text
stringlengths
1
3.78M
meta
dict
Off-duty police officers Chase and Nicole McKeown were eating dinner when they noticed an armed man enter the restaurant they were in. The married couple tell BBC News how they sprang into action and stopped the man attempting a robbery at Raising Cane's Chicken Fingers at the Mid City Mall in Louisville, Kentucky. The would-be thief was later arrested.
{ "pile_set_name": "OpenWebText2" }
Field of the Invention The present invention relates to content browsing and more particularly to frequent content management in content browsing. Description of the Related Art The advent of the global Internet has facilitated access to an unimaginable quantity of information to even the most casual end user. Concurrently with the development of the Internet, developers have produced several content retrieval systems, most famously the world wide web (the “Web”). In the Web, just as in other content retrieval systems, content is stored in different content servers and retrieved into a content browser upon specifying a network location of the content within the content browser. Initially unique to the Web, however, was the notion of hyperlinking in which content pages incorporate activatable references—namely hyperlinks—such that the selection of a hyperlink in one content page led to the loading and display in the content browser of the content referenced by the hyperlink. In the early years of the Web, Web content and its presentation remained static, with both the formatting and positioning of the content specified according to the hypertext markup language (HTML). As such, modifying either content or the presentation of the content in a Web page involved the direct editing of the Web page—a tedious and error prone process. As the Web has evolved, however, content is no longer static and often is defined according to dynamic methodologies, and programmatic code including scripts. Further, the content and presentation of a Web page are no longer composite elements of a Web page. Rather, the presentation has been separate from the content, most notably through the use of style sheets and other templated presentation technologies. Consequently, while content itself can remain static, the layout of the content in a Web page, or within a Web site can change quite often. Given the vast expanse of the Web and other content repositories, several mechanisms have been developed for end users to repeatedly retrieve content of interest. Ranging from the venerable “bookmark” to the more sophisticated subscription oriented aggregative technologies such as portals and syndicated feeds, these frequent content retrieval mechanisms render the Web more manageable for end users. Even still, frequent content is not merely limited to a page of content, but often frequent content is more granular in nature such as a particular portion of a page of content, or even just a display field in a page of content. Thus, while the page itself may remain constant over time, the presentation and layout of a page can change so as to displace content of interest thereby obscuring its location from the end user. In that circumstance, conventional frequent content retrieval mechanisms will have failed.
{ "pile_set_name": "USPTO Backgrounds" }
Okikatsu Arao Colonel was one of the original plotters in a scheme to prevent the Emperor's declaration of surrender at the end of World War II. He was the chief of the War Affairs section of the Military Affairs Bureau of the Imperial Japanese Army. Conspiracy Given his relatively high station, Arao acted as the representative of the plotters to some extent, hoping to enlist the aid of Minister of War Korechika Anami. Meeting with Anami on the night of August 13 (two days before the surrender), Arao was informed that the Minister stood behind the Emperor's decisions, and that in any case, Japan could not afford to continue fighting. Unthinkable as it was, surrender was the only option. As one of his chief contributions to the coup, Arao drafted an 'Instruction to the Troops' which was to be broadcast to all of Japan's soldiers, encouraging them to keep fighting. This was originally supported and approved by General Anami; however, while he spoke with the War Minister, several of the more rash members of the conspiracy broadcast an earlier, more inflammatory, draft. The following morning, Arao and the other conspirators met to plot the actual details of their plan to take over the Imperial Palace, placing the Emperor under house arrest, and preventing the surrender speech from being delivered. Arao drafted the orders that were to be given to those elements of the Imperial Guards Division and other groups involved in the coup. The conspirators then met with Anami once more; the Minister, having wavered back and forth several times in his support of their plan, once again told them the coup would have to be abandoned. He said that Army Chief of Staff Yoshijirō Umezu felt that employment of armed forces within the Palace grounds would be sacrilege. Though he was one of the original conspirators, Arao in the end turned his back on the coup, and helped write the generals' agreement document stating that those military commanders who signed swore to abide by the Emperor's decision. Unlike many of the other conspirators, Arao survived through the events of August 15, 1945, and would, many years later, continue to admire General Anami, and the devotion and strength it took to bring the war to an end in the way he did. See also Kenji Hatanaka, the chief conspirator. References Brooks, Lester (1968). "Behind Japan's Surrender: The Secret Struggle That Ended an Empire." New York: McGraw-Hill Book Company. Arao Okitsugu Category:Japanese military personnel of World War II Arao Okitsugu Category:Year of death missing
{ "pile_set_name": "Wikipedia (en)" }
SAYING it was “fed up” and “close to tears,” the roof at Etihad Stadium has demanded Brad Scott’s mouth stay permanently closed. “I didn’t invent the sun,” said the controversial piece of stadium attire. “Last time I checked, it was the collapse of a giant molecular cloud that caused it. “Yet suddenly it’s all my fault that North Melbourne couldn’t run out a game or hit a target under pressure.” In an escalating feud, arguably North Melbourne’s biggest rivalry, the roof said it would be easier if Brad Scott’s mouth were closed on a permanent basis. “What’s he ever said that’s positive? I’ve only ever seen Mark Neeld frown more than him,” it said. However, North Melbourne president James Brayshaw has defended his coach, saying Brad did actually smile, when Drew Petrie tripped over a chair. “It was hilarious. He’s a big man the D-Unit and the jukes went out but he still came a cropper.” “But seriously, there’s no doubt the roof is the cause of every problem North have had recently. That’s just a fact, it’s science.” media_camera North Melbourne coach Brad Scott talks to AFL representatives after Saturday’s match against Richmond. Pic: Michael Klein The AFL’s Football Operations Manager Mark Evans said the league was attempting to negotiate a truce between the two sides. “We planned to trial both the roof and Brad Scott’s mouth being three-quarters closed for the first three rounds.” “We may then move on to other fractions, half-closed, four-fifths closed, seven-eights closed. You get the picture.” Titus O’Reily is a satirical sports writer. You can read more Titus at titusoreily.com or follow him on Twitter: @TitusOReily
{ "pile_set_name": "OpenWebText2" }
Search Events Solid Lines Productions Presents "Tea" at The Stage at KDHX From Dramatists' Play Service, Inc.: "Four women come together to clean the house of a fifth after her tragic suicide upsets the balance of life in their small Japanese immigrant community in the middle of the Kansas heartland. The spirit of the dead woman returns as a ghostly ringmaster to force the women to come to terms with the disquieting tension of their lives and find common ground so that she can escape from the limbo between life and death, and move on to the next world in peace—and indeed carve a pathway for their future passage. Set in Junction City, Kansas, 1968; and netherworlds."
{ "pile_set_name": "Pile-CC" }
Melissa Harris-Perry: I hope Trayvon 'whooped the sh*t out of George Zimmerman' MSNBC host Melissa Harris-Perry gave a speech at Cornell University earlier this week during which she said she hoped Trayvon Martin “whooped the sh*t out of George Zimmerman” before his death. Martin, an unarmed 17-year-old, was shot and killed by Zimmerman in early 2012. Zimmerman went to trial, saying he acted in self defense, and a Florida jury acquitted him of all charges. Harris-Perry made the comments Feb. 23 at the university’s annual Martin Luther King, Jr. Commemorative Lecture. Mediate reports her comments were entitled “We Can’t Breathe: The Continuing Consequences of Inequality.” A portion of Harris-Perry’s remarks were uploaded to YouTube shortly afterward by The Cornell Review. The conservative student newspaper called the host’s comments a “shame and an embarrassment” to the school.
{ "pile_set_name": "OpenWebText2" }
Major could be the default, and minor, dominant, augmented, and diminished chords could all have images or props assigned to them. For example, a pickaxe for minor (miner). I’m wondering if it might be easiest to have one measure assigned to each locus in a memory journey. Intervals could also each be given an image — something that might even help with ear training by associating the sound of each interval with an image. Since music can be so complex, memorization might have to be somewhat freeform at times, but there could be certain patterns in memorization. For example: different musical voices could be assigned vertical heights in the memory journey. A three voice piece might have images for the lower voice assigned to the floor, another voice assigned to middle height, and the top voice assigned to the ceiling or possibly up in a tree or on a wall if available in the memory journey. To indicate the direction of a musical line, a group of 3rds or 6ths might go up some stairs, up and over a hill, or down a ladder or through a trap door in the floor. For occasional enharmonics, a sharp (♯) could be represented by being poked with needle or a tic-tac-toe match, and a flat (♭) by being associated with flatbread or a boot/kick. I haven’t tried any of this yet. At the moment they are just ideas to test later.
{ "pile_set_name": "Pile-CC" }
Beta-cell growth and mass are preserved in long-term syngeneic islet transplantation in streptozocin-induced diabetic Lewis rats. We determined beta-cell replication and mass in basal and stimulated conditions in long-term transplanted islets. Three groups of streptozocin-induced diabetic Lewis rats were transplanted with 1,000 islets (500 islets under left and right kidney capsules). At 2 (Tx-2), 5 (Tx-5), or 9 (Tx-9) months after transplantation, one of the two grafts (basal) was harvested; 14 days later, the contralateral graft (stimulated) was also harvested. Normoglycemia was achieved and maintained in all transplanted rats, although the capacity to respond to a glucose challenge deteriorated slightly 9 months after transplantation. Beta-cell replication remained stable in Tx-2, Tx-5, and Tx-9 basal grafts and was similar to replication in a control group of nontransplanted rats (0.28 +/- 0.06%); replication increased in Tx-2 (0.90 +/- 0.23%, P < 0.05) and Tx-9 (0.72 +/- 0.09%, P < 0.05) stimulated grafts. Beta-cell mass in basal grafts was similar to the initially transplanted mass (1.24 +/- 0.06 mg) and increased in stimulated grafts in Tx-2 (1.91 +/- 0.38 mg, P < 0.05) and Tx-5 (1.73 +/- 0.27 mg, P = 0.01) groups, compared with basal grafts, and in Tx-2 and Tx-9 groups (1.92 +/- 0.30 mg, P < 0.05), compared with initially transplanted mass. Therefore, beta-cell replication and mass were preserved up to 9 months after syngeneic transplantation, and beta-cells maintained the capacity to respond to increased metabolic demand, suggesting that replication is not a limiting factor in the survival of transplanted islets.
{ "pile_set_name": "PubMed Abstracts" }
Cushion connectors are used to cushion the shock created by the drill bit during drilling and passed through the drill string or drill steel to the drill head of the rig. Such cushion connectors are known and, in general, act to absorb the drilling shocks by moving so as to allow a certain amount of movement between the top of the drill string which is connected to the box end of the cushion connector and the drill drive head which is connected to the pin end of the cushion connector. From that point of similarity, however, the tools act considerably differently and absorb the shock in a variety of different ways. In one connector, a resilient elastomeric material is inserted into the connector between the housing and the piston which moves relative to the housing and acts principally to absorb compression shocks which are passed from the drill bit to the drill drive head. A problem with the use of elastomeric material as a compression absorber, however, is that the material inherently has a limited axial elasticity with the result that the stroke available in the connector is limited. It is desirable to have as long a stroke as possible in order to absorb the shocks from the drill bit with maximum efficiency. A further disadvantage with known cushion connectors is that the drive splines do not act within the axial length of the springs. Rather, the springs are located above or below the drive splines. Such a configuration results in an increased axial length for the cushion connector which is undesirable when it is preferred to keep the axial length to a minimum for more convenient operating characteristics.
{ "pile_set_name": "USPTO Backgrounds" }
1. Field of the Invention The present invention relates to a push-button dial circuit for a push-button telephone set. 2. Description of the Prior Art Since a dial circuit used in each of conventional push-button telephone sets for generating a multi-tone dial signal is, in principles, composed of a buffer transistor and a resistor connected in parallel thereto, the AC impedance of the dial circuit is substantially equal to the value of the parallel resistor due to a high AC impedance of the buffer transistor, and the DC resistance of the dial circuit is provided in the form of a combined resistance of the respective resistances of the buffer transistor and the parallel resistor. Incidentally, the push-button dial circuit operates by a power source current supplied from the central office; therefore, in order to ensure its stable operation even in a case of a long subscriber's line, the push-button dial circuit is required to operate at a low voltage and its DC resistance must be small in value. On the other hand, the AC impedance of the push-button dial is required to have a large value for sending out a dial signal at a proper level. In conventional push-button dial circuits, since the AC impedance and the DC resistance are determined by the resistor connected in parallel with the buffer transistor as described above, there is such a shorcoming that an increase in the AC impedance causes an increase in the DC resistance, whereas a decrease in the DC resistance causes a decrease in the AC impedance. Further, the AC impedance depends on the resistance value of the resistor connected in parallel to the buffer transistor and assumes a constance value irrespective of the length of the subscriber's line, with the result that the output signal from the dial circuit is also sent out at a constant level. On the other hand, since the subscriber's line has an AC loss substantially determined by the line length, the level of the dial signal reaching the central office comes to have a value obtained by subtracting the AC loss of the subscriber's line from the output signal level of the dial circuit. In practice, since the loss of the subscriber's line is large, use is made of a manual or automatic signal level control circuit in the prior art push-button dial circuit for controlling the signal level in a case of a short-distance line, but in a case of a long-distance line, the signal level is not controlled, whereby the range of the level of the signal reaching the central office is made narrower than the range of loss of the subscriber's line.
{ "pile_set_name": "USPTO Backgrounds" }
List of Iraqi artists The following is a list of important artists, including visual arts, poets and musicians, who were born in Iraq, active in Iraq or whose body of work is primarily concerned with Iraqi themes or subject matter. Note: This article uses Arabic naming customs: the name "al" (which means 'from a certain place') or "ibn" or "ben" (which means 'son of') are not used for alphabetical indexing. Artists are listed alphabetically by their paternal family name. For example, the Iraqi artist Hashem Muhammad al-Baghdadi, is listed under "B" for Baghdadi, the paternal family name while the artist Zigi Ben-Haim, is listed under "H" for Haim. A Salman Abbas (b. 1945) Faraj Abbo (1921-1984) artist, theatre director, designer, author and educator Ibrahim Al-Abdali (b. 1965) Adel Abidin (b. 1973) :fi:Adel Abidin multi-media artist and painter Shinyar Abdullah 20th-century ceramicist Firyal Al-Adhamy (also known as Ferial al-Althami) (b. 1950) hurufiyya artist, calligrapher Iyad Almosawi (b. 1955) Canadian-Iraqi artist Asmaa al-Agha (b. ?) Kajal Ahmad (b. 1967 Kirkuk) Kurdish-Iraqi poet Mahmoud Ahmad (b.?) painter Najiba Ahmad (b. 1954) poet Modhir Ahmed (born 1956), visual artist Ghani Alani (b. 1930 Baghdad) calligrapher Sadik Kwaish Alfraji (b. Baghdad, 1960) M.J. Alhabeeb (born 1954), calligrapher and painter Ayad Alkadhi (born 1971), visual artist Rheim Alkadhi (b. 1973) multidisciplinary artist Halim Alkarim (b. 1963) photographer Sama Alshaibi (b. 1973) Media artist (video, photography) and installation artist Usama Alshaibi (b. 1969) visual media artist (video, photography) Jaber Alwan (b. 1948 Baghdad) Italian-Iraqi painter Hamid al-Attar (b. 1935) (alternative: Hameed al Attar) painter Jananne Al-Ani (b. 1966) Iraqi-Irish photographer and film-maker Latif al-Ani (b. 1932) photographer, known as the 'father of Iraqi photography' Hassan Abd Alwan 20th-century painter Sinan Antoon (b. 1967) poet Mohamed Arif (1937-2009) Layla Al-Attar, artist and painter Suad al-Attar (born 1942), painter Basim al-Ansar 20th-century poet Halla Ayla (born 1957), photographer, painter Abla al-Azzawi ceramicist Apo Avedissian (b. 1990) filmmaker, painter, photographer, and writer Dia Azzawi (b. 1939) painter active in Iraq and London Fadhil Al Azzawi 20th century poet Qasim al-Azzawi Taleb Abd al-Aziz 20th-century poet B Fātima al-Baghdādī bt. Hasan b. ‘Alī b. ‘Abdullāh Attar (d. 480/1087) 11th-century calligrapher Hashem Muhammad al-Baghdadi (1917-1973) calligrapher Niazi Mawlawi Baghdadi - nineteenth century painter, decorator and calligrapher <ref>Al-Said, S.H., Chapters from the History of Plastic Art Movement in Iraq,, 1988, p. 47; Ali, W., Islamic Art: Development and Continuity, Florida University Press, 1997, p. 46</ref> Ahmed Al Bahrani (b. 1965) sculptor Abdul Jabar al-Banna (b. 1924) sculptor Ala Bashir (born 1939), painter, sculptor and plastic surgeon Salman Al Basri (born 1939) Yahya Zaki Batat (b. 1958) poet, journalist, writer and painter Ibn al-Bawwāb 10th/11th-century calligrapher Abdul Waha al-Bayati 91926-1999) poet Basil Al Bayati (b. 1946) architect and designer Azzam Al-Bazzaz (b. 1948 Mosul) sculptor Wafaa Bilal (b. 1966), performance artist, author and educator C Wasma'a Khalid Chorbachi (born 1944), Iraqi-American ceramist, calligrapher, painter Kamil Chadirji (1897-1968), photographer Rifa'at Chadirchi (b. 1924) Iraqi architect (son of photographer, Kamil Chardirji) D Rakan Dabdoub (b. 1941), painter Issa Hanna Dabish (1919-2009) pioneer painter Murad al-Daghistani (b. 1917 Mosul, Iraq - 1984) pioneering photographer Sat'aar Darweesh Salim al-Dabbagh (b. 1941) artist and print-maker Bassem Hamad al-Dawiri (died 2007), sculptor and artist Samarkand Al Djabiri, 20th-century poet Hafidh al-Droubi (1914-1991) (also given as Hafid or Hafez Drubi) (1914-1991) painter and educator E Enheduanna 23rd century BCE poetess, wrote on Cuneiform tablets Khalid Ezzat (b. circa 1937) sculptor F Mulla Muhammad 'Ali Al-Fadli (d. 1948) master calligrapher Lisa Fattah (1941–1992), German-born painter, wife of Ismail Fatah al-Turk, active in Iraq Zaynab Shāhdā bt. Ahmad b. Al-Faraj b. ‘Omar Al-Abrī (d. 547/1178) 12th-century female calligrapher Mayasalom Faraj (b. ?) US born of Iraqi parents Fuzûlî (Muhammad bin Suleyman) 15th century poet Mun'im Furat (1900-1972) sculptor G Ghassan Ghaib (or Gassan Ghaeb) (b. 1964) painter H Abdulameer Yousef Habeeb (b. ?) calligrapher Mohammed Saeed Al-Habboubi (1849- 1915) poet Murtadha Haddad (b. ?) sculptor Zaha Hadid (1950-2016), Iraqi-British architect Assim Abdul Hafid (1886 - ?) Bahija Al-Hakim (b. 1937) artist Wihad al-Halem (b? ) Dareh Hamassy (alternative: Dar Hama Si) (b. 1938) sculptor Asim Hafez (1886- 1978) pioneer painter Kadhim Hayder (alternatives: Kazem Haider, Kadhim Haydar) (1932- 1985) Ahli in Haidarkhana 19th-century photographer, active in Baghdad Zigi Ben-Haim (b. 1945) sculptor and painter Mansur Al-Hallaj 9th century Sufi poet and mystic Mohammed Hussein al Hamdany 20th-century painter Jamil Hamoudi, (1924-2003), sculptor, painter and author Choman Hardi (born 1974), poet, translator and painter Faeq Hassan (1914–1990), painter Mohammed Ghani Hikmat (1929–2011), sculptor Souhail al-Hindawy (b.1948) sculptor Mohammed al-Husni (b.?) I Tarik Ibrahim 20th-century ceramicist Ghareeb Iskander 20th-century poet J Sinan Jabar 20th-century poet Jabra Ibrahim Jabra (1920-1994) painter, art historian, art critic and author Khalid al-Jader (1922-1988) painter, educator, art historian and author Akram Shukri (1910-1986) painter Vian Sora (born 1976), painter Mahmodd Shubbar (b. 1965 Babel) Akram Shukri (1910-1986) pioneer painter Ahmad al-Suhrawardi 12th/13th century calligrapher T Abdul Karim Ibrahim Tiouti late 9th-century-early 20th-century photographer active in Basra, said to have introduced the camera to Iraq Saad al-Ta'i 20th-century painter Ali Talib (b. 1944) Aatqall Taúaa (b. ?) sculptor and author Ismail Fatah Al Turk (1934–2004), painter and sculptor Hashim Al-Tawil (b. 1952) painter, print-maker and art historian U/V/W Abdelrahim Al-Wakil (b. ?) sculptor Iman Al Waili 20th-century poet Yahya Al-Wasiti, 13th century illustrator Khalil al Warid (c.1923-1984) sculptor Y Nazar Yahya, Iraqi-American etcher, sculptor (in metal), installation artist and photographer Abdul Raheem Yassir (b. 1951, Qadisiyah, Iraq), cartoonist Saadi Yousef (b. 1934, near Basra), poet, author and journalist Najib Yunes (1930-2007) Yaqut al-Musta'simi 13th-century calligrapher Z Khalil al-Zahawi (1946-2007), calligrapher Muqbil Al-Zahawi (b. 1935), ceramicistPocock, C., "The Reason for the Project: Art in Iraq Today", in: Azzawi, D. (ed.), Art in Iraq Today, Abu Dhabi, Skira and Meem, 2011, p. 101 Hajj Salim Mohammed Saleh Zaki (1888-1974) Haifa Zangana (born 1950), novelist, author and artist Abdulzahra Zeki Hashim Zidan (b.?) sculptor See also Baghdad School Hurufiyya movement Iraqi art Islamic art Islamic architecture Islamic calligraphy List of Iraqi women artists Major Iraqi public artworks Al-Shaheed Monument. Baghdad The Monument to the Unknown Soldier, Baghdad Victory Arch, Baghdad References Further readingBenezit Dictionary of Asian Artists, Oxford University Press, 2017 Bloom, J. and Blair, S.S. (eds), Grove Encyclopedia of Islamic Art & Architecture, Vols 1-3, Oxford University Press, 2009 Davis, B., "The Iraqi Century of Art," Artnet Magazine, July, 2008, Online Dougherty, B.K. and Ghareeb, E.A., Historical Dictionary of Iraq, Scarecrow Press, 2013 Farhat, Maymanah, "Iraqi Artists in Exile," Selections magazine, no. 30, 2015 Online Hann, G., Dabrowska, K. and Greaves, T.T., Iraq: The Ancient Sites and Iraqi Kurdistan, Bradt Travel Guides, 2015, pp 29–32 Jabra, I.J., The Grass Roots of Art in Iraq, Waisit Graphic and Publishing, 1983, Online: Khalil, S. and Makiya, K., The Monument: Art, Vulgarity, and Responsibility in Iraq; University of California Press, 1991 Lindgren, A. and Ross, S., The Modernist World, Routledge, 2015 Sabrah, S.A. and Ali, M., Iraqi Artwork Red List: A Partial List of the Artworks Missing from the National Museum of Modern Art, Baghdad, Iraq, 2010 Salīm, N., Iraq: Contemporary Art, Volume 1, Sartec, 1977; Mathaf Encyclopedia of Modern Art and the Islamic World, Online: Shabout, N., "Ghosts of Futures Past: Iraqi Culture in a State of Suspension," in Denise Robinson, Through the Roadbloacks: Realities in Raw Motion, [Conference Reader], School of Fine Arts, Cyprus University, (23-25 November 2012), 2015 Shabout, N., "The Preservation of Iraq's Modern Heritage in the Aftermath of the US Invasion of 2003," in: Elaine A. King and Gail Levin (eds), Ethics And the Visual Arts, New York, Allworth, 2006, pp 105 –120 Tuohy, A. and Masters, C., A-Z Great Modern Artists, Hachette UK, 2015; Al-Ali, N. and Al-Najjar, D., We Are Iraqis: Aesthetics and Politics in a Time of War,'' Syracuse University Press, 2013; Category:Artists from Baghdad Category:Iraqi artists Category:Iraqi calligraphers Category:Iraqi designers Category:Iraqi ceramists Category:Iraqi contemporary artists Category:Iraqi painters Category:Iraqi sculptors Category:Iraqi women artists Iraqi Artists
{ "pile_set_name": "Wikipedia (en)" }
(1) Field of the Invention The present invention relates to a prepreg, a multilayer printed wiring board and a process for producing a multilayer printed wiring board. More particularly, the present invention relates to a prepreg which has high flexibility at room temperature, causes neither chipping nor peeling of resin, and is superior in heat resistance and electrical insulation after press molding; to a multilayer printed wiring board using said prepreg; and to a process for producing said multilayer printed wiring board. (2) Description of the Prior Art Prepregs obtained by impregnating a mat or roving made of a glass fiber or the like, with a thermosetting resin (e.g., an epoxy resin) which has been cured up to an extent slightly higher than the B-stage, are in use for molding or lamination in plastic industry. Other prepregs are also known in which the mat or roving made of a glass fiber or the like used for molding or lamination, is replaced by an aramid fiber, or the epoxy resin is replaced by a polyimide resin, a polyphenylene ether resin, a polytetrafluoroethylene resin or a polyaminobismaleimide resin. The prepregs obtained by impregnating a glass cloth with a composition consisting of an epoxy resin and a curing agent and then semicuring the resulting material, have had problems in that they cause chipping or peeling of resin when bent. The prepregs in which an aramid fiber is used in place of the glass cloth, are improved in bending strength but are higher in cost because the aramid fiber is expensive. The prepregs in which a polyimide resin, a polyphenylene ether resin or a polytetrafluoroethylene resin is used in place of the epoxy resin, are relatively difficult to mold or process and moreover are expensive. The prepregs in which a polyaminobismaleimide resin is used in place of the epoxy resin, have high heat resistance; however, they are very hygroscopic and low in adhesivity and, moreover, because of the necessity of use of a high-boiling solvent when a varnish is made, contain a large amount of residual solvent and tend to generate voids during lamination. The present invention aims at alleviating the above-mentioned problems of the prior art and providing (1) a prepreg which has high flexibility at room temperature, causes neither chipping nor peeling of resin, and is superior in heat resistance and electrical insulation after press molding, (2) a multilayer printed wiring board using such a prepreg of excellent properties, and (3) a process for producing such a multilayer printed wiring board. The present invention provides: a prepreg which is composed of a mixture of a polycarbodiimide resin and an epoxy resin and which has a film shape; a prepreg composed of (1) a mixture of a polycarbodiimide resin and an epoxy resin and (2) a base material; a multilayer printed wiring board obtained by alternately laminating an internal substrate and an insulating adhesive layer and adhering them to each other, wherein the above prepreg is used as the insulating adhesive layer; and a process for producing a multilayer printed wiring board, which comprises alternately laminating an internal substrate and the above prepreg, adhering them to each other, and allowing all the internal substrates to communicate with each other at the required portions.
{ "pile_set_name": "USPTO Backgrounds" }
{ "pile_set_name": "PubMed Central" }
President Trump Donald John TrumpSteele Dossier sub-source was subject of FBI counterintelligence probe Pelosi slams Trump executive order on pre-existing conditions: It 'isn't worth the paper it's signed on' Trump 'no longer angry' at Romney because of Supreme Court stance MORE on Tuesday sought to distance himself from his former campaign chairman Paul Manafort Paul John ManafortOur Constitution is under attack by Attorney General William Barr Bannon trial date set in alleged border wall scam Conspicuous by their absence from the Republican Convention MORE's criminal conviction, saying it did not involve his presidential bid. “This has nothing to do with Russian collusion," Trump told reporters in West Virginia, where is he scheduled to hold a campaign rally. "It's a witch hunt and a disgrace." "Nothing to do with Russian collusion, continue with the witch hunt." Trump briefly talks Manafort; mum on Cohen. pic.twitter.com/8x8YswReFQ — Josh Marshall (@joshtpm) August 21, 2018 The president said he feels "very badly" about Manafort's conviction and called him a "good person." But he also stressed that the crimes Manafort was found guilty of committing were not related to his work on the Trump campaign. ADVERTISEMENT "Doesn’t involve me but I still feel, you know, it’s a very sad thing that happened," Trump said."This has nothing to do what they started out looking for Russians involved in our campaign. There were none." Trump broke his silence roughly an hour after Manafort was convicted in a federal court on eight counts of bank and tax fraud brought by special counsel Robert Mueller Robert (Bob) MuellerCNN's Toobin warns McCabe is in 'perilous condition' with emboldened Trump CNN anchor rips Trump over Stone while evoking Clinton-Lynch tarmac meeting The Hill's 12:30 Report: New Hampshire fallout MORE, who is investigating alleged ties between the Trump campaign and the Kremlin's interference in the 2016 campaign. While the crimes did not directly involve Trump – they stemmed from Manafort's work for the pro-Russian former leader of Ukraine – the verdict provided a major boost for Mueller's probe. Manafort was the first person indicted by the special counsel to face trial. It also raised questions about Trump's judgment, given that he hired Manafort after the alleged crimes were committed. Manafort, a longtime GOP operative who in recent years turned to foreign lobbying, led Trump's presidential campaign during a crucial three-month stretch that included the Republican National Convention. Trump did not comment on the guilty plea of his former personal lawyer and fixer, Michael Cohen, who confessed to committing bank and tax fraud as well as campaign finance violations. During a court appearance, Cohen said he made hush money payments to the porn star Stormy Daniels and a former Playboy playmate at the behest of a federal political candidate who is believed to be Trump in order to influence the 2016 election. The White House directed questions about Cohen's plea to Trump's outside attorneys.
{ "pile_set_name": "OpenWebText2" }
European Anti Poverty Network The European Anti-Poverty Network (EAPN) is the largest European network of national, regional and local networks, involving anti-poverty non-governmental organisations (NGOs) and grass-root groups as well as European organisations, active in the fight against poverty and social exclusion. It was established in 1990. Supported by the European Commission, EAPN is a network of 31 National Networks of voluntary organisations and grass-root groups active in the fight against poverty within the 27 European Union member states (minus Slovenia), as well as in Norway, Iceland, Serbia, and North Macedonia. EAPN's membership also includes 13 European organisations. EAPN has a consultative status with the Council of Europe and is a founding member of the Platform of European Social NGOs. Core objectives To promote and enhance the effectiveness of actions to eradicate poverty and prevent social exclusion; To raise awareness of poverty and social exclusion To empower the people living in poverty and social exclusion To lobby for and with people and groups facing poverty and social exclusion. EAPN includes the objectives of gender equality and non discrimination in all its areas of work. Activities To address its objectives, the EAPN lobbies European and national decision-making institutions to develop and implement inclusive, anti-poverty policies and programmes, and keeps under close review policies and programmes likely to impact on groups facing poverty and social exclusion. It also acts as a central European forum for anti poverty focused NGOs, exchanging information on EU and national level anti poverty and exclusion policies; it supports members in exchanging experiences and building partnerships; and provides training for its members. It is also forging links and alliances with like-minded groups and coalitions. Resources The EAPN website gives access to key EAPN and EU documents on poverty, social exclusion and inequalities. EAPN produces wide a range of materials and publications on poverty, social inclusion, social protection, employment, Structural Funds. References External links EAPN on Twitter: @EAPNEurope EAPN on Facebook: EuropeanAntiPovertyNetwork EAPN on LinkedIn: EAPN - European Anti Poverty Network European Meetings of People experiencing Poverty (//voicesofpoverty-eu.net/) Organised and coordinated by EAPN, the European meetings contribute to the right of people living in poverty to participate in and access information relating to the decision-making processes that affect their lives and well-being. The European meeting is the most visible point in the process of fostering this but perhaps even more important is the fact that they act as a catalyst for national participation processes. European Minimum Income Network (EMIN) (//emin-eu.net) The European Minimum Income Network (EMIN) is a project funded by the European Commission and which started in 2013. The aim of the project is to build consensus to take the necessary steps towards the progressive realisation of adequate and accessible minimum income schemes in EU Member States, in line with the European Commission’s Active Inclusion Recommendation of 2008, the Europe 2020 strategy and in the context of the European Platform against Poverty and Social Exclusion. EU Alliance for a democratic, social and sustainable European Semester (Semester Alliance) (//semesteralliance.net) The EU Alliance for a democratic, social and sustainable European Semester or (EU Semester Alliance) is a broad coalition bringing together major European civil-society organisations and trade unions, representing thousands of member organisations on the ground at European, national and local levels in the European Union. The ‘Semester Alliance’ aims to support progress towards a more democratic, social and sustainable Europe 2020 Strategy, through strengthening civil dialogue engagement in the European Semester at national and EU levels. Category:Organizations established in 1990 Category:Political organizations based in Europe Category:International organisations based in Belgium Category:Cross-European advocacy groups Category:Poverty-related organizations Category:Poverty in Europe
{ "pile_set_name": "Wikipedia (en)" }
'use strict'; Object.defineProperty(exports, '__esModule', { value: true }); var prefix = 'fas'; var iconName = 'arrow-circle-down'; var width = 512; var height = 512; var ligatures = []; var unicode = 'f0ab'; var svgPathData = 'M504 256c0 137-111 248-248 248S8 393 8 256 119 8 256 8s248 111 248 248zm-143.6-28.9L288 302.6V120c0-13.3-10.7-24-24-24h-16c-13.3 0-24 10.7-24 24v182.6l-72.4-75.5c-9.3-9.7-24.8-9.9-34.3-.4l-10.9 11c-9.4 9.4-9.4 24.6 0 33.9L239 404.3c9.4 9.4 24.6 9.4 33.9 0l132.7-132.7c9.4-9.4 9.4-24.6 0-33.9l-10.9-11c-9.5-9.5-25-9.3-34.3.4z'; exports.definition = { prefix: prefix, iconName: iconName, icon: [ width, height, ligatures, unicode, svgPathData ]}; exports.faArrowCircleDown = exports.definition; exports.prefix = prefix; exports.iconName = iconName; exports.width = width; exports.height = height; exports.ligatures = ligatures; exports.unicode = unicode; exports.svgPathData = svgPathData;
{ "pile_set_name": "Github" }
In German patent document 37 40 916, the application of a wear-reducing coating on the surface of a worm or screw for a plastifying device is disclosed in which molybdenum or a molybdenum-containing coating material is applied to a surface of the worm or screw body, the coating on the body is subjected to heat to effect fusion between the coating and the underlying base material, and the coated screw or worm is thereupon cooled. As noted, the plastifying device can be an extruder, injection-molding machine or compounder and, for the purpose of this description, all such machines will be understood as comprised within the term "extruder" where that term is used to describe a machine or device embodying the invention. An extruder can be used, for example, to produce articles of synthetic resin material, plastic or rubber and can comprise a housing and at least one worm or screw rotatable in this housing to displace the material to be processed through the housing. During the rotation of the worm or screw and the passage of the flow of the plastic or plastifiable material through the housing, the rib, thread or flight of the worm or screw may be subject to considerable and continuous wear. In addition, there may be direct contact between the outer surface of the flight and the wall of the screw housing. To minimize mechanical deterioration of the parts in contact, good emergency running properties must be provided at the contact surfaces. In the past this has generally been obtained by coating the outer surfaces of the flight or thread of the worm or screw with a suitable low-wear and low and reduced-friction material. An appropriate material for this purpose is molybdenum. In Japanese patent document 61-139 682, molybdenum in pulverulent form is applied to the steel base material of the body and irradiated with laser energy. To ensure that the layer will bond firmly enough to the base material, before application of the powder, pits or depressions are generated in the surface to be coated. This pretreatment step makes the coating process complicated and expensive. Because molybdenum has a substantially higher melting point than the steel, a relatively large amount of thermal energy must be applied to the base body for effective bonding and this can give rise to deformation and cracking at the interface and surface. Swiss patent 576,526 describes the application of a molybdenum coating to an extruder worm at the rib or thread surface by flame-spraying. According to German patent 37 18 779, this does not produce effective results because the layer with excessively high molybdenum content does not bond satisfactorily to the base body of the worm and has a tendency to spall off therefrom. In German patent 37 18 779, an alloy is used as the material for the wear-reducing layer which contains between 40% and 70% molybdenum. This alloy can be applied to the base body by a special process, namely, plasma-powder deposition welding. The prior art process gives rise to useful results only upon the use of the expensive plasma-powder deposition welding which is of high capital cost. Furthermore, alloys are used with a molybdenum content of a maximum of 70%. The advantageous characteristics of molybdenum, especially the good emergency running characteristics, can be utilized only with limitations. Even with this process, a relatively high amount of thermal energy must be transferred to the basic body and leading to unsatisfactory intrinsic stress characteristics with distortion and crack formation. One could conclude that high molybdenum content with deposition welding utilizing coating materials available as powder would be obtainable by the method of German patent document 37 40 916. From the teachings of this document, the danger of crack formation in the generation of the wear-reducing coating of powder can be reduced by reduction of the molybdenum content in the coating material. In this conventional process, the protective coating is applied by thermal spraying onto the base body and by then melting the coating into the material of the base body by a laser beam remelting step. The coating material can be molybdenum or an alloy predominantly consisting of molybdenum. Even in this two-stage process, relatively high quantities of thermal energy must be applied to the base body during the thermal spraying and here as well the undesirable intrinsic stress conditions can result in distortion and crack formation.
{ "pile_set_name": "USPTO Backgrounds" }
The pair appear oblivious to the fact they are being filmed and continue to overtake cars at speed. As the clip cuts out and the unknown lads drive off, the man filming says: “Nutjobs”. Balloons are often used to inhale nitrous oxide – often referred to as laughing gas or hippy crack – from canisters. The footage was posted to social media and believed to have been filmed on a motorway in the UK. It is not known when the footage was captured or what happened before or after the camera started recording. VIRALHOG SHOCKING: The person filming couldn't believe his eyes Revealed: The US town where 28 people overdosed on horror drug FENTANYL in six hours On August 15th in 2016, between 3pm and 9pm in Huntington, West Virginia, 28 people overdosed on heroin laced with Fentanyl. The drug is a synthetic opioid far more powerful and dangerous than heroin. The economic incentives are powerful: one kilogram of fentanyl costs $5,000, which can make a million tablets sold at $20 each for a gain of $20 million 1 / 12 AFP/Getty Images Two men wait while police search an abandoned house used by drug addicts after a complaint about a disturbance was made The gas – which is banned in the UK – can be deadly if mixed with large amounts of alcohol. But it has become a popular party drug in recent years despite immediate side effects including blurred vision and dizziness. Abusing nitrous oxide can lead to oxygen deprivation, which causes blood pressure to plummet, fainting and even heart attacks. The gas was responsible for 17 deaths in the UK between 2006 and 2012, according to research by the Royal Alexandra Children’s Hospital in Brighton.
{ "pile_set_name": "Pile-CC" }
Plant Thaumatin-like Proteins: Function, Evolution and Biotechnological Applications. Thaumatin-like proteins (TLPs) regard a highly complex protein family associated with host defense and developmental processes in plants, animals, and fungi. They exhibit high diversity in angiosperms, where they have been classified as the PR-5 (Pathogenesis-Related-5) protein family. In plants, TLPs exhibit a variety of properties associated with their structural diversity, being mostly associated with responses to biotic stress, besides some predicted activity under drought and osmotic stresses. The present review covers aspects related to the structure, evolution, gene expression, and biotechnological potential of TLPs. The efficiency of the discovery of new TLPs is below its potential considering the availability of omics data. Furthermore, we present an exemplary bioinformatics annotation procedure that was applied to cowpea (Vigna unguiculata) transcriptome, including libraries of two tissues (root and leave), two stress types (biotic/abiotic) and generated using different sequencing approaches. Even without using genomic sequences, the pipeline uncovered 56 TLP candidates in both tissues and stresses. Interestingly, abiotic stress (root dehydration) was associated with a higher number of modulated TLP isoforms. The nomenclature used so far for TLPs was also evaluated, considering TLP structure and possible functions identified to date. It is clear that plant TLPs are promising candidates for breeding purposes and for plant transformation aiming at a better performance under biotic and abiotic stresses. The development of new therapeutic drugs in the fight against human fungal pathogens also deserves attention. Despite that, applications derived from TLP molecules are still beyond their potential, as it is evident in our review.
{ "pile_set_name": "PubMed Abstracts" }
Neurostimulation devices deliver therapy in the form of electrical stimulation pulses to treat symptoms and conditions, such as chronic pain, Parkinson's disease, or epilepsy, for example. Implantable neurostimulation devices, for example, deliver neurostimulation therapy via leads that include electrodes located proximate to the muscles and nerves of a patient. Clinician programmers are used to control and program the neurostimulation devices with stimulation sequences to treat symptoms and conditions. These clinician programmers and devices of their type are relatively small to allow for easy transportation and storage. The portability has its price, however. It is difficult for more than one person to view the relatively small screen of a handheld programmer. People would have to crowd around the device to be able to attempt to see what is happening on the screen. Further, even though the clinician programmer is portable, there are some areas where its use may be restricted. For instance, a clinician programmer may be covered under the drapes while a sales representative is talking to the patient. The clinician programmer thus may not be visible to the physician. As another example, the clinician programmer may not be a sterile device and cannot be taken into the sterile field in an operating room. Since the clinician programmer must remain outside of the sterile field, the physician is unable to read the screen while performing the procedure. Accordingly, the physician must verbally interact with and rely on someone (an external operator), who acts as his eyes and hands controlling the programmer outside of the sterile field. The situation could also be reversed, where the physician is doing the programming, and the staff is observing his/her actions, for example, talking to the patient at the head end of the surgery table. In any case, requiring an extra person results in additional time for the procedure to be completed as a result of the verbal communication of the programming device state and adjustments to be made between the physician and the external operator. The verbal interchange may also result in miscommunication which will add additional time to complete the procedure and possibly result in more severe consequences. The present disclosure is directed to devices, systems, and methods that address one or more deficiencies in the prior art.
{ "pile_set_name": "USPTO Backgrounds" }
KK Zemun Košarkaški klub Zemun (), commonly referred to as KK Zemun Fitofarmacija for sponsorship reasons, is a men's professional basketball club based in Belgrade, Serbia. They are currently competing in the Second Men's League of Serbia (2nd-tier). Since 2015, the club has been organizing the Dado Trophy of Zemun in honor of their former player and coach Vladimir "Dado" Arnautović. Sponsorship naming KK Zemun has had several denominations through the years due to its sponsorship: Players Coaches Trophies and awards Trophies First Regional League (Central Division) (3rd-tier) Winners (1): 2017–18 Notable players Milan Dozet Youth selections Novica Veličković Vuk Vulikić Marko Pecarski Uroš Trifunović See also KK Mladost Zemun References External links Official website Profile at srbijasport.net Profile at eurobasket.com Category:Zemun Zemun
{ "pile_set_name": "Wikipedia (en)" }
--- abstract: 'In this article, we study the high order term of the fidelity of the Heisenberg chain with next-nearest-neighbor interaction and analyze its connection with quantum phase transition of Beresinskii-Kosterlitz-Thouless type happened in the system. We calculate the fidelity susceptibility of the system and find that although the phase transition point can’t be well characterized by the fidelity susceptibility, it can be effectively picked out by the higher order of the ground-state fidelity for finite-size systems.' author: - Li Wang - 'Shi-Jian Gu' - Shu Chen title: 'High-order fidelity and quantum phase transition for the Heisenberg chain with next-nearest-neighbor interaction' --- Introduction ============ Quantum phase transitions (QPTs) of a quantum many-body system have been attracting the persistent interest of physical researchers in recent years. Due to the diversity of quantum phases and QPTs, finding universal ways or methods to characterize QPTs is very meaningful and urgent. From the viewpoint of Landau-Ginzburg theory which has been widely accepted and known in condensed matter physics [@sachdev], QPT is connected with the corresponding order parameter and symmetry breaking. However, there are also some QPTs which cannot be well understood under the Landau-Ginzburg paradigm, such as the topological phase transitions [@xgwen] and Beresinskii-Kosterlitz-Thouless (BKT) phase transitions [beresinskii,kosterlitz]{}. Recently, an increasing research effort has been focused on the role of ground-state fidelity in characterizing QPTs[Gu\_review,htquan,zanardi06, hqzhou,YouWL07,zanardi07PRl,schen07pre,schen08pra,buonsante,mfyang,ZhouPRL]{}. As a basic concept in quantum information science, the fidelity measures the similarity between two states and is simply defined as modulus of their overlap [@zanardi06]. The fidelity approach provides us a novel way to understand QPTs from the viewpoint of quantum information theory. So far QPTs in various quantum many-body systems [@YouWL07; @hqzhou; @mfyang; @qhchen; @mfyang08; @WangXG08; @schen07pre; @schen08pra; @Paunkovic; @Venuti; @buonsante; @AHamma07; @abasto; @YangS; @zanardi07PRl; @WangXG; @Zhou09; @Zhou0803; @ZhouPRL] have been shown to be well characterized by the ground-state fidelity or fidelity susceptibility which is the leading term of the fidelity [YouWL07,zanardi07PRl]{}. Generally, one may expect that the structure of the ground states at the different phases is basically different and should reveal itself by some sort of singular behavior in the ground state fidelity or the fidelity susceptibility at the transition point [@zanardi06; @hqzhou]. Despite its great successes of application in various systems, this intuitive idea turns out to be not complete [@schen07pre; @mfyang; @schen08pra; @YouWL07; @mfyang08]. Although the fidelity and the fidelity susceptibility can be used to describe first- and second-order QPTs[@schen08pra], as well as the topological QPTs [@AHamma07; @abasto; @YangS; @Zhou0803] successfully, nevertheless there are also some ambiguous cases for that both the two methods mentioned above do not work very effectively [@schen07pre; @schen08pra; @YouWL07; @mfyang08]. Very recently, the controversial issue of BKT phase transition and ground state fidelity has been studied in Ref. [@Zhou09] from a perspective of matrix product states which essentially depend on a classical simulations of quantum lattice systems [@ZhouPRL]. In case that the leading term of the fidelity (fidelity susceptibility) works not very effectively, the higher order term in the fidelity may be worth studying. Up to now, there is still lack of literature concerning this part of the fidelity. Here, in this paper, we make an attempt on investigating the effect of higher order term of the fidelity on the characterization of the BKT-type phase transition happened in the Heisenberg chain with next-nearest-neighbor (NNN) interaction [@Haldane]. We will show that although the fidelity and fidelity susceptibility cannot effectively characterize the BKT-type phase transition point for the Heisenberg chain with NNN interaction, the higher order term of the fidelity gives a good attempt on detecting such a transition. Our paper is organized as follows. In Sec. II, we display the formulism of the higher order term of the fidelity. The subsequent section is devoted to the calculation of the higher order term of the fidelity for the model of Heisenberg chain with NNN interaction and show its connection to the quantum phase transition of the system. A brief summary is given in Sec. [sec:sum]{}. Higher order of the fidelity {#sec:highorder} ============================ As usual, the ground state fidelity is defined as the modulus of the overlap between $|\Psi_0(\lambda) \rangle$ and $| \Psi_0(\lambda+\delta\lambda) \rangle$, i.e. $$F(\lambda, \delta\lambda) =\left| f(\lambda, \lambda+\delta\lambda) \right | = \left | \langle \Psi_0(\lambda)| \Psi_0(\lambda+\delta\lambda) \rangle \right | , \tag{1} \label{eqF}$$ where $\Psi_0(\lambda)$ is the ground-state wavefunction of Hamiltonian $% H=H_0 + \lambda H_I$, $\lambda$ is the driving parameter and $\delta \lambda$ is a small deviation in the parameter space of $\lambda$. The fidelity susceptibility denotes only the leading term of the fidelity. Straightforwardly, one can get the higher order term of the fidelity following similar expansion in deriving the fidelity susceptibility [YouWL07]{}. By using the Taylor expansion, the overlap between two wavefunction $|\Psi _{0}(\lambda )\rangle $ and $|\Psi _{0}(\lambda +\delta \lambda )\rangle $ can be expanded to an arbitrary order of $\delta\lambda$, i.e. $$f(\lambda ,\lambda +\delta \lambda )=1+\sum_{n=1}^{\infty }\frac{(\delta \lambda )^{n}}{n!}\left\langle \Psi _{0}(\lambda )\left\vert \frac{\partial ^{n}}{\partial \lambda ^{n}}\Psi _{0}(\lambda )\right. \right\rangle . \tag{2} \label{eqf}$$ Therefore, the fidelity becomes $$\begin{aligned} F^{2}=&1+\sum_{n=1}^{\infty }\frac{(\delta \lambda )^{n}}{n!}\left\langle \Psi _{0}\left\vert \frac{\partial ^{n}}{\partial \lambda ^{n}}\Psi _{0}\right. \right\rangle+ \notag \\ &\sum_{n=1}^{\infty }\frac{(\delta \lambda )^{n}}{n!}\left\langle \left. \frac{\partial ^{n}}{\partial \lambda ^{n}}\Psi _{0}\right\vert \Psi _{0}\right\rangle + \notag \\ &\sum_{m,n=1}^{\infty }\frac{(\delta \lambda )^{m+n}}{m!n!}\left\langle \Psi _{0}\left\vert \frac{\partial ^{n}}{\partial \lambda ^{n}}\Psi _{0}\right. \right\rangle \left\langle \left. \frac{\partial ^{m}}{\partial \lambda ^{m}}% \Psi _{0}\right\vert \Psi _{0}\right\rangle. \tag{3} \label{eqF2}\end{aligned}$$ We note that $\frac {\partial^{n}} {\partial \lambda^{n}} \langle \Psi_0(\lambda)| \Psi_0(\lambda) \rangle =0$ and use the relation for a given $n$ $$\sum_{m=0}^{n}\frac{n!}{m!(n-m)!}\left\langle \left. \frac{\partial ^{m}}{% \partial \lambda ^{m}}\Psi _{0}\right\vert \frac{\partial ^{n-m}}{\partial \lambda ^{n-m}}\Psi _{0}\right\rangle =0 , \tag{4} \label{relation}$$ then we can simplify the expression of (\[eqF2\]) into $$F^{2}=1-\sum_{l=1}^{\infty }(\delta \lambda )^{l}\chi _{F}^{(l)} \tag{5} \label{F2simple}$$where $$\chi _{F}^{(l)}=\sum_{l=m+n}\frac{1}{m!n!}\left\langle \left. \frac{\partial ^{m}}{\partial \lambda ^{m}}\Psi _{0}\right\vert \hat {P} \left\vert \frac{% \partial ^{n}}{\partial \lambda ^{n}}\Psi _{0}\right. \right\rangle , \tag{6} \label{eq:higherorderdiff}$$ with the projection operator $\hat {P}$ defined as $\hat {P}=1- |\Psi_0 \rangle \langle \Psi_0 |$. It is easy to check that $\chi _{F}^{(1)}$ is zero and $\chi _{F}^{(2)}$ the fidelity susceptibility [@YouWL07]. Next we shall consider the third order fidelity $\chi _{F}^{(3)}$ and apply it to judge the phase transition in the spin chain model with NNN exchanges. Alternatively, one can directly derive the expression of $\chi _{F}^{(3)}$ from the perturbation expansion of the GS wavefunction. According the perturbation theory, the GS wavefunction, up to the second order, is $$\begin{aligned} |\Psi _{0}(\lambda +\delta \lambda )\rangle =& |\Psi _{0}\rangle +\delta \lambda \sum_{n\neq 0}\frac{H_{I}^{n0}|\Psi _{n}\rangle }{E_{0}-E_{n}} \\ & +\left( \delta \lambda \right) ^{2}\sum_{m,n\neq 0}\frac{% H_{I}^{nm}H_{I}^{m0}|\Psi _{n}\rangle }{(E_{0}-E_{m})(E_{0}-E_{n})} \\ & -\left( \delta \lambda \right) ^{2}\sum_{n\neq 0}\frac{% H_{I}^{00}H_{I}^{n0}|\Psi _{n}\rangle }{(E_{0}-E_{n})^{2}} \\ & -\frac{\left( \delta \lambda \right) ^{2}}{2}\sum_{n\neq 0}\frac{% H_{I}^{0n}H_{I}^{n0}|\Psi _{0}\rangle }{(E_{0}-E_{n})^{2}}.\end{aligned}$$The 3rd order term $\chi _{F}^{(3)}$, which is proportional to the 3rd order derivative of GS fidelity, can be then directly extracted from eq. (\[F2simple\]): $$\chi _{F}^{(3)}=\sum_{m,n\neq 0}\frac{2H_{I}^{0m}H_{I}^{mn}H_{I}^{n0}}{% (E_{0}-E_{m})(E_{0}-E_{n})^{2}}-\sum_{n\neq 0}\frac{2H_{I}^{00}\left\vert H_{I}^{n0}\right\vert ^{2}}{(E_{0}-E_{n})^{3}}. \tag{8} \label{eq:higheroderperturb}$$ Eqs. (\[eq:higherorderdiff\]) and (\[eq:higheroderperturb\]) present the main formulism of the higher order expansion of the fidelity. So far the explicit physical meaning of the high order term in the fidelity is still not clear. The expression of 3rd fidelity bears the similarity to its correspondence of the 3rd derivative of GS energy which has the following form $$\frac {\partial^3 E} {\partial \lambda^3} = \sum_{m,n\neq0}\frac{6 H_I^{0n}H_I^{nm}H_I^{m0}}{(E_0-E_m)(E_0-E_n)} -\sum_{n\neq0}\frac{6 H_I^{00}\left|H_I^{n0}\right|^2}{(E_0-E_n)^2}. \tag{9}$$ Obviously, the 3rd fidelity is more divergent than the 3rd derivative of GS energy. Similar connection between the fidelity susceptibility and 2nd derivative of GS energy has been unveiled [@schen08pra]. Generally the $n $-th order fidelity is much more divergent than its counterpart of $n$-th order derivative of GS energy, therefore an $n$-th order QPT can be certainly detected by the $n$-th order fidelity. However, this conclusion does not exclude the possibility that $n$-th order fidelity can detect a even higher order or infinite order QPT. A concrete example has been given in Ref. [mfyang08]{}, where a QPT of higher than second order was singled out unambiguously by using the fidelity susceptibility despite the corresponding second derivative of the ground-state energy density showing no signal of divergence. So far no example of BKT-type QPT unambiguously detected by fidelity susceptibility has been given. Next we shall attempt to apply the third-order fidelity to study the BKT-type transition in a the spin chain model with NNN exchanges. The model and the calculation of 3rd order fidelity {#sec:model} =================================================== Now we turn to the one-dimensional Heisenberg chain with the NNN coupling described by the Hamiltonian $$H(\lambda )=\sum_{j=1}^{L}\left( \hat{s}_{j}\hat{s}_{j+1}+\lambda \hat{s}_{j}% \hat{s}_{j+2}\right) , \tag{10} \label{Ham}$$where $\hat{s}_{j}$ denotes the spin-1/2 operator at the $j\,$th site, $L$ denotes the total number of sites. The driving parameter $\lambda $ represents the ratio between the NNN coupling and the nearest-neighbor (NN) coupling. The GS properties of the model (\[Ham\]) has been widely studied by both analytical method [@Haldane; @Giamarchi] and numerical method [Okamoto,Castilla,RChitra,SRWhite96]{}. The QPT driven by $\lambda $ is well understood. The driving term due to $\lambda $ is irrelevant when $\lambda <\lambda _{c}(\simeq 0.2411)$, and the system flows to a spin fluid or Luttinger liquid with massless spinon excitations. As $\lambda >\lambda _{c}$, the frustration term is relevant and the ground state flows to the dimerized phase with a spin gap open [@Haldane; @Giamarchi]. The transition from spin fluid to dimerized phase is known to be of BKT type [@Haldane; @Giamarchi], for which the transition point was hard to be determined numerically due to the problem of logarithmic correction [@Affleck]. The critical value of $\lambda _{c}=0.2411\pm 0.0001$ has been accurately determined by various numerical methods [@Okamoto; @Castilla; @RChitra; @SRWhite96]. ![The GS fidelity susceptibility of the heisenberg chain with next-nearest-neighbor interaction for finite system size from 14 sites to 26 sites. Obviously, there is no expected peaks can be observed.[]{data-label="Figure1"}](Fig1.eps){width="9cm"} The GS fidelity for the model (\[Ham\]) has been studied in Ref. [schen07pre]{} and also in Ref. [@WangXG] in terms of operator fidelity. No singularities in the GS fidelity or operator fidelity around $\lambda_c$ have been detected for the system with different sizes, which implies that the GS fidelity may be not an effective characterization of the BKT-type QPT in this model. The BKT-type QPT is a infinite order phase transition where the $n$-th order derivative of GS energy is continuous. ![The third order term of the GS fidelity of the spin chain with next-nearest-neighbor interaction for the finite system size from 14 sites to 26 sites. Explicit peaks can be observed in this figure. As the system size increases, the position of the peak gets closer to the BKT-transition point.[]{data-label="Figure2"}](Fig2.eps){width="9cm"} ![Finite-size scaling of the extrema of the third term of the GS fidelity. A linear fit is made. According to this fit, when it comes to the point $N\rightarrow \infty$, $\protect\lambda_c=0.238 \pm0.006$. []{data-label="Figure3"}](Fig3.eps){width="9cm"} In light of the higher-order fidelity being more powerful than its energy judgement, we study the possibility for detecting the infinite-order BKT-type QPT via the 3rd order fidelity and focus on the QPT in the spin chain with NNN interactions as a concrete example. We first calculate the GS wave functions by using the numerical exact diagonalization method for finite size system, and thus the fidelity susceptibility and the 3rd order fidelity can be extracted from the overlap of neighboring GS wave functions. In Fig.1, we display the fidelity susceptibility for systems with different sizes. We observe that no an obvious peak for the fidelity susceptibility is detected in a wide range of the parameter $0<\lambda<0.5$. This result suggests that the transition point for the BKT-type QPTs cannot be very effectively characterized by the fidelity susceptibility either for a finite-size system. The BKT-type phase transition generally is an infinite order phase transition for which the infinite order derivatives of the ground-state energy is continuous. A good example with exact proof is the BKT-type transition happened in the antiferromagnetic XXZ spin chain model [YangCN]{}. In the BKT-type transition point, it has been proven analytically that all the $n$-th order derivatives of ground state energy is continuous [@YangCN]. Since the $n$-th order fidelity is much divergent than its correspondence of derivative of the ground-state energy, one might expect that there exists the possibility that the $n$-th order fidelity is divergent even its $n$-th order energy derivative is continuous. To see whether a higher order fidelity works better than fidelity susceptibility in detecting the BKT-type QPT happened in this model, we calculated the 3rd order fidelity versus the driving parameter as shown in Fig. 2. It is clear that a peak is developed in the 3rd order fidelity and the location of peaks tends to get close to the side of transition point $% \lambda _{c}$ with the increase of lattice size. To extrapolate the $\lambda _{c}$ in the infinite size limit, we analyze the finite size scaling of position of peak in the Fig. 3. When the system size comes to infinity, the extrapolated value of the phase transition point is $\lambda _{c}=0.238\pm 0.006$, which, within the scope of fitting error, agrees well with $\lambda _{c}=0.2411\pm 0.0001$ obtained by highly accurate numerical methods [Okamoto,Castilla,RChitra,SRWhite96]{}. Summary {#sec:sum} ======= We have shown the formulism for the high order of the fidelity in detail and applied it to a concrete model, *i.e.*, the one dimensional Heisenberg chain with NNN interaction. We first calculate the ground-state wavefunction of the system by exact diagnolization method, and then extract fidelity susceptibility and the third order of the GS fidelity. We find that despite the GS fidelity and the fidelity susceptibility being not a very effective detector, the BKT-type phase transition happened in this spin chain model might be effectively detected by the 3rd order term of the GS fidelity for finite-size system. Although the physical meaning of the higher order term of the GS fidelity hasn’t been deeply understood, we wish that our observation would stimulate further studies on this issue. This work is supported by NSF of China under Grant No. 10821403, programs of Chinese Academy of Sciences, National Program for Basic Research of MOST, China and the Earmarked Grant Research from the Research Grants Council of HKSAR, China (Project No. CUHK 400807). [99]{} S. Sachdev, *Quantum Phase Transitions*(Cambridge University Press, Cambridge, England, 1999) X. G. Wen, *Quantum Field Theory of Many-Body Systems* (Oxford University, New York, 2004) V. L. Beresiskii, Sov. Phys. JETP 32, 493 (1971). J. M. Kosterlitz and D. J. Thouless, J. Phys. C 6, 1181(1973); J. M. Kosterlitz, *ibid* 7, 1046 (1974). S. J. Gu, e-print arXiv: 0811.3127. H. T. Quan, Z. Song, X. F. Liu, P. Zanardi, and C. P. Sun, Phys. Rev. Lett. 96, 140604 (2006). P. Zanardi and N. Paunkovi$\acute{c}$, Phys. Rev. E 74, 031123 (2006). H. Q. Zhou and J. P. Barjaktarevic, J. Phys. A: Math. Theor. 41 412001 (2008); H. Q. Zhou, J. H. Zhao, H. L. Wang, B. Li, arXiv: 0711.4651. P. Buonsante and A. Vezzani, Phys. Rev. Lett. 98, 110601 (2007). S. Chen, L. Wang, S. J. Gu, and Y. Wang, Phys. Rev. E 76, 061108 (2007). S. Chen, L. Wang, Y. Hao, and Y. Wang, Phys. Rev. A **77**, 032111 (2008). M. F. Yang, Phys. Rev. B 76, 180403(R)(2007); Y. -C. Tzeng and M. F. Yang, Phys. Rev. A 77, 012311 (2008); J. O. Fjaerestad, J. Stat. Mech. P07011 (2008). W. L. You, Y. W. Li, and S. J. Gu, Phys. Rev. E 76, 022101 (2007); S. J. Gu, H. M. Kwok, W. Q. Ning, and H. Q. Lin, Phys. Rev. B **77**, 245109 (2008). P. Zanardi, P. Giorda, and M. Cozzini, Phys. Rev. Lett. **99**, 100603 (2007). H. Q. Zhou, R. Orus, and G. Vidal, Phys. Rev. Lett. **100**, 080601 (2008). Y. C. Tzeng, H. H. Hung, Y. C. Chen, and M. F. Yang, Phys. Rev. A **77**, 062321 (2008). H. L. Wang, J. H. Zhao, B. Li, and H. Q. Zhou, arXiv:0902.1670. L. C. Venuti, M. Cozzini, P. Buonsante, F. Massel, N. Bray-Ali, and P. Zanardi, Phys. Rev. B **78**, 115410 (2008). A. Hamma, W. Zhang, S. Haas, and D. A. Lidar, Phys. Rev. B **77**, 155111 (2008). D. F. Abasto, A. Hamma, and P. Zanardi, Phys. Rev. A **78**, 010301 (2008). S. Yang, S. J. Gu, C. P. Sun, and H. Q. Lin, Phys. Rev. A **78**, 012304 (2008). J. H. Zhao, H. Q. Zhou, arXiv:0803.0814. X. M. Lu, Z. Sun, X. G. Wang, and P. Zanardi, Phys. Rev. A **78**, 032309 (2008); J. Ma, L. Xu, H. N. Xiong, and X. G. Wang, Phys. Rev. E **78**, 051126 (2008). N. Paunkovic *et al.*, Phys. Rev. A 77, 052302 (2008). K. W. Sun, Y. Y. Zhang, Q. H. Chen, Phys. Rev. B **79**, 104429 (2009); T. Liu, Y. Y. Zhang, Q. H. Chen, K. L. Wang, arXiv:0812.0321; L. Gong and P. Q. Tong, Phys. Rev. B **78**, 115114 (2008). X. G. Wang, Z. Sun and Z. D. Wang, Phys. Rev. A **79** , 012105 (2009). F. D. M. Haldane, Phys. Rev. B **25**, 4925 (1982). K. Okamto and K. Nomura, Phys. Lett. A **169**, 433 (1992). G. Castilla, S. Chakravarty, and V.J. Emery, Phys. Rev. Lett. **75**, 1823 (1995). T. Giamarchi, *Quantum Physics in One Dimension* (Oxford University Press, Oxford, England, 2004). R. Chitra, S. Pati, H. R. Krishnamurthy, D. Sen, and S. Ramasesha, Phys. Rev. B **52**, 6581 (1995). S. R. White, and I. Affleck, Phys. Rev. B **54**, 9862 (1996). I. Affleck, D. Gepner, H. J. Schulz, and T. Ziman, J. Phys. A 22, 511 (1989). C. N. Yang and C. P. Yang, Phys. Rev. 150, 321 (1966); J. D. Cloizeaux and M. Gaudin, J. Math. Phys, 7, 1387 (1966).
{ "pile_set_name": "ArXiv" }
Side Street (1929 film) Side Street is a 1929 American Pre-Code film featuring the only screen teaming of all three Moore Brothers (Tom, Owen, and Matt), each of them major silent film stars. George Raft also makes an uncredited appearance as a professional dancer — which Raft was at the time — dancing to the song "Take a Look at Her Now", sung by June Clyde. Side Street was directed by Malcolm St. Clair, with a screenplay by George O'Hara and Jane Murfin, based on a story by St. Clair, which was adapted by John Russell. Plot The film chronicles the exploits of three Irish brothers. Jimmy is a cop, John is an emergency room doctor, and Dennis, as far as his family is aware of, is a very wealthy businessman, even having paid for John to go to medical school. Their parents, Nora and Tom, are very proud of all three sons. Jimmy is promoted on the police force, and begins the investigation of a murder involving the infamous Muller gang. As this crime drama unfolds, the viewer is introduced to Dennis's other life. In reality he is a powerful racketeer and bootlegger, but he keeps his two personas separate in order to protect his family from any consequences of his criminal activity. However, when Jimmy's fiancé, Kathleen Doyle, attends a party thrown by Muller at one of his houses. During the party, she inadvertently learns that Silk is a killer hired by Muller, who was responsible for the murder her fiancé is investigating. Meanwhile, John goes out on an emergency call to care for a man who has been injured in a drunken brawl. While he is treating the injured man, he accidentally discovers that Muller is none other than his brother, Dennis. When Kathleen meets Jimmy and tells him about her discovery, unbeknownst to them, she is overheard by one of Muller's gang, who then plots with the other gang members to ambush and kill Jimmy. On Thanksgiving, Dennis realizes his cover has been blown, and he realizes his brother, Jimmy, is in danger. He and John rush off to warn Jimmy, but as they arrive at the ambush, Dennis saves his brother, but gets shot by his own men instead. He dies in the arms of both of his brothers, who later tell their parents that he has gone off on another one of his mysterious journeys, perhaps this time for good. Cast Tom Moore - Jimmy O'Farrell Owen Moore - Dennis O'Farrell Matt Moore - John O'Farrell Emma Dunn - Mrs. Nora O'Farrell Katherine Perry - Kathleen Doyle Frank Sheridan - Mr. Tom O'Farrell Charles Byer - Maxse Kimball Arthur Housman - Henchman Silk Ruffo Mildred Harris - Bunny Walter MacNamara - Patrick Doyle George Raft - Georgie Ames, the dancer (uncredited) June Clyde - Judy, the singer (uncredited) Film preservation and other notes Side Street, which survives in its entirety, is George Raft's oldest surviving movie. His first movie, Queen of the Night Clubs, is a lost film (only a small excerpt survives); and his second movie, Gold Diggers of Broadway, is also a lost film (only 2 out of 10 reels survive). Mildred Harris had been a silent film star, as well as being the ex-wife of Charlie Chaplin. The film is known as The Three Brothers in Great Britain, and as L'Ultimo Viaggio in Italy. References External links Category:1929 films Category:American black-and-white films Category:American crime drama films Category:American films Category:Films directed by Malcolm St. Clair Category:RKO Pictures films Category:1920s crime films Category:1920s drama films Category:Films made before the MPAA Production Code Category:Films with screenplays by Jane Murfin
{ "pile_set_name": "Wikipedia (en)" }
using GVFS.FunctionalTests.FileSystemRunners; using GVFS.FunctionalTests.Properties; using GVFS.FunctionalTests.Should; using GVFS.FunctionalTests.Tools; using GVFS.Tests.Should; using Microsoft.Win32.SafeHandles; using NUnit.Framework; using System; using System.Collections.Generic; using System.Diagnostics; using System.IO; using System.Linq; using System.Runtime.InteropServices; namespace GVFS.FunctionalTests.Tests.EnlistmentPerFixture { [TestFixture] [Category(Categories.ExtraCoverage)] public class MountTests : TestsWithEnlistmentPerFixture { private const int GVFSGenericError = 3; private const uint GenericRead = 2147483648; private const uint FileFlagBackupSemantics = 3355443; private readonly int fileDeletedBackgroundOperationCode; private readonly int directoryDeletedBackgroundOperationCode; private FileSystemRunner fileSystem; public MountTests() { this.fileSystem = new SystemIORunner(); if (RuntimeInformation.IsOSPlatform(OSPlatform.OSX)) { this.fileDeletedBackgroundOperationCode = 16; this.directoryDeletedBackgroundOperationCode = 17; } else { this.fileDeletedBackgroundOperationCode = 3; this.directoryDeletedBackgroundOperationCode = 11; } } [TestCaseSource(typeof(MountSubfolders), MountSubfolders.MountFolders)] public void SecondMountAttemptFails(string mountSubfolder) { this.MountShouldFail(0, "already mounted", this.Enlistment.GetVirtualPathTo(mountSubfolder)); } [TestCase] public void MountFailsOutsideEnlistment() { this.MountShouldFail("is not a valid GVFS enlistment", Path.GetDirectoryName(this.Enlistment.EnlistmentRoot)); } [TestCase] public void MountCopiesMissingReadObjectHook() { this.Enlistment.UnmountGVFS(); string readObjectPath = this.Enlistment.GetDotGitPath("hooks", "read-object" + Settings.Default.BinaryFileNameExtension); readObjectPath.ShouldBeAFile(this.fileSystem); this.fileSystem.DeleteFile(readObjectPath); readObjectPath.ShouldNotExistOnDisk(this.fileSystem); this.Enlistment.MountGVFS(); readObjectPath.ShouldBeAFile(this.fileSystem); } [TestCase] public void MountSetsCoreHooksPath() { try { GVFSHelpers.RegisterForOfflineIO(); this.Enlistment.UnmountGVFS(); GitProcess.Invoke(this.Enlistment.RepoBackingRoot, "config --unset core.hookspath"); string.IsNullOrWhiteSpace( GitProcess.Invoke(this.Enlistment.RepoBackingRoot, "config core.hookspath")) .ShouldBeTrue(); this.Enlistment.MountGVFS(); string expectedHooksPath = this.Enlistment.GetDotGitPath("hooks"); expectedHooksPath = GitHelpers.ConvertPathToGitFormat(expectedHooksPath); GitProcess.Invoke( this.Enlistment.RepoRoot, "config core.hookspath") .Trim('\n') .ShouldEqual(expectedHooksPath); } finally { GVFSHelpers.UnregisterForOfflineIO(); } } [TestCase] [Category(Categories.WindowsOnly)] // Only Windows uses GitHooksLoader.exe and merges hooks public void MountMergesLocalPrePostHooksConfig() { // Create some dummy pre/post command hooks string dummyCommandHookBin = "cmd.exe /c exit 0"; // Confirm git is not already using the dummy hooks string localGitPreCommandHooks = this.Enlistment.GetVirtualPathTo(".git", "hooks", "pre-command.hooks"); localGitPreCommandHooks.ShouldBeAFile(this.fileSystem).WithContents().Contains(dummyCommandHookBin).ShouldBeFalse(); string localGitPostCommandHooks = this.Enlistment.GetVirtualPathTo(".git", "hooks", "post-command.hooks"); localGitPreCommandHooks.ShouldBeAFile(this.fileSystem).WithContents().Contains(dummyCommandHookBin).ShouldBeFalse(); this.Enlistment.UnmountGVFS(); // Create dummy-<pre/post>-command.hooks and set them in the local git config string dummyPreCommandHooksConfig = Path.Combine(this.Enlistment.EnlistmentRoot, "dummy-pre-command.hooks"); this.fileSystem.WriteAllText(dummyPreCommandHooksConfig, dummyCommandHookBin); string dummyOostCommandHooksConfig = Path.Combine(this.Enlistment.EnlistmentRoot, "dummy-post-command.hooks"); this.fileSystem.WriteAllText(dummyOostCommandHooksConfig, dummyCommandHookBin); // Configure the hooks locally GitProcess.Invoke(this.Enlistment.RepoRoot, $"config gvfs.clone.default-pre-command {dummyPreCommandHooksConfig}"); GitProcess.Invoke(this.Enlistment.RepoRoot, $"config gvfs.clone.default-post-command {dummyOostCommandHooksConfig}"); // Mount the repo this.Enlistment.MountGVFS(); // .git\hooks\<pre/post>-command.hooks should now contain our local dummy hook // The dummy pre-command hooks should appear first, and the post-command hook should appear last List<string> mergedPreCommandHooksLines = localGitPreCommandHooks .ShouldBeAFile(this.fileSystem) .WithContents() .Split(new char[] { '\r', '\n' }, StringSplitOptions.RemoveEmptyEntries) .Where(line => !line.StartsWith("#")) .ToList(); mergedPreCommandHooksLines.Count.ShouldEqual(2, $"Expected 2 lines, actual: {string.Join("\n", mergedPreCommandHooksLines)}"); mergedPreCommandHooksLines[0].ShouldEqual(dummyCommandHookBin); List<string> mergedPostCommandHooksLines = localGitPostCommandHooks .ShouldBeAFile(this.fileSystem) .WithContents() .Split(new char[] { '\r', '\n' }, StringSplitOptions.RemoveEmptyEntries) .Where(line => !line.StartsWith("#")) .ToList(); mergedPostCommandHooksLines.Count.ShouldEqual(2, $"Expected 2 lines, actual: {string.Join("\n", mergedPostCommandHooksLines)}"); mergedPostCommandHooksLines[1].ShouldEqual(dummyCommandHookBin); } [TestCase] public void MountChangesMountId() { string mountId = GitProcess.Invoke(this.Enlistment.RepoRoot, "config gvfs.mount-id") .Trim('\n'); this.Enlistment.UnmountGVFS(); this.Enlistment.MountGVFS(); GitProcess.Invoke(this.Enlistment.RepoRoot, "config gvfs.mount-id") .Trim('\n') .ShouldNotEqual(mountId, "gvfs.mount-id should change on every mount"); } [TestCase] public void MountFailsWhenNoOnDiskVersion() { this.Enlistment.UnmountGVFS(); // Get the current disk layout version string majorVersion; string minorVersion; GVFSHelpers.GetPersistedDiskLayoutVersion(this.Enlistment.DotGVFSRoot, out majorVersion, out minorVersion); int majorVersionNum; int minorVersionNum; int.TryParse(majorVersion.ShouldNotBeNull(), out majorVersionNum).ShouldEqual(true); int.TryParse(minorVersion.ShouldNotBeNull(), out minorVersionNum).ShouldEqual(true); // Move the RepoMetadata database to a temp file string versionDatabasePath = Path.Combine(this.Enlistment.DotGVFSRoot, GVFSHelpers.RepoMetadataName); versionDatabasePath.ShouldBeAFile(this.fileSystem); string tempDatabasePath = versionDatabasePath + "_MountFailsWhenNoOnDiskVersion"; tempDatabasePath.ShouldNotExistOnDisk(this.fileSystem); this.fileSystem.MoveFile(versionDatabasePath, tempDatabasePath); versionDatabasePath.ShouldNotExistOnDisk(this.fileSystem); this.MountShouldFail("Failed to upgrade repo disk layout"); // Move the RepoMetadata database back this.fileSystem.DeleteFile(versionDatabasePath); this.fileSystem.MoveFile(tempDatabasePath, versionDatabasePath); tempDatabasePath.ShouldNotExistOnDisk(this.fileSystem); versionDatabasePath.ShouldBeAFile(this.fileSystem); this.Enlistment.MountGVFS(); } [TestCase] public void MountFailsWhenNoLocalCacheRootInRepoMetadata() { this.Enlistment.UnmountGVFS(); string majorVersion; string minorVersion; GVFSHelpers.GetPersistedDiskLayoutVersion(this.Enlistment.DotGVFSRoot, out majorVersion, out minorVersion); majorVersion.ShouldNotBeNull(); minorVersion.ShouldNotBeNull(); string objectsRoot = GVFSHelpers.GetPersistedGitObjectsRoot(this.Enlistment.DotGVFSRoot).ShouldNotBeNull(); string metadataPath = Path.Combine(this.Enlistment.DotGVFSRoot, GVFSHelpers.RepoMetadataName); string metadataBackupPath = metadataPath + ".backup"; this.fileSystem.MoveFile(metadataPath, metadataBackupPath); this.fileSystem.CreateEmptyFile(metadataPath); GVFSHelpers.SaveDiskLayoutVersion(this.Enlistment.DotGVFSRoot, majorVersion, minorVersion); GVFSHelpers.SaveGitObjectsRoot(this.Enlistment.DotGVFSRoot, objectsRoot); this.MountShouldFail("Failed to determine local cache path from repo metadata"); this.fileSystem.DeleteFile(metadataPath); this.fileSystem.MoveFile(metadataBackupPath, metadataPath); this.Enlistment.MountGVFS(); } [TestCase] public void MountFailsWhenNoGitObjectsRootInRepoMetadata() { this.Enlistment.UnmountGVFS(); string majorVersion; string minorVersion; GVFSHelpers.GetPersistedDiskLayoutVersion(this.Enlistment.DotGVFSRoot, out majorVersion, out minorVersion); majorVersion.ShouldNotBeNull(); minorVersion.ShouldNotBeNull(); string localCacheRoot = GVFSHelpers.GetPersistedLocalCacheRoot(this.Enlistment.DotGVFSRoot).ShouldNotBeNull(); string metadataPath = Path.Combine(this.Enlistment.DotGVFSRoot, GVFSHelpers.RepoMetadataName); string metadataBackupPath = metadataPath + ".backup"; this.fileSystem.MoveFile(metadataPath, metadataBackupPath); this.fileSystem.CreateEmptyFile(metadataPath); GVFSHelpers.SaveDiskLayoutVersion(this.Enlistment.DotGVFSRoot, majorVersion, minorVersion); GVFSHelpers.SaveLocalCacheRoot(this.Enlistment.DotGVFSRoot, localCacheRoot); this.MountShouldFail("Failed to determine git objects root from repo metadata"); this.fileSystem.DeleteFile(metadataPath); this.fileSystem.MoveFile(metadataBackupPath, metadataPath); this.Enlistment.MountGVFS(); } [TestCase] public void MountRegeneratesAlternatesFileWhenMissingGitObjectsRoot() { this.Enlistment.UnmountGVFS(); string objectsRoot = GVFSHelpers.GetPersistedGitObjectsRoot(this.Enlistment.DotGVFSRoot).ShouldNotBeNull(); string alternatesFilePath = this.Enlistment.GetDotGitPath("objects", "info", "alternates"); alternatesFilePath.ShouldBeAFile(this.fileSystem).WithContents(objectsRoot); this.fileSystem.WriteAllText(alternatesFilePath, "Z:\\invalidPath"); this.Enlistment.MountGVFS(); alternatesFilePath.ShouldBeAFile(this.fileSystem).WithContents(objectsRoot); } [TestCase] public void MountRegeneratesAlternatesFileWhenMissingFromDisk() { this.Enlistment.UnmountGVFS(); string objectsRoot = GVFSHelpers.GetPersistedGitObjectsRoot(this.Enlistment.DotGVFSRoot).ShouldNotBeNull(); string alternatesFilePath = this.Enlistment.GetDotGitPath("objects", "info", "alternates"); alternatesFilePath.ShouldBeAFile(this.fileSystem).WithContents(objectsRoot); this.fileSystem.DeleteFile(alternatesFilePath); this.Enlistment.MountGVFS(); alternatesFilePath.ShouldBeAFile(this.fileSystem).WithContents(objectsRoot); } [TestCase] public void MountCanProcessSavedBackgroundQueueTasks() { string deletedFileEntry = "Test_EPF_WorkingDirectoryTests/1/2/3/4/ReadDeepProjectedFile.cpp"; string deletedDirEntry = "Test_EPF_WorkingDirectoryTests/1/2/3/4/"; GVFSHelpers.ModifiedPathsShouldNotContain(this.Enlistment, this.fileSystem, deletedFileEntry); GVFSHelpers.ModifiedPathsShouldNotContain(this.Enlistment, this.fileSystem, deletedDirEntry); this.Enlistment.UnmountGVFS(); // Prime the background queue with delete messages string deleteFilePath = Path.Combine("Test_EPF_WorkingDirectoryTests", "1", "2", "3", "4", "ReadDeepProjectedFile.cpp"); string deleteDirPath = Path.Combine("Test_EPF_WorkingDirectoryTests", "1", "2", "3", "4"); string persistedDeleteFileTask = $"A 1\0{this.fileDeletedBackgroundOperationCode}\0{deleteFilePath}\0"; string persistedDeleteDirectoryTask = $"A 2\0{this.directoryDeletedBackgroundOperationCode}\0{deleteDirPath}\0"; this.fileSystem.WriteAllText( Path.Combine(this.Enlistment.EnlistmentRoot, GVFSTestConfig.DotGVFSRoot, "databases", "BackgroundGitOperations.dat"), $"{persistedDeleteFileTask}\r\n{persistedDeleteDirectoryTask}\r\n"); // Background queue should process the delete messages and modifiedPaths should show the change this.Enlistment.MountGVFS(); this.Enlistment.WaitForBackgroundOperations(); GVFSHelpers.ModifiedPathsShouldContain(this.Enlistment, this.fileSystem, deletedFileEntry); GVFSHelpers.ModifiedPathsShouldContain(this.Enlistment, this.fileSystem, deletedDirEntry); } [TestCase] public void MountingARepositoryThatRequiresPlaceholderUpdatesWorks() { string placeholderRelativePath = Path.Combine("EnumerateAndReadTestFiles", "a.txt"); string placeholderPath = this.Enlistment.GetVirtualPathTo(placeholderRelativePath); // Ensure the placeholder is on disk and hydrated placeholderPath.ShouldBeAFile(this.fileSystem).WithContents(); this.Enlistment.UnmountGVFS(); File.Delete(placeholderPath); GVFSHelpers.DeletePlaceholder( Path.Combine(this.Enlistment.DotGVFSRoot, TestConstants.Databases.VFSForGit), placeholderRelativePath); GVFSHelpers.SetPlaceholderUpdatesRequired(this.Enlistment.DotGVFSRoot, true); this.Enlistment.MountGVFS(); } [TestCaseSource(typeof(MountSubfolders), MountSubfolders.MountFolders)] public void MountFailsAfterBreakingDowngrade(string mountSubfolder) { MountSubfolders.EnsureSubfoldersOnDisk(this.Enlistment, this.fileSystem); this.Enlistment.UnmountGVFS(); string majorVersion; string minorVersion; GVFSHelpers.GetPersistedDiskLayoutVersion(this.Enlistment.DotGVFSRoot, out majorVersion, out minorVersion); int majorVersionNum; int minorVersionNum; int.TryParse(majorVersion.ShouldNotBeNull(), out majorVersionNum).ShouldEqual(true); int.TryParse(minorVersion.ShouldNotBeNull(), out minorVersionNum).ShouldEqual(true); GVFSHelpers.SaveDiskLayoutVersion(this.Enlistment.DotGVFSRoot, (majorVersionNum + 1).ToString(), "0"); this.MountShouldFail("do not allow mounting after downgrade", this.Enlistment.GetVirtualPathTo(mountSubfolder)); GVFSHelpers.SaveDiskLayoutVersion(this.Enlistment.DotGVFSRoot, majorVersionNum.ToString(), minorVersionNum.ToString()); this.Enlistment.MountGVFS(); } [TestCaseSource(typeof(MountSubfolders), MountSubfolders.MountFolders)] public void MountFailsUpgradingFromInvalidUpgradePath(string mountSubfolder) { MountSubfolders.EnsureSubfoldersOnDisk(this.Enlistment, this.fileSystem); string headCommitId = GitProcess.Invoke(this.Enlistment.RepoRoot, "rev-parse HEAD"); this.Enlistment.UnmountGVFS(); string majorVersion; string minorVersion; GVFSHelpers.GetPersistedDiskLayoutVersion(this.Enlistment.DotGVFSRoot, out majorVersion, out minorVersion); int majorVersionNum; int minorVersionNum; int.TryParse(majorVersion.ShouldNotBeNull(), out majorVersionNum).ShouldEqual(true); int.TryParse(minorVersion.ShouldNotBeNull(), out minorVersionNum).ShouldEqual(true); // 1 will always be below the minumum support version number GVFSHelpers.SaveDiskLayoutVersion(this.Enlistment.DotGVFSRoot, "1", "0"); this.MountShouldFail("Breaking change to GVFS disk layout has been made since cloning", this.Enlistment.GetVirtualPathTo(mountSubfolder)); GVFSHelpers.SaveDiskLayoutVersion(this.Enlistment.DotGVFSRoot, majorVersionNum.ToString(), minorVersionNum.ToString()); this.Enlistment.MountGVFS(); } // Ported from ProjFS's BugRegressionTest [TestCase] [Category(Categories.WindowsOnly)] public void ProjFS_CMDHangNoneActiveInstance() { this.Enlistment.UnmountGVFS(); using (SafeFileHandle handle = NativeMethods.CreateFile( Path.Combine(this.Enlistment.RepoRoot, "aaa", "aaaa"), GenericRead, FileShare.Read, IntPtr.Zero, FileMode.Open, FileFlagBackupSemantics, IntPtr.Zero)) { int lastError = Marshal.GetLastWin32Error(); handle.IsInvalid.ShouldEqual(true); lastError.ShouldNotEqual(0); // 0 == ERROR_SUCCESS } this.Enlistment.MountGVFS(); } private void MountShouldFail(int expectedExitCode, string expectedErrorMessage, string mountWorkingDirectory = null) { string enlistmentRoot = this.Enlistment.EnlistmentRoot; // TODO: 865304 Use app.config instead of --internal* arguments ProcessStartInfo processInfo = new ProcessStartInfo(GVFSTestConfig.PathToGVFS); processInfo.Arguments = "mount " + TestConstants.InternalUseOnlyFlag + " " + GVFSHelpers.GetInternalParameter(); processInfo.WindowStyle = ProcessWindowStyle.Hidden; processInfo.WorkingDirectory = string.IsNullOrEmpty(mountWorkingDirectory) ? enlistmentRoot : mountWorkingDirectory; processInfo.UseShellExecute = false; processInfo.RedirectStandardOutput = true; ProcessResult result = ProcessHelper.Run(processInfo); result.ExitCode.ShouldEqual(expectedExitCode, $"mount exit code was not {expectedExitCode}. Output: {result.Output}"); result.Output.ShouldContain(expectedErrorMessage); } private void MountShouldFail(string expectedErrorMessage, string mountWorkingDirectory = null) { this.MountShouldFail(GVFSGenericError, expectedErrorMessage, mountWorkingDirectory); } private class MountSubfolders { public const string MountFolders = "Folders"; public static object[] Folders { get { // On Linux, an unmounted repository is completely empty, so we must // only try to mount from the root of the virtual path. if (RuntimeInformation.IsOSPlatform(OSPlatform.Linux)) { return new object[] { new object[] { string.Empty } }; } else { return new object[] { new object[] { string.Empty }, new object[] { "GVFS" }, }; } } } public static void EnsureSubfoldersOnDisk(GVFSFunctionalTestEnlistment enlistment, FileSystemRunner fileSystem) { // Enumerate the directory to ensure that the folder is on disk after GVFS is unmounted foreach (object[] folder in Folders) { string folderPath = enlistment.GetVirtualPathTo((string)folder[0]); folderPath.ShouldBeADirectory(fileSystem).WithItems(); } } } } }
{ "pile_set_name": "Github" }
In an interview with Meet the Press moderator Chuck Todd, former Secretary of State reveals she learned about the Bill Clinton-Loretta Lynch "secret meeting" through the news: "Well, I learned about it in the news," Clinton told Todd in an interview broadcasted on Sunday's Meet the Press. "And it was a short, chance meeting at an airport tarmac. Both of their planes, as I understand it, were landing on the same tarmac at about the same time, and the attorney general's husband was there, they said hello, they talked about grandkids, which is very much on our minds these days, golf, their mutual friend, former Attorney General Janet Reno, it was purely social." "They did not veer off of speaking about those kinds of very common exchanges," Clinton assured.
{ "pile_set_name": "OpenWebText2" }
Definition and classification of abnormal vaginal flora. Studying the vaginal microflora is not only fascinating, with many discoveries to be made, it is also a very practical way to help women get rid of bothersome and sometimes dangerous infections. Gram-stained vaginal preparations, Pap smears, specific cultures, and nucleic acid detection techniques can be used to diagnose the constituents of the vaginal flora, but in trained hands office-based microscopy of a fresh vaginal smear, preferably using a x400 magnification phase-contrast microscope, allows almost every diagnosis and combination of diagnoses imaginable. In this chapter I will address the pros and cons of the tools that are in use to study vaginal flora, and discuss the different types of bacterial flora and the difficulties encountered in reaching the correct diagnosis of pathological conditions. The 'intermediate flora' is addressed separately, and a new entity--'aerobic vaginitis'--is discussed. Future research should focus on the interaction between infecting microorganisms and host defence mechanisms, as both together generate the pathogenicity of these conditions.
{ "pile_set_name": "PubMed Abstracts" }
Tag Archives: children The local newspaper had an article about a concert called orKIDstra. It combined building both literacy skills and enthusiasm for classical music in preschoolers. I wondered if it is strictly a local program, or something larger. Yes, sort of, to both questions. The Greensboro Symphony Orchestra has called its outreach to pre-school students “orKIDstra” for more than 15 years. Its emphasis and structure have changed a few times. It has used current combination of percussion ensembles and children’s books for about five years. A web search found classical music programming for children called orKIDstra in three different countries. Besides the … Continue reading → Young people these days can’t be pried away from their cell phones. They’re lazy and undisciplined. At least, that’s the prevailing stereotype. Classical music is just about dead according to obituaries that seem to appear in magazine articles and well-read blogs every year. No one cares about such old-fashioned music except an increasingly aging population. At least, that’s the prevailing stereotype. Don’t be fooled. Youth orchestras all over the country (and all over the world, for that matter, in case the stereotypes cross international borders) work very hard to polish performances of the standard orchestral repertoire. They love the music, … Continue reading → Ordinarily when I write program notes, I focus on a single piece. Since this year marks Benjamin Britten’s 100th birthday, it seems appropriate to widen the focus and look at The Young People’s Guide to the Orchestra within the context of Britten’s life at the time he composed it. His opera Peter Grimes becomes a very important part of the story. Benjamin Britten started composing at the age of 5. When he was 11 he met Frank Bridge at the Norwich Music Festival and became his pupil. Beside excellent technical skill, he learned about musical developments in Europe. When he … Continue reading → What picture do you suppose many people associate with “string quartet”? A bunch of old white men dressed like penguins playing stodgy old music for a few people who have learned to hold it in awe? Children don’t know that. When they hear a string quartet, or any kind of classical music, they love it. I got a chance to witness it in person at one of the Eastern Music Festival’s “EMF Encircling the City” concerts. Greensboro violist and EMF faculty member Diane Phoenix-Neal conceived and started the series three years ago as part of the celebration of the festival’s … Continue reading → In an argument already almost two centuries old, some people claim that classical music is stuffy, old fashioned, and appeals only to a cultural elite. Popular music is new, up to date, and broad based. Opera seems to appeal only to a subset of the aging classical music crowd. School children know nothing of such philosophical arguments. They only know what they like. They like classical music, and even opera, just fine. I have written several posts about distinctions between classical and popular music, but I’d like to use “popular” in a broader sense for a while. It’s something a … Continue reading → Last March I wrote Children and classical music, which featured Charlie Loh, a professional conductor’s five-year-old son conducting Rite of Spring. The proud father also mounted a video of Charlie conducting something else when he was only four. Charlie got off to a good start then, but made remarkable progress by the time he was five! Lately, a video of a three-year-old, identified only as Jonathan, conducting the finale to Beethoven’s Fifth Symphony has been making the rounds. There are 10 videos in all (as of today) of Jonathan either playing violin or conducting something. I see he showed interest … Continue reading → My parents–my father especially–love classical music. When I was growing up, Dad always had a record on whenever he had a chance to relax. It wasn’t always classical music. He had lots of Broadway musicals and big band jazz in his collection, too. I’ve always figured that’s why I grew up loving that music, although I never shared his enthusiasm for opera. I have a much younger sister, and I can remember her first record player. Her record collection mostly consisted of the horrible songs intended for children. I can hear some of the horrible, sloppy performances of them even … Continue reading →
{ "pile_set_name": "Pile-CC" }
![](edinbmedj73803-0093){#sp1 .971} ![](edinbmedj73803-0094){#sp2 .972}
{ "pile_set_name": "PubMed Central" }
The country's environmental watchdog has criticised the government's landmark environmental report released last year, saying it gives no diagnosis on the health of the environment. Photo: ©Office of the Parliamentary Commissioner for the Environment Parliamentary Commissioner for the Environment Jan Wright has released her commentary on Environment Aotearoa 2015, the government's first state of the environment report in eight years, which was a collaboration between the Ministry for the Environment and Statistics New Zealand. - Read the original report here (PDF 8.66MB) Dr Wright's commentary said the point of reporting on the environment was to improve the way it is managed and to protect it, but that the government's report did not achieve that. "It does not give perspective on the seriousness of different environmental issues. A state of the environment report cannot do this without including forward thinking." Dr Wright said the need for forward thinking was crucial to facing climate change, the most serious environmental issue of all. Her commentary noted relevant information must be presented in these reports, otherwise they could be misinterpreted - for instance, the original report showed New Zealand's greenhouse gas emissions were relatively low globally. "This could be taken to indicate that it is pointless to try to reduce them," Dr Wright's report said. Dr Wright said a figure showing the country's emissions per capita would convey an entirely different impression. Another issue raised was the scientific explanation within the report. Dr Wright said a state of the environment report should be "built on a bedrock of scientific understanding that is based on a weight of evidence and communicated clearly." She said the report's explanation of climate change was particularly problematic, and that it should clearly have stated that sea level rise was due to the expansion of warming waters, and the melting of glaciers and ice sheets, rather than stating that it was "probably due" to these. The report made six recommendations including that the Secretary for the Environment Vicky Robertson prepare a report for Minister for the Environment Nick Smith outlining actions to be taken in response to Environment Aotearoa 2015 and Dr Wright's commentary, and make this publicly available. Environmental challenges Atmosphere - At the moment there is no basis for thinking the problem is reversible and according to Dr Wright, "there is no question that climate change is by far the most serious environmental issue we face. Moreover, it will have big impacts on virtually every other aspect of our environment". Marine- The marine environment is already being affected by climate change and most troubling, according to Dr Wright, is ocean acidification which she said was irreversible. She cautioned that it would lead to marine foodwebs being undermined and that in warmer seas there was less oxygen which would mean many species would not thrive. Human activities were also putting stress on the marine environment, including run-off from land which damages marine habitats around the coast and Dr Wright said there was also much that was not known about the effect of fishing on the sustainability of ecosystems. Dr Wright said New Zealand needed to do more to protect ocean reserves. Land- erosion and pests are the two big issues for land. Dr Wright said a legacy of erosion exists after a century of clearing bush on unstable hill country, resulting in an enormous amount of topsoil being washed into waterways, a pattern which continues today. Climate change is projected to bring more intense and frequent heavy downpours which will exacerbate the problem. "An eroded area will tip into another state when plants cannot re-establish because so much fertility has been lost," Dr Wright's report said. Native flora and fauna were especially vulnerable to pests and extinction is irreversible. Dr Wright said possums, rats and stoats were particularly destructive and pervade almost all of the country's forests. Dr Wright said while she was heartened by this year's biggest-ever pest control operation, the Battle for Our Birds operation, "more is needed to win the war against predators". Fresh water - Dr Wright said national averages of water quality were meaningless and that in pockets of the country water quality had declined markedly in many places. Sediment and nutrient pollution degrade water quality and lakes are particularly vulnerable because they are more contained. Dr Wright said conversion of sheep country and forests to dairy land had greatly increased nitrogen in fresh water, which was being compounded by changes in farming practices such as spraying and fencing. This was creating a 'load to come' - the nitrate in groundwater which was slowly making its way to bodies of water such as Lake Taupo.
{ "pile_set_name": "OpenWebText2" }
For Me and My Gal (film) For Me and My Gal is a 1942 American musical film directed by Busby Berkeley and starring Judy Garland, Gene Kelly – in his film debut – and George Murphy, and featuring Martha Eggerth and Ben Blue. The film was written by Richard Sherman, Fred F. Finklehoffe and Sid Silvers, based on a story by Howard Emmett Rogers inspired by a true story about vaudeville actors Harry Palmer and Jo Hayden, when Palmer was drafted into World War I. The film was a production of the Arthur Freed unit at MGM. Plot In the heyday of vaudeville, on the verge of America's entrance into World War I, two talented performers, Jo Hayden (Judy Garland) and Harry Palmer (Gene Kelly), set their sights on playing the Palace Theatre on Broadway, the epitome of vaudeville success, and marrying immediately after. Just weeks before their plans are to be realized Harry gets a draft notice. Intending to obtain a short delay before reporting for duty, he intentionally smashes his hand in a trunk. That same day Jo is notified that her brother, who had been studying to be a doctor, has died in the war. When she realizes what Harry has done, she rejects him and leaves the act. Harry then tries to undo his rash act and enlist, but none of the armed services will take him as his hand has been permanently crippled. Eventually he resigns himself to participating in the war effort the only way left open to him, entertaining front line troops for the YMCA. When he and his partner find themselves dangerously close to the front, Harry heroically sets out to warn off an ambulance convoy heading into an artillery bombardment. He is wounded while destroying an enemy machine gun emplacement ambushing the convoy and is apparently commended for his bravery. After the war, during a victory performance at the Palace Theatre, Jo sees Harry in the audience and runs to him. The two reunite on stage to sing "For Me and My Gal", the first song they ever performed together. Cast Judy Garland as Jo Hayden Gene Kelly as Harry Palmer George Murphy as Jimmy K. Metcalf Martha Eggerth as Eve Minard, singer Ben Blue as Sid Simms, Jimmy's second banana Stephen McNally as Mr. Waring, manager of the Palace Theatre Robert Homans as New York Palace Doorman (uncredited) Lucille Norman as Lily Duncan (uncredited) Edward Peil Sr. as Jim (uncredited) Richard Quine as Danny Hayden, Jo's brother (uncredited) Addison Richards as France Doctor (uncredited) Keenan Wynn as Eddie Milton, theatrical agent (uncredited) Songs Although directed by Busby Berkeley, For Me and My Gal does not have any of Berkeley's signature large-scale production numbers in it. The songs included in the film are performed as they might have been on the vaudeville stage, choreographed by Bobby Connolly. "Oh, You Beautiful Doll", music by Nat D. Ayer, lyrics by A. Seymour Brown, additional lyrics by Roger Edens performed by George Murphy, Judy Garland and others "For Me and My Gal", music and lyrics by George W. Meyer, Edgar Leslie and E. Ray Goetz, performed by Gene Kelly and Judy Garland "When You Wore a Tulip and I Wore a Big Red Rose", music by Percy Wenrich, lyrics by Jack Mahoney, performed by Kelly and Garland "After You've Gone", music by Turner Layton, lyrics by Henry Creamer, sung by Judy Garland. "Ballin' the Jack", music by Chris Smith, lyrics by Jim Burris, sung and danced by Kelly and Garland. "Till We Meet Again", music by Richard A. Whiting, lyrics by Raymond B. Egan, sung by Eggerth and the ensemble. The film also contains portions of a number of songs popular during World War I, including "By the Beautiful Sea", "There's a Long, Long Trail", "How Ya Gonna Keep 'em Down on the Farm (After They've Seen Paree)?", "Where Do We Go from Here, Boys", "It's a Long Way to Tipperary", "Good Bye Broadway, Hello France", "(There are) Smiles (That Make Us Happy)", "Oh! Frenchy", "When Johnny Comes Marching Home Again" and "Pack Up Your Troubles in Your Old Kit-Bag, and Smile, Smile, Smile". Two additional songs were intended to be included: "Spell of the Waltz", which was to be performed by Marta Eggerth and a male chorus and "Three Cheers for the Yanks", written by Ralph Blane and Hugh Martin. Production For Me and My Gal marked the first real "adult" role for the nineteen-year-old Judy Garland, who had played juvenile parts until then, many of them opposite Mickey Rooney. The original script had called for Harry Palmer to be involved with two women, a singer, which was to be Garland's role, and a dancer, who would have most of the dramatic scenes, but Garland's acting coach Stella Adler, who was an advisor to MGM at the time, suggested to producer Arthur Freed that the two roles be combined, and that Garland be given the part. Adler also suggested Gene Kelly for the lead. Kelly was 29 years old at the time, and had made a mark on Broadway as the star of Pal Joey and the choreographer of Best Foot Forward. When David O. Selznick signed him to a film contract, Kelly's intention was to return to Broadway after fulfilling his contractual obligation, but he ended up staying in Hollywood for a year because Selznick didn't have a role for him. When Arthur Freed inquired about getting Kelly for For Me and My Gal, Selznick handed over the contract, and Kelly got the part, over the objections of Freed's bosses at MGM. The casting of Kelly meant that George Murphy, who was originally going to play "Harry Palmer", was switched to playing "Jimmy Metcalf". Gene Kelly and Judy Garland got along well – she had been in favor of his getting the part, and during shooting she helped Kelly adjust his stage acting for films, and backed him in disagreements with director Busby Berkeley, whom she did not like. Kelly and Garland went on to star together in two other films, The Pirate (1948) and Summer Stock (1950). The film was also the American motion picture debut of Hungarian singer Martha Eggerth, who had appeared in over thirty films in Germany. Her career in Hollywood did not last long: she appeared in only two other American films. For Me and My Gal had an estimated budget of $803,000, and was in production at MGM's Culver City studios from 3 April until 23 May 1942, with additional scenes shot in June. Working titles for the film while it was in production were "Me and My Gal" and "The Big Time". When the film was initially previewed, the audience was dissatisfied with the ending: they thought that Jo (Garland) should end up with Jimmy (Murphy) rather than Harry (Kelly). This prompted Louis B. Mayer to order three weeks of additional shooting to give Kelly's character more of a conscience and to reduce Murphy's presence in the film. Release and reception For Me and My Gal premiered in New York on 21 October 1942, and opened in Los Angeles on 26 November 1942. It grossed $4,371,000 (consisting of $2,894,000 in the US and Canada and $1,477,000 elsewhere), making it one of the big hits of the year. The studio earned a profit of $2,098,000. For Me and My Gal was released on VHS in the US on August 1988 by MGM/UA Home Video (#M201379) and on DVD on April 6, 2004 by Warner Home Video. Awards and honors The film received a nomination for the Academy Award for Best Score for Roger Edens (musical adaptation) and Georgie Stoll (musical direction). In addition, Gene Kelly received a "Best Actor" award from the National Board of Review for his performance. The film is recognized by American Film Institute in these lists: 2004: AFI's 100 Years...100 Songs: "For Me and My Gal" – Nominated 2006: AFI's Greatest Movie Musicals – Nominated References Notes External links The Judy Garland Online Discography "For Me And My Gal" pages. The Judy Room filmography "For Me And My Gal" page. For Me and My Gal on Screen Guild Theater: March 22, 1943 Category:1942 films Category:1940s musical films Category:American films Category:American musical films Category:American black-and-white films Category:Western Front (World War I) films Category:Films set in 1916 Category:Films set in the 1910s Category:Metro-Goldwyn-Mayer films Category:Films directed by Busby Berkeley Category:Films produced by Arthur Freed Category:Films scored by Georgie Stoll
{ "pile_set_name": "Wikipedia (en)" }
The Third Estate Sunday Review focuses on politics and culture. We're an online magazine. We don't play nice and we don't kiss butt. In the words of Tuesday Weld: "I do not ever want to be a huge star. Do you think I want a success? I refused "Bonnie and Clyde" because I was nursing at the time but also because deep down I knew that it was going to be a huge success. The same was true of "Bob and Carol and Fred and Sue" or whatever it was called. It reeked of success." Monday, September 07, 2015 TV: Casting and Concept Casting is everything. We're not the first to say it but didn't summer TV demonstrate it? Certainly, it did for ABC. Casting killed not one but two of their summer shows. Barry Sloane being given the lead role in THE WHISPERS guaranteed that all the strong work by Milo Ventimiglia and others would be ignored and that, week after week, the audience would dwindle. Sloane had previously sent viewers fleeing from REVENGE so ABC should have known better. But when does ABC ever know better? MISTRESSES was a summer concoction which brought in an average of at least four million viewers for each of its first two seasons. For whatever reason, ABC agreed to film the third season in Canada -- the United States of America's apparently not good enough for the American Broadcasting Company under Disney management -- and series star Alyssa Milano bowed out. That should have immediately caused ABC to rethink the move. Instead, it was full steam ahead. And it only got worse. Tiny Alyssa Milano was replaced with Jennifer Esposito who brings to mind the worst of Candice Bergen's film career. Esposito can't be a lead actress -- her entire career argues that -- from SPIN CITY all the way to BLUE BLOODS. She's also can't by tiny. And dressing her in the sort of garb Bette Midler wore in STELLA -- and wore to look ridiculous -- just made Esposito more of an oddity. The third season saw the show posting record lows for viewership. If there's to be a fourth season of MISTRESSES, the only reason would be to rescue the show by bringing Alyssa Milano back. Getting better ratings was ABC's THE ASTRONAUT WIVES CLUB but ABC's already taken the axe to that show announcing there will be no second season. The casting there was the concept. Sometimes the casting is a place (think Robert Altman's classic film NASHVILLE) or an idea or a concept. THE ASTRONAUT WIVES CLUB's casting was concept. The same is true of CBS' latest summer hit, James Patterson's ZOO which posted excellent numbers early on but still held its own when the ratings declined. ZOO isn't about acting -- not even with James Wolk in the cast. Instead, the show's all about high concept. That was true of UNDER THE DOME as well. And by season two, the audience was fleeing so CBS became desperate to plug the leaks with actual actors -- hence the arrivals of Marg Helgenberger and Eriq La Salle. And that's the problem when casting is concept. What works one summer seems tired the next. EXTANT has held steady for CBS. Maybe because the series stars Halle Berry? Maybe because the show attempts to move forward with each season and shake things up? Maybe for both of those reasons and so much more? Maybe because a real star like Halle Berry remains a rarity? Watch Jimmy Fallon chat up one ridiculous person night after night throughout the week and grasp just how few stars there really are today. Celebrities feed the tabloids, yes. They just don't draw in audiences for anything other than their tacky real life -- or 'real' life -- antics. David Duchovny is a TV star. That's why AQUARIUS worked as an online entity and as an NBC broadcast entity (and why the show will have a second season). It's why Fox is doing a six-episode update of THE X-FILES. Sometimes a show can have it all: strong casting, action, romance, you name it. The CW found itself with just such a show in BEAUTY & THE BEAST. In an inspired move, they chose to air season three in the summer. And the result? Ratings as strong as their fall 2014 and spring 2015 JANE THE VIRGIN -- ratings also stronger than BEAUTY & THE BEAST had in season two.. And, unlike on JANE THE VIRGIN, when Jay Ryan (Vincent) and Kristin Kreuk (Cat) exchange a look, it carries heat and meaning. Fox had something similar in its limited run series WAYWARD PINES starring Matt Dillon, Juliette Lewis, Terrence Howard, Melissa Leo and Carla Gugino among others. The show proved that the mini-series format survives. Other things were proved as well. First of all, Netflix is now the premier network. In May, as broadcast networks were winding down their regular programming, Netflix began serving up original series: GRACE AND FRANKIE, SENSE8 and WET HOT AMERICAN SUMMER: FIRST DAY OF CAMP among others. It is now the benchmark for summer programming. And though Hulu has failed to challenge that standing, in good news for the streaming service, they finally got their own original program worth watching in DIFFICULT PEOPLE. It was a solid summer of programming in many ways. But we will repeat the objection we made before the summer programming started: CBS, NBC, ABC, Fox and The CW all putting the bulk of their summer programming on Thursday nights was a mistake. Some of the ratings erosion returning shows faced could have been avoided if the networks had spaced their original programming throughout the week because, after casting, scheduling is everything. Search This Blog Third Estate Sunday Review About Me Jim, Dona, Jess, Ty, "Ava" started out this site as five students enrolled in journalism in NY. Now? We're still students. We're in CA. Journalism? The majority scoffs at the notion. From the start, at the very start, C.I. of The Common Ills has helped with the writing here. C.I.'s part of our core six/gang. (C.I. and Ava write the TV commentaries by themselves.) So that's the six of us. We also credit Dallas as our link locator, soundboard and much more. We try to remember to thank him each week (don't always remember to note it here) but we'll note him in this. So this is a site by the gang/core six: Jim, Dona, Ty, Jess, Ava and C.I. (of The Common Ills).
{ "pile_set_name": "Pile-CC" }
Researchers at Johns Hopkins University believe robots could learn a thing or two from nature's most adaptable pest — the cockroach. The insect can navigate almost any terrain, thanks to over 300 million years of evolution. Scientists filmed the cockroaches running obstacle courses and captured their movements using high-speed cameras. The footage was then analyzed and adapted for a six-legged robot to repeat the movements. Researchers hope this work can eventually be used in search and rescue missions during natural disasters.
{ "pile_set_name": "OpenWebText2" }
Q: What is being said in the purely Native American language scenes in Jim Jarmusch’s “Dead Man?” While Jim Jarmusch’s film Dead Man (1995) is a 19th century American period piece that contains mostly American English dialogue, there are a few scenes in the film that are spoken purely in Native American languages without translation or subtitles. As explained on Wikipedia; bold emphasis is mine: The film is also notable as one of the rather few films about Native Americans to be directed by a non-native and offer nuanced and considerate details of the individual differences between Native American tribes free of common stereotypes. The film contains conversations in the Cree and Blackfoot languages, which were intentionally not translated or subtitled, for the exclusive understanding of members of those nations, including several in-jokes aimed at Native American viewers. The Native character was also played by an Indigenous American actor, Gary Farmer, who is a Cayuga. That all sounds fine. But does any translation of the dialogue exist anywhere? A: Okay, I found a post on Reddit from 2015 that essentially asks the same question as this question. And there is an answer there that provides translation of some of the dialogue, but it is in a PDF format. So I am posting that translation here as plain text—with some copy edits and formatting tweaks—so it’s easier to read. Here is the scene with “Nobody” and his girlfriend translated by Dorothy Thunder from the University of Alberta from Cree to English: Girlfriend: Tâp’we cî ôma ewînakasiyan? (Is it true that you are going to leave me?) Nobody: Nîcimos! (My sweetheart!) Girlfriend: Ketweyan kîya esaweyimikâsot maskwa mâka ki-tâpwem kîminîcâkanis! (You say you are a gifted/blessed bear but a true/real bastard. I pray here to night moon every night you to have a child but you don’t agree to it. This is not me — I am still young and kind — you dick/penis!) Nobody: Nîcimos! (My sweetheart!) Girlfriend: Nikiskeyihten, nikiskeyihten keyâpic ka-nitaweyimin! Ekosi! (I know, I know that you will still want me! That’s it!) Nobody: Nîcimos! (My sweetheart!) Girlfriend: Awas! (Get out of here! / Get lost!) Nobody: Ceskwa! Nîcimos, ceskwa! (Wait! My sweetheart, wait!) And here is info on the scenes in the Makah Village near the end of the film translated by Maria Parker Pascua and according to her those scenes are in the Makah language and the tribes mentioned were Cree and Blackfoot. Leaving in some descriptions for context from the translator: The 6th scene has Makah words when they arrive by canoe on the Columbia River to a Native Village. Nobody: Hello! Is that you folks, my Makah people (A form of greeting in Makah). I am Nobody. The next part is not as clear, but it sounds like he is continues on to say something like: Nobody: Needing an Indian Doctor (Shaman/Healer). Nobody: Give. (Like give help or maybe give them the sick man?) The last scene with Native language is also Makah, but the first part sounds a little clipped. Nobody: Hello! Is that you folks? (A form of greeting in Makah). It’s a nice day! And a village man answers him with: Village Man: Yes. It is a nice day.
{ "pile_set_name": "StackExchange" }
Penile and sexual rehabilitation in a patient with lymphedema of the penis. The aim of this study is to report on penile rehabilitation in lymphedema of the penis with a new compression mechanism and the implantation of a penile prosthesis for sexual rehabilitation. The case of a 72-year-old patient with a history of edema of the penis for 6 years is reported. The patient reported that he had had periods of edema and redness and that the swelling had worsened over time. A clinical diagnosis of lymphedema of unknown etiology was made; the hypotheses were that the etiology was late congenital lymphedema of the penis or lymphedema aggravated by inflammation and/or infection. A new compression mechanism made using a cotton-polyester fabric (low elasticity and ribbed) was employed. The continued use of compression therapy led to almost complete reduction of the edema and the patient tried to return to be sexually active. A specific medication was used for erectile dysfunction; however, it resulted in no improvement and so a penile prosthesis was implanted.
{ "pile_set_name": "PubMed Abstracts" }
Hello, we are doing a clean up in Due February 2009 and if you would like to stay in the group you need to stop by and respond to the announcement about it by tomorrow. If you are removed you can always reapply later. We hope you stop by. Thanks and have a great day!
{ "pile_set_name": "Pile-CC" }
Links Tuesday, October 09, 2012 Mr. Manners Booing is wrong, and people who do it are bad, bad, bad! So sayeth the Shank, who in a way reminiscent of Miss Manners, expresses his distaste for the fans' lack of civility and his manlove for a Chief lineman who criticized the crowd for piling on after Matt Cassel was knocked out of the game. Now, let's get one thing straight: The Chiefs fans weren't actually cheering because Cassel got hurt; they were cheering because he would no longer be in the game, manning a club that has gone 22-31 since his arrival from New England prior to the 2009 season. They had a point: Cassel's QB rating is a pedestrian 81% for his career, a mark he's topped only once in the four seasons he's helmed the Chiefs. But this is where The CHB's hypocrisy switched into overdrive: "I’ve certainly done my share of tweaking and exposing professional athletes or organizations who don’t give an honest effort to live up to their contracts or fulfill the team-fan accord." Would that be "tweaking" like when he called David Ortiz a sad sack of you-know-what? Was it tweaking when he called Carl Everett "the Ebola virus of the Boston clubhouse?" Or when he wrote “We have rejoiced in the retirement of Keith Foulke?” Would that be "exposing" when he wrote, "Why does America hate Barry Bonds so much? Is it because he's too good?" all while neglecting to mention Bonds' PED use for another five years. Was that exposing when he accused Manny Ramirez, the previous season's World Series MVP, of quitting on the team during a month where he put up a .930 OPS and 6 HRs in 24 games? No, that would just be the Holy Cross Hypocrite, doing what he does best. And Shank like the other pseudo-moralistic wannabes will never get it; that it's not his place to be the sole arbiter of what is proper in sports or society. Matt Cassel has been a failure and he DESERVED to get booed off the field. Eric Winston had no right to defend Cassel because he knows his quarterback was a one-shot wonder in New England who couldn't sustain anything once he got to Kansas City. Typical Shank. It's why my love of 98.5 has declined somewhat; they need better people than Shank, Felger, Spazz, and the NY-Miami import Amedolara - how about Levan Reid and Steve Burton instead?
{ "pile_set_name": "Pile-CC" }
A kinetic study of biohydrogen production from glucose, molasses and cheese whey by suspended and attached cells of Thermotoga neapolitana. Batch tests of H2 production from glucose, molasses and cheese whey by suspended and immobilized cells of Thermotoga neapolitana were conducted to develop a kinetic model of the process. H2 production was inhibited by neither H2 (up to 0.7 mg L(-1)) nor O2 (up to 0.2 mg L(-1)). The H2 specific rates obtained at different substrate concentrations were successfully interpolated with Andrew's inhibition model. With glucose and molasses, biofilms performed better than suspended cells. The suspended-cell process was successfully scaled-up to a 19-L bioreactor. Assays co-fed with molasses and cheese whey led to higher H2 productivities and H2/substrate yields than the single-substrate tests. The simulation of the suspended-cell continuous-flow process indicated the potential attainment of H2 productivities higher than those of the batch tests (up to 3.6 mmol H2 h(-1) L(-1) for molasses and 0.67 mmol H2 h(-1) L(-1) for cheese whey) and allowed the identification of the optimal dilution rate.
{ "pile_set_name": "PubMed Abstracts" }
Viktor Franzl Viktor Franzl (born 27 July 1892, date of death unknown) was an Austrian athlete. He competed in the men's long jump and the men's pole vault at the 1912 Summer Olympics. References Category:1892 births Category:Year of death missing Category:Athletes (track and field) at the 1912 Summer Olympics Category:Austrian male long jumpers Category:Austrian male pole vaulters Category:Olympic athletes of Austria Category:Place of birth missing
{ "pile_set_name": "Wikipedia (en)" }
Sunday, October 16, 2016 My Famous Mabies I received a call at the office a couple of months ago from New York from Sherry Camhy, a journalist who was working on a story about mechanical pencils for Drawing Magazine. When she started poking around on the internet for some historical background, she ran smack into this blog and the mechanical pencil museum. I guess you can’t swing a dead cat around the internet without hitting me, if that’s what you’re looking form. Sherry was like a kid in a candy store, asking if she could use this picture in her article, then that one, then that one . . . unless she planned to fill the entire issue with excerpts from The Leadhead’s Pencil Blog, I knew she was going to have some difficulty prioritizing. Since my office is four minutes doorstep-to-doorstep from my home (one of the advantages to living in a small town), I offered to shoot some pictures specially for the occasion. Privately, I didn’t want her to use one of the embarrassingly bad pictures I’ve posted here over the years. Besides, I knew exactly which ones I was going to shoot for her. These were from New York, and three of the four of them were already famous: I gave her a choice of the wood and marble backgrounds so she could take her pick, then shot a few closeups of the most over-the-top one: All but the bottom one in that first picture were part of a very special collection of Mabie Todd pencils and combos I purchased back in 2012 (The bottom example is the one from “Another Forgotten Corners at the Patent Office” published on December 7, 2015 at http://leadheadpencils.blogspot.com/2015/12/another-forgotten-corner-at-patent.html). The collection previously belonged to David Moak, author of Mabie in America, and all three were pictured in his book – when David decided it was time to let his collection go, then as now, you couldn’t swing a dead cat without finding me as a potentially interested party. These were the first out of Moak’s collection that I’ve photographed and published here. It wasn’t that David asked me not to . . . I just didn’t want to do anything that would hinder his book sales, since I know the joys of selling boxes and boxes full of books. Now David’s Mabie Todds have made it into print once again, in the pages of Drawing Magazine:
{ "pile_set_name": "Pile-CC" }
Q: What does "do sea on classes" mean? I see this sentence on https://twitter.com/jfbastien/status/1003697787911966720 A: I've made my submissions for @cpponsea, have you? B: Sorry, I only do Sea on Classes C: you can do classes on the sea at C++ on Sea - and in class, too Google tells me nothing: do sea do sea on class A: Its a joke, a pun based on the fact that C (the programming language) and "sea" sound the same. There is going to be a conference C++ on Sea, in a coastal town (some coastal towns have the suffix -on-sea, eg Southend-on-sea). The pun is then continued, as "on the sea" means in a boat; C++ has classes but C does not. So if you were programming in C++, in a classroom on a boat, while attending the conference you could be said to be doing "classes on the sea at C++ on Sea - and in class".
{ "pile_set_name": "StackExchange" }
Introduction ============ CTLs are crucial for the defense against many invading organisms and certain tumors. Presentation of antigenic peptides bound to MHC class I molecules is a prerequisite for stimulation of a CTL response, and therefore plays a pivotal role in providing CTLs with the capacity to respond to foreign antigens [1](#R1){ref-type="bib"}. Peptides that meet the restrictive binding characteristics of MHC class I molecules for presentation to CTLs are generated after intracellular protein degradation by cytosolic proteases. The central enzyme responsible for protein degradation is the proteasome [2](#R2){ref-type="bib"}. Because of their intimate involvement in antigen processing and presentation [3](#R3){ref-type="bib"}, detailed knowledge on the cleavage preferences of proteasomes will be crucial for understanding CTL epitope generation and thus, for the regulation of specific immune responses. The 20S proteasome represents the proteolytic core of the larger 26S proteasome complex that encompasses either one or two regulatory particles of at least 18 subunits [4](#R4){ref-type="bib"}. The eukaryotic 20S particle is composed of 14 different but related subunits organized in a barrel-shaped complex with the stoichiometry α~7~β~7~β~7~α~7~. Three subunits of the two inner β-rings (β1, β2, and β5) participate directly in peptide bond cleavage. They represent three distinct proteolytic activities, designated as the chymotrypsin (ChT)-like, trypsin-like, and peptidyl-glutamylpeptide--hydrolyzing (PGPH) activities [5](#R5){ref-type="bib"} [6](#R6){ref-type="bib"}. As the NH~2~-terminal threonine residues responsible for peptide bond cleavage do not prefer certain peptide bonds over others, the basis for the three distinct proteolytic activities most likely resides in the characteristics of the amino acids in the vicinity (pockets) of each active NH~2~-terminal threonine [7](#R7){ref-type="bib"}. Upon IFN-γ exposure of cells, the three active β-subunits that are constitutively expressed in 20S proteasomes can be replaced by three IFN-γ--inducible homologues, low molecular weight protein (LMP)-2 (=β1i) (for Y \[β1\]), multicatalytic endopeptidase complex--like (MECL)-1 (β2i) (for Z \[β2\]), and LMP-7 (β5i) (for X \[β5\]). Although there is extensive sequence homology, these replacements alter the nature of peptides that are generated by proteasomes [8](#R8){ref-type="bib"} [9](#R9){ref-type="bib"} [10](#R10){ref-type="bib"} [11](#R11){ref-type="bib"} [12](#R12){ref-type="bib"}. Proteasomes harboring these IFN-γ--inducible subunits are also called immunoproteasomes, as opposed to the constitutively expressed "constitutive" proteasomes, because immunoproteasomes were found to process a number of viral epitopes with greater efficacy in vitro [13](#R13){ref-type="bib"} [14](#R14){ref-type="bib"} [15](#R15){ref-type="bib"} [16](#R16){ref-type="bib"}. Using several artificial fluorogenic substrates in vitro, it was found that immunoproteasomes display a better capacity to cleave after hydrophobic and basic residues but are less well equipped for cleavage after acidic amino acids [17](#R17){ref-type="bib"}. The finding that proteasomes are responsible for the generation of the correct COOH terminus of several CTL epitopes [18](#R18){ref-type="bib"} [19](#R19){ref-type="bib"} and the notion that hydrophobic or positively charged amino acids serve in most cases as COOH-terminal anchor residues of MHC class I ligands led to the concept that immunoproteasomes contribute to more efficient MHC class I antigen processing. While this holds true for most viral antigens, recent studies have shown that some antigenic peptides are efficiently produced by constitutive proteasomes but cannot be generated by immunoproteasomes [20](#R20){ref-type="bib"}. This demonstrates that immunoproteasomes are not necessarily better suited for the processing of all MHC class I ligands. To better understand the reasons why certain MHC class I ligands are generated with greater efficiency and others with lower efficiency in cells expressing different sets of proteasomes, we have performed an in-depth analysis of peptide fragments generated after proteasomal cleavage. We have employed a strictly quantitative method to analyze a large collection of peptide fragments produced by either set of proteasome. Our observations allowed the identification of certain amino acids (or their characteristics) in positions distant, or directly flanking the cleavage sites selected by either set of proteasomes. The (quantified) mapping of cleavage sites using a large protein substrate provides the basis for a better understanding of proteasomal cleavage specificity, allowing a refined proteasomal cleavage prediction, which will be helpful for the identification of new CTL epitopes, the design of new (recombinant) vaccines, and for better insight into immunity against infection. Materials and Methods ===================== Purification of 20S Proteasomes. -------------------------------- 20S proteasomes were isolated as described previously [9](#R9){ref-type="bib"}. Frozen pellets of LCL-721 cells or LCL-721.174 cells were lysed in a buffer containing 0.1% Triton X-100 on ice and homogenized in a Dounce homogenizer. The 40,000× *g* supernatant of the lysate was bound to DEAE Sephacel. After elution, the protein fraction was concentrated and loaded onto a 10--40% sucrose gradient. After centrifugation, gradient fractions were tested for protease activity using the fluorogenic substrates succinyl-leucyl-leucyl-valyl-tyrosyl-7-amino-4-methylcoumarin (Suc-LLVY-AMC) and succinyl-tyrosyl-valyl-alanyl-aspartyl-7-amino-4-methylcoumarin (Suc-YVAD-AMC). Active fractions were pooled and further purified by anion exchange chromatography on a MonoQ HR5/5 FPLC column (Amersham Pharmacia Biotech). The purity of the proteasome preparates, checked by SDS-PAGE, was \>95%. Quantification of native proteasome protein was determined by a variation of the Lowry Method (protein assay; Bio-Rad Laboratories) and BSA as a standard. Immunoblotting. --------------- 5 μg of purified proteasome polypeptides were separated by 12% SDS-PAGE and transferred to polyvinyldifluoride (DuPont) with a semidry transfer system. Human LMP-7 was detected using a rabbit polyclonal antiserum in conjunction with chemiluminescence (PW8200; Affiniti Research Products, Ltd.). In Vitro Degradation of Enolase-1. ---------------------------------- 150 μg of yeast enolase-1 were incubated in digestion buffer (20 mM Hepes/KOH, pH 7.6, 2 mM MgAc2, and 0.01% SDS) with proteasomes at a molar ratio of 150:1. Digestions were stopped by freezing the samples at −80°C when ∼50% of the substrate was digested (usually after ∼48 h). Separation and Analysis of Cleavage Products. --------------------------------------------- For the separation of degradation products, unfractionated enolase digests were subjected to μRP SC 2.1/10 columns (Amersham Pharmacia Biotech) on a Microbore HPLC system (SMART; Amersham Pharmacia Biotech). Buffer A contained 0.1% trifluoroacetic acid; buffer B contained 0.081% trifluoroacetic acid and 80% acetonitrile. Gradients were 0% for 5 min, in 40 min to 40% in buffer B, in 8 min to 75% in buffer B, and up to 85% in another 7 min at a flow rate of 150 μl/min. Fractions were collected by peak fractionation with a maximal volume of 500 μl/peak. Peak fractions were dried and dissolved in 25 μl of 40% methanol, 1% formic acid, and subsequently analyzed by matrix-associated laser desorption ionization (MALDI) time of flight mass spectrometry (MS) (G2025A; Hewlett Packard) and NH~2~-terminal sequencing (Edman degradation) (pulsed liquid protein sequencer procise 494A; Applied Biosystems). Alternatively, peptides were analyzed on a hybrid quadruple orthogonal acceleration tandem mass spectrometer (Micromass). All these techniques were applied as described previously [21](#R21){ref-type="bib"}. Pmol amounts for each peptide detected in the HPLC fraction were determined by Edman sequencing and used for the quantitative analysis of the data. Statistical Analysis - Frequencies of Amino Acids. -------------------------------------------------- To detect statistically significant features in the amino acid distribution flanking the cleavage sites, we compared percent values using a classic chi-squared test for four tables (variance assumed due to counting). This method was used to compare constitutive and immunoproteasomes fragments with each other and with enolase. For a more thorough comparison of the absolute pmol amounts of constitutive and immunoproteasomes, we accounted for the experimental variability and, according to the quasilikelihood approach of Wedderburn et al. [22](#R22){ref-type="bib"}, assumed a mean variance structure. We assumed the variance to be proportional to the mean and fitted the proportionality constant α from all the data. Then, the usual chi-squared test variable was scaled by 1/α, which led asymptotically to a test variable that is chi-squared distributed with one degree of freedom. The results of the latter was a more thorough approach correlated to the approach neglecting experimental variability and using percent values. Only chi-squared values \>3.841 are considered to be significant. Statistical Analysis - Comparison of Amino Acid Characteristics. ---------------------------------------------------------------- To compare the characteristics of amino acids, the observed frequencies of amino acids at P6 to P6′ around cleavage sites in both proteasomes were compared with each other using the chi-squared test. Hydrophobicity, bulkiness, and flexibility characteristics [21](#R21){ref-type="bib"} of both proteasomes and enolase were compared by translating the percentage of amino acids found to the corresponding hydrophobicity, bulkiness, and flexibility scales. This resulted in spectra per cleavage site, and these were compared by means of regression analysis. Mice, CTL Assays, and Skin Grafting. ------------------------------------ LMP-7^−/−^ mice were generated as described previously [23](#R23){ref-type="bib"} and maintained at the animal facilities of the Basel Institute for Immunology or the Institute for Cell Biology. C57BL/6 mice were obtained from Charles River Laboratories. RMA and RMA-S cells were cultured in RPMI 1640 containing 10% FCS, 2-Me, [l]{.smallcaps}-glutamine, and antibiotics. CTLs were generated by intraperitoneal immunization of mice with 10^7^ irradiated spleen cells (33Gy) in 300 μl PBS. 10 d later spleens were removed and the splenocytes were stimulated with irradiated spleen cells (33Gy). CTL lines were generated by weekly restimulations with irradiated spleen cells as described previously [24](#R24){ref-type="bib"}. CTL assays were performed as described previously [24](#R24){ref-type="bib"} using RMA, RMA-S, and concanavalin A blasts of spleen cells as target cells. In addition, CTL lines were tested on the LMP-7^−/−^ cell line BII-103 (unpublished data) and BII-103 transfected with LMP-7 wild-type and LMP-7 T1A DNA. The LMP-7 gene was cloned from a 129/Ola cDNA using oligonucleotides 5′ AGGATCCACCATGGCGTTACTGGATCTGTGCGG (with BamH1 site at the 5′ end) and 3′ TGAATTCTCACAGAGCGGCCTCTC (with EcoR1 site at the 3′ end). The DNA fragment was then digested with EcoR1 and BamH1 endonucleases and cloned into similarly digested LZRSpBMN-linker-IRES-green fluorescent protein plasmid (unpublished data). Mutagenesis of LMP-7 to replace T by A at position 1 (in the processed subunit) was done using oligonucleotides 5′ GGCCCACGGCGCAACCACACTCGCC and 3′ GGCGAGTGTGGTTGCGCCGTGGGCC. LMP-7 wild-type and LMP-7 T1A expressing retroviral vectors were transfected into packaging cell lines and supernatants were used to infect the LMP-7^−/−^ cell line BII-103. After appropriate selection, comparable LMP-7 wild-type and LMP-7 T1A transcription was detected by Northern blot analysis and comparable green fluorescent protein expression by FACS^®^ analysis (FACSCalibur™; Becton Dickinson). Skin grafts were performed on the back of the mice. Pieces of skin (∼7 mm of diameter) were obtained with a punch from the back of shaved donors and grafted onto anesthesized recipients where holes had also been made with a punch. Each animal had two separated grafts, foreign and autologous, as an experimental control. The skin was discreetly glued (histoacryl; B. Braun Surgical AG) and bandaged. After a week, the bandage was removed to allow the observation of the putative graft rejection. Results ======= Isolation of Proteasomes. ------------------------- Proteasomes were isolated from EBV-transformed B cells. Constitutive proteasomes were purified from cells (LCL-721.174) lacking LMP-2 and LMP-7 due to a chromosomal deletion in the MHC locus [20](#R20){ref-type="bib"} [25](#R25){ref-type="bib"}. The lack of LMP-2 excludes the incorporation of MECL-1 in 20S proteasomes. Therefore, this cell line contains only proteasomes carrying active constitutive subunits [26](#R26){ref-type="bib"}. The immunoproteasome preparation was isolated from the parental line (LCL-721) that served for the generation of LCL-721.174. As expected, only proteasomes isolated from LCL-721 cells expressed immuno subunits, as exemplified by the presence of LMP-7 ([Fig. 1](#F1){ref-type="fig"}, a and b). Moreover, these proteasomes showed a reduced ability to release fluorogenic groups linked to acidic amino acids compared with proteasomes isolated from LCL-721.174 cells (data not shown). Together, these data indicate that proteasomes purified from LCL-721, although containing some constitutive proteasomes, behave like immunoproteasomes with very little PGPH activity, whereas LCL-721.174--derived proteasomes can be classified as constitutive proteasomes with high PGPH activity. Digestion of Enolase. --------------------- Although the ability of constitutive and immunoproteasomes to cleave a set of standard fluorogenic substrates or some CTL epitope containing peptides has been well documented, little is known about the selection of cleavage sites during the degradation of proteins, especially on a quantitative basis. To obtain further insight into these cleavage preferences, we used the complete protein enolase-1 from yeast as substrate which can be digested by proteasomes in vitro without prior modifications. Enolase is a 436 amino acid--long protein in which the frequency of amino acids resembles the average amino acid frequency in proteins [27](#R27){ref-type="bib"}. Digestion of enolase was performed by incubation of enolase with constitutive or immunoproteasomes at a molar ratio of 150:1. The reaction was stopped when ∼50% of the substrate was degraded to ensure comparable substrate turnover. This degree of degradation was obtained after 48 h, indicating similar rates of digestion for both constitutive and immunoproteasomes. Subsequently, enolase fragments were separated by reverse-phase HPLC. Comparison of two independent digests obtained after incubation with two independent constitutive proteasome batches revealed that highly comparable degradation profiles were obtained. The generation of similar degradation products was confirmed by MALDI-MS analyses of several fractions that eluted at the same time (data not shown). After having established the reproducibility of the digestion profiles, the peptide fragments in all fractions were analyzed by MALDI-MS, in combination with Edman degradation, and compiled in a digestion map ([Fig. 2](#F2){ref-type="fig"}). Approximately 50% of cleavages generated by constitutive proteasomes were not produced by immunoproteasomes. Indeed, when the identity of fragments produced by either set of proteasome was compared on a qualitative basis only ∼25% of peptides produced by immunoproteasomes were also found in constitutive proteasome digests. Therefore, the pool of peptides generated by cells expressing immunoproteasomes is very different from the peptide pool generated by cells harboring constitutive proteasomes only. Quantification of Digestion Profiles. ------------------------------------- For careful examination of proteasomal cleavage preferences, it is important to know the quantity of each fragment to calculate how often particular cleavage sites are selected. In contrast to MS data, data acquired by Edman sequencing are quantitative and can thus be used to determine the amount of peptide liberated. The combination of MS analysis and the quantified Edman sequencing data identified the absolute amount of each peptide detected in HPLC fractions. In the constitutive proteasome digests, a total of 136 fragments was detected, representing 6,135 pmol of peptide ([Table](#T1){ref-type="table"}). By adding the pmol of all fragments starting or ending at a particular cleavage site (and then choosing the higher one of the two sums), pmol amounts of peptide generated from a given cleavage site, and thus the frequency of cleavage site utilization, was determined. The most frequently used cleavage sites were found at amino acid positions 278 and 404, resulting in the liberation of 265 pmol peptide each ([Table](#T1){ref-type="table"}, top). As usage of many other cleavage sites resulted in only 5 pmol of peptide, these data indicate that the relative usage of cleavage sites within one protein can differ substantially. Similar data were obtained when the immunoproteasome digest was analyzed (123 peptides representing 6,370 pmol of peptide; [Table](#T2){ref-type="table"}). The most prominent cleavage site was found at amino acid position 419, resulting in the generation of 250 pmol peptide ([Table](#T2){ref-type="table"}, top). As for constitutive proteasomes, many other cleavage sites were used less often, indicating that both proteasome species prefer certain peptide bonds over others as cleavage sites. The almost identical amounts of peptides generated by both proteasomes (6,135 pmol versus 6,370 pmol) demonstrate a comparable substrate turnover, allowing a direct comparison of pmol amounts of amino acids at different positions around cleavage sites as well as a comparative statistical analysis of both digests. Comparison on a qualitative and quantitative basis of the fragment length distributions revealed that both proteasome species generated peptides with an average length of 7--9 amino acids (c20S, 7.4 aa; i20S, 8.6 aa) with 30% of the peptides produced by constitutive proteasomes being identical to those generated by immunoproteasomes ([Fig. 2](#F2){ref-type="fig"}). Together, these findings strongly indicate that in cells harboring constitutive or immunoproteasomes, respectively, the pool of peptides generated from proteasomal protein turnover will differ substantially. Analysis of Cleavage Site Usage. -------------------------------- As outlined above, some cleavage sites are used often, whereas others are used less frequently or not at all by one or both proteasome species. Until now, most studies addressing the specificity of proteasomal peptide/protein degradation did not take the frequency of cleavages into account. To study more accurately the influence of all 20 amino acids flanking proteasomal cleavage sites, we determined the frequency of amino acids around cleavage sites (P6 to P1 NH~2~-terminal of cleavage site; P1′ to P6′ COOH-terminal of cleavage site) using the quantified data set described above ([Table](#T1){ref-type="table"} and [Table](#T2){ref-type="table"}, and [Fig. 3](#F3){ref-type="fig"}). No statistically significant differences in cleavage site selection were observed between two independent digests performed by two independent immunoproteasome batches, indicating that the fragment pattern obtained after proteasomal degradation was highly reproducible (data not shown). Examination of cleavages performed by immunoproteasomes revealed several deviations from randomness at the amino acid level (i.e., the background in enolase) as determined by chi-squared analyses (data not shown). L as P1 residue has the highest preference (chi-squared = 21) and reflects a pronounced ChT-like activity within immunoproteasomes. Weaker preferences for D at P2′ (chi-squared = 6.2) are also evident. On the other side, several residues are found less frequently than expected with the hydrophobic amino acids I, L, and V (chi-squared = \>4.3) at P1′ being the most prominent. This finding reflects the preference of proteasomes to cleave behind rather than in front of L residues, for example. Apart from these amino acids at the P1′ position, L at P2 was found less abundantly than expected. When amino acids are grouped according to their characteristics, it was found that there was a positive correlation between cleavage and the presence of hydrophobic, and bulky amino acids in P1 (*P* \< 0.0002). An analogous examination for the cleavages selected by constitutive proteasomes revealed that the frequency of S as P3 and the positively charged amino acid K as P1 and P2′ residue is reduced (all chi-squared = 3.9), indicating that these amino acids are disfavored by constitutive proteasomes at these positions. Constitutive proteasomes show a weak enrichment of P at P4 (chi-squared = 3.8) and, like immunoproteasomes, prefer A at P1′ and L as P1 residue (albeit to a lesser extent; chi-squared = 4.2). Similarly, an enrichment for D at P2′ was noted (chi-squared = 8.5), indicating that both proteasome species have a preference for negatively charged amino acids at the P2′ position. When comparing characteristics of amino acids at these positions, a preference for hydrophobic, bulky amino acids in P1 and P2′ (*P* \< 0.0002) was observed. There is a negative correlation between cleavage site selection and the presence of hydrophobic, bulky amino acids in P1′ (*P* \< 0.0002). Effect of Immunosubunit Incorporation on Cleavage Site Selection. ----------------------------------------------------------------- The data described above reveal that both proteasome species exhibit a different, but partially overlapping (L in P1, A in P1′, and D in P2′) cleavage preference. However, they do not address directly the influence of immunosubunit incorporation on cleavage site selection. Therefore, we compared relative amino acid frequencies around cleavage sites used by immunoproteasomes to those used by constitutive proteasomes. As a control, we evaluated cleavage site selection of two independent immunoproteasome batches yielding no statistically significant differences (data not shown). For comparison between constitutive and immunoproteasomes for positions P6-P6′, significant differences were found at position P1 (*P* \< 0.004) and, to a lesser extent, also at P1′. When testing for amino acid characteristics, we found that immunoproteasomes prefer bulky, hydrophobic amino acids at P1 (*P* \< 0.003) but dislike flexible amino acids at this position (*P* \< 0.001). At position P1′ we found that hydrophobic, bulky amino acids were favored more by constitutive proteasomes (*P* \< 0.04). Thus, comparison of peptide bonds used as cleavage sites by immunoproteasomes to the ones used by constitutive proteasomes revealed a pronounced ChT-like activity of immunoproteasomes, as is reflected by a strong enrichment of hydrophobic amino acids in P1. When comparing the two proteasome species for individual amino acid usage, a strong enrichment of L (chi-squared = 7.1 and, to a lesser extent F, chi-squared = 3.8) was detected at P1 in peptides generated by immunoproteasomes. The strong enrichment of L became most prominent when we analyzed in detail those cleavages exclusively generated by immunoproteasomes, as 43% of these cleavages were performed after L (data not shown). Acidic amino acids D and E in P1 exert a negative influence on cleavage site selection by immunoproteasomes (chi-squared = 4.5 and 8.1, respectively). G in P1′ is enriched in peptides generated by immunoproteasomes (chi-squared = 7.8), pointing to a preference of immunoproteasomes for this small amino acid in P1′. Analysis of amino acid frequencies at positions P2 to P6 and P2′ to P6′ showed that L at P2′ is disfavored by immunoproteasomes (chi-squared = 4.3). Effect of Immunosubunit Incorporation on CTL Induction. ------------------------------------------------------- The observed major differences in the peptide repertoire produced by constitutive and immunoproteasomes could have important biological implications that go beyond differential proteasomal processing of certain CTL epitopes [8](#R8){ref-type="bib"} [13](#R13){ref-type="bib"} [14](#R14){ref-type="bib"} [15](#R15){ref-type="bib"} [16](#R16){ref-type="bib"} [20](#R20){ref-type="bib"}. To study the biological consequences of immunosubunit incorporation in vivo, we tested the immune response of LMP-7^−/^− mice lacking functional immunoproteasomes [28](#R28){ref-type="bib"} against wild-type cells. If immunoproteasome incorporation affects the nature of the CTL epitopes presented, it is expected that wild-type cells expressing both constitutive and immunoproteasomes will induce a CTL response in mice expressing constitutive proteasomes only. The opposite direction should not lead to a CTL response, as no unique ("immuno") peptides are presented in this setting. Indeed, skin grafting experiments showed that wild-type mice were not able to reject skin from LMP-7^−/^− animals [23](#R23){ref-type="bib"}, which are not able to express functional immunoproteasomes because in the absence of the LMP-7 subunit, LMP-2 and MECL-1 subunits are only incorporated in 20S proteasomes as inactive precursors [28](#R28){ref-type="bib"}. However, LMP-7^−/^− mice rejected skin transplants from wild-type mice with even greater efficiency than observed for the rejection of male skin by female recipients ([Fig. 4](#F4){ref-type="fig"} a). The fact that the latter rejection is mediated over several antigenic differences [29](#R29){ref-type="bib"} supports the argument that LMP-7^−/^− mice react against multiple antigenic differences present on LMP-7 wild-type skin. The identical scenario was observed for the induction of CTL responses. Vaccination of wild-type mice with cells derived from LMP-7^−/^− mice did not generate a CTL response. In contrast, LMP-7^−/^− mice readily mounted a strong, transporter-associated with antigen processing (TAP)-dependent CTL response upon vaccination with wild-type cells harboring both proteasome species ([Fig. 4](#F4){ref-type="fig"} b). Cell lines expressing an inactive LMP-7 T1A subunit were recognized with a 30-fold lower efficiency compared to cells expressing the LMP-7 wild-type subunit despite equal expression levels of both gene products and H-2 class I molecules (data not shown). This finding argues against the possibility that CTL responses against a peptide from the LMP-7 protein itself have been induced. The fact that LMP-7 T1A transfectants are still recognized to some extent by CTLs from LMP-7^−/^− mice can be explained by the observation that some CTL epitopes, not produced in LMP-7^−/^− mice, can be generated by proteasomes carrying both catalytically active or inactive LMP-7 subunits, as reported for immunoproteasome-mediated CTL epitope generation from viral antigens [14](#R14){ref-type="bib"} [30](#R30){ref-type="bib"}. The recognition of these epitopes on LMP-7 T1A transfectants would result in a CTL activity above the one induced by LMP-7^−/^− cells but below the one induced by LMP-7 wild-type cells. Together, our findings indicate that the incorporation of immunosubunits strongly influences the repertoire of peptides presented to CTLs and thereby the overall specificity of the CTL response. Discussion ========== The proteasome is the key enzyme responsible for cytosolic protein degradation and generation of peptides that are presented by MHC class I molecules by liberation of their proper COOH termini. However, proteasomes also can prevent MHC class I presentation by destruction of potential MHC ligands or their inability to select the proper COOH-terminal cleavage site. Cleavage site selection might change substantially after incorporation of IFN-γ--inducible subunits, as indicated by experiments using small fluorogenic substrates or short synthetic peptides. Therefore, detailed knowledge on the specificity of protein degradation by either constitutive or immunoproteasomes is crucial to the understanding and prediction of CTL epitope generation. To analyze alterations of cleavage preference upon immunosubunit incorporation we used an entire protein as a substrate without modification of amino acids or bias to known CTL epitopes. The quantitative identification of \>120 peptide fragments generated by either constitutive or immunoproteasomes allowed a detailed analysis of the cleavage specificities. Our data reveal that especially the amino acids in P3 to P3′ have a strong influence on cleavage site selection as the observed frequencies of amino acids in these locations showed the largest discrepancy to their background frequencies in enolase. Nonetheless, amino acids further away most likely influence cleavage site selection as well, as was reported earlier for the effect of P at P4 on peptide bond cleavage by yeast and constitutive human proteasomes [21](#R21){ref-type="bib"} [31](#R31){ref-type="bib"} [32](#R32){ref-type="bib"} [33](#R33){ref-type="bib"}. The average length of fragments produced by either set of proteasome is the same, showing that spacing at which specific cleavage sites of the substrate are recognized is not changed by immunosubunit incorporation. By comparing flanking residues around cleavage sites, we found that both proteasomes display a partially overlapping but different cleavage specificity ([Fig. 3](#F3){ref-type="fig"} and [Fig. 5](#F5){ref-type="fig"}). They both prefer L as P1 residue and K in P3; A in P1′ and D in P2′ were also favored. Nonetheless, immunoproteasomes have a much stronger preference for L at P1, as well as other hydrophobic amino acids in this position. These findings point to a pronounced ChT-like activity after immunosubunit incorporation. In contrast, the acidic amino acids D and E were clearly disfavored by immunoproteasomes, whereas these amino acids were enriched at P1 in peptides generated by constitutive proteasomes. Some of the different characteristics regarding amino acid preferences at the P1 position were also observed previously in a small number of fragments generated from covalently modified lysozyme using proteasomes from bovine spleen and pituitaries [12](#R12){ref-type="bib"}. Our observations most likely reflect the characteristics of amino acids at the inner surface of the proteasome. Analysis of the contribution of individual active β subunits to cleavage site selection in yeast 20S proteasomes [5](#R5){ref-type="bib"} [21](#R21){ref-type="bib"}, revealed that the active site of β1 prefers to cleave after acidic residues, β2 after basic residues, and β5 after hydrophobic residues. Structural analysis of proteasomes has shown that the pockets around the active site threonine of β5 and β2 do not change after immunosubunit incorporation [7](#R7){ref-type="bib"}. Therefore, it can be expected that the cleavage site--flanking amino acids that are preferred by both proteasomes (K in P3, L in P1, A in P1′, and D in P2′) correlate with the characteristics of amino acids in the vicinity of the S-1 pockets of β5/ β5i and/or β2/β2i. The enhanced preference for hydrophobic amino acids at P1 of immunoproteasomes does not probably result from exchange of β5, which mediates the ChT-like activity, for β5i (LMP-7), as replacement of β5 for β5i does not alter the pocket surrounding the active site threonine. Moreover, functional data indicate that β5i influences the structural features of 20S proteasomes, thereby enhancing the activity of β1i (LMP-2; references [14](#R14){ref-type="bib"} and [30](#R30){ref-type="bib"}). The stronger preference of immunoproteasomes for hydrophobic amino acids at P1, however, correlates with the characteristics at the inner surface of the proteasome when β1 (Y) is replaced for β1i. Replacement of β1 for β1i is predicted to cause the formation of a more apolar pocket around the active site threonine. This most likely results in the accommodation of hydrophobic amino acids at P1, leading to an enrichment of peptides with hydrophobic COOH termini and a reduction of fragments with charged COOH termini [7](#R7){ref-type="bib"}. Thus, it is conceivable that the exchange of β1 for β1i causes a reduction of peptides with charged COOH termini (amino acids like D and E) and enhanced liberation of peptides with hydrophobic COOH termini. Structural analyses of proteasomes also predict that the active S-1 pocket of β5i is more constricted than the pocket of β5 [7](#R7){ref-type="bib"}. As most hydrophobic amino acids are rather bulky, it is possible that small and flexible amino acids, like G, in close vicinity to hydrophobic amino acids, support accommodation of these amino acids in the S1 pocket of β5i most efficiently. Therefore, we anticipate that the strong enrichment of G and the decrease of hydrophobic amino acids in P1′ of cleavage sites selected by immunoproteasomes are a direct consequence of these altered characteristics of the β5 immunosubunit. The observation that the P1 preference of immunoproteasomes closely resembles the preferences of the F pocket of most MHC class I molecules is thought to explain why immunoproteasomes are associated with more efficient processing of MHC class I ligands, either by generating CTL epitopes directly or by producing more CTL epitope precursors that are converted into CTL epitopes by the action of aminopeptidases. As some CTL epitopes are preferentially generated by immunoproteasomes [34](#R34){ref-type="bib"}, it is postulated that immunoproteasome expression is generally associated with more efficient CTL epitope generation. However, the correlation between epitope production and expression of immunoproteasomes is more subtle. Some MHC class I alleles harbor F pockets that allow the binding of amino acids with charged polar side chains (e.g., K and R). These MHC alleles are unlikely to profit from immunoproteasome expression, as the trypsin-like activity is not enhanced by immunosubunit incorporation. In view of our results, increased CTL epitope generation can now be explained and also predicted by several different mechanisms. Examples of quantified fragment generation from synthetic peptides by constitutive and immunoproteasomes are listed in [Table](#T3){ref-type="table"}. They include (a) enhanced liberation of the proper NH~2~ and/or COOH terminus by i20S proteasomes resulting from the combination hydrophobic amino acid, small (and polar) amino acid at P1 and P1′, respectively (hepatitis B core antigen 141--151, lymphocytic choriomeningitis virus \[LCMV\] pp89, and adeno virus E1B), (b) enhanced generation of TAP-compatible CTL epitope precursors due to increased i20S proteasome activity for the combination hydrophobic amino acid, small (and polar) amino acid at P1 and P1′, respectively (LCMV pp89, LCMV nucleoprotein \[NP\]), or (c) reduced PGPH activity of i20S proteasomes not destroying the CTL epitope (influenza A NP). However the combination hydrophobic amino acid, small (and polar) amino acid at P1 and P1′ within a CTL epitope can also favor its destruction by i20S proteasomes as shown for a CTL epitope derived from the ubiquitous self-protein RU1. The finding that the peptide pool generated by immunoproteasomes differs from the one produced by constitutive proteasomes leads to important biological consequences as also shown by the effect of immunosubunit incorporation on skin graft rejection and CTL induction ([Fig. 4](#F4){ref-type="fig"}). Recently, it was found that dendritic cells and other professional APCs express immunoproteasomes [20](#R20){ref-type="bib"}. In contrast, most cells outside the lymphoid system harbor mainly constitutive proteasomes, unless they are exposed to inflammatory stimuli. These findings indicate that the peptide pool available to MHC molecules, and thus for presentation to the immune system, differs substantially between professional APCs and nonlymphoid cells. Professional APCs are not only involved in T cell priming, they also play a pivotal role in central and peripheral T cell tolerization [35](#R35){ref-type="bib"} [36](#R36){ref-type="bib"} [37](#R37){ref-type="bib"}. They can tolerize against endogenously expressed antigens, but also against antigens acquired from exogenous sources (cross-tolerization; reference [38](#R38){ref-type="bib"}). Although these antigens are derived from nonlymphoid cells that only express constitutive proteasomes, tolerance will be induced against self-peptides that are generated by cells expressing immunoproteasomes. During viral infection, virus-infected cells but also neighboring cells will be exposed to inflammatory cytokines, leading to immunoproteasome expression. Because tolerance has been adjusted to the peptide pool expressed by cells harboring immunoproteasomes, self-reactive immune attack is thus reduced to a minimum. These considerations might also be relevant for induction of CTL immunity against ubiquitously expressed self-proteins. If tolerance to self-proteins was restricted to peptides generated by immunoproteasomes, nonlymphoid cells expressing constitutive proteasomes would display peptides for which no CTL tolerance has been induced. In this respect, it is noteworthy that all CTL epitopes derived from ubiquitous self-proteins (like RU1, Mage-1, gp100, and Melan-A; reference [20](#R20){ref-type="bib"}) identified thus far are generated less efficiently by immunoproteasomes, whereas presentation of viral epitopes is, in general, enhanced after immunoproteasome expression [8](#R8){ref-type="bib"} [13](#R13){ref-type="bib"} [14](#R14){ref-type="bib"} [15](#R15){ref-type="bib"} [16](#R16){ref-type="bib"}. The combination of MHC class I ligand motifs and constitutive/immunoproteasomal cleavage motifs for T cell epitope prediction will enhance progress in precise manipulation of specific immune responses. For example, it should now be possible to identify new CTL epitopes preferentially generated by constitutive proteasomes (like the RUI epitope). Such peptides are attractive candidates to be used as cancer vaccines, especially if they are derived from antigens that are, for example, overexpressed in tumors. This work was supported by grants of the Deutsche Forschungsgemeinschaft to H. Schild (Schi301/2-2 and SFB 510 C1) and the European Union to H.G. Rammensee (Biomed 95-0263), Merck KgaA (Darmstadt, Germany), and CTL Immunotherapies Corporation (Chatsworth, CA). The research of Dr. R.E.M. Toes has been made possible by a fellowship of the Royal Netherlands Academy of Arts and Sciences. The Basel Institute for Immunology was founded and is supported by Hoffmann-La Roche, Ltd. *Abbreviations used in this paper:* ChT, chymotrypsin; LCMV, lymphocytic choriomeningitis virus; LMP, low molecular weight protein; MALDI, matrix-assisted laser desorption ionization; MECL, multicatalytic endopeptidase complex--like; MS, mass spectrometry; NP, nucleoprotein; PGPH, peptidyl-glutamylpeptide-hydrolyzing; TAP, transporter-associated with antigen processing. R.E.M. Toes and A.K. Nussbaum contributed equally to this work. ###### Absolute Amounts of Amino Acids Found in Positions P6 to P1 and P1′ to P6′ of Peptides Generated by Constitutive Proteasomes Pos Pmol P6-P1 P1′-P6′ ------------ ------- -------- --------- ------- ------- ------- ------- ------- ------- ------- ------- ------- 278 265 LTGPQL ADLYHS 404 265 APARSE RLAKLN 383 185 TEDTFI ADLVVG 31 175 EKGVFR SIVPSG 142 165 SKSKTS PYVLPV 183 165 TFAEAL RIGSEV 230 165 LDLIVD AIKAAG 330 155 TNPKRI ATAIEK 146 150 TSPYVL PVPFLN 79 145 PAFVKA NIDVKD P6 P5 P4 P3 P2 P1 P1′ P2′ P3′ P4′ P5′ P6′ A 865 595 1,020 485 620 825 1,545 330 710 590 930 365 C 0 0 0 0 130 0 0 0 0 0 0 0 D 580 460 255 215 185 805 300 1,185 315 235 170 400 E 530 465 385 455 250 605 300 275 460 150 465 440 F 50 275 430 165 430 145 190 250 165 575 220 50 G 300 575 750 230 545 175 185 415 760 185 320 780 H 175 125 10 150 280 65 165 110 65 35 385 90 I 505 125 385 335 180 510 60 845 220 450 405 170 K 220 580 240 945 455 80 365 115 370 675 600 655 L 540 550 535 525 230 1,185 345 900 1,120 435 670 565 M 10 0 95 10 15 35 70 40 75 65 10 60 N 120 285 235 140 240 95 390 215 195 160 270 730 P 365 475 550 365 95 40 480 20 255 240 330 315 Q 45 260 25 20 340 60 75 60 155 305 35 75 R 125 45 45 425 290 275 595 95 155 145 80 60 S 575 365 380 90 535 395 500 215 170 530 490 555 T 735 460 140 365 365 140 150 430 140 360 250 105 V 270 380 365 920 840 450 275 410 695 705 355 695 W 40 15 35 30 20 30 0 50 0 0 50 10 Y 85 100 255 265 90 220 145 175 110 295 100 15 sum (pmol) 6,135 6,135 6,135 6,135 6,135 6,135 6,135 6,135 6,135 6,135 6,135 6,135 (Top) 10 most abundant cleavage sites from P6-P1 and P1′-P6′, the position of the cleavage site (pos), and the calculated amount of enolase that has been cleaved at this position (pmol; see also Materials and Methods). (Bottom) Based upon quantified data (as exemplified on top), the absolute amounts of amino acids (in pmol) around all identified cleavage sites are shown. ###### Absolute Amounts of Amino Acids Found in Positions P6 to P1 and P1′ to P6′ of Peptides Generated by Immunoproteasomes Pos Pmol P6-P1 P1′-P6′ ------------ ------ -------- --------- ------- ------- ------- ------- ------- ------- ------- ------- ------- 419 250 RIEEEL GDNAVF 390 200 DLVVGL RTGQIK 183 155 TFAEAL RIGSEV 313 155 HFFKTA GIQIVA 133 150 PLYKHL ADLSKS 142 150 SKSKTS PYVLPV 253 150 ASSEFF KDGKYD 285 150 DLYHSL MKRYPI 289 150 SLMKRY PIVSIE 383 150 TEDTFI ADLVVG P6 P5 P4 P3 P2 P1 P1′ P2′ P3′ P4′ P5′ P6′ A 680 615 940 420 590 745 1,440 665 560 775 480 810 C 0 0 0 0 0 0 0 0 0 0 0 0 D 725 360 190 225 160 150 335 1,210 255 325 220 375 E 300 370 515 870 580 155 255 320 410 270 400 515 F 0 495 280 105 665 550 50 100 120 260 190 250 G 500 550 485 180 360 170 880 475 970 265 465 675 H 300 35 80 285 205 130 140 40 50 40 340 285 I 440 345 290 470 145 585 20 800 295 420 730 395 K 90 475 400 1,065 620 175 450 275 290 405 590 830 L 560 975 450 235 160 2,305 65 370 1,025 410 105 510 M 20 0 215 10 80 50 295 0 0 100 0 50 N 245 285 290 165 205 95 520 290 560 575 190 290 P 325 370 255 380 35 0 375 175 305 180 440 80 Q 10 260 210 105 170 10 175 75 225 250 100 20 R 365 100 65 215 395 200 480 0 190 290 320 100 S 545 250 610 225 735 185 345 320 265 695 380 520 T 890 200 85 235 570 195 310 560 275 195 275 55 V 255 485 585 940 695 320 85 535 495 555 925 610 W 25 60 0 25 0 70 0 0 0 75 0 0 Y 95 140 425 215 0 280 150 160 80 285 220 0 sum (pmol) 6370 6,370 6,370 6,370 6,370 6,370 6,370 6,370 6,370 6,370 6,370 6,370 (Top) 10 most abundant cleavage sites from P6-P1 and P1′-P6′, the position of the cleavage site (pos), and the calculated amount of enolase that has been cleaved at this position (pmol; see also Materials and Methods). (Bottom) Based upon quantified data (as exemplified on top), the absolute amounts of amino acids (in pmol) around all identified cleavage sites are shown. ###### Correlation between Observed and Predicted Cleavages Preferentially Performed by c20S and i20S Proteasomes^a^ Source MHC restriction Influence of IFN-γ Sequence Reference ---------------- ----------------- -------------------- --------------------------------- ----------- ▾ NAPIL **STLPETTVVRR**RGRSPR HbcAg 141--151 HLA-Aw68 \+ 14 ▿ RGVQI **ASNENMD AM**DSRTLELR Influenza A NP H2-D^b^ \+ 35 ▾▾ LMY DM **YPHFMPTNL** GPSEKR LCMV pp89 H2-L^d^ \+ 8 ▾▿ KIM RTE **RPQASGVYM** GNLTAQ LCMV NP H2-L^d^ \+ 16 ▾ YKISKL **VNIRNCCYI** SGNGAE Adeno E1B H2-K^b^ \+ 13 ▾ TGSTA**VPYGSF KHV**DTRLQ RUI HLA-B51 − 20 ^a^Cleavages performed at comparable amounts by c20S and i20S proteasomes are not indicated. HBcAg, hepatitis B core antigen; ▾, i20S preference; ▿, c20S preference. ###### Immunosubunit incorporation into 20S proteasomes purified from LCL-721 cells (left) but not into 20S proteasomes derived from LCL-721.174 cells (right). 20S proteasomes were isolated from LCL-721 and LCL-721.174 cells as described in Materials and Methods. Proteasome subunits were separated by SDS-PAGE (a) and probed with an LMP-7--specific antiserum (b). LMP-7 was only detected in 721 proteasomes. i or c indicate subunits exclusively present or overexpressed in i20S or c20S proteasomes, respectively. ![](JEM010516.f1a) ![](JEM010516.f1b) ###### Digestion map generated from degradation of enolase by constitutive proteasomes (a) and immunoproteasomes (b). Vertical lines, cleavage sites determined by Edman degradation and/or MS; black bars, degradation products identified by Edman degradation in combination with MS; white bars, degradation products identified by Edman degradation only (COOH terminus of peptide not identified). ![](JEM010516.f2a) ![](JEM010516.f2b) ###### Relative frequencies of amino acids in position P1 (a) P1′ (b). The absolute amount of amino acids found in a defined positions (P6 to P6′) around cleavage sites used by constitutive proteasomes and immuoproteasomes was divided by the total amount of peptides detected in the digests resulting in the relative frequency of amino acid usage in that position. Big white bars, relative frequency of amino acids found in enolase; black bars, relative frequency of amino acids at P1 or P1′ positions in peptide fragments generated by constitutive proteasomes; grey bars, relative frequency of amino acids at P1 or P1′ in peptide fragments generated by immunoproteasomes. ![](JEM010516.f3a) ![](JEM010516.f3b) ![Summary of cleavage motifs. Amino acid preferences at positions flanking the cleavages performed by constitutive (c20S) or immunoproteasomes (i20S) are indicated by bars pointing up (enriched) or down (decreased). Amino acid frequencies around cleavage sites were compared with amino acid frequencies in enolase. i20S versus c20S indicates a comparison of amino acid preferences between both types of proteasomes. Amino acid frequencies around cleavage sites were compared with each other. Bars pointing up indicate a i20S preference, bars pointing down indicate a c20S preference. Amino acids are shown in one-letter code by capital letters, and amino acid characteristics are indicated by small letters. A decrease in preferences for hydrophobic and bulky amino acids also indicates an increase in preferences for polar and small amino acids, respectively and vice versa. h, hydrophobic; f, flexible; b, bulky.](JEM010516.f5){#F5} ###### \(a\) Skin of the indicated donors were grafted on the back of the indicated recipient mice according to the protocol described in Materials and Methods. Graft rejection was controlled daily. Each dot represents a single recipient. This graph shows a representative result of four independent experiments. (b) LMP-7^−/^− mice and wild-type littermates (129/Ola background) were immunized with wild-type or LMP-7^−/^− splenocytes. CTL activity was tested after in vitro stimulation on LMP-7^−/^− and wild-type concanavalin A blasts, RMA, and RMA-S cells as described in Materials and Methods. This graph shows a representative result of three independent experiments. ![](JEM010516.f4a) ![](JEM010516.f4b)
{ "pile_set_name": "PubMed Central" }
Q: how to writhe a Php inside HTML with substr I write this bellow code <div class="description"><?php echo substr($data['description'],strpos($data['description'],$info['title']),100); ?></div> when I change method to this bellow code I get an error!! <?php echo'<div class="description">'.substr('.$data['description'].',strpos('.$data['description'].','.$info['title']).',100).'</div>'; ?> error: Parse error: syntax error, unexpected T_STRING... A: You need to write your PHP code inside <?php and ?> tags. You cant just write your php code as a string. PHP interpreter needs to know what code should be interpreted. EDIT: You cant put variables names in quotes. Try this: <?php echo '<div class="description">' . substr($data['description'], strpos($data['description'], $info['title']), 100) . '</div>'; ?>
{ "pile_set_name": "StackExchange" }
Q: Installed trigger app, installed node.js, trigger says it can't run npm on Mac New Mac user account. I install the Trigger.io (TriggerToolkit) app for the Mac. It fires up a tab with the apps. I can run the iOS simulator from it - so it is plausibly working installation. I have installed node.js from the node.js website, using the Mac package. I have node.js as /usr/local/bin/npm (version 1.1.43). It is found when I type "npm" at a command line. The path "/usr/local/bin" is on my $PATH. "/usr/local/bin" is set in my /etc/paths file, system wide. So the npm executable should be findable by any user, at any time (before or after login, running a terminal, etc). When I use the web page for the web run, it's OK, until it tries to run npm. [DEBUG] running run_web((), {}) [DEBUG] Running: npm install [DEBUG] failed to run npm: do you have Node.js installed and on your path? while running run_web((), {}) [ERROR] failed to run npm: do you have Node.js installed and on your path? I guess that the problem must be something to do with an assumption about the path for npm. What's the assumption? What can I symlink to make this work? Note that npm is found by "forge run web". This is something specific to the way that TriggerToolkit.app is working. A: Update: this is fixed as of v1.4.6: http://docs.trigger.io/en/v1.4/release-notes.html#v1-4-6 Previous answer: Unfortunately I think the error message here isn't great and reflects a general problem with starting the node app. We are aware of one issue with dependencies which started occurring after Node 0.8. Can you check what Node version you have: node --version If it's 0.8, then a temporary workaround to this problem is to use the command line tools and: forge build Then manually update development/web/package.json to refer to express 2.5.10, then forge run web Sorry for the trouble, we'll report back here when that's fixed
{ "pile_set_name": "StackExchange" }
The Aviary Brewpub Opening This Month in Toronto’s Canary District TORONTO, ON – Now Magazine reports that Longslice Brewery and sports bar/gastropub The Dock Ellis are getting set to open a new brewpub in the Canary District, an up-and-coming neighbourhood near the Distillery District in east Toronto. As originally reported here on CBN in February, The Aviary will be a 230-seat bar and restaurant offering a “fun, community-friendly vibe, with a focus on craft beer, amazing food, and sports.” Planned to soft open later this month in advance of its grand opening on August 9th, The Aviary will feature 10 craft beers on tap including the two flagship brews from Longslice, Hopsta La Vista IPA and Loose Lips Lager. These will be joined by new and exclusive Longslice creations such as Aloha Friday (hibiscus pale ale), Slam Dunkel (dark wheat beer), Klondike Clarke (golden ale), and Puns N’Goses (light summer sour), with the latter being available exclusively to users of the Craft Beer Passport. Also featured will be a food menu featuring favourite items from The Dock Ellis, arcade games, shuffleboard, and a large patio. An on-site brewery producing Longslice beers will open in 2019. For more details, see The Aviary Facebook page.
{ "pile_set_name": "OpenWebText2" }
Electronics Parts Shop With Confidence RS22AQXMQ01 Roper Refrigerator - Instructions All installation instructions for RS22AQXMQ01 parts These instructions have been submitted by other PartSelect customers and can help guide you through the refrigerator repair with useful information like difficulty of repair, length of repair, tools needed, and more. Slow to produce ice & tray damage Removed the top two screws and one on the bottom which attach the ice maker to the side of the freezer. I unclipped the wire bundle from the side of the ice maker and unplugged the connector, totally removing the unit . The maker came with several different wiring setups, but I just used the existing. The contol arm on the new unit basically snaps into place and the above process is reversed to install the new unit. My old ice maker had an accelerator which blows cold air to the bottom of the tray to speed up ice production. This component was undamaged and by taking off the new units outer end cap and borrowing the clips from the old unit, this component can be installed on the new ice maker. First I installed a defrost timer, (the old timer had burnt out contacts in it) It seemed to work for a few days, then went back to not comng out of defrost cycle, I then installed a defrost thermostat. It seems to be working better than before. I found out that maybe I wasn't running it cold enough. So I turned it up colder. Now it works ok for 2 - 3 days, then I check the Temp in the freezer and its up to 6o. So I manually reset the timer and it works for 2 - 3 days. Don't know what to do now to fix it. Following a brief power outage, it stopped producing ice. Harvester was at 6:00 with fingers frozen in ice cubes. Would make a batch if I freed the harvester and jumped the t-stat, but would quit again. Unplugged refrigerator. Used nut driver to remove small bolt retaining wire cover on right side of ice maker. Removed wire cover, used flat head screw driver to depress side-rail clips. Ice maker slid out, unplugged. Timer module cover pops off easily. Three screws removed the timer module. Installation was reverse of removal. Had ice in less than an hour, bin was full by next morning. If you have a screw driver and know what it's for, this job should come easily. Ice door holder arm broken The hardest part was getting the front cover plate off. I used two kitchen knifes one in each slot on the bottom of the plate and pried it off and unplug it. I removed one screw to release arm. I then used long nose pliers to remove the pin on door arm assemble. Then unplug door heater. New door has no heater. The heater had cooked the plastic arm, which caused the arm to fail. Then reassemble in reverse order. Ice was being made, but wouldn't drop My icemaker wouldn’t pop out the ice. I bought a used fridge from 2nd Time Around in Russellville AR which was the most horrible customer service experience of my life. They were supposed to have a 60 day warranty but didn’t follow through. After months of begging them, and knowing what part I needed, I just ordered it myself. It was so easy and quick and fixed my issue my husband said we should have done that months ago and avoided the hassle. It was worth the money to have the peace of mind. Now everything is perfect! All we had to do was remove the icemaker, take off the side with a screwdriver, replace the part and slide it back in. We had ice in hours! Shipping was quick (a couple days) the part was 30 dollars cheaper than other places I checked. We love it! Ice stripper broken on ice maker I unplugged the fridge. Loosened the 2 top screws on the ice maker and removed the lower screw. I disconnected the wiring harness and removed the Ice maker. I removed the plastic timer cover in front. I then loosened the screws on the face of the ice maker and removed the broken ice stripper and replaced it with a new one. Re-tightened the screws on the face, installed the timer cover, plugged in the wiring harness, re-attached the ice maker. Plugged the fridge back in and walla, it was making ice in 30 minutes! Water began to leak under the refrigerator. Source looked like it was coming from control valve suppling water to ice maker and water dispenser. Followed instructions supplied. It was relatively easy and the parts fit exactly right. Sears wanted twice as much for the part and service would have charged me another $100 to come to my home. I saved over $100 doing the project myself. First remove the ice container from the freezerand dump all of the ice. Remove the fourscrews holding the front ice container cover. Remove the control arm screw and bracket from the bottom of the ice container, remove crusher housing (screws and retainer clip). Remove nylonbearing nut on front of auger shaft (left handed threads). Remove crusher blades and spacers (remember order of blades and spacers). Remove broken floating baffle. Replace baffle and reverse removal procedures. Old motor was not resetting back to proper position halting ice production. Removed the three motor screws pulled off old motor put new motor in place replaced screws and re-installed. It was producing ice three hours later. I originally tried to obtian these parts directly from Whirlpool in which twice they shipped me the wrong parts. Finally gave up on them and entered the whilrpool part number which crossreferenced to new part number which was correct the first try. Thank you! Water would not come out of the dispenser. Removed catch tray and then removed two screws that are underneath. I left the control panel hanging from its wires, then removed the two screws from the control bracket. A word of caution before next step: You need to remove the two micro switches on the left and right. While trying to remove one, it split apart and the pieces fell out. I was able to put it back together and it worked fine. So be careful with the micro switches.Continue tranferring wires and switches to the new bracket and reassemble in the opposite order.An easy repair. Ice stuck in mold. mold coating was peeling off. Turn off water supply too ice maker and unplug the fridge power. using a nut driver remove one bottom screw from the bottom, near the front. The other two from the side atop the ice mold. (loosen screws and ice maker will lift up and off.)I set the ice maker on the counter, snapped of the front cover by hand. using a phillips driver, remove two screws near the bottom corners.(they go through the circuit board into the ice mold)circuit board in one hand, other end of ice mold in the other, slowly pull apart about 1 inch. remove the silver colored "on, off" bar at the end by snapping the retainer out of the ice mold. (the silver bar stays with the circuit board end) Watch how the ice guide(white fingers stationary on side of ice mold) hooks too the ice mold on each end. swap ice guide to new ice mold, insert three guide pins on end into holes on the circuit board, while holding ice guide onto ice mold, watch rotation bar while inserting into motor.(it only splines one way.) when each piece is lined up, simply push together and reinstall two screws. snap circuit board cover into place. reinstall ice maker into freezer in reverse order. Ice dispenser freezing up, dispenser door not closing completely. First off, if you have the stainless steel panel inserts on your refrigerator you'll need to remove those to do this repair. I kept looking for the access holes on the underside of the dispenser panel that you're supposed to insert a screwdriver into to pry it off. It wasn't until I removed the freezer door handle, slid the lower stainless panel insert out, and removed the rail just beneath the dispenser that I could see and access these holes. I also removed the upper stainless panel and rail just above the dispenser to allow enough movement get the dispenser cover off and out. The rest of the repair is pretty straightforward. The old ice door was beaten up and not closing completely, this was letting warm air into the freezer which was melting and re-freezing. This kit fixed the problem.
{ "pile_set_name": "Pile-CC" }
Q: socket.io - emitting from within an anonymous function I am quite new to the world of async. I am trying to do everything with callbacks at first before using any of the libraries out there. I think I have a closure problem, but don't know what to do about it. Here is some code: namespace.on('connection', function(socket){ var newClient = socket.id//just in case the a new user logged on between declaration and use socket.join('room1') function newConnection(positionCallback, hashCallback, newUser){ namespace.to(socket.id).emit('hello', {yo:'works'}) for(var i=0; i< cardCounter ;i++){ var keyVal = 'card:'+ cardArray[i] redis.hgetall(keyVal, function (err, storedMsg) { namespace.to(socket.id).emit('hello', {yo:'doesnt work'}) hashCallback(storedMsg, newUser) }); if(i==cardCounter-1){ positionCallback() } } } function onConnectionComplete(){ namespace.to(socket.id).emit('hello', {yo:'works'}) } function onHashComplete(hashObject, newUser){ namespace.to(newUser).emit('hello', {yo:'doesnt work'}) } newConnection(onConnectionComplete, onHashComplete, newClient) } I have placed some socketio emits around the place to pinpoint where things go wrong. Any emits outside of the call to redis work as expected. As soon as I go inside that anonymous function - nada. That said, I have console.log()'ed everything inside that function. I get the right results from redis, I have the right user, and namespace is defined. I just can't emit the result. I would have thought that the anonymous function had access to the scope just outside it - but not the other way around. I don't see what is not making it across... Also I know that some people don't like the if statement to invoke a callback, but that might be a discussion for another day. A: It was a closure problem! Just not what I was expecting. I also, ahem, don't really understand it. The callback isn't the problem, getting variables accessible inside the redis response function is. I would have thought that any variables declared in a parent/ancestor function are available to children/decedent functions. In this instance I needed to create a function inside the loop, and explicitly pass variables for it to be available inside a closure. Here is the stackoverflow question that pointed me in the right direction: How can I access the key passed to hgetall when using node_redis?
{ "pile_set_name": "StackExchange" }
In the World of the High Tech Redneck, the Graybeard is the old guy who earned his gray by making all the mistakes, and tries to keep the young 'uns from repeating them. Silicon Graybeard is my term for an old hardware engineer; a circuit designer. The focus of this blog is on doing things, from radio to home machine shops and making all kinds of things, along with comments from a retired radio engineer running from tech or science news to economics; from firearms to the world at large. Sunday, January 24, 2016 China Isn't Going to Recover for a Long Time A few times in the last year, I mentioned Jim Rickards and his book "The Death of Money" (book link). In one of the more pucker-inducing section of the book, Jim devotes a full chapter to the problems lurking just under the surface in China. China has corruption that makes our government look like a brownie girl scout troop. One of the ways this corruption is evident is in systemic malinvestment. It works like this: China doesn't really have a free market system; it has a state run economy like any other socialist state. There is some freedom around the edges, but the monsters are the so called "state owned enterprises", typically run by local or provincial "big wigs", almost the equivalent of war lords. Think of these SOEs as engines of corruption, shoveling money from the government to cronies who do whatever they want with it (did I say it was like our system, only worse?) China has "ghost cities" that have never been occupied, bridges to nowhere, bridges and other projects that are abandoned after an aborted start and more. Case in point is the city of Caofeidian, the "world's first fully realized eco-city", in a Guardian article from July of '14. Roughly 120 miles southeast of Beijing, Caofeidian was built on land reclaimed from the sea by dredging sea bottom and piling it up (the term "dredge and fill" is an obscenity in South Florida, BTW). ‘As precious as gold ...’ That was how then-president Hu Jintao described Caofeidian during his visit in 2006. It was pledged to be ‘the world’s first fully realised eco-city’ – yet 10 years and almost $100bn later, only a few thousand inhabitants have moved to this land reclaimed from the sea ... One million residents were once supposed to live there. It is a ghost town today, sporting only a few thousand inhabitants. Practically no-one has ever stayed in the city, and the buildings are already deteriorating. In fact, many of the buildings have been left half-finished, as credit eventually ran out. The first city to get a lot of press as a ghost was Ordos, in Inner Mongolia. Ordos was built as a copy of... well, Ordos, a Mongolian city that became wealthy as a center for coal production. A BBC article from 2012 begins: A huge statue of the mighty warrior Genghis Khan presides over Genghis Khan Plaza in Ordos New Town. The square is vast, fading into the snowy mist on a recent Sunday morning. Genghis Khan Plaza is flanked by huge and imposing buildings. Two giant horses from the steppes rise on their hind legs in the centre of the Plaza, statues which dwarf the great Khan himself. Only one element is missing from this vast ensemble - people. There are only two or three of us in this immense townscape. Because this is Ordos, a place that has been called the largest ghost town in China. This recently completed bridge (the white line across the middle of the bay in the image above) holds the world record for the longest bridge over water. Spanning 42 kilometers, it’s long enough to cross the English Channel. Built at a cost of 56 billion yuan ($8.7 billion), the bridge crosses Jiaozhou Bay and connects the main urban area of Qingdao city with the Huangdao District. The bridge saves approximately 20 minutes drive time to go from one industrial side to other. Is 20 minutes times the number of commuters really worth $8.7 billion? How much traffic does this represent? Consider, instead, building a bridge where the red line is at the mouth of that bay. It wouldn't be able to claim the title of "longest bridge over water in the world", but it would have cut drive time between the population centers as well. There's bad investment all over China: bridges, cities and more. Estimates run into the trillions of dollars. You've heard for some time that the China's yuan is being manipulated to make it look better than it really is. They made a mistake, though, in pegging it to the dollar. Since the dollar has been doing well for the last year or so (due to my "least disgusting girl at the dance" theory) causing the dollar to rise against other currencies. This makes Chinese exports more expensive compared to those from places like Vietnam, Myanmar, Taiwan or Thailand. Financial writer Tom Dyson of the Palm Beach Letter observes: That’s why we’ve seen China’s gross domestic product (GDP) decrease every consecutive year since 2007. And it’s now growing at its slowest pace in 25 years. China’s GDP is expected to contract even further next year. The billions of dollars in lost export revenue are now no longer available to service bad debts. The lost revenue was the cash flow that kept the show going. Without it, those who have partaken in this grand scheme will have their legs swept out from under them. He also cautions that we're not going to see China default or go bankrupt, but it is going to take years to go through this bad debt. The days of the (so-called) 7% per year growth in China are over. In my opinion, they're going to look at years of zero to negative growth. That will ripple around the world, and will affect the US economy, too. He presents a list of Exchange Traded Funds that center on China that should be avoided. If you accept his analysis (RTWT). Bridge pylons from Caofeidian. A six-lane road span bridge was abandoned after 10 support pylons had been erected. All true....China is rife with corruption, tell me DC and Wall St. aren't and do it with a straight face. China has centralized control of business, the US does the same thing by regulations and bureaucratic edicts. China wastes BILLIONS on questionable and even useless building projects. The US Gov has shelled out $3 million to study video games like World of Warcraft.....and that is just one of THOUSANDS of things that money is flushed down the shitter for. No better? Seriously? The US certainly isn't a bed of roses bathed in sunshine and scented with unicorn farts, but it's a bit of a stretch to call it "no better" than the totalitarian, pseudocomnunist, Orwellian hell-pit that is China, in my opinion. Are we doing our damndest to change that, to make America into a totalitarian hellhole? You bet. *spits* But even with all the freedoms the constitution enshrines (doesn't give. It enumerates rights that already exist, it does not *grant* them.) that have been stripped away by unconstitutional processes and abuse of the (deeply flawed) concept of "judicial review", America is still a helluva lot freer than just about any other country on the face of this earth that you could name. In my opinion, of course. God bless, hope I didn't offend. :-) Precisely....in your opinion. Ask someone who has been jailed because a DA withheld exculpatory evidence or the po po lied under oath if this is a 'free country'. Ask someone who was pulled over and robbed by an armed badgemonkey of thousands of dollars simply because the thug COULD if this is a 'free country'. I could go on and on and on ad infinitum. NO.... our government is no better than that in China and we are no more free than the people of China.....it's just that our system and methodology of corruption and state sanctioned criminality is DIFFERENT from theirs. To begin with, I think when I said that China was worse than the US, that means a difference in degree, not fundamentally different. Is the US just as bad? I don't think so. We're still better at not having factories full of slave workers, and still better at not harvesting organs from live prisoners. We're still better at not bulldozing churches. They still haven't fundamentally transformed us to that level. Yet. All those other things you write about? Yeah, I've written about them in the pages of this blog, too. Many times. @Dan: What Mr. Graybeard said. I couldn't say it any better. We have (huge, terrifying, awful) problems...but we at least have the illusion of being free. The NSA et al might monitor the content of our conversations, but at least we only *wonder* (can't believe I'm writing this...in America! God help us.) whether we'll be picked up and imprisoned secretly because we say something naughty. In China, they don't wonder. They *know* if their words are overhead they'll be shot or imprisoned. Is the comparison too close for comfort? Hell yeah. But even in China there are people who hope, and have faith, and look towards a brighter future, even if they die for the crime of believing that the present isn't bright and shiny. If China and the US are the same, just as evil, just as dark as each other...why do Chinese people flee here when they get the chance? Hell, the existence of this very blog is evidence that, though things are unacceptably bad, they still haven't gotten to China level. An even better example is the fact that "he who must not be named" (the "supreme dark lord" of the ELOE) continues to run his blog. The feds almost certainly monitor it, but it, and places even more...unsavory and unPC?...than it *exist*. And they exist as more than just a means for the state to identify noncompliant "badthink"ers to arrest. If you'll pardon the sentiment, the flame of Liberty may have been hooded in many places in this country...but it has not gone out. It will continue to burn, obstinate, indomitable, and unfaltering, as long as people like you, and me, and Mr. Graybeard, and the madgeniusclub, According to Hoyt, monsterhunternation, etc. crew refuse to give in to the temptation to despair. I don't know what struggles you've had, sir, but (if I may be so bold) I can tell they haven't extinguished your fervor and devotion to the concept of Liberty, however awful they were. That's a part of what makes this flawed, wounded, ravaged nation great, in my opinion: we are a bunch of seriously stubborn, intractable, unyielding nutters. (Love that word...) We refuse to surrender. And we "have not yet begun to fight!" :-D(Sorry if this makes little sense/seems off topic...I'm feeling under the weather today. I'll stop rambling now.) God bless! Dan, 99.9% of Americans aren't robbed by the police or indicted by lying prosecutors and police. Don't conflate the horror stories the Internet spreads around with the normal life most of us live. I'm 72, don't drink or do drugs and have had zero bad interactions with the police. Most of my friends and family can sat the same. Followers This Is A Test Les Paul People of the Gun Gun Blog Black List Stuff I've Been Reading About Me Retired radio engineer, follower of Christ, RF designer, mentor. Radio ham, home shop machinist, lapidary, silversmith, roadie cyclist, learning to be a rifleman, and home defender, - a guy with too many interests to keep track of. Contact Me Have something you'd like to talk about but don't want to use the comments? You can email me at: SiGraybeard at gmail dot com. Commercial links On occasion, I link to books on Amazon.com or to other commercial sites. I do this as a way of illustrating what I'm referring to, not as revenue generation. I do not obtain any revenue or financial reward for this blog. I have not received samples of anything, nor gifts of any kind. My aim is to make the insights worth more than you pay for them.
{ "pile_set_name": "Pile-CC" }
Simona Williams Nude Photos & Pics 2019 03.03.2019, 10:15 Simona Williams video eva Felicitas Habermann (born January 16,) they rounded out the week learning a bit about pixelation, i you stick around to them. Italienisch und Spanisch). She was succeeded in her role by Xenia Seeberg. Englisch, she is best known for playing the role of Zev Bellringer in the television series Lexx. That is the aggressive part of the equation, but then she just waits there hoping that the guido notice her. Sie beherrscht funf Sprachen flie?end (Deutsch,) 1976) is a German actress who has appeared in numerous films and TV series. As they animated themselves for the credit sequence. Franzosisch, that is what she is most williams worried about. Isabel Florido wuchs als Tochter einer Italienerin und eines Spaniers in Zurich auf. Or animation of live subjects, sexy and unashamed of her exhibitionist ways, before playing the title character on the short-lived series Emily's Reasons Why Not in 2019. After the death of the young man began to take revenge on the offenders. The film was about a schoolboy who, graham starred in films Committed (2000)), which brought some fame. She then wiggles it off her hips and gets rid of it. Committed suicide. There is nothing hesitant about Adriana Chechik once she is placed in front of a camera. Stripped down to nothing but her cherry red high heels, the Hangover (2019)) and its threequel, the actress received a role in a fantastic Comedy “Skeletons”, the view of her thick black patch of pussy hair feels like a surprise at first, she places her clit in perfect position for the most stimulation. Unable to cope with the attacks of classmates, a year later, which is engaged in the destruction of actual evidence, as the motor starts to run, she straddles a Sybian sex machine. And then the memories of customers about their crimes. Gray Matters (2019)), she also had a role on the television series Scrubs in 2019, mary (2019)), the adult model and pornstar unties her teddy and pulls it down off of her soft breasts. In the 2000s, which tells about the company, the girl knows what she is there to do and she is going to get it done. But certainly not a bad one. Say It Isn't So (2019)), the Hangover Part III (2019)). The following year Tuppence received an invitation to the youth Thriller “Tormented”, she also had recurring roles on Showtime's Californication (2019)) and Netflix's Flaked (2019)). Simona Williams Sophie van der Stap Andrea Gara Simona Williams nude photo 2019-2020 Simona Williams nude photo 2019-2020 Maybe Zoe is starring in low budget films but she has the perfect sexy body curves more beautiful than most Hollywood movie star! Great tits, big but, slim waist, a typical silicone beauty, tied to the bed, under the influence of electric shocks shows us hard boobs and pointy nipples. Watch Zoe Paul nude and boobs in Hell`s Gate movie. (SCROLL DOWN for video) Just goes to show you can never take your surroundings for granted. Next time you are cruising the office parks, take a gander down some of the back and side entrances. Who knows, you must just see Alanah Rae airing out all her bodacious attributes once more. Simona Williams Simona Williams nude photo 2019-2020 Hadewych MinisDaphne Duplaix Simona Williams Skin Diamond is already an alternative babe that leaves a lasting impression, but these photos of her from Suze are incredible. That beautiful cocoa skin wearing only neon fishnets is really a sight to see. There’s something simple about this chaos of color that grabs your attention and won’t let you go. Simona Williams nude photo 2019-2020 Anouk Ferjac Comments: Posted: egold2, 28.02.2019, 17:11 I would suspect he sent the message to the wrong person. I would respond and say, “I think you sent this message to the wrong person” and see how he responds. His response will answer all your questions about the meaning. No reason to waste your energy if the message wasn’t meant for you. Posted: davidmoon, 28.02.2019, 20:14 There is already reparations - it's called welfare, wic, food stamps, and much more.
{ "pile_set_name": "Pile-CC" }
a) Field of the Invention The invention is directed to a method for determining the image quality of an optical imaging system substantially comprising an illumination device, a sample holder with sample, imaging optics, and at least one spatially resolving detection device. The invention is further directed to the use of the method according to the invention for determining the influence of samples on the amplitude distribution and phase front distribution of the illumination light, of which, in particular, the amplitude distribution is known. b) Description of the Related Art In connection with the manufacture of high-quality imaging optics, particularly for use in microscopy, an assessment of the achievable image quality is required. It is known to determine, at least semi-quantitatively, the image quality of imaging systems which have few lenses and which can also comprise complex optical subassemblies. For this purpose, it is customary to carry out so-called star tests, wherein circular objects below the resolution limit of the specific optics are used as test samples. Based on the behavior of the diffraction patterns in the imaging of these samples with defocusing devices and the symmetries contained therein, the quality of imaging can be determined qualitatively to a degree of accuracy that is usually deficient. For example, a closed first diffraction ring at the edge of the first Rayleigh region can be considered as a sign of diffraction-limited optics. It is disadvantageous that this assessment must be considered only as integral information. And more specific quantitative information about the distribution of the rest of the imaging errors to different error types, such as a spherical aberration, coma or astigmatism, can also not be gained in this way. In another procedure, the fit of the individual optical components is checked by interferometry to arrive at assertions concerning the geometric errors, e.g., of a lens body, which can then be converted to system-dependent imaging errors. In this connection, system-dependent influencing factors are also already detected insofar as the measurement wavelength of the interferometer conforms to the working wavelength or wavelength spectrum of the illumination light. In more complicated optical systems, specially adapted interferometers are also occasionally used to check the image quality under given constraints and at the correct working wavelength with respect to the total imaging system. This is applied, for example, in imaging objectives for steppers or scanners to be used in semiconductor microlithography. This procedure requires a relatively high technical complexity and is therefore very cost-intensive and not usually employed in connection with microscope manufacture. Further, it is known to measure the wavefront of optical imaging systems with so-called Hartmann or Shack-Hartmann wavefront sensors or with sensors operating on similar principles. This also calls for relatively elaborate technology and, for that reason, the corresponding measuring systems are usually only designed to provide measurements only for different subsystems which, however, have similar interfaces, e.g., microscope objectives for microscopy. In this connection, a continual problem, particularly for microscope producers, is the lack of an available general testing procedure that would make it possible to determine the image quality as accurately as possible for the different optical imaging systems which differ from one another with respect to optical, geometric and mechanical parameters. Also, this problem exists not only during the manufacture and adjustment processes, but also in connection with quality control of imaging systems that are already in use by the customer. Further, the determination of the image quality for a plurality of field positions of the imaging system is uneconomical or inaccurate in all of the previously known procedures. The following source literature is cited in this connection: Joseph Geary, “Wavefront sensors”, SPIE Press 1995, and Daniel Malacara, “Optical Shop Testing”, Wiley Verlag 1992.
{ "pile_set_name": "USPTO Backgrounds" }
SAT/ACT Preparation - Part 2 ID : 75299 SAT/ACT Preparation Part 2 will give you all the information you need to do well on the math questions of the ACT and the SAT. The ACT math tests your knowledge of arithmetic, algebra, geometry, trigonometry and basic statistics. This course provides you with a complete math review of all these subjects. We'll also show you how to use your time wisely so that you finish as many math questions as possible. Taken with Part 1, this course will prepare you to excel in all sections of the undergraduate college entrance exams and provide you with the means to achieve your best potential score!
{ "pile_set_name": "Pile-CC" }
Benefits of a prehospital stroke code system. Feasibility and efficacy in the first year of clinical practice in Barcelona, Spain. Hospital admission delay is a main limiting factor for effective thrombolytic therapy in stroke patients. We developed a stroke code system for rapid request of emergency transportation to the hospital and a priority availability of the attending neurologist on the patient's arrival at the Emergency Department (ED). Over a 1-year period, a 24-hour telephone hotline between the attending neurologist and the Barcelona public emergency coordination service was established. Priority 1 (P1) was defined as a patient with symptoms suggestive of acute stroke with onset of less than 3 h, in which case immediate transportation service and rapid ED reception was organized. Data from patients in the P1 group (n = 39) and patients without activation of the stroke code (P0) (n = 181) were compared. There were significant differences between P1 and P0 groups in mean time from ED arrival to request for neurologic assessment (4.4 +/- 19.5 vs. 194.7 +/- 244.9 min, p < 0.001), from arrival to neurologic examination (12.6 +/- 21.1 vs. 225.3 +/- 258.2 min, p < 0.005), and from arrival to performance of brain CT scan (35.5 +/- 34.9 vs.120.3 +/- 143.2 min, p < 0.001), and also in the number of patients treated with thrombolytic agents (19 vs. 4.5%, p < 0.003). There were no differences between groups in the time elapsed from stroke onset to ED arrival. Activation of the stroke code was effective in increasing the percentage of patients treated with thrombolytic drugs and also in shortening the delay from ED arrival until neurologic assessment and from ED arrival until brain CT.
{ "pile_set_name": "PubMed Abstracts" }
Q: Contradiction in Davis–Putnam–Logemann–Loveland (DPLL) Method?! As we see on page $10,11$ and $12$ on Google Books we know about Unit Clause (UC) and Pure Literal (PL) in DPLL Algorithms. in the following example if assign value $0$ to variables is prior to assign $1$ to variables, PL and UC is used, but I think just UC is used. $\{\lnot A \lor B \lor C\}, \{A \lor \lnot B \lor C\}, \{A \lor B \lor \lnot C\}, \{A \lor B \lor C\}$ any idea why our solution is differ with answer sheet that say PL and UC is used? Edit: I think we have following diagram that in node (3) we can use PL or UC. A: Let $\Phi$ the initial set of four clauses as above. Def 15. A pure literal is a literal $l$ that appears in at least one clause of $\Phi$ while $\lnot l$ doers not appear in any clause of $\Phi$. Thus, initially, there are no pure literals. Def 16. A unit clause is a clause with exactly one unknown literal in it. Thus, initially, there are no unit clauses. So, you have to apply $DPLL(\Phi)$ selecting e.g. the variable $A$ and branching with: $DPLL(\Phi|_{A=0})$ and $DPLL(\Phi|_{A=1})$. For the left branch: 1) $\{ 1∨B∨C \}, \{ 0∨¬B∨C \}, \{ 0∨B∨¬C \}, \{ 0∨B∨C \}$. Now I suppose you can simplify, according to the rules,: $1 \lor p \equiv 1$ and $0 \lor p \equiv p$, to: 1') $\{ 1 \}, \{ ¬B∨C \}, \{ B∨¬C \}, \{ B∨C \}$. After the first step, again neither pure literals nor unit clauses in this branch. Then we can go on with $B$; for $B=0$ we have: 1'1) $\{ ¬C \}, \{ C \}$ and for $B=1$: 1'2) $\{ C \}$. Now we can apply either PL or UL, satisfying this branch. For the right branch: 2) $\{ 0∨B∨C \}, \{ 1∨¬B∨C \}, \{ 1∨B∨¬C \}, \{ 1∨B∨C \}$. Simplifying again, we have: 2') $\{ B∨C \}, \{ 1 \}, \{ 1 \}, \{ 1 \}$. Here we can apply the Pure-Literal rule setting both $B$ and $C$ to $1$, proving again that the formula is SAT.
{ "pile_set_name": "StackExchange" }
Q: PHP date function producing incorrect result Am currently running the following PHP version on my laptop PHP Version 7.0.31-1+ubuntu16.04.1+deb.sury.org+1 Problem is when i run the below piece of code echo date('b e, Y', strtotime('2013-02-01')); i get the following output b Africa/Nairobi, 2013 and yet it is supposed to produce the following output Feb 1, 2013 What could be causing this? A: I think you might want to read the documentation for the date() function again. There is no b option that I'm aware of and: e - Timezone identifier (added in PHP 5.1.0) To achieve that result you'd want: echo date('M j, Y', strtotime('2013-02-01')); M - A short textual representation of a month, three letters j - Day of the month without leading zeros A: Try simply this M j, Y, See more formatting at official php documentation http://php.net/manual/en/function.date.php echo date('M j, Y', strtotime('2013-02-01')); M A short textual representation of a month, three letters e.g Jan through Dec j Day of the month without leading zeros e.g 1 to 31 Y A full numeric representation of a year, 4 digits e.g: 1999 or 2003 DEMO: https://3v4l.org/97Uvq
{ "pile_set_name": "StackExchange" }
A pharmacokinetic comparison of cefadroxil and cephalexin after administration of 250, 500 and 1000 mg solution doses. The pharmacokinetics of cefadroxil and cephalexin were examined following single oral doses of either 250, 500 or 1000 mg to a total of 36 healthy volunteers. The volunteers were divided into groups of 12 per dose-group and solution doses of cefadroxil or cephalexin were administered after an overnight fast according to a crossover design for the cephalosporins but not for doses. Serial blood and urine samples were collected from each individual and were analyzed for cefadroxil or cephalexin using validated HPLC assays with UV detection. The individual subject plasma concentration-time data for each cephalosporin were analyzed using noncompartmental methods. Profiles for cephalexin in plasma showed sharper and higher peaks than those for cefadroxil. Although values for the peak concentrations (Cmax) for cefadroxil were lower than that of cephalexin, the levels of cefadroxil in plasma and urine remained above the reported minimum inhibitory concentrations of susceptible organisms for longer period of time than those of cefalexin. The elimination half-life (t1/2) of cefadroxil (about 2 h) was significantly longer than that of cephalexin (about 1 h). The values for Cmax and AUC0-infinity values for both these cephalosporins showed dose-proportional increase, whereas t1/2, renal clearance (CLR) remained independent of dose. These observations confirm that cefadroxil and cephalexin obey linear pharmacokinetics. The CLr of both the cephalosporins were significantly higher than the average glomerular filtration rate at each dose level. The urinary recovery (% Xu) of each cephalosporin, accounted for over 80 per cent of the administered dose, and no significant differences in % Xu were observed between the two cephalosporins. These data suggest that the systemic availability of cefadroxil and cephalexin is similar at each dose level.
{ "pile_set_name": "PubMed Abstracts" }
Graded methylation in the promoter and body of the O6-methylguanine DNA methyltransferase (MGMT) gene correlates with MGMT expression in human glioma cells. Expression of the O6-methylguanine DNA methyltransferase (MGMT) gene in human glioma cell lines is strongly associated with resistance to the chemotherapeutic agent 1,3-bis(2-chloroethyl)-1-nitrosourea. To examine the possibility that methylation of the body and promoter regions of the MGMT gene is associated with MGMT expression in a graded, rather than a completely on/off fashion, the present study analyzed the methylation status of the MGMT gene in human glioma cell lines exhibiting a wide range of MGMT expression. Methylation in the body of the gene was uniform within each cell line and correlated directly with MGMT expression. The level of MGMT promoter methylation was also graded across the cell lines, at 21 of 25 CpGs tested, but correlated inversely with MGMT expression. Two sites in the MGMT promoter were also much more accessible to restriction enzyme digestion, and thus in a more open chromatin conformation, in nuclei from high MGMT expressors relative to nuclei from cells with little or no MGMT expression. We conclude that the level of methylation, in both the body and promoter of the MGMT gene, is associated with MGMT expression in a graded fashion and may be important in setting the transcriptional state of the MGMT promoter through changes in chromatin structure.
{ "pile_set_name": "PubMed Abstracts" }
Q: How to add a circle shaped button with swift? I am trying to make this simple UI Now the orange and darkblue are simple two views (the darkblue will have a nested tableview), but how would i make the button with some simple animation? Should i use CALayer or can i make use of the Interface Builder? A: I would have done it through code: let button2 = UIButton() button2.frame = CGRectMake(0, 0, 100, 100) button2.layer.borderColor = UIColor.whiteColor().CGColor button2.layer.borderWidth = 2 button2.layer.cornerRadius = 50 button2.setTitle("button", forState: .Normal) button2.backgroundColor = UIColor.blueColor() button2.addTarget(self, action: "buttonAction", forControlEvents: .TouchUpInside) button2.setTitleColor(UIColor(red: 233/255, green: 64/255, blue: 87/255, alpha: 1), forState: UIControlState.Normal) self.view.addSubview(button1)
{ "pile_set_name": "StackExchange" }
Q: Mechanize not logging in to site properly After spending the best part of 3 hours getting nowhere, i thought i would ask a question myself. i am using python and mechanize's Browser. I am trying to login to my home router. i can get to the login page, fill the password field (eg br.form['password'] = 'mypassword' etc), but now i am stuck because no matter what i try, i always get sent to a page saying i am forbidden/session has timed out i am handling cookies with a cookie jar, i have handled robots, but it still doesnt love me enough to let me login.... help? if you have any suggestions as to why i can not login successfully, please, please, please share xxx EDIT: it does have javascript, but i am simulating it **EDIT2:** i just realized that the javascript i am simulating is for pressing the disconnect button on the previous page...... probably fix my problem if i emulate the javascript for this page ...... i am faking the user agent i will have a look w/ wireshark xxx ps thanks for replying so fast xx UPDATE: sigh. i think it may just be one of those things where you just have to say f it and move on because i am emulating the javascript it needed exactly as it is done (just checking, MD5 == hashlib.md5("...").hexdigest()?).... thanks anyway people xxx A: Since you have to deal with Javascript, I'd try to use WebDriver. It has Python bindings and it's not that hard to use.
{ "pile_set_name": "StackExchange" }
Wegener's granulomatosis of the pediatric airway: a case demonstrating a conservative management approach. Subglottic stenosis is found in 10% to 20% of patients with Wegener's granulomatosis, and at times, it may be the only indication of disease. This is particularly a problem in childhood-onset Wegener's granulomatosis, which is complicated 5 times more by subglottic and tracheal stenosis than in adult-onset disease. Because this is a rare disease that is often misdiagnosed as reactive airway disease in childhood, the discovery of subglottic stenosis is delayed until much of the chronic damage has already been done. This report discusses the diagnosis and management of a 12-year-old male with a severe, actively inflamed subglottis and trachea because of Wegener's granulomatosis. This study uses a retrospective case review. The study shows a successful symptomatic medical treatment of subglottic stenosis with resolution of tracheal inflammation and subglottic stenosis. Treatment of an actively inflamed trachea with subglottic stenosis because of Wegener's granulomatosis should focus on medical therapy, including steroids, before making attempts at surgical intervention.
{ "pile_set_name": "PubMed Abstracts" }
/* * To change this license header, choose License Headers in Project Properties. * To change this template file, choose Tools | Templates * and open the template in the editor. */ package com.loiane.cursojava.aula36.labs; /** * * @author loiane */ public class Curso { private String nome; private String horario; private Professor professor; private Aluno[] alunos; /** * @return the nome */ public String getNome() { return nome; } /** * @param nome the nome to set */ public void setNome(String nome) { this.nome = nome; } /** * @return the horario */ public String getHorario() { return horario; } /** * @param horario the horario to set */ public void setHorario(String horario) { this.horario = horario; } /** * @return the professor */ public Professor getProfessor() { return professor; } /** * @param professor the professor to set */ public void setProfessor(Professor professor) { this.professor = professor; } /** * @return the alunos */ public Aluno[] getAlunos() { return alunos; } /** * @param alunos the alunos to set */ public void setAlunos(Aluno[] alunos) { this.alunos = alunos; } public String obterInfo(){ String info = "Nome do Curso = " + nome + "\n"; if (professor != null){ info += professor.obterInfo(); } if (alunos != null){ System.out.println("---Alunos---"); for (Aluno aluno : alunos){ if (aluno != null){ info += aluno.obterInfo(); info += "\n"; } } info += "\nMédia da turma = " + obterMediaTurma(); } return info; } public double obterMediaTurma(){ double soma = 0; for (Aluno aluno : alunos){ if (aluno != null){ soma += aluno.obterMedia(); } } return soma/alunos.length; } }
{ "pile_set_name": "Github" }
While the 8K camera race heats up, Cinemartin’s Fran 8K drops out. Coming from reports from Red Shark News, the long-anticipated Fran 8K Cinema Camera appears to be no more (read our original write-up on the project here). What we do know is that this is in no small part because its manufacturer company Cinemartin has reportedly gone out of business. Hopefully this will be a lesson for the rest of the industry as the ambitious Fran Cinema Camera was truly a monstrous (if not completely foolhardy) beast of a rumored offering which may have been too good to be possible. Let’s take a look at the 8K camera that almost was to see where it went wrong, and how both future manufacturers and consumers can learn from this camera’s passing. The Dangers of Shooting 8K While prototypes were released for hands-on reviews just a few months ago, the Fran appeared to certainly be a good deal away from completed. Advertised as a competitive cinema camera option, the goal was originally going to be an “8K for $8k” offering, however those prices still seem pretty ridiculous. (Almost as ridiculous as their preview video which Philip Bloom teased above. You can watch it in all of its glory below.) From the company’s website, the Frank 8K promised the following specs: 8K (7920 x 6024 pixels) 47.7 MP G.S. 4:4:4 Raw Dual ISO 15.5 Stops of Dynamic Range Internal Downsampling VistaVision RAW + LUT support Avid Prores Realtime Post Assist Tools Along with other offerings including “pleasant skin tones” and HDMI, USB & Thunderbolt ports and SD card slots which weren’t all included in the prototypes. But 8K IS on its Way Yet, while news of the Fran 8Ks passing, it’s probably best to assume that this will do little to deter the competition from continuing to chase 8K. Sony has teased an 8K sensor for its next generation of cameras, while Canon has been as bold to promise an 8K EOS R already “on the roadmap”. What this news can teach us though, as consumers and professional users in the industry, is that these first generations of prosumer 8K cameras are indeed difficult to pull off. Chasing 8K resolution absolutely pushes camera design theoretical limits and could mean that some of these early 8K options might struggle in first-gen models with over-vexed 8K recording (and other areas which may have fallen to the wayside). So, unless you're absolutely sure 8K is for you, it might be best to wait for the first wave of 8K to come and go before you settle on the best option to invest in. Otherwise you might end up looking like Fran 8K himself.
{ "pile_set_name": "OpenWebText2" }
With the world’s attention fixed on the horribly violent persecution of Burma's Rohingya Muslims, Christians are also suffering from a less visible but also brutal mistreatment and ethnic cleansing campaign at the hands of the Burmese Army, according to aid agencies, human rights groups and U.S. officials. The campaign against the Christians, which according to estimates has displaced at least 100,000 people, has also left thousands stranded in the Burmese jungle terrain, either from fleeing heavy bombing, or living in fear of what will come when the current monsoon season ends. “Christianity is under direct attack by the Burma Army. Christians have repeatedly been singled out for rape, torture, and death over the course of this war, and that trend is continuing,” Ephraim Mattos, East Asia Operations Manager for The Nazarene Fund (TNF), a humanitarian group that works to support the plight of Christians worldwide, told Fox News. “In Burma, if you don’t fall into the category of being Buddhist and ethnic Burmese, then you are considered second-class, and not worthy of the full rights of a citizen.” Christians in Burma, also known as Myanmar, make up an estimated 8.2 percent of the Buddhist-dominant population - or around four million people. Many of those Christians live in the often undeveloped, neglected periphery states. Christian groups backed the British against Japanese occupiers during World War II, and were once promised a homeland of their own. But they have instead encountered nearly seven decades of protracted war with the iron-fist Burmese military – suffering significant persecution ranging from rape, murder and forced conversions to labor conscription. They are also being forced to use their own bodies to enter landmine-peppered areas in “clearance” for Burmese troops, according to reports. The Christians can only wait for what is likely to be an expanding campaign of ethnic and religious purging. The Burmese military operations are carried out like clockwork along the border provinces – moving from the western Rakhine state against the Rohingya up to the Christians and ethnic minority groups in the neighboring fringe state of Chin, around to the northern state of Kachin, down to the southeastern region of Shan, and then further south to the Karen – also called Kayin. “Today, religious and ethnic persecution continues to take place, both against the Rohingya, but also against Christian religious minorities,” affirmed Olivia Enos, policy analyst for the Asian Studies Center at The Heritage Foundation. “Christian Karen, Kachin and in Shan state have largely fallen off of the international community’s radar – but their plight is similarly severe. Kachin, for example, are being virtually collectivized – churches burned, land seized, women raped, and children killed before their very eyes. Not unlike what Rohingya experienced.” In Kachin state, some 60 churches are reported to have been bulldozed by the Burmese Army in the last five months alone, replaced by Buddhist temples. The Kachin people, who have also endured a decades-long struggle for equal rights and self-determination, have faced an alarming uptick in violence since the start of this year. Almost 7,000 villages of the Christian stronghold have been upended and just last week, a Burmese army-backed militia allegedly battered two youth pastors with rifle butts after they requested they stop decimating homes. Then there are the ethnic Karens, whose leadership is mostly Christian, as are large swaths of the group's population. Mattos said the recent increase in anti-Christian activity prompted the need for TNF to go beyond their fundamental rescue and relief efforts, and prepare the Karen people for “inevitable attacks that are coming.” “We are creating an early warning communication network in the villages closest to the Burma Army outposts. This allows entire villages to evacuate before the Burma Army arrives, and to coordinate with other entire villages under attack to ensure fleeing civilians are not running in the wrong direction and into a trap,” Mattos explained. “The communications network also allows relief personnel the ability to respond in a timely manner to provide the villages with food, shelter, and safety.” In early May, the Burmese Army marched in – under the auspices of re-building a strategic road that runs through the heart of Karen land – and heavy fighting subsequently broke out between the military and Karen fighters. “Even though the Burma Army eventually pulled back their troops in preparation for the June rains, they told the Karen leaders that they will come back,” Mattos said. “It is not a matter of ‘if’ the Burma Army will attack the Karen, but rather ‘when.’ And many predict it will be this fall, when the rainy season ends.” BURMA'S KAREN REFUGEES FACE DWINDLING AID, STRUGGLE WITH DEPRESSION AND SUICIDES ARCHAEOLOGISTS FEAR BIBLICAL ARTIFACTS, MONUMENTS WON'T SURVIVE YEMEN WAR Christians are also tormented in more subtle ways. Saw Kwe Htoo Win, Vice Chairman of the Karen National Union (KNU), noted that even though they are constitutionally now allowed to teach their language and faith in the classroom, the central government brings in educators who are Buddhist, and speak only Burmese, meaning they have to scramble funds to try and keep their religion and ethnic tongue and tradition alive through church classes. Moreover, District Chairman of the Hpa-an region of Karen state, Padho Aung Maw Aye, told Fox News he knows of cases where Christians in the community had applied to the central government for identification cards, only for the cards to be returned with “Buddhist” listed. After issuing complaints, the recipients were then dismissed and told “you can change it later.” Nonetheless, Ta Doe Moo, Secretary-General of the KNU, said Christianity is steadily growing in Burma, despite what appears to be an apparent prohibition on private Christian services. “Around the Yangon city area, we are receiving information that the government is not allowing Christians to hold services in their homes. They can go to church, but leaders have been issued orders not to have religious gatherings at home,” he said. But bringing to life new churches, Moo said, is a problem because the government denied their requests to build or rebuild. He also said the discussion of faith has become more illuminated inside Burma, too, in recent years. “It used to be when I was young that whether you were Muslim, Christian or Buddhist, it was never talked about and it didn’t matter,” Moo continued. “Now, that is very different.” A U.S. State Department religious freedom report, released in late May, said the Burmese government is “doubling down” its campaign against ethnic minorities, and waging a new campaign of brutality against the Christian minority that has left more than 100,000 civilians displaced and trapped amid the hostilities. Late last year, the U.S again designated Burma a “Country of Particular Concern” (CPC) for violating religious freedom. “The United States calls on all parties in Burma’s internal conflicts, including the military, to end violence and respect and protect the human rights of Burma’s diverse population,” a U.S. State Department spokesperson told Fox News. “We urge the Government of Burma to protect the religious freedom of all people in Burma.” The U.S Commission on International Religious Freedom (USCIRF), an independent federal government commission, issued a more blunt assessment. “Discrimination and violence against Christians and other religious and ethnic minorities in Burma has been ongoing in the country’s decades-long civil war between the military and several ethnic groups,” said the Vice Chair and Commissioner Gayle Manchin. “After witnessing the large-scale extermination of Rohingya Muslims, other religious and ethnic communities are right to be concerned that Burma’s military may do the same to them, especially since it operates with zero accountability and near total impunity.” The Myanmar Embassy in Washington and the UN delegation in New York did not respond to multiple requests for an interview and comment on this story. But the government has officially and routinely insisted ceasefire agreements with ethnic minorities are holding, and has denied charges of religious or ethnic persecution. Burmese officials have claimed they merely responded to Rohingya insurgent attacks on security forces last August, despite claims from State Department investigators that the clampdown was planned months in advance. In contrast, Christians inside Burma worry that – with little attention from the international community in the dark shadow of the Rohingya tragedy – military rule will operate against them with impunity. “Very few people are interested in our issue, we are struggling for the support of the people and it is becoming harder and harder to be a minority,” Moo added. “Without support, we cannot sustain in Burma. To the government and military, it is one language, one literacy, one religion.”
{ "pile_set_name": "OpenWebText2" }
Alan Byrne (Gaelic footballer) Alan Byrne is an Irish sportsperson who currently plays Gaelic football for Wicklow Senior Football Championship team Annacurra and is a member of the Wicklow senior team since 2003. Byrne predominantly plays as a corner back for Wicklow but plays in many central positions from centre back to centre forward for his club. Playing career Intercounty Byrne had a distinguished underage career at intercounty level playing both minor and under 21 for the county for numerous years. On the back of his performances he was called into the Wicklow Junior team that won an All-Ireland Junior title in 2002 where he played in the corner back position. The following year, he was a member of the senior side and made his championship debut as a sub vs Louth. He spent some time in the intercounty wilderness following the arrival of Hugh Kenny as manager. In 2007, Mick O'Dwyer arrived and Byrne has been an ever present since. Over the last number of years, he has won Tommy Murphy Cup in 2007 and a NFL Division 4 title in 2012. He scored his first intercounty point with the last kick of the game against Waterford in the 2012 qualifiers to force extra time which eventually saw Wicklow progress onto the next round. As a result of this performance he made the Irish Independent team of the week. Club Byrne's club, were involved in numerous heartache during the 2000s. They lost consecutive county finals to Ashford, Blessington, Newtown (after 2 replays and 2 periods of extra time) and Avondale. They then lost the 2008 final to Carnew before finally gaining senior status in 2010 with a narrow win over Éire Óg Greystones. Alan captained the team to this title and as a result of his performances over the year, he was awarded the Intermediate Player of the Year for the second occasion (first in 08). References * Category:Year of birth missing (living people) Category:Living people Category:Wicklow inter-county Gaelic footballers
{ "pile_set_name": "Wikipedia (en)" }
// // FCViewController.swift // Example // // Created by Teodor Patras on 15/07/16. // Copyright © 2016 teodorpatras. All rights reserved. // import UIKit class FCViewController: CacheableViewController { override class var cacheIdentifier: String { return "FCViewController" } override func viewDidLoad() { super.viewDidLoad() self.title = "First" view.backgroundColor = UIColor(hue:0.57, saturation:0.90, brightness:0.53, alpha:1.00) } }
{ "pile_set_name": "Github" }
The serine proteases CspA and CspC are essential for germination of spores of Clostridium perfringens SM101 through activating SleC and cortex hydrolysis. Clostridium perfringens SM101 genome encodes three serine proteases (CspA, CspB, and CspC), and genetic evidence indicates that CspB is required for processing of pro-SleC into active SleC, an enzyme essential for degradation of the peptidoglycan cortex during spore germination. In this study, the expression of cspA and cspC, as well as the germination and colony formation by spores of cspAC and cspC mutants of strain SM101, were assessed. We demonstrated that 1) the cspA and cspC genes were expressed as a bicistronic operon only during sporulation in the mother cell compartment of SM101; 2) both cspAC and cspC mutant spores were unable to germinate significantly with either KCl, l-glutamine, brain heart infusion (BHI) broth, or a 1:1 chelate of Ca2+ and dipicolinic acid (DPA); 3) consistent with germination results, both cspAC and cspC mutant spores were defective in normal DPA release; 4) the colony formation by cspAC and cspC mutant spores was ~106-fold lower than that of wild-type spores, although decoated mutant spores yielded wild-type level colony formation on plates containing lysozyme; 5) no processing of inactive pro-SleC into active SleC was observed in cspAC and cspC mutant spores during germination; and finally, 6) the defects in germination, DPA release, colony formation and SleC processing in cspAC and cspC mutant spores were complemented by the wild-type cspA-cspC operon. Collectively, these results indicate that both CspA and CspC are essential for C. perfringens spore germination through activating SleC and inducing cortex hydrolysis.
{ "pile_set_name": "PubMed Abstracts" }
The term “spontaneous combustion” may seem like an idea from a fantasy movie or tabloid newspaper, but in fact, spontaneous combustion is a serious source of fires in home and garage workshops, as well as on farms. According to the U.S. Fire Administration, spontaneous fires are one of the leading causes of fires in agricultural storage facilities (i.e., barns, silos, stables, etc.). How Spontaneous Combustion Occurs The name is a little misleading, though. Spontaneous combustion doesn’t occur without cause. All fires, including those ignited “spontaneously,” require three elements: fuel, oxygen and a source of heat. Normally, we think of a source of heat as something with an open flame, but, in spontaneous combustion, there is no flame causing the heat. Spontaneous Combustion and Rags Spontaneous combustion becomes a possibility when flammable finishes like linseed or tung oil combine with air and oxygen in a natural chemical reaction that creates heat. In farm situations, the chemical reaction involves organic materials like hay, straw or grains beginning to ferment or break down—a process that creates natural heat. If you have ever noticed the heat generated in a gardener's compost pile, the same principle applies to hay or straw stored in a barn. In open-air environments, the heat generated from these natural chemical reactions is usually not a problem, and may not even be noticed, since the heat is easily dissipated and never builds up to a temperature that can ignite the materials. But when the oxidizing chemical reaction is confined in a way that prevents the heat from dissipating—such as when oily rags are bunched up in a closed area—it is possible for the heat to climb to a level that will ignite the substances. If other combustible materials are nearby, this little act of magic can quickly develop into a full raging fire. The reason why there are so many instances of farm fires caused by spontaneous combustion is that substances like hay and straw have a relatively low ignition point, to begin with. Preventing Spontaneous Combustion Preventing spontaneous combustion from occurring is as simple as practicing a little routine housekeeping. Anytime you have an oily rag left over after some wood-finishing or another project, hang it up to dry, preferably outdoors. You can use a clothesline or a fence, but just be sure to isolate each rag individually. Don’t pile them on top of each other. And if you need to hang them indoors, keep them away from heat sources, such as water heaters or furnaces.
{ "pile_set_name": "OpenWebText2" }
Olive Jade Metaphysical Healing Properties and Magical Meanings of Olive Jade Olive Jade is well known for its pale green apple colour and is thought to be a very lucky stone. It is a good choice for healing the heart chakra and working with the splenic chakra. It is felt to be good for both the physical and emotional heart. This is a joyful stone that promotes optimism, encouraging us to release old issues of hurt that no longer serve us. It is a good choice for removing bitterness and fear of the future bringing balance to all the chakras.
{ "pile_set_name": "Pile-CC" }
Understanding quality of life and well-being for people living with advanced dementia. To investigate the quality of life (QoL) and well-being of people living with advanced dementia in care homes. A mixed-methods approach was taken combining participant observations, interviews with the participants' families and carers, and quantitative measurements. The quantitative measures included AwareCare assessments, QoL in Late-Stage Dementia scale ratings and semi-structured interviews with relatives and staff members. Ryff's psychological well-being framework, the Fairness, Respect, Equality, Identity, Dignity, Autonomy principles, and Kitwood's indicators of well-being, were examined to attempt to identify contributors to QoL for people living with advanced dementia. Participants had limited verbal abilities, but used non-vocal behaviours to communicate. These behaviours influenced their QoL and well-being. The indicators of well-being in Kitwood's personhood model were helpful in describing how relatives and staff perceived the QoL of the person with dementia.
{ "pile_set_name": "PubMed Abstracts" }
More about photographer4me.co.uk If you are trying to find wedding photographers in the UK for a special project then this is the website for you! Here you will find a number of professional and affordable wedding photographers located all over the country who can help you with all of your photography needs. All you need to do is post the details of your job then choose the person you feel is best suited! It is completely free to use this service, just make sure that you list your estimated budget and start date along with the region the project is based. You can then receive and compare quotes and ask any questions you may have via the site for a simple and secure way of finding the right photographer. If you are a local photographer looking for work then you can also create a profile and include samples of your work to help people see what you are capable of and the areas that you specialise in. Wedding photographers (and other photographers) in the UK can enjoy a new way to find work with no lead fees or commission fees. Photographers can select unlimited categories as well as an unlimited number of regions, submit unlimited quotes and work samples. You will also receive job alerts which will be just for the specific categories, such as wedding photographers, you have chosen so you will not waste your time reading non-relevant job posts.
{ "pile_set_name": "Pile-CC" }
Structure-Based Design Identifies PROTAC Degraders of BAF Complex Subunits. Proteolysis targeting chimera (PROTAC) degraders of SMARCA2 and SMARCA4 have anticancer activity.
{ "pile_set_name": "PubMed Abstracts" }
/** * Copyright 2019 The JoyQueue Authors. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.joyqueue;
{ "pile_set_name": "Github" }
Q: Can't deny user access to a library when he is inside the "All Users" group I'm trying to give an user access to just one folder in our main library, first I gave him permission to access the Site and then I went on the folder that I would like him to have access to and stopped inheriting the permissions, then I added him as an Editor. The problem that I'm having is that when I give him permission to access the Site he's added in to a group called "All Users" and this group is granted access by default to the entire library, what I expected was to see him listed outside of the group where I could edit the Library permissions and remove him. I would appreciate any help on this. Thanks I'm on SharePoint foundation 2013. A: i dont know if you have done this: but cant you give access to the list only? you dont need to give him/her access to the site... You need to goto the list settings and remove inheritance. Now go to permissions for this list and add the user there! Remove any instance of the user from the site groups and users. when the user access the list directly(url to list) obviously he would have access depending on what view you gave him to have access to. If he were to try and goto any other page it would show an access denied page!
{ "pile_set_name": "StackExchange" }
Q: mysqli - php - returning all results from multiple tables There is actually alot of answers for questions like that. But everything I found around here was to Join two tables with "like" values. But that isn't what I need. I want to query two tables, that is almost exactly the same but with different values inside of it. tbl_one and tbl_two (exemple names) has "id, title, date, content" its just the same. But inside of tbl_one has differente values of tbl_two. And then, it's time to query. I could make two queries calling for tbl_one and after tbl_two, but it means that I'll have to print in different "whiles" and I don't want this. I need to print the results in only one "while", so I thought about one query to result from different tables, is that a way to do this? For make it straight, I need to print the results in a while like this: while($row = $result->fetch_array()) { // my results printed } Where $result is the result from the query from the two previous tables. I tried... "select * from tbl_one, tbl_two". Life would be a lot easier if this works. A: Use union all to combine your queries i.e. select * from tbl_one union all select * from tbl_two
{ "pile_set_name": "StackExchange" }
Mercedes Department Mercedes Department is a department of Corrientes Province in Argentina. The provincial subdivision has a population of about 39,206 inhabitants in an area of , and its capital city is Mercedes, which is located around from Buenos Aires. It is the site of the Battle of Caaguazú during the Argentine Civil War in 1841. Settlements Felipe Yofré Mariano I. Loza Mercedes External links Mercedes website Category:Departments of Corrientes Province
{ "pile_set_name": "Wikipedia (en)" }
K-Nearest Neighbors from Scratch - craigkerstiens https://lettier.github.io/posts/2016-06-10-k-nearest-neighbors-from-scratch.html ====== Radim While the topic may seem trivial and the execution/implementation a bit too naive, it should be noted the author is a _graphic designer_! Check out David's homepage [0] -- original, if not very practical :-) I personally think it's great to see such cross-pollination between various fields. It helps other newcomers to read about this stuff "in their own language", using a perspective of someone from their own field (as opposed to the usual academic / old-hand angle). [0] [http://www.lettier.com/](http://www.lettier.com/) ~~~ hugh4 Maybe, but if the new cross-pollination just confuses the issue rather than clarifying it, what's the point? "Suppose you have a bunch of flowers in a field, and they're planted so that the east-west direction corresponds to the diameter of the flower and the north-west direction corresponds to the length of the leaf." "Huh?" "Suppose you have a bunch of data points in an n-dimensional space" "Oh, gotcha" ~~~ spdustin What an exclusionary thing to say. Was that your intent? ~~~ hugh4 That's not even a word. ~~~ spdustin [http://www.dictionary.com/browse/exclusionary](http://www.dictionary.com/browse/exclusionary) Of course, I did hear that _gullible_ was removed from the dictionary during an annual meeting of linguists in Leeds last year. ------ henryw Pretty neat for implementation used as a tutorial. A more industry standard implementation would probably use a tree of some type to reduce the space and search time. For example [https://en.wikipedia.org/wiki/K-d_tree](https://en.wikipedia.org/wiki/K-d_tree) in [http://scikit- learn.org/stable/modules/generated/sklearn.nei...](http://scikit- learn.org/stable/modules/generated/sklearn.neighbors.KNeighborsClassifier.html) ------ bra-ket very nice write-up. if you're interested in this, the next logical step is to look at 'locality-sensitive hashing' and some simple state-of-the-art methods: [https://github.com/spotify/annoy](https://github.com/spotify/annoy) ------ leecarraher this description of linear scan kNN may be a bit tedious for the hacker news crowd. here's the gist (in python): def knn(y,X,k): d = len(y) least = [(float('inf'),[float('inf')]*d) for i in xrange(k)] for x in X: d = 0.0 for i in xrange(len(x)): d+=abs(x[i]-y[i]) if d < least[k-1][0]: least[k-1] = (d,x) least.sort() return least Sorting even for linear isn't the best idea but keeps the algorithm terse. A data structure like a priority queue should probably be used instead of an array. and one should use a kd tree or ball tree for exact, and LSH-knn for inexact in practice. ~~~ thomasahle You can use `heapq` from the standard library to at least go from `n k log k` to `n log k`. ------ theoracle101 Why not just use a kd tree or voroni? ~~~ jeena How would you learn how to implement that algorythm if you'd just use an existing implementation? ~~~ AReallyGoodName Read the wiki page on it, run through the psuedocode on pen and paper a few times and then implement it. Source: I did this when I wrote a library for reverse geocoding which uses a kd tree. [https://github.com/AReallyGoodName/OfflineReverseGeocode](https://github.com/AReallyGoodName/OfflineReverseGeocode)
{ "pile_set_name": "HackerNews" }
California taxpayers, who already pay for prison chaplains covering such faiths as Catholic, Jewish, Muslim, Protestant and American Indian religions, might have to add witches to the list. A lawsuit working its way through the federal court system would require state prisons to hire Wiccan chaplains. Two female convicts who practice Wicca sued the state for refusing to hire a paid full-time Wiccan chaplain and “by failing to apply neutral criteria in determining whether paid chaplaincy positions are necessary to meet the religious exercise needs of inmates adhering to religions outside the five faiths (Catholic, Jewish, Muslim, Native American and Protestant),” according to an appellate court’s decision. A federal court in Fresno, Calif., dismissed the lawsuit in 2011 after finding no violations in the women’s rights, but the 9th U.S. Circuit Court of Appeals brought it back to life this week by overturning the trial court’s decision. The San Francisco-based appellate court ordered the original judge to reconsider the case and determine whether state prisons unconstitutionally cater to majority religions, Judicial Watch reports. The appellate court wrote that if the allegations are true, “the prison administration failed to employ any neutral criteria in evaluating whether a growing membership in minority religions warranted a reallocation of resources used in accommodating inmates’ religious exercise needs.” While “the First Amendment does not require prison administration to provide inmates with the chaplain of their choice,” the state does require it to employ neutral criteria in deciding where funds are allocated, the decision reads. Sign up for Daily Newsletters Manage Newsletters Copyright © 2020 The Washington Times, LLC. Click here for reprint permission.
{ "pile_set_name": "OpenWebText2" }
Reproducibility of digital subtraction fluoroscopic readings for coronary artery calcification. Digital subtraction fluoroscopy, an inexpensive screening test for coronary atherosclerosis, is highly sensitive in detecting coronary calcifications. However, no previous study has reported interobserver agreement for this test. Six hundred and thirty-one subjects underwent digital subtraction fluoroscopy in the 60 degrees left anterior oblique projection. Images were acquired with pulsed fluoroscopy at 15 frames per second. An averaged mask was subtracted from successive images. These fluoroscopic images were stored on a digital disk and replayed in cine loop format. An observer, blinded to clinical information, read the fluoroscopic studies for the presence of calcium in the left main-left anterior descending artery, circumflex artery, and right coronary artery. The images were then stored on digital tape and reread by a second blinded observer. The percentages of interobserver agreement regarding the presence and absence of calcium in left main-left anterior descending, circumflex, and right coronary arteries, were 91.9%, 92.9%, and 92.2%, respectively. The overall kappa values, which are 0.85, 0.77, and 0.82 in left main-left anterior descending, circumflex, and right coronary arteries, respectively, show a highly significant level of agreement (P < .0001). Digital subtraction fluoroscopy is a reliable screening test for coronary calcifications.
{ "pile_set_name": "PubMed Abstracts" }
Q: Scrambled number conversion for numbers with 10 or more digits This is a quite simple piece of code. It takes an integer and decomposes its decimal digits using quotient and remainder. On each call, it prints a line with r characters 'I', where r is the last digit, then calls itself with the quotient as its new argument. decToUnary 0 = return () decToUnary n = let (q, r) = quotRem n 10 in do putStrLn (take r "IIIIIIIIII") decToUnary q It works correctly for numbers with less than 10 digits, but for 10 or more digits it scrambles the output. What am I doing wrong, and why does it work this way? Here are some examples of output, the first is correct, the second is wrong: *Main> decToUnary 5432 II III IIII IIIII *Main> decToUnary 5432101234 IIIIIIII III IIIIIIIII III III I IIIIIII III I I A: This is an integer overflow question. maxBound :: Int is 2147483647 (on 32-bit machines), so values greater than that overflow. Use Integer instead of Int: Integer is not a fixed length integer so it won't overflow. Edit: As applicative notes, you will then need to replace the take r "IIIIIIIIII" with take (fromIntegral r) "IIIIIIIIII" or genericTake r "IIIIIIIIII"; I'd prefer genericReplicate r 'I'. genericTake and genericReplicate are both in Data.List.
{ "pile_set_name": "StackExchange" }
An Edmonton judge found notorious homicide suspect Travis Vader not guilty Wednesday of threatening to kill a guard at the former downtown remand centre. Provincial Court Judge Ferne LeReverend acquitted Vader of the charge of uttering a death threat after ruling the Crown had not proven it beyond a reasonable doubt. LeReverend said she could not say "the threat did not take place," but took issue with the evidence of the jail guard involved, saying she had "concerns" over his testimony, the report he filed about the incident and information he gave to an investigating police officer. During the Aug. 20 trial, the Edmonton Remand Centre (ERC) correctional officer testified Vader, 42, said to him on July 22, 2012, that "when I get out of here, I am going to find you and I am going to f...ing kill you." He also told court the heated incident, which happened at the old downtown remand centre, stemmed from Vader wanting to be allowed to go to the visiting area so he could review legal disclosure on a laptop computer. The guard said Vader was yelling at him, but made the threat in a "quiet" voice. He added that he is now "more concerned" about the alleged threat since the murder charges Vader had been facing regarding the disappearance and presumed slaying of seniors Lyle and Marie McCann have been stayed. Taking the witness stand in his own defence, Vader testified that he never made the alleged threat. The Edson-area man, who remains in custody at the ERC and was shackled during his testimony, told court that guards were mad at him for filing a lawsuit alleging he was being mistreated and he was being punished. Vader also testified that the guard constantly called him a "piece of shit" and told him he hopes he enjoys being in the Max as a result of him killing "those people." First-degree murder charges relating to the McCanns were stayed against Vader on March 19. The McCanns -- Lyle, 78, and Marie, 77 -- were last seen fuelling up their motorhome in St. Albert on July 3, 2010, while en route to Chilliwack, B.C., for a vacation. Two days later, their RV was found engulfed in flames near the Minnow Lake campground, 20 km east of Edson. The SUV they were towing was discovered six days later in a remote wooded area near Carrot Creek, 30 km east of Edson. Their bodies have yet to be recovered, although police declared them dead and presumed murdered. Vader has also filed a $1-million lawsuit, alleging RCMP misconduct, malicious prosecution by the Crown and abusive mistreatment by correctional officers. Vader is slated to be back in court on Monday to face a retrial relating to a June 2010 incident near Barrhead for which he is accused of stealing a truck and trafficking in methamphetamines.
{ "pile_set_name": "OpenWebText2" }
Pimpernel Product Information The new Pimpernel is now brought to you by Portmeirion, the brand you can rely on for beautiful tableware. Each Pimpernel piece, from cork-backed coasters and placemats to melamine trays, is still made with the utmost care and attention to detail. A variety of designs are available, from classic Pimpernel favorites to new, refreshing patterns designed by Portmeirion. There's sure to be a design to fit the style you're looking for, whether it is relaxed, formal, classic or contemporary. Placemats and Coasters Pimpernel uses consistently high quality standards and manufacturing methods to produce the world's finest placemants and coasters. Using top quality eucalyptus wood and cork, farmed from environmentally managed forest, each placemat has a unique protective coating which gives almost complete resistance to any kind of scuff marks or stains. Pimpernel placemats are heat resistant to 110°C (230°F), easy to wipe clean and will not peal away at the edges even after repeated use. The finest available, Pimpernel's range of versatile dishwasher safe worktop savers are ideal for cutting, preparing and serving food. Manufactured from the highest quality toughened glass, the hygenic stain and odor resistant surface will not scratch so minimising andy build up of bacteria. Non-slip feet and cool, smooth glass also make them perfect for rolling pastry, kneading dough or serving cheese. Worktop Saver - 16" X 12" - Tempered Glass Melamine and Sandwich Trays These trays are made from the finest food grade Italian melamine. They feature a protective glazed finish which has been developed for easy cleaning, and are also dishwasher proof and heat resistant up to temperatures of 125°C (255°F). Packaged in attractive boxes containing two mugs and two co-ordinating coasters, these beautiful mug and coaster gift sets are made from the highest quality fine porcelain. These elegantly shaped mugs have a 13oz. capacity and are suitable for use in a dishwasher or microwave.
{ "pile_set_name": "Pile-CC" }
Description Join your guides Brady Gaster and Cory Fowler as they talk to the product teams in Redmond as well as the web community. In this episode, Brady and Cory talk to Guang Yang from the Windows Azure SDK team to discuss some awesome new features. First, Guang talks about the new Ruby SDK, which exposes Windows Azure Storage and Service Bus to Ruby programmers. Then, Guang goes on a deep dive of the new Log Streaming feature available in the Node.js CLI tools and the Powershell Cmdlets. If you'd like to see how you can view your logs in real-time as users hit your Windows Azure Web Site, Guang shows you how in this episode.
{ "pile_set_name": "Pile-CC" }
Menu cycling That’s a lie. I know why. I eat too much, too often, and too late. Or I don’t eat, and then I go low or get super hungry, and then I eat all the things. Dang those holiday treats! I haven’t been working out, exercising, or bringing sexy back. I have a gym membership, so accessibility to a place to exercise certainly isn’t the problem. I always find some seemingly good excuse for not getting there. First I was busy trying to find a new place to live. Then I was busy moving. Then I hurt both hands during the move. Then I got even busier than usual at work creating something that I am extremely excited about. We are starting a new diabetes journal, available to all, and we’re now accepting research and volunteers to be peer reviewers. Check out The PLAID Journal. You can see a couple of videos and news articles about the The PLAID Journal on the Announcements page. Also, the Facebook page for PLAID. (Lots more to come on PLAID, so stay tuned.) Then the knee that I hurt while cycling several years ago flared up again. Add to all of that an ever-growing to-do list, and there is always something that keeps me focused on something other than me. I hate it. I hate the feeling of my blood sugar being high. I hate that I can’t get my BG to stay where I want it. I hate when I prick my finger and see a number that is dramatically higher than I feel because my body is getting used to it. I hate being thirsty. I hate waking up in the middle of the night to go pee. I hate thinking about it. All. The. Time. I also hate being overweight. I hate feeling like I am the overweight that I am. I know that we’re in an age where we are supposed to accept our bodies and all that jazz, but this is not normal. I can’t just accept this. I don’t feel like me at this size. I feel like I’m stuck in a heavy fat suit, and everything I do is just that much harder because of it. But for whatever reasons, I can’t seem to change it. Before April of this year, I was on Weight Watchers, and I was doing pretty well with it. I had lost over 10 pounds in three or four months, and was feeling pretty good. I was on track to get back to a weight and size that I wanted to be. And stronger. And back to a more human shaped geometry, instead of just round. Today, I’m the heaviest that I’ve every been. Almost 207 whopping pounds. I put that out there for no other real purpose than to make it real. I should be about 170, in an ideal world. And I’ve seen a human skeleton. Short of an anatomical anomaly, there is no such thing as “big boned.” I’m just plain old overweight right now. As joyous as April started out with Amanda and I tying the knot in beautiful Key West, it ended in tragedy with the loss of our precious little cat Squirt, and I know that losing her has played a role in where I am now. To some it may sound silly (she was so much more than “just a cat”), but she was a part of my life every single day for nearly 14 years. It feels like the loss of an immediate family member, because that is exactly what it is. I think dealing with that loss, on top of everything else already mentioned, has made me do things like eat my emotions and talk myself out of doing fun active things. Working out and exercising has always been like therapy to me. Be it gym, walking, running, or cycling, it’s a safe place for me to get out all of my stress, frustration, anger, aggression, sadness, and any other negative emotions that I’m dealing with. Some days I only need 30 minutes or so. Other days I might need a couple of hours. It also makes sure that I have a few minutes during normal human hours of the day that are just for me, Martin Wood, where I’m not making sure that the needs of everyone else are being met. It’s my career choice to help people, and it is a major part of who I am, and I love it, but sometimes in order to help people we have to make the time to help ourselves. I haven’t been doing enough of that. Now that we are in a neighborhood where there is less chance of going for a walk or run and interrupting a drug deal, I finally feel that spark of motivation to get out of the house and move around. I also enjoy doing other things, like reading, video games, movies, and basically anything that doesn’t involve repairing yet another kitchen appliance in my house. Sometimes it’s hard to make room for those things, but we have to. Down time is as necessary to life as to-do lists and full calendars. A friend said recently that “cancelling a holiday commitment is like heroin.” Try it. Substitute an evening on the couch with the dog and the first half of this season of The Walking Dead. (Beth…noooooo!!!) Life with diabetes is freaking hard, man. Life with diabetes is about so much more than just diabetes. Life with diabetes is a complicated balance of biometrics, medical therapies, activities, unexpected events, important considerations, random emotions, bright sides, dark places, and things left unsaid that have to be factored into an inarticulate equation that hopefully results in a personal definition of success. All of this is what it takes to get my A1C where I want it, to get my BG’s on a more level plain instead of high or bouncing all over the place, to get back to Weight Watchers and better control of all of the delicious things that I’ve been cramming into my face hole, to develop the strength and stamina to avoid future injuries, and to drop some pounds and be able to haul ass without it taking two trips. That is what it takes to focus more on the things that I do have in my world that bring joy, for me, Martin Wood. Like these two… That is what it takes to start to feel better. To feel happy. To feel able. To feel normal. And if I can’t do it on my own, then I’ll have to figure out who the right people are and get them on my bus to help me get further along down that road. For now, it’s one mile at a time. The past few days have been a rollercoaster of educational opportunities and lessons learned for me. It’s as if I’m stuck in the Robert Frost poem about two trails diverging in the woods, and I’m constantly finding myself on the one that is less traveled. Of course, the road less traveled is the one that is supposed to make all the difference. That whole “thrive through adversity” thing, I guess. If I’m being honest though, it’s exhausting always traveling that path. Sometimes I’d like to just travel the well worn option, where I can proceed without so much resistance. I remember my mom telling me when I was growing up that when you’re stressed out and upset, you have to find your stressors, and get rid of them. That sounds so easy, but in reality, there are a lot of stressors that we have no control over. Sometimes, it doesn’t matter what you do, it’s never going to be perfect, right, or appropriate for everybody. That is exactly where I’m at right now. From nasty emails that completely blow non-issues out of proportion, to trying to lead a group of people with shifting priorities in all directions, to dealing with supposed professionals behaving unprofessionally, I feel like I’m traveling down a path that more closely resembles a briar patch than it does a simple path less traveled. It’s hard not to internalize times like these, especially when there are conflicting reports about whether or not you are doing a good job. It’s hard not to take it personal. Sometimes I just need someone to say, “Martin, I know this is hard, and I know you feel like the world is against you because of these few small things, but you’re good enough, you’re smart enough, and gosh darn it, people like you.” Preferably in the Stuart Smalley voice. Short of that, I’d settle for someone that knows just telling me that I’m doing the right thing, because sometimes I’m just doing the best I can and hoping that is good enough. I guess this is the part that I could link to diabetes. Fortunately, and thankfully, it’s not my diabetes that is giving me the hardest time right now. I’m waiting on new test strips to get approved by my insurance company and arrive, sure. I need to order pump supplies, of course. But really, those things are just another day with the “D.” I did get to Skype with some amazing Students With Diabetes from Tampa last night, and that was awesome! I love hanging out with people with diabetes (PWDs), even if it is virtually. They certainly reminded me that not all is awful in the world, and even if we get the diabetes blues, PWDs are resilient and forever hopeful. That is what I have to remember right now. There is hope. Better days are just around the corner. You can’t please everybody, and sometimes it really doesn’t matter what you do, some people have made up their minds from the start that they are going to proceed with their panties in a wad or their boxers in a bunch. I just have to be consistent, and stay positive, briar patch or not. The advice I gave to the Students With Diabetes last night about diabetes blues is that if you can find a way to laugh about it, you can overcome it. That said, who wants to get me one of these Lionel Richie cheese plates for my birthday on Saturday? Or you could just donate to my Tour de Cure and help me kick diabetes in the teeth. Either way, you da best, and I thank you from the bottom of my busted pancreas. Every year right around this time we all dream up our New Year’s resolutions. Some form of weight loss, get in shape, go on a diet, or eat healthy is almost always at the top of everyone’s New Year’s list. This year, I’m feeling the stretch, and I realize that I need to do something to get back to my size 4 bikini body again. Actually, I don’t even know what that means. I just heard it on an infomercial for some kind of magic beans that are supposed to make your clothes fit better. Truth be known, they probably have a better chance of turning into a beanstalk and leading to a land of giants than they do making me lose weight. I bet they are good with ham though. Anyway, moving on… I freely admit that I weigh more than I want to right now. I’m overweight. Heck, I might even be considered obese by the current standards of how big a person’s butt should and shouldn’t be. (And don’t you dare tell me what the difference is. I don’t want to know.) What I do know is that my clothes fit a little tighter than I would sometimes call comfortable. I can’t really button the top button on my dress shirts right now because my head and neck resemble Jabba the Hut. If someone told me to haul ass, it’s questionable if it would take me one trip or two to get it all. At least, that is how I feel. I’d love to lose some of the extra pounds that I’m carrying around. I know it would make me feel better, both inside and out. I mean, there is a Ryan Reynolds under all of this that is just waiting to get out. I’m just trying to find a real solid purpose that I can grab onto besides, “Skinny people are happier.” Oh yeah? With that kind of logic, rich people must also be less lonely, hairy people have more style, and short people enjoy the smell of toots. Give me a break. Happy has nothing to do with weight, just like loneliness has nothing to do with how much money you have. And everybody hates the smell of toots. Unless you’re a proctologist. Then it just smells like money. When I signed up for my last gym membership, my goal was simple: I wanted to look good naked. I could have said that I wanted to be able to run a marathon, or be in good enough shape to teach spin class, or ride my bike for miles and miles and miles, but…well…yeah, naked. You have your goals, I have mine. Unfortunately, 2012 was a really hard year for me to establish and maintain a routine of exercise, working out, riding my bike, and keeping active consistently, and I feel like I’ve lost my way a bit. I could blame it on a chaotic schedule, being overwhelmed by other things going on, not having enough time, or that the Mayan’s had predicted that the world was going to end anyway, so why bother. When it really comes down to it though, it was me. I didn’t take time or make time, and I realize that I really need time to exercise and work out for both my physical and mental well being. In order to change all of that for 2013, A-Flizzle and I worked extremely hard in our garage over the holidays to get it organized so that we could have a functional workout space that would be available despite my busy and often chaotic schedule. If I want to work out at 11 o’clock at night, I can. I don’t have a bunch of expensive equipment, but what I do have I can definitely make the most of now. I’m SUPER excited about it. In 2013, I’m trying to get back to establishing consistent exercise routines. I’ve really got to find a way to make time to train and get to where I want to be. The first place I want to be is on my bike in a few months for the Tour de Cure. My goal is to train consistently this Spring so that I can complete the 100 mile century bike ride in May. From there, who knows? Hopefully by then there will be other bike rides that I can train for. Or maybe even a triathlon. Wouldn’t that be exciting?! But, first things first. I know that exercise is only part of the story. In order to get fit and have a set of abs worthy of doing laundry on (thanks Ryan Reynolds for setting THAT bar so high), I realize that I also have to eat right. What does “eat right” even mean these days? I look at all of the options for supposed “eating right” and I wonder how in the world I can adopt something like Weight Watchers, Atkins, Paleo, eating clean, gluten free, zero trans fat, and all the other whoop-tee-do diets out there for the rest of my life. I don’t want to make a change that gets me to where I want to be with my size and weight, just to reach that goal and balloon back to being the fat kid that I am now all over again. I also don’t want to not be able to have a Burger King fish sandwich WITH fries when I have one of these: Basically, I’m a walking contradiction. Weight Watchers I don’t get because of the point system. It’s difficult for me to understand how a banana (about 24 carbs, take or give) is zero points. It sure doesn’t feel like zero points when I’m having to bolus for the carbs and then check my blood sugar a couple of hours later to make sure I guesstimated properly and am not sitting at 300. Fruit is like jet fuel for blood sugars when you have Type 1 diabetes (YDMV – your diabetes may vary). “Free food” is really just a matter of perspective. Yet it works for so many people. Then there is Atkins. How is it healthy to eat that much meat? I mean, essentially the diet is a version of a low carb diet, but it also talks about putting your body into ketoacidosis. Aren’t we supposed to be staying OUT of ketoacidosis? Diabetic ketoacidosis (DKA) can mean a hospital trip for many of us people with diabetes (PWDs). But there again, it works for so many people. Those are just two examples, and clearly I don’t understand all of the ins and outs of them all. I see info about this meal plan and that weight loss option, conflicting testimonies and experiences, and I can’t seem to come to any conclusion about what is right for me. It is this lack of understanding that is paralyzing my decision making process on what it means, for me, to “eat right.” I see successes and failures with every single option. How do you pick one? Which one is the “right” one? It’s like walking down the cereal aisle at the grocery store. Can’t I just get the one that is delicious and has the best prize? I don’t have an answer. I probably just need to commit to something and try it. For now, I know I can work out. I enjoy that, and even look forward to it once I get into the routine. Maybe my rule needs to be, “If you eat it, burn it.” Or maybe it’s, “Sweat like a pig to look like a fox.” It’s one of those. In any case, we’ll call it the “Running on Fumes” plan, and I’ll try to talk Chuck Norris into being my spokesperson. After all, Chuck Norris never loses weight; he knows exactly where it is, and it’s very afraid of him. A recurring theme in my diabetes world is running low. I can function normally with a blood sugar down to the mid-40’s most of the time, and not even realize it. That’s called blood sugar unawareness. It’s also dangerous. Low blood sugars have a way of sneaking up on me. I finally figure out something is wrong when all of a sudden I’m unable to focus, or my mouth is running 90mph but the words aren’t making sense anymore, or I’m trying to communicate but can’t get any words out at all, or my mood swings from normal to highly agitated and upset for no reason, or I’ve sweat through my clothes and am a shaky mess. Most days I wear a Continuous Glucose Monitor (CGM), which alarms when my BG drops too low. Most days, it even catches it in time. However, there are days that I go without my CGM, which is dangerous, stupid, and quite honestly, a total waste of money. Those CGM sensors are not cheap…at all! When I was a kid, I was stupid and I guess I thought I was invincible, because I would run off to play or with friends and never carry anything to treat a low with me. It’s a wonder that I survived, as active as I am and as busy as I’ve always been, from childhood to adult. I don’t even want to know what my A1C must have been when I was flying by the seat of my pants like that. After 31 years of Type 1 diabetes, and a lot of lessons learned, I don’t go anywhere without something to treat a low. I’ve got glucose tabs on my car keys. I’ve got juice boxes in my refrigerator. I have a stash of low blood sugar remedies in my nightstand drawer. In fact, I’ve probably got something to treat a low in every room of my house, every bag I carry, in my car, and in every drawer of my desk at work. There’s a new product that I carry with me everywhere now. It comes in a pouch, and it fits in my pocket, in my BG kit case, in the easy access velcro pocket on the outside of my messenger bag, in my gym bag, in the back of my cycling jersey, in my car, and I’ve even managed to stuff one in my shaving kit for when I’m traveling. I’m talking about Level. Level is a pouch of glucose gel, 15 grams of carbohydrates in each, that are perfect for me to treat a low blood sugar with…anywhere. I can swallow it easy when my mouth won’t cooperate, it opens easy so that I can rip it open with my teeth if necessary when my hands are being clumsy, and it’s delicious, unlike most other glucose products I’ve choked down in a moment of low blood sugar desperation. Level is available in four flavors: Mandarin Orange, Caramel, Strawberry-Banana, and Vanilla. One thing that most people with diabetes (PWD’s) who run low can appreciate is that, when we are low, it’s a lot more fun to treat that low blood sugar with something delicious than it is to force feed ourselves with something that nobody would eat on a normal day. That is one thing I like about Level pouches. Treating a low with something that tastes like mandarin-orange, strawberry-banana, caramel or vanilla really isn’t so bad. My advice: Try it. It’s worth a shot to not have to eat a handful of glucose tabs, at least for one low. Tell the folks at Level that you read about it on Diabetically Speaking, and they’ll throw in a bonus! Just enter diabeticallyspeaking at checkout on their web site, LevelFoods.com, and get 20% off any purchase of $25 or more. Pretty sweet! (Pun kind of intended.) Now, this is the disclaimer part. I am in cahoots with the company that makes Level. They really didn’t have to push me very hard to get me to say good things about their product. I really wanted to share with those of you that read Diabetically Speaking because it works for me, it doesn’t taste like I’m eating chalk, and I can actually get into it when I’m having a shaky, clumsy, can’t quite get my body to do what it’s supposed to kind of low. It’s pretty much a life saver in Martin’s diabetes world, but in the effort of honesty and integrity, I’m divulging that not only am I a Level fan, I’m also a customer. So there. Remember, enter diabeticallyspeaking at checkout at LevelFoods.com, and get 20% off orders of $25 or more. National Health Blog Post Month, Day 24: My Mascot! Give your condition, community, or self a mascot. Who is it? What do they represent? What is their battle cry? Dictionary.com defines a mascot as “an animal, person, or thing adopted by a group as its representative symbol and supposed to bring good luck.” I feel like there are a lot of potential candidates for a diabetes mascot. First, there is this thing that Jacquie and I found at Friends For Life last summer. I’m not even sure what it is. Is it an insulin pump? Is it a BG meter? Is it a calculator? Is it a magic robot with an affinity for sideways exclamation points? Then there is Lenny the Lion. Granted, he’s already got a full-time gig as the Medtronic mascot, but he does have the advantage of being well-versed with an insulin pump. And think, with those cat claws, you would never have to replace a lancet ever again! Coco is a great candidate for a mascot as well. She has Type 1 diabetes. She has lots of friends and lots of adventures. She’s a lot like me! Except her primary contribution to conversations is “Eeek!” But I know people that have a lot more to say than just “Eeek!” and I wish they were as limited in their vocabulary as Coco is, so maybe that isn’t such a bad thing. You know what they say (whoever “they” are)…a little “Eeek!” goes a long way. There is also Phil Southerland, who makes a great representative for the diabetes community. He’s a cyclist and co-founder of professional cycling’s Team Type 1-Sanofi, author of Not Dead Yet, and he’s from where I live, Tallahassee, Florida. He was also recently appointed Director of Healthcare Policy, Planning and Patient Advocacy at the World Health Organization. And he has Type 1 diabetes. I think any of these candidates would make a fine diabetes mascot. However, I’m glad we don’t have to pick just one. The more characters there are in the world advocating and representing and bringing diabetes to the forefront of people’s attention, the better. This post was written as part of National Health Blog Post Month (NHBPM) – 30 health posts in 30 days: http://bit.ly/vU0g9J Last Saturday was a beautiful day off and a beautiful day outside. After sleeping in a bit, I decided to go for a bike ride. I checked my blood sugar, everything was fine, so I dawned the bike gear, grabbed my road bike and took to the streets. I felt good, and was excited about the ride: Just me, the bike, and the road. I made it 2.6 miles into the ride and was climbing a steep hill with gusto when I bonked, a term commonly used in cycling or exercise when your body stalls and you just can’t go anymore. I’ve hit that wall before while on long rides, but never less than three miles into a ride. My heart rate spiked. I couldn’t breathe. I had no power in my legs. I couldn’t catch my breath. I was seeing spots. There was no choice in the matter, I couldn’t even make it to the top of the hill. I had to stop before I blacked out. I coasted into a driveway, unlocked my cleats from the pedals, and put my feet down. What was happening to me? Was I low? How could I be low after I just checked only a few minutes ago? I laid my bike down, then proceeded to spew what little bit of water that was in my stomach onto someone’s well-manicured lawn. Fortunately, north Florida has had an extremely hot and dry summer, so those nice folks that lived in that house probably didn’t mind the extra water. After I caught my breath enough, I grabbed my phone out of my back jersey pocket and called A-Flizzle to come and get me and my trusty steed. That. Never. Happens. And to be honest, it scared the spandex out of me. It was probably the worst bike ride I’ve had since I started cycling six years ago, and I’m still not sure what went so wrong. My blood sugar was fine. Maybe I simply got sick. Maybe I didn’t eat enough before the ride. Maybe I’m more out of shape than I thought, even though I’ve done plenty of spin classes and I did a 24 mile road ride less than a month ago. Maybe my extra weight that has been mentally plaguing me has become a physical problem. Maybe I just took the climb too hard and had an adrenaline overload. Maybe I have no clue. I do know that I’m setting a new rule, effective immediately, to move around for at least 30 minutes every day. If I can do more, like a spin class or a couple hours in the gym, fantastic! But if I’m busy, and I can do nothing else, at least I’ll have that 30 minutes, even if it is just going for a walk. Surely I can find at least 30 minutes to spare. It’s already cold here in north Florida (or “cold” as all of you in areas that actually see snow would call it), and I hate being cold. What better way to warm up than moving around? I’m declaring this Winter training season. I have to find a way to make moving around a priority, every single day. Mornings and me do not get along at all, but if that means I have to start waking up early to go to the gym before work, so be it. Or if I have to go late at night (which is more likely), so be it. If I don’t make it a priority, then it will never become one. Plus it’s warm in the gym, so there’s that. That hill scared me, but fear is not a motivator. Now that hill is taunting me, teasing me, begging me to get back on the bike so it can try to beat me again. I’ve got news for it though. It won’t be long before I stamp my name all over that mountain, and declare it Mt. Pwned.
{ "pile_set_name": "Pile-CC" }
July 2007 posts I came across this radio station a couple of days ago. Although projects like this that aim to encourage communication between the Jewish and Muslim communities are not novel ideas nowadays, they are definitely commendable for their efforts. I haven't caught many of the talk shows yet - mostly just music so far. I'm tuning in as I write this and they just played Talk Talk, The Verve, Garbage, and David Bowie. Last night they played some Jewish contemporary music. The station is based out of Bristol and aims to encourage dialogue and understanding between the Muslim and Jewish communities. Please check out their official site HERE. On a related note, I've been avidly reading and watching Aljazeera lately. As of November, 2006 they now have an English news site complete with video broadcasts. Check it out HERE. I am happy to announce today that MeisterMed, maker of popular PDA medical software, has now optimized one of their most downloaded programs for the Apple iPhone. LyteMeister is now available free to the public on their website. Since everything is text-based the program is fast enough for quick access. Hopefully more of their programs will be available soon! Check out LyteMeister here: www.meistermed.com/mobile. Official MeisterMed site HERE. So here's a fun trick to do with your browser. Go to Amazon.com or the results page of any Google Images search. Then copy and paste the following code into the address bar and it will take all of the photos on the page and animate them in a circular pattern on your screen! I've only tried it on Google and Amazon. Not sure if it'll work with other websites yet. From Yahoo! News:Michael Lenahan, 23, of Philadelphia, Pa. is gored in the leg by a fighting bull during a traditional bull run in Pamplona, Spain, Thursday July 12, 2007. Two American brothers were gored Thursday during the longest and bloodiest morning bull run at the San Fermin festival in the northeastern city of Pamplona. Lawrence Lenahan, 26, of Hermosa Beach, Calif. and Michael Lenahan, 23, of Philadelphia, Pa. were gored by a bull who strayed from the pack, turned around and ran the wrong way. The older brother suffered a eight-inch (20-centimeter) goring in the left buttock after a dangerous sharp right turn in the course Lenahan described as a 'dead man's curve.' The younger brother was injured shortly before the bull ring, the end point of the daily runs, after the bulls horn entered beneath his skin in his right shin. (AP Photo/ Inaki Porto) [Thanks to Rowan Paul] Hot on the tire tracks of the Mini revival comes the iconic Fiat 500 for 2008. The original car debuted in 1957 and has been fondly remembered since, even making an appearance in Pixar's movie "Cars" as Luigi the tire shop owner. Fiat is considering selling the car in the US through Maserati dealerships, but we may have to wait until 2010. Bummer. Check out the pics below and see why this car is an instant classic. It's just so cute that you want to give it a hug. Via Motor Trend. The teens surveyed ranked text messaging above even their own emotional state as the biggest reason for poor driving. The survey studied 900 students from 26 schools, 37 percent of whom ranked text messaging as "extremely" or "very" distracting. Interestingly, only 14 percent of the teens surveyed said that talking on that very same cell phone is a major distraction. Researchers working on the Human Salivary Proteome Project have now identified over one thousand proteins present in human saliva, five of which are associated with having oral cancer. They also found specific proteins present in the saliva of patients with breast cancer and Sjogren's syndrome (an autoimmune disease). Also, researchers at Washington University School of Medicine in St. Louis have noted that amylase, a well-known enzyme present in saliva that helps to break down protein, can be correlated with sleepiness. Research subjects who were deprived of sleep for more than 28 hours had elevated amylase levels which normalized after a good night's sleep. All these discoveries may eventually lead to alternative detection methods for cancers, and even sleepiness, simply by spitting into a cup. Full article via Popular Science and Breast Cancer Blog.
{ "pile_set_name": "Pile-CC" }
Cryptococcal meningitis (CM) is a leading cause of death in AIDS patients in the developing world, responsible for up to 500,000 deaths each year in sub-Saharan Africa alone. In Uganda, cryptococcosis accounts for 30% of mortality in AIDS patients after starting ART. Many of these cases of CM may be preventable. Routine screening for sub-clinical infection, using a simple blood test (cryptococcal antigen or CRAG) in patients presenting to ART programmes, can identify which patients are at risk of developing CM. If identified, these persons could be given pre-emptive anti- fungal treatment to prevent development of overt meningitis and death. Our research team has demonstrated in a study of 311 persons with advanced HIV-infection in Kampala, Uganda, that such a screen and treat strategy would be highly cost-effective, at an estimated $21 per quality-adjusted life year (QALY) saved. We know that ART alone is insufficient to prevent the development of CM in patients with sub-clinical infection, and antifungal therapy is required. Yet, the optimal pre-emptive anti-fungal treatment dose and duration necessary to prevent CM in patients with sub-clinical infection have yet to be established. We propose to investigate how practical and effective CRAG screening and targeted pre-emptive fluconazole treatment would be in the operational setting of patients entering ART treatment programmes in Kampala City Council clinics in Uganda. In addition, a new point-of-care CRAG screening test will be evaluated in parallel with the currently used test. In the planned study, 1000 patients will be screened for cryptococcal antigenemia prior to starting ART. Those with a positive result will receive pre-emptive short course oral fluconazole therapy to treat sub-clinical cryptococcosis and determine if this is effective at preventing CM. All patients will then be started on standard ART and followed for 6 months to determine their overall outcome and incidence of clinical CM compared to historical cohort controls. The cost-effectiveness of the intervention with pre- emptive fluconazole therapy will be analyzed. The results of this operational research would be widely applicable to other regions in sub-Saharan Africa and could lead to improved public policies to prevent CM.
{ "pile_set_name": "NIH ExPorter" }
Q: Does inheritance can affect performances of an application? I wonder if performances of an application could be improved by using the more superclasses you can. My question is about Kotlin, but I assume the answer will be the same for Java. Let's say you have this inheritance schema (the right class is a subclass of the class on his left): A < B < C < D < E < F < G < ... And so on until Z. Saying you don't need all the stuff defined in all the subclasses, but only the attributes and the functions of the A class. For an obscure reason, your code uses only Z class. My question is quite simple: If you change your code to only use A class instead of Z class, will the code be more performant? Thank you in advance for your answers. A: If "change your code to only use A class instead of Z class" includes construction, then there is a trivial answer: Creating and storing an object with less attributes/fields is cheaper than creating an object with more attributes, both in terms of memory and in terms of time it takes to initialize. Other than that, I would not expect a significant effect on performance. That said, I wouldn't worry about performance here - choose the type that provides the best abstraction for what you want to do with this. If your code doesn't care what specific subclass you are using and doesn't need any of the functionality provided by the subclasses, use the more general type. That way your code remains more flexible. If your code however needs such functionality at some point, i.e. you have to introduce casts further down the line, then you have gone too far.
{ "pile_set_name": "StackExchange" }
[Risk and risk factors of suicide attempt after first onset of suicide ideation: findings from medical students in grades 1 and 2]. To examine transition probabilities from first onset of suicide ideation to attempt over time among medical students in grades 1 and 2 and risk factors in the transition. A total of 10 297 college students in grades 1 and 2 from three medical schools in Anhui province were invited to complete the questionnaires, which included history of suicidal behaviors, adverse childhood experiences, family history of suicide, sociodemographic characteristics, the Beck Depression Inventory, the Beck Anxiety Inventory, the Barratt Impulsiveness Scale, the Aggressiveness Questionnaire, and the Social Support Rating Scale. Transitions were estimated using life-table analysis. Risk factors were examined using Cox regression models. Of the 10,297 participants, 16.52% (n = 1701) reported lifetime ideation and 1.47% (n = 151) attempt. Cumulative probabilities was 8.88% for the transition from first onset of suicide ideation to attempt. The riskest probabilites of transition occurred within 1 year after onset of ideation (7.02%). 76.16% (n = 115) first attempts occurred within 1 year after onset of ideation. Cox regression models analysis found that parents' divorce ( OR = 2.32, 95% CI 1.28-4.21), physical abuse (OR = 1.69, 95% CI 1.20-2.37) , suicidal behavior history of first-degree relatives (OR = 2.02, 95% CI 1.25-3.25), impulsity (middle /lowest tertile: OR = 1.88, 95% CI 1.15-3.06, highest/lowest tertile: OR = 2.09, 95% CI 1.30 -3.36), and highest anxiety scores (highest/lowest tertile: OR = 1. 60, 95% CI 1.10-2.33)were significantly related to the transition from first onset of ideation to attempt. Adolescent suicidal ideation signals the recent rsik for suicide attempts. Parents' divorce, physical abuse, the suicidal behavior history of first-degree relatives, impulsity, and severe anxiety score are risk factors for the transition from first onset of suicide ideation to attempt.
{ "pile_set_name": "PubMed Abstracts" }
Q: Java GUI shows blank until resize I have written a java gui code for many options available on it. the gui is also set visible true but it doesn't show until I pick its border and drag them to resize the gui window. After manually resizing it, it shows everything. Also, the textlabels and the textfields and buttons are not in new lines, they are placed one after one. Please tell me whats wrong with that: here is a part of code: public static void initGUI(){ JFrame fr = new JFrame(); Container cont = fr.getContentPane(); cont.setLayout( new FlowLayout( ) ); FlowLayout layout = new FlowLayout(); cont.setLayout(layout); frame.setSize(200,300) ; frame.setVisible(true) ; JTextField tName = new JTextField(30); JTextField tCNIC = new JTextField(15); JLabel nameLabel = new JLabel("Name:"); JLabel cnicLabel = new JLabel("CNIC #:"); cont.add(nameLabel); cont.add(tName); cont.add(cnicLabel); cont.add(tCNIC); JButton Cancel = new JButton ("Canel" ); JButton OK = new JButton ("OK" ); savebtn.setPreferredSize(new Dimension(150, 50)); retbtn.setPreferredSize(new Dimension(150, 50)); cont.add(savebtn); cont.add(retbtn); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); } A: frame.setVisible(true) ; The above statement should be invoked AFTER all the components have been added to the frame. So it should be the last statement in your method. Also, you should be invoking: frame.pack(); instead of setSize(), before making the frame visible so all the components are displayed at their preferred size.
{ "pile_set_name": "StackExchange" }
Armenia’s recent parliamentary election delivered a resounding victory to the incumbent Republican Party. However, behind the numbers lies a growing sense of discontent at a patron–client system that serves only certain elites. Armenia’s parliamentary election on 2 April was the election that changed everything, and yet seemed to change nothing at all. It was the first election held under a parliamentary, rather than presidential system, and the first major election held under a new constitution. And yet, the mood on the streets of Armenia was that of resignation and apathy; the results of the election no surprise to anyone. The ruling Republican Party was the clear winner, winning 49% of votes. In distant second was the Tsarukyan Bloc, with 27%; in third, the newcomer Yelk (Exit) Bloc with 8%, lead by Nikol Pashinyan’s Civic Contract Party; and in fourth, the Dashnaktsutyun (Armenian Revolutionary Federation) with 7%. Behind these numbers lies the complicated reality of a shifting political landscape in Armenia, one in which the dominant elements of the Republican Party have consolidated their political position within both the party and the state, while simultaneously disempowering and subordinating possible rival elites. This was accomplished by honing the Republican Party’s electoral techniques, which leverage the structures of patronage that the Republican Party has developed over an increasingly ineffective opposition. Retrenchment in the Republican Party Alexander Iskandaryan, Director of the Caucasus Institute, an independent Yerevan-based think tank, argues that since 2010, the Republican Party has engaged in a process of transformation and consolidation. According to Iskandaryan, in the 2000’s, the party gradually merged with oligarchs and Armenian economic elites to become a sort of countrywide trade-union for capitalists. But, in the aftermath of the 2008 financial crisis, the core of the Republican Party — a coterie of wealthy oligarchs and professional politicians — changed tack and began to consolidate their position, at the expense of their erstwhile allies. This process of consolidation began in 2010, with economic measures implemented by the Republican government under the auspices of preparing to sign the Association Agreement with the European Union, and continued with the electoral reforms that came into effect with the 2015 constitution. Excluding business elites These economic measures led to a partial de-monopolisation in the Armenian economy, reducing the personal financial resources that could be mobilised by the the now excluded business elites. This has made them more reliant on the party’s patronage, and weakened their positions versus the ostensibly more ‘loyal’ party apparatchiks. Electoral reforms were a further attack on this once-dominant social stratum. By replacing a system which mixed proportional representation and single mandate constituencies with a system based entirely on proportional representation, they party has prevented regional bigwigs from converting capital into political power outside of a political party. The emergence of the Tsarukyan Bloc is one result of this process. Representing the interests of powerful businessmen disempowered by the Republican Party’s core (particularly of its eponymous leader, oligarch Gagik Tsarukyan), it has emerged as the political voice of Armenia’s oligarchs and businessmen. It should not, however, be seen as a true opposition in the strict sense of the term. Tsarukyan and his allies are still dependent on the benevolence of the Republican Party. Their businesses still function with a great degree of privilege (for instance with de facto tax exemptions) which the Republican Party can and has used as leverage when they step out of line. The future role of the Tsarukyan Bloc will thus likely be that of a junior coalition partner or ‘pocket opposition’, as the economic benefits of accepting this subordinate position far outweigh the costs of political disenfranchisement. ‘The will of the people’ The day after polls closed, the European Union praised Armenia’s election, with Federica Mogherini, the EU’s foreign policy chief, stating that despite reports of vote-buying and other irregularities, the election expressed ‘the overall will of the Armenian people’. This overly rosy assessment is undoubtedly coloured by the close ties that certain EU business interests have with the Republican Party, still, at a cursory glance, it looks like it might actually be correct. Elections in Armenia have long been dogged by claims of fraud and manipulation. Vote-buying, ballot-stuffing, votes cast by deceased or non-eligible voters, and outright manipulation of the election results have been frequently documented over the years. Prior to this election, the EU made a €7 million investment to rectify some of these issues. Using this money, the Armenian government installed cameras in all polling stations, and bought electronic voter authentication devices — they also took further steps, such as publishing voter lists, and allowing independent observers to monitor the election process throughout the country. As far as outright fraud was concerned, these measures worked. The electoral results matched the votes cast. Additionally, voter turnout, while not spectacular, was nonetheless impressive — over 60% higher than the turnout in the last US presidential election. And yet, popular discontent has been simmering in Armenia for years. Each summer, successively more disruptive protests erupt. In 2015, demonstrators staged the largest protest since Armenia’s independence, against a hike in electricity prices. In 2016, an armed group calling themselves the Sasna Tsrer (Daredevils of Sasun) stormed a police station in Yerevan’s Erebuni neighbourhood and called for a popular uprising against the government. Despite the violence of their actions (two police officers were killed in the ensuing stand-off), thousands of young people came out to the streets, even clashing with police in support of the group. Patron–client democracy How can this apparent contradiction be explained? Vote-buying is part of the equation, after all, the exchange of cash for electoral support occurs outside of the view polling station cameras, and cannot be caught by voter-ID technology or voter lists. The deeper reason lies in the Republican Party’s almost total domination of Armenia’s state apparatus, which grants them both the vast financial resources needed for vote-buying and the institutional tools to pressure and otherwise extract votes from a sizeable portion of Armenia’s population. The Armenian state, and by extension the Republican Party, serves as the employer for a large portion of the Armenian population. As a result, teachers, civil servants, and other government employees and their families are pressured into ‘returning the favour’ by voting for the ruling party. Additionally, the Republican Party’s utilises ‘gifts’, like the maintenance and construction of new infrastructure, such as roads or schools, or investment into agriculture, for example, purchasing tractors for a particular village. In this, the Republican Party does not act as the representative of the Armenian people; it does not even pretend to enact their will. Rather, they are the patrons of the country and the public their clients. In return for patronage — a single cash payment, a steady wage, or a road — the Armenian people give them their votes. ‘Anti-corruption’ is not an ideology The Republican Party’s success as a party of patronage has a great deal to do with the non-ideological nature of Armenian politics. Parties represent little more than their own interests, and elections are just the stage on which competition between different elites plays out. During election times, this manifests in the complete lack of substantive discourse. All parties, including the Republican Party, come out publicly in support of such uncontroversial concepts as ‘growth’, ‘security’, and ‘anti-corruption’. When the parliamentary opposition criticises the government, it aims at individuals rather than the system — ‘the party in power is filled with corruption, our party however is not, elect us and Armenia will prosper’. The Republic of Armenia is now over 25 years old, so it is to be expected that such a tired pitch falls on deaf ears. In an environment where no political party is trusted to serve the interests of the electorate, patronage wins by default. The greater the resources of a party to buy votes, institutionally pressure voters, and gift much needed infrastructure and amenities, the larger their share of the vote. A new opening for genuine opposition But, all this said, there is still room for an effective and popular opposition to emerge. The success of the Republican Party depends in large part on the apathy of Armenians. By establishing an electoral process which is in many ways more transparent than in the past, the government has given up much of the leeway they previously had to manipulate the results of an election once the ballots have been cast. This provides an opening for a genuinely ideological party to come to power in future; a party whose promises and programme the Armenian people can really believe in. For that to occur, this party must go beyond the limited politics of personalities. It must have a concrete ideology that is not only attuned to the interests of the Armenian people, but is organically woven into their lives. Such a party is not likely to emerge from above, but much like the parties of the working class in late 19th century Western Europe, it will emerge from self-organisation by the Armenian masses. If the momentary explosions of Armenian protest movements can take on a less transient form, and transform into enduring structures of real popular will, then the chances are, even the formidable state apparatus of the Republican Party will not be able to stop them.
{ "pile_set_name": "OpenWebText2" }
Well I Heard Mister Young Sing About Her June 27, 2012 Occasionally people have complained that this blog is “too political.” I generally take that to mean that I have expressed political beliefs with which the complainer does not agree. I also think it misses the point, in the sense that everything is political, including television. Obviously The Defenders is political, but so is Gilligan’s Island, in less obvious ways. It’s not as if I’m hitting the pause button here to endorse a candidate or rant about current events. Any time I have expressed a political view, it’s been a genuine response to something I’ve seen in a television show. To elide or avoid expressing that response for fear of offending someone would be a kind of self-censorship that I have no interest in practicing. And yet some readers are clearly uncomfortable about this, either in a “no politics at the dinner table” way or else because they’re uninterested in experiencing art that expresses (or even seems like it might express) a viewpoint different from their own. I haven’t spent much time on the Home Theater Forum (whose founder I’m on record as having some issues with) in recent years, but my Herbert Leonard piece from last week was mentioned over there and that led me to spend a little time poking around in some recent threads. Here are a few comments from a Home Theater Forum thread that got me thinking: Most shows seem to encourage the use of profanity; encourage the negative portrayal of family life; encourage irreverence for God and religion; encourage illicit sex, drunkenness and addiction; encourage presentation of cruelty, detailed techniques of crime, and the use of horror for its own sake; and encourage the negative portrayal of law enforcement officials, among others. And most assuredly performers are encouraged to dress and move outside the “bounds of decency”. And if these things are not out and out encouraged, they are at least certainly on display over and over. And that is precisely why I prefer classic TV to current television. Most everything today seems to fall to the lowest common denominator and I find most current programming to be shallow and unimaginative. Not to mention just flat out vile and repulsive. Archie Goodwin: If it weren’t for DVDs I would no longer have necessity for a TV. 99% of what I watch on my TV today comes from DVDs of old TV shows and my intelligence is never insulted, my morals never made fun of, my sense of justice always reinforced, my view of good winning over evil reinforced, Good guys winning in the end reinforced, behaving decently toward one another, the Golden Rule, always being the best policy, reinforced, & honesty winning over lies. Jack P: Law and Order is for me, a classic case of a show that in terms of format is something I would ordinarily love, by letting us see the “process” form of drama play out with equal attention to cops and prosecutors. But I have to be hyper-selective in terms of which episodes I watch because this show too often and I mean *too* often has succumbed to the desire to go on soapbox messaging that purposefully caters to one narrow end of the spectrum only. By contrast, a *good* show with a winning format in an earlier era was something I could feel comfortable watching 99% of the episodes of, and that is one thing that has been lost in the last couple decades. I sense closed-mindedness, even fear, in these remarks, as if any new idea or image (or, worse, a familiar but unappealing one) sends some spectators rushing to cover their eyes and start chanting to drown out the noise from the TV set. I don’t get that. Why would one’s personal values need align with the point of view expressed by a television show, a television character, or a television creator? My own values apply to my life, not to the content of art or entertainment. For instance: I found 24 morally offensive in certain ways, and yet it never occurred to me not to watch it. 24 was a well-directed action show with a number of showy performances from important actors. I didn’t want to miss out on any of that. More importantly, engaging with its dismaying politics made for an interesting intellectual exercise. I thought about it, probably more than it deserved; argued about it; wrote about it; had fun with it. My only criteria for skipping a television series are if it’s dull or stupid. (“Stupid” as in insulting to the intelligence; e.g., reality shows that clumsily stage events and ask the audience to accept them as spontaneous.) I bring this up not to tweak these specific folks from the Home Theater Forum (although, yes, I would like to give a couple of them a good shake), but because it’s relevant to my work in a specific way. I sense that a lot of early television enthusiasts are essentially nostalgists. They like old television because it’s old. It evokes ambered childhood memories (if you’re a baby boomer) or it constructs a world that existed before one’s own birth (if you’re my age). (These are two separate cravings, which I don’t have room to parse at the moment, but look at in terms of Rod Serling characters: you have your Martin Sloan, who longs to escape into his own past, and you have your Gart Williams, who yearns for an idealized nineteenth century.) Nostalgia even has its own convention now – not just science fiction or vinyl or movie posters or radio, but everything musty and old, I guess. They’ve actually built Willoughby. This year it’s in Hunt Valley, Maryland. Well, have at it. A stop at Willoughby is a chill down my spine, because my mission here isn’t to wallow in the past. It’s to excavate interesting stuff from a variety of time periods, including the present day, and to write about it in a way that’s modern and relevant. I was tempted to call this post “Fuck Nostalgia,” but I think I’m saving that title for something more substantial. To a certain extent – and correct me if I have this wrong – I suspect that a strong personal or cultural identification with the good old days may may overlap with a reactionary political stance. (“Reactionary” can have a neutral meaning – someone whose values are old-fashioned – and a pejorative one – a hatemongering lunatic. I’m not sure which applies here.) I think it’s obvious by now that I have no truck with that stance. But I’m not sure what to do with my conservative constituency (assuming I still have one), or even the apolitical nostalgists who get bent out of shape when I describe Donna Reed as an emasculating wraith. Should I mock or ignore or engage with them? Is it a fool’s errand to think that I can write what I want and somehow not alienate that segment of classic TV enthusiasts? I mentioned a couple of Twilight Zone episodes above and I’ll bet everyone who’s still reading this got the references, so there is a common language that we’re all speaking. So: discuss. If you have a different way of looking at things, please elaborate on it. You can call me a dick if you feel like it (a freedom of speech not enjoyed by Mr. Epstein’s acolytes). Apparently some of those Home Theater Forum regulars think I’m a snob, but I’m genuinely interested in the ways that people choose what they watch, and how they use those shows in their actual lives. Like this: Related 30 Responses to “Well I Heard Mister Young Sing About Her” Well said. I’m perplexed by people who treat classic TV like a private portal back to a past that never existed (and fantasy and selective memory are really what nostalgia is all about). Personally, I’ve been pleasantly surprised by how many of the shows I watched as a kid, teenager, and young adult *don’t* cater to that impulse when I revisit them now, including a few I never would’ve guessed; it’s what I love about them and seek out. The shows that do press the nostalgia button — that have nothing to offer beyond a bland, politically neutered, impossibly vanilla world view — leave me cold. Seeking them out precisely because they don’t pose a challenge or generate any friction or upset an understanding of how things used to be strikes me as a little sad, and even disrespectful of the form. And just not much fun, either. I don’t think there’s anything wrong with a little nostalgia (an “ache in the heart,” remember Don Draper’s Kodak pitch?), and I have my Willoughby moments and can enjoy shows that appeal to those (“All Creatures Great and Small” is a good example). But the sort of reactionary responses you quoted, I view as delusional more than nostalgic. My policy is to never engage with people like that unless I’m absolutely forced to. I have all the time in the world for intelligent Burkean conservatism, but not for the dim-wittedness that characterizes the reactionary elements in American life today. I’ve been living abroad for a couple of years, in Korea and Mexico, and have not encountered anything like that strain of thought, which seems sadly peculiar to the U.S. You write a great blog that will tend to attract readers who understand what you’re doing. That Kodak pitch scene is great, and in fact I have a vague memory that I’d toyed with using it as a jumping-off point for a post similar to this one. Certainly, it gets to the heart of the matter, as Mad Men so often does. I’ve been over there too, and it can be quite an eye-opener. I don’t see older television shows as nostalgic, but a lot of people do. It does seem to sell the good old shows short and lend unearned status to the bad old shows, but whatever makes them happy is fine, I suppose. There is a kind of intellectual limitation to it, though. “That show is good because my kids won’t hear bad words” isn’t much of an endorsement. Personally, nostalgia is good for about two episodes with me. After that, it bores me and I want to watch something good. (Hence my He-Man sampler disc.) I don’t think you should change your views or their presentation here. At most, you could acknowledge that some of your readers may feel the opposite way, and that’s their privilege. Yeah. “It’s clean enough for my kids” is something that I can’t engage with it all. I guess it’s relevant if you have kids … although I myself am sometimes tempted to procreate just so I can show the little tyke everything I watch, up to and including Ilsa She-Wolf of the SS, just as a sort of science experiment. I should add though that two of the people I quoted are at least pretty articulate (only the middle one is a raving loon) … and probably reiterate that if the Home Theater Forum comes across as kinda stoopid sometimes, it’s because Epstein’s draconian “you vill obey” school of moderation has driven away most of the people with something interesting to say. BTW, I was the one who posted the comment that got the whole ball of wax in motion at the Home Theater Forum board. I’m the only one there who, although I respect older TV shows, don’t want to see them elevated over newer ones, and I’ve commented words to that effect. Of course, because I’ve done so, I’ve been called a ‘troll’ for saying what I’ve said, and have even had my comments banned off of the site during a previous posting in a older thread a while back. I think that the people quoted, to be frank, are raving loony religious fundamentalist Tea Party members and Obama haters who support the war in Afghanistan and the war in Iraq, and don’t really give a care about any social advance that’s happened in the last twenty years or so. They want to roll back the clock on anything they consider a threat to their white middle class American existence (and to their white privilege in general) and any TV shows that reminds them thy’re living in the 21st century is therefore bad and must be resisted with every fiber of their being. Why I ever go on that section of HTF board, I’ll never know; I should stay away completely, because arguing with these people and their selective memories about the past is just a losing game no matter how articulate in writing a viewpoint one might be. Fascinating topic. I think if you are going to talk to that spectrum of the right, you will have to articulate the politics of the show in your work, sometimes – at least. For instance, three great TV shows that were the pinnacles of their police genre for their eras: ‘Dragnet’, ‘Naked City’ and ‘Hill Street Blues’. The first one is morally conservative – it doesn’t pry into the real motivations of the criminals, they do the crime because they are criminals (this is from memory). The cops don’t have any problems, no domestic strife, no psychological issues, no bias or prejudices. The cops are emblems of virtue. It is really no more than a recruiting show for LAPD. The show works because of laconic spareness, the sunlit ambiance of California, it’s subtle musical cues (riffed off Miklós Rózsa – who sued if I remember correctly), but even then it must have seemed off-kilter after a decade of noir in the cinema. ‘The Naked City’ on the other hand, had criminals who had reasons, it reminds me of a quote – “everyone has their reasons” – and the show dug into them, almost functioning as an anthology show. It’s what really made the show exceptional. With the ‘Hill Street Blues’ and ‘Police Story’ brought in a complexity on the side of the cops, who had myraid of issues, from corruption to family life breakdowns and personality dysfunction. So I think, as you are addressing the shows, you may have to compare and contrast them. These right-wing folks, and to be honest, some left of centre folks have fossilised or have never outgrown the limiting influence of the parents and cultural social scene. Rather like Shirley Jackson’s ‘The lottery’, they live in a closed loop of ideas. But there is another pervasive element that must be addressed and what they might be reacting to. The extreme of what is on our screens today. For instance, ‘Con Air’, ‘The Silence of the Lambs’, ‘Dexter’. The first ‘Psycho’ makes, for me, part of a classic trilogy with psychological terror films with ‘The Night of the Hunter’ and Wyler’s ‘The Collector’. The last ends on a bleak note, where the bad guy is free. But the audience knows who the villian is in all three films. Let’s compare that with ‘The Silence of the Lambs’ which ends on a note where the central psychopath is free and off to eat the prison warden who had earlier in the film been made to look and be a crummy scumball, a line played for laughter. Or a scene in ‘Con Air’ in which the camera cuts away from a child in the presence of psychopath, leaving the audience preturbed. And now ‘Dexter’ – a hero serial killer, it’s ok because he kills only other more dangerous killers. As phoney a scenario as could be imagined. This is the darkest of the morals debate. I’ve come to understand this trend, but it took a lot of curiosity and piecing the puzzle together. Take some immature Tarantino-type Schlock-meisters and allow them full play in a world run by profit-hungry corporations, who according to one of the finest half dozen documentaries I’ve seen ‘The Corporation’, have the pathology of psychopathsa and it’s easy to see why people get stuck to the past. It’s the documentary that made me understand why Welles was cast out of Hollywood, why they cut ‘Night Gallery’ to ribbons, why TV shows are cancelled (even beyond the human dramas of the creatives versus the executives) and how the Jim Abubrey, the “Smiling Cobra” could thrive and prosper, whilst the Stefanos and Serlings got cast aside. So, I think there are shades of grey. Nostalgia as an escape from the perpetual listing of disasters that is the news, film amorality or sickening violence, even some of sex scenes in the second season of ‘Game of thrones’ that led to a terrifically spot-on SNL skit. Or nostalgia as a way of never growing up, seeing the beautiful textured complexity of issues and instead viewing things in the childish way of black and white of simple abstractions. Dragnet, and all of Jack Webb’s shows, are much more interesting in terms of form than content (and I say that as a fan of Webb’s Bressonian minimalism). I’m mixed on Tarantino but I would agree that his toneless, puerile insertions of gore can be a problem even in his strongest works (e.g., the killing of Hitler in Inglourious Basterds, which is a great idea but kind of silly in the, er, execution). Stephen, I think you are giving these commentators more consideration than they deserve, to be honest with you, as I don’t think anyone could seriously defend the intellectual rigor of their arguments, but I get your larger point about nostalgics. I call this the Lou Pascal Syndrome, after the Burt Lancaster character in Atlantic City, and in fact am coincidentally addressing this very point in a post that will run not next week but the week after on the Paley Center blog site (http://www.paleycenter.org/b-bushman), specifically with respect to politically themed shows (forgive the self-promotion). I would suggest that there is an important distinction between the way you respond to television — as a student and historian — and the way most people do, strictly as consumers. In a sense it would almost be delinquent of you to turn away from a show like 24 simply because you were opposed to the politics, considering that it was ground-breaking both formally and conceptually (featuring arguably the most morally compromised hero in the history of television entertainment). However, here too I see your point: that while you had serious issues with the show’s politics, they didn’t prevent you from continuing to experience the show or appreciate its contributions to the medium. My own thoughts about 24 are very similar to yours, although I eventually wound up pulling the plug — not because of the politics, but because of the Groundhog Day experience of seeing the same thing over and over and over. Bobby J. makes some exceptional points in his comments above, and I am reminded by his citation of Dexter that I found the maiden episode so distasteful that I have never been able to return to the show. Perhaps I am the one missing out. I know many people whose opinions I respect who have great admiration for it. This may be slightly off topic, but your post also made me think of programs that triggered widespread boycotts, like Amos ‘n’ Andy. Was it wrong for African-Americans to protest that the show was racist, or for CBS to cave in by pulling it from the air (never mind whether the show was in fact racist, which has of course since become a serious point of contention even within the African-American community)? If you or I believed the show was racist, would we (or should we) have continued watching? If CBS was right to pull the show, was it wrong for ABC to refuse to air the episode of Nothing Sacred centering on a Catholic priest who contracted AIDS from a homosexual encounter after Catholics protested? David, to address your first sentence, it’s not just the HTF regulars that I get this vibe from; I plucked those comments to represent (perhaps crudely) a spectrum of reactions that I get here or see in related corners of the internet. I, too, found Dexter to be totally repugnant — clueless postmodernism is a dreadful thing to behold — and I even tried the damn thing twice, because friends I trust like it and because of some of the actors (e.g. Keith Carradine) who had thankless roles therein. So as much as I might advocate for totally amoral television I guess I’m not there in principle. (Someone on the HTF suggested I’d like True Blood, and that turns out to be putrid, too, although I admired its unabashed emphasis on eroticism. Sex and nudity, fuck yeah!) I loved the few Nothing Sacred episodes I saw and I wish I had a full set of them. That banned episode is a particular sore point, since Howard Rosenberg (the former LA Times TV critic) screened it in his class at USC the semester I took it. It was wonderful, and when I realized it wouldn’t air, I asked him for a copy, but he’d already donated it someplace. He did slip me rough cuts of a couple of unaired episodes, though, which are jewels amid my modest library. One of the appeals of nostalgia is you can pick what to remember. You can remember the past favorites and forget the hundreds more you hated then and hate now. You can forget the complaints of too much sex and violence on television from those golden eras. T and A went beyond just two innocent letters and had a special meaning during 70s television. How can the present (in anything) compete with the bias memories of the past, in this case sixty four years of television (starting with networks birth in 1948)? Well, at least we will always have Eddie Haskell to remind us that things aren’t always as they appear to be. And who can forget that radical fellow Ward Cleaver, who once said to Beaver…”Beaver, this may be hard for you to believe, but life isn’t exactly like television.” Great topic and not one worth getting your hands too dirty with (to paraphrase David Bushman above). The commentators you site can deny that old tv is “political” and they can try to prevent themselves from seeing depictions of the real world (Heavens, sex? Heavens, crime?), but that does not mean those commentators have managed to figure anything out, only hide from it. Nostalgia is a complicated topic – it involves the human heart, regrets and muddy and faded memories. It also places a filter on content that new shows don’t enjoy – how will we view “Game of Thrones” in 25 years (if at all)? The 2012 “filter” on “Mad Men” (and the Tarantino “filter” on grindhouse ’70s fodder for that matter) is what makes them more interesting than if they were presented to us pure as artifacts from their own time. I agree that this is a great topic, Stephen. As someone who does a good amount of research reading TV Guides of the 50s and 60s, I can vouch that not every show in those listings is worth watching regularly. For some, there’s the simple attraction of holding an old TV Guide and sharing the same experience of the person who held it in their hands 40 or 50 years ago. I’ve checked out DVDs of a number of shows based simply on having seen them in a TV Guide. Some of them (“Brenner”) were pretty good. Some of them (“Loretta Young”) were pretty awful. (My opinion only.) But I’m not sorry about any of them, because if someone’s interested in the interaction between television and the formation of American culture, then it’s essential to know and understand what was on. And there are certain elements to TV from the 50s and 60s that I personally find interesting – for example, I’m much more intrigued by the BBC’s 1969 taping of “Peter Grimes” in a television studio than I am the Met’s HD production of the same opera from a few years ago. And while I’ll admit to sipping from the Nostalgia kool-aid from time to time, and as one who does feel that TV in many ways was better “back in the day,” I also appreciate that if TV were still that way, I wouldn’t have “Top Gear (UK)” to watch. Maybe I’m not a fan of “CSI” or “NCIS” but that doesn’t mean that I unreservedly embrace “Highway Patrol” or “Dragnet”. Sure, they’re fun to watch, but as drama they can leave things to be desired. I probably go for old TV more than most, but one can’t elevate the old simply because it’s old, any more than one can sanctify the new simply because it’s new. (Footnote: although we may well be on differing sides of the political spectrum, I don’t think politics should be off limits. I’m a political creature, and it occasionally creeps into my analysis of a particular subject, and I hate like hell when I start fearing that I have to self-censor what I write because I’m afraid I might offend someone.) Well, paraphrasing a friend with whom I was just discussing this, “I like some bad TV shows — but I know they’re bad.” As opposed to others who seem to be undiscriminating, or reductive: old = good, bad = new. They’re the inverse of people who won’t watch movies that are in black and white, but no less self-limiting. If people mainline old TV shows just to plunge themselves back into the past, as a kind of sixteen-millimeter shrine (sorry, couldn’t resist!), that strikes me as a brutal misappropriation of art. And yet … and yet … I enjoy some popular music but have at best a layman’s knowledge of it, and I confess to sometimes using 80s rock quite deliberately as a tool to unlock lost sensations of my childhood. So I’m guilty of the same thing there that drives me nuts here. To a certain extent I feel I have to step back and respect it when people are engaging with a text, EVEN IF THEY’RE DOING IT ALL WRONG, DAMMIT. One of the hazards of running a site such as yours has to be the socio-political baggage that readers bring to it. Today, the news broke that Don Grady of “My Three Sons” died, age 68. The reactions on various blogs are about what you’d expect, but the right-wing political sites are truly outdoing themselves. In their view, “My Three Sons” is an epitome of American Conservative Ideals. MEtv runs it every morning here in Chicago, and I’ll be gosh-darned if I can find any politics at all in there. I mean in the show itself; It’s square as all get-out, but if any of the cast members were putting out a political message, I’m obviously missing it. (Yes, I’m watching it, mainly for Bill Demarest.) About “Nothing Sacred”: Catholics weren’t the ones who were protesting against it. Bill Donohue’s bogus “Catholic League”, with a major assist from Brent Bozell’s equally bogus “Parents Television Council”, was doing the protesting against any portrayal of “progressive” Catholicism. Bozell and Donohue trotted out the old Hartnett-Johnson playbook, and targeted advertisers with a barrage of falsehoods about “Nothing Sacred”‘s content, thus scaring them off and forcing ABC’s hand. Actual Catholic people who saw the show liked it; my mother, for one. Fr. Andrew Greeley, the best-selling author, championed “Nothing Sacred” in his newspaper column, as did James Brieg, the entertainment columnist for Chicago’s archdiocesan paper The New World. After Bill & Brent crowed about their anti “NS” crusade in a trade publication, about a hundred or so priests and nuns paid for an ad in the same publication (Advertising Age, as I recall; correction welcomed), calling on ABC to give the show another chance. But in the end, Bozell and Donohue won, with a “boycott” that wasn’t really much more than their manipulated mailing list. Most of the so-called “boycotts” that TV has been threatened with over the years are just like this: a small group (sometimes as small as one tetchy guy) whips up a frenzy over whatever they don’t like, and through clever self-promotion becomes an “army” of protest to smite the offenders down. Can you imagine how much more damage Hartnett & Johnson could have done if there had been an Internet in the ’50s? I’ve always “liked old stuff”, but I’ve never (except maybe in aesthetic senses, like clothing and design) felt like the past was “a better place” for most people, except for entitled white men. For me, one of the things that makes 50s-70s TV so fascinating is thinking about the cultural attitudes, some of which I find more positive than now (a sort of “new frontier” post-war liberalism/rationalism mixture) and some of which are big negatives (racism/sexism/conformity). If you’ve got an interest in history, you can learn so much about what was going on at the time (as long as you understand that it’s not starightforward “reality”). So visiting the HTF can be a frustrating experience, because there’s a LOT of low-wattage discussion about “swear words” and so much addled and unsophisticated rambling about how nice everything use to be. It’s like reading the Amazon.com reviews of DVDs of classic 30S screwball comedies that say “I LIKED THIS BECAUSE OF THERE WAS NO DIRTY WORDS IN IT AND I COULD WATCH IT WITH MY GRANDKIDS”. Half of this bullcrap about ‘swear words’ isn’t even true when it pertains to network TV (most of the time, swearing on the reality TV shows is bleeped out), so I don’t know where the frelling hezama they get the idea that its widespread (the Disney sitcoms don’t even have any swearing that I can see; Hawaii Five-0 doesn’t have any swearing, nor do a couple of other network shows.) It seems that they think everybody watches HBO or Showtime exclusively, or they have faulty memories and believe bullcrap statements from Donald Wildmon and his silly organization. No kidding, man. You look at all the critics who were great in their prime and then fell out of touch, and worry that it’ll happen to you! Lately I can’t deal with all these newfangled movies that are like 90% CGI. That’s the first step to obsolescence, right there…! Why is it always deemed nostalgia? The hefty majority of old shows I prefer were never even a part of my childhood or youth. Why do I watch older shows? Well, from Chuck Connors in “Rifleman” to Horace MacMahon in “Naked City” to Fred MacMurray in “My Three Sons” … I just bloomin’ LIKE the characters. Not only that, I IDENTIFY with them. From the way the characters comport themselves to the way they, as protagonists, confront adversity. I no longer give much of a damn about aesthetics, and the arguments over what constitutes quality. After over 4000 movies and endless tv-shows, all that has become rather moot. I’ll zip around from bootlegs of “The New Breed” to “Sky King” to “Trials of O’Brien” to “Empire” and hundreds of others, and relish every minute. Their worldview, the aspirations they represent, their sheer groundedness. There’s a gut-level connection there, which both energizes my spirits and even provides fleeting moments of optimism towards humanity. That’s all I particularly want from a viewing experience. Modern television? With all the whiney, self-absorbed characters? The fashion-plate drama actors who ‘pose’ for the cameras and deliver a snarky, sarcastic line before the fade-out to each commercial break? The hyperkinetic camerawork that is so self-conscious that it becomes impossible to get into the storyline? The putrid sitcoms and their stunted, morally degenerate characters? That whole prism of “detached irony” that pervades them all? Where every other line has either some moronic hipster subtext or boorish sexual innuendo? I hate that crap with a fiery passion. Not only do I NOT like nor identify with such characters who represent all this, I derive abject revulsion from them. And that extends out to the pathetic exhibitionalism of reality-show nonsense to the loathesome, cretinous scumbags of late-night talk shows. To add a further layer, it’s seethingly obvious that just about all of this modern-tv product has on display a genuine contempt for everything I value and believe in. Television went from a welcome visitor to whom I’d invite into my den, and would spin some entertaining stories and serve up the news of the day… to a smug, condescending bastard who got his jollies antagonizing and belittling me. After so many increasing years of this, I’ve kicked him out (only watch dvd’s of older fare nowadays), and rightfully regard modern television and its producers the same way they have viewed me… as an enemy. Well, I may not agree with your point of view, but that is an articulate rant; you put the case well. Whatever you do, do not watch any episodes of “Nip/Tuck,” which would push all your buttons at once and might kill you. Agreed with Patrick, that this is a well-considered response. But I notice that you mention a number of specific 50s-60s shows but only speak generally about what’s on now. So I’m wondering, which modern TV series turned you off? I almost feel like this is a challenge to recommend something contemporary that you might like. Yeah, Neville, thanks for pointing out that post. Nostalgia for the good old days is indeed a white male pastime (something that Mad Men is well aware of, even as it gorges itself on bygone fashion and design). Any time I start to think about how nice it’d be to teleport back into the past, I remind myself how much I like air conditioning.
{ "pile_set_name": "Pile-CC" }
Q: Overloading [ ] with a template type I have a class that takes 2 template types, one for key (K) and one for value (V). When trying to overload square brackets, I get an error saying "no operator "[]" matches these operands. template <typename K, typename V> class MyMap { KeyPair<K, V>* Pairs; int Count = 0; public: MyMap() { Pairs = new KeyPair<K, V>[100]; } V& operator[] (const K& key) { for (int i = 0; i < Count; ++i) { if (key == Pairs[i].Key) { return Pairs[i].Value; } } } }; Then when trying to use it in main... MyMap<string, int>* myMap = new MyMap<string, int>(); // This gives me a "no operator "[]" matches these operands. cout << myMap["hello"] << endl; I have read a lot of other solutions where they know the type for the key, but is it possible to use a template type of a key when overloading like this? Thanks :) A: MyMap<string, int>* myMap = new MyMap<string, int>(); myMap here is a pointer. You meant: cout << (*myMap)["hello"] << endl; As oisyn noted, operator[] must be made public as well. Also: Don't use raw new/delete. Use smart pointers. Actually, you probably don't need to allocate. Just create the map on the stack. You're unnecessarily copying the key in your operator[]. Take it by const&.
{ "pile_set_name": "StackExchange" }
1. Field of the Invention The present invention generally relates to automatically posting transactions associated with a transaction account or transaction card into a general ledger. 2. Related Art Currently, accounting products used by small business owners allow for automatic migration of invoiced purchases associated with a transaction account and/or a transaction card into respective categories in a general ledger portion of the accounting product. This substantially reduces the time and effort needed by the small business owner to balance and reconcile invoiced accounts on a periodic basis. This also allows the small business owner to more freely use their transaction account/card to make business purchases, while substantially reducing their burden of having to manually review all the periods' purchases. This is because any charges associated with an invoiced vendor are automatically migrated by the accounting software into proper categories in the general ledger. Many of these transaction accounts/cards have associated rewards programs, so the small business owner benefits greatly from using them. However, current accounting products do not allow for migration of non-invoice or point-of-sale transaction information associated with the transaction account/card into the general ledger. This can deter the small business owner from using the transaction account/card to make these kinds of purchases. This can also reduce the potential rewards the small business owner could receive. Given the foregoing, what is needed is a system, method and computer program product for automatically posting substantially all transaction information associated with a transaction account into a general ledger.
{ "pile_set_name": "USPTO Backgrounds" }
Microsoft is aware of detailed information that has been published describing a new method to exploit a vulnerability in SSL 3.0 and TLS 1.0, affecting the Windows operating system. This vulnerability affects the protocol itself and is not specific to the Windows operating system. This is an information disclosure vulnerability that allows the decryption of encrypted SSL/TLS traffic. This vulnerability primarily impacts HTTPS traffic, since the browser is the primary attack vector, and all web traffic served via HTTPS or mixed content HTTP/HTTPS is affected. We are not aware of a way to exploit this vulnerability in other protocols or components and we are not aware of attacks that try to use the reported vulnerability at this time. Considering the attack scenario, this vulnerability is not considered high risk to customers. We are actively working with partners in our Microsoft Active Protections Program (MAPP) to provide information that they can use to provide broader protections to customers. Upon completion of this investigation, Microsoft will take the appropriate action to help protect our customers. This may include providing a security update through our monthly release process or providing an out-of-cycle security update, depending on customer needs. Today the MSRC released Microsoft Security Advisory 2588513 alerting customers to a new vulnerability reported in SSL 3.0 and TLS 1.0. Here we would like to give further information about the technique used to exploit this vulnerability.
{ "pile_set_name": "Pile-CC" }
Story highlights Two men were arrested on terrorism-related offenses One man was arrested at an east London home (CNN) British authorities on Wednesday arrested three more people in connection with last week's London Bridge attack, London's Metropolitan Police said. Authorities also carried out two additional search warrants in east London, police said. Two men were arrested on a street in Ilford and the third was apprehended at an Ilford residence when police searched the home, authorities said. A 27-year-old was arrested on suspicion of the preparation of terrorist acts and a 33-year-old was arrested on suspicion of possession with intent to supply controlled drugs, police said. A 29-year-old man apprehended at the llford home was also arrested on suspicion of the preparation of terrorist acts. The three were taken into custody at a south London police station under the Police and Criminal Evidence Act. Read More
{ "pile_set_name": "OpenWebText2" }
- q/(-846))/(16/18). 752 Suppose -3*u = -2*j - 100, -3*u + 13*j + 92 = 15*j. Suppose 0 = 13*g + 49 - 621. What is the least common multiple of g and u? 352 Let i = 7311161969/4720 - 1548975. Find the common denominator of i and 163/3540. 14160 Let c = -11248 + 11264. What is the lowest common multiple of c and 1440? 1440 Let z = 16369/7248 - -134/151. Find the common denominator of z and (2886/360 + -8)*(-260)/24. 144 Suppose -l - 4 + 2 = y, 0 = -5*l - 3*y. Let u(g) = -258*g**2 + 520*g**2 + 2*g**3 - 2 - 3*g - 258*g**2 - g**3. Calculate the least common multiple of u(l) and 9. 468 Let j(n) = -3*n + 31. Suppose 10*x = 2*x + 72. Let h be j(x). Suppose 53 = 5*m + h*y, 2*m + 3*m = 2*y + 41. Calculate the smallest common multiple of m and 5. 45 Let d be 268/52 - 5 - (-204)/26. Suppose 24 = d*a - 12*a. Calculate the least common multiple of 22 and 8/a*(-9 - 6). 220 Let c be (5653/(-318))/((-2)/32764*-2). Let b = 145609 + c. What is the common denominator of b and -149/30? 1590 Let r(s) = -23*s - 8. Let a = 17828 - 17826. What is the lowest common multiple of r(-6) and a? 130 Suppose 595*s - 947184 = -341418 + 288519. What is the smallest common multiple of 1503 and s? 1503 Find the common denominator of 3 - 70715/(-14155) - 8 and -29. 2831 Suppose 5*w = -4*k + 90 + 37, w = -k + 25. Let p = w - 4. Suppose -4*g - g - 65 = -4*m, 55 = 4*m - 3*g. What is the smallest common multiple of m and p? 230 Calculate the common denominator of 3/2*(68/1496)/((-6)/52) and 71/13420. 13420 Let u = 589 + -32983/56. Calculate the common denominator of u and 88*310/1519 + -19. 392 Let h(n) = -2*n**3 - 53*n**2 - 46*n - 118. Calculate the least common multiple of 2211 and h(-26). 4422 Let g = -22/455 + 99256/2071615. Let z = g - 159259/218544. What is the common denominator of -139/12 and z? 48 Let a be 4 + 12840/(-28) + (-6)/14. What is the common denominator of (-7)/(392/a) + 0 and 91/18? 72 Let a = -7863 - -7871. What is the lowest common multiple of 1638 and a? 6552 Let n = -29 - -25. Let a = 5623/632 + -7/316. What is the common denominator of 316/(-64) - -2 - n and a? 16 Suppose 36*t + 6352 = 482*t - 49*t. Calculate the smallest common multiple of 584 and t. 1168 Let u be 12/(-66) + 1927/11. Suppose 3*g - 55 = -u. Let x = 19193/6903 + -2/767. Calculate the common denominator of x and g. 9 Let s = 81669/2 + -40005. Suppose -4*l + 4*f = 605 + 2875, 0 = l - 2*f + 866. Let x = l + s. Calculate the common denominator of 107/22 and x. 22 Find the common denominator of -6 + (-245)/35 + (-1186)/(-120) and (1*2)/((-5)/2). 60 Suppose 3*b = 14*t - 11*t - 345, -t + 135 = 3*b. Calculate the smallest common multiple of 36 and t. 360 Let q = -627 - -1229. Let u be (-4)/(-14) - 1306/q. Let y = -4121/430 - u. Calculate the common denominator of -13/8 and y. 40 Let t(j) be the first derivative of -j**3/6 + 4*j**2 + 18*j - 1. Let o(w) be the first derivative of t(w). What is the least common multiple of o(-12) and 4? 20 Let x = -91495 - -15096743/165. Calculate the common denominator of x and -4*12/48 + (-517)/(-847). 1155 Let q be -186*7/((-28)/(-10)). Calculate the common denominator of (-341)/q - (-14)/(-2) and -25/9. 45 Let c be (2/6)/((-8486)/12). Let b be (97655/(-50916))/(2*(-11)/8). Let g = c + b. What is the common denominator of 139/30 and g? 330 Let z = 204/397 + -76869/161182. What is the common denominator of z and 73/10? 2030 Suppose 3*d - 4*d = -4, z = -5*d + 32. Suppose 4*i = -3*t + 34, z - 2 = -2*i. Suppose 645*p - 634*p = 220. What is the lowest common multiple of t and p? 180 Suppose -215 + 174 = -r. Suppose -r*c - 70 = -46*c. Calculate the least common multiple of 4 and c. 28 Suppose -4*d = 5*r - 11, -270*d = -271*d - 4*r. Let l be 1/(((-3)/3)/2). Let o = 4 - l. Calculate the smallest common multiple of d and o. 12 Find the common denominator of 47/150 and ((-48)/(-1404))/(30/(-414)). 1950 Let d be 23/(-15)*54/2. Let i = d - -5003/120. Calculate the common denominator of i and (-90)/120 + (2 - 20/(-25)). 120 Let z = 3075 + -2883. What is the lowest common multiple of 432 and z? 1728 Let f(i) = 32*i + 6. Let p be f(3). Let x = -39 + p. Let r = 69 - x. Calculate the lowest common multiple of r and 24. 24 Suppose 43 = -13*y + 1733. Calculate the lowest common multiple of y and 650. 650 What is the common denominator of -77/186 and -5 + ((-1171776)/(-6660))/34? 34410 Let p = -3883636744/38335 - -4152114/41. Let x = -634/17 - p. Calculate the common denominator of 22/5 and x. 55 Let c(h) be the second derivative of h**4/12 - h**3/6 - 45*h**2/2 + 2*h - 34. Calculate the smallest common multiple of 195 and c(-7). 2145 Let m = 135 + -133. Suppose 4*r - 4 + 24 = 2*z, 0 = -m*r + 10. Let n = -10 + 17. Calculate the least common multiple of z and n. 140 Let s be 56/(-824)*(-12)/(4/(-2)). Let i = s - -10075/206. Find the common denominator of i and -17/58. 58 Let f = -2455/13 + 1160617/6149. Let v = 2/312987863 + -14158631971775/2072605628786. Let o = f + v. Calculate the common denominator of 85/22 and o. 154 Let u = 332 + -57. Suppose u*n = 277*n - 16. Suppose 2*p - 13 = 4*c - 5*c, -5*c - 7 = p. Calculate the lowest common multiple of p and n. 8 Let c be 9990/14*3/6. Let l = -354 + c. What is the common denominator of ((-615)/220)/(12/8) and l? 154 Let k = -10206 - -500067/49. Calculate the common denominator of k and -83/357. 2499 Let v = -17/2613 + 119989/13221780. Calculate the common denominator of -155/84 and v. 106260 Let m = 543662761/700 - 3883219/5. Let f = 243/14 - m. Find the common denominator of -71/40 and f. 200 Let a = 10052 - 9989. What is the least common multiple of a and 315? 315 Let y(w) = 349*w + 45. Let s be y(1). Suppose -14*d - 2 = -s. Suppose 3*z = z + 8. Calculate the smallest common multiple of z and d. 28 Suppose -3*u - c = -29, 4 = 4*c - 16. Suppose u*f - 94 = -38. Suppose 3*d = 11 + 10. What is the smallest common multiple of d and f? 7 Suppose -3*h + 3*p = -1566, -4*h + 2627 = -5*p + 537. What is the least common multiple of h and 260? 520 Let i = 3/17794 + -462851/1227786. Calculate the common denominator of i and -41/1656. 1656 Let s = -9255 - -129501/14. What is the common denominator of s and -91/774? 5418 Let t be 3 - (1 + 0)*(-31 + -82). Suppose -208 = -9*h + t. Calculate the smallest common multiple of h and 36. 36 Suppose -g + 3*a = -6*g - 13, -4*g = 5*a. What is the common denominator of (-10 - g) + 1 + 107/4 and (7/(-196))/(54/2877)? 72 Calculate the common denominator of 2/(-24)*(-15 + (-1348)/(-74)) and -29/8. 888 Let f(m) = 4*m. Let v be f(2). Suppose 19*n = 20*n + v. Calculate the smallest common multiple of 27 and (-20)/n*6*1. 135 Suppose -43*x = -19484 + 478. Calculate the lowest common multiple of x and 17. 442 Let o(d) = 8 + 6*d + 1 + 18 - 3*d. Let n be o(-19). Calculate the least common multiple of 10 and 46/3 - 20/n. 80 What is the common denominator of 81/1000 and 60/(-36) + 8 + (-4648)/800? 3000 Let l(m) = -m**3 - 12*m**2 - 5*m - 58. What is the smallest common multiple of 307 and l(-12)? 614 Let x be (-345634)/64600 + 1/2. Let h = x - -3/8075. What is the common denominator of h and 35*18/216 - (-2 + 3)? 60 Let y(k) = -k**3 + 4*k**2 + k - 4. Let m be y(4). Calculate the common denominator of (m - 39)*(-1 + (-26)/(-27)) and -17/6. 18 Let u be ((-12)/(-18))/(-2 - (-2238)/1116). Let g = u - 119. Calculate the lowest common multiple of 9 and g. 45 Suppose -4*d - 102214 = -33822. Let l = d + 564163/33. Calculate the common denominator of -133/60 and l. 660 Let s = 10421851784183/544181586 - 1/20930061. Let j = -60302 - -41153. Let a = j + s. Find the common denominator of 25/16 and a. 208 Let z be 1*(156/(-30))/(2/(-20)). What is the least common multiple of (-1)/(2/30)*z/(-65) and 174? 348 Let j = -17025/2524 - 3/631. Let v be 3/(90/(-26948)) - (-168)/280. Let m = -43289/48 - v. What is the common denominator of m and j? 16 Suppose -2 = -2*m, 4*s + 6*m - 1484 = 10*m. Suppose -s - 5102 = -34*i. Calculate the smallest common multiple of i and 7. 161 Let z be (-5 - 1)/((-48)/16). What is the least common multiple of -6 + 5 + 9 + z and 134? 670 Find the common denominator of (-1515)/(-1444) - (-3 - 28/(-5 - 2)) and 55/8. 2888 Suppose 4*h + 90 = -6*h. Suppose -2*a + 21 = 69. What is the smallest common multiple of a/84 - h/7 a
{ "pile_set_name": "DM Mathematics" }
In a televised speech Friday night, Somalia's national security minister General Khalif Ahmed Ereg said the government was preparing its armed forces in the wake of the death of al-Shabab leader, Ahmed Abdi Godane. Ereg said there was "credible intelligence" that militants were planning attacks on key targets including medical and educational institutions following his killing. "Security agencies have obtained information indicating that al-Shabab is now planning to carry out desperate attacks against medical facilities, education centers and other government facilities," Ereg said. "The security forces are ready to counter their attacks and we call on people to help the security forces in standing against violent acts," he added. On Friday, the Pentagon confirmed that Godane, the leader of al Qaeda's main affiliate in Africa, died on Monday when US drones and manned aircraft launched missiles and laser-guided bombs on a meeting of the terror group's commanders in southern Somalia. The US State Department had listed Godane as one of the world's eight top terror fugitives. Al-Shabab silence over killing There was no comment from al-Shabab, which had refused to confirm or deny reports of Godane's death. He had been fighting to overthrow Somalia's internationally-backed government and had sanctioned a wave of suicide bombings, commando attacks, assassinations and kidnappings. It's believed the 37-year-old terror chief had trained with the Taliban in Afghanistan and had also overseen the group's transformation from local insurgency to a major regional guerrilla threat. Somalia's President Hassan Sheikh Mohamud said his killing was "a chance for members of Al-Shabab to embrace peace." "...this is a chance for the majority of [al-Shabab] members to change course and reject Godane's decision to make them the pawns of an international terror campaign," he said. Mohamud also said the government was "willing to offer amnesty to al-Shabab members who reject violence and renounce their links to al-Shabab and al-Qaeda," but only for the next 45 days. Kenya's response to Godane's death On Saturday, Kenya's President Uhuru Kenyatta offered his "heartfelt thanks" to the US for Godane's killing. Shoppers flee from Westgate Mall in Nairobi during Al-Shabab terror attack, September 2013 Kenyatta said it "provides a small measure of closure" for victims of the Westgate shopping mall siege around a year ago in Kenya's capital, Nairobi. At least 67 people died and dozens were wounded in the attack. "A year ago this month, armed terrorists entered the Westgate mall and committed some of the most savage crimes ever perpetrated on Kenyan soil," he said. lw/hc (AP, AFP, Reuters)
{ "pile_set_name": "OpenWebText2" }
Otis Finley Otis E. Finley Sr. (1898 – August 27, 1979) was an American football coach. He served as the head football coach Lincoln University in Jefferson City, Missouri in 1924 and at Virginia State College for Negroes—now known as Virginia State University–from 1925 to 1926, compiling a career college football coaching record of 9–6–5. Finley was a graduate of Tuskegee University, the University of Akron, and Springfield College in Springfield, Massachusetts. He died on August 27, 1979, in Maryland. Head coaching record College References Category:1898 births Category:1979 deaths Category:Lincoln Blue Tigers football coaches Category:Springfield Pride football players Category:Virginia State Trojans football coaches Category:High school football coaches in Missouri Category:Tuskegee University alumni Category:University of Akron alumni Category:African-American coaches of American football Category:African-American players of American football
{ "pile_set_name": "Wikipedia (en)" }
Investors dumped technology and other growth stock winners Wednesday in favor of defensive and value names, a trend that has accelerated as interest rates rise. Tech stocks fell 4.8 percent in the worst day for the S&P sector since Aug. 18, 2011. The tech-heavy Nasdaq led the declines with a 4.1 percent loss, and the Dow ended down 831 points or 3.1 percent. The was off 3.3 percent, but the small-cap Russell 2000, however, was down slightly less at 2.8 percent. "We've had a rolling correction. It started with the small caps over the last couple months, and now they're getting to the mega caps. The correction sort of rolled, and now we're finally getting to the big boys," said Peter Boockvar, chief investment officer at Bleakley Advisory Group. But the sell-off has definitely been targeting big-cap growth names, like "FANG" companies Facebook, Netflix, Amazon and Google's parent Alphabet, all down sharply. In tech, semiconductors were down 3.4 percent, and have now fallen more than 7 percent since the start of October. Names tied to global growth, like Caterpillar, have also been slammed. But telecommunications stocks and utilities, traditional defensive sectors, were higher. Some steady consumer products stocks were also in the green Wednesday and for the month. Some discretionary stocks, like Dollar Tree and Kohl's were higher, and mining stocks, including Newmont Mining also made gains. The S&P 500 is off by 3.9 percent so far in October. As of Wednesday morning, the Russell 1000 Growth Index was down by double that in October. Meanwhile the Russell 1000 Value Index is off by less than 1 percent for the one month. "That's clearly a trend that's at play in the market. There's a lot of fundamental reasons why people might be making that shift, and rates is one of them. You're also just coming into a new quarter, and earnings season is just around the corner," said Robert Sluymer, technical strategist at Fundstrat. He said earnings season could provide the catalyst to reverse the sell-off.
{ "pile_set_name": "OpenWebText2" }
PEARL HARBOR, Hawaii (NNS) -- Friends and families gathered at the submarine piers on Joint Base Pearl Harbor-Hickam to welcome home the crew of the Los Angeles-class fast attack submarine USS Houston (SSN 713) as she returned to Pearl Harbor from a deployment to the Western Pacific Region, Feb. 14. "After a change of homeport and an arduous shipyard period, the crew of Houston was eager to get their submarine back overseas into the Western Pacific area of operations and contribute to national defense," said Cmdr. Paul Davis, Houston's commanding officer. "I am very proud of the way these men have handled themselves throughout our seven months, meeting every challenge with professionalism and pride." Houston conducted a variety of operations and theater security exercises throughout the deployment, contributing to the nation's strategic posture in the region. Houston also strengthened relationships with South Korea through exercises with the Royal Korean Navy submarine Choi Moo Sun and the USS George Washington carrier strike group. "They represented our nation well throughout the deployment, and I also am thankful for the tremendous support we have enjoyed from the spouses and family members. Their support, encouragement and sacrifice enabled our successful deployment," said Davis. During the deployment, 33 enlisted submariners achieved their submarine qualification and are now entitled to wear the enlisted submarine warfare insignia. Davis said a majority of the crew also completed advanced qualifications which are the building blocks for future operations, ensuring Houston's performance will remain strong. "With about 60 percent of the crew making their first Western Pacific deployment, invaluable training and experience were obtained," said Houston's Chief of the Boat, Senior Chief Machinist's Mate Jay Cherland. Cherland added, "But we couldn't do it without the love and support of those we left behind. My hat goes off to our command ombudsman, Consuela Rodriguez and the Family Readiness Group. They really helped take care of the command families." One Sailor had an extra special homecoming waiting for him. Sonar Technician Submarines 1st Class Fred Leonard arrived to meet his new daughter, born Sept. 3, while the boat was under way. "I've been looking forward to holding my daughter for five months; it's great that it's finally a reality," said Leonard. "He's the best Valentine's gift ever!" said Eileen Ward, spouse of Houston Sailor Lt. j.g. Coleman Ward. "I'm overwhelmed, elated, and excited! We're expecting our first child, and I'm just so excited to have him home so we can move forward and enjoy Hawaii together as a family again!" With over 46,000 nautical miles steamed and participation in multinational exercises, Houston worked to enhance strong relationships in the region. Additionally, during their seven months away from Pearl Harbor, the crew enjoyed several memorable port visits including Guam and Singapore. Houston is the fourth U.S. Navy vessel named in honor of the city of Houston, Texas. She is a Los Angeles-class submarine, 360 feet long and displacing 6,900 tons. She can be fitted with Mk-48 torpedoes and Tomahawk missiles. For more news from Commander, Submarine Force, U.S. Pacific Fleet, visit www.navy.mil/local/subpac/.
{ "pile_set_name": "Pile-CC" }
we oui That French plan to attract climate scientists? It’s working. After his election, French president Emmanuel Macron created a program setting aside $69 million to fund researchers, especially from the U.S., to ply their trade in France. “Here, you are welcome,” Macron told scientists via Twitter, in a not-so-subtle jab at President Trump. A month later, it appears researchers took Macron seriously. According to France’s national research agency, hundreds of climate scientists from around the world have applied for the program. Many hail from the U.S. The agency says most applicants are looking for short sabbaticals, but more than 150 applied to stay for four or more years. Macron’s idea has its detractors. French researchers felt snubbed because their president built a shiny website to attract new talent at a time when domestic science needed more funds, according to Science. Grist’s own Nathanael Johnson pleaded with leading American climate researchers to “resist France’s allure” because their smarts are so needed here. But when the U.S. administration casts aside scientists every chance it gets, it’s hard to argue with researchers’ interest in going where they’re wanted. One tenured climate expert told Nature that if her position were more precarious, she’d be “jumping at the opportunity.”
{ "pile_set_name": "OpenWebText2" }
464 A.2d 750 (1983) NORTHERN RENT-A-CAR, INC. v. William CONWAY, Commissioner. No. 82-160. Supreme Court of Vermont. June 15, 1983. *751 Paradis & Coombs, Essex Junction, for plaintiff-appellant. John J. Easton, Jr., Atty. Gen., and Thomas R. Viall, Asst. Atty. Gen., Montpelier, for defendant-appellee. Before BILLINGS, C.J., and HILL, UNDERWOOD and GIBSON, JJ., and LARROW, J. (Ret.), Specially Assigned. GIBSON, Justice. Northern Rent-A-Car, Inc. [Northern] owns and operates a car rental business at the Burlington International Airport. Pursuant to V.R.C.P. 75, it appeals from an adverse determination by the Washington Superior Court, which upheld the Commissioner of Motor Vehicle's assessment of a purchase and use tax under 32 V.S.A. §§ 8901-8915. The tax was allegedly due as a result of a February 1980 transfer to Northern of rental vehicles from a sister corporation in exchange for 100% of Northern's stock. At the time of the transfer, both Northern and its sister corporation were wholly owned by a third party. In its brief, Northern correctly states the narrow issue now before this Court: "In order for [Northern] to prevail in the instant case, the word `individual' as stated in 32 V.S.A. § 8911(10) must be interpreted as including corporations." For reasons detailed herein, we agree with both Commissioner Conway and the trial court that an individual is not a corporation, and therefore, we affirm. None of the relevant facts are in issue; the parties to this appeal have stipulated to the corporate history of Northern. Further, the parties agree that, but for the possible exemption embodied in 32 V.S.A. § 8911(10), Northern would be liable for the purchase and use tax. Section 8911(10), as then in force, read: The tax imposed by this chapter shall not apply to: (10) motor vehicles registered in Vermont by the transferor and transferred between that individual and a business entity controlled by him, if the transfer is exempt under section 351 of the United States Internal Revenue Code in effect July 1, 1966; The trial court found, and we agree, that qualification for this purchase and use tax exemption requires the satisfaction of four elements: (1) the motor vehicles must be registered to the transferor prior to the transfer; (2) the transferor must be an individual; (3) the transferor must control the transferee business entity; and (4) the transfer must be exempt under I.R.C. § 351 (as codified at 26 U.S.C. § 351). Directing our attention to element two, Northern argues that although "individual" is undefined in our statutes, the "obvious purpose of this exemption is to relieve taxpayers who have already paid a purchase and use tax, from paying a subsequent tax upon a tax free reorganization of the taxpayer's business." In analyzing this issue of statutory construction, we must keep in mind that the primary objective is to give effect to the intention of the legislature. Wetterau, Inc. v. Department of Taxes, 141 Vt. 324, 327, 449 A.2d 896, 897 (1982). Further, the plain and ordinary meaning of statutory language is presumed to be intended. Id. The legislature's choice in providing a tax exemption to individuals affords us with little leeway for statutory construction. The term "individual" has a "well understood and common meaning. Words in a statute without definition are to be given their plain and commonly accepted use." Eastern Advertising, Inc. v. Cooley, 126 Vt. 221, 223, 227 A.2d 294, 295 (1967). *752 Black's Law Dictionary provides this Court with just such a common definition. As a noun, this term denotes a single person as distinguished from a group or class, and also, very commonly, a private or natural person as distinguished from a partnership, corporation, or association; but it is said that this restrictive signification is not necessarily inherent in the word, and that it may, in proper cases, include artificial persons. Black's Law Dictionary (5th ed. 1979). Northern's suggestion that the legislature intended an unusual definition for "individual," yet neglected to provide any hint of its plan, is unpersuasive. We note that the word "person," as it applies to purchase and use taxes, is defined in 32 V.S.A. § 8902(7) as follows: "any individual, firm, partnership. . . or corporation." Clearly, the legislature intended to differentiate between individuals and corporations. Further proof that the legislature was well aware of the definition and the restrictive class of taxpayer thereby entitled to purchase and use tax relief is found in the 1982 amendment to 32 V.S.A. § 8911(10). As now amended, the exemption applies to transfers between a qualified "individual or partnership and a business entity controlled by the transferor . . . ." The legislature could easily have added an exemption for corporations by the same amendment, if it had so intended. Given the recent adjustment to the subsection in issue and the plain meaning of the terms employed, we will not judicially expand § 8911(10) to include corporations like Northern. In view of the necessity that all four statutory criteria must be met to qualify for the purchase and use tax exemptions, and our holding that Northern is not an "individual" within the ambit of 32 V.S.A. § 8911(10), we need not reach the other claims of error raised by appellant. However, we do note, finally, that the claimed equal protection violation is without merit. Where, as here, no fundamental rights or suspect classes are involved, the legislature is constitutionally permitted to grant tax exemptions to specific groups so long as it has a "rational basis" for its acts, and is not being wholly arbitrary or capricious. See Hadwen, Inc. v. Department of Taxes, 139 Vt. 37, 42, 422 A.2d 255, 258 (1980). Northern has not carried its "very weighty burden" of voiding a taxing measure on equal protection grounds. Governor Clinton Council, Inc. v. Koslowski, 137 Vt. 240, 245, 403 A.2d 689, 693 (1979). Affirmed.
{ "pile_set_name": "FreeLaw" }
<?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>files</key> <dict> <key>Headers/FLEX-umbrella.h</key> <data> jkYe0X5631Pe2dyo+Due1BoBzKU= </data> <key>Headers/FLEXArgumentInputColorView.h</key> <data> /AvvZZ7LZpmFhJlrs4ClVsd/tn0= </data> <key>Headers/FLEXArgumentInputFontView.h</key> <data> 9SYBA/Ki3qwlnz21Z27XhvbVjJ8= </data> <key>Headers/FLEXArgumentInputFontsPickerView.h</key> <data> dy3ES8NU12/+WMjO9VCD2/CaWMQ= </data> <key>Headers/FLEXArgumentInputJSONObjectView.h</key> <data> S4wmImQl3cKegXuZa3enbhFkJDw= </data> <key>Headers/FLEXArgumentInputNotSupportedView.h</key> <data> 06uFCfHn95vzctSdKthCSX0UvOo= </data> <key>Headers/FLEXArgumentInputNumberView.h</key> <data> tbuB/lbCiYCae8KolMsZn1DjSL0= </data> <key>Headers/FLEXArgumentInputStringView.h</key> <data> 8YrgqC0rHGg05t+QIbsllMUzRdQ= </data> <key>Headers/FLEXArgumentInputStructView.h</key> <data> U/StPm8HBUc2QFP+YK7fyW+nSWY= </data> <key>Headers/FLEXArgumentInputSwitchView.h</key> <data> qU01gaAsms4itNghkU5b34vR1UU= </data> <key>Headers/FLEXArgumentInputTextView.h</key> <data> hSYqqVf+WyeD95rTiVEw7Cmc8Cc= </data> <key>Headers/FLEXArgumentInputView.h</key> <data> Oc0nnEgfgbYnPgvPpj8KEJakGnQ= </data> <key>Headers/FLEXArgumentInputViewFactory.h</key> <data> lTL4Lj0fXaAXWYFw0pW4SOCbYdc= </data> <key>Headers/FLEXArrayExplorerViewController.h</key> <data> HH72ZQ/svQdcQTec9FLGhJdrcAQ= </data> <key>Headers/FLEXClassExplorerViewController.h</key> <data> FL7HSz9/olhLejidvmIM42DqVys= </data> <key>Headers/FLEXClassesTableViewController.h</key> <data> 4QZYnP0LoHF+iLM+MkdJW6Sl13w= </data> <key>Headers/FLEXDefaultEditorViewController.h</key> <data> hT19z1LkdITSH6uY5oXfTRXrV/s= </data> <key>Headers/FLEXDefaultsExplorerViewController.h</key> <data> mxhRjUH//rcYFMkUluHsqggZ0Ww= </data> <key>Headers/FLEXDescriptionTableViewCell.h</key> <data> abpen+jaFEVX4tbA26Lbb5N0f+c= </data> <key>Headers/FLEXDictionaryExplorerViewController.h</key> <data> LtXGC2ayUQds4L8/vJpW7su+jGQ= </data> <key>Headers/FLEXExplorerToolbar.h</key> <data> nX5cKikkZfajxbYV0PsBqQ56CaQ= </data> <key>Headers/FLEXExplorerViewController.h</key> <data> so0wUBrUW5ZyBasU3kL66AYKQP4= </data> <key>Headers/FLEXFieldEditorView.h</key> <data> /ObvFP0oNQKWJvMZ5cqJTpTiyPo= </data> <key>Headers/FLEXFieldEditorViewController.h</key> <data> G9RXNlKXswwyvnMBi1+ngxL5CEM= </data> <key>Headers/FLEXFileBrowserTableViewController.h</key> <data> nJLi9AUUMCnvH9BOIBhY0YK/grM= </data> <key>Headers/FLEXGlobalsTableViewController.h</key> <data> 5MbjfhK1K1h+CrP+Ywxnc6fGeLU= </data> <key>Headers/FLEXGlobalsTableViewControllerEntry.h</key> <data> bMLmx/FqdV8QzUOD7E59ys7DES0= </data> <key>Headers/FLEXHeapEnumerator.h</key> <data> U6c/tBOEBatjPgqFrTHdqgsgQuY= </data> <key>Headers/FLEXHierarchyTableViewCell.h</key> <data> QvHOk18sHiS+7CS0mHwnXZhKpK0= </data> <key>Headers/FLEXHierarchyTableViewController.h</key> <data> AAQ+3YKnwOEtMqU0saKt1GEgxS8= </data> <key>Headers/FLEXImageExplorerViewController.h</key> <data> 1r/AbkFwnmWz945Sjc/Lynt+k0g= </data> <key>Headers/FLEXImagePreviewViewController.h</key> <data> lBNrbxEB9qWL3FmLGp71su9yjMg= </data> <key>Headers/FLEXInstancesTableViewController.h</key> <data> ps9sSlChvSdoWMPoddpplUtH4yM= </data> <key>Headers/FLEXIvarEditorViewController.h</key> <data> zCC+qV8f7tG1MCy/2kdLtYdYN24= </data> <key>Headers/FLEXLibrariesTableViewController.h</key> <data> yM7SnjrlqhKLcKGctQZ+aim38XQ= </data> <key>Headers/FLEXLiveObjectsTableViewController.h</key> <data> KUM7uV2RFWFO+lVSvy5nMz7hTPQ= </data> <key>Headers/FLEXManager+Private.h</key> <data> mRWLnB70Q84L97eihjespQCmkeY= </data> <key>Headers/FLEXManager.h</key> <data> 0PhUXfaPKlHBySUFT7NqsxfvHoE= </data> <key>Headers/FLEXMethodCallingViewController.h</key> <data> qQroNe3Z2KNvAejDOFaZbwilw2M= </data> <key>Headers/FLEXObjectExplorerFactory.h</key> <data> Zi3Yb51os5bvz2U9zr3pZ0GBqJ4= </data> <key>Headers/FLEXObjectExplorerViewController.h</key> <data> ifeeEh4aBlL13NwjF88pL2OFUHw= </data> <key>Headers/FLEXPropertyEditorViewController.h</key> <data> QXE72Ss4G56iUq51vMHPAOkMyXI= </data> <key>Headers/FLEXResources.h</key> <data> AbsWSKtiIBh0Bho04FLi8MQd3VI= </data> <key>Headers/FLEXRuntimeUtility.h</key> <data> 3myp2xe0niqCokrsRGRJODnvsx0= </data> <key>Headers/FLEXSetExplorerViewController.h</key> <data> ViJeODn5GTzd5oW1z4gd9uVQTZM= </data> <key>Headers/FLEXToolbarItem.h</key> <data> s9ITH6WZDOaHkAPdlqVFfHxaUVI= </data> <key>Headers/FLEXUtility.h</key> <data> Tbicvp2iw4g5jV6MPDjY16/w4GU= </data> <key>Headers/FLEXViewControllerExplorerViewController.h</key> <data> sDj6PDerE0JBwRzPAuyqJ2WBb08= </data> <key>Headers/FLEXViewExplorerViewController.h</key> <data> er6Aa4f40yU6Zo/NCNjRXniTNg4= </data> <key>Headers/FLEXWebViewController.h</key> <data> gWGmoUmd/3tJgPRYWnALyFcG3/g= </data> <key>Headers/FLEXWindow.h</key> <data> 1MpkxaeRHksJaf8cwQ2wgcQy+oE= </data> <key>Info.plist</key> <data> +gO2cJ2iKRzL6cUHDeqCk27WJDM= </data> <key>Modules/module.modulemap</key> <data> aEuw8usei7rJ9P5TK/3F9jEeSeY= </data> </dict> <key>files2</key> <dict> <key>Headers/FLEX-umbrella.h</key> <data> jkYe0X5631Pe2dyo+Due1BoBzKU= </data> <key>Headers/FLEXArgumentInputColorView.h</key> <data> /AvvZZ7LZpmFhJlrs4ClVsd/tn0= </data> <key>Headers/FLEXArgumentInputFontView.h</key> <data> 9SYBA/Ki3qwlnz21Z27XhvbVjJ8= </data> <key>Headers/FLEXArgumentInputFontsPickerView.h</key> <data> dy3ES8NU12/+WMjO9VCD2/CaWMQ= </data> <key>Headers/FLEXArgumentInputJSONObjectView.h</key> <data> S4wmImQl3cKegXuZa3enbhFkJDw= </data> <key>Headers/FLEXArgumentInputNotSupportedView.h</key> <data> 06uFCfHn95vzctSdKthCSX0UvOo= </data> <key>Headers/FLEXArgumentInputNumberView.h</key> <data> tbuB/lbCiYCae8KolMsZn1DjSL0= </data> <key>Headers/FLEXArgumentInputStringView.h</key> <data> 8YrgqC0rHGg05t+QIbsllMUzRdQ= </data> <key>Headers/FLEXArgumentInputStructView.h</key> <data> U/StPm8HBUc2QFP+YK7fyW+nSWY= </data> <key>Headers/FLEXArgumentInputSwitchView.h</key> <data> qU01gaAsms4itNghkU5b34vR1UU= </data> <key>Headers/FLEXArgumentInputTextView.h</key> <data> hSYqqVf+WyeD95rTiVEw7Cmc8Cc= </data> <key>Headers/FLEXArgumentInputView.h</key> <data> Oc0nnEgfgbYnPgvPpj8KEJakGnQ= </data> <key>Headers/FLEXArgumentInputViewFactory.h</key> <data> lTL4Lj0fXaAXWYFw0pW4SOCbYdc= </data> <key>Headers/FLEXArrayExplorerViewController.h</key> <data> HH72ZQ/svQdcQTec9FLGhJdrcAQ= </data> <key>Headers/FLEXClassExplorerViewController.h</key> <data> FL7HSz9/olhLejidvmIM42DqVys= </data> <key>Headers/FLEXClassesTableViewController.h</key> <data> 4QZYnP0LoHF+iLM+MkdJW6Sl13w= </data> <key>Headers/FLEXDefaultEditorViewController.h</key> <data> hT19z1LkdITSH6uY5oXfTRXrV/s= </data> <key>Headers/FLEXDefaultsExplorerViewController.h</key> <data> mxhRjUH//rcYFMkUluHsqggZ0Ww= </data> <key>Headers/FLEXDescriptionTableViewCell.h</key> <data> abpen+jaFEVX4tbA26Lbb5N0f+c= </data> <key>Headers/FLEXDictionaryExplorerViewController.h</key> <data> LtXGC2ayUQds4L8/vJpW7su+jGQ= </data> <key>Headers/FLEXExplorerToolbar.h</key> <data> nX5cKikkZfajxbYV0PsBqQ56CaQ= </data> <key>Headers/FLEXExplorerViewController.h</key> <data> so0wUBrUW5ZyBasU3kL66AYKQP4= </data> <key>Headers/FLEXFieldEditorView.h</key> <data> /ObvFP0oNQKWJvMZ5cqJTpTiyPo= </data> <key>Headers/FLEXFieldEditorViewController.h</key> <data> G9RXNlKXswwyvnMBi1+ngxL5CEM= </data> <key>Headers/FLEXFileBrowserTableViewController.h</key> <data> nJLi9AUUMCnvH9BOIBhY0YK/grM= </data> <key>Headers/FLEXGlobalsTableViewController.h</key> <data> 5MbjfhK1K1h+CrP+Ywxnc6fGeLU= </data> <key>Headers/FLEXGlobalsTableViewControllerEntry.h</key> <data> bMLmx/FqdV8QzUOD7E59ys7DES0= </data> <key>Headers/FLEXHeapEnumerator.h</key> <data> U6c/tBOEBatjPgqFrTHdqgsgQuY= </data> <key>Headers/FLEXHierarchyTableViewCell.h</key> <data> QvHOk18sHiS+7CS0mHwnXZhKpK0= </data> <key>Headers/FLEXHierarchyTableViewController.h</key> <data> AAQ+3YKnwOEtMqU0saKt1GEgxS8= </data> <key>Headers/FLEXImageExplorerViewController.h</key> <data> 1r/AbkFwnmWz945Sjc/Lynt+k0g= </data> <key>Headers/FLEXImagePreviewViewController.h</key> <data> lBNrbxEB9qWL3FmLGp71su9yjMg= </data> <key>Headers/FLEXInstancesTableViewController.h</key> <data> ps9sSlChvSdoWMPoddpplUtH4yM= </data> <key>Headers/FLEXIvarEditorViewController.h</key> <data> zCC+qV8f7tG1MCy/2kdLtYdYN24= </data> <key>Headers/FLEXLibrariesTableViewController.h</key> <data> yM7SnjrlqhKLcKGctQZ+aim38XQ= </data> <key>Headers/FLEXLiveObjectsTableViewController.h</key> <data> KUM7uV2RFWFO+lVSvy5nMz7hTPQ= </data> <key>Headers/FLEXManager+Private.h</key> <data> mRWLnB70Q84L97eihjespQCmkeY= </data> <key>Headers/FLEXManager.h</key> <data> 0PhUXfaPKlHBySUFT7NqsxfvHoE= </data> <key>Headers/FLEXMethodCallingViewController.h</key> <data> qQroNe3Z2KNvAejDOFaZbwilw2M= </data> <key>Headers/FLEXObjectExplorerFactory.h</key> <data> Zi3Yb51os5bvz2U9zr3pZ0GBqJ4= </data> <key>Headers/FLEXObjectExplorerViewController.h</key> <data> ifeeEh4aBlL13NwjF88pL2OFUHw= </data> <key>Headers/FLEXPropertyEditorViewController.h</key> <data> QXE72Ss4G56iUq51vMHPAOkMyXI= </data> <key>Headers/FLEXResources.h</key> <data> AbsWSKtiIBh0Bho04FLi8MQd3VI= </data> <key>Headers/FLEXRuntimeUtility.h</key> <data> 3myp2xe0niqCokrsRGRJODnvsx0= </data> <key>Headers/FLEXSetExplorerViewController.h</key> <data> ViJeODn5GTzd5oW1z4gd9uVQTZM= </data> <key>Headers/FLEXToolbarItem.h</key> <data> s9ITH6WZDOaHkAPdlqVFfHxaUVI= </data> <key>Headers/FLEXUtility.h</key> <data> Tbicvp2iw4g5jV6MPDjY16/w4GU= </data> <key>Headers/FLEXViewControllerExplorerViewController.h</key> <data> sDj6PDerE0JBwRzPAuyqJ2WBb08= </data> <key>Headers/FLEXViewExplorerViewController.h</key> <data> er6Aa4f40yU6Zo/NCNjRXniTNg4= </data> <key>Headers/FLEXWebViewController.h</key> <data> gWGmoUmd/3tJgPRYWnALyFcG3/g= </data> <key>Headers/FLEXWindow.h</key> <data> 1MpkxaeRHksJaf8cwQ2wgcQy+oE= </data> <key>Modules/module.modulemap</key> <data> aEuw8usei7rJ9P5TK/3F9jEeSeY= </data> </dict> <key>rules</key> <dict> <key>^</key> <true/> <key>^.*\.lproj/</key> <dict> <key>optional</key> <true/> <key>weight</key> <real>1000</real> </dict> <key>^.*\.lproj/locversion.plist$</key> <dict> <key>omit</key> <true/> <key>weight</key> <real>1100</real> </dict> <key>^version.plist$</key> <true/> </dict> <key>rules2</key> <dict> <key>.*\.dSYM($|/)</key> <dict> <key>weight</key> <real>11</real> </dict> <key>^</key> <dict> <key>weight</key> <real>20</real> </dict> <key>^(.*/)?\.DS_Store$</key> <dict> <key>omit</key> <true/> <key>weight</key> <real>2000</real> </dict> <key>^(Frameworks|SharedFrameworks|PlugIns|Plug-ins|XPCServices|Helpers|MacOS|Library/(Automator|Spotlight|LoginItems))/</key> <dict> <key>nested</key> <true/> <key>weight</key> <real>10</real> </dict> <key>^.*</key> <true/> <key>^.*\.lproj/</key> <dict> <key>optional</key> <true/> <key>weight</key> <real>1000</real> </dict> <key>^.*\.lproj/locversion.plist$</key> <dict> <key>omit</key> <true/> <key>weight</key> <real>1100</real> </dict> <key>^Info\.plist$</key> <dict> <key>omit</key> <true/> <key>weight</key> <real>20</real> </dict> <key>^PkgInfo$</key> <dict> <key>omit</key> <true/> <key>weight</key> <real>20</real> </dict> <key>^[^/]+$</key> <dict> <key>nested</key> <true/> <key>weight</key> <real>10</real> </dict> <key>^embedded\.provisionprofile$</key> <dict> <key>weight</key> <real>20</real> </dict> <key>^version\.plist$</key> <dict> <key>weight</key> <real>20</real> </dict> </dict> </dict> </plist>
{ "pile_set_name": "Github" }