Split (2)

member · 5k rows

text stringlengths 3.04k 31k
A 27-year-old female (46,XX) patient with normal cognition visited the Endocrinology Clinic of 1st affiliated hospital of China Medical University (Shenyang) for amenorrhea with an unknown etiology. The patient had labial fusion when she was born and underwent plastic surgery afterward. During puberty, the patient underwent another surgery for an ovarian cyst. The patient was treated in another hospital as PCOS for several times resulting with mild remission of amenorrhea and recurrence of ovarian cysts. The patient was suspected of having 21-OHD due to increased 17OHP levels and came to our hospital for a genetic test for CYP21A2 mutations. The patient did not have fatigue, loss of appetite or other symptoms and was the only child in the family. Her parents appeared to be normal. She was born by vaginal delivery, and the mother had no complaints of abnormal manifestations during the perinatal period or history of reproductive system diseases. Her parents are nonconsanguineous. Physical examination of the patient revealed the following characteristics: a height of 165 cm and weight of 55 kg; no hyperandrogenism symptoms like hirsutism or acne; and no purple stripes. The patient complained of difficulty of bending the metacarpophalangeal joints from childhood (Fig. ). There were no obvious abnormalities in the genitals.\nThe ultrasound showed the presence of a 1.2 × 1.4 cm fluid area in the left ovary, and there was a 9.5 × 6.3 × 4.3 cm cyst in the right ovary behind the uterus. Digital radiography (DR) suggested there were no bone abnormalities (Fig. ). The adrenal CT scan showed there were no obvious hyperplasia changes (Fig. ). The laboratory test results of the patient and her parents are shown in Table . The levels of progesterone and 17-hydroxy progesterone of the patient were significantly increased. Androgen levels were not increased, and the basal level of cortisol in the morning was within the lower limit of the normal level. Cortisol was stimulated by the ACTH stimulation test. There were no abnormalities in the other measurements or in those of the parents.\nCYP21A2 (NM_000500) was tested first due to the suspicion of 21-OHD, but no mutations were found in the patient. Then the patient’s complaint about a mild difficulty of bending the metacarpophalangeal joints reminded us to consider PORD, which usually presents with skeletal deformities and sexual dysfunction, so POR (NM_000941) gene was tested secondly. Exon 11 of PORharbored a homozygous mutation (c.1370G > A) which leads to a conversion of arginine at amino acid position 457 to histidine (R457H). The patient’s parents were both heterozygous carriers of this variant (Fig. ). Since the disease-causing homozygous mutations in POR gene were found, no further genetic analysis was performed.\nOur patient once underwent surgery to remove a large ovarian cyst; however, since the diagnosis was unclear and hormone replacement therapy was not given, the ovarian cyst soon recurred. The patient was given low-dose corticosteroids twice a day (hydrocortisone 5 mg in the morning and 2.5 mg in the afternoon) and estrogen/progesterone sequential therapy in our hospital, and her ovarian cysts gradually decreased in size (the biggest ovarian cyst shrank to 3.5 × 3.3 × 2.3 cm) with regular menstruation in the following visits. The serum levels of ACTH, LH, 17OHP and P were declined accordingly (Table ). No adverse effect of corticosteroids was found in the follow-up.
A 42-year-old man was admitted with a recurring vesicocutaneous fistula on the lateral surface of the left hip after two surgical repairs. Three years previously he had experienced a major pelvic trauma (closed left acetabular and left hip fracture) in a motor vehicle accident with immobilization being the only treatment applied. Three months after the accident, the patient denoted urine leakage from a small orifice on the left hip. He used two to three incontinence pads per day for the leakage. During the following 2 years the patient twice underwent surgical treatment (extraperitoneal fistula excision and bladder wall suturing) in a small rural hospital. The fistula recurred shortly after both operations.\nAdmission radiograms disclosed ankylosis of the left hip joint, avascular necrosis of the femoral head, and central hip dislocation through the perforated acetabulum ().\nOn the lateral surface of the left hip in the projection of the greater trochanter, there was a 2 mm fistula orifice with hyperemic rims and discharge confirmed biochemically to be urine. There were no clinical signs of systemic or local inflammation.\nThe median micturition volume was 210 ml with a maximum flow speed of 18 ml/s according to the uroflowmetry. Otherwise, the patient was healthy and all laboratory parameters were within the normal ranges.\nNeither sonography nor urethrocystoscopy yielded any abnormal findings. The cystography combined with the fistulography showed contrast extravasation through the left bladder wall but could not elucidate any relevant information about the fistula tract's course or its relation to the pelvic bones and the hip joint (). To obtain this information, we performed multispiral computed tomography (CT) combined with CT-fistulography.\nThe nonenhanced CT images showed a drastic disfigurement of the left hip joint with some dense structures up to 5 cm in size lying in the joint cavity ().\nA fistulography showed contrast extension to the bladder with excellent visualization of the fistula tract within the left hip joint ().\nThe patient underwent a retroperitoneal fistula excision and a double-layer closure of the bladder wall. The patient was discharged on the 14th postoperative day, and cystography showed no contrast extravasation. No signs of urine leakage in the old fistula location were evident.\nThe fistula and urinary leakage recurred within 2 months. A decrease in mean bladder volume to 130 ml was found according to the bladder diary and during the bladder filling through the urethral catheter.\nA second operation was performed 3 months later. Wide dissection of the left bladder wall was performed with a complete excision of scar tissue. Revision of the hip joint was performed. Up to 10 urinary stones 0.3 to 4 cm in size were extracted from the joint cavity (which were previously seen on CT). Also, ileocystoplasty was performed to augment the bladder, and the left rectus abdominis muscle flap was interposed between the bladder and the acetabulum.\nAgain we had a complete fistula closure in 14 days without discharge.\nHowever, in 2 months, the fistula relapsed again. The bladder capacity during filling was 150 ml with a postvoid residual volume of 20 to 30 ml.\nAfter analyzing the previous failures, we decided to make a urinary diversion as a salvage procedure for this patient. The Bricker procedure was chosen by the patient after explanation of all possible variants (the patient refused to catheterize himself because of living in rural conditions very far from any medical help). Cystectomy was not performed because the access to the bladder was virtually impossible as the result of the previous procedures.\nAfter the operation, discharge from the fistula continued with significant decrease of the amount and change in appearance to a whitish cloudy liquid.\nWe suspected joint osteomyelitis to be the most probable cause for these manifestations. The patient was referred to the orthopaedic center for further treatment. During the next 2 months, the patient two joint revisions with the removal of the nonviable bone tissue and open reduction internal fixation (ORIF) to stabilize the pelvic bones. These were the final steps in the treatment of this patient.
A 60-year-old man presented with sudden severe right shoulder and flank pain and numbness of the right hand. The patient had a history of working in his home garden every day. He had no subjective symptoms prior to the day of admission, and no past medical history other than hypertension, which was managed with medication. The patient called an ambulance 3 h after the onset of symptoms and was able to get into the ambulance unassisted. He was transported to a nearby hospital. At the hospital, he developed hemoptysis and hypoxemia with severe forced breathing and tachypnea. He was tracheally intubated and transferred to our emergency department by air ambulance helicopter 6 h after the onset of symptoms.\nOn examination in our emergency department, a coarse crackle with right lateral dominance was audible. A small volume of blood was continuously suctioned through the tracheal tube, although bronchoscopic examination did not reveal any source of bleeding. The patient’s blood pressure was 132/87 mmHg, pulse was 109 beats per minute and body temperature was 36.7 °C. He was mechanically ventilated with spontaneous breathing at a rate of 14 breaths per minute under sedation. No skin eruptions or lesions were observed.\nUpon examination of chest computed tomography (CT), we saw infiltration predominant in the right upper lobe and spreading to the right middle and lower lobe and left hilar area (Fig. ). Peripheral blood was collected for laboratory examination. Arterial blood gas analysis showed a pH of 7.174, with a partial pressure of carbon dioxide of 62.4 mmHg, a partial pressure of oxygen of 94.3 mmHg, a base deficit of − 7.4. under the condition of end-expiratory pressure at 10 cm H2O, and a fraction of inspired oxygen of 0.5, indicating acute respiratory failure. Other laboratory data were normal, including blood cell count, coagulation, and biochemistry, including inflammatory biomarkers, other than a slight elevation in serum creatinine level (1.37 mg/dL).\nElectrocardiography showed a sinus rate of 86 beats per minute, with an obvious ST segment elevation in the inferior leads. Echocardiography also showed severe hypokinesis of the cardiac inferior wall. The patient’s serum troponin T level was elevated (0.487 ng/mL).\nThe patient’s history was obtained from his family, and showed only hypertension. His current medications included enalapril, carvedilol, and amlodipine. He had no known allergies and no recent travel history. He did not smoke and there was no history of unusual ingestions. The Triage DOA® intoxication screening test result was negative.\nFrom the laboratory results and other tests, there were two contradictory clinical concerns: revascularization of the coronary artery and alveolar hemostasis. As the etiology of the alveolar hemorrhage was unknown, we were obliged to seek the pathogenesis under mechanical ventilation, with no obvious indicators for a hemostatic approach. Thus, after discussion, we decided to prioritize the revascularization of the coronary artery. After heparinization, coronary angiography confirmed 99% severe stenosis with a flow delay (thrombolysis in myocardial infarction grade 2 flow) of the mid right coronary artery at segment 2. Thrombus aspiration was performed, followed by implantation of a drug-eluting stent (DES). To minimize the bleeding risk, we delayed administration of antiplatelet drugs, aspirin and prasugrel, until the time of definite decision to implant the DES.\nNext, transcatheter arterial embolization was performed to treat the alveolar hemorrhage. Although we did not detect overt extravasation by angiography, we believed that the location of the hemorrhage was a branch of the right bronchial artery, which we embolized using a gelatin sponge. However, we were unable to control the alveolar hemorrhage, which increased and blew out from the tracheal tube, making it very difficult to maintain oxygenation and circulation. The patient died 12 h after the onset of symptoms. No antibiotics were administered during treatment.\nAutopsy was performed with the family’s consent immediately after the patient’s death.\nThe following day, additional laboratory blood exams revealed that negative for the anti-neutrophil cytoplasmic antibody, anti-nuclear antibody, and anti-glomerular basement membrane antibody. Levels of lung surfactant proteins A and D, as well as KL-6, were normal. Later, B. cereus was cultured from the sputum sample suctioned through the tracheal tube.\nImmunohistochemistry of B. cereus and real-time PCR for pXO1-like plasmid from lung tissue were performed to confirm that the bacterium was B. cereus and whether this bacterium produced anthrax-like toxin.\nThe lungs were fixed in 20% formalin for 24 h and embedded in paraffin, followed by pathological examination. B. cereus immunostaining was performed using anti-Bacillus cereus rabbit polyclonal antibody (Abcam, Cambridge, UK).\nNext, we performed DNA extraction and real-time PCR for B. anthracis toxin plasmid. Two pieces of 10 μm-thick Formalin fixed paraffin embedded (FFPE) sections were collected in Eppendorf tubes. DNA was extracted from these sections with the use of Nucleospin DNA FFPE XS kit (Macherey-Nagel, Düren, Germany), according to the manufacturer’s instruction. For detecting infection with B. cereus containing pXO1-like plasmid, lethal factor (LF) gene (Genbank M29081.1) and protective antigen gene (PAg) (Genbank AF268967.1) were amplified by real-time PCR. For amplifying LF, two primer sets were prepared.: LF1, 5′- CAGCTTTATGCACCGGAAGC-3′ (forward) and 5′- CGCTCCAGTGTTGATAGTGC-3′ (reverse), generating a product of 148 bp; and LF2, 5′- TCAGCTTAAGGAACATCCCACA -3′ (forward) and 5′- GCTTCCGGTGCATAAAGCTG-3′ (reverse), generating a product of 144 bp. PAg was amplified using the primers 5′- CAGGCTCGAACTGGAGTGAA -3′ (forward) and 5′- TCACTAGGATTAACCGCCGC -3′ (reverse), generating a product of 118 bp. PCR reactions were carried out in a 25-μL final volume containing 2 μL of sample DNA, 12.5 μl of 2× reaction mixture (QuantiTect SYBR Green PCR Kits; Qiagen, Hilden, Germany) and 0.2 μM primers. The real-time PCR was performed with Rotor Gene Q (Qiagen), with an initial holding step at 95 °C for 15 min, followed by 50 cycles of three-step PCR (94 °C for 15 s, 55 °C for 30 s, and 72 °C for 30 s) with SYBR Green fluorescence monitoring to detect amplification. The melting curve was examined to check for contamination. As a positive control, genomic DNA of Bacillus anthracis (JNBP01251) was provided by the Gifu Type Culture Collection, Graduate School of Medicine, Gifu University.\nHistologic sections of the lung, especially of the right upper lobe, demonstrated necrotizing hemorrhagic pneumonia similar to anthrax, with tremendous proliferation of gram-positive rods. The bacteria were diffusely gram-positive. Additionally, hemorrhagic diffuse alveolar damage within the hyaline membrane that was probably due to acute respiratory distress syndrome was also observed throughout the lungs. The bacteria reacted to the B. cereus antibody, and did not react to Pseudomonas aeruginosa and Escherichia coli antibodies. There was no infiltration of neutrophils. There was also no deposition of immunoglobulins or complements on the alveolar walls by immunofluorescence, excluding a diagnosis of vasculitis. B. cereus was also confirmed from the sputum culture. Therefore, B. cereus necrotizing pneumonia was confirmed pathologically (Fig. ).\nIn the real-time PCR, amplification was obtained in the positive control (B. anthracis DNA), but not in the patient sample or the negative control (no template).
Thirty-one-year-old Middle Eastern male presented at the prosthodontic clinic in a private office in Abha, Saudi Arabia, with a chief complaint“ I need to have a better smile.” The patient had no contributory past medical history except smoking a pack of cigarettes daily. Extraoral examination revealed no abnormality including TMJ, lymph nodes, facial symmetry, and lateral profile. Intraorally, the patient had multiple old discolored composite restorations in the anterior area in both arches with recurrent caries underneath. The patient had wear of the maxillary anterior teeth and had multiple missing teeth with deficient alveolar ridges. He also had a large old restoration on #22 with recurrent caries that caused recession of the gingiva apical to the tooth. Additionally, large old restorations on multiple posterior teeth were noted with periapical radiolucency on tooth #36 related to an old root canal treatment. The patient also had midline diastema and retroclined maxillary anterior teeth with a normal molar relationship. The anterior tooth malposition was expressed by the patient as a concern when he smiles. Periodontal status of anterior teeth was fair with minimal bone loss. However, localized horizontal bone loss was evident in the posterior area, especially in the maxillary right posterior area with maxillary sinus pneumatization ().\nDiagnosis included pseudo-class III malocclusion accompanied by dental wear of maxillary anterior teeth and midline diastema. He also had recurrent caries related to the old defective composite restorations in both maxillary and mandibular anterior teeth. Additionally, the patient had recurrent caries on multiple maxillary and mandibular posterior teeth with periapical radiolucency related to tooth #36. After diagnosis and treatment plan presentation, the patient agreed on extracting tooth #22 as it was deemed unrestorable. As the patient wanted to improve his smile and correct his malocclusion with no orthodontic intervention, replacing his anterior teeth with full-coverage lithium disilicate restorations was planned. The missing teeth #14 and #15 also were going to be replaced with a zirconia fixed dental prosthesis as the patient did not want to go through implant treatment. The patient was not interested in treating the mandibular teeth and wanted to treat his maxillary anterior teeth only as an initial stage.\nMaxillary and mandibular irreversible hydrocolloid impressions were made, and proper interocclusal records were taken. All impressions and records were sent to the lab for diagnostic wax-up and for silicone matrix fabrication for diagnostic mock-up. At the mock visit, esthetics, phonetics, and function were initially evaluated and were confirmed satisfactory (). The patient was then referred to an oral surgeon to have his tooth #22 extracted after initial preparation of anterior maxillary teeth to facilitate the fabrication of the provisional FDP to replace tooth #22 immediately after extraction. An Ovate Pontic was made to facilitate tissue sculpturing of the extraction site on #22 to maintain esthetic outcomes.\nThe patient was seen two weeks postextraction for a follow-up to evaluate the tissue maturation. After removing the maxillary anterior provisionals, the tissue maturation around the extraction site was confirmed satisfactory (). The remaining maxillary teeth from #16-25 were prepared. Then, gingival displacement was performed using the double retraction cord technique proceeded by making the final impression () using light- and medium-body vinyl polysiloxane impression material (3M Imprint; United States). The final restorations were made to adopt the patient's existing occlusal scheme as the anterior edge-to-edge relationship did not require changing the occlusal vertical dimension as confirmed by the provisional restorations. Missing teeth #14 and#15 were replaced by monolithic zirconia FDP, while teeth from #12 to #25 were designed to have lithium disilicate full-coverage restorations, including the FDP replacing #22 ().
A 71 year-old man was admitted due to exertional dyspnea (New York Heart Association functional class III). He had a past medical history of pericardiectomy due to effusive-constrictive pericarditis 29 years ago and mitral valve replacement with tricuspid annuloplasty due to severe mitral and tricuspid regurgitation 11 years ago. His electrocardiogram showed atrial fibrillation with controlled ventricular rhythm. Transthoracic echocardiography showed abnormal shunt flow from the aorta to the right atrium, a tissue defect in the mitral annulus with moderate PVL (distal jet area of 7 cm2), mild tricuspid regurgitation with mild resting pulmonary hypertension (maximal velocity of tricuspid regurgitation jet=3.2 m/s), and an enlarged left ventricle with near normal systolic function (end-diastolic dimension of the left ventricle=67 mm, ejection fraction=51%). Transesophageal echocardiography (TEE) also revealed continuous abnormal shunt flow through a fistula tract from the aorta (noncoronary cusp) to the right atrium (), and about a 4-5 mm sized tissue defect in the mitral annulus with moderate PVL (). On computed tomography, about a 3 mm PVL was observed at the lateral aspect of the mitral annulus (). His calculated logistic EuroSCORE and STS risk score were 16.7% and 7.0%, respectively. After discussion with both the surgical and interventional teams, we decided to perform staged transcatheter closures for both the fistula tract and mitral PVL.\nThe first procedure was conducted under general anesthesia with fluoroscopic and TEE guidance. A 7 French (Fr) sheath was inserted through the right femoral vein and 6 Fr sheaths were placed in both femoral arteries. A 6 Fr pigtail catheter was inserted through the right femoral artery. After a peripheral angiogram with a pigtail catheter, we confirmed the existence of a fistula tract between the aorta and right atrium. The fistula tract could be crossed with a 260 cm long 0.032 inch Terumo wire, and it was confirmed by TEE. A 6 Fr Cournand catheter was advanced into and passed through the defect. Another 6 Fr Cournand catheter was introduced into the right atrium (). Using a Curry intravascular retriever, the guidewire was captured and withdrawn through the right femoral sheath. The guidewire was exchanged for a 0.035 inch stiff wire using a 6 Fr Cournand catheter. The 6 Fr Cournand catheter was replaced with an 8 Fr delivery sheath that was advanced into the ascending aorta. Because the sizes of the tissue defect on TEE were 9 mm in length and 4 mm in width, we selected an 8/6 mm sized Amplatzer duct occluder. After proper device positioning, which was confirmed using fluoroscopy and TEE, the device was deployed ( and ). Immediate TEE showed a well-positioned device, and disappearance of the abnormal shunt flow between the aorta and right atrium ().\nAfter the first procedure, his symptoms improved slightly and a follow-up echocardiography two months after the first procedure showed slightly decreased left ventricular diastolic dimension with reduced ejection fraction (from 51% to 46%) and persistent resting pulmonary hypertension. Percutaneous closure of the PVL was attempted to decrease left ventricular volume overloading. Under general anesthesia, a 7 Fr sheath was inserted through the right femoral vein and a 6 Fr sheath was inserted through the right femoral artery. A TEE was also used for guidance. A pigtail catheter was placed into the posterior cusp of the aortic valve through the right femoral artery. The sheath in the right femoral vein was exchanged for a Mullin sheath and dilator, which was advanced over a 0.032-inch guidewire into the superior vena cava. Thereafter, the guidewire was removed and a Brockenbrough needle was gently advanced to within a few millimeters of the tip of the dilator, and the needle was flushed and connected to a manifold for continuous pressure monitoring. With fluoroscopic guidance (RAO 45 degrees), the interatrial septum was punctured at the site of the fossa ovalis. The Mullin sheath was advanced into the left atrium. The stainless steel wire was crossed over the tissue defect in the mitral annulus. Using a 6 Fr multipurpose catheter, the stainless steel wire was exchanged for a 0.035 inch stiff wire (). After several dilatations with a septal dilator, the 8 Fr delivery sheath was placed in the left ventricle. Because the defect size on the TEE was about 4-5 mm, we also chose an 8/6 mm sized Amplatzer duct occluder. After proper device positioning was confirmed on the TEE, the device was deployed (). The TEE that was performed immediately afterwards showed a well-positioned device and a trivial PVL (). At 24 hours post-procedure, transthoracic echocardiography also showed well-positioned devices and no remnant shunt flow or PVL. Echocardiography immediately after the procedure showed persistent left ventricular dysfunction (ejection fraction=47%) but disappearance of resting pulmonary hypertension.
A 35-year-old Caucasian male presented to an Emergency Room of a Portuguese tertiary care hospital with urinary retention and diminished strength in the lower limbs. He had returned a week before from Angola where he had been working as a construction worker for the past 10 months (Table ). He had been vaccinated for yellow fever, poliomyelitis, typhoid fever and meningococcal disease in advance. Excluding an episode of malaria soon after his arrival to Angola, he was asymptomatic until 6 weeks before returning home to Portugal, when he and other co-workers had an acute onset of fever, vomiting and diarrhoea after sharing a meal. Over the following days, while he was still recovering, he woke up suddenly with pain in the umbilical area where he noticed three red spotted lesions that became enlarged and necrotic. He was told by a medical doctor that he had most likely been bitten by a spider and was treated with local dressings and analgesia, with improvement. One week later he developed fever, non productive cough, progressive dyspnoea and thoracic pain that he described as bilateral, oppressive and “belt-like”. Additionally, generalised myalgia and fatigue gradually installed. He was treated in a local clinic with antibiotics without resolution of symptoms. Unable to work, he returned to Portugal and visited another hospital in the same day for persisting fatigue and thoracic pain. Inflammatory parameters were not elevated and chest roentgenography was normal. He was sent home on analgesics. Six days later he presented to our tertiary care hospital complaining of worsening fatigue, thoracic pain and urinary retention.\nPast medical history was irrelevant. The patient denied unprotected sexual contacts in the past ten months, intravenous drug use, blood transfusions or past surgical procedures. He had performed an ear piercing two months before in Angola.\nOn admission the patient was afebrile. Blood pressure was 124/68 mmHg, his pulse was regular with 80 beats per minute and respirations 14 breaths per minute. Neurological examination revealed diminished motor strength in lower extremities (grade 3/5), reduced tactile and pain sensations below L1, normal deep tendon reflexes and bilateral indifferent plantar responses. No cognitive dysfunction or neck rigidity was noticed. Ophthalmologic and cranial nerves examination was normal. A periumbilical triangular scar was observed, with no inflammatory signs. The remainder of physical examination was unremarkable.\nRoutine laboratory data was normal, including complete blood count (Hb 15.6 g/dL, WBC 9.07 × 109/L with 81% neutrophils, platelets 325 × 109/L), renal and liver function tests. Thick blood smear and rapid diagnostic test for malaria were negative. HIV test (4th generation ELISA) was positive and Inno-Lia™ test was indeterminate (positive gp41 band). Chest roentgenography was normal. Cerebrospinal fluid (CSF) examination revealed 302 leukocytes/μL, glucose 0.56 g/L and protein content 0.74 g/L. Gram stain was negative. Magnetic Resonance Imaging (MRI) of the brain was normal, but MRI of the medulla showed extensive hyperintense signal in the long TR sequence throughout C4 to T11, especially in the posterior columns, suggesting inflammatory/infectious aetiology (Figure ).\nHe was admitted with a diagnosis of acute transverse myelitis and treatment with ceftriaxone (2 g IV bid), ganciclovir (400 mg IV tid) and methylprednisolone (1 g IV qd for 3 days and then tapered to 1 mg/Kg/d) was started.\nOver the two following days his clinical condition deteriorated, with intensifying upper thoracic pain, progressing hypoaesthesia up to T10 and dysaesthesia becoming more disabling and characterised by numbness and ice cold sensation. Constipation and urinary retention were also present.\nA second lumbar puncture performed at day 3 revealed 15 leucocytes/μL, glucose 0.98 g/L and protein content 0.86 g/L. India ink stain was negative.\nDoxycicline (100 mg bid) and human immunoglobulin (30 gr IV qd) were associated at this point. Ganciclovir was discontinued after negative CMV results (Table ).\nSignificant improvement was observed within the next days and one week later the patient was able to walk unassisted, with complete resolution of dysaesthesia, urinary retention and constipation. Three weeks after admission he was discharged home asymptomatic, having completed 21d of ceftriaxone, 7d of methylprednisolone, 7d of doxycicline and 5d of human immunoglobulin.\nHIV testing was repeated before discharge: 4th generation ELISA was positive and Inno-Lia™ remained indeterminate (positive gp41 band). All cultures were negative, as well as several serology and PCR-based technique tests (Table ). Convalescent titters were repeated for Borrelia, Rickettsia conorii, West Nile Virus and Dengue, all negative. HIV-1, subtype K RNA copies were quantified in blood and CSF: 743.000 and 77.700 cp/mL respectively. By the time these results were known the patient was already improving significantly and no antiretroviral therapy was started. His CD4 count was 408/mm3 on admission and 760/mm3 in a second determination before discharge.\nThree months later the patient presented to the outpatient clinic and was asymptomatic. HIV Inno-Lia™ test was then positive (positive p17, p24, p31, gp41 and gp120). He repeated a medullar MRI 8 weeks after discharge: previous findings had resolved completely and no pathological changes were found.\nAfter one year of follow up he continued asymptomatic but with a CD4 count decline to below 400/mm3 his viral load had stabilized around 130.000 cp/mL. He started highly active anti-retroviral therapy (HAART) with abacavir/lamivudine and efavirenz, and 6 months later he had undetectable viral load with increased CD4+ cell count.
This was a 25-year-old male with known spina bifida who presented with a chronic infection of his left acetabulum. He had been previously managed for several years for a non-healing pressure ulcer of the left greater trochanter, having undergone a partial femoral head resection and prior flap placement with subsequent failure. He presented with large volume drainage from a small ulceration over his left trochanter with CT imaging demonstrating an abscess in the gluteus muscle with osteomyelitis in the abutting femoral head. He underwent a left Girdlestone procedure. Intraoperative findings included heterotopic ossification with necrotic bone in the femoral head. Cultures grew MRSA, Proteus mirabilis, and mixed microorganisms. The surgical wound was treated with a Cleanse NPWTi-d utilizing normal saline. Three days later, he underwent partial delayed primary closure over closed suction drains with the placement of a negative pressure dressing over the incision and ongoing wound, as complete primary closure was not possible due to the dimensions of the resulting wound. He was discharged eight days after the initial procedure on ertapenem. He was not readmitted in the first 30 days after discharge.\nAt his one-month follow-up, it was noted that his left-sided osteomyelitis had not recurred nor progressed. At his two-month visit, the wound continued to be clean and closed, with no sign of breakdown. However, at this time, he developed the worsening of a previously existing stage IV right ischial pressure ulcer, which was treated with operative debridement. He has not had a recurrence of his left hip osteomyelitis and his wound is nearly completely healed. Figure below depicts his chronic trochanteric ulcer, the wound after Girdlestone resection, placement of negative pressure wound therapy over the closed incision, and the resultant healing wound.\nPatient 7: right side\nThis was a 29-year-old male with a history of paraplegia who developed several stage IV ischial and sacral pressure ulcers on his right side, resulting in a dislocation of his femoral head on the right and progression of the infection into the acetabulum and iliacus muscle. His ulcer progressed despite appropriate treatment, and he also developed severe protein malnutrition; he was thus treated with a right Girdlestone procedure. Intraoperative findings were significant for necrotic exposed acetabulum and femoral head. Cultures grew MRSA and Staphylococcus epidermidis. The resulting wound bed, including the acetabulum, was dressed with a Cleanse Choice® (KCI, San Antonio, Texas, USA) NPWTi-d utilizing normal saline. Three days later, he underwent a partial delayed primary closure over closed suction drains with the placement of a negative pressure device over the incision. He was discharged 14 days after the initial procedure on doxycycline and trimethoprim-sulfamethoxazole. He was not readmitted in the first 30 days after discharge.\nAt his three-month follow-up visit, his wound was healing well, with no sign of recurrent osteomyelitis on the right side. However, he did have progressive ulceration of his previously existing left greater trochanter ulcer and was found to have invasive osteomyelitis in the left hip. Figure demonstrates the pre-operative ulcer, resection specimen, and resultant healing wound.\nPatient 7: left side\nDue to the success of the right Girdlestone procedure, the patient underwent a left Girdlestone approximately three months later. Like the right side, he had developed a chronic ulcer over the left greater trochanter with subsequent femoral head osteomyelitis. Intraoperative findings were also similar, with a necrotic femoral head and resultant cultures growing no organisms, though previous cultures grew Pseudomonas. The wound was dressed with a Cleanse Choice NPWTi-d (see Figure below). Three days later, he underwent a partial delayed primary closure over closed suction drains with the placement of a negative pressure device over the incision. He was discharged eight days after the initial procedure on doxycycline and trimethoprim-sulfamethoxazole and was not readmitted in the first 30 days after discharge.\nThe patient was readmitted at 60 days with concern for the protrusion of his left distal femur into the ongoing wound bed and was taken to the operating room for excisional debridement and bone biopsy. The biopsy was negative for invasive osteomyelitis. In addition, at month four, he presented with a stage IV ulceration of his sacrum. Adequate offloading, wound care and nutritional support, and intravenous antibiotics were not able to be achieved in the postoperative care of this patient due to numerous factors. He was discharged in this state five days later on trimethoprim-sulfamethoxazole with the intent to heal by secondary intention and has since re-presented with progressive malnutrition and dry gangrene of the toes of his right leg. He has refused ongoing medical care. He has not required ongoing treatment for the infection in either hip and his surgical wounds continued to decrease in size.
A 78-year old male patient with recent contralateral right below-the-knee amputation initially presented in July 2019 with ischaemic rest pain and dry gangrene involving his left heel and his first and second toes. His comorbidities included type II diabetes, hypertension, previous stroke and hypercholesterolaemia. Duplex ultrasound showed a focal stenotic lesion in the distal SFA and heavily calcific occlusive tibial disease. He was classified as Rutherford category 5 with a Society for Vascular Surgery WIfI “wound, ischemia and foot infection” score of 2–3-0, which meant he was at high risk of major amputation within the year. The patient initially underwent balloon angioplasty of the SFA but angiography revealed poor outflow to the foot with no suitable target for distal angioplasty or bypass (Fig. A). The lower limb multidisciplinary team at our institution reviewed the case and agreed to proceed with pDVA as the only possible treatment apart from major amputation.\nThe patient underwent vein assessment prior to the procedure and this included duplex scan imaging of the superficial and deep venous system of the foot. Good calibre lateral plantar and posterior tibial veins are necessary for a successful outcome while the presence of DVT contraindicates the procedure. The arterial inflow was assessed in detail on the previous conventional angiograms and the crossing point was determined to be in the proximal posterior tibial artery. The peroneal artery was avoided as a potential ‘crossing’ artery since it supplied the ischemic foot with useful collaterals. Active foot infection, significant cardiac history were excluded and life-expectancy and functional status were also considered before listing the patient for intervention.\nThe pDVA procedure was performed in August 2019 as the first use of the LimFlow System in the United Kingdom. Under ultrasound guidance, arterial access was performed antegrade in the left CFA and venous access was performed in the lateral plantar vein. Using the LimFlow arterial and venous catheters, an arterial-venous communication was created at the level of the proximal posterior tibial artery into a posterior tibial vein. The target posterior tibial and lateral plantar veins were then treated with the LimFlow antegrade (push) valvulotome to render the valves incompetent which was confirmed with balloon dilatation. Finally, the LimFlow self-expanding PTFE-covered stents were deployed in the posterior tibial vein distally from the ankle level to the crossing location where a conical stentgraft was deployed to secure the fistula and optimise flow transition from the artery into the vein. The completed pDVA circuit successfully established blood-flow to the foot (Fig. B) and post-procedure ultrasound demonstrated a satisfactory volume flow of 250 cc/min in the arterialised lateral plantar vein. The case took just under three hours from the time of initial access until final access site closure.\nThe procedure was technically successful with no perioperative complications. The patient experienced an almost complete resolution of ischaemic rest pain after the procedure and did not experience any adverse events in the first 60 days. He was discharged home at day 18 post-procedure to the care of the community diabetic foot and district nursing teams to oversee his foot wound care. Ten weeks after his index procedure, the patient presented to the emergency department with diabetic foot sepsis most likely due to a combination of superimposed infection of the existing necrotic tissue and ischaemia. He underwent first, second and third toe amputation and foot debridement for sepsis control. During his admission to hospital, the patient also had a duplex ultrasound to monitor flow into the affected area, his third surveillance scan as part of a defined follow up protocol to closely monitor and optimise blood flow as necessary. Consequently, angioplasty was performed at the same sitting as surgical debridement to treat the narrowing of the inflow and outflow tracts of the stent grafts at the level of the origin of the posterior tibial artery as well as in the lateral plantar vein. No signs of in-stent stenosis were observed at the time of inflow and outflow treatment. Further surveillance duplex imaging at 3 months revealed a reduction of flow in the stent due to narrowing in the lateral plantar vein. Although there had been no clinical deterioration, further intervention was performed with the implantation of a Supera stent into the lateral plantar vein distal to the LimFlow stent in order to enhance the flow in the venous arch. This was followed by coil embolisation of collateral veinsin order to focalise blood flow to the distal foot. Stealing branches of the great saphenous vein were embolised in the foot in order to encourage flow in the deep venous system and consequently improve healing. At 4 months, the patient underwent a final maintenance angioplasty where the outflow pedal venous arch was treated with balloon angioplasty to further aid circulation to the area of the toe amputation (Fig. ). The heel ulcer and minor amputation wounds showed continued improvement post-pDVA with tissue granulation after debridement at 2 months and complete epithelialisation by 12 months (Fig. ). Ischaemic rest pain resolved almost completely after the index procedure and the patient did not report any pain by 6 months and onward. Due to bone protrusion from the wound, a completion transmetatarsal amputation was performed at 13 months. Most recent Images of the foot (Fig. ) obtained 18 months post index procedure, showing complete wound healing and preservation of the foot.
We describe the case of a 7-year-old male who presented with a first episode of arterial ischemic stroke. The neurological evaluation revealed a left sided hemiparesis which was not involving the facial musculature. The initial CT scan revealed an area of hypointensity in the region of the right basal ganglia. More specifically, its anatomical contribution was extending to the anterior limb and the genu of the right internal capsule, and in the nearby territory of the globus pallidus. This infarct refers to the anatomical contribution of the medial and lateral lenticulostriate arteries and was attributed possibly due to the migration of an arterial thrombus to their vessel of origin (–).\nThe diagnostic work up for the recognition of the underlying cause of the AIS included the investigation of possible prothrombotic conditions and thrombophilia, but it did not reveal any underlying pathologic condition. The patient underwent a detailed cardiologic work up, which included a transesophageal echocardiographic examination. It revealed the presence of a patent foramen ovale (capillary subtype) and a patent ductus arteriosus (, ).\nBased on these findings, the patient was immediately treated with anticoagulation therapy. Despite that, he developed a second episode of arterial ischemic stroke 9 months later. The neurological evaluation after the second ictus revealed complete left-sided hemiparesis with involvement of the musculature of the ipsilateral half of the face.\nHe underwent a radiological evaluation with a new CT scan, which revealed an extensive area of hypointensity, extending to the mesencephalon-pontine region the dimensions of the basal ganglia infarction were significantly reduced. An additional new infarction territory was recognized, in the area of the right cerebellar hemisphere, lateral to the vermis. The anatomic substrate of the new stroke could be attributed to a second stroke that developed in the region that is nourished from the perforators of the basal artery, near its terminal bifurcation. The infarct with a hemispheric distribution was attributed to a thrombus-related obstruction of hemispheric branches of the vertebrobasilar arterial system (–).\nAfter the second episode of AIS, we decided to occlude the foramen ovale with the use of the Amplatzer PFO Occluder Cribiform No 18, and by the way, of the patent ductus arteriosus with an MReye Flipper PDA Closure Detachable Coil IMWCE-8-PDA-4 Coil 8 mm.\nWe performed retrograde catheterization of the ascending aorta through the right femoral artery, utilizing the percutaneous technique. Through the patent ductus arteriosus, the catheter was inserted to the pulmonary artery. Insertion and detachment of the detachable coil from the arterial route followed (, ). Next step was the catheterization of the right cardiac cavities and of the pulmonary artery via the right femoral vein, using the percutaneous technique. The catheter is inserted into the left atrium and the left superior pulmonary vein, via the PFO. The system responsible for deployment of the Amplatzer PFO Ocluder was inserted via the transvenous route, and the ocluder was detached (, ), (). After the procedure, a gradual discontinuation of anticoagulant therapy was decided, which was followed by replacement with antiplatelet therapy, namely aspirin.\nThe follow-up period extends to approximately one and a half years, during which neither adverse effects from the therapy were noted, nor any new ischemic strokes. The patient’s neurological status remains stable.
A 55-year-old female with no significant past medical history initially presented in 2006 with vague abdominal pain. Her past social history was negative for alcoholism or smoking. Work up of the patient including physical examination and laboratory indices were all normal. A multi-detector CT of the abdomen and pelvis utilizing a pancreatic mass protocol (arterial, portal venous and delayed phases) was performed which revealed a diffusely enlarged pancreas with extensive parenchymal calcifications (). No discrete mass was identified in the pancreas. Minimal pancreatic ductal dilatation was noted on the CT examination. The patient was diagnosed with chronic pancreatitis and followed clinically for several years. In 2015, the patient presented with recurrent abdominal pain. A CT of the abdomen and pelvis with pancreatic mass protocol was repeated (), which revealed new hypoattenuating masses in the pancreatic neck and tail. Some of the smaller tumours were hypervascular on the arterial phase imaging. There was redemonstration of extensive parenchymal calcifications. No pancreatic atrophy was identified. The pancreatic duct remained minimally dilated. Given the new masses many of which were arterially enhancing, the possibility of neuroendocrine tumour was raised. A MRI of the abdomen with pancreatic mass protocol (T2 with fat saturation, MRCP, in and out of phase T1 and unenhanced T1/arterial/portal/ 5 min delayed post-contrast T1) was performed (). The MRI confirmed multiple well-circumscribed masses throughout the pancreas, many of which had increased T2 signal with cystic change. The pancreatic duct was at most mildly prominent, and no lesions were identified outside of the pancreas. The largest pancreatic mass in the tail measured approximately 3.5 cm, with peripheral enhancement and central hypointense signal (). An endoscopic ultrasound was performed, which confirmed a hypoechoic mass in the tail of the pancreas, two isoechoic masses in the head of the pancreas, and diffuse parenchymal calcifications suggestive of chronic pancreatitis. Fine needle aspiration of the pancreatic masses in the head was performed, with cytology returning as concerning for neuroendocrine tumour. Given the suspicion for pancreatic neuroendocrine tumour, an indium-111 Octreotide scan was requested for further characterization. Fused SPECT-CT imaging was also performed for improved uptake localization (). The indium-111 scan revealed diffuse intense uptake of radiotracer throughout the entire pancreas. No extrapancreatic foci of uptake was identified. On the grounds of the clinical and imaging findings, it was decided the best course of action would be to perform a pylorus-preserving pancreaticoduodenectomy with total resection of the pancreas, splenectomy and cholecystectomy. Sectioning of the pancreas revealed numerous well-circumscribed, solid and tumoural masses ranging from minute up to the largest grossly identified lesion measuring 3.5 cm in diameter (). Many of the nodules were coalescing with only a scant amount of intervening normal pancreatic parenchyma present. The cut surfaces of the nodular masses were solid and showed a variegated pink to orange-red colour. No gross areas of necrosis were identified. Numerous representative histologic sections of the nodular masses were examined. The nodules were comprised of numerous insular nests and trabecular cords of fairly uniform epithelioid neoplastic cells with oval nuclei and speckled chromatin. Many of the nodules showed numerous calcifications and localized amyloid deposition (). Immunohistochemical stains were performed and the neoplastic cells marked strongly for the neuroendocrine markers chromogranin A and synaptophysin (). Multiple immunostains for pancreatic peptides were performed. The neoplastic cells were positive for pancreatic polypeptide and negative for insulin, glucagon and somatostatin. Only a rare mitotic figure was identified but the Ki-67 mitotic index marker was calculated at 5% as measured by the Aperio image analysis system. The findings were consistent with numerous neuroendocrine tumours of the pancreas, Grade II, as per the 2010 WHO criteria for neuroendocrine tumours of the pancreas. The neuroendocrine neoplastic nodules were all confined within the pancreatic parenchyma and all pancreatic resection margins were free of neoplasia. All regional lymph nodes sampled were negative for metastatic disease.
A one-year-old Thai boy was referred to Phramongkutklao Hospital due to subacute fever, abdominal distension, mucous diarrhea, and failure to thrive. He was born at term with uneventful pregnancy, and he is the first child of nonconsanguineous parents. There was no history of autoimmune or primary immunodeficiency disorders in the family. Intradermal BCG vaccination was inoculated at the left buttock without any reaction within 3 months of life, and intramuscular vitamin K was routinely given after birth. He was exclusively breastfed. At 3 months of age, he developed frequent vomiting and irritability. Physical examination revealed enlarged and tense anterior fontanelle. CT brain showed hyperdensity lesion size of 1.5 × 1.8 cm at left temporal lobe with perilesional edema () which was confirmed to be intracerebral hemorrhage. All hematologic, coagulation studies and biochemical laboratory tests () were consistent with deficiency of vitamin K dependent clotting factors. The cause of vitamin K deficiency in this patient was presumed to be caused by malabsorption mechanism. Therefore, intravenous vitamin K was given for 3 days at initial presentation, and the coagulogram data was corrected within 24 hours. One week later, the patient developed steatorrhea. Fat malabsorption was suspected as the levels of fat-soluble vitamins were evaluated (). Cystic fibrosis was excluded by the negative sweat chloride test. At 4 months of age, perianal abscess was detected and treated with amoxicillin/clavulanic acid for 7 days without surgical drainage. However, subsequent pus culture was not performed. At the age of 6 months, lymphadenopathy of 3 cm in size at the left groin was detected. Fine needle aspiration was accordingly performed, and pus culture was found to be positive for BCG and the tuberculin skin test was positive at 15 × 20 mm. Chest X-ray revealed no pulmonary infiltration. The patient was diagnosed with BCG lymphadenitis and was treated with isoniazid and rifampicin. Interestingly, there was no history of tuberculosis contact in the family. Nevertheless, the patient did lose to follow-up which resulted in the delay of definite diagnosis in this patient.\nOn physical examination at age of 1 year, his weight was 7.8 kg (<3rd percentile) and height was 69.5 cm (<3rd percentile). Abdominal distension, moderate hepatosplenomegaly, and ascites were detected. Left inguinal lymph node was still palpated with 1.5 cm in size. The site of BCG vaccination showed no induration. Physical examinations were unremarkable. Hematologic and biochemical laboratory tests were described (), and chest radiography showed consolidation at the left upper lobe (). Abdominal CT showed generalized ascites with evidence of hepatosplenomegaly. Abdominal paracentesis was performed, and the results were described (). Ascitic fluid adenosine deaminase (ADA) was performed because of suspicious of mycobacterial infection, and the result was compatibly high. The ascitic fluid PCR was positive for BCG. Disseminated BCG infection was diagnosed in our patient. IgG was slightly elevated (1,236 mg/dL) while IgM and IgA levels were normal (). Lymphocyte subset analyses revealed normal T-cell and B-cell counts. The neutrophil dihydrorhodamine (DHR) test revealed no fluorescence detection after granulocyte stimulation. The stimulation index (SI) was 1.21 which was compatible with XL-CGD ().\nFinally, the patient was diagnosed with XL-CGD accompanied with disseminated BCG infection. This clarified the clinical of fat malabsorption leading to vitamin K deficiency since 3 months of age. Treatment was started with antituberculosis including isoniazid, rifampin, pyrazinamide, ethambutol, and amikacin. Itraconazole and co-trimoxazole were given as the prophylactic treatment. The clinical of ascites and steatorrhea was improved after 2 weeks of treatment. The DHR assay was also performed on the mother and revealed bimodal distribution compatible with the XL-CGD carrier (). Allogeneic hematopoietic stem cell transplantation (HCT) is therefore planned as the curative treatment since the mother is six months pregnant.\nAfter informed consent was obtained from the patient's parents, genomic DNA was extracted from peripheral blood leukocytes using the commercial available kit as per the manufacturer's protocol. Thirteen coding exons and exon-intron boundaries of the CYBB gene were amplified by PCR using specific of primers for each exon as previously described []. The PCR products were purified and directly sequenced in both forward and reverse directions. The reference sequences were NM_00397.3 for CYBB cDNA and NP_000388.2 for gp19-phox protein.
A 58 year-old gentleman presented to the hospital with worsening bloating and a gradual increase in his abdominal girth. He had also noted a loss of weight of more than 10 kg over the last 2 years. The patient otherwise denied any abdominal pain or change in his bowel habit. He was known to have a history of well-controlled diabetes mellitus, hypertension, hyperlipidaemia and atrial fibrillation. There was no previous history of pancreatitis or abdominal surgery. The patient had recently undergone a gastroscopy and colonoscopy the previous year for iron deficiency anaemia. This had shown gastritis as well as the presence of pandiverticular disease and a sub-centimeter colonic polyp. Histology showed the polyp to be a tubular adenoma with low-grade dysplasia (, , , , , ).\nClinical examination showed an adequately nourished gentleman but with a large abdominal mass occupying most of his abdomen. It was possible to feel over the superior edge but the inferior edge extended into the pelvis. The mass was non-tender on palpation. Digital rectal examination was unremarkable.\nIn view of the above findings, the patient underwent a computed tomography (CT) of the abdomen and pelvis. This showed a large 25 × 17 × 22 cm cystic lesion extending from the mid-abdomen to the pelvis. The lesion was thin walled and contained homogenous low density fluid (14 Hounsfield unit). There was no septations, irregularity or abnormal thickening of the cyst wall. The cyst was noted to have a mass effect but not invading the surrounding bowel loops and the urinary bladder. It was found to be separate from the liver and the kidneys. The pancreas was normal in appearance. The CT scan was otherwise unable to identify the origin of the giant cyst.\nAs this was a thin walled cyst with no irregular or solid component, a fine needle aspiration (FNA) was not suitable as there was no specific area to target. Aspiration of the fluid was also unlikely to yield any meaningful finding for diagnosis. Further imaging such as a MRI would also not help in identifying the origin or the diagnosis of the cyst. The possibility of a mesenteric or omental cyst was therefore discussed and surgical excision was offered to the patient. Tumour markers were not performed as it would not have affected the management.\nAn elective exploratory laparotomy was performed via a midline incision. A giant cyst was immediately identified but was found to have multiple adhesions to the peritoneum, omentum, mesentery, urinary bladder as well as the small and large intestines. However, the cyst was not found to be originating from any of the above organs or the vas deferens. The cyst was entirely within the abdominal cavity and did not originate from within the mesentery. A controlled decompression of the cyst was made through a purse-string encircled incision in the anterior wall. This was performed to aid with retraction and visualization of the posterior surface. Thick purulent fluid was aspirated until dry. The cyst was subsequently excised in whole.\nThe patient underwent an uneventful recovery with a brief period of expected post-operative ileus. He was discharged on post-operative day 6. Follow-up visits showed complete resolution of his initial symptoms and a vast improvement in his appetite.\nCulture of the fluid was positive for Streptococcus agalactiae. Fungal culture and tuberculosis polymerase chain reaction (TB PCR) tests were negative. Cytology of the fluid showed mainly neutrophils.\nHistological examination of the cyst showed thick fibrous walls covered with coarse fibrillary strands admixed with fibrin. There were also large numbers of mature IgG plasma cells with aggregates of neutrophils and scattered lymphocytes. No viable epithelial lining was identified. The walls stained positive for AE1/3 suggesting myofibroblasts. They were negative for CD117 and DOG-1 and therefore not suggestive of a gastrointestinal stromal tumour.\nThis was therefore treated as a benign cyst of an undetermined origin.\nThe patient was last seen in clinic two months after his surgery with a significant improvement in his appetite and oral intake. He was thereafter discharged from follow-up as the likelihood of recurrence was low considering that the cyst had been excised entirely with no remnant wall left behind.
A 20 year old Sri Lankan male who was employed as a helper in a grocery, admitted to our unit with weakness of both hands of 1 month’s duration. He was treated for serologically confirmed (Dengue NS1 antigen positive) dengue fever approximately 5 weeks ago at the local hospital and had made an uneventful recovery. He has been given 5 days of inward treatment and the records from the local hospital revealed that he had simple dengue fever with no evidence of fluid leakage.\nFive days after discharge from the hospital he has first noticed the weakness of his right hand when he dropped a glass of water due to poor grip. Weakness was more in the right hand which was his dominant hand and it was slowly progressive over 1 month. At the time of presentation to us he could not write or button on his shirt due the weakness of the hands. Weakness of the left hand was milder than that of the right. The weakness was confined to hands and did not involve forearms or arms. He denied any accompanying numbness, parasthesia or pain.\nOn inquiry he admitted that there was slight weakness of both feet which did not significantly interfere with walking. There was no associated neck/back pain or bladder/bowel incontinence. He did not complain of difficulty in breathing, diplopia, dysphagia, nasal regurgitation, dysarthria or fatigability. He did not give a recent history of trauma to the spine/neck or any preceding diarrheal illness or skin rash.\nHe had no previously diagnosed long term medical ailments and has not undergone any surgical procedures in the past. He was not on any long term medications and he denied smoking, use of alcohol or illicit drugs. He did not give a family history of any progressive neurological conditions.\nOn general examination he had an average built with no pallor, lymphadenopathy or any signs of malnutrition. No skin rashes or hypopigmented patches were noted. There was minimal small muscle wasting of bilateral hands and feet. No muscle fasciculations were noted. Distal upper limb (hand) power was diminished asymmetrically, right hand demonstrating a power of 3 out of 5 and left hand demonstrating a power of 4 out of 5. All fine finger movements including flexion, extension, abduction and adduction were affected with some degree of weakness in wrist extension as well. Bilateral supinator and biceps reflexes were diminished.\nDistal lower limb (feet) power was also diminished but was less pronounced (power grade 4) when compared to the degree of hand weakness. Bilateral foot dorsiflexion was weak. Ankle jerks were elicited with reinforcement whereas the knee jerks were elicited without reinforcement. There was no objective sensory impairment of touch, pain, temperature, vibration and joint position sensations in both upper and lower limbs. Bilateral plantar responses were down going. No palpable nerve thickening identified. No cerebellar signs were demonstrated and his gait showed a minor degree of high stepping due to weak dorsiflexion. Examination of higher functions and cranial nerves including the fundal examination revealed no abnormality.\nExamination of the cardiovascular, respiratory systems and the abdomen was essentially normal.\nFull blood count revealed white blood cell count: 8.5 × 109/L, platelet count: 274 × 109/L, hemoglobin 12 g/dl with normal red cell indices. Blood picture showed normochromic normocytic cells with some reactive lymphocytes suggestive of a recent viral infection. Serum creatinine 80 μmol/l (60 - 110 μmol/l), serum sodium 138 mmol/l (135 - 145 mmol/l), serum potassium 3.8 mmol/l (3.5 - 5 mmol/l), serum magnesium 0.9 mmol/l (0.8–1.1 mmol/l), serum ionized calcium 1.2 mmol/l (1.05–1.30 mmol/l). Liver profile: AST 21u/l (10 - 40u/l), ALT 13u/l (7–56 u/l), ALP 67u/l (100–360 u/l), serum total bilirubin 0.7 mg/dl (0.1–1.2 mg/dl), serum albumin 36 g/l (35 - 50 g/l), serum globulin 32 g/l (20 - 35 g/l). CPK levels were normal. Inflammatory markers: ESR 25 mm/hour and CRP < 6 mg/dl.\nNerve conduction study revealed findings in keeping with multifocal motor neuropathy with conduction blocks involving the distal upper and lower limb peripheral nerves without any conduction abnormalities in the sensory nerves (Fig. ).\nCSF analysis did not show any increase in proteins or cells and the values were within the normal limits. Anti-GM1 IgM antibody test was not carried out due to the high cost of the test and the patient’s unstable financial background. A sural nerve biopsy (a sensory nerve) was carried out and revealed histologically unremarkable nerve fibres and blood vessels with no evidence of inflammation, atrophy or granulomata formation. Recent dengue infection was confirmed with positive dengue IgM and IgG antibodies with enzyme-linked immunosorbent assay (ELISA).\nAs the patient fulfilled criteria, the diagnosis of multifocal motor neuropathy with conduction blocks was confirmed. He was then referred to the neurologist and was started on intravenous immunoglobulin (IVIg) therapy (2 g/kg/day) which was given for 5 days. He showed a mild improvement of his neurological weakness with the treatment and outpatient physiotherapy was arranged. The next immunoglobulin dose was planned to be given after 2 weeks.
A 64-year-old White female with history of stage I squamous cell carcinoma of the right middle lung, renal transplant secondary to membranous glomerulonephritis, history of previous VTE, hypertension, chronic obstructive pulmonary disease, and stage four chronic kidney disease presented to the emergency department (ED) for treatment of deep venous thrombosis (DVT). The patient had been sent by her pulmonologist after obtaining outpatient, lower-extremity venous Doppler ultrasounds earlier that day. The patient had been recently hospitalized for an episode of pneumonia and discharged two weeks prior during which her warfarin had been discontinued for unclear reasons; her history of stage I (T1a, N0) squamous cell cancer of the lung had been only minimally addressed during this admission. The patient had not had a positron emission tomography to assess her tumor staging in nearly 10 months. Additionally, her most recent oncology notes from six months prior following two treatments of stereotactic ablative radiotherapy demonstrated a stable computed tomography (CT) of the thorax and recommended surveillance CT in six months. However, a CT of the abdomen obtained three weeks prior to her ED visit to assess for urinary pathology showed a nonspecific 1.9-centimeter (cm) hypodensity of the liver, potentially concerning for metastatic disease.\nOn the day of her ED evaluation, she endorsed right lower leg swelling without redness and right leg pain causing difficulty with ambulation. She denied weakness or sensory loss, bladder or bowel dysfunction, headache, fever, chest pain, dyspnea, and all other review of systems. The patient’s presenting vital signs were grossly normal as she was afebrile (36.2° Celsius) with a heart rate of 81 beats per minute, respiratory rate of 16 breaths per minute, blood pressure of 136/82 millimeters of mercury (mm Hg), and an oxygen saturation of 97% on room air. The patient’s physical examination was remarkable for mild tenderness in the posterior aspect of the right upper, middle, and lower leg, with intact distal neurovascular status. There was no overlying erythema or edema. The rest of her physical examination was grossly normal, including a neurologic examination without any deficits.\nThe patient’s laboratory workup was remarkable for a creatinine of 2.07 milligrams per deciliter (mg/dL) (normal range 0.57–1.00 mg/dL) and estimated glomerular filtration rate of 25 (normal >58), elevated leukocyte count of 13.2 thousand (K)/microliter (μL) (normal range 3.4–10.8 K/ μL), platelet count of 96 K/μL (normal range 150–379), prothrombin time of 13 seconds (normal range 9.1–12.0), international normalized ratio (INR) of 1.26 (normal range 0.80–1.20), and partial thromboplastin time of 27.6 seconds (normal range 24.4–31.4). Her lower-extremity venous Doppler studies, reviewed upon arrival in the ED, demonstrated acute deep venous occlusive disease of the bilateral peroneal veins and the right common femoral vein in addition to acute superficial occlusion of the right greater saphenous vein.\nGiven the patient’s prior history of VTE, previous renal transplant, and current findings of bilateral DVT, both the vascular surgery and transplant services were consulted; both recommended initiation of intravenous heparin infusion for full anticoagulation treatment. Heparin bolus and drip were initiated. The hospitalist was consulted to admit the patient, agreed with the plan for therapeutic heparin infusion, and noted the patient would now require lifelong anticoagulation given that this was her second episode of VTE. The hematology/oncology service was consulted, but did not evaluate the patient the day of admission. The patient had a non-contrast CT of the thorax performed shortly after initiation of heparin to evaluate for persistent pneumonia. This study demonstrated an enlarging hepatic lesion consistent with metastatic disease that had increased in diameter from 1.9 cm to 2.4 cm over the prior three weeks.\nSix hours after admission, the patient developed a headache. Two hours later she subsequently developed lethargy and confusion, which progressed over minutes to obtundation. The patient was tachypneic, possessed anisocoria, and was hypertensive to a systolic blood pressure of 200 mm Hg. The hospitalist discontinued the heparin drip, called for a code intubation, ordered protamine, and transferred the patient to the intensive care unit. A non-contrast CT head was performed to evaluate for suspected intracranial hemorrhage (ICH). Her CT demonstrated a large right parietal/temporal/occipital hemorrhage and a right subdural hematoma accompanied by 1.8 cm right-to-left midline shift, uncal herniation, and contralateral brainstem compression ( and ). The radiologist did not address potential metastatic etiology of her bleed.\nThe neurosurgery service was consulted and a craniotomy was offered to the patient’s family but was declined after being counseled on the patient’s likely “poor prognosis” even after intervention. Instead, the patient’s family opted to pursue comfort measures. The patient was terminally extubated later that day and shortly thereafter died.
A 46-year-old male with no prior medical history presented to UC Irvine with a several month history of episodes of right and left hemiparesis, progressive bulbar weakness, paresthesia, dysarthria, and headache. He also reported a 30-pound unintentional weight loss. He was admitted to the neurology service and underwent an extensive evaluation for autoimmune, demyelinating, vascular, and neoplastic processes. MRI brain demonstrated several small discrete foci of restricted diffusion in the white matter, enhancement in large portions of the bilateral corticospinal tracts, and significant pontine involvement (). Lumbar puncture demonstrated CSF pleocytosis and elevated protein. Histology of the right frontal brain lesion was consistent with diffuse large B-cell lymphoma (DLBCL), and a bone marrow biopsy demonstrated normocellular marrow. The patient was diagnosed with primary diffuse CNS lymphoma (PCNSL) and started on high dose steroid therapy.\nEarly in the hospital course the patient was found to be in acute respiratory distress presenting with tachycardia, tachypnea, and increased work of breathing. He was emergently intubated and transferred to the neuro ICU. CT angiogram of the chest was negative for pulmonary embolism but demonstrated interval left lower lobe consolidation. The patient was placed on multiple conventional ventilator modes with a set tidal volume of 400 ml and pressure support of 5 cm H2O. Despite these standard settings, large tidal volumes were observed ranging from 700 to 1,400 ml. Initial arterial blood gas (ABG) was significant for a pH of 7.61 and PaCO2 of 13.1 mmHg. Due to the significant hypocarbia, a number of ventilator tubing segments were added to increase the mechanical dead space and increase the rebreathing of exhaled CO2. In addition, whole brain radiation and treatment with rituximab were initiated. Before these interventions, the patient's neurological exam was poor. He did not follow commands or open eyes to noxious stimuli. However, the patient had intact brainstem reflexes and trace extremity movement to noxious stimuli.\nCO2 was monitored with ABG and immediate response to the increase in dead space was measured with VBG. Before intervention, VBG showed pH 7.57 and PvCO2 18.4 mmHg which immediately showed signs of improvement after 1 day. Two days after the increase in dead space a follow-up ABG showed pH 7.45 and PaCO2 30.5 mmHg. Over the coming days the patient required ventilator and dead space adjustments as he was weaned off of fentanyl and midazolam to dexmedetomidine and oxycodone.\nThe patient required a tracheostomy due to prolonged ventilator time, but 2 weeks after the initiation of dead space therapy the patient was weaned from the ventilator with T-piece uncapped. He was off sedation and had been weaned off of opioids. The patient was transferred to the step-down unit with ABG showing pH 7.51 and PaCO2 28.5 mmHg without tachypnea. In those 2 weeks the patient's neurological exam had improved significantly, and he was awake, alert, and attending to the examiner. He followed motor commands in all extremities (distal strength better than proximal strength) and also followed commands to close eyes and stick out tongue. On discharge 1 week later (3 weeks after the increase in dead space) he was smiling and interactive with family.
An 8 days old male neonate was born to an Asian mother through vaginal delivery at 37 weeks of gestation, weighed 2,380 g, and had APGAR scores of 9 and 10 at 1 and 5 min, respectively. He was admitted to our hospital with a 2 days history of fever of up to 39°C but did not have respiratory or gastrointestinal symptoms. The infant's family denied any medical history and TB contact. His physical examination at admission documented smooth respiration, clear breathing sound, and no hepatosplenomegaly. The complete blood count indicated a total white blood cell count of 17,500/μL with 69% neutrophils, 20% lymphocytes, 9% monocytes, and 2% eosinophils. The C-reactive protein level was 7.3 mg/dL. The findings of the cerebrospinal fluid (CSF) analysis were normal. Bacterial cultures of the blood, urine, and CSF were negative. Intravenous antibiotics, namely cefotaxime and ampicillin, were administered after admission on the basis of suspicion of neonatal fever. Despite the administration of the antimicrobial combination therapy, the fever persisted and the neonate developed abdominal distension when he was 12 days old. Abdominal radiography exhibited nonspecific dilated bowel loops. Because no improvement in the condition of the patient was observed after changing antibiotics, infection caused by some virus and other atypical pathogen, including Mycobacterium tuberculosis, was considered. Tests for herpes simplex virus, Epstein–Barr virus, cytomegalovirus, hepatitis B virus, rubella, Chlamydia trachomatis, and Toxoplasma gondii were all negative. The repeat C-reactive protein level was elevated to 14.4 mg/dL. Coagulopathy with 323.7 μg/mL of abnormal fibrin degradation product and more than 20 mg/L of D-dimer were also noted. Antibiotics were switched to vancomycin and ceftazidime empirically. Chest radiography displayed only increased right lung field infiltration when the infant was 12 days old (), and chest computed tomography (CT) imaging exhibited a large amount of right pleural effusion with mild inflammatory changes in the right lower lobe when the infant was 15 days old (). Pleural effusion drainage was suggested but refused by his parents at that time. Gastric lavages for acid-fast staining and culture were examined when the infant was 20 days old after his parents agreed to further testing, and one of the three acid-fast stains of gastric lavages yielded few acid-fast bacilli. Repeat chest and abdomen CT imaging performed when the infant was 24 days old indicated patchy consolidation in the right upper lung, multiple new nodules in both the lungs, moderate pleural effusion, and multiple low-density nodules in the spleen and hepatic hilar region without hepatomegaly (). Subsequently, pigtail catheter insertion for pleural effusion drainage was performed. The findings of pleural fluid analysis indicated a total white blood cell count of 10,800/μL with 6% neutrophils, 57% lymphocytes, and 37% mesothelial cells; a total protein level of 4.6 g/dL, a lactic dehydrogenase level of 250 IU/L, and a glucose level of 164 mg/dL. TB infection was strongly suspected. The neonate was administered isoniazid (15 mg/kg/day), rifampicin (15 mg/kg/day), and pyrazinamide (20 mg/kg/day) when he was 24 days old. After initiating anti-TB treatment, the neonate's symptoms and signs subsided gradually. Finally, both gastric lavage and pleural effusion cultures showed M. tuberculosis complex.\nThe neonate's mother was 33 years old, gravida 1, para 1. Her Group B streptococcus test was negative. She had been healthy with no previous medical history and TB contact history; however, she developed a mild dry cough 1 week after delivery, experienced persistent general weakness, and was admitted to our medical intensive care unit because of altered mental status 24 days postpartum. Laboratory examinations indicated leukocytosis, thrombocytopenia, coagulopathy, acute hepatic failure, and acute renal failure. The HIV serology test was negative. A chest X-ray exhibited a miliary TB pattern (). A chest CT image displayed diffuse interlobular and intralobular septal thickening with ground-glass opacities (). Because her neonate was highly suspected to have TB infection at that time, acid-fast staining and TB polymerase chain reaction (PCR) of the sputum were performed. Both tests were strongly positive. The mother was administered anti-TB therapy immediately, but she died 3 days after hospitalization. M. tuberculosis infection was confirmed through sputum culture.
A 62-year-old right-handed man presented to our clinic for advanced treatment options for WC. He had no previous injuries of the limb, no family history of dystonia or tremor. However, he did report repetitive use of the right hand with handwriting and shooting firearms. Initial symptoms occurred in his early 30’s and were characterized by hand cramping and abnormal penmanship when writing. The symptoms were intrusive and unremitting, and over the past nine years significantly interfered with his ability to handwrite with his dominant hand. These symptoms progressed over the past 5 years impairing his ability to perform any action that involved gripping objects. Consequently, he rarely used his right hand for daily activities. He had previously been prescribed tetrabenazine, baclofen, and had undergone botulinum toxin injections without significant benefit or unwanted adverse effects therefore medication was discontinued.\nOn examination, there was no abnormal posturing or tremor of the left upper limb, lower limbs, neck, face, and voice. At rest there was no abnormal posturing of the right hand. With the right hand held in pronation and full extension, the 2nd and 3rd digit flexed at the metacarpophalangeal joints. This abnormal posturing was also exhibited with the arms held in wing beating position (arms abducted with elbows at level of the shoulders and arms flexed with hand pronated and positioned just under the nose). In addition, in the wing beating position, there was slight flexion of the right wrist. No abnormal posturing was demonstrated in supination. These signs were most obvious with writing, but there was no abnormal posturing evident with the patient holding a writing instrument. However, immediately upon placing the writing instrument onto the paper and initiating writing, a greater extent of flexion of the metacarpophalangeal joints and wrist was evident. With continued writing, the thumb also extended and writing was characterized as having a jerky quality and was illegible. (). No mirrored movements of the contralateral limb were evident.\nThe consensus treatment plan from the patient care conference was to pursue DBS with surgical targeting of the VoA/VoP complex based upon literature review. Although there is limited data on thalamic stimulation, immediate tremor suppression intraoperatively has been reported. For these reasons, we initially planned on placing a Boston Scientific (Valencia, California) 2201 electrode with 8 vertically and evenly spaced contacts into the thalamus. The intention was that the contacts would span the VoA/VoP. The surgical approach has been previously described []. Two microelectrodes (AlphaOmega NeuroProbe) were simultaneously descended to target at 12.46 mm (X), 1.23 mm (Y), and 8.45 mm (Z) (tract 2) and 2 mm anterior from this tract (tract 1).\nThe first trajectory had minimal microelectrode recording (MER) consistent with thalamic cells. However, intraoperative electrophysiology was most consistent with STN recordings beginning at 2.3 mm above the intended target. Consistent with the motor territory of the STN, kinesthetic responses were evident from 1.6 mm above to –2.3 mm below radiographic derived target. Using the MER electrode that has a collar 3 mm from the tip of the electrode and can be used for stimulation, we tested macrostimulation of the STN at 1.5 mm above the intended target. STN macrostimulation provided an improvement in dystonic posturing and in writing tested by performing Archimedes’ spirals at 0.5 mA. The patient reported paresthesia in the right arm at 1mA that became intolerable and spread into his face as the stimulation intensity increased.\nThe second trajectory performed simultaneously with the first trajectory, which spanned the targeted brain areas showed kinesthetic responses, specifically active range of motion, during motor testing at 9.4mm, 5.3 mm, 2.3 mm, above intended target. This location was most consistent with the VoP. Macrosimulation at 3 mm and 5.5 mm above target provided less benefit as tested in posturing and in writing as well as greater stimulation adverse effects compared with track one macrostimulation . Given the beneficial effects of STN stimulation, the DBS electrode Boston Scientific 2202 with horizontal directional contacts of the second and third level was implanted with the tip at –3.5 mm below the intended target. Despite the clinical benefits, the patient experienced low threshold for stimulation induced adverse effects at 0.5 mA that was not overcome with various parameter adjustments and use of directional contacts. Consequently, the DBS electrode was removed and a third tract using MER was implanted.\nThe third track was implanted at 1.7 mm posterior and 1.7 mm medial of tract 2. Thalamic activity was recorded from 10 mm to 0.8 mm above radiographic target. Kinesthetic responses of passive range of motion of the upper limb were obtained from 4.7 mm to 0.8 mm above radiographic target (). No clear kinesthetic active range of motion of the upper limb was obtained in this tract consistent with VIM. Given the uncertainty of VoP compared with VIM stimulation, macrostimulation was applied at 7 mm, 4 mm and 2.3 mm above radiographic derived target. Greatest benefit was obtained at 4 mm compared with all macrostimulation tests of all tracts at 1.5 mA (). Furthermore, no stimulation adverse effects were obtained. Given that less benefit was obtained with more dorsal macrostimulation, the Boston Scientific 2202–45 electrode was implanted with the tip positioned at 0 mm of the intended target. Intraoperative testing of the DBS electrode demonstrated superior clinical benefit with only transient paresthesia up to 2 mA ().\nOne week post lead implantation, a Boston Scientific IPG battery (Vercise; Valencia, California) was placed in the left pectoral area and cervical extension wires were connected. Programming was initiated one month post lead implantation. and was initially programmed every one to two weeks for the first three programming sessions at University of Colorado Hospital. After the preliminary three programming appointments, his care was transferred to the Veterans Affairs (VA) Hospital where he is seen every four months. To assess efficacy, motor scales were collected in the form of Archimedes spirals, Writer’s Cramp Rating Scale (WCRS), and handwriting samples such as writing his name and the word “sunny” which caused him to continuously write without taking the pen off the paper to elicit dystonic posturing with sustained activity []. Although not validated, we did perform the WCRS that has been used in previous studies and provides an assessment of severity with higher scores indicative of worse performance []. There was a noticeable improvement in the WCRS motor scores from baseline, 18 score, at intraoperative programming, 5 score, and at four weeks post-operative, 4 score. Traditional monopolar review was performed at each level by increasing amplitude in increments of 0.5 mA with other parameters held constant at 60 µs and of 130 Hz. Upon demonstrating greatest benefit with ring mode stimulation of contacts 5–6–7–, monopolar review was then conducted of these individual contacts, which demonstrated monopolar stimulation of 6(–) as well as 8(–) provided marked benefit (). At 10 months postop, the patient is no longer taking medication for dystonia and his programming settings are: case (+), 8(–), 1 mA, 20 µs, 80 Hz. In a prior programming session, the patient was discharged to test monopolar stimulation of 6– and 8– with separate patient programs. The patient determined that 8– provided slightly greater benefit in tremor control compared with 6–. Testing was performed initially at 60 µs and 130 Hz. Subsequently, a range of frequencies (60 to 225 Hz) were tested. Based upon these findings, 80 Hz provided greatest benefit without inducing adverse effects. Thereafter, further benefit was obtained by increasing the amplitude but at the cost of worsening ataxia and paresthesia. Therefore, pulse width was reduced and the patient was discharged with and gradually increased stimulation to 2mA with his patient programmer.
A 3-year-old British African girl of nonconsanguineous parents presented to her local hospital with 4 weeks history of a firm, nontender, enlarging swelling arising over the sternum. A few weeks later, there was an additional swelling noted in her left side of her chest (Fig. ). This was preceded by 2 months history of manifesting constitutional symptoms of weight loss, lethargy and night sweats. There was no history of fever, cough, breathing difficulties, rash or any local trauma noted. She had been otherwise well prior to this, with no previous medical history or hospital admission. She was on Movicol sachets for constipation management and no other medications. She was born in Kenya and moved to the UK at the age of 1 year. Her immunisations were commenced in Kenya and completed on arrival to the UK as per the national UK schedule. She had received the BCG immunisation, though the scar was not easily visible; her mother confirmed that she had the immunisation. There were no significant associated sick contacts or TB contacts of note. The child’s mother had suffered from extrapulmonary TB approximately 18 years ago and required treatment. She had unfortunately developed side effects from the treatment, probably drug-induced hepatitis as suggested by the jaundice, which led to her treatment being interrupted, though she subsequently completed treatment. She has been well since then and asymptomatic.\nOn initial examination, the child appeared well nourished and comfortable on room air. She had no signs of respiratory related problems. There was 2 × 3 cm firm, nontender and nonmobile mass over the middle part of her sternum. She also had a second 1 × 1 cm firm, nontender and mobile mass on the left side of her chest. The rest of her physical examination was normal.\nThe initial blood tests at the local hospital demonstrated microcytic hypochromic anemia with elevated erythrocyte sedimentation rate (ESR) of 120 mm and C-reactive protein (CRP) of 89. On her initial presentation, she had a chest X-ray, which revealed increased opacifications in the right mid-zone and left upper zone that were thought to be infective in origin (Fig. ). The patient’s TB Quantiferon Gold test was positive. Her case was discussed further with the paediatric infectious disease team at the tertiary centre. The child had an extensive panel of investigations including repeat baseline bloods and TB Quantiferon test. Blood EBV PCR was performed, which was positive and presumed to be reactivation. CMV PCR and human immunodeficiency virus (HIV)-1/2 antibody analysis were also performed, which were both negative.\nShe underwent an ultrasound-guided biopsy of both lumps. The biopsy result identified necrotic material, pus and areas of granulomatous inflammation including multinucleate giant cells. She had a CT scan at her local hospital that showed a presternal mass with rim enhancement suggestive of an abscess (Fig. ).\nZiehl–Neelsen staining was negative, though mycobacterial PCR was positive for Mycobacterium tuberculosis (MTB) target. Early secreted antigenic target of 6 kDa (ESAT-6) of MTB was positive, which suggested a mycobacterial and non-BCG infection.\nThis was followed by further imaging to exclude extrapulmonary involvement including MRI head and spine, which showed no features of TB. She had an ultrasound of the abdomen and pelvis, which showed hypoechoic rounded lymph nodes throughout the abdomen. Further immunophenotyping of PB revealed no detectable aberrant expression or maturation asynchrony on B cell, T cell, or natural killer (NK) cell.\nShe was commenced on quadruple antitubercular treatment: isoniazid, rifampicin, ethambutol hydrochloride and Zinamide. During her time at the tertiary centre, her inflammatory markers (CRP) peaked at 220 mg/L and she developed fever and required piperacillin/tazobactam, which was later switched to oral co-amoxiclav. She remained clinically well and was subsequently discharged to continue on antituberculosis therapy with further follow-ups scheduled. She is scheduled to have a repeat CT chest in 3–4 months. She has been clinically well and showing good signs of improvement, with the sternal swelling significantly decreasing in size. The treatment has been completed at 6 months with both swellings completely resolved (Figs. and ).
A 28-year-old African black male was referred to a hospital in Tanzania for an intraoral radiography. His major complaint was an acute, diffuse-patterned oral pain in the left mandibular area. The patient had no significant previous medical history. A clinical examination confirmed satisfactory dental hygiene without any apparently relevant findings. The patient explained that his mandibular left third molar had been extracted six month previously and that the surgery had been quite laborious and lengthy. Although the healing process had been satisfactory, considerable pain had recently begun in this area. The dental X-ray showed an image consistent with a piece of metal embedded in a subgingival distal caries at the mandibular left second molar (37), which was probably related to a previous tooth impaction process of the mandibular left third molar (38). Two periapical lesions detected at the mandibular left second molar roots might have justified his acute tooth ache due to acute exacerbation (Figure ).\nInitially, the differential diagnosis of this radiographic finding was that of a possibly loosened or released piece of amalgam. Nevertheless, the patient had never previously undergone any dental fillings. After repeating the X-ray twice in order to rule out a possible image artefact, it was concluded that during the third molar extraction a curved blade elevator tip had fractured and impacted into the subgingival caries cavity. As the patient had only been referred for a dental X-ray he was given a written note explaining the finding. His dentist was informed about the need to perform an occlusal access cavity in order to initiate a root canal treatment and remove the foreign body from the second molar (37).\nThe breakage of some instruments, such as endodontic files and dental burs, due to a number of factors including defective manufacturing, stress, fatigue, rust, and poor handling is not unknown in dentistry []. Few papers, however, in the literature have dealt with the breakage of instruments used for exodontias. Yasuhara et al., registered various medical accidents caused by defective surgical instruments over two years. In the maxillofacial speciality the authors reported 7 incidences out of 548 operations []. According to Kluess et al., it is important that any incident with orthopaedic surgical instruments should be reported to the manufacturer and the health authorities for sufficient processing and risk assessment of the accident []. In the case of some reusable metal instruments both titanium alloys and stainless steel are in the high performance range. The latter is the most widely used material for instruments and, according to surgical requirements, its alloys vary: the most frequent being martensitic and austenitic stainless steels. Biomedical cutting instruments are often made of martensitic stainless steel due to its pronounced durability coupled with acceptable corrosion resistance. Surgical instruments that may be subject to high pressure forces, such as a dental elevator, are composed of austenitic stainless steel as it is less brittle []. A safe and effective elevator should have extreme values for torque, and high stress values [].\nSurgical instruments manufactures should carry out strict quality controls and have their instruments bear a visible mark as a sign of guarantee. Various authors have suggested that the inferior quality of some surgical instruments may be a reflection of poor working conditions and low standards, particularly in the developing world. Responsibility lies with the suppliers from developed countries manufacturing in the developing world who behave in an unethical manner, maximising profits and minimising the remuneration of the people who actually produce the goods [-].\nThe location and retrieval of broken fragments during a tooth extraction procedure should not be a serious problem, in most cases the fragment is immediately identified. Any instrument breakage implies the obligation to search for the fractured fragment and remove it in order to avoid possible infection and prevent complications due to swallowing or aspiration of the fragment []. Some of the metallic pieces of the surgical instrument could end up in a fibrous issue capsule and gain access to the adjacent spaces []. The case we report here is unusual in that the elevator tip was embedded in a subgingival caries and remained there asymptomatically for approximately six months.\nAt present there are a number of radiological explorations to identify metallic foreign objects. Cone beam computerized tomography (CBCT) is an excellent tool to locate metallic foreign objects []. However, a single periapical radiograph or using more than one radiograph to apply a tube-shift technique, may be sufficient. Whenever possible, simpler techniques should be first applied. In addition, occlusal radiography can also be employed as necessary. If an occlusal film is not available a periapical radiograph can be put on the surface of the tooth, or on the edentulous crest, and this may reveal an embedded foreign object. If with using these techniques, the foreign object is not detected, then other more sophisticated techniques such as CBCT should be applied. In our case, only conventional intraoral periapical radiographic imaging was available, due to limited hospital facilities, to inform the referral doctor about our findings.\nThe care of medical and surgical instruments has a decisive effect on their efficiency and durability. Damage due to breakage and scratches is usually caused by their being incorrectly stored and secured during sterilization, or being carelessly positioned in the treatment area thus favouring falls. Additionally, metal instruments used in clinical practice may be subjected to fatigue due to the effects of sterilization processes. Manufacturers recommend that all instruments made of metal should be checked regularly before packaging in order to diminish the risk of possible incidences [].\nThe concept of honest and correct communication between physician and patient is a crucial issue. It is linked to the disclosure of adverse events and errors, a complex topic covering medical, psychological, legal, and ethical aspects [-]. Current socio-cultural trends, which condition the medical profession in a variety of ways, and a greater focus on the dignity and rights of the patient, have led to a growing tendency to fully inform patients with regard to their illness, progress, and therapy. Nevertheless, it is still common for doctors to choose to remain silent or manipulate the truth in some way, especially when the prognosis or accident is serious or negative and the patient seems to be having real difficulties accepting it []. As clinicians, this reported case should be helpful by reminding us of the importance of our ethical code with respect to the patients, especially when an adverse eventuality appears during a surgical procedure.
A four-year-old Japanese girl with no remarkable medical history was referred to our orthopedic clinic for treatment of 2 cm of LLD. She had a two-year history of progressive LM in a wide range of the posteromedial aspect of the right thigh and the medial aspect of the right lower leg. At the first presentation, skin lesions exhibited hyperpigmentation, induration, and xerosis. The range of motion of the right knee was full extension to 80° of flexion. Radiographs of the right lower extremity revealed dysplastic/atrophic femur and tibia. LLD increased with time and reached nearly 10 cm at seven years of age (). As she and her parents refused to undergo epiphysiodesis of the unaffected side of the lower extremity, we performed simultaneous lengthening of the right femur and tibia using a unilateral external fixator (EBI/Zimmer Biomet Carbon Rail Deformity System; Warsaw, Indiana, USA). She had taken low-dose prednisolone every day or every second day prior to the first lengthening procedure. The dosage regimen had been dependent on the disease activity based on clinical and thermographic assessment. Tibial osteotomy was performed with the Gigli saw, whereas femoral osteotomy was done with a multiple drilling technique. No postoperative immobilization was used, and full-weight bearing was encouraged from the second postoperative day. After 14 days of the waiting period, distraction of the femur and tibia was commenced at a rate of 1 mm and 0.5 mm per day, respectively. Femur was lengthened at the same rate throughout the distraction period, whereas the distraction speed of the tibia was gradually decreased after the lengthening callus showed thin and sparse on radiographs. Distraction of the tibia was occasionally interrupted until the callus width and continuity were reestablished. As a result, the lengthening period/amount of lengthening of the femur and tibia were 90 days/83 mm and 163 days/37 mm, respectively, and an overall leg length was 7 mm longer in the affected limb at the end of the lengthening period (). During the neutralizing period, an accordion technique and daily low-intensity pulsed ultrasound (LIPUS) exposure were applied to the tibia to stimulate callus maturation. She received LIPUS treatment using a sonic accelerated fracture healing system (SAFHS; Teijin Pharma Ltd., Tokyo, Japan) once a day for 20 minutes without interruption. After 84 days and 194 days of the neutralizing period in the femur and tibia, respectively, the device was loosened to allow dynamization of the lengthened callus so that it could fully mature. The dynamization period reached 49 days in the femur and 58 days in the tibia to obtain matured callus exhibiting fusiform/cylindrical shape and similar density to that of the adjacent cortical bone on radiographs. Before pin removal, we dislodged the fixator frame with the fixation pins leaving in situ for a while to monitor the development of regenerate bone fracture or bending. The monitoring period was 47 days for the tibia and only one day for the femur, because the femoral pins had already been loosened. A healing index (HI) was 29 days/cm and 129 days/cm in the femur and tibia, respectively. Regenerate fracture of the femur, however, occurred due to minor trauma three days after the pin removal (). Since parental consent for open reduction and internal fixation was not obtained, she was treated conservatively with skin traction, resulting in malunion associated with a marked anterolateral bowing.\nAfter the first lengthening procedure, LLD gradually increased again and reached 11 cm at eleven years of age (), when the flexion angle of the right knee decreased to 30 degrees. The second simultaneous lengthening of the femur and tibia was performed through percutaneous osteotomy using a multiple drilling technique. In the femur, acute correction of the bowing was done at the osteotomy site with the use of a fixator. The angulation was corrected up to 25 degrees using a proximal rotational clamp, followed by mechanical realignment of the bone axis using a distal translational clamp. After correction of the angular deformity, the osteotomy site was compressed (). Distraction by 1 mm and 0.5 mm per day was initiated at 14 days postoperatively in the femur and tibia, respectively. During the lengthening period, the rate of distraction was adjusted appropriately in order not to deteriorate the continuity of the callus on radiographs. Since the callus was poorly consolidated in the femur (), a modified “chipping and lengthening technique” was performed to enhance bone regeneration at nine months postoperatively () []. Briefly, both ends of the osteotomy site and the callus were drilled with a 3.0 mm Kirschner wire in advance and then broken into smaller pieces with an osteotome. Subsequently, the comminuted bones were compressed until a radiolucent area was no longer recognized. Hard callus that obliterated the medullary cavity at the ends of the osteotomy site was removed with a sharp spoon. Two weeks after the chipping surgery, the distraction was resumed at a rate of 0.5 mm per day. The lengthening period/amount of the femur and tibia were 435 days/55 mm and 209 days/29 mm, respectively, and an overall leg length was 31 mm shorter in the affected limb at the end of the lengthening period. Symptomatic pin tract infection occasionally occurred during the treatment period and was resolved with oral antibiotics without any sequelae. The HI of the femur and tibia was 182 days/cm and 222 days/cm, respectively. Currently, two or three years have passed since the final removal of the femoral or tibial pins, respectively, and 38 mm of LLD is left with acceptable lower limb alignment (). The range of motion of the right knee is 20° of flexion and 0° of extension, but she can walk independently without a brace or a crutch. She and her parents are satisfied with the outcome despite the long treatment period.
We report a case of a 37-year-old professional male athlete presenting with a seven-month history of worsening respiratory function. He was diagnosed with asthma and managed in the community. He was referred for further investigation following worsening of his symptoms and the onset of stridor. Flexible nasendoscopy revealed intact vocal cord function with a mass lesion visible in the trachea. Rigid bronchoscopy reported an intraluminal tracheal mass immediately inferior to the cricoid extending five centimeters caudally resulting in eighty percent tracheal obstruction (). The carina and upper oesophagus were noted to be grossly free of disease. A biopsy of the mass diagnosed tracheal adenoid cystic carcinoma of cribriform and tubular variant.\nMRI scan and PET-CT demonstrated a low to intermediate FDG uptake of 5.9. Key findings from imaging included submucosal extension within the tracheal lumen, invasion of thyroid gland, and no direct invasion of the cricoid cartilage. There was no evidence of cervical nodal enhancement or distant dissemination. The patient's case was discussed at our multidisciplinary team meeting with input from cardiothoracic surgery, medical oncology, radiation oncology, and the head and neck team. Tracheal resection with primary cricotracheal anastomosis, total thyroidectomy, and preservation of the larynx was the proposed surgical intervention.\nT-shaped neck incision at the level of cricoid cartilage was made with a partial sternotomy to afford greater access (). Vessel loops were applied to the innominate artery and vein. Mobilization of the thyroid lobes was then performed with identification and preservation of the recurrent laryngeal nerves bilaterally. A small pocket of disease was identified bilaterally at the cricothyroid joints surrounding both recurrent laryngeal nerves. Inspection was then made of the distal aspect of the dissection where submucosal extension of disease in the trachea was also identified tracking caudad towards the carina. A curative resection was clearly not a possibility. A 5 cm resection of the trachea was performed to achieve gross intratracheal disease clearance. Following the tracheal resection a cricotracheal anastomosis was performed, using 3-0 polydioxanone sutures preserving the recurrent nerves at the cricothyroid junction. The tension on the cricotracheal anastomosis was reduced by suprahyoidal muscle release and its strength augmented using Tisseal on the anastomotic line. Postoperative care included suturing of the patients chin to his chest with 0-nylon sutures, ensuring the patient's head was kept flexed and thus reducing tension on the new anastomosis. An alternative to this method is with the use of a custom made neck brace. The patient was sedated and intubated in intensive care unit for 7 days prior to extubation in operating theatre. Mild surgical emphysema was noted but resolved by day 3 after operation. The patient was also treated with broad-spectrum antibiotics, a tapering dose of corticosteroids and continuous humidified oxygen and saline nebulisers.\nChin to chest sutures were removed at day 14 after operation and patient was discharged home. Three weeks post-op the patient maintained normal voice quality, normal deglutition and showed significant improvement in exercise tolerance.\nHistopathological analysis of the operative specimen confirmed adenoid cystic carcinoma with a predominately cribriform pattern (). The disease involved multiple tracheal rings with extensive perineural and lymphovascular invasion. The tumor invaded the thyroid gland and both the superior and inferior margins were positive for tumor involvement.\nFollowing discussion at our MDT meeting a decision was made to give adjuvant radiation and concurrent platinum based chemotherapy given the potential locoregional advantage its inclusion may afford []. A total radiation dose of 60 Gy and a cisplatin dose of 30 mg/m2 were administered under the care of the medical and radiation oncology team. No severe or serious adverse events were reported.\nA follow-up PET scan performed 3 months after adjuvant radiation and chemotherapy showed no FDG uptake both locoregionally and distally. The patient has also returned to playing football at professional level maintaining an excellent level of pulmonary function, phonation, and deglutition.
A 4-month-old male was born at 32-week gestation as a result of premature rupture of membranes with a birth weight of 1782 g and APGAR scores of 3 and 8 at 1 and 5 min postdelivery, respectively. His newborn screen was reported as normal. His past medical history was significant for an omphalocele repaired at 2 days of life. Between 14 and 15 weeks of life, he had a pyloric stenosis treated with a pyloromyotomy, gastroesophageal reflux treated with a Nissen fundoplication and gastrostomy tube, and a bilateral herniorrhaphy. Other complications included influenza-A pneumonia during the first month of life requiring 17 days of mechanical ventilation, chronic lung disease, and a grade I intraventricular hemorrhage noted at 6 weeks of age on head ultrasound, which had resolved at 4 months of age. An echocardiogram revealed a resolved patent ductus arteriosus with a clinically insignificant patent foramen ovale and a normal renal sonogram.\nAt 16 weeks of age, weight 4.57 kg, having been admitted to the hospital since birth, he was switched from total parenteral nutrition to enteral feeds consisting of Neocate and breast milk. At that time, his serum sodium was 136 mEq/L. Serum chemistries were done 4 days later, which revealed a serum sodium level of 124 mEq/L and plasma osmolality of 260 mOsm/kg confirmed on two repeated measurements (Table ). There was no apparent explanation for the hyponatremia, since there was no apparent volume depletion, vomiting, diarrhea, or gastrostomy tube loss. He was stable from a respiratory standpoint and was not requiring oxygen. His only medications were famotidine, lansoprazole, and methadone for fentanyl withdrawal. He was not receiving diuretics or intravenous fluids. He was neurologically asymptomatic without lethargy, irritability, vomiting, or feeding intolerance. His total feeds in the previous 24 h were 110 mL/kg and his weight had increased by 400 g since the previous sodium level 4 days earlier.\nAn evaluation of hyponatremia included serum and urine biochemistries including liver function tests, thyroid function tests, a cortisol level, serum and urine osmolality levels, and a uric acid level (Table ). Spot urine electrolytes revealed a low urine sodium level of 23 mEq/L and a low fractional excretion of sodium (FENa) of 0.2%; this combination of findings was suggestive of a prerenal state. He had severe hypouricemia with a uric acid level of 0.9 mg/dL and an elevated fractional excretion of urate (FEUrate) of 45%. This combination of findings was suggestive of a Syndrome of Inappropriate Antidiuretic Hormone secretion (SIADH)-like state. Thyroid function tests revealed severe hypothyroidism (TSH 315.4 IU/mL) (normal range 1.7–9.1 IU/mL), which was confirmed on repeat measurement with a free T4 of 0.52 ng/dL (normal range 0.8–1.8 ng/dL) and a TSH of 540 IU/mL, with a normal cortisol. The hyponatremia was initially corrected with a 24-h infusion of 0.9% sodium chloride at a rate of 4 mL/kg/h and thyroid supplementation, to a sodium level of 138 mEq/L. The hypothyroidism was treated with 37.5 mcg daily of levothyroxine on Day 1 and 2, which was increased to 50 mcg daily on day 3. The intravenous fluids were discontinued on day 1 and the sodium level decreased to 133 mEq/L on day 2. The serum sodium then normalized without further intravenous fluids and without oral sodium supplementation. On day 4, repeat urine and serum chemistries revealed a serum sodium of 136 mEq/L, a spot urine sodium of 63 mEq/L with FENa of 0.7% and resolving hypouricemia with an FEUrate that decreased to 22% and eventually to 18% on day 73 (Table ). Due to mild hyperkalemia an ACTH stimulation test was done which was normal.\nFamily history was remarkable for hypothyroidism in the maternal grandmother and a paternal aunt. To further evaluate the cause of hypothyroidism, a thyroid ultrasound and thyroid scan were done, which were both normal. The scan demonstrated homogeneous uptake at the expected location of the thyroid gland on both sides of the neck with no heterotopic uptake seen. Thyroid autoantibodies and genetic testing were not performed. His levothyroxine requirements decreased overtime and at 2-year follow-up, he was on 25 mcg daily. His development at 2 years of age is almost normal with the exception of an oral aversion requiring gastrostomy tube feedings and mild speech delay.
A 73-year-old male patient presented to the surgical ward with a general malaise and right-sided abdominal pain that had presented for 2 days. His past medical history included left nephrectomy due to nephrolithiasis at the age of 48, CKD of unknown etiology, and right hemicolectomy with adjuvant chemotherapy due to colonic adenocarcinoma 5 years prior to the current hospitalization. The physical examination at the admission to our hospital revealed no signs of peritonitis. Goldflam sign was absent. The abdominal ultrasound revealed no pathology. A noncontrast abdominal CT scan was performed, and a suspicion of either inflammatory infiltration or surgical scarring in the right middle abdomen was indicated by the radiologists. Laboratory results showed signs of AKI, with plasma creatinine 390.6 μmol/L on day 1 rising quickly to 647.6 μmol/L on the second day of hospitalization, metabolic acidosis, hyponatremia (sodium 133.7 mmol/L on day 2), and hyperkalemia (potassium 5.49 mmol/L on day 1 and 5.77 mmol/L on day 2). CRP started to increase on day 2, reaching 52.4 mg/L on the following day. The empirical antibiotic therapy consisting of ciprofloxacin and metronidazole was administered after both blood and urine samples were taken for bacteria culture test.\nShortly after being admitted to our ward, the patient developed anuria, despite intravenous infusions of fluids and loop diuretics initiated at the hospital emergency department and continued at our ward. The kidney function impairment reflected by the raising plasma creatinine levels in subsequent days was worsening rapidly. Considering deteriorating patient's general condition and the laboratory findings, an acute daily hemodialysis treatment was started, and a decision to transfer the patient to the nephrology ward in our hospital was made.\nIn the nephrology ward, the pharmacotherapy was maintained with no significant modifications, and the patient's condition temporarily improved. Over the course of 3 days, serum creatinine decreased from 827.5 μmol/L to 403.5 μmol, and diuresis increased to up to 4 L per day. Serum electrolytes were within the normal range. Hemodialysis was deemed no longer necessary.\nAfter 7 days of hospitalization, the patient complained of a sudden exacerbation of the abdominal pain. The pain was located in the right middle abdomen and radiated to the right iliac fossa and was accompanied by a positive Goldflam sign. At the same time, urine output started to decrease rapidly, and macroscopic hematuria had been observed before the patient became anuric for the second time. Serum creatinine increased quickly to 801.6 μmol/L. The changes of serum creatinine and urine output are presented in Figure . Both abdominal ultrasonography and plain abdominal X-ray showed no abnormalities aside from a slight pelvicalyceal system dilation. A second contrast-enhanced CT scan was performed, this time with urography phase, revealing the extravasation of the contrast medium in the proximity of the right renal pelvis (Fig. ) and alongside the right ureter (Fig. ), suggesting the rupture of the renal pelvis.\nThe patient had 1 acute hemodialysis session performed and then was transported to the urology ward. A cystoscopy was performed, during which a double-J ureteral stent was placed into the right ureter. After the procedure symptoms subsided, diuresis reached 5 L per day and plasma creatinine decreased to 296.2 μmol/L. The patient was discharged in a good general condition, with frequent checkups at a local nephrology clinic recommended.
A 39-year-old man was involved in a high-velocity motor vehicle accident. He sustained an open fracture of the right elbow, with significant loss of the external humeral condyle and partial loss of the olecranon. This fracture was classified as a Gustillo type IIIA injury. There was no neurovascular compromise. The patient was treated in a community center, close to the accident, where he received surgical care (debridement and partial excision of the olecranon). The wound was fully closed. The upper arm was then immobilized in a splint (). IV antibiotics (cefazolin-gentamicin) were started for 5 days.\nThe day following his elbow surgery, the patient fell in a staircase and sustained a C7-C8 and C8-T1 fracture-dislocation. This injury caused neurologic damage (quadriparesis), and his right arm became his only functional limb. Following this injury, the patient was moved to our tertiary center to get spinal fusion. During the spinal surgery, the elbow was tested under fluoroscopy. The patient's elbow showed varus instability and a positive pivot shift test. A CT scan of the elbow was obtained the following day and showed bony loss from the external humeral condyle and subluxation of the radial head ().\nWe decided to treat the patient's elbow surgically. The surgery underwent nine days after the initial trauma (after transfer from the community center, spine procedure and elbow imaging). A posterior approach to the elbow was used along with an extensive elbow debridement. A tricortical iliac crest graft was then collected from the patient's right side to replace the humeral condyle bone loss. A tendinous graft was collected from his third and fourth extensor digitorum longus tendons to reconstruct the lateral collateral ligament. The tendinous graft was fixed to the bone graft through two tunnels (anterior to posterior and lateral to medial). The iliac crest graft was then fixed to the humerus with a cancellous screw. A five-hole one-third tubular plate was used as buttress. The graft was left prominent on the lateral side to improve lateral stability of the elbow. The lateral collateral ligament was then reconstructed by fixing the tendinous graft to the proximal ulna with two bundles. We took care to preserve our reconstructed lateral collateral ligament's isometry during flexion and extension movements. Reduction and stability of the elbow joint were verified under fluoroscopy. The wound was closed with staples, and a posterior splint was applied for three weeks. 14 days postoperative X-rays are presented on . At three weeks following the surgery, passive and active ranges of motion were initiated.\nWhile wearing the splint, the patient developed a pressure wound on the lateral side of his elbow (at the site of the reconstruction). This wound later complicated into a Nocardia septic arthritis, which required surgical debridement. Four months after the reconstruction, range of motion was 30-120 degrees with full pronation and supination, without any evidence of instability.\nTwo months later, instrumentation was removed and a rotational flap was done to increase soft tissue coverage of the articulation. Five months after that procedure, the patient developed a Nocardia osteomyelitis of the humerus and was treated with 6 weeks of IV antibiotics (penicillin) and a surgical debridement. The patient responded well to our treatment. Eleven months after the initial intervention, range of motion of the joint ranged from 30 to 120 degrees of flexion, without clinical instability. Osteosynthesis was achieved according to X-rays of the elbow ().
A 22-year-old man was referred to our hospital with complaints of left eye redness and swelling for more than a month. He had no history of nausea or vomiting, but he also complained of mild blurred vision, double vision and occasional headache for more than a week.\nOn further questioning, the patient revealed a history of a trauma. He was involved in a motor vehicle accident and received a head injury that involved basilar skull fractures and resulted in a subarachnoid haemorrhage and epidural haematoma. The patient received conservative treatment and was discharged from a local hospital following the alleviation of symptoms. However, the patient developed symptoms in the left eye 4 months after the injury. These symptoms included blurred vision, swelling, and hyperaemia of the left eye.\nHe denied a history of diabetes and hypertension. There was no history of pneumonia, tuberculosis, or any other infectious diseases. There was also no history of fever, sickness or any surgery. There was no loss of appetite or loss of weight. He was a non-smoker with no allergies to any medications.\nOn examination, the visual acuity and intraocular pressure in the right eye of the patient were 6/5 and 17 mmHg, respectively, and the corresponding values for the left eye were 4/5 and 25 mmHg. On physical examination, there was no eyelid swelling, exophthalmos, ptosis or visual decrease of the right eye, and this eye was almost normal except for slight hyperaemia (Fig. ). Extraocular muscle movement showed no limitation in the right eye (Fig. ). However, the left eye exhibited eyelid swelling, mild ptosis, exophthalmos, chemosis, and corkscrew hyperaemia centred on the cornea (Figs. and ). Furthermore, there were some limitations of eye movement, and abduction and elevation of the left eye was − 1, yet movement on adduction and depression were normal (Fig. ). The left anterior chamber was slightly shallow and quiet, but the right anterior chamber was normal. The cornea was clear with intact corneal sensation in both eyes, and there was no relative afferent pupillary defect and no anisocoria noted. The vitreous and lens were clear. Fundus examinations did not show disc swelling, obvious vascular dilatation or tortuosity, cotton wool spots or haemorrhages of either eye. The resident doctor previously doubted the presence of glaucoma, and he was admitted to our hospital. Optical coherence tomography (OCT) and field of vision tests did not reveal any abnormalities. By contrast, the MRI of the periorbital region revealed a broadening of the left superior ophthalmic vein, slight thickening of the left lateral rectus muscle, and an expansion of the left cavernous sinus, yet the right superior ophthalmic vein, extraocular muscles and cavernous sinus were almost normal (Fig. ). These results aroused suspicion of the left CCF, so the patient was transferred to the neurosurgery department. The neurological examination was normal with the exception of a periorbital bruit on the left side. Thus, a tentative diagnosis of a left CCF was made. Surprisingly, cerebral angiography revealed a crevasse in the inner side of the intracavernous segment of the right internal carotid artery, the right cerebrovascular (CVA) filling delay, and arterial blood traversing the intercavernous sinus to reach the contralateral cavern, which resulted in the dilatation of the left ophthalmic vein (Fig. ). Therefore, the patient was ultimately diagnosed with right CCF. Embolization surgery was suggested, but no additional treatment for the eyes was mentioned since most studies show that symptoms in the eyes could be completely relieved after aetiological treatment.\nDetachable balloon catheter embolization surgery was performed after several days. The surgery was successful, and the patient recovered well. All symptoms, including the redness and swelling of the left eye, the blurred vision, and the double vision, were resolved. On physical examination prior to the patient’s discharge, the visual acuity was improved to 5/5, and the intraocular pressure was 18 mmHg in the left eye, which was within the normal range. Additionally, the exophthalmos, chemosis and hyperaemia of the left eye were significantly relieved (Fig. ).
A 26-year-old man came to the Oral and Maxillofacial Surgery Department of Taipei Medical University Hospital (Taipei, Taiwan) in May 2011 due to swelling and pain in the jaw. The intraoral examination revealed a raised mass in the left mandibular buccal vestibular area extending to the labial area without secretory discharge. The color and appearance of the surrounding mucosa were normal. The teeth in this area also have no obvious periodontal pockets (). On extraoral examination, the patient's lateral view shows a protruding mandible, and the left and right sides of the face were also slightly asymmetrical. The neurological examination was normal, and there were no swollen and palpable lymph nodes in the neck (). A radiographic examination showed a wide range of radiolucent lesions in the mandible from the canine area on the right to the second molar on the left. The biopsy and pathology reports confirmed that the lesion was consistent with ameloblastoma (). The pathology report is presented as follows. Grossly, they are gray and brown and elastic with some bone chips. Microscopically, it shows an ameloblastoma with islands of odontogenic epithelium in plexiform and follicular patterns within a fibrous stroma. The odontogenic epithelium shows peripheral palisading and stellate reticulum. Neither cytological atypia nor increased mitoses is seen.\nMarsupialization was performed to reduce the size and destructiveness of the tumor for subsequent resection surgery. The marsupialization was firstly performed in the anterior and left posterior region of the mandible. Soft liner was applied immediately as the obturator materials, and regular visits were arranged to monitor the changes of tumor size and to adjust the obturator (). After 4 months, the tumor size was gradually reduced on the left posterior region, but remained unchanged over the anterior region. Thus, the marsupialization was performed again over the anterior region. It took a total of 12 months to reduce the size of the lesion and confirm the scope of the tumor (). After that, the segmental mandibulectomy combined with fibula free flap reconstruction was conducted. At that time, three-dimensional (3D) image processing and printing were used to analyze and guide dental implant design and construction. The more precise the reconstruction operation can be, the more the damage can be reduced. Additionally, the entire postoperative period will benefit from precision reconstruction.\nTherefore, computed tomography (CT) examination was taken to evaluate the precise extension and region of the tumor. And then, the 3D printing transferred from CT files/images was applied to create a solid model, and the actual scope of the resection could be simulated before surgery (). A fibula 3D model was also exported for model surgery, surgical template making, and titanium bone plate bending. During the surgery, the defect was first fixed with a prebent metal bone plate, and then, the fibula part of the removed free flap was divided into three sections according to the surgical template and bent to meet the needs of the defect. Soft tissue defects in the mouth were also reconstructed with free flaps (Figures and ). With the 3D printed models, the surgery can be completed more accurately, and the treatment time can be significantly reduced.\nDuring the healing period, the patient could only use the remaining teeth, 46 and 47, and the opposite tooth. After 9 months, alveoloplasty was performed to correct the uneven and sharp bony edges. The patient was referred to a prosthodontist 3 years after the first visit. At this point, the soft and hard tissues had healed completely and were ready for reconstruction ().\nAfter a prosthetic evaluation, the problems and preliminary treatment directions were revealed. The patient's treatment program was developed to address the following issues. Full mandible implants were necessary and feasible to meet the physical and psychological needs of the patient. Considering that teeth 46 and 47 were the only two teeth that could be used for chewing, a staged dental implant approach was adopted. The transverse discrepancy in the upper and lower jaws and a deficiency in the right maxilla resulting in asymmetric facial features required resolution but could not be repaired by dentures alone. The cross-bite on the right side required resolution, and the space was limited for restoration on the right side.\nA staged approach was conducted. First, four implants in tooth 33, 32, 43, and 44 position were placed in the mandible. After the osseointegration, implant-supported provisional crowns 3332xxx4344 were installed in position. Then, two implants in teeth 34 and 36 were placed on the left mandible and were fitted with 34 × 36 provisional crowns. Finally, teeth 46 and 47 were extracted (). The purpose of the patient's orthodontic treatment was to gain restoration space on the right side and correct the upper jaw deficiency. In the beginning, tooth 17 was extracted and followed by leveling and alignment to create space (). After rapid palatal expander (RPE) placement (), the right maxillary posterior segmental osteotomy (PSO) (), right mandibular alveoloplasty, and extraction of tooth 48 were performed in the same operation to achieve proper interocclusal relationship and gain enough restoration space over right posterior region. Next, the patient was asked to regularly rotate the screw of the conventional Hyrax expander. One rotation per day produces a 0.2 mm lateral expansion, which lasts up to two weeks but varies from individual to individual. After the desired position was achieved, there was no need to continue turning the screw. However, it was still necessary to continue wearing the device for at least three months to stabilize the expansion. PSO and RPE provided the required lateral expansion effect to transform the upper arch into a better shape. Alveoloplasty also increased restoration space (Figures and ). The implant surgery was completed with the implantation of teeth 14, 46, and 47. The provisional teeth were installed after osseointegration. The lower jaw was divided into three groups of cement-retained bridges, and tooth 14 was a screw-retained crown. The prosthesis was made with zirconia-based material. The pontic type was designed to be consistent with the original provisional crowns and appropriate for the patient's extensive mandibular reconstruction. This design did not allow any contact between the pontic bottom and the gums so that the patient could clean the teeth as efficiently as before, and the large-scale bottom hollow was not prone to food impaction. After postoperative treatment was completed, the upper and lower jaws presented smooth and symmetrical dental arches, dental function was restored, and the patient's face showed improved symmetry ().
A healthy 35-year-old woman, gravida 3 para 1, was referred to our unit at 21 weeks and 5 days' gestation because of CMS. The course of the pregnancy had been uneventful until 16 weeks with no history of amniocentesis or abdominal trauma. The patient had two previous pregnancies. The first pregnancy had been uneventful, resulting in a caesarean delivery at term. The second pregnancy was terminated by dilatation and curettage because of a missed abortion at 8 weeks'\ngestation.\nAn ultrasound examination revealed a single living fetus with an estimated weight of 419 g. However, the amniotic membrane appeared to be in a completely separated state from the chorion except the site where the umbilical cord was inserted into the placenta. The amount of amniotic fluid was decreased overall in the amniotic cavity, while the echogenicity of the amniotic fluid was increased. In contrast, the fluid between the separated amnion and chorion had low echogenicity (). We tried to perform a targeted ultrasound examination for fetal anomaly; however, it was difficult to scan the fetal structure in detail due to oligohydramnios.\nAfter obtaining the patient's consent, we removed 20 mL of amniotic fluid for chromosome analysis and cytology and then slowly infused 230 mL of warm saline and 40 mg of Indigocarmine (United Pharm, Seoul, Korea) into the amniotic cavity with a 22-gauge spinal needle. After infusion, we could confirm the fetus had no evidence of fetal anomaly, including in its urinary system. About ten minutes later, the amniotic fluid in the amniotic cavity started to decrease to the previous size. In contrast, the space between the chorion and the amnion had enlarged. After removal of 200 mL of amniotic fluid from the space, we completed the procedure. There was no evidence of leakage of amniotic fluid into the vagina. Based on this outcome, our diagnosis was CMS with amniotic membrane rupture. Chromosome analysis revealed 46XX and cytology showed there was no no white blood cell in the amniotic fluid and its glucose level was 24 mg/dL.\nAt 26 weeks and 6 days' gestation, she complained of regular uterine contractions. We used betamethasone for fetal lung maturation and magnesium sulfate as tocolytics. At 27 weeks and 4 days' gestation, fetal electric cardiac monitor showed minimal variability of heart rate and recurrent variable deceleration. An emergency caesarean section was performed. The newborn was female and weighed 930 g without gross anomaly. Apgar scores at 1 and 5 minutes were 4 and 6. She was intubated and transferred to the neonatal intensive care unit.\nAfter the delivery of the baby and placenta, a localized mushy surface measuring 1.5 cm in diameter was found on the fundus of the uterus. There was no evidence of placenta accrete. We put one hand through the uterine incision and guessed at the thickness of the squashy uterine wall with the other hand over the uterine surface. There was the defect of the uterine muscle and the thickness of the remnant wall was less than 5 mm (). We could infer that the defect was one of the convincing reasons for the CMS, and that the uterine muscle defect had been caused by the previous dilatation and curettage before this pregnancy. There was complete CMS on the placenta and amniotic membrane was only attached where the umbilical cord was inserted on the placental disc (); pathology revealed acute chorioaminonitis, deciduitis, and acute funisitis. After delivery, maternal body temperature decreased to a normal range. The patient was discharged without any complications. Although the baby was diagnosed with respiratory distress syndrome and treated in the neonatal intensive care unit, she was discharged without complications 14 weeks after birth. The baby's current age is 15 months, and she has grown well without any morbidity.
The patient in this case is a 70-year-old female diagnosed with multiple brain metastases from primary small-cell carcinoma of the lung. She reported a significant smoking history (100 packs per year) with COPD and later developed a small-cell carcinoma of the upper lobe of the left lung. Following her diagnosis, she underwent a left upper lobe lobectomy and tolerated the surgery well. Spread to the mediastinal and hilar nodes was not observed at that time. However, tumor evidence was seen in the soft tissues surrounding the bronchial resection margin, and a single involved lymph node was noted in the pathology report of the lobectomy resection. Imaging studies performed at that time did not show evidence of the disease elsewhere in the body.\nAlthough SCLC is known to be a radiosensitive tumor histology, the patient was not felt to be a candidate for radiation therapy due to her limited pulmonary reserve. The patient was prescribed chemotherapy with Carboplatin and VP-16. The chemotherapy was given in 4 cycles within a period of three months, and the patient responded well to the treatment. A CT scan of the chest performed three months after the resection showed no evidence of tumor recurrence. The patient had no complaints at that time except for some mild shortness of breath.\nApproximately five months later, the patient presented with complaints of headaches and blurred vision. She also reported nausea without vomiting. An MRI scan revealed multiple brain metastases (three lesions). The largest of them was in the left cerebellar hemisphere (1.4 cm3). Other masses were noted in the left frontal lobe (0.56 cm3) and right putamen (0.49 cm3). The patient was then prescribed Decadron and her neurological symptoms significantly improved.\nAfter discussing the available treatment options with a radiation oncologist, WBRT was prescribed to the patient for a period of three weeks. The total radiation dose prescribed was 37.5 Gy in 15 fractions. An MRI performed one month later revealed continued postcontrast enhancement of the masses when compared to the previous MRI. The option of being treated with GKRS was then presented, and risks and benefits were discussed with the patient. The patient consented to GKRS and underwent the treatment without reporting any complications. The Gamma Knife dose prescribed for each lesion was 16 Gy to the 50% isodose line.\nAn MRI performed two months following GKRS revealed that the left cerebellar lesion and left frontal lesion decreased in size and the right putamen lesion exhibited stable changes. No new lesions were observed at that time. Follow-up MRIs were performed at two-to-three month intervals for a period of 24 months and were stable without any new foci. During this period, the patient presented with episodes of transient ischemic attacks. An MRI performed three months following the initial attacks showed the presence of two new lesions in the right caudate region (0.21 cm3) and right centrum region (0.054 cm3). The patient consented to repeat GKRS and underwent the procedure without reporting any complications. The previously irradiated left cerebellar lesion (1.3 cm3) and left frontal lesion (0.49 cm3) were also treated. The Gamma Knife dose prescribed was again 16 Gy to the 50% isodose line for each lesion. The second Gamma Knife procedure was performed approximately 27 months following the first procedure.\nAgain, the patient was followed both clinically and with serial MRI scans at two-to-three month intervals and was found to have radiographic documentation of a new brain metastasis directly medial to the previously irradiated left cerebellar lesion (0.13 cm3). The other lesions were reported to have stable changes. The patient was fully informed about the risks and benefits of being treated with a third Gamma Knife procedure. The patient consented to the treatment and was prescribed a dose of 16 Gy to the 55% isodose line. The third Gamma Knife procedure was performed approximately 16 months following the second procedure. The patient tolerated the treatment well and did not report any complications.\nFollow-up appointments with both a medical oncologist and radiation oncologist revealed a stable primary cancer and minor muscle weakness from steroid use. A serial MRI performed approximately three months following the third Gamma Knife procedure revealed a new brain metastasis within the right insular cortex (0.061 cm3). The other treated lesions were reported to have stable changes. The patient consented to a fourth Gamma Knife procedure and was prescribed a dose of 16 Gy to the 50% isodose line. The fourth Gamma Knife procedure was performed approximately three months following the third procedure.\nFurther follow-up appointments and serial MRI scans revealed stability in both her primary cancer and her neurological cancer. No new brain lesions have been reported. The patient was diagnosed with brain metastases 60 months ago and is still alive and experiencing a good quality of life despite some minor chronic neurological symptoms. She continues to be monitored closely.
An 11-year-old African-American male presented to our care in January 2011 because of excessive daytime sleepiness and episodes of losing muscle tone upon experiencing strong emotional stimuli. Before seen by us, the patient was evaluated by a psychiatrist in March 2010 at a request of his mother. Clinician records suggest that the patient was being seen for not being able to express himself, labile mood, lack of focus and concentration at school, anxiety, and lack of self-esteem. At the end of the evaluation by the psychiatrist, the patient was diagnosed with Adjustment disorder of childhood with mixed emotions, depressed feelings, and attention deficit hyperactivity disorder primarily inattentive type. Furthermore, the patient scored 55 (normal = 91-100) on the global assessment of functioning (GAF) score. It is a numerical scale utilized by mental health clinicians to determine the patient's day to day functionality. Specifically, it allows the clinicians to score and determine their social, occupational and psychological functioning [].\nAfter presenting to our care, the patient was sent for further workup including the Epworth Sleepiness Scale (ESS), a nocturnal polysomnogram (NPSG), and a multiple sleep latency test (MSLT). The ESS is a subjective test utilized to measure the patient’s sleepiness []. It includes eight scenarios in which the patient rates their tendency to become sleepy. The scale ranges from 0 (no chance of dozing) to 3 (high chance of dozing). These eight scenarios are sitting and reading, watching television, sitting inactive in a public place, as a passenger in a car for an hour without a break, in a car while stopped for a few minutes in traffic, lying down to rest in the afternoon, sitting and talking to someone, and sitting quietly after a lunch without alcohol [, ]. Our patient scored 17 which is highly associated with pathologic sleepiness because a score of greater than 15 suggests that the patient is excessively sleepy and should be treated.\nNPSG is a sleep study which records brain waves, oxygen levels, heart rate and breathing patterns along with eye and extremity movement as the patient sleeps []. According to the results of NPSG, the patient slept 367.00 minutes out of 440.7 minutes in bed for a sleep efficiency of 83.3%. The patient spent 66.4% of total sleep time in supine position. In addition, the patient spent 16.9%, 38.3%, 27.5% of sleep time in stage 1, 2 and 3, respectively. The study identified five REM sleep periods with REM stage lasting for 17.3% of sleep time. REM latency was recorded as normal at 87.5 minutes. Furthermore, the sleep study noted sleep latency (SL) to be 3.2 minutes. Overall Apnea-Hypopnea Index was 0.5 events/hour. The REM specific index was 1.9 events per hour. During the study, one obstructive hypopnea was with a mean duration of 14.3 seconds. There were two mixed apneas with a mean duration of 10.7 seconds along with 0 central apneas. Laboratory workup for HLA-DR15 and DQ0602 was positive.\nMSLT is the primary diagnostic tool for narcolepsy and is typically performed following an NPSG to measure sleep latency []. Sleep latency can be described as the amount of time it takes to go from wakefulness to entering sleep. Also, it measures sleep onset REM periods (SOREMPs) which illustrates how quickly the patient enters REM sleep []. This test typically includes four or five naps lasting for 20 minutes each. Results of the MSLT consisted of five nap trials with a sleep latency of 1.8, 3.4, 4.7, 2.9, 6.4 minutes, respectively. In addition, REM latency during five nap trials was recorded to be at 2.5, 1.0, 1.5, 0.5 and 2.5 minutes, respectively. The result shows that the patient slept during each nap trial with mean sleep latency (MSL) to be at 3.8 minutes. Lastly, the study recorded five SOREMPs with a mean REM latency of 1.6 minutes. Based on the workup, the patient was diagnosed with narcolepsy which has been successfully managed with stimulant therapy and sodium oxybate.
A 62-year-old female presented for evaluation of recurrent left lower extremity swelling. Her medical history was notable for prior deep vein thrombus in the right distal lower extremity while on hormone replacement therapy (HRT). She denied the active use of HRT and tobacco use during this admission. Venous Doppler ultrasound completed in the emergency room revealed extensive thrombosis of the left lower extremity extending superiorly towards the left common iliac vein. Further imaging with ultrasound revealed compression of the left iliac vein by the right iliac artery as well as a significantly elevated reflux time of the left great saphenous vein (14.2 seconds) suggestive of MTS. The patient was taken to the operating suite and during the procedure the common iliac vein appeared normal distally, but more proximally the vein was narrowed significantly to a diameter of less than 2 mm. Prior to entering the inferior vena cava, the common iliac vein normalized. Using intravenous ultrasound, measurements were taken and a 14 x 60 mm Luminexx stent was deployed at the area of stenosis. The stent was noted to have migrated upward into the inferior vena cava and a buttressing of this stent with a 16 x 40 mm Wallstent was placed to ensure adequate apposition. Unfortunately, this caused further migration upward into the IVC and a 14 mm Atlas balloon was used to help secure the migrated IVC stent. The area of stenosis was no longer stented given this migration. Therefore, stenting of the left common iliac vein stenosis was ultimately achieved with a 14 x 80 mm Luminexx stent (). The patient was started on warfarin with heparin bridging postoperatively. Early ambulation and the routine use of elastic stockings were encouraged following the procedure. The following day the patient complained of severe abdominal pain and an abdominal x-ray revealed only two stents located in the abdomen (). A chest x-ray was obtained and revealed the initial 14 x 60 mm Luminexx stent projecting over the right atrium (). She underwent open-heart surgery for stent retrieval and had a postoperative course complicated by atrial fibrillation and recurrent left sided lower extremity DVT managed with catheter directed thrombolysis. Hypercoagulable work-up revealed homozygosity of the Factor V Leiden gene mutation. One week after discharge, she developed hypotension and lightheadedness. She presented to the emergency department and was found to have pericardial tamponade requiring blood transfusion, pericardiocentesis, and pericardial window. Anticoagulation treatment was stopped during hospital stay and not resumed upon discharge.\nThree weeks later, she had a syncopal episode secondary to a massive pulmonary embolus (PE). Imaging also revealed residual DVT in bilateral lower extremities. She underwent thrombolysis with tissue plasminogen activator and subsequently developed a thoracic hematoma. Given the residual clot burden in the bilateral lower extremity, she underwent IVC filter placement and mechanical thrombectomy. No additional stents were placed. Throughout the hospitalization the patient required multiple blood products after developing a hematoma related to recent thoracic surgery. The patient was eventually stabilized and given the Factor V Leiden mutation and life-threatening PE, she was started on rivaroxaban indefinitely. Since these events, she has been followed closely as an outpatient with no known hospitalizations related to bleeding or thrombosis. At 5-year follow-up, the patient reports that she is doing well. She is not experiencing any complications related to rivaroxaban. She does have residual postthrombotic syndrome (CEAP class 3, Villalta Score 8) well managed with daily compression stockings.
A 42-year-old Mediterranean male presented complaining of inability to sustain good oral care at the posterior aspect of the lower right jaw. The main problems were food impaction in the area and the subsequent malodor. The patient reported remarkable medical history, and he was a non-smoker. Clinical examination revealed local erytherma with noticeable bony defect distal to the second molar with obvious defect in the mesial wall of the third molar; the penetration depth was found to be up to 6 mm (Figure ).\nRadiological evaluation confirmed the defect and it was attributed to the mesioangularly impacted lower third molar; there was marked dilation or thickening of the lamina dura secondary to the local inflammatory reaction. It was decided that the third molar should be extracted and concentrate of the patient's growth factors (PRGF) to be implanted into the bony defect to stimulate bone regeneration and promote healing(Figure ).\nPreoperatively, 24 cc of the patient's blood (venous blood from a peripheral vessel) was obtained using a butterfly cannula. The blood was collected in five sterile glass tubes, pretreated with 3,8% trisodium citrate (anticoagulant factor) and then centrifuged at 460 g for 8 mins at room temperature (PRGF System, BTI Biotechnology Institute, Vitoria, Spain) []. After centrifugation, blood was separated into distinct layers, with the cellular fraction located at the bottom of the tubes and the plasmatic fraction located just above the red blood cell line. Plasma volume constituted 1 cc and was located just above the red blood cell line. This fraction appears to be very rich in growth factors []. A volume of approximately 5 cc of PRGF was collected in a tube and 50 μl of 10% calcium chloride (CaCl2) were added per 1 cc of PRGF []. CaCl2 activates PRGF and stimulates the formation of a semi-solid, scaffold-like mass which functions as a matrix for progenitor cells and maintains the regenerative area of the defect []. After activation, PRGF was mounted on a spatula and ready to be applied to the bony defect (Figure ).\nThe surgical part of this case study took place under local anesthesia. A transginigival incision was made after tissue infiltration with local anesthesia. A buccal mucoperiosteal flap was raised and bone was exposed. The third molar was elevated and removed, followed by debridement and curettage of all debris and granulation tissue in the area. Subsequently, the 'scaffold-like', CaCl2 activated PRGF was implanted in the bony defect. The volume of PRGF was adequate to provide full cover of the whole defect. The flap was carefully repositioned and sutured with horizontal mattress sutures. An immediate postoperative dental panoramic tomography was obtained and considered as the "baseline image" for this case study (Figure ). The patient was given full postoperative instructions, including contact details if postoperative complications to occur. Also, anti-inflammatory and antimicrobial cover was provided for 5 days.\nAt the first postoperative day, moderate pain was the main complaint and was controlled by NSAIDs. After two days, the pain subsided. No postoperative swelling was reported by the patient. There were neither symptoms nor clinical suspicion that would suggest alveolar osteitis (dry socket), indicating normal clotting and coagulation [,]. One week postoperatively, the sutures were removed and there was good tissue healing on examination.\nOn the fiftieth postoperative day, and according to the PRGF clinical protocol, radiographic evaluation took place and showed noticeable enhancement of density and radio-opacity in the third molar socket area, in comparison with the baseline image (Figure and Figure ). Further clinical examination showed significant reduction of periodontal pocketing by 3 mm and evidence of new bone formation.
A 23-year-old Asian man was referred to the ER of Xiamen Chang Gung Memorial Hospital with a 1-day history of right-sided chest pain that had been aggravated for 1 hour. He had no known medical illnesses and was well until the evening prior to presentation, at which time he developed obvious right-sided chest pain radiating to his ipsilateral shoulder with persistent chest tightness. This tightness was described as sticking in nature, significantly worse on deep inspiration and with movement, and relieved by leaning forward or lying down. There was an associated dry cough but no hemoptysis. There was no history of trauma, injury, difficulty in breathing, or palpitations. He was tall and thin and described himself as otherwise quite healthy. He had never previously been admitted to a hospital. He reported no significant chronic medical history, such as primary hypertension, any type of heart disease, disturbed microcirculation, peripheral neuropathy, diabetes mellitus, an impaired immune system, malignancies, leukemia, the long-term administration of corticosteroids, liver cirrhosis, renal failure, urinary tract infection, or hemodialysis. He also reported no history of infection, such as tuberculosis, any type of hepatitis, or acquired immunodeficiency syndrome (AIDS). There was no prior history of traumas, blood transfusions, surgical procedures, or other serious events in his medical history. He had not lived in an epidemic area and had no history of toxin or radioactive exposure. He denied a personal or family history of bleeding diathesis but reported a 10-year history of smoking 8–10 cigarettes per day. He was an office worker by occupation. He had experienced similar symptoms on one occasion 4 years previously. No abnormalities were detected at that time, and his symptoms resolved.\nA physical examination (PE) revealed a young man who was awake and alert but in mild to moderate painful distress. His respiratory rate was 22–26 breaths/minute with an oxygen saturation of 97%. His pulse was 96 beats/minute, his blood pressure was 115/74 mmHg, and his temperature was 36.7 °C. The examining physician noted slight tenderness along the right posterolateral chest wall along the eighth and tenth ribs. Breath sounds and percussion were documented as normal. An electrocardiogram revealed sinus rhythm with a normal axis. PSP was considered, and a standing chest X-ray (CXR) was requested. The radiographic findings revealed a right-sided PSP (approximately 30%) with a small amount of pleural effusion (Fig. ). A right thoracostomy tube (28-F, straight) was immediately placed under sterile conditions; approximately 50 mL of light red pleural effusion flowed out from the chest tube after placement, and good fluctuation of the water column in the drainage reservoir was observed. Another CXR was performed to evaluate the position of the thoracostomy tube and re-expansion of his right lung (Fig. ). Our patient’s vital signs stabilized, and his right-sided chest pain was apparently alleviated after chest tube placement; therefore, he was referred to the respiratory service with parenteral analgesia.\nWhile in the respiratory department, approximately 420 mL of blood was drained from the thoracostomy tube over 15 minutes. He developed obvious hemodynamic instability with hypovolemic shock (his blood pressure dropped from 110/70 to 75/50 mmHg), and he was subsequently admitted to the cardiothoracic surgical ward after fluid resuscitation. During the 4 hours after admission, 750 mL of blood was drained through the thoracostomy tube. His hemoglobin level dropped from 12.6 g/dL to 9.2 g/dL. A prolonged prothrombin time (PT) of 19 seconds was noted (normal reference of 14 seconds). Packed red cells and fresh frozen plasma were administered to our patient. Vitamin K (10 mg) and tranexamic acid (1 g) were also administered parenterally. He was unable to undergo an emergency chest computed tomography scan as his vital signs remained unstable after fluid resuscitation. Alternatively, a bedside supine CXR was performed when he was temporarily hemodynamic stable (Fig. ). A primary SHP associated with right TP was considered based on the radiographic findings. A re-examination of his chest revealed markedly decreased air entry on the right side with mild tracheal deviation.\nAn emergency limited posterolateral thoracotomy was performed for resection of the bullae, ligation of the bleeding adhesion, and irrigation of the pleural cavity, and mechanical pleurodesis was implemented. Approximately 800 mL of blood and clots and a collapsed right lung with several apical bullae were observed. There was a small (less than 1.0 cm) tan lesion noted on the dome of the right side of his chest. Bullous apical tissues of the right lung adhering to the thoracic wall and adhesions at the region of the subclavian artery were identified as the source of bleeding. Aberrant blood vessels growing from the chest wall through the adhesion bands into the pleural lesion were thought to be torn once the lung collapsed. These bleeding blood vessels may also have arisen from the surface of ruptured bullae. Histopathology revealed that the bullous and string-like tissues were rich in blood vessels and were granulomatous.\nSubsequently, the drainage from his chest tube became minimal. A standing CXR performed on day 6 of admission after removal of the thoracostomy tube showed complete re-expansion of his right lung. His hemoglobin level rose to 10.1 g/dL after a transfusion of two units of packed red blood cells, and his PT normalized. He remained stable and was discharged within 1 week (6 days postoperatively). He returned to an out-patient department for follow-up two times. The right-sided posterolateral surgical incision had healed on the 14th postoperative day. Full expansion of lungs was confirmed using a standing CXR on the 14th postoperative day and at 3 months after discharge. He was healthy as usual with no complaints or illness.
A 41-year-old-female had complained of headache and loss of olfactory function and underwent consultation at the Department of Otolaryngology of a general hospital. Endoscopic examination revealed a large mass involving the olfactory cleft of the left nasal cavity. Microscopic examination of a biopsy specimen indicated a diagnosis of neurogenic tumor. She was then referred to Kyoto University Hospital for further examination and treatment.\nNasal endoscopy demonstrated a soft, whitish mass occupying the olfactory cleft and extending laterally to the middle meatus, with destruction of the middle turbinate in the left nostril. Computed tomography (CT) displayed a lesion at the olfactory cleft that extended superiorly to the olfactory groove, with a bone defect in the skull base (). The cribriform plate was elevated upward indicating that the tumor originated from the extracranial compartment. Magnetic resonance imaging (MRI) revealed a mass showing cystic changes (Figures –), with solid portions demonstrating strong postgadolinium contrast enhancement. Our initial diagnosis based on radiographic findings was esthesioneuroblastoma. Partial resection of the tumor in the olfactory cleft was then performed using the endoscopic endonasal approach under local anesthesia, which suggested a histopathologic diagnosis of schwannoma. Based on this result, we planned subtotal resection of the tumor via an endoscopic endonasal approach.\nUnder general anesthesia, the uncinate process in the left nostril was removed to expose the tumor in the middle meatus (). The tumor was attached but had not invaded the internal orbital wall. The anterior part of the middle turbinate was separated from the agger nasi and reserved into the choana as a pedicle flap. Resection of the agger nasi using a drill resulted in exposure of the entire anterior surface of the tumor. A tumor capsule was dissected from the nasal septum and then from the crista galli using a suction elevator and a 45-degree angled endoscope for visualization. During this procedure, the olfactory nerves were identified. After confirmation of their location, the anterior and lateral walls of the tumor were dissected from the posterior wall of the frontal sinus and nasofrontal duct.\nAfterward, the tumor capsule at the anterior surface was opened using an ultrasonic cutter (Harmonic scalpel, EthiconEndo-Surgery, Blue Ash, OH). The tumor contents were debulked with an ultrasonic surgical aspiration (CUSA, Tyco Healthcare Radionics, Burlington, MA) without bleeding. The tumor capsule was resected, except for the region connected to the dura matter. Following surgery, the region with the bone defect was covered with a mucoperiosteal pedicle flap that originated from the nasal septum and the middle turbinate. Pedicle flaps were fixed with fibrin glue, then covered with pieces of gelatin sponges. The operation lasted 3 h, and the volume of blood loss was less than 10 mL.\nMicroscopic examination of the resected tumor demonstrated a neoplasm composed of spindle cells with eosinophilic cytoplasms and elongated or wavy nuclei with occasional symplastic changes (). The mitotic index was less than one per ten high-power fields, and there was no geographic tumor necrosis. All features were apparently compatible with schwannomas. Immunohistochemically, the spindle cells were diffusely positive for S-100 protein, neuron-specific enolase, and synaptophysin (Figures , , and ), and negative for epithelial membrane antigen (), which also supported the diagnosis of schwannoma, although Leu7 was completely negative (). The Ki-67 labeling index was 2%. These results were considered to best fit with a diagnosis of olfactory ensheathing cell tumor.\nNo perioperative cerebrospinal leakage was identified. Postoperative imaging examinations confirmed subtotal extirpation of the tumor. The patient had an uneventful postoperative course, and no further recurrence was detected during the 2-year follow-up period (Figures –).
A 31-year-old male patient was bought to psychiatry OPD by family members with acute onset, complaints of disturbed sleep, appetite, muttering to self, and gesturing in the air from the past 3 days. He had a history of alcohol consumption from the past 4 years in an on and off pattern. His recent pattern of drinking was about 90–180 ml 3–4 times a week and his last drink was about 7 days before the admission and on the day of admission, he had no withdrawal symptoms. He had no significant family history of any major illness. He had a well-adjusted pre-morbid personality and his early developmental period along with childhood history was also unremarkable. He was admitted and all his routines blood workup was done which revealed an elevated serum glutamic oxaloacetic transaminase (174 U/l) and serum glutamic pyruvate transaminase (132 U/l) with normal bilirubin. Apart from this, all his blood parameters were within the normal limits. His ultrasonography revealed Grade I fatty liver. His non contrast computed tomography (NCCT) head was normal. On MSE, the patient had a kempt appearance with normal psychomotor activity and was fearful. He reported 2nd person auditory hallucinations which were derogatory in content. In a further interview, the patient gave a vivid explanation about seeing a flying statue of a deity that was wrapped in his mother's clothes and subsequently, he caught up that flying statue and he burnt it. He further described that the family deity is punishing him for his wrong deed. Although his family members denied any such incident, the only thing they corroborated was that he burnt his mother's clothes without any apparent reason. Because of psychotic symptoms and concurrent use of alcohol, a diagnosis of alcohol-induced psychosis with dependence syndrome was kept. At that time, he was started on olanzapine 5 mg which was up titrated to 20 mg, but he had no response to that medication even after 1 month.\nIn view of his nonresponse to olanzapine, his diagnosis and history were again reviewed. On further enquiry about the visual images, he explained that these images were intrusive in nature and he could get rid of this image by distracting himself by drawing the image of that deity. Also, he explained in detail that first he would get a thought about burning that deity, and then he would hear derogatory comments in form of a female voice stating “Why did you kill me.” He would never see these images while he was engaged in some work. During this interview, a jerky movement of one hand of the patient was observed. On further enquiry, he told that from past 3 years, he was gettingthisjerky movement in his hand, which he described as sudden and brief.\nThese jerky movements interfered with his work. He would get these jerks in his sleep, which would wake him up, but he never consulted any doctor. The description of these jerks was typical of myoclonus and an alternate diagnosis of focal seizure was considered. An EEG was done which came out to be normal, but on a clinical basis he was started on clobazam 5 mg which was up titrated to 10 mg. He reported overall improvement, particularly in his sleep. His olanzapine was stopped gradually and given his alcohol dependence that has a negative outcome on seizures divalproex sodium 500 mg was added as an anti-craving agent and up titrated to 1000 mg, after which he reported complete resolution of his symptoms. For co-morbid alcoholism, the patient was given psycho-education and four sessions of Motivational Enhancement Therapy. On follow-up after a month, he was symptom-free and abstinent from alcohol.
Mr. AA, a 33-year-old right-handed, Asian male, a software engineer by profession, was apparently well before May 1998 (at the age of 18 years), when he had first episode of neurodeficit in the form of abrupt onset blurring of vision involving right eye associated with binocular diplopia on looking towards the right. About 2-3 days later, there was spontaneous recovery of vision, but diplopia recovered over next 5-6 months. About 14 months later, he had another (second) episode that was in July 1999 in the form of acute onset gradually progressive imbalance while walking with a tendency to fall on either side, but more towards the left, also, felt mild weakness of left lower limb. At the onset, his symptoms were very subtle which progressed over next 6 months when there was also change in speech. The speech was slurred with intermittent scanning and abrupt loudness of voice. At this time, the patient was admitted and was diagnosed to have RRMS and was given pulse injection methylprednisolone (1 gm intravenous once daily for 5 days) at another hospital. He completely recovered within 3-4 months. He remained asymptomatic for the next 2 years (January 2000-December 2002). By the end of December 2002, he developed (third episode) subacute onset and progressive gait instability, which progressed over next 6months. He was admitted and underwent relevant and extensive investigations. During this period of progression, injection Rebiff was initiated, but the patient could tolerate only four doses and was discontinued due to intolerable fever and myalgia. His symptom was progressive and was admitted under our care in May 2003. During the hospital course, detailed work-up was done and his MS was of secondary progressive type (SPMS). Expanded Disability Status Scale (EDSS) documented at that time was 3.5. After detailed discussion and understanding the benefits and harms, the patient was initiated on injection mitoxantrone (each 3 months apart), which he discontinued on his own after 1 year, because there was no improvement. Subsequently, he was also prescribed tablet methotrexate after discussion with him and monitoring of adverse events, which was again discontinued by the patient in 6 months. By the end of 2004, patient became dependent for activities of daily living. After another 4 years of gradual progression of disease, he had another acute episode (fourth episode) in September 2008 in the form of worsening of symptoms, he developed increased imbalance while walking and tremulousness of both upper and lower limbs (right more than left limbs); he was again infused pulse injection methylprednisolone (1 g intravenous once daily for five days), but showed no improvement. He also had associated urinary frequency and hesitancy. Between the years 2008 and 2010 (i.e., for 2 years), the patient did not have any relapse, but neurological disability continued to progress. In February 2010, for the first time he was admitted under hematology services for stem cell transplantation, but was not considered eligible in view of the absence of any relapse for last 2 years. However, he again had an episode (fifth episode) in January 2012 with worsening both clinically as well as radiological. After this episode patient was readmitted in hematology services in February 2012 for autologous HSCT (see below under autologous HSCT methodology), which was done on 13th March 2012 (at EDSS of 6.5). Post transplantation he noticed gradual improvement in speech and walking and has been ambulatory without the support till date. The patient underwent reevaluation recently in July 2014 and noted having stabilization in his symptoms without any fresh episode in the last 2 years with an improvement in EDSS from 6.5 (in March 2012) to 5.0 (with Functional Systems Score (FSS) >5 in cerebellar examination, disability severe enough to impair activities of daily living (ADL), but ambulatory without aid for about 200 m). No history of persistent headache, seizures, encephalopathy, meningism, movement disorders, stroke-like events, and peripheral neuropathy. No other systemic symptoms (fever/night sweats, weight loss, arthropathy, rash, ulcers, dry mouth and eyes, and redness of eyes) were observed. Moreover, patient was born of nonconsanguineous marriage without any significant family history and also had no other comorbidities; had no addiction to tobacco chewing, smoking, or alcohol ingestion; no history of any chronic infectious disease; and no exposure to toxins as well.\nHe is conscious, oriented, with normal vital parameters (blood pressure of 124/70 mmHg in right arm supine position and heart rate of 84/min regular). His Mini-Mental Status Examination is 28 of 28 (copying and writing are not possible due to tremulousness). Scanning speech with intermittent loud voice is noted suggestive of cerebellar dysarthria. All the cranial nerves are normal except his visual activity of 6/9 and after pinhole 6/6 in both the eyes. Fundus examination is normal on both sides. Motor examination is showing normal bulk and power; but grade 1.5 spasticity in both the lower limbs, also brisk deep tendon reflexes at all sites. Plantar reflex is extensor on both sides. There is asymmetric (right more severe than left) abnormal cerebellar examination in the form of impaired finger nose test (dysmetria, intention tremor, and in coordination), dysdiadokinesia, knee-heel test (dysmetria, incoordination, intention tremor), and gait ataxia (impaired tandem walk).\nHis routine investigations of complete blood count, liver function test, kidney function tests, and thyroid stimulating hormone were normal. Erythrocyte sedimentation rate, C-reactive protein and other vasculitis markers (antinuclear antibody, rheumatoid factor, perinuclear antineutrophil cytoplasmic antibody (pANCA), cytoplasmic ANCA (cANCA), double-stranded deoxyribonucleic acid (DNA), anti-Ro antibody, anti-La antibody, C3 and C4-complement, immunoglobulin levels (IgG, IgM, and IgA), and cryoglobulinemia were negative. Viral markers tested were negative human immunodeficiency virus (HIV) I and II, hepatitis C virus (HCV), and hepatitis B surface antigen (HBsAg). Cerebrospinal fluid (CSF) examination is normal having normal cell count, protein, glucose, and negative for infections (Cryptococcal antigen, India ink, Gram stain, Ziehl-Neelsen (ZN) stain, negative cultures, including tuberculosis (TB) and fungus, TB-polymerase chain reaction (TB PCR), herpes simplex virus (HSV) DNA, and Venereal Disease Research Laboratory (VDRL)), and positive for oligoclonal bands (OCBs). Visual-evoked potential showed asymmetric bilateral prolonged p100 latency (right more than left) suggestive of anterior visual pathway dysfunction. Neuroimaging done at various stages of disease [see ], the description is made simultaneously in the figure.\nThe clinical diagnoses for recurrent focal neurodeficit in the described form are: MS as per revised Mc Donald 2010 criteria,[] differential diagnosis includes: Secondary inflammatory disease of CNS: Vasculitis secondary to rheumatoid disease, systemic lupus erythematosus, Sjögren's syndrome, drugs, infection (e.g., HIV and HCV), anticardiolipin syndromes, Behçet's, sarcoidosis, other connective tissue diseases, paraneoplastic and other specific autoimmune disease (celiac disease, Hashimoto's disease, etc.). With the clinical possibilities and exclusion of various secondary and other mimics of MS, there was not much diagnostic dilemma, but challenging treatment, since young patient, aggressive and severe disabling disease.\nAfter a consent (an off-labeled single patient consented intervention), initial clinical and laboratory evaluation, first stem cell mobilization was done on Day 1 with injection cyclophosphamide 2 g/m2 adding injection 2-mercaptoethane sulfonate sodium (MESNA) dose of 2 g/m2 to it. Intravenous fluid (0.9% normal saline) and MESNA alternate given on day 5, total of 3L/m2 with MESNA 2 g/m2 in them (at 6 AM). Injection furosemide 20 intravenous given at 6 PM. Day 2 onwards injection nupogen 10 μg/kg (= 300 μg twice daily) till absolute neutrophil count (ANC) count of 1,000/μL along with injection methylprednisolone 1mg/kg/day (50 mg intravenously daily) given. The next step of collection of stem cells done on the day, ANC crossed 1,000/μL. The collection was done on an apheresis machine (P1TA apheresis kit). A total of 2-2.5 times of blood volume (70 ml/kg body weight) processed and autologous hematopoietic stem cells collected. CD 34 + and CD 3 + enumeration done in the harvest bag by standard flowcytometry and subsequently stem cells are stored in the stem cell laboratory for cryopreservation with standard protocol. Conditioning done with high dose immunosuppressive therapy (injection cyclophosphamide 50 mg/kg body weight intravenously for 5 days, injection rabbit antithymocyte globulin 0.5 mg/kg body weight intravenously on day 6 and 1mg/kg body weight for another 5 days. Injection methylprednisolone 2 mg/kg body weight was given intravenously for 5 days). At this point, stem cell infusion was done with 3-8 × 106CD34 + cells/kg body weight with standard protocol and precautions. Post-stem cell infusion, all precaution was taken to reduce infections in view of the neutropenic state patient. Injection granulocyte colony stimulating factor (GCSF) 5 μg/kg body weight was given till his ANC was >500/μL. Subsequently, the patient followed-up by repeated clinical and laboratory evaluations.\nThe patient was comfortable and adherent to the treatment option of autologous HSCT and follow-up. He was monitored on regular interval and no adverse events were noted till now in 2 years of follow-up. He was reevaluated and at 2 years follow-up of autologous HSCT his EDSS was 5.0 (reduced by 1.5), no relapse, and there was no fresh lesion load on magnetic resonance imaging (MRI) brain [].
The patient was a 67-year-old man with hypertension who had undergone pancreatoduodenectomy for pancreatic cancer 7 years ago. He also had noncirrhotic recurrent hepatic encephalopathy after shunting from the superior mesenteric vein to the inferior vena cava for a jejunal varicose vein for 3 years and dialysis for chronic kidney disease for 1 year. He had a high school degree, lived with family, and worked until he was 60 years old. He smoked 40 cigarettes per day for 30 years until he was 50 years old. He had no history of alcohol consumption. He did not regularly exercise.\nChest CT screening after pancreatoduodenectomy in our hospital revealed a 1.1 × 1.4 cm mass located in the right S6. The tumor was diagnosed as stage IV (T1aN0M1) lung metastasis of pancreas adenocarcinoma. The patient was advised to limit the use of postoperative analgesic drugs because of comorbidities. He had no signs of pleural effusion, ascites, disturbance of consciousness, or obvious fatigue. Clinical findings on admission were normal, except that the pulmonary function test revealed a mild restrictive defect (). The 6MWD on admission was 372 m.\nPreoperative pain-related psychological findings were measured using the Pain Catastrophizing Scale (PCS), which consists of 13 items and gives a score ranging from 0 to 52 [, ]. The PCS measures a subject's perception of how frequently they have experienced negative automatic thoughts and predicts postoperative pain [, ]. The total PCS score was 23, and the subscales were 15 in rumination, 5 in magnification, and 3 in helplessness. The total PCS score was above the cutoff points of strong pain prediction, which have been reported to be 13 [] or 16 []. The patient's thoughts were “I cannot seem to keep pain out of my mind” and “I keep thinking about how badly I want the pain to stop,” which was one of the items in the rumination of pain of the maladaptive coping style [–].\nMedical and psychological information was provided during the preoperative period, and training to modify pain coping skills was performed throughout the study []. The patient was provided with opportunities to recognize pain-related negative automatic thoughts, such as pain catastrophizing, and to replace these with alternative, rational, reassuring, adaptive thoughts.\nThe patient underwent S6 segmentectomy of the right lung. The operating time was 87 minutes, and blood loss was 103 mL. The patient returned to the general ward on POD1. Postoperative analgesic drugs included continuous fentanyl (50 μg/hr) until POD2 and oral celecoxib (up to 200 mg per day as needed). Continuous epidural anesthesia and patient-controlled analgesia were not used because of comorbidities. Pain intensity using a 0–10 numerical rating scale was 8/10 on POD1, 5/10 on POD2, 3/10 on POD3 and POD4, and 0–2/10 on all subsequent days. The patient thought “I do something active, which diverts my attention away from the pain” and “I tell myself to be brave and carry on despite the pain,” which was similar to one of the items in the adaptive coping style []. Oral intake without aspiration was possible on POD6.\nThe patient was discharged home on POD19. The 6MWD at discharge was 344 m. The patient thought “I see my illness as a challenge,” which was similar to one of the items in the fighting spirit of the adaptive coping style [, ]. After discharge, the patient regularly walked for 20 minutes every day to improve his physical function. The patient was not readmitted for any pulmonary complications.
A 3.5 years old female child was brought to department of oral medicine and radiology with a complaint of mobility of right lower back tooth of 1 week duration. There was no history of toothache, trauma or associated symptoms. Extraoral examination revealed an irregular lobulated, nontender bony hard swelling of size 3 × 3.5 cm with uniformly blending borders on buccal aspect of right side body and angle of mandible (). Lower border of the mandible showed a discontinuity without considerable expansion. It extends to midline through submandibular region with a size of 4 × 5 cm. Local rise in temperature noted on overlying skin and is not fixed to swelling.\nIntraorally, right lower gingivobuccal sulcus and floor of mouth obliterated due to swelling from 84 region to retromolar region (). An irregular lobulated swelling of variable consistency with bilateral cortical plate expansion was seen on premolar-molar region. Hard tissue examination showed full complement of healthy teeth except grade III mobile nontender, 85.\nOcclusal and panoramic radiographs revealed ill-defined lytic lesions involving premolar-molar region of right side body of mandible, extending from 83 to angle of mandible. Cortex and periosteum was characterized by erosion, thinning and discontinuity on buccal cortex; radiating spicules on lingual cortex; irregular thinning of lower cortical plate seen without considerable expansion. Multiple irregular patchy radiolucent areas in internal structure of permeative and moth eaten pattern with size varying from 0.5 to 2 cm was noted in internal structure (). Considerable root resorption was seen on 84, 85. Other effects on surrounding structures include posterior superior displacement and mesial tipping of developed crown of dental follicles of 46, 47 and missing dental follicle of 45. Loss of alveolar canal outlines medial to angle of mandible (). Computed tomographic (CT) axial section showed multilocular expansile lytic lesion in body of mandible right side with significant enhancing soft tissue matrix ().\nTrucut needle biopsy showed spicules of bone with a cellular cytoplasm composed of round cells with scanty cytoplasm and pleomorphic round or oval nuclei in sheets and sinusoidal pattern (). Immunohistochemistry showed diffuse strong membrane positivity for MIC2 (), focal positivity for synaptophysin and negativity for desmin and diagnosis came compatible with ES or primitive neuroectodermal tumor (PNET).\nPatient underwent radiotherapy and adjuvant chemotherapy treatment with vincristine, cyclophosphamide, etoposide and mesna in Regional Cancer Centre, Thiruvananthapuram, Kerala. One year follow-up clinical review showed bony hard nontender diffuse expansion of right side mandible without apparent soft tissue swelling extraorally (). Intraorally missing 85 was noted due to exfoliation, 6 months after onset of treatment ().\nRadiological follow-up using occlusal and panoramic radiography after 1 year of treatment showed mixed radiodensity on premolar-molar region and anterior border of ramus of right side of mandible involving 82 to 47. Intact and visible uniform expansion with cortical regeneration was seen throughout the lower border of the mandible near the lesion. Cortical break in buccal aspect remodeled with overzealous cancellous bone apposition resulted in an increased buccolingual width. Periosteal reactions including vertical spiculations completely resolved and cortical out line re-established in lingual aspect (). Considerable reduction in permeative and moth eaten pattern and replacement with accentuated multiple linear and granular trabeculae with a multiseptated pattern was noted in internal structure. Enamel formation completed and dentine formation started 44 and 47. Relative developmental delay was observed on 46 (). Radiological features suggestive of cessation of malignant tissue growth and active destruction, followed by vigorous regeneration and reparative reactions of healthy osseous and dental tissues and arrested growth of dental follicle near epicenter of the lesion.
A 90-year-old woman was referred for management of CIED pocket infection. She had a history of complete heart block with pacemaker implantation in 2000 and cardiac resynchronization therapy defibrillator upgrade in 2014, end stage renal disease, hypertension, cerebrovascular accident, rheumatoid arthritis, diabetes mellitus, and remote lymphoma. She presented with 1 year of progressive left chest wall device pocket swelling, tenderness, and erythema. On examination the device site was swollen and tender to touch (). She had no systemic signs or symptoms of infection. Her lab work did not reveal any hematologic abnormalities. An echocardiogram was performed with no evidence of endocarditis or lead vegetation. Management strategies were discussed with the patient and her family. Owing to her advanced age and multiple comorbidities, a lead extraction was not done and she underwent a CIED pulse generator removal, debridement, and complete capsulectomy. A new cardiac resynchronization therapy pacemaker device was placed in subpectoral fashion on the left side. At the time of the procedure an intense inflammatory reaction as well as necrosis was noted, but no purulence was seen. Swabs from the pocket as well as tissue from the capsule were sent for culture. The pocket was irrigated with hydrogen peroxide as well as antibiotic solutions and a negative-pressure wound therapy device was placed to assist with pocket closure. She recovered well and was discharged on a 3-week course of oral doxycycline. All cultures remained negative. An area of induration and discoloration persisted and increased in size, breaking through the epidermis and exposing vascularized tissue (). Eleven weeks after her original surgery, she was brought back to the operating room for a pocket exploration, debridement, and primary wound closure. Tissue sent for pathology revealed large B-cell lymphoma. Given the patient’s remote history of B-cell lymphoma, this was felt to likely be a reoccurrence.\nAn 84-year-old man was referred for management of a CIED pocket infection. He had a history of complete heart block with pacemaker in 1995, right ventricle lead revision in 2003, and a generator replacement in 2011. Past medical history was otherwise significant for permanent atrial fibrillation, diabetes mellitus, hypertension, and previous squamous cell carcinoma of his right forearm. He initially presented to an outside hospital with a “cyst” located in the left infraclavicular region. The “cyst” was excised and the wound left open to drain because of concern for infection. The wound culture was positive for Staphylococcus aureus. His wound was cared for by a dermatologist with topical ointments and systemic antibiotics for 4 months without wound healing. He was treated with vancomycin and piperacillin/tazobactam. He was referred for further management and lead extraction. Upon admission, he was afebrile and hemodynamically stable. His examination was significant for an open left upper chest wound measuring 5 × 2 cm, which was warm and tender to palpation and draining purulent fluid (). The area was slightly superior to his pacemaker pocket, with concern for lead erosion. A left upper arm nodule was also noted. Wound cultures were positive for Enterococcus faecalis and Pseudomonas aeruginosa. Blood cultures were negative. An echocardiogram was negative for endocarditis or lead vegetation. Infectious disease was consulted, and they recommended continuation of piperacillin/tazobactam and device extraction because of its proximity to the infected wound and concern for involvement. Plastic surgery was consulted for wound evaluation prior to the device extraction. He underwent pulse generator removal and extraction of 3 permanent transvenous pacemaker leads without complication. His pocket contained a small amount of serous fluid, which was cultured, but otherwise there was no evidence of infection. A temporary-permanent pacemaker was placed via his right internal jugular vein. The plastic surgery team excised and debrided his clavicular wound and placed a split-thickness skin graft from his left thigh to the wound. After 72 hours of negative blood cultures, the patient underwent placement of a leadless pacemaker (Medtronic Micra™; Medtronic, Inc, Minneapolis, MN). He was discharged home to complete 2 weeks of intravenous antibiotic therapy with piperacillin/tazobactam. Pathology results from the wound debridement revealed moderately differentiated squamous cell carcinoma (SCC) extending into the deep margin and focally into the peripheral margins. He was referred to Oncology to discuss further management of the SCC. Prior to decision, a biopsy of the left upper arm nodule was performed to evaluate for disease in transit. The pathology results from an incisional biopsy were significant for B-cell lymphoma. He has undergone infusions to treat the lymphoma and continues to be followed by an oncologist for both his lymphoma and SCC.
The patient is a 24-year-old female who was referred to our eye center in Mediclinic Dubai Mall, Dubai, United Arab Emirates, because of recent bilateral IOP elevation with a severe drop in vision. She had been hospitalized elsewhere 1 week earlier because of severe bilateral frontal headache, nausea, and vomiting. Initially, she was investigated for possible central nervous system disease. Blood tests and brain magnetic resonance imaging (MRI) were performed and revealed no abnormalities. During her stay, there was a progressive worsening of the condition. After 5 days in hospital, the patient complained of loss of vision in the right eye, and after approximately 6 hours, also in the left. Another brain MRI was normal. The ophthalmology consultant suspected bilateral acute angle-closure glaucoma as a possible cause for the severe bilateral loss of vision. The patient was thus referred to our eye center for urgent management.\nOur examination revealed visual acuity of hand movements alone in both eyes. Goldmann applanation pressure was >60 mmHg in both eyes; the patient presented with severely miotic pupils and flat chambers, with almost iridocorneal touch centrally, cloudy corneas, and severe bulbar conjunctival injection. Bilateral diagnostic ultrasound revealed no posterior segment anomalies. The patient’s past history was negative for any medical or surgical diseases and her eye history was also negative. Of note, a routine eye examination had been performed a few months earlier and was reported to be normal. Initial management at our center consisted of multiple topical antiglaucoma medications and intravenous acetazolamide (500 mg). Ultimately, we managed to perform bilateral Nd:YAG laser peripheral iridotomy despite the corneal clouding. After the peripheral iridotomy, the IOP dropped in both eyes to around 45 mmHg, but it rose back to its original level after less than half an hour. The diagnosis of bilateral malignant glaucoma was raised and the patient was admitted to hospital for surgical management. Topical atropine 1% drops and intravenous mannitol (1 g/kg of body weight) were started, and the patient was put under continuous monitoring. In less than 2 hours, the ACs started to deepen in both eyes, with partial clearing of the corneas. The IOP dropped again to 45 mmHg in both eyes. At that stage, the possibility of bilateral malignant glaucoma as a diagnosis was more likely.\nThe next day, the patient was scheduled for trabeculectomy with mitomycin-C (0.02% for 2 minutes) combined with pars plana vitrectomy. Informed consent was obtained from the patient prior to surgery. In the meantime, overnight treatment with topical atropine and antiglaucoma medications was continued, along with intravenous acetazolamide. A second dose of intravenous mannitol was repeated 1 hour before the planned surgery. At the time of surgery, the IOP in both eyes was around 25 mmHg. Surgery was performed in the right eye as planned, and the same procedure was carried out in the left eye 1 day later. In brief, the surgical procedure was performed in both eyes as follows: a limbus-based conjunctival flap was performed, followed by topical 0.2% mitomycin-C application for 2 minutes; prior to the dissection of a 3×3 mm half-thickness trabeculectomy flap, one-port limited core vitrectomy was performed through a pars plana approach 4 mm from the limbus. After completion of the vitrectomy, the trabeculectomy was completed by entering the AC through a small sclerotomy opening using a super blade. The trabeculectomy flap was sutured back using two 10-0 nylon titrated sutures, and the conjunctiva was closed using running 8-0 VICRYL® (Johnson & Johnson, New Brunswick, NJ, USA). Postoperatively, the patient was put on a topical combination of tobramycin (3 mg/mL) and dexamethasone (1 mg/mL), and atropine was continued once a day for 2 weeks. Both eyes had well-formed superior blebs and, surprisingly, visual acuity returned to 20/20 without correction, and there was no optic nerve (ON) damage in either eye. The IOP remained <18 mmHg all throughout the postoperative follow-up period, which extended for more than 1 year, with both eyes maintaining deep chambers and reactive pupils.\nThe study was approved by the review board/ethics committee of the Beirut Eye Specialist Hospital, Beirut, Lebanon. All patients signed an informed consent prior to treatment.
A 71-year-old otherwise healthy man presented to the emergency department with a bulge on his right hip at an area of surgical scar from a total hip arthroplasty performed in October 2018 (2 years before presentation). He first noticed a bulge around the surgical scar 6 weeks before arrival and had undergone an ultrasound scan of the hip 1 week before presentation on an outpatient basis. This showed a complex fluid collection measuring 9.1 × 3.7 × 3.2 cm with a volume of 59 mL suggestive of a haematoma (). At the time, only 1 mL of blood-tinged fluid could be aspirated. Using aerobic cultures and MALDI-TOF MS, the organism would later be identified as T. bernardiae. No in vitro susceptibility testing was performed, and the patient was not treated with antibiotics. His right hip bulge did not resolve with aspiration, and increased in size along with new symptoms of pain, tenderness, warmth and redness prompting presentation to the emergency department. He denied fever, chills, nausea and vomiting. On this visit to the emergency department, an 18-gauge needle was inserted into the centre of greatest fluctuance and 4.5 mL of seropurulent material was aspirated. He was given a regimen of doxycycline for 7 days and told to follow up with his orthopedic surgeon as soon as possible.\nThe patient presented to his orthopedic surgeon 3 days later, by which time cultures from the aspiration with the assistance of MALDI-TOF MS technology were positive for T. bernardiae. Again, no in vitro susceptibility testing was performed. During this evaluation, it was noted that there was persistent drainage from the abscessed area, not previously present, and probably the result of previous aspiration and tract formation from the needle. Incision and drainage, washout, polyethylene exchange, head exchange, along with placement of antibiotic beads were considered and offered to the patient. The patient was amenable to the plan, and underwent outpatient surgery 8 days after initial presentation to the emergency department. During surgery, there was no fluid from the wound, no abscess was appreciated, and the prosthesis was found to be without defect or effusion. The decision was made to leave the prosthesis in place. Three litres of pulse lavage was performed and Stimulan® beads (Biocomposites Inc., 700 Military Cutoff Road, Suite 320, Wilmington, NC 28405, USA) with vancomycin were placed into made tracks. Surgical cultures were obtained by swabbing fatty and soft tissue around the prosthesis. For an additional 2 weeks post-surgery, the patient had continued drainage without erythema or pain, soaking through pressure dressings ().\nFour weeks after the incision and drainage, the patient was then referred by the orthopedic surgeon to a plastic surgeon and wound specialist who also observed continuous serosanguinous fluid drainage, thought to be from a seroma rather than a deep space infection. Sharp excisional debridement and wound VAC placement was recommended and was performed 2.5 months after the initial emergency department visit, with additional cultures taken. Isolates returned positive as the same organisms from the original visit to the emergency department, using similar identification methods. An infectious disease specialist was then consulted and it was felt that, as the infection probably extended up to the prosthetic joint, the infection should be treated aggressively with intravenous antibiotics followed by chronic suppressive antibiotics. The patient agreed, and a peripherally inserted central catheter line was placed for 6 weeks of intravenous ceftriaxone. The patient has been symptom free since completion of treatment and his wound has been healing well. He has been placed on chronic suppressive cefadroxil with a plan to continue for at least 1–2 years.
An 11-month-old female infant presented to our Paediatric Emergency Department (PED) with a 10-day history of metallic cough and intermittent fever. These symptoms were complicated by progressive dysphagia and episodes of mucus regurgitation accompanied by choking and dyspnoea in the last few days before admission. The symptoms started at the end of the flu epidemic season. Therefore, she was initially diagnosed by a general practitioner with a respiratory tract infection and treated with a 7-day course of antibiotics and a short-course of corticosteroids without any relief. During this course, she developed progressive dysphagia, initially for solid food, and then also for liquid food. In the last few days before admission, her parents reported nocturnal regurgitation of thick mucus followed by choking and dyspnoea. At the moment of admission to the PED, the patient was in a fair general condition, apyretic, and without any apparent signs of respiratory distress, but she had drooling and refused food intake. During a physical examination, she suddenly presented with an abrupt onset of coughing with a metallic sound and regurgitation of thick saliva and mucus. Pulse and oxygen saturation levels were within the normal range, while a thoracic examination showed bilateral rhonchi.\nTherefore, chest radiography was performed and it showed a radiopaque OFB (). To better characterize the location of the OFB and its anatomical relationship with adjacent tissues, a chest computed tomography (CT) study was performed (). The CT scan confirmed a radiopaque OFB, which was a 2.5- x 1.5-cm spring with five helixes, and two of them were embedded in the oesophageal mucosa. The OFB appeared to be dislocated in the proximal oesophagus, and projected at the level of the thoracic vertebrae T2–T3 and leaned on the aortic arch. Cranially, the oesophagus appeared to be patent. No active parenchymal lesion or pleural effusion was found. Unfortunately, the presence of many artefacts did not allow study of the tracheal wall.\nThe patient was then referred to the Paediatric Anaesthesiology and Surgery Unit of a tertiary level PED. She underwent a rigid and then flexible oesophagoscopy, which showed considerable granulation tissue inside the spring (). Because of proximity of the spring to the aorta, consultation of a vascular and heart surgeon was requested during the procedure. The first attempt of endoscopic removal failed. With the aim of preserving the oesophagus and removing the OFB endoscopically, a laparoscopic plier was anchored to the spring and was rotated in the opposite direction of the spiral. This technique enabled successful endoscopic removal at the second attempt (). As expected, the oesophageal mucosa was seriously damaged by the caustic effect of rust. This resulted in oedema and surrounding granulating tissues, as well as almost complete erosion of the oesophageal wall ().\nTotal parenteral nutrition was provided for 2 weeks. The infant was then fed with enteral nutrition through nasogastric tubes and treated with a long-term course of antacids. Because of subsequent oesophageal stenosis, she underwent several endoscopic oesophageal dilations with Savary nasogastric tubes ((Savary-Gilliard dilator; Cook Medical, Bloomington, IN, USA) of increasing size (5-7-9 Ch). She was discharged after 2 months of hospitalization. Currently, after 19 endoscopic oesophageal dilations, she is in good general condition and has obtained acceptable food transit. The patient’s parents provided written informed consent to publish.
A 48-year-old Indian woman was referred to the department of periodontology, with the chief complaint of swollen gums. She felt discomfort with the disfigurement of gums which appeared un esthetic due to its more severity and there was bleeding and difficulty while chewing food.\nPast medical history revealed that she is under medication for hypertension with amlodipine (10 mg/day orally) for the last 2 years and 6 months. The amlodipine dose was increased to 50 mg/day orally and statins were prescribed due to the acute angina attack and hypercholesterolemia before 6 months of the dental visit.\nClinical examination was carried out by assessing the periodontal status by plaque index (PI), gingival index (GI), Russel's periodontal index. The patients oral hygiene status revealed the presence of more amount of plaque and some amount of calculus on both anterior and posterior surfaces of the teeth due to the presence of new niches for accumulation of plaque and microorganisms. There was generalized bleeding on probing and generalized probing depths ranging from 3 to 8 mm with greatest depths in relation to mandibular anteriors. Due to the outward enlargement of gingiva, there were no deep periodontal pockets.\nIntraorally, there was generalized GO on the labial and lingual/palatal surface of the maxillary and mandibular teeth, which was more pronounced in the labial surfaces than the lingual and palatal surfaces. The interdental papillae were enlarged, fibrous, and lobulated in appearance mainly around the mandibular and maxillary anterior teeth [].\nIn this case report, photographic analysis by Ellis and Seymour was used for assessing the gingival encroachment or overgrowth on adjacent surfaces for a gingival unit (0 = no encroachment of interdental papilla on tooth surface, 1 = mild encroachment producing a blunted papilla tip, 2 = moderate encroachment involving lateral spread of papilla across buccal tooth surface of less than one quarter tooth width, 3 = marked encroachment of papilla, more than One-fourth tooth width with loss of interdental papilla form).[] In this case report, score 3 severity of gingival enlargement was observed.\nGrade III mobility was observed in relation to mandibular anteriors. Generalized reddish color, purulent discharge in relation to mandibular anteriors and generalized bleeding on probing were observed due to the generalized inflammation of gingiva. Radiographic examination revealed generalized horizontal bone loss with more destruction of bone in relation to maxillary and mandibular anterior region [].\nBlood sample was taken at the patients first visit to the dental hospital. Serum total CHO, HDL, low density lipoprotein (LDL), and triglycerides (TG) were determined by autoanalyzer in the clinical laboratory.\nSeveral methods have been employed for the detection of putative periodontal pathogens in subgingival samples to identify the microbiologic profile of periodontitis. Here we had chosen a genetic microbiologic test to identify microbiologic profile in amlodipine induced gingival enlargement with CVD.\nA paper point made of cellulose is introduced into the deep periodontal pocket. After 10 s, the point is withdrawn and placed in a RNA stabilizer buffer and sent for hybridization []. The IAI Pado Test 4.5 (IAI ESCHENWEG 6. CH-4528 ZUCHWIL/SWITZERLAND) which is a genetic test used in this case study allowed for the identification and quantification of bacteria which have a preponderant pathogenic role in periodontitis.\nThe IAI Pado Test 4.5 is a biologic molecular test which allowed the identification and quantification. The specific periodontal pathogens like Aggregatibacter actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg), Tannerella forsythia (Tf), and Treponema denticola (Td) were identified by this test.\nBiopsy was taken during the surgical phase and sent to the laboratory. It revealed mixture of dense and loose fibrous components with the chronic inflammatory cell infiltrate in the connective tissue and elongation of rete pegs in the epithelium. On the basis of patient's history, clinical features, laboratory investigations for lipid profile, microbiologic profile, and biopsy reports, a diagnosis of amlodipine induced GO in a patient with CVD was made.
A 36-year-old Caucasian male presented to the emergency room complaining of a one-day history of abdominal pain. His main symptoms were that of nausea and vomiting, but he also reported periods of diarrhea. In the emergency room, his initial evaluation was significant for lab studies demonstrating a mild metabolic acidosis with a bicarb of 16.6 mEq/L, an elevation of his creatinine to 1.93 mg/dL, and a serum lactate level of 5.4 mmol/L. A computed tomography (CT) scan of the abdomen and pelvis was obtained and reviewed. The appendix was thought to be normal. There was no evidence of free intraperitoneal air, abscess, or volvulus. There did appear to be evidence of enterocolitis involving the ilium, cecum, and the proximal ascending colon. There was no evidence of pneumatosis or obstruction. Over the course of 12 hours the patient underwent conservative medical management, which included intravenous hydration, intravenous steroids, Toradol and Dilaudid for pain management, and the occasional dose of Ativan for agitation. Failure of conservative management along with medical decline lead to an exploratory laparotomy with a right hemicolectomy for an ileocolic intestinal infarction. Postoperative repeat CT scan of the abdomen incidentally showed pulmonary nodules in the lower lobe. A CT scan of the chest was then obtained, which revealed air in the left chest wall and axilla (Figure ). On physical exam there was very subtle mottling of the left shoulder. The patient was emergently taken back to the OR for further exploration of the shoulder with excisional debridement. Seropurulent fluid and extensive subcutaneous emphysema along the fascial planes of the left chest wall were consistent with necrotizing fasciitis. Both wounds were packed with a gauze bandage roll soaked in saline and then the patient was transferred back to the intensive care unit.\nOver the course of 15 days the patient underwent repeat trips to the OR for re-exploration, incision and drainage of the wounds, and dressing changes (Table ). On postoperative day 17, the wound, ostomy, continence nurse (WOCN) was consulted to evaluate the wound and make treatment recommendations.\nOn exam, there was still a significant amount of nonviable tissue in the base of the left chest and axilla wound. The left chest wound measured 8 x 19 x 8 cm and the left axilla wound measured 6.5 x 25 x 4 cm. NPWTi-d with ROCF-CC was applied to these wounds to aid in the removal of the nonviable tissue. Figures - show the presentation of the wounds prior to the application of the NPWTi-d with ROCF-CC.\nDuring the application of the NPWTi-d with ROCF-CC, care was taken to ensure that the contact layer of the dressing was in contact with the entire wound base. Barrier rings were applied to the skin creases along with any area that presented as a high risk for inadequate seal of the drape (Figure ). The therapy settings for the left axilla were 85 ml of hypochlorous acid solution (Vashe®, SteadMed, Fort Worth, TX), dwell time of 10 minutes with NPWT every hour at -125 mmHg. Therapy settings for the left chest wound were 50 ml of hypochlorous acid solution, dwell time of 10 minutes with NPWT every hour at -125 mmHg.\nDuring the first dressing change after the application of the NPWTi-d with ROCF-CC, there were notable improvements in the quality of the tissue in the wound bed (Figure ). The left chest wound bed was noted to have 100% red healthy tissue and the left axilla wound bed had a decrease in nonviable tissue. There was, however, seropurulent drainage noted deep within the intramuscular structures of the left axilla wound.\nNPWTi-d with ROCF-CC was reapplied to the axilla wound ensuring that the contact layer was placed deep into the wound bed to facilitate the removal of the seropurulent drainage. The left chest wound was transitioned to NPWTi-d to continue to promote granulation tissue (Figure ). The instillation solution was switched to normal saline due to blockage alarms we encountered with the hypochlorous acid solution without resolution.\nThe current treatment regimen was continued for two days until the next dressing change. At that time both wound bases were 100% red with granulation tissue present (Figure ). The seropurulent drainage deep in the intramuscular structures was no longer present. Since there was adequate removal of nonviable tissue and the quality of the tissue had significantly improved, the WOCN made the decision to transition both wounds to NPWTi-d instilling normal saline solution with a dwell time of 10 minutes and NPWT every two hours at -125 mmHg.\nFor the next two weeks the treatment regimen utilizing NPWTi-d to the wounds continued. The dressings were changed three times a week at the bedside by the WOCN. During initial assessment, the axilla wound measured in total volume 650 cm³ and the chest wound measured 1,216 cm³. After 17 days utilizing the combination of NPWTi-d with and without ROCF-CC, the axilla wound measured in total volume 342.25 cm³ and the chest wound measured 554.4 cm³. This presents a significant decrease in overall measurements. At this time, NPWTi-d was discontinued and standard NPWT with black granufoam was utilized to both wounds at -125 mmHg (Figures -).\nNPWT was utilized for approximately a month to promote granulation tissue and assist with wound contraction (Figures -). Once the wound had made vast improvements, NPWT was discontinued and a non-adherent antimicrobial alginate dressing (Silvercel™ Non-adherent, Acelity, San Antonio, TX) was lightly packed into the wound bed and covered with a dry sterile dressing. This dressing was then changed three times a week by a visiting nurse association. The wound measurements prior to discharge showed significant improvement in comparison to the wound measurement at presentation, with the left axilla wound measuring 1.5 x 10.5 x 0.3 cm and the left chest wound measuring 3.5 x 9 x 5 cm.
A 7-year-old Syrian boy with war-related burn injury was referred to our hospital for reconstructive surgery for burn scars and contractures on his face, neck, and body. A consultation with anesthesia department was held by plastic and reconstructive surgery clinic for the preanesthesia evaluation. Patient was conscious and oriented on examination. He had severe scar contractures involving neck, face, anterior chest, and both shoulders leading to restricted mouth opening, no neck extension, and stooped posture with chin and chest fused together by scars and the neck and head contracted in flexed position. The width from upper incisor to lower teeth was approximately 15 mm and Mallampati class was 3, while thyromental and sternomental distance could not be evaluated due to neck and head being contracted in flexed position. Cardiac, thoracic, and laboratory investigations revealed normal findings. Detailed history of the patient obtained from the parents by the help of a translator revealed that the child had been posted for the reconstructive surgery in another university hospital, while the operation was cancelled due to failure to maintain mask ventilation even after pain relief and induction of anesthesia. The previous anesthesiologist had given two attempts after induction of anesthesia but failed at intubation. Then child was awakened. The day after, he was transferred to our hospital for difficult airway approach and the operation. Awake FFB nasal intubation was planned because of the past history of “cannot intubate and cannot oxygenate” scenario. The necessity and details of the procedure were explained to the patient and his family by the help of a translator. After a 6-hour fasting period, the patient was admitted to our intensive care unit (ICU), accompanied by a family member and translator. Following the routine (NIBP, HR, StO2) monitorization (Nihon Kohden, Japan), patient has been informed again about the details and steps of the procedure with the help of the translator. Premedication and sedation were not applied because of the patient's status. During the initial trial phase, nasal drop of xylometazoline 0.1% was instilled for vasoconstriction in both nostrils. Three puffs of 10% lidocaine were implemented for topical anesthesia. Through a nasal cannula, oxygen was administered at 5 L/min through the left side. Tip of the fiberoptic bronchoscope (FOB, 2.8 mm, Karl Storz-Endoskope, Germany) was inserted into the contralateral nostril. Endoscopy was performed. When the vocal cords were visible, the trial procedure was ended. It was explained to the patient and his family that the same procedure would be repeated on the day of surgery as followed by intubation and induction of general anesthesia. On the day of operation, two days after the initial trial, patient was taken to the surgery room and monitored (Infinity Delta Dräger, Lübeck, Germany) routinely (NIBP, HR, SatO2). A nasal drop of xylometazoline 0.1% was instilled for vasoconstriction. Three puffs of 10% lidocaine spray were implemented for topical anesthesia. It directly sprayed onto the mucosa of the mouth, pharynx, and tongue. Through a nasal cannula, oxygen was administered at 5 L/min through the left nostril. Endoscopy was performed through the right nostril. Two ml of 2% lignocaine was sprayed through the FOB on to the glottis after the vocal cords were seen. The FOB's tip was then passed into the trachea through the laryngeal opening and was stopped just above the carina. Lubricated 5.0 nasotracheal tube was railroaded over the FOB. After three ventilations, position of nasotracheal tube was confirmed by the FOB. Successful tracheal intubation had been achieved while maintaining spontaneous ventilation and was monitored by capnography. Propofol, fentanyl, and rocuronium were used for induction of general anesthesia via intravenous route and maintained with remifentanil 0.1 μg/kg/min and sevoflurane in oxygen (Primus workstation Dräger, Lübeck, Germany). The operation lasted for approximately four hours. The contractures on neck and left axilla were released and graft was placed. The intraoperative course was uneventful. The patient was extubated after complete recovery of consciousness, adequate spontaneous breathing, preventive reflex, and muscle strength [] ().
A 6 month old Sudanese female infant with a clinical diagnosis of Crigler Najjar Syndrome Type 1 (CN1) was referred for consideration of liver transplant. She was born to second degree consanguineous parents. The pregnancy was uncomplicated and she was delivered at term by lower segment caesarean section weighing 2.5 Kg. She was noticed to be jaundiced at birth and phototherapy was initiated. The diagnosis of CN1 became apparent in a couple of weeks in view of persistent unconjugated Hyperbilirubinemia. Her unconjugated bilirubin ranged between 20 and 25 mg/dl, with conjugated fraction of less than 0.6 mg/dl. There was no evidence of haemolysis or liver dysfunction. The infant was exclusively breast fed and was developing appropriately for her age. The child was receiving home phototherapy every day at the time of referral. After admitting into our hospital we put her on standard 10 to 12 h of phototherapy every day.\nClinical examination revealed her to be icteric with normal systemic examination. Her weight and height were 6.9 kg and 65 cms respectively, both at 50 centile. Her development and neurology was appropriate for age. Apart from elevated unconjugated bilirubin, she had unremarkable full blood count, liver transaminases, coagulation profile, serum albumin and liver radio imaging(We performed liver ultrasound Doppler and CT abdomen with contrast as per the protocol).\nStandard procedures were employed to obtain genomic DNA from the index case and her parents. The promoter region and all the five coding exons with the intron exon boundaries were PCR amplified. All the PCR products were purified and Sanger sequenced. Bidirectional sequencing was carried out and subjected to sequence analysis. PCR conditions and primer pair details are presented in Table .\nA detailed pedigree of the family was recorded (Fig. ). Our patient was born to second degree consanguineous parents and there was no other case of CN1 reported in all the three generations. UGT1A1 full gene analysis was performed using polymerase chain reaction (PCR) followed by Sanger DNA sequencing. Molecular analysis revealed a normal wild type TATA box (A(TA)6TAA)sequence in our patient and her parents (Fig. ). Further analysis of the exon-intron boundaries in the patient revealed a novel homozygous 22 bp duplication (c.55_76dup) in the coding region of the Exon1 (Fig. ). This 22 bp duplication causes a frame shift leading to a premature stop codon resulting in a truncated 62 amino acids protein. Both parents of the patient were heterozygous for the 22 bp (c.55_76dup) duplication, indicating a clear recessive pattern of inheritance. No mutations were detected in the other coding exons.\nOur patient subsequently received a living related left lateral liver segment from her father. She had a smooth intraoperative period and her postoperative period was unremarkable except for 2 episodes of biopsy proven acute cellular rejection which responded to steroids. Her immunosuppression was performed with Tacrolimus, Mycophenolate mofetil and low dose steroids. Post transplantation bilirubin levels normalized, unconjugated bilirubin levels were found to be 0.8 mg/dL and conjugated bilirubin was 0.3 mg/dL. Post-surgical monitoring of the infant was done with shared care between our team of doctors and Sudanese doctors who took care of her locally. She periodically got blood tests done with immunosuppression levels which are sent to us electronically for advice. She is currently well at 1 year follow up.
A 24-year-old woman from a Middle Eastern country presented to the Jefferson Pancreas, Biliary and Related Cancer Center for evaluation of a recurrent pancreatic mass. She complained of right upper quadrant fullness, and physical examination revealed a remote right subcostal incision. At the age of 12 years, she had first developed decreased appetite, weight loss, fatigue, pruritus, and subsequently became jaundiced. Medical records from that episode revealed that an endoscopic biliary stent was placed with surgical exploration through a right subcostal incision and partial resection/enucleation of a pancreatic mass. In the intervening 12 years, the mass had persisted and enlarged, although the patient was asymptomatic, having neither anorexia, pruritus, nor jaundice.\nRoutine hematology and basic chemistry panels were normal. The tumor marker cancer antigen 19-9 was mildly elevated at 89 U/mL (<35 U/mL). An abdominal computed tomography (CT) scan with contrast revealed an 8.2 × 7.6 cm heterogeneous-enhancing lesion, prominently involving the uncinate process of the pancreas (). The pancreatic head and neck were displaced and splayed around the anterior aspect of the tumor. The mass abutted the superior mesenteric vein (SMV) as well as the superior mesenteric artery (SMA). There was no evidence of main pancreatic ductal dilatation and the pancreatic neck, body, and tail were normal. Imaging showed no evidence of metastatic disease to the liver or regional lymph nodes. The mass was believed to be an SPT, based on the previous partial resection and the accompanying pathology report.\nThe patient underwent an open cholecystectomy and a difficult classic pancreaticoduodenectomy. The operative time was 12 h and the estimated intraoperative blood loss was 1500 mL. There was no evidence of metastasis, but the tumor had adhered extensively to the SMV and portal vein and surrounded the SMA. We were able to accomplish the separation of the tumor from the venous structures without incident; however, separating the tumor from the SMA proved challenging. At one point, the SMA was transected due to adherence of the tumor. The SMA was subsequently reapproximated in an end-to-end manner with good arterial Doppler signals distal to the anastomosis.\nPathological analysis of the surgical specimen revealed the tumor to be a solid pseudopapillary neoplasm (). All surgical margins were free of neoplasia and all harvested regional lymph nodes showed only follicular lymphoid hyperplasia, with no evidence of granulomas or neoplasia. Immunohistochemical stains of the specimen were positive for CD56, CD10, and vimentin, with the neoplastic cells showing strong diffuse nuclear and cytoplasmic staining for β-catenin and weak diffuse staining for synaptophysin. The neoplastic cells were negative for chromogranin A, trypsin, AE1/AE3, and E-cadherin. Molecular genetic analysis was negative for the MYB gene deletion.\nOn the first postoperative day, the patient had a small amount of bile visible in the operatively placed drains, she was fluid seeking, and her abdomen was somewhat distended. Due to the suspicion of a vascular insult related to the SMA reconstruction, an abdominal CT with intravenous contrast was obtained and revealed an intraluminal thrombus in the proximal SMA, ∼1.5 cm from its origin off the aorta, causing near complete occlusion of the SMA (). She was therefore returned to the operating room where the proximal jejunum appeared ischemic. We performed an SMA embolectomy and repaired a leak at her hepaticojejunostomy through reconstruction of the biliary-enteric anastomosis. She tolerated the reoperation well and improved nicely.\nOn the fourth postoperative day, an upper gastrointestinal series with water-soluble contrast instilled into the stomach through a nasogastric tube revealed no contrast extravasation, and both the afferent and efferent limbs of the duodenojejunostomy were grossly patent.\nThe patient and her family were instructed on the home management of the large abdominal incision and superficial wound infection. Healing occurred over the next 4 months. Telehealth monitoring was used by our nursing experts to communicate with the patient on a regular basis, with mobile phone images documenting the status of the wound.\nShe returned to Philadelphia for a follow-up visit after 6 months. At that time, the patient appeared well, her wound was completely healed, and an abdominal CT scan with contrast showed normal after pancreaticoduodenectomy anatomy, without any evidence of recurrent or persistent tumor.
A 26 year-old man was identified to donate marrow for his brother. His height was 178 cm and his weight was 79.2 kg (Body mass index 25.0). He had no bleeding history or other medical problem. Bone marrow harvesting was performed under spinal anesthesia []. The patient was put in the prone position, and the bony landmarks of the posterior iliac crest and sacroiliac joint were palpated for the identification of a proper puncture site (Fig. ). Aspiration trocar and needle were pushed through the skin and subcutaneous tissue to the posterior iliac crest, and the cortical bone was punctured. Bone marrow aspiration was performed after positioning the needle tip within the cortical wall of the posterior crest []. There was no repositioing of the needle. The total surgery time was 62 min. A total of 900 cc of bone marrow(450 cc per site) was collected which yielded 1.46 × 108 CD34-positive cells from the two puncture sites shown in Fig. . No special problems occurred during the procedure. The donor was hospitalized one more day after bone marrow harvesting to check complications and to control the pain. There was no evidence of hematoma on the puncture sites. While in hospital, he suffered mild pelvic pain which had responded to an oral non-steroidal anti-inflammatory drug (NSAID).\nTwo days after the bone marrow harvesting, a pain of tingling and stabbing nature appeared on his left posterior thigh and calf. Pain score was noted at Visual Analogue Scale (VAS) 7 points on resting and aggravated with motion. Allodynia was present. Sensory of all dermatome was intact, and no muscle weakness was present. However, there was gait disturbance due to pain.\nWe conducted a pelvic magnetic resonance image (MRI), nerve conduction study (NCS), and electromyography (EMG) for evaluation. T1 and T2 weighted images of the pelvis magnetic resonance image (MRI) showed patchy edematous change with enhancement in the sacrum, retrosacral muscles, and subcutaneous layer, and the left S2 neural foramen (Fig. a, b). Imaging studies indicated that the left S2 nerve root was injured by mechanical damage when the puncture needle was inserted and that the nerve irritation and inflammation were the cause of the patient’s symptoms [, ].\nAfter 1 month since the pain developed, nerve conduction study (NCS) and electromyography (EMG) were performed. Nerve conduction study (NCS) revealed normal velocity and amplitude of the common peroneal nerve, tibial nerve, sural nerve, and superficial peroneal nerve. Hoffmann reflex, pudendal evoked potential were within normal limits. Electromyography (EMG) showed abnormal spontaneous activities, which are denervation potentials, in the S2-innervated intrinsic foot muscles and the S1-S2 nerve root innervated muscles such as the soleus, gastrocnemius, and lumbar paraspinalis muscle (Table ) [–]. The amplitude of the abnormal spontaneous activities were about 100 μV, indicating that the development of muscle membrane instability following neural injury occurred within 1 month [] (Fig. ). Electrodiagnostic results along with the patient’s clinical presentation and MRI findings led us to a diagnosis of left S2 radiculopathy.\nThe patient took pregabalin 75 mg two times per day to control the pain, and after 3 months of medication, the patient’s pain improved from VAS 7 to 5 []. A follow up nerve conduction study (NCS), electromyography (EMG) and pelvic magnetic resonance image (MRI) were performed 3 months after onset. Consistently, nerve conduction study (NCS) and Hoffmann reflex were within normal limits, and abnormal spontaneous activities were observed in S2 nerve root innervated muscles. In the pelvic magnetic resonance image (MRI), little residual enhancement was still present along the left S2 nerve root (Fig. c, d).\nAt 6 month follow up, visual analogue scale (VAS) further improved to VAS 3, and electromyography (EMG) showed motor unit action potentials (MUAPs) of re-innervation pattern instead of abnormal spontaneous activities, indicating recovery state (Table , Fig. ). The patient took pregabalin for a total of 8 months. After that, the patient stopped medication. One year later, the patient’s pain was reduced to a level that was not inconvenient, and we did not prescribe any further medication. Additional nerve conduction study (NCS), electromyography (EMG), and magnetic resonance image (MRI) were not performed.
We described the clinical course of a 64-year-old Chinese man who was admitted to the hospital with septicemia and necrotic soft tissue inflammation of the right lower limb.\nFourteen days prior, a 64-year-old man, whose only known comorbidity was diabetes mellitus history, sought medical attention at another institution. He presented with pain, swollen, deformity of the right leg caused by falling from a height without any open trauma or neurovascular problem. The comminuted tibia fracture was confirmed with radiographs of the affected leg. Approximately 8 days after the injury, he underwent an uncomplicated routine MIPO surgery of the tibia fracture (Fig. ), when the blood glucose levels near normal and the swelling subsided. And the patient as usual received a single dose of cefazolin preoperatively for a prophylactic antibiotic coverage.\nOn the second postoperative day, the patient had fever as well as pain and redness around the distal operative incision of the leg, despite postoperative antibiotics (cefazolin) were used for prevention. More seriously, the incision started discharge of foul-smelling white exudate the following day. Cellulitis was initially suspected, the sutured wound was opened immediately, and intravenous antibiotic (cefmenoxime) therapy was given empirically. However, the erythema, edema, and then serous-filled bulla progressed to the right proximal leg and distal foot over a 12-hour period. The patient was promptly taken to the operating room for emergency exploratory operation the same day; soft tissue necrosis and pus accumulation beneath the fascia were discovered when the leg was opened. And the patient underwent debridement of the right leg and foot without involving the thigh. On the second day of debridement surgery, the leg infection progressed, with the erythema extending to the distal portion of the right thigh.\nThe patient was then transported to our unit, which was the level-I trauma center in our region, 4 hours after the sudden onset of excruciating painful swelling in the right thigh and right inguinal area in association with generalized malaise and profound weakness in another institution. On admission to our emergency department, the patient had a temperature of 37.8°C, a blood pressure of 90/45 mm Hg, a pulse rate of 134 beats per minute, and a respiratory rate of 32 breaths per minute. Physical examination of the lower limb showed the erythema and swelling progressed to involve the right inguinal area and the scrotum. The right leg, which was cold, cyanotic, and with a pulse absent in the dorsal artery of the foot, was detected with crepitus and sensory and motor deficits. There was a large area cutaneous deficiency on the right foot, which was caused by first debridement, and desquamation from the derma was noticed on the medial aspect of the right ankle (Fig. ). Laboratory abnormal findings included a hemoglobin level of 69.10 g/L, and a white blood cell count of 2.99 × 109/L with 81.71% neutrophils; a platelet count of 34 × 109/L; a serum potassium level of 5.33 mmol/L; serum creatinine 94.50 μmol/L; a serum urea nitrogen level of 10.73 mmol/L; and a serum glucose level of 19.38 mmol/L. In addition, evolving disseminated intravascular coagulation (prothrombin time 20.70 s, international normalized ratio 1.86, D-dimer level 1.02 mg/L, etc.) and a serum sodium level of 126 mmol /L indicated a NF. As we did not detect the result of C-reactive protein in the emergency room, the laboratory risk indicator for necrotizing fasciitis (LRINEC) score may be 5 or greater. No radiographs, computed tomography, or magnetic resonance imaging were obtained upon presentation because of the hemodynamic instability.\nA tentative diagnosis of NF with septic shock was made, and vancomycin and meropenem were given intravenously on an empirical basis. Urgent consultation of doctors including multidisciplinary reached a consensus that emergency amputation must be considered for saving life. Immediately, the patient was transferred to the operating room. Nevertheless, the patient's condition deteriorated rapidly and he died of septic shock and multiple organ failure before surgery can take place. And further investigation of the thigh in the operating room showed prominent skin blistering and bloody bulla with partial necrosis 3 hours after admission (Fig. ). Histological examination of the surgical specimens confirmed the diagnosis of NF by showing necrosis of superficial fascia and subcutaneous fat, with dense infiltration of leucocytes and thrombosis of cutaneous vessels (Fig. ). Additionally, cultures of surgical specimens verified the pathogen to be Staphylococcus aureus, which was sensitive to methicillin.
A 37-year-old Caucasian male with a known history of aplastic anemia (AA), presented to a rural hospital after a ground level fall. AA was diagnosed 10 months earlier after he was investigated for pancytopenia. A bone marrow biopsy showed cellularity of only 10% and the presence of a small paroxysmal nocturnal hemoglobinuria clone (less than 0.2%). He received standard combination treatment for AA with cyclosporine 225 mg orally twice daily, horse anti-thymocyte globulin (ATG) 40 mg/kg daily for 4 consecutive days, and prednisone 1 mg/kg daily. His other medications included daily Pantoloc 40 mg orally, daily Valtrex 500 mg orally, and daily Dapsone 50 mg orally for Pneumocystis jirovecii prophylaxis due to a reported allergy to trimethoprim/sulfamethoxazole. He had recently quit smoking and denied alcohol use but actively used other recreational drugs, including marijuana, cocaine, and methamphetamine. He was unemployed. He had no known other medical co-morbidities and was taking no other medications prior to developing AA. The etiology of AA was felt to be idiopathic because he had no improvement after an initial trial of sobriety. AA improved following immunosuppressive therapy and, although human leukocyte antigen typing was performed, a subsequent bone marrow transplant was deferred not only because of the medical therapeutic response but also due to his ongoing recreational drug use. Although he was no longer transfusion dependent a month after starting immunosuppressive therapy, his treatment compliance waned overtime due to regular ongoing recreational drug use of cocaine and methamphetamines. He routinely used unsterilized tap water for illicit drug injections, but he denied other exposure to fresh or salt water sources at home or in the community.\nOn presentation to the emergency department he was not in distress, with a heart rate of 90 bpm and a blood pressure of 116/59. Severe pallor was noted upon examination, as well as a petechial rash and mild ecchymoses (Fig. ). The rest of his physical assessment was normal, including a neurological examination. Admission bloodwork revealed severe pancytopenia with hemoglobin of 22 g/L, a platelet count of 1 × 109/L, a white blood cell count of 3.7 × 109/L, and an absolute neutrophil count of 0.2 × 109/L (reticulocytes were not sent at admission, but 2 weeks into his hospitalization his absolute reticulocyte count was 12 × 109/L with a reticulocyte percentage of 0.5). All other admission blood work was normal, including liver function tests (total bilirubin 9 μmol/L (reference < 21 μmol/L), alanine aminotransferase 13 μmol/L (reference < 41 μmol/L), alkaline phosphatase 66 U/L (reference 30–130 U/L)) and renal function tests (creatinine 63 μmol/L (reference 59–104 μmol/L), glomerular filtration rate 120 mL/min (reference < 59 mL/min)). He was stabilized and transferred to a tertiary care center where he was restarted on treatment for relapsed AA with a regimen that included cyclosporine (5 mg/kg/day) and prednisone 30 mg daily in addition to five doses of ATG. He remained transfusion dependent throughout his hospitalization.\nOn day 10 after admission, he developed generalized, mild (3/10), colicky abdominal pain with an associated fever > 38.5 °C. He was started empirically on piperacillin-tazobactam (PTZ) 3.375 gm intravenously every 6 hours. Two sets of blood cultures, each consisting of an anaerobic and aerobic BacT/Alert bottle (bioMérieux, Laval, Quebec), were collected peripherally and from his central line. E. coli grew in each bottle set at 10 and 11 hours, respectively. He then developed watery, non-bloody bowel movements, 3–4 times a day, associated with rectal pain. Real-time PCR for Clostridium difficile A/B toxin on a stool sample was negative. Computerized tomography of the abdomen and pelvis was also unremarkable. Repeat blood cultures were negative at 24 and 48 hours after the initial positive set. He improved dramatically after 7 days of intravenous PTZ and was stepped down to oral ciprofloxacin 500 mg orally twice daily to complete a further 7 days of therapy.\nOn day 19 of admission he developed acute continuous severe (9/10), non-radiating dull rectal pain, associated with a high-grade fever (40.4 °C). Vancomycin 1.5 g intravenously every 12 hours and metronidazole 500 mg orally twice daily were empirically started and ciprofloxacin was continued in the same dosage. Blood cultures that were collected from peripheral venipuncture and a peripherally inserted central catheter line grew A. hydrophila at 11 hours. The peripherally inserted central catheter line was immediately removed the next day (day 20 after admission). The same day he also began to complain of vague, mild, bilateral leg pain. Delayed serum sickness due to recent ATG administration was considered a possible cause for his new symptoms because clinical examination did not show erythema, edema, or deformities on either of his legs. However, sustained bacteremia was diagnosed by recovery of A. hydrophila from repeat blood cultures (i.e., one anaerobic and aerobic bottle set from two peripheral venipunctures) positive after 11 and 16 hours of incubation. Bilateral leg pain steadily worsened in intensity (10/10) over the next 48 hours, and the area of distribution of pain extended to the lateral aspect of the right thigh although physical examination remained unremarkable. Creatinine kinase was increased at 470 U/L (normal range for males, 0–195 U/L). Ultrasound venous Doppler of both legs also showed no evidence of deep venous thrombosis. However, magnetic resonance images of both legs showed extensive bilateral patchy multi-compartment muscular and fascial inflammatory changes highly concerning for NF (Fig. , ).\nUrgent initial surgical debridement was performed that evening. An extensive four-compartment fasciotomy, debridement, and myomectomy were performed on both legs. Extensive ‘dishwater’ purulent material was found in multiple compartments of both legs, including (1) the superficial posterior compartment between the gastrocnemius and soleus muscles, and (2) the lateral deep compartment. There was also clinical evidence of severe muscle necrosis of the tibialis anterior muscles in the anterior compartment of both legs. He was admitted to the Intensive Care Unit post-operatively. After consultation with the Infectious Diseases service and review of the antibiotic susceptibility profile of the previously isolated A. hydrophila strain, antibiotics were changed to meropenem 1000 mg intravenously every 8 hours and clindamycin 600 mg intravenously every 8 hours. High dose intravenous immunoglobulin (2 g/kg) was also given. All prior antibiotics were discontinued.\nGram stain of tissue samples from the right tibialis anterior muscle showed no neutrophils but that gram-negative bacilli were present, and subsequently grew a heavy amount of A. hydrophila. Gram stain and anaerobic culture from the right vastis lateralis muscle also did not show the presence of neutrophils or organisms but grew scant amounts of A. hydrophila. A genus-level identification as Aeromonas was obtained for all isolates from blood and tissue samples by matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry using a VITEK MS (bioMérieux, Laval, Quebec, Canada); since this technique has an accuracy of identification rate of 80–90% for species-level identification of Aeromonas [], all isolates were also analyzed using in-house bi-directional 16S rRNA gene cycle sequencing of the V1-V3 (approximately first 500 bp), as previously described []. Broth microdilution susceptibility panel testing was performed and interpreted using published guidelines []. All isolates were multidrug resistant to ampicillin, ceftriaxone, ciprofloxacin, and trimethoprim/sulfamethoxazole but susceptible to meropenem and tetracycline. The isolates were confirmed to produce an extended-spectrum β-lactamase (ESBL) using published guidelines and the Mast Disc Test (Mast Group Ltd., Merseyside, UK) []. Production of an AmpC β-lactamase was shown by resistance to cefoxitin disk (30 μg) testing and the Mast Disc test (Mast Group Ltd.).\nTwo additional extensive surgical procedures for removal of necrotic tissue from both legs were undertaken in the next 24 hours. Bilateral above-knee amputations were performed during the last debridement as a life-saving measure because of extensive rapid progression of bilateral leg necrosis, and the patient’s rapid clinical deterioration with severe unremittent hemodynamic instability during the operation. Post-operatively, he required aggressive resuscitation for septic shock in the Intensive Care Unit with intractable hyperkalemia and severe acidosis, and anuric acute kidney failure (creatinine 210 μmol/L; normal range for males, 50–120 μmol/L). Despite all therapeutic interventions, the patient went into cardiac arrest and passed away within 2 hours after the final surgery.\nPost-mortem examination at autopsy revealed findings related to the underlying AA, and evidence of septic shock secondary to extensive bilateral lower limb necrotizing myofasciitis. The bone marrow was markedly hypocellular and there was splenic enlargement at 331 g. The heart was enlarged (536 g). Cardiomegaly was likely a compensatory response to the AA due to the absence of atherosclerotic and hypertensive cardiovascular disease. In keeping with the patient’s severe septic shock, there was marked centrilobular necrosis of the liver, as well as petechial hemorrhages of the skin, heart, pleural surfaces, kidneys, and liver capsule. Histologic examination of skin and muscle from the left thigh showed necrosis of the muscle and deep subcutaneous adipose tissue, admixed with dense collections of gram-negative bacilli (Fig. , ). However, in keeping with the AA, there was notably an absence of an acute inflammatory response.
A 48-year-old woman, gravida 1, para 1, visited the internal medicine department at another hospital with a complaint of abdominal fullness and weight loss of 10kg during the last year. A huge abdominal mass was palpated, and she was referred to the gynecology department to search for a tumor of uterine origin. She was premenopausal and had no significant past medical history. Physical findings revealed a large elastic hard mass extending from the xiphoid to the pubic bone. The magnetic resonance imaging (MRI) examination revealed a huge tumor on the uterine corpus, and a number of dilated vessels were observed between the tumor and the myometrium. Therefore, the tumor was suspected to derive from the uterus. The tumor showed an uneven signal on T2-weighted sagittal section (), and the enhanced MRI study showed that the tumor edge but not the center was enhanced (). As such, necrosis was suspected to have occurred in the center of the tumor. Uterine sarcoma was primarily suspected due to the large size, degeneration, and necrosis on MRI imaging. Computed tomography (CT) examination showed no lymph node swelling or distant metastasis. Preoperative laboratory testing revealed anemia (hemoglobin level, 5.6g/dl). We transfused 18 units of RCC before surgery. CT examination and ultrasonography on lower extremities indicated an absence of thrombosis. Preoperative serum levels of CEA, CA 19-9, CA 125, and LDH were within normal limits. A biopsy of the endometrium was not collected as the sounding examination of the endometrium was unsuccessful due to a deviated uterine cervix. At this point, preoperatively, we suspected the tumor was a leiomyosarcoma or leiomyoma with degeneration.\nThe patient underwent laparotomy, where we identified a huge tumor occupying a space from the pelvis to the diaphragm. The tumor surface was smooth and hard with many dilated veins (). A massive tumor with a diameter of 30 cm was observed arising from the posterior uterine wall with a smooth contour and invaded the retroperitoneal cavity under the mesentery. The tumor was firmly adhered to both the mesentery and right ovary. There were no findings of extra-uterine dissemination. The intraoperative frozen section report for the uterine tumor was of degenerated myoma with no findings indicating malignancy. A total abdominal hysterectomy (TAH) and right salpingo-oophorectomy (RSO) were performed. The operation duration and blood loss were approximately 216 minutes and 1000 ml, respectively. The excised specimen weighed 7600 g.\nMacroscopic findings of the tumor revealed a well-circumscribed tumor showing extensive continuity with the posterior wall of the uterus, measuring 28 × 23 cm (). On the sliced surface of the tumor, an obvious heterogeneous pattern was recognized within the mixture of a whitish homogeneous area, suggesting benign uterine fibroids, and a vulnerable area, due to bleeding and necrosis ().\nFor the intraoperative frozen section, we examined three areas, namely, a white homogenous part, a necrotic part, and a cystic part, of which all were findings of a leiomyoma. In the permanent histological examination, 10 additional sections were collected from the tumor. The basic histological findings of all the sections were the same. The tumor was comprised of spindle-shaped cells, homologous to smooth muscle cells, which were arranged in bundles with areas of hyalinization, consistent with a degenerated leiomyoma. The tumor was mostly comprised of degenerated uterine leiomyoma. However, enlarged blood vessels were observed within an area of approximately 2 cm × several mm, and proliferation of atypical cells showing a fine meshwork microvascular structure was observed in the blood vessel cavity (). These atypical cells consisted of various contours, such as cubic, polygonal, and short spindle shape. The nucleus was circular with a high degree of vacuolar enlargement and pleomorphism. Abnormal mitotic figures were also interspersed (). A tumor derived from a blood vessel was thus considered, and malignancy was suggested by the presence of nuclear atypia and abnormal mitosis.\nImmunohistochemical analysis revealed the atypical tumor cells to be positive for ERG, CD31, and AE1/3 (Figures and ), partially positive for Factor VIII, and negative for α-SMA, desmin, H-caldesmon, EMA, CD34, and D2-40. From the above, the atypical tumor cells were of epithelial origin and the final diagnosis was epithelioid angiosarcoma arising in a degenerated uterine leiomyoma.\nThe efficacy of postoperative adjuvant therapy for angiosarcoma has not been demonstrated and there is currently no established chemotherapy regimen. In this case, because the atypical tumor was observed in the blood vessel cavity, we thought it could have been spread hematogenously throughout the body. Hence, we selected adjuvant chemotherapy rather than adjuvant radiotherapy. Six courses of combination adjuvant chemotherapy with paclitaxel (150mg/m2), epirubicin (50mg/m2), and carboplatin (area under the curve = 4) were administered in the present case, following referral to previous reported cases. No recurrence has been observed 10 months after the primary surgery.
We present the case of a 43-year-old man who attended the outpatient service of a Psychiatric Hospital in Mexico, with a nine-month evolution of complex visual and auditory hallucinosis. He presents with bilateral amaurosis, which began insidiously 4 years prior, with no associated triggers and no previous studies to identify the cause. Psychiatric family history was denied.\nHe began his current condition with persistent visual and auditory hallucinosis, with a predominance of the former. He referred seeing his previous partner, from whom he had separated two and a half years prior and whom he had no contact, adding that she visited him at his house, would sit on his bed and talk to him. These episodes lasted several minutes and occurred continuously throughout the day, occurring more frequently in low-light environments. It is worth mentioning that he was fully aware that this phenomenon was not real and he referred to it as part of a disease, however, it caused him discomfort and sometimes agitation.\nAfter the complete vision loss he initiated with depressive symptoms which consisted of sadness, anhedonia, fatigue, weight loss and low self-esteem, later adding recurrent thoughts of death. Family members mentioned that he began with personality changes such as constant irritability, impulsivity and behavioral changes regarding personal hygiene and dressing, lasting weeks without taking a bath, a situation that had never happened before. For this reason, he was taken to a psychiatric evaluation and was hospitalized for diagnosis and treatment, initially admitted with an unspecified non-organic psychotic disorder.\nDuring the initial assessment, an ophthalmological and neurological alteration was found, being unable to perceive light in both eyes, with preserved eye movements, both slightly mydriatic pupils and bilateral hyposmia. The photomotor and the consensual light reflex were conserved, and the accommodation reflex was abolished. The rest of the physical exam was normal. He denied the presence of any specific visual complaint except for the vision loss. He also denied any physical symptoms like headaches, nausea or dizziness. Unfortunately, before his admission, he had not visited an ophthalmologist or neurologist for a check-up regarding the visual loss.\nDuring his stay, the patient continued to present complex visual and auditory hallucinosis, referring that his ex-partner spoke to him and constantly warned him about his health, visiting him frequently in the hospitalization area: “Today I saw her. I was taking a bath and when I closed my eyes she told me to get ready, that something big was going to happen to me. I asked her what and she did not answer… I know that what I see is not real, it is a product of my mind, I know that I am not crazy … “ (sic patient). These symptoms did not ameliorate with the pharmacological treatment, which consisted of 3 mg of risperidone, 50 mg of sertraline and 0.25 mg of alprazolam every 24 h during 4 weeks. No neuropsychological tests were performed during his stay. Laboratory studies did not report abnormalities. The MRI revealed an occupational mass located at the anterior floor level of the skull adjacent to the olfactory groove in contact with the base of the sphenoid, with a mass effect on adjacent structures and significant compression of the optic chiasm, with characteristics suggestive of a benign meningioma (Fig. ). He was referred to the neurosurgery department where a partial tumor resection was carried out by craniotomy with the confirmation of the pathology report of a benign meningioma (WHO Grade I) (Fig. ). After the intervention, he achieved remission of the perception disturbances; however the visual impairment continued, which worsened the depressive symptoms. In addition to an exacerbation on impulsivity and low frustration tolerance, he carried out multiple suicide attempts, thus requiring six subsequent psychiatric hospitalizations. Information regarding his last follow- up reported him as stable, though apathetic and without senso-perceptive alterations. Neurologically he was reported with psychomotor retardation and frontal release signs. He remained unemployed and under his sister’s care.
A 13-year 8-month-old female presented to our orthodontic clinic, with a chief complaint of “a labially positioned upper right canine”. The patient had a nonrelevant medical history, her dental history showed extraction of upper right first permanent molar and remaining roots of upper left first permanent molar.\nExtraoral examination revealed that the patient had a fairly symmetrical face; her upper midline was shifted to the right 2 mm in relation to the facial midline. She had normal incisor show during smiling. The patient showed a convex profile with a retruded chin, decreased lower face height, protrusive and incompetent lips.\nIntraoral examination revealed that the patient had a poor oral hygiene, with some carious teeth. All permanent teeth were present through second molars except for the extracted upper right first molar and the upper left first molar which was in a nonrestorable status. Upper right canine was labially positioned, upper right second premolar was rotated, and upper left second premolar was in a crossbite. Canine was in Class II relationship on the left side. Right molar relationship could not be determined because of the missing upper right and left first molars. Canine relationship could not be determined on the right side due to the labially positioned upper canine. The overjet was 4 mm with 20-40% overbite. The lower midline was shifted 1 mm to the right in relation to facial midline. There was 3-mm crowding in the lower arch. There was no crowding in the upper with most of the space of extracted upper right first molar lost before starting treatment. Bolton analysis revealed 1.5-mm anterior mandibular excess [Figures and ].\nThe Panoramic radiograph revealed normal morphology of the condyles, no bone pathologies. All permanent teeth are present, including the four wisdom teeth, except for the extracted upper right first permanent molar and the nonrestorable upper left first permanent molar [].\nCephalometric analysis showed a skeletal Class II relationship, hyperdivergent mandibular plane, slightly decreased lower facial height. Upper and lower incisors were proclined and protruded. Upper and lower lips were protrusive in relation to E line of Ricketts[] with a normal nasolabial angle [ and ].\nThe problem list included: skeletal Class II, left side Class II canine relationship, bimaxillary dentoalveolar protrusion, increased overjet (4 mm), crowding in lower anterior teeth (3 mm), deviated upper midline to the right (2 mm) and lower midline to the right of facial midline (1 mm), lower left second premolar is in crossbite, anterior Bolton excess in lower anterior teeth, protrusive and incompetent lips.\nThe treatment was aiming at correcting the inclination and position of upper and lower anterior teeth to resolve the bimaxillary dentoalveolar and lip protrusion, resolving mandibular crowding , achieving minimum overbite and overjet, correcting tooth mass discrepancy, achieving Class I buccal segment relationships, and correcting crossbite of lower left second premolar.\nExtraction of lower first molars, distalization of the maxillary and mandibular premolars, the use of miniscrews for en-masse retraction of the upper and lower anterior teeth, finishing and detailing followed by retention.\nExtraction option was important to resolve the bimaxillary dentoalveolar protrusion and crowding. The option of extracting the lower first molars and distalization in the upper arch will achieve better posterior interdigitation over extracting first premolars in the lower arch which will lead to lower molar opposing upper premolars.\nThe mandibular first molars were extracted. The patient received 0.018-inch Roth preadjusted edgewise appliance. Initial leveling was accomplished with 0.016- inch nickel-titanium (Ni-Ti) arch wires. After leveling and alignment, two orthodontic miniscrews (Dual Top; Rocky Mountain Orthodontics Inc, Denver, CO), 1.6 mm in diameter and 6 mm in length, were placed in the interdental space between the maxillary canines and the first premolars buccally. Active open Niti coil spring (3M Unitek, Monrovia, CA) inserted between the canines and the first premolars, the two canines where then ligated to the miniscrews using 0.010-inch stainless steel ligature wire. In the lower arch a “V” bend was done in the 0.016 × 0.016-inch stainless steel arch wire just mesial to the lower second molars (tip back) for anchorage. A power chain was extended from the first and second premolars to the second molar on both sides [Figures and ].\nAfter completion of distalization of upper and lower premolars, the miniscrews were removed and new miniscrews with the same specifications were inserted mesial to the second molars in the upper and lower arches.\nEn masse retraction was started in the upper and lower arches using 0.016 × 0.022- inch stainless steel arch wire, with a medium size Niti closed coil spring (3M Unitek, Monrovia.).\nThe minscrews in the lower arch failed. New ones were inserted between the first and second premolars []. After the completion of retraction, 0.017 × 0.025-inch stainless steel finishing arch wires were used. During the finishing stage, the patient was instructed to use ¼-inch, 3.5-oz box elastics bilaterally to improve interdigitation.\nThe case was finished with normal overbite and overjet. The arches were well coordinated. The maxillary and mandibular dental midlines were coincident with the facial midline. The bimaxillary dentoalveolar protrusion was resolved [Figures -]. Retention was done using upper wrap-around retainer and lower fixed 3-3 retainer.\nPre- and post-treatment cephalometric tracings superimposition showed retraction of maxillary incisors (6 mm). The mandibular incisors were retracted (5 mm) with 10° retroclination. Maxillary superimposition shows retraction of upper incisors 5 mm. The upper second molar moved backward 5 mm. Mandibular superimposition showed 5 mm retraction of the lower incisors. The lower second molar moved forward 5 mm [Figures and ].\nThe ANB angle changed from 5° to 4°, as shown in .
A 49 year old gentleman presented to cardiology with lower limb claudication pain and breathlessness of three years duration. Clinical examination revealed upper limb hypertension, with similar blood pressures in both arms (180/100 mm Hg). His past history included repair of coarctation of aorta about 30 years ago. The medical records and operative details from the previous operation were unavailable. The operation had been performed through a left thoracotomy. An MRI scan revealed a 2 cm long narrowing of the aorta just distal to the origin of an aberrant right subclavian artery, which was the last of four branches from the aortic arch (Fig. ). The origins of the arch vessels did not show any sign of narrowing. The aortic root and ascending aorta were 3.5 cm in diameter, and the arch was of normal calibre. The diameter in the region of the stenosis was 1.4 cm with an additional web-like stenotic lesion at the distal end of the stenotic segment. There was evidence of calcification, possibly of an interposition tube graft which had been used at the time of the first operation. The descending thoracic aorta was of normal calibre.\nIn view of his symptomatic status, a re-intervention was considered appropriate. In view of his previous surgery, and especially the fact that the area of re-coarctation appeared to be calcified, it was decided to approach the aorta via a median sternotomy and construct an extra-anatomic ascending to descending thoracic aorta bypass graft. Cardiopulmonary bypass would be necessary to lift the heart out of the way to gain access to the descending thoracic aorta just above the diaphragm. We planned to use an apical suction device to keep the empty beating heart elevated.\nThe sternotomy was completed uneventfully. The pericardial cavity was obliterated with dense adhesions. This was rather surprising since we had anticipated that the previous procedure would have been extra-pericardial. However, further dissection revealed a large hole in the pericardial sac with the left lung directly adherent to the heart. The adhesions were released, some of them after establishing cardiopulmonary bypass using ascending aortic cannulation for inflow and bicaval cannulation (to maintain adequate venous drainage even after lifting up the heart) for venous outflow. Once the apex and the posterior surface of the heart were free of adhesions, an apical suction device (URCHIN™ Heart Positioner, Medtronic Inc., Minneapolis MN55432-5604 USA) was placed in position and the beating heart was lifted superiorly. This allowed further dissection in the posterior pericardium and allowing freeing up of adhesions between the left lung and the descending thoracic aorta, and allowed visualization of and access to the descending thoracic aorta just above the diaphragm in spite of a deep thoracic cavity (Fig. ). Proximal and distal cross clamps were applied isolating a 4 cm length of aorta. A longitudinal incision was made in this segment and an 18 mm Haemashield Platinum™ Woven Double Velour Vascular tube graft (Boston Scientific Corporation, Natick, MA 01760-1537) was anastomosed in an end to side manner using continuous 3-0 polypropylene sutures. The clamps were released, the distal one first, the aorta was de-aired and the anastomosis was checked. The graft was then routed to the right of the inferior vena cava and brought up alongside the right atrium to the ascending aorta. The apical suction device was released and the heart was replaced in the pericardial sac. The length of the tube graft was estimated after filling up the heart. A side biting clamp was applied to the ascending aorta and the proximal anastomosis of the tube graft was constructed to a longitudinal arteriotomy using 3-0 polypropylene sutures. The clamp was released, the graft was de-aired, and the anastomosis checked. The patient was weaned off cardiopulmonary bypass with no inotropic support. Haemostasis was ensured and the chest was closed in the routine manner leaving two drains in the left pleural space, one drain in the pericardial sac and one in the mediastinum.\nThe patient was extubated eight hours after arrival in the intensive care unit. His drains were removed the next morning. He made an uneventful recovery thereafter except for needing some respiratory support with non-invasive continuous positive airway pressure for treating basal atelectasis. A CT scan was done prior to his discharge from hospital on the tenth postoperative day. Figure shows an oblique 3-D reconstructed view from the CT scan demonstrating the locations of the proximal and distal anastomoses, and the lie of the graft. The patient was reviewed in outpatients six weeks after his discharge. His claudication pain had disappeared completely. His upper limb blood pressure was 120/60 mm Hg on a reduced amount of medication.
A 59-year-old female presented to our outpatient clinic complaining of pain in the left knee, with decreased range of motion (ROM) for 1 year. When she visited our inpatient department on the next day, her ROM of the left knee was restricted from 0° to 15°. She had a history of left knee pain in the past 2 years with the absence of trauma. The pain was non-specific and significantly exacerbated by knee activity. She had no prior consultation for her symptoms but occasionally took diclofenac sodium capsules for pain relief. The pain became so severe that she could no longer walk. Her past history of illness revealed that she had atrial fibrillation and a 1-week history of swelling and pain in both legs 3 years ago. Therefore, she underwent ultrasound examination and was diagnosed with multiple thrombosis in the bilateral lower limb arteries, which was more serious in the right lower limb with complete thrombus occlusion occurring in the right popliteal artery. She underwent interventional right iliac artery thrombectomy with stent implantation and balloon dilatation of the right anterior tibial artery in our hospital 3 years ago. Since then, she has been taking anticoagulants (warfarin) for atrial fibrillation until she presented at our department. The patient had no history of endocrine and metabolic disorders such as diabetes, hyperthyroidism, and gout. During physical examination, obvious and unbearable pain upon movement was noted without any knee swelling and tenderness. Signs related to meniscus pathology or joint laxity were not found.\nBlood tests were performed while the patient was hospitalized. The results revealed normal range of calcium and glucose at 2.35 and 4.99 mmol/L, respectively; however, the patient’s blood uric acid was high (480 μmol/L). The patient had normal hemoglobin of approximately 130 g/L. Three days after arthroscopic debridement, the patient developed mild leukocytosis, which was believed to be a response to surgical stress. The results of biochemical and hematologic tests were within the normal range. Anteroposterior and lateral radiographs of the left knee demonstrated a high-density shadow within the intercondylar notch with mild osteoarthritic changes (Fig. ). The high-density mass on plain radiographs was so inconspicuous that our radiologist did not notice or report it. Multi-planar computed tomography (CT) positioned the lesion precisely and excluded any other intra-articular pathology that could cause limitation of joint movement. The mass appeared as a non-structural lesion in the intercondylar area by coronal CT (Fig. a). The sagittal CT image revealed the mass inside the PCL (Fig. b). CT showed the mass with heterogeneous density. In both X-ray and CT images, the mass was shown as high density, which made it difficult to determine whether it was an ossified or a calcified lesion. Although magnetic resonance imaging (MRI) is meaningful and necessary for a full evaluation of the ligaments in our patient, it was not recommended because of the presence of a stent of unknown material in the body.\nBecause we speculated that the patient’s discomfort resulted from mechanical locking and entrapment by the dense mass, we recommended surgery and performed arthroscopy accordingly. Intraoperatively, a hump of the PCL was revealed by arthroscopic examination, while other pathological changes were not found. The fiber fascicles of the PCL appeared after debridement of the synovial membrane covering the pathological site of the PCL. We slit open the fascicles and exposed the mass, which appeared grayish-white and seemed to be hard based on the macroscopic appearance (Fig. ). The mass was so closely adhered to the fibrous bundles of the ligament that debridement of the lesion was carefully performed. The pathological tissue obtained from surgery was sent for histopathology.\nPathologically, the tissues were calcified mature lamellar bone with completely fibrotic bone marrow, which was infiltrated by a few chronic inflammatory cells (Fig. ). The pathological tissue obtained from surgery was stained with hematoxylin–eosin. The finding of osteogenic components or lamellar bone and chondrogenic components or cartilage led to the diagnosis of HO. The hallmark of osteogenic components, which were stained clearly red, is lamellar characteristics. The chondrogenic components were stained light blue with a few chondroblasts.\nFollowing the surgery, the patient verbalized complete relief of her symptoms. Moreover, she was allowed full ROM and weight bearing with no assistance. No complications were observed during the postoperative course. The patient was discharged after wound healing 2 weeks later. At 1-year follow-up, clinical examination demonstrated no signs of recurrence, and the patient gained full ROM with no pain or instability.
A 67-year-old man with a history of treated prostate cancer, alcohol abuse and alcoholic cirrhosis presented to an urban, academic hospital with new low back pain. The pain had started 2 weeks prior to his presentation, had gradually worsened, and then became associated with bilateral lower extremity shooting pain and weakness. He denied bowel or bladder incontinence or saddle anaesthesia. He also denied subjective fevers or chills or any other bothersome symptoms. He was found to have normal vital signs, poor dental hygiene, tenderness over the lumbar spinous processes, and normal neurological and prostate exams. Magnetic resonance imaging (MRI) of the spine () showed mild compression fractures, with small lytic lesions throughout the thoracic and lumbar spine, and a large lytic lesion at the L5 vertebral body. The patient had a normal prostate specific antigen (PSA) level and a normal white blood cell count. C-reactive protein was mildly elevated at 30 mg l−1 (normal range 0–10 mg l−1).\nThere was concern for metastatic cancer given the patient's prior history of prostate cancer. His normal PSA level was not reassuring, because his prior prostate cancer had been diagnosed in the setting of a normal PSA level. He was started on intravenous dexamethasone 4 mg every 6 hours given the concern for metastatic spinal lesions and a neurosurgical consult was obtained. The neurosurgery team did not feel that urgent surgical intervention was needed and thus a biopsy of the lesion was obtained by the interventional radiology team for diagnostic purposes. Surprisingly, the vertebral biopsy result showed no evidence of malignancy, but did show findings consistent with osteomyelitis and was sent for culture. Dexamethasone was discontinued and blood cultures were drawn. Antibiotic therapy was withheld while culture data was pending, as the patient was clinically stable.\nThe patient was observed while the cultures were pending, and 2 days later Veillonella species started growing from the broth of the tissue biopsy and from one of two blood cultures. After a great deal of prompting for additional history, the patient reported a mechanical fall 4 weeks prior to the onset of his pain, at which time several teeth had been dislodged. A trans-thoracic echocardiogram obtained to evaluate for possible endocarditis was negative. Additionally, repeat blood cultures obtained to ensure clearance of the bacteraemia after the initiation of antibiotics were also negative. Culture sensitivity results were obtained, but were delayed as the sample had to be sent out to a reference laboratory for further testing. In the meantime, ceftriaxone 1 g intravenous daily was started and the patient was discharged to a nursing home for further rehabilitation, with close clinical follow-up scheduled. The sensitivity testing was performed by broth microdilution and showed that there was no β-lactamase inhibition. The MIC results showed sensitivity to meropenem, ampicillin/sulbactam and piperacillin/tazobactam, and borderline sensitivity to metronidazole and penicillin. The results were delivered with the caveat that there are currently no Clinical and Laboratory Standards Institute guidelines in the USA for the performance and interpretation of susceptibility testing for anaerobes other than Bacteroides fragilis. Thus, the advice of the reference laboratory was to interpret these results with caution. At his follow-up appointment, the patient appeared to be having a good clinical response to ceftriaxone. Given the lack of β-lactamase inhibition in the culture data and the fact that once daily dosing of antibiotics decreases disruption of therapies, ceftriaxone was continued. The patient completed a 6 week course of antibiotics and had complete resolution of his symptoms.
There was a 68-year-old female with past medical history of being diagnosed with colon cancer in 2008. Present status was post colon resection with adjuvant chemotherapy. In 2008, the patient had a recurrence involving metastasis to the liver, which was then treated with metastectomy followed by a chemotherapy regimen. The patient was brought into the emergency room presenting with a sudden onset of facial swelling and pain which had begun before she went to sleep that night. Later, she woke up in the middle of the night experiencing bluish facial skin discoloration accompanied with severe shortness of breath. She had undergone the most recent chemotherapy cycle just 4 days ago to treat colon cancer with liver metastasis. The patient complained of wheezing along with lip and neck swelling. It was noted that the patient had an allergy to pollen extract, cats, dogs and several food items. At the time of the symptoms onset, the patient denied any previous exposure to known allergens or experiencing similar episodes. On the right side of her chest, the patient had a port.\nThe patient was treated in the emergency room with intravenous Benadryl 50 mg, famotidine 20 mg and Solumedrol 125 mg. She was also administered with an intramuscular injection of 0.3% epinephrine and then placed on a Ventimask of 50%. The patient was placed on bi-level positive airway pressure (BiPAP) machine after the initial treatment failed to show improvement. The patient was treated in the emergency room for anaphylactic reaction for unknown reason. The patient was shown to be awake, oriented and alert upon evaluation. She was observed to be in distress and using her accessory muscles to breath. Her heart rate was 104 beats/min, respiratory rate was 30 breaths/min and the blood pressure was 165/100 mm Hg. The general examination was remarkable for periorbital swelling and facial blush discoloration. Symmetrical swelling on the neck was observed. Lung examination was remarkable for tachypnea and using the accessory muscles was noted, no crackles, stridor or wheezing. Cardiac examination revealed tachycardia, no murmur or gallop. The patient had swollen upper extremities and she was asked to elevate her arms till they touch her face. The patient started complaining of increased pain in her arms and shortness of breath and she soon turned blue.\nThe laboratory investigations of the patient revealed hemoglobin (Hb) 13 g/dL, white blood cell (WBC) 29.5 × 103/µL and platelets 159 × 103/µL. Arterial blood gas analysis showed a pH of 7.53, partial pressure of oxygen (PO2) of 161 mm Hg and bicarbonate (HCO3) of 18 mmol/L. Troponin was found to be negative and the basal metabolic panel was observed as unremarkable. Partial prothrombin time of 22.2 s, internal normalized ratio of 1.03 and prothrombin time of 13.4 s were shown by the coagulation studies. Sinus tachycardia with heart rate of 104 beats/min and no ST elevation or depression was shown in the electrocardiogram (ECG). Except for the internal jugular vein port-A catheter, the chest X-ray came out clear. A chest computed tomography (CT) scan with intravenous contrast was ordered, and the suspicion of thrombus within SVC was raised by the presence of abundant collateral vessels revealed in the report ().\nThe patient was immediately started on a heparin drip and then moved to the intensive care unit (ICU). Consultations were sought for thrombectomy from the Interventional Radiology and Vascular Surgery. During the procedure, a focal hemodynamically significant stricture of the SVC was revealed by venography, which was adjacent to the tip of the right internal jugular vein port-A catheter. The antegrade blood flow was restored after successfully achieving near complete interval thrombolysis. Minimal residual clot was analyzed by starting the tissue plasminogen activator (TPA) at 1 mg/h. Further TPA therapy was deferred after successful thrombolysis of the focal thrombus was revealed by the venogram 1 day later along with persistent non-occlusive small thrombus in the SVC. The patient’s condition improved, and her symptoms resolved. The patient was started on oral anticoagulation. Few days later the patient was discharged home on oral anticoagulation.
A 38-year-old male patient who was a smoker (5 pack-years) and had a history of unknown arrhythmia without medical treatment was admitted to the emergency room due to right hemiplegia. During the initial examination, the patient was stuporous with a Glasgow Coma Scale score of 7. He was diagnosed with infarction of the left middle cerebral artery (MCA) territory () with occlusion of the M1 segment of the left MCA (). He had atrial fibrillation, heart failure with a left ventricular ejection fraction (LVEF) of 27% (), pulmonary edema, pleural effusion, and mild cardiomegaly (). He was admitted to the intensive care unit of the Department of Cardiology. He received a tracheostomy, mechanical ventilation, and additional medical treatment. He showed improvement in the LVEF from 27% to 47% on echocardiography and normal sinus rhythm on electrocardiogram (ECG) after treatment.\nOn day 37 after admission, the patient was transferred to the Department of Rehabilitation Medicine, where he was provided with stroke rehabilitation and CR. The Mini-Mental State Evaluation score denoting the cognitive function was 30. In the manual muscle test, the right upper extremity was graded as good in the proximal portion and fair in the distal portion. The right lower extremity was graded as good. The functional ambulation category (FAC) score was 4 and the Berg balance scale (BBS) score was 53. The modified Barthel index (MBI) score was 77. Speech evaluation showed anomic aphasia with an aphasia quotient (AQ) of 79. On day 38 after admission, the nasogastric tube was removed, and oral feeding was started after the videofluoroscopic swallowing study. The tracheostomy tube was also removed on day 43 after confirming that the patient had sufficient strength for coughing and sputum expectoration. He received physical therapy, occupational therapy, and speech therapy for stroke rehabilitation.\nThe first symptom-limited exercise tolerance test (ETT) was conducted on day 45 after admission (). After 14 minutes and 48 seconds, the ETT was terminated upon patient’s request due to leg discomfort. Using the Fitness Registry and the Importance of Exercise National Database (FRIEND) equation, the predicted VO2 max, which reflected age and weight, was 42.15 mL/kg/min []. The measured VO2 max was 21.7 mL/kg/min (51.5% of predicted value), and there was no abnormality in exercise ECG and hemodynamic response. The patient participated in a CR program for 2 weeks (1-hour sessions five times per week) (). An ECG-monitored exercise training with 4.6 metabolic equivalents (METs) was started, and the intensity was gradually increased. After 2 weeks, a follow-up ETT was performed, and the test was stopped after 15 minutes and 53 seconds upon patient’s request. The VO2 max improved from 21.7 to 27.3 mL/kg/min (from 51.5% to 64.8% of the predicted value) (). The patient also received an educational program about risk factor management, including smoking cessation and nutrition. Upon discharge (day 60 after admission), the BBS score changed from 53 to 56 (smaller than the minimal clinically important difference [MCID] of 12.5) [], MBI score from 77 to 98 (larger than MCID of 20.1) [], and AQ from 79 to 88.2.\nThe patient underwent a home-based CR program three times a week after discharge from the hospital for 8 weeks. After 8 weeks, a follow-up ETT was performed (). The test was stopped after 18 minutes and 30 seconds upon patient’s request, and the VO2 max showed further improvement (31.3 mL/kg/min, 74.3% of predicted value). Based on the guidelines of the American Association of Cardiovascular and Pulmonary Rehabilitation (AACVPR), risk stratification of the patient was changed from moderate risk at the first test to low risk at the follow-up ETT [].
This case involves a 15-year-old male patient with no pertinent orthopaedic past medical or surgical history. He sustained an initial injury to his left hip six weeks prior to presentation following a direct lateral impact during a lacrosse match. The patient felt pain but was able to return to play. Two weeks later, he was running in a lacrosse match and sustained a non-contact left hip injury. He was unable to ambulate and was taken by ambulance to the emergency room, where he was diagnosed with a posterior hip dislocation. He underwent uncomplicated closed reduction within two hours of the injury and was referred for follow-up to the senior author’s practice. Upon examination, his left hip had good range of motion, demonstrated no joint laxity and had a negative dial test. There was no laxity in his elbows, wrist, hands or knees. His hip range of motion was symmetric to his contralateral side with internal rotation to 10 degrees and external rotation to 65 degrees. His radiographs showed a concentric reduction with no fracture (). He was instructed to limit weight bearing to 30% for 4 weeks, and to start a physical therapy program focusing primarily on hip stabilization and gluteus medius activation. He was also given standard instructions for posterior hip precautions to limit flexion to 90 degrees, adduction to neutral and to limit internal rotation. He was not braced, and the risks of avascular necrosis were discussed. He was instructed to follow-up with our clinic in 6–8 weeks.\nApproximately 4 weeks after his clinical evaluation, he dislocated his hip in his sleep. He was evaluated in the Emergency Room where a magnetic resonance imaging (MRI) scan was ordered due to the lack of clinical suspicion for hip dislocation. It showed the left hip to be dislocated posteriorly with the ligamentum teres absent (). The hip was reduced with closed reduction techniques, and he was instructed to follow-up with our clinic. Radiographic evaluation in our clinic showed a non-arthritic joint with reasonable lateral coverage and a lateral centre edge angle of 32 degrees with no crossover sign. His overall acetabular volume was low with small anterior and posterior walls and neutral acetabular version. A CT scan was ordered to assess the volume of the cup and, specifically, integrity of the posterior acetabular wall (). Distal cuts were not made through the knee so femoral version was not analysed. Both the anterior and posterior walls were small and there was a mild flattening to the posterior wall, on a cephalad cut on the CT scan there was small ossification (). It was not felt to be a fragment of the acetabular wall, but rather possibly some early heterotopic ossification. He was sent to an Orthopaedic Traumatologist for confirmation, and he was sent back to our clinic for definitive treatment.\nBoth he and his family were very concerned about the stability of his hip and requested a surgical procedure to correct the problem and prevent it from happening again. A periacetabular osteotomy to increase acetabular coverage and bony stability was ruled out as it was felt that his acetabulum was in an optimal position for a low volume cup. His lateral X-ray showed mild CAM-type femoroacetabular impingement with an alpha angle exceeding 60 degrees (). His MRI showed a labral tear and no evidence of avascular necrosis. He and his family were offered hip arthroscopy to address both the labral tear and the ligamentum teres deficiency, understanding the possibility of reconstruction of both.
Our patient is a 67-year-old white man, who works as a teacher in a small city. He does not smoke tobacco; he has a history of arterial hypertension grade I to II and coronary heart disease. His mother died from myocardial infarction due to occlusive coronary artery disease. He was diagnosed as having CML in 2006. The treatment was initially started with imatinib (Glivec, Novartis) 400 mg administered orally once daily. Imatinib 400 to 800 mg per day was taken for 53 months. He lost major molecular response (MMR) and imatinib therapy was replaced with dasatinib 100 mg orally administered once daily and after 6 months MMR was achieved. He was also using torasemide 20 mg orally administered once daily and metoprolol succinate 50 mg orally administered once daily. In April 2015 he developed increasing dyspnea on exertion, fatigue, and peripheral edema. He consulted his family physician, and a chest X-ray was done, confirming pleural effusion. On admission his heart rate was 97 beats per minute and blood pressure was 143/90 mmHg. Fever was not present. He presented with peripheral edema and diminished breath sounds. Pleural friction rub was present. Deformity of the spine accompanied by lower back pain was noted during neurological check-up. The pleural fluid was drawn out several times via thoracentesis (1.5 to 2 liters of exudate in total) but cytological analysis excluded malignancy, a GeneXpert® tuberculosis test of a bronchial smear was also negative, therefore, the pleural effusion was suspected to be caused by congestive heart failure. A complete blood count was normal, but his creatinine levels were elevated (Tables and ). Over the course of the next 4 months his general condition deteriorated as he experienced multiple recurrences of pleural effusion requiring drainage of the built-up fluid (Table ). Dasatinib therapy was stopped in September 2015 after 42 months of treatment. A coronarography was done in September 2015; it did not reveal any hemodynamically important stenosis in his coronary arteries, thereby excluding coronary artery disease. An echocardiogram showed right ventricular dilation, estimated right ventricle systolic pressure of 125 mmHg, and severe tricuspid regurgitation suggesting PH.\nRHC performed on 12 October 2015 revealed severe PAH with mPAP of 53 mmHg and normal left ventricle diastolic pressure (Table ). A computed tomography scan confirmed the absence of pulmonary embolism; laboratory specific tests for HIV, rheumatoid factor, and anti-nuclear antibodies (ANA) were negative and dasatinib-induced PAH was diagnosed. The 6-minute walk test (6MWT) distance was limited to 165 m (Table ). He started PAH-targeted treatment with sildenafil 20 mg × 3 orally administered and restarted CML therapy with imatinib 400 mg orally administered daily on 19 October 2015.\nHis condition rapidly improved, a check-up RHC done a month later showed mPAP of 34 mmHg, decreased pulmonary vascular resistance, and increased cardiac output values (Table ). His 6MWT score was 2.1 times higher (Table ). Echocardiography done in February 2016 revealed right ventricle systolic pressure of 50 mmHg; a complete blood count and biochemistry showed no abnormalities (Tables and ). He has been asymptomatic since, but treatment for PAH with sildenafil is still necessary. The last hematological check-up was in January 2017, he was still on imatinib 400 mg daily and had normal complete blood count and MMR (BRA-ABL was negative).
A 26-year-old Sri Lankan woman in early labor presented to the birthing unit at 40 weeks and 6 days of gestation with spontaneous onset of labor and rupture of membranes. She had experienced threatened premature labor at 22 weeks and 6 days of gestation, but the pregnancy was otherwise uncomplicated.\nThe woman progressed well into established labor; however, labor slowed following administration of morphine. Augmentation of labor was commenced with 10 IU of oxytocin (Syntocinon; Mylan Health Pty Ltd, Millers Point, Australia) in 1 L of Hartmann’s solution, after which labor progressed well. Seventeen hours following admission to the hospital, the laboring woman had not progressed beyond 7cm dilation. Epidural analgesia was commenced, but due to “failure to progress” in the first stage of labor and a nonreassuring fetal heart rate, the woman gave birth by cesarean section. A healthy male infant was born following 16 hours and 51 minutes of established labor, and an estimated blood loss of 450 ml was recorded.\nTwelve hours following the cesarean section, the woman started to experience pain in her lower right leg, and by 28 hours, she had developed clinical symptoms of an ACS. She was treated with antibiotics for possible cellulitis. Her symptoms did not improve, and a Doppler ultrasound examination was performed to exclude deep venous thrombosis (DVT) but showed no remarkable findings. ACS was definitively diagnosed on postpartum day 10 and confirmed by magnetic resonance imaging. The ACS was managed nonsurgically, and the woman remained in the hospital with her baby for 15 days following the birth. A detailed timeline of events and clinical management following the cesarean section is provided in Table .\nOver the following months, the patient experienced improvement in tibialis anterior function. The main residual deficit was contracture of the extensor hallucis longus and the extensor digitorum longus to the lateral two toes. The patient had altered sensation over the dorsum of the first web space. Nerve conduction studies were conducted six weeks following the ACS and indicated a lesion of the superficial and deep branches of the right peroneal nerve, more markedly affecting the deep branch.\nFifteen months following the original diagnosis, the woman underwent tendon surgery. Percutaneous tenotomies were performed of the extensor tendons to the fourth and fifth toes, and a Z-lengthening of the extensor hallucis longus tendon was performed to correct the dorsiflexion contracture that had developed following the ACS. The woman recovered well from this procedure.\nAt long-term follow-up (5 years), the woman walks normally. She has no active dorsiflexion of the great toe. She can walk in bare feet but must be careful not to trip over the hallux, so she prefers closed-in footwear. Pain in the affected leg has diminished but not completely resolved. Dorsiflexion of the ankle is slightly reduced in power and in range, and there is slight persistent anterolateral wasting of the leg. There is slight weakness of extension of the lesser toes, and a contracture is evident when the ankle is plantarflexed.\nFive years following a delayed diagnosis of ACS, there are some ongoing deficits in the right leg secondary to the ACS, including reduced ankle dorsiflexion power and a complete loss of function of the extensor hallucis longus following from release of the distal tendon due to contracture development. These ongoing deficits, along with compensatory movement patterns, have contributed to the development of further issues higher up in the kinetic chain. Findings of an assessment at this stage included reduced lumbar spine active range of motion (especially extension and left lateral flexion) with sharp right-sided lumbopelvic pain. There are signs of left sacral torsion and reduced right lower limb proprioception and lumbopelvic stability (poor single-leg balance and ability to perform single-leg bridge). Ongoing physiotherapy treatment now focuses on addressing these issues in the pelvis and spine.
A previously healthy 60-year-old male was referred to the outpatient clinic due to atrial fibrillation. The patient reported pain in the lower left leg for 3 weeks followed by right-sided chest pain and dyspnea for 2 weeks. Transthoracic echocardiography (TTE) revealed a dilated right atrium (RA) with a large longitudinal thrombus (1–1.5 cm × 15–20 cm) fluctuating through the tricuspid valve (). The patient was stable and had no signs of right or left ventricular strain. Treatment with rivaroxaban 15 mg × 2 was initiated, and he was admitted to our center with suspected multilevel VTE: deep venous thrombosis (DVT), RA thrombus, and acute pulmonary embolism (PE). Computed tomography confirmed PE in the lower right pulmonary artery with associated pleural effusion. TTE and transesophageal echocardiography (TEE) confirmed the RA thrombus. Ultrasound revealed a large DVT in the left femoral vein stretching from the popliteal to the iliac vein. The patient was switched from rivaroxaban to unfractionated heparin (UFH) 5000 IE bolus followed by infusion starting at 1000 IE/hour and monitored by APTT. APPT remained in the lower range (maximum 77) treatment despite increasing doses of UFH to a maximum dose of 1900 IE/hour. After 3 days of UFH treatment, there was no regression of RA thrombus on TTE. The thrombus appeared to be attached in a thin fibrotic pedicle to the area between the superior vena cava and RA (). No persistent foramen ovale or atrial septal defect was found. Due to the large size and thin attachment, the risk of a possibly fatal PE was considered significant. As there were no regression in thrombus despite 7 days of anticoagulation treatment, it was decided to refer the patient for catheter-based embolectomy using the AngioVac system.\nPreprocedural planning included a new ultrasound of the lower extremities that confirmed regression of thrombus in the lower veins bilaterally. This allowed for a femoral venous-venous access. The procedure was performed in a hybrid suite with a multidisciplinary team from interventional cardiology and thoracic surgery enabling fast conversion to extracorporeal circulation and surgical embolectomy if needed. The patient was placed in general anesthesia, and the procedure was guided by fluoroscopy and continuous TEE. A 26F dry-seal sheath (Gore Medical®) was placed in the right femoral vein to accommodate the AngioVac cannula and an 18F reinfusion cannula in the left femoral vein. A venous sheath was placed in the left external jugular vein to allow for conversion to a jugular approach, insertion of an adjunctive catheter, or a temporary v. cava filter if needed. Furthermore, a 6F sheath was placed in the right femoral artery allowing easy conversion to venous-arterial bypass.\nThe catheter was placed in the inferior vena cava. The funnel-shaped tip was then opened, and the centrifugal pump started. Using a flow of 3.5 L/min, the catheter was slowly moved towards the RA, and part of the thrombus was sucked into the tip. The solid thrombus occluded the catheter and stopped the flow completely. With the vacuum maintained, the occluded catheter was removed from the patient, and the thrombus was removed from the catheter (). The catheter was reintroduced to the RA, and this time thrombus material was sucked out and into the filter (). A small thrombus of 5 × 8 mm remained attached despite significant suction (). Sheaths were removed and venous access closed by percutaneous suture and the arterial access by Angio-Seal®. The thrombus fragments removed by the procedure measured a total of 15 × 1 cm and consisted of heterogeneous solid older thrombus material (\n), which was confirmed by the pathologist after the procedure.\nThe patient recovered well after the procedure. He was treated with low molecular weight heparin (7500 IEx2) and was discharged 7 days postprocedure to follow-up in the outpatient PE clinic.
A 51-year-old male was admitted to our hospital on August 28, 2013 after a motorcycle accident. The patient complained of pain, swelling and bleeding in the left upper limb for 2 h.\nThe patient had a motorcycle accident on August 28, 2013. The left little finger landed first, then the left wrist flexed and landed and the dorsal skin of the left forearm was punctured by ulna and radius fractures causing pain, swelling and bleeding of the left upper limb. The skin of the left hand felt normal after the trauma, and finger activity was normal. He was sent to our hospital for emergency treatment for debridement, and his left arm was fixed with long arm plaster. The X-ray radiography showed fractures of the left distal ulna, radius and little finger as well as wrist joint dislocation (Figure ). The injury occurred only in the left upper limb, and no other organs or tissues were injured.\nThe patient was hospitalized for further surgical treatment. External fixation and Kirschner wire were used to stabilize the left distal ulna, radius and little finger (Figure ). The patient walked every day after the operation. The swelling of the left forearm was reduced 12 d after the first surgery. Open reduction and internal fixation were performed under general anesthesia to stabilize the left distal ulna and radius. Because some of the bone in the distal radius was lost due to compression, we took about 10 g of bone from the left ilium to fill (Figure ). The operation continued for 4 h. Broad-spectrum antibiotic was used to prevent infection, and drugs were used to promote blood flow and microcirculation. After the anesthesia recovery period, the patient told us that he suffered severe pain and could hear the noise from the electric drill during the operation, but he was unable to communicate this during the operation. This led to psychological trauma. The patient became very sensitive to pain and remained in bed until the third postoperative day.\nOn the third postoperative morning, when he got out of bed and was going to the toilet, he was unable to stand, owing to double lower limb weakness and pain. The double lower limbs were not tumid, and the skin color was normal. When he received a shot for the intravenous infusion, he was very nervous and suddenly felt chest pain and asthma and had breathing difficulty. Additionally, his double lung breaths sounded thick and had a large number of dry and wet rales. The partial pressure of arterious blood oxygen was 7.2 kPa (normal range 11-13 kPa), arterial oxygen saturation was 88.8% (normal range 91.9%-99.0%), and central venous pressure was 11 cmH2O (normal range 5-10 cmH2O). After oxygen therapy, peripheral capillary hemoglobin oxygen saturation was 92%, blood pressure was 158/110 mmHg, heart rate was 110 bpm, and respiratory rate was 30 bpm. The brain natriuretic peptide troponin I was negative. The serum D-dimer level was 17.48 μg/mL. The bedside electrocardiograph showed sinus tachycardia. Wells and revised Geneva scores were 9 and 11, respectively. The patient was diagnosed with high clinical probability of PTE based on these Wells and revised Geneva scoring systems[,]. We first considered PTE.\nThe patient had no previous surgery or medical problems or family history of blood clotting disorders. Previously, the patient had no respiratory or circulatory problems.\nThe patient was a 51-year-old male, weighed 90 kg and was 175 cm tall. His body mass index (BMI) was 29.4 kg/m2. He started drinking heavily around age 17 (about 500 mL of wine a day). He did not smoke. None of his family has suffered from VTE.\nLeft forearm dorsal skin was pricked by ulna and radius fracture ends, swelling deformity, bleeding, left wrist activity limitations. The skin of the left hand felt normal after the trauma, and finger activity was normal.\nOn the morning of the first day after the motorcycle accident, the serum D-dimer level was 0.80 μg/mL (the reference range < 1.00 μg/mL). When pulmonary embolism occurred, the serum D-dimer level was 17.48 μg/mL. The routine blood and biochemical indicators were not significantly abnormal.\nComputed tomographic pulmonary angiography (CTPA) showed intravascular wirelike, sheet filling defects in both sides of the pulmonary artery trunks and its branches; the large shadow in the right pulmonary trunk was about 56 mm × 16 mm (Figure ). Doppler ultrasonography showed no significant anomalies in the upper extremity deep vein within the bilateral posterior tibial veins of the lower limb thrombus formation. Echocardiography did not show patent foramen ovale and a right to left shunt.
An 18-year-old Greek male student presented for screening test in order to get a health certificate. Physical examination revealed splenomegaly, although the patient was asymptomatic. No other clinical signs were detected. Ultrasonography and Magnetic resonance imaging (MRI) showed a hypoechogenic mass involving the spleen and the splenomegaly (Figure ). Preoperative evaluation led to the possible diagnosis of hemangioma of the spleen. The patient was subjected to laparoscopy, which demonstrated a solid tumor of the spleen. Laparoscopic splenectomy was performed. Operative time was 65 minutes. Postoperative recovery was uneventful, the drain was removed on the second postoperative day and the patient was discharged on the same day. Histologic examination showed a capillary hemangioma of a spleen weighing 850 gr. The patient remains asymptomatic 6 months after the operation.\nFollowing induction of general anesthesia and endotracheal intubation, a nasogastric tube and a urinary catheter were inserted, and compression stockings were applied. The patient was placed on a beanbag in a 60-degree right lateral decubitus position. The right brachial plexus was protected with a pillow roll and the left arm was supported by a splint. The patient was positioned so that the table could be flexed to create a wider working space in a reverse Trendelenburg position. The surgeon and the scrub nurse stood to the patient's right, and the assistants stood to the left. The video monitors were placed on each side of the table, above the level of the patient's shoulders.\nPneumoperitoneum was established using a Veress needle to a pressure of 12 mm Hg. Four ports were used: the first 10-mm trocar was inserted at the left margin of the umbilicus. The other three 5-mm operating trocars were positioned as follows: the first trocar was on the median line, 8 cm above the umbilicus, a second operating trocar in a left subcostal position on the axillary line to enable gastroepiploic mobilization, and a left 5-mm operating trocar was positioned in the left lateral position, 10 cm from the umbilicus (Figure ).\nThe operation is begun with a thorough search of the abdominal cavity. The inferior pole of the spleen was lifted superiorly. The splenocolic ligament was divided (Figure ). This mobilized the inferior aspect of the spleen and allowed the spleen to be retracted cephalad. Great care was taken to avoid rupture of the splenic capsule during retraction. The lateral peritoneal attachments of the spleen, the splenorenal and splenophrenic ligaments were sequentially incised (Figure ). The splenic hilum was approached from the lower pole and dissection was continued cephalad. With the spleen elevated, the short gastric vessels and main vascular pedicle were visualized. The tail of the pancreas was also visualized and avoided at this point as it approached the splenic hilum. The splenic pedicle was carefully dissected from the medial and lateral aspects. After the short gastric vessels had been divided with ultrasonic dissector, the splenic artery and vein were dissected. The vessels were divided by application of endoscopic vascular staplers (ENDOPATH®, ETS Flex 45 Endoscopic Articulating Linear Cutter 45 mm staple line, 2.5 mm Staple Leg Length (Vascular/Thin). 45 MM Vascular/Thin). Each jaw was positioned anterior and posterior to the splenic vessels (Figure ). The instrument was fired two times in sequence. To remove the detached spleen, a nylon extraction bag was introduced through the left lateral trocar site. The bag was opened within the abdominal cavity. An incision adequate to enable removal of the bag containing the intact spleen was made at the left lateral site. The spleen was placed into the specimen retrieval bag. The drawstring was grasped, and the bag was closed and drawn out. The laparoscope was reinserted and the splenic bed was assessed for hemostasis. Finally, peritoneal irrigation was carried out and a Rob drain tube N° 24 was placed at the residual cavity.
A 15-year-old female patient accompanied by her uncle was referred to the Department of Periodontics, ACPM Dental Collage and Hospital, Dhule, (Maharashtra) for the complaint of progressively enlarging gums. According to her, gums started growing about 1 year back beginning in the upper left back tooth region and gradually progressively involved all the teeth on that side. Similar enlargement of gums was also noticed with the lower back tooth region of that side. As the patient had difficulty in chewing from that side she continued to chew from the opposite side. Over a period of time, as the enlargement took a massive form and caused difficulty in mastication and compromised her esthetics, the school authorities brought it to the notice of her parents and they approached for treatment for it.\nOn further communication, the patient's past medical history and dental history was non-significant and was reporting for the first time to dental hospital.\nExtraoral examination revealed a slight asymmetry of the face on the left side []. Intra-orally massive gingival enlargement was noted in the maxillary as well as mandibular gingiva, but only on the left side whereas the right side gingiva appeared normal. The gingival enlargement extended from distal aspect of maxillary left lateral incisor to second molar []. The mandibular gingiva enlargement extended from distal aspect of lower lateral incisor up to the second molar and almost encroached the occlusal surface leaving a small view of it. The degree of enlargement was categorized as grade 3 (Angelopoulos 1971) [].\nThe color of the gingiva appeared pink with consistency being firm and fibrous with no evidence of stippling on the affected side. Traces of plaque, food debris and calculus were noted on the affected side. Bleeding on probing was minimal/evident/present. Periodontal examination revealed deep periodontal pockets in relation to 25, 26, 27, 35, 36 and 37. Mobility of grade 3 degree was found with 26 and 27 and grade 1 degree mobility with 25 and 35. An orthopantomograph was advised to rule out bony changes. Along with this a complete blood examination along with hormonal analysis of estrogen and progesterone were advised.\nBlood examination reports revealed all parameters to be within the normal limits including hormones (estrogen and progesterone). Radiographic examination revealed severe angular bone loss localized around maxillary first and second molars and moderate bone loss around mandibular first and second molars, but of the left side only []. Based on onset of age, presence of minimal local factors, clinical, radiographic and non-significant medical history and a diagnosis of IGF with localized aggressive periodontitis was made.\nA biopsy was advised and sent for histopathological examination, which confirmed the features of fibrous gingival overgrowth. The section was stained with hematoxylin and eosin, which revealed thickened epithelium with elongated retepegs that penetrated deep into the connective tissue. Dense collagenous tissue bundles arranged in parallel were found scattered throughout the connective tissue. Few fibroblasts, inflammatory cells, blood capillaries were also found [].\nThe usual treatment for IGF consists of surgical excision of gingiva the treatment for aggressive periodontitis initially consists of Phase 1 therapy that comprises of scaling and root planing, advise on oral hygiene instructions, administration of antibiotics, drugs amoxicillin (500 mg) and metronidazole (400 mg) for 5 days, along with anti-inflammatory drugs (ibuprofen and paracetamol) and use of chlorhexidine mouthrinses The same was carried out for the patient. The patient was discharged with oral hygiene instructions and recalled after 4 weeks.\nAt the end of 4 weeks, internal bevel gingivectomy quadrant wise along with open flap debridement was carried out. This procedure eliminates the pocket reduces the bulk of tissue and makes plaque control much easier. External bevel gingivectomy remains the method of choice if no bony involvement exists. Maxillary first and second molars were extracted as their prognosis was hopeless. Interrupted sutures were placed and periodontal dressing given []. Healing after 2 weeks at suture removal was satisfactory. Patient was recalled again at the end of 3 months, during which time there were no signs of recurrence. The clinical picture of the jaws at the end of 3 months []. The patient was advised to get the missing teeth replaced. Follow-up at the end of 1 year showed no recurrence of gingival overgrowth [].
A right-handed, 63-year-old Chinese woman, with 12 years of education, was admitted to our hospital in September 2018 at the request of her family members.\nIn 2016, the patient had developed psychotic symptoms, including delusions and auditory hallucination, without an apparent cause. She said someone wanted to harm her and was talking about her. Sometimes she told her family members that she heard knocking on the door, and she exhibited diminished emotional expression and avolition. She required the support of family members to conduct daily activities and communicate with others. Her sleep quality was poor, but she showed no disturbance of consciousness. She did not seek medical advice and receive any remedy at that time.\nAfter these symptoms had continued for about 12 months, she was taken by her family to the outpatient department of our hospital. Brain magnetic resonance imaging (MRI) did not reveal any obvious structural abnormalities (Fig. ). She was diagnosed with schizophrenia by an experienced psychiatrist based on criteria in the fifth edition of the Diagnostic and Statistical Manual of Mental Disorders []. Delusions and hallucinations disappeared after the patient took 5 mg of olanzapine every night for 1 month. We monitored the blood glucose, blood lipid, blood pressure and weight every month to investigate the possibility of metabolic syndrome after treatment with olanzapine. However, she began to walk slowly, her neck became rigid, and she experienced episodic memory impairment, leading her to forget new events, ask the same question repeatedly and get lost in new places. Her physical functions, such as dressing and eating, were also impaired. However, she did not develop language dysfunction, and she was able to communicate smoothly with family members. She was treated with benzhexol hydrochloride at 2 mg every night for extrapyramidal symptoms, but the symptoms did not improve. The daily dose of olanzapine was reduced to 2.5 mg in July 2017, but the symptoms still did not improve after 1 month. Therefore, we believe that her symptoms did not cause by olanzapine then stop using benzhexol hydrochloride. In May 2018, her neck stiffness became worse and gradually spread to the limbs. She developed severe neck, limb and postural rigidity, but no tremor. She walked unstably, exhibited bradykinesia and memory decline, and showed obvious decline in her ability to take care of herself. On the other hand, she did not exhibit socially inappropriate behaviors, apathy, or dietary changes, and she responded normally to family members’ feelings.\nAt her admission to our hospital in September 2018, the patient reported never smoking or drinking. She had previously undergone gallbladder surgery. She was in good health and had no family history of mental disorders. The patient had good support from family members and did not report any major adverse life events. The patient and her family members denied any drug abuse. She did not have any history of violence, agitation and suicidal behavior during the course of her illness. Her vital signs were stable, and no abnormal physical signs were detected at admission. Blood and urine tests, blood glucose level, liver and renal function and thyroid function were normal, and the patient showed no evidence of infection. Electroencephalography, electrocardiography, and transcranial doppler ultrasound results were normal. Mental status examination showed no signs of hallucinations or delusions. The patient had stable mood but temporal disorientation and deficits in attention, calculation and language competence, as well as delayed recall. She also exhibited impairments in visuospatial organization and abstract thinking. She had no insight into her disease. The total score on the MMSE was 16 and on the MoCA was 9.\nDuring hospitalization, brain MRI showed mild frontotemporal atrophy relative to the MRI in 2016 (Fig. ). She scored 16/30 on the Mini-Mental State Exam (MMSE). She exhibited temporal disorientation and deficits in attention, calculation and language competence, as well as delayed recall. She scored 9/30 on the Montreal Cognitive Assessment (MoCA), indicating impairments in visuospatial organization, attention, language ability, temporal orientation, and abstract thinking. Her total score on the Activity of Daily Living Scale (ADL) [] was 54, indicating difficulty in performing daily life activities (Table ). Based on her two-year history of using antipsychotics and hypermyotonia, she was diagnosed with tardive dyskinesia. After consultation with experts in the neurology department, her diagnosis was changed to Parkinson’s disease on the basis of her bradykinesia and hypermyotonia. Olanzapine treatment was replaced with the combination of levodopa and benserazide hydrochloride (375 mg/d), pramipexole hydrochloride (0.75 mg/d), Selegiline hydrochloride (5 mg/d), and benzhexol hydrochloride (3 mg/d). Her bradykinesia, rigidity and shuffling gait improved after 2 weeks, but not her memory. She was discharged in October 2018.\nDuring a follow-up visit 2 months after discharge, 53 genes associated with dementia were analyzed (Table ). The only mutation detected was a heterozygous variant in SORL1 (chr11:121340726, c.296A > G). She showed a higher score of 20/30 on both the MMSE and MoCA. She was prescribed with memantine (10 mg/d) and donepezil (10 mg/d) and stopped taking benzhexol hydrochloride, but her cognitive function showed no change at follow-up in July 2019. At follow-up in August 2019, brain MRI detected moderate frontotemporal atrophy that appeared more serious than in 2018 (Fig. ), while 18F-fluorodeoxyglucose-based positron emission tomography/computed tomography demonstrated bilateral frontal and caudate hypometabolism (Fig. ). The score on MoCA improved to 23/30, but the score on the ADLS fell to 31. She was unable to complete many daily life activities (Table ).\nOur patient was diagnosed with probable AD because of early, significant episodic memory impairment, medial temporal lobe atrophy, brain glucose hypometabolism based on PET and AD-associated genetic mutation []. She was prescribed memantine (10 mg/d) and donepezil (10 mg/d). At her last follow-up in October 2019, the patient showed poor memory, slow reaction and bradykinesia, but no psychotic symptoms.\nThe patient had temporal disorientation and deficits in attention, calculation and language competence, significant episodic memory impairment. She had significant temporal lobe atrophy, brain glucose hypometabolism based on PET and AD-associated genetic mutation. A timeline of the historical and current information is shown in Fig. .\nThe psychotic symptoms of the patient occur after the age of 60, but disappeared after treatment with antipsychotics in 1 month. She did not display the clinical course typical of patients with schizophrenia. Frontotemporal dementia: The patient did not display the impaired language function typical of semantic variant primary progressive aphasia or the non-fluent/agrammatic variant of primary progressive aphasia [, ]. She also did not display early behavioral disinhibition, apathy, loss of sympathy or empathy, dietary changes, or deficits in executive tasks typical of the behavioral variant of frontotemporal dementia [].
An 86-year-old man on HD visited the emergency department (ED) of Okinawa Yaeyama Hospital with the complaint of worsening dyspnea. The symptom had started with mild shortness of breath on exertion several months ago and had gradually exacerbated. Given the frequency of dyspnea associated with volume overload and/or heart failure in HD patients, his doctor in the HD clinic assumed that the symptom was caused by heart failure associated with volume overload and attempted to empirically reduce his DW. The doctor failed to reduce his DW because of the frequent falling of the blood pressure during HD. Furthermore, while his dyspnea became worse, the doctor had to increase his DW by as much as 2 kg over 3 weeks to prevent blood pressure falling and leg cramping during HD. The patient visited our ED with the complaint of an acute worsening of dyspnea during the previous few days. He denied having chest pain, cough, sputum, orthopnea or paroxysmal nocturnal dyspnea, fever, chills, night sweats, or anorexia. He had a past medical history of end-stage renal disease (ESRD) due to unknown etiology and was on scheduled HD (4 h per day at 3 days per week) for 4 years with an uneventful course. He also had well-controlled essential hypertension and chronic atrial fibrillation which was treated by anticoagulation with warfarin for 4 years. He developed a hemorrhagic gastric ulcer that was probably associated with excessive anticoagulation 1 year ago. Helicobacter pylori was serologically negative at that time. Surgical repair of the left inguinal hernia was performed 10 years ago. He had no previous history of tuberculosis, pneumonia, or heart failure. He was not diabetic. He lived with his family. He worked as a construction worker up until several years ago. He smoked 2 packs of cigarettes a day for 30 years up until 30 years ago. He had no habit of regular alcohol consumption. Family history was noncontributory.\nOn physical examination, he was alert and appeared slightly sick. His body weight at the ED was 46.1 kg. His recent DW was 46.0 kg with an increase of 2 kg over 3 weeks. His blood pressure was 130/60 mm Hg, pulse was irregularly irregular with a rate of 50 beats per minute, respiration rate was 18 per minute, and body temperature was 37.4°C. Conjunctivae were pale. Cervical examination revealed nondistended jugular veins and no lymphadenopathy. Heart sounds were irregularly irregular without murmur or friction rubs. Chest auscultation revealed remarkably diminished breath sounds at the left thorax. A dull sound was heard at the left thorax on percussion. The abdomen was benign. There was no cyanosis, clubbing, or edema at the extremities. An arteriovenous fistula at his left forearm was unremarkable. Chest X-ray (CXR) showed massive left-sided pleural effusion without findings of pulmonary congestion or masses. (A CXR performed 7 months previous at the HD clinic showed no pleural effusion.) Immediate transthoracic echocardiogram showed no evidence of acute heart failure or volume overload. Laboratory findings are listed in table . Blood examination was remarkable for monocytosis (17.4%), hypoalbuminemia (2.5 mg/dl), elevated serum thyroid stimulating hormone over 10 μg/ml with positive anti-thyroid peroxidase antibody, and positive result for QuantiFERON-TB2G testing. Tumor marker testing revealed markedly elevated soluble interleukin-2 receptor. Thoracentesis with continuous pleural effusion drainage was immediately performed. The pleural effusion was grossly bloody and exudative with atypical cells, massive mesothelial pleocytosis, and elevation of lactate dehydrogenase (table ). The cytology of the effusion was class IV with strong suspicion of malignant lymphoma. Both fluorescent stain and Ziehl-Neelsen stain of the effusion detected no acid-fast bacilli. The culture of the effusion was negative. Computed tomography scans with contrast material of the neck, thorax, abdomen, and pelvis detected no findings suggesting a primary lesion of the malignant tumor or lymphadenopathy. Given the massive malignant pleural effusion at the unilateral side in the absence of solid tumor masses, we suspected PEL of the left thoracic cavity. We submitted cell surface marker testing and immunostaining for HHV8 of the effusion. CD45, CD38, and CD138 were dominantly detected as cell surface markers. HHV8 was detected by specific immunostaining. Enzyme-linked immunoassay (ELISA) for HIV was negative. Based on these results, we diagnosed the patient with PEL.\nThe patient's dyspnea subsided after the drainage. More than 6 liters of effusion were extracted over the first 3 days. We removed the chest tube on the 5th hospital day. We also prescribed 25 μg per day of levothyroxine for subclinical hypothyroidism due to Hashimoto thyroiditis, although the association with pleural effusion is unlikely. We notified his daughter of the diagnosis and prognosis and discussed his management. His family wanted no further invasive treatment or evaluation. With consideration of his age, underlying illness such as ESRD, the lack of established treatment for PEL, and the request from his family members, we gave up treating him with chemotherapy. As per the family's wishes, his daughter informed the patient of the diagnosis. We treated the patient with the goal of living at home with his family comfortably. He was discharged 2 weeks following his first admission. A CXR on the date of discharge revealed that there was no further accumulation of effusion. HD was continued at the HD clinic.\nThe patient was referred to our ED 1 month after the previous discharge with the complaint of dyspnea and left pleural effusion. After discontinuation of warfarin and administration of vitamin K, we performed another thoracic tube placement. Although he consequently developed re-expansion pulmonary edema (which presented as dyspnea with bilateral wheeze, crackles, and symmetric pulmonary edema on CXR) that required noninvasive positive pressure ventilation (NPPV) and bacteremia with Enterobacter cloacae treated with intravenous ceftriaxone (CTRX) for 14 days, his symptoms eventually subsided. Given the symptomatic accumulation of effusion after less than 1 month, we performed pleurodesis with 5 g of talc to the left thorax. He was discharged again after 1 month hospitalization.\nThree months following the second admission, he visited the ED due to general fatigue. He was evaluated for anemia (hemoglobin 7.6 g/dl) and was transfused with the diagnosis of mixed anemia of chronic disease due to PEL and renal anemia. His condition was fully improved with transfusion and rehabilitation and he was discharged after 10 days hospitalization.\nTwo weeks following the previous hospitalization, he was referred to the ED due to acute hypoxia following a productive cough for 2 days. We treated him with intravenous CTRX 1 g every 12 h, intravenous ciprofloxacin 200 mg every 12 h, intravenous nitroglycerin, NPPV, and emergent HD with the extracorporeal ultrafiltration method for clinical diagnosis of pneumonia combined with acute heart failure. Despite our intensive treatment, his condition rapidly deteriorated. Considering his underlying condition and the pain associated with treatment, we started intravenous morphine for palliation. He died peacefully the day after admission, 7 months after his diagnosis of PEL.
An 8-year-old boy with chronic encephalopathy secondary to hypoxic ischemic syndrome, with cerebral palsy and symptomatic epilepsy, was admitted to the emergency department of the children's hospital. He had been seizure-free for the past year with an enteric-coated delayed release formulation of VPA (375 mg every 8 hours). Thirty days prior to hospital admission, he was started on LTG 25 mg/day along with VPA, since his seizures were no longer under control with VPA. Two weeks later, the dose was increased (50 mg/day). His morning trough plasma VPA level was measured before LTG was added to the therapy yielding a concentration of 85 mg/L. On admission, he presented macular lesions on the front of the thorax that extend to the back, followed by bilateral eyelid edema and ulcerated lesions at the level of lips, jugal mucosa, and pharynx. He developed erythematosus conjunctivitis with ulcers. He presented skin rash with high fever (39°C) and respiratory failure type I. History revealed that no such lesions occurred earlier and that was the first time such rashes have occurred. Other personal and family history was not relevant. From a dermatologic point of view and based on the history and clinical presentation, a diagnosis of SJS was made. Since the presumptive cause was LTG, the drug was discontinued immediately. Soon after the patient admission, periofocal and ocular involvement worsened. Intravenous immunoglobulin was administered for 48 hours. Mouth care (oral washes with sodium borate) and eye care (tobramycin ophthalmic drops) were also indicated.\nFrom a hemodynamic point of view, four hours after admission, his condition deteriorated and he developed septic shock with peripheral circulatory failure. The patient was admitted to the intensive care unit with intravenous fluids and antibacterial therapy due to skin infection by Staphylococcus aureus. In addition to fluid resuscitation, dopamine was administered. Despite the inotropic treatment, the patient's condition did not improve, indicating a septic shock refractory to conventional vasopressor therapy but during treatment with milrinone and norepinephrine for six days (apart from the antibiotics), the septic shock was reversed.\nHis clinical state steadily improved over the following days. He made an excellent recovery under control seizure and was discharged after twelve days on admission with VPA (375 mg every 8 hours) and oral L-carnitine (2 g/day).\nA blood sample (2 mL) of the patient was collected by venipuncture and was refrigerated (4–8°C) until analysis. The Wizard® genomic DNA puriﬁcation kit was used to isolate the genomic DNA from whole blood. Then, it was quantiﬁed by spectrophotometry (260/280 nm) on a NanoQuant-Tecan instrument. EPHX genotype was determined by a real-time polymerase chain reaction using a TaqMan Drug Metabolism Genotyping Assay for rs1051740 and rs2234922.\nTwo polymorphisms, Tyr113His in exon 3 (SNP rs1051740 T > C) and His139Arg in exon 4 (SNP rs2234922 A > G), have been associated with a decrease or increase in enzyme activity, respectively [, ]. 113His/113His or 113His heterozygosity (mutated allele in exon 3) combined with His139/His139 (wild-type allele in exon 4) indicates a decrease in enzyme activity. An increase in activity occurs with 139Arg/139Arg or 139Arg heterozygosity (mutated allele in exon 4) combined with Tyr113/Tyr113 (wild-type allele in exon 3).\nThe genetic study revealed an increase in EPHX activity (wild-type allele in homozygosity for SNP rs1051740 and heterozygosity for SNP rs2234922).\nThis study was conducted in accordance with the principles of good clinical practice and the Declaration of Helsinki and was approved by the Ethics Review Committee of the Faculty of Chemistry (Uruguay). Written informed consent of the mother was obtained for the purpose of reporting this case.
A 57-year-old Chinese woman presented to Tianjin Union Medicine Center, Tianjin, China, with rectal adenocarcinoma at Dukes’ stage C. Before presenting to the hospital, the patient was not taking any drugs and had a completely negative medical history. On 7 October 2008, the patient was treated by low anterior resection, at a distance of 13 cm from the anus and radical resection was performed. Before surgery, it was not known whether the patient had lymph node metastasis or whether the tumor, which was not large in size, could be completely resected by surgery, and so neoadjuvant chemoradiotherapy was not performed.\nFollowing the operation, from 31 October 2008 to 10 April 2009, chemotherapy treatment (oxaliplatin) was carried out five times every month with a total of six cycles. On 4 June 2009, six lesions with a maximum diameter of 0.5 cm were removed by inner lens polyp resection. Six months later, a lesion measuring 2.3 cm × 1.4 cm, at a distance of 0.5 cm from the left side of perianal region, was removed and pathology analysis indicated adenocarcinoma. On 13 March 2010, another lesion measuring 1.5 cm × 1.0 cm × 1.0 cm was removed from the left groin. Pathology analysis indicated lymph node metastasis. Figure a shows the pathological findings of this lesion. On 31 March 2010, the patient could not tolerate chemotherapy with irinotecan and so chemotherapy was terminated. From 12 April 2010 to 18 June 2010, the patient received radiation therapy on the bilateral inguinal region and anus 32 times, including 10 times with enhanced radiation therapy. On 6 August 2010, a perianal lesion measuring approximately 1.3 cm × 0.8 cm × 0.9 cm, 1 cm from the left anterior anal wall (close to the perineum), was removed. Pathology analysis indicated adenocarcinoma with cytokeratin CK20+ (Figure b). There was a small postoperative anal defect in the patient. On 30 September 2010, multiple right inguinal nodules, measuring a maximum of approximately 1.6 cm × 0.7 cm, were removed. Pathology analysis indicated metastatic lymph node adenocarcinoma (5/7 nodules). On 11 November 2010, the perianal nodules (measuring 2.2 cm × 1.3 cm × 0.3 cm), the adenocarcinoma nodules in the skin and subcutaneous tissue, and three right inguinal nodules (CK−) (measuring a maximum 1.4 cm × 1.4 cm), were resected (Figure c).\nOn 23 February 2011, three perianal tumors (measuring 2.0 cm × 2.0 cm × 0.4 cm; CK+, CEA+−), 0.3 cm to 1.3 cm from the anal margin and left posterior anal wall of the external sphincter (left, middle and rear), were resected (Figure a). On 31 May 2011, the left inguinal lymph node was resected and analysis indicated lymphadenia (measuring 1.0 cm × 1.5 cm × 0.2 cm) (Figure b). The anal margin tumor near the location of the nodule, found on 6 August 2010, was resected and pathology analysis indicated adenocarcinoma (measuring approximately 0.6 cm × 0.7 cm × 0.2 cm). On 23 September 2011, tissue measuring 0.9 cm × 0.5 cm × 0.7 cm was removed, but analysis indicated that it was adipose tissue. On 25 October 2011, the perianal lesions (measuring 1.4 cm × 0.6 cm × 0.8 cm; near the last end tailbone) left behind the anal margin were removed. Pathology analysis indicated CK staining was negative (Figure c).\nFollowing the initial resection surgery, the patient attended hospital for surveillance examination every 3 months. B-mode ultrasonography, chest X-ray and blood biomarker tests were performed. Every 6 months, CT scanning was used to find any LR and distant metastasis. Until 9 April 2013, the patient is alive and has good condition.
A 4-month-old female infant was referred to the genetic clinic for aniridia and an enlarged anterior fontanel during November 2019. She was the first child of non-consanguineous parents, both of whom are now 33 years old. The mother underwent surgical tumor removal due to mucinous cystadenoma of the right ovary at the age of 27. Simultaneously, she suffered from polycystic ovarian syndrome (PCOS) and subclinical hypothyroidism. Because of the PCOS, the infant was conceived through in vitro fertilization and embryo transfer (IVF-ET). Euthyrox was given orally before pregnancy, and thyroid function was well-controlled. A genetic karyotype analysis of both parents was done prior to in vitro fertilization (IVF), and results were normal.\nThe mother of the patient had a routine prenatal examination during pregnancy. The ultrasound examination at 12 weeks of gestation revealed no major structural abnormalities in the fetus, and the thickness of nuchal translucency (NT) was normal. Noninvasive prenatal testing (NIPT) at 14 + 5 weeks showed no abnormalities. There was a mild reduction in the amount of amniotic fluid (AF) observed at 28 weeks of gestation, but no other abnormal findings were identified at this time. Percutaneous umbilical blood sampling was recommended to the mother to exclude possible genetic disorders, but she declined. The amount of AF was monitored regularly during mid-late gestation (weeks 24 through 39), and results are shown in Fig. . The amount of AF was reduced than normal between 28 and 30 weeks and at 38 weeks of gestation. The baby was born at 40 weeks of gestation. Her birth weight was 2820 g, height was 49 cm, head circumference (HC) was 31.5 cm, and Apgar score was 10; all parameters were in normal range.\nAfter delivery, however, due to “poor response”, the infant was transferred to the neonatal intensive care unit. After a routine blood test showed that the white blood cells (WBC) increased to 33.7 × 109/L and granulocytes were at 72.8%, antibiotic treatment was given. Physical examination showed that the anterior fontanelle was 2.5 × 2.5 cm, full, and accessible to the bone seam, and the posterior fontanelle was at 2x2cm and not closed; thyroid function appeared to be normal; ultrasound scan showed normal liver, gallbladder, pancreas, spleen and kidney; normal MRI brain scan and diffusion-weighted brain imaging was reported; echocardiography showed that the atrial septal defect (central type) was 2 mm; and the newborn hearing screening was in the normal range. After 12 days of antibiotic treatment, the WBC decreased to 9.1 × 109/L, and the granulocytes decreased to 34.6%. The infant was then discharged from the hospital.\nSigns of bilateral aniridia and ptosis were noticed by physicians at Xi’an Angel Women’s & Children’s Hospital when the infant was 6 weeks old. Developmental delays were observed at 3 months old with manifestations of great motor retardation. At 4 months old, she was diagnosed with aniridia, ptosis, macular dysplasia, nystagmus, low set ears, and an enlarged anterior fontanel. Genetic examination was recommended. On November 6, 2019, SNP array analysis was performed in our hospital, and arr [hg19]11p15.1p11.2(18742043–44,991,839) xl (26.25 Mb) was detected. The molecular diagnosis confirmed that the patient had both WAGR and Potocki-Schaffer syndromes.\nThe patient is now 6 months old with normal body length, weight, and head circumference. After intensive pediatric physical therapy, she can raise her head but cannot sit. Her intellectual ability is equivalent to that of a 3-month-old. Physical examination revealed an enlarged anterior fontanel, aniridia, ptosis, macular dysplasia, nystagmus, low set ears, rough face, micrognathia, and atrial septal defect. The growth stage-based development and phenotype assessments are shown in Table .
A 61 year old man presented to emergency room with history of flank pain on right side, dysuria, urgency and frequency with occasional hematuria for 3 days associated with fever, chills and rigors. 3 weeks before this presentation he was admitted for renal colic and was found to have a new staghorn calculus in the kidney which was managed conservatively with 7 days of oral antibiotics. Review of systems noted a history of 40 pounds weight loss over 3 months, drenching night sweats and occasional low grade fevers for last 3 months. Past medical history was significant for multiple episodes of renal colic secondary to nephrolithiasis treated with lithotripsy several years ago. Social history was significant for 30 pack year history of smoking, occasional alcohol consumption and no substance abuse or high risk behavior. Family history and medication history were not contributory. At the time of presentation patient was noted to be hypotensive with a blood pressure (BP) of 78/49 mmHg and mean arterial pressure (MAP) of 59 mmHg. The hypotension was new compared with recent admission 3 weeks prior, where the BP readings were consistently above a MAP of 80. The hypotension did not correct with bolus of 3 liters of 0.9% normal Saline (NS) and in view of his history of dysuria and intermittent hematuria and recent diagnosis of staghorn calculus he was diagnosed with urinary tract infection (UTI) leading to urosepsis and septic shock. He was admitted to medical intensive care unit (MICU) where he was started on pressor support with norepinephrine and broad spectrum antibiotic coverage with vancomycin and piperacillin-tazobactam. Vitals recorded at presentation were temperature of 97.3°F, BP of 78/49 mmHg, MAP of 59 mmHg, heart rate 80/min, respiratory rate 18/min, SpO2 of 98-99% on room air. General exam was significant for an averaged sized man in mild distress with mild pallor, no icterus, cyanosis or edema. Systemic exam was significant for mild right costovertebral angle tenderness. Labs were significant for hemoglobin (Hb) of 9.2 g/dL, mean corpuscular volume (MCV) of 77.6 fL and leukocyte count (WBC) of 5.1 k/µL with differential of 77% neutrophils. Liver enzymes showed alkaline phosphatase of 212 U/L, Alanine transaminase (ALT) 80 U/L, Aspartate tranaminase (AST) 96 U/L, Total protein 3.6 g/dL and albumin 1.5 g/dL. Urine dipstick was positive for blood (1+), proteins (30) and glucose (50) and urine microscopy showed 109 RBC and 12 WBC. Rest of the lab results are shown in . Cortisol level at admission was 182.6 mg/dL which ruled out adrenal insufficiency. Two sets of blood culture and urine culture were done prior to starting antibiotics which showed no growth after 5 days of incubation. CT scan abdomen done at presentation showed numerous ill defined lesions in the liver which were new from the CT scan done 3 weeks before for evaluation of renal colic (). The study redemonstrated the staghorn calculus with no evidence of obstruction, no radiographic evidence of pyelonephritis or renal abscess. Patient received 2 days of pressor support with Norepinephrine drip, following which his blood pressure improved to a MAP over 70 mmHg, however he continued to have intermittent episodes of hypotension which were managed with frequent boluses of 1000 to 500 mL of 0.9% NS. Interestingly, on Day 5 of admission, patient developed increased shortness of breath and became hypoxic. Trans-thoracic echocardiogram done at bedside showed normal ejection fraction and normal inferior vena cava. Patient was diagnosed with fluid overload secondary to frequent fluid boluses and was given one dose of 20 mg i.v. lasix which led to resolution of shortness of breath. During this entire stay, he continued to have intermittent episodes of hypotension with mean arterial pressure dropping to low 60’s. Colonoscopy and esophago-gastro-duo-denoscopy (EGD) done as part of malignancy workup, showed 2 polyps which were diagnosed as tubular adenoma and thick gastric folds with chronic gastritis on histopathology respectively. A liver biopsy was planned after improvement in his overall condition however on day 9 of the hospitalization patient declined the procedure and requested a break from the hospital. Liver biopsy was deferred for a later date and patient was discharged in a stable condition. During this admission 4 blood cultures and 3 urine cultures did not show any growth after 5 days of incubation. He was discharged with oral levofloxacin to complete a course of 14 days of antibiotics for complicated UTI. Three days after being discharged from hospital, patient returned to emergency room with similar complaints of acute onset weakness and fatigue and a single episode of fever for which he received a single dose of Ibuprofen at home. Vitals at presentation showed rectal temperature of 94.1°F, BP of 84/49 mmHg, mean arterial pressure of 60 mmHg, breathing at rate of 18/min, heart rate 59/min and saturating 97% on room air. Examination this time was unremarkable. All labs at readmission are shown in . Patient was readmitted to MICU with a provisional diagnosis of urosepsis and was given vancomycin and piperacillin-tazobactam. Blood culture and urine culture done at this time again showed no growth which could support the diagnosis of sepsis. Biopsy of the liver lesions showed extensive lymphocytic and histiocytic infiltrates with abnormally large cells and positive stains for CD15 and CD30. Bone marrow biopsy also showed areas of residual trilineage hematopoesis with 40% cellularity alongwith several para-trabecular infiltrates composed of large atypical cells including Reed-Sternberg (RS) cells, in a mixed inflammatory background consisting of small lymphocytes, histiocytes, eosinophils and plasma cells (). The immuno-histochemical stains were positive for CD15 and CD30 and negative for CD45, CD3 and CD20. Bone marrow aspirate showed trilineage hematopoesis with orderly maturation. A 100 cell count showed granulocytes (56%), monocytes (1%), eosinophils (6%), erythroid precursors (34%), lymphocytes (2%) and plasma cells (1%). The presence of the characteristic RS cell in a mixed inflammatory background pointed towards a diagnosis of HL. The diagnosis was further confirmed by positive immune-histo-chemical (IHC) stain for CD15 and CD30 along-with negative IHC stain for CD45, CD3 and CD20. Since no pan-T antigens were missing, the possibility of a T-cell lymphoma was very low. A CT Chest for staging did not show any hilar lymphadenopathy. Soon after the diagnosis patient was started on chemotherapy with doxorubicin, dacarbazine, vinblastine. Bleomycin was initially withheld due to unknown pulmonary function in view of patient been active smoker and was added later after pulmonary function test turned out to be normal. After completion of the 1st cycle of chemotherapy the blood pressure started improving to a MAP of more than 80 mmHg (). At 6 month follow up the patient continues to be free of any episode of hypotension or hypothermia.
We present the case of a 13-year-old boy admitted to our hospital in September 2018 for severe respiratory distress, a global motor deficit with the lower limbs more affected than the upper limbs, motor regression, axial hypotonia with poor control of the head, muscle strength of 2–3/5 on the Medical Research Council’s scale (MRC) for the upper limbs and 2/5 on the MRC scale for the lower limbs, generalized severe muscular atrophy, retractions of the elbow and knees, more obvious in the distal segments.\nThe patient comes from a non-consanguineous twin pregnancy with term birth and no hypoxic events. He has a 19-year-old healthy brother.\nIn the first year of life, the patient was hypotonic and had a moderate motor delay, sat after 1 year, and walked without support after 2 years. He never achieved running, climbing stairs, or jumping on one foot. His lower limbs have always been more affected than his upper limbs. He had his first neurological examination at the age of 4, where the lack of deep tendon reflexes, tongue fasciculations, neurogenic changes on electromyography, motor deficit with the lower limbs being more affected than the upper limbs and muscular atrophy were observed. Biopsy revealed neurogenic changes raising the suspicion of a motor neuron disease. Genetic testing for 5q SMA – multiplex ligation-dependent probe amplification (MLPA) and Sanger sequencing – was negative. Between 5 and 10 years of age, the evolution was slowly progressive. The proximal weakness became severe, and the patient developed severe generalized muscle atrophy, swallowing dysfunction and ventilatory restriction, severe contractures at all levels, progressive scoliosis, and a lack of deep tendon reflexes. Gastrostomy was performed in 2019. After the age of 10, he became a wheelchair user, and his motor regression was dramatic. In March 2021, spine surgery was performed, after which muscular atrophy became extreme and the weakness was generalized. The patient lost head control and only presented a few active movements in the upper limbs. He presented paradoxical breathing without requiring noninvasive ventilation or oxygen. He had no deep tendon reflexes and presented a dysphonia with a hoarse voice. The patient also had retraction of the mandibular joint with very limited movements leading to the incomplete opening of the mouth, subcutaneous nodules around the interphalangeal joints, with the upper limbs more affected than the lower limbs. He had no paroxysmal events such as myoclonus or other types of seizures.\nElectroencephalography (EEG) showed frequent generalized slow waves with a duration of 1–2 seconds, rarely focalized, with the left side more affected than the right one, without any clinical manifestations. Electroneurography (ENG) showed mildly reduced amplitude of Compound Motor Action Potential (CMAP) but with an increased area (due to the reinnervation process). Sensory Nerve Action Potential (SNAP) had normal amplitude and velocities. Electromyography (EMG) showed chronic denervation changes with very large, polyphasic motor unit potentials (MUP) and incomplete recruitment.\nNo liver enlargement was seen following the abdominal ultrasound. Spinal X-ray showed severe thoracal scoliosis (Cobb angle >100 degrees) with thoracic deformity and restrictive respiratory dysfunction.\nIn order to elucidate the diagnosis, a dried blood spot (DBS) card was sent for sequencing and copy number variation (CNV) assessment (using MLPA) of the SMN1 gene. No clinically relevant variant was identified following SMN1 sequencing and MLPA.\nIn the presence of a negative SMN1 test, we continued the testing using the whole-exome sequencing method. Genetic testing identified three heterozygous mutations in the ASAH1 gene. The first identified mutation (NM_004315.5:c.458_459del) was a two-base pair deletion in position 458 of the coding region in exon 6 generating the substitution of tyrosine in position 153 of the protein to a stop codon – p.(Tyr153Ter), or p.(Tyr153*), leading to a premature stop codon and thus, to a truncated protein. This variant is reported as pathogenic (class 1) according to the American College of Medical Genetics and Genomics (ACMG) guidelines.\nThe second identified mutation (NM_004315.5:c.1226T>C) was the T to C substitution of nucleotide 1226 of the coding region in exon 14, generating the substitution of isoleucine in position 409 of the protein to threonine – p.(Ile409Thr). This variant has been reported as a variant of unknown significance according to ACMG.\nThe third identified mutation (NM_004315.5:c.35G>C) was the G to C substitution of nucleotide 35 of the coding region in exon 1, generating the substitution of arginine in position 12 of the protein to a stop codon – p.(Arg12Pro). This variant is reported as a variant of uncertain significance according to ACMG.\nThe patient received supportive treatment in our Center, including respiratory assessment. Currently, he only needs cough assist 3–4 times/day, does not need oxygen or noninvasive ventilation. He receives daily physical therapy, respiratory and general, daily occupational therapy, neurocognitive evaluation, and psychotherapy. He has no need for anticonvulsant drugs. A severe evolution was noted, and the patient’s prognostic is poor due to rapid motor regression with extremely severe, generalized muscular atrophy and retractions, almost without any active movements, together with respiratory involvement (chronic respiratory failure) and swallowing difficulties (bulbar involvement).
A 65-year-old woman with a history of LSPAF (> 15 years) was referred for thoracoscopic left atrial posterior wall and pulmonary vein isolation combined with left atrial appendage resection. After being treated with amiodarone, digoxin, and beta-blockers for several years, her electrocardiogram remained abnormal. Electrical cardioversions eight and six years before the admission were unsuccessful. Anticoagulant (Rivaroxaban) use was stopped after intestinal bleeding two years before the surgery.\nBrain natriuretic peptide on admission was elevated to 1621 pg/mL, while troponin I was negative. Echocardiography showed moderate mitral and tricuspid regurgitation, pulmonary hypertension (mean arterial pressure 41 mmHg at rest), moderate impairment of left ventricular systolic motion, a left ventricular ejection fraction of 50%, and atrial dilatation, with a left atrial diameter of 43 mm. Coronary angiography showed arteries without any sign of obstructive atherosclerosis. Preoperative chest computed tomography (CT) is a part of the protocol for patients undergoing video-assisted thoracoscopic procedures at our institution and it revealed a mass in the superior segment (S6) of the inferior lobe of the right lung ().\nIn order to follow the institutional protocol for cancer patients and minimize the operative trauma, we performed a totally thoracoscopic resection of the lung lesion and left atrial posterior wall and pulmonary vein isolation. Catheter ablation of atrial fibrillation was not performed because of its controversial efficacy in patients with LSPAF[.\nThe operation was carried out under general anesthesia with single lung ventilation. The patient was positioned supine with 45° rotation toward the left decubitus position. External pads for emergency defibrillation were placed on the chest wall. The surgeon stood in the right side of the patient to perform segmentectomy first.\nThree ports were made, including a 1-cm thoracoscopic port in the 6th intercostal space (ICS) on the scapular line, a 2-cm incision on the middle axillary line in the 4th ICS, and a 2-cm incision in the 5th ICS on the anterior axillary line for resection of the superior segment of the right inferior pulmonary lobe using a thoracoscopic linear stapler (EndoGIA, Medtronic). The tumor had dark grey appearance and was completely included in the S6. The diagnosis of the lesion was confirmed by intraoperative frozen section.\nAfter that, the patient was positioned in supine position on the table to perform left atrial posterior wall and pulmonary vein isolation combined with left atrial appendage resection (also known as GALAXY procedure[). At our institution, the modified GALAXY procedure is routinely used. We increased the number of ablations to 20 for each side (the total number of ablations is 40) with frequent position changing of the device and change of device angulation after 10 ablations (technique described below).\nBriefly, the procedure is performed through three thoracic ports with pericardial reflection and sequential single lung ventilation. Soft grey and blue rubber catheters are passed behind the left atrium, above and below the superior and inferior pulmonary veins, respectively, to guide the device advancement while avoiding trauma.\nThe curved device is firstly inserted into the pericardial cavity from the left side, guided by the soft rubber catheters, up to the patient's spine. Once appropriately positioned, it is clamped over the left half of the left atrium. Lesions are applied guided by impedance drop to confirm transmurality. After each application, the device is adjusted a little to get overlapping lesions. The process is repeated on the right side to obtain isolation of the pulmonary veins as well as a large portion of the left atrial posterior wall ().\nThe final portion of the procedure is removal of the left atrial appendage with use of a thoracoscopic stapling device (EndoGIA, Medtronic).\nAfter the surgery, the patient was transferred to the intensive care unit and recovered well. Sinus rhythm was restored 12 hours later, after amiodarone infusion and electrical cardioversion.\nA perioperative red blood cell transfusion was not necessary. The patient’s postoperative mechanical ventilation time was 12 hours. Postoperative transthoracic echocardiography showed normal ejection fraction and heart chamber. Pathologic examination of the lung lesion showed a well differentiated primary pulmonary mucinous adenocarcinoma. Patient was discharged on the 6th postoperative day.\nThree-month, 6-month, and 1-year follow-ups (24-hour Holter monitoring) revealed no sign of recurrence of atrial fibrillation or other supraventricular arrhythmia.\nPostoperative therapy included amiodarone, warfarin (canceled after three months), and bisoprolol (the only medicine continued in this patient after the 3-month follow-up).\nChest CT at 3-month and 1-year follow-ups showed no sign of tumor recurrence and good expansion of the residual right lower lobe with no consolidation. No chemotherapy or radiotherapy was needed.
Patient GN is a 68-year-old right-handed woman without previous psychiatric or neurological episodes, and a normal seven-years education. She was admitted to our neurological clinic because of spontaneous complaints about mild episodic memory impairment and about a generalized and compelling feeling of familiarity and even intimacy for unknown people’s faces. This erroneous face familiarity recognition involved people met personally during daily life activities as well as people seen on television. HFF started about six months before admittance and gradually increased up to become severe and with direct consequences in daily life. In fact, HFF was spontaneous and immediate, and happened constantly throughout the day to the extent that for many (unknown) persons met or seen, GN engaged in effortful memory searching, trying to remember the circumstances, episodes and reasons that made the person’s face look familiar. The failure to recall such circumstance, and the stress related to it, leaded her to social detachment, as she stopped leaving the house or watching TV. By contrast, her ability to recognize truly familiar faces was unimpaired and correct recognition was associated with retrieval of the specific identity and correct name. GN never misidentified a person for another and never believed that people were disguised. Therefore, GN’s HFF appears as a selective disorder, qualitatively different from other misidentification syndromes, such as the Capgras (the pathological belief that a patient’s family member has been replaced by an identical impostor) or Fregoli syndrome (the delusional belief that different persons are in fact a single person in disguise) [, ].\nMedical and neurological examination was entirely normal as well as standard laboratory blood tests. During the psychiatric examination the patient was cooperative, well groomed, oriented and with a euthymic mood. No evidence of a formal thought, language and mood disturbance or of other psychiatric symptoms was detected. She never reported epileptic disorders. GN was treated with donepezil (5 mg/die for the first month, and then 10 mg/die for other 5 months) with relieve from the mild memory impairment but not from the HFF, which persisted substantially unchanged until the second follow-up (six months after discharge) and then gradually abated until spontaneous remission.\nA positive family history for dementia was reported, as GN’s mother had an early-onset AD. The presence of mild episodic memory deficits and the familiarity for dementia, suggested to further evaluating the possibility of a prodromal stage of AD. Therefore, additional metabolic and genetic analyses were carried out. There is indeed evidence that early stages of dementia are related to the increase of specific biomarkers in the cerebrospinal fluid (CSF) and to genetic factors. Analysis of the CSF (cells count: 1 element/mm3) was performed to assess the presence of biomarkers with high levels of sensitivity and specificity for amyloid load and tangles in the brain, which are characteristic of dementia. These markers are amyloid β1–42 (Aβ-42) (mean sensitivity: 86%; specificity: 90%), total tau (t-tau) (mean sensitivity: 81%; specificity: 90%), and phosphorylated-tau (p-tau) (mean sensitivity: 80%; specificity: 92%). Concentrations of the Aβ-42 were significantly reduced (298.40 pg/ml; normal values > 500 pg/ml), whereas concentrations of the t-tau were in the normal range (207 pg/ml; n.v. < 450 pg/ml) and concentrations of the p-tau were slightly increased (61.6 pg/ml; n.v. < 61 pg/ml). As far as the genetic factors related to dementia is concerned, GN has been found to carry the ε2–ε3 alleles of the apolipoprotein E (APOE), whereas higher risk to develop dementia and AD has been found in carriers of the ε4 allele of the (APOE) genotype. In consideration of the clinical history and of the assessment results, GN was diagnosed with atypical AD.\nThe neuropsychological examination took place during the first week after admittance, while the fMRI experiment and SPECT scan were performed three weeks after admittance.
A 56-year-old female patient was transferred to our department of critical care medicine, Huashan hospital in Shanghai in June 2016 after she received treatment in a local hospital for productive cough, tachypnea and respiratory distress. She complained of recurrent fever and asymmetric edema of the lower extremities for over 1 month, as well as painful swelling both in the thyroid and labium majus for 2 weeks. In the previous hospital, due to the finding of multiple bilateral cysts which were palpable nodules in her thyroid gland by ultrasound examination, a left lobe thyroid puncture and drainage had been conducted and an aspergillus fumigatus infection was detected. She had a history of systemic lupus erythematosus (SLE) and lupus nephritis for 8 years, and received prednisone treatment for these diseases. But from November 2015, prednisone was switched to methylprednisolone, and hydroxychloroquine has been added because of lupus nephritis aggravation, and tacrolimus has also been added to the medications in the following month. She was also diagnosed with renal hypertension and diabetes induced by steroids, and received antihypertension and antihyperglycemic therapy. She had no history of pulmonary diseases such as chronic obstructive pulmonary disease (COPD), asthma, or any repeated infections, and had no addiction to drugs, smoking or alcoholism. Previous examinations showed no evidence of neutropenia. The ratio of CD4/CD8 was 0.33. Only one aspergillus test was positive in repeated sputum cultures. The galactomannan aspergillus antigen and culture tests in BALF were negative, so were blood and urine cultures including fungi. Our chest computed tomography (CT) imaging revealed bilateral patchy lung opacities in the middle and lower lobes, along with multiple shadows of fibrotic streaks, high-density nodules and mediastinal calcification of lymph nodes (Fig. ). The diagnosis of pulmonary infection was established, and pathogen was highly suspected of aspergillus according to the previous finding of thyroid puncture and drainage. An ultrasound examination showed thrombosis in the bilateral femoral veins and popliteal veins. In addition, a 51 × 16 mm hypoechoic lesion was detected in the left subcutaneous perineal region. We continued voriconazole therapy in a standard treatment dose (200 mg twice a day), but her body temperature was still up to 37.6 °C intermittently. Her white blood cells were 15.61 × 109/L (neutrophils 90.8% and lymphocytes 5.4%), hemoglobin was 93 g/L, and platelets were 295 × 109/L. Except hyperglycemia, proteinuria, and hypoproteinemia, other routine laboratory tests were unremarkable, which including thyroid hormone levels. A neck CT showed findings consistent with a fluid collection in the right thyroid lobe (Fig. ). Cultures of aspirated purulent fluid showed aspergillus fumigatus growth, which was obtained from fine needle aspirations in both thyroid and perineum. Five days after being transferred to our hospital, the patient’s thyroid drainage tube was removed because no further fluid was drained out. We continued the voriconazole dose 400 mg per day as anti-aspergillosis therapy with 16 mg methylprednisolone and 400 mg hydroxychloroquine per day as immunosuppressive therapy, along with a therapeutic 4100 iu q 12 h dose of nadroparin calcium. The patient’s fever was relatively controlled and white blood cells decreased to 10.74 × 109/L (neutrophils 91.7%, and lymphocytes 4.7%). Lesions in the thyroid and subcutaneous labium majus became significantly smaller, and the pain was greatly relieved. On the eighth day of hospitalization, the symptoms had improved and the patient was discharged from our hospital. She continuously took voriconazole orally (400 mg per day) for 6 months, combined with caspofungin for the initial 2 weeks (first day 70 mg, then 50 mg per day). After 1 month of antifungal treatment, she was afebrile and all the clinical symptoms were relieved. The patient is on a follow-up for 1 year and has been free of aspergillosis for 6 months. Hydroxychloroquine treatment ceased in April 2017, and methylprednisolone dose was reduced in a tapered manner.
A 41-year-old woman presented with a mass on the left upper lip and difficulty in pronunciation. The mass developed after she bit the upper lip 5 years earlier. The volume of mass was not reduced; however, the patient complained of pain. One year after the development, she visited an otolaryngologist. The mass was diagnosed as mucocele and aspirated. However, only blood was aspirated from this lesion, and the lesion's size was not reduced. Two years after aspiration, the size of mass increased, and she visited a plastic surgeon. The lesion was diagnosed as hemangioma by magnetic resonance imaging (MRI). Ethanol was injected into the lesion twice. Although the lesion was slightly reduced at the first injection, it did not change at the second. She consulted a dental clinic two years after the second injection and then was referred to our department.\nOral examination revealed a circumscribed submucosal single nodule, approximately 30 × 20 mm in size in the left upper lip. The overlying mucosa was smooth, with bluish discoloration. On palpation, the nodule was elastic firm and mobile (). Cervical lymph nodes were not palpable. MRI revealed a relatively well-demarcated lesion in the left upper lip. The lesion showed low signal intensity on T1-weighted images; however, it had a high signal area suspecting the subacute bleeding image in the centre of tumor. The lesion showed mostly high signal intensity on T2-weighted images (). Under the clinical diagnosis of hemangioma, surgical enucleation was performed under local anesthesia. The tumor was removed with ligation and ablation of the inflow blood vessels. The overlying mucosa was partly removed, and the wound was closed by sutures (). Postoperative course was uneventful. The patient was free of recurrence 2 years after surgery ().\nThe size of excised the lesion was 30 × 20 mm. The specimen had reddish brown surfaces covered by thin-walled capsule including the mucosa of partial lower lip and inflow blood vessels which were well demarcated. Microscopically, the lesion was a well-circumscribed mass surrounded by fibrous connective tissue and showed a variety of cellularity imparting a lobular architecture in low power (Figures –). The lesion was characterized by irregular cavernous spaces and solid cellular areas. The cavernous spaces contained erythrocytes and were lined by a single layer of flattened endothelial cells. Large cavernous spaces were filled with a mix of erythrocytes and organizing thrombi. The solid areas showed proliferation of spindle cells arranged haphazardly or in short interlacing fascicles. Epithelioid cells were also seen, some of which contained large cytoplasmic vacuole.\nImmunohistochemically, most endothelial cells lining the cavernous spaces, spindle cells within solid areas, and epithelioid cells within both areas strongly reacted with vimentin (Figures and ). The endothelial cells lining the cavernous spaces reacted strongly with CD34 (), CD 31, factor VIII, smooth muscle actin (SMA) (), and Wilms tumor-1 (WT-1) (). The spindle cells within solid areas focally reacted with CD34 (), CD31, SMA (), and WT-1 (), whereas epithelioid cells were positive for SMA (), WT-1 () and negative for CD34 (), CD31. S100 protein, AE1/AE3, D2-40, and EMA were negative in endothelial cells, epithelioid cells, and spindle cells. From these findings, the lesion was diagnosed as SCH.
This 11-year-old girl presented with headache for 3 weeks, weakness of all the four limbs for 2 weeks, and rapidly progressive vision loss for 10 days. At 16 months of age (10 years back), she underwent fenestration of posterior fossa arachnoid cyst with ventriculoperitoneal (VP) shunt insertion when she had become lethargic and lost motor milestones. She improved and returned to baseline and was doing fine.\nThree weeks before presentation to our center, she developed persistent frontal headache and vomiting which progressively increasing. On the 7th day of illness, she was evaluated elsewhere by an ophthalmologist. Visual acuity was reportedly normal. There was no papilledema. Magnetic resonance imaging (MRI) was done, which showed a posterior fossa arachnoid cyst with VP shunt in situ and normal-sized ventricles []. Cerebrospinal fluid (CSF) examination revealed acellular CSF with normal biochemistry, but opening pressure was not measured. She also had aching over the limbs. Headache decreased after the CSF drainage (25 mL).\nDuring hospitalization, she developed symmetrical proximal as well as distal weakness of all the four limbs without sensory loss. She also developed difficulty in chewing and jaw drop without facial sensory loss. There was left-sided facial, palatal, tongue, and neck weakness. Eleven days after the onset of headache, she developed horizontal binocular diplopia. Then, she started having diminution of vision in both the eyes, which progressed over 5 days to complete blindness with worsening of headache. There were no seizures, ataxia, fever, and loss of weight or appetite. There were no other systemic complaints. She received pulse methylprednisolone with no improvement. At presentation at our center (3 weeks after onset of illness), she was conscious, drowsy, and had a normal general physical examination and hemodynamically stable without any features of Cushing's triad but had neck stiffness.\nExamination revealed absent perception of light bilaterally without papilledema. Pupils were dilated and not reacting to light, with ptosis of the right eyelid with bilateral impaired abduction of the eyeballs. Facial sensation was normal with diminished corneal reflex bilaterally, with jaw weakness. There was no facial weakness, palatal, or tongue weakness. Neck flexors as well as extensors were weak.\nThere was symmetrical flaccid quadriparesis. All deep tendon reflexes were absent and plantars were extensor. Sensory examination was normal. Finger–nose test was normal and tandem walking could not be evaluated.\nRoutine investigations were normal. MRI of the brain was done []. Lumbar puncture showed elevated CSF pressure >40 cm CSF. CSF was acellular with sugar of 63 mg/dL (corresponding Random blood sugar (RBS) of 87 mg/dL), protein was 26 mg/dL. Other investigations such as CSF culture, acid–fast bacillus staining, malignant cytology, cryptococcal antigen, and GeneXpert were negative. After CSF tapping of 50 mL, her weakness and cranial nerve deficits except vision improved and she also had relief in headache. Visually evoked potentials were not recordable. Nerve conduction study was suggestive of radicular involvement.\nClinically, she had a meningeal process with contiguous involvement of the cranial nerves on the left side, bilateral 6th nerve involvement as well as polyradiculopathy. Possibility of chronic meningitis, shunt malfunction, or other causes of raised intracranial pressure (ICP) such as chronic sinovenous thrombosis was considered. ICP rise due to idiopathic ICP or drug-induced causes were ruled out because modified Dandy's criteria for IIH were not fulfilled. Moreover, since the shunt was already in situ, if it was functional, the patient was unlikely to be having features of raised ICP. Thus, shunt malfunction was diagnosed.\nSince the patient had loss of vision as well as multiple deficits, lumbar thecoperitoneal shunt (LP shunt) insertion was performed to relieve the raised ICP immediately. LP shunt was preferred in this case over VP shunt revision, as the shunt revision was technically difficult in normal-sized ventricles, and our center has a large experience in LP shunting in patients with malignant idiopathic intracranial hypertension.\nAfter surgery, patient's limb power improved. She also started walking on her own, and all other cranial nerve deficits got relieved, except for vision loss which was persistent. Subsequently, lumbar puncture was repeated, which showed CSF opening pressure of 5 cm CSF and was clear and normal biochemically. Even after 1 year of follow-up, there was no improvement in vision. Vision did not improve probably due to the long duration of symptoms before intervention was done.
A 4-year-old boy was referred to our unit in August 2017 from another hospital because he developed sudden left lumbar cruralgia after a moderate back injury that occurred 2 weeks prior during a recreational activity. The child also had a fever, which started almost simultaneously with the head injury. The past medical history was unremarkable (as well as the familial and the psychosocial history), with the exception of frequent episodes of respiratory tract infections.\nAt the physical examination, the child was conscious and was complaining of lumbar pain radiating to the anterior thigh, palpation of the lumbar spine evoked the pain, no stiff neck was present, no skin markers were detected, and his body temperature was 38.5 °C. The neurological examination revealed no motor or sensory deficits, bladder disorders, or bowel disorders; however, the patient could not walk because of the intense pain. Once admitted, the child underwent spinal cord magnetic resonance imaging (MRI), which showed an intra- and extradural lesion extending from the lower L4 vertebra to the S2 vertebra, resulting in compression of the medullary conus and roots. The lesion appeared to be a fluid collection, with contrast enhancement, similar to an abscess (Fig. ). Blood leucocytosis and increased levels of inflammation markers were detected.\nThe day after admission, a surgical excision of the lesion was performed through a L5-S1 laminectomy. A purulent collection that filled the epidural space was completely removed and sent for microbiological examination. At the S1 level, a partially collapsed lipoma of the filum that occupied the subdural space was progressively separated from the nerve roots under neurophysiological monitoring and excised by sectioning the terminal filum. The procedure was completed by duraplasty. The L5-S1 laminae were not replaced in order to leave the spinal cord decompressed. The regeneration properties of the bone at this age and the static behaviour of the sacral vertebrae are likely to close the bony gap, avoiding instability problems.\nA histological analysis of the surgical samples confirmed the diagnosis of a lipoma.\nThe postoperative course was uneventful. The child showed a rapid recovery from the preoperative pain. The culture of the abscess revealed the presence of a methicillin-sensitive Staphylococcus aureus, so a targeted antibiotic therapy was carried out for 4 weeks. Postoperative MRI (performed 1 month later) showed a normalization of the radiological picture (Fig. ). At the current follow-up (16 months), the child is asymptomatic.\nA 4-year-old boy was referred to our unit in May 2018 from the Pediatric Intensive Care Unit where he was admitted 2 days prior with a suspected case of Guillain-Barré syndrome. The clinical history had started with urinary incontinence associated with paraparesis, which quickly progressed and prevented ambulation. The past familial, medical and psychosocial history was unremarkable.\nAt the time of admission, the patient was conscious; the neurological examination demonstrated paraparesis (2/5) with severe deficits in dorsiflexion of the feet, a moderate deficit in trunk elevation, diffuse hypoesthesia of the lower limbs and urinary incontinence. The MRI scan of the spinal cord (Fig. ) documented a large dorsolumbar syringomyelia secondary to a severe tethered cord, supported by a small lipoma of the conus, which was stretched to reach the S3-S4 level.\nThe child underwent surgery immediately after the MRI scan. Through an L5-S4 laminectomy, the dural sac was opened to explore and decompress the spinal cord. The small distal lipoma was dissected and removed, which immediately detethered the spinal cord.\nThe diagnosis of a lipoma was confirmed by histological examination.\nThe postoperative course was uneventful. The child showed a progressive improvement in both paraparesis and urinary incontinence, which were normalized after 3 weeks. The hypoesthesia significantly improved but still persisted in the 7-month follow-up. The postoperative MRI scan, performed 3 months after surgery, showed the detethering of the spinal cord and the significant reduction of the syringomyelia (Fig. ).
A 37-year-old male patient presented at the emergency service of oral and maxillofacial surgery of a private hospital in Recife, Brazil, with complaints of a painful hard swelling in the submandibular region (). He had undergone extraction of the left third molar seven days before presentation (). He has noncontributory medical or socioeconomic history, since he was not hypertensive, did not have diabetes mellitus or sexually transmitted infections such as HIV or syphilis, and did not smoke or drink alcoholic beverages.\nA computed tomography revealed a hypodense image in the submandibular region accompanied by the presence of gas in their interior (). Respiratory rate and blood pressure changes were not observed. On extraoral examination, the skin of the submandibular region was tender bilaterally and of normal color. Intraoral examination revealed maximal interincisal opening (<20 mm), as well as absence of the left mandibular third molar. Blood cultures were performed, and intravenous Metronidazole (500 mg, 8/8 hours) and Rocefin (1 g, 12/12 hours) were empirically started.\nOn the third day, there was a slight hyperemia in the cervical region and in the thorax, and the patient reported dysphagia and dysphonia. Due to the persistence of the infection, the antibiotic was changed and a new cycle was started with 1.5 g Tazocin injected intravenously every 6 hours. To monitor the clinical status of the patient, daily laboratory tests were carried out, which showed that the body continued to exhibit marked leukocytosis (15,290). There was also positivity and an increase in the 7.32 reference value for C-reactive protein, indicating that there was still a significant infection in the body.\nA new contrast-computed tomography of the face, neck, and chest clearly showed the presence of a purulent collection in pharyngeal spaces, with a descending path to the mediastinum and marked deviation of the trachea (). In view of the emergency situation, after antisepsis of the region, bilateral drainage of the submandibular and submental regions, and tissue divulsion, irrigation with copious amounts of 0.9% saline solution to serve as drainage orifices was performed on the 5th day of hospitalization (). Next, two No. 2 Penrose drains were installed in drainage holes, and the patient was also referred to the intensive care unit (ICU) for 5 days due to the severity of his condition and the need for daily care. The patient underwent orotracheal intubation and, because of severe limitation of mouth opening, the aid of a bougie, an artifact used for intubation of a difficult airway, was selected. During the intensive care period, an investigation was carried out in search of data that could explain the poor evolution of the patient, since he had no comorbidities. A chest tomography revealed the presence of purulent collection in the region above the sternal furcula.\nDue to a clinical presentation without significant improvement, the thoracic surgery team intervened six days after the procedure performed by the maxillofacial surgeons. The decision was made to perform tracheostomy and suprasternal cervicotomy, which revealed the presence of necrotic tissues mainly consisting of omohyoid musculature. A large pseudocyst extending from the submandibular region to the sternal furcula and containing secretion was also detected. A tracheal aspiration culture was performed and revealed Pseudomonas aeruginosa and Klebsiella pneumoniae ssp pneumoniae. Opening of the mediastinum revealed no devitalized tissues and very few purulent collections. A Penrose drain was installed in the furcula, and at the end of the procedure, the patient underwent a tracheostomy and returned to the ICU.\nDuring the postoperative period, the patient was kept on antibiotic therapy with 1 g Meropenem 8/8 hours and 400 mg Targocid 12/12 hours intravenously, showing significant improvement with sudden falls in leukocytosis and C-reactive protein, as well as improvement of general clinical status. After 1 year of treatment, the patient was invited by telephone to follow-up; however, he did not return to our service and only reported no symptomatology.
A 13-year-old boy with SHFM was admitted to our department with his fourth episode of purulent meningitis. His family history was significant: he was born as the third child in the family; his sister is alive; his brother, who had a congenital heart malformation and Down’s syndrome, died as an infant. His two cousins had Say-Meyer syndrome. His mother had contact with chemical disinfectants during the first two months of her pregnancy. The boy was born in the 38th week of pregnancy with Apgar scale 9 congenital malformation of all four limbs. When he was 1 year old, his family recognized that he had hearing problems but they did not seek any professional help. In 2006, his chromosome analysis confirmed incorrect karyotype 46, XY, t(7:12)(q21.2;q21.3). The boy had reciprocal translocation between chromosome pairs 7 and 12.***\nThe first episode of invasive streptococcal disease was diagnosed in 2008 when the patient was 6 years old. It was a complication of an inflammation of his right ear. After that, the boy developed two further episodes of meningitis: in 2011, without confirmed aetiology, and in 2012, again streptococcal. In 2011, due to his recurrent infections of the central nervous system, the boy had a consultation with a neurosurgeon and underwent an magnetic resonance imaging (MRI) of the brain and lumbar column, but the radiologist did not find any abnormalities of these structures.\nIn April 2015, the boy started to complain of pain in his left ear. After three hours the laryngologist confirmed the presence of an inflammation in his left ear and prescribed an oral antibiotic. The pain was so severe that the mother took the child to the hospital two hours later. At the time of admission the general status of the child was good: he presented neither a fever nor pathological neurological symptoms. His leucocyte count was 18.7 G/uL; C-reactive protein– 0.39 mg/dL; procalcitonin – 43.07 ng/mL. The patient received a first dosage of intravenous ceftriaxone. Three hours later the general status of the child had worsened: he started to vomit and complained of a headache. He presented positive meningeal signs. His leucocyte count increased to 27.95 G/ul; C-reactive protein – 12.7 mg/dL. A lumbar puncture was performed and confirmed the diagnosis of purulent meningitis (leu – 137 cells/mm3 with 96 % of neutrophils; protein – 3.77 g/L; glucose – 0.01 mmol/L). Therapy with ceftriaxone and vancomycin was started. The next morning the child was sent to actual department. At the time of admission the boy presented severe hyperaesthesia of the skin, neck stiffness of 7 cm and a positive Kernig’s sign. Physical examination of the body revealed median clefts of both hands and feet (Figs. and ). Other systemic examinations were normal except for a mild systemic murmur in the heart apex. The child presented appropriate-to-age development, but because he was deaf and without speech he used only sign language. The laboratory findings were worse: the leucocyte count was 38.26 G/uL with 98 % of neutrophils; C-reactive protein – 40.20 mg/dL; procalcitonin – 43.89 ng/mL. The blood and CSF culture confirmed penicillin-resistant Streptococcus pneumoniae with low sensitivity to vancomycin infection. The patient received high-intensity treatment with cefotaxym (107 mg/kg/day), vancomycin (4 × 10 mg/kg/day) and meropenem (3 × 1 g/day). Over the next few days we observed a slow improvement of the patient’s general status. His therapy was complicated by two episodes of generalized tonic-clonic seizures, which were observed on the 10th and 16th days of treatment. Post-infection epilepsy was diagnosed and levetiracetam was induced.\nDuring his hospitalization we tried to find the reason for his recurrent pneumococcal meningitis. Immunological analysis did not present any abnormalities, and the levels of immunoglobulins G, A and M were correct. The cytometric analysis of the leucocytes presented increased absolute values of lymphocytes CD4-T, CD8-T and B with normal percentages. The expression of adhesive molecules (CD11a, CD11b, CD11c, CD18) was normal. The high-resolution, computer tomography (CT) (axial, coronal, and sagittal planes) of both temporal bones was performed (128-layer Somatom Definition AS apparatus, Siemens, Germany). This indicated: preserved basal turns and absence of the apical turns of the both cochleas, vestibulums wider than usual (Figs. and ). The clinical suggestion of inner ear abnormality was confirmed – Mondini dysplasia. The malformation was also confirmed in magnetic resonance imagination (3-Tesla MAGNETOM Spectra scanner, Siemens Healthcare, Erlangen/Germany) (Fig. ).\nTwo months after the 4th episode the child had the left subtotal petrosectomy performed to protect him against next recurrent bacterial meningitis. A postauricular S-shaped skin incision was done from the temporal region to the mastoid tip. Mastoid periosteal flap was created and external auditory canal was closed as a “blind sac”. Complete mastoidoepitympanectomy was performed with skeletonisation of the dura, sigmoid sinus and facial nerve. The mastoid cells (retrosigmoid, retrofacial, antral, retrolabyrinthine, supra-labyrinthine, infralabyrinthine, supratubal and pericarotid) were all exenterated. The mucosa of the bony Eustachian tube was removed with the diamond burr and coagulated with bipolar forceps. The Eustachian tube was obliterated with fibrin patch and bone wax. Stapes superstructure was removed. The middle ear cavity was obliterated with abdominal fat harvested from the lower quadrant of the abdomen. Both wounds: abdominal and parietal were closed in layers using 3.0 vicryl subcutaneously and monocryl 3.0 to the skin. The patient’s post-operative course was unremarkable.
A 41-year-old non-smoker obese female patient was examined at the Department of Neurology and the Center for rehabilitation. Relevant history of the patient is summarized on a timeline in Fig. . She showed an onset of neuromuscular disorders during early childhood with a delay in motor and written language development. She had a hard time to complete physical exercise at school and always finished last. There was nothing really alarming in terms of muscle disorder until her first pregnancy at the age of 33 during which she experienced shortness of breath (dyspnea) at the 7 months of gestation and showed signs of weakness of lower limbs afterwards. At the age of 34 she showed worsening of breath symptoms, suffered from sleep apnea and started using a mechanical ventilation machine. Alarming symptoms of skeletal muscle disorders occurred immediately after delivery with progressive but rapidly incapacitating weakness of lower limbs. This worsened during the 3 following years, a period during which she first started being unable to get up by herself and then was unable to climb stairs. At the age of 37, she started to use a cane, then a walker for her daily walking needs. At the age of 39, she started using a wheelchair to move outdoors. Despite these signs of progressive muscle weakness, she never had a thorough neuromuscular investigation. It was wrongly thought that her health problems, in general, was mainly related to being overweight. At the age of 41, she had four episodes of lower limb paralysis during which she was completely unable to move her legs and support her weight. She did not seek medical consultation for the first three episodes. For the fourth, she was admitted to the emergency room (ER) and first referred to the Department of Neurology and then to the Center for Rehabilitation.\nThe family history showed that her mother died at the age of 66 from a heart attack associated with non-compaction cardiomyopathy. There is nothing remarkable in terms of muscle disorders in her father, brother, and sister. However, her only daughter, now at the age of 11, shows signs of muscle disorders with congenital muscular torticollis, excessive growing pains as well as underdeveloped muscles in half of the body.\nPhysical examinations conducted following her admission to the ER at the age of 41 showed normal tone/bulk of the arm muscles. However, muscles in shoulders and upper and lower limbs showed bilateral weakness. Deltoids, biceps and triceps showed moderate weakness with MRC scale of 3/5. Fine finger movements were intact. There was no pronator drift. In the lower limbs, all muscles examined showed the same severity of weakness (2/5) except quadriceps which showed mild weakness (4/5). Hip flexors were extremely weak (1/5); hip abductors and adductors were mildly weak (4/5). Knee extensors and flexors were moderately weak (3/5). Dorsiflexion of feet was severely weak (2/5). Plantar flexors were severely weak (2/5). Deep tendon reflexes were 2+ in the arms, absent in the patella and Achilles. The toes were down-going. No sensory deficit was observed. No sign of dysphagia or involvement of ocular muscles was observed.\nAdditional physical examination conducted during the 2-year follow-up (at the age of 43) showed no worsening of muscle strength. However, this brought new information about the weakness of other muscles, notably in the shoulders, with extremely weak abductors and flexors (1/5). The patient showed decreased perception of vibration in the lower limbs. She reported that she experienced occasional dysphagia.\nElectrophysiological exams showed normal nerve conduction velocities for upper and lower limbs, with all SNAP and CMAP amplitudes in the range of normal values. However, needle EMG revealed a tendency of myotonic potentials, generated by needle insertion. Right deltoids, biceps and ulnar-innerved first dorsal interosseus muscles showed myotonic potentials as well. The right tibialis anterior showed 2+ polyphasic motor unit potentials with myotonic potentials. The right medial gastrocnemius, vastus medialis and vastus lateralis showed myotonic tendencies as well.\nExamination of muscle biopsy of left quadriceps showed features of an end-stage process, consistent with a severe, chronic myopathy. There are scattered clusters of viable muscle fibers which showed myopathic features in the form of a marked variation in fiber size and numerous internal nuclei. In addition, there are scattered fibers with abundant intrasarcoplasmic vacuoles (Fig. a, b). Given we could not clearly observe the presence of hyaline bodies on H&E staining we decided to proceed with p62 immunostaining, a well-known technique for revealing the presence of inclusion bodies []. Immuno-histochemical detection of p62 was performed on a Leica Bond III automated stainer. Following digestion in a low pH citrate solution, sections were incubated in a primary mouse monoclonal anti-p62 antibody, diluted 1:50 (BD Transduction Laboratories Catalog Number 610833). Detection of bound antibody was achieved using the Leica Bond Polymer Refine Detection kit, comprising the secondary antibody, the substrate chromogen DAB (3,3′-Diaminobenzidine tetrahydrochloride hydrate) and the Hematoxylin counterstaining solutions. Immunostaining for p62 revealed, in a proportion of the surviving muscle fibers, diffusely distributed, small intermyofibrillar dots or, more commonly, larger central or eccentric sarcoplasmic inclusion bodies (Fig. c, d). Examination of heart function using Holter ECG monitor carried out following her admission to the ER showed no clinically significant implication of cardiac involvement. However, the patient complained about repeated episodes of oppressive chest pain during the following years. Additional examination conducted during the 2-year follow-up showed signs of cardiac involvement with bradycardia of 58 beats per minute.\nRegarding respiratory involvement, the patient suffered from dyspnea since the age of 34. Examination of lung function conducted following her admission to ER and during the follow-ups showed worsening of her respiratory condition. Spirometry test conducted at the age of 44 showed a very weak pulmonary function, with forced vital capacity (FVC) of 27% and forced expiratory volume in a second (FEV1) of 29% of normal values.\nThe blood samples were collected for whole-exome sequencing (WES) to detect mutations potentially involved in the phenotype of neuromuscular disorders observed for this patient. The genomic DNA was extracted from whole blood and subsequently subjected to whole-exome DNA library construction using the Ion AmpliSeqTM Exome RDY panel (Thermo Fisher Scientific) essentially as described in the manufacturer’s protocol, with barcode incorporation. For the sequencing, samples were loaded on an Ion HI-Q PI Chip v3 and placed onto the Ion Proton instrument (Thermo Fisher Scientific) together with an Ion PI HI-Q sequencing 200 Kit (Thermo Fisher Scientific) and sequenced for 520 cycles according to the manual (See Additional file : Table S1 for parameters). All candidate mutations found by WES were validated by direct Sanger sequencing (See Additional file : Figure S1 for the filtering process). DNA sequences were obtained from the University of California Santa Cruz (UCSC) Genome Browser. Predesigned primers were directly purchased from Thermo Fisher Scientific (See Additional file : Tables S2 for details). Amplicons were sent to Genewiz () for Sanger sequencing.\nWhole exome sequencing showed that a novel variant NM_000257.3: c.1370 T > G (p.Ile457Arg) in the MYH7 gene is a missense single nucleotide variant possibly linked to the clinical findings, found in the DNA of the patient as heterozygous (Fig. ). The novel variant has been submitted to ClinVar database; with the assigned accession number SCV000804311. Two other candidate mutations were identified in the DNA of this patient, namely NM_003085.4:c.368C > A (p.Pro123His) in the SNCB gene and NM_001001557.3:c.746C > A (p.Ala249Glu) in the GDF6 gene (Additional file : Table S3). However, both mutations were discarded after filtering only genes involved in neuromuscular functions that potentially cause clinical features of muscle myopathy observed in this patient (Additional file : Figure S1). Regarding the novel variant NM_000257.3: c.1370 T > G (p.Ile457Arg), bioinformatics analyses showed that nucleotide T coding at the position 1370 of the MYH7 gene is highly conserved across 44 vertebrate species (PhyloP at 1.76). Amino acid substitution from Isoleucine (I) to Arginine (R) at the position 457 of MyHCI suggested a high impact on protein structure (Grantham at 97). Results of analyses obtained from VarSome () suggested a classification of Likely pathogenic for this variant, with evidence of Pathogenic computational results coming from 8 various prediction software including DANN, GERP, dbNSFP.FATHMM, MetaLR, MetaSVM, MutationAssessor, MutationTaster and PROVEAN (vs no benign predictions). Also, the results of analyses using the recommendation of the ACMG and the AMP suggested the same classification of Likely pathogenic for this variant, with combined criteria of 2 moderate (PM1 and PM2) and 2 supporting (PP2 and PP3) [].
The patient is a 36-year-old male with bicuspid aortic valve and history of IV drug use (which he initially denied). He presented to another hospital approximately one week after developing a diffuse rash, generalized muscle aches, profound weakness, fevers, and chills. At that time, he was diagnosed with an upper respiratory infection and was discharged from the emergency room on oral antibiotics. After five days he returned back to the same hospital with complaints of persistent high fevers and was admitted. During his stay, he was found to have 4/4 positive blood cultures prompting a transfer to our hospital for further evaluation and management.\nHis physical exam on presentation was significant for Janeway lesions as well as multiple vasculitic lesions on his fingers and toes () as well as a grade II/IV diastolic murmur. IE was suspected. Blood cultures were obtained and he was promptly started on intravenous Ceftriaxone and Vancomycin. At the time of admission the patient stated that he had a peripherally inserted central catheter placed three months before for treatment of non-Hodgkin's lymphoma at a neighboring hospital that was removed six days prior to presentation. He later admitted to an ICU nurse that the IV line had been inserted by a friend in a hotel room for intravenous injections of illicit drugs.\nBlood cultures from the previous hospital grew MSSA. Repeat bacterial and fungal cultures at our institution came back negative. Initial ECG showed probable sinus tachycardia with first-degree atrioventricular block (). Transesophageal echocardiogram (TEE) demonstrated a bicuspid aortic valve with multiple mobile echo densities along both the anterior and posterior leaflets with the largest one measuring 1.8 cm ().\nOvernight the patient was noted to have arrhythmias on telemetry and a repeat ECG showed new complete heart block (). The patient was then taken to the operating room (OR) emergently where he had an aortic valve replacement with bovine pericardial prosthesis, pericardial patch repair of the aorto-left atrial fistula with a St. Jude Medical bovine pericardial patch, and removal of infected debris from his tricuspid valve and mitral valve. Intraoperative histopathological results of the aortic valve indicated marked acute inflammation, fibroinflammatory debris, coccoid bacteria, and calcifications. The tricuspid valve was also involved with fibroinflammatory debris consistent with endocarditis. Cultures of the specimens grew out MSSA and antibiotics were changed to Cefazolin. The patient had an uncomplicated postoperative course and was discharged one week later with a plan of a six-week course of intravenous Cefazolin and close outpatient follow-up.\nThe patient missed his initial two follow-ups with his infectious disease (ID) doctors and there was concern for recurrent IVDA which he denied. After multiple attempts to reach him he started to follow up and became routine in his treatment. In the outpatient setting he also had repeat blood cultures taken at 3 weeks which came back negative. Six weeks after discharge he complained to his cardiologist of night sweats, fatigue, and shortness of breath. A repeat transthoracic echocardiogram was performed showing new vegetations over the bioprosthetic aortic valve with an abscess cavity and fistulization into the right atrium, moderate/severe tricuspid insufficiency, presence of ventricular septal defects, and new vegetations in the mitral valve. He was started empirically on Cefazolin with a continuous antimicrobial infusion to maintain adequate minimum inhibitory concentration and Rifampin. Repeat blood cultures (bacterial and fungal) were negative. He was taken back to the operating room where he had a redo aortic valve replacement with a Carpentier-Edwards ThermaFix bovine pericardial bioprosthesis, closure of the VSD, and subaortic fistula into the right atrium and into the left atrium using a St. Jude Medical bovine pericardial patch. The aortic bioprosthetic valve grossly was a tricuspid porcine valve measuring 3.7 cm (diameter) × 1.5 cm (thickness) with a tan white smooth surface with green sutures attached. Histopathological examination of the valve and fistula showed fibroconnective tissue with associated foci of inflammatory exudates, cultures and staining of which were negative for bacteria and fungi. He was eventually discharged on oral Ciprofloxacin and Rifampin for a total 6-week course.\nOne week after discharge he developed symptoms of heart failure including shortness of breath and nocturnal dyspnea. He had a repeat echocardiogram that showed a prosthetic valve vegetation with a large aneurysmal membrane between the prosthesis and mitral annulus and evidence of left ventricular outflow tract left atrial fistula with severe regurgitation. A ventricular septal defect was present with left ventricular outflow tract right atrial flow and another vegetation was seen over the anterior mitral valve. Blood cultures (bacterial and fungal) were taken at the time both of which were negative and he was empirically started on Vancomycin, Gentamycin, Cefepime, Rifampin, and Micafungin. The patient was then taken back to the OR for the final time where he had a St. Jude mechanical aortic valve replacement with debridement of the other valves. Intraoperative histological analysis showed fibroconnective tissue that was negative for bacterial and fungal staining and cultures as well as negative for 16sRNA and 18sRNA. The patient was then stabilized and discharged on Rifampin plus Vancomycin for a total course of 6 weeks and Gentamicin for 2 weeks. Upon discharge he followed with his doctors regularly and did not have any further cardiac complications.
A 60-year-old man initially presented with rectal bleeding and discomfort. On physical exam, a rectal mass was initially identified as hemorrhoids. Hemorrhoidectomy was performed, and pathology showed an over 20 mm thick ulcerated mucosal melanoma extending to the margins with a high mitotic rate and the presence of lymphovascular invasion. Tumor profiling showed the malignancy to be BRAF wild-type and KIT mutated (D579 deletion). Upon referral to our institution, staging CT scans showed an enlarging anal mass, a right inguinal mass, and multiple pulmonary nodules consistent with metastatic disease. He underwent palliative trans-anal excision of the rectal mass and was urgently started on dual ICI with ipilimumab 3 mg/kg and nivolumab 1 mg/kg once every 3 weeks for a total of four planned doses. After the third cycle, he presented with a constellation of new symptoms including nausea, constipation, weight loss, fatigue, and hypotension (seated systolic BP as low as 70 mmHg systolic). ICI was held, and he was admitted for further work-up.\nHis blood pressure did not respond to an initial intravenous fluid challenge of 5 l of normal saline. There were no localizing signs of infection, leukocytosis, tachycardia, or fever, so both sepsis and cytokine release syndrome were felt to be unlikely. His examination was negative other than for orthostatic hypotension. His pupillary responses to light and accommodation, and motor and sensory examinations were normal. A cardiac workup with transthoracic echocardiogram showed preserved ejection fraction without diastolic dysfunction, no significant valvular disease, and no pericardial effusion. A cardiac MRI had no acute findings. An endocrinopathy was considered, however multiple morning cortisol levels were normal as were TSH and a comprehensive evaluation of pituitary function including LH, FSH, prolactin, and GH, thereby ruling out hypopituitarism. There was also no evidence of mineralocorticoid deficiency (normal aldosterone and renin). Other etiologies of autonomic neuropathy were investigated including a work-up for autoimmune (ANA, creatinine kinase), infectious (Lyme, syphilis, HIV), and neurologic (anti-cholinergic receptor antibodies, anti-GAD65 antibody) causes, nutritional deficiencies (B12), and paraneoplastic syndromes (Mayo Clinic paraneoplastic antibody panel), all of which were negative (Table ). MRI of the brain was negative for intracranial metastases and had no abnormalities that could explain his symptoms. There was no family history of dysautonomia, synucleopathies, or other neurologic disorders.\nThere was no evidence of volume depletion based on objective bioimpedance measures of total body water and extracellular water. On formal autonomic testing (Finapres NOVA, Finapres Medical Systems, Enschede, Netherlands), he had a low supine resting heart rate (51 bpm) and BP (91/50 mmHg). Slow deep breathing revealed blunted amplitude (4.5 bpm [normal > 7 bpm]) at a low heart rate range (45–52 bpm). Valsalva maneuver resulted in normal heart rate responses (Valsalva ratio 1.38–1.57 [normal > 1.29]) but a “flat top” blood pressure profile and absent phase 4 overshoot. This constellation of findings was indicative of significant sympathetic dysfunction and resultant parasympathetic predominance. His cold-pressor test resulted in only a modest rise in blood pressure (91/52 to 108/63 mmHg [normal: BP increase by > 20/10 mmHg]) and no change in heart rate, also indicative of poor sympathetic reserve. On orthostatic testing, systolic blood pressure dropped from supine average of 92 mmHg to 68 mmHg within 30 s of standing, and further down to 57 mmHg by the 50th second, at which time we terminated the test. His heart rate increased from 49 at baseline to 63 bpm at termination of orthostasis. Peripheral resistance averaged 860 dyn.s.cm− 5 at baseline and increased only minimally (to ~ 990 dyn.s.cm− 5) with standing. Concomitantly, stroke volume decreased from 83 ml supine to 54 ml at the end of standing (50 s), suggesting excessive venous pooling. His hypotension, chronotropic incompetence, suboptimal baroreflex-mediated responses, impaired increase in vascular resistance and significant venous pooling all indicated a loss of sympathetic tone, consistent with acute autonomic dysfunction due to an acute autonomic ganglionopathy which, in his case, was presumed to be autoimmune in nature given its development while on ICI.\nTreatment was initiated with pulse dose solumedrol 1 g IV for 6 days that was converted to oral prednisone upon hospital discharge and was slowly tapered over months. Although there was no serologic evidence of the presence of autoantibodies, seronegative cases of autoimmune autonomic ganglionopathy (AAG) have been shown to respond to intravenous immune globulin (IVIg) [, ]. Thus in addition to steroids, IVIG was administered initially as 0.4 g/kg daily for 5 days (total dose 2 g/kg), followed by 1 g/kg every 2 weeks as maintenance (Fig. ). He was also maintained on midodrine (up to 20 mg three times daily), fludrocortisone (up to 0.3 mg per day in divided doses) and sodium chloride tablets (1 g three times daily). His blood pressure gradually improved to 100/60s mmHg and several months later fludrocortisone and salt were tapered off, midodrine dose was tapered down, IVIg was discontinued, and he was maintained on prednisone 7.5 mg daily, with systolic blood pressures ranging 100–120 s mmHg and minimal orthostatic changes on variable doses of midodrine as the sole treatment agent.\nRestaging CT scans approximately 4 months after the last dose of combined ICI showed disease progression in the lung and anal region for which he underwent re-excision of the anal mass followed by palliative radiation. Nivolumab alone was restarted which was well tolerated and he did not have reoccurrence of AAG at this time. Six months later CT scans showed disease progression and he was re-induced with combination ICI, but with only 1 mg/kg of ipilimumab and 3 mg/kg of nivolumab. This led to a milder exacerbation of his orthostatic hypotension, which responded to 2 mg/kg of prednisone followed by a slow taper. After his symptoms improved, he was re-challenged with nivolumab alone but again became hypotensive and ICI was discontinued. He also developed autoimmune transaminitis that was rapidly responsive to oral prednisone. Other treatment options were offered, however he opted for hospice care and ultimately passed away from disease progression.
A 21 year-old female undergraduate student presented with a 2 year history of spinal, pelvic and distal thigh pains with an insidious onset. There were no reports of neurogenic-type pain or sensory changes. See Fig. for the body chart.\nThe patient reported a slight weakness negotiating a flight of stairs but she was unsure if she felt weakness in her lower extremities or her trunk. Aggravating factors included walking up more than down stairs, sit to stand transfers and stepping up curbs. In sitting, no symptoms were evident.\nThere was no history of weight change, night sweats or recent infections/systemic illness. Early morning stiffness was described as minimal but lasted 40 min. There was no family history of any significance. The patient recalled always being last at running races as a child but no missed milestones or paediatric input was highlighted. Medication included naproxen and paracetamol as required, taken a few times per week with mild relief. No other medical, drug or mental health history was noted. Attendance at University had not been interrupted. No change to social activities or family relationships were reported due to the symptoms.\nPast treatment included recent private physiotherapy and the patient’s interpretation was that “core exercises” had been initiated. These had been performed twice a day for 2 weeks. Subjectively, pain severity and the sense of strength when negotiating stairs had improved by 10% since starting the exercises. Care was transferred to the authors NHS service as is typical in the UK to enable free provision of assessment and treatment.\nA 9-question tool called The Subgroups for Targeted Treatment (STarT) back screening tool questions patients on matters such as catastrophising, fear, anxiety and depression []. The tool has been advised to identify back pain patients who may have modifiable aspects to their presentation that may benefit from cognitive-behavioural approaches [].\nThe initial STarT back score was 7 with a subscore of 4 (see Additional file ) indicating a high risk factor for spinal pain-related disability []. The score indicates significant psychosocial risk factors for a poor prognosis [] and stratification to physiotherapy services to deal with psychosocial elements would be advised [–]. The EuroQol 5D (EQ. 5D) questionnaire gives health related quality of life and psychometric analysis that has demonstrable construct validity and reliability []. The patients EQ. 5D responses demonstrated severe pain, functional impact and anxiety/depression scores (see Additional file ).\nSubtle spinal rotation and thoracic scoliosis concave to the right was noted on standing. The gait pattern was entirely normal including rope walking tasks. The sit to stand movement pattern was abnormal. A wide base of support was achieved by abducting the hips. The lower limbs were internally rotated and the upper limbs were used to assist rising from the chair.\nDermatomes, reflexes and tone were deemed normal. There were no Babinski or Hoffmann’s reflexes. There was no clonus at the feet. The Romberg’s test was also negative and there was no dysdiadochokinesis. Myotomal examination revealed no focal weakness when examined in isolation, but weakness was apparent during sit to stand and bridging tasks. Single leg stance demonstrated a good ability to maintain pelvic and trunk posture with no Trendelenburg. There was no visible muscle atrophy but a mildly raised BMI may have limited the ability to detect a loss of muscle bulk.\nLumbar spine movements into extension and side flexion were normal and pain free. Flexion was relatively reduced (fingers to mid-tibia) and some spinal pain was reported at the end of range. Rising from flexion involved bracing of the lumbar spine and movement generation from the thoracic region and hips. Neurodynamic tests were unremarkable. Spinal palpation was pain free. The thoracic spine moved well and gave no pain responses. The hips moved well and quadrant testing was normal. Distal joint screening revealed no evidence of inflammation or synovitis.\nAtypical movement patterns were evident but no focal neural concerns on testing in clinic, pointing to either central cord or nerve root pathology, were detected. The initial plan was to monitor and continue exercise-based physiotherapy input especially in light of recent gains from exercise.\nPhysiotherapy focused on functional movement quality with a trunk and lower limb strengthening programme. No formal myotome weakness was detected but the functional challenge when standing and the effortful nature of bridging was enough to warrant a programme to strengthen these tasks. Bridging was the main focus of the physiotherapy programme that involved review and progression of an exercise programme. Sit to stand exercises from a raised position were also encouraged. Reassurance was provided regarding the negative examination findings in clinic as evident fear and anxiety had been displayed in clinic and on the questionnaire responses. A review with the initial Extended Scope Practitioner (ESP) was advised if no further gains were made or any regressions materialised.\nSome subjective gains were reported but objectively there were no gains after four sessions of treatment over a 2 month period. The ESP reviewed again. Isolated trunk and limb strength was re-assessed using myotome testing as well as isometric hip strength testing into abduction and extension. This again proved negative. Bridging remained effortful but the sit to stand movement was the main evident limitation.\nAn MRI of the entire spine was ordered by the ESP to assess the cord/neural health. If this test proved negative the next suggestion was to explore a neurology referral. The MRI hoped to differentiate or rule out the following possible origins to the bilateral lower limb weakness: spinal cord pathology such as compression from intervertebral discs, inflammation or intrinsic tumour, or more rarely a parasaggital brain lesion. The lack of upper motor neuron signs suggested a lower probability of any brain lesions though. Anterior horn cell disease could be ruled out and was low on the hypothesis list as the patient was young and did not have any fasciculations. Spinal canal stenosis and cauda equina change could also be examined but there was no bladder/sphincter symptoms or saddle changes so again the level of concern was low. A primary muscle disorder was another possible origin to be considered.\nBlood tests ordered by the general practitioner had shown no significant change to inflammatory markers, urea, electrolytes or liver function. Repeat tests were scheduled by the general practitioner but did not include creatine kinase.
We present a case of a 28-year-old G1P0 female at 39 weeks coming for a primary cesarean delivery due to breech presentation. The past medical history was significant for extensive substance use disorder. On initial pre-operative consultation, it was discovered that the patient had oscillated between extensive drug use and rehabilitation cycles for a dozen years, experimenting with multiple illicit substances, causing her family and husband a lot of anger and strife. She underwent extensive rehabilitation and behavioral therapy through the years and was able to stabilize on maintenance dose buprenorphone + naloxone combination lozenge (Suboxone®) 8 mg/2 mg daily. She had been on this stable dose for 2 years prior to discovering that she was pregnant and was seen in consultation 4 weeks prior to her scheduled cesarean delivery.\nThe patient’s major concern was fear of receiving opioids and relapsing back into the addiction spiral. To appropriately plan, a large multidisciplinary team comprised of her addiction specialist, the in-house pain management physician, obstetrical anesthesiologist, the patient’s obstetrician, and labor and delivery charge nurses was assembled. An exhaustive discussion was held that covered all narcotic, non-narcotic, regional and alternative options for the perioperative period. All options, possibilities and acceptable expectations were discussed at length. The patient’s family was a major support structure and with her permission, they too were involved in the final planning. After two pre-operative visits, a plan was agreed upon and the cesarean delivery was scheduled.\nThe patient was the first case of the day and she took her daily Suboxone® maintenance dose. Her extended family and husband were present and provided immense support prior to her being transferred into the operating room (OR).\nIn the OR, standard American Society of Anesthesiologists (ASA) monitors were applied to the patient. She was properly positioned and an epidural was placed at the T8 level via loss of resistance to air technique. The catheter was threaded and a test dose was administered, which was negative for intravascular or intrathecal placement. This was followed by a spinal block with a 27-g pencil-point needle at the L4-L5 level. The 1.6 mL of 0.75% hyperbaric bupivacaine (12 mg) with 200 µg epinephrine was administered. After confirming a bilateral T5 sensory spinal level, the cesarean section was uneventfully performed and a healthy baby was delivered.\nAfter closure, the anesthesia team performed bilateral ultrasound-guided transverse abdominal plane blocks with a total of 15 mL 0.2% ropivacaine per side. The patient was then transferred to the post-anesthesia care unit and an infusion of 0.0625% of bupivacaine at 6 mL/h was started in the epidural. She was also given ketorolac 15 mg and acetaminophen 1,000 mg IV every 6 h for the next 24 h.\nThe patient was seen the following morning for her post-operative check with her epidural having been running for 18 h. She had been out of bed to her chair, starting in the prior evening with minimal discomfort. Her IV ketorolac and IV acetaminophen were switched to oral ibuprofen 400 mg and acetaminophen 650 mg every 6 h in addition to her daily maintenance Suboxone®. After expressing a desire to be free from the epidural, the infusion was paused, and then removed 4 h later, after experiencing minimal pain.\nThe remainder of the patient’s stay was unremarkable. She went home on post-operative day 2, having received no narcotics besides her maintenance Suboxone® dose throughout her entire perioperative stay. Her pain scores were minimal and she was very enthusiastic and satisfied with her care. She expressed immense gratitude and on serial follow-ups we were advised that the patient was doing great at home with no pain, not having taken any medication at all besides her daily maintenance Suboxone®.
A 56-year-old man who developed ankylosing spondylitis at the age of 33 in 1986 complained of dyspnea and back pain for 10 days before his first admission to the pulmonology department of our hospital via the emergency room in 2009. At another hospital in 2002, he had been treated with internal fixation of the thoracic and lumbar spine due to an ankylosing spondylitis-associated spine deformity. He was clinically diagnosed with smear-negative pulmonary tuberculosis in 2004 and received incomplete treatment. In 2007, he was diagnosed with reactivation of pulmonary tuberculosis and took anti-tuberculosis agents for 9 months . Medical records review showed that he was clinically diagnosed with smearnegative, culture-negative pulmonary tuberculosis based only on radiological findings and without mycobacterial confirmation. At the time of admission to out hospital, the patient was not taking drugs other than anti-tuberculous agents and nonsteroidal anti-inflammatory drugs for intermittent pain control. He has smoked half a pack of cigarettes daily for 15 years with occasional alcohol intake.\nThe patient was diagnosed with pneumonia and an exacerbation of chronic obstructive pulmonary disease at first admission. Therapy with daily intravenous antibiotics was begun following multiple blood, sputum , and urine cultures. Oral and inhaled bronchodilators were prescribed and oral prednisolone (30 mg) was maintained for 10 days. Since discharge in 2009, he has maintained medical treatments and respiratory rehabilitation. Treatment consists of oral medication, including methylxanthine, a long-acting beta 2 agonist (LABA), with inhaled therapy of a long-acting anticholinergic, inhaled corticosteroid and LABA combination.\nThe patient's initial chest radiograph, taken by the orthopedic department in 2006, showed apical linear fibrotic opacity with cystic changes similar to sequelae of pulmonary tuberculosis (). A nother chest radiograph, taken in the pulmonology department at first admission in 2009, showed patchy consolidations and ground-glass opacities in both lungs, and apical fibrosis with bullous changes suggesting stable tuberculosis and emphysema in both lungs (). Over the next 8 years, the patient's serial chest radiographs () and HRCT findings () showed bullous fibrocystic changes on both upper lobes, and the bullous cysts increased in size with disease duration. HRCT findings () revealed linear fibrocystic opacity, calcified granulomas, and traction bronchiectasis accompanying parenchymal lung destruction in both upper lungs compatible with post-tuberculosis sequelae, and pneumonic consolidations wi th ground-glass opacities in both lower lobes.\nDuring a follow-up period of 6 years from 2009 to 2014 in the pulmonology department of our hospital, the patient experienced frequent respiratory events and was hospitalized ten times. Among his respiratory events, pneumonia was the most common reason requiring a visit to the hospital, followed by acute exacerbation of chronic obstructive pulmonary disease and hemoptysis. The patient was hospitalized via the emergency room due to massive hemoptysis following superinfection of the cavitary-destroyed lung with mycetoma, and underwent bronchial artery embolization in combination with antifungal agents at the age of 60 in 2013. The pathogen was not confirmed by sputum or blood culture, but since aspergillus antigen was confirmed positive in serum, the lung lesions were thought to be associated with a fungal infection. Chest radiography showed that a fungal ball had been present in a fibrocavitary lesion of the left upper lung since 2011. The patient complained of symptoms such as worsening dyspnea and required oxygen therapy at home because of chronic respiratory failure.\nIn analyses of radiologic serial images with chest X-ray and HRCT, the progression of parenchymal lung destruction was correlated with disease duration in this patient with advanced ankylosing spondylitis. Chest X-ray () and HRCT () showed that the initial apical fibrosis in 2009 progressed to progressive fibrocystic bullous changes that involved both upper lobes with cavitations. In serial films, frequent superinfections of cavitary lung lesion with mycetoma in both upper lungs were noted. Although the patient was clinically diagnosed with smear-negative pulmonary tuberculosis and reactivation during previous treatment at another hospital, acid-fast staining and all subsequent mycobacterial sputum cultures were negative, and an interferon-γ release assay failed to detect mycobacterial infection.\nFollowing the investigation and retrospective review of medical records and radiologic findings by a pulmonologist, a rheumatologist, and a chest radiologist, the patient's progressive fibrocystic bullous lung changes were interpreted as pleuropulmonary involvement of extra-articular symptoms of advanced ankylosing spondylitis. The patient is currently managed at home with supportive care, maintenance medical treatment, and oxygen therapy. Considering the generally poor performance of patients with advanced-stage disease and the high risk of complications related to active treatments, surgical resection procedures, such as bullectomy, and anti-tumor necrosis factor α (TNF-α) agents are not being used.
An 81-year-old woman was transferred to our Neurocritical Care Unit at the University of Miami Hospital (from another hospital), for severe encephalopathy in the setting of a right frontal mass. Her past medical history was significant for coronary artery disease (status post stent placement 1 year prior to admission to our hospital), type 2 diabetes mellitus (DM), endometrial carcinoma (status post hysterectomy and chemotherapy more than 30 years prior to admission to our hospital), and aseptic meningitis with no sequelae (20 years prior to admission to our hospital).\nAt the outside hospital, where she was admitted 1 week earlier with a history of possible syncope versus seizure, dysarthria, runny nose, nausea, and diarrhea, her course was as follows: she was initially started on ciprofloxacin for her gastrointestinal manifestations; subsequently, she experienced a rapid deterioration of her neurological status, described as profound lethargy followed by the onset of bilateral weakness (right-sided greater than left-sided weakness) and cranial nerve abnormalities; viral encephalitis was suspected on clinical grounds alone and the patient was started on empiric intravenous acyclovir. A subsequent brain CT showed a right frontal brain mass; additional CT imaging of the chest, the abdomen and the pelvis was unremarkable. The patient was then transferred to our institution for further workup and management.\nUpon presentation, the patient was afebrile with stable vital signs (in room air). A neurological examination revealed that she was stuporous, opening eyes only to painful stimuli (with attempts to localize them with her left upper extremity), not following commands, and nonverbal. She had a left gaze preference and her pupils were anisocoric (left 6 mm and right 4 mm), but both reactive to light. Her right upper extremity and lower extremity were flaccid with no response to painful stimuli, and there was minimal withdrawal in her left lower extremity.\nHer laboratory data were unremarkable except for hyponatremia (sodium level: 131), hyperglycemia (glucose: 248) and mild anemia (Hgb: 11).\nA brain MRI, with and without gadolinium (fig. ), was performed, and the neuroradiologist's official report was as follows: large areas of high FLAIR signal and tubular/lobulated/ring enhancement in bifrontal regions with a smaller focus in the left anterior midbrain; overall, these findings indicate underlying multicentric glioma or multicentric primary CNS lymphoma.\nA lumbar puncture was also performed on admission, but CSF studies for bacterial, viral and fungal etiologies were unrevealing. The CSF chemical profile was within normal limits except for a mildly elevated protein level of 78.\nNevertheless, a high index of clinical suspicion for brain abscesses was maintained and, in consideration of the patient's age and her history of DM, empiric antimicrobial treatment was modified to include ampicillin, meropenem, vancomycin as well as voriconazole and pyrimethamine/sulfadiazine in order to prevent opportunistic infections. Intravenous dexamethasone was added due to significant perilesional vasogenic edema.\nAn open brain biopsy was performed, and on day 3 Gram-positive rods were reported to be growing in the surgical tissue culture. This eventually revealed the diagnosis of early abscess formation caused by L. monocytogenes infection.\nAll antibiotics but ampicillin were discontinued. Steroids were slowly tapered off and the patient was transferred to the regular floor 10 days after admission with no signs of neurological improvement. A percutaneous endoscopic gastrostomy was placed due to the patient's inability to swallow safely. Thirty-two days after admission, the patient was transferred to a rehabilitation facility with instructions to complete an 8-week course of antibiotic treatment.\nAt the time of discharge from our institution, the final neurological examination documented: eye opening to verbal stimuli, command-following with left upper extremity, incomprehensible sounds, pupils 4 mm bilaterally and reactive to light, partial left third cranial nerve palsy and left nasolabial fold flattening. Also noticed was the persistent significant weakness in her right upper extremity, right lower extremity and left lower extremity (minimal withdrawal to pain).
A 61-year-old African American woman with a past medical history of peripheral vascular disease (PVD), chronic venous insufficiency and pre-diabetes mellitus presented to our Emergency Department (ED) with worsening left lower extremity pain for the past 3 days. The pain was continuous, progressive and the patient denied any history of trauma. Examination showed a clean, shallow ulcer 2x3 cm with surrounding hyperpigmentation from stasis dermatitis; without discharges or signs of infection. Upon assessment, the pain was deemed to be due to chronic venous insufficiency. It improved with non-steroidal anti-inflammatory drugs and she was subsequently discharged from the emergency department. Three days later, the patient returned to the ED with worsening leg pain unresponsive to the oral analgesics. At this admission, she also reported inability to bear weight on the affected extremity. She denied fevers, chills, nausea, vomiting, abdominal pain, or urinary symptoms. Physical examination revealed erythema around the ulcer with increased warmth and mild tenderness. CT of her left lower extremity with intravenous (IV) contrast revealed subcutaneous edema and fascial thickening most prominently at the medial aspect of the lower extremity, compatible with cellulitis in the absence of a drainable fluid collection (). The patient was treated with IV ampicillin/sulbactam. There was evidence of symptomatic improvement and the patient was discharged with an oral course of antibiotics and zinc oxide compression bandages for local wound care. Her discharge diagnosis was lower extremity cellulitis with associated chronic venous insufficiency ulcer. Immediately upon leaving the hospital, the patient had a syncopal episode and collapsed; which prompted her to be rushed to the ED for further evaluation. In the ED, the patient presented with tachypnea and confusion and reported feeling short of breath. Physical examination revealed a blood pressure of 85/61 mmHg, heart rate of 131 beats per minute and respiratory rate of 32 breaths per minute with an oxygen saturation of 92% on non-rebreather mask 15 litres per minute. The patient was sedated and intubated due to dyspnea, increased work of breathing and hemodynamic instability. A central venous catheter was placed, along with initiation of vasopressors. CT scan of the head showed pneumocephalus within the cavernous sinus and clival venous plexus in the absence of skull base fracture, acute hemorrhage, mass effect or evidence of an acute ischemic infarct (). CT with IV contrast of pulmonary artery revealed saddle pulmonary embolus with pulmonary emboli extending into the right and left main pulmonary arteries, bilateral lobar and segmental arteries. The Figures also showed marked right heart strain with bowing of the interventricular septum and reflux of contrast within the IVC and hepatic veins, and pooling of contrast within the right heart. It also demonstrated air within the right ventricle as well as subcutaneous emphysema involving anterior chest wall and right supraclavicular fossa. Foci of air are also seen tracking into the hepatic vasculature likely iatrogenic from contrast administration (). Due to her clinical condition and imaging findings, the patient received thrombolytic therapy (recombinant Tissue Plasminogen Activator) for pulmonary embolism. Subsequently she was admitted to the critical care unit. Her initial laboratory results revealed lactate of 3 mmol/L (reference range 0.5-2.2), troponin I <0.01 ng/mL (reference range <0.01) and N-terminal pro B-type natriuretic peptide (NT-pro BNP) at 61 pg/mL (reference range <300 pg/mL). She was started on therapeutic anticoagulation with heparin drip afterwards. The patient was extubated next day and put on high flow 100% O2 as a trial to improve resorption of air in the vasculature. Once the patient was hemodynamically stable, there were no apparent neurological deficits noted as a result of cerebral air embolism. Two days after extubation, repeat CT head revealed resolution of air in cavernous system (). Venous duplex of her lower extremities revealed no evidence of thrombosis bilaterally (). Patient was transitioned to oral anticoagulation and discharged after two days of hemodynamic and clinical recovery.
An 85 year-old Caucasian man, affected by chronic renal failure, had been undergoing hemodialysis treatments three times a week for the previous three years. His fluid intake was controlled and he was unable to eat independently. Due to a severe episode of macrohematuria (International Normalized Ratio, I.N.R. 6.1), he was transferred to the local hospital where continuous bladder irrigation was promptly activated with a 3-way catheter. Irrigation fluid with 0.9% saline solution was injected from a height of about 150 cm without pressure. A urine bacteriologic culture test was immediately performed, whose results, obtained some days later, were negative. During the first three days of irrigation, the patient did not claim any problems and successfully underwent hemodialysis as usual. On the third day of his hospital stay, while still undergoing bladder irrigation, he suddenly experienced extreme shortness of breath, breathing difficulties, and a cough with frothy sputum. The nurse attending him immediately noted that there was no return of the fluid (5 liters) introduced through bladder irrigation. No manual evacuation of the bladder was performed during the treatment. A chest radiography revealed cardiomegaly, mild perihilar interstitial infiltrates and an increase of the pulmonary vasculature leading to pulmonary edema. An electrocardiography revealed nonspecific ST-T wave changes. Cardiac isoenzymes were within normal ranges; hemoglobin values were constantly >7 g/dL. A computed tomography (CT) of the abdomen was immediately performed and excluded the perforation of the bladder walls and an intraperitoneal fluid extravasation. The patient was treated urgently once again with hemodialysis. At the beginning of the dialysis, the patient had gained weight for 7.4 kg since the previous measurement (24 hours prior) without any clear explanation. Despite a significant weight loss (from 81 to 76 kg) following the dialysis, the patient died shortly after the final treatment.\nThe prosecutor opened an investigation, ordering that an autopsy was to be performed to clarify the exact mechanism of death. The autopsy was executed 24 hours after the patient's death. The results revealed that the brain and the lungs were heavily edematous: the brain weighed 1700 g, the left lung weighed 790 g while the right lung weighed 590 g. The heart was found increased in size (12 × 8.5 × 8 cm) and weight (660 g), coronary vessels and main branches showed slight stenoses. The kidneys were small and showed a finely granular external surface; in cross-section, a gross diminution of cortical thickness with loss of demarcation between cortex and medulla was evident; each kidney weighed 100 g. A small amount of soft blood clots was found in the bladder. Other organs were unremarkable. Samples of organs were taken for histological examination and sections were stained by Hematoxylin & Eosin. On bladder specimens an immunohistochemical study using mouse monoclonal anti-pan cytokeratin antibody AE1/AE3 was performed in order to investigate the urothelium cells. A microscopic examination of the bladder specimens revealed interstitial and mucosal swelling; loss of the umbrella cell layer (superficial urothelium) was evident while intermediate and basal urothelial cells were preserved. The bladder section expressed a very low positivity to AE1/AE3 antibody in comparison with a control case (bladder specimens in a 70 year-old man who had died of pulmonary embolism) which revealed a positive labeling with both AE/1 AE/3 antibodies. PAS and Alcian blue staining demonstrated a clear absence of the superficial layer of glycosaminoglycans (GAGs) in comparison with the control case (Figure ). Altogether the abovementioned findings were suggestive of a diffuse disruption of the urothelium.\nThe histological examination of other organs was unremarkable except for a massive cerebral and pulmonary endoalveolar edema, myocardial colliquative myocitolysis and mild diffuse arteriolosclerosis.\nIn conclusion the death of the man was attributed to an acute severe pulmonary edema due to massive fluid absorption.
In 1994, a 34-year-old woman suffered from a left arm caput humeri fracture that led to open reduction and internal fixation by a plate osteosynthesis. During the next 4 years, she developed a severe posttraumatic omarthrosis that necessitated the implantation of a total shoulder joint arthroplasty. Eight years later, she again injured her shoulder and now suffered from a rotator cuff lesion and a slight loosening of the humeral stem. The rotator cuff lesion was treated by open surgery, and the humeral part of the arthroplasty was changed. In 2006, the patient injured her shoulder once more and this time the TJR was luxated and a major rotator cuff lesion was diagnosed. Once again surgery was proceeded. The TJR was restored and the rotator cuff lesion was fixated. Five days after this procedure, signs of a severe infection occurred. With further surgical revisions and antibiotic treatment, the situation could be solved. But due to these revisions, the rotator cuff was destabilized because of the loss of soft tissue, and during the following months, the arthroplasty luxated frequently. In September 2006, a reversed shoulder arthroplasty (Grammont prosthesis) [] was implanted. All these procedures were performed in external institutions. We do not have more detailed information about the patient’s history before the lady was sent to our department of septic and reconstructive surgery in July 2007. We could not obtain precise information why the primary osteosynthesis led so rapidly to a severe omarthrosis, about the implantation of the TJR and finally why a reversed endoprosthesis was implanted in such a young lady.\nWhen she came to our department, she showed signs of an acute exacerbation of the already known infection of the left shoulder joint (white blood cell count (WBC): 9.3 × 109/l, C-reactive protein (CRP): 37 mg/l). First goal was to get in control of the infected articulation and preserve shoulder function.\nThe patient was taken into the surgical revision program. In the first step, the arthroplasty was removed as well as the surrounding bone cement. Necrotic and infected bone and soft tissues were removed, a hybrid-spacer made from an intramedullary nail and a custom-made gentamycin PMMA spacer was implanted (Fig. ). The microbiological examination of the specimen taken during the first surgical revision lead to the detection ofStaphylococcus epidermidis. Thus, an additional antibiotic therapy was performed. After two further operations (debridement and lavage), no further sign of infection could be detected. The wound healing showed no pathological findings and the paraclinical values turned back to normal (WBC: 9.2 × 109/l, CRP: 6 mg/l). No bacteria could be detected microbiologically from the specimen taken during the last operation.\nOur planned approach was to reconstruct the shoulder joint by custom-made tumor-TJR 12 weeks after we gained sterility. But the patient refused any further surgical procedures. The patient felt well and was highly satisfied with the result of the last procedure. Even though the hybrid-spacer, which was now replacing her left shoulder joint, was not planned to be a definitive solution, it was left in situ.\nTwelve weeks after surgery, the range of motion of the shoulder was as follows: active: 40/0/10° (anteversion/retroversion); 30/0/10° (abduction/adduction) with free passive motion (Fig. ).\nShe was recommended not to carry more than 3 kilos of weight with her left arm. At her 12 months check up, the lady was still highly satisfied with her situation. Meanwhile, she had turned back to work in her beauty parlor (administration and supervision tasks, no active hairdressing anymore).
The patient was a 21-year-old Caucasian female with a past medical history of uncomplicated laparoscopic appendectomy (1 month prior to the time of presentation), major depressive disorder, asthma, iron deficiency anemia, pelvic inflammatory disease secondary to sexually transmitted Chlamydia trachomatis infection, and SLE. She presented to the emergency department from an outside hospital complaining of severe right upper quadrant abdominal (RUQ) pain for one day that was non-radiating. She had been hospitalized for two weeks prior to the time of this presentation with a de novo diagnosis of SLE with the debut of GI symptoms after running out of her original prescription for steroids and hydroxychloroquine two days prior. Overall, her abdominal pain was accompanied by fever, nausea, vomiting, diarrhea, headaches, diplopia, generalized muscle weakness, and arthralgias. She denied vaginal bleeding or discharge. Physical examination was most significant for diffuse tenderness to palpation of the abdomen especially in the RUQ, a negative Murphy's sign, and well-healing surgical incision sites. Vital signs remained within normal limits. An erythematous facial rash with a butterfly pattern was noted as well as tenderness to palpation of the metacarpophalangeal and interphalangeal joints of both hands. The differential diagnosis at this point included a severe lupus flare secondary to medication shortage, acute cholecystitis, acute pancreatitis, Celiac disease, or enterotoxigenic Escherichia coli (ETEC or traveler's diarrhea). Blood work including complete blood counts and metabolic profiles were negative for any acute processes during her admission except for an elevated lipase level three times above normal. A urine pregnancy test was also negative. Stool tests for white blood cells, gram staining, ova and parasites, and Clostridium difficile were also negative. A CT scan of the abdomen and pelvis with contrast showed moderate wall thickening of the duodenum and proximal jejunum and moderate adjacent-associated inflammatory stranding most compatible with infectious/inflammatory enteritis (Figure ; obtained with consent from the hospital radiology department). Thus, we could safely rule out Fitz-Hugh-Curtis syndrome as well despite the patient's history of pelvic inflammatory disease.\nThe case was determined to be non-surgical based on the lack of acute abdomen on exam and negative imaging findings. Gastroenterology planned for upper endoscopy (esophagogastroduodenoscopy, EGD). Rheumatology ordered autoimmunity standard tests and started the patient on pulse-dosed intravenous (IV) methylprednisolone (which was transitioned to oral prednisone after three days), oral hydroxychloroquine, and low-dose lisinopril once daily for scleroderma renal crisis (SRC) prophylaxis. EGD showed edematous mucosa in the duodenum and jejunum without active bleeding, gastropathy, or ulceration (Figure ; obtained with consent from the hospital endoscopy department). Biopsies obtained from the EGD were non-specific (Figure , obtained with consent from the hospital pathology lab). The autoimmunity standard tests including anti-nuclear antibody (1:2560 titer), double-stranded DNA (1:80 titer), C3 (45 g/L), C4 (4 g/L), and anti-Smith (175 AU/mL) were strongly positive. Antiphospholipid antibodies were negative, as were anti-transglutaminase (TTG) antibodies for Celiac disease. This confirmed the diagnosis of a severe flare of lupus; more specifically, lupus enteritis secondary to medication shortage was determined to be the principal cause of the patient's abdominal pain. The patient continued to have intermittent bouts of moderate to severe periumbilical abdominal pains and non-bloody diarrhea that were treated with supportive care. Her symptoms responded very well to treatment by day four, and she had no further complications during her hospital stay.
A 56-year-old female patient was transferred to our department of critical care medicine, Huashan hospital in Shanghai in June 2016 after she received treatment in a local hospital for productive cough, tachypnea and respiratory distress. She complained of recurrent fever and asymmetric edema of the lower extremities for over 1 month, as well as painful swelling both in the thyroid and labium majus for 2 weeks. In the previous hospital, due to the finding of multiple bilateral cysts which were palpable nodules in her thyroid gland by ultrasound examination, a left lobe thyroid puncture and drainage had been conducted and an aspergillus fumigatus infection was detected. She had a history of systemic lupus erythematosus (SLE) and lupus nephritis for 8 years, and received prednisone treatment for these diseases. But from November 2015, prednisone was switched to methylprednisolone, and hydroxychloroquine has been added because of lupus nephritis aggravation, and tacrolimus has also been added to the medications in the following month. She was also diagnosed with renal hypertension and diabetes induced by steroids, and received antihypertension and antihyperglycemic therapy. She had no history of pulmonary diseases such as chronic obstructive pulmonary disease (COPD), asthma, or any repeated infections, and had no addiction to drugs, smoking or alcoholism. Previous examinations showed no evidence of neutropenia. The ratio of CD4/CD8 was 0.33. Only one aspergillus test was positive in repeated sputum cultures. The galactomannan aspergillus antigen and culture tests in BALF were negative, so were blood and urine cultures including fungi. Our chest computed tomography (CT) imaging revealed bilateral patchy lung opacities in the middle and lower lobes, along with multiple shadows of fibrotic streaks, high-density nodules and mediastinal calcification of lymph nodes (Fig. ). The diagnosis of pulmonary infection was established, and pathogen was highly suspected of aspergillus according to the previous finding of thyroid puncture and drainage. An ultrasound examination showed thrombosis in the bilateral femoral veins and popliteal veins. In addition, a 51 × 16 mm hypoechoic lesion was detected in the left subcutaneous perineal region. We continued voriconazole therapy in a standard treatment dose (200 mg twice a day), but her body temperature was still up to 37.6 °C intermittently. Her white blood cells were 15.61 × 109/L (neutrophils 90.8% and lymphocytes 5.4%), hemoglobin was 93 g/L, and platelets were 295 × 109/L. Except hyperglycemia, proteinuria, and hypoproteinemia, other routine laboratory tests were unremarkable, which including thyroid hormone levels. A neck CT showed findings consistent with a fluid collection in the right thyroid lobe (Fig. ). Cultures of aspirated purulent fluid showed aspergillus fumigatus growth, which was obtained from fine needle aspirations in both thyroid and perineum. Five days after being transferred to our hospital, the patient’s thyroid drainage tube was removed because no further fluid was drained out. We continued the voriconazole dose 400 mg per day as anti-aspergillosis therapy with 16 mg methylprednisolone and 400 mg hydroxychloroquine per day as immunosuppressive therapy, along with a therapeutic 4100 iu q 12 h dose of nadroparin calcium. The patient’s fever was relatively controlled and white blood cells decreased to 10.74 × 109/L (neutrophils 91.7%, and lymphocytes 4.7%). Lesions in the thyroid and subcutaneous labium majus became significantly smaller, and the pain was greatly relieved. On the eighth day of hospitalization, the symptoms had improved and the patient was discharged from our hospital. She continuously took voriconazole orally (400 mg per day) for 6 months, combined with caspofungin for the initial 2 weeks (first day 70 mg, then 50 mg per day). After 1 month of antifungal treatment, she was afebrile and all the clinical symptoms were relieved. The patient is on a follow-up for 1 year and has been free of aspergillosis for 6 months. Hydroxychloroquine treatment ceased in April 2017, and methylprednisolone dose was reduced in a tapered manner.
A 30-year-old male with no past medical history, except a diagnosis of schizophrenia, had a second psychiatric hospitalization for the treatment of worsening delusions and hallucinations. His first hospitalization occurred approximately 1 month prior, and discharge medication was olanzapine 20 mg at bedtime. Also, at that time his platelet count was 156 × 103/μL; reference range is 135 × 103/μL to 317 × 103/μL (). Three days prior to the current admission, the patient had self-discontinued olanzapine because of blurry vision. During the hospitalization the patient was trialed on multiple antipsychotics without benefit. Because of persistent psychotic symptoms, clozapine 25 mg at bedtime was initiated on hospital day (HD) 24. A complete blood count (CBC) with differential at that time revealed no derangements, including a platelet count of 156 × 103/μL.\nBy HD 29, clozapine was titrated to 175 mg at bedtime, at which time the patient started to complain of sialorrhea with nighttime predominance. One drop of ophthalmic atropine 1% sublingually administered at bedtime was initiated but was ineffective after 5 days of use, and the patient was not agreeable to an increase of the drops. The patient reported awakening at least 5 times throughout the night to “spit into a water bottle” and complained of having a wet pillow every morning. Both the bottle of saliva and wet pillow were observed by staff. Clinically, clozapine was increased to target psychotic symptoms, but it was divided as 50 mg in the morning and 150 mg at bedtime in an attempt to minimize sialorrhea. This was not successful to reduce the excessive salivation. Clozapine was further increased to a total daily dose of 250 mg by HD 36 with improvement in psychotic symptoms, although sialorrhea persisted. Clonidine 0.05 mg by mouth twice daily was added on HD 37 to target sialorrhea. On HD 39, the patient reported improvement of sialorrhea, and objectively his pillowcase was found to be dry during morning rounds.\nDuring the first week of clonidine treatment (HD 37-43), the patient's platelet count decreased from 146 × 103/μL to 132 × 103/μL. Clozapine had reached a total daily dose of 300 mg by HD 43. On HD 50 the platelet count remained the same, but on HD 52 the platelet count was found to be 117 × 103/μL. All other cell line values were within normal limits. There were no concerns for bleeding, evidence of bruising, or petechiae, but the decision was made to discontinue clonidine given the new thrombocytopenia. Sialorrhea was treated with continued sublingual ophthalmic atropine 1%, 1 drop at night, with the patient accepting additional as needed doses, using on average an extra 2 to 3 drops per day. Five days later, on HD 58, a CBC with differential revealed that the platelet count was within normal limits at 153 × 103/μL. At this time the patient was also noted to be psychiatrically ready for discharge. Delays related to placement issues resulted in the patient leaving the acute care psychiatric hospital on HD 84. Discharge medications included clozapine 150 mg in the morning and 150 mg at bedtime; atropine 1% drops, 1 drop sublingually at nighttime and as needed; melatonin 3 mg at bedtime; and senna/docusate 8.6/50 mg twice daily as needed for constipation.
A 6-year-old girl presented with complaint of a solitary, raised skin lesion of size 15 × 12 cm over the back of her left knee since five months. Initially, she developed an erythematous swelling of size 1 × 1 cm over the site; the swelling was insidious in onset and gradually progressive in nature. She subsequently developed intermittent, moderate grade fever associated with chills and rigors that subsided upon taking medication. The swelling grew to 15 × 12 cm size within 3 months, with tenderness, but no discharge. It also led to difficulty in flexion of the left knee joint. She underwent incision and drainage of the swelling at a private clinic. However, the swelling continued to progress and within one month of surgery, the swelling progressed to 15 × 10 cm size, filled with pus and associated with tenderness. Magnetic resonance imaging of the swelling showed it to be cellulitis and fine-needle aspiration cytology suggested an abscess. She again underwent incision and drainage. At the time of presentation to our centre, she had an annular plaque of size 15 × 12 cm having an erythematous to violaceous, raised, indurated and tender periphery and a centrally atrophied plaque extending from the lower third of thigh, involving the knee joint along with the popliteal fossa and downward up to the upper one-third of left leg []. The center of the plaque showed three hypertrophic scar marks of the previous incision and drainage []. Movements of left knee joint were restricted. She had no history of trauma, insect bite, no atopic diathesis such as seasonal rhinitis or atopic dermatitis, contact dermatitis, morning stiffness of the joint, Raynaud's phenomenon, thyroid disorder, vitiligo, or alopecia areata.\nPast history was insignificant; there was no history of consanguinity and the patient was delivered as full term normal vaginal delivery. Her systemic examination was normal. She had leukocytosis with an erythrocyte sedimentation rate of 70 mm/h. Absolute eosinophilic counts along with serum IgE levels were within normal limits. Her thyroid profile showed raised serum total T3 level (225.5 ng/dl) along with raised free T3 level (4.6 pg/ml). Her pediatrician consultation was done, but no active intervention was required. Her blood sugar, antinuclear antibodies, renal function and liver function tests were within normal limits. Rheumatoid arthritis factor and C-reactive protein were negative. Routine and microscopic examination of stool and urine were normal. Serology for human immunodeficiency virus (HIV) I and II by Combi-AIDS kit was negative. Ultrasonography of the affected leg showed subcutaneous soft tissue swelling around the knee joint. Skin biopsy confirmed a diagnosis of eosinophillic panniculitis showing infiltration of eosinophils in subcutaneous fat []. In our case, no definitive causative factor for panniculitis was found. Patient was given oral antibiotic for 1 week before 1 month of reporting to us. Patient responded well to the oral prednisolone 30 mg given once a day. It was tapered after every 15 days by 10 mg, which got completed after 6 weeks and also we had put her on tablet dapsone 50 mg daily for a period of 1 month. Orthopedic referral was made, and she was advised physiotherapy for the left knee to which she showed good response. She responded well to treatment []. The treatment was then stopped; the patient was advised monthly follow up for 6 months that was uneventful.
A 17-year-old female patient reported to the Department of Periodontology and Oral Implantology with a chief complaint of severe mobility of her upper and lower front teeth. She had started noticing the mobility since the past two years and it was noticed that the mobility had increased progressively over the years. This was the first dental visit for the patient and the past medical and social histories were noncontributory. There was no relevant familial history of the disease and hence the patient was considered to be a first generation sufferer. The clinical intraoral examination revealed the presence of normal color and morphology of the crowns of all teeth. Stable gingival and periodontal health was confirmed by a thorough intraoral assessment, which demonstrated a clinical absence of gingival inflammatory changes, absence of bleeding on probing, as well as, loss of clinical attachment. However, assessment of mobility revealed grade III mobility of the upper and lower anterior teeth and all the four first premolars. The second premolar and molar teeth remained immobile. The patient demonstrated good oral hygiene and there were no other relevant intraoral findings noted. An orthopantamogram of the patient revealed rudimentary and nearly absent root structures in relation to the upper and lower anterior teeth, the premolars, and molars []. The intraoral periapical radiographs revealed a defective morphology with a strikingly flared, inverted, crescent-shaped appearance of the roots of the mandibular first molar teeth []. There was a generalized total obliteration of the pulp tissues within the pulp chambers and root canals [Figures –]. An interesting feature was the absence of periapical radiolucencies and periradicular lesions. Also, there were no associated osseous changes or bone pathologies detected. Based on the clinical and radiographic findings of the disease, the diagnosis was established as dentin dysplasia type I. However, the findings of this case did not fit into any subtypes of the existing classification systems of the disease. The observations of an absence of familial hereditary pattern, the absence of periradicular radiolucent lesions and osseous pathologies, and the variant morphological defects of the molar roots were diverse from the classical findings of the various subtypes of dentin dysplasia type I reported to date.\nThe treatment plan was formulated based on the age of the patient, the expected esthetic outcome, and the long-term prognosis of the therapy. The patient had completed the craniofacial growth phase and was highly concerned about the esthetic outcome of the treatment. As the patient was 17 years old at the time of the visit to the dental office, a major period of growth and growth spurts was completed. Hence, no further changes in the craniofacial structure that might cause gross future occlusal derangement were deemed to occur and no further growth investigations were carried out. Taking all these multiple factors into consideration, an implant-based oral rehabilitation was finalized as the treatment for this patient. The treatment plan was explained in detail to the patient and her family and a written informed consent was obtained from the patient as well as the guardian of the patient.\nThe surgical sites extending bilaterally between the first premolar regions in the maxilla and mandible were anesthetized using local administration of 2% lignocaine hydrochloride (LOX, Neon Laboratories Ltd., Mumbai, India) with 1: 200,000 adrenaline. All the Grade III mobile teeth were extracted and the osteotomy site preparations were carried out under copious irrigation with sterile isotonic saline solution. After establishing proper depth and direction, a total of 10 self-threaded titanium implant fixtures, including six in the maxillary and four in the mandibular regions were placed []. Temporary maxillary and mandibular removable partial denture prostheses were delivered []. Postoperative care included a prescription of 8 mg of betamethasone and 2 g/ day dosage of amoxicillin, for 10 days. The patient was advised to rinse with warm saline solution for the first two weeks to promote flap healing without disturbing the surgical sites. The patient was also instructed to use 0.12% chlorhexidine gluconate mouthwash (Peridex, Zila Pharmaceuticals, Phoenix, AZ, USA), twice daily, to facilitate plaque control. The surgical sites were checked every two weeks for a period of two months. Following six months of healing, the second surgical procedure to uncover the implants was performed, the abutments were placed, and the final prostheses were delivered [Figures and ]. The patient and family members expressed a positive response toward the superior esthetic and functional outcome of the treatment. The patient has been put on a strict maintenance program with a first year recall interval of three months, followed by a review once in six months to one year, based on the home care performance and assessment of the intraoral health status.
A 63 year-old female with longstanding type-1 diabetes mellitus and hypertension developed chronic renal failure in 2002 and underwent a pre-emptive renal allograft transplant from her donor husband in 2004 without requiring prior dialysis. Both the donor and recipient were cytomegalovirus-negative. She received basiliximab 20 mg prior to her transplant surgery and another 20 mg on day 4 post-transplant. Following transplantation she was immunosuppressed with mycophenolate mofetil, prednisone and tacrolimus. She had longstanding stable kidney function following transplantation with a baseline GFR of 84 mL/min and a creatinine of 80 micromol/L. Her past medical history was remarkable for iatrogenic hypothyroidism following parathyroidectomy for primary hyperparathyroidism, and she had no prior history of malignancy.\nIn April 2015, after ten years of immunosupression, she developed an irregular hyperpigmented and evolving lesion on her left upper back which was resected in May 2015. The biopsy of the left scapular site revealed a superficial spreading invasive melanoma with a maximum Breslow thickness of 2.59 mm, Clark level of IV, with, mitoses of 5/mm2. No ulceration was identified, but tumor infiltrating lymphocytes and tumor regression were present. Peripheral margins were uninvolved, but deep margin was involved by a satellite nodule and microsatellitosis was also present. Wide-local excision and bilateral axillary lymph node biopsies were performed July 2015, as lymphoscintigraphy had identified drainage of each of the lesion to the contralateral axilla when injected with technetium 99 sulfur colloid. Three right axillary lymph nodes were removed and were negative for malignancy, but 1 left axillary lymph node was removed and pathology revealed an 8.5 mm × 7.5 mm melanoma deposit with extranodal extension. As a result, the patient required a wide local excision with a 2 cm margin and pathology demonstrated residual disease and microsatellites, with negative margins. A second lesion was excised at the time of surgery in the right scapula, again consistent with superficial spreading invasive melanoma, Breslow thickness 1 mm, Clark level II, without ulceration, no mitoses and clear margins (pT1a). Completion lymph-node dissection August 2015 retrieved 22 lymph nodes, all of which were negative for melanoma, with final American Joint Committee on Cancer (AJCC) pathological staging of pT3aN2c.\nStaging CT in July 2015 showed a non-specific 6.5 mm non-calcified right lower lobe (RLL) lung nodule, not previously present. BRAF mutation test of the with real-time PCR assay using the Qiagen BRAF RGQ kit was BRAF wild-type. The patient was not offered adjuvant radiotherapy and declined high-dose adjuvant interferon.\nFollow-up CT imaging in October 2015 demonstrated increase in size of the RLL lung nodule and the appearance of at least eight new subcentimeter bilateral pulmonary nodules, along with increased mediastinal and left hilar lymphadenopathy (12 mm). The patient was asymptomatic. A follow-up 2-deoxy-2[F-18] fluoro-D-glucose (FDG) PET-CT scan in December 2015 demonstrated an intensely hypermetabolic (SUV max 9.9) left hilar lymph node enlarging to 16 mm, along with non-FDG avid pulmonary nodules. An endobronchial ultrasound-guided biopsy of the hilar lymph node (station 11 L) demonstrated atypical cells reactive for S100/melanA, confirming metastatic melanoma. Her case was discussed at the multidisciplinary tumor board and renal transplantation team, and a recommendation for anti-PD-1 treatment was made, based on available safety data and high risk of cancer-related mortality. Full discussion with patient and her husband regarding the risks and benefits of treatment were had and the patient wished to proceed with treatment including unknown risks of allograft rejection. Immunosuppressive medications were titrated off and she was left on 10 mg of prednisone daily, with no deterioration in renal function prior to nivolumab administration.\nThe patient received her first treatment of nivolumab (anti-PD-1 treatment for metastatic melanoma, single intravenous dose of 324 mg) on January 7th, 2016. She reported no subjective toxicities within the first week of treatment, but on day 8 the patient developed lethargy, abdominal pain, nausea, vomiting and loose stools (4 times per day), malaise, anorexia and fatigue. Physical examination demonstrated signs of uremia and concurrent tenderness in the lower abdomen at the site of allograft implantation without peritoneal signs. Laboratory investigations showed a creatinine rise to 577 micromol/L without any change in electrolytes. The ultrasound Doppler of her kidney showed markedly abnormal appearance of the transplant kidney with findings suggestive of acute medical renal disease, poor perfusion and elevated resistive indices concerning for transplant dysfunction. She received a pulse of corticosteroids (methylprednisolone 500 mg IV × 1), and developed diabetic ketoacidosis requiring insulin infusion and initiation of hemodialysis. She had a second pulse of steroids with close endocrinologic monitoring and insulin sliding scale, after which prednisone was tapered down. Renal allograft function did not return and she was discharged home on hemodialysis. Nivolumab was withheld and the patient was observed.\nRestaging CT thorax on February 2016 demonstrated a partial resolution of bilateral pulmonary nodules, hilar lymph nodes and mediastinal lymph nodes but right lower pleural thickening was noted. However, the patient had subsequent clinical deterioration 6 weeks later in March 2016 with dyspnea, cough and hypoxia with CT thorax showing significant progression of lung parenchymal disease and multiple new lung nodules. Infection was ruled out by bronchoscopic examination, and empiric treatment with piperacillin/tazobactam. After careful consideration and multidisciplinary review, the patient was re-administered nivolumab starting April 2016, with both ongoing clinical and radiographic response. Restaging 12-week CT thorax June 2016 on nivolumab shows almost total resolution of previously noted multiple bilateral pulmonary nodules and consolidations (Fig. ), but some slight increase in size of mediastinal and hilar lymph nodes not meeting criteria for progression by immune-related response criteria (irRC) in solid tumors []. At the time of publication the patient has an ongoing (8-month) response in lung metastases and stable mediastinal/hilar lymph nodes, but slight growth of a single axillary lymph node.
A 55-year-old woman with sarcoidosis was admitted to the CTICU after receiving a bilateral OLT involving significant tracheal dissection. On postoperative day 1, sedation was weaned, and she was communicating appropriately while intubated and desired to have an epidural catheter placed for pain control prior to extubation. Timing of the epidural for patients on anticoagulation was in accordance with the American Society of Regional Anesthesia and Pain Medicine guidelines []. Two hours prior to the procedure, the patient was started on a dexmedetomidine infusion at 0.5 micrograms/kilogram/hour for anxiolysis during the procedure. Since bradycardia is oftentimes associated with large boluses and high-dose infusions of dexmedetomidine, we decided to start the infusion at a lower dose two hours prior to procedure. She remained spontaneously breathing, comfortable, and cooperative. Her hemodynamics remained unchanged during the initiation of the dexmedetomidine infusion.\nWith her assistance and the endotracheal tube remaining in place, she was placed in a sitting position for epidural placement, and 50 micrograms of intravenous fentanyl was given for additional analgesia. Hemodynamic and respiratory stability was maintained with a sinus rhythm of 95 beats per minute, blood pressure of 130/63 mmHg, and SpO2 of 95% and was consistent with her vitals prior to initiating the dexmedetomidine infusion. After obtaining the sitting position, her sinus rhythm deteriorated to bradycardia of 30 beats per minute, and she subsequently became hypotensive. She became agitated, ceased following commands, and became unresponsive. The dexmedetomidine infusion was immediately stopped, and one milligram of intravenous atropine was administered for the bradycardia with no effect. The bradycardia continued to decline and deteriorated to an asystolic event confirmed by arterial pressure monitoring, and cardiopulmonary resuscitation (CPR) was initiated. After 3–5 minutes of CPR, an additional 1-milligram bolus of intravenous atropine was administered along with a 1-milligram bolus of intravenous epinephrine, resulting in a heart rate of 130 beats per minute and a systolic blood pressure of 220 mmHg, which rapidly decreased to 130 mmHg. Her hemodynamic profile remained stable, and the epidural placement was aborted. Transesophageal echocardiogram (TEE) failed to show any signs of a pulmonary embolus.\nDifferential diagnosis for the asystolic arrest included myocardial infarction, pulmonary embolism (PE), relative hypovolemia, a vasovagal event, the Bezold-Jarisch reflex, cardiac sarcoidosis, and direct atrial-ventricular conduction inhibition by dexmedetomidine. Our patient had increased troponin levels; however, these were difficult to interpret due to the CPR efforts and the previous day's lung transplantation operation. Her electrocardiogram remained in sinus rhythm after the resuscitation with no ST abnormalities, and her TEE was unchanged from her baseline, arguing against a saddle embolus or myocardial infarction as the cause of the arrest. While patients with systemic inflammatory diseases are at risk for developing a deep venous thrombosis, this patient was on prophylactic subcutaneous heparin. Cardiac sarcoidosis was also considered; however, this was less likely given that during the preoperative evaluation she denied any previous history of arrhythmias or knowledge of cardiac sarcoidosis. In terms of relative hypovolemia, our patient's fluid balance was negative; however, she was maintaining adequate perfusion pressures with sufficient urine output. Additionally, her ICU bed had previously been positioned in the semirecumbent position with no hemodynamic instability. Unfortunately, she never regained consciousness following the arrest. Computed tomography (CT) of her head and electroencephalogram (EEG) did not demonstrate pathology explaining her comatose state, and she did not meet the criteria for brain death. She remained unresponsive and expired almost a month later from massive gastrointestinal bleeding. On postmortem autopsy, several small pulmonary infarcts consistent with pulmonary emboli were noted. However, the significance and timing of these infarcts could not be established with certainty.
A 15-year-old right-handed boy, accompanied by his mother, arrived at the Pediatric Dentistry Department, Rural Dental College, Loni after seeking treatment without success in a private dental clinic. His chief complaint was pain in the upper front region of jaw associated with front teeth.\nDuring history taking, the mother reported that the patient's “crises” began at 6 years of age. Since then, there have been frequent episodes in which he turned his eyes up, shook, stiffened, contorted his body, and clenched his fists. She could not ascertain if there was any loss of consciousness, during these episodes. She had consulted a pediatrician and a neurologist for evaluation of his general and neurological evaluation. Neurological examination reports revealed that, the patient presented with some spontaneous myoclonic jerks of right and left arms. The diagnosis of right and left focal epileptic fits, which were secondarily generalized was made. Language and learning difficulties were diagnosed as the patient had been repeating his fifth grade for 5 years. Medical reports also revealed that the patient was initially on carbamazepine 200 mg twice/day and risperidone 1 mg/day for 6 years. The drug therapy was changed at the age of 12 years by discarding the risperidone and increasing the carbamazepine dosage to 600 mg/day. The mother did not understand that a diagnosis of epilepsy had been made because of her lack of education. Patient's routine hematological investigations were within the normal limits.\nAt first dental visit patient was extremely anxious about the dental clinical environment. The patient was relaxed by the dental staff and nurses. He was introduced to the dental equipment's in a stepwise manner. Tell-show-do approach was very helpful in this patient. The oral examination revealed numerous grossly decayed teeth with poor oral hygiene []. Root stumps were present for 31, 32, 41, and 42. Endodontic treatment was carried out for 21 and 22 by the previous dentist with iatrogenic mishaps. Intraoral periapical radiographs revealed extruding gutta-percha point beyond the apical foramen in association with 21 and a broken endodontic file at the apical 3rd of 22 []. The patient had underwent extractions of first permanent molars in 3rd and 4th quadrants by the previous dentist at the age of 14 years. The patient's dental occlusion was entirely deranged. The case was diagnosed as adolescent dental caries with special health-care needs. Treatment plan was formulated for the patient with following goals in mind:\nEducation and motivation of the parent for improvement of patient's oral hygiene Minimizing the pain in maxillary anterior region Reducing and treating other carious teeth Stabilizing the occlusion Improving the masticatory efficiency Improving the salivary flow rate Improving the overall oral health. Patient's parent was informed about the diagnosis, were explained about the treatment plan and the need for endodontic, surgical, and prosthetic rehabilitation. After the motivation of the parent, they were willing for the treatment and were ready to keep up the appointments. In the initial appointments, a thorough oral prophylaxis was carried out, and 0.12% chlorhexidine oral rinses twice daily were prescribed at home. A salivary substitute like mouthkote solution was prescribed to minimize the oral dryness.\nAfter obtaining the neurologist's consent, the blood reports, and under an antiepileptic drug regime, endodontic surgery was planned for 21 and 22 along with endodontic retreatment for the same. Following oral prophylaxis and administration of a local anesthetic (lignocaine and adrenaline injection I.P. (Harson Laboratories, Baroda, Gujarath, India) a semilunar incision was placed with no. 15 blade on the attached gingiva extending from mesial aspect of 21 and until the distal aspect of 22. A bony window was made with surgical round carbide bur (no. 8R, SS White Company, Dental Avenue India, Pvt. Ltd., Mumbai, India) mounted on a slow speed handpiece (NSK, PANA AIR; Nakanishi Inc., Shimohinata, Tochigi-Ken, Japan) under copious normal saline irrigation []. The extruded gutta-percha was excised from the apical 3rd of 21. Furthermore, the broken endodontic file was removed from the apical 3rd of 22. A complete curettage of the area was carried out followed by suturing of the flap with 3-0 non-resorbable black surgical silk suture (Ethicon, Johnson and Johnson Ltd., Mumbai, India) []. The endodontic treatment was repeated with 21 and 22 followed by treatment with 11 and 12. Postoperatively antibiotics and analgesics were prescribed for 5 days. Patient's pain was relieved completely after the endodontic surgery, and endodontic treatment and the healing of the surgical area was uneventful.\nThe clinical crowns of maxillary incisors were compromised as a result of caries, hence prior to planning for extracoronal fixed restorations on these teeth, and it was mandatory to restore them with custom made the post and core. The 2/3rd of gutta-percha was removed from the endodontically treated maxillary incisors root canals with the help of no. 2 Peeso reamer (Prime Dental Products, Mumbai, India) for post-space preparation. Post-space impression was made using blue inlay wax (Inlay Wax Medium, GC Corporation, Tokyo, Japan) along with the fabrication of core with the blue inlay wax for the four maxillary incisors. The casting was carried for the impressions of post and core. The custom made the post and core were trail fitted on the four maxillary incisors and then were cemented with Type 1 Glass Ionomer cement (GC Corporation, Tokyo, Japan) []. Extra-coronal porcelain fused metal (PFM) restorations were given on the four maxillary incisors after []. Meanwhile, extractions of the anterior root stumps in the lower arch were carried out. All the procedures were carried out under antiepileptic medication, with Neurologist's and Parental consent. The extraction sockets were allowed to heal till a period of 4-6 weeks.\nAfter the complete healing of the extraction sockets, diagnostic impressions were made for the arches using irreversible hydrocolloid (Alginate) impression material (Imprint Alginate Impression Material, Mumbai, India). Special tray was fabricated on the diagnostic cast for the dual impression technique. After border molding and final impression of mandibular edentulous region under physiological loading, using non-eugenol impression paste (IMAGE, Eugenol Free Impression Paste, Prime Dental Products, Mumbai, India) and the anatomical (dentulous) region was recorded using alginate pick up impression []. The master casts were obtained, and a surveying of the master casts revealed larger amount of lingual undercuts, so a labial flange flexible denture was planned. After blocking out of all the undercut areas and the diagnostic wax up, Face bow transfer was carried out, and centric jaw relation was recorded. The jaw relation record was quite difficult for this patient and required repeated training at home by the parent as well as in the dental operatory by the dentist. Try-in was carried out after the teeth arrangement. A flexible Valplast partial denture (Katara Dental Laboratories, Mumbai, India) was fabricated and was inserted in the lower arch []. Patient's comfort, speech, and acceptance for the treatment were assessed. The patient and his parent were happy and satisfied with the treatment being carried out. There was a significant improvement in the speech as well. The entire treatment was completed in 8 months due to intellectual deterioration of the adolescent. After the insertion of removable prosthesis to the patient, it needs to be changed after a period of 6-8 months until the age of 17-18 years unless the maxillo-mandibular growth of the patient is ceased. The patient was regularly followed-up every month.
A 34-year-old Chinese man presented to the rheumatology department of our hospital with a 1-week history of muscle weakness and pain. He was referred by the general practitioner in the company he worked in for further evaluation. The patient admitted a history of sudden onset weakness involving his upper and lower limbs 1 day prior to his presentation. The patient was well before he went to bed at 10 pm, but when he woke at about 6 am he was unable to move his upper and lower limbs; just his neck. Symptoms lasted about 1 hour, then resolved completely. The patient had physically demanding work the day before. One week earlier, the patient complained of pain and weakness in lower limbs when he woke up for urination at around 4:00 am, to the point he reached the toilet with extreme difficulty. This took about 30 minutes to resolve.\nThe patient attributed that to his long flight the proceeding day. Since then, he had been experiencing muscle pain mainly involving the thigh, gradually increasing in severity and later involving the arm which was also associated with stiffness and mild weakness.\nOn the top of musculoskeletal symptoms during the past 3 months he reported sweating, heat intolerance, palpitations, and unintentional weight loss of 6 kg despite good appetite, but did not report any changes in skin, and hair.\nThere was no history of preceding fever, vomiting, diarrhea, trauma or seizures. The patient denied having shortness of breath, urinary problem, abdominal pain, backache, involuntary movements, and sensory loss in any limb. There was no history of recent drug ingestion. He denied any intake of supplements, alcohol or drug abuse. He smoked 1 pack of cigarettes daily for 8 years. There was no significant past illness, and family history was noncontributory.\nOn examination, the patient was conscious and oriented, and looked slightly anxious. He was afebrile with a pulse of 90 beats per minute, respirations of 16 breaths per minute, and blood pressure 120/70 mm Hg. The thyroid gland was diffusely enlarged, firm, smooth, and not tender, with no audible bruit. There was no lid lag, lid retraction, or exophthalmos. Fine tremor was detected on outstretching of the hands. Cardiac, respiratory, and abdominal examination were normal. Musculoskeletal examination was unremarkable apart from quadriceps, deltoid, and biceps tenderness. Neurological examination of the upper and lower limbs revealed normal tone, proximal muscle weakness (4/5 power in the lower limbs, 4+/5 power in the upper limbs), normal distal muscle strength. Reflexes were brisk and plantar response was flexor bilaterally. There were no sensory abnormalities and the cranial nerves were intact.\nLaboratory studies revealed potassium of 3.2 mmol/L (3.5–5.1 mmol/L), TSH<0.005 μIU/L (0.25–4.55 μIU/L), FT4 71.1pmol/L (12–22 pmol/L), FT3 22.6 pmol/L (3.1–6.8 pmol/L), and total creatine kinase(CK) 587 U/L(39–308 U/L). All other lab tests including full blood count, erythrocyte sedimentation rate, kidney and liver function test, blood sugar, serum calcium, serum magnesium, serum phosphorus, hepatitis serology, brucella agglutination test, lactate dehydrogenase, rheumatoid factor, and antinuclear antibodies (ANA) were normal.\nHis clinical presentation and laboratory abnormalities were consistent with thyrotoxic periodic paralysis. Patient was referred to endocrinologist who prescribed him propranolol 40 mg BID and Carbimazole 45 mg/day. On follow up 2 months later, the patient was subjectively well, and free from TTP attacks. His thyroid function test and serum potassium were normal.
A 57-year-old man presented in April 2017 with non-specific headaches and a short history of left facial numbness and pain. He had no other visual nor cranial nerve symptoms such as ophthalmoplegia nor paraesthesia. He had a longstanding history of stage 4 clear cell RCC. He underwent a left nephrectomy in 2008 with metastatic recurrence demonstrated in 2010. He was initially treated with a right adrenalectomy and stereotactic radiotherapy to a lung lesion. In terms of systemic therapy, he received first-line sunitinib from June 2011 and dendritic cell vaccine therapy from July 2011, followed by nivolumab.\nMagnetic resonance imaging (MRI) of his brain revealed a left-sided lesion centered in MC with extension into the cavernous sinus. It measured 17 x 12 x 18 mm and enhanced with gadolinium. There was no intra-axial involvement. Based on the clinical features and imaging, the provisional diagnosis was metastatic disease. There was no prior MRI available for comparison, and prior staging compute tomography (CT) scans including cranial imaging did not reveal the lesion. A four-week-interval MRI demonstrated progressive growth in keeping with metastatic disease (Figure ).\nThe patient was treated with Gamma Knife (GK) SRS to a dose of 20 Gy in one fraction prescribed to the 50% isodose in May 2017.\nClinical follow-up at two months post-GK SRS showed marked symptomatic improvement in facial pain and paraesthesia. The patient was able to cease analgesic medication. Radiological follow-up at six months post-GK SRS showed substantial tumour reduction on MRI; however, he had recently developed facial numbness and wasting of his muscles of mastication in keeping with a trigeminal nerve palsy. His lesion showed a partial response, reducing in size to 16 x 9 x 14 mm six months post-SRS with persistent residual enhancing changes seen one year following SRS.\nJust over 13 months post-GK SRS, he presented to clinic with a recurrence of facial pain, paraesthesia and new-onset diplopia consistent with a right sixth nerve palsy. MRI confirmed recurrent disease in the left MC with extension into the cavernous sinus (Figure ). CT staging revealed three metastases progressing in the left lower lung, right hilum and left gluteal soft tissue mass. These signified progressive systemic disease.\nThe patient was recommenced on sunitinib, which showed an initial partial response, but subsequently, his systemic disease progressed again in October 2019 with enlargement of the MC lesion to 24 x 20 x 18 mm (Figure ), a right lung mass and thoracic adenopathy. The result of a multidisciplinary team meeting was to retreat with SRS rather than surgery. He was treated with repeat GK SRS to the left cavernous sinus in November 2019 (30 months after initial SRS) to a dose of 30 Gy in five fractions at the 50% isodose line.\nAs of his MRI in August 2020 (nine months after repeat SRS), the MC metastasis was stable and post-treatment effect enhancement in the adjacent temporal lobe was noted (Figure ). From his latest clinical follow-up in March 2021, his facial pain had completely resolved, while his paraesthesia had significantly improved but was still present. He continued to experience diplopia, managed with prism glasses. A repeat MRI in March 2021 confirmed stability of the treated lesion with some enhancing post-radiosurgical change and oedema.
A 48-year-old female with a past medical history of low-risk JAK2 positive PV presented to the emergency department with a chief complaint of right eye pain for eight days. Her pain started after she had an accidental low-impact trauma inflicted by her child. She described non-pulsatile, dull pain with increasing intensity overlying her right eye. She had no visual changes in her right eye and unchanged chronic left eye myopia. To attenuate the pain, the patient consumed 12 tablets of 81 mg aspirin every day for three days at the onset of pain. She took preparations of ginseng and other unspecified Chinese herbs and prepared a herbal poultice to place over her right eye.\nHer PV was diagnosed in China more than 15 years ago. She was compliant with therapeutic phlebotomies every two months for treatment of her PV, however recently she was not able to get to the clinic due to novel coronavirus restrictions. She was treated in the past with Hydroxyurea but was discontinued due to severe mucositis. Three years before presentation to our institution, she had been having heavy menstrual bleeding. Ristocetin-induced platelet aggregation assay showed decreased Von Willebrand factor (VWF) activity. Therefore, scheduled 81 mg of aspirin daily was stopped. Abdominal ultrasound, performed for the indication of abdominal swelling, revealed splenomegaly with 19.4 cm spleen in maximal dimension as well as a fully distinct 2 cm splenule.\nAt the time of presentation to our institution, she had no skin or eyelid wounds, mucosal bleeding, menorrhagia, joint swelling, rash, bruises, or neurological deficits. She has no family history of coagulopathy. Her vital signs were within normal limits. Her neurological exam revealed normal extraocular muscle movement, normal visual fields, decreased left eye visual acuity that remains unchanged from previous encounters. The rest of her neurological examination was unremarkable.\nCT head without contrast was significant for right-sided subdural hematoma with a 6 mm right-to-left subfalcine shift and mass effect noted in the right ventricle without evidence of hydrocephalus (Figure ). CTA scan of the head and neck showed a 4-mm cortically based vascular malformation or suspected aneurysm observed within the right parieto-occipital region (Figure ). At the time of admission, her hemoglobin was 14.8 gm/dL, hematocrit was 53.6%, mean corpuscular volume was 68 fL, platelet count was 1,029,000/µL, and white blood cell count was 24,800/µL. Peripheral blood smear showed microcytosis, hypochromia, and polychromasia. Prothrombin time/international normalized ratio (PT/INR) and partial thromboplastin time (PTT) were within normal laboratory limits. VWF activity was reduced to 26%. She had a normal factor VIII assay. Platelet mapping revealed no inhibition to arachidonic acid (AA), but significant inhibition to adenosine diphosphate (ADP) (60% inhibited) was observed with a significant reduction in the mean amplitude of clot.\nMagnetic resonance angiography (MRA) revealed a possible saccular aneurysm, measuring up to 0.7 cm, along the lateral aspect of the right parietal lobe associated with a distal branch of the right middle cerebral artery (MCA). Apparent clotted blood material surrounding this aneurysm was observed. Direct angiographic imaging of the right internal carotid artery was then performed which showed an inferolaterally projecting aneurysm arising from the mid aspect of M4 right MCA branch, specifically the angular artery. The aneurysm in question measured 3.6 x 3.9 mm. The neck of the aneurysm was relatively wide, measuring 3.2 mm (Figure ). The right anterior and remaining right middle cerebral artery branches were normal in appearance without significant stenosis or major branch vessel occlusion.\nNeurosurgical intervention was recommended as the distal position of the aneurysm made endovascular access difficult and the wide-necked morphology of the aneurysm was not amenable to vascular intervention. The patient was given 1-deamino-8-D-arginine vasopressin (DDAVP) prior to the surgery to reduce the risk of bleeding. She underwent right craniotomy and intra-op examination revealed that directly underneath the dura, there was a very thick membrane of fibrinous material as well as hemorrhage. There was a large grape-like membrane that was attached to the pia-arachnoid. There was some bleeding noted from one of the pial arterial branches on the surface. This thickened grape-like membrane was then detached from the underside of the dura and sent off to pathology. Intraoperative microscopic evaluation of the angular artery of the middle cerebral artery revealed no evidence of an aneurysm. This aneurysm-like structure was in fact a small grape-like structure of the fibrinous part of the subdural membrane that had formed from the subdural hematoma that was being fed by a pial branch of the middle cerebral artery through a parasitized process. The pathological examination of the excised specimen was consistent with a subdural membrane showing organized hematoma with highly vascularized granulation tissue. In the post craniotomy diagnostic cerebral angiogram, the aneurysm was no longer visualized. (Figure ). The patient recovered well postoperatively with no clinical evidence of rebleeding. She was discharged home one day later.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.