium than a rel(+) control. This growth effect was restored by a plasmid-encoded copy of rel or, alternatively, by supplementation of the minimal medium with the amino acid mixture casamino acids. In particular, the Deltarel strain of C. glutamicum displayed a requirement for the amino acids histidine and serine.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
---
author:
- 'Utkarsh Mall$^{1, 2}$'
- 'G. Roshan Lal$^{1, 3}$'
- 'Siddhartha Chaudhuri$^{1, 4}$'
- Parag Chaudhuri$^1$
- |
\
$^1$IIT Bombay $^2$Cornell University $^3$University of Wisconsin-Madison $^4$Adobe Research
bibliography:
- 'ebf.bib'
title: A Deep Recurrent Framework for Cleaning Motion Capture Data
---
{width="100.00000%"}
|
{
"pile_set_name": "ArXiv"
}
|
Senecio antandroi
Senecio antandroi is a species of the genus Senecio endemic to Madagascar.
References
External links
antandroi
Category:Flora of Madagascar
|
{
"pile_set_name": "Wikipedia (en)"
}
|
---
abstract: 'We prove that the algebraic Witten’s “top Chern class" constructed in [@PV] satisfies the axioms for the spin virtual class formulated in [@JKV].'
address: 'Department of Mathematics, Boston University, Boston, MA 02215'
author:
- Alexander Polishchuk
title: 'Witten’s top Chern class on the moduli space of higher spin curves'
---
[^1]
This paper is a sequel to [@PV]. Its goal is to verify that the [*virtual top Chern class*]{} ${c^{1/r}}$ in the Chow group of the moduli space of higher spin curves ${{\overline{{{{\mathcal}M}}}_{g,n}}^{1/r}}$, constructed in [@PV], satisfies all the axioms of [*spin virtual class*]{} formulated in [@JKV]. Hence, according to [@JKV], it gives rise to a cohomological field theory in the sense of Kontsevich-Manin [@KM]. As was observed in [@PV], the only non-trivial axioms that have to be checked for the class ${c^{1/r}}$ are two axioms that we call [*Vanishing axiom*]{} and [*Ramond factorization axiom*]{}. The first of them requires ${c^{1/r}}$ to vanish on all the components of the moduli space ${{\overline{{{{\mathcal}M}}}_{g,n}}^{1/r}}$, where one of the markings is equal to $r-1$. The second demands vanishing of the push-forward of ${c^{1/r}}$ restricted to the components of the moduli space corresponding to the so called Ramond sector, under some natural finite maps.
Recall that the virtual top Chern class is a crucial ingredient in the generalized Witten’s conjecture formulated in [@W1], [@W2]. The original index-theoretic construction of this class sketched by Witten was recently extended to the compactified moduli space by T. Mochizuki [@Mo] who also showed that the obtained class satisfies the axioms of [@JKV]. The algebraic construction of [@PV] gives a class in the Chow group with rational coefficients (and axioms are satisfied on the level of Chow groups). Presumably, the algebraic construction induces the same class in cohomology of ${{\overline{{{{\mathcal}M}}}_{g,n}}^{1/r}}$ as the analytic construction.
It is interesting to note that the class ${c^{1/r}}$ is constructed as a characteristic class of certain supercommutative ${{{\mathbb}Z}}/2{{{\mathbb}Z}}$-graded dg-algebra over ${{\overline{{{{\mathcal}M}}}_{g,n}}^{1/r}}$ equipped with an odd closed section (where the entire data is defined up to quasi-isomorphism). This resembles Kontsevich’s approach to the construction of the virtual fundamental class (see [@Kon]). One may hope that both constructions can be embedded into a more general framework involving dg-spaces. This would be in agreement with the philosophy of derived moduli spaces promoted in [@Kon], [@CK1], [@CK2].
The paper is organized as follows. In section \[homsec\] we prove two identities for localized Chern characters of specific ${{{\mathbb}Z}}/2{{{\mathbb}Z}}$-graded complexes. In section \[vanishsec\] we deduce Vanishing axiom from the first identity and in section \[Ramondsec\] we deduce Ramond factorization axiom from the second identity.
Some ${{{\mathbb}Z}}/2{{{\mathbb}Z}}$-graded homological algebra {#homsec}
================================================================
Recall (see [@PV]) that for every ${{{\mathbb}Z}}/2{{{\mathbb}Z}}$-graded complex $(V^{\bullet}=V^+\oplus V^-,d)$ of vector bundles on a scheme $X$, which is strictly exact off a closed subset $Z\subset X$, the graph-construction associates the [*localized Chern character*]{} ${\operatorname{ch}}_Z^X(V^{\bullet})\in A^*(Z{\rightarrow}X)_{{{{\mathbb}Q}}},$ where $A^*(Z{\rightarrow}X)_{{{{\mathbb}Q}}}$ is the bivariant Chow group with rational coefficients. (the original construction given in [@BFM] or [@F Ch. 18] deals with ${{{\mathbb}Z}}$-graded complexes). Here we use the following terminology from [@PV]: $(V^{\bullet},d)$ is [*strictly exact*]{} if it is exact and ${\operatorname{im}}(d)$ is a subbundle of $V^{\bullet}$. Note that if a ${{{\mathbb}Z}}/2{{{\mathbb}Z}}$-graded complex is homotopic to zero then it is strictly exact (since in this case ${\operatorname{im}}(d)$ is a direct summand of $V^{\bullet}$). Witten’s top Chern class is constructed in [@PV] by slightly modifying the localized Chern class of the complex corresponding to the action of an isotropic section of an orthogonal bundle on a spinor bundle, where the relevant orthogonal data is constructed using the higher spin structure on the universal curve over ${{\overline{{{{\mathcal}M}}}_{g,n}}^{1/r}}$ (we will recall this construction in section \[vanishsec\]).
We are going to prove two identities for the localized Chern character that will be main ingredients for the proof of Vanishing axiom and Ramond factorization axiom respectively. In both cases the identities hold on the level of $K$-theory (of complexes that are strictly exact off a closed subset).
\[mainlem\] Let $d({\lambda}):V^{\bullet}{\rightarrow}V^{\bullet}[{\lambda}]$ be an odd endomorphism of a ${{{\mathbb}Z}}/2{{{\mathbb}Z}}$-graded bundle $V^{\bullet}$ on $X$ of the form $d({\lambda})=d_0+d_1{\lambda}+\ldots+d_{r-1}{\lambda}^{r-1}$ for some $r\ge 2$, depending on a formal parameter ${\lambda}$ (commuting with everything). Assume that $d({\lambda})^2={\lambda}^r$. Then ${\operatorname{ch}}_Z^X(V^{\bullet},d_0)=0$ for every closed subset $Z{\subset}X$ such that $(V^{\bullet},d_0)$ is strictly exact off $Z$.
[[*Proof*]{}]{}. We can extend $d({\lambda})$ to a ${{{\mathcal}O}}_X[{\lambda}]$-linear endomorphism of $V^{\bullet}[{\lambda}]$. Let $W^{\bullet}=V^{\bullet}[{\lambda}]/({\lambda}^r)$ with the odd endomorphism $d_W:W^{\bullet}{\rightarrow}W^{\bullet}$ induced by $d({\lambda})$. Then $d_W^2=0$ and there is a natural $r$-step filtration on the complex $(W^{\bullet},d_W)$ with all consequtive quotient-complexes isomorphic to $(V^{\bullet},d_0)$. Thus, it is enough to prove that $(W^{\bullet},d_W)$ is strictly exact (everywhere). We claim that in fact this complex is homotopic to zero. Indeed, for every interval of integers $[a,b]$ let us denote $V^{\bullet}[{\lambda}]_{[a,b]}=\oplus_{i=a}^b V^{\bullet}{\lambda}^i$. Let us denote by $d'$ and $d''$ the following components of the restriction of $d({\lambda})$ to $V^{\bullet}[{\lambda}]_{[0,r-1]}$: $$d({\lambda}):V^{\bullet}[{\lambda}]_{[0,r-1]}\rTo^{(d',d'')}
V^{\bullet}[{\lambda}]_{[0,r-1]}\oplus V^{\bullet}[{\lambda}]_{[r,2r-1]}.$$ Note that $d'=d_W$ upon the natural identification of $V^{\bullet}[{\lambda}]_{[0,r-1]}$ with $W^{\bullet}$. Also, the image of $d''$ is contained in $V^{\bullet}[{\lambda}]_{[r,2r-2]}$. Extending $d'$ and $d''$ to ${{{\mathcal}O}}_X[{\lambda}^r]$-linear endomorphisms of $V^{\bullet}[{\lambda}]$ we can write $d=d'+d''$. Then the condition $d({\lambda})^2={\lambda}^r$ implies that $d'd''+d''d'={\lambda}^r$ on $V^{\bullet}[{\lambda}]_{[0,r-1]}$. Hence $$h=d''/{\lambda}^r:V^{\bullet}[{\lambda}]_{[0,r-1]}{\rightarrow}V^{\bullet}[{\lambda}]_{[0,r-1]}$$ gives a homotopy between the identity and zero endomorphisms of the complex $(V^{\bullet}[{\lambda}]_{[0,r-1]},d')\simeq (W^{\bullet},d_W)$.
The above lemma admits the following generalization: if the differential $d({\lambda})=d_0+d_1{\lambda}+\ldots+d_{r-1}{\lambda}^{r-1}$ as above satisfies $d({\lambda})^2=f({\lambda})$ for some polynomial $f$ of degree $r$ then $$\sum_{z: f(z)=0}m_z\cdot{\operatorname{ch}}_Z^X(V^{\bullet},d(z))=0$$ where $m_z$ is the multiplicity of a root $z$, $Z\subset X$ is a closed subset such that all the complexes $(V^{\bullet},d(z))$ (for $f(z)=0$) are strictly exact off $Z$.
\[mainlem2\] Let $d:V^{\bullet}{\rightarrow}V^{\bullet}$ be an odd endomorphism of a ${{{\mathbb}Z}}/2{{{\mathbb}Z}}$-graded bundle $V^{\bullet}$ on $X$ such that $d^2=-(f_1\ldots f_r)\cdot{\operatorname{id}}_{V^{\bullet}}$, where $f_1,\ldots,f_r$ are functions on $X$. For every $i=1,\ldots,r$ let us introduce the differential $d_i$ on $V^{\bullet}\oplus V^{\bullet}[1]$ by the formula $$d_i(x,x')=
(d(x)+(\prod_{j\neq i}f_j)\cdot x', -d(x')+f_i\cdot x)$$ where $x\in V^{\bullet}$, $x'\in V^{\bullet}[1]$. Then $$\sum_{i=1}^r{\operatorname{ch}}_Z^X(V^{\bullet}\oplus V^{\bullet}[1],d_i)=0$$ for every closed subset $Z{\subset}X$ such that all $(V^{\bullet}\oplus V^{\bullet}[1],d_i)$ are strictly exact off $Z$.
[[*Proof*]{}]{}. Let us introduce the differential $D$ on $W^{\bullet}:=(V^{\bullet}\oplus V^{\bullet}[1])^{\oplus r}$ by the formula $$D(x_i,x'_i)_{i=1,\ldots r}=(y_i,y'_i)_{i=1,\ldots,r}$$ where $x_i,y_i\in V^{\bullet}$, $x'_i,y'_i\in V^{\bullet}[1]$, $$\begin{aligned}
&y_i=dx_i+f_{i+1}f_{i+2}\ldots f_r\cdot[x'_1+f_1x'_2+f_1f_2x'_3+\ldots+
f_1\ldots f_{i-1}x'_i]\ \text{for}\ i<r,\\
&y_r=dx_r+x'_1+f_1x'_2+f_1f_2x'_3+\ldots+f_1\ldots f_{r-1}x'_r,\\
&y'_i=-dx'_i+f_ix_i-x_{i-1}\ \text{for}\ i\ge 2,\\
&y'_1=-dx'_1+f_1x_1.\end{aligned}$$ One can easily check that $D^2=0$. There is a natural decreasing filtration of $W^{\bullet}$ by subcomplexes $W^{\bullet}=F^1W^{\bullet}\supset\ldots\supset F^rW^{\bullet}\supset
F^{r+1}W^{\bullet}=0$, where $$F^jW^{\bullet}=\{(x_i,x'_i)_{i=1,\ldots,r}: x_1=\ldots=x_{j-1}=0,
x'_1=\ldots=x'_{j-1}=0\}.$$ The associated graded quotients are $$F^jW^{\bullet}/F^{j+1}W^{\bullet}\simeq (V^{\bullet}\oplus V^{\bullet}[1],d_j),$$ $j=1,\ldots,r$. Therefore, $$\sum_{i=1}^r{\operatorname{ch}}_Z^X(V^{\bullet}\oplus V^{\bullet}[1],d_i)={\operatorname{ch}}_Z^X(W^{\bullet},D).$$ It remains to prove that the complex $(W^{\bullet}, D)$ is strictly exact on $X$. For this we construct a homotopy $h$ between the identity and zero endomorphisms of $W^{\bullet}$. Namely, we set $$h(x_i,x'_i)_{i=1,\ldots r}=(y_i,y'_i)_{i=1,\ldots,r},$$ where $$\begin{aligned}
&y_i=-[x'_{i+1}+f_{i+1}x'_{i+2}+f_{i+1}f_{i+2}x'_{i+2}+\ldots+
f_{i+1}\ldots f_{r-1}x'_r]\ \text{for}\ i<r-1,\\
&y_{r-1}=-x'_r,\ y_r=0,\\
&y'_1=x_r,\ y'_i=0\ \text{for}\ i\ge 2.\end{aligned}$$ It is easy to check that $Dh+hD={\operatorname{id}}_{W^{\bullet}}$.
Vanishing axiom {#vanishsec}
===============
Henceforward all our schemes are assumed to be quasiprojective over a field $k$. We assume that $\operatorname{char} k>r$ and that $k$ contains all $r$-th roots of unity.
Let $\pi:{{{\mathcal}C}}{\rightarrow}X$ be a family of prestable curves over a scheme $X$, and let ${{{\mathcal}T}}$ be a family of rank-one torsion-free sheaves on ${{{\mathcal}C}}$ equipped with a non-zero homomorphism $b:{{{\mathcal}T}}^r{\rightarrow}{\omega}_{{{{\mathcal}C}}/X}$, where ${\omega}_{{{{\mathcal}C}}/X}$ is the dualizing sheaf of $\pi$. In this situation we defined in section 5.1 of [@PV] the class $c({{{\mathcal}T}},b)\in A^{-\chi}(X)_{{{{\mathbb}Q}}}$, where $\chi$ is the Euler-Poincaré characteristic of members of the family ${{{\mathcal}T}}$. To construct this class we consider the map $\tau:S^rR\pi_*{{{\mathcal}T}}{\rightarrow}{{{\mathcal}O}}_X[-1]$ induced by $b$ and by the trace map ${\operatorname{Tr}}:R\pi_*{\omega}_{{{{\mathcal}C}}/X}{\rightarrow}{{{\mathcal}O}}_X[-1]$. As was proved in Proposition 4.7 of [@PV] there exists a complex $C_0{\rightarrow}C_1$ of vector bundles on $X$ representing $R\pi_*{{{\mathcal}T}}$ such that the map $\tau$ is represented by the chain map of complexes $S^r[C_0{\rightarrow}C_1]{\rightarrow}{{{\mathcal}O}}_X[-1]$. This chain map corresponds to a morphism of vector bundles $\nu:S^{r-1}C_0{\rightarrow}C_1^{\vee}$. We can consider the differential $d:C_0{\rightarrow}C_1$ and the map $\nu$ as sections of the pull-backs of $C_1$ and $C_1^{\vee}$ to the total space of $C_0$. Then $s=(d,\nu)$ will be an isotropic section of the orthogonal vector bundle $p^*C_1\oplus p^*C_1^{\vee}$ on $C_0$, where $p:C_0{\rightarrow}X$ is the projection. Moreover, $s$ vanishes exactly on $X$ embedded into $C_0$ by the zero section. Then we consider the action of $s$ on the spinor bundle ${\Lambda}^*p^*C_1^{\vee}$. The obtained ${{{\mathbb}Z}}/2{{{\mathbb}Z}}$-graded complex $({\Lambda}^*p^*C_1^{\vee},s)$ is exact outside $X{\subset}C_0$. Therefore, the localized Chern character of this complex is an element of the bivariant Chow group $A^*(X{\rightarrow}C_0)_{{{{\mathbb}Q}}}\simeq A^*(X)_{{{{\mathbb}Q}}}$. The class $c({{{\mathcal}T}},b)$ is obtained by multiplying this localized Chern character with the Todd class of $C_1$. Theorem 4.3 of [@PV] assures that $c({{{\mathcal}T}},b)$ does not depend on the choices made.
We can consider $({{{\mathcal}A}}:=p_*({\Lambda}^*p^*C_1^{\vee}),{\delta})$ as a sheaf of ${{{\mathbb}Z}}/2{{{\mathbb}Z}}$-graded dg-algebras over $X$, where the differential ${\delta}$ is induced by $d:C_0{\rightarrow}C_1$. The action of the isotropic section $s$ on ${{{\mathcal}A}}$ has form $d+\epsilon(e)$, where $\epsilon(e)$ is the operator of multiplication with the ${\delta}$-closed odd section $e\in{{{\mathcal}A}}$ corresponding to $\nu:S^{r-1}C_0{\rightarrow}C_1^{\vee}$. The proof of Theorem 4.3 in [@PV] can be converted into the proof of the fact that the quasi-isomorphism class of the data $({{{\mathcal}A}},e)$ is uniquely determined by $({{{\mathcal}T}},b)$.
Let ${\sigma}:X{\rightarrow}{{{\mathcal}C}}$ be a section of $\pi$ such that $\pi$ is smooth near ${\sigma}(X)$ (a marked point). By abuse of notation we will denote by $F\mapsto F({\sigma})$ the operation of tensoring with the line bundle ${{{\mathcal}O}}_{{{{\mathcal}C}}}({\sigma}(X))$. The following theorem immediately implies Vanishing axiom for ${c^{1/r}}$ (Axiom 4 of [@JKV]).
\[axiom1thm\] Assume that $b$ factors as a composition $${{{\mathcal}T}}^r\stackrel{b_0}{{\rightarrow}}{\omega}_{{{{\mathcal}C}}/X}(-(r-1){\sigma}){\rightarrow}{\omega}_{{{{\mathcal}C}}/X},$$ where ${\sigma}^*b_0$ is an isomorphism. Then $c({{{\mathcal}T}},b)=0$.
Let us set $L={{{\mathcal}T}}({\sigma})|_{{\sigma}}$. The map ${\sigma}^*b_0$ gives an isomorphism $$L^r{\widetilde}{{\rightarrow}}{\omega}_{{{{\mathcal}C}}/X}({\sigma})|_{\sigma}\simeq{{{\mathcal}O}}_X.$$ Since we are working with rational coefficients, we can replace $X$ by its finite étale covering over which $L$ is trivial (right now we do not need to choose a specific trivialization of $L$).
Let $\pi^{(r)}:{{{\mathcal}C}}^{(r)}{\rightarrow}X$ denote the relative $r$-th symmetric power of ${{{\mathcal}C}}$ over $X$. We denote by ${\sigma}^r\in{{{\mathcal}C}}^{(r)}$ the $X$-point corresponding to the relative divisor $r{\sigma}(X)$ and by ${{{\mathcal}I}}_{{\sigma}^r}{\subset}{{{\mathcal}O}}_{{{{\mathcal}C}}^{(r)}}$ the ideal sheaf of ${\sigma}^r(X){\subset}{{{\mathcal}C}}^{(r)}$. For every coherent sheaf ${{{\mathcal}F}}$ on ${{{\mathcal}C}}$, let ${{{\mathcal}F}}^{(r)}$ denote the $r$-th symmetric power of ${{{\mathcal}F}}$, which is a sheaf on ${{{\mathcal}C}}^{(r)}$. We claim that $b_0$ induces a morphism $$\label{idealsheafmap}
R\pi^{(r)}_*({{{\mathcal}I}}_{{\sigma}^r}\otimes({{{\mathcal}T}}({\sigma}))^{(r)}){\rightarrow}R\pi_*({\omega}_{{{{\mathcal}C}}/X}).$$ Indeed, let ${\Delta}:{{{\mathcal}C}}{\rightarrow}{{{\mathcal}C}}^{(r)}$ be the diagonal map. Then we have a natural morphism $${{{\mathcal}I}}_{{\sigma}^r}\otimes({{{\mathcal}T}}({\sigma}))^{(r)}{\rightarrow}{\Delta}_*{\Delta}^*({{{\mathcal}I}}_{{\sigma}^r}\otimes({{{\mathcal}T}}({\sigma}))^{(r)}){\rightarrow}{\Delta}_*{{{\mathcal}T}}^r((r-1){\sigma}){\rightarrow}{\Delta}_*{\omega}_{{{{\mathcal}C}}/X},$$ where the last arrow is induced by $b_0$. Now the morphism (\[idealsheafmap\]) is obtained by applying the functor $R\pi^{(r)}_*$. Composing (\[idealsheafmap\]) with the trace map $R\pi_*({\omega}_{{{{\mathcal}C}}/X}){\rightarrow}{{{\mathcal}O}}_X[-1]$, we get a morphism $${\widetilde}{\tau}:R\pi^{(r)}_*({{{\mathcal}I}}_{{\sigma}^r}\otimes({{{\mathcal}T}}({\sigma}))^{(r)}){\rightarrow}{{{\mathcal}O}}_X[-1]$$ that will play a major role in the proof of Theorem \[axiom1thm\]. Note that we also have a natural map $$\iota:R\pi^{(r)}_*({{{\mathcal}T}}^{(r)}){\rightarrow}R\pi^{(r)}_*({{{\mathcal}I}}_{{\sigma}^r}\otimes({{{\mathcal}T}}({\sigma}))^{(r)})$$ and an isomorphism $S^r R\pi_*{{{\mathcal}T}}\simeq R\pi^{(r)}_*({{{\mathcal}T}}^{(r)})$, such that $\tau={\widetilde}{\tau}\circ\iota$ can be identified with the map $S^r R\pi_*{{{\mathcal}T}}{\rightarrow}{{{\mathcal}O}}_X[-1]$ used in the definition of $c({{{\mathcal}T}},b)$.
Note that there is an exact triangle $$\label{symextri}
{{{\mathcal}O}}_X[-1]\stackrel{{\delta}}{{\rightarrow}}
R\pi^{(r)}_*({{{\mathcal}I}}_{{\sigma}^r}\otimes({{{\mathcal}T}}({\sigma}))^{(r)}){\rightarrow}R\pi^{(r)}_*({{{\mathcal}T}}({\sigma}))^{(r)}{\rightarrow}{{{\mathcal}O}}_X$$ where we use the canonical trivialization of $L^r$.
\[composlem\] The composition ${\widetilde}{\tau}\circ{\delta}$ is the identity map.
[[*Proof*]{}]{}. This follows immediately from the existence of a natural morphism of exact triangles $$\begin{diagram}
{\Delta}^*{{{\mathcal}I}}_{{\sigma}^r}\otimes{{{\mathcal}T}}^r(r{\sigma}) &\rTo & {{{\mathcal}T}}^r(r{\sigma}) &\rTo & {\Delta}^* ({\sigma}^r)_*{{{\mathcal}O}}_X &\rTo\ldots\\
\dTo & & \dTo & & \dTo &\\
{\omega}_{{{{\mathcal}C}}/X} &\rTo &{\omega}_{{{{\mathcal}C}}/X}({\sigma}) &\rTo & {\sigma}_*{{{\mathcal}O}}_X &\rTo\ldots
\end{diagram}$$ and from the fact that the composition $${{{\mathcal}O}}_X[-1]\simeq R\pi_*{\sigma}_*{{{\mathcal}O}}_X[-1]{\rightarrow}R\pi_*{\omega}_{{{{\mathcal}C}}/X}{\rightarrow}{{{\mathcal}O}}_X[-1]$$ is the identity map.
We want to realize the maps ${\widetilde}{\tau}$ and $\iota$ on the level of complexes in a compatible way. We start by realizing the canonical distinguished triangle in $D^b(X)$: $$R\pi_*{{{\mathcal}T}}\stackrel{{\alpha}}{{\rightarrow}} R\pi_*({{{\mathcal}T}}({\sigma}))\stackrel{{\beta}}{{\rightarrow}} L
\stackrel{{\gamma}}{{\rightarrow}} R\pi_*{{{\mathcal}T}}[1]$$ by an exact triple of complexes of vector bundles on $X$.
\[extensionlem\] Let $[C_0\stackrel{d}{{\rightarrow}} C_1]$ be a complex of vector bundles (concentrated in degrees $[0,1]$) representing $R\pi_*{{{\mathcal}T}}$. Then there exists an extension of vector bundles $$\label{mainexseq}
0{\rightarrow}C_0{\rightarrow}{\widetilde}{C}_0{\rightarrow}L{\rightarrow}0,$$ and a morphism ${\widetilde}{d}:{\widetilde}{C}_0{\rightarrow}C_1$ extending $d$, such that the morphism ${\gamma}: L{\rightarrow}R\pi_*{{{\mathcal}T}}[1]$ is represented by the chain map of complexes $$\label{chainext}
[C_0{\rightarrow}{\widetilde}{C}_0]\stackrel{({\operatorname{id}},{\widetilde}{d})}{{\rightarrow}} [C_0{\rightarrow}C_1],$$ hence, the complex $[{\widetilde}{C}_0\stackrel{{\widetilde}{d}}{\rightarrow}C_1]$ represents $R\pi_*({{{\mathcal}T}}({\sigma}))$ and the morphisms ${\alpha}$ and ${\beta}$ are represented by the natural chain maps $$[C_0{\rightarrow}C_1]{\rightarrow}[{\widetilde}{C}_0{\rightarrow}C_1]{\rightarrow}L;$$
[[*Proof*]{}]{}. Applying the second arrow in the exact sequence $$\label{exseq}
{\operatorname{Hom}}(L,C_1){\rightarrow}{\operatorname{Hom}}(L,R\pi_*{{{\mathcal}T}}[1]){\rightarrow}{\operatorname{Ext}}^1(L,C_0){\rightarrow}{\operatorname{Ext}}^1(L,C_1)$$ to the element ${\gamma}$ we get an extension class $e\in{\operatorname{Ext}}^1(L,C_0)$ which becomes trivial in ${\operatorname{Ext}}^1(L,C_1)$. Let $$0{\rightarrow}C_0{\rightarrow}{\widetilde}{C}_0{\rightarrow}L{\rightarrow}0$$ be an extension with the class $e$, ${\widetilde}{d}:{\widetilde}{C}_0{\rightarrow}C_1$ be a splitting of its push-out by $d:C_0{\rightarrow}C_1$. The element in ${\operatorname{Hom}}(L,R\pi_*{{{\mathcal}T}}[1])$ represented by the chain map (\[chainext\]) induces the same class $e$ in ${\operatorname{Ext}}^1(L,C_0)$. Now the sequence (\[exseq\]) shows that after changing a splitting ${\widetilde}{d}$ by an appropriate element of ${\operatorname{Hom}}(L,C_1)$ the chain map (\[chainext\]) will represent ${\gamma}$.
Let $C=[C_0{\rightarrow}C_1]$ be a complex representing $R\pi_*{{{\mathcal}T}}$ and let ${\widetilde}{C}=[{\widetilde}{C}_0{\rightarrow}C_1]$ be the complex representing $R\pi_*({{{\mathcal}T}}({\sigma}))$ obtained by applying the above lemma. Then the complex $S^r C$ (resp. $S^r {\widetilde}{C}$) represents $S^r R\pi_*{{{\mathcal}T}}\simeq R\pi^{(r)}_*{{{\mathcal}T}}^{({\sigma})}$ (resp. $R\pi^{(r)}_*({{{\mathcal}T}}({\sigma}))^{(r)}$) and we have a natural surjective map of complexes $S^r{\widetilde}{C}{\rightarrow}L^r\simeq{{{\mathcal}O}}_X$ induced by the map ${\widetilde}{C}_0{\rightarrow}L$. Then the kernel complex ${\operatorname{ker}}(S^r{\widetilde}{C}{\rightarrow}{{{\mathcal}O}}_X)$ represents $R\pi^{(r)}_*({{{\mathcal}I}}_{{\sigma}^r}\otimes({{{\mathcal}T}}({\sigma}))^{(r)})$ in a way compatible with the exact triangle (\[symextri\]). Moreover, the map $\iota$ is represented by the natural chain map $S^r C{\rightarrow}{\operatorname{ker}}(S^r{\widetilde}{C}{\rightarrow}{{{\mathcal}O}}_X)$. It remains to choose our data in such a way that ${\widetilde}{\tau}$ would be represented by a chain map ${\widetilde}{\tau}:{\operatorname{ker}}(S^r{\widetilde}{C}{\rightarrow}{{{\mathcal}O}}_X){\rightarrow}{{{\mathcal}O}}_X[-1]$. For this we use the following lemma analogous to Proposition 4.7 from [@PV].
\[complexlem\] There exists a complex of vector bundles $C_0{\rightarrow}C_1$ representing $R\pi_*{{{\mathcal}T}}$, such that one has $${\operatorname{Hom}}_{K^b(X)}(E,{{{\mathcal}O}}_X[n])\simeq{\operatorname{Hom}}_{D^b(X)}(E,{{{\mathcal}O}}_X[n])$$ for $n\le 0$ and $E={\operatorname{ker}}(S^r[{\widetilde}{C}_0{\rightarrow}C_1]{\rightarrow}L)$.
[[*Proof*]{}]{}. We start with an arbitrary complex of vector bundles $C'_0{\rightarrow}C'_1$ representing $R\pi_*{{{\mathcal}T}}$ and then replace it by the quasiisomorphic complex $C_0{\rightarrow}C_1$, where $C_1={{{\mathcal}O}}_X(-m)^{\oplus N}{\rightarrow}C'_1$ is a surjection (see [@PV], Lemma 4.6), ${{{\mathcal}O}}_X(1)$ is an ample line bundle on $X$ $m$ is an integer (later we will need to choose $m$ sufficiently large). The spectral sequence computing ${\operatorname{Hom}}_{D^b(X)}(E,{{{\mathcal}O}}_X[n])$ shows that to prove (ii) it suffices to check the vanishing $$H^i(S^j{\widetilde}{C}_0^{\vee}(m'))=0$$ for $i>0$, $j<r$, $m'\ge m$. Since ${\widetilde}{C}_0$ is an extension of the trivial bundle by $C_0$, this would follow from the vanishing of $H^i(S^jC_0^{\vee}(m'))$ under the same conditions on $i,j,m'$. We know that for sufficiently large $m$ one has $$H^{>0}(S^j(C'_0)^{\vee}\otimes
S^{j_1}(C'_1)^{\vee}\otimes\ldots\otimes S^{j_k}(C'_1)^{\vee}(m'))=0$$ for $j+j_1+\ldots+j_k<r$ and $m'\ge m$. As was shown in Proposition 4.7 of [@PV], this implies that $H^{>0}(S^jC_0^{\vee}(m'))=0$ for $j<r$, $m'\ge m$.
[*Proof of Theorem \[axiom1thm\]*]{}. Let us choose the data $(C_0,C_1,{\widetilde}{C}_0,d,{\widetilde}{d})$ as in Lemmas \[complexlem\] and \[extensionlem\]. Let us set $K:={\operatorname{ker}}(S^r[{\widetilde}{C}_0{\rightarrow}C_1]{\rightarrow}{{{\mathcal}O}}_X)$. Then the morphism ${\widetilde}{\tau}$ is represented by the chain map $K{\rightarrow}{{{\mathcal}O}}_X[-1]$ that corresponds to a morphism $${\widetilde}{\tau}:S^{r-1}{\widetilde}{C}_0\otimes C_1{\rightarrow}{{{\mathcal}O}}_X$$ such that the composition $$\label{zerocomp}
{\operatorname{ker}}(S^r{\widetilde}{C}_0{\rightarrow}{{{\mathcal}O}}_X) {\rightarrow}S^{r-1}{\widetilde}{C}_0\otimes C_1{\rightarrow}{{{\mathcal}O}}_X$$ is zero.
Let $X'{\rightarrow}X$ be the affine bundle classifying splittings of the exact sequence (\[mainexseq\]). Since the pull-back induces an isomorphism of Chow groups of $X$ and $X'$ we can make a base change of our data by the morphism $X'{\rightarrow}X$. Thus, we can assume that the extension (\[mainexseq\]) splits. Let $1\in{\widetilde}{C}_0$ be a section projecting to a trivialization of $L$. It is easy to see that the morphism ${{{\mathcal}O}}_X[-1]{\rightarrow}K$ corresponding to the section $1^{r-1}\otimes {\widetilde}{d}(1)$ of $S^{r-1}{\widetilde}{C}_0\otimes C_1$ represents the map ${\delta}$ from (\[symextri\]). So from Lemma \[composlem\] we derive that ${\widetilde}{\tau}(1^{r-1}\otimes{\widetilde}{d}(1))=1$. Together with the condition that the composition (\[zerocomp\]) vanishes this is equivalent to the equation $${\langle}\nu((x+{\lambda}\cdot 1)^{r-1}),{\widetilde}{d}(x+{\lambda}\cdot 1){\rangle}={\lambda}^r$$ where $x\in C_0{\subset}{\widetilde}{C}_0$, the morphism $\nu:S^{r-1}{\widetilde}{C}_0{\rightarrow}C_1^{\vee}$ is induced by ${\widetilde}{\tau}$. It follows that the section $$s_{{\lambda}}(x)=({\widetilde}{d}(x+{\lambda}),\nu(x+{\lambda}\cdot 1))$$ of the orthogonal bundle $p^*C_1\oplus p^*C_1^{\vee}$ on $C_0$ satisfies $s_{{\lambda}}(x)\cdot s_{{\lambda}}(x)={\lambda}^r$. Applying Lemma \[mainlem\] to the action of $s_{{\lambda}}$ on the spinor bundle ${\Lambda}^*p^*C_1^{\vee}$ we derive the vanishing of localized Chern class corresponding to the isotropic section $s_0$ obtained from $s_{{\lambda}}$ by setting ${\lambda}=0$. But the latter class is precisely $c({{{\mathcal}T}},b)$.
Ramond factorization axiom {#Ramondsec}
==========================
Let the data $(\pi:{{{\mathcal}C}}{\rightarrow}X,{{{\mathcal}T}}, b:{{{\mathcal}T}}^r{\rightarrow}{\omega}_{{{{\mathcal}C}}/X})$ be as in section \[vanishsec\]. Assume in addition that we have an $X$-point ${\sigma}:X{\rightarrow}{{{\mathcal}C}}$ which is a nodal point of every fiber and that ${\widetilde}{\pi}:{\widetilde}{{{{\mathcal}C}}}{\rightarrow}X$ is a fiberwise normalization of this point. We denote by $n:{\widetilde}{{{{\mathcal}C}}}{\rightarrow}{{{\mathcal}C}}$ the corresponding morphism and by ${\sigma}_1,{\sigma}_2:X{\rightarrow}{\widetilde}{{{{\mathcal}C}}}$ two disjoint points that project to $p\in{{{\mathcal}C}}$. Finally, let us assume that ${{{\mathcal}T}}$ is locally free at ${\sigma}$ and that that map $b$ is an isomorphism at ${\sigma}$ (in [@JKV] this situation is referred to as “Ramond case”).
For every ${\lambda}\in k^*$ there is a natural line bundle ${{{\mathcal}L}}_{{\lambda}}$ on ${{{\mathcal}C}}$ such that $n^*{{{\mathcal}L}}_{{\lambda}}\simeq{{{\mathcal}O}}_{{\widetilde}{{{{\mathcal}C}}}}$ and the isomorphism $n^*{{{\mathcal}L}}_{{\lambda}}|_{{\sigma}_1}{\rightarrow}n^*{{{\mathcal}L}}_{{\lambda}}|_{{\sigma}_2}$ corresponds to the multiplication by ${\lambda}$. It is clear that ${{{\mathcal}L}}_{{\lambda}{\lambda}'}\simeq{{{\mathcal}L}}_{{\lambda}}\otimes{{{\mathcal}L}}_{{\lambda}'}$. In particular, if $\xi$ is an $r$-th root of unity then ${{{\mathcal}L}}_{\xi}^r\simeq{{{\mathcal}O}}_{{{{\mathcal}C}}}$. Therefore, we can twist the data $({{{\mathcal}T}},b)$ by considering ${{{\mathcal}T}}\otimes{{{\mathcal}L}}_{\xi}$ and the map $b_{\xi}:({{{\mathcal}T}}\otimes{{{\mathcal}L}}_{\xi})^r{\rightarrow}{\omega}_{{{{\mathcal}C}}/X}$ induced by $b$ and the trivialization of ${{{\mathcal}L}}_{\xi}^r$.
Now the Ramond case of Axiom 3 in [@JKV] is implied easily by Theorem \[axiom1thm\] together with the following result.
\[Ramondthm\] One has $$\sum_{\xi:\xi^r=1} c({{{\mathcal}T}}\otimes{{{\mathcal}L}}_{\xi},b_{\xi})=0.$$
Recall that the relative dualizing sheaves on ${{{\mathcal}C}}/X$ and ${\widetilde}{{{{\mathcal}C}}}/X$ are related by the isomorphism $n^*{\omega}_{{{{\mathcal}C}}/X}\simeq{\omega}_{{\widetilde}{{{{\mathcal}C}}}/X}({\sigma}_1+{\sigma}_2)$ such that the following diagram is commutative $$\begin{diagram}
n^*{\omega}_{{{{\mathcal}C}}/X}|_{{\sigma}_1} &&\rTo && n^*{\omega}_{{{{\mathcal}C}}/X}|_{{\sigma}_2}\\
\dTo &&&&\dTo\\
{\omega}_{{\widetilde}{{{{\mathcal}C}}}/X}({\sigma}_1+{\sigma}_2)|_{{\sigma}_1}&\rTo^{{\operatorname{Res}}}&{{{\mathcal}O}}_X&
\lTo^{-{\operatorname{Res}}}&{\omega}_{{\widetilde}{{{{\mathcal}C}}}/X}({\sigma}_1+{\sigma}_2)|_{{\sigma}_2}
\end{diagram}$$ where the top arrow is the canonical isomorphism (the sign comes from the relation $dx/x=-dy/y$ near the node $xy=0$). In particular, there is a canonical trivialization of ${\omega}_{{{{\mathcal}C}}/X}|_{{\sigma}}$ such that the boundary map ${\delta}:{{{\mathcal}O}}_X\simeq{\omega}_{{{{\mathcal}C}}/X}|_{{\sigma}}{\rightarrow}R\pi_*{\omega}_{{{{\mathcal}C}}/X}[1]$ from the exact triangle $$R\pi_*{\omega}_{{{{\mathcal}C}}/X}\rTo R\pi_*n_*n^*{\omega}_{{{{\mathcal}C}}/X}\rTo{\omega}_{{{{\mathcal}C}}/X}|_{{\sigma}}\rTo^{{\delta}}
R\pi_*{\omega}_{{{{\mathcal}C}}/X}[1]$$ satisfies ${\operatorname{Tr}}\circ{\delta}={\operatorname{id}}$, where ${\operatorname{Tr}}:R\pi_*{\omega}_{{{{\mathcal}C}}/X}[1]{\rightarrow}{{{\mathcal}O}}_X$ is the trace map.
We can recover $R\pi_*{{{\mathcal}T}}$ from $R{\widetilde}{\pi}_*{\widetilde}{{{{\mathcal}T}}}$, where ${\widetilde}{{{{\mathcal}T}}}=n^*{{{\mathcal}T}}$, together with the evaluation maps at ${\sigma}_1$ and ${\sigma}_2$. Namely, if we denote $L={\widetilde}{{{{\mathcal}T}}}|_{{\sigma}_1}\simeq{\widetilde}{{{{\mathcal}T}}}|_{{\sigma}_2}$ then there is an exact triangle $$\label{Ramondtriangle}
R\pi_*{{{\mathcal}T}}{\rightarrow}R{\widetilde}{\pi}_*{\widetilde}{{{{\mathcal}T}}}\rTo^{{\operatorname{ev}}_{1}-{\operatorname{ev}}_{2}} L{\rightarrow}R\pi_*{{{\mathcal}T}}[1]$$ where ${\operatorname{ev}}_{i}:R{\widetilde}{\pi}_*{\widetilde}{{{{\mathcal}T}}}{\rightarrow}L$ is the evaluation map at ${\sigma}_i$ ($i=1,2$). Note that the morphism $b:{{{\mathcal}T}}^r{\rightarrow}{\omega}_{{{{\mathcal}C}}/X}$ induces a morphism $${\widetilde}{b}:{\widetilde}{{{{\mathcal}T}}}^r{\rightarrow}{\omega}_{{\widetilde}{{{{\mathcal}C}}}/X}({\sigma}_1+{\sigma}_2).$$ Moreover, ${\widetilde}{b}$ is an isomorphism at ${\sigma}_1$ and ${\sigma}_2$, so restricting to either of these points we get a trivialization of $L^r$ (the two trivializations are the same). Passing to an étale cover of $X$ we can assume that $L$ itself is trivial.
Let $[C_0\stackrel{d}{{\rightarrow}} C_1]$ be a complex of vector bundles representing $R{\widetilde}{\pi}_*{\widetilde}{{{{\mathcal}T}}}$ with $C_1$ a direct sum of sufficiently negative powers of an ample line bundle on $X$. Then the evaluation maps ${\operatorname{ev}}_{1},{\operatorname{ev}}_{2}:R{\widetilde}{\pi}_*{\widetilde}{{{{\mathcal}T}}}{\rightarrow}L$ can be realized by morphisms $[C_0{\rightarrow}C_1]{\rightarrow}L$ in the homotopy category of complexes. Let $e_1,e_2:C_0{\rightarrow}L$ be the corresponding morphisms (unique up to adding morphisms that factor through $C_1$). Then we can choose a quasiisomorphism of $R\pi_*{{{\mathcal}T}}$ with the complex $${\operatorname{Cone}}([C_0{\rightarrow}C_1]\rTo^{e_1-e_2} L)[-1]=[C_0\rTo^{(d,e_1-e_2)}C_1\oplus L]$$ compatible with the triangle (\[Ramondtriangle\]), where ${\operatorname{Cone}}(C{\rightarrow}C')$ denotes the cone of a morphism of complexes $C{\rightarrow}C'$.
The triangle (\[Ramondtriangle\]) is obtained by applying the functor $R\pi_*$ to to the triangle $${{{\mathcal}T}}{\rightarrow}n_*{\widetilde}{{{{\mathcal}T}}}\rTo^{{\operatorname{ev}}_{1}-{\operatorname{ev}}_{2}} {\sigma}_*L{\rightarrow}{{{\mathcal}T}}[1]$$ on ${{{\mathcal}C}}$. To understand the map $S^rR\pi_*{{{\mathcal}T}}{\rightarrow}R\pi_*{\omega}_{{{{\mathcal}C}}/X}$ we can use the symmetric Künneth isomorphism $S^rR\pi_*{{{\mathcal}T}}\simeq R\pi^{(r)}_*({{{\mathcal}T}}^{(r)})$, where ${{{\mathcal}T}}^{(r)}$ is the $r$-th symmetric power of ${{{\mathcal}T}}$ on ${{{\mathcal}C}}^{(r)}$. The maps ${\operatorname{ev}}_1,{\operatorname{ev}}_2:n_*{\widetilde}{{{{\mathcal}T}}}{\rightarrow}{\sigma}_*L$ induce naturally the maps $${\operatorname{ev}}_1^r,{\operatorname{ev}}_2^r:(n_*{\widetilde}{{{{\mathcal}T}}})^{(r)}{\rightarrow}{\sigma}^r_*L,$$ where ${\sigma}^r:X{\rightarrow}{{{\mathcal}C}}^{(r)}$ is the $r$-tuple point of ${{{\mathcal}C}}^{(r)}$ corresponding to ${\sigma}$. Let us define a coherent sheaf on ${{{\mathcal}C}}^{(r)}$ as follows: $$K:={\operatorname{ker}}((n_*{\widetilde}{{{{\mathcal}T}}})^{(r)}\rTo^{{\operatorname{ev}}_1^r-{\operatorname{ev}}_2^r}{\sigma}^r_*L^r).$$ Then we have a natural embedding ${{{\mathcal}T}}^{(r)}{\rightarrow}K$ which induces a morphism $$\iota:S^rR\pi_*{{{\mathcal}T}}\simeq R\pi^{(r)}_*{{{\mathcal}T}}^{(r)}{\rightarrow}R\pi^{(r)}_*K.$$ Let ${\Delta}:{{{\mathcal}C}}{\rightarrow}{{{\mathcal}C}}^{(r)}$ be the diagonal embedding. We claim that there is a natural morphism $K{\rightarrow}{\Delta}_*{\omega}_{{{{\mathcal}C}}/X}$, such that the composition of the induced map ${\widetilde}{\eta}:R\pi^{(r)}_*K{\rightarrow}R\pi_*{\omega}_{{{{\mathcal}C}}/X}$ with $\iota$ coincides with the map $\eta:S^rR\pi_*{{{\mathcal}T}}{\rightarrow}R\pi_*{\omega}_{{{{\mathcal}C}}/X}$ induced by $b$. Indeed, ${\Delta}^*K$ maps to the kernel of the upper horizontal arrow in the commutative diagram $$\begin{diagram}
(n_*{\widetilde}{{{{\mathcal}T}}})^{\otimes r}&\rTo^{{\operatorname{ev}}_1^r-{\operatorname{ev}}_2^r}&{\sigma}_*L^r\\
\dTo &&\dTo\\
n_*n^*{\omega}_{{{{\mathcal}C}}/X} &\rTo& {\sigma}_*({\omega}_{{{{\mathcal}C}}/X}|_{{\sigma}})
\end{diagram}$$ Therefore, we obtain the natural map from ${\Delta}^*K$ to the kernel of the lower horizontal arrow in this diagram, i.e., a map ${\Delta}^*K{\rightarrow}{\omega}_{{{{\mathcal}C}}/X}$. By adjunction we get a morphism $K{\rightarrow}{\Delta}_*{\omega}_{{{{\mathcal}C}}/X}$. The restriction of this map to the subsheaf ${{{\mathcal}T}}^{(r)}{\subset}K$ is the map induced by $b$ which implies our claim. We also have a morphism of exact sequences $$\begin{diagram}
0 &\rTo& K&\rTo& (n_*{\widetilde}{{{{\mathcal}T}}})^{(r)}&\rTo^{{\operatorname{ev}}_1^r-{\operatorname{ev}}_2^r}&{\sigma}^r_*L^r &\rTo& 0\\
&&\dTo&&\dTo &&\dTo\\
0 &\rTo&{\Delta}_*{\omega}_{{{{\mathcal}C}}/X}&\rTo&{\Delta}_*n_*n^*{\omega}_{{{{\mathcal}C}}/X} &\rTo&{\sigma}^r_*({\omega}_{{{{\mathcal}C}}/X}|_{{\sigma}})&\rTo&0
\end{diagram}$$ This implies the commutativity of the following diagram: $$\begin{diagram}
{{{\mathcal}O}}_X\simeq &L^r &\rTo& R\pi^{(r)}_*K[1]\\
&\dTo&&\dTo^{{\widetilde}{\eta}[1]} \\
&{\omega}_{{{{\mathcal}C}}/X}|_{{\sigma}} &\rTo&R\pi_*{\omega}_{{{{\mathcal}C}}/X}[1]
\end{diagram}$$ Therefore, the composition of the map ${\widetilde}{\tau}:={\operatorname{Tr}}\circ{\widetilde}{\eta}[1]:R\pi^{(r)}_*K[1]{\rightarrow}{{{\mathcal}O}}_X$ with the natural map ${{{\mathcal}O}}_X\simeq L^r{\rightarrow}R\pi^{(r)}_*K[1]$ is equal to the identity. On the other hand, since ${\widetilde}{\eta}\circ\iota=\eta$, it follows that the composition ${\widetilde}{\tau}\circ\iota=\tau:S^rR\pi_*{{{\mathcal}T}}[1]{\rightarrow}{{{\mathcal}O}}_X$ is exactly the map induced by $b$ (which is used in the definition of the class $c({{{\mathcal}T}},b)$).
Note that $R\pi^{(r)}_*n_*{\widetilde}{{{{\mathcal}T}}}\simeq S^rR{\widetilde}{\pi}_*{\widetilde}{{{{\mathcal}T}}}$, so the object $R\pi^{(r)}_*K$ fits into the distinguished triangle $$R\pi^{(r)}_*K{\rightarrow}S^r R{\widetilde}{\pi}_*{\widetilde}{{{{\mathcal}T}}}\rTo^{{\operatorname{ev}}_1^r-{\operatorname{ev}}_2^r} L^r{\rightarrow}R\pi^{(r)}_*K[1].$$ Therefore, it can be represented by the complex ${\operatorname{Cone}}(S^r[C_0{\rightarrow}C_1]\rTo^{e_1^r-e_2^r} L^r)[-1]$ in a way compatible with this triangle. Furthermore, the natural morphism $S^rR\pi_*{{{\mathcal}T}}{\rightarrow}R\pi^{(r)}_*K$ is realized by the natural map of complexes $$\label{complexmap}
S^r[C_0\rTo^{(d,e_1-e_2)}C_1\oplus L]{\rightarrow}{\operatorname{Cone}}(S^r[C_0{\rightarrow}C_1]\rTo^{e_1^r-e_2^r} L^r)[-1]$$ with the components ${\operatorname{id}}:S^r C_0{\rightarrow}S^r C_0$, $$S^{r-1}C_0\otimes (C_1\oplus L){\rightarrow}(S^{r-1}C_0\otimes C_1)\oplus L^r:
x^{r-1}\otimes (y,z)\mapsto (x^{r-1}\otimes y, \sum_{i=0}^{r-1}e_1^i(x)e_2^{r-1-i}(x)z),$$ etc. Finally, we claim that for a suitable choice of the complex $C_0{\rightarrow}C_1$ (as in Proposition 4.7 of [@PV]) the map ${\widetilde}{\tau}:R\pi^{(r)}_*K[1]{\rightarrow}{{{\mathcal}O}}_X$ is represented by the chain map of complexes ${\operatorname{Cone}}(S^r[C_0{\rightarrow}C_1]\rTo^{e_1^r-e_2^r} L^r){\rightarrow}{{{\mathcal}O}}_X$. This is a consequence of the following general result.
\[Ramondlem\] Let $g:A{\rightarrow}B$, $f:B{\rightarrow}C$ be a pair of maps in the homotopy category ${{{\mathcal}K}}$ of some abelian category and let ${{{\mathcal}D}}$ be the corresponding derived category. Consider the subsets $H_{{{{\mathcal}K}}}(f){\subset}{\operatorname{Hom}}_{{{{\mathcal}K}}}({\operatorname{Cone}}(g),C)$ and $H_{{{{\mathcal}D}}}(f){\subset}{\operatorname{Hom}}_{{{{\mathcal}D}}}({\operatorname{Cone}}(g),C)$ consisting of morphisms ${\operatorname{Cone}}(g){\rightarrow}C$ such that their composition with the canonical morphism $i:B{\rightarrow}{\operatorname{Cone}}(g)$ is equal to $f$ (in ${{{\mathcal}K}}$ and ${{{\mathcal}D}}$ respectively). Assume that the map $${\operatorname{Hom}}_{{{{\mathcal}K}}}(A,C){\rightarrow}{\operatorname{Hom}}_{{{{\mathcal}D}}}(A,C)$$ is injective and the map $${\operatorname{Hom}}_{{{{\mathcal}K}}}(A[1],C){\rightarrow}{\operatorname{Hom}}_{{{{\mathcal}D}}}(A[1],C)$$ is surjective. Then the natural map $$\kappa:H_{{{{\mathcal}K}}}(f){\rightarrow}H_{{{{\mathcal}D}}}(f)$$ is surjective.
[[*Proof*]{}]{}. Let us denote by $\pi:{\operatorname{Cone}}(g){\rightarrow}A[1]$ the canonical chain map. If the set $H_{{{{\mathcal}D}}}(g)$ is empty then the assertion is clear, so we can assume that $H_{{{{\mathcal}D}}}(g)\neq\emptyset$. Then the composition $f\circ g:A{\rightarrow}C$ becomes zero in the derived category. By our assumption the natural map ${\operatorname{Hom}}_{{{{\mathcal}K}}}(A,C){\rightarrow}{\operatorname{Hom}}_{{{{\mathcal}D}}}(A,C)$ is injective, hence $f\circ g$ is homotopic to zero. Every homotopy $h$ from $g\circ f$ to $0$ induces naturally a chain map ${\operatorname{Cone}}(h):{\operatorname{Cone}}(g){\rightarrow}C$ which coincides with $f$ on the subcomplex $i(B){\subset}{\operatorname{Cone}}(g)$. In fact, it is easy to see that the map $h\mapsto{\operatorname{Cone}}(h)$ is a bijection between homotopies from $g\circ f$ to $0$ and chain maps ${\operatorname{Cone}}(g){\rightarrow}C$ extending $f$ on $B$. If we have two homotopies $h_1,h_2$ from $g\circ f$ to $0$ then the difference $h_1-h_2$ gives a chain map from $A[1]$ to $C$. It is easy to see that $${\operatorname{Cone}}(h_1)-{\operatorname{Cone}}(h_2)=(h_1-h_2)\circ\pi.$$
Now let ${\gamma}\in H_{{{{\mathcal}D}}}(g)$ be any element. Let us pick a homotopy $h_0$ from $g\circ f$ to $0$. Then the homotopy class $[{\operatorname{Cone}}(h_0)]$ is an element of $H_{{{{\mathcal}K}}}(f)$. The composition of $\kappa([{\operatorname{Cone}}(h_0)])-{\gamma}$ with $i$ vanishes in the derived category, hence we have $\kappa([{\operatorname{Cone}}(h_0)])-{\gamma}={\beta}\circ\pi$ for some ${\beta}\in{\operatorname{Hom}}_{{{{\mathcal}D}}}(A[1],C)$. By our assumption there exists a chain map ${\widetilde}{{\beta}}:A[1]{\rightarrow}C$ representing ${\beta}$. Then $h=h_0-{\widetilde}{{\beta}}$ is another homotopy from $g\circ f$ to $0$. We have $$\kappa([{\operatorname{Cone}}(h)])=\kappa([{\operatorname{Cone}}(h_0)-{\widetilde}{{\beta}}\circ\pi])=\kappa([{\operatorname{Cone}}(h_0)])-{\beta}\circ\pi={\gamma}.$$
We apply the above lemma to $A=S^r[C_0{\rightarrow}C_1]$, $B=L^r$ and $C={{{\mathcal}O}}_X$, where $f:L^r{\rightarrow}{{{\mathcal}O}}_X$ is the canonical isomorphism. To satisfy the assumptions of the lemma we choose the complex $C_0{\rightarrow}C_1$ representing $R{\widetilde}{\pi}_*{\widetilde}{{{{\mathcal}T}}}$ with $C_1$ a direct sum of sufficiently negative powers of an ample line bundle (one has to argue as in Proposition 4.7 of [@PV]). Hence, the map ${\widetilde}{\tau}$ is represented by a morphism in the homotopic category ${\operatorname{Cone}}(S^r[C_0{\rightarrow}C_1]\rTo^{e_1^r-e_2^r} L^r){\rightarrow}{{{\mathcal}O}}_X$ that we still denote by ${\widetilde}{\tau}$. The restriction of ${\widetilde}{\tau}$ to the subcomplex $L^r$ is equal to the canonical isomorphism $L^r{\rightarrow}{{{\mathcal}O}}_X$, while its composition with the map (\[complexmap\]) is the morphism $$\tau:S^r[C_0\rTo^{(d,e_1-e_2)}C_1\oplus L]{\rightarrow}{{{\mathcal}O}}_X[-1]$$ that should be used for the computation of $c({{{\mathcal}T}},b)$. It follows that the restriction of the corresponding morphism $$\tau:S^{r-1}C_0\otimes (C_1\oplus L){\rightarrow}{{{\mathcal}O}}_X$$ to $S^{r-1}C_0\otimes L$ has form $$\tau(x^{r-1}\otimes y)=\sum_{i=0}^{r-1} e_{1}(x)^i e_{2}(x)^{r-1-i}y\in L^r\simeq{{{\mathcal}O}}_X$$ where $x\in C_0$, $y\in L$. Hence, the corresponding isotropic section of $p^*(C_1\oplus L\oplus C_1^{\vee}\oplus L^{-1})$ (where $p:C_0{\rightarrow}X$ is the projection) has form $$s(x)=(d(x),(e_1-e_2)(x),\nu(x),\sum_{i=0}^{r-1} e_{1}(x)^i e_{2}(x)^{r-1-i}),$$ where the last component belongs to $L^{r-1}\simeq L^{-1}$, $\nu$ is given by some morphism $S^{r-1}C_0{\rightarrow}C_1^{\vee}$.
To compute the class corresponding to the twisted data $({{{\mathcal}T}}\otimes{{{\mathcal}L}}_{\xi},b_{\xi})$ for some $r$-th root of unity $\xi$ we simply have to replace the pair $(e_1,e_2)$ by $(e_1,\xi e_2)$. Note that this will not affect the definition of $K$ and of the morphism ${\widetilde}{\tau}$. Hence the corresponding isotropic section of $p^*(C_1\oplus L\oplus C_1^{\vee}\oplus L^{-1})$ will take form $$s_{\xi}(x)=
(d(x),(e_1-\xi e_2)(x),\nu(x),\sum_{i=0}^{r-1} \xi^{r-1-i}e_{1}(x)^i e_{2}(x)^{r-1-i}),$$ for some $\nu:S^{r-1}C_0{\rightarrow}C_1^{\vee}$.
Now we can finish the proof of Theorem \[Ramondthm\]. For every $\xi$ the class $c({{{\mathcal}T}}\otimes{{{\mathcal}L}}_{\xi},b_{\xi})$ is equal to $${\operatorname{td}}(C_1\oplus L)\cdot{\operatorname{ch}}^{C_0}_X({\Lambda}^*p^*(C_1^{\vee}\oplus L^{-1}),s_{\xi}),$$ where $s_{\xi}\in p^*(C_1\oplus L\oplus C_1^{\vee}\oplus L^{-1}), s_{\xi})$ is the isotropic section $s_{\xi}$ constructed above. Let us set $f_{\xi}=e_1-\xi e_2$. We consider $(f_{\xi})$ as a collection of sections of $p^*L$ on $C_0$. We have an orthogonal decomposition $$p^*(C_1\oplus L\oplus C_1^{\vee}\oplus L^{-1})\simeq p^*(C_1\oplus C_1^{\vee})\oplus
p^*(L\oplus L^{-1}),$$ so that the section $s_{\xi}$ has components $s_0=(d,\nu)\in p^*(C_1\oplus C_1^{\vee})$ and $(f_{\xi},\prod_{\xi'\neq\xi} f_{\xi'})$. Recall that we can trivialize $L$, so the spinor bundle ${\Lambda}^*p^*(C_1^{\vee}\oplus L^{-1})$ can be identified with ${\Lambda}^*p^*C_1^{\vee}\oplus {\Lambda}^*p^*C_1^{\vee}[1]$. Under this identification the action of sections $s_{\xi}$ will take form of differentials $(d_i)$ in Lemma \[mainlem2\], where the odd endomorphism $d$ of ${\Lambda}^*p^*C_1^{\vee}$ is given by the action of $s_0$. Now the assertion of the theorem follows from Lemma \[mainlem2\].
[99]{} P.Baum, W.Fulton, R.MacPherson, [*Riemann-Roch for singular varieties*]{}, Inst. Hautes Itudes Sci. Publ. Math. **45** (1975), 101–145.
I.Ciocan-Fontanine, M.Kapranov, *Derived Quot schemes*, preprint math.AG/9905174. I.Ciocan-Fontanine, M.Kapranov, *Derived Hilbert schemes*, preprint math.AG/0005155.
W.Fulton, [*Intersection theory*]{}, Springer, 1998.
T.J.Jarvis, T.Kimura, A.Vaintrob, *Moduli spaces of higher spin curves and integrable hierarchies*, Compositio Math., [math.AG/9905034]{}.
M.Kontsevich, *Enumeration of rational curves via torus action*, in *Moduli Space of Curves (R.Dijkgraaf, C.Faber, G.van der Geer, Eds.)*, 335–368, Birkhauser, Boston, 1995.
M.Kontsevich, Yu.I.Manin, *Gromov-Witten classes, quantum cohomology, and enumerative geometry*, Commun. Math. Phys.**164** (1994), 525–562.
T. Mochizuki, [*The virtual class of the moduli stack of $r$-spin curves*]{}, preprint, see http://www.math.ias.edu/$\tilde{\phantom{x}}$takuro/list.html
A. Polishchuk, A. Vaintrob, [*Algebraic construction of Witten’s top Chern class*]{}, in [*Advances in Algebraic Geometry motivated by Physics*]{}, E. Previato, ed., 229–250. AMS, 2001.
E.Witten, *The $N$-matrix model and gauged WZW models,* Nucl. Phys. B **371** (1992), no. 1-2, 191-245.
E.Witten, *Algebraic geometry associated with matrix models of two dimensional gravity*, Topological methods in modern mathematics (Stony Brook, NY, 1991), Publish or Perish, Houston, 1993, 235-269.
[^1]: This work was partially supported by NSF grant DMS-0070967.
|
{
"pile_set_name": "ArXiv"
}
|
Q:
Google Identity Toolkit returns error 2 when signing in with aol email Id
I have been using Google Identity Toolkit for my GAE (Java) based app for couple years now. I have Google, Facebook and Microsoft federated logins enabled. However, when a user tries to "Sign In with Email" and uses an @aol.com account, it returns a 503 error, and Error code: Error code: 2. error message on the UI. In the console, the following errors appear:
gitkit.js:242 POST https://www.googleapis.com/identitytoolkit/v3/relyingparty/createAuthUri?key=<key> 503 ()
lj.send @ gitkit.js:242
Mj @ gitkit.js:255
Lj.requestGitkitEndpoint @ gitkit.js:256
Oj.createAuthUri @ gitkit.js:258
N @ gitkit.js:190
Vm @ gitkit.js:337
(anonymous) @ gitkit.js:338
(anonymous) @ gitkit.js:79
(anonymous) @ gitkit.js:77
Yc @ gitkit.js:44
g.dispatchEvent @ gitkit.js:42
g.handleEvent @ gitkit.js:70
Mc.a.(anonymous function).a.(anonymous function) @ gitkit.js:41
Uc @ gitkit.js:39
Rc @ gitkit.js:41
Pc.b @ gitkit.js:37
gitkit.js:254 [ 40.291s] [identitytoolkit] createAuthUri: {"error":{"errors":[{"domain":"global","reason":"backendError","message":"Error code: 2"}],"code":503,"message":"Error code: 2"}}
Is this a bug?
A:
It was related to AOL shutting down their OIDC service. Google Identity Toolkit team applied a fix to bypass it. The issue was resolved without any code change from my end. Thanks to @bojeil for help.
|
{
"pile_set_name": "StackExchange"
}
|
Edward Teach's Posts - Atheist Nexus2016-12-09T13:38:27ZEdward Teachhttp://atheistnexus.org/profile/edwardteachhttp://api.ning.com/files/B4t5nfzyPSNUTZ*iRAv99Me5fEHDwMcaDY6UFXzfL9gVLQMZgaaITgNerWvBXbTYRtpxNt5UZIoyqyP5HegWmpP*3jheX20H/blackbeard.jpg?width=48&height=48&crop=1%3A1http://atheistnexus.org/profiles/blog/feed?user=3lj5xmmh8xdy7&xn_auth=noOn Being Anti-Religiontag:atheistnexus.org,2016-10-13:2182797:BlogPost:27129542016-10-13T14:00:00.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p><a href="http://www.corsairphilosopher.com/2016/10/on-being-anti-religion.html" target="_blank">Here is the link to the blog post</a></p>
<p><a href="http://www.corsairphilosopher.com/2016/10/on-being-anti-religion.html" target="_blank">Here is the link to the blog post</a></p>Why would you want to be an atheist?tag:atheistnexus.org,2015-09-28:2182797:BlogPost:26473512015-09-28T20:30:00.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p>My mom is genuinely bewildered that I would "choose" to be atheist. I remember when I was a believer just pitying atheists, because they didn't "know the lord" as I did. It was an egocentric thinking error to assume that the atheist hadn't experienced what I had. In truth, I had never experienced the myriad joys of being a free thinker. Here's my article:…</p>
<p></p>
<p></p>
<p>My mom is genuinely bewildered that I would "choose" to be atheist. I remember when I was a believer just pitying atheists, because they didn't "know the lord" as I did. It was an egocentric thinking error to assume that the atheist hadn't experienced what I had. In truth, I had never experienced the myriad joys of being a free thinker. Here's my article:</p>
<p></p>
<p><a href="http://www.corsairphilosophy.com/2015/09/why-would-you-want-to-be-atheist.html">http://www.corsairphilosophy.com/2015/09/why-would-you-want-to-be-atheist.html</a></p>
<p></p>
<div class="separator"></div>
<div><div>This is a great question and one that I think I am uniquely qualified to answer. Religion was at the center of my life growing up. I was a Born Again Christian and experienced all forms of religious ecstasy. Jesus Christ was my personal savior. My walk with the Lord was never far from my thoughts.</div>
</div>
<div>My initial answer to the question, “Why would you want to be an atheist?” was, “I didn’t want to.” I didn’t want to give up beliefs that provided so much comfort. I wanted an invisible, omniscient parent figure watching over me. I wanted bad people to be punished and good people to be rewarded. I wanted miracles to be real. I wanted to meet my loved ones in Heaven after I died. I wanted the power of prayer to influence outcomes in this world. I wanted to believe what everyone I grew up with believed. I wanted to believe in magic.</div>
<div>As I began to develop my intellect, I found that my religious beliefs did not hold up to critical evaluation. I desperately wanted Christian doctrine to be true. Everyone I loved and respected growing up was a Christian. “Christian” and “good” actually meant the same thing to me (I have since found this to be a grossly inaccurate perception). I was so determined to prove mystical beliefs valid that I spent over 20 years attempting to reconcile rational thinking and religion. I failed.</div>
<div>Historically, better minds than mine also failed at this endeavor. I found that there were no loopholes through which I could contort a logical argument to such a degree as to deny reality. Religion is mythology. Reality demonstrates its true nature to us every minute of every day. You don’t need to be an atheist to know that snakes don’t talk, gravity is constant, and death is permanent. Magical forces that operate outside of the laws of nature have never been real.</div>
<div>I didn’t decide to become an atheist. In the absence of evidence to the contrary, atheism is the default position. Every baby on the planet is born an atheist until she is indoctrinated into the mythology of her culture. The burden of proof is on he who makes the assertion. If I say I have a hundred dollar bill in my pocket and you don’t believe me, it is up to me to show you the bill. And, if I say that my god is real, it is on me to show you my god. It is not your responsibility to prove me false. No one can prove that there are no pixies, leprechauns, or other inventions of the human imagination and no one should have to. Like Carl Sagan said, "extraordinary claims require extraordinary evidence."</div>
<div>I am atheist, because any other position would be intellectually dishonest. The fundamental human thinking error is to mistake “feeling true” for “being true.” The modern age was born the minute the scientific method factored out this natural human tendency. “Wanting” a piece of information to be true does not make it so. “Believing” a piece of information to be true does not make it so. Objective truth is provable through evidence and logic. Objective truth often conflicts with what I would prefer to be true. However, I value truth above my own emotional needs.</div>
<div class="separator"></div>
<div>The evidence for every single religion is no evidence at all. They are all justified by the same fallacious support:</div>
<ul>
<li>Personal, spiritual experiences that have led to an intuitive sense or "gut feeling" that the god in question is real. Feelings are NOT evidence.</li>
</ul>
<ul>
<li>Many other people within a given culture, especially respected people in positions of authority (parents, ministers, educators, political officials), share belief in said god. Popular opinion is NOT evidence.</li>
</ul>
<ul>
<li>Stories passed on through the spoken or written word stating the existence of the god in question. Stories are NOT evidence.</li>
</ul>
<p></p>
<div>Sometimes Christians say, “If you knew Jesus as I do, you would believe.” Speaking in tongues? Check. Healing? Check. Emotional redemption experience? Check. Feeling the Lord’s presence? Check. Prayers answered? Check. I have been through the experience that people call “knowing Jesus.” However, I have yet to meet a Christian who has ever experienced the dignity, peace, and wisdom that accompanies living completely without superstition under the warm light of reason. It takes great courage to deal with life without belief in supernatural helpers, but the benefits are tremendous:</div>
<div><h2>Self deception is degrading</h2>
</div>
<div>As a boy, when my mother told me that Santa isn’t real, I remember longing to believe again. But, it was impossible to put the genie back in the bottle. Discarding my belief in Santa was a loss of innocence and loss of innocence brings the gift of maturity. If I were an adult who refused to acknowledge Santa as a myth, I would be considered mentally unsound. Discarding comforting religious mythology was also a loss of innocence, but it allowed me to develop an aspect of maturity otherwise impossible to achieve. </div>
<div>As an adult, I wouldn’t want to still believe in Santa and I wouldn’t want to still believe in a god. Through the 19th century, women were generally regarded as incapable of managing adult life without the guidance of a man. It is repugnant to modern sensibilities that grown women were treated like children. It is equally offensive to me that religion keeps the adult believer in a child’s role throughout life. </div>
<div><h2>The permanence of death is scary, but makes life richer and fuller</h2>
</div>
<div>The irreversible nature of death is an obvious truth when considering mosquitoes, tomato plants, or bacteria. However, when we have to deal with the death of a loved one, the permanence of death becomes overwhelming. And, when we have to reflect on our own ultimate mortality, this truth is seemingly unbearable. So like children, we retreat into fantasy. No one we care about really dies. We all get to live in a magical paradise forever.</div>
<div><a href="http://4.bp.blogspot.com/-0S8zgD9Qm9k/VgVdncGQAdI/AAAAAAAACDY/90cKNZBWr-s/s1600/woman-591576_1280.jpg"></a>Dealing with one’s own mortality can be frightening business. But, as Emily Dickinson said, “That life will never come again is what makes life sweet.” Truly accepting our own impermanence makes every sunset more beautiful, every meal more delicious, and every kiss more passionate. It shines a bright light on the things that are truly important in life. Knowing that our time is limited makes opportunities to interact with the people we love deeply special.</div>
<div><h2>Making the world a better place is intrinsically rewarding</h2>
</div>
<div>Often times, bad people enjoy great success and good people are punished. Aggressive, violent apes are often rewarded with first choice for food, grooming, and sex partners while their passive counterparts live as victims of an unfair social order. This doesn’t occur because god is punishing or testing the passive apes. It occurs because this is the nature of life in an ape tribe.</div>
<div><a href="http://4.bp.blogspot.com/-0dOJ7oyvxaU/VgVdyXNlRMI/AAAAAAAACDg/Ns6oZMewZUY/s1600/hands-908165_1280.jpg"></a>Praying will not change unfairness. One hundred years of prayer research has clearly proven that prayer has absolutely no impact on external reality.<a href="https://www.blogger.com/blogger.g?blogID=2841603237581584083#_ftn1" title="">[1]</a> None. Spending your time praying, watching cartoons on television, or standing on one foot are all activities that do nothing to make the world a better place. The problems of this world are myriad and complex, but solutions will only come about when people take action to provide actual help for one another.</div>
<div>The fantasy that everything will be made right after one dies has been used to control slaves, peasants, oppressed minorities, and the down trodden throughout history. This horrible myth has enabled the rich and powerful to live in opulence through the suffering of gullible believers. Believers who accept their miserable lots in life, because they think a god will fix everything when they die. How many lives have been thrown away? How many people wasted this one and only opportunity they would ever have to enjoy the absolute wonder of living a human life?</div>
<div><h2>Being responsible is empowering</h2>
</div>
<div class="separator"></div>
<div>You are 100% responsible for your life regardless of your beliefs. This truth becomes obvious at the end of life, but it is often denied by believers. The number one regret of the terminally ill? “I wish I’d had the courage to live a life true to myself, not the life others expected of me.”<a href="https://www.blogger.com/blogger.g?blogID=2841603237581584083#_ftn2" title="">[2]</a> <br/></div>
<div>If you are unhappy with your life, it is not because you are unlucky or because you are being punished by god. You are randomly thrown into this world under a wide range of life circumstances beyond your control. You may be fortunate, unfortunate, rich, poor, ugly, beautiful, healthy, sickly, tall, or short. You may be deformed or blind or brilliant. Regardless of your circumstances, you have the right and the responsibility to make something meaningful of your single opportunity at life.</div>
<div>Religion demands a prescribed life. It provides a paint by numbers formula for meaning. Conversely, my life is a blank canvass on which I paint from an endless palette of the experiences that vibrate with depth and significance specifically for me. Unrestricted by the egocentric delusion that my every thought and act is being monitored and judged by an invisible deity, I live as a truly free man and revel in the joy it brings me. I still experience fear, but I fear things that are real. Superstitious fears of magical forces are absurd. Observation of those who worship gods and goddesses different than your own makes this abundantly clear. Magical forces have never once harmed anyone. People who believe in such foolishness, however, have inflicted harm beyond comprehension.</div>
<div>I guess my final answer to, “Why would you want to be an atheist?” is “Because it is the richest, most satisfying life I can imagine!”</div>A Personal Article on Dealing with Major Depressiontag:atheistnexus.org,2015-04-27:2182797:BlogPost:25972602015-04-27T12:30:00.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p><a href="http://www.corsairphilosophy.com/2015/04/rough-waters-4-steps-to-navigating.html">http://www.corsairphilosophy.com/2015/04/rough-waters-4-steps-to-navigating.html</a></p>
<p></p>
<div class="post-body entry-content"><div dir="ltr"></div>
<div dir="ltr"><p><strong><span class="font-size-5">4 Steps to Navigating the Rough Waters of Depression</span></strong></p>
<p> </p>
<p>After suffering a lifetime of Major Depression, I have found 4 strategies that minimize the damages and maximize…</p>
</div>
</div>
<p><a href="http://www.corsairphilosophy.com/2015/04/rough-waters-4-steps-to-navigating.html">http://www.corsairphilosophy.com/2015/04/rough-waters-4-steps-to-navigating.html</a></p>
<p></p>
<div class="post-body entry-content"><div dir="ltr"></div>
<div dir="ltr"><p><strong><span class="font-size-5">4 Steps to Navigating the Rough Waters of Depression</span></strong></p>
<p> </p>
<p>After suffering a lifetime of Major Depression, I have found 4 strategies that minimize the damages and maximize the benefits of this disorder. Yeah, there are actually benefits!</p>
<p> </p>
<p><strong>STEP 1: Get treatment!</strong></p>
<p> </p>
<p>Let’s start with separating “normal” depression that everyone experiences from clinical depression which affects 20-26% of women and 8-12% of men over the course of a lifetime<a title="">[1]</a>. Normal depression means feeling blue or having a down day. Clinical depression means that for most days, over at least a two week period, you experience 5 or more of these symptoms:</p>
<p>Feeling sad, empty, depressed, or tearful</p>
<p>Loss of interest or pleasure in almost all activities</p>
<p>Increased or decreased sleep</p>
<p>Restlessness or a sense of being slowed down</p>
<p>Loss of energy</p>
<p>Feeling worthless or guilt ridden</p>
<p>Trouble concentrating or making decisions</p>
<p>Thoughts of death or suicide</p>
<p>Unintentional weight loss or weight gain of over 5% of your body weight (within a two week period).<a title="">[2]</a></p>
<p> </p>
<p>Prior to coming to terms with my depression, I was completely against treatment and in severe denial. I felt like getting treatment somehow spoke to my character, as if it meant I was weak or less of a man. I employed every alternative strategy I could come up with. I tried yoga, running, diets, self-hypnosis, weight lifting, meditation, talk therapy, and every holistic treatment I could find.</p>
<p> </p>
<p>By age 28, I was at the end of my rope. Fortunately, a doctor friend insisted on a trial of antidepressant medication. This changed my life. Over the course of a couple of weeks, my mental processes became clear, my sleep and appetite improved dramatically, and my overall level of functioning skyrocketed. I went from the being the lowest to the highest producer in my office. I had always been a “C” student, but when I returned to grad school after treatment, I earned all “A”s. Once I treated the underlying illness, all of the other strategies I had tried in the past were able to take root. It was as if I had been wearing dark glasses with the wrong prescription my whole life and suddenly they had been removed. This was how “normal” people felt!?! I had been dragging a boulder behind me while everyone else skipped along unencumbered!</p>
<p> </p>
<p>Depression is a serious illness and should not be ignored. We lose many good people every day to suicide. Often, well-meaning, but ignorant, family and friends tell sufferers of depression to “get over it” or “suck it up.” The proper advice to give a sick loved one is to get treatment. No one would advise a heart patient to, “Stop taking your medication. You don’t need that shit!” However, depressed people hear such comments frequently, and from people who are supposed to care about them!</p>
<p> </p>
<p>Treatment programs may include medication, talk therapy, physical exercise, dietary changes and numerous other strategies. A major obstacle to any treatment program is patient noncompliance<a title="">[3]</a>. Depressed patients often feel shame and embarrassment about their condition. It takes precious little social pressure from the people in his/her life to get a depressed person to stop treatment or fail to seek treatment. The results can be tragic. Statistically, death by suicide tops chronic liver disease, Alzheimer’s, homicide, arteriosclerosis and hypertension.<a title="">[4]</a></p>
<p> </p>
<p>Even with excellent compliance, depressive episodes still happen. But, sticking with the treatment program can make episodes much less frequent and much less severe.</p>
<p> </p>
<p><strong>STEP 2: Don’t trust your gut feelings.</strong></p>
<p> </p>
<p>Emotions evolved in humans because they helped our ancestors survive.<a title="">[5]</a> Anger and fear, associated with the fight or flight response, gave early humans the instinct to protect themselves by confronting danger or fleeing to safety. Feelings of love and affection motivated them to protect younger and weaker members of their social group. In a modern society, these primitive instincts are sometimes a hindrance. For instance, if one were to act on every violent impulse one experiences when angry, the social, legal and physical consequences would be catastrophic.</p>
<p> </p>
<p>During depressive illness, gut feelings are out of whack.<a title="">[6]</a> Because they evolved from survival instincts, gut feelings can be overwhelmingly powerful and difficult to overcome. Most people assume their feelings are accurate without question. This can be a HUGE problem for people with depression. Messages from the guts of depressed people can look like this:</p>
<p> </p>
<p>“You are useless.”</p>
<p> </p>
<p>“All you do is screw up.”</p>
<p> </p>
<p>“Your life is terrible.”</p>
<p> </p>
<p>“You are a failure.”</p>
<p> </p>
<p>“Everyone can see that you are a loser.”</p>
<p> </p>
<p>When people trust this faulty sense they are worthless and life sucks, depression is intensified. When clinical depression manifests, symptoms are unavoidable. “Thinking your way” out of an organic, depressive episode is akin to “thinking your way” out of having a bad cold. You can be aware that you have a cold and think positive, healthy thoughts… but you will still have a cold. The depressive episode will pass, but it will do so gradually, the same way a head cold subsides.</p>
<p> </p>
<p>At this stage in the game, I am acutely aware of the physical and cognitive symptoms of emerging depression. My concentration and memory slip. My ability to do complex tasks becomes impaired. Everyday activities feel overwhelming. My sleep patterns change. I know the experience is unavoidable, but I also know that it is temporary.</p>
<p> </p>
<p><strong>STEP 3: Be kind and patient with yourself.</strong></p>
<p> </p>
<p>If you have depressive illness, you have an ILLNESS! Ease up on yourself.<a title="">[7]</a> How would you treat a sick friend? Would you tell them to get over it? Would you tell them that they are worthless and lazy? </p>
<p>As soon as I become aware of depression, I consciously start to shift my inner dialogue:</p>
<p> </p>
<p>“Take it easy. You can’t rely on your feelings today.”</p>
<p> </p>
<p>“This is like a thunder storm. It will eventually move on.”</p>
<p> </p>
<p>“You can’t trust the emotional signals you’re getting today.”</p>
<p> </p>
<p> “Depressed feelings are not evidence of anything but depressed feelings. They don’t mean a damn thing.”</p>
<p> </p>
<p>“Just like a head cold. Take care of yourself and it will eventually pass.”</p>
<p> </p>
<p>“You are doing the best you can and that is enough.”</p>
<p> </p>
<p>“If these exact same things happened on a day when you were not depressed, they would not affect you at all.”</p>
<p> </p>
<p>When I realize I am dealing with a depressive episode, my priorities also shift. I know that the machine I use for problem solving, planning, and social interactions is malfunctioning, so it’s a bad time to engage in those activities. I know not to make big decisions about my life when I’m depressed.</p>
<p> </p>
<p>For some people, socializing eases depression. But for me, solitude can also be helpful. I communicate that I’m not feeling well and need some time. Then, I go off by myself and nap, read, listen to music, write, play guitar, watch movies, or do light exercise. These solo activities can be comforting to me when I’m depressed. The best strategy, when you are having severe depression, is to fill your time with any non-hazardous activities that help you cope until the episode passes.</p>
<p> </p>
<p><strong>STEP 4: Appreciate the experience.</strong></p>
<p> </p>
<p>I am a fortunate man. I was thrown into the world an intelligent, reasonably attractive, white, male American with a loving, stable family. I have received a lifetime of benefits (seen and unseen) associated with these qualities, even though I did nothing to earn them. Under other circumstances, I could have easily become an arrogant, self-righteous, uncaring, privileged jerk. But, depression has made me keenly aware of human suffering. Depression helped make me an empathetic, caring human being. Depression has given me the opportunity to experience depths of emotion that are not available to people without the condition. I wouldn't wish it on my worst enemy, but I wouldn't be me without depression. And, I love being me!</p>
<p> </p>
<p>People say they want a “happy life.” I consider this a foolish aspiration. Every healthy person will live through a complete repertoire of emotional experiences. Each of us will know joy, sadness, boredom, love, hate, excitement, bliss, pain, and on, and on. Emotions give color and texture and meaning to our lives. Often times the most difficult emotional experiences are the most necessary ones for our own development.<a title="">[8]</a></p>
<p> </p>
<p>I don’t think anyone would actually want a “happy life” even if it were possible. Less emotional experiences would mean being less human. Why are there movie genres for horror, comedy, tragedy, action, romance, and fantasy? Because people want to experience a full range of human emotions!</p>
<p> </p>
<p>No one “enjoys” having depression, but the experience is wasted if you fail to at least appreciate it.</p>
<p></p>
<div><hr size="1" width="33%" align="left"/></div>
<p> </p>
<p>[1] "Hotline Information." Depression Statistics. N.p., n.d. Web. 21 Apr. 2015.</p>
<p>[2] "Major Depressive Episode Symptoms." Psych Central. N.p., n.d. Web. 21 Apr. 2015.</p>
<p>[3] Martin, Leslie R., Summer L. Williams, Kelly B. Haskard, and M. Robin DiMatteo. "The Challenge of Patient Adherence." Therapeutics and Clinical Risk Management. Dove Medical Press, n.d. Web. 21 Apr. 2015.</p>
<p>[4] "Hotline Information." Depression Statistics. N.p., n.d. Web. 21 Apr. 2015.</p>
<p>[5] "The Nature of Emotions." » American Scientist. N.p., n.d. Web. 21 Apr. 2015.</p>
<p>[6] "Corsair Philosophy." : Why You Can't Always Trust Your "Gut Feelings?" N.p., n.d. Web. 21 Apr. 2015.</p>
<p>[7] "Depression Acting Up? 5 Ways To Be Kind to Yourself." Depression Acting Up? 5 Ways To Be Kind to Yourself. N.p., n.d. Web. 21 Apr. 2015.</p>
<p>[8] "Negative Emotions Are Key to Well-Being." Scientific American Global RSS. N.p., n.d. Web. 21 Apr. 2015.</p>
<p> </p>
</div>
</div>Is Atheism in Men Caused by Bad Father/Son Relationships?tag:atheistnexus.org,2015-02-12:2182797:BlogPost:25667982015-02-12T17:39:18.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<h3 class="post-title entry-title"><a href="http://edwardteach100.blogspot.com/2015/02/is-atheism-in-men-caused-by-bad.html">http://edwardteach100.blogspot.com/2015/02/is-atheism-in-men-caused-by-bad.html…</a></h3>
<p><a href="http://api.ning.com:80/files/sRY-hG6lRQ-Ofjz43nBJoqNu3HaA-zUNEyxtbW2ahfa8Kr*J28tZgBOMNE19cC6EZkMkOMImSFsF94f*AQEIJGdfYH4I3UGm/193204torikaituneo1.jpg" target="_self"><img class="align-center" src="http://api.ning.com:80/files/sRY-hG6lRQ-Ofjz43nBJoqNu3HaA-zUNEyxtbW2ahfa8Kr*J28tZgBOMNE19cC6EZkMkOMImSFsF94f*AQEIJGdfYH4I3UGm/193204torikaituneo1.jpg" width="480"></img></a></p>
<div class="post-body entry-content"><div dir="ltr"></div>
</div>
<h3 class="post-title entry-title"><a href="http://edwardteach100.blogspot.com/2015/02/is-atheism-in-men-caused-by-bad.html">http://edwardteach100.blogspot.com/2015/02/is-atheism-in-men-caused-by-bad.html</a></h3>
<p><a href="http://api.ning.com:80/files/sRY-hG6lRQ-Ofjz43nBJoqNu3HaA-zUNEyxtbW2ahfa8Kr*J28tZgBOMNE19cC6EZkMkOMImSFsF94f*AQEIJGdfYH4I3UGm/193204torikaituneo1.jpg" target="_self"><img src="http://api.ning.com:80/files/sRY-hG6lRQ-Ofjz43nBJoqNu3HaA-zUNEyxtbW2ahfa8Kr*J28tZgBOMNE19cC6EZkMkOMImSFsF94f*AQEIJGdfYH4I3UGm/193204torikaituneo1.jpg" width="480" class="align-center"/></a></p>
<div class="post-body entry-content"><div dir="ltr"><div class="separator" style="text-align: center;"><span class="font-size-1">"193204torikaituneo". Licensed under Public Domain via Wikimedia Commons - <a href="http://commons.wikimedia.org/wiki/File:193204torikaituneo.jpg#mediaviewer/File:193204torikaituneo.jp">http://commons.wikimedia.org/wiki/File:193204torikaituneo.jpg#mediaviewer/File:193204torikaituneo.jp</a></span>g</div>
<div class="separator"></div>
<div class="separator"></div>
<div align="center"><p align="center"><b>Is Atheism in Men Caused by Bad Father/Son Relationships?</b></p>
<p>A few years ago, my cousin informed me that his minister delivered a sermon on atheism. The minister indicated that in men, the best predictor of atheism is bad relationships with their fathers. “YOU had a bad relationship with YOUR father and now YOU are an atheist!” This bothered me, because it was true. And, while I was certain that there was no causal relationship between my atheism and conflicts I had with my father, I could completely understand how this coincidence might inspire a compelling sense in my cousin that his minister had nailed it.</p>
<p>I looked for research on atheism and father issues and found a piece called “The Psychology of Atheism,” by Paul C. Vitz, a psychology professor at NYU.<a title="">[1]</a> Dr. Vitz admits to a brief period of atheism in his youth which he attributes to social conformity (Interestingly, he does not attribute his subsequent Catholicism to social conformity). I have great respect for information yielded from well-controlled scientific studies in the field of psychology. However, “The Psychology of Atheism” doesn’t cite a single scientific reference. Not one! To my knowledge, no supporting scientific evidence exists for Dr. Vitz’ theory.</p>
<p>Vitz’ essay presents an anecdotal argument that since Hobbes, Voltaire, Freud, Zedong, and Hitler all had fathers who were weak, unloving, or not present, then father issues must have caused their atheism. In fact, while all of these men questioned dominant religions, Hobbes was a Christian<a title="">[2]</a>, Voltaire a Deist<a title="">[3]</a>, Zedong a Buddhist/Taoist<a title="">[4]</a>, and Hitler a Catholic. Pope Pius XI negotiated the <i>Reichskonkordat</i> agreement, which actually lent moral legitimacy to the Nazi regime in Germany.<a title="">[5]</a> And, Hitler made his views on God very clear, “My feelings as a Christian points me to my Lord and Savior as a fighter."<a title="">[6]</a></p>
<p>Freud was an actual atheist and did a good deal of philosophical writing on the topic. In “The Future of an Illusion,” he reasoned that as children, we are weak, ignorant, and helpless by nature. We are comforted through childhood by parents whom we consider strong, knowledgeable, and invulnerable. As adults, when we realize the imperfections of our parents, we would once again be thrown into a deep sense of fallibility. Freud believed it an adaptive evolutionary trait to invent invisible, magical parents who were all-knowing, all powerful, and immortal. Like our terrestrial parents, the magical ones protect us from danger, punish us when we are bad, reward us when we are good, and have the answers to all of our questions.<a title="">[7]</a> </p>
<p>Let’s stop here and ask a question. Which argument seems more reasonable? Freud’s argument that man invented God to fill in the gap left by Earthly parents, or Vitz’ argument that the atheist is angry at his Heavenly Father because of a bad relationship with his Earthly one? Neither argument was based in scientific research, but one will “feel” more true to you depending on your own pre-existing beliefs.</p>
<p>There are obviously many rational problems with making assumptions about an enormous and diverse population like the atheists based on the idea that Freud and I had bad relationships with our fathers. Vitz cannot assume that this is the case for other atheists, since no supporting data exists. It is likely that many men have rocky relationships with their fathers. Some of them happen to become atheists while others happen to become theists.</p>
<p>Without evidence, neither can we assume that Freud is accurate in his assumption that all religious people have needs for safety and answers. In this case, however, scientific evidence abounds. The fight or flight response is present in all animals, including humans.<a title="">[8]</a> Likewise, curiosity is an intrinsic human motivator.<a title="">[9]</a> A 2003 article cites 74 studies from scientific journals supporting Freud’s basic assertions that religious thought is a natural by-product of brain function<a title="">[10]</a>.</p>
<p>Discerning and using objective evidence to determine accuracy is a relatively new development in humans. Making broad assumptions without sufficient evidence is much more characteristic of the way humans think. In simple terms, the mind is a machine that takes tiny amounts of information, makes sweeping generalizations, then “feels” these generalizations are accurate and reasonable. This is a fundamental cognitive error responsible for much death and suffering across the ages.</p>
<p>Tendencies towards making sweeping generalizations are hard wired into us and are essential to navigating human life.<a title="">[11]</a> Imagine having to consider the universe of potential outcomes prior to every decision you make. NOT making sweeping generalizations based on small amounts of information would completely paralyze us!</p>
<p>So, we work within our inherent limitations and try our best not to screw up. One way to avoid screw ups is the choice to consciously override gut feelings whenever reason and overwhelming objective evidence disputes said feelings. In other words, if the majority of scientific evidence says one thing and my gut says the opposite, my gut has a high likelihood of being wrong. Science is never able to provide the absolute answer, only the best possible answer according to evidence available at a given time.</p>
<p>Just for kicks, I researched the best predictors of atheism. What I found brought a broad smile to my face. Turns out a primary predictor of atheism is… IQ.<a title="">[12]</a></p>
<p> </p>
<div><br clear="all"/><hr align="left" size="1" width="33%"/><div><p style="text-align: left;"><span class="font-size-1"><a title="">[1]</a> "Faith of the Fatherless: The Psychology of Atheism Paperback – October 18, 2013." <i>Faith of the Fatherless: The Psychology of Atheism: Paul C. Vitz: 9781586176877: Amazon.com: Books</i>. N.p., n.d. Web. 11 Feb. 2015.</span></p>
</div>
<div style="text-align: left;"><p><span class="font-size-1"><a title="">[2]</a> Fuller, Timothy "The Idea of Christianity in Hobbes’s Leviathan." <i>JSTOR</i> (n.d.): n. pag. JSTOR 192.168.82.205, 27 Nov. 2012. Web. 11 Feb. 2015.</span></p>
</div>
<div style="text-align: left;"><p><span class="font-size-1"><a title="">[3]</a> "Voltaire - Biography." <i>Voltaire</i>. N.p., n.d. Web. 11 Feb. 2015.</span></p>
</div>
<div style="text-align: left;"><p><span class="font-size-1"><a title="">[4]</a> "Religion - East and Southeast Asia - Modern China." <i>- Mao, Religious, Daoist, and Zedong</i>. N.p., n.d. Web. 11 Feb. 2015.</span></p>
</div>
<div style="text-align: left;"><p><span class="font-size-1"><a title="">[5]</a> Peter Hebblethwaite; Paul VI, the First Modern Pope; Harper Collins Religious; 1993; p.118</span></p>
</div>
<div style="text-align: left;"><p><span class="font-size-1"><a title="">[6]</a> Adolf Hitler, in a speech on 12 April 1922 (Norman H. Baynes, ed. <i>The Speeches of Adolf Hitler</i>, April 1922-August 1939, Vol. 1 of 2, pp. 19-20, Oxford University Press, 1942)</span></p>
</div>
<div style="text-align: left;"><p><span class="font-size-1"><a title="">[7]</a> "The Future of an Illusion Paperback – June 30, 2011." <i>The Future of an Illusion: Sigmund Freud: 9781614270867: Amazon.com: Books</i>. N.p., n.d. Web. 11 Feb. 2015.</span></p>
</div>
<div style="text-align: left;"><p><span class="font-size-1"><a title="">[8]</a> "The Enduring Importance of Animal Models in Understanding Periodontal Disease." <i>Taylor & Francis</i>. N.p., n.d. Web. 11 Feb. 2015.</span></p>
</div>
<div style="text-align: left;"><p><span class="font-size-1"><a title="">[9]</a> "The Oxford Handbook of Human Motivation ." <i>Oxford Handbook of Human Motivation</i>. N.p., n.d. Web. 11 Feb. 2015.</span></p>
</div>
<div style="text-align: left;"><p><span class="font-size-1"><a title="">[10]</a> Boyer, Pascal. "Religious Thought and Behaviour as By-products of Brain Function." <i>Trends in Cognitive Sciences</i> 7.3 (2003): 119-24. Web.</span></p>
</div>
<div style="text-align: left;"><p><span class="font-size-1"><a title="">[11]</a> "Cognitive StudiesVol. 10 (2003) No. 1 P 76-92." <i>Developmental and Computational Neuroscience Approaches to Cognition: The Case of Generalization</i>. N.p., n.d. Web. 11 Feb. 2015.</span></p>
</div>
<div><p style="text-align: left;"><span class="font-size-1"><a title="">[12]</a> Zuckerman, M., J. Silberman, and J. A. Hall. "The Relation Between Intelligence and Religiosity: A Meta-Analysis and Some Proposed Explanations." <i>Personality and Social Psychology Review</i> 17.4 (2013): 325-54. Web.</span></p>
</div>
</div>
</div>
</div>
</div>5 Questions Christians are Always Asking Atheiststag:atheistnexus.org,2015-02-03:2182797:BlogPost:25632182015-02-03T17:27:54.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<div class="view attribution-view clear-float" id="yui_3_16_0_rc_1_1_1398800142311_9945"><p class="separator"><a href="http://1.bp.blogspot.com/-nLXEXsetVLE/U2AApzXEkNI/AAAAAAAABl0/Z3cp-mmWsF8/s1600/3350995960_c61c02769c_o.jpg"><img border="0" height="266" src="https://images-blogger-opensocial.googleusercontent.com/gadgets/proxy?url=http%3A%2F%2F1.bp.blogspot.com%2F-nLXEXsetVLE%2FU2AApzXEkNI%2FAAAAAAAABl0%2FZ3cp-mmWsF8%2Fs1600%2F3350995960_c61c02769c_o.jpg&container=blogger&gadget=a&rewriteMime=image%2F*" width="400"></img></a></p>
<p class="separator"><a class="owner-name truncate" href="https://www.flickr.com/photos/35703605@N06/" title="Go to Atheist Bus Canada's photostream"><font><font color="#000000" size="1">Atheist Bus Canada </font></font><font>Atheist Bus -…</font></a></p>
</div>
<div class="view attribution-view clear-float" id="yui_3_16_0_rc_1_1_1398800142311_9945"><p class="separator"><a href="http://1.bp.blogspot.com/-nLXEXsetVLE/U2AApzXEkNI/AAAAAAAABl0/Z3cp-mmWsF8/s1600/3350995960_c61c02769c_o.jpg"><img border="0" height="266" src="https://images-blogger-opensocial.googleusercontent.com/gadgets/proxy?url=http%3A%2F%2F1.bp.blogspot.com%2F-nLXEXsetVLE%2FU2AApzXEkNI%2FAAAAAAAABl0%2FZ3cp-mmWsF8%2Fs1600%2F3350995960_c61c02769c_o.jpg&container=blogger&gadget=a&rewriteMime=image%2F*" width="400"/></a></p>
<p class="separator"><a class="owner-name truncate" href="https://www.flickr.com/photos/35703605@N06/" title="Go to Atheist Bus Canada's photostream"><font><font color="#000000" size="1">Atheist Bus Canada </font></font><font>Atheist Bus - Toronto</font></a></p>
</div>
<p><font face="Times, Times New Roman, serif"><font color="#37404E"><font>There is an invisible creature that follows me everywhere I go. It reads my mind and knows my deepest secrets. The creature loves me, but it is jealous and will punish me if I don't love it back. Since it reads my mind, the creature can even punish me for my thoughts. I must never have doubts about its complete power over me or I will be made to suffer </font></font><font class="text_exposed_show" color="#37404E">horribly. I would do anything for the creature, even die or kill, because to do otherwise is to be doomed. The creature rewards me when I’m good. Sometimes it grants me wishes. If I am very good, when I die I will get to spend forever on my knees worshipping at the creatures feet. If you don’t believe in the creature as I do, you are a fool and you are damned for all eternity.<br/><br/>“If you have doubts, it means the Devil is at work. You must push those doubts out of your minds through prayer.” The Reverend Sun Myung Moon<br/><br/><b>1. “Can you prove that there is no god?”</b><br/><br/>The burden of proof is on he/she who makes the assertion. If I say I have a hundred dollar bill in my pocket and you don’t believe me, it is up to me to show you the bill. It is not your responsibility to prove I'm lying. No one can prove that there are no pixies, leprechauns, or other inventions of the human imagination and no one should have to. "Extraordinary claims require extraordinary evidence," Carl Sagan.<br/><b><br/>2. “Are you angry at god? Are you rebelling?”</b><br/><br/>Are you rebelling against Odin? Are you angry at Zeus? Do you not believe in Santa because you are angry with him?<br/><br/><b>3. “How can you see a sunset and not believe in god?”</b><br/><br/>The sunset is evidence that sunsets exist. It is not evidence for the existence of gods, devils, angels, or any other invisible creatures. How can you see a sunset and not believe in Apollo? After all, he is responsible for pulling the sun across the sky. Is it difficult for you to not believe in Apollo? Because, that is exactly how difficult it is for me to not believe in your god/goddess. The scientific explanation for sunsets seems more likely to me than the magical explanation. Absence of superstition in no way reduces the wonder and appreciation one feels when experiencing a beautiful sunset.<br/><br/><b>4. “If you experienced what I have experienced, would you believe?”</b><br/><br/>I grew up a Christian and religion was at the center of my life for many years. I experienced religious ecstasy, speaking in tongues, healing. I was born again and had a personal relationship with Jesus Christ. I got goose bumps and had prayers answered, just like Sufis, Muslims, Christians, Moonies, and the followers of Jim Jones. Religious ecstasy is only evidence that humans experience a wide range of cognitive and emotional states. Emotions are not evidence. I have experienced what you have. Have you ever experienced life without superstition? Have you had the courage to objectively evaluate the validity of your beliefs? Would the evidence you used to support your beliefs be different than the evidence used by any and every other religious cult (ancient stories/books, lots of other people who believe, personal spiritual experiences, the gut feeling that you are right)? Have you ever experienced the power and the uncertainty of being 100% responsible for your life?<br/><br/><b>5. “What if you are wrong? Isn't it better to be safe than sorry?”</b><br/><br/>Staying on the safe side would mean trying to appease all 4000 odd gods and goddesses that humans have loved and worshipped across history. Pleasing one deity usually means angering the others. Chances are, I only believe in one less god than you do. Put 4000 gods/goddesses in a hat and randomly pull one out (By chance, you were born into, and probably reflect, the religious tendencies of your family/culture). The odds that you picked the right god are 3999 to 1. In other words, I have 4000 gods and goddesses angry at me, but you have 3999.<br/><br/>What if YOU are wrong? Reality demonstrates its true nature every minute of every day. You don’t need an atheist to inform you that snakes can’t talk, death is permanent, and the physical laws of nature remain in effect regardless. Living one life as a true human adult is an incredible opportunity! Thinking, emoting, moving, changing, being are the real miracles.<br/><br/>The richness of the human experience is bathed in wonder. Superstition is not required to enjoy the awe and amazement of being alive. Being responsible for your own life is a heavy burden, but it defines what it means to be an adult. Developing the emotional maturity to deal with the realities of death, unanswered questions, and all of the other uncertainties of human life without resorting to magic and superstition requires courage and unyielding integrity. One must be committed to all truths regardless of how scary or difficult.<br/><br/>I have no issue with private, superstitious beliefs. If you believe that walking under ladders is bad luck, I think that is pretty harmless. But, when walking under ladders is made a crime, superstition becomes malevolent. When folks who avoid walking under ladders are given a tax break, then superstition causes unfairness. When monuments and texts dedicated to the avoidance of walking under ladders are displayed and sponsored by government, then superstition becomes exclusionary. When bad luck from walking under ladders is taught in public schools, then superstition becomes a force for ignorance.</font></font></p>
<p><font face="Times, Times New Roman, serif"><font class="text_exposed_show" color="#37404E"> </font></font></p>
<p><a href="http://edwardteach100.blogspot.com/2014/04/on-why-believing-is-not-option-for-me.html"><font face="Times, Times New Roman, serif"><font class="text_exposed_show" color="#37404E">http://edwardteach100.blogspot.com/2014/04/on-why-believing-is-not-option-for-me.html</font></font></a></p>Human Humans and Human Animalstag:atheistnexus.org,2014-06-16:2182797:BlogPost:24358042014-06-16T18:24:30.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<div align="center"><p><b><font>Human Humans and Human Animals</font></b></p>
</div>
<div align="center"><p></p>
</div>
<div align="center"><p><i><font>“<font color="#252525">In no case is an animal activity to be interpreted in terms of higher psychological processes if it can be fairly interpreted in terms of processes which stand lower in the scale of psychological evolution and development.” Morgan’s Canon…</font></font></i></p>
</div>
<div><p></p>
</div>
<div align="center"><p><b><font>Human Humans and Human Animals</font></b></p>
</div>
<div align="center"><p></p>
</div>
<div align="center"><p><i><font>“<font color="#252525">In no case is an animal activity to be interpreted in terms of higher psychological processes if it can be fairly interpreted in terms of processes which stand lower in the scale of psychological evolution and development.” Morgan’s Canon</font></font></i></p>
</div>
<div><p></p>
<table align="center" cellspacing="0" class="tr-caption-container">
<tbody><tr><td><p></p>
</td>
</tr>
<tr><td class="tr-caption"><p>Photo by Andrew Turner</p>
</td>
</tr>
</tbody>
</table>
<p></p>
</div>
<div><p><font>The truth is, we are animals with the <i>potential</i> to develop humanness. The behavioral trait that defines humanness is our ability to advance higher order critical thinking and empathy skills.<sup><sup><font color="windowtext" face="Arial, sans-serif">[1]</font></sup></sup> <sup><sup><font color="windowtext" face="Arial, sans-serif">[2]</font></sup></sup> While other animals have been shown to demonstrate both critical thought and empathy, the human capacity for cultivating these skills to high levels can distinguish <i>Human Humans</i> from <i>Human Animals</i> and all other animals. Again, higher order critical thinking and empathy are skills that require development. So, though genetics determine whether or not one falls into the biological category of Homo Sapiens, a subspecies in the Great Ape family,<sup><sup><font color="windowtext" face="Arial, sans-serif">[3]</font></sup></sup> the characteristics that define true humanness are not present in all members of the group, Homo Sapiens.</font></p>
</div>
<div><p></p>
</div>
<div><p><i><font>Human Animals</font></i><font> share the following behavioral traits with other species within the Great Ape family:</font></p>
</div>
<div><p></p>
</div>
<div><p><font>1.<font> </font></font><font>Formation of social structures</font></p>
</div>
<div><p><font>2.<font> </font></font><font>Establishment of pecking orders through demonstrations of dominance</font></p>
</div>
<div><p><font>3.<font> </font></font><font>Cooperation within social <i>ingroups</i> (groups of apes/people with whom one member identifies and belongs)</font></p>
</div>
<div><p><font>4.<font> </font></font><font>Competition/conflict with social <i>outgroups</i> (groups of apes/people that are different from the ones within which a single member belongs and identifies)</font></p>
</div>
<div><p><font>5.<font> </font></font><font>Use of language and d</font><font>evelopment of unique cultures</font><sup><sup><font color="windowtext" face="Arial, sans-serif">[4]</font></sup></sup></p>
</div>
<div><p></p>
</div>
<div><p><font>Examples include communications and social interactions between ingroups and outgroups of baboon troops, religious organizations, chimpanzee communities, civics clubs, armies, orangutan congresses, indigenous tribes, and academic institutions.</font></p>
</div>
<div><p></p>
</div>
<div><p><font>So, like all Great Apes, Human Animals form families and social groups. We LOVE our ingroups whether they be political, religious, regional, national, or sports related. We establish pecking orders within these groups based on dominance. On the playground, human dominance is often determined by who is biggest. As adults, dominance may be determined through superior IQ, physical strength, wealth, attractiveness, ambition, narcissism, or any number of other factors. Like chimpanzees, we will often cooperate with our ingroup, but we tend to view outgroups with suspicion. Our nature is to consider them threats and often to classify them as “lesser than” or even “evil.” This instinctual behavior is at the root of all forms of bigotry. From an evolutionary standpoint, it is easy to understand that a “go to” position for early humans of assuming people who are different are threats would be more adaptive than assuming their benevolence. In the natural environment, early humans were constantly at risk, so tendencies resulting in cautiousness aided in their survival.</font></p>
</div>
<div><p></p>
</div>
<div><p><font>Dictionary.com defines critical thinking as, “<font color="#333333">disciplined thinking that is clear, rational, open-minded, and informed by evidence.”<sup><sup><font color="#333333" face="Arial, sans-serif">[5]</font></sup></sup> The scientific method was born of critical thought. It is a process designed to factor out emotional human bias, such as ingroup/outgroup behaviors. Prior to the advent of the scientific method, our natural tendencies towards emotional bias and superstition were the primary stumbling blocks to the advancement of our species.<sup><sup><font color="#333333" face="Arial, sans-serif">[6]</font></sup></sup> <sup><sup><font color="#333333" face="Arial, sans-serif">[7]</font></sup></sup></font></font></p>
</div>
<div><p></p>
</div>
<div><p><font color="#37404E">By nature, critical thinking leads to more questions than answers. For a skilled critical thinker, issues are rarely simple. Because critical thought requires approaching a problem from many angles and many perspectives, solutions tend to come in shades of gray rather than black and white. H.L. Menken wasn’t far off the mark when he said, “For every complex problem, there is a simple solution… and it is always wrong.” The Human Animal within us is highly attracted to simple solutions.</font></p>
</div>
<div><p></p>
</div>
<div><p><font color="#37404E">Prior to the Enlightenment, humans used a simple catch-all to explain phenomena beyond our understanding, “God.” Few seemed to notice that “God” really wasn’t much of an explanation as, it simply moved the goal post back one yard. If God causes all things, what causes God? “God” is still the catch-all for unexplained phenomena. Fortunately, science been able to provide evidence based, rational explanations for most of the physical phenomena we encounter on a daily basis. The expanse of ignorance that Human Animals now use God to explain has shrunken to a tiny area.</font></p>
</div>
<div><p></p>
</div>
<div><p><font color="#37404E">Human Animals are not inclined towards critical thinking, and therefore, have a much greater tendency to see things in concrete, black and white terms. For them, conforming to a solution posed by dominant members of their ingroup is obviously the "right thing to do." They may interpret the failure of critical thinkers to do likewise as "crazy" or "stupid." Conforming to the decisions of dominant members of one’s group is a trait Human Animals share with their ape cousins. Critically evaluating the relative merits of dominant group members’ decisions is inherent to Human Human behavior.</font></p>
</div>
<div><p></p>
</div>
<div><p><font color="#37404E">Higher order critical thinking does not come naturally to any species. It requires ongoing training and self-discipline. The difference between the skilled critical thinker, or Human Human, and the average thinker, or Human Animal, is as dramatic as the difference between the physique of a pro bodybuilder and that of the average couch potato.</font></p>
</div>
<div><p></p>
</div>
<div><p><b><font color="#37404E">Teach's Precepts for Higher Order Critical Thinking:</font></b></p>
</div>
<div><p></p>
</div>
<div><p><font color="#37404E">1. High levels of certainly often correlates to low levels of critical thinking</font></p>
</div>
<div><p><font color="#37404E">2. Objective evidence and logic outweigh popular views and intuition</font></p>
</div>
<div><p><font color="#37404E">3. "Feelings" are not evidence. "Common Sense" is not evidence. "Faith" is not evidence. "How I was raised" is not evidence. "Anecdotes" are not evidence.</font></p>
</div>
<div><p><font color="#37404E">4. Changing positions when opposing evidence outweighs supporting evidence is the hallmark for critical thought.</font></p>
</div>
<div><p><font color="#37404E">5. Ego is the greatest obstacle to critical thought.</font></p>
</div>
<div><p></p>
</div>
<div><p><b><font color="#37404E">Examples from the Left and the Right of failure to critically evaluate an issue:</font></b></p>
</div>
<div><p></p>
</div>
<div><p><b><font color="#37404E">1. On the Left: </font></b><font color="#37404E">"All of my friends at the health food store say that immunizations are dangerous and cause autism. There are scientific studies that prove it. Immunizations are part of a conspiracy generated by the medical industrial complex."</font></p>
</div>
<div><p></p>
</div>
<div><p><font color="#37404E">Actually, there was a single flawed study linking immunization to autism. The results have not been replicated, and overwhelming scientific evidence supporting the need for immunization reflects the consensus of the scientific community.<sup><sup><font color="#37404E" face="Arial, sans-serif">[8]</font></sup></sup> So, if you believe that immunizations are bad, this belief is likely based on anecdotes, your need to conform to the group with whom you identify, failure to acknowledge objective evidence, and on your intuitive feelings of paranoia. In this case, you are demonstrating the behaviors of a Human Animal.</font></p>
</div>
<div><p></p>
</div>
<div><p><b><font color="#37404E">2. On the Right:</font></b><font color="#37404E"> "The guys on Talk Radio say that climate change is a myth. Many scientists agree. The whole global warming thing is a conspiracy perpetrated by liberal scientists who want grant money."</font></p>
</div>
<div><p></p>
</div>
<div><p><font color="#37404E">In truth, there has never been a more researched natural phenomenon in history than climate change. Overwhelming scientific evidence supports the validity of climate change caused by human activity and, again, this view is supported by a consensus of the scientific community. If you believe that climate change is not occurring or that it is not caused by human activity, this belief is likely based on anecdotes, failure to acknowledge objective evidence, your need to conform to the group with whom you identify, and on your intuitive feelings of paranoia.<sup><sup><font color="#37404E" face="Arial, sans-serif">[9]</font></sup></sup> Again, this line of reasoning (or absence thereof) is a manifestation of the Human Animal and NOT the Human Human.</font><a href="http://l.facebook.com/l.php?u=http%3A%2F%2Fwww.pnas.org%2Fcontent%2F107%2F27%2F12107.short&h=mAQEv4rfc&enc=AZOmPKFK0faHD0n_8PefgFVR2AcdWoMss9nXtjVVbvgrIjNNC1pIzy8f2Ch90bYft9RK-__IeItWV0CRKlOg7YjfQy4bY8R-pZjVbw3oXLGef8mQ2UemloGxl7ne9KD-LLcjZqpTLDDOgvF97SsEm8lk&s=1"></a></p>
<p><font color="#37404E"> </font></p>
</div>
<div><p></p>
</div>
<div><p><font color="#37404E">That said, alternative theories to the scientific consensus are a VERY good thing. On occasion, the scientist who disagrees with the consensus will be able to demonstrate strong opposing evidence. As opposing evidence accumulates and eventually outweighs supporting evidence, the scientific consensus will shift to the new position. So, if and when evidence opposing immunization and opposing climate change theory accumulates to the tipping point, good critical thinkers (like the scientific community) will shift to the new position.</font></p>
</div>
<div><p></p>
</div>
<div><p><font color="#37404E">I was once trying to teach a particularly difficult theory to a class. About half the class understood the theory and the other half didn't get it. When polled, 100% of the students who understood the theory said they found the theory “very interesting,” while 100% of those who failed to understand the theory described it as "stupid." It takes time and effort to become informed on complex issues and no effort at all to have a gut level response. Ironically, the informed individual is more likely to be uncertain about his/her position than is the uninformed individual.</font></p>
</div>
<div><p></p>
</div>
<div><p><font color="#454545">All organisms demonstrate a tendency to avoid harm. Even amoeba will avoid aversive stimuli. This is one of the basic premises of operant conditioning. Behaviors that yield pleasing results tend to be repeated. Behaviors that yield aversive results tend to not be repeated. Amoeba have no need for morality, only self-preservation.</font></p>
</div>
<div><p></p>
</div>
<div><p><font color="#454545">But, we are not amoeba. Humans are social animals requiring the assistance of other humans in order to survive in the natural environment. For Human Humans and Human Animals, self-preservation is interdependent with preservation of "the tribe." Other social animals like wolves, lions, and buffalo will predictably behave in ways that promote the health and safety of the ingroup over the health and safety of the individual. These animals engage in what might be considered benevolent behaviors even without benefit of higher cognitive functioning.</font></p>
</div>
<div><p></p>
</div>
<div><p><font color="#454545">Humans are the only species capable of higher order empathy. Empathy does not mean sympathy. Many species demonstrate sympathy. Higher order empathy requires the complex ability to cognitively attempt to see through the eyes of another. With huge effort, it is possible to put our collective ego aside and on some level understand the world from another person's perspective.</font></p>
</div>
<div><p></p>
</div>
<div><p><font color="#454545">Research on feral children has shown that empathy is a learned behavior.<sup><sup><font color="#454545" face="Arial, sans-serif">[10]</font></sup></sup> Empathy is an extremely difficult cognitive skill that Human Animals rarely try master. If all people were Human Humans and regularly employed this skill, conflict with each other and the destruction of other species could be virtually eliminated.</font></p>
</div>
<div><p></p>
</div>
<table border="1" cellspacing="0">
<tbody><tr><td valign="top" width="132"><div><p></p>
</div>
</td>
<td valign="top" width="309"><h3><font size="3"><font color="#333333" face=""Arial","sans-serif"">Empathy</font></font></h3>
</td>
<td valign="top" width="253"><h3><font size="3"><font color="#333333" face=""Arial","sans-serif"">Sympathy</font></font></h3>
</td>
</tr>
<tr><td valign="top" width="132"><div align="right"><p><a href="https://www.blogger.com/null"></a><a href="https://www.blogger.com/null"></a><b><font color="#333333">Definition</font></b></p>
</div>
</td>
<td valign="top" width="309"><div><p><font color="#333333">Understanding what others are feeling because you have experienced it yourself or can put yourself in their shoes.</font></p>
</div>
</td>
<td valign="top" width="253"><div><p><font color="#333333">Acknowledging another person's emotional hardships and providing comfort and assurance.</font></p>
</div>
</td>
</tr>
<tr><td valign="top" width="132"><div align="right"><p><b><font color="#333333">Example</font></b></p>
</div>
</td>
<td valign="top" width="309"><div><p><font color="#333333">I know it's not easy to lose weight because I have faced the same problems myself.</font></p>
</div>
</td>
<td valign="top" width="253"><div><p><font color="#333333">When people try to make changes like this (e.g.</font><a href="http://www.diffen.com/difference/Loose_vs_Lose"><font color="#333333"> </font></a><a href="http://www.diffen.com/difference/Loose_vs_Lose"><font color="#1155CC">lose</font></a><font color="#333333"> some weight) at first it seems difficult.</font></p>
</div>
</td>
</tr>
<tr><td valign="top" width="132"><div align="right"><p><b><font color="#333333">Relationship</font></b></p>
</div>
</td>
<td valign="top" width="309"><div><p><font color="#333333">Personal</font></p>
</div>
</td>
<td valign="top" width="253"><div><p><font color="#333333">Friends, family and community ( the experience of others) .</font></p>
</div>
</td>
</tr>
<tr><td valign="top" width="132"><div align="right"><p><b><font color="#333333">Nursing context</font></b></p>
</div>
</td>
<td valign="top" width="309"><div><p><font color="#333333">Relating with your patient because you have been in a similar situation or experience</font></p>
</div>
</td>
<td valign="top" width="253"><div><p><font color="#333333">Comforting your patient or their family</font></p>
</div>
</td>
</tr>
<tr><td valign="top" width="132"><div align="right"><p><b><font color="#333333">Scope</font></b></p>
</div>
</td>
<td valign="top" width="309"><div><p><font color="#333333">Personal, It can be one to many in some circumstances</font></p>
</div>
</td>
<td valign="top" width="253"><div><p><font color="#333333">From either one to another person or one to many (or one to a group).</font></p>
</div>
</td>
</tr>
</tbody>
</table>
<div><p><sup><font color="#333333"><sup><font face="Arial, sans-serif">[11]</font></sup></font></sup></p>
</div>
<div><p></p>
</div>
<div><p><font>Children raised in an environment devoid of contact with people, demonstrate neither of the behavioral traits that define humanness.<sup><sup><font color="windowtext" face="Arial, sans-serif">[12]</font></sup></sup> So, while all people are Human Animals not all people are Human Humans.</font></p>
</div>
<div><p></p>
</div>
<div><p><font>Take a look in the mirror. Are you a Human Human? If so, you are likely experiencing deep, meaningful relationships with other people. And, you also suffer deeply when you become aware of social injustices (homophobia, racism, genocide, intolerance, man’s inhumanity to man, etc.). You are not easily duped by the barrage of manipulative, emotionally charged, nonsense you receive from the media, the pulpit, and the political arena. You are likely able to override primitive emotions to some degree, enabling you to maintain a healthy body and a stable mind. Your moral code comes from evaluating an ideal based on universals such as “harm done,” “fairness,” and “empathetic understanding” rather than from “how you were raised,” cultural norms, or some religious or law text.</font></p>
</div>
<div><p></p>
</div>
<div><p><font>We are all Human Animals, and this is not a bad thing. We are literally wired to be such and wouldn’t want to throw the baby out with the bathwater. However, some of these animal traits are not adaptive in a civilized culture. With hard work, metacognition, courage, and a tireless commitment to intellectual honesty, we can all come closer and closer to being truly human.</font></p>
</div>
<div><p></p>
</div>
<div><p></p>
</div>
<div><p></p>
</div>
<div><p></p>
</div>
<div><p></p>
</div>
<div dir="ltr"></div>
<div><p></p>
<hr align="left" size="1" width="33%"/><p></p>
<div><div><p><sup><sup><font color="windowtext" face="Arial, sans-serif">[1]</font></sup></sup> <font face="'Times New Roman', serif">Nussbaum, Martha Craven. <i>Cultivating Humanity: A Classical Defense of Reform in Liberal Education</i>. Cambridge, MA: Harvard UP, 1997. Print.</font></p>
</div>
</div>
<div><div><p><sup><sup><font color="windowtext" face="Arial, sans-serif">[2]</font></sup></sup> <font face="'Times New Roman', serif">Elder, Lina. "Critical Thinking Across the Disciplines." <i>Inquiry</i> Winter XVI.2 (1996): n. pag. Web. 28 May 2014. </font></p>
</div>
</div>
<div><div><p><sup><sup><font color="windowtext" face="Arial, sans-serif">[3]</font></sup></sup> <font face="'Times New Roman', serif">"Mammal Species of the World : A Taxonomic and Geographic Reference."<i>(Book, 2006) [WorldCat.org]</i>. N.p., n.d. Web. 09 June 2014.</font></p>
</div>
</div>
<div><div><p><sup><sup><font color="windowtext" face="Arial, sans-serif">[4]</font></sup></sup> <font face="'Times New Roman', serif">Kappeler, Peter M., and Joan B. Silk. <i>Mind the Gap: Tracing the Origins of Human Universals</i>. Berlin: Springer, 2010. Print.</font></p>
</div>
</div>
<div><div><p><sup><sup><font color="windowtext" face="Arial, sans-serif">[5]</font></sup></sup> <font face="Verdana, sans-serif">Open Source. (2014 ). <i>Critical Thinking.</i> Available: <a href="http://www.reference.com/browse/critical+thinking?s=t">http://www.reference.com/browse/critical+thinking?s=t</a>. Last accessed 28th May 2014.</font></p>
</div>
</div>
<div><div><p><sup><sup><font color="windowtext" face="Arial, sans-serif">[6]</font></sup></sup> <font face="'Times New Roman', serif">Harris, William. "How the Scientific Method Works." <i>HowStuffWorks</i>. HowStuffWorks.com, 14 Jan. 2008. Web. 09 June 2014.</font></p>
</div>
</div>
<div><div><p><sup><sup><font color="windowtext" face="Arial, sans-serif">[7]</font></sup></sup> <font face="'Times New Roman', serif">Killeen, P. R. "Superstition: A Matter of Bias, Not Detectability." <i>Science</i>199.4324 (1978): 88-90. Web.</font></p>
</div>
</div>
<div><div><p><sup><sup><font color="windowtext" face="Arial, sans-serif">[8]</font></sup></sup> <font face="'Times New Roman', serif">Destefano, Frank, Cristofer S. Price, and Eric S. Weintraub. "Increasing Exposure to Antibody-Stimulating Proteins and Polysaccharides in Vaccines Is Not Associated with Risk of Autism." <i>The Journal of Pediatrics</i> 163.2 (2013): 561-67. Web.</font></p>
</div>
</div>
<div><div><p><sup><sup><font color="windowtext" face="Arial, sans-serif">[9]</font></sup></sup> <font face="'Times New Roman', serif">Anderegg, W. R. L., J. W. Prall, J. Harold, and S. H. Schneider. "Expert Credibility in Climate Change." <i>Proceedings of the National Academy of Sciences</i> 107.27 (2010): 12107-2109. Web.</font></p>
</div>
</div>
<div><div><p><sup><sup><font color="windowtext" face="Arial, sans-serif">[10]</font></sup></sup> <font face="'Times New Roman', serif">"Feral Children and Clever Animals: Reflections on Human Nature." <i>Choice Reviews Online</i> 31.08 (1994): 31-4641. Web.</font></p>
</div>
</div>
<div><div><p><sup><sup><font color="windowtext" face="Arial, sans-serif">[11]</font></sup></sup> <font color="#333333" face="Georgia, serif">"Empathy vs Sympathy." <i>Diffen.com.</i> Diffen LLC, n.d. Web. 1 Jun 2014.</font><font color="#333333" face=""Georgia","serif""> </font><a href="http://www.diffen.com/difference/Empathy_vs_Sympathy"><font color="#07798E" face=""Georgia","serif"">http://www.diffen.com/difference/Empathy_vs_Sympathy</font></a></p>
</div>
</div>
<div><div><p><sup><sup><font color="windowtext" face="Arial, sans-serif">[12]</font></sup></sup> <font face="'Times New Roman', serif">Plessis, Susa Du, and Jan Strydom. "Chapter 7." <i>The Right to Read :Beating Dyslexia and Other Learning Disabilities</i>. N.p.: n.p., 2000. N. pag. Print.</font></p>
<p></p>
<p><a href="http://edwardteach100.blogspot.com/2014/06/human-humans-and-human-animals-are-you.html"><font face="'Times New Roman', serif">http://edwardteach100.blogspot.com/2014/06/human-humans-and-human-animals-are-you.html</font></a></p>
</div>
</div>
</div>Human Overhaul 365tag:atheistnexus.org,2014-05-15:2182797:BlogPost:24233982014-05-15T13:35:55.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p>This is a little cheesy, but I put together a self'-help blog to cover strategies I implemented towards physical, emotional, and cognitive improvements:</p>
<p></p>
<p><a href="http://humanoverhaul365.blogspot.com/2014/05/a-complete-human-overhaul-journey-begins.html" target="_blank">Human Overhaul 365…</a></p>
<p></p>
<p></p>
<div dir="ltr" style="text-align: left;"><div class="separator" style="clear: both; text-align: center;"></div>
</div>
<p>This is a little cheesy, but I put together a self'-help blog to cover strategies I implemented towards physical, emotional, and cognitive improvements:</p>
<p></p>
<p><a href="http://humanoverhaul365.blogspot.com/2014/05/a-complete-human-overhaul-journey-begins.html" target="_blank">Human Overhaul 365</a></p>
<p></p>
<p></p>
<div dir="ltr" style="text-align: left;"><div class="separator" style="clear: both; text-align: center;"><a href="http://2.bp.blogspot.com/-ERoJvSUq8gI/U2PTbjE4fbI/AAAAAAAAAGI/Fh2X4_8F8wQ/s1600/1279358164_a580274563_o.jpg" style="margin-left: 1em; margin-right: 1em;"><span style="font-size: large;"><img border="0" src="http://2.bp.blogspot.com/-ERoJvSUq8gI/U2PTbjE4fbI/AAAAAAAAAGI/Fh2X4_8F8wQ/s1600/1279358164_a580274563_o.jpg" height="640" width="489"/></span></a></div>
<div class="separator" style="clear: both; text-align: center;"><span style="background-color: white; font-size: large;"> </span></div>
<div class="separator" style="clear: both; text-align: center;"><a class="owner-name truncate" href="https://www.flickr.com/photos/swanksalot/" style="display: inline !important; font-family: 'Proxima Nova', 'helvetica neue', helvetica, arial, sans-serif; line-height: 1; overflow: hidden; padding-bottom: 4px; xg-p: relative; text-decoration: none; text-overflow: ellipsis; top: -1px; white-space: nowrap; width: 213px;" title="Go to Seth Anderson's photostream"><span style="background-color: #b45f06; color: white; font-size: large;"><span style="display: inline !important; font-family: 'Proxima Nova', 'helvetica neue', helvetica, arial, sans-serif; line-height: 1; overflow: hidden; padding-bottom: 4px; xg-p: relative; text-decoration: none; text-overflow: ellipsis; top: -1px; white-space: nowrap; width: 213px;">Seth Anderson </span><span style="display: inline !important; font-family: 'Proxima Nova', 'helvetica neue', helvetica, arial, sans-serif; line-height: 18px; overflow: hidden; padding-bottom: 4px; xg-p: relative; text-decoration: none; text-overflow: ellipsis; top: -1px; white-space: nowrap; width: 213px;">Wheel of transformation</span></span></a></div>
<div class="separator" style="clear: both; text-align: left;"><span style="font-size: large;"> </span></div>
<div class="separator" style="clear: both; text-align: left;"><span style="font-size: large;"> </span></div>
<div class="separator" style="clear: both; text-align: left;"><a href="http://4.bp.blogspot.com/-2vhbOhmrMTw/U2KgfKobKbI/AAAAAAAABJk/Jm6DRxcAofg/s1600/Clipboard01.jpg" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em; text-align: center;"><span style="font-size: large;"><img border="0" src="http://4.bp.blogspot.com/-2vhbOhmrMTw/U2KgfKobKbI/AAAAAAAABJk/Jm6DRxcAofg/s1600/Clipboard01.jpg" height="400" width="275"/></span></a><span style="font-size: large;">Four months prior to my 50th birthday, I had a bad motorcycle accident resulting in a broken back, broken ribs, a collapsed lung, and bleeding kidneys. By the time my birthday arrived, I had physically recovered from injuries to a large degree, but my body was still in pretty bad shape. Likewise, my thinking was muddy, and my spirit was weighed down with hopelessness. Despite a great job, lots of good friends, and a loving family, I had a deep sense that my best years were behind me. I felt old, sad, in pain, and without purpose. I needed a complete human overhaul! </span></div>
<div class="separator" style="clear: both; text-align: left;"><span style="font-size: large;"> </span></div>
<div class="separator" style="clear: both; text-align: left;"><span style="font-size: large;">Having worked in the field of psychology as a counselor and teacher for most of my adult life, I had a great deal of under-applied knowledge about how to improve the mind and spirit. I had also spent much of my adult life as a fitness geek. I continue to voraciously consume reams of research on physical and mental health.</span></div>
<div style="clear: both;"><span style="font-size: large;"> </span></div>
<div style="clear: both;"><span style="font-size: large;">On my 50th birthday, I set out a plan to improve myself physically, cognitively, and emotionally. I created an excel spreadsheet (<a href="https://docs.google.com/spreadsheet/ccc?key=0AlYJDcTQhOacdG9SY1ZWdFV2V1V3dlpUM0cyT0hNenc&usp=drive_web#gid=0" target="_blank">part1</a> and <a href="https://docs.google.com/spreadsheet/ccc?key=0AlYJDcTQhOacdHROLTkwdUVWUzdtRHlDVDc4Z3hmUGc&usp=drive_web#gid=0" target="_blank">part2</a>) to document my moods, exercise, diet, supplements, sleep, and medication. The results at six months were fairly dramatic. <b>Below </b>shows off my physical transformation:</span><br/> <span style="font-size: large;"><br/></span> At 6 months<br/> <a href="http://4.bp.blogspot.com/-VL4jpyWGFig/U2KglM7XALI/AAAAAAAABJs/aMhOYnQGGL4/s1600/Clipboard02.jpg" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em; text-align: center;"><span style="font-size: large;"><img border="0" src="http://4.bp.blogspot.com/-VL4jpyWGFig/U2KglM7XALI/AAAAAAAABJs/aMhOYnQGGL4/s1600/Clipboard02.jpg" height="400" width="290"/></span></a><br/> <span style="font-size: large;">On my 51st birthday, I took a fitness test and scored in the 100th percentile for A 30 YEAR OLD! At 51, I also met the girl of my dreams and accepted numerous leadership roles at my college! See my <a href="http://humanoverhaul365.blogspot.com/2014_05_01_archive.html" target="_blank">other posts</a> (links are in the column on the left of your screen) for articles on how I did i</span>t.<br/> <br/> <br/> <br/> <br/> <br/> <br/> <br/> <br/> <br/> This one is at the 1 year mark<br/><div class="separator" style="clear: both; text-align: center;"><a href="http://2.bp.blogspot.com/-HFQPI8wqclQ/U3LAHrYxBxI/AAAAAAAAAHQ/xS1Y_hzfAeM/s1600/DSCN1113.jpg" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"><img border="0" src="http://2.bp.blogspot.com/-HFQPI8wqclQ/U3LAHrYxBxI/AAAAAAAAAHQ/xS1Y_hzfAeM/s1600/DSCN1113.jpg" height="400" width="253"/></a></div>
</div>
</div>What's YOUR Theme?tag:atheistnexus.org,2014-04-27:2182797:BlogPost:24156762014-04-27T20:35:46.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p class="separator"><a href="http://humanoverhaul365.blogspot.com/2014/04/playing-race-card.html">http://humanoverhaul365.blogspot.com/2014/04/playing-race-card.html</a></p>
<div><p></p>
</div>
<div><p><a href="http://4.bp.blogspot.com/-DSQ6kJ8QnHo/U1fPaaqdsMI/AAAAAAAAAFI/dCqhfcY4QfU/s1600/images+(3).jpg"><img border="0" height="266" src="https://images-blogger-opensocial.googleusercontent.com/gadgets/proxy?url=http%3A%2F%2F4.bp.blogspot.com%2F-DSQ6kJ8QnHo%2FU1fPaaqdsMI%2FAAAAAAAAAFI%2FdCqhfcY4QfU%2Fs1600%2Fimages%2B(3).jpg&container=blogger&gadget=a&rewriteMime=image%2F*" width="400"></img></a></p>
</div>
<div><p>Freud was keen on the influence of early experiences on personality development. Recently, I explored memories of my own solitary, fantasy, play themes from…</p>
</div>
<p class="separator"><a href="http://humanoverhaul365.blogspot.com/2014/04/playing-race-card.html">http://humanoverhaul365.blogspot.com/2014/04/playing-race-card.html</a></p>
<div><p></p>
</div>
<div><p><a href="http://4.bp.blogspot.com/-DSQ6kJ8QnHo/U1fPaaqdsMI/AAAAAAAAAFI/dCqhfcY4QfU/s1600/images+(3).jpg"><img border="0" height="266" src="https://images-blogger-opensocial.googleusercontent.com/gadgets/proxy?url=http%3A%2F%2F4.bp.blogspot.com%2F-DSQ6kJ8QnHo%2FU1fPaaqdsMI%2FAAAAAAAAAFI%2FdCqhfcY4QfU%2Fs1600%2Fimages%2B(3).jpg&container=blogger&gadget=a&rewriteMime=image%2F*" width="400"/></a></p>
</div>
<div><p>Freud was keen on the influence of early experiences on personality development. Recently, I explored memories of my own solitary, fantasy, play themes from childhood. I chose solitary play, when a child is playing alone with only simple toys and his/her imagination, because the manifestations are a pure reflection of the child's inner world. What I found was a fascinating consistency in patterns that have endured throughout my life! I discussed the phenomenon with my girlfriend who was, likewise, able to recognize play themes that became woven into the very fabric of her personal identity and sense of purpose.</p>
</div>
<div><p></p>
</div>
<div><p>I grew up on the coast of South Carolina. My parents took me to the beach as regularly as parents from other places might have taken their kids to the park. After swimming, body surfing, and feeding some of my snacks to the seagulls, I always built an elaborate sand castle with multiple walls and moats to protect the it from the incoming tide. I gained huge satisfaction from re-fighting this losing battle of frantically fortifying my creation against ever advancing waves. The theme of the underdog, bravely taking on impossible odds and fighting until the end resonated deep inside me.</p>
</div>
<div><p></p>
</div>
<div><p>At home, I liked to play smash up derby with my toy cars. I would repeatedly crash two cars together in head on collisions until one of the cars capsized. The winner would be the car that landed with all four tires on the ground. Some cars were “good guys” others were “bad guys.” My favorite car was the oldest, most beat up vehicle in my collection. The dilapidated car was an old veteran of the game, battle worn and over the hill, but with such heart that, win or lose, it would fight with its last ounce of strength.</p>
</div>
<div><p></p>
</div>
<div><p>Fighting for the underdog continues to provide a deep sense of meaning in my life. For good or ill, I equate suffering for a good cause with nobility. I have always considered myself peculiar in that, while “winning” in a challenge is nice, it has never been my top priority. For me, "fighting the good fight” takes precedence above all else. Giving my best effort and enduring whatever difficulties that might emerge, represent my gut level measures of success. Winning and goal achievement are wonderful, but of much less importance than giving my all.</p>
</div>
<div><p></p>
</div>
<div><p>My girlfriend's early fantasy play involved pretending to organize elaborate fashion shows. Her role was always to provide support and encouragement to aid her imaginary friends in successfully “starring” in the shows. For my girlfriend, her own inner knowledge of the importance of her contributions and NOT recognition from others, defined nobility of character. As an adult, creativity, fashion, and working “behind the scenes” continue to shape her personal sense of meaning.</p>
</div>
<div><p></p>
</div>
<div><p>What were the themes of your fantasy play as a child? Do those themes continue to play out in your adult life? I would love to hear your stories.</p>
</div>Playing the "Race Card"tag:atheistnexus.org,2014-04-26:2182797:BlogPost:24148082014-04-26T15:55:10.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p><a href="http://humanoverhaul365.blogspot.com/2014/04/playing-race-card.html">http://humanoverhaul365.blogspot.com/2014/04/playing-race-card.html</a></p>
<p><a href="http://api.ning.com:80/files/PfEgRPHovLS4YX*l7fzSV0DisWJnApfHl3iuVeqi*KG*E4W96MbW7uLP4a-3aoFVRfTk3nbbL0rKQ9hxRzAnmLMWG3Z4iVO5/TheRaceCard.jpg" target="_self"><img class="align-full" src="http://api.ning.com:80/files/PfEgRPHovLS4YX*l7fzSV0DisWJnApfHl3iuVeqi*KG*E4W96MbW7uLP4a-3aoFVRfTk3nbbL0rKQ9hxRzAnmLMWG3Z4iVO5/TheRaceCard.jpg" width="392"></img></a></p>
<p>The first college course I taught was a section on General Psychology in Charleston, SC. The demographics of my class was about half white kids and…</p>
<p><a href="http://humanoverhaul365.blogspot.com/2014/04/playing-race-card.html">http://humanoverhaul365.blogspot.com/2014/04/playing-race-card.html</a></p>
<p><a href="http://api.ning.com:80/files/PfEgRPHovLS4YX*l7fzSV0DisWJnApfHl3iuVeqi*KG*E4W96MbW7uLP4a-3aoFVRfTk3nbbL0rKQ9hxRzAnmLMWG3Z4iVO5/TheRaceCard.jpg" target="_self"><img src="http://api.ning.com:80/files/PfEgRPHovLS4YX*l7fzSV0DisWJnApfHl3iuVeqi*KG*E4W96MbW7uLP4a-3aoFVRfTk3nbbL0rKQ9hxRzAnmLMWG3Z4iVO5/TheRaceCard.jpg" width="392" class="align-full"/></a></p>
<p>The first college course I taught was a section on General Psychology in Charleston, SC. The demographics of my class was about half white kids and half black kids. We were covering the chapter on Abnormal Psychology, so I gave what I thought would be a fun weekend assignment. Over the weekend, each student was to engage in an "abnormal" behavior in a public place, then record peoples' responses. Students were given safety instructions NOT to break any laws or institutional rules (example: talking in the library) and they were NOT to engage in any behaviors that might be considered threatening to people or dangerous in any way. I gave a few examples of "safe" abnormal behaviors like talking to self, standing backwards in an elevator, invading personal space in conversation, etc..</p>
<p>Monday morning, I was shocked at the outcome of this assignment. Despite following my safety instructions, almost universally, the black kids got into trouble with law enforcement, store managers, and other authority figures in the community. Apparently, if you are a black kid in Charleston, behaving abnormally results in trouble. Conversely, white kids who behaved abnormally, received the expected responses of laughing, pointing, ignoring, gossiping and avoiding.</p>
<p>Later, when I recount this story to subsequent classes, white students are typically surprised (as I was) at the differences in public responses to black versus white kids. However, black students hearing the story for the first time, know what the outcome will be before I ever say it. One middle aged, African American student, who had children of her own, reported that she raised her kids to keep their hands in full view at all times whenever they were in a store or mall. As a white parent of white children, having my kids keep their hands in full view is something that never would have crossed my mind.</p>
<p>A few years later, an African American colleague of mine, Anna, requested my help with her son who had recently gotten in trouble at school. Her son, John, was an honor roll, high school student, with no history of school behavior problems. However, he got into a conflict with another student and became defiant when the principal interveined. His punishment for defiance was expulsion for the remainder of the year. John subsequently apologized to the principal for talking back, but a hearing was set to confirm expulsion.</p>
<p>Anna had me and several other professionals who were familiar with John to speak on his behalf at the hearing. The Discipline Board consisted of three white, male, principals and one white, female principal. I felt the hearing went very much in John's favor, so I was shocked when the panel ruled to go through with the expulsion. I approached the Chair of the Discipline Board and made the comment that an all white, all principal, and nearly all male panel was inappropriate. The Chair dramatically raised both hands in the air and yelled out, "I knew it! I knew someone just had to play the race card!" Anna was embarrassed that I brought it up. It is very bad form for victims of racism to complain about their mistreatment.</p>
<p>Three months later, I was back before the same Discipline Board in support of another high school kid. On this occasion, another honor roll student with no history of behavior problems, had gotten in big trouble. This second troublemaker was, Suzie, a cute, white, female who broke federal law by distributing marijuana brownies to her classmates. The legal penalty for this act is up to 5 years in prison and up to $250,000 fine. Again, the hearing seemed to go well for the student. The ruling? She was told never to do that again and was allowed to return to school the next day.</p>
<p>The Race Card: A term invented by bigots. It is used to shut down victims of bigotry.</p>Are we Dancing Bears?tag:atheistnexus.org,2014-04-16:2182797:BlogPost:24098412014-04-16T12:00:00.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p><a href="http://edwardteach100.blogspot.com/2014/04/are-we-dancing-bears.html">http://edwardteach100.blogspot.com/2014/04/are-we-dancing-bears.html</a></p>
<div><div><img class="align-center" height="303" src="http://1.bp.blogspot.com/-rrQQ6T9elnM/U0WNiTVyH2I/AAAAAAAABd8/Rl4k-Cg_arg/s1600/download+(1).jpg" width="375"></img></div>
<div><p>If you want to understand a species, observe the behaviors of it's members over time. Bears have specific behaviors that have been exhibited throughout bear history. Bears forage, hibernate, are omnivorous, and so on. While the reactions of one bear in a particular situation may be unpredictable, the…</p>
</div>
</div>
<p><a href="http://edwardteach100.blogspot.com/2014/04/are-we-dancing-bears.html">http://edwardteach100.blogspot.com/2014/04/are-we-dancing-bears.html</a></p>
<div><div><img src="http://1.bp.blogspot.com/-rrQQ6T9elnM/U0WNiTVyH2I/AAAAAAAABd8/Rl4k-Cg_arg/s1600/download+(1).jpg" class="align-center" width="375" height="303"/></div>
<div><p>If you want to understand a species, observe the behaviors of it's members over time. Bears have specific behaviors that have been exhibited throughout bear history. Bears forage, hibernate, are omnivorous, and so on. While the reactions of one bear in a particular situation may be unpredictable, the general behaviors of the species are extremely predictable.</p>
<p> </p>
<p>Likewise, observation of the human species yields similar understanding. Throughout history humans have always organized into groups, aspired towards moving up in their respective social pecking orders, developed religious systems, fought with groups having opposing views and with groups having desired resources, and so on.</p>
<p> </p>
<p>It is possible to train a bear to dance and do tricks. A bear can rise above its nature and learn to do things beyond the scope of the average bear. However, training a bear to dance does not change the behavior of the bear species. The dancing bear is an anomaly and will likely be rejected by other bears in nature.</p>
<p> </p>
<p>Individual humans can also rise above their base nature and, using the highly complex human mind, learn to live as relatively enlightened, rational animals. But, an enlightened individual does not change the overall patterns of the human species. Socrates, Plato, Jesus, Gandhi, the Buddha all demonstrated varying levels of enlightened understanding... but they were anomalies and were ultimately rejected by their species.</p>
<p> </p>
<p>The species did not become enlightened by the efforts of enlightened individuals. Instead, the human species simply incorporated concrete aberrations of abstract, enlightened messages into the same systems and patterns that have always existed in humans (i.e. forming groups, moving up in social pecking orders, fighting with groups that have opposing view points, etc.).</p>
<p> </p>
<p>I postulate that enlightened beings are no more than dancing bears. They are an interesting anomaly having little impact on the species at large. Bears behave like bears. Let them be bears. Humans behave like humans. Let them be humans. We each have the opportunity to develop our minds and bodies far beyond those of the typical human, but that will not change the nature of the human species.</p>
</div>
</div>On a Better Metaphor for Consciousnesstag:atheistnexus.org,2014-04-15:2182797:BlogPost:24093952014-04-15T16:30:00.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p></p>
<p class="separator"><a href="http://api.ning.com:80/files/wfufAsrgkK9U1H0Xmv9upnAsBvOMN-P9LcNL8QUNsHUsaB6VwWlsDKEV*CR3bz82-MP44DrrObN5uiNehnnaphfw0E3EhN02/download2.jpg" target="_self"><img class="align-center" height="234" src="http://api.ning.com:80/files/wfufAsrgkK9U1H0Xmv9upnAsBvOMN-P9LcNL8QUNsHUsaB6VwWlsDKEV*CR3bz82-MP44DrrObN5uiNehnnaphfw0E3EhN02/download2.jpg" width="312"></img></a></p>
<div><p></p>
</div>
<div><p></p>
</div>
<div><p><span>Until very recently, consciousness was considered sort of a “black box.” A mysterious phenomenon too complex to even attempt to explain in any objective manner. However, new theories are beginning to …</span></p>
</div>
<p></p>
<p class="separator"><a href="http://api.ning.com:80/files/wfufAsrgkK9U1H0Xmv9upnAsBvOMN-P9LcNL8QUNsHUsaB6VwWlsDKEV*CR3bz82-MP44DrrObN5uiNehnnaphfw0E3EhN02/download2.jpg" target="_self"><img src="http://api.ning.com:80/files/wfufAsrgkK9U1H0Xmv9upnAsBvOMN-P9LcNL8QUNsHUsaB6VwWlsDKEV*CR3bz82-MP44DrrObN5uiNehnnaphfw0E3EhN02/download2.jpg" width="312" class="align-center" height="234"/></a></p>
<div><p></p>
</div>
<div><p></p>
</div>
<div><p><span>Until very recently, consciousness was considered sort of a “black box.” A mysterious phenomenon too complex to even attempt to explain in any objective manner. However, new theories are beginning to </span><span class="text_exposed_show">shine a light on the nature of consciousness. The following is my interpretation of how consciousness operates.<br/> <br/> “Stream of consciousness,” is a misleading and ultimately inaccurate metaphor. “Hive of consciousness” or “city of consciousness” are better fits for our current understanding of the phenomenon. “Stream” implies a linear progression, thoughts moving forward single file. Human thought patterns more closely resemble a popcorn popper than an assembly line. <br/> <br/> Consider my average morning. The alarm clock goes off and I enter a vague level of wakeful consciousness. The following blur of thoughts emerge in no particular order<br/> <br/> “Where is that alarm clock ugh I hate that noise my back hurts it’s cold outside no way its already 6:30 I have to pee man I don’t want to get up my mouth is so dry shit its cold in here I have so much to do today I bet the dog needs to go out what time is my first class ok five more minutes”<br/> <br/> In less than few seconds, this barrage of thoughts has been condensed into a gut feeling, the cognitive shortcut that automatically tallies up every thought and feeling I have in reaction to the alarm going off and prompts me to act… “I want more sleep,” so I hit snooze. <br/> <br/> Hundreds of thoughts whirl in a nonsensical storm of neuronal firings. Then, they are bundled into chunks called gut feelings, and the gut feelings sometimes prompt us to take some kind of action. The whole process is very quick and very constant.<br/> <br/> If we use the analogy of a factory, it would look something like this:<br/> <br/> 1. Different objects (thoughts) are thrown from all directions into a hopper<br/> 2. At varying levels of hopper volume, the objects are bagged up (gut feelings)<br/> 3. The bags are conveyed to three different locations<br/> 4. Most of the bags will go to the incinerator (the forgetting process)<br/> 5. Some, will be warehoused for later use (memory)<br/> 6. And, the remaining bags will trigger the “on” switch for any of a wide array of machines (taking some kind of action)<br/> <br/> In the same way that our bodies are composed of millions of cells living out their lives as tiny coordinated components of the universe that is your physical self, your consciousness is composed of millions of random thoughts firing from different parts of the brain and living out their sparks of existence as coordinated components of the universe that is your conscious self.</span></p>
<p></p>
<p><span class="text_exposed_show"><a href="http://edwardteach100.blogspot.com/2014/04/on-better-metaphor-for-consciousness.html">http://edwardteach100.blogspot.com/2014/04/on-better-metaphor-for-consciousness.html</a></span></p>
</div>On Snobberytag:atheistnexus.org,2014-04-14:2182797:BlogPost:24088962014-04-14T17:06:34.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p><a href="http://api.ning.com:80/files/LzTY94yzCcJEQ7qpnEaXavUnDnj07BRipGp56ecOWTn3d245bysIjG7ZhFrgSNVTf37x5tQwJF1YUuuJTgxnOVRPO5AWPTNo/images3.jpg" target="_self"><img class="align-center" src="http://api.ning.com:80/files/LzTY94yzCcJEQ7qpnEaXavUnDnj07BRipGp56ecOWTn3d245bysIjG7ZhFrgSNVTf37x5tQwJF1YUuuJTgxnOVRPO5AWPTNo/images3.jpg" width="190"></img></a></p>
<p></p>
<p></p>
<p>I had a fairly unpleasant high school experience. In the middle of my tenth grade year, my family moved from the coast of South Carolina to the Piedmont of North Carolina. My new high school had two distinct social groups: tobacco farmers’ kids and the privileged children of fairly affluent…</p>
<p><a href="http://api.ning.com:80/files/LzTY94yzCcJEQ7qpnEaXavUnDnj07BRipGp56ecOWTn3d245bysIjG7ZhFrgSNVTf37x5tQwJF1YUuuJTgxnOVRPO5AWPTNo/images3.jpg" target="_self"><img src="http://api.ning.com:80/files/LzTY94yzCcJEQ7qpnEaXavUnDnj07BRipGp56ecOWTn3d245bysIjG7ZhFrgSNVTf37x5tQwJF1YUuuJTgxnOVRPO5AWPTNo/images3.jpg" width="190" class="align-center"/></a></p>
<p></p>
<p></p>
<p>I had a fairly unpleasant high school experience. In the middle of my tenth grade year, my family moved from the coast of South Carolina to the Piedmont of North Carolina. My new high school had two distinct social groups: tobacco farmers’ kids and the privileged children of fairly affluent parents from Bermuda Run Country Club, a gated community. Oh, there was a tiny, third social group of transplant kids from the Sea Islands of SC… me.</p>
<p>Universally, the tobacco kids were unsophisticated, but emotionally mature. Each worked on the farm from a young age and gained an adult-like tempering from being productive and from contributing to the welfare of his/her family. The Bermuda Run children were emotionally infantile and inflicted a smug, judgmental snobbery on each other and on the rest of us. Prior to the move, I was honestly unaware of the phenomenon called, “name brand.” I quickly learned that wearing shirts with the wrong animal embroidered on the chest or sneakers with the wrong stripe on the side meant ridicule and a sense of shame.</p>
<p>In retrospect, I give the Bermuda Run children a pass. They were simply mimicking their parents. I can understand this level of immaturity in high schoolers, but am always surprised that any adult would want to extend such puerile behaviors beyond adolescence. Pretentiousness is rare in the upper class, but pervasive to the middle and upper middle-classes. Most Bermuda Runners fell into these latter categories. Bermuda Run parents universally applied the absurd costumes and manners of sociological “wannabes.” Ironically, pretentiousness is does not result from feelings of superiority. It is conversely, a manifestation of extreme insecurity. Snobbery is a desperate clinging to the superficial in the absence of genuine self-respect.</p>
<p>Pretentiousness is a “passive-aggressive” behavior that demonstrates craven hostility. The intent of snobbery is to inflict emotional harm on others. It can effectively harm the immature, but ultimately causes greater harm to the snob his/herself. Snobbery is born of fear, vulnerability, and social incompetence. It serves as a mechanism for generating scraps of esteem in people so small inside that these tiny perceived victories are of value. Pretentiousness is a “short game” that sacrifices intimacy and meaningful relationships for pettiness and cruelty.</p>
<p></p>
<p><a href="http://edwardteach100.blogspot.com/2014/04/on-snobbery.html" target="_blank" rel="nofollow">http://edwardteach100.blogspot.com/2014/04/on-snobbery.html</a></p>On Empathy in Moral Judgementtag:atheistnexus.org,2014-04-10:2182797:BlogPost:24075222014-04-10T16:41:55.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<a href="http://edwardteach100.blogspot.com/2014/04/on-empathy-in-moral-judgement.html">http://edwardteach100.blogspot.com/2014/04/on-empathy-in-moral-judgement.html…</a><br />
<br />
<div class="separator" style="clear: both; text-align: center;"><a href="http://1.bp.blogspot.com/-qRd9G5aYlJg/U0bIQQjZUJI/AAAAAAAABf8/qWZHLgsWT6g/s1600/download+(1).jpg" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="337" src="http://1.bp.blogspot.com/-qRd9G5aYlJg/U0bIQQjZUJI/AAAAAAAABf8/qWZHLgsWT6g/s1600/download+(1).jpg" width="400"></img></a></div>
<a href="http://edwardteach100.blogspot.com/2014/04/on-empathy-in-moral-judgement.html">http://edwardteach100.blogspot.com/2014/04/on-empathy-in-moral-judgement.html</a><br />
<br />
<div class="separator" style="clear: both; text-align: center;"><a href="http://1.bp.blogspot.com/-qRd9G5aYlJg/U0bIQQjZUJI/AAAAAAAABf8/qWZHLgsWT6g/s1600/download+(1).jpg" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="http://1.bp.blogspot.com/-qRd9G5aYlJg/U0bIQQjZUJI/AAAAAAAABf8/qWZHLgsWT6g/s1600/download+(1).jpg" height="337" width="400"/></a></div>
<span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;"><br/>
</span><br />
<span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;"><br/>
</span><br />
<span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">All organisms demonstrate a tendency to avoid harm. Even amoeba will </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">avoid aversive stimuli. This is one of the basic premises of behavioral </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">psychology's operant conditioning. Behaviors that yield pleasing results </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">tend to be repeated. Behaviors that yield aversive results tend to not </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">be repeated. Amoeba have no need for morality, only self-preservation.</span><br/>
<br style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;"/><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">If we were to stop right there, we would have an argument for hedonism, indicating no need for morality. But, we are </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">not amoeba. Humans are social animals requiring the assistance of other </span><span style="background-color: white;"><span style="color: #454545; font-family: Helvetica Neue, Helvetica, Arial, sans-serif;"><span style="line-height: 20.280000686645508px;">humans in order to survive in the natural environment. For humans, self-preservation is interdependent with preservation of "the tribe."</span></span></span><br/>
<br style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;"/><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">Other social animals like wolves, lions, and buffalo will predictably </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">behave in ways that promote the health and safety of the group over the </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">health and safety of the individual. These animals engage in what might </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">be considered benevolent behaviors even without the benefit of higher </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">cognitive functioning.</span><br/>
<br style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;"/><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">To my knowledge, humans are the only species capable of true empathy. </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">Empathy does not mean sympathy. Many species demonstrate sympathy. E</span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">mpathy requires the complex ability to cognitively attempt to </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">see through the eyes of another. With huge effort, it is possible to put our </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">collective ego aside and on some level understand the world from another person's perspective</span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">.</span><br/>
<br style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;"/><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">Research on feral children has shown that empathy is a learned behavior. </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">Empathy is an extremely difficult cognitive skill that few humans try </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">master. If humans developed and regularly employed this skill, conflict with each </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">other and the destruction of other species could be virtually </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">eliminated.</span><br/>
<br style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;"/><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">My theory is that empathy is the highest human good, as </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">it is an extension (actually a giant leap) of the natural tendency for </span><span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">social animals to engage in behaviors that benefit the survival of the</span><br/>
<span style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;">group. To employ this litmus in making moral decisions, one must not only, "do unto others as you would have them do unto you," but also consider how others would wish to be treated from "their own" perspectives and not just your own.</span><br/>
<br style="background-color: white; color: #454545; font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; font-size: 16px; line-height: 20.280000686645508px;"/>On "Gut Feelings"tag:atheistnexus.org,2014-04-10:2182797:BlogPost:24071042014-04-10T13:36:03.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p><a href="http://edwardteach100.blogspot.com/2014/04/on-gut-feelings_10.html">http://edwardteach100.blogspot.com/2014/04/on-gut-feelings_10.html…</a></p>
<p></p>
<p></p>
<div class="separator" style="clear: both; text-align: center;"><a href="http://4.bp.blogspot.com/-xPYUbOZbMLA/U0WOseYB12I/AAAAAAAABec/fSYlwdddEtI/s1600/intellect-vs-intuition.jpg" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="246" src="http://4.bp.blogspot.com/-xPYUbOZbMLA/U0WOseYB12I/AAAAAAAABec/fSYlwdddEtI/s1600/intellect-vs-intuition.jpg" width="320"></img></a></div>
<p></p>
<p><a href="http://edwardteach100.blogspot.com/2014/04/on-gut-feelings_10.html">http://edwardteach100.blogspot.com/2014/04/on-gut-feelings_10.html</a></p>
<p></p>
<p></p>
<div class="separator" style="clear: both; text-align: center;"><a href="http://4.bp.blogspot.com/-xPYUbOZbMLA/U0WOseYB12I/AAAAAAAABec/fSYlwdddEtI/s1600/intellect-vs-intuition.jpg" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="http://4.bp.blogspot.com/-xPYUbOZbMLA/U0WOseYB12I/AAAAAAAABec/fSYlwdddEtI/s1600/intellect-vs-intuition.jpg" height="246" width="320"/></a></div>
<p><span style="background-color: white; color: #37404e; font-family: 'lucida grande', tahoma, verdana, arial, sans-serif; font-size: 13px; line-height: 18px;"><br/></span><span style="background-color: white; color: #37404e; font-family: 'lucida grande', tahoma, verdana, arial, sans-serif; font-size: 13px; line-height: 18px;"><br/></span><span style="background-color: white; color: #37404e; font-family: 'lucida grande', tahoma, verdana, arial, sans-serif; font-size: 13px; line-height: 18px;">A “gut feeling” is an automatic, cognitive, short-cut that provides a crude, organic, meta-analysis of the culmination of one’s entire life experience relating to a given concept.</span><br/><br style="background-color: white; color: #37404e; font-family: 'lucida grande', tahoma, verdana, arial, sans-serif; font-size: 13px; line-height: 18px;"/><span style="background-color: white; color: #37404e; font-family: 'lucida grande', tahoma, verdana, arial, sans-serif; font-size: 13px; line-height: 18px;">Life experiences are three-fold. First, they involve sensations. Real and/or imagined sensory stimulation from the environment such as light, sound, fragrance, texture, etc. Second, experiences requir</span><span class="text_exposed_show" style="background-color: white; color: #37404e; display: inline; font-family: 'lucida grande', tahoma, verdana, arial, sans-serif; font-size: 13px; line-height: 18px;">e cognitions and perceptions. These are your thoughts about the sensory stimuli. Your eyes and brain may sense a light, and then your mind interprets, “Oh, the car in front of me just put on the brakes.” Third, experiences are bathed in varying levels of emotion. So, the car in front of you suddenly hits the brakes and you feel a quick tinge of fear that you may rear end the other car. Emotions are the body’s security system. They evolved as a mechanism to aid us in survival. Emotions warn us of danger and reward us for behaviors that have historically resulted in increased odds for survival of the species.<br/><br/>In the course of a lifetime, you have trillions of experiences covering innumerable concepts. Some of these experiences are available to the conscious mind, but most are not. It would be impossible to function if you had to process your lifetime of experiences every time you had to answer a question or make a decision. So, the mind provides a short cut called the “gut feeling.”<br/><br/>If I ask, “Do you like raisins?” the answer will lie in an overview of every life experience you have ever had with the concept called, “raisin.”<br/><br/>…raisins are dehydrated grapes<br/>…the dancing California Raisins<br/>…raisin bran cereal<br/>…raisins look like flies<br/>…raisins are high in antioxidants<br/>…as a kid, I threw up after eating a box of raisins<br/>…raisins are sweet<br/>…raisins have a funny texture<br/>…I got raisins in my lunchbox when I was in grade school<br/>…raisins smell bad<br/>…and on and on and on and on<br/><br/>But, since filtering through these millions of experiences would be impossible and impractical, your mind makes a snap shot using the most dominant, overshadowing emotion related to the concept called, “raisin.” This provides your gut feeling and your answer… “No, raisins are gross.”<br/><br/>The gut feeling is necessary to navigating the complex terrain of human life. Without it, we would be paralyzed. However, it is also the fundamental cognitive error that interferes with human advancement. Our nature, like all animals, is to accept gut feelings as “truth.” If I approach a squirrel with the intention of giving it a walnut, the squirrel’s gut feeling may be that I am a threat, so the squirrel runs away. The truth is that I intended to help the squirrel by giving it food. Gut feelings are not truth. Truth is based in fact and posses objective reality.<br/><br/>So, if I am interested in finding "truth," then I must understand that my gut feeling is an extremely fallible resource completely dependent on my very limited and unique fund of life experiences. To find “truth,“ I must test my gut feeling against objective litmus’ like logic, mathematics, physical properties, etc. The gut feeling is a necessary place to start, but it can be a foolish place to end.<br/><br/>The ability to override “gut feelings” is the characteristic that enables the human to operate beyond the confines of biological and environmental programming. Every animal on the planet is a slave to gut feelings. Throughout the majority of human history, we have operated exactly like every other species in this respect. However, the advent of logic, mathematics, and the scientific method, has provided a means for humans to break the bonds of our animal nature and rise above superstition and intuition. It is a tragedy that so few take advantage of this magnificent opportunity.</span></p>On Being a Real Mantag:atheistnexus.org,2014-04-09:2182797:BlogPost:24069842014-04-09T17:05:09.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p><a href="http://edwardteach100.blogspot.com/2014/04/onbeing-real-man-disclaimer-given-that.html" target="_blank">On Being a Real Man</a></p>
<br />
Disclaimer: Given that men and women are equal representatives of the human race, the qualities of a real man may be identical to the qualities of a real woman or simply, a real person.<br />
<br />
I was raised in a culture that clearly defined what it meant to be a real man. As a male in this environment, the importance of achieving real manhood can not be…
<p><a href="http://edwardteach100.blogspot.com/2014/04/onbeing-real-man-disclaimer-given-that.html" target="_blank">On Being a Real Man</a></p>
<br />
Disclaimer: Given that men and women are equal representatives of the human race, the qualities of a real man may be identical to the qualities of a real woman or simply, a real person.<br />
<br />
I was raised in a culture that clearly defined what it meant to be a real man. As a male in this environment, the importance of achieving real manhood can not be overstated. This essay will evaluate the qualities of a real man as defined by my culture. I will rebut with my own personal views on what it means to be a real man. As a dyed in the wool skeptic and moral relativist, I would be disappointed if my opinions were interpreted by anyone as some universal definition of manhood.<br />
<br />
Real Men are Brave:<br />
<br />
If “brave” means “fearless,” I would have to judge one who claims this quality a liar. The fear response is hardwired into humans and most other animals, so fear is a given. True courage is the ability to do the right thing in spite of one's fear. If we use this second definition, I agree that bravery is necessary to real manhood. A real man has the guts to stand up for the underdog, the unpopular, and the underrepresented. Ironically, many of the characteristics of real men, as defined by culture, are rooted in fear and cowardice.<br />
<br />
Real Men are Strong:<br />
<br />
I place a high value on physical strength and put forth a good deal of effort to develop and maintain it. However, this quality can easily be dismissed as essential to real manhood. A frail and weak individual who puts himself between danger and someone vulnerable to harm would certainly meet the standards for real manhood. I would specify strength of character as a necessary component of real manhood.<br />
<br />
Real Men Wear Prescribed Hairstyles and Clothing:<br />
<br />
In my home town, this prescription includes short hair, with either khaki pants and boat shoes or camouflage and boots. While there is nothing wrong with enjoying the prescribed stuff, I consider one who fears to deviate from it, a coward. No courage at all is required to conform. Fear of being different is indicative of one who does not have what it takes to be a real man.<br />
<br />
Real Men Take Care of Their Own:<br />
<br />
This is an instinctual characteristic found in many lower animals. Real chimps, baboons, and bison take care of their own. A guy who demonstrates this quality has not distinguished himself beyond this level. I think a real man must set the bar higher. A real man should take care of all who are unable to defend themselves from abuse and exploitation regardless of race, sexual orientation, gender, political group, regional affiliation, socioeconomic status, or even species. One who only takes care of his own is less than a real man.<br />
<br />
Real Men View Homosexual Behavior with Disgust:<br />
<br />
If this were true, we would have to exclude Julius Ceasar, Alexander the Great, and Richard the Lion Hearted from the category of “real men.” A large research study tested attitudes about homosexuals in self-identified heterosexual men. The men were then divided into two groups, homophobes and non-homophobes. Both groups were hooked up to plethysmographs (instruments for measuring erections) and asked to view male, homosexual, pornographic videos. Only the homophobe group became sexually aroused. This response did not occur in the non-homophobe group. In other words, guys who have huge issues with gay people are often covering for their own homosexual tendencies.<br />
<br />
<a href="http://www.livescience.com/19563-homophobia-hidden-homosexuals.html">http://www.livescience.com/19563-homophobia-hidden-homosexuals.html</a><br />
<br />
Real Men Take Charge:<br />
<br />
Yes, I would say that taking charge when the situation warrants is inherent to real manhood. However, one who wants to take charge in ALL situations is simply arrogant and self-deluded. Real men have the maturity to defer to a more qualified individual when one is available. An intelligence that exceeds the level of any single individual within a group emerges whenever a group of people cooperate and respectfully work together.<br />
<br />
Real Men Express only One Emotion, Anger:<br />
<br />
<br />
Unless damaged, all people experience the full range of human emotions. Which requires greater courage, to express emotions that show vulnerability or to hide them? Hiding is not a behavior I typically associate with being a real man.<br />
<br />
Conclusions:<br />
<br />
Make your own.Poem from the Existential Atheists Group: A Letter from the Bones of a Broken Piratetag:atheistnexus.org,2014-01-16:2182797:BlogPost:19891352014-01-16T18:00:00.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p align="center"><span class="font-size-4"><b>A Letter from My Bones:</b></span></p>
<p align="center"><span class="font-size-4"><b> </b></span></p>
<p align="center"><span class="font-size-3">We are here to remind you of who you are.</span></p>
<p align="center"><span class="font-size-3">You are temporary.</span></p>
<p align="center"><span class="font-size-3">You are broken.</span></p>
<p align="center"><span class="font-size-3">You are pieces and parts that fit together less and less…</span></p>
<p align="center"><span class="font-size-4"><b>A Letter from My Bones:</b></span></p>
<p align="center"><span class="font-size-4"><b> </b></span></p>
<p align="center"><span class="font-size-3">We are here to remind you of who you are.</span></p>
<p align="center"><span class="font-size-3">You are temporary.</span></p>
<p align="center"><span class="font-size-3">You are broken.</span></p>
<p align="center"><span class="font-size-3">You are pieces and parts that fit together less and less comfortably.</span></p>
<p align="center"><span class="font-size-3">You are a sputtering and coughing stream of semi-consciousness.</span></p>
<p align="center"><span class="font-size-3">See how easily the veneer peels away and exposes your frailty?</span></p>
<p align="center"><span class="font-size-3">See how your posture mimics a sail on a still afternoon?</span></p>
<p align="center"><span class="font-size-3">You are the scent of stale, empty space.</span></p>
<p align="center"><span class="font-size-3">Hear the voice deepen and crack like old wooden hull?</span></p>
<p align="center"><span class="font-size-3">There is no place to hide, but you keep trying.</span></p>
<p align="center"><span class="font-size-3">Who are you afraid of?</span></p>
<p align="center"><span class="font-size-3">What would happen if you were honest?</span></p>
<p align="center"><span class="font-size-3">What would happen if you forced your crooked frame out into the light of day?</span></p>
<p align="center"><span class="font-size-3">What would happen if you even took a peek through the curtain that obstructs what is real?</span></p>
<p align="center"><span class="font-size-3"> Would you die of shame?</span></p>
<p align="center"><span class="font-size-3">Would you neutralize the mechanisms that imprison you?</span></p>
<p align="center"><span class="font-size-3">How strong are the locks?</span></p>
<p align="center"><span class="font-size-3"> And why do you love them so!?</span></p>
<p><span class="font-size-3">.</span></p>
<p><span class="font-size-3"> </span></p>Atheist or Agnostic?tag:atheistnexus.org,2014-01-16:2182797:BlogPost:23671102014-01-16T15:00:00.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<div class="clearfix"><h2 class="_5clb">Atheist or Agnostic?</h2>
</div>
<div class="mts _50f8"><br></br><div class="uiSelector inlineBlock audienceSelector timelineAudienceSelector audienceSelectorNoTruncate dynamicIconSelector uiSelectorNormal uiSelectorDynamicTooltip"></div>
</div>
<div class="_5k3v _5k3w clearfix"><p><strong>a·the·ist - </strong><em>a person who disbelieves or lacks belief in the existence of God or gods.</em></p>
<p> </p>
<p> </p>
<p><strong>ag·nos·tic - </strong><em>a person…</em></p>
</div>
<div class="clearfix"><h2 class="_5clb">Atheist or Agnostic?</h2>
</div>
<div class="mts _50f8"><br/><div class="uiSelector inlineBlock audienceSelector timelineAudienceSelector audienceSelectorNoTruncate dynamicIconSelector uiSelectorNormal uiSelectorDynamicTooltip"></div>
</div>
<div class="_5k3v _5k3w clearfix"><p><strong>a·the·ist - </strong><em>a person who disbelieves or lacks belief in the existence of God or gods.</em></p>
<p> </p>
<p> </p>
<p><strong>ag·nos·tic - </strong><em>a person who believes that nothing is known or can be known of the existence or nature of God or of anything beyond material phenomena; a person who claims neither faith nor disbelief in God.</em></p>
<p> </p>
<p> </p>
<p>Atheism answers the question, “Do you believe God or gods exist?”</p>
<p> </p>
<p>The evidence for the existence of all 4000 of the gods and goddesses people have worshipped from the beginning of recorded time is identical:</p>
<p> </p>
<ul>
<li>Personal, spiritual experiences that have lead to an intuitive sense or "gut feeling" that the god/s or goddess/es in question are real</li>
<li>The fact that so many other people within a given culture, especially respected people in positions of authority (parents, ministers, educators, political officials), share belief in said god/s or goddess/es.</li>
<li>Stories passed on through the spoken or written word supporting the existence of the god/s or goddess/es in question.</li>
</ul>
<p> </p>
<p>Since Christian God, Muslim God, the Greek gods, the Roman gods, the Nordic gods, the gods from shamanistic cultures, and so on are all validated subjectively, <span class="fbUnderline">they each have an equal likelihood of existing</span>.</p>
<p> </p>
<p>One could easily make up stories of a newly invented god and convince others to believe them. And, this would result in the same spiritual “feelings” that validate the existence of established gods (think Scientology or Moonies). Therefore, <span class="fbUnderline">any absurdity conjured up by the human mind has the same likelihood of existing as any of the other 4000 gods and goddesses worshipped by humans</span>.</p>
<p> </p>
<p>So, based on the unimaginably low probability that established or newly invented gods are real, the atheist makes the claim, “I don’t believe god/s or goddess/es exist.”</p>
<p> </p>
<p>Agnosticism answers a different question, “Can we know if God or gods exist?”</p>
<p> </p>
<p>In a universe of infinite time and space, anything is possible. We truly cannot <span class="fbUnderline">know</span> for certain that god/s or godess/es do not exist. We cannot <span class="fbUnderline">know</span> for certain that fairies, smurfs, and leprechauns do not exist. It is possible that invisible horses with Snoopy heads exist in a place called Woowoo. The probability that this scenario is true is astronomically low. However, it is the exact same likelihood that Thor and Odin exist in a place called Valhalla or that the Christian and Muslim gods exist in a place called Heaven.</p>
<p> </p>
<p>So, the agnostic states that he/she cannot know if god/s or goddess/es exist. And, the atheist states that, based on probability, he/she does not believe god/s or goddess/es exist.</p>
<p></p>
</div>On Why Believing is not an Option for Me....tag:atheistnexus.org,2014-01-15:2182797:BlogPost:23666572014-01-15T13:00:00.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p><span class="font-size-6">On why believing is not an option for me...</span></p>
<p><em>There is an invisible creature that follows me everywhere I go. It reads my mind and knows my deepest secrets. The creature loves me, but it is jealous and will punish me if I don’t love it back. Since it reads my mind, the creature can even punish me for my thoughts. I must never have doubts about its complete power over me or I will be made to suffer horribly. I would do anything for the creature, even…</em></p>
<p><span class="font-size-6">On why believing is not an option for me...</span></p>
<p><em>There is an invisible creature that follows me everywhere I go. It reads my mind and knows my deepest secrets. The creature loves me, but it is jealous and will punish me if I don’t love it back. Since it reads my mind, the creature can even punish me for my thoughts. I must never have doubts about its complete power over me or I will be made to suffer horribly. I would do anything for the creature, even die or kill, because to do otherwise is to be doomed. The creature rewards me when I’m good. Sometimes it grants me wishes. If I am very good, when I die I will get to spend forever on my knees worshipping at the creatures feet. If you don’t believe in the creature as I do, you are a fool and you are damned for all eternity.</em></p>
<p>“If you have doubts, it means the Devil is at work. You must push those doubts out of your minds through prayer.” The Reverend Sun Myung Moon</p>
<p><span class="font-size-4"><strong>“Can you prove that there is no god?”</strong></span></p>
<p>The burden of proof is on he/she who makes the assertion. If I say I have a hundred dollar bill in my pocket and you don’t believe me, it is up to me to show you the bill. It is not your responsibility to prove I'm lying. No one can prove that there are no pixies, leprechauns, or other inventions of the human imagination and no one should have to. "Extraordinary claims require extraordinary evidence," Carl Segan.</p>
<p><span class="font-size-4"><strong>“Are you angry at god? Are you rebelling?”</strong></span></p>
<p>Are you rebelling against Odin? Are you angry at Zeus? Do you not believe in Santa because you are angry with him?</p>
<p><span class="font-size-4"><strong>“How can you see a sunset and not believe in god?”</strong></span></p>
<p>The sunset is evidence that sunsets exist. It is not evidence for the existence of gods, devils, angels, or any other invisible creatures. How can you see a sunset and not believe in Apollo? After all, he is responsible for pulling the sun across the sky. Is it difficult for you to not believe in Apollo? Because, that is exactly how difficult it is for me to not believe in your god/goddess. The scientific explanation for sunsets seems more likely to me than the magical explanation. The absence of superstition in no way reduces the wonder and appreciation one feels when experiencing a beautiful sunset.</p>
<p><span class="font-size-4"><strong>"Everything has to come from something. If God didn't create the Universe, then where did it come from?"</strong></span></p>
<p><span class="font-size-3">So, the problem is to determine where the Universe came from. But, "God created it," doesn't solve your dilemma. It only pushes the issue back one step. If everything has to come from something, then what about the origin of God? If, "God is infinite," is an acceptable answer to the question, "Where did God come from?," then the "Universe is infinite," should be an acceptable answer to the question, "Where did the Universe come from?" This makes God an unnecessary variable to the equation.</span></p>
<p><span class="font-size-3">In other words, if the problem were that you needed to get rid of a brick, and your solution was to throw the brick up in the air, you didn't really solve your brick problem. You only pushed it back a step. </span></p>
<p><span class="font-size-4"><strong>“If you experienced what I have experienced, you would believe.”</strong></span></p>
<p>I grew up a Christian and religion was at the center of my life for many years. I experienced religious ecstasy, speaking in tongues, healing. I was born again and had a personal relationship with Jesus Christ. I got goose bumps and had prayers answered, just like Sufis, Muslims, Christians, Moonies, and the followers of Jim Jones. Religious ecstasy is only evidence that humans experience a wide range of cognitive and emotional states. Emotions are not evidence. I have experienced what you have. Have you ever experienced life without superstition? Have you had the courage to objectively evaluate the validity of your beliefs? Would the evidence you used to support your beliefs be different than the evidence used by any and every other religious cult (ancient stories/books, lots of other people who believe, personal spiritual experiences, the gut feeling that you are right)? Have you ever experienced the power and the uncertainty of being 100% responsible for your life?</p>
<p><span class="font-size-4"><strong>“What if you are wrong? Isn't it better to be safe than sorry?”</strong></span></p>
<p>Staying on the safe side would mean trying to appease all 4000 odd gods and goddesses that humans have loved and worshipped across history. Pleasing one deity usually means angering the others. Chances are, I only believe in one less god than you do. Put 4000 gods/goddesses in a hat and randomly pull one out (By chance, you were born into, and probably reflect, the religious tendencies of your family/culture). The odds that you picked the right god are 3999 to 1. In other words, I have 4000 gods and goddesses angry at me, but you have 3999.</p>
<p>What if you are wrong? Reality demonstrates its true nature every minute of every day. You don’t need an atheist to inform you that snakes can’t talk, death is permanent, and gravity and the other physical laws of nature remain in effect regardless. Living one life as a true human adult is an incredible opportunity. Thinking, emoting, moving, changing, being are the real miracles.</p>
<p>The richness of the human experience is bathed in wonder. Superstition is not required to enjoy the awe and amazement of sensory experiences. Being responsible for your own life is a heavy burden, but it defines what it means to be an adult. Developing the emotional maturity to deal with the realities of death, unanswered questions, and all of the other uncertainties of human life without resorting to magic and superstition requires courage and unyielding integrity. One must be committed to all truths regardless of how scary or difficult.</p>
<p>I have no issue with private, superstitious beliefs. If you believe that walking under ladders is bad luck, I think that is pretty harmless. But, when walking under ladders is made a crime, superstition becomes malevolent. When folks who avoid walking under ladders are given a tax break, then superstition causes unfairness. When monuments and texts dedicated to the avoidance of walking under ladders are displayed and sponsored by government, then superstition becomes exclusionary. When bad luck from walking under ladders is taught in public schools, then superstition becomes a force for ignorance.</p>Critical evaluation of some “Old Sayings”tag:atheistnexus.org,2013-12-05:2182797:BlogPost:23450202013-12-05T17:57:28.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<div class="clearfix"><h2 class="_5clb"><strong style="font-size: 13px;"><em>"Faith can move mountains."</em></strong></h2>
</div>
<div class="_5k3v _5k3w clearfix"><p><strong><em> </em></strong></p>
<p>Faith can move… nothing. Dynamite, bulldozers, big trucks, and people of action have proven an effective means for messing mountains up, but <em>faith</em> has yet to move even a grain of sand. On a side note, “faith” is generally regarded as a positive attribute. The term refers to belief…</p>
</div>
<div class="clearfix"><h2 class="_5clb"><strong style="font-size: 13px;"><em>"Faith can move mountains."</em></strong></h2>
</div>
<div class="_5k3v _5k3w clearfix"><p><strong><em> </em></strong></p>
<p>Faith can move… nothing. Dynamite, bulldozers, big trucks, and people of action have proven an effective means for messing mountains up, but <em>faith</em> has yet to move even a grain of sand. On a side note, “faith” is generally regarded as a positive attribute. The term refers to belief without evidence, based on gut feelings or intuition. I consider this a slippery slope. If I accept even one idea without evidence, have I not opened the flood gates to falling for believing any number of absurdities? Doesn’t this define gullibility and make me an easy mark for those who would manipulate me to their advantage?</p>
<p> </p>
<p><strong><em>"Absence makes the heart grow fonder."</em></strong></p>
<p> </p>
<p>This may have some validity in the short run, but in the long run, absence tends to quell (but not necessarily eliminate) emotional connections. Otherwise, the grief one feels at the death of a loved one or the termination of a romantic relationship would increase in intensity over time, rather than the gradual tempering of the grief response we have all experienced.</p>
<p> </p>
<p><strong><em>"You can’t teach an old dog new tricks."</em></strong></p>
<p> </p>
<p>This is simply a false statement. Old dogs and old people have the capacity to learn throughout the life span (in the absence of brain disorders).<a href="http://jag.sagepub.com/content/early/2012/01/03/0733464811431824.abstract" target="_blank" rel="nofollow">http://jag.sagepub.com/content/early/2012/01/03/0733464811431824.abstract</a></p>
<p> </p>
<p><strong><em>"Lightning never strikes twice in the same place."</em></strong></p>
<p><strong><em> </em></strong></p>
<p>Another false statement</p>
<p><a href="http://www.accuweather.com/en/weather-blogs/weathermatrix/myth-lightning-never-strikes-twice/19890" target="_blank" rel="nofollow">http://www.accuweather.com/en/weather-blogs/weathermatrix/myth-lightning-never-strikes-twice/19890</a></p>
<p> </p>
<p><strong><em>"Those who can, do. Those who can’t, teach."</em></strong></p>
<p><strong><em> </em></strong></p>
<p>Aside from my own personal objection to this sentiment, this saying doesn’t make sense. Teaching, like all jobs, requires a specific skill set (i.e. good communication skills, charisma, ability to inspire others, passion, knowledge of subject matter, etc.). The world’s greatest biologist could be a terrible biology teacher. The world’s greatest auto mechanic might be completely incompetent in the instruction of car repair.</p>
<p> </p>
<p><strong><em>"People with book smarts have no common sense."</em></strong></p>
<p><strong><em> </em></strong></p>
<p>Research has shown the exact opposite. Different types of intelligence tend to positively correlate with each other. In other words, folks who are highly intelligent in one arena, tend to also be highly intelligent in other arenas. We all know exceptions to this pattern and tend to use them as “evidence” to the truth of this old saying. However, using rare exceptions to nullify overwhelming data to the contrary speaks more to our psychological need to “take smart people down a peg” than it does to the validity of the saying… Besides, isn’t it common sense to have book smarts?</p>
<p> </p>
<p><em><strong>"Sticks and stones can break my bones, but words can never hurt me."</strong></em></p>
<p> </p>
<p>Hmmm, this one is just self evident bull shit.</p>
</div>On Critical Thinkingtag:atheistnexus.org,2013-12-04:2182797:BlogPost:23440342013-12-04T00:13:57.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p><span>By nature, critical thinking leads to more questions than answers. For a skilled critical thinker, issues are rarely simple. Because critical thought requires approaching a problem from many angles and many perspectives, solutions tend to come in shades of gray rather than black and white. </span><br></br><br></br><span>People who are not inclined towards critical thinking, have a much greater tendency to see things in terms of black and white. For them, conforming to a solution posed by the…</span></p>
<p><span>By nature, critical thinking leads to more questions than answers. For a skilled critical thinker, issues are rarely simple. Because critical thought requires approaching a problem from many angles and many perspectives, solutions tend to come in shades of gray rather than black and white. </span><br/><br/><span>People who are not inclined towards critical thinking, have a much greater tendency to see things in terms of black and white. For them, conforming to a solution posed by the group with whom they identify is easy and even the obvious "right thing to do." They may interpret the failure of critical thinkers to do likewise as "crazy" or "stupid."</span><br/><br/><span>Critical thinking does not come naturally to humans. It requires ongoing training and self-discipline. The difference between the skilled critical thinker and the average thinker is as dramatic as the difference between the physique of a pro body builder and the average physique. </span><br/><br/><span>Teach's Precepts for Critical Thinking:</span><br/><br/><span>1. High levels of certainly often correlates to low levels of critical thinking</span><br/><span>2. Objective evidence and logic outweigh popular views and intuition</span><br/><span>3. "Feelings" are not evidence. "Common Sense" is not evidence. "Faith" is not evidence. "How I was raised" is not evidence. "Anecdotes" are not evidence.</span><br/><span>4. Changing positions when opposing evidence outweighs supporting evidence is the hallmark for critical thought.</span><br/><span>5. Ego is the greatest obstacle to critical thought.</span><br/><br/><span>Examples from the Left and the Right of failure to critically evaluate the issue:</span><br/><br/><span>1. On the Left: "All of my friends at the health food store say that immunizations are dangerous and cause autism. There are scientific studies that prove it. Immunizations are part of a conspiracy generated by the medical industrial complex.""</span><br/><br/><span>In truth, there was a single flawed study linking immunization to autism. The results have not been replicated, and overwhelming scientific evidence supporting the need for immunization reflects the consensus of the scientific community. So, if you believe that immunizations are bad, this belief is likely based on anecdotes, your need to conform to the group with whom you identify, and on your intuitive feelings of paranoia.</span><br/><br/><span>2. On the Right: "The guys on Talk Radio say that climate change is a myth. Many scientists agree. The whole global warming thing is a conspiracy perpetrated by liberal scientists who want grant money."</span><br/><br/><span>In truth, there has never been a more researched natural phenomenon in history than climate change. Overwhelming scientific evidence supports the validity of climate change caused by human activity and, again, this view is supported by a consensus of the scientific community. If you believe that climate change is not occurring or that it is not caused by human activity, this belief is likely based on anecdotes, your need to conform to the group with whom you identify, and on your intuitive feelings of paranoia.</span><br/><br/><span>That said, alternative theories to the scientific consensus is a VERY good thing. On occasion, the scientist who opposes the consensus will find strong opposing evidence. As opposing evidence accumulates and eventually outweighs supporting evidence, the scientific consensus will shift to the new position. So, if and when evidence opposing immunization and opposing climate change theory accumulates to the tipping point, good critical thinkers (like the scientific community) will shift to the new position. </span><br/><br/><span>I was once trying to teach a particularly difficult theory to a class. About half the class understood the theory and the other half didn't get it. When polled, 100% of the students who understood the theory said they agreed with the theory, while 100% of those who failed to understand the theory described it as "stupid." It takes time and effort to become informed on complex issues and no effort at all to have a gut level response. Ironically, the informed individual is more likely to be uncertain about his/her position than is the uninformed individual.</span></p>Kudos to A/Ntag:atheistnexus.org,2013-03-12:2182797:BlogPost:21828232013-03-12T14:55:06.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p>I rarely visit A/N these days, but I want to express my gratitude for my experiences as an A/N member. Having worked alone in my efforts to hammer out rationally sound philosophies for a number of years, A/N gave me access to a world of brilliant thinkers. There were numerous issues I was having a hard time wrapping my mind around, and I was very fortunate to find thinkers who had traveled further down the path. Answers to life's eternal questions are not found on A/N. However, A/N does…</p>
<p>I rarely visit A/N these days, but I want to express my gratitude for my experiences as an A/N member. Having worked alone in my efforts to hammer out rationally sound philosophies for a number of years, A/N gave me access to a world of brilliant thinkers. There were numerous issues I was having a hard time wrapping my mind around, and I was very fortunate to find thinkers who had traveled further down the path. Answers to life's eternal questions are not found on A/N. However, A/N does provide an excellent venue for exploring those questions in a rational manner.</p>Southern Baptists Fundie Studentstag:atheistnexus.org,2010-11-29:2182797:BlogPost:10399982010-11-29T19:33:18.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
I had two SBF students walk out of my class the other day when we had a discussion about the rights of the mother vs the rights of the unborn. They said such discussion was "just wrong." They also sent angry e-mails when I talked about the oppression of homosexuals in America.<br/><br/>HOWEVER... their strong moral convictions did not keep them from cheating on today's test.<br/><br/>At this juncture, the incident struck me more as predictable than ironic!<br/>
I had two SBF students walk out of my class the other day when we had a discussion about the rights of the mother vs the rights of the unborn. They said such discussion was "just wrong." They also sent angry e-mails when I talked about the oppression of homosexuals in America.<br/><br/>HOWEVER... their strong moral convictions did not keep them from cheating on today's test.<br/><br/>At this juncture, the incident struck me more as predictable than ironic!<br/>Outlaw Bikertag:atheistnexus.org,2010-03-12:2182797:BlogPost:7567712010-03-12T23:38:25.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
I wrote an article and sent dozens of pics from the Fire in the Hole Rally. It's being published in the next issue of Outlaw Biker!!! I'm psyched!<br/>
I wrote an article and sent dozens of pics from the Fire in the Hole Rally. It's being published in the next issue of Outlaw Biker!!! I'm psyched!<br/>Praying to a Jug of Milktag:atheistnexus.org,2010-02-09:2182797:BlogPost:7193442010-02-09T20:03:30.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<span class="url"><font color="#008000">www.<b>youtube.com</b>/watch?v=jk6ILZAaAMI</font></span>
<span class="url"><font color="#008000">www.<b>youtube.com</b>/watch?v=jk6ILZAaAMI</font></span>What's YOUR Theory?tag:atheistnexus.org,2010-01-19:2182797:BlogPost:6927862010-01-19T20:00:41.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<p style="text-align: left;"><img alt="" src="http://api.ning.com/files/-0b7l*JhUNDzi0UEptOSqhkLwq*ip6fjemzObYgIfFT7RNgv4u1sVAgu4AlbsYngE3i0s9**utgTilrPYlFpxR0vm2LANU3C/viktorfrankl.jpg"></img></p>
<p style="text-align: left;"><img alt="" src="http://api.ning.com/files/IT3*PB-6VweO93omn0Qkp0lNF6MHgkvNp03IOH*vpwdlda8M-tcre3suJw88kliB7LrwzVYdiNt3-ouhlWu9j2QwkqzOS1KK/CarlRogers.jpg"></img></p>
<p style="text-align: left;"><img alt="" src="http://api.ning.com/files/IT3*PB-6VweHxj22spcihwyLx70fhsSxbjw0RxSDCc9h02D2HnIykxwF4UrFssoSTXenqX11UmyppiE556KuwfcGKM5cGT9I/freud.jpg"></img></p>
<br />
<br />
I teach a class on Counseling Theory and love it! One assignment I give for students to create an original theory that answers the following questions:<br />
<br />
<b>1. What is life all about?</b><br />
<br />
Freud: Our instinctual drives (id) are forever at war with social propriety (superego) and life is about maintaining a balance between these two forces using the logical mind…
<p style="text-align: left;"><img src="http://api.ning.com/files/-0b7l*JhUNDzi0UEptOSqhkLwq*ip6fjemzObYgIfFT7RNgv4u1sVAgu4AlbsYngE3i0s9**utgTilrPYlFpxR0vm2LANU3C/viktorfrankl.jpg" alt=""/></p>
<p style="text-align: left;"><img src="http://api.ning.com/files/IT3*PB-6VweO93omn0Qkp0lNF6MHgkvNp03IOH*vpwdlda8M-tcre3suJw88kliB7LrwzVYdiNt3-ouhlWu9j2QwkqzOS1KK/CarlRogers.jpg" alt=""/></p>
<p style="text-align: left;"><img src="http://api.ning.com/files/IT3*PB-6VweHxj22spcihwyLx70fhsSxbjw0RxSDCc9h02D2HnIykxwF4UrFssoSTXenqX11UmyppiE556KuwfcGKM5cGT9I/freud.jpg" alt=""/></p>
<br />
<br />
I teach a class on Counseling Theory and love it! One assignment I give for students to create an original theory that answers the following questions:<br />
<br />
<b>1. What is life all about?</b><br />
<br />
Freud: Our instinctual drives (id) are forever at war with social propriety (superego) and life is about maintaining a balance between these two forces using the logical mind (ego) as mediator.<br />
<br />
Rogers: Life is about self-actualization. Becoming the best possible you.<br />
<br />
Frankle: Life is about finding subjective meaning.<br />
<br />
<b>2. How do we screw things up?</b><br />
<br />
Freud: Unconscious issues create an imbalance between the id and the superego.<br />
<br />
Rogers: An unhealthy environment (indifference, phoniness, ridicule) has inhibited your natural progression towards self-actualization.<br />
<br />
Frankle: Allowing others to define your meaning in life.<br />
<br />
<b>3. How do we fix it?</b><br />
<br />
Freud: Uproot unconscious issues so that the ego can deal with them.<br />
<br />
Rogers: In an environment of genuiness, empathy and respect, we can’t help but grow towards actualizing.<br />
<br />
Frankle: Understand that you have both the freedom and the responsibility to create a meaningful life for yourself.<br />
<br />
I’ve played fast and loose with Freud, Rogers and Frankle. The examples above are just my own interpretations for illustrative purposes. The point of the post is for us to explore <u><i>our own</i></u>, personal theories.<br />
<br />
How do you answer the questions?Why Smart People Feel Frustrated and Displacedtag:atheistnexus.org,2009-10-29:2182797:BlogPost:5754532009-10-29T16:30:00.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
Ok, get ready to fuss at me for being a jerk....<br />
<br />
The average IQ score is 100, with a standard deviation of 15 points. This makes the normal range from 85 to 115. One more standard deviation on either end, from 70 to 130, encompasses dull normal and bright normal. Anything below two standard deviations, or <69, is considered mentally retarded. Anything above two standard deviations, or >130, is considered gifted. 95% of the general population has IQs that fall between 70 and 130. 2.5%…
Ok, get ready to fuss at me for being a jerk....<br />
<br />
The average IQ score is 100, with a standard deviation of 15 points. This makes the normal range from 85 to 115. One more standard deviation on either end, from 70 to 130, encompasses dull normal and bright normal. Anything below two standard deviations, or <69, is considered mentally retarded. Anything above two standard deviations, or >130, is considered gifted. 95% of the general population has IQs that fall between 70 and 130. 2.5% fall within the mental retardation range and 2.5% fall within the gifted range.<br />
<br />
"Normals" don't typically hang out and socialize with mentally retarded folks. "Normals" find mentally retarded folks frustrating and boring. Historically, normal folks have treated people with mental retardation pretty horribly (institutions, torture, extermination, ridicule, etc.). Imagine how angry and frustrated the normal population would feel if the world's politics, religious institutions, laws, social norms and commerce were all primarily maintained by the mentally retarded!<br />
<br />
Now consider this, gifted individuals are intellectually as far from normal people, as normal people are from the mentally retarded! Being gifted and living in a world run by normals is exactly like being normal in a world run by people with mental retardation!<br />
<br />
Can you imagine being of normal IQ and trying to argue politics or religion with a mentally retarded person who is incapable of comprehending your standards for logic and rational thought? It is the same for gifted people who debate normal people. Except, that the normals represent such a HUGE majority that their opinions are considered valid! The majority of the populous operates from same crude belief system... "Because we all agree, we must be right."We are Dancing Bears: An argument for why our cause is hopelesstag:atheistnexus.org,2009-10-28:2182797:BlogPost:5740432009-10-28T16:30:00.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
If you want to understand a species, observe the behaviors of it's members over time. Bears have specific behaviors that have been exhibited throughout bear history. Bears forage, hibernate, are omnivorous, and so on. While the reactions of one bear in a particular situation may be unpredictable, the general behaviors of the species are extremely predictable.<br />
<br />
Likewise, observation of the human species yields similar understanding. Throughout history humans have always organized into groups,…
If you want to understand a species, observe the behaviors of it's members over time. Bears have specific behaviors that have been exhibited throughout bear history. Bears forage, hibernate, are omnivorous, and so on. While the reactions of one bear in a particular situation may be unpredictable, the general behaviors of the species are extremely predictable.<br />
<br />
Likewise, observation of the human species yields similar understanding. Throughout history humans have always organized into groups, aspired towards moving up in social pecking orders, developed religious systems, fought with groups having opposing views and with groups having desired resources, and so on.<br />
<br />
It is possible to train a bear to dance and do tricks. A bear can learn to rise above its nature to do things beyond the scope of the average bear. However, training a bear to dance does not change the behavior of the bear species. The dancing bear is an anomaly and will likely be rejected by other bears in nature.<br />
<br />
Individual humans can also rise above their base nature and, using the highly complex human mind, learn to live as enlightened, rational animals. But, an enlightened individual does not change the overall patterns of the human species. Socrates, Plato, Jesus, Gandhi, the Buddha all demonstrated varying levels of enlightened understanding... but they were anomalies and were ultimately rejected by their species.<br />
<br />
The species did not become enlightened by the efforts of enlightened individuals. Instead, the human species simply incorporated concrete aberrations of abstract, enlightened messages into the same human systems that perform the same human functions and behaviors that have always existed in humans (i.e. forming groups, moving up in social pecking orders, fighting with groups that have opposing view points, etc.).<br />
<br />
I postulate that enlightened beings are no more than dancing bears. They are an interesting anomaly having little impact on the species at large. Bears behave like bears. Let them be bears. Humans behave like humans. Let them be humans.God is Pro-Lifetag:atheistnexus.org,2009-10-27:2182797:BlogPost:5725032009-10-27T18:00:00.000ZEdward Teachhttp://atheistnexus.org/profile/edwardteach
<b>Capital Punishment Crimes:</b><br />
<br />
<br />
<br />
<b>Kill People Who Don't Listen to Priests</b><br />
<br />
Anyone arrogant enough to reject the verdict of the judge or of the priest who represents the LORD your God must be put to death. Such evil must be purged from Israel. (Deuteronomy 17:12 NLT)<br />
<br />
<br />
<br />
<b>Kill Witches</b><br />
<br />
You should not let a sorceress live. (Exodus 22:17 NAB)<br />
<br />
<br />
<br />
<b>Kill Homosexuals</b><br />
"If a man lies with a male as with a women, both of them shall be put to death for their abominable deed; they have…
<b>Capital Punishment Crimes:</b><br />
<br />
<br />
<br />
<b>Kill People Who Don't Listen to Priests</b><br />
<br />
Anyone arrogant enough to reject the verdict of the judge or of the priest who represents the LORD your God must be put to death. Such evil must be purged from Israel. (Deuteronomy 17:12 NLT)<br />
<br />
<br />
<br />
<b>Kill Witches</b><br />
<br />
You should not let a sorceress live. (Exodus 22:17 NAB)<br />
<br />
<br />
<br />
<b>Kill Homosexuals</b><br />
"If a man lies with a male as with a women, both of them shall be put to death for their abominable deed; they have forfeited their lives." (Leviticus 20:13 NAB)<br />
<br />
<br />
<br />
<b>Kill Fortunetellers</b><br />
<br />
A man or a woman who acts as a medium or fortuneteller shall be put to death by stoning; they have no one but themselves to blame for their death. (Leviticus 20:27 NAB)<br />
<br />
<br />
<br />
<b>Death for Hitting Dad</b><br />
<br />
Whoever strikes his father or mother shall be put to death. (Exodus 21:15 NAB)<br />
<br />
<br />
<br />
<b>Death for Cursing Parents</b><br />
<br />
1) If one curses his father or mother, his lamp will go out at the coming of darkness. (Proverbs 20:20 NAB)<br />
<br />
2) All who curse their father or mother must be put to death. They are guilty of a capital offense. (Leviticus 20:9 NLT)<br />
<br />
<br />
<br />
<b>Death for Adultery</b><br />
If a man commits adultery with another man's wife, both the man and the woman must be put to death. (Leviticus 20:10 NLT)<br />
<br />
<br />
<br />
<b>Death for Fornication</b><br />
<br />
A priest's daughter who loses her honor by committing fornication and thereby dishonors her father also, shall be burned to death. (Leviticus 21:9 NAB)<br />
<br />
<br />
<br />
<b>Death to Followers of Other Religions</b><br />
<br />
Whoever sacrifices to any god, except the Lord alone, shall be doomed. (Exodus 22:19 NAB)<br />
<br />
<br />
<br />
<b>Kill Nonbelievers</b><br />
<br />
They entered into a covenant to seek the Lord, the God of their fathers, with all their heart and soul; and everyone who would not seek the Lord, the God of Israel, was to be put to death, whether small or great, whether man or woman. (2 Chronicles 15:12-13 NAB)<br />
<br />
<br />
<br />
<b>Kill False Prophets</b><br />
<br />
If a man still prophesies, his parents, father and mother, shall say to him, "You shall not live, because you have spoken a lie in the name of the Lord." When he prophesies, his parents, father and mother, shall thrust him through. (Zechariah 13:3 NAB)<br />
<br />
<br />
<br />
<b>Kill the Entire Town if One Person Worships Another God</b><br />
<br />
Suppose you hear in one of the towns the LORD your God is giving you that some worthless rabble among you have led their fellow citizens astray by encouraging them to worship foreign gods. In such cases, you must examine the facts carefully. If you find it is true and can prove that such a detestable act has occurred among you, you must attack that town and completely destroy all its inhabitants, as well as all the livestock. Then you must pile all the plunder in the middle of the street and burn it. Put the entire town to the torch as a burnt offering to the LORD your God. That town must remain a ruin forever; it may never be rebuilt. Keep none of the plunder that has been set apart for destruction. Then the LORD will turn from his fierce anger and be merciful to you. He will have compassion on you and make you a great nation, just as he solemnly promised your ancestors. "The LORD your God will be merciful only if you obey him and keep all the commands I am giving you today, doing what is pleasing to him." (Deuteronomy 13:13-19 NLT)<br />
<br />
<br />
<b><br />
Kill Women Who Are Not Virgins On Their Wedding Night</b><br />
<br />
But if this charge is true (that she wasn't a virgin on her wedding night), and evidence of the girls virginity is not found, they shall bring the girl to the entrance of her fathers house and there her townsman shall stone her to death, because she committed a crime against Israel by her unchasteness in her father's house. Thus shall you purge the evil from your midst. (Deuteronomy 22:20-21 NAB)<br />
<br />
<br />
<br />
<b>Kill Followers of Other Religions.</b><br />
<br />
1) If your own full brother, or your son or daughter, or your beloved wife, or you intimate friend, entices you secretly to serve other gods, whom you and your fathers have not known, gods of any other nations, near at hand or far away, from one end of the earth to the other: do not yield to him or listen to him, nor look with pity upon him, to spare or shield him, but kill him. Your hand shall be the first raised to slay him; the rest of the people shall join in with you. You shall stone him to death, because he sought to lead you astray from the Lord, your God, who brought you out of the land of Egypt, that place of slavery. And all Israel, hearing of this, shall fear and never do such evil as this in your midst. (Deuteronomy 13:7-12 NAB)<br />
<br />
<br />
<br />
2) Suppose a man or woman among you, in one of your towns that the LORD your God is giving you, has done evil in the sight of the LORD your God and has violated the covenant by serving other gods or by worshiping the sun, the moon, or any of the forces of heaven, which I have strictly forbidden. When you hear about it, investigate the matter thoroughly. If it is true that this detestable thing has been done in Israel, then that man or woman must be taken to the gates of the town and stoned to death. (Deuteronomy 17:2-5 NLT)<br />
<br />
<br />
<b><br />
Death for Blasphemy</b><br />
<br />
One day a man who had an Israelite mother and an Egyptian father got into a fight with one of the Israelite men. During the fight, this son of an Israelite woman blasphemed the LORD's name. So the man was brought to Moses for judgment. His mother's name was Shelomith. She was the daughter of Dibri of the tribe of Dan. They put the man in custody until the LORD's will in the matter should become clear. Then the LORD said to Moses, "Take the blasphemer outside the camp, and tell all those who heard him to lay their hands on his head. Then let the entire community stone him to death. Say to the people of Israel: Those who blaspheme God will suffer the consequences of their guilt and be punished. Anyone who blasphemes the LORD's name must be stoned to death by the whole community of Israel. Any Israelite or foreigner among you who blasphemes the LORD's name will surely die. (Leviticus 24:10-16 NLT)<br />
<br />
<br />
<br />
<b>Kill False Prophets</b><br />
<br />
1) Suppose there are prophets among you, or those who have dreams about the future, and they promise you signs or miracles, and the predicted signs or miracles take place. If the prophets then say, 'Come, let us worship the gods of foreign nations,' do not listen to them. The LORD your God is testing you to see if you love him with all your heart and soul. Serve only the LORD your God and fear him alone. Obey his commands, listen to his voice, and cling to him. The false prophets or dreamers who try to lead you astray must be put to death, for they encourage rebellion against the LORD your God, who brought you out of slavery in the land of Egypt. Since they try to keep you from following the LORD your God, you must execute them to remove the evil from among you. (Deuteronomy 13:1-5 NLT)<br />
<br />
<br />
<br />
2) But any prophet who claims to give a message from another god or who falsely claims to speak for me must die.' You may wonder, 'How will we know whether the prophecy is from the LORD or not?' If the prophet predicts something in the LORD's name and it does not happen, the LORD did not give the message. That prophet has spoken on his own and need not be feared. (Deuteronomy 18:20-22 NLT)<br />
<br />
<br />
<br />
<b>Infidels and Gays Should Die</b><br />
<br />
So God let them go ahead and do whatever shameful things their hearts desired. As a result, they did vile and degrading things with each other's bodies. Instead of believing what they knew was the truth about God, they deliberately chose to believe lies. So they worshiped the things God made but not the Creator himself, who is to be praised forever. Amen. That is why God abandoned them to their shameful desires. Even the women turned against the natural way to have sex and instead indulged in sex with each other. And the men, instead of having normal sexual relationships with women, burned with lust for each other. Men did shameful things with other men and, as a result, suffered within themselves the penalty they so richly deserved. When they refused to acknowledge God, he abandoned them to their evil minds and let them do things that should never be done. Their lives became full of every kind of wickedness, sin, greed, hate, envy, murder, fighting, deception, malicious behavior, and gossip. They are backstabbers, haters of God, insolent, proud, and boastful. They are forever inventing new ways of sinning and are disobedient to their parents. They refuse to understand, break their promises, and are heartless and unforgiving. They are fully aware of God's death penalty for those who do these things, yet they go right ahead and do them anyway. And, worse yet, they encourage others to do them, too. (Romans 1:24-32 NLT)<br />
<br />
<br />
<br />
<b>Kill Anyone who Approaches the Tabernacle</b><br />
<br />
For the LORD had said to Moses, 'Exempt the tribe of Levi from the census; do not include them when you count the rest of the Israelites. You must put the Levites in charge of the Tabernacle of the Covenant, along with its furnishings and equipment. They must carry the Tabernacle and its equipment as you travel, and they must care for it and camp around it. Whenever the Tabernacle is moved, the Levites will take it down and set it up again. Anyone else who goes too near the Tabernacle will be executed.' (Numbers 1:48-51 NLT)<br />
<br />
<br />
<br />
Kil<b>l People for Working on the Sabbath</b><br />
<br />
The LORD then gave these further instructions to Moses: 'Tell the people of Israel to keep my Sabbath day, for the Sabbath is a sign of the covenant between me and you forever. It helps you to remember that I am the LORD, who makes you holy. Yes, keep the Sabbath day, for it is holy. Anyone who desecrates it must die; anyone who works on that day will be cut off from the community. Work six days only, but the seventh day must be a day of total rest. I repeat: Because the LORD considers it a holy day, anyone who works on the Sabbath must be put to death.' (Exodus 31:12-15 NLT)<br />
<br />
<a href="http://www.evilbible.com">www.evilbible.com</a>
|
{
"pile_set_name": "Pile-CC"
}
|
Captain Bancaflor of the Anastasia S on Voyage Length
The captain of a large bulk ship describes its complicated schedule which includes stops in Mexico, New Jersey and Germany with various kinds of cargo, from rock salt to coal. The single leg between Cedrus, Mexico and Port Newark takes more than two weeks.
|
{
"pile_set_name": "Pile-CC"
}
|
Multi-locus species delimitation in closely related animals and fungi: one marker is not enough.
Despite taxonomy's 250-year history, the past 20 years have borne witness to remarkable advances in technology and techniques, as well as debate. DNA barcoding has generated a substantial proportion of this debate, with its proposition that a single mitochondrial sequence will consistently identify and delimit species, replacing more evidence-rich and time-intensive methods. Although mitochondrial DNA (mtDNA) has since been the focus of voluminous discussion and case studies, little effort has been made to comprehensively evaluate its success in delimiting closely related species. We have conducted the first broadly comparative literature review addressing the efficacy of molecular markers for delimiting such species over a broad taxonomic range. By considering only closely related species, we sought to avoid confusion of success rates with those due to deeply divergent taxa. We also address whether increased population-level or geographic sampling affects delimitation success. Based on the results from 101 studies, we found that all marker groups had approximately equal success rates (~70%) in delimiting closely related species and that the use of additional loci increased average delimitation success. We also found no relationship between increased sampling of intraspecific variability and delimitation success. Ultimately, our results support a multi-locus integrative approach to species delimitation and taxonomy.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
"Xena, what does this herb look like?" "A mushroom." "Just a plain old mushroom." "I think this is it." "[ Groans ]" "You're telling me that this is going to help you with morning nausea?" "That's what they say." "Come on." "Give me, give me." "All right." "Well, bottoms up." "Some warrior, huh?" "You look beautiful." "[ Scoffs ]" "You do." "I feel like a slug." "A pregnant slug." "You're happy, Xena." "Oh, yeah?" "Yeah." "You know how I know?" "No." "'Cause it's the only time you make fun of yourself." "Well, maybe I'm happy 'cause I know I don't have to go through this alone." "I'm not eating mushrooms." "[ Chuckles ]" "[ Whooshing ] [ Moans ] Gabrielle." "You okay?" "[ Heartbeat ]" "Yeah." "Yeah." "I think it was just a cramp." "[ Moans ]" "Do I take you to a healer?" "[ Screaming ]" "Come on." "Bring her in quickly." "Come on!" "Gabrielle!" "Gabrielle!" "Right here." "Right here." "Something's gone wrong." "Something's wrong." "[ Sobs ]" "How far along is she?" "About a season." "No!" "Get me something!" " Healer, give her something!" " Get it off me!" " I've never seen anything like this." "[ Screams ]" "Get it off me!" "Get it off!" "Get this off me!" "[ Growling ]" "[ Screaming ]" "[ Panting ]" "Gabrielle?" "Gabrielle!" "It's okay." "You were just dreaming." "It's okay." "When your friend brought you in, you were in considerable pain." "I gave you a sedative." "My baby." "I can't find anything physically wrong with you or your child." "The best thing for both of you now is bed rest." "A trader told me he saw you come in here." "Are you okay?" "She just needs more sleep." "What are you doing?" "Yakut-- she'll know what to do." "Who's Yakut?" "Shamaness." "Leader of the Northern Amazons." "TheNorthernAmazons." "Isn't that a long journey for a pregnant woman to take?" "That was no dream I had." "It was a premonition." "Something's trying to kill my baby." "[ Man Narrating ] In a time of ancient gods-- [ Xena Yells ] warlords and kings, a land in turmoil cried out for a hero." "She was Xena, a mighty princess forged in the heat of battle." "The power." "The passion." "The danger." " [ Kiaiing ]" "Her courage will change the world." "[ Horse Neighing ]" "[ Woman ] She's come." "Xena's here." "Welcome, Xena." "We've been expecting you." "Let me guess." "She saw it in some kind of vision." "In fact, I did." "It's good to see you again, Yakut." "Come." "We have much work to do." "Your child is being drained of its life force in the spiritual realm." "Tell me what you saw." "The entity that stalks your child, Xena, bears the mark of the shamaness." "You know who it is, don't you?" "Alti." "I wanna tap into the heart of darkness-- the sheer naked will behind all craving." "The hatred and violence." "I'll become the face of death itself, capable of destroying not only a person's body, but their soul." "But Xena killed Alti." "That's why she can only attack through the spiritual realm." "Wait a minute." "I'm still a little confused on this whole spiritual realm thing." "Nature is composed of several planes of reality, Amarice, and they're all united by one thing-- the mind." "Oh, yeah." "That explains it." "Think of it this way." "In the day, when you're awake is one reality." "At night, when you dream, is another." "And what all these realities have in common... is your awareness of them." "Then how do we kill someone that we can't see?" "Xena is preparing to do battle with Alti in her realm." "But I'm afraid in her condition, she won't win." "Then I guess I have to convince her to let me go." "No." "I have seen Alti rip the hearts out of people that I love." "I'm not going to take that chance with you." "Xena, we don't have a choice." "I was there in India." "I know who we're dealing with." "I might not have the strength to stop Alti, Gabrielle, but I can stop you." "Xena, I love your baby like it were my own." "I will do anything I have to to fight for its life." "And I deserve that chance as much as you do." "Let me." "Looks like you're going to learn the ways of the shamaness... sooner than I thought." "[ Xena's Voice ] The ritual of crossing over." "To do battle with Alti on the spiritual plane, you must be unified... with one who's recently passed over." "Choose a creature of the forest." "This being, killed with a ceremonial dagger of a shamaness, will be your bridge to the realm of souls." "[ Stag Bleats ]" "[ Woman Chanting ]" "[ Continues ]" "[ Continues ]" "Just as daughter becomes mother, the student becomes the teacher." "Their strength will be their unity." "Their courage will be their guide." "Give me your hand." "The stag's blood mingled with your own... will carry you across to the other side." "My blood mixed with yours... will be your link to the physical world." "When you drink, you will begin to cross over." "Carry the dagger with you." "On no account should you let go of it." "It's our only chance to kill Alti in the spiritual realm." "If we can destroy her there, we destroy her soul." "I understand." "Remember, don't let go of the dagger." "I won't." "Xena, don't let go of me." "Never." "[ Continues ]" "[ Moaning ]" "[ Fire Crackling ]" "[ Water Splashing ]" "[ Bird Chirping ]" "Xena's little bitch." "[ Grunts ]" "Welcome to the doghouse." "[ Shuddering ]" "You see, things aren't exactly the way they are in your realm." "Use your dagger, Gabrielle." "Here, the strongest mind wins." "[ Groaning ]" "Keep going, Gabrielle." "Your war is with Xena, not her child." " You've got me all wrong." " [ Groans ]" "I don't wanna hurt the baby any more than you do." "I need it to be born." "[ Gasps ]" "Fortunately, I don't need you." " [ Groans ]" " You have the dagger." "Use it." "Alti." "All right, Gabrielle, that's enough." "Come back now!" "[ Grunts ]" "All right, that's enough!" "I'm gonna count to ten, and during this... you will feel your body shutting down." "Your heart will stop." "You will cease to breathe." "[ Moans ] And at the count of ten, you will die." "I want you back here." "Gabrielle, you can do no more good!" "One" " Can you hear me?" " two, three, four" "Sharp pains in your arms as your blood pressure lowers." "Six" " Your brain is screaming." " Seven" " Gabrielle." "eight" "Alti's not gonna defeat us this time." "Come on, Gabrielle." " nine-- - [ Gasps ]" "One more count and you will be dead." "Gabrielle, this is not your destiny." "Come on." "Ten!" "Come on, Gabrielle!" "No." "Come on." "No." "Come on." "[ Gasps ]" "I got ya." "I got ya." "I got ya now." "Don't you ever do that again." "You never do that again." "I failed." "You made it back in one piece, didn't you?" "Believe it or not, I feel a whole lot better now." "You managed to buy us some time." "There's something else." "Alti doesn't want to hurt your baby." "She wants it to be born." "What does that mean?" "Alti wants to steal my baby's soul." "She wants to replace it with her own." "I'll try again." "No." "You barely made it back the last time." "Yakut, you remember the burial ritual for restless souls?" "That ritual never worked, Xena." "Well, unless you got a better idea, we've got no choice." "The tree of amber grows in the temple of Chi'ah." "If we can get our hands on some of it, we can use it to cover Alti's remains." "How will that stop her?" "When the amber hardens, it will trap Alti's soul." "[ Amarice ] Sounds easy enough." "All right, we'll split up." "Yakut, you come with me." "We're going to go and dig up Alti's grave." "Gabrielle, I want you and Amarice to go to the temple." "Bring back some of the amber." "A word of warning." "The tree is guarded by an Amazon mystic named Chi'ah." "She has the power to see the truth in your heart." "You may lie to yourself, but you can't lie to Chi'ah." "I'm ready." "Then what are we waiting for?" "[ Horse Neighing ]" "[ Yakut ] We're close." "She knows we're coming." "Is something wrong?" "No." "It's you I'm worried about, Xena." "There aren't many women in the world who can carry both child... and weapon with equal grace." "And yet, I sense that your heart is not yet fully committed to motherhood." "Part of me wants this child so bad... that I'm counting the days till I have it." "Another part of me wonders if bringing a child into this world... is the right thing to do." "It's not even born yet, and already it's suffering." "And you blame yourself?" "Of course." "It's my child." "It's my responsibility." "You're right." "Do you remember the story of the world tree?" "Of course." "Shaman elders believe that at the golden navel of the earth... there is a tree that has more branches than even the gods can count." "And on these branches perch the souls of unborn children." "The part I didn't tell you... is that when a mother finally accepts what she is about to become, the child will send her a message in the form of a dove." "And what does it say?" "Thank you." "You've come a long way since I first met you." "I wish that were true." "[ Caws ]" "The skull's missing." "Who would come all this way to rob a... grave?" "This is all my fault." "I wanted to harness Alti's power to use it for good." "I needed her skull for my ritual." "But all I did was unleash her soul." "And now you and your baby are paying the price." "I'm so ashamed." "I didn't want to disappoint you." "Disappoint?" "You don't wanna disappoint me?" "Yakut, my friend almost died yesterday." "I know." "And that's why I want to finish what you two started." "Let me face Alti myself." "No!" "We stick to the plan." "[ Fire Crackling ]" "Yakut." "Yakut." "[ Chanting ]" "[ Screaming ]" "[ Chanting Stops ]" "Yakut, what do you think you're doing?" "I thought you were hurt!" "I'm okay." "I wanted to defeat Alti myself." "I needed your forgiveness." "[ Groaning ]" "I've always wanted to be inside of you, Xena." "[ Screams, Gasps ]" "Xena?" "It's such a pleasure to see you again, Xena." "Or should I call you Mommy?" "There aren't many guarantees in life, Alti, but I promise you this." "If you harm my child," "I will hound you" "I will hound you throughout all time and between worlds." "I will be your eternal damnation." "Well, at least we'll be together again." "I've so missed these intimate little moments." "I'd kill myself before I'd let your soul replace my child's." "Tempting, but no." "I like having you around too much." "I have a way that we can both win, Xena." "I'll give you your soul of your child, but you must bring me back to the physical world." "I can't do that." "Not by yourself, but if you convince the Amazons... to put their minds to it, then anything is possible." "[ Screams ]" "[ Chuckling ]" "[ Shuddering ]" "I'm sorry." "Let's get back to camp." "[ Amarice ] Sure this is the right cave?" "Yeah, I think so." "All right." "Well, let's get the amber and get out of here." "What about Chi'ah?" "What, the mystic that can see right through you?" "Ooh, scary." "[ Chi'ah's Voice ] No need for me to appear frightening, my child." "Facing oneself can be crippling, even for the most hardened warrior." "We've come for the-- Amber." "Will you help us?" "As the Amazon protector of the sacred amber," "I can only release it to a fellow Amazon." "And one of you is not an Amazon." "I can see the truth, Amarice." "And you dare to come here... hiding behind an identity you have not earned." "Is that true?" "You, on the other hand, may pass." "I've got it." "You and Xena were right." "What you see isn't always what you get." "I thought if I denied that enough times, I'd make it true." "I had no identity, so I created one, the thing I always wanted to be-- an Amazon." "You know, I just wanted to feel like part of something." "Amarice," "look, for many years I walked in Xena's shadow." "I wanted to be her." "She taught me something." "It's warmer standing in the sun." "Yeah." "[ Sighs ] Well, you better get going." "She's waiting for you." "She's waiting for us." "Come on." "We have the amber." "What happened to you?" "I'm okay." "Alti's got the baby's soul." "What do we do?" "We can't use the amber until we know the baby's soul is safe." "Otherwise, we'll risk trapping them both forever." "The strongest mind wins." "We're gonna have to beat Alti at her own game." "What are you thinking?" "She wants us to bring her back." "Why don't we do that?" "] [ Chanting" "[ Thunderclaps ]" "Our focus is our unity, our minds, the creator of worlds." "[ Continues ]" "[ Chanting Stops ]" "[ Gasps ] What's it gonna be, Xena?" "All right, you win." "You give me my child's soul, and I will take you back to my world." "Tsk, tsk." "First you take me back, then you get your child." "The ritual's already begun." "All you have to do is take my hand." "I knew you'd see things my way." "[ Thunderclaps Continue ]" "[ Bones Rattling ]" "Now the real fun starts." "All right, Alti." "Give me back my child's soul." "Motherhood has made you weak." "The Xena I knew would have never given into this so easily." "You're right." "I'm a big softie." "Now, a deal's a deal." "Is it?" "Even in this world, I'm even more powerful than you ever dreamed." "You'd be surprised what I can summon up in my dreams." "[ Hisses ]" "Do you think we fooled her?" "What have you done?" "When you thought you were stepping into the real world, you let your guard down." "I took you from one dream world into another." "Welcome!" " [ Hisses ]" " Like you said, once you put your mind to it, anything's possible." "Imagine what several can do." "[ Xena Kiaiing ]" "[ Both Grunting ]" "Come on, Xena." "Give me a signal!" "[ Groaning ]" "[ Groaning ]" "[ Moans ]" "[ Alti Laughing ]" " She's killing her." "We should get her out." " Give her more time!" "[ Xena ] This is gonna hurt." "Hyah!" "You have something that belongs to me." "[ Rumbling ]" " Did you feel that?" " She's got her baby." "That's the sign." "Xena!" "[ Screaming ]" "Stay out of my nightmares." "[ Screaming ]" "[ Alti's Voice Screaming ]" "[ Screaming Continues ]" "[ Screaming Stops ]" "Xena, come on." "[ Gasps ]" "Gabrielle." "[ Moans ]" "You did it." "We did it." "Xena must think I'm a joke." "I didn't tell her what Chi'ah said." "Why not?" "Because I don't think it's true anymore." "I have this Amazon necklace, and... it's from my tribe." "There's a stone on here for all my sisters." "I just added another one... for you." "Thank you." "Better hurry." "Xena and I are ready." "Actually, Gabrielle, um, I'm gonna stay here, learn a few things." "Okay." "See ya." "I don't know what to say." "What would you say to any friend who was leaving for a time?" "You're not like any other friend." "I'll miss you, Xena." "Take care of yourself, Yakut." "Be careful." "It doesn't take a vision... to know the child of Xena is gonna be someone to behold." "You'll be a target again, and so will your baby." "I know." "That's why I'm headed east." "I figure I could learn a few new tricks." " Your baby's lucky to have you." "[ Dove Cooing ]" "I'm the lucky one." "Closed-Captioned By Captions, Inc., Los Angeles"
|
{
"pile_set_name": "OpenSubtitles"
}
|
Traditional Straight Sword
W027-T-26"
Sale
$39.95
Regular price
$59.95
Length
Quantity
The Traditional Straight Sword blade is made with cold-rolled, chrome plated steel. It is lightweight with a stiff blade having virtually no flex. These traditional straight swords are available in 26", 27", and 29" blade lengths. The fittings made of strong steel, and the whole package gives a very utilitarian, functional look. The design of the scabbard and fittings are done in the traditional style. The straight swords are perfect for traditional practice, demonstration, or competition. They can also be used as an excellent means of strength conditioning by wushu players used to light-weight, flexible weapons...a noticeable increase in speed and power can be achieved through practicing with heavier weapons.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Remove an image using CSS attributes
I have a set of identical images that I don't wish to display, I hope to do this with display:none;
How can I target a src image url with CSS attributes?
So far, I have:
[src="mypic_68.png"] {
display:none;
}
A:
I think you have src like this: src="images/mypic_68.png" then your code won't work. You may use:
[src$="mypic_68.png"] { //$ to indicate ending with
display:none;
}
Here, you can find all attribute selectors.
|
{
"pile_set_name": "StackExchange"
}
|
ve of -3635523*q**6 - 2*q**2 + 63650*q + 7?
-436262760*q**3
Differentiate -1889*t**3*w**2 - t**3 + 7*t**2*w**2 + 131*t + 109 wrt w.
-3778*t**3*w + 14*t**2*w
What is the first derivative of 140421*j - 372529 wrt j?
140421
Differentiate -f*n*r + 2*f*r + 29*f + 539*n**3*r - 5*n**2*r**2 - 7*r**2 + r + 75 with respect to n.
-f*r + 1617*n**2*r - 10*n*r**2
Differentiate 64713*o*t - 217824*o + 5*t with respect to t.
64713*o + 5
What is the derivative of z**2 + 2337*z - 22082 wrt z?
2*z + 2337
What is the third derivative of 2*f**2*h**3 + 6518*f**2 - 516*f*h**4 - 3*f*h**2 - 3*h**4 wrt h?
12*f**2 - 12384*f*h - 72*h
What is the second derivative of -4466157*y**2 - 26*y + 12507 wrt y?
-8932314
What is the third derivative of 3507302*u**3 - 1225*u**2 + 4*u + 13?
21043812
What is the second derivative of 39556*g**2 - 443*g?
79112
What is the third derivative of -46*c*h**3 + 4*c*h**2 - 225*c*h - c + 7*h**5 + 10*h**4 - 3*h**2 wrt h?
-276*c + 420*h**2 + 240*h
What is the second derivative of -24114*l**4 - 35179*l - 6?
-289368*l**2
What is the derivative of -16031*n**2 - 73947?
-32062*n
What is the derivative of 150149*m**4 + m**2 - 96341?
600596*m**3 + 2*m
Find the second derivative of -26540*d**5 - 22733*d wrt d.
-530800*d**3
Find the second derivative of -19785*i**2*n + 5*i + 1951*n wrt i.
-39570*n
What is the second derivative of 464212*d**5 + 12*d + 61166 wrt d?
9284240*d**3
What is the second derivative of 2*d**3*l**2 + 208*d**3*l - 2*d**2*l**2 - 6*d - 797*l**2 + 2 wrt d?
12*d*l**2 + 1248*d*l - 4*l**2
What is the third derivative of -176*a**5 + a**4 + 4*a**3 - 2*a**2 - 31308 wrt a?
-10560*a**2 + 24*a + 24
Differentiate 2*x**3 + 3*x**2 + 354270*x + 2914378 wrt x.
6*x**2 + 6*x + 354270
What is the second derivative of -19027*t**4*z + 47093*t*z wrt t?
-228324*t**2*z
What is the first derivative of -2*l**3 - 77*l*n - 217*l - 332237*n wrt l?
-6*l**2 - 77*n - 217
Differentiate -642272*j*v - 342711*j + 4 wrt v.
-642272*j
What is the second derivative of x**3 + 1687*x**2 + 6*x - 447 wrt x?
6*x + 3374
Find the second derivative of -g**3*u**2*v - 7*g**3*u**2 + 23634*g**3*v**2 + 4*g**3 + 7*g**2*u**2*v**2 + 8*u**2 - 41*u wrt v.
47268*g**3 + 14*g**2*u**2
Find the second derivative of -34*g**3*r*w**2 - 4416*g**3*w**2 + 2*g*r + g*w**2 + 21*r*w**2 - 4*r*w + 141*w wrt g.
-204*g*r*w**2 - 26496*g*w**2
What is the second derivative of 33*b**2*q**2 + 235*b**2 - 5*b*q**2 - b + 5*q**2 - 3*q + 2 wrt q?
66*b**2 - 10*b + 10
What is the second derivative of -58006*b**5 + b**4 - 14*b + 10143 wrt b?
-1160120*b**3 + 12*b**2
What is the first derivative of 578314*k**2 + 623243?
1156628*k
Find the second derivative of 82475*b**2*o**2 - 2*b**2*o - 133339*b**2 wrt o.
164950*b**2
Find the first derivative of -73852*p - 184983 wrt p.
-73852
What is the first derivative of -2*t**2*z - 54108*t*v + 3117*v*z + z wrt t?
-4*t*z - 54108*v
What is the first derivative of 51613*t**2 - 59861?
103226*t
What is the first derivative of -3229495*j + 519439 wrt j?
-3229495
Find the second derivative of -7*d*g**4 - 386*d*g**3 + 2*d*g**2 - 18654*d*g + 2*d wrt g.
-84*d*g**2 - 2316*d*g + 4*d
What is the second derivative of -270*j**4 - 34*j**3 + 2*j - 41162?
-3240*j**2 - 204*j
What is the second derivative of -17402*b**4 - b**3 + 174*b - 23?
-208824*b**2 - 6*b
Find the third derivative of 35070*x**6 - 49*x**2 + 3*x.
4208400*x**3
Differentiate 12*c*u**2 + 910*c*u + 2*c + 41489*u**2 - u + 1 wrt c.
12*u**2 + 910*u + 2
What is the second derivative of 3711*d**3 - 5*d**2 + 92*d - 84 wrt d?
22266*d - 10
Find the third derivative of -414753*m**4 + 43311*m**2 + 48.
-9954072*m
What is the third derivative of 2812364*r**3 - 3003429*r**2?
16874184
Find the third derivative of 1262336*s**3*u - 33*s**2*u + 9*s**2 + 105*u wrt s.
7574016*u
Find the first derivative of 1773*d*m*y + d*y + 2*d + 11049*m*y - 2*m - 3*y wrt d.
1773*m*y + y + 2
Find the third derivative of 58949*l**5 + 4*l**2 + 5834*l + 4.
3536940*l**2
What is the second derivative of 795419*v**4 + v**3 - 4013*v - 100?
9545028*v**2 + 6*v
What is the second derivative of -1150*r**4 + 18*r**3 - 6*r**2 - 1911742*r - 1?
-13800*r**2 + 108*r - 12
What is the second derivative of -55*j*o**2 + j - 1779*o**4 + 3026*o wrt o?
-110*j - 21348*o**2
What is the derivative of 711106*s**4 + 513341?
2844424*s**3
What is the second derivative of -19*d**3 - 793*d**2 + 91233*d?
-114*d - 1586
What is the third derivative of 41*s**4 + 354*s**3 - 64*s**2 - 9*s + 25 wrt s?
984*s + 2124
What is the first derivative of 126*y**2 - 7*y - 172212 wrt y?
252*y - 7
Find the second derivative of 9*y**4 - 118*y**2 - 455*y - 123.
108*y**2 - 236
Find the second derivative of 2624781*v**3 + 3174711*v wrt v.
15748686*v
Find the third derivative of 377451*o**4 - 1000*o**2 - 31.
9058824*o
Find the third derivative of -92*c**5*h - 1102*c**3*h - c**2*h + c**2 + 3*c + 6749*h wrt c.
-5520*c**2*h - 6612*h
What is the third derivative of 16934*q**4 + 21*q**3 + 350*q**2 - 29?
406416*q + 126
Find the third derivative of -11*d**3*n*y**3 - 1974*d**3*n - 4*d**3*y**3 + 12580*d**2*n*y**3 - d**2*y**3 + d*n*y - 3*n*y**3 - y**2 wrt d.
-66*n*y**3 - 11844*n - 24*y**3
Differentiate -4579659*s*t - 2092*s - 67 wrt t.
-4579659*s
What is the derivative of 8291*n**3*q*t**3 + 3*n**2*q*t**3 - q*t**2 + 139*t**3 - 2*t**2 wrt n?
24873*n**2*q*t**3 + 6*n*q*t**3
What is the third derivative of -795277*w**3 - 276*w**2 + 1502*w?
-4771662
Find the second derivative of -1893735*s**2 - 16*s + 23313 wrt s.
-3787470
Find the second derivative of 1505976*h**2*q - 13594*h*q - 9*h - 3 wrt h.
3011952*q
Find the second derivative of 2*d**3*l**2 - 2*d**2*l**2 - 861*d**2*l - 657*d + 3*l**2 - 1 wrt d.
12*d*l**2 - 4*l**2 - 1722*l
What is the derivative of -190*i*m**4 - 112*i - 293*m**4 + 334 wrt m?
-760*i*m**3 - 1172*m**3
What is the second derivative of 747*i**5*w - 10*i**5 - 3*i*w - 2*i + 2*w - 413 wrt i?
14940*i**3*w - 200*i**3
Find the third derivative of 232824*t**3 - 228500*t**2 wrt t.
1396944
What is the first derivative of -14813*b**4*l - 2*b**2*l - 20306*l wrt b?
-59252*b**3*l - 4*b*l
Find the third derivative of -5*a**3*s**5 + a**3*s + 4*a**2*s**2 + 14001*s**4 + 2545*s wrt s.
-300*a**3*s**2 + 336024*s
Find the third derivative of 935*c**2*x**4*y**2 - 6*c**2*x**2*y**2 - 2*c**2*x**2 + 177*c**2*x*y**2 - 233*c*x**4 + 9*x**2*y - x**2 + 2*y**2 wrt x.
22440*c**2*x*y**2 - 5592*c*x
What is the third derivative of 3*a**5 - 5839*a**4 + 7*a**3 + 94531*a**2 wrt a?
180*a**2 - 140136*a + 42
What is the derivative of 62*u**3 + 45*u**2 + u - 24616?
186*u**2 + 90*u + 1
What is the third derivative of -5*y**5 - 76*y**4 - 25*y**3 - 71370*y**2 wrt y?
-300*y**2 - 1824*y - 150
What is the second derivative of -153336*b**3 + 645941*b wrt b?
-920016*b
Differentiate 862912*s + 352506.
862912
Find the third derivative of -2*c*j**2*m**4 - c*j**2*m**2 - 4*c*j*m**3 + 22031*j**2*m**2 - 360*m**4 wrt m.
-48*c*j**2*m - 24*c*j - 8640*m
What is the first derivative of -45245*j*o - 4*j - o - 164494 wrt j?
-45245*o - 4
Find the second derivative of -5983*y*z**2 + 3*y*z - 8749*y + 7*z**2 wrt z.
-11966*y + 14
What is the third derivative of -14405*r**6 + 7*r**3 + 860*r**2 - 18?
-1728600*r**3 + 42
Find the first derivative of 151817*j**3 - 6*j**2*t**2 + 3675215*t**2 wrt j.
455451*j**2 - 12*j*t**2
What is the first derivative of 976368*n**2*z - n**2 + 581967*n - z wrt z?
976368*n**2 - 1
What is the third derivative of 1056*k**3*m**3 - k**3*m + 13*k**2*m**3 + 15*k*m - 27*m**2 wrt m?
6336*k**3 + 78*k**2
Find the third derivative of -637249*u**3 - 547941*u**2.
-3823494
What is the derivative of -3240479*q + 2935724?
-3240479
Find the third derivative of -38316*g**3*h**3*t - 4*g**3*h*t - g**3 - 2*g**2*h**2*t - 21*g**2*t + 3*g*h*t - h**3 - 81*h*t wrt g.
-229896*h**3*t - 24*h*t - 6
What is the second derivative of -32158*d**3*t**3 + 17*d*t**3 - 57*d*t wrt d?
-192948*d*t**3
Find the second derivative of 604610*g**2 - 4*g - 141700 wrt g.
1209220
What is the second derivative of -7496*a**2 - 31143*a?
-14992
Find the third derivative of 36850*m*z**5 + 8*m*z**2 - 10*z**5 + 93523*z**2 wrt z.
2211000*m*z**2 - 600*z**2
Find the first derivative of -20*b**2*x**3 - 1606070*b**2 + 36849*x**4 wrt x.
-60*b**2*x**2 + 147396*x**3
Find the second derivative of 2037193*x**5 - 806849*x - 2.
40743860*x
|
{
"pile_set_name": "DM Mathematics"
}
|
Taking the Long View - Sustainability in Tertiary Education
Taking the Long View - Sustainability needed in uni education
By Gord Stewart
“Many things on which our future health and prosperity depend are in dire jeopardy: climate stability, the resilience and productivity of natural systems, the beauty of the natural world, and biological diversity.It is worth noting that this is not the work of ignorant people. Rather, it is largely the work of people with BAs, BScs, LLBs, MBAs and PhDs.”
Noted academic and environmentalist, David W Orr, made the above observation. Harsh words, perhaps, but why beat around the bush.
You’d swear he was talking about our current National Government, given their policies relating to the likes of climate change, biodiversity, and plastics in the environment. He actually penned those words back in 1994 in his thoughtful book. Earth in Mind: On Education, Environment, and the Human Prospect.
In spite of the good work of David Orr and other academic leaders over the years, coverage of sustainability issues remains a minor, even marginal, part of the university curriculum. Thus, it’s highly possible for students to complete a university degree and have little idea of the kind of world they are graduating into.
With hopes of change and improvement, a recent study looked at how well New Zealand universities are integrating sustainability into the curriculum and what leading overseas institutions could teach us.
Nine innovative universities in five countries were studied. Of the group, Chalmers University of Technology in Sweden has the longest running commitment to sustainability across the curriculum, growing out of a policy established there in 1985.
Now 10 years into its efforts, The University of Plymouth in the UK has nearly half its courses with an embedded or major sustainability element. At Emory University in the US, sustainability issues are now integrated into the likes of nursing, mathematics and language courses – not disciplines one would normally expect.
Macquarie University in Australia, the UK’s Nottingham Trent University and the University of British Columbia in Canada have innovative training programmes. They provide faculty members with the knowledge, skills and resources needed to integrate sustainability into what they teach.
Arizona State University in the US and Dalhouse University in Canada have taken it a step further. ASU established its School of Sustainability in 2006, while Dal opened the doors of its College of Sustainability in 2009. Australian National University has its Fenner School of Environment and Society. The three of them offer a range of sustainability degrees and diplomas.
All nine universities emphasise experiential learning in sustainability education. They use the campus and surrounding community as a ‘living laboratory’. Student internships and work placements with partner organisations are common.
Developments at New Zealand’s universities pale in comparison. The research suggests that less than 10 percent of current courses would address sustainability in even the most modest of ways.
Progress is evident, but it’s perhaps best captured in a comment made by David Blackstein of the US National Council on Science and the Environment when he said: “The glaciers are melting faster than the curriculum is changing.”
To its credit, Lincoln University has a foundation paper and second-year core paper compulsory for all students (though with changes there they are under threat).
The shining light looking ahead is Victoria University of Wellington. Last year the university created the position of assistant vice-chancellor (sustainability). A ‘Sustainability 101’ paper will soon be offered and, in time, there are hopes for sweeping changes.
Why bother with all of this? Three very good reasons: Properly embedding sustainability across the curriculum will lead to improved quality and relevance of education for all enrolled students. It will better prepare domestic students for meaningful work at home and abroad. And it will strengthen offerings to attract foreign students in a competitive international education marketplace.
As higher education faces rising costs, funding challenges, and disruptions through the likes of open online courses, a focus on sustainability could provide a source of hope and opportunity for institutional change and a renewed sense of mission.
Returning to David Orr. Reflecting on the immense possibilities, he has said, “Educational institutions committed to the real work of building a sustainable and decent human future and willing to learn what that requires of us would be exciting and challenging places. More to the point, they would equip the rising generation to see that the world is rich with possibilities and prepare them to act competently in that light.”
Gord Stewart is an environmental sustainability consultant. He does project work for government, industry, and non-profit organisations.
© Scoop Media
|
{
"pile_set_name": "OpenWebText2"
}
|
Simultaneous ocular and systemic cysticercosis and tuberculosis.
Human cysticercosis and tuberculosis are endemic diseases in developing countries. Both these diseases have certain common factors of origin. We would like to present the co-existence of these infections in a 20-year-old female. She was a known case of pulmonary and ocular tuberculosis and she acquired cysticercosis of the eye and brain.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
(b) -21 (c) 86
a
Which is the closest to 0.099? (a) 24 (b) 0.4 (c) -1/8 (d) 0
d
What is the closest to 0.276 in 2/9, -2, -5, -0.59?
2/9
What is the closest to -64 in -1, 4, -5/6, -5, 0.3?
-5
What is the nearest to 0.3 in -2/15, 2/29, 2/15, -725, -3?
2/15
Which is the nearest to -2/125? (a) -2 (b) 0 (c) 1.4
b
What is the closest to 19/14 in -4, -0.9, 0.5, 2/3, 3?
2/3
What is the closest to -3 in 0.1, -2/5, 0.0222, -4?
-4
Which is the closest to -2? (a) -2/15 (b) 2297 (c) 1 (d) -2 (e) 6/5
d
Which is the closest to -8.7? (a) 2 (b) -2 (c) -2/19 (d) 1 (e) -153
b
Which is the nearest to 1/6? (a) 0.3 (b) 4 (c) 6/7 (d) -325 (e) -5
a
What is the nearest to 1 in 0, 0.1015, 11/6?
11/6
What is the closest to -3840/41 in -2, -0.2, 4/7, 1/3?
-2
Which is the closest to 38? (a) -0.095 (b) -2 (c) -5 (d) -7
a
Which is the closest to -2? (a) 9/4 (b) 0.9 (c) 18 (d) 1/8 (e) 3
d
What is the nearest to 0.1 in 0.4, 94/13, 28, 5/4?
0.4
What is the closest to 0 in -7793, 5, 0.2, -3/10?
0.2
Which is the closest to 0? (a) -1/3 (b) -0.15 (c) -3.3
b
Which is the nearest to 7/5? (a) 2/3 (b) -32.3 (c) 1 (d) 2 (e) 4
c
Which is the closest to -12? (a) 0.04 (b) 2 (c) 284
a
Which is the nearest to 0.2? (a) 26 (b) -1.3 (c) 0.1 (d) 0.4 (e) -2/19
c
What is the closest to -1 in -0.5, 0.02, 2/3, 0.2, 341?
-0.5
What is the closest to -10 in -1.29, 0.16, 1/4?
-1.29
What is the nearest to 0 in 0, 0.4, 3, 52.9?
0
What is the nearest to -1 in -4, -3, -0.3, -1/4, -3.7?
-0.3
Which is the nearest to 0.4? (a) 2 (b) 29 (c) 52
a
Which is the closest to -572? (a) -2/5 (b) -0.3 (c) 4/23 (d) 3/2
a
Which is the nearest to 2/3? (a) 0.19 (b) -182 (c) 0.2
c
Which is the closest to 1/61? (a) 2/5 (b) 5/3 (c) 3 (d) -3
a
What is the closest to 2/7 in -5, -1, -2/23, -11, -1/4?
-2/23
What is the nearest to -1/10 in -0.5, 117, -0.084, -4, 1/2?
-0.084
Which is the nearest to -0.1? (a) 0.4 (b) -0.08 (c) 65/44 (d) 4 (e) 1.5
b
Which is the closest to 0.3? (a) -4 (b) -2 (c) 39.03 (d) 1/6
d
What is the nearest to -0.2 in -123, -7, 5, -2.02?
-2.02
What is the closest to 13 in -2, 5, -5, -10?
5
What is the nearest to -60 in 82, 4, -1, -3?
-3
Which is the closest to 19? (a) -37 (b) -0.2 (c) -3/7
b
Which is the nearest to -1? (a) 2 (b) 0.38 (c) 3.3 (d) -2/7 (e) 2/5
d
What is the closest to 115 in -0.2, -0.1, 0?
0
Which is the closest to -8? (a) -0.6 (b) -6 (c) -1 (d) 3 (e) 2/9
b
What is the nearest to 4 in -5/3, -0.3, 35/2, 1/3, 1/30?
1/3
What is the nearest to -2/3 in 0.2, 469, 0.13, 2?
0.13
Which is the nearest to 0? (a) -0.12 (b) 1/4 (c) -39826
a
Which is the closest to 1/6? (a) -2/5 (b) -2 (c) -0.3 (d) 1 (e) -0.065
e
Which is the closest to 0? (a) -367 (b) 0.5 (c) 2/13 (d) -16
c
What is the closest to 0 in -3090, -3/8, 3, 0, 20?
0
Which is the closest to -286? (a) 0 (b) 0.2 (c) -50 (d) -1/3
c
What is the nearest to -1/5 in 0.5, 1/8, -13.1, 1, 0.6?
1/8
What is the nearest to -20.1 in -0.3, -6507, -5?
-5
Which is the nearest to 1? (a) -34847 (b) 3/7 (c) -0.4
b
Which is the nearest to -6/23? (a) 3/2 (b) -2/7 (c) -1/2 (d) -2/37
b
What is the closest to -69 in -17/5, -12/5, -1?
-17/5
What is the closest to -2 in -1/6, -60, -3, -12/13, 5?
-3
Which is the nearest to -0.01? (a) 4/17 (b) 1 (c) 2/15 (d) 2/3
c
What is the nearest to -38/5 in 1, 1/6, 2, -1937?
1/6
What is the closest to 0 in 1/3, -1/5, 4, -21646?
-1/5
What is the closest to -7/4 in -60, 5, -2, 34?
-2
Which is the nearest to 1/3? (a) -42/55 (b) -0.1 (c) -3/4 (d) -0.4
b
Which is the closest to 0.1? (a) 0.2 (b) -1 (c) 15959 (d) 4 (e) 2/21
e
Which is the closest to 61? (a) 1 (b) 1/5 (c) -0.4 (d) -0.02 (e) -3
a
Which is the nearest to 3.76? (a) 0.3 (b) 5 (c) -5 (d) 104
b
What is the closest to 0.1318 in 183, -1, -5?
-1
Which is the closest to 1/4? (a) -5 (b) -0.31199 (c) 2
b
Which is the closest to 8? (a) -5 (b) -4 (c) -8/521
c
What is the nearest to -0.08 in 2, 1/18, 125?
1/18
Which is the nearest to 8? (a) -2/29 (b) -0.2 (c) -0.329
a
What is the nearest to -0.1 in 0.1, 1/5, -23.9, 0.052, -1/2?
0.052
Which is the nearest to -11? (a) 0 (b) 1 (c) 0.8 (d) 0.138 (e) -1/6
e
What is the nearest to -8 in -2/11, 15, -1/2, -13, -30/13?
-13
Which is the closest to -0.5? (a) 13 (b) 7 (c) 4 (d) 2
d
What is the nearest to 1 in -9/8, -40, 2/5?
2/5
What is the nearest to -2/221 in -6, 5, -4?
-4
Which is the nearest to 0? (a) -3/134 (b) -1 (c) 177
a
What is the nearest to 1/4 in 0.3, -4221, -1/10, -4, -0.4?
0.3
What is the nearest to 0.1 in -5, -4, 199/5?
-4
What is the closest to -0.18 in -8, 1, 0.2, -2/13?
-2/13
What is the nearest to 10/3 in 1, 782, -0.2?
1
Which is the closest to -1/72? (a) 1 (b) -1 (c) -8/9 (d) 4/25 (e) -5
d
What is the nearest to -5 in -799, 0.2, 7/5, -5?
-5
What is the closest to 156 in 17, 0.3, 4/5?
17
What is the nearest to -1 in -3.5, -0.5, -4/9, 0.1?
-0.5
What is the closest to 0.2 in -2, -4/11, 169, -6?
-4/11
What is the closest to 75 in -0.7, 134, 4?
134
What is the closest to 4/3 in 160/21, 0.3, 3/5?
3/5
What is the nearest to -0.2 in -1/3, 0.1, 5/2, 0.07?
-1/3
Which is the closest to -3/14? (a) -1/3 (b) -4 (c) 1.3 (d) -3
a
What is the nearest to 17 in 2, -467, -1, -0.2?
2
What is the nearest to -0.1 in -1, 0.5, -5, 4, 0.74?
0.5
Which is the closest to 240? (a) -25 (b) -4/5 (c) -1/7
c
What is the nearest to 0.1 in -1/9, 4, -93/10, 0.5, 1?
-1/9
What is the nearest to -2 in 3/4, 1, 12/31, 0.9?
12/31
What is the closest to -25 in -0.3, 347, 1, -3/2?
-3/2
What is the closest to -2/9 in -5, -2/29, -0.1, -82/5?
-0.1
Which is the closest to -46? (a) 2/505 (b) 4 (c) -0.3
c
What is the nearest to -10 in -0.01, 0.9, -0.3, -36.8?
-0.3
What is the nearest to 1 in 3/7, 11/13, 99, -7?
11/13
Which is the closest to -40369? (a) 0.4 (b) 1 (c) -0.3 (d) 4
c
What is the nearest to 0.09 in 3, -5, -3, 0.008, -3/4?
0.008
What is the nearest to 2 in 5/8, -0.2, -0.85?
5/8
What is the closest to -7 in -1/8, -1.9, 0.5, -4?
-4
Which is the nearest to 12? (a) -3.3 (b) -5 (c) 0.04 (d) -0.4 (e) 3
e
Which is the nearest to 1.77? (a) -5 (b) -1/11 (c) -2/7 (d) -0.51 (e) -1
b
Which is the closest to 29? (a) 2/13 (b) -2.61 (c) -0.3 (d) 5
d
Which is the closest to -0.2? (a) 2 (b) 40 (c) -0.5 (d) -23 (e) 5
c
What is the closest to 23 in 5, 16, -0.25?
16
What is the nearest to 3 in 4, 5, 350/13?
4
Which is the nearest to -1115? (a) 4 (b) 0.1 (c) -103
c
What is the closest to -1 in -11, -0.05, 5, -19, -2?
-0.05
Which is the closest to -24? (a) 2 (b) 37 (c) -5 (d) -2/19
c
What is the closest to -3/2 in 1/2, -57/20, -0.4?
-0.4
What is the closest to -0.6 in 1/247, -2, 4, -5?
1/247
Which is the closest to 1/2? (a) -97/3 (b) 2 (c) 0.5 (d) -1/2
c
Which is the closest to -2/5? (a) -2 (b) 10/147 (c) -5
b
What is the nearest to -0.1 in -3, 31, 5, -0.3?
-0.3
What is the nearest to 52 in 2/13, 4/5, -9, -1/8?
4/5
Which is the closest to 2? (a) 45 (b) 4 (c) 5 (d) -4/7
b
Which is the nearest to 1/2? (a) 1/17 (b) -1 (c) -8 (d) -176
a
What is the nearest to -2 in -15/2, 1/13, 1/3, 1/2?
1/13
What is the nearest to 0 in -2, 7, 390/7?
-2
What is the nearest to 0.3 in -0.3, 1/4, -2/5, -7739, -2/13?
1/4
Which is the nearest to -4/5? (a) 5 (b) 1 (c) -6
b
Which is the closest to -2? (a) -16.8 (b) -4/71 (c) -0.2
c
What is the closest to 1/9 in -395, -11, -4?
-4
Which is the closest to -0.3? (a) -0.87 (b) -3 (c) 2/27
c
Which is the nearest to 0? (a) -0.007 (b) -0.45 (c) 5 (d) 0.03
a
Which is the nearest to 14? (a) -1 (b) -1/9 (c) -2.4 (d) -7
b
Which is the nearest to -0.1? (a) 3/2 (b) -3.68 (c) -39 (d) -2/13
d
Which is the nearest to -87? (a) -0.1 (b) 5 (c) -1073
a
What is the closest to 2 in 4/9, -1, 1/6, -1.649, -1/7?
4/9
Which is the nearest to -0.064? (a) -2/25 (b) 1/4 (c) 8
a
What is the closest to -0.1 in 4, 1.7, 823, 0.1, 1?
0.1
Which is the nearest to 0? (a) 1/6 (b) 4 (c) -20 (d) 2.482
a
What is the nearest to -2 in 2, 2019, 11/3?
2
What is the nearest to -93 in -2/21, 2/11, 258?
-2/21
Which is the nearest to 1/51? (a) -3 (b) -1/4 (c) 4 (d) 4/3 (e) 69
b
Which is the nearest to -1? (a) 259 (b) 5 (c) 1.2 (d) 0.2
d
What is the nearest to 1 in -10, -3/7, 39
|
{
"pile_set_name": "DM Mathematics"
}
|
Corral (film)
Corral is a 1954 National Film Board of Canada (NFB) short film documentary about the life of a cowboy, directed by Colin Low and produced by Tom Daly. It featured cinematography by Wolf Koenig and a musical score by Eldon Rathburn, and was produced as part of the NFB's postwar Canada Carries On series.
Synopsis
With the aid of a trained dog, a cowboy (Wallace Jensen) in southwestern Alberta, has located and rounded up a large herd of wild horses. Driving the mustangs into a corral at the Cochrane Ranch, he begins the process of "breaking" each horse. The process is a familiar one for cowboys that requires years of experience and a knowledge of handling horses.
Selecting one wild horse that is marked with a white streak on its face, the cowboy lassoes the horse and cinches the rope to a large stump, gradually pulling the animal closer to him. Once the wild horse gets used to his hands near the head, ears and neck, the cowboy ties a rope halter on its head. The next step is to introduce a loose halter, fitted without a bridle and bit and finally, a blanket and saddle on the half-broken steed.
The cowboy mounts the rearing, high-spirited mustang, and driving through the open corral, rides rapidly at break-neck speed across the Alberta Rocky Mountain Foothills, until his mount is finally able to get used to his rider. The cowboy reins in the charging steed, slowing the gait to a trot, finally heading back to the ranch.
Production
Filmmaker Colin Low got the idea for the film after attending a cattle auction in 1952 with his father, who had worked as a foreman at the Cochrane Ranch, in what is now Cochrane, Alberta. The following summer, Low asked NFB colleague Wolf Koenig, an ex-farm boy, if he would like to come to Alberta to make a film about a cowboy. Koenig was in the NFB Animation Department, with film becoming his first live-action production using a new Arriflex cinema camera fitted with a gyro stabilizer.
Corral has no narration, although Low had been initially worried that he would need extensive narration to explain the process of horse breaking. The film represents a break in tradition for the NFB, which had until that time, relied heavily on narration in its documentaries. Low had left the narration for colleague Stanley Jackson to write over the weekend. When Low and producer Daly arrived on Monday to see the finished film Jackson had said, "it's done." However, when they gathered around the moviola to watch the film, the visual were accompanied only by Rathburn's musical score. "Where's the commentary?" someone reportedly asked. Jackson replied, "What would a commentary do for that?"
The gentle guitar score and use of handheld camera also breaks with Hollywood's traditionally epic portal of the cowboy.
Corral was shot in 1953 at the Cochrane Ranch. Low's father provided the horses and his top hand, "Wally" Jensen. Low had written a script but Jensen re-wrote it as they filmed. Film producer Tom Daly edited the film with Eldon Rathburn writing the score for two jazz guitarists, based on well-known cowboy songs.
Reception
In April 1954, Corral would play theatrically across Canada and in some American cities, including Washington, D.C. Individual films in the Canada Carries On series were further distributed worldwide by the NFB and were also made available to film libraries operated by university and provincial authorities. A total of 199 films in the Canada Carries On series were produced before the series was canceled in 1959.
Awards
Corral received the Best Documentary award at the 1954 Venice Film Festival.
References
Notes
Citations
Bibliography
Evsns, Gary. In the National Interest: A Chronicle of the National Film Board of Canada from 1949 to 1989. Toronto: University of Toronto Press, 2001. .
Rist, Peter Harry. Guide to the Cinema(s) of Canada. Westport, Connecticut: Greenwood Publishing Group, 2001. .
External links
Watch Corral at NFB.ca
Category:Films directed by Colin Low (filmmaker)
Category:1954 films
Category:National Film Board of Canada documentaries
Category:Films set in Alberta
Category:Canadian short documentary films
Category:Canadian short films
Category:Cowboy culture
Category:Black-and-white documentary films
Category:Films shot in Alberta
Category:1950s documentary films
Category:Films scored by Eldon Rathburn
Category:Films produced by Tom Daly
Category:Films about horses
Category:National Film Board of Canada short films
Category:Canada Carries On
Category:Films about animals
Category:Canadian films
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Alistair Darling, Labour’s former chancellor, has revealed he will step down as an MP at the next election, warning that the issue of an EU referendum is a “boil that has to be lanced”.
His decision means the loss of another heavyweight figure for Labour in 2015 along with Jack Straw, Dame Tessa Jowell and David Blunkett.
It is another blow for Scottish Labour after Johann Lamont resigned as leader with a warning that Westminster was trying to run it like a branch office.
Darling has been an MP in Edinburgh since 1987 and is best known for steering the UK through the financial crisis under the premiership of Gordon Brown, later revealing that No 10 had unleashed “the forces of hell” on him after he issued a stern warning about the likely severity of the recession.
Speaking to the Financial Times, the senior Labour figure, who led the Better Together campaign in the Scottish referendum, revealed he was stepping down and spoke of how he was frustrated that Labour had not used that campaign to do better north of the border.
In the interview, Darling also endorsed Jim Murphy to lead Scottish Labour. Murphy, who stepped down as Ed Miliband’s shadow development secretary on Sunday on Sunday, has two rivals: MSPs Neil Findlay and Sarah Boyack.
“Jim has the enthusiasm, the energy and above all he’s a fighter. For too long we have sat back when we needed to fight,” Darling said.
On the subject of the Scottish independence referendum, he said: “My frustration is that we actually won … You can’t say it often enough. We made the arguments, we had confidence in ourselves.”
Turning the possibility of an EU referendum, which Labour is resisting, Darling said he hoped to use his campaign experience in Scotland to help argue for Britain in Europe in a referendum.
He suggested it was all but inevitable whoever wins the next election, saying: “It’s a boil that has to be lanced.”
He said he learned from Scotland that “if you sit back and wait till the other lot have taken so much ground then you’re on the back foot … you pay a heavy price.”
Ed Miliband said Darling “distinguished himself as an extraordinary public servant - a servant of the Labour Party, a servant of Scotland and a servant of the United Kingdom”.
Polls in Scotland show surging support for the Scottish National party despite its unsuccessful yes campaign, with a YouGov survey finding 52% of people favoured leaving the UK only weeks after the vote to stay in the union.
On Sunday, Alex Salmond, the outgoing SNP leader and first minister, hinted the door could be open for coalition with Labour if his party took enough seats next year. This raises the possibility Salmond could return to Westminster and take a senior role in the government in May.
Speaking on the BBC’s Andrew Marr Show, Salmond said: “I certainly think that there’s no chance whatsoever of the SNP ever going into coalition with the Conservative party, with their attitude towards Scotland, and their attitude towards people in general. I think it’s unlikely [with Labour] but who knows, people change sometimes, parties change sometimes, party leaders change sometimes and lead them in a different direction.”
|
{
"pile_set_name": "OpenWebText2"
}
|
[A change of the medium salinity as a functional load for evaluation of physiological state of the crayfish Astacus leptodactylus].
The necessity of developing criteria for evaluation of the functional state of benthic invertebrates for toxicological studies or for their use as biosensors in systems of the water quality biomonitoring is emphasized. It is proposed to evaluate the organism state with aid of standard test actions dosed by strength and duration. For freshwater crayfish, such action--the functional load--can be the medium salinity change by 1%o, which can be achieved by addition of sodium chloride. Peculiarities of the response reaction of the crayfish cardiac system to such action have been shown by non-invasive method of recording of cardiac activity.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Many optical systems use a reticle—a pattern of fine lines, typically positioned in a focal plane of the system—for purposes of alignment, focusing and/or measurement. Reticles are most commonly used in the eyepieces of sighting devices, such camera viewfinders, telescopes and microscopes.
For example, U.S. Pat. No. 5,130,845, whose disclosure is incorporated herein by reference, describes a real image viewfinder with an objective having movable focusing lenses, a field lens, an eyepiece lens and image inverting optics. The field lens surface is at the focus of the eyepiece lens. A reticle pattern is located on the field lens surface. Since the objective forms a focus at the location of the reticle, observation of the reticle indicates when the objective is focused.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
About 1 in every 10 adults worldwide is overweight or obese[@b1] and obesity is a risk factor for morbidity and mortality from cardiovascular diseases, diabetes, certain cancers, and musculoskeletal disorders. Despite strong interest in research addressing obesity, safe and effective pharmacological options for the prevention and treatment of this condition remain elusive[@b2][@b3]. Currently, most drug-discovery efforts are based on *in vitro* assays with candidate targets, but *in vitro* assays do not reconstitute the complexity of whole organisms. This is particularly relevant for drugs modulating feeding behavior and metabolic homeostasis, since both arise from complex interactions within and between the central nervous system, the digestive tract, and fat-storage organs[@b4][@b5][@b6], which cannot be modeled *in vitro*.
An alternative to *in vitro-*based screens is phenotype-based whole organism screens[@b7][@b8][@b9][@b10]. Whole organism drug screens provide several advantages over *in vitro* assays. Active drugs are by definition bio-available and potential toxicity can be evaluated at early project stages. Further, an effective drug need not act through a well-validated target, but can have novel or complex mechanisms of action. However, whole organism drugs screens can be costly and time-consuming. These disadvantages can be partially overcome by using model organisms that can be raised cost-effectively in large quantities, like the vinegar fly *Drosophila melanogaster*. Flies and vertebrates share many metabolic functions, molecular machinery, and analogous organ systems that control nutrient uptake, storage, and metabolism[@b11][@b12][@b13][@b14][@b15]. Like humans, flies regulate circulating sugar levels according to food availability, and store excess energy in the form of glycogen and lipids. These reserves are mobilized during periods of energy consumption[@b12][@b16][@b17]. As seen in many animals, fasted flies increase food foraging and intake[@b18]. Two master metabolic regulators in vertebrates, insulin and leptin, have functional homologues in the fly[@b13][@b14]. In addition, an unbalanced diet can trigger a type-2 diabetes-like insulin resistance and obesity phenotypes in the fly[@b19].
Here we report the development of a high-throughput drug-screen for *Drosophila* larval feeding. We identify the serotonin (5-hydroxytryptamine or 5-HT) receptor antagonist metitepine as a potent anorectic drug and show that all five fly 5-HT receptors are inhibited by this drug. Despite its broad spectrum antagonism of *Drosophila* 5-HT receptors, metitepine requires only receptor 5-HT2A for its *in vivo* anti-feeding activity. Our results highlight the potential of *Drosophila* as a tool for pharmacological study of feeding behavior and provide a powerful method for drug discovery and target identification.
Results
=======
High-throughput feeding assay for *Drosophila* larvae
-----------------------------------------------------
To screen for drugs that modify food intake in whole animals, we developed a high-throughput assay that allowed us to monitor ingestion of fluorescent liquid food by *Drosophila* first instar larvae in 96-well plates read by a plate reader ([Fig. 1a](#f1){ref-type="fig"}). Larvae were dispensed into plates and fed liquid food consisting of sugar and yeast extract and supplemented with fluorescein for visualization. After washing uningested fluorescent food from the wells, we quantified the fluorescein ingested by the larvae that was visible in the digestive tract ([Fig. 1b](#f1){ref-type="fig"}).
To evaluate the dynamic range of our assay, we carried out control experiments to either decrease or increase food intake in the larvae. When the animals were cold-paralyzed while feeding on fluorescent food, ingestion was reduced ([Fig. 1c](#f1){ref-type="fig"}). When larvae were selectively fasted for protein by removing yeast extract from the liquid food before being exposed to fluorescent food, they showed a post-fasting rebound in which they ingested more standard liquid food than control animals continuously fed standard liquid food ([Fig. 1d](#f1){ref-type="fig"}). The dynamic range of feeding suppression was more than two times greater than feeding enhancement in these experiments, perhaps because larvae are continual feeders and may be ingesting at a near maximal rate during basal conditions[@b20].
We next tested a known feeding mutant in our assay by comparing the fluorescent signal accumulated in three different wild-type strains (*w*^1118^, Canton-S, and Oregon-R) and a *klumpfuss*^09036^ mutant (*klu*, ref. [@b20]). *klu* encodes a transcription factor necessary for proper expression of the neuropeptide hugin, whose activity is required for normal feeding behavior in *Drosophila*[@b20]. All three wild-type strains ingested significantly more than the feeding mutant ([Fig. 1e](#f1){ref-type="fig"}). In addition, we confirmed previous reports[@b21] that high concentrations of dietary amino acids suppressed food intake ([Fig. 1f](#f1){ref-type="fig"}).
Drug screen for modulators of food intake
-----------------------------------------
After validating our feeding assay, we screened for small molecules that modulated food intake. In a pilot screen of 415 compounds tested individually at 20 μg/ml, we identified one compound, cycloheximide, which inhibited feeding (data not shown). This established a hit rate of 0.24%. To improve the throughput of the subsequent primary screen, we used pools of 3 to 4 compounds per well (see Methods for details).
3630 small molecules were tested in the primary screen ([Fig. 2a](#f2){ref-type="fig"}). The compounds were obtained primarily from annotated chemical libraries, such that each compound had at least one known cellular target (see Methods for details). The average signal of all the drug-treated wells was less than 3% different from the average of solvent-treated wells, indicating that the drugs did not cause generalized toxicity ([Fig. 2b](#f2){ref-type="fig"}). 279 and 114 compounds were identified as candidate anorectic (feeding suppressant) and orexigenic (feeding stimulant) drugs, respectively, by the criterion that they differed from solvent controls by more than one standard deviation ([Fig. 2a](#f2){ref-type="fig"}). The anorectic compounds caused an average decrease in fluorescent signal of 27%, while the orexigenic compounds caused an average increase of 18% ([Fig. 2b](#f2){ref-type="fig"}).
The 393 candidate small molecules were re-tested individually in the secondary screen ([Fig. 2a](#f2){ref-type="fig"}). Of the anorectic and orexigenic candidates, 32 and 10 compounds, respectively, were reconfirmed as hits, defined as differing from solvent controls by more than one standard deviation ([Fig. 2a, c, d](#f2){ref-type="fig"}, [Supplementary Table 1](#s1){ref-type="supplementary-material"}). We searched for reported molecular targets for each of the 42 hits of the secondary screen using a drug-discovery database (<https://www.collaborativedrug.com/>). Two known insect anti-feedants, gedunin and plumbagin[@b22][@b23], were among these compounds ([Fig. 2d](#f2){ref-type="fig"}), confirming the efficacy of our screen. We chose 14 compounds for verification of a dose-response curve ([Supplementary Table 1](#s1){ref-type="supplementary-material"}), based on their annotation as drugs that target neuromodulators, cell signaling, and/or neuronal activity. From these, only metitepine, a non-selective antagonist of 5-HT receptors, and reserpine, an inhibitor of the vesicular mono-amine transporter (VMAT), showed reliable dose-dependent responses and were selected for further characterization. Reserpine was subsequently discarded because it dramatically reduced larval locomotion at concentrations as low as 10 μM (data not shown). In light of these results, we concluded that the effects of reserpine on feeding were secondary to a general effect on locomotion and muscular tone, as confirmed by the sluggish phenotype of the dVMAT mutant larvae[@b24].
Metitepine decreased food accumulation by more than one standard deviation when tested in combination with other drugs, during the primary screen ([Fig. 2e, f](#f2){ref-type="fig"}), or alone, in the secondary screen ([Fig. 2g](#f2){ref-type="fig"}). Dose-response experiments indicated that the threshold concentration for metitepine efficacy was 10 μM, with increasing effects at 50 and 100 μM ([Fig. 2h](#f2){ref-type="fig"}).
Metitepine decreases feeding persistently, reversibly, and specifically
-----------------------------------------------------------------------
To ask if metitepine decreases larval feeding on conventional fly food, we tested the effect of the drug on larvae fed a standard laboratory cornmeal-agar-molasses diet supplemented with the dye bromophenol blue. We quantified the amount of food ingested by measuring the optical density (O.D.) of the gut in individual larvae. Larvae treated with the drug accumulated less solid food in their digestive tract as reflected by a lower O.D. ([Fig. 3a](#f3){ref-type="fig"}). The effect of metitepine on solid food accumulation was dose-dependent ([Fig. 3b](#f3){ref-type="fig"}) with a threshold efficacy dose of 50 μM.
To rule out the possibility that metitepine was causing a general locomotor defect in larvae, we measured their crawling speed when fed solvent or metitepine. Metitepine-treated animals crawled at the same speed as solvent treated controls ([Fig. 3c](#f3){ref-type="fig"}).
Food accumulation in the digestive tract is a function of both ingestion and excretion. To establish a direct link between metitepine treatment and food intake, we measured mouth-hook contraction rates of larvae that were treated with either solvent or 100 μM metitepine. Mouth-hook contraction is the motor behavior associated with food intake in larvae. Animals treated with the drug displayed decreased mouth-hook contraction rates, confirming that metitepine had a direct effect on food intake ([Fig. 3d](#f3){ref-type="fig"}). Notably, since mouth-hook contractions were measured after drug treatment (see Methods), this result also suggests that metitepine is not required to be present in food to induce a decrease in ingestion.
To further explore the time course of metitepine action on feeding behavior, we measured food intake at various time points after metitepine treatment. When tested immediately after exposure, drug-treated larvae showed reduced food accumulation ([Fig. 3e](#f3){ref-type="fig"}, 0-h recovery). The anorectic effect of metitepine lasted for 2 hours but was not evident 4 hours after treatment ([Fig. 3e](#f3){ref-type="fig"}). At 24 hours after treatment, metitepine-treated larvae ate significantly more, suggesting that larvae were rebounding from drug-induced fasting ([Fig. 3e](#f3){ref-type="fig"}).
Metitepine is a non-selective antagonist of *Drosophila* 5-HT receptors
-----------------------------------------------------------------------
Metitepine is a broad spectrum antagonist of vertebrate 5-HT receptors. To investigate the pharmacology of this drug on *Drosophila* 5-HT receptors, we expressed each in mammalian tissue culture cells and carried out calcium imaging experiments. Four 5-HT receptors have been previously identified and cloned: *5-HT1A* and *5-HT1B* (ref. [@b25]), *5-HT2* (ref. [@b26]), and *5-HT7* (ref. [@b27]). Of these, 5-HT1A, 5-HT1B, and 5-HT7 were previously expressed in heterologous systems, shown to respond to 5-HT, and to activate different intracellular effector systems[@b25][@b27][@b28]. In binding-competition assays 5-HT2 was shown to bind to both 5-HT and metitepine[@b26]. A fifth putative receptor (CG42796) was annotated as a 5-HT receptor based on homology[@b29]. We cloned CG42796 and propose that it be named 5-HT2B, since its closest homologue is 5-HT2 (ref. [@b29]). We suggest that the gene formerly known as 5-HT2 be denoted as 5-HT2A. This revised nomenclature for 5-HT2A and 5-HT2B is used throughout the manuscript.
We expressed all five 5-HT receptors in HEK-293T cells and monitored their activity by measuring intracellular calcium concentrations. All of the receptors induced a dose-dependent response to 5-HT ([Fig. 4a](#f4){ref-type="fig"}). From the dose-responses curves of each receptor we calculated a half effective concentration (EC~50~, [Fig. 4b](#f4){ref-type="fig"}). The most sensitive receptor was 5-HT7 (EC~50~ = 12 nM) and the least sensitive receptor was 5-HT1A (EC~50~ = 1 μM). We next established stimulus conditions in which we applied two pulses of 5-HT without desensitizing any of the receptors ([Fig. 4c](#f4){ref-type="fig"}). Under these conditions, 100 μM metitepine dramatically suppressed or completely abolished responses to 5-HT in all 5-HT receptors ([Fig. 4d](#f4){ref-type="fig"}). Control experiments confirmed that metitepine did not kill the cells because ATP, a ligand for endogenous purinergic receptors, activated all cells after metitepine treatment ([Fig. 4d](#f4){ref-type="fig"}). Metitepine had an effective inhibitory concentration (IC~50~) in the μM range, ranging from 2 μM for 5-HT2B to 58 μM for 5-HT1B ([Fig. 4e](#f4){ref-type="fig"}). These pharmacological experiments confirmed that all five candidate 5-HT receptors in the *Drosophila* genome respond to serotonin. However, since they all showed sensitivity to metitepine, further genetic experiments were required to identify the molecular target of the anorectic drug *in vivo*.
5-HT2A is required for the anorectic actions of metitepine and for normal feeding behavior
------------------------------------------------------------------------------------------
We reasoned that if metitepine were acting through a specific 5-HT receptor, mutating that gene would render larvae resistant to the drug. We generated or obtained null mutants for each one of the five *Drosophila* 5-HT receptors and asked if they were sensitive to the anorectic effects of 100 μM metitepine. All mutants except *5-HT2A*^Gal4^ were sensitive to metitepine and showed a decrease in feeding similar to that seen in wild-type strains ([Fig. 5a](#f5){ref-type="fig"}). In contrast, 5-HT2A receptor mutants were resistant to the effects of this drug.
To confirm this observation, we tested additional 5-HT2A mutant alleles. *5-HT2A*^e01363^ and *5-HT2A*^PL00052^ are different pBac transposon insertions in the *5-HT2A* locus. We tested each as homozygous insertions and in heteroallelic combinations with the original *5-HT2A*^Gal4^ mutant.
*5-HT2A*^e01363^ (*5-HT2A*^e^ in [Fig. 5b](#f5){ref-type="fig"}) interferes with proper splicing of the transcript, but is not a null[@b30]. Consistent with this, *5-HT2A*^e^ was sensitive to the effects of metitepine when tested as a homozygote ([Fig. 5b](#f5){ref-type="fig"}). However, when *5-HT2A*^e^ was tested in combination with the original *5-HT2A*^Gal4^, the heteroallelic mutant combination *5-HT2A*^Gal4/e^ was insensitive to metitepine ([Fig. 5b](#f5){ref-type="fig"}).
*5-HT2A*^PL00052^ (*5-HT2A*^PL^ in [Fig. 5b](#f5){ref-type="fig"}) has dramatically reduced levels of *5-HT2A* mRNA[@b31]. Both *5-HT2A*^PL^ homozygous mutants and the heteroallelic mutant combination *5-HT2A*^Gal4/PL^ were insensitive to metitepine ([Fig. 5b](#f5){ref-type="fig"}). Heterozygous *5-HT2A*^Gal4^ larvae showed normal sensitivity to the drug ([Fig. 5b](#f5){ref-type="fig"}).
If metitepine suppresses feeding by blocking the activation of 5-HT2A, mutating the gene should result in larvae that eat less. Indeed, *5-HT2A*^Gal4/e^ mutants ate less than wild-type larvae ([Fig. 6a](#f6){ref-type="fig"}).
To further confirm the role of *5-HT2A* in larval feeding behavior, we knocked down *5-HT2A* by conditional expression of a *5-HT2A* RNAi with a pan-neuronal GeneSwitch system[@b32]. Larvae in which neuronal expression of 5-HT2A-RNAi was induced ate less than larvae in which the RNAi was not induced or in control larvae in which GFP was induced ([Fig. 6b](#f6){ref-type="fig"}). Thus, genetic knock-down of 5-*HT2A* in a time frame similar to the action of metitepine was sufficient to phenocopy the drug-induced feeding phenotype.
Discussion
==========
Serotonin is involved in regulating appetite, food intake, and metabolic homeostasis in organisms ranging from *C. elegans* to humans. In *C. elegans*, serotonin activates overall feeding by activating two separate neural pathways that respectively control pharyngeal pumping and isthmus peristalsis[@b33]. In *Drosophila*, serotonin has been shown to play a trophic role during embryonic development in the establishment of neuronal innervation to the gut[@b34]. In adult female flies, serotonin controls the postmating dietary switch to protein-rich food[@b35]. We show here that the 5-HT receptor antagonist metitepine reduces food intake in *Drosophila* larvae and that the drug acts selectively through the 5-HT2A receptor.
Interestingly, metitepine was previously identified in a different small molecule screen as a compound that extends lifespan in *C. elegans*[@b8]. There is a known connection between dietary restriction and lifespan across several organism including primates[@b36]. We have not tested the effect of metitepine on *Drosophila* lifespan, but this would be of interest in future studies on this drug.
In mammals, the role of serotonin in controlling appetite and body-weight is complex[@b37]. It appears that the level of brain serotonin signaling has an inverse relationship with food intake: when brain serotonin signaling is increased, food intake is reduced, and vice versa. For example, serotonin re-uptake inhibitors reduce food intake[@b2][@b37]. Part of the complexity of the serotonin system that controls metabolic homeostasis in mammals might arise from the fact mammals have 14 5-HT receptor subtypes. This raises the possibility of serotonin having divergent effects on food intake and body weight depending on the receptor subtype activated. *Drosophila*, with only five receptor subtypes, offers a simplified model in which to study the core mechanisms by which serotonin regulates food intake and coordinates metabolic homeostasis.
Here we established that *Drosophila* larvae can be used to screen for drugs that modulate food intake. Few model organisms allow the combination of large-scale drug screens with genetic screens to identify bioactive small molecules and their *in vivo* targets[@b2]. *Drosophila* is an appealing model to study appetite control because 60% of functional human genes have orthologues in the fly[@b38] and *Drosophila* has a specialized tissue for fat storage that controls metabolic homeostasis using a leptin-like signaling mechanism[@b13]. Future work can apply these methods to larger scale screens of novel compounds to identify new pathways regulating feeding behavior.
Methods
=======
Fly stocks
----------
Flies were maintained on conventional cornmeal-agar-molasses medium and, unless otherwise stated, under a natural light-dark cycle, at room temperature. *klumpfuss*^09036^ (stock \#11733), *5-HT1A*^Δ5Kb^ (stock \#27640), *5-HT1B*^MB08181^ (stock \#24240), *5-HT2A*^PL00052^ (stock \#19367), *5-HT2A*^RNAi^ (stock \#31882) and *Df(3R)tll-e* (stock \#5415) were obtained from the Bloomington Stock Center. *5-HT2A*^e01363^ was obtained from the Harvard Exelixis Collection. *5-HT1A*^Gal4^, *5-HT2A*^Gal4^, *5-HT2B*^Gal4^, and *5-HT7*^Gal4^ were generated by J.H and Y.R. by replacing the first coding exon of each gene by Gal4, and will be reported elsewhere (Huang and Rao, in preparation).
Embryo collection
-----------------
For embryo collection, grape-juice 2%-agar plates were used. Flies were allowed to lay eggs for 24 hours at 25°C. Eggs were further incubated at 18°C for another 24 hours. Egg laying and embryo development were both performed at 70% humidity and in a 12 hour light: 12 hour dark cycle.
First instar larva collection
-----------------------------
Previously hatched larvae were removed from the embryo-collection plates under a stream of water. Plates were further incubated for 2 hours at 25°C to allow new larvae to hatch.
### For primary and secondary screens
Newly hatched larvae were collected in a cell strainer with a gentle stream of distilled water, rinsed and re-suspended in liquid food (100 g/l yeast extract, 100 g/l glucose, 7.5% sucrose, 0.15% nipagin, 6.25 μg/ml cholesterol).
### For individual larval assays
Newly hatched larvae were collected with a brush, and transferred to a vial with conventional medium or to a 96-well plate with liquid food. To facilitate penetration of the larvae into the solid food, incisions were made on the surface of the medium. Larvae were incubated at 25°C and 70% humidity.
Liquid food feeding assay
-------------------------
Seventy-five larvae were dispensed into each well a filter-bottom 96-well plate (Millipore, Part. No. MSRLN04) using a COPAS Select worm sorter (Union Biometrica). Once loading was completed, the liquid content of the plates was filtered away and replaced with 100 μl of liquid food. The plates were incubated for 16--18 hours at 25°C and 70% humidity. Thereafter, the food was replaced with food that contained 0.3% fluorescein (sodium salt, Sigma Cat. No. 6377). Before the fluorescent signal was quantified the plates were washed 4× with 300 μl double-distilled water, 10× with 0.05% PBT, 6× with 400 mM lysine and 2× with 100 mM Na-citrate, 100 mM NaCl, pH2 (citrate buffer). The larvae were kept in 50 μl of citrate buffer for quantification or imaging capture. The fluorescent signal from the plate was acquired in a 5 × 5 circular grid using an EnVision Plate Reader (Perkin Elmer). The total fluorescent value of each well was calculated by adding the data points.
Small-molecule screen
---------------------
### Primary screen
The small molecules were obtained from the LOPAC1280, Prestwick, GreenPharma, and MicroSource Spectrum libraries, and were provided by the High-Throughput Screening Resource Center (HTSRC) of The Rockefeller University. A total of 3688 compounds, representing 3630 unique structures, were screened. Small molecules were pooled at 10 μg/ml each such that each compound was represented twice in two independent mixtures. Only those compounds that showed the required effect two times were chosen for confirmation in the secondary screen. For the primary screen, sixteen 384-well plates with a different small-molecule in each well were mixed using a 4 × 4 grid into eight 384-well destination plates. Since we screened 3688 small molecules, and the 384-well plates contain 352 usable wells each (32 wells in each plate are reserved for solvent controls), a total of 1944 wells in the source plates were empty (16 × 352 − 3688 = 1944). While the majority of mixtures contained 4 compounds, about a third contained only 3. To apply the drugs to the larvae loaded into the 96-well plates, each 384-well plate quadrant was treated as an independent 96-well plate.
The cut-off for hit-identification was arbitrarily set to one standard deviation above or below the solvent-treated wells for anorectic and orexigenic compounds, respectively. The compounds were applied to the larvae in 96-well plates in the liquid food together with fluorescein for 16--18 hours. In each 96-well plate, 80 compound-mixtures were tested and 16 wells were treated only with solvent as control (1.6% DMSO). Each plate was tested in duplicate.
### Secondary screen
Compounds were screened individually at 40 μg/ml. Each hit was tested in two rounds, in duplicate. Each screening plate contained 8 solvent-treated control wells.
Solid food feeding assay
------------------------
Zero-to-two hour old larvae were transferred to conventional solid food containing either solvent or 100 μM metitepine and 0.05% bromophenol blue, and allowed to feed for 17 hours at 25°C and 70% humidity. Larvae were recovered from the food with a brush, rinsed in PBS, and photograph under a SMZ1500 dissecting scope (Nikon). Images were captured with a DS-2Mv digital camera (Nikon) and a NIS-Elements F acquisition program. Larvae were immobilized in a cold plate set to 4°C. Reflective light was adjusted to make the background of each picture 12% gray. Images of individual larvae were analyzed in MetaMorph (Molecular Devices) to calculate the optical density of the digestive tract. Optical density values of drug-treated larvae were analyzed always in parallel with same day solvent-treated larvae.
Mouth-hook contractions
-----------------------
Zero-to-two hour old larvae were transferred to conventional solid food containing either solvent or 100 μM metitepine, and allowed to feed for 17 hours at 25°C and 70% humidity. Larvae were recovered from the food with a brush, rinsed in PBS and transfer to a 2% yeast suspension at room temperature. After a one-minute acclimation, a one-minute movie was recorded at 6.25 frames per second (fps) using a Nikon SMZ1500 dissecting scope, a Rolera-RX camera (Q Imaging), and Q Capture 6.0 Software (Q Imaging). Movies were manually scored to quantify mouth-hook contraction rate.
Larval locomotion
-----------------
Zero-to-two hour old larvae were transferred to conventional solid food containing either solvent or 100 μM metitepine and 0.05% bromophenol blue, and allowed to feed for 17 hours at 25°C and 70% humidity. Bromophenol blue facilitated tracking of the animals since it enhanced contrast. Larvae were recovered from the food with a brush, rinsed in PBS, and transferred to a 3% agar plate at room temperature. After a one-minute acclimation, a one-minute movie was recorded at 6.25 fps using a Nikon SMZ1500 dissecting scope, a Rolera-RX camera (Q Imaging), and Q Capture 6.0 Software (Q Imaging). Movies were analyzed in EthoVision XT 8.0 (Noldus) to calculate linear velocity.
Cloning *Drosophila* 5-HT receptors
-----------------------------------
5-HT1A, 5-HT1B and 5-HT2A receptors were PCR-cloned from genomic DNA extracted from transgenic flies expressing full-length cDNAs under regulation of UAS promoter (5-HT1A: Bloomington stock \#27630; 5-HT1B: Bloomington stock \# 27632; 5-HT2A (formerly 5-HT2): Bloomington stock \#24504). The 5-HT2B receptor cDNA (GenBank accession \#KC852205) was PCR-cloned from whole adult fly cDNA prepared using poly-A primers and SuperScript III Reverse Transcriptase (Invitrogen) according to the manufacturer\'s instructions. 5-HT7 receptor was PCR-cloned from *w*^1118^ genomic DNA. High-fidelity KOD polymerase (Novagen) was used for all cloning amplifications and the full sequences of the amplicons were verified. The following primers were used in the cloning reactions:
5-HT1A:
Forward: 5′-ATGGCGCACGAGACCAGC-3′
Reverse: 5′-CTAGAGCTTCCCGCTGCGG-3′
5-HT1B:
Forward: 5′-ATGCTGAAAACTGTGACAACAGC-3′
Reverse: 5′-TCAAATTTTCGCACTGCG-3′
5-HT2A:
Forward: 5′-ATGGAGATGCAAAGCTACTCTG-3′
Reverse: 5′-TCACCGTTTGCAGTTGCACTTG-3′
5-HT2B:
Forward: 5′-ATGGAAGAGGATGTGTATGCCT-3′
Reverse: 5′-TTATCTGCTCGGTCGCCA-3′
5-HT7:
Forward: 5′-ATGGCTTTATCTGGACAGGACT-3′
Reverse: 5′-CTAGAGAAAGCTCTCCCTCGC-3′
A 5′-GCCACC-3′ vertebrate Kozak sequence was added upstream of every forward primer. The amplicons were cloned into the XhoI-NotI sites in the pME18ST vertebrate expression vector[@b39].
Expression of *Drosophila* 5-HT receptors in HEK-293T cells
-----------------------------------------------------------
HEK-293T cells were seeded on glass-bottom 35-mm Petri dishes (MatTek Corporation, Part No. P35GC-1.5-10-C) and allowed to reach \~70% confluence. Cells were transiently transfected with 2 μg of each receptor-expressing plasmid and Gα~15~-expressing plasmid using Lipofectamine 2000 (Invitrogen) according to the manufacturer\'s instructions. Gα~15~ is a promiscuous G protein that couples activation of a wide variety of G-protein coupled receptor to release of calcium from intracellular stores[@b40]. Cells were kept for 24--32 hours at 37°C and 5% CO~2~ before imaging. To monitor intracellular Ca^2+^ concentrations, transfected cells were loaded for 20 minutes with 2 μM Fura2-AM. Imaging was carried out in a saline solution containing 140 mM NaCl, 5.6 mM KCl, 2 mM CaCl~2~, 2 mM MgCl~2~, 1.25 mM KH~2~PO~4~, 2 mM Na-pyruvate, 0.17% Glucose, 5 mM HEPES (pH 7.4 with NaOH). The Petri dish was placed on an Eclipse TE 2000-U inverted microscope (Nikon) equipped with a Retiga Exi Fast Camera (Q Imaging) and excited with a Lambda DG-4 xenon lamp illumination system (Sutter Instruments). Images were acquired at 1.43 fps. Ligands and drugs were dissolved freshly every day at the indicated concentrations in saline solution and superfused directly into the Petri dish with a peristaltic pump (Miniplus 3, Gilson). Ca^2+^ fluctuations were recorded with MetaFluor software (version 7.1.2.0; Molecular Devices). To determine 5-HT sensitivity for each receptor, several pulses of increasing concentration of 5-HT were applied to the same cells. Pulses were delivered 2 minutes after full recovery of the previous pulse to Ca^2+^ resting levels. 5-HT dose-response curves were calculated normalizing the responses elicited by each concentration tested, by the maximal response elicited by 5-HT in those cells: ΔF/ΔF~MAX~. For metitepine inhibition, a pair pulse protocol was used. Each set of cells was stimulated twice; first they were exposed to 5-HT alone (ΔF~0~), then they were exposed to 5-HT and a given concentration of metitepine (ΔF~Met~). The concentration of 5-HT used in these experiments was closed to the calculated EC~50~ for each receptor and within 95% confidence intervals. The degree of metitepine inhibition was calculated by the following equation: ΔF~Met~/ΔF~0~. Data analysis and curve-fitting was done in Prism 5 (GraphPad).
Drug preparation
----------------
### Primary and secondary screens
Drugs were obtained from the HTSRC of The Rockefeller University pre-dissolved in DMSO at 2.5 mg/ml.
### Dose-response curves, in vitro pharmacology, and behavioral experiments
Stock solutions of metitepine (Sigma) were prepared in DMSO (100 mM or 500 mM). Stock solutions of 5-HT and ATP (both from Sigma) were prepared in water (50 mM), kept frozen at −20°C, and aliquots thawed only once.
5-HT1B mutant generation
------------------------
Homozygous males carrying the Minos MB05181 transposable insertion inserted in the sixth intron of 5-HT1B were crossed to virgin females of this genotype:
Sna^Sco^/SM6a, p(w\[+mC\] = hslLMiT) (Bloomington stock \#24613).
The heat-shock scheme to induce expression of the Minos transposase, marker selection, and the establishment of excision lines were carried out as originally described[@b41]. Ninety-four independent excision events were analyzed by PCR with the following primers:
Forward primer: 5′-CTGCGCTCCTTCTTCAGC-3′
Reverse primer: 5′-CGTAATTGCCGCCATTATACTC-3′
One imprecise excision that removed a 1344 bp fragment from genomic DNA, thus producing a 1002 bp PCR product instead of the wild-type 2346 bp product, was selected for further characterization. The resulting allele was named *5-HT1B*^ΔIII-V^, since the deleted exons encode transmembrane segments III-V. The breakpoints of the sequence are:
AAAAAGGATGTAGAGGAATAGAATA //deletion// CTCCAAAAATAATATTTATACAATA
A precise excision was also identified in this screen by virtue of producing a 2346 bp PCR fragment, diagnostic of a clean deletion of the Minos element.
Expression of *5-HT2A-*RNAi
---------------------------
Zero-to-two hour old transgenic larvae carrying Elav-GeneSwitch and either UAS-5-HT2A-RNAi (Bloomington stock \#31882) or UAS-mCD8-GFP were transferred to fluorescent liquid food containing 160 μg/ml of RU-486 (induced) (Sigma Cat. No. M8046) or 1% ethanol (uninduced) for 17 hours.
Data presentation
-----------------
Fluorescence and optical density data were always normalized to controls ran in parallel, according to the equation: Unless otherwise noted, data are presented as mean ± s.e.m.
Statistical analysis
--------------------
Statistical analysis was conducted as indicated in the figure legends using Prism (GraphPad). Every single set of data was tested for normality (Shapiro-Wilk test) and equal variance (F test or Bartlett\'s test). If those criteria were met, parametric comparisons were performed (*t* test or ANOVA). Otherwise, Mann Whitney test or Kruskal-Wallis test were used. *Post hoc* test (Dunnett\'s or Dunn\'s) are listed for each condition examined. Significance is as described in the figure legends with \**p* \< 0.05; \*\**p* \< 0.01; \*\*\**p* \< 0.001.
Author Contributions
====================
G.G. and L.B.V. conceived the project. G.G. carried out all experiments and analyzed the data. S.C. provided technical help for the drug screen and the mouth-hook contraction experiments. J.H. and Y.R. made the Gal4 knock-in *Drosophila* mutant lines. G.G. and L.B.V. wrote the manuscript and prepared the figures.
Supplementary Material {#s1}
======================
###### Supplementary Information
Supplementary Table 1
Dragana Rogulja, Vanessa Ruta, and members of the Vosshall Laboratory provided helpful comments on the manuscript. We thank Yi-Chen Hsieh for technical help in setting up the feeding assay and Fraser Glickman and members of The Rockefeller University HTSRC for advice in implementing the drug screen. G.G. was a Pew Latin American Fellow in the Biomedical Sciences. This work was funded by National Natural Science Foundation of China (Young Scientists Fund 31000547 to J.H.), Chinese Ministry of Science and Technology (973 Program 2010CB833900 to Y.R.), and The Klarman Family Foundation Grants Program in Eating Disorders Research to L.B.V. L.B.V. is an investigator of the Howard Hughes Medical Institute.
{#f1}
{#f2}
{#f3}
{#f4}
{#f5}
{#f6}
|
{
"pile_set_name": "PubMed Central"
}
|
Antioxidant activity of diterpenes and polyphenols from Ophryosporus heptanthus.
The antioxidant activity of 14 compounds (1-14) isolated from the ether and butanolic extracts of the aerial parts of Ophryosporus heptanthus has been assayed using a beta-carotene bleaching method and the DPPH technique. Compounds 1 and 13 showed the most potent antioxidant activity. Their structures have been established by spectroscopic techniques (mainly NMR). Compounds 7 and 12 are new natural products, and their structures have been confirmed by chemical synthesis.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
As Donald Trump rolls on, we analysts lag behind. While we still struggle to come to grips with who he is and how he could be, to say nothing of our relationship to the Trump phenomenon and Trump supporters, the man himself seems free to slap around the political moment as he pleases. Even when some type of pushback briefly abounds, Trump’s comebacks, in word and deed, superabound. In his most striking similarity with the bad old authoritarians of the twentieth century, he has—he is—the initiative, the rest of us stuck looking, somehow, like the “real” reactionaries.
The time is long overdue to pin down Trump as a symptom of our political culture. He ought to have sharpened our awareness of the problem. Certainly we have no shortage of takes. But Trump has deranged our senses. Time and again this campaign season, the recent past has been a bad guide to what’s around the corner.
It’s always worth consulting the wisdom of the ages to feel our way forward. Closer to hand, we might recur to a handful of thinkers who hit their prime the last time authoritarianism had elites in fits: the late 1960s and early 1970s. Importantly, they worked through the issue when Trump was not a public figure. So when their diagnosis calls him so quickly to mind, we can see more clearly the damning context that surrounds him—and implicates us all.
A Billionaire, Just Like Ordinary Folk
Let’s first dispense with what we now all know. Of all people, Sarah Palin made it plain enough. “He’s a billionaire,” she conceded (or claimed) in her early endorsement of Trump. “But we’re rooting for him because he roots for us.” Despite the unrefined intensity of populist feeling today, it’s striking how wholly our populists have abandoned what Palin herself fulfilled—the primal, powerful wish for one of our own to represent us.
At the national level, at least, identity politics has shifted far away from the ‘90s era, when Bill Clinton promised a cabinet that “looked like America.” Today even Hillary Clinton’s support is rooted in the longing for an elite champion to do the representing. It’s not quite a vindication of Thomas Hobbes, for whom only the overawing Sovereign could truly represent the All, but it’s getting there. Whether it’s a left-leaning figure like Bloomberg or Sanders, whether right-leaning in Cruz’s style or Rubio’s, the vogue is for whichever sponsor-cum-gladiator has the perceived goods to “root for us” inside the arena and not just from the stands. Our warring pseudo-tribes will settle for nothing less.
The vogue is for whichever sponsor-cum-gladiator has the perceived goods to ‘root for us’ inside the arena and not just from the stands.
These mechanics of our acutely ugly politics are now familiar enough to brush past. In fact, we’ve seen it all before, at least in intimations: think of the cowboy boots Dubya favored, the family scion, or the folksy common touch of Hollywood alumnus Reagan; or, further still, Mr. Top-hat-and-tails himself, Franklin Delano Roosevelt, riding to victory again and again as the hero of the downtrodden.
So what makes this time different? On closer inspection—on the ground plowed by the sharpest culture critics of our last great political crisis—it’s plain to see there’s more at work than another round of dueling sponsors. What’s more, per usual, every faction has its designated foes.
But less remarked upon is just how those enemies now are seen, by all of our respective factions. Today each battling pseudo-tribe looks downward on a detested scapegoat class—a group singled out not merely as bad and wrong, but as contemptible losers, people who must be deprived of political power to say the least, and if possible, eventually all but effaced.
Losing Our Respect for the Enemy
This is the source of a deeper ugliness than simple tribalism or “othering” can create. Even in our global wars against mortal German, Japanese, and Soviet enemies, the fear and loathing was hardened with a measure of respect—in some instances, closet admiration. Today’s designated domestic scapegoats are all but subhuman.
Strangely enough, although radically different, every scapegoat is ascribed similar characteristics. “Establishment elites,” no less than “the black underclass” and “the white underclass,” are portrayed by their enemy factions as bloated, pampered, vulgar, vain, dangerous, self-entitled monsters. Recall the following aria of contempt:
Nothing happened to them. There wasn’t some awful disaster. There wasn’t a war or a famine or a plague or a foreign occupation. Even the economic changes of the past few decades do very little to explain the dysfunction and negligence — and the incomprehensible malice — of [insert scapegoat class here]…. The truth about these dysfunctional [scapegoat] communities is that they deserve to die. Economically, they are negative assets. Morally, they are indefensible.
That was National Review’s Kevin Williamson browbeating “poor white America,” but it could just as easily be your identity or affinity group, or that of your worst enemy. To be sure, none of us quite escape blame for the roles we have played in contributing to our great national shame show. The unhinged vitriol fueling our pseudo-tribal hatreds masks the scandalous fact that contempt for one another is rational.
But instead of recognizing that the burdens of politics cannot be borne by reason alone, in the absence of forbearance and comity, we have strained to shove all of our sins inside a single community fit for the pyre—a dog to kick in the strange hope that the rest of us will be purified in the kicking. Without punishing the scapegoat class, we’ve allowed ourselves to believe, justice for all cannot be achieved. In the face of this monumental crisis manufactured in our souls, only the most monumental punisher will do. Enter, transformed, our gladiatorial sponsors.
How Our Therapeutic Culture Stokes Authoritarianism
Enter, perhaps, what was known in the ‘60s and ‘70s as the authoritarian personality. As Christopher Lasch noted in 1974, American research into authoritarianism under Frankfurt school majordomo Theodor Adorno failed to account for the way modern society flexed its muscle by offering “the illusion of individuality without its substance.”
A ‘culture organized by contempt and rancor, rather than reverence and justice, must view inhibition, the delay of gratification…as the main enemy.’
But if Erich Fromm and his followers grasped this point, Lasch explained, they missed out on its psychological nature. They could not see how authoritarianism was growing even though the supposedly authoritarian structure of the patriarchal family was collapsing. For that, wagered Lasch, you needed a social theorist of therapy—like Philip Rieff, who referred to what Lasch called “the decline of conscience and the spread of cynicism” as “the democratization of contempt.”
Ah. Now we’re on to something. For Rieff—writing in the Year of Fear and Loathing itself, 1972—the triumph of therapeutic culture was not announced by an avalanche of warm and fuzzy self-esteem experiences, but by the rise to dominance of “a new voice, an anarchic comical voice pitched to encourage popular contempt[.]” He saw Trump coming an epoch away. Whether superficially “authoritarian” or “anti-authoritarian,” Rieff added, the “release of transgressive behavior” was “a teaching of universal contempt” with an “old name”—nihilism. “Right or Left,” our nihilist contempt-leaders were “followers of the basest instinct, for sheer possibility.”
But if Rieff is at all correct about this, we gravely err to make a scapegoat of Trump himself. A “culture organized by contempt and rancor, rather than reverence and justice, must view inhibition, the delay of gratification, all those disciplines by which self and society can be held in mutual check, as the main enemy.”
Without doubt, Trump has distinguished himself as America’s most anarchic and comical fomenter of violent contempt. He has not, as truth be told, we all also know, created our culture of democratized contempt. We have. We may not deserve forgiveness for this great transgression against ourselves and one another, but God knows we need it.
Democratizing Contempt
To grasp our full responsibility for Trump, one final quote is in order. Rieff references Edmund Burke, on a topic more closely associated with Trump than with his conservative critics:
Dogs are indeed the most social, affectionate, and amiable animals of the whole brute creation; but love approaches much nearer to contempt than is commonly imagined; and accordingly, though we caress dogs, we borrow from them an appellation of the most despicable kind, when we employ terms of reproach; and this appellation is the common mark of the last vileness and contempt in every language.
Shuddering with recognition at one of Trump’s favorite insults? Read on.
Wolves have not more strength than several species of dogs; but, on account of their unmanageable fierceness, the idea of a wolf is not despicable […]. Thus we are affected by strength, which is natural power. The power which arises from institution in kings and commanders, has the same connexion with terror.
If Rieff and Burke are right, there is a dark, secret link between Trump’s bald-faced praise of strength and his canine cut-downs—a connection that runs to the heart of our culture and its bad moral habits. The more we make lapdogs of our own identity tribe, pampering and spoiling our team, the more prone we seem to be to make scapedogs of another. Our failure to love justice has led us to celebrate injustice. Trump may come and Trump may go; left unfought, the democratization of contempt will dog us forever.
James Poulos is the Executive Editor of The American Mind, an online publication of the Claremont Institute. He is the author of The Art of Being Free.
|
{
"pile_set_name": "Pile-CC"
}
|
A study published in the June issue of the Journal of Geophysical Research: Planets (full paper in .pdf) provides new evidence that an ocean covered as much as one third of the Martian surface early in its history.
Most of the planet’s northern hemisphere is flat and at a lower elevation than the southern hemisphere, and thus appears similar to the ocean basins found on Earth. The border between the lowlands and the highlands would have been the coastline for the hypothetical ocean.
Planetary scientists at California Institute of Technology in Pasadena used new images from the Mars Reconnaissance Orbiter to study a 100-square-km area that sits right on this possible former coastline.
Previous satellite images have shown that this area – part of a larger region called Aeolis Dorsa, which is about 1,000 km away from Gale Crater where the Curiosity rover is now roaming – is covered in ridge-like features called inverted channels. These inverted channels form when coarse materials like large gravel and cobbles are carried along rivers and deposited at their bottoms, building up over time. After the river dries up, the finer material – such as smaller grains of clay, silt, and sand—around the river erodes away, leaving behind the coarser stuff. This remaining sediment appears as today’s ridge-like features, tracing the former river system.
When looked at from above, the inverted channels appear to fan out, a configuration that suggests one of three possible origins: the channels could have once been a drainage system in which streams and creeks flowed down a mountain and converged to form a larger river; the water could have flowed in the other direction, creating an alluvial fan, in which a single river channel branches into multiple smaller streams and creeks; or the channels are actually part of a delta, which is similar to an alluvial fan except that the smaller streams and creeks empty into a larger body of water such as an ocean.
The scientists analyzed the stratigraphic layers of the inverted channels, piecing together the history of how sediments were deposited along these ancient rivers and streams. They were able to determine the slopes of the channels back when water was still coursing through them. Such slope measurements can reveal the direction of water flow – in this case, showing that the water was spreading out instead of converging, meaning the channels were part of an alluvial fan or a delta. But they also found evidence for an abrupt increase in slope of the sedimentary beds near the downstream end of the channels. That sort of steep slope is most common when a stream empties into a large body of water – suggesting that the channels are part of a delta and not an alluvial fan.
Scientists have discovered deltas on Mars before, but most are inside a geological boundary, like a crater. Water therefore would have most likely flowed into a lake enclosed by such a boundary and so did not provide evidence for an ocean. But the newly discovered delta is not inside a crater or other confining boundary, suggesting that the water likely emptied into a large body of water like an ocean.
“This is probably one of the most convincing pieces of evidence of a delta in an unconfined region – and a delta points to the existence of a large body of water in the northern hemisphere of Mars,” said lead author Dr Roman DiBiase.
“This large body of water could be the ocean that has been hypothesized to have covered a third of the planet. At the very least, the water would have covered the entire Aerolis Dorsa region, which spans about 100,000 square km.”
______
Bibliographic information: Roman A. DiBiase et al. 2013. Deltaic deposits at Aeolis Dorsa: Sedimentary evidence for a standing body of water on the northern plains of Mars. Journal of Geophysical Research: Planets, vol. 118, no. 6, 1285–1302; doi: 10.1002/jgre.20100
|
{
"pile_set_name": "OpenWebText2"
}
|
Hemocyanin from Tachypleus gigas. II. Cooperative interactions of the subunits.
Six subunits (I to VI) were isolated from hemocyanin of an Asian horseshoe crab, Tachypleus gigas, by anion exchange chromatography of the dissociated hemocyanin. The subunit preparations were nearly homogeneous as judged by alkaline electrophoresis, but they still showed the presence of isoproteins in isoelectric focusing. The subunits were reassembled (in 10 mM CaCl2 at pH 7.5) and tested for restoration of the cooperativity in O2 binding. The reassembly of the subunits gave equilibrium mixtures of the monomer and hexamer with small amounts of larger molecules. Homogeneous and heterogeneous hexamers were prepared by reassembling a single kind or two kinds of subunits, followed by isolation of the hexamer fraction by gel filtration. Among the homohexamers, only the subunit V hexamer showed cooperativity in O2 binding with the Hill coefficient of 1.6. Among the heterohexamers the subunit I/V hybrid was most noteworthy, showing a Hill coefficient (1.7) higher than that of any other heterohexamer examined. It was concluded that there are specific interactions between the subunits I and V. It is suggested that their interactions are important for the cooperativity in the native hemocyanin.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
IL-17 silencing does not protect nonobese diabetic mice from autoimmune diabetes.
The long-held view that many autoimmune disorders are primarily driven by a Th1 response has been challenged by the discovery of Th17 cells. Since the identification of this distinct T cell subset, Th17 cells have been implicated in the pathogenesis of several autoimmune diseases, including multiple sclerosis and rheumatoid arthritis. Type 1 diabetes has also long been considered a Th1-dependent disease. In light of the emerging role for Th17 cells in autoimmunity, several recent studies investigated the potential of this subset to initiate autoimmune diabetes. However, direct evidence supporting the involvement of Th17 cells in actual pathogenesis, particularly during spontaneous onset, is lacking. In this study, we sought to directly address the role of IL-17, the cytokine by which Th17 cells are primarily characterized, in the pathogenesis of autoimmune diabetes. We used lentiviral transgenesis to generate NOD mice in which IL-17 is silenced by RNA interference. The loss of IL-17 had no effect on the frequency of spontaneous or cyclophosphamide-induced diabetes. In contrast, IL-17 silencing in transgenic NOD mice was sufficient to reduce the severity of myelin oligodendrocyte glycoprotein-induced experimental autoimmune encephalomyelitis, consistent with reports that IL-17 deficiency is protective in this experimental model of multiple sclerosis. We concluded that IL-17 is dispensable, at least in large part, in the pathogenesis of autoimmune diabetes.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
Check if current date is between 2 dates in MySQL
I have a contract table in my database and those contracts have a start date and an end date. How can I change their active state if the current date is after the end date?
I already figured out that I'll do it with a stored procedure that gets executed every day or something like that. My Problem is, I don't know, how I can check each row in the table. It seems like something extremely basic yet I can't think of any solution.
I found this Response and it looks very promising but I'm afraid I don't understand the way it's supposed to work.
I'd highly appreciate any and all pointers.
EDIT: I found the solution and my way of approaching the problem was way off.
A:
Thanks to @RiggsFolly I found the solution:
UPDATE contract_conclusion SET is_active=0 WHERE CURDATE() > date_end_contract_conclusion;
|
{
"pile_set_name": "StackExchange"
}
|
Q:
UITableViewCell next to eachother
How can i make a tableview where the cells are next to each other. Where there are 2 on each row. example like this? In the second row there are 2 images next to each other. Can this be done in a tableview by making custom tablevieCells?
A:
Yes this can be done in UItableViewCell But preferred to use collection view for this kind of view.
Just subclass uitableviewcell, add new method
-(void)setCellWithNumberOfImages:(NSInteger)images withImage1:(UIimage *)image1 withImage2:(UIImage *)image2;
if(image2 ==nil)
//add only one UIimageView with image1
else
//add two imageviews.
|
{
"pile_set_name": "StackExchange"
}
|
James Haggerty (politician)
James Haggerty (1833–1912) was an Ontario farmer and political figure. He represented Hastings North in the Legislative Assembly of Ontario from 1894 to 1898 as a Patrons of Industry member.
He was born in Huntingdon Township, Upper Canada, the son of James Haggerty who came to Upper Canada from Ireland, and was educated there and in Toronto. Haggerty was also a school teacher. He married Ann Fleming. He was president of the North Hastings Agricultural Society and was also president of the West Huntingdon Cheese Manufacturing Company. Haggerty served as reeve for Huntingdon in 1877, 1880–1882 and 1891 to 1894.
External links
The Canadian parliamentary companion, 1897 JA Gemmill
The Heritage Years : A History of Stirling and District (1983)
Category:1833 births
Category:1912 deaths
Category:Ontario Patrons of Industry MPPs
|
{
"pile_set_name": "Wikipedia (en)"
}
|
%YAML 1.2
--- |
# Copyright 2015 gRPC authors.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
FROM debian:jessie
<%include file="../../apt_get_basic.include"/>
<%include file="../../gcp_api_libraries.include"/>
<%include file="../../python_deps.include"/>
<%include file="../../ruby_deps.include"/>
<%include file="../../run_tests_addons.include"/>
# Define the default command.
CMD ["bash"]
|
{
"pile_set_name": "Github"
}
|
Q:
Junit4 Android TestField text test
My test is:
@RunWith(AndroidJUnit4.class)
@LargeTest
public class TipActivityTests {
@Rule
public ActivityTestRule<TipActivity> mActivityRule = new ActivityTestRule<>(TipActivity.class);
@Test
public void initialValues() {
onView(withId(R.id.tip_label_base_price)).check(matches(ViewMatchers.withText("45"")));
}
}
But I get the error 'with text: is "45"' doesn't match the selected view. Expected: with text: is "45":
android.support.test.espresso.base.DefaultFailureHandler$AssertionFailedWithCauseError: 'with text: is "45"' doesn't match the selected view.
Expected: with text: is "45"
Got: "AppCompatTextView{id=2131689669, res-name=tip_label_base_price, visibility=VISIBLE, width=266, height=106, has-focus=false, has-focusable=false, has-window-focus=true, is-clickable=false, is-enabled=true, is-focused=false, is-focusable=false, is-layout-requested=false, is-selected=false, root-is-layout-requested=false, has-input-connection=false, x=141.0, y=96.0, text=$ 45.00, input-type=0, ime-target=false, has-links=false}"
It doesn't make sense to me, it should not print the actual value of the field vs the compared value?
A:
I had the same problem and spent quite some time trying to understand the root cause. It turned out the strings were not equals, that's why it was failing. The error message is not really explicit because it's printing the whole object properties etc instead of saying: expected: "foo", received: "bar". But the strings are actually compared.
|
{
"pile_set_name": "StackExchange"
}
|
Slideshow ( 2 images )
TOKYO (Reuters) - Japan’s Sharp Corp said it will acquire Toshiba Corp’s personal computer business for $36 million, highlighting its recovery under the control of Foxconn and marking a return to a business it quit eight years ago.
It will pay 4 billion yen ($36.47 million) for an 80.1 percent stake, it said in a statement on Tuesday.
Sharp was once known as a major supplier of high-end TVs and smartphone displays but struggled to compete with Asian rivals and was bought by Taiwan’s Foxconn, or Hon Hai Precision Industry Co Ltd, two years ago. It exited the PC market in 2010.
|
{
"pile_set_name": "OpenWebText2"
}
|
<!---
# Licensed to the Apache Software Foundation (ASF) under one
# or more contributor license agreements. See the NOTICE file
# distributed with this work for additional information
# regarding copyright ownership. The ASF licenses this file
# to you under the Apache License, Version 2.0 (the
# "License"); you may not use this file except in compliance
# with the License. You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
-->
# Apache Hadoop Changelog
## Release 1.0.1 - 2012-02-22
### INCOMPATIBLE CHANGES:
| JIRA | Summary | Priority | Component | Reporter | Contributor |
|:---- |:---- | :--- |:---- |:---- |:---- |
| [HADOOP-7470](https://issues.apache.org/jira/browse/HADOOP-7470) | move up to Jackson 1.8.8 | Minor | util | Steve Loughran | Enis Soztutar |
| [HADOOP-8037](https://issues.apache.org/jira/browse/HADOOP-8037) | Binary tarball does not preserve platform info for native builds, and RPMs fail to provide needed symlinks for libhadoop.so | Blocker | build | Matt Foley | Matt Foley |
### IMPROVEMENTS:
| JIRA | Summary | Priority | Component | Reporter | Contributor |
|:---- |:---- | :--- |:---- |:---- |:---- |
| [MAPREDUCE-3184](https://issues.apache.org/jira/browse/MAPREDUCE-3184) | Improve handling of fetch failures when a tasktracker is not responding on HTTP | Major | jobtracker | Todd Lipcon | Todd Lipcon |
| [MAPREDUCE-3607](https://issues.apache.org/jira/browse/MAPREDUCE-3607) | Port missing new API mapreduce lib classes to 1.x | Major | client | Tom White | Tom White |
| [HADOOP-7987](https://issues.apache.org/jira/browse/HADOOP-7987) | Support setting the run-as user in unsecure mode | Major | security | Devaraj Das | Jitendra Nath Pandey |
| [HDFS-2814](https://issues.apache.org/jira/browse/HDFS-2814) | NamenodeMXBean does not account for svn revision in the version information | Minor | . | Hitesh Shah | Hitesh Shah |
| [HADOOP-8009](https://issues.apache.org/jira/browse/HADOOP-8009) | Create hadoop-client and hadoop-minicluster artifacts for downstream projects | Critical | build | Alejandro Abdelnur | Alejandro Abdelnur |
### BUG FIXES:
| JIRA | Summary | Priority | Component | Reporter | Contributor |
|:---- |:---- | :--- |:---- |:---- |:---- |
| [MAPREDUCE-3343](https://issues.apache.org/jira/browse/MAPREDUCE-3343) | TaskTracker Out of Memory because of distributed cache | Major | mrv1 | Ahmed Radwan | yunjiong zhao |
| [HADOOP-7960](https://issues.apache.org/jira/browse/HADOOP-7960) | Port HADOOP-5203 to branch-1, build version comparison is too restrictive | Major | . | Giridharan Kesavan | Matt Foley |
| [HADOOP-7964](https://issues.apache.org/jira/browse/HADOOP-7964) | Deadlock in class init. | Blocker | security, util | Kihwal Lee | Daryn Sharp |
| [HADOOP-7988](https://issues.apache.org/jira/browse/HADOOP-7988) | Upper case in hostname part of the principals doesn't work with kerberos. | Major | . | Jitendra Nath Pandey | Jitendra Nath Pandey |
| [HADOOP-8010](https://issues.apache.org/jira/browse/HADOOP-8010) | hadoop-config.sh spews error message when HADOOP\_HOME\_WARN\_SUPPRESS is set to true and HADOOP\_HOME is present | Minor | scripts | Roman Shaposhnik | Roman Shaposhnik |
| [HDFS-2379](https://issues.apache.org/jira/browse/HDFS-2379) | 0.20: Allow block reports to proceed without holding FSDataset lock | Critical | datanode | Todd Lipcon | Todd Lipcon |
| [HADOOP-8052](https://issues.apache.org/jira/browse/HADOOP-8052) | Hadoop Metrics2 should emit Float.MAX\_VALUE (instead of Double.MAX\_VALUE) to avoid making Ganglia's gmetad core | Major | metrics | Varun Kapoor | Varun Kapoor |
|
{
"pile_set_name": "Github"
}
|
Q:
What kind of Exception occurred?
I tried to create a test ClassCastException:
In line 1: it prints out class cast exception as I expected
In line 2: it just prints exception.RuntimeExceptionTest$1B@7852e922 (RuntimeExceptionTest is my class name). I wonder what kind of exception here?
try {
class A { }
class B extends A {}
class C extends A {}
A objA = new B();
System.out.println((C)objA); // Line 1
System.out.println((A)objA); // Line 2
} catch (Exception e) {
e.printStackTrace();
}
A:
Line2 doesn't throw an exception. From the Oracle javadocs:
The toString method for class Object returns a string consisting of the name of the class of which the object is an instance, the at-sign character `@', and the unsigned hexadecimal representation of the hash code of the object. In other words, this method returns a string equal to the value of:
getClass().getName() + '@' + Integer.toHexString(hashCode())
That means your Line2 just prints what objA.toString() returns, which is
exception.RuntimeExceptionTest$1B@7852e922
since exception.RuntimeExceptionTest is your class name.
|
{
"pile_set_name": "StackExchange"
}
|
Psychological Determinants of Heart Failure Self-Care: Systematic Review and Meta-Analysis.
Psychological distress has been associated with poor outcomes in patients with chronic heart failure (HF), which is assumed to be partly due to poor HF self-care behavior. This systematic review and meta-analysis describes the current evidence concerning psychological determinants of self-care in patients with chronic HF. Eligible studies were systematically identified by searching electronic databases PubMed, PsycINFO, and the Conference Proceedings Citation Index (Web of Science) for relevant literature (1980-October 17, 2014). Study quality was assessed according to the level of risk of bias. Quantitative data were pooled using random-effects models. Sixty-five studies were identified for inclusion that varied considerably with respect to sample and study characteristics. Risk of bias was high in the reviewed studies and most problematic with regard to selection bias (67%). Depression (r = -0.19, p < .001), self-efficacy (r = 0.37, p < .001), and mental well-being (r = 0.14, p = .030) were significantly associated with self-reported self-care. Anxiety was not significantly associated with either self-reported (r = -0.18, p = .24) or objective self-care (r = -0.04, p = .79), neither was depression associated with objectively measured medication adherence (r = -0.05, p = .44). Psychological factors (depression, self-efficacy, and mental well-being) were associated with specific self-care facets in patients with chronic HF. These associations were predominantly observed with self-reported indices of self-care and not objective indices. Methodological heterogeneity and limitations preclude definite conclusions about the association between psychological factors and self-care and should be addressed in future research.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
Implementing a "soft delete" system using sqlalchemy
We are creating a service for an app using tornado and sqlalchemy. The application is written in django and uses a "soft delete mechanism". What that means is that there was no deletion in the underlying mysql tables. To mark a row as deleted we simply set the attributed "delete" as True. However, in the service we are using sqlalchemy. Initially, we started to add check for delete in the queries made through sqlalchemy itself like:
customers = db.query(Customer).filter(not_(Customer.deleted)).all()
However this leads to a lot of potential bugs because developers tend to miss the check for deleted in there queries. Hence we decided to override the default querying with our query class that does a "pre-filter":
class SafeDeleteMixin(Query):
def __iter__(self):
return Query.__iter__(self.deleted_filter())
def from_self(self, *ent):
# override from_self() to automatically apply
# the criterion too. this works with count() and
# others.
return Query.from_self(self.deleted_filter(), *ent)
def deleted_filter(self):
mzero = self._mapper_zero()
if mzero is not None:
crit = mzero.class_.deleted == False
return self.enable_assertions(False).filter(crit)
else:
return self
This inspired from a solution on sqlalchemy docs here:
https://bitbucket.org/zzzeek/sqlalchemy/wiki/UsageRecipes/PreFilteredQuery
However, we are still facing issues, like in cases where we are doing filter and update together and using this query class as defined above the update does not respect the criterion of delete=False when applying the filter for update.
db = CustomSession(with_deleted=False)()
result = db.query(Customer).filter(Customer.id == customer_id).update({Customer.last_active_time: last_active_time })
How can I implement the "soft-delete" feature in sqlalchemy
A:
I've done something similar here. We did it a bit differently, we made a service layer that all database access goes through, kind of like a controller, but only for db access, we called it a ResourceManager, and it's heavily inspired by "Domain Driven Design" (great book, invaluable for using SQLAlchemy well). A derived ResourceManager exists for each aggregate root, ie. each resource class you want to get at things through. (Though sometimes for really simple ResourceManagers, the derived manager class itself is generated dynamically) It has a method that gives out your base query, and that base query gets filtered for your soft delete before it's handed out. From then on, you can add to that query generatively for filtering, and finally call it with query.one() or first() or all() or count(). Note, there is one gotcha I encountered for this kind of generative query handling, you can hang yourself if you join a table too many times. In some cases for filtering we had to keep track of which tables had already been joined. If your delete filter is off the primary table, just filter that first, and you can join willy nilly after that.
so something like this:
class ResourceManager(object):
# these will get filled in by the derived class
# you could use ABC tools if you want, we don't bother
model_class = None
serializer_class = None
# the resource manager gets instantiated once per request
# and passed the current requests SQAlchemy session
def __init__(self, dbsession):
self.dbs = dbsession
# hand out base query, assumes we have a boolean 'deleted' column
@property
def query(self):
return self.dbs(self.model_class).filter(
getattr(self.model_class, 'deleted')==False)
class UserManager(ResourceManager):
model_class = User
# some client code might look this
dbs = SomeSessionFactoryIHave()
user_manager = UserManager(dbs)
users = user_manager.query.filter_by(name_last="Duncan").first()
Now as long as I always start off by going through a ResourceManager, which has other benefits too (see aforementioned book), I know my query is pre-filtered. This has worked very well for us on a current project that has soft-delete and quite an extensive and thorny db schema.
hth!
|
{
"pile_set_name": "StackExchange"
}
|
India's most "nationalist" government in history has done quite badly on the actual security scenario on the ground. So, while the keyboard warriors battle it out, handing out "faux nationalism certificates" perpetually citing the soldier at the borders, the real soldiers are being given a short shrift.
The death toll of the CRPF battling the Maoists in India's heartland has shown a shocking spiral in the past three years. On Monday, 25 CRPF men were killed in a Chhattisgarh jungle ambush, yet the ministry of home affairs has not found time to appoint a full-time Director General for the force for the past two months after K Durga Prasad retired.
During the same period, the CRPF has lost 38 men in two major ambushes, including Monday's which was the worst in the past seven years.
The terror spiral in the Valley where even an election cannot be held has put a huge question mark over the legitimacy of the inept Mehbooba Mufti government in alliance with the BJP.
Periodic outbreaks in Kashmir, such as the blinding of nearly 100 young people with pellet guns after the death of militant Burhan Wani last summer, are a symptom of the malaise that is plaguing the security establishment – also the fact that National Security Adviser Ajit Doval is completely out of his depth and unable to formulate a response to the ever increasing problem and the constant meddling by the powerful Ram Madhav, the RSS pracharak on secondment to the BJP who is credited with the BJP-PDP alliance.
The Doval-Madhav duo have also meddled in the ministry of external affairs (MEA) with disastrous effect. For those with short memories, remember the Modi-Doval road show around the world with much fanfare last year to secure the Nuclear Security Group waiver and how after a mega publicity blitz, even Mexico and Switzerland voted against us.
While the publicity machine is awash with unconvincing tales of his daring do and acts of valour in Punjab and Pakistan, the reality is somewhat different.
In Pakistan, during his tenure, he was in charge of the security detail of the mission which in itself is quite a taxing job in the hostile environs. People close to him tell me he was identified as an Intelligence Bureau man from day one of his tenure and did not undertake any missions, contrary to the "Desi Bond" myth.
Doval as NSA has ensured that Pakistan and China run rings around India and even friendly Nepal has turned hostile.
After mismanaging the Pathankot siege, which lasted an incredible four days in January 2016, Doval incredibly gave Pakistan access to the Indian Air Force base - the first time ever in our history. Pakistan did not reciprocate and later called the entire siege a "false flag operation" by India.
Doval as NSA has ensured that Pakistan and China run rings around India and even friendly Nepal has turned hostile. Photo: India Today
Consider the case of Myanmar, where India had for years been carrying out secret anti-terror operations. Even this was grist to Doval's publicity machine and one such operation was made public, with junior minister Raghuvendra Rathore tweeting a juvenile hashtag "56 inch rocks".
The result: A red-faced, embarrassed Myanmar refuted reports that India had entered their territory and said no such operations would be allowed in the future.
The so called "historic Naga accord" is yet another example of Doval's insatiable hunger for publicity. The accord signed in the presence of Prime Minister Narendra Modi at 7 Lok Kalyan Marg on August 15, 2015, is still a "secret" - its contents known to no one, neither the chief ministers of the affected states such as Manipur, nor Parliament.
Yet Doval, who was heading the RSS-funded Vivekanand Foundation post-retirement where he used to give talks on Pakistan trying to "bleed India by a thousand cuts", is not held to account.
Despite going along with then foreign minister Jaswant Singh in the worst security surrender of the IC-814 hijack on December 24, 1999, Doval emerged as BJP leader LK Advani's key IB point-man.
As Doval's power increased, his family has also benefitted. His son Shaurya who earlier used to run the Saudi-funded Zeus caps now heads the India Foundation along with Ram Madhav. The foundation is key for foreign heavy-hitters looking to connect with the Indian establishment. It has several cabinet ministers such as Nirmala Sitharaman, Suresh Prabhu and Jayant Sinha as directors.
Even Bangladeshi Prime Minister Sheikh Hasina on her visit this month attended a reception thrown by Madhav via the India Foundation.
Ram Madhav enjoys power without any accountability is evident in the case of the Valley.
His constant espousal of the hard RSS line has ensured that the Valley careens from crisis to crisis with no attempt at any kind of political outreach.
A carpet weaver who had gone out to vote in the recent bypoll, which saw a dismal 7 per cent turnout, was tied by the Army to a jeep and paraded around as a human shield, violating the Geneva convention and the Army's own code; the incident brought India international opprobrium.
But Doval and Madhav's hard line continues, so while India holds on grimly to Kashmir, questions which were considered settled decades ago are being asked again.
In an interview to DailyO, former J&K CM Omar Abdullah confessed candidly that parties like his did not represent the mainstream anymore in the Valley. He also blamed Modi's "tourism versus terrorism" binary laced comment, which is an article of faith with Madhav.
The list of security failures and omissions is stunning. Equally stunning is the fact that the Centre is never held to account for the claims they make.
Remember Modi saying that demonetisation had broken the back of terror and Maoist funding?
After Sukma and the ongoing tragedy in the Valley, has even a single leader asked the question "how and why"?
Also read: 26 CRPF personnel killed in Maoist encounter in Chhattisgarh: What you should know
|
{
"pile_set_name": "OpenWebText2"
}
|
---
abstract: 'The properties of $\sim 1000$ high-excitation and low-excitation radio galaxies (HERGs and LERGs) selected from the [@2016MNRAS.460.4433H] $1 - 2$ GHz VLA survey of Stripe 82 are investigated. The HERGs in this sample are generally found in host galaxies with younger stellar populations than LERGs, consistent with other work. The HERGs tend to accrete at a faster rate than the LERGs, but there is more overlap in the accretion rates of the two classes than has been found previously. We find evidence that mechanical feedback may be significantly underestimated in hydrodynamical simulations of galaxy evolution; 84 % of this sample release more than 10 % of their energy in mechanical form. Mechanical feedback is significant for many of the HERGs in this sample as well as the LERGs; nearly 50 % of the HERGs release more than 10 % of their energy in their radio jets.'
---
Introduction
============
One of the key unknowns in galaxy evolution is how star-formation in galaxies becomes quenched; it is widely thought that feedback from active galactic nuclei (AGN) is responsible for this, but the mechanisms are not well understood. Observational evidence (e.g. [@2012MNRAS.421.1569B]) suggests that AGN can be split into two distinct classes; high-excitation radio galaxies (HERGs; also known as cold mode, quasar mode or radiative mode sources) which radiate efficiently across the electromagnetic spectrum and posses the typical AGN accretion-related structures such as an accretion disk and a dusty torus, and low-excitation radio galaxies (LERGs; also known as hot mode, radio mode or jet mode sources) which radiate inefficiently and emit the bulk of their energy in mechanical form as powerful radio jets (see e.g. ).
It is thought that these two AGN accretion modes have different feedback effects on the host galaxy (see review by ) and lead to the two different feedback paths in semi-analytic and hydrodynamic simulations, but despite being widely studied over the last decade (e.g. [@2007MNRAS.376.1849H]; [@2009Natur.460..213C]; ) these processes are not well understood. In these proceedings I use a sample of $\sim 1000$ HERGs and LERGs to investigate the host galaxy properties and accretion rates of the two classes, and explore the implications of these results for AGN feedback.
Data used and source classification
===================================
This work is based on a $1-2$ GHz Karl G. Jansky Very Large Array (VLA) survey covering 100 deg$^2$ in SDSS Stripe 82 which has a $1 \sigma$ rms noise of 88 $\mu$Jy beam$^{-1}$ and a resolution of $16 \times 10$ arcsec; full details of the radio survey are given in [@2016MNRAS.460.4433H]. This radio catalogue was matched to the SDSS DR14 optical catalogue ([@2018ApJS..235...42A]) by eye; details of the matching process are described in [@2018MNRAS.480..707P]. We restrict our analysis to sources with a counterpart in the spectroscopic catalogue with $z < 0.7$, our sample therefore has 1501 sources which cover the range $0.01 < z < 0.7$ and $10^{21} < L_{1.4~\rm GHz} / \textrm{W Hz}^{-1} < 10^{27}$. We use the the value-added spectroscopic catalogues described in [@2013MNRAS.431.1383T].
Sources are classified as either AGN or star-forming galaxies using information from their optical spectra, full details of this process are given in [@2018MNRAS.480..707P]. The AGN in the sample are then classified as HERGs or LERGs using the criteria given in [@2012MNRAS.421.1569B], which use a combination of emission line ratios and \[OIII\] equivalent width. This is explained in detail in [@2018MNRAS.480..358W]. Additionally to the Best and Heckman classification scheme, we introduce a ‘probable LERG’ class for sources which cannot be classified according to the full criteria but which have an \[OIII\] equivalent width $<5$ Å. The total number of sources in each category is as follows; HERGs = 60, LERGs = 149, probable LERGs = 600, QSOs = 81 and unclassified sources = 271, with 340 star-forming galaxies.
Host galaxy properties
======================
![4000 Å break strength as a function of redshift with the HERGs, LERGs, probable LERGs and unclassified sources shown separately. The filled shapes show the mean values in each luminosity bin for the different samples. From [@2018MNRAS.480..358W][]{data-label="fig:Dn4000"}](fig1_whittam.pdf){width="7cm"}
Using the wealth of multi-wavelength data available in the field, we can compare the properties of the host galaxies of the HERGs and LERGs. 4000 Å break strength, which traces stellar age, is shown as a function of redshift in Fig \[fig:Dn4000\]. This shows that HERGs tend to be found in host galaxies with younger stellar populations than LERGs across the redshift range probed here. This is agrees with other results in the literature (e.g. [@2012MNRAS.421.1569B]) and is consistent with the idea that HERGs have a supply of cold gas which provides the fuel for both star-formation and AGN activity. We refer the reader to [@2018MNRAS.480..358W] for further discussion of this and other host galaxy properties.
Accretion rates
===============
![Left panel shows the distribution of Eddington-scaled accretion rates for the different source classifications. Right panel shows the fraction of the accreted energy released in the jets for the different source types as a function of redshift. Triangles represent sources with an upper limit on their radiative accretion rate, so the fraction of energy released in the jet is a lower limit. The dashed line is the radio mode feedback model used in Horizon-AGN from [@2014MNRAS.444.1453D]. The uncertainties in the scaling relations used to estimate $L_\textrm{bol}$ and $L_\textrm{mech}$ are 0.4 and 0.7 dex respectively. From [@2018MNRAS.480..358W]. []{data-label="fig:accretion"}](fig2a_whittam.pdf "fig:"){width="6.5cm"} ![Left panel shows the distribution of Eddington-scaled accretion rates for the different source classifications. Right panel shows the fraction of the accreted energy released in the jets for the different source types as a function of redshift. Triangles represent sources with an upper limit on their radiative accretion rate, so the fraction of energy released in the jet is a lower limit. The dashed line is the radio mode feedback model used in Horizon-AGN from [@2014MNRAS.444.1453D]. The uncertainties in the scaling relations used to estimate $L_\textrm{bol}$ and $L_\textrm{mech}$ are 0.4 and 0.7 dex respectively. From [@2018MNRAS.480..358W]. []{data-label="fig:accretion"}](fig2b_whittam.pdf "fig:"){width="6.5cm"}
There is a scenario building up in the literature that there are two distinct accretion modes which are responsible for HERGs and LERGs respectively; in this scenario there is a dichotomy in accretion rates between the two classes, relating to the two different modes. The radiative accretion rates of the AGN in this sample are estimated from their \[OIII\] 5007 line luminosity and the mechanical accretion rates are estimated from the 1.4-GHz radio luminosity using the [@2010ApJ...720.1066C] relationship. Black hole masses are estimated from the local black hole mass - bulge mass relation, allowing Eddington-scaled accretion rates to be calculated as follows: $\lambda = (L_{\rm bol} + L_{\rm mech}) / L_{\rm Edd}$. The left panel of Fig. \[fig:accretion\] shows the distribution of Eddington-scaled accretion rates for the HERGs and LERGs in this sample. It is clear from this figure that the HERGs generally accrete at a faster Eddington-scaled rate than the LERGs, with a distribution that peaks just below 0.1 compared to 0.01. However, there is a significant overlap in accretion rates between the two classes, with HERGs found across nearly the full range of accretion rates.
The dichotomy in accretion rates between HERGs and LERGs is therefore less clear in this study than it is in other studies in the literature; for example [@2012MNRAS.421.1569B] and [@2014MNRAS.440..269M] both find almost no overlap in accretion rates between the two classes. In contrast, our sample seems to suggest a more continuous range of accretion rates. Note the our sample probes fainter radio luminosities ($10^{21} < L_{1.4~\rm GHz} / \textrm{W Hz}^{-1} < 10^{27}$) than other results in the literature; this could be part of the reason for the difference in our results, although we see some overlap in the accretion rates of the HERGs and LERGs across the luminosity range sampled here. We also do not observe any dichotomy in the \[OIII\] equivalent width or Excitation Index distributions, the two main parameters used to classify the HERGs and LERGs, suggesting that any dividing value chosen in these parameters is perhaps arbitrary for our sample.
Implications for AGN feedback
=============================
AGN feedback is required in all leading hydrodynamical simulations of galaxy evolution to quench star-formation. Some simulations implement mechanical and radiative feedback (assumed to relate to LERGs and HERGs respectively) separately (e.g. Horizon-AGN; [@2014MNRAS.444.1453D]) while others do not (e.g. MUFASA; [@2016MNRAS.462.3265D]).
The right panel of Fig. \[fig:accretion\] shows $L_\textrm{mech} / (L_\textrm{bol} + L_\textrm{mech})$, which provides an estimate of the fraction of the total accreted energy deposited back into the interstellar medium in mechanical form. The dashed line shows the mechanical feedback efficiency of 10 % assumed in Horizon-AGN; it is clear that this is a significant underestimate for the sources in this sample, with 84 % of the sample depositing more than 10 % of their energy in mechanical form. This plot also demonstrates that mechanical feedback can be significant for HERGs as well as for LERGs; nearly 50 % (29/60) of the HERGs in this sample release more than 10 % of their accreted energy in mechanical form.
There is a scatter of $\sim 2$ dex in $L_\textrm{mech} / (L_\textrm{bol} + L_\textrm{mech})$, which shows that the assumption that there is a direct scaling between accretion rate and mechanical feedback which is used in most hydrodynamical simulations does not necessarily hold. This may be because environment plays a significant role.
Conclusions and future perspectives
===================================
We have used the [@2016MNRAS.460.4433H] VLA 1-2 GHz radio survey covering 100 deg$^2$ in Stripe 82 along with optical spectroscopy to probe the properties of $\sim 1000$ high- and low-excitation radio galaxies. They key results of this work are:
- HERGs tend to be found in host galaxies with younger stellar populations than LERGs, consistent with other results in the literature.
- While the HERGs in our sample tend to have higher accretion rates than the LERGs, we find considerable overlap in the accretion rates of the two samples.
- Mechanical feedback can be significant for HERGs as well as for LERGs, and may be underestimated for both populations in hydrodynamical simulations.
The advent of new radio telescopes, such as MeerKAT, LOFAR and ASKAP, means there is potential to make a large step forward in our understanding of radio galaxies and their mechanical feedback effects in the next few years. One example of a survey planned with a new instrument is the MeerKAT MIGHTEE survey ([@2016mks..confE...6J]) which has just started to collect data and will survey 10 deg$^2$ to a depth of 1 $\mu$Jy at 800 - 1600 MHz in four different fields. The unique combination of deep radio images over a significant cosmological volume along with excellent multi-wavelength coverage means we will be able to, amongst other things, extend the study described in this proceedings to significantly fainter luminosities and probe whether or not there is an accretion mode dichotomy, particularly at lower luminosities.
*Acknowledgements* The author thanks Matthew Prescott, Matt Jarvis, Kim McAlpine and Ian Heywood for their significant contributions to this work. This research was supported by the South African Radio Astronomy Observatory, which is a facility of the National Research Foundation, an agency of the Department of Science and Technology.
Abolfathi B., et al., 2018, *ApJS*, 235, 42
Best P. N., Heckman T. M., 2012, *MNRAS*, 421, 1569
Cattaneo A., et al., 2009, *Nature*, 460, 213
Cavagnolo K. W., et al., 2010, *ApJ*, 720, 1066
Dav[é]{} R., Thompson R., Hopkins P. F., 2016, *MNRAS*, 462, 3265
Dubois Y., et al., 2014, *MNRAS*, 444, 1453
Fabian A. C., 2012, *ARA&A*, 50, 455
Hardcastle M. J., Evans D. A., Croston J. H., 2007, *MNRAS*, 376, 1849
Heckman T. M., Best P. N., 2014, *ARA&A*, 52, 589
Heywood I., et al., 2016, *MNRAS*, 460, 4433
Jarvis M., et al., 2016, *Proceedings of MeerKAT Science: On the Pathway to the SKA. 25-27 May, 2016 Stellenbosch, South Africa*, 6
Mingo B., et al., 2014, *MNRAS*, 440, 269
Prescott M., et al., 2018, *MNRAS*, 480, 707
Thomas D., et al., 2013, *MNRAS*, 431, 1383
Whittam I. H., Prescott M., McAlpine K., Jarvis M. J., Heywood I., 2018, *MNRAS*, 480, 358
|
{
"pile_set_name": "ArXiv"
}
|
I've been working on a new, much improved version of this for a few months now. No trains yet -- building the tracks and cities first this time. First screenshot from NW London:
Improvements:-- Better heightmap from DEMs-- Bigger scale -- 118 metres per tile, which allows for all stations and tracks to be built. It also means that the map is 4200 x 8600 tiles and consumes 1.5Gb of RAM so far! I'm not sure how well it will run when there are actually trains operating, but we shall see. -- Since Experimental has come a long way since I made the last map, I'm hoping I'll be able to simulate as close to realistic running as possible on each line.-- (Eventually:) real-liveried trains
When the next version of Experimental is released, I'll be able to start operating train routes. (The new braking physics features are required for this to work properly at such a big scale).
That is very impressive. Have to say think I'm going to stick to my 3800x2800 map of Britain for now if only because I don't think my computer would cope with the size of yours! Mind you, only needs to be about another 10 times larger in each direction and we'll be approaching a scale which is realistic for buildings and distances (Moores Law would indicate that should be possible in about 10 years time...)! :p
I recommend you switch to large player and turn the resolution up, or you'll need a magnifying glass!
(The trains you see, in order of departure from Colchester, are: 1104 London to Ipswich, 1103 Norwich to London, 1116 London to Clacton, 1120 Colchester to Colchester Town, 1123 London to Norwich, 1130 Norwich to London, 1133 Clacton to London. The two left over at the end are the 1141 London to Colchester Town and the 1144 Colchester Town to London. You can also see the 1056 Colchester to Walton-on-the-Naze in the bottom half of the video at the beginning.)
I'm excited to work more on this when the new version is finalised!
Notes:
> I haven't taken any time to paint the trains yet, but they do all have the relevant .dat file stats, which is required for them to run to time.
> The non-standard source of data here is the National Rail sectional appendix, which gives linespeeds and platform layouts etc. People might not know that this data is available, so here's the link: http://www.networkrail.co.uk/aspx/10563.aspx
Here's another video of rather higher quality from my above testing -- a journey from Clacton-on-Sea to London in four minutes.
Our service makes all the stops you'd find on an ordinary timetable, and arrive in almost exactly the timetabled 85 in-game minutes. (Sadly you can't see the time indicator as I'm not recording fullscreen).
There are lots of work-in-progress elements here: missing roads and trackwork, cities which need tidying up, etc. But this video gives a good sense for the map.
Note that the performance of the old map will be pretty unsatisfactory in the latest version of Experimental, since the vehicle physics have changed since I made it. When the new version of Experimental comes out (any time now, hopefully) I'll be spending some time developing my new version of this map.
Here's another video from the new map, showing local services around London Liverpool Street:
Preview: click for larger
*Watch in 720p and fullscreen to avoid squinting*
This one features services to Shenfield, Chingford, Enfield Town and Cheshunt. As ever, what you see reflects a real daytime off-peak timetable. You'll notice (from the annotations) that the Shenfield arrivals are a little early, but everything else is more or less spot on.
Of course, Liverpool Street has more than four platforms: the rest are underground for space reasons. Because the scale is 118 meters per tile, it wouldn't be possible to have all the platforms above ground.
I'm hoping to make a different kind of video soon: a "video diary" type thing in which I give a tour of the map as it stands and talk about how it's been made and where it will go next.
The track layout on the Tower Gateway branch of the DLR is not accurate. After the Bank branch was opened Tower Gateway was served from a single lead junction, and more recently still the station has been rebuilt to only have one platform track (but two platforms).
It goes without saying that to have a layout so complete and complex that only tiny flaws like this can be spotted is very impressive
Showing the complexity of the network and the connexions. That's where the real beauty lies for me, when the subject leaves the pure aesthetic and my mind forms it's own representation of the complex system.
ps.: this just made me wonder if the term beauty is correct, as it may apply only to aesthetic beauty. The representation in my mind can hardly called aesthetic* anymore, since it is beyond sensing already. Unless i would consider the transfer of information in my mind as sensing. First thought was the appreciation of abstract art, where one might appreciate the representation in one's mind, thus seeing no conceptual difference, which would most likely fall under aesthetic. Third thought everything sensed requires a mental representation. Fourth thought, there is a fundamentall difference in my own perception of the matter when looking at a non-abstract photo and the mental representation of a complex system. Let both have the same degree of appreciation by me, i consider the former as mostly reception the latter as mostly forming the mental representation. Degree of conscious evolvement is different when forming both mental representations. Reflection on this: for the picture the medium is important, i would not appreciate the beauty of it when reading a good description, i can get the beauty of the complex system regardless of the medium -- as long as i can understand it.
pps.: mostly wrote above to structure my thoughts, decided not to delete it, since the people here might understand why i can consider the complex system to be beautiful (while i doubt it is the right word).
Showing the complexity of the network and the connexions. That's where the real beauty lies for me, when the subject leaves the pure aesthetic and my mind forms it's own representation of the complex system.
I agree completely -- that's the main appeal for me of wanting to simulate real systems, networks and passenger flows. I'll get to work on the video diary soon.
Another new video, this time featuring the Essex Thameside lines -- i.e. what used to be known as the London, Tilbury and Southend Railway. The video features trains at Southend, Upminster, Barking and Grays:
A preview image (click for larger):
We see tube trains at Barking and Upminster, too. Note that tubes are limited to four cars since in central London there is only room for two-tile long underground stations.
I've also been working on the suburban lines out of Waterloo. These were the first real test for my ambition to simulate a real timetable, since the lines out of Waterloo are very crowded! I was relieved to find, however, that everything works just fine. A preview image is below, and I'll have a video of this (as well as the promised video diary) coming soon:
Here's the first episode of the promised video diary, in which I introduce the map and talk mainly about two things: first, how it's different from my first attempt at a GB map in Simutrans, and second, the various kinds of data that I've used in making the map.
This screenshot is of the Richmond area. I'll probably have to add another bay platform at Richmond station once I add the London Overground services. At some stations I've omitted platforms which are not in regular off-peak use. Richmond seems to have five bay platforms, but I think I'll only need four. Also, to give another example, I think that the new bay platforms at Blackfriars are only used by peak-time services, so I won't be building those -- which is just as well, since that area is quite crowded!
Ignorant as the non-native speaker i am, it sounded just like typical accademic english to me. :-(
Kieron was joking -- my accent is definitely not Aberdonian I've only lived here for six months, so the accent has yet to take hold!
Quote
Good luck with the rest, and remember: there is life outside Simutrans...
Haha, indeed! Even to get this far has been a slow gradual process over several months, so don't worry, I maintain a healthy life outside Simutrans. In fact, I've spent a lot of time in the last few weeks engrossed in Guild Wars 2. Oh, you mean that there is life outside video games? Well, I'm not so sure about that...
This is incredible! Shame that virtual undertakings are so hard to see... When finished, this would deserve (or rather generate?) some publicity (giving Simutrans some spotlight as well ). At least public transport people should be interested!
Come to think about this, why is it that the program feels... normal, while the world created in it amazing? That's not fair.
The London Overground (and Underground) network has been taking shape:
This is Highbury & Islington, whereOverground trains from Crystal Palace and West Croydon terminate -- allowing passengers to change for North London Line services to Stratford, Richmond and Clapham Junction. All services are operated by Class 378 'Capitalstar' trains.
Londoner here. I used to frequent these forums a lot, but popped on earlier today to see how things were going as I somewhat dropped off, but I must say that this is *amazing*. Awesomeness of this simply cannot be explained.
Dear Carl,Your videos, drawings and explications about your map are very fascinating to watch. It must have taken a lot of time to make that and I think your work inspires me to introduce in this section my own map of Paris.
Another video, hot on the heels of the last, in which we discuss how the timetables and schedules work on this map. I also give a general overview of the progress that's been made since previous videos.
Screenshot from the Cannon Street/London Bridge/Waterloo area, where services have been taking shape.
The map still runs very smoothly -- I'm only recording at 10fps here so it's actually even smoother than shown in the video -- and I can still fast-forward up to 30-35x normal speed. That said, performance is my big worry on this map -- I'm concerned that it will be unplayably slow towards the end. I'm not worried about the number of convoys, since I don't think there will be many more than on the previous version of the map, and that still ran acceptably even when full. (Also, I think about 1/4 of the total convoys are already on this new map -- since the frequency of London Underground trains means that they take up a surprising proportion of the total convoys). But the population and passenger levels are likely to be much higher on this new map, and it's this that might kill performance. We shall see.
If you mean how often do I have to replace vehicles in the pakset, the answer is often: all of the trains I'm using here have been painted or modified by me (which is why many of them look a little dodgy )
Or if you mean how often do I have to use the "replace" function in-game, the answer is never -- I've set it up so that I don't have to use that.
First, a quick one I grabbed by accident with four trains passing at Brentwood (on the London-Colchester line). On checking the timetable I was pleasantly surprised to find that all four trains were indeed meant to be passing here at exactly that time! I continue to be amazed at just how accurately it is possible to model the network on this map -- this is a testament to how far Experimental has come in recent versions. The top-most two trains are the London-Shenfield trains, and the other two are the Braintree and Southend trains.
Second, an up-to-date shot of the minimap, showing the extent and limits of the progress that I've made. It's progressing nicely... (more detail on click)
Very nice - might be my eyes playing tricks on me but looks like you've not got a reversing siding at St. Albans City (north of the station between the slow lines) which may cause problems once you start implementing Thameslink services. Also when I was last at Harwich I remember it being single track (on the platform anyway), maybe it's changed in the last 16 years though - this is just from glancing at the minimap so apologies if I've misinterpreted it...
The videos are interesting to follow, I look forward to seeing many more
|
{
"pile_set_name": "Pile-CC"
}
|
Mathematician Mary Jackson was one of a small group of African American women who worked as aeronautical engineers, called "human computers," at NASA during the Space Age.
Who Was Mary Jackson?
Mathematician Mary Winston Jackson excelled academically in a time of racial segregation. Her math and science skills earned her a position as a "human computer" for NACA, and she later became NASA's first Black female engineer. Along with serving a vital role in the development of the space program, she helped other women and minorities advance their careers. Jackson died in February 2005 at the age of 83. The story of her groundbreaking contributions to NASA was later dramatized in the 2016 film Hidden Figures.
Early Years
Mary Winston Jackson was born on April 9, 1921, in Hampton, Virginia, the daughter of Ella and Frank Winston. She attended Hampton’s all-Black schools and graduated with high honors from George P. Phenix Training School in 1937. Five years later, she earned dual bachelor’s degrees in mathematics and physical science from Hampton Institute.
Taking her Talents to Work
After college, Jackson took on a series of jobs, including teacher, bookkeeper and receptionist. Then in 1951, she found employment at the National Advisory Committee for Aeronautics (NACA, the predecessor agency to NASA) in Langley, Virginia. She worked at the West Computers section as a research mathematician—known at the time as a "human computer." In 1953, she moved to the Compressibility Research Division of NACA.
Working through Segregation
Though President Franklin D. Roosevelt’s Executive Order 8802 prohibited discrimination in the defense industry, Virginia state law still enforced segregation in the workplace. All work facilities had separate restrooms and cafeterias designated “white” or “colored.” In the company cafeteria, whites could select their food choices and sit in a lunchroom. Black people had to make their food requests to a cafeteria attendant and then go back to their desks and eat, an experience Jackson considered an indignity.
NASA's First Black Female Engineer
After several months of “separate and unequal” accommodations, Jackson had had enough. She considered resigning, but a chance encounter with a supervisor changed her mind. After hearing her complaints, he invited her to work for him and she accepted. He quickly saw her potential and encouraged her to take engineering classes. In time, she was promoted to aeronautical engineer, making her NASA's first Black female engineer, and developed expertise working with wind tunnels and analyzing data on aircraft flight experiments.
Giving Back by Helping Others
Mary Jackson Photo: NASA
By 1978, Jackson changed positions to be a human resources administrator. She served as both the Federal Women’s Program Manager in the Office of Equal Opportunity Programs and as the Affirmative Action Program Manager. From then until her retirement in 1985, she helped other women and minorities advance their careers, advising them to study and take extra courses to increase their chances for promotion.
Death and 'Hidden Figures' Legacy
During her career, Jackson served on many organizations’ boards and committees, including the Girl Scouts of America, and was honored by numerous charitable organizations for her leadership and service. She died at age 83 on February 11, 2005, at Riverside Convalescent Home in Hampton, Virginia.
In 2016, the story of Jackson and her NASA colleagues Katherine G. Johnson and Dorothy Johnson Vaughan, who calculated flight trajectories for project Mercury and the Apollo program in the 1960s, made it to the big screen in Hidden Figures. Janelle Monáe portrays Jackson in the film.
In 2018, it was announced that Jackson Elementary in Salt Lake City, Utah, named for President Andrew Jackson, would be renamed Mary W. Jackson Elementary School in honor of the groundbreaking NASA engineer.
In June 2020, NASA renamed its DC headquarters after Jackson to The Mary W. Jackson NASA Headquarters.
|
{
"pile_set_name": "OpenWebText2"
}
|
The recording of a nitrogen adsorption isotherm employing a known automatically-operating vacuum microbalance is effected by registering the values of the variation in the weight of the specimen under observation with a multi-channel compensation recorder. Different gas pressures in the vacuum micro-balance are then controlled through a manostat by a buoyancy manometer which permits various pressure stages to be adjusted according to a preselected programme. Pressure regulation is effected by means of a minor quantity of gas which is kept constant and admitted to the vacuum micro-balance. Once the desirable nominal pressure value is attained, the gas admitted to the vacuum micro-balance is partially removed by means of a pump until the preselected gas pressure remains constant.
This procedure has serious disadvantages in respect of the following points:
1. Preliminary tests are necessary in order to ascertain how much time is required for adjustment of the equilibrium. Depending upon the specimen used and the gas pressure, between 5 and 200 minutes are needed for adjustment of the equilibrium.
2. A certain safety margin for the time must be allowed in order to be sure that the equilibrium has adjusted.
3. The statement of the variation in weight of the specimen is made in the form of a graph from which the actual weight difference must be laboriously interpolated.
4. For large variations in weight of the specimen, the hundreds and thousands decades must be laboriously deduced from the record strip, because the decade is stepped up or stepped down automatically when the recorder carriage strikes the limit points. The relevant hundreds or thousands decade has to be reconstructed from the number of jumps.
5. The pressure indication can also only be obtained inaccurately, because only the width of the recorder is available for the entire range of pressure.
6. The association of the variation in weight with the corresponding gas pressure is likewise a time-consuming operation.
7. The pressure regulation is effected by a regulated exhaustion of inflowing gas. Due to the slight pressure variations which then occur, the highly sensitive vacuum micro-balance is set into oscillations which lead to inaccuracy in detecting the equilibrium state.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
{
"paths": {
"customizerJs": [
"../assets/js/vendor/autoprefixer.js",
"../assets/js/vendor/less.min.js",
"../assets/js/vendor/jszip.min.js",
"../assets/js/vendor/uglify.min.js",
"../assets/js/vendor/Blob.js",
"../assets/js/vendor/FileSaver.js",
"../assets/js/raw-files.min.js",
"../assets/js/src/customizer.js"
],
"docsJs": [
"../assets/js/vendor/holder.min.js",
"../assets/js/vendor/ZeroClipboard.min.js",
"../assets/js/vendor/anchor.min.js",
"../assets/js/src/application.js"
]
},
"config": {
"autoprefixerBrowsers": [
"Android 2.3",
"Android >= 4",
"Chrome >= 20",
"Firefox >= 24",
"Explorer >= 8",
"iOS >= 6",
"Opera >= 12",
"Safari >= 6"
],
"jqueryCheck": [
"if (typeof jQuery === 'undefined') {",
" throw new Error('Bootstrap\\'s JavaScript requires jQuery')",
"}\n"
],
"jqueryVersionCheck": [
"+function ($) {",
" 'use strict';",
" var version = $.fn.jquery.split(' ')[0].split('.')",
" if ((version[0] < 2 && version[1] < 9) || (version[0] == 1 && version[1] == 9 && version[2] < 1) || (version[0] > 3)) {",
" throw new Error('Bootstrap\\'s JavaScript requires jQuery version 1.9.1 or higher, but lower than version 4')",
" }",
"}(jQuery);\n\n"
]
}
}
|
{
"pile_set_name": "Github"
}
|
Gino Pellegrini
Gino Pellegrini (1941 – 20 December 2014) was an Italian film set designer and painter.
Born in Lugo di Vicenza, in the mid-fifties at 16 years old Pellegrini moved to Los Angeles where he attended the architecture course at UCLA and then achieved a master's degree in Fine Arts. After a brief period of work in the poster advertising field, he entered the cinema industry, where he worked as a scenic painter and set designer. His film works include 2001: A Space Odyssey, Mary Poppins, Fantastic Voyage, Guess Who's Coming to Dinner, The Birds, West Side Story. After about fifteen years in California, in 1972 he came back to Italy, where he worked in the fields of stage design, video filmmaking and documentaries. In San Giovanni in Persiceto, in two stages between the 1980s and the 1990s, he realized the "Piazzetta degli inganni" ("Little square of deception"), consisting in some trompe l'oeil scenes painted on the walls of the houses around Piazza Betlemme (Betlemme square).
References
External links
Category:1941 births
Category:2014 deaths
Category:20th-century Italian painters
Category:Italian male painters
Category:21st-century Italian painters
Category:People from the Province of Vicenza
Category:University of California, Los Angeles alumni
Category:Italian scenic designers
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Larri Leeger
Larri Leeger (born October 30, 1986) is a Swiss-Finnish professional ice hockey defenceman. He is currently playing with the SCL Tigers of the Swiss National League (NL).
Leeger made his National League A debut playing with ZSC Lions during the 2006–07 NLA season.
References
External links
Category:1986 births
Category:Living people
Category:People from Bülach
Category:HC Fribourg-Gottéron players
Category:Genève-Servette HC players
Category:Lausanne HC players
Category:SCL Tigers players
Category:Swiss ice hockey players
Category:Finnish ice hockey defencemen
Category:ZSC Lions players
Category:EV Zug players
|
{
"pile_set_name": "Wikipedia (en)"
}
|
With thousands of acres covered with lava in just a few weeks, it is hard to imagine they will ever support vegetation again — at least in our lifetime.
In heavy rainfall regions such as Kapoho it only takes a few decades once the lava stops flowing. The process of healing can be more rapid with a little help from humans.
ADVERTISING
Where rainfall is scant, it takes more effort.
Where weather conditions are dry, it is a good to explore ways to conserve water as well. Organic material is essential to healthy growing conditions.
Decomposed organic matter helps increase water- and nutrient-holding capacity of the soil. Rotted material such as leaves and clippings used as surface mulch can help conserve moisture and keep weeds under control.
Nematodes, those little microscopic worms that feed on plant roots, will do less damage in a high-organic soil.
Organic matter also can increase the minor element and microbiological activity of a new planting medium. Technically, what you are building on a young lava flow is not soil but a growing medium to bring back life more quickly.
For simplicity, let’s just call it soil.
Be sure to save your grass clippings and leaves. They are like money in the bank. You can store these materials in a corner of the garden.
Decay of plant material deposited in a compost pile can be hastened through the use of fertilizer and manures. For each bushel of leaves, grass clippings or other green waste, add 2 cups of balanced fertilizer such as organic 8-8-8 and 1 cup crushed coral, dolomitic or hydrated lime.
The compost is ready to use in about three months. It is an excellent material to mix with soil for vegetable gardens and new plantings.
Anthuriums especially thrive on compost. They love that high-organic mixed with good water retention capability and yet good drainage. A good mix needs to be able to anchor the roots and stem so the plant will not topple over as it grows upward yet provide sufficient moisture, nutrients, and aeration to the plant.
Cinder or crushed rock added to composted wood shavings, sugar cane bagasse, macadamia nut shells, peat or tree bark will serve to better anchor the roots.
Even with composting and mulching, you will still need to fertilize your garden. Some Hawaiian soils are very young and low in nutrients. Larger amounts of fertilizer are needed for growing plants and lawn grasses in these areas than where soils are older and better developed.
The young soil is not only lacking in the primary elements, such as nitrogen, phosphorus and potassium, but it might be deficient in the minor elements such as manganese, copper, zinc, and boron. When plants are grown in these mineral deficient soils and fertilized with ordinary plant foods, they often develop various diseases.
Several years ago, plant doctors studied these deficiencies and learned not only how to recognize the affected plants, but also that they could be corrected by spraying them with the mineral in which the plant was deficient. But what average gardener has the training that enables him or her to recognize deficiency symptoms in plants?
To overcome this problem, the nutritional spray was developed. It is a mixture that contains about all of the minerals in which a plant can be deficient. Some plants are more subject to mineral deficiencies than others.
Especially vulnerable to mineral deficiencies such as dieback, mottled leaf, small or deformed leaves and yellow leaves are hibiscus, gardenia, mock orange, ixoras, mangoes, avocados, macadamia, coffee and citrus.
In new gardens, it might be necessary to apply a nutritional spray about every three months for the first year in order to keep ahead of deficiencies.
Along with the nutritional spray, it is a good idea to use a soil application of other elements. Magnesium and sulfur are the most important, but occasionally we find plants with boron, manganese, copper and other trace element deficiencies.
There are several combinations available at your garden supply store. Certain plants require larger amounts of the trace elements than other plants.
You will find, for example, that iron is especially important on ixoras, hibiscus, azaleas and gardenias, or that magnesium keeps leaves of coconut and areca palms from getting orange colored and dying prematurely. Zinc is the vital element in growing queen palms, royal palms and palms in the date group.
ADVERTISING
Increasing your soil’s organic matter and using minor element treatment as a spray or soil application or both will keep your plants from having these deficiencies under most conditions.
And remember to follow directions on the label. Too much of the important plant nutrient materials can be as bad as than too little.
|
{
"pile_set_name": "OpenWebText2"
}
|
How I got into Y Combinator and fathered a child, almost simultaneously - antongm
http://adgrok.com/pseudorandomness-or-how-i-got-into-y-combinator-and-had-a-child-with-a-woman-i-barely-knew-almost-simultaneously
======
abstractbill
I enjoy reading posts like these for the perspective they give me on how
differently some people do things. My wife and I by contrast are ridiculously
over-prepared. Dated for a year before moving in together, lived together for
two more years before deciding to get married, waited another two years to
have a kid, and then invested enough time into learning about childbirth that
every medical professional we talked to though the whole pregnancy and labor
assumed that we were both in the medical field (seriously, I know way more
about the anatomy of the female pelvic area than any other part of the human
body because of this).
She's a month old today (coincidentally also named Zoe).
~~~
sgoraya
Congratulations - The journey only gets better!
I've got a 8 month baby boy and wonderful wife that are the center of my
universe right now.
I got a chuckle about the time invested into the childbirth process; my wife
teased me about knowing more about having a baby than she did ;)
That said, I am spending less time on my business - whereas in the past after
coming home from the office I would take a break for dinner, the gym, then get
back to my desk at home and work into the night. That schedule has changed
drastically - I would rather spend the evening playing with my son and hanging
out with my wife than working. After the little one goes to sleep though, I
try to put in a couple hours of highly focused work.
Overall, I think I'm almost as productive (after the first 4 months) - when
you have a child, the need to maximize time and effort are amplified.
------
runjake
Getting a woman pregnant and fathering a child are two entirely different
things. I hope you have found the perfect balance between being a father and
running a startup.
Hint: the proper balance is heavily leaning towards the child.
~~~
tptacek
I upvoted you, since I've had the (apparently not so) unique experience of
having my first kid at the same time as my first "real" startup, and it was
fraught with peril. I agree that the preachiness of your comment is grating,
but the tone of the blog post you're commenting on kind of warrants it.
That said, the real risk in this scenario isn't to the child; the risk is that
you'll demolish your relationship with the other parent. The kid will be fine
for the first year or so. They're basically very smelly houseplants until they
get to crawling age. You're constantly terrified that they're going to
randomly die on you, but the rules for preventing that outcome are
straightforward and hard to forget.
~~~
m_eiman
_You're constantly terrified that they're going to randomly die on you, but
the rules for preventing that outcome are straightforward and hard to forget._
Changing the recommendation from sleeping face-down to sleeping on the back
has reduced the rate of SIDS (Sudden Infant Death Syndrome or something like
that) in Sweden by roughly 80% since 1992. There was a peak at 1.1 per 1000
live births in 1991, and it's now at 0.25 or less (in 2008 it was down to
0.13)[1].
Some babies sleep better face down, but I prefer somewhat uneasy sleep for six
to nine months (until they can turn over by themselves) to a tenfold higher
risk of death.
[1]: (Swedish) <http://www.internetmedicin.se/dyn_main.asp?page=1466>
~~~
jaxn
I have 4 kids. They all slept face down. They all lived.
The point being, even the stuff we fear in the western world is really pretty
unlikely. Feed them, don't drop them and you are pretty much good. (for the
first year)
~~~
ekanes
For things that occur so rarely, you can't extrapolate based on your
experience. By your logic, we shouldn't get vaccinated because "my 4 cousins
didn't, and they lived."
~~~
runjake
I think that was the OP's point. SIDS is rare and probably has nothing to do
with a baby's position.It's a medical guess, at this point.
I almost feel irresponsible mentioning this, so let me say that one should
always listen to their doctors.
~~~
m_eiman
_SIDS is rare and probably has nothing to do with a baby's position._
There's a bunch of research on the subject, and the resulting recommendation
is that sleeping on the back is preferred. I haven't read the actual studies,
but a bunch are mentioned in the article I linked to:
Alm B, Lagercrantz H, Wennergren G. Stop SIDS - sleeping solitary supine,
sucking soother, stopping smoking substitutes. Acta Paediatr. 2006
Mar;95(3):260-2.
Swedish Medical Research Council State of the Art Conference on the Sudden
Infant Death Syndrome. Proceedings. Gothenburg, 3-5 June 1992. Acta Paediatr
Suppl 1993;389(1):1-129.
Alm B, Milerad J, Wennergren G, Skjaerven R, Øyen N, Norvenius G, et al. A
case-control study of smoking and sudden infant death syndrome in the
Scandinavian countries, 1992 to 1995. The Nordic Epidemiological SIDS Study.
Arch Dis Child 1998;78(4):329-34.
Alm B, Norvenius SG, Wennergren G, Skjaerven R, Oyen N, Milerad J, et al.
Changes in the epidemiology of sudden infant death syndrome in Sweden
1973-1996. Arch Dis Child 2001;84(1):24-30.
Alm B, Möllborg P, Erdes L, Pettersson R, Aberg N, Norvenius G, Wennergren G.
SIDS risk factors and factors associated with prone sleeping in Sweden. Arch
Dis Child. 2006;91:915-9.
Wennergren G. Prevention of sudden infant death syndrome. Pediatr Pulmonol
2004;37 Suppl 26:110-1.
Carpenter RG, Irgens LM, Blair PS, England PD, Fleming P, Huber J, et al.
Sudden unexplained infant death in 20 regions in Europe: case control study.
Lancet 2004;363(9404):185-91.
American Academy of Pediatrics, Task Force on Sudden Infant Death Syndrome.
Policy Statement. The changing concept of sudden infant death syndrome:
diagnostic coding shifts, controversies regarding the sleeping environment,
and new variables to consider in reducing risk. Pediatrics 2005;116:1245-55.
[edit: google the names of the studies and you'll find abstracts or more]
~~~
runjake
I've read some of the actual studies you've quoted (and others), and they seem
to indicate that infants that sleep on their backs fair slightly better in
statistics. Some also blame heavier blankets and "bumper pads" (the pads that
wrap around the bars at the base of the mattress).
As I mentioned elsewhere, my understanding is that it's merely a
recommendation based on statistics with no direct correlation.
My babies went on their backs, because even a %.001 difference is enough for
me to play the game, seeing as I don't know what I'd do if one of them passed
away.
~~~
nl
_a recommendation based on statistics with no direct correlation_
"a recommendation based on statistics" usually means there is a correlation. I
think you mean that it may not imply causation, which is true of course.
------
alexophile
If you didn't make the jump to the footnotes, I thought this was great:
"One of the Y Combinator questions asked you to name one non-computer system
that you’d hacked in some interesting way. My answer concerned a man-in-the-
middle attack I once did on Craigslist personals. I placed an ad as a woman
seeking a man, and as a man seeking a woman, and then simply crossed the email
streams by forwarding mail from one to the other, and vice versa. Most
Craigslist personals didn’t even have photos back then, so the switch went
undetected, even after the couples had met. I handed off the relationship by
telling one that the other’s email address had changed, from my fake one to
the real one, and likewise vice versa. For all I know, those couples are still
together and having kids. They probably don’t know to this day what happened
or what brought them together."
------
Nate75Sanders
So...2nd encounter leads to a "pornographic scene on her kitchen counter"
after you already ran into her with her ex and you make no mention of a
paternity test? How do you know it's yours?
------
maxawaytoolong
I have to comment...
One interesting aspect of dating in the bay area is that the woman's ex-
boyfriend always happens to be on the set of the first date, every time. Every
single time.
~~~
antongm
Hahahaha...
Really? I haven't had that happen, other than this one time. And this time it
was weird, because both ex and I were sailors, and our boats happened to be
next to each other in the yard...total fluke. And then of course Girlfriend
showed up in the middle of it, making it even more comical.
Anyhow, didn't know it was a local trend.
------
leif
Minor edit: gmail's file limit is not 30GB, and there's no way a 1m 10s video
fills up that much space. ;-)
~~~
antongm
Actually, it sure as hell did fill it up. I'm not big into digital media, so I
can't quote the real specs, but my machine is a late model MacBook Pro using
the stock camera, filmed with iMovie at what are probably default settings.
And the file limit was certainly 30GB, or in the neighborhood. Trust me. I was
shitting bricks when it happened....waiting to upload a file, watch it bounce
because it's too big...rinse, repeat.....
~~~
bjonathan
30Mo maybe?
~~~
leif
Yeah I think 30MB is correct. 30GB is about 7 DVDs.
------
dbrannan
The most important thing you can do for your child is love their mom.
~~~
araneae
How could he possibly do that if he got her pregnant on the first date?
95% of the people I have gone on first dates with would have made disastrous
life partners. It's kind of a lot to ask of him.
~~~
my_account
He doesn't love the woman, you can sense it in the writing. Probably doesn't
even like her that much. I picture a scenario where he drifts toward his man-
cave aka start-up, when domesticity comes calling. Michael Lewis wrote a book
about his domestic situation, but one never doubts he puts wife and kids
first. That said, he and the wife were a little more conventinal given their
approach.
~~~
antongm
I won't comment on the love angle, other than to comment that our current
notion of love is a 19th century European invention that doesn't really exist
in most traditional societies. There's ways of getting along that don't
involve long courtship, touching poems, or passionate romance.
And it's funny you mention Lewis. The mother gave me that book as a present
last March. Great book. I should note, he didn't particularly love his
children at all at first...until the child was stricken ill and he had to care
for him.
~~~
araneae
Our "current notion" of love may certainly change, but the neurophysiological
fact of love does not (at least, not on the same timescale). I don't know what
the original commenter was referring to when he said love, but I rather think
he meant the emotional connection, not poetry (who think that has anything to
do with love nowadays anyway?)
~~~
dbrannan
Love has many meanings, yes. If love is a stretch for you (or does not come
naturally) at least try your best to respect their mother, treat her kindly,
speak well of her, support her the best you can, and encourage her. These
simple steps will do more for a child than you might realize - I don't care
what the media says, parenting is really a team effort.
------
tptacek
Ew. That was... vivid.
~~~
atomical
Vivid? Seems more casual to me.
~~~
theycallmemorty
"I watched with increasing alarm as red streaks traced bloody spiderwebs
across her thighs."
Vivid.
~~~
Sukotto
Actually, compared to what I saw at each of my kid's births, that _was_
casual.
------
stevederico
Amazing showing of drive and determination. I admire your focus and level-
headedness in a time of great stress. If I can achieve half what you did in
those 9 months, in the next year I will be happy. There is no better time than
now. Thank you for the inspiration.
------
JacobAldridge
I just finished reading _The Time Traveler's Wife_ and this post gave me
flashbacks.
Pseudorandomness or unalterable fate? Neither provides guaranteed success, so
I wish you much luck with both ventures.
------
rgrieselhuber
That was awesome.
------
create_account
My first reaction was: "oh no, not _another_ post from this guy."
It was better than his earlier stuff, and makes him seem less of a jerk.
Still, his is the only YC company I'm not really rooting for to succeed; an
IPO or acquisition would turn him into an insufferable lout.
~~~
azymnis
Your comment is priceless...
What I find really interesting is that you actually sat down and read the
whole post despite it being "from that guy".
I don't understand trolls...
|
{
"pile_set_name": "HackerNews"
}
|
Q:
How can I take multiple inputs from the same line?
I can't figure out how to take multiple inputs from one line. Here is an example:
p=gets.chomp().to_i
q=gets.chomp().to_i
puts"#{p} #{q}"
When I run this and take inputs, I have to take it from a new line. E.g.,
3
4
output:
3 4
If I type
3 4
it is not taking 4 as input and is waiting for another input from the next line. What should be done?
A:
gets reads in the whole line. If you want to process multiple elements from it, you need to split on that line, or perform regex matches on it, etc. In your case:
p, q = gets.split.map(&:to_i)
BTW, in your code, the chomp calls are superfluous, since to_i will work correctly whether the string ends with a newline or not.
|
{
"pile_set_name": "StackExchange"
}
|
<?php
/**
* Top Menu English lexicon topic
*
* @language en
* @package modx
* @subpackage lexicon
*/
$_lang['about'] = 'About';
$_lang['about_desc'] = 'Learn more and get help with MODX';
$_lang['access_permissions'] = 'Права доступу';
$_lang['access_permissions_desc'] = 'Manage user group access to Resources and Contexts';
$_lang['acls'] = 'Списки управління доступом';
$_lang['acls_desc'] = 'Управління дозволами через групи, ролі та політики доступу';
$_lang['admin'] = 'Admin';
$_lang['api_docs'] = 'Документація по API';
$_lang['api_docs_desc'] = 'Complete API documentation for MODX Revolution';
$_lang['bespoke_manager'] = 'Налаштування Менеджера';
$_lang['bespoke_manager_desc'] = 'Управління користувацькими налаштуваннями адміністративної панелі';
$_lang['components'] = 'Додатки';
$_lang['content_types'] = 'Типи вмісту';
$_lang['content_types_desc'] = 'Додавання нових типів вмісту для ресурсів, таких як .html, .js тощо.';
$_lang['contexts'] = 'Контексти';
$_lang['contexts_desc'] = 'Управління контекстами сайту та їх налаштуваннями';
$_lang['custom'] = 'Custom';
$_lang['custom_desc'] = 'Користувацькі елементи меню';
$_lang['dashboard'] = 'Панель управління';
$_lang['dashboards'] = 'Панелі';
$_lang['dashboards_desc'] = 'Управління панелями та віджетами Менеджера';
$_lang['edit_menu'] = 'Меню';
$_lang['edit_menu_desc'] = 'Управління діями та структурою верхнього меню Менеджера';
$_lang['eventlog_viewer'] = 'Журнал помилок';
$_lang['eventlog_viewer_desc'] = 'View the MODX error log';
$_lang['export_site'] = 'Export Static HTML';
$_lang['export_site_desc'] = 'Export the current site into static HTML pages';
$_lang['file_browser'] = 'Браузер медіа';
$_lang['file_browser_desc'] = 'Перегляд, завантаження і керування медіа-файлами';
$_lang['flush_access'] = 'Скинути Ваші права доступу';
$_lang['flush_access_confirm'] = 'Ви впевнені, що хочете перезавантажити Ваші права доступу? УВАГА: це не вплине на сеанси інших користувачів.';
$_lang['flush_access_desc'] = 'Перезавантажити усі права доступу у поточному сеансі і очистити кеш';
$_lang['flush_sessions'] = 'Розлогінити усіх користувачів';
$_lang['flush_sessions_confirm'] = 'Ви впевнені, що хочете завершити сеанси усіх користувачів? Завершаться сеанси усіх користувачів, включаючи Ваш сеанс, після цього усім необхідно буде входити в систему заново.';
$_lang['flush_sessions_desc'] = 'Негайно завершити усі сеанси роботи';
$_lang['flush_sessions_err'] = 'Сталася помилка при спробі завершення поточних сеансів користувачів.';
$_lang['flush_sessions_not_supported'] = 'Завершення сеансів роботи користувачів не підтримується у Вашій конфігурації.';
$_lang['form_customization'] = 'Налаштування форм';
$_lang['form_customization_desc'] = 'Налаштування зовнішнього вигляду Менеджера';
$_lang['forums'] = 'Форуми';
$_lang['forums_desc'] = 'View the MODX Forums';
$_lang['help'] = 'Допомога';
$_lang['import_resources'] = 'Імпорт статичних ресурсів';
$_lang['import_resources_desc'] = 'Import any Content Type based on file extension to Static Resources';
$_lang['import_site'] = 'Імпорт HTML';
$_lang['import_site_desc'] = 'Імпортування ресурсів з HTML-файлів';
$_lang['installer'] = 'Встановник додатків';
$_lang['installer_desc'] = 'Управління доповненнями та репозитаріями';
$_lang['lexicon_management'] = 'Словники';
$_lang['lexicon_management_desc'] = 'Редагування мовних рядків у Менеджері';
$_lang['logout'] = 'Вийти';
$_lang['logout_desc'] = 'Вийти з Менеджера';
$_lang['manage'] = 'Управління';
$_lang['media'] = 'Медіа';
$_lang['media_desc'] = 'Update Media and Media Sources';
$_lang['messages'] = 'Повідомлення';
$_lang['messages_desc'] = 'Перегляд та надсилання повідомлень';
$_lang['namespaces'] = 'Простори імен';
$_lang['namespaces_desc'] = 'Distinguish between Add-on settings';
$_lang['new_document'] = 'Новий документ';
$_lang['new_document_desc'] = 'Створити новий документ';
$_lang['new_resource'] = 'Новий ресурс';
$_lang['new_resource_desc'] = 'Створення ресурсу - зазвичай, веб-сторінки';
$_lang['new_static_resource'] = 'Новий статичний ресурс';
$_lang['new_static_resource_desc'] = 'Create a file-based Resource';
$_lang['new_symlink'] = 'Нове символічне посилання';
$_lang['new_symlink_desc'] = 'Mirror Resource content without redirecting';
$_lang['new_weblink'] = 'Нове посилання';
$_lang['new_weblink_desc'] = 'Redirect to an existing URL';
$_lang['policy_management'] = 'Політики доступу';
$_lang['policy_management_desc'] = 'Create and edit security policies';
$_lang['powered_by'] = 'is powered by';
$_lang['preview'] = 'Перегляд сайту';
$_lang['preview_desc'] = 'Перегляд сайту у новій вкладці браузера';
$_lang['profile'] = 'Профіль';
$_lang['profile_desc'] = 'Зміна адреси email, паролю тощо';
$_lang['propertysets'] = 'Набори параметрів';
$_lang['propertysets_desc'] = 'Управління наборами параметрів';
$_lang['refresh_site'] = 'Очистити кеш';
$_lang['refresh_site_desc'] = 'Видалити файли кешу для всіх контекстів';
$_lang['refreshuris'] = 'Оновити URI';
$_lang['refreshuris_desc'] = 'Regenerate system Resource URIs';
$_lang['remove_locks'] = 'Зняти блокування';
$_lang['remove_locks_desc'] = 'Зняття усіх блокувань, які виникли при редагуванні іншими користувачами';
$_lang['remove_locks_error'] = 'Сталася помилка при спробі видалення блокувань.';
$_lang['reports'] = 'Звіти';
$_lang['reports_desc'] = 'Звіти щодо Вашої установки MODX для адміністратора';
$_lang['resource_groups'] = 'Групи ресурсів';
$_lang['resource_groups_desc'] = 'Управління приналежністю ресурсів до груп ресурсів';
$_lang['search'] = 'Пошук';
$_lang['search_desc'] = 'Search for resources';
$_lang['search_resulttype_actions'] = 'Дії';
$_lang['search_resulttype_chunks'] = 'Чанки';
$_lang['search_resulttype_plugins'] = 'Плагіни';
$_lang['search_resulttype_resources'] = 'Ресурси';
$_lang['search_resulttype_snippets'] = 'Сніпети';
$_lang['search_resulttype_templates'] = 'Шаблони';
$_lang['search_resulttype_tvs'] = 'TVs';
$_lang['search_resulttype_users'] = 'Користувачі';
$_lang['security'] = 'Безпека';
$_lang['settings'] = 'Налаштування';
$_lang['site'] = 'Вміст';
$_lang['sources'] = 'Джерела медіа';
$_lang['sources_desc'] = 'Управління джерелами медіа-файлів';
$_lang['support'] = 'Підтримка';
$_lang['support_desc'] = '';
$_lang['site_schedule'] = 'Розклад сайту';
$_lang['site_schedule_desc'] = 'View Resources with upcoming publish or unpublish dates';
$_lang['system'] = 'Система';
$_lang['system_settings'] = 'System Settings';
$_lang['system_settings_desc'] = 'Налаштування усіх параметрів системи';
$_lang['tools'] = 'Tools';
$_lang['tools_desc'] = 'Utilities to keep your site sorted';
$_lang['topnav'] = 'Top Navigation';
$_lang['topnav_desc'] = '';
$_lang['user'] = 'Користувач';
$_lang['usernav'] = 'User Navigation';
$_lang['usernav_desc'] = '';
$_lang['users'] = 'Користувачі';
$_lang['user_management'] = 'Управління користувачами';
$_lang['user_management_desc'] = 'Управління користувачами та їх правами доступу';
$_lang['user_group_management'] = 'Списки управління доступом';
$_lang['user_group_management_desc'] = 'Manage user permissions through groups, roles and access policies';
$_lang['view_logging'] = 'Manager log';
$_lang['view_logging_desc'] = 'View the recent manager activity';
$_lang['view_sysinfo'] = 'Інформація про систему';
$_lang['view_sysinfo_desc'] = 'View server information, such as phpinfo, database info, and more';
$_lang['wiki'] = 'Wiki';
$_lang['wiki_desc'] = 'Launch the official MODX documentation';
|
{
"pile_set_name": "Github"
}
|
Sign in to your account.
are there any totally free dating sites - Red sox dating show
Clemens also described Garciaparra as “always ready to play” whenever he showed up at the ballpark, and he remarked on how electric (a word commonly used on this day in reference to Pedro) the crowd was whenever Martinez pitched.
After Orsillo aptly described him as “the brightest star in the Red Sox constellation,” Garciaparra took the stage next to his best friend and fellow Red Sox alum, Lou Merloni, and said he was “blessed and honored to be inducted into this [Red Sox] Nation.” As if on a dating show, Orsillo asked the two former infielders to describe how they met.
Even though he departed from the Red Sox on rocky terms on July 31Aug 14, 2014; Boston, MA, USA; Boston Red Sox former pitcher Pedro Martinez waves to the crowd as he walks onto the field as part of the Red Sox Hall of Fame Class of 2014 before the game against the Houston Astros at Fenway Park. Cooper-USA TODAY Sportsbrilliant pitching career in Boston, which spanned from 1998-2004.
As a young baseball fan, Martinez made watching the game fun and it was his commanding fastball that made me realize how beautiful a pitch can be.
Here, Bradford describes the Castiglione he knows from working with him in the booth and offers fascinating insight into his strong work ethic behind the scenes.
|
{
"pile_set_name": "Pile-CC"
}
|
The proposed research seeks (1) to explore the development of auditory perceptual abilities, specifically pitch and timbre perception, during infancy, and (2) to delineate some of the acoustic cues infants can employ in those tasks. Both pitch and timbre perception appear to require the integration or synthesis of information gleaned from a peripheral analysis of the spectral characteristics of sound, whereas spectral analysis alone permits simple discrimination of sounds. On the basis of the animal literature, adult psychoacoustics work, and the available infancy research, it can be hypothesized that the synthesis of acoustic information will show dramatic developmental changes during early life. Furthermore, it appears that the ability to analyze sounds into their spectral components precedes the ability to integrate that information in the service of perception. The studies of pitch perception will attempt to establish the emergence of pitch for complex harmonic and inharmonic sounds, including the perception of the missing fundamental. Specifically, these studies will (1) evaluate pitch extraction from harmonic tonal complexes in 3 month olds, and (2) from inharmonic tonal complexes in 7 month olds; (3) determine whether 7 month olds can use spectral information to categorize tonal complexes, when they are unable to integrate that information; (4) determine whether 7 month old infants can use high frequency energy to extract pitch from tonal complexes; and (5) employ a psychophysical technique to assess the extent of the dominance region for pitch in 7 month olds, and (6) in adults. Since very little is known about timbre perception in infancy, an initial study will investigate infants' categorization of sounds on the basis of timbre, but in the presence of irrelevant variations in pitch. Infants from 3 to 8 months of age will be tested in an operant conditioning procedure. Since the proposed research will investigate both analytic and synthetic processing of sound, it is hoped that the general pattern of auditory development and the mechanisms underlying it can be uncovered. In doing so, the proposed research will provide a necessary preliminary step toward the formulation of a general model of auditory development. Furthermore, the brain-behavior relations uncovered will contribute to our understanding of the behavioral consequences of brain damage in human adults and children.
|
{
"pile_set_name": "NIH ExPorter"
}
|
The view from behind a lender's desk
“We have a lot of concern about the current financial stress in the agricultural industry. However, the current environment in the ag lending sector is remarkably good considering we’ve had low commodity prices for the past five years, and considering the economic conditions we’re faced with today,” says Alton McRee, president of CEO of the Federal Land Bank Association of South Mississippi in Jackson, Miss.
Speaking to a group of agricultural economists attending the Southern Region Agricultural Outlook Conference in Robinsonville, Miss., McRee said, “I pinch myself everyday, and ask myself, when is this bubble going to burst, because things are remarkably good from the standpoint of overall agricultural loans and loan performance.”
Involved in agricultural lending since 1977, McRee says he has been around long enough to see the absolute best and worst of times. From a lender’s perspective, he says, the agriculture credit sector is strong and lenders are continuing to be proactive with regards to agricultural lending.
“The Farm Credit System, as well as the commercial banking sector, has very strong financials, and we really don’t see many signs of stress in our loan portfolios. It’s just remarkable,” he says.
Agricultural credit continued its upward trend in 2001 in the commercial banking sector, and actually expanded by about 5 percent. That marked the ninth consecutive increase. In comparison, the Farm Credit System experienced about 9.3-percent increase in gross loan volume over the previous year.
“We’re seeing growth from large commercial farming operations consolidating, as well as small part-time operations created, in part, by favorable interest rates,’ he says. “Slightly more than 50 percent of the Farm Credit portfolio of the Federal Land Bank of Mississippi consists of loans to individuals who do not rely completely on farm income to meet their primary financial obligations. There’s great diversity in the individuals who stand behind the agricultural land loans made by the Federal Land Bank Association.”
In addition, asset quality has remained favorable and the ratio of non-performing loans to total loans in only slightly over one percent. Net charge-offs of loans are estimated at nine-tenths of 1 percent of total loans for commercial banks, which is up slightly from the previous year. “Loan losses haven’t been greatly increasing, however because of the economic conditions we are faced with, we are increasing our loan loss reserves,” he says.
The reasons for McRee’s optimistic view of agriculture’s financials are not necessarily all cash-flow based.
A lot of the favorable conditions we have today in terms of loan performance are due to interest rates, he says. “For several years now, because of the Fed’s action, interest rate reductions have created a more favorable borrowing environment for agricultural producers. Certainly we as bankers would like to see commodity prices a lot higher, but we’re very thankful that interest rates are at the lowest level they have been in some 40 years.”
Current interest rate levels, of course, are subject to various economic factors, including the current situation with Iraq looming on the horizon, but McRee is optimistic that relatively low inflation and interest rates should help keep the farm sector strong.
“The economic news continues to be both good and bad, depending on what day you wake up and look at the newspaper. We’ve got a very volatile situation in the world, and in the financial markets. But thankfully, the money markets are remaining fairly steady and low, fueling consumer confidence in the economy,” he says.
Another factor influencing farm liquidity is the price of land.
“Land prices have remained steady, and bankers have remained cautious,” McRee says. “Commercial banks and the Farm Credit System learned a lot of the lessons back in the seventies and early eighties about lending on balance sheets and collateral lending. Those of us who went through that period are very cautious, and more careful about letting someone get over-extended just because they have a strong balance sheet.”
According to McRee, the real estate market has remained strong, with an overall steady to slightly upward trends in land values, which is due in part to low interest rates. “People have money to invest because in many cases they are taking it out of the stock market. There’s capital out there that’s looking for a place to go, and a lot of it is going into real estate,” he says.
Based on current market conditions, interest rates, and overall economic conditions, McRee believes land values will continue to remain steady, and perhaps level off somewhat.
“Land values are not being supported by agricultural cash flow necessarily, it’s just that the economy in general is supporting land values,” he says. “A lot of small tracks of land are being sold as the baby boom generation ages and they are looking to diversify their asset base and portfolios. In a lot of cases, these boomers simply want to own pieces of land somewhere. As a result, we’re continuing to see a strong demand for real estate.”
|
{
"pile_set_name": "Pile-CC"
}
|
As a conventional wine dispenser, for example, “Device for Selling Wine by Cup” disclosed in Patent Document 1 which has been previously filed by the present applicant is known. In the device, a wine flow-out tube with a cock communicating with an inner space of an upright cylinder is provided at the bottom of the cylinder, a load lid having an outer circumferential face slidably coming into contact with an inner circumferential face of the cylinder is inserted into the cylinder and an upper end of the cylinder is opened to the atmosphere. The cylinder and the load lid are made of stainless steel. An upper face (bottom wall face of the inner space) of a bottom plate of the cylinder is flat, and a lower end of a butt side opening of the wine flow-out tube is provided at the same height as that of the upper face of the bottom plate of the cylinder so that wine in the cylinder can be entirely discharged.
Wine is poured into the cylinder, and the load lid is inserted into the cylinder with a bottom face of the load lid coming into contact with a surface of the wine. When the cock is opened in this state, the wine in the cylinder is poured into a glass through the wine flow-out tube by weight of the wine and static load of the load lid. Accordingly, the load lid gradually falls in accordance with the dispensing amount of the wine with the outer circumferential face of the load lid coming into contact with the inner circumferential face of the cylinder. Accordingly, during use of the wine dispenser, the wine hardly comes into contact with the atmosphere and can be prevented from oxidizing.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Q:
Simple Clarification Objects Swift Language
I have a very simple question on something that I may have misunderstood.
I have two UIViews "A" and "B". If I write :
let A = UIView() // Or something else
let B = A
and then I change properties of B (for exemple the frame), will the properties of A change too ?
I though not, but I was animating a view, so I had the initial view and the final view. I created a transition view like this :
let transitionView = finalView
and then I changed the properties of transitionView, the position of a label for exemple.
When I added the final view at the end of the animation, the label was at the new position.
Why ? Thanks
A:
In swift types are split in 2 main categories:
reference types
value types
Classes are reference types; structs (which include arrays and dictionaries), basic data types (int, float, string, etc.), and enums are all value types.
A value type is always passed by value, which means when assigning to a variable or passing to a function/method, a copy of the original data is created. There's an exception to this rule: a function/method can use the inout modifier on a value type parameter to have it passed by reference.
Note that the compiler and the runtime usually do optimizations, so a copy is not always created unless strictly needed - what's important is that we, as developer, know that we are working on a copy and not on the original data.
A reference type is always passed by reference, which means when assigning it to a variable or passing it to a function/method, a reference to the data and not the data itself is assigned/passed.
UIView is a class, so when you create an instance, assign it to a variable, then assign that variable to another variable, the reference to the instance and not the instance itself is assigned. Both variables point to the same UIView instance. Any change made to the instance is visible to all variables referencing that instance.
Suggested reading: Classes and Structures
|
{
"pile_set_name": "StackExchange"
}
|
/*------------------------------------------------------------------------------
Interim login dialog
------------------------------------------------------------------------------*/
#wp-auth-check-wrap.hidden {
display: none;
}
#wp-auth-check-wrap #wp-auth-check-bg {
position: fixed;
top: 0;
bottom: 0;
left: 0;
right: 0;
background: #000;
opacity: 0.7;
filter: alpha(opacity=70);
z-index: 1000010; /* needs to appear above .notification-dialog */
}
#wp-auth-check-wrap #wp-auth-check {
position: fixed;
left: 50%;
overflow: hidden;
top: 40px;
bottom: 20px;
max-height: 415px;
width: 380px;
margin: 0 0 0 -190px;
padding: 30px 0 0;
background-color: #f1f1f1;
z-index: 1000011; /* needs to appear above #wp-auth-check-bg */
-webkit-box-shadow: 0 3px 6px rgba( 0, 0, 0, 0.3 );
box-shadow: 0 3px 6px rgba( 0, 0, 0, 0.3 );
}
@media screen and ( max-width: 380px ) {
#wp-auth-check-wrap #wp-auth-check {
left: 0;
width: 100%;
margin: 0;
}
}
#wp-auth-check-wrap.fallback #wp-auth-check {
max-height: 180px;
overflow: auto;
}
#wp-auth-check-wrap #wp-auth-check-form {
height: 100%;
position: relative;
overflow: auto;
-webkit-overflow-scrolling: touch;
}
#wp-auth-check-form.loading:before {
content: "";
display: block;
width: 20px;
height: 20px;
position: absolute;
left: 50%;
top: 50%;
margin: -10px 0 0 -10px;
background: url(../images/spinner.gif) no-repeat center;
-webkit-background-size: 20px 20px;
background-size: 20px 20px;
-webkit-transform: translateZ(0);
transform: translateZ(0);
}
@media print,
(-webkit-min-device-pixel-ratio: 1.25),
(min-resolution: 120dpi) {
#wp-auth-check-form.loading:before {
background-image: url(../images/spinner-2x.gif);
}
}
#wp-auth-check-wrap #wp-auth-check-form iframe {
height: 98%; /* Scrollbar fix */
width: 100%;
}
#wp-auth-check-wrap .wp-auth-check-close {
position: absolute;
top: 5px;
right: 5px;
height: 22px;
width: 22px;
color: #72777c;
}
#wp-auth-check-wrap .wp-auth-check-close:before {
content: "\f158";
font: normal 20px/22px dashicons;
speak: none;
-webkit-font-smoothing: antialiased !important;
-moz-osx-font-smoothing: grayscale;
}
#wp-auth-check-wrap .wp-auth-check-close:hover,
#wp-auth-check-wrap .wp-auth-check-close:focus {
color: #0073aa;
}
#wp-auth-check-wrap .wp-auth-fallback-expired {
outline: 0;
}
#wp-auth-check-wrap .wp-auth-fallback {
font-size: 14px;
line-height: 21px;
padding: 0 25px;
display: none;
}
#wp-auth-check-wrap.fallback .wp-auth-fallback,
#wp-auth-check-wrap.fallback .wp-auth-check-close {
display: block;
}
|
{
"pile_set_name": "Github"
}
|
/* Copyright (c) 2019 The Brave Authors. All rights reserved.
* This Source Code Form is subject to the terms of the Mozilla Public
* License, v. 2.0. If a copy of the MPL was not distributed with this file,
* You can obtain one at http://mozilla.org/MPL/2.0/. */
#ifndef BRAVE_COMPONENTS_L10N_COMMON_LOCALE_UTIL_H_
#define BRAVE_COMPONENTS_L10N_COMMON_LOCALE_UTIL_H_
#include <string>
namespace brave_l10n {
std::string GetLanguageCode(
const std::string& locale);
std::string GetCountryCode(
const std::string& locale);
} // namespace brave_l10n
#endif // BRAVE_COMPONENTS_L10N_COMMON_LOCALE_UTIL_H_
|
{
"pile_set_name": "Github"
}
|
Tag Archives: 4 star
Dublin is a small city in comparison with many of its other European counterparts but is listed as one of the Top 20 cities worldwide for hosting conferences. With the combination of excellent air access, fantastic conference venues and a world renowned hospitality culture, Dublin is the ideal conference destination.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
What does 4X, 5X, 6X VALUE! mean in Special Offers in CoC?
In clash of clans, there are some special offers, with 4X, 5X, 6X VALUE! in top as you can see in the picture.
Does this mean for example if we took Builder Potion we can gain 6 x 5 hours which mean 30 hours instead of just 6 hours? or what does mean exactly.
A:
It's just a marketing thing to motivate players to buy the bundle.
You will get what's inside the bundle once. The 'value' is just saying that it's a limited offer that's way more valuable than a regular offer for the same amount of money.
|
{
"pile_set_name": "StackExchange"
}
|
Michael J. Armstrong teaches courses on quality improvement in the Goodman School of Business at Brock University.
Recent Globe and Mail reporting has uncovered a "Wild West" of grey-market marijuana sales where product quality ranges from uneven to potentially unsafe. Given this situation, the federal government should proceed promptly with its legalization promise. This will not only protect consumers from hazardous products but also enable industry self-improvement.
Many products are easy for customers to evaluate before purchase. For example, before buying a sweater, I can see colour, feel texture and test fit. In product-design terms, these are "search" characteristics. I can judge quality while searching for the best product to buy.
Story continues below advertisement
Recreational pot isn't one of those products. Like a restaurant meal or a massage, it instead has important "experience" characteristics, such as the high it produces. Consumers can evaluate these only through use.
Marijuana also has "credence" characteristics consumers can't easily assess, even after use. Some are desirable, such as tetrahydrocannabinol (THC) and cannabidiol (CBD) content. Others are hazardous, such as bacteria and pesticide contamination. For these, buyers must rely on sellers' claims.
Because these unseen factors affect consumer health, government regulation is appropriate. As others have argued, the products themselves need standards, such as for minimum THC content and maximum pesticide levels. Likewise, processes need defining, such as for product testing and retailer licensing. Some of the new cannabis grower and retailer associations could participate in this.
Regulatory standards and oversight will help prevent defects that could harm consumers. In the quality field, these are part of conformance quality: ensuring products meet the minimums and maximums set for them.
But quality isn't just about avoiding the bad; it also involves creating the good. From a consumer viewpoint, what is a high-quality high? What are the best THC and CBD levels? Do the answers vary by market segment?
Those issues are part of design quality: making products great for consumers. This is where marijuana producers and retailers should take the lead, once government sets the baselines.
Marijuana's credence and experience aspects will likely make branding important. Name brands allow products to establish trustworthy reputations. Given a choice, would customers buy weed from some guy allegedly named Mike, and risk an unpredictable result each time? Or would they purchase Mike's Genuine (TM), knowing it consistently provides the desired effect?
Story continues below advertisement
To create and protect those brands, retailers and producers will need reliable supply chains that provide product traceability. Industry associations can also help by creating guidelines that encourage higher quality, much as the Vintners Quality Alliance does for wines.
The industry's eventual structure will largely depend on the details of legalization. Will marijuana be treated like tobacco, widely available but with restricted advertising? Like alcohol, with sales only through licensed (often government-owned) retailers? Like medicines, available only from pharmacies? Or like dietary supplements, with relatively few limitations?
In any event, controlling chemical compositions and establishing brand images won't come cheaply. So the recent proliferation of small retailers and suppliers likely won't last. Some will consolidate into regional or national firms, while others will get marginalized.
(For parallels, look at the personal-computer industry. Decades ago, many small shops built homemade computers. Now, big companies such as Dell and Lenovo dominate sales to mainstream consumers.)
But before any of this can happen, governments need to create the legalization framework. The sooner this happens, the better, as marijuana's current in-between status is the worst of all worlds. It's increasingly available to consumers, but impossible for regulators to control or for entrepreneurs to develop.
In this budding industry, it's time to not only weed out the bad, but also cultivate the good.
|
{
"pile_set_name": "OpenWebText2"
}
|
/* Cancel */
"picker.navigation.cancel-button" = "Cancelar";
/* Done */
"picker.navigation.done-button" = "OK";
/* Navigation bar default title */
"picker.navigation.title" = "GMImagePicker";
/* %@ Items Selected */
"picker.selection.multiple-items" = "%@ ítems selec.";
/* %@ Photos Selected */
"picker.selection.multiple-photos" = "%@ fotos selec.";
/* %@ Videos Selected */
"picker.selection.multiple-videos" = "%@ vídeos selec.";
/* 1 Photo Selected */
"picker.selection.single-photo" = "1 foto selec.";
/* 1 Video Selected */
"picker.selection.single-video" = "1 vídeo selec.";
/* All photos */
"picker.table.all-photos-label" = "Carrete";
/* Smart Albums */
"picker.table.smart-albums-header" = "COLECCIONES INTELIGENTES";
/* Albums */
"picker.table.user-albums-header" = "COLECCIONES";
|
{
"pile_set_name": "Github"
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.