question stringlengths 14 1.69M | answer stringlengths 1 40.5k | meat_tokens int64 1 8.18k |
|---|---|---|
Layout that places nodes using a tidy layout of a node-link tree diagram. This algorithm lays out a rooted tree such that each depth level of the tree is on a shared line. The orientation of the tree can be set such that the tree goes left-to-right (default), right-to-left, top-to-bottom, or bottom-to-top.
The algorithm<|fim_middle|> this layout.
public static const PARAMS:String = "nodeLinkTreeLayoutParams"
Property name for storing parameters for this layout. | used is that of Christoph Buchheim, Michael Jünger, and Sebastian Leipert from their research paper Improving Walker's Algorithm to Run in Linear Time, Graph Drawing 2002. This algorithm corrects performance issues in Walker's algorithm, which generalizes Reingold and Tilford's method for tidy drawings of trees to support trees with an arbitrary number of children at any given node.
The space between siblings in the tree.
The space between successive depth levels of the tree.
The orientation of the layout.
The space between different sub-trees.
Returns the visualization's axes as a CartesianAxes instance.
PARAMS : String = "nodeLinkTreeLayoutParams"
[static] Property name for storing parameters for | 145 |
Le moulin Smolenski à Sub<|fim_middle|> en Serbie
Monument culturel à Subotica
Subotica
Subotica | otica (en serbe cyrillique : ; en serbe latin : ) est situé à Subotica, dans la province de Voïvodine et dans le district de Bačka septentrionale, en Serbie. Il est inscrit sur la liste des monuments culturels protégés de la République de Serbie (identifiant SK 1829).
Le moulin a joué un rôle important au moment du développement économique de Subotica puis un rôle tragique lors de la Seconde Guerre mondiale en servant de camp de concentration pour les Juifs de la région.
Historique
Le bâtiment, constitué de trois étages, a d'abord été conçu sur les plans d'un architecte de Budapest pour un certain László Fürszt. Les archives de la ville ne conservent pas le nom des premiers propriétaires ; les premiers à être mentionnés sont Gábor Szmolenszky et Mihály Muity en 1906. Le moulin a ensuite été racheté par un certain Henrik Bíró de Budapest en 1909. Jusqu'en 1941, le moulin a continué à fonctionner, devenant le plus important de la ville et employant jusqu'à 70 travailleurs ; au moment de la guerre, le moulin était surnommé « Viktória ».
Selon le souvenir des anciens de Subotica, à la fin de la Seconde Guerre mondiale, les fascistes ont rassemblé dans ce lieu des familles juives venues de Srbobran, Kula, Vrbas, Crvenka et Bačka Topola ; elles y étaient maintenues sans pain, sans eau et dans des conditions inhumaines avant d'être envoyées à Bácsalmás et, au-delà, dans des camps d'extermination en Pologne et en Allemagne.
Après la guerre, les communistes ont continué à y garder des prisonniers.
Architecture
Le moulin est un des rares exemples de bâtiment à trois étages à Subotica au début du . La façade compte peu d'éléments décoratifs et l'ensemble marque une étape vers le mouvement moderne.
La façade est constituée de briques et de mortier, ce qui rappelle malgré tout beaucoup de constructions de la ville. Verticalement, elle est rythmée par des pilastres en briques jaunes et, horizontalement, par un soubassement et une corniche réalisés dans le même matériau.
Notes et références
Articles connexes
Histoire des Juifs en Serbie
Monuments culturels du district de Bačka septentrionale
Smolenski
Camp de concentration en Serbie
Monument culturel protégé | 621 |
Call Robert at (914)299-3690 or email now!
Interactive! Guitar, puppets, rhythm instruments, role-playing!
Robert's Music and Movement Party combines creative play and movement: often<|fim_middle|> "Yes" in one special place in the song, and "No" in another. Movement is introduced, as the children jump forward with "Yes" and backward with "No." The results are playful as the children advance, forcing Robert back, and then retreat, allowing Robert to recover.
Robert's musical game accomodates both a four-year-old and a toddler. Drawing from a vast repertoire, Robert's experience allows him effortlessly to entertain disparate ages. | marching, jumping or dancing. One song mixes a bedtime lullaby with a rock and roll jumping song. In another, the ants go marching into a spider and then must duck and hide.
Robert alternates sitting and standing, high energy and tranquility, music and comedy, singing and moving, well-tested original material and old favorites. His material masquerades as pure entertainment but is also aimed at teaching basic music competency, rhythmically and tonally.
One of the singing/movement pieces for slightly older children challenges them to be able to sing | 110 |
June 3, 2019, 6:16 a.m.
Microsoft & HoloLens
Microsoft is one of the biggest technology players, dabbling in software and hardware alike. The company was founded April 4th, 1975 by the two friends Bill Gates and Paul Allen in New Mexico, US. The inspiration was an article in Popular Electronics about microcomputer Altair 8000 – believing in the coming home computer revolution, the pair developed a programming language for the Altair –Microsoft BASIC. Microsoft's true breakthrough, however, came with the operating system Windows in 1984.
What's all that got to do with holo|one and Augmented Reality (or, as Microsoft prefers to call it, Mixed Reality)?
In 2015, Microsoft released their AR hardware - HoloLens, then described as 'the most advanced holographic computer the world has ever seen' – which isn't far from the truth. At the time of release, HoloLens was the first Augmented Reality device fully leveraging spatial computing technology (also drawing attention from organizations such as<|fim_middle|>D space. The headset is without a doubt one of the strongest on the market.
Now, 4 years later, Microsoft is moving further: in February, a new model was announced during the GSMA Mobile World Conference, formerly known as the Mobile World Congress - one of the world's largest exhibitions in the mobile sector.
The new device is called HoloLens 2 and it will likely be the most advanced AR headset on the market when it is released. A common belief in Silicon Valley is that the new era of computing will be worn on our faces - and giants such as Apple, Facebook and Huawei are racing to develop Augmented Reality glasses. Which would be small enough to be comfortable worn and still powerful enough to project digital images onto the real world.
We are eagerly waiting for the release of each new headset in order to try out their new capabilities and integrate our solution to their hardware. | NASA), which enabled users to truly experience holograms in 3 | 13 |
It has been a week since the TEDx event at Monroe Correctional Complex and I'm still glowing. I'm inspired by the many ways we have to support healing already and I'm<|fim_middle|> The two of them ended up in tears and their relationship healed. | hopeful that we can grow that support exponentially to embrace more of the prison system. One of the many highlights was a conversation between and inmate and officer in the green room as the three of us were waiting for our turn to speak. They were talking about inmate-staff relations. The officer talked about how he sees his job not just to contain, but to encourage. He talked about how he tried to get those in solitary to at least laugh once a day, because he wanted them to have that human connection that comes through humor. He told a story of how he was really hard on an inmate once, much more so than other inmates, and when that inmate was being released, he pulled him into an interview room and said he wanted to tell him why he had been so hard on him. The inmate's crime was similar to the one that had killed one of the officer's family members. The officer was encouraging the soon to be released inmate that he could do well one the outside, that he had a lot to give, that he could make it. | 212 |
There are 415 million people living with diabetes today, and rising. In fact, Singapore has the 2nd highest proportion of people with diabetes among all developed nations, according to the International Diabetes Federation. Even more worrying, 3 in 10 patients develop diabetes before the age of 40. This has led the Health Minister in Singapore to declare a 'war on diabetes' earlier this year.
This means that the traditional approach to healthcare isn't working well enough. Our hospitals are stretched to the seams, with longer waiting times to see a doctor. Patient care needs to be moved forward, focusing on prevention – before you have the disease or develop complications from it. And we need to bring patient care out of the hospitals or clinics, and into the community and homes.
Most healthcare organisations, such as the American Diabetes Association (ADA) and the Ministry of Health (Singapore), recognise that lifestyle management is the cornerstone for good diabetes management. Unfortunately, due to operational challenges, it is often difficult to engage people in positive lifestyle changes, which requite constant engagement and support.
And for the individual person living with diabetes, it is a difficult and often lonely journey. Diabetes is a disease that is with you 24 hours a day, 7 days a week. And yet, a typical patient with diabetes spends less than 1% of that time with a medical professional at the clinic or hospital. The rest of that time is spent on self-management at home, at work, often with no one reliable to turn to for advice or help.
One of the most common questions from someone worried about diabetes is "What food can I eat?". Our food intake, particularly carbohydrates, is the most important contributor to our blood glucose levels, and even our risk of diabetes (a recent study published by Harvard School of Public Health showed that eating white rice regularly may raise your diabetes risk). Yet only a minority of people have a good understanding of the relationship between our food and our bodies. In my personal experience, many people with diabetes have not had the chance to visit a dietitian or diabetes nurse educator to get professional advice. There is a general lack of public awareness on nutrition, which needs to be addressed.
And to make matters worse: if you attempt to do an online search on Google for this information (eg 'best diet for diabetes'), you will come across a variety of conflicting information – some which are credible, some misleading, and some plainly trying to push unproven herbal supplements. It's easy to be confused and overwhelmed.
So, what are some ways you can prevent diabetes, or manage it better?
Participate in a lifestyle program. The Diabetes Prevention Program Trial in the United States showed that lifestyle interventions, focused on diet, exercise and weight loss, can reduce your risk of developing diabetes by more than half. And for people with diabetes, another large study shows that it can help you to improve your glucose control and reduce your<|fim_middle|> coaching with mobile technology – to help you develop healthier habits for a better life.
GlycoLeap is a smart coach that lets you worry less about diabetes. It combines expert human coaching with mobile technology – to help people with type 2 diabetes, or who want to reduce their risk of diabetes, develop healthier habits for a better life. Here's a video introduction to GlycoLeap.
How it works: You take photos of your meals using the mobile app. Through the mobile app, you can chat with a real-life health coach who will rate your meals and provide daily feedback and support. This promotes accountability and helps you to develop good, sustainable eating habits over time. The coaches are accredited dietitians with years of clinical experience in the hospitals.
There are also weekly interactive lessons that provide practical tips on nutrition, exercise, monitoring, medications and stress management.
Does this new approach work? We have a list of stories from people who've shared with us how they've managed to improve their glucose levels, achieve a healthier weight, and love what we're doing.
Holmusk is a digital health and data analytics company that developed GlycoLeap. | risk of long-term complications. An example of this is the diabetes prevention and lifestyle programs run by the SGH LIFE Center in Singapore.
Visit a dietitian. We think we're experts at food, but we're really not! Dietitians have years of education and experience in this field, and can help you to understand your food habits and how to make the right changes to stay healthy. There are dietitians at most polyclinics and hospitals, and your doctor can refer you to see one. Alternatively, you can also make an appointment for a consultation with a private dietitian. Here is a list of dietitians accredited by the Singapore Nutrition and Dietetics Association.
Use GlycoLeap. If you're busy and don't have time to participate in a face-to-face lifestyle program or visit a dietitian in person, you can consider this simple and convenient alternative. GlycoLeap is a smart coach that lets you worry less about diabetes. It combines expert human | 197 |
ANSI Launches Pilot Program for Certification Bodies Seeking Accreditation to BRC Global Standard for Consumer Products Issue 4
Accepting Applications from October 6 through October 20, 2017
The American National Standards Institute (ANSI), coordinator of the U.S. voluntary standardization system, has launched a Pilot Accreditation Program for certification bodies seeking accreditation to BRC Global Standard for Consumer Products Issue 4. ANSI is accepting applications for the program until Friday, October 20, 2017.
BRC Global Standards, a brand- and consumer-protection organization, published the new BRC Global Standards for Consumer Products (Personal Care and Household and General Merchandising) on November 1, 2016. The revised version of the Consumer Products Standard Issue 4 contains two parts that specifically focus on general merchandising and personal care and household items. The introduction of two levels ?Foundation Level and Higher Level? was to allow simpler entry to the standard and encourage continuous improvement and to align with the different expectations of customers. Additional changes have been made to the protocol regarding exclusions and the removal of surveillance audits.
As a signatory to the International Accreditation Forum (IAF) Multilateral Recognition Arrangement (MLA), ANSI is recognized by BRC as an accreditation body that accredits certification bodies (CBs) to BRC Global Standard for Consumer Products Issue 4.
Potential applicants seeking to be part of the ANSI BRC Global Standard for Consumer Products Pilot Program must first seek BRC approval by demonstrating, through qualifications and work experience, that the currently BRC<|fim_middle|>000 companies and organizations and 3.5 million professionals worldwide.
The Institute is the official U.S. representative to the International Organization for Standardization (ISO) and, via the U.S. National Committee, the International Electrotechnical Commission (IEC).
For more on ANSI accreditation, visit www.ansiaccreditation.org.
ANSI Organization
ANSI Launches Pilot Accreditation Program for EPA Title VI Formaldehyde Emissions Certification Program for Wood Composite Products
Update: ANSI Releases Reference Translation of China Standardization Law | -recognized CB meets the personnel criteria specified for each component.
Upon receipt of such BRC approval of the qualifications/work experience of the CB body and auditors, ANSI will do the following:
1. Verify that the ANSI-accredited certification body has a valid agreement with BRC that covers the applicable components.
2. Use the following criteria to assess the CB:
- ISO/IEC 17065:2012, Conformity assessment - Requirements for bodies certifying products, processes, and services
- BRC 004: Requirements for Certification Bodies Offering Certification Against the Criteria of the BRC Global Standards
- BRC Global Standard for Consumer Products Issue 4
- Applicable ANSI requirements
To obtain an application for the new Pilot Accreditation Program, please contact Reinaldo Figueiredo (rfigueir@ansi.org; 202.331.3611), ANSI senior program director for product and process accreditation, or Elizabeth Okutuga (EOkutuga@ansi.org; 202.331.3627), program coordinator for ANSI's product certification accreditation program.
About ANSI
The American National Standards Institute (ANSI) is a private non-profit organization whose mission is to enhance U.S. global competitiveness and the American quality of life by promoting, facilitating, and safeguarding the integrity of the voluntary standardization and conformity assessment system. Its membership is comprised of businesses, professional societies and trade associations, standards developers, government agencies, and consumer and labor organizations. The Institute represents the diverse interests of more than 125, | 333 |
Need something custom for your Business or Racing Team? Need vehicle wrap, race car wrap, trailer wrap, banner & signs or something else? we got you covered. We can design any custom wrap graphics you need, plus vehicle vinyl wrap graphics. Just contact us and we will see what we can do for you.
Racing is in our Blood and that is what makes out designs more exciting & eye catching. Lets Design the exact graphics you need for your Business or Race Car. We have have designed many graphics layouts for Late Models, sprints, mini sprints, bombers, quarter midgets, and many more. Our custom race car wraps are made of air-release adhesive backed vinyl laminated in gloss. For a perfect finish we can install it for you.
Whether we are designing, printing, or installing vinyl graphics or wraps, our company is committed to providing excellent service, quality & professionalism. With over a decade of experience in vehicle wrap design and installation, our team will prove they are worth every penny by showing the meticulous attention to detail that sets us apart from other wrap companies.
We specialize in<|fim_middle|> your brand, products and services.
We offer all types of signs for any important occasion including events, sports, business, real-estate, and holiday.
We offer all types of banners for any important occasion including events, sports, business, real-estate, and holiday.
We have 2 Roland solvent inkjet printers to offer lightning-fast turnaround on most print jobs of any scale. | designing & installing race car, trailer and vehicle wraps that result in custom, rolling pieces of artwork.
Set your storefront apart from the rest with the use of full color exterior graphics. Our durable, weather-resistant films can be applied to windows or smooth surfaces.
We design eye-popping graphics that sets the ideal memorable image of | 64 |
Home Columns Is There a Future for Democracy in America?
The Latest in News & Opinion
Is There a Future for Democracy in America?
There is a sense of despondency on the American left that is increasingly visible. The calls for the removal of President Trump no longer dominate their discourse. It conveys despair and resignation. The dominant theme today is the lament for what the left sees as the demise of American democracy.
Left-wing politicians, mainstream media pundits, journalists, and all types of progressive sympathizers invariably complain about the rising tyranny of minority led by President Trump and the Republicans. Their mood is decidedly apocalyptic. Thomas Friedman, of the NYTimes, characteristically entitled his article "Will 2020's Elections be the End of Our Democracy?" Thomas Edsall, Friedman's colleague, makes in his article "I Fear that We Are Witnessing the End of American Democracy" an unapologetically pessimistic prediction about prospects for democracy in the United States.
The death of the Supreme Court justice Ruth Bader Ginsburg and President Trump's decision to fill in the vacancy her death has created before the election have driven the imagination of the left-wingers to cataclysmic proportions. Democratic senators accuse the Republicans on the Senate of nothing less than trying to establish the Republican dictatorship. A piece in the The Guardian intones in unison "our democracy is deeply imperiled"—all on the occasion of the president executing his legal responsibility. Democratic senators led by the Senate minority leader Chuck Schumer have rallied in their unanimous refusal to meet with President Trump's Supreme Court nominee Amy Coney Barrett.
The apocalyptic prophecies about the end of democracy are very broad. They do not provide any details as to what specifically is under threat.
Our political system has two major components. They are the structure of our government and our political practice. The structure<|fim_middle|> demise of the Democratic Party mean the end of democracy in America. The article tries to answer this question positively.
Christian Gains October 6, 2020 At 11:04 am
Gennady, you know PERFECTLY WELL what TRUE patriots think about "DEM-ocracy"…But your explanation above is encouraging the ignorant to THINK that's what you're pushing…be MORE CLEAR in you details PLEASE…(for the SAKE of the IGNORANT)!!!…& God Bless you brother!!!
oldarmyblog October 6, 2020 At 10:25 am
The problem is that we have too many people voting. People who are wards of the state should be allowed to vote. I am always in favor of raising your taxes and increasing my benefits every day of the week. The voting age needs to go back to 21 for starters.
Gennady Shkliarevsky October 6, 2020 At 10:31 am
You may or may not be right. I am a poor judge on this. However, I think that the problem is not how many people vote. The problem is that our political practice is elitist. It excludes and disempowers common Americans. That's what motivated many Americans to support Donald Trump.
LET'S HOPE NO DEMOCRACY…ONLY REPUBLIC!!!
Do you prefer to be excluded from the process of political decision-making?
Republic is about the structure of our political institutions. Democracy refers to the practice of political decision-making. If we change our elitist political practice, this change will not affect our republican institutions. Try to see the difference.
I want to make one clarification for the sake of the patriots who are opposed to the Democratic Party. The Democratic Party is a master of confusion. It has appropriated many good words like equality, freedom, democracy, etc. Democrats have designed their newspeak to confuse common citizents and force them to accept their interpretation of these words. We should not let them hijack our language. The patriots support Trump precisely because they want to be included, not excluded, and participate as equals in the process of political decision-making. That's what Trump is all about. There is no reason to surrender all these good words–such as democracy, inclusion, empowerment, freedom, etc.–to the Democrats. They are perfectly good words. We should use our own interpretation of these words. Don't surrender democracy to the Democrats. That's what they want. | of the American government consists of its institutions. Even a cursory analysis shows that whatever else may be going on in the country, there is no threat to our political institutions. Nobody puts forward demands that these institutions should be abolished. So, arguments about the threat to American democracy can only relate to the political practice.
A two-party system is the core of the political practice in America. This practice that has been in use for much of American history indeed appears to be coming to an end due to the demise of the two-party system. However, this demise is not due to some hostile actions. Neither the President, nor the Republican or the Democratic Party is making any deliberate and hostile moves against it; if anything, they all desperately try to preserve it. The demise of the two-party system seems to be happening by default, as a result of the self-destructive policies of the Democratic Party. The fact is that the Democratic Party is rapidly losing its viability as a political organization. It lacks leadership, has no new ideas, and offers no workable solutions for the current problems that America faces; its policies are chaotic and contradictory. One cannot take seriously its proposed course to turn America into a socialist country, or its delusional Green New Deal, or its support for cancel culture and anarchist groups like BLM and Antifa.
But does the demise of the Democratic Party and the two-party system mean that democracy has no future in America?
The fundamental feature of a true Democracy is universal inclusion and empowerment. There is not much that the left and the right agree on, but both contend that exclusion and disempowerment is endemic to American politics; and where there is exclusion, democracy is in peril. Since the current two-party system allows exclusion and disempowerment, it is obvious that a two-party system is not an essential condition for democratic rule. Therefore the decline of the two-party system does not necessarily mean the demise of democracy and we can, indeed must, look to other new forms of political practice that will be conducive to universal inclusion and empowerment.
The principal features of such new practice should follow from the very definition of democracy as universal inclusion and empowerment. Universal means by definition that all must be included and empowered. Therefore, all people must be recognized as equals and have equal access to the process of political decision-making.
The condition of universal inclusion and empowerment exists in networks. Networks do not permit exclusion. All members of a network are equal; they all participate in interactions with each other. Nobody is in a position to exclude anyone from participating in these interactions. It is simply impossible.
In the course of interactions all individuals have to treat each other as equals, since none of them has a preferential position in the network. These interactions have to involve inclusion since no participant in the network has the power to exclude another member. They have to recognize each other's autonomy and agency. Inclusion is the characteristic and necessary feature of such interactions. No individual in the network can achieve dominance over others; they all have to embrace and combine each other's views and opinions since there is no way they can exclude them from the common pool. They have no other choice but to combine their differences. As a result of the inclusion and combination of differences, network interactions create new and increasingly more powerful levels of organization since they include all differences, all possible points of view and opinions.
A new and more powerful level of organization means hierarchy. Thus the interactions of equals create hierarchies. These hierarchies must be preserved in order to conserve what networks create. Therefore, hierarchies are important for preserving the creative output of networks. Both hierarchical and non-hierarchical interactions are essential for conserving social systems and advancing their evolution, but they can only achieve this result if thay are in balance.
In social systems that exist today the two types of interactions are not in balance. As a result, one type or the other usually dominates. The domination of non-hierarchical interactions prevents networks from conserving they create. The distinct feature of hierarchical interactions is subordination, not equality. For this reason, hierarchical interactions are incapable of creating anything new since they are not conducive to the inclusion of differences. Hierarchical and non-hierarchical interactions should be in balance: one type of interactions creates and another preserves what has been created. This balance is the principal condition for a democratic practice. Such practice involves inclusion and empowerment; it is capable of creating new and increasingly more powerful levels of organization; and it can conserve its creation. Such democratic practice–and not two-, three-, or multi-party systems—is the essential condition for democracy. That is the critical condition for the existence of democracy.
The current two-party system increasingly appears to be beyond repair. If we want democracy to have a future in America, we have to implement a new practice that will create conditions for democratic rule. We must open a broad discussion of the specific forms that embody such practice and ways to make these forms functional. We also have to think how new developments and particularly new information and communication technologies can help us realize the new practice. Such democratic rule will preserve our republican institutions and at the same time create real possibilities for universal inclusion and empowerment.
The Democratic Party and progressivism represent a venerable aspect of American culture: our insatiable desire to move forward and progress. Unfortunately, the Democratic Party has chosen an elitist approach toward achieving progress. This approach is exclusive and disempowering. Leaders of the Democratic Party do not understand that real progress can only be achieved through inclusion and empowerment. The approach chosen by the Democratic Party has transformed the party itself. Its leadership has become increasingly isolated from its own rank-and-file. This closed and self-perpetuating group cannot generate new ideas and approaches that are necessary for solving today's problems.
This article does not call for the dismantling of the Democratic Party or the elimination of the two-party system. It simply recognizes what appears to be an inescapable fact—the inevitable demise of the Democratic Party—and it emphasizes the need to prepare for this contingency. The Democratic Party is becoming increasingly fragmented; its policies are incoherent and its leadership is in paralysis. Will the Democratic Party be able to overcome its internal crisis and remain an important factor in American political practice? The answer to this question can only come from the Democratic Party itself. The important problem for the rest of us is to make sure that we preserve and continue to develop our democracy. Our Constitution, our republic, and its institutions are integral parts of our democracy. The survival of our democracy is too important to depend on the survival of any political party or political leader. It is our common cause—the cause of the American people.
Gennady Shkliarevsky is a Professor Emeritus at Bard College, New York.
PowerInbox
Previous articleCBS correspondent says he feels safer in North Korea
Next articleUnhinged Chris Wallace attacks Trump campaign advisor
BMH October 5, 2020 At 6:50 pm
The USA, has not, nor has it ever been, a 'Democracy'!!
It's a REPUBLIC. (A 'Representative Republic') …
There is a HUGE difference. (Note that not once in The Constitution do you find the word 'Democracy'…)
Do your homework again and come back later.
Eric the Constitutionalist October 5, 2020 At 8:06 pm
but suffrage is essential,right?
lose it and you'll lose every other rights
Gennady Shkliarevsky October 5, 2020 At 9:58 pm
You are absolutely correct. America is a republic and our institutions are republican institutions. My article is about practice, not institutions. Our practice is elitist and that is what we have to change. Our practice should include and empowerment everyone and such practice is democratic. This is not about our institutions. It is about what our parties do.
Flotmorton P Gildersleeve October 5, 2020 At 6:53 pm
It is not Democracy that the left is agitating for it is communism that the professional agitators that George Soros has bought and paid for that these thugs & goons are pushing for.
Friedman & Edsall are just a couple of communist propagandists and no one reads the New York Times who has his.her own brain & uses it.
NYT and Guardian are left winged trash, great for back up toilet paper.
Jonathan Karl is a left winged puke, he is not someone whom we respect who is a straight shooter.
IT WAS CHINA JOE BIDEN WHO CRITICIZED PRES TRUMP FOR CUTTING OFF TRAVEL FROM CHINA AT THE BEGINNING OF TH COVID CRISIS
DR. JYA, THIS MAY BE THE BEGINNING OF AN INVESTIGATION OF SOMEONE TRYING TO KILL/ASSASINATE THE PRESIDENT OF THE UNITED STATES.
PELOSI IS FROTHING AT THE LIPS TO GAIN THE PRESIDENCY. WHO DOES SHE THINK SHE IS KIDDING?? GOD HELP US IF THIS WITCH EVER GETS CLOSE TO THE WHITE HOUSE.
BYE BYE DEMOCRACY SHE HAS ALREADY BEEN A BIG PART IN THE DESTRUCTION OF THE FBI WHICH WILL never, ever REGAIN THE RESPECT OF THE AMERICAN PUBLIC
"WEARING A MASK IS NOT ENOUGH, DR JYAD????" Aha, you mean he cannbot attend the debates? you goon…………..
Weimar Wheelbarrow October 5, 2020 At 7:40 pm
Igor Panarin predicted a Balkanization break up 22 years ago.
Will it be a peaceful divorce?
Democracy doesn't work with no border, special interest groups clamoring for a larger piece of the redistribution pie with equal rights plus, and mass immigration of people who will never assimilate or contribute.
It may sound racist but it can probably only work in a monoethnic society.
Gennady Shkliarevsky October 5, 2020 At 10:04 pm
I think America will survive this crisis and will be even stronger, no matter what anyone says. Americans are very independent and have plenty of common sense. We will survive.
Tim Shep October 6, 2020 At 6:33 am
I agree we will survive. However the democrats want it their way or no way. It's time for term limits and time to drain the swamp , which Trump is attempting to do. These politicians are getting to complacent and getting rich off the American people,
Gennady Shkliarevsky October 6, 2020 At 9:04 am
You are absolutely correct. The Democratic Party seems to be on a suicide mission. Its policies are incoherent and contradictory and its leadership is in paralysis. The quesstion is, should the | 2,234 |
Coach Lewis: "We will have our hands full."
It was surprising to learn of HB Tra Carson's injury. Did he go down in<|fim_middle|> you felt the need to be a psychologist as well as a football coach?
Are you happy that K Randy Bullock is going to be here for a while, after signing a contract extension yesterday?
When you look across the league, other teams are having kicking issues. Is his consistency exactly what you're looking for?
Is it too much to ask for HB Thomas Rawls to be ready to go in five days?
You said last Friday that you made an adult decision with LB Preston Brown by not having him play. Is that kind of the same concept going forward with HB Joe Mixon?
Both have the mindset of playing sooner rather than later. Do you have to pull the brakes on them a little bit?
Do you have to remind guys like that of the importance of being honest with you about how they are feeling?
You haven't talked about DE Michael Johnson. Where is he right now in his recovery process?
Would you rather coach a team of selfless guys who aren't as talented, or coach a team of selfish guys who are talented? | practice on Monday?
Was it a hamstring issue or something more serious?
In this situation, why would you waive him after the injury instead of placing him on Reserve/Injured?
So it's more of an injury settlement?
What impresses you the most about Cam Newton?
How many headed monsters is Luke Kuechly?
With C Billy Price probably being out for a while, who will back up Trey Hopkins at center?
Will we see G Clint Boling move around the offensive line again?
You guys are off to a positive 2-0 start. As a coach, your job is to critique and praise at the same time. What more are you looking for out of your guys?
You've had multiple instances in the first two games of 'next man up.' That's life in the NFL, and it happens everywhere. How pleased are you with the guys who have been the next men up?
Speaking of the next guy up, HB Mark Walton is someone who you have relied on a little bit more. What have you seen from him?
How similar are Mark and HB Giovani Bernard?
Speaking of Georgia guys, who talks less, DE Jordan Willis or DT Geno Atkins?
The two position groups you wanted to revamp — offensive line and safety — have given you good production these first two games, haven't they?
Gio has been here for so long that it feels old to have to ask about him. Does his reliability impress you the most about him? What is it about him that you guys love so much?
Bengals offensive coordinator Bill Lazor called him a warrior and thinks how he runs in between the tackles is underrated, because people focus more on his versatility than what he does in other areas. Do you view it that way as well?
How important is it as the head coach to be able to manage egos in the locker room?
What happens when it doesn't work out that way?
Do you feel like you have a guy like that in almost every position group?
How often over the years have | 411 |
The254Hub
Tech + Style = Life
Samsung Launches 4K Ultra Short Throw Laser Projector: The Premiere
Posted on September 4, 2020 September 2, 2020 by Kimani Chege
Samsung Electronics announced its all new 4K Ultra Short Throw laser projector, The Premiere, at its virtual press conference event "Life Unstoppable" on September 2nd. The new 4K laser projector provides a big picture cinematic experience in the comfort of one's home. The Premiere is the new anchor product in the award-wining Lifestyle product portfolio that now transcends the display experience – without the display.
Samsung will begin to rollout The Premiere globally starting from the US, Europe, Korea, and other regions later this year.
The Premiere will be available up to 130- and 120-inch models – LSP9T and LSP7T respectively – that support a laser powered<|fim_middle|> LG
How to enjoy unlimited entertainment options with LG's NanoCell TV
All you need to know about the Galaxy Buds Pro
Betty, HBO's critically-acclaimed female skater comedy, is now on Showmax
The Real Housewives of Durban, the second South African instalment, is coming first and exclusive to Showmax
Recent Posts: BizWatchKenya
Angry reactions as Uhuru, Sonko battle rages
Moet & Chandon ink partnership with premier restaurant Oysters & More
The Real Housewives of Durban, the second South African installment to air exclusively on Showmax
Kalonzo comes out guns blazing, accuses DP Ruto of wanton corruption
Sarova introduces two brands to its portfolio as it diversifies into standalone restaurants | 4K picture resolution. The Premiere LSP9T is the world's first HDR10+ certified projector with triple laser technology and delivers revolutionary contrast details as the user watches from bright to dark scenes with a peak brightness of up to 2,800 ANSI lumens. The Premiere also supports Filmmaker Mode for the first of its kind as a projector allowing users to enjoy watching movies as director intended. The smart projector comes equipped with Samsung's Smart TV platform and experience full of streaming video apps from major content partners and mobile connectivity features such as Tap View and mirroring.
The Premiere comes in an all-in-one compact, space-saving design that blends into a variety of living room settings and arrangements. As it is an ultra-short-throw projector, The Premiere can be placed just in front of the wall. It is designed for an easy-to-install set up and sports fabric finishes around its edges to harmonize different environments. The Premiere has powerful built-in woofers and Acoustic Beam surround sound, providing one of the best cinema experiences of projectors on the market today and reduces the need for additional bigger sound equipment in tighter spaces.
"Over the past few months, we have seen how consumers are spending more time at home and how the role of everyday life continues to change. TV has become the center of entertainment, a fitness partner, a co-worker and a source for news," said Jongsuk Chu, Executive Vice President of Visual Display Business at Samsung Electronics. "The Premiere re-imagines the home cinema experience with an all-new, compact design, 4K picture quality and big sound for tight spaces that can be used for any at-home activity and living room arrangements."
Samsung first launched its Lifestyle product portfolio with The Serif in 2016 and has since expanded it to the award-winning TV line-up of The Frame, The Sero and The Terrace. By enhancing elements that speak to the consumer passion points for art, interior designs and the mobile experience, Samsung's Lifestyle product line-up functions have evolved to become a central hub for a wide array of lifestyles.
Posted in Lifestyle, TechnologyTagged Samsung Electronics, The Premiere
DJ Pierra Makena brings trouble with her new role in the drama series Kina
All you need to know about the Galaxy Z Fold2
Follow The254Hub on WordPress.com
A review of the AI DD washing machine from | 486 |
Encyclopedias almanacs transcripts and maps
Body piercing is the practice of inserting jewelry (usually metal, though wood, glass, bone, or ivory, and certain plastics are used as well) completely through a hole in the body. Piercing is often combined with other forms of body art, such as tattooing or branding, and many studios offer more than one of these services. While virtually any part of the body can be, and has been, pierced and bejeweled (for evidence, see the well-known Web site http://www.bmezine.com) widely pierced sites include ear, eyebrow, nose, lip, tongue, nipple, navel, and genitals.
Much of what popularly passes for the history of body piercing is in fact fictitious. In the 1970s, the Los Angeles resident Doug Malloy, an eccentric and wealthy proponent of piercing, set forth with charismatic authority a set of historical references connecting contemporary Western body piercing to numerous ancient practices. He declared, for example, that ancient Egyptian royalty pierced their navels (consequently valuing deep navels), Roman soldiers hung their capes from rings through their nipples, the hafada (a piercing through the skin of the scrotum) was a puberty rite brought back from the Middle East by French legionnaires, and that the guiche (a male piercing of the perineum) was a Tahitian puberty rite performed by respected transvestite priests. No anthropological accounts bear out these claims.
What facts can be sorted from the fiction nonetheless attest to the remarkable antiquity of piercing. The oldest fully preserved human being found, the 5,300-year-old "ice-man" of the Alps, shows evidence of ear-lobe piercing. Like many with a serious interest in piercing in the twenty-first century, the ice-man has stretched his lobes, in his case to a diameter of about seven millimeters. Artifacts as well as bodies offer evidence of ancient single and multiple ear piercings from as early as the ninth century b.c.e.
While Malloy's claims are largely imaginative, there are geographically diverse cultures in which piercing has been continually practiced for quite some time. Ear and nose piercing seem to be, and seem to have been, the most popular; indeed, there are far too many examples to list here, and the following instances should be taken as representative rather than anything close to exhaustive. Many Native American peoples practiced ear or nose—generally septum—piercing (the latter most famously among the Nez Percé of the American Northwest). Multiple ear piercing was practiced by both men and women in the ancient Middle East, and a mummy believed to be that of Queen Nefertiti of Egypt, sports two piercings in each ear. The Maoris of New Zealand, though better known for their intricate and elegant tattoo designs, have also long practiced ear piercing, which along with nose piercing is widespread among native peoples of both New Zealand and Australia. Ear piercing for girls forms part of traditional rites in Thai and Polynesian cultures. Ear piercing among the Alaskan Tlingits could be an indication of social status, as could nose piercing.
Stretched ear piercings—in which the hole is gradually enlarged by the use of weights or by the insertion of successively larger pieces of jewelry—appear in diverse cultures as well. In Africa, the Masai and Fulani are known for ear-cartilage piercings, which may be stretched (a much slower and more difficult process than stretching earlobe piercings). Images and artifacts from native Central American cultures show stretched lobes with jewelry much like that used by contemporary enthusiasts. East Asian images and sculptures,<|fim_middle|> mind | some many centuries old, show long stretched lobes as well; these are emblematic especially of Buddhist saints. The Dayaks of Borneo traditionally pierce and dramatically stretch the earlobe; other piercings—including the ampallang, a horizontal piercing through the penis—have also been attributed to them.
Nostril piercing may have originated in the Middle East, and has been practiced in India for thousands of years, particularly among women. It may be through their interest in Eastern cultures that the hippies of North America took to nostril piercing around the 1970s.
While not as prevalent as the piercing of the ears or nose, lip piercing is also geographically widespread. Women in many regions of East Africa have traditionally worn lip piercings with plugs, while Dogon women may pierce their lips with rings. The men among some native Alaskan peoples also pierced the lower lip, either doubly or singly.
Other piercings are much less attested to in older or more traditional contexts. There is some indication of Central American tongue piercing, for example among the Mayas, but this may have been temporary, intended to draw blood for ceremonial purposes rather than for the lasting insertion of jewelry. More reliable is the evidence of the Indian Kama Sutra (written by the sixth century c.e.) where penis piercings resembling the contemporary apadravya—a vertical piercing through the penis—are described as enhancing the pleasure of both the penis-bearer and his partner.
There may also have been temporary upsurges of interest prior to contemporary versions—some sources, for example, report a fad for nipple piercings among women in the late nineteenth century in both London and Paris. (See both Kern and Harwood.) Here, as in its contemporary
form, piercing is removed from its more traditional social functions, such as marking one as a member of a community or as being of a particular status, and more specifically erotic as well as decorative functions are noted.
Recent History and Subcultures
"Body piercing" is generally distinguished from (unstretched) earlobe piercing, and is more recent in popularity. In its late-twentieth-century version, the interest in such piercing can be traced largely to a handful of figures, particularly Doug Malloy along with Jim Ward and Fakir Musafar (Roland Loomis) in the United States and Mr. Sebastian (Alan Oversby) in the United Kingdom.
With Malloy serving as patron and in some respects teacher, Ward began making specialized piercing jewelry in the early 1970s (Ward is credited with the design of the ubiquitous captive-bead ring, also called the ball-closure ring). He and Musafar opened the Gauntlet, a piercing shop that seemed a natural outgrowth of the jewelry business, in Los Angeles in 1975. Gauntlet shops in other major cities opened in succeeding years. Later he began the journal PFIQ (Piercing Fans International Quarterly), an important source of both information and community for those interested in body piercing. Mr. Sebastian, likewise taught at first by Malloy, was more secretive with his techniques, but was widely known as a piercer. For both, the initial clientele was largely gay men from the sadomasochistic (s/m) community.
In the 1980s, Elayne Binnnie (known as Elayne Angel in the early 2000s) joined the staff of the Gauntlet, attracting many more women clients. Angel, who was the first person to obtain the "Master Piercer" certificate from the Gauntlet, is also widely credited with popularizing the tongue piercing (having five herself). Along with the navel, the tongue is one of the most popular piercings in the early twenty-first century.
Musafar, who later fell out with his former partner, is responsible for the term "modern primitive," with which a number of highly pierced people have identified. Musafar emphasizes commonalities between contemporary and older, particularly tribal, traditions; he also emphasizes the psychological and spiritual elements of all sorts of body modifications, including piercing. Many serious piercers in the early 2000s are trained in his seminars. Modern primitives may ritualize the processes and meaning of their body art and often draw on traditional cultures for design in both piercing jewelry and other arts, such as tattooing.
From its start among gay leathermen, piercing grew in popularity to include a number of communities. Among the most influential in the spread of piercing's popularity was punk. The punks in both the United States and the United Kingdom were fond of non-ear piercings, particularly on the face (lip, nostril, and cheek piercings attained popularity early in this group). The punk emphasis is on rebellion and unconventionality; the modern primitive emphasis on cross-cultural connection and spirituality is quite absent here, replaced by punk's interesting combination of outrage and playfulness.
Music and cultural styles that emerged out of punk often have a place for piercing as well. The straightedge movement, generally dated to the early 1980s, though it attained more popularity later on, provides today a large subset of the heavily pierced. Along with tattoos (often of straightedge symbols such as XXX or sXe) piercings show both the punk influence on straightedge music and the subculture's deep interest in the body (most who identify as straightedge are vegetarian or vegan and abstain from the use of alcohol and other recreational drugs). Straightedge thinking may emphasize the slightly mind-altering sensation of the piercing experience, incorporating elements of the modern primitive emphasis on ecstasies (overcoming the limits of time and selfhood in experience) alongside punk unconventionality. The Goth scene emergent in the early 1980s and again in the 1990s has a religious sensibility very different from modern primitive spirituality, tending toward highly stylized and cultivated artifice in its use of religious, particularly Catholic and Wiccan, imagery. As these associations suggest, Goth style tends toward intense theatricality, and visually striking piercings are widespread; the "dark" emphasis of much Goth culture also meets up with an acceptance of s/m imagery and the pain that may be inherent in body piercing.
The rave scene emergent in the 1990s also includes an interest in visually compelling piercings, particularly facial and navel piercings. Often glow-in-the-dark or battery-powered flashing jewelry is used, giving the piercings a hypnotic effect in dimly lit spaces and playing off the more rapid pulse of the very high beats-per-minute music generally favored.
Not all highly pierced groups or scenes are connected to particular species of music, of course. S/m communities remain strongholds of piercing. Here both the physicality of the piercing experience (and the enhanced sensation often provided by healed piercings) and the symbolism of the jewelry are significant—with the significance ranging from pain-tolerance to community affiliation to ownership. Piercing is also popular, though not so much as tattooing, in biker culture. Here large-gauge (thickness) piercings are often favored, complimenting the traditional bold lines of biker tattooing. Finally, many people also simply understand themselves as members of a body-modification or body-art community, with a respect for body modification and an interest in its being practiced well—as well as in having their own bodies modified.
The Move to the Mainstream
Most piercers, however, will emphasize that the people who get pierced do not often fit into any of these groups, and may indeed be, for example, corporate or grandparental types whose under-the-clothes piercings almost certainly go unsuspected. The more fashionable piercings—particularly tongue, navel, nostril, and eyebrow— tend to attract a younger and more specifically (or overtly) fashion-oriented clientele. A significant influence on the entry of body piercing into mainstream fashion has been popular music, as formerly "edgy" or marginal looks were assimilated into pop and made widely visible in music videos. The most famous instance here is undoubtedly the inspirationally pierced navel of the singer Britney Spears, which has taken thousands if not millions of young women into piercing shops they might not otherwise have frequented.
In general, "mainstream" body piercing involves relatively small-gauge jewelry, often (particularly for navel piercings) with ornamental, even jeweled, beads. Gold, while expensive, may be used as well as more commonly used nonreactive metals including stainless steel and titanium. Perhaps in response, those who identify as more marginal or as members of the body-art community tend to prize piercings that are unusual in location or style, such as surface piercings (piercings that go under the skin rather than through a protruding part of the body—the eyebrow is a surface piercing, but less common versions include the nape or front of the neck, the back along the spine, and the wrists), multiple piercings in a single location (even the navel offers top, bottom, left, and right options), or very large-gauge piercings.
As body piercing has grown in popularity, it has come to be increasingly regulated, though it is still much less so than tattooing. In most of the United States, and in parts of Canada and Australia, local legislation sets hygienic standards via departments of health, and limits the piercing permitted to minors, either banning it outright or requiring parental permission. Interestingly, earlobe piercing is almost invariably excluded from this legislation, a reflection of its well-established and unthreatening presence. The Association of Professional Piercers, a voluntary organization, promotes self-regulation regarding cleanliness standards and piercing practices, and many piercers are members.
Legislation in the United Kingdom is somewhat ambiguous, although piercing seems in general to be legal so long as its purpose is solely cosmetic. In 1991, Mr. Sebastian was found guilty of "gross bodily harm" to thirteen of his clients (they had not complained, but their names were located in his records), on the principle that one cannot assent to assault or mutilation. Cosmetic piercing is regulated in London, and ear piercing elsewhere in the United Kingdom, but it is not quite clear how or whether laws on injury, surgery, or female circumcision might apply (see Tameside Metropolitan Borough Council).
Despite occasional suggestions that the proper legislation regarding body piercing is to ban it outright, the phenomenon seems unlikely to disappear altogether. Undoubtedly its popularity will wane, perhaps to wax again at some point, but the longevity of the practice among human beings suggests that it has an enduring, as well as cross-cultural, appeal.
See alsoPlastic and Cosmetic Surgery; Punk; Scarification; Tattoos .
Camphausen, Rufus C. Return of the Tribal. Rochester, Vt.: Inner Traditions Ltd., 1997.
Harwood, Bernhardt. The Golden Age of Erotica. New York: Paperback Library, 1968.
Kern, Stephen. Anatomy and Destiny. Indianapolis, Ind.: Bobbs-Merrill Company, 1974.
Larratt, Shannon. ModCon: The Secret World of Extreme Body Modification. Toronto: BME Books, 2002.
Vale, V., and Andrea Juno. Modern Primitives. San Francisco: V/Search, 1989.
Tameside Metropolitan Borough Council. 2000. "Guidelines for the Practice of Body Piercing." Available from <http://www.tameside.gov.uk/licensing/bodypiercingguidelines.html>.
Karmen MacKendrick
Encyclopedia of Clothing and Fashion
"Body Piercing ." Encyclopedia of Clothing and Fashion. . Encyclopedia.com. 17 Jan. 2023 <https://www.encyclopedia.com>.
"Body Piercing ." Encyclopedia of Clothing and Fashion. . Encyclopedia.com. (January 17, 2023). https://www.encyclopedia.com/fashion/encyclopedias-almanacs-transcripts-and-maps/body-piercing
"Body Piercing ." Encyclopedia of Clothing and Fashion. . Retrieved January 17, 2023 from Encyclopedia.com: https://www.encyclopedia.com/fashion/encyclopedias-almanacs-transcripts-and-maps/body-piercing
Body Image , "Body image" can be considered synonymous with such terms as "body concept" and "body scheme." Broadly speaking, the term pertains to how the individ… Body Snatching , body snatchers Between the Tudor era and the early nineteenth century, the only legal source of corpses for dissection was the gallows. Not enough bo… Body , Body The consumption of tobacco is related to the human understanding and view of the body, in terms of health and illness, as well as aesthetics and… Body Language , body language refers to any kind of bodily movement or posture, including facial expression, which transmits a message to the observer. Every part of… Peter Christian Asbjornsen , Christianity and the body Christianity is centred on the life, death, and resurrection of Jesus of Nazareth, yet there is enormous diversity in the i… Gesture , Gesture The concept of gesture suffers to some extent from insufficiently defined and imprecisely drawn outlines of what we understand by this term.…
II. CULTURAL AND RELIGIOUS
body odours
Body Modifications
Body, Perspectives on the
Body, The
Bodily Marks
Body Parts 1994
Body of Influence 2
Body of Influence
Body Moves
Body Melt
Body Marks
body louse
Body Language 1995
Body Image/Self Image
Body Image, Media Effect on
Body Glove International LLC
Body for Life diet
Body Fat Distribution
Body Execution
Body Dysmorphic Disorder
Body Positioning in X-Ray Studies
Body Search
Body Shot
Body Shots
Body Snatcher from Hell
Body Strokes
Body Trouble
Body Waves
Body, Depictions and Metaphors
Body, Jack (actually, John Stanley)
Body, Mind & Spirit Magazine
Body, Significance of
body, sociology of
Body, speech, and | 2,946 |
Brooke Graddy
"My greatest achievement at Rainbows is the relationships I have built with the children and their families," said Brooke Graddy, Speech/Language Pathologist for Rainbows' Sedgwick County Infant/Toddler Services program. "One of my greatest moments at Rainbows happened after a child I'd been working with turned three. His parents said, 'You really helped us teach our child to talk, and for that we are grateful.' While I love helping children, to give a parent the sense of accomplishment is even sweeter."
"When I was in graduate school, one of my favorite professors called our favorite parts in life our 'Golden moments'," said Brooke. "I have always loved that phrase. My favorite "golden moments" are when a parent gets their child to say or do something for the first time. The look on their faces gets stored in my memory and heart forever. To see a parent feel that empowered is just the thing I need to keep doing what I do."
Brooke has a Master's Degree in Speech/Language Pathology from the University of Tulsa. "When my husband and I were engaged, and I decided to make the big move from Oklahoma, Rainbows was hiring," said Brooke. "Anyone I talked to said it was a great place to work and I would get the chance to make a difference with not only children, but their families too. I couldn't resist the opportunity and I am so glad that I did."
"Brooke is a cheerleader for her families and her team members," said Alexia Foster, Coordinator for Sedgwick County Infant/Toddler Services. "Whenever given the chance, she brags about the amazing things happening with the families she serves. She is the first one to offer encouragement or help when a team member needs it. Her calm, self-assured demeanor puts worried parents at ease. And if you ask Brooke<|fim_middle|> homes to help 4-7 families per day," said Brooke. "We learn to talk through books, outside exploring, and playing with the child's favorite toys. I love that we could do visits where the family wanted to be that day. When a family has plans for outside the home, it's fun. I've had visits at the zoo, Exploration Place, and at the park. I get to help children and families expand their language beyond the four walls of their home."
"Now my work takes me to each home through video conferencing," said Brooke. "It really puts our model into practice and I think has made me a better "coach". Brooke is the proud mama of a sassy and sweet two-year-old who sometimes helps her mom during the tele-therapy sessions. "I think the families like to see her and see that, like them, I am learning the parenting thing as I go. It makes me more relatable."
In her spare time, Brooke loves running, reading, and anything involving the Oklahoma Sooners. "OU football is my favorite and in the fall I can be found wearing crimson and celebrating game day every Saturday," she said.
Brooke's favorite place to be is anywhere with her family. "I will admit that being a speech/language pathologist is a dream, but being a wife to my husband Cole and mama to Baker have been my greatest adventure and gift," she said.
PrevPreviousTeddi Hollingsworth
NextRossana GonzalesNext | , she serves the cutest kids in all of Rainbows!"
"Prior to COVD-19, I would travel into | 26 |
Modern life offers us a little bit of everything – food from all corners of the globe, constant contact with distant relatives, streamed music, and access to our favourite TV programmes 24/7. But the one thing that we just don't seem<|fim_middle|> The cottage is open throughout the year, and don't be put off in by the cold – chilly evenings are something to look forward to as you snuggle by the wood burning stove – or wrap up and head outside to stargaze on a crisp winter's night. | to be able to pin down is peace and quiet – a place to retreat to away from the crowds. So where better to seek it than on a secluded beach – with just the sound of lapping waves and the odd sea turtle or seagull for company?
Our favourite resort on the island of Ithaca is built on the ethos of slow. Slow travel, slow food, slowing your racing mind and relaxing into the Greek way of life. This luxurious villa is surrounded by organic gardens – enjoy the produce during a cooking class, picnic, or prepare the freshly harvested herbs and fruit in your own, well equipped kitchen. Stay on site and make the most of the pool, Pilates and aromatherapy massages, or book horse riding trips, yacht charters and cycling excursions through dramatic Mediterranean scenery.
Sometimes there are spots that are so special, we really do wonder if we should tell the world about them – but we love Cirali Beach so much we just can't keep shtum. Discrete wooden chalets blend into lush gardens that blend into beach; soak up these surroundings from the hammock on your own private porch. You'll be undisturbed by TVs or bright lights; candles and subdued lighting preserve not only the guests' sense of calm, but avoid disturbing the sea turtles nesting just metres away. The Lycian Way is also right on your doorstep – so bring your walking shoes (or cycling shorts) and explore this gorgeous coastal trail.
If you're looking for silence and stillness, Castara might not tick the box. Waves thunder upon the shore below, parrots squawk in the surrounding jungle and Friday nights ring out with the sound of steelpan bands in a nearby open air café. Hummingbirds flit energetically from flower to flower, while busy fishermen haul their heavy nets up onto the sand. But as you sway in a hammock in your hillside cabin, cooled by the soft sea breeze, you'll have a sense of being the still eye of a beautiful, tropical storm as nature and Caribbean life buzz on around you. It's a true escape from the modern world.
There are 115 islands in the Seychelles, of which just 30 are inhabited – so it's not hard to get away from the crowds here. It also means you're sure to find a quiet beach retreat which is just right for you, from traditional thatched cabins to colonial-style villas. Some luxury accommodations serve produce grown in their own organic gardens, other islands have bicycles and ox carts as the main forms of transport. But don't confuse "uninhabited" with "empty" – there are seabirds in their hundreds of thousands, nesting sea turtles, giant tortoises and reefs teeming with life.
If you're looking for a quiet beach holiday in Southeast Asia, think beyond the well-worn trails of Thailand, and set sail instead for a remote Malaysian island. The seclusion is all the more pronounced after the shining towers of Kuala Lumpur – on Tioman, for example, your neighbours include 45 species of mammal and 138 birds, flourishing here thanks to the creation of wildlife and marine reserves. If you're craving human company, you can take a trip to one of a handful of island villages to learn about life in paradise. Sample traditional Malaysian dishes at one of the waterfront restaurants as the sun sets, before finding your way back to your chalet, carefully concealed by trees and rocks.
Lanzarote may be the last place that springs to mind for anyone looking to escape the crowds. But it turns out "Lanzagrotty" is hiding some rather delightful secrets in between the stacked resorts and looming volcanoes. Take your pick of characterful cottages with walls built from dark volcanic rocks, traditional Canarian balconies and beautiful wooden floors. Many accommodations also take advantage of Lanzarote's perpetual sun and wind – and are powered by solar panels and turbines. Swimming pools, landscaped gardens and – of course – the beach, all provide tranquil placed to relax, or you can pop out for lunch at a nearby fishing village and enjoy the catch of the day.
The Indonesian island of Bali has long been celebrated for its spirituality, artistry, cultural history and outstanding natural beauty; despite the increase in tourism, no building can be higher than a palm tree and the island still pulses to the clicking of traditional looms and the hollow ring of the gamelan. Travel past rice paddies, temples and distant mountains to reach your boutique beachside accommodation, boasting private pools, detailed wood carvings, Balinese textiles and blooming tropical gardens.
The name "Mauritius" just oozes luxury, and with 160km of coastline, you'll be able to take your pick of secluded beaches. Powdery sand gives way to lagoons and coral reefs, backed by forests literally dripping with tropical fruit. Kayak and snorkel your way along the coast, or learn to dive to get closer to the clownfish and angelfish. Spend a day sailing to explore a little further – keep an eye out for dolphins! Back at your beachside hotel, the underwater world comes to you – as fishermen bring in the catch of the day. Alternatively, take a balmy evening stroll to a restaurant in a nearby village.
Tanzania offers a double whammy of seclusion – first in the wilderness of its game reserves, where you'll be surrounded more animals than people – and then on its offshore islands, whose sands are tickled by the milky blue waters of the Indian Ocean. Zanzibar is big on Swahili culture – with the winding alleyways of UNESCO-rate Stone Town and spice plantations to explore in between the beach time. Little Chole Island, in the Mafia Island Marine Park, is even more tranquil; explore lush forests and traditional villages from your romantic treehouse base, tucked amid the baobabs.
Not everyone seeks coastal seclusion; if sandy sandwiches and salty hair are just not your thing, take a look at our top three tranquil holiday destinations away from the beach.
Portugal's sleepy enough as it is – but once you head into this lush natural park, criss-crossed with walking trails, you can take your pick of empty vistas – from the craggy Sintra Mountains all the way down to Europe's westernmost point at Cabo da Roca. Staying in this glorious guesthouse also lets you explore on one of their bikes, fired up on the (included) organic breakfast. It's unlikely you'll even hear the roar of an engine; you can walk and cycle everywhere.
Time seems to have stopped in this lovingly restored 1800s guesthouse, owned by a real Count whose family have lived in this Transylvanian village for generations. The atmospheric sound of ticking grandfather clocks echoes around the exposed stone walls and heavy wooden beams, but the real drama begins when you step outside; the guesthouse sits at the foot of the Carpathian Mountains, and you can take your pick from wolf and bear tracking, bird watching, and exploring the local village.
At the end of the day, the quest for quietness does not always require us to journey far from home. This self catering cottage in Devon promises a bit of old fashioned peace and quiet – the chance to don your wellies for a walk, pedal to the local pub or just enjoy the stillness as you fish in the farm pond. | 1,521 |
Last night we visited the "Sundaes on Thursdays at the Gazebo" in our little town. Ice cream is sold for $1.50 and you get to add your own your toppings. I don't know why but I thought my dad would get a kick out of that.
Reminds me of the story when Mark was still playing ball and my parents flew out to help my sister drive back home from the west coast. It's been a long time - was it even the west coast? It was somewhere far away. It was the end of baseball season, so there was a ton of stuff to bring back, including<|fim_middle|> The hotel lobby featured a Pantry where you could shop using the honor system. You wrote down what you took on a provided form and left it there and it was charged to your room. This excited my dad immensely and he bought a can of Dinty Moore stew and I'm sure numerous other snacks. I can't look at a can of Dinty Moore without laughing now.
I would have loved to be a fly on the wall when that group checked in. A mom, a dad, a questionably young looking daughter with a baby of her own, a dog, bike, and luggage came rolling in. That, my friends, is another post worthy of itself.
Getting back on track. Usually some type of band plays music while people are enjoying their sundaes, but last night it was dancers. The weather was perfect and it was a nice small-town night.
Thanks for the laugh this morning! Ahhhh such sweet memories of living that crazy baseball life!!! Sounds like a wonderful evening you had last night! Dad would love that. | a bike, a dog, and a child. Ryan was there, wasn't she? Anyways, they had to stop and stay the night in some small town and chose the hotel because it was the only one that allowed dogs. | 47 |
Back to Dine
Yunomi Handroll
The first Yunomi Handroll opened in Los Angeles in November 2019. The brainchild of renowned Sushi chef and restaurateur, David Movsisian, Yunomi serves a selection of Japanese and Western-style handrolls and sashimi appetizers, including both traditional selections and innovative combinations with unique textures and flavors. A sleek, industrial bar setting provides the backdrop for these offerings, which are complemented by<|fim_middle|> Sign up to become an insider, and get immediate access to exclusive deals, as well as advance notice of events.
9300 Culver Blvd,
© 2023 The Culver Steps. Owned by an affiliate of Hackman Capital Partners. All Rights Reserved. | individual servings of sake and Japanese draft beer. The name, Yunomi, refers to a type of Japanese teacup used for daily tea drinking, and we celebrate this tradition by offering a variety of loose-leaf tea Japanese teas, which we brew and serve in individual Japanese iron teapots, or Tetsubin. Past and present, traditional and modern. It all comes together at Yunomi Handroll.
Available 1,000 SF
Be the first to know! | 99 |
The<|fim_middle|>0.
FDIC Chairwoman Jelena McWilliams indicated last month that regulators are developing proposals to simplify and ease the requirements of the resolution plans. | Federal Reserve and FDIC found shortcomings in the bank's plans for unwinding in bankruptcy without disrupting the broader financial system.
U.S. bank regulators approved the "living will" plans of four foreign-based banks but pointed to shortcomings that the banks should address in next year's plans.
Under the Dodd-Frank Act, large banks are required to detail how they could be unwound in bankruptcy without disrupting the broader financial system. If regulators do not find such a resolution plan, or living will, credible, they could impose restrictions on a bank's activities or even order it to divest.
The Federal Reserve and Federal Deposit Insurance Corp. on Thursday signed off on the plans of Barclays, Credit Suisse, Deutsche Bank, and UBS, finding they did not have "deficiencies" that could lead to more stringent capital and liquidity requirements on the firms.
But the regulators did fault the banks for shortcomings, including weaknesses in how each of the firms communicates and coordinates between its U.S. operations and its foreign parent in stress.
Additionally, Credit Suisse had a shortcoming related to estimating the liquidity needs of its U.S. intermediate holding company in a resolution.
The firms must address the shortcomings in their next resolution plans, which are due July 1, 202 | 254 |
Q: How to pass a parameter to a regular expression inside of a Python user-defined function? Say I have a string of characters like:
'TTATGACGTTATTCTACTTTGATTGTGCGAGACAATGCTACCTTACCGGTCGGAACTCGATCGGTTGAACTCTATCACGCCTGGTCTTCGAAGTTAGCA'
And I would like to use a regular expression like re.findall to locate any instances of 3 entries (e.g. TTA or GTT for instance).
How can I pass the sub-string to a user-defined function such that this is possible?
What I tried was something like this:
def finder(sequence, codons):
Y =<|fim_middle|> of your question (using python 3+):
# codon_search.py
import re
def finder(codon, fullseq):
matched = re.findall(codon, fullseq)
print (matched)
sequence = "TTATGACGTTATTCTACTTTGATTGTGCGAGACAATGCTACCTTACCGGTCGGAAC"
search_str = "TTA"
#call function
finder(search_str, sequence)
Output: 3 matches will be found in the above sequence
['TTA', 'TTA', 'TTA']
| re.findall(r'codons',sequence)
return Y
However, when I attempt to call this function on my string that I gave above using some input for codons like 'TTA', all I get as a return is an empty list...
I think the list is empty because within the regular expression in my function, "codons" is within the quotation marks next to the r. Is there a way to pass something to a regular expression in a manner that circumvents this?
A: You are trying to match the string "codons", rather than the variable parameter. Try this:
def finder(sequence, codons):
return re.findall(codons, sequence)
A: A polished answer | 145 |
Discussion in 'Completed Listings' started by namasste, Nov 7, 2018.
Olympus OMD EM5 MkII - $275 ($250 if bundled) LOWERED PRICE!
Long story short, I've decided that after two forays into M43, my shooting needs require DSLR still so my gear is up for sale. All is in EXCELLENT condition unless otherwise described and comes from a non-smoking home. I'd prefer to sell as a package and would sell at the reduced prices shown for bundled. I'd also be more open to offers if sold together.
The only issue to note is that I had a cable come loose on the lcd of the EM5II about a<|fim_middle|> I don't shoot that way anyway so it was a non-event for me. The tape is there simply as a precaution so I didn't inadvertently swing the screen out and risk detaching a cable again. As such, I am pricing it below market in the event you do feel you would want to articulate the screen and it needed any future repair. call it peace of mind. I've included a pic of it powered up so you can see its working fine but if needed, I can also send a video or Facetime of me demonstrating that it is functional. Shutter count is 12,483 as of today.
Camera will come with an Olympus battery and charger, original box and all original paperwork. Also included is an Olympus hot shoe flash head.
Both the 75 (by far the best M43 lens I have ever used) and the 45 come with hoods and original boxes. I will also include a Tiffen UV filter for the 75. The 12-32 does not have an original box but will be packaged well.
If you buy the bundle, I will also include an additional charger and 3 additional batteries. In addition, I will include an Ape Case cube that can be used standalone for storage or as an insert into any bag.
Feel free to ask any and all questions, I can take additional images if needed as well.
Prices include Paypal (I can also do Venmo or Zelle) but do not include shipping. That will be determined once I have a zip code and item(s) being purchased. It will be actual or below cost as I just don't believe in people trying to make money on shipping.
Be well and hope someone can use this gear!
I am really interested in buying the bundle for the EM5 MkII. Would you consider $950?
I'll pm you, check your inbox. Thanks! | year ago. I had it repaired locally and it works fine but rather than risk loosening it again, I have left it as you see it and have not moved the screen into other positions. | 39 |
<|fim_middle|> top of other shoes and boots around the house. Paired with our custom made shoe shine cloths this wood shoe polishing kit is made from reclaimed pallet lumber and stained with burnt umber and dark pigments with linseed oil or a light honey stain and wax. The box measures 7 1/4" by 4 1/4" by 14".
Black, Parade Gloss Black and Neutral Kiwi Polish - perfect for military and dress boots.
If you have any questions about this product by Shinekits, contact us by completing and submitting the form below. If you are looking for a specif part number, please include it with your message. | 1 32 gram can Kiwi Parade Gloss Black shoe polish 2 32 gram cans of regular Kiwi Black and Neutral shoe polish 2 5.5" Kiwi 100% horsehair shoe shine brushes 2 Kiwi 100% horsehair shoe shine polish applicators 2 Shinekits flannel shine cloths Japanese carpentry intrigues us. This wood shoe shine box is a perfect example of simplicity and function for your shoe polishing needs. We've had lots of requests for Kiwi brand shoe polish from our customers in the military and other branches of service like police, paramedic and fire. Kiwi brand horse hair brushes and Kiwi brand black and Parade Gloss black polish with a can of neutral to keep on | 154 |
<|fim_middle|> faced, and all I can do is thank God that we're not alone. I thank God for being our Savior when it's obvious that we can't save ourselves. I thank God for our marriage---for this beautiful, imperfect, indestructible bond that is full of opportunities to forgive and redeem.
Because this marriage, our marriage, is teaching us more about grace and love than any other experience this side of Heaven. | This post was published with Brett's permission and blessing. There are many parts of our marriage that need and deserve privacy, but we have agreed this part of our story is worth sharing. Thank you, as always, for being respectful with your comments.
"When my dad died, it's like a part of me died too."
I could see the sadness in his eyes, all the way from the other side of the living room. My legs were tucked tightly underneath me on the couch and tears began to sting my eyes. It felt like we were in therapy, minus the therapist.
Confession after confession, we laid it all out on the coffee table.
"I feel depressed," he told me.
"I feel unloved," I told him.
Round and around we went. Accusations, explanations, apologies---back and forth, back and forth. We were both tired. Tired of fighting, tired of arguing, tired of giving each other the silent treatment.
"This isn't us," I said. "We are better than this. We're Brett and Ashlee!"
The air felt raw and vulnerable, bold and desperate---each of us determined to make the other understand. He wanted me to extend more grace; I wanted him to love me better. We slowly confessed our shortcomings and recent failures. He was withdrawn and distracted; I was irritable and bitter. He was in a hole and needed someone to pull him out; I was invisible and needed someone to see me.
Grief is something I know very little about, yet it has creeped into every inch of my home, my marriage, and my life in the past year and a half. It has been all consuming at times, and barely there at other times. But no matter what day, what hour, what conversation, what fight, it is there, permeating the air like a soft poison, crippling each of us in slow motion.
The loss of Brett's dad has affected our marriage in ways I never expected, and changed Brett in ways I never saw coming. We will have a good day, a good week, a good month, and then suddenly out of nowhere, grief hits our house like a hurricane. And much like any other Californian couple, we don't even know how to prepare for those.
As we sat in the living room with broken hearts, struggling to pick up the pieces surrounding us, I was struck with a startling realization.
And he couldn't save me.
We each wanted so desperately to be healed, to be loved, to be made whole in some way, but we were both looking at the wrong person to do that for us. We were both looking for a Savior, something we were never going to find in each other.
And I guess that's the most freeing and challenging part of marriage. You want your spouse to be everything to you, but in fact, they are only capable of so much. When you look to your marriage for the type of healing and love that only a Savior brings, your spouse will always, always fall short.
So here we are, two weeks after our living room therapy---still a little broken, but in tact, like a softly cracked windshield. We are leaving each other silly notes on the kitchen chalkboard and sharing candy hearts on the couch. Day by day, word by word, kiss by kiss, we are still figuring out how to love each other through grief and loss. It's the hardest thing we've ever had to do, the greatest challenge our marriage has ever | 709 |
The Roman driving for Prema set the pole position valid for race one during the last few seconds of the session, Maisano kept at his back Agostini and Marasca. In the second session two red flags and the best time set by JD Motorsport's driver from Padova ahead of Giovesi and Cheever.
31/08/2012 - Eddie Cheever and Riccardo Agostini, same names challenging each other. The Roman secured the pole position of race one, while Agostini that of qualifying 2.
In qualifying 1, valid for the grid of the first race, Riccardo Agostini with the Mygale of JD Motorsport was at the lead until when 20'' were to go, but then the sting in the tail with Eddie Cheever setting a very good 1'41''509 and Brandon Maisano, Cheever's team mate on the Dallara F308 of Prema Powerteam. Between the French and the Italian only <|fim_middle|> Roman De Beer.
The last three positions of the grid were occupied by the Euronova pairing with Yoshitaka Kuroda leading Sirotkin while Jakub Dalewski (Ghinzani) ended the bunch.
Race 1 will start tomorrow at 14.55 (GMT+2) with live coverage on Rai Sport 2 and web streaming available at www.acisportitalia.it/F3. | 8 thousands of a second.
Very good performance for Mario Marasca that completed the second row on the side of Agostini as he set with a best time of 1'41''792. The third row went to the third Prema Powerteam's driver, Henrique Martins that will have Euronova's Sergey Sirotkin at his side. Seventh place for the Canadian of JD Motorsport, Nicholas Latifi just 9 tenths from the poleman Cheever. The top seven drivers of qualifying one were all within a second.
The eighth place went to Roman De Beer (Victoria World) who did not manage to reproduce the same result he showed on the wet. Behind him the Japanese of Euronova, Yoshitaka Kuroda. The two drivers of team Ghinzani had a troubled session as the rookie Dalewski managed to complete only 3 laps before ending sanded, while Kevin Giovesi had to stop right after the green flag due to a problem to the axle shaft.
The second qualifying was marked by two red flags deployed with 6 and 3 minutes to the end. Marasca first and Martins afterwards made stewards stop the session. Dalewski managed to get back on track, Martins was forced to leave it instead.
The pole position went to Riccardo Agostini with a stunning 1'40''542, that relegated the Milanese of team Ghinzani, Kevin Giovesi, to 460 thousands but counter-charging after qualifying 1. The third time went to Eddie Cheever, who will share the second row with his team mate Brandon Maisano. Between the two team mates only 15 thousands of a second. The third row was obtained by Mario Marasca, that is the only driver racing with team BVM in this weekend and Henrique Martins, who set a 1'41''662 before exiting the track. Seventh time for the Canadian Nicholas Latifi (JD Motorsport) who proceeded the other Mygale driven by | 420 |
Mat Riches reviews Climacteric by Jo Bratten (Fly On The Wall Press, 2022)
Halfway through Jo Bratten's new pamphlet I realised I needed waterproof clothing. Water is ever-present. The book opens with the narrator scrubbing the bath on New Year's Day, and almost every subsequent poem features some sort of liquid. However, what should feel like a literal clean start to the year is anything but:
Morning of the new year and I'm scrubbing
the bath, tugging snakes of hair
from the stinking drain, wondering
how so much of me got down here
(from 'New Year's Day')
In later stanzas Bratten uses imagery which echoes that "stinking drain" – "In the cold estuary I'm circling / black terns under a groggy sky" – and continues to question not only "how so much of me got down here", but where that "so much" goes afterwards. In an age where climate change and humankind's impact on the world and all its flora and fauna has never been felt quite so keenly, the final lines of the poem are:
I'm far out at sea
brining with molluscs, latching on
to cephalopods like flame, waking
somewhere in the belly of a whale,
retched up on your shore, a warning.
A Jungian scholar would love this poem and its potential allusions to depression and rebirth, but those final two words read less as a warning to the self, and more as a warning to the world. This is what we are doing to the world around us. While words like "brining" and "latching" can have preservative or caring connotations, the "retched" of the final line feels like nature rejecting us and our impact. It's powerful stuff, and will give me pause for thought next time I clean the bath.
While this first poem acts as way of using poetry to question the self and then broadens out to encompass a wider world, there are a range of poems dotted through the collection that are referential, if not always reverential towards poetry itself. And, yes, they mention water. Never more so than in 'Serious Verse' where our protagonist leads us towards an evening out with "the river" (and I'm inferring it's the Regent's Canal up near Camden Lock on the grounds that they leave The World's End pub), taking it to a"little cool place" and buying it "a dirty martini, extra olives, / no twist".
Bratten manages to blend and contrast the modern with the historical, and often in the same poem
For all the heightened feeling and vaguely surreal set up of the poem, its conclusion has us asking what has happened to the river such that it drinks "<|fim_middle|> of references to Gerard Manley Hopkins, Caravaggio, Judith and Holofernes, quotes from George Ripley and Christopher Marlowe, and allusions to Milton and Wordsworth, what stands out in this collection is the way that Bratten manages to blend and contrast the modern with the historical, and often in the same poem. 'Chiaroscuro', for example, illustrates and explores our inability to look away from the darkness of the world, and of social media, and compares us to Judith in the painting 'Judith Beheading Holofernes' by Caravaggio.
In the fractured dark we're all doomscrolling
before dawn. Lit up like Caravaggios:
arms stretched across burning beds,
brows trenched like Judith surveying the head
of Holofernes caught against her bright blade,
baffling our morning brains with fresh dread.
Later on in the poem we're asked to adopt that most modern of interactions with an image – to "Tag yourself" – and invited to wonder who we are in the picture – the killer, the killed, or the (not so) casual observer. Perhaps it was ever thus and – as Bratten implies – there is nothing new under the sun.
There is darkness throughout the book, both literally and figuratively – subjects explored include loss, environmental damage, shame, and religion and its impact, – but there is also light intermixed
'Chiaroscuro' is perhaps the maypole around which the other poems are woven. There is darkness throughout the book, both literally and figuratively – subjects explored include loss, environmental damage, shame, and religion and its impact – but there is also light intermixed.
A poem that shows this draws a sense of light and hope out of the literal darkness. The first stanza of 'Solstice' (and we will ignore the clever title and it's sun reference) opens:
I don't mind the dark so much going home
as the days tilt us further from the light;
the shiver of air crossing the river,
thunder from fog-plumed highways,
far off trains necklacing the night.
That "trains necklacing the night" is worth the price of entry on its own.
The second stanza begins "I miss cars in darkness seen from a plane" and ends on "cats testing the edges / of themselves, waiting for you". The "miss" of that first line tells us we've moved on, we're now in the summer solstice, and that wherever we are in the year, whichever solstice we're shuttling between, there is much to be grateful for.
Climacteric absolutely feels like Bratten's version of the cats of 'Solstice', she's testing the edges of herself here. This book is "waiting for you".
Mat Riches is ITV's unofficial poet-in-residence. His work's been in a number of journals and magazines, most recently Wild Court, The High Window and Finished Creatures. He co-runs the Rogue Strands poetry evenings, reviews for Sphinx Review, The High Window and London Grip, and has a pamphlet due out from Red Squirrel Press in 2023. Mat Riches' blog Wear the Fox Hat is here.
Phantom Settlements
by Mat Riches — our Friday Poem on 14/01/22 | like a navvy" and wants to go home with our protagonist and "lie down in front of the fan / and flood"? Those final two words are left, dare I say, floating on their own on the last line for a reason, and they emphasise, to my mind, a need to let it all out, to be overwhelmed and lose control. Earlier, the protagonist is asked if they write "serious verse" as a chat up line. We are left in no doubt by the end that Bratten very much does indeed.
For a book that is full | 115 |
When I was around twelve years old I had high fever. With a mixture of paranoia and hypochondria I dramatically said to my mother that my sister could have my CD player if I would die.
Today I'm well and less dramatic. However, if I were to die or fall ill would I then feel inclined to tell my sister to take control of my Facebook account?
Last week Facebook introduced a new feature, which allows users to choose a legacy contact, such as a friend or family member. This chosen person would manage the account once the account holder has passed away. So, we have reached a point where it is seemingly necessary to not only have a will applying to the physical but also a second one for the digital world we live in. Since the internet is relatively new and the average age of user is getting older we are facing a few issues such as: Who should have access to our data? How do we want to be remembered? How are we going to handle this new notion of a digital afterlife?
By talking to people who have experienced loss, we realized there is more we can do to support those who are grieving and those who want a say in what happens to their account after death.
With the permission of the account holder the legacy contact can later download an archive of the photos, posts and profile information that has been shared on Facebook.
There are of course restrictions to how much access your legacy contact has to your account. For example, he/she cannot enter your personal messages or log in in your name. Also, the rest of your settings cannot be altered with at this stage.
The feature is optional and has so far only been made available in the US. There is also other option, where one instead of a legacy contact can have the Facebook account deleted.
Google<|fim_middle|> the perservanists who think we owe it to the future generations to save all the digital content, no matter how small. Secondly, the deletionists who believe we need to learn how to forget and get rid of the dead data online as it eventually will outnumber the content produced by the living.
Maybe the new Facebook legacy contact is a huge leap towards something bigger. In a time of YOLO (You Only Live Once) perhaps it would be wise to start thinking about how we should view our digital property, who should 'inherit' the access to it, and what laws should regulate it. | was the first large company to deal with the issue of 'digital afterlife'. In 2013, Google introduced a tool which enabled users to decide what would happen to their data when they die. They could, similarly to Facebook's feature, chose to have their data deleted after a certain amount of time or pass it on to a contact person.
However, Facebook has had a memorial process since 2009. It prevents late users to appear alongside the advertisement and friends would not be reminded of their birthdays. For example, Facebook's Ifidie app gives users the opportunity to share a video after their death.
Social networks are a relatively new concept. A lot of websites grew fast and fell even faster. Therefore, it is hard to say how long Facebook will last. Emily Dunham, from What If claims that if Facebook follows the faith of many websites and starts losing market share this decade and fails to recover, the amount of dead people's profiles on Facebook would exceed the living by 2065.
Certain aspects of this online after death planning may seem a bit morbid. Not only do we control the content we share on Facebook, now we want to control afterlife and how we are remembered on the social network.
Nevertheless, a large part of the global population spends many hours a day online. The digital sphere has become a huge part of people's lives. We produce thousands and thousands pieces of content during our lifetime, so-called digital property. For example, our email account is the key to most log-ins and allows access to multiple other accounts. In case of death, it is important to have a digital will not only because of sentimental value, but also economic value. A will concerning digital content and digital access could also make it easier for family members to organise unresolved online businesses of the deceased.
Still, if the notions of digital will and digital property develop further we would want to look over restrictions and legal aspects of the new issue. Take privacy for that matter. Who should have access to your digital accounts? Facebook and Google have both already been to court over access to deceased people's accounts.
Anja C. Nilsson wrote for the Harvard Crimson, "Fast-forward to 2070, and each of us will find a lifetime of digital content tied to our identity." Nilsson also discussed at the two different schools in regards to the future of digital property. First, | 487 |
US Army Up-Gunning the STRYKER
US Army presents first DRAGOON prototype integrated with PROTECTOR MCT-30
On 27 October, the US Army Program Executive Office (PEO) for Ground Combat Systems and Project Manager for the STRYKER Brigade Combat Team, in conjunction with General Dynamics Land Systems (GDLS), presented the first of the up-gunned DRAGOON vehicles to the US Army. One of the most noticeable changes on the vehicle is the 30mm turret, known as PROTECTOR MCT-30 from Kongsberg.
The STRYKER Infantry Carrier Vehicle, produced by GDLS, is an "up-gunned" vehicle that will be used by the US 2nd Cavalry Regiment STRYKER Brigade, which is stationed in Europe. Up-gunning the STRYKER's by integrating a 30mm cannon will, as stated by Maj. Gen. David G. Bassett, PEO Ground Combat Systems, not only increases firepower but also increases the survivability of the platform.
The selection of PROTECTOR MCT-30 for the STRYKER programme was announced in December last year, and the accelerated delivery of the first systems is a result of a close and effective cooperation between the two companies, and strong determination from both sides in order to deliver a world class capability to the US Army.
Kongsberg has, over the past eight years, developed the innovative PROTECTOR MCT-30 turret by leveraging Kongsberg`s extensive experience from remotely controlled weapon stations. The system<|fim_middle|>'re able to move more quickly at less risk, because they're supported by a much more effective weapons system."
Government testing of these vehicles is planned to start in January, 2017 with the initial fielding of the systems to occur in 2018. | design and selected sub systems introduce new technologies that increase both performance and reliability for medium calibre weapon systems. The system's capabilities have been demonstrated and tested by the US authorities in several iterations over the last several years. This delivery and upcoming test initiatives will bring the system through the final milestones for operational use by the US Army.
"This cannon fires a much greater distance, with much more effective munitions, and that allows our soldiers to approach their objective more protected, with less return fire from the enemy," Col. Glenn Dean, the Army's Project Manager for the STRYKER Brigade Combat Team, explained. "They | 123 |
Gemini, the sign of the Twins, exemplifies how the Mind perceives the world as a play of opposites: light and dark, man and woman, left and right, good and bad, spirit and matter, life and death, yin and yang. Tao says that these opposites contain a spark of each other. What appears to be separate is really related. The best way to understand an opposition is to see that each side complements and balances the other side to create a greater whole.
The full Moon is an opposition between the Sun and the Moon, a moment in their cosmic circle dance when they face each other fully. It's interesting that we read the result of that dance on the face of the feminine Moon rather than the masculine Sun. The Moon records what the Sun's been up to. The Moon releases what"s unconscious in the psyche. The Moon draws our eyes and opens our imaginations to what could be. Thanks to the life-giving light of the Sun.
Astrological signs come in opposites too. The loner Aries is balanced by the partner Libra, sensual Taurus with passionate Scorpio, intellectual Gemini with wise Sagittarius. There are 12 signs and the 6 pairs of signs create a dynamic that keeps them on their toes<|fim_middle|> downstairs in the dark -- instead of disregarding it and taking a tumble. Or take the opportunity to speak with the stranger on the street rather than turn fearfully away.
Change your Beliefs and Open your Mind! | .
Monday's Sagittarius full Moon is a partial lunar eclipse, with the Earth lining up between the Sun and the Moon so that the Earth block's the Sun's light from fully reaching the Moon. Since planets do have energetic connections, during a lunar eclipse the Earth cuts the energy between Sun and Moon, dissolving the energetic structures on Earth and within us. Lunar eclipses open a portal through which we can release old complexes, habits, ideas, beliefs and wounds that no longer serve our life. When the Earth moves out of orbit between them, new energetic lines snap into place. We can change what those connections are by how we change our own energies.
This is a great time to do ritual. Since for many of us the eclipse occurs during the early morning hours, you can do a ritual Sunday evening and create a psychic container to hold what needs releasing until the eclipse happens. If you ritualize this release, make sure you send what you're releasing out to Pluto to regenerate, or down into the Earth to compost, or to the Sun to burn.
For this Gemini/Sagittarius full Moon eclipse, release old categories of perception, old prejudices and old dogmas. While the light of ego-consciousness is blocked during the eclipse, you might remember some beautiful dream or fantasy you loved as a kid, some belief in the grace and goodness of Spirit that you haven't felt for a while. Why not take that image out of the closet and dust it off? Maybe it's something you really wanted to believe in, but were told you couldn't. Who says? Or perhaps you just lost faith. Why?
Who gets to say what's real? Science is still debating that question so for now, open your mind and look at the unseen real aspects of life. Who says we're not connected, or that we can't do magic, or that we can't trust Love? Who really believes that we are sinners if we don't believe in the "correct" version of God? The Spirit of Life created us, so It probably wants us to find as many ways back to It as there are life-forms. The best way to worship Spirit is to live fully and creatively, kindly and compassionately, freely and openly.
The tension of opposites in Gemini/Sagittarius is one between reason and faith, intellect and intuition, the lower Mind and the Higher Mind. Gemini wants to articulate exactly what makes one thing different or similar to another. Gemini is the master communicator who can use language to open up people's minds and hearts. Sagittarius is the ultimate believer, knowing right from wrong and piercing through to the truth of the matter, a trait which Gemini isn't interested in. Gemini likes the play of the Mind while Sagittarius wants to focus the Mind on the goal.
This lunar eclipse offer us a great opportunity to see what strange and distorted beliefs we've ingested from patriarchy that are strangling our lives. Sagittarius is the container for our belief systems. Everybody has to believe something about life, religion or no religion. There are cosmic laws that give rise to life and that's where our beliefs can take root and give us strength. Whether we see those laws operating as a Goddess or as a God, as mathematical laws or magical correspondences, we need to believe that we are part of the whole, that we hold meaning. Sagittarius anchors us to our beliefs so we don't get lost in the inundation of information that Gemini can spew out. Sag points to information that is useful to us.
If we can unite the energies so they work together, we can engage in the deepest form of understanding and communication -- articulating what is rather than what I think it is. Once we get rid of old ways of understanding our world, our categories, we can once again be open to the life around us in new and intriguing ways. We might listen to our intuition which tells us that perhaps we should tie our laces before walking | 804 |
Mosh Pits, Raves and One Small Orgy: New Paintings By Dan Witz at Jonathan LeVine Gallery
April 11, 2016 rezpect 1 Comment
Scrum 2 (All Out War) By Dan Witz (All Photos By Gail)
This past week, when a friend or coworker would ask me what I did over the weekend, or if I'd seen any good art lately, I felt like I had to qualify my response by first asking, "Well, do you know what a Mosh Pit is?" And usually that person would say that they did, or at least that they had some idea. The reason I had to ask was to put in context the exhibit I had just seen at the Jonathan Levine Gallery by contemporary hyper–realist painter Dan Witz, who is all about the mosh pit action. Nobody paints a pit like Dan Witz.
Byronesque 3
Mosh Pits, Raves and One Small Orgy is the latest series by the Mosh Pit Maestro, whose work we have been covering on The Gig for years already. With a career spanning over three decades Witz has evolved from being a pioneer of the street art movement to refining a studio practice that incorporates both digital and old master techniques. Influenced by the work of Renaissance painters Hieronymus Bosch and Pieter Bruegel, his large-scale oil paintings of rampant crowds embody a rebellious and provocative nature that's heightened by a stunning hyperreal aesthetic. You can almost smell the sweat.
Mosh Pit Study (Jets)
<|fim_middle|> 21st century, so I'm not going to be painting Roman soldiers invading, or some Gothic baroque composition…The highest aspiration of an academic realist painter are these big group figure paintings, and I'm using the hardcore scene as my subject."
Seriously, Dan Witz is amazing.
Brite Nite 1
In this new series of work, he continues to portray the frenetic motion of mosh pits but also expands upon his usual hardcore setting in a pair of works called Brite Nite, which depict rave scenes. As their luminous titles suggest, this atmospheric change has fostered a tonal shift, resulting in compositions that are euphoric and less physically aggressive. Witz further develops this notion in Small Orgy, an amorphous interlocking of nude figures in the midst of experiencing different stages of ecstasy. Sorry that I did not get a picture of the orgy, because too many people were standing in front of it, and I could not wait for them to move away.
Brite Nite 2 (Detail)
I love this detail of Brite Nite 2 (above), which seems to indicate a flirtation between these two characters, each with an arm in the air, and freezes for eternity a moment of energy and emotion that I find completely compelling. Rave on!
While building upon established themes, Witz remains true to his skillful methods of conveying light, shadow, movement and depth. Mosh Pits, Raves and One Small Orgy exemplifies his renowned trompe l'oeil artistry, as well as his ability to epitomize the primordial instincts of his subjects.
Spy Pic of the Artist that I took at the Opening Reception
I would like to add that Dan Witz seems like a very nice guy. Geoffrey took a selfie with him once about five years ago and now every time we see him, he always nods at G, or says Hi, even though he must meet a gazillion people. He is also supportive of other artists' work, as we see him out at nearly every LeVine opening, and we go to most of them. Dan Witz!
Dan Witz' Mosh Pits, Raves and One Small Orgy will be on Exhibit Through April 30th, 2016 at Jonathan LeVine Gallery, Located at 529 West 20th Street, 9th Floor, in the Chelsea Gallery District. While You are There do Check Out Erik Jones' Twenty Sixteen, which Runs Concurrently in the Adjoining Gallery Space.
artartistdan witzHardcoreHyper-Realisticjonathan levine galleryMosh PitsOne Small OrgypaintingsRavesSick of It All
Previous PostModern Art Monday Presents: John Frederick Kensett, Sunset on the SeaNext PostHalt and Don't Catch Fire
One thought on "Mosh Pits, Raves and One Small Orgy: New Paintings By Dan Witz at Jonathan LeVine Gallery"
LittlestWinslow says:
Awesome! I was in a pit on Saturday. Pits are rad. | Witz elaborates:
"I'm an academic realist painter, but I'm living in the | 19 |
It's been two weeks since #BPSquareDance. The dust may have settled on this year's Square Dance, but we're already excited for next year's! If you weren't able to join us, or want to re-live the fun, enjoy the photos below.
All photos by Angelito Jusay Photography.
Over the course of the three-day event, we distributed 4,500 straw hats, donated by Southwest Airlines®, to Square Dance attendees.
Vendors from Hester Street Fair and 'wichcraft were on hand to dish up Square Dance-themed snacks and sips.
Each Square Dance date featured a different band. For the Friday event, the Calamity Janes played the tunes while Dave Harvey of NYC Barn Dance called the dance.
Dave Harvey<|fim_middle|>Kids enjoyed old-fashioned sack races.
The #BPArtCart was wheeled onto the lawn, loaded with Square Dance-themed crafts for kids. Here, kids make their own stick horses out of pool noodles. | called the Square Dance all three dates. He guided the participants into shapes that looked beautiful from above.
Hundreds of people kicked up their heels.
A mechanical bull took residence on the Upper Terrace for Friday and Saturday evenings.
Sunday was geared toward families.
| 49 |
Home 1010 Wins AM
1010 Wins AM
These sources have minimal bias and use very few loaded words (wording that attempts to influence an audience by appeals to emotion or stereotypes). The reporting is factual and usually sourced. These are the most credible media sources. See all Least Biased Sources.
Overall, we rate 1010 Wins Least Biased based on balanced story selection and High for factual reporting due to proper sourcing and a clean fact check record.
Bias Rating:<|fim_middle|> that owns over 200 radio stations. Advertising through radio and the web generates revenue.
In review, the 1010 Wins website reports news through journalists in the form of written reports, radio clips, and video. Local news stories focus on crime and lifestyle and utilize minimally loaded language such as this: Homeless man covered in bed bugs found dead on subway train: report. National and international news is usually provided through the Associated Press. The website also features a section dedicated to politics that again uses the Associated Press for national politics and local journalists for local news such as this: NY Times endorses Klobuchar, Warren in Democratic contest.
The website does not produce editorial content, and political stories tend to be balanced and low-biased in wording.
Overall, we rate 1010 Wins Least Biased based on balanced story selection and High for factual reporting due to proper sourcing and a clean fact check record. (D. Van Zandt 1/22/2020) Updated (12/16/2021)
Source: https://www.audacy.com/1010wins
Last Updated on January 5, 2022 by Media Bias Fact Check | LEAST BIASED
Media Type: TV Station
1010 Wins AM is a New York City-based all-news radio station. The radio station debuted in 1924 and became all news in 1965, making it the oldest continuously operating all-news radio station in the United States. This review focuses on their news website 1010wins.radio.com, which publishes local news on crime, sports, weather, traffic, and the New York lifestyle.
1010 Wins is owned by Entercom Communications Corporation, a publicly-traded American broadcasting company | 120 |
Like most Americans, clergy and church leaders neglect securing disability coverage despite the fact that research shows people are much more likely to become disabled for more than three months than die in any given year.
States require us to purchase auto insurance. Banks make certain we have mortgage insurance. Parents with children buy life insurance to protect their families in case of an unexpected death.
75 percent of disabilities result from illness, not accidents.
Financial crises associated with disability are the leading cause of personal bankruptcies and responsible for nearly 50 percent of mortgage foreclosures.
1 in 3 women and 1 in 4 men will be out of work for 90 days or more during their working lifetime due to disability.
When a church leader's income is the primary one, disability can become a real hardship for the household. If you think of a disability policy as insuring against loss of income, you are much more likely to view it as a necessity.
Nine out of 10 Americans who have disability coverage are insured through their employers. Churches can provide two types of disability insurance—short-term, (STD), and long-term, (LTD).
STD insurance is generally limited to 60-180 days, (although<|fim_middle|> financial planning and investment knowledge to his work at MMBB. | some may last up to a year), and typically pays 60-80 percent of your gross salary. Most plans begin paying benefits after you provide written documentation from a physician of your condition and estimated time away from work. You may also have to wait up to 20 days between the date you stop working and the date your benefits begin. Some employers may require you to use up your sick/vacation leave before your disability benefits begin.
An LTD policy begins if STD ends before you can return to work. Some employer STD plans automatically convert to LTD. Check the terms of your employer's plan closely. At MMBB Financial Services, members whose employers are enrolled in the Comprehensive Plan receive life and disability insurance in addition to a 403(b) retirement income account.
Determine how much you spend monthly on necessities such as housing, food, utilities, child care, transportation and other living expenses. Don't forget the premium payments for your LTD plan and added medical costs. Aim for a plan that will cover these expenses. Factor in your spouse's income and an emergency fund if you have one.
Decide how long you want the benefits period to last – the longer the benefits period, the higher your premium payment. For LTD it can range from a set number of years, such as two to five years, or until a certain age, usually 65.
Consider making the policy "non-cancelable and guaranteed renewable." These protections guarantee that once a policy is in-force there will be no changes to your monthly benefits, or your policy benefits during the life of the policy as long as the premiums are paid. This can be critical when you are already living on a reduced income. Guaranteed renewable by itself only provides that your insurance cannot be dropped but the premium can be increased.
Pay attention to payout restrictions for behavioral health conditions, pre-existing conditions or family medical history.
Know whether you are required to coordinate with government benefits such as those available from the Veterans Administration or Social Security.
Finally, be sure to read the fine print on your disability policy. Become familiar with it before you need it and before you are distracted with managing your disability.
Church leaders need only look to their congregations to understand that various health conditions can arise that affect a person's ability to do their work, or can result in a long-term absence from work. Disability insurance can allow your family to tend to your recovery without the burden of worrying about paying the bills.
Portions of this article previously appeared in the Sept/Oct 2015 issue of Church Executive magazine.
Colin E. Nass , CFP®, AEP®, RICP®, Senior Manager, Financial Planning, MMBB Financial Services. With over 25 years' experience, Mr. Nass brings a broad range of | 562 |
Come home and relax in your luxurious freestanding bathtub by Empava. From the serenity collection emerges the ergonomic pure-scape freestanding bathtub by Empava. Its design is as comfortable as it is stylish. The contemporary design and defined lines will complement any bathroom decor and make the room seem more spacious. The pure-scape stand alone tub is ergonomically engineered and will comfortably hold your body, so you can soak in peaceful tranquility. Empava uses 100% white glossy acrylic (never any paint) reinforced with fiberglass in its pure-scape bathtub to ensure that the color is consistent throughout and never fades or loses its brilliance over time. Stand alone bathtub features / specifications:, 66.92" long x 31.49" wide x 26.<|fim_middle|> Easy installation., 1 person bathing., Chrome plated overflow/drain available upon request (DIY replacement only)., 1 year warranty. Empava bathtubs are as pleasing to the eye as they are comfortable to soak in. World-class modern designs and ergonomic features are incorporated into all of Empava's luxury tubs. From the finest selection of raw materials to the contemporary design, Empava bathtubs bring innovation and durability to create some of the highest quality, visually striking bathtubs in the world. Add the Empava modern freestanding bathtub to your cart today . | 77" deep and an effective bathtub capacity of 58.11 gallons., Adjustable metal feet under tub for stability., Brushed nickel overflow and pop up drain., Anti-bacterial surface with high gloss white finish. CUPU certified., Premium quality acrylic construction reinforced with fiberglass for strength and durability., Non-porous surface for easy cleaning., | 70 |
Taapsee Pannu to play the romantic lead in Rajkumar Hirani's Dunki?
Taapsee Pannu, who has often dazzled audiences with her exceptional performances, is scheduled to co-star with superstar Shah Rukh Khan in the forthcoming flick Dunki. For the first time, she will be working alongside him. Rajkumar Hirani directed the film. The audience is ecstatic to see Shah Rukh on the big screen for the first time in a long time. Taapsee and SRK's photos were recently released when they were filming in London. Taapsee has already revealed her involvement in the film in a recent interview.
Taapsee Pannu reveals information about Shah Rukh Khan's Dunki
Taapsee stated to India Today that she will be romancing King Khan in Dunki. Hirani's world was dubbed 'endearing' by her. She stated, "It's a Raju Sir film, and it's that charming world. I'd be amazed if someone wasn't having a good time on that set." She also shared her delight over romancing SRK in the<|fim_middle|> do you desire from life?"
Shah Rukh Khan discusses Dunki.
Recently, Shah Rukh was seen visiting the Red Sea Film Festival in style. With his presence, he made everyone go crazy. During his session, he was spotted discussing his much-anticipated picture. "It is a film made by one of the most outstanding directors we have in our nation, Mr. Raju Hirani," he explained. Abhijat Joshi, a wonderful writer, wrote it. It's a story about folks who desire to return home when they eventually get the call. It's a comedy flick. His films are typically a blend of humour and strong feelings towards the country.It's a long voyage for me, and the video travels to other parts of the world before returning to India."
Shah Rukh was most recently seen in Zero in 2018. After a lengthy wait, his fans will be able to see him as Dunki, Pathaan, and Jawan in 2023. Pathaan will star him and Deepika Padukone, while Jawan will feature him and Nayanthara.
Also Read;
Aishwaryaa shares a PHOTO of 'birthday boy' Rajinikanth with her sons. | flick. Taapsee said, "If you get to romance Shah Rukh Khan in a Rajkumar Hirani film, I'll play a supporting part… as well. What else | 39 |
Xella manufactures and markets building materials, gypsum fiberboard and cement-bonded dry lining panels together with lime and limestone under the brand names Ytong, silka, mulipor, hebel and fermacell.
A reorganization of Xella's SAP authorization concept was necessary because of audit issues in 2007/2008.
In the reorganization project, Xella chose to keep an active role to gain knowledge about the tooling and methodology. At Xella, they're now able to fully maintain the authorization concept themselves; CSI Role Build & Manage supports the authorization maintenance.
"I would always suggest a company to use CSI tools, get skilled and trained in the methodology of the authorization concept and in using the tools rather than just being consulted. With this knowledge you can maintain the authorization concept yourself and keep it<|fim_middle|>. "It was from the very beginning relatively good understandable that the authorizations are built in blocks. The function-tasks concept". Every task a user performs corresponds with a single role in a SAP system. The function of a person (the combinations of tasks), corresponds with a composite role in a SAP system. "Because of this concept, the organization had a good understanding of the authorizations. They see their own descriptions in job roles and they know what their authorizations are". Over the years, Xella is still very satisfied with this concept and continues using the role build and management tool, because it is very easy to maintain changes. For example, to make organizational changes, you only have to adjust the organization structure in the tool and it will generate the roles for you. The function-tasks concept is very stable and is implemented in the other SAP systems by Xella herself. New system lines were implemented with the authorization concept and audit did not have remarks about this concept.
Xella is in the process of redefining the Segregation of Duty (SOD) procedures using axl & trax's predefined SOD conflicts rule set. These procedures are implemented together with the (client and web based) role- and user change requests functionality of CSI Authorization Auditor.
"We have built up a very good cooperation and partnership with the SAP security company axl & trax and CSI tools", says Frank Haertwig.
Learn what people say about our EBook "SAP Authorizations Logic, where did it all go wrong?". Learn about our EBook here! | compliant after the project is finished."
CSI Accelerator, now CSI Role Build & Manage, was used together with axl & trax's SOD-free SAP single roles to speed up the reorganization process | 41 |
The service vision of Florence Desert, Chief Customer Experience Officer, Air<|fim_middle|> understand the impact of service quality on the bottom line." | France
Also discover this article on our French blog.
Thirty years at the service of customers
Florence Désert has celebrated her 30th year at Air France. In a career that has seen this practical, action-oriented woman work in B2C, B2B, sales, stopovers, customer service centres and cargo, the customer has always been the focus of her attention. It's thus natural that, since July 2015, she has been Air France's Chief Customer Experience Officer. The post consists in positioning the customer at the heart of the company's concerns and infusing a customer-centric culture throughout the organization, ensuring that all Air France's divisions seamlessly deliver the same quality of customer experience.
Over the past thirty years the way customers engage with the company has been transformed. Digitalization has radically changed their behaviour. When Florence headed up Air France's customer service centres in the early 2000s, its 1,200 customer service agents handled 12 million calls a year. A few years later, thanks to the development of the internet, that number had dropped to 7 million. By then, the foundations of Air France's service culture were already in place: even if the approach at the time was more quantitative than it is today, Air France, by not using scripts in its customer service centres, ensured that the quality of interaction with the customer remained a central focus.
The British Experience: Air France Cargo, a technology-intensive service with a human face
Offered an opportunity to assume new responsibilities abroad, Florence became an expatriate in London. Heading up the cargo sales management team, she represented Air France-KLM-MartinAir, positioned as a challenger in the market. Cargo is a pure logistics business and, at Florence's end, it consisted in filling an airliner's cargo holds with commercial goods. In this business, everyone, no matter what their function in the organization, is in contact with the customer. Florence took up her post just before the Lehman Brothers crisis, and thus in the very difficult economic environment that prevailed then. Competition was ferocious in the face of the local top guns, British Airways and Virgin Atlantic, the American companies in their biggest European market, and the aggressively expanding Gulf companies. Of course, overcapacity was great: for example, over 360 weekly flights were scheduled on UK to New York routes, and over 160 for Dubai and onward to Asia. In such a buyer's market, customers were able to drive prices down even as they demanded higher levels of service.
Air France-KLM-MartinAir decided to differentiate itself from the competition by cultivating personalized relations with its customers. As a market challenger, it did not have the resources to invite its customers for a stay on a tropical island, as Virgin's CEO Richard Branson could do, so Florence played the "customer closeness" card differently. She did not lavish her attentions only on the higher ups in the customer's organization, but also on those who actually place the orders and could, for example, organize pub quizzes (of which the British are so fond). The idea was to reach the customer's entire decision-making chain: "Think of Air France KLM, whether you are a purchasing manager, a local cargo manager or a reservation agent". Florence's strategy for succeeding in this tough environment was to raise her team's game when it came to customer relations, making them more professional. She focused on two aspects:
Customer closeness (availability) and proactivity. Even Florence, the market manager, took calls from key accounts at all hours. With each new process (the arrival of e-technology, for example), the team closely accompanied customers. When a problem arose, Florence would, as far as possible, anticipate its consequences and alert her customers.
Hyper responsiveness. In order not to lose an opportunity, one had to be capable of answering an inquiry or issuing a quote in less than an hour, despite the complexity of certain matters. One had to be inventive in organizing a solution and very agile in its execution.
The strategy paid off. In business terms, Florence's teams maintained the company's market share in a very grim economic environment. In terms of service culture, Air France KLM distinguished itself from the competition by being the player with a human touch: having a global offer but a local approach. Indeed, presence, closeness to customers and responsiveness were what made it strong in those economically depressed times.
The lesson: "Simple is beautiful"
Britain's pragmatic service culture has had a lasting influence on Florence. She brought back to France two new professional practices, at once simple and effective. The first is that of not waiting conscientiously until a full answer to an inquiry is available, but rather responding immediately, indicating that the request has been received and that all parties concerned, both internal and external, are working on it. The second is not to waste time elaborating rules and procedures for the 2% of customers who may be ill-intentioned, but rather to reimburse them without haggling, as the British do. This works out better in terms of time, cost and customer satisfaction.
By way of conclusion, a motto: "There's nobility in service"
This is a conviction Florence holds firmly, like a personal motto: there's nobility in service. Successful performance depends on a service culture, which in turn depends on teamwork, creativity and an intelligent grasp of situations.
In terms of education and training in teamwork, the British are better equipped!
A couple of French strengths, according to Florence:
"The French are capable of excellence in service, even of being the best in their field, especially in exceptional or crisis situations. Routine, however, bores them, and can make their performance irregular over the medium term."
"When service 'à la française' is good, it is often a rather unique experience, and therefore more difficult to replicate."
A couple of British strengths, according to Florence:
"Their culture of politeness and cordial relations is an asset in services… it's fertile ground for a service culture."
"They are economically intelligent, they immediately | 1,242 |
Naiman's Catering is a full-service catering company located in Louisville, Kentucky. In business for more than 30 years, the company takes pride in its personalized service, which includes meeting with clients in their homes and allowing them to try samples of the food. The company has extensive experience working with local venues, and the staff is committed to going above and beyond for your special day. Committed to detail, creativity and elegance, the company aims to make sure each meal is a special one.
The company offers setup, cleanup and delivery services. They'll also provide a catering staff and work with you to design your menu.
TOP NOTCH!! Everyone at our reception had nothing but compliments on the food and service of the servers. They stayed in contact we me leading up to the wedding. Arrived on time, food was ready when guest arrived and did an excellent job cleaning up. Naimon's is second to none.
Outstanding service!! We have worked several weddings and events with Les and his staff. They are friendly, extremely attentive to guest and their needs. Les works closely with his clients to give them the best quality of food and service<|fim_middle|>ing to anyone who is looking for a caterer. | while staying within their budget. We would and do recommend Naiman's Cater | 16 |
Fifth FAA-Conforming HondaJet Achieves First Flight
Aerospace, Manufacturing Aerospace, Aircraft, Airplanes, Aviation, HondaJet, Jets
HondaJet Program Approaches Final Phase of Flight Testing
GREENSBORO, N.C. – May 20, 2013 – Honda Aircraft Company today announced that its fifth Federal Aviation Administration (FAA) conforming HondaJet, equipped with a production interior matching the final customer aircraft, successfully completed its first flight on May 16, 2013 at the company's world headquarters in Greensboro, N.C. With this achievement, the HondaJet program approaches the final phase of flight testing as the company advances toward FAA aircraft certification of the world's most advanced light jet.
"An aircraft's first flight is an important and emotional milestone," said Honda Aircraft Company President and CEO Michimasa Fujino. "This is especially true<|fim_middle|> and most fuel-efficient jet in its class.
About HondaJet
HondaJet is the world's most advanced light business jet aircraft, with best-in-class advantages in performance, comfort, quality and efficiency. The HondaJet is the fastest, highest-flying, quietest, and most fuel-efficient jet in its class. The HondaJet incorporates many technological innovations in aviation design, including the unique Over-The-Wing Engine Mount (OTWEM) configuration that dramatically improves performance and fuel efficiency by reducing aerodynamic drag. OTWEM design also reduces cabin sound, minimizes ground-detected noise, and allows for the roomiest cabin in class, the largest baggage capacity, and a fully serviceable private aft lavatory. The HondaJet is powered by two highly fuel-efficient GE Honda HF120 turbofan jet engines, and is equipped with the most sophisticated glass flight deck available in any light business jet, a Honda-customized Garmin® G3000 next-generation all-glass avionics system composed of three 14-inch landscape-format displays and dual touch-screen controllers. The HondaJet is Honda's first commercial aircraft and lives up to the company's reputation for superior performance, efficiency, quality and value.
For more information, visit www.hondajet.com.
About Honda Aircraft Company
Honda Aircraft Company, LLC, a wholly owned subsidiary of American Honda Motor Co., Inc., was founded in 2006 though has its heritage in more than 20 years of groundbreaking aeronautical research and development. At Honda Aircraft's world headquarters in North Carolina, the birthplace of aviation, the company's associates work in more than 500,000 square feet of state-of-the-art R&D, manufacturing and administration headquarter buildings to develop, produce, market and support the HondaJet with HondaJet dealers. The challenging spirit upon which Mr. Soichiro Honda founded Honda Motor Co., Ltd. is alive today as Honda Aircraft fulfills one of Honda's long-standing dreams to advance human mobility skyward.
SOURCE: HondaJet
Jeppesen Terminal Charts Now Available Through Honeywell GoDirect Flight Bag Pro Platform
Boeing HorizonX Invests in Fortem Technologies, Creator of Radar Systems for Unmanned Aerial Vehicles
Boeing Crowdsources Employee Ideas for $100 Million Tax Reform Investment | for our fifth FAA-conforming HondaJet. This aircraft is equipped with a production interior and options, and it will anchor the final leg of our flight test program. From inside and out, this HondaJet matches the final configuration of a customer aircraft."
The light jet lifted off at 3:00 p.m. EDT from the Piedmont Triad International Airport (KGSO). During the 60-minute flight, the aircraft performed very smoothly with an initial climb to 12,000 feet, reaching a top speed of 300 Knots True Air Speed (KTAS).
Howard Judd, pilot-in-command, and Stefan Johansson, co-pilot, completed several checks during the flight, including low and high speed handling characteristics, avionics and system functionality including the stall protection system. Data gathered during the flight was transmitted in real time to the company's on-site flight test telemetry operations for analysis.
This aircraft will be used for function and reliability (F&R) testing. F&R testing will simulate in-service flight operations of the aircraft. It has a production interior with standard lavatory and options including a side-facing seat, and will be used for interior and cabin systems tests. Future testing on the aircraft will also analyze the controller-pilot data link communications (CPDLC).
The fifth conforming HondaJet features the signature HondaJet paint scheme in a special edition blue and pearl white finish with a metallic gold stripe, an artistic moniker to signify the plane's unique role to the program. The cabin's color palette is parchment, a pale beige base that is one of two interior color options available on the HondaJet.
Since 2010, Honda Aircraft has developed and produced six FAA-conforming HondaJets. Four active flight test aircraft include:
First conforming aircraft – aerodynamics, performance, and stability and control testing
Third conforming aircraft – mechanical system testing
Fourth conforming aircraft – avionics and electrical testing
Fifth conforming aircraft – function and reliability (F&R) testing; and cabin system and interior, and options testing
Two ground test aircraft include:
Second conforming aircraft – structural testing and retired from the ground test program in 2012 after successfully completing all ultimate load testing, European Aviation Safety Agency (EASA) bird strike test, and seat attachment test
Sixth conforming aircraft – structural testing and joined the program in October 2012; currently being used for static testing and damage tolerance testing
"Our flight test fleet maintains a very active schedule and continues to complete milestones for FAA certification flight testing" said Fujino.
The HondaJet is priced at $4.5 million (€3.41 million), and its design incorporates advanced technologies and concepts. The HondaJet patented Over-The-Wing Engine Mount (OTWEM) configuration, Natural-Laminar Flow wing and fuselage nose and composite fuselage were developed from long-term research activities. These innovations combine to make the HondaJet the fastest, most spacious | 609 |
Homepage > eco-tourist destinations in Vietnam
eco-tourist destinations in Vietnam
Eight forests suitable for nature enthusiasts in Vietnam
Cuc Phuong, Nam Cat Tien and U Minh are the ideal eco-tourist destinations for families or groups of young people on the weekends.
Located 120 kilometers south of Hanoi, Cuc Phuong national park was established in 1962 and is the oldest national park in Vietnam. Consisting of more than 200 square kilometers of tropical forest and many grottoes, the reserve is rich in wildlife and natural beauty and also possesses historical significance, as prehistoric tools and ancient tombs have been discovered in some of the caves.
The best way to explore the park is by a combination of motorbike or bicycle and foot.
You'll see some sights en route to the centre: Mac Lake is less than two kilometers from reception and so reachable on foot. The lake itself is pretty enough and there is accommodation and a restaurant along its banks. Around five kilometers further on is the cave of prehistoric man, now apparently a refuge for bats.
The park centre itself houses a restaurant, a cafe, a shop and more accommodation, and is the starting point for a six kilometer walk to the thousand year old tree. You can also take a short detour to visit the Palace Cave. The tree itself is impressive but not worth more than a few minutes, although there's space to sit and rest ready for the return journey.
For those seeking a longer walk, it is 16 kilometers from the park centre to a Hmong<|fim_middle|> Park
U Minh Ha National Park is located in the two districts of U Minh and Tran Van Thoi of Ca Mau Province, including more than 8,000 hectares of indigo blues and 25,000 hectares of buffer zone as well as rich fauna and flora.
Tourists can visit the observatory which is 24 meters high. Standing on the forest observation deck, visitors are surprised at endless forests and vast waterways.
U Minh Ha is one of three core zones of the Mui Ca Mau (Ca Mau Cape) World Biosphere Reserve.
In U Minh Ha, visitors can rent a boat to go along interlacing canals or walk through the forest. The national park is also home to various wildlife species, including deer, wild boars, monkeys, weasels, snakes, turtles and pangolins, many of which were listed in the Red Book.
There are also around 60 kinds of freshwater and brackish water fish. Visitors can fish by themselves or ask local people to help spread the net to catch fish. After the forest travel, visitors together process and enjoy delicious and delicious rustic dishes such as grilled freshwater fish, fried field mouse, grilled snake with water lily and premature lotus leaves.
The forest is a source of life for local people on this land, producing an abundant and rich resource of produce. The forest not only protects but also helps them create revenues to feed their families.
Travelling and discovering mangrove forests in daytime, along with catching voles are expected to be a memorable experience for visitors to the southern forest land.
However, visitors will be limited during the peak seasons in March and April due to the work of forest fire prevention and control.
Source Vietnamnet | village. This needs to be visited through an organised trip – Cuc Phuong runs a number of tours including overnights in the village. Other walks, such as the fossil and ancient tree loop trail, also require a guide.
As well as the natural environment, Cuc Phuong is home to the Endangered Primate Rescue Centre. This houses around 150 primates from endangered species in large enclosures. The aim of the centre is to release the animals back into the wild, but it is often difficult to rehabilitate them and they have only released a small number since the centre opened in 1995.
Over the road from the Endangered Primate Rescue Centre is the Turtle Conservation Centre, a rescue facility for turtles confiscated from the wildlife trade. The entry hall has some well presented displays detailing the problem and up to 19 species can be seen inside.
April and May are ideal months for a visit as the park is alive with butterflies and the weather is likely to be hot but dry. Other than that, any time is good as long as you are prepared for the weather: remember it gets chilly December through February.
Ba Be National Park, Bac Kan Province
Located 250 km away from Hanoi, Ba Be National Park belongs to Ba Be district in Bac Kan province.
Designated as Vietnam's eighth national park in 1992 and covering an area of about one hundred square kilometers, Ba Be is a region of astounding beauty, from the lush vegetation mirrored in the lake's still waters to towering limestone pinnacles that reach over 1500m.
The main attractions for visitors are boat trips to visit caves, waterfalls and minority villages, with the added bonus of seeing at least a few of the 220 animal, 417 plant and 49 fish species recorded here.
Bears, tigers and one of Vietnam's rarest and most endangered primates, the Tonkin snub-nosed langur (Rhinopithecus avunculus), live in a few isolated communities on the fringes of the park, but nearer the lake there's a good chance of spotting the more common macaque monkeys, herons and garrulous, colourful flocks of parrots.
Vietnam's largest natural lake, Ho Ba Be forms the core of the delightful Ba Be National Park, a feast of limestone and tropical forest. Enclosed by steep, densely wooded slopes breaking out here and there into white limestone cliffs, the lake is 7km long, up to 30m deep and a kilometer wide in parts. A few islands decorate the surface.
Phong Nha - Ke Bang National Park
Covering an area of more than 343,000 hectares, Phong Nha – Ke Bang National Park is situated in Quang Ninh, Bo Trach and Minh Hoa districts of the central province of Quang Binh.
Designated a UNESCO World Heritage site in 2003, the Phong Nha-Ke Bang National Park contains the oldest karst mountains in Asia, formed approximately 400 million years ago. Riddled with hundreds of cave systems – many of extraordinary scale and length – and spectacular underground rivers, Phong Nha is a speleologist's heaven on earth.
Serious exploration only began in the 1990s, led by the British Cave Research Association and Hanoi University. Cavers first penetrated deep into Phong Nha Cave, one of the world's longest systems. In 2005 Paradise Cave was discovered, and in 2009 a team found the world's largest caveSon Doong. In 2015 public access to two more cave systems was approved.
Above the ground, most of the mountainous 885 sq km of Phong Nha-Ke Bang National Park is near-pristine tropical evergreen jungle, more than 90% of which is primary forest. It borders the biodiverse Hin Namno reserve in Laos to form an impressive, continuous slab of protected habitat. More than 100 types of mammals (including 10 species of primate, tigers, elephants, and the saola, a rare Asian antelope), 81 types of reptiles and amphibians, and more than 300 varieties of bird have been logged in Phong Nha.
Bach Ma National Park
Bach Ma national Park is about 40km to the south of Hue city and 65km to the North of Da Nang. With the beauty of semi- tropical rain forest and cool climate, Bach Ma National Park is famous as an ideal resort for tourists to relax and explore the wild beauty of nature.
It has a diversity of flora and fauna and is the home to many rare animals. Coming to Bach Ma, visitors can walk, look at a panoramic view of mountains, rivers, lagoons and villages, hear birds singing, step in the cool streams and see many kinds of animals and plants.
As the bio geographical border between northern and southern Vietnam and having a wide variety of habitats, the park is well-known for its biodiversity. Some people consider Bach Ma "The centre of flora diversity in Vietnam", as it represents around one-fifth of the entire flora of the country.
The forest also possesses a precious source of over 500 species which serve as medicinal plants. Besides, this is where people can luckily see "Sao la" (Pseudoryx nghetinhensis), a type of antelope that exists only in Vietnam, first discovered in 1992. It may be one of the rarest mammals on the planet.
Nature lovers, especially those who are eager for bird-watching would find Bach Ma a real paradise on the ground. The 358 species of birds in the park account for more than one-third of the bird species of Vietnam, including the fabulous crested argus pheasant and the tenacious Edwards' pheasant (the symbol of Bach Ma National Park) – unseen and thought to be extinct for 50 years.
Numerous bird species like pigeons, bulbuls, malkohas, crow pheasant, herons and egrets and sights of parakeets, kingfishers or jungle fowl are worth adding to tourists' bird-watching.
Tourists are advised to visit Bach Ma National Park in February, when famous red Rhododendron simsii blossom along small streams and in particular at the bottom of the Rhododendron waterfall. During that period of time, the weather is ideally dry with favorable temperatures. In addition, summer is tourism season as people want to escape the heat, from June to August.
Yok Don National Park
Yok Don National Park, the largest of Vietnam's nature reserves, encompasses 115,000 hectares of mainly dry deciduous forest. The park runs all the way up to the border with Cambodia, with the beautiful Serepok River flowing through it.
Yok Don is home to 89 mammal species including wild elephants, tigers, leopards and rare red wolves. However, these exotica are very rare (and virtually never encountered by visitors). More common wildlife includes muntjac deer, monkeys and snakes. Numerous bird species live in the park, including storks and two types of hornbills.
Within the park's boundaries are four minority villages, predominantly M'nong but also with Ede and Lao people. Three villages are accessible (one by boat from the park office) while the fourth is deep inside the park and out of bounds.
The delicate balance between ecological conservation and the preservation of local cultures is a challenge, considering the poverty of the region's people and their traditional means of survival, such as hunting.
Buon Don district in Dak Lak province is famous as a centre for elephant riding which is considered as a long tradition of several ethnic groups in the Central Highlands. Elephant riding is now growing in popularity as a tourist attraction, bringing increasing numbers of visitors and revenue to the area. Visiting to Yok Don, you will be able to take elephant rides into the national park.
Cat Tien National Park
Cat Tien comprises an amazingly biodiverse area of lowland tropical rainforest. The 72,000-hectare park is one of the outstanding natural treasures in Vietnam, and the hiking, mountain biking and bird-watching here are the best in the south of the country.
A haven for lovers of nature and outdoor activities, Cat Tien National Park is one of six biosphere reserves recognized by UNESCO in Vietnam. The park protects one of the largest areas of lowland tropical rainforests in Vietnam and is home to many rare fauna and flora, as well as animals including Asian elephants, sun bears, gaur and a variety of smaller mammals.
Fauna in the park includes 100 types of mammal including the bison-like guar, 79 types of reptile, 41 amphibian species, plus an incredible array of insects, including 400 or so butterfly species. Of the 350-plus birds, rare species include the orange-necked partridge and Siamese fireback.
Tra Su forest
The 845-hectare Tra Su cajuput forest, 25 km southwest of Chau Doc town, An Giang Province is home to more than 70 species of birds, including storks, egrets, and herons.
The best time to visit is when the cajeput (paperbark) forest is flooded, from July to November.
A one-hour exploration by boat includes a motorboat ride and then a peaceful cruise by rowboat through the brilliant green duckweed, lotus flowers, and water lilies. The tour usually includes a stop at a bird-observation tower that is 23 meters high. For most of the year, the sanctuary's narrow 12-km track can also be explored by bicycle, with rentals available at the boat station.
U Minh Ha National | 2,070 |
Find general information and resources on dietary supplements below. Also see:
Questions and Answers on Dietary Supplements
HHS. National Institutes of Health. Office of Dietary Supplements
MedlinePlus: Dietary Supplements
HHS. National Institutes of Health. National Library of Medicine
Understand dietary supplements with<|fim_middle|> Dietary Supplements
Dietary Supplement Fact Sheets
Dietary Supplements for Weight Loss
This fact sheet describes what's known about the safety and effectiveness of many ingredients that are commonly used in weight-loss dietary supplements.
Know the Science: How Medications and Supplements Can Interact
This interactive tool was designed to help you better understand how medications and supplements can interact in potentially harmful ways, and why it's important to speak with your doctor about supplements. | information and resources that cover a variety of related topics. Also available in Spanish.
Dietary and Herbal Supplements
HHS. National Institutes of Health. National Center for Complementary and Integrative Health
Links to information to help understand dietary supplements, find research resources and clinical trials, and more.
MedlinePlus: All Herbs and Supplements
Find resources for over 100 herbs and supplements organized alphabetically.
Office of Dietary Supplements
Find evidence-based information about dietary supplements. Resources include:
Background Information: | 104 |
With October fast approaching, we've mixed together the perfect Holiday drink to kick off the season! One leaf falls to the ground and we begin rummaging through our closet preparing our sweaters and cute scarves for Autumn- dusting off the decor from last year, and buying up all the cinnamon scented candles one can find. This is the reality for many, die-hard Autumn folks who are already waiting in line for the signature Autumn indicator- pumpkin spiced EVERYTHING! Fantasizing about the treats that are routinely eaten at the end of the year, and in such quantities that it can constitute for a dominant portion of our diet, means getting our bodies prepared for sugar overload! If maintaining a healthy diet during this holiday season is your goal, then there's no reason why your favorite flavors have to be skipped due to excess chemicals and sugars. We're here to support you with healthy alternatives to your holiday favorites. Let us introduce, the deviously-delicious, Pumpkin Spiced Proteini Shake! Less sugar than those popular frapps, with the same classic pumpkin spice flavor!
This recipe is dairy-free (less fat) with a low amount of sugar. We will use frozen banana for consistency and sweetness. Slice two bananas and freeze overnight, or a couple of hours, until completely solid.
Next prepare your pumpkin puree. Note * Avoid accidentally purchasing Pumpkin Pie filling.* There really isn't too much preparation to this recipe which makes it great to add to your mornings or to enjoy after your workout.
Add all ingredients, including pitted dates, into a blender with a couple cubes of ice. The more ice you use the thicker your consistency. Blend and serve.
For added sweetness or just to top off, sprinkle toasted coconut or crunchy graham cracker with a dollop of coconut whipped cream! I don't care how basic they say Pumpkin Spice is! I can drink this all day! Blood Type: Pumpkin spice!
Instructions: Blend almond milk, bananas, pumpkin, dates, protein powder, vanilla extract, nutmeg, cinnamon, cloves, and ginger together in a blender until smooth.
Another less-known fact about sugar is that liquid sugars, like those used in<|fim_middle|>ice, or like us on Facebook. Our full product lineup and guided cleanse can be found at smartpressedjuice.com. | drinks, metabolize quicker than solid sugars found in food. These may have a bigger and faster impact on your body; liquid sugar calories do not register in the body the same way as calories from solid foods. Studies show, these calories do not elicit the same fullness signals as eating them. So in order to avoid consuming an excess amount of sugar this holiday season, make sure your beverages contain little, to no sugar. If you are looking to simply cut back on sugar, try avoiding refined sugars, and opt for natural sugars like those found in fruit (natural fructose), raw honey, agave nectar, and monk fruit sweeteners. Once we are aware of the implications and the way the body processes food, we are able to make healthy, and SMART choices, for the season and for life in general.
Want more information like this? Please check out our Instagram @smartpressedjuice, Twitter @smartpressju | 188 |
The fairy tale version of coming up with a new product idea is the eureka moment. But, real life is not always a straight line. Sometimes you stumble across an idea in quite an indirect and seemingly random way.
One of my favourite apps, back in the day, was FavIt by Tim Haines. It would display a single tweet at a time (based on top-ranking favourites from the FavStar.fm site). You could flick left and right to navigate through the list or pull down to reveal more information about the tweet and its author.
It was a delightful and tactile app, and I would often find myself soaking up the odd spare moment I had when out and about during the course of a day to be entertained by some funny tweets.
Sadly, it didn't survive the transition to the new Twitter API, and eventually stopped working altogether.
Mourning its demise, we got to talking about what other types of app would work better with a scroll view rather than a table list view.
One idea was dating, and that turned into a bit of a rabbit hole that we went down for a while. However, as I've written about previously, the best things to work on are things you care about, have authority in and are prepared to take responsibility for, and that particular idea didn't really chin any of those three bars for us.
Then one day Koz suggested email. Genius!
We seem to spend a lot of time fighting our inboxes.
That's certainly something we'd care to fix.
"Imagine if there was an app that let me use a spare 5 minutes here and there to quickly filter out all of the emails which I can just read<|fim_middle|>, far too long and not easily compressed into a soundbite, is actually much more interesting. Perhaps you won't mind?
I hope lots of you will be tempted to buy it and use it. We're hopeful that sales will justify the time we've invested in it, of course. But, mostly we're just excited that people will get to enjoy something that we've made with pride and will find it useful.
If you do, it would make us happy to hear from you and even happier if you would tell your friends.
And, if you don't, let us know too, so we can maybe make it better in the future, or at least be amused by your witty one-star review.
Either way, Triage: Email First Aid is available now. Go get it.
This week we finally take the covers off a side project we're calling: Bullseye.
If you're a software developer there are bunch of popular tools that you can use to help you plan and manage your projects: Basecamp, Pivotal Tracker and (the new kid on the block) Trello. In fact we used all three in the process of developing Bullseye. But, as Rod pointed out, none of these are designed for CEOs and Founders to manage high-level strategy and executive teams.
Shared, but low maintenance. Unlike other tools that require your whole team to be on-board, you control who has access to Bullseye. You can instantly record commitments from your managers and ensure that each project is contributing to your strategy.
Execution, not status updates. Bullseye allows you to make the most of the time you spend with your team, by focusing your attention on the projects and actions that are off-track or not getting enough focus, rather than wasting precious time on status updates.
But, don't take our word for it, there's a 30-day free trial available to everybody now, so kick the tyres yourself and let us know what you think. It may be just what you need.
When we started putting Southgate Labs together, about 18 months ago, one of the first people we spoke to was Vaughan from Vend.
He had first floated the idea for a web based point-of-sale with me somewhere over the Akatarawa Ranges en route to Otaki, as he cycled the length of New Zealand. By the time I heard from him again he'd built the first version and already had a couple of paying customers. Now that's what impresses potential investors!
In fact they weren't just customers, they were raving fans. They wondered if the decimal point was in the wrong place in their monthly subscription price, compared to the painful expensive support contracts they were used to, and they found the software itself was beautiful and easy to use.
Finally POS means "point of sale" again.
It was great to have a chance to invest early and allow him to work on the venture full time. We convinced Sam to invest too. I've been privileged to piggy-back with Sam on a number of the early-stage investments he's done over recent years, so it was nice to be able to return the favour.
But, more than that, it was great to have the chance to get involved.
We've enjoyed helping him push it along over the last year, working on the product design and user experience, branding and marketing site, making introductions where that has been useful, a number of long planning sessions as we all tried to wrap our heads around the opportunity, and basically whatever was required (as is the nature of a venture like this). It's been fun to see the product getting better and better and the number of customers increasing.
So, it's exciting this week to announce the end of the beginning and the beginning of the next phase in the development of the company. From the very early days we've been in touch with Christoph Janz from Point Nine Capital based in Berlin, Germany. They have been involved in a number of successful start-ups, including Zendesk, Free Agent and Geckoboard, and it's excellent to welcome them into the team as investors and advisors, along with some kiwi angels.
If you're a designer, developer or business development person looking to be part of an exciting start-up then get in touch now.
It's great to be part of something like this.
Onwards and upwards from here, hopefully!
Predicting rain doesn't count. Building an ark counts.
It's not enough to know what to do, think about doing it, put it on a list. It turns out that all of those are very common.
The only thing that separates you from the pack is actually completing things.
To be successful, it seems, you just have to do the things that most people don't. And, unfortunately, most people don't do much.
So, how do you get better at this?
I think that is a really elegant and simple idea, and pretty much the polar opposite of every productivity system and to-do application I've used. Rather than combining more and more complex ways of capturing, storing, sorting and retrieving lists of tasks it starts with a focus on completing important things.
And so, I'm pleased to announce Top Three for iPhone, a new app that replaces the index card and helps you change the way you manage your priorities. Every day you get three new slots to fill. Choose the most important things and tick them off as you complete them. At the end of the day, or the end of the week, look back and see how many of your priorities you actually completed.
This has been an interesting app to build, not because it's technically difficult1 but because it's functionally simple, and as a result there is a constant temptation to add more features. I've intentionally left out just about all of the things that you'd normally expect from a to-do app. It doesn't let you tag and categorize, it doesn't let you search, it doesn't let you order and re-order (beyond the three slots you see), it doesn't let you set due dates and it doesn't let you schedule tasks for far into the future – you can add and edit tasks for today and tomorrow and that's all. There are literally hundreds of to-do apps in the app store, and this may be the most simple of them all, but I'm hoping that it's amongst the most useful as a result.
I have some free copies to give away to the first people who email support@southgatelabs.com – I just need you to tell me what your existing to-do app is (if any) and also promise to send me some feedback telling me what you think of it once you've been using Top Three for a week or two and to post a review on the iTunes App Store, positive or negative – you decide (note: these codes are valid in the US App Store only).
Either way, if you decide to download the app and use it I'd love to hear from you. I hope you find it useful. Thanks in advance for giving it a try.
We pulled the plug on Wingman yesterday.
It was an itch. We scratched it.
We never really got it working to our satisfaction, and as a result we never really got to the point where we were comfortable pushing it harder.
We launched with an incomplete product. Possibly too incomplete?
I still believe that if you launch and you're not a little embarrassed you launched too late, but I'm coming around to the school of thought that says you shouldn't launch at all.
We put a throttle in place to ensure that we were not slammed by too many users before we were ready (a simple "enter your email address and we'll send you an invite link when we're ready"). We got slammed anyway.
I'd probably try and do that differently, given the opportunity.
Lots of people signed-up and used the service, kicked the tyres briefly, but moved on too quickly.
We never really had a product that was compelling or a business model that was obvious.
So, given the futility of flogging dead horses, this was an easy decision.
I enjoyed working with Koz. I'm fortunate to be involved in other ventures that he is also working on and look forward to working with him again soon.
I got my hands dirty with some code again for the first time in ages.
I feel like I could hold my own now in a discussion about Rails and Git (two tools I hadn't previously used). And I know a little about some of the challenges of creating an add-on for Firefox.
I found a great font!
We came up with a great structure for the venture, which is well suited to this sort of prospective product build I think. I will definitely use this sort of arrangement again in the future. When I get some more time I'll write more about this.
Posted on April 28, 2009 July 11, 2010 Author Rowan SimpsonCategories Southgate LabsTags Wingman2 Comments on Come in Wingman? | and delete, so that when I get back to my desk I only have to deal with the messages which require a bit more thought and attention".
You really should pay attention to sentences that start with "imagine if…" or "wouldn't it be better if…" or "what I really need is …". There is gold in them there hills.
We didn't, of course. At least not immediately. That idea just sat there ruminating. Anyway, who would be stupid enough to build an email client, that sounded like a lot of work…!
But, like all good ideas, it kept coming back and demanding some more attention.
Amnon took that the original idea, and came up with the concept of a stack of cards, one for each newly arrived email message, which you could quickly and easily flick up to archive or flick down to keep for later.
When he showed it to us we were both immediately angry that it didn't already exist.
Koz meanwhile had decided that building an email client wasn't that hard (!) and had started working on that.
We decided to share it with some friends anyway. There were some early hiccups ("Archive" can be interpreted to mean "Delete" in some circumstances, right Karl?) Overall the feedback was really mixed. It didn't fit with the way that everybody used email, and not everybody had the problem we were solving, but those that liked it loved it, which was really encouraging (note: if you're testing something and don't hate it, be sure to tell the developer that, your feedback will likely be much more positive than you realise).
It seemed that this was a thing that some people might want. Ideas like that don't come around everyday, so we continued on.
"You know what this is like… it's like triage in an emergency room".
And so we had a name for the app. Triage. It's first aid for your inbox. Perfect.
After a few months and a lot of work, and a bunch more beta testers, and a bit more feedback, and some minor tweaks to the original concept, it eventually got to the point where we weren't horribly embarrassed by it anymore. And what's more we were using it ourselves all the time – I'd long since relegated the old Mail app to the folder on the last page along with Maps, Compass and Voice Memos, with Triage taking its spot in the dock.
We pitched it to some of the speakers at Webstock, who couldn't have come to Wellington at a better time in this process. We were flattered when they loved it and offered to introduce us to others in their network who might be interested.
The last piece of the puzzle was an icon. We wanted something that would belong on the homepage of your phone, and after a lot of work from Amanda, heaps of different concepts and some help from our friend Bryan in the US we eventually came up with something that we all liked.
All that was left were some final improvements to animations, and some additional fun features such as the achievement stamp for getting to the bottom of the stack and the card wiggle if you tap on one of the arrows, plus a one-page marketing site, and we were ready to submit and now today, make it available for sale.
I'm sitting here trying to come up with a succinct myth to describe how we got to this point for a blog post, and I'm thinking that the reality | 697 |
Chicago police officer tied to disgraced unit faces firing 16 years after scandal broke
WGN personality Ray Rayner dead at 84
By By William Hageman
Tribune staff reporter |
Someone at WGN-Ch. 9 once calculated that, during Ray Rayner's first thousand shows on "Bozo's Circus," he threw or was hit by<|fim_middle|> "The Odd Couple" and the lead role in "A Funny Thing Happened On the Way to the Forum."
"Aside from his other accomplishments, Ray also was very much a creature of the stage," said Richard Christiansen, former chief critic of the Chicago Tribune.
"He had a zestful presence and a wonderful voice along with excellent comic timing. There was a sense of enjoyment in his work-you knew he was having a good time, and the audience was having a good time along with him."
"The Dick Tracy Show" ended in 1966, and Rayner moved to "Rocket to Adventure," another children's show, which lasted two years. He left "Bozo's Circus" in 1971, and continued his morning show until he retired from WGN in December 1980. He moved to Albuquerque, where he was soon back on the air, doing weather for the CBS affiliate until 1989.
After his first wife, Jeanne, died about seven years ago, he decided to relocate to Florida, his daughter said.
In addition to his daughter, survivors include his second wife, Marie; a son, Dr. Mark Rahner; and four grandchildren. Mass will be said Saturday in Ft. Myers. | 800 pies and fired off or was sprayed by 700 bottles of seltzer water.
But Rayner, who died Wednesday morning at age 84 of respiratory failure at a Ft. Myers, Fla., hospital, was more than a target for Bozo. He was a TV icon for Chicago Baby Boomers.
"There were times in his career when he was on whenever you turned the television on," said Bruce DuMont, founder and president of the Museum of Broadcast Communications. "To me, along with Bob Bell, who played Bozo for so many years, and Frazier Thomas, who was synonymous with Garfield Goose, he was the other jewel in the crown of children's icons."
The New York-born and -raised Rayner --he was born July 23, 1919 as Rahner but later changed it. He was a B-17 navigator during World War II and was shot down over France. It was during the 2½ years he spent as a prisoner of war that he was bitten by the acting bug.
"They put on plays to kill time," said Rayner's daughter, Christina Miller.
"That was the first time he did any acting. And he loved it." After the war, he attended Holy Cross College for a year, then transferred to Fordham University, where he received a degree in philosophy. He later returned to school and received a master's in humanities from the University of Chicago in 1970.
After college, Rayner started his radio career on Long Island. He became news director for a Dayton radio station in 1949, and later took a job in Grand Rapids, Mich., as a disc jockey. He came to Chicago in 1953 and was hired as a staff announcer for the local CBS affiliate. His Chicago television debut came on a morning variety show, "Rayner Shine."
While at WBBM-Ch. 2, he hosted "The Ray Rayner Show," an afternoon dance party show; "The Little Show," a children's program; and "Popeye's Firehouse." He moved to WGN-TV in 1961, where he became a part of the lives of thousands of Chicago Baby Boomers.
He started out as Sgt. Henry Pettibone on "The Dick Tracy Show," where young viewers could watch the cartoon Tracy battle the likes of Pruneface and Flat Top. Several months later, he also joined "Bozo's Circus" as Oliver O. Oliver, the sidekick clown with the Kentucky accent who served as Bozo's foil.
In 1962, Rayner also became host of "Breakfast with Bugs Bunny," which was retitled "Ray Rayner and His Friends" two years later. At that point, he had three shows and some interesting friends.
There was Cuddly Dudley, a giant orange dog-voiced by Roy Brown, who later became Cooky the Clown on the show-who helped him answer mail. There was Dr. Lester Fisher, director of the Lincoln Park Zoo, who made weekly appearances to talk about animals. And there was Chelveston the Duck.
Named after Chelveston, England, where Rayner was stationed during the war, Chelveston may be best remembered for chasing Rayner around the studio, nipping at his heels. (Rayner later admitted to stashing duck feed in his pants cuffs so the duck would peck at his legs). Rayner inevitably would save himself by providing Chelveston with a head of lettuce, which the duck also would attack savagely.
The morning show featured Rayner in a jumpsuit covered with small pieces of paper-a 1960s version of Post-Its-on which he supposedly wrote things (they were actually blank) he needed to do, such as show a cartoon, visit Cuddly Dudley or work on a do-it-yourself project (most of which ended up as less than artistic successes).
"When he first started his show in the morning, I suggested we do a do-it-yourself segment," said Al Hall, longtime WGN producer and director.
"I gave him a rather simple project to do, which I figured would take about three minutes. It took 15. We were live-I was almost out of my mind. How could anybody be this uncoordinated? About two weeks later, I talked to the guy who used to be his producer at Channel 2, and he said, `Hey, you've got to have him do do-it-yourself projects.' I said, `Yeah, I know.'."
While he was most visible on television, Rayner also did other work during his Chicago days.
"He was a working actor," his daughter said. "He did voice-overs. He did commercials. He did industrials. He did, you name it. He was doing appearances. He did anything any actor in Chicago would do."
Rayner worked extensively at the Candlelight Dinner Playhouse in Summit and the adjacent Forum Theatre, mainly in the 1970s. His major theatrical roles at the Forum and Candlelight included work in Neil Simon's | 1,060 |
Prop Prep
Obs Prep
Data Proc
Volume Vol#, Issue Iss#
Day# Month# Year#
eNews Index
Volume Vol#, Issue Iss# • Day# Month# Year#
NRAO Community Day at UMBC
Jun 13 - 14, 2019 | Baltimore, MD
CASCA 2019
Jun 17 - 20, 2019 | Montréal, Québec
Radio/mm Astrophysical Frontiers in the Next Decade
Jun 25 - 27, 2019 | Charlottesville, VA
7th VLA Data Reduction Workshop
Oct 7 - 18, 2019 | Socorro, NM
ALMA2019: Science Results and Cross-Facility Synergies
Oct 14 - 18, 2019 | Cagliari, Sardinia, Italy
Semester 2019B Proposal Outcomes
Lewis Ball
The NRAO has completed the Semester 2019B proposal review and time allocation process for the Very Large Array (VLA) and the Very Long Baseline Array (VLBA).
For the VLA a single configuration (the D array) will be available in the 19B semester and 124 new proposals were received by the 1 February 2019 submission deadline including one large and sixteen time critical (triggered) proposals. The oversubscription rate (by proposal number) was 2.5 and the proposal pressure (hours requested over hours available) was 2.1, both of which are similar to recent semesters.
For the VLBA 27 new proposals were submitted, including two large proposals and one triggered proposal. The oversubscription rate was 2.1 and the proposal pressure was 2.3, both of which are similar to recent semesters.
There was significant demand for the time made available on space observatories through inter-observatory agreements, and fourteen proposals requesting time on HST, Swift or Chandra (together with AUI/NRAO telescope time) were submitted.
The proposals were reviewed for scientific merit by nine Science Review Panels (SRPs) and for technical feasibility by NRAO staff. These reviews were completed in February – March 2019 and then considered by the Time Allocation Committee (TAC) at a face-to-face meeting on 24-25 April 2019 in Green Bank, West Virginia. The TAC – comprising the 9 SRP chairs – was charged with recommending a science program for Semester 2019B to the Observatory Director. The recommended program was reviewed and approved on 8 May 2019.
Proposals submitted to the GBO were assessed through the same process. Fifty eight proposals for the GBT were received for the 19B Semester, including one large and four triggered proposals. The oversubscription rate is 2.5 and the proposal pressure is 2.2. For information on proposals for GBT observations see the GBO website.
A disposition letter was sent to the Principal Investigator and Co-Investigators of each proposal on 16 May 2019 and a TAC report containing information for proposers and observers, including statistics and telescope pressure plots, was released the same day. The approved science program for the VLA and the VLBA has been posted to the NRAO science website. The authors, title, abstract, and scheduled hours for each approved proposal can be accessed from the Proposal Finder Tool.
The Student Observing Support program continues to be available for NRAO observing programs and we encourage Principal Investigators of highly ranked VLA and VLBA proposals to consider applying for support.
The NRAO welcomes community feedback on the proposal review and time allocation process. Please provide such feedback via the Proposal Review department of the NRAO Helpdesk.
Announcement of Opportunity – Extra-Large Proposals
NRAO and GBO will consider submissions of Extra-Large observing proposals (X-proposals for short) at the upcoming 1 August proposal submission deadline. This opportunity is open for observers seeking to use the VLA, VLBA and / or GBT. Extra-Large proposals will be defined as those requesting a total of more than 1000 hours of telescope time and / or extending over four or more observing semesters. Note that the earliest that successful Extra-Large projects could be scheduled is the start of Semester 2020B in August 2020. The opportunity to submit Extra-Large proposals will likely not be repeated for at least three years.
Regular and Large proposals continue to be encouraged for Semesters 2020A and beyond. At least 50% of open skies science time on each of the VLA, VLBA and GBT will continue to be made available for Regular and Large proposals from Semester 2020B. (The maximum amount of time that can be requested through a Large proposal will be capped at 1000 hours starting from Semester 2020B.)
To be accepted, Extra-Large proposals will be expected to demonstrate outstanding science impact, a high level of scientific and technical readiness, and excellent legacy science value (potential to generate high science impact from community use of archival data and data products.)
The capabilities available for Extra-Large Proposals will be restricted to a subset of general observing capabilities – Shared Risk Observing and Resident Shared Risk Observing capabilities will not be available for Extra-Large proposals, and high-frequency bands (12 GHz and above) are likely to be excluded or severely restricted for all three telescopes because of scheduling difficulty and the limited available time with suitable observing conditions. Specific capabilities that will not be available for Extra-Large proposals are:
For the VLA – pulsar modes, phased array, subarrays, mixed 3/8-bit samplers, moving sources (including Solar and planetary observing), and On-The-Fly mosaicking; in addition, observing time at 12 GHz and above will be restricted according to the expected availability of suitable observing conditions;
For the VLBA – moving sources and 3mm observing; in addition, observing time in the 2cm, 1cm, and 7mm bands will be restricted according to expected availability of suitable observing conditions;
For the GBT – monitoring and fixed time observations, observations with any weather restrictions (typically above 8 GHz).
Extra-Large Proposals requiring fixed observing dates will not be supported for any telescope. Additional band, configuration, response time and cadence restrictions may also apply for each telescope. The definitive list of capabilities excluded from Extra-Large proposals will be provided in the Call for Proposals that will be released on 2 July 2019.
The scientific review process for Extra-Large proposals will be different from the normal NRAO Science Review Panel (SRP) / Time Allocation Committee process. The Science Review Panels will assess the scientific potential of each Extra-Large proposal in their science area, providing comments and a coarse grading<|fim_middle|>. Bowen Professor of Astronomy, Emeritus, at the California Institute of Technology (Caltech). The Jansky Lectureship is an honor established by the trustees of AUI to recognize outstanding contributions to the advancement of radio astronomy.
Professor Sargent is being honored for her pioneering, and continuing, studies of young stars and the dusty disks that surround them -- disks from which planets form. In addition, she has been a leader in the astronomical community, serving on important boards and committees and in offices for scientific organizations, while also helping shape the careers of younger astronomers and standing out as an inspiring role model for female scientists.
A member of the U.S. National Science Board and a Fellow of the American Academy of Arts and Sciences, Sargent is a past president of the American Astronomical Society. She chaired the NASA Space Science Advisory Committee and the U.S. National Research Council Board of Physics and Astronomy, and served on the U.K. Science and Technology Facilities Council.
A native of Scotland, Sargent earned her B.Sc. at the University of Edinburgh and her Ph.D. from Caltech, where she has spent her career. She was Caltech's Vice President for Student Affairs from 2007 to 2015.
She has led in the development of important radio observatories, serving as director of Caltech's Owens Valley Radio Observatory, and as founding director of the Combined Array for Millimeter-wave Astronomy, the U.S. precursor to the international Atacama Large Millimeter/submillimeter Array (ALMA). She served on the ALMA board for a decade and chaired it twice.
As Jansky Lecturer, Sargent will give lectures at NRAO facilities in Charlottesville, Virginia, and Socorro, New Mexico. These lectures are open to the public.
First awarded in 1966, the Jansky Lectureship is named in honor of the man who, in 1932, first detected radio waves from a cosmic source. Karl Jansky's discovery of radio waves from the central region of the Milky Way started the science of radio astronomy.
Past recipients of the Jansky award include seven Nobel laureates (Drs. Subrahmanyan Chandrasekhar, Edward Purcell, Charles Townes, Arno Penzias, Robert Wilson, William Fowler, and Joseph Taylor) as well as Jocelyn Bell-Burnell, discoverer of the first pulsar, and Vera Rubin, discoverer of dark matter in galaxies.
Starlink & Constellations of Communication Satellites
Tony Beasley
Recent news reports of planned constellations of communication satellites, including the SpaceX Starlink proposal, have pointed out the potential impacts these systems may have on radio astronomy. For decades, the NRAO and the Green Bank Observatory (GBO), in cooperation with the National Science Foundation (NSF), have worked to ensure that innovations in communications can advance while still preserving our ability to explore the Universe from Earth and conduct essential fundamental research through radio astronomy.
Most recently, the NRAO and GBO have been working directly with SpaceX to jointly analyze and minimize any potential impacts from their proposed Starlink system. These discussions have been fruitful and are providing valuable guidelines that could be considered by other such systems as well. To date, SpaceX has demonstrated their respect for our concerns and their support for astronomy. This includes an agreed-upon protocol to monitor impacts and address issues to NRAO's current and future cutting-edge research facilities. We continue to monitor, analyze, and discuss the evolving parameters of the SpaceX system. Among the many proposals under consideration are defining exclusions zones and other mitigations around the NSF's current radio astronomy facilities and the planned future antenna locations for the next generation Very Large Array. We also are working with our international partners, including the Square Kilometre Array, to present their concerns as well.
The United States continues to be a world leader in radio astronomy research and engineering innovations. With the explosion of wireless technologies and the growing potential to lease portions of the electromagnetic spectrum for commercial purposes, it is essential that we safeguard our ability to perform basic research. Ground-based astronomy, whether optical or radio, has benefits that cannot be matched by even the most advanced space-based observatories. The recent imaging of a supermassive black hole is just one example of how ground-based radio astronomy facilities provide powerful and unique capabilities.
The NRAO looks forward to future discussions and is confident that the needs of both the research and communications communities can be met and preserved.
ALMA Program News
Al Wootten
Pablo Carrillo
AN ALMA antenna is moved to its extended configuration location by an ALMA transporter.
Cycle 6 Science Observing
The ALMA antennas have been deployed to their most extensive C43-10 configuration (16.2 km maximum baseline; approximate diameter of Washington D.C. beltway.). Atacama Compact Array observations continue, and 12-m Array observing has resumed in the long baseline configurations. The array will gradually move to shorter baselines over the next few months.
Cycle 7 Call for Proposals
Cycle 7 proposals have been distributed to the reviewers, who will meet in Atlanta, Georgia 16-21 June 2019. Results are expected at the end of July. The Call for Cycle 7 proposals closed with a total of 1785 submitted proposals, a 3% decrease from the 1838 proposals submitted in Cycle 6. In Cycle 7, there were 9123 registered ALMA users, compared to 8811 for Cycle 6, and 8082 for Cycle 5. The total time requested for the 12-m Array is just short of 19,338 hours, 360 hours less than in Cycle 6. This is an oversubscription factor of 4.5X above the 4300 available hours. For the 7-m and Total Power arrays, the total time requested is 9019 hours and 6938 hours, respectively, slightly lower than in Cycle 6. The median amount of 12-m Array time being requested per proposal is 8.9 hours, similar compared to earlier cycles. Detailed statistics for the Cycle 7 Call for Proposals are available at the ALMA Science Portal.
Fourth ALMA Science Conference
The ALMA partnership is organizing the Fourth ALMA Science Conference in Cagliari (Sardinia, Italy) on 14-18 October 2019. The full breadth of ALMA science will be discussed, with special emphasis on results from the first rounds of ALMA Large Programs, ALMA's high resolution and high frequency capabilities, the new Solar and VLBI modes, as well as the synergy between ALMA and other observatories. As in previous editions of the conference series, we expect to discuss the scientific priorities for the implementation of the ALMA Development Roadmap.
Abstract submission for the conference closed on 15 May 2019. Response was gratifying, exceeding the capacity of the venue. As a result, registration has closed, and prospective participants may register on a waiting list basis only. Participant selection is under way; those wishing to attend should postpone further planning until informed of the outcome of the selection process in the second half of June.
Whispers Special Session
Call for oral contributions and posters (deadline: 28 June 2019)
Massive data processing and analysis in radioastronomy: Amsterdam, 26 September 2019
Datasets produced by the current and future generations of radio telescopes are becoming extremely large, due to the increase in sensitivity, instantaneous bandpass per pixel, and the number of pixels per receiver. This main instruments in the (sub)millimeter through the centimeter domain, such as ALMA and the Jansky Very Large Array, now routinely process several tens of GHz with spectral resolutions of the order of 100 kHz, implying the measurement of about 500,000 frequencies simultaneously. Instruments planned for the relatively near-term future, such as a next generation Very Large Array and Square Kilometre Array, will drive yet another revolution in data rate.
Data processing and analysis of these large volumes requires the development of innovative methods based on the most recent advances in signal processing. A proposed one-day session during the Workshop on Hyperspectral Image and Signal Processing: Evolutions in Remote Sensing (Whispers) Workshop in Amsterdam aims at presenting the challenges encountered by the radio-astronomy community and the on-going activities that are designed to solve them.
ngVLA Project News
Eric Murphy
Now that the Astro2020 Decadal Survey process is underway, the next generation Very Large Array (ngVLA) Project Office is continuing to work on producing materials for submission to the Survey. The most immediate submission will be our Activity, Project, and Statement of the Profession Consideration (APC) White Paper, due 10 July, and our full project submission (ngVLA Reference Design) expected to be due later in the Fall. The ngVLA Reference Design is the technical complement to our Science Book, and includes ~ 54 documents (~1500 pages) describing the end-to-end system design with a full bottoms-up supported costing estimate. All materials submitted to Astro2020 will include a critical review by members of the astronomical community.
A number of key scientific documents included in the Reference Design, such as the ngVLA Science Requirements and Operations Concept, have recently been released by the Project Office and can be found on the ngVLA website. These documents, as well as all of the compelling science white papers submitted to Astro2020, will be discussed at our Radio/Millimeter Astrophysical Frontiers in the Next Decade meeting later this month (25 – 27 June) in Charlottesville. I look forward to seeing many of you there!
High-Resolution Radio Interferometry in Space: 2nd International Meeting
Following the spectacular images from the Event Horizon Telescope and the successful Space Very Long Baseline Interferometry (VLBI) missions – the Highly Advanced Laboratory for Communications and Astronomy (HALCA) and RadioAstron – there is growing interest in the next set of Space VLBI technical concepts, including next-generation constellations and millimeter-wavelength systems. This meeting is a second in a series of international meetings, the first of which was held at Noordwijk in 2018. The focus of this second meeting is to review black hole and other Space VLBI science cases, and begin to assess the maturity of the relevant technologies and needed technology developments and roadmaps.
The tentative dates for this second international meeting are 27-29 January 2020 at the NRAO headquarters in Charlottesville, Virginia. Please save these dates and stay tuned for additional information in eNews and at the NRAO science website.
SADC: Delivering High-Speed Data With Minimal Power
Matt Morgan, Jason Castro, Stephen Wunduke, and Tod Boyd
Laboratory test setup for SADC and integrated receiver developments, including cryogenic front-end, warm electronics modules, 10 km fiber-optic link, and backend signal processing.
Almost a decade ago [1], researchers at the NRAO Central Development Lab (CDL) conceived of a method for capturing and delivering digital imaging data over great distances by optical fiber using a factor of ten less power than is consumed by conventional systems. The technique, which leverages the natural, statistical properties of noise-laden data, is implemented in two parts: a digitizer for capturing and transmitting the data, known as the Serial Analog-to-Digital Converter (SADC), and a patented deserialization algorithm [2]–[3] which parses the information at a data processing center potentially many kilometers away. This concept is now a key component of the next generation Very Large Array (ngVLA) Reference Design, as well as a candidate for commercial applications in markets that are sensitive to size, weight, power, and cost, such as wearable technologies, automotive radar, and the Internet of Things (IoT).
The CDL engineers pursuing this line of development achieved a significant milestone this month by successfully streaming live data from a radio-astronomy front-end to a Field Programmable Gate Array processor through 10 km of fiber on a spool (see Figure). The data stream comprised four synchronous channels or lanes, essentially corresponding to upper- and lower-sidebands from two polarization inputs, each running at 8 Gigabits per second (Gbps), for a total throughput of 32 Gbps.
While this milestone was achieved using off-the-shelf hardware programmed to mimic the intended operation of the SADC, a separate application-specific integrated circuit (ASIC) chip has already been developed to perform the same function with an order of magnitude less power and smaller footprint. Test and demonstration boards that utilize this new chip are currently in progress.
Alongside the chip development, the CDL continues to make improvements in the associated deserialization and data processing algorithms, and prototyping the integrated warm-electronics modules needed for the ngVLA. The ultimate goal is to achieve a data rate of 56 Gbps per lane on at least four light wavelengths (about 200 Gbps aggregate per fiber) with a range of 40 km from a front-end receiver module no bigger than a cell phone.
M. Morgan and J. Fisher, Word-boundary Detection in a Serialized, Gaussian-distributed, White-noise Data Stream, Electronics Division Technical Note #213, October 2009.
M. Morgan and J. Fisher, Statistical Word Boundary Detection in Serialized Data Streams, U.S. Patent No. 8,688,617, April 1, 2014. People's Republic Of China Patent No. 201180046318.8, February 5, 2017.
M. Morgan, J. Fisher, and J. Castro, Unformatted Digital Fiber-optic Data Transmission for Radio Astronomy Front Ends, Publications Of The Astronomical Society Of The Pacific, 125, 695-704, June 2013.
Recent Media Releases
Dosvedanya and Farewell, RadioAstron
Cool, Nebulous Ring around Milky Way's Supermassive Black Hole
Ellen Bouton
About this month's photo: A replica of Karl Jansky's original antenna at Bell Laboratories, used in Jansky's detection of radio waves from the center of the Milky Way which was announced in a front-page article in the New York Times on 5 May 1933, was built at Bell Laboratories for installation at the entrance to the Green Bank site. The reconstruction in Green Bank was completed 55 years ago, in June 1964. In this spring 1995 photo, David Jansky (left), Karl Jansky's son, and Grote Reber (right), confer in front of the replica. Photo by Ken Kellermann.
From the Archives is an ongoing series illustrating NRAO and U.S. radio astronomy history via images selected from our collections of individuals' and institutional papers. If readers have images they believe would be of interest to the Archives, please contact Ellen Bouton.
The National Radio Astronomy Observatory is a facility of the National Science Foundation operated under cooperative agreement by Associated Universities, Inc. | . A new X-Proposal Science Assessment Committee (XSAC) appointed by the NRAO and GBO Directors will assess the Extra-Large proposals for their scientific merit and likely legacy science value, taking into account the initial assessments from the SRPs. Observatory staff will assess each proposal for technical readiness, and the final selection of proposals will involve a face to face scientific, technical and operations readiness review in Spring 2020.
Preference will be given to proposals which demonstrate substantial engagement with astronomers at U.S. institutions. Preference may be given to proposals with lower requirements for observatory support, and lower operational impact. The progress of Extra-Large projects that are accepted will be monitored through NRAO Program Management Department processes.
The announcement of successful Extra-Large proposals is anticipated to occur in July 2020. The deadline for submissions will be 1 August 2019, the same as for Semester 2020A regular and large proposals.
Submission of Extra-Large proposals will be via the usual NRAO Proposal Submission Tool (PST) with the same 10-page limit for the Scientific Justification. Extra-Large proposals will be required to also submit (or provide a link to) additional material addressing the following issues:
The data management and delivery plan, including computing resource requirements;
A set of major project milestones and schedule;
The team resources (including plans for resident scientists at the Observatory).
Proposers are also encouraged to address the following:
The demonstrated feasibility of the project;
Any special requirements (such as scheduling, calibration, scanning, data processing);
Engagement of U.S. astronomical community;
For the GBT, an observing plan.
The ability of the proposing team to execute the data management plan, as well as the feasibility for NRAO to accommodate any requests made of it in the data management plan, will be evaluated as part of the review process
Information that assists Observatory staff to assess likely operational and NRAO/GBO support implications will be welcomed as part of the additional material. This will be the focus of the final face to face technical and operations readiness reviews with the highest ranked proposal teams.
More details will be provided in the formal call for proposals on 2 July at Please direct any questions regarding X-proposals to the "VLA/GBT/VLBA Proposing" department of the NRAO Helpdesk.
VLBA Commissioning Complete to Double Data Rate
Walter Brisken
Over the past year, Mark6 recording units have been deployed to all Very Long Baseline Array (VLBA) antennas. The Mark6 recorder, designed by Haystack Observatory and Conduant Corporation, offers a number of advantages over the Mark5 series of recorders. The most important and user-visible feature is support for higher data rates. The Mark5C, when used in "single-bank" mode, reliably supports data rates as high as 2048 Mbps, which is the VLBA's current sustainable rate. This corresponds to 256 MHz of bandwidth when observing with both polarizations. The Mark6 units, fed by the existing VLBA data acquisition system, will support science observing at 4096 Mbps or 512 MHz of dual-polarization bandwidth.
Please watch for the announced availability of this capability in the upcoming Call for Proposals. Standard observing setups for continuum observing will be made available at that time.
The Mark6 units (left) and Mark5 units (right) feeding the VLBA correlator in Socorro, NM. Unlike the Mark5 units, each Mark6 can play back data from multiple modules at the same time. In the VLBA's deployment, the first and third racks host "system chassis" containing a high-end computer motherboard and Infiniband networks. The second and fourth racks host "expansion chassis", which simply host additional modules. In the current configuration, the VLBA has the capacity to simultaneously correlate from 24 Mark6 modules and 9 Mark5 modules.
2019 Jansky Lectureship Awarded to Caltech Professor
Dr. Anneila Sargent
Associated Universities, Inc. (AUI), and the National Radio Astronomy Observatory (NRAO) have awarded the 2019 Karl G. Jansky Lectureship to Dr. Anneila Sargent, Ira S | 881 |
In Sicily: Land of Love and Strife, the process of capturing the island nation on film is revealed. Mark Spano invites the listener to follow him on his journey to celebrate the real Sicily, and to change the public perception of his family's homeland.
Ramie Targoff's Renaissance Woman tells of the most remarkable woman of the Italian Renaissance: Vittoria Colonna, Marchesa of Pescara. Vittoria has long been celebrated by scholars of Michelangelo as the artist's best friend - the two of them exchanged beautiful letters, poems, and works of art that bear witness to their intimacy - but she also had close ties to Charles V, Pope Clement VII and Pope Paul III, Pietro Bembo, Baldassare Castiglione, Pietro Aretino, Queen Marguerite de Navarre, Reginald Pole, and Isabella d'Este, among others.
The best-selling author of Italian<|fim_middle|> a glimpse of yesterday. And a feeling of being a part of it a lot faster.
I hope some day this Island finds its own direction because it can stand on its own. It has three perfect things location,location and location. I really enjoyed the book. | Neighbors returns with a wry and revealing portrait of Italian life - by riding its trains. In his first Italian travelogue in a decade, he deli0vers a charming and funny portrait of Italian ways by riding its trains from Verona to Milan, Rome to Palermo, and right down to the heel of Italy.
Sicilian Splendors explores the history, politics, food, Mafia, and people which John Keahey encounters throughout his travels during his return to Sicily. Through conversing with natives and immersing himself in culture, Keahey illustrates a brand new Sicily no one has ever talked about before.
Villagers, eager to welcome tourism and impart awareness of their cultural background, greet Keahey for meals and drink and walk him through their winding streets. They share stories of well-known writers, such as Maria Messina, who have found inspiration in Sicily's villages. Keahey's never-ending curiosity as a traveler shines light on Sicily's mythical mysteries and portrays the island not only through his eyes but also through Sicily's heart.
I give John Keahey a lot of credit for his approach to travel. He has reinforced the direction I have taken with my travels. I have been to Sicily many times and I now have new places to see thanks to him. The smaller towns give you | 273 |
Althorp Literary Festival Proudly Sponsored by Brights of Nettlebed
Brights of Nettlebed were proud sponsors of a conversation between Lady Antonia Frase...
Bright<|fim_middle|>'s most beautiful, private, stately homes.
Brights of Nettlebed are suppliers of Althorp Living History by Theodore Alexander
Hand made furniture inspired by the collection at Althorp House, the home of the Spencer family.
Knole sofas
Althorp Food and Drink Festival 2019
New Displays of Outdoor Furniture in our Nettlebed Gardens | s of Nettlebed were proud sponsors of a conversation between Lady Antonia Fraser and Lord Spencer at the 12th Althorp Literary Festival which took place on Saturday 13th June 2015.
One of our finest narrative historians, Lady Antonia Fraser discussed her new release My History: A Memoir of Growing Up in which she recounts her childhood, early life and the experiences that inspired her interest in exploring the past. From her days as an evacuee in a romantic Elizabethan manor house near Oxford, to childhood adventures at Dunsany Castle and Pakenham Hall, Lady Antonia explores the inspirational settings for her historical imaginings. Her magical and moving memoir, told with humour and style, will take many readers back to their own discovery of history.
We enjoyed a wonderful summer's day at the Althorp Literary Festival, inspired by stellar authors in the setting of one of England | 187 |
Saleh
Saleh (name)
Mohammad Ahmed Abdullah Saleh Al Hanashi
Saleh (/ˈsɑːlə/) or Salih (/ˈsɑːli/; Arabic: صالح Ṣāliḥ, meaning "Pious") was a prophet of ancient Arabia mentioned in the Qur'an, who prophesied to the tribe of Thamud. He is mentioned nine times throughout the Qur'an and his people are frequently referenced as<|fim_middle|> did not allow journalists who were at the camp for Omar Khadr's Guantanamo military commission to report news of his death until they left Guantanamo.
June 2009 death
Ahmed was reported to have been found "unresponsive" in his cell late on the night of June 1, 2009. He is reported to have been held in Camp 5, and to have been held in the Guantanamo psychiatric ward. Like all the other men camp authorities claimed were suicides he was on a long term hunger strike, and, consequently, where he was being strapped twice a day into a restraint chair, for force-feeding. The Associated Press reports that his weight had, at one time, dropped to just 86 pounds.
This page contains text from Wikipedia, the Free Encyclopedia - https://wn.com/Mohammad_Ahmed_Abdullah_Saleh_Al_Hanashi
sapost.com
sawangan.net
salawati.com
sachat.org
samini.org
saglobe.com
saradio.net
sawangan.org
sasbu.net
solarpowersa.org
energiesa.com
sabuildinggroup.com
sasbu.org
sacorruption.com
sashiko.com
solarroofsa.com
allthatsadeal.com
saradio.org
thatsadeal.org
worldnewssa.com | a wicked community who, because of their sins, were ultimately destroyed. Saleh is sometimes equated with Salah, a figure from the Hebrew Bible, although the two have little in common save for their names. The preaching and prophecy of Saleh is linked to the famous Islamic story of the She-Camel, which was the gift given by God to the people of Thamud when they desired a miracle to confirm the truth of the message Saleh was preaching.
Thamud people are believed to have been the successors to the ancient tribe of ʿĀd. Their ancestral descendant may have been Eber, the great-grandson of Noah and their location is likely to have been in the Northwest corner of Arabia, between Madinah and Syria. In later Islamic history, when Muhammad led his expedition to Tabuk against the Romans, on a reported Roman invasion from Syria, the prophet and his companions walked past the land of Thamud. With the advance of material civilization, the people of Thamud became materialistic and arrogant as well as godless. Thus, God sent the prophet and seer Saleh, to warn them about the impending doom they would face if they did not mend their sinful ways.
This page contains text from Wikipedia, the Free Encyclopedia - https://wn.com/Saleh
Saleh, Salih, Sahlay or Çalih and other variants (Arabic: صالح, [sˤɑːleħ] or [sˤɑːlɪħ]) is a male given name of Arabic origin.
Saleh, Arabian prophet
Saleh Abdul Aziz Al Rajhi, Saudi Arabian businessman
Saleh Abdelaziz Al-Haddad (born 1986), Kuwaiti long jumper
Salih Dursun, Turkish footballer
Salih Güney, Turkish film actor
Saleh and Daoud Al-Kuwaity, Iraqi musician
Saleh al-Mutlaq, Iraqi politician
Salih Neftçi, Turkish financial economist
Salih Omurtak, Turkish general
Salih Pasha (disambiguation), various Ottoman people
Salih Sadir, Iraqi footballer
Salih Uçan, Turkish footballer
Abdul Rahman Saleh, Indonesian aviator and physician
Ali Abdullah Saleh, former President of Yemen
Akmal Saleayer
Hashim Saleh, Omani footballer
Mohammad Ahmed Abdullah Saleh Al Hanashi, prisoner who died in United States military detention
Raden Saleh, Indonesian painter
Tayeb Salih, Sudanese author
Salah (name)
Salehi
Mada'in Saleh, an archaeological site in Saudi Arabia
This page contains text from Wikipedia, the Free Encyclopedia - https://wn.com/Saleh_(name)
Mohammad Ahmed Abdullah Saleh Al Hanashi (February 1, 1978 - June 1, 2009) was a citizen of Yemen, held in extrajudicial detention in the United States Guantanamo Bay detainment camps, in Cuba. Al Hanashi's Guantanamo Internment Serial Number was 78. The Department of Defense reports that Al Hanashi was born on February 1, 1978, in Al Habrub, Yemen.
On June 2, 2009, the Department of Defense reported that a 31-year-old Yemeni captive named "Muhammed Ahmad Abdallah Salih" committed suicide late on June 1, 2009. Camp officials | 722 |
Sydney's 'ugliest building' to<|fim_middle|>'s a speculative project, and the final version is likely to be a little less dramatic than the pictures. In the meantime, it's been busy installing a more efficient boiler heat recovery system. Not quite as dramatic.
The university is also carrying out feasibility studies of a hydro turbine and ducted wind turbine.
Iran bans Gmail, forgets to turn Internets off
Sony promises 3D Blu-ray player by summer | get solar skin
Sydney's University of Technology knows its Sydney Tower is pretty hideous – it even says so on the website. So in traditional fashion, it's decided to put a paper bag over its head.
The university has recruited design company Lava to make the building a little less of an eyesore, and is now considering plans to cover the 1960s Brutalist building in a solar skin as part of a major environmental sustainability plan.
The plan "offers a unique opportunity to transform the identity, sustainability and interior comfort of the once state of the art building," says Lava director Chris Bosse.
The lightweight composite mesh textile would be easy to stretch around the building, says Lava. It could collect rainwater and generate electricity through photovoltaic cells and use convective energy to power the building's ventilation systems.
At night, the skin could be used as a giant billboard to display university performances and campus events in real time.
It | 195 |
Using locational technology and geospatial data, insurers can calculate premiums that more accurately reflect important factors surrounding their customers. As a result, the most responsible drivers benefit hugely from reduced rates, and the more risk-prone drivers will be charged at a rate that is fairer for all. Perhaps most crucially however, the volume of both claims and pay outs can be significantly reduced, saving time and boosting profitability.
We can augment your tracked customer data with geospatial information to provide an unparalleled insight into customers' routines and interests. Beyond this, we can also track significant changes in customers' behaviours to ensure that your customer profiling is always up-to-date, allowing you to reduce risk and keep pay outs down. If a driver is sensed to be driving too recklessly too regularly, they will risk voiding their insurance.
With more accurate premiums, drivers will be incentivised to drive more carefully. The result will be a positive ripple effect in society, as drivers' habits change to reduce high speed driving and therefore vehicle-related injuries and air and noise pollution.
Use big data to analyse the conditions encountered by one or more mobile assets including the routes taken and the condition and types of vehicles involved, calculating an insurance cost based on the assessed safety of the journeys. Use our data to calculate the risk associated with each route, accounting for accident blackspots, road types and traffic volumes. Taking this data-driven approach creates fairer rates, saving money for the best prepared and more accurately<|fim_middle|> channel; this mainly includes machines with online connectivity such as smart devices or black boxes. Utilizing these technologies enables your business to know which postcode or street your customers are on when they open your app or locational website from their mobile device.
The Internet of Things refers to a state where the majority of machines, devices, systems and platforms are connected through embedded or wearable devices to connect and communicate with other machines and devices. This provides a platform by which to analyse, optimise and develop processes so that individual's lives are improved and communities, businesses and governments are made more efficient.
Geoconcept and Geoxploit provide map analysis solutions, with the latter including pre-configured data to make it easy to analyse demographics, territories and more. This suite enables your intelligence to benefit from 4D mapping, easy to use thematic maps, and direct links with cloud based mapping. With the correct GIS technology, your business can excel in using geography profitably and notably reduce claims and pay outs alike.
Mapmechanics helps insurers of various sizes turn their raw data into a key part of their business plan moving forward. By licensing mapping software and providing a bespoke mapping consultancy service, we can help you make sense of your unprocessed datasets to create valuable business intelligence. | reflecting the journeys with the most associated risk.
Exploit geographic data to improve the claims process, providing faster risk assessment for legitimate claims while identifying locations with residents more likely to submit fraudulent claims. Your organisation can also use geospatial data and mapping to project regional profitability and manage resources more effectively.
In practical terms, Usage Based Insurance involves the tracking of a black box or smart device within a given vehicle in order to gain an insight into the driver's driving habits. Having tracked the driver and compiled data on their behaviour on the road, the insurer is better prepared to assess how careful the driver tends to be. This means that fewer claims come in for processing and fewer pay outs are made.
Background maps, geocoding and asset tracking combine to enhance routing and scheduling. With a more intimate knowledge of your customers' scheduling and their destinations, you can offer your customers more bespoke usage-based premiums and reduce your volume of claims and pay outs.
M2M technologies are devices capable of connecting to one another through any communications | 203 |
This Dreamy Tiny House in Bali Is Made of Recycled Tetra Pak Cartons
The 688-square-foot Tetra Pod is every bit as artful as it is efficient-and Stilt Studios is offering DIY plans for just $5,000.
Architectural designer Alexis Dornier of Stilt Studios prefers compact homes that tread lightly on the landscape. "I'm overwhelmed by how little one actually needs," he says. "The less you have, the less you have to worry about." Inspired by the idea of living only with what's essential, Dornier devised Tetra Pod, a 688-square-foot prefabricated home made from recycled Tetra Pak cartons in Uluwatu, Bali.
The 688-square-foot home that Alexis Dornier of Stilt Studios created in Bali is clad with recycled Tetra Pak cartons, wood, steel, and glass.
Large sliding-glass doors open the tiny home to<|fim_middle|> imperative in Indonesia, where the terrain is difficult and many buildings are demolished not long after they're constructed due to short-term property leases. "In order to bring sustainable development to remote areas and boost the local economy, we need knock-down structures that can be fabricated off-site and built quickly," says Dornier, who cofounded Bali-based Stilt Studios with Florian Holm, the firm's CEO.
Ironwood flooring lends warmth and texture to the open-plan interior. The layout includes a small kitchen area and a living area with a built-in sofa and table crafted with teak veneer.
A wood deck wraps around the exterior of the home, offering a place to perch among the trees.
The Tetra Pod took just eight weeks to construct, and it can be swiftly taken down, allowing for maximum agility in Bali's rapidly changing property market. Stilts lift the compact house 40 centimeters off the ground. "Many developments in Bali use large quantities of concrete, which destroys the natural environment," Dornier says. "I wanted to challenge the status quo and create architecture that leaves behind a minimal footprint."
The bedroom area, adjacent to the living space, offers cinematic views of the verdant landscape. "The diagonally oriented floor plan creates exciting spaces that exude outward toward the exterior," Dornier says.
By eliminating concrete and using recycled Tetra Pak cartons as a building material-along with wood, steel, and glass-Dornier's sought to follow the principles of a circular economy. "Tetra Pak is reused, so it helps to reduce waste," he says.
The home also features large roof overhangs that help reduce solar heat gain, solar panels, a rainwater collection system, and a passive cooling system. "I also envisioned being able to grow food beneath the elevated structures," Dornier says.
Dornier outfitted the dining area with a built-in table and seating area made from teak veneer.
Inside, the Tetra Pod features an open plan that accommodates a bedroom, a living area, a dining space, a kitchen, and a bathroom. Dornier designed furniture pieces made with teak veneer-including a bed, a built-in dining table and bench, a living-room sofa, and a coffee table-to suit each of the rooms. Large sliding-glass doors and expanses of glazed cladding wrap the bedroom and living areas in lush greenery.
The bedroom area is situated behind a partial wall that separates it from the dining space.
The Tetra Pod is designed to be built for about $45K on almost any lot in any country, and Dornier is offering detailed plans (complete with five drawings) at a special price of $5,000 per set. "These drawings contain all required materials with sizes and finishes; structural, mechanical, electrical, and plumbing details; interior drawings; and a detailed step-by-step explanation of how to build Tetra Pod," he says.
The Tetra Pod Dornier built in Bali is a prototype that's currently available to rent for short-term stays. "The prototype is part of a development that's a place for experimentation and ongoing creative expression," says Dornier, who plans to eventually turn the development into a resort. "Our design studio is placed in one of our studios, submerged into the thick and lush surroundings."
Glazed surfaces reflect the surrounding greenery, helping the tiny home blend in with its site.
Stilt Studio's long-term goal is to make each and every one of their sustainable designs available for purchase. "We want design lovers around the world to be able to build their favorite studio or home without paying a star architect's design fee," Dornier says. "Especially in times like COVID-19, people are looking for alternative living spaces. Tetra Pod can be used as a workspace or yoga pavilion in a garden, as multiple units for a hotel or resort, or as a tiny home."
To inquire about booking a stay in Tetra Pod or another of the firm's designs, visit Stilt Studios. | the wooded landscape.
According to Dornier, efficiency, affordability, and sustainability go hand in hand. "I love the idea of making houses more affordable to the greater audience," he says. "In addition to keeping costs low, a prefabricated structure is practical because it can be set up or dismantled in a short amount of time."
Dornier employed recycled Tetra Pak cartons as a siding material. "The reflective characteristics of the material help the architecture blend into the surroundings," he says.
Deep exterior overhangs help to prevent solar heat gain, keeping the tiny house cool and comfortable.
That practicality is | 127 |
If you build it<|fim_middle|> in St. Pauli, the area was best known for prostitution. Today, St Pauli is Hamburg's top entertainment district, with many bars and night clubs. | , they will come. That's the idea behind the brand new Elbphilharmonie in Hamburg. The grand glass concert hall stands tall on the Elbe River, a vibrant statement of Hamburg's position as a top European city, and a destination that should not be missed.
The long-awaited Elbphilharmonie in Hamburg, Germany opened in January 2017 after years of cost-overruns and delays. But the wait seems to have been worthwhile, because tickets have been snatched up like gold. More than 30,000 tickets for the spring season sold out in half an hour.
While Sydney's opera house has become an iconic symbol of that classic city, Hamburg hopes its new concert hall will do the same. Designed by Swiss architectural firm Herzog & de Meuron, the Elbphilharmonie – or Elphie, as she is nicknamed – resembles waves, a reflection of Hamburg's maritime character and long history as a port town.
Built on a former warehouse and surrounded on three sides by water, the Elbphilharmonie has redrawn Hamburg's skyline. The structure is the tallest building in Hamburg and is easily seen from miles around.
With a population of more than a million, Hamburg doesn't need such a landmark to boost its stature in Germany and Europe. After all, it is the 3rd largest port in Europe. The city's stately homes and abundance of global companies reflect Hamburg's status as the wealthiest city in Germany.
Hamburg is a popular destination for Scandinavians and other Europeans, but when you step past Europe, many travelers are unfamiliar with Hamburg. Americans flock to Oktoberfest in Munich and many visit Berlin. Yet many miss Hamburg, which is just 90 minutes from Berlin by train, and a perfect add-on for those exploring Germany.
The Elbphilharmonie hopes to change that, and will help introduce Hamburg to the world. The grand structure, covered in more than 5,800 glass panes, houses three concert halls, a Westin Hotel, 45 apartments, and a range of places to eat and drink.
Elbphilharmonie is one of the most acoustically-advanced concert halls on the planet. The venue's White Skin refers to 10,000 individually shaped gypsum fiber panels that cover the walls. Developed by internationally renowned acoustician Yasuhisa Toyota, this special wall and roof structure ensures every corner of the concert hall receives perfect sound.
Concerts for Hamburg is a special series of one-hour concerts designed especially for the local market. Tickets are affordable, and the traditional concert dress code is ignored. Performances cover a wide variety of genres, from symphonic to jazz to large-scale operatic works.
Even if you don't attend a concert at Elbphilharmonie, the concert hall's plaza is open to all. Due to popularity, free tickets are needed to ride the 80 meter-long escalator to the plaza viewing platform. Free tickets to visit the plaza are available at the Elphilharmonie's Visitor Center at Kaiserkai 62 and near the Elbphilharmonie entrance. You can pre-book a plaza viewing ticket at Elbphilharmonie.de/en/plaza for a €2 charge.
The Elbphilharmonie is the second of Hamburg's two grand concert halls. Laeiszhalle, an historic venue which opened in 1908, also has a full calendar of concerts and events. Hamburg's music scene includes three professional orchestras, several solo and chamber ensembles and a wealth of jazz, rock, pop and contemporary artists and composers.
Hamburg's tradition in music runs deep. Composers like Johannes Brahms, Gustav Mahler, and C.P.E. Bach were born and worked here.
The Composers Quarter, opened in 2015 near St. Michael church, highlights the life and works of many of these music greats. Museum guests receive headphones with commentary in multiple languages to augment the displays.
The English band were teenagers and still in obscurity when they first performed in some of Hamburg's now famous nightclubs from 1960 to 1962, helping to establish Hamburg's legendary live music scene.
Hempel's Beatles Tour takes visitors to some of the Fab Four's key locations in Hamburg. Stefanie Hempel, a local Beatles expert, offers insight and stories that bring the Beatles to life. A trained musician, she can also belt out their music, adding to the Beatles nostalgia.
Hamburg's live music scene continues today as many young newcomer and established bands play at nightclubs in the Reeperbahn at the St. Pauli quarter of Hamburg. When the Beatles first played clubs | 981 |
Board Game Discovery
Letters from Whitechapel
This is the Board Game Geek (BGG) game ranking.<|fim_middle|> right there. One player plays Jack the Ripper, and his goal is to take five victims before being caught. The other players are police detectives who must cooperate to catch Jack the Ripper before the end of the game. The game board represents the Whitechapel area at the time of Jack the Ripper and is marked with 199 numbered circles linked together by dotted lines. During play, Jack the Ripper, the Policemen, and the Wretched are moved along the dotted lines that represent Whitechapel's streets. Jack the Ripper moves stealthily between numbered circles, while policemen move on their patrols between crossings, and the Wretched wander alone between the numbered circles.
Letters from Whitechapel: Dear Boss
© 2019 - Made by Ben Henschel in between rounds of Pandemic. Board game data and images provided by Board Game Geek. | BGG is like the IMDB for board games. BGG Rank
Letters from Whitechapel (2011)
2 - 6 players
2.69 This measures, out of 5, how complex a game is. With 5 being a very heavy, complex game and 1 being very light. complexity
13+ min age
1 expansion
7.5 This is the Board Game Geek (BGG) game rating (out of 10). BGG is like the IMDB for board games. BGG Rating
Get ready to enter the poor and dreary Whitechapel district in London 1888 – the scene of the mysterious Jack the Ripper murders – with its crowded and smelly alleys, hawkers, shouting merchants, dirty children covered in rags who run through the crowd and beg for money, and prostitutes – called "the wretched" – on every street corner. The board game Letters from Whitechapel, which plays in 90-150 minutes, takes the players | 217 |
Change the C4 key fob battery?
See if the Rear Parking Sensors are working via the Dashboard Display?
Save Tax by driving a C4?
Find a list of Bulb Types used in the C4 Picasso?
Find the Telephone Numbers for Citroen Assist.
Adjust the windscreen washer jets on a C4?
Remove a Dashboard Air Vent?
Know if I need headlamp beam deflectors for<|fim_middle|>rectification.
Jump start to or from a C4? | a UK C4 in Europe?
Get an aftermarket Stereo mute control to work when selecting reverse?
How do I find the Air Bag safety Instructions for a C4?
Convert my C4 Speedometer from KPH to MPH?
CREATE AN MP3 CD WITH iTUNES FROM AAC files.
Lock my C4 Doors without setting the alarm?
Free a C4 Coupe passenger seat back which has jammed.
Change a starter motor on a C4?
Find a spare 12v permanent live in a C4 Fusebox?
Fitting a new C4 driver's seat back cushion. There's an air bag in the way!!
Fix a Disc Judder problem - Cause/ | 136 |
City Wide Limousine is a transportation company located in Wilmington, Delaware that services weddings throughout the local area including in Delaware County, Chester County and Cecil County. The company has been part of the wedding industry since 1991 and specializes in luxury wedding and special event transportation<|fim_middle|> small bus to shuttle guests from the Hilton to the Farmhouse. The were friendly, professional and reliable!
I had a wonderful experience with city wide limousine for my wedding! Our pick up/drop off plans changed constantly leading up to the wedding and were slightly confusing however, City Wide was extremely responsive and helpful to make sure everything was perfect for us. Any questions I had were answered quickly! Our driver was extremely friendly and professional and arrived on time! The 27 passenger limo party bus was also a big hit with our wedding party. It was clean and we were able to hook up our cell phones and play our own music which was awesome! Definitely feel like our driver and the company went above and beyond to ensure everything went smoothly and was exactly how we wanted it and that we were on schedule! Definitely will be recommending!
City Wide was great to work with right from the start. Patty was so responsive and helpful with all of my questions. Our driver Ronnie was the best, especially since our end of the night drop off was semi confusing. He was awesome and so accommodating. I would highly recommend them to anyone.
We love City Wide Limousine. Great company! | .
City Wide Limousine offers high-quality service options to each couple. The company keeps only the newest car models in stock, including a brand new Cadillac Escalade Stretch and Limo Party Bus. The staff at City Wide is extremely friendly, and the team of drivers is professionally trained. Your transportation will be carefully planned and styled to your vision. In addition to wedding day services, City Wide also provides bachelor party, bachelorette party and airport transportation.
City Wide Limo provided a Lincoln Navigator for our small wedding party as well as a | 111 |
Third Circuit Decisions
In a Groundbreaking Decision, Third Circuit Provides Framework for Evaluating Numerosity
Class Certifications, Third Circuit Decisions
One of the least disputed elements of class certification is Rule 23(a)(1) numerosity, and so there is relatively little analysis from the courts<|fim_middle|>3475, 2016 WL 4757793 (3d Cir. Sept. 13, 2016) were direct wholesale purchasers of Provigil, a wakefulness-promoting agent used to treat narcolepsy and other sleep disorders. Defendant Cephalon owned the patent for modafinil and had FDA approval for the branded version. Plaintiffs alleged an antitrust conspiracy between Cephalon and the four generic modafinil manufacturers for entering into reverse-payment settlements. Plaintiffs also brought a monopoly claim against Cephalon.
The district court | about it. Last month, however, a divided panel of the Third Circuit provided a detailed analysis of the purposes of numerosity and the factors that district courts should employ in making numerosity determinations. In doing so, the court has broken new ground, and its decision will likely be cited by other courts and parties for years to come.
Plaintiffs in In re: Modafinil Antitrust Litigation, No. 15- | 90 |
Giving Tuesday 2018
Give to 2018 Giving Tuesday and help our student volunteers do more.
Helping Langara create strong community leaders through volunteering.
Giving Tuesday is an annual day of giving for people to support the causes important to them, and to celebrate the act of giving. In 201<|fim_middle|> carried the Olympic Flame as it passed through campus during the final days of the torch relay. | 8, we asked our community to support one of Langara's best kept secrets and a program close to the hearts of many Langarans, our VOLT volunteer program.
VOLT was created in 2010 by two students inspired to do more. Since then the program has contributed over 57,000 volunteer hours on-campus, and at organizations in Vancouver and abroad. VOLT's mission is to promote community engagement, social awareness, and student development through volunteerism.
With support from our community, Langara's Giving Tuesday campaign raised almost $10,000 (before matching for VOLT and other student scholarships and bursaries. The College matched a portion of the funds raised for Giving Tuesday. After matching, our final total for Giving Tuesday was over Giving Tuesday raised over $17,000 for the VOLT program and other student scholarships and bursaries.
Thank you to everyone who supported the Giving Tuesday campaign. In particular, thanks to our friends at the Langara Students Union for partnering with us again for Giving Tuesday. Through the efforts from our social media community, Langara Students' Union donated $2,500 to VOLT as a result of our social media campaign. Each and every like, share, and comment on Giving Tuesday made a difference and the combined impact of our social media followers will help VOLT do more in the community.
Photos from this year's Giving Tuesday celebration on-campus are available here. You can also learn more about the VOLT program by watching the video below.
Give to 2018 Giving Tuesday
"VOLT is more than a program; it is a support network of peers, mentors, and leaders. I hope that more students are able to experience the program, and through it, have the opportunity to become student leaders and realize their full potential. " – Khaled Sukkarie
VOLT Alumnus
Get InvolvedMake an Impact
We have a giving community made up of great ambassadors and champions. There are many ways that you can give to the College and support student success.
Hire a co-op student or graduate
Looking for your next star employee? Consider hiring a Langara student or new graduate. Access a fantastic prospective pool of candidates and open up opportunities for a fellow Langaran.
Host an alumni meet-up
Are you still in touch with your classmates? Do you work with other Langara graduates? Help us bring Langarans together by hosting an alumni meet-up event. We'll help you every step of the way.
Langara helped you get to where you are today, and you can help the next generation of Langarans. Share your experience and knowledge and inspire our students to achieve. A range of opportunities are available.
Thank You ToOur Partners
49 Langarans Contributing Sponsor
49 Langarans Friend/Community Partner
49 Langarans Media Partners
I will celebrate YOU. 49 is a perfect square (meaning 49, 7 to the power of 2). This college celebrated only 7 of them, but there are plenty of perfect things we can celebrate with our students and faculty. – Nora Franzova
Thanks to Langara, I've become a "better me" every single day! – Jack Do
The success of the school. – Austin Everett
Twenty continuous years of BC's largest Continuing Studies operation, delivering great lifelong learning. – Daniel Thorpe
Seeing members of the Langara Chicken Hawks who played in the 1972 BC Winter Games (Brother Ron included). I was also the proud President of the Langara Commerce Club and would like to see other members. (1972) – Terry Sadler
I'm celebrating a world class institution that has been a stepping stone for me to reaching my goals and dreams. – Noor Kesbeh
I'm celebrating the contributions that Langara has made over the last 49 years that has helped students pursue their goals. In turn, our Langarans have gone on to contribute their knowledge, passion, and energy to make our community a better more prosperous, sustainable, and fair place. – Lane Trotter
My 1.5 years of being a Langaran – Jasmeen Kaur
Celebrating our diversity, achievements, and growth. – Sherry Chin-Shue
The success of our students for 49 years. – Marg Heldman
Langara's unique place and identity in higher learning in the lower mainland, after so many years. – Michael Fox
I'm celebrating the Trek, Pep Rally, BSN 10 year celebration, and Retiree Nursing Celebration. – Wanda Pierson
Langara College was a proud Community Partner for the 2010 Winter Olympic Games in Vancouver. Human Kinetics student Evan Eichler | 985 |
NewsHomiliesMessages and AddressesQuotesPhotosBiography
Basilica.roNewsfeedContactRSSNewsletter
» Feasts and Saints » St. Alypius the Stylite of Adrianopolis; St. Nikon "Metanoeite," the Preacher of Repentance; St. Stylianus of Paphlagonia
St. Alypius the Stylite of Adrianopolis; St. Nikon "Metanoeite," the Preacher of Repentance; St. Stylianus of Paphlagonia
Published by basilica.ro
1. Saint Alypius the Stylite was born in the city of Adrianopolis in Paphlagonia. His mother, a Christian, was widowed early, and she sent her son to be educated by Bishop Theodore. She distributed her substance to the poor, then began to live an ascetic life near the church as a deaconess.
Saint Alypius, from his early years, wanted to devote his life to God and yearned for the solitary life, although Bishop Theodore would not give him permission to do so. Once, when Saint Alypius was accompanying his bishop to Constantinople, the holy Martyr Euphemia (September 16) appeared to him in a vision, summoning Saint Alypius to return to Adrianopolis and found a church in her name.
With contributions offered by believers in Adrianopolis, Saint Alypius did build a church in the name of the holy Martyr Euphemia, on the site of a dilapidated pagan temple infested by legions of devils. Beside the church, under the open sky, the saint erected a pillar over a pagan tomb. For fifty-three years Saint Alypius struggled upon the pillar, praying to God and teaching those who came to him.
The demons which infested the pagan cemetery fell upon the ascetic by night and pelted him with stones. Saint Alypius, wanted nothing to stand in the way of the<|fim_middle|> of Saint John the Baptist (Matthew 3:2), and of Christ Himself (Matthew 4:17). This was also the message of Saint Nikon. Wherever he went, he would begin his sermons with "Repent," hence he was called "Nikon Metanoeite," or "Nikon, the Preacher of Repentance."
At first, people paid little heed to his message. Then gradually he won their hearts through his preaching, his miracles, and his gentle, loving nature. He stressed the necessity for everyone to repent, warning that those who utter a few sighs and groans and think that they have achieved true repentance have deluded themselves. Saint Nikon told the people that true sorrow for one's sins is cultivated by prayer, self-denial, almsgiving, ascetical efforts, and by confession to one's spiritual Father.
After sowing the seeds of piety, Saint Nikon began to see them bear fruit. People started to change their lives, but he urged them to strengthen their souls in virtue and good works so that they would not be overwhelmed by the cares of this world.
Eventually, Saint Nikon settled in a cave outside Sparta. Soon he moved into the city, because so many people were coming to hear him. In the center of Sparta, he built a church dedicated to Christ the Savior. In time a monastery grew up around the church.
Saint Nikon never ceased to preach the Word of God, and to lead people back to the spiritual life of the Church. He also healed the sick, and performed many other miracles.
Saint Nikon fell asleep in the Lord in 998, and his memory was honored by the people around Sparta. During the Turkish occupation of Greece, however, he was all but forgotten, except in Sparta. After the Greek Revolution in 1821, a service to Saint Nikon was composed by Father Daniel Georgopoulos, and was based on the saint's Life, which had been written by Igumen Gregory of Saint Nikon's Monastery in 1142.
Saint Nikon was recognized as the patron saint of the diocese of Monemvasia and Lakedaimonia in 1893 when the cathedral church in Sparta was dedicated to Saint Nikon, the Preacher of Repentance.
Lakedaimon rejoices, having the divine coffer of your relics, which gush forth a fountain of healings, and protect from afflictions all those who have recourse to you with faith, O Venerable Father Nikon, entreat Christ God that He may grant us great mercy.
3. Saint Stylianus was born in Paphlagonia of Asia Minor sometime between the fourth and sixth centuries. He inherited a great fortune from his parents when they died, but he did not keep it. He gave it away to the poor according to their need, desiring to help those who were less fortunate.
Stylianus left the city and went to a monastery, where he devoted his life to God. Since he was more zealous and devout than the other monks, he provoked their jealousy and had to leave. He left the monastery to live alone in a cave in the wilderness, where he spent his time in prayer and fasting.
The goodness and piety of the saint soon became evident to the inhabitants of Paphlagonia, and they sought him out to hear his teaching, or to be cured by him. Many were healed of physical and mental illnesses by his prayers.
Saint Stylianus was known for his love of children, and he would heal them of their infirmities. Even after his death, the citizens of Paphlagonia believed that he could cure their children. Whenever a child became sick, an icon of Saint Stylianus was painted and was hung over the child's bed.
At the hour of his death, the face of Saint Stylianus suddenly became radiant, and an angel appeared to receive his soul.
Known as a protector of children, Saint Stylianus is depicted in iconography holding an infant in his arms. Pious Christians ask him to help and protect their children, and childless women entreat his intercession so that they might have children.
By a flood of tears you made the desert fertile, and your longing for God brought forth fruits in abundance. By the radiance of miracles you illumined the whole universe! O our holy father Stylianus, pray to Christ our God to save our souls!
26 November,
daily saints,
life of saints,
Orthodox saints,
saints,
saints of the day
Subscribe to Basilica.ro newsletter
Persecutions against Christians worsen during pandemic
Published by Ștefana Totorcea
More than 340 million Christians were severely persecuted in 2020 and the phenomenon worsened during the coronavirus pandemic, announced last week Portes Ouvertes, the Frech partner of Open Doors International. The numbers have gone up…
Poll: The Church remains the most trusted institution in Romania
A poll made by the Center for Urban and Regional Sociology – CURS between January 11-15 found that the Church remains the most trusted institution in Romania. The research report showed that 62% of the…
The Week in Pictures: January 11 – 17, 2021
Winter's cold and snow were not able to conquer the warm souls of the Orthodox faithful. Please see below our selection of photos taken between January 11 and 17, 2021. Last week's most-liked Instagram post:…
Messages and Addresses
When culture is inspired by worship, it opens up to eternity: Patriarch Daniel on National Culture Day
Published by Aurelian Iftimiu
In his message on Romania's National Culture Day, Patriarch Daniel referred to the connection between worship and culture but also stressed the liturgical and cultural value of cemeteries. "When religious worship bore fruit in culture,…
Romania's Timișoara, on The Independent's list of Best Second Cities in Europe to Visit in 2021
Published by Iulian Dumitraşcu
Timișoara, in western Romania, features on the list of the Best Second Cities in Europe to Visit in 2021 put together by the British newspaper The Independent. The list covers nine cities that can serve…
Thursday21January
St. Maximus the Confessor; Martyr Neophytus of Nicea; Virginmartyr Agnes of Rome
Table Tennis Cadet World Champion: I've always enjoyed going to church
Subscribe to newsletter to receive the most important news from us.
© 2021 Biserica Ortodoxă Română. All Rights Reserved.
About us Terms and conditions Cookie policy Privacy policy | attacks of the spirits of darkness, then even took down the boards that served him as a roof, protecting him from the rain and wind. In the face of the saint's conquering steadfastness, the demons fled the place forever, which had been sanctified by his deed of voluntary martyrdom.
Fourteen years before his death, Saint Alypius was no longer able to stand. He was compelled to lie on his side because of the weakness of his legs, and endured grievous sufferings with humble gratitude. Around the saint's pillar two monasteries sprang up: a men's monastery on the one side, and a women's monastery on the other.
Saint Alypius introduced strict monastic rules for both monasteries and he directed both monasteries until his death. Saint Alypius reposed in the year 640, at age 118. The body of the venerable stylite was buried in the church he founded in honor of the holy Martyr Euphemia. The relics of the saint of God healed many of those who came in faith.
Troparion, tone 1:
You were a pillar of patient endurance, having imitated the forefathers, O Venerable One: Job in suffering, and Joseph in temptations. You lived like the Bodiless Ones while yet in the flesh, O Alypius, our Father. Beseech Christ God that our souls may be saved.
2. Saint Nikon Metanoeite ("the Preacher of Repentance") was born at Pontus Polemoniacus at the beginning of the tenth century. He was the son of a wealthy landowner, and he was given the name Nicetas in Baptism.
Since he had no desire to take over the management of his family's wealth and estates, Nicetas entered the monastery of Chrysopetro, where he shone forth in prayer and asceticism. When he received the monastic tonsure, he was given the new name Nikon. The new name symbolizes a new life in the Spirit (Romans 7:6), and the birth of the new man (Ephesians 4:24). A monk is expected to stop associating himself with the old personality connected to his former life in the world, and to devote himself entirely to God.
Saint Nikon had a remarkable gift for preaching. When he spoke of virtue and spiritual matters, his listeners were filled with heartfelt compunction and love for God. His words produced such spiritual fruit in those who heard him that he was asked to travel through the eastern regions to preach. He visited Armenia, Crete, Euboea, Aegina, and the Peloponnesus, proclaiming the Gospel of Christ.
"Repent, for the Kingdom of Heaven is at hand." This was the message | 582 |
NFL reinstates Michael Vick on conditional basis
Nearly two years after he pleaded guilty to a federal charge of bankrolling a dogfighting operation at a home he owned in Virginia, Michael Vick was reinstated to the National Football League on a conditional basis, according to an NFL statement Monday.
Vick "will be considered for full reinstatement and to play in regular-season games by Week 6 based on the progress he makes in his transition plan," the statement said. Week 6 of the NFL season is in October. Vick may participate in practices, workouts and meetings and may play in his club's final two preseason games under the conditions of his reinstatement, the league said. Vick, in a statement, thanked the league's commissioner and former Indianapolis Colts coach Tony Dungy, who has served as his mentor. "I would like to express my sincere gratitude and appreciation to Commissioner [Roger] Goodell for allowing me to be readmitted to the National Football League," Vick said in a statement. "I fully understand that playing football in the NFL is a privilege, not a right, and I am truly thankful for the opportunity I have been given." Vick, 29, was freed from federal prison at Leavenworth, Kansas, on May 20 and returned to his home to serve the last two months of his 23-month sentence in home confinement. Vick also said in his statement that he is re-evaluating his life after the "terrible mistakes" he made. "As you can imagine, the last two years have given me time to re-evaluate my life, mature as an individual and fully understand the terrible mistakes I made in the past and what type of life I must lead moving forward," Vick said in the statement. "Again, I would like to thank the commissioner for the chance to return to the game I love and the opportunity to become an example of positive change." The former Atlanta Falcons player is a free agent and has not been signed by any team. Goodell said he was not involved in any negotiations between Vick and a team. Dungy has agreed to continue working with Vick as an adviser and mentor, the NFL statement said. Goodell said Vick underwent tests after requests from animal rights groups, including a psychiatric evaluation.
SI.com: Banks: Goodell made right move with Vick
SI.com: King: Decision as fair as Vick could have hoped
SI.com: Storylines that have nothing to do with Vick
"We worked with animal rights activist groups, and we are clear," he said. "We worked with their medical professionals about the aspects of our evaluations. Michael fully cooperated with all of those tests. Those tests did not indicate there was any reason he couldn't make a transition forward." In a letter to Vick, Goodell wrote that his decision regarding full reinstatement "will be based on reports from outside professionals, your probation officer and others charged with supervising your activities, the quality of your work outside football" as well as factors such as the absence of any further law enforcement issues.iReport.com: Should Vick get a second chance "This step-by-step approach is not meant to be a further punishment and should not be viewed as such," Goodell wrote, according to the NFL. "Instead, it is intended to maximize the prospect that you can successfully resume your career and your life. I believe that a transitional approach with a strong network of support will give you the best opportunity to manage effectively the various issues and pressures that you will inevitably face in the coming weeks and months and earn your full reinstatement." Watch Goodell talk<|fim_middle|> Chapter 11 bankruptcy. At a hearing in that case, he told the judge that he earned 12 cents an hour as an overnight janitor while in prison. "We take this as a very serious matter," Goodell said. "We're dealing with a young man's life." He said Vick admitted lying to him about his involvement in dogfighting and apologized. Goodell said he accepts Vick's apology. He acknowledged that he does not like being lied to but said he intends to move forward. The Humane Society of the United States has said Vick has offered to work with the organization on anti-dogfighting campaigns. Wayne Pacelle, the organization's president, has said Vick was to work on programs aimed at preventing youths from getting involved in dogfighting and on programs to assist young people who have been involved.
In testimony before the bankruptcy judge, Vick acknowledged committing a "heinous" act and said he should have acted more maturely. "Your margin of error is extremely limited," Goodell wrote to Vick. "I urge you to take full advantage of the resources available to support you and to dedicate yourself to rebuilding your life and your career. If you do this, the NFL will support you."
Michael Vick taking construction job after prison, lawyer says
Michael Vick leaves prison for home confinement
No takers for Michael Vick's Georgia mansion
Man behind Caylee dolls, Vick dog toys faces lawsuit
Michael Jackson: A look back at a pop legend's life
Posted byadmin July 28, 2009 Posted inDaily NewsTags: commissioner, decision, home, life, michael-vick, national, nfl, progress, work
Source: Jackson's doctor gave drug that police believe killed him
Sarkozy health scare: What is vasovagal syncope? | about his decision » The league suspended Vick indefinitely in August 2007 after his guilty plea. Although he was released from federal custody July 20, he must serve three years of probation, the league said. In reviewing Vick's status, Goodell considered court records, submissions from Vick and others, reports from outside professionals and conversations with current and former players, among other items. At a hearing July 22, Goodell spoke to Vick along with his representatives and others including NFL Players' Association officials. "As I emphasized to you when we met … it is actions that count," Goodell wrote to Vick. "I accept that you are sincere when you say that you want to, and will, turn your life around and that you intend to be a positive role model for others. I am prepared to offer you that opportunity. Whether you succeed is entirely in your hands." Vick has also filed for | 185 |
Students of the University of Westminster's BA in Fashion Design made a spectacular debut on the London Fashion Week schedule as the first ever undergraduate course to be invited to show at a major fashion week.
Showcasing the work of final year students from an institution that has nurtured some<|fim_middle|> corruption and the abuse of power to the changing stages of grief, while others found inspiration in everything from space pioneers to social change in the North of England. Raising the stakes for design institutions around the world, we look forward to what is sure to be a London Fashion Week highlight for years to come. | of the leading names in the industry, including Ashley Williams, Liam Hodges, Vivienne Westwood and Christopher Bailey, the BA show has been a longstanding favourite on June's Graduate Fashion Week schedule. However, in a bid to reform fashion education to better prepare students for a future in the field, course director Andrew Groves restructured the programme to allow his students to align their collections with the international fashion calendar.
The collections presented the very best of emerging talent, with an exciting array of designs inspired by both real-life and hypothetical society and culture. Suzi Lee's soft silhouettes in a vibrant palette of orange, teal, rust, and navy took inspiration from the last remaining Haenyeo Divers of Jeju Island on the South Korean peninsula, while Lauren Audrey's high glamour designs celebrated the current climate in the West with a display of female empowerment in a riotous mélange of clashing tones and rich textures.
Meanwhile, non-binary designer William Dill-Russell explored the rise of gender fluidity in fashion with a dark and voluminous collection reminiscent of a child's game of dress-up, and Savannah Avery imagined a desiccated desert land punctuated with brightly coloured, fringed designs in a number of hand-crafted fabrics in homage to the traditional craftsmanship of the Tuareg People, a nomadic tribe of the Sahara.
Elsewhere, students explored subjects ranging from | 282 |
Awesome job as always , looks great !!
Wow!! Manchester 1, created a duplicate of the original saddlebags Tote Gote used... I just got them and had to try them on for size!! absolutely perfect!!
Thank you Eric. Is that the bike I customized the seat for you?.
Yes that's the bike with the custom seat!!
Dang I'd like me a set of<|fim_middle|> the outside light! | those bags.
I think you started something Karen!
I love the saddle bags! Bike is looking great!
Its a Roller and the tires hold air and move this time!!! Just waiting on the Headlight bracket and rear fender struts to dry and then this guy is back in Garage for Chains, cables and the Engine!
WOW, that looks awesome. Great job Eric.
That turned out nice Eric!
Saddlebags, light stick…Great finishing touches!
Cables, Chains, throttle and then the Engine... If had more time and some gas I would have rode this guy today... but just as well, I need to remove the gas tank and fix a Run I found in | 138 |
08We're pleased to announce that Hammond House Publishing have become a VANEL member. The organisation<|fim_middle|> www.hammondhousepublishing.com and Billboard TV at www.billboardtv.uk for more information. | describes itself as a 'not for profit' members' organisation and publishing company formed and operated by Authors, for Authors. They aim to bridge the gap between self-publishing and traditional publishing, providing help and support towards a successful career.
Originally formed by a group of university students studying for B.A. in Professional Writing, they now have members, contributors and subscribers across five continents.
Their annual International literary Prizes awarded by the University Centre Grimsby include categories for Short Stories, Poetry and screenplays and attract entrants from around the world.
Their community programmes, including creative writing workshops are aimed at reaching and supporting isolated people through literature.
Visit their website at | 132 |
BIG CYPRESS — Crystal Wilcox wanted to start<|fim_middle|> Osceola Sr.
Seminole Unconquered electronic cigarettes will be first made in U.S. | a business but wasn't sure what she wanted to do. While attending a 5-year-old's birthday party with her daughter at a beauty salon in Fort Myers, she was inspired to open a salon of her own in Big Cypress. That dream has become a reality with the opening of Sweetgrass & Serenity Spa Salon Boutique on Nov. 13.
Crystal, a cosmetology student at iTECH in Immokalee, never saw herself in the beauty industry until now. Having a daughter, Jalee, 7, changed her perspective. Crystal enjoys helping other people find their beauty.
Owned with her husband, Cory Wilcox, Sweetgrass & Serenity is a full-service salon, spa and boutique. The salon, located in the old Bureau of Indian Affairs building, has separate rooms for hair, nails and facials and for the boutique. Before they opened, the Wilcoxes renovated the entire 1,000-square-foot building and put in new plumbing and electricity to prepare it for business.
Services offered include hair care for men and women, facials and peels, waxing, makeup application, manicures and pedicures. The salon offers specific services on different days of the week. Wednesday, for example, is barber day, and Tuesday, the esthetician is there to give facials. Future services will include massages and possibly chiropractic services. The hairdresser and nail technician are available daily.
The boutique also features Native American-made jewelry, handmade purses, flower arrangements and customized flip-flops and cell phone cases.
The Wilcoxes believe more businesses could do well in Big Cypress.
"Just follow your dreams and run with it," Cory said.
Sweetgrass & Serenity is located across from the Big Cypress Field Office at 31025 Josie Billie Highway. Hours are Tuesday through Friday, 10 a.m. to 6 p.m.; weekends are by appointment only. For more information, call 863-902-1224 or email SweetgrassAndSerenity@aol.com.
Senior profile: Marcellus | 432 |
Katie and Trevor's Sonoma destination wedding was the perfect way for them to begin their life as a married couple and for me to close out my wedding season. I mean, I don't think I'll ever get tired of shooting weddings in the Rocky Mountains of Colorado, but every once in a while a change of scenery can really be inspiring. That's probably why Katie and Trevor decided to have their wedding on a hilltop in wine country and invite their family and closest friends to join them.
The whole wedding<|fim_middle|> with new friends and exploring the surrounding areas. It seemed like family and friends enjoyed the escape from the ordinary and I know that I did, too.
Thank you Katie and Trevor for having me along to photograph your destination wedding. It was a wonderful way to close out my 2013 wedding season! | had an elegant yet refined feel to it. From Katie's Vera Wang dress and Trevor's YSL tux to the pastel palette of the florals and linens, nothing screamed "Look at me! Notice me!". The entire wedding had a quiet confidence about it. The private residence and estate where the wedding was held was definitely impressive, but the fact that it was open to everyone to explore and enjoy made it feel less like a museum and more like home.
I guess this all kind of lends to the relaxed feel of the weekend as well. I was fortunate enough to have been invited to spend the entire weekend with Katie and Trevor's friends and family at the residence. There was definitely plenty of wedding and work going on over the weekend, but there was also relaxing by the pool, enjoying drinks | 161 |
Our Village, Our Future
Visioning for<|fim_middle|>.
Participants also indicated the desire for more flexibility in storefront design, including signs, which is important for communicating information to customers.
Every decision made about downtown should consider the customer experience in addition to other community values, which this visioning process seeks to identify further. What if every potential policy, operational, management, regulatory, and purchasing decision made about downtown were passed through a "customer experience" filter?
Participants mentioned several concrete ideas for improving the customer experience: explore the idea of a Village concierge, create a Visitor's Center, provide improved information online, and employ high school students as "downtown ambassadors" to assist customers navigate downtown and answer questions about topics such as parking and events.
Improve Communication Between Downtown & Residents
The first roundtable discussion ended with what participants noted as being a crucial topic: the relationship between Ridgewood residents and their downtown (and, by relation, business- and property-owners). Participants indicated a sense that some residents believe that it is "their downtown" and that catering to people who visit from other communities should not be a Village priority in downtown matters. However, downtown businesses need both resident and non-residents as customers to in order to survive and thrive. Therefore, individually and collectively, downtown businesses in many similar towns market themselves throughout their region and try to resolve operational challenges that create obstacles for all customers. This brings up several critical questions that the visioning process will explore further:
Which of the emerging visions might residents and downtown business- and property-owners agree on?
How does the Village negotiate between the wishes of residents and the needs of business- and property-owners when they conflict.
What principles currently guide the Village's decisions? What principles should guide those decisions?
How can communication be improved?
Furthermore, the train station adds another layer of complexity to downtown Ridgewood. How does the Village negotiate the needs of commuters for access to and parking at the train station with the needs of all the other constituencies in downtown?
Do you have any comments on what you've just read or any additional "emerging principles" or ideas related to the topics raised in this Village Voices segment that you'd like to share? Write to us through the Contact page of this website or in the comment form below.
Author: Neil@NV5
City planner, graphic/web designer for NV5. View all posts by Neil@NV5
Format Aside
Comment Form Cancel reply
Enter your email address to receive notifications of new posts on this website by email.
What is Visioning?
Visioning is a process of engaging people to find out what they value most about their community and to share concerns, ideas, and aspirations for the future of their community. Click here to read the Frequently Asked Questions (FAQ) about the visioning process for the Village of Ridgewood.
The second Visioning Workshop is this Saturday, 9/28! www.visionridgewood.org
The results of the Visioning Questionnaire are in! Check out www.visionridgewood.org to download some end-of-summer beach reading.
Spring is here, I think. Tomorrow is the last day to complete the Ridgewood Visioning Questionnaire! Visit http://bit.ly/myridgewood or www.visionridgewood.org/vq
See the "Village Voices" section of www.visionridgewood.org to find out what a group of RHS students envisions for the future of the Village. #visionridgewood
The Village on Social Media
Site designed and maintained by NV5, Inc. for the Village of Ridgewood, NJ
Our Village, Our Future Powered by WordPress.com. | Ridgewood's Next Master Plan
Village Voices
Village Voices: Downtown Dialogues
Ridgewood's Central Business District, or Downtown, is without a doubt one of the defining features of the Village. Downtown features strongly in the hearts and lives of many residents and the people who own and/or operate the businesses and organizations located here. A group of business- and property-owners participated in a roundtable discussion last month about the present and future of downtown. What do they see and need as they look into the future?
More than 20 business- and property-owners attended a roundtable discussion at the Ridgewood Public Library auditorium on the morning of February 20th about Ridgewood's Central Business District, or "Downtown."
The discussion, which was followed by a second discussion with local realtors, was held as part of the Our Village, Our Future visioning process. The discussions were geared toward the future of downtown and encouraging participants to think about the qualities, values, and principles that should shape the Village's next master plan as it relates to downtown. In focusing in on the future, the discussions provided an opportunity for participants to describe qualities, values, principles, and ideas that represent "emerging principles." This summary of the discussions are organized by these emerging principles.
Emerging Principles:
Create a Mix of Complementary/Supportive Uses that Leads to an Active Downtown Day and Night
Maintain the Aesthetic Qualities/Feeling of Downtown
Consider "Anchors" that Draw People In
To get participants to think broadly, the discussion started with a conversation about other "great" small town downtowns across the country. This was not asked to suggest that Ridgewood's downtown needs to be or look more like any other downtown, but rather to get a sense of the aspects or qualities that make certain downtowns especially attractive and successful, in their opinion.
Downtown Princeton, NJ (photo by Doug Kerr, licensed by CC BY-SA 2.0)
Among the NJ towns participants mentioned were Princeton, Morristown, Montclair, Clinton, Westfield, and Westwood. Princeton seemed to resonate with the group, generating the most discussion. Participants pointed to the mix of activities in Princeton's downtown, which includes a hotel, theater, and library along with restaurants and shops. Recognizing that Princeton has the advantage of a large university containing thousands of students and faculty adjacent to downtown, participants admire the mix of uses in its downtown and how they "work well together," as one participant commented, sustaining activity during the day and at night and giving reasons for people to go to more than one establishment in a single visit. Furthermore, Princeton is able to achieve this while also remaining "aesthetically cohesive," as participants noted, even though its downtown consists of a combination of historic buildings and newer buildings with contemporary architecture.
Ridgewood's downtown has a strong and growing base of restaurants, many of them with excellent reputations throughout the region. However, there is a flip side; activity in downtown is disproportionately concentrated in the evening and nighttime hours, when most of the restaurants are open. In the meantime, daytime commerce is much slower during the week, and most shops in downtown typically close in the early evening. Furthermore, some participants report that restaurants are starting to scale back lunchtime service in order to focus more on their dinner offerings. One participant noted that even during major festivals such as Downtown for the Holidays, which attracts thousands of visitors (i.e., potential customers) to downtown, many stores remain closed.
During the second roundtable discussion, a realtor commented that Ridgewood's downtown doesn't have a strong anchor that consistently draws people and generates pedestrian traffic. Such anchors can come in various forms. Princeton, for example, has a public library that is well-integrated into the "fabric" of downtown. Ridgewood's restaurants, taken together, are a strong anchor, but, as noted above, they attract people primarily during the evening and nighttime hours.
Could the arts be another anchor of sorts for Ridgewood? One participant suggested leveraging local educational institutions (e.g., Ridgewood High School, Bergen Community College, Ramapo College) and local talent through curated programs, festivals, and events in public spaces in downtown and in businesses. This requires areas such as Van Neste Square to be equipped for such uses.
Yoga in the Square (photo by Kelly's Yoga Passion)
A safe and active public square is a great asset for a downtown. Could Van Neste Square also serve as an anchor? Currently, it appears to be an underutilized asset, especially during typical evening and nighttime hours. No one wants to spend time in a dark park.
Fortunately the future of Van Neste Square may be looking brighter. The Van Neste Square Lighting Project will beautify and create a more comfortable experience for people to being in the park. The purpose of this project is to design and install lighting create an safe and inviting ambiance for visitors to the square after sunset. Electrical supplies will be strategically placed throughout the park to power future functions, shows, music, and other park events. Once this project is implemented, Van Neste Square could become an anchor that attracts people and encourages them to linger in downtown even after the sun goes down. It could add more pedestrian activity along E. Ridgewood Avenue and S. Walnut Street, which might encourage stores to stay open later, thus providing opportunities to complement a visitors' dining experience.
Emerging Principles
Keep in Mind the Transition from "Central Business District" to "Downtown" or "Village Center"
Capture New Opportunities Created by Public & Private Investments
Ridgewood's central commercial area has, traditionally, been called the "Central Business District," and with good reason; commerce has been the only permitted activity. However, within a few years, construction will be completed on three new residential developments, which will be home to several hundred people within the "Central Business District." A term such as "Downtown" or "Village Center" would be more accurate and could be incorporated into any future coordinated branding and marketing.
The consultant team encouraged business- and property-owners to pay close attention to the changes that the three new residential developments and the new parking garage, once completed, bring to downtown over time and to be ready to respond to the challenges and opportunities that they present. Several business-owners reported being very concerned, in the near-term, about the time during which the parking garage is constructed, when the surface parking lot will not be available. On the other hand, looking at the long-term, several hundred new live-in people in downtown presents a significant opportunity to attract new customers. They will add more pedestrian activity to downtown during the day and at night. Furthermore, the three new residential developments are located at each edge of downtown, so the potential increase in pedestrian traffic wouldn't be concentrated on only one street. This could start to shift the downtown economy by increasing daytime commerce so that it is not so reliant on evening and nighttime patrons.
The addition of more cars in downtown from the residential developments could aggravate current traffic congestion challenges, which underscores the importance of determining how pedestrians should be regarded in downtown into the future, how pedestrian traffic might shift to or increase on certain streets, and how to manage and reduce congestion holistically. One of the next "emerging principles" touches on this a bit more.
Create a Safe Environment for Pedestrians of All Ages
Consider Alternatives that Reduce Car Traffic and the Need for Parking
The "great" downtowns that participants identified outside of New Jersey were Del Ray Beach, FL and Burlington, VT. They brought them up for a similar reason: mobility, or the ability to move around with ease and safety whether by foot, bicycle, car, or transit.
Burlington's Church Street Marketplace (photo by Beyond My Ken, licensed by CC BY-SA 4.0)
Burlington, VT was mentioned specifically for its Church Street Marketplace, a four-block outdoor pedestrian shopping and dining promenade in this city's downtown. More than 80 storefronts line this promenade and, despite the prevalence of Internet commerce, occupancy rates sometimes reach 100%. The takeaway from this example for Ridgewood isn't to replicate this feature, but rather to understand the potential that creating a very safe and comfortable experience for pedestrians, along with other operational matters, can have on a downtown environment and economy.
One participant brought up Del Ray Beach, FL for its electric car taxi that shuttles local residents from their door to downtown and back. While the impetus of this "Downtowner" service was to encourage residents to shop locally, any such system that encourages residents to leave their cars at home can help reduce parking access and supply challenges. And, from the perspective of residents, they do not have to worry about finding parking or wondering if their meter has expired, which can help encourage them to stay in downtown longer.
Closer to home, Summit, NJ has a ride-sharing program for commuters. The program uses Lyft (a service similar to Uber) to transport local residents to and from the train station, instead of them having to find parking in the already congested downtown area. Residents with prepaid parking permits are eligible for free rides to and from the station during weekday commuting hours; residents without prepaid permits are eligible for $2 rides, which is equivalent to the cost of the city's $4 daily parking.
A crossing guard in a small downtown (photo by USFWS Marine Station, licensed by CC BY 2.0)
One participant suggested an idea that could be incorporated into a broader strategy for creating a safe environment for pedestrians: crossing guards. Schools have crossing guards to ensure students are safe while crossing streets adjacent to schools. Crossing guards could be very helpful in downtown during rush hours and other busy times to help pedestrians feel more safe and secure while crossing busy intersections, especially those four-way intersections that are only controlled by a stop sign, such as E. Ridgewood Ave and N. Broad St. This is also one element of the "emerging principle" described in the next paragraph.
Emerging Principle:
Strive for a Customer-Focused and Customer-Friendly Downtown
One of the overarching themes of the discussion with business- and property-owners was the experience of customers in downtown. For anyone in the hospitality industry, which, in essence is what downtowns are in, keeping customers safe and happy is of utmost importance. Several participants recounted stories of customers who have reported unpleasant and unfriendly experiences in downtown Ridgewood, even to the extent to which they would not return to downtown. This problem seems especially acute when it comes to parking and its accessibility, operation, timing, and enforcement. Participants reported hearing complaints from customers who have had problems using the newly-installed kiosks. They have also noticed times when the kiosks have malfunctioned, and an instance when a group of people visiting Ridgewood for lunch had all been ticketed for parking violations.
At the second roundtable, several realtors reported that they often introduce a prospective homebuyer to Ridgewood by taking them through downtown, which typically creates a strong positive impression. However, prospective residents generally come to know that when day-to-day challenges such as commuter parking come into play, they can be a significant negative factor in their evaluation of Ridgewood as a place to live. So, in this sense, the idea of "customer" expands to encompass potential new residents of Ridgewood, and not just customers of downtown | 2,345 |
Хидрокела је назив који означава једнострано или обострано накупљање течности у овојницама тестиса или у семеноводу. У десет посто случајева хидрокела је обострана. Клиничком сликом хидрокеле доминира оток и осећај тежине у скротуму (мошницама) и препонама.
Етиологија
Узроци хид<|fim_middle|>ћине болесника хидрокелу не изазива никакве симптоме. У осталим случајевим манифестује се:
пуноћом скроталне кесе и отежаним напипавање тестиса унутар ње
промене код хидрокеле се могу наћи са једне, или са обе стране
бол је најчешће осутан
слободна течност се најчешће налази испред тестиса и може бити удружен скроталном килом
неплодност, ако је хидрокеле удружене са стерилитетом који је настао као последица запаљењских процеса у скротуму
Дијагноза
Анамнеза, клиничка слика објективни преглед
Дијагноза се поставља на основу анамнезе, клиничке слике и објективног прегледа са просветљавањем мошница, што је обично довољно да се постави дијагноза хидрокеле.
Ултрасонографија
Ултразвучни преглед мошница обично потврђује дијагнозу хидрокеле код нејасних случајева.
Допунска испитивања
Допунска испитивања су потребна у случају сумње на удржене болести које изазивају хидрокелу (присуство инфестација, жаришна туберкулоза, присуство туморског процеса на тестисима итд).
Диференцијална дијагноза
Дференцијално дијагностички треба имати у виду:
Торзију тестикуларних апендикса
Терапија
Лакши облици комуницирајућих хидрокела не захтевају лечење, већ само редовно праћење.
Једна од метода лечења је и скротална аспирација са склеротерапијом хемискротума, коришћењем раствора тетрациклина или доксициклина. Склерозни агенси се не смеју користити код деце због ризика од хемијског перитонитиса.
Хируршко лечење се узима у обзир само приликом накупљања слободних течности у хидрокели у већим количинама, и подразумева лигатуру вагиналне тунике тестиса и евакуацију (дренажу) акумулиране течности.
У случајевима када је хидрокрекинг повезан са другим болестима, такође је неопходно третирати основну болест која је узроковала некомуницирајућу хидроцикелу.
Види још
Ингвинална хернија
Варикокела
Бутна кила
Извори
Спољашње везе
Приручник ургентне урологије
Урологија
Акутни скротум
Хирургија | рокеле су многобројни. Код деце је један од честих узрока необлитерирана комуникација између трбушне дупље и скротума. Овај тип хидрокеле носи назива "комуницирајући тип хидрокеле".
Што се тиче другог типа или некомуницирајућег облика хидрокеле, он настаје као последица неравнотеже између стварања, упијања (апсорпције) и накупљања течности у овојницама тестиса. Неки од узрока овог типа хидрокеле су запаљењски процеси у подручју скротума и тестиса (епидимитис, орхитис), затим трауме тестиса, тумори тестиса итд.
Клиничка слика
Код ве | 262 |
Hard disk backup software programs are employed for data safety reasons. It creates disc image files that contains exact copies of hard disk drives. These drive image files could be saved in a number of mediums for example Compact disc, DVD, and Iomega Zip.
Software that supports your hard disk allows you to definitely quickly reinstate your system to normalcy functioning after an operating-system crash, virus attack, or hardware failure. Hard disk backup software programs are also helpful for mass system deployment including many identical computer systems. Hard disk backup software likewise helps you restore only necessary files.
Hard disk backup software allows you to definitely secure all of your programs, os's, documents, financial records, pictures, and music files. Miracle traffic bot will the backup job without preventing any operating-system or any other running programs. Hard disk backup software normally doesn't interrupt the functioning of the computer. It safeguards data by archiving it at scheduled occasions. Many hard disk backup software programs have timetable configurations that may be modified through the user.
Several hard disk backup applications are available for sale to ensure that you are able to choose one which feels like a fit perfectly. Some backup programs are equipped<|fim_middle|> will vary versions of the identical hard disk backup software for various os's. When buying hard disk backup software, it is best that you simply purchase a backup software product which does bit-level verification. Hard disk backup software programs are very essential for all companies which use computer systems it's the only remedy to outlive system and network crashes. | for personal and small company computer systems, while some are only concerned with professional use. Most hard disk backup programs focus on several operating-system.
Also in the marketplace | 32 |
Growth in self-employment in the UK has been the fastest of all Western European countries over the last year, with the proportion of workers who are self-employed rising by almost a whole percentage point.
Self-employment has proven to be a key driver of overall job creation, with the working-age employment rate reaching historically high levels.
In May 2014 compared with April 2014, the seasonally adjusted volume of retail trade remained stable in the euro area (EA18) and fell by 0.1% in the EU28.
In April retail trade decreased by 0.2% in the euro area and rose by 0.2% in the EU28.
In May 2014 compared with May 2013 the retail sales index increased by 0.7% in the euro area and by 1.2% in the EU28.
The euro area (EA18) seasonally-adjusted unemployment rate was 11.6% in May 2014, stable compared with April 2014, but down from 12.0% in May 2013.
The EU28 unemployment rate was 10.3% in May 2014, down from 10.4% in April 2014, and from 10.9% in May 2013.
25.184 million men and women in the EU28, of whom 18.552 million were in the euro area, were unemployed in May 2014.
Compared with April 2014, the number of persons unemployed decreased by 63 000 in the EU28 and by 28 000 in the euro area.
Seasonally adjusted GDP rose by 0.2% in the euro area (EA18) and by 0.3% in the EU28 during the first quarter of 2014, compared with the previous quarter.
In the fourth quarter of 2013, GDP grew by 0.2<|fim_middle|> rose by 0.9% in the euro area and by 1.4% in the EU28 in the first quarter of 2014, after +0.5% and +1.0% respectively in the previous quarter. | % in the euro area and by 0.4% in the EU28.
Compared with the same quarter of the previous year, seasonally adjusted GDP | 33 |
Waterfall railway station is located on the Illawarra line, serving the Sydney suburb of Waterfall. It is served by Sydney Trains T4 Ill<|fim_middle|>886
Railway stations in Australia opened in 1905
Illawarra railway line
Sutherland Shire | awarra line services and NSW TrainLink South Coast services.
History
The station opened on 9 March 1886 as Waterfalls, being renamed later in the year. It served as the line's terminus until it was extended to Scarborough in 1887. When the line was duplicated from Hurstville on 12 December 1890, the station was relocated northwards. In 1897 a locomotive depot opened.
On 4 May 1905 the station moved 600 metres north to its present location.
On 20 December 1994, a shunting accident involving two empty S sets saw one train jack-knife onto the platform, demolishing the concrete pedestrian bridge.
The original weatherboard building was demolished in 1995 and replaced by a rendered brick building.
South of Waterfall railway station is the site of the Waterfall train disaster, a rail accident that claimed the lives of the driver and six passengers on 31 January 2003.
Work commenced in late 2013 to make the station fully wheelchair accessible.
Sidings
Waterfall has sidings for staging freight trains in either direction and a bypass track for goods trains on either side of the platforms. There are also three sidings for the stabling of suburban electric trains to the east of the station. If both platforms at Waterfall station are occupied, then trains that do not stop at Waterfall will also pass by on the bypass tracks.
Platforms & services
Trackplan
References
Further reading
"Waterfall and its Three Stations" Australian Railway Historical Society Bulletin October 1961
External links
Waterfall station details Transport for New South Wales
Easy Access railway stations in Sydney
Railway stations in Sydney
Railway stations in Australia opened in 1 | 381 |
The Licking River is a partly navigable, 303-mile-long (488 km) tributary of the Ohio River in northeastern Kentucky in the United States. The river and its tributaries drain much of the region of northeastern Kentucky between the watersheds of the Kentucky River to the west and the Big Sandy River to the east.
The Native Americans of the area called the river Nepernine. When the explorer Dr. Thomas Walker first saw it in 1750, he called it Frederick's River. An earlier name given by hunters and frontiersmen, Great Salt Lick Creek, makes reference to the many saline springs near the river that attracted animals to its salt licks. The origin of the present name is unclear, though likely related to the previous name.
Numerous aboriginal peoples inhabited the watershed for at least part of the year for several thousand years; Native American tribes that frequently hunted in and around the Licking River valley included the Shawnee and Cherokee. Other, older settlements of unnamed groups in Bath County on Slate Creek are also known. The river served as an important transportation and trade route for both Native Americans and,<|fim_middle|> operation since 1890. The community took its name from the nearby river.
In 1999, the community of River received international attention for having the world's longest "plastic" bridge. The wooden deck of the 420-foot-long (130 m) Forrest and Maxie Preston Memorial Bridge was replaced with a deck made of glass fiber-reinforced polymer composites. The bridge is 30 feet longer than Aberfeldy Bridge in Scotland, which was the former recordholder. The bridge spans the Levisa Fork and connects River to the community of Offutt.
River is also noted as the birthplace of country music star Hylo Brown and is the burial site of legendary pioneer, Jenny Wiley. | from the mid-18th Century on, colonists of European descent who began pushing into the area (predominately from Virginia, Maryland and the Carolina colonies).
River is an unincorporated community located in Johnson County, Kentucky, United States. The post office was first established on September 6, 1890 and its current ZIP code is 41254 and its telephone area code is 606. Its logistical coordinates are (37.86102N, 82.72623W).
A post office called River has been in | 125 |
Putting principles into practice: our next steps forward for security and privacy
Just like you need steel, concrete, and wood to build a house, you need a few key components to build a modern, successful business. Employee experience, impactful services, customer engagement, and secure infrastructure are some of those essential items — the latter serving as the glue that keeps your business together. You can't scale your business without security, and that's especially the case with hybrid work.
While hybrid work creates flexibility and scalability, it presents a complex IT challenge that requires a more thoughtful approach to security. Exposure points multiply as employees work from offices, homes, coffee shops, airports, and more, tasking IT with securing and controlling a diverse set of environments.
This requires security leaders to design a strategy that helps protect employees no matter where they are or what they do, one rooted in the variability that comes with flexible work. Our security and privacy sessions at Zoomtopia 2022 reflected on this current landscape, and experts discussed its impact on security strategy, data sharing and privacy programs, solution adoption, and more.
Chatting with IDC on accelerating collaboration and minimizing risk
Frank Dickson and Christopher Rodriguez, analysts at IDC who authored the white paper "Securing the Real World: Accelerating Collaboration, Minimizing Risk," were joined by our own John Kennedy, distinguished security architect, to bring their paper to life at our user conference.
The three speakers came together to expand upon takeaways from the paper. From adopting relevant security controls to encryption types to factoring in the human element, the session took a realistic look at security and privacy in the era of hybrid work and what's needed to set a business up for success. Security is about context, according to Frank and Christopher, and everyone's context is different — what matters is having options you can tailor to your organization's needs.
Data privacy in practice
Our own Aurora Brigham, lead product manager; and Glory Francke, former senior counsel, got up close and personal with privacy during their Zoomtopia session. They explained how we at Zoom talk the talk and walk the walk when it comes to data privacy, discussing the guiding principles behind our initiatives, as well as how we're rolling out features and programs to turn these principles into reality.
Privacy is a part of our value of care: We are a steward of the personal information entrusted to us.
Transparency: We help our users, employees, and partners understand how Zoom uses data.
User choice: We are committed to providing our users with meaningful control<|fim_middle|> and how that works for different solutions.
A peek into architecture, policy, and process.
Encryption types that underpin each flow.
Address your business's context
We at Zoom have designed our security and privacy offerings around this new flexible future. We want to equip our customers with the tools they need to embrace whatever working style suits their employees. From our recently announced end-to-end encryption feature for Zoom Mail Service (beta) to enterprise auto-update, these security offerings are here to help you choose the kind of technology you need to effectively protect your infrastructure.
Check out all the security and privacy Zoomtopia 2022 sessions in our on-demand library, and learn more about our security and privacy efforts, visit our Trust Center. | over their personal data.
Privacy by design: Privacy and security are core to our product design, and we take steps to identify privacy and compliance risks early in the software development process.
Recent offerings and initiatives
Aurora and Glory also discussed the findings from our recent Data Protection Impact Assessment (DPIA), which is an assessment and detailed report on how a company processes data. A DPIA gives recommendations on how to minimize privacy risks, and essentially lets institutions benchmark and evolve their data privacy and protection strategies. Aurora then explained how we've acted upon the DPIA's findings through new product features and launches — putting our principle of privacy by design into practice.
Know the flow
Want to know where your data goes? Our own Russ Hearn, distinguished security architect, pulled back the curtain for attendees of this data handling session, discussing how data sharing works when using Zoom solutions. Highlights included:
How data flows, where it goes, what's included in a data set, | 195 |
Steven Spielberg - an American director, producer, screenwriter and co-founders of DreamWorks Studios, who is considered one a pioneer of the New Hollywood era and one of the most popular directors and producers in film history - born on Wednesday December 18th 1946, in Cincinnati, Ohio, United States.
Freedom is the key to Steven's personality. Steven Spielberg loves travel, adventure, variety and meeting new people, and he longs to experience all of life. He also loves to be involved in several things at the same time as long as he is not tied down to any one area. Change is constant in his world, requiring adaptability and courage.
With his upbeat and often inspiring personality, Steven Spielberg makes friends<|fim_middle|> with others, and much more.
April 20th 2019 is a day of problem solving for Steven Spielberg. That can be achieved through his creativity, optimism, and ability to share feelings with others today. Steven is also capable of gathering and using information today when approaching a challenge.
Spielberg enjoys a pleasant evening, and quality encounters that involve sharing of feelings. | easily and attracts people from all walks of life. He has a way with words and an uncanny ability to motivate others. Thus, Steven can be very successful and happy in sales, advertising, publicity, promotion, politics or any profession that requires communication skills and understanding of people.
Steven is multi-talented and possesses a variety of diverse abilities. However, discipline and focus are the true keys to his success. Without these, many of the tasks Steven begins will remain unfinished and he will fail to realize the true fruits of his abilities. With hard work and perseverance, however, the sky is the limit. Self-employment attracts Spielberg powerfully, yet his challenge is to settle into one area to cultivate his ability sufficiently to earn a living and attain success. Once Steven Spielberg finds his niche, the motivation and inspiration he supplies others with will bring him much in return, and he will find his friends and colleagues supporting and promoting him on the road to success.
He is often a late-bloomer and needs to experience life before he can truly know and commit to his heart's desire. Steven Spielberg may be perceived as a wild child by adults and a source of concern by his family. However, he must not be obliged to hurry his choice of career or family. Steven's challenge is to learn the true meaning of freedom-from-within through his jurney. He should try to maintain an exercise program to keep his body in shape. The flexibility and durability of Spielberg's body will promote security and confidence within him.
Steven Spielberg tends to be quite adaptable, and he finds it easy to fit into most social set ups and vocational fields.
There are no particular virtues that can cause an imbalance in Steven's personality and life, but he has to work hard and persistently to develop those special strengths that he desires to attain.
Learning to be wisely assertive is a major lesson to be taken by Steven Spielberg throughout his life.
Tour Steven's menu and gain more insight into his personality traits, relationships, strengths and weaknesses, likes and dislikes, compatibility with you and | 413 |
Gucci Tops Balenciaga as the<|fim_middle|> of the hottest fashion brands of 2017.
Source:Business of Fashion
Main / Featured Image:Eva Al Desnudo / Highsnobiety.com
Jonathan SawyerStaff Writer
Not NYC, not LA. | Hottest Brand of 2017
2018-01-29 19:00 in StyleWords By Jonathan Sawyer
Throughout the entirety of 2017, Gucci and Balenciaga jostled for positioning atop the hottest fashion brands list. Now, Business of Fashion, with the help of global fashion search platform Lyst, has revealed its final standings for 2017.
BoF in turn notes that Balenciaga was especially popular during the second half of the year, but in total, Gucci came out on top as the world's hottest fashion brand. Furthermore, four out of the five top-selling products of 2017 were Gucci. Balenciaga's Speed Trainer was the other to join the selection.
Business of Fashion also points out that Georgian designer Demna Gvsalia's influence on 2017 was undeniable, as Balenciaga and Vetements came in at number two and number three respectively. Searches for Balenciaga reportedly increased 50% throughout the course of the year.
In addition, OFF-WHITE experienced a significant leap on the list, moving up 71 places from 2016 to 2017, while YEEZY transitioned from 31st to 10th.
See below for BoF's list of 2017's hottest brands, as well as the top products of the year. Following, visit their website for a thorough breakdown.
Hottest Brands of 2017
1. Gucci 2. Balenciaga 3. Vetements 4. Valentino 5. OFF-WHITE 6. Givenchy 7. Moncler 8. Stone Island 9. Balmain 10. YEEZY
1. Gucci GG Blooms Supreme Sandal 2. Balenciaga Speed Trainer 3. Gucci GG Logo Belt 4. Gucci Ace 5. Gucci Logo T-Shirt 6. Givenchy Logo Slide 7. Balenciaga Campaign Logo T-Shirt 8. Isabel Marant Lexing Boots 9. Acne Studios Lab Denim Jacket 10. Moncler Maya Quilted Jacket
Now here's another look at some | 472 |
However, this ease of information exchange also comes with a price: new ways to be victimized by scams, fraud, and outright theft of personal information.
Don't despair! There are simple, common sense steps you can take to reduce your risk of losing your information, your money, and your identity to con artists, and you don't have to give up the convenience of the Web!
Tip 1: Don't give ANY personal information to anyone unless you initiated contact.
Most commonly, people fall into the trap of giving away bank account numbers, Social Security numbers, credit card numbers, usernames, and passwords after receiving an email from a bank or credit card company asking for a customer response. Sometimes, these emails will ask for this personal information to be returned in an email, but more often, they will provide a link to a website.
This technique, often called "phishing," creates emails that often warn recipients that their account or personal information has been compromised or that they are in danger of having certain privileges, such as use of a credit card, revoked. While it used to be easy to tell these bogus emails from genuine ones, many phishing emails now look quite official, using logos, legal language, even real customer service telephone numbers!
Most banks, credit card companies, and other businesses that handle sensitive information will not ask you to give personal information via email. In fact, it's always good practice never to give any personal information unless you initiated<|fim_middle|> of cure." So get out there—do your banking, buy your gifts, and earn that degree! | the contact. If you receive such an email, visit or call the company (with their customer service number that you have on file, not in the email) that's asking for the information to determine if the communication is legitimate. It's an extra step worth taking to protect yourself!
Tip 2: Always check website addresses.
Before you divulge any sensitive information on a website, check the website address, or URL, first. Make sure that it begins with "https://", not "http://." That extra "s" means "secure," and that means that there is a security certificate for the website that encrypts all information that is sent over the internet. Never give any personal information to an "http://" address.
Tip 3: Always check security certificates.
Another good piece of advice is to check the security certificate before giving personal information. You can do that by clicking the padlock icon that appears in your browser, usually in the address bar but sometimes along the bottom of the screen. A new window should pop up, giving you information about the security certificate. All you need to look for is that the certificate hasn't expired and that it matches the domain name of the website. For example, a certificate for "anytownbank.com" should be registered for "anytownbank.com." Most browsers will warn you with a popup window if these parts of the security certificate aren't correct, but you can always check anyway.
You should also be aware of another scam called "pharming." This is when a hacker builds a fake website that mimics a real one and hijacks the information that tells your computer's browser where to find the website. So your browser is trying to go to "anytownbank.com" but is given the wrong information on where to find the real website. While this sounds frightening because you may not be able to tell the difference between the real site and the fake one, the fake website will not have the correct security certificate…or even one at all.
If you doubt the legitimacy of a website, call the customer service number you have on file for the company to verify that you are using the real website.
Tip 4: Never download software from sources you don't know or without reading the End User License Agreement.
Spyware and adware, unwanted software programs that track your computer activities and report them to a third party, can engage in key logging, which simply is logging your keystrokes. This can open you up to revealing usernames, passwords, account numbers, and other sensitive information to unknown sources.
Before downloading software, particularly free software, read the End User License Agreement (EULA). The EULA will reveal if extra software comes with the package and if you are agreeing to submit information involuntarily. Also, never download software from an unsolicited source and from popups that warn you that your computer is at risk. These are almost always clever disguises.
Keep your computer up to date with antivirus software and spyware detection programs to keep your information safe.
With all this said, don't be afraid to take full advantage of the technology available to you. Just remember that a little common sense and careful Web surfing can keep your personal information and identity safe. And always contact your bank or other institutions if you fear that personal information has been compromised. It's just like that adage: "An ounce of prevention is worth a pound | 683 |
Mashpee Boys Tennis: Season CL<|fim_middle|> 3-2 Ben. | oser
By Ben Nadzeika
The Mashpee Boys Varsity tennis team faces a defeat Thursday afternoon, at Mashpee High against Saint John Paul. The team had had a rough season with the loss of Jashan Chopra, a senior player last year, and first singles player for the team. The team's record this year is 0-12.
The top 3 players on the team this year are Liam, Donovan, Connor Wescott, and Cole Lorig. When interviewed players of the team had this to say, "The season has been tough. Saint John Paul is a really tough team who we didn't expect to beat, but we still had fun all the same."
When asked if there has been improvement in the team, individually among players and as a whole, assistant coach Donovan had this to say: "The team has come a long way since the beginning of the season, but there is still room for improvement. Each player has shown improvement too. The season next year looks promising."
The team is disappointed with their overall season outcome, but they don't let that bring them down. They keep their heads up and look forwards to the next season.
Connor Westcott
This is wrong our last game was against carver and we won | 258 |
29.8 x 21 cms
The word 'Sublime' drawn onto a yellow post-it note which has been stuck onto white cartridge paper.
The Blank Page - Darian Leader SHOW
The Blank Page - Darian Leader
Everyone is familiar with the image of the writer or artist confronted with blank page or canvas. We see it on TV, at the movies, in comics or in magazines. When we read a description of the particularity of the experience, we might identify with it or we might not. Sometimes the emphasis is on a preconception and sometimes on a void: there's a difference between having a clear image of exactly what one wants to create and being stuck at the moment of materialising it and just knowing one wants to create but not having any idea of what. Both of these suppose the encounter with the blank page, but isn't this blankness itself something that involves a complex process<|fim_middle|> yet without this blankness, how can a creation emerge?
Gavin Turk's blue plaque provided an elegant solution to this apparent impasse. Instead of displaying works that would necessarily fail to represent their maker, he simply indexed the fact that works had been made. That way, no one could judge whether the works had done their job or not. Naturally, this solution was a transitory one, as the association of the plaque with renown opened up a thread that the artist followed with some tenacity: his later works explored iconic images and what it
would mean to inhabit them.
The parsimony of the RCA installation of course raised the question of the missing works. Where were they? How could the artist conjure himself out of representing himself? What was there to interpret? This coalescence of blankness and creation brings into focus nicely the main psychoanalytic approaches to making. Analysts tend to fall into two camps here. Those who believe that we create from our phantasies, unconscious scenarios that mould and shape what we produce, and those who emphasise less such unconscious templates than their absence. For them, it is precisely the points at which our phantasies fail us from which the work of creation springs. Where we are unable to explain to ourselves key questions such as birth, death and sexuality, we create works in the place of the missing solutions. This would explain why classical psychoanalytic readings of literary and artistic works seem so reductive: they put the emphasis on phantasy and meaning rather than the experience of a hole.
Again, the stakes can be quite high at this point. Confronted with a hole, we can make something out of it or we can jump into it. And can't the blank
page be both the substance and the metaphor of these options?
Ceramic plaque in room
Dali Moustache
Human hair & ink on gold card
News Font
Newsprint on paper
Positive Negative A4
Silkscreen on paper | of creation? Is a page with nothing on it a blank page from the start?
Blankness, like silence, needs to be created. You might enjoy the silence of your garden every morning until one day you notice that it isn't silent in the same way anymore: the birds have suddenly stopped twittering. The silence you feel now has a weight to it, created by the absence of birdsong. In other words, it's the noise that creates the silence,
that frames it. To take another example, you might be pleased to spend the day at a spa where mobiles are banned and there's only a vague background hum of New Age music. But what would happen if when you checked in, the receptionist just stared at you and said nothing? The absence of noise at the spa wouldn't be silence, but the receptionist's non-response would be. Isn't the blankness of the blank page quite similar?
It only becomes blank at the moment we feel the weight of an expectation to fill it, to put something there. It's the expectation that creates the blankness. This means that the same blank sheet of paper will only become a blank sheet of paper at a certain moment in one's life. Perhaps it will then stay blank forever, perhaps not. But the moment that it becomes blank will be specific and unique to each of us. For some, the accent is perhaps less on expectation than on necessity. Paul Klee would find it impossible not to draw, covering any available surface from menus to newspaper borders with configurations of lines. Klee explained that he felt looked at from all sides: even on
his trips to the country, he said, "it was not I who looked at the forest, since the trees were looking at me". This feeling of being submerged, of being invaded, was why he had to make marks. They protected him from an intrusive and enigmatic presence. With such high stakes, the page, for Klee, could not stay blank.
We often make marks at moments when we feel overwhelmed. This goes beyond the idea that we make narratives to protect ourselves from trauma. It is less about making meaning than about making an inscription, less about making stories than about making marks. Something can be fixed or arrested by making a mark, as we see, for example, in the feeling of relief sometimes experienced by self-harmers after they have made a cut in their body surface. This could be seen as a form of discharge, but a better term might be barrier or limit. Isn't the crucial moment in the act of inscription, after all, the moment when one ends a line or mark or brushstroke? This is less an art of representing than an art of stopping.
Sometimes, it can be the very blankness of a page
that needs stopping. The page itself becomes a conduit for an anxiety that has its source somewhere else. The blankness calls us like a siren: say something, write something, do something. This solicitation requires us to represent ourselves, yet representing always involves a loss. We can never represent ourselves perfectly, only inadequately and incompletely, and this margin of loss can both bind us to the blank page and inhibit us to go further. Whatever we do will not be enough, so we remain at the edge of what seems like an abyss. Writers sometimes speak here of how they feel taunted by the blank page. And | 690 |
In this introductory-level article we look at the mechanics of a Sprint, and at how team members are expected to collaborate in order to produce a release-quality increment.
Sprint Planning ought to be prepared for. The most important preparation<|fim_middle|> that the Product Backlog has been refined to an appropriate level of detail, with estimates and acceptance criteria (this is the purpose of Product Backlog Refinement). Next, the Product Owner should have ordered the work on the Product Backlog, and have a general idea of how to negotiate a valuable Sprint Goal with the team. The options for negotiating a Goal should also have been considered during Refinement, and reflected in backlog ordering. Also, the team should have an idea of their capacity for this Sprint, which is to say, how much work they believe they can take on. They may be able to use their experience with previous Sprints to help them ascertain the size of this budget.
Each Sprint should result in a valuable increment of completed work, fit and ready for immediate release. The Product Owner is wholly accountable for what "value" means, and ought to have ordered the Product Backlog in such a way that value can be maximized by the team, sprint-by-sprint. The first thing the team must do is therefore to plan which items from the Product Backlog should be worked on in this Sprint, so that the best value can be delivered by the end of it.
To do this, the team work with the Product Owner to select the most valuable items from the Product Backlog which fits their projected capacity for the Sprint. Bear in mind that each item on the Product Backlog ought to have been given an estimate by the team, so they will know roughly how much work is likely to be involved.
This selection of work should be cohesive, and not just a grouping of unrelated and disparate items. Remember that a Sprint is a time-boxed opportunity to achieve something significant. For example, by the end of the Sprint a coherent feature may have been delivered, or a significant risk will have been mitigated. The Sprint Goal is a simple expression of this purpose, of the overarching significance of the work selected, and the coherence behind the selection.
A Sprint Backlog is more than just a selection of work with an end goal in mind. It is also a plan for how that goal will be achieved, and how the associated work will be performed. This can be done by identifying and ordering the technical tasks that are likely to be involved. In effect the Sprint Backlog is a plan for meeting the Sprint Goal, and a forecast of the work that will have to be done.
Once the team have planned their Sprint Backlog they can start work. If they have planned things out as tasks, they will collaborate with each other, as a team, to make sure that those tasks are completed. They'll be able to track their progress by using their task board and their Sprint Burndown of work remaining.
Every working day, at the same time, the Development Team will meet and plan what they will do to bring them closer to the Sprint Goal. This meeting is called the Daily Scrum and it should never take more than 15 minutes.
By the end of the Daily Scrum, the team should have a clear plan for the next 24 hours and an understanding of how they will need to collaborate in order to achieve it. They should also have a list of any impediments which require the Scrum Master's attention.
A refinement session typically begins with the Product Owner presenting the current Product Backlog to the team. The backlog may be held in a number of forms, such as an electronic Scrum Board or other collaboration tool, or it may simply be a spreadsheet. A projector or shared screen can be very useful.
The team start at the top of the Product Backlog and work their way downwards, refining each item in turn. They'll examine each one and discuss its scope, and the acceptance criteria that will be necessary for its completion. Each item will then be estimated using a technique such as Planning Poker. A large item may be broken down into smaller ones which capture greater detail. Epics may be decomposed into user stories, for example.
The team stop once the session's time-box runs out. They will recommence where they left off the next time, eventually starting at the top again so the backlog is kept up to date.
This means that each Development Team member must collaborate with his or her peers throughout the day, as they are jointly responsible for the progress of work. Any problems or failures are jointly owned by the team, as well as their successes. Collaboration is not something which is restricted to events such as the Daily Scrum, but applies to everything the team does throughout each entire Sprint.
If a team has collaborated efficiently, they'll have worked together to meet the Sprint Goal, managing any risks and adjusting their plans as necessary. They'll have demonstrated control throughout the Sprint through an even burndown of work remaining, where each member saw it as their personal responsibility to help complete work in progress. They'll have a valuable increment to demonstrate to the Product Owner and any invited stakeholders. A Review is something a team should look forward to.
The next thing to do is to conduct a Sprint Retrospective. A Retrospective considers the process which the team is following. Are they working as effectively as they can? It's generally best to hold the Retrospective immediately after the Review, because the former can introduce ideas for consideration in the latter.
Establishing a time-line can help jog attendees' memories about significant events during the Sprint. | is to ensure | 3 |
This is a full-year introductory college course in biology with laboratory. The major content areas are molecules and cells, heredity and evolution, and organisms and populations. University credit can be earned with a successful performance on the AP exam.
This is an advanced laboratory course, which is designed to correlate with and compliment the theoretical knowledge learned in Advanced Placement science courses.
AP Chemistry is a full-year introductory college course. The study includes advanced theoretical and physical understanding of chemistry. University credit can be earned with a successful performance on the AP exam.
This course is a core curriculum science course. The goal is to provide students with the scientific principles, concepts, and methodologies required to understand the interrelationships of the natural world, to identify and analyze environmental problems – both natural and human-made, to evaluate the relative risks associated with these problems, and to examine alternative solutions for<|fim_middle|> Students should also be enrolled in AP Calculus AB or BC. The focus of Physics C is mechanics, electricity and magnetism. It is especially appropriate for students planning to enter careers in engineering or physical science. University credit can be earned with a successful performance on the Advanced Placement exam.
It is strongly recommended that students take both AP Physics I and AP Physics II before taking AP Physics C. AP Physics C is equivalent to an introductory, calculus-based college level physics course for students majoring in the physical sciences or engineering. | resolving and/or preventing them.
AP Physics I is the equivalent of a first-semester algebra-based college physics course, but it is designed to be taught over a full academic high school year to enable AP students to develop deep understanding of the content. The course covers Newtonian mechanics (including rotational dynamics and angular momentum), work, energy, and power, mechanical waves and sound. It also introduces electric circuits. The combination of AP Physics I and AP Physics II is equivalent to a 2-semester introductory college physics course for students in life sciences, pre-medicine, as well as other non-science fields. So it is strongly recommended (but not required) that the following year you enroll in AP Physics II. A strong desire to learn and a serious time commitment are needed to succeed in AP Physics I.
AP Physics II is the equivalent of a second-semester algebra-based college physics course, but it is designed to be taught over a full academic high school year to enable AP students to develop deep understanding of the content. The course covers fluid mechanics, thermodynamics, electricity and magnetism, optics, atomic and nuclear physics. The combination of AP Physics I and AP Physics II is equivalent to a 2-semester introductory college physics course for students in life sciences, pre-medicine, as well as other non-science fields. A strong desire to learn and a serious time commitment are needed to succeed in all AP Physics II. University credit can be earned with a successful performance on the Advanced Placement exam.
The Physics C: Electricity and Magnetism course is a college-level physics course, especially appropriate for students planning to specialize or major in physical science or engineering. The course explores topics such as electrostatics; conductors, capacitors, and dielectrics; electric circuits; magnetic fields; and electromagnetism. Introductory differential and integral calculus is used throughout the course.
This is an advanced college-level course in physics. Students should have taken an introductory physics course. | 396 |
All too often a boiled egg or plain scrambled egg just doesn't quite cut it. My all time favourite breakfast on a weekend is Anda Bhurji spiced scrambled eggs piled on buttered toast. So satisfying. Most Indian regions have their unique way of cooking eggs with spices and the state of Andhra Pradesh is no different. This is a personal favourite and I think the combination of the heat from the chilli and sour tamarind make it quite moreish. Coconut milk is used sparingly to add the creaminess to the dish; the bland boiled eggs soak in all the flavours of the spices<|fim_middle|>. Add the mustard seeds letting them splutter for a few seconds. Add the onions and fry for 5-7 minutes on medium as they begin to turn light brown. Add the cinnamon stick and green chillies frying for a further minute. Tip in the chopped tomatoes and cook for 5 minutes stirring well ensuring it doesn't stick to the bottom of the pan. The tomatoes will soften and form a thick sauce.
Add the sliced ginger and fry for a further minute. Now add the powdered spices and stir for a minute. At this point the oil will start to leave the sides of the pan. Add the tamarind concentrate along with the water. Bring to a boil and simmer. At this stage add the coconut milk. Simmer gently and tip in the halved boiled eggs along with the curry leaves.
Let the eggs soak in the spices for 2-3 minutes. Stir gently making sure the eggs stay intact. Season to taste and garnish with coriander. Serve with soft dosas or plain rice.
Is 1 tspoon of tamarind concentration enough in the end?
Yes although check the quality of the paste and adjust as required.
Is the Tamarind concentrate the same as Tamarind puree?
Tamarind concentrate is a richer stronger flavour. So taste the quality of what you get before adding!
Paired this with the Aloo Dalna. Lovely contrast between the two curries. Very pleased. | in the gravy. You can leave the eggs whole if you prefer though I like to halve them. Added to the dish last minute letting them steep in the warm curry. Serve with rice, flat bread or dosas as I did. Soft dosas soak in all the flavour and help mop up the egg curry. Simply gorgeous!
Heat the oil in a heavy bottom sauce pan | 76 |
Friendship Circle Supports Children With Disabilities – Rolling Without Limits: Your mobility may be limited. Your voice, boundless.
If one friend can bring out the best in somebody, imagine how much could be accomplished if friends from around the world encouraged<|fim_middle|> their solidarity and raise funds for their cause. If you would like to find a local chapter of Friendship Circle, visit their website at Friendship Circle. | and supported one another? For many children and young adults living with disabilities, such a dream is a reality through Friendship Circle International.
Friendship Circle International's mission is to provide happiness and compassion to children with disabilities and young adults through the kindness of the organization's teen volunteers. Friendship Circle, through its more than 80 regional chapters, connects volunteers to children with special needs, to promote a sense of altruism, companionship, and confidence. The organization's mission is achieved by implementation of several programs.
Friends@Home: Each week, two trained volunteers provide home visits to children with special needs. During these one or two hour visits, the teen volunteers share stories, play games or enjoy music with the children.
Camp: Winter and summer camps are offered to families of children with special needs. The camps not only offer friendship and recreational activities for the children but also provide respite to families and caregivers.
Holiday Programs: The Holiday Programs engages families in the education of the Jewish heritage. It also provides an opportunity to connect to the community through such traditions.
Sports Night: Volunteers and coaches guide participants through a variety of sports activities.
Sibling Support Programs: Siblings of children with special needs also need support with their own lives, and the Sibling Support Programs provides a healthy outlet to socialize and learn the skills necessary to improve the challenges they may face.
Life Skills: Professionals work with volunteers to help acclimate children with special needs to the challenges of the outside world. One way this is achieved is by accompanying participants in public spaces, to help build confidence in attending to daily activities that will be part of their adult lives.
In addition to these programs, Friendship Circle participates in other activities that enrich the lives of those in their communities. "Walk4Friendship" allows friends, family, and volunteers to show | 363 |
Reviewing the song "Me and your Mama"
Picture credits: Glassnote
By: Noah Danielson, Writer
"Me and your Mama" written and produced by the 39 year old actor, comedian, and artist Donald Glover otherwise known as Childish Gambino is a song in Glover's third studio album," Awaken my Love". This album is Glover's take on Hip hop meets soul music meets r&b (rhythm and blues) music and this song is a great example of that. This song is Glover's attempt to show what falling in love feels like.
Donald Glover aka Childish Gambino
This song starts with a quiet but captivating melody. It has a sparkling galaxy-like melody with bells acting as the stars sparkling all around you. Glover also pairs it with a calm psychedelic, smooth, legato sound that makes it great for easy listening or meditation. It is layered with choir-like vocals that hit you with a marcato type of sound. In this part of the song the theme of love is calm,smooth and dream-like.
James Webb Space Telescope zoomed in on the galaxy
This all ends around the 2:00 minute mark when it suddenly explodes from its trance-like calmness, as you descend into madness. This part of the song is extremely intense and passionate. You hear the same marcato type of drum beat that hits you but this time it is layered with a distorted electric guitar and distorted vocals with the powerful fortissimo choir that screams, " LET ME INTO YOUR HEART". You also hear Glover's frantic cries begging his love interest to open up her heart and let him in. His first cry is him knowing it's over because he says, " You know that, I love you". But later he screams, " Ima get you girl!" Once again he cries, " This is the end of us". He contradicts himself this whole time and it's clear that Glover is in complete love with this person and struggling to decide on the next steps for their relationship As the song progresses you hear a new melody that lets you know that the storm is almost over with the vibrato of the sound waves becoming increasingly more apparent. Here, Gambino gets even more desperate saying, " Girl you really got a hold on me, so this isn't just puppy love."
After the storm, comes the calm and you distinctly hear the fortepiano here. The song finds itself back to its original state but with different instrumentation and a snare drum fading out slower and slower and quieter and quieter otherwise known as morendo.
Donald Glover is an extremely gifted individual and "Me and your Mama" is definitely evidence of that. I have listened to it a million times and<|fim_middle|> Aka
Noah Danielson, Writer
Hey Guys i'm Noah Danielson and i'm a caring, thoughtful person who thrives on making deep meaningful connections. I describe my own personality as laid... | it has never gotten old and I definitely think you should give it a listen.
Photo Credits: Ike | 20 |
In this Christmas special, which aired this year on Cartoon Network, Daffy Duck is the suit-and-tie-wearing owner and CEO of Lucky Duck, a huge super-store that is gearing<|fim_middle|> why all the other characters work for Daffy, and how did Daffy convince Marvin to wear that vest? Additionally, antics that are hilarious over the course of seven minutes grow thinner as more time passes.
Despite this, the writing on this show is reasonably sharp if not razor-sharp. There are a few funny lines, but most of the time I was more amused than hysterical. The show held my interest for those 46 minutes, but I was not left clamoring for more when it was done. However, the other thing to consider is whether or not this is simply a good Christmas special. Hm. Well, again it is likely not going to be ever considered a classic, but it is warm and fuzzy enough. I believed Daffy's transformation at the end, especially since we still could see a bit of the old Daffy peeking through.
This is mainly Daffy's story, so do not expect the many cameo-making characters to get much of the spotlight. Bugs and the ghosts get to do their thing, but most of the employees are just extras, or acting out of character. (Seeing Elmer and Marvin being subservient to Daffy is odd.) It was fun to pause the story in order to check out the cameos, but they added up to little more than cute stunts. That's fine, though; I liked the cameos for what they were.
One of my main issues with this special, though, is that Bugs Bunny has so little to do. He is in quite a bit of it, but his role is largely unnecessary. He simply seems to be there to tell Daffy what will happen… then it happens. This is particularly obvious when Bugs warns Daffy that he will be visited by ghosts, then Sylvester, playing the Jacob Marley role, does the same thing. What was the point of this redundancy? This continues the rest of the way through the story. I can understand that they had no suitable role for Bugs out of the Christmas Carol story— you couldn't have Bugs be a subordinate of Daffy's or a ghost, it just wouldn't work— but they needed to find a stronger role for him than they did.
The animation is primarily traditionally drawn, but there are some CGI elements. (The constant snow falling outside is digital, as is Daffy's vehicle that nearly runs over Bugs at the beginning of the show.) This is really a very professional-looking special, with very energetic, squashy-stretchy animation. No complaints in that department.
Old-time Looney Tunes who feel like the old days cannot be revisited will find this as overly modern as they expected, but those who simply enjoy seeing the characters in whatever they appear in can enjoy this tale, even if it is by now overly familiar.
If the idea of this movie has you sitting on the fence, the bonus features probably aren't going to convince to buy it.
The disc has Trailers that play before the Main Menu, including Dr. Seuss's How The Grinch Stole Christmas: 50th Birthday Deluxe Edition, the Teenage Mutant Ninja Turtles CGI movie, and Unaccompanied Minors. A pile more are available in the Special Features Menu.
Bah, Humduck!: The Lucky Duck Dilemma is a game where the player steers Daffy on his Segue, going around obstacles in the store. There are then eight Deleted Scenes (4:42) that are fully animated and colored, and offers some nice bits of extra material that continue to focus on Daffy. Lastly, we see a little of the band in action in God Rest Ye Merry Gentlemen By Gordon Goodwin And His Phat Band, basically a music video that is mainly clips from Bah, Humduck!, but also has a few snippets of the band playing.
The standard keepcase holds only the disc plus an insert advertising Bah, Humduck's soundtrack CD.
Usually the framing appears OK, but looking at this shot (this was not part of a pan at this instant), one has to wonder if a wider aspect ratio was not used in production.
Now this was a nice surprise. The soundtrack was done in full Dolby Digital 5.1. (What, no DTS?) Although the sound is mostly kept in front, there is plenty going on there, especially in regards to the music but also the sound effects.
The music by Gordon Goodwin And His Big Phat Band is peppy and fun. They give the show a jazzy, Christmas carol-filled sound that neither is a slave to the scoring style of the classic shorts, nor seems totally out of place either. Goodwin never shies away from making the music a star in its own right, but at the same time it supports the action well.
Long-time WB'er Andrea Romano is on board here as the casting director, and she brought along a number of the usual suspects. Billy West, who has done Bugs before in Space Jam and other venues, does the honors here as well. He's not quite Mel Blanc, but he does at least as good a job as anyone else has been able to manage since Blanc died. The same goes for Joe Alaskey as Daffy and the rest of the crew. June Foray returns as Granny, decades after she first voiced her.
There's nothing like classic Looney Tunes. Of course, that isn't what this is. This is, however, a retread of an already-familiar Christmas story. Fortunately, they wisely kept from making this too literal a telling, and generally kept things fresh. Not all of the characters are in character, but Daffy is certainly properly cast (at least in the "Chuck Jones" sense of the character). The decent writing and sharp animation, as well as the strong sound and video on the disc, keep it a notch above mediocre. With all the other versions of A Christmas Carol available, all the classic Looney Tunes cartoons to watch, and all the great Christmas specials one already has to choose from, this one seems a little superfluous. Nevertheless, if you watch it you will likely enjoy it. | up for its final day of Christmas sales. He is portrayed as being extremely selfish and cynical, which naturally made Daffy the obvious casting choice. Here, Daffy suffers no orphans looking for change outside his store, and neither does he tolerate whiny employees. Anything that impedes him from making a dollar is woefully obstructive to him. He jets around on a hovering Segue, doling out criticism and intimidation to all he sees.
His employees include many of the familiar Looney Tunes gang, such as familiar types like Elmer Fudd and Porky Pig, but also less recognizable characters like Pete Puma, Chuck Jones' Three Bears, and Hubie and Bertie. They all wear blue work vests, with Marvin The Martian looking particularly out of place. Daffy seems fond of none of his employees (coming perhaps closest with the red-haired monster in the tennis shows, which is his security guard), and he offers no compassion when Elmer complains of lack of rest, or when Marvin reports his homesickness. His assistant manager, Porky, also gets no kind words when he tells Daffy of his promise to get his daughter a nice gift, either. These are all simply distractions to Daffy, momentary annoyances that keep him from focusing on making as much profit as possible.
Of course, there is one customer who can get the best of Daffy. Bugs Bunny comes into the store and gives Daffy a rough time, gleefully turning Daffy's worst impulses against him as usual. Daffy wants Bugs tossed out of the store, while Bugs warns Daffy of what will happen if he does not begin to show more respect for the holiday. Bugs describes a series of ghosts that will come to visit Daffy, ghosts who will show him the true meaning of Christmas.
Unfortunately for him, Daffy is then visited by the next ghost, actually a pair— the Ghosts Of Christmas Past. Granny and Tweety bring Daffy back to his childhood at the orphanage, where he first became disillusioned and gave in to despair. Yosemite Sam is the next ghost, bringing Daffy to see present-day scenes such as Porky at home with his daughter, Priscilla. When Daffy returns, Bugs is still there to tell him of there being one more ghost, who turns out to be The Tasmanian Devil— as the Ghost Of Christmas Yet To Come. As you can likely guess, there is a graveyard scene that scares the poop out of Daffy, making him ready to head back to the present and begin making amends.
Nothing says "Christmas" quite like A Christmas Carol. Charles Dickens' perennial classic has been adapted many times for television and film, including humorous takes by Mr. Magoo, Mickey Mouse, the Muppets and even Rich Little. I have seen the story told so many times, in fact, that I really doubted that I would appreciate yet another one. Actually, when I first read about Bah, Humduck!, I rolled my eyes. I'm all for seeing more of Bugs and the gang if done well, but… A Christmas Carol… again?! Doesn't anyone want to do The Gift Of The Magi?
So that was my feeling going in. Plus, it would be hard for anything to top my favorite "funny" take on the story, A Muppet Christmas Carol, which I think is an underappreciated classic.
And now I have seen it. And what did I think? Well, I found this to be a fairly decent effort, but the characters will never truly work in longer forms like this, because we are so use to seeing them in shorts, in well-defined roles with clear personalities. Most of them are antagonistic to each other normally, so to have them working together in a story just doesn't quite fly. As the minutes drag on, we start to wonder just | 801 |
The Continuing Dance…
Are Scientists Playing God?
Awe, Wonder and Beauty in Science…
My Science, My Faith
Dr Ruth Bancewicz
By ocg_admin 13 January 17 10 April 17 23 March 2017
Ruth is a Senior Research Associate at The Faraday Institute for Science and Religion, working on the positive interaction between science and faith.
After studying Genetics at Aberdeen University, she completed a PhD at Edinburgh University, based at the MRC Human Genetics Unit. During this time she also worked at the Edinburgh Science Festival, developing and delivering hands-on science activities.
She spent two years as a part-time postdoctoral researcher at the Wellcome Trust Centre for Cell Biology, Edinburgh University, while also working as the Development Officer for Christians in Science – a post she held for three years, before moving full-time to the Faraday Institute to develop the "Test of FAITH"<|fim_middle|>regations project, funded by the Templeton Foundation
Course Directors: Prof John Bryant and Canon Anna Norman-Walker
© Exeter Cathedral | Privacy Policy | Site developed by Websites Ahoy! | resources, the first of which were launched in 2009. Ruth is a trustee of Christians in Science.
On Common Ground
Ruth participated in the conversation "Awe, Wonder and Beauty in Science – a route to God?" on 23 March.
Continue the conversation
Twitter: @SciAndBelief and see also @TheFaradayInst
Blog: Science and Belief
« Dr Morven Shearer
Dr Nick Higgs »
Dr Althea Wilkinson
Venue change, 16 March
Dr Cherryl Hunt
Prof Timothy Lenton
Join in on Twitter
Follow @ocgconversation Tweets by ocgconversation
On Common Ground events
On Common Ground resources
A Scientists in Cong | 150 |
Alan Jackson Promised to Cling On "The Old Rugged<|fim_middle|> are familiar with is that when Jesus was crucified in Calvary. And, that's what the hit "The Old Rugged Cross" is all about. I hope that we will not forget what He did for our salvation. And, we can repay Him in many ways like living in a Christian way, free from sin.
https://www.youtube.com/watch?v=-JS9P8d2iOc
Alan Jackson, Grand Ole Opry, The Old Rugged Cross
Who Are Johnny Cash's Children and Where Are They Now?
"Alan Jackson is the Blackest Name I Know," says Josh Pray
When Alan Jackson and George Strait Reproved Modern Country through "Murder on Music Row"
WATCH: Lorrie Morgan Performing Ex-Husband's Greatest Hit
Carrie Underwood and Randy Travis Team up to Sing "I Told You So"
"Tennessee Whiskey" Dad Kris Jones Makes Daughter Proud, Fluid Cover Goes Viral
Country Artists Who Once Asked the Question, "WHY ME LORD?" | Cross"
God is really a great wonder and an epitome of love. Anyhow, he sent His only begotten son Jesus on earth to save us. Also, He performed a lot of miracles and saved hundreds of souls. It's just sad that some people ridiculed and mocked Him. But maybe, they don't want to be saved, and they want to burn in the slums of hell. Jesus Christ had done a lot of things for us, especially when he was crucified on the cross. That alone showed the purity and strength of what love can do. Just like the hit "The Old Rugged Cross" as rendered by Alan Jackson. This is a perfect example of Christ's love and a perfect proof of how people adore His sacrifice in Calvary.
The Pride of Georgia
He is one of the great singers in country music, with a total of more than 80 million records sold. Further, this artist was able to push 35 songs in the number one spot in the U.S. Charts. Due to his success, he is a recipient of different awards and recognition. I hope that you did not forget Alan Jackson, who is also a member of the Grand Ole Opry, the longest running radio station in the U.S.
Photo Credits: Alan Jackson/Official Home Page
The Hymn that Adores the Sacrifice of Christ
We often show our adoration of Jesus' sacrifice in many ways. Moreover, a lot of composers create tons of masterpiece in adoration to Him. The greatest atonement that we | 316 |
Tag: Richard Barrett
Richard Barrett and others: binary systems (strange strings)
There are several reasons I'm excited by the release this week of binary systems by Richard Barrett and collaborators (available through Richard's Bandcamp page). First, the music sounds like it's going to be great; I'm listening to the opening track, Dysnomia, made with guitarist Daryl Buckley and it goes, just as you would expect, into all sorts of weird and inexplicable places. (The ending especially offers a new instance of the slow, melting drone style that I think is the most characteristic feature of Richard's work to have emerged in the last few years.) Second, though, it's evidence of a sort of pandemic creativity that I drew attention to a few days ago on Twitter: videos, studio work, solo compositions, unusual collaborations, self-performances and so on that may in time shift the centre of gravity of what a 'work' is – within the compositional field at least; it has long been a more complex concept in other fields – away from notated works for an ensemble on stage in front of an audience and towards a wider range of possibilities. Traditional concerts and new works written for them will return one day, but this emergent diversity is likely a good thing in the long run.
'A year without new works' is an obvious exaggeration, but the nature of musical creativity (which has not halted in the pandemic, in spite of all), might encourage us to reconsider our definitions of 'new' and 'work'.https://t.co/LBo7uOneR3
— Tim Rutherford-Johnson (@moderncomp) March 4, 2021
Dysnomia is just such a thing. Without in-person access to the international network of performers that usually energises his work, Barrett has encouraged a network of online collaborators instead, and a means of creating work with them that is not only musically rewarding in itself but takes his own practice into potentially fruitful new directions. For some time there has been something of the studio composer to Barrett's working methods: the way he layers texture-types, even whole bands of material, the management of transitions, the editing of modules to collage them together in larger polyworks (a part of his work since Negatives) and so on. With Dysnomia this is taken to a new level. Barrett has solicited solo improvisations by five musicians (a sixth, requested from John Russell, was not possible before the guitarist's death in January this year; the album is dedicated to him), and used these as raw material for the creation of fixed media works in a process of duo composition that sidesteps the various difficulties of face-to-face meeting and online live performance. In a way it is a reversal of what happens at the end of CONSTRUCTION, where improvisation takes place on the basis of composed materials (to the extent that improvisation and composition can be viewed as opposites anyway, which is partly the point). It's a method that recasts Barrett as something more of a DJ or producer than a composer in the usual sense, and challenges conventional notions of authorship, composition and 'the work'. All five musicians – Buckley, Lori Freedman, Ivana G<|fim_middle|>.
For now, that's all I can manage. CONSTRUCTION is available on the BBC's iPlayer until the end of the week. I suggest you have a listen.
By Tim Rutherford-Johnsonin Music 22 November 2011 22 November 2011 520 Words8 Comments | rahovac, Anne La Berge and Lê Quan Ninh – have worked with Barrett before, and this awareness of shared languages and forms gives coherence to the music, but the dislocated, distanced working method productively cracks that open too. Take a listen here:
By Tim Rutherford-Johnsonin Music, Sonic Distancing 10 March 2021 518 Words1 Comment
Rambler releases of 2020
In no particular order, some of my favourite releases of 2020.
Liza Lim: Extinction Events and Dawn Chorus (KAIROS)
An essential release of what will surely be one of the most important, powerful and original compositions of the decade. A transformative work in Lim's career, you can hear in real time the disintegration of her previous compositional voice and its metamorphic re-emergence from the rubble. Shoring fragments (Janáček, Chinese astrology, the songs of extinct birds) against her ruin, this is a musical Wasteland for the age of the climate crisis.
Moor Mother: Circuit City (Don Giovanni)
Bleak, angry, restorative, hopeful. Camae Ayewa was a howl of productivity against 2020's numerous oppressions. Circuit City, an album I listened to and excavated day after day in December, just pipped Offering, with Nicole Mitchell, released earlier in the lockdown.
Clara Iannotta: Earthing (WERGO)
One of a number of composers who have broken through into something much deeper and darker in the last few years (see also Tim McCormack and Iannotta's teacher Chaya Czernowin): there's a doom-core/drone metal vibe to Iannotta's second CD that one can hear permeating the music of several other composers at the moment. Few do it with Iannotta's lightness of touch, though.
Beatriz Ferryra: Echos+ (Room40)
I knew nothing of Beatriz Ferryra before this year, and I'm sure I'm not the only one. The trio of new works released as Huellas Entreveradas (Persistence of Sound) in May revealed an important and singular voice in contemporary electronic composition. But this collection of earlier pieces, released a couple of months before, was the real knockout, epitomised by the previously unreleased title piece from 1978, a ghostly collage created from the voice of her late niece.
Anna Höstman: Harbour (Redshift)
Released in early January, Anna Höstman's album of piano solos, played by Cheryl Duvall, is a capsule from an entirely other era. We shouldn't forget that other life, though, and Harbour is a reminder of a more careless, casually meandering, simply beautiful time. Brief review here.
Linda Catlin Smith: Meadow (Louth CMS)
Any new recording of Linda Catlin Smith's music is to be welcomed, but this issue of Meadow, released by Louth Contemporary Music Society near the very end of the year (launch event on 11 December here) feels very special. A 30-minute string trio, Meadow scrapes a little deeper into the influences of early music that frequently run beneath the surface of Smith's music: like a Dufay motet it conveys an atmosphere of melody and polyphony without constraint, but also of contemplation and extraordinary warmth. If Höstman caught the end of the pre-pandemic world, maybe her Canadian contemporary points to a future after it.
Sarah Hennies: The Reinvention of Romance (Astral Spirits)
2020 feels like it was the breakthrough year for composer and percussionist Sarah Hennies. Last September's Reservoir 1 made many end-of-2019 lists, but this year that position has been built upon and, remarkably, expanded with two releases: Spectral Malsconcities and The Reinvention of Romance. Both records are examples of a stark yet organic minimalism, characterised by patience, sensitivity and unsettling tension. The latter just pips it though for its capturing of love in the time of Covid – a negotiation of shared spaces, intimacies and solitudes.
Daniel Lentz and Ian William Craig: In a Word (RVNG Intl.)
When I was invited to contribute marketing notes to this album I knew nothing of Ian William Craig's haunted combination of classically trained voice and crippled technologies, but I was quickly sold on his music's haunted nostalgia. In combination with Daniel Lentz's expansive piano minimalism, In a Word (the sixteenth in RVNG's FRKWYS series of intergenerational collaborations) conjures something between the disintegrating texture of William Basinski and the yearning ghost of Schubert song. Wonderful.
Milana Zarić and Richard Barrett: Mirage (Strange Strings)
Typically for him, Richard Barrett has taken the circumstances of the pandemic and lockdown as a prompt to reexamine the fundamentals of his practice. In 2003, following the invasion of Iraq, he began a reassessment of his work in view of what responsible artists should do in the face of war and parliamentary deceit – a process that began with the orchestral work NO and culminated (although did not end) with 2012's CONSTRUCTION. In 2020 he has sought ways in which to turn enforced isolation to his advantage – no small challenge for a composer whose work is so enmeshed with performance and collaboration. One outcome has been a turn to electronic composition, documented on strange lines and distances; another is the development of the duo with his partner, harpist Milana Zarić, begun with Barrett's 2013 work for harp and electronics tendril, but taking on a new significance with the curtailment of all other shared performance opportunities in 2020. nocturnes was one of my compositional highlights of last year, and the new pieces mirage, restless horizon and sphinx highlight still further Barrett's refusal to constrain his imagination.
Angharad Davies/Tim Parkinson: The Quarantine Concerts (Experimental Sound Studio/YouTube)
The March lockdown represented a fundamental challenge to every musician on the planet. Many are still finding it hard to produce work under pandemic conditions. One composer who came fast out of the gates, even found the constrictions a spur to creativity, was Tim Parkinson. Parkinson's 2020 album Here Comes a Monster (Takuroko) was released in May 2020, and somehow already incorporated compositional responses to quarantine. But this even earlier performance, from the first month of Experimental Sound Studio's (still-running) Quarantine Concerts series stuck with me (at a time when I, for one, still found it hard to engage with new music) for its whimsical reinvention of Parkinson's opera Time with People, played by him and Angharad Davies using Playmobil toy figures. For more like that, see also the split-screen performance with James Saunders, 24 Preludes.
Bastard Assignments: Lockdown Jams (Bastard Assignments/YouTube)
Trust BA to make 2020 even weirder and more unsettling. The Lockdown Jams emerged from short studies in making experimental music theater over Zoom and Google Hangouts, but quickly grew into a series of commissioned works by (among others) Marcela Lucatelli, Neil Luck, Alexander Schubert, Elaine Mitchener and Tommaso Petrolo, and Jennifer Walshe. As the series has gone on, the Lockdown Jams have taken an increasingly classical approach to Zoom/isolation aesthetics (see Walshe's zusammen iii, and Thick and Tight's wonderful Woking), but the early instantiations capture like nothing else the unravelling, baffling, inexpertly improvisational mess that was spring 2020. Read my review here.
By Tim Rutherford-Johnsonin Reviews 8 December 2020 1,092 Words3 Comments
Sounds Outside
I've been finding that as I've been isolating, sounds have started to take on heightened meanings. A cough in the street, a cry from a neighbouring house, an ambulance siren: in the first week sounds like these became especially poignant, even harrowing, the sounds of a world in pain, fractured into remote, isolated bits.
Yet two kinds of sound have done more, for me, to dispel that sense than any number of Zoom meetings, phone calls or YouTube workouts. One can be heard at the front of my house, the other at the back.
The one at the back is particularly apparent at the weekends. It is the sound of Victorian terrace gardens in the sun. But as though one has time-travelled back to, say, the 1950s, a time when ambient mechanical noise is all but gone: no planes, few trains, hardly any cars. A time when the soundscape is almost entirely organic: produced by insects, birds, people and air. I made this recording on my phone on Sunday afternoon:
This sound is a living palimpsest, every species occupying its own sonic biome, a phenomenon that can be heard in much greater complexity in a rainforest, and that was introduced to me by the 'Arboreal' movement in Richard Barrett's Life-form for cello and electronics. Without the broad-spectrum filters of trains and traffic hum, every layer of that soundscape can be heard clearly once more. As with the air, particulates and pollution are dropping away. Sound and breath both arrive in higher fidelity. This week, British seismologists have noticed that the 'cultural noise' of the earth has started to quieten too. As the 'anthropogenic din' of vehicles and machines subdues, they say, their equipment will be better able to detect small tremors throughout the UK and further afield. Even as we draw ourselves inward, it seems, we become more widely connected.
The birdlife seems more active than ever too – a product of the time of year – every bird marking its territory, calling for a mate or just shooting the avian breeze. And every person is at home, rather than making costly excursions in the hope of running down another Sunday afternoon. The sonic imprint of every family can be heard: the young children banging pans two doors down, our elderly neighbours making lunch, the dogs, the teenagers, the DIYers, the gardeners and the chatterers, all of us sounding and being heard.
If that's all a bit R. Murray Schafer-esque nostalgic, I wonder what he would have made of the second sound, the one at the front of the house, the one that happens every Thursday at 8pm. #clapforourcarers has quickly become a national ritual of solidarity, gratitude and emotional release. For several minutes, everyone opens their front doors and claps, whistles, cheers, rings bells, bangs saucepans, makes all kinds of noise (this week someone on our street was blowing a horn of some kind) in recognition of the extraordinary work of NHS staff at this time. I've never experienced anything like it: a pure prayer, sent out loud into the air. The relief it produces is immense: for me, staying strictly indoors, it is the only moment in the week when I really feel part of something bigger than my immediate family. To stand outside my front door and see the faces of my neighbours left and right is very treasured. Even more is to hear the glorious noise of grief and longing, celebration and defiance.
By Tim Rutherford-Johnsonin Music 10 April 2020 11 April 2020 585 Words3 Comments
Playlists for the Long Distancing 3
We're going to be indoors for a long time now. In case it helps ease the pressure, I'm revisiting my back catalogue of new music playlists and posting things here every weekend. Some of these lists regular readers will have seen before; some of them will be new collections. (Or at least ones I've had knocking around privately for a while.)
For this weekend's listening, I've collected together the (small but growing) number of composer-chronology playlists I have been compiling over the last six months or so. So far each of these has been created in response to a piece of writing on my desk related to that composer, but I have a couple more partly ready that don't relate to anything much yet; I'll add them to this post in due course.
George Benjamin
Oliver Knussen
Original post here. This list now includes Axis Mundi for bassoon, and the extraordinary Extinction Events and Dawn Chorus, from this newly released and essential CD.
Luigi Nono
Original post here.
I've also added a new playlist to this collection, for Krzysztof Penderecki, who died last weekend. Judge for yourselves the degree to which his later (post-1977) style was prefigured in his earlier works, or not. It's a chance, too, to listen to some of his overlooked very late works, which exhibit a simplicity and clarity rarely encountered in his earlier music. Missing from the list – because recordings aren't available – are the operas, the early electronic works and a handful of occasional pieces. I haven't bothered to include many of the arrangements that Penderecki made of his own music.
By Tim Rutherford-Johnsonin Music, Radio Rambler, Sonic Distancing 4 April 2020 3 April 2020 347 Words1 Comment
By Tim Rutherford-Johnsonin CD, Music, Reviews 10 December 2019 11 December 2019 746 Words2 Comments
Music after the Fall mixtape for The Lake Radio
A fun outcome of my visit to the Borealis Festival last month was an invitation from Jan Stricker of The Lake Radio to produce a new music mixtape for their podcast.
The original brief was that it would accompany an interview with Simon Steen-Andersen and Louise Alenius, so I made sure to include a track by each in there. As for the remaining artists, it's sort of a Music after the Fall who's who.
It has been a while since I did anything like this, and while the final result is nowhere near as densely layered as those old Blogariddims mixes, I still had a blast making it. The whole thing was put together in Audacity, texture/mood matching things along the way. Here's a tracklist with timings:
0:00 Laurence Crane: 20th Century Music. Michael Finnissy, pf (Métier)
2:37 Liza Lim: Tongue of the Invisible. Musikfabrik, Omar Ebrahim, Uri Caine, André de Ridder (Wergo)
8:25 Pamela Z: Pop Titles "You". (Starkland)
11:33 Chaya Czernowin: Sahaf. Ensemble Nikel (Wergo)
14:21 Simon Steen-Andersen: On and Off and To and Fro. asamisimasa (Dacapo)
18:20 Michael Finnissy: The History of Photography in Sound: I. Le demon de l'analogie. Ian Pace, pf (Métier)
24:26 Peter Garland: Another Sunrise (Mode)
27:57 Peter Ablinger: Morton Feldman, from Voices and Piano (Kairos)
29:21 Louise Alenius: Doctor Treves, from Elephant Man (Louis Alenius)
30:50 Sr. Anselme O'Ceallaigh (Jennifer Walshe): Virtue IV (Migro)
35:46 Richard Barrett: Transmission VI, from DARK MATTER. Daryl Buckley, gui (NMC)
By Tim Rutherford-Johnsonin Music 17 April 2018 244 WordsLeave a comment
Some recent CDs
Self Portrait by Brooklyn composer and multimedia artist Grant Cutler (innova 961) is composed of artists improvising to recordings of themselves, the results heavy with loops, delays and textures. innova's press release dresses this up as 'an act of memoir, an active reimagining of the self'. I think that's stretching a point: if that's what these tracks are, they're cosy, untroubled imaginings that rarely stray far from their original path. (Not what I see in my mirror, certainly.) Nevertheless, set that aside and Cutler and his musicians have made an attractive, not always predictable work of instrumental/electronic ambiance. Requires a sweet tooth, but I have one.
If you like this, you might also like Listening Beam Five by Crystal Mooncone (Stephen Rush, Chris Peck and Jon Moniaci; innova 973). More of a 60s, West Coast psychedelia vibe here, although washed out, exhausted, like the fade-outs to a Bitches Brew session at full scale. The instrumentarium includes Phase Maracas, Foil-o-tron, Distant Echo Flute, Float Tank Rhodes and Cistern Singing, so that should give some idea (or not).
Manfred Werder's 2003/1–3 arrive on a triple-disc set from Edition Wandelweiser Records (EWR 1601-03). 70 minutes per disc, two (performed) sounds per disc. (I emphasise performed: these seem to be studio recordings, so the huge silences in between aren't completely silent; they're live, not digital.) It's a colossal, utopian extravagance, of the sort I'd rather started to miss from EWR. There is undoubtedly something ridiculous about firing up the CD player for more than hour of almost nothing (in three different versions, no less), but at the same time, there's nothing else quite like doing so. Which is one underlying message of Werder's work, at least: that experience trumps thought. I doubt I'll be returning to these discs very often, but I'm absolutely certain that I will, so unique is that feeling – not something one can always say.
Eva-Maria Houben's livres d'heures, a two-disc set this time from EWR (1607/08), goes into the less abstract territory that I feel has characterised many Wandelweiser recordings of the last year or two. In particular, it foregrounds the Christian/spiritual dimension that appears to underlie the aesthetic of several Wandelweiser composers. A book of hours is an obvious choice for a style preoccupied with periodicity and the articulation of very large spans of time – see Werder, above. The difference in his case is that the periodicity is intuitive and unpredictable: thus it holds its time in a state of heightened tension; whereas Houben's meticulously steady bell chimes and violin drones mark out a structured, and hence contemplative time. It reminds me of other large-scale religious settings, most notably Knaifel's Agnus Dei, or even (although its language is much less bombastic) Radulescu's Cinerum.
Pick of the listening at the moment, though, is EXAUDI's recording of Mala punica composed by their director James Weeks (Winter & Winter 910 239-2). I've said this a few times recently about other composers' works, and I find myself saying it again, but this may be the best thing I've heard from Weeks so far. Making use of the little canonic and fan-like games that populate a lot of his music, Mala punica – interleaved on this recording with the three-part Walled Garden for instrumental ensemble – is a stunningly subtle, disarmingly simple achievement; a crystallisation of basic ideas down to the point that they transform into something else entirely. Combining the metaphor of the hortus conclusus with a setting of Song of Songs, Weeks's piece models an exquisite tension between chaste procedure and order, and over-tumbling sensuality.
Further to these short pocket reviews, I've recently written a much longer consideration of Richard Barrett's album Music for cello and electronics, with Arne Deforce and recorded for aeon. You can read that here at Music & Literature.
By Tim Rutherford-Johnsonin CD, Music, Reviews 2 May 2017 2 May 2017 625 Words1 Comment
Against the day: A concert for Simon Howard
Last week I attended a concert for the poet Simon Howard, who died in December 2013. It was not really a memorial as such – no eulogies or anything like that. More, it was an opportunity to gather Simon's friends and many admirers to listen to a cross section of the music he inspired and that had inspired him, and to place on the record the small but intense influence Simon and his poetry have had on a little segment of the Anglo-American new music scene over the last few years.
So there were two pieces by Richard Barrett, lost for piano (the title of whose version with electronics, adrift, Simon borrowed for one of his own chapbooks) and tendril for harp and electronics. Barrett is a composer Simon always felt close too; he also loved the music of the Baroque, and there were pieces here too by Bach and Biber, sensitively chosen by the concert's organiser, John Fallas.
John, I suppose, is one of few people who can claim to have known Simon, who was a severe recluse, at all well (I'm not one of them). He did an exemplary job putting the programme together, not only in terms of the music and the composers it contained, but also the performers (Pavlos Antoniadis, Milana Zarić, Carla Rees, Emily Howard, Persephone Gibbs), and wrote a beautiful programme essay to boot. Everything fit, and was fitting. Simon's poetry as musical text was represented by Philip Venables' numbers 91–95, a setting of part of Howard's long poem numbers (2010). Almost all the other composers on the programme had known Simon, like I had, through his presence on Radio 3 webforums and later Facebook. John Hails and Philipp Blume contributed new pieces – enlightenment for harp and recording, and Departures for four-channel sound, respectively – both connected to Simon's poetry and poetic enthusiasms: enlightenment is the title of the last poem he posted to his blog. Evan Johnson, Andrew Noble and Alistair Zaldua were present in the form of pieces for piano (with electronics in the case of Zaldua's contrejours). The concert began with Utopians, an electronic piece constructed by Barbara Woof and Michèl Koenders from voice recordings by Howard and Jane Harrison. It was remarkable to hear, in this way, on this occasion, Simon's voice for the first time.
I'm not writing a review here, so I shan't. But aside from its biographical meaning this concert was extraordinary for the quality of the music; I honestly don't think there was a weak piece in the programme (and how often can you say that?). Several of them were very very good indeed. In showing Simon at the centre of a small but fiercely fruitful network of musicians this concert's sadness was also its gift. And now that network has lost its heart.
Many of Simon Howard's poems can be read at his blog, walking in the ceiling; his published works include Zooaxeimplode (Arthur Shilling Press), numbers (Knives Forks and Spoons), adrift and Forgotten (Red Ceilings Press), and Wrecked (Oystercatcher Press). [update: list corrected]
By Tim Rutherford-Johnsonin Music 31 March 2015 17 December 2018 504 Words2 Comments
ELISION in Huddersfield – review
Just over a week ago in Huddersfield ELISION presented a concert of four works by postgraduate composers Alex Jang, Pedro Alvarez, Matthew Sergeant and Luke Paulding, followed by a realisation of Richard Barrett's CODEX IV for four improvising musicians.
These being student works, there were naturally areas where more experience and development in the future will count. But more importantly, I heard four distinct voices, each attempting a tricky artistic problem, and each coming up with a musically intriguing result.
Jang's Retracings, for trumpet and percussion, was instrumentally and formally the lightest of the pieces; it had a much lower density of activity, at times stripping down to just the sizzle of a cymbal or rumble of a bass drum. It was also, I think, less concerned with weight and presence, and more a sort of spectral afterglow.
At several points one felt a distinct sense of dissipation, but the music was so low-key that there was rarely a sense of where we might have dissipated from. It is a piece possessed of strange and unidentifiable energies. Yet it somehow made a shape for itself. Although fragmentary in style, Jang's use of a controlled timbral palette (dominated by sizzling or brushing sounds) prevented it from becoming too discontinuous.
The balance of activity between the two players is interesting. The music is dominated by the percussion, with the trumpet playing a very aphoristic role, certainly not acting as a melodic voice in its own right. It's less of a duo than a solo + 1. Alex told me afterwards that he intended the trumpet as an extension of the metallic percussion instruments – its music came from the timbre and gestural language of percussion, rather than brass. And again, the choice of a sonic palette is a dominant feature.
Alvarez's Debris was the least 'ELISION-y' of the four pieces, in that it didn't emphasise virtuosity, and set its formal argument on the macro- rather than micro-level. It is arranged in sharply defined panels, which are continually shuffled and varied as the piece progresses. The composer's notes refer to 'negat[ing] aesthetic ideals of fluency and continuity', and the idea of gate-switching between different gestural states is important. In addition to a small set of restricted (and related) instrumental textures, two further elements were in play: an electronic patch that was a sort of mellowed aggregrate of the previous instrumental sound, and very short bursts of noisy, saturated improvisation.
In an unexpected way it owed a debt to minimalism, or post-minimalism, like a Michael Gordon without half an eye on its audience. Certainly Alvarez is tackling the themes of continuity, rupture, form, duration and so on familiar from minimalism, but doing so with less easily assimilated materials so as not to let the work slip into a new agey/Arcadian mode. I liked it more than I thought I would, if I'm honest. On stage its longeurs are forgotten, and its subtle shifts in rhythm and texture are well-judged to maintain a sense of inquisitive experiment. I wasn't convinced by the improvised interjections/punctuations, but they require such a vertiginous change in playing that I appreciate they may be hard to bring off successfully.
There's a very obvious temptation for a young composer invited to write for a group like ELISION to forget any considerations of technique or practicality, and just let your ideas run to their limit. Matthew Sergeant cannot be accused of not taking this opportunity.
yimrehanne krestos is a trio for flugelhorn, alto trombone and percussion. It's about 11 minutes long but it is played at a ferocious speed and, for the two brass players, completely without a break. In truth, it stepped beyond the boundary of the possible. In one passage percussion notes are flying past at a rate of about 10 per second. With grace notes in between. The writing for flugelhorn and trombone (!) hits similar speeds at times.
That's what the score says, anyway. In practice ELISION brought the tempo down a notch, although not that you could tell from the dementedly fast sticks that Peter Neville brought out on the night. Most astonishingly it wasn't just a blur, but playing that retained its contours of rhythm and timbre. Similarly, how Tristram Williams and Ben Marks coped without so much as a quaver's rest between them I will never know.
But this piece is more than a speed-fuelled thrash. Yimrehanne Krestos is the name of an Ethiopian negus, and a church supposedly constructed by him deep inside a volcanic cave. From what I know it sounds an extraordinary, uncanny and bizarre place. The church is constructed of wood, and behind it lie the mummified bodies of some 10,000 pilgrims and workmen. At the front of the cave is a spring that supposedly has healing properties.
You can get a sense of the place from this video:
Having all this in mind (although I was lucky to be pre-informed – there were no programme notes), I parsed the work as a brass/percussion duo, in which the two brass enacted or suggested a complex of ghostly presences, fear, precariousness, mortality, presence. There's an obvious apocalypse/trumpets route through there, but aspects of the sinuous counterpoint, rhythm and over-abundance of material made it richer than that. The percussion meanwhile was arranged in three clear sections: scrubbing brushes on bongo skins; tom-toms, bongos and congas played with Thai sticks (the passage mentioned above); and vibraphone (motor off, very hard sticks). One could hear this as a journey – outside/inside? arid/liquid? towards clarity? revelation? That's a thematically appropriate but very literal reading; actually the shifts in the brass/percussion balance that take place throughout the piece complicate this picture.
There was an interesting continuity between Sergeant's piece and Paulding's where dust is in their mouths and clay is their food, in which similar instrumentation is brought to bear on another perspective on the afterlife. Again the brass appeared as the conduit to another world, but with the Messianic clangour of yimrehanne krestos replaced by something more ungraspable, internal, fearful.
I've already introduced the piece, but on the night it wasn't without its surprises. Most unexpected was the rice which, having been poured into a collection of shallow trays and bowls, is struck like conventional percussion, causing clouds of grain to fly into the air, a beautiful and intentional visual effect. The overall soundworld was also much more fragile than its score suggests, a realm of apparitions of sound from all three players.
The concert ended with Barrett's CODEX IV, a guided improvisation in which the four players made maximal use of the sounds, mutes and percussion instruments already on stage to close the concert with a network of incidental sonic connections.
And then it was time to sweep the rice.
By Tim Rutherford-Johnsonin Concerts, Music, Reviews 18 February 2013 1,145 Words1 Comment
Divers instruments of music likewise to you unknown
I wasn't there last Saturday, in Huddersfield Town Hall at the dead of night. So I can only write a compromised response to a partial experience. Richard Barrett's music is so inherently physical in the way it is conceived and arranged – disposed and composed – that anything not in the flesh is almost not there at all.
Well, I exaggerate, but listening to CONSTRUCTION via Radio 3's online broadcast falls even shorter than usual of the complete picture. CONSTRUCTION is a work so detailed in its working-out, so expansive and spatial in its design, that a stereo stream (even in HD) will always be found wanting.
But here goes.
More than two hours in length, CONSTRUCTION has occupied Barrett for at least six years. Its programme note advertises it in 20 separate parts, but its shape is more complicated than a simple list. Wounds I–V, for example are as much the five movements of a miniature violin concerto as they are separate pieces (although most (?all) have already been performed as such). All of the 20 'movements' of CONSTRUCTION belong to one of four such cycles running throughout the work. And CONSTRUCTION itself, of course, belongs to the much larger cycle of compositions Resistance and Vision.
Another of those CONSTRUCTION movements, heliocentric, is itself a tessellation of several smaller Barrett works to have emerged in recent years. These include the clarinet duo Hypnerotomachia, the flugelhorn and trombone duo Aurora, and the flute and recorder duo Città del sole (now renamed Adocentyn).
Any one of these duos is therefore a work within a work within a cycle within a work within a cycle. As CONSTRUCTION unfolds in real time, the upper and lower boundaries of that ecosystem – the little duo and the overall cycle – are invisible. We are somewhere in the middle, a chosen screenshot within an animated fractal dive. Extending the ecosystem metaphor, perhaps somewhere on the level of organisms or communities.
This sounds like an impossibly complicated design, its execution over nearly 150 minutes a utopian folly. And it's probably meant to come across that way – utopias, and their relationship to the poorer reality in which we live, is the work's underlying subject. However, because it is a work of art, it is able to put its own idealism into action, to send it out into the world and let it concretise into an existence of its own.
There's more here than it is possible to write about. (Perhaps that's why, as I write myself on Tuesday evening, I can find no other reviews from press or blogs.)
Some favourite things: the sudden emergence of familiar elements from Aurora or Wound II; the rotating solar system, ordered and chaotic, of heliocentric; the blend of electronics and acoustic instruments; the devastating control of one colossal span of time; the staggering instrumental colour.
Some things that either surprised me or still need processing: the children's playground recording; the final 'resolution' of the work's own utopian goals into improvisation | 7,186 |
Lydia Ko Attempts ANA Repeat Title
On the Right Course
Lydia Ko never really played well at the ANA Inspiration until last year when she found her stride to win. Now she believes the Mission Hills course matches well with her strengths.
JUDD SPICER March 27, 2017 Golf
Can Lydia Ko swing her way to becoming the ANA's first back-to-back champion since Annika Sorenstam in 2001-02?
PHOTO COURTESY OF ANA INSPIRATION
At the tender age of 19, Lydia Ko, the top-ranked player in the world, already has 14 LPGA titles (and five Euro wins) to her credit.
Standing foremost among them: Ko's victory leap into "Poppie's Pond" at the 2016 ANA Inspiration. She is back and ready to attempt to become the event's first repeat champion since Annika Sorenstam in 2001-02. The ANA Inspiration tees off March 27 and runs through April 2 at Mission<|fim_middle|> if you do miss a fairway you may just have an 'OK' lie. And when you look at the past winners it's not all about the straight hitters; there have been some that long, some that are shorter, so I think it's the person that plays smart and within their game is always so important. It's not 'One Game Fits All.'"
Since a much-publicized club change to the burgeoning PXG brand, Ko wasn't discouraged about charting zero wins (and no top-5 finishes) in her first four events of 2017.
"I feel like I've gained a little distance with my driver, and that not because it's what everybody says now," Ko says. "I really do feel like I've gained that distance. And I've never really been a high-ball hitter, so it's been good to see the irons go a little higher, which means they're a little bit more controllable, especially down-wind."
Even at 19, Ko believes she is no longer one of the new kids on the LPGA block.
"I feel like I've aged; this is my fourth year on tour and it goes by really fast," she says. "My first couple of years on the LPGA Tour, I was always the youngest on tour and, starting last year, there are girls now younger and similar to my age, so I feel a lot older."
Experience has taught her how fleeting her time as a tour player is.
"A lot of people I've talked to, even athletes outside of golf, have told me that the most important thing is to, 'Embrace every moment,'" Ko says. "And I think that's so true. Sometimes, it's not going to be a path of flowers, where everything is exactly the way you want it to be; there will be little dips along the way. But I think the learning experiences from those are even bigger than the successes or wins at the end of the week."
ANA Inspiration, March 27 through April 2, www.anainspiration.com | Hills Country Club in Rancho Mirage.
The Dinah Shore Tournament Course at Mission Hills is known for rewarding experience, and the polite, personable, and mature Ko is well-aware that her major championship win in Rancho Mirage was preceded by nary a top-20 finish in her three previous tries at the ANA.
VIDEO: Lydia Ko speaks about what she learned from her previous experiences playing at Mission Hills Country Club.
"It's a very strategic golf course," Ko says. "It's about positioning, and the fairways aren't super-wide. And depending on the years, the rough can play longer, and that makes a huge difference because | 131 |
Book your place at the next fully-funded Manufacturing Champions Network event - connecting leaders from small and medium enterprises with the Champions of the manufacturing and engineering sectors.
During the session you'll hear from Environmental Business experts who will talk about resource productivity and consider the financial and environmental savings can be gained by applying changes to the manufacturing process.
Resource productivity does not focus on 'end of pipe' solutions such as abatement and recycling because the later in the production cycle a waste is produced, the more costs it has accrued in terms of raw materials, labour, energy and production time. As such, by reducing or eliminating waste in the process, manufacturing companies can save on all the costs that went into manufacturing the waste, rather than just saving on the landfill and effluent costs involved in handling wastes.
The Manufacturing Champions will talk about their<|fim_middle|> and delegates will then then work in groups to work through a problem together.
The session will close with a tour of the Crystal Doors facility in Rochdale, which will demonstrate some of the topics discussed during the event.
Places at this event are extremely limited, and are restricted to one delegate per company. Non-manufacturers will not be permitted to attend. | experiences of managing this within their businesses | 7 |
The Billy T James Collection
Billy Taitoko James is a Kiwi entertainment legend. His iconic 'bro' giggle was infectious and his gags universally beloved. This collection celebrates his screen legacy, life and inimitable brand of comedy: from the skits (Te News, Turangi Vice), to the show-stealing cameos (The Tainuia Kid), and the stories behind the yellow towel and black singlet.
In a Land of Plenty
Film, 2002 (Full Length)
The tagline runs: "The story of unemployment in New Zealand" and In A Land of Plenty is an exploration of just that; it takes as its starting point the consensus from The Depression onwards that Godzone economic policy should focus on achieving full employment, and explores how this was radically shifted by the 1984 Labour government. Director Alister Barry's perspective is clear, as he trains a humanist lens on 'Rogernomics' to argue for the policy's negative effects on society, "as a new poverty-stricken underclass developed".
Reluctant Revolutionary
Television, 2004 (Full Length)
Reluctant Revolutionary mines a wealth of then new interviews to trace David Lange's rise from pudgy doctor's son to lawyer, to Prime Minister leading the country through radical change. Along the way, writer/director Tom Scott asks how a man as gifted as Lange allowed his government to collapse around him after only five years in office. The film includes rare input from National leader Jim McLay (who praises Lange's wit at university), Rogernomics architect Roger Douglas, and the first television interview with Lange's second wife Margaret Pope.
Revolution - 3, The Great Divide
Four-part series Revolution examined sweeping changes in New Zealand society that began in the 1980s. This third episode looks at the lurch of the Kiwi stock market from boom to bust in 1987, and the growing philosophical divide between the "head boys": PM David Lange and finance minister Roger 'Rogernomics' Douglas. Within two months of the October 1987 stock market crash, $21 billion was lost from the value of NZ shares. Lange and Douglas give accounts of how their differing views on steering the NZ economy eventually resulted in both their resign<|fim_middle|> a wider agenda that sought to remake New Zealand as a model free market state. The trickle-down 'Rogernomics' rhetoric warned of no gain without pain, and here the theory is counterpointed by the social effects (redundant workers, Post Office closures). Made by Alister Barry in 1996 when the effects were raw, the film draws extensively on archive footage and interviews with key "witnesses to history".
Frontline - Five Days in July
Ten years on from the tumultuous 1984 General Election, this award-winning TVNZ current affairs doco examines the financial and constitutional crisis that resulted from Robert Muldoon's initial refusal to yield power. Reporter Richard Harman, who conducted pivotal interviews at the time, talks to key players to piece together the events of five remarkable days. They also saw the opening salvoes between David Lange and US Secretary of State George Shultz over nuclear ship visits, and foreshadowed Roger Douglas' controversial remaking of the NZ economy.
Revolution - 4, The New Country
Four-part series Revolution examined radical changes in New Zealand society in the 1980s and 1990s. This final episode sums things up, after examining "the second wave" of neoliberal reform when National took power in 1990, shortly after Telecom was sold to American interests. Incoming finance minister Ruth "mother of all budgets" Richardson oversaw a reduction of welfare payments, a shake-up of the health system, and a curbing of union powers. Richardson: "in a human sense I understood that [community outrage], but that wasn't going to deflect me".
Four-part series Revolution mapped sweeping social and economic change in New Zealand society in the 1980s and early 1990s. Described as a "journalist's assembly" by its makers, it collected together interviews with the major players and archive footage. Producer Marcia Russell: "We wanted to make Revolution because we believed that unless we re-run and re-examine our recent history we are in constant danger of forgetting, and forgetting can render us passive about the present and slaves of the future." It won Best Factual Series at the 1997 Film and TV Awards.
Sale of a Nation
As part of the radical 80s neoliberal reform of the public and corporate sector in New Zealand, many government-run assets were turned into state owned enterprises; some were sold off to foreign buyers. Screening on TV3, this 1991 film, written by Metro columnist Bruce Jesson, examines the controversial programme by asking "who owns this country and who controls it?". Those answering range from businesspeople to politicians, academics, journalists, vox pops and critics of the 'cashing-in', from the Hamilton Jet family to UK environmentalist Teddy Goldsmith.
Revolution - 2, The Grand Illusion
Award-winning series Revolution examined sweeping changes in 1980s New Zealand society. This second episode argues that in its first term in office, the Labour Government promoted neoliberal reform via illusory ideas of consensus and fairness, while PM David Lange mined goodwill from its indie anti-nuclear policy (famously in an Oxford Union debate, see third clip). The interviews include key figures in politics, the public service and business: an age of easy lending and yuppie excess is recalled, while those in rural areas recount the downside of job losses. | ations.
Someone Else's Country
Someone Else's Country looks critically at the radical economic changes implemented by the 1984 Labour Government - where privatisation of state assets was part of | 38 |
We were delighted to be nominated by Sovereign Healthcare Charitable Trust for their inaugural Good All Round Awards. Fourteen local charities were shortlisted, which they considered to be well-managed, do great work and represent the variety of voluntary action supported by the trust.
We were delighted to receive a Gold IMPACT Champions Award in 2012, as really valuable recognition of the impact we had made in improving health in our community since winning the original award.
The Champions Award was open to organisations who had been shortlisted for an IMPACT Award between 2000 and 2009. We were chosen as one of three Gold award winners from over 100 organisations.
This was really BIG news for HALE as we only had 12 months to demonstrate our impact, whereas other charities in the running had up to 10<|fim_middle|>Having identified a health need amongst older service users who attended luncheon clubs, we piloted a programme which was cost effective, engaged older people in cooking and ensured that the food's goodness was maintained during cooking and before eating.
The success of this pilot, and winning the award meant that HALE was able to employ a Nutrition Worker to roll out a programme of nutrition advice and support for older people at four more luncheon clubs in the Shipley and Bingley area. | years!
Our win at the 2010 GSK IMPACT Awards was a very proud moment for HALE, and valuable recognition of the work that we do and the impact we have on local people's health.
The awards are run by GlaxoSmithKline in partnership with the Kings Fund. After being shortlisted from over 350 charities throughout the UK as one of 10 prize winners, HALE was announced as the overall winner for 2010!
In March 2009 HALE received the Inspiration Award for our 'work with luncheon clubs to provide home made meals for older people'.
The Inspiration Award was given out by Bradford and Airedale NHS, and its purpose was: to support good ideas, to develop new ways of working and to encourage creative thinking to improve services for patients and customers. HALE won the award in the Improvement in Adult Services category.
| 187 |
Archive for February 5th, 2015
The International Wool Project (Hong Kong) — Wool Garden Rolls Out at East Point City to Celebrate the 50th Anniversary of the Woolmark Logo
HONG KONG, Feb. 4, 2015 /PRNewswire/ — As the Year of the Sheep is approaching, and the world-famous Woolmark brand celebrates its 50-year milestone, East Point City, Sun Hung Kai Properties' flagship shopping mall in Tseung Kwan O, Hong Kong, is cooperating with local felt artist Debbie Leung and The Woolmark Company in launching The International Wool Project (Hong Kong) — Wool Garden. Apart from creating a festive in-mall shepherd garden, there will be a series of "sheep" and "wool" themed education programmes which the public can find out more about the natural, renewable, highly malleable and versatile characteristics of wool, as well as experience wool art and the fun of knitting. The project also aims at inducing consumers' greater demand for wool and enriching their knowledge on this natural material, thus increasing<|fim_middle|> wool products so as to arouse public awareness about environmental friendly fabrics. Besides, the award-wining wool couture designed by 3 local young designers are showcased at East Point City.
Increasing demand from China offers huge opportunities and wool's price is expected to rise steadily
Mr Alex Lai, Country Manager of The Woolmark Company, said, "Wool is highly versatile, and can be used to make garments for all ages, from classic knit sweaters to the most fashionable clothes. The increasing demand for wool from the Greater China Region, especially China, offers huge opportunities for the wool industry. Global wool production reaches approximately 1.05 billion kilograms per year, while Australia stands as the world's largest wool producer, accounting for 23% of the wool production (per capita). Australia is also the largest supplier of wool to China, with a share of up to 70% of imported wool to China in the past three seasons. As China's economy continues to grow, both the demand and the price of wool are expected to rise steadily in 2015."
"Felt is the only fabric in the world that can be shaped by hand. You can change the shape of felt freely by applying soapy water of the right temperature, no matter 2D or 3D," indicated by Debbie Leung while referring to features of felt fashion. Felt art is also environmentally friendly, as you can redo your felt art piece by unknitting it, in which no material would be wasted. Moreover, wool is anti-bacterial, fire and water resistant. It can also keep you warm in cold weather, but release heat and moisture when it is hot. All these characteristics make wool a desirable fabric for clothing.
East Point City x Woolmark x Debbie Leung
The International Wool Project (Hong Kong) — Wool Garden
31 Jan – 8 Mar 2015
10am – 10pm
1/F Exhibition Area, East Point City
8 Chung Wa Road, Hang Hau, Tseung Kwan O, Hong Kong
About The Woolmark Company
The Woolmark Company is a not-for-profit company which invests in research, development and marketing along the global supply chain for Australian wool — from woolgrowers through to retailers. Their goal is to increase the demand for wool. Woolmark is the iconic fibre brand symbolizing the best wool in the world. Created in 1964, the logo perfectly represents the softness, elegance and modernity of wool. Today, it is still amongst the ten most recognized and appreciated brands in the world. A product bearing the logo indicated that it has been independently tested as a high quality woolen product with guaranteed fibre content. Its creation was the result of a collaboration of the world's woolgrowers led by Australian woolgrowers and it became the independent marketing tool used to support the use of quality wool.
About Felt
There are two types of felt, namely dry felt and wet felt. The former refers to felt art sculpted by special needles while the latter refers to felt produced by applying soapy water. Felt is the oldest fabric in human history, and its history can date back to 6500 BC. Since felt art emphasizes craftsmanship and is easy to produce, it can be created by people of all ages. While colourful felt art can enhance children's sensitivity to colours, stimulate their creativity and help them develop artistic sense, it also helps to improve the mobility of the elderly's fingers and stimulate their five senses.
Photo – http://photos.prnasia.com/prnh/20150130/8521500613-a
Photo – http://photos.prnasia.com/prnh/20150130/8521500613-b | the competitiveness and sustainability of the Australian wool industry.
Mr Alex Lai, Country Manager of The Woolmark Company(Right 3), Ms. Fiona Chung, General Manager (Leasing) of Sun Hung Kai Real Estate Agency (Left 4) and Ms. Debbie Leung, local felt artist(Left 3) and guests hosted the opening ceremony of The International Wool Project (Hong Kong) — Wool Garden.
Woolmark, East Point City, Sun Hung Kai Properties' flagship shopping mall in Tseung Kwan O, Hong Kong, is cooperating with local felt artist Debbie Leung and The Woolmark Company in launching The International Wool Project (Hong Kong) — Wool Garden.
International Wool Project rolls out in Hong Kong to celebrate the 50th anniversary of the Woolmark logo
Started in Australia, the International Wool Project encourages local woolgrowers, fashion designers, retailers, manufacturers, artisans and interior designers to work together to promote the versatility of wool. As the Year of the Sheep is around the corner, The Woolmark Company takes this opportunity to introduce this international education project to Hong Kong through and joins hands with East Point City to launch this Wool Garden project. Six sets of haute couture made of felt by Hong Kong felt artist Debbie Leung are on display at East Point City, along with six lovely sheep in Chinese New Year and Valentine's Day themed costumes. "Happy shepherds" visiting the garden will find themselves immersed in the colourful world of felt art.
Moreover, in order to let more people understand how wool products are being processed, The Woolmark Company exhibits fleece, fabrics and wool products at the "Wool Studio" in East Point City. Videos and exhibition panels in the studio also illustrate the characteristics and applications of wool and | 355 |
Excellent place to stay in a perfect location!
Staff were very helpful and friendly, room was modern, location is perfect - just a few mins walk from the ferry and with amazing views over the harbour but quiet, food for a small 'self made' breakfast was a nice surprise. Would stay here again.
Fantastic views( we were on the top floor) from the balcony. Really comfortable bed. Really good range of breakfast foods and snacks which were topped up every day. Panos was so friendly and helpful.
Really hard to find fault with this property. I think the only thing I would say is that we didn't need our towels changing every day but they were.
A lovely well presented apartment with superb views of the harbour and a lovely helpful owner.
A lovely clean well presented apartment with a superb view from the balcony. The owner was exceptionally helpful in all respects particularly picking us up and dropping us off at the ferry. He is a truly lovely guy.
Best place to stay in Symi.
Perfect place to stay in Symi! Fantastic host (thanks Panos!), great location (not too many steps), brilliant facilities and excellent service and cleanliness. The coffee was pretty great too.
Wonderful owner<|fim_middle|> toaster, complimentary bread and snacks etc to prepare breakfast on the balcony. Just perfect!
Can't find a single fault.
Great place to enjoy Symi!
Great place to stay in Symi, the view from the balcony is amazing and the hospitality and service we received was excellent.
I would definitely recommend people to stay at Thea!
Panos was very friendly and helpful, we appreciated him transporting us and cases to from the ferry. The fridge was kept well stocked with breakfast and snack foods, together with a wide range teas and ground and instant coffees. Room facilities were five star.
We were supplied with delicious cinnamon buns every morning, coffee, snacks, all you could need. The room was beautiful and Panos, the owner, was a wonderful host; extremely helpful and accommodating. We had an amazing view of the harbour and we were near to all of the lovely tavernas. Excellent all round, we couldn't fault it! Totally recommend Thea Apartments.
Fantastic accommodation overlooking the harbor!
Spacious room in an excellent location. Very well equipped and maintained. Panos the owner was extremely helpful.
Gem of a place in Symi!
Everything about Thea was perfect. The welcome,the facilities the attention to detail all were outstanding. The beds were extremely comfortable and the bathroom was lovely. The bottle of wine on arrival was a nice touch.
Could not fault this hotel, it was a joy and a pleasure to stay there!
Created with passion and with one person in mind. You.
The attention to detail through the well thought out design, styling, cleanliness and sheer comfort of the beautiful rooms. The wonderful view. The unexpected generosity of the welcome pack. The warmth and attentiveness of the owner who offered thoughtful suggestions of what to do when asked. Thea has been created and is run with passion by someone who really understands his guests needs and delivers them on every level.
Lovely clean and modern apartments. Fantastic location with stunning views of Symi port. Bed and pillows extremely comfortable. Panos was an amazing host as always.
Brilliant location, beautiful room, gorgeous building, stunning views.
The owner Panos was very helpful throughout our stay.
The charming view on the port, the good taste of the furniture, the kindness of our host.
"Glorious views over Symi Harbour!"
Lovely rooms, free wifi, fantastic views, bath with hot water, free delicious wine and real coffee, being met by Panos. A real treat!
"A room with a view!"
The style and quality if the room and the comfy bed with white cotton sheets and the location and especially the view!
Simply wonderful location, truly wonderful room & facilities.
Excellent holiday accommodation. The location is perfect and Panos was an excellent host. Apartments are recently refurbished to a high standard. Would definitely recommend staying at Thea apartments!
We liked everything about this hotel, have payed a lot more for a lot less. Perfect location, we had a room with a balcony that had an absolutely stunning view of the town and harbour. The room itself was immaculate and very tastefully decorated. Panos collected us from the ferry, carried the baggage and showed us around the town, excellent service. The room itself was quite small but with the mezzanine floor with two extra beds we had ample room. We only stayed two nights but the bedding gave us the best nights sleep we had on our holiday! Some people might find the short climb of stairs a problem, but this is Symi, it's built on a hill, if you have a problem with steps, book someplace on the harbour front; but you will be missing out on one anazing view in a class boutique apartment.
We really enjoyed our stay at Thea. The staff were extremely helpful and friendly and even met us when we arrived on the ferry which we didn't expect. The hotel is centrally located with fantastic views. The room was very clean and comfortable.
Excellent, what a view and location. Panos was a lovely punctual and efficient host!
Small guest house overlooking the harbour. There are about 25 steps to get to the room so it wouldn't be easy for people with disabilities etc.
Excellent hotel with an excellent host!
Wonderful, magical location with views to die for. Accommodation included room facilities similar to 4 star hotel rooms plus self catering option. Location ideal as central with privacy. Very attentive host who changed his approach skilfully for different clients.
Fabulous stay on beautiful Symi!!!
Everything is provided in these very comfortable rooms that overlook the busy harbour. Panagiotis, the owner, could not be more helpful or hospitable.
The room was very clean, beds extremely comfy. Bathroom luxurious with good toiletries. Loved the fruit juice, yoghurt, large bottles of water delivered daily to our fridge. The view on the first floor is fantastic & the owner very friendly & helpful.
Breakfast on the balcony every morning, taking in the beautiful view of the harbour was lovely. Panos could not have been friendlier or more helpful.
The Apartments are beautiful. Furnished very tastefully. A lovely bathroom. Great views over the port. Breakfast ingredients are provided every day. The guy who lets out these apartments is also very amiable and helpful. Symi itself is also fantastic with water taxis leaving the port for the various beaches around the island. So we can recommend both the island and the accommodation highly enough. It was a fantastic experience.
Everything about this place was first class. At the Thea every fine detail for your comfort has been thought of. Also even though room only the goodies for breakfast in the fridge that are replenished every day mean it as good as bed and breakfast.
We were picked up by the owner who couldn't have been more helpful. He carried all our bags up the steps to the house where our apartment was on the top floor with the most stunning views over the harbour. The room was very tastefully decorated and spotless. We had a room with our teenage kids and all agreed it was excellent value for the price and very comfortable. We are used to staying in top hotels round the world and this compared highly with many of them.
Amazing apartment - amazing place! They cant do enough for you. All brand new furniture/interior. Wine and juice waiting on your arrival - the views are unreal. You need to be able to walk up and down steps to visit the island.
This place is a must to visit. The location, the views, the accommodation. We only stayed one night but really wish it could have been 4 or 5. Panos was really fantastic, the fridge was stocked with stuff for breakfast and a free bottle of wine. Nothing was too much trouble for him.
Everything was brilliant. We stayed in the attic apartment and it was fantastic. one of the best views of symi. we were given water, milk and wine. balcony was perfect.location is on the harbor. the owner is a lovely guy who showed us round and told us about the places to stay. if...no...when i come back to Symi, it will be here. thanks for everything!
Design ..especially the bathrooms.. Views..locality..comfortable beds. There was water, tea, coffee, toast, jams, butter, fruit juice in fridge..all included. Excellent place to stay! Will be going back in September, if it is available. | . Excellent location - view from balcony to die for!
Panos was the most welcoming host - outstanding facilities and cleanliness. The best place to stay in Symi.
Thank you Panos for giving us a wonderful holiday, for reasons that I will not explain, we needed a relaxing break and we got it and more. Symi is a special place and its people wonderful.
A real find - just what Symi needs!
Great studio - in fantastic location close to harbour and restaurants. Panos the host is extremely helpful!
The best, most relaxing holiday we have had in many years!
Incredibly friendly, stunning scenery, wonderful walking and snorkelling.
Utter peace and quiet once 500 metres from the port area.
Met some marvellous characters, and Panos, our host couldn't have been more helpful or welcoming.
Perfection in the perfect Greek Island!
Symi. A few steps away from the most idyllic harbour in Greece with the perfect view from your balcony. The host, Panos, was so helpful even connecting on WhatsApp for instant advice. Our room was advertised as "no breakfast" but the fridge was full of everything we needed and home baking delivered each day. The sun sets shining onto the balconies so perfect for a glass of wine. Perfect in every way!
It's such a lovely place to stay and Panos is an amazing host!
Panos and the rest of the staff were absolutely fantastic in every respect.
It was simply perfect. I wish we could have stayed longer. Best place to stay in Symi without a doubt. We will come back for sure. Panos was so friendly and able to provide excellent advice on what to do and see, which boat to get the beaches etc. Lots of thoughtful additions to the apartment such as | 362 |
enquiries@hartsbooks.co.uk
Hart's Books
26 King Street - Saffron Walden - CB10 1ES01799 524 552
Recommended by Max
Available in Paperback
Published by Harper Collins
Available to buy over the phone on 0<|fim_middle|>004) was born in Kiev, Russia. As a child she studied piano at the Conservatoire and gave her first public performance at the age of 10. After moving to the UK, Goehr studied photography under Bill Brandt. She published three books: Faces with text by Vita Sackville-West, Musicians in Camera with text by John Amis and A Little Tiger with text by Elspeth Huxley. Her photos have been exhibited over the world, and are held in collections including the Victoria & Albert Museum and the National Portrait Gallery.
Essex CB10 1ES
Website by Winston Design
© Hart's Books 2020 | 1799 524 552 or in the shop.
A Read with Jenna Today Show Book Club Pick!
"I can't believe how good this book is…. It's wholly original. It's also perfect…. Wilson writes with such a light touch…. The brilliance of the novel [is] that it distracts you with these weirdo characters and mesmerizing and funny sentences and then hits you in a way you didn't see coming. You're laughing so hard you don't even realize that you've suddenly caught fire." —Taffy Brodesser-Akner, New York Times Book Review
Big Sky – Jackson Brodie
by Kate Atkinson
Published by Transworld
Jackson Brodie has relocated to a quiet seaside village in North Yorkshire, in the occasional company of his recalcitrant teenage son Nathan and ageing Labrador Dido, both at the discretion of his former partner Julia. It's a picturesque setting, but there's something darker lurking behind the scenes.
Jackson's current job, gathering proof of an unfaithful husband for his suspicious wife, seems straightforward, but a chance encounter with a desperate man on a crumbling cliff leads him into a sinister network-and back into the path of someone from his past. Old secrets and new lies intersect in this breathtaking new literary crime novel, both sharply funny and achingly sad, by one of the most dazzling and surprising writers at work today.
Published by Cornerstone
For a while, Daisy Jones & The Six were everywhere. Their albums were on every turntable, they sold out arenas from coast to coast, their sound defined an era. And then, on 12 July 1979, they split. Nobody ever knew why. Until now.
They were lovers and friends and brothers and rivals. They couldn't believe their luck, until it ran out. This is their story of the early days and the wild nights, but everyone remembers the truth differently.
The only thing they all know for sure is that from the moment Daisy Jones walked barefoot, on to the stage at the Whisky, the band were irrevocably changed. Making music is never just about the music. And sometimes it can be hard to tell where the sound stops and the feelings begin.
by Kiley Reid
Available in Hardback
Published by Bloomsbury Publishing PLC
When Emira is apprehended at a supermarket for 'kidnapping' the white child she's actually babysitting, it sets off an explosive chain of events.
Her employer Alix, a feminist blogger with a 'personal brand' and the best of intentions, resolves to make things right. But Emira herself is aimless, broke and wary of Alix's desire to help.
When she meets someone from Alix's past, the two women find themselves on a crash course that will upend everything they think they know – about themselves, each other, and the messy dynamics of privilege.
Faces: Profiles of Dogs
by Vita Sackville-West
Published by Daunt
'It must be a nuisance to go through life with a Father Christmas moustache like that, but no doubt the Schnauzer gets used to it.'
In Faces, Vita Sackville-West traces the origins and history of forty-four dog breeds, reflecting on their characteristics with frank humour, from the silky gentle-eyed Afghan, 'like somebody's elderly Aunt Lavinia, who nourishes a secret passion for the Vicar', to the Labrador Retriever, 'dear, solid, faithful lump of a dog!', and that 'docile minion' the Corgi.
First published in 1961, each profile is strikingly illustrated by Laelia Goehr's original black and white photographs. Together, profile and portrait capture these canine characters in their various moods: benevolent, haughty, amused, wistful, or simply a little bit sleepy.
Charming and fascinating in equal measure, Faces is a memorable insight into 'how very odd it must be to be a dog'.
Laelia Goehr (1908-2 | 829 |
When I was studying at the University of Kent I learnt many different ways of expressing myself creatively. The main inspiration I had for choosing Multimedia Technology and Design was because I did not want to be stuck down to one medium. I wanted to work with multiple platforms constantly expanding my knowledge and combining technologies to create effective outcomes.
For my final year project I joined a team that had a wide range of knowledge with different specialisms. We decided that because of the varied nature of the course we would try to combine all the knowledge we had gained to create a multi-media project. We created a fictional product which we would advertise using a variety of online digital content. This included creating the product (through initial concept design to 3d models), adverts (TV ads, animations, posters), booklets, a website, flash games and textual material all informed by real<|fim_middle|> people. We knew we couldn't actually invent the product but wanted to show how we could market it effectively online if it did exist. I received a 1st for the project.
NOTE: blog and forum no longer available. | technology research.
I was chosen by my three team mates as team leader and would over see the creative direction and production. I also produced all of the flash content throughout the site (interactions, games, banners), 3d animations, character designs and textual content. The product we created was a robotic designer toy that could walk, talk, dance and interact with its surroundings and | 76 |
CHICAGO - The American Library Association is accepting nominations for the 2019 John Ames Humphry/OCLC/Forest Press Award for International Librarianship. The deadline for nominations is Jan<|fim_middle|> seconding the nomination or other letters of commendation or appreciation. | . 10, 2019.
The award consists of a prize of $1,000 and a certificate, which are presented at the International Relations Round Table Reception at the ALA Annual Conference in Washington, D.C. The award is given to a librarian or person who has made significant contributions to international librarianship.
Created on the occasion of the retirement of John Humphry as executive director of Forest Press, publisher of the Dewey Decimal Classification, the award recognizes Humphry's far-ranging work to internationalize the English language editions of Dewey and to ensure that translations were adapted to meet the needs of other cultures and countries.
All nominations should include, as appropriate, personal history or curriculum vitae, with emphasis on achievements related to international librarianship; bibliography, critical reviews, articles, etc.; and letters | 168 |
A Little Emerald Book of Ephemera by Jack Ketchum — Signed, Limited<|fim_middle|>—Signed, Ltd. Edition
A Little Orange Book of Ornery Stories by Ed Gorman—Signed, Ltd. Edition
A Little Black Book of Quiet Horror by Charles L. Grant — Limited, numbered, signed edition.
The eighth title in our Little Books Series III.Charles L. Grant was a prolific writer of more than 100 novels and twice as many short stories. He was one the most respected and revered writers of his generation. He is the winner of a British Fantasy Award, two Nebula Awards, three World Fantasy Awards, the Bram Stoker for Lifetime Achievement, the World Horror Convention Lifetime Achievement Award, the Lifetime Legend Award of the International Horror Guild.Grant died in 2006, but his work remains a lasting monument to his talent. This current volume collects stories that best represent his style and type of tale he liked to call "quiet horror." It has been edited by his wife, writer Kathryn Ptacek and Hank Wagner—signed by both.
A Little Purple Book of New Orleans Stories by Poppy Z. Brite — Signed, Limited Edition
A Little Gray Book of Shadows by William F. Nolan — Signed, Limited Edition.
A Little White Book of Ghost Stories by Rick Hautala — Signed, Limited Edition
A Little Cobalt Book of Old Blue Stories . . . and Stuff by Mort Castle — Signed, Limited Edition
A Little Magenta Book about a Dollhouse by Edward Lee — Signed Limited Edition
A Little Blue Book of Bibliomancy by Chet Williamson — Signed, Limited Edition | Edition
A Little Brown Book of Burials by Laird Barron — Signed Limited Edition
A Little Black Book of Horror Tales by Dennis Etchison | 31 |
The manufacturer touts the Snowball USB Microphone as a mic that is not just easy to use, but sounds as good right on your desktop as it does in a professional recording studio. And we tend to agree. Whether you want to record and sing at the kitchen table or grab the band and hit the studio, this little Snowball can capture the detail that has never been heard before in a USB recording microphone.
It has a crisp and clean sound thats as close as your going to get this side of a professional studio for the money. The value is un-matched.
The build quality is very, very solid. It comes with a nice little tripod stand that is included in the box along with a nice long USB cable. The tripod has 3 retractable legs that you can adjust for your needs. You can take the microphone off the tripod if you desire. It's just very easy to use!
There is no software that needs to be installed. You just plug it in and it is ready to go! You'll notice that once it's plugged in and it's receiving power, that the light will turn on on front. You're in business. On the back of the microphone you'll see the three different settings that you can choose from.
The Snowball is a condenser microphone. It has a frequency response of 40-18kHz a sample world rate of 44.1 Khz/16 bit and it's polar patterns can be adjusted to be either Omni-directional or Cardioid. It is a direct plug n' play mic that connects to either a PC or Mac. It can handle everything from the loudest garage band to the softest vocals. So anything you throw at it the Snowball can take it and make it sound magical.
If you're really portable you can use the Snowball to record on your Ipad. Using either the USB-30 pin adapter, or Lightning to USB camera adapter. So when inspiration strikes, or if you're out just practicing by yourself, you can plug the Snowball into your Ipad fire up Garageband (or any recording app) and get that studio quality on the go.
It makes the perfect USB microphone for singing at home, wherever that is at the time!
It's available in several stylish colors. You can also add a pop-filter as well to take care of your poppin' 'P's when you sing. With all the different settings and just "plug-in-and-go" features. The snowball is a no-brainer when it comes to an entry level microphone for singing.
Setting 1 is the Cardioid option. It is used mainly for podcasts, voiceovers, singing and vocals. It's focus is mainly on capturing anything type of sound that you are projecting directly at the microphone.
Setting 2 is also a Cardioid option with a<|fim_middle|> of the Snowball USB in that it doesn't have all of the recording patterns and is more or less just fixed to one setting. It also only has one capsule instead of two.
If you're stepping up your game to start recording or singing at home the value in this powerful entry-level microphone will be music to your ears.
UPDATE: Blue often has a special Snowball package complete with a pair of headphones and pop filter! So be sure to check out the latest on Amazon to see if you can snag a deal. | twist! This has a setting on it to help capture louder sounds without losing quality. It adds a -10 dB pad to the signal. It's good for recording something loud like instruments or loud music.
Setting 3 is the omni-directional mode. This is when you want to capture sounds equally from all directions. If you want to pick up background or ambient noises. If you want to record several voices singing into the microphone from all around it.
One point to be made though is with the Snowball you have to get in close to record your voice. Usually we leave our volume all the way up and adjust around the mic based upon if we're singing or speaking. This isn't a microphone that you'll be standing 2 feet away from and belting out tunes. You'll have to figure out your own little "sweet-spot" when it comes to your unique voice.
Another accessory is Blue Microphones Ringer Universal Shockmount. Not that you're actually going to have snowball fight or throw a fastball with it. But the shockmount makes it so that the Snowball actually "floats" and doesn't come into contact with any nearby surface. It's perfect to prevent any type of hits or vibrations on the mics stand or base.
With over 2400 Amazon reviews the Snowball USB Microphone is a winner if your goal is to be singing at home. Blue Microphones Snowball family also includes its "little brother", The Snowball iCE Condenser Microphone. It offers a stripped down version | 313 |
Abstract : Vowel reduction may involve phonetic reduction processes, with non reached targets, and/or phonological processes in which a<|fim_middle|> – which could be considered as /ə/ – corresponds to reduction for mid- high and mid-low vowels /e ɛ o ɔ/. /a/ is probably not affected by phonological reduction, possibly due to the longer duration of the consonant to vowel trajectory for low vowels. Altogether, the Coratino vowel system appears to evolve from a 7-vowel system /i e ɛ o ɔ u a/ for stressed configurations to a 3-vowel system /ɨ ə a/ for the most reduced configurations. | vowel target is changed for another target, possibly schwa. Coratino, a dialect of southern Italy, displays complex vowel reduction processes assumed to be phonological. We analyzed a corpus representative of vowel reduction in Coratino, based on a set of a hundred pairs of words contrasting a stressed and an unstressed version of a given vowel in a given consonant environment, produced by 10 speakers. We report vowel formants together with consonant-to-vowel formant trajectories and durations, and show that these data are rather in agreement with a change in vowel target from /i e ɛ o ɔ u/ to schwa when the vowel is a non-word-initial unstressed utterance, unless the vowel shares a place-of-articulation feature with the preceding or following consonant. Interestingly, it also appears that there are 2 targets for phonological reduction, differing in F1 values. A "higher schwa" – which could be considered as /ɨ/ – corresponds to reduction for high vowels /i u/ while a "lower schwa" | 216 |
Q: CNN with RGB input and BW binary output I am a beginner to deep learning and I am working with Keras built on top of Tensorflow. I am trying to using RGB images (540 x 360) resolution to predict bounding boxes.
My labels are binary (black/white) 2 dimensional np array of dimensions (540, 360) where all pixels are 0 except for the box edges which are a 1.
Like this:
[[0 0 0 0 0 0 ... 0]
[0 1 1 1 1 0 ... 0]
[0 1 0 0 1 0 ... 0]
[0 1 0 0 1 0 ... 0]
[0 1 1 1 1 0 ... 0]
[0 0 0 0 0 0 ... 0]]
There can be more than one bounding box in every picture. A typical image could look like this:
So, my input has the dimension (None, 540, 360, 3), output has dimensions (None, 540, 360) but if I add an internal array I can change the shape to (None, 540, 360, 1)
How would I define a CNN model such that my model could fit this criteria? How can I design a CNN with these inputs and outputs?
A: This is a simple example of how to write intermediate layers to achieve the output. You can use this as a starter code.
def model_360x540(input_shape=(360, 540, 3),num_classes=1):
inputs = Input(shape=input_shape)
# 360x540x3
downblock0 = Conv2D(32, (3, 3), padding='same')(inputs)
# 360x540x32
downblock0 = BatchNormalization()(block0)
downblock0 = Activation('relu')(block0)
downblock0_pool = MaxPooling2D((2, 2), strides=(2, 2))(block0)
# 180x270x32
centerblock0 = Conv2D(1024, (3, 3), padding='same')(downblock0_pool)
#180x270x1024
centerblock0 = BatchNormalization()(center)
centerblock0 = Activation('relu')(center)
upblock0 = UpSampling2D((2, 2))(centerblock0)
# 180x270x32
upblock0 = concatenate([downblock0 , upblock0], axis=3)
upblock0 = Activation('relu')(upblock0)
upblock0 = Conv2D(32<|fim_middle|> such, but segmentation maps showing regions of interest.
What is right for you, depends on what precisely you want to achieve. For getting actual bounding boxes you want to perform an object detection. However, if you're interested in highlighting regions of interest that go beyond rectangle windows a segmentation may be a better fit. In theory, you can use your rectangle labels for a segmentation, where the network will learn to create better masks than the inaccurate segmentation of the ground truth, provided you have enough data.
| , (3, 3), padding='same')(upblock0)
# 360x540x32
upblock0 = BatchNormalization()(upblock0)
upblock0 = Activation('relu')(upblock0)
classify = Conv2D(num_classes, (1, 1), activation='sigmoid')(upblock0)
#360x540x1
model = Model(inputs=inputs, outputs=classify)
model.compile(optimizer=RMSprop(lr=0.001), loss=bce_dice_loss, metrics=[dice_coeff])
return model
The downblock represents the block of layers which perform downsampling(MaxPooling2D).
The centerblock has no sampling layer.
The upblock represents the block of layers which perform up sampling(UpSampling2D).
So here you can see how (360,540,3) is being transformed to (360,540,1)
Basically, you can add such blocks of layers to create your model.
Also check out Holistically-Nested Edge Detection which will help you better with the edge detection task.
Hope this helps!
A: I have not worked with keras but I will provide a solution approach in more generalized way which can be used on any framework.
Here is full procedure.
*
*Data preparation: I know your labels are edges of boxes which will also work but i will recommend that instead of edges you prepare dataset marking complete box like given in sample (I have marked for two boxes). Now your dataset have three classes (Box,Edges of box and background). Create two lists, Image and label.
*Get a pre-trained model (RESNET-51 recommended) solver and train prototxt from here, Remove fc1000 layer and add de-convolution/up-sampling layers to match your input size. use paddding in first layer to make it square and crop in deconvolution layer to match input output dimensions.
*Transfer weights from previously trained network (Original) and train your network.
*Test your dataset and create bounding boxes using detected blobs.
A: You have do differentiate between object detection and object segmentation. While both can be used for similar problems, the underlying CNN architectures look very different.
Object detection models use a CNN classification/regression architecure, where the output refers to the coordinates of the bounding boxes. It's common practice to use 4 values belonging to vertical center, horizontal center, width and height of each bounding box. Search for Faster R-CNN, SSD or YOLO to find popular object detection models for keras. In your case you would need to define a function that converts the current labels to the 4 coordinates I mentioned.
Object segmentation models commonly use an architecture referred to as encoder-decoder networks, where the original image is scaled down and compressed on the first half and then brought back to it's original resolution to predict a full image. Search for SegNet, U-Net or Tiramisu to find popular object segmentation models for keras. My own implementation of U-Net can be found here. In your case you would need to define a custom function, that fills all the 0s inside your bounding boxes with 1s. Understand that this solution will not predict bounding boxes as | 684 |
Next available date Contact RPS for more information.
The RPS Area Managers Workshop is designed to provide you with a tried-and-tested system for becoming a high performing Area Manager in any retail environment, driving the performance of your business.
As key contributors to a business' bottom line, area managers will thus leave the course with the practical abilities & confidence to turn plans into profits.
Numbers – plan – execution – sign off.
Leadership – team engagement – customer engagement – feedback and improvement.
Numbers – Sales opportunity focus – non negotiable standards – training – coaching - accountability.
Instant performance recognition through visual scorecards and dashboard.
Customer journey - creating a performance culture – Zero<|fim_middle|>. Dennis & Barry are obviously experienced and talented tutors and held my concentration totally! I could listen to both of them for hours! | pressure selling.
Practicing and honing your skills in a safe environment, before doing it for real with your unsuspecting team.
Using the numbers to identify opportunity for sales improvement and creating the plan to achieve the improvement.
Writing game-plans that are quantifiable actions and accountable commitments.
RPS - 3 tier coaching model.
When to coach, when to tell.
Directive vs Non Directive coaching.
Structured and documented system for sustainable compliance.
Managing the spread of performance from best practice to critical care people.
Practice having the hard conversations for positive outcomes.
Writing games - plans that are outcome based actions.
Managing time to focus on the areas of greatest opportunity.
Every Area Manager will leave the workshop with their personal performance gameplan.
The price for this workshop is £950 + VAT per delegate.
RPS also offers a range of tailored consultancy services to help retail businesses tackle their specific challenges and produce tangible performance improvements.
Fill out your details to find out more about Area Managers Workshop.
Excellent new ideas and systems with a first class delivery. Very interesting working alongside other Area Managers.
Great Atmosphere. A lot to get through but worth it though. Was able to network with other companies as well and learn new ideas.
The workshop was extremely useful | 250 |
I love the real estate industry because of the professional career opportunity and flexibility it's offered me personally. I pride myself on being a calming voice to my clients in the pursuit of one of their biggest personal investments.
I am a trusted advisor and my clients view me as customer focused. I am a relentless advocate of their interests.
Before becoming a Licensed Real Estate Salesperson and Associate Broker, I had over 10 years of experience working on Wall Street. My time on Wall Street provided significant customer service experience in the course of facilitating large scale financial investments.
I provide an objective and judicious perspective to my clients, that's based on over 18 years of successful buyer and seller experience. My clients describe me as patient and view me as professional and responsive to their individual needs.
As a Julia B Fee Sotheby's real estate professional you can depend on your listing to be marketed to the broadcast audience. This is based on our insight and knowledge of the market both globally and locally.
My buyers and sellers can rest assure that our listings, marketing, and business processing services are supported by a high tech team of dedicated professionals. I will always be there to advise, support, and guide my client in their most important real estate choice. I do this by listening to my client's needs and desires.
A cornerstone of my service is the confidential protection of my client's business affairs. I'll always keep their interest at the forefront. I love the world of real estate and I'm always learning something new to help my clients. You won't be disappointed!
Please read my reviews on Zillow, just type in Michele R. Gonzalez.
"This was our third time working with Michele. She is knowledgable and always accessible. We truly appreciated her advice and immediate response. It is not easy to sell a property when you are living in a different country but Michele's commitment and trustworthiness made the process very smooth. We would highly recommend her to anyone looking to sell or buy or rent a property in her area."
"I highly recommend Michele! She did a Comparative Market Analysis for us and I was impressed with her great personality, professionalism and expertise in the Westchester real estate market. Thanks again Michele!!"
"Michelle Gonzales came highly recommended by a former tenant and from our first meeting, I was impressed by her professionalism and thorough knowledge of the local market and had no doubt she was the right fit for me. I ended up not needing her services and as I was ready to pay her for the time and efforts she had already invested, she refused to charge me anything! Needless to say, now that I am ready to look for another property to buy, she is the person I want to work with."
"Michele was super quick to respond (much quicker than most realtors I spoke too) and very efficient. Most importantly, she was flexible and friendly. Now we have our lovely place. I would strongly recommend her."
"We worked with Michele to buy our first home and she was amazing. Having worked with brokers on apartment rentals in the city I was skeptical at the value they provide but Michele totally changed my mind. She was thoughtful and creative and put time and effort into learning our taste - after a few rounds of pictures she zeroed in on exactly the types we liked. She met us multiple times to show us houses, picking some that pushed our boundaries the right amount but the vast majority were on point. She wasn't pushy at all and stayed in our price range. She knows the area extremely well and had great advice on the negotiation process. Most importantly, she always treated us with decency, was honest and trustworthy, and always made us feel like she had our best interests in mind."
"Michele Gonzalez is a very knowledgeable real estate broker. She was able to take us confidently through the extremely stressful home purchase process providing highly qualified alternative mortgage lenders as our first mortgage lender backed away from the transaction. On the day of our closing, 1/4/2018, Winter storm Grayson decided to close down the entire county. Fortunately, after the home inspection Michele drove us in her AWD sport utility to the closing and then drove the sellers home too, as the driving conditions continued to deteriorate. Michele "never misses a closing" and crosses every "t" and dots every "i" through the entire investment property purchase process. Thank you again Michele"
"Michele Gonzalez was recommended to me by a friend and colleague who was very happy with the apartment she had found him. At first I wanted only temporary accommodation in the Hudson River town I was thinking about living in, to see if I would really like it. She was able to find that quickly, an apartment which I was able to stay in for short periods of time. When it came time to find a more long-term rental, she found me a terrific place on the first day of the search. I was surprised and amazed, but that's how it worked out. Michele had a keen sense of what I wanted and how to get it for me. I highly recommend her for anyone looking for a place they can call home."
"Michele is one of the hardest-working people I know. She helped my brother and me buy our family homes in the Rivertowns, and when my work took me overseas she rented out my property and managed it superbly. She's efficient and responsive to a fault - with our time difference, I've sometimes sent her messages that I expected her to deal with the next day, only to get an immediate, and thorough, response. Plus she's always established a very good relationship with my tenants and provided reliable advice on many aspects of property management. I enthusiastically recommend working with her."
"We just had a quick bagel lunch in our new home. It felt great to have all the paperwork and drama behind us. Having said that, I know that the purchase and closing would not have gone well had it not been for the wonderful and resourceful Michele R. Gonzalez. She was truly amazing, our rock when things got rough. She never panicked and never seemed to break a sweat. Exactly the type of support you want when going through the house buying process. I would strongly recommend her to anyone looking for a trustworthy and brilliant advisor and advocate."
"People call me a nitpicker because I am very particular about how I feel business should be handled. If you make a promise, you keep it. Same thing goes for an appointment. If you hope to earn my business, show some compassion, some understanding and while you're at it, do your homework and come with all the information I need. Yes, most would consider the nitpicking me a real pain, but here's the thing. With MICHELE GONZALEZ, I had no reason to nitpick. She was all of the above and more. I enthusiastically recommend her whether you are a buyer OR seller."
"Knowledgeable. Responsive<|fim_middle|> to our questions. We never feel like we are bugging her and she is always honest and forthright with her response. There is no one else I would recommend working with besides Michele - she helped us find a wonderful home, all while introducing us to a number of neighborhoods with an intimacy only present in someone who lives in the area herself. We feel so lucky we found her -- and you should too!!"
"Michele is the most professional broker I have ever dealt with. Her input prior to sale and staging of the property did, without doubt, increase the value of my home. She provided impartial advise during negotiations while at the same time being sensitive to the stresses of selling a home I had lived in for 20+ years. I highly recommend Michele Gonzalez!"
"Michele went well past what A realtor usually does, she stuck with us for 7 years showing us home after home after, never giving up and never made us feel that we were bothering her or we weren't go to buy A home. She new that there was A home, and A place for us and she was going to find it for us. Further more when ever we called she picked up and was Johnny on the spot. She is more like A good Friend then A realtor! I hope when the day comes that we sell the home she absolutely helped us buy that she's still A realtor, because we know she'll put our interest first and above hers and her company's."
"I can't say enough good things about Michele. She is knowledgeable, professional, responsive and calm. She held my hand through the whole process. During the final property walk-through the buyer wanted the tire swing in the back yard taken down, so Michele went to her house and came back with a step ladder and saw and hacked away at the rope. Wow. You will be very pleased if you work with Michele."
"Michele's knowledge, sincere care and dedication is truly unique in an experience riddled with many twists and turns. She was incredibly patient as we shifted our priorities and locations (as first-time home buyers, we were figuring it out as we went). Michele maintained an upbeat and energetic spirit even through some hefty showing schedules and last minute surprises. She gave us space to form our own opinions and drive the process while also interjecting with her experienced eye when it was needed. As a seasoned agent, Michele also taught us a lot about the features of a house that are the true make or break factors in the long-term of home ownership. We recommend her hands-down with no reservations - you will be happy to have her on your side!"
"Michele was effective in getting our home sold. She had a solid knowledge of the area and the market in real estate. Pleasant to work with her. We had also purchased from her the same home 11 years ago and used her again to sell our home because we had confidence in her."
"Michele is a fantastic agent! My wife and I recently moved up to Westchester from the city, having lived only in large cities our entire lives. We knew very little about the options and the process of buying a house, which made it hard for us to define exactly what we wanted, but we had a strong sense of what we did not want. Michele patiently showed us maybe thirty houses over a few months until we finally found the perfect one. She is extremely knowledgeable about the area, including hidden details that are hard or impossible to find online. When it was time to negotiate, she provided helpful advice but made sure we make all the decisions consciously. She is very savvy about the nuances of making offers and responding to counter-offers. Throughout the entire process, she was always available to communicate by text, email or phone, whatever we preferred. All in all, Michele really exceeded our expectations of how knowledgeable, communicative and friendly an agent can be. I would passionately recommend her to anyone looking to buy or sell real estate."
"Michele is awesome! She found me the holy grail of tenants in just two weeks. She also helped me buy the place and was a strong advocate for my interests. She is very attentive and responsive to inquires."
"Michele worked with us for almost a year to help us find our perfect home. She is very pleasant to work with, very responsive, and has a solid understanding of Westchester real estate market, especially the river towns."
"Michelle was a fantastic agent! She helped us sell our home and very patiently helped us find our new home in another town. She went through our home room-by-room offering suggestions to help us get it ready to go on the market. I most appreciated her input in buying our new home. She was helpful in pointing out areas of homes that maybe we needed to consider more carefully (is this living room *really* going to function for your family? Are you sure not having a bathroom on this floor is going to work for your kids? If you don't like this part of the house, you can always renovate it so don't rule out this house) rather than jumping on the first thing we were interested in. She is very personable which was fantastic because the home-selling and home-buying process can be so emotional and stressful! I feel like she really understood that. She is also organized and returned all communications (emails, calls, texts) very quickly. I highly recommend her."
"Michele went above and beyond the call of duty representing us with the sale of our property. We dealt with multiple negotiations with multiple contracts and finally a buyer that could be best described as challenging. The buyer did not have a real estate professional representing her through the process so Michele had to hold her hand the entire time. She truly earned her commission with patience and a throughly professional approach."
"My husband and I recently sold our home in Sleepy Hollow, New York. In this very tough real estate market, I believe Michele's professionalism and her dedication were the key ingredients to our going to contract within two months of the listing date and going to closing within three weeks thereafter. Michele was with us every step of the way, starting with when we first talked about listing our home a year ago. She worked with the Village to make sure that all open building permits were closed out and that the house was in full compliance with Village Code. Michele assisted us in pricing the house in order to get the highest and best price in the market. She gave us excellent advice when it came to staging our home. Michele even volunteered to be in the house to let inspectors in if we were were not able to be there. At no time during the entire process did we feel like we could not turn to Michele with any questions or issues that came up. Michele is a true professional. I would not hesitate to recommend her to anyone in connection with either buying or selling. She knows the market and can be trusted to represent her clients to achieve their goal, whether buying or selling." | . Proactive. All qualities my partner and I wanted in a real estate professional - we found that and more in Michele Gonzalez. Highly-recommended!"
"My wife and I have known Michele casually through mutual acquaintances for a number of years. When we finally made the decision to sell our condo and asked our friends of any realtor they would recommend, the first person that was mentioned most often - and with glowing praises - is Michele Gonzales. Working with Michele was a dream. She knew the challenges and pitfalls to avoid. Moreover, she was always available to answer our questions, provide solid advice and recommendations on how to best position our condo for sale. Michele even went so far as to help us stage our condo to attract as many potential buyers as possible. In the end, based on her advice and hard work, the sale of our condo received multiple bids and achieved not only our asking price, yet well above it."
"We hit the jackpot when we found Michele. From the first time we spoke, Michele was warm, welcoming and INCREDIBLY knowledgable about the local real estate market. I was most impressed the first time we went out and she didn't need to check a map once - she was able to navigate from one town to the next based on her knowledge of the area. Michele listened closely to what it was we cared about, and was able to fine tune the listings to match it. She has a deep breadth of knowledge surrounding home renovation and repairs, so having her with us when we visited properties allowed us to imagine what we would need to, or want to, do if we were to buy. We have frequently told Michele that she was our first new friend in the area, and we mean it! Even though we closed on our new home two weeks ago, we still reach out to Michele frequently with questions about our new town. She responds promptly and with complete answers | 381 |
HOUSTON -- We settled in at 7:21 p.m. local time, expecting a tense, classic World Series pitchers' duel between Dallas Keuchel and Clayton Kershaw.
The Houston Astros beat the Los Angeles Dodgers 13-12 in a 10-inning slugfest of epic proportions, during which the Astros hit five home runs. They became just the fifth team in World Series history to rally from three separate deficits and just the second to rally from two three-run deficits -- and after all that, they still had to score the winning run off the best closer in baseball.
"Just when I thought I could describe Game 2 as my favorite game of all time, I think Game 5 exceeded that and more," Astros manager A.J. Hinch said after the game. "It's hard to put into words all the twists and turns in that game, the emotion, doing it at home, in front of our home crowd. Just exactly what you expect to<|fim_middle|> the 43,000-something fans in attendance at Minute Maid Park will tell their kids and their grandkids and their neighbors and the woman in line at the grocery store and the co-worker at the office they haven't talked to in two years. Games like this bring us together. The entire city of Houston will be talking baseball on Monday morning.
"I can't tell you how many times I've said, 'This is the craziest game of my life,'" winning pitcher Joe Musgrove said about this postseason. "This was the craziest game of my life."
At one point -- somewhere in the midst of Yuli Gurriel's tying three-run home run off Kershaw in the fourth inning, or Jose Altuve's tying three-run home run off Kenta Maeda in the fifth, or George Springer's tying home run or Altuve's go-ahead double in the seventh -- Collin McHugh turned to teammate Lance McCullers Jr. and asked, "We've seen everything else. What will happen next?"
The 25 combined runs tied for the second most in a World Series game. The teams combined for seven home runs. The offenses were so locked in that the teams combined for 28 hits -- and just 28 swings and misses. When the Astros were trailing 4-0 in the fourth, their win probability was 12 percent, but that doesn't factor in the fact that Kershaw was pitching. When Brian McCann homered to give the Astros a 12-9 lead in the eighth, their win probability was 97 percent. The Dodgers still managed to tie it with three runs in the ninth.
Where would you even start when telling this improbable tale? I guess at the end, with the score tied at 12 and Alex Bregman facing Kenley Jansen with two outs in the bottom of the 10th after Jansen had hit McCann and walked Springer.
"That guy lives for stuff like this," Springer said of Bregman. "He loves it. I noticed he was digging in the box a little harder. He wanted to be the guy to do it."
Bregman had never had a walk-off hit in his career. There was a short delay as the Dodgers had a meeting at the mound and Derek Fisher pinch ran for McCann.
"Springer had a huge at-bat and walked right before me," Bregman said. "I took one more swing on the on-deck circle and I looked to [Carlos] Correa. Correa said, 'It's your time.' And then I thought, what's your approach going to be? I saw [Jansen] last night and he threw more a slider and I was fortunate enough to put a good swing on it and hit it out of the yard. And I basically eliminated the slider."
Jansen's first pitch to Bregman was his 33rd of his outing, the 47th in two nights and the 417th pitch in what would be the second-longest game by time in World Series history. It was a 92 mph cutter, low and away, not Jansen's usual 95 and up in the zone. But Bregman was looking for something down in the zone, knowing Jansen thrives with that high cutter.
He lined a base hit into left field and Fisher -- who Bregman said is "probably the fastest guy in baseball," which even if that's not quite true, is worth the hyperbole on this night -- easily came around to slide home, creating pandemonium as players rushed out from the dugout to celebrate. The train then blared its horn and the hearts of Astros fans started beating once again.
The first four games already set up the potential for a World Series for the ages. Game 1 was Kershaw's 11-strikeout masterpiece. Game 2 was the wild extra-inning affair that Houston won 7-6 with Marwin Gonzalez's tying home run in the ninth and then three more home runs in extra innings. Game 4 was a 1-1 battle into the ninth. And now we can call that Game 2 and raise you Game 5.
"In the midst of it, it's hard to separate yourself from it, especially when it's a game you've pitched in," McHugh said. "I have family waiting outside that will probably let me know how exciting it was."
Yes, Collin, they most certainly will.
"Honestly, it felt like I didn't even pitch," Keuchel said. "I've never been so nervous in my life. The bubble-gut feeling. The highs, the lows. I'm glad that us pitchers are with the No. 1 offense and they provided a good show."
There was some criticism on social media about that show. This World Series already has 22 home runs, breaking the previous record of 21 set by the Angels and Giants in 2002. All the home runs shouldn't necessarily be a surprise in a season when the record for home runs was established. For all the talk before the game about the slippery postseason baseballs, and the difficulty some pitchers claimed in throwing sliders, this hasn't actually been a high-scoring postseason. Even including this game, the overall postseason batting line is just .226/.306/.406, and teams are averaging 4.39 runs per game, below the 4.65 mark of the regular season.
Plus, while this was certainly one of the nuttier World Series games, there have been others. The highest-scoring game was the Blue Jays' 15-14 win over the Phillies in 1993, in which the Jays remarkably didn't hit a home run (they were the other team to rally from two three-run deficits). In that 2002 World Series, there was an 11-10 game, a 10-4 game and a 16-4 game. Nobody called that the end of baseball. The Marlins beat the Indians 14-11 in Game 4 in 1997. Many believe Game 7 in 1960 was the greatest game ever played, and there were 19 runs and five homers in that game, including Bill Mazeroski's walk-off winner.
So these games happen. We should enjoy that we've had two of them in one World Series.
"This whole series has been an emotional roller coaster," Dodgers manager Dave Roberts said after the loss. "It's the two best teams playing for a championship. ... Guys want to take the baseball. Guys coming up with big hits in big spots. That's what the World Series is all about." | come to the park with Keuchel and Kershaw pitching."
Did it really happen? Sweet mother of all that's pure and good, this insanity most definitely did happen, as | 37 |
Scott Muir got so much value out of coaching that he now promotes it to others in his field.
In fact, Scott published a paper titled "The Executive Coach and the Library Leader" in The Informed Librarian Online (paywall). In his paper, Scott encourages other library leaders to consider hiring a coach, and pulls from his experience working with Coach Lisa to outline what coaching is, how to work with a coach, and how to select a coach.
Is coaching for you? Discover the impact of coaching on productivity, retention, and profitability.
"I have worked with Lisa, as my coach, over the last few years. Most recently, my action plan shifted away from moving within my organization as it became clear the best opportunities were at outside firms.
Lisa guided me through each step: Resume & LinkedIn writing, job searches that matched my target-goals, interview prep, and finally, salary negotiation. What sets Lisa apart is how she drove my success by instilling confidence at each level of the process. Never was I so prepared for an interview. What was once a tremendous challenge for me is now perhaps my greatest strength. I am sure Lisa would say I succeeded on my own, however, her support and feedback enabled me to put my career back on target."
"I was lucky enough recently to receive career coaching from Lisa. She is knowledgeable; bringing experiences from a variety of work settings including corporate America, health, and higher education. Lisa uses current instruments to determine your strengths and motivators, and she educates you on successful and current trends and practices in the job search market. She is supportive, analytical, and can guide you skillfully to your own conclusions using questioning techniques and information from your previous sessions. Lisa is open, honest, resourceful, hard working, sensitive, responsive, and kind. Lisa laughs freely and has a wonderful sense of humor. I highly recommend Lisa if you are looking for a career coach that will guide you on your next journey."
"I recently made the decision to exit my business and explore new career opportunities. My wife recommended I work with Lisa to help with an upcoming business deal, and to get perspective on what to do next given my strengths and goals. Amazingly, Lisa was able to elicit responses from a man who is not inclined to share his business with anyone. Then she helped me with my negotiation skills, even schooling me on opposition tactics. By working with Lisa, I was able to secure the deal I desired, and I've already got my foot in the door for my chosen career path. I have a newfound respect for the value of coaching in general, and Lisa in particular. She knows her stuff. And she knows how to tailor her approach to the personality involved -- even reluctant, 'no nonsense' guys like me. I enjoyed working with her and recommend her to anyone in need of a push in the right direction."
"I have known Lisa for over 25 years. She has coached me through numerous personal and professional challenges during this time. She has considerable skills regarding relationships, navigating the corporate world and assisting people to move forward in their lives. I know she has offered me incredible insight and support while I have made transitions in my life. Lisa's knowledge of organizational development combined with her knowledge of psychology and human nature make her an outstanding coach. I highly recommend her."
"I have known Lisa since I was a college student at ASU. Lisa was instrumental in helping me to grow and develop early in my career. With her guidance and coaching she helped me to explore and focus on my strengths, giving me plenty of opportunity to apply and develop my skills in a variety of projects. This not only increased my confidence, but also enabled me to see what I was capable of,<|fim_middle|> to identify and focus on current priorities to minimize stress and overwhelm. I would highly recommend Lisa to individuals who feel stuck or overwhelmed in their career and who recognize that they need to make changes to work smarter."
"Thank you so much for your excellent presentation on organizational change. I found your presentation to be an exceptionally informative one, notably regarding both the nature of change and how to structure our personal and organizational responses to change."
"I really enjoyed your presentation at Career Connectors today. I found it to be very useful and informative!"
"I enjoyed your presentation last week at Career Connectors. Thank you so much for sharing your insights. You provided lots of good nuggets."
"A number of people expressed to me how much they enjoyed your workshop session - and how useful they found all the information. It was, by all accounts, fantastic! Your presentation provided a valuable opportunity for many university staff, who might not otherwise have access to quality professional development such as this. Your presentation will directly affect the lives and work experience of those who attended. I look forward to working together again in the future!"
"I really appreciate your energy, enthusiasm and probing questions."
"Lisa continued to set the pace for all leaders in our Office of Human Resources (OHR). Because of her efforts, we saw another giant leap forward in our OHR offerings. Also, her new certification as an executive coach is already paying dividends as we were able to add this service to our collective consulting practice. I continue to be impressed by the sheer volume of work that her unit produces. Lisa is an exemplar when it comes to mixing vision, creativity and execution."
"Client feedback regarding Lisa was consistently distinguished. Senior leaders often requested her specifically to handle employee relations issues."
"Lisa is fantastic leader. Very insightful and inspirational. We had an employee engagement project where she brought her strategic thinking as well as her ability to build and leverage business relationships that truly drove business results as evidenced by our annual employee survey. Her staff respected and enjoyed working for her, always wanting to go the extra mile for her. Absolute pleasure to work with!"
"Lisa made immediate and significant contributions. She took on two important tasks: pulling together the organizational leadership training program, and launching the new performance management program. She executed both flawlessly."
"Few people demonstrate the level of organization, knowledge and, most importantly, compassion that I had the honor of experiencing with Lisa."
"I worked with Lisa for several years. She is a results-oriented, collaborative HR professional with a wealth of experience. She is dedicated and loyal and acts with a high degree of integrity."
"Lisa is a strategic thinker and has a very solid understanding of HR programs and how they fit together. She has quickly established herself as one of the top leaders in our HR organization."
"I had the pleasure of working with Lisa at American Express for several years, during our time in Human Resources. Lisa was exceptional at delivering results, and she was called upon often by our senior HR leader to manage and deliver on critical, enterprise-level projects. She accomplished this through her excellent leadership skills, strong relationship management skills, and flawless project management skills. As a peer/co-worker of Lisa's, I appreciated her coaching, guidance and consistent support, which supported my success and the success of the organization. I have no doubt she has continued to demonstrate those skills and abilities, and would recommend her for any role that requires strong leadership and flawless project/process execution."
"There was a lot of discussion at dinner [after your facilitated program]. We found the [MBTI] program to be very useful and very well facilitated."
"Very impressed with Lisa. She drew a lot on her own experience in real life situations, which made the whole thing feel more real."
"Lisa brings a wealth of knowledge and experience. When a technique or a concept was difficult, she had a personal experience she would share to help me understand."
"Lisa was awesome. She created a comfortable environment. She was able to deal with talkative people while giving the quieter people opportunity to speak up. She handled everyone well so we were all engaged."
in class discussions, particularly related to current trends not included in the textbook."
"Lisa was awesome. She was my first teacher, but she certainly got me engaged. If the teacher makes the class interesting, then she did a wonderful job... and she did." | which led me to my career path in business intelligence and data analytics. She is a wonderful coach and mentor, and I would highly recommend her."
"I worked with Lisa for many years at American Express, and most recently leveraged her for career coaching through her coaching and consulting practice. She is truly the most intelligent, articulate, and passionate HR professional I have had the pleasure to work with. Throughout my career, I have considered Lisa a mentor and have learned so much from her deep expertise in various disciplines of HR Management. My recent experience with her coaching and counsel was truly amazing. Lisa helped me achieve clarity on my strengths and recognize what matters to me most. She asked the tough questions, actively listened and gave me the necessary guidance to help me through my career transition. I highly recommend Lisa. She is a fantastic coach who is committed to helping others find their true passion in life."
"Lisa was recommended to me by a previous co-worker during a transitional period of my life where my confidence was low and I felt has if I had no direction. After my free consultation with Lisa, I already felt at ease and knew she would be able to help me. Her years of experience are shown through her method of coaching, which is extremely professional. She understood immediately the issues I was experiencing and was able to give solutions, feedback, and the confidence to enable me to return to my professional path."
"I chose Lisa because...she listened to me right from the beginning, was very easy to talk to, and very professional....I had some idea what I wanted to do, but nothing clear. Halfway through working with Lisa, I experienced some difficult challenges at work that forced me to resign a lot sooner than expected....With help from Lisa, I did this in a professional manner, leaving the door open. I am currently in the process of making a life career change thanks to Lisa's encouragement and expertise. She helped me stay focused on my goal, and encouraged me to explore other options that I had no idea were in my interest. Well worth it! And I can't wait to continue working with her in the future. I definitely recommend Lisa as a coach!
"Lisa has been my career coach for a couple years and has helped me so much. I came to Lisa thinking that I wanted to change careers. She helped me understand that I wasn't struggling with my career, it was where I worked. With Lisa's guidance, I learned a lot about myself and what I wanted. She was my cheerleader and confidante. With her advice and support, I had the confidence to find a job that was more suited to me. I appreciated her guidance and professionalism throughout the process. Whether you are changing careers or just at a crossroads, Lisa can help you accomplish your goals."
"In working with Lisa on my further development as a leader … I found her to be very engaging and thoroughly knowledgeable. The time I spent with her was of high value, and is one of the components not only in my growth, but also defining what I want that growth to look like. Lisa a great coach and a great person."
"I reached out to Lisa during a midlife career change. I had just started my own business and was struggling to find my focus without compromising my dream of being a solopreneur. By helping me to clarify my goals and priorities, Lisa made it easier for me to focus on where I want to go with my company and how I might go about achieving that. Although Lisa let me explore, she also validated my thoughts and provided insight and suggestions when she thought they might be helpful. My work with Lisa will remind me | 733 |
A community fridge is an open access fridge stocked with surplus food from local supermarkets and other businesses that is freely available to all members of the community. By saving food that would otherwise end up in the bin<|fim_middle|> city, Abingdon, Witney, Wantage and Bicester. | , they help fight food waste and food poverty. The average fridge saves over 7000kg of food a year!
Would you like to start a community fridge?
Replenish have launched a free training programme to help Oxfordshire residents set up community fridges in their local area. Participants will be supported through every step of the process, from finding a venue to securing funding for a fridge. They will also receive one-to-one support from community fridge expert Riki Therivel. Riki founded Banbury Food for Charities – the Banbury equivalent of the Oxford food bank – as well as setting up two community fridges in Oxford.
We currently have teams setting up Community Fridges in Oxford | 141 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.