content
stringlengths
7
1.05M
# encoding: utf-8 # module cv2.ogl # from /home/davtoh/anaconda3/envs/rrtools/lib/python3.5/site-packages/cv2.cpython-35m-x86_64-linux-gnu.so # by generator 1.144 # no doc # no imports # Variables with simple values BUFFER_ARRAY_BUFFER = 34962 Buffer_ARRAY_BUFFER = 34962 Buffer_ELEMENT_ARRAY_BUFFER = 34963 BUFFER_...
# 2. Data of XYZ company is stored in sorted list. Write a program for searching specific data from that list. # Hint: Use if/elif to deal with conditions. string = input("Enter list of items (comma seperated)>>> ") find_ele = input("Enter the elements which needs to find>>> ") list_eles = str(string).split(",") if ...
class Iterator: def set_client_response(self, client_response: dict): self.client_response = client_response return self def count(self): return len(self.client_response['Environments'])
#Desenvolver um algoritmo que leia o preço base de um determinado produto e #calcule o seu preço de venda ao público (ou seja, preço base acrescido da taxa de #IVA a 23%). #Altere o algoritmo anterior para que o valor da taxa de IVA seja também um valor #fornecido pelo utilizador. def IVA(): try: i...
class Solution: def canTransform(self, start: str, end: str) -> bool: n = len(start) L = R = 0 for i in range(n): s, e = start[i], end[i] if s == 'R': if L != 0: return False else: R += 1 ...
values = [int(i) for i in open('input','r').readline().split(",")] data = [0,1,2,3,4,5,6,7,8,9] steps = 256 for i in range(10): data[i] = values.count(i) for i in range(steps): item = data.pop(0) data[6] += item data[8] = item data.append(0) print(sum(data))
# Null Object Sentinel class NullObject: def __repr__(self): return '< Null object >'
############################################################################ # Copyright (C) 2008 - 2015 Bosch Sensortec GmbH # # File : bmp180.h # # Date : 20150327 # # Revision : 2.2.2 # # Usage: Sensor Driver for BMP180 sensor # ############################################################################ #file bmp...
class Solution: def diagonalSort(self, mat: List[List[int]]) -> List[List[int]]: m, n = len(mat), len(mat[0]) q = [[] for i in range(m + n)] for i in range(m): for j in range(n): q[i - j + n].append(mat[i][j]) q = list(map(lambda x: sorted(x, reverse=True)...
class OpcodeError(Exception): ''' opcodeが指定されたものではありません ''' pass class TooLongMessageError(Exception): ''' メッセージは125バイト以下です ''' pass class FirstFrameBitError(Exception): ''' fin,rsv1,2,3の数値が0,1ではありません ''' pass class UnavailableToSendError(Exception): ''' データが送信できなかった。 ''' pass class UnavailableToSen...
print('===== DESAFIO 079 =====') lista = [] while True: i = int(input('digite um numero: ')) if i not in lista: lista.append(i) print('valor adicionado com sucesso') else: print('valor duplicado, não vou adicionar') f = str(input('vc deseja continuar: [S/N] ')) if f in 'Nn'...
# # PySNMP MIB module ATTO-PRODUCTS-MIB (http://snmplabs.com/pysmi) # ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/ATTO-PRODUCTS-MIB # Produced by pysmi-0.3.4 at Wed May 1 11:31:53 2019 # On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4 # Using Python version 3.7.3 (default, Ma...
def cCollateralBugHandler_fbPoisonRegister( oSelf, oProcess, oThread, sInstruction, duPoisonedRegisterValue_by_sbName, u0PointerSizedOriginalValue, sbRegisterName, uSizeInBits, ): uPoisonValue = oSelf.fuGetPoisonedValue( oProcess = oProcess, oWindowsAPIThread = oProcess.foGetWindowsAPIThreadFo...
#!/usr/local/bin/python #-*- coding: utf-8 -*- __author__ = "Miracle Wong" class Fibonacci(object): """返回一个Fibonacci数列""" def __init__(self): self.fList = [0,1] #设置初始数列 self.main() def main(self): listLen = raw_input('请输入Fibonacci数列的长度(3-50):') self.checkLen(listLen) ...
class Settings(): def __init__(self, screenSize): # Configurações da tela self.screen_width = screenSize[0] self.screen_height = screenSize[1] self.bg_color = (100, 100, 100) # Configurações do retangulo self.rect_color = (150, 150, 150) self.rect_width = 3...
''' Challenge Suppose the following input is supplied to the program: without,hello,bag,world Then, the output should be: bag,hello,without,world ''' items = [x for x in input('Enter words separated with comma: ').split(',')] items.sort() print(','.join(items))
""" Space : O(n) Time : O(n) """ class Solution: def fib(self, n: int) -> int: mem = [0, 1] if n <= 1: return mem[n] for i in range(2, n+1): mem.append(mem[i-1] + mem[i-2]) return mem[-1]
def left_join(phrases): if(len(phrases) < 1 or len(phrases) > 41): return "Error" mytext = ','.join(phrases); mytext = mytext.replace("right", "left"); return mytext if __name__ == '__main__': #These "asserts" using only for self-checking and not necessary for auto-testing a...
class ONE(object): symbol = 'I' value = 1 class FIVE(object): symbol = 'V' value = 5 class TEN(object): symbol = 'X' value = 10 class FIFTY(object): symbol = 'L' value = 50 class HUNDRED(object): symbol = 'C' value = 100 class FOUR(object): symbol = ONE.symbol + FIVE.sym...
def inf_cad_cliente(): nome = input('Digite o nome do cliente: ') sobrenome = input('Digite o sobrenome do cliente: ') cpf = input('Digite o cpf: ') idade = int(input('Digite a idade: ')) dic_cliente = {'nome':nome,'sobrenome':sobrenome,'cpf':cpf, 'idade':idade} print('''########################...
# python3 def naive_fibonacci_partial_sum(m: int, n: int) -> int: total = 0 previous, current = 0, 1 for i in range(n + 1): if i >= m: total += previous previous, current = current, previous + current return total % 10 def fast_fibonacci_huge(n: int, m: int) -> int: p...
class atom_type: """ Class that describes the atomtype representation in the GROMACS topology file Args: ---- line(str): A string which is the line in the GROMACS topology file that holds information about an atom """ def __init__(self,line): # name at.num mass charge ptype sigma...
def longest_palindrome(s: str) -> str: def expand(left: int, right: int) -> str: while left >= 0 and right < len(s) and s[left] == s[right]: left -= 1 right += 1 return s[left + 1:right] if len(s) < 2 or s == s[::-1]: return s result = '' for i in rang...
#!/bin/python # Specified for different system partition = "engi" totres = 2616 # Do a batch for every 5 residues as 'residue I' # for 'residue J': loop it through the whole I+1 to the end of tetramer #for i in range(int(totres/5)): # beg = i*5 + 1 # end = (i+1)*5 # print(f"sbatch --export=batchid={i+1},batc...
"""Alunos Escreva um programa que lê duas notas de vários alunos e armazena tais notas em um dicionário, onde a chave é o nome do aluno. A entrada de dados deve terminar quando for lida uma string vazia como nome. De seguida o programa deverá perguntar um nome ao utilizador e imprimir as notas e a média do aluno. """ ...
class Solution: def fourSum(self, nums, target): """ :type nums: List[int] :type target: int :rtype: List[List[int]] """ size = len(nums) if size < 4: return [] nums.sort() ret = [] nums_set = set() for i in range(si...
""" Check if a triangle of positive area is possible with the given angles Given three angles. The task is to check if it is possible to have a triangle of positive area with these angles. If it is possible print “YES” else print “NO”. Examples: Input : ang1 = 50, ang2 = 60, ang3 = 70 Output : YES Input : ang1 =...
# ------------------------------ # 310. Minimum Height Trees # # Description: # For an undirected graph with tree characteristics, we can choose any node as the root. The result graph is # then a rooted tree. Among all possible rooted trees, those with minimum height are called minimum height trees # (MHTs). Given s...
# # PySNMP MIB module ASCEND-MIBREDHM-MIB (http://snmplabs.com/pysmi) # ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/ASCEND-MIBREDHM-MIB # Produced by pysmi-0.3.4 at Mon Apr 29 17:12:05 2019 # On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4 # Using Python version 3.7.3 (default...
"""Role testing files using testinfra.""" def test_service(host): """assert service enabled and started""" squid = host.service('squid') assert squid.is_enabled assert squid.is_running def test_port(host): """assert port is listening""" assert host.socket('tcp://0.0.0.0:3128').is_listening
def get_id_from_urn(urn): """ Return the ID of a given Linkedin URN. Example: urn:li:fs_miniProfile:<id> """ return urn.split(":")[3]
work = True while(work): t = 2 t = t+1 work = False print(t)
class Solution(object): def countNumbersWithUniqueDigits(self, n): return self.fn(n) def fn(self,n): if n==0: return 1 if n==1: return 10 if n>10: return 0 f = 9 i = 1 while i<n and i<=10: f *= 10-i ...
def file_to_id(outfile: str) -> str: fn = outfile.split('.')[0] assert(fn.startswith('blk')) return fn[3:] def id_int_to_outfile(fid_int: int, fid_len: int) -> str: fid_s = str(fid_int) prefix = (fid_len - len(fid_s)) * '0' return f'blk{prefix+fid_s}.out' def id_int_to_chunk_id(cid_int: int) -> ...
# problem statement: Given an array, find the total number of inversions of it. If (i < j) and (A[i] > A[j]), then pair (i, j) is called an inversion of an array A. We need to count all such pairs in the array. # Function to find inversion count of a given list def findInversionCount(A): inversionCount = 0 f...
# # PySNMP MIB module BLUECOAT-SG-PROXY-MIB (http://snmplabs.com/pysmi) # ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/BLUECOAT-SG-PROXY-MIB # Produced by pysmi-0.3.4 at Mon Apr 29 17:22:43 2019 # On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4 # Using Python version 3.7.3 (def...
a = (42, 1) print(f"First value of a: {a[0]}.") # Set first value of a to 23: a[0] = 23 print(f"First value of a: {a[0]}.")
INSTAGRAM_FEED = """ [ { "comments": 2, "likes": 1, "id": "363839373298", "created": "2010-07-17 01:29:43", "caption": "", "type": "video", "tags": [ ], "user": { "username": "kevin", "full_name": "Kevin S", ...
# coding=utf-8 class RpcRequest(object): def __init__(self, method, params): self._method = method self._params = params @property def method(self): return self._method @property def params(self): return self._params @property def to_json(self): r...
# original data data = "75\n\ 95 64\n\ 17 47 82\n\ 18 35 87 10\n\ 20 04 82 47 65\n\ 19 01 23 75 03 34\n\ 88 02 77 73 07 63 67\n\ 99 65 04 28 06 16 70 92\n\ 41 41 26 56 83 40 80 70 33\n\ 41 48 72 33 47 32 37 16 94 29\n\ 53 71 44 65 25 43 91 52 97 51 14\n\ 70 11 33 28 77 73 17 78 39 68 17 57\n\ 91 71 52 38 17 14 91 43 58...
def encontra_impares(lista): if len(lista) == 0: return lista if lista[0] % 2 == 0: return encontra_impares(lista[1:]) return [lista[0]] + encontra_impares(lista[1:])
# Kth smallest element # Input: # N = 6 # arr[] = 7 10 4 3 20 15 # K = 3 # Output : 7 # Explanation : # 3rd smallest element in the given # array is 7. k = int(input()) arr = list(map(int,input().split())) arr.sort() print("\n") print("{k}th min element is : ",arr[k-1]) print("{k}th max element is : ",arr[-k])
#Class for scrapers table class Scrapers: def __init__(self, cursor): self.cursor = cursor #read from db #read all scaping jobs by progress def getScrapingJobsByProgress(cursor, progress): sql= "SELECT * from scrapers WHERE scrapers_progress=%s ORDER BY RANDOM()" data = (progress) ...
""" @name: PyHouse_Install/src/Update/update_pyhouse.py @author: D. Brian Kimmel @contact: D.BrianKimmel@gmail.com @copyright: (c) 2015-2016 by D. Brian Kimmel @license: MIT License @note: Created on Oct 20, 2015 @Summary: """ __updated__ = '2016-08-26' # Import system type stuff # Import PyHouse...
# # PySNMP MIB module TIMETRA-IF-GROUP-HANDLER-MIB (http://snmplabs.com/pysmi) # ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/TIMETRA-IF-GROUP-HANDLER-MIB # Produced by pysmi-0.3.4 at Wed May 1 15:17:53 2019 # On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4 # Using Python vers...
async def create_table(database): conn = await database.get_connection() await conn.execute( """ CREATE TABLE IF NOT EXISTS users( id serial PRIMARY KEY, name text, dob date ) """ ) await conn.close() return True async def drop_ta...
class JobResult(): def __init__(self, job, build_number, status): self.job = job self.build_number = int(build_number) self.status = status def __repr__(self): return "job: %s, build number: %s, status: %s" % (self.job, self.build_number, self.status)
# Please refer to sanitizers.gni for detail. load("@cc//:compiler.bzl", "is_linux", "is_x64") load("//third_party/chromium/build/config:buildconfig.bzl", "IS_OFFICIAL_BUILD") IS_HWASAN = False IS_CFI = is_linux() and is_x64() USE_CFI_CAST = False USE_CFI_ICALL = is_linux() and is_x64() and IS_OFFICIAL_BUILD USE_CFI_...
#3,用户任意输入他的生日,判断他输入00后,90后,还是80后 data = input("请输入你的生日:") year = int(data[0:4]) if year >= 2000 : print("你是00后阿!") elif 1990 <= year < 2000: print("你是90后阿!") elif 1980 <= year < 1990: print("你是80后阿!") else: print("你啥都不是!")
class Character: def __init__(self, health, power): self.health=health self.power=power class Hero(Character): def __init__(self): super(Hero, self).__init__(10,5) class Goblin(Character): def __init__(self): super(Goblin, self).__init__(6,2)
def findDecision(obj): #obj[0]: Coupon, obj[1]: Education, obj[2]: Occupation # {"feature": "Coupon", "instances": 8148, "metric_value": 0.4751, "depth": 1} if obj[0]>1: # {"feature": "Education", "instances": 5867, "metric_value": 0.4695, "depth": 2} if obj[1]>0: # {"feature": "Occupation", "instances": 3831,...
# -*- coding: utf-8 -*- """ Created on Fri May 15 01:14:44 2020 @author: Dilay Ercelik """ # Practice # You are driving a little too fast, and a police officer stops you. # Write code to compute the result, encoded as an int value: 0=no ticket, 1=small ticket, 2=big ticket. # If speed is 60 or less, t...
class Progress: prg = '|/-\\' prg_len = len(prg) def __init__(self, total=0): self.i = 0 self.total = total self.val = '' self.update = self._progress if total else self._spin def _spin(self): self.i %= self.prg_len self.val = self.prg[self.i] def _...
#!/usr/bin/env python3 class Code: """ The Code class contains static attributes of the (Comp)utation, (Dest)ination, and Jump codes of the Hack language. More can be found under 'assets/'. """ # Static class attributes _jump_codes = ["null", "JGT", "JEQ", "JGE", "JLT", "JNE", "JLE", "JMP"] ...
n = int(input()) def encontrarCamino(viajes,temp,camino,CaminoActual,llaves): if temp == "C-137" and CaminoActual!=0: camino.append(CaminoActual) return camino else: if temp in llaves: for i in viajes[temp]: caminos=encontrarCamino(viajes,i,camino,CaminoActua...
#Find a Motif in DNA: string = "AACTATGCAACTATGAAACTATGAACTATGATTCCAACTATGTAACTATGATGCATTAAACTATGAAACTATGAACTATGAACTATGAACTATGAAACTATGCGGAACTATGAACTATGGGGACAACTATGGAACTATGAGAACTATGTCAATTAACTATGCGTAACTATGGTCGAAACTATGAACTATGGAACTATGGCAACTATGCAAACTATGAAACTATGTAACTATGTGAAGGACGCACTAACTATGAGAAACTATGAACTATGAACTATGAACTATGCACG...
def single_number(numbers): single = 0 for number in numbers: single ^= number return single if __name__ == "__main__": numbers = [3, 4, 2, 1, 3, 1, 4] assert single_number(numbers) == 2 numbers = input("Enter list of repeated numbers: ") numbers = map(int, numbers.split()) p...
# Name - Thilakarathna W M D U # Email - dtdinidu7@gmail.com # Date - 08/04/2020 tm = int(input()) # number of test cases for t in range(1, tm+1): lis = [int(i) for i in list(input())] # taking the input as list strg = '('*lis[0] + str(lis[0]) # final string to be displayed prev = lis[0] ...
#!/usr/bin/env python3 class TokenBase(): """ Base class of all tokens """ def get_possible_words(self) -> list: """ Gets all possible words that can be made out of this token """ raise NotImplemented
# Sample untracked-keys file # If you get errors trying to 'import apikeys', do the following: # 1) Copy this file to apikeys.py (keeping it in the package directory) # 2) Replace all of the example values with real ones # 3) Generate your own cookie key, possibly using urandom as per below # You should then be able to...
# Definition for a binary tree node. # class TreeNode: # def __init__(self, x): # self.val = x # self.left = None # self.right = None class Solution: def subtreeWithAllDeepest(self, root: TreeNode) -> TreeNode: depths = [collections.defaultdict(list) for _ in range(500)] ...
""" реализация Объектов типа Tree """ class TreeObject: pass
# # PySNMP MIB module S5-CHASSIS-TRAP-MIB (http://snmplabs.com/pysmi) # ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/S5-CHASSIS-TRAP-MIB # Produced by pysmi-0.3.4 at Wed May 1 14:59:28 2019 # On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4 # Using Python version 3.7.3 (default...
class Ssl(object): FIELD_MAP = { "domain": "domain", "expires": "expires", "issuer": "issuer", "org": "org", "subject": "subject", "valid": "valid", "version": "version" } def __init__(self): self.domain = "" self.expires = "" ...
cuenta = [] for i in range(0,20): cuenta.append(i+1) print("Primeros 3 elementos en la lista") print(cuenta[slice(3)]) print() print("3 elementos del medio") print(cuenta[slice(7,10)]) print() print("ultimos 3 elementos de la lista") print(cuenta[slice(len(cuenta)-3,len(cuenta))])
# -*- coding: utf-8 -*- inputCoordInicialFinalFazenda = list(map(int, input().split())) countTest = 1 while sum(inputCoordInicialFinalFazenda) != 0: qntOcorrenciaMeteoro = int(input()) qntOcorrenciaMeteoroDentroFazenda = 0 tamanhoFazendaCoordX = abs(inputCoordInicialFinalFazenda[0] - inputCoordInicialFin...
def binary_search(items, target): """O(log n).""" low = 0 high = len(items) - 1 while low <= high: mid = (low + high) // 2 if items[mid] == target: return mid elif items[mid] < target: low = mid + 1 elif items[mid] > target: high = mi...
endPoints={ "register" : "/register", "checkKyc" : "/check_kyc", "checkHandle" : "/check_handle", "requestKyc" : "/request_kyc", "issueSila" : "/issue_sila", "redeemSila" : "/redeem_sila", "transferSila" : "/transfer_sil...
id_to_channel = {} # Official Studio Channels id_to_channel['UC2-BeLxzUBSs0uSrmzWhJuQ'] = "20th Century Fox" id_to_channel['UCor9rW6PgxSQ9vUPWQdnaYQ'] = "FoxSearchlight" id_to_channel['UCz97F7dMxBNOfGYu3rx8aCw'] = "Sony Pictues" id_to_channel['UCFqyJFbsV-uEcosvNhg0PaQ'] = "Sony Pictures India" id_to_channel['UCjmJD...
N=int(input()) v=[*map(int,input().split())] ba=ba2=-1 last=-1 dec_start=False for n,i in enumerate(v): if i>=last: if i>last: if not dec_start: ba=n else: ba2=n-1 break else: dec_start=True last=i if not dec_start: ...
class ModelManager: models = [ { 'modelPath': 'core/models/mobilenet_ssd_v1_coco/frozen_inference_graph.pb', 'configPath': 'core/models/mobilenet_ssd_v1_coco/ssd_mobilenet_v1_coco_2017_11_17.pbtxt', 'classNames': { 0: 'background', 1: 'person', 2: 'bicy...
# Space: O(n) # Time: O(n) # Solution without collections library # Definition for a binary tree node. # class TreeNode(object): # def __init__(self, val=0, left=None, right=None): # self.val = val # self.left = left # self.right = right class Solution(): def zigzagLevelOrder(self,...
# adds a and b def addNumbers(a, b): return a+b # subtracts a and b def subNumbers(a, b): return a-b
#!/usr/bin/python """ Amicable numbers https://projecteuler.net/problem=21 """ def d(n): q = [] for i in range(1, n / 2 + 1, 1): if n % i == 0: q.append(i) return sum(q) def main(): w = [] for i in range(1, 10000, 1): if i == d(d(i)) and i != d(i): print(i...
# Evaluation function CAPACITY_SCALAR = 0.25 TARGET_SCORE = 1e4 # Bed update generation TIMESTEP = 50 UPDATE_CASES = ["normal_to_corona", "corona_leaves_hosp"] BED_UPDATE_PROB = 10 # Hospitals initialization NUMBER_FREE_BEDS = 25 NUMBER_CORONA_BEDS = 5 NUMBER_FREE_CORONA_BEDS = 3 NUMBER_CORONA_PAT_IN_NORMAL_BED =...
class HttpResponseException(Exception): def __init__(self, http_response): super(HttpResponseException, self).__init__(http_response) self.http_response = http_response
User_Name=input('What is your name? ') User_Age=input('How old are you? ') User_Home=input('Where do you live? ') print('Hello, ',User_Name) print('Your age is ',User_Age) print('You live in ',User_Home)
#Valor na faixa numero = int(input('Digite um número: ')) if numero in range(1, 10): print("O valor está na faixa permitida!") else: print("O valor informado está fora da faixa!")
def funA(fn): print('A') fn() return "success" @funA def funB(): print('B') print(funB) a = funB print(a) class Category: cake=lambda p: print(p) c=Category() c.cake()
#!/usr/bin/env python #pylint: skip-file # This source code is licensed under the Apache license found in the # LICENSE file in the root directory of this project. class CertificateInfo(object): def __init__(self): """ Attributes: swaggerTypes (dict): The key is attribute name and the ...
''' Faça um pprograma que leia 5 valoes numericos e guarde-os em uma lista. No final, mostre qual foi o maior e o menor valor difitado e as suas respectrivas posiçoes na lista ''' lista = [] for i in range(5): lista.append(int(input("Diga um valor"))) if i == 0: maior = menor = lista[i] else: ...
expected_output = { 'topo_id': { '0': { 'topo_name': { 'EVPN-Multicast-BTV': { 'topo_type': 'L2VRF'}}}, '4294967294': { 'topo_name': { 'GLOBAL': { 'topo_type': 'N/A'}}}, '4294967295': { ...
num1 = int(input("Enter the first number")) num2 = int(input("Enter second number")) op = input("Enter operator") if op == " + ": print(num1+num2) elif op == "-": print("The subraction is", num1-num2) elif op == "*": print("The multiplication is ",num1*num2) elif op == "/": print("The divisi...
def add_common_params(parser): parser.add_argument( '--batch-size', type=int, default=64, help='input batch size for training (default: 64)') parser.add_argument( '--test-batch-size', type=int, default=1000, help='input batch size for testing ...
def div(a, b): if b==0: return "error" else: return a/b def add(a,b): return a+b
class Fibonacci: def __init__(self): self.memo = dict() self.memo[1] = 1 self.memo[2] = 1 def __call__(self, N): if N <= 0 or type(N) != int: raise ValueError('Invalid argument: %s' % str(N) ) if N in self.memo: return self.memo[N] els...
o = input() e = input() ans = '' for i in range(min(len(o), len(e))): ans += o[i] ans += e[i] if len(o) > len(e): ans += o[len(o) - 1] if len(o) < len(e): ans += o[len(e) - 1] print(ans)
# FOR LOOP print('This program prints all the even number upto n') n=int(input('Enter the value of n ')) for i in range(0,n): if(not i%2): print(i)
# Topics topics = { # Letter A "Amor post mortem" : ["Amor más allá de la muerte.", "Carácter eterno del amor, sentimiento que perdura después de la muerte física."] , "Amor bonus" : ["Amor bueno.", "Carácter positivo del amor espiritual."] , "Amor ferus" : ["Amor salvaje.", "Carácter negativo del amor físico, de la...
load("//:import_external.bzl", import_external = "safe_wix_scala_maven_import_external") def dependencies(): import_external( name = "org_joda_joda_convert", artifact = "org.joda:joda-convert:2.1.1", artifact_sha256 = "9b5ec53c4974be36fdf97ba026f3cec4106b8109bb9b484883c8d81c433991fb", srcjar...
sample_rate = 32000 window_size = 1024 hop_size = 500 # So that there are 64 frames per second mel_bins = 64 fmin = 50 # Hz fmax = 14000 # Hz frames_per_second = sample_rate // hop_size logmel_eps = -100 # This value indicates silence used for padding labels = ['Accelerating_and_revving_and_vroom', 'A...
def get_customized_mapping(cls): mapping = { "fda_orphan_drug": { "properties": { "designated_date": { "type": "date" }, "designation_status": { "normalizer": "keyword_lowercase_normalizer", ...
#! python3 def mapear(funcao, lista): return (funcao(elemento) for elemento in lista) if __name__ =='__main__': print(list(mapear(lambda x: x ** 2, [2, 3, 4])))
class Hand: def __init__(self, cards): self.__cards = cards self.__total = self.sum_cards(cards) def __str__(self): string = 'total: ' + str(self.total()) + ' ' for card in self.cards(): string += str(card) string += ' ' return string def add_card(self, card): self.__cards....
#!/usr/bin/env python3 # https://codeforces.com/problemset/problem/17/A def f(l): n,k = l pl = [True]*(n+1) # TRUE=prime or not? for i in range(2): pl[i] = False ll = n+1 i = 2 while i<ll: if pl[i]: #only for prime j = (i<<1) while j<...
"""Global shared constants for dart rules.""" dart_filetypes = [".dart"] api_summary_extension = "api.ds" analysis_extension = "analysis" codegen_outline_extension = "outline" WEB_PLATFORM = "web" VM_PLATFORM = "vm" FLUTTER_PLATFORM = "flutter" ALL_PLATFORMS = [WEB_PLATFORM, VM_PLATFORM, FLUTTER_PLATFORM]
# Первая строка входа содержит число операций 1≤n≤105. # Каждая из последующих n строк задают операцию одного из следующих двух типов: # # Insert x, где 0≤x≤109 — целое число; # ExtractMax. # # Первая операция добавляет число x в очередь с приоритетами, # Вторая — извлекает максимальное число и выводит его. # Sample In...
def luck_check(s): if len(s) % 2 == 1: s = s[:len(s)//2] + s[len(s)//2 + 1:] return (sum(int(i) for i in s[:len(s)//2]) == sum(int(i) for i in s[len(s)//2:]))
# This is the solution to the problem if the lines would "partition" # the containers, as physics works in real life. # This particular problem doesn't care about partitioning the water, though. HEIGHT = 0 INDEX = 1 BOUNDING_HEIGHT = 2 class Solution: ''' Given n non-negative integers a1, a2, ..., an, where ea...
def open_door(): # TODO: This needs to be in the stdlib. Driftwood.area.tilemap.layers[2].tile(4, 0).nowalk = None Driftwood.area.tilemap.layers[2].tile(4, 0).setgid(27) def open_door2(): Driftwood.area.tilemap.layers[2].tile(2, 0).nowalk = None Driftwood.area.tilemap.layers[2].tile(2, 0).setgid(2...