content
stringlengths
7
1.05M
# coding: utf-8 # In[1]: #num01_SwethaMJ.py sum_ = 0 for i in range(1,1000): if i%3==0 or i%5==0: sum_ += i print(sum_)
# M6 #2 str = 'inet addr:127.0.0.1 Mask:255.0.0.0' index = str.find(':') if index > 0: # clip off the front str1 = str[index+1:] i = str1.find(' ') addr = str1[:i].rstrip() # addr is the inet address print('Address: ', addr)
# o desconto e o total a pagar (total a pagar = total - desconto), sabendo-se que: # - Se quantidade <= 5 o desconto será de 2% # - Se quantidade > 5 e quantidade <=10 o desconto será de 3% # - Se quantidade > 10 o desconto será de 5% print('====================DESCRIÇÃO DE UM PRODUTO====================') nome_do_prod = input('Qual o nome do produto?: ') quant_adquirida = int(input('Qual foi a quantidade adquirida?: ') ) preco_unit = float(input('Qual é o preço unitário desse produto?: R$ ') ) total = preco_unit * quant_adquirida valor_a_pg = total - 0.02 valor_a_pg2 = total - 0.03 valor_a_pg3 = total - 0.05 if (quant_adquirida <=5): print('O desconto será de 2%') print('Total a pagar pelo {} : R$ {}'.format(nome_do_prod, valor_a_pg) ) # 2% do total if (quant_adquirida >5) and (quant_adquirida <=10): print('O desconto será de 3%') print('Total a pagar pelo {} : R$ {}'.format(nome_do_prod, valor_a_pg2) ) # 3% do total if (quant_adquirida >10): print('O desconto será de 5%') print('Total a pagar pelo {} : R$ {}'.format(nome_do_prod, valor_a_pg3 ) )
# (C) Datadog, Inc. 2010-2016 # All rights reserved # Licensed under Simplified BSD License (see LICENSE) class Singleton(type): _instances = {} def __call__(cls, *args, **kwargs): if cls not in cls._instances: cls._instances[cls] = super(Singleton, cls).__call__(*args, **kwargs) return cls._instances[cls]
A = ['polegar esticado vertical: afastado do indicador', 'indicador dobrado: proximo ao medio', 'medio dobrado: proximo ao anelar', 'anelar dobrado: proximo ao minimo', 'minimo dobrado: proximo ao anelar'] B = ['polegar dobrado: afastado do indicador', 'indicador esticado vertical: proximo ao medio', 'medio esticado vertical: proximo ao anelar', 'anelar esticado vertical: proximo ao minimo', 'minimo esticado vertical: proximo ao anelar'] C = ['polegar esticado horizontal: afastado do indicador', 'indicador esticado vertical: proximo ao medio', 'medio esticado vertical: proximo ao anelar', 'anelar esticado vertical: proximo ao minimo', 'minimo esticado vertical: proximo ao anelar'] D = ['polegar esticado horizontal: afastado do indicador', 'indicador esticado vertical: afastado do medio', 'medio dobrado: proximo ao anelar', 'anelar dobrado: proximo ao minimo', 'minimo dobrado: proximo ao anelar'] E = ['polegar dobrado: afastado do indicador', 'indicador dobrado: proximo ao medio', 'medio dobrado: proximo ao anelar', 'anelar dobrado: proximo ao minimo', 'minimo dobrado: proximo ao anelar'] F = ['polegar esticado vertical: proximo ao indicador', 'indicador esticado vertical: proximo ao medio', 'medio esticado vertical: afastado do anelar', 'anelar dobrado: proximo ao minimo', 'minimo dobrado: proximo ao anelar'] G = ['polegar esticado vertical: proximo ao indicador', 'indicador esticado vertical: afastado do medio', 'medio dobrado: proximo ao anelar', 'anelar dobrado: proximo ao minimo', 'minimo dobrado: proximo ao anelar'] I = ['polegar dobrado: proximo ao indicador', 'indicador dobrado: proximo ao medio', 'medio dobrado: proximo ao anelar', 'anelar dobrado: afastado do minimo', 'minimo esticado vertical: afastado do anelar'] L = ['polegar esticado vertical: afastado do indicador', 'indicador esticado vertical: afastado do medio', 'medio dobrado: proximo ao anelar', 'anelar dobrado: proximo ao minimo', 'minimo dobrado: proximo ao anelar'] M = ['polegar esticado vertical: proximo ao indicador', 'indicador esticado vertical: proximo ao medio', 'medio esticado vertical: proximo ao anelar', 'anelar esticado vertical: proximo ao minimo', 'minimo esticado vertical: proximo ao anelar'] N = ['polegar esticado horizontal: afastado do indicador', 'indicador esticado vertical: proximo ao medio', 'medio esticado vertical: afastado do anelar', 'anelar dobrado: proximo ao minimo', 'minimo dobrado: proximo ao anelar'] O = ['polegar esticado horizontal: afastado do indicador', 'indicador dobrado: proximo ao medio', 'medio dobrado: proximo ao anelar', 'anelar dobrado: proximo ao minimo', 'minimo dobrado: proximo ao anelar'] P = ['polegar esticado vertical: afastado do indicador', 'indicador esticado vertical: afastado do medio', 'medio esticado vertical: afastado do anelar', 'anelar dobrado: proximo ao minimo', 'minimo dobrado: proximo ao anelar'] Q = ['polegar esticado vertical: afastado do indicador', 'indicador esticado vertical: afastado do medio', 'medio dobrado: proximo ao anelar', 'anelar dobrado: afastado do minimo', 'minimo esticado vertical: afastado do anelar'] R = ['polegar dobrado: afastado do indicador', 'indicador esticado vertical: proximo ao medio', 'medio esticado vertical: afastado do anelar', 'anelar dobrado: proximo ao minimo', 'minimo dobrado: proximo ao anelar'] S = ['polegar dobrado: proximo ao indicador', 'indicador dobrado: proximo ao medio', 'medio dobrado: proximo ao anelar', 'anelar dobrado: proximo ao minimo', 'minimo dobrado: proximo ao anelar'] T = ['polegar esticado horizontal: afastado do indicador', 'indicador dobrado: afastado do medio', 'medio esticado vertical: proximo ao anelar', 'anelar esticado vertical: proximo ao minimo', 'minimo esticado vertical: proximo ao anelar'] U = ['polegar esticado horizontal: afastado do indicador', 'indicador esticado vertical: proximo ao medio', 'medio esticado vertical: afastado do anelar', 'anelar dobrado: proximo ao minimo', 'minimo dobrado: proximo ao anelar'] V = ['polegar esticado horizontal: afastado do indicador', 'indicador esticado vertical: afastado do medio', 'medio esticado vertical: afastado do anelar', 'anelar dobrado: proximo ao minimo', 'minimo dobrado: proximo ao anelar'] W = ['polegar esticado horizontal: afastado do indicador', 'indicador esticado vertical: afastado do medio', 'medio esticado vertical: proximo ao anelar', 'anelar esticado vertical: afastado do minimo', 'minimo dobrado: afastado do anelar'] letras = [A, B, C, D, E, F, G, I, L, M, N, O, P, Q, R, S, T, U, V, W] # não foram usadas as letras: H, J, K, X, ,Y , Z # devido ao movimento adicional para a execução correta das letras. # Estas letras podem ser analisadas em uma função diferente, semelhante a função de # análise de posicionamento do corpo, onde comparamos a transição entre pontos # Letra T: para o dedo polegar, devido a estar sobreposto pelo dedo indicador, o algoritmo não reconhece os pontos da ponta do dedo # Letra N e U se confundem
#set a=set() #a={}でも初期化可能 x=1 a.add(x) if x in a: print(x) a.remove(x)
class Solution: def romanToInt(self, s: str) -> int: dic = {"I":1,"V":5,"X":10,"L":50,"C":100,"D":500,"M":1000} res = 0 while s: letter = s[0] if len(s)==1: res+=dic[letter] return res if dic[letter]>=dic[s[1]]: res+=dic[letter] s = s[1:] elif dic[letter]<dic[s[1]]: res +=dic[s[1]]-dic[letter] s=s[2:] return res
class blank (object): def __init__ (self): object.__init__ (self) deployment_settings = blank () # Web2py Settings deployment_settings.web2py = blank () deployment_settings.web2py.port = 8000 # Database settings deployment_settings.database = blank () deployment_settings.database.db_type = "sqlite" deployment_settings.database.host = "localhost" deployment_settings.database.port = None # use default deployment_settings.database.database = "healthscapes" deployment_settings.database.username = "hs" deployment_settings.database.password = "hs" deployment_settings.database.pool_size = 30 # MongoDB Settings deployment_settings.mongodb = blank () deployment_settings.mongodb.host = None deployment_settings.mongodb.port = 27017 deployment_settings.mongodb.db = 'mongo_db' deployment_settings.mongodb.username = 'mongo' deployment_settings.mongodb.password = 'mongo' # PostGIS Settings deployment_settings.postgis = blank () deployment_settings.postgis.host = None deployment_settings.postgis.port = 5432 deployment_settings.postgis.database = "geodata" deployment_settings.postgis.username = "postgis" deployment_settings.postgis.password = "postgis" deployment_settings.postgis.pool_size = 10 deployment_settings.geoserver_sources = [] # Upload Geoserver Settings deployment_settings.geoserver = blank () deployment_settings.geoserver.host = 'http://localhost' deployment_settings.geoserver.port = 8888 deployment_settings.geoserver.username = "admin" deployment_settings.geoserver.password = "geoserver" deployment_settings.geoserver.workspace = 'hsd' deployment_settings.geoserver.pgis_store = 'test' # NPR Settings deployment_settings.npr = blank () deployment_settings.npr.key = 'MDA2OTc4ODY2MDEyOTc0NTMyMjFmZGNjZg001' deployment_settings.data = blank () deployment_settings.data.base_table = 'datatypes' # Development Mode deployment_settings.dev_mode = blank () deployment_settings.dev_mode.enabled = False deployment_settings.dev_mode.firstname = 'First' deployment_settings.dev_mode.lastname = 'Last' deployment_settings.dev_mode.email = 'fake@gmail.com' # ExtJS Settings deployment_settings.extjs = blank () deployment_settings.extjs.location = 'http://skapes.org/media/js/ext'
def insertion_sort(to_sort): i=0 while i <= len(to_sort)-1: hole = i; item = to_sort[i] while hole > 0 and to_sort[hole-1] > item: to_sort[hole] = to_sort[hole-1] hole-=1 to_sort[hole] = item i+=1 return to_sort
load_modules = { 'hw_USBtin': {'port':'auto', 'speed':500}, # IO hardware module # Module for sniff and replay 'mod_stat': {"bus":'mod_stat','debug':2},'mod_stat~2': {"bus":'mod_stat'}, 'mod_firewall': {}, 'mod_fuzz1':{'debug':2}, 'gen_replay': {'debug': 1}# Stats } # Now let's describe the logic of this test actions = [ {'hw_USBtin': {'action': 'read','pipe': 1}}, # Read to PIPE 1 {'mod_stat': {'pipe': 1}}, # Write generated packets (pings) {'mod_firewall': {'white_bus': ["mod_stat"]}}, {'gen_replay': {}}, {'mod_stat~2': {'pipe': 1}}, {'hw_USBtin': {'action': 'write','pipe': 1}}, ]
def dragon_lives_for(sequence): dragon_size = 50 sheep = 0 squeezed_for = 0 days = 0 while True: sheep += sequence.pop(0) if dragon_size <= sheep: sheep -= dragon_size dragon_size += 1 squeezed_for = 0 else: sheep = 0 dragon_size -= 1 squeezed_for += 1 if squeezed_for >= 5: return days days += 1 def test_dragon_lives_for(): assert dragon_lives_for([50, 52, 52, 49, 50, 47, 45, 43, 50, 55]) == 7 if __name__ == '__main__': with open('input/01') as f: l = [int(v) for v in f.read().split(', ')] print(dragon_lives_for(l))
# -*- coding: utf-8 -*- # ----------------------------------------------------------- # Copyright (C) 2009 StatPro Italia s.r.l. # # StatPro Italia # Via G. B. Vico 4 # I-20123 Milano # ITALY # # phone: +39 02 96875 1 # fax: +39 02 96875 605 # # email: info@riskmap.net # # This program is distributed in the hope that it will be # useful, but WITHOUT ANY WARRANTY; without even the # warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR # PURPOSE. See the license for more details. # ----------------------------------------------------------- # # Author: Enrico Sirola <enrico.sirola@statpro.com> # $Id$ """drmaa constants""" # drmaa_get_attribute() ATTR_BUFFER = 1024 # drmaa_get_contact() CONTACT_BUFFER = 1024 # drmaa_get_DRM_system() DRM_SYSTEM_BUFFER = 1024 # drmaa_get_DRM_system() DRMAA_IMPLEMENTATION_BUFFER = 1024 # Agreed buffer length constants # these are recommended minimum values ERROR_STRING_BUFFER = 1024 JOBNAME_BUFFER = 1024 SIGNAL_BUFFER = 32 # Agreed constants TIMEOUT_WAIT_FOREVER = -1 TIMEOUT_NO_WAIT = 0 JOB_IDS_SESSION_ANY = "DRMAA_JOB_IDS_SESSION_ANY" JOB_IDS_SESSION_ALL = "DRMAA_JOB_IDS_SESSION_ALL" SUBMISSION_STATE_ACTIVE = "drmaa_active" SUBMISSION_STATE_HOLD = "drmaa_hold" # Agreed placeholder names PLACEHOLDER_INCR = "$drmaa_incr_ph$" PLACEHOLDER_HD = "$drmaa_hd_ph$" PLACEHOLDER_WD = "$drmaa_wd_ph$" # Agreed names of job template attributes REMOTE_COMMAND = "drmaa_remote_command" JS_STATE = "drmaa_js_state" WD = "drmaa_wd" JOB_CATEGORY = "drmaa_job_category" NATIVE_SPECIFICATION = "drmaa_native_specification" BLOCK_EMAIL = "drmaa_block_email" START_TIME = "drmaa_start_time" JOB_NAME = "drmaa_job_name" INPUT_PATH = "drmaa_input_path" OUTPUT_PATH = "drmaa_output_path" ERROR_PATH = "drmaa_error_path" JOIN_FILES = "drmaa_join_files" TRANSFER_FILES = "drmaa_transfer_files" DEADLINE_TIME = "drmaa_deadline_time" WCT_HLIMIT = "drmaa_wct_hlimit" WCT_SLIMIT = "drmaa_wct_slimit" DURATION_HLIMIT = "drmaa_duration_hlimit" DURATION_SLIMIT = "drmaa_duration_slimit" # names of job template vector attributes V_ARGV = "drmaa_v_argv" V_ENV = "drmaa_v_env" V_EMAIL = "drmaa_v_email" NO_MORE_ELEMENTS = 25 def job_state(code): return _JOB_PS[code] class JobState(object): UNDETERMINED = 'undetermined' QUEUED_ACTIVE = 'queued_active' SYSTEM_ON_HOLD = 'system_on_hold' USER_ON_HOLD = 'user_on_hold' USER_SYSTEM_ON_HOLD = 'user_system_on_hold' RUNNING = 'running' SYSTEM_SUSPENDED = 'system_suspended' USER_SUSPENDED = 'user_suspended' USER_SYSTEM_SUSPENDED = 'user_system_suspended' DONE = 'done' FAILED = 'failed' # Job control action class JobControlAction(object): SUSPEND = 'suspend' RESUME = 'resume' HOLD = 'hold' RELEASE = 'release' TERMINATE = 'terminate' _JOB_CONTROL = [ JobControlAction.SUSPEND, JobControlAction.RESUME, JobControlAction.HOLD, JobControlAction.RELEASE, JobControlAction.TERMINATE ] def string_to_control_action(operation): return _JOB_CONTROL.index(operation) def control_action_to_string(code): return _JOB_CONTROL[code] def status_to_string(status): return _JOB_PS[status] _JOB_PS = { 0x00: JobState.UNDETERMINED, 0x10: JobState.QUEUED_ACTIVE, 0x11: JobState.SYSTEM_ON_HOLD, 0x12: JobState.USER_ON_HOLD, 0x13: JobState.USER_SYSTEM_ON_HOLD, 0x20: JobState.RUNNING, 0x21: JobState.SYSTEM_SUSPENDED, 0x22: JobState.USER_SUSPENDED, 0x23: JobState.USER_SYSTEM_SUSPENDED, 0x30: JobState.DONE, 0x40: JobState.FAILED, } # State at submission time class JobSubmissionState(object): HOLD_STATE = SUBMISSION_STATE_HOLD ACTIVE_STATE = SUBMISSION_STATE_ACTIVE _SUBMISSION_STATE = [ JobSubmissionState.HOLD_STATE, JobSubmissionState.ACTIVE_STATE ] def submission_state(code): return _SUBMISSION_STATE[code]
load("//tools/bzl:maven_jar.bzl", "maven_jar") def external_plugin_deps(): AUTO_VALUE_VERSION = "1.7.4" maven_jar( name = "auto-value", artifact = "com.google.auto.value:auto-value:" + AUTO_VALUE_VERSION, sha1 = "6b126cb218af768339e4d6e95a9b0ae41f74e73d", ) maven_jar( name = "auto-value-annotations", artifact = "com.google.auto.value:auto-value-annotations:" + AUTO_VALUE_VERSION, sha1 = "eff48ed53995db2dadf0456426cc1f8700136f86", )
# -*- coding: utf-8 -*- class AzureShellCache: __inst = None __cache = {} @staticmethod def Instance(): if AzureShellCache.__inst == None: AzureShellCache() return AzureShellCache.__inst def __init__(self): if AzureShellCache.__inst != None: raise Exception("This must not be called!!") AzureShellCache.__inst = self def set(self, k, v): self.__cache[k] = v def get(self, k): return self.__cache.get(k)
solutions = [] maxAllowed = 10**1000 value = 1 base = 1 while value * value <= maxAllowed: while value < base * 10: solutions.append(value) value += base base = value solutions.append(value) while True: num = int(input()) if num == 0: break # Binary search # start is inclusive, end is not start = 0 end = len(solutions) while start + 1 < end: middle = (start + end) // 2 # Too high if solutions[middle] * solutions[middle] > num: end = middle else: start = middle; print(solutions[start])
# template_parsetab.py # This file is automatically generated. Do not edit. # pylint: disable=W,C,R _tabversion = '3.10' _lr_method = 'LALR' _lr_signature = 'template_validateALL ARROW ARROWPARENS ARROW_PRE ASSIGN ASSIGNBAND ASSIGNBOR ASSIGNBXOR ASSIGNDIVIDE ASSIGNLLSHIFT ASSIGNLSHIFT ASSIGNMINUS ASSIGNMOD ASSIGNPLUS ASSIGNRRSHIFT ASSIGNRSHIFT ASSIGNTIMES AWAIT BACKSLASH BAND BITINV BNEGATE BOR BREAK BXOR BYTE CASE CATCH CHAR CLASS CLOSECOM COLON COMMA COMMENT COND_DOT CONST CONTINUE DEC DEFAULT DELETE DIVIDE DO DOT DOUBLE ELSE EMPTYLINE EQUAL EQUAL_STRICT EXPONENT EXPORT EXTENDS FINALLY FOR FROM FUNCTION GET GLOBAL GTHAN GTHANEQ ID IF IMPORT IN INC INFERRED INSTANCEOF LAND LBRACKET LET LLSHIFT LOR LPAREN LSBRACKET LSHIFT LTHAN LTHANEQ MINUS MLSTRLIT MOD NATIVE NEW NOT NOTEQUAL NOTEQUAL_STRICT NUMBER OF OPENCOM PLUS QEST RBRACKET REGEXPR RETURN RPAREN RRSHIFT RSBRACKET RSHIFT SEMI SET SHORT SIGNED SLASHR STATIC STRINGLIT SWITCH TEMPLATE TEMPLATE_STR TGTHAN THROW TIMES TLTHAN TRIPLEDOT TRY TYPED TYPEOF VAR VARIABLE VAR_TYPE_PREC WHILE WITH YIELD newlinelthan : LTHAN\n | TLTHAN\n gthan : GTHAN\n | TGTHAN\n id : ID\n | GET\n | SET\n | STATIC\n | CATCH\n | GLOBAL\n | AWAIT\n left_id : id id_opt : id\n |\n id_var_type : id \n id_var_decl : id \n var_type : var_type id_var_type\n | id_var_type\n | SHORT\n | DOUBLE\n | CHAR\n | BYTE\n | INFERRED\n | var_type template_ref\n \n templatedeflist : var_type\n | var_type ASSIGN var_type\n | templatedeflist COMMA var_type\n | templatedeflist COMMA var_type ASSIGN var_type\n template : lthan templatedeflist gthan\n typeof_opt : TYPEOF\n |\n \n simple_templatedeflist : typeof_opt var_type\n | simple_templatedeflist COMMA typeof_opt var_type\n template_ref : lthan simple_templatedeflist gthan\n template_ref_validate : lthan simple_templatedeflist gthan\n template_validate : template\n | template_ref_validate\n ' _lr_action_items = {'LTHAN':([0,9,11,12,13,14,15,16,18,19,20,21,22,23,24,25,28,29,33,34,36,37,39,42,43,44,],[5,5,-18,-19,-20,-21,-22,-23,-15,-5,-6,-7,-8,-9,-10,-11,-3,-4,-17,-24,5,5,5,5,-34,5,]),'TLTHAN':([0,9,11,12,13,14,15,16,18,19,20,21,22,23,24,25,28,29,33,34,36,37,39,42,43,44,],[6,6,-18,-19,-20,-21,-22,-23,-15,-5,-6,-7,-8,-9,-10,-11,-3,-4,-17,-24,6,6,6,6,-34,6,]),'$end':([1,2,3,26,28,29,30,],[0,-36,-37,-29,-3,-4,-35,]),'SHORT':([4,5,6,10,17,27,31,32,35,38,41,],[12,-1,-2,12,-30,12,-31,12,-31,12,12,]),'DOUBLE':([4,5,6,10,17,27,31,32,35,38,41,],[13,-1,-2,13,-30,13,-31,13,-31,13,13,]),'CHAR':([4,5,6,10,17,27,31,32,35,38,41,],[14,-1,-2,14,-30,14,-31,14,-31,14,14,]),'BYTE':([4,5,6,10,17,27,31,32,35,38,41,],[15,-1,-2,15,-30,15,-31,15,-31,15,15,]),'INFERRED':([4,5,6,10,17,27,31,32,35,38,41,],[16,-1,-2,16,-30,16,-31,16,-31,16,16,]),'TYPEOF':([4,5,6,31,35,],[17,-1,-2,17,17,]),'ID':([4,5,6,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,27,28,29,31,32,33,34,35,36,37,38,39,41,42,43,44,],[19,-1,-2,19,19,-18,-19,-20,-21,-22,-23,-30,-15,-5,-6,-7,-8,-9,-10,-11,19,-3,-4,-31,19,-17,-24,-31,19,19,19,19,19,19,-34,19,]),'GET':([4,5,6,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,27,28,29,31,32,33,34,35,36,37,38,39,41,42,43,44,],[20,-1,-2,20,20,-18,-19,-20,-21,-22,-23,-30,-15,-5,-6,-7,-8,-9,-10,-11,20,-3,-4,-31,20,-17,-24,-31,20,20,20,20,20,20,-34,20,]),'SET':([4,5,6,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,27,28,29,31,32,33,34,35,36,37,38,39,41,42,43,44,],[21,-1,-2,21,21,-18,-19,-20,-21,-22,-23,-30,-15,-5,-6,-7,-8,-9,-10,-11,21,-3,-4,-31,21,-17,-24,-31,21,21,21,21,21,21,-34,21,]),'STATIC':([4,5,6,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,27,28,29,31,32,33,34,35,36,37,38,39,41,42,43,44,],[22,-1,-2,22,22,-18,-19,-20,-21,-22,-23,-30,-15,-5,-6,-7,-8,-9,-10,-11,22,-3,-4,-31,22,-17,-24,-31,22,22,22,22,22,22,-34,22,]),'CATCH':([4,5,6,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,27,28,29,31,32,33,34,35,36,37,38,39,41,42,43,44,],[23,-1,-2,23,23,-18,-19,-20,-21,-22,-23,-30,-15,-5,-6,-7,-8,-9,-10,-11,23,-3,-4,-31,23,-17,-24,-31,23,23,23,23,23,23,-34,23,]),'GLOBAL':([4,5,6,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,27,28,29,31,32,33,34,35,36,37,38,39,41,42,43,44,],[24,-1,-2,24,24,-18,-19,-20,-21,-22,-23,-30,-15,-5,-6,-7,-8,-9,-10,-11,24,-3,-4,-31,24,-17,-24,-31,24,24,24,24,24,24,-34,24,]),'AWAIT':([4,5,6,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,27,28,29,31,32,33,34,35,36,37,38,39,41,42,43,44,],[25,-1,-2,25,25,-18,-19,-20,-21,-22,-23,-30,-15,-5,-6,-7,-8,-9,-10,-11,25,-3,-4,-31,25,-17,-24,-31,25,25,25,25,25,25,-34,25,]),'COMMA':([7,8,9,11,12,13,14,15,16,18,19,20,21,22,23,24,25,28,29,33,34,36,37,39,40,42,43,44,],[27,31,-25,-18,-19,-20,-21,-22,-23,-15,-5,-6,-7,-8,-9,-10,-11,-3,-4,-17,-24,-32,-27,-26,31,-33,-34,-28,]),'GTHAN':([7,8,9,11,12,13,14,15,16,18,19,20,21,22,23,24,25,28,29,33,34,36,37,39,40,42,43,44,],[28,28,-25,-18,-19,-20,-21,-22,-23,-15,-5,-6,-7,-8,-9,-10,-11,-3,-4,-17,-24,-32,-27,-26,28,-33,-34,-28,]),'TGTHAN':([7,8,9,11,12,13,14,15,16,18,19,20,21,22,23,24,25,28,29,33,34,36,37,39,40,42,43,44,],[29,29,-25,-18,-19,-20,-21,-22,-23,-15,-5,-6,-7,-8,-9,-10,-11,-3,-4,-17,-24,-32,-27,-26,29,-33,-34,-28,]),'ASSIGN':([9,11,12,13,14,15,16,18,19,20,21,22,23,24,25,28,29,33,34,37,43,],[32,-18,-19,-20,-21,-22,-23,-15,-5,-6,-7,-8,-9,-10,-11,-3,-4,-17,-24,41,-34,]),} _lr_action = {} for _k, _v in _lr_action_items.items(): for _x,_y in zip(_v[0],_v[1]): if not _x in _lr_action: _lr_action[_x] = {} _lr_action[_x][_k] = _y del _lr_action_items _lr_goto_items = {'template_validate':([0,],[1,]),'template':([0,],[2,]),'template_ref_validate':([0,],[3,]),'lthan':([0,9,36,37,39,42,44,],[4,35,35,35,35,35,35,]),'templatedeflist':([4,],[7,]),'simple_templatedeflist':([4,35,],[8,40,]),'var_type':([4,10,27,32,38,41,],[9,36,37,39,42,44,]),'typeof_opt':([4,31,35,],[10,38,10,]),'id_var_type':([4,9,10,27,32,36,37,38,39,41,42,44,],[11,33,11,11,11,33,33,11,33,11,33,33,]),'id':([4,9,10,27,32,36,37,38,39,41,42,44,],[18,18,18,18,18,18,18,18,18,18,18,18,]),'gthan':([7,8,40,],[26,30,43,]),'template_ref':([9,36,37,39,42,44,],[34,34,34,34,34,34,]),} _lr_goto = {} for _k, _v in _lr_goto_items.items(): for _x, _y in zip(_v[0], _v[1]): if not _x in _lr_goto: _lr_goto[_x] = {} _lr_goto[_x][_k] = _y del _lr_goto_items _lr_productions = [ ("S' -> template_validate","S'",1,None,None,None), ('lthan -> LTHAN','lthan',1,'p_lthan','js_parse_template.py',12), ('lthan -> TLTHAN','lthan',1,'p_lthan','js_parse_template.py',13), ('gthan -> GTHAN','gthan',1,'p_gthan','js_parse_template.py',18), ('gthan -> TGTHAN','gthan',1,'p_gthan','js_parse_template.py',19), ('id -> ID','id',1,'p_id','js_parse_template.py',24), ('id -> GET','id',1,'p_id','js_parse_template.py',25), ('id -> SET','id',1,'p_id','js_parse_template.py',26), ('id -> STATIC','id',1,'p_id','js_parse_template.py',27), ('id -> CATCH','id',1,'p_id','js_parse_template.py',28), ('id -> GLOBAL','id',1,'p_id','js_parse_template.py',29), ('id -> AWAIT','id',1,'p_id','js_parse_template.py',30), ('left_id -> id','left_id',1,'p_left_id','js_parse_template.py',35), ('id_opt -> id','id_opt',1,'p_id_opt','js_parse_template.py',39), ('id_opt -> <empty>','id_opt',0,'p_id_opt','js_parse_template.py',40), ('id_var_type -> id','id_var_type',1,'p_id_var_type','js_parse_template.py',46), ('id_var_decl -> id','id_var_decl',1,'p_id_var_decl','js_parse_template.py',51), ('var_type -> var_type id_var_type','var_type',2,'p_var_type','js_parse_template.py',56), ('var_type -> id_var_type','var_type',1,'p_var_type','js_parse_template.py',57), ('var_type -> SHORT','var_type',1,'p_var_type','js_parse_template.py',58), ('var_type -> DOUBLE','var_type',1,'p_var_type','js_parse_template.py',59), ('var_type -> CHAR','var_type',1,'p_var_type','js_parse_template.py',60), ('var_type -> BYTE','var_type',1,'p_var_type','js_parse_template.py',61), ('var_type -> INFERRED','var_type',1,'p_var_type','js_parse_template.py',62), ('var_type -> var_type template_ref','var_type',2,'p_var_type','js_parse_template.py',63), ('templatedeflist -> var_type','templatedeflist',1,'p_templatedeflist','js_parse_template.py',69), ('templatedeflist -> var_type ASSIGN var_type','templatedeflist',3,'p_templatedeflist','js_parse_template.py',70), ('templatedeflist -> templatedeflist COMMA var_type','templatedeflist',3,'p_templatedeflist','js_parse_template.py',71), ('templatedeflist -> templatedeflist COMMA var_type ASSIGN var_type','templatedeflist',5,'p_templatedeflist','js_parse_template.py',72), ('template -> lthan templatedeflist gthan','template',3,'p_template','js_parse_template.py',77), ('typeof_opt -> TYPEOF','typeof_opt',1,'p_typeof_opt','js_parse_template.py',82), ('typeof_opt -> <empty>','typeof_opt',0,'p_typeof_opt','js_parse_template.py',83), ('simple_templatedeflist -> typeof_opt var_type','simple_templatedeflist',2,'p_simple_templatedeflist','js_parse_template.py',93), ('simple_templatedeflist -> simple_templatedeflist COMMA typeof_opt var_type','simple_templatedeflist',4,'p_simple_templatedeflist','js_parse_template.py',94), ('template_ref -> lthan simple_templatedeflist gthan','template_ref',3,'p_template_ref','js_parse_template.py',99), ('template_ref_validate -> lthan simple_templatedeflist gthan','template_ref_validate',3,'p_template_ref_validate','js_parse_template.py',104), ('template_validate -> template','template_validate',1,'p_template_validate','js_parse_template.py',109), ('template_validate -> template_ref_validate','template_validate',1,'p_template_validate','js_parse_template.py',110), ]
def f(): print('f executed from module 1') if __name__ == '__main__': print('We are in module 1')
class ParserError(Exception): """ Base parser exception class. Throws when any error occurs. """ pass
n=int(input("Enter a number : ")) r=int(input("Enter range of table : ")) print("Multiplication Table of",n,"is") for i in range(0,r): i=i+1 print(n,"X",i,"=",n*i) print("Loop completed")
PRACTICE = False N_DAYS = 80 with open("test.txt" if PRACTICE else "input.txt", "r") as f: content = f.read().strip() state = list(map(int, content.split(","))) def next_day(state): new_state = [] num_new = 0 for fish in state: if fish == 0: new_state.append(6) num_new += 1 else: new_state.append(fish - 1) return new_state + [8] * num_new for days in range(N_DAYS): state = next_day(state) # print("After {:2} days: ".format(days + 1) + ",".join(map(str, state))) print(len(state))
# This program says hello print("Hello World!") # Ask the user to input their name and assign it to the name variable print("What is your name? ") myName = input() # Print out greet followed by name print("It is good to meet you, " + myName) # Print out the length of the name print("The length of your name " + str(len(myName))) # Ask for your age and show how old you will be next year print("What is your age?") myAge = input() print("You will be " + str(int(myAge)+1) + "in a year. ")
N = int(input()) x, y = 0, 0 for _ in range(N): T, S = input().split() T = int(T) x += min(int(12 * T / 1000), len(S)) y += max(len(S) - int(12 * T / 1000), 0) print(x, y)
# -*- coding: utf-8 -*- # tomolab # Michele Scipioni # Harvard University, Martinos Center for Biomedical Imaging # University of Pisa LIGHT_BLUE = "rgb(200,228,246)" BLUE = "rgb(47,128,246)" LIGHT_RED = "rgb(246,228,200)" RED = "rgb(246,128,47)" LIGHT_GRAY = "rgb(246,246,246)" GRAY = "rgb(200,200,200)" GREEN = "rgb(0,100,0)"
__all__ = [ 'manager', \ 'node', \ 'feature', \ 'python_utils' ]
TEST_LAT=-12 TEST_LONG=60 TEST_LOCATION_HIERARCHY_FOR_GEO_CODE=['madagascar'] class DummyLocationTree(object): def get_location_hierarchy_for_geocode(self, lat, long ): return TEST_LOCATION_HIERARCHY_FOR_GEO_CODE def get_centroid(self, location_name, level): if location_name=="jalgaon" and level==2: return None return TEST_LONG, TEST_LAT def get_location_hierarchy(self,lowest_level_location_name): if lowest_level_location_name=='pune': return ['pune','mh','india']
#Escreva um programa que leia dois números inteiros e compare-os. mostrando na tela uma mensagem: while True: try: n1 = int(input('Primeiro número: ')) n2 = int(input('Segundo número: ')) except: print('Entrada inválida, digite apenas números inteiros! Tente novamente...') else: break if n1 > n2: print('O PRIMEIRO valor é o maior!') elif n1 == n2: print('Os valores são IGUAIS!') else: print('O Segundo valor é o maior!')
# # PySNMP MIB module HUAWEI-PGI-MIB (http://snmplabs.com/pysmi) # ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/HUAWEI-PGI-MIB # Produced by pysmi-0.3.4 at Mon Apr 29 19:35:58 2019 # On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4 # Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15) # OctetString, Integer, ObjectIdentifier = mibBuilder.importSymbols("ASN1", "OctetString", "Integer", "ObjectIdentifier") NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues") SingleValueConstraint, ConstraintsIntersection, ValueSizeConstraint, ConstraintsUnion, ValueRangeConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "SingleValueConstraint", "ConstraintsIntersection", "ValueSizeConstraint", "ConstraintsUnion", "ValueRangeConstraint") hwDatacomm, = mibBuilder.importSymbols("HUAWEI-MIB", "hwDatacomm") ModuleCompliance, ObjectGroup, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "ObjectGroup", "NotificationGroup") Counter64, Gauge32, Integer32, TimeTicks, MibScalar, MibTable, MibTableRow, MibTableColumn, ObjectIdentity, iso, ModuleIdentity, MibIdentifier, Bits, Unsigned32, Counter32, IpAddress, NotificationType = mibBuilder.importSymbols("SNMPv2-SMI", "Counter64", "Gauge32", "Integer32", "TimeTicks", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "ObjectIdentity", "iso", "ModuleIdentity", "MibIdentifier", "Bits", "Unsigned32", "Counter32", "IpAddress", "NotificationType") DisplayString, RowStatus, TextualConvention = mibBuilder.importSymbols("SNMPv2-TC", "DisplayString", "RowStatus", "TextualConvention") hwPortGroupIsolation = ModuleIdentity((1, 3, 6, 1, 4, 1, 2011, 5, 25, 144)) if mibBuilder.loadTexts: hwPortGroupIsolation.setLastUpdated('200701010000Z') if mibBuilder.loadTexts: hwPortGroupIsolation.setOrganization('Huawei Technologies Co. Ltd.') hwPortGroupIsolationMibObjects = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 144, 1)) hwPortGroupIsolationConfigTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 5, 25, 144, 1, 1), ) if mibBuilder.loadTexts: hwPortGroupIsolationConfigTable.setStatus('current') hwPortGroupIsolationConfigEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 5, 25, 144, 1, 1, 1), ).setIndexNames((0, "HUAWEI-PGI-MIB", "hwPortGroupIsolationIndex")) if mibBuilder.loadTexts: hwPortGroupIsolationConfigEntry.setStatus('current') hwPortGroupIsolationIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 144, 1, 1, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 1024))) if mibBuilder.loadTexts: hwPortGroupIsolationIndex.setStatus('current') hwPortGroupIsolationIfName = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 144, 1, 1, 1, 11), OctetString().subtype(subtypeSpec=ValueSizeConstraint(0, 255))).setMaxAccess("readcreate") if mibBuilder.loadTexts: hwPortGroupIsolationIfName.setStatus('current') hwPortGroupIsolationGroupID = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 144, 1, 1, 1, 12), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 255))).setMaxAccess("readcreate") if mibBuilder.loadTexts: hwPortGroupIsolationGroupID.setStatus('current') hwPortGroupIsolationConfigRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 5, 25, 144, 1, 1, 1, 51), RowStatus()).setMaxAccess("readcreate") if mibBuilder.loadTexts: hwPortGroupIsolationConfigRowStatus.setStatus('current') hwPortGroupIsolationConformance = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 144, 3)) hwPortGroupIsolationCompliances = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 144, 3, 1)) hwPortGroupIsolationCompliance = ModuleCompliance((1, 3, 6, 1, 4, 1, 2011, 5, 25, 144, 3, 1, 1)).setObjects(("HUAWEI-PGI-MIB", "hwPortGroupIsolationObjectGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): hwPortGroupIsolationCompliance = hwPortGroupIsolationCompliance.setStatus('current') hwPortGroupIsolationGroups = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 5, 25, 144, 3, 3)) hwPortGroupIsolationObjectGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 2011, 5, 25, 144, 3, 3, 1)).setObjects(("HUAWEI-PGI-MIB", "hwPortGroupIsolationIfName"), ("HUAWEI-PGI-MIB", "hwPortGroupIsolationGroupID"), ("HUAWEI-PGI-MIB", "hwPortGroupIsolationConfigRowStatus")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): hwPortGroupIsolationObjectGroup = hwPortGroupIsolationObjectGroup.setStatus('current') mibBuilder.exportSymbols("HUAWEI-PGI-MIB", PYSNMP_MODULE_ID=hwPortGroupIsolation, hwPortGroupIsolation=hwPortGroupIsolation, hwPortGroupIsolationIfName=hwPortGroupIsolationIfName, hwPortGroupIsolationCompliance=hwPortGroupIsolationCompliance, hwPortGroupIsolationConformance=hwPortGroupIsolationConformance, hwPortGroupIsolationConfigTable=hwPortGroupIsolationConfigTable, hwPortGroupIsolationIndex=hwPortGroupIsolationIndex, hwPortGroupIsolationGroups=hwPortGroupIsolationGroups, hwPortGroupIsolationConfigEntry=hwPortGroupIsolationConfigEntry, hwPortGroupIsolationMibObjects=hwPortGroupIsolationMibObjects, hwPortGroupIsolationObjectGroup=hwPortGroupIsolationObjectGroup, hwPortGroupIsolationGroupID=hwPortGroupIsolationGroupID, hwPortGroupIsolationCompliances=hwPortGroupIsolationCompliances, hwPortGroupIsolationConfigRowStatus=hwPortGroupIsolationConfigRowStatus)
class Solution: def frequencySort(self, s: str) -> str: freq = {} for ch in s: if(ch in freq): freq[ch] += 1 else: freq[ch] = 1 out = "" for k,v in sorted(freq.items(), key=lambda x: x[1], reverse=True): out += (k * v) return out
psys_game_rain = 0 psys_game_snow = 1 psys_game_blood = 2 psys_game_blood_2 = 3 psys_game_hoof_dust = 4 psys_game_hoof_dust_mud = 5 psys_game_water_splash_1 = 6 psys_game_water_splash_2 = 7 psys_game_water_splash_3 = 8 psys_torch_fire = 9 psys_fire_glow_1 = 10 psys_fire_glow_fixed = 11 psys_torch_smoke = 12 psys_flue_smoke_short = 13 psys_flue_smoke_tall = 14 psys_war_smoke_tall = 15 psys_ladder_dust_6m = 16 psys_ladder_dust_8m = 17 psys_ladder_dust_10m = 18 psys_ladder_dust_12m = 19 psys_ladder_dust_14m = 20 psys_ladder_straw_6m = 21 psys_ladder_straw_8m = 22 psys_ladder_straw_10m = 23 psys_ladder_straw_12m = 24 psys_ladder_straw_14m = 25 psys_torch_fire_sparks = 26 psys_fire_sparks_1 = 27 psys_pistol_smoke = 28 psys_brazier_fire_1 = 29 psys_cooking_fire_1 = 30 psys_cooking_smoke = 31 psys_food_steam = 32 psys_candle_light = 33 psys_candle_light_small = 34 psys_lamp_fire = 35 psys_dummy_smoke = 36 psys_dummy_smoke_big = 37 psys_gourd_smoke = 38 psys_gourd_piece_1 = 39 psys_gourd_piece_2 = 40 psys_fire_fly_1 = 41 psys_bug_fly_1 = 42 psys_moon_beam_1 = 43 psys_moon_beam_paricle_1 = 44 psys_night_smoke_1 = 45 psys_fireplace_fire_small = 46 psys_fireplace_fire_big = 47 psys_village_fire_big = 48 psys_village_fire_smoke_big = 49 psys_map_village_fire = 50 psys_map_village_fire_smoke = 51 psys_map_village_looted_smoke = 52 psys_dungeon_water_drops = 53 psys_wedding_rose = 54 psys_sea_foam_a = 55 psys_fall_leafs_a = 56 psys_desert_storm = 57 psys_blizzard = 58 psys_rain = 59 psys_oil = 60 psys_ship_shrapnel = 61 psys_lanse = 62 psys_lanse_straw = 63 psys_dummy_straw = 64 psys_dummy_straw_big = 65 psys_lanse_blood = 66 psys_blood_decapitation = 67
# config:utf-8 """ production settings file. """
def isEven(num): num1 = num / 2 num2 = num // 2 if num1 == num2: return True else: return False # pi = (4/1) - (4/3) + (4/5) - (4/7) + (4/9) - (4/11) + (4/13) - (4/15) pi = 0.0 for index, i in enumerate(range(1, 100), start=1): thing = (4/((2 * index) - 1)) if isEven(index): pi -= thing else: pi += thing print(pi)
DOMAIN = { '20191016_1571241600': {'datasource': {'source': '20191016_1571241600'}}, '20191210_1575997200': {'datasource': {'source': '20191210_1575997200'}}, '20190724_1563969600': {'datasource': {'source': '20190724_1563969600'}}, '20191128_1574982000': {'datasource': {'source': '20191128_1574982000'}}, '20191029_1572386400': {'datasource': {'source': '20191029_1572386400'}}, '20191202_1575291600': {'datasource': {'source': '20191202_1575291600'}}, '20191122_1574427600': {'datasource': {'source': '20191122_1574427600'}}, '20190729_1564437600': {'datasource': {'source': '20190729_1564437600'}}, '20191207_1575738000': {'datasource': {'source': '20191207_1575738000'}}, '20190709_1562688000': {'datasource': {'source': '20190709_1562688000'}}, '20191022_1571760000': {'datasource': {'source': '20191022_1571760000'}}, '20190723_1563919200': {'datasource': {'source': '20190723_1563919200'}}, '20190707_1562500800': {'datasource': {'source': '20190707_1562500800'}}, '20191120_1574290800': {'datasource': {'source': '20191120_1574290800'}}, '20190810_1565438400': {'datasource': {'source': '20190810_1565438400'}}, '20190807_1565193600': {'datasource': {'source': '20190807_1565193600'}}, '20191127_1574859600': {'datasource': {'source': '20191127_1574859600'}}, '20191127_1574895600': {'datasource': {'source': '20191127_1574895600'}}, '20191009_1570658400': {'datasource': {'source': '20191009_1570658400'}}, '20190712_1562947200': {'datasource': {'source': '20190712_1562947200'}}, '20190815_1565906400': {'datasource': {'source': '20190815_1565906400'}}, '20190727_1564243200': {'datasource': {'source': '20190727_1564243200'}}, '20190829_1567116000': {'datasource': {'source': '20190829_1567116000'}}, '20190919_1568930400': {'datasource': {'source': '20190919_1568930400'}}, '20191129_1575032400': {'datasource': {'source': '20191129_1575032400'}}, '20190905_1567684800': {'datasource': {'source': '20190905_1567684800'}}, '20191129_1575068400': {'datasource': {'source': '20191129_1575068400'}}, '20190913_1568412000': {'datasource': {'source': '20190913_1568412000'}}, '20191121_1574377200': {'datasource': {'source': '20191121_1574377200'}}, '20190803_1564869600': {'datasource': {'source': '20190803_1564869600'}}, '20191108_1573232400': {'datasource': {'source': '20191108_1573232400'}}, '20191113_1573664400': {'datasource': {'source': '20191113_1573664400'}}, '20191008_1570572000': {'datasource': {'source': '20191008_1570572000'}}, '20191027_1572177600': {'datasource': {'source': '20191027_1572177600'}}, '20190710_1562774400': {'datasource': {'source': '20190710_1562774400'}}, '20191122_1574442000': {'datasource': {'source': '20191122_1574442000'}}, '20191001_1569931200': {'datasource': {'source': '20191001_1569931200'}}, '20191015_1571176800': {'datasource': {'source': '20191015_1571176800'}}, '20190826_1566856800': {'datasource': {'source': '20190826_1566856800'}}, '20191005_1570276800': {'datasource': {'source': '20191005_1570276800'}}, '20191212_1576155600': {'datasource': {'source': '20191212_1576155600'}}, '20191201_1575241200': {'datasource': {'source': '20191201_1575241200'}}, '20190717_1563364800': {'datasource': {'source': '20190717_1563364800'}}, '20191211_1576105200': {'datasource': {'source': '20191211_1576105200'}}, '20190922_1569168000': {'datasource': {'source': '20190922_1569168000'}}, '20191011_1570809600': {'datasource': {'source': '20191011_1570809600'}}, '20191012_1570917600': {'datasource': {'source': '20191012_1570917600'}}, '20190914_1568498400': {'datasource': {'source': '20190914_1568498400'}}, '20190827_1566943200': {'datasource': {'source': '20190827_1566943200'}}, '20190703_1562169600': {'datasource': {'source': '20190703_1562169600'}}, '20190906_1567785600': {'datasource': {'source': '20190906_1567785600'}}, '20191111_1573477200': {'datasource': {'source': '20191111_1573477200'}}, '20190817_1566079200': {'datasource': {'source': '20190817_1566079200'}}, '20191117_1573995600': {'datasource': {'source': '20191117_1573995600'}}, '20190714_1563105600': {'datasource': {'source': '20190714_1563105600'}}, '20190711_1562860800': {'datasource': {'source': '20190711_1562860800'}}, '20191208_1575846000': {'datasource': {'source': '20191208_1575846000'}}, '20190922_1569153600': {'datasource': {'source': '20190922_1569153600'}}, '20190820_1566302400': {'datasource': {'source': '20190820_1566302400'}}, '20190826_1566835200': {'datasource': {'source': '20190826_1566835200'}}, '20190715_1563228000': {'datasource': {'source': '20190715_1563228000'}}, '20190902_1567461600': {'datasource': {'source': '20190902_1567461600'}}, '20190901_1567339200': {'datasource': {'source': '20190901_1567339200'}}, '20190804_1564956000': {'datasource': {'source': '20190804_1564956000'}}, '20191008_1570536000': {'datasource': {'source': '20191008_1570536000'}}, '20191126_1574773200': {'datasource': {'source': '20191126_1574773200'}}, '20190811_1565539200': {'datasource': {'source': '20190811_1565539200'}}, '20190904_1567598400': {'datasource': {'source': '20190904_1567598400'}}, '20191110_1573405200': {'datasource': {'source': '20191110_1573405200'}}, '20191201_1575219600': {'datasource': {'source': '20191201_1575219600'}}, '20190912_1568304000': {'datasource': {'source': '20190912_1568304000'}}, '20191204_1575464400': {'datasource': {'source': '20191204_1575464400'}}, '20190908_1567944000': {'datasource': {'source': '20190908_1567944000'}}, '20191101_1572624000': {'datasource': {'source': '20191101_1572624000'}}, '20191023_1571868000': {'datasource': {'source': '20191023_1571868000'}}, '20190717_1563400800': {'datasource': {'source': '20190717_1563400800'}}, '20190713_1563055200': {'datasource': {'source': '20190713_1563055200'}}, '20191102_1572696000': {'datasource': {'source': '20191102_1572696000'}}, '20191126_1574787600': {'datasource': {'source': '20191126_1574787600'}}, '20190812_1565611200': {'datasource': {'source': '20190812_1565611200'}}, '20191020_1571572800': {'datasource': {'source': '20191020_1571572800'}}, '20190918_1568822400': {'datasource': {'source': '20190918_1568822400'}}, '20191107_1573146000': {'datasource': {'source': '20191107_1573146000'}}, '20190721_1563746400': {'datasource': {'source': '20190721_1563746400'}}, '20190714_1563120000': {'datasource': {'source': '20190714_1563120000'}}, '20191116_1573945200': {'datasource': {'source': '20191116_1573945200'}}, '20190909_1568044800': {'datasource': {'source': '20190909_1568044800'}}, '20191011_1570795200': {'datasource': {'source': '20191011_1570795200'}}, '20190919_1568908800': {'datasource': {'source': '20190919_1568908800'}}, '20191204_1575500400': {'datasource': {'source': '20191204_1575500400'}}, '20190921_1569081600': {'datasource': {'source': '20190921_1569081600'}}, '20190911_1568239200': {'datasource': {'source': '20190911_1568239200'}}, '20191203_1575392400': {'datasource': {'source': '20191203_1575392400'}}, '20191006_1570399200': {'datasource': {'source': '20191006_1570399200'}}, '20190914_1568476800': {'datasource': {'source': '20190914_1568476800'}}, '20190923_1569240000': {'datasource': {'source': '20190923_1569240000'}}, '20191104_1572908400': {'datasource': {'source': '20191104_1572908400'}}, '20190806_1565092800': {'datasource': {'source': '20190806_1565092800'}}, '20191112_1573563600': {'datasource': {'source': '20191112_1573563600'}}, '20191030_1572436800': {'datasource': {'source': '20191030_1572436800'}}, 'full_20190701_1561982400': {'datasource': {'source': 'full_20190701_1561982400'}}, '20190729_1564401600': {'datasource': {'source': '20190729_1564401600'}}, '20191013_1570968000': {'datasource': {'source': '20191013_1570968000'}}, '20191127_1574874000': {'datasource': {'source': '20191127_1574874000'}}, '20191123_1574550000': {'datasource': {'source': '20191123_1574550000'}}, '20191112_1573599600': {'datasource': {'source': '20191112_1573599600'}}, '20191211_1576069200': {'datasource': {'source': '20191211_1576069200'}}, '20190828_1566993600': {'datasource': {'source': '20190828_1566993600'}}, '20190922_1569189600': {'datasource': {'source': '20190922_1569189600'}}, '20190727_1564228800': {'datasource': {'source': '20190727_1564228800'}}, '20190809_1565388000': {'datasource': {'source': '20190809_1565388000'}}, '20191030_1572472800': {'datasource': {'source': '20191030_1572472800'}}, '20190828_1567029600': {'datasource': {'source': '20190828_1567029600'}}, '20190929_1569794400': {'datasource': {'source': '20190929_1569794400'}}, '20191119_1574204400': {'datasource': {'source': '20191119_1574204400'}}, '20190907_1567857600': {'datasource': {'source': '20190907_1567857600'}}, '20190921_1569103200': {'datasource': {'source': '20190921_1569103200'}}, '20191104_1572886800': {'datasource': {'source': '20191104_1572886800'}}, '20190815_1565884800': {'datasource': {'source': '20190815_1565884800'}}, '20190818_1566165600': {'datasource': {'source': '20190818_1566165600'}}, '20191106_1573059600': {'datasource': {'source': '20191106_1573059600'}}, '20190701_1562018400': {'datasource': {'source': '20190701_1562018400'}}, '20191022_1571745600': {'datasource': {'source': '20191022_1571745600'}}, '20191121_1574341200': {'datasource': {'source': '20191121_1574341200'}}, '20190802_1564747200': {'datasource': {'source': '20190802_1564747200'}}, '20190704_1562256000': {'datasource': {'source': '20190704_1562256000'}}, '20190920_1568995200': {'datasource': {'source': '20190920_1568995200'}}, '20191002_1570017600': {'datasource': {'source': '20191002_1570017600'}}, '20191120_1574269200': {'datasource': {'source': '20191120_1574269200'}}, '20190812_1565647200': {'datasource': {'source': '20190812_1565647200'}}, '20191203_1575414000': {'datasource': {'source': '20191203_1575414000'}}, '20190807_1565179200': {'datasource': {'source': '20190807_1565179200'}}, '20190817_1566043200': {'datasource': {'source': '20190817_1566043200'}}, '20190704_1562241600': {'datasource': {'source': '20190704_1562241600'}}, '20190929_1569758400': {'datasource': {'source': '20190929_1569758400'}}, '20191214_1576342800': {'datasource': {'source': '20191214_1576342800'}}, '20190904_1567634400': {'datasource': {'source': '20190904_1567634400'}}, '20191130_1575118800': {'datasource': {'source': '20191130_1575118800'}}, '20191013_1571004000': {'datasource': {'source': '20191013_1571004000'}}, '20191215_1576414800': {'datasource': {'source': '20191215_1576414800'}}, '20191120_1574254800': {'datasource': {'source': '20191120_1574254800'}}, '20191211_1576083600': {'datasource': {'source': '20191211_1576083600'}}, '20191106_1573045200': {'datasource': {'source': '20191106_1573045200'}}, '20191205_1575586800': {'datasource': {'source': '20191205_1575586800'}}, '20190928_1569686400': {'datasource': {'source': '20190928_1569686400'}}, '20190927_1569585600': {'datasource': {'source': '20190927_1569585600'}}, '20191014_1571054400': {'datasource': {'source': '20191014_1571054400'}}, '20190822_1566489600': {'datasource': {'source': '20190822_1566489600'}}, '20190827_1566921600': {'datasource': {'source': '20190827_1566921600'}}, '20190912_1568289600': {'datasource': {'source': '20190912_1568289600'}}, '20190720_1563624000': {'datasource': {'source': '20190720_1563624000'}}, '20191111_1573491600': {'datasource': {'source': '20191111_1573491600'}}, '20190723_1563897600': {'datasource': {'source': '20190723_1563897600'}}, '20190907_1567893600': {'datasource': {'source': '20190907_1567893600'}}, '20190819_1566252000': {'datasource': {'source': '20190819_1566252000'}}, '20190730_1564524000': {'datasource': {'source': '20190730_1564524000'}}, '20190913_1568376000': {'datasource': {'source': '20190913_1568376000'}}, '20190906_1567771200': {'datasource': {'source': '20190906_1567771200'}}, '20191119_1574182800': {'datasource': {'source': '20191119_1574182800'}}, '20190822_1566511200': {'datasource': {'source': '20190822_1566511200'}}, '20191113_1573686000': {'datasource': {'source': '20191113_1573686000'}}, '20190715_1563192000': {'datasource': {'source': '20190715_1563192000'}}, '20190925_1569427200': {'datasource': {'source': '20190925_1569427200'}}, '20190714_1563141600': {'datasource': {'source': '20190714_1563141600'}}, '20190907_1567872000': {'datasource': {'source': '20190907_1567872000'}}, '20191009_1570636800': {'datasource': {'source': '20191009_1570636800'}}, '20190817_1566057600': {'datasource': {'source': '20190817_1566057600'}}, '20191212_1576191600': {'datasource': {'source': '20191212_1576191600'}}, '20190911_1568203200': {'datasource': {'source': '20190911_1568203200'}}, '20190902_1567425600': {'datasource': {'source': '20190902_1567425600'}}, '20190706_1562428800': {'datasource': {'source': '20190706_1562428800'}}, '20190901_1567353600': {'datasource': {'source': '20190901_1567353600'}}, '20191119_1574168400': {'datasource': {'source': '20191119_1574168400'}}, '20190926_1569513600': {'datasource': {'source': '20190926_1569513600'}}, '20190810_1565474400': {'datasource': {'source': '20190810_1565474400'}}, '20191202_1575327600': {'datasource': {'source': '20191202_1575327600'}}, '20191205_1575550800': {'datasource': {'source': '20191205_1575550800'}}, '20190718_1563487200': {'datasource': {'source': '20190718_1563487200'}}, '20190904_1567612800': {'datasource': {'source': '20190904_1567612800'}}, '20190701_1561996800': {'datasource': {'source': '20190701_1561996800'}}, '20191105_1572973200': {'datasource': {'source': '20191105_1572973200'}}, '20191017_1571328000': {'datasource': {'source': '20191017_1571328000'}}, '20191020_1571608800': {'datasource': {'source': '20191020_1571608800'}}, '20191028_1572300000': {'datasource': {'source': '20191028_1572300000'}}, '20190806_1565107200': {'datasource': {'source': '20190806_1565107200'}}, '20191105_1572958800': {'datasource': {'source': '20191105_1572958800'}}, '20191207_1575723600': {'datasource': {'source': '20191207_1575723600'}}, '20190716_1563314400': {'datasource': {'source': '20190716_1563314400'}}, '20190912_1568325600': {'datasource': {'source': '20190912_1568325600'}}, '20191216_1576501200': {'datasource': {'source': '20191216_1576501200'}}, '20190908_1567958400': {'datasource': {'source': '20190908_1567958400'}}, '20191027_1572192000': {'datasource': {'source': '20191027_1572192000'}}, '20190925_1569448800': {'datasource': {'source': '20190925_1569448800'}}, '20191110_1573426800': {'datasource': {'source': '20191110_1573426800'}}, '20191026_1572105600': {'datasource': {'source': '20191026_1572105600'}}, '20190703_1562155200': {'datasource': {'source': '20190703_1562155200'}}, '20190916_1568635200': {'datasource': {'source': '20190916_1568635200'}}, '20190924_1569362400': {'datasource': {'source': '20190924_1569362400'}}, '20191114_1573772400': {'datasource': {'source': '20191114_1573772400'}}, '20191024_1571932800': {'datasource': {'source': '20191024_1571932800'}}, '20190725_1564070400': {'datasource': {'source': '20190725_1564070400'}}, '20191016_1571263200': {'datasource': {'source': '20191016_1571263200'}}, '20190731_1564574400': {'datasource': {'source': '20190731_1564574400'}}, '20191001_1569945600': {'datasource': {'source': '20191001_1569945600'}}, '20191209_1575910800': {'datasource': {'source': '20191209_1575910800'}}, '20190920_1569016800': {'datasource': {'source': '20190920_1569016800'}}, '20190702_1562068800': {'datasource': {'source': '20190702_1562068800'}}, '20191010_1570744800': {'datasource': {'source': '20191010_1570744800'}}, '20190813_1565697600': {'datasource': {'source': '20190813_1565697600'}}, '20190706_1562450400': {'datasource': {'source': '20190706_1562450400'}}, '20191029_1572364800': {'datasource': {'source': '20191029_1572364800'}}, '20190808_1565301600': {'datasource': {'source': '20190808_1565301600'}}, '20190726_1564178400': {'datasource': {'source': '20190726_1564178400'}}, '20191004_1570204800': {'datasource': {'source': '20191004_1570204800'}}, '20191214_1576364400': {'datasource': {'source': '20191214_1576364400'}}, '20191004_1570226400': {'datasource': {'source': '20191004_1570226400'}}, '20190715_1563206400': {'datasource': {'source': '20190715_1563206400'}}, '20191117_1574010000': {'datasource': {'source': '20191117_1574010000'}}, '20191126_1574809200': {'datasource': {'source': '20191126_1574809200'}}, '20191102_1572710400': {'datasource': {'source': '20191102_1572710400'}}, '20190814_1565820000': {'datasource': {'source': '20190814_1565820000'}}, '20190821_1566403200': {'datasource': {'source': '20190821_1566403200'}}, '20191012_1570881600': {'datasource': {'source': '20191012_1570881600'}}, '20190708_1562587200': {'datasource': {'source': '20190708_1562587200'}}, '20190909_1568066400': {'datasource': {'source': '20190909_1568066400'}}, '20191129_1575046800': {'datasource': {'source': '20191129_1575046800'}}, '20190919_1568894400': {'datasource': {'source': '20190919_1568894400'}}, '20190926_1569535200': {'datasource': {'source': '20190926_1569535200'}}, '20191216_1576515600': {'datasource': {'source': '20191216_1576515600'}}, '20190823_1566597600': {'datasource': {'source': '20190823_1566597600'}}, '20190804_1564934400': {'datasource': {'source': '20190804_1564934400'}}, '20191214_1576328400': {'datasource': {'source': '20191214_1576328400'}}, '20191008_1570550400': {'datasource': {'source': '20191008_1570550400'}}, '20191204_1575478800': {'datasource': {'source': '20191204_1575478800'}}, '20191117_1574031600': {'datasource': {'source': '20191117_1574031600'}}, '20190823_1566576000': {'datasource': {'source': '20190823_1566576000'}}, '20190908_1567980000': {'datasource': {'source': '20190908_1567980000'}}, '20190831_1567252800': {'datasource': {'source': '20190831_1567252800'}}, '20191026_1572127200': {'datasource': {'source': '20191026_1572127200'}}, '20190928_1569708000': {'datasource': {'source': '20190928_1569708000'}}, '20190812_1565625600': {'datasource': {'source': '20190812_1565625600'}}, '20190829_1567080000': {'datasource': {'source': '20190829_1567080000'}}, '20191021_1571695200': {'datasource': {'source': '20191021_1571695200'}}, '20190803_1564848000': {'datasource': {'source': '20190803_1564848000'}}, '20190719_1563552000': {'datasource': {'source': '20190719_1563552000'}}, '20190719_1563537600': {'datasource': {'source': '20190719_1563537600'}}, '20190930_1569844800': {'datasource': {'source': '20190930_1569844800'}}, '20191124_1574600400': {'datasource': {'source': '20191124_1574600400'}}, '20190914_1568462400': {'datasource': {'source': '20190914_1568462400'}}, '20191103_1572818400': {'datasource': {'source': '20191103_1572818400'}}, '20191022_1571781600': {'datasource': {'source': '20191022_1571781600'}}, '20191125_1574722800': {'datasource': {'source': '20191125_1574722800'}}, '20191206_1575637200': {'datasource': {'source': '20191206_1575637200'}}, '20191021_1571673600': {'datasource': {'source': '20191021_1571673600'}}, '20191128_1574946000': {'datasource': {'source': '20191128_1574946000'}}, '20191130_1575154800': {'datasource': {'source': '20191130_1575154800'}}, '20190806_1565128800': {'datasource': {'source': '20190806_1565128800'}}, '20191118_1574096400': {'datasource': {'source': '20191118_1574096400'}}, '20190906_1567807200': {'datasource': {'source': '20190906_1567807200'}}, '20191122_1574463600': {'datasource': {'source': '20191122_1574463600'}}, '20190701_1561982400': {'datasource': {'source': '20190701_1561982400'}}, '20191208_1575810000': {'datasource': {'source': '20191208_1575810000'}}, '20191003_1570118400': {'datasource': {'source': '20191003_1570118400'}}, '20190810_1565452800': {'datasource': {'source': '20190810_1565452800'}}, '20190728_1564315200': {'datasource': {'source': '20190728_1564315200'}}, '20190801_1564660800': {'datasource': {'source': '20190801_1564660800'}}, '20191024_1571954400': {'datasource': {'source': '20191024_1571954400'}}, '20191109_1573304400': {'datasource': {'source': '20191109_1573304400'}}, '20191028_1572278400': {'datasource': {'source': '20191028_1572278400'}}, '20191007_1570464000': {'datasource': {'source': '20191007_1570464000'}}, '20191027_1572213600': {'datasource': {'source': '20191027_1572213600'}}, '20191028_1572264000': {'datasource': {'source': '20191028_1572264000'}}, '20190920_1568980800': {'datasource': {'source': '20190920_1568980800'}}, '20190730_1564502400': {'datasource': {'source': '20190730_1564502400'}}, '20190731_1564588800': {'datasource': {'source': '20190731_1564588800'}}, '20190831_1567267200': {'datasource': {'source': '20190831_1567267200'}}, '20190723_1563883200': {'datasource': {'source': '20190723_1563883200'}}, '20191209_1575932400': {'datasource': {'source': '20191209_1575932400'}}, '20190707_1562515200': {'datasource': {'source': '20190707_1562515200'}}, '20191105_1572994800': {'datasource': {'source': '20191105_1572994800'}}, '20190725_1564092000': {'datasource': {'source': '20190725_1564092000'}}, '20190826_1566820800': {'datasource': {'source': '20190826_1566820800'}}, '20191029_1572350400': {'datasource': {'source': '20191029_1572350400'}}, '20191118_1574082000': {'datasource': {'source': '20191118_1574082000'}}, '20191206_1575673200': {'datasource': {'source': '20191206_1575673200'}}, '20191017_1571349600': {'datasource': {'source': '20191017_1571349600'}}, '20191215_1576450800': {'datasource': {'source': '20191215_1576450800'}}, '20191019_1571522400': {'datasource': {'source': '20191019_1571522400'}}, '20191015_1571155200': {'datasource': {'source': '20191015_1571155200'}}, '20190718_1563451200': {'datasource': {'source': '20190718_1563451200'}}, '20190728_1564351200': {'datasource': {'source': '20190728_1564351200'}}, '20190915_1568548800': {'datasource': {'source': '20190915_1568548800'}}, '20190804_1564920000': {'datasource': {'source': '20190804_1564920000'}}, '20190803_1564833600': {'datasource': {'source': '20190803_1564833600'}}, '20190911_1568217600': {'datasource': {'source': '20190911_1568217600'}}, '20190728_1564329600': {'datasource': {'source': '20190728_1564329600'}}, '20190821_1566424800': {'datasource': {'source': '20190821_1566424800'}}, '20190811_1565524800': {'datasource': {'source': '20190811_1565524800'}}, '20190702_1562083200': {'datasource': {'source': '20190702_1562083200'}}, '20190830_1567202400': {'datasource': {'source': '20190830_1567202400'}}, '20191210_1576018800': {'datasource': {'source': '20191210_1576018800'}}, '20190823_1566561600': {'datasource': {'source': '20190823_1566561600'}}, '20190801_1564675200': {'datasource': {'source': '20190801_1564675200'}}, '20190903_1567526400': {'datasource': {'source': '20190903_1567526400'}}, '20190831_1567288800': {'datasource': {'source': '20190831_1567288800'}}, '20191103_1572796800': {'datasource': {'source': '20191103_1572796800'}}, '20190709_1562673600': {'datasource': {'source': '20190709_1562673600'}}, '20191116_1573909200': {'datasource': {'source': '20191116_1573909200'}}, '20190824_1566648000': {'datasource': {'source': '20190824_1566648000'}}, '20191213_1576278000': {'datasource': {'source': '20191213_1576278000'}}, '20191109_1573340400': {'datasource': {'source': '20191109_1573340400'}}, '20191206_1575651600': {'datasource': {'source': '20191206_1575651600'}}, '20191005_1570291200': {'datasource': {'source': '20191005_1570291200'}}, '20190705_1562364000': {'datasource': {'source': '20190705_1562364000'}}, '20190824_1566684000': {'datasource': {'source': '20190824_1566684000'}}, '20191118_1574118000': {'datasource': {'source': '20191118_1574118000'}}, '20191123_1574528400': {'datasource': {'source': '20191123_1574528400'}}, '20190910_1568131200': {'datasource': {'source': '20190910_1568131200'}}, '20190929_1569772800': {'datasource': {'source': '20190929_1569772800'}}, '20190710_1562760000': {'datasource': {'source': '20190710_1562760000'}}, '20190721_1563710400': {'datasource': {'source': '20190721_1563710400'}}, '20190720_1563638400': {'datasource': {'source': '20190720_1563638400'}}, '20191106_1573081200': {'datasource': {'source': '20191106_1573081200'}}, '20191115_1573858800': {'datasource': {'source': '20191115_1573858800'}}, '20190722_1563832800': {'datasource': {'source': '20190722_1563832800'}}, '20190718_1563465600': {'datasource': {'source': '20190718_1563465600'}}, '20191114_1573736400': {'datasource': {'source': '20191114_1573736400'}}, '20190724_1563984000': {'datasource': {'source': '20190724_1563984000'}}, '20190717_1563379200': {'datasource': {'source': '20190717_1563379200'}}, '20190814_1565784000': {'datasource': {'source': '20190814_1565784000'}}, '20190809_1565366400': {'datasource': {'source': '20190809_1565366400'}}, '20190813_1565712000': {'datasource': {'source': '20190813_1565712000'}}, '20190727_1564264800': {'datasource': {'source': '20190727_1564264800'}}, '20191101_1572645600': {'datasource': {'source': '20191101_1572645600'}}, '20190713_1563033600': {'datasource': {'source': '20190713_1563033600'}}, '20191005_1570312800': {'datasource': {'source': '20191005_1570312800'}}, '20191003_1570140000': {'datasource': {'source': '20191003_1570140000'}}, '20190814_1565798400': {'datasource': {'source': '20190814_1565798400'}}, '20191213_1576256400': {'datasource': {'source': '20191213_1576256400'}}, '20191108_1573254000': {'datasource': {'source': '20191108_1573254000'}}, '20190705_1562328000': {'datasource': {'source': '20190705_1562328000'}}, '20190925_1569412800': {'datasource': {'source': '20190925_1569412800'}}, '20191209_1575896400': {'datasource': {'source': '20191209_1575896400'}}, '20191216_1576537200': {'datasource': {'source': '20191216_1576537200'}}, '20191130_1575133200': {'datasource': {'source': '20191130_1575133200'}}, '20190909_1568030400': {'datasource': {'source': '20190909_1568030400'}}, '20190927_1569600000': {'datasource': {'source': '20190927_1569600000'}}, '20191030_1572451200': {'datasource': {'source': '20191030_1572451200'}}, '20191016_1571227200': {'datasource': {'source': '20191016_1571227200'}}, '20190821_1566388800': {'datasource': {'source': '20190821_1566388800'}}, '20191112_1573578000': {'datasource': {'source': '20191112_1573578000'}}, '20190808_1565265600': {'datasource': {'source': '20190808_1565265600'}}, '20191113_1573650000': {'datasource': {'source': '20191113_1573650000'}}, '20190825_1566734400': {'datasource': {'source': '20190825_1566734400'}}, '20191208_1575824400': {'datasource': {'source': '20191208_1575824400'}}, '20191201_1575205200': {'datasource': {'source': '20191201_1575205200'}}, '20190807_1565215200': {'datasource': {'source': '20190807_1565215200'}}, '20191125_1574686800': {'datasource': {'source': '20191125_1574686800'}}, '20190712_1562932800': {'datasource': {'source': '20190712_1562932800'}}, '20190813_1565733600': {'datasource': {'source': '20190813_1565733600'}}, '20190713_1563019200': {'datasource': {'source': '20190713_1563019200'}}, '20191102_1572732000': {'datasource': {'source': '20191102_1572732000'}}, '20191019_1571500800': {'datasource': {'source': '20191019_1571500800'}}, '20190706_1562414400': {'datasource': {'source': '20190706_1562414400'}}, '20191217_1576587600': {'datasource': {'source': '20191217_1576587600'}}, '20191217_1576602000': {'datasource': {'source': '20191217_1576602000'}}, '20190710_1562796000': {'datasource': {'source': '20190710_1562796000'}}, '20190719_1563573600': {'datasource': {'source': '20190719_1563573600'}}, '20191115_1573822800': {'datasource': {'source': '20191115_1573822800'}}, '20191109_1573318800': {'datasource': {'source': '20191109_1573318800'}}, '20191018_1571400000': {'datasource': {'source': '20191018_1571400000'}}, '20191212_1576170000': {'datasource': {'source': '20191212_1576170000'}}, '20190724_1564005600': {'datasource': {'source': '20190724_1564005600'}}, '20190805_1565006400': {'datasource': {'source': '20190805_1565006400'}}, '20190811_1565560800': {'datasource': {'source': '20190811_1565560800'}}, '20190913_1568390400': {'datasource': {'source': '20190913_1568390400'}}, '20191103_1572782400': {'datasource': {'source': '20191103_1572782400'}}, '20191001_1569967200': {'datasource': {'source': '20191001_1569967200'}}, '20191123_1574514000': {'datasource': {'source': '20191123_1574514000'}}, '20190711_1562846400': {'datasource': {'source': '20190711_1562846400'}}, '20191014_1571068800': {'datasource': {'source': '20191014_1571068800'}}, '20190801_1564696800': {'datasource': {'source': '20190801_1564696800'}}, '20191203_1575378000': {'datasource': {'source': '20191203_1575378000'}}, '20191107_1573167600': {'datasource': {'source': '20191107_1573167600'}}, '20191205_1575565200': {'datasource': {'source': '20191205_1575565200'}}, '20191024_1571918400': {'datasource': {'source': '20191024_1571918400'}}, '20191003_1570104000': {'datasource': {'source': '20191003_1570104000'}}, '20190731_1564610400': {'datasource': {'source': '20190731_1564610400'}}, '20190809_1565352000': {'datasource': {'source': '20190809_1565352000'}}, '20191020_1571587200': {'datasource': {'source': '20191020_1571587200'}}, '20190930_1569880800': {'datasource': {'source': '20190930_1569880800'}}, '20191125_1574701200': {'datasource': {'source': '20191125_1574701200'}}, '20190705_1562342400': {'datasource': {'source': '20190705_1562342400'}}, '20190816_1565971200': {'datasource': {'source': '20190816_1565971200'}}, '20191004_1570190400': {'datasource': {'source': '20191004_1570190400'}}, '20190928_1569672000': {'datasource': {'source': '20190928_1569672000'}}, '20190825_1566770400': {'datasource': {'source': '20190825_1566770400'}}, '20191111_1573513200': {'datasource': {'source': '20191111_1573513200'}}, '20191101_1572609600': {'datasource': {'source': '20191101_1572609600'}}, '20190820_1566338400': {'datasource': {'source': '20190820_1566338400'}}, '20190902_1567440000': {'datasource': {'source': '20190902_1567440000'}}, '20191213_1576242000': {'datasource': {'source': '20191213_1576242000'}}, '20190901_1567375200': {'datasource': {'source': '20190901_1567375200'}}, '20191019_1571486400': {'datasource': {'source': '20191019_1571486400'}}, '20190830_1567180800': {'datasource': {'source': '20190830_1567180800'}}, '20191107_1573131600': {'datasource': {'source': '20191107_1573131600'}}, '20190824_1566662400': {'datasource': {'source': '20190824_1566662400'}}, '20191031_1572537600': {'datasource': {'source': '20191031_1572537600'}}, '20190827_1566907200': {'datasource': {'source': '20190827_1566907200'}}, '20190725_1564056000': {'datasource': {'source': '20190725_1564056000'}}, '20191202_1575306000': {'datasource': {'source': '20191202_1575306000'}}, '20191023_1571832000': {'datasource': {'source': '20191023_1571832000'}}, '20190924_1569340800': {'datasource': {'source': '20190924_1569340800'}}, '20190716_1563278400': {'datasource': {'source': '20190716_1563278400'}}, '20190915_1568584800': {'datasource': {'source': '20190915_1568584800'}}, '20190918_1568844000': {'datasource': {'source': '20190918_1568844000'}}, '20190917_1568721600': {'datasource': {'source': '20190917_1568721600'}}, '20190917_1568736000': {'datasource': {'source': '20190917_1568736000'}}, '20190927_1569621600': {'datasource': {'source': '20190927_1569621600'}}, '20191006_1570363200': {'datasource': {'source': '20191006_1570363200'}}, '20190805_1565020800': {'datasource': {'source': '20190805_1565020800'}}, '20190720_1563660000': {'datasource': {'source': '20190720_1563660000'}}, '20190916_1568649600': {'datasource': {'source': '20190916_1568649600'}}, '20190819_1566230400': {'datasource': {'source': '20190819_1566230400'}}, '20191124_1574614800': {'datasource': {'source': '20191124_1574614800'}}, '20190825_1566748800': {'datasource': {'source': '20190825_1566748800'}}, '20191031_1572523200': {'datasource': {'source': '20191031_1572523200'}}, '20190703_1562191200': {'datasource': {'source': '20190703_1562191200'}}, '20190808_1565280000': {'datasource': {'source': '20190808_1565280000'}}, '20190802_1564783200': {'datasource': {'source': '20190802_1564783200'}}, '20191115_1573837200': {'datasource': {'source': '20191115_1573837200'}}, '20191014_1571090400': {'datasource': {'source': '20191014_1571090400'}}, '20190702_1562104800': {'datasource': {'source': '20190702_1562104800'}}, '20190819_1566216000': {'datasource': {'source': '20190819_1566216000'}}, '20190820_1566316800': {'datasource': {'source': '20190820_1566316800'}}, '20190924_1569326400': {'datasource': {'source': '20190924_1569326400'}}, '20191207_1575759600': {'datasource': {'source': '20191207_1575759600'}}, '20190707_1562536800': {'datasource': {'source': '20190707_1562536800'}}, '20190802_1564761600': {'datasource': {'source': '20190802_1564761600'}}, '20191110_1573390800': {'datasource': {'source': '20191110_1573390800'}}, '20190910_1568152800': {'datasource': {'source': '20190910_1568152800'}}, '20191217_1576623600': {'datasource': {'source': '20191217_1576623600'}}, '20190708_1562601600': {'datasource': {'source': '20190708_1562601600'}}, '20190815_1565870400': {'datasource': {'source': '20190815_1565870400'}}, '20191011_1570831200': {'datasource': {'source': '20191011_1570831200'}}, '20191017_1571313600': {'datasource': {'source': '20191017_1571313600'}}, '20191124_1574636400': {'datasource': {'source': '20191124_1574636400'}}, '20190918_1568808000': {'datasource': {'source': '20190918_1568808000'}}, '20191018_1571414400': {'datasource': {'source': '20191018_1571414400'}}, '20190722_1563796800': {'datasource': {'source': '20190722_1563796800'}}, '20191002_1570053600': {'datasource': {'source': '20191002_1570053600'}}, '20190917_1568757600': {'datasource': {'source': '20190917_1568757600'}}, '20190816_1565992800': {'datasource': {'source': '20190816_1565992800'}}, '20191025_1572019200': {'datasource': {'source': '20191025_1572019200'}}, '20190915_1568563200': {'datasource': {'source': '20190915_1568563200'}}, '20191007_1570449600': {'datasource': {'source': '20191007_1570449600'}}, '20191010_1570723200': {'datasource': {'source': '20191010_1570723200'}}, '20190726_1564156800': {'datasource': {'source': '20190726_1564156800'}}, '20191025_1572040800': {'datasource': {'source': '20191025_1572040800'}}, '20190816_1565956800': {'datasource': {'source': '20190816_1565956800'}}, '20191012_1570896000': {'datasource': {'source': '20191012_1570896000'}}, '20190818_1566129600': {'datasource': {'source': '20190818_1566129600'}}, '20191025_1572004800': {'datasource': {'source': '20191025_1572004800'}}, '20191007_1570485600': {'datasource': {'source': '20191007_1570485600'}}, '20191114_1573750800': {'datasource': {'source': '20191114_1573750800'}}, '20191116_1573923600': {'datasource': {'source': '20191116_1573923600'}}, '20190829_1567094400': {'datasource': {'source': '20190829_1567094400'}}, '20190704_1562277600': {'datasource': {'source': '20190704_1562277600'}}, '20191010_1570708800': {'datasource': {'source': '20191010_1570708800'}}, '20191006_1570377600': {'datasource': {'source': '20191006_1570377600'}}, '20190923_1569254400': {'datasource': {'source': '20190923_1569254400'}}, '20190729_1564416000': {'datasource': {'source': '20190729_1564416000'}}, '20190930_1569859200': {'datasource': {'source': '20190930_1569859200'}}, '20190921_1569067200': {'datasource': {'source': '20190921_1569067200'}}, '20191121_1574355600': {'datasource': {'source': '20191121_1574355600'}}, '20190926_1569499200': {'datasource': {'source': '20190926_1569499200'}}, '20190726_1564142400': {'datasource': {'source': '20190726_1564142400'}}, '20190712_1562968800': {'datasource': {'source': '20190712_1562968800'}}, '20190903_1567548000': {'datasource': {'source': '20190903_1567548000'}}, '20191108_1573218000': {'datasource': {'source': '20191108_1573218000'}}, '20191013_1570982400': {'datasource': {'source': '20191013_1570982400'}}, '20191031_1572559200': {'datasource': {'source': '20191031_1572559200'}}, '20190828_1567008000': {'datasource': {'source': '20190828_1567008000'}}, '20191215_1576429200': {'datasource': {'source': '20191215_1576429200'}}, '20191009_1570622400': {'datasource': {'source': '20191009_1570622400'}}, '20191021_1571659200': {'datasource': {'source': '20191021_1571659200'}}, '20191015_1571140800': {'datasource': {'source': '20191015_1571140800'}}, '20190905_1567720800': {'datasource': {'source': '20190905_1567720800'}}, '20190910_1568116800': {'datasource': {'source': '20190910_1568116800'}}, '20190822_1566475200': {'datasource': {'source': '20190822_1566475200'}}, '20191128_1574960400': {'datasource': {'source': '20191128_1574960400'}}, '20190722_1563811200': {'datasource': {'source': '20190722_1563811200'}}, '20190903_1567512000': {'datasource': {'source': '20190903_1567512000'}}, '20190709_1562709600': {'datasource': {'source': '20190709_1562709600'}}, '20190721_1563724800': {'datasource': {'source': '20190721_1563724800'}}, '20190916_1568671200': {'datasource': {'source': '20190916_1568671200'}}, '20190730_1564488000': {'datasource': {'source': '20190730_1564488000'}}, '20190905_1567699200': {'datasource': {'source': '20190905_1567699200'}}, '20191026_1572091200': {'datasource': {'source': '20191026_1572091200'}}, '20190711_1562882400': {'datasource': {'source': '20190711_1562882400'}}, '20190708_1562623200': {'datasource': {'source': '20190708_1562623200'}}, '20191104_1572872400': {'datasource': {'source': '20191104_1572872400'}}, '20190805_1565042400': {'datasource': {'source': '20190805_1565042400'}}, '20190923_1569276000': {'datasource': {'source': '20190923_1569276000'}}, '20191210_1575982800': {'datasource': {'source': '20191210_1575982800'}}, '20191018_1571436000': {'datasource': {'source': '20191018_1571436000'}}, '20191023_1571846400': {'datasource': {'source': '20191023_1571846400'}}, '20191002_1570032000': {'datasource': {'source': '20191002_1570032000'}}, '20190818_1566144000': {'datasource': {'source': '20190818_1566144000'}}, '20190830_1567166400': {'datasource': {'source': '20190830_1567166400'}}, '20190716_1563292800': {'datasource': {'source': '20190716_1563292800'}}, } MONGO_HOST = 'localhost' MONGO_PORT = 27017 MONGO_DBNAME = "cota_access_agg" ALLOW_UNKNOWN=True X_DOMAINS='*' PUBLIC_METHODS = ['GET'] PAGINATION_LIMIT = 10000 PAGINATION_DEFAULT = 10000
# pylint: skip-file class Hostgroup(object): ''' hostgroup methods''' @staticmethod def get_host_group_id_by_name(zapi, hg_name): '''Get hostgroup id by name''' content = zapi.get_content('hostgroup', 'get', {'filter': {'name': hg_name}}) return content['result'][0]['groupid'] @staticmethod def get_host_ids_by_group_name(zapi, hg_name): '''Get hostgroup id by name''' content = zapi.get_content('hostgroup', 'get', {'filter': {'name': hg_name}}) results = [host['hostid'] for host in content['result']] return results @staticmethod def get_hostgroup_id(zapi, hg_name): '''get a hostgroup id from hg name''' content = zapi.get_content('hostgroup', 'get', {'search': {'name': hg_name}}) return content['result'][0]['groupid']
# Python - Object Oriented Programming # Raise can be different for different employees or instances. # But total number of employees will not be different for any instance. # so lets create a class variable names num_of employees. class Employee: num_of_emps = 0 raise_amt = 1.04 def __init__(self, firstName, lastName, pay): self.firstName = firstName self.lastName = lastName self.pay = pay self.email = f"{firstName}.{lastName}@Company.com" Employee.num_of_emps += 1 def fullname(self): return f"{self.firstName} {self.lastName}" def apply_raise(self): self.pay = int(self.pay * self.raise_amt) employee_1 = Employee("Tom", "Hanks", 50000) employee_2 = Employee("Ricky", "Martin", 60000) print(Employee.num_of_emps)
# Escrever um programa em Python em que dada uma lista com números inteiros, # retorna uma nova lista com os números ímpares (ou pares) contidos nesta lista. sampleList = [11, 45, 8, 23, 14, 12, 78, 45, 89, 88] sampleList_even = [] sampleList_odd = [] i = 0 resto = 0 while i < len(sampleList): if sampleList[i] % 2: sampleList_odd.append(sampleList[i]) else: sampleList_even.append(sampleList[i]) i += 1 even_inOrder = sorted(sampleList_even) odd_inOrder = sorted(sampleList_odd) print(f'Lista Par: {even_inOrder}') print(f'Lista Ímpar: {odd_inOrder}')
# Split string at line boundaries file_split = file.splitlines() # Print file_split print(file_split) # Complete for-loop to split by commas for substring in file_split: substring_split = substring.split(",") print(substring_split)
#!/usr/bin/env python # coding: utf-8 def check(guess, tries): if guess == word: print("Good Job! You are one with the Source.") exit(0) elif guess == "lol": print("You wasted a guess =P") elif len(guess) < 5: print("0, 1, 2, 3, 4 that’s how we count to five!") elif guess[0] != word[0]: print("ABCDEFGHIJKLMNOPQRSTUVWXYZ") else: print("you have " + str(tries) + " guesses left!") def main(): tries = 10 print("The secret word begins with a " + word[0]) while tries > 0: tries -= 1 guess = raw_input("GUESS?: ") check(guess, tries) exit(0) word = "moist" main()
#!/usr/bin/python # coding=utf-8 class Project(object): __allowed_properties = [ 'name', 'git_url', 'absolute_path' ] def __new__(cls, project_settings): # Check if project settings are a go for setting attributes if not sorted(project_settings.keys()) == sorted(cls.__allowed_properties): return None # Create attributes from provided dict for allowed_property in cls.__allowed_properties: setattr(cls, allowed_property, project_settings[allowed_property]) return cls
# -*- coding: utf-8 -*- """ Created on Mon Apr 23 20:07:08 2018 @author: Shen Zhen-Xiong """ BasisDict = {'LDAmin': {'H': 'H_lda_5.0au_50Ry_2s1p', 'Li': 'Li_lda_8.0au_50Ry_2s2p1d', 'Be': 'Be_lda_8.0au_50Ry_2s2p1d', 'B': 'B_lda_7.0au_50Ry_2s2p1d', 'C': 'C_pz-vbc_6.0au_50Ry_2s2d1p', 'N': 'N_lda_5.0au_50Ry_2s2p1d', 'O': 'O_lda_5.0au_50Ry_2s2p1d', 'F': 'F_lda_5.0au_50Ry_2s2p1d', 'Na': 'Na_lda_9.0au_50Ry_2s2p1d', 'Mg': 'Mg_lda_8.0au_50Ry_2s2p1d', 'Al': 'Al_pz-vbc_9.0au_50Ry_2s2d1p', 'Si': 'Si_lda_8.0au_50Ry_2s2p1d', 'P': 'P_lda_7.0au_50Ry_2s2p1d', 'S': 'S_lda_6.0au_50Ry_2s2p1d', 'Cl': 'Cl_pz-bhs_6.0au_50Ry_2s2d1p', 'K': 'K_lda_10.0au_50Ry_2s2p1d', 'Ca': 'Ca_pz-n-vbc_10.0au_50Ry_2s2p1d', 'Ti': 'Ti_lda_8.0au_100Ry_2s2p2d', 'Mn': 'Mn_lda_7.0au_100Ry_2s2p2d', 'Fe': 'Fe_lda_7.0au_100Ry_2s2p2d', 'Cu': 'Cu_lda_6.0au_100Ry_2s2p2d', 'Zn': 'Zn_lda_6.0au_120Ry_2s2p2d', 'Ga': 'Ga_lda_7.0au_100Ry_2s2p2d', 'Ge': 'Ge_pz-bhs_8.0au_50Ry_2s2d1p', 'As': 'As_pz-bhs_7.0au_50Ry_2s2p1d', 'Se': 'Se_pz-bhs_7.0au_50Ry_2s2p1d', 'Br': 'Br_lda_6.0au_50Ry_2s2p1d', 'In': 'In_pz-bhs_8.0au_50Ry_2s2p1d', 'Sn': 'Sn_pz-bhs_8.0au_16Ry_2s2p1d', 'I': 'I_lda_6.0au_50Ry_2s2p2d'}, 'LDAmid': {'H': 'H_lda_6.0au_50Ry_2s1p', 'Li': 'Li_lda_10.0au_50Ry_2s2p1d', 'Be': 'Be_lda_9.0au_50Ry_2s2p1d', 'B': 'B_lda_8.0au_50Ry_2s2p1d', 'C': 'C_pz-vbc_7.0au_50Ry_2s2d1p', 'N': 'N_lda_6.0au_50Ry_2s2p1d', 'O': 'O_lda_6.0au_50Ry_2s2p1d', 'F': 'F_lda_6.0au_50Ry_2s2p1d', 'Na': 'Na_lda_10.0au_50Ry_2s2p1d', 'Mg': 'Mg_lda_10.0au_50Ry_2s2p1d', 'Al': 'Al_pz-vbc_10.0au_50Ry_2s2d1p', 'Si': 'Si_lda_9.0au_50Ry_2s2p1d', 'P': 'P_lda_8.0au_50Ry_2s2p1d', 'S': 'S_lda_7.0au_50Ry_2s2p1d', 'Cl': 'Cl_pz-bhs_7.0au_50Ry_2s2d1p', 'K': 'K_lda_11.0au_50Ry_2s2p1d', 'Ca': 'Ca_pz-n-vbc_11.0au_50Ry_2s2p1d', 'Ti': 'Ti_lda_10.0au_100Ry_2s2p2d', 'Mn': 'Mn_lda_9.0au_100Ry_2s2p2d', 'Fe': 'Fe_lda_8.0au_100Ry_2s2p2d', 'Cu': 'Cu_lda_7.0au_100Ry_2s2p2d', 'Zn': 'Zn_lda_8.0au_120Ry_2s2p2d', 'Ga': 'Ga_lda_8.0au_100Ry_2s2p2d', 'Ge': 'Ge_pz-bhs_9.0au_50Ry_2s2d1p', 'As': 'As_pz-bhs_8.0au_50Ry_2s2p1d', 'Se': 'Se_pz-bhs_8.0au_50Ry_2s2p1d', 'Br': 'Br_lda_7.0au_50Ry_2s2p1d', 'In': 'In_pz-bhs_10.0au_50Ry_2s2p1d', 'Sn': 'Sn_pz-bhs_9.0au_16Ry_2s2p1d', 'I': 'I_lda_7.0au_50Ry_2s2p2d'}, 'LDAact': {'H': 'H_lda_8.0au_50Ry_2s1p', 'Li': 'Li_lda_12.0au_50Ry_2s2p1d', 'Be': 'Be_lda_10.0au_50Ry_2s2p1d', 'B': 'B_lda_9.0au_50Ry_2s2p1d', 'C': 'C_pz-vbc_8.0au_50Ry_2s2d1p', 'N': 'N_lda_7.0au_50Ry_2s2p1d', 'O': 'O_lda_7.0au_50Ry_2s2p1d', 'F': 'F_lda_7.0au_50Ry_2s2p1d', 'Na': 'Na_lda_12.0au_50Ry_2s2p1d', 'Mg': 'Mg_lda_12.0au_50Ry_2s2p1d', 'Al': 'Al_pz-vbc_11.0au_50Ry_2s2d1p', 'Si': 'Si_lda_10.0au_50Ry_2s2p1d', 'P': 'P_lda_9.0au_50Ry_2s2p1d', 'S': 'S_lda_8.0au_50Ry_2s2p1d', 'Cl': 'Cl_pz-bhs_8.0au_50Ry_2s2d1p', 'K': 'K_lda_12.0au_50Ry_2s2p1d', 'Ca': 'Ca_pz-n-vbc_12.0au_50Ry_2s2p1d', 'Ti': 'Ti_lda_11.0au_100Ry_2s2p2d', 'Mn': 'Mn_lda_10.0au_100Ry_2s2p2d', 'Fe': 'Fe_lda_9.0au_100Ry_2s2p2d', 'Cu': 'Cu_lda_8.0au_100Ry_2s2p2d', 'Zn': 'Zn_lda_9.0au_120Ry_2s2p2d', 'Ga': 'Ga_lda_9.0au_100Ry_2s2p2d', 'Ge': 'Ge_pz-bhs_10.0au_50Ry_2s2d1p', 'As': 'As_pz-bhs_9.0au_50Ry_2s2p1d', 'Se': 'Se_pz-bhs_9.0au_50Ry_2s2p1d', 'Br': 'Br_lda_8.0au_50Ry_2s2p1d', 'In': 'In_pz-bhs_11.0au_50Ry_2s2p1d', 'Sn': 'Sn_pz-bhs_10.0au_16Ry_2s2p1d', 'I': 'I_lda_8.0au_50Ry_2s2p2d'}, 'PBEmin': {'H': 'H_pbe_5.0au_50Ry_2s1p', 'Li': 'Li_pbe_8.0au_50Ry_2s2p1d', 'Be': 'Be_pbe_8.0au_50Ry_2s2p1d', 'B': 'B_pbe_7.0au_50Ry_2s2p1d', 'C': 'C_pbe_6.0au_50Ry_2s2d1p', 'N': 'N_pbe_5.0au_50Ry_2s2p1d', 'O': 'O_pbe_5.0au_50Ry_2s2p1d', 'F': 'F_pbe_5.0au_50Ry_2s2p1d', 'Na': 'Na_pbe_9.0au_50Ry_2s2p1d', 'Mg': 'Mg_pbe_8.0au_50Ry_2s2p1d', 'Al': 'Al_pbe_9.0au_50Ry_2s2d1p', 'Si': 'Si_pbe_8.0au_50Ry_2s2p1d', 'P': 'P_pbe_7.0au_50Ry_2s2p1d', 'S': 'S_pbe_6.0au_50Ry_2s2p1d', 'Cl': 'Cl_pbe_6.0au_50Ry_2s2d1p', 'K': 'K_pbe_10.0au_50Ry_2s2p1d', 'Ti': 'Ti_pbe_8.0au_100Ry_2s2p2d', 'Mn': 'Mn_pbe_7.0au_100Ry_2s2p2d', 'Fe': 'Fe_pbe_7.0au_100Ry_2s2p2d', 'Cu': 'Cu_pbe_6.0au_100Ry_2s2p2d', 'Zn': 'Zn_pbe_6.0au_120Ry_2s2p2d', 'Ga': 'Ga_pbe_7.0au_100Ry_2s2p2d', 'Br': 'Br_pbe_6.0au_50Ry_2s2p1d', 'I': 'I_pbe_6.0au_50Ry_2s2p2d'}, 'PBEmid': {'H': 'H_pbe_6.0au_50Ry_2s1p', 'Li': 'Li_pbe_10.0au_50Ry_2s2p1d', 'Be': 'Be_pbe_9.0au_50Ry_2s2p1d', 'B': 'B_pbe_8.0au_50Ry_2s2p1d', 'C': 'C_pbe_7.0au_50Ry_2s2d1p', 'N': 'N_pbe_6.0au_50Ry_2s2p1d', 'O': 'O_6.0au_50Ry_2s2p1d', 'F': 'F_pbe_6.0au_50Ry_2s2p1d', 'Na': 'Na_pbe_10.0au_50Ry_2s2p1d', 'Mg': 'Mg_pbe_10.0au_50Ry_2s2p1d', 'Al': 'Al_pbe_10.0au_50Ry_2s2d1p', 'Si': 'Si_pbe_9.0au_50Ry_2s2p1d', 'P': 'P_8.0au_50Ry_2s2p1d', 'S': 'S_pbe_7.0au_50Ry_2s2p1d', 'Cl': 'Cl_pbe_7.0au_50Ry_2s2d1p', 'K': 'K_pbe_11.0au_50Ry_2s2p1d', 'Ti': 'Ti_pbe_10.0au_100Ry_2s2p2d', 'Mn': 'Mn_pbe_9.0au_100Ry_2s2p2d', 'Fe': 'Fe_pbe_8.0au_100Ry_2s2p2d', 'Cu': 'Cu_pbe_7.0au_100Ry_2s2p2d', 'Zn': 'Zn_pbe_8.0au_120Ry_2s2p2d', 'Ga': 'Ga_pbe_8.0au_100Ry_2s2p2d', 'Br': 'Br_pbe_7.0au_50Ry_2s2p1d', 'I': 'I_pbe_7.0au_50Ry_2s2p2d'}, 'PBEact': {'H': 'H_pbe_8.0au_50Ry_2s1p', 'Li': 'Li_pbe_12.0au_50Ry_2s2p1d', 'Be': 'Be_pbe_10.0au_50Ry_2s2p1d', 'B': 'B_pbe_9.0au_50Ry_2s2p1d', 'C': 'C_pbe_8.0au_50Ry_2s2d1p', 'N': 'N_pbe_7.0au_50Ry_2s2p1d', 'O': 'O_pbe_7.0au_50Ry_2s2p1d', 'F': 'F_pbe_7.0au_50Ry_2s2p1d', 'Na': 'Na_pbe_12.0au_50Ry_2s2p1d', 'Mg': 'Mg_pbe_12.0au_50Ry_2s2p1d', 'Al': 'Al_pbe_11.0au_50Ry_2s2d1p', 'Si': 'Si_pbe_10.0au_50Ry_2s2p1d', 'P': 'P_pbe_9.0au_50Ry_2s2p1d', 'S': 'S_pbe_8.0au_50Ry_2s2p1d', 'Cl': 'Cl_pbe_8.0au_50Ry_2s2d1p', 'K': 'K_pbe_12.0au_50Ry_2s2p1d', 'Ti': 'Ti_pbe_11.0au_100Ry_2s2p2d', 'Mn': 'Mn_pbe_10.0au_100Ry_2s2p2d', 'Fe': 'Fe_pbe_9.0au_100Ry_2s2p2d', 'Cu': 'Cu_pbe_8.0au_100Ry_2s2p2d', 'Zn': 'Zn_pbe_9.0au_120Ry_2s2p2d', 'Ga': 'Ga_pbe_9.0au_100Ry_2s2p2d', 'Br': 'Br_pbe_8.0au_50Ry_2s2p1d', 'I': 'I_pbe_8.0au_50Ry_2s2p2d'}, 'SG15std': {'Ag': 'Ag_gga_9au_60Ry_4s2p2d1f.orb', 'Al': 'Al_gga_9au_60Ry_4s4p1d.orb', 'Ar': 'Ar_gga_7au_60Ry_2s2p1d.orb', 'As': 'As_gga_8au_60Ry_2s2p1d.orb', 'Au': 'Au_gga_9au_60Ry_4s2p2d1f.orb', 'Ba': 'Ba_gga_11au_60Ry_4s2p2d.orb', 'Be': 'Be_gga_8au_60Ry_4s1p.orb', 'Bi': 'Bi_gga_9au_60Ry_2s2p2d.orb', 'Br': 'Br_gga_8au_60Ry_2s2p1d.orb', 'B': 'B_gga_8au_60Ry_2s2p1d.orb', 'Ca': 'Ca_gga_9au_60Ry_4s2p1d.orb', 'Cd': 'Cd_gga_9au_60Ry_4s2p2d1f.orb', 'Cl': 'Cl_gga_8au_60Ry_2s2p1d.orb', 'Co': 'Co_gga_9au_60Ry_4s2p2d1f.orb', 'Cr': 'Cr_gga_9au_60Ry_4s2p2d1f.orb', 'Cs': 'Cs_gga_11au_60Ry_4s2p1d.orb', 'Cu': 'Cu_gga_9au_60Ry_4s2p2d1f.orb', 'C': 'C_gga_8au_60Ry_2s2p1d.orb', 'Fe': 'Fe_gga_9au_60Ry_4s2p2d1f.orb', 'F': 'F_gga_7au_60Ry_2s2p1d.orb', 'Ga': 'Ga_gga_9au_60Ry_2s2p2d.orb', 'Ge': 'Ge_gga_8au_60Ry_2s2p2d.orb', 'He': 'He_gga_6au_60Ry_2s1p.orb', 'Hf': 'Hf_gga_10au_60Ry_4s2p2d2f.orb', 'Hg': 'Hg_gga_9au_60Ry_4s2p2d1f.orb', 'H': 'H_gga_8au_60Ry_2s1p.orb', 'In': 'In_gga_9au_60Ry_2s2p2d.orb', 'Ir': 'Ir_gga_9au_60Ry_4s2p2d1f.orb', 'I': 'I_gga_8au_60Ry_2s2p2d.orb', 'Kr': 'Kr_gga_7au_60Ry_2s2p1d.orb', 'K': 'K_gga_9au_60Ry_4s2p1d.orb', 'Li': 'Li_gga_9au_60Ry_4s1p.orb', 'Mg': 'Mg_gga_9au_60Ry_4s2p1d.orb', 'Mn': 'Mn_gga_9au_60Ry_4s2p2d1f.orb', 'Mo': 'Mo_gga_9au_60Ry_4s2p2d1f.orb', 'Na': 'Na_gga_10au_60Ry_4s2p1d.orb', 'Nb': 'Nb_gga_9au_60Ry_4s2p2d1f.orb', 'Ne': 'Ne_gga_6au_60Ry_2s2p1d.orb', 'Ni': 'Ni_gga_9au_60Ry_4s2p2d1f.orb', 'N': 'N_gga_8au_60Ry_2s2p1d.orb', 'Os': 'Os_gga_9au_60Ry_4s2p2d1f.orb', 'O': 'O_gga_7au_60Ry_2s2p1d.orb', 'Pb': 'Pb_gga_9au_60Ry_2s2p2d.orb', 'Pd': 'Pd_gga_9au_60Ry_4s2p2d1f.orb', 'Pt': 'Pt_gga_9au_60Ry_4s2p2d1f.orb', 'P': 'P_gga_8au_60Ry_2s2p1d.orb', 'Rb': 'Rb_gga_10au_60Ry_4s2p1d.orb', 'Re': 'Re_gga_10au_60Ry_4s2p2d1f.orb', 'Rh': 'Rh_gga_9au_60Ry_4s2p2d1f.orb', 'Ru': 'Ru_gga_9au_60Ry_4s2p2d1f.orb', 'Sb': 'Sb_gga_9au_60Ry_2s2p2d.orb', 'Sc': 'Sc_gga_9au_60Ry_4s2p2d1f.orb', 'Se': 'Se_gga_8au_60Ry_2s2p1d.orb', 'Si': 'Si_gga_8au_60Ry_2s2p1d.orb', 'Sn': 'Sn_gga_9au_60Ry_2s2p2d.orb', 'Sr': 'Sr_gga_10au_60Ry_4s2p1d.orb', 'S': 'S_gga_8au_60Ry_2s2p1d.orb', 'Ta': 'Ta_gga_10au_60Ry_4s2p2d2f.orb', 'Tc': 'Tc_gga_9au_60Ry_4s2p2d1f.orb', 'Te': 'Te_gga_9au_60Ry_2s2p2d.orb', 'Ti': 'Ti_gga_9au_60Ry_4s2p2d1f.orb', 'Tl': 'Tl_gga_9au_60Ry_2s2p2d.orb', 'V': 'V_gga_9au_60Ry_4s2p2d1f.orb', 'W': 'W_gga_10au_60Ry_4s2p2d2f.orb', 'Xe': 'Xe_gga_8au_60Ry_2s2p2d.orb', 'Y': 'Y_gga_9au_60Ry_4s2p2d1f.orb', 'Zn': 'Zn_gga_9au_60Ry_4s2p2d1f.orb', 'Zr': 'Zr_gga_9au_60Ry_4s2p2d1f.orb'}, 'SG15act': {'Ag': 'Ag_gga_9au_100Ry_4s2p2d1f.orb', 'Al': 'Al_gga_9au_100Ry_4s4p1d.orb', 'Ar': 'Ar_gga_7au_100Ry_2s2p1d.orb', 'As': 'As_gga_8au_100Ry_2s2p1d.orb', 'Au': 'Au_gga_9au_100Ry_4s2p2d1f.orb', 'B': 'B_gga_8au_100Ry_2s2p1d.orb', 'Ba': 'Ba_gga_11au_100Ry_4s2p2d.orb', 'Be': 'Be_gga_8au_100Ry_4s1p.orb', 'Bi': 'Bi_gga_9au_100Ry_2s2p2d.orb', 'Br': 'Br_gga_8au_100Ry_2s2p1d.orb', 'C': 'C_gga_8au_100Ry_2s2p1d.orb', 'Ca': 'Ca_gga_9au_100Ry_4s2p1d.orb', 'Cd': 'Cd_gga_9au_100Ry_4s2p2d1f.orb', 'Cl': 'Cl_gga_8au_100Ry_2s2p1d.orb', 'Co': 'Co_gga_9au_100Ry_4s2p2d1f.orb', 'Cr': 'Cr_gga_9au_100Ry_4s2p2d1f.orb', 'Cs': 'Cs_gga_11au_100Ry_4s2p1d.orb', 'Cu': 'Cu_gga_9au_100Ry_4s2p2d1f.orb', 'F': 'F_gga_7au_100Ry_2s2p1d.orb', 'Fe': 'Fe_gga_9au_100Ry_4s2p2d1f.orb', 'Ga': 'Ga_gga_9au_100Ry_2s2p2d.orb', 'Ge': 'Ge_gga_8au_100Ry_2s2p2d.orb', 'H': 'H_gga_8au_100Ry_2s1p.orb', 'He': 'He_gga_6au_100Ry_2s1p.orb', 'Hf': 'Hf_gga_10au_100Ry_4s2p2d2f.orb', 'Hg': 'Hg_gga_9au_100Ry_4s2p2d1f.orb', 'I': 'I_gga_8au_100Ry_2s2p2d.orb', 'In': 'In_gga_9au_100Ry_2s2p2d.orb', 'Ir': 'Ir_gga_9au_100Ry_4s2p2d1f.orb', 'K': 'K_gga_9au_100Ry_4s2p1d.orb', 'Kr': 'Kr_gga_7au_100Ry_2s2p1d.orb', 'Li': 'Li_gga_9au_100Ry_4s1p.orb', 'Mg': 'Mg_gga_9au_100Ry_4s2p1d.orb', 'Mn': 'Mn_gga_9au_100Ry_4s2p2d1f.orb', 'Mo': 'Mo_gga_9au_100Ry_4s2p2d1f.orb', 'N': 'N_gga_8au_100Ry_2s2p1d.orb', 'Na': 'Na_gga_9au_100Ry_4s2p1d.orb', 'Nb': 'Nb_gga_9au_100Ry_4s2p2d1f.orb', 'Ne': 'Ne_gga_6au_100Ry_2s2p1d.orb', 'Ni': 'Ni_gga_9au_100Ry_4s2p2d1f.orb', 'O': 'O_gga_7au_100Ry_2s2p1d.orb', 'Os': 'Os_gga_9au_100Ry_4s2p2d1f.orb', 'P': 'P_gga_8au_100Ry_2s2p1d.orb', 'Pb': 'Pb_gga_9au_100Ry_2s2p2d.orb', 'Pd': 'Pd_gga_9au_100Ry_4s2p2d1f.orb', 'Pt': 'Pt_gga_9au_100Ry_4s2p2d1f.orb', 'Rb': 'Rb_gga_10au_100Ry_4s2p1d.orb', 'Re': 'Re_gga_10au_100Ry_4s2p2d1f.orb', 'Rh': 'Rh_gga_9au_100Ry_4s2p2d1f.orb', 'Ru': 'Ru_gga_9au_100Ry_4s2p2d1f.orb', 'S': 'S_gga_8au_100Ry_2s2p1d.orb', 'Sb': 'Sb_gga_9au_100Ry_2s2p2d.orb', 'Sc': 'Sc_gga_9au_100Ry_4s2p2d1f.orb', 'Se': 'Se_gga_8au_100Ry_2s2p1d.orb', 'Si': 'Si_gga_8au_100Ry_2s2p1d.orb', 'Sn': 'Sn_gga_9au_100Ry_2s2p2d.orb', 'Sr': 'Sr_gga_10au_100Ry_4s2p1d.orb', 'Ta': 'Ta_gga_10au_100Ry_4s2p2d2f.orb', 'Tc': 'Tc_gga_9au_100Ry_4s2p2d1f.orb', 'Te': 'Te_gga_9au_100Ry_2s2p2d.orb', 'Ti': 'Ti_gga_9au_100Ry_4s2p2d1f.orb', 'Tl': 'Tl_gga_9au_100Ry_2s2p2d.orb', 'V': 'V_gga_9au_100Ry_4s2p2d1f.orb', 'W': 'W_gga_10au_100Ry_4s2p2d2f.orb', 'Xe': 'Xe_gga_7au_100Ry_2s2p2d.orb', 'Y': 'Y_gga_9au_100Ry_4s2p2d1f.orb', 'Zn': 'Zn_gga_9au_100Ry_4s2p2d1f.orb', 'Zr': 'Zr_gga_9au_100Ry_4s2p2d1f.orb'}, 'SG15tzdp': {'Ag': 'Ag_gga_9au_100Ry_5s3p3d2f.orb', 'Al': 'Al_gga_9au_100Ry_5s5p2d.orb', 'Ar': 'Ar_gga_8au_100Ry_3s3p2d.orb', 'As': 'As_gga_8au_100Ry_3s3p2d.orb', 'Au': 'Au_gga_9au_100Ry_5s3p3d2f.orb', 'Ba': 'Ba_gga_11au_100Ry_5s3p3d1f.orb', 'Be': 'Be_gga_8au_100Ry_5s2p.orb', 'Bi': 'Bi_gga_9au_100Ry_3s3p3d1f.orb', 'Br': 'Br_gga_8au_100Ry_3s3p2d.orb', 'B': 'B_gga_8au_100Ry_3s3p2d.orb', 'Ca': 'Ca_gga_9au_100Ry_5s3p2d.orb', 'Cd': 'Cd_gga_9au_100Ry_5s3p3d2f.orb', 'Cl': 'Cl_gga_8au_100Ry_3s3p2d.orb', 'Co': 'Co_gga_9au_100Ry_5s3p3d2f.orb', 'Cr': 'Cr_gga_9au_100Ry_5s3p3d2f.orb', 'Cs': 'Cs_gga_11au_100Ry_5s3p2d.orb', 'Cu': 'Cu_gga_9au_100Ry_5s3p3d2f.orb', 'C': 'C_gga_8au_100Ry_3s3p2d.orb', 'Fe': 'Fe_gga_9au_100Ry_5s3p3d2f.orb', 'F': 'F_gga_8au_100Ry_3s3p2d.orb', 'Ga': 'Ga_gga_9au_100Ry_3s3p3d1f.orb', 'Ge': 'Ge_gga_8au_100Ry_3s3p3d1f.orb', 'He': 'He_gga_8au_100Ry_3s2p.orb', 'Hf': 'Hf_gga_10au_100Ry_5s3p3d3f1g.orb', 'Hg': 'Hg_gga_9au_100Ry_5s3p3d2f.orb', 'H': 'H_gga_8au_100Ry_3s2p.orb', 'In': 'In_gga_10au_100Ry_3s3p3d1f.orb', 'Ir': 'Ir_gga_9au_100Ry_5s3p3d2f.orb', 'I': 'I_gga_8au_100Ry_3s3p3d1f.orb', 'Kr': 'Kr_gga_8au_100Ry_3s3p2d.orb', 'K': 'K_gga_9au_100Ry_5s3p2d.orb', 'Li': 'Li_gga_9au_100Ry_5s2p.orb', 'Mg': 'Mg_gga_9au_100Ry_5s3p2d.orb', 'Mn': 'Mn_gga_9au_100Ry_5s3p3d2f.orb', 'Mo': 'Mo_gga_9au_100Ry_5s3p3d2f.orb', 'Na': 'Na_gga_9au_100Ry_5s3p2d.orb', 'Nb': 'Nb_gga_10au_100Ry_5s3p3d2f.orb', 'Ne': 'Ne_gga_8au_100Ry_3s3p2d.orb', 'Ni': 'Ni_gga_9au_100Ry_5s3p3d2f.orb', 'N': 'N_gga_8au_100Ry_3s3p2d.orb', 'Os': 'Os_gga_9au_100Ry_5s3p3d2f.orb', 'O': 'O_gga_8au_100Ry_3s3p2d.orb', 'Pb': 'Pb_gga_10au_100Ry_3s3p3d1f.orb', 'Pd': 'Pd_gga_9au_100Ry_5s3p3d2f.orb', 'Pt': 'Pt_gga_9au_100Ry_5s3p3d2f.orb', 'P': 'P_gga_8au_100Ry_3s3p2d.orb', 'Rb': 'Rb_gga_10au_100Ry_5s3p2d.orb', 'Re': 'Re_gga_10au_100Ry_5s3p3d2f.orb', 'Rh': 'Rh_gga_9au_100Ry_5s3p3d2f.orb', 'Ru': 'Ru_gga_9au_100Ry_5s3p3d2f.orb', 'Sb': 'Sb_gga_9au_100Ry_3s3p3d1f.orb', 'Sc': 'Sc_gga_10au_100Ry_5s3p3d2f.orb', 'Se': 'Se_gga_8au_100Ry_3s3p2d.orb', 'Si': 'Si_gga_8au_100Ry_3s3p2d.orb', 'Sn': 'Sn_gga_10au_100Ry_3s3p3d1f.orb', 'Sr': 'Sr_gga_10au_100Ry_5s3p2d.orb', 'S': 'S_gga_8au_100Ry_3s3p2d.orb', 'Ta': 'Ta_gga_10au_100Ry_5s3p3d3f1g.orb', 'Tc': 'Tc_gga_10au_100Ry_5s3p3d2f.orb', 'Te': 'Te_gga_9au_100Ry_3s3p3d1f.orb', 'Ti': 'Ti_gga_9au_100Ry_5s3p3d2f.orb', 'Tl': 'Tl_gga_10au_100Ry_3s3p3d1f.orb', 'V': 'V_gga_9au_100Ry_5s3p3d2f.orb', 'W': 'W_gga_10au_100Ry_5s3p3d3f1g.orb', 'Xe': 'Xe_gga_8au_100Ry_3s3p3d1f.orb', 'Y': 'Y_gga_10au_100Ry_5s3p3d2f.orb', 'Zn': 'Zn_gga_9au_100Ry_5s3p3d2f.orb', 'Zr': 'Zr_gga_9au_100Ry_5s3p3d2f.orb'} }
""" Unit test module How to debug test: $ pytest -s # disable all capturing """
class Building: def __init__(s,x,y,a,b,h=10): s.x,s.y,s.a,s.b,s.h=x,y,a,b,h __repr__ = lambda s: "Building({}, {}, {}, {}, {})".format(s.x,s.y,s.a,s.b,s.h) area,volume = lambda s: s.a*s.b,lambda s: s.a*s.b*s.h corners = lambda s: {"south-west":(s.x,s.y),"north-east":(s.x+s.b,s.y+s.a), "south-east":(s.x,s.y+s.a),"north-west":(s.x+s.b,s.y)}
##for i in range(0,5): ## for j in range(5,i,-1): ## ## print(j,end='') ## ## ## print() for i in range(5,0,-1): for j in range(1,i+1): print(i,end='') print()
class User: def __init__(self, user_name, email=None): self.name = user_name self.email = email self.expense_dict = {} def add_entry(self, user, amount): print(f"Now updating Entry {user.name} for {self.name}'s dict.") if self.expense_dict.get(user, None) is not None: print(f"Previous entry was {self.expense_dict[user]}") self.expense_dict[user] += amount print(f"New entry is {self.expense_dict[user]}") else: self.expense_dict[user] = amount def get_report(self): for user in self.expense_dict: amount = self.expense_dict[user] if amount < 0: print(f"{self.name} owes {user.name} {-1*amount} $") else: print(f"{self.name} has loaned {user.name} {amount} $")
# 問題URL: https://atcoder.jp/contests/abc128/tasks/abc128_d # 解答URL: https://atcoder.jp/contests/abc128/submissions/14707279 n, k = map(int, input().split()) v = [int(i) for i in input().split()] ans = 0 for a in range(min(n, k) + 1): pa, va = v[:a], v[a:] for b in range(min(n, k) - a + 1): pb = pa + va[-b:] if b > 0 else pa pb.sort() s = sum(pb) ans = max(s, ans) for c in range(min(k - a - b, a + b)): s -= pb[c] ans = max(s, ans) print(ans)
_base_ = [ '../_base_/models/oscar/oscar_nlvr2_config.py', '../_base_/datasets/oscar/oscar_nlvr2_dataset.py', '../_base_/default_runtime.py', ] # cover the parrmeter in above files model = dict(params=dict(model_name_or_path='/home/datasets/mix_data/model/vinvl/vqa/large/checkpoint-2000000', )) lr_config = dict( num_warmup_steps=5000, # warmup_proportion=0 num_training_steps=36000, # ceil(totoal 86373 / batch size 72 / GPUS 1) * epoch size 20 ) data_root = '/home/datasets/mix_data/vinvl/datasets/nlvr2' nlvr_reader_train_cfg = dict( model_name_or_path='/home/datasets/mix_data/model/vinvl/vqa/large/checkpoint-2000000', data_dir=data_root, ) nlvr_reader_test_cfg = dict( model_name_or_path='/home/datasets/mix_data/model/vinvl/vqa/large/checkpoint-2000000', data_dir=data_root, ) train_data = dict( samples_per_gpu=24, data=dict(reader=nlvr_reader_train_cfg, ), sampler='DistributedSampler', ) test_data = dict(data=dict(reader=nlvr_reader_test_cfg, ), )
class Required(object): """ A class holding a dictionary of required fields for variety of transaction supported by pypesa """ re_customer_to_bussiness = { "input_Amount", "input_Country", "input_Currency", "input_CustomerMSISDN", "input_ServiceProviderCode", "input_ThirdPartyConversationID", "input_TransactionReference", "input_PurchasedItemsDesc", } re_bussiness_to_customer = { "input_Amount", "input_Country", "input_Currency", "input_CustomerMSISDN", "input_ServiceProviderCode", "input_ThirdPartyConversationID", "input_TransactionReference", "input_PaymentItemsDesc", } re_bussiness_to_bussiness = { "input_Amount", "input_Country", "input_Currency", "input_PrimaryPartyCode", "input_ReceiverPartyCode", "input_ThirdPartyConversationID", "input_TransactionReference", "input_PurchasedItemsDesc", } re_payment_reversal = { "input_Country", "input_ReversalAmount", "input_ServiceProviderCode", "input_ThirdPartyConversationID", "input_TransactionID", } re_transaction_status = { "input_Country", "input_QueryReference", "input_ServiceProviderCode", "input_ThirdPartyConversationID", } re_create_direct_debit = { "input_AgreedTC", "input_Country", "input_CustomerMSISDN", "input_EndRangeOfDays", "input_ExpiryDate", "input_FirstPaymentDate", "input_Frequency", "input_ServiceProviderCode", "input_StartRangeOfDays", "input_ThirdPartyConversationID", "input_ThirdPartyReference", } re_direct_debit_payment = { "input_Amount", "input_Country", "input_Currency", "input_CustomerMSISDN", "input_ServiceProviderCode", "input_ThirdPartyConversationID", "input_ThirdPartyReference", } class sandbox(Required): """ Service URL to be used during sandbox Development """ def __init__(self): self.session_id = ( "https://openapi.m-pesa.com/sandbox/ipg/v2/vodacomTZN/getSession/" ) self.single_stage_c2b = "https://openapi.m-pesa.com:443/sandbox/ipg/v2/vodacomTZN/c2bPayment/singleStage/" self.single_stage_b2c = ( "https://openapi.m-pesa.com:443/sandbox/ipg/v2/vodacomTZN/b2cPayment/" ) self.single_stage_b2b = ( "https://openapi.m-pesa.com:443/sandbox/ipg/v2/vodacomTZN/b2bPayment/" ) self.payment_reversal = ( "https://openapi.m-pesa.com:433/sandbox/ipg/v2/vodacomTZN/reversal/" ) self.transaction_status = "https://openapi.m-pesa.com:443/sandbox/ipg/v2/vodacomTZN/queryTransactionStatus/" self.direct_debit = "https://openapi.m-pesa.com:443/sandbox/ipg/v2/vodacomTZN/directDebitCreation/" self.direct_debit_payment = "https://openapi.m-pesa.com:443/sandbox/ipg/v2/vodacomTZN/directDebitPayment/" def __str__(self) -> str: return '<Using Sandbox Urls>' def __str__(self) -> str: return '<Using Sandbox Urls>' class production(Required): """ Service URL to be used for Production Development """ def __init__(self): self.session_id = ( "https://openapi.m-pesa.com/openapi/ipg/v2/vodacomTZN/getSession/" ) self.single_stage_c2b = "https://openapi.m-pesa.com:443/openapi/ipg/v2/vodacomTZN/c2bPayment/singleStage/" self.single_stage_b2c = ( "https://openapi.m-pesa.com:443//openapi/ipg/v2/vodacomTZN/b2cPayment/" ) self.single_stage_b2b = ( "https://openapi.m-pesa.com:443/openapi/ipg/v2/vodacomTZN/b2bPayment/" ) self.payment_reversal = ( "https://openapi.m-pesa.com:443/openapi/ipg/v2/vodacomTZN/reversal/" ) self.transaction_status = "https://openapi.m-pesa.com:443/openapi/ipg/v2/vodacomTZN/queryTransactionStatus/" self.direct_debit = "https://openapi.m-pesa.com:443/openapi/ipg/v2/vodacomTZN/directDebitCreation/" self.direct_debit_payment = "https://openapi.m-pesa.com:443/openapi/ipg/v2/vodacomTZN/directDebitPayment/" def __str__(self) -> str: return '<Using Production Urls>' def __repr__(self) -> str: return '<Using Production Urls>'
mcl = [[-5.592134638754766e-05, 1e6], [-6.441295571105171e-05, 1e6], [-2.7292256647813406e-05, 1e6], [-5.738494934280777e-05, 1e6], [-3.920474118683737e-05, 1e6]] accval, accruns = 0, 0 for mcrun in mcl: accval += mcrun[0]*mcrun[1] accruns += mcrun[1] print(accruns, ': ', accval/accruns)
greet=' hello bob ' greet.strip() print(greet) #right strip greet=' hello bob ' greet.rstrip() print(greet) #left strip greet=' hello bob ' greet.lstrip() print(greet)
# # PySNMP MIB module CPQSANAPP-MIB (http://snmplabs.com/pysmi) # ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/CPQSANAPP-MIB # Produced by pysmi-0.3.4 at Mon Apr 29 18:12:09 2019 # On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4 # Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15) # ObjectIdentifier, Integer, OctetString = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "Integer", "OctetString") NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues") ValueRangeConstraint, ValueSizeConstraint, ConstraintsUnion, ConstraintsIntersection, SingleValueConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueRangeConstraint", "ValueSizeConstraint", "ConstraintsUnion", "ConstraintsIntersection", "SingleValueConstraint") ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "NotificationGroup") TimeTicks, Counter32, NotificationType, ModuleIdentity, Bits, enterprises, NotificationType, Counter64, Unsigned32, IpAddress, iso, Gauge32, ObjectIdentity, Integer32, MibIdentifier, MibScalar, MibTable, MibTableRow, MibTableColumn = mibBuilder.importSymbols("SNMPv2-SMI", "TimeTicks", "Counter32", "NotificationType", "ModuleIdentity", "Bits", "enterprises", "NotificationType", "Counter64", "Unsigned32", "IpAddress", "iso", "Gauge32", "ObjectIdentity", "Integer32", "MibIdentifier", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn") TextualConvention, DisplayString = mibBuilder.importSymbols("SNMPv2-TC", "TextualConvention", "DisplayString") compaq = MibIdentifier((1, 3, 6, 1, 4, 1, 232)) cpqSanAppliance = MibIdentifier((1, 3, 6, 1, 4, 1, 232, 151)) resourceMonitor = MibIdentifier((1, 3, 6, 1, 4, 1, 232, 151, 11)) swSystemName = MibScalar((1, 3, 6, 1, 4, 1, 232, 151, 11, 1), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(255, 255)).setFixedLength(255)).setMaxAccess("readwrite") if mibBuilder.loadTexts: swSystemName.setStatus('mandatory') swSystemType = MibScalar((1, 3, 6, 1, 4, 1, 232, 151, 11, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("hsg80", 1), ("switch", 2), ("appliance", 3)))).setMaxAccess("readwrite") if mibBuilder.loadTexts: swSystemType.setStatus('mandatory') swEventName = MibScalar((1, 3, 6, 1, 4, 1, 232, 151, 11, 3), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(255, 255)).setFixedLength(255)).setMaxAccess("readwrite") if mibBuilder.loadTexts: swEventName.setStatus('mandatory') swFailure = MibScalar((1, 3, 6, 1, 4, 1, 232, 151, 11, 4), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(255, 255)).setFixedLength(255)).setMaxAccess("readwrite") if mibBuilder.loadTexts: swFailure.setStatus('mandatory') swSequence = MibScalar((1, 3, 6, 1, 4, 1, 232, 151, 11, 5), Integer32()).setMaxAccess("readwrite") if mibBuilder.loadTexts: swSequence.setStatus('mandatory') swFailureTrap = NotificationType((1, 3, 6, 1, 4, 1, 232, 151, 11) + (0,1)).setObjects(("CPQSANAPP-MIB", "swSystemName"), ("CPQSANAPP-MIB", "swSystemType"), ("CPQSANAPP-MIB", "swEventName"), ("CPQSANAPP-MIB", "swFailure"), ("CPQSANAPP-MIB", "swSequence")) swWarningTrap = NotificationType((1, 3, 6, 1, 4, 1, 232, 151, 11) + (0,2)).setObjects(("CPQSANAPP-MIB", "swSystemName"), ("CPQSANAPP-MIB", "swSystemType"), ("CPQSANAPP-MIB", "swEventName"), ("CPQSANAPP-MIB", "swFailure"), ("CPQSANAPP-MIB", "swSequence")) swInformationTrap = NotificationType((1, 3, 6, 1, 4, 1, 232, 151, 11) + (0,4)).setObjects(("CPQSANAPP-MIB", "swSystemName"), ("CPQSANAPP-MIB", "swSystemType"), ("CPQSANAPP-MIB", "swEventName"), ("CPQSANAPP-MIB", "swFailure"), ("CPQSANAPP-MIB", "swSequence")) mibBuilder.exportSymbols("CPQSANAPP-MIB", compaq=compaq, swWarningTrap=swWarningTrap, swInformationTrap=swInformationTrap, swSequence=swSequence, swEventName=swEventName, swSystemName=swSystemName, swSystemType=swSystemType, resourceMonitor=resourceMonitor, swFailure=swFailure, cpqSanAppliance=cpqSanAppliance, swFailureTrap=swFailureTrap)
class Factorial: def __init__(self): self.fact = [1] def __call__(self,n): if n < len(self.fact): return 1 else: fact_number = n * self(n-1) self.fact.append(fact_number) return self.fact[n] factorial_of_n = Factorial() n = int(input("n = ")) print(factorial_of_n(n))
def permutation(text, anchor, p): if anchor == len(text): p.add("".join(text)) return for i in range(anchor, len(text)): text[anchor], text[i] = text[i], text[anchor] permutation(text, anchor + 1, p) text[anchor], text[i] = text[i], text[anchor] if __name__ == "__main__": text = "abc" p = set() permutation(list(text), 0, p) print(p) text = "abcd" p = set() permutation(list(text), 0, p) print(p)
_config = { "class": "class" } def config(): return _config
fixthis = """ YOUR STORY GOES HERE """
######################## GLOBAL VARIABLES ######################### BINANCE = True # Variable to indicate which exchange to use: True for BINANCE, False for FTX SHITCOIN = 'ftm' MULTI_TF = True TF_LIST = ['4h','1h','15m','5m','1m'] TF = '1h' LEVELS_PER_TF = 3 # Number of levels per Time Frame to include in the list of DCAs DAYS_BACK = 90 # Number of days to look back in time for initial candles data TRADE_ON = False ################################################################### # Balance variables MAX_BAL_PER_COIN = 10 # Maximum percentage of balance to use per asset/coin LVRG = 20 # Take Profit variables TPGRID_MIN_DIST = 0.2 # Percentage to use for the closest order in the TP grid TPGRID_MAX_DIST = 0.8 # Percentage to use for the farthest order in the TP grid TP_ORDERS = 6 # Number of orders for the TP grid DCA_FACTOR_MULT = 1.75 # Factor to multiply each DCA entry in the grid (it will multiply the amount of previous DCA by this factor) ASSYMMETRIC_TP = False # False for equal sized orders, False for descending size TP orders MIN_LEVEL_DISTANCE = 0.8 # Variable to indicate what % will be the minimum valid distance between levels found
# enable_pin 메소드는 아직 코딩되지 않았습니다. # 코드가 오류없이 실행되도록 더미 메소드를 만들었습니다. # 여러분이 이 장의 코드를 이해하지 못한다고 해서 놀라지 마세요. # 별도의 챕터에서 메소드를 다룰 것입니다. def enable_pin(user, pin): print('pin enabled') # current_user 와 pin에 테스트값을 넣었습니다. current_user = 'TEST123' pin = '123456' # enable_pin에 인자를 넣어 pin을 활성화시켜보세요. enable_pin(current_user, pin)
# def sumar_numeros(numero1 = 1, numero2 = 1) -> int: # Esto es una pista de lo que debe retornar la funcion # return numero1 + numero2 # print('Llamado a función con valores por default', sumar_numeros()) # print('Llamado a función suma con valores asignados', sumar_numeros(2,10)) # #Cuando no se conoce el numero de argumentos # #--------------- # # ARGUMENTOS VARIABLES # #--------------- # def nombres_estudiantes(*nombres): # for nombre_individual in nombres: # print(f'El nombre del estudiante es: {nombre_individual}') # nombres_estudiantes('Juan', 'Carlos', 'Sara', 'Lucas', 'Timoteo') # def sumar_numeros(*args): # for x in args: # x *= x # return x # print('El resultado es {}'.format(sumar_numeros(1,2,3,4,5))) # #---------------- # # ENCRIPTAR CON HASHES # #--------------- # # ARGUMENTOS VARIABLES LLAVE-VALOR # #--------------- # import hashlib # def listar_nombres(**users): # for key, value in users.items(): # print(f'{key}: {value}') # h=hashlib.new('sha512',b"clavexd") # listar_nombres(juan_castellanos={'Account':'correoexample@examplemail.com','password':h.hexdigest()}) # #---------------- # # Funciones Recursivas # #---------------- # def factorial(numero): # if numero == 1: # return 1 # else: # return numero * factorial(numero-1) # resultado = factorial(5) # print(f'El factorial de 5 es {resultado}') # def numeros_desc(numero): # if numero>0: # if numero == 1: # print(1) # else: # print(numero) # numeros_desc(numero-1) # else: # print('No es válido para numeros negativos ') # numeros_desc(5) def calcular_total(pago_sin_impuesto, impuesto): pago_sin_impuesto+=(impuesto/100)*pago_sin_impuesto return pago_sin_impuesto print(calcular_total(float(input("Solicite el valor sin impuesto \n --> ")),float(input("Digite el impuesto\n --> ")))) def celsius_fahrenheit(celsius): return celsius * 9/5 +32 def fahrenheit_celsius(fahrenheit): return (fahrenheit-32)* 5/9 print('Los grados en fahrenheit son: {}'.format(celsius_fahrenheit(float(input(" Please enter a temperature in celsius \n---> "))))) print('Los grados en celsius son: {}'.format(fahrenheit_celsius(float(input(" Please enter a temperature in fahrenheit \n---> ")))))
# https://codeforces.com/problemset/problem/266/A n = int(input()) s = input() ans = 0 for i in range(n - 1): if s[i] == s[i + 1]: ans += 1 print(ans)
def generate_list(): output_list = [x ** 2 for x in list(range(1, 21))] print(output_list) generate_list()
class DynamoDataAttribute(object): def __init__(self, datatype, value=None, initialized=True): """initialize the DynamoDataAttribute This class stores the current value of the attribute on the model and some extra metadata about the attribute itself datatype - the Datatype of the corresponding Model attribute value - the current value initialized - if this attribute was included when the Model was instantiated _changed - has the set() method be called initialized / _changed help determine what attributes to include in the model.put() and model.update() value is built using datatype.build() to handle default values """ self.datatype = datatype self.value = self.datatype.build(value) self.initialized = initialized self._changed = False def get(self): return self.value def set(self, newvalue): self._changed = True self.value = newvalue
def assert_modal_view_shown(running_app, klass=None): assert running_app.root_window.children if klass: klass_found = False children = running_app.root_window.children for child in children: klass_found |= isinstance(child, klass) assert klass_found, "%s modal view not found in %s" % (klass, children) def assert_modal_view_not_shown(running_app, klass=None): if not klass: assert not running_app.root_window.children else: klass_found = False children = running_app.root_window.children for child in children: klass_found |= isinstance(child, klass) assert not klass_found, "%s modal view found in %s" % (klass, children) def assert_tracker_event_sent(tracker, category, action, *args, **kwargs): tracker.send_event.assert_called_with(category, action, *args, **kwargs) def assert_bought(billing, sku, *args, **kwargs): billing.buy.assert_any_call(sku, *args, **kwargs) def assert_achievement_incremented(google_client, name): google_client.increment_achievement.assert_any_call(name) def assert_achievement_unlocked(google_client, name): google_client.unlock_achievement.assert_any_call(name) def assert_leaderboard_score_submitted(google_client, name, score): google_client.submit_score.assert_any_call(name, score) def assert_vibrated(vibrator, length): vibrator.vibrate.assert_any_call(length)
#!/usr/bin/env python3 def check_kwarg(kwargs, name, default=None, arg_type=None, required=False, pop=False): """ Simple function for checking a kwarg. Useful if you don't want to create a new object to check a kwarg or two. Pop=True will remove the kwarg entry from kwargs if found. """ if required: assert name in kwargs, "\n".join([ "", 40*"#", f"## {name} not in kwargs", f"## kwargs has {kwargs.keys()}", 40*"#", ""]) out = default if name in kwargs: out = kwargs.pop(name) if pop else kwargs[name] type_handle = _assert_types(out, name=name, arg_type=arg_type) if type_handle is None: # No type casting return out elif isinstance(type_handle, (list, tuple)): # Type casting elements in a list return [th(element) for th, element in zip(type_handle, out)] else: # Type casting a single output variable return type_handle(out) def get_check_kwarg_fu(function_kwargs, pop=False): """ Create a simple function for checking kwargs. Useful if you don't need long term storage of KwargChecker and find supplying kwargs to check_kwarg as an argument annoying. Pop will pop entries out of the kwargs list if found. """ def fu(name, default=None, arg_type=None, required=False): return check_kwarg(function_kwargs, name, default=default, arg_type=arg_type, required=required, pop=pop) return fu def check_add_kwarg(kwargs, name, default=None, arg_type=None, force=False): """ Simple function for checking if a name is in kwargs and adding a default value if it isn't. If force is True, it will overwrite an existing value with default. It will also return the existing or default value. """ # Add or set the default if applicable if name not in kwargs or force: kwargs[name] = default out = kwargs[name] type_handle = _assert_types(out, name=name, arg_type=arg_type) if type_handle is None: # No type casting return out elif isinstance(type_handle, (list, tuple)): # Type casting elements in a list return [th(element) for th, element in zip(type_handle, out)] else: # Type casting a single output variable return type_handle(out) def get_check_add_kwarg_fu(function_kwargs): """ Create a simple function for checking and adding kwargs. """ def fu(name, default=None, arg_type=None, force=False): return check_add_kwarg(function_kwargs, name, default=default, arg_type=arg_type, force=force) return fu def _generic_assert_type(arg, arg_name, type_handle, type_name, type_casting_ok): """Assert if the arg is of type(s) type_handle or, if type_casting_ok is True, assert if the arg can be cast to any of type_handle. Parameters ---------- arg : The variable being checked. arg_name : string The name of the variable used for the error message. type_handle : The handle for the variable type desired. Can be a single handle (e.g. type_handle=int) or a sequence of handles (e.g. type_handle=(int, float)). type_name : The name of the type(s) for the error message. (e.g. 'int or float') type_casting_ok: Indicates whether type casting is allowed. However, the function only checks that it is possible. **The function does not actually recast the variable.** Returns ------- type_handle : The returned type handle will be the same as the input type_handle unless type_casting_ok is True and there are multiple accepted types. If so, the return handle will be the first successful type to cast the variable. """ error_message = f"{arg_name} ({type(arg)}) must be of type {type_name}" output_type_handle = type_handle try: # See if arg is of type(s) type_handle assert isinstance(arg, type_handle), error_message except AssertionError as wrong_type_error: # arg is not of type type_handle # If type casting is not allowed, re-raise the failure if not type_casting_ok: raise wrong_type_error # Type casting is allowed, see if arg can be casted to type(s) # type_handle if isinstance(type_handle, (tuple, list)): # Multiple accepted types, see if arg can be cast to any # RETURNS the first type handle that is successful for th in type_handle: try: assert isinstance(th(arg), th) output_type_handle = th break except: pass else: # Failed to find a valid casting type raise wrong_type_error else: # Single accepted type, see if arg can be cast to it try: assert isinstance(type_handle(arg), type_handle) except (AssertionError, ValueError, TypeError): raise wrong_type_error # Assertions all passed return output_type_handle def _assert_types(arg, name='arg', arg_type=None): """Assert that arg is the correct type, if applicable. Parameters ---------- arg : The variable to be checked. name : The name of the arg to be used for error messages. arg_type : A string representing the accepted type or types for the variable. Currently handles the basic types: 'list', 'tuple', 'int', 'float', 'str', and 'bool'). Can specify extra qualifiers too. Multiple types and qualifiers can be present in the string. Order only matters if checking casting between both int and float(e.g. 'int-float' vs. 'float-int'), where the first ones are given preference. Extra qualifiers: 'none' = Allows the arg to be None even if something else was specified 'tcast' = If the var does not match the provided type(s), allows the program to check if the variable can be cast to the desired type(s). 'pos', 'whole', 'neg' = Asserts an 'int' or 'float' variable is >0, >=0, or <0, respectively. Examples: '' or None = No type specifications, check will unconditionally pass. 'float-none' = Check if the variable is a float or None. 'float-int-pos' = Check if variable is a positive (>0) float or int. 'int-whole-tcast' = Check if variable is or can be cast to a whole (>=0) int. Returns ------- If type casting is allowed, returns the successful casting type. (First one if there are multiple accepted types) If type casting is not allowed, the return variable is not useful. """ # No type requirements if arg_type is None or arg_type == '': return # Check that None is allowed if the arg is still None elif arg is None: assert 'none' in arg_type, f"{name} cannot be None" return # arg is okay, no further checking needed type_casting_ok = 'tcast' in arg_type output_type_handle = None is_sequence = False # Check list types if 'list' in arg_type or 'tuple' in arg_type: is_sequence = True # For either lists or tuples, assert that all elements are a valid type assert isinstance(arg, (list, tuple)) if isinstance(arg, list): assert 'list' in arg_type elif isinstance(arg, tuple): assert 'tuple' in arg_type output_type_handle = [] sequence_arg_type = \ arg_type.replace('list','').replace('tuple', '').strip('_- ') for element in arg: # Check each element output_type_handle.append( _assert_types( element, name=name, arg_type=sequence_arg_type) ) # Check numeric types elif 'int' in arg_type and 'float' in arg_type: # int or float allowed # The order is set by which one comes first int_idx = arg_type.index('int') float_idx = arg_type.index('float') handles = (int, float) if int_idx < float_idx else (float, int) output_type_handle = _generic_assert_type( arg, name, handles, 'float or int', type_casting_ok) elif 'int' in arg_type: output_type_handle = _generic_assert_type( arg, name, int, 'int', type_casting_ok) elif 'float' in arg_type: output_type_handle = _generic_assert_type( arg, name, float, 'float', type_casting_ok) # Check other types elif 'str' in arg_type: output_type_handle = _generic_assert_type( arg, name, str, 'string', type_casting_ok) elif 'bool' in arg_type: output_type_handle = _generic_assert_type( arg, name, bool, 'boolean', type_casting_ok) # Unknown type requirement else: print(f"Unknown arg type!") print(f"arg={arg}, name={name}, arg_type={arg_type}") raise NotImplementedError # Check numeric sign if 'int' in arg_type or 'float' in arg_type: # Check sign if 'pos' in arg_type or 'counting' in arg_type: assert arg > 0, f"{name} must be greater than zero ({arg})" elif 'whole' in arg_type: assert arg >= 0, f"{name} must be greater or equal to zero ({arg})" elif 'neg' in arg_type: assert arg < 0, f"{name} must be less than zero ({arg})" else: pass # No sign requirements # Assertions all passed. Return the output type handle. # This will be useful only if type casting is allowed. return output_type_handle if type_casting_ok else None class KwargChecker: """ Simple kwarg checking class. Better ones almost certainly exist elsewhere, but this was easy to make and does exactly what I need.""" def __init__(self, kwargs): self.kwargs = kwargs def kwarg_check(self, name, default=None): if name in self.kwargs: return self.kwargs[name] else: return default def check_add_kwarg(self, name, default=None, arg_type=None, force=False): return check_add_kwarg(self.kwargs, name, default=default, arg_type=arg_type, force=force) def check_kwarg(self, name, default=None, arg_type=None, required=False, pop=False): return check_kwarg(self.kwargs, name, default=default, arg_type=arg_type, required=required, pop=pop)
# Alexa skill APPLICATION_ID: str = "amzn1.ask.skill.dd677950-cade-4805-b1f1-ce2e3a3569f0" RESPONSE_VERSION: str = "1.0" # Bible API BIBLE_TRANSLATION = "GNBDC" # Can't use NIV - it's still in copyright BIBLE_API_URL = f"https://bibles.org/v2/eng-{BIBLE_TRANSLATION}/passages.js" # Bible Passages BIBLE_PASSAGES_CSV_URL = ("https://docs.google.com/spreadsheets/d/e/2PACX-1vQqiE5BF" "-VtKfaV9NtpwYqgT3Ijw5pRmfbg7mzIIMrV5huonrAYQPawIHzoqA-_fAsUgP4Bvcs6NgUk/pub?output=csv") # Sermons SERMONS_XML_URL = "http://www.christchurchmayfair.org/our-talks/podcast/" SERMONS_XML_NAMESPACE = { "ccm": "http://christchurchmayfair.org/", "itunes": "http://www.itunes.com/dtds/podcast-1.0.dtd" } SERMONS_XML_SERVICE_NAMES = {"morning": "Morning Service", "evening": "Evening Service"} # Alexa audio must be served from https endpoint HTTP_MP3_TO_HTTPS_M3U_API_URL = ("https://0elu033c2a.execute-api.eu-west-1.amazonaws.com/prod/" "m3uGenerator") # Config for correction of AMAZON.Date defaulting to future date if year not given FUTURE_DAYS_GO_BACK_YEAR_THRESHOLD_SERMONS = 30 FUTURE_DAYS_GO_BACK_YEAR_THRESHOLD_PASSAGES = 150 # See https://developer.amazon.com/docs/custom-skills/include-a-card-in-your-skills-response.html MAX_CARD_CHARACTERS: int = 8000 # CCM Events EVENTS_JSON_URL = "https://ccmayfair.churchsuite.co.uk/embed/calendar/json"
def sum_array(arr): if arr == None: return 0 if len(arr) == 0 or 1: return 0 else: x = max(arr) y = min(arr) arr.remove(x) arr.remove(y) return(sum(arr)) print(sum_array([1,2,3,4,4]))
# ------------------------------------------------------------------------------ # Access to the CodeHawk Binary Analyzer Analysis Results # Author: Henny Sipma # ------------------------------------------------------------------------------ # The MIT License (MIT) # # Copyright (c) 2016-2020 Kestrel Technology LLC # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in all # copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE # SOFTWARE. # ------------------------------------------------------------------------------ class MIPSRegisterBase(object): def __init__(self,bd,index,tags,args): self.bd = bd self.index = index self.tags = tags self.args = args def is_mips_register(self): return False def is_mips_stack_pointer(self): return False def is_mips_argument_register(self): return False def is_mips_special_register(self): return False def is_mips_floating_point_register(self): return False def get_key(self): return (','.join(self.tags), ','.join([str(x) for x in self.args])) # ------------------------------------------------------------------------------ # Regular MIPS Register # ------------------------------------------------------------------------------ class MIPSRegister(MIPSRegisterBase): def __init__(self,bd,index,tags,args): MIPSRegisterBase.__init__(self,bd,index,tags,args) def is_mips_register(self): return True def is_mips_argument_register(self): return self.tags[1] in [ 'a0', 'a1', 'a2', 'a3' ] def is_mips_stack_pointer(self): return self.tags[1] in [ 'sp' ] def get_argument_index(self): if self.is_mips_argument_register(): return int(self.tags[1][1:]) + 1 def __str__(self): return self.tags[1] # ------------------------------------------------------------------------------ # Regular MIPS Special Register # ------------------------------------------------------------------------------ class MIPSSpecialRegister(MIPSRegisterBase): def __init__(self,bd,index,tags,args): MIPSRegisterBase.__init__(self,bd,index,tags,args) def is_mips_special_register(self): return True def __str__(self): return self.tags[1] # ------------------------------------------------------------------------------ # Regular MIPS Floating Point Register # ------------------------------------------------------------------------------ class MIPSFloatingPointRegister(MIPSRegisterBase): def __init__(self,bd,index,tags,args): MIPSRegisterBase.__init__(self,bd,index,tags,args) def is_mips_floating_point_register(self): return True def get_register_index(self): return int(self.args[0]) def __str__(self): return '$f' + str(self.get_register_index())
class TemplateBindingExtension(MarkupExtension): """ Implements a markup extension that supports the binding between the value of a property in a template and the value of some other exposed property on the templated control. TemplateBindingExtension() TemplateBindingExtension(property: DependencyProperty) """ def ProvideValue(self,serviceProvider): """ ProvideValue(self: TemplateBindingExtension,serviceProvider: IServiceProvider) -> object Returns an object that should be set as the value on the target object's property for this markup extension. For System.Windows.TemplateBindingExtension,this is an expression (System.Windows.TemplateBindingExpression) that supports the binding. serviceProvider: An object that can provide services for the markup extension. May be null in this implementation. Returns: The expression that supports the binding. """ pass @staticmethod def __new__(self,property=None): """ __new__(cls: type) __new__(cls: type,property: DependencyProperty) """ pass Converter=property(lambda self: object(),lambda self,v: None,lambda self: None) """Gets or sets the converter that interprets between source and target of a binding. Get: Converter(self: TemplateBindingExtension) -> IValueConverter Set: Converter(self: TemplateBindingExtension)=value """ ConverterParameter=property(lambda self: object(),lambda self,v: None,lambda self: None) """Gets or sets the parameter to pass to the converter. Get: ConverterParameter(self: TemplateBindingExtension) -> object Set: ConverterParameter(self: TemplateBindingExtension)=value """ Property=property(lambda self: object(),lambda self,v: None,lambda self: None) """Gets or sets the property being bound to. Get: Property(self: TemplateBindingExtension) -> DependencyProperty Set: Property(self: TemplateBindingExtension)=value """
"""AyudaEnPython: https://www.facebook.com/groups/ayudapython """ a = int(input("Ingrese un número: ")) b = int(input("Ingrese un número: ")) if a % b == 0: print(f"El número {a} es divisible de {b}") else: print(f"El número {a} no es divisible de {b}")
# -*- coding: utf-8 -*- """ Created on Sun Sep 26 11:20:30 2021 @author: qizhe """ # -*- coding: utf-8 -*- """ Created on Sun Sep 26 10:45:37 2021 @author: qizhe """ class Solution: def maxProfit(self, prices) -> int: """ 这个参考答案了,要求最多2次交易,用动态规划来做 共5种状态 效果很好,但是没太懂其实,为什么可以这样做,好像是用“状态”;来理解 这里的状态是,第i天为……状态的最大利润 """ # 第0天结束时的状态,边界条件 buy1 = buy2 = -prices[0] sell1 = sell2 = 0 for i in range(1,len(prices)): buy1 = max(buy1,-prices[i]) # 本质上是在记录当前的最小值 sell1 = max(sell1,buy1+prices[i]) # 本质上是在记录交易最大利润 buy2 = max(buy2,sell1-prices[i]) # sell2 = max(sell2,buy2+prices[i]) print(buy1,sell1,buy2,sell2) return sell2 if __name__ == '__main__': solu = Solution() input_Str = str('hello') # input_list = input_List = [3,3,5,0,0,3,1,4,1,1,1] # input_List = [[-10]] # input_int = 6 result = solu.maxProfit(input_List) # output_Str = 'result = ' + solu.intToRoman(input_int) output_Str = 'result = ' + str(result) print(output_Str)
s = 'Aracati, Fortim, Cedro, Fortim' busca = str(input("Digite o nome de uma cidade: ")) resultado = busca.lower() in s.lower() if resultado: print("A cidade está na lista") else: print("A cidade não está na lista")
def print_bigger_number(first, second): if first > second: print(first) else: print(second)
def palindrome(number): return number == number[::-1] if __name__ == '__main__': init = int(input()) number = init + 1 while not palindrome(str(number)): number += 1 print(number - init)
""" Logforce request settings file """ USERNAME = '' PASSWORD = '' CLIENT_VERSION = '4.3.0.0' URLS = { 'development':'', 'test':'', 'production':'' }
# bad practice: I/O inside the function def say_hello(): name = input('enter a name: ') print('hello ' + name) # say_hello() # best practice: No I/O in the function def say_hello2(name): msg = 'hello ' + name msg += '\nPleased to meet you' return msg print(say_hello2('Ahmed')) name1 = input('enter a name: ') result = say_hello2(name1) result += '\nWelcome to python II' print(result)
# All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA. # Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. # Example: # Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT" # Output: ["AAAAACCCCC", "CCCCCAAAAA"] class Solution(object): def findRepeatedDnaSequences(self, s): """ :type s: str :rtype: List[str] """ if not s or len(s) == 1: return [] store = set() res = set() for i in range(len(s) - 9): if s[i:i+10] in store: res.add(s[i : i + 10]) store.add(s[i:i+10]) return list(res) # Time: O(n) # Space: O(n^2) # Difficulty: medium
def main(): # Declare nucleotide variables [Adenine, Cytosine, Guanine, Thymine] A = 0; C = 0; G = 0; T = 0; # Manage input file input = open(r"C:\Users\lawht\Desktop\Github\ROSALIND\Bioinformatics Stronghold\(1) Counting DNA Nucleotides\Counting DNA Nucleotides\rosalind_dna.txt","r"); DNA_string = input.readline(); # take first line of input file for counting # Take in input file of DNA string and count the number of each nucleotide count_nucleotides(DNA_string, A, C, G, T); input.close(); # INPUT: # s = DNA string # a,c,g,t = stored number of counted a,c,g,t # # OUTPUT: # Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s. def count_nucleotides(s, a, c, g, t): for n in s: if n == 'A': a+=1; elif n == 'C': c+=1; elif n == 'G': g+=1; elif n == 'T': t+=1; else: continue; print(a,c,g,t); return # It is required in python to call manually main() if __name__ == "__main__": main();
def get_template_filter(): return example_filter2 def example_filter2(string): return "Example2: " + string
### Migratory Birds - Solution def migratoryBirds(type_nums): count = [0] * len(type_nums) for i in type_nums: count[i] += 1 min_id = count.index(max(count)) print(min_id) birds = int(input()) type_nums = tuple(map(int, input().split()[:birds])) migratoryBirds(type_nums)
def transpose(matrix): return map(list, zip(*matrix)) M = [[1,2,3], [4,5,6]] print(transpose(M))
class Node: def __init__(self, data, parent): self.data = data self.parent = parent self.right_node = None self.left_node = None class BinarySearchTree: def __init__(self): self.root = None def remove(self, data): if self.root: self.remove_node(data, self.root) def insert(self, data): if self.root is None: self.root = Node(data, None) else: self.insert_node(data, self.root) def insert_node(self, data, node): # we have to go to the left subtree if data < node.data: if node.left_node: self.insert_node(data, node.left_node) else: node.left_node = Node(data, node) # we have to visit the right subtree else: if node.right_node: self.insert_node(data, node.right_node) else: node.right_node = Node(data, node) def remove_node(self, data, node): if node is None: return if data < node.data: self.remove_node(data, node.left_node) elif data > node.data: self.remove_node(data, node.right_node) else: if node.left_node is None and node.right_node is None: print("Removing a leaf node...%d" % node.data) parent = node.parent if parent is not None and parent.left_node == node: parent.left_node = None if parent is not None and parent.right_node == node: parent.right_node = None if parent is None: self.root = None del node elif node.left_node is None and node.right_node is not None: # node !!! print("Removing a node with single right child...") parent = node.parent if parent is not None: if parent.left_node == node: parent.left_node = node.left_node if parent.rightChild == node: parent.right_node = node.right_node else: self.root = node.right_node node.right_node.parent = parent del node elif node.right_node is None and node.left_node is not None: print("Removing a node with single left child...") parent = node.parent if parent is not None: if parent.left_node == node: parent.left_node = node.left_node if parent.right_node == node: parent.right_node = node.left_node else: self.root = node.left_node node.left_node.parent = parent del node else: print('Removing node with two children....') predecessor = self.get_predecessor(node.left_node) temp = predecessor.data predecessor.data = node.data node.data = temp self.remove_node(data, predecessor) def get_predecessor(self, node): if node.right_node: return self.get_predecessor(node.right_node) return node def traverse(self): if self.root is not None: self.traverse_in_order(self.root) def traverse_in_order(self, node): if node.left_node: self.traverse_in_order(node.left_node) print(node.data) if node.right_node: self.traverse_in_order(node.right_node) if __name__ == '__main__': bst = BinarySearchTree() bst.insert(5) bst.insert(3) bst.insert(6) bst.insert(1) bst.remove(3) bst.traverse()
# -*- coding: utf-8 -*- """ Created on 19-1-24 上午11:32 IDE PyCharm @author: Meng Dong """
""" Functions for easily setting up Tkinter window settings Author: Marco P. L. Ribeiro Date: June 2019 MIT License Copyright (c) 2019 Marco P. L. Ribeiro """ def configure_window(master, title="Python Application", width=600, height=600, resizable=True, centred=True, bg=None): '''Configure Tkinter GUI window Parameters ---------- master : Tk object title : str Application title width : int Application width height : int Application height resizable : bool Allow resizing of application centred : bool Centre application on screen bg : tkinter color string Application background colour ''' master.title(title) if centred: s_width = master.winfo_screenwidth() s_height = master.winfo_screenheight() x = (s_width - width)//2 y = (s_height - height)//2 master.geometry('%dx%d+%d+%d' % (width, height, x, y)) else: master.geometry('{}x{}'.format(width, height)) if not resizable: master.resizable(width=False, height=False) if bg is not None: master.configure(bg=bg)
# Copyright (c) 2016 Google Inc. (under http://www.apache.org/licenses/LICENSE-2.0) # Test trailing comma after last arg def h1(a:a1,) -> r1: pass def h2(a:a2,b:b2,) -> r2: pass def h3(a:a3) -> r3: pass def h4(a:a4) -> r4: pass
"""Helper structure to set default config""" # pylint: disable=line-too-long default_config = [ { "arg": "--cooldown", "type": int, "default": 1440, # A day "dest": "minutes_between_trades", "help": "It determine the amount of minutes that the trader should wait between trades of the same symbol", }, { "arg": "--sleep", "type": int, "default": 35, "dest": "sleep_between_calls", "help": "Time in seconds to sleep between calls to the Binance API", }, ]
# Space: O(n) # Time: O(n) class Solution: def coinChange(self, coins, amount): dp = [amount + 1] * (amount + 1) dp[0] = 0 for i in coins: for j in range(len(dp)): if j - i >= 0: dp[j] = min(dp[j], dp[j - i] + 1) return dp[amount] if dp[amount] != amount + 1 else -1
class coordinate: def __init__(self, x, y): self.x = x self.y = y def distance(self, other_coordinate): x_diff = (self.x - other_coordinate.x)**2 y_diff = (self.y - other_coordinate.y)**2 return (x_diff + y_diff)**0.5 if __name__ == "__main__": Coord_1 = coordinate(3, 30) Coord_2 = coordinate(4, 8) # print(Coord_1.distance(Coord_2)) print(isinstance(Coord_2, coordinate))
# Time: O(n); Space: O(n) def fib(n): memo = {} if n == 0 or n == 1: return n if n not in memo: memo[n] = fib(n - 1) + fib(n - 2) return memo[n] # Test cases: print(fib(4))
def get_size(nbytes, suffix="B"): factor = 1024 for unit in ["", "K", "M", "G", "T", "P"]: if nbytes < factor: return f"{nbytes:.2f}{unit}{suffix}" nbytes /= factor # This shouldn't happen on real systems, but you can never be sure (2020, btw) return f"{nbytes:.2f}{unit}{suffix}"
class Enricher: def __init__(self, connection=None): self._connection = connection async def enrich(self, post_ids): return await self._connection.find_many(post_ids)
def cycle(sequence): dict={} for i,j in enumerate(sequence): if dict.get(j, -1)<0: dict[j]=i else: return [dict[j], i] if not dict[j] else [dict[j], i-1] return []
BANG_DICT = { "!allegro": "Allegro", "!cakebook": "CakePHP Cookbook", "!animeka": "Animeka", "!webcams": "webcams.travel", "!ipernity": "Ipernity", "!trademe": "TradeMe", "!anidb": "aniDB", "!nuget": "nuget gallery", "!pgp": "MIT PGP Public Key Server Lookup", "!endthelie": "End the Lie", "!fuzz": "FuzzFind", "!slate": "Slate", "!wikipedia": "Wikipedia", "!wsjmw": "http://www.marketwatch.com/", "!wosn": "webOS Nation", "!cbsnews": "CBSNews", "!wosi": "WebOS Internals", "!emy": "ebay.com.my", "!searchforphp": "SearchForPHP", "!emc": "electronic medicines compendium", "!bondfaro": "Bondfaro", "!gpt": "Google PT", "!gps": "Google Product Search", "!sas": "SAS", "!gamesradar": "GamesRadar", "!qme": "quickmeme", "!espacenet": "Espacenet", "!twn": "The Weather Network", "!uscript": "Unity Script Reference", "!engadget": "Engadget", "!dvdfr": "DVDFr", "!najdi": "Najdi.si", "!issuu": "Issuu.com", "!ocal": "Open Clip Art Library", "!cooks": "Cooks.com", "!vmkb": "VMware Knowledge Base", "!wowarmoryeu": "WOW Armory EU", "!scifi": "Worlds Without End", "!vgg": "viagogo", "!everymac": "EveryMac.com", "!vgd": "v.gd", "!heise": "www.heise.de", "!validate": "W3C Validator", "!movielike": "Movielike", "!allelec": "All Electronics", "!n": "Google News", "!veoh": "Veoh", "!m": "Google Maps", "!videosift": "Videosift", "!i": "Google Images", "!g": "Google", "!heinzelnisse": "Heinzelnisse", "!e": "eBay", "!b": "Bing", "!price": "Amazon.com", "!a": "Amazon.com", "!isohunt": "ISOHunt", "!unscatter": "Unscatter.com", "!btdigg": "BtDigg", "!vin": "Decode This!", "!v": "YouTube", "!ter": "TYPO3 Extension Repository", "!t": "Thesaurus.com", "!r": "Reddit", "!s": "startpage.com", "!nico": "Nico Nico Douga", "!q": "Quora", "!perseus": "Perseus Digital Library", "!cache": "Google Cache", "!ontrac": "OnTrac", "!powiki": "Pokemon Online Wiki", "!lyricswiki": "LyricWiki", "!killerstartups": "killerstartups.com", "!eurogamer": "Eurogamer.net", "!glocal": "Google Local", "!arte": "http://arte.tv", "!cpdl": "Choral Public Domain Library", "!gisoff": "Google Images Safe Off", "!ip": "WhatIsMyIPAddress.com", "!nasa": "nasa", "!conj": "Le Conjugueur", "!nautiljon": "Nautiljon", "!cpp": "Cplusplus.com", "!amfr": "Amazon.fr", "!boardman": "Boardman Perspective", "!weheartit": "We Heart It", "!tweakers": "Tweakers.net", "!5": "Fiverr", "!jdk": "Java Docs", "!lp": "Launchpad", "!gamezebo": "Gamezebo", "!fenopy": "Fenopy", "!lv": "Livermore library", "!inab": "INeedaBargain.com", "!oxl": "Oxford Advanced Learner Dictionary", "!tuaw": "The Unofficial Apple Weblog TUAW", "!lavva": "Lavva", "!lh": "Lifehacker", "!lj": "LiveJournal", "!lm": "LiveMixtapes", "!ll": "LiveLeak", "!gamesandgeeks": "Games and Geeks", "!cnrtlm": "Centre National de Ressources Textuelles et Lexicales", "!nes": "Nationalencyklopedin", "!cnrtls": "Centre National de Ressources Textuelles et Lexicales", "!hackaday": "HackADay", "!cake2": "Cakephp 2 Api", "!wref": "Wordreference en->fr", "!devapple": "Apple Developer", "!alternate": "Alternate", "!wren": "WordReference", "!icon": "IconFinder", "!wiktionary": "Wiktionary", "!wres": "Wordreference", "!toppreise": "Toppreise.ch", "!catholic": "Catholic Answers", "!fcs": "Fulton County Schools", "!nationalgeographic": "National Geographic", "!opensuse": "OpenSUSE", "!vandale": "Van Dale", "!gnde": "Google News Germany", "!gorp": "Gorp", "!codeweavers": "Codeweavers Crossover application database", "!oolone": "Oolone", "!siteslike": "siteslike", "!ao3": "Archive of Our Own", "!wunderground": "Weather Underground", "!180": "180.no", "!golem": "Golem.de", "!emusic": "eMusic", "!fluidinfo": "fluidinfo.com", "!shopwiki": "Shopwiki", "!jvcom": "jeuxvideo.com", "!gplusp": "Google Plus", "!xdaf": "XDA-Developers Forum", "!abbuc": "Abbuc e.V.", "!lingvo": "Lingvo", "!yify": "YIFY Torrents", "!player": "Player FM", "!hecf": "Hazme El Chingado Favor", "!highrec": "HighRec", "!allbibles": "Online Parallel Bible", "!lgw": "libregamewiki", "!bwc": "Belfry Web Comics", "!hudku": "International Yellow Pages", "!ebaysg": "ebay.com.sg", "!mpgde": "Max Planck Society", "!cean": "CEAN", "!lgc": "legeekcafe.com", "!blogtalkradio": "BlogTalkRadio", "!lmdtfy": "LMDDGTFY.CO.CC", "!crossword": "WordFun crossword solver", "!gaccess": "Google Accessible", "!gid": "Google ID", "!gie": "Google IE", "!tudou": "土豆网", "!gim": "Google Images", "!ebayes": "ebay ES", "!boost": "Boost.org", "!gik": "Google IL", "!git": "Git", "!nrcnext": "NRC Next", "!ebde": "ebay.de", "!newscomau": "News.com.au", "!gir": "Dear Computer Google Image Ripper SFW", "!gis": "Google Search by Image", "!sciencedaily": "Sciencedaily", "!exfm": "exfm", "!blackbookmag": "BlackBook", "!mineforum": "Minecraft Forums", "!yandex": "Yandex", "!optimot": "Optimot", "!pkgs": "Linux Packages Search", "!drugs": "Drugs", "!zyrv": "Zyrv.com", "!mamma": "Mamma", "!stockphotos": "iStockPhoto", "!lycos": "Lycos", "!clojuredocs": "Clojure Docs", "!foofind": "Foofind", "!chicagotribune": "The Chicago Tribune", "!roadandtrack": "Road & Track", "!msh": "Jaen", "!nzbmatrix": "NzbMatrix", "!wowbattlenet": "BattleNet", "!trulia": "Trulia", "!okf": "otrkeyfinder", "!msq": "Morningstar Quote", "!gblast": "Gigablast ", "!bigfish": "Big Fish Games", "!eeggs": "Easter Eggs", "!mspa": "MS Paint Adventures Wiki", "!bay12": "Bay12Games", "!sba": "SBA", "!openradar": "OpenRadar", "!pcworld": "Pcworld", "!kotakuau": "KotakuAus", "!43things": "43Things", "!ixquickvideos": "Ixquick videos", "!naturespic": "Nature's Pic Images", "!xda": "XDA-Developers Forum", "!exif": "Jeffrey's Exif Viewer", "!animenewsnetwork": "Anime News Network", "!stock": "Google Finance", "!aukro": "Aukro", "!spi": "Startpage Images", "!pc": "ProCog", "!hoogle": "Hoogle", "!moviepilot": "Moviepilot DE", "!youtube": "YouTube", "!earth911": "Earth911.com", "!spr": "SitePoint Reference", "!lurk": "Lurkmoar", "!ilyax": "ilyax iblox is my blox", "!hadoop": "Search-Hadoop", "!xep": "XMPP Extension Protocols", "!animelyrics": "AnimeLyrics", "!tv2": "TV2", "!sslife": "Skyscraperlife", "!subreddit": "Reddit Subreddits", "!ytl": "YouTube - long", "!kerodicas": "KeroDicas", "!submarino": "Submarino", "!soso": "Soso", "!worldofspectrum": "World of Spectrum", "!nullege": "Nullege", "!emacs": "EmacsWiki", "!013": "0l3.de", "!filefacts": "Filefacts", "!carmag": "CarMagazine.co.uk", "!awesomecow": "Awesome Cow", "!wink": "Wink", "!next": "Next-Episode.net", "!winc": "Wikimedia Incubator", "!perldoc": "Perldoc.perl.org", "!wattpad": "Wattpad", "!3tailer": "3tailer", "!rfaces": "alltheragefaces", "!orthonet": "orthonet", "!ci": "Codeigniter User Guide", "!diigo": "Diigo", "!luaforge": "LuaForge", "!cf": "ColdFusion Docs", "!upackages": "Ubuntu Packages", "!cc": "CreativeCommons.org", "!wnl": "Wikipedia NL", "!wno": "Wikipedia NO", "!wnn": "Wikipedia Nynorsk", "!scala": "Scala ", "!geoip": "GeoIpTool", "!epl": "ebay.pl", "!investopedia": "Investopedia", "!vndb": "VNDB", "!worldcat": "WorldCat.org", "!shareware": "Download.com", "!gridcalendar": "GriCal", "!last.fm": "Last.fm", "!moo": "mooTools Docs", "!eph": "ebay.ph", "!thalia": "Thalia", "!mpny": "MenuPages", "!onion": "The Onion", "!ade": "Amazon.de", "!w3schools": "W3Schools.com", "!latex": "LaTeX Code", "!avax": "AvaxHome", "!merriamwebster": "Merriam-Webster", "!epg": "epguides.com", "!btmon": "BitTorrentMonster", "!ftp": "Mamont", "!nvd": "National Vulnerability Database", "!hatbuzz": "hatbuzz", "!wpl": "Wikipedia PL", "!libris": "Libris", "!cake2book": "Cakephp 2 Book", "!googlemaps": "Google Maps", "!pplware": "Pplware", "!ling": "Ling.pl", "!wykop": "Wykop", "!lyrics": "Lyric Wiki", "!jetwick": "Jetwick", "!cinemagay": "CinemaGay", "!d": "The Free Dictionary", "!help": "DuckDuckGo Help", "!leos": "LEO Dictionary Spanish", "!leor": "LEO Dictionary Russian", "!hack": "duckduckhack", "!leoi": "LEO Dictionary Italian", "!leof": "LEO Dictionary French", "!whois": "DomainTools.com", "!ted": "TED", "!leoc": "LEO Dictionary Chinese", "!wowpedia": "Wowpedia", "!mcanime": "MCAnime.net Beta", "!liquidation": "http://www.liquidation.com", "!gde": "Google DE", "!gdk": "Google DK", "!bigstock": "Bigstock", "!kindleuk": "Amazon UK Kindle", "!launchpad": "LaunchPad", "!gtranslate": "Google Translate", "!prisjakt": "Prisjakt", "!gdt": "Grand Dictionnaire Terminologique", "!vim": "Vim.org", "!ebayph": "ebay.ph", "!wieowie": "Wieowie", "!ebaypl": "ebay.pl", "!mootools": "mooTools Docs", "!here": "Here.net formerly Nokia Maps", "!ebes": "ebay ES", "!chefkoch": "Chefkoch", "!nounproject": "NounProject", "!food": "Food.com", "!w": "Wikipedia", "!gjp": "Google JP", "!pxb": "Pixabay", "!globeandmail": "The Globe And Mail", "!tokyotosho": "Tokyotosho", "!gittigidiyor": "GittiGidiyor", "!gpat": "Google Patents", "!acro": "Acronyms", "!foursquare": "foursquare", "!ohnorobot": "Oh No Robot", "!scaruffi": "Scaruffi", "!icecast": "Icecast Directory", "!gsub": "Greek Subtitles Project", "!glyde": "Glyde", "!everyclick": "Every Click", "!gsuk": "Google Shopping UK", "!musicme": "MusicMe", "!folha": "Folha de S. Paulo", "!chrome": "Chrome Extensions", "!gl": "google", "!cowboylyrics": "Cowboy Lyrics", "!bl": "DuckDuckGo Blinders", "!clseattle": "Craigslist", "!gpackages": "Gentoo Packages", "!h18": "http://hangar18.com.ar", "!giezhals": "Geizhals", "!html2txt": "Html2Txt", "!newsyc": "HNsearch", "!cnrtl": "Centre National des Ressources Textuelles et Lexicales", "!fren": "Wordreference", "!worm": "Wormbase", "!lspace": "L-Space", "!msmalware": "Microsoft malware encyclopedia", "!vogue": "Vogue.com", "!azfonts": "AZFonts", "!ebe": "ebay.be", "!web2py": "Web2Py", "!dhlgm": "DHL Global Mail", "!boardgamegeek": "BoardGameGeek", "!eventful": "Eventful", "!epinions": "Epinions", "!googletr": "Google Turkey", "!wotif": "Wotif", "!freecode": "FreshMeat.net", "!yeahway": "Yeah Way!", "!ips": "IPS", "!spstory": "cultura", "!reciva": "Reciva", "!ebayuk": "ebay.co.uk", "!howjsay": "HowJSay", "!wikthu": "Wiktionary hu", "!jinni": "Jinni", "!hotukdeals": "Hotukdeals", "!tld": "Gandi.net", "!dgg": "GG - dejure.org", "!leo": "LEO Dictionary", "!gog": "Good old games", "!god": "Guts of Darkness", "!ebbe": "ebay.be", "!espacoliberdade": "Espaço Liberdade", "!bce": "dict.bing.com.cn", "!lewrockwell": "LewRockwell.com", "!gov": "US Government Search", "!epfl": "EPFL", "!bcp": "Best Current Practices", "!citeseer": "CiteSeer", "!duo": "..duo dotdotduo", "!vggde": "viagogo.de", "!duc": "Duke University Catalog", "!ebca": "ebay.ca", "!ikso": "Ikso Kantaro", "!startpage": "StartPage", "!vimscripts": "Vim Scripts", "!xdcc": "XDCCFinder", "!gbugs": "Gentoo's Bugzilla", "!pollin": "Pollin Electronic", "!trfde": "transfermarkt.de", "!dman": "Debian Hypertext Man Pages", "!oopon": "Oopon", "!timestamp": "DuckDuckGo", "!gamefaqs": "GameFAQs.com", "!bookmine": "Gutenberg text content", "!nypost": "NYPost", "!indigo": "Indigo Books", "!forbes": "Forbes", "!compass": "Compass", "!dribbble": "dribbble", "!miniclip": "Miniclip", "!bsocial": "Bing Social", "!lololyrics": "Lololyrics", "!gplay": "Google Play Store", "!zapaday": "Zapaday", "!apolloduck": "Apollo Duck", "!idealode": "Idealo", "!scipy": "SciPy", "!munju": "Munju", "!evirttit": "Estante Virtual by title", "!isup": "Is Up?", "!catalinstefan": "http://android.catalinstefan.com/", "!shoutcast": "Shoutcast Streaming Internet Radio", "!geocaching": "Geocaching.com", "!bbapps": "BlackBerry App World", "!meteociel": "Meteociel", "!canistream": "Can I Stream It?", "!pagine": "Pagine Gialle", "!wadoku": "WaDoKu", "!spinoza": "Spinoza", "!gmob": "Google mobile site viewer", "!pep": "Python PEP", "!ebayin": "ebay.in", "!yellownz": "Yellow NZ", "!shopzilla": "Shopzilla", "!ebayie": "ebay.ie", "!coldfusion": "ColdFusion Docs", "!gtabs": "UltimateGuitar.com", "!dtc": "DansTonChat", "!java6": "Java6 Docs", "!java7": "Java7 Docs", "!kippt": "Kippt", "!taobao": "Taobao", "!stackoverflow": "StackOverflow", "!anandtech": "Anandtech", "!mendeley": "Mendeley", "!python3": "Python3 Docs", "!jed": "Joomla ", "!tradera": "Tradera", "!texdoc": "Texdoc", "!mv": "Myvideo", "!mw": "Merriam-Webster", "!tent": "Skate", "!ms": "Microsoft", "!mp": "MenuPages", "!mq": "MapQuest", "!angelhalowiki": "Angelhalo Wiki", "!bbcw": "BBC Weather", "!tanzil": "Tanzil", "!mb": "MusicBrainz", "!rosettacode": "RosettaCode.org", "!ma": "Memory Alpha", "!duckco": "The DuckDuckGo Community", "!ml": "Mercado Livre", "!mh": "The Monster Hunter Wiki", "!pbone": "RPM.pbone.net", "!wln": "WestlawNext", "!pronounce": "Dictionary.com", "!bestsimilarsites": "bestsimilarsites", "!cpandeps": "CPAN Dependencies Checker", "!huffingtonpost": "Huffington Post", "!apache": "Apache.org", "!mib": "Mibbit", "!gworkshop": "Games Workshop", "!kickstarter": "Kickstarter", "!rpggeek": "RPGGeek", "!hi5": "Hi5", "!gwiki": "Gentoo Wiki", "!groove": "Grooveshark", "!atom": "Atomurl ", "!biography": "Biography.com", "!uzg": "Uitzending Gemist", "!fhtml": "Fireburst HTML", "!jumpr": "Jump", "!lw": "LessWrong", "!adlibrisno": "AdLibris NO", "!komputeko": "Komputeko", "!csfd": "ČSFD", "!symbolhound": "Symbol Hound", "!cook": "Cooks.com", "!upcoming": "Upcoming", "!appledev": "Apple Developer", "!rateyourmusic": "Rate Your Music", "!jarvanacontent": "Jarvana", "!clojure": "Clojure Docs", "!mapp": "ACME Mapper 2.0", "!maps": "Google Maps", "!discovery": "Discovery.com", "!ibm": "IBM", "!enfr": "Wordreference", "!man7": "The Linux man-pages project", "!mamont": "Mamont", "!mathoverflow": "MathOverflow", "!dram": "Encyclopedia Dramatica", "!avclub": "A.V. Club", "!d20": "d20 SRD", "!cms": "Chicago Manual of Style", "!bulbapedia": "Bulbapedia", "!subsearch": "Subsearch", "!majorsbooks": "Majors Books", "!creativecow": "Creative Cow Forums", "!ripestat": "RIPEstat", "!koreus": "Koreus", "!pixelp": "PixelProspector", "!li": "LinkedIn", "!nyt": "New York Times", "!myopera": "My Opera", "!gnfr": "Google News French", "!acm": "ACM Guide to Computing Literature", "!gallica.bnf": "Gallica BNF", "!willh": "The Will Will Web", "!slwiki": "Second Life Wiki", "!askapatient": "AskaPatient.com", "!sierrasoftworks": "Sierra Softworks", "!gamespot": "GameSpot", "!dhnet": "La Dernière Heure", "!watchtower": "Watchtower Online Library", "!yjp": "Yahoo! Japan", "!skyrock": "SkyRock", "!dell": "Dell", "!tabs": "UltimateGuitar.com", "!dlpo": "Dicionário Priberam da Língua Portuguesa", "!skroutz": "skroutz", "!flickriver": "Flickriver", "!bbc": "BBC.co.uk", "!ghk": "Google HK", "!flickpeek": "FlickPeek", "!iarchive": "archive.org", "!ebayde": "ebay.de", "!sonicretro": "Sonic Retro / Sega Retro", "!openbook": "OpenBook", "!qobuz": "Qobuz", "!ebch": "ebay.ch", "!bbt": "BakaBT", "!sulit": "Sulit", "!psulib": "Penn State Library", "!rfc": "tools.ietf.org", "!gcsebitesize": "BBC GCSE Bitesize", "!onelook": "OneLook", "!nyaa": "Nyaa Torrents", "!swdb": "The Spaghetti Western Database", "!fxr": "FreeBSD Cross Reference", "!arcgis": "ArcGIS Online", "!neto": "Netophonix", "!gus": "Google US", "!cfp": "WikiCFP", "!grave": "Find A Grave", "!dbgb": "BGB - dejure.org", "!rps": "Rock, Paper, Shotgun", "!ordfr": "Ord.se FR", "!amazonde": "Amazon", "!mvnrepository": "MVNRepository", "!nestuk": "Nestoria UK", "!reuq": "Stock Quotes & Company News | Reuters.com", "!dhgate": "DHGate", "!accuweather": "AccuWeather", "!vgguk": "viagogo.co.uk", "!gocomics": "GoComics", "!bimages": "Bing Images", "!rpm": "RPMfind.net", "!legal": "Google Scholar - Legal Opinion Section", "!cnet": "CNET", "!workcircle": "Workcircle", "!khanacademy": "Khan academy", "!search.refertus": "search.refertus", "!startrek": "Memory Alpha", "!lovefilm": "lovefilm.com", "!priberam": "Priberam", "!deezer": "Deezer", "!bloomberg": "Bloomberg", "!wikimapia": "Wikimapia", "!qrobe": "qrobe.it", "!douban": "Douban", "!suntimes": "SunTimes", "!ccr": "Chakra Community Repository", "!yjisho": "Yahoo Jisho", "!indeed": "Indeed", "!amglobal": "Amazon GLOBAL", "!yimages": "Yahoo! Images", "!techdirt": "TechDirt", "!mathse": "Mathematics - Stack Exchange", "!imb": "imbiomed", "!domainr": "Domainr", "!img": "Google Images", "!4chan": "FoOlz [4chan] Archives", "!kkbruce": "KingKong Bruce記事", "!derpibooru": "Derpibooru", "!writen": "Wordreference it->en", "!vogueuk": "Vogue.co.uk", "!proc": "Processing.org", "!bible": "BibleGateway", "!liquipedia": "Liquipedia2", "!pdf": "PDFs", "!gplus": "Google Plus", "!pdb": "RSCB Protein Data Bank", "!linkedin": "LinkedIn", "!acronyms": "Acronyms", "!dolu": "Dolu Sozluk", "!eventid": "EventID", "!mp3skull": "MP3Skull", "!bitsnoop": "BitSnoop", "!hypem": "The Hype Machine", "!sanakirja": "Sanakirja.org", "!blogs": "Google Blogs", "!4shared": "4shared", "!whiskyde": "whisky DE", "!amit": "Amazon.it", "!mercurynews": "Mercury News", "!miso": "http://gomiso.com/", "!mpph": "MenuPages", "!wallbase": "wallbase", "!chef": "Opscode Chef Wiki", "!makeuseof": "MakeUseOf", "!scritique": "SensCritique", "!veroot": "Veroot", "!lynxview": "Lynx Viewer Yellowpipe.com", "!charity": "Charity Navigator", "!wmc": "https://commons.wikimedia.org/", "!cnn": "CNN", "!asoiaf": "A Wiki of Ice and Fire", "!caniuse": "Can I use...", "!synonym": "Thesaurus.com", "!similar": "SimilarSites", "!pinboard": "Pinboard", "!redis": "Redis Command Reference", "!foodsubs": "Cook's Thesaurus", "!hrwiki": "Homestar Runner Wiki", "!howthingswork": "How Things Work", "!ubottu": "Ubottu.com", "!oid": "Search OID registry", "!azlyrics": "A-Z Lyrics", "!dailymed": "DailyMed", "!michaelis": "Michaelis - Portugues - English", "!mitvid": "MIT Video", "!api": "DuckDuckGo API", "!bigwords": "BigWords.com", "!ggroups": "Google Groups", "!nvidia": "Nvidia", "!mmnt": "Mamont", "!answers": "Answers.com", "!mash": "mashable", "!uesp": "The Unoffical Elder Scrolls pages", "!nfb": "National Film Board of Canada", "!mpsf": "MenuPages", "!dwds": "DWDS", "!jeopardy": "J! Archive", "!archlinux": "Archlinux Forums", "!shooter": "Shooter", "!fdo": "freedesktop.org", "!123p": "123people", "!zappos": "Zappos", "!gvpl": "Greater Victoria Public Library", "!fda": "FDA", "!wowarmory": "WOW Armory", "!musopen": "Musopen", "!qrdecode": "ZXing QR decode", "!dbasx": "DBA StackExchange", "!ann": "Anime News Network", "!kcommunity": "KDE Community Wiki", "!dfm": "definefor.me", "!htf": "HowtoForge", "!htg": "How-To Geek shortcut", "!dfw": "DwarfFortress Wiki", "!debianforums": "Debian Forums", "!gw2wiki": "Guild Wars 2 Wiki", "!politiken": "Politiken.dk", "!osalt": "osalt.com", "!principien": "Principien", "!texture": "Google Images", "!androidpit": "AndroidPit", "!imgur": "Imgur", "!focalprice": "Focalprice", "!blender": "Blender", "!yummly": "Yummly", "!lifehacker": "Lifehacker", "!allabolag": "Alla Bolag", "!goodreads": "GoodReads", "!senderbase": "SenderBase", "!utf8": "Unicode Character Search", "!yopmail": "YopMail", "!agdl": "The Annotated Grateful Dead Lyrics", "!opensusesoftware": "OpenSUSE Software Search", "!fefe": "Fefes Blog", "!sloanes": "Integer Sequences", "!govtrack": "govtrack.us", "!googleuk": "Google UK", "!trakt": "Trakt", "!palgn": "PALGN", "!wakoopa": "Wakoopa", "!sdict": "SpanishDict", "!fireburstvideos": "Videos - Fireburst", "!yanswers": "Yahoo! Answers", "!trello": "Trello", "!lds": "The Church of Jesus Christ of Latter-day Saints", "!cellartracker": "CellarTracker", "!ebuk": "ebay.co.uk", "!wiktit": "Wikizionario, il dizionario libero", "!thomas": "Thomas.loc.gov", "!login": "BugMeNot", "!dictcc": "dict.cc", "!wit": "Wikipedia IT", "!wiq": "WordIQ", "!cbc": "CBC News", "!imbd": "IMBD", "!techrights": "TechRights", "!songsterr": "Songsterr", "!trovaprezzi": "Trovaprezzi.it", "!extratorrent": "ExtraTorrent", "!amazonmp3": "Amazon MP3 Store", "!911s": "911 Tabs Songs", "!binsearch": "Binsearch", "!posters": "All Posters", "!rl": "Rapidlibrary", "!freebsd": "FreeBSD", "!baidu": "Baidu", "!rg": "Rap Genius", "!collegeconfidential": "CollegeConfidential Forums", "!tubafm": "Tuba FM", "!rb": "Redbubble", "!nintendolife": "Nintendo Life", "!domainsbot": "domainsbot.com", "!ynews": "Yahoo! News", "!whosampled": "who sampled", "!rt": "Rotten Tomatoes", "!plot": "FooPlot", "!okgeek": "Okay Geek", "!iusethis": "iusethis.com", "!dhl": "DHL", "!numerama": "Numerama", "!sproducts": "Sproducts", "!pylons": "Pylons Docs", "!wordpress": "WordPress.org", "!wikisum": "Wiki Summaries", "!teamliquid": "Teamliquid", "!debbug": "Debian Bugs", "!pcmag": "Pcmag", "!tureng": "Tureng Dictionary", "!nbd": "Norwegian Bokmål Dictionary", "!nba": "NBA.com", "!dll": "DLL-files.com", "!sloganmaker": "SloganMaker", "!chip": "CHIP Online", "!sphp": "SearchForPHP", "!shopathome": "ShopAtHome.com", "!perlmonks": "PerlMonks.org", "!ajc": "AJC.com", "!ajb": "Acha Jogo Barato", "!teketen": "Teketen", "!foodnetwork": "Food Network", "!git-scm": "Git", "!elen": "Google translate el-en", "!bakabt": "BakaBT", "!subs": "addic7ed", "!compfight": "Compfight", "!urlquery": "Urlquery", "!qype": "Qype", "!crunchyroll": "CrunchyRoll", "!scoop": "Scoop.it", "!regex": "Regular Expression Library", "!tatoeba": "Tatoeba", "!wikivs": "WikiVS", "!lotrow": "LOTRO-Wiki", "!cashback": "Sunshine Rewards", "!vemo": "Vemo.it forniture alberghiere", "!racket": "Racket", "!capost": "Canada Post", "!geocache": "Geocaching.com", "!mcpan": "MetaCPAN", "!zavvi": "Zavvi", "!mitocw": "MIT OpenCourseWare", "!son2teuf": "Son2Teuf", "!searchyc": "HNsearch", "!clipstijl": "Clipstijl", "!laser": "LaserShip", "!hgnc": "HUGO Gene Nomenclature Committee HGNC", "!musiciansfriend": "Musician's Friend", "!macupdate": "MacUpdate", "!chords": "UltimateGuitar.com", "!patternry": "Patternry", "!gbooks": "Google Books", "!iwant": "iWantMyName", "!yatr": "Yandex Turkiye", "!btn": "Broadcasthe.net", "!activeden": "ActiveDen", "!ebit": "ebay.it", "!gfc": "greatfirewallofchina.org", "!imagenet": "ImageNet", "!newsday": "NewsDay.com", "!gfi": "Google FI", "!findlaw": "FindLaw", "!nciku": "Nciku.com", "!rhyme": "RhymeZone", "!ebie": "ebay.ie", "!gfr": "Google FR", "!ebin": "ebay.in", "!ii": "Ixquick Images", "!huffpost": "Huffington Post", "!nzbs": "nzbs.org", "!bing": "Bing", "!susebug": "openSUSE Bugzilla", "!musicbrainz": "MusicBrainz", "!date": "Date Sort", "!im": "Google Images", "!twinpedia": "Twinpedia", "!passmark": "passmark.com", "!magma": "MagmaWiki", "!skepticsbible": "Skeptic's Bible", "!sunpatch": "WeSunSolve", "!lyricsmania": "Lyrics Mania", "!macworld": "Macworld", "!mskb": "Microsoft Knowledge Base", "!osnews": "OSNews", "!scope.dk": "scope.dk", "!yegg": "Gabriel Weinberg's Blog", "!mvn": "Maven Central", "!facebook": "Facebook", "!wtpt": "Wiktionary portuguese", "!dipadova": "Perpetual DiPadova", "!mhwiki": "The Monster Hunter Wiki", "!answer": "Yahoo! Answers", "!mathworks": "Matlab File Exchange", "!captaincrawl": "CaptainCrawl", "!indiamart": "IndiaMART", "!wordnet": "WordNet", "!seb": "Sebsauvage", "!sec": "SEC.gov", "!tsa": "TechSupportAlert.com", "!photodune": "PhotoDune", "!appcel": "Appcelerator API Docs", "!zbmath": "Zentralblatt MATH Database", "!esg": "ebay.com.sg", "!cricinfo": "Cricinfo", "!sep": "Stanford Encyclopedia of Philosophy", "!seq": "The Online Encyclopedia Of Integer Sequences", "!istockphoto": "iStockPhoto", "!tsr": "The Student Room", "!xkcdn": "XKCD Number", "!ihep": "InspireHEP", "!grepcode": "GrepCode.com", "!alto": "AlternativeTo", "!psimplified": "Programming Simplified", "!lpbug": "Launchpad Bugs", "!kapi": "KDE API Reference", "!newsnow": "News Now", "!crunchbase": "CrunchBase", "!gmap": "Google Maps", "!dailymotion": "DailyMotion", "!themag": "The Mag", "!prpm": "Pusat Rujukan Persuratan Melayu", "!codeplex": "Codeplex", "!kbugs": "KDE Bugs", "!7digital": "7digital", "!dpdt": "DPD Online Tracking", "!pubmed": "PubMed", "!mednar": "Mednar", "!snopes": "Snopes.com", "!uglifyjs": "UglifyJS", "!eqd": "Equestria Daily", "!tmd": "torrentsmd.com", "!wrenit": "Wordreference en->it", "!dictionary": "Dictionary.com", "!osub": "OpenSubtitles.org", "!glu": "Google Luxembourg", "!scienceblogs": "Science Blogs", "!usa": "Search.USA.gov", "!usc": "Ubuntu Software Center", "!reddit": "reddit", "!pictures": "Google Images", "!songmeanings": "SongMeanings", "!wikt": "Wiktionary", "!kasperskymal": "Securelist Malware info", "!news": "Google News", "!slackbuilds": "Slackbuilds", "!torwiki": "Torproject Wiki", "!newegg": "Newegg", "!etree": "Live Music Archive", "!mathematica": "Mathematica Documentation Center", "!nlab": "nLab", "!newsarchive": "Google News Archive", "!rails": "Rails Docs", "!gettyimages": "Getty Images", "!wiki": "Wikipedia", "!serebii": "Serebii", "!tvtropes": "TV Tropes", "!cheapassgamer": "Cheap Ass Gamer", "!drupalcontrib": "DrupalContrib", "!rutube": "RuTube", "!inspire": "Inspire HEP ", "!goosh": "Goosh", "!microcenter": "Micro Center", "!doi": "DOI.org", "!scrape": "Scrape Torrent", "!tiho": "TiHo-OPAC", "!myallsearch": "MyAllSearch", "!gramota": "gramota.ru", "!brightstorm": "Brightstorm", "!tcrf": "The Cutting Room Floor", "!lcc": "Let’s CC", "!nsr": "NationStates Region", "!ideas": "RePEc IDEAS", "!ilsole24ore": "Il Sole 24 Ore", "!/.j": "Slashdot Japan", "!verbomatic": "Verb-o-Matic", "!nsn": "NationStates Nation", "!forkd": "Forkd", "!ros": "ROS", "!ikeanl": "IKEA Nederland", "!techcrunch": "Techcrunch", "!crate": "Crate.io", "!movies": "movies.io", "!cwebstore": "Chrome Webstore", "!staticice": "Static Ice", "!fark": "Fark.com", "!cake": "CakePHP API", "!gtrends": "Google Trends", "!blackbook": "BlackBook", "!dblp": "DBLP", "!gtnl": "Google Translate to Dutch", "!ordbok": "Ordbok.no", "!parabola": "Parabola GNU/Linux", "!jarvanaclass": "www.jarvana.com", "!rapidonline": "Rapid Online", "!plan3t": "Plan3t.info", "!beatport": "Beatport", "!naver": "Naver", "!oreilly": "O'Reilly", "!zanran": "Zanran", "!fwiki": "Fortran Wiki", "!onimoto": "Onimoto.Com", "!purolator": "Purolator shipment tracking", "!br": "Baseball-Reference", "!apackages": "ArchLinux Packages", "!batlyrics": "Batlyrics", "!ebates": "Ebates", "!bkr": "Basketball Reference", "!qssl": "Qualys SSL Labs", "!vukajlija": "Vukajlija", "!/.": "Slashdot", "!dict.cc": "dict.cc", "!traceroute": "DomainTools.com", "!recipe": "Punchfork", "!ggr": "Google GR", "!gin": "Google IN", "!rockethub": "RocketHub", "!mercadolivre": "Mercado Livre", "!stex": "Stack Exchange", "!lastfm": "Last.fm", "!piratenwiki": "Wiki der Piratenpartei Deutschland", "!startribune": "The Star Tribune", "!gua": "Google UA", "!gaen": "Google Translate", "!iqdb": "iqdb", "!eat": "ebay.at", "!eau": "ebay.com.au", "!guk": "Google UK", "!inci": "incisozluk", "!wiggle": "www.wiggle.co.uk", "!yfinance": "Yahoo Finance", "!wimp": "wimp.com", "!verb": "Verb-o-Matic", "!dsv": "DSV SU", "!ebayau": "ebay.com.au", "!ebayat": "ebay.at", "!appshopper": "Appshopper", "!rym": "Rate Your Music", "!android": "Android Developers", "!indiegogo": "IndieGoGo", "!slang": "The Online Slang Dictionary", "!stackexchange": "stackexchange.com", "!zumi": "Mapy Zumi", "!wos": "World of Spectrum", "!dawanda": "DaWanda", "!vtkcd": "Visualization Toolkit VTK class documentation devel", "!anisearch": "aniSearch.de", "!imagery": "http://elzr.com/imagery/", "!djpackages": "Django Packages", "!radiotimes": "Radio Times", "!metalstorm": "Metal Storm", "!trl": "The Ring Lord", "!trademarks": "Trademarkia", "!orkut": "Orkut", "!recordclick": "www.recordclick.com", "!sfe": "Sparkfun Electronics", "!trz": "Torrentz", "!sfs": "stopforumspam.com", "!chakrawiki": "The Chakra Project Wiki", "!newark": "Newark", "!rei": "REI", "!gb": "Google Books", "!gdrive": "Google Drive", "!ge": "google.encypted.com", "!gf": "Google Finance", "!gg": "Google Groups", "!gh": "GitHub.com", "!gi": "Google Images", "!gj": "Google Japan", "!anyr": "DuckDuckGo", "!swagbucks": "Swagbucks", "!whitewater": "Whitewater Search Engine", "!gn": "Google News", "!gp": "Google Photos", "!gr": "Google Reader", "!gs": "Google Shopping", "!gt": "Google Translate", "!gv": "Google Video", "!gd": "Google Docs", "!thinkgeek": "ThinkGeek", "!tmdb": "TheMovieDB.org", "!siteduzero": "Site du Zéro", "!sf2": "Symfony Framework", "!gfaqs": "GameFAQS.com", "!coupons": "DealTaker", "!mogr": "moviegram", "!wikitravel": "Wikitravel", "!instructables": "Instructables", "!matlab": "Matlab documentation", "!ups": "UPS", "!imfdb": "Internet Movie Firearms Database", "!updown": "DownForEveryone?", "!drae": "Diccionario de la lengua española", "!emuparadise": "Emuparadise", "!bartlets": "Bartelby", "!exalead": "Exalead", "!nsprings": "North Springs Community", "!wdr": "webDevRefinery", "!tmbw": "This MIght Be a Wiki", "!gmane": "Gmane", "!wdt": "Wikidata", "!map": "Google Maps", "!fireburst": "Fireburst Web Search", "!freepascal": "Freepascal", "!rakuten": "Rakuten", "!wda": "Wikipedia DA", "!winfu": "WinFuture", "!man": "man.cx", "!wde": "Wikipedia DE", "!mac": "MAC Address", "!iplayer": "iPlayer", "!taringa": "Taringa!", "!p4k": "Pitchfork Media", "!pollstar": "Pollstar", "!princeton": "Princeton", "!slashdot": "Slashdot", "!jetslide": "Jetslide News Reader", "!wja": "Wikipedia JA", "!stationsweb": "Stationsweb", "!hs": "Honyaku Star", "!java4": "Java4 Docs", "!albumartdvd": "Albumart DVD", "!snake": "Just Snake", "!idioms": "The Free Dictionary", "!qr": "QR Code Search", "!nfl": "NFL.com", "!code": "Search Code", "!topsy": "Topsy", "!adlibrisdk": "AdLibris DK", "!qt": "Qt Reference Documentation", "!java5": "Java5 Docs", "!compete": "Compete", "!gentoowiki": "Gentoo Wiki", "!xgau": "Robert Christgau", "!powells": "Powells", "!weather": "WeatherBug", "!careerbuilder": "CareerBuilder", "!discogs": "Discogs", "!gizmodo": "Gizmodo", "!matlabfx": "Matlab File Exchange", "!tomshardware": "Tom's Hardware", "!historious": "Historious", "!lolpro": "LoL Pro", "!define": "The Free Dictionary", "!amjp": "Amazon.co.jp", "!hnsearch": "HNsearch", "!gopher": "Floodgap Gopher", "!qwiki": "Qwiki", "!hoepli": "Hoepli", "!camel": "CamelCamelCamel", "!nestde": "Nestoria Deutschland", "!mangafox": "Mangafox", "!g24": "Google Past 24h", "!appvv": "AppVV", "!smention": "Social Mention", "!thingiverse": "Thingiverse", "!csharp": "C# MSDN", "!crx": "Chrome Extension Repository", "!searchworks": "SearchWorks SULAIR", "!devonforum": "DEVONtechnologies Forum", "!randt": "Road & Track", "!wowwiki": "WoWWiki", "!oldcpan": "CPAN", "!habra": "habrahabr.ru", "!gphotos": "Google Photos", "!leboncoin": "Leboncoin.fr", "!msmvps": "MSMVPs.com", "!gm": "Google Maps", "!newsfr": "Google News France", "!bv": "Bing Videos", "!ww": "Whitewater Search Engine", "!bs": "Bing Shopping", "!sbo": "SlackBuilds.org", "!bn": "Barnes & Noble", "!bm": "bing maps", "!pecl": "PECL :: The PHP Extension Community Library", "!bi": "Bing Images", "!orthodoxwiki": "OrthodoxWiki", "!ebert": "RogerEbert.com", "!bd": "baidu", "!bc": "DuckDuckGo", "!bb": "Bitbucket", "!ba": "Beer Advocate", "!targeo": "Targeo", "!lyricwiki": "LyricWiki", "!ezydvd": "EzyDVD", "!wot": "Web of Trust", "!quizlet": "Quizlet", "!liquidpedia": "Liquidpedia", "!wog": "World of Gnome", "!yandexen": "Yandex english", "!target": "Target", "!mlb": "The official site of Major League Baseball", "!nethack": "NetHack Wiki", "!gcpan": "CPAN -> GREP", "!thefullwiki": "The Full Wiki", "!musikm": "Musik Meisinger Burghausen", "!wa": "WolframAlpha", "!tweet": "Tweet", "!newgrounds": "Newgrounds", "!fishpond": "Fishpond", "!summitpost": "SummitPost", "!debian": "Debian", "!cald": "Cambridge Advanced Learner's Dictionary", "!docs": "Scribd.com", "!websitedown": "Website Down", "!twitch": "TwitchTV", "!play": "Play.com", "!faucet": "Faucet.com", "!shopping": "Google Shopping", "!what": "What", "!firefox": "Firefox Add-ons", "!giga": "GIGABLAST", "!molw": "WebQC.org", "!bang": "DuckDuckGo", "!gch": "Google CH", "!sanalpazar": "Sanal Pazar", "!package": "PackageMapping", "!abcnews": "ABCNews", "!zapiks": "Zapiks", "!safe": "DDG Safesearch On", "!nds": "Nachdenkseiten", "!sparknotes": "SparkNotes", "!alc": "Eijiro on the web", "!ali": "Aliexpress", "!fbr": "Pro Basketball Reference", "!xbox": "Xbox", "!tumblr": "Tumblr", "!fatwallet": "FatWallet", "!meneame": "Menéame", "!comicvine": "Comic Vine", "!winehq": "WineHQ", "!baseballreference": "Baseball-Reference", "!boxoh": "Boxoh", "!criticker": "Criticker", "!gsmarena": "GSMArena", "!govimages": "US Government Image Search", "!gee": "Google EE", "!ncix": "NCIX.com", "!glatest": "Google Latest", "!freenode": "Freenode", "!datasheet": "AllDataSheet", "!buy": "Amazon.com", "!omim": "http://www.ncbi.nlm.nih.gov/omim", "!ges": "Google Spain", "!bibletools": "Bible Study Tools", "!kapaza": "Kapaza", "!behindsurname": "http://surnames.behindthename.com/", "!joystiq": "Joystiq", "!dlang": "D Programming Language", "!marmiton": "Marmiton", "!freshmeat": "FreshMeat.net", "!tex": "TeX Stack Exchange", "!fantasy": "fantasy.fr", "!bgp": "Hurricane Electrics Internet Services", "!vsg": "Value Stock Guide", "!ebfr": "ebay.fr", "!bgg": "BoardGameGeek", "!webstats": "webstatsdomain", "!jorginho": "jorgeluizmartinsjunior@.com", "!ebaych": "ebay.ch", "!gday": "Google Past Day", "!evri": "Evri", "!gkr": "Google KR", "!serch": "de.serchilo.net", "!ebayca": "ebay.ca", "!weboftrust": "Web of Trust", "!parking": "ParkWhiz", "!pcgw": "PCGamingWiki", "!ringtones": "Brinked", "!versiontracker": "VersionTracker.com", "!truveo": "Truveo", "!procog": "ProCog", "!startpageimages": "Startpage images", "!weatherspark": "Weather Spark", "!sfpl": "San Francisco Public Library", "!openlibrary": "Open Library", "!data": "Infochimps", "!duden": "Duden", "!rut": "rutracker.org", "!newsmax": "NewsMax.com", "!esseffr": "ESSEF fr", "!infospace": "Infospace", "!overstock": "Overstock", "!dpts": "Debian Packages", "!rtnews": "RT", "!xanga": "Xanga", "!mefi": "MetaFilter", "!salixforums": "SalixOS Forums", "!ech": "ebay.ch", "!ticketmaster": "Ticket Master", "!openstreetmap": "OpenStreetMap", "!eca": "ebay.ca", "!cercavino": "CercaVino", "!quotes": "WikiQuote", "!mpl": "matplotlib", "!sampled": "whosampled", "!caranddriver": "Car and Driver", "!distrowatch": "DistroWatch", "!metacafe": "Metacafe", "!metaso": "Meta Stack Overflow", "!macports": "MacPorts", "!arstechnica": "ArsTechnica", "!pixiv": "Pixiv", "!dilbert": "Dilbert", "!whatis": "WhatIs.com", "!beer": "BeerAdvocate", "!exploitdb": "Exploit DB", "!scp": "SCP Foundation", "!seznam": "Seznam", "!pastebin": "pastebin", "!rinf": "RINF Alternative news", "!ktb": "KDE TechBase", "!telegraph": "Telegraph", "!seatgeek": "SeatGeek", "!newffr": "NewFFR", "!gpsies": "GPSies.de", "!soundcloud": "SoundCloud", "!mediadico": "Mediadico", "!csdb": "The C64 Scene Database", "!enlt": "Google Translate English to Lithuanian", "!chakraforum": "The Chakra Project", "!hatesloganmaker": "Sloganmaker /hate", "!meteofr": "Météo-France", "!wzh": "Wikipedia ZH", "!quixey": "Quixey", "!123people": "123people", "!biblsrv": "Bibleserver", "!ap": "AP", "!at": "Addictive Tips", "!au": "African Unioun", "!css": "CSS", "!ah": "Así hablamos", "!allocine": "Allocine.com", "!csw": "Chicken Scheme Wiki", "!am": "Amazon.com", "!erlang": "Erlang Docs", "!chakrapkg": "The Chakra Project Packages", "!whu": "Wikipedia Hungary", "!themeforest": "ThemeForest", "!gamebanana": "GameBanana", "!rootsarchives": "Roots Archives", "!fileinfo": "File info", "!canoo": "canoonet", "!autocar": "Autocar.co.uk", "!who": "who.is", "!about": "About.com", "!car": "CarMagazine.co.uk", "!whi": "Wikipedia HI", "!sqlite": "SQLite", "!sm": "Smashing Magazine", "!webtender": "Webtender", "!so": "StackOverflow", "!sh": "SimplyHired", "!si": "SI.com", "!sk": "songkick.com", "!sd": "Slickdeals", "!sf": "ServerFault", "!gamepro": "GamePro", "!studydroid": "StudyDroid", "!sc": "Soundcloud", "!ccst": "CSS Tricks", "!graphemica": "Graphemica", "!sx": "stackexchange.com", "!liveleak": "http://www.liveleak.com/", "!su": "SuperUser", "!sv": "La Simpla Vortaro ", "!sw": "Simple English Wikipedia", "!sp": "StartPage", "!mpla": "MenuPages", "!sr": "reddit", "!ss": "Subscene", "!obb": "oremus Bible Browser", "!traffic": "Google Traffic", "!arturogoga": "Arturogoga", "!burnbit": "Burnbit", "!gnomebugs": "GNOME Bugzilla", "!w3c": "W3C", "!clipart": "Microsoft Clipart", "!flickrc": "Flickr comm/deriv", "!tigerdirect": "TigerDirect", "!homedepot": "Home Depot", "!mdbg": "MDBG Chinese-English dictionary", "!lparchive": "Let's Play Archive", "!thesession": "The Session", "!nck": "Nciku", "!gifl": "Google: I'm Feeling Lucky", "!forrst": "Forrst", "!trueknowledge": "True Knowledge", "!gutenberg": "Project Gutenberg", "!susepkg": "openSUSE Software", "!cbssports": "CBS Sports", "!rlib": "Rapidlibrary", "!amf": "Ask Metafilter", "!ncz": "Nciku Chinese", "!dfman": "DragonFly BSD manual pages", "!enpt": "google translate en-pt", "!sconj": "SpanishDict verb conjugation", "!kicknews": "KickNews", "!millionshort": "Million short", "!dcc": "dict.cc", "!sfgate": "SFGate", "!newsweek": "Newsweek", "!epicurious": "Epicurious", "!archaur": "ArchLinux User Repository", "!fsf": "Free Software Foundation", "!cafepress": "CafePress", "!bizrate": "Bizrate", "!gmusic": "Google Music", "!sskj": "Slovar slovenskega knjižnega jezika", "!color": "0to255.com", "!perezhilton": "PerezHilton", "!starwars": "Wookiepedia", "!macdic": "Macmillan Dictionary", "!gtr": "Google TR", "!exex": "Experts Exchange", "!gtw": "Google TW", "!academicearth": "Academic Earth", "!gtu": "TechGujarat", "!scan": "Scan", "!lyricful": "Lyricful", "!thesaurus": "Thesaurus.com", "!lar": "Larousse Français", "!wordnik": "Wordnik", "!viul": "Vancouver Island University Library", "!mio": "Movies.io", "!showtimes": "Google Movies", "!steam": "Steam", "!biznar": "Biznar", "!foolz": "FoOlz [4chan] Archives", "!dpv": "Dogpile Video", "!dpw": "Dogpile Web", "!.net": "DotNet Docs", "!wissen": "wissen.de", "!viasona": "Viasona", "!torrentfreak": "Torrent Freak", "!deviantart": "DeviantART", "!monster": "Monster.com", "!dpd": "Diccionario panhispánico de dudas", "!rubydoc": "Ruby-Doc.org", "!dpb": "Depiraatbaai", "!dpc": "DVDpasCher", "!dpl": "Dogpile Local", "!dpn": "Dogpile News", "!dpi": "Dogpile Images", "!spice": "Spiceworks Community", "!nokiamaps": "Nokia Maps", "!modulusfe": "Modulus Financial Engineering", "!archforums": "Arch Linux Forums", "!bugmenot": "BugMeNot", "!independent": "The Independent", "!amiami": "Amiami", "!urbancomfort": "Urban Comfort", "!ebhk": "ebay.com.hk", "!php": "PHP.net", "!ncbi": "NCBI", "!ninja": "Ninjawords", "!mdn": "Mozilla Developer Network", "!icheckmovies": "iCheckMovies", "!bvideo": "Bing Videos", "!smog": "Smogon University", "!tubalr": "Tubalr", "!tinyurl": "TinyURL.com", "!hpv": "Heise.de Preisvergleich", "!memoryalpha": "Memory Alpha", "!justsnake": "A blog about snakes", "!msdn": "MSDN", "!download": "Download.com", "!chammy": "Chammy.info", "!metalarch": "Metal Archives", "!tf2": "TF2 Wiki", "!earthcam": "earthcam", "!wtf": "MirBSD Acronyms Database", "!madeinusa": "madeinusa", "!oer": "OER Commons", "!ausgov": "australia.gov.au", "!wtr": "Vikipedi", "!dfiles": "Debian file search", "!allmovie": "AllMovie", "!equestriadaily": "Equestria Daily", "!oed": "Oxford English Dictionary", "!telefonterror": "Telefonterror", "!fedorawiki": "Fedora Project", "!dstgb": "StGB - dejure.org", "!treccani": "treccani", "!tpb": "The Pirate Bay", "!sdn": "SAP Developer Network Forums", "!youku": "Youku", "!ixquick": "ixquick", "!dwiki": "Davis Wiki", "!yandexmaps": "Yandex Maps", "!malist": "MyAnimeList", "!mobygames": "Moby Games", "!gdocs": "Google Docs", "!cached": "Google Cache", "!beoes": "Beolingus De-es", "!sdz": "Site du Zer0", "!root": "ROOT", "!shodan": "SHODAN", "!viki": "Estonian Wikipedia Vikipeedia", "!redtram": "RedTram", "!codepoints": "Codepoints", "!gmonth": "Google Past Month", "!geartested": "GearTested.Net", "!unwiki": "Uncyclopedia", "!stubhub": "StubHub", "!lucire": "Lucire", "!technet": "Microsoft TechNet", "!tfd": "The Free Dictionary", "!finalfantasy": "Final Fantasy Wiki", "!market": "Android Market", "!gisafeoff": "Google Images Safe Off", "!duedil": "Duedil", "!faff": "Film Affinity", "!globo": "Globo.com", "!themoviedb": "TheMovieDB.org", "!icm": "iCheckMovies", "!wowhead": "WowHead", "!bingmaps": "Bing Maps", "!chacha": "ChaCha", "!evirtau": "Estante Virtual by author", "!evirtat": "Estante Virtual by author and/or title", "!ede": "ebay.de", "!trailer": "Trailer Addict", "!gpl": "Google PL", "!album": "Allmusic Album Search", "!gpe": "Google PE", "!gpd": "GoPkgDoc", "!yippy": "Yippy", "!cpan1": "MetaCPAN", "!morningstar": "Morningstar Search", "!dilandau": "DilanDau", "!thomann": "Thomann", "!rseek": "RSeek", "!tbuff": "TechnoBuffalo", "!ixquickimages": "Ixquick images", "!gweek": "Google Past Week", "!metacrawler": "MetaCrawler", "!derstandard": "derStandard.at", "!markos": "markosweb", "!cpanm": "MetaCPAN", "!coalgirls": "Coalgirls", "!kym": "Know Your Meme", "!codex": "WordPress Codex", "!zuckerzauber": "Caros Zuckerzauber Shop", "!userscripts": "UserScripts", "!wuk": "Wikipedia UK", "!reflets": "Reflets.info", "!tripadvisor": "Trip Advisor", "!uude": "Ubuntuusers", "!wten": "Wiktionary", "!tayda": "Tayda Electronics", "!kayak": "Kayak", "!beo": "Beolingus De-en", "!ytw": "Yaoo! Taiwan", "!ftube": "FilesTube", "!cheatcc": "CheatCC.com", "!tunein": "TuneIn", "!economist": "The Economist", "!keepvid": "KeepVid", "!gimages": "Google Images", "!meme": "Know Your Meme", "!ifdb": "Interactive Fiction Database", "!gbang": "GiggleBang", "!osmw": "OpenStreetMap Wiki", "!ubuntuforums": "Ubuntu Forums", "!usatoday": "USA Today", "!wtsv": "Wiktionary SV", "!glv": "Google LV", "!flipkart": "Flipkart", "!ehk": "ebay.com.hk", "!gturl": "Google Translate URL", "!wpt": "Wikipedia PT", "!e2": "Everything 2", "!win": "Microsoft Windows", "!wpp": "WordPress.org Plugins", "!roku": "Roku", "!gatherer": "Gatherer", "!ceneo": "Ceneo", "!ka": "Khan Academy", "!piratesea": "Pirate Sea", "!musipedia": "Musipedia", "!puppet": "Puppet Forge", "!sxc": "stock.xchng", "!eve": "Eve Online", "!blendapi": "Blender API", "!ks": "KickStarter", "!wmeta": "Wikimedia Meta-Wiki", "!ad": "Ask Different", "!ebuilds": "Gentoo Packages", "!eo": "Online Etymology Dictionary", "!em": "eBay Motors", "!cplusplus": "Cplusplus.com", "!d&d": "d20 SRD", "!eg": "Epguides", "!ed": "Encyclopedia Dramatica", "!ee": "ellislab", "!eb": "eBay", "!ec": "http://ecosia.org/", "!quantcast": "Quantcast", "!kindle": "Amazon Kindle", "!rbugs": "Redhat Bugzilla", "!wp7": "Windows Phone 7 Marketplace", "!svb": "Silicon Valley Bank", "!eqbeats": "Equestrian Beats", "!ep": "Experience Project", "!startpagevideos": "StartPage videos", "!ohlohcode": "Ohloh Code", "!fancy": "TheFancy", "!mpfl": "MenuPages", "!800": "800notes", "!foxnews": "FoxNews", "!9gag": "9gag", "!khronos": "Khronos", "!dota": "DOTA 2 wiki", "!kazazz": "Kazazz", "!nutridata": "nutritiondata", "!tproj": "Torrent Project", "!monoprice": "Monoprice", "!eksisozluk": "Ekşi Sözlük", "!sozluk": "Eksi Sozluk", "!rpmfind": "RPMfind.net", "!planetmc": "Planetminecraft", "!encyclopedia": "Wikipedia", "!hypestat": "hypestat", "!dart": "dartlang", "!gametrailers": "Gametrailers", "!vs": "Vertical Set", "!dictleode": "Leo Translation EN<->DE", "!abandonia": "Abandonia", "!searchmygmail": "Search My Gmail", "!omg": "Jaen", "!bliptv": "Blip.tv", "!vb": "VedaBase", "!clojars": "Clojars", "!clker": "Clker", "!vg": "Google", "!vk": "Vkontakte", "!grical": "GriCal", "!guitartabs": "GuitarTabsExplorer.com", "!netcraft": "Netcraft", "!bmp3": "BeeMP3", "!mbug": "Mozilla Bugzilla", "!dafont": "DaFont", "!ecosia": "Ecosia", "!expedia": "Expedia", "!blekkoi": "blekko.com/ws/ ... /images", "!uitinv": "www.uitinvlaanderen.be", "!scholarpedia": "Scholarpedia", "!zipca": "Zip.ca", "!dreamincode": "Dream In Code", "!bitgamer": "BitGamer", "!make": "Make Magazine Blog", "!flashback": "Flashback", "!transfermarkt": "transfermarkt.de", "!businessweek": "Business Week", "!ppa": "Personal Package Archives for Ubuntu", "!ppc": "PocketPC.ch", "!gigaom": "GigaOM", "!gist": "gists.github.com", "!npr": "NPR.org", "!ipartsplanet": "ipartsplanet.com", "!npm": "Node Package Manager", "!linuxmint": "Linux Mint Forums", "!c2": "C2 Wiki", "!willhaben": "Willhaben", "!quora": "Quora", "!bestbuy": "BestBuy", "!graph": "Graph.tk", "!digitalcomics": "Digital Comic Museum", "!tvcom": "tv.com", "!docjar": "Docjar", "!dogpile": "Dogpile", "!gssl": "Google with SSL", "!march": "Metal Archives", "!diasporatags": "Diaspora Tags", "!popsike": "Popsike", "!zoho": "Zoho", "!behindthename": "Behind the Name", "!metrolyrics": "Metro Lyrics", "!gbr": "Google BR", "!ebmy": "ebay.com.my", "!collaj": "collaj", "!operaext": "Opera Extensions", "!retailmenot": "RetailgMeNot", "!gbe": "Google BE", "!gbg": "Google BG", "!gbk": "Google Bookmarks", "!gbm": "Google Bookmarks", "!archiveis": "Archive.is", "!coral": "Coral CDN", "!vol": "Viva o Linux", "!goodfilms": "Goodfil.ms", "!appengine": "App Engine Docs", "!yubnub": "YubNub", "!prfc": "Pretty-RFC", "!kpop": "allkpop", "!thumbplay": "Thumb Play", "!salon": "Salon.com", "!dexonline": "Dexonline", "!groovy": "Groovy API", "!iconfinder": "IconFinder", "!dapi": "Drupal API", "!grelated": "Google", "!newsvine": "Newsvine", "!terraria": "Terraria Wiki", "!uman": "Ubuntu Manpages", "!wtfr": "Wiktionnaire Wiktionary FR", "!yui": "YUI Docs", "!delluk": "Dell UK", "!totalcmd": "TotalCmd.Net", "!cstheory": "Theoretical Computer Science - Stack Exchange", "!thepiratebay": "The Pirate Bay", "!metacpan": "MetaCPAN", "!amukmp3": "Amazon.co.uk MP3", "!hark": "Hark", "!gumtree": "gmtr", "!simbad": "SIMBAD Astronomical Database", "!ygo": "Yu-Gi-Oh! Wikia", "!jf": "JarFinder", "!geonames": "GeoNames", "!jb": "jupiter broadcasting", "!jl": "John Lewis", "!irs": "IRS", "!selfhtml": "SELFHTML", "!tof": "Tree Of Life Web Project", "!js": "JavaScript Docs", "!jq": "jQuery Docs", "!johnlewis": "John Lewis", "!irc": "irc.netsplit.de", "!lmgtfy": "LMGTFY", "!di": "Dictionary.com", "!mdc": "Mozilla Developer Center", "!dj": "Django documentation", "!dm": "Dailymotion", "!tweetgrid": "Tweetgrid", "!epubbud": "ePub Bud", "!da": "DeviantART", "!dc": "DuckDuckGo Community Forum", "!c1024": "Dem Commander1024 sein Blog", "!c1neon": "C1neon", "!df": "Daring Fireball", "!tf2wiki": "Team Fortress Official Wiki", "!dx": "DealExtreme", "!sectube": "Security Tube", "!dp": "Dogpile", "!espn": "ESPN", "!librivox": "LibriVox", "!kaskus": "Kaskus", "!wnetwork": "The Weather Network", "!mongo": "MongoDB", "!debianfr": "Debian pages in french language", "!fedex": "FedEx", "!slideshare": "SlideShare", "!allrovi": "AllRovi", "!boomkat": "boomkat", "!modx": "MODX", "!atx": "Atomix.vg", "!java": "Oracle Java Documentation", "!tones": "Thumb Play", "!walpha": "WolframAlpha", "!enit": "Google translate en-it", "!uloz": "uloz.to", "!appbrain": "AppBrain", "!poetry": "The Poetry Foundation", "!thefreedictionary": "The Free Dictionary", "!redfin": "RedFin", "!symfony": "Symfony Framework", "!podnapisi": "Podnapisi", "!giez": "Geizhals", "!yii": "Yii Framework", "!sesli": "Sesli Sözlük", "!hackernews": "HNsearch", "!youtify": "Youtify", "!fbaddons": "Browser Addons: Fireburst", "!ticketnetwork": "TicketNetwork", "!washingtonpost": "The Washington Post", "!desura": "Desura", "!graphicriver": "GraphicRiver", "!jishoj": "Jisho JAP to ENG", "!ebph": "ebay.ph", "!ebpl": "ebay.pl", "!bvideos": "Bing Videos", "!ign": "IGN", "!jishoe": "Jisho ENG to JAP", "!cisco": "Cisco", "!wiktde": "Wiktionary, das freie Wörterbuch", "!veekun": "Veekun Pokedex", "!geekcafe": "Le geek café", "!qomun": "Qomun", "!ikeade": "Ikea Germany", "!ymovies": "Yahoo! Movies", "!unicode": "Unicode Character Search", "!epicmafia": "Epic Mafia Wiki", "!ebnl": "ebay.nl", "!loc": "LOC.gov", "!python": "Python Docs", "!subscene": "Subscene", "!findchips": "FindChips", "!qrobei": "qrobe.it Images", "!finn": "Finn", "!doctrine": "Doctrine ORM", "!rottentomatoes": "Rotten Tomatoes", "!netzpolitik": "Netzpolitik.org", "!t411": "Torrent 411", "!synonymes": "Synonymes", "!seamonkey": "Seamonkey Add-on", "!host": "IP Lookup", "!ncheap": "NameCheap", "!webcite": "WebCitation", "!dbyte": "Darkbyte", "!fdroid": "F-Droid", "!elibre": "L'étudiant libre", "!koders": "Koders", "!aops": "Art of Problem Solving Wiki", "!play.com": "Play.com", "!serverfault": "ServerFault", "!emacswiki": "EmacsWiki", "!cracked": "Cracked", "!freebsdman": "FreeBSD Man Pages", "!gcz": "Google CZ", "!d20srd": "d20 SRD", "!britannica": "Britannica.com", "!bol": "Bol.com", "!tpbs": "The Pirate Bay sorted by seeds", "!gca": "Google CA", "!gcn": "Google CN", "!gco": "Google CO", "!greader": "Google Reader", "!adslabs": "NASA ADS Labs", "!ghacks": "Ghacks Technology News", "!whitepages": "InfoSpace", "!christmas": "Find Christmas Presents", "!postgresql": "PostgreSQL.org", "!photobucket": "PhotoBucket.com", "!ordsv": "Ord.se SV", "!freitag": "Der Freitag", "!jbhifi": "JB-HI-FI", "!filmweb": "Filmweb", "!ees": "ebay ES", "!imslp": "IMSLP", "!apple": "Apple", "!itunes": "iTunes Apps", "!books": "Amazon.com", "!ubuntuf": "Ubuntu Forums", "!ebaymy": "ebay.com.my", "!intaljazeera": "Aljazeera", "!gigablast": "GIGABLAST", "!blogspot": "Blogspot", "!bchain": "blockchain.info", "!valleywag": "Valleywag", "!whatif": "what if?", "!digitalcomicmuseum": "Digital Comic Museum", "!booko": "Booko", "!8tracks": "8tracks", "!naruto": "NarutoPedia", "!shodanhq": "SHODAN", "!gookokugo": "Goo国語辞典検索", "!crawl": "CrawlWiki", "!processing": "Processing.org", "!guardian": "The Guardian", "!nrc": "NRC", "!asknews": "Ask News", "!ebookee": "Ebookee", "!leoe": "LEO Dictionary English", "!habbotrading": "Habbo Ruilwaarde", "!python30": "Python3.0 Docs", "!python31": "Python3.1 Docs", "!python32": "Python3.2 Docs", "!php2py": "Php2Python", "!webstagram": "Webstagram", "!diaspora": "Diaspora", "!ping": "DomainTools.com", "!gph": "Google PH", "!parashift": "Parashift.com", "!noaa": "NOAA", "!fports": "FreeBSD Ports", "!discussion": "Google Discussion Search", "!artwork": "artcyclopedia.com", "!webmenu": "webmenu", "!youdao": "Youdao", "!eksi": "ek$i sozluk", "!otran": "Open-Tran.eu", "!entrez": "Entrez", "!doaj": "Directory of Open Access Journals", "!scribd": "Scribd", "!verge": "The Verge", "!networkx": "networkx", "!songmeaning": "Songmeaning", "!markmail": "MarkMail", "!gamejaunt": "Game Jaunt", "!wp7fr": "Windows Phone 7 Marketplace France", "!etym": "etymonline.com", "!py3k": "Python 3 docs", "!iec": "Institut d'Estudis Catalans", "!rswiki": "Runescape Wiki", "!archive": "Internet ", "!gve": "Google VE", "!rlslog": "Releaselog", "!gviewer": "Google Docs Viewer", "!11870": "11870", "!gvn": "Google VN", "!geizhals": "Geizhals", "!gview": "Google Docs Viewer", "!playlist": "Playlist.com", "!ebaynl": "ebay.nl", "!btcaddr": "blockchain.info", "!adsabs": "SAO/NASA Astrophysics Data System", "!cartoonnetwork": "Cartoon Network", "!anime": "aniDB", "!knowyourmeme": "Know Your Meme", "!gizoogle": "Gizoogle", "!csc": "Chicken Scheme Chickadee", "!channel4": "Channel 4", "!channel5": "Channel 5", "!sheetmusicplus": "Sheet Music Plus", "!gyear": "Google Past Year", "!tldp": "The Linux Documentation Project", "!half": "Half.com", "!daum": "Daum", "!arch": "ArchLinux Wiki", "!splunk": "Splunk", "!..": "..duo dotdotduo", "!github": "GitHub.com", "!lenovo": "Lenovo", "!linkup": "LinkUp", "!icons": "IconFinder", "!tyda": "Tyda.se", "!fc": "FreeCode", "!fb": "Facebook", "!torrent": "ISOHunt", "!theh": "the h", "!ff": "fanfiction.net", "!dkwk": "DokuWiki", "!fd": "Free Dictionary", "!sourceforge": "SourceForge.net", "!bitbucket": "BitBucket.org", "!fotolog": "Fotolog", "!rae": "Diccionario de la lengua española", "!tcl": "TCLers Wiki", "!ft": "Financial Times", "!bookdepository": "The Book Depository", "!fy": "Fuck Yeah", "!digg": "Digg", "!fsfd": "Free Software Directory", "!tigsource": "TIGSource", "!bpedia": "Bulbapedia", "!audiojungle": "AudioJungle", "!pricegrabber": "Price Grabber", "!openstreet": "OpenStreetMap", "!flex": "Flex Docs", "!addic7ed": "Addic7ed", "!down": "Down For Everyone Or Just Me", "!myfonts": "Myfonts", "!dotlan": "Dotlan EVE Maps", "!nnd": "Norwegian Nynorsk Dictionary", "!heureka": "Heureka!", "!vimdoc": "Vimdoc", "!pinvoke": "Pinvoke.net", "!ehow": "eHow", "!matplotlib": "matplotlib", "!freedictionary": "Free Dictionary", "!nginxwiki": "nginx wiki", "!wes": "Wikipedia ES", "!weu": "Wikipedia", "!ites": "Google translate it-es", "!headfi": "Head-Fi", "!cve": "Common Vulnerabilities and Exposures CVE", "!web": "Web Platform", "!fimfic": "FimFiction", "!iteo": "Vocabolario Italiano-Esperanto Minnaja", "!iten": "Google translate it-en", "!gfl": "Google", "!2dehands": "2dehands.be", "!myanimelist": "MyAnimeList", "!wen": "Wikipedia EN", "!weo": "Wikipedia EO", "!cdt": "China Digital Times", "!searchch": "search.ch", "!ahk": "AutoHotkey", "!dottk": "Dot TK", "!imdb": "IMDB", "!blindsearch": "Blind Search", "!toma": "Toma.hk", "!cdc": "CDC", "!ahw": "Arkham Horror Wiki", "!ebaybe": "ebay.be", "!cdn": "Cdn js", "!tlfi": "Trésor de la Langue Française informatisé", "!pw": "Pricewatch", "!wolfram": "WolframAlpha", "!ps": "Picsearch", "!blocket": "Blocket", "!stagevu": "StageVu", "!py": "Python Docs", "!bsdman": "FreeBSD", "!nametoolkit": "NameToolkit", "!srfi": "Scheme Request for Implementation", "!ifixit": "iFixit", "!domain": "NameCheap", "!archbugs": "ArchLinux Bugtracker", "!pb": "Pinboard", "!4sq": "Jaen", "!jquery": "jQuery Docs", "!tickets": "StubHub", "!firefoxmarket": "Firefox Marketplace", "!bcwiki": "Bitcoin Wiki", "!numpy": "numpy", "!srcforge": "SourceForge", "!tvguide": "TV Guide", "!friendster": "Friendster", "!thenation": "The Nation", "!eggtimer": "Egg Timer", "!911": "911tabs", "!dnb": "Deutsche National Bibliothek", "!tasteline": "Tasteline", "!librarything": "LibraryThing", "!forvo": "Forvo", "!querycat": "QueryCat", "!findjar": "FindJar.com", "!dns": "DNS Lookup", "!pcpartpicker": "PCPartPicker", "!playterm": "PlayTerm", "!gw2": "Guild Wars 2 Wiki", "!gnews": "Google News", "!mtv": "MTV", "!arcgisres": "ArcGIS Resource Center", "!askubuntu": "Ask Ubuntu", "!dw": "Deeper Web", "!springsource": "SpringSource", "!aliexp": "Aliexpress", "!cnbc": "CNBC", "!stupi": "Stupidedia", "!gae": "Google AE", "!bingimages": "Bing Images", "!pokepedia": "Pokepedia", "!macys": "Macy's", "!gat": "Google AT", "!gau": "Google AU", "!jstor": "JSTOR", "!gar": "Google AR", "!gas": "Google American Samoa", "!2ememain": "2ememain.be", "!superd": "SuperDownloads", "!gwp": "Google Wikipedia", "!wlfind": "cablegatesearch", "!ymaps": "Yahoo Maps", "!unity": "Unity Answers", "!beopt": "Beolingus De-pt", "!xkcd": "xkcd", "!libuniversitaria": "Libreria Universitaria", "!gcl": "Google CL", "!allexperts": "All Experts", "!adplanner": "Google Ad Planner", "!python27": "Python2.7 Docs", "!python26": "Python2.6 Docs", "!pricespy": "pricespy.co.nz", "!zdnet": "ZDNet", "!sweetsearch": "SweetSearch4me", "!evernote": "Evernote", "!appnr": "appnr", "!wresfr": "Wordreference", "!drinkify": "Drinkify", "!marktplaats": "Marktplaats", "!gdgt": "gdgt", "!distro": "DistroWatch", "!okazii": "Okazii", "!duck.co": "duck.co", "!wired": "Wired", "!couponmeup": "CouponMeUp", "!zhen": "Nciku", "!spezify": "Spezify", "!zillow": "Zillow.com", "!kotobank": "コトバンク用語検索", "!wtde": "Wiktionary Deutsch", "!tastekid": "TasteKid", "!gopkg": "GoPkgDoc", "!gawker": "Gawkr", "!googlemap": "Google Maps", "!hulu": "Hulu", "!wikisimple": "Wikipedia Simple", "!oeis": "The On-Line Encyclopedia of Integer Sequences", "!veronica": "Veronica2", "!blekko": "Blekko", "!concerts": "Pollstar", "!filecrop": "filecrop", "!mtg": "magiccards.info", "!sqlalchemy": "SQL Alchemy Docs", "!cxx": "Cplusplus.com", "!itv": "iTV Player", "!tmt": "Tiny Mix Tapes", "!tmz": "TMZ", "!pcgarage": "pcgarage", "!gcal": "Google Calendar", "!halopedia": "Halopedia", "!readwriteweb": "ReadWriteWeb", "!barnesandnoble": "Barnes & Noble", "!alexasi": "alexa", "!slackbuild": "Slackbuilds", "!adlibrisfi": "AdLibris FI", "!fcatch": "FileCatch.com", "!scopek": "scopek", "!uniprot": "uniprot", "!superuser": "SuperUser", "!dbsnp": "NCBI dbSNP", "!thinktutorial": "Th!ink", "!evec": "EVE-Central", "!pricewatch": "Tweakers Pricewatch", "!w3": "W3C", "!wfr": "Wikipedia FR", "!mouser": "Mouser Electronics", "!tvrage": "TVRage", "!evirtdes": "Estante Virtual description", "!wfa": "Persian Wikipedia", "!jms": "JoobMobile Support", "!webmd": "WebMD", "!wfi": "Finnish Wikipedia", "!isitdown": "isup.me", "!ieee": "IEEE Xplore Digital Library", "!entireweb": "Entireweb", "!ada": "Ada 2005 Manual", "!collegeboard": "CollegeBoard", "!drugbank": "drugbank.ca", "!bluray": "blu-ray.com", "!ghu": "Google HU", "!gwpde": "Google de.Wikipedia", "!isbnnu": "isbn.nu", "!wikibooks": "Wikibooks", "!atomurl": "Atomurl", "!wp": "WordPress.org", "!wq": "WikiQuote", "!wr": "WordReference", "!images": "Google Images", "!wt": "Wiktionary", "!wu": "Weather Underground", "!devo": "Dev.Opera ", "!menupages": "MenuPages", "!psql": "PostgreSQL Docs", "!rapgenius": "Rap Genius", "!wikihow": "WikiHow", "!boingboing": "boingboing", "!cppr": "Cppreference", "!searchcode": "searchco.de", "!wc": "The Weather Channel", "!wd": "Website Down", "!wf": "fr.wikipedia.org", "!wg": "WunderGround", "!wm": "Wikipedia mobile", "!pitchfork": "Pitchfork Media", "!alternative": "AlternativeTo.net", "!alexa": "Alexa", "!cyberport": "Cyberport", "!superdownloads": "SuperDownloads", "!craigslist": "Craigslist", "!tcgplayer": "TCGPlayer", "!tigdb": "The Indie Game Database", "!filext": "FILExt", "!lwjgl": "LWJGL", "!videohive": "VideoHive", "!dig": "dig Lookup", "!die": "Linux.die.net man pages", "!dic": "Dream In Code", "!magmawiki": "MagmaWiki", "!groklaw": "Groklaw", "!wiktbr": "Wikeriadur", "!editus": "editus.lu", "!adsref": "NASA ADS Bibliographical reference search", "!y": "Yahoo!", "!pkgsrc": "Pkgsrc.se", "!myetym": "www.myetymology.com", "!rmp": "Rate My Professor", "!emedicine": "Medscape Reference", "!gsbr": "Google Shopping BR", "!geiz": "Geizhals", "!jcpenney": "JC Penney", "!lma": "Live Music Archive", "!nce": "Nciku English", "!heroku": "Heroku Devcenter", "!gitl": "Google IT", "!bmaps": "Bing Maps", "!slbr": "SpeakLikeABrazilian", "!rml": "R mailing lists archive", "!bandcamp": "Bandcamp", "!zerohedge": "ZeroHedge", "!gmaps": "Google Maps", "!springer": "Springer Link", "!sc2ranks": "SC2Ranks", "!g4tv": "G4TV", "!random": "random.org", "!like": "Thesaurus.com", "!emule": "eMule Content Database", "!tr": "Google Translate", "!punchfork": "Punchfork", "!niv": "BibleStudyTools.com", "!thetvdb": "The TV db", "!yaen": "Yandex", "!essefn": "ESSEF nl", "!nih": "NIH", "!metal": "Encyclopedia Metallum The Metal Archives", "!glink": "Google", "!shbd": "Shabdkosh", "!wikide": "Wikipedia", "!fgf": "Flightgear Forums", "!lisp": "Lispdoc", "!downfor": "DownForEveryone?", "!asn": "AS Lookup", "!ask": "Ask.com", "!ujc": "Internetová jazyková příručka", "!archpkg": "ArchLinux Packages", "!hes": "HES Data Dictionary", "!tinypic": "TinyPic", "!evirt": "Estante Virtual all", "!wwend": "Worlds Without End", "!artist": "artcyclopedia.com", "!amo": "Firefox Addons", "!aes": "Amazon ES", "!adobe": "Adobe", "!archwiki": "ArchLinux Wiki", "!subito": "Subito.it", "!furet": "Furet du Nord", "!jalopnik": "Jalopnik", "!wordreference": "WordReference", "!ohloh": "ohloh", "!filestube": "FilesTube", "!myspace": "MySpace", "!kickasstorrents": "Kick Ass Torrents", "!build": "Build.com", "!jeux": "JeuxVideo", "!gtfr": "Google Translate to French", "!moddb": "ModDB", "!datpiff": "Datpiff", "!mcskin": "Minecraft Skin Search", "!as3": "AS3 Docs", "!spanishdict": "SpanishDict", "!softpedia": "Softpedia", "!yahoo": "Yahoo!", "!drupal": "Drupal", "!safebooru": "Safebooru", "!mercadolibre": "Mercado Libre", "!rollingstone": "Rolling Stone", "!viewpdf": "Online PDF Viewer", "!wallpaper": "Google Images", "!grooveshark": "Grooveshark", "!netgear": "Netgear", "!bsd": "GoogleBSD", "!wiktfr": "Wiktionnaire", "!webwarper": "WebWarper.com", "!ikeafr": "Ikea FR", "!sumotorrent": "sumotorrent", "!railsdock": "Rails-Dock", "!dtdeals": "DoubleTakeDeals", "!omgu": "OMG! Ubuntu!", "!btabs": "UltimateGuitar.com", "!diccionari": "Diccionari de la llengua Catalana", "!usaspending": "usaspending.gov", "!evewiki": "EVElopedia", "!puc": "Ubuntu Packages Search", "!ral": "RAL color coding system", "!hymnary": "Hymnary", "!mimvi": "Mimvi", "!lmddgtfy": "LMDDGTFY.NET", "!versandapo": "VersandApo", "!kprojects": "KDE Git Projects", "!howtogeek": "How-To Geek", "!metalab": "Metalab Mediawiki", "!userstyles": "Userstyles", "!opera": "Opera Extension", "!file": "FileHippo", "!gems": "RubyGems", "!etsy": "Etsy", "!ext": "FILExt", "!applediscuss": "Apple Discussions", "!ios": "iOS Developer Library", "!linuxhcl": "Linux Hardware Compatibility List", "!esit": "Google translate es-it", "!lasership": "LaserShip", "!abcnotation": "abcnotation.com", "!iol": "IOL", "!evirted": "Estante Virtual by publisher", "!cultureunplugged": "CultureUnplugged.com", "!snl": "http://snl.no/", "!ctan": "CTAN.org", "!sporcle": "Sporcle", "!kol": "The KoLwiki", "!amazonfr": "Amazon france", "!pbs": "PBS", "!xiami": "Xiami", "!port": "port Lookup", "!ebayhk": "ebay.com.hk", "!scirus": "Scirus", "!pbi": "Pbi Directory", "!hackage": "HackageDB", "!comicrocket": "Comic Rocket", "!kos": "KingOfSat", "!opensubtitles": "OpenSubtitles.org", "!verticalset": "Vertical Set", "!dribble": "dribbble", "!oracle": "Oracle.com", "!metafilter": "MetaFilter", "!ordnet.dk": "Ordnet", "!bookfinder": "Book Finder", "!register": "The Register", "!firmycz": "firmy.cz", "!yandexm": "Yandex Market", "!pic": "picsearch", "!reuters": "Reuters", "!cpan": "MetaCPAN", "!tvlinks": "TVLinks", "!hitchwiki": "Hitchwiki", "!wtit": "Wiktionary", "!dash": "Digital Access to Scholarship at Harvard", "!wpthemes": "WordPress.org Themes", "!jarvanaproject": "Jarvana", "!cpap": "CPAP.com", "!habr": "HabraHabr", "!local": "Google Local", "!ames": "Amazon España", "!uschess": "US Chess Federation", "!mathworld": "Wolfram MathWorld", "!gcache": "Google Cache", "!isbndb": "ISBNdb.com", "!brreg": "Brønnøysundregistrene", "!academic": "Microsoft Academic", "!bookflavor": "Bookflavor", "!citeul": "CikeULike", "!aion": "Aion Wiki", "!ox": "Oxford Dictionaries", "!oz": "Stichting OZNB Foundation", "!nndb": "NNDB", "!nolo": "Nolo.com", "!gcode": "Google Code", "!reed": "reed.co.uk", "!genesis": "Library Genesis", "!yr": "yr", "!identica": "Identi.ca", "!lynx": "lynx.io", "!progarchives": "Prog Archives", "!qrz": "QRZ.com", "!shoutitout": "Shoutitout", "!cine": "Cinemassacre", "!yc": "HNsearch", "!mkz": "musik", "!wbr": "Wikipedia Brezhoneg", "!yf": "Yahoo Finance", "!asksutra": "Ask Sutra", "!codecanyon": "CodeCanyon", "!osi": "Open Source Initiative", "!arduino": "Arduino", "!ose": "Open Site Explorer", "!track": "PackageMapping", "!mpbo": "MenuPages", "!pond5": "Pond5", "!chilango": "Chilango", "!nina": "Narodowy Instytut Audiowizualny nina.gov.pl", "!similarsitesearch": "similarsitesearch", "!gshopping": "Google Shopping", "!ohinternet": "ohinternet.com", "!smashwords": "Smashwords", "!fullwiki": "The Full Wiki", "!tvdb": "TheTVDB.com", "!apidockruby": "APIdock", "!abe": "Abe's Market", "!video": "YouTube", "!dfwiki": "DwarfFortress Wiki", "!google": "Google", "!linkscape": "Open Site Explorer", "!thwiki": "Touhouwiki English", "!digikey": "Digi-Key", "!gfinance": "Google Finance", "!smallsafari": "SmallSafari", "!ultimateguitar": "Ultimate Guitar", "!dirae": "Dirae", "!techiris": "The TechIRIS", "!clusty": "Clusty", "!latimes": "LATimes", "!dhlde": "DHL German", "!besch": "Bescherelle", "!gamerankings": "GameRankings.com", "!staples": "Staples.com", "!fnac": "Fnac", "!malpha": "Memory Alpha", "!australian": "The Australian", "!paleo": "Paleo Hacks", "!danbooru": "Danbooru", "!ebsg": "ebay.com.sg", "!packagist": "Packagist", "!software": "Download.com", "!jigsaw": "Jigsaw", "!msnbc": "MSNBC", "!squidoo": "Squidoo", "!adlibrisse": "AdLibris SE", "!ddo": "Den Danske Ordbog", "!phpnet": "PHP.net", "!nzb": "NzbMatrix", "!ddg": "DuckDuckGo", "!scripts": "HotScripts", "!ebayfr": "ebay.fr", "!howtoforge": "HowtoForge", "!webischool.org": "webischool.org", "!cpuworld": "cpu-world.com", "!theonion": "The Onion", "!ebay": "eBay", "!kat": "Kick Ass Torrents", "!seeks": "Seeks", "!quran": "The Noble Qur'an", "!yv": "Yahoo", "!drive": "Google Drive", "!ptp": "Pass The Popcorn", "!ebat": "ebay.at", "!infochimps": "Infochimps", "!jalop": "Jalopnik", "!gth": "Google TH", "!buej": "BU Alumni Medical Library- E-Journals", "!appleinsider": "AppleInsider", "!woxikon": "Woxikon", "!node": "node.js docs", "!weatherbug": "WeatherBug", "!zahe": "Zahe.me", "!macaddress": "MAC Address", "!rdio": "Rdio", "!nettuts": "Nettuts+", "!tawlk": "Tawlk", "!vala": "http://live.gnome.org/Vala", "!csmonitor": "CSMonitor", "!hphys": "HyperPhysics", "!searchcpan": "CPAN", "!recipes": "Punchfork", "!dtag": "DebTags", "!mspawiki": "MS Paint Adventures Wiki", "!enl": "ebay.nl", "!dpr": "dpreview", "!gnz": "Google New Zealand", "!gnu": "GNU", "!freedict": "Free Dictionary", "!opencv": "OpenCV documentation", "!l1sp": "Lisp Docs", "!gnm": "Google News mobile", "!gnl": "Google NL", "!gno": "Google NO", "!osm": "OpenStreetMap", "!translate": "Google Translate", "!developpez": "Developpez.com", "!orielly": "O'Reilly", "!wresen": "WordReference", "!ens": "Ensembl", "!trisquel": "Trisquel", "!dsd": "Den Store Danske", "!eff": "Electronic Frontier Foundation", "!yt": "YouTube", "!isgd": "is.gd", "!digitalspy": "DigitalSpy", "!gamecheats": "CheatCC", "!allmusic": "AllMusic", "!name": "Name.com ", "!unix": "The Unix Tree", "!savannah": "Savannah", "!use": "Unix & Linux StackExchange", "!dmoz": "dmoz", "!allposters": "All Posters", "!perlmod": "p3rl.org", "!sigma": "Sigma Aldritch Catalog", "!greeksubtitles": "Greek Subtitles Project", "!h33t": "h33t", "!fool": "Fool.com", "!sapo": "SAPO", "!fonplus": "Find People on Plus", "!zemljevid": "Zemljevid Najdi.si", "!amde": "Amazon.de", "!dplb": "DPLB", "!watch": "YouTube", "!synonyms": "Thesaurus.com", "!drupalapi": "Drupal API", "!french": "French Language and Usage", "!stabs": "Songsterr", "!jamendo": "Jamendo", "!costco": "Costco.com", "!nf": "netflix", "!ne": "Newegg", "!nx": "networkx", "!kelkoo": "Kelkoo UK", "!stumbleupon": "StumbleUpon", "!gmg": "Green Man Gaming", "!godaddy": "GoDaddy", "!efr": "ebay.fr", "!wca": "Wikipedia CA", "!cultofmac": "Cult of Mac", "!kong": "Kongregate", "!mywot": "Web of Trust", "!wcs": "Wikipedia Cs", "!mafia": "mafiatoday", "!safeon": "DDG Safesearch On", "!head-fi": "Head-Fi", "!mpch": "MenuPages", "!guildwiki": "Guild Wiki", "!osvdb": "The Open Source Vulnerability Database", "!redz": "RedZ", "!wwwjdic": "WWWJDIC", "!fotobanka": "FotoBanka", "!corriere": "Corriere della Sera", "!furaffinity": "FurAffinity", "!readthedocs": "Read the Docs", "!ponsde": "PONS", "!mmls": "Minuteman Library Network", "!enes": "Google translate en-es", "!ubuntuusers": "Ubuntuusers", "!enel": "Google translate en-el", "!eneo": "Sonja's English-Esperanto Dictionary", "!biblegateway": "BibleGateway", "!mysql": "MySQL.com", "!perl": "p3rl.org", "!nhl": "NHL.com", "!wrfe": "Wordreference fr->en", "!ukp": "UK Parliament", "!shelfari": "Shelfari", "!mapquest": "Mapquest", "!ffm": "Firefox Marketplace", "!touhou": "Touhou Wiki", "!elexikon": "Elektronik-Lexikon", "!gmail": "GMail.com", "!mill": "Million short", "!jpg": "http://jpg.to/", "!amcn": "Amazon.cn", "!wru": "Wikipedia RU", "!chow": "Chowhound", "!amca": "Amazon.ca", "!mozbrowser": "MozBrowser.nl", "!wayback": "Wayback Machine", "!imdbp": "IMDB pro", "!jar": "FindJar.com", "!folktunefinder": "FolkTuneFinder", "!robtex": "Robtex", "!esen": "Google translate es-en", "!slickdeals": "SlickDeals", "!movieweb": "Movie Web", "!batoto": "Batoto", "!miniinthebox": "MiniInTeBox", "!feedbooks": "Feedbooks", "!tnw": "The Next Web", "!tnt": "TNT", "!oca": "Open Clip Art Library", "!pspgen": "PSP GEN", "!is": "http://ilmainensanakirja.fi/", "!pten": "Google Translate pt-en", "!iso": "DistroWatch", "!iw": "InstantWatcher", "!ocw": "MIT OpenCourseWare", "!ix": "Ixquick Alias", "!fowiki": "The Vault/Nukapedia/Fallout Wiki", "!aljazeera": "Aljazeera English", "!bangs": "DuckDuckGo", "!charitynavigator": "Charity Navigator", "!qtc": "Nokia QT Docs", "!simplyhired": "SimplyHired", "!multicolr": "Multicolr Search Lab", "!gse": "Google SE", "!ebuild": "Gentoo Packages", "!dispt": "Dispostable", "!poems": "The Poetry Foundation", "!eow": "英辞郎 on the WEB Pro", "!amazon": "Amazon.com", "!mpdc": "MenuPages", "!uitm": "Uitmuntend", "!gsa": "GSA Advantage", "!localch": "local.ch", "!thefutoncritic": "The Futon Critic", "!cran": "CRAN", "!flattr": "Flattr", "!goear": "Goear", "!awimg": "All the web, yahoo version", "!pythondev": "Python dev doc", "!delicious": "delicious", "!wikinews": "Wikinews", "!albumartcd": "Albumart Music", "!ya": "Yandex", "!tivo": "TiVo", "!selfhtmlwiki": "SELFHTML wiki", "!othes": "http://openthes-es.berlios.de/", "!sos": "Software OpenSuse", "!docubufr": "Documentation Ubuntu-fr", "!ciu": "Can I use...", "!auk": "Amazon UK", "!slatefr": "Slate.fr", "!brew": "Homebrew", "!aur": "Arch Linux", "!cia": "CIA World Factbook", "!snuson": "SnusOn", "!gblogs": "Google Blogs", "!hn": "HNsearch", "!ikea": "Ikea", "!edgar": "EDGAR", "!ck12": "cK-12.org", "!linuxfr": "LinuxFr.org", "!mightyape": "Mighty Ape", "!vimeo": "Vimeo", "!fox": "Fox News", "!altto": "AlternativeTo", "!gtde": "Google Translate to German", "!octopart": "Octopart", "!creativecowlib": "Creative Cow Library", "!blueletterbible": "Blue Letter Bible", "!fbrecipes": "Recipes: Fireburst", "!uu": "Ubuntuusers", "!commons": "Wikimedia Commons", "!rubygems": "RubyGems", "!bitesizegcse": "BBC GCSE Bitesize", "!x86": "x86 Opcode & Instruction Reference", "!ug": "Ultimate Guitar", "!ud": "Urban Dictionary", "!django": "Django Docs", "!maany": "Almaany", "!xmarks": "Xmarks | Boomark Sync and Search", "!freshports": "FreshPorts", "!lnu": "Library.nu", "!ftram": "File Tram", "!zvon": "ZVON.org", "!playasia": "Play-asia", "!iops": "Iops", "!pminister": "Priceminister", "!rbl": "RBL Lookup", "!gscholar": "Google Scholar", "!acronym": "Acronyms", "!piratebay": "The Pirate Bay", "!som": "Spirit of Metal", "!ktechbase": "KDE TechBase", "!lonelyplanet": "lonelyplanet", "!braumeister": "Braumeister", "!vossey": "Vossey.com", "!arxiv": "arXiv", "!metacritic": "Metacritic", "!lyriki": "Lyriki", "!blinders": "DuckDuckGo Blinders", "!tineye": "Tineye", "!rdoc": "RubyDoc.info", "!yelp": "Yelp", "!jeuxvideo.com": "jeuxvideo.com", "!./": "Slashdot", "!djangome": "Django Docs", "!etymology": "EtymOnline.com", "!pipl": "Pipl", "!parlysearch": "ParlySearch", "!baixaki": "Baixaki", "!instructables ": "Instructables", "!glt": "Google LT", "!ruby": "Ruby-lang.org", "!techjungle": "Tech Jungle", "!ebayit": "ebay.it", "!bnews": "Bing News", "!bnf": "Bibliothèque nationale de France ", "!gulesider": "Gule Sider", "!newyorker": "The New Yorker", "!wikit": "Wikitravel", "!jisho": "Jisho", "!portableapps": "PortableApps.com", "!smogon": "Smogon University", "!punguzo": "Punguzo.com", "!apertium": "Appertium", "!twitter": "Twitter", "!omq": "Open.MapQuest.com", "!wikic": "Wikimedia Commons", "!wikia": "Wikia", "!netflix": "Netflix current one is broken", "!pinterest": "pinterest.com/", "!recycle": "Earth911.com", "!repubblica": "la Repubblica", "!gri": "Google Reverse Image Search", "!courant": "Hartford Courant", "!cooksi": "Cook's Illustrated", "!gro": "Google RO", "!posix": "The Open Group", "!minecraft": "Minecraft Wiki", "!gru": "Google RU", "!grv": "Grooveshark", "!flickr": "Flickr", "!xing": "Xing.de", "!fssc": "Code: Fireburst Specialized Search", "!safeoff": "Safe search off", "!usps": "USPS", "!stumble": "StumbleUpon", "!pyramid": "Pyramid Web Application Development Framework", "!stuffnz": "stuff.co.nz", "!amuk": "Amazon.co.uk", "!alternativeto": "AlternativeTo", "!pandora": "Pandora", "!hitta": "Hitta", "!cspan": "C-SPAN", "!gratefuldead": "Grateful Dead Concerts", "!qur": "The Noble Qur'an", "!seslisozluk": "sesli sözlük", "!vagalume": "Vagalume", "!ricardo": "www.ricardo.ch", "!mapsfr": "Google Maps FR", "!swipl": "SWI-Prolog", "!basesearch": "BASE Bielefeld Academic Search Engine", "!eu3": "Europa Universalis III Wiki", "!zf": "http://framework.zend.com", "!rom": "Emuparadise", "!kolw": "Kingdom of Loathing Wiki", "!cheatcodes": "CheatCC", "!ovi": "Ovi Store", "!mbsdman": "MirBSD Manpages", "!ord": "Ord.se", "!flix": "http://www.flixster.com/", "!roto": "Rotoworld", "!hayoo": "Hayoo", "!kuler": "Adobe Kuler", "!jaba": "JABA and JEAB articles", "!image": "Google Images", "!niif": "NIIF Institute", "!microsoft": "Microsoft", "!geegain": "Geegain Search", "!tpp": "ThePirateParty TPB Mirror", "!dict": "DICT.org", "!tknowledge": "True Knowledge", "!jobs": "Indeed", "!gza": "Google ZA", "!allrecipes": "All Recipes", "!rogerebert": "Roger Ebert", "!redflagdeals": "RedFlagDeals.com", "!dpackages": "Debian Packages", "!greplin": "Greplin", "!gephi": "Gephi", "!debml": "Debian Mailing Lists", "!dealextreme": "DealExtreme", "!tgdict": "tangorin", "!dpkg": "Debian Packages", "!archived": "Wayback Machine", "!ark": "Intel Ark", "!occuprint": "Occuprint", "!ars": "Ars Technica", "!gban": "GameBanana", "!emag": "eMAG", "!locita": "Locita", "!homebase": "Homebase", "!adn": "app.net", "!sitealytics": "sitealytics.com", "!darklyrics": "DarkLyrics.com", "!grepcpan": "CPAN -> GREP", "!mashable": "Mashable", "!adc": "Apple Developer Center", "!torrentz": "Torrentz", "!posten": "Posten", "!osxdaily": "Osxdaily", "!vgmdb": "VGMdb", "!ads": "SAO/NASA ADS", "!shop": "Yahoo! Shopping", "!kobo": "Kobo", "!dlss": "Summon Duke", "!tz": "timeanddate", "!peppermintos": "Peppermint OS forums", "!slyrics": "SONG LYRICS", "!patft": "US Patent Database Search", "!tt": "Tokyo Toshokan", "!tw": "Twitter", "!tv": "Yahoo! TV", "!javascript": "JavaScript Docs", "!tk": "True Knowledge", "!slackfind": "Slackfind", "!vatera": "Vatera", "!imeem": "Imeem", "!tc": "Techcrunch", "!buscape": "Buscapé", "!tg": "ThinkGeek", "!wikipainting": "wikipaintings", "!mydealz": "myDealZ", "!tmark": "Justia.com trademarks", "!watchanime": "Watch Anime On", "!vbox7": "Vbox7", "!tanka": "Tankafetast", "!pyside": "PySide", "!maxthon": "Maxthon 3 Extension", "!ufrj": "Universidade Federal do Rio de Janeiro", "!francesurf": "FranceSurf", "!urban": "Urban Dictionary", "!anagram": "One Across", "!proofwiki": "ProofWiki", "!omgubuntu": "OMG! Ubuntu!", "!pypi": "Pypi.python.org", "!d20pfsrd": "Pathfinder SRD", "!lxr": "Linux Cross Reference", "!fsfe": "Free Software Foundation Europe", "!wiktes": "Wikcionario", "!redbox": "RedBox", "!dbugs": "Debian Bugs", "!nbsdman": "NetBSD manual pages", "!rso": "R questions on Stack Overflow", "!clubic": "Clubic", "!karmadecay": "Karma Decay", "!gethuman": "GetHuman", "!openprocessing": "OpenProcessing", "!cocoa": "Apple Developer", "!rdns": "Reverse DNS", "!liberia": "Libreria Universitaria", "!gmx": "Google MX", "!gmy": "Google MY", "!ein": "ebay.in", "!thestar": "The Star", "!demonoid": "Demonoid", "!erowid": "Erowid", "!eie": "ebay.ie", "!hastane": "Hastane", "!shutterstock": "Shutterstock", "!eit": "ebay.it", "!mc": "Metacritic", "!wetter": "Wetter.com", "!peeron": "Peeron", "!smh": "SMH.com.au", "!smg": "Search My Gmail", "!start": "START", "!golang": "Go Programming Language", "!edgart": "Edgar", "!onr": "Oh No Robot", "!ficly": "ficly", "!rs4": "rs.4chan.org", "!argos": "Argos", "!gsg": "Google SG", "!speed": "Speed.cd", "!gsc": "Google Scholar", "!khan": "Khan Academic", "!elreg": "The Register", "!gsl": "Google SL", "!gsk": "Google SK", "!mediawiki": "MediaWiki", "!openports": "OpenPorts", "!bacon": "Oracle of Bacon", "!raamattu": "Koivuniemen Raamattuhaku", "!pci": "http://www.pcinpact.com", "!googleimages": "Google Images", "!uncyclopedia": "Uncyclopedia", "!howstuffworks": "How Stuff Works", "!wolframalpha": "WolframAlpha", "!circuitcity": "Circuit City", "!esvonline": "ESVonline", "!bulba": "Bulbapedia", "!findlunchin": "FindLunchIn", "!scrabblelookup": "scrabblelookup", "!ipt": "IP Torrents", "!filehippo": "FileHippo", "!urbandictionary": "Urban Dictionary", "!ptv": "PipocasTV", "!mcwiki": "Minecraft Wiki", "!wikipaintings": "wikipaintings", "!theregister": "the register", "!ebau": "ebay.com.au", "!linguee": "Linguee", "!disney": "Disney.com", "!waffles": "Waffles", "!wpplugins": "WordPress.org Plugins", "!airbnb": "airbnb", "!walmart": "WalMart", "!longurl": "LongURL.org", "!iafd": "internet adult film database", "!salix": "SalixOS", "!wsv": "Wikipedia SV", "!activestate": "ActiveState.com", "!scholar": "Google Scholar", "!wsl": "Wikipedia SL", "!bbcfood": "BBC Food", "!wsj": "The Wall Street Journal", "!norsk": "Norskordbok | UiO", "!nicolinux": "Le blog de Nicolinux", "!openbsd": "OpenBSD", "!magiccards": "Magiccards.info", "!euk": "ebay.co.uk", "!tig": "TIGSource", "!hp": "HP", "!kcls": "King County Library System" }
A = int(input()) n = 1 while n ** 3 < A: n += 1 print('YES' if n ** 3 == A else 'NO')
""" Push O(1) :Push Element To Top Pop O(1) : POP Element From Top get_max O(1) : Returns max Element from the stack Peek O(1): Returns Top Element Size O(1) : Returns Size of the stack """ class Stack: def __init__(self): self.items = [] self.itemmax=[] self.top=0 def isEmpty(self): return self.items == [] def push(self, item): self.items.append(item) if self.items[self.top-1] < item or self.top==0: self.itemmax.append(item) else: self.itemmax.append(self.itemmax[self.top-1]) self.top=self.top+1 def pop(self): self.top=self.top-1 self.itemmax.pop() return self.items.pop() def peek(self): return self.items[self.top-1] def size(self): return len(self.items) def get_max(self): return self.itemmax[self.size()-1] if __name__ == "__main__": stack=Stack() stack.push(10) print("Pushed Element :",stack.peek()) print("Max Element :", stack.get_max()) stack.push(2) print("Pushed Element :",stack.peek()) print("Max Element :", stack.get_max()) stack.push(50) print("Pushed Element :",stack.peek()) print("Max Element :", stack.get_max()) stack.push(45) print("Pushed Element :",stack.peek()) print("Max Element :", stack.get_max()) stack.push(30) print("Pushed Element :",stack.peek()) print("Max Element :", stack.get_max()) #print(stack.itemmax) #print(stack.items) print("==========================") while stack.size()!=0: print("Max Element :", stack.get_max()) print("Poped Element :",stack.pop())
tupla =( 'APRENDER', 'PROGRAMAR', 'LINGUAGEM', 'PYTHON', 'CURSO', 'GRATIS', 'ESTUDAR', 'PRATICAR', 'TRABALHAR', 'MERCADO', 'PROGRAMADOR', 'FUTURO' ) for palavra in tupla: print('Na palavra {} temos'.format(palavra), end=' ') for letra in palavra: if letra in 'AEIOU': print('{}'.format(letra), end=' ') print('')
def Decorator(f): def wrapper(arg): print ('befor') f(arg) print ('after') return wrapper @Decorator # либо: Function = Decorator(Function) def Function(x): print ('function', + x) Function(23) # декорированая функция
# Implement a macro folly_library() that the BUILD file can load. load("@rules_cc//cc:defs.bzl", "cc_library") # Ref: https://github.com/google/glog/blob/v0.5.0/bazel/glog.bzl def expand_template_impl(ctx): ctx.actions.expand_template( template = ctx.file.template, output = ctx.outputs.out, substitutions = ctx.attr.substitutions, ) expand_template = rule( implementation = expand_template_impl, attrs = { "template": attr.label(mandatory = True, allow_single_file = True), "substitutions": attr.string_dict(mandatory = True), "out": attr.output(mandatory = True), }, ) def dict_union(x, y): z = {} z.update(x) z.update(y) return z def _val(predicate): return "1" if predicate else "0" def folly_library( with_gflags = True, with_jemalloc = False, with_bz2 = False, with_lzma = False, with_lz4 = False, with_zstd = False, with_libiberty = False, with_libunwind = False, with_libdwarf = False, with_libaio = False, with_liburing = False): # Exclude tests, benchmarks, and other standalone utility executables from the # library sources. Test sources are listed separately below. common_excludes = [ "folly/build/**", "folly/experimental/exception_tracer/**", "folly/experimental/pushmi/**", "folly/futures/exercises/**", "folly/logging/example/**", "folly/test/**", "folly/**/test/**", "folly/tools/**", ] hdrs = native.glob(["folly/**/*.h"], exclude = common_excludes + [ "folly/python/fibers.h", "folly/python/GILAwareManualExecutor.h", ]) srcs = native.glob(["folly/**/*.cpp"], exclude = common_excludes + [ "folly/**/*Benchmark.cpp", "folly/**/*Test.cpp", "folly/experimental/JSONSchemaTester.cpp", "folly/experimental/io/HugePageUtil.cpp", "folly/python/fibers.cpp", "folly/python/GILAwareManualExecutor.cpp", "folly/cybld/folly/executor.cpp", ]) # Explicitly include utility library code from inside # test subdirs hdrs = hdrs + [ "folly/container/test/F14TestUtil.h", "folly/container/test/TrackingTypes.h", "folly/io/async/test/AsyncSSLSocketTest.h", "folly/io/async/test/AsyncSocketTest.h", "folly/io/async/test/AsyncSocketTest2.h", "folly/io/async/test/BlockingSocket.h", "folly/io/async/test/MockAsyncSocket.h", "folly/io/async/test/MockAsyncServerSocket.h", "folly/io/async/test/MockAsyncSSLSocket.h", "folly/io/async/test/MockAsyncTransport.h", "folly/io/async/test/MockAsyncUDPSocket.h", "folly/io/async/test/MockTimeoutManager.h", "folly/io/async/test/ScopedBoundPort.h", "folly/io/async/test/SocketPair.h", "folly/io/async/test/TestSSLServer.h", "folly/io/async/test/TimeUtil.h", "folly/io/async/test/UndelayedDestruction.h", "folly/io/async/test/Util.h", "folly/synchronization/test/Semaphore.h", "folly/test/DeterministicSchedule.h", "folly/test/JsonTestUtil.h", "folly/test/TestUtils.h", ] srcs = srcs + [ "folly/io/async/test/ScopedBoundPort.cpp", "folly/io/async/test/SocketPair.cpp", "folly/io/async/test/TimeUtil.cpp", ] # Exclude specific sources if we do not have third-party libraries # required to build them common_excludes = [] # NOTE(storypku): hardcode with_libsodium to False for now hdrs_excludes = [ "folly/experimental/crypto/Blake2xb.h", "folly/experimental/crypto/detail/LtHashInternal.h", "folly/experimental/crypto/LtHash-inl.h", "folly/experimental/crypto/LtHash.h", ] srcs_excludes = [ "folly/experimental/crypto/Blake2xb.cpp", "folly/experimental/crypto/detail/MathOperation_AVX2.cpp", "folly/experimental/crypto/detail/MathOperation_Simple.cpp", "folly/experimental/crypto/detail/MathOperation_SSE2.cpp", "folly/experimental/crypto/LtHash.cpp", ] # Excerpt from <TOP-DIR>/CMake/folly-deps.cmake # check_function_exists(backtrace FOLLY_HAVE_BACKTRACE) # if (FOLLY_HAVE_ELF_H AND FOLLY_HAVE_BACKTRACE AND LIBDWARF_FOUND) # set(FOLLY_USE_SYMBOLIZER ON) # Question: with_libdwarf is equivalent to use_symbolizer ? if with_libdwarf == False: common_excludes = common_excludes + [ "folly/experimental/symbolizer/**", ] srcs_excludes = srcs_excludes + [ "folly/SingletonStackTrace.cpp", ] if with_libaio == False: hdrs_excludes = hdrs_excludes + [ "folly/experimental/io/AsyncIO.h", ] srcs_excludes = srcs_excludes + [ "folly/experimental/io/AsyncIO.cpp", ] if with_liburing == False: hdrs_excludes = hdrs_excludes + [ "folly/experimental/io/IoUring.h", ] srcs_excludes = srcs_excludes + [ "folly/experimental/io/IoUring.cpp", ] if with_libaio == False and with_liburing == False: hdrs_excludes = hdrs_excludes + [ "folly/experimental/io/AsyncBase.h", ] srcs_excludes = srcs_excludes + [ "folly/experimental/io/AsyncBase.cpp", ] common_defs = { "@FOLLY_HAVE_PTHREAD@": "1", "@FOLLY_HAVE_PTHREAD_ATFORK@": "1", "@FOLLY_HAVE_MEMRCHR@": "1", "@FOLLY_HAVE_ACCEPT4@": "1", "@FOLLY_HAVE_PREADV@": "1", "@FOLLY_HAVE_PWRITEV@": "1", "@FOLLY_HAVE_CLOCK_GETTIME@": "1", "@FOLLY_HAVE_PIPE2@": "1", "@FOLLY_HAVE_SENDMMSG@": "1", "@FOLLY_HAVE_RECVMMSG@": "1", "@FOLLY_HAVE_OPENSSL_ASN1_TIME_DIFF@": "1", "@FOLLY_HAVE_IFUNC@": "1", "@FOLLY_HAVE_STD__IS_TRIVIALLY_COPYABLE@": "1", "@FOLLY_HAVE_UNALIGNED_ACCESS@": "1", "@FOLLY_HAVE_VLA@": "1", "@FOLLY_HAVE_WEAK_SYMBOLS@": "1", "@FOLLY_HAVE_LINUX_VDSO@": "1", "@FOLLY_HAVE_MALLOC_USABLE_SIZE@": "1", "@FOLLY_HAVE_INT128_T@": "1", "@FOLLY_SUPPLY_MISSING_INT128_TRAITS@": "0", "@FOLLY_HAVE_WCHAR_SUPPORT@": "1", "@HAVE_VSNPRINTF_ERRORS@": "1", "@FOLLY_HAVE_SHADOW_LOCAL_WARNINGS@": "1", "@FOLLY_SUPPORT_SHARED_LIBRARY@": "1", } # Note(storypku): # FOLLY_HAVE_EXTRANDOM_SFMT19937 will make <ext/random> included, causing error: # /usr/include/aarch64-linux-gnu/c++/7.5.0/ext/opt_random.h:81:13: error: unknown type name '__Uint32x4_t total_defs = dict_union(common_defs, { "@FOLLY_USE_LIBSTDCPP@": "1", "@FOLLY_USE_LIBCPP@": "0", "@FOLLY_HAVE_EXTRANDOM_SFMT19937@": "0", "@FOLLY_LIBRARY_SANITIZE_ADDRESS@": "0", "@FOLLY_HAVE_LIBSNAPPY@": "1", "@FOLLY_HAVE_LIBZ@": "1", "@FOLLY_GFLAGS_NAMESPACE@": "gflags", "@FOLLY_HAVE_LIBGLOG@": "1", "@FOLLY_UNUSUAL_GFLAGS_NAMESPACE@": "0", "@FOLLY_HAVE_LIBGFLAGS@": _val(with_gflags), "@FOLLY_USE_JEMALLOC@": _val(with_jemalloc), "@FOLLY_USE_SYMBOLIZER@": _val(with_libdwarf), "@FOLLY_HAVE_LIBLZ4@": _val(with_lz4), "@FOLLY_HAVE_LIBLZMA@": _val(with_lzma), "@FOLLY_HAVE_LIBZSTD@": _val(with_zstd), "@FOLLY_HAVE_LIBBZ2@": _val(with_bz2), }) native.genrule( name = "folly_config_in_h", srcs = [ "CMake/folly-config.h.cmake", ], outs = [ "folly/folly-config.h.in", ], cmd = "$(location @rules_folly//bazel:generate_config_in.sh) < $< > $@", tools = ["@rules_folly//bazel:generate_config_in.sh"], ) expand_template( name = "folly_config_h_unstripped", template = "folly/folly-config.h.in", out = "folly/folly-config.h.unstripped", substitutions = total_defs, ) native.genrule( name = "folly_config_h", srcs = [ "folly/folly-config.h.unstripped", ], outs = [ "folly/folly-config.h", ], cmd = "$(location @rules_folly//bazel:strip_config_h.sh) < $< > $@", tools = ["@rules_folly//bazel:strip_config_h.sh"], ) # CHECK_CXX_COMPILER_FLAG(-mpclmul COMPILER_HAS_M_PCLMUL) cc_library( name = "folly", hdrs = ["folly_config_h"] + native.glob(hdrs, exclude = common_excludes + hdrs_excludes), srcs = native.glob(srcs, exclude = common_excludes + srcs_excludes), copts = [ "-fPIC", "-faligned-new", "-fopenmp", "-Wall", "-Wno-deprecated", "-Wno-deprecated-declarations", "-Wno-sign-compare", "-Wno-unused", "-Wunused-label", "-Wunused-result", "-Wshadow-compatible-local", "-Wno-noexcept-type", "-std=gnu++14", ] + select({ ":linux_x86_64": ["-mpclmul"], "//conditions:default": [], }), includes = ["."], linkopts = [ "-pthread", "-ldl", ], # Ref: https://docs.bazel.build/versions/main/be/c-cpp.html#cc_library.linkstatic linkstatic = True, visibility = ["//visibility:public"], deps = [ "@boost//:algorithm", "@boost//:config", "@boost//:container", "@boost//:context", "@boost//:conversion", "@boost//:crc", "@boost//:filesystem", "@boost//:intrusive", "@boost//:iterator", "@boost//:multi_index", "@boost//:operators", "@boost//:program_options", "@boost//:regex", "@boost//:type_traits", "@boost//:utility", "@boost//:variant", "@com_github_gflags_gflags//:gflags", "@com_github_google_glog//:glog", "@com_github_google_snappy//:snappy", "@com_github_libevent_libevent//:libevent", "@double-conversion//:double-conversion", "@openssl//:ssl", ], )
# Created by MechAviv # Chinese Text Damage Skin (30 Day) | (2436741) if sm.addDamageSkin(2436741): sm.chat("'Chinese Text Damage Skin (30 Day)' Damage Skin has been added to your account's damage skin collection.") sm.consumeItem()
def rumble(rate, intensity, duration): __end_regular_rumble() _["viewport"].rumble(rate, intensity, duration) def regular_rumble(rate, intensity, duration, interval): __end_regular_rumble() def _rumble(): _["viewport"].rumble(rate, intensity, duration) _["regular_rumble"] = _rumble Driftwood.tick.register(_rumble, delay=interval) def __end_regular_rumble(): if "regular_rumble" in Driftwood.vars: Driftwood.tick.unregister(Driftwood.vars["regular_rumble"]) del Driftwood.vars["regular_rumble"] def constant_rumble(rate, intensity): __end_regular_rumble() _["viewport"].rumble(rate, intensity, None) def end_rumble(): __end_regular_rumble() _["viewport"].end_rumble()
def fuc() -> None: return None def fua() -> bool: return True def fub() -> bool: return False def fud() -> int: return -1 def fue() -> str: return ""
del_items(0x80121A34) SetType(0x80121A34, "void PreGameOnlyTestRoutine__Fv()") del_items(0x80123AF8) SetType(0x80123AF8, "void DRLG_PlaceDoor__Fii(int x, int y)") del_items(0x80123FCC) SetType(0x80123FCC, "void DRLG_L1Shadows__Fv()") del_items(0x801243E4) SetType(0x801243E4, "int DRLG_PlaceMiniSet__FPCUciiiiiii(unsigned char *miniset, int tmin, int tmax, int cx, int cy, int setview, int noquad, int ldir)") del_items(0x80124850) SetType(0x80124850, "void DRLG_L1Floor__Fv()") del_items(0x8012493C) SetType(0x8012493C, "void StoreBlock__FPiii(int *Bl, int xx, int yy)") del_items(0x801249E8) SetType(0x801249E8, "void DRLG_L1Pass3__Fv()") del_items(0x80124B9C) SetType(0x80124B9C, "void DRLG_LoadL1SP__Fv()") del_items(0x80124C78) SetType(0x80124C78, "void DRLG_FreeL1SP__Fv()") del_items(0x80124CA8) SetType(0x80124CA8, "void DRLG_Init_Globals__Fv()") del_items(0x80124D4C) SetType(0x80124D4C, "void set_restore_lighting__Fv()") del_items(0x80124DDC) SetType(0x80124DDC, "void DRLG_InitL1Vals__Fv()") del_items(0x80124DE4) SetType(0x80124DE4, "void LoadL1Dungeon__FPcii(char *sFileName, int vx, int vy)") del_items(0x80124FB0) SetType(0x80124FB0, "void LoadPreL1Dungeon__FPcii(char *sFileName, int vx, int vy)") del_items(0x80125168) SetType(0x80125168, "void InitL5Dungeon__Fv()") del_items(0x801251C8) SetType(0x801251C8, "void L5ClearFlags__Fv()") del_items(0x80125214) SetType(0x80125214, "void L5drawRoom__Fiiii(int x, int y, int w, int h)") del_items(0x80125280) SetType(0x80125280, "unsigned char L5checkRoom__Fiiii(int x, int y, int width, int height)") del_items(0x80125314) SetType(0x80125314, "void L5roomGen__Fiiiii(int x, int y, int w, int h, int dir)") del_items(0x80125610) SetType(0x80125610, "void L5firstRoom__Fv()") del_items(0x801259CC) SetType(0x801259CC, "long L5GetArea__Fv()") del_items(0x80125A2C) SetType(0x80125A2C, "void L5makeDungeon__Fv()") del_items(0x80125AB8) SetType(0x80125AB8, "void L5makeDmt__Fv()") del_items(0x80125BA0) SetType(0x80125BA0, "int L5HWallOk__Fii(int i, int j)") del_items(0x80125CDC) SetType(0x80125CDC, "int L5VWallOk__Fii(int i, int j)") del_items(0x80125E28) SetType(0x80125E28, "void L5HorizWall__Fiici(int i, int j, char p, int dx)") del_items(0x80126068) SetType(0x80126068, "void L5VertWall__Fiici(int i, int j, char p, int dy)") del_items(0x8012629C) SetType(0x8012629C, "void L5AddWall__Fv()") del_items(0x8012650C) SetType(0x8012650C, "void DRLG_L5GChamber__Fiiiiii(int sx, int sy, int topflag, int bottomflag, int leftflag, int rightflag)") del_items(0x801267CC) SetType(0x801267CC, "void DRLG_L5GHall__Fiiii(int x1, int y1, int x2, int y2)") del_items(0x80126880) SetType(0x80126880, "void L5tileFix__Fv()") del_items(0x80127144) SetType(0x80127144, "void DRLG_L5Subs__Fv()") del_items(0x8012733C) SetType(0x8012733C, "void DRLG_L5SetRoom__Fii(int rx1, int ry1)") del_items(0x8012743C) SetType(0x8012743C, "void L5FillChambers__Fv()") del_items(0x80127B28) SetType(0x80127B28, "void DRLG_L5FTVR__Fiiiii(int i, int j, int x, int y, int d)") del_items(0x80128078) SetType(0x80128078, "void DRLG_L5FloodTVal__Fv()") del_items(0x8012817C) SetType(0x8012817C, "void DRLG_L5TransFix__Fv()") del_items(0x8012838C) SetType(0x8012838C, "void DRLG_L5DirtFix__Fv()") del_items(0x801284E8) SetType(0x801284E8, "void DRLG_L5CornerFix__Fv()") del_items(0x801285F8) SetType(0x801285F8, "void DRLG_L5__Fi(int entry)") del_items(0x80128B18) SetType(0x80128B18, "void CreateL5Dungeon__FUii(unsigned int rseed, int entry)") del_items(0x8012B0BC) SetType(0x8012B0BC, "unsigned char DRLG_L2PlaceMiniSet__FPUciiiiii(unsigned char *miniset, int tmin, int tmax, int cx, int cy, int setview, int ldir)") del_items(0x8012B4B0) SetType(0x8012B4B0, "void DRLG_L2PlaceRndSet__FPUci(unsigned char *miniset, int rndper)") del_items(0x8012B7B0) SetType(0x8012B7B0, "void DRLG_L2Subs__Fv()") del_items(0x8012B9A4) SetType(0x8012B9A4, "void DRLG_L2Shadows__Fv()") del_items(0x8012BB68) SetType(0x8012BB68, "void InitDungeon__Fv()") del_items(0x8012BBC8) SetType(0x8012BBC8, "void DRLG_LoadL2SP__Fv()") del_items(0x8012BC68) SetType(0x8012BC68, "void DRLG_FreeL2SP__Fv()") del_items(0x8012BC98) SetType(0x8012BC98, "void DRLG_L2SetRoom__Fii(int rx1, int ry1)") del_items(0x8012BD98) SetType(0x8012BD98, "void DefineRoom__Fiiiii(int nX1, int nY1, int nX2, int nY2, int ForceHW)") del_items(0x8012BFA4) SetType(0x8012BFA4, "void CreateDoorType__Fii(int nX, int nY)") del_items(0x8012C088) SetType(0x8012C088, "void PlaceHallExt__Fii(int nX, int nY)") del_items(0x8012C0C0) SetType(0x8012C0C0, "void AddHall__Fiiiii(int nX1, int nY1, int nX2, int nY2, int nHd)") del_items(0x8012C198) SetType(0x8012C198, "void CreateRoom__Fiiiiiiiii(int nX1, int nY1, int nX2, int nY2, int nRDest, int nHDir, int ForceHW, int nH, int nW)") del_items(0x8012C820) SetType(0x8012C820, "void GetHall__FPiN40(int *nX1, int *nY1, int *nX2, int *nY2, int *nHd)") del_items(0x8012C8B8) SetType(0x8012C8B8, "void ConnectHall__Fiiiii(int nX1, int nY1, int nX2, int nY2, int nHd)") del_items(0x8012CF20) SetType(0x8012CF20, "void DoPatternCheck__Fii(int i, int j)") del_items(0x8012D1D4) SetType(0x8012D1D4, "void L2TileFix__Fv()") del_items(0x8012D2F8) SetType(0x8012D2F8, "unsigned char DL2_Cont__FUcUcUcUc(unsigned char x1f, unsigned char y1f, unsigned char x2f, unsigned char y2f)") del_items(0x8012D378) SetType(0x8012D378, "int DL2_NumNoChar__Fv()") del_items(0x8012D3D4) SetType(0x8012D3D4, "void DL2_DrawRoom__Fiiii(int x1, int y1, int x2, int y2)") del_items(0x8012D4D8) SetType(0x8012D4D8, "void DL2_KnockWalls__Fiiii(int x1, int y1, int x2, int y2)") del_items(0x8012D6A8) SetType(0x8012D6A8, "unsigned char DL2_FillVoids__Fv()") del_items(0x8012E02C) SetType(0x8012E02C, "unsigned char CreateDungeon__Fv()") del_items(0x8012E338) SetType(0x8012E338, "void DRLG_L2Pass3__Fv()") del_items(0x8012E4D0) SetType(0x8012E4D0, "void DRLG_L2FTVR__Fiiiii(int i, int j, int x, int y, int d)") del_items(0x8012EA18) SetType(0x8012EA18, "void DRLG_L2FloodTVal__Fv()") del_items(0x8012EB1C) SetType(0x8012EB1C, "void DRLG_L2TransFix__Fv()") del_items(0x8012ED2C) SetType(0x8012ED2C, "void L2DirtFix__Fv()") del_items(0x8012EE8C) SetType(0x8012EE8C, "void L2LockoutFix__Fv()") del_items(0x8012F218) SetType(0x8012F218, "void L2DoorFix__Fv()") del_items(0x8012F2C8) SetType(0x8012F2C8, "void DRLG_L2__Fi(int entry)") del_items(0x8012FD14) SetType(0x8012FD14, "void DRLG_InitL2Vals__Fv()") del_items(0x8012FD1C) SetType(0x8012FD1C, "void LoadL2Dungeon__FPcii(char *sFileName, int vx, int vy)") del_items(0x8012FF0C) SetType(0x8012FF0C, "void LoadPreL2Dungeon__FPcii(char *sFileName, int vx, int vy)") del_items(0x801300F8) SetType(0x801300F8, "void CreateL2Dungeon__FUii(unsigned int rseed, int entry)") del_items(0x80130AB0) SetType(0x80130AB0, "void InitL3Dungeon__Fv()") del_items(0x80130B38) SetType(0x80130B38, "int DRLG_L3FillRoom__Fiiii(int x1, int y1, int x2, int y2)") del_items(0x80130D94) SetType(0x80130D94, "void DRLG_L3CreateBlock__Fiiii(int x, int y, int obs, int dir)") del_items(0x80131030) SetType(0x80131030, "void DRLG_L3FloorArea__Fiiii(int x1, int y1, int x2, int y2)") del_items(0x80131098) SetType(0x80131098, "void DRLG_L3FillDiags__Fv()") del_items(0x801311C8) SetType(0x801311C8, "void DRLG_L3FillSingles__Fv()") del_items(0x80131294) SetType(0x80131294, "void DRLG_L3FillStraights__Fv()") del_items(0x80131658) SetType(0x80131658, "void DRLG_L3Edges__Fv()") del_items(0x80131698) SetType(0x80131698, "int DRLG_L3GetFloorArea__Fv()") del_items(0x801316E8) SetType(0x801316E8, "void DRLG_L3MakeMegas__Fv()") del_items(0x8013182C) SetType(0x8013182C, "void DRLG_L3River__Fv()") del_items(0x8013226C) SetType(0x8013226C, "int DRLG_L3SpawnEdge__FiiPi(int x, int y, int *totarea)") del_items(0x801324F8) SetType(0x801324F8, "int DRLG_L3Spawn__FiiPi(int x, int y, int *totarea)") del_items(0x8013270C) SetType(0x8013270C, "void DRLG_L3Pool__Fv()") del_items(0x80132960) SetType(0x80132960, "void DRLG_L3PoolFix__Fv()") del_items(0x80132A94) SetType(0x80132A94, "int DRLG_L3PlaceMiniSet__FPCUciiiiii(unsigned char *miniset, int tmin, int tmax, int cx, int cy, int setview, int ldir)") del_items(0x80132E14) SetType(0x80132E14, "void DRLG_L3PlaceRndSet__FPCUci(unsigned char *miniset, int rndper)") del_items(0x8013315C) SetType(0x8013315C, "unsigned char WoodVertU__Fii(int i, int y)") del_items(0x80133208) SetType(0x80133208, "unsigned char WoodVertD__Fii(int i, int y)") del_items(0x801332A4) SetType(0x801332A4, "unsigned char WoodHorizL__Fii(int x, int j)") del_items(0x80133338) SetType(0x80133338, "unsigned char WoodHorizR__Fii(int x, int j)") del_items(0x801333BC) SetType(0x801333BC, "void AddFenceDoors__Fv()") del_items(0x801334A0) SetType(0x801334A0, "void FenceDoorFix__Fv()") del_items(0x80133694) SetType(0x80133694, "void DRLG_L3Wood__Fv()") del_items(0x80133E84) SetType(0x80133E84, "int DRLG_L3Anvil__Fv()") del_items(0x801340E0) SetType(0x801340E0, "void FixL3Warp__Fv()") del_items(0x801341C8) SetType(0x801341C8, "void FixL3HallofHeroes__Fv()") del_items(0x8013431C) SetType(0x8013431C, "void DRLG_L3LockRec__Fii(int x, int y)") del_items(0x801343B8) SetType(0x801343B8, "unsigned char DRLG_L3Lockout__Fv()") del_items(0x80134478) SetType(0x80134478, "void DRLG_L3__Fi(int entry)") del_items(0x80134B98) SetType(0x80134B98, "void DRLG_L3Pass3__Fv()") del_items(0x80134D3C) SetType(0x80134D3C, "void CreateL3Dungeon__FUii(unsigned int rseed, int entry)") del_items(0x80134E50) SetType(0x80134E50, "void LoadL3Dungeon__FPcii(char *sFileName, int vx, int vy)") del_items(0x80135074) SetType(0x80135074, "void LoadPreL3Dungeon__FPcii(char *sFileName, int vx, int vy)") del_items(0x80136EC0) SetType(0x80136EC0, "void DRLG_L4Shadows__Fv()") del_items(0x80136F84) SetType(0x80136F84, "void InitL4Dungeon__Fv()") del_items(0x80137020) SetType(0x80137020, "void DRLG_LoadL4SP__Fv()") del_items(0x801370C4) SetType(0x801370C4, "void DRLG_FreeL4SP__Fv()") del_items(0x801370EC) SetType(0x801370EC, "void DRLG_L4SetSPRoom__Fii(int rx1, int ry1)") del_items(0x801371EC) SetType(0x801371EC, "void L4makeDmt__Fv()") del_items(0x80137290) SetType(0x80137290, "int L4HWallOk__Fii(int i, int j)") del_items(0x801373E0) SetType(0x801373E0, "int L4VWallOk__Fii(int i, int j)") del_items(0x8013755C) SetType(0x8013755C, "void L4HorizWall__Fiii(int i, int j, int dx)") del_items(0x8013772C) SetType(0x8013772C, "void L4VertWall__Fiii(int i, int j, int dy)") del_items(0x801378F4) SetType(0x801378F4, "void L4AddWall__Fv()") del_items(0x80137DD4) SetType(0x80137DD4, "void L4tileFix__Fv()") del_items(0x80139FBC) SetType(0x80139FBC, "void DRLG_L4Subs__Fv()") del_items(0x8013A194) SetType(0x8013A194, "void L4makeDungeon__Fv()") del_items(0x8013A3CC) SetType(0x8013A3CC, "void uShape__Fv()") del_items(0x8013A670) SetType(0x8013A670, "long GetArea__Fv()") del_items(0x8013A6CC) SetType(0x8013A6CC, "void L4drawRoom__Fiiii(int x, int y, int width, int height)") del_items(0x8013A734) SetType(0x8013A734, "unsigned char L4checkRoom__Fiiii(int x, int y, int width, int height)") del_items(0x8013A7D0) SetType(0x8013A7D0, "void L4roomGen__Fiiiii(int x, int y, int w, int h, int dir)") del_items(0x8013AACC) SetType(0x8013AACC, "void L4firstRoom__Fv()") del_items(0x8013ACE8) SetType(0x8013ACE8, "void L4SaveQuads__Fv()") del_items(0x8013AD88) SetType(0x8013AD88, "void DRLG_L4SetRoom__FPUcii(unsigned char *pSetPiece, int rx1, int ry1)") del_items(0x8013AE5C) SetType(0x8013AE5C, "void DRLG_LoadDiabQuads__FUc(unsigned char preflag)") del_items(0x8013AFD4) SetType(0x8013AFD4, "unsigned char DRLG_L4PlaceMiniSet__FPCUciiiiii(unsigned char *miniset, int tmin, int tmax, int cx, int cy, int setview, int ldir)") del_items(0x8013B3EC) SetType(0x8013B3EC, "void DRLG_L4FTVR__Fiiiii(int i, int j, int x, int y, int d)") del_items(0x8013B934) SetType(0x8013B934, "void DRLG_L4FloodTVal__Fv()") del_items(0x8013BA38) SetType(0x8013BA38, "unsigned char IsDURWall__Fc(char d)") del_items(0x8013BA68) SetType(0x8013BA68, "unsigned char IsDLLWall__Fc(char dd)") del_items(0x8013BA98) SetType(0x8013BA98, "void DRLG_L4TransFix__Fv()") del_items(0x8013BDF0) SetType(0x8013BDF0, "void DRLG_L4Corners__Fv()") del_items(0x8013BE84) SetType(0x8013BE84, "void L4FixRim__Fv()") del_items(0x8013BEC0) SetType(0x8013BEC0, "void DRLG_L4GeneralFix__Fv()") del_items(0x8013BF64) SetType(0x8013BF64, "void DRLG_L4__Fi(int entry)") del_items(0x8013C860) SetType(0x8013C860, "void DRLG_L4Pass3__Fv()") del_items(0x8013CA04) SetType(0x8013CA04, "void CreateL4Dungeon__FUii(unsigned int rseed, int entry)") del_items(0x8013CAE4) SetType(0x8013CAE4, "int ObjIndex__Fii(int x, int y)") del_items(0x8013CB98) SetType(0x8013CB98, "void AddSKingObjs__Fv()") del_items(0x8013CCC8) SetType(0x8013CCC8, "void AddSChamObjs__Fv()") del_items(0x8013CD44) SetType(0x8013CD44, "void AddVileObjs__Fv()") del_items(0x8013CDF0) SetType(0x8013CDF0, "void DRLG_SetMapTrans__FPc(char *sFileName)") del_items(0x8013CEB4) SetType(0x8013CEB4, "void LoadSetMap__Fv()") del_items(0x8013D1DC) SetType(0x8013D1DC, "unsigned long CM_QuestToBitPattern__Fi(int QuestNum)") del_items(0x8013D2B4) SetType(0x8013D2B4, "void CM_ShowMonsterList__Fii(int Level, int List)") del_items(0x8013D32C) SetType(0x8013D32C, "int CM_ChooseMonsterList__FiUl(int Level, unsigned long QuestsNeededMask)") del_items(0x8013D3CC) SetType(0x8013D3CC, "int NoUiListChoose__FiUl(int Level, unsigned long QuestsNeededMask)") del_items(0x8013D3D4) SetType(0x8013D3D4, "void ChooseTask__FP4TASK(struct TASK *T)") del_items(0x8013D4DC) SetType(0x8013D4DC, "void ShowTask__FP4TASK(struct TASK *T)") del_items(0x8013D70C) SetType(0x8013D70C, "int GetListsAvailable__FiUlPUc(int Level, unsigned long QuestsNeededMask, unsigned char *ListofLists)") del_items(0x8013D830) SetType(0x8013D830, "unsigned short GetDown__C4CPad(struct CPad *this)") del_items(0x8013D858) SetType(0x8013D858, "void AddL1Door__Fiiii(int i, int x, int y, int ot)") del_items(0x8013D990) SetType(0x8013D990, "void AddSCambBook__Fi(int i)") del_items(0x8013DA30) SetType(0x8013DA30, "void AddChest__Fii(int i, int t)") del_items(0x8013DC10) SetType(0x8013DC10, "void AddL2Door__Fiiii(int i, int x, int y, int ot)") del_items(0x8013DD5C) SetType(0x8013DD5C, "void AddL3Door__Fiiii(int i, int x, int y, int ot)") del_items(0x8013DDF0) SetType(0x8013DDF0, "void AddSarc__Fi(int i)") del_items(0x8013DECC) SetType(0x8013DECC, "void AddFlameTrap__Fi(int i)") del_items(0x8013DF28) SetType(0x8013DF28, "void AddTrap__Fii(int i, int ot)") del_items(0x8013E020) SetType(0x8013E020, "void AddArmorStand__Fi(int i)") del_items(0x8013E0A8) SetType(0x8013E0A8, "void AddObjLight__Fii(int i, int r)") del_items(0x8013E150) SetType(0x8013E150, "void AddBarrel__Fii(int i, int ot)") del_items(0x8013E200) SetType(0x8013E200, "void AddShrine__Fi(int i)") del_items(0x8013E350) SetType(0x8013E350, "void AddBookcase__Fi(int i)") del_items(0x8013E3A8) SetType(0x8013E3A8, "void AddBookstand__Fi(int i)") del_items(0x8013E3F0) SetType(0x8013E3F0, "void AddBloodFtn__Fi(int i)") del_items(0x8013E438) SetType(0x8013E438, "void AddPurifyingFountain__Fi(int i)") del_items(0x8013E514) SetType(0x8013E514, "void AddGoatShrine__Fi(int i)") del_items(0x8013E55C) SetType(0x8013E55C, "void AddCauldron__Fi(int i)") del_items(0x8013E5A4) SetType(0x8013E5A4, "void AddMurkyFountain__Fi(int i)") del_items(0x8013E680) SetType(0x8013E680, "void AddTearFountain__Fi(int i)") del_items(0x8013E6C8) SetType(0x8013E6C8, "void AddDecap__Fi(int i)") del_items(0x8013E744) SetType(0x8013E744, "void AddVilebook__Fi(int i)") del_items(0x8013E794) SetType(0x8013E794, "void AddMagicCircle__Fi(int i)") del_items(0x8013E808) SetType(0x8013E808, "void AddBrnCross__Fi(int i)") del_items(0x8013E850) SetType(0x8013E850, "void AddPedistal__Fi(int i)") del_items(0x8013E8C4) SetType(0x8013E8C4, "void AddStoryBook__Fi(int i)") del_items(0x8013EA94) SetType(0x8013EA94, "void AddWeaponRack__Fi(int i)") del_items(0x8013EB1C) SetType(0x8013EB1C, "void AddTorturedBody__Fi(int i)") del_items(0x8013EB98) SetType(0x8013EB98, "void AddFlameLvr__Fi(int i)") del_items(0x8013EBD8) SetType(0x8013EBD8, "void GetRndObjLoc__FiRiT1(int randarea, int *xx, int *yy)") del_items(0x8013ECE4) SetType(0x8013ECE4, "void AddMushPatch__Fv()") del_items(0x8013EE08) SetType(0x8013EE08, "void AddSlainHero__Fv()") del_items(0x8013EE48) SetType(0x8013EE48, "unsigned char RndLocOk__Fii(int xp, int yp)") del_items(0x8013EF2C) SetType(0x8013EF2C, "unsigned char TrapLocOk__Fii(int xp, int yp)") del_items(0x8013EF94) SetType(0x8013EF94, "unsigned char RoomLocOk__Fii(int xp, int yp)") del_items(0x8013F02C) SetType(0x8013F02C, "void InitRndLocObj__Fiii(int min, int max, int objtype)") del_items(0x8013F1D8) SetType(0x8013F1D8, "void InitRndLocBigObj__Fiii(int min, int max, int objtype)") del_items(0x8013F3D0) SetType(0x8013F3D0, "void InitRndLocObj5x5__Fiii(int min, int max, int objtype)") del_items(0x8013F4F8) SetType(0x8013F4F8, "void SetMapObjects__FPUcii(unsigned char *pMap, int startx, int starty)") del_items(0x8013F798) SetType(0x8013F798, "void ClrAllObjects__Fv()") del_items(0x8013F888) SetType(0x8013F888, "void AddTortures__Fv()") del_items(0x8013FA14) SetType(0x8013FA14, "void AddCandles__Fv()") del_items(0x8013FA9C) SetType(0x8013FA9C, "void AddTrapLine__Fiiii(int min, int max, int tobjtype, int lobjtype)") del_items(0x8013FE38) SetType(0x8013FE38, "void AddLeverObj__Fiiiiiiii(int lx1, int ly1, int lx2, int ly2, int x1, int y1, int x2, int y2)") del_items(0x8013FE40) SetType(0x8013FE40, "void AddBookLever__Fiiiiiiiii(int lx1, int ly1, int lx2, int ly2, int x1, int y1, int x2, int y2, int msg)") del_items(0x80140054) SetType(0x80140054, "void InitRndBarrels__Fv()") del_items(0x801401F0) SetType(0x801401F0, "void AddL1Objs__Fiiii(int x1, int y1, int x2, int y2)") del_items(0x80140328) SetType(0x80140328, "void AddL2Objs__Fiiii(int x1, int y1, int x2, int y2)") del_items(0x8014043C) SetType(0x8014043C, "void AddL3Objs__Fiiii(int x1, int y1, int x2, int y2)") del_items(0x8014053C) SetType(0x8014053C, "unsigned char WallTrapLocOk__Fii(int xp, int yp)") del_items(0x801405A4) SetType(0x801405A4, "unsigned char TorchLocOK__Fii(int xp, int yp)") del_items(0x801405E4) SetType(0x801405E4, "void AddL2Torches__Fv()") del_items(0x80140798) SetType(0x80140798, "void AddObjTraps__Fv()") del_items(0x80140B10) SetType(0x80140B10, "void AddChestTraps__Fv()") del_items(0x80140C60) SetType(0x80140C60, "void LoadMapObjects__FPUciiiiiii(unsigned char *pMap, int startx, int starty, int x1, int y1, int w, int h, int leveridx)") del_items(0x80140DCC) SetType(0x80140DCC, "void AddDiabObjs__Fv()") del_items(0x80140F20) SetType(0x80140F20, "void AddStoryBooks__Fv()") del_items(0x80141070) SetType(0x80141070, "void AddHookedBodies__Fi(int freq)") del_items(0x80141268) SetType(0x80141268, "void AddL4Goodies__Fv()") del_items(0x80141318) SetType(0x80141318, "void AddLazStand__Fv()") del_items(0x801414AC) SetType(0x801414AC, "void InitObjects__Fv()") del_items(0x80141AF8) SetType(0x80141AF8, "void PreObjObjAddSwitch__Fiiii(int ot, int ox, int oy, int oi)") del_items(0x80141E00) SetType(0x80141E00, "void FillSolidBlockTbls__Fv()") del_items(0x80141FAC) SetType(0x80141FAC, "void SetDungeonMicros__Fv()") del_items(0x80141FB4) SetType(0x80141FB4, "void DRLG_InitTrans__Fv()") del_items(0x80142028) SetType(0x80142028, "void DRLG_RectTrans__Fiiii(int x1, int y1, int x2, int y2)") del_items(0x801420A8) SetType(0x801420A8, "void DRLG_CopyTrans__Fiiii(int sx, int sy, int dx, int dy)") del_items(0x80142110) SetType(0x80142110, "void DRLG_ListTrans__FiPUc(int num, unsigned char *List)") del_items(0x80142184) SetType(0x80142184, "void DRLG_AreaTrans__FiPUc(int num, unsigned char *List)") del_items(0x80142214) SetType(0x80142214, "void DRLG_InitSetPC__Fv()") del_items(0x8014222C) SetType(0x8014222C, "void DRLG_SetPC__Fv()") del_items(0x801422DC) SetType(0x801422DC, "void Make_SetPC__Fiiii(int x, int y, int w, int h)") del_items(0x8014237C) SetType(0x8014237C, "unsigned char DRLG_WillThemeRoomFit__FiiiiiPiT5(int floor, int x, int y, int minSize, int maxSize, int *width, int *height)") del_items(0x80142644) SetType(0x80142644, "void DRLG_CreateThemeRoom__Fi(int themeIndex)") del_items(0x8014364C) SetType(0x8014364C, "void DRLG_PlaceThemeRooms__FiiiiUc(int minSize, int maxSize, int floor, int freq, int rndSize)") del_items(0x801438F4) SetType(0x801438F4, "void DRLG_HoldThemeRooms__Fv()") del_items(0x80143AA8) SetType(0x80143AA8, "unsigned char SkipThemeRoom__Fii(int x, int y)") del_items(0x80143B74) SetType(0x80143B74, "void InitLevels__Fv()") del_items(0x80143C78) SetType(0x80143C78, "unsigned char TFit_Shrine__Fi(int i)") del_items(0x80143EE8) SetType(0x80143EE8, "unsigned char TFit_Obj5__Fi(int t)") del_items(0x801440BC) SetType(0x801440BC, "unsigned char TFit_SkelRoom__Fi(int t)") del_items(0x8014416C) SetType(0x8014416C, "unsigned char TFit_GoatShrine__Fi(int t)") del_items(0x80144204) SetType(0x80144204, "unsigned char CheckThemeObj3__Fiiii(int xp, int yp, int t, int f)") del_items(0x80144354) SetType(0x80144354, "unsigned char TFit_Obj3__Fi(int t)") del_items(0x80144414) SetType(0x80144414, "unsigned char CheckThemeReqs__Fi(int t)") del_items(0x801444E0) SetType(0x801444E0, "unsigned char SpecialThemeFit__Fii(int i, int t)") del_items(0x801446BC) SetType(0x801446BC, "unsigned char CheckThemeRoom__Fi(int tv)") del_items(0x80144968) SetType(0x80144968, "void InitThemes__Fv()") del_items(0x80144CB4) SetType(0x80144CB4, "void HoldThemeRooms__Fv()") del_items(0x80144D9C) SetType(0x80144D9C, "void PlaceThemeMonsts__Fii(int t, int f)") del_items(0x80144F40) SetType(0x80144F40, "void Theme_Barrel__Fi(int t)") del_items(0x801450B8) SetType(0x801450B8, "void Theme_Shrine__Fi(int t)") del_items(0x801451A0) SetType(0x801451A0, "void Theme_MonstPit__Fi(int t)") del_items(0x801452CC) SetType(0x801452CC, "void Theme_SkelRoom__Fi(int t)") del_items(0x801455D0) SetType(0x801455D0, "void Theme_Treasure__Fi(int t)") del_items(0x80145834) SetType(0x80145834, "void Theme_Library__Fi(int t)") del_items(0x80145AA4) SetType(0x80145AA4, "void Theme_Torture__Fi(int t)") del_items(0x80145C14) SetType(0x80145C14, "void Theme_BloodFountain__Fi(int t)") del_items(0x80145C88) SetType(0x80145C88, "void Theme_Decap__Fi(int t)") del_items(0x80145DF8) SetType(0x80145DF8, "void Theme_PurifyingFountain__Fi(int t)") del_items(0x80145E6C) SetType(0x80145E6C, "void Theme_ArmorStand__Fi(int t)") del_items(0x80146004) SetType(0x80146004, "void Theme_GoatShrine__Fi(int t)") del_items(0x80146154) SetType(0x80146154, "void Theme_Cauldron__Fi(int t)") del_items(0x801461C8) SetType(0x801461C8, "void Theme_MurkyFountain__Fi(int t)") del_items(0x8014623C) SetType(0x8014623C, "void Theme_TearFountain__Fi(int t)") del_items(0x801462B0) SetType(0x801462B0, "void Theme_BrnCross__Fi(int t)") del_items(0x80146428) SetType(0x80146428, "void Theme_WeaponRack__Fi(int t)") del_items(0x801465C0) SetType(0x801465C0, "void UpdateL4Trans__Fv()") del_items(0x80146620) SetType(0x80146620, "void CreateThemeRooms__Fv()") del_items(0x80146804) SetType(0x80146804, "void InitPortals__Fv()") del_items(0x80146864) SetType(0x80146864, "void InitQuests__Fv()") del_items(0x80146C68) SetType(0x80146C68, "void DrawButcher__Fv()") del_items(0x80146CAC) SetType(0x80146CAC, "void DrawSkelKing__Fiii(int q, int x, int y)") del_items(0x80146CE8) SetType(0x80146CE8, "void DrawWarLord__Fii(int x, int y)") del_items(0x80146DE4) SetType(0x80146DE4, "void DrawSChamber__Fiii(int q, int x, int y)") del_items(0x80146F20) SetType(0x80146F20, "void DrawLTBanner__Fii(int x, int y)") del_items(0x80146FFC) SetType(0x80146FFC, "void DrawBlind__Fii(int x, int y)") del_items(0x801470D8) SetType(0x801470D8, "void DrawBlood__Fii(int x, int y)") del_items(0x801471B8) SetType(0x801471B8, "void DRLG_CheckQuests__Fii(int x, int y)") del_items(0x801472F4) SetType(0x801472F4, "void InitInv__Fv()") del_items(0x80147348) SetType(0x80147348, "void InitAutomap__Fv()") del_items(0x8014750C) SetType(0x8014750C, "void InitAutomapOnce__Fv()") del_items(0x8014751C) SetType(0x8014751C, "unsigned char MonstPlace__Fii(int xp, int yp)") del_items(0x801475D8) SetType(0x801475D8, "void InitMonsterGFX__Fi(int monst)") del_items(0x801476B0) SetType(0x801476B0, "void PlaceMonster__Fiiii(int i, int mtype, int x, int y)") del_items(0x80147750) SetType(0x80147750, "int AddMonsterType__Fii(int type, int placeflag)") del_items(0x8014784C) SetType(0x8014784C, "void GetMonsterTypes__FUl(unsigned long QuestMask)") del_items(0x801478FC) SetType(0x801478FC, "void ClrAllMonsters__Fv()") del_items(0x80147A2C) SetType(0x80147A2C, "void InitLevelMonsters__Fv()") del_items(0x80147AB0) SetType(0x80147AB0, "void GetLevelMTypes__Fv()") del_items(0x80147F18) SetType(0x80147F18, "void PlaceQuestMonsters__Fv()") del_items(0x801482DC) SetType(0x801482DC, "void LoadDiabMonsts__Fv()") del_items(0x801483EC) SetType(0x801483EC, "void PlaceGroup__FiiUci(int mtype, int num, unsigned char leaderf, int leader)") del_items(0x8014899C) SetType(0x8014899C, "void SetMapMonsters__FPUcii(unsigned char *pMap, int startx, int starty)") del_items(0x80148BC0) SetType(0x80148BC0, "void InitMonsters__Fv()") del_items(0x80148F70) SetType(0x80148F70, "void PlaceUniqueMonst__Fiii(int uniqindex, int miniontype, int unpackfilesize)") del_items(0x801496DC) SetType(0x801496DC, "void PlaceUniques__Fv()") del_items(0x8014986C) SetType(0x8014986C, "int PreSpawnSkeleton__Fv()") del_items(0x801499AC) SetType(0x801499AC, "int encode_enemy__Fi(int m)") del_items(0x80149A04) SetType(0x80149A04, "void decode_enemy__Fii(int m, int enemy)") del_items(0x80149B14) SetType(0x80149B14, "unsigned char IsGoat__Fi(int mt)") del_items(0x80149B40) SetType(0x80149B40, "void InitMissiles__Fv()") del_items(0x80149D08) SetType(0x80149D08, "void InitNoTriggers__Fv()") del_items(0x80149D2C) SetType(0x80149D2C, "void InitTownTriggers__Fv()") del_items(0x8014A074) SetType(0x8014A074, "void InitL1Triggers__Fv()") del_items(0x8014A188) SetType(0x8014A188, "void InitL2Triggers__Fv()") del_items(0x8014A318) SetType(0x8014A318, "void InitL3Triggers__Fv()") del_items(0x8014A474) SetType(0x8014A474, "void InitL4Triggers__Fv()") del_items(0x8014A688) SetType(0x8014A688, "void InitSKingTriggers__Fv()") del_items(0x8014A6D4) SetType(0x8014A6D4, "void InitSChambTriggers__Fv()") del_items(0x8014A720) SetType(0x8014A720, "void InitPWaterTriggers__Fv()") del_items(0x8014A76C) SetType(0x8014A76C, "void InitVPTriggers__Fv()") del_items(0x8014A7B8) SetType(0x8014A7B8, "void InitStores__Fv()") del_items(0x8014A838) SetType(0x8014A838, "void SetupTownStores__Fv()") del_items(0x8014A9C8) SetType(0x8014A9C8, "void DeltaLoadLevel__Fv()") del_items(0x8014B2A0) SetType(0x8014B2A0, "unsigned char SmithItemOk__Fi(int i)") del_items(0x8014B304) SetType(0x8014B304, "int RndSmithItem__Fi(int lvl)") del_items(0x8014B410) SetType(0x8014B410, "unsigned char WitchItemOk__Fi(int i)") del_items(0x8014B550) SetType(0x8014B550, "int RndWitchItem__Fi(int lvl)") del_items(0x8014B650) SetType(0x8014B650, "void BubbleSwapItem__FP10ItemStructT0(struct ItemStruct *a, struct ItemStruct *b)") del_items(0x8014B734) SetType(0x8014B734, "void SortWitch__Fv()") del_items(0x8014B854) SetType(0x8014B854, "int RndBoyItem__Fi(int lvl)") del_items(0x8014B978) SetType(0x8014B978, "unsigned char HealerItemOk__Fi(int i)") del_items(0x8014BB2C) SetType(0x8014BB2C, "int RndHealerItem__Fi(int lvl)") del_items(0x8014BC2C) SetType(0x8014BC2C, "void RecreatePremiumItem__Fiiii(int ii, int idx, int plvl, int iseed)") del_items(0x8014BCF4) SetType(0x8014BCF4, "void RecreateWitchItem__Fiiii(int ii, int idx, int lvl, int iseed)") del_items(0x8014BE4C) SetType(0x8014BE4C, "void RecreateSmithItem__Fiiii(int ii, int idx, int lvl, int iseed)") del_items(0x8014BEE8) SetType(0x8014BEE8, "void RecreateHealerItem__Fiiii(int ii, int idx, int lvl, int iseed)") del_items(0x8014BFA8) SetType(0x8014BFA8, "void RecreateBoyItem__Fiiii(int ii, int idx, int lvl, int iseed)") del_items(0x8014C06C) SetType(0x8014C06C, "void RecreateTownItem__FiiUsii(int ii, int idx, unsigned short icreateinfo, int iseed, int ivalue)") del_items(0x8014C0F8) SetType(0x8014C0F8, "void SpawnSmith__Fi(int lvl)") del_items(0x8014C294) SetType(0x8014C294, "void SpawnWitch__Fi(int lvl)") del_items(0x8014C600) SetType(0x8014C600, "void SpawnHealer__Fi(int lvl)") del_items(0x8014C91C) SetType(0x8014C91C, "void SpawnBoy__Fi(int lvl)") del_items(0x8014CA70) SetType(0x8014CA70, "void SortSmith__Fv()") del_items(0x8014CB84) SetType(0x8014CB84, "void SortHealer__Fv()") del_items(0x8014CCA4) SetType(0x8014CCA4, "void RecreateItem__FiiUsii(int ii, int idx, unsigned short icreateinfo, int iseed, int ivalue)")
# _*_ coding: utf-8 _*_ # # Package: base __all__ = ["firebase"]
class Solution(object): def mincostTickets(self, days, costs): """ :type days: List[int] :type costs: List[int] :rtype: int """ dp = [] dp.append((costs[0], days[0],)) dp.append((costs[1], days[0] + 6,)) dp.append((costs[2], days[0] + 29,)) for day in days[1:]: mincost = None remain = [] for pp in dp: if pp[1] >= day: remain.append(pp) else: mincost = min(mincost, pp[0]) if mincost else pp[0] if mincost: remain.append((mincost + costs[0], day,)) remain.append((mincost + costs[1], day + 6,)) remain.append((mincost + costs[2], day + 29,)) dp = remain dp.sort() return dp[0][0] def test_mincost_tickets(): s = Solution() assert 11 == s.mincostTickets([1, 4, 6, 7, 8, 20], [2, 7, 15]) assert 17 == s.mincostTickets( [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 30, 31], [2, 7, 15]) assert 50 == s.mincostTickets( [1, 2, 3, 4, 6, 8, 9, 10, 13, 14, 16, 17, 19, 21, 24, 26, 27, 28, 29], [3, 14, 50])