text
stringlengths
4
1.02M
meta
dict
import numpy as np from pandas.compat import zip from pandas.core.dtypes.generic import ABCSeries, ABCIndex from pandas.core.dtypes.missing import isna, notna from pandas.core.dtypes.common import ( is_bool_dtype, is_categorical_dtype, is_object_dtype, is_string_like, is_list_like, is_scalar, is_integer, is_re) from pandas.core.common import _values_from_object from pandas.core.algorithms import take_1d import pandas.compat as compat from pandas.core.base import AccessorProperty, NoNewAttributesMixin from pandas.util._decorators import Appender import re import pandas._libs.lib as lib import warnings import textwrap import codecs _cpython_optimized_encoders = ( "utf-8", "utf8", "latin-1", "latin1", "iso-8859-1", "mbcs", "ascii" ) _cpython_optimized_decoders = _cpython_optimized_encoders + ( "utf-16", "utf-32" ) _shared_docs = dict() def _get_array_list(arr, others): from pandas.core.series import Series if len(others) and isinstance(_values_from_object(others)[0], (list, np.ndarray, Series)): arrays = [arr] + list(others) else: arrays = [arr, others] return [np.asarray(x, dtype=object) for x in arrays] def str_cat(arr, others=None, sep=None, na_rep=None): """ Concatenate strings in the Series/Index with given separator. Parameters ---------- others : list-like, or list of list-likes If None, returns str concatenating strings of the Series sep : string or None, default None na_rep : string or None, default None If None, NA in the series are ignored. Returns ------- concat : Series/Index of objects or str Examples -------- When ``na_rep`` is `None` (default behavior), NaN value(s) in the Series are ignored. >>> Series(['a','b',np.nan,'c']).str.cat(sep=' ') 'a b c' >>> Series(['a','b',np.nan,'c']).str.cat(sep=' ', na_rep='?') 'a b ? c' If ``others`` is specified, corresponding values are concatenated with the separator. Result will be a Series of strings. >>> Series(['a', 'b', 'c']).str.cat(['A', 'B', 'C'], sep=',') 0 a,A 1 b,B 2 c,C dtype: object Otherwise, strings in the Series are concatenated. Result will be a string. >>> Series(['a', 'b', 'c']).str.cat(sep=',') 'a,b,c' Also, you can pass a list of list-likes. >>> Series(['a', 'b']).str.cat([['x', 'y'], ['1', '2']], sep=',') 0 a,x,1 1 b,y,2 dtype: object """ if sep is None: sep = '' if others is not None: arrays = _get_array_list(arr, others) n = _length_check(arrays) masks = np.array([isna(x) for x in arrays]) cats = None if na_rep is None: na_mask = np.logical_or.reduce(masks, axis=0) result = np.empty(n, dtype=object) np.putmask(result, na_mask, np.nan) notmask = ~na_mask tuples = zip(*[x[notmask] for x in arrays]) cats = [sep.join(tup) for tup in tuples] result[notmask] = cats else: for i, x in enumerate(arrays): x = np.where(masks[i], na_rep, x) if cats is None: cats = x else: cats = cats + sep + x result = cats return result else: arr = np.asarray(arr, dtype=object) mask = isna(arr) if na_rep is None and mask.any(): if sep == '': na_rep = '' else: return sep.join(arr[notna(arr)]) return sep.join(np.where(mask, na_rep, arr)) def _length_check(others): n = None for x in others: try: if n is None: n = len(x) elif len(x) != n: raise ValueError('All arrays must be same length') except TypeError: raise ValueError("Did you mean to supply a `sep` keyword?") return n def _na_map(f, arr, na_result=np.nan, dtype=object): # should really _check_ for NA return _map(f, arr, na_mask=True, na_value=na_result, dtype=dtype) def _map(f, arr, na_mask=False, na_value=np.nan, dtype=object): if not len(arr): return np.ndarray(0, dtype=dtype) if isinstance(arr, ABCSeries): arr = arr.values if not isinstance(arr, np.ndarray): arr = np.asarray(arr, dtype=object) if na_mask: mask = isna(arr) try: convert = not all(mask) result = lib.map_infer_mask(arr, f, mask.view(np.uint8), convert) except (TypeError, AttributeError) as e: # Reraise the exception if callable `f` got wrong number of args. # The user may want to be warned by this, instead of getting NaN if compat.PY2: p_err = r'takes (no|(exactly|at (least|most)) ?\d+) arguments?' else: p_err = (r'((takes)|(missing)) (?(2)from \d+ to )?\d+ ' r'(?(3)required )positional arguments?') if len(e.args) >= 1 and re.search(p_err, e.args[0]): raise e def g(x): try: return f(x) except (TypeError, AttributeError): return na_value return _map(g, arr, dtype=dtype) if na_value is not np.nan: np.putmask(result, mask, na_value) if result.dtype == object: result = lib.maybe_convert_objects(result) return result else: return lib.map_infer(arr, f) def str_count(arr, pat, flags=0): """ Count occurrences of pattern in each string of the Series/Index. Parameters ---------- pat : string, valid regular expression flags : int, default 0 (no flags) re module flags, e.g. re.IGNORECASE Returns ------- counts : Series/Index of integer values """ regex = re.compile(pat, flags=flags) f = lambda x: len(regex.findall(x)) return _na_map(f, arr, dtype=int) def str_contains(arr, pat, case=True, flags=0, na=np.nan, regex=True): """ Return boolean Series/``array`` whether given pattern/regex is contained in each string in the Series/Index. Parameters ---------- pat : string Character sequence or regular expression case : boolean, default True If True, case sensitive flags : int, default 0 (no flags) re module flags, e.g. re.IGNORECASE na : default NaN, fill value for missing values. regex : bool, default True If True use re.search, otherwise use Python in operator Returns ------- contained : Series/array of boolean values See Also -------- match : analogous, but stricter, relying on re.match instead of re.search """ if regex: if not case: flags |= re.IGNORECASE regex = re.compile(pat, flags=flags) if regex.groups > 0: warnings.warn("This pattern has match groups. To actually get the" " groups, use str.extract.", UserWarning, stacklevel=3) f = lambda x: bool(regex.search(x)) else: if case: f = lambda x: pat in x else: upper_pat = pat.upper() f = lambda x: upper_pat in x uppered = _na_map(lambda x: x.upper(), arr) return _na_map(f, uppered, na, dtype=bool) return _na_map(f, arr, na, dtype=bool) def str_startswith(arr, pat, na=np.nan): """ Return boolean Series/``array`` indicating whether each string in the Series/Index starts with passed pattern. Equivalent to :meth:`str.startswith`. Parameters ---------- pat : string Character sequence na : bool, default NaN Returns ------- startswith : Series/array of boolean values """ f = lambda x: x.startswith(pat) return _na_map(f, arr, na, dtype=bool) def str_endswith(arr, pat, na=np.nan): """ Return boolean Series indicating whether each string in the Series/Index ends with passed pattern. Equivalent to :meth:`str.endswith`. Parameters ---------- pat : string Character sequence na : bool, default NaN Returns ------- endswith : Series/array of boolean values """ f = lambda x: x.endswith(pat) return _na_map(f, arr, na, dtype=bool) def str_replace(arr, pat, repl, n=-1, case=None, flags=0): """ Replace occurrences of pattern/regex in the Series/Index with some other string. Equivalent to :meth:`str.replace` or :func:`re.sub`. Parameters ---------- pat : string or compiled regex String can be a character sequence or regular expression. .. versionadded:: 0.20.0 `pat` also accepts a compiled regex. repl : string or callable Replacement string or a callable. The callable is passed the regex match object and must return a replacement string to be used. See :func:`re.sub`. .. versionadded:: 0.20.0 `repl` also accepts a callable. n : int, default -1 (all) Number of replacements to make from start case : boolean, default None - If True, case sensitive (the default if `pat` is a string) - Set to False for case insensitive - Cannot be set if `pat` is a compiled regex flags : int, default 0 (no flags) - re module flags, e.g. re.IGNORECASE - Cannot be set if `pat` is a compiled regex Returns ------- replaced : Series/Index of objects Notes ----- When `pat` is a compiled regex, all flags should be included in the compiled regex. Use of `case` or `flags` with a compiled regex will raise an error. Examples -------- When `repl` is a string, every `pat` is replaced as with :meth:`str.replace`. NaN value(s) in the Series are left as is. >>> pd.Series(['foo', 'fuz', np.nan]).str.replace('f', 'b') 0 boo 1 buz 2 NaN dtype: object When `repl` is a callable, it is called on every `pat` using :func:`re.sub`. The callable should expect one positional argument (a regex object) and return a string. To get the idea: >>> pd.Series(['foo', 'fuz', np.nan]).str.replace('f', repr) 0 <_sre.SRE_Match object; span=(0, 1), match='f'>oo 1 <_sre.SRE_Match object; span=(0, 1), match='f'>uz 2 NaN dtype: object Reverse every lowercase alphabetic word: >>> repl = lambda m: m.group(0)[::-1] >>> pd.Series(['foo 123', 'bar baz', np.nan]).str.replace(r'[a-z]+', repl) 0 oof 123 1 rab zab 2 NaN dtype: object Using regex groups (extract second group and swap case): >>> pat = r"(?P<one>\w+) (?P<two>\w+) (?P<three>\w+)" >>> repl = lambda m: m.group('two').swapcase() >>> pd.Series(['One Two Three', 'Foo Bar Baz']).str.replace(pat, repl) 0 tWO 1 bAR dtype: object Using a compiled regex with flags >>> regex_pat = re.compile(r'FUZ', flags=re.IGNORECASE) >>> pd.Series(['foo', 'fuz', np.nan]).str.replace(regex_pat, 'bar') 0 foo 1 bar 2 NaN dtype: object """ # Check whether repl is valid (GH 13438, GH 15055) if not (is_string_like(repl) or callable(repl)): raise TypeError("repl must be a string or callable") is_compiled_re = is_re(pat) if is_compiled_re: if (case is not None) or (flags != 0): raise ValueError("case and flags cannot be set" " when pat is a compiled regex") else: # not a compiled regex # set default case if case is None: case = True # add case flag, if provided if case is False: flags |= re.IGNORECASE use_re = is_compiled_re or len(pat) > 1 or flags or callable(repl) if use_re: n = n if n >= 0 else 0 regex = re.compile(pat, flags=flags) f = lambda x: regex.sub(repl=repl, string=x, count=n) else: f = lambda x: x.replace(pat, repl, n) return _na_map(f, arr) def str_repeat(arr, repeats): """ Duplicate each string in the Series/Index by indicated number of times. Parameters ---------- repeats : int or array Same value for all (int) or different value per (array) Returns ------- repeated : Series/Index of objects """ if is_scalar(repeats): def rep(x): try: return compat.binary_type.__mul__(x, repeats) except TypeError: return compat.text_type.__mul__(x, repeats) return _na_map(rep, arr) else: def rep(x, r): try: return compat.binary_type.__mul__(x, r) except TypeError: return compat.text_type.__mul__(x, r) repeats = np.asarray(repeats, dtype=object) result = lib.vec_binop(_values_from_object(arr), repeats, rep) return result def str_match(arr, pat, case=True, flags=0, na=np.nan, as_indexer=None): """ Determine if each string matches a regular expression. Parameters ---------- pat : string Character sequence or regular expression case : boolean, default True If True, case sensitive flags : int, default 0 (no flags) re module flags, e.g. re.IGNORECASE na : default NaN, fill value for missing values. as_indexer : DEPRECATED - Keyword is ignored. Returns ------- Series/array of boolean values See Also -------- contains : analogous, but less strict, relying on re.search instead of re.match extract : extract matched groups """ if not case: flags |= re.IGNORECASE regex = re.compile(pat, flags=flags) if (as_indexer is False) and (regex.groups > 0): raise ValueError("as_indexer=False with a pattern with groups is no " "longer supported. Use '.str.extract(pat)' instead") elif as_indexer is not None: # Previously, this keyword was used for changing the default but # deprecated behaviour. This keyword is now no longer needed. warnings.warn("'as_indexer' keyword was specified but is ignored " "(match now returns a boolean indexer by default), " "and will be removed in a future version.", FutureWarning, stacklevel=3) dtype = bool f = lambda x: bool(regex.match(x)) return _na_map(f, arr, na, dtype=dtype) def _get_single_group_name(rx): try: return list(rx.groupindex.keys()).pop() except IndexError: return None def _groups_or_na_fun(regex): """Used in both extract_noexpand and extract_frame""" if regex.groups == 0: raise ValueError("pattern contains no capture groups") empty_row = [np.nan] * regex.groups def f(x): if not isinstance(x, compat.string_types): return empty_row m = regex.search(x) if m: return [np.nan if item is None else item for item in m.groups()] else: return empty_row return f def _str_extract_noexpand(arr, pat, flags=0): """ Find groups in each string in the Series using passed regular expression. This function is called from str_extract(expand=False), and can return Series, DataFrame, or Index. """ from pandas import DataFrame, Index regex = re.compile(pat, flags=flags) groups_or_na = _groups_or_na_fun(regex) if regex.groups == 1: result = np.array([groups_or_na(val)[0] for val in arr], dtype=object) name = _get_single_group_name(regex) else: if isinstance(arr, Index): raise ValueError("only one regex group is supported with Index") name = None names = dict(zip(regex.groupindex.values(), regex.groupindex.keys())) columns = [names.get(1 + i, i) for i in range(regex.groups)] if arr.empty: result = DataFrame(columns=columns, dtype=object) else: result = DataFrame( [groups_or_na(val) for val in arr], columns=columns, index=arr.index, dtype=object) return result, name def _str_extract_frame(arr, pat, flags=0): """ For each subject string in the Series, extract groups from the first match of regular expression pat. This function is called from str_extract(expand=True), and always returns a DataFrame. """ from pandas import DataFrame regex = re.compile(pat, flags=flags) groups_or_na = _groups_or_na_fun(regex) names = dict(zip(regex.groupindex.values(), regex.groupindex.keys())) columns = [names.get(1 + i, i) for i in range(regex.groups)] if len(arr) == 0: return DataFrame(columns=columns, dtype=object) try: result_index = arr.index except AttributeError: result_index = None return DataFrame( [groups_or_na(val) for val in arr], columns=columns, index=result_index, dtype=object) def str_extract(arr, pat, flags=0, expand=None): """ For each subject string in the Series, extract groups from the first match of regular expression pat. .. versionadded:: 0.13.0 Parameters ---------- pat : string Regular expression pattern with capturing groups flags : int, default 0 (no flags) re module flags, e.g. re.IGNORECASE expand : bool, default False * If True, return DataFrame. * If False, return Series/Index/DataFrame. .. versionadded:: 0.18.0 Returns ------- DataFrame with one row for each subject string, and one column for each group. Any capture group names in regular expression pat will be used for column names; otherwise capture group numbers will be used. The dtype of each result column is always object, even when no match is found. If expand=False and pat has only one capture group, then return a Series (if subject is a Series) or Index (if subject is an Index). See Also -------- extractall : returns all matches (not just the first match) Examples -------- A pattern with two groups will return a DataFrame with two columns. Non-matches will be NaN. >>> s = Series(['a1', 'b2', 'c3']) >>> s.str.extract('([ab])(\d)') 0 1 0 a 1 1 b 2 2 NaN NaN A pattern may contain optional groups. >>> s.str.extract('([ab])?(\d)') 0 1 0 a 1 1 b 2 2 NaN 3 Named groups will become column names in the result. >>> s.str.extract('(?P<letter>[ab])(?P<digit>\d)') letter digit 0 a 1 1 b 2 2 NaN NaN A pattern with one group will return a DataFrame with one column if expand=True. >>> s.str.extract('[ab](\d)', expand=True) 0 0 1 1 2 2 NaN A pattern with one group will return a Series if expand=False. >>> s.str.extract('[ab](\d)', expand=False) 0 1 1 2 2 NaN dtype: object """ if expand is None: warnings.warn( "currently extract(expand=None) " + "means expand=False (return Index/Series/DataFrame) " + "but in a future version of pandas this will be changed " + "to expand=True (return DataFrame)", FutureWarning, stacklevel=3) expand = False if not isinstance(expand, bool): raise ValueError("expand must be True or False") if expand: return _str_extract_frame(arr._orig, pat, flags=flags) else: result, name = _str_extract_noexpand(arr._data, pat, flags=flags) return arr._wrap_result(result, name=name, expand=expand) def str_extractall(arr, pat, flags=0): """ For each subject string in the Series, extract groups from all matches of regular expression pat. When each subject string in the Series has exactly one match, extractall(pat).xs(0, level='match') is the same as extract(pat). .. versionadded:: 0.18.0 Parameters ---------- pat : string Regular expression pattern with capturing groups flags : int, default 0 (no flags) re module flags, e.g. re.IGNORECASE Returns ------- A DataFrame with one row for each match, and one column for each group. Its rows have a MultiIndex with first levels that come from the subject Series. The last level is named 'match' and indicates the order in the subject. Any capture group names in regular expression pat will be used for column names; otherwise capture group numbers will be used. See Also -------- extract : returns first match only (not all matches) Examples -------- A pattern with one group will return a DataFrame with one column. Indices with no matches will not appear in the result. >>> s = Series(["a1a2", "b1", "c1"], index=["A", "B", "C"]) >>> s.str.extractall("[ab](\d)") 0 match A 0 1 1 2 B 0 1 Capture group names are used for column names of the result. >>> s.str.extractall("[ab](?P<digit>\d)") digit match A 0 1 1 2 B 0 1 A pattern with two groups will return a DataFrame with two columns. >>> s.str.extractall("(?P<letter>[ab])(?P<digit>\d)") letter digit match A 0 a 1 1 a 2 B 0 b 1 Optional groups that do not match are NaN in the result. >>> s.str.extractall("(?P<letter>[ab])?(?P<digit>\d)") letter digit match A 0 a 1 1 a 2 B 0 b 1 C 0 NaN 1 """ regex = re.compile(pat, flags=flags) # the regex must contain capture groups. if regex.groups == 0: raise ValueError("pattern contains no capture groups") if isinstance(arr, ABCIndex): arr = arr.to_series().reset_index(drop=True) names = dict(zip(regex.groupindex.values(), regex.groupindex.keys())) columns = [names.get(1 + i, i) for i in range(regex.groups)] match_list = [] index_list = [] is_mi = arr.index.nlevels > 1 for subject_key, subject in arr.iteritems(): if isinstance(subject, compat.string_types): if not is_mi: subject_key = (subject_key, ) for match_i, match_tuple in enumerate(regex.findall(subject)): if isinstance(match_tuple, compat.string_types): match_tuple = (match_tuple,) na_tuple = [np.NaN if group == "" else group for group in match_tuple] match_list.append(na_tuple) result_key = tuple(subject_key + (match_i, )) index_list.append(result_key) if 0 < len(index_list): from pandas import MultiIndex index = MultiIndex.from_tuples( index_list, names=arr.index.names + ["match"]) else: index = None result = arr._constructor_expanddim(match_list, index=index, columns=columns) return result def str_get_dummies(arr, sep='|'): """ Split each string in the Series by sep and return a frame of dummy/indicator variables. Parameters ---------- sep : string, default "|" String to split on. Returns ------- dummies : DataFrame Examples -------- >>> Series(['a|b', 'a', 'a|c']).str.get_dummies() a b c 0 1 1 0 1 1 0 0 2 1 0 1 >>> Series(['a|b', np.nan, 'a|c']).str.get_dummies() a b c 0 1 1 0 1 0 0 0 2 1 0 1 See Also -------- pandas.get_dummies """ arr = arr.fillna('') try: arr = sep + arr + sep except TypeError: arr = sep + arr.astype(str) + sep tags = set() for ts in arr.str.split(sep): tags.update(ts) tags = sorted(tags - set([""])) dummies = np.empty((len(arr), len(tags)), dtype=np.int64) for i, t in enumerate(tags): pat = sep + t + sep dummies[:, i] = lib.map_infer(arr.values, lambda x: pat in x) return dummies, tags def str_join(arr, sep): """ Join lists contained as elements in the Series/Index with passed delimiter. Equivalent to :meth:`str.join`. Parameters ---------- sep : string Delimiter Returns ------- joined : Series/Index of objects """ return _na_map(sep.join, arr) def str_findall(arr, pat, flags=0): """ Find all occurrences of pattern or regular expression in the Series/Index. Equivalent to :func:`re.findall`. Parameters ---------- pat : string Pattern or regular expression flags : int, default 0 (no flags) re module flags, e.g. re.IGNORECASE Returns ------- matches : Series/Index of lists See Also -------- extractall : returns DataFrame with one column per capture group """ regex = re.compile(pat, flags=flags) return _na_map(regex.findall, arr) def str_find(arr, sub, start=0, end=None, side='left'): """ Return indexes in each strings in the Series/Index where the substring is fully contained between [start:end]. Return -1 on failure. Parameters ---------- sub : str Substring being searched start : int Left edge index end : int Right edge index side : {'left', 'right'}, default 'left' Specifies a starting side, equivalent to ``find`` or ``rfind`` Returns ------- found : Series/Index of integer values """ if not isinstance(sub, compat.string_types): msg = 'expected a string object, not {0}' raise TypeError(msg.format(type(sub).__name__)) if side == 'left': method = 'find' elif side == 'right': method = 'rfind' else: # pragma: no cover raise ValueError('Invalid side') if end is None: f = lambda x: getattr(x, method)(sub, start) else: f = lambda x: getattr(x, method)(sub, start, end) return _na_map(f, arr, dtype=int) def str_index(arr, sub, start=0, end=None, side='left'): if not isinstance(sub, compat.string_types): msg = 'expected a string object, not {0}' raise TypeError(msg.format(type(sub).__name__)) if side == 'left': method = 'index' elif side == 'right': method = 'rindex' else: # pragma: no cover raise ValueError('Invalid side') if end is None: f = lambda x: getattr(x, method)(sub, start) else: f = lambda x: getattr(x, method)(sub, start, end) return _na_map(f, arr, dtype=int) def str_pad(arr, width, side='left', fillchar=' '): """ Pad strings in the Series/Index with an additional character to specified side. Parameters ---------- width : int Minimum width of resulting string; additional characters will be filled with spaces side : {'left', 'right', 'both'}, default 'left' fillchar : str Additional character for filling, default is whitespace Returns ------- padded : Series/Index of objects """ if not isinstance(fillchar, compat.string_types): msg = 'fillchar must be a character, not {0}' raise TypeError(msg.format(type(fillchar).__name__)) if len(fillchar) != 1: raise TypeError('fillchar must be a character, not str') if not is_integer(width): msg = 'width must be of integer type, not {0}' raise TypeError(msg.format(type(width).__name__)) if side == 'left': f = lambda x: x.rjust(width, fillchar) elif side == 'right': f = lambda x: x.ljust(width, fillchar) elif side == 'both': f = lambda x: x.center(width, fillchar) else: # pragma: no cover raise ValueError('Invalid side') return _na_map(f, arr) def str_split(arr, pat=None, n=None): """ Split each string (a la re.split) in the Series/Index by given pattern, propagating NA values. Equivalent to :meth:`str.split`. Parameters ---------- pat : string, default None String or regular expression to split on. If None, splits on whitespace n : int, default -1 (all) None, 0 and -1 will be interpreted as return all splits expand : bool, default False * If True, return DataFrame/MultiIndex expanding dimensionality. * If False, return Series/Index. .. versionadded:: 0.16.1 return_type : deprecated, use `expand` Returns ------- split : Series/Index or DataFrame/MultiIndex of objects """ if pat is None: if n is None or n == 0: n = -1 f = lambda x: x.split(pat, n) else: if len(pat) == 1: if n is None or n == 0: n = -1 f = lambda x: x.split(pat, n) else: if n is None or n == -1: n = 0 regex = re.compile(pat) f = lambda x: regex.split(x, maxsplit=n) res = _na_map(f, arr) return res def str_rsplit(arr, pat=None, n=None): """ Split each string in the Series/Index by the given delimiter string, starting at the end of the string and working to the front. Equivalent to :meth:`str.rsplit`. .. versionadded:: 0.16.2 Parameters ---------- pat : string, default None Separator to split on. If None, splits on whitespace n : int, default -1 (all) None, 0 and -1 will be interpreted as return all splits expand : bool, default False * If True, return DataFrame/MultiIndex expanding dimensionality. * If False, return Series/Index. Returns ------- split : Series/Index or DataFrame/MultiIndex of objects """ if n is None or n == 0: n = -1 f = lambda x: x.rsplit(pat, n) res = _na_map(f, arr) return res def str_slice(arr, start=None, stop=None, step=None): """ Slice substrings from each element in the Series/Index Parameters ---------- start : int or None stop : int or None step : int or None Returns ------- sliced : Series/Index of objects """ obj = slice(start, stop, step) f = lambda x: x[obj] return _na_map(f, arr) def str_slice_replace(arr, start=None, stop=None, repl=None): """ Replace a slice of each string in the Series/Index with another string. Parameters ---------- start : int or None stop : int or None repl : str or None String for replacement Returns ------- replaced : Series/Index of objects """ if repl is None: repl = '' def f(x): if x[start:stop] == '': local_stop = start else: local_stop = stop y = '' if start is not None: y += x[:start] y += repl if stop is not None: y += x[local_stop:] return y return _na_map(f, arr) def str_strip(arr, to_strip=None, side='both'): """ Strip whitespace (including newlines) from each string in the Series/Index. Parameters ---------- to_strip : str or unicode side : {'left', 'right', 'both'}, default 'both' Returns ------- stripped : Series/Index of objects """ if side == 'both': f = lambda x: x.strip(to_strip) elif side == 'left': f = lambda x: x.lstrip(to_strip) elif side == 'right': f = lambda x: x.rstrip(to_strip) else: # pragma: no cover raise ValueError('Invalid side') return _na_map(f, arr) def str_wrap(arr, width, **kwargs): r""" Wrap long strings in the Series/Index to be formatted in paragraphs with length less than a given width. This method has the same keyword parameters and defaults as :class:`textwrap.TextWrapper`. Parameters ---------- width : int Maximum line-width expand_tabs : bool, optional If true, tab characters will be expanded to spaces (default: True) replace_whitespace : bool, optional If true, each whitespace character (as defined by string.whitespace) remaining after tab expansion will be replaced by a single space (default: True) drop_whitespace : bool, optional If true, whitespace that, after wrapping, happens to end up at the beginning or end of a line is dropped (default: True) break_long_words : bool, optional If true, then words longer than width will be broken in order to ensure that no lines are longer than width. If it is false, long words will not be broken, and some lines may be longer than width. (default: True) break_on_hyphens : bool, optional If true, wrapping will occur preferably on whitespace and right after hyphens in compound words, as it is customary in English. If false, only whitespaces will be considered as potentially good places for line breaks, but you need to set break_long_words to false if you want truly insecable words. (default: True) Returns ------- wrapped : Series/Index of objects Notes ----- Internally, this method uses a :class:`textwrap.TextWrapper` instance with default settings. To achieve behavior matching R's stringr library str_wrap function, use the arguments: - expand_tabs = False - replace_whitespace = True - drop_whitespace = True - break_long_words = False - break_on_hyphens = False Examples -------- >>> s = pd.Series(['line to be wrapped', 'another line to be wrapped']) >>> s.str.wrap(12) 0 line to be\nwrapped 1 another line\nto be\nwrapped """ kwargs['width'] = width tw = textwrap.TextWrapper(**kwargs) return _na_map(lambda s: '\n'.join(tw.wrap(s)), arr) def str_translate(arr, table, deletechars=None): """ Map all characters in the string through the given mapping table. Equivalent to standard :meth:`str.translate`. Note that the optional argument deletechars is only valid if you are using python 2. For python 3, character deletion should be specified via the table argument. Parameters ---------- table : dict (python 3), str or None (python 2) In python 3, table is a mapping of Unicode ordinals to Unicode ordinals, strings, or None. Unmapped characters are left untouched. Characters mapped to None are deleted. :meth:`str.maketrans` is a helper function for making translation tables. In python 2, table is either a string of length 256 or None. If the table argument is None, no translation is applied and the operation simply removes the characters in deletechars. :func:`string.maketrans` is a helper function for making translation tables. deletechars : str, optional (python 2) A string of characters to delete. This argument is only valid in python 2. Returns ------- translated : Series/Index of objects """ if deletechars is None: f = lambda x: x.translate(table) else: from pandas import compat if compat.PY3: raise ValueError("deletechars is not a valid argument for " "str.translate in python 3. You should simply " "specify character deletions in the table " "argument") f = lambda x: x.translate(table, deletechars) return _na_map(f, arr) def str_get(arr, i): """ Extract element from lists, tuples, or strings in each element in the Series/Index. Parameters ---------- i : int Integer index (location) Returns ------- items : Series/Index of objects """ f = lambda x: x[i] if len(x) > i else np.nan return _na_map(f, arr) def str_decode(arr, encoding, errors="strict"): """ Decode character string in the Series/Index using indicated encoding. Equivalent to :meth:`str.decode` in python2 and :meth:`bytes.decode` in python3. Parameters ---------- encoding : str errors : str, optional Returns ------- decoded : Series/Index of objects """ if encoding in _cpython_optimized_decoders: # CPython optimized implementation f = lambda x: x.decode(encoding, errors) else: decoder = codecs.getdecoder(encoding) f = lambda x: decoder(x, errors)[0] return _na_map(f, arr) def str_encode(arr, encoding, errors="strict"): """ Encode character string in the Series/Index using indicated encoding. Equivalent to :meth:`str.encode`. Parameters ---------- encoding : str errors : str, optional Returns ------- encoded : Series/Index of objects """ if encoding in _cpython_optimized_encoders: # CPython optimized implementation f = lambda x: x.encode(encoding, errors) else: encoder = codecs.getencoder(encoding) f = lambda x: encoder(x, errors)[0] return _na_map(f, arr) def _noarg_wrapper(f, docstring=None, **kargs): def wrapper(self): result = _na_map(f, self._data, **kargs) return self._wrap_result(result) wrapper.__name__ = f.__name__ if docstring is not None: wrapper.__doc__ = docstring else: raise ValueError('Provide docstring') return wrapper def _pat_wrapper(f, flags=False, na=False, **kwargs): def wrapper1(self, pat): result = f(self._data, pat) return self._wrap_result(result) def wrapper2(self, pat, flags=0, **kwargs): result = f(self._data, pat, flags=flags, **kwargs) return self._wrap_result(result) def wrapper3(self, pat, na=np.nan): result = f(self._data, pat, na=na) return self._wrap_result(result) wrapper = wrapper3 if na else wrapper2 if flags else wrapper1 wrapper.__name__ = f.__name__ if f.__doc__: wrapper.__doc__ = f.__doc__ return wrapper def copy(source): "Copy a docstring from another source function (if present)" def do_copy(target): if source.__doc__: target.__doc__ = source.__doc__ return target return do_copy class StringMethods(NoNewAttributesMixin): """ Vectorized string functions for Series and Index. NAs stay NA unless handled otherwise by a particular method. Patterned after Python's string methods, with some inspiration from R's stringr package. Examples -------- >>> s.str.split('_') >>> s.str.replace('_', '') """ def __init__(self, data): self._is_categorical = is_categorical_dtype(data) self._data = data.cat.categories if self._is_categorical else data # save orig to blow up categoricals to the right type self._orig = data self._freeze() def __getitem__(self, key): if isinstance(key, slice): return self.slice(start=key.start, stop=key.stop, step=key.step) else: return self.get(key) def __iter__(self): i = 0 g = self.get(i) while g.notna().any(): yield g i += 1 g = self.get(i) def _wrap_result(self, result, use_codes=True, name=None, expand=None): from pandas.core.index import Index, MultiIndex # for category, we do the stuff on the categories, so blow it up # to the full series again # But for some operations, we have to do the stuff on the full values, # so make it possible to skip this step as the method already did this # before the transformation... if use_codes and self._is_categorical: result = take_1d(result, self._orig.cat.codes) if not hasattr(result, 'ndim') or not hasattr(result, 'dtype'): return result assert result.ndim < 3 if expand is None: # infer from ndim if expand is not specified expand = False if result.ndim == 1 else True elif expand is True and not isinstance(self._orig, Index): # required when expand=True is explicitly specified # not needed when infered def cons_row(x): if is_list_like(x): return x else: return [x] result = [cons_row(x) for x in result] if not isinstance(expand, bool): raise ValueError("expand must be True or False") if expand is False: # if expand is False, result should have the same name # as the original otherwise specified if name is None: name = getattr(result, 'name', None) if name is None: # do not use logical or, _orig may be a DataFrame # which has "name" column name = self._orig.name # Wait until we are sure result is a Series or Index before # checking attributes (GH 12180) if isinstance(self._orig, Index): # if result is a boolean np.array, return the np.array # instead of wrapping it into a boolean Index (GH 8875) if is_bool_dtype(result): return result if expand: result = list(result) return MultiIndex.from_tuples(result, names=name) else: return Index(result, name=name) else: index = self._orig.index if expand: cons = self._orig._constructor_expanddim return cons(result, columns=name, index=index) else: # Must be a Series cons = self._orig._constructor return cons(result, name=name, index=index) @copy(str_cat) def cat(self, others=None, sep=None, na_rep=None): data = self._orig if self._is_categorical else self._data result = str_cat(data, others=others, sep=sep, na_rep=na_rep) return self._wrap_result(result, use_codes=(not self._is_categorical)) @copy(str_split) def split(self, pat=None, n=-1, expand=False): result = str_split(self._data, pat, n=n) return self._wrap_result(result, expand=expand) @copy(str_rsplit) def rsplit(self, pat=None, n=-1, expand=False): result = str_rsplit(self._data, pat, n=n) return self._wrap_result(result, expand=expand) _shared_docs['str_partition'] = (""" Split the string at the %(side)s occurrence of `sep`, and return 3 elements containing the part before the separator, the separator itself, and the part after the separator. If the separator is not found, return %(return)s. Parameters ---------- pat : string, default whitespace String to split on. expand : bool, default True * If True, return DataFrame/MultiIndex expanding dimensionality. * If False, return Series/Index. Returns ------- split : DataFrame/MultiIndex or Series/Index of objects See Also -------- %(also)s Examples -------- >>> s = Series(['A_B_C', 'D_E_F', 'X']) 0 A_B_C 1 D_E_F 2 X dtype: object >>> s.str.partition('_') 0 1 2 0 A _ B_C 1 D _ E_F 2 X >>> s.str.rpartition('_') 0 1 2 0 A_B _ C 1 D_E _ F 2 X """) @Appender(_shared_docs['str_partition'] % { 'side': 'first', 'return': '3 elements containing the string itself, followed by two ' 'empty strings', 'also': 'rpartition : Split the string at the last occurrence of `sep`' }) def partition(self, pat=' ', expand=True): f = lambda x: x.partition(pat) result = _na_map(f, self._data) return self._wrap_result(result, expand=expand) @Appender(_shared_docs['str_partition'] % { 'side': 'last', 'return': '3 elements containing two empty strings, followed by the ' 'string itself', 'also': 'partition : Split the string at the first occurrence of `sep`' }) def rpartition(self, pat=' ', expand=True): f = lambda x: x.rpartition(pat) result = _na_map(f, self._data) return self._wrap_result(result, expand=expand) @copy(str_get) def get(self, i): result = str_get(self._data, i) return self._wrap_result(result) @copy(str_join) def join(self, sep): result = str_join(self._data, sep) return self._wrap_result(result) @copy(str_contains) def contains(self, pat, case=True, flags=0, na=np.nan, regex=True): result = str_contains(self._data, pat, case=case, flags=flags, na=na, regex=regex) return self._wrap_result(result) @copy(str_match) def match(self, pat, case=True, flags=0, na=np.nan, as_indexer=None): result = str_match(self._data, pat, case=case, flags=flags, na=na, as_indexer=as_indexer) return self._wrap_result(result) @copy(str_replace) def replace(self, pat, repl, n=-1, case=None, flags=0): result = str_replace(self._data, pat, repl, n=n, case=case, flags=flags) return self._wrap_result(result) @copy(str_repeat) def repeat(self, repeats): result = str_repeat(self._data, repeats) return self._wrap_result(result) @copy(str_pad) def pad(self, width, side='left', fillchar=' '): result = str_pad(self._data, width, side=side, fillchar=fillchar) return self._wrap_result(result) _shared_docs['str_pad'] = (""" Filling %(side)s side of strings in the Series/Index with an additional character. Equivalent to :meth:`str.%(method)s`. Parameters ---------- width : int Minimum width of resulting string; additional characters will be filled with ``fillchar`` fillchar : str Additional character for filling, default is whitespace Returns ------- filled : Series/Index of objects """) @Appender(_shared_docs['str_pad'] % dict(side='left and right', method='center')) def center(self, width, fillchar=' '): return self.pad(width, side='both', fillchar=fillchar) @Appender(_shared_docs['str_pad'] % dict(side='right', method='ljust')) def ljust(self, width, fillchar=' '): return self.pad(width, side='right', fillchar=fillchar) @Appender(_shared_docs['str_pad'] % dict(side='left', method='rjust')) def rjust(self, width, fillchar=' '): return self.pad(width, side='left', fillchar=fillchar) def zfill(self, width): """ Filling left side of strings in the Series/Index with 0. Equivalent to :meth:`str.zfill`. Parameters ---------- width : int Minimum width of resulting string; additional characters will be filled with 0 Returns ------- filled : Series/Index of objects """ result = str_pad(self._data, width, side='left', fillchar='0') return self._wrap_result(result) @copy(str_slice) def slice(self, start=None, stop=None, step=None): result = str_slice(self._data, start, stop, step) return self._wrap_result(result) @copy(str_slice_replace) def slice_replace(self, start=None, stop=None, repl=None): result = str_slice_replace(self._data, start, stop, repl) return self._wrap_result(result) @copy(str_decode) def decode(self, encoding, errors="strict"): result = str_decode(self._data, encoding, errors) return self._wrap_result(result) @copy(str_encode) def encode(self, encoding, errors="strict"): result = str_encode(self._data, encoding, errors) return self._wrap_result(result) _shared_docs['str_strip'] = (""" Strip whitespace (including newlines) from each string in the Series/Index from %(side)s. Equivalent to :meth:`str.%(method)s`. Returns ------- stripped : Series/Index of objects """) @Appender(_shared_docs['str_strip'] % dict(side='left and right sides', method='strip')) def strip(self, to_strip=None): result = str_strip(self._data, to_strip, side='both') return self._wrap_result(result) @Appender(_shared_docs['str_strip'] % dict(side='left side', method='lstrip')) def lstrip(self, to_strip=None): result = str_strip(self._data, to_strip, side='left') return self._wrap_result(result) @Appender(_shared_docs['str_strip'] % dict(side='right side', method='rstrip')) def rstrip(self, to_strip=None): result = str_strip(self._data, to_strip, side='right') return self._wrap_result(result) @copy(str_wrap) def wrap(self, width, **kwargs): result = str_wrap(self._data, width, **kwargs) return self._wrap_result(result) @copy(str_get_dummies) def get_dummies(self, sep='|'): # we need to cast to Series of strings as only that has all # methods available for making the dummies... data = self._orig.astype(str) if self._is_categorical else self._data result, name = str_get_dummies(data, sep) return self._wrap_result(result, use_codes=(not self._is_categorical), name=name, expand=True) @copy(str_translate) def translate(self, table, deletechars=None): result = str_translate(self._data, table, deletechars) return self._wrap_result(result) count = _pat_wrapper(str_count, flags=True) startswith = _pat_wrapper(str_startswith, na=True) endswith = _pat_wrapper(str_endswith, na=True) findall = _pat_wrapper(str_findall, flags=True) @copy(str_extract) def extract(self, pat, flags=0, expand=None): return str_extract(self, pat, flags=flags, expand=expand) @copy(str_extractall) def extractall(self, pat, flags=0): return str_extractall(self._orig, pat, flags=flags) _shared_docs['find'] = (""" Return %(side)s indexes in each strings in the Series/Index where the substring is fully contained between [start:end]. Return -1 on failure. Equivalent to standard :meth:`str.%(method)s`. Parameters ---------- sub : str Substring being searched start : int Left edge index end : int Right edge index Returns ------- found : Series/Index of integer values See Also -------- %(also)s """) @Appender(_shared_docs['find'] % dict(side='lowest', method='find', also='rfind : Return highest indexes in each strings')) def find(self, sub, start=0, end=None): result = str_find(self._data, sub, start=start, end=end, side='left') return self._wrap_result(result) @Appender(_shared_docs['find'] % dict(side='highest', method='rfind', also='find : Return lowest indexes in each strings')) def rfind(self, sub, start=0, end=None): result = str_find(self._data, sub, start=start, end=end, side='right') return self._wrap_result(result) def normalize(self, form): """Return the Unicode normal form for the strings in the Series/Index. For more information on the forms, see the :func:`unicodedata.normalize`. Parameters ---------- form : {'NFC', 'NFKC', 'NFD', 'NFKD'} Unicode form Returns ------- normalized : Series/Index of objects """ import unicodedata f = lambda x: unicodedata.normalize(form, compat.u_safe(x)) result = _na_map(f, self._data) return self._wrap_result(result) _shared_docs['index'] = (""" Return %(side)s indexes in each strings where the substring is fully contained between [start:end]. This is the same as ``str.%(similar)s`` except instead of returning -1, it raises a ValueError when the substring is not found. Equivalent to standard ``str.%(method)s``. Parameters ---------- sub : str Substring being searched start : int Left edge index end : int Right edge index Returns ------- found : Series/Index of objects See Also -------- %(also)s """) @Appender(_shared_docs['index'] % dict(side='lowest', similar='find', method='index', also='rindex : Return highest indexes in each strings')) def index(self, sub, start=0, end=None): result = str_index(self._data, sub, start=start, end=end, side='left') return self._wrap_result(result) @Appender(_shared_docs['index'] % dict(side='highest', similar='rfind', method='rindex', also='index : Return lowest indexes in each strings')) def rindex(self, sub, start=0, end=None): result = str_index(self._data, sub, start=start, end=end, side='right') return self._wrap_result(result) _shared_docs['len'] = (""" Compute length of each string in the Series/Index. Returns ------- lengths : Series/Index of integer values """) len = _noarg_wrapper(len, docstring=_shared_docs['len'], dtype=int) _shared_docs['casemethods'] = (""" Convert strings in the Series/Index to %(type)s. Equivalent to :meth:`str.%(method)s`. Returns ------- converted : Series/Index of objects """) _shared_docs['lower'] = dict(type='lowercase', method='lower') _shared_docs['upper'] = dict(type='uppercase', method='upper') _shared_docs['title'] = dict(type='titlecase', method='title') _shared_docs['capitalize'] = dict(type='be capitalized', method='capitalize') _shared_docs['swapcase'] = dict(type='be swapcased', method='swapcase') lower = _noarg_wrapper(lambda x: x.lower(), docstring=_shared_docs['casemethods'] % _shared_docs['lower']) upper = _noarg_wrapper(lambda x: x.upper(), docstring=_shared_docs['casemethods'] % _shared_docs['upper']) title = _noarg_wrapper(lambda x: x.title(), docstring=_shared_docs['casemethods'] % _shared_docs['title']) capitalize = _noarg_wrapper(lambda x: x.capitalize(), docstring=_shared_docs['casemethods'] % _shared_docs['capitalize']) swapcase = _noarg_wrapper(lambda x: x.swapcase(), docstring=_shared_docs['casemethods'] % _shared_docs['swapcase']) _shared_docs['ismethods'] = (""" Check whether all characters in each string in the Series/Index are %(type)s. Equivalent to :meth:`str.%(method)s`. Returns ------- is : Series/array of boolean values """) _shared_docs['isalnum'] = dict(type='alphanumeric', method='isalnum') _shared_docs['isalpha'] = dict(type='alphabetic', method='isalpha') _shared_docs['isdigit'] = dict(type='digits', method='isdigit') _shared_docs['isspace'] = dict(type='whitespace', method='isspace') _shared_docs['islower'] = dict(type='lowercase', method='islower') _shared_docs['isupper'] = dict(type='uppercase', method='isupper') _shared_docs['istitle'] = dict(type='titlecase', method='istitle') _shared_docs['isnumeric'] = dict(type='numeric', method='isnumeric') _shared_docs['isdecimal'] = dict(type='decimal', method='isdecimal') isalnum = _noarg_wrapper(lambda x: x.isalnum(), docstring=_shared_docs['ismethods'] % _shared_docs['isalnum']) isalpha = _noarg_wrapper(lambda x: x.isalpha(), docstring=_shared_docs['ismethods'] % _shared_docs['isalpha']) isdigit = _noarg_wrapper(lambda x: x.isdigit(), docstring=_shared_docs['ismethods'] % _shared_docs['isdigit']) isspace = _noarg_wrapper(lambda x: x.isspace(), docstring=_shared_docs['ismethods'] % _shared_docs['isspace']) islower = _noarg_wrapper(lambda x: x.islower(), docstring=_shared_docs['ismethods'] % _shared_docs['islower']) isupper = _noarg_wrapper(lambda x: x.isupper(), docstring=_shared_docs['ismethods'] % _shared_docs['isupper']) istitle = _noarg_wrapper(lambda x: x.istitle(), docstring=_shared_docs['ismethods'] % _shared_docs['istitle']) isnumeric = _noarg_wrapper(lambda x: compat.u_safe(x).isnumeric(), docstring=_shared_docs['ismethods'] % _shared_docs['isnumeric']) isdecimal = _noarg_wrapper(lambda x: compat.u_safe(x).isdecimal(), docstring=_shared_docs['ismethods'] % _shared_docs['isdecimal']) @classmethod def _make_accessor(cls, data): from pandas.core.index import Index if (isinstance(data, ABCSeries) and not ((is_categorical_dtype(data.dtype) and is_object_dtype(data.values.categories)) or (is_object_dtype(data.dtype)))): # it's neither a string series not a categorical series with # strings inside the categories. # this really should exclude all series with any non-string values # (instead of test for object dtype), but that isn't practical for # performance reasons until we have a str dtype (GH 9343) raise AttributeError("Can only use .str accessor with string " "values, which use np.object_ dtype in " "pandas") elif isinstance(data, Index): # can't use ABCIndex to exclude non-str # see scc/inferrence.pyx which can contain string values allowed_types = ('string', 'unicode', 'mixed', 'mixed-integer') if data.inferred_type not in allowed_types: message = ("Can only use .str accessor with string values " "(i.e. inferred_type is 'string', 'unicode' or " "'mixed')") raise AttributeError(message) if data.nlevels > 1: message = ("Can only use .str accessor with Index, not " "MultiIndex") raise AttributeError(message) return StringMethods(data) class StringAccessorMixin(object): """ Mixin to add a `.str` acessor to the class.""" str = AccessorProperty(StringMethods) def _dir_additions(self): return set() def _dir_deletions(self): try: getattr(self, 'str') except AttributeError: return set(['str']) return set()
{ "content_hash": "ccfea6db631b3716cff58a9f8c544de7", "timestamp": "", "source": "github", "line_count": 1939, "max_line_length": 79, "avg_line_length": 30.999484270242395, "alnum_prop": 0.5750482464896519, "repo_name": "DGrady/pandas", "id": "0b1db0277eee3fc0d7b7d80258333c157a7cf46b", "size": "60108", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "pandas/core/strings.py", "mode": "33188", "license": "bsd-3-clause", "language": [ { "name": "Batchfile", "bytes": "4071" }, { "name": "C", "bytes": "493476" }, { "name": "C++", "bytes": "17353" }, { "name": "HTML", "bytes": "551706" }, { "name": "Makefile", "bytes": "907" }, { "name": "PowerShell", "bytes": "2970" }, { "name": "Python", "bytes": "12054479" }, { "name": "R", "bytes": "1177" }, { "name": "Shell", "bytes": "22265" }, { "name": "Smarty", "bytes": "2045" } ], "symlink_target": "" }
"""Home of the Sequential model, and the `save_model`/`load_model` functions. """ from __future__ import absolute_import from __future__ import division from __future__ import print_function import copy import json import os import numpy as np from tensorflow.contrib.keras.python.keras import backend as K from tensorflow.contrib.keras.python.keras import layers as layer_module from tensorflow.contrib.keras.python.keras import optimizers from tensorflow.contrib.keras.python.keras.engine import topology from tensorflow.contrib.keras.python.keras.engine.topology import Input from tensorflow.contrib.keras.python.keras.engine.topology import Layer from tensorflow.contrib.keras.python.keras.engine.topology import TFBaseLayer from tensorflow.contrib.keras.python.keras.engine.training import Model from tensorflow.contrib.keras.python.keras.utils.io_utils import ask_to_proceed_with_overwrite from tensorflow.python.framework import ops from tensorflow.python.platform import tf_logging as logging # pylint: disable=g-import-not-at-top try: import h5py except ImportError: h5py = None try: import yaml except ImportError: yaml = None # pylint: enable=g-import-not-at-top def save_model(model, filepath, overwrite=True, include_optimizer=True): """Save a model to a HDF5 file. The saved model contains: - the model's configuration (topology) - the model's weights - the model's optimizer's state (if any) Thus the saved model can be reinstantiated in the exact same state, without any of the code used for model definition or training. Arguments: model: Keras model instance to be saved. filepath: String, path where to save the model. overwrite: Whether we should overwrite any existing model at the target location, or instead ask the user with a manual prompt. include_optimizer: If True, save optimizer's state together. Raises: ImportError: if h5py is not available. """ if h5py is None: raise ImportError('`save_model` requires h5py.') def get_json_type(obj): """Serialize any object to a JSON-serializable structure. Arguments: obj: the object to serialize Returns: JSON-serializable structure representing `obj`. Raises: TypeError: if `obj` cannot be serialized. """ # if obj is a serializable Keras class instance # e.g. optimizer, layer if hasattr(obj, 'get_config'): return {'class_name': obj.__class__.__name__, 'config': obj.get_config()} # if obj is any numpy type if type(obj).__module__ == np.__name__: if isinstance(obj, np.ndarray): return {'type': type(obj), 'value': obj.tolist()} else: return obj.item() # misc functions (e.g. loss function) if callable(obj): return obj.__name__ # if obj is a python 'type' if type(obj).__name__ == type.__name__: return obj.__name__ raise TypeError('Not JSON Serializable:', obj) from tensorflow.contrib.keras.python.keras import __version__ as keras_version # pylint: disable=g-import-not-at-top # If file exists and should not be overwritten. if not overwrite and os.path.isfile(filepath): proceed = ask_to_proceed_with_overwrite(filepath) if not proceed: return f = h5py.File(filepath, 'w') f.attrs['keras_version'] = str(keras_version).encode('utf8') f.attrs['backend'] = K.backend().encode('utf8') f.attrs['model_config'] = json.dumps( { 'class_name': model.__class__.__name__, 'config': model.get_config() }, default=get_json_type).encode('utf8') model_weights_group = f.create_group('model_weights') model_layers = model.layers topology.save_weights_to_hdf5_group(model_weights_group, model_layers) if include_optimizer and hasattr(model, 'optimizer'): if isinstance(model.optimizer, optimizers.TFOptimizer): logging.warning( 'TensorFlow optimizers do not ' 'make it possible to access ' 'optimizer attributes or optimizer state ' 'after instantiation. ' 'As a result, we cannot save the optimizer ' 'as part of the model save file.' 'You will have to compile your model again after loading it. ' 'Prefer using a Keras optimizer instead ' '(see keras.io/optimizers).') else: f.attrs['training_config'] = json.dumps( { 'optimizer_config': { 'class_name': model.optimizer.__class__.__name__, 'config': model.optimizer.get_config() }, 'loss': model.loss, 'metrics': model.metrics, 'sample_weight_mode': model.sample_weight_mode, 'loss_weights': model.loss_weights, }, default=get_json_type).encode('utf8') # Save optimizer weights. symbolic_weights = getattr(model.optimizer, 'weights') if symbolic_weights: optimizer_weights_group = f.create_group('optimizer_weights') weight_values = K.batch_get_value(symbolic_weights) weight_names = [] for w, val in zip(symbolic_weights, weight_values): name = str(w.name) weight_names.append(name.encode('utf8')) optimizer_weights_group.attrs['weight_names'] = weight_names for name, val in zip(weight_names, weight_values): param_dset = optimizer_weights_group.create_dataset( name, val.shape, dtype=val.dtype) if not val.shape: # scalar param_dset[()] = val else: param_dset[:] = val f.flush() f.close() def load_model(filepath, custom_objects=None, compile=True): # pylint: disable=redefined-builtin """Loads a model saved via `save_model`. Arguments: filepath: String, path to the saved model. custom_objects: Optional dictionary mapping names (strings) to custom classes or functions to be considered during deserialization. compile: Boolean, whether to compile the model after loading. Returns: A Keras model instance. If an optimizer was found as part of the saved model, the model is already compiled. Otherwise, the model is uncompiled and a warning will be displayed. When `compile` is set to False, the compilation is omitted without any warning. Raises: ImportError: if h5py is not available. ValueError: In case of an invalid savefile. """ if h5py is None: raise ImportError('`load_model` requires h5py.') if not custom_objects: custom_objects = {} def convert_custom_objects(obj): """Handles custom object lookup. Arguments: obj: object, dict, or list. Returns: The same structure, where occurrences of a custom object name have been replaced with the custom object. """ if isinstance(obj, list): deserialized = [] for value in obj: deserialized.append(convert_custom_objects(value)) return deserialized if isinstance(obj, dict): deserialized = {} for key, value in obj.items(): deserialized[key] = convert_custom_objects(value) return deserialized if obj in custom_objects: return custom_objects[obj] return obj with h5py.File(filepath, mode='r') as f: # instantiate model model_config = f.attrs.get('model_config') if model_config is None: raise ValueError('No model found in config file.') model_config = json.loads(model_config.decode('utf-8')) model = model_from_config(model_config, custom_objects=custom_objects) # set weights topology.load_weights_from_hdf5_group(f['model_weights'], model.layers) # Early return if compilation is not required. if not compile: return model # instantiate optimizer training_config = f.attrs.get('training_config') if training_config is None: logging.warning('No training configuration found in save file: ' 'the model was *not* compiled. Compile it manually.') return model training_config = json.loads(training_config.decode('utf-8')) optimizer_config = training_config['optimizer_config'] optimizer = optimizers.deserialize( optimizer_config, custom_objects=custom_objects) # Recover loss functions and metrics. loss = convert_custom_objects(training_config['loss']) metrics = convert_custom_objects(training_config['metrics']) sample_weight_mode = training_config['sample_weight_mode'] loss_weights = training_config['loss_weights'] # Compile model. model.compile( optimizer=optimizer, loss=loss, metrics=metrics, loss_weights=loss_weights, sample_weight_mode=sample_weight_mode) # Set optimizer weights. if 'optimizer_weights' in f: # Build train function (to get weight updates). if isinstance(model, Sequential): model.model._make_train_function() else: model._make_train_function() optimizer_weights_group = f['optimizer_weights'] optimizer_weight_names = [ n.decode('utf8') for n in optimizer_weights_group.attrs['weight_names'] ] optimizer_weight_values = [ optimizer_weights_group[n] for n in optimizer_weight_names ] try: model.optimizer.set_weights(optimizer_weight_values) except ValueError: logging.warning('Error in loading the saved optimizer ' 'state. As a result, your model is ' 'starting with a freshly initialized ' 'optimizer.') return model def model_from_config(config, custom_objects=None): """Instantiates a Keras model from its config. Arguments: config: Configuration dictionary. custom_objects: Optional dictionary mapping names (strings) to custom classes or functions to be considered during deserialization. Returns: A Keras model instance (uncompiled). Raises: TypeError: if `config` is not a dictionary. """ if isinstance(config, list): raise TypeError('`model_from_config` expects a dictionary, not a list. ' 'Maybe you meant to use ' '`Sequential.from_config(config)`?') return layer_module.deserialize(config, custom_objects=custom_objects) def model_from_yaml(yaml_string, custom_objects=None): """Parses a yaml model configuration file and returns a model instance. Arguments: yaml_string: YAML string encoding a model configuration. custom_objects: Optional dictionary mapping names (strings) to custom classes or functions to be considered during deserialization. Returns: A Keras model instance (uncompiled). Raises: ImportError: if yaml module is not found. """ if yaml is None: raise ImportError('Requires yaml module installed.') config = yaml.load(yaml_string) return layer_module.deserialize(config, custom_objects=custom_objects) def model_from_json(json_string, custom_objects=None): """Parses a JSON model configuration file and returns a model instance. Arguments: json_string: JSON string encoding a model configuration. custom_objects: Optional dictionary mapping names (strings) to custom classes or functions to be considered during deserialization. Returns: A Keras model instance (uncompiled). """ config = json.loads(json_string) return layer_module.deserialize(config, custom_objects=custom_objects) class Sequential(Model): """Linear stack of layers. Arguments: layers: list of layers to add to the model. # Note The first layer passed to a Sequential model should have a defined input shape. What that means is that it should have received an `input_shape` or `batch_input_shape` argument, or for some type of layers (recurrent, Dense...) an `input_dim` argument. Example: ```python model = Sequential() # first layer must have a defined input shape model.add(Dense(32, input_dim=500)) # afterwards, Keras does automatic shape inference model.add(Dense(32)) # also possible (equivalent to the above): model = Sequential() model.add(Dense(32, input_shape=(500,))) model.add(Dense(32)) # also possible (equivalent to the above): model = Sequential() # here the batch dimension is None, # which means any batch size will be accepted by the model. model.add(Dense(32, batch_input_shape=(None, 500))) model.add(Dense(32)) ``` """ def __init__(self, layers=None, name=None): self.layers = [] # Stack of layers. self.model = None # Internal Model instance. self.inputs = [] # List of input tensors self.outputs = [] # List of length 1: the output tensor (unique). self._trainable = True self._initial_weights = None self._input_layers = [] # Model attributes. self.inbound_nodes = [] self.outbound_nodes = [] self.built = False # Set model name. if not name: prefix = 'sequential_' name = prefix + str(K.get_uid(prefix)) self.name = name # The following properties are not actually used by Keras; # they exist for compatibility with TF's variable scoping mechanism. self._updates = [] self._losses = [] self._scope = None self._reuse = None self._base_name = name self._graph = ops.get_default_graph() # Add to the model any layers passed to the constructor. if layers: for layer in layers: self.add(layer) def add(self, layer): """Adds a layer instance on top of the layer stack. Arguments: layer: layer instance. Raises: TypeError: If `layer` is not a layer instance. ValueError: In case the `layer` argument does not know its input shape. ValueError: In case the `layer` argument has multiple output tensors, or is already connected somewhere else (forbidden in `Sequential` models). """ if not isinstance(layer, (Layer, TFBaseLayer)): raise TypeError('The added layer must be ' 'an instance of class Layer. ' 'Found: ' + str(layer)) if not self.outputs: # first layer in model: check that it is an input layer if not layer.inbound_nodes: # create an input layer if not hasattr(layer, 'batch_input_shape'): raise ValueError('The first layer in a ' 'Sequential model must ' 'get an `input_shape` or ' '`batch_input_shape` argument.') # Instantiate the input layer. x = Input( batch_shape=layer.batch_input_shape, dtype=layer.dtype, name=layer.name + '_input') # This will build the current layer # and create the node connecting the current layer # to the input layer we just created. layer(x) if len(layer.inbound_nodes) != 1: raise ValueError('A layer added to a Sequential model must ' 'not already be connected somewhere else. ' 'Model received layer ' + layer.name + ' which has ' + str(len(layer.inbound_nodes)) + ' pre-existing inbound connections.') if len(layer.inbound_nodes[0].output_tensors) != 1: raise ValueError('All layers in a Sequential model ' 'should have a single output tensor. ' 'For multi-output layers, ' 'use the functional API.') self.outputs = [layer.inbound_nodes[0].output_tensors[0]] self.inputs = topology.get_source_inputs(self.outputs[0]) # We create an input node, which we will keep updated # as we add more layers topology.Node( outbound_layer=self, inbound_layers=[], node_indices=[], tensor_indices=[], input_tensors=self.inputs, output_tensors=self.outputs) else: output_tensor = layer(self.outputs[0]) if isinstance(output_tensor, list): raise TypeError('All layers in a Sequential model ' 'should have a single output tensor. ' 'For multi-output layers, ' 'use the functional API.') self.outputs = [output_tensor] # update self.inbound_nodes self.inbound_nodes[0].output_tensors = self.outputs self.inbound_nodes[0].output_shapes = [K.int_shape(self.outputs[0])] self.layers.append(layer) self.built = False def pop(self): """Removes the last layer in the model. Raises: TypeError: if there are no layers in the model. """ if not self.layers: raise TypeError('There are no layers in the model.') self.layers.pop() if not self.layers: self.outputs = [] self.inbound_nodes = [] self.outbound_nodes = [] else: self.layers[-1].outbound_nodes = [] self.outputs = [self.layers[-1].output] # update self.inbound_nodes self.inbound_nodes[0].output_tensors = self.outputs self.inbound_nodes[0].output_shapes = [K.int_shape(self.outputs[0])] self.built = False def get_layer(self, name=None, index=None): """Retrieve a layer that is part of the model. Returns a layer based on either its name (unique) or its index in the graph. Indices are based on order of horizontal graph traversal (bottom-up). Arguments: name: string, name of layer. index: integer, index of layer. Returns: A layer instance. """ if self.model is None: self.build() return self.model.get_layer(name, index) def call(self, inputs, mask=None): if self.model is None: self.build() return self.model.call(inputs, mask) def build(self, input_shape=None): if not self.inputs or not self.outputs: raise TypeError('Sequential model cannot be built: model is empty.' ' Add some layers first.') # actually create the model self.model = Model(self.inputs, self.outputs[0], name=self.name + '_model') self.model.trainable = self.trainable # mirror model attributes self.supports_masking = self.model.supports_masking self._output_mask_cache = self.model._output_mask_cache self._output_tensor_cache = self.model._output_tensor_cache self._output_shape_cache = self.model._output_shape_cache self._input_layers = self.model._input_layers self._output_layers = self.model._output_layers self._input_coordinates = self.model._input_coordinates self._output_coordinates = self.model._output_coordinates self._nodes_by_depth = self.model._nodes_by_depth self._network_nodes = self.model._network_nodes self.output_names = self.model.output_names self.input_names = self.model.input_names self._feed_input_names = self.model._feed_input_names self._feed_inputs = self.model._feed_inputs # Make sure child model callbacks # will call the parent Sequential model. self.model.callback_model = self self.built = True @property def uses_learning_phase(self): if self.model is None: self.build() return self.model.uses_learning_phase def _gather_list_attr(self, attr): all_attrs = [] for layer in self.layers: all_attrs += getattr(layer, attr, []) return all_attrs @property def trainable(self): return self._trainable @trainable.setter def trainable(self, value): if self.model: self.model.trainable = value self._trainable = value @property def trainable_weights(self): if not self.trainable: return [] return self._gather_list_attr('trainable_weights') @property def non_trainable_weights(self): weights = self._gather_list_attr('non_trainable_weights') if not self.trainable: trainable_weights = self._gather_list_attr('trainable_weights') return trainable_weights + weights return weights @property def updates(self): if self.model is None: self.build() return self.model.updates @property def state_updates(self): if self.model is None: self.build() return self.model.state_updates def get_updates_for(self, inputs): if self.model is None: self.build() return self.model.get_updates_for(inputs) @property def losses(self): if self.model is None: self.build() return self.model.losses def get_losses_for(self, inputs): if self.model is None: self.build() return self.model.get_losses_for(inputs) @property def regularizers(self): if self.model is None: self.build() return self.model.regularizers def get_weights(self): """Retrieves the weights of the model. Returns: A flat list of Numpy arrays (one array per model weight). """ if self.model is None: self.build() return self.model.get_weights() def set_weights(self, weights): """Sets the weights of the model. Arguments: weights: Should be a list of Numpy arrays with shapes and types matching the output of `model.get_weights()`. """ if self.model is None: self.build() self.model.set_weights(weights) def load_weights(self, filepath, by_name=False): if h5py is None: raise ImportError('`load_weights` requires h5py.') f = h5py.File(filepath, mode='r') if 'layer_names' not in f.attrs and 'model_weights' in f: f = f['model_weights'] layers = self.layers if by_name: topology.load_weights_from_hdf5_group_by_name(f, layers) else: topology.load_weights_from_hdf5_group(f, layers) if hasattr(f, 'close'): f.close() def save_weights(self, filepath, overwrite=True): if h5py is None: raise ImportError('`save_weights` requires h5py.') # If file exists and should not be overwritten: if not overwrite and os.path.isfile(filepath): proceed = ask_to_proceed_with_overwrite(filepath) if not proceed: return layers = self.layers f = h5py.File(filepath, 'w') topology.save_weights_to_hdf5_group(f, layers) f.flush() f.close() def compile(self, optimizer, loss, metrics=None, sample_weight_mode=None, **kwargs): """Configures the learning process. Arguments: optimizer: str (name of optimizer) or optimizer object. See [optimizers](/optimizers). loss: str (name of objective function) or objective function. See [losses](/losses). metrics: list of metrics to be evaluated by the model during training and testing. Typically you will use `metrics=['accuracy']`. See [metrics](/metrics). sample_weight_mode: if you need to do timestep-wise sample weighting (2D weights), set this to "temporal". "None" defaults to sample-wise weights (1D). **kwargs: for Theano backend, these are passed into K.function. When using the Tensorflow backend, these are passed into `tf.Session.run`. Example: ```python model = Sequential() model.add(Dense(32, input_shape=(500,))) model.add(Dense(10, activation='softmax')) model.compile(optimizer='rmsprop', loss='categorical_crossentropy', metrics=['accuracy']) ``` """ # create the underlying model self.build() # call compile method of Model class self.model.compile( optimizer, loss, metrics=metrics, sample_weight_mode=sample_weight_mode, **kwargs) self.optimizer = self.model.optimizer self.loss = self.model.loss self.total_loss = self.model.total_loss self.loss_weights = self.model.loss_weights self.metrics = self.model.metrics self.metrics_tensors = self.model.metrics_tensors self.metrics_names = self.model.metrics_names self.sample_weight_mode = self.model.sample_weight_mode self.sample_weights = self.model.sample_weights self.targets = self.model.targets def fit(self, x, y, batch_size=32, epochs=10, verbose=1, callbacks=None, validation_split=0., validation_data=None, shuffle=True, class_weight=None, sample_weight=None, initial_epoch=0): """Trains the model for a fixed number of epochs. Arguments: x: input data, as a Numpy array or list of Numpy arrays (if the model has multiple inputs). y: labels, as a Numpy array. batch_size: integer. Number of samples per gradient update. epochs: integer, the number of epochs to train the model. verbose: 0 for no logging to stdout, 1 for progress bar logging, 2 for one log line per epoch. callbacks: list of `keras.callbacks.Callback` instances. List of callbacks to apply during training. See [callbacks](/callbacks). validation_split: float (0. < x < 1). Fraction of the data to use as held-out validation data. validation_data: tuple (x_val, y_val) or tuple (x_val, y_val, val_sample_weights) to be used as held-out validation data. Will override validation_split. shuffle: boolean or str (for 'batch'). Whether to shuffle the samples at each epoch. 'batch' is a special option for dealing with the limitations of HDF5 data; it shuffles in batch-sized chunks. class_weight: dictionary mapping classes to a weight value, used for scaling the loss function (during training only). sample_weight: Numpy array of weights for the training samples, used for scaling the loss function (during training only). You can either pass a flat (1D) Numpy array with the same length as the input samples (1:1 mapping between weights and samples), or in the case of temporal data, you can pass a 2D array with shape (samples, sequence_length), to apply a different weight to every timestep of every sample. In this case you should make sure to specify sample_weight_mode="temporal" in compile(). initial_epoch: epoch at which to start training (useful for resuming a previous training run) Returns: A `History` object. Its `History.history` attribute is a record of training loss values and metrics values at successive epochs, as well as validation loss values and validation metrics values (if applicable). Raises: RuntimeError: if the model was never compiled. """ if self.model is None: raise RuntimeError('The model needs to be compiled ' 'before being used.') return self.model.fit( x, y, batch_size=batch_size, epochs=epochs, verbose=verbose, callbacks=callbacks, validation_split=validation_split, validation_data=validation_data, shuffle=shuffle, class_weight=class_weight, sample_weight=sample_weight, initial_epoch=initial_epoch) def evaluate(self, x, y, batch_size=32, verbose=1, sample_weight=None): """Computes the loss on some input data, batch by batch. Arguments: x: input data, as a Numpy array or list of Numpy arrays (if the model has multiple inputs). y: labels, as a Numpy array. batch_size: integer. Number of samples per gradient update. verbose: verbosity mode, 0 or 1. sample_weight: sample weights, as a Numpy array. Returns: Scalar test loss (if the model has no metrics) or list of scalars (if the model computes other metrics). The attribute `model.metrics_names` will give you the display labels for the scalar outputs. Raises: RuntimeError: if the model was never compiled. """ if self.model is None: raise RuntimeError('The model needs to be compiled ' 'before being used.') return self.model.evaluate( x, y, batch_size=batch_size, verbose=verbose, sample_weight=sample_weight) def predict(self, x, batch_size=32, verbose=0): """Generates output predictions for the input samples. The input samples are processed batch by batch. Arguments: x: the input data, as a Numpy array. batch_size: integer. verbose: verbosity mode, 0 or 1. Returns: A Numpy array of predictions. """ if self.model is None: self.build() return self.model.predict(x, batch_size=batch_size, verbose=verbose) def predict_on_batch(self, x): """Returns predictions for a single batch of samples. Arguments: x: input data, as a Numpy array or list of Numpy arrays (if the model has multiple inputs). Returns: A Numpy array of predictions. """ if self.model is None: self.build() return self.model.predict_on_batch(x) def train_on_batch(self, x, y, class_weight=None, sample_weight=None): """Single gradient update over one batch of samples. Arguments: x: input data, as a Numpy array or list of Numpy arrays (if the model has multiple inputs). y: labels, as a Numpy array. class_weight: dictionary mapping classes to a weight value, used for scaling the loss function (during training only). sample_weight: sample weights, as a Numpy array. Returns: Scalar training loss (if the model has no metrics) or list of scalars (if the model computes other metrics). The attribute `model.metrics_names` will give you the display labels for the scalar outputs. Raises: RuntimeError: if the model was never compiled. """ if self.model is None: raise RuntimeError('The model needs to be compiled ' 'before being used.') return self.model.train_on_batch( x, y, sample_weight=sample_weight, class_weight=class_weight) def test_on_batch(self, x, y, sample_weight=None): """Evaluates the model over a single batch of samples. Arguments: x: input data, as a Numpy array or list of Numpy arrays (if the model has multiple inputs). y: labels, as a Numpy array. sample_weight: sample weights, as a Numpy array. Returns: Scalar test loss (if the model has no metrics) or list of scalars (if the model computes other metrics). The attribute `model.metrics_names` will give you the display labels for the scalar outputs. Raises: RuntimeError: if the model was never compiled. """ if self.model is None: raise RuntimeError('The model needs to be compiled ' 'before being used.') return self.model.test_on_batch(x, y, sample_weight=sample_weight) def predict_proba(self, x, batch_size=32, verbose=1): """Generates class probability predictions for the input samples. The input samples are processed batch by batch. Arguments: x: input data, as a Numpy array or list of Numpy arrays (if the model has multiple inputs). batch_size: integer. verbose: verbosity mode, 0 or 1. Returns: A Numpy array of probability predictions. """ preds = self.predict(x, batch_size, verbose) if preds.min() < 0. or preds.max() > 1.: logging.warning('Network returning invalid probability values. ' 'The last layer might not normalize predictions ' 'into probabilities ' '(like softmax or sigmoid would).') return preds def predict_classes(self, x, batch_size=32, verbose=1): """Generate class predictions for the input samples. The input samples are processed batch by batch. Arguments: x: input data, as a Numpy array or list of Numpy arrays (if the model has multiple inputs). batch_size: integer. verbose: verbosity mode, 0 or 1. Returns: A numpy array of class predictions. """ proba = self.predict(x, batch_size=batch_size, verbose=verbose) if proba.shape[-1] > 1: return proba.argmax(axis=-1) else: return (proba > 0.5).astype('int32') def fit_generator(self, generator, steps_per_epoch, epochs=1, verbose=1, callbacks=None, validation_data=None, validation_steps=None, class_weight=None, max_queue_size=10, workers=1, use_multiprocessing=False, initial_epoch=0, **kwargs): """Fits the model on data generated batch-by-batch by a Python generator. The generator is run in parallel to the model, for efficiency. For instance, this allows you to do real-time data augmentation on images on CPU in parallel to training your model on GPU. Arguments: generator: A generator. The output of the generator must be either - a tuple (inputs, targets) - a tuple (inputs, targets, sample_weights). All arrays should contain the same number of samples. The generator is expected to loop over its data indefinitely. An epoch finishes when `steps_per_epoch` batches have been seen by the model. steps_per_epoch: Total number of steps (batches of samples) to yield from `generator` before declaring one epoch finished and starting the next epoch. It should typically be equal to the number of unique samples of your dataset divided by the batch size. epochs: Integer, total number of iterations on the data. verbose: Verbosity mode, 0, 1, or 2. callbacks: List of callbacks to be called during training. validation_data: This can be either - A generator for the validation data - A tuple (inputs, targets) - A tuple (inputs, targets, sample_weights). validation_steps: Only relevant if `validation_data` is a generator. Number of steps to yield from validation generator at the end of every epoch. It should typically be equal to the number of unique samples of your validation dataset divided by the batch size. class_weight: Dictionary mapping class indices to a weight for the class. max_queue_size: Maximum size for the generator queue workers: Maximum number of processes to spin up use_multiprocessing: If True, use process based threading. Note that because this implementation relies on multiprocessing, you should not pass non picklable arguments to the generator as they can't be passed easily to children processes. initial_epoch: Epoch at which to start training (useful for resuming a previous training run) **kwargs: support for legacy arguments. Returns: A `History` object. Raises: RuntimeError: if the model was never compiled. ValueError: In case the generator yields data in an invalid format. Example: ```python def generate_arrays_from_file(path): while 1: f = open(path) for line in f: # create Numpy arrays of input data # and labels, from each line in the file x, y = process_line(line) yield (x, y) f.close() model.fit_generator(generate_arrays_from_file('/my_file.txt'), steps_per_epoch=1000, epochs=10) ``` """ # Legacy support if 'max_q_size' in kwargs: max_queue_size = kwargs.pop('max_q_size') logging.warning('The argument `max_q_size` has been renamed ' '`max_queue_size`. Update your method calls accordingly.') if 'pickle_safe' in kwargs: use_multiprocessing = kwargs.pop('pickle_safe') logging.warning('The argument `pickle_safe` has been renamed ' '`use_multiprocessing`. ' 'Update your method calls accordingly.') if kwargs: raise ValueError('Unrecognized keyword arguments: ' + str(kwargs)) if self.model is None: raise RuntimeError('The model needs to be compiled ' 'before being used.') return self.model.fit_generator( generator, steps_per_epoch, epochs, verbose=verbose, callbacks=callbacks, validation_data=validation_data, validation_steps=validation_steps, class_weight=class_weight, max_queue_size=max_queue_size, workers=workers, use_multiprocessing=use_multiprocessing, initial_epoch=initial_epoch) def evaluate_generator(self, generator, steps, max_queue_size=10, workers=1, use_multiprocessing=False, **kwargs): """Evaluates the model on a data generator. The generator should return the same kind of data as accepted by `test_on_batch`. Arguments: generator: Generator yielding tuples (inputs, targets) or (inputs, targets, sample_weights) steps: Total number of steps (batches of samples) to yield from `generator` before stopping. max_queue_size: maximum size for the generator queue workers: maximum number of processes to spin up use_multiprocessing: if True, use process based threading. Note that because this implementation relies on multiprocessing, you should not pass non picklable arguments to the generator as they can't be passed easily to children processes. **kwargs: support for legacy arguments. Returns: Scalar test loss (if the model has no metrics) or list of scalars (if the model computes other metrics). The attribute `model.metrics_names` will give you the display labels for the scalar outputs. Raises: RuntimeError: if the model was never compiled. ValueError: In case the generator yields data in an invalid format. """ # Legacy support if 'max_q_size' in kwargs: max_queue_size = kwargs.pop('max_q_size') logging.warning('The argument `max_q_size` has been renamed ' '`max_queue_size`. Update your method calls accordingly.') if 'pickle_safe' in kwargs: use_multiprocessing = kwargs.pop('pickle_safe') logging.warning('The argument `pickle_safe` has been renamed ' '`use_multiprocessing`. ' 'Update your method calls accordingly.') if kwargs: raise ValueError('Unrecognized keyword arguments: ' + str(kwargs)) if self.model is None: raise RuntimeError('The model needs to be compiled ' 'before being used.') return self.model.evaluate_generator( generator, steps, max_queue_size=max_queue_size, workers=workers, use_multiprocessing=use_multiprocessing) def predict_generator(self, generator, steps, max_queue_size=10, workers=1, use_multiprocessing=False, verbose=0, **kwargs): """Generates predictions for the input samples from a data generator. The generator should return the same kind of data as accepted by `predict_on_batch`. Arguments: generator: generator yielding batches of input samples. steps: Total number of steps (batches of samples) to yield from `generator` before stopping. max_queue_size: maximum size for the generator queue workers: maximum number of processes to spin up use_multiprocessing: if True, use process based threading. Note that because this implementation relies on multiprocessing, you should not pass non picklable arguments to the generator as they can't be passed easily to children processes. verbose: verbosity mode, 0 or 1. **kwargs: support for legacy arguments. Returns: A Numpy array of predictions. Raises: ValueError: In case the generator yields data in an invalid format. """ # Legacy support if 'max_q_size' in kwargs: max_queue_size = kwargs.pop('max_q_size') logging.warning('The argument `max_q_size` has been renamed ' '`max_queue_size`. Update your method calls accordingly.') if 'pickle_safe' in kwargs: use_multiprocessing = kwargs.pop('pickle_safe') logging.warning('The argument `pickle_safe` has been renamed ' '`use_multiprocessing`. ' 'Update your method calls accordingly.') if kwargs: raise ValueError('Unrecognized keyword arguments: ' + str(kwargs)) if self.model is None: self.build() return self.model.predict_generator( generator, steps, max_queue_size=max_queue_size, workers=workers, use_multiprocessing=use_multiprocessing, verbose=verbose) def get_config(self): config = [] for layer in self.layers: config.append({ 'class_name': layer.__class__.__name__, 'config': layer.get_config() }) return copy.deepcopy(config) @classmethod def from_config(cls, config, custom_objects=None): model = cls() for conf in config: layer = layer_module.deserialize(conf, custom_objects=custom_objects) model.add(layer) return model
{ "content_hash": "9a2d86041d80642492debca962e652ce", "timestamp": "", "source": "github", "line_count": 1218, "max_line_length": 119, "avg_line_length": 35.14860426929393, "alnum_prop": 0.6266380135946369, "repo_name": "jostep/tensorflow", "id": "1a0d95c7ff24f3ff658cce7ef86204c04820806b", "size": "43535", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "tensorflow/contrib/keras/python/keras/models.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Batchfile", "bytes": "7666" }, { "name": "C", "bytes": "191403" }, { "name": "C++", "bytes": "28623031" }, { "name": "CMake", "bytes": "635936" }, { "name": "Go", "bytes": "957914" }, { "name": "Java", "bytes": "404257" }, { "name": "Jupyter Notebook", "bytes": "1833674" }, { "name": "LLVM", "bytes": "6536" }, { "name": "Makefile", "bytes": "38060" }, { "name": "Objective-C", "bytes": "7056" }, { "name": "Objective-C++", "bytes": "63210" }, { "name": "Perl", "bytes": "6715" }, { "name": "Protocol Buffer", "bytes": "264080" }, { "name": "PureBasic", "bytes": "24932" }, { "name": "Python", "bytes": "25225588" }, { "name": "Ruby", "bytes": "327" }, { "name": "Shell", "bytes": "371221" } ], "symlink_target": "" }
from rest_framework import generics, permissions as drf_permissions from rest_framework.exceptions import ValidationError, NotFound, PermissionDenied from framework.auth.oauth_scopes import CoreScopes from osf.models import AbstractNode, Registration, OSFUser from api.base import permissions as base_permissions from api.base import generic_bulk_views as bulk_views from api.base.filters import ListFilterMixin from api.base.views import JSONAPIBaseView, BaseContributorDetail, BaseContributorList, BaseNodeLinksDetail, BaseNodeLinksList, WaterButlerMixin from api.base.serializers import HideIfWithdrawal, LinkedRegistrationsRelationshipSerializer from api.base.serializers import LinkedNodesRelationshipSerializer from api.base.pagination import NodeContributorPagination from api.base.parsers import JSONAPIRelationshipParser from api.base.parsers import JSONAPIRelationshipParserForRegularJSON from api.base.utils import get_user_auth, default_node_list_permission_queryset, is_bulk_request, is_truthy from api.comments.serializers import RegistrationCommentSerializer, CommentCreateSerializer from api.identifiers.serializers import RegistrationIdentifierSerializer from api.nodes.views import NodeIdentifierList from api.users.views import UserMixin from api.users.serializers import UserSerializer from api.nodes.permissions import ( ReadOnlyIfRegistration, ContributorDetailPermissions, ContributorOrPublic, ContributorOrPublicForRelationshipPointers, AdminOrPublic, ExcludeWithdrawals, NodeLinksShowIfVersion, ) from api.registrations.serializers import ( RegistrationSerializer, RegistrationDetailSerializer, RegistrationContributorsSerializer, RegistrationProviderSerializer ) from api.nodes.filters import NodesFilterMixin from api.nodes.views import ( NodeMixin, NodeRegistrationsList, NodeLogList, NodeCommentsList, NodeProvidersList, NodeFilesList, NodeFileDetail, NodeInstitutionsList, NodeForksList, NodeWikiList, LinkedNodesList, NodeViewOnlyLinksList, NodeViewOnlyLinkDetail, NodeCitationDetail, NodeCitationStyleDetail, NodeLinkedRegistrationsList, ) from api.registrations.serializers import RegistrationNodeLinksSerializer, RegistrationFileSerializer from api.wikis.serializers import RegistrationWikiSerializer from api.base.utils import get_object_or_error class RegistrationMixin(NodeMixin): """Mixin with convenience methods for retrieving the current registration based on the current URL. By default, fetches the current registration based on the node_id kwarg. """ serializer_class = RegistrationSerializer node_lookup_url_kwarg = 'node_id' def get_node(self, check_object_permissions=True): node = get_object_or_error( AbstractNode, self.kwargs[self.node_lookup_url_kwarg], self.request, display_name='node' ) # Nodes that are folders/collections are treated as a separate resource, so if the client # requests a collection through a node endpoint, we return a 404 if node.is_collection or not node.is_registration: raise NotFound # May raise a permission denied if check_object_permissions: self.check_object_permissions(self.request, node) return node class RegistrationList(JSONAPIBaseView, generics.ListAPIView, bulk_views.BulkUpdateJSONAPIView, NodesFilterMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_list). """ permission_classes = ( drf_permissions.IsAuthenticatedOrReadOnly, base_permissions.TokenHasScope, ) required_read_scopes = [CoreScopes.NODE_REGISTRATIONS_READ] required_write_scopes = [CoreScopes.NODE_REGISTRATIONS_WRITE] serializer_class = RegistrationSerializer view_category = 'registrations' view_name = 'registration-list' ordering = ('-modified',) model_class = Registration # overrides BulkUpdateJSONAPIView def get_serializer_class(self): """ Use RegistrationDetailSerializer which requires 'id' """ if self.request.method in ('PUT', 'PATCH'): return RegistrationDetailSerializer else: return RegistrationSerializer # overrides NodesFilterMixin def get_default_queryset(self): return default_node_list_permission_queryset(user=self.request.user, model_cls=Registration) def is_blacklisted(self): query_params = self.parse_query_params(self.request.query_params) for key, field_names in query_params.iteritems(): for field_name, data in field_names.iteritems(): field = self.serializer_class._declared_fields.get(field_name) if isinstance(field, HideIfWithdrawal): return True return False # overrides ListAPIView, ListBulkCreateJSONAPIView def get_queryset(self): # For bulk requests, queryset is formed from request body. if is_bulk_request(self.request): auth = get_user_auth(self.request) registrations = Registration.objects.filter(guids___id__in=[registration['id'] for registration in self.request.data]) # If skip_uneditable=True in query_params, skip nodes for which the user # does not have EDIT permissions. if is_truthy(self.request.query_params.get('skip_uneditable', False)): has_permission = registrations.filter(contributor__user_id=auth.user.id, contributor__write=True).values_list('guids___id', flat=True) return Registration.objects.filter(guids___id__in=has_permission) for registration in registrations: if not registration.can_edit(auth): raise PermissionDenied return registrations blacklisted = self.is_blacklisted() registrations = self.get_queryset_from_request() # If attempting to filter on a blacklisted field, exclude withdrawals. if blacklisted: return registrations.exclude(retraction__isnull=False) return registrations class RegistrationDetail(JSONAPIBaseView, generics.RetrieveUpdateAPIView, RegistrationMixin, WaterButlerMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_read). """ permission_classes = ( drf_permissions.IsAuthenticatedOrReadOnly, AdminOrPublic, base_permissions.TokenHasScope, ) required_read_scopes = [CoreScopes.NODE_REGISTRATIONS_READ] required_write_scopes = [CoreScopes.NODE_REGISTRATIONS_WRITE] serializer_class = RegistrationDetailSerializer view_category = 'registrations' view_name = 'registration-detail' # overrides RetrieveAPIView def get_object(self): registration = self.get_node() if not registration.is_registration: raise ValidationError('This is not a registration.') return registration class RegistrationContributorsList(BaseContributorList, RegistrationMixin, UserMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_contributors_list). """ view_category = 'registrations' view_name = 'registration-contributors' pagination_class = NodeContributorPagination serializer_class = RegistrationContributorsSerializer required_read_scopes = [CoreScopes.NODE_REGISTRATIONS_READ] required_write_scopes = [CoreScopes.NODE_REGISTRATIONS_WRITE] permission_classes = ( ContributorDetailPermissions, drf_permissions.IsAuthenticatedOrReadOnly, ReadOnlyIfRegistration, base_permissions.TokenHasScope, ) def get_default_queryset(self): node = self.get_node(check_object_permissions=False) return node.contributor_set.all().include('user__guids') class RegistrationContributorDetail(BaseContributorDetail, RegistrationMixin, UserMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_contributors_read). """ view_category = 'registrations' view_name = 'registration-contributor-detail' serializer_class = RegistrationContributorsSerializer required_read_scopes = [CoreScopes.NODE_REGISTRATIONS_READ] required_write_scopes = [CoreScopes.NODE_REGISTRATIONS_WRITE] permission_classes = ( ContributorDetailPermissions, drf_permissions.IsAuthenticatedOrReadOnly, ReadOnlyIfRegistration, base_permissions.TokenHasScope, ) class RegistrationImplicitContributorsList(JSONAPIBaseView, generics.ListAPIView, ListFilterMixin, RegistrationMixin): permission_classes = ( AdminOrPublic, drf_permissions.IsAuthenticatedOrReadOnly, base_permissions.TokenHasScope, ) required_read_scopes = [CoreScopes.NODE_CONTRIBUTORS_READ] required_write_scopes = [CoreScopes.NULL] model_class = OSFUser serializer_class = UserSerializer view_category = 'registrations' view_name = 'registration-implicit-contributors' ordering = ('_order',) # default ordering def get_default_queryset(self): node = self.get_node() return node.parent_admin_contributors def get_queryset(self): queryset = self.get_queryset_from_request() return queryset class RegistrationChildrenList(JSONAPIBaseView, generics.ListAPIView, ListFilterMixin, RegistrationMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_children_list). """ view_category = 'registrations' view_name = 'registration-children' serializer_class = RegistrationSerializer permission_classes = ( ContributorOrPublic, drf_permissions.IsAuthenticatedOrReadOnly, ReadOnlyIfRegistration, base_permissions.TokenHasScope, ExcludeWithdrawals ) required_read_scopes = [CoreScopes.NODE_REGISTRATIONS_READ] required_write_scopes = [CoreScopes.NULL] ordering = ('-modified',) def get_default_queryset(self): return default_node_list_permission_queryset(user=self.request.user, model_cls=Registration) def get_queryset(self): registration = self.get_node() registration_pks = registration.node_relations.filter(is_node_link=False).select_related('child').values_list('child__pk', flat=True) return self.get_queryset_from_request().filter(pk__in=registration_pks).can_view(self.request.user).order_by('-modified') class RegistrationCitationDetail(NodeCitationDetail, RegistrationMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_citations_list). """ required_read_scopes = [CoreScopes.NODE_REGISTRATIONS_READ] view_category = 'registrations' view_name = 'registration-citation' class RegistrationCitationStyleDetail(NodeCitationStyleDetail, RegistrationMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_citation_read). """ required_read_scopes = [CoreScopes.NODE_REGISTRATIONS_READ] view_category = 'registrations' view_name = 'registration-style-citation' class RegistrationForksList(NodeForksList, RegistrationMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_forks_list). """ view_category = 'registrations' view_name = 'registration-forks' class RegistrationCommentsList(NodeCommentsList, RegistrationMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_comments_list). """ serializer_class = RegistrationCommentSerializer view_category = 'registrations' view_name = 'registration-comments' def get_serializer_class(self): if self.request.method == 'POST': return CommentCreateSerializer else: return RegistrationCommentSerializer class RegistrationLogList(NodeLogList, RegistrationMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_logs_list). """ view_category = 'registrations' view_name = 'registration-logs' class RegistrationProvidersList(NodeProvidersList, RegistrationMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_providers_list). """ serializer_class = RegistrationProviderSerializer view_category = 'registrations' view_name = 'registration-providers' class RegistrationNodeLinksList(BaseNodeLinksList, RegistrationMixin): """Node Links to other nodes. *Writeable*. Node Links act as pointers to other nodes. Unlike Forks, they are not copies of nodes; Node Links are a direct reference to the node that they point to. ##Node Link Attributes `type` is "node_links" None ##Links See the [JSON-API spec regarding pagination](http://jsonapi.org/format/1.0/#fetching-pagination). ##Relationships ### Target Node This endpoint shows the target node detail and is automatically embedded. ##Actions ###Adding Node Links Method: POST URL: /links/self Query Params: <none> Body (JSON): { "data": { "type": "node_links", # required "relationships": { "nodes": { "data": { "type": "nodes", # required "id": "{target_node_id}", # required } } } } } Success: 201 CREATED + node link representation To add a node link (a pointer to another node), issue a POST request to this endpoint. This effectively creates a relationship between the node and the target node. The target node must be described as a relationship object with a "data" member, containing the nodes `type` and the target node `id`. ##Query Params + `page=<Int>` -- page number of results to view, default 1 + `filter[<fieldname>]=<Str>` -- fields and values to filter the search results on. #This Request/Response """ view_category = 'registrations' view_name = 'registration-pointers' serializer_class = RegistrationNodeLinksSerializer permission_classes = ( drf_permissions.IsAuthenticatedOrReadOnly, ContributorOrPublic, ReadOnlyIfRegistration, base_permissions.TokenHasScope, ExcludeWithdrawals, NodeLinksShowIfVersion, ) required_read_scopes = [CoreScopes.NODE_REGISTRATIONS_READ] required_write_scopes = [CoreScopes.NULL] # TODO: This class doesn't exist # model_class = Pointer class RegistrationNodeLinksDetail(BaseNodeLinksDetail, RegistrationMixin): """Node Link details. *Writeable*. Node Links act as pointers to other nodes. Unlike Forks, they are not copies of nodes; Node Links are a direct reference to the node that they point to. ##Attributes `type` is "node_links" None ##Links *None* ##Relationships ###Target node This endpoint shows the target node detail and is automatically embedded. ##Actions ###Remove Node Link Method: DELETE URL: /links/self Query Params: <none> Success: 204 No Content To remove a node link from a node, issue a DELETE request to the `self` link. This request will remove the relationship between the node and the target node, not the nodes themselves. ##Query Params *None*. #This Request/Response """ view_category = 'registrations' view_name = 'registration-pointer-detail' serializer_class = RegistrationNodeLinksSerializer permission_classes = ( drf_permissions.IsAuthenticatedOrReadOnly, base_permissions.TokenHasScope, ExcludeWithdrawals, NodeLinksShowIfVersion, ) required_read_scopes = [CoreScopes.NODE_REGISTRATIONS_READ] required_write_scopes = [CoreScopes.NULL] # TODO: this class doesn't exist # model_class = Pointer # overrides RetrieveAPIView def get_object(self): registration = self.get_node() if not registration.is_registration: raise ValidationError('This is not a registration.') return registration class RegistrationRegistrationsList(NodeRegistrationsList, RegistrationMixin): """List of registrations of a registration.""" view_category = 'registrations' view_name = 'registration-registrations' class RegistrationFilesList(NodeFilesList, RegistrationMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_files_list). """ view_category = 'registrations' view_name = 'registration-files' serializer_class = RegistrationFileSerializer class RegistrationFileDetail(NodeFileDetail, RegistrationMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_files_read). """ view_category = 'registrations' view_name = 'registration-file-detail' serializer_class = RegistrationFileSerializer class RegistrationInstitutionsList(NodeInstitutionsList, RegistrationMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_institutions_list). """ view_category = 'registrations' view_name = 'registration-institutions' class RegistrationWikiList(NodeWikiList, RegistrationMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_wikis_list). """ view_category = 'registrations' view_name = 'registration-wikis' serializer_class = RegistrationWikiSerializer class RegistrationLinkedNodesList(LinkedNodesList, RegistrationMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_linked_nodes_list). """ view_category = 'registrations' view_name = 'linked-nodes' class RegistrationLinkedNodesRelationship(JSONAPIBaseView, generics.RetrieveAPIView, RegistrationMixin): """ Relationship Endpoint for Nodes -> Linked Node relationships Used to retrieve the ids of the linked nodes attached to this collection. For each id, there exists a node link that contains that node. ##Actions """ view_category = 'registrations' view_name = 'node-pointer-relationship' permission_classes = ( ContributorOrPublicForRelationshipPointers, drf_permissions.IsAuthenticatedOrReadOnly, base_permissions.TokenHasScope, ReadOnlyIfRegistration, ) required_read_scopes = [CoreScopes.NODE_LINKS_READ] required_write_scopes = [CoreScopes.NULL] serializer_class = LinkedNodesRelationshipSerializer parser_classes = (JSONAPIRelationshipParser, JSONAPIRelationshipParserForRegularJSON, ) def get_object(self): node = self.get_node(check_object_permissions=False) auth = get_user_auth(self.request) obj = {'data': [ linked_node for linked_node in node.linked_nodes.filter(is_deleted=False).exclude(type='osf.collection').exclude(type='osf.registration') if linked_node.can_view(auth) ], 'self': node} self.check_object_permissions(self.request, obj) return obj class RegistrationLinkedRegistrationsRelationship(JSONAPIBaseView, generics.RetrieveAPIView, RegistrationMixin): """Relationship Endpoint for Registration -> Linked Registration relationships. *Read-only* Used to retrieve the ids of the linked registrations attached to this collection. For each id, there exists a node link that contains that registration. """ view_category = 'registrations' view_name = 'node-registration-pointer-relationship' permission_classes = ( ContributorOrPublicForRelationshipPointers, drf_permissions.IsAuthenticatedOrReadOnly, base_permissions.TokenHasScope, ReadOnlyIfRegistration, ) required_read_scopes = [CoreScopes.NODE_LINKS_READ] required_write_scopes = [CoreScopes.NULL] serializer_class = LinkedRegistrationsRelationshipSerializer parser_classes = (JSONAPIRelationshipParser, JSONAPIRelationshipParserForRegularJSON,) def get_object(self): node = self.get_node(check_object_permissions=False) auth = get_user_auth(self.request) obj = { 'data': [ linked_registration for linked_registration in node.linked_nodes.filter(is_deleted=False, type='osf.registration').exclude(type='osf.collection') if linked_registration.can_view(auth) ], 'self': node } self.check_object_permissions(self.request, obj) return obj class RegistrationLinkedRegistrationsList(NodeLinkedRegistrationsList, RegistrationMixin): """List of registrations linked to this registration. *Read-only*. Linked registrations are the registration nodes pointed to by node links. <!--- Copied Spiel from RegistrationDetail --> Registrations are read-only snapshots of a project. This view shows details about the given registration. Each resource contains the full representation of the registration, meaning additional requests to an individual registration's detail view are not necessary. A withdrawn registration will display a limited subset of information, namely, title, description, created, registration, withdrawn, date_registered, withdrawal_justification, and registration supplement. All other fields will be displayed as null. Additionally, the only relationships permitted to be accessed for a withdrawn registration are the contributors - other relationships will return a 403. ##Linked Registration Attributes <!--- Copied Attributes from RegistrationDetail --> Registrations have the "registrations" `type`. name type description ======================================================================================================= title string title of the registered project or component description string description of the registered node category string bode category, must be one of the allowed values date_created iso8601 timestamp timestamp that the node was created date_modified iso8601 timestamp timestamp when the node was last updated tags array of strings list of tags that describe the registered node current_user_can_comment boolean Whether the current user is allowed to post comments current_user_permissions array of strings list of strings representing the permissions for the current user on this node fork boolean is this project a fork? registration boolean has this project been registered? (always true - may be deprecated in future versions) collection boolean is this registered node a collection? (always false - may be deprecated in future versions) node_license object details of the license applied to the node year string date range of the license copyright_holders array of strings holders of the applied license public boolean has this registration been made publicly-visible? withdrawn boolean has this registration been withdrawn? date_registered iso8601 timestamp timestamp that the registration was created embargo_end_date iso8601 timestamp when the embargo on this registration will be lifted (if applicable) withdrawal_justification string reasons for withdrawing the registration pending_withdrawal boolean is this registration pending withdrawal? pending_withdrawal_approval boolean is this registration pending approval? pending_embargo_approval boolean is the associated Embargo awaiting approval by project admins? registered_meta dictionary registration supplementary information registration_supplement string registration template ##Links See the [JSON-API spec regarding pagination](http://jsonapi.org/format/1.0/#fetching-pagination). ##Query Params + `page=<Int>` -- page number of results to view, default 1 + `filter[<fieldname>]=<Str>` -- fields and values to filter the search results on. Nodes may be filtered by their `title`, `category`, `description`, `public`, `registration`, or `tags`. `title`, `description`, and `category` are string fields and will be filtered using simple substring matching. `public` and `registration` are booleans, and can be filtered using truthy values, such as `true`, `false`, `0`, or `1`. Note that quoting `true` or `false` in the query will cause the match to fail regardless. `tags` is an array of simple strings. #This Request/Response """ serializer_class = RegistrationSerializer view_category = 'registrations' view_name = 'linked-registrations' class RegistrationViewOnlyLinksList(NodeViewOnlyLinksList, RegistrationMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_view_only_links_list). """ required_read_scopes = [CoreScopes.REGISTRATION_VIEW_ONLY_LINKS_READ] required_write_scopes = [CoreScopes.REGISTRATION_VIEW_ONLY_LINKS_WRITE] view_category = 'registrations' view_name = 'registration-view-only-links' class RegistrationViewOnlyLinkDetail(NodeViewOnlyLinkDetail, RegistrationMixin): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_view_only_links_read). """ required_read_scopes = [CoreScopes.REGISTRATION_VIEW_ONLY_LINKS_READ] required_write_scopes = [CoreScopes.REGISTRATION_VIEW_ONLY_LINKS_WRITE] view_category = 'registrations' view_name = 'registration-view-only-link-detail' class RegistrationIdentifierList(RegistrationMixin, NodeIdentifierList): """The documentation for this endpoint can be found [here](https://developer.osf.io/#operation/registrations_identifiers_list). """ serializer_class = RegistrationIdentifierSerializer
{ "content_hash": "6acb15363d5c4d2070361d5a000c58a3", "timestamp": "", "source": "github", "line_count": 673, "max_line_length": 150, "avg_line_length": 40.803863298662705, "alnum_prop": 0.6965150577182185, "repo_name": "binoculars/osf.io", "id": "25d487a64e482fcb96a8edf4a53cf7b2b6b85e95", "size": "27461", "binary": false, "copies": "2", "ref": "refs/heads/develop", "path": "api/registrations/views.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "CSS", "bytes": "106867" }, { "name": "HTML", "bytes": "236223" }, { "name": "JavaScript", "bytes": "1831128" }, { "name": "Mako", "bytes": "666783" }, { "name": "Python", "bytes": "7866290" }, { "name": "VCL", "bytes": "13885" } ], "symlink_target": "" }
import SimpleXMLRPCServer as xmls def echo(msg): print 'Got', msg return msg class echoserver(xmls.SimpleXMLRPCServer): allow_reuse_address = True server = echoserver(('127.0.0.1', 8001)) server.register_function(echo, 'echo') print 'Listening on port 8001' try: server.serve_forever() except: server.server_close()
{ "content_hash": "efee93b31fae91ae9847a66afd43f468", "timestamp": "", "source": "github", "line_count": 16, "max_line_length": 42, "avg_line_length": 21.1875, "alnum_prop": 0.7138643067846607, "repo_name": "keobox/yap101", "id": "7ce16cb7ee2c1e090289468a70fd88401aba8ddc", "size": "339", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "examples/xml-rpc/echoserver.py", "mode": "33188", "license": "mit", "language": [ { "name": "Jupyter Notebook", "bytes": "159082" }, { "name": "Python", "bytes": "667" }, { "name": "Shell", "bytes": "67" } ], "symlink_target": "" }
def find_words(letters): results = set() def extend_prefix(w, letters): if w in WORDS: results.add(w) if w not in PREFIXES: return for L in letters: return extend_prefix(w+L, removed(letters, L)) extend_prefix('', letters) return results
{ "content_hash": "f320adfb5df820a107a9475880976857", "timestamp": "", "source": "github", "line_count": 11, "max_line_length": 49, "avg_line_length": 22.90909090909091, "alnum_prop": 0.6944444444444444, "repo_name": "feredean/cs313", "id": "758a7c1bb061591a35f644b3c09e4d739c506101", "size": "254", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "notes/test_recursivity-nested.py", "mode": "33188", "license": "mit", "language": [ { "name": "Python", "bytes": "210982" } ], "symlink_target": "" }
import sys from Bio import SeqIO # nanocorrect is zero-based, exclusive endpoints recs = len([rec for rec in SeqIO.parse(open(sys.argv[1]), "fasta")]) batch_size = 50 for n in xrange(0, recs, batch_size): if (n + batch_size) > recs: print "%d:%d" % (n, recs) else: print "%d:%d" % (n, n + batch_size)
{ "content_hash": "f7917e92e461e6cf884b86ba45387435", "timestamp": "", "source": "github", "line_count": 12, "max_line_length": 68, "avg_line_length": 25.75, "alnum_prop": 0.6440129449838188, "repo_name": "jts/nanocorrect", "id": "9d8828973c5d9ea67f21e48a7caec8c73471ec30", "size": "310", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "makerange.py", "mode": "33188", "license": "mit", "language": [ { "name": "Jupyter Notebook", "bytes": "436671" }, { "name": "Makefile", "bytes": "919" }, { "name": "Perl", "bytes": "573" }, { "name": "Python", "bytes": "7235" }, { "name": "Shell", "bytes": "280" } ], "symlink_target": "" }
"""Code to exist off of google.appengine.dist. Kept in a separate file from the __init__ module for testing purposes. """ __all__ = ['use_library'] try: import distutils.version except ImportError: distutils = None import os import sys server_software = os.getenv('SERVER_SOFTWARE') USING_SDK = not server_software or server_software.startswith('Dev') del server_software _DESIRED_DJANGO_VERSION = 'v0_96' AUTO_IMPORT_FIXER_FILE = 'auto_import_fixer.py' def fix_paths(app_path, python_lib_path): """Fix the __path__ attr of sys.modules entries. Specifically this fixes the path of those sys.modules package entries that have __path__ attributes that point to the python library, but where there is a similar package in the application's code. Args: app_path: The root path of the application code. python_lib_path: The root path of the python library. """ if os.path.isfile(os.path.join(app_path, AUTO_IMPORT_FIXER_FILE)): return for module_name, module in sys.modules.items(): if getattr(module, '__path__', None) is None: continue module_app_path = os.path.join(app_path, *module_name.split('.')) module_init_file = os.path.join(module_app_path, '__init__.py') if not os.path.isfile(module_init_file): continue found_python_lib_path = False found_app_path = False for path in module.__path__: if path.startswith(python_lib_path): found_python_lib_path = True if path.startswith(app_path): found_app_path = True if found_python_lib_path and not found_app_path: module.__path__.append(module_app_path) try: import google except ImportError: import google as google if not USING_SDK: this_version = os.path.dirname(os.path.dirname(google.__file__)) versions = os.path.dirname(this_version) PYTHON_LIB = os.path.dirname(versions) fix_paths(sys.path[-1], PYTHON_LIB) del this_version, versions else: PYTHON_LIB = os.path.dirname(os.path.dirname(google.__file__)) del google installed = {} def SetAllowedModule(_): pass class UnacceptableVersionError(Exception): """Raised when a version of a package that is unacceptable is requested.""" pass class LooseVersion(object): """Shallow class compatible with distutils.version.LooseVersion.""" def __init__(self, version): """Create a new instance of LooseVersion. Args: version: iterable containing the version values. """ self.version = tuple(map(str, version)) def __repr__(self): return '.'.join(self.version) def __str__(self): return '.'.join(self.version) @classmethod def parse(cls, string): """Parse a version string and create a new LooseVersion instance. Args: string: dot delimited version string. Returns: A distutils.version.LooseVersion compatible object. """ return cls(string.split('.')) def DjangoVersion(): """Discover the version of Django installed. Returns: A distutils.version.LooseVersion. """ try: __import__('django.' + _DESIRED_DJANGO_VERSION) except ImportError: pass import django try: return distutils.version.LooseVersion('.'.join(map(str, django.VERSION))) except AttributeError: return LooseVersion(django.VERSION) def PylonsVersion(): """Discover the version of Pylons installed. Returns: A distutils.version.LooseVersion. """ import pylons return distutils.version.LooseVersion(pylons.__version__) PACKAGES = { 'django': (DjangoVersion, {'0.96': None, '1.0': None, '1.1': None, '1.2': None, '1.3': None, }), '_test': (lambda: distutils.version.LooseVersion('1.0'), {'1.0': None}), '_testpkg': (lambda: distutils.version.LooseVersion('1.0'), {'1.0': set([('_test', '1.0')])}), } def EqualVersions(version, baseline): """Test that a version is acceptable as compared to the baseline. Meant to be used to compare version numbers as returned by a package itself and not user input. Args: version: distutils.version.LooseVersion. The version that is being checked. baseline: distutils.version.LooseVersion. The version that one hopes version compares equal to. Returns: A bool indicating whether the versions are considered equal. """ baseline_tuple = baseline.version truncated_tuple = version.version[:len(baseline_tuple)] if truncated_tuple == baseline_tuple: return True else: return False def AllowInstalledLibrary(name, desired): """Allow the use of a package without performing a version check. Needed to clear a package's dependencies in case the dependencies need to be imported in order to perform a version check. The version check is skipped on the dependencies because the assumption is that the package that triggered the call would not be installed without the proper dependencies (which might be a different version than what the package explicitly requires). Args: name: Name of package. desired: Desired version. Raises: UnacceptableVersion Error if the installed version of a package is unacceptable. """ CallSetAllowedModule(name, desired) dependencies = PACKAGES[name][1][desired] if dependencies: for dep_name, dep_version in dependencies: AllowInstalledLibrary(dep_name, dep_version) installed[name] = desired, False def CheckInstalledLibrary(name, desired): """Check that the library and its dependencies are installed. Args: name: Name of the library that should be installed. desired: The desired version. Raises: UnacceptableVersionError if the installed version of a package is unacceptable. """ dependencies = PACKAGES[name][1][desired] if dependencies: for dep_name, dep_version in dependencies: AllowInstalledLibrary(dep_name, dep_version) CheckInstalledVersion(name, desired, explicit=True) def CheckInstalledVersion(name, desired, explicit): """Check that the installed version of a package is acceptable. Args: name: Name of package. desired: Desired version string. explicit: Explicitly requested by the user or implicitly because of a dependency. Raises: UnacceptableVersionError if the installed version of a package is unacceptable. """ CallSetAllowedModule(name, desired) find_version = PACKAGES[name][0] if name == 'django': global _DESIRED_DJANGO_VERSION _DESIRED_DJANGO_VERSION = 'v' + desired.replace('.', '_') installed_version = find_version() try: desired_version = distutils.version.LooseVersion(desired) except AttributeError: desired_version = LooseVersion.parse(desired) if not EqualVersions(installed_version, desired_version): raise UnacceptableVersionError( '%s %s was requested, but %s is already in use' % (name, desired_version, installed_version)) installed[name] = desired, explicit def CallSetAllowedModule(name, desired): """Helper to call SetAllowedModule(name), after special-casing Django.""" if USING_SDK and name == 'django': sys.path[:] = [dirname for dirname in sys.path if not dirname.startswith(os.path.join( PYTHON_LIB, 'lib', 'django'))] if desired in ('0.96', '1.2', '1.3'): sys.path.insert(1, os.path.join(PYTHON_LIB, 'lib', 'django_' + desired.replace('.', '_'))) SetAllowedModule(name) def CreatePath(name, version): """Create the path to a package.""" package_dir = '%s-%s' % (name, version) return os.path.join(PYTHON_LIB, 'versions', 'third_party', package_dir) def RemoveLibrary(name): """Remove a library that has been installed.""" installed_version, _ = installed[name] path = CreatePath(name, installed_version) try: sys.path.remove(path) except ValueError: pass del installed[name] def AddLibrary(name, version, explicit): """Add a library to sys.path and 'installed'.""" sys.path.insert(1, CreatePath(name, version)) installed[name] = version, explicit def InstallLibrary(name, version, explicit=True): """Install a package. If the installation is explicit then the user made the installation request, not a package as a dependency. Explicit installation leads to stricter version checking. Args: name: Name of the requested package (already validated as available). version: The desired version (already validated as available). explicit: Explicitly requested by the user or implicitly because of a dependency. """ installed_version, explicitly_installed = installed.get(name, [None] * 2) if name in sys.modules: if explicit: CheckInstalledVersion(name, version, explicit=True) return elif installed_version: if version == installed_version: return if explicit: if explicitly_installed: raise ValueError('%s %s requested, but %s already in use' % (name, version, installed_version)) RemoveLibrary(name) else: version_ob = distutils.version.LooseVersion(version) installed_ob = distutils.version.LooseVersion(installed_version) if version_ob <= installed_ob: return else: RemoveLibrary(name) AddLibrary(name, version, explicit) dep_details = PACKAGES[name][1][version] if not dep_details: return for dep_name, dep_version in dep_details: InstallLibrary(dep_name, dep_version, explicit=False) def use_library(name, version): """Specify a third-party package to use. Args: name: Name of package to use. version: Version of the package to use (string). """ if name not in PACKAGES: raise ValueError('%s is not a supported package' % name) versions = PACKAGES[name][1].keys() if version not in versions: raise ValueError('%s is not a supported version for %s; ' 'supported versions are %s' % (version, name, versions)) if USING_SDK: CheckInstalledLibrary(name, version) else: InstallLibrary(name, version, explicit=True) if not USING_SDK: InstallLibrary('django', '0.96', explicit=False)
{ "content_hash": "1d44853c93d8440c780baf6f58402841", "timestamp": "", "source": "github", "line_count": 435, "max_line_length": 79, "avg_line_length": 23.680459770114943, "alnum_prop": 0.6767304145228619, "repo_name": "illicitonion/givabit", "id": "289d8c999b3c67699e99a5cd9b1da47d5d1d523b", "size": "10918", "binary": false, "copies": "5", "ref": "refs/heads/master", "path": "lib/sdks/google_appengine_1.7.1/google_appengine/google/appengine/dist/_library.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "ActionScript", "bytes": "87423" }, { "name": "C", "bytes": "2369361" }, { "name": "C#", "bytes": "6965" }, { "name": "C++", "bytes": "20" }, { "name": "Emacs Lisp", "bytes": "4733" }, { "name": "Java", "bytes": "374" }, { "name": "JavaScript", "bytes": "10909968" }, { "name": "Python", "bytes": "27960052" }, { "name": "Ruby", "bytes": "25648" }, { "name": "Shell", "bytes": "8763" }, { "name": "VimL", "bytes": "5645" } ], "symlink_target": "" }
"""manage test imports.""" import unittest def suite(): """collect and run all tests for gateway.""" return unittest.TestLoader().discover("gateway.tests", pattern="*.py")
{ "content_hash": "39e8887ab5542bfda5d20816ae75d76b", "timestamp": "", "source": "github", "line_count": 7, "max_line_length": 74, "avg_line_length": 26, "alnum_prop": 0.6758241758241759, "repo_name": "davisk/gateway", "id": "aebce2ad9a15b5b5575a93fe89bb1db1061e02fe", "size": "182", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "gateway/tests/__init__.py", "mode": "33188", "license": "mit", "language": [ { "name": "CSS", "bytes": "212650" }, { "name": "JavaScript", "bytes": "23853" }, { "name": "Python", "bytes": "25257" }, { "name": "Shell", "bytes": "2357" } ], "symlink_target": "" }
from __future__ import unicode_literals import django.contrib.postgres.fields.jsonb from django.db import migrations class Migration(migrations.Migration): dependencies = [ ('crowdsourcing', '0004_batchfile_hash_sha512'), ] operations = [ migrations.AlterField( model_name='batchfile', name='first_row', field=django.contrib.postgres.fields.jsonb.JSONField(blank=True, null=True), ), ]
{ "content_hash": "a0ab2a5a150578d76835c06a036a8bc2", "timestamp": "", "source": "github", "line_count": 19, "max_line_length": 88, "avg_line_length": 24.57894736842105, "alnum_prop": 0.6445396145610278, "repo_name": "aginzberg/crowdsource-platform", "id": "bcfeb6d4b05fed1caf5d37409625165e0916ffdd", "size": "537", "binary": false, "copies": "2", "ref": "refs/heads/develop2", "path": "crowdsourcing/migrations/0005_auto_20151207_2358.py", "mode": "33188", "license": "mit", "language": [ { "name": "CSS", "bytes": "328687" }, { "name": "HTML", "bytes": "178994" }, { "name": "JavaScript", "bytes": "168588" }, { "name": "Python", "bytes": "339941" }, { "name": "Shell", "bytes": "838" } ], "symlink_target": "" }
from __future__ import unicode_literals import datetime import inspect import random import re import six def camelcase_to_underscores(argument): ''' Converts a camelcase param like theNewAttribute to the equivalent python underscore variable like the_new_attribute''' result = '' prev_char_title = True for char in argument: if char.istitle() and not prev_char_title: # Only add underscore if char is capital, not first letter, and prev # char wasn't capital result += "_" prev_char_title = char.istitle() if not char.isspace(): # Only add non-whitespace result += char.lower() return result def underscores_to_camelcase(argument): ''' Converts a camelcase param like the_new_attribute to the equivalent camelcase version like theNewAttribute. Note that the first letter is NOT capitalized by this function ''' result = '' previous_was_underscore = False for char in argument: if char != '_': if previous_was_underscore: result += char.upper() else: result += char previous_was_underscore = char == '_' return result def method_names_from_class(clazz): # On Python 2, methods are different from functions, and the `inspect` # predicates distinguish between them. On Python 3, methods are just # regular functions, and `inspect.ismethod` doesn't work, so we have to # use `inspect.isfunction` instead if six.PY2: predicate = inspect.ismethod else: predicate = inspect.isfunction return [x[0] for x in inspect.getmembers(clazz, predicate=predicate)] def get_random_hex(length=8): chars = list(range(10)) + ['a', 'b', 'c', 'd', 'e', 'f'] return ''.join(six.text_type(random.choice(chars)) for x in range(length)) def get_random_message_id(): return '{0}-{1}-{2}-{3}-{4}'.format(get_random_hex(8), get_random_hex(4), get_random_hex(4), get_random_hex(4), get_random_hex(12)) def convert_regex_to_flask_path(url_path): """ Converts a regex matching url to one that can be used with flask """ for token in ["$"]: url_path = url_path.replace(token, "") def caller(reg): match_name, match_pattern = reg.groups() return '<regex("{0}"):{1}>'.format(match_pattern, match_name) url_path = re.sub("\(\?P<(.*?)>(.*?)\)", caller, url_path) if url_path.endswith("/?"): # Flask does own handling of trailing slashes url_path = url_path.rstrip("/?") return url_path class convert_flask_to_httpretty_response(object): def __init__(self, callback): self.callback = callback @property def __name__(self): # For instance methods, use class and method names. Otherwise # use module and method name if inspect.ismethod(self.callback): outer = self.callback.__self__.__class__.__name__ else: outer = self.callback.__module__ return "{0}.{1}".format(outer, self.callback.__name__) def __call__(self, args=None, **kwargs): from flask import request result = self.callback(request, request.url, {}) # result is a status, headers, response tuple status, headers, response = result return response, status, headers def iso_8601_datetime_with_milliseconds(datetime): return datetime.strftime("%Y-%m-%dT%H:%M:%S.%f")[:-3] + 'Z' def rfc_1123_datetime(datetime): RFC1123 = '%a, %d %b %Y %H:%M:%S GMT' return datetime.strftime(RFC1123) def unix_time(dt=None): dt = dt or datetime.datetime.utcnow() epoch = datetime.datetime.utcfromtimestamp(0) delta = dt - epoch return (delta.days * 86400) + (delta.seconds + (delta.microseconds / 1e6)) def unix_time_millis(dt=None): return unix_time(dt) * 1000.0
{ "content_hash": "8aa7d3ed60a88bdf63faddbb9d92094c", "timestamp": "", "source": "github", "line_count": 123, "max_line_length": 135, "avg_line_length": 31.54471544715447, "alnum_prop": 0.6257731958762887, "repo_name": "silveregg/moto", "id": "0b30556acdff49e8d02c5e0dc3a0572f54eb7e72", "size": "3880", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "moto/core/utils.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Makefile", "bytes": "230" }, { "name": "Python", "bytes": "2435907" } ], "symlink_target": "" }
import errno import json import logging import math import time import unittest from threading import Event, Thread import cook.executor as ce import cook.progress as cp import tests.utils as tu class ProgressTest(unittest.TestCase): def test_match_progress_update(self): progress_regex_string = '\^\^\^\^JOB-PROGRESS:\s+([0-9]*\.?[0-9]+)($|\s+.*)' progress_watcher = cp.ProgressWatcher('', '', None, 1, progress_regex_string, None, None, None) def match_progress_update(input_string): return progress_watcher.match_progress_update(input_string) self.assertIsNone(match_progress_update(b'One percent complete')) self.assertIsNone(match_progress_update(b'^^^^JOB-PROGRESS: 1done')) self.assertIsNone(match_progress_update(b'^^^^JOB-PROGRESS: 1.0done')) self.assertIsNone(match_progress_update(b'^^^^JOB-PROGRESS 1 One percent complete')) self.assertIsNone(match_progress_update(b'JOB-PROGRESS: 1 One percent complete')) self.assertEqual((b'1', b''), match_progress_update(b'^^^^JOB-PROGRESS: 1')) self.assertEqual((b'1', b''), match_progress_update(b'^^^^JOB-PROGRESS: 1')) self.assertEqual((b'1', b' '), match_progress_update(b'^^^^JOB-PROGRESS: 1 ')) self.assertEqual((b'1', b' done'), match_progress_update(b'^^^^JOB-PROGRESS: 1 done')) self.assertEqual((b'1', b' One percent complete'), match_progress_update(b'^^^^JOB-PROGRESS: 1 One percent complete')) self.assertEqual((b'1', b' One percent complete'), match_progress_update(b'^^^^JOB-PROGRESS: 1 One percent complete')) self.assertEqual((b'50', b' Fifty percent complete'), match_progress_update(b'^^^^JOB-PROGRESS: 50 Fifty percent complete')) # Fractions in progress update are also supported self.assertEqual((b'2.2', b''), match_progress_update(b'^^^^JOB-PROGRESS: 2.2')) self.assertEqual((b'2.0', b' Two percent complete'), match_progress_update(b'^^^^JOB-PROGRESS: 2.0 Two percent complete')) self.assertEqual((b'2.0', b' Two percent complete'), match_progress_update(b'^^^^JOB-PROGRESS: 2.0 Two percent complete')) self.assertEqual((b'2.0', b'\tTwo percent complete'), match_progress_update(b'^^^^JOB-PROGRESS: 2.0\tTwo percent complete')) def send_progress_message_helper(self, driver, max_message_length): def send_progress_message(message): ce.send_message(driver, tu.fake_os_error_handler, message) self.assertTrue('progress-message' in message) self.assertLessEqual(len(message['progress-message']), max_message_length) return len(message['progress-message']) <= max_message_length return send_progress_message def test_send_progress_update(self): driver = tu.FakeMesosExecutorDriver() task_id = tu.get_random_task_id() max_message_length = 30 poll_interval_ms = 100 send_progress_message = self.send_progress_message_helper(driver, max_message_length) progress_updater = cp.ProgressUpdater(task_id, max_message_length, poll_interval_ms, send_progress_message) progress_data_0 = {'progress-message': b' Progress message-0', 'progress-sequence': 1} progress_updater.send_progress_update(progress_data_0) self.assertEqual(1, len(driver.messages)) actual_encoded_message_0 = driver.messages[0] expected_message_0 = {'progress-message': 'Progress message-0', 'progress-sequence': 1, 'task-id': task_id} tu.assert_message(self, expected_message_0, actual_encoded_message_0) progress_data_1 = {'progress-message': b' Progress message-1', 'progress-sequence': 2} progress_updater.send_progress_update(progress_data_1) self.assertEqual(1, len(driver.messages)) time.sleep(poll_interval_ms / 1000.0) progress_data_2 = {'progress-message': b' Progress message-2', 'progress-sequence': 3} progress_updater.send_progress_update(progress_data_2) self.assertEqual(2, len(driver.messages)) actual_encoded_message_2 = driver.messages[1] expected_message_2 = {'progress-message': 'Progress message-2', 'progress-sequence': 3, 'task-id': task_id} tu.assert_message(self, expected_message_2, actual_encoded_message_2) def test_send_progress_update_trims_progress_message(self): driver = tu.FakeMesosExecutorDriver() task_id = tu.get_random_task_id() max_message_length = 30 poll_interval_ms = 10 send_progress_message = self.send_progress_message_helper(driver, max_message_length) progress_updater = cp.ProgressUpdater(task_id, max_message_length, poll_interval_ms, send_progress_message) progress_data_0 = {'progress-message': b' Progress message-0 is really long lorem ipsum dolor sit amet text', 'progress-sequence': 1} progress_updater.send_progress_update(progress_data_0) self.assertEqual(1, len(driver.messages)) actual_encoded_message_0 = driver.messages[0] expected_message_0 = {'progress-message': 'Progress message-0 is reall...', 'progress-sequence': 1, 'task-id': task_id} tu.assert_message(self, expected_message_0, actual_encoded_message_0) def test_send_progress_does_not_trim_unknown_field(self): driver = tu.FakeMesosExecutorDriver() task_id = tu.get_random_task_id() max_message_length = 30 poll_interval_ms = 10 send_progress_message = self.send_progress_message_helper(driver, max_message_length) progress_updater = cp.ProgressUpdater(task_id, max_message_length, poll_interval_ms, send_progress_message) progress_data_0 = {'progress-message': b' pm', 'progress-sequence': 1, 'unknown': 'Unknown field has a really long lorem ipsum dolor sit amet exceed limit text'} progress_updater.send_progress_update(progress_data_0) self.assertEqual(1, len(driver.messages)) actual_encoded_message_0 = driver.messages[0] expected_message_0 = {'progress-message': 'pm', 'progress-sequence': 1, 'task-id': task_id, 'unknown': 'Unknown field has a really long lorem ipsum dolor sit amet exceed limit text'} tu.assert_message(self, expected_message_0, actual_encoded_message_0) def test_watcher_tail(self): file_name = tu.ensure_directory('build/tail_progress_test.' + tu.get_random_task_id()) items_to_write = 12 stop = Event() completed = Event() termination = Event() write_sleep_ms = 50 tail_sleep_ms = 25 try: def write_to_file(): file = open(file_name, 'w+') for item in range(items_to_write): time.sleep(write_sleep_ms / 1000.0) file.write('{}\n'.format(item)) file.flush() file.close() time.sleep(0.15) completed.set() Thread(target=write_to_file, args=()).start() counter = cp.ProgressSequenceCounter() watcher = cp.ProgressWatcher(file_name, 'test', counter, 1024, '', stop, completed, termination) collected_data = [] for line in watcher.tail(tail_sleep_ms): collected_data.append(line.strip()) self.assertEqual(items_to_write, len(collected_data)) self.assertEqual(list(map(lambda x: str.encode(str(x)), range(items_to_write))), collected_data) finally: tu.cleanup_file(file_name) def test_watcher_tail_lot_of_writes(self): file_name = tu.ensure_directory('build/tail_progress_test.' + tu.get_random_task_id()) items_to_write = 250000 stop = Event() completed = Event() termination = Event() tail_sleep_ms = 25 try: def write_to_file(): file = open(file_name, 'w+') for item in range(items_to_write): file.write('line-{}\n'.format(item)) if item % 100 == 0: file.flush() file.flush() file.close() time.sleep(0.15) completed.set() Thread(target=write_to_file, args=()).start() counter = cp.ProgressSequenceCounter() watcher = cp.ProgressWatcher(file_name, 'test', counter, 1024, '', stop, completed, termination) collected_data = [] for line in watcher.tail(tail_sleep_ms): collected_data.append(line.strip()) logging.info('Items read: {}'.format(len(collected_data))) if items_to_write != len(collected_data): for index in range(len(collected_data)): logging.info('{}: {}'.format(index, collected_data[index])) self.assertEqual(items_to_write, len(collected_data)) expected_data = list(map(lambda x: str.encode('line-{}'.format(x)), range(items_to_write))) self.assertEqual(expected_data, collected_data) finally: tu.cleanup_file(file_name) def test_watcher_tail_with_read_limit(self): file_name = tu.ensure_directory('build/tail_progress_test.' + tu.get_random_task_id()) stop = Event() completed = Event() termination = Event() tail_sleep_ms = 25 try: def write_to_file(): file = open(file_name, 'w+') file.write('abcd\n') file.flush() file.write('abcdefghijkl\n') file.flush() file.write('abcdefghijklmnopqrstuvwxyz\n') file.flush() file.close() time.sleep(0.15) completed.set() Thread(target=write_to_file, args=()).start() counter = cp.ProgressSequenceCounter() watcher = cp.ProgressWatcher(file_name, 'test', counter, 10, '', stop, completed, termination) collected_data = [] for line in watcher.tail(tail_sleep_ms): collected_data.append(line.strip()) logging.debug('collected_data = {}'.format(collected_data)) expected_data = [b'abcd', b'abcdefghij', b'kl', b'abcdefghij', b'klmnopqrst', b'uvwxyz'] self.assertEqual(expected_data, collected_data) finally: tu.cleanup_file(file_name) def test_collect_progress_updates_one_capture_group(self): file_name = tu.ensure_directory('build/collect_progress_test.' + tu.get_random_task_id()) progress_regex = '\^\^\^\^JOB-PROGRESS:\s+([0-9]*\.?[0-9]+)$' stop = Event() completed = Event() termination = Event() file = open(file_name, 'w+') file.flush() counter = cp.ProgressSequenceCounter() watcher = cp.ProgressWatcher(file_name, 'test', counter, 1024, progress_regex, stop, completed, termination) try: def print_to_file(): file.write('Stage One complete\n') file.write('^^^^JOB-PROGRESS: 50\n') file.write('Stage Three complete\n') file.write('^^^^JOB-PROGRESS: 55.0\n') file.write('^^^^JOB-PROGRESS: 65.8 Sixty-six percent\n') file.write('^^^^JOB-PROGRESS: 98.8\n') file.write('^^^^JOB-PROGRESS: 99.8\n') file.write('^^^^JOB-PROGRESS: 100.0\n') file.write('^^^^JOB-PROGRESS: 198.8\n') file.flush() file.close() print_thread = Thread(target=print_to_file, args=()) print_thread.start() progress_states = [{'progress-message': b'', 'progress-percent': 50, 'progress-sequence': 1}, {'progress-message': b'', 'progress-percent': 55, 'progress-sequence': 2}, {'progress-message': b'', 'progress-percent': 99, 'progress-sequence': 3}, {'progress-message': b'', 'progress-percent': 100, 'progress-sequence': 4}, {'progress-message': b'', 'progress-percent': 100, 'progress-sequence': 5}] for actual_progress_state in watcher.retrieve_progress_states(): expected_progress_state = progress_states.pop(0) self.assertEqual(expected_progress_state, actual_progress_state) self.assertEqual(expected_progress_state, watcher.current_progress()) if not progress_states: completed.set() self.assertFalse(progress_states) print_thread.join() finally: completed.set() tu.cleanup_file(file_name) def test_collect_progress_updates_two_capture_groups(self): file_name = tu.ensure_directory('build/collect_progress_test.' + tu.get_random_task_id()) progress_regex = '\^\^\^\^JOB-PROGRESS:\s+([0-9]*\.?[0-9]+)($|\s+.*)' stop = Event() completed = Event() termination = Event() file = open(file_name, 'w+') file.flush() counter = cp.ProgressSequenceCounter() watcher = cp.ProgressWatcher(file_name, 'test', counter, 1024, progress_regex, stop, completed, termination) try: def print_to_file(): file.write('Stage One complete\n') file.write('^^^^JOB-PROGRESS: 25 Twenty-Five\n') file.write('^^^^JOB-PROGRESS: 50 Fifty\n') file.write('Stage Three complete\n') file.write('^^^^JOB-PROGRESS: 55.0 Fifty-five\n') file.write('^^^^JOB-PROGRESS: 65.8 Sixty-six\n') file.write('Stage Four complete\n') file.write('^^^^JOB-PROGRESS: 100 Hundred\n') file.write('^^^^JOB-PROGRESS: 100.1 Over a hundred\n') file.flush() file.close() print_thread = Thread(target=print_to_file, args=()) print_thread.start() progress_states = [{'progress-message': b' Twenty-Five', 'progress-percent': 25, 'progress-sequence': 1}, {'progress-message': b' Fifty', 'progress-percent': 50, 'progress-sequence': 2}, {'progress-message': b' Fifty-five', 'progress-percent': 55, 'progress-sequence': 3}, {'progress-message': b' Sixty-six', 'progress-percent': 66, 'progress-sequence': 4}, {'progress-message': b' Hundred', 'progress-percent': 100, 'progress-sequence': 5}] for actual_progress_state in watcher.retrieve_progress_states(): expected_progress_state = progress_states.pop(0) self.assertEqual(expected_progress_state, actual_progress_state) self.assertEqual(expected_progress_state, watcher.current_progress()) if not progress_states: completed.set() self.assertFalse(progress_states) print_thread.join() finally: completed.set() tu.cleanup_file(file_name) def test_progress_updates_early_termination(self): file_name = tu.ensure_directory('build/collect_progress_test.' + tu.get_random_task_id()) progress_regex = '\^\^\^\^JOB-PROGRESS:\s+([0-9]*\.?[0-9]+)($|\s+.*)' stop = Event() completed = Event() termination = Event() termination_trigger = Event() file = open(file_name, 'w+') file.flush() counter = cp.ProgressSequenceCounter() watcher = cp.ProgressWatcher(file_name, 'test', counter, 1024, progress_regex, stop, completed, termination) try: def print_to_file(): file.write('Stage One complete\n') file.write('^^^^JOB-PROGRESS: 25 Twenty-Five\n') file.write('^^^^JOB-PROGRESS: 50 Fifty\n') file.flush() logging.info('Awaiting termination_trigger') termination_trigger.wait() logging.info('termination_trigger has been set') termination.set() file.write('Stage Three complete\n') file.write('^^^^JOB-PROGRESS: 55 Fifty-five\n') file.write('Stage Four complete\n') file.write('^^^^JOB-PROGRESS: 100 Hundred\n') file.flush() file.close() completed.set() print_thread = Thread(target=print_to_file, args=()) print_thread.daemon = True print_thread.start() progress_states = [{'progress-message': b' Twenty-Five', 'progress-percent': 25, 'progress-sequence': 1}, {'progress-message': b' Fifty', 'progress-percent': 50, 'progress-sequence': 2}] for actual_progress_state in watcher.retrieve_progress_states(): expected_progress_state = progress_states.pop(0) self.assertEqual(expected_progress_state, actual_progress_state) self.assertEqual(expected_progress_state, watcher.current_progress()) if expected_progress_state['progress-percent'] == 50: termination_trigger.set() self.assertFalse(progress_states) print_thread.join() finally: completed.set() tu.cleanup_file(file_name) def test_collect_progress_updates_skip_faulty(self): file_name = tu.ensure_directory('build/collect_progress_updates_skip_faulty.' + tu.get_random_task_id()) progress_regex = '\^\^\^\^JOB-PROGRESS:\s+([0-9]*\.?[0-9]+)($|\s+.*)' stop = Event() completed = Event() termination = Event() file = open(file_name, 'w+') file.flush() counter = cp.ProgressSequenceCounter() watcher = cp.ProgressWatcher(file_name, 'test', counter, 1024, progress_regex, stop, completed, termination) try: def print_to_file(): file.write('^^^^JOB-PROGRESS: F50 Fifty percent\n') file.write('^^^^JOB-PROGRESS: 100.1 Over a hundred percent\n') file.write('^^^^JOB-PROGRESS: 200 Two-hundred percent\n') file.write('^^^^JOB-PROGRESS: 121212121212121212 Huge percent\n') file.write('^^^^JOB-PROGRESS: 075 75% percent\n') file.flush() file.close() completed.set() print_thread = Thread(target=print_to_file, args=()) print_thread.start() progress_states = [{'progress-message': b' 75% percent', 'progress-percent': 75, 'progress-sequence': 1}] for actual_progress_state in watcher.retrieve_progress_states(): expected_progress_state = progress_states.pop(0) self.assertEqual(expected_progress_state, actual_progress_state) self.assertEqual(expected_progress_state, watcher.current_progress()) self.assertFalse(progress_states) print_thread.join() finally: completed.set() tu.cleanup_file(file_name) def test_collect_progress_updates_faulty_regex(self): file_name = tu.ensure_directory('build/collect_progress_updates_skip_faulty.' + tu.get_random_task_id()) progress_regex = '\^\^\^\^JOB-PROGRESS: (\S+)(?: )?(.*)' stop = Event() completed = Event() termination = Event() file = open(file_name, 'w+') file.flush() counter = cp.ProgressSequenceCounter() watcher = cp.ProgressWatcher(file_name, 'test', counter, 1024, progress_regex, stop, completed, termination) try: def print_to_file(): file.write('^^^^JOB-PROGRESS: ABCDEF string percent\n') file.write('^^^^JOB-PROGRESS: F50 Fifty percent\n') file.write('^^^^JOB-PROGRESS: 1019101010101010101010101018101101010101010110171010110 Sixty percent\n') file.write('^^^^JOB-PROGRESS: 75 75% percent\n') file.flush() file.close() completed.set() print_thread = Thread(target=print_to_file, args=()) print_thread.start() progress_states = [{'progress-message': b'75% percent', 'progress-percent': 75, 'progress-sequence': 1}] for actual_progress_state in watcher.retrieve_progress_states(): expected_progress_state = progress_states.pop(0) self.assertEqual(expected_progress_state, actual_progress_state) self.assertEqual(expected_progress_state, watcher.current_progress()) self.assertFalse(progress_states) print_thread.join() finally: completed.set() tu.cleanup_file(file_name) def test_collect_progress_updates_dev_null(self): file_name = tu.ensure_directory('build/collect_progress_test.' + tu.get_random_task_id()) progress_regex = '\^\^\^\^JOB-PROGRESS:\s+([0-9]*\.?[0-9]+)($|\s+.*)' location = '/dev/null' stop = Event() completed = Event() termination = Event() file = open(file_name, 'w+') file.flush() counter = cp.ProgressSequenceCounter() dn_watcher = cp.ProgressWatcher(location, 'dn', counter, 1024, progress_regex, stop, completed, termination) out_watcher = cp.ProgressWatcher(file_name, 'so', counter, 1024, progress_regex, stop, completed, termination) try: def print_to_file(): file.write('Stage One complete\n') file.write('^^^^JOB-PROGRESS: 100 100-percent\n') file.flush() file.close() completed.set() print_thread = Thread(target=print_to_file, args=()) print_thread.start() progress_states = [{'progress-message': b' 100-percent', 'progress-percent': 100, 'progress-sequence': 1}] for actual_progress_state in out_watcher.retrieve_progress_states(): expected_progress_state = progress_states.pop(0) self.assertEqual(expected_progress_state, actual_progress_state) self.assertEqual(expected_progress_state, out_watcher.current_progress()) self.assertFalse(progress_states) iterable = dn_watcher.retrieve_progress_states() exhausted = object() self.assertEqual(exhausted, next(iterable, exhausted)) self.assertIsNone(dn_watcher.current_progress()) print_thread.join() finally: completed.set() tu.cleanup_file(file_name) def test_collect_progress_updates_lots_of_writes(self): file_name = tu.ensure_directory('build/collect_progress_test.' + tu.get_random_task_id()) progress_regex = 'progress: ([0-9]*\.?[0-9]+), (.*)' items_to_write = 250000 stop = Event() completed = Event() termination = Event() def write_to_file(): target_file = open(file_name, 'w+') unit_progress_granularity = int(items_to_write / 100) for item in range(items_to_write): remainder = (item + 1) % unit_progress_granularity if remainder == 0: progress_percent = math.ceil(item / unit_progress_granularity) target_file.write('progress: {0}, completed-{0}-percent\n'.format(progress_percent)) target_file.flush() target_file.write('{}\n'.format(item)) target_file.flush() target_file.close() time.sleep(0.15) write_thread = Thread(target=write_to_file, args=()) write_thread.daemon = True write_thread.start() counter = cp.ProgressSequenceCounter() watcher = cp.ProgressWatcher(file_name, 'test', counter, 1024, progress_regex, stop, completed, termination) try: progress_states = list(map(lambda x: {'progress-message': 'completed-{}-percent'.format(x).encode(), 'progress-percent': x, 'progress-sequence': x}, range(1, 101))) for actual_progress_state in watcher.retrieve_progress_states(): expected_progress_state = progress_states.pop(0) self.assertEqual(expected_progress_state, actual_progress_state) self.assertEqual(expected_progress_state, watcher.current_progress()) if not progress_states: completed.set() self.assertFalse(progress_states) write_thread.join() finally: completed.set() tu.cleanup_file(file_name) def test_collect_progress_updates_with_empty_regex(self): file_name = tu.ensure_directory('build/collect_progress_test.' + tu.get_random_task_id()) progress_regex = '' stop = Event() completed = Event() termination = Event() file = open(file_name, 'w+') file.flush() counter = cp.ProgressSequenceCounter() watcher = cp.ProgressWatcher(file_name, 'test', counter, 1024, progress_regex, stop, completed, termination) try: def print_to_file(): file.write('Stage One complete\n') file.write('^^^^JOB-PROGRESS: 25 Twenty-Five percent\n') file.write('Stage Two complete\n') file.write('^^^^JOB-PROGRESS: 50 Fifty percent\n') file.write('Stage Three complete\n') file.write('^^^^JOB-PROGRESS: 55.0 Fifty-five percent\n') file.write('Stage Four complete\n') file.write('^^^^JOB-PROGRESS: 100 100-percent\n') file.flush() file.close() completed.set() print_thread = Thread(target=print_to_file, args=()) print_thread.start() progress_states = [] for actual_progress_state in watcher.retrieve_progress_states(): expected_progress_state = progress_states.pop(0) self.assertEqual(expected_progress_state, actual_progress_state) self.assertEqual(expected_progress_state, watcher.current_progress()) self.assertFalse(progress_states) self.assertIsNone(watcher.current_progress()) finally: completed.set() tu.cleanup_file(file_name) def test_retrieve_progress_states_os_error_from_tail(self): class FakeProgressWatcher(cp.ProgressWatcher): def __init__(self, output_name, location_tag, sequence_counter, max_bytes_read_per_line, progress_regex_string, stop_signal, task_completed_signal, progress_termination_signal): super().__init__(output_name, location_tag, sequence_counter, max_bytes_read_per_line, progress_regex_string, stop_signal, task_completed_signal, progress_termination_signal) def tail(self, sleep_time_ms): yield (b'Stage One complete') yield (b'progress: 25 Twenty-Five percent') raise OSError(errno.ENOMEM, 'No Memory') regex = 'progress: ([0-9]*\.?[0-9]+) (.*)' counter = cp.ProgressSequenceCounter() watcher = FakeProgressWatcher('', '', counter, 1024, regex, Event(), Event(), Event()) with self.assertRaises(OSError) as context: for progress in watcher.retrieve_progress_states(): self.assertIsNotNone(progress) self.assertEqual('No Memory', context.exception.strerror) def test_retrieve_progress_states_os_error_from_match_progress_update(self): class FakeProgressWatcher(cp.ProgressWatcher): def __init__(self, output_name, location_tag, sequence_counter, max_bytes_read_per_line, progress_regex_string, stop_signal, task_completed_signal, progress_termination_signal): super().__init__(output_name, location_tag, sequence_counter, max_bytes_read_per_line, progress_regex_string, stop_signal, task_completed_signal, progress_termination_signal) def tail(self, sleep_time_ms): yield (b'Stage One complete') yield (b'progress: 25 Twenty-Five percent') yield (b'Stage Two complete') def match_progress_update(self, input_data): if self.current_progress() is not None: raise OSError(errno.ENOMEM, 'No Memory') else: return super().match_progress_update(input_data) regex = 'progress: ([0-9]*\.?[0-9]+) (.*)' counter = cp.ProgressSequenceCounter() watcher = FakeProgressWatcher('', '', counter, 1024, regex, Event(), Event(), Event()) with self.assertRaises(OSError) as context: for progress in watcher.retrieve_progress_states(): self.assertIsNotNone(progress) self.assertEqual('No Memory', context.exception.strerror)
{ "content_hash": "ca0247d01a391c43ebd89915bd258ec4", "timestamp": "", "source": "github", "line_count": 648, "max_line_length": 120, "avg_line_length": 46.248456790123456, "alnum_prop": 0.5708899195835697, "repo_name": "twosigma/Cook", "id": "96eae55f594d6552c8fa48b0b2e85dd6a4760124", "size": "29969", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "executor/tests/test_progress.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Batchfile", "bytes": "799" }, { "name": "Clojure", "bytes": "2506248" }, { "name": "Dockerfile", "bytes": "2638" }, { "name": "Java", "bytes": "268686" }, { "name": "Jupyter Notebook", "bytes": "8047" }, { "name": "Makefile", "bytes": "638" }, { "name": "Python", "bytes": "978718" }, { "name": "Shell", "bytes": "51541" } ], "symlink_target": "" }
from __future__ import absolute_import, division, print_function __metaclass__ = type ANSIBLE_METADATA = {'metadata_version': '1.1', 'status': ['preview'], 'supported_by': 'community'} DOCUMENTATION = ''' --- module: redis short_description: Various redis commands, slave and flush description: - Unified utility to interact with redis instances. version_added: "1.3" options: command: description: - The selected redis command - C(config) (new in 1.6), ensures a configuration setting on an instance. - C(flush) flushes all the instance or a specified db. - C(slave) sets a redis instance in slave or master mode. required: true choices: [ config, flush, slave ] login_password: description: - The password used to authenticate with (usually not used) login_host: description: - The host running the database default: localhost login_port: description: - The port to connect to default: 6379 master_host: description: - The host of the master instance [slave command] master_port: description: - The port of the master instance [slave command] slave_mode: description: - the mode of the redis instance [slave command] default: slave choices: [ master, slave ] db: description: - The database to flush (used in db mode) [flush command] flush_mode: description: - Type of flush (all the dbs in a redis instance or a specific one) [flush command] default: all choices: [ all, db ] name: description: - A redis config key. version_added: 1.6 value: description: - A redis config value. version_added: 1.6 notes: - Requires the redis-py Python package on the remote host. You can install it with pip (pip install redis) or with a package manager. https://github.com/andymccurdy/redis-py - If the redis master instance we are making slave of is password protected this needs to be in the redis.conf in the masterauth variable requirements: [ redis ] author: "Xabier Larrakoetxea (@slok)" ''' EXAMPLES = ''' - name: Set local redis instance to be slave of melee.island on port 6377 redis: command: slave master_host: melee.island master_port: 6377 - name: Deactivate slave mode redis: command: slave slave_mode: master - name: Flush all the redis db redis: command: flush flush_mode: all - name: Flush only one db in a redis instance redis: command: flush db: 1 flush_mode: db - name: Configure local redis to have 10000 max clients redis: command: config name: maxclients value: 10000 - name: Configure local redis to have lua time limit of 100 ms redis: command: config name: lua-time-limit value: 100 ''' import traceback REDIS_IMP_ERR = None try: import redis except ImportError: REDIS_IMP_ERR = traceback.format_exc() redis_found = False else: redis_found = True from ansible.module_utils.basic import AnsibleModule, missing_required_lib from ansible.module_utils._text import to_native # Redis module specific support methods. def set_slave_mode(client, master_host, master_port): try: return client.slaveof(master_host, master_port) except Exception: return False def set_master_mode(client): try: return client.slaveof() except Exception: return False def flush(client, db=None): try: if not isinstance(db, int): return client.flushall() else: # The passed client has been connected to the database already return client.flushdb() except Exception: return False # Module execution. def main(): module = AnsibleModule( argument_spec=dict( command=dict(type='str', choices=['config', 'flush', 'slave']), login_password=dict(type='str', no_log=True), login_host=dict(type='str', default='localhost'), login_port=dict(type='int', default=6379), master_host=dict(type='str'), master_port=dict(type='int'), slave_mode=dict(type='str', default='slave', choices=['master', 'slave']), db=dict(type='int'), flush_mode=dict(type='str', default='all', choices=['all', 'db']), name=dict(type='str'), value=dict(type='str') ), supports_check_mode=True, ) if not redis_found: module.fail_json(msg=missing_required_lib('redis'), exception=REDIS_IMP_ERR) login_password = module.params['login_password'] login_host = module.params['login_host'] login_port = module.params['login_port'] command = module.params['command'] # Slave Command section ----------- if command == "slave": master_host = module.params['master_host'] master_port = module.params['master_port'] mode = module.params['slave_mode'] # Check if we have all the data if mode == "slave": # Only need data if we want to be slave if not master_host: module.fail_json(msg='In slave mode master host must be provided') if not master_port: module.fail_json(msg='In slave mode master port must be provided') # Connect and check r = redis.StrictRedis(host=login_host, port=login_port, password=login_password) try: r.ping() except Exception as e: module.fail_json(msg="unable to connect to database: %s" % to_native(e), exception=traceback.format_exc()) # Check if we are already in the mode that we want info = r.info() if mode == "master" and info["role"] == "master": module.exit_json(changed=False, mode=mode) elif mode == "slave" and info["role"] == "slave" and info["master_host"] == master_host and info["master_port"] == master_port: status = dict( status=mode, master_host=master_host, master_port=master_port, ) module.exit_json(changed=False, mode=status) else: # Do the stuff # (Check Check_mode before commands so the commands aren't evaluated # if not necessary) if mode == "slave": if module.check_mode or\ set_slave_mode(r, master_host, master_port): info = r.info() status = { 'status': mode, 'master_host': master_host, 'master_port': master_port, } module.exit_json(changed=True, mode=status) else: module.fail_json(msg='Unable to set slave mode') else: if module.check_mode or set_master_mode(r): module.exit_json(changed=True, mode=mode) else: module.fail_json(msg='Unable to set master mode') # flush Command section ----------- elif command == "flush": db = module.params['db'] mode = module.params['flush_mode'] # Check if we have all the data if mode == "db": if db is None: module.fail_json(msg="In db mode the db number must be provided") # Connect and check r = redis.StrictRedis(host=login_host, port=login_port, password=login_password, db=db) try: r.ping() except Exception as e: module.fail_json(msg="unable to connect to database: %s" % to_native(e), exception=traceback.format_exc()) # Do the stuff # (Check Check_mode before commands so the commands aren't evaluated # if not necessary) if mode == "all": if module.check_mode or flush(r): module.exit_json(changed=True, flushed=True) else: # Flush never fails :) module.fail_json(msg="Unable to flush all databases") else: if module.check_mode or flush(r, db): module.exit_json(changed=True, flushed=True, db=db) else: # Flush never fails :) module.fail_json(msg="Unable to flush '%d' database" % db) elif command == 'config': name = module.params['name'] value = module.params['value'] r = redis.StrictRedis(host=login_host, port=login_port, password=login_password) try: r.ping() except Exception as e: module.fail_json(msg="unable to connect to database: %s" % to_native(e), exception=traceback.format_exc()) try: old_value = r.config_get(name)[name] except Exception as e: module.fail_json(msg="unable to read config: %s" % to_native(e), exception=traceback.format_exc()) changed = old_value != value if module.check_mode or not changed: module.exit_json(changed=changed, name=name, value=value) else: try: r.config_set(name, value) except Exception as e: module.fail_json(msg="unable to write config: %s" % to_native(e), exception=traceback.format_exc()) module.exit_json(changed=changed, name=name, value=value) else: module.fail_json(msg='A valid command must be provided') if __name__ == '__main__': main()
{ "content_hash": "5051b7ad042711f75ea225d26d9e3887", "timestamp": "", "source": "github", "line_count": 297, "max_line_length": 135, "avg_line_length": 32.66329966329966, "alnum_prop": 0.5812802803834656, "repo_name": "thaim/ansible", "id": "0a27c4e1b17489833d8f2df5aadbd9ac938753e3", "size": "9867", "binary": false, "copies": "41", "ref": "refs/heads/fix-broken-link", "path": "lib/ansible/modules/database/misc/redis.py", "mode": "33188", "license": "mit", "language": [ { "name": "Python", "bytes": "7" }, { "name": "Shell", "bytes": "246" } ], "symlink_target": "" }
""" QiBuild """ from __future__ import absolute_import from __future__ import unicode_literals from __future__ import print_function print("this is foo")
{ "content_hash": "4564fb968bd5174b446c010f87ca6025", "timestamp": "", "source": "github", "line_count": 6, "max_line_length": 39, "avg_line_length": 25.833333333333332, "alnum_prop": 0.7161290322580646, "repo_name": "aldebaran/qibuild", "id": "1dba1b80a62ac7991d3a492dbb0296b429eda678", "size": "352", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "python/qipy/test/projects/foomodules/foo.py", "mode": "33188", "license": "bsd-3-clause", "language": [ { "name": "C", "bytes": "6892" }, { "name": "C++", "bytes": "23130" }, { "name": "CMake", "bytes": "292637" }, { "name": "Makefile", "bytes": "755" }, { "name": "Nix", "bytes": "563" }, { "name": "Python", "bytes": "1581825" }, { "name": "SWIG", "bytes": "306" }, { "name": "Shell", "bytes": "888" } ], "symlink_target": "" }
from __future__ import unicode_literals import re from math import floor from django import template from django.template.loader import get_template from django.utils.encoding import force_text from ..bootstrap import css_url, javascript_url, jquery_url, theme_url from ..html import link_tag from ..forms import render_button, render_field, render_field_and_label, render_form, render_form_group, render_formset, \ render_label from ..icons import render_icon from ..templates import handle_var, parse_token_contents register = template.Library() @register.simple_tag def bootstrap_jquery_url(): """ **Tag name**:: bootstrap_jquery_url Return the full url to jQuery file to use Default value: ``//code.jquery.com/jquery.min.js`` this value is configurable, see Settings section **usage**:: {% bootstrap_jquery_url %} **example**:: {% bootstrap_jquery_url %} """ return jquery_url() @register.simple_tag def bootstrap_javascript_url(): """ Return the full url to FIXTHIS Default value: ``None`` this value is configurable, see Settings section **Tag name**:: bootstrap_javascript_url **usage**:: {% bootstrap_javascript_url %} **example**:: {% bootstrap_javascript_url %} """ return javascript_url() @register.simple_tag def bootstrap_css_url(): """ Return the full url to FIXTHIS Default value: ``None`` this value is configurable, see Settings section **Tag name**:: bootstrap_css_url **usage**:: {% bootstrap_css_url %} **example**:: {% bootstrap_css_url %} """ return css_url() @register.simple_tag def bootstrap_theme_url(): """ Return the full url to FIXTHIS Default value: ``None`` this value is configurable, see Settings section **Tag name**:: bootstrap_css_url **usage**:: {% bootstrap_css_url %} **example**:: {% bootstrap_css_url %} """ return theme_url() @register.simple_tag def bootstrap_css(): """ Return HTML for Bootstrap CSS Adjust url in settings. If no url is returned, we don't want this statement to return any HTML. This is intended behavior. Default value: ``FIXTHIS`` this value is configurable, see Settings section **Tag name**:: bootstrap_css **usage**:: {% bootstrap_css %} **example**:: {% bootstrap_css %} """ urls = [url for url in [bootstrap_css_url(), bootstrap_theme_url()] if url] return ''.join([link_tag(url, media='screen') for url in urls]) @register.simple_tag def bootstrap_javascript(jquery=False): """ Return HTML for Bootstrap JavaScript Adjust url in settings. If no url is returned, we don't want this statement to return any HTML. This is intended behavior. Default value: ``None`` this value is configurable, see Settings section **Tag name**:: bootstrap_javascript **Parameters**: :jquery: True to include jquery FIXTHIS **usage**:: {% bootstrap_javascript FIXTHIS %} **example**:: {% bootstrap_javascript FIXTHIS %} """ javascript = '' # No async on scripts, not mature enough. See issue #52 and #56 if jquery: url = bootstrap_jquery_url() if url: javascript += '<script src="{url}"></script>'.format(url=url) url = bootstrap_javascript_url() if url: javascript += '<script src="{url}"></script>'.format(url=url) return javascript @register.simple_tag def bootstrap_formset(*args, **kwargs): """ Render a formset **Tag name**:: bootstrap_formset **Parameters**: :args: :kwargs: **usage**:: {% bootstrap_formset formset FIXTHIS %} **example**:: {% bootstrap_formset formset FIXTHIS %} """ return render_formset(*args, **kwargs) @register.simple_tag def bootstrap_form(*args, **kwargs): """ Render a form **Tag name**:: bootstrap_form **Parameters**: :args: :kwargs: **usage**:: {% bootstrap_form form FIXTHIS %} **example**:: {% bootstrap_form form FIXTHIS %} """ return render_form(*args, **kwargs) @register.simple_tag def bootstrap_field(*args, **kwargs): """ Render a field **Tag name**:: bootstrap_field **Parameters**: :args: :kwargs: **usage**:: {% bootstrap_field form_field FIXTHIS %} **example**:: {% bootstrap_form form_field FIXTHIS %} """ return render_field(*args, **kwargs) @register.simple_tag() def bootstrap_label(*args, **kwargs): """ Render a label **Tag name**:: bootstrap_label **Parameters**: :args: :kwargs: **usage**:: {% bootstrap_label FIXTHIS %} **example**:: {% bootstrap_label FIXTHIS %} """ return render_label(*args, **kwargs) @register.simple_tag def bootstrap_button(*args, **kwargs): """ Render a button **Tag name**:: bootstrap_button **Parameters**: :args: :kwargs: **usage**:: {% bootstrap_button FIXTHIS %} **example**:: {% bootstrap_button FIXTHIS %} """ return render_button(*args, **kwargs) @register.simple_tag def bootstrap_icon(icon): """ Render an icon **Tag name**:: bootstrap_icon **Parameters**: :icon: icon name **usage**:: {% bootstrap_icon "icon_name" %} **example**:: {% bootstrap_icon "star" %} """ return render_icon(icon) @register.tag('buttons') def bootstrap_buttons(parser, token): """ Render buttons for form **Tag name**:: bootstrap_buttons **Parameters**: :parser: :token: **usage**:: {% bootstrap_buttons FIXTHIS %} **example**:: {% bootstrap_buttons FIXTHIS %} """ kwargs = parse_token_contents(parser, token) kwargs['nodelist'] = parser.parse(('endbuttons', )) parser.delete_first_token() return ButtonsNode(**kwargs) class ButtonsNode(template.Node): def __init__(self, nodelist, args, kwargs, asvar, **kwargs2): self.nodelist = nodelist self.args = args self.kwargs = kwargs self.asvar = asvar def render(self, context): output_kwargs = {} for key in self.kwargs: output_kwargs[key] = handle_var(self.kwargs[key], context) buttons = [] submit = output_kwargs.get('submit', None) reset = output_kwargs.get('reset', None) if submit: buttons.append(bootstrap_button(submit, 'submit')) if reset: buttons.append(bootstrap_button(reset, 'reset')) buttons = ' '.join(buttons) + self.nodelist.render(context) output_kwargs.update({ 'label': None, 'field': buttons, }) output = render_form_group(render_field_and_label(**output_kwargs)) if self.asvar: context[self.asvar] = output return '' else: return output @register.simple_tag(takes_context=True) def bootstrap_messages(context, *args, **kwargs): """ Show django.contrib.messages Messages in Bootstrap alert containers **Tag name**:: bootstrap_messages **Parameters**: :context: :args: :kwargs: **usage**:: {% bootstrap_messages FIXTHIS %} **example**:: {% bootstrap_messages FIXTHIS %} """ return get_template('bootstrap3/messages.html').render(context) @register.inclusion_tag('bootstrap3/pagination.html') def bootstrap_pagination(page, **kwargs): """ Render pagination for a page **Tag name**:: bootstrap_pagination **Parameters**: :page: :kwargs: **usage**:: {% bootstrap_pagination FIXTHIS %} **example**:: {% bootstrap_pagination FIXTHIS %} """ pagination_kwargs = kwargs.copy() pagination_kwargs['page'] = page return get_pagination_context(**pagination_kwargs) def get_pagination_context(page, pages_to_show=11, url=None, size=None, extra=None): """ Generate Bootstrap pagination context from a page object """ pages_to_show = int(pages_to_show) if pages_to_show < 1: raise ValueError("Pagination pages_to_show should be a positive " + "integer, you specified {pages}".format(pages=pages_to_show)) num_pages = page.paginator.num_pages current_page = page.number half_page_num = int(floor(pages_to_show / 2)) - 1 if half_page_num < 0: half_page_num = 0 first_page = current_page - half_page_num if first_page <= 1: first_page = 1 if first_page > 1: pages_back = first_page - half_page_num if pages_back < 1: pages_back = 1 else: pages_back = None last_page = first_page + pages_to_show - 1 if pages_back is None: last_page += 1 if last_page > num_pages: last_page = num_pages if last_page < num_pages: pages_forward = last_page + half_page_num if pages_forward > num_pages: pages_forward = num_pages else: pages_forward = None if first_page > 1: first_page -= 1 if pages_back is not None and pages_back > 1: pages_back -= 1 else: pages_back = None pages_shown = [] for i in range(first_page, last_page + 1): pages_shown.append(i) # Append proper character to url if url: # Remove existing page GET parameters url = force_text(url) url = re.sub(r'\?page\=[^\&]+', '?', url) url = re.sub(r'\&page\=[^\&]+', '', url) # Append proper separator if '?' in url: url += '&' else: url += '?' # Append extra string to url if extra: if not url: url = '?' url += force_text(extra) + '&' if url: url = url.replace('?&', '?') # Set CSS classes,see twitter.github.io/bootstrap/components.html#pagination pagination_css_classes = ['pagination'] if size == 'small': pagination_css_classes.append('pagination-sm') elif size == 'large': pagination_css_classes.append('pagination-lg') # Build context object return { 'bootstrap_pagination_url': url, 'num_pages': num_pages, 'current_page': current_page, 'first_page': first_page, 'last_page': last_page, 'pages_shown': pages_shown, 'pages_back': pages_back, 'pages_forward': pages_forward, 'pagination_css_classes': ' '.join(pagination_css_classes), }
{ "content_hash": "6c35af5fec9b7677ba07e5c012f25a71", "timestamp": "", "source": "github", "line_count": 527, "max_line_length": 122, "avg_line_length": 21.434535104364326, "alnum_prop": 0.554621104815864, "repo_name": "rumz/pis-system", "id": "a13d65500e860fe3acfcf5b54bbef42d35089bc9", "size": "11296", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "pis_system/bootstrap3/templatetags/bootstrap3.py", "mode": "33188", "license": "mit", "language": [ { "name": "CSS", "bytes": "954" }, { "name": "HTML", "bytes": "13171" }, { "name": "JavaScript", "bytes": "6045" }, { "name": "Python", "bytes": "54395" } ], "symlink_target": "" }
import os import logging import socket from dessn.framework.fitter import Fitter from dessn.framework.models.approx_model import ApproximateModel from dessn.framework.simulations.snana_bulk import SNANABulkSimulation from dessn.framework.simulations.selection_effects import lowz_sel, des_sel if __name__ == "__main__": logging.basicConfig(level=logging.DEBUG) plot_dir = os.path.dirname(os.path.abspath(__file__)) + "/plots/%s/" % os.path.basename(__file__)[:-3] dir_name = plot_dir + "output/" pfn = plot_dir + os.path.basename(__file__)[:-3] file = os.path.abspath(__file__) print(dir_name) if not os.path.exists(dir_name): os.makedirs(dir_name) model = ApproximateModel() # Turn off mass and skewness for easy test simulation = [SNANABulkSimulation(152, sim="SHINTON_LOWZ_MATRIX_G10_SYMC_SYMX1", manual_selection=lowz_sel(), num_calib=50), SNANABulkSimulation(208, sim="SHINTON_DES_MATRIX_G10_SYMC_SYMX1", manual_selection=des_sel(), num_calib=21)] fitter = Fitter(dir_name) fitter.set_models(model) fitter.set_simulations(simulation) fitter.set_num_cosmologies(120) fitter.set_num_walkers(1) fitter.set_max_steps(5000) h = socket.gethostname() if h != "smp-hk5pn72": # The hostname of my laptop. Only will work for me, ha! fitter.fit(file) else: from chainconsumer import ChainConsumer m, s, chain, truth, weight, old_weight, posterior = fitter.load() c = ChainConsumer() c.add_chain(chain, weights=weight, posterior=posterior, name="Approx") c.configure(spacing=1.0) parameters = [r"$\Omega_m$", r"$\alpha$", r"$\beta$", r"$\langle M_B \rangle$"] print(c.analysis.get_latex_table(transpose=True)) c.plotter.plot(filename=pfn + ".png", truth=truth, parameters=parameters) print("Plotting distributions") c = ChainConsumer() c.add_chain(chain, weights=weight, posterior=posterior, name="Approx") c.configure(label_font_size=10, tick_font_size=10, diagonal_tick_labels=False) c.plotter.plot_distributions(filename=pfn + "_dist.png", truth=truth, col_wrap=8)
{ "content_hash": "78634515e102d65685799936c6c76afc", "timestamp": "", "source": "github", "line_count": 52, "max_line_length": 128, "avg_line_length": 42.01923076923077, "alnum_prop": 0.6718535469107552, "repo_name": "dessn/sn-bhm", "id": "1c0c8e02edcad0b718dd139edf2affab99db515b", "size": "2185", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "dessn/configurations/old/approximate_bulk_g10_gauss_test.py", "mode": "33188", "license": "mit", "language": [ { "name": "Batchfile", "bytes": "316" }, { "name": "HTML", "bytes": "140" }, { "name": "Python", "bytes": "342893" }, { "name": "Shell", "bytes": "2079" }, { "name": "Stan", "bytes": "59737" }, { "name": "TeX", "bytes": "595827" } ], "symlink_target": "" }
import operator from datetime import datetime, timedelta import warnings from itertools import product, starmap import numpy as np import pytest import pytz import pandas as pd import pandas.util.testing as tm from pandas.compat.numpy import np_datetime64_compat from pandas.errors import PerformanceWarning, NullFrequencyError from pandas._libs.tslibs.conversion import localize_pydatetime from pandas._libs.tslibs.offsets import shift_months from pandas.core import ops from pandas import ( Timestamp, Timedelta, Period, Series, date_range, NaT, DatetimeIndex, TimedeltaIndex) # ------------------------------------------------------------------ # Comparisons class TestDatetime64DataFrameComparison(object): @pytest.mark.parametrize('timestamps', [ [pd.Timestamp('2012-01-01 13:00:00+00:00')] * 2, [pd.Timestamp('2012-01-01 13:00:00')] * 2]) def test_tz_aware_scalar_comparison(self, timestamps): # GH#15966 df = pd.DataFrame({'test': timestamps}) expected = pd.DataFrame({'test': [False, False]}) tm.assert_frame_equal(df == -1, expected) def test_dt64_nat_comparison(self): # GH#22242, GH#22163 DataFrame considered NaT == ts incorrectly ts = pd.Timestamp.now() df = pd.DataFrame([ts, pd.NaT]) expected = pd.DataFrame([True, False]) result = df == ts tm.assert_frame_equal(result, expected) class TestDatetime64SeriesComparison(object): # TODO: moved from tests.series.test_operators; needs cleanup def test_comparison_invalid(self): # GH#4968 # invalid date/int comparisons ser = Series(range(5)) ser2 = Series(pd.date_range('20010101', periods=5)) for (x, y) in [(ser, ser2), (ser2, ser)]: result = x == y expected = Series([False] * 5) tm.assert_series_equal(result, expected) result = x != y expected = Series([True] * 5) tm.assert_series_equal(result, expected) with pytest.raises(TypeError): x >= y with pytest.raises(TypeError): x > y with pytest.raises(TypeError): x < y with pytest.raises(TypeError): x <= y @pytest.mark.parametrize('data', [ [Timestamp('2011-01-01'), NaT, Timestamp('2011-01-03')], [Timedelta('1 days'), NaT, Timedelta('3 days')], [Period('2011-01', freq='M'), NaT, Period('2011-03', freq='M')] ]) @pytest.mark.parametrize('dtype', [None, object]) def test_nat_comparisons_scalar(self, dtype, data): left = Series(data, dtype=dtype) expected = Series([False, False, False]) tm.assert_series_equal(left == NaT, expected) tm.assert_series_equal(NaT == left, expected) expected = Series([True, True, True]) tm.assert_series_equal(left != NaT, expected) tm.assert_series_equal(NaT != left, expected) expected = Series([False, False, False]) tm.assert_series_equal(left < NaT, expected) tm.assert_series_equal(NaT > left, expected) tm.assert_series_equal(left <= NaT, expected) tm.assert_series_equal(NaT >= left, expected) tm.assert_series_equal(left > NaT, expected) tm.assert_series_equal(NaT < left, expected) tm.assert_series_equal(left >= NaT, expected) tm.assert_series_equal(NaT <= left, expected) def test_series_comparison_scalars(self): series = Series(date_range('1/1/2000', periods=10)) val = datetime(2000, 1, 4) result = series > val expected = Series([x > val for x in series]) tm.assert_series_equal(result, expected) val = series[5] result = series > val expected = Series([x > val for x in series]) tm.assert_series_equal(result, expected) def test_dt64_ser_cmp_date_warning(self): # https://github.com/pandas-dev/pandas/issues/21359 # Remove this test and enble invalid test below ser = pd.Series(pd.date_range('20010101', periods=10), name='dates') date = ser.iloc[0].to_pydatetime().date() with tm.assert_produces_warning(FutureWarning) as m: result = ser == date expected = pd.Series([True] + [False] * 9, name='dates') tm.assert_series_equal(result, expected) assert "Comparing Series of datetimes " in str(m[0].message) assert "will not compare equal" in str(m[0].message) with tm.assert_produces_warning(FutureWarning) as m: result = ser != date tm.assert_series_equal(result, ~expected) assert "will not compare equal" in str(m[0].message) with tm.assert_produces_warning(FutureWarning) as m: result = ser <= date tm.assert_series_equal(result, expected) assert "a TypeError will be raised" in str(m[0].message) with tm.assert_produces_warning(FutureWarning) as m: result = ser < date tm.assert_series_equal(result, pd.Series([False] * 10, name='dates')) assert "a TypeError will be raised" in str(m[0].message) with tm.assert_produces_warning(FutureWarning) as m: result = ser >= date tm.assert_series_equal(result, pd.Series([True] * 10, name='dates')) assert "a TypeError will be raised" in str(m[0].message) with tm.assert_produces_warning(FutureWarning) as m: result = ser > date tm.assert_series_equal(result, pd.Series([False] + [True] * 9, name='dates')) assert "a TypeError will be raised" in str(m[0].message) @pytest.mark.skip(reason="GH#21359") def test_dt64ser_cmp_date_invalid(self): # GH#19800 datetime.date comparison raises to # match DatetimeIndex/Timestamp. This also matches the behavior # of stdlib datetime.datetime ser = pd.Series(pd.date_range('20010101', periods=10), name='dates') date = ser.iloc[0].to_pydatetime().date() assert not (ser == date).any() assert (ser != date).all() with pytest.raises(TypeError): ser > date with pytest.raises(TypeError): ser < date with pytest.raises(TypeError): ser >= date with pytest.raises(TypeError): ser <= date def test_dt64ser_cmp_period_scalar(self): ser = Series(pd.period_range('2000-01-01', periods=10, freq='D')) val = Period('2000-01-04', freq='D') result = ser > val expected = Series([x > val for x in ser]) tm.assert_series_equal(result, expected) val = ser[5] result = ser > val expected = Series([x > val for x in ser]) tm.assert_series_equal(result, expected) @pytest.mark.parametrize("left,right", [ ("lt", "gt"), ("le", "ge"), ("eq", "eq"), ("ne", "ne"), ]) def test_timestamp_compare_series(self, left, right): # see gh-4982 # Make sure we can compare Timestamps on the right AND left hand side. ser = pd.Series(pd.date_range("20010101", periods=10), name="dates") s_nat = ser.copy(deep=True) ser[0] = pd.Timestamp("nat") ser[3] = pd.Timestamp("nat") left_f = getattr(operator, left) right_f = getattr(operator, right) # No NaT expected = left_f(ser, pd.Timestamp("20010109")) result = right_f(pd.Timestamp("20010109"), ser) tm.assert_series_equal(result, expected) # NaT expected = left_f(ser, pd.Timestamp("nat")) result = right_f(pd.Timestamp("nat"), ser) tm.assert_series_equal(result, expected) # Compare to Timestamp with series containing NaT expected = left_f(s_nat, pd.Timestamp("20010109")) result = right_f(pd.Timestamp("20010109"), s_nat) tm.assert_series_equal(result, expected) # Compare to NaT with series containing NaT expected = left_f(s_nat, pd.Timestamp("nat")) result = right_f(pd.Timestamp("nat"), s_nat) tm.assert_series_equal(result, expected) def test_timestamp_equality(self): # GH#11034 ser = pd.Series([pd.Timestamp('2000-01-29 01:59:00'), 'NaT']) result = ser != ser tm.assert_series_equal(result, pd.Series([False, True])) result = ser != ser[0] tm.assert_series_equal(result, pd.Series([False, True])) result = ser != ser[1] tm.assert_series_equal(result, pd.Series([True, True])) result = ser == ser tm.assert_series_equal(result, pd.Series([True, False])) result = ser == ser[0] tm.assert_series_equal(result, pd.Series([True, False])) result = ser == ser[1] tm.assert_series_equal(result, pd.Series([False, False])) class TestDatetimeIndexComparisons(object): @pytest.mark.parametrize('other', [datetime(2016, 1, 1), Timestamp('2016-01-01'), np.datetime64('2016-01-01')]) def test_dti_cmp_datetimelike(self, other, tz_naive_fixture): tz = tz_naive_fixture dti = pd.date_range('2016-01-01', periods=2, tz=tz) if tz is not None: if isinstance(other, np.datetime64): # no tzaware version available return other = localize_pydatetime(other, dti.tzinfo) result = dti == other expected = np.array([True, False]) tm.assert_numpy_array_equal(result, expected) result = dti > other expected = np.array([False, True]) tm.assert_numpy_array_equal(result, expected) result = dti >= other expected = np.array([True, True]) tm.assert_numpy_array_equal(result, expected) result = dti < other expected = np.array([False, False]) tm.assert_numpy_array_equal(result, expected) result = dti <= other expected = np.array([True, False]) tm.assert_numpy_array_equal(result, expected) def dti_cmp_non_datetime(self, tz_naive_fixture): # GH#19301 by convention datetime.date is not considered comparable # to Timestamp or DatetimeIndex. This may change in the future. tz = tz_naive_fixture dti = pd.date_range('2016-01-01', periods=2, tz=tz) other = datetime(2016, 1, 1).date() assert not (dti == other).any() assert (dti != other).all() with pytest.raises(TypeError): dti < other with pytest.raises(TypeError): dti <= other with pytest.raises(TypeError): dti > other with pytest.raises(TypeError): dti >= other @pytest.mark.parametrize('other', [None, np.nan, pd.NaT]) def test_dti_eq_null_scalar(self, other, tz_naive_fixture): # GH#19301 tz = tz_naive_fixture dti = pd.date_range('2016-01-01', periods=2, tz=tz) assert not (dti == other).any() @pytest.mark.parametrize('other', [None, np.nan, pd.NaT]) def test_dti_ne_null_scalar(self, other, tz_naive_fixture): # GH#19301 tz = tz_naive_fixture dti = pd.date_range('2016-01-01', periods=2, tz=tz) assert (dti != other).all() @pytest.mark.parametrize('other', [None, np.nan]) def test_dti_cmp_null_scalar_inequality(self, tz_naive_fixture, other): # GH#19301 tz = tz_naive_fixture dti = pd.date_range('2016-01-01', periods=2, tz=tz) with pytest.raises(TypeError): dti < other with pytest.raises(TypeError): dti <= other with pytest.raises(TypeError): dti > other with pytest.raises(TypeError): dti >= other def test_dti_cmp_nat(self): left = pd.DatetimeIndex([pd.Timestamp('2011-01-01'), pd.NaT, pd.Timestamp('2011-01-03')]) right = pd.DatetimeIndex([pd.NaT, pd.NaT, pd.Timestamp('2011-01-03')]) for lhs, rhs in [(left, right), (left.astype(object), right.astype(object))]: result = rhs == lhs expected = np.array([False, False, True]) tm.assert_numpy_array_equal(result, expected) result = lhs != rhs expected = np.array([True, True, False]) tm.assert_numpy_array_equal(result, expected) expected = np.array([False, False, False]) tm.assert_numpy_array_equal(lhs == pd.NaT, expected) tm.assert_numpy_array_equal(pd.NaT == rhs, expected) expected = np.array([True, True, True]) tm.assert_numpy_array_equal(lhs != pd.NaT, expected) tm.assert_numpy_array_equal(pd.NaT != lhs, expected) expected = np.array([False, False, False]) tm.assert_numpy_array_equal(lhs < pd.NaT, expected) tm.assert_numpy_array_equal(pd.NaT > lhs, expected) def test_dti_cmp_nat_behaves_like_float_cmp_nan(self): fidx1 = pd.Index([1.0, np.nan, 3.0, np.nan, 5.0, 7.0]) fidx2 = pd.Index([2.0, 3.0, np.nan, np.nan, 6.0, 7.0]) didx1 = pd.DatetimeIndex(['2014-01-01', pd.NaT, '2014-03-01', pd.NaT, '2014-05-01', '2014-07-01']) didx2 = pd.DatetimeIndex(['2014-02-01', '2014-03-01', pd.NaT, pd.NaT, '2014-06-01', '2014-07-01']) darr = np.array([np_datetime64_compat('2014-02-01 00:00Z'), np_datetime64_compat('2014-03-01 00:00Z'), np_datetime64_compat('nat'), np.datetime64('nat'), np_datetime64_compat('2014-06-01 00:00Z'), np_datetime64_compat('2014-07-01 00:00Z')]) cases = [(fidx1, fidx2), (didx1, didx2), (didx1, darr)] # Check pd.NaT is handles as the same as np.nan with tm.assert_produces_warning(None): for idx1, idx2 in cases: result = idx1 < idx2 expected = np.array([True, False, False, False, True, False]) tm.assert_numpy_array_equal(result, expected) result = idx2 > idx1 expected = np.array([True, False, False, False, True, False]) tm.assert_numpy_array_equal(result, expected) result = idx1 <= idx2 expected = np.array([True, False, False, False, True, True]) tm.assert_numpy_array_equal(result, expected) result = idx2 >= idx1 expected = np.array([True, False, False, False, True, True]) tm.assert_numpy_array_equal(result, expected) result = idx1 == idx2 expected = np.array([False, False, False, False, False, True]) tm.assert_numpy_array_equal(result, expected) result = idx1 != idx2 expected = np.array([True, True, True, True, True, False]) tm.assert_numpy_array_equal(result, expected) with tm.assert_produces_warning(None): for idx1, val in [(fidx1, np.nan), (didx1, pd.NaT)]: result = idx1 < val expected = np.array([False, False, False, False, False, False]) tm.assert_numpy_array_equal(result, expected) result = idx1 > val tm.assert_numpy_array_equal(result, expected) result = idx1 <= val tm.assert_numpy_array_equal(result, expected) result = idx1 >= val tm.assert_numpy_array_equal(result, expected) result = idx1 == val tm.assert_numpy_array_equal(result, expected) result = idx1 != val expected = np.array([True, True, True, True, True, True]) tm.assert_numpy_array_equal(result, expected) # Check pd.NaT is handles as the same as np.nan with tm.assert_produces_warning(None): for idx1, val in [(fidx1, 3), (didx1, datetime(2014, 3, 1))]: result = idx1 < val expected = np.array([True, False, False, False, False, False]) tm.assert_numpy_array_equal(result, expected) result = idx1 > val expected = np.array([False, False, False, False, True, True]) tm.assert_numpy_array_equal(result, expected) result = idx1 <= val expected = np.array([True, False, True, False, False, False]) tm.assert_numpy_array_equal(result, expected) result = idx1 >= val expected = np.array([False, False, True, False, True, True]) tm.assert_numpy_array_equal(result, expected) result = idx1 == val expected = np.array([False, False, True, False, False, False]) tm.assert_numpy_array_equal(result, expected) result = idx1 != val expected = np.array([True, True, False, True, True, True]) tm.assert_numpy_array_equal(result, expected) @pytest.mark.parametrize('op', [operator.eq, operator.ne, operator.gt, operator.ge, operator.lt, operator.le]) def test_comparison_tzawareness_compat(self, op): # GH#18162 dr = pd.date_range('2016-01-01', periods=6) dz = dr.tz_localize('US/Pacific') with pytest.raises(TypeError): op(dr, dz) with pytest.raises(TypeError): op(dr, list(dz)) with pytest.raises(TypeError): op(dz, dr) with pytest.raises(TypeError): op(dz, list(dr)) # Check that there isn't a problem aware-aware and naive-naive do not # raise assert (dr == dr).all() assert (dr == list(dr)).all() assert (dz == dz).all() assert (dz == list(dz)).all() # Check comparisons against scalar Timestamps ts = pd.Timestamp('2000-03-14 01:59') ts_tz = pd.Timestamp('2000-03-14 01:59', tz='Europe/Amsterdam') assert (dr > ts).all() with pytest.raises(TypeError): op(dr, ts_tz) assert (dz > ts_tz).all() with pytest.raises(TypeError): op(dz, ts) # GH#12601: Check comparison against Timestamps and DatetimeIndex with pytest.raises(TypeError): op(ts, dz) @pytest.mark.parametrize('op', [operator.eq, operator.ne, operator.gt, operator.ge, operator.lt, operator.le]) @pytest.mark.parametrize('other', [datetime(2016, 1, 1), Timestamp('2016-01-01'), np.datetime64('2016-01-01')]) def test_scalar_comparison_tzawareness(self, op, other, tz_aware_fixture): tz = tz_aware_fixture dti = pd.date_range('2016-01-01', periods=2, tz=tz) with pytest.raises(TypeError): op(dti, other) with pytest.raises(TypeError): op(other, dti) @pytest.mark.parametrize('op', [operator.eq, operator.ne, operator.gt, operator.ge, operator.lt, operator.le]) def test_nat_comparison_tzawareness(self, op): # GH#19276 # tzaware DatetimeIndex should not raise when compared to NaT dti = pd.DatetimeIndex(['2014-01-01', pd.NaT, '2014-03-01', pd.NaT, '2014-05-01', '2014-07-01']) expected = np.array([op == operator.ne] * len(dti)) result = op(dti, pd.NaT) tm.assert_numpy_array_equal(result, expected) result = op(dti.tz_localize('US/Pacific'), pd.NaT) tm.assert_numpy_array_equal(result, expected) def test_dti_cmp_str(self, tz_naive_fixture): # GH#22074 # regardless of tz, we expect these comparisons are valid tz = tz_naive_fixture rng = date_range('1/1/2000', periods=10, tz=tz) other = '1/1/2000' result = rng == other expected = np.array([True] + [False] * 9) tm.assert_numpy_array_equal(result, expected) result = rng != other expected = np.array([False] + [True] * 9) tm.assert_numpy_array_equal(result, expected) result = rng < other expected = np.array([False] * 10) tm.assert_numpy_array_equal(result, expected) result = rng <= other expected = np.array([True] + [False] * 9) tm.assert_numpy_array_equal(result, expected) result = rng > other expected = np.array([False] + [True] * 9) tm.assert_numpy_array_equal(result, expected) result = rng >= other expected = np.array([True] * 10) tm.assert_numpy_array_equal(result, expected) @pytest.mark.parametrize('other', ['foo', 99, 4.0, object(), timedelta(days=2)]) def test_dti_cmp_scalar_invalid(self, other, tz_naive_fixture): # GH#22074 tz = tz_naive_fixture rng = date_range('1/1/2000', periods=10, tz=tz) result = rng == other expected = np.array([False] * 10) tm.assert_numpy_array_equal(result, expected) result = rng != other expected = np.array([True] * 10) tm.assert_numpy_array_equal(result, expected) with pytest.raises(TypeError): rng < other with pytest.raises(TypeError): rng <= other with pytest.raises(TypeError): rng > other with pytest.raises(TypeError): rng >= other def test_dti_cmp_list(self): rng = date_range('1/1/2000', periods=10) result = rng == list(rng) expected = rng == rng tm.assert_numpy_array_equal(result, expected) @pytest.mark.parametrize('other', [ pd.timedelta_range('1D', periods=10), pd.timedelta_range('1D', periods=10).to_series(), pd.timedelta_range('1D', periods=10).asi8.view('m8[ns]') ], ids=lambda x: type(x).__name__) def test_dti_cmp_tdi_tzawareness(self, other): # GH#22074 # reversion test that we _don't_ call _assert_tzawareness_compat # when comparing against TimedeltaIndex dti = date_range('2000-01-01', periods=10, tz='Asia/Tokyo') result = dti == other expected = np.array([False] * 10) tm.assert_numpy_array_equal(result, expected) result = dti != other expected = np.array([True] * 10) tm.assert_numpy_array_equal(result, expected) with pytest.raises(TypeError): dti < other with pytest.raises(TypeError): dti <= other with pytest.raises(TypeError): dti > other with pytest.raises(TypeError): dti >= other def test_dti_cmp_object_dtype(self): # GH#22074 dti = date_range('2000-01-01', periods=10, tz='Asia/Tokyo') other = dti.astype('O') result = dti == other expected = np.array([True] * 10) tm.assert_numpy_array_equal(result, expected) other = dti.tz_localize(None) with pytest.raises(TypeError): # tzawareness failure dti != other other = np.array(list(dti[:5]) + [Timedelta(days=1)] * 5) result = dti == other expected = np.array([True] * 5 + [False] * 5) tm.assert_numpy_array_equal(result, expected) with pytest.raises(TypeError): dti >= other # ------------------------------------------------------------------ # Arithmetic class TestFrameArithmetic(object): def test_dt64arr_sub_dtscalar(self, box): # GH#8554, GH#22163 DataFrame op should _not_ return dt64 dtype idx = pd.date_range('2013-01-01', periods=3) idx = tm.box_expected(idx, box) ts = pd.Timestamp('2013-01-01') # TODO: parametrize over scalar types expected = pd.TimedeltaIndex(['0 Days', '1 Day', '2 Days']) expected = tm.box_expected(expected, box) result = idx - ts tm.assert_equal(result, expected) def test_df_sub_datetime64_not_ns(self): # GH#7996, GH#22163 ensure non-nano datetime64 is converted to nano df = pd.DataFrame(pd.date_range('20130101', periods=3)) dt64 = np.datetime64('2013-01-01') assert dt64.dtype == 'datetime64[D]' res = df - dt64 expected = pd.DataFrame([pd.Timedelta(days=0), pd.Timedelta(days=1), pd.Timedelta(days=2)]) tm.assert_frame_equal(res, expected) class TestTimestampSeriesArithmetic(object): def test_timestamp_sub_series(self): ser = pd.Series(pd.date_range('2014-03-17', periods=2, freq='D', tz='US/Eastern')) ts = ser[0] delta_series = pd.Series([np.timedelta64(0, 'D'), np.timedelta64(1, 'D')]) tm.assert_series_equal(ser - ts, delta_series) tm.assert_series_equal(ts - ser, -delta_series) def test_dt64ser_sub_datetime_dtype(self): ts = Timestamp(datetime(1993, 1, 7, 13, 30, 00)) dt = datetime(1993, 6, 22, 13, 30) ser = Series([ts]) result = pd.to_timedelta(np.abs(ser - dt)) assert result.dtype == 'timedelta64[ns]' # ------------------------------------------------------------- # TODO: This next block of tests came from tests.series.test_operators, # needs to be de-duplicated and parametrized over `box` classes @pytest.mark.parametrize('klass', [Series, pd.Index]) def test_sub_datetime64_not_ns(self, klass): # GH#7996 dt64 = np.datetime64('2013-01-01') assert dt64.dtype == 'datetime64[D]' obj = klass(date_range('20130101', periods=3)) res = obj - dt64 expected = klass([Timedelta(days=0), Timedelta(days=1), Timedelta(days=2)]) tm.assert_equal(res, expected) res = dt64 - obj tm.assert_equal(res, -expected) def test_sub_single_tz(self): # GH12290 s1 = Series([pd.Timestamp('2016-02-10', tz='America/Sao_Paulo')]) s2 = Series([pd.Timestamp('2016-02-08', tz='America/Sao_Paulo')]) result = s1 - s2 expected = Series([Timedelta('2days')]) tm.assert_series_equal(result, expected) result = s2 - s1 expected = Series([Timedelta('-2days')]) tm.assert_series_equal(result, expected) def test_dt64tz_series_sub_dtitz(self): # GH#19071 subtracting tzaware DatetimeIndex from tzaware Series # (with same tz) raises, fixed by #19024 dti = pd.date_range('1999-09-30', periods=10, tz='US/Pacific') ser = pd.Series(dti) expected = pd.Series(pd.TimedeltaIndex(['0days'] * 10)) res = dti - ser tm.assert_series_equal(res, expected) res = ser - dti tm.assert_series_equal(res, expected) def test_sub_datetime_compat(self): # see gh-14088 s = Series([datetime(2016, 8, 23, 12, tzinfo=pytz.utc), pd.NaT]) dt = datetime(2016, 8, 22, 12, tzinfo=pytz.utc) exp = Series([Timedelta('1 days'), pd.NaT]) tm.assert_series_equal(s - dt, exp) tm.assert_series_equal(s - Timestamp(dt), exp) def test_dt64_series_addsub_timedelta(self): # scalar timedeltas/np.timedelta64 objects # operate with np.timedelta64 correctly s = Series([Timestamp('20130101 9:01'), Timestamp('20130101 9:02')]) result = s + np.timedelta64(1, 's') result2 = np.timedelta64(1, 's') + s expected = Series([Timestamp('20130101 9:01:01'), Timestamp('20130101 9:02:01')]) tm.assert_series_equal(result, expected) tm.assert_series_equal(result2, expected) result = s + np.timedelta64(5, 'ms') result2 = np.timedelta64(5, 'ms') + s expected = Series([Timestamp('20130101 9:01:00.005'), Timestamp('20130101 9:02:00.005')]) tm.assert_series_equal(result, expected) tm.assert_series_equal(result2, expected) def test_dt64_series_add_tick_DateOffset(self): # GH 4532 # operate with pd.offsets ser = Series([Timestamp('20130101 9:01'), Timestamp('20130101 9:02')]) expected = Series([Timestamp('20130101 9:01:05'), Timestamp('20130101 9:02:05')]) result = ser + pd.offsets.Second(5) tm.assert_series_equal(result, expected) result2 = pd.offsets.Second(5) + ser tm.assert_series_equal(result2, expected) def test_dt64_series_sub_tick_DateOffset(self): # GH 4532 # operate with pd.offsets ser = Series([Timestamp('20130101 9:01'), Timestamp('20130101 9:02')]) expected = Series([Timestamp('20130101 9:00:55'), Timestamp('20130101 9:01:55')]) result = ser - pd.offsets.Second(5) tm.assert_series_equal(result, expected) result2 = -pd.offsets.Second(5) + ser tm.assert_series_equal(result2, expected) with pytest.raises(TypeError): pd.offsets.Second(5) - ser @pytest.mark.parametrize('cls_name', ['Day', 'Hour', 'Minute', 'Second', 'Milli', 'Micro', 'Nano']) def test_dt64_series_add_tick_DateOffset_smoke(self, cls_name): # GH 4532 # smoke tests for valid DateOffsets ser = Series([Timestamp('20130101 9:01'), Timestamp('20130101 9:02')]) offset_cls = getattr(pd.offsets, cls_name) ser + offset_cls(5) offset_cls(5) + ser def test_dt64_series_add_mixed_tick_DateOffset(self): # GH 4532 # operate with pd.offsets s = Series([Timestamp('20130101 9:01'), Timestamp('20130101 9:02')]) result = s + pd.offsets.Milli(5) result2 = pd.offsets.Milli(5) + s expected = Series([Timestamp('20130101 9:01:00.005'), Timestamp('20130101 9:02:00.005')]) tm.assert_series_equal(result, expected) tm.assert_series_equal(result2, expected) result = s + pd.offsets.Minute(5) + pd.offsets.Milli(5) expected = Series([Timestamp('20130101 9:06:00.005'), Timestamp('20130101 9:07:00.005')]) tm.assert_series_equal(result, expected) def test_dt64_series_sub_NaT(self): # GH#18808 dti = pd.DatetimeIndex([pd.NaT, pd.Timestamp('19900315')]) ser = pd.Series(dti) res = ser - pd.NaT expected = pd.Series([pd.NaT, pd.NaT], dtype='timedelta64[ns]') tm.assert_series_equal(res, expected) dti_tz = dti.tz_localize('Asia/Tokyo') ser_tz = pd.Series(dti_tz) res = ser_tz - pd.NaT expected = pd.Series([pd.NaT, pd.NaT], dtype='timedelta64[ns]') tm.assert_series_equal(res, expected) def test_dt64_series_arith_overflow(self): # GH#12534, fixed by #19024 dt = pd.Timestamp('1700-01-31') td = pd.Timedelta('20000 Days') dti = pd.date_range('1949-09-30', freq='100Y', periods=4) ser = pd.Series(dti) with pytest.raises(OverflowError): ser - dt with pytest.raises(OverflowError): dt - ser with pytest.raises(OverflowError): ser + td with pytest.raises(OverflowError): td + ser ser.iloc[-1] = pd.NaT expected = pd.Series(['2004-10-03', '2104-10-04', '2204-10-04', 'NaT'], dtype='datetime64[ns]') res = ser + td tm.assert_series_equal(res, expected) res = td + ser tm.assert_series_equal(res, expected) ser.iloc[1:] = pd.NaT expected = pd.Series(['91279 Days', 'NaT', 'NaT', 'NaT'], dtype='timedelta64[ns]') res = ser - dt tm.assert_series_equal(res, expected) res = dt - ser tm.assert_series_equal(res, -expected) def test_datetime64_ops_nat(self): # GH 11349 datetime_series = Series([NaT, Timestamp('19900315')]) nat_series_dtype_timestamp = Series([NaT, NaT], dtype='datetime64[ns]') single_nat_dtype_datetime = Series([NaT], dtype='datetime64[ns]') # subtraction tm.assert_series_equal(-NaT + datetime_series, nat_series_dtype_timestamp) with pytest.raises(TypeError): -single_nat_dtype_datetime + datetime_series tm.assert_series_equal(-NaT + nat_series_dtype_timestamp, nat_series_dtype_timestamp) with pytest.raises(TypeError): -single_nat_dtype_datetime + nat_series_dtype_timestamp # addition tm.assert_series_equal(nat_series_dtype_timestamp + NaT, nat_series_dtype_timestamp) tm.assert_series_equal(NaT + nat_series_dtype_timestamp, nat_series_dtype_timestamp) tm.assert_series_equal(nat_series_dtype_timestamp + NaT, nat_series_dtype_timestamp) tm.assert_series_equal(NaT + nat_series_dtype_timestamp, nat_series_dtype_timestamp) # ------------------------------------------------------------- # Invalid Operations # TODO: this block also needs to be de-duplicated and parametrized @pytest.mark.parametrize('dt64_series', [ Series([Timestamp('19900315'), Timestamp('19900315')]), Series([pd.NaT, Timestamp('19900315')]), Series([pd.NaT, pd.NaT], dtype='datetime64[ns]')]) @pytest.mark.parametrize('one', [1, 1.0, np.array(1)]) def test_dt64_mul_div_numeric_invalid(self, one, dt64_series): # multiplication with pytest.raises(TypeError): dt64_series * one with pytest.raises(TypeError): one * dt64_series # division with pytest.raises(TypeError): dt64_series / one with pytest.raises(TypeError): one / dt64_series @pytest.mark.parametrize('op', ['__add__', '__radd__', '__sub__', '__rsub__']) @pytest.mark.parametrize('tz', [None, 'Asia/Tokyo']) def test_dt64_series_add_intlike(self, tz, op): # GH#19123 dti = pd.DatetimeIndex(['2016-01-02', '2016-02-03', 'NaT'], tz=tz) ser = Series(dti) other = Series([20, 30, 40], dtype='uint8') pytest.raises(TypeError, getattr(ser, op), 1) pytest.raises(TypeError, getattr(ser, op), other) pytest.raises(TypeError, getattr(ser, op), other.values) pytest.raises(TypeError, getattr(ser, op), pd.Index(other)) # ------------------------------------------------------------- # Timezone-Centric Tests def test_operators_datetimelike_with_timezones(self): tz = 'US/Eastern' dt1 = Series(date_range('2000-01-01 09:00:00', periods=5, tz=tz), name='foo') dt2 = dt1.copy() dt2.iloc[2] = np.nan td1 = Series(pd.timedelta_range('1 days 1 min', periods=5, freq='H')) td2 = td1.copy() td2.iloc[1] = np.nan result = dt1 + td1[0] exp = (dt1.dt.tz_localize(None) + td1[0]).dt.tz_localize(tz) tm.assert_series_equal(result, exp) result = dt2 + td2[0] exp = (dt2.dt.tz_localize(None) + td2[0]).dt.tz_localize(tz) tm.assert_series_equal(result, exp) # odd numpy behavior with scalar timedeltas result = td1[0] + dt1 exp = (dt1.dt.tz_localize(None) + td1[0]).dt.tz_localize(tz) tm.assert_series_equal(result, exp) result = td2[0] + dt2 exp = (dt2.dt.tz_localize(None) + td2[0]).dt.tz_localize(tz) tm.assert_series_equal(result, exp) result = dt1 - td1[0] exp = (dt1.dt.tz_localize(None) - td1[0]).dt.tz_localize(tz) tm.assert_series_equal(result, exp) with pytest.raises(TypeError): td1[0] - dt1 result = dt2 - td2[0] exp = (dt2.dt.tz_localize(None) - td2[0]).dt.tz_localize(tz) tm.assert_series_equal(result, exp) with pytest.raises(TypeError): td2[0] - dt2 result = dt1 + td1 exp = (dt1.dt.tz_localize(None) + td1).dt.tz_localize(tz) tm.assert_series_equal(result, exp) result = dt2 + td2 exp = (dt2.dt.tz_localize(None) + td2).dt.tz_localize(tz) tm.assert_series_equal(result, exp) result = dt1 - td1 exp = (dt1.dt.tz_localize(None) - td1).dt.tz_localize(tz) tm.assert_series_equal(result, exp) result = dt2 - td2 exp = (dt2.dt.tz_localize(None) - td2).dt.tz_localize(tz) tm.assert_series_equal(result, exp) with pytest.raises(TypeError): td1 - dt1 with pytest.raises(TypeError): td2 - dt2 class TestDatetimeIndexArithmetic(object): # ------------------------------------------------------------- # Invalid Operations @pytest.mark.parametrize('other', [3.14, np.array([2.0, 3.0])]) @pytest.mark.parametrize('op', [operator.add, ops.radd, operator.sub, ops.rsub]) def test_dti_add_sub_float(self, op, other): dti = DatetimeIndex(['2011-01-01', '2011-01-02'], freq='D') with pytest.raises(TypeError): op(dti, other) def test_dti_add_timestamp_raises(self, box): # GH#22163 ensure DataFrame doesn't cast Timestamp to i8 idx = DatetimeIndex(['2011-01-01', '2011-01-02']) idx = tm.box_expected(idx, box) msg = "cannot add" with tm.assert_raises_regex(TypeError, msg): idx + Timestamp('2011-01-01') def test_dti_radd_timestamp_raises(self): idx = DatetimeIndex(['2011-01-01', '2011-01-02']) msg = "cannot add DatetimeIndex and Timestamp" with tm.assert_raises_regex(TypeError, msg): Timestamp('2011-01-01') + idx # ------------------------------------------------------------- # Binary operations DatetimeIndex and int def test_dti_add_int(self, tz_naive_fixture, one): # Variants of `one` for #19012 tz = tz_naive_fixture rng = pd.date_range('2000-01-01 09:00', freq='H', periods=10, tz=tz) result = rng + one expected = pd.date_range('2000-01-01 10:00', freq='H', periods=10, tz=tz) tm.assert_index_equal(result, expected) def test_dti_iadd_int(self, tz_naive_fixture, one): tz = tz_naive_fixture rng = pd.date_range('2000-01-01 09:00', freq='H', periods=10, tz=tz) expected = pd.date_range('2000-01-01 10:00', freq='H', periods=10, tz=tz) rng += one tm.assert_index_equal(rng, expected) def test_dti_sub_int(self, tz_naive_fixture, one): tz = tz_naive_fixture rng = pd.date_range('2000-01-01 09:00', freq='H', periods=10, tz=tz) result = rng - one expected = pd.date_range('2000-01-01 08:00', freq='H', periods=10, tz=tz) tm.assert_index_equal(result, expected) def test_dti_isub_int(self, tz_naive_fixture, one): tz = tz_naive_fixture rng = pd.date_range('2000-01-01 09:00', freq='H', periods=10, tz=tz) expected = pd.date_range('2000-01-01 08:00', freq='H', periods=10, tz=tz) rng -= one tm.assert_index_equal(rng, expected) # ------------------------------------------------------------- # __add__/__sub__ with integer arrays @pytest.mark.parametrize('freq', ['H', 'D']) @pytest.mark.parametrize('box', [np.array, pd.Index]) def test_dti_add_intarray_tick(self, box, freq): # GH#19959 dti = pd.date_range('2016-01-01', periods=2, freq=freq) other = box([4, -1]) expected = DatetimeIndex([dti[n] + other[n] for n in range(len(dti))]) result = dti + other tm.assert_index_equal(result, expected) result = other + dti tm.assert_index_equal(result, expected) @pytest.mark.parametrize('freq', ['W', 'M', 'MS', 'Q']) @pytest.mark.parametrize('box', [np.array, pd.Index]) def test_dti_add_intarray_non_tick(self, box, freq): # GH#19959 dti = pd.date_range('2016-01-01', periods=2, freq=freq) other = box([4, -1]) expected = DatetimeIndex([dti[n] + other[n] for n in range(len(dti))]) with tm.assert_produces_warning(PerformanceWarning): result = dti + other tm.assert_index_equal(result, expected) with tm.assert_produces_warning(PerformanceWarning): result = other + dti tm.assert_index_equal(result, expected) @pytest.mark.parametrize('box', [np.array, pd.Index]) def test_dti_add_intarray_no_freq(self, box): # GH#19959 dti = pd.DatetimeIndex(['2016-01-01', 'NaT', '2017-04-05 06:07:08']) other = box([9, 4, -1]) with pytest.raises(NullFrequencyError): dti + other with pytest.raises(NullFrequencyError): other + dti with pytest.raises(NullFrequencyError): dti - other with pytest.raises(TypeError): other - dti # ------------------------------------------------------------- # Binary operations DatetimeIndex and timedelta-like def test_dti_add_timedeltalike(self, tz_naive_fixture, two_hours, box): # GH#22005, GH#22163 check DataFrame doesn't raise TypeError tz = tz_naive_fixture rng = pd.date_range('2000-01-01', '2000-02-01', tz=tz) rng = tm.box_expected(rng, box) result = rng + two_hours expected = pd.date_range('2000-01-01 02:00', '2000-02-01 02:00', tz=tz) expected = tm.box_expected(expected, box) tm.assert_equal(result, expected) def test_dti_iadd_timedeltalike(self, tz_naive_fixture, two_hours): tz = tz_naive_fixture rng = pd.date_range('2000-01-01', '2000-02-01', tz=tz) expected = pd.date_range('2000-01-01 02:00', '2000-02-01 02:00', tz=tz) rng += two_hours tm.assert_index_equal(rng, expected) def test_dti_sub_timedeltalike(self, tz_naive_fixture, two_hours): tz = tz_naive_fixture rng = pd.date_range('2000-01-01', '2000-02-01', tz=tz) expected = pd.date_range('1999-12-31 22:00', '2000-01-31 22:00', tz=tz) result = rng - two_hours tm.assert_index_equal(result, expected) def test_dti_isub_timedeltalike(self, tz_naive_fixture, two_hours): tz = tz_naive_fixture rng = pd.date_range('2000-01-01', '2000-02-01', tz=tz) expected = pd.date_range('1999-12-31 22:00', '2000-01-31 22:00', tz=tz) rng -= two_hours tm.assert_index_equal(rng, expected) # ------------------------------------------------------------- # Binary operations DatetimeIndex and TimedeltaIndex/array def test_dti_add_tdi(self, tz_naive_fixture): # GH#17558 tz = tz_naive_fixture dti = DatetimeIndex([Timestamp('2017-01-01', tz=tz)] * 10) tdi = pd.timedelta_range('0 days', periods=10) expected = pd.date_range('2017-01-01', periods=10, tz=tz) # add with TimdeltaIndex result = dti + tdi tm.assert_index_equal(result, expected) result = tdi + dti tm.assert_index_equal(result, expected) # add with timedelta64 array result = dti + tdi.values tm.assert_index_equal(result, expected) result = tdi.values + dti tm.assert_index_equal(result, expected) def test_dti_iadd_tdi(self, tz_naive_fixture): # GH#17558 tz = tz_naive_fixture dti = DatetimeIndex([Timestamp('2017-01-01', tz=tz)] * 10) tdi = pd.timedelta_range('0 days', periods=10) expected = pd.date_range('2017-01-01', periods=10, tz=tz) # iadd with TimdeltaIndex result = DatetimeIndex([Timestamp('2017-01-01', tz=tz)] * 10) result += tdi tm.assert_index_equal(result, expected) result = pd.timedelta_range('0 days', periods=10) result += dti tm.assert_index_equal(result, expected) # iadd with timedelta64 array result = DatetimeIndex([Timestamp('2017-01-01', tz=tz)] * 10) result += tdi.values tm.assert_index_equal(result, expected) result = pd.timedelta_range('0 days', periods=10) result += dti tm.assert_index_equal(result, expected) def test_dti_sub_tdi(self, tz_naive_fixture): # GH#17558 tz = tz_naive_fixture dti = DatetimeIndex([Timestamp('2017-01-01', tz=tz)] * 10) tdi = pd.timedelta_range('0 days', periods=10) expected = pd.date_range('2017-01-01', periods=10, tz=tz, freq='-1D') # sub with TimedeltaIndex result = dti - tdi tm.assert_index_equal(result, expected) msg = 'cannot subtract .*TimedeltaIndex' with tm.assert_raises_regex(TypeError, msg): tdi - dti # sub with timedelta64 array result = dti - tdi.values tm.assert_index_equal(result, expected) msg = 'cannot subtract DatetimeIndex from' with tm.assert_raises_regex(TypeError, msg): tdi.values - dti def test_dti_isub_tdi(self, tz_naive_fixture): # GH#17558 tz = tz_naive_fixture dti = DatetimeIndex([Timestamp('2017-01-01', tz=tz)] * 10) tdi = pd.timedelta_range('0 days', periods=10) expected = pd.date_range('2017-01-01', periods=10, tz=tz, freq='-1D') # isub with TimedeltaIndex result = DatetimeIndex([Timestamp('2017-01-01', tz=tz)] * 10) result -= tdi tm.assert_index_equal(result, expected) msg = 'cannot subtract .*TimedeltaIndex' with tm.assert_raises_regex(TypeError, msg): tdi -= dti # isub with timedelta64 array result = DatetimeIndex([Timestamp('2017-01-01', tz=tz)] * 10) result -= tdi.values tm.assert_index_equal(result, expected) msg = '|'.join(['cannot perform __neg__ with this index type:', 'ufunc subtract cannot use operands with types', 'cannot subtract DatetimeIndex from']) with tm.assert_raises_regex(TypeError, msg): tdi.values -= dti # ------------------------------------------------------------- # Binary Operations DatetimeIndex and datetime-like # TODO: A couple other tests belong in this section. Move them in # A PR where there isn't already a giant diff. @pytest.mark.parametrize('addend', [ datetime(2011, 1, 1), DatetimeIndex(['2011-01-01', '2011-01-02']), DatetimeIndex(['2011-01-01', '2011-01-02']).tz_localize('US/Eastern'), np.datetime64('2011-01-01'), Timestamp('2011-01-01') ], ids=lambda x: type(x).__name__) @pytest.mark.parametrize('tz', [None, 'US/Eastern']) def test_add_datetimelike_and_dti(self, addend, tz): # GH#9631 dti = DatetimeIndex(['2011-01-01', '2011-01-02']).tz_localize(tz) msg = 'cannot add DatetimeIndex and {0}'.format(type(addend).__name__) with tm.assert_raises_regex(TypeError, msg): dti + addend with tm.assert_raises_regex(TypeError, msg): addend + dti # ------------------------------------------------------------- # __add__/__sub__ with ndarray[datetime64] and ndarray[timedelta64] def test_dti_add_dt64_array_raises(self, tz_naive_fixture): tz = tz_naive_fixture dti = pd.date_range('2016-01-01', periods=3, tz=tz) dtarr = dti.values with pytest.raises(TypeError): dti + dtarr with pytest.raises(TypeError): dtarr + dti def test_dti_sub_dt64_array_naive(self): dti = pd.date_range('2016-01-01', periods=3, tz=None) dtarr = dti.values expected = dti - dti result = dti - dtarr tm.assert_index_equal(result, expected) result = dtarr - dti tm.assert_index_equal(result, expected) def test_dti_sub_dt64_array_aware_raises(self, tz_naive_fixture): tz = tz_naive_fixture if tz is None: return dti = pd.date_range('2016-01-01', periods=3, tz=tz) dtarr = dti.values with pytest.raises(TypeError): dti - dtarr with pytest.raises(TypeError): dtarr - dti def test_dti_add_td64_array(self, tz_naive_fixture): tz = tz_naive_fixture dti = pd.date_range('2016-01-01', periods=3, tz=tz) tdi = pd.TimedeltaIndex(['-1 Day', '-1 Day', '-1 Day']) tdarr = tdi.values expected = dti + tdi result = dti + tdarr tm.assert_index_equal(result, expected) result = tdarr + dti tm.assert_index_equal(result, expected) def test_dti_sub_td64_array(self, tz_naive_fixture): tz = tz_naive_fixture dti = pd.date_range('2016-01-01', periods=3, tz=tz) tdi = pd.TimedeltaIndex(['-1 Day', '-1 Day', '-1 Day']) tdarr = tdi.values expected = dti - tdi result = dti - tdarr tm.assert_index_equal(result, expected) with pytest.raises(TypeError): tdarr - dti # ------------------------------------------------------------- def test_sub_dti_dti(self): # previously performed setop (deprecated in 0.16.0), now changed to # return subtraction -> TimeDeltaIndex (GH ...) dti = date_range('20130101', periods=3) dti_tz = date_range('20130101', periods=3).tz_localize('US/Eastern') dti_tz2 = date_range('20130101', periods=3).tz_localize('UTC') expected = TimedeltaIndex([0, 0, 0]) result = dti - dti tm.assert_index_equal(result, expected) result = dti_tz - dti_tz tm.assert_index_equal(result, expected) with pytest.raises(TypeError): dti_tz - dti with pytest.raises(TypeError): dti - dti_tz with pytest.raises(TypeError): dti_tz - dti_tz2 # isub dti -= dti tm.assert_index_equal(dti, expected) # different length raises ValueError dti1 = date_range('20130101', periods=3) dti2 = date_range('20130101', periods=4) with pytest.raises(ValueError): dti1 - dti2 # NaN propagation dti1 = DatetimeIndex(['2012-01-01', np.nan, '2012-01-03']) dti2 = DatetimeIndex(['2012-01-02', '2012-01-03', np.nan]) expected = TimedeltaIndex(['1 days', np.nan, np.nan]) result = dti2 - dti1 tm.assert_index_equal(result, expected) @pytest.mark.parametrize('freq', [None, 'D']) def test_sub_period(self, freq, box): # GH#13078 # not supported, check TypeError p = pd.Period('2011-01-01', freq='D') idx = pd.DatetimeIndex(['2011-01-01', '2011-01-02'], freq=freq) idx = tm.box_expected(idx, box) with pytest.raises(TypeError): idx - p with pytest.raises(TypeError): p - idx @pytest.mark.parametrize('op', [operator.add, ops.radd, operator.sub, ops.rsub]) @pytest.mark.parametrize('pi_freq', ['D', 'W', 'Q', 'H']) @pytest.mark.parametrize('dti_freq', [None, 'D']) def test_dti_sub_pi(self, dti_freq, pi_freq, op, box_df_broadcast_failure): # GH#20049 subtracting PeriodIndex should raise TypeError box = box_df_broadcast_failure dti = pd.DatetimeIndex(['2011-01-01', '2011-01-02'], freq=dti_freq) pi = dti.to_period(pi_freq) dti = tm.box_expected(dti, box) # TODO: Also box pi? with pytest.raises(TypeError): op(dti, pi) # ------------------------------------------------------------------- # TODO: Most of this block is moved from series or frame tests, needs # cleanup, box-parametrization, and de-duplication @pytest.mark.parametrize('op', [operator.add, operator.sub]) def test_timedelta64_equal_timedelta_supported_ops(self, op): ser = Series([Timestamp('20130301'), Timestamp('20130228 23:00:00'), Timestamp('20130228 22:00:00'), Timestamp('20130228 21:00:00')]) intervals = ['D', 'h', 'm', 's', 'us'] # TODO: unused # npy16_mappings = {'D': 24 * 60 * 60 * 1000000, # 'h': 60 * 60 * 1000000, # 'm': 60 * 1000000, # 's': 1000000, # 'us': 1} def timedelta64(*args): return sum(starmap(np.timedelta64, zip(args, intervals))) for d, h, m, s, us in product(*([range(2)] * 5)): nptd = timedelta64(d, h, m, s, us) pytd = timedelta(days=d, hours=h, minutes=m, seconds=s, microseconds=us) lhs = op(ser, nptd) rhs = op(ser, pytd) tm.assert_series_equal(lhs, rhs) def test_ops_nat_mixed_datetime64_timedelta64(self): # GH#11349 timedelta_series = Series([NaT, Timedelta('1s')]) datetime_series = Series([NaT, Timestamp('19900315')]) nat_series_dtype_timedelta = Series([NaT, NaT], dtype='timedelta64[ns]') nat_series_dtype_timestamp = Series([NaT, NaT], dtype='datetime64[ns]') single_nat_dtype_datetime = Series([NaT], dtype='datetime64[ns]') single_nat_dtype_timedelta = Series([NaT], dtype='timedelta64[ns]') # subtraction tm.assert_series_equal(datetime_series - single_nat_dtype_datetime, nat_series_dtype_timedelta) tm.assert_series_equal(datetime_series - single_nat_dtype_timedelta, nat_series_dtype_timestamp) tm.assert_series_equal(-single_nat_dtype_timedelta + datetime_series, nat_series_dtype_timestamp) # without a Series wrapping the NaT, it is ambiguous # whether it is a datetime64 or timedelta64 # defaults to interpreting it as timedelta64 tm.assert_series_equal(nat_series_dtype_timestamp - single_nat_dtype_datetime, nat_series_dtype_timedelta) tm.assert_series_equal(nat_series_dtype_timestamp - single_nat_dtype_timedelta, nat_series_dtype_timestamp) tm.assert_series_equal(-single_nat_dtype_timedelta + nat_series_dtype_timestamp, nat_series_dtype_timestamp) with pytest.raises(TypeError): timedelta_series - single_nat_dtype_datetime # addition tm.assert_series_equal(nat_series_dtype_timestamp + single_nat_dtype_timedelta, nat_series_dtype_timestamp) tm.assert_series_equal(single_nat_dtype_timedelta + nat_series_dtype_timestamp, nat_series_dtype_timestamp) tm.assert_series_equal(nat_series_dtype_timestamp + single_nat_dtype_timedelta, nat_series_dtype_timestamp) tm.assert_series_equal(single_nat_dtype_timedelta + nat_series_dtype_timestamp, nat_series_dtype_timestamp) tm.assert_series_equal(nat_series_dtype_timedelta + single_nat_dtype_datetime, nat_series_dtype_timestamp) tm.assert_series_equal(single_nat_dtype_datetime + nat_series_dtype_timedelta, nat_series_dtype_timestamp) def test_ufunc_coercions(self): idx = date_range('2011-01-01', periods=3, freq='2D', name='x') delta = np.timedelta64(1, 'D') for result in [idx + delta, np.add(idx, delta)]: assert isinstance(result, DatetimeIndex) exp = date_range('2011-01-02', periods=3, freq='2D', name='x') tm.assert_index_equal(result, exp) assert result.freq == '2D' for result in [idx - delta, np.subtract(idx, delta)]: assert isinstance(result, DatetimeIndex) exp = date_range('2010-12-31', periods=3, freq='2D', name='x') tm.assert_index_equal(result, exp) assert result.freq == '2D' delta = np.array([np.timedelta64(1, 'D'), np.timedelta64(2, 'D'), np.timedelta64(3, 'D')]) for result in [idx + delta, np.add(idx, delta)]: assert isinstance(result, DatetimeIndex) exp = DatetimeIndex(['2011-01-02', '2011-01-05', '2011-01-08'], freq='3D', name='x') tm.assert_index_equal(result, exp) assert result.freq == '3D' for result in [idx - delta, np.subtract(idx, delta)]: assert isinstance(result, DatetimeIndex) exp = DatetimeIndex(['2010-12-31', '2011-01-01', '2011-01-02'], freq='D', name='x') tm.assert_index_equal(result, exp) assert result.freq == 'D' def test_datetimeindex_sub_timestamp_overflow(self): dtimax = pd.to_datetime(['now', pd.Timestamp.max]) dtimin = pd.to_datetime(['now', pd.Timestamp.min]) tsneg = Timestamp('1950-01-01') ts_neg_variants = [tsneg, tsneg.to_pydatetime(), tsneg.to_datetime64().astype('datetime64[ns]'), tsneg.to_datetime64().astype('datetime64[D]')] tspos = Timestamp('1980-01-01') ts_pos_variants = [tspos, tspos.to_pydatetime(), tspos.to_datetime64().astype('datetime64[ns]'), tspos.to_datetime64().astype('datetime64[D]')] for variant in ts_neg_variants: with pytest.raises(OverflowError): dtimax - variant expected = pd.Timestamp.max.value - tspos.value for variant in ts_pos_variants: res = dtimax - variant assert res[1].value == expected expected = pd.Timestamp.min.value - tsneg.value for variant in ts_neg_variants: res = dtimin - variant assert res[1].value == expected for variant in ts_pos_variants: with pytest.raises(OverflowError): dtimin - variant def test_datetimeindex_sub_datetimeindex_overflow(self): # GH#22492, GH#22508 dtimax = pd.to_datetime(['now', pd.Timestamp.max]) dtimin = pd.to_datetime(['now', pd.Timestamp.min]) ts_neg = pd.to_datetime(['1950-01-01', '1950-01-01']) ts_pos = pd.to_datetime(['1980-01-01', '1980-01-01']) # General tests expected = pd.Timestamp.max.value - ts_pos[1].value result = dtimax - ts_pos assert result[1].value == expected expected = pd.Timestamp.min.value - ts_neg[1].value result = dtimin - ts_neg assert result[1].value == expected with pytest.raises(OverflowError): dtimax - ts_neg with pytest.raises(OverflowError): dtimin - ts_pos # Edge cases tmin = pd.to_datetime([pd.Timestamp.min]) t1 = tmin + pd.Timedelta.max + pd.Timedelta('1us') with pytest.raises(OverflowError): t1 - tmin tmax = pd.to_datetime([pd.Timestamp.max]) t2 = tmax + pd.Timedelta.min - pd.Timedelta('1us') with pytest.raises(OverflowError): tmax - t2 @pytest.mark.parametrize('names', [('foo', None, None), ('baz', 'bar', None), ('bar', 'bar', 'bar')]) @pytest.mark.parametrize('tz', [None, 'America/Chicago']) def test_dti_add_series(self, tz, names): # GH#13905 index = DatetimeIndex(['2016-06-28 05:30', '2016-06-28 05:31'], tz=tz, name=names[0]) ser = Series([Timedelta(seconds=5)] * 2, index=index, name=names[1]) expected = Series(index + Timedelta(seconds=5), index=index, name=names[2]) # passing name arg isn't enough when names[2] is None expected.name = names[2] assert expected.dtype == index.dtype result = ser + index tm.assert_series_equal(result, expected) result2 = index + ser tm.assert_series_equal(result2, expected) expected = index + Timedelta(seconds=5) result3 = ser.values + index tm.assert_index_equal(result3, expected) result4 = index + ser.values tm.assert_index_equal(result4, expected) def test_dti_add_offset_array(self, tz_naive_fixture): # GH#18849 tz = tz_naive_fixture dti = pd.date_range('2017-01-01', periods=2, tz=tz) other = np.array([pd.offsets.MonthEnd(), pd.offsets.Day(n=2)]) with tm.assert_produces_warning(PerformanceWarning): res = dti + other expected = DatetimeIndex([dti[n] + other[n] for n in range(len(dti))], name=dti.name, freq='infer') tm.assert_index_equal(res, expected) with tm.assert_produces_warning(PerformanceWarning): res2 = other + dti tm.assert_index_equal(res2, expected) @pytest.mark.parametrize('names', [(None, None, None), ('foo', 'bar', None), ('foo', 'foo', 'foo')]) def test_dti_add_offset_index(self, tz_naive_fixture, names): # GH#18849, GH#19744 tz = tz_naive_fixture dti = pd.date_range('2017-01-01', periods=2, tz=tz, name=names[0]) other = pd.Index([pd.offsets.MonthEnd(), pd.offsets.Day(n=2)], name=names[1]) with tm.assert_produces_warning(PerformanceWarning): res = dti + other expected = DatetimeIndex([dti[n] + other[n] for n in range(len(dti))], name=names[2], freq='infer') tm.assert_index_equal(res, expected) with tm.assert_produces_warning(PerformanceWarning): res2 = other + dti tm.assert_index_equal(res2, expected) def test_dti_sub_offset_array(self, tz_naive_fixture): # GH#18824 tz = tz_naive_fixture dti = pd.date_range('2017-01-01', periods=2, tz=tz) other = np.array([pd.offsets.MonthEnd(), pd.offsets.Day(n=2)]) with tm.assert_produces_warning(PerformanceWarning): res = dti - other expected = DatetimeIndex([dti[n] - other[n] for n in range(len(dti))], name=dti.name, freq='infer') tm.assert_index_equal(res, expected) @pytest.mark.parametrize('names', [(None, None, None), ('foo', 'bar', None), ('foo', 'foo', 'foo')]) def test_dti_sub_offset_index(self, tz_naive_fixture, names): # GH#18824, GH#19744 tz = tz_naive_fixture dti = pd.date_range('2017-01-01', periods=2, tz=tz, name=names[0]) other = pd.Index([pd.offsets.MonthEnd(), pd.offsets.Day(n=2)], name=names[1]) with tm.assert_produces_warning(PerformanceWarning): res = dti - other expected = DatetimeIndex([dti[n] - other[n] for n in range(len(dti))], name=names[2], freq='infer') tm.assert_index_equal(res, expected) @pytest.mark.parametrize('names', [(None, None, None), ('foo', 'bar', None), ('foo', 'foo', 'foo')]) def test_dti_with_offset_series(self, tz_naive_fixture, names): # GH#18849 tz = tz_naive_fixture dti = pd.date_range('2017-01-01', periods=2, tz=tz, name=names[0]) other = Series([pd.offsets.MonthEnd(), pd.offsets.Day(n=2)], name=names[1]) expected_add = Series([dti[n] + other[n] for n in range(len(dti))], name=names[2]) with tm.assert_produces_warning(PerformanceWarning): res = dti + other tm.assert_series_equal(res, expected_add) with tm.assert_produces_warning(PerformanceWarning): res2 = other + dti tm.assert_series_equal(res2, expected_add) expected_sub = Series([dti[n] - other[n] for n in range(len(dti))], name=names[2]) with tm.assert_produces_warning(PerformanceWarning): res3 = dti - other tm.assert_series_equal(res3, expected_sub) def test_dti_add_offset_tzaware(self, tz_aware_fixture, box): # GH#21610, GH#22163 ensure DataFrame doesn't return object-dtype timezone = tz_aware_fixture if timezone == 'US/Pacific': dates = date_range('2012-11-01', periods=3, tz=timezone) offset = dates + pd.offsets.Hour(5) assert dates[0] + pd.offsets.Hour(5) == offset[0] dates = date_range('2010-11-01 00:00', periods=3, tz=timezone, freq='H') expected = DatetimeIndex(['2010-11-01 05:00', '2010-11-01 06:00', '2010-11-01 07:00'], freq='H', tz=timezone) dates = tm.box_expected(dates, box) expected = tm.box_expected(expected, box) # TODO: parametrize over the scalar being added? radd? sub? offset = dates + pd.offsets.Hour(5) tm.assert_equal(offset, expected) offset = dates + np.timedelta64(5, 'h') tm.assert_equal(offset, expected) offset = dates + timedelta(hours=5) tm.assert_equal(offset, expected) @pytest.mark.parametrize('klass', [Series, DatetimeIndex]) def test_dt64_with_offset_array(klass): # GH#10699 # array of offsets box = Series if klass is Series else pd.Index dti = DatetimeIndex([Timestamp('2000-1-1'), Timestamp('2000-2-1')]) s = klass(dti) with tm.assert_produces_warning(PerformanceWarning): result = s + box([pd.offsets.DateOffset(years=1), pd.offsets.MonthEnd()]) exp = klass([Timestamp('2001-1-1'), Timestamp('2000-2-29')]) tm.assert_equal(result, exp) # same offset result = s + box([pd.offsets.DateOffset(years=1), pd.offsets.DateOffset(years=1)]) exp = klass([Timestamp('2001-1-1'), Timestamp('2001-2-1')]) tm.assert_equal(result, exp) @pytest.mark.parametrize('klass', [Series, DatetimeIndex]) def test_dt64_with_DateOffsets_relativedelta(klass): # GH#10699 vec = klass([Timestamp('2000-01-05 00:15:00'), Timestamp('2000-01-31 00:23:00'), Timestamp('2000-01-01'), Timestamp('2000-03-31'), Timestamp('2000-02-29'), Timestamp('2000-12-31'), Timestamp('2000-05-15'), Timestamp('2001-06-15')]) # DateOffset relativedelta fastpath relative_kwargs = [('years', 2), ('months', 5), ('days', 3), ('hours', 5), ('minutes', 10), ('seconds', 2), ('microseconds', 5)] for i, kwd in enumerate(relative_kwargs): op = pd.DateOffset(**dict([kwd])) tm.assert_equal(klass([x + op for x in vec]), vec + op) tm.assert_equal(klass([x - op for x in vec]), vec - op) op = pd.DateOffset(**dict(relative_kwargs[:i + 1])) tm.assert_equal(klass([x + op for x in vec]), vec + op) tm.assert_equal(klass([x - op for x in vec]), vec - op) @pytest.mark.parametrize('cls_and_kwargs', [ 'YearBegin', ('YearBegin', {'month': 5}), 'YearEnd', ('YearEnd', {'month': 5}), 'MonthBegin', 'MonthEnd', 'SemiMonthEnd', 'SemiMonthBegin', 'Week', ('Week', {'weekday': 3}), 'Week', ('Week', {'weekday': 6}), 'BusinessDay', 'BDay', 'QuarterEnd', 'QuarterBegin', 'CustomBusinessDay', 'CDay', 'CBMonthEnd', 'CBMonthBegin', 'BMonthBegin', 'BMonthEnd', 'BusinessHour', 'BYearBegin', 'BYearEnd', 'BQuarterBegin', ('LastWeekOfMonth', {'weekday': 2}), ('FY5253Quarter', {'qtr_with_extra_week': 1, 'startingMonth': 1, 'weekday': 2, 'variation': 'nearest'}), ('FY5253', {'weekday': 0, 'startingMonth': 2, 'variation': 'nearest'}), ('WeekOfMonth', {'weekday': 2, 'week': 2}), 'Easter', ('DateOffset', {'day': 4}), ('DateOffset', {'month': 5})]) @pytest.mark.parametrize('normalize', [True, False]) @pytest.mark.parametrize('klass', [Series, DatetimeIndex]) def test_dt64_with_DateOffsets(klass, normalize, cls_and_kwargs): # GH#10699 # assert these are equal on a piecewise basis vec = klass([Timestamp('2000-01-05 00:15:00'), Timestamp('2000-01-31 00:23:00'), Timestamp('2000-01-01'), Timestamp('2000-03-31'), Timestamp('2000-02-29'), Timestamp('2000-12-31'), Timestamp('2000-05-15'), Timestamp('2001-06-15')]) if isinstance(cls_and_kwargs, tuple): # If cls_name param is a tuple, then 2nd entry is kwargs for # the offset constructor cls_name, kwargs = cls_and_kwargs else: cls_name = cls_and_kwargs kwargs = {} offset_cls = getattr(pd.offsets, cls_name) with warnings.catch_warnings(record=True): # pandas.errors.PerformanceWarning: Non-vectorized DateOffset being # applied to Series or DatetimeIndex # we aren't testing that here, so ignore. warnings.simplefilter("ignore", PerformanceWarning) for n in [0, 5]: if (cls_name in ['WeekOfMonth', 'LastWeekOfMonth', 'FY5253Quarter', 'FY5253'] and n == 0): # passing n = 0 is invalid for these offset classes continue offset = offset_cls(n, normalize=normalize, **kwargs) tm.assert_equal(klass([x + offset for x in vec]), vec + offset) tm.assert_equal(klass([x - offset for x in vec]), vec - offset) tm.assert_equal(klass([offset + x for x in vec]), offset + vec) @pytest.mark.parametrize('klass', [Series, DatetimeIndex]) def test_datetime64_with_DateOffset(klass): # GH#10699 s = klass(date_range('2000-01-01', '2000-01-31'), name='a') result = s + pd.DateOffset(years=1) result2 = pd.DateOffset(years=1) + s exp = klass(date_range('2001-01-01', '2001-01-31'), name='a') tm.assert_equal(result, exp) tm.assert_equal(result2, exp) result = s - pd.DateOffset(years=1) exp = klass(date_range('1999-01-01', '1999-01-31'), name='a') tm.assert_equal(result, exp) s = klass([Timestamp('2000-01-15 00:15:00', tz='US/Central'), pd.Timestamp('2000-02-15', tz='US/Central')], name='a') result = s + pd.offsets.Day() result2 = pd.offsets.Day() + s exp = klass([Timestamp('2000-01-16 00:15:00', tz='US/Central'), Timestamp('2000-02-16', tz='US/Central')], name='a') tm.assert_equal(result, exp) tm.assert_equal(result2, exp) s = klass([Timestamp('2000-01-15 00:15:00', tz='US/Central'), pd.Timestamp('2000-02-15', tz='US/Central')], name='a') result = s + pd.offsets.MonthEnd() result2 = pd.offsets.MonthEnd() + s exp = klass([Timestamp('2000-01-31 00:15:00', tz='US/Central'), Timestamp('2000-02-29', tz='US/Central')], name='a') tm.assert_equal(result, exp) tm.assert_equal(result2, exp) @pytest.mark.parametrize('years', [-1, 0, 1]) @pytest.mark.parametrize('months', [-2, 0, 2]) def test_shift_months(years, months): dti = DatetimeIndex([Timestamp('2000-01-05 00:15:00'), Timestamp('2000-01-31 00:23:00'), Timestamp('2000-01-01'), Timestamp('2000-02-29'), Timestamp('2000-12-31')]) actual = DatetimeIndex(shift_months(dti.asi8, years * 12 + months)) raw = [x + pd.offsets.DateOffset(years=years, months=months) for x in dti] expected = DatetimeIndex(raw) tm.assert_index_equal(actual, expected)
{ "content_hash": "b75568a75c5218830f1a2473aa6bc80f", "timestamp": "", "source": "github", "line_count": 1864, "max_line_length": 79, "avg_line_length": 39.43562231759657, "alnum_prop": 0.5547967568155847, "repo_name": "cython-testbed/pandas", "id": "36bb0aca066fbffda83e038d300115d493081fb5", "size": "73679", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "pandas/tests/arithmetic/test_datetime64.py", "mode": "33188", "license": "bsd-3-clause", "language": [ { "name": "Batchfile", "bytes": "4907" }, { "name": "C", "bytes": "404689" }, { "name": "C++", "bytes": "17194" }, { "name": "HTML", "bytes": "551714" }, { "name": "Makefile", "bytes": "574" }, { "name": "Python", "bytes": "14136208" }, { "name": "Shell", "bytes": "27731" }, { "name": "Smarty", "bytes": "2045" } ], "symlink_target": "" }
"""Tests for Vanderbilt SPC component.""" from unittest.mock import patch, PropertyMock, Mock from homeassistant.bootstrap import async_setup_component from homeassistant.components.spc import DATA_API from homeassistant.const import (STATE_ALARM_ARMED_AWAY, STATE_ALARM_DISARMED) from tests.common import mock_coro async def test_valid_device_config(hass, monkeypatch): """Test valid device config.""" config = { 'spc': { 'api_url': 'http://localhost/', 'ws_url': 'ws://localhost/' } } with patch('pyspcwebgw.SpcWebGateway.async_load_parameters', return_value=mock_coro(True)): assert await async_setup_component(hass, 'spc', config) is True async def test_invalid_device_config(hass, monkeypatch): """Test valid device config.""" config = { 'spc': { 'api_url': 'http://localhost/' } } with patch('pyspcwebgw.SpcWebGateway.async_load_parameters', return_value=mock_coro(True)): assert await async_setup_component(hass, 'spc', config) is False async def test_update_alarm_device(hass): """Test that alarm panel state changes on incoming websocket data.""" import pyspcwebgw from pyspcwebgw.const import AreaMode config = { 'spc': { 'api_url': 'http://localhost/', 'ws_url': 'ws://localhost/' } } area_mock = Mock(spec=pyspcwebgw.area.Area, id='1', mode=AreaMode.FULL_SET, last_changed_by='Sven') area_mock.name = 'House' area_mock.verified_alarm = False with patch('pyspcwebgw.SpcWebGateway.areas', new_callable=PropertyMock) as mock_areas: mock_areas.return_value = {'1': area_mock} with patch('pyspcwebgw.SpcWebGateway.async_load_parameters', return_value=mock_coro(True)): assert await async_setup_component(hass, 'spc', config) is True await hass.async_block_till_done() entity_id = 'alarm_control_panel.house' assert hass.states.get(entity_id).state == STATE_ALARM_ARMED_AWAY assert hass.states.get(entity_id).attributes['changed_by'] == 'Sven' area_mock.mode = AreaMode.UNSET area_mock.last_changed_by = 'Anna' await hass.data[DATA_API]._async_callback(area_mock) await hass.async_block_till_done() assert hass.states.get(entity_id).state == STATE_ALARM_DISARMED assert hass.states.get(entity_id).attributes['changed_by'] == 'Anna'
{ "content_hash": "35e661e02b9e78aedc53dfc743cb903f", "timestamp": "", "source": "github", "line_count": 74, "max_line_length": 78, "avg_line_length": 33.78378378378378, "alnum_prop": 0.6424, "repo_name": "persandstrom/home-assistant", "id": "d4bedda4e967e7b1739785b433ba1e43fc2c5305", "size": "2500", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "tests/components/test_spc.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Dockerfile", "bytes": "1067" }, { "name": "Python", "bytes": "11745210" }, { "name": "Ruby", "bytes": "518" }, { "name": "Shell", "bytes": "16652" } ], "symlink_target": "" }
import pymongo from scrapy.conf import settings from scrapy.exceptions import DropItem from scrapy import log class MongoDBPipeline(object): def __init__(self): connection = pymongo.MongoClient( settings['MONGODB_SERVER'], settings['MONGODB_PORT'] ) db = connection[settings['MONGODB_DB']] self.collection = db[settings['MONGODB_COLLECTION']] def process_item(self, item, spider): if not self.collection.find_one({'imdb_id': item['imdb_id']}): self.collection.insert(item) return item
{ "content_hash": "9800e2ac8391b7b94596d6a974657d98", "timestamp": "", "source": "github", "line_count": 21, "max_line_length": 70, "avg_line_length": 27.714285714285715, "alnum_prop": 0.6408934707903781, "repo_name": "Nathx/parental_advisory_ml", "id": "7f01262fa3a09481d58c1eca876f8fd73c1d3d96", "size": "776", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "scraping/imdb/imdb/pipelines.py", "mode": "33188", "license": "mit", "language": [ { "name": "Python", "bytes": "60644" }, { "name": "Shell", "bytes": "1928" } ], "symlink_target": "" }
"""This library contains classes for launching graphs and executing operations. The [basic usage](../../get_started/index.md#basic-usage) guide has examples of how a graph is launched in a [`tf.Session`](#Session). ## Session management @@Session @@InteractiveSession @@get_default_session ## Error classes @@OpError @@CancelledError @@UnknownError @@InvalidArgumentError @@DeadlineExceededError @@NotFoundError @@AlreadyExistsError @@PermissionDeniedError @@UnauthenticatedError @@ResourceExhaustedError @@FailedPreconditionError @@AbortedError @@OutOfRangeError @@UnimplementedError @@InternalError @@UnavailableError @@DataLossError """ from __future__ import absolute_import from __future__ import division from __future__ import print_function # NOTE(mrry): Support for `tf.GrpcServer` is currently experimental. from tensorflow.core.protobuf.tensorflow_server_pb2 import ClusterDef from tensorflow.core.protobuf.tensorflow_server_pb2 import JobDef from tensorflow.core.protobuf.tensorflow_server_pb2 import ServerDef from tensorflow.python.client.server_lib import ClusterSpec from tensorflow.python.client.server_lib import GrpcServer from tensorflow.python.client.session import InteractiveSession from tensorflow.python.client.session import Session from tensorflow.python.framework import errors from tensorflow.python.framework.errors import OpError from tensorflow.python.framework.ops import get_default_session
{ "content_hash": "b059965facf48466c914b432cce0effd", "timestamp": "", "source": "github", "line_count": 51, "max_line_length": 79, "avg_line_length": 28.15686274509804, "alnum_prop": 0.8182451253481894, "repo_name": "awni/tensorflow", "id": "37f8fe29946bd811440e55305563d0406791a160", "size": "2146", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "tensorflow/python/client/client_lib.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "C", "bytes": "156098" }, { "name": "C++", "bytes": "7765982" }, { "name": "CMake", "bytes": "29325" }, { "name": "CSS", "bytes": "1297" }, { "name": "HTML", "bytes": "684124" }, { "name": "Java", "bytes": "50361" }, { "name": "JavaScript", "bytes": "7188" }, { "name": "Jupyter Notebook", "bytes": "1771787" }, { "name": "Objective-C", "bytes": "1288" }, { "name": "Protocol Buffer", "bytes": "103762" }, { "name": "Python", "bytes": "4675299" }, { "name": "Shell", "bytes": "126103" }, { "name": "TypeScript", "bytes": "342627" } ], "symlink_target": "" }
class AgentGlobals(object): """ This class is used for setting AgentGlobals which can be used all throughout the Agent. """ GUID_ZERO = "00000000-0000-0000-0000-000000000000" # # Some modules (e.g. telemetry) require an up-to-date container ID. We update this variable each time we # fetch the goal state. # _container_id = GUID_ZERO @staticmethod def get_container_id(): return AgentGlobals._container_id @staticmethod def update_container_id(container_id): AgentGlobals._container_id = container_id
{ "content_hash": "f342e9371e91cb8f09d51af708d5896b", "timestamp": "", "source": "github", "line_count": 20, "max_line_length": 108, "avg_line_length": 28.65, "alnum_prop": 0.6736474694589878, "repo_name": "Azure/WALinuxAgent", "id": "dbfda92d9dcfa019126afca1edf603da9c48f3c0", "size": "1234", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "azurelinuxagent/common/AgentGlobals.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Python", "bytes": "3073264" }, { "name": "Shell", "bytes": "19249" } ], "symlink_target": "" }
from msrest.paging import Paged class DataMaskingRulePaged(Paged): """ A paging container for iterating over a list of :class:`DataMaskingRule <azure.mgmt.sql.models.DataMaskingRule>` object """ _attribute_map = { 'next_link': {'key': 'nextLink', 'type': 'str'}, 'current_page': {'key': 'value', 'type': '[DataMaskingRule]'} } def __init__(self, *args, **kwargs): super(DataMaskingRulePaged, self).__init__(*args, **kwargs)
{ "content_hash": "8807295f0af4e1b91b7a7e82567a93e3", "timestamp": "", "source": "github", "line_count": 16, "max_line_length": 123, "avg_line_length": 29.8125, "alnum_prop": 0.6184486373165619, "repo_name": "AutorestCI/azure-sdk-for-python", "id": "4e1eed7b9f516b90aea2317dc18ce3f9b5552290", "size": "951", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "azure-mgmt-sql/azure/mgmt/sql/models/data_masking_rule_paged.py", "mode": "33188", "license": "mit", "language": [ { "name": "Python", "bytes": "34619070" } ], "symlink_target": "" }
""" Created on May 17, 2013 @author: tanel """ import gi gi.require_version('Gst', '1.0') from gi.repository import GObject, Gst GObject.threads_init() Gst.init(None) import logging import thread import os logger = logging.getLogger(__name__) import pdb class DecoderPipeline2(object): def __init__(self, conf={}): logger.info("Creating decoder using conf: %s" % conf) self.create_pipeline(conf) self.outdir = conf.get("out-dir", None) if not os.path.exists(self.outdir): os.makedirs(self.outdir) elif not os.path.isdir(self.outdir): raise Exception("Output directory %s already exists as a file" % self.outdir) self.result_handler = None self.full_result_handler = None self.eos_handler = None self.error_handler = None self.request_id = "<undefined>" def create_pipeline(self, conf): self.appsrc = Gst.ElementFactory.make("appsrc", "appsrc") self.decodebin = Gst.ElementFactory.make("decodebin", "decodebin") self.audioconvert = Gst.ElementFactory.make("audioconvert", "audioconvert") self.audioresample = Gst.ElementFactory.make("audioresample", "audioresample") self.tee = Gst.ElementFactory.make("tee", "tee") self.queue1 = Gst.ElementFactory.make("queue", "queue1") self.filesink = Gst.ElementFactory.make("filesink", "filesink") self.queue2 = Gst.ElementFactory.make("queue", "queue2") self.asr = Gst.ElementFactory.make("kaldinnet2onlinedecoder", "asr") self.fakesink = Gst.ElementFactory.make("fakesink", "fakesink") # This needs to be set first if "use-threaded-decoder" in conf["decoder"]: self.asr.set_property("use-threaded-decoder", conf["decoder"]["use-threaded-decoder"]) for (key, val) in conf.get("decoder", {}).iteritems(): if key != "use-threaded-decoder": logger.info("Setting decoder property: %s = %s" % (key, val)) self.asr.set_property(key, val) self.appsrc.set_property("is-live", True) self.filesink.set_property("location", "/dev/null") logger.info('Created GStreamer elements') self.pipeline = Gst.Pipeline() for element in [self.appsrc, self.decodebin, self.audioconvert, self.audioresample, self.tee, self.queue1, self.filesink, self.queue2, self.asr, self.fakesink]: logger.debug("Adding %s to the pipeline" % element) self.pipeline.add(element) logger.info('Linking GStreamer elements') self.appsrc.link(self.decodebin) #self.appsrc.link(self.audioconvert) self.decodebin.connect('pad-added', self._connect_decoder) self.audioconvert.link(self.audioresample) self.audioresample.link(self.tee) self.tee.link(self.queue1) self.queue1.link(self.filesink) self.tee.link(self.queue2) self.queue2.link(self.asr) self.asr.link(self.fakesink) # Create bus and connect several handlers self.bus = self.pipeline.get_bus() self.bus.add_signal_watch() self.bus.enable_sync_message_emission() self.bus.connect('message::eos', self._on_eos) self.bus.connect('message::error', self._on_error) #self.bus.connect('message::cutter', self._on_cutter) self.asr.connect('partial-result', self._on_partial_result) self.asr.connect('final-result', self._on_final_result) self.asr.connect('full-final-result', self._on_full_final_result) logger.info("Setting pipeline to READY") self.pipeline.set_state(Gst.State.READY) logger.info("Set pipeline to READY") def _connect_decoder(self, element, pad): logger.info("%s: Connecting audio decoder" % self.request_id) pad.link(self.audioconvert.get_static_pad("sink")) logger.info("%s: Connected audio decoder" % self.request_id) def _on_partial_result(self, asr, hyp): logger.info("%s: Got partial result: %s" % (self.request_id, hyp.decode('utf8'))) if self.result_handler: self.result_handler(hyp, False) def _on_final_result(self, asr, hyp): logger.info("%s: Got final result: %s" % (self.request_id, hyp.decode('utf8'))) if self.result_handler: self.result_handler(hyp, True) def _on_full_final_result(self, asr, result_json): logger.info("%s: Got full final result: %s" % (self.request_id, result_json.decode('utf8'))) if self.full_result_handler: self.full_result_handler(result_json) def _on_error(self, bus, msg): self.error = msg.parse_error() logger.error(self.error) self.finish_request() if self.error_handler: self.error_handler(self.error[0].message) def _on_eos(self, bus, msg): logger.info('%s: Pipeline received eos signal' % self.request_id) #self.decodebin.unlink(self.audioconvert) self.finish_request() if self.eos_handler: self.eos_handler[0](self.eos_handler[1]) def get_adaptation_state(self): return self.asr.get_property("adaptation-state") def set_adaptation_state(self, adaptation_state): """Sets the adaptation state to a certian value, previously retrieved using get_adaptation_state() Should be called after init_request(..) """ return self.asr.set_property("adaptation-state", adaptation_state) def finish_request(self): logger.info("%s: Resetting decoder state" % self.request_id) if self.outdir: self.filesink.set_state(Gst.State.NULL) self.filesink.set_property('location', "/dev/null") self.filesink.set_state(Gst.State.PLAYING) self.pipeline.set_state(Gst.State.NULL) self.request_id = "<undefined>" def init_request(self, id, caps_str): self.request_id = id logger.info("%s: Initializing request" % (self.request_id)) if caps_str and len(caps_str) > 0: logger.info("%s: Setting caps to %s" % (self.request_id, caps_str)) caps = Gst.caps_from_string(caps_str) self.appsrc.set_property("caps", caps) else: #caps = Gst.caps_from_string("") self.appsrc.set_property("caps", None) #self.pipeline.set_state(Gst.State.READY) pass #self.appsrc.set_state(Gst.State.PAUSED) if self.outdir: self.pipeline.set_state(Gst.State.PAUSED) self.filesink.set_state(Gst.State.NULL) self.filesink.set_property('location', "%s/%s.raw" % (self.outdir, id)) self.filesink.set_state(Gst.State.PLAYING) #self.filesink.set_state(Gst.State.PLAYING) #self.decodebin.set_state(Gst.State.PLAYING) self.pipeline.set_state(Gst.State.PLAYING) self.filesink.set_state(Gst.State.PLAYING) # push empty buffer (to avoid hang on client diconnect) #buf = Gst.Buffer.new_allocate(None, 0, None) #self.appsrc.emit("push-buffer", buf) # reset adaptation state self.set_adaptation_state("") def process_data(self, data): logger.debug('%s: Pushing buffer of size %d to pipeline' % (self.request_id, len(data))) buf = Gst.Buffer.new_allocate(None, len(data), None) buf.fill(0, data) self.appsrc.emit("push-buffer", buf) logger.debug('%s: Pushing buffer done' % self.request_id) def end_request(self): logger.info("%s: Pushing EOS to pipeline" % self.request_id) self.appsrc.emit("end-of-stream") def set_result_handler(self, handler): self.result_handler = handler def set_full_result_handler(self, handler): self.full_result_handler = handler def set_eos_handler(self, handler, user_data=None): self.eos_handler = (handler, user_data) def set_error_handler(self, handler): self.error_handler = handler def cancel(self): logger.info("%s: Sending EOS to pipeline in order to cancel processing" % self.request_id) self.appsrc.emit("end-of-stream") #self.asr.set_property("silent", True) #self.pipeline.set_state(Gst.State.NULL) #if (self.pipeline.get_state() == Gst.State.PLAYING): #logger.debug("Sending EOS to pipeline") #self.pipeline.send_event(Gst.Event.new_eos()) #self.pipeline.set_state(Gst.State.READY) logger.info("%s: Cancelled pipeline" % self.request_id)
{ "content_hash": "0b80ca9cb171e8c4201e67690ce3fb62", "timestamp": "", "source": "github", "line_count": 226, "max_line_length": 106, "avg_line_length": 38.18141592920354, "alnum_prop": 0.6256808436667053, "repo_name": "claritylab/kaldi-gstreamer-server", "id": "f70fa4716a8ad9de69464eb03d1b8acc667bcf25", "size": "8629", "binary": false, "copies": "5", "ref": "refs/heads/master", "path": "kaldigstserver/decoder2.py", "mode": "33188", "license": "bsd-2-clause", "language": [ { "name": "CSS", "bytes": "3214" }, { "name": "HTML", "bytes": "8835" }, { "name": "JavaScript", "bytes": "33511" }, { "name": "Python", "bytes": "70764" }, { "name": "Shell", "bytes": "2151" }, { "name": "Thrift", "bytes": "931" } ], "symlink_target": "" }
from argus.backends import base as base_backend from argus.backends import windows as windows_backend from argus import config as argus_config CONFIG = argus_config.CONFIG class LocalBackend(windows_backend.WindowsBackendMixin, windows_backend.BaseMetadataProviderMixin, base_backend.BaseBackend): """Local Backend for testing Windows machines that are running, have git installed and winrm configured""" def __init__(self, name=None, userdata=None, metadata=None, availability_zone=None): super(LocalBackend, self).__init__(name=name, userdata=userdata, metadata=metadata, availability_zone=availability_zone) self._username = CONFIG.local.username self._password = CONFIG.local.password self._ip = CONFIG.local.ip def get_remote_client(self, protocol='http', **kwargs): super(LocalBackend, self).get_remote_client(self._username, self._password, protocol, **kwargs) def setup_instance(self): pass def cleanup(self): pass def save_instance_output(self): pass def get_password(self): return lambda: self._password def get_username(self): return lambda: self._username def floating_ip(self): return self._ip
{ "content_hash": "e0d867072c6e9d3cf6ca4153c5d56ce3", "timestamp": "", "source": "github", "line_count": 43, "max_line_length": 79, "avg_line_length": 34.74418604651163, "alnum_prop": 0.5876840696117804, "repo_name": "micumatei/cloudbase-init-ci", "id": "673a0f9b7e99e695523e23f8683bdcb67b915743", "size": "2133", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "argus/backends/local/local_backend.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Batchfile", "bytes": "138" }, { "name": "PowerShell", "bytes": "15716" }, { "name": "Python", "bytes": "571424" } ], "symlink_target": "" }
import os import re import sys import urllib import gzip import cStringIO import subprocess from debian import deb822 import argparse destdir="newpkg" arches=["amd64", "i386"] REPO="http://repo.steampowered.com/steamrt" DIST="scout" COMPONENT="main" out = open("runtime-generated.nix", "w"); out.write("# This file is autogenerated! Do not edit it yourself, use update-runtime.py for regeneration.\n") out.write("{ fetchurl }:\n") out.write("\n") out.write("{\n") def parse_args(): parser = argparse.ArgumentParser() parser.add_argument("-b", "--beta", help="build beta runtime", action="store_true") parser.add_argument("-d", "--debug", help="build debug runtime", action="store_true") parser.add_argument("--symbols", help="include debugging symbols", action="store_true") parser.add_argument("--repo", help="source repository", default=REPO) return parser.parse_args() def download_file(file_base, file_name, file_url): file_shortname = file_base + ".deb" md5 = subprocess.check_output(["nix-prefetch-url", "--type", "md5", "--name", file_shortname, file_url]) out.write(" rec {\n") out.write(" name = \"%s\";\n" % file_name) out.write(" md5 = \"%s\";\n" % md5.strip()) out.write(" source = fetchurl {\n") out.write(" url = \"%s\";\n" % file_url) out.write(" inherit md5;\n") out.write(" name = \"%s\";\n" % file_shortname) out.write(" };\n") out.write(" }\n") def install_binaries (arch, binarylist): installset = binarylist.copy() # # Load the Packages file so we can find the location of each binary package # packages_url = "%s/dists/%s/%s/binary-%s/Packages" % (REPO, DIST, COMPONENT, arch) print("Downloading %s binaries from %s" % (arch, packages_url)) for stanza in deb822.Packages.iter_paragraphs(urllib.urlopen(packages_url)): p = stanza['Package'] if p in installset: print("DOWNLOADING BINARY: %s" % p) # # Download the package and install it # file_url="%s/%s" % (REPO,stanza['Filename']) download_file(p, os.path.splitext(os.path.basename(stanza['Filename']))[0], file_url) installset.remove(p) for p in installset: # # There was a binary package in the list to be installed that is not in the repo # e = "ERROR: Package %s not found in Packages file %s\n" % (p, packages_url) sys.stderr.write(e) def install_symbols (arch, binarylist): # # Load the Packages file to find the location of each symbol package # packages_url = "%s/dists/%s/%s/debug/binary-%s/Packages" % (REPO, DIST, COMPONENT, arch) print("Downloading %s symbols from %s" % (arch, packages_url)) for stanza in deb822.Packages.iter_paragraphs(urllib.urlopen(packages_url)): p = stanza['Package'] m = re.match('([\w\-\.]+)\-dbgsym', p) if m and m.group(1) in binarylist: print("DOWNLOADING SYMBOLS: %s" % p) # # Download the package and install it # file_url="%s/%s" % (REPO,stanza['Filename']) download_file(p, os.path.splitext(os.path.basename(stanza['Filename']))[0], file_url) args = parse_args() REPO=args.repo if args.beta: DIST="steam_beta" if args.debug: COMPONENT = "debug" # Process packages.txt to get the list of source and binary packages source_pkgs = set() binary_pkgs = set() print ("Creating runtime-generated.nix") pkgs_list = urllib.urlopen("https://raw.githubusercontent.com/ValveSoftware/steam-runtime/master/packages.txt").readlines() for line in pkgs_list: if line[0] != '#': toks = line.split() if len(toks) > 1: source_pkgs.add(toks[0]) binary_pkgs.update(toks[1:]) # remove development packages for end-user runtime if not args.debug: binary_pkgs -= {x for x in binary_pkgs if re.search('-dbg$|-dev$|-multidev$',x)} for arch in arches: out.write(" %s = [\n" % arch) install_binaries(arch, binary_pkgs) if args.symbols: install_symbols(arch, binary_pkgs) out.write(" ];\n"); out.write("}\n") # vi: set noexpandtab:
{ "content_hash": "96814fda9c3132abf9fff89c2e4d960a", "timestamp": "", "source": "github", "line_count": 133, "max_line_length": 123, "avg_line_length": 29.383458646616543, "alnum_prop": 0.6678607983623337, "repo_name": "triton/triton", "id": "3244297084906e7fa19f33ab8154b61cc568c90f", "size": "4097", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "pkgs/all-pkgs/s/steam/update-runtime.py", "mode": "33261", "license": "mit", "language": [ { "name": "C", "bytes": "19566" }, { "name": "C++", "bytes": "654" }, { "name": "CMake", "bytes": "1035" }, { "name": "CSS", "bytes": "1837" }, { "name": "Dockerfile", "bytes": "553" }, { "name": "Emacs Lisp", "bytes": "673" }, { "name": "Go", "bytes": "373" }, { "name": "JavaScript", "bytes": "936" }, { "name": "Nix", "bytes": "6740090" }, { "name": "Perl", "bytes": "166382" }, { "name": "Python", "bytes": "36406" }, { "name": "Ruby", "bytes": "6523" }, { "name": "Shell", "bytes": "469375" }, { "name": "XSLT", "bytes": "6371" }, { "name": "sed", "bytes": "794" } ], "symlink_target": "" }
from google.cloud import retail_v2 async def sample_create_control(): # Create a client client = retail_v2.ControlServiceAsyncClient() # Initialize request argument(s) control = retail_v2.Control() control.display_name = "display_name_value" control.solution_types = "SOLUTION_TYPE_SEARCH" request = retail_v2.CreateControlRequest( parent="parent_value", control=control, control_id="control_id_value", ) # Make the request response = await client.create_control(request=request) # Handle the response print(response) # [END retail_v2_generated_ControlService_CreateControl_async]
{ "content_hash": "976cc18150173ec9b650e34b07a9b8ce", "timestamp": "", "source": "github", "line_count": 25, "max_line_length": 62, "avg_line_length": 26.4, "alnum_prop": 0.6954545454545454, "repo_name": "googleapis/python-retail", "id": "57c27d004ab84376c487972ad987bf6f1bf7c223", "size": "2045", "binary": false, "copies": "1", "ref": "refs/heads/main", "path": "samples/generated_samples/retail_v2_generated_control_service_create_control_async.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Dockerfile", "bytes": "2050" }, { "name": "Python", "bytes": "7420556" }, { "name": "Shell", "bytes": "30660" } ], "symlink_target": "" }
from __future__ import (absolute_import, division, print_function, with_statement) from Crypto.PublicKey import RSA import datetime from podship.models import UserBase from firenado.config import load_yaml_config_file from firenado import service from firenado.util import random_string from passlib.hash import bcrypt from sqlalchemy.orm.exc import NoResultFound import os class UserService(service.FirenadoService): def __init__(self, handler, data_source=None): super(UserService, self).__init__(handler, data_source) #self.security = load_yaml_config_file() self.project_root = os.path.abspath( os.path.join(os.path.dirname(os.path.abspath(__file__)), '..')) self.security_conf = load_yaml_config_file( os.path.join(self.project_root, 'conf', 'security.yml')) def create(self, user_data, created_utc=None, db_session=None): if not created_utc: created_utc = datetime.datetime.utcnow() user = UserBase() user.user_name = user_data['user_name'] # TODO: Generate the serialized private key user.serialized_private_key = self.generate_key(user_data['password']) user.getting_started = True user.disable_mail = False # TODO: Handle language user.language = 'en' user.email = user_data['email'] # TODO: encrypt the password user.encrypted_password = bcrypt.encrypt( self.get_peppered_password(user_data['password'])) # Not used user.invitation_token = None user.invitation_sent_at = None user.reset_password_sent_at = None user.sign_in_count = 0 user.current_sign_in_at = None user.last_sign_in_at = None user.current_sign_in_ip = None user.last_sign_in_ip = None user.created_at = created_utc user.updated_at = created_utc user.invitation_service = None user.invitation_identifier = None user.invitation_limit = None user.invited_by_id = None user.invited_by_type = None user.authentication_token = None user.unconfirmed_email = None user.confirm_email_token = None user.locked_at = None # TODO: This should be set based on an application settings user.show_community_spotlight_in_stream = True user.auto_follow_back = False user.auto_follow_back_aspect_id = None user.hidden_shareables = None user.reset_password_sent_at = None user.last_seen = None user.remove_after = None user.export = None user.exported_at = None user.exporting = False user.strip_exif = True user.exported_photos_file = None user.exported_photos_at = None user.exporting_photos = False commit = False if not db_session: db_session = self.get_data_source( 'diasporapy').get_connection()['session'] commit = True db_session.add(user) if commit: db_session.commit() return user def get_by_user_name(self, user_name, db_session=None): if not db_session: db_session = self.get_data_source( 'diasporapy').get_connection()['session'] auth_user = None try: auth_user = db_session.query(UserBase).filter( UserBase.user_name == user_name).one() except NoResultFound: pass return auth_user def is_password_valid(self, challenge, encrypted_password): return bcrypt.verify( self.get_peppered_password(challenge), encrypted_password) def get_peppered_password(self, password): return '%s%s' % (password, self.security_conf['password']['pepper']) def generate_key(self, passphrase): """ FROM pyraspora: pyaspora.user.models Generate a 2048-bit RSA key. The key will be stored in the User object. The private key will be protected with password <passphrase>, which is usually the user password. """ # TODO: I don't know if this is the way diaspora is handling the key # Let's keep this way by now # TODO: looks like this method is candidate to be part of some security # toolkit RSAkey = RSA.generate(4096) print private_key = RSAkey.exportKey( format='PEM', pkcs=1, passphrase=passphrase ).decode("ascii") return RSAkey.publickey().exportKey( format='PEM', pkcs=1 ).decode("ascii")
{ "content_hash": "c94f222f230eb110496819dcedbf75ee", "timestamp": "", "source": "github", "line_count": 129, "max_line_length": 79, "avg_line_length": 36.16279069767442, "alnum_prop": 0.6113612004287245, "repo_name": "piraz/diasporapy", "id": "7006c1f50a06710414fff5e726d918af5c2b913c", "size": "5327", "binary": false, "copies": "2", "ref": "refs/heads/develop", "path": "podship/services/user.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "CSS", "bytes": "3151" }, { "name": "HTML", "bytes": "13743" }, { "name": "JavaScript", "bytes": "5895" }, { "name": "Python", "bytes": "94094" } ], "symlink_target": "" }
from swgpy.object import * def create(kernel): result = Building() result.template = "object/building/poi/shared_naboo_swamhunt_large2.iff" result.attribute_template_id = -1 result.stfName("poi_n","base_poi_building") #### BEGIN MODIFICATIONS #### #### END MODIFICATIONS #### return result
{ "content_hash": "91aa2ff4e0a38ab3c314f76d0bdb5f9b", "timestamp": "", "source": "github", "line_count": 13, "max_line_length": 73, "avg_line_length": 23.615384615384617, "alnum_prop": 0.6938110749185668, "repo_name": "obi-two/Rebelion", "id": "52fdf87f216fdc1279055d7846c7c199ae4c339f", "size": "452", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "data/scripts/templates/object/building/poi/shared_naboo_swamhunt_large2.py", "mode": "33188", "license": "mit", "language": [ { "name": "Batchfile", "bytes": "11818" }, { "name": "C", "bytes": "7699" }, { "name": "C++", "bytes": "2293610" }, { "name": "CMake", "bytes": "39727" }, { "name": "PLSQL", "bytes": "42065" }, { "name": "Python", "bytes": "7499185" }, { "name": "SQLPL", "bytes": "41864" } ], "symlink_target": "" }
import unicodedata __all__ = [ "EmojiData", ] def get_unicode_data(emoji): try: name = [unicodedata.name(ch) for ch in emoji] category = [unicodedata.category(ch) for ch in emoji] except ValueError: # Couldn't find for codepoint name = [emoji] category = ["unicode_other"] return name, category class EmojiData: __slots__ = ( "raw", "id", "unicode", "custom", "managed", "name", "category", "roles", "guild", ) def __init__(self, emoji): self.raw = emoji if isinstance(emoji, str): name, category = get_unicode_data(emoji) self.id = 0 self.unicode = emoji self.custom = False self.managed = False self.name = name self.category = category self.roles = [] self.guild = None else: self.id = emoji.id self.unicode = "" self.custom = True self.managed = getattr(emoji, "managed", None) self.name = [emoji.name] self.category = ["custom"] self.roles = getattr(emoji, "roles", None) self.guild = getattr(emoji, "guild", None) @property def mention(self): if self.id: return f"<:{self.name[0]}:{self.id}>" else: return self.unicode @property def cache_id(self): return (self.id, self.unicode) def values(self): return { "emoji_id": self.id, "emoji_unicode": self.unicode, "is_custom": self.custom, "is_managed": self.managed, "is_deleted": False, "name": self.name, "category": self.category, "roles": list(map(lambda r: r.id, self.roles or [])), "guild_id": getattr(self.guild, "id", None), } def __str__(self): return str(self.id or self.unicode) def __repr__(self): return f"<EmojiData {self}>"
{ "content_hash": "5b3afa450fea9c41e18a0c555508af5d", "timestamp": "", "source": "github", "line_count": 85, "max_line_length": 65, "avg_line_length": 24.576470588235296, "alnum_prop": 0.49114408808042126, "repo_name": "strinking/statbot", "id": "280308ff5b41d8b8272202260178fd44fba3843e", "size": "2465", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "statbot/emoji.py", "mode": "33188", "license": "mit", "language": [ { "name": "Python", "bytes": "95550" }, { "name": "Shell", "bytes": "862" } ], "symlink_target": "" }
import logging import threading import time import os import Server import websocket import LightSchedule import PCA9685 import PCA9685_dummy import Settings import Channel from WeatherType import WeatherType import json from objdict import ObjDict from outlet import outlet DEBUG = True MAIN_LOOP_TIME = 5 MAIN_LOOP_HEALTH_FREQ = 120 LED_MAX = 4095 # Max Brightness LED_MIN = 0 # Min Brightness (off) def makeLogger(): '''sets up the logger''' logging.raiseExceptions = True logdir = 'logs/' if not os.path.exists(logdir): os.makedirs(logdir) logger = logging.getLogger(__name__) logger.setLevel(logging.INFO) formatter = logging.Formatter('%(asctime)s:%(levelname)s: %(message)s') handler = logging.handlers.TimedRotatingFileHandler(logdir + "whet.log", when='midnight', interval=1, backupCount=7) handler.setLevel(logging.INFO) handler.setFormatter(formatter) logger.addHandler(handler) debug_handler = logging.handlers.TimedRotatingFileHandler(logdir + "whet-DEBUG.log", when='midnight', interval=1, backupCount=2) debug_handler.setLevel(logging.DEBUG) debug_handler.setFormatter(formatter) logger.addHandler(debug_handler) # consoleHandler = logging.StreamHandler() # consoleHandler.setLevel(logging.INFO) # consoleHandler.setFormatter(formatter) # logger.addHandler(consoleHandler) return logger def main_loop(): logger = makeLogger() logger.info("Whet started") # counts for debug/ health report loops = 0 dead_tornado_cnt = 0 dead_channel_cnt = 0 # Settings ---------------------------------------------------------------- settings = Settings.Settings() # Server ------------------------------------------------------------------ tornado_server = Server.Server() tornado_server.start() time.sleep(1) # connect to the server light_schedule = LightSchedule.LightSchedule() # Initialise the PCA9685, if cant use a dummy (for testing on machine that is not pi) try: pwm = PCA9685.PCA9685() # Alternatively specify a different address and/or bus: #pwm = Adafruit_PCA9685.PCA9685(address=0x41, busnum=2) except ImportError: msg = "UNABLE TO LOAD PCA9685... no pwm values will set!" logger.exception(msg) print(msg) pwm = PCA9685_dummy.PCA9685() # Set frequency to 1000hz... LEDS. pwm.set_pwm_freq(1000) pwm.set_all(LED_MIN) time.sleep(1) try: channel_threads = [] while True: settings.read_file() # untested if not tornado_server.is_alive(): dead_tornado_cnt += 1 logger.error("Tornado thread died %s", dead_tornado_cnt) tornado_server = Server.Server() tornado_server.start() time.sleep(1) # restart threads if they die, this should never happen for i, val in enumerate(channel_threads): if not val.is_alive(): dead_channel_cnt += 1 logger.error( "THREAD %s IS DEAD: Dead thread count = %s", val.c_id, dead_channel_cnt) channel_threads[i] = Channel.Channel( val.c_id, pwm, light_schedule) channel_threads[i].start() if len(channel_threads) != light_schedule.get_number_of_channels(): logger.info("Thread to channel mismatch config=%s threads=%s", light_schedule.get_number_of_channels(), len(channel_threads)) for i, val in enumerate(channel_threads): channel_threads[i].cancel() while channel_threads[i].is_alive(): logger.info("waiting for thread to die") time.sleep(1) channel_threads = [] # reset list for i in range(light_schedule.get_number_of_channels()): channel_obj = Channel.Channel(i, pwm, light_schedule) channel_threads.append(channel_obj) channel_obj.start() a_data = [] conn = websocket.create_connection("ws://localhost:7999/chat/websocket?id=py", timeout=2) for i, val in enumerate(channel_threads): if val.is_alive: a_data.append(val.broadcast()) c_data = ObjDict() c_data.status = a_data conn.send(json.dumps(c_data, sort_keys=True, indent=4)) conn.close(reason="whet.py loop finished", timeout=2) if loops >= MAIN_LOOP_HEALTH_FREQ: loops = 0 logger.info("Dead Channels:%s | Dead Tornados:%s", dead_channel_cnt, dead_tornado_cnt) time.sleep(MAIN_LOOP_TIME) if settings.__dict__.get('outlet_run', False): outlet.run() loops += 1 except KeyboardInterrupt: logger.info('KeyboardInterrupt Quit') pwm.set_all(LED_MIN) finally: for i, val in enumerate(channel_threads): logger.info('Cancel channel %s', i) channel_threads[i].cancel() pwm.set_all(LED_MIN) logger.info('Killing server thread') conn.close() tornado_server.stop() if __name__ == "__main__": main_loop()
{ "content_hash": "64e34f4d6a3ee217bf9ea0269d519978", "timestamp": "", "source": "github", "line_count": 174, "max_line_length": 101, "avg_line_length": 33.38505747126437, "alnum_prop": 0.5407126872095025, "repo_name": "mike-gracia/whet", "id": "79dd8375ef5b4420613c6c108daae102d4c4ea4c", "size": "5832", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "whet.py", "mode": "33261", "license": "mit", "language": [ { "name": "CSS", "bytes": "2469" }, { "name": "HTML", "bytes": "11953" }, { "name": "JavaScript", "bytes": "191313" }, { "name": "Python", "bytes": "35197" } ], "symlink_target": "" }
from __future__ import absolute_import, print_function import os import sys import tempfile import numpy from numpy.testing import TestCase, dec, assert_, run_module_suite from scipy.weave import inline_tools,ext_tools from scipy.weave.build_tools import msvc_exists, gcc_exists from scipy.weave.catalog import unique_file from scipy.weave.numpy_scalar_spec import numpy_complex_scalar_converter def unique_mod(d,file_name): f = os.path.basename(unique_file(d,file_name)) m = os.path.splitext(f)[0] return m #---------------------------------------------------------------------------- # Scalar conversion test classes # int, float, complex #---------------------------------------------------------------------------- class NumpyComplexScalarConverter(TestCase): compiler = '' def setUp(self): self.converter = numpy_complex_scalar_converter() @dec.slow def test_type_match_string(self): assert_(not self.converter.type_match('string')) @dec.slow def test_type_match_int(self): assert_(not self.converter.type_match(5)) @dec.slow def test_type_match_float(self): assert_(not self.converter.type_match(5.)) @dec.slow def test_type_match_complex128(self): assert_(self.converter.type_match(numpy.complex128(5.+1j))) @dec.slow def test_complex_var_in(self): mod_name = sys._getframe().f_code.co_name + self.compiler mod_name = unique_mod(test_dir,mod_name) mod = ext_tools.ext_module(mod_name) a = numpy.complex(1.+1j) code = "a=std::complex<double>(2.,2.);" test = ext_tools.ext_function('test',code,['a']) mod.add_function(test) mod.compile(location=test_dir, compiler=self.compiler) exec('from ' + mod_name + ' import test') b = numpy.complex128(1.+1j) test(b) try: b = 1. test(b) except TypeError: pass try: b = 'abc' test(b) except TypeError: pass @dec.slow def test_complex_return(self): mod_name = sys._getframe().f_code.co_name + self.compiler mod_name = unique_mod(test_dir,mod_name) mod = ext_tools.ext_module(mod_name) a = 1.+1j code = """ a= a + std::complex<double>(2.,2.); return_val = PyComplex_FromDoubles(a.real(),a.imag()); """ test = ext_tools.ext_function('test',code,['a']) mod.add_function(test) mod.compile(location=test_dir, compiler=self.compiler) exec('from ' + mod_name + ' import test') b = 1.+1j c = test(b) assert_(c == 3.+3j) @dec.slow def test_inline(self): a = numpy.complex128(1+1j) result = inline_tools.inline("return_val=1.0/a;",['a']) assert_(result == .5-.5j) for _n in dir(): if _n[-9:] == 'Converter': if msvc_exists(): exec("class Test%sMsvc(%s):\n compiler = 'msvc'" % (_n,_n)) else: exec("class Test%sUnix(%s):\n compiler = ''" % (_n,_n)) if gcc_exists(): exec("class Test%sGcc(%s):\n compiler = 'gcc'" % (_n,_n)) def setup_test_location(): test_dir = tempfile.mkdtemp() sys.path.insert(0,test_dir) return test_dir test_dir = setup_test_location() def teardown_test_location(): import tempfile test_dir = os.path.join(tempfile.gettempdir(),'test_files') if sys.path[0] == test_dir: sys.path = sys.path[1:] return test_dir if not msvc_exists(): for _n in dir(): if _n[:8] == 'TestMsvc': exec('del '+_n) else: for _n in dir(): if _n[:8] == 'TestUnix': exec('del '+_n) if not (gcc_exists() and msvc_exists() and sys.platform == 'win32'): for _n in dir(): if _n[:7] == 'TestGcc': exec('del '+_n) if __name__ == "__main__": run_module_suite()
{ "content_hash": "1a64037d5f5d22563ce0dfdb6a083b57", "timestamp": "", "source": "github", "line_count": 140, "max_line_length": 77, "avg_line_length": 28.107142857142858, "alnum_prop": 0.5519695044472681, "repo_name": "RobertABT/heightmap", "id": "2c19ce4f420cb886823caff0532e6014f7aba8a3", "size": "3935", "binary": false, "copies": "4", "ref": "refs/heads/master", "path": "build/scipy/scipy/weave/tests/test_numpy_scalar_spec.py", "mode": "33188", "license": "mit", "language": [ { "name": "C", "bytes": "25165856" }, { "name": "C++", "bytes": "5251754" }, { "name": "CSS", "bytes": "17123" }, { "name": "FORTRAN", "bytes": "6353469" }, { "name": "JavaScript", "bytes": "816504" }, { "name": "M", "bytes": "66" }, { "name": "Matlab", "bytes": "4280" }, { "name": "Objective-C", "bytes": "284551" }, { "name": "Python", "bytes": "13223936" }, { "name": "TeX", "bytes": "37261" } ], "symlink_target": "" }
from .elastic_first_recommender import ( article_recommendations_for_user, article_search_for_user )
{ "content_hash": "c0a89bbad7799d7199bf01fae6841e4a", "timestamp": "", "source": "github", "line_count": 4, "max_line_length": 40, "avg_line_length": 27.25, "alnum_prop": 0.7522935779816514, "repo_name": "mircealungu/Zeeguu-Core", "id": "58e76dd9c449932674b14144731d75e96f02babf", "size": "109", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "zeeguu_core/content_recommender/__init__.py", "mode": "33188", "license": "mit", "language": [ { "name": "Python", "bytes": "164762" }, { "name": "Shell", "bytes": "366" } ], "symlink_target": "" }
from setuptools import setup setup( name='ChannelWorm', version='0.1', packages=[ 'channelworm', 'channelworm.ion_channel', 'channelworm.digitizer', 'channelworm.account', 'channelworm.web_app', 'channelworm.fitter', 'channelworm.predictor' ], long_description=open('README.md').read(), install_requires=[ 'unicodecsv', 'pillow', 'pytest', 'pytest-django', 'django', 'django-formtools', 'django-sql-explorer', ] )
{ "content_hash": "ea048f0c12ec6e5912bba221513e6288", "timestamp": "", "source": "github", "line_count": 25, "max_line_length": 46, "avg_line_length": 22.2, "alnum_prop": 0.5477477477477477, "repo_name": "openworm/ChannelWorm", "id": "624a8dcbf18fb23745f924d767c4e52d8b72f44e", "size": "555", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "setup.py", "mode": "33261", "license": "mit", "language": [ { "name": "CSS", "bytes": "11459" }, { "name": "HTML", "bytes": "185500" }, { "name": "JavaScript", "bytes": "598029" }, { "name": "Jupyter Notebook", "bytes": "411940" }, { "name": "PLpgSQL", "bytes": "2505" }, { "name": "Python", "bytes": "252678" }, { "name": "Shell", "bytes": "2962" }, { "name": "TeX", "bytes": "13842" } ], "symlink_target": "" }
""" Report connected FTDI devices. This may be useful in obtaining serial numbers to use as the device_id parameter of the Device() constructor to communicate with a specific device when more than one is present. example usage: $ python pylibftdi/examples/list_devices.py FTDI:UB232R:FTAS1UN5 FTDI:UM232R USB <-> Serial:FTE4FFVQ To open a device specifically to communicate with the second of these devices, the following would be used: >>> from pylibftdi import Device >>> dev = Device(device_id="FTE4FFVQ") >>> Copyright (c) 2011-2014 Ben Bass <benbass@codedstructure.net> All rights reserved. """ from pylibftdi import Driver def get_ftdi_device_list(): """ return a list of lines, each a colon-separated vendor:product:serial summary of detected devices """ dev_list = [] for device in Driver().list_devices(): # list_devices returns bytes rather than strings dev_info = map(lambda x: x.decode('latin1'), device) # device must always be this triple vendor, product, serial = dev_info dev_list.append("%s:%s:%s" % (vendor, product, serial)) return dev_list if __name__ == '__main__': for device in get_ftdi_device_list(): print(device)
{ "content_hash": "3b1c0dde3ad2bd4b71c91b0305a78d51", "timestamp": "", "source": "github", "line_count": 43, "max_line_length": 64, "avg_line_length": 29.11627906976744, "alnum_prop": 0.6821086261980831, "repo_name": "claudyus/pylibftdi", "id": "7fbd9ce518ca995c0a0fcb0fe744966a70f0883e", "size": "1252", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "pylibftdi/examples/list_devices.py", "mode": "33188", "license": "mit", "language": [ { "name": "Python", "bytes": "71273" } ], "symlink_target": "" }
""" django_geopostcodes.managers ~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Django model managers for django-geopostcodes. """ from __future__ import absolute_import, print_function, unicode_literals from django.db.models import QuerySet from django.db.models.manager import Manager from django.contrib.gis.db import models class LocalityQuerySet(QuerySet): """ Locality QuerySet. """ anything_fields = ('country', 'region1', 'region2', 'region3', 'region4', 'locality', 'postcode', 'suburb') def anything(self, lookup_type, value, fields=anything_fields): queries = [models.Q(**{'%s__%s' % (field, lookup_type): value}) for field in fields] # Take one Q object from the list query = queries.pop() # Or the Q object with the ones remaining in the list for item in queries: query |= item return self.filter(query) def anything_icontains(self, value, fields=anything_fields): return self.anything('icontains', value, fields) def anything_contains(self, value, fields=anything_fields): return self.anything('contains', value, fields) def anything_exact(self, value, fields=anything_fields): return self.anything('exact', value, fields) def anything_iexact(self, value, fields=anything_fields): return self.anything('iexact', value, fields) def anything_startswith(self, value, fields=anything_fields): return self.anything('startswith', value, fields) def anything_istartswith(self, value, fields=anything_fields): return self.anything('istartswith', value, fields) def anything_endswith(self, value, fields=anything_fields): return self.anything('endswith', value, fields) def anything_iendswith(self, value, fields=anything_fields): return self.anything('iendswith', value, fields) class LocalityManager(Manager.from_queryset(LocalityQuerySet)): "Overrides Manager to return Geographic QuerySets." # This manager should be used for queries on related fields # so that geometry columns on Oracle and MySQL are selected # properly. use_for_related_fields = True
{ "content_hash": "2ccf4e7903d3b08ffb7399e176cdf092", "timestamp": "", "source": "github", "line_count": 65, "max_line_length": 92, "avg_line_length": 34.12307692307692, "alnum_prop": 0.6681695220919748, "repo_name": "alexhayes/django-geopostcodes", "id": "a0e0ad416c334b9107dbcad7f3984b03250da299", "size": "2242", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "django_geopostcodes/managers.py", "mode": "33188", "license": "mit", "language": [ { "name": "Makefile", "bytes": "2426" }, { "name": "Python", "bytes": "26750" } ], "symlink_target": "" }
import re import json from os import listdir class WD: def __init__(self): self.method = [] self.parse() self.writeOutput() def parse(self): self.method = [ WDMethod(f) for f in listdir('.') if re.match('^[a-zA-Z_].*\.json$', f) ] def writeOutput(self): wavedromSVH = open('wavedrom.svh', 'w') for m in self.method: wavedromSVH.write('`include "%s"\n' % m.ofile) m.writeOutput() wavedromSVH.close() class WDMethod: def __init__(self, ifile): self.ifile = ifile self.name = '' self.clk = '' self.signal = [] self.input = [] self.output = [] self.edge = [] self.edgeTypes = '[<>~\-|]+' self.rawData = {} self.parse() def parse(self): with open(self.ifile) as _input: self.rawData = json.load(_input) self.name = self.rawData['name'] self.ofile = self.name + '.svh' # clk is anything that matches 'p' in the wave (but only 1 is valid hence the [0]) self.clk = [ clk for clk in self.rawData['signal'] if re.match('p', clk['wave']) ][0] # signals are anything that don't match 'p' in the wave self.signal = [ signal for signal in self.rawData['signal'] if not re.match('p', signal['wave']) ] try: self.input = self.rawData['input'] except KeyError: pass try: self.output = self.rawData['output'] except KeyError: pass try: self.edge = self.rawData['edge'] except KeyError: pass def writeOutput(self): cycles = [] ofile = open(self.ofile, 'w') # header if len(self.input) + len(self.output) > 0: if len(self.input) > 0: io = [ "input %s %s" % (_input['type'], _input['name']) for _input in self.input ] if len(self.output) > 0: io += [ "output %s %s" % (_output['type'], _output['name']) for _output in self.output ] cycles.append('task %s(%s);\n' % (self.name, ', '.join(io))) else: cycles.append('task %s();\n' % self.name) # build each clock cycle for i in range( 0, len(self.clk['wave']) ): thisCycle = '' waitThisCycle = self.isWait(self.clk['wave'][i]) waitLastCycle = self.isWait(self.clk['wave'][i-1]) waitBothCycles = waitThisCycle and waitLastCycle waitNeitherCycle = not (waitThisCycle or waitLastCycle) if not (waitThisCycle or waitLastCycle): thisCycle += self.step() thisCycle += self.writeSignals(i) elif waitThisCycle and not waitLastCycle: thisCycle += self.getWaitFor(i) elif waitLastCycle and not waitThisCycle: thisCycle += self.writeSignals(i) elif waitLastCycle and waitThisCycle: thisCycle += self.writeSignals(i) thisCycle += self.getWaitFor(i) thisCycle += self.captureOutputs(i) if thisCycle != '': cycles.append(thisCycle) # footer cycles.append('endtask') ofile.write(''.join(cycles)) ofile.close() def writeSignals(self, idx): _thisCycle = '' # if a signal has a new value for this cycle, assign it for s in self.signal: if 'input' in s and s['input']: break else: if self.isBinary(s['wave'][idx]): _thisCycle += " %s = 'h%s;\n" % (s['name'], s['wave'][idx]) elif self.isValue(s['wave'][idx]): _thisCycle += " %s = %s;\n" % (s['name'], s['data'].pop(0)) return _thisCycle def captureOutputs(self, idx): _thisCycle = '' for s in self.signal: if 'output' in s and s['output']: if self.isValue(s['wave'][idx-1]): _thisCycle += " %s = %s;\n" % (s['data'].pop(0), s['name']) return _thisCycle def isBinary(self, value): return value in [ "0", "1", "x", "X" ] def isValue(self, value): return value in [ "=" ] def isWait(self, value): return value in [ "|" ] def step(self, num='1', loop='repeat'): step = '' step += '%sstep();\n' % (' ' * (1 + int(num != '1'))) step += '%snextSamplePoint();\n' % (' ' * (1 + int(num != '1'))) if num != '1': step = ' %s (%s) begin\n' % (loop, num) + step + ' end\n' return step def getWaitFor(self, nodeIdx): cond = [ e for e in self.edge if re.match('.%s%s' % (self.edgeTypes, self.clk['node'][nodeIdx+1]), e) ][0] cond = re.sub('.* ', '', cond) if self.clk['node'][nodeIdx] == '.': return self.step("!(%s)" % cond, 'while') else: return self.step("$urandom_range(%s)" % cond) if __name__ == "__main__": print ("Info: Writing wavedrom output.") wd = WD()
{ "content_hash": "72f1bc97871549db2cdbd471c9f2f856", "timestamp": "", "source": "github", "line_count": 171, "max_line_length": 114, "avg_line_length": 29.900584795321638, "alnum_prop": 0.4971640915313906, "repo_name": "nosnhojn/svunit-code", "id": "3d2a444a2de55e55c80f9200e0c8ae4772fed81d", "size": "5865", "binary": false, "copies": "4", "ref": "refs/heads/master", "path": "bin/wavedromSVUnit.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Coq", "bytes": "63" }, { "name": "Filebench WML", "bytes": "160" }, { "name": "Forth", "bytes": "301" }, { "name": "Perl", "bytes": "48525" }, { "name": "Python", "bytes": "40075" }, { "name": "Shell", "bytes": "3528" }, { "name": "SystemVerilog", "bytes": "127033" }, { "name": "VHDL", "bytes": "190" } ], "symlink_target": "" }
""" Presubmit script for the printing backend. See https://dev.chromium.org/developers/how-tos/depottools/presubmit-scripts for more details about the presubmit API. """ USE_PYTHON3 = True def _CheckForStringViewFromNullableIppApi(input_api, output_api): """ Looks for all affected lines in CL where one constructs either base::StringPiece or std::string_view from any ipp*() CUPS API call. Assumes over-broadly that all ipp*() calls can return NULL. Returns affected lines as a list of presubmit errors. """ # Attempts to detect source lines like: # * base::StringPiece foo = ippDoBar(); # * base::StringPiece foo(ippDoBar()); # and the same for std::string_view. string_view_re = input_api.re.compile( r"^.+(base::StringPiece|std::string_view)\s+\w+( = |\()ipp[A-Z].+$") violations = input_api.canned_checks._FindNewViolationsOfRule( lambda extension, line: not (extension in ("cc", "h") and string_view_re.search(line)), input_api, None) bulleted_violations = [" * {}".format(entry) for entry in violations] if bulleted_violations: return [output_api.PresubmitError( ("Possible construction of base::StringPiece or std::string_view " "from CUPS IPP API (that can probably return NULL):\n{}").format( "\n".join(bulleted_violations))),] return [] def _CommonChecks(input_api, output_api): """Actual implementation of presubmits for the printing backend.""" results = [] results.extend(_CheckForStringViewFromNullableIppApi(input_api, output_api)) return results def CheckChangeOnUpload(input_api, output_api): """Mandatory presubmit entry point.""" return _CommonChecks(input_api, output_api) def CheckChangeOnCommit(input_api, output_api): """Mandatory presubmit entry point.""" return _CommonChecks(input_api, output_api)
{ "content_hash": "4e2d3ee55416eff369aa2c3b6a90c57d", "timestamp": "", "source": "github", "line_count": 48, "max_line_length": 78, "avg_line_length": 38.395833333333336, "alnum_prop": 0.7037438958220293, "repo_name": "ric2b/Vivaldi-browser", "id": "4ef6bceedf30a869c3ea715ebdf95b0da599d0ce", "size": "2006", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "chromium/printing/backend/PRESUBMIT.py", "mode": "33188", "license": "bsd-3-clause", "language": [], "symlink_target": "" }
from django.template.loaders import app_directories, filesystem from django.template.base import TemplateDoesNotExist from django.template.loader import make_origin from django.conf import settings from rhinocloud.template.openoffice import OpenOfficeTemplate import zipfile def read_openoffice(filepath): files = zipfile.ZipFile(filepath, 'r') try: return files.read('content.xml') finally: files.close() class AppDirectoriesLoader(app_directories.Loader): def load_template_source(self, template_name, template_dirs=None): for filepath in self.get_template_sources(template_name, template_dirs): if zipfile.is_zipfile(filepath): pass try: file = open(filepath) try: return (file.read().decode(settings.FILE_CHARSET), filepath) finally: file.close() except IOError: pass raise TemplateDoesNotExist(template_name) class FileSystemLoader(filesystem.Loader): def load_template_source(self, template_name, template_dirs=None): tried = [] for filepath in self.get_template_sources(template_name, template_dirs): if zipfile.is_zipfile(filepath): try: return (read_openoffice(filepath), filepath) finally: files.close() tried.append(filepath) if tried: error_msg = "Tried %s" % tried else: error_msg = "Your TEMPLATE_DIRS setting is empty. Change it to point to at least one template directory." raise TemplateDoesNotExist(error_msg) def load_template(self, template_name, template_dirs=None): source, display_name = self.load_template_source(template_name, template_dirs) origin = make_origin(display_name, self.load_template_source, template_name, template_dirs) try: return OpenOfficeTemplate(source, origin, filepath=display_name), None except TemplateDoesNotExist: # If compiling the template we found raises TemplateDoesNotExist, back off to # returning the source and display name for the template we were asked to load. # This allows for correct identification (later) of the actual template that does # not exist. return source, display_name
{ "content_hash": "b4f1b30fc1aeeb514054d3c60ca85779", "timestamp": "", "source": "github", "line_count": 60, "max_line_length": 117, "avg_line_length": 41.21666666666667, "alnum_prop": 0.63040841083704, "repo_name": "allanlei/rhinocloud-utils", "id": "2a29aca4f35ce7f21b99707089983ef3939fb2df", "size": "2473", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "rhinocloud/template/loaders/openoffice.py", "mode": "33188", "license": "bsd-3-clause", "language": [ { "name": "Python", "bytes": "104927" } ], "symlink_target": "" }
from __future__ import print_function, division, absolute_import import os import sys from nose.tools import raises from cutadapt.scripts import cutadapt from .utils import run, files_equal, datapath, cutpath, redirect_stderr, temporary_path def test_example(): run('-N -b ADAPTER', 'example.fa', 'example.fa') def test_small(): run('-b TTAGACATATCTCCGTCG', 'small.fastq', 'small.fastq') def test_empty(): '''empty input''' run('-a TTAGACATATCTCCGTCG', 'empty.fastq', 'empty.fastq') def test_newlines(): '''DOS/Windows newlines''' run('-e 0.12 -b TTAGACATATCTCCGTCG', 'dos.fastq', 'dos.fastq') def test_lowercase(): '''lowercase adapter''' run('-b ttagacatatctccgtcg', 'lowercase.fastq', 'small.fastq') def test_rest(): '''-r/--rest-file''' with temporary_path('rest.tmp') as rest_tmp: run(['-b', 'ADAPTER', '-N', '-r', rest_tmp], "rest.fa", "rest.fa") assert files_equal(datapath('rest.txt'), rest_tmp) def test_restfront(): with temporary_path("rest.txt") as path: run(['-g', 'ADAPTER', '-N', '-r', path], "restfront.fa", "rest.fa") assert files_equal(datapath('restfront.txt'), path) def test_discard(): '''--discard''' run("-b TTAGACATATCTCCGTCG --discard", "discard.fastq", "small.fastq") def test_discard_untrimmed(): '''--discard-untrimmed''' run('-b CAAGAT --discard-untrimmed', 'discard-untrimmed.fastq', 'small.fastq') def test_plus(): '''test if sequence name after the "+" is retained''' run("-e 0.12 -b TTAGACATATCTCCGTCG", "plus.fastq", "plus.fastq") def test_extensiontxtgz(): '''automatic recognition of "_sequence.txt.gz" extension''' run("-b TTAGACATATCTCCGTCG", "s_1_sequence.txt", "s_1_sequence.txt.gz") def test_format(): '''the -f/--format parameter''' run("-f fastq -b TTAGACATATCTCCGTCG", "small.fastq", "small.myownextension") def test_minimum_length(): '''-m/--minimum-length''' run("-c -m 5 -a 330201030313112312", "minlen.fa", "lengths.fa") def test_too_short(): '''--too-short-output''' run("-c -m 5 -a 330201030313112312 --too-short-output tooshort.tmp.fa", "minlen.fa", "lengths.fa") assert files_equal(datapath('tooshort.fa'), "tooshort.tmp.fa") os.remove('tooshort.tmp.fa') def test_too_short_no_primer(): '''--too-short-output and --trim-primer''' run("-c -m 5 -a 330201030313112312 --trim-primer --too-short-output tooshort.tmp.fa", "minlen.noprimer.fa", "lengths.fa") assert files_equal(datapath('tooshort.noprimer.fa'), "tooshort.tmp.fa") os.remove('tooshort.tmp.fa') def test_maximum_length(): '''-M/--maximum-length''' run("-c -M 5 -a 330201030313112312", "maxlen.fa", "lengths.fa") def test_too_long(): '''--too-long-output''' run("-c -M 5 --too-long-output toolong.tmp.fa -a 330201030313112312", "maxlen.fa", "lengths.fa") assert files_equal(datapath('toolong.fa'), "toolong.tmp.fa") os.remove('toolong.tmp.fa') def test_length_tag(): '''454 data; -n and --length-tag''' run("-n 3 -e 0.1 --length-tag length= " \ "-b TGAGACACGCAACAGGGGAAAGGCAAGGCACACAGGGGATAGG "\ "-b TCCATCTCATCCCTGCGTGTCCCATCTGTTCCCTCCCTGTCTCA", '454.fa', '454.fa') def test_overlap_a(): '''-O/--overlap with -a (-c omitted on purpose)''' run("-O 10 -a 330201030313112312 -e 0.0 -N", "overlapa.fa", "overlapa.fa") def test_overlap_b(): '''-O/--overlap with -b''' run("-O 10 -b TTAGACATATCTCCGTCG -N", "overlapb.fa", "overlapb.fa") def test_qualtrim(): '''-q with low qualities''' run("-q 10 -a XXXXXX", "lowqual.fastq", "lowqual.fastq") def test_qualbase(): '''-q with low qualities, using ascii(quality+64) encoding''' run("-q 10 --quality-base 64 -a XXXXXX", "illumina64.fastq", "illumina64.fastq") def test_quality_trim_only(): '''only trim qualities, do not remove adapters''' run("-q 10 --quality-base 64", "illumina64.fastq", "illumina64.fastq") def test_twoadapters(): '''two adapters''' run("-a AATTTCAGGAATT -a GTTCTCTAGTTCT", "twoadapters.fasta", "twoadapters.fasta") def test_polya(): '''poly-A tails''' run("-m 24 -O 10 -a AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA", "polya.fasta", "polya.fasta") def test_polya_brace_notation(): '''poly-A tails''' run("-m 24 -O 10 -a A{35}", "polya.fasta", "polya.fasta") def test_mask_adapter(): '''mask adapter with N (reads maintain the same length)''' run("-b CAAG -n 3 --mask-adapter", "anywhere_repeat.fastq", "anywhere_repeat.fastq") def test_gz_multiblock(): '''compressed gz file with multiple blocks (created by concatenating two .gz files)''' run("-b TTAGACATATCTCCGTCG", "small.fastq", "multiblock.fastq.gz") def test_suffix(): '''-y/--suffix parameter, combined with _F3''' run("-c -e 0.12 -a 1=330201030313112312 -y _my_suffix_{name} --strip-f3", "suffix.fastq", "solid.csfasta", 'solid.qual') def test_read_wildcard(): '''test wildcards in reads''' run("--match-read-wildcards -b ACGTACGT", "wildcard.fa", "wildcard.fa") def test_adapter_wildcard(): '''wildcards in adapter''' for adapter_type, expected in ( ("-a", "wildcard_adapter.fa"), ("-b", "wildcard_adapter_anywhere.fa")): with temporary_path("wildcardtmp.txt") as wildcardtmp: run("--wildcard-file {0} {1} ACGTNNNACGT".format(wildcardtmp, adapter_type), expected, "wildcard_adapter.fa") with open(wildcardtmp) as wct: lines = wct.readlines() lines = [ line.strip() for line in lines ] assert lines == ['AAA 1', 'GGG 2', 'CCC 3b', 'TTT 4b'] def test_wildcard_N(): '''test 'N' wildcard matching with no allowed errors''' run("-e 0 -a GGGGGGG --match-read-wildcards", "wildcardN.fa", "wildcardN.fa") def test_illumina_adapter_wildcard(): run("-a VCCGAMCYUCKHRKDCUBBCNUWNSGHCGU", "illumina.fastq", "illumina.fastq.gz") def test_adapter_front(): '''test adapter in front''' run("--front ADAPTER -N", "examplefront.fa", "example.fa") def test_literal_N(): '''test matching literal 'N's''' run("-N -e 0.2 -a NNNNNNNNNNNNNN", "trimN3.fasta", "trimN3.fasta") def test_literal_N2(): run("-N -O 1 -g NNNNNNNNNNNNNN", "trimN5.fasta", "trimN5.fasta") def test_literal_N_brace_notation(): '''test matching literal 'N's''' run("-N -e 0.2 -a N{14}", "trimN3.fasta", "trimN3.fasta") def test_literal_N2_brace_notation(): run("-N -O 1 -g N{14}", "trimN5.fasta", "trimN5.fasta") def test_anchored_front(): run("-g ^FRONTADAPT -N", "anchored.fasta", "anchored.fasta") def test_anchored_front_ellipsis_notation(): run("-a FRONTADAPT... -N", "anchored.fasta", "anchored.fasta") def test_anchored_back(): run("-a BACKADAPTER$ -N", "anchored-back.fasta", "anchored-back.fasta") def test_anchored_back_no_indels(): run("-a BACKADAPTER$ -N --no-indels", "anchored-back.fasta", "anchored-back.fasta") def test_no_indels(): run('-a TTAGACATAT -g GAGATTGCCA --no-indels', 'no_indels.fasta', 'no_indels.fasta') def test_issue_46(): '''issue 46 - IndexError with --wildcard-file''' with temporary_path("wildcardtmp.txt") as wildcardtmp: run("--anywhere=AACGTN --wildcard-file={0}".format(wildcardtmp), "issue46.fasta", "issue46.fasta") def test_strip_suffix(): run("--strip-suffix _sequence -a XXXXXXX", "stripped.fasta", "simple.fasta") def test_info_file(): # The true adapter sequence in the illumina.fastq.gz data set is # GCCTAACTTCTTAGACTGCCTTAAGGACGT (fourth base is different) # with temporary_path("infotmp.txt") as infotmp: run(["--info-file", infotmp, '-a', 'adapt=GCCGAACTTCTTAGACTGCCTTAAGGACGT'], "illumina.fastq", "illumina.fastq.gz") assert files_equal(cutpath('illumina.info.txt'), infotmp) def test_info_file_times(): with temporary_path("infotmp.txt") as infotmp: run(["--info-file", infotmp, '--times', '2', '-a', 'adapt=GCCGAACTTCTTA', '-a', 'adapt2=GACTGCCTTAAGGACGT'], "illumina5.fastq", "illumina5.fastq") assert files_equal(cutpath('illumina5.info.txt'), infotmp) def test_info_file_fasta(): with temporary_path("infotmp.txt") as infotmp: # Just make sure that it runs run(['--info-file', infotmp, '-a', 'TTAGACATAT', '-g', 'GAGATTGCCA', '--no-indels'], 'no_indels.fasta', 'no_indels.fasta') def test_named_adapter(): run("-a MY_ADAPTER=GCCGAACTTCTTAGACTGCCTTAAGGACGT", "illumina.fastq", "illumina.fastq.gz") def test_adapter_with_U(): run("-a GCCGAACUUCUUAGACUGCCUUAAGGACGU", "illumina.fastq", "illumina.fastq.gz") def test_no_trim(): ''' --no-trim ''' run("--no-trim --discard-untrimmed -a CCCTAGTTAAAC", 'no-trim.fastq', 'small.fastq') def test_bzip2(): '''test bzip2 support''' run('-b TTAGACATATCTCCGTCG', 'small.fastq', 'small.fastq.bz2') try: import lzma def test_xz(): '''test xz support''' run('-b TTAGACATATCTCCGTCG', 'small.fastq', 'small.fastq.xz') except ImportError: pass @raises(SystemExit) def test_qualfile_only(): with redirect_stderr(): cutadapt.main(['file.qual']) @raises(SystemExit) def test_no_args(): with redirect_stderr(): cutadapt.main([]) @raises(SystemExit) def test_two_fastqs(): with redirect_stderr(): cutadapt.main([datapath('paired.1.fastq'), datapath('paired.2.fastq')]) def test_anchored_no_indels(): '''anchored 5' adapter, mismatches only (no indels)''' run('-g ^TTAGACATAT --no-indels -e 0.1', 'anchored_no_indels.fasta', 'anchored_no_indels.fasta') def test_anchored_no_indels_wildcard_read(): '''anchored 5' adapter, mismatches only (no indels), but wildcards in the read count as matches''' run('-g ^TTAGACATAT --match-read-wildcards --no-indels -e 0.1', 'anchored_no_indels_wildcard.fasta', 'anchored_no_indels.fasta') def test_anchored_no_indels_wildcard_adapt(): '''anchored 5' adapter, mismatches only (no indels), but wildcards in the adapter count as matches''' run('-g ^TTAGACANAT --no-indels -e 0.1', 'anchored_no_indels.fasta', 'anchored_no_indels.fasta') def test_unconditional_cut_front(): run('-u 5', 'unconditional-front.fastq', 'small.fastq') def test_unconditional_cut_back(): run('-u -5', 'unconditional-back.fastq', 'small.fastq') def test_unconditional_cut_both(): run('-u -5 -u 5', 'unconditional-both.fastq', 'small.fastq') def test_untrimmed_output(): with temporary_path('untrimmed.tmp.fastq') as tmp: run(['-a', 'TTAGACATATCTCCGTCG', '--untrimmed-output', tmp], 'small.trimmed.fastq', 'small.fastq') assert files_equal(cutpath('small.untrimmed.fastq'), tmp) def test_adapter_file(): run('-a file:' + datapath('adapter.fasta'), 'illumina.fastq', 'illumina.fastq.gz') def test_adapter_file_5p_anchored(): run('-N -g file:' + datapath('prefix-adapter.fasta'), 'anchored.fasta', 'anchored.fasta') def test_adapter_file_3p_anchored(): run('-N -a file:' + datapath('suffix-adapter.fasta'), 'anchored-back.fasta', 'anchored-back.fasta') def test_adapter_file_5p_anchored_no_indels(): run('-N --no-indels -g file:' + datapath('prefix-adapter.fasta'), 'anchored.fasta', 'anchored.fasta') def test_adapter_file_3p_anchored_no_indels(): run('-N --no-indels -a file:' + datapath('suffix-adapter.fasta'), 'anchored-back.fasta', 'anchored-back.fasta') def test_demultiplex(): multiout = os.path.join(os.path.dirname(__file__), 'data', 'tmp-demulti.{name}.fasta') params = ['-a', 'first=AATTTCAGGAATT', '-a', 'second=GTTCTCTAGTTCT', '-o', multiout, datapath('twoadapters.fasta')] assert cutadapt.main(params) is None assert files_equal(cutpath('twoadapters.first.fasta'), multiout.format(name='first')) assert files_equal(cutpath('twoadapters.second.fasta'), multiout.format(name='second')) assert files_equal(cutpath('twoadapters.unknown.fasta'), multiout.format(name='unknown')) os.remove(multiout.format(name='first')) os.remove(multiout.format(name='second')) os.remove(multiout.format(name='unknown')) def test_max_n(): run('--max-n 0', 'maxn0.fasta', 'maxn.fasta') run('--max-n 1', 'maxn1.fasta', 'maxn.fasta') run('--max-n 2', 'maxn2.fasta', 'maxn.fasta') run('--max-n 0.2', 'maxn0.2.fasta', 'maxn.fasta') run('--max-n 0.4', 'maxn0.4.fasta', 'maxn.fasta')
{ "content_hash": "a547280209226b70f87910a1aca0c79d", "timestamp": "", "source": "github", "line_count": 351, "max_line_length": 148, "avg_line_length": 33.45014245014245, "alnum_prop": 0.6816284813900009, "repo_name": "Chris7/cutadapt", "id": "34b3c1ab7af3ec9515ccdf8f3d771b1c53ccdee9", "size": "11831", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "tests/tests.py", "mode": "33188", "license": "mit", "language": [ { "name": "Python", "bytes": "178037" } ], "symlink_target": "" }
import copy import datetime from django.contrib.auth.models import User from django.db import models from django.db.models.query import Q from django.utils.datastructures import SortedDict class RevisionableModel(models.Model): base = models.ForeignKey('self', null=True) title = models.CharField(blank=True, max_length=255) when = models.DateTimeField(default=datetime.datetime.now) def __unicode__(self): return u"%s (%s, %s)" % (self.title, self.id, self.base.id) def save(self, force_insert=False, force_update=False): super(RevisionableModel, self).save(force_insert, force_update) if not self.base: self.base = self super(RevisionableModel, self).save() def new_revision(self): new_revision = copy.copy(self) new_revision.pk = None return new_revision class Order(models.Model): created_by = models.ForeignKey(User) text = models.TextField() __test__ = {"API_TESTS": """ # Regression tests for #7314 and #7372 >>> rm = RevisionableModel.objects.create(title='First Revision', when=datetime.datetime(2008, 9, 28, 10, 30, 0)) >>> rm.pk, rm.base.pk (1, 1) >>> rm2 = rm.new_revision() >>> rm2.title = "Second Revision" >>> rm.when = datetime.datetime(2008, 9, 28, 14, 25, 0) >>> rm2.save() >>> print u"%s of %s" % (rm2.title, rm2.base.title) Second Revision of First Revision >>> rm2.pk, rm2.base.pk (2, 1) Queryset to match most recent revision: >>> qs = RevisionableModel.objects.extra(where=["%(table)s.id IN (SELECT MAX(rev.id) FROM %(table)s rev GROUP BY rev.base_id)" % {'table': RevisionableModel._meta.db_table,}],) >>> qs [<RevisionableModel: Second Revision (2, 1)>] Queryset to search for string in title: >>> qs2 = RevisionableModel.objects.filter(title__contains="Revision") >>> qs2 [<RevisionableModel: First Revision (1, 1)>, <RevisionableModel: Second Revision (2, 1)>] Following queryset should return the most recent revision: >>> qs & qs2 [<RevisionableModel: Second Revision (2, 1)>] >>> u = User.objects.create_user(username="fred", password="secret", email="fred@example.com") # General regression tests: extra select parameters should stay tied to their # corresponding select portions. Applies when portions are updated or otherwise # moved around. >>> qs = User.objects.extra(select=SortedDict((("alpha", "%s"), ("beta", "2"), ("gamma", "%s"))), select_params=(1, 3)) >>> qs = qs.extra(select={"beta": 4}) >>> qs = qs.extra(select={"alpha": "%s"}, select_params=[5]) >>> result = {'alpha': 5, 'beta': 4, 'gamma': 3} >>> list(qs.filter(id=u.id).values('alpha', 'beta', 'gamma')) == [result] True # Regression test for #7957: Combining extra() calls should leave the # corresponding parameters associated with the right extra() bit. I.e. internal # dictionary must remain sorted. >>> User.objects.extra(select={"alpha": "%s"}, select_params=(1,)).extra(select={"beta": "%s"}, select_params=(2,))[0].alpha 1 >>> User.objects.extra(select={"beta": "%s"}, select_params=(1,)).extra(select={"alpha": "%s"}, select_params=(2,))[0].alpha 2 # Regression test for #7961: When not using a portion of an extra(...) in a # query, remove any corresponding parameters from the query as well. >>> list(User.objects.extra(select={"alpha": "%s"}, select_params=(-6,)).filter(id=u.id).values_list('id', flat=True)) == [u.id] True # Regression test for #8063: limiting a query shouldn't discard any extra() # bits. >>> qs = User.objects.all().extra(where=['id=%s'], params=[u.id]) >>> qs [<User: fred>] >>> qs[:1] [<User: fred>] # Regression test for #8039: Ordering sometimes removed relevant tables from # extra(). This test is the critical case: ordering uses a table, but then # removes the reference because of an optimisation. The table should still be # present because of the extra() call. >>> Order.objects.extra(where=["username=%s"], params=["fred"], tables=["auth_user"]).order_by('created_by') [] # Regression test for #8819: Fields in the extra(select=...) list should be # available to extra(order_by=...). >>> User.objects.filter(pk=u.id).extra(select={'extra_field': 1}).distinct() [<User: fred>] >>> User.objects.filter(pk=u.id).extra(select={'extra_field': 1}, order_by=['extra_field']) [<User: fred>] >>> User.objects.filter(pk=u.id).extra(select={'extra_field': 1}, order_by=['extra_field']).distinct() [<User: fred>] # When calling the dates() method on a queryset with extra selection columns, # we can (and should) ignore those columns. They don't change the result and # cause incorrect SQL to be produced otherwise. >>> RevisionableModel.objects.extra(select={"the_answer": 'id'}).dates('when', 'month') [datetime.datetime(2008, 9, 1, 0, 0)] """}
{ "content_hash": "4a219004a6b365b59b8c85094b805241", "timestamp": "", "source": "github", "line_count": 118, "max_line_length": 176, "avg_line_length": 39.88135593220339, "alnum_prop": 0.6784955376115597, "repo_name": "weigj/django-multidb", "id": "680917b8ae5c11668642d1970fe7169a05d3e192", "size": "4706", "binary": false, "copies": "3", "ref": "refs/heads/master", "path": "tests/regressiontests/extra_regress/models.py", "mode": "33188", "license": "bsd-3-clause", "language": [ { "name": "JavaScript", "bytes": "77034" }, { "name": "Python", "bytes": "4173202" }, { "name": "Shell", "bytes": "804" } ], "symlink_target": "" }
# Permission is hereby granted, free of charge, to any person obtaining a # copy of this data, including any software or models in source or binary # form, as well as any drawings, specifications, and documentation # (collectively "the Data"), to deal in the Data without restriction, # including without limitation the rights to use, copy, modify, merge, # publish, distribute, sublicense, and/or sell copies of the Data, and to # permit persons to whom the Data is furnished to do so, subject to the # following conditions: # The above copyright notice and this permission notice shall be included # in all copies or substantial portions of the Data. # THE DATA IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL # THE AUTHORS, SPONSORS, DEVELOPERS, CONTRIBUTORS, OR COPYRIGHT HOLDERS BE # LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION # OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION # WITH THE DATA OR THE USE OR OTHER DEALINGS IN THE DATA. # ======================= # This version of the META tools is a fork of an original version produced # by Vanderbilt University's Institute for Software Integrated Systems (ISIS). # Their license statement: # Copyright (C) 2011-2014 Vanderbilt University # Developed with the sponsorship of the Defense Advanced Research Projects # Agency (DARPA) and delivered to the U.S. Government with Unlimited Rights # as defined in DFARS 252.227-7013. # Permission is hereby granted, free of charge, to any person obtaining a # copy of this data, including any software or models in source or binary # form, as well as any drawings, specifications, and documentation # (collectively "the Data"), to deal in the Data without restriction, # including without limitation the rights to use, copy, modify, merge, # publish, distribute, sublicense, and/or sell copies of the Data, and to # permit persons to whom the Data is furnished to do so, subject to the # following conditions: # The above copyright notice and this permission notice shall be included # in all copies or substantial portions of the Data. # THE DATA IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL # THE AUTHORS, SPONSORS, DEVELOPERS, CONTRIBUTORS, OR COPYRIGHT HOLDERS BE # LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION # OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION # WITH THE DATA OR THE USE OR OTHER DEALINGS IN THE DATA. #!/usr/bin/env python __author__ = 'Zsolt Lattmann' __copyright__ = 'Copyright (C) 2013 Vanderbilt University' __license__ = """ Copyright (C) 2013 Vanderbilt University Permission is hereby granted, free of charge, to any person obtaining a copy of this data, including any software or models in source or binary form, as well as any drawings, specifications, and documentation (collectively "the Data"), to deal in the Data without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Data, and to permit persons to whom the Data is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Data. THE DATA IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS, SPONSORS, DEVELOPERS, CONTRIBUTORS, OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE DATA OR THE USE OR OTHER DEALINGS IN THE DATA. """ __status__ = "Prototype" __maintainer__ = "https://openmodelica.org" import os import re import math import uuid import json import logging import sys from optparse import OptionParser import svgwrite import OMPython # OpenModelica setup commands OMC_SETUP_COMMANDS = ['setCommandLineOptions("+d=nogen,noevalfunc")'] # Bitmap # extends GraphicItem # extent # fileName # imageSource regex_equal_key_value = re.compile("([^ =]+) *= *(\"[^\"]*\"|[^ ]*)") regex_points = re.compile("{([+-]?\d+(?:.\d+)?), ([+-]?\d+(?:.\d+)?)}") regex_type_value = re.compile("(\w+.\w+)*") # Compile regular expressions ONLY once! # example: {-100.0,-100.0,100.0,100.0,true,0.16,2.0,2.0, {... regex_coordSys = re.compile('([+-]?\d+(?:.\d+)?),([+-]?\d+(?:.\d+)?),([+-]?\d+(?:.\d+)?),([+-]?\d+(?:.\d+)?),(\w+),([+-]?\d+(?:.\d+)?),([+-]?\d+(?:.\d+)?),([+-]?\d+(?:.\d+)?),') # example: Rectangle(true, {35.0, 10.0}, 0, {0, 0, 0}, {255, 255, 255}, LinePattern.Solid, FillPattern.Solid, 0.25, BorderPattern.None, {{-15.0, -4.0}, {15.0, 4.0}}, 0 regex_rectangle = re.compile('Rectangle\((\w+), {([+-]?\d+(?:.\d+)?), ([+-]?\d+(?:.\d+)?)}, ([+-]?\d+(?:.\d+)?), {(\d+), (\d+), (\d+)}, {(\d+), (\d+), (\d+)}, (\w+.\w+), (\w+.\w+), ([+-]?\d+(?:.\d+)?), (\w+.\w+), {{([+-]?\d+(?:.\d+)?), ([+-]?\d+(?:.\d+)?)}, {([+-]?\d+(?:.\d+)?), ([+-]?\d+(?:.\d+)?)}}, ([+-]?\d+(?:.\d+)?)') # example: Line(true, {0.0, 0.0}, 0, {{-30, -120}, {-10, -100}}, {0, 0, 0}, LinePattern.Solid, 0.25, {Arrow.None, Arrow.None}, 3, Smooth.None regex_line = re.compile('Line\((\w+), {([+-]?\d+(?:.\d+)?), ([+-]?\d+(?:.\d+)?)}, ([+-]?\d+(?:.\d+)?), ({{[+-]?\d+(?:.\d+)?, [+-]?\d+(?:.\d+)?}(?:, {[+-]?\d+(?:.\d+)?, [+-]?\d+(?:.\d+)?})*}), {(\d+), (\d+), (\d+)}, (\w+.\w+), ([+-]?\d+(?:.\d+)?), {(\w+.\w+), (\w+.\w+)}, ([+-]?\d+(?:.\d+)?), (\w+.\w+)') # example: Ellipse(true, {0.0, 0.0}, 0, {0, 0, 0}, {95, 95, 95}, LinePattern.Solid, FillPattern.Solid, 0.25, {{-100, 100}, {100, -100}}, 0, 360)}} regex_ellipse = re.compile('Ellipse\((\w+), {([+-]?\d+(?:.\d+)?), ([+-]?\d+(?:.\d+)?)}, ([+-]?\d+(?:.\d+)?), {(\d+), (\d+), (\d+)}, {(\d+), (\d+), (\d+)}, (\w+.\w+), (\w+.\w+), ([+-]?\d+(?:.\d+)?), {{([+-]?\d+(?:.\d+)?), ([+-]?\d+(?:.\d+)?)}, {([+-]?\d+(?:.\d+)?), ([+-]?\d+(?:.\d+)?)}}, ([+-]?\d+(?:.\d+)?), ([+-]?\d+(?:.\d+)?)') # example: Text(true, {0.0, 0.0}, 0, {0, 0, 255}, {0, 0, 0}, LinePattern.Solid, FillPattern.None, 0.25, {{-150, 110}, {150, 70}}, "%name", 0, TextAlignment.Center regex_text = re.compile('Text\((\w+), {([+-]?\d+(?:.\d+)?), ([+-]?\d+(?:.\d+)?)}, ([+-]?\d+(?:.\d+)?), {(\d+), (\d+), (\d+)}, {(\d+), (\d+), (\d+)}, (\w+.\w+), (\w+.\w+), ([+-]?\d+(?:.\d+)?), {{([+-]?\d+(?:.\d+)?), ([+-]?\d+(?:.\d+)?)}, {([+-]?\d+(?:.\d+)?), ([+-]?\d+(?:.\d+)?)}}, ("[^"]*"), ([+-]?\d+(?:.\d+)?)(?:, ("[^"]*"))?(?:, {([^}]*)})?, (\w+.\w+)') # example: Polygon(true, {0.0, 0.0}, 0, {0, 127, 255}, {0, 127, 255}, LinePattern.Solid, FillPattern.Solid, 0.25, {{-24, -34}, {-82, 40}, {-72, 46}, {-14, -26}, {-24, -34}}, Smooth.None regex_polygon = re.compile('Polygon\((\w+), {([+-]?\d+(?:.\d+)?), ([+-]?\d+(?:.\d+)?)}, ([+-]?\d+(?:.\d+)?), {(\d+), (\d+), (\d+)}, {(\d+), (\d+), (\d+)}, (\w+.\w+), (\w+.\w+), ([+-]?\d+(?:.\d+)?), ({{[+-]?\d+(?:.\d+)?, [+-]?\d+(?:.\d+)?}(?:, {[+-]?\d+(?:.\d+)?, [+-]?\d+(?:.\d+)?})*}), (\w+.\w+)') # example: {{-100.0, -100.0}, {-100.0, -30.0}, {0.0, -30.0}, {0.0, 0.0}} regex_points = re.compile('{([+-]?\d+(?:.\d+)?), ([+-]?\d+(?:.\d+)?)}') # example: Bitmap(true, {0.0, 0.0}, 0, {{-98, 98}, {98, -98}}, "modelica://Modelica/Resources/Images/Mechanics/MultiBody/Visualizers/TorusIcon.png" # TODO: where is the imageSource? # def __ask_omc(question, opt=None, parsed=True): # p = (question, opt, parsed) # if p in omc_cache: # return omc_cache[p] # # if opt: # expression = question + '(' + opt + ')' # else: # expression = question # # logger.debug('ask_omc: {0} - parsed: {1}'.format(expression, parsed)) # # try: # if parsed: # res = OMPython.execute(expression) # else: # res = OMPython.omc.sendExpression(expression) # except Exception as e: # logger.error("OMC failed: {0}, {1}, parsed={2}".format(question, opt, parsed)) # raise e # # omc_cache[p] = res # # return res omc_cache = {} graphics_cache = {} class IconExporter(object): def __init__(self, omc_session, icon_dir_name): """ Creates a new instance of IconExporter and passes in an OMCSession """ self.logger = logging.getLogger('py_modelica_exporter.IconExporter') self.logger.setLevel(logging.NOTSET) self.logger.info('Initializing IconExporter()') # start om session self.omc = omc_session self.icon_dir_name = icon_dir_name # get graphics objects from annotation Icon def get_graphics_for_class(self, modelica_class): # TODO: does not work if a port (same class) is being used multiple times... # if modelicaClass in graphics_cache: # return graphics_cache[modelicaClass] result = dict() result['graphics'] = [] # answer2 = ask_omc('getIconAnnotation', modelicaClass, parsed=False) icon_annotation = self.omc.getIconAnnotation(modelica_class) result['coordinateSystem'] = {} result['coordinateSystem']['extent'] = [[-100, -100], [100, 100]] r = regex_coordSys.search(icon_annotation) if r: g = r.groups() result['coordinateSystem']['extent'] = [[float(g[0]), float(g[1])], [float(g[2]), float(g[3])]] result['coordinateSystem']['preserveAspectRatio'] = bool(g[4]) result['coordinateSystem']['initialScale'] = float(g[5]) result['coordinateSystem']['grid'] = [float(g[6]), float(g[7])] withOutCoordSys = icon_annotation[icon_annotation.find(',{'):] else: # logger.warning('Coordinate system was skipped') # logger.warning(answer2) withOutCoordSys = icon_annotation for icon_line in withOutCoordSys.split('),'): # default values graphicsObj = {} r = regex_line.search(icon_line) if r: graphicsObj['type'] = 'Line' g = r.groups() graphicsObj['visible'] = g[0] graphicsObj['origin'] = [float(g[1]), float(g[2])] graphicsObj['rotation'] = float(g[3]) points = [] gg = re.findall(regex_points, g[4]) for i in range(0, len(gg)): points.append([float(gg[i][0]), float(gg[i][1])]) graphicsObj['points'] = points graphicsObj['color'] = [int(g[5]), int(g[6]), int(g[7])] graphicsObj['pattern'] = g[8] graphicsObj['thickness'] = float(g[9]) graphicsObj['arrow'] = [g[10], g[11]] graphicsObj['arrowSize'] = float(g[12]) graphicsObj['smooth'] = g[13] r = regex_rectangle.search(icon_line) if r: graphicsObj['type'] = 'Rectangle' g = r.groups() graphicsObj['visible'] = g[0] graphicsObj['origin'] = [float(g[1]), float(g[2])] graphicsObj['rotation'] = float(g[3]) graphicsObj['lineColor'] = [int(g[4]), int(g[5]), int(g[6])] graphicsObj['fillColor'] = [int(g[7]), int(g[8]), int(g[9])] graphicsObj['linePattern'] = g[10] graphicsObj['fillPattern'] = g[11] graphicsObj['lineThickness'] = float(g[12]) graphicsObj['borderPattern'] = g[13] graphicsObj['extent'] = [[float(g[14]), float(g[15])], [float(g[16]), float(g[17])]] graphicsObj['radius'] = float(g[18]) r = regex_polygon.search(icon_line) if r: graphicsObj['icon_line'] = icon_line graphicsObj['type'] = 'Polygon' g = r.groups() graphicsObj['visible'] = g[0] graphicsObj['origin'] = [float(g[1]), float(g[2])] graphicsObj['rotation'] = float(g[3]) graphicsObj['lineColor'] = [int(g[4]), int(g[5]), int(g[6])] graphicsObj['fillColor'] = [int(g[7]), int(g[8]), int(g[9])] graphicsObj['linePattern'] = g[10] graphicsObj['fillPattern'] = g[11] graphicsObj['lineThickness'] = float(g[12]) points = [] gg = re.findall(regex_points, g[13]) for i in range(0, len(gg)): points.append([float(gg[i][0]), float(gg[i][1])]) graphicsObj['points'] = points minX = 100 minY = 100 maxX = -100 maxY = -100 for point in graphicsObj['points']: if minX > point[0]: minX = point[0] if maxX < point[0]: maxX = point[0] if minY > point[1]: minY = point[1] if maxY < point[1]: maxY = point[1] graphicsObj['extent'] = [[minX, minY], [maxX, maxY]] graphicsObj['smooth'] = g[14] r = regex_text.search(icon_line) if r: graphicsObj['type'] = 'Text' g = r.groups() graphicsObj['visible'] = g[0] graphicsObj['origin'] = [float(g[1]), float(g[2])] graphicsObj['rotation'] = float(g[3]) graphicsObj['lineColor'] = [int(g[4]), int(g[5]), int(g[6])] graphicsObj['fillColor'] = [int(g[7]), int(g[8]), int(g[9])] graphicsObj['linePattern'] = g[10] graphicsObj['fillPattern'] = g[11] graphicsObj['lineThickness'] = float(g[12]) graphicsObj['extent'] = [[float(g[13]), float(g[14])], [float(g[15]), float(g[16])]] graphicsObj['textString'] = g[17].strip('"') graphicsObj['fontSize'] = float(g[18]) graphicsObj['fontName'] = g[19] if graphicsObj['fontName']: graphicsObj['fontName'] = graphicsObj['fontName'].strip('"') graphicsObj['textStyle'] = [] if g[20]: graphicsObj['textStyle'] = regex_type_value.findall(g[20]) # text Style can have different number of styles graphicsObj['horizontalAlignment'] = g[21] r = regex_ellipse.search(icon_line) if r: g = r.groups() graphicsObj['type'] = 'Ellipse' graphicsObj['visible'] = g[0] graphicsObj['origin'] = [float(g[1]), float(g[2])] graphicsObj['rotation'] = float(g[3]) graphicsObj['lineColor'] = [int(g[4]), int(g[5]), int(g[6])] graphicsObj['fillColor'] = [int(g[7]), int(g[8]), int(g[9])] graphicsObj['linePattern'] = g[10] graphicsObj['fillPattern'] = g[11] graphicsObj['lineThickness'] = float(g[12]) graphicsObj['extent'] = [[float(g[13]), float(g[14])], [float(g[15]), float(g[16])]] graphicsObj['startAngle'] = float(g[17]) graphicsObj['endAngle'] = float(g[18]) if not 'type' in graphicsObj: graphicsObj['type'] = 'Unknown' # logger.error('Unknown graphicsObj: {0}'.format(icon_line)) result['graphics'].append(graphicsObj) graphics_cache[modelica_class] = result return result def get_graphics_with_ports_for_class(self, modelica_class): graphics = self.get_graphics_for_class(modelica_class) graphics['className'] = modelica_class graphics['ports'] = [] # answer_full = ask_omc('getComponents', modelicaClass, parsed=False) answer_full = self.omc.getComponents(modelica_class, parsed=False) comp_id = 0 for answer in answer_full[2:].split('},{'): #print answer comp_id += 1 class_name = answer[0:answer.find(',')] component_name = answer[answer.find(',') + 1:][0:answer[answer.find(',') + 1:].find(',')] # if ask_omc('isConnector', class_name): if self.omc.isConnector(class_name): try: comp_annotation = self.omc.getNthComponentAnnotation(modelica_class, comp_id) # comp_annotation = ask_omc('getNthComponentAnnotation', modelicaClass + ', ' + str(comp_id))['SET2']['Set1'] except KeyError as ex: self.logger.error('KeyError: {0} componentName: {1} {2}'.format(modelica_class, component_name, ex.message)) continue # base class graphics for ports g_base = [] base_classes = [] self.get_base_classes(class_name, base_classes) for base_class in base_classes: graphics_base = self.get_graphics_for_class(base_class) g_base.append(graphics_base) g = self.get_graphics_for_class(class_name) g_this = g['graphics'] g['graphics'] = [] for g_b in g_base: for g_i in g_b['graphics']: g['graphics'].append(g_i) for g_b in g_this: g['graphics'].append(g_b) g['id'] = component_name g['className'] = class_name desc = self.omc.getComponentComment(modelica_class + ', ' + component_name ) # desc = ask_omc('getComponentComment', modelicaClass + ', ' + component_name) if type(desc) is dict: g['desc'] = '' else: g['desc'] = desc.strip().strip('"') g['classDesc'] = self.omc.getClassComment(class_name).strip().strip('"') # g['classDesc'] = ask_omc('getClassComment', class_name).strip().strip('"') minX = g['coordinateSystem']['extent'][0][0] minY = g['coordinateSystem']['extent'][0][1] maxX = g['coordinateSystem']['extent'][1][0] maxY = g['coordinateSystem']['extent'][1][1] for gs in g['graphics']: # use default values if it is not there if not 'extent' in gs: gs['extent'] = [[-100, -100], [100, 100]] if not 'origin' in gs: gs['origin'] = [0, 0] if minX > gs['extent'][0][0] + gs['origin'][0]: minX = gs['extent'][0][0] + gs['origin'][0] if minX > gs['extent'][1][0] + gs['origin'][0]: minX = gs['extent'][1][0] + gs['origin'][0] if minY > gs['extent'][0][1] + gs['origin'][1]: minY = gs['extent'][0][1] + gs['origin'][1] if minY > gs['extent'][1][1] + gs['origin'][1]: minY = gs['extent'][1][1] + gs['origin'][1] if maxX < gs['extent'][1][0] + gs['origin'][0]: maxX = gs['extent'][1][0] + gs['origin'][0] if maxX < gs['extent'][0][0] + gs['origin'][0]: maxX = gs['extent'][0][0] + gs['origin'][0] if maxY < gs['extent'][1][1] + gs['origin'][1]: maxY = gs['extent'][1][1] + gs['origin'][1] if maxY < gs['extent'][0][1] + gs['origin'][1]: maxY = gs['extent'][0][1] + gs['origin'][1] g['coordinateSystem']['extent'] = [[minX, minY], [maxX, maxY]] #print comp_annotation index_delta = 7 if comp_annotation[10] == "-": # fallback to diagram annotations index_delta = 0 origin_x = comp_annotation[1 + index_delta] origin_y = comp_annotation[2 + index_delta] x0 = comp_annotation[3 + index_delta] y0 = comp_annotation[4 + index_delta] x1 = comp_annotation[5 + index_delta] y1 = comp_annotation[6 + index_delta] rotation = comp_annotation[7 + index_delta] g['transformation'] = {} g['transformation']['origin'] = [origin_x, origin_y] g['transformation']['extent'] = [[x0, y0], [x1, y1]] g['transformation']['rotation'] = rotation graphics['ports'].append(g) return graphics def get_gradient_colors(self, start_color, stop_color, mid_points): result = [] startRed = int(start_color[0]) startGreen = int(start_color[1]) startBlue = int(start_color[2]) stopRed = int(stop_color[0]) stopGreen = int(stop_color[1]) stopBlue = int(stop_color[2]) r_delta = (stopRed - startRed) / (mid_points + 1) g_delta = (stopGreen - startGreen) / (mid_points + 1) b_delta = (stopBlue - startBlue) / (mid_points + 1) result.append((startRed, startGreen, startBlue)) for i in range(1, mid_points + 1): result.append((startRed + i * r_delta, startGreen + i * g_delta, startBlue + i * b_delta)) result.append((stopRed, stopGreen, stopBlue)) return result def get_coordinates(self, xy, graphics, min_x, max_y, transformation, coordinate_system): x = xy[0] + graphics['origin'][0] y = xy[1] + graphics['origin'][1] # rotation for the icon s = math.sin(graphics['rotation'] / 180 * 3.1415) c = math.cos(graphics['rotation'] / 180 * 3.1415) x -= graphics['origin'][0] y -= graphics['origin'][1] xnew = x * c - y * s ynew = x * s + y * c x = xnew + graphics['origin'][0] y = ynew + graphics['origin'][1] if transformation and coordinate_system: try: t_width = abs(max(transformation['extent'][1][0], transformation['extent'][0][0]) - min(transformation['extent'][1][0], transformation['extent'][0][0])) t_height = abs(max(transformation['extent'][1][1], transformation['extent'][0][1]) - min(transformation['extent'][1][1], transformation['extent'][0][1])) o_width = abs(max(coordinate_system['extent'][1][0], coordinate_system['extent'][0][0]) - min(coordinate_system['extent'][1][1], coordinate_system['extent'][0][1])) o_height = abs(max(coordinate_system['extent'][1][1], coordinate_system['extent'][0][1]) - min(coordinate_system['extent'][1][1], coordinate_system['extent'][0][1])) if 'extent' in transformation and transformation['extent'][1][0] < transformation['extent'][0][0]: # horizontal flip x = (-xy[0] + graphics['origin'][0]) / o_width * t_width + transformation['origin'][0] + transformation['extent'][1][0] + t_width / 2 else: x = (xy[0] + graphics['origin'][0]) / o_width * t_width + transformation['origin'][0] + transformation['extent'][0][0] + t_width / 2 if 'extent' in transformation and transformation['extent'][1][1] < transformation['extent'][0][1]: # vertical flip y = (-xy[1] + graphics['origin'][1]) / o_height * t_height + transformation['origin'][1] + min(transformation['extent'][1][1], transformation['extent'][0][1]) + t_height / 2 else: y = (xy[1] + graphics['origin'][1]) / o_height * t_height + transformation['origin'][1] + min(transformation['extent'][0][1], transformation['extent'][0][1]) + t_height / 2 s = math.sin(transformation['rotation'] / 180 * 3.1415) c = math.cos(transformation['rotation'] / 180 * 3.1415) x -= transformation['origin'][0] y -= transformation['origin'][1] xnew = x * c - y * s ynew = x * s + y * c x = xnew + transformation['origin'][0] y = ynew + transformation['origin'][1] except KeyError as ex: self.logger.error('Component position transformation failed: {0}', ex.message) self.logger.error(graphics) x -= min_x y = max_y - y return x, y # get svg object from modelica graphics object def get_svg_from_graphics(self, dwg, graphics, min_x, max_y, transformation=None, coordinate_system=None): shape = None definitions = svgwrite.container.Defs() origin = None if not 'origin' in graphics: graphics['origin'] = (0, 0) origin = graphics['origin'] if graphics['type'] == 'Rectangle' or graphics['type'] == 'Ellipse' or graphics['type'] == 'Text': (x0, y0) = self.get_coordinates(graphics['extent'][0], graphics, min_x, max_y, transformation, coordinate_system) (x1, y1) = self.get_coordinates(graphics['extent'][1], graphics, min_x, max_y, transformation, coordinate_system) if graphics['type'] == 'Rectangle' or graphics['type'] == 'Ellipse' or graphics['type'] == 'Polygon': if not 'fillPattern' in graphics: graphics['fillPattern'] = 'FillPattern.None' if graphics['type'] == 'Rectangle': shape = dwg.rect((min(x0, x1), min(y0, y1)), (abs(x1 - x0), abs(y1 - y0)), graphics['radius'], graphics['radius']) elif graphics['type'] == 'Line': if 'points' in graphics: if graphics['smooth'] == 'Smooth.Bezier' and len(graphics['points']) > 2: # TODO: Optimize this part!!! shape = svgwrite.path.Path() x_0, y_0 = self.get_coordinates([graphics['points'][0][0], graphics['points'][0][1]], graphics, min_x, max_y, transformation, coordinate_system) shape.push('M', x_0, y_0, 'C') for i in range(1, len(graphics['points']) - 1): x_0, y_0 = self.get_coordinates([graphics['points'][i-1][0], graphics['points'][i-1][1]], graphics, min_x, max_y, transformation, coordinate_system) x_1, y_1 = self.get_coordinates([graphics['points'][i][0], graphics['points'][i][1]], graphics, min_x, max_y, transformation, coordinate_system) x_2, y_2 = self.get_coordinates([graphics['points'][i+1][0], graphics['points'][i+1][1]], graphics, min_x, max_y, transformation, coordinate_system) x_01 = (x_1 + x_0) / 2 y_01 = (y_1 + y_0) / 2 x_12 = (x_2 + x_1) / 2 y_12 = (y_2 + y_1) / 2 shape.push(x_01, y_01, x_1, y_1, x_12, y_12) x_n, y_n = self.get_coordinates([graphics['points'][len(graphics['points']) - 1][0], graphics['points'][len(graphics['points']) - 1][1]], graphics, min_x, max_y, transformation, coordinate_system) shape.push(x_12, y_12, x_n, y_n, x_n, y_n) else: shape = dwg.polyline([self.get_coordinates([x, y], graphics, min_x, max_y, transformation, coordinate_system) for (x, y) in graphics['points']]) shape.fill('none', opacity=0) # markers if graphics['arrow'][0] != 'Arrow.None': url_id_start = graphics['arrow'][0] + '_start' + str(uuid.uuid4()) marker = svgwrite.container.Marker(insert=(10, 5), size=(4, 3), orient='auto', id=url_id_start, viewBox="0 0 10 10") p = svgwrite.path.Path(d="M 10 0 L 0 5 L 10 10 z") p.fill("rgb(" + ','.join([str(v) for v in graphics['color']]) + ")") marker.add(p) definitions.add(marker) shape['marker-start'] = marker.get_funciri() if graphics['arrow'][1] != 'Arrow.None': url_id_end = graphics['arrow'][1] + '_end' + str(uuid.uuid4()) marker = svgwrite.container.Marker(insert=(0, 5), size=(4, 3), orient='auto', id=url_id_end, viewBox="0 0 10 10") p = svgwrite.path.Path(d="M 0 0 L 10 5 L 0 10 z") p.fill("rgb(" + ','.join([str(v) for v in graphics['color']]) + ")") marker.add(p) definitions.add(marker) shape['marker-end'] = marker.get_funciri() else: self.logger.error('Not handled: {0}'.format(graphics)) return None elif graphics['type'] == 'Polygon': if 'points' in graphics: if graphics['smooth'] == 'Smooth.Bezier' and len(graphics['points']) > 2: # TODO: Optimize this part!!! shape = svgwrite.path.Path() x_0, y_0 = self.get_coordinates([graphics['points'][0][0], graphics['points'][0][1]], graphics, min_x, max_y, transformation, coordinate_system) shape.push('M', x_0, y_0, 'C') for i in range(1, len(graphics['points']) - 1): x_0, y_0 = self.get_coordinates([graphics['points'][i-1][0], graphics['points'][i-1][1]], graphics, min_x, max_y, transformation, coordinate_system) x_1, y_1 = self.get_coordinates([graphics['points'][i][0], graphics['points'][i][1]], graphics, min_x, max_y, transformation, coordinate_system) x_2, y_2 = self.get_coordinates([graphics['points'][i+1][0], graphics['points'][i+1][1]], graphics, min_x, max_y, transformation, coordinate_system) x_01 = (x_1 + x_0) / 2 y_01 = (y_1 + y_0) / 2 x_12 = (x_2 + x_1) / 2 y_12 = (y_2 + y_1) / 2 shape.push(x_01, y_01, x_1, y_1, x_12, y_12) x_n, y_n = self.get_coordinates([graphics['points'][len(graphics['points']) - 1][0], graphics['points'][len(graphics['points']) - 1][1]], graphics, min_x, max_y, transformation, coordinate_system) shape.push(x_12, y_12, x_n, y_n, x_n, y_n) else: shape = dwg.polygon([self.get_coordinates([x, y], graphics, min_x, max_y, transformation, coordinate_system) for (x, y) in graphics['points']]) shape.fill('none', opacity=0) else: self.logger.error('Not handled: {0}'.format(graphics)) return None elif graphics['type'] == 'Ellipse': shape = dwg.ellipse(((x0 + x1) / 2, (y0 + y1) / 2), (abs((x1 - x0) / 2), abs((y1 - y0) / 2))) elif graphics['type'] == 'Text': extra = {} x = (x0 + x1) / 2 y = (y0 + y1) / 2 extra['font_family'] = graphics['fontName'] or "Verdana" if graphics['fontSize'] == 0: extra['font_size'] = "18" else: extra['font_size'] = graphics['fontSize'] for style in graphics['textStyle']: if style == "TextStyle.Bold": extra['font-weight'] = 'bold' elif style == "TextStyle.Italic": extra['font-style'] = 'italic' elif style == "TextStyle.UnderLine": extra['text-decoration'] = 'underline' extra['alignment_baseline'] = "middle" if graphics['horizontalAlignment'] == "TextAlignment.Left": extra['text_anchor'] = "start" if x0 < x1: x = x0 else: x = x1 if y0 < y1: y = y0 else: y = y1 elif graphics['horizontalAlignment'] == "TextAlignment.Center": extra['text_anchor'] = "middle" elif graphics['horizontalAlignment'] == "TextAlignment.Right": extra['text_anchor'] = "end" if x0 < x1: x = x1 else: x = x0 if y0 < y1: y = y1 else: y = y0 shape = dwg.text(graphics['textString'].replace('%', ''), None, [x], [y], **extra) if graphics['textString'].find('%') != -1: extra = {'class': "bbox", 'display': "none"} xmin = x0 ymin = y0 xmax = x1 ymax = y1 if x0 > x1: xmin = x1 xmax = x0 if y0 > y1: ymin = y1 ymax = y0 shape.add(svgwrite.text.TSpan(("{0} {1} {2} {3}".format(xmin, ymin, xmax, ymax)), **extra)) extra = {'class': "data-bind", 'display': "none"} shape.add(svgwrite.text.TSpan(graphics['textString'], **extra)) else: self.logger.error('Not handled: {0}'.format(graphics)) return None dot_size = 4 dash_size = 16 space_size = 8 if 'linePattern' in graphics: dot_size *= graphics['lineThickness'] dash_size *= graphics['lineThickness'] space_size *= graphics['lineThickness'] if graphics['linePattern'] == 'LinePattern.None' or graphics['type'] == 'Text': pass elif graphics['linePattern'] == 'LinePattern.Solid': shape.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width='{0}mm'.format(graphics['lineThickness'])) elif graphics['linePattern'] == 'LinePattern.Dash': shape.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width='{0}mm'.format(graphics['lineThickness'])) shape.dasharray([dash_size, space_size]) elif graphics['linePattern'] == 'LinePattern.Dot': shape.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width='{0}mm'.format(graphics['lineThickness'])) shape.dasharray([dot_size, space_size]) elif graphics['linePattern'] == 'LinePattern.DashDot': shape.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width='{0}mm'.format(graphics['lineThickness'])) shape.dasharray([dash_size, space_size, dot_size, space_size]) elif graphics['linePattern'] == 'LinePattern.DashDotDot': shape.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width='{0}mm'.format(graphics['lineThickness'])) shape.dasharray([dash_size, space_size, dot_size, space_size, dot_size, space_size]) if graphics['type'] == 'Rectangle': if graphics['borderPattern'] == 'BorderPattern.None': pass elif graphics['borderPattern'] == 'BorderPattern.Raised': url_id = graphics['borderPattern'] + '_' + str(uuid.uuid4()) shape['filter'] = 'url(#' + url_id + ')' filter = svgwrite.filters.Filter(id=url_id, filterUnits="objectBoundingBox", x="-0.1", y="-0.1", width="1.2", height="1.2") filter.feGaussianBlur("SourceAlpha", stdDeviation="5", result="alpha_blur") feSL = filter.feSpecularLighting("alpha_blur", surfaceScale="5", specularConstant="1", specularExponent="20", lighting_color="#FFFFFF", result="spec_light") feSL.fePointLight((-5000, -10000, 10000)) filter.feComposite("spec_light", in2="SourceAlpha", operator="in", result="spec_light") filter.feComposite("SourceGraphic", in2="spec_light", operator="out", result="spec_light_fill") definitions.add(filter) elif graphics['borderPattern'] == 'BorderPattern.Sunken': self.logger.warning('Not supported: {0}'.format(graphics['borderPattern'])) elif graphics['borderPattern'] == 'BorderPattern.Engraved': self.logger.warning('Not supported: {0}'.format(graphics['borderPattern'])) if 'color' in graphics: try: shape.stroke("rgb(" + ','.join([str(v) for v in graphics['color']]) + ")", width='{0}mm'.format(graphics['thickness'])) except TypeError as ex: self.logger.error('{0} {1}'.format(graphics['color'], ex.message)) if 'pattern' in graphics: dot_size *= graphics['thickness'] dash_size *= graphics['thickness'] space_size *= graphics['thickness'] if graphics['pattern'] == 'LinePattern.None' or graphics['type'] == 'Text': pass elif graphics['pattern'] == 'LinePattern.Solid': shape.stroke("rgb(" + ','.join([str(v) for v in graphics['color']]) + ")", width='{0}mm'.format(graphics['thickness'])) elif graphics['pattern'] == 'LinePattern.Dash': shape.stroke("rgb(" + ','.join([str(v) for v in graphics['color']]) + ")", width='{0}mm'.format(graphics['thickness'])) shape.dasharray([dash_size, space_size]) elif graphics['pattern'] == 'LinePattern.Dot': shape.stroke("rgb(" + ','.join([str(v) for v in graphics['color']]) + ")", width='{0}mm'.format(graphics['thickness'])) shape.dasharray([dot_size, space_size]) elif graphics['pattern'] == 'LinePattern.DashDot': shape.stroke("rgb(" + ','.join([str(v) for v in graphics['color']]) + ")", width='{0}mm'.format(graphics['thickness'])) shape.dasharray([dash_size, space_size, dot_size, space_size]) elif graphics['pattern'] == 'LinePattern.DashDotDot': shape.stroke("rgb(" + ','.join([str(v) for v in graphics['color']]) + ")", width='{0}mm'.format(graphics['thickness'])) shape.dasharray([dash_size, space_size, dot_size, space_size, dot_size, space_size]) if 'fillPattern' in graphics: if graphics['fillPattern'] == 'FillPattern.None': if graphics['type'] == 'Text': shape.fill("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")") else: shape.fill('none', opacity=0) elif graphics['fillPattern'] == 'FillPattern.Solid': shape.fill("rgb(" + ','.join([str(v) for v in graphics['fillColor']]) + ")") elif graphics['fillPattern'] == 'FillPattern.Horizontal': url_id = str(uuid.uuid4()) shape.fill('url(#' + url_id + ')') pattern = svgwrite.pattern.Pattern(id=url_id, insert=(0, 0), size=(5, 5), patternUnits='userSpaceOnUse') rect = svgwrite.shapes.Rect(insert=(0, 0), size=(5, 5)) rect.fill("rgb(" + ','.join([str(v) for v in graphics['fillColor']]) + ")") pattern.add(rect) svg_path = svgwrite.path.Path(d="M0,0 L5,0") svg_path.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width=2) pattern.add(svg_path) definitions.add(pattern) elif graphics['fillPattern'] == 'FillPattern.Vertical': url_id = str(uuid.uuid4()) shape.fill('url(#' + url_id + ')') pattern = svgwrite.pattern.Pattern(id=url_id, insert=(0, 0), size=(5, 5), patternUnits='userSpaceOnUse') rect = svgwrite.shapes.Rect(insert=(0, 0), size=(5, 5)) rect.fill("rgb(" + ','.join([str(v) for v in graphics['fillColor']]) + ")") pattern.add(rect) svg_path = svgwrite.path.Path(d="M0,0 L0,5") svg_path.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width=2) pattern.add(svg_path) definitions.add(pattern) elif graphics['fillPattern'] == 'FillPattern.Cross': url_id = str(uuid.uuid4()) shape.fill('url(#' + url_id + ')') pattern = svgwrite.pattern.Pattern(id=url_id, insert=(0, 0), size=(5, 5), patternUnits='userSpaceOnUse') rect = svgwrite.shapes.Rect(insert=(0, 0), size=(5, 5)) rect.fill("rgb(" + ','.join([str(v) for v in graphics['fillColor']]) + ")") pattern.add(rect) svg_path = svgwrite.path.Path(d="M0,0 L5,0") svg_path.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width=2) pattern.add(svg_path) svg_path = svgwrite.path.Path(d="M0,0 L0,5") svg_path.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width=2) pattern.add(svg_path) definitions.add(pattern) elif graphics['fillPattern'] == 'FillPattern.Forward': url_id = str(uuid.uuid4()) shape.fill('url(#' + url_id + ')') pattern = svgwrite.pattern.Pattern(id=url_id, insert=(0, 0), size=(7, 7), patternUnits='userSpaceOnUse') rect = svgwrite.shapes.Rect(insert=(0, 0), size=(7, 7)) rect.fill("rgb(" + ','.join([str(v) for v in graphics['fillColor']]) + ")") pattern.add(rect) svg_path = svgwrite.path.Path(d="M0,0 l7,7") svg_path.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width=1) pattern.add(svg_path) svg_path = svgwrite.path.Path(d="M6,-1 l3,3") svg_path.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width=1) pattern.add(svg_path) svg_path = svgwrite.path.Path(d="M-1,6 l3,3") svg_path.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width=1) pattern.add(svg_path) definitions.add(pattern) elif graphics['fillPattern'] == 'FillPattern.Backward': url_id = str(uuid.uuid4()) shape.fill('url(#' + url_id + ')') pattern = svgwrite.pattern.Pattern(id=url_id, insert=(0, 0), size=(7, 7), patternUnits='userSpaceOnUse') rect = svgwrite.shapes.Rect(insert=(0, 0), size=(7, 7)) rect.fill("rgb(" + ','.join([str(v) for v in graphics['fillColor']]) + ")") pattern.add(rect) svg_path = svgwrite.path.Path(d="M7,0 l-7,7") svg_path.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width=1) pattern.add(svg_path) svg_path = svgwrite.path.Path(d="M1,-1 l-7,7") svg_path.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width=1) pattern.add(svg_path) svg_path = svgwrite.path.Path(d="M8,6 l-7,7") svg_path.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width=1) pattern.add(svg_path) definitions.add(pattern) elif graphics['fillPattern'] == 'FillPattern.CrossDiag': url_id = str(uuid.uuid4()) shape.fill('url(#' + url_id + ')') pattern = svgwrite.pattern.Pattern(id=url_id, insert=(0, 0), size=(8, 8), patternUnits='userSpaceOnUse') rect = svgwrite.shapes.Rect(insert=(0, 0), size=(8, 8)) rect.fill("rgb(" + ','.join([str(v) for v in graphics['fillColor']]) + ")") pattern.add(rect) svg_path = svgwrite.path.Path(d="M0,0 l8,8") svg_path.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width=1) pattern.add(svg_path) svg_path = svgwrite.path.Path(d="M8,0 l-8,8") svg_path.stroke("rgb(" + ','.join([str(v) for v in graphics['lineColor']]) + ")", width=1) pattern.add(svg_path) definitions.add(pattern) elif graphics['fillPattern'] == 'FillPattern.HorizontalCylinder': url_id = str(uuid.uuid4()) shape.fill('url(#' + url_id + ')') lineColor = graphics['lineColor'] fillColor = graphics['fillColor'] if not lineColor: lineColor = 'black' if not fillColor: fillColor = 'white' gradient = svgwrite.gradients.LinearGradient(id=url_id, x1="0%", y1="0%", x2="0%", y2="100%") colors = self.get_gradient_colors(lineColor, fillColor, 0) stopValues = [ (0, 0), (0.3, 1), (0.7, 1), (1, 0) ] for (stopValue, idx) in stopValues: gradient.add_stop_color(offset=stopValue, color='rgb({0}, {1}, {2})'.format(colors[idx][0], colors[idx][1], colors[idx][2]), opacity=1) definitions.add(gradient) elif graphics['fillPattern'] == 'FillPattern.VerticalCylinder': url_id = str(uuid.uuid4()) shape.fill('url(#' + url_id + ')') lineColor = graphics['lineColor'] fillColor = graphics['fillColor'] if not lineColor: lineColor = 'black' if not fillColor: fillColor = 'white' gradient = svgwrite.gradients.LinearGradient(id=url_id, x1="0%", y1="0%", x2="100%", y2="0%") colors = self.get_gradient_colors(lineColor, fillColor, 0) stopValues = [ (0, 0), (0.3, 1), (0.7, 1), (1, 0) ] for (stopValue, idx) in stopValues: gradient.add_stop_color(offset=stopValue, color='rgb({0}, {1}, {2})'.format(colors[idx][0], colors[idx][1], colors[idx][2]), opacity=1) definitions.add(gradient) elif graphics['fillPattern'] == 'FillPattern.Sphere': if graphics['type'] == 'Ellipse': url_id = str(uuid.uuid4()) shape.fill('url(#' + url_id + ')') lineColor = graphics['lineColor'] fillColor = graphics['fillColor'] if not lineColor: lineColor = 'black' if not fillColor: fillColor = 'white' gradient = svgwrite.gradients.RadialGradient(id=url_id, cx="50%", cy="50%", r="55%", fx="50%", fy="50%") colors = self.get_gradient_colors(lineColor, fillColor, 9) stopValues = [ (0, 10), (0.45, 8), (0.7, 6), (1, 0) ] for (stopValue, idx) in stopValues: gradient.add_stop_color(offset=stopValue, color='rgb({0}, {1}, {2})'.format(colors[idx][0], colors[idx][1], colors[idx][2]), opacity=1) definitions.add(gradient) elif graphics['type'] == 'Rectangle': url_id = str(uuid.uuid4()) shape.fill('url(#' + url_id + ')') lineColor = graphics['lineColor'] fillColor = graphics['fillColor'] if not lineColor: lineColor = 'black' if not fillColor: fillColor = 'white' gradient = svgwrite.gradients.RadialGradient(id=url_id, cx="50%", cy="50%", r="0.9", fx="50%", fy="50%") colors = self.get_gradient_colors(lineColor, fillColor, 0) stopValues = [ (0, 1), (1, 0) ] for (stopValue, idx) in stopValues: gradient.add_stop_color(offset=stopValue, color='rgb({0}, {1}, {2})'.format(colors[idx][0], colors[idx][1], colors[idx][2]), opacity=1) definitions.add(gradient) else: shape.fill('none', opacity=0) return shape, definitions # generate svgs from graphics objects def generate_svg(self, filename, icon_graphics): width = 100 height = 100 minX = 0 minY = 0 maxX = 100 maxY = 100 for iconGraphic in icon_graphics: for graphics in iconGraphic['graphics']: if not 'origin' in graphics: graphics['origin'] = (0, 0) if not 'extent' in graphics: graphics['extent'] = [[-100, -100], [100, 100]] if 'extent' in graphics: if minX > graphics['extent'][0][0] + graphics['origin'][0]: minX = graphics['extent'][0][0] + graphics['origin'][0] if minX > graphics['extent'][1][0] + graphics['origin'][0]: minX = graphics['extent'][1][0] + graphics['origin'][0] if minY > graphics['extent'][0][1] + graphics['origin'][1]: minY = graphics['extent'][0][1] + graphics['origin'][1] if minY > graphics['extent'][1][1] + graphics['origin'][1]: minY = graphics['extent'][1][1] + graphics['origin'][1] if maxX < graphics['extent'][1][0] + graphics['origin'][0]: maxX = graphics['extent'][1][0] + graphics['origin'][0] if maxX < graphics['extent'][0][0] + graphics['origin'][0]: maxX = graphics['extent'][0][0] + graphics['origin'][0] if maxY < graphics['extent'][1][1] + graphics['origin'][1]: maxY = graphics['extent'][1][1] + graphics['origin'][1] if maxY < graphics['extent'][0][1] + graphics['origin'][1]: maxY = graphics['extent'][0][1] + graphics['origin'][1] if 'points' in graphics: for point in graphics['points']: if minX > point[0] + graphics['origin'][0]: minX = point[0] + graphics['origin'][0] if minY > point[1] + graphics['origin'][1]: minY = point[1] + graphics['origin'][1] if maxX < point[0] + graphics['origin'][0]: maxX = point[0] + graphics['origin'][0] if maxY < point[1] + graphics['origin'][1]: maxY = point[1] + graphics['origin'][1] for port in iconGraphic['ports']: if minX > port['transformation']['extent'][0][0] + port['transformation']['origin'][0]: minX = port['transformation']['extent'][0][0] + port['transformation']['origin'][0] if minX > port['transformation']['extent'][1][0] + port['transformation']['origin'][0]: minX = port['transformation']['extent'][1][0] + port['transformation']['origin'][0] if minY > port['transformation']['extent'][0][1] + port['transformation']['origin'][1]: minY = port['transformation']['extent'][0][1] + port['transformation']['origin'][1] if minY > port['transformation']['extent'][1][1] + port['transformation']['origin'][1]: minY = port['transformation']['extent'][1][1] + port['transformation']['origin'][1] if maxX < port['transformation']['extent'][1][0] + port['transformation']['origin'][0]: maxX = port['transformation']['extent'][1][0] + port['transformation']['origin'][0] if maxX < port['transformation']['extent'][0][0] + port['transformation']['origin'][0]: maxX = port['transformation']['extent'][0][0] + port['transformation']['origin'][0] if maxY < port['transformation']['extent'][1][1] + port['transformation']['origin'][1]: maxY = port['transformation']['extent'][1][1] + port['transformation']['origin'][1] if maxY < port['transformation']['extent'][0][1] + port['transformation']['origin'][1]: maxY = port['transformation']['extent'][0][1] + port['transformation']['origin'][1] # ports can have borders minX -= 5 maxX += 5 minY -= 5 maxY += 5 width = maxX - minX height = maxY - minY dwg = svgwrite.Drawing(filename, size=(width, height), viewBox="0 0 " + str(width) + " " + str(height)) dwg.add(svgwrite.base.Desc(icon_graphics[-1]['className'])) for iconGraphic in icon_graphics: for graphics in iconGraphic['graphics']: shape_definitions = self.get_svg_from_graphics(dwg, graphics, minX, maxY) if shape_definitions: shape, definitions = shape_definitions if isinstance(shape, svgwrite.text.Text) and shape.text == 'name': shape.text = filename.split('.')[-2] dwg.add(shape) dwg.add(definitions) for iconGraphic in icon_graphics: for port in iconGraphic['ports']: group = dwg.g(id=port['id']) for graphics in port['graphics']: svgShape = self.get_svg_from_graphics(dwg, graphics, minX, maxY, port['transformation'], port['coordinateSystem']) if svgShape: group.add(svgShape[0]) group.add(svgShape[1]) port_info = dwg.g(id='info', display='none') port_info.add(svgwrite.text.Text(port['id'], id='name')) port_info.add(svgwrite.text.Text(port['className'], id='type')) port_info.add(svgwrite.text.Text(port['classDesc'], id='classDesc')) port_info.add(svgwrite.text.Text(port['desc'], id='desc')) group.add(port_info) dwg.add(group) dwg.save() return dwg def export_icon(self, modelica_class, dir_name=None): if dir_name == None: dir_name = self.icon_dir_name try: # get all icons iconGraphics = [] base_classes = [] self.get_base_classes(modelica_class, base_classes) for base_class in base_classes: graphics = self.get_graphics_with_ports_for_class(base_class) iconGraphics.append(graphics) graphics = self.get_graphics_with_ports_for_class(modelica_class) iconGraphics.append(graphics) # with open(os.path.join(output_dir, self.class_to_filename(modelica_class) + '.json'), 'w') as f_p: # json.dump(iconGraphics, f_p) # export svgs svg_file_path = os.path.join(dir_name, self.class_to_filename(modelica_class) + ".svg") dwg = self.generate_svg(svg_file_path, iconGraphics) return svg_file_path except: return None def get_base_classes(self, modelica_class, base_classes): inheritance_cnt = self.omc.getInheritanceCount(modelica_class) # inheritance_cnt = ask_omc('getInheritanceCount', modelica_class) for i in range(1, inheritance_cnt + 1): base_class = self.omc.getNthInheritedClass(modelica_class, str(i)) # base_class = ask_omc('getNthInheritedClass', modelica_class + ', ' + str(i)) if base_class not in base_classes: base_classes.append(base_class) self.get_base_classes(base_class, base_classes) def class_to_filename(self, cl): """ The file-system dislikes directory separators, and scripts dislike tokens that expand to other names. This function uses the same replacement rules as the OpenModelica documentation-generating script. """ return cl.replace("/","Division").replace("*","Multiplication") # def main(): # parser = OptionParser() # parser.add_option("--with-html", help="Generate an HTML report with all SVG-files", action="store_true", dest="with_html", default=False) # parser.add_option("--output-dir", help="Directory to generate SVG-files in", type="string", dest="output_dir", default=os.path.abspath('ModelicaIcons')) # (options, args) = parser.parse_args() # if len(args) == 0: # parser.print_help() # return # global output_dir # output_dir = options.output_dir # with_html = options.with_html # # # Inputs # PACKAGES_TO_LOAD = args # PACKAGES_TO_LOAD_FROM_FILE = [] # PACKAGES_TO_GENERATE = PACKAGES_TO_LOAD # # # logger.info('Application started') # logger.info('Output directory: ' + output_dir) # # if not os.path.exists(output_dir): # os.makedirs(output_dir) # # success = True # # for command in OMC_SETUP_COMMANDS: # print command,":",OMPython.omc.sendExpression(command) # for package in PACKAGES_TO_LOAD: # logger.info('Loading package: {0}'.format(package)) # package_load = OMPython.execute('loadModel(' + package + ')') # logger.info('Load success: {0}'.format(package_load)) # success = success and package_load # # for package in PACKAGES_TO_LOAD_FROM_FILE: # logger.info('Loading package from file: {0}'.format(package)) # package_load = OMPython.execute('loadFile("' + package + '")') # logger.info('Load success: {0}'.format(package_load)) # success = success and package_load # # if success: # dwgs = [] # # for package in PACKAGES_TO_GENERATE: # modelica_classes = ask_omc('getClassNames', package + ', recursive=true, qualified=true, sort=true')['SET1']['Set1'] # # for modelica_class in modelica_classes: # logger.info('Exporting: ' + modelica_class) # # # try: # base_classes = [] # getBaseClasses(modelica_class, base_classes) # dwg = exportIcon(modelica_class, base_classes) # dwgs.append(dwg) # # logger.info('Done: ' + modelica_class) # # except: # # print 'FAILED: ' + modelica_class # if with_html: # logger.info('Generating HTML file ...') # with open(os.path.join(output_dir, 'index.html'), 'w') as f_p: # f_p.write('<html>\n') # f_p.write('<head>\n') # f_p.write('</head>\n') # # f_p.write('<body>\n') # # for dwg in dwgs: # dwg.write(f_p) # # f_p.write('</body>\n') # f_p.write('</html>\n') # # logger.info('HTML file is ready.') # print "Generated svg's for %d models" % len(dwgs) # # logger.info('quit OMC') # logger.info('End of application') # # if __name__ == '__main__': # main()
{ "content_hash": "f267909eabd6e5b1dd6e2f7aef4d8f18", "timestamp": "", "source": "github", "line_count": 1263, "max_line_length": 357, "avg_line_length": 48.53206650831354, "alnum_prop": 0.49946162881754114, "repo_name": "pombredanne/metamorphosys-desktop", "id": "0c79c0463384039ac56edbfe6289f6fa838247f9", "size": "61347", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "metamorphosys/META/src/Python27Packages/py_modelica_exporter/py_modelica_exporter/generate_icons.py", "mode": "33261", "license": "mit", "language": [ { "name": "Arduino", "bytes": "10683" }, { "name": "Assembly", "bytes": "117345" }, { "name": "Awk", "bytes": "3591" }, { "name": "Batchfile", "bytes": "228118" }, { "name": "BitBake", "bytes": "4526" }, { "name": "C", "bytes": "3613212" }, { "name": "C#", "bytes": "11617773" }, { "name": "C++", "bytes": "51448188" }, { "name": "CMake", "bytes": "3055" }, { "name": "CSS", "bytes": "109563" }, { "name": "Clojure", "bytes": "37831" }, { "name": "Eagle", "bytes": "3782687" }, { "name": "Emacs Lisp", "bytes": "8514" }, { "name": "GAP", "bytes": "49124" }, { "name": "Groff", "bytes": "2178" }, { "name": "Groovy", "bytes": "7686" }, { "name": "HTML", "bytes": "4025250" }, { "name": "Inno Setup", "bytes": "35715" }, { "name": "Java", "bytes": "489537" }, { "name": "JavaScript", "bytes": "167454" }, { "name": "Lua", "bytes": "1660" }, { "name": "Makefile", "bytes": "97209" }, { "name": "Mathematica", "bytes": "26" }, { "name": "Matlab", "bytes": "80874" }, { "name": "Max", "bytes": "78198" }, { "name": "Modelica", "bytes": "44541139" }, { "name": "Objective-C", "bytes": "34004" }, { "name": "Perl", "bytes": "19285" }, { "name": "PostScript", "bytes": "400254" }, { "name": "PowerShell", "bytes": "19749" }, { "name": "Processing", "bytes": "1477" }, { "name": "Prolog", "bytes": "3121" }, { "name": "Protocol Buffer", "bytes": "58995" }, { "name": "Python", "bytes": "5517835" }, { "name": "Ruby", "bytes": "4483" }, { "name": "Shell", "bytes": "956773" }, { "name": "Smarty", "bytes": "37892" }, { "name": "TeX", "bytes": "4183594" }, { "name": "Visual Basic", "bytes": "22546" }, { "name": "XSLT", "bytes": "332312" } ], "symlink_target": "" }
# Hive Netius System # Copyright (c) 2008-2020 Hive Solutions Lda. # # This file is part of Hive Netius System. # # Hive Netius System is free software: you can redistribute it and/or modify # it under the terms of the Apache License as published by the Apache # Foundation, either version 2.0 of the License, or (at your option) any # later version. # # Hive Netius System is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # Apache License for more details. # # You should have received a copy of the Apache License along with # Hive Netius System. If not, see <http://www.apache.org/licenses/>. __author__ = "João Magalhães <joamag@hive.pt>" """ The author(s) of the module """ __version__ = "1.0.0" """ The version of the module """ __revision__ = "$LastChangedRevision$" """ The revision number of the module """ __date__ = "$LastChangedDate$" """ The last change date of the module """ __copyright__ = "Copyright (c) 2008-2020 Hive Solutions Lda." """ The copyright for the module """ __license__ = "Apache License, Version 2.0" """ The license for the module """ import os import math import socket import collections import netius SIZE_UNITS_LIST = ( "B", "KB", "MB", "GB", "TB", "PB", "EB", "ZB", "YB" ) """ The size units list that contains the complete set of units indexed by the depth they represent """ SIZE_UNITS_LIST_S = ( "B", "K", "M", "G", "T", "P", "E", "Z", "Y" ) """ The simplified size units list that contains the complete set of units indexed by the depth they represent """ SIZE_UNIT_COEFFICIENT = 1024 """ The size unit coefficient as an integer value, this is going to be used in each of the size steps as divisor """ DEFAULT_MINIMUM = 1024 """ The default minimum value meaning that this is the maximum value that one integer value may have for the size rounding operation to be performed """ DEFAULT_PLACES = 3 """ The default number of places (digits) that are going to be used for the string representation in the round based conversion of size units to be performed """ _HOST = None """ The globally cached value for the current hostname, this value is used to avoid an excessive blocking in the get host by name call, as it is a blocking call """ def cstring(value): index = value.index("\0") if index == -1: return value return value[:index] def chunks(sequence, count): for index in range(0, len(sequence), count): yield sequence[index:index + count] def header_down(name): values = name.split("-") values = [value.lower() for value in values] return "-".join(values) def header_up(name): values = name.split("-") values = [value.title() for value in values] return "-".join(values) def is_ip4(address): address_p = address.split(".", 4) if not len(address_p) == 4: return False for part in address_p: try: part_i = int(part) except ValueError: return False if part_i < 0: return False if part_i > 255: return False return True def is_ip6(address): if is_ip4(address): return False return True def assert_ip4(address, allowed, default = True): if not allowed: return default for item in allowed: is_subnet = "/" in item if is_subnet: valid = in_subnet_ip4(address, item) else: valid = address == item if not valid: continue return True return False def in_subnet_ip4(address, subnet): subnet, length = subnet.split("/", 1) size_i = 32 - int(length) address_a = ip4_to_addr(address) subnet_a = ip4_to_addr(subnet) limit_a = subnet_a + pow(2, size_i) in_subnet = (address_a & subnet_a) == subnet_a in_subnet &= address_a < limit_a return in_subnet def addr_to_ip4(number): first = int(number / 16777216) % 256 second = int(number / 65536) % 256 third = int(number / 256) % 256 fourth = int(number) % 256 return "%s.%s.%s.%s" % (first, second, third, fourth) def addr_to_ip6(number): buffer = collections.deque() for index in range(8): offset = index * 2 first = number >> (8 * offset) & 0xff second = number >> (8 * (offset + 1)) & 0xff buffer.appendleft("%02x%02x" % (second, first)) return ":".join(buffer) def ip4_to_addr(value): first, second, third, fourth = value.split(".", 3) first_a = int(first) * 16777216 second_a = int(second) * 65536 third_a = int(third) * 256 fourth_a = int(fourth) return first_a + second_a + third_a + fourth_a def string_to_bits(value): return bin(netius.legacy.reduce(lambda x, y : (x << 8) + y, (netius.legacy.ord(c) for c in value), 1))[3:] def integer_to_bytes(number, length = 0): if not isinstance(number, netius.legacy.INTEGERS): raise netius.DataError("Invalid data type") bytes = [] number = abs(number) while number > 0: bytes.append(chr(number & 0xff)) number >>= 8 remaining = length - len(bytes) remaining = 0 if remaining < 0 else remaining for _index in range(remaining): bytes.append("\x00") bytes = reversed(bytes) bytes_s = "".join(bytes) bytes_s = netius.legacy.bytes(bytes_s) return bytes_s def bytes_to_integer(bytes): if not type(bytes) == netius.legacy.BYTES: raise netius.DataError("Invalid data type") number = 0 for byte in bytes: number = (number << 8) | netius.legacy.ord(byte) return number def random_integer(number_bits): """ Generates a random integer of approximately the size of the provided number bits bits rounded up to whole bytes. :type number_bits: int :param number_bits: The number of bits of the generated random integer, this value will be used as the basis for the calculus of the required bytes. :rtype: int :return: The generated random integer, should be provided with the requested size. """ # calculates the number of bytes to represent the number # by dividing the number of bits by a byte and then rounding # the value to the next integer value number_bytes = math.ceil(number_bits / 8.0) number_bytes = int(number_bytes) # generates a random data string with the specified # number of bytes in length random_data = os.urandom(number_bytes) # converts the random data into an integer and then # makes sure the last bit of the value is correctly # filled with data, and returns it to the caller method random_integer = bytes_to_integer(random_data) random_integer |= 1 << (number_bits - 1) return random_integer def host(default = "127.0.0.1"): """ Retrieves the host for the current machine, typically this would be the ipv4 address of the main network interface. No result type are guaranteed and a local address (eg: 127.0.0.1) may be returned instead. The returned value is cached to avoid multiple blocking calls from blocking the processor. :type default: String :param default: The default value that is going to be returned in case no resolution is possible, take into account that this result is going to be cached. :rtype: Strong :return: The string that contains the host address as defined by specification for the current machine. """ global _HOST if _HOST: return _HOST hostname = socket.gethostname() try: _HOST = socket.gethostbyname(hostname) except socket.gaierror: _HOST = default is_unicode = type(_HOST) == netius.legacy.OLD_UNICODE if is_unicode: _HOST = _HOST.encode("utf-8") return _HOST def hostname(): """ The name as a simple string o the name of the current local machine. This value may or may not be a fully qualified domain name for the machine. The result of this function call is unpredictable and should not be trusted for critical operations. :rtype: String :return: The name as a string of the current local machine, the definition of this value varies. """ return socket.gethostname() def size_round_unit( size_value, minimum = DEFAULT_MINIMUM, places = DEFAULT_PLACES, reduce = True, space = False, justify = False, simplified = False, depth = 0 ): """ Rounds the size unit, returning a string representation of the value with a good rounding precision. This method should be used to round data sizing units. Note that using the places parameter it's possible to control the number of digits (including decimal places) of the number that is going to be "generated". :type size_value: int/float :param size_value: The current size value (in bytes). :type minimum: int :param minimum: The minimum value to be used. :type places: int :param places: The target number of digits to be used for describing the value to be used for output, this is going to be used to calculate the proper number of decimal places. :type reduce: bool :param reduce: If the final string value should be reduced meaning that right decimal zeros should be removed as they represent an extra unused value. :type space: bool :param space: If a space character must be used dividing the value from the unit symbol. :type justify: bool :param justify: If the size string value should be (right) justified important for properly aligned values in a table. :type simplified: bool :param simplified: If the simplified version of the units should be used instead of the longer one. :type depth: int :param depth: The current iteration depth value. :rtype: String :return: The string representation of the data size value in a simplified manner (unit). """ # in case the current size value is acceptable (less than # the minimum) this is the final iteration and the final # string representation is going to be created if size_value < minimum: # calculates the maximum size of the string that is going # to represent the base size value as the number of places # plus one (representing the decimal separator character) size_s = places + 1 # calculates the target number of decimal places taking # into account the size (in digits) of the current size # value, this may never be a negative number log_value = size_value and math.log10(size_value) digits = int(log_value) + 1 places = places - digits places = places if places > 0 else 0 # creates the proper format string that is going to # be used in the creation of the proper float value # according to the calculated number of places format = "%%.%df" % places # rounds the size value, then converts the rounded # size value into a string based representation size_value = round(size_value, places) size_value_s = format % size_value # forces the reduce flag when the depth is zero, meaning # that an integer value will never be decimal, this is # required to avoid strange results for depth zero reduce = reduce or depth == 0 # in case the dot value is not present in the size value # string adds it to the end otherwise an issue may occur # while removing extra padding characters for reduce if reduce and not "." in size_value_s: size_value_s += "." # strips the value from zero appended to the right and # then strips the value also from a possible decimal # point value that may be included in it, this is only # performed in case the reduce flag is enabled if reduce: size_value_s = size_value_s.rstrip("0") if reduce: size_value_s = size_value_s.rstrip(".") # in case the justify flag is set runs the justification # process on the size value taking into account the maximum # size of the associated size string if justify: size_value_s = size_value_s.rjust(size_s) # retrieves the size unit (string mode) for the current # depth according to the provided map if simplified: size_unit = SIZE_UNITS_LIST_S[depth] else: size_unit = SIZE_UNITS_LIST[depth] # retrieves the appropriate separator based # on the value of the space flag separator = space and " " or "" # creates the size value string appending the rounded # size value string and the size unit and returns it # to the caller method as the size value string size_value_string = size_value_s + separator + size_unit return size_value_string # otherwise the value is not acceptable and a new iteration # must be ran with one less depth of size value else: # re-calculates the new size value, increments the depth # and runs the size round unit again with the new values new_size_value = float(size_value) / SIZE_UNIT_COEFFICIENT new_depth = depth + 1 return size_round_unit( new_size_value, minimum = minimum, places = places, reduce = reduce, space = space, justify = justify, simplified = simplified, depth = new_depth ) def verify(condition, message = None, exception = None): """ Ensures that the requested condition returns a valid value and if that's no the case an exception raised breaking the current execution logic. :type condition: bool :param condition: The condition to be evaluated and that may trigger an exception raising. :type message: String :param message: The message to be used in the building of the exception that is going to be raised in case of condition failure. :type exception: Class :param exception: The exception class that is going to be used to build the exception to be raised in case the condition verification operation fails. """ if condition: return exception = exception or netius.AssertionError raise exception(message or "Assertion Error") def verify_equal(first, second, message = None, exception = None): message = message or "Expected %s got %s" % (repr(second), repr(first)) return verify( first == second, message = message, exception = exception ) def verify_not_equal(first, second, message = None, exception = None): message = message or "Expected %s not equal to %s" % (repr(first), repr(second)) return verify( not first == second, message = message, exception = exception ) def verify_type(value, types, null = True, message = None, exception = None, **kwargs): message = message or "Expected %s to have type %s" % (repr(value), repr(types)) return verify( (null and value == None) or isinstance(value, types), message = message, exception = exception, **kwargs ) def verify_many(sequence, message = None, exception = None): for condition in sequence: verify( condition, message = message, exception = exception )
{ "content_hash": "3cf9e5a232cf366f29a9975f21dfd8f6", "timestamp": "", "source": "github", "line_count": 445, "max_line_length": 110, "avg_line_length": 35.39325842696629, "alnum_prop": 0.6421587301587302, "repo_name": "hivesolutions/netius", "id": "887c58341bf97017b891e1e97852c15cc833d41e", "size": "15796", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "src/netius/common/util.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Python", "bytes": "1400497" } ], "symlink_target": "" }
"""Unit tests for modules/questionnaire.""" __author__ = [ 'johncox@google.com (John Cox)', ] from tests.unit import javascript_tests class JavaScriptTests(javascript_tests.TestBase): def test_scripts(self): self.karma_test('modules/questionnaire/javascript_tests')
{ "content_hash": "52cd9e747fe909bf12b5dc0f0a01b056", "timestamp": "", "source": "github", "line_count": 14, "max_line_length": 65, "avg_line_length": 20.571428571428573, "alnum_prop": 0.7083333333333334, "repo_name": "ram8647/gcb-mobilecsp", "id": "a1d396f579ecf9c9e20ba70ece18428e1a7f138c", "size": "886", "binary": false, "copies": "4", "ref": "refs/heads/master", "path": "modules/questionnaire/questionnaire_unit_tests.py", "mode": "33261", "license": "apache-2.0", "language": [ { "name": "CSS", "bytes": "122290" }, { "name": "HTML", "bytes": "486625" }, { "name": "JavaScript", "bytes": "620039" }, { "name": "Python", "bytes": "5013996" }, { "name": "Shell", "bytes": "36511" } ], "symlink_target": "" }
import tinctest from mpp.gpdb.tests.storage.lib.sql_isolation_testcase import SQLIsolationTestCase from gppylib.commands.base import Command from resource_management.runaway_query.runaway_udf import * from mpp.lib.PSQL import PSQL def _set_VLIM_SLIM_REDZONEPERCENT(vlimMB, slimMB, activationPercent): # Set up GUCs for VLIM (gp_vmem_protect_limit), SLIM (gp_vmem_limit_per_query) and RQT activation percent (runaway_detector_activation_percent) tinctest.logger.info('Setting GUCs for VLIM gp_vmem_protect_limit=%dMB, SLIM gp_vmem_limit_per_query=%dMB and RQT activation percent runaway_detector_activation_percent=%s'%(vlimMB, slimMB, activationPercent)) Command('Run gpconfig to set GUC gp_vmem_protect_limit', 'source $GPHOME/greenplum_path.sh;gpconfig -c gp_vmem_protect_limit -v %d' % vlimMB).run(validateAfter=True) Command('Run gpconfig to set GUC gp_vmem_limit_per_query', 'source $GPHOME/greenplum_path.sh;gpconfig -c gp_vmem_limit_per_query -v %d --skipvalidation' % (slimMB * 1024)).run(validateAfter=True) Command('Run gpconfig to set GUC runaway_detector_activation_percent', 'source $GPHOME/greenplum_path.sh;gpconfig -c runaway_detector_activation_percent -v %d --skipvalidation' % activationPercent).run(validateAfter=True) # Restart DB Command('Restart database for GUCs to take effect', 'source $GPHOME/greenplum_path.sh && gpstop -ar').run(validateAfter=True) def _reset_VLIM_SLIM_REDZONEPERCENT(): # Reset GUCs for VLIM (gp_vmem_protect_limit), SLIM (gp_vmem_limit_per_query) and RQT activation percent (runaway_detector_activation_percent) tinctest.logger.info('Resetting GUCs for VLIM gp_vmem_protect_limit, SLIM gp_vmem_limit_per_query, and RQT activation percent runaway_detector_activation_percent') Command('Run gpconfig to reset GUC gp_vmem_protect_limit', 'source $GPHOME/greenplum_path.sh;gpconfig -c gp_vmem_protect_limit -v 8192').run(validateAfter=True) Command('Run gpconfig to reset GUC gp_vmem_limit_per_query', 'source $GPHOME/greenplum_path.sh;gpconfig -r gp_vmem_limit_per_query --skipvalidation').run(validateAfter=True) Command('Run gpconfig to reset GUC runaway_detector_activation_percent', 'source $GPHOME/greenplum_path.sh;gpconfig -r runaway_detector_activation_percent --skipvalidation').run(validateAfter=True) # Restart DB Command('Restart database for GUCs to take effect', 'source $GPHOME/greenplum_path.sh && gpstop -ar').run(validateAfter=True) class RunawayDetectorTestCase(SQLIsolationTestCase): """ @tags runaway_query_termination """ ''' Test for Runaway Query Termination that require concurrent sessions ''' def _infer_metadata(self): super(RunawayDetectorTestCase, self)._infer_metadata() try: self.vlimMB = int(self._metadata.get('vlimMB', '8192')) # Default is 8192 self.slimMB = int(self._metadata.get('slimMB', '0')) # Default is 0 self.activationPercent = int(self._metadata.get('redzone', '80')) # Default is 80 except Exception: tinctest.logger.info("Error getting the testcase related metadata") raise def faultInjector(self, faultIdentifier, faultType, segId, sleepTime=10, numOccurences=1): tinctest.logger.info('Injecting fault: id=%s, fault=%s, segId=%d' % (faultIdentifier, faultType, segId)) finjectCmd = 'source $GPHOME/greenplum_path.sh; '\ 'gpfaultinjector -f %s '\ '-y %s --seg_dbid %d ' \ '--sleep_time_s=%d '\ '-o %d ' % (faultIdentifier, faultType, segId, sleepTime, numOccurences) tinctest.logger.info('Fault injector command: ' + finjectCmd) gpfaultinjector = Command('fault injector', finjectCmd) gpfaultinjector.run() def setUp(self): _set_VLIM_SLIM_REDZONEPERCENT(self.vlimMB, self.slimMB, self.activationPercent) # segid = 2, sleepTime = 20, numOccurences = 0 # numOccurences = 0 means we'll keep triggering the fault until we reset it self.faultInjector('runaway_cleanup', 'sleep', 2, 20, 0) return super(RunawayDetectorTestCase, self).setUp() def tearDown(self): self.faultInjector('runaway_cleanup', 'reset', 2) return super(RunawayDetectorTestCase, self).tearDown() @classmethod def setUpClass(cls): super(RunawayDetectorTestCase, cls).setUpClass() create_runaway_udf() create_session_state_view() @classmethod def tearDownClass(cls): drop_session_state_view() drop_runaway_udf() _reset_VLIM_SLIM_REDZONEPERCENT() sql_dir = 'sql/' ans_dir = 'expected' out_dir = 'output/'
{ "content_hash": "14def84501a07fb6149814a57fd3cd4f", "timestamp": "", "source": "github", "line_count": 95, "max_line_length": 213, "avg_line_length": 51.642105263157895, "alnum_prop": 0.6718304117407257, "repo_name": "kaknikhil/gpdb", "id": "36961f81f271b4e974c08736f4deebc7d465eb27", "size": "4906", "binary": false, "copies": "6", "ref": "refs/heads/master", "path": "src/test/tinc/tincrepo/resource_management/runaway_query/runaway_detector/test_runaway_detector.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Assembly", "bytes": "5665" }, { "name": "Batchfile", "bytes": "11492" }, { "name": "C", "bytes": "35311132" }, { "name": "C++", "bytes": "3781313" }, { "name": "CMake", "bytes": "17118" }, { "name": "CSS", "bytes": "7407" }, { "name": "Csound Score", "bytes": "179" }, { "name": "DTrace", "bytes": "1160" }, { "name": "Fortran", "bytes": "14777" }, { "name": "GDB", "bytes": "576" }, { "name": "Gherkin", "bytes": "734463" }, { "name": "HTML", "bytes": "191406" }, { "name": "Java", "bytes": "268244" }, { "name": "JavaScript", "bytes": "23969" }, { "name": "Lex", "bytes": "196275" }, { "name": "M4", "bytes": "104559" }, { "name": "Makefile", "bytes": "434729" }, { "name": "PLSQL", "bytes": "261269" }, { "name": "PLpgSQL", "bytes": "5487022" }, { "name": "Perl", "bytes": "3893346" }, { "name": "Perl 6", "bytes": "14377" }, { "name": "Python", "bytes": "8690818" }, { "name": "Roff", "bytes": "51338" }, { "name": "Ruby", "bytes": "26724" }, { "name": "SQLPL", "bytes": "3824391" }, { "name": "Shell", "bytes": "544188" }, { "name": "XS", "bytes": "8405" }, { "name": "XSLT", "bytes": "5779" }, { "name": "Yacc", "bytes": "488932" } ], "symlink_target": "" }
from play import Play from behavior import Behavior import plays.stopped import plays.testing.test_coach import logging from PyQt5 import QtCore import main import evaluation.double_touch import tactics.positions.goalie import role_assignment import traceback ## The RootPlay is basically the python-side of the c++ GameplayModule # it coordinates the selection of the 'actual' play and handles the goalie behavior class RootPlay(Play, QtCore.QObject): def __init__(self): QtCore.QObject.__init__(self) Play.__init__(self, continuous=True) self._play = None self._goalie_id = None self.add_transition(Behavior.State.start, Behavior.State.running, lambda: True, 'immediately') # if a play fails for some reason, we can temporarily blacklist it, which removes it from play # selection for the next iteration, then enables it again self.temporarily_blacklisted_play_class = None self._currently_restarting = False play_changed = QtCore.pyqtSignal("QString") def execute_running(self): # update double touch tracker evaluation.double_touch.tracker().spin() # cache and calculate the score() function for each play class main.play_registry().recalculate_scores() # Play Selection ################################################################################ if main.game_state().is_stopped(): evaluation.double_touch.tracker().restart() if main.game_state().is_placement(): if not isinstance(self.play, plays.restarts.placement.Placement): logging.info("Placing Ball") self.play = plays.restarts.placement.Placement() self._currently_restarting = True else: if self.play is None or not self.play.run_during_stopped(): logging.info( "Running 'Stopped' play due to game state change") self.play = plays.stopped.Stopped() self._currently_restarting = True elif main.game_state().is_halted(): evaluation.double_touch.tracker().restart() self.play = None else: # (play_class, score value) tuples enabled_plays_and_scores = [ p for p in main.play_registry().get_enabled_plays_and_scores() ] # only let restart play run once enabled_plays_and_scores = [ p for p in enabled_plays_and_scores if not p[0].is_restart() or (p[0].is_restart() and self._currently_restarting) ] # handle temporary blacklisting # we remove the blacklisted play class from selection for this iteration, then unblacklist it enabled_plays_and_scores = [ p for p in enabled_plays_and_scores if p[0] != self.temporarily_blacklisted_play_class ] self.temporarily_blacklisted_play_class = None # see if we need to kill current play or if it's done running if self.play is not None: if self.play.__class__ not in map(lambda tup: tup[0], enabled_plays_and_scores): logging.info("Current play '" + self.play.__class__.__name__ + "' no longer enabled, aborting") self.play.terminate() self.play = None elif self.play.is_done_running(): logging.info("Current play '" + self.play.__class__.__name__ + "' finished running") if self.play.is_restart: self._currently_restarting = False self.play = None elif self.play.__class__.score() == float("inf"): logging.info("Current play '" + self.play.__class__.__name__ + "' no longer applicable, ending") self.play.terminate() self.play = None if self.play is None: try: if len(enabled_plays_and_scores) > 0: # select the play with the smallest value for score() play_class_and_score = min(enabled_plays_and_scores, key=lambda tup: tup[1]) # run the play with the lowest score, as long as it isn't inf if play_class_and_score[1] != float("inf"): play_class = play_class_and_score[0] self.play = play_class() # instantiate it else: # there's no available plays to run pass except Exception as e: logging.error("Exception occurred during play selection: " + str(e)) traceback.print_exc() if self.play is not None: logging.info("Chose new play: '" + self.play.__class__.__name__ + "'") # Role Assignment ################################################################################ try: assignments = role_assignment.assign_roles( self.robots, self.role_requirements()) except role_assignment.ImpossibleAssignmentError as e: logging.error( "Unable to satisfy role assignment constraints. Dropping and temp. blacklisting current play...") self.drop_current_play(temporarily_blacklist=True) else: self.assign_roles(assignments) def handle_subbehavior_exception(self, name, exception): if name == 'goalie': logging.error("Goalie encountered an exception: " + str(exception) + ". Reloading goalie behavior") traceback.print_exc() self.drop_goalie_behavior() else: logging.error("Play '" + self.play.__class__.__name__ + "' encountered an exception: " + str(exception) + ". Dropping and temp. blacklisting current play...") traceback.print_exc() self.drop_current_play(temporarily_blacklist=True) # this is used to force a reselection of a play def drop_current_play(self, temporarily_blacklist=False): self.temporarily_blacklisted_play_class = self.play.__class__ self.play = None # this is called when the goalie behavior must be reloaded (for example when the goalie.py file is modified) def drop_goalie_behavior(self): if self.has_subbehavior_with_name('goalie'): self.remove_subbehavior('goalie') self.setup_goalie_if_needed() @property def play(self): return self._play @play.setter def play(self, value): # trash old play if self.play is not None: self.remove_subbehavior('play') self._play = None if value is not None: self._play = value # see if this play handles the goalie by itself if value.__class__.handles_goalie(): self.drop_goalie_behavior() self.add_subbehavior(value, name='play', required=True) # make sure somebody handles the goalie self.setup_goalie_if_needed() # change notification so ui can update if necessary self.play_changed.emit(self.play.__class__.__name__ if self._play is not None else "(No Play)") ## the c++ GameplayModule reaches through the language portal and sets this # note that in c++, a value of -1 indicates no assigned goalie, in python we represent the same thing with None @property def goalie_id(self): return self._goalie_id @goalie_id.setter def goalie_id(self, value): self._goalie_id = None if value == -1 else value self.setup_goalie_if_needed() logging.info("goalie_id set to: " + str(self._goalie_id)) def setup_goalie_if_needed(self): if self.goalie_id is None: if self.has_subbehavior_with_name('goalie'): self.remove_subbehavior('goalie') else: if self.has_subbehavior_with_name('goalie'): goalie = self.subbehavior_with_name('goalie') elif self.play is None or not self.play.__class__.handles_goalie(): goalie = tactics.positions.goalie.Goalie() self.add_subbehavior(goalie, 'goalie', required=True) else: goalie = None if goalie is not None: goalie.shell_id = self.goalie_id @property def robots(self): return self._robots @robots.setter def robots(self, robots): self._robots = robots if robots is not None else [] def __str__(self): return '\n'.join([str(bhvr) for bhvr in self.all_subbehaviors()])
{ "content_hash": "ccf6db3378db6d44c3afd764da807224", "timestamp": "", "source": "github", "line_count": 227, "max_line_length": 115, "avg_line_length": 41.66079295154185, "alnum_prop": 0.5308237284551126, "repo_name": "JNeiger/robocup-software", "id": "5886ab43dd5976d8bb073ef0b3fd859df55af229", "size": "9457", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "soccer/gameplay/root_play.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "C", "bytes": "2990" }, { "name": "C++", "bytes": "1083792" }, { "name": "CMake", "bytes": "112437" }, { "name": "Dockerfile", "bytes": "2872" }, { "name": "MATLAB", "bytes": "31229" }, { "name": "Makefile", "bytes": "5816" }, { "name": "Python", "bytes": "735005" }, { "name": "Shell", "bytes": "21468" } ], "symlink_target": "" }
''' Created on 15 Aug 2011 @author: kfuchsbe ''' class JPyMadGlobals(): java_gateway = None jmad_service = None enums = None
{ "content_hash": "68fc76b17e382b4d06efe0277783ec34", "timestamp": "", "source": "github", "line_count": 9, "max_line_length": 23, "avg_line_length": 15.333333333333334, "alnum_prop": 0.644927536231884, "repo_name": "pymad/jpymad", "id": "38c33def25f377b72067cab7438b65b376ac6d66", "size": "924", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "src/cern/jpymad/globals.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "CSS", "bytes": "8170" }, { "name": "Perl", "bytes": "22155" }, { "name": "Python", "bytes": "215528" }, { "name": "Shell", "bytes": "4509" } ], "symlink_target": "" }
"""OS X Launchd process listing test data. These dicts are python representations of the pyobjc NSCFDictionarys returned by the ServiceManagement framework. It's close enough to the pyobjc object that we can use it to test the parsing code without needing to run on OS X. """ # Disable some lint warnings to avoid tedious fixing of test data # pylint: disable=g-line-too-long # Number of entries we expect to be dropped due to filtering FILTERED_COUNT = 84 class FakeCFDict(object): """Fake out the CFDictionary python wrapper.""" def __init__(self, value): self.value = value def __contains__(self, key): return key in self.value def __getitem__(self, key): return self.value[key] # pylint: disable=g-bad-name def get(self, key, default='', stringify=False): if key in self.value: if stringify: obj = str(self.value[key]) else: obj = self.value[key] else: obj = default return obj # pylint: enable=g-bad-name class FakeCFObject(object): """Fake CFString and other wrapped objects.""" def __init__(self, value): self.value = value def __int__(self): return int(self.value) JOB = [ FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.FileSyncAgent.PHD', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.FileSyncAgent.PHD': 0, 'com.apple.FileSyncAgent.PHD.isRunning': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/CoreServices/FileSyncAgent.app/Contents/MacOS/FileSyncAgent' ), FakeCFObject('-launchedByLaunchd'), FakeCFObject('-PHDPlist') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), ] JOBS = [ FakeCFDict({ 'Label': '0x7f8759d20ab0.mach_init.Inspector', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': '[0x0-0x4d44d4].com.google.GoogleTalkPluginD[32298].subset.257', 'MachServices': { 'com.Google.BreakpadInspector32298': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/Library/Application ' 'Support/Google/GoogleTalkPlugin.app/Contents/Frameworks/GoogleBreakpad.framework/Versions/A/Resources/Inspector' ), FakeCFObject('com.Google.BreakpadInspector32298') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c23570.mach_init.crash_inspector', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32284].subset.584', 'MachServices': { 'com.Breakpad.Inspector32284': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/Applications/Google ' 'Chrome.app/Contents/Versions/21.0.1180.79/Google Chrome ' 'Framework.framework/Resources/crash_inspector'), FakeCFObject('com.Breakpad.Inspector32284') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.coreservices.appleid.authentication', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.coreservices.appleid.authentication': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/CoreServices/AppleIDAuthAgent', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d30310.anonymous.launchd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[35271].subset.440', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(499), 'Program': 'launchd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c23ae0.anonymous.launchd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32282].subset.281', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(499), 'Program': 'launchd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d30610.mach_init.crash_inspector', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[35271].subset.440', 'MachServices': { 'com.Breakpad.Inspector35271': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/Applications/Google ' 'Chrome.app/Contents/Versions/21.0.1180.79/Google Chrome ' 'Framework.framework/Resources/crash_inspector'), FakeCFObject('com.Breakpad.Inspector35271') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.systemprofiler', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.systemprofiler': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/Applications/Utilities/System ' 'Information.app/Contents/MacOS/System Information', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d2b140.anonymous.bash', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(69813), 'Program': 'login', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d318d0.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': {}, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(60522), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.axserver': 0, 'com.apple.tsm.portname': 0, }, 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d1fb70.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': {}, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32285), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.axserver': 0, 'com.apple.tsm.portname': 0, }, 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c22f60.anonymous.Google Chrome', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32284].subset.584', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32275), 'Program': 'Google Chrome', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.FontWorker', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.FontWorker': 0, 'com.apple.FontWorker.ATS': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/Frameworks/ApplicationServices.framework/Versions/A/Frameworks/ATS.framework/Versions/A/Support/fontworker', 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759d1d200.mach_init.crash_inspector', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': '[0x0-0x4c54c5].com.google.Chrome[32275].subset.632', 'MachServices': { 'com.Breakpad.Inspector32275': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/Applications/Google ' 'Chrome.app/Contents/Versions/21.0.1180.79/Google Chrome ' 'Framework.framework/Resources/crash_inspector'), FakeCFObject('com.Breakpad.Inspector32275') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.UserNotificationCenterAgent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.UNCUserNotificationAgent': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/CoreServices/UserNotificationCenter.app/Contents/MacOS/UserNotificationCenter' ) ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d30f40.anonymous.Google Chrome C', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[60520].subset.399', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(60513), 'Program': 'Google Chrome C', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.bluetoothUIServer', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.bluetoothUIServer': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/CoreServices/BluetoothUIServer.app/Contents/MacOS/BluetoothUIServer', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.SubmitDiagInfo', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject('/System/Library/CoreServices/SubmitDiagInfo') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.gssd-agent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.gssd-agent': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/usr/sbin/gssd', 'ProgramArguments': [FakeCFObject('gssd-agent')], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '[0x0-0x4d44d4].com.google.GoogleTalkPluginD', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': {}, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32298), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.CFPasteboardClient': 0, 'com.apple.axserver': 0, 'com.apple.tsm.portname': 0, }, 'ProgramArguments': [ FakeCFObject( '/Library/Application ' 'Support/Google/GoogleTalkPlugin.app/Contents/MacOS/GoogleTalkPlugin' ), FakeCFObject('-psn_0_5063892') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.quicklook.config', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.quicklook.config': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/QuickLook.framework/Resources/quicklookconfig' ) ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759c2fda0.anonymous.login', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(83461), 'Program': 'login', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c12410.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': {}, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32297), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.CFPasteboardClient': 0, 'com.apple.axserver': 0, 'com.apple.tsm.portname': 0, }, 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c2cec0.anonymous.bash', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(73991), 'Program': 'login', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c24ca0.anonymous.login', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(24592), 'Program': 'login', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c17720.mach_init.crash_inspector', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[35104].subset.553', 'MachServices': { 'com.Breakpad.Inspector35104': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/Applications/Google ' 'Chrome.app/Contents/Versions/21.0.1180.79/Google Chrome ' 'Framework.framework/Resources/crash_inspector'), FakeCFObject('com.Breakpad.Inspector35104') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d1cf00.anonymous.login', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(38234), 'Program': 'login', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c2e870.anonymous.configd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(17), 'Program': 'configd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c23de0.mach_init.crash_inspector', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32282].subset.281', 'MachServices': { 'com.Breakpad.Inspector32282': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/Applications/Google ' 'Chrome.app/Contents/Versions/21.0.1180.79/Google Chrome ' 'Framework.framework/Resources/crash_inspector'), FakeCFObject('com.Breakpad.Inspector32282') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.spindump_agent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.spinreporteragent': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [FakeCFObject('/usr/libexec/spindump_agent')], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759c16550.anonymous.login', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(73954), 'Program': 'login', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c2f1a0.anonymous.configd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(17), 'Program': 'configd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.ZoomWindow', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.ZoomWindow.running': 0, 'com.apple.ZoomWindow.startup': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/CoreServices/ZoomWindow.app/Contents/MacOS/ZoomWindowStarter' ), FakeCFObject('launchd'), FakeCFObject('-s') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759c17a30.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': {}, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(35104), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.axserver': 0, 'com.apple.tsm.portname': 0, }, 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.syncservices.uihandler', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.syncservices.uihandler': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/PrivateFrameworks/SyncServicesUI.framework/Versions/Current/Resources/syncuid.app/Contents/MacOS/syncuid', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c17110.anonymous.Google Chrome', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[35104].subset.553', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32275), 'Program': 'Google Chrome', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.DictionaryPanelHelper', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.DictionaryPanelHelper': 0, 'com.apple.DictionaryPanelHelper.reply': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/Applications/Dictionary.app/Contents/SharedSupport/DictionaryPanelHelper.app/Contents/MacOS/DictionaryPanelHelper', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c1d630.anonymous.Python', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(69592), 'Program': 'python', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.talagent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.window_proxies': 0, 'com.apple.window_proxies.startup': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(639), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.CFPasteboardClient': 0, 'com.apple.axserver': 0, 'com.apple.tsm.portname': 0, }, 'Program': '/System/Library/CoreServices/talagent', 'TimeOut': FakeCFObject(30), 'TransactionCount': 0, }), FakeCFDict({ 'Label': '0x7f8759c1f7f0.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[60522].subset.309', 'MachServices': { 'com.Breakpad.BootstrapParent': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(60522), 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.speech.recognitionserver', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.speech.recognitionserver': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/Frameworks/Carbon.framework/Frameworks/SpeechRecognition.framework/Versions/A/SpeechRecognitionServer.app/Contents/MacOS/SpeechRecognitionServer', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c2faa0.anonymous.Python', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(82320), 'Program': 'python', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.cvmsCompAgent_x86_64', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.cvmsCompAgent_x86_64': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/OpenGL.framework/Versions/A/Libraries/CVMCompiler' ), FakeCFObject('1') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759c23270.anonymous.launchd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32284].subset.584', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(499), 'Program': 'launchd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d30c30.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[60520].subset.399', 'MachServices': { 'com.Breakpad.BootstrapParent': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(60520), 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.printuitool.agent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.printuitool.agent': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/PrivateFrameworks/PrintingPrivate.framework/Versions/A/PrintUITool' ) ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759d29b20.anonymous.bash', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(46172), 'Program': 'login', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.coreservices.uiagent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.coreservices.launcherror-handler': 0, 'com.apple.coreservices.quarantine-resolver': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/CoreServices/CoreServicesUIAgent.app/Contents/MacOS/CoreServicesUIAgent', 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.mdworker.pool.1', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.mdworker.pool.1': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/CoreServices.framework/Frameworks/Metadata.framework/Versions/A/Support/mdworker' ), FakeCFObject('-s'), FakeCFObject('mdworker'), FakeCFObject('-c'), FakeCFObject('MDSImporterWorker'), FakeCFObject('-m'), FakeCFObject('com.apple.mdworker.pool.1') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '[0x0-0x21021].com.google.GoogleDrive', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': {}, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(763), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.CFPasteboardClient': 0, 'com.apple.axserver': 0, 'com.apple.coredrag': 0, 'com.apple.tsm.portname': 0, }, 'ProgramArguments': [ FakeCFObject( '/Applications/Google Drive.app/Contents/MacOS/Google Drive'), FakeCFObject('-psn_0_135201') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.cvmsCompAgent_i386', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.cvmsCompAgent_i386': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/OpenGL.framework/Versions/A/Libraries/CVMCompiler' ), FakeCFObject('1') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759c2b8b0.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32284].subset.584', 'MachServices': { 'com.Breakpad.BootstrapParent': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32284), 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d1f860.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': {}, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32283), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.axserver': 0, 'com.apple.tsm.portname': 0, }, 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.VoiceOver', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.VoiceOver.running': 0, 'com.apple.VoiceOver.startup': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/CoreServices/VoiceOver.app/Contents/MacOS/VoiceOver' ), FakeCFObject('launchd'), FakeCFObject('-s') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759d2e7b0.anonymous.tail', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(74455), 'Program': 'tail', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.PreferenceSyncAgent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/CoreServices/PreferenceSyncClient.app/Contents/MacOS/PreferenceSyncClient' ), FakeCFObject('--sync'), FakeCFObject('--periodic') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c15a50.anonymous.login', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(38234), 'Program': 'login', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.mdworker.i386.framework.0', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.mdworker.i386.framework.0': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/CoreServices.framework/Frameworks/Metadata.framework/Versions/A/Support/mdworker32' ), FakeCFObject('-s'), FakeCFObject('mdworker-lsb'), FakeCFObject('-c'), FakeCFObject('MDSImporterWorker'), FakeCFObject('-m'), FakeCFObject('com.apple.mdworker.i386.framework.0') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': 'com.apple.launchctl.Background', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject('/bin/launchctl'), FakeCFObject('bootstrap'), FakeCFObject('-S'), FakeCFObject('Background') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.speech.synthesisserver', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.speech.synthesis.ScreenReaderPort': 0, 'com.apple.speech.synthesis.SpeakingHotKeyPort': 0, 'com.apple.speech.synthesis.TimeAnnouncementsPort': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/Frameworks/ApplicationServices.framework/Versions/A/Frameworks/SpeechSynthesis.framework/Versions/A/SpeechSynthesisServer.app/Contents/MacOS/SpeechSynthesisServer', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d207b0.anonymous.launchd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': '[0x0-0x4d44d4].com.google.GoogleTalkPluginD[32298].subset.257', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(499), 'Program': 'launchd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.ATS.FontValidatorConduit', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.ATS.FontValidatorConduit': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/Frameworks/ApplicationServices.framework/Versions/A/Frameworks/ATS.framework/Versions/A/Support/FontValidatorConduit', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.fontd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.FontObjectsServer': 0, 'com.apple.FontServer': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(640), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/ApplicationServices.framework/Frameworks/ATS.framework/Support/fontd' ) ], 'TimeOut': FakeCFObject(30), 'TransactionCount': 0, }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.quicklook', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.quicklook': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/QuickLook.framework/Resources/quicklookd.app/Contents/MacOS/quicklookd' ) ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759d29e20.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': {}, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(35271), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.axserver': 0, 'com.apple.tsm.portname': 0, }, 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d20db0.anonymous.sshd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(68600), 'Program': 'sshd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.unmountassistant.useragent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.unmountassistant.useragent': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/CoreServices/UnmountAssistantAgent.app/Contents/MacOS/UnmountAssistantAgent' ) ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759d1ebf0.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': {}, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32282), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.axserver': 0, 'com.apple.tsm.portname': 0, }, 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.installd.user', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.installd.user': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/PrivateFrameworks/PackageKit.framework/Resources/installd' ) ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d33ce0.anonymous.login', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(46170), 'Program': 'login', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c240f0.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': {}, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32284), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.axserver': 0, 'com.apple.tsm.portname': 0, }, 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.syncdefaultsd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.syncdefaultsd': 0, 'com.apple.syncdefaultsd.push': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/PrivateFrameworks/SyncedDefaults.framework/Support/syncdefaultsd' ) ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.marcoagent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.marco': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/PrivateFrameworks/Marco.framework/marcoagent') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.distnoted.xpc.agent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.distributed_notifications@Uv3': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(625), 'ProgramArguments': [ FakeCFObject('/usr/sbin/distnoted'), FakeCFObject('agent') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': 42, }), FakeCFDict({ 'Label': '0x7f8759c2eb70.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32282].subset.281', 'MachServices': { 'com.Breakpad.BootstrapParent': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32282), 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d28f10.anonymous.login', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(83461), 'Program': 'login', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c1fb00.anonymous.Google Chrome C', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[60522].subset.309', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(60513), 'Program': 'Google Chrome C', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.bluetoothAudioAgent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.bluetoothAudioAgent': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/CoreServices/BluetoothAudioAgent.app/Contents/MacOS/BluetoothAudioAgent' ) ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.mdworker.pool.framework.0', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.mdworker.pool.framework.0': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/CoreServices.framework/Frameworks/Metadata.framework/Versions/A/Support/mdworker' ), FakeCFObject('-s'), FakeCFObject('mdworker'), FakeCFObject('-c'), FakeCFObject('MDSImporterWorker'), FakeCFObject('-m'), FakeCFObject('com.apple.mdworker.pool.framework.0') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759d20190.mach_init.crash_inspector', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32297].subset.637', 'MachServices': { 'com.Breakpad.Inspector32297': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/Applications/Google ' 'Chrome.app/Contents/Versions/21.0.1180.79/Google Chrome ' 'Framework.framework/Resources/crash_inspector'), FakeCFObject('com.Breakpad.Inspector32297') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': '[0x0-0x19019].com.apple.AppleSpell', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'Multilingual (Apple)_OpenStep': 0, 'da (Apple)_OpenStep': 0, 'de (Apple)_OpenStep': 0, 'en (Apple)_OpenStep': 0, 'en_AU (Apple)_OpenStep': 0, 'en_CA (Apple)_OpenStep': 0, 'en_GB (Apple)_OpenStep': 0, 'en_JP (Apple)_OpenStep': 0, 'en_US (Apple)_OpenStep': 0, 'es (Apple)_OpenStep': 0, 'fr (Apple)_OpenStep': 0, 'it (Apple)_OpenStep': 0, 'nl (Apple)_OpenStep': 0, 'pt (Apple)_OpenStep': 0, 'pt_BR (Apple)_OpenStep': 0, 'pt_PT (Apple)_OpenStep': 0, 'ru (Apple)_OpenStep': 0, 'sv (Apple)_OpenStep': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(727), 'ProgramArguments': [ FakeCFObject( '/System/Library/Services/AppleSpell.service/Contents/MacOS/AppleSpell' ), FakeCFObject('-psn_0_102425') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': 0, }), FakeCFDict({ 'Label': '0x7f8759d22370.anonymous.Google Chrome', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32656].subset.619', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32275), 'Program': 'Google Chrome', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d2f3c0.mach_init.crash_inspector', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': '[0x0-0x34c34c].com.google.Chrome.canary[60513].subset.374', 'MachServices': { 'com.Breakpad.Inspector60513': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/Applications/Google Chrome ' 'Canary.app/Contents/Versions/180.1.1025.40/Google Chrome ' 'Framework.framework/Resources/crash_inspector'), FakeCFObject('com.Breakpad.Inspector60513') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.mdworker.pool.framework.1', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.mdworker.pool.framework.1': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/CoreServices.framework/Frameworks/Metadata.framework/Versions/A/Support/mdworker' ), FakeCFObject('-s'), FakeCFObject('mdworker'), FakeCFObject('-c'), FakeCFObject('MDSImporterWorker'), FakeCFObject('-m'), FakeCFObject('com.apple.mdworker.pool.framework.1') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.mdworker.lsb.framework.0', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.mdworker.lsb.framework.0': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/CoreServices.framework/Frameworks/Metadata.framework/Versions/A/Support/mdworker' ), FakeCFObject('-s'), FakeCFObject('mdworker-lsb'), FakeCFObject('-c'), FakeCFObject('MDSImporterWorker'), FakeCFObject('-m'), FakeCFObject('com.apple.mdworker.lsb.framework.0') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759c16060.anonymous.bash', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(68666), 'Program': 'sshd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.store_helper', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.store_helper': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/PrivateFrameworks/CommerceKit.framework/Resources/store_helper.app/Contents/MacOS/store_helper', 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.mdworker.pool.framework.2', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.mdworker.pool.framework.2': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/CoreServices.framework/Frameworks/Metadata.framework/Versions/A/Support/mdworker' ), FakeCFObject('-s'), FakeCFObject('mdworker'), FakeCFObject('-c'), FakeCFObject('MDSImporterWorker'), FakeCFObject('-m'), FakeCFObject('com.apple.mdworker.pool.framework.2') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': 'com.apple.FontRegistryUIAgent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.FontRegistry.FontRegistryUIAgent': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/Frameworks/ApplicationServices.framework/Frameworks/ATS.framework/Support/FontRegistryUIAgent.app/Contents/MacOS/FontRegistryUIAgent', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.softwareupdateagent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject('/System/Library/CoreServices/Software ' 'Update.app/Contents/Resources/SoftwareUpdateCheck'), FakeCFObject('-LaunchApp'), FakeCFObject('YES') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.ubd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/PrivateFrameworks/Ubiquity.framework/Versions/A/Support/ubd' ) ], 'Sockets': { 'Apple_Ubiquity_Message': ('-1'), }, 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d07d60.anonymous.applepushservic', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(85), 'Program': 'applepushservic', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c1c700.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32291].subset.223', 'MachServices': { 'com.Breakpad.BootstrapParent': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32291), 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d2c7e0.anonymous.Google Chrome', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32438].subset.554', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32275), 'Program': 'Google Chrome', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c103c0.anonymous.bash', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(24593), 'Program': 'login', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.mdworker.pool.framework.3', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.mdworker.pool.framework.3': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/CoreServices.framework/Frameworks/Metadata.framework/Versions/A/Support/mdworker' ), FakeCFObject('-s'), FakeCFObject('mdworker'), FakeCFObject('-c'), FakeCFObject('MDSImporterWorker'), FakeCFObject('-m'), FakeCFObject('com.apple.mdworker.pool.framework.3') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.ScreenReaderUIServer', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.ScreenReaderUIServer': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/PrivateFrameworks/ScreenReader.framework/Resources/ScreenReaderUIServer.app/Contents/MacOS/ScreenReaderUIServer', 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759c1ab70.anonymous.Google Chrome', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32283].subset.231', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32275), 'Program': 'Google Chrome', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '[0x0-0x34c34c].com.google.Chrome.canary', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.google.Chrome.canary.rohitfork.60513': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(60513), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.CFPasteboardClient': 0, 'com.apple.axserver': 0, 'com.apple.coredrag': 0, 'com.apple.tsm.portname': 0, }, 'ProgramArguments': [ FakeCFObject( '/Applications/Google Chrome Canary.app/Contents/MacOS/Google ' 'Chrome Canary'), FakeCFObject('-psn_0_3457868') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c1bde0.anonymous.launchd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32285].subset.229', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(499), 'Program': 'launchd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.warmd_agent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(737), 'ProgramArguments': [FakeCFObject('/usr/libexec/warmd_agent')], 'TimeOut': FakeCFObject(30), 'TransactionCount': 0, }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.ATS.FontValidator', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.ATS.FontValidator': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/Frameworks/ApplicationServices.framework/Versions/A/Frameworks/ATS.framework/Versions/A/Support/FontValidator', 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759c115d0.anonymous.Google Chrome C', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[60518].subset.363', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(60513), 'Program': 'Google Chrome C', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.mdworker.pool.3', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.mdworker.pool.3': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/CoreServices.framework/Frameworks/Metadata.framework/Versions/A/Support/mdworker' ), FakeCFObject('-s'), FakeCFObject('mdworker'), FakeCFObject('-c'), FakeCFObject('MDSImporterWorker'), FakeCFObject('-m'), FakeCFObject('com.apple.mdworker.pool.3') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759c1e5a0.mach_init.crash_inspector', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[60518].subset.363', 'MachServices': { 'com.Breakpad.Inspector60518': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/Applications/Google Chrome ' 'Canary.app/Contents/Versions/180.1.1025.40/Google Chrome ' 'Framework.framework/Resources/crash_inspector'), FakeCFObject('com.Breakpad.Inspector60518') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.RemoteDesktop.agent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.RemoteDesktop.agent': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/CoreServices/RemoteManagement/ARDAgent.app/Contents/MacOS/ARDAgent', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c24490.anonymous.launchd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[60518].subset.363', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(499), 'Program': 'launchd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c18730.anonymous.sh', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(68799), 'Program': 'sh', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d2fcf0.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[35271].subset.440', 'MachServices': { 'com.Breakpad.BootstrapParent': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(35271), 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.FTCleanup', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject('/bin/sh'), FakeCFObject('-c'), FakeCFObject( "if [ \"$HOME\" == \"/System\" ], then exit 0, fi, if [ -f " "\"$HOME/Library/LaunchAgents/com.apple.imagent.plist\" ] , " 'then launchctl unload -wF ' '~/Library/LaunchAgents/com.apple.imagent.plist , launchctl ' 'load -wF /System/Library/LaunchAgents/com.apple.imagent.plist' ' , fi , if [ -f ' "\"$HOME/Library/LaunchAgents/com.apple.apsd-ft.plist\" ] , " "then launchctl unload -wF -S 'Aqua' " '~/Library/LaunchAgents/com.apple.apsd-ft.plist, fi , if [ -f ' "\"$HOME/Library/LaunchAgents/com.apple.marcoagent.plist\" ] ," ' then launchctl unload -wF ' '~/Library/LaunchAgents/com.apple.marcoagent.plist , launchctl' ' load -wF ' '/System/Library/LaunchAgents/com.apple.marcoagent.plist , fi ' ', if [ -f ' "\"$HOME/Library/LaunchAgents/com.apple.FTMonitor.plist\" ] , " 'then launchctl unload -wF ' '~/Library/LaunchAgents/com.apple.FTMonitor.plist , fi ,') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.mdworker.isolation.0', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.mdworker.isolation.0': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/CoreServices.framework/Frameworks/Metadata.framework/Versions/A/Support/mdworker' ), FakeCFObject('-s'), FakeCFObject('mdworker'), FakeCFObject('-c'), FakeCFObject('MDSImporterWorker'), FakeCFObject('-m'), FakeCFObject('com.apple.mdworker.isolation.0') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': 'com.apple.netauth.user.gui', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.netauth.user.gui': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/CoreServices/NetAuthAgent.app/Contents/MacOS/NetAuthAgent' ) ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d28310.anonymous.bash', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(83462), 'Program': 'login', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d31250.anonymous.launchd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[60520].subset.399', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(499), 'Program': 'launchd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': '[0x0-0x9009].com.apple.Terminal', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.Terminal.ServiceProvider': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(634), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.CFPasteboardClient': 0, 'com.apple.axserver': 0, 'com.apple.coredrag': 0, 'com.apple.tsm.portname': 0, }, 'ProgramArguments': [ FakeCFObject( '/Applications/Utilities/Terminal.app/Contents/MacOS/Terminal'), FakeCFObject('-psn_0_36873') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': 1, }), FakeCFDict({ 'Label': '0x7f8759c2d1c0.anonymous.su', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(74539), 'Program': 'su', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c1d940.anonymous.sshd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(68714), 'Program': 'sshd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'org.openbsd.ssh-agent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(46009), 'ProgramArguments': [ FakeCFObject('/usr/bin/ssh-agent'), FakeCFObject('-l') ], 'Sockets': { 'Listeners': ('-1'), }, 'TimeOut': FakeCFObject(30), 'TransactionCount': 0, }), FakeCFDict({ 'Label': 'com.apple.familycontrols.useragent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.familycontrols.useragent': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/PrivateFrameworks/FamilyControls.framework/Resources/ParentalControls.app/Contents/MacOS/ParentalControls' ) ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c1b7c0.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32285].subset.229', 'MachServices': { 'com.Breakpad.BootstrapParent': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32285), 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.AppStoreUpdateAgent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.AppStoreUpdateAgent': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/Applications/App Store.app/Contents/Resources/appstoreupdateagent', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.csuseragent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.csuseragent': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject('/System/Library/CoreServices/CSUserAgent') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.PubSub.Agent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.pubsub.ipc': 0, 'com.apple.pubsub.notification': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/PubSub.framework/Versions/A/Resources/PubSubAgent.app/Contents/MacOS/PubSubAgent' ) ], 'Sockets': { 'Render': ('-1'), }, 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.rcd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.rcd': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/CoreServices/rcd.app/Contents/MacOS/rcd') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': 'com.apple.netauth.user.auth', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.netauth.user.auth': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/CoreServices/NetAuthAgent.app/Contents/MacOS/NetAuthSysAgent' ) ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c1dc40.anonymous.bash', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(68720), 'Program': 'sshd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c2f7a0.anonymous.bash', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(75030), 'Program': 'login', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.BezelUIServer', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.BezelUI': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/LoginPlugins/BezelServices.loginPlugin/Contents/Resources/BezelUI/BezelUIServer' ) ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c0cf00.anonymous.com.apple.dock.', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': {}, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(652), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.CFPasteboardClient': 0, 'com.apple.axserver': 0, 'com.apple.tsm.portname': 0, }, 'Program': 'com.apple.dock.', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d28c10.anonymous.bash', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(83462), 'Program': 'bash', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.xgridd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.xgridd': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [FakeCFObject('/usr/libexec/xgrid/xgridd')], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': 'com.apple.reclaimspace', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.ReclaimSpace': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/CoreServices/backupd.bundle/Contents/Resources/ReclaimSpaceAgent.app/Contents/MacOS/ReclaimSpaceAgent', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d31550.mach_init.crash_inspector', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[60520].subset.399', 'MachServices': { 'com.Breakpad.Inspector60520': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/Applications/Google Chrome ' 'Canary.app/Contents/Versions/180.1.1025.40/Google Chrome ' 'Framework.framework/Resources/crash_inspector'), FakeCFObject('com.Breakpad.Inspector60520') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '[0x0-0x4c54c5].com.google.Chrome', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.google.Chrome.rohitfork.32275': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32275), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.CFPasteboardClient': 0, 'com.apple.axserver': 0, 'com.apple.coredrag': 0, 'com.apple.tsm.portname': 0, }, 'ProgramArguments': [ FakeCFObject( '/Applications/Google Chrome.app/Contents/MacOS/Google Chrome'), FakeCFObject('-psn_0_5002437') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c0c320.anonymous.loginwindow', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(71), 'Program': 'loginwindow', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.mdworker.lsb.0', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.mdworker.lsb.0': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/CoreServices.framework/Frameworks/Metadata.framework/Versions/A/Support/mdworker' ), FakeCFObject('-s'), FakeCFObject('mdworker-lsb'), FakeCFObject('-c'), FakeCFObject('MDSImporterWorker'), FakeCFObject('-m'), FakeCFObject('com.apple.mdworker.lsb.0') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': 'com.apple.midiserver', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.midiserver': 0, 'com.apple.midiserver.io': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/CoreMIDI.framework/MIDIServer') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c15d50.anonymous.eapolclient', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(68168), 'Program': 'eapolclient', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.AddressBook.SourceSync', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.AddressBook.PushNotification': 0, 'com.apple.AddressBook.SourceSync': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/AddressBook.framework/Versions/A/Resources/AddressBookSourceSync.app/Contents/MacOS/AddressBookSourceSync' ) ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.mdworker.i386.0', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.mdworker.i386.0': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/CoreServices.framework/Frameworks/Metadata.framework/Versions/A/Support/mdworker32' ), FakeCFObject('-s'), FakeCFObject('mdworker-lsb'), FakeCFObject('-c'), FakeCFObject('MDSImporterWorker'), FakeCFObject('-m'), FakeCFObject('com.apple.mdworker.i386.0') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759d2a8d0.mach_init.crash_inspector', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32438].subset.554', 'MachServices': { 'com.Breakpad.Inspector32438': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/Applications/Google ' 'Chrome.app/Contents/Versions/21.0.1180.79/Google Chrome ' 'Framework.framework/Resources/crash_inspector'), FakeCFObject('com.Breakpad.Inspector32438') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d2a130.anonymous.launchd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32656].subset.619', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(499), 'Program': 'launchd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c1c0e0.mach_init.crash_inspector', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32285].subset.229', 'MachServices': { 'com.Breakpad.Inspector32285': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/Applications/Google ' 'Chrome.app/Contents/Versions/21.0.1180.79/Google Chrome ' 'Framework.framework/Resources/crash_inspector'), FakeCFObject('com.Breakpad.Inspector32285') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c15450.anonymous.sshd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(68665), 'Program': 'sshd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.tiswitcher', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.inputswitcher.running': 0, 'com.apple.inputswitcher.startup': 0, 'com.apple.inputswitcher.stop': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/CoreServices/Menu ' 'Extras/TextInput.menu/Contents/SharedSupport/TISwitcher.app/Contents/MacOS/TISwitcher', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.java.InstallOnDemandAgent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.java.installondemand': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/Java/Support/CoreDeploy.bundle/Contents/Download ' 'Java Components.app/Contents/MacOS/Download Java Components', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c1a860.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32283].subset.231', 'MachServices': { 'com.Breakpad.BootstrapParent': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32283), 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.cookied', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.cookied': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/CoreServices.framework/Versions/A/Frameworks/CFNetwork.framework/Versions/A/Support/cookied' ) ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': 'com.apple.speech.feedbackservicesserver', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.speech.feedbackservicesserver': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/Frameworks/Carbon.framework/Frameworks/SpeechRecognition.framework/Versions/A/SpeechFeedbackWindow.app/Contents/MacOS/SpeechFeedbackWindow', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c1d020.mach_init.crash_inspector', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32291].subset.223', 'MachServices': { 'com.Breakpad.Inspector32291': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/Applications/Google ' 'Chrome.app/Contents/Versions/21.0.1180.79/Google Chrome ' 'Framework.framework/Resources/crash_inspector'), FakeCFObject('com.Breakpad.Inspector32291') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.AddressBook.abd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.AddressBook.abd': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/AddressBook.framework/Versions/A/Resources/AddressBookManager.app/Contents/MacOS/AddressBookManager' ) ], 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': 'com.apple.cfnetwork.AuthBrokerAgent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.cfnetwork.AuthBrokerAgent': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject('/System/Library/CoreServices/AuthBrokerAgent') ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.SystemUIServer.agent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.BluetoothMEDOServer': 0, 'com.apple.SUISMessaging': 0, 'com.apple.dockextra.server': 0, 'com.apple.dockling.server': 0, 'com.apple.ipodserver': 0, 'com.apple.systemuiserver.ServiceProvider': 0, 'com.apple.systemuiserver.screencapture': 0, 'com.apple.tsm.uiserver': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(641), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.CFPasteboardClient': 0, 'com.apple.axserver': 0, 'com.apple.coredrag': 0, 'com.apple.tsm.portname': 0, }, 'Program': '/System/Library/CoreServices/SystemUIServer.app/Contents/MacOS/SystemUIServer', 'TimeOut': FakeCFObject(30), 'TransactionCount': 0, }), FakeCFDict({ 'Label': 'com.apple.safaridavclient', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.safaridavclient': 0, 'com.apple.safaridavclient.push': 0, }, 'OnDemand': FakeCFObject(1), 'ProgramArguments': [ FakeCFObject( '/System/Library/PrivateFrameworks/BookmarkDAV.framework/Helpers/SafariDAVClient' ) ], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.Dock.agent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.dock.appstore': 0, 'com.apple.dock.downloads': 0, 'com.apple.dock.fullscreen': 0, 'com.apple.dock.server': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(638), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.axserver': 0, 'com.apple.coredrag': 0, }, 'Program': '/System/Library/CoreServices/Dock.app/Contents/MacOS/Dock', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': 'com.apple.TrustEvaluationAgent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.TrustEvaluationAgent': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/PrivateFrameworks/TrustEvaluationAgent.framework/Resources/trustevaluationagent', 'ProgramArguments': [FakeCFObject('trustevaluationagent')], 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.storeagent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.storeagent': 0, 'com.apple.storeagent-xpc': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/PrivateFrameworks/CommerceKit.framework/Versions/A/Resources/storeagent', 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.imklaunchagent', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': { 'com.apple.inputmethodkit.launchagent': 0, 'com.apple.inputmethodkit.launcher': 0, }, 'OnDemand': FakeCFObject(1), 'Program': '/System/Library/Frameworks/InputMethodKit.framework/Resources/imklaunchagent', 'TimeOut': FakeCFObject(30), 'TransactionCount': '-1', }), FakeCFDict({ 'Label': '0x7f8759c1cd20.anonymous.launchd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32291].subset.223', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(499), 'Program': 'launchd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d2eab0.anonymous.su', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(74539), 'Program': 'su', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c2ee80.anonymous.Google Chrome', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32282].subset.281', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(32275), 'Program': 'Google Chrome', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d2f9e0.anonymous.Google Chrome H', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'MachServices': {}, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(60518), 'PerJobMachServices': { 'WakeUpProcessPort': 0, 'com.apple.axserver': 0, 'com.apple.tsm.portname': 0, }, 'Program': 'Google Chrome H', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c16e10.anonymous.launchd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(499), 'Program': 'launchd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'EnableTransactions': 1, 'Label': 'com.apple.mdworker.pool.0', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'MachServices': { 'com.apple.mdworker.pool.0': 0, }, 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(68737), 'PerJobMachServices': { 'WakeUpProcessPort': 0, }, 'ProgramArguments': [ FakeCFObject( '/System/Library/Frameworks/CoreServices.framework/Frameworks/Metadata.framework/Versions/A/Support/mdworker' ), FakeCFObject('-s'), FakeCFObject('mdworker'), FakeCFObject('-c'), FakeCFObject('MDSImporterWorker'), FakeCFObject('-m'), FakeCFObject('com.apple.mdworker.pool.0') ], 'TimeOut': FakeCFObject(30), 'TransactionCount': 0, }), FakeCFDict({ 'Label': '0x7f8759d1f460.anonymous.launchd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': '[0x0-0x4c54c5].com.google.Chrome[32275].subset.632', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(499), 'Program': 'launchd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d1e8f0.anonymous.launchd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Google Chrome H[32297].subset.637', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(499), 'Program': 'launchd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759c1d330.anonymous.sshd', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Background', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(68710), 'Program': 'sshd', 'TimeOut': FakeCFObject(30), }), FakeCFDict({ 'Label': '0x7f8759d2ba80.anonymous.sudo', 'LastExitStatus': FakeCFObject(0), 'LimitLoadToSessionType': 'Aqua', 'OnDemand': FakeCFObject(1), 'PID': FakeCFObject(68719), 'Program': 'sudo', 'TimeOut': FakeCFObject(30), }) ] # pylint: enable=g-line-too-long
{ "content_hash": "b616f0f588805bbcba3bae39b2cebf44", "timestamp": "", "source": "github", "line_count": 2984, "max_line_length": 193, "avg_line_length": 31.373994638069703, "alnum_prop": 0.5263939329203162, "repo_name": "google/grr", "id": "56dceb7f91efbbcaf8a331dd32e8cb0d59fa97de", "size": "93642", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "grr/test_lib/osx_launchd_testdata.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "C", "bytes": "12697" }, { "name": "C++", "bytes": "54814" }, { "name": "Dockerfile", "bytes": "1822" }, { "name": "HCL", "bytes": "8451" }, { "name": "HTML", "bytes": "366783" }, { "name": "JavaScript", "bytes": "13088" }, { "name": "Jupyter Notebook", "bytes": "199216" }, { "name": "Makefile", "bytes": "3244" }, { "name": "PowerShell", "bytes": "531" }, { "name": "Python", "bytes": "8844725" }, { "name": "Roff", "bytes": "444" }, { "name": "SCSS", "bytes": "105120" }, { "name": "Shell", "bytes": "48663" }, { "name": "Standard ML", "bytes": "8172" }, { "name": "TypeScript", "bytes": "2139377" } ], "symlink_target": "" }
"""Mean shift clustering algorithm. Mean shift clustering aims to discover *blobs* in a smooth density of samples. It is a centroid based algorithm, which works by updating candidates for centroids to be the mean of the points within a given region. These candidates are then filtered in a post-processing stage to eliminate near-duplicates to form the final set of centroids. Seeding is performed using a binning technique for scalability. """ # Authors: Conrad Lee <conradlee@gmail.com> # Alexandre Gramfort <alexandre.gramfort@inria.fr> # Gael Varoquaux <gael.varoquaux@normalesup.org> # Martino Sorbaro <martino.sorbaro@ed.ac.uk> import numpy as np import warnings from joblib import Parallel from collections import defaultdict from ..utils.validation import check_is_fitted from ..utils.fixes import delayed from ..utils import check_random_state, gen_batches, check_array from ..base import BaseEstimator, ClusterMixin from ..neighbors import NearestNeighbors from ..metrics.pairwise import pairwise_distances_argmin from .._config import config_context def estimate_bandwidth(X, *, quantile=0.3, n_samples=None, random_state=0, n_jobs=None): """Estimate the bandwidth to use with the mean-shift algorithm. That this function takes time at least quadratic in n_samples. For large datasets, it's wise to set that parameter to a small value. Parameters ---------- X : array-like of shape (n_samples, n_features) Input points. quantile : float, default=0.3 should be between [0, 1] 0.5 means that the median of all pairwise distances is used. n_samples : int, default=None The number of samples to use. If not given, all samples are used. random_state : int, RandomState instance, default=None The generator used to randomly select the samples from input points for bandwidth estimation. Use an int to make the randomness deterministic. See :term:`Glossary <random_state>`. n_jobs : int, default=None The number of parallel jobs to run for neighbors search. ``None`` means 1 unless in a :obj:`joblib.parallel_backend` context. ``-1`` means using all processors. See :term:`Glossary <n_jobs>` for more details. Returns ------- bandwidth : float The bandwidth parameter. """ X = check_array(X) random_state = check_random_state(random_state) if n_samples is not None: idx = random_state.permutation(X.shape[0])[:n_samples] X = X[idx] n_neighbors = int(X.shape[0] * quantile) if n_neighbors < 1: # cannot fit NearestNeighbors with n_neighbors = 0 n_neighbors = 1 nbrs = NearestNeighbors(n_neighbors=n_neighbors, n_jobs=n_jobs) nbrs.fit(X) bandwidth = 0.0 for batch in gen_batches(len(X), 500): d, _ = nbrs.kneighbors(X[batch, :], return_distance=True) bandwidth += np.max(d, axis=1).sum() return bandwidth / X.shape[0] # separate function for each seed's iterative loop def _mean_shift_single_seed(my_mean, X, nbrs, max_iter): # For each seed, climb gradient until convergence or max_iter bandwidth = nbrs.get_params()["radius"] stop_thresh = 1e-3 * bandwidth # when mean has converged completed_iterations = 0 while True: # Find mean of points within bandwidth i_nbrs = nbrs.radius_neighbors([my_mean], bandwidth, return_distance=False)[0] points_within = X[i_nbrs] if len(points_within) == 0: break # Depending on seeding strategy this condition may occur my_old_mean = my_mean # save the old mean my_mean = np.mean(points_within, axis=0) # If converged or at max_iter, adds the cluster if ( np.linalg.norm(my_mean - my_old_mean) < stop_thresh or completed_iterations == max_iter ): break completed_iterations += 1 return tuple(my_mean), len(points_within), completed_iterations def mean_shift( X, *, bandwidth=None, seeds=None, bin_seeding=False, min_bin_freq=1, cluster_all=True, max_iter=300, n_jobs=None, ): """Perform mean shift clustering of data using a flat kernel. Read more in the :ref:`User Guide <mean_shift>`. Parameters ---------- X : array-like of shape (n_samples, n_features) Input data. bandwidth : float, default=None Kernel bandwidth. If bandwidth is not given, it is determined using a heuristic based on the median of all pairwise distances. This will take quadratic time in the number of samples. The sklearn.cluster.estimate_bandwidth function can be used to do this more efficiently. seeds : array-like of shape (n_seeds, n_features) or None Point used as initial kernel locations. If None and bin_seeding=False, each data point is used as a seed. If None and bin_seeding=True, see bin_seeding. bin_seeding : bool, default=False If true, initial kernel locations are not locations of all points, but rather the location of the discretized version of points, where points are binned onto a grid whose coarseness corresponds to the bandwidth. Setting this option to True will speed up the algorithm because fewer seeds will be initialized. Ignored if seeds argument is not None. min_bin_freq : int, default=1 To speed up the algorithm, accept only those bins with at least min_bin_freq points as seeds. cluster_all : bool, default=True If true, then all points are clustered, even those orphans that are not within any kernel. Orphans are assigned to the nearest kernel. If false, then orphans are given cluster label -1. max_iter : int, default=300 Maximum number of iterations, per seed point before the clustering operation terminates (for that seed point), if has not converged yet. n_jobs : int, default=None The number of jobs to use for the computation. This works by computing each of the n_init runs in parallel. ``None`` means 1 unless in a :obj:`joblib.parallel_backend` context. ``-1`` means using all processors. See :term:`Glossary <n_jobs>` for more details. .. versionadded:: 0.17 Parallel Execution using *n_jobs*. Returns ------- cluster_centers : ndarray of shape (n_clusters, n_features) Coordinates of cluster centers. labels : ndarray of shape (n_samples,) Cluster labels for each point. Notes ----- For an example, see :ref:`examples/cluster/plot_mean_shift.py <sphx_glr_auto_examples_cluster_plot_mean_shift.py>`. """ model = MeanShift( bandwidth=bandwidth, seeds=seeds, min_bin_freq=min_bin_freq, bin_seeding=bin_seeding, cluster_all=cluster_all, n_jobs=n_jobs, max_iter=max_iter, ).fit(X) return model.cluster_centers_, model.labels_ def get_bin_seeds(X, bin_size, min_bin_freq=1): """Finds seeds for mean_shift. Finds seeds by first binning data onto a grid whose lines are spaced bin_size apart, and then choosing those bins with at least min_bin_freq points. Parameters ---------- X : array-like of shape (n_samples, n_features) Input points, the same points that will be used in mean_shift. bin_size : float Controls the coarseness of the binning. Smaller values lead to more seeding (which is computationally more expensive). If you're not sure how to set this, set it to the value of the bandwidth used in clustering.mean_shift. min_bin_freq : int, default=1 Only bins with at least min_bin_freq will be selected as seeds. Raising this value decreases the number of seeds found, which makes mean_shift computationally cheaper. Returns ------- bin_seeds : array-like of shape (n_samples, n_features) Points used as initial kernel positions in clustering.mean_shift. """ if bin_size == 0: return X # Bin points bin_sizes = defaultdict(int) for point in X: binned_point = np.round(point / bin_size) bin_sizes[tuple(binned_point)] += 1 # Select only those bins as seeds which have enough members bin_seeds = np.array( [point for point, freq in bin_sizes.items() if freq >= min_bin_freq], dtype=np.float32, ) if len(bin_seeds) == len(X): warnings.warn( "Binning data failed with provided bin_size=%f, using data points as seeds." % bin_size ) return X bin_seeds = bin_seeds * bin_size return bin_seeds class MeanShift(ClusterMixin, BaseEstimator): """Mean shift clustering using a flat kernel. Mean shift clustering aims to discover "blobs" in a smooth density of samples. It is a centroid-based algorithm, which works by updating candidates for centroids to be the mean of the points within a given region. These candidates are then filtered in a post-processing stage to eliminate near-duplicates to form the final set of centroids. Seeding is performed using a binning technique for scalability. Read more in the :ref:`User Guide <mean_shift>`. Parameters ---------- bandwidth : float, default=None Bandwidth used in the RBF kernel. If not given, the bandwidth is estimated using sklearn.cluster.estimate_bandwidth; see the documentation for that function for hints on scalability (see also the Notes, below). seeds : array-like of shape (n_samples, n_features), default=None Seeds used to initialize kernels. If not set, the seeds are calculated by clustering.get_bin_seeds with bandwidth as the grid size and default values for other parameters. bin_seeding : bool, default=False If true, initial kernel locations are not locations of all points, but rather the location of the discretized version of points, where points are binned onto a grid whose coarseness corresponds to the bandwidth. Setting this option to True will speed up the algorithm because fewer seeds will be initialized. The default value is False. Ignored if seeds argument is not None. min_bin_freq : int, default=1 To speed up the algorithm, accept only those bins with at least min_bin_freq points as seeds. cluster_all : bool, default=True If true, then all points are clustered, even those orphans that are not within any kernel. Orphans are assigned to the nearest kernel. If false, then orphans are given cluster label -1. n_jobs : int, default=None The number of jobs to use for the computation. This works by computing each of the n_init runs in parallel. ``None`` means 1 unless in a :obj:`joblib.parallel_backend` context. ``-1`` means using all processors. See :term:`Glossary <n_jobs>` for more details. max_iter : int, default=300 Maximum number of iterations, per seed point before the clustering operation terminates (for that seed point), if has not converged yet. .. versionadded:: 0.22 Attributes ---------- cluster_centers_ : ndarray of shape (n_clusters, n_features) Coordinates of cluster centers. labels_ : ndarray of shape (n_samples,) Labels of each point. n_iter_ : int Maximum number of iterations performed on each seed. .. versionadded:: 0.22 n_features_in_ : int Number of features seen during :term:`fit`. .. versionadded:: 0.24 Examples -------- >>> from sklearn.cluster import MeanShift >>> import numpy as np >>> X = np.array([[1, 1], [2, 1], [1, 0], ... [4, 7], [3, 5], [3, 6]]) >>> clustering = MeanShift(bandwidth=2).fit(X) >>> clustering.labels_ array([1, 1, 1, 0, 0, 0]) >>> clustering.predict([[0, 0], [5, 5]]) array([1, 0]) >>> clustering MeanShift(bandwidth=2) Notes ----- Scalability: Because this implementation uses a flat kernel and a Ball Tree to look up members of each kernel, the complexity will tend towards O(T*n*log(n)) in lower dimensions, with n the number of samples and T the number of points. In higher dimensions the complexity will tend towards O(T*n^2). Scalability can be boosted by using fewer seeds, for example by using a higher value of min_bin_freq in the get_bin_seeds function. Note that the estimate_bandwidth function is much less scalable than the mean shift algorithm and will be the bottleneck if it is used. References ---------- Dorin Comaniciu and Peter Meer, "Mean Shift: A robust approach toward feature space analysis". IEEE Transactions on Pattern Analysis and Machine Intelligence. 2002. pp. 603-619. """ def __init__( self, *, bandwidth=None, seeds=None, bin_seeding=False, min_bin_freq=1, cluster_all=True, n_jobs=None, max_iter=300, ): self.bandwidth = bandwidth self.seeds = seeds self.bin_seeding = bin_seeding self.cluster_all = cluster_all self.min_bin_freq = min_bin_freq self.n_jobs = n_jobs self.max_iter = max_iter def fit(self, X, y=None): """Perform clustering. Parameters ---------- X : array-like of shape (n_samples, n_features) Samples to cluster. y : Ignored """ X = self._validate_data(X) bandwidth = self.bandwidth if bandwidth is None: bandwidth = estimate_bandwidth(X, n_jobs=self.n_jobs) elif bandwidth <= 0: raise ValueError( "bandwidth needs to be greater than zero or None, got %f" % bandwidth ) seeds = self.seeds if seeds is None: if self.bin_seeding: seeds = get_bin_seeds(X, bandwidth, self.min_bin_freq) else: seeds = X n_samples, n_features = X.shape center_intensity_dict = {} # We use n_jobs=1 because this will be used in nested calls under # parallel calls to _mean_shift_single_seed so there is no need for # for further parallelism. nbrs = NearestNeighbors(radius=bandwidth, n_jobs=1).fit(X) # execute iterations on all seeds in parallel all_res = Parallel(n_jobs=self.n_jobs)( delayed(_mean_shift_single_seed)(seed, X, nbrs, self.max_iter) for seed in seeds ) # copy results in a dictionary for i in range(len(seeds)): if all_res[i][1]: # i.e. len(points_within) > 0 center_intensity_dict[all_res[i][0]] = all_res[i][1] self.n_iter_ = max([x[2] for x in all_res]) if not center_intensity_dict: # nothing near seeds raise ValueError( "No point was within bandwidth=%f of any seed. Try a different seeding" " strategy or increase the bandwidth." % bandwidth ) # POST PROCESSING: remove near duplicate points # If the distance between two kernels is less than the bandwidth, # then we have to remove one because it is a duplicate. Remove the # one with fewer points. sorted_by_intensity = sorted( center_intensity_dict.items(), key=lambda tup: (tup[1], tup[0]), reverse=True, ) sorted_centers = np.array([tup[0] for tup in sorted_by_intensity]) unique = np.ones(len(sorted_centers), dtype=bool) nbrs = NearestNeighbors(radius=bandwidth, n_jobs=self.n_jobs).fit( sorted_centers ) for i, center in enumerate(sorted_centers): if unique[i]: neighbor_idxs = nbrs.radius_neighbors([center], return_distance=False)[ 0 ] unique[neighbor_idxs] = 0 unique[i] = 1 # leave the current point as unique cluster_centers = sorted_centers[unique] # ASSIGN LABELS: a point belongs to the cluster that it is closest to nbrs = NearestNeighbors(n_neighbors=1, n_jobs=self.n_jobs).fit(cluster_centers) labels = np.zeros(n_samples, dtype=int) distances, idxs = nbrs.kneighbors(X) if self.cluster_all: labels = idxs.flatten() else: labels.fill(-1) bool_selector = distances.flatten() <= bandwidth labels[bool_selector] = idxs.flatten()[bool_selector] self.cluster_centers_, self.labels_ = cluster_centers, labels return self def predict(self, X): """Predict the closest cluster each sample in X belongs to. Parameters ---------- X : {array-like, sparse matrix} of shape (n_samples, n_features) New data to predict. Returns ------- labels : ndarray of shape (n_samples,) Index of the cluster each sample belongs to. """ check_is_fitted(self) X = self._validate_data(X, reset=False) with config_context(assume_finite=True): return pairwise_distances_argmin(X, self.cluster_centers_)
{ "content_hash": "76baa0c20114779ee35da93df5e57db7", "timestamp": "", "source": "github", "line_count": 501, "max_line_length": 88, "avg_line_length": 35.16367265469062, "alnum_prop": 0.6329681557586422, "repo_name": "huzq/scikit-learn", "id": "e8ece2034d0f0ca5b3c4432aa3c984f7fb038b59", "size": "17617", "binary": false, "copies": "3", "ref": "refs/heads/master", "path": "sklearn/cluster/_mean_shift.py", "mode": "33188", "license": "bsd-3-clause", "language": [ { "name": "Batchfile", "bytes": "3366" }, { "name": "C", "bytes": "394787" }, { "name": "C++", "bytes": "140225" }, { "name": "Makefile", "bytes": "1579" }, { "name": "PowerShell", "bytes": "17042" }, { "name": "Python", "bytes": "6394128" }, { "name": "Shell", "bytes": "9250" } ], "symlink_target": "" }
from django.conf.urls import patterns from django.conf.urls import url from openstack_dashboard.dashboards.admin.images.images import views VIEWS_MOD = 'openstack_dashboard.dashboards.admin.images.images.views' urlpatterns = patterns(VIEWS_MOD, url(r'^create/$', views.CreateView.as_view(), name='create'), url(r'^upload/$', views.UploadView.as_view(), name='upload'), url(r'^downloadimage/$', 'download_image', name='downloadimage'), url(r'^(?P<image_id>[^/]+)/update/$', views.UpdateView.as_view(), name='update'), url(r'^(?P<image_id>[^/]+)/download/$', views.DownloadImageView.as_view(), name='download'), url(r'^(?P<image_id>[^/]+)/$', views.DetailView.as_view(), name='detail'), )
{ "content_hash": "49b3e0b99b893e253d677bb71b348c4b", "timestamp": "", "source": "github", "line_count": 18, "max_line_length": 96, "avg_line_length": 40.22222222222222, "alnum_prop": 0.669889502762431, "repo_name": "xuweiliang/Codelibrary", "id": "9832a87df0fd879e2c7c03cc6089ba6378fd2ac9", "size": "1488", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "openstack_dashboard/dashboards/admin/images/images/urls.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "CSS", "bytes": "134284" }, { "name": "HTML", "bytes": "830844" }, { "name": "JavaScript", "bytes": "2421484" }, { "name": "Makefile", "bytes": "4934" }, { "name": "Python", "bytes": "17185807" }, { "name": "Shell", "bytes": "9144" } ], "symlink_target": "" }
from operator import itemgetter from typing import Optional, cast from libsyntyche.widgets import HBoxLayout, Label, Stretch, mk_signal1 from PyQt5 import QtGui, QtWidgets from PyQt5.QtCore import Qt from ..common import Settings class TagInfoList(QtWidgets.QScrollArea): error = mk_signal1(str) print_ = mk_signal1(str) class TagCountBar(QtWidgets.QWidget): def __init__(self, parent: QtWidgets.QWidget, percentage: float) -> None: super().__init__(parent) self.percentage = percentage def paintEvent(self, ev: QtGui.QPaintEvent) -> None: right_offset = (1 - self.percentage) * ev.rect().width() painter = QtGui.QPainter(self) painter.fillRect(ev.rect().adjusted(0, 0, -int(right_offset), 0), painter.background()) painter.end() def __init__(self, parent: QtWidgets.QWidget, settings: Settings) -> None: super().__init__(parent) self.setSizeAdjustPolicy(self.AdjustToContents) self.setSizePolicy(QtWidgets.QSizePolicy.Expanding, QtWidgets.QSizePolicy.Expanding) self.tag_macros: dict[str, str] = settings.tag_macros.value settings.tag_macros.changed.connect(self.set_tag_macros) self.panel = QtWidgets.QWidget(self) self.panel.setObjectName('tag_info_list_panel') self.panel.setSizePolicy(QtWidgets.QSizePolicy.Expanding, QtWidgets.QSizePolicy.Maximum) layout = QtWidgets.QGridLayout(self.panel) layout.setColumnStretch(2, 1) layout.setHorizontalSpacing(10) # layout.setSizeConstraint(layout.SetMinAndMaxSize) # TODO: something less ugly than this self.setFixedHeight(200) self.panel.setLayout(layout) self.setWidget(self.panel) self.setWidgetResizable(True) self.hide() def clear(self) -> None: layout = self.panel.layout() while not layout.isEmpty(): item = layout.takeAt(0) if item and item.widget() is not None: item.widget().deleteLater() def set_tag_macros(self, tag_macros: dict[str, str]) -> None: self.tag_macros = tag_macros def _make_tag(self, tag: str) -> QtWidgets.QWidget: tag_label_wrapper = QtWidgets.QWidget(self) tag_label = Label(tag, name='tag', parent=tag_label_wrapper) tag_label.setStyleSheet('background: #667;') HBoxLayout(tag_label, Stretch(), parent=tag_label_wrapper) return tag_label_wrapper def view_tags(self, tags: list[tuple[str, int]], sort_alphabetically: bool, reverse: bool, name_filter: Optional[str]) -> None: self.clear() max_count = max(t[1] for t in tags) if sort_alphabetically: tags.sort(key=itemgetter(0)) else: tags.sort(key=itemgetter(0), reverse=True) tags.sort(key=itemgetter(1)) # If alphabetically, we want to default to ascending, # but if we're sorting by usage count, we want it descending. if reverse or (not sort_alphabetically and not reverse): tags.reverse() if name_filter: tags = [t for t in tags if name_filter in t[0]] layout = cast(QtWidgets.QGridLayout, self.panel.layout()) for n, (tag, count) in enumerate(tags): # Tag name layout.addWidget(self._make_tag(tag), n, 0) # Tag count layout.addWidget(Label(count, name='tag_info_count', parent=self), n, 1, alignment=Qt.AlignBottom) # Tag bar count_bar = self.TagCountBar(self, count / max_count) layout.addWidget(count_bar, n, 2) self.show() def view_macros(self) -> None: # TODO: better view of this self.clear() layout = cast(QtWidgets.QGridLayout, self.panel.layout()) for n, (tag, macro) in enumerate(sorted(self.tag_macros.items())): # Tag macro name layout.addWidget(self._make_tag('@' + tag), n, 0) # Tag macro expression layout.addWidget(Label(macro, name='tag_info_macro_expression', word_wrap=True, parent=self), n, 1) self.show()
{ "content_hash": "6d7d534ac8cdd92c74cb724a732dc562", "timestamp": "", "source": "github", "line_count": 104, "max_line_length": 79, "avg_line_length": 41.83653846153846, "alnum_prop": 0.601241094001379, "repo_name": "nycz/sapfo", "id": "c52f6513fdb914611be851b1bfe07db2c811d99e", "size": "4351", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "sapfo/index/taginfolist.py", "mode": "33188", "license": "mit", "language": [ { "name": "CSS", "bytes": "6186" }, { "name": "Python", "bytes": "157249" } ], "symlink_target": "" }
from mail_utils.messages import (TemplateMixin, EnvelopeMixin, ImagesMixin, TemplateMessageMixin, EnvelopedMessageMixin)
{ "content_hash": "4490e161b2c0d61ba426ce5e09696d56", "timestamp": "", "source": "github", "line_count": 2, "max_line_length": 75, "avg_line_length": 62.5, "alnum_prop": 0.84, "repo_name": "koorgoo/django-mail-utils", "id": "0217dc2e3bc75679521df24d8f6a73d824627d94", "size": "125", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "mail_utils/__init__.py", "mode": "33188", "license": "mit", "language": [ { "name": "HTML", "bytes": "145" }, { "name": "Python", "bytes": "11337" } ], "symlink_target": "" }
from settings import * # noqa INSTALLED_APPS += ( 'debug_toolbar', ) DEBUG_TOOLBAR_PATCH_SETTINGS = False # Prevent DDT from patching the settings. MIDDLEWARE_CLASSES += ('debug_toolbar.middleware.DebugToolbarMiddleware',) def debug_toolbar_enabled(request): """Callback used by the Django Debug Toolbar to decide when to display.""" # We want to make sure to have the DEBUG value at runtime, not the one we # have in this specific settings file. from django.conf import settings return settings.DEBUG DEBUG_TOOLBAR_CONFIG = { 'SHOW_TOOLBAR_CALLBACK': 'settings.debug_toolbar_enabled', 'JQUERY_URL': '', # Use the jquery that's already on the page. } # Disable CSP by setting it as report only. We can't enable it because it uses # "data:" for its logo, and it uses "unsafe eval" for some panels like the # templates or SQL ones. CSP_REPORT_ONLY = True
{ "content_hash": "c6eff8e9d730737c7b7e92e0c16d6ec7", "timestamp": "", "source": "github", "line_count": 28, "max_line_length": 79, "avg_line_length": 32, "alnum_prop": 0.7165178571428571, "repo_name": "andymckay/addons-server", "id": "bab9dac761495f9bc3c91c60f2676683f933673d", "size": "1035", "binary": false, "copies": "3", "ref": "refs/heads/master", "path": "djdt_settings.py", "mode": "33188", "license": "bsd-3-clause", "language": [ { "name": "ApacheConf", "bytes": "249" }, { "name": "CSS", "bytes": "846032" }, { "name": "HTML", "bytes": "1589366" }, { "name": "JavaScript", "bytes": "1316196" }, { "name": "Makefile", "bytes": "4442" }, { "name": "PLSQL", "bytes": "74" }, { "name": "Python", "bytes": "4128481" }, { "name": "Shell", "bytes": "9112" }, { "name": "Smarty", "bytes": "1930" } ], "symlink_target": "" }
from __future__ import print_function import os.path import platform import shutil import sys try: from setuptools import setup except ImportError as e: from distutils.core import setup if sys.version_info[0] < 3: sys.exit('Sorry, Python < 3 is not supported') # Set to False to disable compiling cython modules, set to True to enable cython use_cython = False # let cmake configure whether we use cython or not # this string will be replaced by cmake with a string literal in that case cmake_use_cython = '${USE_CYTHON}' if cmake_use_cython.startswith("$"): pass # cmake did not configure this file else: use_cython = (cmake_use_cython == "True") # allow the user to set whether cython is used using an environment variable if "MONOSAT_CYTHON" in os.environ: use_cython = str(os.environ["MONOSAT_CYTHON"]) == "1" # allow cmake to configure the package directory package_dir = '${PACKAGE_DIR}' if package_dir.startswith("$"): package_dir = '.' library_dir = "${CMAKE_BINARY_DIR}" if library_dir.startswith("$"): library_dir = "../../../../" monosat_path = "${CMAKE_SOURCE_DIR}/src" if monosat_path.startswith("$"): monosat_path = "../../../../src/" if use_cython: print("Attempting Cython installation") # attempt to load the cython modules try: from distutils.extension import Extension from Cython.Build import cythonize from Cython.Distutils import build_ext from distutils.command.sdist import sdist as _sdist except: print("Could not load cython modules, falling back on ctypes") use_cython = False if platform.system() == "Darwin": sharedlib = 'libmonosat.dylib' elif platform.system() != "Windows": sharedlib = 'libmonosat.so' else: sharedlib = 'libmonosat.dll' orig_lib = library_dir + "/" + sharedlib copy_lib = package_dir + "/monosat/" + sharedlib if os.path.exists(orig_lib): # only copy the library if it hasn't already been copied (this facilitates separate build/install steps) if not os.path.exists(copy_lib) or os.path.getmtime(orig_lib) > os.path.getmtime(copy_lib): shutil.copy2(orig_lib, package_dir + "/monosat/") if not os.path.exists(package_dir + "/monosat/" + sharedlib): print("Warning: could not find %s. See README for instructions on compiling the library, the re-install" % ( sharedlib), file=sys.stderr) if use_cython: # build the cython interface to monosat cmdclass = {} cmdclass.update({'build_ext': build_ext}) setup( version='1.6', python_requires='>3.0.0', description='MonoSAT Cython Interface', author='Sam Bayless', author_email='sbayless@cs.ubc.ca', url='http://www.cs.ubc.ca/labs/isd/projects/monosat/', cmdclass=cmdclass, runtime_library_dirs=['./', package_dir + "/"], ext_modules=cythonize([Extension("monosat.monosat_p", [package_dir + "/monosat/monosat_p.pyx"], include_dirs=[".", package_dir, package_dir + "/monosat", monosat_path], libraries=["monosat"], language="c", extra_compile_args=["-DNDEBUG", "-O3"] )], include_path=[package_dir, package_dir + "/monosat"], gdb_debug=True), install_requires=['cython'], packages=['monosat'], package_data={'monosat': [sharedlib]}, package_dir={'': package_dir}, ) else: setup(name='monosat', version='1.6', python_requires='>3.0.0', description='MonoSAT Python Interface', author='Sam Bayless', author_email='sbayless@cs.ubc.ca', url='http://www.cs.ubc.ca/labs/isd/projects/monosat/', packages=['monosat'], package_data={'monosat': [sharedlib]}, package_dir={'': package_dir}, )
{ "content_hash": "3c8d44d8c01dd18f65e79740f492edb9", "timestamp": "", "source": "github", "line_count": 112, "max_line_length": 115, "avg_line_length": 35.017857142857146, "alnum_prop": 0.6228964813870475, "repo_name": "sambayless/monosat", "id": "acadea8799dd008018e51023401adafa9d775f87", "size": "3945", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "src/monosat/api/python/setup.py", "mode": "33261", "license": "mit", "language": [ { "name": "C", "bytes": "33006" }, { "name": "C++", "bytes": "3493499" }, { "name": "CMake", "bytes": "25650" }, { "name": "Cython", "bytes": "75137" }, { "name": "Java", "bytes": "423109" }, { "name": "Python", "bytes": "269148" }, { "name": "Scala", "bytes": "3262" } ], "symlink_target": "" }
from __future__ import absolute_import, division, print_function, \ with_statement import socket import logging import struct import errno import random from shadowsocks import encrypt, eventloop, lru_cache, common, shell from shadowsocks.common import parse_header, pack_addr BUF_SIZE = 65536 def client_key(source_addr, server_af): # notice this is server af, not dest af return '%s:%s:%d' % (source_addr[0], source_addr[1], server_af) class UDPRelay(object): def __init__(self, config, dns_resolver, is_local): self._config = config if is_local: self._listen_addr = config['local_address'] self._listen_port = config['local_port'] self._remote_addr = config['server'] self._remote_port = config['server_port'] else: self._listen_addr = config['server'] self._listen_port = config['server_port'] self._remote_addr = None self._remote_port = None self._dns_resolver = dns_resolver self._password = config['password'] self._method = config['method'] self._timeout = config['timeout'] self._is_local = is_local self._cache = lru_cache.LRUCache(timeout=config['timeout'], close_callback=self._close_client) self._client_fd_to_server_addr = \ lru_cache.LRUCache(timeout=config['timeout']) self._dns_cache = lru_cache.LRUCache(timeout=300) self._eventloop = None self._closed = False self._sockets = set() if 'forbidden_ip' in config: self._forbidden_iplist = config['forbidden_ip'] else: self._forbidden_iplist = None addrs = socket.getaddrinfo(self._listen_addr, self._listen_port, 0, socket.SOCK_DGRAM, socket.SOL_UDP) if len(addrs) == 0: raise Exception("can't get addrinfo for %s:%d" % (self._listen_addr, self._listen_port)) af, socktype, proto, canonname, sa = addrs[0] server_socket = socket.socket(af, socktype, proto) server_socket.bind((self._listen_addr, self._listen_port)) server_socket.setblocking(False) self._server_socket = server_socket def _get_a_server(self): server = self._config['server'] server_port = self._config['server_port'] if type(server_port) == list: server_port = random.choice(server_port) if type(server) == list: server = random.choice(server) logging.debug('chosen server: %s:%d', server, server_port) return server, server_port def _close_client(self, client): if hasattr(client, 'close'): self._sockets.remove(client.fileno()) self._eventloop.remove(client, self) client.close() else: # just an address pass def _handle_server(self): server = self._server_socket data, r_addr = server.recvfrom(BUF_SIZE) if not data: logging.debug('UDP handle_server: data is empty') if self._is_local: frag = common.ord(data[2]) if frag != 0: logging.warn('drop a message since frag is not 0') return else: data = data[3:] else: data = encrypt.encrypt_all(self._password, self._method, 0, data) # decrypt data if not data: logging.debug('UDP handle_server: data is empty after decrypt') return header_result = parse_header(data) if header_result is None: return addrtype, dest_addr, dest_port, header_length = header_result if self._is_local: server_addr, server_port = self._get_a_server() else: server_addr, server_port = dest_addr, dest_port addrs = self._dns_cache.get(server_addr, None) if addrs is None: addrs = socket.getaddrinfo(server_addr, server_port, 0, socket.SOCK_DGRAM, socket.SOL_UDP) if not addrs: # drop return else: self._dns_cache[server_addr] = addrs af, socktype, proto, canonname, sa = addrs[0] key = client_key(r_addr, af) logging.debug(key) client = self._cache.get(key, None) if not client: # TODO async getaddrinfo if self._forbidden_iplist: if common.to_str(sa[0]) in self._forbidden_iplist: logging.debug('IP %s is in forbidden list, drop' % common.to_str(sa[0])) # drop return client = socket.socket(af, socktype, proto) client.setblocking(False) self._cache[key] = client self._client_fd_to_server_addr[client.fileno()] = r_addr self._sockets.add(client.fileno()) self._eventloop.add(client, eventloop.POLL_IN, self) if self._is_local: data = encrypt.encrypt_all(self._password, self._method, 1, data) if not data: return else: data = data[header_length:] if not data: return try: client.sendto(data, (server_addr, server_port)) except IOError as e: err = eventloop.errno_from_exception(e) if err in (errno.EINPROGRESS, errno.EAGAIN): pass else: shell.print_exception(e) def _handle_client(self, sock): data, r_addr = sock.recvfrom(BUF_SIZE) if not data: logging.debug('UDP handle_client: data is empty') return if not self._is_local: addrlen = len(r_addr[0]) if addrlen > 255: # drop return data = pack_addr(r_addr[0]) + struct.pack('>H', r_addr[1]) + data response = encrypt.encrypt_all(self._password, self._method, 1, data) if not response: return else: data = encrypt.encrypt_all(self._password, self._method, 0, data) if not data: return header_result = parse_header(data) if header_result is None: return # addrtype, dest_addr, dest_port, header_length = header_result response = b'\x00\x00\x00' + data client_addr = self._client_fd_to_server_addr.get(sock.fileno()) if client_addr: self._server_socket.sendto(response, client_addr) else: # this packet is from somewhere else we know # simply drop that packet pass def add_to_loop(self, loop): if self._eventloop: raise Exception('already add to loop') if self._closed: raise Exception('already closed') self._eventloop = loop server_socket = self._server_socket self._eventloop.add(server_socket, eventloop.POLL_IN | eventloop.POLL_ERR, self) loop.add_periodic(self.handle_periodic) def handle_event(self, sock, fd, event): if sock == self._server_socket: if event & eventloop.POLL_ERR: logging.error('UDP server_socket err') self._handle_server() elif sock and (fd in self._sockets): if event & eventloop.POLL_ERR: logging.error('UDP client_socket err') self._handle_client(sock) def handle_periodic(self): self._cache.sweep() self._client_fd_to_server_addr.sweep() if self._closed: self._server_socket.close() for sock in self._sockets: sock.close() self._eventloop.remove_periodic(self.handle_periodic) def close(self, next_tick=False): self._closed = True if not next_tick: self._eventloop.remove(self._server_socket, self) self._server_socket.close()
{ "content_hash": "13c34df7717204025571c53a4237885f", "timestamp": "", "source": "github", "line_count": 226, "max_line_length": 79, "avg_line_length": 36.72566371681416, "alnum_prop": 0.5390361445783133, "repo_name": "lucienevans/shadowsocks", "id": "b67770acca1ffe805f6f4ea84f36b45dbbc43a4f", "size": "10603", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "shadowsocks/udprelay.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Python", "bytes": "145172" }, { "name": "Shell", "bytes": "14934" } ], "symlink_target": "" }
from globus_sdk.tokenstorage.base import FileAdapter, StorageAdapter from globus_sdk.tokenstorage.file_adapters import SimpleJSONFileAdapter from globus_sdk.tokenstorage.sqlite_adapter import SQLiteAdapter __all__ = ("SimpleJSONFileAdapter", "SQLiteAdapter", "StorageAdapter", "FileAdapter")
{ "content_hash": "96595381d544604b5de2f2176914a4d0", "timestamp": "", "source": "github", "line_count": 5, "max_line_length": 85, "avg_line_length": 58.6, "alnum_prop": 0.8293515358361775, "repo_name": "globus/globus-sdk-python", "id": "9ed982da9b3f09e263dbfadf3c62c39081aec146", "size": "293", "binary": false, "copies": "2", "ref": "refs/heads/main", "path": "src/globus_sdk/tokenstorage/__init__.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Jinja", "bytes": "303" }, { "name": "Makefile", "bytes": "810" }, { "name": "Python", "bytes": "896256" }, { "name": "Shell", "bytes": "125" } ], "symlink_target": "" }
from multiprocessing import Process import unittest import numpy as np import os from bigdl.ppml.fl import * from bigdl.ppml.fl.estimator import Estimator from bigdl.ppml.fl.nn.fl_server import FLServer from bigdl.ppml.fl.nn.tensorflow.utils import set_one_like_parameter from bigdl.ppml.fl.nn.fl_context import init_fl_context from bigdl.ppml.fl.nn.tensorflow.estimator import TensorflowEstimator import tensorflow as tf print("TensorFlow version:", tf.__version__) from tensorflow.keras.layers import Dense, Flatten, Conv2D, InputLayer from tensorflow.keras import Model, Input resource_path = os.path.join(os.path.dirname(__file__), "../../resources") class TestCorrectness(FLTest): fmt = '%(asctime)s %(levelname)s {%(module)s:%(lineno)d} - %(message)s' logging.basicConfig(format=fmt, level=logging.INFO) tf.config.run_functions_eagerly(True) # enable step-by-step debug def setUp(self) -> None: self.fl_server = FLServer() self.fl_server.set_port(self.port) self.fl_server.build() self.fl_server.start() def tearDown(self) -> None: self.fl_server.stop() def test_mnist(self) -> None: """ following code is copied from pytorch quick start link: https://www.tensorflow.org/tutorials/quickstart/advanced """ mnist = tf.keras.datasets.mnist (x_train, y_train), (x_test, y_test) = mnist.load_data() x_train, x_test = x_train / 255.0, x_test / 255.0 # Add a channels dimension x_train = x_train[..., tf.newaxis].astype("float32") x_test = x_test[..., tf.newaxis].astype("float32") train_ds = tf.data.Dataset.from_tensor_slices( (x_train[:5000], y_train[:5000])).batch(32) test_ds = tf.data.Dataset.from_tensor_slices((x_test, y_test)).batch(32) model = build_whole_model() set_one_like_parameter(model) loss_object = tf.keras.losses.SparseCategoricalCrossentropy(from_logits=True) optimizer = tf.keras.optimizers.Adam() train_loss = tf.keras.metrics.Mean(name='train_loss') train_accuracy = tf.keras.metrics.SparseCategoricalAccuracy(name='train_accuracy') test_loss = tf.keras.metrics.Mean(name='test_loss') test_accuracy = tf.keras.metrics.SparseCategoricalAccuracy(name='test_accuracy') @tf.function def train_step(images, labels): with tf.GradientTape() as tape: # training=True is only needed if there are layers with different # behavior during training versus inference (e.g. Dropout). predictions = model(images, training=True) loss = loss_object(labels, predictions) gradients = tape.gradient(loss, model.trainable_variables) optimizer.apply_gradients(zip(gradients, model.trainable_variables)) train_loss(loss) train_accuracy(labels, predictions) return loss @tf.function def test_step(images, labels): # training=False is only needed if there are layers with different # behavior during training versus inference (e.g. Dropout). predictions = model(images, training=False) t_loss = loss_object(labels, predictions) test_loss(t_loss) test_accuracy(labels, predictions) tensorflow_loss_history = [] EPOCHS = 1 for epoch in range(EPOCHS): # Reset the metrics at the start of the next epoch train_loss.reset_states() train_accuracy.reset_states() test_loss.reset_states() test_accuracy.reset_states() size = len(train_ds) for batch, (images, labels) in enumerate(train_ds): loss = train_step(images, labels) if batch % 10 == 0: tensorflow_loss_history.append(np.array(loss)) logging.info(f"loss: {loss:>7f} [{batch:>5d}/{size:>5d}] \ epoch {epoch}/{EPOCHS}") for test_images, test_labels in test_ds: test_step(test_images, test_labels) print( f'Epoch {epoch + 1}, ' f'Loss: {train_loss.result()}, ' f'Accuracy: {train_accuracy.result() * 100}, ' f'Test Loss: {test_loss.result()}, ' f'Test Accuracy: {test_accuracy.result() * 100}' ) # TODO: set fixed parameters init_fl_context(1, self.target) vfl_model_1 = build_client_model() set_one_like_parameter(vfl_model_1) vfl_model_2 = build_server_model() set_one_like_parameter(vfl_model_2) vfl_client_ppl = Estimator.from_keras(client_model=vfl_model_1, loss_fn=loss_object, optimizer_cls=tf.keras.optimizers.Adam, optimizer_args={}, server_model=vfl_model_2) vfl_client_ppl.fit(train_ds) assert np.allclose(tensorflow_loss_history, vfl_client_ppl.loss_history), \ "Validation failed, correctness of PPML and native Pytorch not the same" def build_client_model(): inputs = Input(shape=(28, 28, 1)) x = Conv2D(32, 3, activation='relu')(inputs) outputs = Flatten()(x) return Model(inputs=inputs, outputs=outputs, name="vfl_client_model") def build_server_model(): inputs = Input(shape=(21632)) x = Dense(128, activation='relu')(inputs) outputs = Dense(10)(x) return Model(inputs=inputs, outputs=outputs, name="vfl_server_model") def build_whole_model(): inputs = Input(shape=(28, 28, 1)) x = Conv2D(32, 3, activation='relu')(inputs) x = Flatten()(x) x = Dense(128, activation='relu')(x) outputs = Dense(10)(x) return Model(inputs=inputs, outputs=outputs, name="vfl_whole_model") if __name__ == '__main__': unittest.main()
{ "content_hash": "d0f2cbc3f3722e94dde8523f8ff24853", "timestamp": "", "source": "github", "line_count": 156, "max_line_length": 90, "avg_line_length": 39.1474358974359, "alnum_prop": 0.5950548550843294, "repo_name": "yangw1234/BigDL", "id": "df9f531e19f593f44085f42441756450f1b1b260", "size": "6694", "binary": false, "copies": "2", "ref": "refs/heads/main", "path": "python/ppml/test/bigdl/ppml/fl/nn/tensorflow/test_mnist.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "C", "bytes": "5342" }, { "name": "Dockerfile", "bytes": "138760" }, { "name": "Java", "bytes": "1321348" }, { "name": "Jupyter Notebook", "bytes": "54063856" }, { "name": "Lua", "bytes": "1904" }, { "name": "Makefile", "bytes": "19253" }, { "name": "PowerShell", "bytes": "1137" }, { "name": "PureBasic", "bytes": "593" }, { "name": "Python", "bytes": "8762180" }, { "name": "RobotFramework", "bytes": "16117" }, { "name": "Scala", "bytes": "13216038" }, { "name": "Shell", "bytes": "844916" } ], "symlink_target": "" }
import asyncio import os import sys if not sys.version >= '3.6': print('This script requires Python 3.6+') sys.exit() root = os.path.dirname(os.path.dirname(os.path.dirname(os.path.abspath(__file__)))) sys.path.append(root + '/python') import ccxt.async_support as ccxt # noqa: E402 async def poll(): exchange = ccxt.bittrex() while True: yield await exchange.fetch_order_book('BTC/USDT') await asyncio.sleep(exchange.rateLimit / 1000) async def main(): async for orderbook in poll(): print(orderbook['bids'][0], orderbook['asks'][0]) asyncio.run(main())
{ "content_hash": "40ceeb2ce067212c2c9d5c6a6ee45b9c", "timestamp": "", "source": "github", "line_count": 27, "max_line_length": 83, "avg_line_length": 22.555555555555557, "alnum_prop": 0.6617405582922824, "repo_name": "ccxt/ccxt", "id": "efce406fd5829fd2e0d5971f3bee15d78cceabc3", "size": "634", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "examples/py/async-bittrex-orderbook.py", "mode": "33188", "license": "mit", "language": [ { "name": "Dockerfile", "bytes": "1724" }, { "name": "HTML", "bytes": "246" }, { "name": "JavaScript", "bytes": "11619228" }, { "name": "PHP", "bytes": "10272973" }, { "name": "Python", "bytes": "9037496" }, { "name": "Shell", "bytes": "6887" } ], "symlink_target": "" }
"""Progress bars module""" import time import datetime import sys from qiskit.tools.events.pubsub import Subscriber class BaseProgressBar(Subscriber): """An abstract progress bar with some shared functionality.""" def __init__(self): super().__init__() self.type = "progressbar" self.touched = False self.iter = None self.t_start = None self.t_done = None def start(self, iterations): """Start the progress bar. Parameters: iterations (int): Number of iterations. """ self.touched = True self.iter = int(iterations) self.t_start = time.time() def update(self, n): """Update status of progress bar.""" pass def time_elapsed(self): """Return the time elapsed since start. Returns: elapsed_time: Time since progress bar started. """ return "%6.2fs" % (time.time() - self.t_start) def time_remaining_est(self, completed_iter): """Estimate the remaining time left. Parameters: completed_iter (int): Number of iterations completed. Returns: est_time: Estimated time remaining. """ if completed_iter: t_r_est = (time.time() - self.t_start) / completed_iter * (self.iter - completed_iter) else: t_r_est = 0 date_time = datetime.datetime(1, 1, 1) + datetime.timedelta(seconds=t_r_est) time_string = "%02d:%02d:%02d:%02d" % ( date_time.day - 1, date_time.hour, date_time.minute, date_time.second, ) return time_string def finished(self): """Run when progress bar has completed.""" pass class TextProgressBar(BaseProgressBar): """ A simple text-based progress bar. output_handler : the handler the progress bar should be written to, default is sys.stdout, another option is sys.stderr """ def __init__(self, output_handler=None): super().__init__() self._init_subscriber() self.output_handler = output_handler if output_handler else sys.stdout def _init_subscriber(self): def _initialize_progress_bar(num_tasks): """ """ self.start(num_tasks) self.subscribe("terra.parallel.start", _initialize_progress_bar) def _update_progress_bar(progress): """ """ self.update(progress) self.subscribe("terra.parallel.done", _update_progress_bar) def _finish_progress_bar(): """ """ self.unsubscribe("terra.parallel.start", _initialize_progress_bar) self.unsubscribe("terra.parallel.done", _update_progress_bar) self.unsubscribe("terra.parallel.finish", _finish_progress_bar) self.finished() self.subscribe("terra.parallel.finish", _finish_progress_bar) def start(self, iterations): self.touched = True self.iter = int(iterations) self.t_start = time.time() pbar = "-" * 50 self.output_handler.write("\r|{}| {}{}{} [{}]".format(pbar, 0, "/", self.iter, "")) def update(self, n): # Don't update if we are not initialized or # the update iteration number is greater than the total iterations set on start. if not self.touched or n > self.iter: return filled_length = int(round(50 * n / self.iter)) pbar = "█" * filled_length + "-" * (50 - filled_length) time_left = self.time_remaining_est(n) self.output_handler.write("\r|{}| {}{}{} [{}]".format(pbar, n, "/", self.iter, time_left)) if n == self.iter: self.output_handler.write("\n") self.output_handler.flush()
{ "content_hash": "12a04a24326e3c0125fa7d0d031475d6", "timestamp": "", "source": "github", "line_count": 124, "max_line_length": 98, "avg_line_length": 30.81451612903226, "alnum_prop": 0.5710546977231091, "repo_name": "QISKit/qiskit-sdk-py", "id": "dba2ffdd84cf33ff451da162ad15e37345648795", "size": "6123", "binary": false, "copies": "1", "ref": "refs/heads/main", "path": "qiskit/tools/events/progressbar.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Batchfile", "bytes": "2582" }, { "name": "C++", "bytes": "327518" }, { "name": "CMake", "bytes": "19294" }, { "name": "Makefile", "bytes": "5608" }, { "name": "Pascal", "bytes": "2444" }, { "name": "Python", "bytes": "1312801" }, { "name": "Shell", "bytes": "8385" } ], "symlink_target": "" }
from datetime import date from dateutil.rrule import MONTHLY, rrule from juriscraper.AbstractSite import logger from juriscraper.lib.html_utils import get_html5_parsed_text from juriscraper.lib.string_utils import convert_date_string from juriscraper.OpinionSite import OpinionSite class Site(OpinionSite): def __init__(self, *args, **kwargs): super().__init__(*args, **kwargs) self.court_id = self.__module__ date_keys = rrule( MONTHLY, dtstart=date(2003, 11, 1), until=date(2015, 8, 30) ) self.back_scrape_iterable = [i.date() for i in date_keys] self.row_base_path = '//tr[contains(./td[1]/a/@href, "3d")]' self.division = 1 self.url = self.build_url() def _get_case_names(self): path = f"{self.row_base_path}/td[1]" return [cell.text_content() for cell in self.html.xpath(path)] def build_url(self, target_date=False): base = ( "http://www.courts.state.ny.us/reporter/slipidx/aidxtable_%s" % self.division ) if target_date: return "{}_{}_{}.shtml".format( base, target_date.year, target_date.strftime("%B"), ) else: return f"{base}.shtml" def _get_download_urls(self): path = f"{self.row_base_path}/td[1]//a/@href" return self.html.xpath(path) def _get_case_dates(self): case_dates = [] for element in self.html.xpath("//caption | //center"): date_string = ( element.text_content().strip().replace("Cases Decided ", "") ) path_prefix = ( "./parent::" if element.tag == "caption" else "./following-sibling::" ) path = f"{path_prefix}table[1]{self.row_base_path}" cases = element.xpath(path) case_dates.extend([convert_date_string(date_string)] * len(cases)) return case_dates def _get_precedential_statuses(self): return ["Published"] * len(self.case_names) def _get_docket_numbers(self): path = f"{self.row_base_path}/td[3]" return list( map( self._add_str_to_list_where_empty_element, self.html.xpath(path), ) ) def _get_judges(self): path = f"{self.row_base_path}/td[2]" return list( map( self._add_str_to_list_where_empty_element, self.html.xpath(path), ) ) def _get_citations(self): path = f"{self.row_base_path}/td[4]" return [cell.text_content().strip() for cell in self.html.xpath(path)] @staticmethod def _add_str_to_list_where_empty_element(element): string_list = element.xpath("./text()") return string_list[0] if string_list else "" def _download_backwards(self, target_date): self.crawl_date = target_date logger.info(f"Running backscraper with date: {target_date}") self.url = self.build_url(target_date=target_date) self.html = self._download() def _make_html_tree(self, text): return get_html5_parsed_text(text)
{ "content_hash": "5e12c55a970f27ce9c10ba58fdbbe424", "timestamp": "", "source": "github", "line_count": 98, "max_line_length": 78, "avg_line_length": 33.255102040816325, "alnum_prop": 0.5556919300398895, "repo_name": "freelawproject/juriscraper", "id": "7fd38c8a784bdf2db403365384d154011841911d", "size": "3420", "binary": false, "copies": "1", "ref": "refs/heads/main", "path": "juriscraper/opinions/united_states/state/nyappdiv_1st.py", "mode": "33188", "license": "bsd-2-clause", "language": [ { "name": "HTML", "bytes": "63242956" }, { "name": "Jinja", "bytes": "2201" }, { "name": "Makefile", "bytes": "75" }, { "name": "Python", "bytes": "1059228" } ], "symlink_target": "" }
import tensorflow as tf from hanlp.components.tokenizers.tok import NgramConvTokenizer from hanlp.datasets.tokenization.sighan2005.msr import SIGHAN2005_MSR_TRAIN, SIGHAN2005_MSR_VALID, SIGHAN2005_MSR_TEST from hanlp.pretrained.word2vec import CONVSEG_W2V_NEWS_TENSITE_CHAR, CONVSEG_W2V_NEWS_TENSITE_WORD_MSR from tests import cdroot cdroot() tokenizer = NgramConvTokenizer() save_dir = 'data/model/cws/convseg-msr-nocrf-noembed' tokenizer.fit(SIGHAN2005_MSR_TRAIN, SIGHAN2005_MSR_VALID, save_dir, word_embed={'class_name': 'HanLP>Word2VecEmbedding', 'config': { 'trainable': True, 'filepath': CONVSEG_W2V_NEWS_TENSITE_CHAR, 'expand_vocab': False, 'lowercase': False, }}, ngram_embed={'class_name': 'HanLP>Word2VecEmbedding', 'config': { 'trainable': True, 'filepath': CONVSEG_W2V_NEWS_TENSITE_WORD_MSR, 'expand_vocab': True, 'lowercase': False, }}, optimizer=tf.keras.optimizers.Adam(learning_rate=0.001, epsilon=1e-8, clipnorm=5), epochs=3, window_size=4, metrics='f1', weight_norm=True) print(tokenizer.predict(['中央民族乐团离开北京前往维也纳', '商品和服务'])) tokenizer.load(save_dir, metrics='f1') tokenizer.evaluate(SIGHAN2005_MSR_TEST, save_dir=save_dir)
{ "content_hash": "092a3788a17d72660ffaa0f115828ab9", "timestamp": "", "source": "github", "line_count": 36, "max_line_length": 118, "avg_line_length": 46.388888888888886, "alnum_prop": 0.5293413173652695, "repo_name": "hankcs/HanLP", "id": "ed319995a6491de435d1058c902dd3b15633a541", "size": "1775", "binary": false, "copies": "1", "ref": "refs/heads/doc-zh", "path": "plugins/hanlp_demo/hanlp_demo/zh/tf/train/cws/train_msr_cws_ngram_conv_embed.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Java", "bytes": "40933" }, { "name": "Jupyter Notebook", "bytes": "566269" }, { "name": "Python", "bytes": "2196905" } ], "symlink_target": "" }
from frasco import Feature, action, flash, url_for, hook, lazy_translate from frasco_users import current_user from .blueprint import create_blueprint class TwitterFeature(Feature): name = "twitter" requires = ["users"] blueprints = [create_blueprint] defaults = {"use_screenname_as_username": False, "user_denied_login_message": lazy_translate("Login via Twitter was denied")} def init_app(self, app): self.app = app self.api = app.features.users.create_oauth_app("twitter", base_url='https://api.twitter.com/1.1/', request_token_url='https://api.twitter.com/oauth/request_token', access_token_url='https://api.twitter.com/oauth/access_token', authorize_url='https://api.twitter.com/oauth/authenticate', consumer_key=self.options["consumer_key"], consumer_secret=self.options["consumer_secret"], login_view="twitter_login.login") @self.api.tokengetter def token_getter(token=None): if not current_user.is_authenticated() or not current_user.twitter_oauth_token: return return (current_user.twitter_oauth_token, current_user.twitter_oauth_token_secret) self.model = app.features.models.ensure_model(app.features.users.model, twitter_oauth_token=str, twitter_oauth_token_secret=str, twitter_screenname=dict(type=str, index=True)) @action("post_twitter_update", default_option="status") def post_update(self, status): self.api.post("statuses/update.json", data={"status": status})
{ "content_hash": "9e387fb74f9130c187466c14a0653e90", "timestamp": "", "source": "github", "line_count": 37, "max_line_length": 94, "avg_line_length": 44.24324324324324, "alnum_prop": 0.6499694563225412, "repo_name": "frascoweb/frasco-twitter", "id": "547b2d7a5d6b108d7289d6fd6e7494e4d29df855", "size": "1637", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "frasco_twitter/__init__.py", "mode": "33188", "license": "mit", "language": [ { "name": "Python", "bytes": "3211" } ], "symlink_target": "" }
from __future__ import unicode_literals from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('plea', '0039_auto_20180522_1341'), ] operations = [ migrations.AlterField( model_name='courtemailcount', name='total_guilty_court', field=models.IntegerField(blank=True, default=0, null=True), ), migrations.AlterField( model_name='courtemailcount', name='total_guilty_no_court', field=models.IntegerField(blank=True, default=0, null=True), ), migrations.AlterField( model_name='usagestats', name='online_guilty_attend_court_pleas', field=models.PositiveIntegerField(blank=True, default=0, null=True), ), migrations.AlterField( model_name='usagestats', name='online_guilty_no_court_pleas', field=models.PositiveIntegerField(blank=True, default=0, null=True), ), ]
{ "content_hash": "f9ee3e3d1d39975572361e7fd228c7ad", "timestamp": "", "source": "github", "line_count": 33, "max_line_length": 80, "avg_line_length": 31.484848484848484, "alnum_prop": 0.5967276227141483, "repo_name": "ministryofjustice/manchester_traffic_offences_pleas", "id": "4a3da0f40f55744fb131eae62b28c9ad5cb5f965", "size": "1112", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "apps/plea/migrations/0040_auto_20180523_1512.py", "mode": "33188", "license": "mit", "language": [ { "name": "Dockerfile", "bytes": "867" }, { "name": "Gherkin", "bytes": "10122" }, { "name": "HTML", "bytes": "184454" }, { "name": "JavaScript", "bytes": "52955" }, { "name": "Python", "bytes": "792658" }, { "name": "SCSS", "bytes": "43568" }, { "name": "Shell", "bytes": "1766" } ], "symlink_target": "" }
from django.conf.urls import * urlpatterns = [ #url(r'', include('apps.api.v2.urls', namespace='default')), url(r'^v1/', include('apps.api.v1.urls', namespace='v1')), ]
{ "content_hash": "5849a2aa71302b66b432fd6259043c13", "timestamp": "", "source": "github", "line_count": 6, "max_line_length": 64, "avg_line_length": 29.666666666666668, "alnum_prop": 0.6292134831460674, "repo_name": "MySmile/sfchat", "id": "6aadf5e5cb51c3aea807781d73145b6b2f70adf2", "size": "178", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "apps/api/urls.py", "mode": "33188", "license": "bsd-3-clause", "language": [ { "name": "CSS", "bytes": "5563" }, { "name": "HTML", "bytes": "40427" }, { "name": "JavaScript", "bytes": "117323" }, { "name": "Makefile", "bytes": "2488" }, { "name": "Python", "bytes": "79515" }, { "name": "Shell", "bytes": "1902" } ], "symlink_target": "" }
# -*- coding: utf-8 -*- """ A TestRunner for use with the Python unit testing framework. It generates a HTML report to show the result at a glance. The simplest way to use this is to invoke its main method. E.g. import unittest import HTMLTestRunner ... define your tests ... if __name__ == '__main__': HTMLTestRunner.main() For more customization options, instantiates a HTMLTestRunner object. HTMLTestRunner is a counterpart to unittest's TextTestRunner. E.g. # output to a file fp = file('my_report.html', 'wb') runner = HTMLTestRunner.HTMLTestRunner( stream=fp, title='My unit test', description='This demonstrates the report output by HTMLTestRunner.' ) # Use an external stylesheet. # See the Template_mixin class for more customizable options runner.STYLESHEET_TMPL = '<link rel="stylesheet" href="my_stylesheet.css" type="text/css">' # run the test runner.run(my_test_suite) ------------------------------------------------------------------------ Copyright (c) 2004-2007, Wai Yip Tung All rights reserved. Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: * Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. * Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. * Neither the name Wai Yip Tung nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission. THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. """ # URL: http://tungwaiyip.info/software/HTMLTestRunner.html __author__ = "Wai Yip Tung" __version__ = "0.8.3" """ Change History Version 0.8.3 * Prevent crash on class or module-level exceptions (Darren Wurf). Version 0.8.2 * Show output inline instead of popup window (Viorel Lupu). Version in 0.8.1 * Validated XHTML (Wolfgang Borgert). * Added description of test classes and test cases. Version in 0.8.0 * Define Template_mixin class for customization. * Workaround a IE 6 bug that it does not treat <script> block as CDATA. Version in 0.7.1 * Back port to Python 2.3 (Frank Horowitz). * Fix missing scroll bars in detail log (Podi). """ # TODO: color stderr # TODO: simplify javascript using ,ore than 1 class in the class attribute? import datetime import StringIO import sys import time import unittest from xml.sax import saxutils # ------------------------------------------------------------------------ # The redirectors below are used to capture output during testing. Output # sent to sys.stdout and sys.stderr are automatically captured. However # in some cases sys.stdout is already cached before HTMLTestRunner is # invoked (e.g. calling logging.basicConfig). In order to capture those # output, use the redirectors for the cached stream. # # e.g. # >>> logging.basicConfig(stream=HTMLTestRunner.stdout_redirector) # >>> def to_unicode(s): try: return unicode(s) except UnicodeDecodeError: # s is non ascii byte string return s.decode('unicode_escape') class OutputRedirector(object): """ Wrapper to redirect stdout or stderr """ def __init__(self, fp): self.fp = fp def write(self, s): self.fp.write(to_unicode(s)) def writelines(self, lines): lines = map(to_unicode, lines) self.fp.writelines(lines) def flush(self): self.fp.flush() stdout_redirector = OutputRedirector(sys.stdout) stderr_redirector = OutputRedirector(sys.stderr) # ---------------------------------------------------------------------- # Template class Template_mixin(object): """ Define a HTML template for report customerization and generation. Overall structure of an HTML report HTML +------------------------+ |<html> | | <head> | | | | STYLESHEET | | +----------------+ | | | | | | +----------------+ | | | | </head> | | | | <body> | | | | HEADING | | +----------------+ | | | | | | +----------------+ | | | | REPORT | | +----------------+ | | | | | | +----------------+ | | | | ENDING | | +----------------+ | | | | | | +----------------+ | | | | </body> | |</html> | +------------------------+ """ STATUS = { 0: 'pass', 1: 'fail', 2: 'error', } DEFAULT_TITLE = 'Unit Test Report' DEFAULT_DESCRIPTION = '' # ------------------------------------------------------------------------ # HTML Template HTML_TMPL = r"""<?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <title>%(title)s</title> <meta name="generator" content="%(generator)s"/> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"/> %(stylesheet)s </head> <body> <script language="javascript" type="text/javascript"><!-- output_list = Array(); /* level - 0:Summary; 1:Failed; 2:All */ function showCase(level) { trs = document.getElementsByTagName("tr"); for (var i = 0; i < trs.length; i++) { tr = trs[i]; id = tr.id; if (id.substr(0,2) == 'ft') { if (level < 1) { tr.className = 'hiddenRow'; } else { tr.className = ''; } } if (id.substr(0,2) == 'pt') { if (level > 1) { tr.className = ''; } else { tr.className = 'hiddenRow'; } } } } function showClassDetail(cid, count) { var id_list = Array(count); var toHide = 1; for (var i = 0; i < count; i++) { tid0 = 't' + cid.substr(1) + '.' + (i+1); tid = 'f' + tid0; tr = document.getElementById(tid); if (!tr) { tid = 'p' + tid0; tr = document.getElementById(tid); } id_list[i] = tid; if (tr.className) { toHide = 0; } } for (var i = 0; i < count; i++) { tid = id_list[i]; if (toHide) { if(document.getElementById('div_'+tid)){ document.getElementById('div_'+tid).style.display = 'none'; } document.getElementById(tid).className = 'hiddenRow'; } else { document.getElementById(tid).className = ''; } } } function showTestDetail(div_id){ var details_div = document.getElementById(div_id) var displayState = details_div.style.display // alert(displayState) if (displayState != 'block' ) { displayState = 'block' details_div.style.display = 'block' } else { details_div.style.display = 'none' } } function html_escape(s) { s = s.replace(/&/g,'&amp;'); s = s.replace(/</g,'&lt;'); s = s.replace(/>/g,'&gt;'); return s; } /* obsoleted by detail in <div> function showOutput(id, name) { var w = window.open("", //url name, "resizable,scrollbars,status,width=800,height=450"); d = w.document; d.write("<pre>"); d.write(html_escape(output_list[id])); d.write("\n"); d.write("<a href='javascript:window.close()'>close</a>\n"); d.write("</pre>\n"); d.close(); } */ --></script> %(heading)s %(report)s %(ending)s </body> </html> """ # variables: (title, generator, stylesheet, heading, report, ending) # ------------------------------------------------------------------------ # Stylesheet # # alternatively use a <link> for external style sheet, e.g. # <link rel="stylesheet" href="$url" type="text/css"> STYLESHEET_TMPL = """ <style type="text/css" media="screen"> body { font-family: verdana, arial, helvetica, sans-serif; font-size: 80%; } table { font-size: 100%; } pre { } /* -- heading ---------------------------------------------------------------------- */ h1 { font-size: 16pt; color: gray; } .heading { margin-top: 0ex; margin-bottom: 1ex; } .heading .attribute { margin-top: 1ex; margin-bottom: 0; } .heading .description { margin-top: 4ex; margin-bottom: 6ex; } /* -- css div popup ------------------------------------------------------------------------ */ a.popup_link { } a.popup_link:hover { color: red; } .popup_window { display: none; position: relative; left: 0px; top: 0px; padding: 10px; background-color: #EEE; font-family: "Lucida Console", "Courier New", Courier, monospace; text-align: left; font-size: 8pt; } } /* -- report ------------------------------------------------------------------------ */ #show_detail_line { margin-top: 3ex; margin-bottom: 1ex; } #result_table { width: 80%; border-collapse: collapse; border: 1px solid #777; } #header_row { font-weight: bold; color: white; background-color: #777; } #result_table td { border: 1px solid rgba(119, 119, 119, 0.23); padding: 2px; vertical-align:top; } #total_row { font-weight: bold; } .passClass { background-color: #00c853; color: white;} .failClass { background-color: #fa842d; color: white;} .errorClass { background-color: #fa2d2d; color: white;} .passCase { color: #00c853; } .failCase { color: #fa842d; background-color: #f9ede4; } .errorCase { color: #fa2d2d; background-color: #ffefef } .hiddenRow { display: none; } .testcase { margin-left: 2em; } /* -- ending ---------------------------------------------------------------------- */ #ending { } </style> """ # ------------------------------------------------------------------------ # Heading # HEADING_TMPL = """<div class='heading'> <h1>%(title)s</h1> %(parameters)s <p class='description'>%(description)s</p> </div> """ # variables: (title, parameters, description) HEADING_ATTRIBUTE_TMPL = """<p class='attribute'><strong>%(name)s:</strong> %(value)s</p> """ # variables: (name, value) # ------------------------------------------------------------------------ # Report # REPORT_TMPL = """ <p id='show_detail_line'>Show <a href='javascript:showCase(0)'>Summary</a> <a href='javascript:showCase(1)'>Failed</a> <a href='javascript:showCase(2)'>All</a> </p> <table id='result_table'> <colgroup> <col align='left' /> <col align='right' /> <col align='right' /> <col align='right' /> <col align='right' /> <col align='right' /> </colgroup> <tr id='header_row'> <td>Test Group/Test case</td> <td>Count</td> <td>Pass</td> <td>Fail</td> <td>Error</td> <td>View</td> </tr> %(test_list)s <tr id='total_row'> <td>Total</td> <td>%(count)s</td> <td>%(Pass)s</td> <td>%(fail)s</td> <td>%(error)s</td> <td>&nbsp;</td> </tr> </table> """ # variables: (test_list, count, Pass, fail, error) REPORT_CLASS_TMPL = r""" <tr class='%(style)s'> <td>%(desc)s</td> <td>%(count)s</td> <td>%(Pass)s</td> <td>%(fail)s</td> <td>%(error)s</td> <td><a href="javascript:showClassDetail('%(cid)s',%(count)s)">Detail</a></td> </tr> """ # variables: (style, desc, count, Pass, fail, error, cid) REPORT_TEST_WITH_OUTPUT_TMPL = ur""" <tr id='%(tid)s' class='%(Class)s'> <td class='%(style)s'><div class='testcase'>%(desc)s</div></td> <td colspan='5' align='center'> <!--css div popup start--> <a class="popup_link" onfocus='this.blur();' href="javascript:showTestDetail('div_%(tid)s')" > %(status)s</a> <div id='div_%(tid)s' class="popup_window"> <div style='text-align: right;cursor:pointer;font-size: large;font-weight: bold;'> <a onfocus='this.blur();' onclick="document.getElementById('div_%(tid)s').style.display = 'none' " > ×</a> </div> <pre> %(script)s </pre> </div> <!--css div popup end--> </td> </tr> """ # variables: (tid, Class, style, desc, status) REPORT_TEST_NO_OUTPUT_TMPL = r""" <tr id='%(tid)s' class='%(Class)s'> <td class='%(style)s'><div class='testcase'>%(desc)s</div></td> <td colspan='5' align='center'>%(status)s</td> </tr> """ # variables: (tid, Class, style, desc, status) REPORT_TEST_OUTPUT_TMPL = r""" %(id)s: %(output)s """ # variables: (id, output) # ------------------------------------------------------------------------ # ENDING # ENDING_TMPL = """<div id='ending'>&nbsp;</div>""" # -------------------- The end of the Template class ------------------- TestResult = unittest.TestResult class _TestResult(TestResult): # note: _TestResult is a pure representation of results. # It lacks the output and reporting ability compares to unittest._TextTestResult. def __init__(self, verbosity=1): TestResult.__init__(self) self.outputBuffer = StringIO.StringIO() self.stdout0 = None self.stderr0 = None self.success_count = 0 self.failure_count = 0 self.error_count = 0 self.verbosity = verbosity # result is a list of result in 4 tuple # ( # result code (0: success; 1: fail; 2: error), # TestCase object, # Test output (byte string), # stack trace, # ) self.result = [] def startTest(self, test): TestResult.startTest(self, test) # just one buffer for both stdout and stderr stdout_redirector.fp = self.outputBuffer stderr_redirector.fp = self.outputBuffer self.stdout0 = sys.stdout self.stderr0 = sys.stderr sys.stdout = stdout_redirector sys.stderr = stderr_redirector def complete_output(self): """ Disconnect output redirection and return buffer. Safe to call multiple times. """ if self.stdout0: sys.stdout = self.stdout0 sys.stderr = self.stderr0 self.stdout0 = None self.stderr0 = None return self.outputBuffer.getvalue() def stopTest(self, test): # Usually one of addSuccess, addError or addFailure would have been called. # But there are some path in unittest that would bypass this. # We must disconnect stdout in stopTest(), which is guaranteed to be called. self.complete_output() def addSuccess(self, test): self.success_count += 1 TestResult.addSuccess(self, test) output = self.complete_output() self.result.append((0, test, output, '')) if self.verbosity > 1: sys.stderr.write('ok ') sys.stderr.write(str(test)) sys.stderr.write('\n') else: sys.stderr.write('.') def addError(self, test, err): self.error_count += 1 TestResult.addError(self, test, err) _, _exc_str = self.errors[-1] output = self.complete_output() self.result.append((2, test, output, _exc_str)) if self.verbosity > 1: sys.stderr.write('E ') sys.stderr.write(str(test)) sys.stderr.write('\n') else: sys.stderr.write('E') def addFailure(self, test, err): self.failure_count += 1 TestResult.addFailure(self, test, err) _, _exc_str = self.failures[-1] output = self.complete_output() self.result.append((1, test, output, _exc_str)) if self.verbosity > 1: sys.stderr.write('F ') sys.stderr.write(str(test)) sys.stderr.write('\n') else: sys.stderr.write('F') class HTMLTestRunner(Template_mixin): """ """ def __init__(self, stream=sys.stdout, verbosity=1, title=None, description=None): self.stream = stream self.verbosity = verbosity if title is None: self.title = self.DEFAULT_TITLE else: self.title = title if description is None: self.description = self.DEFAULT_DESCRIPTION else: self.description = description self.startTime = datetime.datetime.now() def run(self, test): "Run the given test case or test suite." result = _TestResult(self.verbosity) test(result) self.stopTime = datetime.datetime.now() self.generateReport(test, result) print >>sys.stderr, '\nTime Elapsed: %s' % (self.stopTime-self.startTime) return result def sortResult(self, result_list): # unittest does not seems to run in any particular order. # Here at least we want to group them together by class. rmap = {} classes = [] for n,t,o,e in result_list: cls = t.__class__ if not rmap.has_key(cls): rmap[cls] = [] classes.append(cls) rmap[cls].append((n,t,o,e)) r = [(cls, rmap[cls]) for cls in classes] return r def getReportAttributes(self, result): """ Return report attributes as a list of (name, value). Override this to add custom attributes. """ startTime = str(self.startTime)[:19] duration = str(self.stopTime - self.startTime) status = [] if result.success_count: status.append('Pass %s' % result.success_count) if result.failure_count: status.append('Failure %s' % result.failure_count) if result.error_count: status.append('Error %s' % result.error_count ) if status: status = ' '.join(status) else: status = 'none' return [ ('Start Time', startTime), ('Duration', duration), ('Status', status), ] def generateReport(self, test, result): report_attrs = self.getReportAttributes(result) generator = 'HTMLTestRunner %s' % __version__ stylesheet = self._generate_stylesheet() heading = self._generate_heading(report_attrs) report = self._generate_report(result) ending = self._generate_ending() output = self.HTML_TMPL % dict( title = saxutils.escape(self.title), generator = generator, stylesheet = stylesheet, heading = heading, report = report, ending = ending, ) self.stream.write(output.encode('utf8')) def _generate_stylesheet(self): return self.STYLESHEET_TMPL def _generate_heading(self, report_attrs): a_lines = [] for name, value in report_attrs: line = self.HEADING_ATTRIBUTE_TMPL % dict( name = saxutils.escape(name), value = saxutils.escape(value), ) a_lines.append(line) heading = self.HEADING_TMPL % dict( title = saxutils.escape(self.title), parameters = ''.join(a_lines), description = saxutils.escape(self.description), ) return heading def _generate_report(self, result): rows = [] sortedResult = self.sortResult(result.result) for cid, (cls, cls_results) in enumerate(sortedResult): # subtotal for a class np = nf = ne = 0 for n,t,o,e in cls_results: if n == 0: np += 1 elif n == 1: nf += 1 else: ne += 1 # format class description if cls.__module__ == "__main__": name = cls.__name__ else: name = "%s.%s" % (cls.__module__, cls.__name__) doc = cls.__doc__ and cls.__doc__.split("\n")[0] or "" desc = doc and '%s: %s' % (name, doc) or name row = self.REPORT_CLASS_TMPL % dict( style = ne > 0 and 'errorClass' or nf > 0 and 'failClass' or 'passClass', desc = desc, count = np+nf+ne, Pass = np, fail = nf, error = ne, cid = 'c%s' % (cid+1), ) rows.append(row) for tid, (n,t,o,e) in enumerate(cls_results): self._generate_report_test(rows, cid, tid, n, t, o, e) report = self.REPORT_TMPL % dict( test_list = ''.join(rows), count = str(result.success_count+result.failure_count+result.error_count), Pass = str(result.success_count), fail = str(result.failure_count), error = str(result.error_count), ) return report def _generate_report_test(self, rows, cid, tid, n, t, o, e): # e.g. 'pt1.1', 'ft1.1', etc has_output = bool(o or e) tid = (n == 0 and 'p' or 'f') + 't%s.%s' % (cid+1,tid+1) name = t.id().split('.')[-1] doc = t.shortDescription() or "" desc = doc and ('%s: %s' % (name, doc)) or name tmpl = has_output and self.REPORT_TEST_WITH_OUTPUT_TMPL or self.REPORT_TEST_NO_OUTPUT_TMPL # o and e should be byte string because they are collected from stdout and stderr? if isinstance(o,str): # TODO: some problem with 'string_escape': it escape \n and mess up formating # uo = unicode(o.encode('string_escape')) uo = o.decode('latin-1') else: uo = o if isinstance(e,str): # TODO: some problem with 'string_escape': it escape \n and mess up formating # ue = unicode(e.encode('string_escape')) ue = e.decode('latin-1') else: ue = e script = self.REPORT_TEST_OUTPUT_TMPL % dict( id = tid, output = saxutils.escape(uo+ue), ) row = tmpl % dict( tid = tid, Class = (n == 0 and 'hiddenRow' or 'none'), style = n == 2 and 'errorCase' or (n == 1 and 'failCase' or 'none'), desc = desc, script = script, status = self.STATUS[n], ) rows.append(row) if not has_output: return def _generate_ending(self): return self.ENDING_TMPL ############################################################################## # Facilities for running tests from the command line ############################################################################## # Note: Reuse unittest.TestProgram to launch test. In the future we may # build our own launcher to support more specific command line # parameters like test title, CSS, etc. class TestProgram(unittest.TestProgram): """ A variation of the unittest.TestProgram. Please refer to the base class for command line parameters. """ def runTests(self): # Pick HTMLTestRunner as the default test runner. # base class's testRunner parameter is not useful because it means # we have to instantiate HTMLTestRunner before we know self.verbosity. if self.testRunner is None: self.testRunner = HTMLTestRunner(verbosity=self.verbosity) unittest.TestProgram.runTests(self) main = TestProgram ############################################################################## # Executing this module from the command line ############################################################################## if __name__ == "__main__": main(module=None)
{ "content_hash": "eb7f2f1ef0c052878ee47e559c9b0c20", "timestamp": "", "source": "github", "line_count": 837, "max_line_length": 109, "avg_line_length": 29.675029868578257, "alnum_prop": 0.5354295837023915, "repo_name": "LukeMurphey/splunk-network-tools", "id": "f747ebd8ee74f27d0ef19098424892a4ca849c37", "size": "24839", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "tests/HTMLTestRunner.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "CSS", "bytes": "26768" }, { "name": "HTML", "bytes": "25259" }, { "name": "JavaScript", "bytes": "119795" }, { "name": "Python", "bytes": "1621004" } ], "symlink_target": "" }
"""Pens for creating UFO glyphs.""" from robofab.objects.objectsBase import MOVE, LINE, CORNER, CURVE, QCURVE, OFFCURVE from robofab.objects.objectsRF import RContour, RSegment, RPoint from robofab.pens.pointPen import BasePointToSegmentPen from robofab.pens.adapterPens import SegmentToPointPen class RFUFOPen(SegmentToPointPen): def __init__(self, glyph): SegmentToPointPen.__init__(self, RFUFOPointPen(glyph)) class RFUFOPointPen(BasePointToSegmentPen): """Point pen for building objectsRF glyphs""" def __init__(self, glyph): BasePointToSegmentPen.__init__(self) self.glyph = glyph def _flushContour(self, segments): # # adapted from robofab.pens.adapterPens.PointToSegmentPen # assert len(segments) >= 1 # if we only have one point and it has a name, we must have an anchor first = segments[0] segmentType, points = first pt, smooth, name, kwargs = points[0] if len(segments) == 1 and name != None: self.glyph.appendAnchor(name, pt) return # we must have a contour contour = RContour() contour.setParent(self.glyph) if segments[0][0] == "move": # It's an open path. closed = False points = segments[0][1] assert len(points) == 1 movePt, smooth, name, kwargs = points[0] del segments[0] else: # It's a closed path, do a moveTo to the last # point of the last segment. only if it isn't a qcurve closed = True segmentType, points = segments[-1] movePt, smooth, name, kwargs = points[-1] ## THIS IS STILL UNDECIDED!!! # since objectsRF currently follows the FL model of not # allowing open contours, remove the last segment # since it is being replaced by a move if segmentType == 'line': del segments[-1] # construct a move segment and apply it to the contour if we aren't dealing with a qcurve segment = RSegment() segment.setParent(contour) segment.smooth = smooth rPoint = RPoint(x=movePt[0], y=movePt[1], pointType=MOVE, name=name) rPoint.setParent(segment) segment.points = [rPoint] contour.segments.append(segment) # do the rest of the segments for segmentType, points in segments: points = [(pt, name) for pt, smooth, name, kwargs in points] if segmentType == "line": assert len(points) == 1 sType = LINE elif segmentType == "curve": sType = CURVE elif segmentType == "qcurve": sType = QCURVE else: assert 0, "illegal segmentType: %s" % segmentType segment = RSegment() segment.setParent(contour) segment.smooth = smooth rPoints = [] # handle the offCurves for point in points[:-1]: point, name = point rPoint = RPoint(x=point[0], y=point[1], pointType=OFFCURVE, name=name) rPoint.setParent(segment) rPoints.append(rPoint) # now the onCurve point, name = points[-1] rPoint = RPoint(x=point[0], y=point[1], pointType=sType, name=name) rPoint.setParent(segment) rPoints.append(rPoint) # apply them to the segment segment.points = rPoints contour.segments.append(segment) if contour.segments[-1].type == "curve": contour.segments[-1].points[-1].name = None self.glyph.contours.append(contour) def addComponent(self, glyphName, transform): xx, xy, yx, yy, dx, dy = transform self.glyph.appendComponent(baseGlyph=glyphName, offset=(dx, dy), scale=(xx, yy))
{ "content_hash": "3c876329d60fbe021168becc22d12bf5", "timestamp": "", "source": "github", "line_count": 103, "max_line_length": 91, "avg_line_length": 32.029126213592235, "alnum_prop": 0.6938466201879357, "repo_name": "jamesgk/robofab", "id": "265d7aea027f0ec0bea6c4f638f1648d51a59620", "size": "3299", "binary": false, "copies": "9", "ref": "refs/heads/master", "path": "Lib/robofab/pens/rfUFOPen.py", "mode": "33261", "license": "bsd-3-clause", "language": [ { "name": "CSS", "bytes": "8714" }, { "name": "HTML", "bytes": "4597" }, { "name": "Makefile", "bytes": "6776" }, { "name": "Python", "bytes": "902044" } ], "symlink_target": "" }
"""Init and utils.""" from zope.i18nmessageid import MessageFactory _ = MessageFactory('biobee.sitetheme') def initialize(context): """Initializer called when used as a Zope 2 product."""
{ "content_hash": "106db11e70ce28cf4853b7a37913d43c", "timestamp": "", "source": "github", "line_count": 9, "max_line_length": 59, "avg_line_length": 21.77777777777778, "alnum_prop": 0.7244897959183674, "repo_name": "a25kk/biobee", "id": "399b48f69a957abb33fc77689839ede3ae733372", "size": "220", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "src/biobee.sitetheme/biobee/sitetheme/__init__.py", "mode": "33261", "license": "mit", "language": [ { "name": "CSS", "bytes": "426222" }, { "name": "HTML", "bytes": "29770" }, { "name": "JavaScript", "bytes": "792827" }, { "name": "Makefile", "bytes": "2579" }, { "name": "Python", "bytes": "33747" } ], "symlink_target": "" }
"""Config flow for konnected.io integration.""" import asyncio import copy import logging import random import string from urllib.parse import urlparse import voluptuous as vol from homeassistant import config_entries from homeassistant.components.binary_sensor import ( DEVICE_CLASS_DOOR, DEVICE_CLASSES_SCHEMA, ) from homeassistant.components.ssdp import ATTR_UPNP_MANUFACTURER, ATTR_UPNP_MODEL_NAME from homeassistant.const import ( CONF_ACCESS_TOKEN, CONF_BINARY_SENSORS, CONF_HOST, CONF_ID, CONF_NAME, CONF_PORT, CONF_SENSORS, CONF_SWITCHES, CONF_TYPE, CONF_ZONE, ) from homeassistant.core import callback from homeassistant.helpers import config_validation as cv from .const import ( CONF_ACTIVATION, CONF_API_HOST, CONF_BLINK, CONF_DEFAULT_OPTIONS, CONF_DISCOVERY, CONF_INVERSE, CONF_MODEL, CONF_MOMENTARY, CONF_PAUSE, CONF_POLL_INTERVAL, CONF_REPEAT, DOMAIN, STATE_HIGH, STATE_LOW, ZONES, ) from .errors import CannotConnect from .panel import KONN_MODEL, KONN_MODEL_PRO, get_status _LOGGER = logging.getLogger(__name__) ATTR_KONN_UPNP_MODEL_NAME = "model_name" # standard upnp is modelName CONF_IO = "io" CONF_IO_DIS = "Disabled" CONF_IO_BIN = "Binary Sensor" CONF_IO_DIG = "Digital Sensor" CONF_IO_SWI = "Switchable Output" CONF_MORE_STATES = "more_states" CONF_YES = "Yes" CONF_NO = "No" CONF_OVERRIDE_API_HOST = "override_api_host" KONN_MANUFACTURER = "konnected.io" KONN_PANEL_MODEL_NAMES = { KONN_MODEL: "Konnected Alarm Panel", KONN_MODEL_PRO: "Konnected Alarm Panel Pro", } OPTIONS_IO_ANY = vol.In([CONF_IO_DIS, CONF_IO_BIN, CONF_IO_DIG, CONF_IO_SWI]) OPTIONS_IO_INPUT_ONLY = vol.In([CONF_IO_DIS, CONF_IO_BIN, CONF_IO_DIG]) OPTIONS_IO_OUTPUT_ONLY = vol.In([CONF_IO_DIS, CONF_IO_SWI]) # Config entry schemas IO_SCHEMA = vol.Schema( { vol.Optional("1", default=CONF_IO_DIS): OPTIONS_IO_ANY, vol.Optional("2", default=CONF_IO_DIS): OPTIONS_IO_ANY, vol.Optional("3", default=CONF_IO_DIS): OPTIONS_IO_ANY, vol.Optional("4", default=CONF_IO_DIS): OPTIONS_IO_ANY, vol.Optional("5", default=CONF_IO_DIS): OPTIONS_IO_ANY, vol.Optional("6", default=CONF_IO_DIS): OPTIONS_IO_ANY, vol.Optional("7", default=CONF_IO_DIS): OPTIONS_IO_ANY, vol.Optional("8", default=CONF_IO_DIS): OPTIONS_IO_ANY, vol.Optional("9", default=CONF_IO_DIS): OPTIONS_IO_INPUT_ONLY, vol.Optional("10", default=CONF_IO_DIS): OPTIONS_IO_INPUT_ONLY, vol.Optional("11", default=CONF_IO_DIS): OPTIONS_IO_INPUT_ONLY, vol.Optional("12", default=CONF_IO_DIS): OPTIONS_IO_INPUT_ONLY, vol.Optional("out", default=CONF_IO_DIS): OPTIONS_IO_OUTPUT_ONLY, vol.Optional("alarm1", default=CONF_IO_DIS): OPTIONS_IO_OUTPUT_ONLY, vol.Optional("out1", default=CONF_IO_DIS): OPTIONS_IO_OUTPUT_ONLY, vol.Optional("alarm2_out2", default=CONF_IO_DIS): OPTIONS_IO_OUTPUT_ONLY, } ) BINARY_SENSOR_SCHEMA = vol.Schema( { vol.Required(CONF_ZONE): vol.In(ZONES), vol.Required(CONF_TYPE, default=DEVICE_CLASS_DOOR): DEVICE_CLASSES_SCHEMA, vol.Optional(CONF_NAME): cv.string, vol.Optional(CONF_INVERSE, default=False): cv.boolean, } ) SENSOR_SCHEMA = vol.Schema( { vol.Required(CONF_ZONE): vol.In(ZONES), vol.Required(CONF_TYPE, default="dht"): vol.All( vol.Lower, vol.In(["dht", "ds18b20"]) ), vol.Optional(CONF_NAME): cv.string, vol.Optional(CONF_POLL_INTERVAL, default=3): vol.All( vol.Coerce(int), vol.Range(min=1) ), } ) SWITCH_SCHEMA = vol.Schema( { vol.Required(CONF_ZONE): vol.In(ZONES), vol.Optional(CONF_NAME): cv.string, vol.Optional(CONF_ACTIVATION, default=STATE_HIGH): vol.All( vol.Lower, vol.In([STATE_HIGH, STATE_LOW]) ), vol.Optional(CONF_MOMENTARY): vol.All(vol.Coerce(int), vol.Range(min=10)), vol.Optional(CONF_PAUSE): vol.All(vol.Coerce(int), vol.Range(min=10)), vol.Optional(CONF_REPEAT): vol.All(vol.Coerce(int), vol.Range(min=-1)), } ) OPTIONS_SCHEMA = vol.Schema( { vol.Required(CONF_IO): IO_SCHEMA, vol.Optional(CONF_BINARY_SENSORS): vol.All( cv.ensure_list, [BINARY_SENSOR_SCHEMA] ), vol.Optional(CONF_SENSORS): vol.All(cv.ensure_list, [SENSOR_SCHEMA]), vol.Optional(CONF_SWITCHES): vol.All(cv.ensure_list, [SWITCH_SCHEMA]), vol.Optional(CONF_BLINK, default=True): cv.boolean, vol.Optional(CONF_API_HOST, default=""): vol.Any("", cv.url), vol.Optional(CONF_DISCOVERY, default=True): cv.boolean, }, extra=vol.REMOVE_EXTRA, ) CONFIG_ENTRY_SCHEMA = vol.Schema( { vol.Required(CONF_ID): cv.matches_regex("[0-9a-f]{12}"), vol.Required(CONF_HOST): cv.string, vol.Required(CONF_PORT): cv.port, vol.Required(CONF_MODEL): vol.Any(*KONN_PANEL_MODEL_NAMES), vol.Required(CONF_ACCESS_TOKEN): cv.matches_regex("[a-zA-Z0-9]+"), vol.Required(CONF_DEFAULT_OPTIONS): OPTIONS_SCHEMA, }, extra=vol.REMOVE_EXTRA, ) class KonnectedFlowHandler(config_entries.ConfigFlow, domain=DOMAIN): """Handle a config flow for NEW_NAME.""" VERSION = 1 CONNECTION_CLASS = config_entries.CONN_CLASS_LOCAL_PUSH # class variable to store/share discovered host information discovered_hosts = {} # pylint: disable=no-member # https://github.com/PyCQA/pylint/issues/3167 def __init__(self): """Initialize the Konnected flow.""" self.data = {} self.options = OPTIONS_SCHEMA({CONF_IO: {}}) async def async_gen_config(self, host, port): """Populate self.data based on panel status. This will raise CannotConnect if an error occurs """ self.data[CONF_HOST] = host self.data[CONF_PORT] = port try: status = await get_status(self.hass, host, port) self.data[CONF_ID] = status.get("chipId", status["mac"].replace(":", "")) except (CannotConnect, KeyError): raise CannotConnect else: self.data[CONF_MODEL] = status.get("model", KONN_MODEL) self.data[CONF_ACCESS_TOKEN] = "".join( random.choices(f"{string.ascii_uppercase}{string.digits}", k=20) ) async def async_step_import(self, device_config): """Import a configuration.yaml config. This flow is triggered by `async_setup` for configured panels. """ _LOGGER.debug(device_config) # save the data and confirm connection via user step await self.async_set_unique_id(device_config["id"]) self.options = device_config[CONF_DEFAULT_OPTIONS] # config schema ensures we have port if we have host if device_config.get(CONF_HOST): # automatically connect if we have host info return await self.async_step_user( user_input={ CONF_HOST: device_config[CONF_HOST], CONF_PORT: device_config[CONF_PORT], } ) # if we have no host info wait for it or abort if previously configured self._abort_if_unique_id_configured() return await self.async_step_import_confirm() async def async_step_import_confirm(self, user_input=None): """Confirm the user wants to import the config entry.""" if user_input is None: return self.async_show_form( step_id="import_confirm", description_placeholders={"id": self.unique_id}, ) # if we have ssdp discovered applicable host info use it if KonnectedFlowHandler.discovered_hosts.get(self.unique_id): return await self.async_step_user( user_input={ CONF_HOST: KonnectedFlowHandler.discovered_hosts[self.unique_id][ CONF_HOST ], CONF_PORT: KonnectedFlowHandler.discovered_hosts[self.unique_id][ CONF_PORT ], } ) return await self.async_step_user() async def async_step_ssdp(self, discovery_info): """Handle a discovered konnected panel. This flow is triggered by the SSDP component. It will check if the device is already configured and attempt to finish the config if not. """ _LOGGER.debug(discovery_info) try: if discovery_info[ATTR_UPNP_MANUFACTURER] != KONN_MANUFACTURER: return self.async_abort(reason="not_konn_panel") if not any( name in discovery_info[ATTR_UPNP_MODEL_NAME] for name in KONN_PANEL_MODEL_NAMES ): _LOGGER.warning( "Discovered unrecognized Konnected device %s", discovery_info.get(ATTR_UPNP_MODEL_NAME, "Unknown"), ) return self.async_abort(reason="not_konn_panel") # If MAC is missing it is a bug in the device fw but we'll guard # against it since the field is so vital except KeyError: _LOGGER.error("Malformed Konnected SSDP info") else: # extract host/port from ssdp_location netloc = urlparse(discovery_info["ssdp_location"]).netloc.split(":") return await self.async_step_user( user_input={CONF_HOST: netloc[0], CONF_PORT: int(netloc[1])} ) return self.async_abort(reason="unknown") async def async_step_user(self, user_input=None): """Connect to panel and get config.""" errors = {} if user_input: # build config info and wait for user confirmation self.data[CONF_HOST] = user_input[CONF_HOST] self.data[CONF_PORT] = user_input[CONF_PORT] # brief delay to allow processing of recent status req await asyncio.sleep(0.1) try: status = await get_status( self.hass, self.data[CONF_HOST], self.data[CONF_PORT] ) except CannotConnect: errors["base"] = "cannot_connect" else: self.data[CONF_ID] = status.get( "chipId", status["mac"].replace(":", "") ) self.data[CONF_MODEL] = status.get("model", KONN_MODEL) # save off our discovered host info KonnectedFlowHandler.discovered_hosts[self.data[CONF_ID]] = { CONF_HOST: self.data[CONF_HOST], CONF_PORT: self.data[CONF_PORT], } return await self.async_step_confirm() return self.async_show_form( step_id="user", description_placeholders={ "host": self.data.get(CONF_HOST, "Unknown"), "port": self.data.get(CONF_PORT, "Unknown"), }, data_schema=vol.Schema( { vol.Required(CONF_HOST, default=self.data.get(CONF_HOST)): str, vol.Required(CONF_PORT, default=self.data.get(CONF_PORT)): int, } ), errors=errors, ) async def async_step_confirm(self, user_input=None): """Attempt to link with the Konnected panel. Given a configured host, will ask the user to confirm and finalize the connection. """ if user_input is None: # abort and update an existing config entry if host info changes await self.async_set_unique_id(self.data[CONF_ID]) self._abort_if_unique_id_configured(updates=self.data) return self.async_show_form( step_id="confirm", description_placeholders={ "model": KONN_PANEL_MODEL_NAMES[self.data[CONF_MODEL]], "id": self.unique_id, "host": self.data[CONF_HOST], "port": self.data[CONF_PORT], }, ) # Create access token, attach default options and create entry self.data[CONF_DEFAULT_OPTIONS] = self.options self.data[CONF_ACCESS_TOKEN] = self.hass.data.get(DOMAIN, {}).get( CONF_ACCESS_TOKEN ) or "".join(random.choices(f"{string.ascii_uppercase}{string.digits}", k=20)) return self.async_create_entry( title=KONN_PANEL_MODEL_NAMES[self.data[CONF_MODEL]], data=self.data, ) @staticmethod @callback def async_get_options_flow(config_entry): """Return the Options Flow.""" return OptionsFlowHandler(config_entry) class OptionsFlowHandler(config_entries.OptionsFlow): """Handle a option flow for a Konnected Panel.""" def __init__(self, config_entry: config_entries.ConfigEntry): """Initialize options flow.""" self.entry = config_entry self.model = self.entry.data[CONF_MODEL] self.current_opt = self.entry.options or self.entry.data[CONF_DEFAULT_OPTIONS] # as config proceeds we'll build up new options and then replace what's in the config entry self.new_opt = {CONF_IO: {}} self.active_cfg = None self.io_cfg = {} self.current_states = [] self.current_state = 1 @callback def get_current_cfg(self, io_type, zone): """Get the current zone config.""" return next( ( cfg for cfg in self.current_opt.get(io_type, []) if cfg[CONF_ZONE] == zone ), {}, ) async def async_step_init(self, user_input=None): """Handle options flow.""" return await self.async_step_options_io() async def async_step_options_io(self, user_input=None): """Configure legacy panel IO or first half of pro IO.""" errors = {} current_io = self.current_opt.get(CONF_IO, {}) if user_input is not None: # strip out disabled io and save for options cfg for key, value in user_input.items(): if value != CONF_IO_DIS: self.new_opt[CONF_IO][key] = value return await self.async_step_options_io_ext() if self.model == KONN_MODEL: return self.async_show_form( step_id="options_io", data_schema=vol.Schema( { vol.Required( "1", default=current_io.get("1", CONF_IO_DIS) ): OPTIONS_IO_ANY, vol.Required( "2", default=current_io.get("2", CONF_IO_DIS) ): OPTIONS_IO_ANY, vol.Required( "3", default=current_io.get("3", CONF_IO_DIS) ): OPTIONS_IO_ANY, vol.Required( "4", default=current_io.get("4", CONF_IO_DIS) ): OPTIONS_IO_ANY, vol.Required( "5", default=current_io.get("5", CONF_IO_DIS) ): OPTIONS_IO_ANY, vol.Required( "6", default=current_io.get("6", CONF_IO_DIS) ): OPTIONS_IO_ANY, vol.Required( "out", default=current_io.get("out", CONF_IO_DIS) ): OPTIONS_IO_OUTPUT_ONLY, } ), description_placeholders={ "model": KONN_PANEL_MODEL_NAMES[self.model], "host": self.entry.data[CONF_HOST], }, errors=errors, ) # configure the first half of the pro board io if self.model == KONN_MODEL_PRO: return self.async_show_form( step_id="options_io", data_schema=vol.Schema( { vol.Required( "1", default=current_io.get("1", CONF_IO_DIS) ): OPTIONS_IO_ANY, vol.Required( "2", default=current_io.get("2", CONF_IO_DIS) ): OPTIONS_IO_ANY, vol.Required( "3", default=current_io.get("3", CONF_IO_DIS) ): OPTIONS_IO_ANY, vol.Required( "4", default=current_io.get("4", CONF_IO_DIS) ): OPTIONS_IO_ANY, vol.Required( "5", default=current_io.get("5", CONF_IO_DIS) ): OPTIONS_IO_ANY, vol.Required( "6", default=current_io.get("6", CONF_IO_DIS) ): OPTIONS_IO_ANY, vol.Required( "7", default=current_io.get("7", CONF_IO_DIS) ): OPTIONS_IO_ANY, } ), description_placeholders={ "model": KONN_PANEL_MODEL_NAMES[self.model], "host": self.entry.data[CONF_HOST], }, errors=errors, ) return self.async_abort(reason="not_konn_panel") async def async_step_options_io_ext(self, user_input=None): """Allow the user to configure the extended IO for pro.""" errors = {} current_io = self.current_opt.get(CONF_IO, {}) if user_input is not None: # strip out disabled io and save for options cfg for key, value in user_input.items(): if value != CONF_IO_DIS: self.new_opt[CONF_IO].update({key: value}) self.io_cfg = copy.deepcopy(self.new_opt[CONF_IO]) return await self.async_step_options_binary() if self.model == KONN_MODEL: self.io_cfg = copy.deepcopy(self.new_opt[CONF_IO]) return await self.async_step_options_binary() if self.model == KONN_MODEL_PRO: return self.async_show_form( step_id="options_io_ext", data_schema=vol.Schema( { vol.Required( "8", default=current_io.get("8", CONF_IO_DIS) ): OPTIONS_IO_ANY, vol.Required( "9", default=current_io.get("9", CONF_IO_DIS) ): OPTIONS_IO_INPUT_ONLY, vol.Required( "10", default=current_io.get("10", CONF_IO_DIS) ): OPTIONS_IO_INPUT_ONLY, vol.Required( "11", default=current_io.get("11", CONF_IO_DIS) ): OPTIONS_IO_INPUT_ONLY, vol.Required( "12", default=current_io.get("12", CONF_IO_DIS) ): OPTIONS_IO_INPUT_ONLY, vol.Required( "alarm1", default=current_io.get("alarm1", CONF_IO_DIS) ): OPTIONS_IO_OUTPUT_ONLY, vol.Required( "out1", default=current_io.get("out1", CONF_IO_DIS) ): OPTIONS_IO_OUTPUT_ONLY, vol.Required( "alarm2_out2", default=current_io.get("alarm2_out2", CONF_IO_DIS), ): OPTIONS_IO_OUTPUT_ONLY, } ), description_placeholders={ "model": KONN_PANEL_MODEL_NAMES[self.model], "host": self.entry.data[CONF_HOST], }, errors=errors, ) return self.async_abort(reason="not_konn_panel") async def async_step_options_binary(self, user_input=None): """Allow the user to configure the IO options for binary sensors.""" errors = {} if user_input is not None: zone = {"zone": self.active_cfg} zone.update(user_input) self.new_opt[CONF_BINARY_SENSORS] = self.new_opt.get( CONF_BINARY_SENSORS, [] ) + [zone] self.io_cfg.pop(self.active_cfg) self.active_cfg = None if self.active_cfg: current_cfg = self.get_current_cfg(CONF_BINARY_SENSORS, self.active_cfg) return self.async_show_form( step_id="options_binary", data_schema=vol.Schema( { vol.Required( CONF_TYPE, default=current_cfg.get(CONF_TYPE, DEVICE_CLASS_DOOR), ): DEVICE_CLASSES_SCHEMA, vol.Optional( CONF_NAME, default=current_cfg.get(CONF_NAME, vol.UNDEFINED) ): str, vol.Optional( CONF_INVERSE, default=current_cfg.get(CONF_INVERSE, False) ): bool, } ), description_placeholders={ "zone": f"Zone {self.active_cfg}" if len(self.active_cfg) < 3 else self.active_cfg.upper }, errors=errors, ) # find the next unconfigured binary sensor for key, value in self.io_cfg.items(): if value == CONF_IO_BIN: self.active_cfg = key current_cfg = self.get_current_cfg(CONF_BINARY_SENSORS, self.active_cfg) return self.async_show_form( step_id="options_binary", data_schema=vol.Schema( { vol.Required( CONF_TYPE, default=current_cfg.get(CONF_TYPE, DEVICE_CLASS_DOOR), ): DEVICE_CLASSES_SCHEMA, vol.Optional( CONF_NAME, default=current_cfg.get(CONF_NAME, vol.UNDEFINED), ): str, vol.Optional( CONF_INVERSE, default=current_cfg.get(CONF_INVERSE, False), ): bool, } ), description_placeholders={ "zone": f"Zone {self.active_cfg}" if len(self.active_cfg) < 3 else self.active_cfg.upper }, errors=errors, ) return await self.async_step_options_digital() async def async_step_options_digital(self, user_input=None): """Allow the user to configure the IO options for digital sensors.""" errors = {} if user_input is not None: zone = {"zone": self.active_cfg} zone.update(user_input) self.new_opt[CONF_SENSORS] = self.new_opt.get(CONF_SENSORS, []) + [zone] self.io_cfg.pop(self.active_cfg) self.active_cfg = None if self.active_cfg: current_cfg = self.get_current_cfg(CONF_SENSORS, self.active_cfg) return self.async_show_form( step_id="options_digital", data_schema=vol.Schema( { vol.Required( CONF_TYPE, default=current_cfg.get(CONF_TYPE, "dht") ): vol.All(vol.Lower, vol.In(["dht", "ds18b20"])), vol.Optional( CONF_NAME, default=current_cfg.get(CONF_NAME, vol.UNDEFINED) ): str, vol.Optional( CONF_POLL_INTERVAL, default=current_cfg.get(CONF_POLL_INTERVAL, 3), ): vol.All(vol.Coerce(int), vol.Range(min=1)), } ), description_placeholders={ "zone": f"Zone {self.active_cfg}" if len(self.active_cfg) < 3 else self.active_cfg.upper() }, errors=errors, ) # find the next unconfigured digital sensor for key, value in self.io_cfg.items(): if value == CONF_IO_DIG: self.active_cfg = key current_cfg = self.get_current_cfg(CONF_SENSORS, self.active_cfg) return self.async_show_form( step_id="options_digital", data_schema=vol.Schema( { vol.Required( CONF_TYPE, default=current_cfg.get(CONF_TYPE, "dht") ): vol.All(vol.Lower, vol.In(["dht", "ds18b20"])), vol.Optional( CONF_NAME, default=current_cfg.get(CONF_NAME, vol.UNDEFINED), ): str, vol.Optional( CONF_POLL_INTERVAL, default=current_cfg.get(CONF_POLL_INTERVAL, 3), ): vol.All(vol.Coerce(int), vol.Range(min=1)), } ), description_placeholders={ "zone": f"Zone {self.active_cfg}" if len(self.active_cfg) < 3 else self.active_cfg.upper() }, errors=errors, ) return await self.async_step_options_switch() async def async_step_options_switch(self, user_input=None): """Allow the user to configure the IO options for switches.""" errors = {} if user_input is not None: zone = {"zone": self.active_cfg} zone.update(user_input) del zone[CONF_MORE_STATES] self.new_opt[CONF_SWITCHES] = self.new_opt.get(CONF_SWITCHES, []) + [zone] # iterate through multiple switch states if self.current_states: self.current_states.pop(0) # only go to next zone if all states are entered self.current_state += 1 if user_input[CONF_MORE_STATES] == CONF_NO: self.io_cfg.pop(self.active_cfg) self.active_cfg = None if self.active_cfg: current_cfg = next(iter(self.current_states), {}) return self.async_show_form( step_id="options_switch", data_schema=vol.Schema( { vol.Optional( CONF_NAME, default=current_cfg.get(CONF_NAME, vol.UNDEFINED) ): str, vol.Optional( CONF_ACTIVATION, default=current_cfg.get(CONF_ACTIVATION, STATE_HIGH), ): vol.All(vol.Lower, vol.In([STATE_HIGH, STATE_LOW])), vol.Optional( CONF_MOMENTARY, default=current_cfg.get(CONF_MOMENTARY, vol.UNDEFINED), ): vol.All(vol.Coerce(int), vol.Range(min=10)), vol.Optional( CONF_PAUSE, default=current_cfg.get(CONF_PAUSE, vol.UNDEFINED), ): vol.All(vol.Coerce(int), vol.Range(min=10)), vol.Optional( CONF_REPEAT, default=current_cfg.get(CONF_REPEAT, vol.UNDEFINED), ): vol.All(vol.Coerce(int), vol.Range(min=-1)), vol.Required( CONF_MORE_STATES, default=CONF_YES if len(self.current_states) > 1 else CONF_NO, ): vol.In([CONF_YES, CONF_NO]), } ), description_placeholders={ "zone": f"Zone {self.active_cfg}" if len(self.active_cfg) < 3 else self.active_cfg.upper(), "state": str(self.current_state), }, errors=errors, ) # find the next unconfigured switch for key, value in self.io_cfg.items(): if value == CONF_IO_SWI: self.active_cfg = key self.current_states = [ cfg for cfg in self.current_opt.get(CONF_SWITCHES, []) if cfg[CONF_ZONE] == self.active_cfg ] current_cfg = next(iter(self.current_states), {}) self.current_state = 1 return self.async_show_form( step_id="options_switch", data_schema=vol.Schema( { vol.Optional( CONF_NAME, default=current_cfg.get(CONF_NAME, vol.UNDEFINED), ): str, vol.Optional( CONF_ACTIVATION, default=current_cfg.get(CONF_ACTIVATION, STATE_HIGH), ): vol.In(["low", "high"]), vol.Optional( CONF_MOMENTARY, default=current_cfg.get(CONF_MOMENTARY, vol.UNDEFINED), ): vol.All(vol.Coerce(int), vol.Range(min=10)), vol.Optional( CONF_PAUSE, default=current_cfg.get(CONF_PAUSE, vol.UNDEFINED), ): vol.All(vol.Coerce(int), vol.Range(min=10)), vol.Optional( CONF_REPEAT, default=current_cfg.get(CONF_REPEAT, vol.UNDEFINED), ): vol.All(vol.Coerce(int), vol.Range(min=-1)), vol.Required( CONF_MORE_STATES, default=CONF_YES if len(self.current_states) > 1 else CONF_NO, ): vol.In([CONF_YES, CONF_NO]), } ), description_placeholders={ "zone": f"Zone {self.active_cfg}" if len(self.active_cfg) < 3 else self.active_cfg.upper(), "state": str(self.current_state), }, errors=errors, ) return await self.async_step_options_misc() async def async_step_options_misc(self, user_input=None): """Allow the user to configure the LED behavior.""" errors = {} if user_input is not None: # config schema only does basic schema val so check url here try: if user_input[CONF_OVERRIDE_API_HOST]: cv.url(user_input.get(CONF_API_HOST, "")) else: user_input[CONF_API_HOST] = "" except vol.Invalid: errors["base"] = "bad_host" else: # no need to store the override - can infer del user_input[CONF_OVERRIDE_API_HOST] self.new_opt.update(user_input) return self.async_create_entry(title="", data=self.new_opt) return self.async_show_form( step_id="options_misc", data_schema=vol.Schema( { vol.Required( CONF_BLINK, default=self.current_opt.get(CONF_BLINK, True) ): bool, vol.Required( CONF_OVERRIDE_API_HOST, default=bool(self.current_opt.get(CONF_API_HOST)), ): bool, vol.Optional( CONF_API_HOST, default=self.current_opt.get(CONF_API_HOST, "") ): str, } ), errors=errors, )
{ "content_hash": "914c8bf95b1236ef972b1cbb82daa620", "timestamp": "", "source": "github", "line_count": 824, "max_line_length": 99, "avg_line_length": 40.19660194174757, "alnum_prop": 0.49118410723990097, "repo_name": "pschmitt/home-assistant", "id": "f545c5f2f2a26de7da10deddcda7288d831fa20a", "size": "33122", "binary": false, "copies": "4", "ref": "refs/heads/dev", "path": "homeassistant/components/konnected/config_flow.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Dockerfile", "bytes": "1522" }, { "name": "Python", "bytes": "24807200" }, { "name": "Shell", "bytes": "4342" } ], "symlink_target": "" }
from django.conf.urls import patterns, include, url from django.contrib import admin admin.autodiscover() urlpatterns = patterns('', # Examples: url(r'^$', 'demo.views.index', name='index'), url(r'^all_events/', 'demo.views.all_events', name='all_events'), url(r'^admin/', include(admin.site.urls)), )
{ "content_hash": "036c9d115bf2edf38ca5a79a622cdad2", "timestamp": "", "source": "github", "line_count": 11, "max_line_length": 69, "avg_line_length": 29.09090909090909, "alnum_prop": 0.66875, "repo_name": "rodrigoamaral/django-fullcalendar", "id": "512082b787daa3e4fcabf204381640c2e31b73e2", "size": "320", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "demo/demo/urls.py", "mode": "33188", "license": "mit", "language": [ { "name": "CSS", "bytes": "11815" }, { "name": "HTML", "bytes": "1672" }, { "name": "JavaScript", "bytes": "154287" }, { "name": "Python", "bytes": "14526" } ], "symlink_target": "" }
""" APE - a productive environment """ from __future__ import print_function # Tasks specified here are available globally. # # WARNING: importing ape.tasks at the module level leads to a cyclic import for # global tasks in this file, so import it inside the task function. # The effect is specific to this file - you may import ape.tasks directly # at the module level in tasks modules of features. # FEATURE_SELECTION = [] def help(task): '''print help on specific task''' from ape import tasks tasks.help(taskname=task) def explain_feature(featurename): '''print the location of single feature and its version if the feature is located inside a git repository, this will also print the git-rev and modified files ''' import os import featuremonkey import importlib import subprocess def guess_version(feature_module): if hasattr(feature_module, '__version__'): return feature_module.__version__ if hasattr(feature_module, 'get_version'): return feature_module.get_version() return ('unable to determine version:' ' please add __version__ or get_version()' ' to this feature module!') def git_rev(module): stdout, stderr = subprocess.Popen( ["git", "rev-parse", "HEAD"], cwd=os.path.dirname(module.__file__), stdout=subprocess.PIPE, stderr=subprocess.PIPE ).communicate() if 'Not a git repo' in stderr: return '-' else: return stdout.strip() def git_changes(module): stdout = subprocess.Popen( ["git", "diff", "--name-only"], cwd=os.path.dirname(module.__file__), stdout=subprocess.PIPE, stderr=subprocess.PIPE ).communicate()[0] return stdout.strip() or '-' if featurename in featuremonkey.get_features_from_equation_file(os.environ['PRODUCT_EQUATION_FILENAME']): print() print(featurename) print('-' * 60) print() is_subfeature = '.features.' in featurename try: feature_module = importlib.import_module(featurename) except ImportError: print('Error: unable to import feature "%s"' % featurename) print('Location: %s' % os.path.dirname(feature_module.__file__)) print() if is_subfeature: print('Version: see parent feature') print() else: print('Version: %s' % str(guess_version(feature_module))) print() print('git: %s' % git_rev(feature_module)) print() print('git changed: %s' % '\n\t\t'.join(git_changes(feature_module).split('\n'))) else: print('No feature named ' + featurename) def explain_features(): '''print the location of each feature and its version if the feature is located inside a git repository, this will also print the git-rev and modified files ''' from ape import tasks import featuremonkey import os featurenames = featuremonkey.get_features_from_equation_file(os.environ['PRODUCT_EQUATION_FILENAME']) for featurename in featurenames: tasks.explain_feature(featurename) def selftest(): '''run ape tests''' from ape import tests result = tests.run_all() if not result.wasSuccessful(): raise Exception('Selftests failed! :(')
{ "content_hash": "7bf78010dc1e3981c4889c34d91549b6", "timestamp": "", "source": "github", "line_count": 114, "max_line_length": 109, "avg_line_length": 30.394736842105264, "alnum_prop": 0.6138528138528139, "repo_name": "henzk/ape", "id": "42f84c378f4fbfdb40f27677294732afbf7a5afb", "size": "3465", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "ape/_tasks.py", "mode": "33188", "license": "mit", "language": [ { "name": "Python", "bytes": "75028" }, { "name": "Shell", "bytes": "268" } ], "symlink_target": "" }
"""Tests for prompt generation.""" import unittest import os from IPython.testing import tools as tt, decorators as dec from IPython.core.prompts import PromptManager, LazyEvaluate from IPython.testing.globalipapp import get_ipython from IPython.utils.tempdir import TemporaryDirectory from IPython.utils import py3compat from IPython.utils.py3compat import unicode_type ip = get_ipython() class PromptTests(unittest.TestCase): def setUp(self): self.pm = PromptManager(shell=ip, config=ip.config) def test_multiline_prompt(self): self.pm.in_template = "[In]\n>>>" self.pm.render('in') self.assertEqual(self.pm.width, 3) self.assertEqual(self.pm.txtwidth, 3) self.pm.in_template = '[In]\n' self.pm.render('in') self.assertEqual(self.pm.width, 0) self.assertEqual(self.pm.txtwidth, 0) def test_translate_abbreviations(self): def do_translate(template): self.pm.in_template = template return self.pm.templates['in'] pairs = [(r'%n>', '{color.number}{count}{color.prompt}>'), (r'\T', '{time}'), (r'\n', '\n') ] tt.check_pairs(do_translate, pairs) def test_user_ns(self): self.pm.color_scheme = 'NoColor' ip.ex("foo='bar'") self.pm.in_template = "In [{foo}]" prompt = self.pm.render('in') self.assertEqual(prompt, u'In [bar]') def test_builtins(self): self.pm.color_scheme = 'NoColor' self.pm.in_template = "In [{int}]" prompt = self.pm.render('in') self.assertEqual(prompt, u"In [%r]" % int) def test_undefined(self): self.pm.color_scheme = 'NoColor' self.pm.in_template = "In [{foo_dne}]" prompt = self.pm.render('in') self.assertEqual(prompt, u"In [<ERROR: 'foo_dne' not found>]") def test_render(self): self.pm.in_template = r'\#>' self.assertEqual(self.pm.render('in',color=False), '%d>' % ip.execution_count) @dec.onlyif_unicode_paths def test_render_unicode_cwd(self): save = py3compat.getcwd() with TemporaryDirectory(u'ünicødé') as td: os.chdir(td) self.pm.in_template = r'\w [\#]' p = self.pm.render('in', color=False) self.assertEqual(p, u"%s [%i]" % (py3compat.getcwd(), ip.execution_count)) os.chdir(save) def test_lazy_eval_unicode(self): u = u'ünicødé' lz = LazyEvaluate(lambda : u) # str(lz) would fail self.assertEqual(unicode_type(lz), u) self.assertEqual(format(lz), u) def test_lazy_eval_nonascii_bytes(self): u = u'ünicødé' b = u.encode('utf8') lz = LazyEvaluate(lambda : b) # unicode(lz) would fail self.assertEqual(str(lz), str(b)) self.assertEqual(format(lz), str(b)) def test_lazy_eval_float(self): f = 0.503 lz = LazyEvaluate(lambda : f) self.assertEqual(str(lz), str(f)) self.assertEqual(unicode_type(lz), unicode_type(f)) self.assertEqual(format(lz), str(f)) self.assertEqual(format(lz, '.1'), '0.5') @dec.skip_win32 def test_cwd_x(self): self.pm.in_template = r"\X0" save = py3compat.getcwd() os.chdir(os.path.expanduser('~')) p = self.pm.render('in', color=False) try: self.assertEqual(p, '~') finally: os.chdir(save)
{ "content_hash": "6760b7a8b2eb1da684ce67650b97b1b2", "timestamp": "", "source": "github", "line_count": 111, "max_line_length": 86, "avg_line_length": 32.027027027027025, "alnum_prop": 0.5727144866385373, "repo_name": "WillisXChen/django-oscar", "id": "7226af1209b16b041496ba57b42f67fed5bf8c05", "size": "3584", "binary": false, "copies": "7", "ref": "refs/heads/master", "path": "oscar/lib/python2.7/site-packages/IPython/core/tests/test_prompts.py", "mode": "33188", "license": "bsd-3-clause", "language": [ { "name": "Assembly", "bytes": "78" }, { "name": "C", "bytes": "5979" }, { "name": "C++", "bytes": "572" }, { "name": "CSS", "bytes": "694578" }, { "name": "CoffeeScript", "bytes": "21" }, { "name": "Groff", "bytes": "21346" }, { "name": "HTML", "bytes": "708061" }, { "name": "JavaScript", "bytes": "1433937" }, { "name": "Jupyter Notebook", "bytes": "189877" }, { "name": "Makefile", "bytes": "6656" }, { "name": "Python", "bytes": "47548581" }, { "name": "Shell", "bytes": "6790" }, { "name": "Smarty", "bytes": "21023" }, { "name": "TeX", "bytes": "56837" }, { "name": "XSLT", "bytes": "24882" } ], "symlink_target": "" }
import csv #! Comma-Separated Values - tabular data in plain text. import os #! Miscellaneous operating system interfaces. import sys #! System-specific parameters and functions. from time import sleep #! Sleep - for command-line animation. #! Function for printing slowly (animation) -- ex: print_slowly ('Hello World!') def print_slowly(text): for glyph in text: print glyph, sys.stdout.flush() #! I'm not sure if this is necesarry. sleep(0.05) #! Let the user know it's working, slowly. print '' print_slowly ('farmigotools\n\nft_farmigo_to_route4me.py') print '' print '' sleep(0.3) #! Make a new folder in the current directory for the outputed files. output_dir = 'CSVs_4_route4me' print '' print '' print 'Making a new folder called -- ' + output_dir sleep(0.3) try: os.makedirs(output_dir) except OSError: # Directory already exists, move on. pass #! Loop through every file in the current working directory for csv_input_filename in os.listdir('.'): if not csv_input_filename.endswith('.csv'): continue # skip non-csv files print '' print 'Processing -- ' + csv_input_filename + '...' print '' #! Print column headers csv_input_file = open(csv_input_filename) csv_output_file = open(os.path.join(output_dir, csv_input_filename), 'w') csv_reader = csv.reader(csv_input_file) csv_writer = csv.writer(csv_output_file) #! create variables from csv for row in csv_reader: bag_type = row[1] last_name = row[2] first_name = row[3] primary_phone = row[4] secondary_phone = row[5] address = row[7] city = row[8] state = row[9] zipcode = row[10] blank = None #! output reformated CSV output_row = [ bag_type, address + ' ' + city + ' ' + state + ' ' + zipcode, first_name + ' ' + last_name + ' | ' + primary_phone + ' | ' + secondary_phone, 'Run 1'] csv_writer.writerow(output_row) csv_output_file.close() #! Let the user know it's done print_slowly ('## DONE!') print ('') print ('')
{ "content_hash": "922e39984a4582c9581dde8bd884f5b5", "timestamp": "", "source": "github", "line_count": 72, "max_line_length": 80, "avg_line_length": 30.23611111111111, "alnum_prop": 0.6067983463481855, "repo_name": "eliheuer/FarmigoDataTools", "id": "8f8002dfb5bb00290639b16e747b2218f697e94d", "size": "2180", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "f_isolate_pm.py", "mode": "33188", "license": "mit", "language": [ { "name": "Python", "bytes": "9440" } ], "symlink_target": "" }
from __future__ import absolute_import from sentry.models import GroupStatus from sentry.testutils import TestCase from sentry.search.utils import parse_query class ParseQueryTest(TestCase): def test_simple(self): result = parse_query('foo bar', self.user) assert result == {'tags': {}, 'query': 'foo bar'} def test_useless_prefix(self): result = parse_query('foo: bar', self.user) assert result == {'tags': {}, 'query': 'foo: bar'} def test_mix_tag_and_query(self): result = parse_query('foo bar key:value', self.user) assert result == {'tags': {'key': 'value'}, 'query': 'foo bar'} def test_single_tag(self): result = parse_query('key:value', self.user) assert result == {'tags': {'key': 'value'}, 'query': ''} def test_tag_with_colon_in_value(self): result = parse_query('url:http://example.com', self.user) assert result == {'tags': {'url': 'http://example.com'}, 'query': ''} def test_multiple_tags(self): result = parse_query('foo:bar key:value', self.user) assert result == {'tags': {'key': 'value', 'foo': 'bar'}, 'query': ''} def test_single_tag_with_quotes(self): result = parse_query('foo:"bar"', self.user) assert result == {'tags': {'foo': 'bar'}, 'query': ''} def test_tag_with_quotes_and_query(self): result = parse_query('key:"a value" hello', self.user) assert result == {'tags': {'key': 'a value'}, 'query': 'hello'} def test_is_resolved(self): result = parse_query('is:resolved', self.user) assert result == {'status': GroupStatus.RESOLVED, 'tags': {}, 'query': ''} def test_assigned_me(self): result = parse_query('assigned:me', self.user) assert result == {'assigned_to': self.user, 'tags': {}, 'query': ''} def test_assigned_email(self): result = parse_query('assigned:%s' % (self.user.email,), self.user) assert result == {'assigned_to': self.user, 'tags': {}, 'query': ''} def test_assigned_unknown_user(self): result = parse_query('assigned:fake@example.com', self.user) assert result['assigned_to'].id == 0
{ "content_hash": "6fa35040890db6faefaa88bdd820b986", "timestamp": "", "source": "github", "line_count": 55, "max_line_length": 82, "avg_line_length": 39.763636363636365, "alnum_prop": 0.5925925925925926, "repo_name": "argonemyth/sentry", "id": "055cd2a9e9a0c0aae8b5abe70ebbdaf57031501e", "size": "2187", "binary": false, "copies": "4", "ref": "refs/heads/master", "path": "tests/sentry/search/test_utils.py", "mode": "33188", "license": "bsd-3-clause", "language": [ { "name": "CSS", "bytes": "583460" }, { "name": "HTML", "bytes": "316232" }, { "name": "JavaScript", "bytes": "608538" }, { "name": "Makefile", "bytes": "2715" }, { "name": "Python", "bytes": "5918211" } ], "symlink_target": "" }
from __future__ import absolute_import from __future__ import division from __future__ import print_function from __future__ import unicode_literals from caffe2.python import schema from caffe2.python.layers.layers import ( ModelLayer, ) from caffe2.python.layers.tags import ( Tags ) import numpy as np class BatchMSELoss(ModelLayer): def __init__(self, model, input_record, name='batch_mse_loss', **kwargs): super(BatchMSELoss, self).__init__(model, name, input_record, **kwargs) assert schema.is_schema_subset( schema.Struct( ('label', schema.Scalar()), ('prediction', schema.Scalar()) ), input_record ) self.tags.update([Tags.EXCLUDE_FROM_PREDICTION]) self.output_schema = schema.Scalar( np.float32, self.get_next_blob_reference('output')) def add_ops(self, net): prediction = net.Squeeze( self.input_record.prediction(), net.NextScopedBlob('squeezed_prediction'), dims=[1] ) label = self.input_record.label.field_blobs() if self.input_record.label.field_type().base != ( self.input_record.prediction.field_type().base): label = net.Cast( label, net.NextScopedBlob('cast_label'), to=schema.data_type_for_dtype( self.input_record.prediction.field_type() ) ) label = net.StopGradient( label, net.NextScopedBlob('stopped_label') ) l2dist = net.SquaredL2Distance( [label, prediction], net.NextScopedBlob('l2') ) net.AveragedLoss(l2dist, self.output_schema.field_blobs())
{ "content_hash": "d0fa0cd363f0b81e908d8c6b50daf120", "timestamp": "", "source": "github", "line_count": 63, "max_line_length": 79, "avg_line_length": 28.746031746031747, "alnum_prop": 0.5681943677526229, "repo_name": "pietern/caffe2", "id": "85b1802b5c5c9420683a96da68e38ae09e8edfb1", "size": "2554", "binary": false, "copies": "3", "ref": "refs/heads/master", "path": "caffe2/python/layers/batch_mse_loss.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Batchfile", "bytes": "5415" }, { "name": "C", "bytes": "316608" }, { "name": "C++", "bytes": "4743501" }, { "name": "CMake", "bytes": "139649" }, { "name": "CSS", "bytes": "2196" }, { "name": "Cuda", "bytes": "671183" }, { "name": "HTML", "bytes": "5203" }, { "name": "Makefile", "bytes": "1225" }, { "name": "Metal", "bytes": "36752" }, { "name": "Objective-C", "bytes": "6505" }, { "name": "Objective-C++", "bytes": "239139" }, { "name": "Python", "bytes": "2902249" }, { "name": "Shell", "bytes": "31734" } ], "symlink_target": "" }
"""Admin application.""" import importlib import pkgutil from flask_admin import Admin from flask_admin.base import AdminIndexView, MenuLink from flask.ext.admin.contrib.sqla import ModelView from flask_login import current_user from raven.contrib.flask import Sentry from pygotham import factory, filters __all__ = ('create_app',) class HomeView(AdminIndexView): """Only show the admin to authenticated admin users.""" def is_accessible(self): return current_user.has_role('admin') def create_app(settings_override=None): """Return the PyGotham admin application. :param settings_override: a ``dict`` of settings to override. """ app = factory.create_app(__name__, __path__, settings_override) Sentry(app) app.jinja_env.filters['rst'] = filters.rst_to_html # Because the admin is being wrapped inside an app, the url needs to # be overridden to use / instead of the default of /admin/. One of # the side effects of doing this is that the static assets won't # serve correctly without overriding static_url_path as well. admin = Admin( app, name='PyGotham', static_url_path='/admin', subdomain='<event_slug>', index_view=HomeView(endpoint='', url='/'), template_mode='bootstrap3', ) # Iterate through all the modules of the current package. For each # module, check the public API for any instances of types that can # be added to the Flask-Admin menu and register them. for _, name, _ in pkgutil.iter_modules(__path__): module = importlib.import_module('{}.{}'.format(__name__, name)) for attr in dir(module): view = getattr(module, attr) if isinstance(view, ModelView): admin.add_view(view) elif isinstance(view, MenuLink): admin.add_link(view) return app
{ "content_hash": "d06dd5743f03e004faff73d1da836f48", "timestamp": "", "source": "github", "line_count": 59, "max_line_length": 72, "avg_line_length": 31.88135593220339, "alnum_prop": 0.6608187134502924, "repo_name": "PyGotham/pygotham", "id": "7d218855d9b739bbb8f997829c79400842f03488", "size": "1881", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "pygotham/admin/__init__.py", "mode": "33188", "license": "bsd-3-clause", "language": [ { "name": "CSS", "bytes": "56204" }, { "name": "HTML", "bytes": "37411" }, { "name": "JavaScript", "bytes": "116" }, { "name": "Mako", "bytes": "412" }, { "name": "Python", "bytes": "113486" }, { "name": "Ruby", "bytes": "1526" }, { "name": "Shell", "bytes": "587" } ], "symlink_target": "" }
from ..Qt import QtGui, QtCore, QT_LIB import matplotlib if QT_LIB != 'PyQt5': if QT_LIB == 'PySide': matplotlib.rcParams['backend.qt4']='PySide' from matplotlib.backends.backend_qt4agg import FigureCanvasQTAgg as FigureCanvas try: from matplotlib.backends.backend_qt4agg import NavigationToolbar2QTAgg as NavigationToolbar except ImportError: from matplotlib.backends.backend_qt4agg import NavigationToolbar2QT as NavigationToolbar else: from matplotlib.backends.backend_qt5agg import FigureCanvasQTAgg as FigureCanvas from matplotlib.backends.backend_qt5agg import NavigationToolbar2QT as NavigationToolbar from matplotlib.figure import Figure class MatplotlibWidget(QtGui.QWidget): """ Implements a Matplotlib figure inside a QWidget. Use getFigure() and redraw() to interact with matplotlib. Example:: mw = MatplotlibWidget() subplot = mw.getFigure().add_subplot(111) subplot.plot(x,y) mw.draw() """ def __init__(self, size=(5.0, 4.0), dpi=100): QtGui.QWidget.__init__(self) self.fig = Figure(size, dpi=dpi) self.canvas = FigureCanvas(self.fig) self.canvas.setParent(self) self.toolbar = NavigationToolbar(self.canvas, self) self.vbox = QtGui.QVBoxLayout() self.vbox.addWidget(self.toolbar) self.vbox.addWidget(self.canvas) self.setLayout(self.vbox) def getFigure(self): return self.fig def draw(self): self.canvas.draw()
{ "content_hash": "dbb3137f577b1af2ad99435ee6acb9ff", "timestamp": "", "source": "github", "line_count": 49, "max_line_length": 99, "avg_line_length": 32.10204081632653, "alnum_prop": 0.6713286713286714, "repo_name": "meganbkratz/acq4", "id": "c5b6c980188d92cf52baec1c331caf9bcb699f94", "size": "1573", "binary": false, "copies": "4", "ref": "refs/heads/develop", "path": "acq4/pyqtgraph/widgets/MatplotlibWidget.py", "mode": "33188", "license": "mit", "language": [ { "name": "AMPL", "bytes": "3037" }, { "name": "Arduino", "bytes": "18651" }, { "name": "Batchfile", "bytes": "64" }, { "name": "C", "bytes": "705091" }, { "name": "C++", "bytes": "321384" }, { "name": "CSS", "bytes": "716" }, { "name": "MATLAB", "bytes": "1752" }, { "name": "Objective-C", "bytes": "596020" }, { "name": "Processing", "bytes": "13403" }, { "name": "Python", "bytes": "5922488" } ], "symlink_target": "" }
import roslib roslib.load_manifest('faa_image_processing') import sys import rospy import cv import cv2 import numpy import os import copy from sensor_msgs.msg import Image from cv_bridge import CvBridge, CvBridgeError from faa_utilities import FileTools from faa_actuation.msg import ActuationState from faa_image_processing import Tracker, Drawer, Parameters from faa_image_processing.srv import SaveImage, SaveImageResponse from faa_image_processing.srv import SetTracking, SetTrackingResponse from faa_image_processing.srv import GetParameters, GetParametersResponse from faa_image_processing.srv import SetParameter, SetParameterResponse from faa_image_processing.srv import SetArrayParameter, SetArrayParameterResponse from faa_image_processing.srv import SetStatus, SetStatusResponse from faa_image_processing.msg import TrackingData, TunnelData file_tools = FileTools() class ImageProcessor(object): def __init__(self): self.reusing_bg_images = rospy.get_param('/camera/faa_image_processing/reusing_bg_images') self.image_p_pub = rospy.Publisher("image_processed",Image) self.image_d_pub = rospy.Publisher("data_image",Image) self.tracking_data_pub = rospy.Publisher("tracking_data",TrackingData) self.bridge = CvBridge() self.image_sub = rospy.Subscriber("image_conditioned",Image,self.conditioned_image_callback) self.actuation_state_sub = rospy.Subscriber("/faa_actuation/actuation_state",ActuationState,self.actuation_state_callback) self.tracking = False self.drawing = False self.tracker = Tracker() self.drawer = Drawer() self.parameters = Parameters() self.tracker.setParameters(self.parameters) self.drawer.setParameters(self.parameters) self.display_images = False if self.display_images: # cv.NamedWindow("Image Processed", 1) # cv.NamedWindow("Image Tracked", 1) cv.NamedWindow("Image Data", 1) self.image_conditioned = None self.sbi = rospy.Service('/faa_image_processing/save_background_image', SaveImage, self.save_background_image_callback) self.st = rospy.Service('/faa_image_processing/set_tracking', SetTracking, self.set_tracking_callback) self.gp = rospy.Service('/faa_image_processing/get_parameters', GetParameters, self.get_parameters_callback) self.sp = rospy.Service('/faa_image_processing/set_parameter', SetParameter, self.set_parameter_callback) self.sap = rospy.Service('/faa_image_processing/set_array_parameter', SetArrayParameter, self.set_array_parameter_callback) self.ss = rospy.Service('/faa_image_processing/set_status', SetStatus, self.set_status_callback) def conditioned_image_callback(self,data): self.parameters.increment_image_count() self.tracker.setParameters(self.parameters) self.drawer.setParameters(self.parameters) try: image_cv = self.bridge.imgmsg_to_cv(data, "passthrough") except CvBridgeError, e: print e image_np = numpy.asarray(image_cv) self.image_conditioned = numpy.copy(image_np) if self.tracking: # data_tracked,image_tracked = self.tracker.processImage(image_np) data_tracked,data_image = self.tracker.processImage(image_np) tracking_data = TrackingData() tracking_data.header = data.header tracking_data.image_count = self.parameters.image_count # rospy.logwarn(str(data_tracked)) # try: # data_tracked_tunnels = data_tracked['tunnels'] # except KeyError: # data_tracked_tunnels = [] # if 0 < len(data_tracked_tunnels): # for tunnel in range(len(data_tracked_tunnels)): tunnel_data_list = [] tunnels = range(self.parameters.tunnel_count) for tunnel in tunnels: tunnel_data = TunnelData() enabled = self.parameters.tunnels_enabled[tunnel] tunnel_data.tunnel = tunnel tunnel_data.enabled = enabled tunnel_data.gate0 = "" tunnel_data.gate1 = "" tunnel_data.gate2 = "" tunnel_data.fly_x = 0 tunnel_data.fly_y = 0 tunnel_data.fly_angle = 0 tunnel_data.chamber = "" tunnel_data.blob_x = 0 tunnel_data.blob_y = 0 tunnel_data.blob_area = 0 tunnel_data.blob_slope = 0 tunnel_data.blob_ecc = 0 if enabled: try: tunnel_data.gate0 = data_tracked[tunnel]['gate0'] tunnel_data.gate1 = data_tracked[tunnel]['gate1'] tunnel_data.gate2 = data_tracked[tunnel]['gate2'] except KeyError: pass try: tunnel_data.fly_x = data_tracked[tunnel]['fly_x'] tunnel_data.fly_y = data_tracked[tunnel]['fly_y'] tunnel_data.fly_angle = data_tracked[tunnel]['fly_angle'] tunnel_data.chamber = data_tracked[tunnel]['chamber'] tunnel_data.blob_x = data_tracked[tunnel]['blob_x'] tunnel_data.blob_y = data_tracked[tunnel]['blob_y'] tunnel_data.blob_area = data_tracked[tunnel]['blob_area'] tunnel_data.blob_slope = data_tracked[tunnel]['blob_slope'] tunnel_data.blob_ecc = data_tracked[tunnel]['blob_ecc'] except KeyError: pass tunnel_data_list.append(tunnel_data) tracking_data.tunnel_data = tunnel_data_list self.tracking_data_pub.publish(tracking_data) data_image_cv = cv.fromarray(data_image) try: data_img = self.bridge.cv_to_imgmsg(data_image_cv, "bgr8") data_img.header = data.header self.image_d_pub.publish(data_img) except CvBridgeError, e: print e # image_tracked_cv = cv.fromarray(image_tracked) # if self.display_images: # cv.ShowImage("Image Tracked", image_tracked_cv) # cv.WaitKey(3) else: data_tracked = {} if self.drawing: image_processed = self.drawer.processImage(image_np,data_tracked) else: image_processed = cv2.cvtColor(image_np,cv2.COLOR_GRAY2RGB) image_cv = cv.fromarray(image_processed) # if self.display_images: # cv.ShowImage("Image Processed", image_cv) # cv.WaitKey(3) try: self.image_p_pub.publish(self.bridge.cv_to_imgmsg(image_cv, "bgr8")) except CvBridgeError, e: print e # image_trimmed = self.trim_image(image_np) # image_trimmed_cv = cv.fromarray(image_trimmed) # if self.display_images: # cv.ShowImage("Image Data", image_trimmed_cv) # cv.WaitKey(3) # try: # self.image_d_pub.publish(self.bridge.cv_to_imgmsg(image_trimmed_cv, "mono8")) # except CvBridgeError, e: # print e # def trim_image(self,image_o): # image_t = numpy.zeros((ty,tx*self.parameters.tunnel_count),image_o.dtype) # for tunnel in range(self.parameters.tunnel_count): # if self.parameters.tunnels_enabled[tunnel]: # x_offset_o = self.parameters.tunnel_x_offsets[tunnel] # x_offset_t = tunnel*tx # tx0_o = self.parameters.tunnel_mask['x0'] + x_offset_o # ty0_o = self.parameters.tunnel_mask['y0'] # tx1_o = self.parameters.tunnel_mask['x1'] + x_offset_o # ty1_o = self.parameters.tunnel_mask['y1'] # tx0_t = x_offset_t # ty0_t = 0 # tx1_t = self.parameters.tunnel_mask['x1'] + x_offset_t # ty1_t = self.parameters.tunnel_mask['y1'] # image_t[ty0_t:ty1_t,tx0_t:tx1_t] = image_o[ty0_o:ty1_o,tx0_o:tx1_o] # return image_t def save_background_image_callback(self,req): if self.image_conditioned is not None: self.drawing = True (path,filename) = os.path.split(req.image_path) if not self.reusing_bg_images: image_background = numpy.copy(self.image_conditioned) else: image_background = file_tools.read_image_file(filename) file_tools.write_image_file(req.image_path,image_background) # rospy.logwarn("save_background_image_callback: " + filename) if filename == 'bg_gates_opened.png': self.tracker.setBgImageGatesOpened(image_background) elif filename == 'bg_gates_closed.png': self.tracker.setBgImageGatesClosed(image_background) return SaveImageResponse("success") def set_tracking_callback(self,req): self.tracking = req.tracking self.parameters.reset_image_count() self.tracker.setParameters(self.parameters) self.drawer.setParameters(self.parameters) return SetTrackingResponse("success") def actuation_state_callback(self,req): self.tracker.setTunnelsState(req.tunnels_state) def get_parameters_callback(self,req): return GetParametersResponse(self.parameters.get_parameters_json()) def set_parameter_callback(self,req): self.parameters.set_parameter(req.name,req.value) self.tracker.setParameters(self.parameters) self.drawer.setParameters(self.parameters) return SetParameterResponse("success") def set_array_parameter_callback(self,req): self.parameters.set_array_parameter(req.name,req.array) self.tracker.setParameters(self.parameters) self.drawer.setParameters(self.parameters) return SetArrayParameterResponse("success") def set_status_callback(self,req): self.parameters.status = req.status self.tracker.setParameters(self.parameters) self.drawer.setParameters(self.parameters) return SetStatusResponse("success") def main(args): rospy.init_node('faa_image_processing', anonymous=True) ip = ImageProcessor() try: rospy.spin() except KeyboardInterrupt: print "Shutting down" if ip.display_images: cv.DestroyAllWindows() if __name__ == '__main__': main(sys.argv)
{ "content_hash": "4f4ec7830a8db37f44313b22aa66a765", "timestamp": "", "source": "github", "line_count": 248, "max_line_length": 127, "avg_line_length": 38.57258064516129, "alnum_prop": 0.681685134852603, "repo_name": "JaneliaSciComp/fly-alcohol-assay", "id": "923854e8f14afd06ec0b2e25537b372fb31fbea2", "size": "9588", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "faa_image_processing/nodes/image_processing.py", "mode": "33261", "license": "bsd-3-clause", "language": [ { "name": "Arduino", "bytes": "392" }, { "name": "C++", "bytes": "36131" }, { "name": "CMake", "bytes": "26184" }, { "name": "CSS", "bytes": "3706" }, { "name": "HTML", "bytes": "68111" }, { "name": "JavaScript", "bytes": "173781" }, { "name": "Makefile", "bytes": "908" }, { "name": "Python", "bytes": "444569" }, { "name": "Shell", "bytes": "214" } ], "symlink_target": "" }
""" Component to wake up devices sending Wake-On-LAN magic packets. For more details about this component, please refer to the documentation at https://home-assistant.io/components/wake_on_lan/ """ from functools import partial import logging import voluptuous as vol from homeassistant.const import CONF_MAC import homeassistant.helpers.config_validation as cv REQUIREMENTS = ['wakeonlan==1.1.6'] _LOGGER = logging.getLogger(__name__) DOMAIN = 'wake_on_lan' CONF_BROADCAST_ADDRESS = 'broadcast_address' SERVICE_SEND_MAGIC_PACKET = 'send_magic_packet' WAKE_ON_LAN_SEND_MAGIC_PACKET_SCHEMA = vol.Schema({ vol.Required(CONF_MAC): cv.string, vol.Optional(CONF_BROADCAST_ADDRESS): cv.string, }) async def async_setup(hass, config): """Set up the wake on LAN component.""" import wakeonlan async def send_magic_packet(call): """Send magic packet to wake up a device.""" mac_address = call.data.get(CONF_MAC) broadcast_address = call.data.get(CONF_BROADCAST_ADDRESS) _LOGGER.info("Send magic packet to mac %s (broadcast: %s)", mac_address, broadcast_address) if broadcast_address is not None: await hass.async_add_job( partial(wakeonlan.send_magic_packet, mac_address, ip_address=broadcast_address)) else: await hass.async_add_job( partial(wakeonlan.send_magic_packet, mac_address)) hass.services.async_register( DOMAIN, SERVICE_SEND_MAGIC_PACKET, send_magic_packet, schema=WAKE_ON_LAN_SEND_MAGIC_PACKET_SCHEMA) return True
{ "content_hash": "1e8947618d9ee4a1ef0a9f35a00ba139", "timestamp": "", "source": "github", "line_count": 53, "max_line_length": 75, "avg_line_length": 30.660377358490567, "alnum_prop": 0.6750769230769231, "repo_name": "PetePriority/home-assistant", "id": "dba99bf7e3d4e693f10cc6556e2592c1083515f0", "size": "1625", "binary": false, "copies": "2", "ref": "refs/heads/dev", "path": "homeassistant/components/wake_on_lan/__init__.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Batchfile", "bytes": "1175" }, { "name": "Dockerfile", "bytes": "1073" }, { "name": "Python", "bytes": "13985647" }, { "name": "Ruby", "bytes": "745" }, { "name": "Shell", "bytes": "17364" } ], "symlink_target": "" }
"""Interface Package Interfaces $Id: interfaces.py 67803 2006-05-01 15:20:47Z jim $ """ __docformat__ = 'restructuredtext' from zope.interface import Interface from zope.interface.interface import Attribute class IElement(Interface): """Objects that have basic documentation and tagged values. """ __name__ = Attribute('__name__', 'The object name') __doc__ = Attribute('__doc__', 'The object doc string') def getTaggedValue(tag): """Returns the value associated with `tag`. Raise a `KeyError` of the tag isn't set. """ def queryTaggedValue(tag, default=None): """Returns the value associated with `tag`. Return the default value of the tag isn't set. """ def getTaggedValueTags(): """Returns a list of all tags.""" def setTaggedValue(tag, value): """Associates `value` with `key`.""" class IAttribute(IElement): """Attribute descriptors""" interface = Attribute('interface', 'Stores the interface instance in which the ' 'attribute is located.') class IMethod(IAttribute): """Method attributes""" def getSignatureInfo(): """Returns the signature information. This method returns a dictionary with the following keys: o `positional` - All positional arguments. o `required` - A list of all required arguments. o `optional` - A list of all optional arguments. o `varargs` - The name of the varargs argument. o `kwargs` - The name of the kwargs argument. """ def getSignatureString(): """Return a signature string suitable for inclusion in documentation. This method returns the function signature string. For example, if you have `func(a, b, c=1, d='f')`, then the signature string is `(a, b, c=1, d='f')`. """ class ISpecification(Interface): """Object Behavioral specifications""" def extends(other, strict=True): """Test whether a specification extends another The specification extends other if it has other as a base interface or if one of it's bases extends other. If strict is false, then the specification extends itself. """ def isOrExtends(other): """Test whether the specification is or extends another """ def weakref(callback=None): """Return a weakref to the specification This method is, regrettably, needed to allow weakrefs to be computed to security-proxied specifications. While the zope.interface package does not require zope.security or zope.proxy, it has to be able to coexist with it. """ __bases__ = Attribute("""Base specifications A tuple if specifications from which this specification is directly derived. """) __sro__ = Attribute("""Specification-resolution order A tuple of the specification and all of it's ancestor specifications from most specific to least specific. (This is similar to the method-resolution order for new-style classes.) """) def get(name, default=None): """Look up the description for a name If the named attribute is not defined, the default is returned. """ class IInterface(ISpecification, IElement): """Interface objects Interface objects describe the behavior of an object by containing useful information about the object. This information includes: o Prose documentation about the object. In Python terms, this is called the "doc string" of the interface. In this element, you describe how the object works in prose language and any other useful information about the object. o Descriptions of attributes. Attribute descriptions include the name of the attribute and prose documentation describing the attributes usage. o Descriptions of methods. Method descriptions can include: - Prose "doc string" documentation about the method and its usage. - A description of the methods arguments; how many arguments are expected, optional arguments and their default values, the position or arguments in the signature, whether the method accepts arbitrary arguments and whether the method accepts arbitrary keyword arguments. o Optional tagged data. Interface objects (and their attributes and methods) can have optional, application specific tagged data associated with them. Examples uses for this are examples, security assertions, pre/post conditions, and other possible information you may want to associate with an Interface or its attributes. Not all of this information is mandatory. For example, you may only want the methods of your interface to have prose documentation and not describe the arguments of the method in exact detail. Interface objects are flexible and let you give or take any of these components. Interfaces are created with the Python class statement using either Interface.Interface or another interface, as in:: from zope.interface import Interface class IMyInterface(Interface): '''Interface documentation''' def meth(arg1, arg2): '''Documentation for meth''' # Note that there is no self argument class IMySubInterface(IMyInterface): '''Interface documentation''' def meth2(): '''Documentation for meth2''' You use interfaces in two ways: o You assert that your object implement the interfaces. There are several ways that you can assert that an object implements an interface: 1. Call zope.interface.implements in your class definition. 2. Call zope.interfaces.directlyProvides on your object. 3. Call 'zope.interface.classImplements' to assert that instances of a class implement an interface. For example:: from zope.interface import classImplements classImplements(some_class, some_interface) This approach is useful when it is not an option to modify the class source. Note that this doesn't affect what the class itself implements, but only what its instances implement. o You query interface meta-data. See the IInterface methods and attributes for details. """ def providedBy(object): """Test whether the interface is implemented by the object Return true of the object asserts that it implements the interface, including asserting that it implements an extended interface. """ def implementedBy(class_): """Test whether the interface is implemented by instances of the class Return true of the class asserts that its instances implement the interface, including asserting that they implement an extended interface. """ def names(all=False): """Get the interface attribute names Return a sequence of the names of the attributes, including methods, included in the interface definition. Normally, only directly defined attributes are included. If a true positional or keyword argument is given, then attributes defined by base classes will be included. """ def namesAndDescriptions(all=False): """Get the interface attribute names and descriptions Return a sequence of the names and descriptions of the attributes, including methods, as name-value pairs, included in the interface definition. Normally, only directly defined attributes are included. If a true positional or keyword argument is given, then attributes defined by base classes will be included. """ def __getitem__(name): """Get the description for a name If the named attribute is not defined, a KeyError is raised. """ def direct(name): """Get the description for the name if it was defined by the interface If the interface doesn't define the name, returns None. """ def validateInvariants(obj, errors=None): """Validate invariants Validate object to defined invariants. If errors is None, raises first Invalid error; if errors is a list, appends all errors to list, then raises Invalid with the errors as the first element of the "args" tuple.""" def __contains__(name): """Test whether the name is defined by the interface""" def __iter__(): """Return an iterator over the names defined by the interface The names iterated include all of the names defined by the interface directly and indirectly by base interfaces. """ __module__ = Attribute("""The name of the module defining the interface""") class IDeclaration(ISpecification): """Interface declaration Declarations are used to express the interfaces implemented by classes or provided by objects. """ def __contains__(interface): """Test whether an interface is in the specification Return true if the given interface is one of the interfaces in the specification and false otherwise. """ def __iter__(): """Return an iterator for the interfaces in the specification """ def flattened(): """Return an iterator of all included and extended interfaces An iterator is returned for all interfaces either included in or extended by interfaces included in the specifications without duplicates. The interfaces are in "interface resolution order". The interface resolution order is such that base interfaces are listed after interfaces that extend them and, otherwise, interfaces are included in the order that they were defined in the specification. """ def __sub__(interfaces): """Create an interface specification with some interfaces excluded The argument can be an interface or an interface specifications. The interface or interfaces given in a specification are subtracted from the interface specification. Removing an interface that is not in the specification does not raise an error. Doing so has no effect. Removing an interface also removes sub-interfaces of the interface. """ def __add__(interfaces): """Create an interface specification with some interfaces added The argument can be an interface or an interface specifications. The interface or interfaces given in a specification are added to the interface specification. Adding an interface that is already in the specification does not raise an error. Doing so has no effect. """ def __nonzero__(): """Return a true value of the interface specification is non-empty """ class IInterfaceDeclaration(Interface): """Declare and check the interfaces of objects The functions defined in this interface are used to declare the interfaces that objects provide and to query the interfaces that have been declared. Interfaces can be declared for objects in two ways: - Interfaces are declared for instances of the object's class - Interfaces are declared for the object directly. The interfaces declared for an object are, therefore, the union of interfaces declared for the object directly and the interfaces declared for instances of the object's class. Note that we say that a class implements the interfaces provided by it's instances. An instance can also provide interfaces directly. The interfaces provided by an object are the union of the interfaces provided directly and the interfaces implemented by the class. """ def providedBy(ob): """Return the interfaces provided by an object This is the union of the interfaces directly provided by an object and interfaces implemented by it's class. The value returned is an IDeclaration. """ def implementedBy(class_): """Return the interfaces implemented for a class' instances The value returned is an IDeclaration. """ def classImplements(class_, *interfaces): """Declare additional interfaces implemented for instances of a class The arguments after the class are one or more interfaces or interface specifications (IDeclaration objects). The interfaces given (including the interfaces in the specifications) are added to any interfaces previously declared. Consider the following example:: class C(A, B): ... classImplements(C, I1, I2) Instances of ``C`` provide ``I1``, ``I2``, and whatever interfaces instances of ``A`` and ``B`` provide. """ def implementer(*interfaces): """Create a decorator for declaring interfaces implemented by a facory A callable is returned that makes an implements declaration on objects passed to it. """ def classImplementsOnly(class_, *interfaces): """Declare the only interfaces implemented by instances of a class The arguments after the class are one or more interfaces or interface specifications (IDeclaration objects). The interfaces given (including the interfaces in the specifications) replace any previous declarations. Consider the following example:: class C(A, B): ... classImplements(C, IA, IB. IC) classImplementsOnly(C. I1, I2) Instances of ``C`` provide only ``I1``, ``I2``, and regardless of whatever interfaces instances of ``A`` and ``B`` implement. """ def directlyProvidedBy(object): """Return the interfaces directly provided by the given object The value returned is an IDeclaration. """ def directlyProvides(object, *interfaces): """Declare interfaces declared directly for an object The arguments after the object are one or more interfaces or interface specifications (IDeclaration objects). The interfaces given (including the interfaces in the specifications) replace interfaces previously declared for the object. Consider the following example:: class C(A, B): ... ob = C() directlyProvides(ob, I1, I2) The object, ``ob`` provides ``I1``, ``I2``, and whatever interfaces instances have been declared for instances of ``C``. To remove directly provided interfaces, use ``directlyProvidedBy`` and subtract the unwanted interfaces. For example:: directlyProvides(ob, directlyProvidedBy(ob)-I2) removes I2 from the interfaces directly provided by ``ob``. The object, ``ob`` no longer directly provides ``I2``, although it might still provide ``I2`` if it's class implements ``I2``. To add directly provided interfaces, use ``directlyProvidedBy`` and include additional interfaces. For example:: directlyProvides(ob, directlyProvidedBy(ob), I2) adds I2 to the interfaces directly provided by ob. """ def alsoProvides(object, *interfaces): """Declare additional interfaces directly for an object:: alsoProvides(ob, I1) is equivalent to:: directivelyProvides(ob, directlyProvidedBy(ob), I1) """ def noLongerProvides(object, interface): """Remove an interface from the list of an object's directly provided interfaces:: noLongerProvides(ob, I1) is equivalent to:: directlyProvides(ob, directlyProvidedBy(ob)-I1) with the exception that if ``I1`` is an interface that is provided by ``ob`` through the class's implementation, ValueError is raised. """ def implements(*interfaces): """Declare interfaces implemented by instances of a class This function is called in a class definition. The arguments are one or more interfaces or interface specifications (IDeclaration objects). The interfaces given (including the interfaces in the specifications) are added to any interfaces previously declared. Previous declarations include declarations for base classes unless implementsOnly was used. This function is provided for convenience. It provides a more convenient way to call classImplements. For example:: implements(I1) is equivalent to calling:: classImplements(C, I1) after the class has been created. Consider the following example:: class C(A, B): implements(I1, I2) Instances of ``C`` implement ``I1``, ``I2``, and whatever interfaces instances of ``A`` and ``B`` implement. """ def implementsOnly(*interfaces): """Declare the only interfaces implemented by instances of a class This function is called in a class definition. The arguments are one or more interfaces or interface specifications (IDeclaration objects). Previous declarations including declarations for base classes are overridden. This function is provided for convenience. It provides a more convenient way to call classImplementsOnly. For example:: implementsOnly(I1) is equivalent to calling:: classImplementsOnly(I1) after the class has been created. Consider the following example:: class C(A, B): implementsOnly(I1, I2) Instances of ``C`` implement ``I1``, ``I2``, regardless of what instances of ``A`` and ``B`` implement. """ def classProvides(*interfaces): """Declare interfaces provided directly by a class This function is called in a class definition. The arguments are one or more interfaces or interface specifications (IDeclaration objects). The given interfaces (including the interfaces in the specifications) are used to create the class's direct-object interface specification. An error will be raised if the module class has an direct interface specification. In other words, it is an error to call this function more than once in a class definition. Note that the given interfaces have nothing to do with the interfaces implemented by instances of the class. This function is provided for convenience. It provides a more convenient way to call directlyProvides for a class. For example:: classProvides(I1) is equivalent to calling:: directlyProvides(theclass, I1) after the class has been created. """ def moduleProvides(*interfaces): """Declare interfaces provided by a module This function is used in a module definition. The arguments are one or more interfaces or interface specifications (IDeclaration objects). The given interfaces (including the interfaces in the specifications) are used to create the module's direct-object interface specification. An error will be raised if the module already has an interface specification. In other words, it is an error to call this function more than once in a module definition. This function is provided for convenience. It provides a more convenient way to call directlyProvides for a module. For example:: moduleImplements(I1) is equivalent to:: directlyProvides(sys.modules[__name__], I1) """ def Declaration(*interfaces): """Create an interface specification The arguments are one or more interfaces or interface specifications (IDeclaration objects). A new interface specification (IDeclaration) with the given interfaces is returned. """ class IAdapterRegistry(Interface): """Provide an interface-based registry for adapters This registry registers objects that are in some sense "from" a sequence of specification to an interface and a name. No specific semantics are assumed for the registered objects, however, the most common application will be to register factories that adapt objects providing required specifications to a provided interface. """ def register(required, provided, name, value): """Register a value A value is registered for a *sequence* of required specifications, a provided interface, and a name. """ def registered(required, provided, name=u''): """Return the component registered for the given interfaces and name Unlike the lookup method, this methods won't retrieve components registered for more specific required interfaces or less specific provided interfaces. If no component was registered exactly for the given interfaces and name, then None is returned. """ def lookup(required, provided, name='', default=None): """Lookup a value A value is looked up based on a *sequence* of required specifications, a provided interface, and a name. """ def queryMultiAdapter(objects, provided, name=u'', default=None): """Adapt a sequence of objects to a named, provided, interface """ def lookup1(required, provided, name=u'', default=None): """Lookup a value using a single required interface A value is looked up based on a single required specifications, a provided interface, and a name. """ def queryAdapter(object, provided, name=u'', default=None): """Adapt an object using a registered adapter factory. """ def adapter_hook(provided, object, name=u'', default=None): """Adapt an object using a registered adapter factory. """ def lookupAll(required, provided): """Find all adapters from the required to the provided interfaces An iterable object is returned that provides name-value two-tuples. """ def names(required, provided): """Return the names for which there are registered objects """ def subscribe(required, provided, subscriber, name=u''): """Register a subscriber A subscriber is registered for a *sequence* of required specifications, a provided interface, and a name. Multiple subscribers may be registered for the same (or equivalent) interfaces. """ def subscriptions(required, provided, name=u''): """Get a sequence of subscribers Subscribers for a *sequence* of required interfaces, and a provided interface are returned. """ def subscribers(objects, provided, name=u''): """Get a sequence of subscription adapters """
{ "content_hash": "9e2ef0a64a1e83629c0de9b2122587cd", "timestamp": "", "source": "github", "line_count": 717, "max_line_length": 79, "avg_line_length": 32.62900976290098, "alnum_prop": 0.6626202179952981, "repo_name": "GetSomeBlocks/ServerStatus", "id": "6deac8cb60dc7c95bd9e0a46844612f32a42394b", "size": "24032", "binary": false, "copies": "19", "ref": "refs/heads/master", "path": "resources/lib/zope.interface/zope/interface/interfaces.py", "mode": "33188", "license": "mit", "language": [ { "name": "Batchfile", "bytes": "930" }, { "name": "C", "bytes": "293000" }, { "name": "C#", "bytes": "9664" }, { "name": "CSS", "bytes": "24716" }, { "name": "D", "bytes": "542" }, { "name": "HTML", "bytes": "374176" }, { "name": "Java", "bytes": "206" }, { "name": "Objective-C", "bytes": "9421" }, { "name": "Python", "bytes": "8744725" }, { "name": "Ruby", "bytes": "6773" }, { "name": "Shell", "bytes": "13600" } ], "symlink_target": "" }
import imp import os import sys import shutil import six from migrate import exceptions from migrate.versioning import version, repository from migrate.versioning.script import * from migrate.versioning.util import * from migrate.tests import fixture from migrate.tests.fixture.models import tmp_sql_table class TestBaseScript(fixture.Pathed): def test_all(self): """Testing all basic BaseScript operations""" # verify / source / run src = self.tmp() open(src, 'w').close() bscript = BaseScript(src) BaseScript.verify(src) self.assertEqual(bscript.source(), '') self.assertRaises(NotImplementedError, bscript.run, 'foobar') class TestPyScript(fixture.Pathed, fixture.DB): cls = PythonScript def test_create(self): """We can create a migration script""" path = self.tmp_py() # Creating a file that doesn't exist should succeed self.cls.create(path) self.assertTrue(os.path.exists(path)) # Created file should be a valid script (If not, raises an error) self.cls.verify(path) # Can't create it again: it already exists self.assertRaises(exceptions.PathFoundError,self.cls.create,path) @fixture.usedb(supported='sqlite') def test_run(self): script_path = self.tmp_py() pyscript = PythonScript.create(script_path) pyscript.run(self.engine, 1) pyscript.run(self.engine, -1) self.assertRaises(exceptions.ScriptError, pyscript.run, self.engine, 0) self.assertRaises(exceptions.ScriptError, pyscript._func, 'foobar') # clean pyc file if six.PY3: os.remove(imp.cache_from_source(script_path)) else: os.remove(script_path + 'c') # test deprecated upgrade/downgrade with no arguments contents = open(script_path, 'r').read() f = open(script_path, 'w') f.write(contents.replace("upgrade(migrate_engine)", "upgrade()")) f.close() pyscript = PythonScript(script_path) pyscript._module = None try: pyscript.run(self.engine, 1) pyscript.run(self.engine, -1) except exceptions.ScriptError: pass else: self.fail() def test_verify_notfound(self): """Correctly verify a python migration script: nonexistant file""" path = self.tmp_py() self.assertFalse(os.path.exists(path)) # Fails on empty path self.assertRaises(exceptions.InvalidScriptError,self.cls.verify,path) self.assertRaises(exceptions.InvalidScriptError,self.cls,path) def test_verify_invalidpy(self): """Correctly verify a python migration script: invalid python file""" path=self.tmp_py() # Create empty file f = open(path,'w') f.write("def fail") f.close() self.assertRaises(Exception,self.cls.verify_module,path) # script isn't verified on creation, but on module reference py = self.cls(path) self.assertRaises(Exception,(lambda x: x.module),py) def test_verify_nofuncs(self): """Correctly verify a python migration script: valid python file; no upgrade func""" path = self.tmp_py() # Create empty file f = open(path, 'w') f.write("def zergling():\n\tprint('rush')") f.close() self.assertRaises(exceptions.InvalidScriptError, self.cls.verify_module, path) # script isn't verified on creation, but on module reference py = self.cls(path) self.assertRaises(exceptions.InvalidScriptError,(lambda x: x.module),py) @fixture.usedb(supported='sqlite') def test_preview_sql(self): """Preview SQL abstract from ORM layer (sqlite)""" path = self.tmp_py() f = open(path, 'w') content = ''' from migrate import * from sqlalchemy import * metadata = MetaData() UserGroup = Table('Link', metadata, Column('link1ID', Integer), Column('link2ID', Integer), UniqueConstraint('link1ID', 'link2ID')) def upgrade(migrate_engine): metadata.create_all(migrate_engine) ''' f.write(content) f.close() pyscript = self.cls(path) SQL = pyscript.preview_sql(self.url, 1) self.assertEqualIgnoreWhitespace(""" CREATE TABLE "Link" ("link1ID" INTEGER, "link2ID" INTEGER, UNIQUE ("link1ID", "link2ID")) """, SQL) # TODO: test: No SQL should be executed! def test_verify_success(self): """Correctly verify a python migration script: success""" path = self.tmp_py() # Succeeds after creating self.cls.create(path) self.cls.verify(path) # test for PythonScript.make_update_script_for_model @fixture.usedb() def test_make_update_script_for_model(self): """Construct script source from differences of two models""" self.setup_model_params() self.write_file(self.first_model_path, self.base_source) self.write_file(self.second_model_path, self.base_source + self.model_source) source_script = self.pyscript.make_update_script_for_model( engine=self.engine, oldmodel=load_model('testmodel_first:meta'), model=load_model('testmodel_second:meta'), repository=self.repo_path, ) self.assertTrue("['User'].create()" in source_script) self.assertTrue("['User'].drop()" in source_script) @fixture.usedb() def test_make_update_script_for_equal_models(self): """Try to make update script from two identical models""" self.setup_model_params() self.write_file(self.first_model_path, self.base_source + self.model_source) self.write_file(self.second_model_path, self.base_source + self.model_source) source_script = self.pyscript.make_update_script_for_model( engine=self.engine, oldmodel=load_model('testmodel_first:meta'), model=load_model('testmodel_second:meta'), repository=self.repo_path, ) self.assertFalse('User.create()' in source_script) self.assertFalse('User.drop()' in source_script) @fixture.usedb() def test_make_update_script_direction(self): """Check update scripts go in the right direction""" self.setup_model_params() self.write_file(self.first_model_path, self.base_source) self.write_file(self.second_model_path, self.base_source + self.model_source) source_script = self.pyscript.make_update_script_for_model( engine=self.engine, oldmodel=load_model('testmodel_first:meta'), model=load_model('testmodel_second:meta'), repository=self.repo_path, ) self.assertTrue(0 < source_script.find('upgrade') < source_script.find("['User'].create()") < source_script.find('downgrade') < source_script.find("['User'].drop()")) def setup_model_params(self): self.script_path = self.tmp_py() self.repo_path = self.tmp() self.first_model_path = os.path.join(self.temp_usable_dir, 'testmodel_first.py') self.second_model_path = os.path.join(self.temp_usable_dir, 'testmodel_second.py') self.base_source = """from sqlalchemy import *\nmeta = MetaData()\n""" self.model_source = """ User = Table('User', meta, Column('id', Integer, primary_key=True), Column('login', Unicode(40)), Column('passwd', String(40)), )""" self.repo = repository.Repository.create(self.repo_path, 'repo') self.pyscript = PythonScript.create(self.script_path) sys.modules.pop('testmodel_first', None) sys.modules.pop('testmodel_second', None) def write_file(self, path, contents): f = open(path, 'w') f.write(contents) f.close() class TestSqlScript(fixture.Pathed, fixture.DB): @fixture.usedb() def test_error(self): """Test if exception is raised on wrong script source""" src = self.tmp() f = open(src, 'w') f.write("""foobar""") f.close() sqls = SqlScript(src) self.assertRaises(Exception, sqls.run, self.engine) @fixture.usedb() def test_success(self): """Test sucessful SQL execution""" # cleanup and prepare python script tmp_sql_table.metadata.drop_all(self.engine, checkfirst=True) script_path = self.tmp_py() pyscript = PythonScript.create(script_path) # populate python script contents = open(script_path, 'r').read() contents = contents.replace("pass", "tmp_sql_table.create(migrate_engine)") contents = 'from migrate.tests.fixture.models import tmp_sql_table\n' + contents f = open(script_path, 'w') f.write(contents) f.close() # write SQL script from python script preview pyscript = PythonScript(script_path) src = self.tmp() f = open(src, 'w') f.write(pyscript.preview_sql(self.url, 1)) f.close() # run the change sqls = SqlScript(src) sqls.run(self.engine) tmp_sql_table.metadata.drop_all(self.engine, checkfirst=True) @fixture.usedb() def test_transaction_management_statements(self): """ Test that we can successfully execute SQL scripts with transaction management statements. """ for script_pattern in ( "BEGIN TRANSACTION; %s; COMMIT;", "BEGIN; %s; END TRANSACTION;", ): test_statement = ("CREATE TABLE TEST1 (field1 int); " "DROP TABLE TEST1") script = script_pattern % test_statement src = self.tmp() with open(src, 'wt') as f: f.write(script) sqls = SqlScript(src) sqls.run(self.engine)
{ "content_hash": "93af135241f6e0920ede3777973122b5", "timestamp": "", "source": "github", "line_count": 292, "max_line_length": 92, "avg_line_length": 34.43150684931507, "alnum_prop": 0.611597374179431, "repo_name": "watspidererik/testenv", "id": "954bc0d881050a87fbe93fdd6ae4fb5fe22b9c6a", "size": "10101", "binary": false, "copies": "4", "ref": "refs/heads/master", "path": "flask/lib/python2.7/site-packages/migrate/tests/versioning/test_script.py", "mode": "33188", "license": "mit", "language": [ { "name": "C", "bytes": "6349" }, { "name": "CSS", "bytes": "11367" }, { "name": "JavaScript", "bytes": "22141" }, { "name": "Python", "bytes": "10555714" }, { "name": "Shell", "bytes": "3745" } ], "symlink_target": "" }
""" concerts/management/commands/make_matches.py Uses the Artist.re_string to search for the artist in the concert lineup (Concert.billing). If a match is found, saves a ConcertMatch object for lookup later. """ import re import logging from django.core.management.base import BaseCommand, CommandError from concerts.models import Artist, Concert, ConcertMatch, Venue logger = logging.getLogger('concerts.data_management') class Command(BaseCommand): help = 'Looks for tracked artists in the concert billings and saves matches' def handle(self, *args, **options): artist_pairs = list(Artist.objects.filter(is_active=True).values_list('id', 're_string')) concert_pairs = list(Concert.objects.filter(is_active=True).values_list('id', 'billing')) match_count = 0 for artist_id, regex_string in artist_pairs: artist_regex = re.compile( r'{}'.format(regex_string), flags=re.IGNORECASE|re.MULTILINE|re.DOTALL, ) for concert_id, concert_billing in concert_pairs: if artist_regex.search(concert_billing): concert_matched = Concert.objects.get(id=concert_id) artist_matched = Artist.objects.get(id=artist_id) logger.info( "Matched artist {} and concert {}".format( artist_matched, concert_matched ) ) # check for existing concertmatch # TODO but hacky? --review models-- match, created = ConcertMatch.objects.get_or_create( concert=concert_matched ) concert_matched.artists.add(artist_matched) concert_matched.save() match.artists.add(artist_matched) match.save() match_count += 1 logger.info("Saved {} matches".format(match_count)) # on first match, create entry in ConcertMatch, add artist to Concert.artists # subsequent matches add artist to ConcertMatch.artists, Concert.artists
{ "content_hash": "ac21bcbfedb785f26581432ca782cc75", "timestamp": "", "source": "github", "line_count": 58, "max_line_length": 97, "avg_line_length": 37.62068965517241, "alnum_prop": 0.5962419798350137, "repo_name": "jravesloot/sift_app", "id": "9c0d594dd09f1ecf18142dba396a8e69a1f33b84", "size": "2182", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "sift/concerts/management/commands/make_matches.py", "mode": "33188", "license": "mit", "language": [ { "name": "HTML", "bytes": "10007" }, { "name": "Python", "bytes": "82597" } ], "symlink_target": "" }
"""Tracing Protocol for tf.function. TODO(b/202447704): Briefly describe the tracing, retracing, and how trace types control it. """ from tensorflow.core.function.trace_type.signature_builder import make_function_signature from tensorflow.core.function.trace_type.signature_builder import SignatureContext from tensorflow.core.function.trace_type.signature_builder import WeakrefDeletionObserver
{ "content_hash": "137379a2103d6d891fa43f584dce466f", "timestamp": "", "source": "github", "line_count": 11, "max_line_length": 89, "avg_line_length": 36.36363636363637, "alnum_prop": 0.83, "repo_name": "Intel-Corporation/tensorflow", "id": "1e354166515627b8b69d0a759e2bc4a310b4d49b", "size": "1089", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "tensorflow/core/function/trace_type/__init__.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Batchfile", "bytes": "7481" }, { "name": "C", "bytes": "183416" }, { "name": "C++", "bytes": "24549804" }, { "name": "CMake", "bytes": "160888" }, { "name": "Go", "bytes": "849081" }, { "name": "HTML", "bytes": "681293" }, { "name": "Java", "bytes": "307123" }, { "name": "Jupyter Notebook", "bytes": "1833659" }, { "name": "LLVM", "bytes": "6536" }, { "name": "Makefile", "bytes": "37393" }, { "name": "Objective-C", "bytes": "7037" }, { "name": "Objective-C++", "bytes": "64142" }, { "name": "Protocol Buffer", "bytes": "218430" }, { "name": "Python", "bytes": "21875003" }, { "name": "Shell", "bytes": "337846" }, { "name": "TypeScript", "bytes": "849555" } ], "symlink_target": "" }
from flask.ext.wtf import Form from wtforms import StringField, BooleanField, PasswordField, TextAreaField from wtforms.validators import DataRequired, Length, Email, ValidationError from app.models import User, Post, Page from app import bcrypt from unidecode import unidecode from sqlalchemy import func import re class LoginForm(Form): username = StringField('Username', validators=[DataRequired()]) password = PasswordField('Password', validators=[DataRequired(), Length(min=8)]) remember_me = BooleanField('Remember Me', default=False) def validate_username(self, field): user = User.query.filter(func.lower(User.username) == self.username.data.lower()).first() if user is None: raise ValidationError('User does not exist') def validate_password(self, field): user = User.query.filter(func.lower(User.username) == self.username.data.lower()).first() if user: if not bcrypt.check_password_hash(user.password, self.password.data): raise ValidationError('Password is incorrect') class RegisterForm(Form): first_name = StringField('First Name', validators=[DataRequired()]) last_name = StringField('Last Name', validators=[DataRequired()]) username = StringField('Username', validators=[DataRequired()]) email = StringField('Email Address', validators=[DataRequired(), Email()]) password = PasswordField('Password', validators=[DataRequired()]) def validate_username(self, field): if User.query.filter(func.lower(User.username) == self.username.data.lower()).count() > 0: raise ValidationError('Username already exists.') def validate_email(self, field): if User.query.filter(func.lower(User.email) == self.email.data.lower()).count() > 0: raise ValidationError('Email already in use.') class PostForm(Form): title = StringField('Title', validators=[DataRequired("Please enter a title!")]) post_short = TextAreaField('Short Post') post_body = TextAreaField('Post Body', validators=[DataRequired("Please enter a post body!")]) tags = StringField('Tags', validators=[DataRequired("Please enter post tags!")]) def generate_slug(self, title): title_slug = re.sub(r'\W+', '-', unidecode(title).lower().rstrip(r' .?!(),[]{}')) if Post.query.filter_by(title_slug=title_slug).count() > 0: raise ValidationError('Title is already taken') return title_slug class EditUser(Form): first_name = StringField('First Name', validators=[DataRequired("First name is required!")]) last_name = StringField('Last Name', validators=[DataRequired("Last name is required!")]) username = StringField('Username', validators=[DataRequired("Username is required!")]) email = StringField('Email Address', validators=[DataRequired("Email is required!"), Email()]) about_me = TextAreaField('About Me', validators=[Length(max=200, message="About me must be less than 200 characters!")]) def __init__(self, orig_user, orig_email, *args, **kwargs): Form.__init__(self, *args, **kwargs) self.orig_user = orig_user self.orig_email = orig_email def validate_username(self, field): if self.orig_user and self.username.data.lower() == self.orig_user.lower(): return True if User.query.filter(func.lower(User.username) == self.username.data.lower()).count() > 0: raise ValidationError('Username is taken.') def validate_email(self, field): if self.orig_email and self.email.data.lower() == self.orig_email.lower(): return True if User.query.filter(func.lower(User.email) == self.email.data.lower()).count() > 0: raise ValidationError('Email already exists.') class PageForm(Form): title = StringField('Page Title', validators=[DataRequired("Page must have a title")]) content = TextAreaField('Page Content', validators=[DataRequired("Page must have content")]) def generate_slug(self, title): title_slug = re.sub(r'\W+', '-', unidecode(title).lower().rstrip(r' .?!(),[]{}')) if Page.query.filter_by(title_slug=title_slug).count() > 0: raise ValidationError('Title is already taken') return title_slug
{ "content_hash": "789b631393c62b2045fda8cb778dee52", "timestamp": "", "source": "github", "line_count": 110, "max_line_length": 112, "avg_line_length": 44.18181818181818, "alnum_prop": 0.5940329218106996, "repo_name": "jaymickey/jmickey-blog", "id": "9deba68cf1e6a0026834d83ed312c347f34be8a4", "size": "4860", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "app/forms.py", "mode": "33188", "license": "mit", "language": [ { "name": "CSS", "bytes": "3841" }, { "name": "HTML", "bytes": "26955" }, { "name": "JavaScript", "bytes": "484" }, { "name": "Python", "bytes": "17415" } ], "symlink_target": "" }
""" This file is part of the TheLMA (THe Laboratory Management Application) project. See LICENSE.txt for licensing, CONTRIBUTORS.txt for contributor information. Species mapper. """ from sqlalchemy.orm import relationship from everest.repositories.rdb.utils import as_slug_expression from everest.repositories.rdb.utils import mapper from thelma.entities.gene import Gene from thelma.entities.species import Species __docformat__ = 'reStructuredText en' __all__ = ['create_mapper'] def create_mapper(species_tbl): "Mapper factory." m = mapper(Species, species_tbl, id_attribute='species_id', slug_expression=lambda cls: as_slug_expression(cls.common_name), properties=dict( genes=relationship(Gene, back_populates='species'), ), ) return m
{ "content_hash": "d250e0f005af3c25ead1f27f777fb5c5", "timestamp": "", "source": "github", "line_count": 29, "max_line_length": 80, "avg_line_length": 31.24137931034483, "alnum_prop": 0.6434878587196468, "repo_name": "helixyte/TheLMA", "id": "ee5f901ee342e6d933c9d2ec0a8fa27889013b44", "size": "906", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "thelma/repositories/rdb/mappers/species.py", "mode": "33188", "license": "mit", "language": [ { "name": "Makefile", "bytes": "3126" }, { "name": "Python", "bytes": "3329729" }, { "name": "Shell", "bytes": "3071" } ], "symlink_target": "" }
from __future__ import annotations from poetry.core.constraints.version import constraint_regions __all__ = ["constraint_regions"]
{ "content_hash": "dac694a94df34f90142a01c1f4696a80", "timestamp": "", "source": "github", "line_count": 6, "max_line_length": 62, "avg_line_length": 22.333333333333332, "alnum_prop": 0.7611940298507462, "repo_name": "python-poetry/poetry-core", "id": "eabcc06b08b4735b921c04e1795f584964f7b5b1", "size": "134", "binary": false, "copies": "1", "ref": "refs/heads/main", "path": "src/poetry/core/semver/util.py", "mode": "33188", "license": "mit", "language": [ { "name": "C", "bytes": "2664" }, { "name": "Makefile", "bytes": "1021" }, { "name": "Python", "bytes": "2084191" }, { "name": "Shell", "bytes": "120" } ], "symlink_target": "" }
import sys, os import mysql.connector """ Example using MySQL Connector/Python showing: * sending multiple statements and iterating over the results """ def main(config): output = [] db = mysql.connector.Connect(**config) cursor = db.cursor() # Drop table if exists, and create it new stmt_drop = "DROP TABLE IF EXISTS names" cursor.execute(stmt_drop) stmt_create = """ CREATE TABLE names ( id TINYINT UNSIGNED NOT NULL AUTO_INCREMENT, name VARCHAR(30) DEFAULT '' NOT NULL, info TEXT DEFAULT '', age TINYINT UNSIGNED DEFAULT '30', PRIMARY KEY (id) )""" cursor.execute(stmt_create) info = "abc"*10000 stmts = [ "INSERT INTO names (name) VALUES ('Geert')", "SELECT COUNT(*) AS cnt FROM names", "INSERT INTO names (name) VALUES ('Jan'),('Michel')", "SELECT name FROM names", ] # Note 'multi=True' when calling cursor.execute() for result in cursor.execute(' ; '.join(stmts), multi=True): if result.with_rows: if result.statement == stmts[3]: output.append("Names in table: " + ' '.join([ name[0] for name in result])) else: output.append( "Number of rows: {}".format(result.fetchone()[0])) else: output.append("Inserted {} row{}".format(result.rowcount, 's' if result.rowcount > 1 else '')) cursor.execute(stmt_drop) cursor.close() db.close() return output if __name__ == '__main__': # # Configure MySQL login and database to use in config.py # from config import Config config = Config.dbinfo().copy() out = main(config) print('\n'.join(out))
{ "content_hash": "be9512200c66da8f2ba5e1b87bdf5c46", "timestamp": "", "source": "github", "line_count": 66, "max_line_length": 70, "avg_line_length": 27.348484848484848, "alnum_prop": 0.5634349030470914, "repo_name": "rcosnita/fantastico", "id": "82e3c2776bac2847801abb289d8f00f65da6cea4", "size": "2982", "binary": false, "copies": "3", "ref": "refs/heads/master", "path": "virtual_env/libs/mysql-connector/python3/examples/multi_resultsets.py", "mode": "33188", "license": "mit", "language": [ { "name": "Makefile", "bytes": "6802" }, { "name": "Python", "bytes": "2168052" }, { "name": "Shell", "bytes": "13309" } ], "symlink_target": "" }
"""Testing.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function # pylint: disable=g-bad-import-order from tensorflow.python.framework import test_util as _test_util from tensorflow.python.platform import googletest as _googletest # pylint: disable=unused-import from tensorflow.python.framework.test_util import assert_equal_graph_def from tensorflow.python.framework.test_util import create_local_cluster from tensorflow.python.framework.test_util import TensorFlowTestCase as TestCase from tensorflow.python.framework.test_util import gpu_device_name from tensorflow.python.framework.test_util import is_gpu_available from tensorflow.python.ops.gradient_checker import compute_gradient_error from tensorflow.python.ops.gradient_checker import compute_gradient # pylint: enable=unused-import,g-bad-import-order import functools import sys from tensorflow.python.util.tf_export import tf_export if sys.version_info.major == 2: import mock # pylint: disable=g-import-not-at-top,unused-import else: from unittest import mock # pylint: disable=g-import-not-at-top,g-importing-member tf_export(v1=['test.mock'])(mock) # Import Benchmark class Benchmark = _googletest.Benchmark # pylint: disable=invalid-name # Import StubOutForTesting class StubOutForTesting = _googletest.StubOutForTesting # pylint: disable=invalid-name @tf_export('test.main') def main(argv=None): """Runs all unit tests.""" _test_util.InstallStackTraceHandler() return _googletest.main(argv) @tf_export(v1=['test.get_temp_dir']) def get_temp_dir(): """Returns a temporary directory for use during tests. There is no need to delete the directory after the test. Returns: The temporary directory. """ return _googletest.GetTempDir() @tf_export(v1=['test.test_src_dir_path']) def test_src_dir_path(relative_path): """Creates an absolute test srcdir path given a relative path. Args: relative_path: a path relative to tensorflow root. e.g. "core/platform". Returns: An absolute path to the linked in runfiles. """ return _googletest.test_src_dir_path(relative_path) @tf_export('test.is_built_with_cuda') def is_built_with_cuda(): """Returns whether TensorFlow was built with CUDA (GPU) support. This method should only be used in tests written with `tf.test.TestCase`. A typical usage is to skip tests that should only run with CUDA (GPU). >>> class MyTest(tf.test.TestCase): ... ... def test_add_on_gpu(self): ... if not tf.test.is_built_with_cuda(): ... self.skipTest("test is only applicable on GPU") ... ... with tf.device("GPU:0"): ... self.assertEqual(tf.math.add(1.0, 2.0), 3.0) TensorFlow official binary is built with CUDA. """ return _test_util.IsGoogleCudaEnabled() @tf_export('test.is_built_with_rocm') def is_built_with_rocm(): """Returns whether TensorFlow was built with ROCm (GPU) support. This method should only be used in tests written with `tf.test.TestCase`. A typical usage is to skip tests that should only run with ROCm (GPU). >>> class MyTest(tf.test.TestCase): ... ... def test_add_on_gpu(self): ... if not tf.test.is_built_with_rocm(): ... self.skipTest("test is only applicable on GPU") ... ... with tf.device("GPU:0"): ... self.assertEqual(tf.math.add(1.0, 2.0), 3.0) TensorFlow official binary is NOT built with ROCm. """ return _test_util.IsBuiltWithROCm() @tf_export('test.disable_with_predicate') def disable_with_predicate(pred, skip_message): """Disables the test if pred is true.""" def decorator_disable_with_predicate(func): @functools.wraps(func) def wrapper_disable_with_predicate(self, *args, **kwargs): if pred(): self.skipTest(skip_message) else: return func(self, *args, **kwargs) return wrapper_disable_with_predicate return decorator_disable_with_predicate @tf_export('test.is_built_with_gpu_support') def is_built_with_gpu_support(): """Returns whether TensorFlow was built with GPU (CUDA or ROCm) support. This method should only be used in tests written with `tf.test.TestCase`. A typical usage is to skip tests that should only run with GPU. >>> class MyTest(tf.test.TestCase): ... ... def test_add_on_gpu(self): ... if not tf.test.is_built_with_gpu_support(): ... self.skipTest("test is only applicable on GPU") ... ... with tf.device("GPU:0"): ... self.assertEqual(tf.math.add(1.0, 2.0), 3.0) TensorFlow official binary is built with CUDA GPU support. """ return is_built_with_cuda() or is_built_with_rocm() @tf_export('test.is_built_with_xla') def is_built_with_xla(): """Returns whether TensorFlow was built with XLA support. This method should only be used in tests written with `tf.test.TestCase`. A typical usage is to skip tests that should only run with XLA. >>> class MyTest(tf.test.TestCase): ... ... def test_add_on_xla(self): ... if not tf.test.is_built_with_xla(): ... self.skipTest("test is only applicable on XLA") ... @tf.function(jit_compile=True) ... def add(x, y): ... return tf.math.add(x, y) ... ... self.assertEqual(add(tf.ones(()), tf.ones(())), 2.0) TensorFlow official binary is built with XLA. """ return _test_util.IsBuiltWithXLA()
{ "content_hash": "6353f5b406c54e021f347dd150c221ce", "timestamp": "", "source": "github", "line_count": 176, "max_line_length": 85, "avg_line_length": 30.698863636363637, "alnum_prop": 0.6947991856376088, "repo_name": "petewarden/tensorflow", "id": "ca48f71b2bbec41f129244890ee732d757099289", "size": "6093", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "tensorflow/python/platform/test.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Assembly", "bytes": "31796" }, { "name": "Batchfile", "bytes": "55269" }, { "name": "C", "bytes": "895451" }, { "name": "C#", "bytes": "8562" }, { "name": "C++", "bytes": "82100676" }, { "name": "CMake", "bytes": "6500" }, { "name": "Dockerfile", "bytes": "112853" }, { "name": "Go", "bytes": "1867248" }, { "name": "HTML", "bytes": "4686483" }, { "name": "Java", "bytes": "984477" }, { "name": "Jupyter Notebook", "bytes": "550862" }, { "name": "LLVM", "bytes": "6536" }, { "name": "MLIR", "bytes": "1982867" }, { "name": "Makefile", "bytes": "66496" }, { "name": "Objective-C", "bytes": "116558" }, { "name": "Objective-C++", "bytes": "317461" }, { "name": "PHP", "bytes": "4236" }, { "name": "Pascal", "bytes": "318" }, { "name": "Pawn", "bytes": "20422" }, { "name": "Perl", "bytes": "7536" }, { "name": "Python", "bytes": "37425809" }, { "name": "RobotFramework", "bytes": "1779" }, { "name": "Roff", "bytes": "2705" }, { "name": "Ruby", "bytes": "7464" }, { "name": "SWIG", "bytes": "8992" }, { "name": "Shell", "bytes": "700106" }, { "name": "Smarty", "bytes": "35725" }, { "name": "Starlark", "bytes": "3613406" }, { "name": "Swift", "bytes": "62814" }, { "name": "Vim Snippet", "bytes": "58" } ], "symlink_target": "" }
from openerp.osv import fields, osv class account_move_line_unreconcile_select(osv.osv_memory): _name = "account.move.line.unreconcile.select" _description = "Unreconciliation" _columns ={ 'account_id': fields.many2one('account.account','Account',required=True), } def action_open_window(self, cr, uid, ids, context=None): data = self.read(cr, uid, ids, context=context)[0] return { 'domain': "[('account_id','=',%d),('reconcile_id','<>',False),('state','<>','draft')]" % data['account_id'], 'name': 'Unreconciliation', 'view_type': 'form', 'view_mode': 'tree,form', 'view_id': False, 'res_model': 'account.move.line', 'type': 'ir.actions.act_window' } # vim:expandtab:smartindent:tabstop=4:softtabstop=4:shiftwidth=4:
{ "content_hash": "f03067d5a6f0ed365143d862eda6435e", "timestamp": "", "source": "github", "line_count": 22, "max_line_length": 124, "avg_line_length": 40.22727272727273, "alnum_prop": 0.5649717514124294, "repo_name": "cristianquaglio/odoo", "id": "31fbeddeea8d74fe71e153fac7e5da6cbe1de022", "size": "1864", "binary": false, "copies": "378", "ref": "refs/heads/master", "path": "addons/account/wizard/account_move_line_unreconcile_select.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Batchfile", "bytes": "9611" }, { "name": "C++", "bytes": "108790" }, { "name": "CSS", "bytes": "671328" }, { "name": "HTML", "bytes": "212829" }, { "name": "JavaScript", "bytes": "5984109" }, { "name": "Makefile", "bytes": "12332" }, { "name": "Mako", "bytes": "561" }, { "name": "PHP", "bytes": "14033" }, { "name": "Python", "bytes": "8366254" }, { "name": "Ruby", "bytes": "220" }, { "name": "Shell", "bytes": "19163" }, { "name": "Vim script", "bytes": "406" }, { "name": "XSLT", "bytes": "92945" } ], "symlink_target": "" }
from south.utils import datetime_utils as datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Adding model 'Post' db.create_table('blog_post', ( ('id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('title', self.gf('django.db.models.fields.CharField')(max_length=100)), ('slug', self.gf('django.db.models.fields.SlugField')(unique=True, max_length=40)), ('text', self.gf('ckeditor.fields.RichTextField')()), ('status', self.gf('django.db.models.fields.CharField')(max_length=9, default='published')), ('pub_date', self.gf('django.db.models.fields.DateTimeField')(default=datetime.datetime.now)), ('date_created', self.gf('django.db.models.fields.DateTimeField')()), ('last_modified', self.gf('django.db.models.fields.DateTimeField')()), )) db.send_create_signal('blog', ['Post']) def backwards(self, orm): # Deleting model 'Post' db.delete_table('blog_post') models = { 'blog.post': { 'Meta': {'ordering': "['-pub_date']", 'object_name': 'Post'}, 'date_created': ('django.db.models.fields.DateTimeField', [], {}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'last_modified': ('django.db.models.fields.DateTimeField', [], {}), 'pub_date': ('django.db.models.fields.DateTimeField', [], {'default': 'datetime.datetime.now'}), 'slug': ('django.db.models.fields.SlugField', [], {'unique': 'True', 'max_length': '40'}), 'status': ('django.db.models.fields.CharField', [], {'max_length': '9', 'default': "'published'"}), 'text': ('ckeditor.fields.RichTextField', [], {}), 'title': ('django.db.models.fields.CharField', [], {'max_length': '100'}) } } complete_apps = ['blog']
{ "content_hash": "3f9394be2413bd806ee328059d60c406", "timestamp": "", "source": "github", "line_count": 43, "max_line_length": 111, "avg_line_length": 47, "alnum_prop": 0.5833745670460169, "repo_name": "dangerdak/apuniverse", "id": "bcd70ef1874d58e050acbea82f3d55b24a7a02b8", "size": "2045", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "apuniverse/blog/migrations/0001_initial.py", "mode": "33188", "license": "mit", "language": [ { "name": "CSS", "bytes": "148317" }, { "name": "JavaScript", "bytes": "4039056" }, { "name": "Makefile", "bytes": "5612" }, { "name": "Python", "bytes": "81901" }, { "name": "Shell", "bytes": "5120" } ], "symlink_target": "" }
from django.conf import settings from django.shortcuts import redirect from login import auth class User_Data(object): def __init__(self): self.username = "" self.email = "" self.default_shipping_address = "" self.phone_number = "" self.tw_id = "" self.real_name = "" class oauth(object): def __init__(self, request): self.redirect_uri = self.get_callback_uri(request) def login(self, request): pass def callback(self, request): pass def get_userdata_and_uuid(self, request): pass def init_user(self, uuid, access_token): if auth.hasUser(uuid) and auth.hasProfile(uuid): return False else: if auth.create_empty_user(uuid, self.provider_name, access_token): return True else: raise RuntimeError def init_session_with_uuid(self, uuid, request): if auth.hasUser(uuid): if auth.create_session(request, uuid): if auth.hasProfile(uuid): return redirect("digikey.views.progress_page") else: return redirect("login.views.profile") else: raise RuntimeError else: raise RuntimeError def get_callback_uri(self, request): redirect_uri = "http://chiphub.c4labs.xyz/" + self.provider_name + "_callback" if settings.DEBUG == True: redirect_uri = "http://" + request.META['HTTP_HOST'] + "/" + self.provider_name + "_callback" return redirect_uri
{ "content_hash": "a9aee8f9063d2de3e52c8998dfdde841", "timestamp": "", "source": "github", "line_count": 56, "max_line_length": 105, "avg_line_length": 28.821428571428573, "alnum_prop": 0.5656753407682775, "repo_name": "sonicyang/chiphub", "id": "13ed9b0f21120c0cc8e6b51865901611b5fe6be2", "size": "1614", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "login/oauth.py", "mode": "33188", "license": "mit", "language": [ { "name": "CSS", "bytes": "298157" }, { "name": "HTML", "bytes": "89822" }, { "name": "JavaScript", "bytes": "285818" }, { "name": "Python", "bytes": "89817" } ], "symlink_target": "" }
from setuptools import setup from djangocms_googlemap import __version__ CLASSIFIERS = [ 'Development Status :: 5 - Production/Stable', 'Environment :: Web Environment', 'Framework :: Django', 'Intended Audience :: Developers', 'License :: OSI Approved :: BSD License', 'Operating System :: OS Independent', 'Programming Language :: Python', 'Topic :: Communications', 'Topic :: Internet :: WWW/HTTP :: Dynamic Content', 'Topic :: Internet :: WWW/HTTP :: Dynamic Content :: Message Boards', 'Programming Language :: Python :: 2.6', 'Programming Language :: Python :: 2.7', ] setup( name='djangocms-googlemap', version=__version__, description='Google Maps plugin for django CMS', author='Divio AG', author_email='info@divio.ch', url='https://github.com/divio/djangocms-googlemap', packages=['djangocms_googlemap', 'djangocms_googlemap.migrations', 'djangocms_googlemap.migrations_django'], license='LICENSE.txt', platforms=['OS Independent'], classifiers=CLASSIFIERS, long_description=open('README.md').read(), include_package_data=True, zip_safe=False )
{ "content_hash": "34cd55438ddd2a04b823af842d6aa1ee", "timestamp": "", "source": "github", "line_count": 33, "max_line_length": 112, "avg_line_length": 35.06060606060606, "alnum_prop": 0.6698357821953328, "repo_name": "mkost/djangocms-googlemap", "id": "08b3881e0a96b5a354140496002fa0d1b672ae75", "size": "1203", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "setup.py", "mode": "33188", "license": "bsd-3-clause", "language": [ { "name": "HTML", "bytes": "3892" }, { "name": "Python", "bytes": "26738" } ], "symlink_target": "" }
import pytest import torch from allennlp.common import Params from allennlp.common.checks import ConfigurationError from allennlp.data import Vocabulary from allennlp.modules.text_field_embedders import BasicTextFieldEmbedder from allennlp.common.testing import AllenNlpTestCase class TestBasicTextFieldEmbedder(AllenNlpTestCase): def setup_method(self): super().setup_method() self.vocab = Vocabulary() self.vocab.add_token_to_namespace("1") self.vocab.add_token_to_namespace("2") self.vocab.add_token_to_namespace("3") self.vocab.add_token_to_namespace("4") params = Params( { "token_embedders": { "words1": {"type": "embedding", "embedding_dim": 2}, "words2": {"type": "embedding", "embedding_dim": 5}, "words3": {"type": "embedding", "embedding_dim": 3}, } } ) self.token_embedder = BasicTextFieldEmbedder.from_params(vocab=self.vocab, params=params) self.inputs = { "words1": {"tokens": torch.LongTensor([[0, 2, 3, 5]])}, "words2": {"tokens": torch.LongTensor([[1, 4, 3, 2]])}, "words3": {"tokens": torch.LongTensor([[1, 5, 1, 2]])}, } def test_get_output_dim_aggregates_dimension_from_each_embedding(self): assert self.token_embedder.get_output_dim() == 10 def test_forward_asserts_input_field_match(self): # Total mismatch self.inputs["words4"] = self.inputs["words3"] del self.inputs["words3"] with pytest.raises(ConfigurationError) as exc: self.token_embedder(self.inputs) assert exc.match("Mismatched token keys") self.inputs["words3"] = self.inputs["words4"] # Text field has too many inputs with pytest.raises(ConfigurationError) as exc: self.token_embedder(self.inputs) assert exc.match("Mismatched token keys") del self.inputs["words4"] def test_forward_concats_resultant_embeddings(self): assert self.token_embedder(self.inputs).size() == (1, 4, 10) def test_forward_works_on_higher_order_input(self): params = Params( { "token_embedders": { "words": {"type": "embedding", "num_embeddings": 20, "embedding_dim": 2}, "characters": { "type": "character_encoding", "embedding": {"embedding_dim": 4, "num_embeddings": 15}, "encoder": { "type": "cnn", "embedding_dim": 4, "num_filters": 10, "ngram_filter_sizes": [3], }, }, } } ) token_embedder = BasicTextFieldEmbedder.from_params(vocab=self.vocab, params=params) inputs = { "words": {"tokens": (torch.rand(3, 4, 5, 6) * 20).long()}, "characters": {"token_characters": (torch.rand(3, 4, 5, 6, 7) * 15).long()}, } assert token_embedder(inputs, num_wrapping_dims=2).size() == (3, 4, 5, 6, 12) def test_forward_runs_with_forward_params(self): class FakeEmbedder(torch.nn.Module): def __init__(self): super().__init__() def forward(self, tokens: torch.Tensor, extra_arg: int = None): assert tokens is not None assert extra_arg is not None return tokens token_embedder = BasicTextFieldEmbedder({"elmo": FakeEmbedder()}) inputs = {"elmo": {"elmo_tokens": (torch.rand(3, 6, 5) * 2).long()}} kwargs = {"extra_arg": 1} token_embedder(inputs, **kwargs) def test_forward_runs_with_non_bijective_mapping(self): elmo_fixtures_path = self.FIXTURES_ROOT / "elmo" options_file = str(elmo_fixtures_path / "options.json") weight_file = str(elmo_fixtures_path / "lm_weights.hdf5") params = Params( { "token_embedders": { "words": {"type": "embedding", "num_embeddings": 20, "embedding_dim": 2}, "elmo": { "type": "elmo_token_embedder", "options_file": options_file, "weight_file": weight_file, }, } } ) token_embedder = BasicTextFieldEmbedder.from_params(vocab=self.vocab, params=params) inputs = { "words": {"tokens": (torch.rand(3, 6) * 20).long()}, "elmo": {"elmo_tokens": (torch.rand(3, 6, 50) * 15).long()}, } token_embedder(inputs) def test_forward_runs_with_non_bijective_mapping_with_null(self): elmo_fixtures_path = self.FIXTURES_ROOT / "elmo" options_file = str(elmo_fixtures_path / "options.json") weight_file = str(elmo_fixtures_path / "lm_weights.hdf5") params = Params( { "token_embedders": { "elmo": { "type": "elmo_token_embedder", "options_file": options_file, "weight_file": weight_file, } } } ) token_embedder = BasicTextFieldEmbedder.from_params(vocab=self.vocab, params=params) inputs = {"elmo": {"elmo_tokens": (torch.rand(3, 6, 50) * 15).long()}} token_embedder(inputs) def test_forward_runs_with_non_bijective_mapping_with_dict(self): elmo_fixtures_path = self.FIXTURES_ROOT / "elmo" options_file = str(elmo_fixtures_path / "options.json") weight_file = str(elmo_fixtures_path / "lm_weights.hdf5") params = Params( { "token_embedders": { "words": {"type": "embedding", "num_embeddings": 20, "embedding_dim": 2}, "elmo": { "type": "elmo_token_embedder", "options_file": options_file, "weight_file": weight_file, }, } } ) token_embedder = BasicTextFieldEmbedder.from_params(vocab=self.vocab, params=params) inputs = { "words": {"tokens": (torch.rand(3, 6) * 20).long()}, "elmo": {"elmo_tokens": (torch.rand(3, 6, 50) * 15).long()}, } token_embedder(inputs) def test_forward_runs_with_bijective_and_non_bijective_mapping(self): params = Params( { "token_embedders": { "bert": {"type": "pretrained_transformer", "model_name": "bert-base-uncased"}, "token_characters": { "type": "character_encoding", "embedding": {"embedding_dim": 5}, "encoder": { "type": "cnn", "embedding_dim": 5, "num_filters": 5, "ngram_filter_sizes": [5], }, }, } } ) token_embedder = BasicTextFieldEmbedder.from_params(vocab=self.vocab, params=params) inputs = { "bert": { "token_ids": (torch.rand(3, 5) * 10).long(), "mask": (torch.rand(3, 5) * 1).bool(), }, "token_characters": {"token_characters": (torch.rand(3, 5, 5) * 1).long()}, } token_embedder(inputs)
{ "content_hash": "6b88fedd623ef61c125912bb6377cdac", "timestamp": "", "source": "github", "line_count": 189, "max_line_length": 98, "avg_line_length": 40.61904761904762, "alnum_prop": 0.5004559072554383, "repo_name": "allenai/allennlp", "id": "7381ac6d246a9ead4833915de046999eaeffae48", "size": "7677", "binary": false, "copies": "1", "ref": "refs/heads/main", "path": "tests/modules/text_field_embedders/basic_text_field_embedder_test.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "C", "bytes": "39870" }, { "name": "Dockerfile", "bytes": "1190" }, { "name": "Jsonnet", "bytes": "4469" }, { "name": "Makefile", "bytes": "5306" }, { "name": "Perl", "bytes": "101" }, { "name": "Python", "bytes": "3575059" }, { "name": "Scilab", "bytes": "4085" }, { "name": "Shell", "bytes": "2092" } ], "symlink_target": "" }
import re import ConfigParser from devstack import cfg_helpers from devstack import date from devstack import env from devstack import exceptions as excp from devstack import log as logging from devstack import settings from devstack import shell as sh from devstack import utils LOG = logging.getLogger("devstack.cfg") ENV_PAT = re.compile(r"^\s*\$\{([\w\d]+):\-(.*)\}\s*$") SUB_MATCH = re.compile(r"(?:\$\(([\w\d]+):([\w\d]+))\)") CACHE_MSG = "(value will now be internally cached)" def get_config(cfg_fn=None, cfg_cls=None): if not cfg_fn: cfg_fn = sh.canon_path(settings.STACK_CONFIG_LOCATION) if not cfg_cls: cfg_cls = StackConfigParser config_instance = cfg_cls() config_instance.read(cfg_fn) return config_instance class IgnoreMissingConfigParser(ConfigParser.RawConfigParser): DEF_INT = 0 DEF_FLOAT = 0.0 DEF_BOOLEAN = False DEF_BASE = None def __init__(self): ConfigParser.RawConfigParser.__init__(self) #make option names case sensitive self.optionxform = str def get(self, section, option): value = IgnoreMissingConfigParser.DEF_BASE try: value = ConfigParser.RawConfigParser.get(self, section, option) except ConfigParser.NoSectionError: pass except ConfigParser.NoOptionError: pass return value def getboolean(self, section, option): if not self.has_option(section, option): return IgnoreMissingConfigParser.DEF_BOOLEAN return ConfigParser.RawConfigParser.getboolean(self, section, option) def getfloat(self, section, option): if not self.has_option(section, option): return IgnoreMissingConfigParser.DEF_FLOAT return ConfigParser.RawConfigParser.getfloat(self, section, option) def getint(self, section, option): if not self.has_option(section, option): return IgnoreMissingConfigParser.DEF_INT return ConfigParser.RawConfigParser.getint(self, section, option) class StackConfigParser(IgnoreMissingConfigParser): def __init__(self): IgnoreMissingConfigParser.__init__(self) self.configs_fetched = dict() def _resolve_value(self, section, option, value_gotten): if section == 'host' and option == 'ip': LOG.debug("Host ip from configuration/environment was empty, programatically attempting to determine it.") value_gotten = utils.get_host_ip() LOG.debug("Determined your host ip to be: [%s]" % (value_gotten)) return value_gotten def getdefaulted(self, section, option, default_val): val = self.get(section, option) if not val or not val.strip(): LOG.debug("Value [%s] found was not good enough, returning provided default [%s]" % (val, default_val)) return default_val return val def get(self, section, option): key = cfg_helpers.make_id(section, option) if key in self.configs_fetched: value = self.configs_fetched.get(key) LOG.debug("Fetched cached value [%s] for param [%s]" % (value, key)) else: LOG.debug("Fetching value for param [%s]" % (key)) gotten_value = self._get_bashed(section, option) value = self._resolve_value(section, option, gotten_value) LOG.debug("Fetched [%s] for [%s] %s" % (value, key, CACHE_MSG)) self.configs_fetched[key] = value return value def set(self, section, option, value): key = cfg_helpers.make_id(section, option) LOG.audit("Setting config value [%s] for param [%s]" % (value, key)) self.configs_fetched[key] = value IgnoreMissingConfigParser.set(self, section, option, value) def _resolve_replacements(self, value): LOG.debug("Performing simple replacement on [%s]", value) #allow for our simple replacement to occur def replacer(match): section = match.group(1) option = match.group(2) return self.getdefaulted(section, option, '') return SUB_MATCH.sub(replacer, value) def _get_bashed(self, section, option): value = IgnoreMissingConfigParser.get(self, section, option) if value is None: return value extracted_val = '' mtch = ENV_PAT.match(value) if mtch: env_key = mtch.group(1).strip() def_val = mtch.group(2).strip() if not def_val and not env_key: msg = "Invalid bash-like value [%s]" % (value) raise excp.BadParamException(msg) env_value = env.get_key(env_key) if env_value is None: LOG.debug("Extracting value from config provided default value [%s]" % (def_val)) extracted_val = self._resolve_replacements(def_val) LOG.debug("Using config provided default value [%s] (no environment key)" % (extracted_val)) else: extracted_val = env_value LOG.debug("Using enviroment provided value [%s]" % (extracted_val)) else: extracted_val = value LOG.debug("Using raw config provided value [%s]" % (extracted_val)) return extracted_val def add_header(fn, contents): lines = list() lines.append('# Adjusted source file %s' % (fn.strip())) lines.append("# On %s" % (date.rcf8222date())) lines.append("# By user %s, group %s" % (sh.getuser(), sh.getgroupname())) lines.append("# Comments may have been removed (TODO: darn python config writer)") # TODO Maybe use https://code.google.com/p/iniparse/ which seems to preserve comments! lines.append("") if contents: lines.append(contents) return utils.joinlinesep(*lines)
{ "content_hash": "fc82c94beca4119da48b525da551d89a", "timestamp": "", "source": "github", "line_count": 151, "max_line_length": 118, "avg_line_length": 38.59602649006622, "alnum_prop": 0.6257721345229924, "repo_name": "hagleitn/Openstack-Devstack2", "id": "f7f4e1be58924666f53cea549c8bf28f7173b9f3", "size": "6505", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "devstack/cfg.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Python", "bytes": "322122" }, { "name": "Shell", "bytes": "19341" } ], "symlink_target": "" }
from video_scripts.video_processor import * step = parse_line('# just a comment') print('1:', step) step = parse_line('file path/to/file.avi') print('2:', step) if isinstance(step, FileSpec): print(step.path, step.start, step.end) step = parse_line('file path/to/file.avi -s 20 -e 44.5') print('3:', step) if isinstance(step, FileSpec): print(step.path, step.start, step.end) step = parse_line('set-video -gamma 1.4 -abc Abc ') print('4:', step) if isinstance(step, OptionSpec): print(step.what, step.params) step = parse_line('set-video -crop 1792,896,64,128 -scale 1280,640 -gamma 1.4 -speed 4 -textlist a,bc,d') print('5:', step) if isinstance(step, OptionSpec): print(step.what, step.params) step = parse_line('set-video -cited "Ala ma kota"') print('6:', step) if isinstance(step, OptionSpec): print(step.what, step.params) step = parse_line('set-video -cited "Ala ma kota" -normal Ola') print('7:', step) if isinstance(step, OptionSpec): print(step.what, step.params)
{ "content_hash": "f36420c6de7ffdf7bdb961cd9f1b4fab", "timestamp": "", "source": "github", "line_count": 39, "max_line_length": 105, "avg_line_length": 25.897435897435898, "alnum_prop": 0.6801980198019802, "repo_name": "patczar/video-scripts", "id": "407227a15e159fe98eb1f45392a0d1b67087bae4", "size": "1010", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "src/python/examples/parsing.py", "mode": "33188", "license": "mit", "language": [ { "name": "C", "bytes": "2005" }, { "name": "Makefile", "bytes": "239" }, { "name": "Python", "bytes": "9498" }, { "name": "Shell", "bytes": "59833" } ], "symlink_target": "" }
import circuits import rexviewer as r import naali import urllib2 #for js_src downloading """ first EC handlers were not 'Naali modules' (circuits components), but apparently they typically need to get Naali events to handle logout etc. so am making now so that they are registered to the circuits manager automagically. the reference to the manager is not needed though, 'cause circuits supports registering new components under a component out of the box. """ #import modulemanager #import core.circuits_manager #modulemanager_instance = core.circuits_manager.ComponentRunner.instance """a registry of component handlers, by type""" handlertypes = {} def register(compname, handlertype): handlertypes[compname] = handlertype import animsync register(animsync.COMPNAME, animsync.AnimationSync) #deprecated - see scenes/Door/ #import door #register(door.COMPNAME, door.DoorHandler) import rotate register(rotate.COMPNAME, rotate.RotationHandler) #import webmoduleloader #register("pythonmodule", webmoduleloader.WebPythonmoduleLoader) class ComponenthandlerRegistry(circuits.BaseComponent): def __init__(self): circuits.BaseComponent.__init__(self) @circuits.handler("on_sceneadded") def on_sceneadded(self, name): #print "Scene added:", name#, s = naali.getScene(name) #s.connect("ComponentInitialized(Foundation::ComponentInterface*)", self.onComponentInitialized) s.connect("ComponentAdded(Scene::Entity*, IComponent*, AttributeChange::Type)", self.onComponentAdded) #def onComponentInitialized(self, comp): # print "Comp inited:", comp def onComponentAdded(self, entity, comp, changetype): #print "Comp added:", entity, comp, changetype #print comp.className() if comp.className() == "EC_DynamicComponent": #print "comp Name:", comp.Name if comp.name in handlertypes: handlertype = handlertypes[comp.name] h = handlertype(entity, comp, changetype) self += h #so that handlers get circuits events too #if the data was there already, could do this. #but it's not - must now listen to onChanged and check instead #jssrc = comp.GetAttribute("js_src") #print "JS SRC:", jssrc #if jssrc is not None: # self.apply_js(jssrc) # jscheck = make_jssrc_handler(entity, comp, changetype) #todo: OnChanged() is deprecated # comp.connect("OnChanged()", jscheck) # def make_jssrc_handler(entity, comp, changetype): # #def handle_js(): # class JsHandler(): #need a functor so that can disconnect itself # def __call__(self): # jssrc = comp.GetAttribute("js_src") # #print "JS SRC:", jssrc # if jssrc is not None: # apply_js(jssrc, comp) # comp.disconnect("OnChanged()", self) # return JsHandler() # def apply_js(jssrc, comp): # jscode = loadjs(jssrc) # #print jscode # ctx = { # #'entity'/'this': self.entity # 'component': comp # } # ent = comp.GetParentEntity() # try: # ent.touchable # except AttributeError: # pass # else: # ctx['touchable'] = ent.touchable # try: # ent.placeable # except: # pass # else: # ctx['placeable'] = ent.placeable # naali.runjs(jscode, ctx) # #print "-- done with js" # def loadjs(srcurl): # #print "js source url:", srcurl # f = urllib2.urlopen(srcurl) # return f.read()
{ "content_hash": "5d6405920d59bcc81c2e89809746f712", "timestamp": "", "source": "github", "line_count": 110, "max_line_length": 159, "avg_line_length": 32.81818181818182, "alnum_prop": 0.6421052631578947, "repo_name": "antont/tundra", "id": "520193691f3e1a5a2fe70add879b1a7489406577", "size": "3610", "binary": false, "copies": "1", "ref": "refs/heads/tundra2", "path": "src/Application/PythonScriptModule/pymodules_old/apitest/componenthandler.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "C", "bytes": "110345" }, { "name": "C#", "bytes": "76173" }, { "name": "C++", "bytes": "4959154" }, { "name": "CoffeeScript", "bytes": "2229" }, { "name": "JavaScript", "bytes": "316308" }, { "name": "Objective-C", "bytes": "222359" }, { "name": "Python", "bytes": "999850" }, { "name": "Shell", "bytes": "8224" }, { "name": "TypeScript", "bytes": "230019" } ], "symlink_target": "" }
import warnings import os ######################################################################## # Note: imports must be limited to the maximum here, and under no circumstances # import a package that creates a background thread at import time. Failure to # comply will prevent lisa._unshare._do_unshare() to work correctly, as it # cannot work if the process is multithreaded when it is called. ######################################################################## from lisa.version import __version__ # Raise an exception when a deprecated API is used from within a lisa.* # submodule. This ensures that we don't use any deprecated APIs internally, so # they are only kept for external backward compatibility purposes. warnings.filterwarnings( action='error', category=DeprecationWarning, module=fr'{__name__}\..*', ) # When the deprecated APIs are used from __main__ (script or notebook), always # show the warning warnings.filterwarnings( action='always', category=DeprecationWarning, module=r'__main__', ) # vim :set tabstop=4 shiftwidth=4 textwidth=80 expandtab
{ "content_hash": "d62355529b071c5a797e3a84e5da7bfd", "timestamp": "", "source": "github", "line_count": 31, "max_line_length": 79, "avg_line_length": 35.58064516129032, "alnum_prop": 0.6473254759746147, "repo_name": "credp/lisa", "id": "05c02b5e2d1c68d81aed04abdc13c3257b4a0fdd", "size": "1128", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "lisa/__init__.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "C", "bytes": "18748" }, { "name": "Jupyter Notebook", "bytes": "81363929" }, { "name": "Makefile", "bytes": "4003" }, { "name": "Perl", "bytes": "6106" }, { "name": "Python", "bytes": "2309481" }, { "name": "Shell", "bytes": "108055" } ], "symlink_target": "" }
""" The MIT License (MIT) Copyright (c) 2015-2019 Rapptz Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. """ import copy from collections import namedtuple, defaultdict from . import utils from .role import Role from .member import Member, VoiceState from .activity import create_activity from .emoji import Emoji from .permissions import PermissionOverwrite from .colour import Colour from .errors import InvalidArgument, ClientException from .channel import * from .enums import VoiceRegion, Status, ChannelType, try_enum, VerificationLevel, ContentFilter, NotificationLevel from .mixins import Hashable from .user import User from .invite import Invite from .iterators import AuditLogIterator from .webhook import Webhook from .widget import Widget from .asset import Asset BanEntry = namedtuple('BanEntry', 'reason user') class Guild(Hashable): """Represents a Discord guild. This is referred to as a "server" in the official Discord UI. .. container:: operations .. describe:: x == y Checks if two guilds are equal. .. describe:: x != y Checks if two guilds are not equal. .. describe:: hash(x) Returns the guild's hash. .. describe:: str(x) Returns the guild's name. Attributes ---------- name: :class:`str` The guild name. emojis A :class:`tuple` of :class:`Emoji` that the guild owns. region: :class:`VoiceRegion` The region the guild belongs on. There is a chance that the region will be a :class:`str` if the value is not recognised by the enumerator. afk_timeout: :class:`int` The timeout to get sent to the AFK channel. afk_channel: Optional[:class:`VoiceChannel`] The channel that denotes the AFK channel. None if it doesn't exist. icon: Optional[:class:`str`] The guild's icon. id: :class:`int` The guild's ID. owner_id: :class:`int` The guild owner's ID. Use :attr:`Guild.owner` instead. unavailable: :class:`bool` Indicates if the guild is unavailable. If this is ``True`` then the reliability of other attributes outside of :meth:`Guild.id` is slim and they might all be None. It is best to not do anything with the guild if it is unavailable. Check the :func:`on_guild_unavailable` and :func:`on_guild_available` events. max_presences: Optional[:class:`int`] The maximum amount of presences for the guild. max_members: Optional[:class:`int`] The maximum amount of members for the guild. banner: Optional[:class:`str`] The guild's banner. description: Optional[:class:`str`] The guild's description. mfa_level: :class:`int` Indicates the guild's two factor authorisation level. If this value is 0 then the guild does not require 2FA for their administrative members. If the value is 1 then they do. verification_level: :class:`VerificationLevel` The guild's verification level. explicit_content_filter: :class:`ContentFilter` The guild's explicit content filter. default_notifications: :class:`NotificationLevel` The guild's notification settings. features: List[:class:`str`] A list of features that the guild has. They are currently as follows: - ``VIP_REGIONS``: Guild has VIP voice regions - ``VANITY_URL``: Guild has a vanity invite URL (e.g. discord.gg/discord-api) - ``INVITE_SPLASH``: Guild's invite page has a special splash. - ``VERIFIED``: Guild is a "verified" server. - ``MORE_EMOJI``: Guild is allowed to have more than 50 custom emoji. splash: Optional[:class:`str`] The guild's invite splash. """ __slots__ = ('afk_timeout', 'afk_channel', '_members', '_channels', 'icon', 'name', 'id', 'unavailable', 'banner', 'region', '_state', '_default_role', '_roles', '_member_count', '_large', 'owner_id', 'mfa_level', 'emojis', 'features', 'verification_level', 'explicit_content_filter', 'splash', '_voice_states', '_system_channel_id', 'default_notifications', 'description', 'max_presences', 'max_members', 'premium_tier') def __init__(self, *, data, state): self._channels = {} self._members = {} self._voice_states = {} self._state = state self._from_data(data) def _add_channel(self, channel): self._channels[channel.id] = channel def _remove_channel(self, channel): self._channels.pop(channel.id, None) def _voice_state_for(self, user_id): return self._voice_states.get(user_id) def _add_member(self, member): self._members[member.id] = member def _remove_member(self, member): self._members.pop(member.id, None) def __str__(self): return self.name def __repr__(self): return '<Guild id={0.id} name={0.name!r} chunked={0.chunked}>'.format(self) def _update_voice_state(self, data, channel_id): user_id = int(data['user_id']) channel = self.get_channel(channel_id) try: # check if we should remove the voice state from cache if channel is None: after = self._voice_states.pop(user_id) else: after = self._voice_states[user_id] before = copy.copy(after) after._update(data, channel) except KeyError: # if we're here then we're getting added into the cache after = VoiceState(data=data, channel=channel) before = VoiceState(data=data, channel=None) self._voice_states[user_id] = after member = self.get_member(user_id) return member, before, after def _add_role(self, role): # roles get added to the bottom (position 1, pos 0 is @everyone) # so since self.roles has the @everyone role, we can't increment # its position because it's stuck at position 0. Luckily x += False # is equivalent to adding 0. So we cast the position to a bool and # increment it. for r in self._roles.values(): r.position += (not r.is_default()) self._roles[role.id] = role def _remove_role(self, role_id): # this raises KeyError if it fails.. role = self._roles.pop(role_id) # since it didn't, we can change the positions now # basically the same as above except we only decrement # the position if we're above the role we deleted. for r in self._roles.values(): r.position -= r.position > role.position return role def _from_data(self, guild): # according to Stan, this is always available even if the guild is unavailable # I don't have this guarantee when someone updates the guild. member_count = guild.get('member_count', None) if member_count: self._member_count = member_count self.name = guild.get('name') self.region = try_enum(VoiceRegion, guild.get('region')) self.verification_level = try_enum(VerificationLevel, guild.get('verification_level')) self.default_notifications = try_enum(NotificationLevel, guild.get('default_message_notifications')) self.explicit_content_filter = try_enum(ContentFilter, guild.get('explicit_content_filter', 0)) self.afk_timeout = guild.get('afk_timeout') self.icon = guild.get('icon') self.banner = guild.get('banner') self.unavailable = guild.get('unavailable', False) self.id = int(guild['id']) self._roles = {} state = self._state # speed up attribute access for r in guild.get('roles', []): role = Role(guild=self, data=r, state=state) self._roles[role.id] = role self.mfa_level = guild.get('mfa_level') self.emojis = tuple(map(lambda d: state.store_emoji(self, d), guild.get('emojis', []))) self.features = guild.get('features', []) self.splash = guild.get('splash') self._system_channel_id = utils._get_as_snowflake(guild, 'system_channel_id') self.description = guild.get('description') self.max_presences = guild.get('max_presences') self.max_members = guild.get('max_members') self.premium_tier = guild.get('premium_tier') for mdata in guild.get('members', []): member = Member(data=mdata, guild=self, state=state) self._add_member(member) self._sync(guild) self._large = None if member_count is None else self._member_count >= 250 self.owner_id = utils._get_as_snowflake(guild, 'owner_id') self.afk_channel = self.get_channel(utils._get_as_snowflake(guild, 'afk_channel_id')) for obj in guild.get('voice_states', []): self._update_voice_state(obj, int(obj['channel_id'])) def _sync(self, data): try: self._large = data['large'] except KeyError: pass empty_tuple = tuple() for presence in data.get('presences', []): user_id = int(presence['user']['id']) member = self.get_member(user_id) if member is not None: member._presence_update(presence, empty_tuple) if 'channels' in data: channels = data['channels'] for c in channels: c_type = c['type'] if c_type in (ChannelType.text.value, ChannelType.news.value): self._add_channel(TextChannel(guild=self, data=c, state=self._state)) elif c_type == ChannelType.voice.value: self._add_channel(VoiceChannel(guild=self, data=c, state=self._state)) elif c_type == ChannelType.category.value: self._add_channel(CategoryChannel(guild=self, data=c, state=self._state)) elif c_type == ChannelType.store.value: self._add_channel(StoreChannel(guild=self, data=c, state=self._state)) @property def channels(self): """List[:class:`abc.GuildChannel`]: A list of channels that belongs to this guild.""" return list(self._channels.values()) @property def large(self): """:class:`bool`: Indicates if the guild is a 'large' guild. A large guild is defined as having more than ``large_threshold`` count members, which for this library is set to the maximum of 250. """ if self._large is None: try: return self._member_count >= 250 except AttributeError: return len(self._members) >= 250 return self._large @property def voice_channels(self): """List[:class:`VoiceChannel`]: A list of voice channels that belongs to this guild. This is sorted by the position and are in UI order from top to bottom. """ r = [ch for ch in self._channels.values() if isinstance(ch, VoiceChannel)] r.sort(key=lambda c: (c.position, c.id)) return r @property def me(self): """Similar to :attr:`Client.user` except an instance of :class:`Member`. This is essentially used to get the member version of yourself. """ self_id = self._state.user.id return self.get_member(self_id) @property def voice_client(self): """Returns the :class:`VoiceClient` associated with this guild, if any.""" return self._state._get_voice_client(self.id) @property def text_channels(self): """List[:class:`TextChannel`]: A list of text channels that belongs to this guild. This is sorted by the position and are in UI order from top to bottom. """ r = [ch for ch in self._channels.values() if isinstance(ch, TextChannel)] r.sort(key=lambda c: (c.position, c.id)) return r @property def categories(self): """List[:class:`CategoryChannel`]: A list of categories that belongs to this guild. This is sorted by the position and are in UI order from top to bottom. """ r = [ch for ch in self._channels.values() if isinstance(ch, CategoryChannel)] r.sort(key=lambda c: (c.position, c.id)) return r def by_category(self): """Returns every :class:`CategoryChannel` and their associated channels. These channels and categories are sorted in the official Discord UI order. If the channels do not have a category, then the first element of the tuple is ``None``. Returns -------- List[Tuple[Optional[:class:`CategoryChannel`], List[:class:`abc.GuildChannel`]]]: The categories and their associated channels. """ grouped = defaultdict(list) for channel in self._channels.values(): if isinstance(channel, CategoryChannel): continue grouped[channel.category_id].append(channel) def key(t): k, v = t return ((k.position, k.id) if k else (-1, -1), v) _get = self._channels.get as_list = [(_get(k), v) for k, v in grouped.items()] as_list.sort(key=key) for _, channels in as_list: channels.sort(key=lambda c: (c._sorting_bucket, c.position, c.id)) return as_list def get_channel(self, channel_id): """Returns a :class:`abc.GuildChannel` with the given ID. If not found, returns None.""" return self._channels.get(channel_id) @property def system_channel(self): """Optional[:class:`TextChannel`]: Returns the guild's channel used for system messages. Currently this is only for new member joins. If no channel is set, then this returns ``None``. """ channel_id = self._system_channel_id return channel_id and self._channels.get(channel_id) @property def members(self): """List[:class:`Member`]: A list of members that belong to this guild.""" return list(self._members.values()) def get_member(self, user_id): """Returns a :class:`Member` with the given ID. If not found, returns None.""" return self._members.get(user_id) @property def roles(self): """Returns a :class:`list` of the guild's roles in hierarchy order. The first element of this list will be the lowest role in the hierarchy. """ return sorted(self._roles.values()) def get_role(self, role_id): """Returns a :class:`Role` with the given ID. If not found, returns None.""" return self._roles.get(role_id) @utils.cached_slot_property('_default_role') def default_role(self): """Gets the @everyone role that all members have by default.""" return utils.find(lambda r: r.is_default(), self._roles.values()) @property def owner(self): """:class:`Member`: The member that owns the guild.""" return self.get_member(self.owner_id) @property def icon_url(self): """Returns the URL version of the guild's icon. Returns an empty string if it has no icon.""" return self.icon_url_as() def icon_url_as(self, *, format='webp', size=1024): """Returns a friendly URL version of the guild's icon. Returns an empty string if it has no icon. The format must be one of 'webp', 'jpeg', 'jpg', or 'png'. The size must be a power of 2 between 16 and 4096. Parameters ----------- format: :class:`str` The format to attempt to convert the icon to. size: :class:`int` The size of the image to display. Raises ------ InvalidArgument Bad image format passed to ``format`` or invalid ``size``. Returns -------- :class:`Asset` The resulting CDN asset. """ return Asset._from_guild_image(self._state, self.id, self.icon, 'icons', format=format, size=size) @property def banner_url(self): """Returns the URL version of the guild's banner. Returns an empty string if it has no banner.""" return self.banner_url_as() def banner_url_as(self, *, format='webp', size=2048): """Returns a friendly URL version of the guild's banner. Returns an empty string if it has no banner. The format must be one of 'webp', 'jpeg', or 'png'. The size must be a power of 2 between 16 and 4096. Parameters ----------- format: :class:`str` The format to attempt to convert the banner to. size: :class:`int` The size of the image to display. Raises ------ InvalidArgument Bad image format passed to ``format`` or invalid ``size``. Returns -------- :class:`Asset` The resulting CDN asset. """ return Asset._from_guild_image(self._state, self.id, self.banner, 'banners', format=format, size=size) @property def splash_url(self): """Returns the URL version of the guild's invite splash. Returns an empty string if it has no splash.""" return self.splash_url_as() def splash_url_as(self, *, format='webp', size=2048): """Returns a friendly URL version of the guild's invite splash. Returns an empty string if it has no splash. The format must be one of 'webp', 'jpeg', 'jpg', or 'png'. The size must be a power of 2 between 16 and 4096. Parameters ----------- format: :class:`str` The format to attempt to convert the splash to. size: :class:`int` The size of the image to display. Raises ------ InvalidArgument Bad image format passed to ``format`` or invalid ``size``. Returns -------- :class:`Asset` The resulting CDN asset. """ return Asset._from_guild_image(self._state, self.id, self.splash, 'splashes', format=format, size=size) @property def member_count(self): """Returns the true member count regardless of it being loaded fully or not.""" return self._member_count @property def chunked(self): """Returns a boolean indicating if the guild is "chunked". A chunked guild means that :attr:`member_count` is equal to the number of members stored in the internal :attr:`members` cache. If this value returns ``False``, then you should request for offline members. """ count = getattr(self, '_member_count', None) if count is None: return False return count == len(self._members) @property def shard_id(self): """Returns the shard ID for this guild if applicable.""" count = self._state.shard_count if count is None: return None return (self.id >> 22) % count @property def created_at(self): """Returns the guild's creation time in UTC.""" return utils.snowflake_time(self.id) def get_member_named(self, name): """Returns the first member found that matches the name provided. The name can have an optional discriminator argument, e.g. "Jake#0001" or "Jake" will both do the lookup. However the former will give a more precise result. Note that the discriminator must have all 4 digits for this to work. If a nickname is passed, then it is looked up via the nickname. Note however, that a nickname + discriminator combo will not lookup the nickname but rather the username + discriminator combo due to nickname + discriminator not being unique. If no member is found, ``None`` is returned. Parameters ----------- name: :class:`str` The name of the member to lookup with an optional discriminator. Returns -------- :class:`Member` The member in this guild with the associated name. If not found then ``None`` is returned. """ result = None members = self.members if len(name) > 5 and name[-5] == '#': # The 5 length is checking to see if #0000 is in the string, # as a#0000 has a length of 6, the minimum for a potential # discriminator lookup. potential_discriminator = name[-4:] # do the actual lookup and return if found # if it isn't found then we'll do a full name lookup below. result = utils.get(members, name=name[:-5], discriminator=potential_discriminator) if result is not None: return result def pred(m): return m.nick == name or m.name == name return utils.find(pred, members) def _create_channel(self, name, overwrites, channel_type, category=None, **options): if overwrites is None: overwrites = {} elif not isinstance(overwrites, dict): raise InvalidArgument('overwrites parameter expects a dict.') perms = [] for target, perm in overwrites.items(): if not isinstance(perm, PermissionOverwrite): raise InvalidArgument('Expected PermissionOverwrite received {0.__name__}'.format(type(perm))) allow, deny = perm.pair() payload = { 'allow': allow.value, 'deny': deny.value, 'id': target.id } if isinstance(target, Role): payload['type'] = 'role' else: payload['type'] = 'member' perms.append(payload) try: options['rate_limit_per_user'] = options.pop('slowmode_delay') except KeyError: pass parent_id = category.id if category else None return self._state.http.create_channel(self.id, channel_type.value, name=name, parent_id=parent_id, permission_overwrites=perms, **options) async def create_text_channel(self, name, *, overwrites=None, category=None, reason=None, **options): """|coro| Creates a :class:`TextChannel` for the guild. Note that you need the :attr:`~Permissions.manage_channels` permission to create the channel. The ``overwrites`` parameter can be used to create a 'secret' channel upon creation. This parameter expects a :class:`dict` of overwrites with the target (either a :class:`Member` or a :class:`Role`) as the key and a :class:`PermissionOverwrite` as the value. .. note:: Creating a channel of a specified position will not update the position of other channels to follow suit. A follow-up call to :meth:`~TextChannel.edit` will be required to update the position of the channel in the channel list. Examples ---------- Creating a basic channel: .. code-block:: python3 channel = await guild.create_text_channel('cool-channel') Creating a "secret" channel: .. code-block:: python3 overwrites = { guild.default_role: discord.PermissionOverwrite(read_messages=False), guild.me: discord.PermissionOverwrite(read_messages=True) } channel = await guild.create_text_channel('secret', overwrites=overwrites) Parameters ----------- name: :class:`str` The channel's name. overwrites A :class:`dict` of target (either a role or a member) to :class:`PermissionOverwrite` to apply upon creation of a channel. Useful for creating secret channels. category: Optional[:class:`CategoryChannel`] The category to place the newly created channel under. The permissions will be automatically synced to category if no overwrites are provided. position: :class:`int` The position in the channel list. This is a number that starts at 0. e.g. the top channel is position 0. topic: Optional[:class:`str`] The new channel's topic. slowmode_delay: :class:`int` Specifies the slowmode rate limit for user in this channel, in seconds. The maximum value possible is `21600`. nsfw: :class:`bool` To mark the channel as NSFW or not. reason: Optional[:class:`str`] The reason for creating this channel. Shows up on the audit log. Raises ------- Forbidden You do not have the proper permissions to create this channel. HTTPException Creating the channel failed. InvalidArgument The permission overwrite information is not in proper form. Returns ------- :class:`TextChannel` The channel that was just created. """ data = await self._create_channel(name, overwrites, ChannelType.text, category, reason=reason, **options) channel = TextChannel(state=self._state, guild=self, data=data) # temporarily add to the cache self._channels[channel.id] = channel return channel async def create_voice_channel(self, name, *, overwrites=None, category=None, reason=None, **options): """|coro| This is similar to :meth:`create_text_channel` except makes a :class:`VoiceChannel` instead, in addition to having the following new parameters. Parameters ----------- bitrate: :class:`int` The channel's preferred audio bitrate in bits per second. user_limit: :class:`int` The channel's limit for number of members that can be in a voice channel. """ data = await self._create_channel(name, overwrites, ChannelType.voice, category, reason=reason, **options) channel = VoiceChannel(state=self._state, guild=self, data=data) # temporarily add to the cache self._channels[channel.id] = channel return channel async def create_category(self, name, *, overwrites=None, reason=None): """|coro| Same as :meth:`create_text_channel` except makes a :class:`CategoryChannel` instead. .. note:: The ``category`` parameter is not supported in this function since categories cannot have categories. """ data = await self._create_channel(name, overwrites, ChannelType.category, reason=reason) channel = CategoryChannel(state=self._state, guild=self, data=data) # temporarily add to the cache self._channels[channel.id] = channel return channel create_category_channel = create_category async def leave(self): """|coro| Leaves the guild. .. note:: You cannot leave the guild that you own, you must delete it instead via :meth:`delete`. Raises -------- HTTPException Leaving the guild failed. """ await self._state.http.leave_guild(self.id) async def delete(self): """|coro| Deletes the guild. You must be the guild owner to delete the guild. Raises -------- HTTPException Deleting the guild failed. Forbidden You do not have permissions to delete the guild. """ await self._state.http.delete_guild(self.id) async def edit(self, *, reason=None, **fields): """|coro| Edits the guild. You must have the :attr:`~Permissions.manage_guild` permission to edit the guild. Parameters ---------- name: :class:`str` The new name of the guild. description: :class:`str` The new description of the guild. This is only available to guilds that contain `VERIFIED` in :attr:`Guild.features`. icon: :class:`bytes` A :term:`py:bytes-like object` representing the icon. Only PNG/JPEG supported. Could be ``None`` to denote removal of the icon. banner: :class:`bytes` A :term:`py:bytes-like object` representing the banner. Could be ``None`` to denote removal of the banner. splash: :class:`bytes` A :term:`py:bytes-like object` representing the invite splash. Only PNG/JPEG supported. Could be ``None`` to denote removing the splash. Only available for partnered guilds with ``INVITE_SPLASH`` feature. region: :class:`VoiceRegion` The new region for the guild's voice communication. afk_channel: Optional[:class:`VoiceChannel`] The new channel that is the AFK channel. Could be ``None`` for no AFK channel. afk_timeout: :class:`int` The number of seconds until someone is moved to the AFK channel. owner: :class:`Member` The new owner of the guild to transfer ownership to. Note that you must be owner of the guild to do this. verification_level: :class:`VerificationLevel` The new verification level for the guild. default_notifications: :class:`NotificationLevel` The new default notification level for the guild. explicit_content_filter: :class:`ContentFilter` The new explicit content filter for the guild. vanity_code: :class:`str` The new vanity code for the guild. system_channel: Optional[:class:`TextChannel`] The new channel that is used for the system channel. Could be ``None`` for no system channel. reason: Optional[:class:`str`] The reason for editing this guild. Shows up on the audit log. Raises ------- Forbidden You do not have permissions to edit the guild. HTTPException Editing the guild failed. InvalidArgument The image format passed in to ``icon`` is invalid. It must be PNG or JPG. This is also raised if you are not the owner of the guild and request an ownership transfer. """ http = self._state.http try: icon_bytes = fields['icon'] except KeyError: icon = self.icon else: if icon_bytes is not None: icon = utils._bytes_to_base64_data(icon_bytes) else: icon = None try: banner_bytes = fields['banner'] except KeyError: banner = self.banner else: if banner_bytes is not None: banner = utils._bytes_to_base64_data(banner_bytes) else: banner = None try: vanity_code = fields['vanity_code'] except KeyError: pass else: await http.change_vanity_code(self.id, vanity_code, reason=reason) try: splash_bytes = fields['splash'] except KeyError: splash = self.splash else: if splash_bytes is not None: splash = utils._bytes_to_base64_data(splash_bytes) else: splash = None fields['icon'] = icon fields['banner'] = banner fields['splash'] = splash try: default_message_notifications = int(fields.pop('default_notifications')) except (TypeError, KeyError): pass else: fields['default_message_notifications'] = default_message_notifications try: afk_channel = fields.pop('afk_channel') except KeyError: pass else: if afk_channel is None: fields['afk_channel_id'] = afk_channel else: fields['afk_channel_id'] = afk_channel.id try: system_channel = fields.pop('system_channel') except KeyError: pass else: if system_channel is None: fields['system_channel_id'] = system_channel else: fields['system_channel_id'] = system_channel.id if 'owner' in fields: if self.owner != self.me: raise InvalidArgument('To transfer ownership you must be the owner of the guild.') fields['owner_id'] = fields['owner'].id if 'region' in fields: fields['region'] = str(fields['region']) level = fields.get('verification_level', self.verification_level) if not isinstance(level, VerificationLevel): raise InvalidArgument('verification_level field must be of type VerificationLevel') fields['verification_level'] = level.value explicit_content_filter = fields.get('explicit_content_filter', self.explicit_content_filter) if not isinstance(explicit_content_filter, ContentFilter): raise InvalidArgument('explicit_content_filter field must be of type ContentFilter') fields['explicit_content_filter'] = explicit_content_filter.value await http.edit_guild(self.id, reason=reason, **fields) async def fetch_member(self, member_id): """|coro| Retreives a :class:`Member` from a guild ID, and a member ID. .. note:: This method is an API call. For general usage, consider :meth:`get_member` instead. Parameters ----------- member_id: :class:`int` The member's ID to fetch from. Raises ------- Forbidden You do not have access to the guild. HTTPException Getting the guild failed. Returns -------- :class:`Member` The member from the member ID. """ data = await self._state.http.get_member(self.id, member_id) return Member(data=data, state=self._state, guild=self) async def fetch_ban(self, user): """|coro| Retrieves the :class:`BanEntry` for a user, which is a namedtuple with a ``user`` and ``reason`` field. See :meth:`bans` for more information. You must have the :attr:`~Permissions.ban_members` permission to get this information. Parameters ----------- user: :class:`abc.Snowflake` The user to get ban information from. Raises ------ Forbidden You do not have proper permissions to get the information. NotFound This user is not banned. HTTPException An error occurred while fetching the information. Returns ------- BanEntry The BanEntry object for the specified user. """ data = await self._state.http.get_ban(user.id, self.id) return BanEntry( user=User(state=self._state, data=data['user']), reason=data['reason'] ) async def bans(self): """|coro| Retrieves all the users that are banned from the guild. This coroutine returns a :class:`list` of BanEntry objects, which is a namedtuple with a ``user`` field to denote the :class:`User` that got banned along with a ``reason`` field specifying why the user was banned that could be set to ``None``. You must have the :attr:`~Permissions.ban_members` permission to get this information. Raises ------- Forbidden You do not have proper permissions to get the information. HTTPException An error occurred while fetching the information. Returns -------- List[BanEntry] A list of BanEntry objects. """ data = await self._state.http.get_bans(self.id) return [BanEntry(user=User(state=self._state, data=e['user']), reason=e['reason']) for e in data] async def prune_members(self, *, days, compute_prune_count=True, reason=None): r"""|coro| Prunes the guild from its inactive members. The inactive members are denoted if they have not logged on in ``days`` number of days and they have no roles. You must have the :attr:`~Permissions.kick_members` permission to use this. To check how many members you would prune without actually pruning, see the :meth:`estimate_pruned_members` function. Parameters ----------- days: :class:`int` The number of days before counting as inactive. reason: Optional[:class:`str`] The reason for doing this action. Shows up on the audit log. compute_prune_count: :class:`bool` Whether to compute the prune count. This defaults to ``True`` which makes it prone to timeouts in very large guilds. In order to prevent timeouts, you must set this to ``False``. If this is set to ``False``\, then this function will always return ``None``. Raises ------- Forbidden You do not have permissions to prune members. HTTPException An error occurred while pruning members. InvalidArgument An integer was not passed for ``days``. Returns --------- Optional[:class:`int`] The number of members pruned. If ``compute_prune_count`` is ``False`` then this returns ``None``. """ if not isinstance(days, int): raise InvalidArgument('Expected int for ``days``, received {0.__class__.__name__} instead.'.format(days)) data = await self._state.http.prune_members(self.id, days, compute_prune_count=compute_prune_count, reason=reason) return data['pruned'] async def webhooks(self): """|coro| Gets the list of webhooks from this guild. Requires :attr:`~.Permissions.manage_webhooks` permissions. Raises ------- Forbidden You don't have permissions to get the webhooks. Returns -------- List[:class:`Webhook`] The webhooks for this guild. """ data = await self._state.http.guild_webhooks(self.id) return [Webhook.from_state(d, state=self._state) for d in data] async def estimate_pruned_members(self, *, days): """|coro| Similar to :meth:`prune_members` except instead of actually pruning members, it returns how many members it would prune from the guild had it been called. Parameters ----------- days: :class:`int` The number of days before counting as inactive. Raises ------- Forbidden You do not have permissions to prune members. HTTPException An error occurred while fetching the prune members estimate. InvalidArgument An integer was not passed for ``days``. Returns --------- :class:`int` The number of members estimated to be pruned. """ if not isinstance(days, int): raise InvalidArgument('Expected int for ``days``, received {0.__class__.__name__} instead.'.format(days)) data = await self._state.http.estimate_pruned_members(self.id, days) return data['pruned'] async def invites(self): """|coro| Returns a list of all active instant invites from the guild. You must have the :attr:`~Permissions.manage_guild` permission to get this information. Raises ------- Forbidden You do not have proper permissions to get the information. HTTPException An error occurred while fetching the information. Returns ------- List[:class:`Invite`] The list of invites that are currently active. """ data = await self._state.http.invites_from(self.id) result = [] for invite in data: channel = self.get_channel(int(invite['channel']['id'])) invite['channel'] = channel invite['guild'] = self result.append(Invite(state=self._state, data=invite)) return result async def fetch_emojis(self): r"""|coro| Retrieves all custom :class:`Emoji`\s from the guild. .. note:: This method is an API call. For general usage, consider :attr:`emojis` instead. Raises --------- HTTPException An error occurred fetching the emojis. Returns -------- List[:class:`Emoji`] The retrieved emojis. """ data = await self._state.http.get_all_custom_emojis(self.id) return [Emoji(guild=self, state=self._state, data=d) for d in data] async def fetch_emoji(self, emoji_id): """|coro| Retrieves a custom :class:`Emoji` from the guild. .. note:: This method is an API call. For general usage, consider iterating over :attr:`emojis` instead. Parameters ------------- emoji_id: :class:`int` The emoji's ID. Raises --------- NotFound The emoji requested could not be found. HTTPException An error occurred fetching the emoji. Returns -------- :class:`Emoji` The retrieved emoji. """ data = await self._state.http.get_custom_emoji(self.id, emoji_id) return Emoji(guild=self, state=self._state, data=data) async def create_custom_emoji(self, *, name, image, roles=None, reason=None): r"""|coro| Creates a custom :class:`Emoji` for the guild. There is currently a limit of 50 static and animated emojis respectively per guild, unless the guild has the ``MORE_EMOJI`` feature which extends the limit to 200. You must have the :attr:`~Permissions.manage_emojis` permission to do this. Parameters ----------- name: :class:`str` The emoji name. Must be at least 2 characters. image: :class:`bytes` The :term:`py:bytes-like object` representing the image data to use. Only JPG, PNG and GIF images are supported. roles: Optional[List[:class:`Role`]] A :class:`list` of :class:`Role`\s that can use this emoji. Leave empty to make it available to everyone. reason: Optional[:class:`str`] The reason for creating this emoji. Shows up on the audit log. Raises ------- Forbidden You are not allowed to create emojis. HTTPException An error occurred creating an emoji. Returns -------- :class:`Emoji` The created emoji. """ img = utils._bytes_to_base64_data(image) if roles: roles = [role.id for role in roles] data = await self._state.http.create_custom_emoji(self.id, name, img, roles=roles, reason=reason) return self._state.store_emoji(self, data) async def create_role(self, *, reason=None, **fields): """|coro| Creates a :class:`Role` for the guild. All fields are optional. You must have the :attr:`~Permissions.manage_roles` permission to do this. Parameters ----------- name: :class:`str` The role name. Defaults to 'new role'. permissions: :class:`Permissions` The permissions to have. Defaults to no permissions. colour: :class:`Colour` The colour for the role. Defaults to :meth:`Colour.default`. This is aliased to ``color`` as well. hoist: :class:`bool` Indicates if the role should be shown separately in the member list. Defaults to False. mentionable: :class:`bool` Indicates if the role should be mentionable by others. Defaults to False. reason: Optional[:class:`str`] The reason for creating this role. Shows up on the audit log. Raises ------- Forbidden You do not have permissions to create the role. HTTPException Creating the role failed. InvalidArgument An invalid keyword argument was given. Returns -------- :class:`Role` The newly created role. """ try: perms = fields.pop('permissions') except KeyError: fields['permissions'] = 0 else: fields['permissions'] = perms.value try: colour = fields.pop('colour') except KeyError: colour = fields.get('color', Colour.default()) finally: fields['color'] = colour.value valid_keys = ('name', 'permissions', 'color', 'hoist', 'mentionable') for key in fields: if key not in valid_keys: raise InvalidArgument('%r is not a valid field.' % key) data = await self._state.http.create_role(self.id, reason=reason, **fields) role = Role(guild=self, data=data, state=self._state) # TODO: add to cache return role async def kick(self, user, *, reason=None): """|coro| Kicks a user from the guild. The user must meet the :class:`abc.Snowflake` abc. You must have the :attr:`~Permissions.kick_members` permission to do this. Parameters ----------- user: :class:`abc.Snowflake` The user to kick from their guild. reason: Optional[:class:`str`] The reason the user got kicked. Raises ------- Forbidden You do not have the proper permissions to kick. HTTPException Kicking failed. """ await self._state.http.kick(user.id, self.id, reason=reason) async def ban(self, user, *, reason=None, delete_message_days=1): """|coro| Bans a user from the guild. The user must meet the :class:`abc.Snowflake` abc. You must have the :attr:`~Permissions.ban_members` permission to do this. Parameters ----------- user: :class:`abc.Snowflake` The user to ban from their guild. delete_message_days: :class:`int` The number of days worth of messages to delete from the user in the guild. The minimum is 0 and the maximum is 7. reason: Optional[:class:`str`] The reason the user got banned. Raises ------- Forbidden You do not have the proper permissions to ban. HTTPException Banning failed. """ await self._state.http.ban(user.id, self.id, delete_message_days, reason=reason) async def unban(self, user, *, reason=None): """|coro| Unbans a user from the guild. The user must meet the :class:`abc.Snowflake` abc. You must have the :attr:`~Permissions.ban_members` permission to do this. Parameters ----------- user: :class:`abc.Snowflake` The user to unban. reason: Optional[:class:`str`] The reason for doing this action. Shows up on the audit log. Raises ------- Forbidden You do not have the proper permissions to unban. HTTPException Unbanning failed. """ await self._state.http.unban(user.id, self.id, reason=reason) async def vanity_invite(self): """|coro| Returns the guild's special vanity invite. The guild must be partnered, i.e. have 'VANITY_URL' in :attr:`~Guild.features`. You must have the :attr:`~Permissions.manage_guild` permission to use this as well. Raises ------- Forbidden You do not have the proper permissions to get this. HTTPException Retrieving the vanity invite failed. Returns -------- :class:`Invite` The special vanity invite. """ # we start with { code: abc } payload = await self._state.http.get_vanity_code(self.id) # get the vanity URL channel since default channels aren't # reliable or a thing anymore data = await self._state.http.get_invite(payload['code']) payload['guild'] = self payload['channel'] = self.get_channel(int(data['channel']['id'])) payload['revoked'] = False payload['temporary'] = False payload['max_uses'] = 0 payload['max_age'] = 0 return Invite(state=self._state, data=payload) def ack(self): """|coro| Marks every message in this guild as read. The user must not be a bot user. Raises ------- HTTPException Acking failed. ClientException You must not be a bot user. """ state = self._state if state.is_bot: raise ClientException('Must not be a bot account to ack messages.') return state.http.ack_guild(self.id) def audit_logs(self, *, limit=100, before=None, after=None, oldest_first=None, user=None, action=None): """Return an :class:`AsyncIterator` that enables receiving the guild's audit logs. You must have the :attr:`~Permissions.view_audit_log` permission to use this. Examples ---------- Getting the first 100 entries: :: async for entry in guild.audit_logs(limit=100): print('{0.user} did {0.action} to {0.target}'.format(entry)) Getting entries for a specific action: :: async for entry in guild.audit_logs(action=discord.AuditLogAction.ban): print('{0.user} banned {0.target}'.format(entry)) Getting entries made by a specific user: :: entries = await guild.audit_logs(limit=None, user=guild.me).flatten() await channel.send('I made {} moderation actions.'.format(len(entries))) Parameters ----------- limit: Optional[:class:`int`] The number of entries to retrieve. If ``None`` retrieve all entries. before: Union[:class:`abc.Snowflake`, datetime] Retrieve entries before this date or entry. If a date is provided it must be a timezone-naive datetime representing UTC time. after: Union[:class:`abc.Snowflake`, datetime] Retrieve entries after this date or entry. If a date is provided it must be a timezone-naive datetime representing UTC time. oldest_first: :class:`bool` If set to true, return entries in oldest->newest order. Defaults to True if ``after`` is specified, otherwise False. user: :class:`abc.Snowflake` The moderator to filter entries from. action: :class:`AuditLogAction` The action to filter with. Raises ------- Forbidden You are not allowed to fetch audit logs HTTPException An error occurred while fetching the audit logs. Yields -------- :class:`AuditLogEntry` The audit log entry. """ if user: user = user.id if action: action = action.value return AuditLogIterator(self, before=before, after=after, limit=limit, oldest_first=oldest_first, user_id=user, action_type=action) async def widget(self): """|coro| Returns the widget of the guild. .. note:: The guild must have the widget enabled to get this information. Raises ------- Forbidden The widget for this guild is disabled. HTTPException Retrieving the widget failed. Returns -------- :class:`Widget` The guild's widget. """ data = await self._state.http.get_widget(self.id) return Widget(state=self._state, data=data)
{ "content_hash": "917106bec7317ad5ce8b543e8b5fd9dc", "timestamp": "", "source": "github", "line_count": 1543, "max_line_length": 122, "avg_line_length": 34.78483473752431, "alnum_prop": 0.588508188474652, "repo_name": "gnmiller/craig-bot", "id": "3dd28533e1e2a3f35c19104ec49aead65811a7f5", "size": "53698", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "craig-bot/lib/python3.6/site-packages/discord/guild.py", "mode": "33188", "license": "mit", "language": [ { "name": "C", "bytes": "259967" }, { "name": "C++", "bytes": "670" }, { "name": "Python", "bytes": "5770206" } ], "symlink_target": "" }
from distutils.core import setup from catkin_pkg.python_setup import generate_distutils_setup # fetch values from package.xml setup_args = generate_distutils_setup( packages=['kobuki_noros'], package_dir={'': 'src'}, ) setup(**setup_args)
{ "content_hash": "862656ce313e6185ddf02a7cabe60129", "timestamp": "", "source": "github", "line_count": 10, "max_line_length": 60, "avg_line_length": 24.8, "alnum_prop": 0.7338709677419355, "repo_name": "git-afsantos/kobukium", "id": "76e9ccfaca39577394f2145cddf9608ed8c8646c", "size": "311", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "kobuki_noros/setup.py", "mode": "33188", "license": "mit", "language": [ { "name": "CMake", "bytes": "1720" }, { "name": "CSS", "bytes": "7238" }, { "name": "HTML", "bytes": "4945" }, { "name": "JavaScript", "bytes": "25204" }, { "name": "Python", "bytes": "54729" } ], "symlink_target": "" }
""" Created on Tir 29 Oct 2013. Uses the Crank Nicolson scheme to solve the time dependent Schrodinger equation for a center potential spike (delta potential). Animation is done using the matplotlib.pyplot library. Usage: python CrankNicolsonPotentialSpike.py or equivalent: ./CrankNicolsonPotentialSpike.py No commandline arguments are needed. Note that some of the probability "tunnels" through the barrier. @author Benedicte Emilie Braekken """ # Tools for sparse matrices import scipy.sparse as sparse import scipy.sparse.linalg # Numerical tools from numpy import * # Plotting library from matplotlib.pyplot import * """Physical constants""" _E0p = 938.27 # Rest energy for a proton [MeV] _hbarc = 0.1973 # [MeV pm] _c = 3.0e2 # Spees of light [pm / as] def Psi0( x ): ''' Initial state for a travelling gaussian wave packet. ''' x0 = -0.100 # [pm] a = 0.0050 # [pm] l = 200000.0 # [1 / pm] A = ( 1. / ( 2 * pi * a**2 ) )**0.25 K1 = exp( - ( x - x0 )**2 / ( 4. * a**2 ) ) K2 = exp( 1j * l * x ) return A * K1 * K2 def deltaPotential( x, height=75 ): """ A potential spike or delta potential in the center. @param height Defines the height of the barrier / spike. This should be chosen to be high "enough". """ # Declare new empty array with same length as x potential = zeros( len( x ) ) # Middle point has high potential potential[ 0.5*len(potential) ] = height return potential if __name__ == '__main__': nx = 1001 # Number of points in x direction dx = 0.001 # Distance between x points [pm] # Use zero as center, same amount of points each side a = - 0.5 * nx * dx b = 0.5 * nx * dx x = linspace( a, b, nx ) # Time parameters T = 0.005 # How long to run simulation [as] dt = 1e-5 # The time step [as] t = 0 time_steps = int( T / dt ) # Number of time steps # Constants - save time by calculating outside of loop k1 = - ( 1j * _hbarc * _c) / (2. * _E0p ) k2 = ( 1j * _c ) / _hbarc # Create the initial state Psi Psi = Psi0(x) # Create the matrix containing central differences. It it used to # approximate the second derivative. data = ones((3, nx)) data[1] = -2*data[1] diags = [-1,0,1] D2 = k1 / dx**2 * sparse.spdiags(data,diags,nx,nx) # Identity Matrix I = sparse.identity(nx) # Create the diagonal matrix containing the potential. V_data = deltaPotential(x) V_diags = [0] V = k2 * sparse.spdiags(V_data, V_diags, nx, nx) # Put mmatplotlib in interactive mode for animation ion() # Setup the figure before starting animation fig = figure() # Create window ax = fig.add_subplot(111) # Add axes line, = ax.plot( x, abs(Psi)**2, label='$|\Psi(x,t)|^2$' ) # Fetch the line object # Also draw a green line illustrating the potential ax.plot( x, V_data, label='$V(x)$' ) # Add other properties to the plot to make it elegant fig.suptitle("Solution of Schrodinger's equation with delta potential") # Title of plot ax.grid('on') # Square grid lines in plot ax.set_xlabel('$x$ [pm]') # X label of axes ax.set_ylabel('$|\Psi(x, t)|^2$ [1/pm] and $V(x)$ [MeV]') # Y label of axes ax.legend(loc='best') # Adds labels of the lines to the window draw() # Draws first window # Time loop while t < T: """ For each iteration: Solve the system of linear equations: (I - k/2*D2) u_new = (I + k/2*D2)*u_old """ # Set the elements of the equation A = (I - dt/2*(D2 + V)) b = (I + dt/2. * (D2 + V)) * Psi # Calculate the new Psi Psi = sparse.linalg.spsolve(A,b) # Update time t += dt # Plot this new state line.set_ydata( abs(Psi)**2 ) # Update the y values of the Psi line draw() # Update the plot # Turn off interactive mode ioff() # Add show so that windows do not automatically close show()
{ "content_hash": "edaec43ecb40c627d664c29ad898f951", "timestamp": "", "source": "github", "line_count": 143, "max_line_length": 91, "avg_line_length": 28.097902097902097, "alnum_prop": 0.6070184171229467, "repo_name": "ahye/FYS2140-Resources", "id": "cd5ef667fd1fb64aede0e8018d637b1c3916286b", "size": "4040", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "src/CrankNicolson/CrankNicolsonPotentialSpike.py", "mode": "33261", "license": "mit", "language": [ { "name": "Python", "bytes": "45359" } ], "symlink_target": "" }
try: from django.conf.urls import patterns, url except ImportError: from django.conf.urls.defaults import patterns, url from django.views.generic import TemplateView from django.core.urlresolvers import reverse from hyperadmin.apirequests import InternalAPIRequest import logging class Client(object): default_namespace = 'hyper-client' default_app_name = 'client' def __init__(self, api_endpoint, name=None, app_name=None): self.api_endpoint = api_endpoint self.name = name or self.default_namespace self.app_name = app_name or self.default_app_name def get_logger(self): return logging.getLogger(__name__) def get_urls(self): pass def urls(self): return self, self.app_name, self.name urls = property(urls) @property def urlpatterns(self): return self.get_urls() def reverse(self, name, *args, **kwargs): return reverse('%s:%s' % (self.name, name), args=args, kwargs=kwargs, current_app=self.app_name) class SimpleTemplateClientView(TemplateView): client = None def get_context_data(self, **kwargs): context = super(SimpleTemplateClientView, self).get_context_data(**kwargs) context.update(self.client.get_context_data()) return context class SimpleTemplateClient(Client): template_name = None template_view = SimpleTemplateClientView def get_media(self): pass #TODO def get_context_data(self): api_endpoint = self.api_endpoint api_request = InternalAPIRequest(site=api_endpoint) api_endpoint = api_endpoint.fork(api_request=api_request) api_url = api_endpoint.get_url() return {'media':self.get_media(), 'api_endpoint':api_url, 'client':self,} def get_urls(self): urlpatterns = patterns('', url(r'^$', self.template_view.as_view(template_name=self.template_name, client=self), name='index'), ) return urlpatterns
{ "content_hash": "0744db897278330d7ccf7e580691baa1", "timestamp": "", "source": "github", "line_count": 70, "max_line_length": 104, "avg_line_length": 29.785714285714285, "alnum_prop": 0.6345323741007194, "repo_name": "webcube/django-hyperadmin", "id": "66163af54b1896927aec80322b30839ed6597b2d", "size": "2085", "binary": false, "copies": "2", "ref": "refs/heads/master", "path": "hyperadmin/clients/common.py", "mode": "33188", "license": "bsd-3-clause", "language": [ { "name": "Python", "bytes": "291331" } ], "symlink_target": "" }
""" One of the most controversial issues in the US educational system is the efficacy of standardized tests, and whether they are unfair to certain groups. Given our prior knowledge about this topic, investigating the correlations between SAT scores and demographic factors might be an interesting angle to take. We could correlate SAT scores with factors like race, gender, income, and more. The NYC Open Data website has a plethora of data on NYC public schools, including SAT data. But the data of interest is spread over many different data sets. First we need to read in and clean multiple datasets and then merge them into a single useful dataset. """ import matplotlib.pyplot as plt import numpy as np import os import pandas as pd import re from mpl_toolkits.basemap import Basemap # Directory containing all of the datasets data_dir= "../data/schools" # All of the CSV-format datasets data_files = [ "ap_2010.csv", "class_size.csv", "demographics.csv", "graduation.csv", "hs_directory.csv", "sat_results.csv" ] # Dicitonary of Pandas DataFrames for all of the datasets data = {} # Read each of the files in the list data_files into a Pandas Dataframe using the read_csv function. # Add each of the Dataframes to the dictionary data, using the base of the filename as the key. for data_file in data_files: df = pd.read_csv(os.path.join(data_dir, data_file)) data[os.path.splitext(data_file)[0]] = df ## Reading in the Survey Data # Read in survey_all.txt all_survey = pd.read_csv(os.path.join(data_dir, 'survey_all.txt'), delimiter='\t', encoding='windows-1252') # Read in survey_d75.txt d75_survey = pd.read_csv(os.path.join(data_dir, 'survey_d75.txt'), delimiter='\t', encoding='windows-1252') # Combine the d75_survey and all_survey into a single DataFrame survey = pd.concat([d75_survey, all_survey], axis=0) ## Cleaning Up The Surveys # Copy the data from the dbn column of survey into a new column in survey called DBN survey['DBN'] = survey['dbn'] # List of relevant columns rel_cols = ["DBN", "rr_s", "rr_t", "rr_p", "N_s", "N_t", "N_p", "saf_p_11", "com_p_11", "eng_p_11", "aca_p_11", "saf_t_11", "com_t_11", "eng_t_11", "aca_t_11", "saf_s_11", "com_s_11", "eng_s_11", "aca_s_11", "saf_tot_11", "com_tot_11", "eng_tot_11", "aca_tot_11",] # Filter survey so it only contains the relevant columns we care about filtered_survey = survey[rel_cols] # Assign the Dataframe survey to the key survey in the dictionary data data['survey'] = filtered_survey ## Inserting DBN Fields # Copy the dbn column in hs_directory into a new column called DBN data['hs_directory']['DBN'] = data['hs_directory']['dbn'] def pad_two_digits(an_int): in_str = str(an_int) if len(in_str) == 1: return "0" + in_str return in_str # Create a new column called padded_csd in the class_size dataset data['class_size']['padded_csd'] = data['class_size']['CSD'].apply(pad_two_digits) # Use the + operator along with the padded_csd and SCHOOL_CODE columns of class_zie, then # assign the result ot the DBN column of class_size data['class_size']['DBN'] = data['class_size']['padded_csd'] + data['class_size']['SCHOOL CODE'] ## Combining The SAT Scores sat_results = data['sat_results'] # Convert the three SAT score columns from string data type to numeric datatype sat_results['SAT Math Avg. Score'] = pd.to_numeric(sat_results['SAT Math Avg. Score'], errors='coerce') sat_results['SAT Critical Reading Avg. Score'] = pd.to_numeric(sat_results['SAT Critical Reading Avg. Score'], errors='coerce') sat_results['SAT Writing Avg. Score'] = pd.to_numeric(sat_results['SAT Writing Avg. Score'], errors='coerce') # Create a column called sat_score that is the combined SAT score sat_results['sat_score'] = sat_results['SAT Math Avg. Score'] + sat_results['SAT Critical Reading Avg. Score'] + sat_results['SAT Writing Avg. Score'] ## Parsing Coordinates For Each School # Extracting the latitude def get_latitude(in_str): matches = re.findall("\(.+, .+\)", in_str) if len(matches) == 0: return None substr = matches[0] substr = substr.replace('(', '') substr = substr.replace(')', '') return substr.split(',')[0] # Use the apply method with above function to get latitude from Location 1 column data['hs_directory']['lat'] = data['hs_directory']['Location 1'].apply(get_latitude) # Extracting the longitude def get_longitude(in_str): matches = re.findall("\(.+, .+\)", in_str) if len(matches) == 0: return None substr = matches[0] substr = substr.replace('(', '') substr = substr.replace(')', '') return substr.split(',')[1] # Use the apply method with above function to get latitude from Location 1 column data['hs_directory']['lon'] = data['hs_directory']['Location 1'].apply(get_longitude) # Convert lat and lon columns to numeric data['hs_directory']['lat'] = pd.to_numeric(data['hs_directory']['lat'], errors='coerce') data['hs_directory']['lon'] = pd.to_numeric(data['hs_directory']['lon'], errors='coerce') ## The next step we will need to take is to condense some of the data we have # First we will need to make sure every value in the DBN column is unique ## Condensing Class Size # Create a new variable called class_size and assign the value of data['class_size'] class_size = data['class_size'] # Filter class_size so the 'GRADE ' column only contains the value 09-12 class_size = class_size[class_size['GRADE '] == '09-12'] # Filter class_size so that the 'PROGRAM TYPE' column only contains the value 'GEN ED' class_size = class_size[class_size['PROGRAM TYPE'] == 'GEN ED'] ## Computing Average Class Sizes # Find the avergae values for each column for each DBN in class_size class_size = class_size.groupby('DBN').agg(np.mean) # DBN is now the index. Reset the index, making DBN a column again class_size.reset_index(inplace=True) data['class_size'] = class_size ## Condensing Demographics # Filter demographics and only select rows where schoolyear is 20112012 data['demographics'] = data['demographics'][data['demographics']['schoolyear'] == 20112012] ## Condensing Graduation # Filter graduation and only select rows where the Cohort column equals 2006 data['graduation'] = data['graduation'][data['graduation']['Cohort'] == '2006'] # Filter graduation and only select rows where the Demographic column equals 'Total Cohort' data['graduation'] = data['graduation'][data['graduation']['Demographic'] == 'Total Cohort'] ## Converting AP Test Scores cols = ['AP Test Takers ', 'Total Exams Taken', 'Number of Exams with scores 3 4 or 5'] # Convert columns in ap_2010 to numeric values for col in cols: data['ap_2010'][col] = pd.to_numeric(data['ap_2010'][col], errors='coerce') ### Now it is finally time to start merging the disparate datasets ## Performing The Left Joins # Both the ap_2010 and the graduation datasets have many missing DBN values, so we'll use a left # join when we join the sat_results dataset with them. A left join means that our final Dataframe # will have all the same DBN values as the original sat_results Dataframe. # Merge sat_results, ap_2010, and graduation using left joins combined = data["sat_results"] combined = combined.merge(data['ap_2010'], how='left', on='DBN') combined = combined.merge(data['graduation'], how='left', on='DBN') ## Performing the Inner Joins # Now that we've done the left joins, we still have class_size, demographics, survey, and # hs_directory left to merge into combined. Because these files contain information that's more # valuable to our analysis, and because they have fewer missing DBN values, we'll use the inner join # type when merging these into combined. combined = combined.merge(data['class_size'], how='inner', on='DBN') combined = combined.merge(data['demographics'], how='inner', on='DBN') combined = combined.merge(data['survey'], how='inner', on='DBN') combined = combined.merge(data['hs_directory'], how='inner', on='DBN') ## Filling In Missing values # Since we did a number of left joins, we have a number of columns with missing data. There are many # ways to deal with this, one is to replace missing values with the column mean. # Some analyses can deal with missing values (plotitng), but other analyses cannot (correlation). # Compute the means of all the columns in combined means = combined.mean() # Fill in any missing values in combined iwth the column means combined = combined.fillna(means) # Fill in any remaining missing values in combined with 0 combined = combined.fillna(0) ### We've finished cleaning and combining our data! We now have a clean dataset on which we can base our analysis. ## Adding A School District Column # One type of analysis that we might want to do is mapping out statistics on a school district level. # In order to help us do this, it will be useful to add a column that specifies the school district to the dataset. # The school district is just the first two characters of the DBN. def first_2_chars(s): """ Extract the first 2 characters of a string and return them. @param s : str - input string @return str - first 2 characters in s """ return s[0:2] # Apply the function to the DBN column of combined, and assign result to a new column combined['school_dist'] = combined['DBN'].apply(first_2_chars) ### --------------- Analying Data # It is time to find correlations, make plots, and make maps. # The first step that we'll take is to find correlations between every column and sat_score. # This will help us figure out what columns might be interesting to investigate more or plot out. ## Finding correlations # Correlations tell us how closely related two columns are. We'll be using the r value, also called # Pearson's correlation coefficient, which measures how closely two sequences of numbers are correlated. # An r value falls between -1 and 1, and tells you if the two columns are positively correlated, not # correlated, or negatively correlated. The closer to 1 the r value is, the more strongly positively # correlated the columns are. The closer to -1 the r value is, the more strongly negatively correlated # the columns are. The closer to 0 the r value is, the less the columns are correlated. # In general r-values : # - above .25 or below -.25 are enough to qualify a correlation as interesting (potentially relevant) # - above .45 or below -.45 tend to be signficient correlations (usually relevant) # - above .65 or below -.65 tend to be strong correlations (almost always relevant) # Find all possible correlations in the "combined" DataFrame correlations = combined.corr() # Filter correltaions so that only correlations for the column "sat_score" are shown correlations = correlations['sat_score'] # Drop NaN values correlations = correlations.dropna() # Sort by correlation value correlations.sort(ascending=False, inplace=True) # Diplay all the rows in correlations with a correlation above 0.25 or below -0.25 print('Significant correlations with overall SAT score:') print(correlations[abs(correlations) > 0.25]) # Note the extremely high negative correlation (< -0.7) between SAT Scores and the percentage of # students receiving a free or reduced-cost lunch (frl_percent). The frl_percent is a direct measure # of the percentage of students living in (or near) poverty. ## Plotting Enrollment # Enable matplotlib interactive plt.ion() # Plot Total Enrollment vs SAT Score combined.plot.scatter(x='sat_score', y='total_enrollment') plt.show() ## Exploring Schools With Low SAT Scores And Enrollment # From looking at the plot we just generated, it doesn't appear that there's a Significant correlations # between SAT Score and total enrollment. However, there is an interesting cluster of points at the # bottom left where total_enrollment and sat_score are both low. # Filter the combined Dataframe, and only keep rows with low sat_score and total_enrollment low_enrollment = combined[combined['total_enrollment'] < 1000] low_enrollment = combined[combined['sat_score'] < 1000] # Display all the items in the School Name column of low enrollment print('\nLow Enrollment schools with Low SAT Scores') print(low_enrollment['School Name']) # All of these schools appear to be international schools intended for recent # immigrants from a foreign country who speak English as a second language. ## Plotting Language Learning Percentage # From our research in the last screen, we found that most of the high schools with low total # enrollment and low SAT scores are actually schools with a high percentage of English language # learners enrolled. This indicates that it's actually ell_percent that correlates strongly with # sat_score instead of total_enrollment combined.plot.scatter(x='sat_score', y='ell_percent') plt.show() ## Mapping the Schools # It looks like ell_percent correlates with sat_score more strongly, because the scatterplot is # more linear. However, there's still the cluster with very high ell_percent and low sat_score, # which is the same group of international high schools that we investigated earlier. # In order to explore this relationship, we'll want to map out ell_percent by school district, # so we can more easily see which parts of the city have a lot of English language learners. # Setup the Matplotlib Basemap centered on New York City plt.figure() m = Basemap(projection='merc', llcrnrlat=40.496044, urcrnrlat=40.915256, llcrnrlon=-74.255735, urcrnrlon=-73.700272, resolution='i') m.drawmapboundary(fill_color='#85A6D9') m.drawcoastlines(color='#6D5F47', linewidth=.4) m.drawrivers(color='#6D5F47', linewidth=.4) # Convert the lat and lon columns of combined to lists longitudes = combined['lon'].tolist() latitudes = combined['lat'].tolist() # Plot the locations m.scatter(longitudes, latitudes, s=20, zorder=2, latlon=True) plt.show() ## Plotting Out Statistics # Now that we can plot out the positions of the schools, we can start to display meaningful # information on maps, such as the percentage of English language learners by area. # # We can shade each point in the scatterplot by passing the keyword argument c into the scatter # method. The c keyword argument will accept a sequence of numbers, and will shade points # corresponding to lower numbers or higher numbers differently. # # Whatever sequence of numbers we pass into the c keyword argument will be converted to a range # from 0 to 1. These values will then be mapped onto a color map. plt.figure() m = Basemap(projection='merc', llcrnrlat=40.496044, urcrnrlat=40.915256, llcrnrlon=-74.255735, urcrnrlon=-73.700272, resolution='i') m.drawmapboundary(fill_color='#85A6D9') m.drawcoastlines(color='#6D5F47', linewidth=.4) m.drawrivers(color='#6D5F47', linewidth=.4) # Convert the lat and lon columns of combined to lists longitudes = combined['lon'].tolist() latitudes = combined['lat'].tolist() # Plot the locations m.scatter(longitudes, latitudes, s=20, zorder=2, latlon=True, c=combined['ell_percent'], cmap='summer') plt.show() ## Calculating District Level Statistics # Unfortunately, due to the number of schools, it's hard to interpret the map we made in the last # screen. It looks like uptown Manhattan and parts of Queens have a higher ell_percent, but we can't # be sure. One way to make it easier to read very granular statistics is to aggregate them. In this # case, we can aggregate based on district, which will enable us to plot ell_percent district by # district instead of school by school. # Find the average values for each column for each school_dist in combined districts = combined.groupby('school_dist').agg(np.mean) # Reset the index of districts, making school_dist a column again districts.reset_index(inplace=True) ## Plotting ell_percent by District # Now that we've taken the mean of all the columns, we can plot out ell_percent by district. Not # only did we find the mean of ell_percent, we also took the mean of the lon and lat columns, which # will give us the coordinates for the center of each district. # Setup the Matplotlib Basemap centered on New York City plt.figure() m = Basemap(projection='merc', llcrnrlat=40.496044, urcrnrlat=40.915256, llcrnrlon=-74.255735, urcrnrlon=-73.700272, resolution='i') m.drawmapboundary(fill_color='#85A6D9') m.drawcoastlines(color='#6D5F47', linewidth=.4) m.drawrivers(color='#6D5F47', linewidth=.4) # Convert the lat and lon columns of districts to lists longitudes = districts['lon'].tolist() latitudes = districts['lat'].tolist() # Plot the locations m.scatter(longitudes, latitudes, s=50, zorder=2, latlon=True, c=districts['ell_percent'], cmap='summer') plt.show()
{ "content_hash": "4e6c7398a3138831cb7cb58f584aecef", "timestamp": "", "source": "github", "line_count": 390, "max_line_length": 150, "avg_line_length": 43.225641025641025, "alnum_prop": 0.7295052793925733, "repo_name": "tleonhardt/CodingPlayground", "id": "04311252a6f9b0efcbb1f363596c9bfe7dec5b62", "size": "16880", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "dataquest/DataCleaning/cleaning_walkthrough.py", "mode": "33261", "license": "mit", "language": [ { "name": "C", "bytes": "30533" }, { "name": "C++", "bytes": "2514" }, { "name": "CMake", "bytes": "3607" }, { "name": "Cython", "bytes": "3972" }, { "name": "HTML", "bytes": "1700" }, { "name": "Jupyter Notebook", "bytes": "2056095" }, { "name": "Makefile", "bytes": "161" }, { "name": "Python", "bytes": "244507" }, { "name": "Ruby", "bytes": "296" }, { "name": "SWIG", "bytes": "1120" }, { "name": "Shell", "bytes": "893" } ], "symlink_target": "" }
""" Class for PXE bare-metal nodes. """ import datetime import os import jinja2 from oslo.config import cfg from nova.compute import flavors from nova import exception from nova.openstack.common.db import exception as db_exc from nova.openstack.common import fileutils from nova.openstack.common.gettextutils import _ from nova.openstack.common import log as logging from nova.openstack.common import loopingcall from nova.openstack.common import timeutils from nova.virt.baremetal import baremetal_states from nova.virt.baremetal import base from nova.virt.baremetal import db from nova.virt.baremetal import utils as bm_utils pxe_opts = [ cfg.StrOpt('deploy_kernel', help='Default kernel image ID used in deployment phase'), cfg.StrOpt('deploy_ramdisk', help='Default ramdisk image ID used in deployment phase'), cfg.StrOpt('net_config_template', default='$pybasedir/nova/virt/baremetal/' 'net-dhcp.ubuntu.template', help='Template file for injected network config'), cfg.StrOpt('pxe_append_params', default='nofb nomodeset vga=normal', help='additional append parameters for baremetal PXE boot'), cfg.StrOpt('pxe_config_template', default='$pybasedir/nova/virt/baremetal/pxe_config.template', help='Template file for PXE configuration'), cfg.BoolOpt('use_file_injection', help='If True, enable file injection for network info, ' 'files and admin password', default=True), cfg.IntOpt('pxe_deploy_timeout', help='Timeout for PXE deployments. Default: 0 (unlimited)', default=0), cfg.BoolOpt('pxe_network_config', help='If set, pass the network configuration details to the ' 'initramfs via cmdline.', default=False), cfg.StrOpt('pxe_bootfile_name', help='This gets passed to Neutron as the bootfile dhcp ' 'parameter when the dhcp_options_enabled is set.', default='pxelinux.0'), ] LOG = logging.getLogger(__name__) baremetal_group = cfg.OptGroup(name='baremetal', title='Baremetal Options') CONF = cfg.CONF CONF.register_group(baremetal_group) CONF.register_opts(pxe_opts, baremetal_group) CONF.import_opt('use_ipv6', 'nova.netconf') def build_pxe_network_config(network_info): interfaces = bm_utils.map_network_interfaces(network_info, CONF.use_ipv6) template = None if not CONF.use_ipv6: template = "ip=%(address)s::%(gateway)s:%(netmask)s::%(name)s:off" else: template = ("ip=[%(address_v6)s]::[%(gateway_v6)s]:" "[%(netmask_v6)s]::%(name)s:off") net_config = [template % iface for iface in interfaces] return ' '.join(net_config) def build_pxe_config(deployment_id, deployment_key, deployment_iscsi_iqn, deployment_aki_path, deployment_ari_path, aki_path, ari_path, network_info): """Build the PXE config file for a node This method builds the PXE boot configuration file for a node, given all the required parameters. The resulting file has both a "deploy" and "boot" label, which correspond to the two phases of booting. This may be extended later. """ LOG.debug(_("Building PXE config for deployment %s.") % deployment_id) network_config = None if network_info and CONF.baremetal.pxe_network_config: network_config = build_pxe_network_config(network_info) pxe_options = { 'deployment_id': deployment_id, 'deployment_key': deployment_key, 'deployment_iscsi_iqn': deployment_iscsi_iqn, 'deployment_aki_path': deployment_aki_path, 'deployment_ari_path': deployment_ari_path, 'aki_path': aki_path, 'ari_path': ari_path, 'pxe_append_params': CONF.baremetal.pxe_append_params, 'pxe_network_config': network_config, } tmpl_path, tmpl_file = os.path.split(CONF.baremetal.pxe_config_template) env = jinja2.Environment(loader=jinja2.FileSystemLoader(tmpl_path)) template = env.get_template(tmpl_file) return template.render({'pxe_options': pxe_options, 'ROOT': '${ROOT}'}) def build_network_config(network_info): interfaces = bm_utils.map_network_interfaces(network_info, CONF.use_ipv6) tmpl_path, tmpl_file = os.path.split(CONF.baremetal.net_config_template) env = jinja2.Environment(loader=jinja2.FileSystemLoader(tmpl_path)) template = env.get_template(tmpl_file) return template.render({'interfaces': interfaces, 'use_ipv6': CONF.use_ipv6}) def get_deploy_aki_id(flavor): return flavor.get('extra_specs', {}).\ get('baremetal:deploy_kernel_id', CONF.baremetal.deploy_kernel) def get_deploy_ari_id(flavor): return flavor.get('extra_specs', {}).\ get('baremetal:deploy_ramdisk_id', CONF.baremetal.deploy_ramdisk) def get_image_dir_path(instance): """Generate the dir for an instances disk.""" return os.path.join(CONF.instances_path, instance['name']) def get_image_file_path(instance): """Generate the full path for an instances disk.""" return os.path.join(CONF.instances_path, instance['name'], 'disk') def get_pxe_config_file_path(instance): """Generate the path for an instances PXE config file.""" return os.path.join(CONF.baremetal.tftp_root, instance['uuid'], 'config') def get_partition_sizes(instance): flavor = flavors.extract_flavor(instance) root_mb = flavor['root_gb'] * 1024 swap_mb = flavor['swap'] ephemeral_mb = flavor['ephemeral_gb'] * 1024 # NOTE(deva): For simpler code paths on the deployment side, # we always create a swap partition. If the flavor # does not specify any swap, we default to 1MB if swap_mb < 1: swap_mb = 1 return (root_mb, swap_mb, ephemeral_mb) def get_pxe_mac_path(mac): """Convert a MAC address into a PXE config file name.""" return os.path.join( CONF.baremetal.tftp_root, 'pxelinux.cfg', "01-" + mac.replace(":", "-").lower() ) def get_tftp_image_info(instance, flavor): """Generate the paths for tftp files for this instance Raises NovaException if - instance does not contain kernel_id or ramdisk_id - deploy_kernel_id or deploy_ramdisk_id can not be read from flavor['extra_specs'] and defaults are not set """ image_info = { 'kernel': [None, None], 'ramdisk': [None, None], 'deploy_kernel': [None, None], 'deploy_ramdisk': [None, None], } try: image_info['kernel'][0] = str(instance['kernel_id']) image_info['ramdisk'][0] = str(instance['ramdisk_id']) image_info['deploy_kernel'][0] = get_deploy_aki_id(flavor) image_info['deploy_ramdisk'][0] = get_deploy_ari_id(flavor) except KeyError: pass missing_labels = [] for label in image_info.keys(): (uuid, path) = image_info[label] if not uuid: missing_labels.append(label) else: image_info[label][1] = os.path.join(CONF.baremetal.tftp_root, instance['uuid'], label) if missing_labels: raise exception.NovaException(_( "Can not activate PXE bootloader. The following boot parameters " "were not passed to baremetal driver: %s") % missing_labels) return image_info class PXE(base.NodeDriver): """PXE bare metal driver.""" def __init__(self, virtapi): super(PXE, self).__init__(virtapi) def _collect_mac_addresses(self, context, node): macs = set() for nic in db.bm_interface_get_all_by_bm_node_id(context, node['id']): if nic['address']: macs.add(nic['address']) return sorted(macs) def _cache_tftp_images(self, context, instance, image_info): """Fetch the necessary kernels and ramdisks for the instance.""" fileutils.ensure_tree( os.path.join(CONF.baremetal.tftp_root, instance['uuid'])) LOG.debug(_("Fetching kernel and ramdisk for instance %s") % instance['name']) for label in image_info.keys(): (uuid, path) = image_info[label] bm_utils.cache_image( context=context, target=path, image_id=uuid, user_id=instance['user_id'], project_id=instance['project_id'], ) def _cache_image(self, context, instance, image_meta): """Fetch the instance's image from Glance This method pulls the relevant AMI and associated kernel and ramdisk, and the deploy kernel and ramdisk from Glance, and writes them to the appropriate places on local disk. Both sets of kernel and ramdisk are needed for PXE booting, so these are stored under CONF.baremetal.tftp_root. At present, the AMI is cached and certain files are injected. Debian/ubuntu-specific assumptions are made regarding the injected files. In a future revision, this functionality will be replaced by a more scalable and os-agnostic approach: the deployment ramdisk will fetch from Glance directly, and write its own last-mile configuration. """ fileutils.ensure_tree(get_image_dir_path(instance)) image_path = get_image_file_path(instance) LOG.debug(_("Fetching image %(ami)s for instance %(name)s") % {'ami': image_meta['id'], 'name': instance['name']}) bm_utils.cache_image(context=context, target=image_path, image_id=image_meta['id'], user_id=instance['user_id'], project_id=instance['project_id'] ) return [image_meta['id'], image_path] def _inject_into_image(self, context, node, instance, network_info, injected_files=None, admin_password=None): """Inject last-mile configuration into instances image Much of this method is a hack around DHCP and cloud-init not working together with baremetal provisioning yet. """ # NOTE(deva): We assume that if we're not using a kernel, # then the target partition is the first partition partition = None if not instance['kernel_id']: partition = "1" ssh_key = None if 'key_data' in instance and instance['key_data']: ssh_key = str(instance['key_data']) if injected_files is None: injected_files = [] else: # NOTE(deva): copy so we dont modify the original injected_files = list(injected_files) net_config = build_network_config(network_info) if instance['hostname']: injected_files.append(('/etc/hostname', instance['hostname'])) LOG.debug(_("Injecting files into image for instance %(name)s") % {'name': instance['name']}) bm_utils.inject_into_image( image=get_image_file_path(instance), key=ssh_key, net=net_config, metadata=instance['metadata'], admin_password=admin_password, files=injected_files, partition=partition, ) def cache_images(self, context, node, instance, admin_password, image_meta, injected_files, network_info): """Prepare all the images for this instance.""" flavor = self.virtapi.flavor_get(context, instance['instance_type_id']) tftp_image_info = get_tftp_image_info(instance, flavor) self._cache_tftp_images(context, instance, tftp_image_info) self._cache_image(context, instance, image_meta) if CONF.baremetal.use_file_injection: self._inject_into_image(context, node, instance, network_info, injected_files, admin_password) def destroy_images(self, context, node, instance): """Delete instance's image file.""" bm_utils.unlink_without_raise(get_image_file_path(instance)) bm_utils.rmtree_without_raise(get_image_dir_path(instance)) def dhcp_options_for_instance(self, instance): return [{'opt_name': 'bootfile-name', 'opt_value': CONF.baremetal.pxe_bootfile_name}, {'opt_name': 'server-ip-address', 'opt_value': CONF.my_ip}, {'opt_name': 'tftp-server', 'opt_value': CONF.my_ip} ] def activate_bootloader(self, context, node, instance, network_info): """Configure PXE boot loader for an instance Kernel and ramdisk images are downloaded by cache_tftp_images, and stored in /tftpboot/{uuid}/ This method writes the instances config file, and then creates symlinks for each MAC address in the instance. By default, the complete layout looks like this: /tftpboot/ ./{uuid}/ kernel ramdisk deploy_kernel deploy_ramdisk config ./pxelinux.cfg/ {mac} -> ../{uuid}/config """ flavor = self.virtapi.flavor_get(context, instance['instance_type_id']) image_info = get_tftp_image_info(instance, flavor) (root_mb, swap_mb, ephemeral_mb) = get_partition_sizes(instance) pxe_config_file_path = get_pxe_config_file_path(instance) image_file_path = get_image_file_path(instance) deployment_key = bm_utils.random_alnum(32) deployment_iscsi_iqn = "iqn-%s" % instance['uuid'] db.bm_node_update(context, node['id'], {'deploy_key': deployment_key, 'image_path': image_file_path, 'pxe_config_path': pxe_config_file_path, 'root_mb': root_mb, 'swap_mb': swap_mb, 'ephemeral_mb': ephemeral_mb}) pxe_config = build_pxe_config( node['id'], deployment_key, deployment_iscsi_iqn, image_info['deploy_kernel'][1], image_info['deploy_ramdisk'][1], image_info['kernel'][1], image_info['ramdisk'][1], network_info, ) bm_utils.write_to_file(pxe_config_file_path, pxe_config) macs = self._collect_mac_addresses(context, node) for mac in macs: mac_path = get_pxe_mac_path(mac) bm_utils.unlink_without_raise(mac_path) bm_utils.create_link_without_raise(pxe_config_file_path, mac_path) def deactivate_bootloader(self, context, node, instance): """Delete PXE bootloader images and config.""" try: db.bm_node_update(context, node['id'], {'deploy_key': None, 'image_path': None, 'pxe_config_path': None, 'root_mb': 0, 'swap_mb': 0}) except exception.NodeNotFound: pass # NOTE(danms): the flavor extra_specs do not need to be # present/correct at deactivate time, so pass something empty # to avoid an extra lookup flavor = dict(extra_specs={ 'baremetal:deploy_ramdisk_id': 'ignore', 'baremetal:deploy_kernel_id': 'ignore'}) try: image_info = get_tftp_image_info(instance, flavor) except exception.NovaException: pass else: for label in image_info.keys(): (uuid, path) = image_info[label] bm_utils.unlink_without_raise(path) bm_utils.unlink_without_raise(get_pxe_config_file_path(instance)) try: macs = self._collect_mac_addresses(context, node) except db_exc.DBError: pass else: for mac in macs: bm_utils.unlink_without_raise(get_pxe_mac_path(mac)) bm_utils.rmtree_without_raise( os.path.join(CONF.baremetal.tftp_root, instance['uuid'])) def activate_node(self, context, node, instance): """Wait for PXE deployment to complete.""" locals = {'error': '', 'started': False} def _wait_for_deploy(): """Called at an interval until the deployment completes.""" try: row = db.bm_node_get(context, node['id']) if instance['uuid'] != row.get('instance_uuid'): locals['error'] = _("Node associated with another instance" " while waiting for deploy of %s") raise loopingcall.LoopingCallDone() status = row.get('task_state') if (status == baremetal_states.DEPLOYING and locals['started'] == False): LOG.info(_("PXE deploy started for instance %s") % instance['uuid']) locals['started'] = True elif status in (baremetal_states.DEPLOYDONE, baremetal_states.ACTIVE): LOG.info(_("PXE deploy completed for instance %s") % instance['uuid']) raise loopingcall.LoopingCallDone() elif status == baremetal_states.DEPLOYFAIL: locals['error'] = _("PXE deploy failed for instance %s") except exception.NodeNotFound: locals['error'] = _("Baremetal node deleted while waiting " "for deployment of instance %s") if (CONF.baremetal.pxe_deploy_timeout and timeutils.utcnow() > expiration): locals['error'] = _("Timeout reached while waiting for " "PXE deploy of instance %s") if locals['error']: raise loopingcall.LoopingCallDone() expiration = timeutils.utcnow() + datetime.timedelta( seconds=CONF.baremetal.pxe_deploy_timeout) timer = loopingcall.FixedIntervalLoopingCall(_wait_for_deploy) timer.start(interval=1).wait() if locals['error']: raise exception.InstanceDeployFailure( locals['error'] % instance['uuid']) def deactivate_node(self, context, node, instance): pass
{ "content_hash": "7aa3f1fa42cd07135cfb7d9412e2ba45", "timestamp": "", "source": "github", "line_count": 482, "max_line_length": 79, "avg_line_length": 39.37344398340249, "alnum_prop": 0.5804615871008536, "repo_name": "sacharya/nova", "id": "8e0514167d81a4f3876a316b2f9db5e2bedc8829", "size": "19718", "binary": false, "copies": "1", "ref": "refs/heads/master", "path": "nova/virt/baremetal/pxe.py", "mode": "33188", "license": "apache-2.0", "language": [ { "name": "Python", "bytes": "13505239" }, { "name": "Shell", "bytes": "16239" } ], "symlink_target": "" }