content stringlengths 7 1.05M |
|---|
"""This problem was asked by Pinterest.
At a party, there is a single person who everyone knows, but who does not
know anyone in return (the "celebrity"). To help figure out who this is,
you have access to an O(1) method called knows(a, b), which returns True
if person a knows person b, else False.
Given a list of N people and the above operation,
find a way to identify the celebrity in O(N) time.
""" |
class Item:
def __init__(self, name, price, rarity, typ):
self.__name = name
self.__price = price
self.__rarity = rarity
self.__typ = typ
def getName(self):
return self.__name
def setName(self, name):
self.__name = name
def getPrice(self):
return self.__price
def setPrice(self, price):
self.__price = price
def getRarity(self):
return self.__rarity
def setRarity(self, rarity):
self.__rarity = rarity
def getType(self):
return self.__typ
def setType(self, typ):
self.__typ = typ
|
general_value_test_cases = [( {'type': 'driving-licence', 'id': '4HpY_e2U_TUH', 'preferred_label': 'AM', 'deprecated_legacy_id': '16'},
'driving-license', {'legacy_ams_taxonomy_id': '16', 'type': 'driving-license', 'label': 'AM', 'concept_id': '4HpY_e2U_TUH', 'legacy_ams_taxonomy_num_id': 16}),
( {'type': 'driving-licence', 'id': 'bneY_V3g_Kog', 'preferred_label': 'A1', 'deprecated_legacy_id': '2'},
'driving-license', {'legacy_ams_taxonomy_id': '2', 'type': 'driving-license', 'label': 'A1', 'concept_id': 'bneY_V3g_Kog', 'legacy_ams_taxonomy_num_id': 2}),
( {'type': 'driving-licence', 'id': 'Eybh_j3s_SqF', 'preferred_label': 'A2', 'deprecated_legacy_id': '17'},
'driving-license', {'legacy_ams_taxonomy_id': '17', 'type': 'driving-license', 'label': 'A2', 'concept_id': 'Eybh_j3s_SqF', 'legacy_ams_taxonomy_num_id': 17}),
( {'type': 'driving-licence', 'id': 'hK8X_cX9_5P4', 'preferred_label': 'A', 'deprecated_legacy_id': '10'},
'driving-license', {'legacy_ams_taxonomy_id': '10', 'type': 'driving-license', 'label': 'A', 'concept_id': 'hK8X_cX9_5P4', 'legacy_ams_taxonomy_num_id': 10}),
( {'type': 'driving-licence', 'id': 'VTK8_WRx_GcM', 'preferred_label': 'B', 'deprecated_legacy_id': '3'},
'driving-license', {'legacy_ams_taxonomy_id': '3', 'type': 'driving-license', 'label': 'B', 'concept_id': 'VTK8_WRx_GcM', 'legacy_ams_taxonomy_num_id': 3}),
( {'type': 'driving-licence', 'id': 'ftCQ_gFu_L4b', 'preferred_label': 'Utökad B', 'deprecated_legacy_id': '18'},
'driving-license', {'legacy_ams_taxonomy_id': '18', 'type': 'driving-license', 'label': 'Utökad B', 'concept_id': 'ftCQ_gFu_L4b', 'legacy_ams_taxonomy_num_id': 18}),
( {'type': 'driving-licence', 'id': 'bcFd_Vkt_KXL', 'preferred_label': 'BE', 'deprecated_legacy_id': '6'},
'driving-license', {'legacy_ams_taxonomy_id': '6', 'type': 'driving-license', 'label': 'BE', 'concept_id': 'bcFd_Vkt_KXL', 'legacy_ams_taxonomy_num_id': 6}),
( {'type': 'driving-licence', 'id': 'swP6_psb_FCB', 'preferred_label': 'C1', 'deprecated_legacy_id': '12'},
'driving-license', {'legacy_ams_taxonomy_id': '12', 'type': 'driving-license', 'label': 'C1', 'concept_id': 'swP6_psb_FCB', 'legacy_ams_taxonomy_num_id': 12}),
( {'type': 'driving-licence', 'id': 'xRum_Wtt_T1e', 'preferred_label': 'C1E', 'deprecated_legacy_id': '14'},
'driving-license', {'legacy_ams_taxonomy_id': '14', 'type': 'driving-license', 'label': 'C1E', 'concept_id': 'xRum_Wtt_T1e', 'legacy_ams_taxonomy_num_id': 14}),
( {'type': 'driving-licence', 'id': 'BKCx_hST_Pcm', 'preferred_label': 'C', 'deprecated_legacy_id': '4'},
'driving-license', {'legacy_ams_taxonomy_id': '4', 'type': 'driving-license', 'label': 'C', 'concept_id': 'BKCx_hST_Pcm', 'legacy_ams_taxonomy_num_id': 4}),
( {'type': 'driving-licence', 'id': 'zZu8_iZ9_wMH', 'preferred_label': 'CE', 'deprecated_legacy_id': '7'},
'driving-license', {'legacy_ams_taxonomy_id': '7', 'type': 'driving-license', 'label': 'CE', 'concept_id': 'zZu8_iZ9_wMH', 'legacy_ams_taxonomy_num_id': 7}),
( {'type': 'driving-licence', 'id': '5L6k_p4w_8Wu', 'preferred_label': 'D1', 'deprecated_legacy_id': '19'},
'driving-license', {'legacy_ams_taxonomy_id': '19', 'type': 'driving-license', 'label': 'D1', 'concept_id': '5L6k_p4w_8Wu', 'legacy_ams_taxonomy_num_id': 19}),
( {'type': 'driving-licence', 'id': 'qZ2E_JSL_xAq', 'preferred_label': 'D1E', 'deprecated_legacy_id': '15'},
'driving-license', {'legacy_ams_taxonomy_id': '15', 'type': 'driving-license', 'label': 'D1E', 'concept_id': 'qZ2E_JSL_xAq', 'legacy_ams_taxonomy_num_id': 15}),
( {'type': 'driving-licence', 'id': 'hK1a_wsQ_4UG', 'preferred_label': 'D', 'deprecated_legacy_id': '5'},
'driving-license', {'legacy_ams_taxonomy_id': '5', 'type': 'driving-license', 'label': 'D', 'concept_id': 'hK1a_wsQ_4UG', 'legacy_ams_taxonomy_num_id': 5}),
( {'type': 'driving-licence', 'id': '6se7_AdD_nGw', 'preferred_label': 'DE', 'deprecated_legacy_id': '8'},
'driving-license', {'legacy_ams_taxonomy_id': '8', 'type': 'driving-license', 'label': 'DE', 'concept_id': '6se7_AdD_nGw', 'legacy_ams_taxonomy_num_id': 8}),
( {'type': 'country', 'id': 'kTtK_3Y3_Kha', 'preferred_label': 'Afghanistan', 'deprecated_legacy_id': '1'},
'country', {'legacy_ams_taxonomy_id': '1', 'type': 'country', 'label': 'Afghanistan', 'concept_id': 'kTtK_3Y3_Kha', 'legacy_ams_taxonomy_num_id': 1}),
( {'type': 'country', 'id': 'UinE_kZh_fyB', 'preferred_label': 'Albanien', 'deprecated_legacy_id': '2'},
'country', {'legacy_ams_taxonomy_id': '2', 'type': 'country', 'label': 'Albanien', 'concept_id': 'UinE_kZh_fyB', 'legacy_ams_taxonomy_num_id': 2}),
( {'type': 'country', 'id': 'RfvE_aUv_QNd', 'preferred_label': 'Algeriet', 'deprecated_legacy_id': '3'},
'country', {'legacy_ams_taxonomy_id': '3', 'type': 'country', 'label': 'Algeriet', 'concept_id': 'RfvE_aUv_QNd', 'legacy_ams_taxonomy_num_id': 3}),
( {'type': 'country', 'id': 'TQUR_jxt_5My', 'preferred_label': 'Amerikanska Samoa', 'deprecated_legacy_id': '4'},
'country', {'legacy_ams_taxonomy_id': '4', 'type': 'country', 'label': 'Amerikanska Samoa', 'concept_id': 'TQUR_jxt_5My', 'legacy_ams_taxonomy_num_id': 4}),
( {'type': 'country', 'id': 'vdpd_XS2_ZBZ', 'preferred_label': 'Amerikanska, mindre uteliggande öar', 'deprecated_legacy_id': '5'},
'country', {'legacy_ams_taxonomy_id': '5', 'type': 'country', 'label': 'Amerikanska, mindre uteliggande öar', 'concept_id': 'vdpd_XS2_ZBZ', 'legacy_ams_taxonomy_num_id': 5}),
( {'type': 'country', 'id': 'sweX_RLA_3e6', 'preferred_label': 'Andorra', 'deprecated_legacy_id': '6'},
'country', {'legacy_ams_taxonomy_id': '6', 'type': 'country', 'label': 'Andorra', 'concept_id': 'sweX_RLA_3e6', 'legacy_ams_taxonomy_num_id': 6}),
( {'type': 'country', 'id': 'kWK9_dqr_Mo7', 'preferred_label': 'Anguilla', 'deprecated_legacy_id': '8'},
'country', {'legacy_ams_taxonomy_id': '8', 'type': 'country', 'label': 'Anguilla', 'concept_id': 'kWK9_dqr_Mo7', 'legacy_ams_taxonomy_num_id': 8}),
( {'type': 'country', 'id': 'vc1T_oaU_Ctj', 'preferred_label': 'Antarktis', 'deprecated_legacy_id': '9'},
'country', {'legacy_ams_taxonomy_id': '9', 'type': 'country', 'label': 'Antarktis', 'concept_id': 'vc1T_oaU_Ctj', 'legacy_ams_taxonomy_num_id': 9}),
( {'type': 'country', 'id': 'bq7f_tFF_eHk', 'preferred_label': 'Antigua och Barbuda', 'deprecated_legacy_id': '10'},
'country', {'legacy_ams_taxonomy_id': '10', 'type': 'country', 'label': 'Antigua och Barbuda', 'concept_id': 'bq7f_tFF_eHk', 'legacy_ams_taxonomy_num_id': 10}),
( {'type': 'country', 'id': '5HZv_9h6_oEx', 'preferred_label': 'Förenade arabemiraten', 'deprecated_legacy_id': '11'},
'country', {'legacy_ams_taxonomy_id': '11', 'type': 'country', 'label': 'Förenade arabemiraten', 'concept_id': '5HZv_9h6_oEx', 'legacy_ams_taxonomy_num_id': 11}),
( {'type': 'country', 'id': '47CY_xjT_Xc2', 'preferred_label': 'Argentina', 'deprecated_legacy_id': '12'},
'country', {'legacy_ams_taxonomy_id': '12', 'type': 'country', 'label': 'Argentina', 'concept_id': '47CY_xjT_Xc2', 'legacy_ams_taxonomy_num_id': 12}),
( {'type': 'country', 'id': 'fy8S_VeD_ssD', 'preferred_label': 'Armenien', 'deprecated_legacy_id': '13'},
'country', {'legacy_ams_taxonomy_id': '13', 'type': 'country', 'label': 'Armenien', 'concept_id': 'fy8S_VeD_ssD', 'legacy_ams_taxonomy_num_id': 13}),
( {'type': 'country', 'id': 'ryVr_iWV_Fng', 'preferred_label': 'Aruba', 'deprecated_legacy_id': '14'},
'country', {'legacy_ams_taxonomy_id': '14', 'type': 'country', 'label': 'Aruba', 'concept_id': 'ryVr_iWV_Fng', 'legacy_ams_taxonomy_num_id': 14}),
( {'type': 'country', 'id': 'miKy_TpU_dxq', 'preferred_label': 'Australien', 'deprecated_legacy_id': '15'},
'country', {'legacy_ams_taxonomy_id': '15', 'type': 'country', 'label': 'Australien', 'concept_id': 'miKy_TpU_dxq', 'legacy_ams_taxonomy_num_id': 15}),
( {'type': 'country', 'id': 'aHrz_7Ra_BHD', 'preferred_label': 'Azerbajdzjan', 'deprecated_legacy_id': '16'},
'country', {'legacy_ams_taxonomy_id': '16', 'type': 'country', 'label': 'Azerbajdzjan', 'concept_id': 'aHrz_7Ra_BHD', 'legacy_ams_taxonomy_num_id': 16}),
( {'type': 'country', 'id': 'TkqL_i5G_onf', 'preferred_label': 'Bahamas', 'deprecated_legacy_id': '17'},
'country', {'legacy_ams_taxonomy_id': '17', 'type': 'country', 'label': 'Bahamas', 'concept_id': 'TkqL_i5G_onf', 'legacy_ams_taxonomy_num_id': 17}),
( {'type': 'country', 'id': 'nLkD_9YC_CbV', 'preferred_label': 'Bahrain', 'deprecated_legacy_id': '18'},
'country', {'legacy_ams_taxonomy_id': '18', 'type': 'country', 'label': 'Bahrain', 'concept_id': 'nLkD_9YC_CbV', 'legacy_ams_taxonomy_num_id': 18}),
( {'type': 'country', 'id': 'SntG_Zrn_SR3', 'preferred_label': 'Bangladesh', 'deprecated_legacy_id': '19'},
'country', {'legacy_ams_taxonomy_id': '19', 'type': 'country', 'label': 'Bangladesh', 'concept_id': 'SntG_Zrn_SR3', 'legacy_ams_taxonomy_num_id': 19}),
( {'type': 'country', 'id': 'BXzb_Wib_vNM', 'preferred_label': 'Barbados', 'deprecated_legacy_id': '20'},
'country', {'legacy_ams_taxonomy_id': '20', 'type': 'country', 'label': 'Barbados', 'concept_id': 'BXzb_Wib_vNM', 'legacy_ams_taxonomy_num_id': 20}),
( {'type': 'country', 'id': 'igN2_SxA_VJK', 'preferred_label': 'Belgien', 'deprecated_legacy_id': '21'},
'country', {'legacy_ams_taxonomy_id': '21', 'type': 'country', 'label': 'Belgien', 'concept_id': 'igN2_SxA_VJK', 'legacy_ams_taxonomy_num_id': 21}),
( {'type': 'country', 'id': 'ccCA_va6_Lx1', 'preferred_label': 'Belize', 'deprecated_legacy_id': '22'},
'country', {'legacy_ams_taxonomy_id': '22', 'type': 'country', 'label': 'Belize', 'concept_id': 'ccCA_va6_Lx1', 'legacy_ams_taxonomy_num_id': 22}),
( {'type': 'country', 'id': '99u3_XQB_jRk', 'preferred_label': 'Benin', 'deprecated_legacy_id': '23'},
'country', {'legacy_ams_taxonomy_id': '23', 'type': 'country', 'label': 'Benin', 'concept_id': '99u3_XQB_jRk', 'legacy_ams_taxonomy_num_id': 23}),
( {'type': 'country', 'id': 'EwAS_2UD_n2e', 'preferred_label': 'Bermuda', 'deprecated_legacy_id': '24'},
'country', {'legacy_ams_taxonomy_id': '24', 'type': 'country', 'label': 'Bermuda', 'concept_id': 'EwAS_2UD_n2e', 'legacy_ams_taxonomy_num_id': 24}),
( {'type': 'country', 'id': 'bhUZ_uVe_pLo', 'preferred_label': 'Bhutan', 'deprecated_legacy_id': '25'},
'country', {'legacy_ams_taxonomy_id': '25', 'type': 'country', 'label': 'Bhutan', 'concept_id': 'bhUZ_uVe_pLo', 'legacy_ams_taxonomy_num_id': 25}),
( {'type': 'country', 'id': 'v5g4_WPx_zE4', 'preferred_label': 'Bolivia', 'deprecated_legacy_id': '26'},
'country', {'legacy_ams_taxonomy_id': '26', 'type': 'country', 'label': 'Bolivia', 'concept_id': 'v5g4_WPx_zE4', 'legacy_ams_taxonomy_num_id': 26}),
( {'type': 'country', 'id': 'sdJ3_JHH_bHh', 'preferred_label': 'Bosnien och Hercegovina', 'deprecated_legacy_id': '27'},
'country', {'legacy_ams_taxonomy_id': '27', 'type': 'country', 'label': 'Bosnien och Hercegovina', 'concept_id': 'sdJ3_JHH_bHh', 'legacy_ams_taxonomy_num_id': 27}),
( {'type': 'country', 'id': 'f4zT_ajm_AT8', 'preferred_label': 'Botswana', 'deprecated_legacy_id': '28'},
'country', {'legacy_ams_taxonomy_id': '28', 'type': 'country', 'label': 'Botswana', 'concept_id': 'f4zT_ajm_AT8', 'legacy_ams_taxonomy_num_id': 28}),
( {'type': 'country', 'id': 'biXx_VWq_vrH', 'preferred_label': 'Bouvetön', 'deprecated_legacy_id': '29'},
'country', {'legacy_ams_taxonomy_id': '29', 'type': 'country', 'label': 'Bouvetön', 'concept_id': 'biXx_VWq_vrH', 'legacy_ams_taxonomy_num_id': 29}),
( {'type': 'country', 'id': 'KYRf_tqd_ndA', 'preferred_label': 'Brasilien', 'deprecated_legacy_id': '30'},
'country', {'legacy_ams_taxonomy_id': '30', 'type': 'country', 'label': 'Brasilien', 'concept_id': 'KYRf_tqd_ndA', 'legacy_ams_taxonomy_num_id': 30}),
( {'type': 'country', 'id': 'DtaS_uBt_nvb', 'preferred_label': 'Brittiska Indiska Oceanöarna', 'deprecated_legacy_id': '31'},
'country', {'legacy_ams_taxonomy_id': '31', 'type': 'country', 'label': 'Brittiska Indiska Oceanöarna', 'concept_id': 'DtaS_uBt_nvb', 'legacy_ams_taxonomy_num_id': 31}),
( {'type': 'country', 'id': 'tttG_4rv_nRZ', 'preferred_label': 'Brunei Darussalam', 'deprecated_legacy_id': '32'},
'country', {'legacy_ams_taxonomy_id': '32', 'type': 'country', 'label': 'Brunei Darussalam', 'concept_id': 'tttG_4rv_nRZ', 'legacy_ams_taxonomy_num_id': 32}),
( {'type': 'country', 'id': 'HnDR_EFB_MBp', 'preferred_label': 'Bulgarien', 'deprecated_legacy_id': '33'},
'country', {'legacy_ams_taxonomy_id': '33', 'type': 'country', 'label': 'Bulgarien', 'concept_id': 'HnDR_EFB_MBp', 'legacy_ams_taxonomy_num_id': 33}),
( {'type': 'country', 'id': '5huD_yut_1ro', 'preferred_label': 'Burkina Faso', 'deprecated_legacy_id': '34'},
'country', {'legacy_ams_taxonomy_id': '34', 'type': 'country', 'label': 'Burkina Faso', 'concept_id': '5huD_yut_1ro', 'legacy_ams_taxonomy_num_id': 34}),
( {'type': 'country', 'id': '2vPv_RfT_FHq', 'preferred_label': 'Burundi', 'deprecated_legacy_id': '35'},
'country', {'legacy_ams_taxonomy_id': '35', 'type': 'country', 'label': 'Burundi', 'concept_id': '2vPv_RfT_FHq', 'legacy_ams_taxonomy_num_id': 35}),
( {'type': 'country', 'id': 'MS1s_AYg_kZe', 'preferred_label': 'Caymanöarna', 'deprecated_legacy_id': '36'},
'country', {'legacy_ams_taxonomy_id': '36', 'type': 'country', 'label': 'Caymanöarna', 'concept_id': 'MS1s_AYg_kZe', 'legacy_ams_taxonomy_num_id': 36}),
( {'type': 'country', 'id': 'Jon9_cAq_w2p', 'preferred_label': 'Centralafrikanska republiken', 'deprecated_legacy_id': '37'},
'country', {'legacy_ams_taxonomy_id': '37', 'type': 'country', 'label': 'Centralafrikanska republiken', 'concept_id': 'Jon9_cAq_w2p', 'legacy_ams_taxonomy_num_id': 37}),
( {'type': 'country', 'id': 'yoHy_NiM_Hxi', 'preferred_label': 'Chile', 'deprecated_legacy_id': '38'},
'country', {'legacy_ams_taxonomy_id': '38', 'type': 'country', 'label': 'Chile', 'concept_id': 'yoHy_NiM_Hxi', 'legacy_ams_taxonomy_num_id': 38}),
( {'type': 'country', 'id': 'w4Mh_AHu_aUe', 'preferred_label': 'Colombia', 'deprecated_legacy_id': '39'},
'country', {'legacy_ams_taxonomy_id': '39', 'type': 'country', 'label': 'Colombia', 'concept_id': 'w4Mh_AHu_aUe', 'legacy_ams_taxonomy_num_id': 39}),
( {'type': 'country', 'id': 'Bw5r_quJ_jGb', 'preferred_label': 'Comorerna', 'deprecated_legacy_id': '40'},
'country', {'legacy_ams_taxonomy_id': '40', 'type': 'country', 'label': 'Comorerna', 'concept_id': 'Bw5r_quJ_jGb', 'legacy_ams_taxonomy_num_id': 40}),
( {'type': 'country', 'id': 'gBuN_LH5_1sS', 'preferred_label': 'Cooköarna', 'deprecated_legacy_id': '41'},
'country', {'legacy_ams_taxonomy_id': '41', 'type': 'country', 'label': 'Cooköarna', 'concept_id': 'gBuN_LH5_1sS', 'legacy_ams_taxonomy_num_id': 41}),
( {'type': 'country', 'id': '5gYb_FrC_N5L', 'preferred_label': 'Costa Rica', 'deprecated_legacy_id': '42'},
'country', {'legacy_ams_taxonomy_id': '42', 'type': 'country', 'label': 'Costa Rica', 'concept_id': '5gYb_FrC_N5L', 'legacy_ams_taxonomy_num_id': 42}),
( {'type': 'country', 'id': 'EDUL_5Zh_4bg', 'preferred_label': 'Cypern', 'deprecated_legacy_id': '43'},
'country', {'legacy_ams_taxonomy_id': '43', 'type': 'country', 'label': 'Cypern', 'concept_id': 'EDUL_5Zh_4bg', 'legacy_ams_taxonomy_num_id': 43}),
( {'type': 'country', 'id': 'Co3h_1xq_Cwb', 'preferred_label': 'Danmark', 'deprecated_legacy_id': '44'},
'country', {'legacy_ams_taxonomy_id': '44', 'type': 'country', 'label': 'Danmark', 'concept_id': 'Co3h_1xq_Cwb', 'legacy_ams_taxonomy_num_id': 44}),
( {'type': 'country', 'id': 'AH2Q_RGM_hFj', 'preferred_label': 'Djibouti', 'deprecated_legacy_id': '45'},
'country', {'legacy_ams_taxonomy_id': '45', 'type': 'country', 'label': 'Djibouti', 'concept_id': 'AH2Q_RGM_hFj', 'legacy_ams_taxonomy_num_id': 45}),
( {'type': 'country', 'id': 'SPjh_8RR_Go5', 'preferred_label': 'Dominica', 'deprecated_legacy_id': '46'},
'country', {'legacy_ams_taxonomy_id': '46', 'type': 'country', 'label': 'Dominica', 'concept_id': 'SPjh_8RR_Go5', 'legacy_ams_taxonomy_num_id': 46}),
( {'type': 'country', 'id': 'veGZ_ph6_D2z', 'preferred_label': 'Dominikanska republiken', 'deprecated_legacy_id': '47'},
'country', {'legacy_ams_taxonomy_id': '47', 'type': 'country', 'label': 'Dominikanska republiken', 'concept_id': 'veGZ_ph6_D2z', 'legacy_ams_taxonomy_num_id': 47}),
( {'type': 'country', 'id': 'prLG_gW1_iya', 'preferred_label': 'Ecuador', 'deprecated_legacy_id': '48'},
'country', {'legacy_ams_taxonomy_id': '48', 'type': 'country', 'label': 'Ecuador', 'concept_id': 'prLG_gW1_iya', 'legacy_ams_taxonomy_num_id': 48}),
( {'type': 'country', 'id': 'Q39b_6A6_feS', 'preferred_label': 'Egypten', 'deprecated_legacy_id': '49'},
'country', {'legacy_ams_taxonomy_id': '49', 'type': 'country', 'label': 'Egypten', 'concept_id': 'Q39b_6A6_feS', 'legacy_ams_taxonomy_num_id': 49}),
( {'type': 'country', 'id': 'N2MB_xDC_Dxk', 'preferred_label': 'Ekvatorialguinea', 'deprecated_legacy_id': '50'},
'country', {'legacy_ams_taxonomy_id': '50', 'type': 'country', 'label': 'Ekvatorialguinea', 'concept_id': 'N2MB_xDC_Dxk', 'legacy_ams_taxonomy_num_id': 50}),
( {'type': 'country', 'id': '2pi1_At7_eS8', 'preferred_label': 'El Salvador', 'deprecated_legacy_id': '51'},
'country', {'legacy_ams_taxonomy_id': '51', 'type': 'country', 'label': 'El Salvador', 'concept_id': '2pi1_At7_eS8', 'legacy_ams_taxonomy_num_id': 51}),
( {'type': 'country', 'id': 'caeu_xU5_Pr2', 'preferred_label': 'Elfenbenskusten', 'deprecated_legacy_id': '52'},
'country', {'legacy_ams_taxonomy_id': '52', 'type': 'country', 'label': 'Elfenbenskusten', 'concept_id': 'caeu_xU5_Pr2', 'legacy_ams_taxonomy_num_id': 52}),
( {'type': 'country', 'id': 'pyTe_kTE_QkJ', 'preferred_label': 'Eritrea', 'deprecated_legacy_id': '53'},
'country', {'legacy_ams_taxonomy_id': '53', 'type': 'country', 'label': 'Eritrea', 'concept_id': 'pyTe_kTE_QkJ', 'legacy_ams_taxonomy_num_id': 53}),
( {'type': 'country', 'id': 'EtpD_2Kn_dEP', 'preferred_label': 'Estland', 'deprecated_legacy_id': '54'},
'country', {'legacy_ams_taxonomy_id': '54', 'type': 'country', 'label': 'Estland', 'concept_id': 'EtpD_2Kn_dEP', 'legacy_ams_taxonomy_num_id': 54}),
( {'type': 'country', 'id': '3o66_NRC_qxC', 'preferred_label': 'Etiopien', 'deprecated_legacy_id': '55'},
'country', {'legacy_ams_taxonomy_id': '55', 'type': 'country', 'label': 'Etiopien', 'concept_id': '3o66_NRC_qxC', 'legacy_ams_taxonomy_num_id': 55}),
( {'type': 'country', 'id': '3UTC_vx3_ivC', 'preferred_label': 'Falklandsöarna', 'deprecated_legacy_id': '56'},
'country', {'legacy_ams_taxonomy_id': '56', 'type': 'country', 'label': 'Falklandsöarna', 'concept_id': '3UTC_vx3_ivC', 'legacy_ams_taxonomy_num_id': 56}),
( {'type': 'country', 'id': 'S2GW_3zC_U1C', 'preferred_label': 'Fijiöarna', 'deprecated_legacy_id': '57'},
'country', {'legacy_ams_taxonomy_id': '57', 'type': 'country', 'label': 'Fijiöarna', 'concept_id': 'S2GW_3zC_U1C', 'legacy_ams_taxonomy_num_id': 57}),
( {'type': 'country', 'id': '3PiS_KrW_bRW', 'preferred_label': 'Filippinerna', 'deprecated_legacy_id': '58'},
'country', {'legacy_ams_taxonomy_id': '58', 'type': 'country', 'label': 'Filippinerna', 'concept_id': '3PiS_KrW_bRW', 'legacy_ams_taxonomy_num_id': 58}),
( {'type': 'country', 'id': 'WgbG_whJ_E7J', 'preferred_label': 'Finland', 'deprecated_legacy_id': '59'},
'country', {'legacy_ams_taxonomy_id': '59', 'type': 'country', 'label': 'Finland', 'concept_id': 'WgbG_whJ_E7J', 'legacy_ams_taxonomy_num_id': 59}),
( {'type': 'country', 'id': 'GN3D_B21_gpD', 'preferred_label': 'Frankrike', 'deprecated_legacy_id': '60'},
'country', {'legacy_ams_taxonomy_id': '60', 'type': 'country', 'label': 'Frankrike', 'concept_id': 'GN3D_B21_gpD', 'legacy_ams_taxonomy_num_id': 60}),
( {'type': 'country', 'id': 'MZtV_bG4_drn', 'preferred_label': 'Guyana', 'deprecated_legacy_id': '62'},
'country', {'legacy_ams_taxonomy_id': '62', 'type': 'country', 'label': 'Guyana', 'concept_id': 'MZtV_bG4_drn', 'legacy_ams_taxonomy_num_id': 62}),
( {'type': 'country', 'id': 'FF6b_T3q_35V', 'preferred_label': 'Franska Polynesien', 'deprecated_legacy_id': '63'},
'country', {'legacy_ams_taxonomy_id': '63', 'type': 'country', 'label': 'Franska Polynesien', 'concept_id': 'FF6b_T3q_35V', 'legacy_ams_taxonomy_num_id': 63}),
( {'type': 'country', 'id': 'Vn3X_9zH_2yn', 'preferred_label': 'Franska Sydterritorierna', 'deprecated_legacy_id': '64'},
'country', {'legacy_ams_taxonomy_id': '64', 'type': 'country', 'label': 'Franska Sydterritorierna', 'concept_id': 'Vn3X_9zH_2yn', 'legacy_ams_taxonomy_num_id': 64}),
( {'type': 'country', 'id': 'QKFb_bvZ_gNY', 'preferred_label': 'Färöarna', 'deprecated_legacy_id': '65'},
'country', {'legacy_ams_taxonomy_id': '65', 'type': 'country', 'label': 'Färöarna', 'concept_id': 'QKFb_bvZ_gNY', 'legacy_ams_taxonomy_num_id': 65}),
( {'type': 'country', 'id': 'FY6e_EBz_sqn', 'preferred_label': 'Gabon', 'deprecated_legacy_id': '66'},
'country', {'legacy_ams_taxonomy_id': '66', 'type': 'country', 'label': 'Gabon', 'concept_id': 'FY6e_EBz_sqn', 'legacy_ams_taxonomy_num_id': 66}),
( {'type': 'country', 'id': 'vbtb_ju1_kUX', 'preferred_label': 'Gambia', 'deprecated_legacy_id': '67'},
'country', {'legacy_ams_taxonomy_id': '67', 'type': 'country', 'label': 'Gambia', 'concept_id': 'vbtb_ju1_kUX', 'legacy_ams_taxonomy_num_id': 67}),
( {'type': 'country', 'id': '7DEB_o2m_bc2', 'preferred_label': 'Georgien', 'deprecated_legacy_id': '68'},
'country', {'legacy_ams_taxonomy_id': '68', 'type': 'country', 'label': 'Georgien', 'concept_id': '7DEB_o2m_bc2', 'legacy_ams_taxonomy_num_id': 68}),
( {'type': 'country', 'id': 'Qgi9_tqh_b2X', 'preferred_label': 'Ghana', 'deprecated_legacy_id': '69'},
'country', {'legacy_ams_taxonomy_id': '69', 'type': 'country', 'label': 'Ghana', 'concept_id': 'Qgi9_tqh_b2X', 'legacy_ams_taxonomy_num_id': 69}),
( {'type': 'country', 'id': '9Lj6_Lrk_83M', 'preferred_label': 'Gibraltar', 'deprecated_legacy_id': '70'},
'country', {'legacy_ams_taxonomy_id': '70', 'type': 'country', 'label': 'Gibraltar', 'concept_id': '9Lj6_Lrk_83M', 'legacy_ams_taxonomy_num_id': 70}),
( {'type': 'country', 'id': 'BRi4_in4_xLc', 'preferred_label': 'Grekland', 'deprecated_legacy_id': '71'},
'country', {'legacy_ams_taxonomy_id': '71', 'type': 'country', 'label': 'Grekland', 'concept_id': 'BRi4_in4_xLc', 'legacy_ams_taxonomy_num_id': 71}),
( {'type': 'country', 'id': 't9U9_e8w_oQi', 'preferred_label': 'Grenada', 'deprecated_legacy_id': '72'},
'country', {'legacy_ams_taxonomy_id': '72', 'type': 'country', 'label': 'Grenada', 'concept_id': 't9U9_e8w_oQi', 'legacy_ams_taxonomy_num_id': 72}),
( {'type': 'country', 'id': '6JQy_Wpf_8RK', 'preferred_label': 'Grönland', 'deprecated_legacy_id': '73'},
'country', {'legacy_ams_taxonomy_id': '73', 'type': 'country', 'label': 'Grönland', 'concept_id': '6JQy_Wpf_8RK', 'legacy_ams_taxonomy_num_id': 73}),
( {'type': 'country', 'id': 'o8tZ_1V3_5do', 'preferred_label': 'Guadeloupe', 'deprecated_legacy_id': '74'},
'country', {'legacy_ams_taxonomy_id': '74', 'type': 'country', 'label': 'Guadeloupe', 'concept_id': 'o8tZ_1V3_5do', 'legacy_ams_taxonomy_num_id': 74}),
( {'type': 'country', 'id': 'UxZz_53F_fcb', 'preferred_label': 'Guam', 'deprecated_legacy_id': '75'},
'country', {'legacy_ams_taxonomy_id': '75', 'type': 'country', 'label': 'Guam', 'concept_id': 'UxZz_53F_fcb', 'legacy_ams_taxonomy_num_id': 75}),
( {'type': 'country', 'id': 'RxXm_KBi_sjp', 'preferred_label': 'Guatemala', 'deprecated_legacy_id': '76'},
'country', {'legacy_ams_taxonomy_id': '76', 'type': 'country', 'label': 'Guatemala', 'concept_id': 'RxXm_KBi_sjp', 'legacy_ams_taxonomy_num_id': 76}),
( {'type': 'country', 'id': 'SYb7_4Rj_9SB', 'preferred_label': 'Guinea', 'deprecated_legacy_id': '77'},
'country', {'legacy_ams_taxonomy_id': '77', 'type': 'country', 'label': 'Guinea', 'concept_id': 'SYb7_4Rj_9SB', 'legacy_ams_taxonomy_num_id': 77}),
( {'type': 'country', 'id': 'BCcY_Z35_kS6', 'preferred_label': 'Guinea-Bissau', 'deprecated_legacy_id': '78'},
'country', {'legacy_ams_taxonomy_id': '78', 'type': 'country', 'label': 'Guinea-Bissau', 'concept_id': 'BCcY_Z35_kS6', 'legacy_ams_taxonomy_num_id': 78}),
( {'type': 'country', 'id': 'dKCz_1XX_ays', 'preferred_label': 'Haiti', 'deprecated_legacy_id': '80'},
'country', {'legacy_ams_taxonomy_id': '80', 'type': 'country', 'label': 'Haiti', 'concept_id': 'dKCz_1XX_ays', 'legacy_ams_taxonomy_num_id': 80}),
( {'type': 'country', 'id': '3XFZ_Hte_nch', 'preferred_label': 'Heardön och McDonaldöarna', 'deprecated_legacy_id': '81'},
'country', {'legacy_ams_taxonomy_id': '81', 'type': 'country', 'label': 'Heardön och McDonaldöarna', 'concept_id': '3XFZ_Hte_nch', 'legacy_ams_taxonomy_num_id': 81}),
( {'type': 'country', 'id': 'is8V_V6o_iyS', 'preferred_label': 'Honduras', 'deprecated_legacy_id': '82'},
'country', {'legacy_ams_taxonomy_id': '82', 'type': 'country', 'label': 'Honduras', 'concept_id': 'is8V_V6o_iyS', 'legacy_ams_taxonomy_num_id': 82}),
( {'type': 'country', 'id': 'H1JH_rYH_LjG', 'preferred_label': 'Hongkong', 'deprecated_legacy_id': '83'},
'country', {'legacy_ams_taxonomy_id': '83', 'type': 'country', 'label': 'Hongkong', 'concept_id': 'H1JH_rYH_LjG', 'legacy_ams_taxonomy_num_id': 83}),
( {'type': 'country', 'id': 'mCdG_xuR_qwD', 'preferred_label': 'Indien', 'deprecated_legacy_id': '84'},
'country', {'legacy_ams_taxonomy_id': '84', 'type': 'country', 'label': 'Indien', 'concept_id': 'mCdG_xuR_qwD', 'legacy_ams_taxonomy_num_id': 84}),
( {'type': 'country', 'id': 'St4p_G3F_MTj', 'preferred_label': 'Indonesien', 'deprecated_legacy_id': '85'},
'country', {'legacy_ams_taxonomy_id': '85', 'type': 'country', 'label': 'Indonesien', 'concept_id': 'St4p_G3F_MTj', 'legacy_ams_taxonomy_num_id': 85}),
( {'type': 'country', 'id': 'LQar_3Jn_BGU', 'preferred_label': 'Irak', 'deprecated_legacy_id': '86'},
'country', {'legacy_ams_taxonomy_id': '86', 'type': 'country', 'label': 'Irak', 'concept_id': 'LQar_3Jn_BGU', 'legacy_ams_taxonomy_num_id': 86}),
( {'type': 'country', 'id': 'wZw5_AY7_RMg', 'preferred_label': 'Iran', 'deprecated_legacy_id': '87'},
'country', {'legacy_ams_taxonomy_id': '87', 'type': 'country', 'label': 'Iran', 'concept_id': 'wZw5_AY7_RMg', 'legacy_ams_taxonomy_num_id': 87}),
( {'type': 'country', 'id': 'cnZp_bhJ_JCZ', 'preferred_label': 'Irland', 'deprecated_legacy_id': '88'},
'country', {'legacy_ams_taxonomy_id': '88', 'type': 'country', 'label': 'Irland', 'concept_id': 'cnZp_bhJ_JCZ', 'legacy_ams_taxonomy_num_id': 88}),
( {'type': 'country', 'id': 'ZDbX_yJc_zin', 'preferred_label': 'Island', 'deprecated_legacy_id': '89'},
'country', {'legacy_ams_taxonomy_id': '89', 'type': 'country', 'label': 'Island', 'concept_id': 'ZDbX_yJc_zin', 'legacy_ams_taxonomy_num_id': 89}),
( {'type': 'country', 'id': 'L2vN_3YW_6jk', 'preferred_label': 'Israel', 'deprecated_legacy_id': '90'},
'country', {'legacy_ams_taxonomy_id': '90', 'type': 'country', 'label': 'Israel', 'concept_id': 'L2vN_3YW_6jk', 'legacy_ams_taxonomy_num_id': 90}),
( {'type': 'country', 'id': 'yTER_v5s_onb', 'preferred_label': 'Italien', 'deprecated_legacy_id': '91'},
'country', {'legacy_ams_taxonomy_id': '91', 'type': 'country', 'label': 'Italien', 'concept_id': 'yTER_v5s_onb', 'legacy_ams_taxonomy_num_id': 91}),
( {'type': 'country', 'id': 'zJ4U_hmd_yei', 'preferred_label': 'Jamaica', 'deprecated_legacy_id': '92'},
'country', {'legacy_ams_taxonomy_id': '92', 'type': 'country', 'label': 'Jamaica', 'concept_id': 'zJ4U_hmd_yei', 'legacy_ams_taxonomy_num_id': 92}),
( {'type': 'country', 'id': 'DBob_NQg_ayR', 'preferred_label': 'Japan', 'deprecated_legacy_id': '93'},
'country', {'legacy_ams_taxonomy_id': '93', 'type': 'country', 'label': 'Japan', 'concept_id': 'DBob_NQg_ayR', 'legacy_ams_taxonomy_num_id': 93}),
( {'type': 'country', 'id': 'nXoR_hvq_TLr', 'preferred_label': 'Jordanien', 'deprecated_legacy_id': '94'},
'country', {'legacy_ams_taxonomy_id': '94', 'type': 'country', 'label': 'Jordanien', 'concept_id': 'nXoR_hvq_TLr', 'legacy_ams_taxonomy_num_id': 94}),
( {'type': 'country', 'id': 'BZuK_352_yAD', 'preferred_label': 'Julön', 'deprecated_legacy_id': '96'},
'country', {'legacy_ams_taxonomy_id': '96', 'type': 'country', 'label': 'Julön', 'concept_id': 'BZuK_352_yAD', 'legacy_ams_taxonomy_num_id': 96}),
( {'type': 'country', 'id': 'cr4o_3L8_hoa', 'preferred_label': 'Jungfruöarna, Brittiska', 'deprecated_legacy_id': '97'},
'country', {'legacy_ams_taxonomy_id': '97', 'type': 'country', 'label': 'Jungfruöarna, Brittiska', 'concept_id': 'cr4o_3L8_hoa', 'legacy_ams_taxonomy_num_id': 97}),
( {'type': 'country', 'id': 's4H2_8bX_V5G', 'preferred_label': 'Jungfruöarna, Förenta Staternas', 'deprecated_legacy_id': '98'},
'country', {'legacy_ams_taxonomy_id': '98', 'type': 'country', 'label': 'Jungfruöarna, Förenta Staternas', 'concept_id': 's4H2_8bX_V5G', 'legacy_ams_taxonomy_num_id': 98}),
( {'type': 'country', 'id': 'a5yX_nAP_GVu', 'preferred_label': 'Kambodja', 'deprecated_legacy_id': '99'},
'country', {'legacy_ams_taxonomy_id': '99', 'type': 'country', 'label': 'Kambodja', 'concept_id': 'a5yX_nAP_GVu', 'legacy_ams_taxonomy_num_id': 99}),
( {'type': 'country', 'id': 'Gx97_r5T_5vJ', 'preferred_label': 'Kamerun', 'deprecated_legacy_id': '100'},
'country', {'legacy_ams_taxonomy_id': '100', 'type': 'country', 'label': 'Kamerun', 'concept_id': 'Gx97_r5T_5vJ', 'legacy_ams_taxonomy_num_id': 100}),
( {'type': 'country', 'id': '4pSd_nND_Buv', 'preferred_label': 'Kanada', 'deprecated_legacy_id': '101'},
'country', {'legacy_ams_taxonomy_id': '101', 'type': 'country', 'label': 'Kanada', 'concept_id': '4pSd_nND_Buv', 'legacy_ams_taxonomy_num_id': 101}),
( {'type': 'country', 'id': '7hV5_ej6_4Ry', 'preferred_label': 'Kap Verde', 'deprecated_legacy_id': '102'},
'country', {'legacy_ams_taxonomy_id': '102', 'type': 'country', 'label': 'Kap Verde', 'concept_id': '7hV5_ej6_4Ry', 'legacy_ams_taxonomy_num_id': 102}),
( {'type': 'country', 'id': 'Jf5g_omQ_YVY', 'preferred_label': 'Kazakstan', 'deprecated_legacy_id': '103'},
'country', {'legacy_ams_taxonomy_id': '103', 'type': 'country', 'label': 'Kazakstan', 'concept_id': 'Jf5g_omQ_YVY', 'legacy_ams_taxonomy_num_id': 103}),
( {'type': 'country', 'id': 'RvV6_URK_zjd', 'preferred_label': 'Kenya', 'deprecated_legacy_id': '104'},
'country', {'legacy_ams_taxonomy_id': '104', 'type': 'country', 'label': 'Kenya', 'concept_id': 'RvV6_URK_zjd', 'legacy_ams_taxonomy_num_id': 104}),
( {'type': 'country', 'id': 'hwyG_7pq_yHR', 'preferred_label': 'Kina', 'deprecated_legacy_id': '105'},
'country', {'legacy_ams_taxonomy_id': '105', 'type': 'country', 'label': 'Kina', 'concept_id': 'hwyG_7pq_yHR', 'legacy_ams_taxonomy_num_id': 105}),
( {'type': 'country', 'id': '6uZH_6X8_8u4', 'preferred_label': 'Kirgizistan', 'deprecated_legacy_id': '106'},
'country', {'legacy_ams_taxonomy_id': '106', 'type': 'country', 'label': 'Kirgizistan', 'concept_id': '6uZH_6X8_8u4', 'legacy_ams_taxonomy_num_id': 106}),
( {'type': 'country', 'id': 'YoNM_eCx_zat', 'preferred_label': 'Kiribati', 'deprecated_legacy_id': '107'},
'country', {'legacy_ams_taxonomy_id': '107', 'type': 'country', 'label': 'Kiribati', 'concept_id': 'YoNM_eCx_zat', 'legacy_ams_taxonomy_num_id': 107}),
( {'type': 'country', 'id': 'UZKB_8TU_Hkn', 'preferred_label': 'Kokosöarna', 'deprecated_legacy_id': '108'},
'country', {'legacy_ams_taxonomy_id': '108', 'type': 'country', 'label': 'Kokosöarna', 'concept_id': 'UZKB_8TU_Hkn', 'legacy_ams_taxonomy_num_id': 108}),
( {'type': 'country', 'id': 'Rgpn_h5Y_u6N', 'preferred_label': 'Kongo, republiken', 'deprecated_legacy_id': '109'},
'country', {'legacy_ams_taxonomy_id': '109', 'type': 'country', 'label': 'Kongo, republiken', 'concept_id': 'Rgpn_h5Y_u6N', 'legacy_ams_taxonomy_num_id': 109}),
( {'type': 'country', 'id': 'STUC_FzH_Ah2', 'preferred_label': 'Nordkorea', 'deprecated_legacy_id': '110'},
'country', {'legacy_ams_taxonomy_id': '110', 'type': 'country', 'label': 'Nordkorea', 'concept_id': 'STUC_FzH_Ah2', 'legacy_ams_taxonomy_num_id': 110}),
( {'type': 'country', 'id': '1dcY_7Gr_ucB', 'preferred_label': 'Sydkorea', 'deprecated_legacy_id': '111'},
'country', {'legacy_ams_taxonomy_id': '111', 'type': 'country', 'label': 'Sydkorea', 'concept_id': '1dcY_7Gr_ucB', 'legacy_ams_taxonomy_num_id': 111}),
( {'type': 'country', 'id': 'kzWw_cdp_PhU', 'preferred_label': 'Kroatien', 'deprecated_legacy_id': '112'},
'country', {'legacy_ams_taxonomy_id': '112', 'type': 'country', 'label': 'Kroatien', 'concept_id': 'kzWw_cdp_PhU', 'legacy_ams_taxonomy_num_id': 112}),
( {'type': 'country', 'id': 'BAGM_XF7_FpH', 'preferred_label': 'Kuba', 'deprecated_legacy_id': '113'},
'country', {'legacy_ams_taxonomy_id': '113', 'type': 'country', 'label': 'Kuba', 'concept_id': 'BAGM_XF7_FpH', 'legacy_ams_taxonomy_num_id': 113}),
( {'type': 'country', 'id': 'NJTY_G1b_vc6', 'preferred_label': 'Kuwait', 'deprecated_legacy_id': '114'},
'country', {'legacy_ams_taxonomy_id': '114', 'type': 'country', 'label': 'Kuwait', 'concept_id': 'NJTY_G1b_vc6', 'legacy_ams_taxonomy_num_id': 114}),
( {'type': 'country', 'id': 'invg_zpk_bHR', 'preferred_label': 'Laos', 'deprecated_legacy_id': '115'},
'country', {'legacy_ams_taxonomy_id': '115', 'type': 'country', 'label': 'Laos', 'concept_id': 'invg_zpk_bHR', 'legacy_ams_taxonomy_num_id': 115}),
( {'type': 'country', 'id': 'QGD8_mTz_JdA', 'preferred_label': 'Lesotho', 'deprecated_legacy_id': '116'},
'country', {'legacy_ams_taxonomy_id': '116', 'type': 'country', 'label': 'Lesotho', 'concept_id': 'QGD8_mTz_JdA', 'legacy_ams_taxonomy_num_id': 116}),
( {'type': 'country', 'id': 'FcoH_7D1_p8H', 'preferred_label': 'Lettland', 'deprecated_legacy_id': '117'},
'country', {'legacy_ams_taxonomy_id': '117', 'type': 'country', 'label': 'Lettland', 'concept_id': 'FcoH_7D1_p8H', 'legacy_ams_taxonomy_num_id': 117}),
( {'type': 'country', 'id': '7P48_RTM_NwH', 'preferred_label': 'Libanon', 'deprecated_legacy_id': '118'},
'country', {'legacy_ams_taxonomy_id': '118', 'type': 'country', 'label': 'Libanon', 'concept_id': '7P48_RTM_NwH', 'legacy_ams_taxonomy_num_id': 118}),
( {'type': 'country', 'id': '5Lt9_xKU_6cC', 'preferred_label': 'Liberia', 'deprecated_legacy_id': '119'},
'country', {'legacy_ams_taxonomy_id': '119', 'type': 'country', 'label': 'Liberia', 'concept_id': '5Lt9_xKU_6cC', 'legacy_ams_taxonomy_num_id': 119}),
( {'type': 'country', 'id': 'ZfuN_DVH_t2R', 'preferred_label': 'Libyen', 'deprecated_legacy_id': '120'},
'country', {'legacy_ams_taxonomy_id': '120', 'type': 'country', 'label': 'Libyen', 'concept_id': 'ZfuN_DVH_t2R', 'legacy_ams_taxonomy_num_id': 120}),
( {'type': 'country', 'id': 'dL9B_ubn_9KN', 'preferred_label': 'Liechtenstein', 'deprecated_legacy_id': '121'},
'country', {'legacy_ams_taxonomy_id': '121', 'type': 'country', 'label': 'Liechtenstein', 'concept_id': 'dL9B_ubn_9KN', 'legacy_ams_taxonomy_num_id': 121}),
( {'type': 'country', 'id': '37nR_YtF_158', 'preferred_label': 'Litauen', 'deprecated_legacy_id': '122'},
'country', {'legacy_ams_taxonomy_id': '122', 'type': 'country', 'label': 'Litauen', 'concept_id': '37nR_YtF_158', 'legacy_ams_taxonomy_num_id': 122}),
( {'type': 'country', 'id': 'eh3o_JnT_ZU7', 'preferred_label': 'Luxemburg', 'deprecated_legacy_id': '123'},
'country', {'legacy_ams_taxonomy_id': '123', 'type': 'country', 'label': 'Luxemburg', 'concept_id': 'eh3o_JnT_ZU7', 'legacy_ams_taxonomy_num_id': 123}),
( {'type': 'country', 'id': 'PRSy_b5B_piv', 'preferred_label': 'Macao', 'deprecated_legacy_id': '124'},
'country', {'legacy_ams_taxonomy_id': '124', 'type': 'country', 'label': 'Macao', 'concept_id': 'PRSy_b5B_piv', 'legacy_ams_taxonomy_num_id': 124}),
( {'type': 'country', 'id': 'Y3iU_QDa_5Js', 'preferred_label': 'Madagaskar', 'deprecated_legacy_id': '125'},
'country', {'legacy_ams_taxonomy_id': '125', 'type': 'country', 'label': 'Madagaskar', 'concept_id': 'Y3iU_QDa_5Js', 'legacy_ams_taxonomy_num_id': 125}),
( {'type': 'country', 'id': 'T3Ui_pa1_2Wc', 'preferred_label': 'Malawi', 'deprecated_legacy_id': '126'},
'country', {'legacy_ams_taxonomy_id': '126', 'type': 'country', 'label': 'Malawi', 'concept_id': 'T3Ui_pa1_2Wc', 'legacy_ams_taxonomy_num_id': 126}),
( {'type': 'country', 'id': 'MRfa_jpt_dmY', 'preferred_label': 'Malaysia', 'deprecated_legacy_id': '127'},
'country', {'legacy_ams_taxonomy_id': '127', 'type': 'country', 'label': 'Malaysia', 'concept_id': 'MRfa_jpt_dmY', 'legacy_ams_taxonomy_num_id': 127}),
( {'type': 'country', 'id': 'yrE7_cE9_cVF', 'preferred_label': 'Maldiverna', 'deprecated_legacy_id': '128'},
'country', {'legacy_ams_taxonomy_id': '128', 'type': 'country', 'label': 'Maldiverna', 'concept_id': 'yrE7_cE9_cVF', 'legacy_ams_taxonomy_num_id': 128}),
( {'type': 'country', 'id': 'dLVN_jSb_YjF', 'preferred_label': 'Mali', 'deprecated_legacy_id': '129'},
'country', {'legacy_ams_taxonomy_id': '129', 'type': 'country', 'label': 'Mali', 'concept_id': 'dLVN_jSb_YjF', 'legacy_ams_taxonomy_num_id': 129}),
( {'type': 'country', 'id': 'u8qF_qpq_R5W', 'preferred_label': 'Malta', 'deprecated_legacy_id': '130'},
'country', {'legacy_ams_taxonomy_id': '130', 'type': 'country', 'label': 'Malta', 'concept_id': 'u8qF_qpq_R5W', 'legacy_ams_taxonomy_num_id': 130}),
( {'type': 'country', 'id': 'wJGU_XXo_28H', 'preferred_label': 'Marocko', 'deprecated_legacy_id': '131'},
'country', {'legacy_ams_taxonomy_id': '131', 'type': 'country', 'label': 'Marocko', 'concept_id': 'wJGU_XXo_28H', 'legacy_ams_taxonomy_num_id': 131}),
( {'type': 'country', 'id': 'mdMy_Gru_gjg', 'preferred_label': 'Marshallöarna', 'deprecated_legacy_id': '132'},
'country', {'legacy_ams_taxonomy_id': '132', 'type': 'country', 'label': 'Marshallöarna', 'concept_id': 'mdMy_Gru_gjg', 'legacy_ams_taxonomy_num_id': 132}),
( {'type': 'country', 'id': 'H5my_Ues_ya3', 'preferred_label': 'Martinique', 'deprecated_legacy_id': '133'},
'country', {'legacy_ams_taxonomy_id': '133', 'type': 'country', 'label': 'Martinique', 'concept_id': 'H5my_Ues_ya3', 'legacy_ams_taxonomy_num_id': 133}),
( {'type': 'country', 'id': '6Er6_yt8_Kzk', 'preferred_label': 'Mauretanien', 'deprecated_legacy_id': '134'},
'country', {'legacy_ams_taxonomy_id': '134', 'type': 'country', 'label': 'Mauretanien', 'concept_id': '6Er6_yt8_Kzk', 'legacy_ams_taxonomy_num_id': 134}),
( {'type': 'country', 'id': 'wcHy_zcL_tUt', 'preferred_label': 'Mauritius', 'deprecated_legacy_id': '135'},
'country', {'legacy_ams_taxonomy_id': '135', 'type': 'country', 'label': 'Mauritius', 'concept_id': 'wcHy_zcL_tUt', 'legacy_ams_taxonomy_num_id': 135}),
( {'type': 'country', 'id': 'aBL1_wh8_qgu', 'preferred_label': 'Mayotte', 'deprecated_legacy_id': '136'},
'country', {'legacy_ams_taxonomy_id': '136', 'type': 'country', 'label': 'Mayotte', 'concept_id': 'aBL1_wh8_qgu', 'legacy_ams_taxonomy_num_id': 136}),
( {'type': 'country', 'id': 'T7Dy_wGz_9vv', 'preferred_label': 'Mexiko/Mexikos förenta stater', 'deprecated_legacy_id': '137'},
'country', {'legacy_ams_taxonomy_id': '137', 'type': 'country', 'label': 'Mexiko/Mexikos förenta stater', 'concept_id': 'T7Dy_wGz_9vv', 'legacy_ams_taxonomy_num_id': 137}),
( {'type': 'country', 'id': 'NXE2_wDm_jtg', 'preferred_label': 'Mikronesiska federationen', 'deprecated_legacy_id': '138'},
'country', {'legacy_ams_taxonomy_id': '138', 'type': 'country', 'label': 'Mikronesiska federationen', 'concept_id': 'NXE2_wDm_jtg', 'legacy_ams_taxonomy_num_id': 138}),
( {'type': 'country', 'id': 'LXPi_qGh_dXN', 'preferred_label': 'Moçambique', 'deprecated_legacy_id': '139'},
'country', {'legacy_ams_taxonomy_id': '139', 'type': 'country', 'label': 'Moçambique', 'concept_id': 'LXPi_qGh_dXN', 'legacy_ams_taxonomy_num_id': 139}),
( {'type': 'country', 'id': 'g8EG_tGy_Y9h', 'preferred_label': 'Moldavien', 'deprecated_legacy_id': '140'},
'country', {'legacy_ams_taxonomy_id': '140', 'type': 'country', 'label': 'Moldavien', 'concept_id': 'g8EG_tGy_Y9h', 'legacy_ams_taxonomy_num_id': 140}),
( {'type': 'country', 'id': 'Rhid_ebP_t7s', 'preferred_label': 'Monaco', 'deprecated_legacy_id': '141'},
'country', {'legacy_ams_taxonomy_id': '141', 'type': 'country', 'label': 'Monaco', 'concept_id': 'Rhid_ebP_t7s', 'legacy_ams_taxonomy_num_id': 141}),
( {'type': 'country', 'id': 'hGXE_Keq_uhh', 'preferred_label': 'Mongoliet', 'deprecated_legacy_id': '142'},
'country', {'legacy_ams_taxonomy_id': '142', 'type': 'country', 'label': 'Mongoliet', 'concept_id': 'hGXE_Keq_uhh', 'legacy_ams_taxonomy_num_id': 142}),
( {'type': 'country', 'id': 'BVxK_CPb_XDd', 'preferred_label': 'Montserrat', 'deprecated_legacy_id': '143'},
'country', {'legacy_ams_taxonomy_id': '143', 'type': 'country', 'label': 'Montserrat', 'concept_id': 'BVxK_CPb_XDd', 'legacy_ams_taxonomy_num_id': 143}),
( {'type': 'country', 'id': 'h8Nc_4cm_SVk', 'preferred_label': 'Myanmar (Burma)', 'deprecated_legacy_id': '144'},
'country', {'legacy_ams_taxonomy_id': '144', 'type': 'country', 'label': 'Myanmar (Burma)', 'concept_id': 'h8Nc_4cm_SVk', 'legacy_ams_taxonomy_num_id': 144}),
( {'type': 'country', 'id': 'UvNn_GZf_GKx', 'preferred_label': 'Namibia', 'deprecated_legacy_id': '145'},
'country', {'legacy_ams_taxonomy_id': '145', 'type': 'country', 'label': 'Namibia', 'concept_id': 'UvNn_GZf_GKx', 'legacy_ams_taxonomy_num_id': 145}),
( {'type': 'country', 'id': 'nrBz_LjD_fC2', 'preferred_label': 'Nauru', 'deprecated_legacy_id': '146'},
'country', {'legacy_ams_taxonomy_id': '146', 'type': 'country', 'label': 'Nauru', 'concept_id': 'nrBz_LjD_fC2', 'legacy_ams_taxonomy_num_id': 146}),
( {'type': 'country', 'id': 'mc3v_dHh_dzf', 'preferred_label': 'Nederländerna', 'deprecated_legacy_id': '147'},
'country', {'legacy_ams_taxonomy_id': '147', 'type': 'country', 'label': 'Nederländerna', 'concept_id': 'mc3v_dHh_dzf', 'legacy_ams_taxonomy_num_id': 147}),
( {'type': 'country', 'id': 'YfAA_stA_Wim', 'preferred_label': 'Nepal', 'deprecated_legacy_id': '149'},
'country', {'legacy_ams_taxonomy_id': '149', 'type': 'country', 'label': 'Nepal', 'concept_id': 'YfAA_stA_Wim', 'legacy_ams_taxonomy_num_id': 149}),
( {'type': 'country', 'id': '9aCc_E74_GW4', 'preferred_label': 'Nicaragua', 'deprecated_legacy_id': '150'},
'country', {'legacy_ams_taxonomy_id': '150', 'type': 'country', 'label': 'Nicaragua', 'concept_id': '9aCc_E74_GW4', 'legacy_ams_taxonomy_num_id': 150}),
( {'type': 'country', 'id': '6mBR_Vzm_hEy', 'preferred_label': 'Niger', 'deprecated_legacy_id': '151'},
'country', {'legacy_ams_taxonomy_id': '151', 'type': 'country', 'label': 'Niger', 'concept_id': '6mBR_Vzm_hEy', 'legacy_ams_taxonomy_num_id': 151}),
( {'type': 'country', 'id': 'pUgR_4E5_Lcb', 'preferred_label': 'Nigeria', 'deprecated_legacy_id': '152'},
'country', {'legacy_ams_taxonomy_id': '152', 'type': 'country', 'label': 'Nigeria', 'concept_id': 'pUgR_4E5_Lcb', 'legacy_ams_taxonomy_num_id': 152}),
( {'type': 'country', 'id': 'iW9P_8kt_BSS', 'preferred_label': 'Niue', 'deprecated_legacy_id': '153'},
'country', {'legacy_ams_taxonomy_id': '153', 'type': 'country', 'label': 'Niue', 'concept_id': 'iW9P_8kt_BSS', 'legacy_ams_taxonomy_num_id': 153}),
( {'type': 'country', 'id': 'JawQ_qCy_XVW', 'preferred_label': 'Norfolkön', 'deprecated_legacy_id': '154'},
'country', {'legacy_ams_taxonomy_id': '154', 'type': 'country', 'label': 'Norfolkön', 'concept_id': 'JawQ_qCy_XVW', 'legacy_ams_taxonomy_num_id': 154}),
( {'type': 'country', 'id': 'QJgN_Zge_BzJ', 'preferred_label': 'Norge', 'deprecated_legacy_id': '155'},
'country', {'legacy_ams_taxonomy_id': '155', 'type': 'country', 'label': 'Norge', 'concept_id': 'QJgN_Zge_BzJ', 'legacy_ams_taxonomy_num_id': 155}),
( {'type': 'country', 'id': 'KCpz_RKA_EYu', 'preferred_label': 'Norra Marianaöarna', 'deprecated_legacy_id': '156'},
'country', {'legacy_ams_taxonomy_id': '156', 'type': 'country', 'label': 'Norra Marianaöarna', 'concept_id': 'KCpz_RKA_EYu', 'legacy_ams_taxonomy_num_id': 156}),
( {'type': 'country', 'id': 'FELd_2Jy_ZCP', 'preferred_label': 'Nya Kaledonien', 'deprecated_legacy_id': '157'},
'country', {'legacy_ams_taxonomy_id': '157', 'type': 'country', 'label': 'Nya Kaledonien', 'concept_id': 'FELd_2Jy_ZCP', 'legacy_ams_taxonomy_num_id': 157}),
( {'type': 'country', 'id': 'Ue2v_DjR_ANf', 'preferred_label': 'Nya Zeeland', 'deprecated_legacy_id': '158'},
'country', {'legacy_ams_taxonomy_id': '158', 'type': 'country', 'label': 'Nya Zeeland', 'concept_id': 'Ue2v_DjR_ANf', 'legacy_ams_taxonomy_num_id': 158}),
( {'type': 'country', 'id': 'XHsS_76L_o2s', 'preferred_label': 'Oman', 'deprecated_legacy_id': '159'},
'country', {'legacy_ams_taxonomy_id': '159', 'type': 'country', 'label': 'Oman', 'concept_id': 'XHsS_76L_o2s', 'legacy_ams_taxonomy_num_id': 159}),
( {'type': 'country', 'id': 'P42X_cky_m8v', 'preferred_label': 'Pakistan', 'deprecated_legacy_id': '160'},
'country', {'legacy_ams_taxonomy_id': '160', 'type': 'country', 'label': 'Pakistan', 'concept_id': 'P42X_cky_m8v', 'legacy_ams_taxonomy_num_id': 160}),
( {'type': 'country', 'id': 'Jtka_2NV_XGQ', 'preferred_label': 'Palau', 'deprecated_legacy_id': '161'},
'country', {'legacy_ams_taxonomy_id': '161', 'type': 'country', 'label': 'Palau', 'concept_id': 'Jtka_2NV_XGQ', 'legacy_ams_taxonomy_num_id': 161}),
( {'type': 'country', 'id': 'knPC_Zwn_w2t', 'preferred_label': 'Panama', 'deprecated_legacy_id': '162'},
'country', {'legacy_ams_taxonomy_id': '162', 'type': 'country', 'label': 'Panama', 'concept_id': 'knPC_Zwn_w2t', 'legacy_ams_taxonomy_num_id': 162}),
( {'type': 'country', 'id': 'VkNj_E4f_m93', 'preferred_label': 'Papua Nya Guinea', 'deprecated_legacy_id': '163'},
'country', {'legacy_ams_taxonomy_id': '163', 'type': 'country', 'label': 'Papua Nya Guinea', 'concept_id': 'VkNj_E4f_m93', 'legacy_ams_taxonomy_num_id': 163}),
( {'type': 'country', 'id': 'LRBs_ePE_o5F', 'preferred_label': 'Paraguay', 'deprecated_legacy_id': '164'},
'country', {'legacy_ams_taxonomy_id': '164', 'type': 'country', 'label': 'Paraguay', 'concept_id': 'LRBs_ePE_o5F', 'legacy_ams_taxonomy_num_id': 164}),
( {'type': 'country', 'id': 'qiLW_VZG_x3k', 'preferred_label': 'Peru', 'deprecated_legacy_id': '165'},
'country', {'legacy_ams_taxonomy_id': '165', 'type': 'country', 'label': 'Peru', 'concept_id': 'qiLW_VZG_x3k', 'legacy_ams_taxonomy_num_id': 165}),
( {'type': 'country', 'id': 'VJGs_3wz_vLw', 'preferred_label': 'Pitcairn', 'deprecated_legacy_id': '166'},
'country', {'legacy_ams_taxonomy_id': '166', 'type': 'country', 'label': 'Pitcairn', 'concept_id': 'VJGs_3wz_vLw', 'legacy_ams_taxonomy_num_id': 166}),
( {'type': 'country', 'id': 'EV41_7cy_jw7', 'preferred_label': 'Polen', 'deprecated_legacy_id': '167'},
'country', {'legacy_ams_taxonomy_id': '167', 'type': 'country', 'label': 'Polen', 'concept_id': 'EV41_7cy_jw7', 'legacy_ams_taxonomy_num_id': 167}),
( {'type': 'country', 'id': 'crVW_7oo_nLm', 'preferred_label': 'Portugal', 'deprecated_legacy_id': '168'},
'country', {'legacy_ams_taxonomy_id': '168', 'type': 'country', 'label': 'Portugal', 'concept_id': 'crVW_7oo_nLm', 'legacy_ams_taxonomy_num_id': 168}),
( {'type': 'country', 'id': 'SEbV_xRE_ZCF', 'preferred_label': 'Puerto Rico', 'deprecated_legacy_id': '169'},
'country', {'legacy_ams_taxonomy_id': '169', 'type': 'country', 'label': 'Puerto Rico', 'concept_id': 'SEbV_xRE_ZCF', 'legacy_ams_taxonomy_num_id': 169}),
( {'type': 'country', 'id': '76AC_UMd_YfA', 'preferred_label': 'Qatar', 'deprecated_legacy_id': '170'},
'country', {'legacy_ams_taxonomy_id': '170', 'type': 'country', 'label': 'Qatar', 'concept_id': '76AC_UMd_YfA', 'legacy_ams_taxonomy_num_id': 170}),
( {'type': 'country', 'id': '65UW_uMB_qMm', 'preferred_label': 'Reunion', 'deprecated_legacy_id': '171'},
'country', {'legacy_ams_taxonomy_id': '171', 'type': 'country', 'label': 'Reunion', 'concept_id': '65UW_uMB_qMm', 'legacy_ams_taxonomy_num_id': 171}),
( {'type': 'country', 'id': 't76b_fb1_WCi', 'preferred_label': 'Rumänien', 'deprecated_legacy_id': '172'},
'country', {'legacy_ams_taxonomy_id': '172', 'type': 'country', 'label': 'Rumänien', 'concept_id': 't76b_fb1_WCi', 'legacy_ams_taxonomy_num_id': 172}),
( {'type': 'country', 'id': '3Y4P_Upu_aWq', 'preferred_label': 'Rwanda', 'deprecated_legacy_id': '173'},
'country', {'legacy_ams_taxonomy_id': '173', 'type': 'country', 'label': 'Rwanda', 'concept_id': '3Y4P_Upu_aWq', 'legacy_ams_taxonomy_num_id': 173}),
( {'type': 'country', 'id': '24fF_htV_bs1', 'preferred_label': 'Ryssland/Ryska Federationen', 'deprecated_legacy_id': '174'},
'country', {'legacy_ams_taxonomy_id': '174', 'type': 'country', 'label': 'Ryssland/Ryska Federationen', 'concept_id': '24fF_htV_bs1', 'legacy_ams_taxonomy_num_id': 174}),
( {'type': 'country', 'id': 'taYQ_K5H_yRi', 'preferred_label': 'Saint Helena', 'deprecated_legacy_id': '175'},
'country', {'legacy_ams_taxonomy_id': '175', 'type': 'country', 'label': 'Saint Helena', 'concept_id': 'taYQ_K5H_yRi', 'legacy_ams_taxonomy_num_id': 175}),
( {'type': 'country', 'id': 'yrcR_Pps_5hd', 'preferred_label': 'Saint Kitts och Nevis', 'deprecated_legacy_id': '176'},
'country', {'legacy_ams_taxonomy_id': '176', 'type': 'country', 'label': 'Saint Kitts och Nevis', 'concept_id': 'yrcR_Pps_5hd', 'legacy_ams_taxonomy_num_id': 176}),
( {'type': 'country', 'id': 'Nq2U_CeR_qvC', 'preferred_label': 'Saint Lucia', 'deprecated_legacy_id': '177'},
'country', {'legacy_ams_taxonomy_id': '177', 'type': 'country', 'label': 'Saint Lucia', 'concept_id': 'Nq2U_CeR_qvC', 'legacy_ams_taxonomy_num_id': 177}),
( {'type': 'country', 'id': 'umJ8_fX9_XMg', 'preferred_label': 'Saint Pierre och Miquelon', 'deprecated_legacy_id': '178'},
'country', {'legacy_ams_taxonomy_id': '178', 'type': 'country', 'label': 'Saint Pierre och Miquelon', 'concept_id': 'umJ8_fX9_XMg', 'legacy_ams_taxonomy_num_id': 178}),
( {'type': 'country', 'id': 'avAF_tuR_8sR', 'preferred_label': 'Saint Vincent och Grenadinerna', 'deprecated_legacy_id': '179'},
'country', {'legacy_ams_taxonomy_id': '179', 'type': 'country', 'label': 'Saint Vincent och Grenadinerna', 'concept_id': 'avAF_tuR_8sR', 'legacy_ams_taxonomy_num_id': 179}),
( {'type': 'country', 'id': 'JWYP_wan_dVQ', 'preferred_label': 'Västsahara', 'deprecated_legacy_id': '180'},
'country', {'legacy_ams_taxonomy_id': '180', 'type': 'country', 'label': 'Västsahara', 'concept_id': 'JWYP_wan_dVQ', 'legacy_ams_taxonomy_num_id': 180}),
( {'type': 'country', 'id': 'hhAn_wpZ_8YQ', 'preferred_label': 'Salomonöarna', 'deprecated_legacy_id': '181'},
'country', {'legacy_ams_taxonomy_id': '181', 'type': 'country', 'label': 'Salomonöarna', 'concept_id': 'hhAn_wpZ_8YQ', 'legacy_ams_taxonomy_num_id': 181}),
( {'type': 'country', 'id': 'Kme6_ujn_tD4', 'preferred_label': 'San Marino', 'deprecated_legacy_id': '182'},
'country', {'legacy_ams_taxonomy_id': '182', 'type': 'country', 'label': 'San Marino', 'concept_id': 'Kme6_ujn_tD4', 'legacy_ams_taxonomy_num_id': 182}),
( {'type': 'country', 'id': 'CpWu_dFG_Lw3', 'preferred_label': 'São Tomé och Príncipe', 'deprecated_legacy_id': '183'},
'country', {'legacy_ams_taxonomy_id': '183', 'type': 'country', 'label': 'São Tomé och Príncipe', 'concept_id': 'CpWu_dFG_Lw3', 'legacy_ams_taxonomy_num_id': 183}),
( {'type': 'country', 'id': 'nKbk_boM_G1U', 'preferred_label': 'Saudiarabien', 'deprecated_legacy_id': '184'},
'country', {'legacy_ams_taxonomy_id': '184', 'type': 'country', 'label': 'Saudiarabien', 'concept_id': 'nKbk_boM_G1U', 'legacy_ams_taxonomy_num_id': 184}),
( {'type': 'country', 'id': 'Q78b_oCw_Yq2', 'preferred_label': 'Schweiz', 'deprecated_legacy_id': '185'},
'country', {'legacy_ams_taxonomy_id': '185', 'type': 'country', 'label': 'Schweiz', 'concept_id': 'Q78b_oCw_Yq2', 'legacy_ams_taxonomy_num_id': 185}),
( {'type': 'country', 'id': 'XWA9_zm8_DJu', 'preferred_label': 'Senegal', 'deprecated_legacy_id': '186'},
'country', {'legacy_ams_taxonomy_id': '186', 'type': 'country', 'label': 'Senegal', 'concept_id': 'XWA9_zm8_DJu', 'legacy_ams_taxonomy_num_id': 186}),
( {'type': 'country', 'id': '6UUy_rcP_KSp', 'preferred_label': 'Seychellerna', 'deprecated_legacy_id': '187'},
'country', {'legacy_ams_taxonomy_id': '187', 'type': 'country', 'label': 'Seychellerna', 'concept_id': '6UUy_rcP_KSp', 'legacy_ams_taxonomy_num_id': 187}),
( {'type': 'country', 'id': 'f8JX_cnY_7vt', 'preferred_label': 'Sierra Leone', 'deprecated_legacy_id': '188'},
'country', {'legacy_ams_taxonomy_id': '188', 'type': 'country', 'label': 'Sierra Leone', 'concept_id': 'f8JX_cnY_7vt', 'legacy_ams_taxonomy_num_id': 188}),
( {'type': 'country', 'id': 'TJLA_9GT_Wm8', 'preferred_label': 'Singapore', 'deprecated_legacy_id': '189'},
'country', {'legacy_ams_taxonomy_id': '189', 'type': 'country', 'label': 'Singapore', 'concept_id': 'TJLA_9GT_Wm8', 'legacy_ams_taxonomy_num_id': 189}),
( {'type': 'country', 'id': 'zu3V_aT3_KzE', 'preferred_label': 'Slovakien', 'deprecated_legacy_id': '190'},
'country', {'legacy_ams_taxonomy_id': '190', 'type': 'country', 'label': 'Slovakien', 'concept_id': 'zu3V_aT3_KzE', 'legacy_ams_taxonomy_num_id': 190}),
( {'type': 'country', 'id': 'UGMH_x68_T6m', 'preferred_label': 'Slovenien', 'deprecated_legacy_id': '191'},
'country', {'legacy_ams_taxonomy_id': '191', 'type': 'country', 'label': 'Slovenien', 'concept_id': 'UGMH_x68_T6m', 'legacy_ams_taxonomy_num_id': 191}),
( {'type': 'country', 'id': '1WZA_XkL_92R', 'preferred_label': 'Somalia', 'deprecated_legacy_id': '192'},
'country', {'legacy_ams_taxonomy_id': '192', 'type': 'country', 'label': 'Somalia', 'concept_id': '1WZA_XkL_92R', 'legacy_ams_taxonomy_num_id': 192}),
( {'type': 'country', 'id': 'bN7k_4ka_YGQ', 'preferred_label': 'Spanien', 'deprecated_legacy_id': '193'},
'country', {'legacy_ams_taxonomy_id': '193', 'type': 'country', 'label': 'Spanien', 'concept_id': 'bN7k_4ka_YGQ', 'legacy_ams_taxonomy_num_id': 193}),
( {'type': 'country', 'id': 'pQK1_3Gn_hPg', 'preferred_label': 'Sri Lanka', 'deprecated_legacy_id': '194'},
'country', {'legacy_ams_taxonomy_id': '194', 'type': 'country', 'label': 'Sri Lanka', 'concept_id': 'pQK1_3Gn_hPg', 'legacy_ams_taxonomy_num_id': 194}),
( {'type': 'country', 'id': '7wHq_Mri_wCt', 'preferred_label': 'Storbritannien och Nordirland', 'deprecated_legacy_id': '195'},
'country', {'legacy_ams_taxonomy_id': '195', 'type': 'country', 'label': 'Storbritannien och Nordirland', 'concept_id': '7wHq_Mri_wCt', 'legacy_ams_taxonomy_num_id': 195}),
( {'type': 'country', 'id': 'xjRk_KwZ_FSx', 'preferred_label': 'Sudan', 'deprecated_legacy_id': '196'},
'country', {'legacy_ams_taxonomy_id': '196', 'type': 'country', 'label': 'Sudan', 'concept_id': 'xjRk_KwZ_FSx', 'legacy_ams_taxonomy_num_id': 196}),
( {'type': 'country', 'id': 'xDZc_yza_2Tn', 'preferred_label': 'Surinam', 'deprecated_legacy_id': '197'},
'country', {'legacy_ams_taxonomy_id': '197', 'type': 'country', 'label': 'Surinam', 'concept_id': 'xDZc_yza_2Tn', 'legacy_ams_taxonomy_num_id': 197}),
( {'type': 'country', 'id': '8gs6_Na1_VVw', 'preferred_label': 'Svalbard och Jan Mayen', 'deprecated_legacy_id': '198'},
'country', {'legacy_ams_taxonomy_id': '198', 'type': 'country', 'label': 'Svalbard och Jan Mayen', 'concept_id': '8gs6_Na1_VVw', 'legacy_ams_taxonomy_num_id': 198}),
( {'type': 'country', 'id': 'i46j_HmG_v64', 'preferred_label': 'Sverige', 'deprecated_legacy_id': '199'},
'country', {'legacy_ams_taxonomy_id': '199', 'type': 'country', 'label': 'Sverige', 'concept_id': 'i46j_HmG_v64', 'legacy_ams_taxonomy_num_id': 199}),
( {'type': 'country', 'id': '8uqC_JpJ_cbM', 'preferred_label': 'Swaziland', 'deprecated_legacy_id': '200'},
'country', {'legacy_ams_taxonomy_id': '200', 'type': 'country', 'label': 'Swaziland', 'concept_id': '8uqC_JpJ_cbM', 'legacy_ams_taxonomy_num_id': 200}),
( {'type': 'country', 'id': '8TSL_ZL7_E5p', 'preferred_label': 'Sydafrika', 'deprecated_legacy_id': '201'},
'country', {'legacy_ams_taxonomy_id': '201', 'type': 'country', 'label': 'Sydafrika', 'concept_id': '8TSL_ZL7_E5p', 'legacy_ams_taxonomy_num_id': 201}),
( {'type': 'country', 'id': 'KRyt_Bj8_vWZ', 'preferred_label': 'Sydgeorgien och Södra Sandwichöarna', 'deprecated_legacy_id': '202'},
'country', {'legacy_ams_taxonomy_id': '202', 'type': 'country', 'label': 'Sydgeorgien och Södra Sandwichöarna', 'concept_id': 'KRyt_Bj8_vWZ', 'legacy_ams_taxonomy_num_id': 202}),
( {'type': 'country', 'id': 'Vkhm_P1M_BzE', 'preferred_label': 'Syrien', 'deprecated_legacy_id': '203'},
'country', {'legacy_ams_taxonomy_id': '203', 'type': 'country', 'label': 'Syrien', 'concept_id': 'Vkhm_P1M_BzE', 'legacy_ams_taxonomy_num_id': 203}),
( {'type': 'country', 'id': 'MdqM_dHv_9Rd', 'preferred_label': 'Tadzjikistan', 'deprecated_legacy_id': '204'},
'country', {'legacy_ams_taxonomy_id': '204', 'type': 'country', 'label': 'Tadzjikistan', 'concept_id': 'MdqM_dHv_9Rd', 'legacy_ams_taxonomy_num_id': 204}),
( {'type': 'country', 'id': 'HdNx_QfU_ALG', 'preferred_label': 'Taiwan', 'deprecated_legacy_id': '205'},
'country', {'legacy_ams_taxonomy_id': '205', 'type': 'country', 'label': 'Taiwan', 'concept_id': 'HdNx_QfU_ALG', 'legacy_ams_taxonomy_num_id': 205}),
( {'type': 'country', 'id': 'A1hv_Ljz_fUi', 'preferred_label': 'Tanzania', 'deprecated_legacy_id': '206'},
'country', {'legacy_ams_taxonomy_id': '206', 'type': 'country', 'label': 'Tanzania', 'concept_id': 'A1hv_Ljz_fUi', 'legacy_ams_taxonomy_num_id': 206}),
( {'type': 'country', 'id': 'xscm_4AC_j8o', 'preferred_label': 'Tchad', 'deprecated_legacy_id': '207'},
'country', {'legacy_ams_taxonomy_id': '207', 'type': 'country', 'label': 'Tchad', 'concept_id': 'xscm_4AC_j8o', 'legacy_ams_taxonomy_num_id': 207}),
( {'type': 'country', 'id': 'Sxx2_SZe_Krs', 'preferred_label': 'Thailand', 'deprecated_legacy_id': '208'},
'country', {'legacy_ams_taxonomy_id': '208', 'type': 'country', 'label': 'Thailand', 'concept_id': 'Sxx2_SZe_Krs', 'legacy_ams_taxonomy_num_id': 208}),
( {'type': 'country', 'id': '7qR2_55U_iyh', 'preferred_label': 'Tjeckien', 'deprecated_legacy_id': '209'},
'country', {'legacy_ams_taxonomy_id': '209', 'type': 'country', 'label': 'Tjeckien', 'concept_id': '7qR2_55U_iyh', 'legacy_ams_taxonomy_num_id': 209}),
( {'type': 'country', 'id': 'yD6Z_Jiw_xm2', 'preferred_label': 'Togo', 'deprecated_legacy_id': '210'},
'country', {'legacy_ams_taxonomy_id': '210', 'type': 'country', 'label': 'Togo', 'concept_id': 'yD6Z_Jiw_xm2', 'legacy_ams_taxonomy_num_id': 210}),
( {'type': 'country', 'id': 'ywtd_6fW_Eue', 'preferred_label': 'Tokelau', 'deprecated_legacy_id': '211'},
'country', {'legacy_ams_taxonomy_id': '211', 'type': 'country', 'label': 'Tokelau', 'concept_id': 'ywtd_6fW_Eue', 'legacy_ams_taxonomy_num_id': 211}),
( {'type': 'country', 'id': 'd6ce_nB8_LaP', 'preferred_label': 'Tonga', 'deprecated_legacy_id': '212'},
'country', {'legacy_ams_taxonomy_id': '212', 'type': 'country', 'label': 'Tonga', 'concept_id': 'd6ce_nB8_LaP', 'legacy_ams_taxonomy_num_id': 212}),
( {'type': 'country', 'id': 'WyNg_Ae1_hWd', 'preferred_label': 'Trinidad och Tobago', 'deprecated_legacy_id': '213'},
'country', {'legacy_ams_taxonomy_id': '213', 'type': 'country', 'label': 'Trinidad och Tobago', 'concept_id': 'WyNg_Ae1_hWd', 'legacy_ams_taxonomy_num_id': 213}),
( {'type': 'country', 'id': 'oCfK_4fN_DEE', 'preferred_label': 'Tunisien', 'deprecated_legacy_id': '214'},
'country', {'legacy_ams_taxonomy_id': '214', 'type': 'country', 'label': 'Tunisien', 'concept_id': 'oCfK_4fN_DEE', 'legacy_ams_taxonomy_num_id': 214}),
( {'type': 'country', 'id': 'YpWA_xv7_Qmr', 'preferred_label': 'Turkiet', 'deprecated_legacy_id': '215'},
'country', {'legacy_ams_taxonomy_id': '215', 'type': 'country', 'label': 'Turkiet', 'concept_id': 'YpWA_xv7_Qmr', 'legacy_ams_taxonomy_num_id': 215}),
( {'type': 'country', 'id': 'gUPX_Q1E_aNc', 'preferred_label': 'Turkmenistan', 'deprecated_legacy_id': '216'},
'country', {'legacy_ams_taxonomy_id': '216', 'type': 'country', 'label': 'Turkmenistan', 'concept_id': 'gUPX_Q1E_aNc', 'legacy_ams_taxonomy_num_id': 216}),
( {'type': 'country', 'id': 'dHjg_a8H_kHA', 'preferred_label': 'Turks- och Caicosöarna', 'deprecated_legacy_id': '217'},
'country', {'legacy_ams_taxonomy_id': '217', 'type': 'country', 'label': 'Turks- och Caicosöarna', 'concept_id': 'dHjg_a8H_kHA', 'legacy_ams_taxonomy_num_id': 217}),
( {'type': 'country', 'id': 'eSp2_gR8_EBG', 'preferred_label': 'Tuvalu', 'deprecated_legacy_id': '218'},
'country', {'legacy_ams_taxonomy_id': '218', 'type': 'country', 'label': 'Tuvalu', 'concept_id': 'eSp2_gR8_EBG', 'legacy_ams_taxonomy_num_id': 218}),
( {'type': 'country', 'id': 'G3M7_959_8Pp', 'preferred_label': 'Tyskland', 'deprecated_legacy_id': '219'},
'country', {'legacy_ams_taxonomy_id': '219', 'type': 'country', 'label': 'Tyskland', 'concept_id': 'G3M7_959_8Pp', 'legacy_ams_taxonomy_num_id': 219}),
( {'type': 'country', 'id': 'GwGd_ukJ_qsx', 'preferred_label': 'Förenta staterna (Amerikas förenta stater)', 'deprecated_legacy_id': '220'},
'country', {'legacy_ams_taxonomy_id': '220', 'type': 'country', 'label': 'Förenta staterna (Amerikas förenta stater)', 'concept_id': 'GwGd_ukJ_qsx', 'legacy_ams_taxonomy_num_id': 220}),
( {'type': 'country', 'id': 'VXZG_btz_6N3', 'preferred_label': 'Uganda', 'deprecated_legacy_id': '221'},
'country', {'legacy_ams_taxonomy_id': '221', 'type': 'country', 'label': 'Uganda', 'concept_id': 'VXZG_btz_6N3', 'legacy_ams_taxonomy_num_id': 221}),
( {'type': 'country', 'id': 'GmdR_egb_EWJ', 'preferred_label': 'Ukraina', 'deprecated_legacy_id': '222'},
'country', {'legacy_ams_taxonomy_id': '222', 'type': 'country', 'label': 'Ukraina', 'concept_id': 'GmdR_egb_EWJ', 'legacy_ams_taxonomy_num_id': 222}),
( {'type': 'country', 'id': 'QWsJ_QBW_vGb', 'preferred_label': 'Ungern', 'deprecated_legacy_id': '223'},
'country', {'legacy_ams_taxonomy_id': '223', 'type': 'country', 'label': 'Ungern', 'concept_id': 'QWsJ_QBW_vGb', 'legacy_ams_taxonomy_num_id': 223}),
( {'type': 'country', 'id': 'QAsK_uc2_8yJ', 'preferred_label': 'Uruguay', 'deprecated_legacy_id': '224'},
'country', {'legacy_ams_taxonomy_id': '224', 'type': 'country', 'label': 'Uruguay', 'concept_id': 'QAsK_uc2_8yJ', 'legacy_ams_taxonomy_num_id': 224}),
( {'type': 'country', 'id': 'TAAP_kv5_V6g', 'preferred_label': 'Uzbekistan', 'deprecated_legacy_id': '225'},
'country', {'legacy_ams_taxonomy_id': '225', 'type': 'country', 'label': 'Uzbekistan', 'concept_id': 'TAAP_kv5_V6g', 'legacy_ams_taxonomy_num_id': 225}),
( {'type': 'country', 'id': 'm2x5_LAT_X2t', 'preferred_label': 'Vanuatu', 'deprecated_legacy_id': '226'},
'country', {'legacy_ams_taxonomy_id': '226', 'type': 'country', 'label': 'Vanuatu', 'concept_id': 'm2x5_LAT_X2t', 'legacy_ams_taxonomy_num_id': 226}),
( {'type': 'country', 'id': 'DDSg_45a_2Qi', 'preferred_label': 'Heliga stolen (Vatikanstaten)', 'deprecated_legacy_id': '227'},
'country', {'legacy_ams_taxonomy_id': '227', 'type': 'country', 'label': 'Heliga stolen (Vatikanstaten)', 'concept_id': 'DDSg_45a_2Qi', 'legacy_ams_taxonomy_num_id': 227}),
( {'type': 'country', 'id': '2YeU_EST_ykA', 'preferred_label': 'Venezuela', 'deprecated_legacy_id': '228'},
'country', {'legacy_ams_taxonomy_id': '228', 'type': 'country', 'label': 'Venezuela', 'concept_id': '2YeU_EST_ykA', 'legacy_ams_taxonomy_num_id': 228}),
( {'type': 'country', 'id': '7RXF_Wx9_mfY', 'preferred_label': 'Vietnam', 'deprecated_legacy_id': '229'},
'country', {'legacy_ams_taxonomy_id': '229', 'type': 'country', 'label': 'Vietnam', 'concept_id': '7RXF_Wx9_mfY', 'legacy_ams_taxonomy_num_id': 229}),
( {'type': 'country', 'id': '9QXG_KJN_ZVN', 'preferred_label': 'Vitryssland', 'deprecated_legacy_id': '230'},
'country', {'legacy_ams_taxonomy_id': '230', 'type': 'country', 'label': 'Vitryssland', 'concept_id': '9QXG_KJN_ZVN', 'legacy_ams_taxonomy_num_id': 230}),
( {'type': 'country', 'id': 'PpbT_Psw_2Qy', 'preferred_label': 'Jemen', 'deprecated_legacy_id': '232'},
'country', {'legacy_ams_taxonomy_id': '232', 'type': 'country', 'label': 'Jemen', 'concept_id': 'PpbT_Psw_2Qy', 'legacy_ams_taxonomy_num_id': 232}),
( {'type': 'country', 'id': 'buDY_D5p_DAc', 'preferred_label': 'Zambia', 'deprecated_legacy_id': '234'},
'country', {'legacy_ams_taxonomy_id': '234', 'type': 'country', 'label': 'Zambia', 'concept_id': 'buDY_D5p_DAc', 'legacy_ams_taxonomy_num_id': 234}),
( {'type': 'country', 'id': 'K2Kh_K4w_NLF', 'preferred_label': 'Zimbabwe', 'deprecated_legacy_id': '235'},
'country', {'legacy_ams_taxonomy_id': '235', 'type': 'country', 'label': 'Zimbabwe', 'concept_id': 'K2Kh_K4w_NLF', 'legacy_ams_taxonomy_num_id': 235}),
( {'type': 'country', 'id': 'uZex_hVg_jPf', 'preferred_label': 'Österrike', 'deprecated_legacy_id': '236'},
'country', {'legacy_ams_taxonomy_id': '236', 'type': 'country', 'label': 'Österrike', 'concept_id': 'uZex_hVg_jPf', 'legacy_ams_taxonomy_num_id': 236}),
( {'type': 'country', 'id': 'nziP_X84_aBA', 'preferred_label': 'Östtimor', 'deprecated_legacy_id': '237'},
'country', {'legacy_ams_taxonomy_id': '237', 'type': 'country', 'label': 'Östtimor', 'concept_id': 'nziP_X84_aBA', 'legacy_ams_taxonomy_num_id': 237}),
( {'type': 'country', 'id': 'Yfec_Cw6_Ejz', 'preferred_label': 'Kongo, demokratiska republiken', 'deprecated_legacy_id': '238'},
'country', {'legacy_ams_taxonomy_id': '238', 'type': 'country', 'label': 'Kongo, demokratiska republiken', 'concept_id': 'Yfec_Cw6_Ejz', 'legacy_ams_taxonomy_num_id': 238}),
( {'type': 'country', 'id': 'qi2S_K8c_Kn6', 'preferred_label': 'Nordmakedonien', 'deprecated_legacy_id': '239'},
'country', {'legacy_ams_taxonomy_id': '239', 'type': 'country', 'label': 'Nordmakedonien', 'concept_id': 'qi2S_K8c_Kn6', 'legacy_ams_taxonomy_num_id': 239}),
( {'type': 'country', 'id': 'qrQX_cxS_t7P', 'preferred_label': 'Palestina', 'deprecated_legacy_id': '240'},
'country', {'legacy_ams_taxonomy_id': '240', 'type': 'country', 'label': 'Palestina', 'concept_id': 'qrQX_cxS_t7P', 'legacy_ams_taxonomy_num_id': 240}),
( {'type': 'country', 'id': 'G7zY_fB5_zg4', 'preferred_label': 'Wallis och Futuna', 'deprecated_legacy_id': '241'},
'country', {'legacy_ams_taxonomy_id': '241', 'type': 'country', 'label': 'Wallis och Futuna', 'concept_id': 'G7zY_fB5_zg4', 'legacy_ams_taxonomy_num_id': 241}),
( {'type': 'country', 'id': 'nFvs_pbn_aia', 'preferred_label': 'Angola', 'deprecated_legacy_id': '242'},
'country', {'legacy_ams_taxonomy_id': '242', 'type': 'country', 'label': 'Angola', 'concept_id': 'nFvs_pbn_aia', 'legacy_ams_taxonomy_num_id': 242}),
( {'type': 'country', 'id': 'WNSF_XBA_piV', 'preferred_label': 'Franska Guyana', 'deprecated_legacy_id': '243'},
'country', {'legacy_ams_taxonomy_id': '243', 'type': 'country', 'label': 'Franska Guyana', 'concept_id': 'WNSF_XBA_piV', 'legacy_ams_taxonomy_num_id': 243}),
( {'type': 'country', 'id': 'K6sm_uW6_Lch', 'preferred_label': 'Samoa', 'deprecated_legacy_id': '244'},
'country', {'legacy_ams_taxonomy_id': '244', 'type': 'country', 'label': 'Samoa', 'concept_id': 'K6sm_uW6_Lch', 'legacy_ams_taxonomy_num_id': 244}),
( {'type': 'country', 'id': 'amTW_Ebm_ejQ', 'preferred_label': 'Serbien', 'deprecated_legacy_id': '245'},
'country', {'legacy_ams_taxonomy_id': '245', 'type': 'country', 'label': 'Serbien', 'concept_id': 'amTW_Ebm_ejQ', 'legacy_ams_taxonomy_num_id': 245}),
( {'type': 'country', 'id': 'bUNp_6HW_Vbn', 'preferred_label': 'Åland (tillhör Finland)', 'deprecated_legacy_id': '246'},
'country', {'legacy_ams_taxonomy_id': '246', 'type': 'country', 'label': 'Åland (tillhör Finland)', 'concept_id': 'bUNp_6HW_Vbn', 'legacy_ams_taxonomy_num_id': 246}),
( {'type': 'country', 'id': '5zrc_Su8_X4D', 'preferred_label': 'Guernsey', 'deprecated_legacy_id': '247'},
'country', {'legacy_ams_taxonomy_id': '247', 'type': 'country', 'label': 'Guernsey', 'concept_id': '5zrc_Su8_X4D', 'legacy_ams_taxonomy_num_id': 247}),
( {'type': 'country', 'id': 'BApY_3G4_Nsb', 'preferred_label': 'Isle of Man', 'deprecated_legacy_id': '248'},
'country', {'legacy_ams_taxonomy_id': '248', 'type': 'country', 'label': 'Isle of Man', 'concept_id': 'BApY_3G4_Nsb', 'legacy_ams_taxonomy_num_id': 248}),
( {'type': 'country', 'id': 'ihaN_Ru8_mPg', 'preferred_label': 'Jersey', 'deprecated_legacy_id': '249'},
'country', {'legacy_ams_taxonomy_id': '249', 'type': 'country', 'label': 'Jersey', 'concept_id': 'ihaN_Ru8_mPg', 'legacy_ams_taxonomy_num_id': 249}),
( {'type': 'country', 'id': 'vZtV_pRR_Evp', 'preferred_label': 'Montenegro', 'deprecated_legacy_id': '250'},
'country', {'legacy_ams_taxonomy_id': '250', 'type': 'country', 'label': 'Montenegro', 'concept_id': 'vZtV_pRR_Evp', 'legacy_ams_taxonomy_num_id': 250}),
( {'type': 'country', 'id': 'iJho_QUP_eaC', 'preferred_label': 'Kosovo', 'deprecated_legacy_id': '251'},
'country', {'legacy_ams_taxonomy_id': '251', 'type': 'country', 'label': 'Kosovo', 'concept_id': 'iJho_QUP_eaC', 'legacy_ams_taxonomy_num_id': 251}),
( {'type': 'country', 'id': 'tNTV_qrs_awt', 'preferred_label': 'Saint Barthélemy', 'deprecated_legacy_id': '252'},
'country', {'legacy_ams_taxonomy_id': '252', 'type': 'country', 'label': 'Saint Barthélemy', 'concept_id': 'tNTV_qrs_awt', 'legacy_ams_taxonomy_num_id': 252}),
( {'type': 'country', 'id': 'Ynjj_eeN_fM6', 'preferred_label': 'Saint Martin (franska delen)', 'deprecated_legacy_id': '253'},
'country', {'legacy_ams_taxonomy_id': '253', 'type': 'country', 'label': 'Saint Martin (franska delen)', 'concept_id': 'Ynjj_eeN_fM6', 'legacy_ams_taxonomy_num_id': 253}),
( {'type': 'country', 'id': 'CSwg_jk9_P5S', 'preferred_label': 'Bonaire, Sint Eustatius och Saba', 'deprecated_legacy_id': '254'},
'country', {'legacy_ams_taxonomy_id': '254', 'type': 'country', 'label': 'Bonaire, Sint Eustatius och Saba', 'concept_id': 'CSwg_jk9_P5S', 'legacy_ams_taxonomy_num_id': 254}),
( {'type': 'country', 'id': 'XPvX_7KR_UsM', 'preferred_label': 'Curaçao', 'deprecated_legacy_id': '255'},
'country', {'legacy_ams_taxonomy_id': '255', 'type': 'country', 'label': 'Curaçao', 'concept_id': 'XPvX_7KR_UsM', 'legacy_ams_taxonomy_num_id': 255}),
( {'type': 'country', 'id': 'sGcM_zCn_iGQ', 'preferred_label': 'Sint Maarten (nederländska delen)', 'deprecated_legacy_id': '256'},
'country', {'legacy_ams_taxonomy_id': '256', 'type': 'country', 'label': 'Sint Maarten (nederländska delen)', 'concept_id': 'sGcM_zCn_iGQ', 'legacy_ams_taxonomy_num_id': 256}),
( {'type': 'country', 'id': 'aqxj_t1i_SxL', 'preferred_label': 'Sydsudan', 'deprecated_legacy_id': '257'},
'country', {'legacy_ams_taxonomy_id': '257', 'type': 'country', 'label': 'Sydsudan', 'concept_id': 'aqxj_t1i_SxL', 'legacy_ams_taxonomy_num_id': 257}),
( {'type': 'worktime-extent', 'id': '6YE1_gAC_R2G', 'preferred_label': 'Heltid', 'deprecated_legacy_id': '1'},
'worktime-extent', {'legacy_ams_taxonomy_id': '1', 'type': 'worktime-extent', 'label': 'Heltid', 'concept_id': '6YE1_gAC_R2G', 'legacy_ams_taxonomy_num_id': 1}),
( {'type': 'worktime-extent', 'id': '947z_JGS_Uk2', 'preferred_label': 'Deltid', 'deprecated_legacy_id': '2'},
'worktime-extent', {'legacy_ams_taxonomy_id': '2', 'type': 'worktime-extent', 'label': 'Deltid', 'concept_id': '947z_JGS_Uk2', 'legacy_ams_taxonomy_num_id': 2}),
( {'type': 'language', 'id': '5vWL_41L_udS', 'preferred_label': 'Afar', 'deprecated_legacy_id': '239'},
'language', {'legacy_ams_taxonomy_id': '239', 'type': 'language', 'label': 'Afar', 'concept_id': '5vWL_41L_udS', 'legacy_ams_taxonomy_num_id': 239}),
( {'type': 'language', 'id': 'vitY_dty_VbD', 'preferred_label': 'Afrikaans', 'deprecated_legacy_id': '240'},
'language', {'legacy_ams_taxonomy_id': '240', 'type': 'language', 'label': 'Afrikaans', 'concept_id': 'vitY_dty_VbD', 'legacy_ams_taxonomy_num_id': 240}),
( {'type': 'language', 'id': '7xZB_9BJ_eLa', 'preferred_label': 'Akan', 'deprecated_legacy_id': '242'},
'language', {'legacy_ams_taxonomy_id': '242', 'type': 'language', 'label': 'Akan', 'concept_id': '7xZB_9BJ_eLa', 'legacy_ams_taxonomy_num_id': 242}),
( {'type': 'language', 'id': 'rod1_aPk_8V5', 'preferred_label': 'Albanska', 'deprecated_legacy_id': '243'},
'language', {'legacy_ams_taxonomy_id': '243', 'type': 'language', 'label': 'Albanska', 'concept_id': 'rod1_aPk_8V5', 'legacy_ams_taxonomy_num_id': 243}),
( {'type': 'language', 'id': 'EMhG_wnR_hYP', 'preferred_label': 'Amhariska', 'deprecated_legacy_id': '245'},
'language', {'legacy_ams_taxonomy_id': '245', 'type': 'language', 'label': 'Amhariska', 'concept_id': 'EMhG_wnR_hYP', 'legacy_ams_taxonomy_num_id': 245}),
( {'type': 'language', 'id': '3iEY_RGP_qXq', 'preferred_label': 'Arabiska', 'deprecated_legacy_id': '247'},
'language', {'legacy_ams_taxonomy_id': '247', 'type': 'language', 'label': 'Arabiska', 'concept_id': '3iEY_RGP_qXq', 'legacy_ams_taxonomy_num_id': 247}),
( {'type': 'language', 'id': 'Hk93_QrC_QXX', 'preferred_label': 'Arameiska', 'deprecated_legacy_id': '248'},
'language', {'legacy_ams_taxonomy_id': '248', 'type': 'language', 'label': 'Arameiska', 'concept_id': 'Hk93_QrC_QXX', 'legacy_ams_taxonomy_num_id': 248}),
( {'type': 'language', 'id': 'jsQe_Bra_Ety', 'preferred_label': 'Armeniska', 'deprecated_legacy_id': '249'},
'language', {'legacy_ams_taxonomy_id': '249', 'type': 'language', 'label': 'Armeniska', 'concept_id': 'jsQe_Bra_Ety', 'legacy_ams_taxonomy_num_id': 249}),
( {'type': 'language', 'id': 'zYgB_czd_R1x', 'preferred_label': 'Assamesiska', 'deprecated_legacy_id': '250'},
'language', {'legacy_ams_taxonomy_id': '250', 'type': 'language', 'label': 'Assamesiska', 'concept_id': 'zYgB_czd_R1x', 'legacy_ams_taxonomy_num_id': 250}),
( {'type': 'language', 'id': 'Lg2z_RbL_A8S', 'preferred_label': 'Aymara', 'deprecated_legacy_id': '251'},
'language', {'legacy_ams_taxonomy_id': '251', 'type': 'language', 'label': 'Aymara', 'concept_id': 'Lg2z_RbL_A8S', 'legacy_ams_taxonomy_num_id': 251}),
( {'type': 'language', 'id': 'J16c_pLE_QY4', 'preferred_label': 'Azerbajdzjanska', 'deprecated_legacy_id': '252'},
'language', {'legacy_ams_taxonomy_id': '252', 'type': 'language', 'label': 'Azerbajdzjanska', 'concept_id': 'J16c_pLE_QY4', 'legacy_ams_taxonomy_num_id': 252}),
( {'type': 'language', 'id': 'TJsR_11M_d72', 'preferred_label': 'Baluchiska', 'deprecated_legacy_id': '253'},
'language', {'legacy_ams_taxonomy_id': '253', 'type': 'language', 'label': 'Baluchiska', 'concept_id': 'TJsR_11M_d72', 'legacy_ams_taxonomy_num_id': 253}),
( {'type': 'language', 'id': 'T3Yk_ZEt_kLQ', 'preferred_label': 'Bambara', 'deprecated_legacy_id': '254'},
'language', {'legacy_ams_taxonomy_id': '254', 'type': 'language', 'label': 'Bambara', 'concept_id': 'T3Yk_ZEt_kLQ', 'legacy_ams_taxonomy_num_id': 254}),
( {'type': 'language', 'id': 'X5sT_hmN_m2S', 'preferred_label': 'Banda', 'deprecated_legacy_id': '255'},
'language', {'legacy_ams_taxonomy_id': '255', 'type': 'language', 'label': 'Banda', 'concept_id': 'X5sT_hmN_m2S', 'legacy_ams_taxonomy_num_id': 255}),
( {'type': 'language', 'id': 'udrA_ZMS_epP', 'preferred_label': 'Bantuspråk, andra', 'deprecated_legacy_id': '256'},
'language', {'legacy_ams_taxonomy_id': '256', 'type': 'language', 'label': 'Bantuspråk, andra', 'concept_id': 'udrA_ZMS_epP', 'legacy_ams_taxonomy_num_id': 256}),
( {'type': 'language', 'id': 'yPxq_rk8_QqY', 'preferred_label': 'Basjkiriska', 'deprecated_legacy_id': '257'},
'language', {'legacy_ams_taxonomy_id': '257', 'type': 'language', 'label': 'Basjkiriska', 'concept_id': 'yPxq_rk8_QqY', 'legacy_ams_taxonomy_num_id': 257}),
( {'type': 'language', 'id': 'rucj_CJq_mV8', 'preferred_label': 'Baskiska', 'deprecated_legacy_id': '258'},
'language', {'legacy_ams_taxonomy_id': '258', 'type': 'language', 'label': 'Baskiska', 'concept_id': 'rucj_CJq_mV8', 'legacy_ams_taxonomy_num_id': 258}),
( {'type': 'language', 'id': 'nc4p_BwA_2HH', 'preferred_label': 'Bemba', 'deprecated_legacy_id': '259'},
'language', {'legacy_ams_taxonomy_id': '259', 'type': 'language', 'label': 'Bemba', 'concept_id': 'nc4p_BwA_2HH', 'legacy_ams_taxonomy_num_id': 259}),
( {'type': 'language', 'id': 'GBG3_87R_ux1', 'preferred_label': 'Bengaliska', 'deprecated_legacy_id': '260'},
'language', {'legacy_ams_taxonomy_id': '260', 'type': 'language', 'label': 'Bengaliska', 'concept_id': 'GBG3_87R_ux1', 'legacy_ams_taxonomy_num_id': 260}),
( {'type': 'language', 'id': 'QTC1_ADL_T85', 'preferred_label': 'Berberspråk, andra', 'deprecated_legacy_id': '261'},
'language', {'legacy_ams_taxonomy_id': '261', 'type': 'language', 'label': 'Berberspråk, andra', 'concept_id': 'QTC1_ADL_T85', 'legacy_ams_taxonomy_num_id': 261}),
( {'type': 'language', 'id': 'Ur91_w7s_dP1', 'preferred_label': 'Bislama', 'deprecated_legacy_id': '262'},
'language', {'legacy_ams_taxonomy_id': '262', 'type': 'language', 'label': 'Bislama', 'concept_id': 'Ur91_w7s_dP1', 'legacy_ams_taxonomy_num_id': 262}),
( {'type': 'language', 'id': '9TLR_Ri9_34C', 'preferred_label': 'Bihariska', 'deprecated_legacy_id': '263'},
'language', {'legacy_ams_taxonomy_id': '263', 'type': 'language', 'label': 'Bihariska', 'concept_id': '9TLR_Ri9_34C', 'legacy_ams_taxonomy_num_id': 263}),
( {'type': 'language', 'id': 'AGKq_3n1_4sm', 'preferred_label': 'Bosniska', 'deprecated_legacy_id': '265'},
'language', {'legacy_ams_taxonomy_id': '265', 'type': 'language', 'label': 'Bosniska', 'concept_id': 'AGKq_3n1_4sm', 'legacy_ams_taxonomy_num_id': 265}),
( {'type': 'language', 'id': 'pW4U_gcW_VGv', 'preferred_label': 'Bulgariska', 'deprecated_legacy_id': '266'},
'language', {'legacy_ams_taxonomy_id': '266', 'type': 'language', 'label': 'Bulgariska', 'concept_id': 'pW4U_gcW_VGv', 'legacy_ams_taxonomy_num_id': 266}),
( {'type': 'language', 'id': 'yHFe_Te6_E6F', 'preferred_label': 'Burmesiska', 'deprecated_legacy_id': '267'},
'language', {'legacy_ams_taxonomy_id': '267', 'type': 'language', 'label': 'Burmesiska', 'concept_id': 'yHFe_Te6_E6F', 'legacy_ams_taxonomy_num_id': 267}),
( {'type': 'language', 'id': 'y89C_Uia_Y5j', 'preferred_label': 'Cebuano', 'deprecated_legacy_id': '269'},
'language', {'legacy_ams_taxonomy_id': '269', 'type': 'language', 'label': 'Cebuano', 'concept_id': 'y89C_Uia_Y5j', 'legacy_ams_taxonomy_num_id': 269}),
( {'type': 'language', 'id': 'yGZ2_39H_oPN', 'preferred_label': 'Danska', 'deprecated_legacy_id': '274'},
'language', {'legacy_ams_taxonomy_id': '274', 'type': 'language', 'label': 'Danska', 'concept_id': 'yGZ2_39H_oPN', 'legacy_ams_taxonomy_num_id': 274}),
( {'type': 'language', 'id': 'ov2k_GtY_wDw', 'preferred_label': 'Dinka', 'deprecated_legacy_id': '277'},
'language', {'legacy_ams_taxonomy_id': '277', 'type': 'language', 'label': 'Dinka', 'concept_id': 'ov2k_GtY_wDw', 'legacy_ams_taxonomy_num_id': 277}),
( {'type': 'language', 'id': 'XFGV_NHd_eaf', 'preferred_label': 'Divehi', 'deprecated_legacy_id': '278'},
'language', {'legacy_ams_taxonomy_id': '278', 'type': 'language', 'label': 'Divehi', 'concept_id': 'XFGV_NHd_eaf', 'legacy_ams_taxonomy_num_id': 278}),
( {'type': 'language', 'id': '1bwY_BGf_CH7', 'preferred_label': 'Dyula', 'deprecated_legacy_id': '280'},
'language', {'legacy_ams_taxonomy_id': '280', 'type': 'language', 'label': 'Dyula', 'concept_id': '1bwY_BGf_CH7', 'legacy_ams_taxonomy_num_id': 280}),
( {'type': 'language', 'id': '8RMF_7gP_NaH', 'preferred_label': 'Bhutanesiska', 'deprecated_legacy_id': '281'},
'language', {'legacy_ams_taxonomy_id': '281', 'type': 'language', 'label': 'Bhutanesiska', 'concept_id': '8RMF_7gP_NaH', 'legacy_ams_taxonomy_num_id': 281}),
( {'type': 'language', 'id': 'Vfz9_yba_MkG', 'preferred_label': 'Efik', 'deprecated_legacy_id': '282'},
'language', {'legacy_ams_taxonomy_id': '282', 'type': 'language', 'label': 'Efik', 'concept_id': 'Vfz9_yba_MkG', 'legacy_ams_taxonomy_num_id': 282}),
( {'type': 'language', 'id': 'NVxJ_hLg_TYS', 'preferred_label': 'Engelska', 'deprecated_legacy_id': '283'},
'language', {'legacy_ams_taxonomy_id': '283', 'type': 'language', 'label': 'Engelska', 'concept_id': 'NVxJ_hLg_TYS', 'legacy_ams_taxonomy_num_id': 283}),
( {'type': 'language', 'id': 'zg1P_hzq_eMR', 'preferred_label': 'Estniska', 'deprecated_legacy_id': '285'},
'language', {'legacy_ams_taxonomy_id': '285', 'type': 'language', 'label': 'Estniska', 'concept_id': 'zg1P_hzq_eMR', 'legacy_ams_taxonomy_num_id': 285}),
( {'type': 'language', 'id': '5FUu_wLF_tTf', 'preferred_label': 'Ewe', 'deprecated_legacy_id': '286'},
'language', {'legacy_ams_taxonomy_id': '286', 'type': 'language', 'label': 'Ewe', 'concept_id': '5FUu_wLF_tTf', 'legacy_ams_taxonomy_num_id': 286}),
( {'type': 'language', 'id': 'L4AS_T9o_VwB', 'preferred_label': 'Fang', 'deprecated_legacy_id': '287'},
'language', {'legacy_ams_taxonomy_id': '287', 'type': 'language', 'label': 'Fang', 'concept_id': 'L4AS_T9o_VwB', 'legacy_ams_taxonomy_num_id': 287}),
( {'type': 'language', 'id': 'WTZi_v28_Unh', 'preferred_label': 'Fanti', 'deprecated_legacy_id': '288'},
'language', {'legacy_ams_taxonomy_id': '288', 'type': 'language', 'label': 'Fanti', 'concept_id': 'WTZi_v28_Unh', 'legacy_ams_taxonomy_num_id': 288}),
( {'type': 'language', 'id': 'j4rH_cw8_s7g', 'preferred_label': 'Färöiska', 'deprecated_legacy_id': '289'},
'language', {'legacy_ams_taxonomy_id': '289', 'type': 'language', 'label': 'Färöiska', 'concept_id': 'j4rH_cw8_s7g', 'legacy_ams_taxonomy_num_id': 289}),
( {'type': 'language', 'id': 'ZMHx_hup_v34', 'preferred_label': 'Fidjianska', 'deprecated_legacy_id': '291'},
'language', {'legacy_ams_taxonomy_id': '291', 'type': 'language', 'label': 'Fidjianska', 'concept_id': 'ZMHx_hup_v34', 'legacy_ams_taxonomy_num_id': 291}),
( {'type': 'language', 'id': 'Swhq_4Fg_qfm', 'preferred_label': 'Finska', 'deprecated_legacy_id': '292'},
'language', {'legacy_ams_taxonomy_id': '292', 'type': 'language', 'label': 'Finska', 'concept_id': 'Swhq_4Fg_qfm', 'legacy_ams_taxonomy_num_id': 292}),
( {'type': 'language', 'id': 'KPgw_t5P_759', 'preferred_label': 'Fon', 'deprecated_legacy_id': '293'},
'language', {'legacy_ams_taxonomy_id': '293', 'type': 'language', 'label': 'Fon', 'concept_id': 'KPgw_t5P_759', 'legacy_ams_taxonomy_num_id': 293}),
( {'type': 'language', 'id': 'AJf5_p3a_b64', 'preferred_label': 'Franska', 'deprecated_legacy_id': '295'},
'language', {'legacy_ams_taxonomy_id': '295', 'type': 'language', 'label': 'Franska', 'concept_id': 'AJf5_p3a_b64', 'legacy_ams_taxonomy_num_id': 295}),
( {'type': 'language', 'id': 'XXq9_Nq8_55j', 'preferred_label': 'Frisiska', 'deprecated_legacy_id': '296'},
'language', {'legacy_ams_taxonomy_id': '296', 'type': 'language', 'label': 'Frisiska', 'concept_id': 'XXq9_Nq8_55j', 'legacy_ams_taxonomy_num_id': 296}),
( {'type': 'language', 'id': 'nUfQ_bem_j5n', 'preferred_label': 'Fulfulde', 'deprecated_legacy_id': '298'},
'language', {'legacy_ams_taxonomy_id': '298', 'type': 'language', 'label': 'Fulfulde', 'concept_id': 'nUfQ_bem_j5n', 'legacy_ams_taxonomy_num_id': 298}),
( {'type': 'language', 'id': '6vC5_KFf_rKT', 'preferred_label': 'Ga', 'deprecated_legacy_id': '300'},
'language', {'legacy_ams_taxonomy_id': '300', 'type': 'language', 'label': 'Ga', 'concept_id': '6vC5_KFf_rKT', 'legacy_ams_taxonomy_num_id': 300}),
( {'type': 'language', 'id': 'ySYP_i3K_WZ2', 'preferred_label': 'Galiciska', 'deprecated_legacy_id': '301'},
'language', {'legacy_ams_taxonomy_id': '301', 'type': 'language', 'label': 'Galiciska', 'concept_id': 'ySYP_i3K_WZ2', 'legacy_ams_taxonomy_num_id': 301}),
( {'type': 'language', 'id': '69WT_Knh_hLs', 'preferred_label': 'Gaeliska (Skotsk)', 'deprecated_legacy_id': '304'},
'language', {'legacy_ams_taxonomy_id': '304', 'type': 'language', 'label': 'Gaeliska (Skotsk)', 'concept_id': '69WT_Knh_hLs', 'legacy_ams_taxonomy_num_id': 304}),
( {'type': 'language', 'id': 'jALF_55z_yDE', 'preferred_label': 'Georgiska', 'deprecated_legacy_id': '305'},
'language', {'legacy_ams_taxonomy_id': '305', 'type': 'language', 'label': 'Georgiska', 'concept_id': 'jALF_55z_yDE', 'legacy_ams_taxonomy_num_id': 305}),
( {'type': 'language', 'id': 'RKH6_hwa_6nk', 'preferred_label': 'Grekiska', 'deprecated_legacy_id': '306'},
'language', {'legacy_ams_taxonomy_id': '306', 'type': 'language', 'label': 'Grekiska', 'concept_id': 'RKH6_hwa_6nk', 'legacy_ams_taxonomy_num_id': 306}),
( {'type': 'language', 'id': 'a1wy_pzH_aQv', 'preferred_label': 'Grönländska', 'deprecated_legacy_id': '307'},
'language', {'legacy_ams_taxonomy_id': '307', 'type': 'language', 'label': 'Grönländska', 'concept_id': 'a1wy_pzH_aQv', 'legacy_ams_taxonomy_num_id': 307}),
( {'type': 'language', 'id': 'dWqu_Ldo_jcD', 'preferred_label': 'Guarani', 'deprecated_legacy_id': '308'},
'language', {'legacy_ams_taxonomy_id': '308', 'type': 'language', 'label': 'Guarani', 'concept_id': 'dWqu_Ldo_jcD', 'legacy_ams_taxonomy_num_id': 308}),
( {'type': 'language', 'id': 'D91H_7iz_Qbn', 'preferred_label': 'Gujarati', 'deprecated_legacy_id': '309'},
'language', {'legacy_ams_taxonomy_id': '309', 'type': 'language', 'label': 'Gujarati', 'concept_id': 'D91H_7iz_Qbn', 'legacy_ams_taxonomy_num_id': 309}),
( {'type': 'language', 'id': 'LaYc_2hR_4i1', 'preferred_label': 'Zenaga', 'deprecated_legacy_id': '312'},
'language', {'legacy_ams_taxonomy_id': '312', 'type': 'language', 'label': 'Zenaga', 'concept_id': 'LaYc_2hR_4i1', 'legacy_ams_taxonomy_num_id': 312}),
( {'type': 'language', 'id': 'ViTs_TnK_DzW', 'preferred_label': 'Hausa', 'deprecated_legacy_id': '313'},
'language', {'legacy_ams_taxonomy_id': '313', 'type': 'language', 'label': 'Hausa', 'concept_id': 'ViTs_TnK_DzW', 'legacy_ams_taxonomy_num_id': 313}),
( {'type': 'language', 'id': 'uWA3_QLq_nu3', 'preferred_label': 'Hebreiska', 'deprecated_legacy_id': '314'},
'language', {'legacy_ams_taxonomy_id': '314', 'type': 'language', 'label': 'Hebreiska', 'concept_id': 'uWA3_QLq_nu3', 'legacy_ams_taxonomy_num_id': 314}),
( {'type': 'language', 'id': 'DFr5_o1T_Bop', 'preferred_label': 'Herero', 'deprecated_legacy_id': '315'},
'language', {'legacy_ams_taxonomy_id': '315', 'type': 'language', 'label': 'Herero', 'concept_id': 'DFr5_o1T_Bop', 'legacy_ams_taxonomy_num_id': 315}),
( {'type': 'language', 'id': 'PwxQ_XQT_MnB', 'preferred_label': 'Hindi', 'deprecated_legacy_id': '316'},
'language', {'legacy_ams_taxonomy_id': '316', 'type': 'language', 'label': 'Hindi', 'concept_id': 'PwxQ_XQT_MnB', 'legacy_ams_taxonomy_num_id': 316}),
( {'type': 'language', 'id': 'kNtt_ZNR_N23', 'preferred_label': 'Igbo', 'deprecated_legacy_id': '317'},
'language', {'legacy_ams_taxonomy_id': '317', 'type': 'language', 'label': 'Igbo', 'concept_id': 'kNtt_ZNR_N23', 'legacy_ams_taxonomy_num_id': 317}),
( {'type': 'language', 'id': 'br9N_CBK_BCz', 'preferred_label': 'Gilbertesiska', 'deprecated_legacy_id': '318'},
'language', {'legacy_ams_taxonomy_id': '318', 'type': 'language', 'label': 'Gilbertesiska', 'concept_id': 'br9N_CBK_BCz', 'legacy_ams_taxonomy_num_id': 318}),
( {'type': 'language', 'id': 'Nojx_VyS_nLf', 'preferred_label': 'Indonesiska', 'deprecated_legacy_id': '319'},
'language', {'legacy_ams_taxonomy_id': '319', 'type': 'language', 'label': 'Indonesiska', 'concept_id': 'Nojx_VyS_nLf', 'legacy_ams_taxonomy_num_id': 319}),
( {'type': 'language', 'id': 'yXoA_zAJ_RoN', 'preferred_label': 'Iriska', 'deprecated_legacy_id': '320'},
'language', {'legacy_ams_taxonomy_id': '320', 'type': 'language', 'label': 'Iriska', 'concept_id': 'yXoA_zAJ_RoN', 'legacy_ams_taxonomy_num_id': 320}),
( {'type': 'language', 'id': 'bvPv_3kf_EQK', 'preferred_label': 'Isländska', 'deprecated_legacy_id': '321'},
'language', {'legacy_ams_taxonomy_id': '321', 'type': 'language', 'label': 'Isländska', 'concept_id': 'bvPv_3kf_EQK', 'legacy_ams_taxonomy_num_id': 321}),
( {'type': 'language', 'id': 'b9cE_KXy_Yxv', 'preferred_label': 'Italienska', 'deprecated_legacy_id': '322'},
'language', {'legacy_ams_taxonomy_id': '322', 'type': 'language', 'label': 'Italienska', 'concept_id': 'b9cE_KXy_Yxv', 'legacy_ams_taxonomy_num_id': 322}),
( {'type': 'language', 'id': 'qmex_uW7_kJw', 'preferred_label': 'Japanska', 'deprecated_legacy_id': '323'},
'language', {'legacy_ams_taxonomy_id': '323', 'type': 'language', 'label': 'Japanska', 'concept_id': 'qmex_uW7_kJw', 'legacy_ams_taxonomy_num_id': 323}),
( {'type': 'language', 'id': 'NNHs_R1H_ESq', 'preferred_label': 'Javanesiska', 'deprecated_legacy_id': '324'},
'language', {'legacy_ams_taxonomy_id': '324', 'type': 'language', 'label': 'Javanesiska', 'concept_id': 'NNHs_R1H_ESq', 'legacy_ams_taxonomy_num_id': 324}),
( {'type': 'language', 'id': 'obg3_pig_x58', 'preferred_label': 'Jiddisch', 'deprecated_legacy_id': '325'},
'language', {'legacy_ams_taxonomy_id': '325', 'type': 'language', 'label': 'Jiddisch', 'concept_id': 'obg3_pig_x58', 'legacy_ams_taxonomy_num_id': 325}),
( {'type': 'language', 'id': 'j4JW_5P4_BGA', 'preferred_label': 'Kabyliska', 'deprecated_legacy_id': '327'},
'language', {'legacy_ams_taxonomy_id': '327', 'type': 'language', 'label': 'Kabyliska', 'concept_id': 'j4JW_5P4_BGA', 'legacy_ams_taxonomy_num_id': 327}),
( {'type': 'language', 'id': '8DQh_CaG_Jsk', 'preferred_label': 'Kamba', 'deprecated_legacy_id': '329'},
'language', {'legacy_ams_taxonomy_id': '329', 'type': 'language', 'label': 'Kamba', 'concept_id': '8DQh_CaG_Jsk', 'legacy_ams_taxonomy_num_id': 329}),
( {'type': 'language', 'id': 'T5kG_Krh_ZBZ', 'preferred_label': 'Kanaresiska', 'deprecated_legacy_id': '330'},
'language', {'legacy_ams_taxonomy_id': '330', 'type': 'language', 'label': 'Kanaresiska', 'concept_id': 'T5kG_Krh_ZBZ', 'legacy_ams_taxonomy_num_id': 330}),
( {'type': 'language', 'id': 'uC3q_W2M_BzA', 'preferred_label': 'Kanuri', 'deprecated_legacy_id': '332'},
'language', {'legacy_ams_taxonomy_id': '332', 'type': 'language', 'label': 'Kanuri', 'concept_id': 'uC3q_W2M_BzA', 'legacy_ams_taxonomy_num_id': 332}),
( {'type': 'language', 'id': 'hq1g_5Md_6PZ', 'preferred_label': 'Karen', 'deprecated_legacy_id': '333'},
'language', {'legacy_ams_taxonomy_id': '333', 'type': 'language', 'label': 'Karen', 'concept_id': 'hq1g_5Md_6PZ', 'legacy_ams_taxonomy_num_id': 333}),
( {'type': 'language', 'id': 'kpf7_mGV_EWk', 'preferred_label': 'Kasmiriska', 'deprecated_legacy_id': '334'},
'language', {'legacy_ams_taxonomy_id': '334', 'type': 'language', 'label': 'Kasmiriska', 'concept_id': 'kpf7_mGV_EWk', 'legacy_ams_taxonomy_num_id': 334}),
( {'type': 'language', 'id': 'YPKq_LRQ_CHT', 'preferred_label': 'Katalanska', 'deprecated_legacy_id': '335'},
'language', {'legacy_ams_taxonomy_id': '335', 'type': 'language', 'label': 'Katalanska', 'concept_id': 'YPKq_LRQ_CHT', 'legacy_ams_taxonomy_num_id': 335}),
( {'type': 'language', 'id': 'mdWX_4PC_wY7', 'preferred_label': 'Kazakiska', 'deprecated_legacy_id': '337'},
'language', {'legacy_ams_taxonomy_id': '337', 'type': 'language', 'label': 'Kazakiska', 'concept_id': 'mdWX_4PC_wY7', 'legacy_ams_taxonomy_num_id': 337}),
( {'type': 'language', 'id': 'LrSS_yQQ_w6c', 'preferred_label': 'Khmer', 'deprecated_legacy_id': '338'},
'language', {'legacy_ams_taxonomy_id': '338', 'type': 'language', 'label': 'Khmer', 'concept_id': 'LrSS_yQQ_w6c', 'legacy_ams_taxonomy_num_id': 338}),
( {'type': 'language', 'id': 'pgjM_8KQ_RZT', 'preferred_label': 'Kinesiska', 'deprecated_legacy_id': '339'},
'language', {'legacy_ams_taxonomy_id': '339', 'type': 'language', 'label': 'Kinesiska', 'concept_id': 'pgjM_8KQ_RZT', 'legacy_ams_taxonomy_num_id': 339}),
( {'type': 'language', 'id': 'TKMX_Mgp_roJ', 'preferred_label': 'Kinyarwanda', 'deprecated_legacy_id': '340'},
'language', {'legacy_ams_taxonomy_id': '340', 'type': 'language', 'label': 'Kinyarwanda', 'concept_id': 'TKMX_Mgp_roJ', 'legacy_ams_taxonomy_num_id': 340}),
( {'type': 'language', 'id': 'H3Mn_eaX_XbQ', 'preferred_label': 'Kirgisiska', 'deprecated_legacy_id': '341'},
'language', {'legacy_ams_taxonomy_id': '341', 'type': 'language', 'label': 'Kirgisiska', 'concept_id': 'H3Mn_eaX_XbQ', 'legacy_ams_taxonomy_num_id': 341}),
( {'type': 'language', 'id': 'i2A1_KpM_osQ', 'preferred_label': 'Kirundi', 'deprecated_legacy_id': '342'},
'language', {'legacy_ams_taxonomy_id': '342', 'type': 'language', 'label': 'Kirundi', 'concept_id': 'i2A1_KpM_osQ', 'legacy_ams_taxonomy_num_id': 342}),
( {'type': 'language', 'id': 'rZYz_myk_W5T', 'preferred_label': 'Kongo', 'deprecated_legacy_id': '343'},
'language', {'legacy_ams_taxonomy_id': '343', 'type': 'language', 'label': 'Kongo', 'concept_id': 'rZYz_myk_W5T', 'legacy_ams_taxonomy_num_id': 343}),
( {'type': 'language', 'id': 'xwTw_Ykx_oMZ', 'preferred_label': 'Konkani', 'deprecated_legacy_id': '344'},
'language', {'legacy_ams_taxonomy_id': '344', 'type': 'language', 'label': 'Konkani', 'concept_id': 'xwTw_Ykx_oMZ', 'legacy_ams_taxonomy_num_id': 344}),
( {'type': 'language', 'id': 'Wj1F_2BF_vtm', 'preferred_label': 'Koreanska', 'deprecated_legacy_id': '345'},
'language', {'legacy_ams_taxonomy_id': '345', 'type': 'language', 'label': 'Koreanska', 'concept_id': 'Wj1F_2BF_vtm', 'legacy_ams_taxonomy_num_id': 345}),
( {'type': 'language', 'id': 'wREW_gh2_Bxu', 'preferred_label': 'Korsikanska', 'deprecated_legacy_id': '346'},
'language', {'legacy_ams_taxonomy_id': '346', 'type': 'language', 'label': 'Korsikanska', 'concept_id': 'wREW_gh2_Bxu', 'legacy_ams_taxonomy_num_id': 346}),
( {'type': 'language', 'id': 'JFiv_95F_eNB', 'preferred_label': 'Kreolska o pidginspråk, portugisisk-baserade,andra', 'deprecated_legacy_id': '348'},
'language', {'legacy_ams_taxonomy_id': '348', 'type': 'language', 'label': 'Kreolska o pidginspråk, portugisisk-baserade,andra', 'concept_id': 'JFiv_95F_eNB', 'legacy_ams_taxonomy_num_id': 348}),
( {'type': 'language', 'id': 'ZUf8_t85_NC6', 'preferred_label': 'Kroatiska', 'deprecated_legacy_id': '350'},
'language', {'legacy_ams_taxonomy_id': '350', 'type': 'language', 'label': 'Kroatiska', 'concept_id': 'ZUf8_t85_NC6', 'legacy_ams_taxonomy_num_id': 350}),
( {'type': 'language', 'id': 'Sgvv_5Vd_xro', 'preferred_label': 'Kru', 'deprecated_legacy_id': '351'},
'language', {'legacy_ams_taxonomy_id': '351', 'type': 'language', 'label': 'Kru', 'concept_id': 'Sgvv_5Vd_xro', 'legacy_ams_taxonomy_num_id': 351}),
( {'type': 'language', 'id': 'JxfJ_kyR_CQZ', 'preferred_label': 'Kurdiska', 'deprecated_legacy_id': '352'},
'language', {'legacy_ams_taxonomy_id': '352', 'type': 'language', 'label': 'Kurdiska', 'concept_id': 'JxfJ_kyR_CQZ', 'legacy_ams_taxonomy_num_id': 352}),
( {'type': 'language', 'id': '95r9_3rM_KWz', 'preferred_label': 'Kikuyu', 'deprecated_legacy_id': '353'},
'language', {'legacy_ams_taxonomy_id': '353', 'type': 'language', 'label': 'Kikuyu', 'concept_id': '95r9_3rM_KWz', 'legacy_ams_taxonomy_num_id': 353}),
( {'type': 'language', 'id': 'FNQx_3PN_eiT', 'preferred_label': 'Lao', 'deprecated_legacy_id': '355'},
'language', {'legacy_ams_taxonomy_id': '355', 'type': 'language', 'label': 'Lao', 'concept_id': 'FNQx_3PN_eiT', 'legacy_ams_taxonomy_num_id': 355}),
( {'type': 'language', 'id': 'YiQE_ERm_7kh', 'preferred_label': 'Lettiska', 'deprecated_legacy_id': '356'},
'language', {'legacy_ams_taxonomy_id': '356', 'type': 'language', 'label': 'Lettiska', 'concept_id': 'YiQE_ERm_7kh', 'legacy_ams_taxonomy_num_id': 356}),
( {'type': 'language', 'id': 'w7am_ASn_5uK', 'preferred_label': 'Lamba', 'deprecated_legacy_id': '357'},
'language', {'legacy_ams_taxonomy_id': '357', 'type': 'language', 'label': 'Lamba', 'concept_id': 'w7am_ASn_5uK', 'legacy_ams_taxonomy_num_id': 357}),
( {'type': 'language', 'id': 'NBKm_cvX_fGo', 'preferred_label': 'Lingala', 'deprecated_legacy_id': '358'},
'language', {'legacy_ams_taxonomy_id': '358', 'type': 'language', 'label': 'Lingala', 'concept_id': 'NBKm_cvX_fGo', 'legacy_ams_taxonomy_num_id': 358}),
( {'type': 'language', 'id': '14pF_wSZ_fnK', 'preferred_label': 'Litauiska', 'deprecated_legacy_id': '359'},
'language', {'legacy_ams_taxonomy_id': '359', 'type': 'language', 'label': 'Litauiska', 'concept_id': '14pF_wSZ_fnK', 'legacy_ams_taxonomy_num_id': 359}),
( {'type': 'language', 'id': 'eW8E_sSU_sbS', 'preferred_label': 'Lozi', 'deprecated_legacy_id': '360'},
'language', {'legacy_ams_taxonomy_id': '360', 'type': 'language', 'label': 'Lozi', 'concept_id': 'eW8E_sSU_sbS', 'legacy_ams_taxonomy_num_id': 360}),
( {'type': 'language', 'id': 'QhX2_SiT_PYf', 'preferred_label': 'Luba-Katanga', 'deprecated_legacy_id': '361'},
'language', {'legacy_ams_taxonomy_id': '361', 'type': 'language', 'label': 'Luba-Katanga', 'concept_id': 'QhX2_SiT_PYf', 'legacy_ams_taxonomy_num_id': 361}),
( {'type': 'language', 'id': 'f3zb_p1z_JDE', 'preferred_label': 'Ganda', 'deprecated_legacy_id': '362'},
'language', {'legacy_ams_taxonomy_id': '362', 'type': 'language', 'label': 'Ganda', 'concept_id': 'f3zb_p1z_JDE', 'legacy_ams_taxonomy_num_id': 362}),
( {'type': 'language', 'id': 'cMMJ_usJ_o6P', 'preferred_label': 'Lunda', 'deprecated_legacy_id': '364'},
'language', {'legacy_ams_taxonomy_id': '364', 'type': 'language', 'label': 'Lunda', 'concept_id': 'cMMJ_usJ_o6P', 'legacy_ams_taxonomy_num_id': 364}),
( {'type': 'language', 'id': '4Vfp_k1i_j59', 'preferred_label': 'Luo (Kenya och Tanzania)', 'deprecated_legacy_id': '365'},
'language', {'legacy_ams_taxonomy_id': '365', 'type': 'language', 'label': 'Luo (Kenya och Tanzania)', 'concept_id': '4Vfp_k1i_j59', 'legacy_ams_taxonomy_num_id': 365}),
( {'type': 'language', 'id': 'PZa9_wAR_1BZ', 'preferred_label': 'Luxemburgiska', 'deprecated_legacy_id': '368'},
'language', {'legacy_ams_taxonomy_id': '368', 'type': 'language', 'label': 'Luxemburgiska', 'concept_id': 'PZa9_wAR_1BZ', 'legacy_ams_taxonomy_num_id': 368}),
( {'type': 'language', 'id': '518r_2Eg_WKo', 'preferred_label': 'Maduresiska', 'deprecated_legacy_id': '369'},
'language', {'legacy_ams_taxonomy_id': '369', 'type': 'language', 'label': 'Maduresiska', 'concept_id': '518r_2Eg_WKo', 'legacy_ams_taxonomy_num_id': 369}),
( {'type': 'language', 'id': 'X8kF_rvX_yuj', 'preferred_label': 'Makedonska', 'deprecated_legacy_id': '370'},
'language', {'legacy_ams_taxonomy_id': '370', 'type': 'language', 'label': 'Makedonska', 'concept_id': 'X8kF_rvX_yuj', 'legacy_ams_taxonomy_num_id': 370}),
( {'type': 'language', 'id': 'dVEU_LsK_m8b', 'preferred_label': 'Malagassiska', 'deprecated_legacy_id': '372'},
'language', {'legacy_ams_taxonomy_id': '372', 'type': 'language', 'label': 'Malagassiska', 'concept_id': 'dVEU_LsK_m8b', 'legacy_ams_taxonomy_num_id': 372}),
( {'type': 'language', 'id': 'TrvD_6oy_oYt', 'preferred_label': 'Malajiska', 'deprecated_legacy_id': '373'},
'language', {'legacy_ams_taxonomy_id': '373', 'type': 'language', 'label': 'Malajiska', 'concept_id': 'TrvD_6oy_oYt', 'legacy_ams_taxonomy_num_id': 373}),
( {'type': 'language', 'id': 'QsrB_4Kx_K7y', 'preferred_label': 'Malayalam', 'deprecated_legacy_id': '374'},
'language', {'legacy_ams_taxonomy_id': '374', 'type': 'language', 'label': 'Malayalam', 'concept_id': 'QsrB_4Kx_K7y', 'legacy_ams_taxonomy_num_id': 374}),
( {'type': 'language', 'id': 'oJMr_g3f_9Z9', 'preferred_label': 'Maltesiska', 'deprecated_legacy_id': '376'},
'language', {'legacy_ams_taxonomy_id': '376', 'type': 'language', 'label': 'Maltesiska', 'concept_id': 'oJMr_g3f_9Z9', 'legacy_ams_taxonomy_num_id': 376}),
( {'type': 'language', 'id': 'cxiY_CBR_1Ve', 'preferred_label': 'Mandarin', 'deprecated_legacy_id': '377'},
'language', {'legacy_ams_taxonomy_id': '377', 'type': 'language', 'label': 'Mandarin', 'concept_id': 'cxiY_CBR_1Ve', 'legacy_ams_taxonomy_num_id': 377}),
( {'type': 'language', 'id': '32J8_SCe_3gR', 'preferred_label': 'Manx', 'deprecated_legacy_id': '381'},
'language', {'legacy_ams_taxonomy_id': '381', 'type': 'language', 'label': 'Manx', 'concept_id': '32J8_SCe_3gR', 'legacy_ams_taxonomy_num_id': 381}),
( {'type': 'language', 'id': 'vG2n_EAN_SwC', 'preferred_label': 'Maori', 'deprecated_legacy_id': '382'},
'language', {'legacy_ams_taxonomy_id': '382', 'type': 'language', 'label': 'Maori', 'concept_id': 'vG2n_EAN_SwC', 'legacy_ams_taxonomy_num_id': 382}),
( {'type': 'language', 'id': 'XadF_xEF_Hvb', 'preferred_label': 'Marathi', 'deprecated_legacy_id': '383'},
'language', {'legacy_ams_taxonomy_id': '383', 'type': 'language', 'label': 'Marathi', 'concept_id': 'XadF_xEF_Hvb', 'legacy_ams_taxonomy_num_id': 383}),
( {'type': 'language', 'id': 'Qgzp_mLJ_4tr', 'preferred_label': 'Mariska', 'deprecated_legacy_id': '384'},
'language', {'legacy_ams_taxonomy_id': '384', 'type': 'language', 'label': 'Mariska', 'concept_id': 'Qgzp_mLJ_4tr', 'legacy_ams_taxonomy_num_id': 384}),
( {'type': 'language', 'id': 'vSm2_7L7_xvL', 'preferred_label': 'Marwariska', 'deprecated_legacy_id': '385'},
'language', {'legacy_ams_taxonomy_id': '385', 'type': 'language', 'label': 'Marwariska', 'concept_id': 'vSm2_7L7_xvL', 'legacy_ams_taxonomy_num_id': 385}),
( {'type': 'language', 'id': 'BHDa_r1G_5Sv', 'preferred_label': 'Masai', 'deprecated_legacy_id': '386'},
'language', {'legacy_ams_taxonomy_id': '386', 'type': 'language', 'label': 'Masai', 'concept_id': 'BHDa_r1G_5Sv', 'legacy_ams_taxonomy_num_id': 386}),
( {'type': 'language', 'id': '53mz_row_sAP', 'preferred_label': 'Maya', 'deprecated_legacy_id': '387'},
'language', {'legacy_ams_taxonomy_id': '387', 'type': 'language', 'label': 'Maya', 'concept_id': '53mz_row_sAP', 'legacy_ams_taxonomy_num_id': 387}),
( {'type': 'language', 'id': 'F6YW_uCL_xCN', 'preferred_label': 'Mende', 'deprecated_legacy_id': '388'},
'language', {'legacy_ams_taxonomy_id': '388', 'type': 'language', 'label': 'Mende', 'concept_id': 'F6YW_uCL_xCN', 'legacy_ams_taxonomy_num_id': 388}),
( {'type': 'language', 'id': 'vWfd_Xrt_hPJ', 'preferred_label': 'Moldaviska', 'deprecated_legacy_id': '390'},
'language', {'legacy_ams_taxonomy_id': '390', 'type': 'language', 'label': 'Moldaviska', 'concept_id': 'vWfd_Xrt_hPJ', 'legacy_ams_taxonomy_num_id': 390}),
( {'type': 'language', 'id': 'J6dh_R8z_Ja4', 'preferred_label': 'Mongolska', 'deprecated_legacy_id': '391'},
'language', {'legacy_ams_taxonomy_id': '391', 'type': 'language', 'label': 'Mongolska', 'concept_id': 'J6dh_R8z_Ja4', 'legacy_ams_taxonomy_num_id': 391}),
( {'type': 'language', 'id': 'T3kB_EuD_ReH', 'preferred_label': 'Mossi', 'deprecated_legacy_id': '393'},
'language', {'legacy_ams_taxonomy_id': '393', 'type': 'language', 'label': 'Mossi', 'concept_id': 'T3kB_EuD_ReH', 'legacy_ams_taxonomy_num_id': 393}),
( {'type': 'language', 'id': 'UNA7_isN_UzK', 'preferred_label': 'Nauhatl', 'deprecated_legacy_id': '397'},
'language', {'legacy_ams_taxonomy_id': '397', 'type': 'language', 'label': 'Nauhatl', 'concept_id': 'UNA7_isN_UzK', 'legacy_ams_taxonomy_num_id': 397}),
( {'type': 'language', 'id': 'jvFH_zK8_KhS', 'preferred_label': 'Nauru', 'deprecated_legacy_id': '398'},
'language', {'legacy_ams_taxonomy_id': '398', 'type': 'language', 'label': 'Nauru', 'concept_id': 'jvFH_zK8_KhS', 'legacy_ams_taxonomy_num_id': 398}),
( {'type': 'language', 'id': 'niMN_h39_tm3', 'preferred_label': 'Nauriska', 'deprecated_legacy_id': '399'},
'language', {'legacy_ams_taxonomy_id': '399', 'type': 'language', 'label': 'Nauriska', 'concept_id': 'niMN_h39_tm3', 'legacy_ams_taxonomy_num_id': 399}),
( {'type': 'language', 'id': '3rPm_Muj_kJT', 'preferred_label': 'Ndebele Nord', 'deprecated_legacy_id': '400'},
'language', {'legacy_ams_taxonomy_id': '400', 'type': 'language', 'label': 'Ndebele Nord', 'concept_id': '3rPm_Muj_kJT', 'legacy_ams_taxonomy_num_id': 400}),
( {'type': 'language', 'id': '6S6h_c57_VnV', 'preferred_label': 'Nederländska', 'deprecated_legacy_id': '401'},
'language', {'legacy_ams_taxonomy_id': '401', 'type': 'language', 'label': 'Nederländska', 'concept_id': '6S6h_c57_VnV', 'legacy_ams_taxonomy_num_id': 401}),
( {'type': 'language', 'id': 'Lwot_W1k_dFW', 'preferred_label': 'Nepalesiska', 'deprecated_legacy_id': '402'},
'language', {'legacy_ams_taxonomy_id': '402', 'type': 'language', 'label': 'Nepalesiska', 'concept_id': 'Lwot_W1k_dFW', 'legacy_ams_taxonomy_num_id': 402}),
( {'type': 'language', 'id': 'pnjj_2JX_Fub', 'preferred_label': 'Norska', 'deprecated_legacy_id': '404'},
'language', {'legacy_ams_taxonomy_id': '404', 'type': 'language', 'label': 'Norska', 'concept_id': 'pnjj_2JX_Fub', 'legacy_ams_taxonomy_num_id': 404}),
( {'type': 'language', 'id': 'Ygzd_HiY_Ksk', 'preferred_label': 'Nyamwezi', 'deprecated_legacy_id': '405'},
'language', {'legacy_ams_taxonomy_id': '405', 'type': 'language', 'label': 'Nyamwezi', 'concept_id': 'Ygzd_HiY_Ksk', 'legacy_ams_taxonomy_num_id': 405}),
( {'type': 'language', 'id': 'Lcsi_xHg_8UW', 'preferred_label': 'Nyanja', 'deprecated_legacy_id': '406'},
'language', {'legacy_ams_taxonomy_id': '406', 'type': 'language', 'label': 'Nyanja', 'concept_id': 'Lcsi_xHg_8UW', 'legacy_ams_taxonomy_num_id': 406}),
( {'type': 'language', 'id': 'MzzG_eb7_ojB', 'preferred_label': 'Occitanska', 'deprecated_legacy_id': '407'},
'language', {'legacy_ams_taxonomy_id': '407', 'type': 'language', 'label': 'Occitanska', 'concept_id': 'MzzG_eb7_ojB', 'legacy_ams_taxonomy_num_id': 407}),
( {'type': 'language', 'id': 'qrBQ_mhN_W7D', 'preferred_label': 'Oriya', 'deprecated_legacy_id': '408'},
'language', {'legacy_ams_taxonomy_id': '408', 'type': 'language', 'label': 'Oriya', 'concept_id': 'qrBQ_mhN_W7D', 'legacy_ams_taxonomy_num_id': 408}),
( {'type': 'language', 'id': 'qDZT_5H6_ZET', 'preferred_label': 'Oromo', 'deprecated_legacy_id': '409'},
'language', {'legacy_ams_taxonomy_id': '409', 'type': 'language', 'label': 'Oromo', 'concept_id': 'qDZT_5H6_ZET', 'legacy_ams_taxonomy_num_id': 409}),
( {'type': 'language', 'id': 'g6Up_z8D_oAY', 'preferred_label': 'Pashto', 'deprecated_legacy_id': '412'},
'language', {'legacy_ams_taxonomy_id': '412', 'type': 'language', 'label': 'Pashto', 'concept_id': 'g6Up_z8D_oAY', 'legacy_ams_taxonomy_num_id': 412}),
( {'type': 'language', 'id': 'sNoC_CTL_8Ph', 'preferred_label': 'Persiska (Farsi)', 'deprecated_legacy_id': '414'},
'language', {'legacy_ams_taxonomy_id': '414', 'type': 'language', 'label': 'Persiska (Farsi)', 'concept_id': 'sNoC_CTL_8Ph', 'legacy_ams_taxonomy_num_id': 414}),
( {'type': 'language', 'id': 'Gp9q_gTW_XAw', 'preferred_label': 'Polska', 'deprecated_legacy_id': '415'},
'language', {'legacy_ams_taxonomy_id': '415', 'type': 'language', 'label': 'Polska', 'concept_id': 'Gp9q_gTW_XAw', 'legacy_ams_taxonomy_num_id': 415}),
( {'type': 'language', 'id': 'W1EH_yKC_wMJ', 'preferred_label': 'Portugisiska', 'deprecated_legacy_id': '416'},
'language', {'legacy_ams_taxonomy_id': '416', 'type': 'language', 'label': 'Portugisiska', 'concept_id': 'W1EH_yKC_wMJ', 'legacy_ams_taxonomy_num_id': 416}),
( {'type': 'language', 'id': 'so8d_dR6_E8j', 'preferred_label': 'Punjabi/Panjabo', 'deprecated_legacy_id': '417'},
'language', {'legacy_ams_taxonomy_id': '417', 'type': 'language', 'label': 'Punjabi/Panjabo', 'concept_id': 'so8d_dR6_E8j', 'legacy_ams_taxonomy_num_id': 417}),
( {'type': 'language', 'id': 'gBd9_PJY_gbT', 'preferred_label': 'Quechua', 'deprecated_legacy_id': '418'},
'language', {'legacy_ams_taxonomy_id': '418', 'type': 'language', 'label': 'Quechua', 'concept_id': 'gBd9_PJY_gbT', 'legacy_ams_taxonomy_num_id': 418}),
( {'type': 'language', 'id': 'ocLM_QVf_661', 'preferred_label': 'Retoromanska', 'deprecated_legacy_id': '420'},
'language', {'legacy_ams_taxonomy_id': '420', 'type': 'language', 'label': 'Retoromanska', 'concept_id': 'ocLM_QVf_661', 'legacy_ams_taxonomy_num_id': 420}),
( {'type': 'language', 'id': 'EgN8_Usb_2f6', 'preferred_label': 'Romani', 'deprecated_legacy_id': '421'},
'language', {'legacy_ams_taxonomy_id': '421', 'type': 'language', 'label': 'Romani', 'concept_id': 'EgN8_Usb_2f6', 'legacy_ams_taxonomy_num_id': 421}),
( {'type': 'language', 'id': 'ZDoY_SrN_mRm', 'preferred_label': 'Rumänska', 'deprecated_legacy_id': '422'},
'language', {'legacy_ams_taxonomy_id': '422', 'type': 'language', 'label': 'Rumänska', 'concept_id': 'ZDoY_SrN_mRm', 'legacy_ams_taxonomy_num_id': 422}),
( {'type': 'language', 'id': 'mHSV_SUD_wXF', 'preferred_label': 'Ryska', 'deprecated_legacy_id': '424'},
'language', {'legacy_ams_taxonomy_id': '424', 'type': 'language', 'label': 'Ryska', 'concept_id': 'mHSV_SUD_wXF', 'legacy_ams_taxonomy_num_id': 424}),
( {'type': 'language', 'id': 'oRUY_CU4_s9t', 'preferred_label': 'Samiska', 'deprecated_legacy_id': '425'},
'language', {'legacy_ams_taxonomy_id': '425', 'type': 'language', 'label': 'Samiska', 'concept_id': 'oRUY_CU4_s9t', 'legacy_ams_taxonomy_num_id': 425}),
( {'type': 'language', 'id': 'qhwA_Zhw_XLy', 'preferred_label': 'Samoanska', 'deprecated_legacy_id': '426'},
'language', {'legacy_ams_taxonomy_id': '426', 'type': 'language', 'label': 'Samoanska', 'concept_id': 'qhwA_Zhw_XLy', 'legacy_ams_taxonomy_num_id': 426}),
( {'type': 'language', 'id': 'wspL_wxs_ud5', 'preferred_label': 'Sango', 'deprecated_legacy_id': '427'},
'language', {'legacy_ams_taxonomy_id': '427', 'type': 'language', 'label': 'Sango', 'concept_id': 'wspL_wxs_ud5', 'legacy_ams_taxonomy_num_id': 427}),
( {'type': 'language', 'id': 'xLXn_NYc_2Zv', 'preferred_label': 'Santali', 'deprecated_legacy_id': '428'},
'language', {'legacy_ams_taxonomy_id': '428', 'type': 'language', 'label': 'Santali', 'concept_id': 'xLXn_NYc_2Zv', 'legacy_ams_taxonomy_num_id': 428}),
( {'type': 'language', 'id': 'jcL9_M9C_mAE', 'preferred_label': 'Sardiska/Sardiniska', 'deprecated_legacy_id': '430'},
'language', {'legacy_ams_taxonomy_id': '430', 'type': 'language', 'label': 'Sardiska/Sardiniska', 'concept_id': 'jcL9_M9C_mAE', 'legacy_ams_taxonomy_num_id': 430}),
( {'type': 'language', 'id': 'CKpA_mgw_jgi', 'preferred_label': 'Serbiska', 'deprecated_legacy_id': '432'},
'language', {'legacy_ams_taxonomy_id': '432', 'type': 'language', 'label': 'Serbiska', 'concept_id': 'CKpA_mgw_jgi', 'legacy_ams_taxonomy_num_id': 432}),
( {'type': 'language', 'id': 'ECrL_6pW_Zuz', 'preferred_label': 'Sesotho/Sesuto/Sotho', 'deprecated_legacy_id': '434'},
'language', {'legacy_ams_taxonomy_id': '434', 'type': 'language', 'label': 'Sesotho/Sesuto/Sotho', 'concept_id': 'ECrL_6pW_Zuz', 'legacy_ams_taxonomy_num_id': 434}),
( {'type': 'language', 'id': 'b7BB_6HR_vNr', 'preferred_label': 'Tswana', 'deprecated_legacy_id': '435'},
'language', {'legacy_ams_taxonomy_id': '435', 'type': 'language', 'label': 'Tswana', 'concept_id': 'b7BB_6HR_vNr', 'legacy_ams_taxonomy_num_id': 435}),
( {'type': 'language', 'id': 'duKn_okc_J3Q', 'preferred_label': 'Shona', 'deprecated_legacy_id': '438'},
'language', {'legacy_ams_taxonomy_id': '438', 'type': 'language', 'label': 'Shona', 'concept_id': 'duKn_okc_J3Q', 'legacy_ams_taxonomy_num_id': 438}),
( {'type': 'language', 'id': '97Zk_gEu_4XD', 'preferred_label': 'Sindhi', 'deprecated_legacy_id': '440'},
'language', {'legacy_ams_taxonomy_id': '440', 'type': 'language', 'label': 'Sindhi', 'concept_id': '97Zk_gEu_4XD', 'legacy_ams_taxonomy_num_id': 440}),
( {'type': 'language', 'id': 'PKJu_KCn_zAV', 'preferred_label': 'Singalesiska/Sinhala', 'deprecated_legacy_id': '441'},
'language', {'legacy_ams_taxonomy_id': '441', 'type': 'language', 'label': 'Singalesiska/Sinhala', 'concept_id': 'PKJu_KCn_zAV', 'legacy_ams_taxonomy_num_id': 441}),
( {'type': 'language', 'id': 'tVYE_xuR_B75', 'preferred_label': 'Swazi/Swati', 'deprecated_legacy_id': '442'},
'language', {'legacy_ams_taxonomy_id': '442', 'type': 'language', 'label': 'Swazi/Swati', 'concept_id': 'tVYE_xuR_B75', 'legacy_ams_taxonomy_num_id': 442}),
( {'type': 'language', 'id': 'rcVk_VU4_zay', 'preferred_label': 'Skotska', 'deprecated_legacy_id': '444'},
'language', {'legacy_ams_taxonomy_id': '444', 'type': 'language', 'label': 'Skotska', 'concept_id': 'rcVk_VU4_zay', 'legacy_ams_taxonomy_num_id': 444}),
( {'type': 'language', 'id': 'mLRm_6VG_s3c', 'preferred_label': 'Slovakiska', 'deprecated_legacy_id': '445'},
'language', {'legacy_ams_taxonomy_id': '445', 'type': 'language', 'label': 'Slovakiska', 'concept_id': 'mLRm_6VG_s3c', 'legacy_ams_taxonomy_num_id': 445}),
( {'type': 'language', 'id': 'H9bz_4TN_vL5', 'preferred_label': 'Slovenska', 'deprecated_legacy_id': '446'},
'language', {'legacy_ams_taxonomy_id': '446', 'type': 'language', 'label': 'Slovenska', 'concept_id': 'H9bz_4TN_vL5', 'legacy_ams_taxonomy_num_id': 446}),
( {'type': 'language', 'id': 'F6dn_vX1_Qnm', 'preferred_label': 'Somaliska', 'deprecated_legacy_id': '447'},
'language', {'legacy_ams_taxonomy_id': '447', 'type': 'language', 'label': 'Somaliska', 'concept_id': 'F6dn_vX1_Qnm', 'legacy_ams_taxonomy_num_id': 447}),
( {'type': 'language', 'id': 'n69w_Nza_N6w', 'preferred_label': 'Songhai', 'deprecated_legacy_id': '448'},
'language', {'legacy_ams_taxonomy_id': '448', 'type': 'language', 'label': 'Songhai', 'concept_id': 'n69w_Nza_N6w', 'legacy_ams_taxonomy_num_id': 448}),
( {'type': 'language', 'id': 'cqJm_R5Q_Gpr', 'preferred_label': 'Sorbiska språk', 'deprecated_legacy_id': '450'},
'language', {'legacy_ams_taxonomy_id': '450', 'type': 'language', 'label': 'Sorbiska språk', 'concept_id': 'cqJm_R5Q_Gpr', 'legacy_ams_taxonomy_num_id': 450}),
( {'type': 'language', 'id': 'i9Hd_bVm_Z3c', 'preferred_label': 'Spanska', 'deprecated_legacy_id': '451'},
'language', {'legacy_ams_taxonomy_id': '451', 'type': 'language', 'label': 'Spanska', 'concept_id': 'i9Hd_bVm_Z3c', 'legacy_ams_taxonomy_num_id': 451}),
( {'type': 'language', 'id': 'popv_w4d_5uB', 'preferred_label': 'Susu', 'deprecated_legacy_id': '453'},
'language', {'legacy_ams_taxonomy_id': '453', 'type': 'language', 'label': 'Susu', 'concept_id': 'popv_w4d_5uB', 'legacy_ams_taxonomy_num_id': 453}),
( {'type': 'language', 'id': 'Hbzs_PLN_Vo8', 'preferred_label': 'Swahili', 'deprecated_legacy_id': '455'},
'language', {'legacy_ams_taxonomy_id': '455', 'type': 'language', 'label': 'Swahili', 'concept_id': 'Hbzs_PLN_Vo8', 'legacy_ams_taxonomy_num_id': 455}),
( {'type': 'language', 'id': 'vYua_sYT_JEg', 'preferred_label': 'Syrianska', 'deprecated_legacy_id': '457'},
'language', {'legacy_ams_taxonomy_id': '457', 'type': 'language', 'label': 'Syrianska', 'concept_id': 'vYua_sYT_JEg', 'legacy_ams_taxonomy_num_id': 457}),
( {'type': 'language', 'id': 'ChZf_oUX_fKG', 'preferred_label': 'Tadjikiska', 'deprecated_legacy_id': '458'},
'language', {'legacy_ams_taxonomy_id': '458', 'type': 'language', 'label': 'Tadjikiska', 'concept_id': 'ChZf_oUX_fKG', 'legacy_ams_taxonomy_num_id': 458}),
( {'type': 'language', 'id': '7EYg_JZj_aU8', 'preferred_label': 'Tagalog', 'deprecated_legacy_id': '459'},
'language', {'legacy_ams_taxonomy_id': '459', 'type': 'language', 'label': 'Tagalog', 'concept_id': '7EYg_JZj_aU8', 'legacy_ams_taxonomy_num_id': 459}),
( {'type': 'language', 'id': 'YAw2_WRr_SAZ', 'preferred_label': 'Tahitiska', 'deprecated_legacy_id': '460'},
'language', {'legacy_ams_taxonomy_id': '460', 'type': 'language', 'label': 'Tahitiska', 'concept_id': 'YAw2_WRr_SAZ', 'legacy_ams_taxonomy_num_id': 460}),
( {'type': 'language', 'id': 'BWtj_uTy_nUS', 'preferred_label': 'Tamashek', 'deprecated_legacy_id': '461'},
'language', {'legacy_ams_taxonomy_id': '461', 'type': 'language', 'label': 'Tamashek', 'concept_id': 'BWtj_uTy_nUS', 'legacy_ams_taxonomy_num_id': 461}),
( {'type': 'language', 'id': 'u4QL_MM1_3zA', 'preferred_label': 'Tamil/Tamilska', 'deprecated_legacy_id': '463'},
'language', {'legacy_ams_taxonomy_id': '463', 'type': 'language', 'label': 'Tamil/Tamilska', 'concept_id': 'u4QL_MM1_3zA', 'legacy_ams_taxonomy_num_id': 463}),
( {'type': 'language', 'id': 'WmiH_iwb_S95', 'preferred_label': 'Tatariska', 'deprecated_legacy_id': '465'},
'language', {'legacy_ams_taxonomy_id': '465', 'type': 'language', 'label': 'Tatariska', 'concept_id': 'WmiH_iwb_S95', 'legacy_ams_taxonomy_num_id': 465}),
( {'type': 'language', 'id': '4N2S_MYT_nt7', 'preferred_label': 'Telugu', 'deprecated_legacy_id': '466'},
'language', {'legacy_ams_taxonomy_id': '466', 'type': 'language', 'label': 'Telugu', 'concept_id': '4N2S_MYT_nt7', 'legacy_ams_taxonomy_num_id': 466}),
( {'type': 'language', 'id': 'YQs2_RvS_UjV', 'preferred_label': 'Timne', 'deprecated_legacy_id': '467'},
'language', {'legacy_ams_taxonomy_id': '467', 'type': 'language', 'label': 'Timne', 'concept_id': 'YQs2_RvS_UjV', 'legacy_ams_taxonomy_num_id': 467}),
( {'type': 'language', 'id': 'ECih_Cev_hwd', 'preferred_label': 'Thailändska', 'deprecated_legacy_id': '469'},
'language', {'legacy_ams_taxonomy_id': '469', 'type': 'language', 'label': 'Thailändska', 'concept_id': 'ECih_Cev_hwd', 'legacy_ams_taxonomy_num_id': 469}),
( {'type': 'language', 'id': 'SXCC_X3z_zYJ', 'preferred_label': 'Tibetanska', 'deprecated_legacy_id': '470'},
'language', {'legacy_ams_taxonomy_id': '470', 'type': 'language', 'label': 'Tibetanska', 'concept_id': 'SXCC_X3z_zYJ', 'legacy_ams_taxonomy_num_id': 470}),
( {'type': 'language', 'id': '4Qvn_5N7_AVk', 'preferred_label': 'Tigre', 'deprecated_legacy_id': '471'},
'language', {'legacy_ams_taxonomy_id': '471', 'type': 'language', 'label': 'Tigre', 'concept_id': '4Qvn_5N7_AVk', 'legacy_ams_taxonomy_num_id': 471}),
( {'type': 'language', 'id': 'nPzh_1oc_EKz', 'preferred_label': 'Tigrinja/Tigrinska', 'deprecated_legacy_id': '472'},
'language', {'legacy_ams_taxonomy_id': '472', 'type': 'language', 'label': 'Tigrinja/Tigrinska', 'concept_id': 'nPzh_1oc_EKz', 'legacy_ams_taxonomy_num_id': 472}),
( {'type': 'language', 'id': 'aAje_qMU_iU9', 'preferred_label': 'Tjeckiska', 'deprecated_legacy_id': '473'},
'language', {'legacy_ams_taxonomy_id': '473', 'type': 'language', 'label': 'Tjeckiska', 'concept_id': 'aAje_qMU_iU9', 'legacy_ams_taxonomy_num_id': 473}),
( {'type': 'language', 'id': 'heWF_H1y_48o', 'preferred_label': 'Tjuvasjiska', 'deprecated_legacy_id': '475'},
'language', {'legacy_ams_taxonomy_id': '475', 'type': 'language', 'label': 'Tjuvasjiska', 'concept_id': 'heWF_H1y_48o', 'legacy_ams_taxonomy_num_id': 475}),
( {'type': 'language', 'id': 'wL3C_poK_fbi', 'preferred_label': 'Tok Pisin', 'deprecated_legacy_id': '476'},
'language', {'legacy_ams_taxonomy_id': '476', 'type': 'language', 'label': 'Tok Pisin', 'concept_id': 'wL3C_poK_fbi', 'legacy_ams_taxonomy_num_id': 476}),
( {'type': 'language', 'id': 'sVLN_wnV_MxS', 'preferred_label': 'Tonga (Nyasa)', 'deprecated_legacy_id': '477'},
'language', {'legacy_ams_taxonomy_id': '477', 'type': 'language', 'label': 'Tonga (Nyasa)', 'concept_id': 'sVLN_wnV_MxS', 'legacy_ams_taxonomy_num_id': 477}),
( {'type': 'language', 'id': 'UaRX_FvG_rKF', 'preferred_label': 'Turkiska', 'deprecated_legacy_id': '481'},
'language', {'legacy_ams_taxonomy_id': '481', 'type': 'language', 'label': 'Turkiska', 'concept_id': 'UaRX_FvG_rKF', 'legacy_ams_taxonomy_num_id': 481}),
( {'type': 'language', 'id': 'HFys_DBy_E5b', 'preferred_label': 'Turkmenska', 'deprecated_legacy_id': '482'},
'language', {'legacy_ams_taxonomy_id': '482', 'type': 'language', 'label': 'Turkmenska', 'concept_id': 'HFys_DBy_E5b', 'legacy_ams_taxonomy_num_id': 482}),
( {'type': 'language', 'id': 'k3AV_Asg_TWU', 'preferred_label': 'Twi', 'deprecated_legacy_id': '483'},
'language', {'legacy_ams_taxonomy_id': '483', 'type': 'language', 'label': 'Twi', 'concept_id': 'k3AV_Asg_TWU', 'legacy_ams_taxonomy_num_id': 483}),
( {'type': 'language', 'id': 'S368_jFS_2hP', 'preferred_label': 'Tyska', 'deprecated_legacy_id': '484'},
'language', {'legacy_ams_taxonomy_id': '484', 'type': 'language', 'label': 'Tyska', 'concept_id': 'S368_jFS_2hP', 'legacy_ams_taxonomy_num_id': 484}),
( {'type': 'language', 'id': 'tAM8_qNg_sW5', 'preferred_label': 'Uiguriska', 'deprecated_legacy_id': '485'},
'language', {'legacy_ams_taxonomy_id': '485', 'type': 'language', 'label': 'Uiguriska', 'concept_id': 'tAM8_qNg_sW5', 'legacy_ams_taxonomy_num_id': 485}),
( {'type': 'language', 'id': 'zkfD_Qwv_kTk', 'preferred_label': 'Ukrainska', 'deprecated_legacy_id': '486'},
'language', {'legacy_ams_taxonomy_id': '486', 'type': 'language', 'label': 'Ukrainska', 'concept_id': 'zkfD_Qwv_kTk', 'legacy_ams_taxonomy_num_id': 486}),
( {'type': 'language', 'id': 'TWvN_hko_Uk5', 'preferred_label': 'Umbundu', 'deprecated_legacy_id': '487'},
'language', {'legacy_ams_taxonomy_id': '487', 'type': 'language', 'label': 'Umbundu', 'concept_id': 'TWvN_hko_Uk5', 'legacy_ams_taxonomy_num_id': 487}),
( {'type': 'language', 'id': 'Cs9j_jSN_wNH', 'preferred_label': 'Ungerska', 'deprecated_legacy_id': '488'},
'language', {'legacy_ams_taxonomy_id': '488', 'type': 'language', 'label': 'Ungerska', 'concept_id': 'Cs9j_jSN_wNH', 'legacy_ams_taxonomy_num_id': 488}),
( {'type': 'language', 'id': 'Jw1X_vyk_SbY', 'preferred_label': 'Urdu', 'deprecated_legacy_id': '489'},
'language', {'legacy_ams_taxonomy_id': '489', 'type': 'language', 'label': 'Urdu', 'concept_id': 'Jw1X_vyk_SbY', 'legacy_ams_taxonomy_num_id': 489}),
( {'type': 'language', 'id': '3Xxo_J8v_rez', 'preferred_label': 'Uzbekiska', 'deprecated_legacy_id': '491'},
'language', {'legacy_ams_taxonomy_id': '491', 'type': 'language', 'label': 'Uzbekiska', 'concept_id': '3Xxo_J8v_rez', 'legacy_ams_taxonomy_num_id': 491}),
( {'type': 'language', 'id': 'RqHU_aEE_tJA', 'preferred_label': 'Vietnamesiska', 'deprecated_legacy_id': '492'},
'language', {'legacy_ams_taxonomy_id': '492', 'type': 'language', 'label': 'Vietnamesiska', 'concept_id': 'RqHU_aEE_tJA', 'legacy_ams_taxonomy_num_id': 492}),
( {'type': 'language', 'id': 'i2wN_KYK_kRT', 'preferred_label': 'Vitryska', 'deprecated_legacy_id': '493'},
'language', {'legacy_ams_taxonomy_id': '493', 'type': 'language', 'label': 'Vitryska', 'concept_id': 'i2wN_KYK_kRT', 'legacy_ams_taxonomy_num_id': 493}),
( {'type': 'language', 'id': 'jFod_528_29i', 'preferred_label': 'Walesiska', 'deprecated_legacy_id': '494'},
'language', {'legacy_ams_taxonomy_id': '494', 'type': 'language', 'label': 'Walesiska', 'concept_id': 'jFod_528_29i', 'legacy_ams_taxonomy_num_id': 494}),
( {'type': 'language', 'id': 'GF87_h5U_r6r', 'preferred_label': 'Wolof', 'deprecated_legacy_id': '495'},
'language', {'legacy_ams_taxonomy_id': '495', 'type': 'language', 'label': 'Wolof', 'concept_id': 'GF87_h5U_r6r', 'legacy_ams_taxonomy_num_id': 495}),
( {'type': 'language', 'id': 'ZExV_tjM_Nbo', 'preferred_label': 'Xhosa/Isixhosa', 'deprecated_legacy_id': '496'},
'language', {'legacy_ams_taxonomy_id': '496', 'type': 'language', 'label': 'Xhosa/Isixhosa', 'concept_id': 'ZExV_tjM_Nbo', 'legacy_ams_taxonomy_num_id': 496}),
( {'type': 'language', 'id': 'hWuY_56Y_gEA', 'preferred_label': 'Yoruba', 'deprecated_legacy_id': '498'},
'language', {'legacy_ams_taxonomy_id': '498', 'type': 'language', 'label': 'Yoruba', 'concept_id': 'hWuY_56Y_gEA', 'legacy_ams_taxonomy_num_id': 498}),
( {'type': 'language', 'id': '5sps_VbV_7DK', 'preferred_label': 'Zande/Azande', 'deprecated_legacy_id': '499'},
'language', {'legacy_ams_taxonomy_id': '499', 'type': 'language', 'label': 'Zande/Azande', 'concept_id': '5sps_VbV_7DK', 'legacy_ams_taxonomy_num_id': 499}),
( {'type': 'language', 'id': 'RD8Y_xdr_zdh', 'preferred_label': 'Zhuang', 'deprecated_legacy_id': '500'},
'language', {'legacy_ams_taxonomy_id': '500', 'type': 'language', 'label': 'Zhuang', 'concept_id': 'RD8Y_xdr_zdh', 'legacy_ams_taxonomy_num_id': 500}),
( {'type': 'language', 'id': 'Mhbn_hgq_sa6', 'preferred_label': 'Zulu', 'deprecated_legacy_id': '501'},
'language', {'legacy_ams_taxonomy_id': '501', 'type': 'language', 'label': 'Zulu', 'concept_id': 'Mhbn_hgq_sa6', 'legacy_ams_taxonomy_num_id': 501}),
( {'type': 'language', 'id': 'zSLA_vw2_FXN', 'preferred_label': 'Svenska', 'deprecated_legacy_id': '502'},
'language', {'legacy_ams_taxonomy_id': '502', 'type': 'language', 'label': 'Svenska', 'concept_id': 'zSLA_vw2_FXN', 'legacy_ams_taxonomy_num_id': 502}),
( {'type': 'language', 'id': 'fYiW_4KZ_MHa', 'preferred_label': 'Teckenspråk', 'deprecated_legacy_id': '503'},
'language', {'legacy_ams_taxonomy_id': '503', 'type': 'language', 'label': 'Teckenspråk', 'concept_id': 'fYiW_4KZ_MHa', 'legacy_ams_taxonomy_num_id': 503}),
( {'type': 'language', 'id': '43Dr_HRx_rRx', 'preferred_label': 'Adangme', 'deprecated_legacy_id': '10015'},
'language', {'legacy_ams_taxonomy_id': '10015', 'type': 'language', 'label': 'Adangme', 'concept_id': '43Dr_HRx_rRx', 'legacy_ams_taxonomy_num_id': 10015}),
( {'type': 'language', 'id': 'uDkg_vvB_DsN', 'preferred_label': 'Afrihili', 'deprecated_legacy_id': '10017'},
'language', {'legacy_ams_taxonomy_id': '10017', 'type': 'language', 'label': 'Afrihili', 'concept_id': 'uDkg_vvB_DsN', 'legacy_ams_taxonomy_num_id': 10017}),
( {'type': 'language', 'id': 'RfoX_qzv_t7i', 'preferred_label': 'Afro-asiatiska språk', 'deprecated_legacy_id': '10265'},
'language', {'legacy_ams_taxonomy_id': '10265', 'type': 'language', 'label': 'Afro-asiatiska språk', 'concept_id': 'RfoX_qzv_t7i', 'legacy_ams_taxonomy_num_id': 10265}),
( {'type': 'language', 'id': 'pYrC_AU4_73N', 'preferred_label': 'Akkadiska', 'deprecated_legacy_id': '10266'},
'language', {'legacy_ams_taxonomy_id': '10266', 'type': 'language', 'label': 'Akkadiska', 'concept_id': 'pYrC_AU4_73N', 'legacy_ams_taxonomy_num_id': 10266}),
( {'type': 'language', 'id': 'c2mi_duS_MDX', 'preferred_label': 'Aleutiska', 'deprecated_legacy_id': '10267'},
'language', {'legacy_ams_taxonomy_id': '10267', 'type': 'language', 'label': 'Aleutiska', 'concept_id': 'c2mi_duS_MDX', 'legacy_ams_taxonomy_num_id': 10267}),
( {'type': 'language', 'id': 'N6Hi_gMb_u2D', 'preferred_label': 'Algokinspråk', 'deprecated_legacy_id': '10268'},
'language', {'legacy_ams_taxonomy_id': '10268', 'type': 'language', 'label': 'Algokinspråk', 'concept_id': 'N6Hi_gMb_u2D', 'legacy_ams_taxonomy_num_id': 10268}),
( {'type': 'language', 'id': 'jTzC_UTB_m7d', 'preferred_label': 'Altaiska språk, andra', 'deprecated_legacy_id': '10269'},
'language', {'legacy_ams_taxonomy_id': '10269', 'type': 'language', 'label': 'Altaiska språk, andra', 'concept_id': 'jTzC_UTB_m7d', 'legacy_ams_taxonomy_num_id': 10269}),
( {'type': 'language', 'id': 'b6Pn_p3r_nDz', 'preferred_label': 'Apachespråk', 'deprecated_legacy_id': '10270'},
'language', {'legacy_ams_taxonomy_id': '10270', 'type': 'language', 'label': 'Apachespråk', 'concept_id': 'b6Pn_p3r_nDz', 'legacy_ams_taxonomy_num_id': 10270}),
( {'type': 'language', 'id': 'Z19f_uKB_oTc', 'preferred_label': 'Arapaho', 'deprecated_legacy_id': '10271'},
'language', {'legacy_ams_taxonomy_id': '10271', 'type': 'language', 'label': 'Arapaho', 'concept_id': 'Z19f_uKB_oTc', 'legacy_ams_taxonomy_num_id': 10271}),
( {'type': 'language', 'id': 'cZpA_5RH_23F', 'preferred_label': 'Araukiska', 'deprecated_legacy_id': '10272'},
'language', {'legacy_ams_taxonomy_id': '10272', 'type': 'language', 'label': 'Araukiska', 'concept_id': 'cZpA_5RH_23F', 'legacy_ams_taxonomy_num_id': 10272}),
( {'type': 'language', 'id': 'J4aC_yPX_Sgt', 'preferred_label': 'Arawak', 'deprecated_legacy_id': '10273'},
'language', {'legacy_ams_taxonomy_id': '10273', 'type': 'language', 'label': 'Arawak', 'concept_id': 'J4aC_yPX_Sgt', 'legacy_ams_taxonomy_num_id': 10273}),
( {'type': 'language', 'id': 'XVwz_HH4_PjB', 'preferred_label': 'Artificiella, andra språk', 'deprecated_legacy_id': '10274'},
'language', {'legacy_ams_taxonomy_id': '10274', 'type': 'language', 'label': 'Artificiella, andra språk', 'concept_id': 'XVwz_HH4_PjB', 'legacy_ams_taxonomy_num_id': 10274}),
( {'type': 'language', 'id': 'A2Ts_vri_15G', 'preferred_label': 'Athapaskspråk', 'deprecated_legacy_id': '10275'},
'language', {'legacy_ams_taxonomy_id': '10275', 'type': 'language', 'label': 'Athapaskspråk', 'concept_id': 'A2Ts_vri_15G', 'legacy_ams_taxonomy_num_id': 10275}),
( {'type': 'language', 'id': 'xPeV_5HK_buN', 'preferred_label': 'Australiska språk', 'deprecated_legacy_id': '10276'},
'language', {'legacy_ams_taxonomy_id': '10276', 'type': 'language', 'label': 'Australiska språk', 'concept_id': 'xPeV_5HK_buN', 'legacy_ams_taxonomy_num_id': 10276}),
( {'type': 'language', 'id': '6RTo_v81_XdA', 'preferred_label': 'Austronesiska språk, andra', 'deprecated_legacy_id': '10277'},
'language', {'legacy_ams_taxonomy_id': '10277', 'type': 'language', 'label': 'Austronesiska språk, andra', 'concept_id': '6RTo_v81_XdA', 'legacy_ams_taxonomy_num_id': 10277}),
( {'type': 'language', 'id': 'WzGi_zgx_pbJ', 'preferred_label': 'Avariska', 'deprecated_legacy_id': '10278'},
'language', {'legacy_ams_taxonomy_id': '10278', 'type': 'language', 'label': 'Avariska', 'concept_id': 'WzGi_zgx_pbJ', 'legacy_ams_taxonomy_num_id': 10278}),
( {'type': 'language', 'id': 'V5kR_n15_m1D', 'preferred_label': 'Avestiska', 'deprecated_legacy_id': '10279'},
'language', {'legacy_ams_taxonomy_id': '10279', 'type': 'language', 'label': 'Avestiska', 'concept_id': 'V5kR_n15_m1D', 'legacy_ams_taxonomy_num_id': 10279}),
( {'type': 'language', 'id': 'fwrn_bpj_4vM', 'preferred_label': 'Awadhi', 'deprecated_legacy_id': '10280'},
'language', {'legacy_ams_taxonomy_id': '10280', 'type': 'language', 'label': 'Awadhi', 'concept_id': 'fwrn_bpj_4vM', 'legacy_ams_taxonomy_num_id': 10280}),
( {'type': 'language', 'id': 'DKjf_DVV_vxC', 'preferred_label': 'Acoli', 'deprecated_legacy_id': '10282'},
'language', {'legacy_ams_taxonomy_id': '10282', 'type': 'language', 'label': 'Acoli', 'concept_id': 'DKjf_DVV_vxC', 'legacy_ams_taxonomy_num_id': 10282}),
( {'type': 'language', 'id': '4tXr_2NX_SSy', 'preferred_label': 'Abkhasiska', 'deprecated_legacy_id': '10283'},
'language', {'legacy_ams_taxonomy_id': '10283', 'type': 'language', 'label': 'Abkhasiska', 'concept_id': '4tXr_2NX_SSy', 'legacy_ams_taxonomy_num_id': 10283}),
( {'type': 'language', 'id': 'YJcD_PeA_u4M', 'preferred_label': 'Akinesiska', 'deprecated_legacy_id': '10284'},
'language', {'legacy_ams_taxonomy_id': '10284', 'type': 'language', 'label': 'Akinesiska', 'concept_id': 'YJcD_PeA_u4M', 'legacy_ams_taxonomy_num_id': 10284}),
( {'type': 'language', 'id': 'GcJV_gXD_7YU', 'preferred_label': 'Balinesiska', 'deprecated_legacy_id': '10285'},
'language', {'legacy_ams_taxonomy_id': '10285', 'type': 'language', 'label': 'Balinesiska', 'concept_id': 'GcJV_gXD_7YU', 'legacy_ams_taxonomy_num_id': 10285}),
( {'type': 'language', 'id': 'gFSD_xzk_PfW', 'preferred_label': 'Baltiska språk, andra', 'deprecated_legacy_id': '10286'},
'language', {'legacy_ams_taxonomy_id': '10286', 'type': 'language', 'label': 'Baltiska språk, andra', 'concept_id': 'gFSD_xzk_PfW', 'legacy_ams_taxonomy_num_id': 10286}),
( {'type': 'language', 'id': 'c8iN_jaP_6xc', 'preferred_label': 'Bamilekespråk', 'deprecated_legacy_id': '10288'},
'language', {'legacy_ams_taxonomy_id': '10288', 'type': 'language', 'label': 'Bamilekespråk', 'concept_id': 'c8iN_jaP_6xc', 'legacy_ams_taxonomy_num_id': 10288}),
( {'type': 'language', 'id': 'SRr4_baB_iSZ', 'preferred_label': 'Basa', 'deprecated_legacy_id': '10289'},
'language', {'legacy_ams_taxonomy_id': '10289', 'type': 'language', 'label': 'Basa', 'concept_id': 'SRr4_baB_iSZ', 'legacy_ams_taxonomy_num_id': 10289}),
( {'type': 'language', 'id': 'YHen_8sx_MDd', 'preferred_label': 'Batak (Indonésien)', 'deprecated_legacy_id': '10290'},
'language', {'legacy_ams_taxonomy_id': '10290', 'type': 'language', 'label': 'Batak (Indonésien)', 'concept_id': 'YHen_8sx_MDd', 'legacy_ams_taxonomy_num_id': 10290}),
( {'type': 'language', 'id': 'Tzjp_quT_tX2', 'preferred_label': 'Bedja', 'deprecated_legacy_id': '10291'},
'language', {'legacy_ams_taxonomy_id': '10291', 'type': 'language', 'label': 'Bedja', 'concept_id': 'Tzjp_quT_tX2', 'legacy_ams_taxonomy_num_id': 10291}),
( {'type': 'language', 'id': 'czZH_fp8_mbz', 'preferred_label': 'Bodjpuri', 'deprecated_legacy_id': '10292'},
'language', {'legacy_ams_taxonomy_id': '10292', 'type': 'language', 'label': 'Bodjpuri', 'concept_id': 'czZH_fp8_mbz', 'legacy_ams_taxonomy_num_id': 10292}),
( {'type': 'language', 'id': 'fyTh_C2w_gsy', 'preferred_label': 'Bikol', 'deprecated_legacy_id': '10293'},
'language', {'legacy_ams_taxonomy_id': '10293', 'type': 'language', 'label': 'Bikol', 'concept_id': 'fyTh_C2w_gsy', 'legacy_ams_taxonomy_num_id': 10293}),
( {'type': 'language', 'id': 'QZv8_dXK_dw8', 'preferred_label': 'Bini', 'deprecated_legacy_id': '10294'},
'language', {'legacy_ams_taxonomy_id': '10294', 'type': 'language', 'label': 'Bini', 'concept_id': 'QZv8_dXK_dw8', 'legacy_ams_taxonomy_num_id': 10294}),
( {'type': 'language', 'id': 'XdkL_b18_aE3', 'preferred_label': 'Braj', 'deprecated_legacy_id': '10295'},
'language', {'legacy_ams_taxonomy_id': '10295', 'type': 'language', 'label': 'Braj', 'concept_id': 'XdkL_b18_aE3', 'legacy_ams_taxonomy_num_id': 10295}),
( {'type': 'language', 'id': 'txVD_z3R_P4q', 'preferred_label': 'Bretonska', 'deprecated_legacy_id': '10296'},
'language', {'legacy_ams_taxonomy_id': '10296', 'type': 'language', 'label': 'Bretonska', 'concept_id': 'txVD_z3R_P4q', 'legacy_ams_taxonomy_num_id': 10296}),
( {'type': 'language', 'id': 'becB_LRA_kuX', 'preferred_label': 'Buginesiska', 'deprecated_legacy_id': '10297'},
'language', {'legacy_ams_taxonomy_id': '10297', 'type': 'language', 'label': 'Buginesiska', 'concept_id': 'becB_LRA_kuX', 'legacy_ams_taxonomy_num_id': 10297}),
( {'type': 'language', 'id': '6VZ8_y2a_ViA', 'preferred_label': 'Burjatiska', 'deprecated_legacy_id': '10298'},
'language', {'legacy_ams_taxonomy_id': '10298', 'type': 'language', 'label': 'Burjatiska', 'concept_id': '6VZ8_y2a_ViA', 'legacy_ams_taxonomy_num_id': 10298}),
( {'type': 'language', 'id': 'A5So_xQX_T59', 'preferred_label': 'Caddo', 'deprecated_legacy_id': '10299'},
'language', {'legacy_ams_taxonomy_id': '10299', 'type': 'language', 'label': 'Caddo', 'concept_id': 'A5So_xQX_T59', 'legacy_ams_taxonomy_num_id': 10299}),
( {'type': 'language', 'id': 'QFad_Hdf_EqL', 'preferred_label': 'Karibiska', 'deprecated_legacy_id': '10300'},
'language', {'legacy_ams_taxonomy_id': '10300', 'type': 'language', 'label': 'Karibiska', 'concept_id': 'QFad_Hdf_EqL', 'legacy_ams_taxonomy_num_id': 10300}),
( {'type': 'language', 'id': 'VpQH_nua_x5a', 'preferred_label': 'Kaukasiska språk, andra', 'deprecated_legacy_id': '10302'},
'language', {'legacy_ams_taxonomy_id': '10302', 'type': 'language', 'label': 'Kaukasiska språk, andra', 'concept_id': 'VpQH_nua_x5a', 'legacy_ams_taxonomy_num_id': 10302}),
( {'type': 'language', 'id': 'yy2q_Zsg_6Ei', 'preferred_label': 'Keltiska språk, andra', 'deprecated_legacy_id': '10303'},
'language', {'legacy_ams_taxonomy_id': '10303', 'type': 'language', 'label': 'Keltiska språk, andra', 'concept_id': 'yy2q_Zsg_6Ei', 'legacy_ams_taxonomy_num_id': 10303}),
( {'type': 'language', 'id': 'DUK5_RYX_sRe', 'preferred_label': 'Centralamerikanska indianspråk, andra', 'deprecated_legacy_id': '10304'},
'language', {'legacy_ams_taxonomy_id': '10304', 'type': 'language', 'label': 'Centralamerikanska indianspråk, andra', 'concept_id': 'DUK5_RYX_sRe', 'legacy_ams_taxonomy_num_id': 10304}),
( {'type': 'language', 'id': 'FnFC_4cc_heD', 'preferred_label': 'Chagatai', 'deprecated_legacy_id': '10305'},
'language', {'legacy_ams_taxonomy_id': '10305', 'type': 'language', 'label': 'Chagatai', 'concept_id': 'FnFC_4cc_heD', 'legacy_ams_taxonomy_num_id': 10305}),
( {'type': 'language', 'id': 'uyoM_hFZ_kh1', 'preferred_label': 'Chamiska språk', 'deprecated_legacy_id': '10306'},
'language', {'legacy_ams_taxonomy_id': '10306', 'type': 'language', 'label': 'Chamiska språk', 'concept_id': 'uyoM_hFZ_kh1', 'legacy_ams_taxonomy_num_id': 10306}),
( {'type': 'language', 'id': 'FyZY_BJZ_yz6', 'preferred_label': 'Chamorro', 'deprecated_legacy_id': '10307'},
'language', {'legacy_ams_taxonomy_id': '10307', 'type': 'language', 'label': 'Chamorro', 'concept_id': 'FyZY_BJZ_yz6', 'legacy_ams_taxonomy_num_id': 10307}),
( {'type': 'language', 'id': 'wfdT_62G_T49', 'preferred_label': 'Tjetjenska', 'deprecated_legacy_id': '10308'},
'language', {'legacy_ams_taxonomy_id': '10308', 'type': 'language', 'label': 'Tjetjenska', 'concept_id': 'wfdT_62G_T49', 'legacy_ams_taxonomy_num_id': 10308}),
( {'type': 'language', 'id': 'p8af_zMR_sbN', 'preferred_label': 'Cherokee', 'deprecated_legacy_id': '10309'},
'language', {'legacy_ams_taxonomy_id': '10309', 'type': 'language', 'label': 'Cherokee', 'concept_id': 'p8af_zMR_sbN', 'legacy_ams_taxonomy_num_id': 10309}),
( {'type': 'language', 'id': 'NaRV_tAk_xx2', 'preferred_label': 'Cheyenne', 'deprecated_legacy_id': '10310'},
'language', {'legacy_ams_taxonomy_id': '10310', 'type': 'language', 'label': 'Cheyenne', 'concept_id': 'NaRV_tAk_xx2', 'legacy_ams_taxonomy_num_id': 10310}),
( {'type': 'language', 'id': 'mxQt_Uiv_X9B', 'preferred_label': 'Chibcha', 'deprecated_legacy_id': '10311'},
'language', {'legacy_ams_taxonomy_id': '10311', 'type': 'language', 'label': 'Chibcha', 'concept_id': 'mxQt_Uiv_X9B', 'legacy_ams_taxonomy_num_id': 10311}),
( {'type': 'language', 'id': 'tfxQ_bTn_jVT', 'preferred_label': 'Tsjinuksjargong', 'deprecated_legacy_id': '10312'},
'language', {'legacy_ams_taxonomy_id': '10312', 'type': 'language', 'label': 'Tsjinuksjargong', 'concept_id': 'tfxQ_bTn_jVT', 'legacy_ams_taxonomy_num_id': 10312}),
( {'type': 'language', 'id': 'tKF5_Dm1_PL5', 'preferred_label': 'Chipewyan', 'deprecated_legacy_id': '10313'},
'language', {'legacy_ams_taxonomy_id': '10313', 'type': 'language', 'label': 'Chipewyan', 'concept_id': 'tKF5_Dm1_PL5', 'legacy_ams_taxonomy_num_id': 10313}),
( {'type': 'language', 'id': 'CFaA_CXW_ZLx', 'preferred_label': 'Choctaw', 'deprecated_legacy_id': '10314'},
'language', {'legacy_ams_taxonomy_id': '10314', 'type': 'language', 'label': 'Choctaw', 'concept_id': 'CFaA_CXW_ZLx', 'legacy_ams_taxonomy_num_id': 10314}),
( {'type': 'language', 'id': 'WfH2_RjG_CyW', 'preferred_label': 'Kyrkslaviska', 'deprecated_legacy_id': '10315'},
'language', {'legacy_ams_taxonomy_id': '10315', 'type': 'language', 'label': 'Kyrkslaviska', 'concept_id': 'WfH2_RjG_CyW', 'legacy_ams_taxonomy_num_id': 10315}),
( {'type': 'language', 'id': 'Utfp_DGP_qCS', 'preferred_label': 'Chuukesiska', 'deprecated_legacy_id': '10316'},
'language', {'legacy_ams_taxonomy_id': '10316', 'type': 'language', 'label': 'Chuukesiska', 'concept_id': 'Utfp_DGP_qCS', 'legacy_ams_taxonomy_num_id': 10316}),
( {'type': 'language', 'id': 'gnmK_CdW_viG', 'preferred_label': 'Koptiska', 'deprecated_legacy_id': '10317'},
'language', {'legacy_ams_taxonomy_id': '10317', 'type': 'language', 'label': 'Koptiska', 'concept_id': 'gnmK_CdW_viG', 'legacy_ams_taxonomy_num_id': 10317}),
( {'type': 'language', 'id': 'vk8M_mQD_JtZ', 'preferred_label': 'Korniska', 'deprecated_legacy_id': '10318'},
'language', {'legacy_ams_taxonomy_id': '10318', 'type': 'language', 'label': 'Korniska', 'concept_id': 'vk8M_mQD_JtZ', 'legacy_ams_taxonomy_num_id': 10318}),
( {'type': 'language', 'id': 'Y3nz_qvd_DBW', 'preferred_label': 'Cree', 'deprecated_legacy_id': '10319'},
'language', {'legacy_ams_taxonomy_id': '10319', 'type': 'language', 'label': 'Cree', 'concept_id': 'Y3nz_qvd_DBW', 'legacy_ams_taxonomy_num_id': 10319}),
( {'type': 'language', 'id': 'FzWY_WsG_LUy', 'preferred_label': 'Muskogee', 'deprecated_legacy_id': '10320'},
'language', {'legacy_ams_taxonomy_id': '10320', 'type': 'language', 'label': 'Muskogee', 'concept_id': 'FzWY_WsG_LUy', 'legacy_ams_taxonomy_num_id': 10320}),
( {'type': 'language', 'id': 'e5AH_3JG_yc1', 'preferred_label': 'Kreolska och pidginspråk, andra', 'deprecated_legacy_id': '10321'},
'language', {'legacy_ams_taxonomy_id': '10321', 'type': 'language', 'label': 'Kreolska och pidginspråk, andra', 'concept_id': 'e5AH_3JG_yc1', 'legacy_ams_taxonomy_num_id': 10321}),
( {'type': 'language', 'id': 'h35H_jBx_XFy', 'preferred_label': 'Kreolska och pidginspråk, engelsk-baserade, andra', 'deprecated_legacy_id': '10322'},
'language', {'legacy_ams_taxonomy_id': '10322', 'type': 'language', 'label': 'Kreolska och pidginspråk, engelsk-baserade, andra', 'concept_id': 'h35H_jBx_XFy', 'legacy_ams_taxonomy_num_id': 10322}),
( {'type': 'language', 'id': 'R8WU_fQb_Y4E', 'preferred_label': 'Kreolska och pidginspråk, fransk-baserade, andra', 'deprecated_legacy_id': '10323'},
'language', {'legacy_ams_taxonomy_id': '10323', 'type': 'language', 'label': 'Kreolska och pidginspråk, fransk-baserade, andra', 'concept_id': 'R8WU_fQb_Y4E', 'legacy_ams_taxonomy_num_id': 10323}),
( {'type': 'language', 'id': 'LrDr_WmD_Ljb', 'preferred_label': 'Kusjittiska språk, andra', 'deprecated_legacy_id': '10324'},
'language', {'legacy_ams_taxonomy_id': '10324', 'type': 'language', 'label': 'Kusjittiska språk, andra', 'concept_id': 'LrDr_WmD_Ljb', 'legacy_ams_taxonomy_num_id': 10324}),
( {'type': 'language', 'id': 'MXbX_9Du_nkp', 'preferred_label': 'Dakota', 'deprecated_legacy_id': '10325'},
'language', {'legacy_ams_taxonomy_id': '10325', 'type': 'language', 'label': 'Dakota', 'concept_id': 'MXbX_9Du_nkp', 'legacy_ams_taxonomy_num_id': 10325}),
( {'type': 'language', 'id': 'AvDT_nvZ_uig', 'preferred_label': 'Dajak', 'deprecated_legacy_id': '10326'},
'language', {'legacy_ams_taxonomy_id': '10326', 'type': 'language', 'label': 'Dajak', 'concept_id': 'AvDT_nvZ_uig', 'legacy_ams_taxonomy_num_id': 10326}),
( {'type': 'language', 'id': 'Kpju_m4q_31i', 'preferred_label': 'Delaware', 'deprecated_legacy_id': '10327'},
'language', {'legacy_ams_taxonomy_id': '10327', 'type': 'language', 'label': 'Delaware', 'concept_id': 'Kpju_m4q_31i', 'legacy_ams_taxonomy_num_id': 10327}),
( {'type': 'language', 'id': 'ttMr_bG7_Go7', 'preferred_label': 'Dogri', 'deprecated_legacy_id': '10328'},
'language', {'legacy_ams_taxonomy_id': '10328', 'type': 'language', 'label': 'Dogri', 'concept_id': 'ttMr_bG7_Go7', 'legacy_ams_taxonomy_num_id': 10328}),
( {'type': 'language', 'id': 'utaN_9Tq_yM3', 'preferred_label': 'Dogrib', 'deprecated_legacy_id': '10329'},
'language', {'legacy_ams_taxonomy_id': '10329', 'type': 'language', 'label': 'Dogrib', 'concept_id': 'utaN_9Tq_yM3', 'legacy_ams_taxonomy_num_id': 10329}),
( {'type': 'language', 'id': '9AnT_Sut_QBs', 'preferred_label': 'Dravidiska språk, andra', 'deprecated_legacy_id': '10330'},
'language', {'legacy_ams_taxonomy_id': '10330', 'type': 'language', 'label': 'Dravidiska språk, andra', 'concept_id': '9AnT_Sut_QBs', 'legacy_ams_taxonomy_num_id': 10330}),
( {'type': 'language', 'id': 'HnUQ_rah_Akr', 'preferred_label': 'Duala', 'deprecated_legacy_id': '10331'},
'language', {'legacy_ams_taxonomy_id': '10331', 'type': 'language', 'label': 'Duala', 'concept_id': 'HnUQ_rah_Akr', 'legacy_ams_taxonomy_num_id': 10331}),
( {'type': 'language', 'id': '7a3p_ktX_vgP', 'preferred_label': 'Medelnederländska', 'deprecated_legacy_id': '10332'},
'language', {'legacy_ams_taxonomy_id': '10332', 'type': 'language', 'label': 'Medelnederländska', 'concept_id': '7a3p_ktX_vgP', 'legacy_ams_taxonomy_num_id': 10332}),
( {'type': 'language', 'id': 'bJXz_kjT_LfC', 'preferred_label': 'Egyptiska', 'deprecated_legacy_id': '10333'},
'language', {'legacy_ams_taxonomy_id': '10333', 'type': 'language', 'label': 'Egyptiska', 'concept_id': 'bJXz_kjT_LfC', 'legacy_ams_taxonomy_num_id': 10333}),
( {'type': 'language', 'id': 'uhGZ_Xif_8jX', 'preferred_label': 'Ekajuk', 'deprecated_legacy_id': '10334'},
'language', {'legacy_ams_taxonomy_id': '10334', 'type': 'language', 'label': 'Ekajuk', 'concept_id': 'uhGZ_Xif_8jX', 'legacy_ams_taxonomy_num_id': 10334}),
( {'type': 'language', 'id': 'NCju_o5B_Qhv', 'preferred_label': 'Elamitiska', 'deprecated_legacy_id': '10335'},
'language', {'legacy_ams_taxonomy_id': '10335', 'type': 'language', 'label': 'Elamitiska', 'concept_id': 'NCju_o5B_Qhv', 'legacy_ams_taxonomy_num_id': 10335}),
( {'type': 'language', 'id': 'ww2N_GEd_Pc7', 'preferred_label': 'Medelengelska', 'deprecated_legacy_id': '10336'},
'language', {'legacy_ams_taxonomy_id': '10336', 'type': 'language', 'label': 'Medelengelska', 'concept_id': 'ww2N_GEd_Pc7', 'legacy_ams_taxonomy_num_id': 10336}),
( {'type': 'language', 'id': 'hUGZ_TrC_T7v', 'preferred_label': 'Gammelengelska', 'deprecated_legacy_id': '10337'},
'language', {'legacy_ams_taxonomy_id': '10337', 'type': 'language', 'label': 'Gammelengelska', 'concept_id': 'hUGZ_TrC_T7v', 'legacy_ams_taxonomy_num_id': 10337}),
( {'type': 'language', 'id': 'aqBv_yoE_YVf', 'preferred_label': 'Esperanto', 'deprecated_legacy_id': '10338'},
'language', {'legacy_ams_taxonomy_id': '10338', 'type': 'language', 'label': 'Esperanto', 'concept_id': 'aqBv_yoE_YVf', 'legacy_ams_taxonomy_num_id': 10338}),
( {'type': 'language', 'id': 'aRMQ_MKY_kwp', 'preferred_label': 'Éwondo', 'deprecated_legacy_id': '10339'},
'language', {'legacy_ams_taxonomy_id': '10339', 'type': 'language', 'label': 'Éwondo', 'concept_id': 'aRMQ_MKY_kwp', 'legacy_ams_taxonomy_num_id': 10339}),
( {'type': 'language', 'id': 'RRwx_hXb_bRK', 'preferred_label': 'Finsk-ugriska språk, andra', 'deprecated_legacy_id': '10340'},
'language', {'legacy_ams_taxonomy_id': '10340', 'type': 'language', 'label': 'Finsk-ugriska språk, andra', 'concept_id': 'RRwx_hXb_bRK', 'legacy_ams_taxonomy_num_id': 10340}),
( {'type': 'language', 'id': 'k9XX_SU3_PiE', 'preferred_label': 'Medelfranska', 'deprecated_legacy_id': '10341'},
'language', {'legacy_ams_taxonomy_id': '10341', 'type': 'language', 'label': 'Medelfranska', 'concept_id': 'k9XX_SU3_PiE', 'legacy_ams_taxonomy_num_id': 10341}),
( {'type': 'language', 'id': 'LHyw_YUi_539', 'preferred_label': 'Friuliska', 'deprecated_legacy_id': '10342'},
'language', {'legacy_ams_taxonomy_id': '10342', 'type': 'language', 'label': 'Friuliska', 'concept_id': 'LHyw_YUi_539', 'legacy_ams_taxonomy_num_id': 10342}),
( {'type': 'language', 'id': 'XDyM_jnY_2XB', 'preferred_label': 'Gayo', 'deprecated_legacy_id': '10344'},
'language', {'legacy_ams_taxonomy_id': '10344', 'type': 'language', 'label': 'Gayo', 'concept_id': 'XDyM_jnY_2XB', 'legacy_ams_taxonomy_num_id': 10344}),
( {'type': 'language', 'id': 'aayg_wup_G3z', 'preferred_label': 'Gbaya', 'deprecated_legacy_id': '10345'},
'language', {'legacy_ams_taxonomy_id': '10345', 'type': 'language', 'label': 'Gbaya', 'concept_id': 'aayg_wup_G3z', 'legacy_ams_taxonomy_num_id': 10345}),
( {'type': 'language', 'id': 'nX5K_BFZ_CGM', 'preferred_label': 'Geez', 'deprecated_legacy_id': '10346'},
'language', {'legacy_ams_taxonomy_id': '10346', 'type': 'language', 'label': 'Geez', 'concept_id': 'nX5K_BFZ_CGM', 'legacy_ams_taxonomy_num_id': 10346}),
( {'type': 'language', 'id': 'kMxH_v1Y_jcW', 'preferred_label': 'Medelhögtyska', 'deprecated_legacy_id': '10347'},
'language', {'legacy_ams_taxonomy_id': '10347', 'type': 'language', 'label': 'Medelhögtyska', 'concept_id': 'kMxH_v1Y_jcW', 'legacy_ams_taxonomy_num_id': 10347}),
( {'type': 'language', 'id': '2s87_4M9_mF8', 'preferred_label': 'Gammalhögtyska', 'deprecated_legacy_id': '10348'},
'language', {'legacy_ams_taxonomy_id': '10348', 'type': 'language', 'label': 'Gammalhögtyska', 'concept_id': '2s87_4M9_mF8', 'legacy_ams_taxonomy_num_id': 10348}),
( {'type': 'language', 'id': 'oNtF_Wh5_nL3', 'preferred_label': 'Germanska språk, andra', 'deprecated_legacy_id': '10349'},
'language', {'legacy_ams_taxonomy_id': '10349', 'type': 'language', 'label': 'Germanska språk, andra', 'concept_id': 'oNtF_Wh5_nL3', 'legacy_ams_taxonomy_num_id': 10349}),
( {'type': 'language', 'id': 'Sta6_5fE_6YC', 'preferred_label': 'Gondi', 'deprecated_legacy_id': '10351'},
'language', {'legacy_ams_taxonomy_id': '10351', 'type': 'language', 'label': 'Gondi', 'concept_id': 'Sta6_5fE_6YC', 'legacy_ams_taxonomy_num_id': 10351}),
( {'type': 'language', 'id': 'WvNj_WvF_CMS', 'preferred_label': 'Gorontalo', 'deprecated_legacy_id': '10352'},
'language', {'legacy_ams_taxonomy_id': '10352', 'type': 'language', 'label': 'Gorontalo', 'concept_id': 'WvNj_WvF_CMS', 'legacy_ams_taxonomy_num_id': 10352}),
( {'type': 'language', 'id': 'GB2g_Bhp_zh7', 'preferred_label': 'Gotiska', 'deprecated_legacy_id': '10353'},
'language', {'legacy_ams_taxonomy_id': '10353', 'type': 'language', 'label': 'Gotiska', 'concept_id': 'GB2g_Bhp_zh7', 'legacy_ams_taxonomy_num_id': 10353}),
( {'type': 'language', 'id': '1V1A_8LC_9FL', 'preferred_label': 'Grebo', 'deprecated_legacy_id': '10354'},
'language', {'legacy_ams_taxonomy_id': '10354', 'type': 'language', 'label': 'Grebo', 'concept_id': '1V1A_8LC_9FL', 'legacy_ams_taxonomy_num_id': 10354}),
( {'type': 'language', 'id': 'sMa9_mkN_w7L', 'preferred_label': 'Gammalgrekiska', 'deprecated_legacy_id': '10355'},
'language', {'legacy_ams_taxonomy_id': '10355', 'type': 'language', 'label': 'Gammalgrekiska', 'concept_id': 'sMa9_mkN_w7L', 'legacy_ams_taxonomy_num_id': 10355}),
( {'type': 'language', 'id': 'pLK6_YGd_bDZ', 'preferred_label': "Gwich'in", 'deprecated_legacy_id': '10356'},
'language', {'legacy_ams_taxonomy_id': '10356', 'type': 'language', 'label': "Gwich'in", 'concept_id': 'pLK6_YGd_bDZ', 'legacy_ams_taxonomy_num_id': 10356}),
( {'type': 'language', 'id': 'ufzT_NXJ_Gbx', 'preferred_label': 'Haida', 'deprecated_legacy_id': '10357'},
'language', {'legacy_ams_taxonomy_id': '10357', 'type': 'language', 'label': 'Haida', 'concept_id': 'ufzT_NXJ_Gbx', 'legacy_ams_taxonomy_num_id': 10357}),
( {'type': 'language', 'id': 'Xfhf_EwK_2ej', 'preferred_label': 'Hawaiiska', 'deprecated_legacy_id': '10358'},
'language', {'legacy_ams_taxonomy_id': '10358', 'type': 'language', 'label': 'Hawaiiska', 'concept_id': 'Xfhf_EwK_2ej', 'legacy_ams_taxonomy_num_id': 10358}),
( {'type': 'language', 'id': 'H2Le_YR5_AnM', 'preferred_label': 'Hiligaynon', 'deprecated_legacy_id': '10359'},
'language', {'legacy_ams_taxonomy_id': '10359', 'type': 'language', 'label': 'Hiligaynon', 'concept_id': 'H2Le_YR5_AnM', 'legacy_ams_taxonomy_num_id': 10359}),
( {'type': 'language', 'id': 'iNVQ_m3Y_oxH', 'preferred_label': 'Himachali', 'deprecated_legacy_id': '10360'},
'language', {'legacy_ams_taxonomy_id': '10360', 'type': 'language', 'label': 'Himachali', 'concept_id': 'iNVQ_m3Y_oxH', 'legacy_ams_taxonomy_num_id': 10360}),
( {'type': 'language', 'id': 'hYDU_LrU_QCt', 'preferred_label': 'Hiri Motu', 'deprecated_legacy_id': '10361'},
'language', {'legacy_ams_taxonomy_id': '10361', 'type': 'language', 'label': 'Hiri Motu', 'concept_id': 'hYDU_LrU_QCt', 'legacy_ams_taxonomy_num_id': 10361}),
( {'type': 'language', 'id': 'D8L1_GrU_UEk', 'preferred_label': 'Hettittiska', 'deprecated_legacy_id': '10362'},
'language', {'legacy_ams_taxonomy_id': '10362', 'type': 'language', 'label': 'Hettittiska', 'concept_id': 'D8L1_GrU_UEk', 'legacy_ams_taxonomy_num_id': 10362}),
( {'type': 'language', 'id': 'CejU_23x_JPS', 'preferred_label': 'Hmong', 'deprecated_legacy_id': '10363'},
'language', {'legacy_ams_taxonomy_id': '10363', 'type': 'language', 'label': 'Hmong', 'concept_id': 'CejU_23x_JPS', 'legacy_ams_taxonomy_num_id': 10363}),
( {'type': 'language', 'id': '5G9f_Xs6_R9R', 'preferred_label': 'Hupa', 'deprecated_legacy_id': '10364'},
'language', {'legacy_ams_taxonomy_id': '10364', 'type': 'language', 'label': 'Hupa', 'concept_id': '5G9f_Xs6_R9R', 'legacy_ams_taxonomy_num_id': 10364}),
( {'type': 'language', 'id': 'sggr_4ba_xWP', 'preferred_label': 'Iban', 'deprecated_legacy_id': '10365'},
'language', {'legacy_ams_taxonomy_id': '10365', 'type': 'language', 'label': 'Iban', 'concept_id': 'sggr_4ba_xWP', 'legacy_ams_taxonomy_num_id': 10365}),
( {'type': 'language', 'id': '3dD8_TTW_5wh', 'preferred_label': 'Ijo', 'deprecated_legacy_id': '10366'},
'language', {'legacy_ams_taxonomy_id': '10366', 'type': 'language', 'label': 'Ijo', 'concept_id': '3dD8_TTW_5wh', 'legacy_ams_taxonomy_num_id': 10366}),
( {'type': 'language', 'id': 'yBCa_NHj_TcN', 'preferred_label': 'Iloko', 'deprecated_legacy_id': '10367'},
'language', {'legacy_ams_taxonomy_id': '10367', 'type': 'language', 'label': 'Iloko', 'concept_id': 'yBCa_NHj_TcN', 'legacy_ams_taxonomy_num_id': 10367}),
( {'type': 'language', 'id': 'P69L_FCv_sf9', 'preferred_label': 'Indo-iranska språk, andra', 'deprecated_legacy_id': '10368'},
'language', {'legacy_ams_taxonomy_id': '10368', 'type': 'language', 'label': 'Indo-iranska språk, andra', 'concept_id': 'P69L_FCv_sf9', 'legacy_ams_taxonomy_num_id': 10368}),
( {'type': 'language', 'id': 'kwP5_3pt_hk9', 'preferred_label': 'Indo-europeiska språk, andra', 'deprecated_legacy_id': '10369'},
'language', {'legacy_ams_taxonomy_id': '10369', 'type': 'language', 'label': 'Indo-europeiska språk, andra', 'concept_id': 'kwP5_3pt_hk9', 'legacy_ams_taxonomy_num_id': 10369}),
( {'type': 'language', 'id': 'dWU4_ed7_jX6', 'preferred_label': 'Interlingua', 'deprecated_legacy_id': '10370'},
'language', {'legacy_ams_taxonomy_id': '10370', 'type': 'language', 'label': 'Interlingua', 'concept_id': 'dWU4_ed7_jX6', 'legacy_ams_taxonomy_num_id': 10370}),
( {'type': 'language', 'id': 'r2HQ_7Dt_N2N', 'preferred_label': 'Inuktitut', 'deprecated_legacy_id': '10371'},
'language', {'legacy_ams_taxonomy_id': '10371', 'type': 'language', 'label': 'Inuktitut', 'concept_id': 'r2HQ_7Dt_N2N', 'legacy_ams_taxonomy_num_id': 10371}),
( {'type': 'language', 'id': 'gXVC_bNa_VdA', 'preferred_label': 'Inupiak', 'deprecated_legacy_id': '10372'},
'language', {'legacy_ams_taxonomy_id': '10372', 'type': 'language', 'label': 'Inupiak', 'concept_id': 'gXVC_bNa_VdA', 'legacy_ams_taxonomy_num_id': 10372}),
( {'type': 'language', 'id': 'kafF_y2Q_Md2', 'preferred_label': 'Iranska språk, andra', 'deprecated_legacy_id': '10373'},
'language', {'legacy_ams_taxonomy_id': '10373', 'type': 'language', 'label': 'Iranska språk, andra', 'concept_id': 'kafF_y2Q_Md2', 'legacy_ams_taxonomy_num_id': 10373}),
( {'type': 'language', 'id': '8G95_iDg_rtV', 'preferred_label': 'Medelirisk', 'deprecated_legacy_id': '10374'},
'language', {'legacy_ams_taxonomy_id': '10374', 'type': 'language', 'label': 'Medelirisk', 'concept_id': '8G95_iDg_rtV', 'legacy_ams_taxonomy_num_id': 10374}),
( {'type': 'language', 'id': '8VDp_XA9_dBF', 'preferred_label': 'Gammaliriska', 'deprecated_legacy_id': '10375'},
'language', {'legacy_ams_taxonomy_id': '10375', 'type': 'language', 'label': 'Gammaliriska', 'concept_id': '8VDp_XA9_dBF', 'legacy_ams_taxonomy_num_id': 10375}),
( {'type': 'language', 'id': 'rdv1_9u8_wCM', 'preferred_label': 'Irokesarspråk', 'deprecated_legacy_id': '10376'},
'language', {'legacy_ams_taxonomy_id': '10376', 'type': 'language', 'label': 'Irokesarspråk', 'concept_id': 'rdv1_9u8_wCM', 'legacy_ams_taxonomy_num_id': 10376}),
( {'type': 'language', 'id': '64Rg_xyJ_bmN', 'preferred_label': 'Judeo-arabisk', 'deprecated_legacy_id': '10377'},
'language', {'legacy_ams_taxonomy_id': '10377', 'type': 'language', 'label': 'Judeo-arabisk', 'concept_id': '64Rg_xyJ_bmN', 'legacy_ams_taxonomy_num_id': 10377}),
( {'type': 'language', 'id': 'W5rh_1Ec_sox', 'preferred_label': 'Judeo-persiska', 'deprecated_legacy_id': '10378'},
'language', {'legacy_ams_taxonomy_id': '10378', 'type': 'language', 'label': 'Judeo-persiska', 'concept_id': 'W5rh_1Ec_sox', 'legacy_ams_taxonomy_num_id': 10378}),
( {'type': 'language', 'id': 'ZsK2_s92_xaW', 'preferred_label': 'Kachin', 'deprecated_legacy_id': '10379'},
'language', {'legacy_ams_taxonomy_id': '10379', 'type': 'language', 'label': 'Kachin', 'concept_id': 'ZsK2_s92_xaW', 'legacy_ams_taxonomy_num_id': 10379}),
( {'type': 'language', 'id': 'brZn_27W_A9K', 'preferred_label': 'Karakalpak', 'deprecated_legacy_id': '10381'},
'language', {'legacy_ams_taxonomy_id': '10381', 'type': 'language', 'label': 'Karakalpak', 'concept_id': 'brZn_27W_A9K', 'legacy_ams_taxonomy_num_id': 10381}),
( {'type': 'language', 'id': 'DuPf_Z28_3Jv', 'preferred_label': 'Kawi', 'deprecated_legacy_id': '10383'},
'language', {'legacy_ams_taxonomy_id': '10383', 'type': 'language', 'label': 'Kawi', 'concept_id': 'DuPf_Z28_3Jv', 'legacy_ams_taxonomy_num_id': 10383}),
( {'type': 'language', 'id': 'e84R_V8f_fXS', 'preferred_label': 'Khasi', 'deprecated_legacy_id': '10384'},
'language', {'legacy_ams_taxonomy_id': '10384', 'type': 'language', 'label': 'Khasi', 'concept_id': 'e84R_V8f_fXS', 'legacy_ams_taxonomy_num_id': 10384}),
( {'type': 'language', 'id': 'Vdz7_pdG_bTJ', 'preferred_label': 'Khoisanspråk, andra', 'deprecated_legacy_id': '10385'},
'language', {'legacy_ams_taxonomy_id': '10385', 'type': 'language', 'label': 'Khoisanspråk, andra', 'concept_id': 'Vdz7_pdG_bTJ', 'legacy_ams_taxonomy_num_id': 10385}),
( {'type': 'language', 'id': 'aF96_PaA_VAs', 'preferred_label': 'Khotanesiska', 'deprecated_legacy_id': '10386'},
'language', {'legacy_ams_taxonomy_id': '10386', 'type': 'language', 'label': 'Khotanesiska', 'concept_id': 'aF96_PaA_VAs', 'legacy_ams_taxonomy_num_id': 10386}),
( {'type': 'language', 'id': 'PZH4_EGP_Dz3', 'preferred_label': 'Kimbundu', 'deprecated_legacy_id': '10388'},
'language', {'legacy_ams_taxonomy_id': '10388', 'type': 'language', 'label': 'Kimbundu', 'concept_id': 'PZH4_EGP_Dz3', 'legacy_ams_taxonomy_num_id': 10388}),
( {'type': 'language', 'id': 'KVSQ_4pu_RSs', 'preferred_label': 'Komi', 'deprecated_legacy_id': '10389'},
'language', {'legacy_ams_taxonomy_id': '10389', 'type': 'language', 'label': 'Komi', 'concept_id': 'KVSQ_4pu_RSs', 'legacy_ams_taxonomy_num_id': 10389}),
( {'type': 'language', 'id': 'gsoZ_3LM_C79', 'preferred_label': 'Kosraeiska', 'deprecated_legacy_id': '10390'},
'language', {'legacy_ams_taxonomy_id': '10390', 'type': 'language', 'label': 'Kosraeiska', 'concept_id': 'gsoZ_3LM_C79', 'legacy_ams_taxonomy_num_id': 10390}),
( {'type': 'language', 'id': 'nT65_Jya_ocT', 'preferred_label': 'Kpelle', 'deprecated_legacy_id': '10391'},
'language', {'legacy_ams_taxonomy_id': '10391', 'type': 'language', 'label': 'Kpelle', 'concept_id': 'nT65_Jya_ocT', 'legacy_ams_taxonomy_num_id': 10391}),
( {'type': 'language', 'id': 'sXAB_vhU_zN8', 'preferred_label': 'Kuanyama', 'deprecated_legacy_id': '10392'},
'language', {'legacy_ams_taxonomy_id': '10392', 'type': 'language', 'label': 'Kuanyama', 'concept_id': 'sXAB_vhU_zN8', 'legacy_ams_taxonomy_num_id': 10392}),
( {'type': 'language', 'id': 'MZ9f_S5d_6Wo', 'preferred_label': 'Kumykiska', 'deprecated_legacy_id': '10393'},
'language', {'legacy_ams_taxonomy_id': '10393', 'type': 'language', 'label': 'Kumykiska', 'concept_id': 'MZ9f_S5d_6Wo', 'legacy_ams_taxonomy_num_id': 10393}),
( {'type': 'language', 'id': 'qTKS_snK_ezT', 'preferred_label': 'Kurukh', 'deprecated_legacy_id': '10394'},
'language', {'legacy_ams_taxonomy_id': '10394', 'type': 'language', 'label': 'Kurukh', 'concept_id': 'qTKS_snK_ezT', 'legacy_ams_taxonomy_num_id': 10394}),
( {'type': 'language', 'id': 'fLPj_PDh_SQJ', 'preferred_label': 'Kutenai', 'deprecated_legacy_id': '10395'},
'language', {'legacy_ams_taxonomy_id': '10395', 'type': 'language', 'label': 'Kutenai', 'concept_id': 'fLPj_PDh_SQJ', 'legacy_ams_taxonomy_num_id': 10395}),
( {'type': 'language', 'id': 'B9id_Ecv_qji', 'preferred_label': 'Ladino', 'deprecated_legacy_id': '10396'},
'language', {'legacy_ams_taxonomy_id': '10396', 'type': 'language', 'label': 'Ladino', 'concept_id': 'B9id_Ecv_qji', 'legacy_ams_taxonomy_num_id': 10396}),
( {'type': 'language', 'id': '73sF_ejf_2Vx', 'preferred_label': 'Lahnda', 'deprecated_legacy_id': '10397'},
'language', {'legacy_ams_taxonomy_id': '10397', 'type': 'language', 'label': 'Lahnda', 'concept_id': '73sF_ejf_2Vx', 'legacy_ams_taxonomy_num_id': 10397}),
( {'type': 'language', 'id': '7nWL_Bzc_RFQ', 'preferred_label': 'Latin', 'deprecated_legacy_id': '10400'},
'language', {'legacy_ams_taxonomy_id': '10400', 'type': 'language', 'label': 'Latin', 'concept_id': '7nWL_Bzc_RFQ', 'legacy_ams_taxonomy_num_id': 10400}),
( {'type': 'language', 'id': '9ig9_ypn_cVw', 'preferred_label': 'Lesgiska', 'deprecated_legacy_id': '10401'},
'language', {'legacy_ams_taxonomy_id': '10401', 'type': 'language', 'label': 'Lesgiska', 'concept_id': '9ig9_ypn_cVw', 'legacy_ams_taxonomy_num_id': 10401}),
( {'type': 'language', 'id': 'yA84_KQv_pKJ', 'preferred_label': 'Luba-Lulua', 'deprecated_legacy_id': '10402'},
'language', {'legacy_ams_taxonomy_id': '10402', 'type': 'language', 'label': 'Luba-Lulua', 'concept_id': 'yA84_KQv_pKJ', 'legacy_ams_taxonomy_num_id': 10402}),
( {'type': 'language', 'id': 'rEi5_NuN_9xC', 'preferred_label': 'Luiseno', 'deprecated_legacy_id': '10403'},
'language', {'legacy_ams_taxonomy_id': '10403', 'type': 'language', 'label': 'Luiseno', 'concept_id': 'rEi5_NuN_9xC', 'legacy_ams_taxonomy_num_id': 10403}),
( {'type': 'language', 'id': 'qeKC_PXn_cHU', 'preferred_label': 'Lushai', 'deprecated_legacy_id': '10404'},
'language', {'legacy_ams_taxonomy_id': '10404', 'type': 'language', 'label': 'Lushai', 'concept_id': 'qeKC_PXn_cHU', 'legacy_ams_taxonomy_num_id': 10404}),
( {'type': 'language', 'id': 'rJah_bYL_qdW', 'preferred_label': 'Magahi', 'deprecated_legacy_id': '10405'},
'language', {'legacy_ams_taxonomy_id': '10405', 'type': 'language', 'label': 'Magahi', 'concept_id': 'rJah_bYL_qdW', 'legacy_ams_taxonomy_num_id': 10405}),
( {'type': 'language', 'id': 'AzXn_4ic_B5Y', 'preferred_label': 'Maithili', 'deprecated_legacy_id': '10406'},
'language', {'legacy_ams_taxonomy_id': '10406', 'type': 'language', 'label': 'Maithili', 'concept_id': 'AzXn_4ic_B5Y', 'legacy_ams_taxonomy_num_id': 10406}),
( {'type': 'language', 'id': 'ER1i_tUG_y4e', 'preferred_label': 'Makassar', 'deprecated_legacy_id': '10407'},
'language', {'legacy_ams_taxonomy_id': '10407', 'type': 'language', 'label': 'Makassar', 'concept_id': 'ER1i_tUG_y4e', 'legacy_ams_taxonomy_num_id': 10407}),
( {'type': 'language', 'id': 'PvjG_Ak1_L71', 'preferred_label': 'Mandingo', 'deprecated_legacy_id': '10408'},
'language', {'legacy_ams_taxonomy_id': '10408', 'type': 'language', 'label': 'Mandingo', 'concept_id': 'PvjG_Ak1_L71', 'legacy_ams_taxonomy_num_id': 10408}),
( {'type': 'language', 'id': '4xVc_tVS_85F', 'preferred_label': 'Manipuriska', 'deprecated_legacy_id': '10409'},
'language', {'legacy_ams_taxonomy_id': '10409', 'type': 'language', 'label': 'Manipuriska', 'concept_id': '4xVc_tVS_85F', 'legacy_ams_taxonomy_num_id': 10409}),
( {'type': 'language', 'id': 'A4h7_WDJ_Qzf', 'preferred_label': 'Manobospråk', 'deprecated_legacy_id': '10410'},
'language', {'legacy_ams_taxonomy_id': '10410', 'type': 'language', 'label': 'Manobospråk', 'concept_id': 'A4h7_WDJ_Qzf', 'legacy_ams_taxonomy_num_id': 10410}),
( {'type': 'language', 'id': 'JDk9_Yia_DPQ', 'preferred_label': 'Marshalliska', 'deprecated_legacy_id': '10411'},
'language', {'legacy_ams_taxonomy_id': '10411', 'type': 'language', 'label': 'Marshalliska', 'concept_id': 'JDk9_Yia_DPQ', 'legacy_ams_taxonomy_num_id': 10411}),
( {'type': 'language', 'id': '3ueP_nhZ_1em', 'preferred_label': 'Micmac', 'deprecated_legacy_id': '10412'},
'language', {'legacy_ams_taxonomy_id': '10412', 'type': 'language', 'label': 'Micmac', 'concept_id': '3ueP_nhZ_1em', 'legacy_ams_taxonomy_num_id': 10412}),
( {'type': 'language', 'id': 'hB5i_2eY_Kur', 'preferred_label': 'Minangkabau', 'deprecated_legacy_id': '10413'},
'language', {'legacy_ams_taxonomy_id': '10413', 'type': 'language', 'label': 'Minangkabau', 'concept_id': 'hB5i_2eY_Kur', 'legacy_ams_taxonomy_num_id': 10413}),
( {'type': 'language', 'id': '8GQ1_Avf_vdR', 'preferred_label': 'Diverse språk', 'deprecated_legacy_id': '10414'},
'language', {'legacy_ams_taxonomy_id': '10414', 'type': 'language', 'label': 'Diverse språk', 'concept_id': '8GQ1_Avf_vdR', 'legacy_ams_taxonomy_num_id': 10414}),
( {'type': 'language', 'id': 's6ka_gDZ_Ycb', 'preferred_label': 'Mohawk', 'deprecated_legacy_id': '10415'},
'language', {'legacy_ams_taxonomy_id': '10415', 'type': 'language', 'label': 'Mohawk', 'concept_id': 's6ka_gDZ_Ycb', 'legacy_ams_taxonomy_num_id': 10415}),
( {'type': 'language', 'id': 'wcNi_yzQ_n9V', 'preferred_label': 'Monkhmerspråk, andra', 'deprecated_legacy_id': '10416'},
'language', {'legacy_ams_taxonomy_id': '10416', 'type': 'language', 'label': 'Monkhmerspråk, andra', 'concept_id': 'wcNi_yzQ_n9V', 'legacy_ams_taxonomy_num_id': 10416}),
( {'type': 'language', 'id': 'En9t_Siu_7yx', 'preferred_label': 'Mongo', 'deprecated_legacy_id': '10417'},
'language', {'legacy_ams_taxonomy_id': '10417', 'type': 'language', 'label': 'Mongo', 'concept_id': 'En9t_Siu_7yx', 'legacy_ams_taxonomy_num_id': 10417}),
( {'type': 'language', 'id': 'o8Xp_wvY_5pu', 'preferred_label': 'Flera språk', 'deprecated_legacy_id': '10419'},
'language', {'legacy_ams_taxonomy_id': '10419', 'type': 'language', 'label': 'Flera språk', 'concept_id': 'o8Xp_wvY_5pu', 'legacy_ams_taxonomy_num_id': 10419}),
( {'type': 'language', 'id': 'EUGX_wJT_qxE', 'preferred_label': 'Mundspråk', 'deprecated_legacy_id': '10420'},
'language', {'legacy_ams_taxonomy_id': '10420', 'type': 'language', 'label': 'Mundspråk', 'concept_id': 'EUGX_wJT_qxE', 'legacy_ams_taxonomy_num_id': 10420}),
( {'type': 'language', 'id': '8ZiC_PNc_hkY', 'preferred_label': 'Ndebele Syd', 'deprecated_legacy_id': '10422'},
'language', {'legacy_ams_taxonomy_id': '10422', 'type': 'language', 'label': 'Ndebele Syd', 'concept_id': '8ZiC_PNc_hkY', 'legacy_ams_taxonomy_num_id': 10422}),
( {'type': 'language', 'id': 'zAgM_Myz_xeD', 'preferred_label': 'Ndonga', 'deprecated_legacy_id': '10423'},
'language', {'legacy_ams_taxonomy_id': '10423', 'type': 'language', 'label': 'Ndonga', 'concept_id': 'zAgM_Myz_xeD', 'legacy_ams_taxonomy_num_id': 10423}),
( {'type': 'language', 'id': 'dS3F_4gn_htW', 'preferred_label': 'Newari', 'deprecated_legacy_id': '10424'},
'language', {'legacy_ams_taxonomy_id': '10424', 'type': 'language', 'label': 'Newari', 'concept_id': 'dS3F_4gn_htW', 'legacy_ams_taxonomy_num_id': 10424}),
( {'type': 'language', 'id': 'vNJX_dvg_1aq', 'preferred_label': 'Nias', 'deprecated_legacy_id': '10425'},
'language', {'legacy_ams_taxonomy_id': '10425', 'type': 'language', 'label': 'Nias', 'concept_id': 'vNJX_dvg_1aq', 'legacy_ams_taxonomy_num_id': 10425}),
( {'type': 'language', 'id': 'Kmib_KAp_WkF', 'preferred_label': 'Niger-Kordofanspråk, andra', 'deprecated_legacy_id': '10426'},
'language', {'legacy_ams_taxonomy_id': '10426', 'type': 'language', 'label': 'Niger-Kordofanspråk, andra', 'concept_id': 'Kmib_KAp_WkF', 'legacy_ams_taxonomy_num_id': 10426}),
( {'type': 'language', 'id': 'MAWi_wjM_Qrb', 'preferred_label': 'Nilsahariska, andra', 'deprecated_legacy_id': '10427'},
'language', {'legacy_ams_taxonomy_id': '10427', 'type': 'language', 'label': 'Nilsahariska, andra', 'concept_id': 'MAWi_wjM_Qrb', 'legacy_ams_taxonomy_num_id': 10427}),
( {'type': 'language', 'id': 'e44f_RYG_BZd', 'preferred_label': 'Niuea', 'deprecated_legacy_id': '10428'},
'language', {'legacy_ams_taxonomy_id': '10428', 'type': 'language', 'label': 'Niuea', 'concept_id': 'e44f_RYG_BZd', 'legacy_ams_taxonomy_num_id': 10428}),
( {'type': 'language', 'id': 'Xgng_L5L_T89', 'preferred_label': 'Gammalnorska', 'deprecated_legacy_id': '10429'},
'language', {'legacy_ams_taxonomy_id': '10429', 'type': 'language', 'label': 'Gammalnorska', 'concept_id': 'Xgng_L5L_T89', 'legacy_ams_taxonomy_num_id': 10429}),
( {'type': 'language', 'id': 'rztR_jw7_vez', 'preferred_label': 'Nordamerikanska indianerspråk, andra', 'deprecated_legacy_id': '10430'},
'language', {'legacy_ams_taxonomy_id': '10430', 'type': 'language', 'label': 'Nordamerikanska indianerspråk, andra', 'concept_id': 'rztR_jw7_vez', 'legacy_ams_taxonomy_num_id': 10430}),
( {'type': 'language', 'id': '5gu3_xFf_Mo8', 'preferred_label': 'Nubiska språk', 'deprecated_legacy_id': '10431'},
'language', {'legacy_ams_taxonomy_id': '10431', 'type': 'language', 'label': 'Nubiska språk', 'concept_id': '5gu3_xFf_Mo8', 'legacy_ams_taxonomy_num_id': 10431}),
( {'type': 'language', 'id': 'yh9H_efB_UFJ', 'preferred_label': 'Nyankole', 'deprecated_legacy_id': '10432'},
'language', {'legacy_ams_taxonomy_id': '10432', 'type': 'language', 'label': 'Nyankole', 'concept_id': 'yh9H_efB_UFJ', 'legacy_ams_taxonomy_num_id': 10432}),
( {'type': 'language', 'id': 'EwW1_aQH_EXu', 'preferred_label': 'Nyoro', 'deprecated_legacy_id': '10433'},
'language', {'legacy_ams_taxonomy_id': '10433', 'type': 'language', 'label': 'Nyoro', 'concept_id': 'EwW1_aQH_EXu', 'legacy_ams_taxonomy_num_id': 10433}),
( {'type': 'language', 'id': 'Agwy_4Hu_NTY', 'preferred_label': 'Nzima', 'deprecated_legacy_id': '10434'},
'language', {'legacy_ams_taxonomy_id': '10434', 'type': 'language', 'label': 'Nzima', 'concept_id': 'Agwy_4Hu_NTY', 'legacy_ams_taxonomy_num_id': 10434}),
( {'type': 'language', 'id': 'MPVv_14T_88n', 'preferred_label': 'Ojibwa', 'deprecated_legacy_id': '10435'},
'language', {'legacy_ams_taxonomy_id': '10435', 'type': 'language', 'label': 'Ojibwa', 'concept_id': 'MPVv_14T_88n', 'legacy_ams_taxonomy_num_id': 10435}),
( {'type': 'language', 'id': 'Ev2g_L1i_D62', 'preferred_label': 'Osage', 'deprecated_legacy_id': '10436'},
'language', {'legacy_ams_taxonomy_id': '10436', 'type': 'language', 'label': 'Osage', 'concept_id': 'Ev2g_L1i_D62', 'legacy_ams_taxonomy_num_id': 10436}),
( {'type': 'language', 'id': 'Ji47_WT1_NKN', 'preferred_label': 'Ossetiska', 'deprecated_legacy_id': '10437'},
'language', {'legacy_ams_taxonomy_id': '10437', 'type': 'language', 'label': 'Ossetiska', 'concept_id': 'Ji47_WT1_NKN', 'legacy_ams_taxonomy_num_id': 10437}),
( {'type': 'language', 'id': 'QdLQ_Ti9_UP3', 'preferred_label': 'Oto-manguespråk', 'deprecated_legacy_id': '10438'},
'language', {'legacy_ams_taxonomy_id': '10438', 'type': 'language', 'label': 'Oto-manguespråk', 'concept_id': 'QdLQ_Ti9_UP3', 'legacy_ams_taxonomy_num_id': 10438}),
( {'type': 'language', 'id': '9RmN_zLz_k9H', 'preferred_label': 'Pahlavi', 'deprecated_legacy_id': '10439'},
'language', {'legacy_ams_taxonomy_id': '10439', 'type': 'language', 'label': 'Pahlavi', 'concept_id': '9RmN_zLz_k9H', 'legacy_ams_taxonomy_num_id': 10439}),
( {'type': 'language', 'id': '3ofn_Vft_AFK', 'preferred_label': 'Palauiska', 'deprecated_legacy_id': '10440'},
'language', {'legacy_ams_taxonomy_id': '10440', 'type': 'language', 'label': 'Palauiska', 'concept_id': '3ofn_Vft_AFK', 'legacy_ams_taxonomy_num_id': 10440}),
( {'type': 'language', 'id': 'uVrS_Lx3_7N2', 'preferred_label': 'Pali', 'deprecated_legacy_id': '10441'},
'language', {'legacy_ams_taxonomy_id': '10441', 'type': 'language', 'label': 'Pali', 'concept_id': 'uVrS_Lx3_7N2', 'legacy_ams_taxonomy_num_id': 10441}),
( {'type': 'language', 'id': 'wAEM_WR9_cmv', 'preferred_label': 'Pampanggo', 'deprecated_legacy_id': '10442'},
'language', {'legacy_ams_taxonomy_id': '10442', 'type': 'language', 'label': 'Pampanggo', 'concept_id': 'wAEM_WR9_cmv', 'legacy_ams_taxonomy_num_id': 10442}),
( {'type': 'language', 'id': 'yymy_7L8_LDE', 'preferred_label': 'Pangasinan', 'deprecated_legacy_id': '10443'},
'language', {'legacy_ams_taxonomy_id': '10443', 'type': 'language', 'label': 'Pangasinan', 'concept_id': 'yymy_7L8_LDE', 'legacy_ams_taxonomy_num_id': 10443}),
( {'type': 'language', 'id': 'QWLc_9BV_8RS', 'preferred_label': 'Papiamento', 'deprecated_legacy_id': '10444'},
'language', {'legacy_ams_taxonomy_id': '10444', 'type': 'language', 'label': 'Papiamento', 'concept_id': 'QWLc_9BV_8RS', 'legacy_ams_taxonomy_num_id': 10444}),
( {'type': 'language', 'id': '7HE9_DoQ_a56', 'preferred_label': 'Papuanska språk, andra', 'deprecated_legacy_id': '10445'},
'language', {'legacy_ams_taxonomy_id': '10445', 'type': 'language', 'label': 'Papuanska språk, andra', 'concept_id': '7HE9_DoQ_a56', 'legacy_ams_taxonomy_num_id': 10445}),
( {'type': 'language', 'id': 'WA3P_FfD_nmy', 'preferred_label': 'Gammelpersiska', 'deprecated_legacy_id': '10446'},
'language', {'legacy_ams_taxonomy_id': '10446', 'type': 'language', 'label': 'Gammelpersiska', 'concept_id': 'WA3P_FfD_nmy', 'legacy_ams_taxonomy_num_id': 10446}),
( {'type': 'language', 'id': 'SUTA_7JX_JRw', 'preferred_label': 'Filippinska språk, andra', 'deprecated_legacy_id': '10447'},
'language', {'legacy_ams_taxonomy_id': '10447', 'type': 'language', 'label': 'Filippinska språk, andra', 'concept_id': 'SUTA_7JX_JRw', 'legacy_ams_taxonomy_num_id': 10447}),
( {'type': 'language', 'id': 'CM6d_taZ_vVL', 'preferred_label': 'Fönikiska', 'deprecated_legacy_id': '10448'},
'language', {'legacy_ams_taxonomy_id': '10448', 'type': 'language', 'label': 'Fönikiska', 'concept_id': 'CM6d_taZ_vVL', 'legacy_ams_taxonomy_num_id': 10448}),
( {'type': 'language', 'id': 'zASV_5vH_5Yr', 'preferred_label': 'Pohnpei', 'deprecated_legacy_id': '10449'},
'language', {'legacy_ams_taxonomy_id': '10449', 'type': 'language', 'label': 'Pohnpei', 'concept_id': 'zASV_5vH_5Yr', 'legacy_ams_taxonomy_num_id': 10449}),
( {'type': 'language', 'id': 'HPb5_vo6_Dmp', 'preferred_label': 'Prakrit', 'deprecated_legacy_id': '10450'},
'language', {'legacy_ams_taxonomy_id': '10450', 'type': 'language', 'label': 'Prakrit', 'concept_id': 'HPb5_vo6_Dmp', 'legacy_ams_taxonomy_num_id': 10450}),
( {'type': 'language', 'id': '1zy3_huH_ic1', 'preferred_label': 'Gammelprovecanska', 'deprecated_legacy_id': '10451'},
'language', {'legacy_ams_taxonomy_id': '10451', 'type': 'language', 'label': 'Gammelprovecanska', 'concept_id': '1zy3_huH_ic1', 'legacy_ams_taxonomy_num_id': 10451}),
( {'type': 'language', 'id': 'bUdf_dcV_r3c', 'preferred_label': 'Rajasthanisja; marwariska', 'deprecated_legacy_id': '10453'},
'language', {'legacy_ams_taxonomy_id': '10453', 'type': 'language', 'label': 'Rajasthanisja; marwariska', 'concept_id': 'bUdf_dcV_r3c', 'legacy_ams_taxonomy_num_id': 10453}),
( {'type': 'language', 'id': 'VEPz_1v9_Rvu', 'preferred_label': 'Rapanui', 'deprecated_legacy_id': '10454'},
'language', {'legacy_ams_taxonomy_id': '10454', 'type': 'language', 'label': 'Rapanui', 'concept_id': 'VEPz_1v9_Rvu', 'legacy_ams_taxonomy_num_id': 10454}),
( {'type': 'language', 'id': 'anUm_Nr6_gpN', 'preferred_label': 'Rarotonga', 'deprecated_legacy_id': '10455'},
'language', {'legacy_ams_taxonomy_id': '10455', 'type': 'language', 'label': 'Rarotonga', 'concept_id': 'anUm_Nr6_gpN', 'legacy_ams_taxonomy_num_id': 10455}),
( {'type': 'language', 'id': 'xxAm_o17_Sf3', 'preferred_label': 'Romanska språk, andra', 'deprecated_legacy_id': '10456'},
'language', {'legacy_ams_taxonomy_id': '10456', 'type': 'language', 'label': 'Romanska språk, andra', 'concept_id': 'xxAm_o17_Sf3', 'legacy_ams_taxonomy_num_id': 10456}),
( {'type': 'language', 'id': 'GXwq_W4u_cvX', 'preferred_label': 'Saliska språk', 'deprecated_legacy_id': '10458'},
'language', {'legacy_ams_taxonomy_id': '10458', 'type': 'language', 'label': 'Saliska språk', 'concept_id': 'GXwq_W4u_cvX', 'legacy_ams_taxonomy_num_id': 10458}),
( {'type': 'language', 'id': 'kQvM_k1N_nne', 'preferred_label': 'Samaritansk aramaiska', 'deprecated_legacy_id': '10459'},
'language', {'legacy_ams_taxonomy_id': '10459', 'type': 'language', 'label': 'Samaritansk aramaiska', 'concept_id': 'kQvM_k1N_nne', 'legacy_ams_taxonomy_num_id': 10459}),
( {'type': 'language', 'id': 'FCsC_s5t_dU2', 'preferred_label': 'Sandawe', 'deprecated_legacy_id': '10460'},
'language', {'legacy_ams_taxonomy_id': '10460', 'type': 'language', 'label': 'Sandawe', 'concept_id': 'FCsC_s5t_dU2', 'legacy_ams_taxonomy_num_id': 10460}),
( {'type': 'language', 'id': 'WV6s_E7d_hBp', 'preferred_label': 'Sanskrit', 'deprecated_legacy_id': '10461'},
'language', {'legacy_ams_taxonomy_id': '10461', 'type': 'language', 'label': 'Sanskrit', 'concept_id': 'WV6s_E7d_hBp', 'legacy_ams_taxonomy_num_id': 10461}),
( {'type': 'language', 'id': 'anHt_dxL_Yvo', 'preferred_label': 'Sasak', 'deprecated_legacy_id': '10462'},
'language', {'legacy_ams_taxonomy_id': '10462', 'type': 'language', 'label': 'Sasak', 'concept_id': 'anHt_dxL_Yvo', 'legacy_ams_taxonomy_num_id': 10462}),
( {'type': 'language', 'id': 'agM1_4uk_nHZ', 'preferred_label': 'Selkupiska', 'deprecated_legacy_id': '10463'},
'language', {'legacy_ams_taxonomy_id': '10463', 'type': 'language', 'label': 'Selkupiska', 'concept_id': 'agM1_4uk_nHZ', 'legacy_ams_taxonomy_num_id': 10463}),
( {'type': 'language', 'id': 'sCUz_F8E_pKZ', 'preferred_label': 'Semitiska språk, andra', 'deprecated_legacy_id': '10464'},
'language', {'legacy_ams_taxonomy_id': '10464', 'type': 'language', 'label': 'Semitiska språk, andra', 'concept_id': 'sCUz_F8E_pKZ', 'legacy_ams_taxonomy_num_id': 10464}),
( {'type': 'language', 'id': 'Xajo_j9B_XWW', 'preferred_label': 'Serer', 'deprecated_legacy_id': '10465'},
'language', {'legacy_ams_taxonomy_id': '10465', 'type': 'language', 'label': 'Serer', 'concept_id': 'Xajo_j9B_XWW', 'legacy_ams_taxonomy_num_id': 10465}),
( {'type': 'language', 'id': 'ZRA5_7p5_vY7', 'preferred_label': 'Shan', 'deprecated_legacy_id': '10466'},
'language', {'legacy_ams_taxonomy_id': '10466', 'type': 'language', 'label': 'Shan', 'concept_id': 'ZRA5_7p5_vY7', 'legacy_ams_taxonomy_num_id': 10466}),
( {'type': 'language', 'id': 'G8e4_Sid_vFd', 'preferred_label': 'Sidamo', 'deprecated_legacy_id': '10467'},
'language', {'legacy_ams_taxonomy_id': '10467', 'type': 'language', 'label': 'Sidamo', 'concept_id': 'G8e4_Sid_vFd', 'legacy_ams_taxonomy_num_id': 10467}),
( {'type': 'language', 'id': 'DJfZ_4fk_kwb', 'preferred_label': 'Siksika', 'deprecated_legacy_id': '10468'},
'language', {'legacy_ams_taxonomy_id': '10468', 'type': 'language', 'label': 'Siksika', 'concept_id': 'DJfZ_4fk_kwb', 'legacy_ams_taxonomy_num_id': 10468}),
( {'type': 'language', 'id': 'dQvb_BHK_Yxk', 'preferred_label': 'Sinotibetanska språk, andra', 'deprecated_legacy_id': '10469'},
'language', {'legacy_ams_taxonomy_id': '10469', 'type': 'language', 'label': 'Sinotibetanska språk, andra', 'concept_id': 'dQvb_BHK_Yxk', 'legacy_ams_taxonomy_num_id': 10469}),
( {'type': 'language', 'id': '443s_ZvN_1F4', 'preferred_label': 'Sioux-språk', 'deprecated_legacy_id': '10470'},
'language', {'legacy_ams_taxonomy_id': '10470', 'type': 'language', 'label': 'Sioux-språk', 'concept_id': '443s_ZvN_1F4', 'legacy_ams_taxonomy_num_id': 10470}),
( {'type': 'language', 'id': 'u9Rr_v5c_iT2', 'preferred_label': 'Slaviska (Athapascaniska)', 'deprecated_legacy_id': '10471'},
'language', {'legacy_ams_taxonomy_id': '10471', 'type': 'language', 'label': 'Slaviska (Athapascaniska)', 'concept_id': 'u9Rr_v5c_iT2', 'legacy_ams_taxonomy_num_id': 10471}),
( {'type': 'language', 'id': 'PMLh_Nss_Ehg', 'preferred_label': 'Slaviska språk, andra', 'deprecated_legacy_id': '10472'},
'language', {'legacy_ams_taxonomy_id': '10472', 'type': 'language', 'label': 'Slaviska språk, andra', 'concept_id': 'PMLh_Nss_Ehg', 'legacy_ams_taxonomy_num_id': 10472}),
( {'type': 'language', 'id': 'kdXZ_zHa_KTB', 'preferred_label': 'Sogdiska', 'deprecated_legacy_id': '10473'},
'language', {'legacy_ams_taxonomy_id': '10473', 'type': 'language', 'label': 'Sogdiska', 'concept_id': 'kdXZ_zHa_KTB', 'legacy_ams_taxonomy_num_id': 10473}),
( {'type': 'language', 'id': 'Gi82_GNa_Uvu', 'preferred_label': 'Soninke', 'deprecated_legacy_id': '10474'},
'language', {'legacy_ams_taxonomy_id': '10474', 'type': 'language', 'label': 'Soninke', 'concept_id': 'Gi82_GNa_Uvu', 'legacy_ams_taxonomy_num_id': 10474}),
( {'type': 'language', 'id': 'HgMp_vQ1_7ed', 'preferred_label': 'Nordsotho', 'deprecated_legacy_id': '10475'},
'language', {'legacy_ams_taxonomy_id': '10475', 'type': 'language', 'label': 'Nordsotho', 'concept_id': 'HgMp_vQ1_7ed', 'legacy_ams_taxonomy_num_id': 10475}),
( {'type': 'language', 'id': 'AtJY_V9b_8Ae', 'preferred_label': 'Sydamerikanska indianspråk, andra', 'deprecated_legacy_id': '10476'},
'language', {'legacy_ams_taxonomy_id': '10476', 'type': 'language', 'label': 'Sydamerikanska indianspråk, andra', 'concept_id': 'AtJY_V9b_8Ae', 'legacy_ams_taxonomy_num_id': 10476}),
( {'type': 'language', 'id': 'HJSu_QbW_htd', 'preferred_label': 'Sukuma', 'deprecated_legacy_id': '10477'},
'language', {'legacy_ams_taxonomy_id': '10477', 'type': 'language', 'label': 'Sukuma', 'concept_id': 'HJSu_QbW_htd', 'legacy_ams_taxonomy_num_id': 10477}),
( {'type': 'language', 'id': 's6D9_CAD_eMB', 'preferred_label': 'Sumeriska', 'deprecated_legacy_id': '10478'},
'language', {'legacy_ams_taxonomy_id': '10478', 'type': 'language', 'label': 'Sumeriska', 'concept_id': 's6D9_CAD_eMB', 'legacy_ams_taxonomy_num_id': 10478}),
( {'type': 'language', 'id': 'qLfm_7QZ_37r', 'preferred_label': 'Sundanesiska', 'deprecated_legacy_id': '10479'},
'language', {'legacy_ams_taxonomy_id': '10479', 'type': 'language', 'label': 'Sundanesiska', 'concept_id': 'qLfm_7QZ_37r', 'legacy_ams_taxonomy_num_id': 10479}),
( {'type': 'language', 'id': 'rt8T_8UB_wTq', 'preferred_label': 'Thaispråk, andra', 'deprecated_legacy_id': '10480'},
'language', {'legacy_ams_taxonomy_id': '10480', 'type': 'language', 'label': 'Thaispråk, andra', 'concept_id': 'rt8T_8UB_wTq', 'legacy_ams_taxonomy_num_id': 10480}),
( {'type': 'language', 'id': 'Zrmd_kmh_AtN', 'preferred_label': 'Tereno', 'deprecated_legacy_id': '10481'},
'language', {'legacy_ams_taxonomy_id': '10481', 'type': 'language', 'label': 'Tereno', 'concept_id': 'Zrmd_kmh_AtN', 'legacy_ams_taxonomy_num_id': 10481}),
( {'type': 'language', 'id': 'JGyZ_VXD_V8b', 'preferred_label': 'Tetum', 'deprecated_legacy_id': '10482'},
'language', {'legacy_ams_taxonomy_id': '10482', 'type': 'language', 'label': 'Tetum', 'concept_id': 'JGyZ_VXD_V8b', 'legacy_ams_taxonomy_num_id': 10482}),
( {'type': 'language', 'id': 'yTWE_vfZ_HNB', 'preferred_label': 'Tiv', 'deprecated_legacy_id': '10484'},
'language', {'legacy_ams_taxonomy_id': '10484', 'type': 'language', 'label': 'Tiv', 'concept_id': 'yTWE_vfZ_HNB', 'legacy_ams_taxonomy_num_id': 10484}),
( {'type': 'language', 'id': 'mZVe_5Ug_ncD', 'preferred_label': 'Tlingit', 'deprecated_legacy_id': '10485'},
'language', {'legacy_ams_taxonomy_id': '10485', 'type': 'language', 'label': 'Tlingit', 'concept_id': 'mZVe_5Ug_ncD', 'legacy_ams_taxonomy_num_id': 10485}),
( {'type': 'language', 'id': 'cnGc_92Q_oex', 'preferred_label': 'Tokelau', 'deprecated_legacy_id': '10486'},
'language', {'legacy_ams_taxonomy_id': '10486', 'type': 'language', 'label': 'Tokelau', 'concept_id': 'cnGc_92Q_oex', 'legacy_ams_taxonomy_num_id': 10486}),
( {'type': 'language', 'id': 'RUJ6_xGA_eUN', 'preferred_label': 'Tonganska', 'deprecated_legacy_id': '10487'},
'language', {'legacy_ams_taxonomy_id': '10487', 'type': 'language', 'label': 'Tonganska', 'concept_id': 'RUJ6_xGA_eUN', 'legacy_ams_taxonomy_num_id': 10487}),
( {'type': 'language', 'id': 'qzy8_5NW_TDP', 'preferred_label': 'Tsimshian', 'deprecated_legacy_id': '10488'},
'language', {'legacy_ams_taxonomy_id': '10488', 'type': 'language', 'label': 'Tsimshian', 'concept_id': 'qzy8_5NW_TDP', 'legacy_ams_taxonomy_num_id': 10488}),
( {'type': 'language', 'id': '2tws_aRJ_FC8', 'preferred_label': 'Tsonga', 'deprecated_legacy_id': '10489'},
'language', {'legacy_ams_taxonomy_id': '10489', 'type': 'language', 'label': 'Tsonga', 'concept_id': '2tws_aRJ_FC8', 'legacy_ams_taxonomy_num_id': 10489}),
( {'type': 'language', 'id': 'VPVt_rxK_6JP', 'preferred_label': 'Tumbuka', 'deprecated_legacy_id': '10491'},
'language', {'legacy_ams_taxonomy_id': '10491', 'type': 'language', 'label': 'Tumbuka', 'concept_id': 'VPVt_rxK_6JP', 'legacy_ams_taxonomy_num_id': 10491}),
( {'type': 'language', 'id': '4eqr_GrX_XM6', 'preferred_label': 'Ottomanturkiska', 'deprecated_legacy_id': '10492'},
'language', {'legacy_ams_taxonomy_id': '10492', 'type': 'language', 'label': 'Ottomanturkiska', 'concept_id': '4eqr_GrX_XM6', 'legacy_ams_taxonomy_num_id': 10492}),
( {'type': 'language', 'id': 'zunG_TL8_koW', 'preferred_label': 'Tuvalu', 'deprecated_legacy_id': '10493'},
'language', {'legacy_ams_taxonomy_id': '10493', 'type': 'language', 'label': 'Tuvalu', 'concept_id': 'zunG_TL8_koW', 'legacy_ams_taxonomy_num_id': 10493}),
( {'type': 'language', 'id': 'jE6j_5nL_t9U', 'preferred_label': 'Tuvinska', 'deprecated_legacy_id': '10494'},
'language', {'legacy_ams_taxonomy_id': '10494', 'type': 'language', 'label': 'Tuvinska', 'concept_id': 'jE6j_5nL_t9U', 'legacy_ams_taxonomy_num_id': 10494}),
( {'type': 'language', 'id': 'hP5c_JJk_riU', 'preferred_label': 'Ugaritiska', 'deprecated_legacy_id': '10495'},
'language', {'legacy_ams_taxonomy_id': '10495', 'type': 'language', 'label': 'Ugaritiska', 'concept_id': 'hP5c_JJk_riU', 'legacy_ams_taxonomy_num_id': 10495}),
( {'type': 'language', 'id': 'h3RJ_dgP_MxH', 'preferred_label': 'Vai', 'deprecated_legacy_id': '10496'},
'language', {'legacy_ams_taxonomy_id': '10496', 'type': 'language', 'label': 'Vai', 'concept_id': 'h3RJ_dgP_MxH', 'legacy_ams_taxonomy_num_id': 10496}),
( {'type': 'language', 'id': 'sGCA_SoQ_VDz', 'preferred_label': 'Venda', 'deprecated_legacy_id': '10497'},
'language', {'legacy_ams_taxonomy_id': '10497', 'type': 'language', 'label': 'Venda', 'concept_id': 'sGCA_SoQ_VDz', 'legacy_ams_taxonomy_num_id': 10497}),
( {'type': 'language', 'id': 'SMdj_4DK_D7D', 'preferred_label': 'Volapük', 'deprecated_legacy_id': '10498'},
'language', {'legacy_ams_taxonomy_id': '10498', 'type': 'language', 'label': 'Volapük', 'concept_id': 'SMdj_4DK_D7D', 'legacy_ams_taxonomy_num_id': 10498}),
( {'type': 'language', 'id': 'QHQc_Thx_KyY', 'preferred_label': 'Votiska', 'deprecated_legacy_id': '10499'},
'language', {'legacy_ams_taxonomy_id': '10499', 'type': 'language', 'label': 'Votiska', 'concept_id': 'QHQc_Thx_KyY', 'legacy_ams_taxonomy_num_id': 10499}),
( {'type': 'language', 'id': 'Su2Y_KnM_Nm3', 'preferred_label': 'Wakashan språk', 'deprecated_legacy_id': '10500'},
'language', {'legacy_ams_taxonomy_id': '10500', 'type': 'language', 'label': 'Wakashan språk', 'concept_id': 'Su2Y_KnM_Nm3', 'legacy_ams_taxonomy_num_id': 10500}),
( {'type': 'language', 'id': 'pKgd_UJA_ahC', 'preferred_label': 'Walamo', 'deprecated_legacy_id': '10501'},
'language', {'legacy_ams_taxonomy_id': '10501', 'type': 'language', 'label': 'Walamo', 'concept_id': 'pKgd_UJA_ahC', 'legacy_ams_taxonomy_num_id': 10501}),
( {'type': 'language', 'id': 'vm4L_9sD_6Dd', 'preferred_label': 'Waray', 'deprecated_legacy_id': '10502'},
'language', {'legacy_ams_taxonomy_id': '10502', 'type': 'language', 'label': 'Waray', 'concept_id': 'vm4L_9sD_6Dd', 'legacy_ams_taxonomy_num_id': 10502}),
( {'type': 'language', 'id': 'ZLh2_Qtx_GQm', 'preferred_label': 'Washo', 'deprecated_legacy_id': '10503'},
'language', {'legacy_ams_taxonomy_id': '10503', 'type': 'language', 'label': 'Washo', 'concept_id': 'ZLh2_Qtx_GQm', 'legacy_ams_taxonomy_num_id': 10503}),
( {'type': 'language', 'id': 'PsHc_32K_PEz', 'preferred_label': 'Jakutiska', 'deprecated_legacy_id': '10506'},
'language', {'legacy_ams_taxonomy_id': '10506', 'type': 'language', 'label': 'Jakutiska', 'concept_id': 'PsHc_32K_PEz', 'legacy_ams_taxonomy_num_id': 10506}),
( {'type': 'language', 'id': 'rYw9_SHt_yWk', 'preferred_label': 'Yao', 'deprecated_legacy_id': '10507'},
'language', {'legacy_ams_taxonomy_id': '10507', 'type': 'language', 'label': 'Yao', 'concept_id': 'rYw9_SHt_yWk', 'legacy_ams_taxonomy_num_id': 10507}),
( {'type': 'language', 'id': 'PWs8_ctN_ewk', 'preferred_label': 'Yapese', 'deprecated_legacy_id': '10508'},
'language', {'legacy_ams_taxonomy_id': '10508', 'type': 'language', 'label': 'Yapese', 'concept_id': 'PWs8_ctN_ewk', 'legacy_ams_taxonomy_num_id': 10508}),
( {'type': 'language', 'id': 'KBWH_gdK_uVB', 'preferred_label': 'Zapotekiska', 'deprecated_legacy_id': '10510'},
'language', {'legacy_ams_taxonomy_id': '10510', 'type': 'language', 'label': 'Zapotekiska', 'concept_id': 'KBWH_gdK_uVB', 'legacy_ams_taxonomy_num_id': 10510}),
( {'type': 'language', 'id': 'B9Dx_jN8_QZg', 'preferred_label': 'Zuni', 'deprecated_legacy_id': '10512'},
'language', {'legacy_ams_taxonomy_id': '10512', 'type': 'language', 'label': 'Zuni', 'concept_id': 'B9Dx_jN8_QZg', 'legacy_ams_taxonomy_num_id': 10512}),
( {'type': 'language', 'id': 'ASKN_a1S_Uqt', 'preferred_label': 'Yupik språk', 'deprecated_legacy_id': '10513'},
'language', {'legacy_ams_taxonomy_id': '10513', 'type': 'language', 'label': 'Yupik språk', 'concept_id': 'ASKN_a1S_Uqt', 'legacy_ams_taxonomy_num_id': 10513}),
( {'type': 'language', 'id': 'vQHk_Y7j_NVM', 'preferred_label': 'Gammelfranska', 'deprecated_legacy_id': '10514'},
'language', {'legacy_ams_taxonomy_id': '10514', 'type': 'language', 'label': 'Gammelfranska', 'concept_id': 'vQHk_Y7j_NVM', 'legacy_ams_taxonomy_num_id': 10514}),
( {'type': 'language', 'id': 'ujrF_MeF_LSB', 'preferred_label': 'Meänkieli/Tornedalsfinska', 'deprecated_legacy_id': '10515'},
'language', {'legacy_ams_taxonomy_id': '10515', 'type': 'language', 'label': 'Meänkieli/Tornedalsfinska', 'concept_id': 'ujrF_MeF_LSB', 'legacy_ams_taxonomy_num_id': 10515}),
( {'type': 'language', 'id': 'Lozg_qhA_r3y', 'preferred_label': 'Dari', 'deprecated_legacy_id': '10516'},
'language', {'legacy_ams_taxonomy_id': '10516', 'type': 'language', 'label': 'Dari', 'concept_id': 'Lozg_qhA_r3y', 'legacy_ams_taxonomy_num_id': 10516}),
( {'type': 'language', 'id': 'xYJh_6Ez_4Md', 'preferred_label': 'Assyriska', 'deprecated_legacy_id': '10517'},
'language', {'legacy_ams_taxonomy_id': '10517', 'type': 'language', 'label': 'Assyriska', 'concept_id': 'xYJh_6Ez_4Md', 'legacy_ams_taxonomy_num_id': 10517}),
( {'type': 'language', 'id': '8VkC_Gwt_jHy', 'preferred_label': 'Kaldeiska', 'deprecated_legacy_id': '10518'},
'language', {'legacy_ams_taxonomy_id': '10518', 'type': 'language', 'label': 'Kaldeiska', 'concept_id': '8VkC_Gwt_jHy', 'legacy_ams_taxonomy_num_id': 10518}),
( {'type': 'language', 'id': 'w9hf_iyH_FCH', 'preferred_label': 'Saho', 'deprecated_legacy_id': '10519'},
'language', {'legacy_ams_taxonomy_id': '10519', 'type': 'language', 'label': 'Saho', 'concept_id': 'w9hf_iyH_FCH', 'legacy_ams_taxonomy_num_id': 10519}),
( {'type': 'language', 'id': 'nTYu_SG6_CNa', 'preferred_label': 'Kurmanji', 'deprecated_legacy_id': None},
'language', {'legacy_ams_taxonomy_id': None, 'type': 'language', 'label': 'Kurmanji', 'concept_id': 'nTYu_SG6_CNa', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'language', 'id': '49Hh_qTx_aj5', 'preferred_label': 'Sorani', 'deprecated_legacy_id': None},
'language', {'legacy_ams_taxonomy_id': None, 'type': 'language', 'label': 'Sorani', 'concept_id': '49Hh_qTx_aj5', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'language', 'id': 'M3e1_w6W_iLW', 'preferred_label': 'Kantonesiska', 'deprecated_legacy_id': None},
'language', {'legacy_ams_taxonomy_id': None, 'type': 'language', 'label': 'Kantonesiska', 'concept_id': 'M3e1_w6W_iLW', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'wage-type', 'id': 'oG8G_9cW_nRf', 'preferred_label': 'Fast månads- vecko- eller timlön', 'deprecated_legacy_id': '1'},
'wage-type', {'legacy_ams_taxonomy_id': '1', 'type': 'wage-type', 'label': 'Fast månads- vecko- eller timlön', 'concept_id': 'oG8G_9cW_nRf', 'legacy_ams_taxonomy_num_id': 1}),
( {'type': 'wage-type', 'id': 'vVtj_qm6_GQu', 'preferred_label': 'Rörlig ackords- eller provisionslön', 'deprecated_legacy_id': '8'},
'wage-type', {'legacy_ams_taxonomy_id': '8', 'type': 'wage-type', 'label': 'Rörlig ackords- eller provisionslön', 'concept_id': 'vVtj_qm6_GQu', 'legacy_ams_taxonomy_num_id': 8}),
( {'type': 'wage-type', 'id': 'asrX_9Df_ukn', 'preferred_label': 'Fast och rörlig lön', 'deprecated_legacy_id': '7'},
'wage-type', {'legacy_ams_taxonomy_id': '7', 'type': 'wage-type', 'label': 'Fast och rörlig lön', 'concept_id': 'asrX_9Df_ukn', 'legacy_ams_taxonomy_num_id': 7}),
( {'type': 'sun-education-field-1', 'id': 'U925_qMh_KzG', 'preferred_label': 'Allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-1', 'label': 'Allmän utbildning', 'concept_id': 'U925_qMh_KzG', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-1', 'id': 'Umn1_P6Q_vPp', 'preferred_label': 'Pedagogik och lärarutbildning', 'deprecated_legacy_id': None},
'sun-education-field-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-1', 'label': 'Pedagogik och lärarutbildning', 'concept_id': 'Umn1_P6Q_vPp', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-1', 'id': 'KmhN_geK_3Gd', 'preferred_label': 'Humaniora och konst', 'deprecated_legacy_id': None},
'sun-education-field-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-1', 'label': 'Humaniora och konst', 'concept_id': 'KmhN_geK_3Gd', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-1', 'id': 'Mga4_MQZ_aRW', 'preferred_label': 'Samhällsvetenskap, juridik, handel, administration', 'deprecated_legacy_id': None},
'sun-education-field-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-1', 'label': 'Samhällsvetenskap, juridik, handel, administration', 'concept_id': 'Mga4_MQZ_aRW', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-1', 'id': 'mQSY_Afj_Bv4', 'preferred_label': 'Naturvetenskap, matematik och informations- och kommunikationsteknik (IKT)', 'deprecated_legacy_id': None},
'sun-education-field-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-1', 'label': 'Naturvetenskap, matematik och informations- och kommunikationsteknik (IKT)', 'concept_id': 'mQSY_Afj_Bv4', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-1', 'id': 'xsQC_69i_d1X', 'preferred_label': 'Teknik och tillverkning', 'deprecated_legacy_id': None},
'sun-education-field-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-1', 'label': 'Teknik och tillverkning', 'concept_id': 'xsQC_69i_d1X', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-1', 'id': 'WtZG_YJq_m3B', 'preferred_label': 'Lant- och skogsbruk samt djursjukvård', 'deprecated_legacy_id': None},
'sun-education-field-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-1', 'label': 'Lant- och skogsbruk samt djursjukvård', 'concept_id': 'WtZG_YJq_m3B', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-1', 'id': 'bV8r_EjP_wxB', 'preferred_label': 'Hälso- och sjukvård samt social omsorg', 'deprecated_legacy_id': None},
'sun-education-field-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-1', 'label': 'Hälso- och sjukvård samt social omsorg', 'concept_id': 'bV8r_EjP_wxB', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-1', 'id': 'SmQC_tL9_6Vb', 'preferred_label': 'Tjänster', 'deprecated_legacy_id': None},
'sun-education-field-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-1', 'label': 'Tjänster', 'concept_id': 'SmQC_tL9_6Vb', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-1', 'id': 'SvNP_hTj_bHG', 'preferred_label': 'Okänd', 'deprecated_legacy_id': None},
'sun-education-field-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-1', 'label': 'Okänd', 'concept_id': 'SvNP_hTj_bHG', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'n4aT_1x4_oFw', 'preferred_label': 'Bred, generell utbildning', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Bred, generell utbildning', 'concept_id': 'n4aT_1x4_oFw', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 's6jT_CW8_viT', 'preferred_label': 'Läs- och skrivinlärning för vuxna', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Läs- och skrivinlärning för vuxna', 'concept_id': 's6jT_CW8_viT', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'CESx_ZDS_4bY', 'preferred_label': 'Personlig utveckling', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Personlig utveckling', 'concept_id': 'CESx_ZDS_4bY', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'dvre_Duj_oyv', 'preferred_label': 'Pedagogik och lärarutbildning', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Pedagogik och lärarutbildning', 'concept_id': 'dvre_Duj_oyv', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': '49hp_SsT_G6u', 'preferred_label': 'Konst och media', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Konst och media', 'concept_id': '49hp_SsT_G6u', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'XMgK_vMp_xJp', 'preferred_label': 'Humaniora', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Humaniora', 'concept_id': 'XMgK_vMp_xJp', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'bLS3_m9V_c41', 'preferred_label': 'Samhälls- och beteendevetenskap', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Samhälls- och beteendevetenskap', 'concept_id': 'bLS3_m9V_c41', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': '4CNy_4r7_Kqk', 'preferred_label': 'Journalistik och information', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Journalistik och information', 'concept_id': '4CNy_4r7_Kqk', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': '1nfZ_zkU_RyS', 'preferred_label': 'Företagsekonomi, handel och administration', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Företagsekonomi, handel och administration', 'concept_id': '1nfZ_zkU_RyS', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'H5iv_5v9_t4o', 'preferred_label': 'Juridik och rättsvetenskap', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Juridik och rättsvetenskap', 'concept_id': 'H5iv_5v9_t4o', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': '4rRq_Nyp_tCB', 'preferred_label': 'Biologi och miljövetenskap', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Biologi och miljövetenskap', 'concept_id': '4rRq_Nyp_tCB', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': '4uY2_MQQ_XQy', 'preferred_label': 'Fysik, kemi och geovetenskap', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Fysik, kemi och geovetenskap', 'concept_id': '4uY2_MQQ_XQy', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'jvrj_RjH_Xzz', 'preferred_label': 'Matematik och övrig naturvetenskap', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Matematik och övrig naturvetenskap', 'concept_id': 'jvrj_RjH_Xzz', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'Bktq_dkL_8fH', 'preferred_label': 'Informations- och kommunikationsteknik (IKT)', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Informations- och kommunikationsteknik (IKT)', 'concept_id': 'Bktq_dkL_8fH', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'n6zo_VDi_gPi', 'preferred_label': 'Teknik och teknisk industri', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Teknik och teknisk industri', 'concept_id': 'n6zo_VDi_gPi', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'JjwK_ULz_LyY', 'preferred_label': 'Material och tillverkning', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Material och tillverkning', 'concept_id': 'JjwK_ULz_LyY', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'fPFH_YgR_2MH', 'preferred_label': 'Samhällsbyggnad och byggnadsteknik', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Samhällsbyggnad och byggnadsteknik', 'concept_id': 'fPFH_YgR_2MH', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'yDGz_siE_K7e', 'preferred_label': 'Lantbruk, trädgård, skog och fiske', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Lantbruk, trädgård, skog och fiske', 'concept_id': 'yDGz_siE_K7e', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'Fkrh_L3n_g84', 'preferred_label': 'Djursjukvård', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Djursjukvård', 'concept_id': 'Fkrh_L3n_g84', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'xPJU_eQm_ehe', 'preferred_label': 'Hälso- och sjukvård', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Hälso- och sjukvård', 'concept_id': 'xPJU_eQm_ehe', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'Cbrh_8aE_CcP', 'preferred_label': 'Socialt arbete och omsorg', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Socialt arbete och omsorg', 'concept_id': 'Cbrh_8aE_CcP', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'Fxpk_ePT_hMZ', 'preferred_label': 'Personliga tjänster', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Personliga tjänster', 'concept_id': 'Fxpk_ePT_hMZ', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'QgQc_N3Y_Xrh', 'preferred_label': 'Transporttjänster', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Transporttjänster', 'concept_id': 'QgQc_N3Y_Xrh', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': '1joZ_PHC_wU7', 'preferred_label': 'Arbetsmiljö och renhållning', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Arbetsmiljö och renhållning', 'concept_id': '1joZ_PHC_wU7', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': '16Ri_bLX_Wug', 'preferred_label': 'Säkerhetstjänster', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Säkerhetstjänster', 'concept_id': '16Ri_bLX_Wug', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-2', 'id': 'Jc4o_RgJ_ddf', 'preferred_label': 'Okänd', 'deprecated_legacy_id': None},
'sun-education-field-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-2', 'label': 'Okänd', 'concept_id': 'Jc4o_RgJ_ddf', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'wES4_1rw_TEH', 'preferred_label': 'Bred, generell utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Bred, generell utbildning', 'concept_id': 'wES4_1rw_TEH', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'K4t9_4gZ_MgJ', 'preferred_label': 'Läs- och skrivinlärning för vuxna', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Läs- och skrivinlärning för vuxna', 'concept_id': 'K4t9_4gZ_MgJ', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'VQPP_GZg_xkU', 'preferred_label': 'Personlig utveckling', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Personlig utveckling', 'concept_id': 'VQPP_GZg_xkU', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'NpSa_78c_ma1', 'preferred_label': 'Pedagogik och lärarutbildning, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Pedagogik och lärarutbildning, allmän utbildning', 'concept_id': 'NpSa_78c_ma1', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'vp9A_NEv_dbU', 'preferred_label': 'Pedagogik', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Pedagogik', 'concept_id': 'vp9A_NEv_dbU', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'ybAL_uBD_x7v', 'preferred_label': 'Lärarutbildning för förskola och fritidsverksamhet', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Lärarutbildning för förskola och fritidsverksamhet', 'concept_id': 'ybAL_uBD_x7v', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'DGWJ_xnW_S3L', 'preferred_label': 'Lärarutbildning för grundskolans tidiga åldrar', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Lärarutbildning för grundskolans tidiga åldrar', 'concept_id': 'DGWJ_xnW_S3L', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'VkYx_GTn_tWF', 'preferred_label': 'Ämneslärarutbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Ämneslärarutbildning', 'concept_id': 'VkYx_GTn_tWF', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '1wAW_w4s_Gif', 'preferred_label': 'Lärarutbildning i yrkesämne och praktisk-estetiska ämnen', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Lärarutbildning i yrkesämne och praktisk-estetiska ämnen', 'concept_id': '1wAW_w4s_Gif', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'F3Zd_KX4_orz', 'preferred_label': 'Pedagogik och lärarutbildning, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Pedagogik och lärarutbildning, övrig och ospecificerad utbildning', 'concept_id': 'F3Zd_KX4_orz', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '3oX1_N64_PLW', 'preferred_label': 'Konst och media, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Konst och media, allmän utbildning', 'concept_id': '3oX1_N64_PLW', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'vd5y_Ppm_TuU', 'preferred_label': 'Bild- och formkonst', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Bild- och formkonst', 'concept_id': 'vd5y_Ppm_TuU', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'WXYK_9T2_unn', 'preferred_label': 'Musik, dans och dramatik', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Musik, dans och dramatik', 'concept_id': 'WXYK_9T2_unn', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '8Eas_LAZ_wW7', 'preferred_label': 'Medieproduktion', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Medieproduktion', 'concept_id': '8Eas_LAZ_wW7', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'zHeT_FtE_yXn', 'preferred_label': 'Formgivning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Formgivning', 'concept_id': 'zHeT_FtE_yXn', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'UX9d_rbD_FT7', 'preferred_label': 'Konsthantverk', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Konsthantverk', 'concept_id': 'UX9d_rbD_FT7', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '4U55_wx6_Q3u', 'preferred_label': 'Konst och media, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Konst och media, övrig och ospecificerad utbildning', 'concept_id': '4U55_wx6_Q3u', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'bHms_Q4W_uQo', 'preferred_label': 'Humaniora, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Humaniora, allmän utbildning', 'concept_id': 'bHms_Q4W_uQo', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '8SMP_CNZ_U75', 'preferred_label': 'Religion', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Religion', 'concept_id': '8SMP_CNZ_U75', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '4jr1_KRN_wpq', 'preferred_label': 'Främmande språk och språkvetenskap', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Främmande språk och språkvetenskap', 'concept_id': '4jr1_KRN_wpq', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'gw6Z_hLp_Hvk', 'preferred_label': 'Svenska och litteraturvetenskap', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Svenska och litteraturvetenskap', 'concept_id': 'gw6Z_hLp_Hvk', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'RnPd_5mc_E9G', 'preferred_label': 'Historia och arkeologi', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Historia och arkeologi', 'concept_id': 'RnPd_5mc_E9G', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'iLjG_2Q5_Bxb', 'preferred_label': 'Filosofi och logik', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Filosofi och logik', 'concept_id': 'iLjG_2Q5_Bxb', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '7kiw_F1A_kd5', 'preferred_label': 'Humaniora, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Humaniora, övrig och ospecificerad utbildning', 'concept_id': '7kiw_F1A_kd5', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'cAKc_bo8_vZa', 'preferred_label': 'Samhälls- och beteendevetenskap, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Samhälls- och beteendevetenskap, allmän utbildning', 'concept_id': 'cAKc_bo8_vZa', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '2tSR_mug_Ero', 'preferred_label': 'Psykologi', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Psykologi', 'concept_id': '2tSR_mug_Ero', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'zRKE_r3q_U1s', 'preferred_label': 'Sociologi, etnologi och kulturgeografi', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Sociologi, etnologi och kulturgeografi', 'concept_id': 'zRKE_r3q_U1s', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'RuTA_kv2_NAp', 'preferred_label': 'Statsvetenskap', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Statsvetenskap', 'concept_id': 'RuTA_kv2_NAp', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'riPZ_vW8_Dep', 'preferred_label': 'Nationalekonomi och ekonomisk historia', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Nationalekonomi och ekonomisk historia', 'concept_id': 'riPZ_vW8_Dep', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'LXUe_hM4_nXf', 'preferred_label': 'Samhälls- och beteendevetenskap, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Samhälls- och beteendevetenskap, övrig och ospecificerad utbildning', 'concept_id': 'LXUe_hM4_nXf', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'CYsz_5Ck_v1n', 'preferred_label': 'Journalistik och information, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Journalistik och information, allmän utbildning', 'concept_id': 'CYsz_5Ck_v1n', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'FeRX_Xc2_8b7', 'preferred_label': 'Journalistik och medievetenskap', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Journalistik och medievetenskap', 'concept_id': 'FeRX_Xc2_8b7', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '6d9j_JKg_wun', 'preferred_label': 'Biblioteks- och dokumentationsvetenskap', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Biblioteks- och dokumentationsvetenskap', 'concept_id': '6d9j_JKg_wun', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'LhAm_khy_7P7', 'preferred_label': 'Journalistik och information, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Journalistik och information, övrig och ospecificerad utbildning', 'concept_id': 'LhAm_khy_7P7', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'uCs9_xRZ_jgp', 'preferred_label': 'Företagsekonomi, handel och administration, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Företagsekonomi, handel och administration, allmän utbildning', 'concept_id': 'uCs9_xRZ_jgp', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'VkhU_pFB_PXA', 'preferred_label': 'Inköp, försäljning och distribution', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Inköp, försäljning och distribution', 'concept_id': 'VkhU_pFB_PXA', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'myT2_Uu2_Xbr', 'preferred_label': 'Marknadsföring', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Marknadsföring', 'concept_id': 'myT2_Uu2_Xbr', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'Ta9V_DMN_999', 'preferred_label': 'Bank, försäkring och finansiering', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Bank, försäkring och finansiering', 'concept_id': 'Ta9V_DMN_999', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'MbeC_Ty2_YfL', 'preferred_label': 'Redovisning och beskattning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Redovisning och beskattning', 'concept_id': 'MbeC_Ty2_YfL', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'eXzj_Jdo_xGQ', 'preferred_label': 'Ledning och administration', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Ledning och administration', 'concept_id': 'eXzj_Jdo_xGQ', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'MJKe_ubg_wms', 'preferred_label': 'Kontorsservice och sekreterartjänster', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Kontorsservice och sekreterartjänster', 'concept_id': 'MJKe_ubg_wms', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'YTUT_rQj_u5V', 'preferred_label': 'Arbetsplatsrelaterad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Arbetsplatsrelaterad utbildning', 'concept_id': 'YTUT_rQj_u5V', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'AVZz_6QN_qyM', 'preferred_label': 'Företagsekonomi, handel och administration, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Företagsekonomi, handel och administration, övrig och ospecificerad utbildning', 'concept_id': 'AVZz_6QN_qyM', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'yrf9_Zzw_FLx', 'preferred_label': 'Juridik och rättsvetenskap', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Juridik och rättsvetenskap', 'concept_id': 'yrf9_Zzw_FLx', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '3q44_gdP_4fx', 'preferred_label': 'Biologi och miljövetenskap, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Biologi och miljövetenskap, allmän utbildning', 'concept_id': '3q44_gdP_4fx', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'tfmL_QCu_mdD', 'preferred_label': 'Biologi och biokemi', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Biologi och biokemi', 'concept_id': 'tfmL_QCu_mdD', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'cs1N_Zp4_KgB', 'preferred_label': 'Miljövetenskap', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Miljövetenskap', 'concept_id': 'cs1N_Zp4_KgB', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'qa2V_GWE_bnK', 'preferred_label': 'Miljövård och miljöskydd', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Miljövård och miljöskydd', 'concept_id': 'qa2V_GWE_bnK', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'K8FW_Fct_zJU', 'preferred_label': 'Naturvård och djurskydd', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Naturvård och djurskydd', 'concept_id': 'K8FW_Fct_zJU', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'sTMt_rKA_EHs', 'preferred_label': 'Biologi och miljövetenskap, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Biologi och miljövetenskap, övrig och ospecificerad utbildning', 'concept_id': 'sTMt_rKA_EHs', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'bpAf_YP9_qRf', 'preferred_label': 'Fysik, kemi och geovetenskap, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Fysik, kemi och geovetenskap, allmän utbildning', 'concept_id': 'bpAf_YP9_qRf', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'NMwf_TFi_j57', 'preferred_label': 'Fysik', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Fysik', 'concept_id': 'NMwf_TFi_j57', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'vpZY_6iv_NPL', 'preferred_label': 'Kemi', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Kemi', 'concept_id': 'vpZY_6iv_NPL', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'R9em_jvo_Rge', 'preferred_label': 'Geovetenskap och naturgeografi', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Geovetenskap och naturgeografi', 'concept_id': 'R9em_jvo_Rge', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'ZjBK_44x_xkr', 'preferred_label': 'Fysik, kemi och geovetenskap, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Fysik, kemi och geovetenskap, övrig och ospecificerad utbildning', 'concept_id': 'ZjBK_44x_xkr', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'RqCj_yhw_GFc', 'preferred_label': 'Matematik och naturvetenskap, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Matematik och naturvetenskap, allmän utbildning', 'concept_id': 'RqCj_yhw_GFc', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'WcVD_tdd_7mN', 'preferred_label': 'Matematik', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Matematik', 'concept_id': 'WcVD_tdd_7mN', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'VDZC_YeP_k1P', 'preferred_label': 'Statistik', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Statistik', 'concept_id': 'VDZC_YeP_k1P', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'vQdy_ySp_GzS', 'preferred_label': 'Matematik och naturvetenskap, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Matematik och naturvetenskap, övrig och ospecificerad utbildning', 'concept_id': 'vQdy_ySp_GzS', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'jfpH_VdC_DM3', 'preferred_label': 'Informations- och kommunikationsteknik (IKT), allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Informations- och kommunikationsteknik (IKT), allmän utbildning', 'concept_id': 'jfpH_VdC_DM3', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'Ai2t_uy2_1KN', 'preferred_label': 'Datavetenskap och systemvetenskap', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Datavetenskap och systemvetenskap', 'concept_id': 'Ai2t_uy2_1KN', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'A2fS_GsT_bSC', 'preferred_label': 'Datoranvändning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Datoranvändning', 'concept_id': 'A2fS_GsT_bSC', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'kXWz_6uh_krq', 'preferred_label': 'Informations- och kommunikationsteknik (IKT), övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Informations- och kommunikationsteknik (IKT), övrig och ospecificerad utbildning', 'concept_id': 'kXWz_6uh_krq', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'LDWD_zzm_jeY', 'preferred_label': 'Teknik och teknisk industri, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Teknik och teknisk industri, allmän utbildning', 'concept_id': 'LDWD_zzm_jeY', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'GRcU_Soh_rg5', 'preferred_label': 'Maskinteknik och verkstadsteknik', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Maskinteknik och verkstadsteknik', 'concept_id': 'GRcU_Soh_rg5', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'wuXX_ZG5_31i', 'preferred_label': 'Energi- och elektroteknik', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Energi- och elektroteknik', 'concept_id': 'wuXX_ZG5_31i', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'fDye_THC_7i7', 'preferred_label': 'Elektronik, datateknik och automation', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Elektronik, datateknik och automation', 'concept_id': 'fDye_THC_7i7', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '2rjL_bUS_fk3', 'preferred_label': 'Kemi- och bioteknik', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Kemi- och bioteknik', 'concept_id': '2rjL_bUS_fk3', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '4VCJ_KsY_p5G', 'preferred_label': 'Fordons- och farkostteknik', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Fordons- och farkostteknik', 'concept_id': '4VCJ_KsY_p5G', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'qe9k_qAm_uCN', 'preferred_label': 'Industriell ekonomi och organisation', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Industriell ekonomi och organisation', 'concept_id': 'qe9k_qAm_uCN', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'kyMw_LZF_AGG', 'preferred_label': 'Miljöteknik och miljökontroll', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Miljöteknik och miljökontroll', 'concept_id': 'kyMw_LZF_AGG', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'ex8F_PzU_aqT', 'preferred_label': 'Teknik och teknisk industri, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Teknik och teknisk industri, övrig och ospecificerad utbildning', 'concept_id': 'ex8F_PzU_aqT', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'HNek_Sui_NhZ', 'preferred_label': 'Material och tillverkning, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Material och tillverkning, allmän utbildning', 'concept_id': 'HNek_Sui_NhZ', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'fLKd_6Dg_ohE', 'preferred_label': 'Tillverkning och hantering av livsmedel', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Tillverkning och hantering av livsmedel', 'concept_id': 'fLKd_6Dg_ohE', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'MSyp_oyY_5ZE', 'preferred_label': 'Tillverkning av textilier, konfektion och lädervaror', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Tillverkning av textilier, konfektion och lädervaror', 'concept_id': 'MSyp_oyY_5ZE', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'WsF2_1YU_i5R', 'preferred_label': 'Tillverkning av produkter av trä, papper, glas, porslin och plast', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Tillverkning av produkter av trä, papper, glas, porslin och plast', 'concept_id': 'WsF2_1YU_i5R', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'Bth1_2AW_wKh', 'preferred_label': 'Berg- och mineralteknik', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Berg- och mineralteknik', 'concept_id': 'Bth1_2AW_wKh', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'jMGW_KY7_NCA', 'preferred_label': 'Material och tillverkning, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Material och tillverkning, övrig och ospecificerad utbildning', 'concept_id': 'jMGW_KY7_NCA', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'YXPg_MRw_bpB', 'preferred_label': 'Samhällsbyggnad och byggnadsteknik, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Samhällsbyggnad och byggnadsteknik, allmän utbildning', 'concept_id': 'YXPg_MRw_bpB', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '5v1g_CoF_VE6', 'preferred_label': 'Samhällsbyggnad och arkitektur', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Samhällsbyggnad och arkitektur', 'concept_id': '5v1g_CoF_VE6', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'TbLq_8FH_cNN', 'preferred_label': 'Byggnadsteknik och anläggningsteknik', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Byggnadsteknik och anläggningsteknik', 'concept_id': 'TbLq_8FH_cNN', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'qxHd_cS3_339', 'preferred_label': 'Samhällsbyggnad och byggnadsteknik, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Samhällsbyggnad och byggnadsteknik, övrig och ospecificerad utbildning', 'concept_id': 'qxHd_cS3_339', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '6whE_Hgj_o82', 'preferred_label': 'Lantbruk, trädgård, skog och fiske, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Lantbruk, trädgård, skog och fiske, allmän utbildning', 'concept_id': '6whE_Hgj_o82', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'RXMT_9Ui_TJJ', 'preferred_label': 'Lantbruk', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Lantbruk', 'concept_id': 'RXMT_9Ui_TJJ', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'Vr5b_b9P_3mS', 'preferred_label': 'Trädgård', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Trädgård', 'concept_id': 'Vr5b_b9P_3mS', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'UAAw_NYh_3uY', 'preferred_label': 'Skog', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Skog', 'concept_id': 'UAAw_NYh_3uY', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'MbV3_bZe_HHF', 'preferred_label': 'Fiske och vattenbruk', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Fiske och vattenbruk', 'concept_id': 'MbV3_bZe_HHF', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'uX8X_4yf_Mm6', 'preferred_label': 'Lantbruk, trädgård, skog och fiske, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Lantbruk, trädgård, skog och fiske, övrig och ospecificerad utbildning', 'concept_id': 'uX8X_4yf_Mm6', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'fw6h_X4w_5iP', 'preferred_label': 'Djursjukvård', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Djursjukvård', 'concept_id': 'fw6h_X4w_5iP', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'ePB9_rjD_WYM', 'preferred_label': 'Hälso- och sjukvård, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Hälso- och sjukvård, allmän utbildning', 'concept_id': 'ePB9_rjD_WYM', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'EBEB_9iM_UH5', 'preferred_label': 'Medicin', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Medicin', 'concept_id': 'EBEB_9iM_UH5', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'fQMU_GjY_AkC', 'preferred_label': 'Omvårdnad', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Omvårdnad', 'concept_id': 'fQMU_GjY_AkC', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'LXNM_AzU_2G5', 'preferred_label': 'Tandvård', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Tandvård', 'concept_id': 'LXNM_AzU_2G5', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '12KX_UT8_y22', 'preferred_label': 'Tekniskt inriktad vårdutbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Tekniskt inriktad vårdutbildning', 'concept_id': '12KX_UT8_y22', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'bXtJ_oB1_5w6', 'preferred_label': 'Terapi, rehabilitering och kostbehandling', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Terapi, rehabilitering och kostbehandling', 'concept_id': 'bXtJ_oB1_5w6', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '8iie_en2_ff7', 'preferred_label': 'Farmaci', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Farmaci', 'concept_id': '8iie_en2_ff7', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'nDbs_yS5_4ku', 'preferred_label': 'Hälso- och sjukvård, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Hälso- och sjukvård, övrig och ospecificerad utbildning', 'concept_id': 'nDbs_yS5_4ku', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'qPrp_ZgA_vgH', 'preferred_label': 'Socialt arbete och socialt omsorgsarbete, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Socialt arbete och socialt omsorgsarbete, allmän utbildning', 'concept_id': 'qPrp_ZgA_vgH', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'p2Ky_NBB_N4Y', 'preferred_label': 'Barn och ungdom', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Barn och ungdom', 'concept_id': 'p2Ky_NBB_N4Y', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 't1wZ_E9z_Uz6', 'preferred_label': 'Socialt arbete', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Socialt arbete', 'concept_id': 't1wZ_E9z_Uz6', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'uZJ8_6KZ_fbE', 'preferred_label': 'Socialt arbete och socialt omsorgsarbete, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Socialt arbete och socialt omsorgsarbete, övrig och ospecificerad utbildning', 'concept_id': 'uZJ8_6KZ_fbE', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 't4kE_UxW_WxC', 'preferred_label': 'Personliga tjänster, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Personliga tjänster, allmän utbildning', 'concept_id': 't4kE_UxW_WxC', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'iGn1_QvT_Asi', 'preferred_label': 'Hotell, restaurang och storhushåll', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Hotell, restaurang och storhushåll', 'concept_id': 'iGn1_QvT_Asi', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'jZ9y_Vyg_Kvp', 'preferred_label': 'Turism, resor och fritid', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Turism, resor och fritid', 'concept_id': 'jZ9y_Vyg_Kvp', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'JFAV_cy3_b6a', 'preferred_label': 'Idrott och friskvård', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Idrott och friskvård', 'concept_id': 'JFAV_cy3_b6a', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'NCdQ_RwY_EbN', 'preferred_label': 'Hushållstjänster och lokalvård', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Hushållstjänster och lokalvård', 'concept_id': 'NCdQ_RwY_EbN', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': '8xVi_MZF_dQL', 'preferred_label': 'Hårvård, skönhetsvård och massage', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Hårvård, skönhetsvård och massage', 'concept_id': '8xVi_MZF_dQL', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'Q9yA_4XU_KHo', 'preferred_label': 'Personliga tjänster, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Personliga tjänster, övrig och ospecificerad utbildning', 'concept_id': 'Q9yA_4XU_KHo', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'yEEt_gg6_XBK', 'preferred_label': 'Transporttjänster', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Transporttjänster', 'concept_id': 'yEEt_gg6_XBK', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'PiJ7_1y5_ztn', 'preferred_label': 'Arbetsmiljö och renhållning, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Arbetsmiljö och renhållning, allmän utbildning', 'concept_id': 'PiJ7_1y5_ztn', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'eC23_WkY_KKd', 'preferred_label': 'Arbetsmiljö och arbetarskydd', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Arbetsmiljö och arbetarskydd', 'concept_id': 'eC23_WkY_KKd', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'TKTt_U3W_xpF', 'preferred_label': 'Renhållning och avfallshantering', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Renhållning och avfallshantering', 'concept_id': 'TKTt_U3W_xpF', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'k2vb_jdE_dFL', 'preferred_label': 'Arbetsmiljö och renhållning, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Arbetsmiljö och renhållning, övrig och ospecificerad utbildning', 'concept_id': 'k2vb_jdE_dFL', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'CHpR_CZt_yFH', 'preferred_label': 'Säkerhetstjänster, allmän utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Säkerhetstjänster, allmän utbildning', 'concept_id': 'CHpR_CZt_yFH', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'gFgy_6ge_5y4', 'preferred_label': 'Säkerhet i samhället', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Säkerhet i samhället', 'concept_id': 'gFgy_6ge_5y4', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'GweQ_WZy_ns4', 'preferred_label': 'Militär utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Militär utbildning', 'concept_id': 'GweQ_WZy_ns4', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'Brzn_3gx_ynL', 'preferred_label': 'Säkerhetstjänster, övrig och ospecificerad utbildning', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Säkerhetstjänster, övrig och ospecificerad utbildning', 'concept_id': 'Brzn_3gx_ynL', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-field-3', 'id': 'iVQn_SPL_8hc', 'preferred_label': 'Okänd', 'deprecated_legacy_id': None},
'sun-education-field-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-field-3', 'label': 'Okänd', 'concept_id': 'iVQn_SPL_8hc', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-1', 'id': 'VQCo_PgG_39T', 'preferred_label': 'Förskoleutbildning', 'deprecated_legacy_id': None},
'sun-education-level-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-1', 'label': 'Förskoleutbildning', 'concept_id': 'VQCo_PgG_39T', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-1', 'id': 'p7d8_c57_h7X', 'preferred_label': 'Förgymnasial utbildning, kortare än 9 år', 'deprecated_legacy_id': None},
'sun-education-level-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-1', 'label': 'Förgymnasial utbildning, kortare än 9 år', 'concept_id': 'p7d8_c57_h7X', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-1', 'id': 'm5ZS_gKU_d4v', 'preferred_label': 'Förgymnasial utbildning, 9 (10) år', 'deprecated_legacy_id': None},
'sun-education-level-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-1', 'label': 'Förgymnasial utbildning, 9 (10) år', 'concept_id': 'm5ZS_gKU_d4v', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-1', 'id': 'wyLL_K3a_HRC', 'preferred_label': 'Gymnasial utbildning', 'deprecated_legacy_id': None},
'sun-education-level-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-1', 'label': 'Gymnasial utbildning', 'concept_id': 'wyLL_K3a_HRC', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-1', 'id': 'GD66_5wp_MSh', 'preferred_label': 'Eftergymnasial utbildning, kortare än 2 år', 'deprecated_legacy_id': None},
'sun-education-level-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-1', 'label': 'Eftergymnasial utbildning, kortare än 2 år', 'concept_id': 'GD66_5wp_MSh', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-1', 'id': 'KBjB_gpS_ZJL', 'preferred_label': 'Eftergymnasial utbildning, minst 2 år', 'deprecated_legacy_id': None},
'sun-education-level-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-1', 'label': 'Eftergymnasial utbildning, minst 2 år', 'concept_id': 'KBjB_gpS_ZJL', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-1', 'id': 'ygjL_oek_A2F', 'preferred_label': 'Forskarutbildning', 'deprecated_legacy_id': None},
'sun-education-level-1', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-1', 'label': 'Forskarutbildning', 'concept_id': 'ygjL_oek_A2F', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-2', 'id': 'UY9b_iWP_8Zw', 'preferred_label': 'Förskoleutbildning', 'deprecated_legacy_id': None},
'sun-education-level-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-2', 'label': 'Förskoleutbildning', 'concept_id': 'UY9b_iWP_8Zw', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-2', 'id': '9XKT_8kH_gi7', 'preferred_label': 'Förgymnasial utbildning kortare än 9 år', 'deprecated_legacy_id': None},
'sun-education-level-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-2', 'label': 'Förgymnasial utbildning kortare än 9 år', 'concept_id': '9XKT_8kH_gi7', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-2', 'id': '9WtB_jpA_rXE', 'preferred_label': 'Förgymnasial utbildning, 9 (10) år', 'deprecated_legacy_id': None},
'sun-education-level-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-2', 'label': 'Förgymnasial utbildning, 9 (10) år', 'concept_id': '9WtB_jpA_rXE', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-2', 'id': 'XMhw_at9_A3J', 'preferred_label': 'Gymnasial utbildning, kortare än 2 år', 'deprecated_legacy_id': None},
'sun-education-level-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-2', 'label': 'Gymnasial utbildning, kortare än 2 år', 'concept_id': 'XMhw_at9_A3J', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-2', 'id': 'GNkn_NLL_SFQ', 'preferred_label': 'Gymnasial utbildning, 2 år', 'deprecated_legacy_id': None},
'sun-education-level-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-2', 'label': 'Gymnasial utbildning, 2 år', 'concept_id': 'GNkn_NLL_SFQ', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-2', 'id': '7wEe_uui_q7S', 'preferred_label': 'Gymnasial utbildning, 3 år', 'deprecated_legacy_id': None},
'sun-education-level-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-2', 'label': 'Gymnasial utbildning, 3 år', 'concept_id': '7wEe_uui_q7S', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-2', 'id': '5zyL_72s_9Dq', 'preferred_label': 'Eftergymnasial utbildning, kortare än 2 år', 'deprecated_legacy_id': None},
'sun-education-level-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-2', 'label': 'Eftergymnasial utbildning, kortare än 2 år', 'concept_id': '5zyL_72s_9Dq', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-2', 'id': 'ou37_iEy_U9G', 'preferred_label': 'Eftergymnasial utbildning, 2 år', 'deprecated_legacy_id': None},
'sun-education-level-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-2', 'label': 'Eftergymnasial utbildning, 2 år', 'concept_id': 'ou37_iEy_U9G', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-2', 'id': 'NQLe_3u4_E3H', 'preferred_label': 'Eftergymnasial utbildning, 3 år', 'deprecated_legacy_id': None},
'sun-education-level-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-2', 'label': 'Eftergymnasial utbildning, 3 år', 'concept_id': 'NQLe_3u4_E3H', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-2', 'id': 'yXeS_uF8_bcJ', 'preferred_label': 'Eftergymnasial utbildning, 4 år', 'deprecated_legacy_id': None},
'sun-education-level-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-2', 'label': 'Eftergymnasial utbildning, 4 år', 'concept_id': 'yXeS_uF8_bcJ', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-2', 'id': '63Y9_Y6H_MRS', 'preferred_label': 'Eftergymnasial utbildning, 5 år eller längre', 'deprecated_legacy_id': None},
'sun-education-level-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-2', 'label': 'Eftergymnasial utbildning, 5 år eller längre', 'concept_id': '63Y9_Y6H_MRS', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-2', 'id': 'Tgwr_PnN_eXh', 'preferred_label': 'Övrig forskarutbildning', 'deprecated_legacy_id': None},
'sun-education-level-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-2', 'label': 'Övrig forskarutbildning', 'concept_id': 'Tgwr_PnN_eXh', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-2', 'id': 'dbU6_yuv_FBz', 'preferred_label': 'Licentiatutbildning', 'deprecated_legacy_id': None},
'sun-education-level-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-2', 'label': 'Licentiatutbildning', 'concept_id': 'dbU6_yuv_FBz', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-2', 'id': '212f_zrd_YnB', 'preferred_label': 'Doktorsutbildning', 'deprecated_legacy_id': None},
'sun-education-level-2', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-2', 'label': 'Doktorsutbildning', 'concept_id': '212f_zrd_YnB', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'TzAp_hjo_A8a', 'preferred_label': 'Övrig förskoleutbildning', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Övrig förskoleutbildning', 'concept_id': 'TzAp_hjo_A8a', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'p3Nu_zzc_L7T', 'preferred_label': 'Förskola', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Förskola', 'concept_id': 'p3Nu_zzc_L7T', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'pCha_vWk_pbR', 'preferred_label': 'Förskoleklass', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Förskoleklass', 'concept_id': 'pCha_vWk_pbR', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'WWUK_YR9_tiB', 'preferred_label': 'Övrig förgymnasial utbildning, kortare än 9 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Övrig förgymnasial utbildning, kortare än 9 år', 'concept_id': 'WWUK_YR9_tiB', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'aqCP_3Sv_hbt', 'preferred_label': 'Grundskoleutbildning, årskurs 1–6', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Grundskoleutbildning, årskurs 1–6', 'concept_id': 'aqCP_3Sv_hbt', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'kZCr_aNc_xrE', 'preferred_label': 'Folkskoleutbildning', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Folkskoleutbildning', 'concept_id': 'kZCr_aNc_xrE', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'gxFs_gGU_1AM', 'preferred_label': 'Övrig förgymnasial utbildning, 9 (10) år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Övrig förgymnasial utbildning, 9 (10) år', 'concept_id': 'gxFs_gGU_1AM', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'rprK_LHm_mqY', 'preferred_label': 'Realskoleutbildning', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Realskoleutbildning', 'concept_id': 'rprK_LHm_mqY', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'wkuu_1Vj_bjf', 'preferred_label': 'Grundskoleutbildning, årskurs 7–9 (10)', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Grundskoleutbildning, årskurs 7–9 (10)', 'concept_id': 'wkuu_1Vj_bjf', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'iGTR_7gg_kkU', 'preferred_label': 'Övrig gymnasial utbildning, kortare än 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Övrig gymnasial utbildning, kortare än 2 år', 'concept_id': 'iGTR_7gg_kkU', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'iztQ_c73_SFg', 'preferred_label': 'Gymnasial utbildning, studieförberedande, ej examen, kortare än 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Gymnasial utbildning, studieförberedande, ej examen, kortare än 2 år', 'concept_id': 'iztQ_c73_SFg', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'yaxP_FTp_8tY', 'preferred_label': 'Gymnasial utbildning, yrkesinriktad, ej examen, kortare än 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Gymnasial utbildning, yrkesinriktad, ej examen, kortare än 2 år', 'concept_id': 'yaxP_FTp_8tY', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': '7FFZ_yZV_63D', 'preferred_label': 'Gymnasial utbildning, studieförberedande, kortare än 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Gymnasial utbildning, studieförberedande, kortare än 2 år', 'concept_id': '7FFZ_yZV_63D', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'FqU9_fvY_7aG', 'preferred_label': 'Gymnasial utbildning, yrkesinriktad, kortare än 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Gymnasial utbildning, yrkesinriktad, kortare än 2 år', 'concept_id': 'FqU9_fvY_7aG', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'eykP_7QJ_HP4', 'preferred_label': 'Övrig gymnasial utbildning, 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Övrig gymnasial utbildning, 2 år', 'concept_id': 'eykP_7QJ_HP4', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'uzND_WKS_EvF', 'preferred_label': 'Gymnasial utbildning, studieförberedande, ej examen, 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Gymnasial utbildning, studieförberedande, ej examen, 2 år', 'concept_id': 'uzND_WKS_EvF', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'rsT8_uBz_7GD', 'preferred_label': 'Gymnasial utbildning, yrkesinriktad, ej examen, 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Gymnasial utbildning, yrkesinriktad, ej examen, 2 år', 'concept_id': 'rsT8_uBz_7GD', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': '51zD_KTU_BvN', 'preferred_label': 'Gymnasial utbildning, studieförberedande, 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Gymnasial utbildning, studieförberedande, 2 år', 'concept_id': '51zD_KTU_BvN', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': '5zXG_hBr_f5r', 'preferred_label': 'Gymnasial utbildning, yrkesinriktad, 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Gymnasial utbildning, yrkesinriktad, 2 år', 'concept_id': '5zXG_hBr_f5r', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'dQJv_EFZ_ARk', 'preferred_label': 'Övrig gymnasial utbildning, 3 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Övrig gymnasial utbildning, 3 år', 'concept_id': 'dQJv_EFZ_ARk', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': '24uD_BB2_iNj', 'preferred_label': 'Gymnasial utbildning, studieförberedande, ej examen, 3 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Gymnasial utbildning, studieförberedande, ej examen, 3 år', 'concept_id': '24uD_BB2_iNj', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'quGU_7iM_NmM', 'preferred_label': 'Gymnasial utbildning, yrkesinriktad, ej examen, 3 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Gymnasial utbildning, yrkesinriktad, ej examen, 3 år', 'concept_id': 'quGU_7iM_NmM', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'b69Q_2ZV_Wmf', 'preferred_label': 'Gymnasial utbildning, studieförberedande, 3 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Gymnasial utbildning, studieförberedande, 3 år', 'concept_id': 'b69Q_2ZV_Wmf', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'mLC7_n2W_KzP', 'preferred_label': 'Gymnasial utbildning, yrkesinriktad, 3 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Gymnasial utbildning, yrkesinriktad, 3 år', 'concept_id': 'mLC7_n2W_KzP', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'B1Mh_UAh_mKJ', 'preferred_label': 'Övrig eftergymnasial utbildning, kortare än 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Övrig eftergymnasial utbildning, kortare än 2 år', 'concept_id': 'B1Mh_UAh_mKJ', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'q8Mm_HQR_FNu', 'preferred_label': 'Högskoleutbildning, minst 30 högskolepoäng, ej examen, kortare än 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Högskoleutbildning, minst 30 högskolepoäng, ej examen, kortare än 2 år', 'concept_id': 'q8Mm_HQR_FNu', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'qrw9_w7a_aaA', 'preferred_label': 'Gymnasial påbyggnadsutbildning, kortare än 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Gymnasial påbyggnadsutbildning, kortare än 2 år', 'concept_id': 'qrw9_w7a_aaA', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'qc85_uPq_tp1', 'preferred_label': 'Eftergymnasial utbildning, ej vid universitet och högskola, yrkesinriktad, kortare än 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Eftergymnasial utbildning, ej vid universitet och högskola, yrkesinriktad, kortare än 2 år', 'concept_id': 'qc85_uPq_tp1', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'oroB_8GN_Fe5', 'preferred_label': 'Högskoleutbildning, yrkesinriktad, kortare än 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Högskoleutbildning, yrkesinriktad, kortare än 2 år', 'concept_id': 'oroB_8GN_Fe5', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'awNi_fMS_NKM', 'preferred_label': 'Övrig eftergymnasial utbildning, 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Övrig eftergymnasial utbildning, 2 år', 'concept_id': 'awNi_fMS_NKM', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'xrpD_CxF_DUA', 'preferred_label': 'Högskoleutbildning, 120 högskolepoäng, ej examen, 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Högskoleutbildning, 120 högskolepoäng, ej examen, 2 år', 'concept_id': 'xrpD_CxF_DUA', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'CSRP_pA2_nFg', 'preferred_label': 'Eftergymnasial utbildning, ej vid universitet och högskola, yrkesinriktad, 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Eftergymnasial utbildning, ej vid universitet och högskola, yrkesinriktad, 2 år', 'concept_id': 'CSRP_pA2_nFg', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'rqLj_s2C_LTJ', 'preferred_label': 'Högskoleutbildning, generell, 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Högskoleutbildning, generell, 2 år', 'concept_id': 'rqLj_s2C_LTJ', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'zdKB_pTL_HMS', 'preferred_label': 'Högskoleutbildning, yrkesinriktad, 2 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Högskoleutbildning, yrkesinriktad, 2 år', 'concept_id': 'zdKB_pTL_HMS', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'rEsJ_SeR_PeH', 'preferred_label': 'Övrig eftergymnasial utbildning, 3 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Övrig eftergymnasial utbildning, 3 år', 'concept_id': 'rEsJ_SeR_PeH', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': '6oeu_fV9_XGd', 'preferred_label': 'Högskoleutbildning, minst 180 högskolepoäng, ej examen, 3 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Högskoleutbildning, minst 180 högskolepoäng, ej examen, 3 år', 'concept_id': '6oeu_fV9_XGd', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'Dxdt_jZu_Je3', 'preferred_label': 'Eftergymnasial utbildning, ej vid universitet och högskola, yrkesinriktad, 3 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Eftergymnasial utbildning, ej vid universitet och högskola, yrkesinriktad, 3 år', 'concept_id': 'Dxdt_jZu_Je3', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'u9Qr_2wJ_nVu', 'preferred_label': 'Högskoleutbildning, generell, 3 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Högskoleutbildning, generell, 3 år', 'concept_id': 'u9Qr_2wJ_nVu', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': '9soG_8dX_jNa', 'preferred_label': 'Högskoleutbildning, yrkesinriktad, 3 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Högskoleutbildning, yrkesinriktad, 3 år', 'concept_id': '9soG_8dX_jNa', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'gbpT_d3p_KJf', 'preferred_label': 'Övrig eftergymnasial utbildning, 4 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Övrig eftergymnasial utbildning, 4 år', 'concept_id': 'gbpT_d3p_KJf', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'kDKD_HRg_vJ9', 'preferred_label': 'Eftergymnasial utbildning, ej vid universitet och högskola, yrkesinriktad, 4 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Eftergymnasial utbildning, ej vid universitet och högskola, yrkesinriktad, 4 år', 'concept_id': 'kDKD_HRg_vJ9', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'P5XD_6Qj_hEk', 'preferred_label': 'Högskoleutbildning, generell, 4 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Högskoleutbildning, generell, 4 år', 'concept_id': 'P5XD_6Qj_hEk', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'HPPA_wKg_Zpp', 'preferred_label': 'Högskoleutbildning, yrkesinriktad, 4 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Högskoleutbildning, yrkesinriktad, 4 år', 'concept_id': 'HPPA_wKg_Zpp', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': '8tej_hpa_8CH', 'preferred_label': 'Övrig eftergymnasial utbildning, 5 år eller längre', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Övrig eftergymnasial utbildning, 5 år eller längre', 'concept_id': '8tej_hpa_8CH', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'iy5K_qmx_bco', 'preferred_label': 'Eftergymnasial utbildning, ej vid universitet och högskola, yrkesinriktad, 5 år', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Eftergymnasial utbildning, ej vid universitet och högskola, yrkesinriktad, 5 år', 'concept_id': 'iy5K_qmx_bco', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'mJj4_3Dz_V2z', 'preferred_label': 'Högskoleutbildning, generell, 5 år eller längre', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Högskoleutbildning, generell, 5 år eller längre', 'concept_id': 'mJj4_3Dz_V2z', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': '9wiU_o3Z_BfD', 'preferred_label': 'Högskoleutbildning, yrkesinriktad, 5 år eller längre', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Högskoleutbildning, yrkesinriktad, 5 år eller längre', 'concept_id': '9wiU_o3Z_BfD', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'kfJY_KdG_Bmi', 'preferred_label': 'Övrig forskarutbildning', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Övrig forskarutbildning', 'concept_id': 'kfJY_KdG_Bmi', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'jP4Q_5Co_vWN', 'preferred_label': 'Licentiatutbildning', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Licentiatutbildning', 'concept_id': 'jP4Q_5Co_vWN', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'sun-education-level-3', 'id': 'FAhQ_vze_BYQ', 'preferred_label': 'Doktorsutbildning', 'deprecated_legacy_id': None},
'sun-education-level-3', {'legacy_ams_taxonomy_id': None, 'type': 'sun-education-level-3', 'label': 'Doktorsutbildning', 'concept_id': 'FAhQ_vze_BYQ', 'legacy_ams_taxonomy_num_id': None}),
( {'type': 'employment-duration', 'id': 'a7uU_j21_mkL', 'preferred_label': 'Tills vidare', 'deprecated_legacy_id': '1'},
'employment-duration', {'legacy_ams_taxonomy_id': '1', 'type': 'employment-duration', 'label': 'Tills vidare', 'concept_id': 'a7uU_j21_mkL', 'legacy_ams_taxonomy_num_id': 1}),
( {'type': 'employment-duration', 'id': '9RGe_UxD_FZw', 'preferred_label': '12 månader - upp till 2 år', 'deprecated_legacy_id': '9'},
'employment-duration', {'legacy_ams_taxonomy_id': '9', 'type': 'employment-duration', 'label': '12 månader - upp till 2 år', 'concept_id': '9RGe_UxD_FZw', 'legacy_ams_taxonomy_num_id': 9}),
( {'type': 'employment-duration', 'id': 'gJRb_akA_95y', 'preferred_label': '6 månader – upp till 12 månader', 'deprecated_legacy_id': '0'},
'employment-duration', {'legacy_ams_taxonomy_id': '0', 'type': 'employment-duration', 'label': '6 månader – upp till 12 månader', 'concept_id': 'gJRb_akA_95y', 'legacy_ams_taxonomy_num_id': 0}),
( {'type': 'employment-duration', 'id': 'Xj7x_7yZ_jEn', 'preferred_label': '3 månader – upp till 6 månader', 'deprecated_legacy_id': '3'},
'employment-duration', {'legacy_ams_taxonomy_id': '3', 'type': 'employment-duration', 'label': '3 månader – upp till 6 månader', 'concept_id': 'Xj7x_7yZ_jEn', 'legacy_ams_taxonomy_num_id': 3}),
( {'type': 'employment-duration', 'id': 'Sy9J_aRd_ALx', 'preferred_label': '11 dagar - upp till 3 månader', 'deprecated_legacy_id': '7'},
'employment-duration', {'legacy_ams_taxonomy_id': '7', 'type': 'employment-duration', 'label': '11 dagar - upp till 3 månader', 'concept_id': 'Sy9J_aRd_ALx', 'legacy_ams_taxonomy_num_id': 7}),
( {'type': 'employment-duration', 'id': 'cAQ8_TpB_Tdv', 'preferred_label': 'Upp till 10 dagar', 'deprecated_legacy_id': '8'},
'employment-duration', {'legacy_ams_taxonomy_id': '8', 'type': 'employment-duration', 'label': 'Upp till 10 dagar', 'concept_id': 'cAQ8_TpB_Tdv', 'legacy_ams_taxonomy_num_id': 8}),
] |
def hex2int(hex_str):
"""
Convert hex characters (e.g. "23" or "011a") to int (35 or 282)
:param hex_str: hex character string
:return: int integer
"""
return int(hex_str, 16)
def hex2value10(hex_str):
"""
Convert 2 hex characters (e.g. "23") to float (3.5)
:param hex_str: hex character string
:return: float value
"""
return hex2int(hex_str) / 10.0
def parse_aqburk(hex_str, port=None):
"""
Parse payload like "2a2a0021002c002800300056003b0000" float values
:param hex_str: AQLoRaBurk hex payload
:param port: LoRaWAN port
:return: dict containing float values
"""
data = {
'pm25min': hex2value10(hex_str[4:8]),
'pm25max': hex2value10(hex_str[8:12]),
'pm25avg': hex2value10(hex_str[12:16]),
'pm25med': hex2value10(hex_str[16:20]),
'pm10min': hex2value10(hex_str[20:24]),
'pm10max': hex2value10(hex_str[24:28]),
'pm10avg': hex2value10(hex_str[28:32]),
'pm10med': hex2value10(hex_str[32:36]),
}
if len(hex_str) == 52:
data['temp'] = round(hex2value10(hex_str[36:40]) - 100, 1)
data['humi'] = hex2value10(hex_str[40:44])
data['pres'] = hex2value10(hex_str[44:48])
data['gas'] = hex2value10(hex_str[48:52])
return data
|
class Quantity(object):
def __get__(self, instance, owner):
return getattr(instance, self.target_name)
def __set__(self, instance, value):
if not hasattr(self, 'target_name'):
self.set_target_names(instance)
if value > 0:
setattr(instance, self.target_name, value)
else:
raise ValueError('value must be > 0')
def set_target_names(self, instance, owner=None):
owner = owner if owner else instance.__class__
for key, attr in owner.__dict__.items():
if hasattr(attr, 'set_target_names'):
setattr(attr, 'target_name', '_%s__%s' % (owner.__name__, key))
class LineItem(object):
weight = Quantity()
price = Quantity()
def __init__(self, description, weight, price):
self.description = description
self.weight = weight
self.price = price
def subtotal(self):
return self.weight * self.price
|
def sort_012(inputList):
next0 = 0
next2 = len(inputList) - 1
frontIndex = 0
while frontIndex <= next2:
if inputList[frontIndex] is 0:
inputList[frontIndex] = inputList[next0]
inputList[next0] = 0
next0 += 1
frontIndex += 1
elif inputList[frontIndex] == 2:
inputList[frontIndex] = inputList[next2]
inputList[next2] = 2
next2 -= 1
else:
frontIndex += 1
return inputList
print(sort_012([0, 0, 2, 2, 2, 1, 1, 1, 2, 0, 2]));
# 0, 0, 0, 1, 1, 1, 2, 2, 2, 2, 2]
print(sort_012([1,0]));
# [0, 1]
print(sort_012([]));
# []
|
class Node:
def __init__(self, data):
self.data = data
self.left = None
self.right = None
def __repr__(self):
if type(self.data) != 'str':
return str(self.data)
return self.data
def inorder(root, is_last_node=False):
if root:
inorder(root.left)
print('{}->'.format(root), end='')
inorder(root.right)
return
def preorder(root):
if root:
print('{}->'.format(root), end='')
preorder(root.left)
preorder(root.right)
return
def postorder(root):
if root:
postorder(root.left)
postorder(root.right)
print('{}->'.format(root), end='')
return
def level_order(root):
if root is None:
return
queue = []
queue.append(root)
while(len(queue) > 0):
print(queue[0].data, end=' ')
node = queue.pop(0)
if node.left is not None:
queue.append(node.left)
if node.right is not None:
queue.append(node.right)
return
def build_tree_one():
root = Node(1)
root.left = Node(2)
root.right = Node(3)
root.left.left = Node(4)
root.left.right = Node(5)
return root
def build_tree_two():
root = Node(1)
root.left = Node(12)
root.right = Node(9)
root.left.left = Node(5)
root.left.right = Node(6)
return root
if __name__ == '__main__':
tree_one = build_tree_one()
print('*** Tree One ***')
print('Inorder Traversal')
inorder(tree_one)
print('\nPreorder Traversal')
preorder(tree_one)
print('\nPostorder Traversal')
postorder(tree_one)
print('\nLevel Order Traversal')
level_order(tree_one)
tree_two = build_tree_two()
print('\n\n*** Tree Two ***')
print('Inorder Traversal')
inorder(tree_two)
print('\nPreorder Traversal')
preorder(tree_two)
print('\nPostorder Traversal')
postorder(tree_two)
print('\nLevel Order Traversal')
level_order(tree_two)
|
class Credentials:
"""
Class that generates new instances of credentials.
"""
credentials_list = []
def __init__(self,account_name, username, password):
"""
__init__method to help us create new instances of the class credentials
"""
self.account_name = account_name
self.username = username
self.password = password
def save_account(self):
"""Method to save new account to the credentials_list"""
Credentials.credentials_list.append(self)
@classmethod
def account_exist(cls, username):
'''
Method that checks if an account exists from the credentials list.
Returns :
Boolean: True or false depending if the account exists
'''
for Credentials in cls.credentials_list:
if Credentials.username == username:
return True
return False
@classmethod
def find_by_account_name(cls, account_name):
"""
method to search account by account name
"""
for account in cls.credentials_list:
if account.account_name == account_name:
return account
def delete_account(self):
'''
method to delete a saved account credentials from the credentials_list
'''
Credentials.credentials_list.remove(self)
@classmethod
def display_account(cls):
'''
method that returns the credentials list
'''
return cls.credentials_list
|
sum=0
for i in range(5):
a=int(input())
if a<40:
a=40
sum+=a
print(sum//5) |
# Some constants to work for https://github.com/Di-Ny/LoRaPacketForwarderDomoticzConfigurator
#
# Author: DiNy
###########
## Global
GW_UNIT_ID=10
###########
## LORA
DR_2_SFBW_EU868 = {
"0":["12","125.0","5"],
"1":["11","125.0","5"],
"2":["10","125.0","5"],
"3":["9","125.0","5"],
"4":["8","125.0","5"],
"5":["7","125.0","5"],
"6":["7","250.0","5"],
"7":["12","125.0","7"],
"8":["12","62.5","5"],
"9":["12","62.5","7"],
"10":["12","31.25","5"],
"11":["12","31.25","7"],
"12":["10","125.0","7"],
"13":["10","62.5","5"],
"14":["10","62.5","7"],
"15":["8","62.5","5"]
}
|
# Login information for the 6.034 Automated Tester
USERNAME="lcchiang_MIT_EDU"
PASSWORD="yu7Q4nPJNRALMY3AJ6ze"
XMLRPC_URL="https://ai6034.mit.edu/labs/xmlrpc/"
|
# Autor: David Ferreira de Almeida
# Implementacao de uma Árvore Binária de Busca
#
# Exemplo de uma Árvore Binária de Busca que será usado durante o código.
# O elemento à esquerda são menores que o valor do pai, e os elementos à
# direita são maiores ou iguais ao valor do pai.
#
# 61
# /\
# / \
# / \
# 43 89
# / \ /
# 16 51 66
# / \ \ \
# 11 32 55 79
# / \
# 77 82
#
# 61, 43, 16, 11, 32, 51, 55, 89, 66, 79, 77, 82
ROOT = 'root' # valor constante que será usado como valor padrão em alguns casos no código.
# o nó permite ligar os elementos esparsos da árvore
class Node:
def __init__(self, element): # atributos da classe
self.data = element
self.left = None
self.right = None
def __str__(self):
return f'{self.data}'
class BinarySearchTree:
def __init__(self, element=None, node=None):
# Iniciando a raíz da árvore a partir de um nó já criado.
if node is not None:
self.root = node
# Caso contrário, cria-se um nó e atribui para a raíz da árvore.
elif element is not None:
self.root = Node(element)
else:
self.root = None
def insert(self, element):
father = None # pai do elemento que será inserido
point = self.root
while point is not None:
father = point
# Se o elemento for menor, ele segue descendo à esquerda,
# caso contrário, segue descendo à direita.
if element < point.data:
point = point.left
else:
point = point.right
# Se a árvore estiver vazia, o elemento que entra é a raíz.
if father is None:
self.root = Node(element)
# Adicionando o elemento
elif element < father.data:
father.left = Node(element)
else:
father.right = Node(element)
def search(self, element, node=0):
# Começa a busca pela raíz.
if node == 0:
node = self.root
# Caso o item não esteja na árvore retorna None
if node is None:
return node
# Retorna uma sub-árvore
elif node.data == element:
return BinarySearchTree(node=node)
elif element < node.data:
return self.search(element, node.left) # Se o elemento for menor que o valor do nó, ele segue pela esquerda.
return self.search(element, node.right) # Se for maior, segue pela direita.
# Para a remoção de um elemento da árvore, tem 3 casos possíveis:
# 1. Quando o elemento removido é uma folha.
# 2. Quando o elemento removido tem apenas um filho (esquerda ou direita)
# 3. Quando o elemento removido tem os dois filhos (esquerda e direita)
# No 3º caso removemos o elementos, e substituimos pelo menor elemento da sua
# sub-árvore da direita.
def remove(self, element, node=ROOT):
if node == ROOT:
node = self.root
# Desceu até um ramo nulo, ou seja, o elemento não está na árvore.
if node is None:
return node
# se o elemento for menor, ele desce para a esquerda
if element < node.data:
node.left = self.remove(element, node.left)
# se o elemento for menor, ele desce para a direita
elif element > node.data:
node.right = self.remove(element, node.right)
# Elemento encontrado, ou seja, igual.
else:
# O primeiro caso, quando o elemento a ser removido é uma folha
# retorna-se None, ao filho da esquerda ou da direita do pai do elemento,
# que é equivalente a remover o elemento.
# O segundo caso, quando o elemento que apenas um filho (esquerda ou direita),
# retorna para como filho (à esquerda ou direita) do pai do elemento, o nó do
# filho que não é Nulo do elemento removido.
if node.left is None:
return node.right
elif node.right is None:
return node.left
# O terceiro caso, quando o elemento tem dois filhos.
else:
# O substituto será o menor elemento da sub-árvore da direita,
# que vai substituir o elemento removido.
substitute = self.min(node.right)
# Trocando o valor do removido pelo seu substituto.
node.data = substitute
# removendo o valor substituto da sub-árvore da direita.
node.right = self.remove(substitute, node.right)
# retornando o proprio nó para os casos que não foram feitas alterações para à esquerda ou direita
return node
# O menor elemento da árvore está o máximo à esquerda,
# e que não possua um filho à esquerda.
def min(self, node=ROOT):
if node == ROOT:
node = self.root
while node.left is not None:
node = node.left
return node.data
# O maior elemento da árvore está o máximo à direita,
# e que não possua um filho à direita.
def max(self, node=ROOT):
if node == ROOT:
node = self.root
while node.right is not None:
node = node.right
return node.data
# Percurso em pré ordem.
# O percurso mostra a raíz, depois o elemento à esquerda e o elemento à dereita.
# A ordem visitada no exemplo visto acima sera:
# 61, 43, 16, 11, 32, 51, 55, 89, 66, 79, 77, 82
def pre_order_route(self, node=ROOT):
if node == ROOT:
node = self.root
if node is not None:
print(node, end=' ')
self.pre_order_route(node.left)
self.pre_order_route(node.right)
# Percurso em ordem simétrica/em ordem.
# O percurso mostra primeiro o elemento da esquerda, depois a raíz, e
# o elemento da direita, recursivamente. Na BST os elementos ficam em ordem crescente,
# quando é usado esse percurso.
# A ordem visitada no exemplo visto acima sera:
# 11, 16, 32, 43, 51, 55, 61, 66, 77, 79, 82, 89
def inorder_route(self, node=None):
if node is None:
node = self.root
# Chamando recursivamente e mostrando os elementos
if node.left is not None:
self.inorder_route(node.left)
print(node, end=' ') # mostrando o elemento do nó
if node.right is not None:
self.inorder_route(node.right)
# Percurso em pós ordem: exibi os filhos da esquerda e direita antes de mostrar a sí mesmo,
# visitando recursivamente sua sub-árvore da esquerda, e depois sua sub-árvore da direta.
# A ordem visitada no exemplo visto acima sera:
# 11, 32, 16, 55, 51, 43, 77, 82, 79, 66, 89, 61
def post_order_route(self, node=None):
if node is None: # Começa o percurso pela raíz da árvore
node = self.root
if node.left is not None:
self.post_order_route(node.left)
if node.right is not None:
self.post_order_route(node.right)
print(node, end=' ') # mostrando o elemento do nó
# Percurso em Nível
# O elementos visitados são os de cada nivel da árvore, da esquerda para a direita.
# Para obter esse percurso é necessário usar uma Fila, seguindo a regra: primeiro a entrar,
# primeiro a sair.
# A ordem visitada no exemplo visto acima sera:
# 61, 43, 89, 16, 51, 66, 11, 32, 55, 79, 77, 82
def route_at_level(self, node=ROOT):
if node == ROOT:
node = self.root
queue = []
queue.append(node) # insere no final, e remove do inicio
while len(queue) > 0:
node = queue.pop(0)
if node.left is not None:
queue.append(node.left)
if node.right is not None:
queue.append(node.right)
print(node, end=' ')
# Altura da árvore: raíz ate sua folha mais profunda.
# O objetivo é olhar a altura das sub-arvores da esquerda e direita,
# utilizando o percurso em pós ordem, e pegar a maior altura e incrementar 1.
def height(self, node=None):
if node is None:
node = self.root # altura da arvore completa
height_left = 0 # altura da sub-árvore esquerda
height_right = 0 # altura da sub-árvore direita
if node.left is not None:
height_left = self.height(node.left)
if node.right is not None:
height_right = self.height(node.right)
if height_left > height_right:
return height_left + 1
return height_right + 1
if __name__ == '__main__':
bst = BinarySearchTree()
# valores do exemplo
valores = [61, 43, 89, 16, 51, 66, 11, 32, 55, 79, 77, 82]
for i in valores:
bst.insert(i)
print('Percurso em Pré Ordem:')
bst.pre_order_route()
print('\n\nPercurso em Ordem Simétrica/Em ordem:')
bst.inorder_route()
print('\n\nPercurso em Pós Ordem:')
bst.post_order_route()
print('\n\nPercurso em Nível:')
bst.route_at_level()
print('\n')
print(f'Menor elemento da árvore: {bst.min()}') # -> 11
print(f'Maior elemento da árvore: {bst.max()}') # -> 89
print(f'Altura da árvore: {bst.height()}') # -> 5
print(bst.remove(66)) # <- removendo o 66
print('\nPercurso em Ordem Simétrica/Em ordem:')
bst.inorder_route()
print('\n\nPercurso em Nível:')
bst.route_at_level()
|
class Solution:
def reverseBits(self, n):
res = 0
for _ in range(32):
res = (res<<1) + (n&1) # 右移动
n>>=1 # 左移
return res
s =Solution()
b = s.reverseBits(101010111)
print(b)
|
ENDPOINT = "https://en.wikipedia.org/w/api.php"
def make_url(id, is_expanded=False, is_html=False):
# TODO: isdigit is not robust enough, title could be number instead of string
return make_id_url(id, is_expanded, is_html) if str(id).isdigit() else make_title_url(id, is_expanded, is_html)
def make_title_url(id, is_expanded=False, is_html=False):
url = ENDPOINT + "?action=query&titles=" + url_safe_spaces(str(id)) + "&prop=revisions|pageprops&rvprop=content&format=json"
if is_expanded:
url += "&rvexpandtemplates"
if is_html:
url = ENDPOINT + "?format=json&rvprop=content&prop=revisions&rvparse=&titles=" + url_safe_spaces(str(id)) + "&rvlimit=1&action=query"
return url
def make_id_url(id, is_expanded=False, is_html=False):
url = ENDPOINT + "?action=query&pageids=" + url_safe_spaces(str(id)) + "&prop=revisions|pageprops&rvprop=content&format=json"
if is_expanded:
url += "&rvexpandtemplates"
if is_html:
url = ENDPOINT + "?format=json&rvprop=content&prop=revisions&rvparse=&pageids=" + url_safe_spaces(str(id)) + "&rvlimit=1&action=query"
return url
def url_safe_spaces(text):
return text.replace(" ", "%20") |
#!/usr/bin/python3
def main():
buffersize = 50000
infile = open('obama.png', 'rb')
outfile = open('obama-copy.png', 'wb')
buffer = infile.read(buffersize)
while len(buffer):
outfile.write(buffer)
print('.', end = '')
buffer = infile.read(buffersize)
print()
print('Done.')
if __name__ == "__main__": main()
|
a, b, c = sorted(list(map(float, input().split())))
if(((a+b) > c)and((c-a) < b)):
print('It is a triangle.')
if(((a**2)+(b**2)) == (c**2)):
print('-> also a Right triangle.')
if(not(a-b)):
print('-> Wow it\'s a Isosceles right triangle!')
else:
print('not a triangle.') |
def alternating(list_of_ints):
pass
print(alternating([1, 2, 3, 4]))
print(alternating([10, 11, 1, 12]))
print(alternating([10, 21, 22, -5, 100, 101, 2]))
|
DEVICE_NAME = '00002a00-0000-1000-8000-00805f9b34fb'
MODEL_NUMBER = '00002a24-0000-1000-8000-00805f9b34fb'
SERIAL_NUMBER = '00002a25-0000-1000-8000-00805f9b34fb'
FIRMWARE_VERSION = '00002a26-0000-1000-8000-00805f9b34fb'
HARDWARE_VERSION = '00002a27-0000-1000-8000-00805f9b34fb'
MANUFACTURER_NAME = '00002a29-0000-1000-8000-00805f9b34fb'
LYWSD02_DATA = 'EBE0CCC1-7A0A-4B0C-8A1A-6FF2997DA3A6'
CGG_DATA = '00000100-0000-1000-8000-00805f9b34fb'
MJHT_DATA = '00000001-0000-1000-8000-00805f9b34fb'
MJHT_BATTERY = '00002a19-0000-1000-8000-00805f9b34fb'
|
pkgname = "libusbmuxd"
pkgver = "2.0.2"
pkgrel = 0
build_style = "gnu_configure"
hostmakedepends = ["pkgconf", "automake", "libtool"]
makedepends = ["libusb-devel", "libplist-devel"]
pkgdesc = "Client library to multiplex connections to/from iOS devices"
maintainer = "q66 <q66@chimera-linux.org>"
license = "LGPL-2.1-only"
url = "https://libimobiledevice.org"
source = f"https://github.com/libimobiledevice/{pkgname}/archive/{pkgver}.tar.gz"
sha256 = "8ae3e1d9340177f8f3a785be276435869363de79f491d05d8a84a59efc8a8fdc"
def pre_configure(self):
self.do("autoreconf", "-if")
@subpackage("libusbmuxd-devel")
def _devel(self):
return self.default_devel()
@subpackage("libusbmuxd-progs")
def _progs(self):
return self.default_progs()
|
allowedAccess = ['Danilo', 'Lucio', 'Daiana', 'Vanessa']
requestName = input("Por gentileza informa seu nome para verificar nivel de permissão: ")
for name in allowedAccess:
if(name == requestName):
print("Acesso autorizado a " + requestName)
break
else:
print("Acesso negado a " + requestName)
break
|
def main():
return 'THIS_IS_MAIN_MAIN'
def func():
return 'THIS_IS_MAIN_FUNC'
|
"""
Boolean Data Type(bool):
- Only be True or False
- None is false
- All numbers are True, except 0.
- All strings are True, except Empty strings. ie ""
- All Collections(list, tuple, set, and dictionary) are True, except Empty ones.ie. (), [], {},
- Objects from a class with a __len__ function that returns 0 is always false
"""
# Empty, 0 or null value are False Values
print(bool(None)) # Null
print(bool(False)) # false
print(bool(0)) # 0 Number
print(bool("")) # empty String
print(bool(())) # empty Tuple
print(bool([])) # empty List
print(bool({})) # empty Dictionary
# Class with__len__ returning 0 is False
class TestClass():
def __len__(self):
return 0
testObj = TestClass()
# Can use to assert if its empty, null or return 0 in __len__
if bool(testObj):
print("Object is True ", bool(testObj),"\n")
else:
print("Object is False ", bool(testObj), "\n")
print(bool(True)) # True
print(bool(2.75)) # Non 0 Number
print(bool("Hitesh")) # Non empty String
print(bool(('Hitesh', 'Sahu'))) # Non empty Tuple
print(bool(['Hitesh', 'Sahu'])) # Non empty List
print(bool({'firstName':'Hitesh',
'lastName': 'Sahu'})) # Nonempty Dictionary
|
def get_msg_with_punctuations(old, new):
new_org_text = new
for i in range(len(old)):
if not str.isalpha(old[i]):
new_org_text = new_org_text[0:i] + old[i] + new_org_text[i:]
for i in range(len(old)):
if str.isupper(old[i]):
new_org_text = new_org_text[0:i] + str.upper(new_org_text[i]) + new_org_text[i + 1:]
return new_org_text
def get_alphabetic_msg(text):
normal = ''
for ch in text:
if str.isalpha(ch):
normal += ch
return normal |
class Solution:
def lowestCommonAncestor(self, root, p, q):
if root is None or p == root or q == root:
return root
l = self.lowestCommonAncestor(root.left, p, q)
r = self.lowestCommonAncestor(root.right, p, q)
if l is None:
return r
if r is None:
return l
return root
|
def Logo():
print("""
____________________ ______________ ____________
| | | | | @
| ____________| | ______ | | _______. #
| | | | | | | | | #
| | __________ | | | | | | | #
| | | | | | | | | | | $
| | | | | | | | | | | $
| | ------| | | | | | | | | #
| |________| | | ------ | | |______| @
|__________________| |____________| |__________@
""")
|
### This program subtracts ###
def minus(a, b):
sub = a - b
print(sub)
print("Welcome to subtracting your life version 1.0.0.0.0.0.0.1!")
x,y = input("Please input the digits of your life that you wish to subtract: ").split()
x = int(x)
y = int(y)
minus(x,y)
|
class XmlServiceTransport(object):
"""XMLSERVICE transport base class
Args:
ctl (str): XMLSERVICE control options, see
http://yips.idevcloud.com/wiki/index.php/XMLService/XMLSERVICEQuick#ctl
ipc (str): An XMLSERVICE ipc key for stateful conections, see
http://yips.idevcloud.com/wiki/index.php/XMLService/XMLSERVICEConnect
"""
def __init__(self, ctl="*here *cdata", ipc="*na"):
self.ipc = ipc
self.ctl = ctl
self.trace_attrs = ["ipc", "ctl"]
def trace_data(self):
output = ""
for i in self.trace_attrs:
if isinstance(i, tuple):
trace, attr = i
else:
trace = attr = i
output += " {}({})".format(trace, getattr(self, attr))
return output
def call(self, tk):
"""Call XMLSERVICE with accumulated actions
Args:
tk (iToolKit): An iToolkit object
Returns:
str: The XML returned from XMLSERVICE
"""
raise NotImplementedError
|
class ListNode:
def __init__(self, x):
self.val = x
self.next = None
class Solution:
def reverseList(self, head: ListNode) -> ListNode:
if head == None or head.next == None:
return head
next_node = head.next
head.next = None
while next_node:
next_next_node = next_node.next
next_node.next = head
head = next_node
next_node = next_next_node
return head
def reverseList_recursive(self, head: ListNode) -> ListNode:
if head.next == None:
return head
remaining = head.next
head.next = None
remaining = self.reverseList_recursive(remaining)
cur = remaining
while cur.next:
cur = cur.next
cur.next = head
return remaining
if __name__ == "__main__":
h = ListNode(1)
h.next = ListNode(2)
h.next.next = ListNode(3)
h.next.next.next = ListNode(4)
solu = Solution()
solu.reverseList_recursive(h) |
def Cel():
celsius = float(input("Enter the temperature in Celsius ")) # It will take user input
fahrenheit :float = (celsius * 9 / 5) + 32 # calculation part
print("Value in Fahrenheit ", fahrenheit)
def Far():
fahrenheit = float(input("Enter the temperature in Fahrenheit ")) # It will take user input
celsius :float = (fahrenheit - 32) * 5 / 9 # calculation part
print(" Value in Celsius", celsius)
def condition():
cont=int(input((" Enter 1 to continue or else to exit ")))
if cont ==1:
main()
condition()
def main():
print(" To convert Temperatures")
choice=int(input("Enter 1 to convert Celsius to Fahrenheit 0r Enter 2 for vice versa "))
if choice ==1 :
Cel()
elif choice ==2 :
Far()
else :
print(' Wrong choice ')
return
main()
condition()
|
#CP2
#Thomas Franceschi
#Kyle Williams
#import sys
class baseParser:
def __init__(self, expression, length, counter):
self.expression = expression #String being parsed
self.length = length #Max range for token
self.counter = counter #Token
self.M = '' #Output
def parseRegexp(self):
self.M = self.parseUnion()
if self.counter == self.length:
return self.M
else:
print('regex error, count: ' + str(self.counter) + ' length: ' + str(self.length))
return 1 #ERROR
def parseUnion(self):
self.M = self.parseConcat()
if self.counter == self.length:
return self.M
if self.expression[self.counter] == '|': #If next token is |
self.counter = self.counter + 1 #'read' |
self.M = self.union(self.M, self.parseConcat())
return self.M
def parseConcat(self):
if self.counter == self.length:
return self.epsilon()
if self.expression[self.counter] == '|' or self.expression[self.counter] == ')':
return self.epsilon()
else:
self.M = self.parseUnary()
while self.counter < self.length and self.expression[self.counter] != '|' and self.expression[self.counter] != ')':
self.M = self.concat(self.M, self.parseUnary())
return self.M
def parseUnary(self):
self.M = self.parsePrimary()
if self.counter == self.length:
return self.M
if self.expression[self.counter] == '*':
self.counter = self.counter + 1; #read *
return self.star(self.M)
else:
return self.M
def parsePrimary(self):
if self.expression[self.counter] == '(':
self.counter = self.counter + 1 #read (
self.M = self.parseUnion()
self.counter = self.counter + 1 #read )
return self.M
elif self.expression[self.counter] == '@':
self.counter = self.counter + 1 #read @
return self.emptyset()
elif self.expression[self.counter] != '(' and self.expression[self.counter] != ')' and self.expression[self.counter] != '*' and self.expression[self.counter] != '|':
a = self.expression[self.counter]
self.counter = self.counter + 1
return self.symbol(a)
else:
print('parse primary error')
return 1 #Error
#Placeholders
def emptyset(self):
return 'emptyset()'
def epsilon(self):
return 'epsilon()'
def symbol(self, a):
return 'symbol(' + str(a) + ')'
def union(self, M1, M2):
return 'union(' + str(M1) + ',' + str(M2) + ')'
def concat(self, M1,M2):
return 'concat(' + str(M1) + ',' + str(M2) + ')'
def star(self, M):
return 'star(' + M + ')'
if __name__ == "__main__":
#expression = '(ab|a)*'
length = len(expression)
counter = 0
parser = baseParser(expression, length, counter)
M = parser.parseRegexp()
print(M) |
""" Problem Set 1 - Problem 3
Assume s is a string of lower case characters.
Write a program that prints the longest substring of s in which the letters occur in alphabetical order. For example, if s = 'azcbobobegghakl', then your program should print
Longest substring in alphabetical order is: beggh
In the case of ties, print the first substring. For example, if s = 'abcbcd', then your program should print
Longest substring in alphabetical order is: abc"""
# s = 'abcbcd'
maxLength = 0
current = s[0]
longest = s[0]
for i in range(len(s)-1):
if s[i + 1] >= s[i]:
current += s[i + 1]
print(current)
if len(current) > maxLength:
maxLength = len(current)
longest = current
else:
current = s[i+1]
i += 1
print ("Longest substring in alphabetical order is: " + longest)
|
"""Simple example test."""
def test_simple():
"""Simple example test."""
assert True
|
__all__ = [
'PrimaryStatus',
'InputStatus',
'OutputStatus',
'StopReason'
]
class PrimaryStatus:
QUEUING_CHECKS = "QUEUING_CHECKS"
# one of checks tasks has been started
CHECKING = "CHECKING"
# when all first level tasks has been finished
CHECKS_FINISHED = "CHECKS_FINISHED"
# It will be set outside of tasks,
# when CHECKS_FINISHED and not INPUTS_DOWNLOADING
QUEUING_INPUTS_DOWNLOADING = "QUEUING_INPUTS_DOWNLOADING"
# when one of checks tasks has been started
INPUTS_DOWNLOADING = "INPUTS_DOWNLOADING"
# when downloading all inputs has been finished
ALL_INPUTS_DOWNLOADED = "ALL_INPUTS_DOWNLOADED"
# It will be set outside of tasks,
# when ALL_INPUTS_DOWNLOADED and not QUEUING_OUTPUTS
QUEUING_OUTPUTS = "QUEUING_OUTPUTS"
# when one of level3 chains has been started
OUTPUTS_PROGRESSING = "OUTPUTS_PROGRESSING"
# when all outputs are finished
# means total_outputs == (ready_outputs + revoked_outputs + failed_outputs)
FINISHED = "FINISHED"
# when all outputs revoked
REVOKED = "REVOKED"
# when one of checks has been failed, one of inputs has been failed,
# or all outputs has been failed
FAILED = "FAILED"
class InputStatus:
# for every input
PREPARATION_DOWNLOAD = "PREPARATION_DOWNLOAD"
DOWNLOADING = "DOWNLOADING"
DOWNLOADING_FINISHED = "DOWNLOADING_FINISHED"
QUEUING_TO_ANALYZE = "QUEUING_TO_ANALYZE"
ANALYZING = "ANALYZING"
ANALYZING_FINISHED = "ANALYZING_FINISHED"
INPUT_REVOKED = "INPUT_REVOKED"
INPUT_FAILED = "INPUT_FAILED"
class OutputStatus:
# for every output
OUTPUT_REVOKED = "OUTPUT_REVOKED"
OUTPUT_FAILED = "OUTPUT_FAILED"
PREPARATION_PROCESSING = "PREPARATION_PROCESSING"
PROCESSING = "PROCESSING"
PROCESSING_FINISHED = "PROCESSING_FINISHED"
# It will be set outside of tasks,
# when PROCESSING_FINISHED and not UPLOADING
QUEUING_UPLOADING = "QUEUING_UPLOADING"
UPLOADING = "UPLOADING"
UPLOADING_FINISHED = "UPLOADING_FINISHED"
class StopReason:
FORCE_REVOKED = "FORCE_REVOKED"
INTERNAL_ERROR = "INTERNAL_ERROR"
# CheckInputKeyTask and DownloadInputTask
INPUT_VIDEO_ON_S3_IS_404_OR_403 = "INPUT_VIDEO_ON_S3_IS_404_OR_403"
# CheckInputKeyTask
FAILED_INPUT_KEY_CHECKING = "FAILED_INPUT_KEY_CHECKING"
# CheckOutputBucketTask
FAILED_OUTPUT_BUCKET_CHECKING = "FAILED_OUTPUT_BUCKET_CHECKING"
OUTPUT_BUCKET_ON_S3_IS_404_OR_403 = "OUTPUT_BUCKET_ON_S3_IS_404_OR_403"
# CheckOutputKeyTask
FAILED_OUTPUT_KEY_CHECKING = "FAILED_OUTPUT_KEY_CHECKING"
OUTPUT_KEY_IS_ALREADY_EXIST = "OUTPUT_KEY_IS_ALREADY_EXIST"
# DownloadInputTask
DOWNLOADING_FAILED = "DOWNLOADING_FAILED"
# AnalyzeInputTask
FAILED_ANALYZE_INPUT = "FAILED_ANALYZE_INPUT"
# AnalyzeInputTask
INPUT_VIDEO_CODEC_TYPE_IN_NOT_VIDEO = "INPUT_VIDEO_CODEC_TYPE_IN_NOT_VIDEO"
# InputsFunnelTask
AGGREGATE_INPUTS_FAILED = "AGGREGATE_INPUTS_FAILED"
# CreatePlaylistTask
FAILED_CREATE_PLAYLIST = "FAILED_CREATE_PLAYLIST"
INPUT_VIDEO_SIZE_CAN_NOT_BE_ZERO = "INPUT_VIDEO_SIZE_CAN_NOT_BE_ZERO"
REPRESENTATION_NEEDS_BOTH_SIZE_AND_BITRATE = "REPRESENTATION_NEEDS_BOTH_SIZE_AND_BITRATE"
# UploadDirectoryTask
FAILED_UPLOAD_DIRECTORY = "FAILED_UPLOAD_DIRECTORY"
# GenerateThumbnailTask
FAILED_GENERATE_THUMBNAIL = "FAILED_GENERATE_THUMBNAIL"
# UploadFileTask
FAILED_UPLOAD_FILE = "FAILED_UPLOAD_FILE"
# AddWatermarkTask
FAILED_ADD_WATERMARK = "FAILED_ADD_WATERMARK"
# InputsFunnelTask
# when job_details not found
JOB_TIMEOUT = "JOB_TIMEOUT"
|
# __getattr__ is not implemented by default
# __getattribute__ run for every attribute access (w/o looking at attributes on object)
# __getattr__ only run when attribute not found in normal ways
class Foo(object):
def __getattribute__(self, item):
print('Foo called __getattribute__ on {0}'.format(item))
return super().__getattribute__(item)
def __getattr__(self, item):
print('Foo called __getattr__ on {0}'.format(item))
return super().__getattr__(item)
class Bar(Foo):
def __getattribute__(self, item):
print('Bar called __getattribute__ on {0}'.format(item))
return super().__getattribute__(item)
def __getattr__(self, item):
print('Bar called __getattr__ on {0}'.format(item))
return super().__getattr__(item)
if __name__ == '__main__':
b = Bar()
# b.x = 4
b.x |
# palindrome_check.py
# recursion in strings
def isPalindrome(s):
# check if string is a palindrome
def toChars(s):
# convert string to characters
s = s.lower()
ans = ''
for c in s:
if c in 'abcdefghijklmnopqrstuvwxy':
ans = ans + c
return ans
def isPal(s):
#Return true/false if string is a palindrome
if len(s) <= 1:
return True
else:
return s[0] == s[-1] and isPal(s[1:-1])
return isPal(toChars(s))
# test goes here:
test1 = isPalindrome('ama')
print(test1)
|
f = open('./deu.txt','r')
fwde = open('./deu.de','w')
fwen = open('./deu.en','w')
lines = [line for line in f.read().split('\n') if line]
for line in lines:
items = line.split('\t')
assert len(items)==3
fwen.write(items[0] + '\n')
fwde.write(items[1] + '\n')
fwde.close()
fwen.close()
|
height_map = [int(e.strip()) for e in input().strip().split(',')]
count = 0
negative = False
for i in height_map:
if i < 0:
negative = True
else:
if negative:
count += 1
negative = False
print(count) |
# Find value that occurs in odd number of elements.
# Find the number in an non-empty array that does not have pair
# Array [9,3,9,3,9,7,9] pairs
# A[0] = 9 and A[2] = 9
# A[1] = 3 and A[3] = 3
# A[4] = 9 and A[6] = 9
# A[5] = 7 no pair
# the function should return 7, as explained in the example above.
# Important
# N is an odd integer within the range [1..1,000,000];
# each element of array A is an integer within the range [1..1,000,000,000];
# all but one of the values in A occur an even number of times.
def solution(A):
A = sorted(A)
current = A[0]
count = 0
for i in A:
if current == i:
count += 1
else:
if count % 2 != 0:
return current
count = 1
current = i
return current
# Testing
print(solution([9,3,9,3,9,7,9]))
# Result
# Detected time complexity: O(N) or O(N*log(N)) |
# -*- coding: utf-8 -*-
{
'name': 'Gastos unidos a facturas',
'version': '1.0',
'category': 'Accounting/Expenses',
'sequence': 6,
'summary': 'Gastos unidos a facturas',
'description': """ Cambios a gastos para unirlas a facturas """,
'website': 'http://aquih.com',
'author': 'Rodrigo Fernandez',
'depends': ['hr_expense'],
'data': [
'views/hr_expense_views.xml',
'views/account_move_views.xml',
'security/ir.model.access.csv',
],
'qweb': [
],
'installable': True,
'auto_install': False,
} |
Data_File = open("Day2_Data.txt")
Data = Data_File.read()
Data = Data.split(',')
for i in range(len(Data)):
Data[i]=int(Data[i])
Data_Backup = Data.copy()
for noun in range (100):
for verb in range(100):
Data = Data_Backup.copy()
Data[1] = noun
Data[2] = verb
Index_Number = 0
while(True):
if(Data[Index_Number] == 1):
Data[Data[Index_Number+3]] = Data[Data[Index_Number+1]] + Data[Data[Index_Number+2]]
Index_Number +=4
elif(Data[Index_Number] ==2):
Data[Data[Index_Number + 3]] = Data[Data[Index_Number + 1]] * Data[Data[Index_Number + 2]]
Index_Number += 4
elif(Data[Index_Number] == 99):
#print("Terminated successfully")
break
else:
#print("Something has gone wrong, read opcode:"+ str(Data[Index_Number]))
#print("Terminated")
break
if(Data[0] == 19690720):
print("noun :" + str(noun) )
print("verb :" + str(verb) )
exit()
|
# https://www.facebook.com/roshan.philipines/posts/2769055946717382
# Subscribed by Roshaen
#Implementation of ISBN number
def isbn(n):
lst=[]
j=0
for i in range(len(n)):
lst.insert(j,n[i])
j+=1
i=0
sum=0
for i in range(len(lst)):
sum=sum+int(lst[i])*(10-i)
if(sum%11==0):
print("Valid ISBN number")
else:
print("Not a valid ISBN number")
inp=input("Enter isbn number: ")
isbn(inp)
|
def get_defaults():
return {
"acceptable_size": 100,
"acceptable_time": 3,
"get_pages": True,
"get_assets": True,
"get_images": True,
"get_scripts": True,
"get_stylesheets": True,
"give_second_chance": True,
"logfile_location": "gyroscope.log",
"logfile_mode": "w",
"log_level": 30,
"log_too_big": True,
"log_too_slow": True,
"sites_file": "sites.json",
"asset_types": []
} |
#PROBLEM LINK:- https://leetcode.com/problems/shuffle-the-array/
class Solution:
def shuffle(self, nums, n):
v = []
for i in range(n):
v.append(nums[i])
v.append(nums[i+n])
return v
|
# coding: utf-8
##############################################################################
# Copyright (C) 2018 Microchip Technology Inc. and its subsidiaries.
#
# Subject to your compliance with these terms, you may use Microchip software
# and any derivatives exclusively with Microchip products. It is your
# responsibility to comply with third party license terms applicable to your
# use of third party software (including open source software) that may
# accompany Microchip software.
#
# THIS SOFTWARE IS SUPPLIED BY MICROCHIP "AS IS". NO WARRANTIES, WHETHER
# EXPRESS, IMPLIED OR STATUTORY, APPLY TO THIS SOFTWARE, INCLUDING ANY IMPLIED
# WARRANTIES OF NON-INFRINGEMENT, MERCHANTABILITY, AND FITNESS FOR A
# PARTICULAR PURPOSE.
#
# IN NO EVENT WILL MICROCHIP BE LIABLE FOR ANY INDIRECT, SPECIAL, PUNITIVE,
# INCIDENTAL OR CONSEQUENTIAL LOSS, DAMAGE, COST OR EXPENSE OF ANY KIND
# WHATSOEVER RELATED TO THE SOFTWARE, HOWEVER CAUSED, EVEN IF MICROCHIP HAS
# BEEN ADVISED OF THE POSSIBILITY OR THE DAMAGES ARE FORESEEABLE. TO THE
# FULLEST EXTENT ALLOWED BY LAW, MICROCHIP'S TOTAL LIABILITY ON ALL CLAIMS IN
# ANY WAY RELATED TO THIS SOFTWARE WILL NOT EXCEED THE AMOUNT OF FEES, IF ANY,
# THAT YOU HAVE PAID DIRECTLY TO MICROCHIP FOR THIS SOFTWARE.
##############################################################################
def instantiateComponent(comp):
GFX_INTF_SMC_H = comp.createFileSymbol("GFX_INTF_SMC_H", None)
GFX_INTF_SMC_H.setDestPath("gfx/interface/")
GFX_INTF_SMC_H.setSourcePath("../drv_gfx_disp_intf.h")
GFX_INTF_SMC_H.setOutputName("drv_gfx_disp_intf.h")
GFX_INTF_SMC_H.setProjectPath("config/" + Variables.get("__CONFIGURATION_NAME") + "/gfx/interface")
GFX_INTF_SMC_H.setType("HEADER")
GFX_INTF_SMC = comp.createFileSymbol("GFX_INTF_SMC", None)
GFX_INTF_SMC.setDestPath("gfx/interface/parallel_smc/")
GFX_INTF_SMC.setSourcePath("templates/drv_gfx_disp_intf_parallel_smc.c.ftl")
GFX_INTF_SMC.setOutputName("drv_gfx_disp_intf_parallel_smc.c")
GFX_INTF_SMC.setProjectPath("config/" + Variables.get("__CONFIGURATION_NAME") + "/gfx/interface/parallel_smc")
GFX_INTF_SMC.setMarkup(True)
GFX_INTF_SMC.setType("SOURCE")
### Interface type is required for all interface components. This is queried by the driver to determine
### the display interface supported by the interface component. Valid values are "SPI 4-line", "Parallel 16-bit",
### and "Parallel 8-bit"
InterfaceType = comp.createStringSymbol("InterfaceType", None)
InterfaceType.setLabel("Interface Type")
InterfaceType.setDescription("The interface configuration")
InterfaceType.setDefaultValue("Parallel 16-bit")
InterfaceType.setVisible(False)
### Driver settings menu
DriverSettingsMenu = comp.createMenuSymbol("DriverSettingsMenu", None)
DriverSettingsMenu.setLabel("Driver Settings")
UseSyncBarriers = comp.createBooleanSymbol("UseSyncBarriers", DriverSettingsMenu)
UseSyncBarriers.setLabel("Use Synchronization Barriers")
UseSyncBarriers.setDescription("Use Synchronization Barriers.")
UseSyncBarriers.setDefaultValue(True)
UseSyncBarriers.setVisible(False)
DelayNOPCount = comp.createIntegerSymbol("DelayNOPCount", DriverSettingsMenu)
DelayNOPCount.setLabel("Number of NOP for delay")
DelayNOPCount.setDescription("Number of NOP for delay")
DelayNOPCount.setDefaultValue(4)
###
### Interface settings menu
InterfaceSettingsSMCMenu = comp.createMenuSymbol("InterfaceSettingsSMCMenu", None)
InterfaceSettingsSMCMenu.setLabel("Parallel 8080 Display Interface Settings")
EBIChipSelectIndex = comp.createIntegerSymbol("EBIChipSelectIndex", InterfaceSettingsSMCMenu)
EBIChipSelectIndex.setLabel("EBI Chip Select Index")
EBIChipSelectIndex.setDescription("The chip select index")
EBIChipSelectIndex.setDefaultValue(0)
EBIChipSelectIndex.setMin(0)
EBIChipSelectIndex.setMax(4)
EBIChipSelectIndex.setVisible(False)
ControlPinsMenu = comp.createMenuSymbol("ControlPinsMenu", InterfaceSettingsSMCMenu)
ControlPinsMenu.setLabel("Control Pin Settings")
ChipSelectControl = comp.createComboSymbol("ChipSelectControl", ControlPinsMenu, ["GPIO", "Peripheral"])
ChipSelectControl.setLabel("CS# Control")
ChipSelectControl.setDescription("Chip Select Control")
ChipSelectControl.setDefaultValue("GPIO")
ChipSelectControl.setReadOnly(True)
DataCommandSelectControl = comp.createComboSymbol("DataCommandSelectControl", ControlPinsMenu, ["GPIO", "Peripheral"])
DataCommandSelectControl.setLabel("D/C# Control")
DataCommandSelectControl.setDescription("Data Command Select Control")
DataCommandSelectControl.setDefaultValue("GPIO")
DataCommandSelectControl.setDependencies(onDataCommandSelectSet, ["DataCommandSelectControl"])
ReadStrobeControl = comp.createComboSymbol("ReadStrobeControl", ControlPinsMenu, ["GPIO", "Peripheral"])
ReadStrobeControl.setLabel("RD# Control")
ReadStrobeControl.setDescription("Read Strobe Control")
ReadStrobeControl.setDefaultValue("GPIO")
WriteStrobeControl = comp.createComboSymbol("WriteStrobeControl", ControlPinsMenu, ["GPIO", "Peripheral"])
WriteStrobeControl.setLabel("WR# Control")
WriteStrobeControl.setDescription("Write Strobe Control")
WriteStrobeControl.setDefaultValue("GPIO")
DCXAddressBit = comp.createIntegerSymbol("DCXAddressBit", DataCommandSelectControl)
DCXAddressBit.setLabel("DCX Address Bit")
DCXAddressBit.setDescription("Address bit used for DCX signal.")
DCXAddressBit.setDefaultValue(12)
DCXAddressBit.setMin(0)
DCXAddressBit.setMax(31)
###
def configureSMCComponent(comp, smcComponent):
print("Configuring SMC")
smcChipSelNum = comp.getSymbolValue("EBIChipSelectIndex")
smcComponent.setSymbolValue("SMC_CHIP_SELECT" + str(smcChipSelNum), True, 1)
smcComponent.setSymbolValue("SMC_MEM_SCRAMBLING_CS" + str(smcChipSelNum), False, 1)
# SMC Write Timings
smcComponent.setSymbolValue("SMC_NWE_SETUP_CS" + str(smcChipSelNum), 4, 1)
smcComponent.setSymbolValue("SMC_NCS_WR_SETUP_CS" + str(smcChipSelNum), 0, 1)
smcComponent.setSymbolValue("SMC_NWE_PULSE_CS" + str(smcChipSelNum), 4, 1)
smcComponent.setSymbolValue("SMC_NCS_WR_PULSE_CS" + str(smcChipSelNum), 10, 1)
smcComponent.setSymbolValue("SMC_DATA_BUS_CS" + str(smcChipSelNum), 1, 1)
smcComponent.setSymbolValue("SMC_NWE_CYCLE_CS" + str(smcChipSelNum), 3, 1)
# SMC Read Timings
smcComponent.setSymbolValue("SMC_NRD_SETUP_CS" + str(smcChipSelNum), 2, 1)
smcComponent.setSymbolValue("SMC_NCS_RD_SETUP_CS" + str(smcChipSelNum), 0, 1)
smcComponent.setSymbolValue("SMC_NRD_PULSE_CS" + str(smcChipSelNum), 63, 1)
smcComponent.setSymbolValue("SMC_NCS_RD_PULSE_CS" + str(smcChipSelNum), 63, 1)
smcComponent.setSymbolValue("SMC_NRD_CYCLE_CS" + str(smcChipSelNum), 110, 1)
# SMC Mode Configuration
smcComponent.setSymbolValue("SMC_DATA_BUS_CS" + str(smcChipSelNum), 1, 1)
smcComponent.setSymbolValue("SMC_BAT_CS" + str(smcChipSelNum), 0, 1)
smcComponent.setSymbolValue("SMC_READ_ENABLE_MODE_CS" + str(smcChipSelNum), True, 1)
smcComponent.setSymbolValue("SMC_WRITE_ENABLE_MODE_CS" + str(smcChipSelNum), False, 1)
def onDataCommandSelectSet(sourceSymbol, event):
if (sourceSymbol.getComponent().getSymbolByID("DataCommandSelectControl").getValue() == "GPIO"):
sourceSymbol.getComponent().getSymbolByID("DCXAddressBit").setVisible(False)
else:
sourceSymbol.getComponent().getSymbolByID("DCXAddressBit").setVisible(True)
def onInterfaceTypeChanged(sourceSymbol, event):
print("Interface type changed")
def onAttachmentConnected(source, target):
#print(source["component"].getID() + ": " + dependencyID + " dependent component added ")
if source["id"] == "SMC_CS":
configureSMCComponent(source["component"], target["component"]) |
input_numbers = input('Enter numbers separated by a space : ').split()
max = int(input_numbers[0])
min = int(input_numbers[0])
avg = 0
sum = 0
for i in range(0, len(input_numbers)):
input_numbers[i] = int(input_numbers[i])
sum = sum + input_numbers[i]
if input_numbers[i] > max:
max = input_numbers[i]
if input_numbers[i] < min:
min = input_numbers[i]
avg = sum / len(input_numbers)
print (max, min, avg) |
'''3. Write a Python program to print the square and cube symbol in the
area of a rectangle and volume of a cylinder.
Sample output:
The area of the rectangle is 1256.66cm2
The volume of the cylinder is 1254.725cm3'''
area = 1256.66
volume = 1254.725
print(f"The area of the rectangle is {round(area, 2)}cm2")
print(f"The volume of the cylinder is {round(volume, 3)}cm3") |
#!/usr/bin/env python3
def clear_screen(lines=128):
if not isinstance(lines, int) or lines < 64:
lines = 64
print( '\n' * lines, end='' )
class Player:
def __init__(self, n):
self.score = 0
self.name = n
self.attack1 = ''
self.attack2 = ''
self.guard = ''
def step(self):
clear_screen()
print(self.name + '\'s turn:')
self.attack1 = ''
self.attack2 = ''
while len(self.attack1) <= 0 or len(self.attack2) <= 0:
print()
a = ''
if len(self.attack1) <= 0:
print('High or Low?')
if len(self.attack2) <= 0:
print('Left or Right?')
while len(a) <= 0:
a = input('Attack: ').lower()
# test input
if 'hi' in a:
self.attack1 = 'high'
elif 'lo' in a:
self.attack1 = 'low'
if 'le' in a:
self.attack2 = 'left'
elif 'ri' in a:
self.attack2 = 'right'
self.guard = ''
while len(self.guard) <= 0:
print()
a = ''
print('High, Low, Left, or Right?')
while len(a) <= 0:
a = input('Guard: ').lower()
# test input
if 'hi' in a:
self.guard = 'high'
elif 'lo' in a:
self.guard = 'low'
elif 'le' in a:
self.guard = 'left'
elif 'ri' in a:
self.guard = 'right'
clear_screen()
def attack(self, p):
print(self.name + ' attacks ' + p.name + ' with a ' + self.attack1 + ' ' + self.attack2 + '.')
print(p.name + ' guards ' + p.guard + '.')
if (self.attack1 != p.guard) and (self.attack2 != p.guard):
print('HIT!')
self.score += 1
else:
print('BLOCK!')
print()
class Engine:
def __init__(self):
self.players = list()
x = input("How many players?: ")
print()
try:
numOfPlayers = int(x)
except ValueError:
numOfPlayers = 2
if numOfPlayers > 8:
numOfPlayers = 8
elif numOfPlayers < 2:
numOfPlayers = 2
print('Setting to '+ str(numOfPlayers) +' players.\n')
x = 1
print('(Player Names)')
while len(self.players) < numOfPlayers:
a = input('Player '+str(x)+': ')
if len(a) > 0:
self.players.append(Player(a))
x += 1
print()
self.rounds = None
while not isinstance(self.rounds, int) or self.rounds < 1:
self.rounds = input('# of Rounds: ')
try:
self.rounds = int(self.rounds)
except ValueError:
self.rounds = None
self.roundsC = self.rounds
input("\nNOTE: You only need the first two letters. (HI LO LE RI) ")
def mainloop(self):
if len(self.players) > 1:
self.running = True
self.roundsC = self.rounds
for p in self.players:
p.score = 0
while self.running and self.roundsC > 0:
clear_screen()
print('Round ' + str((self.rounds - self.roundsC) + 1) + ':')
input('\n( Begin ) ...')
for p in self.players:
p.step()
# process player attacks
for p in self.players:
for q in self.players:
if p != q:
p.attack(q)
# display scores
for p in self.players:
print(p.name + ': ' + str(p.score))
a = ''
while 'ok' not in a:
a = input('\n( Type "ok" ) ').lower()
self.roundsC -= 1
print('\nFinal scores:\n')
for p in self.players:
print(p.name + ': ' + str(p.score) + '\n')
def main():
e = Engine()
e.mainloop()
if __name__=="__main__":
main()
|
# однострочный комментарий
'''
первая строка
вторая строка
'''
print('Hello!')
print('Hello!', 'student!', 123, sep='xxx')
print('Hello!', 'student!', 123, end='yyy')
print()
# Ввод
age = input('Input your age')
print(age, type(age))
print(int(age), type(int(age)))
'''
print(1+1, 'student', sep='yyy', end='!')
print()
'''
|
class Plugin(object):
"""
Plugin Base Class
Meant to be inherited for plugins
"""
def __init__(self):
self._commands = {}
def command(self, name, **kwargs):
"""
Decorator to register a coroutine to a plugin command
:param name: Command Name
:return:
"""
kwargs = {i: kwargs[i] for i in kwargs.keys() if i != "_coro"}
def command_func(func):
self._commands[name] = {}
self._commands[name]["_coro"] = func
for i in kwargs.keys():
self._commands[name][i] = kwargs[i]
return func
return command_func
def on_load(self, bot):
"""
Function to be called when a plugin is loaded into a Bot. Meant to be overridden
:param bot: Bot Instance into which the Plugin is loaded
:return:
"""
pass
|
class Assert(object):
@staticmethod
def is_instance(instance, instances_class):
assert isinstance(instance, instances_class), '{0} should be an instance of class {1}'.format(
instance.__name__, instances_class.__name__
)
|
#Prime Number Checker
#Parker Dinkins
'''
This program asks for a number between 0 and 5000
If the number isn't in that range it asks for it again
When a proper number is entered it checks if it is prime
If the numbr is prime it prints the two factors
If the number is not prime it prints all the factors
Finally it asks if you want run the checker again or not
'''
# This function takes a number and prints the factors
def print_factors(x):
print("The factors of", x, "are:")
for i in range(1, x + 1):
if x % i == 0:
print(i)
print(x, "is NOT a prime number")
# this functoin check to see if a number is prime and if so prints that out
# if the numbe is not prime it pushes the user input variable into the print_factors function
def prime_checker():
try:
# user input
a = int(input("Enter a number between 0 and 5000: "))
# checks to make sure the number is within the specified range
if a > 5000:
# prints out and error if the check fails and reruns the function with clean memory
print('\n\t****ERROR****')
print('Enter a number between 0 and 5000\n')
return prime_checker()
# place hold variable
k = 0
# this finds the number of factors of the number
for i in range(1, a):
if a % i == 0:
k = k + 1
# this checks to see if the number has less than or one factor
# if the number satisfies this then it is prime and it prints out
if k <= 1:
print('The factors of your number are:')
print('1')
print(a, 'is a prime number')
# if the number has more than one factor it is not prime and it lands here
# the number is then put into the print_factors function
else:
print_factors(x=a)
# this handles the error when the user inputs something other than number into the input statement
except ValueError:
print('\n\t****Invalid*Input****\n\tPlease enter a number\n')
# loop variables
run = True
run1 = True
# first loop that runs the functions when the program one time when the program is opened
while run1:
prime_checker()
break
# second loop that asks the user if they want to run the program again or quit
while run:
option = input("\nContinue and run again? [y/n]: ").lower()
if option == "y":
prime_checker()
elif option == "n":
break
else:
print("\nNot a valid option. Please enter 'y' or 'n'")
|
#!/usr/bin/env python3
# Write a program that computes the GC fraction of a DNA sequence in a window
# Window size is 11 nt
# Output with 4 significant figures using whichever method you prefer
# Use no nested loops. Instead, count only the first window
# Then 'move' the window by adding 1 letter on one side
# And subtracting 1 letter from the other side
# Describe the pros/cons of this algorith vs. nested loops
seq = 'ACGACGCAGGAGGAGAGTTTCAGAGATCACGAATACATCCATATTACCCAGAGAGAG'
w = 11
window = ""
count = 0
for i in range(w):
window += seq[i]
if seq[i] == 'G' or seq[i] == 'C':
count += 1
print(f'{0} {window} {count / w : .4f}')
for i in range(1, len(seq) - w + 1):
if window[0] == 'G' or window[0] == 'C':
count -= 1
if seq[i + w - 1] == 'G' or seq[i + w - 1] == 'C':
count += 1
window = window[1:] + seq[i + w - 1]
print(f'{i} {window} {count / w : .4f}')
|
#!/usr/local/bin/python3
class Duet():
def __init__(self, instruction_list):
self.instruction_list = [ instruction.split() for instruction in instruction_list ]
self.program_counter = 0
self.registers = {}
self.played = None
self.nonZeroPlayed = False
self.__instr_set = {
'set': self.__set,
'add': self.__add,
'mul': self.__mul,
'mod': self.__mod,
'snd': self.__snd,
'rcv': self.__rcv,
'jgz': self.__jgz,
}
def __set(self, x, y):
if y.isalpha(): y = self.registers[y]
self.registers[x] = int(y)
def __add(self, x, y):
if y.isalpha(): y = self.registers[y]
self.registers[x] += int(y)
def __mul(self, x, y):
if y.isalpha(): y = self.registers[y]
self.registers[x] *= int(y)
def __mod(self, x, y):
if y.isalpha(): y = self.registers[y]
self.registers[x] %= int(y)
def __snd(self, x):
self.played = self.registers[x]
def __rcv(self, x):
if self.registers[x] != 0:
self.nonZeroPlayed = True
def __jgz(self, x, y):
if self.registers[x] > 0:
self.program_counter += int(y) - 1
def __exitCriteria(self):
if self.nonZeroPlayed:
return True
if self.program_counter >= len(self.instruction_list):
return True
return False
def __execute(self):
instruction = self.instruction_list[self.program_counter]
self.program_counter += 1
if instruction[1] not in self.registers:
self.registers[instruction[1]] = 0
self.__instr_set[instruction[0]](*instruction[1:])
def run(self):
while not self.__exitCriteria():
self.__execute()
with open("./input.txt") as f:
INPUT = f.readlines()
duet = Duet(INPUT)
duet.run()
print("Star 1: %s" % duet.played)
|
n = int(2367363789863971985761)
#überprüfen welche länge n = 2367363789863971985761 hat
#print(n)
i = 1
while n != 1: #solange n noch nicht gleich 1 ist
if n%2 == 0: #wenn n durch 2 ganz teilbar ist
n = n//2
#print(n)
else: #ansonsten
n = n*3+1
#print(n)
i = i+1
print("Die Länge der Folge ist:",i)
"""
Hier muss noch in die Kommentare wie man die Zahl n findet welches die möglichst
längste Folge hat für n < 10^6. Mit Worten erklärt.
"""
|
def check_flux_balance(data_dict: dict) -> bool:
"""
When all fluxes are specified in the measRates sheet, check if all metabolites are mass balanced (well, the ones
that are marked as balanced in the mets sheet).
If everything is fine flag is 0, otherwise it is set to 1.
Args:
data_dict: a dictionary that represents the excel file with the GRASP model.
Returns:
Whether or not all metabolites mass is balanced.
"""
print('\nChecking if the fluxes for each metabolite production/consumptions add up to zero.\n')
flag = False
flux_df = data_dict['measRates']
mets_df = data_dict['mets']
stoic_df = data_dict['stoic']
if len(stoic_df.index) == len(flux_df.index):
met_in_rxns = dict()
for col in stoic_df.columns:
rxn_list = stoic_df.loc[stoic_df[col].ne(0), col]
met_in_rxns[col] = rxn_list.to_dict()
balanced_mets = set(mets_df.loc[mets_df['balanced?'].eq(1), 'balanced?'].index.values)
mean_col = flux_df.columns[0]
for met in met_in_rxns.keys():
flux_balance = sum([met_in_rxns[met][key] * flux_df.loc[key, mean_col] for key in met_in_rxns[met].keys()])
if abs(flux_balance) > 10**-8 and met in balanced_mets:
print(f'The flux for {met} is not balanced. The difference in flux is {flux_balance}')
flag = True
elif flux_balance == 0 and met not in balanced_mets:
print(f'{met} should be in balanced mets')
flag = True
if flag is False:
print('Everything seems to be OK.')
else:
print('Not all fluxes are specified in measRates.\n')
return flag
def check_balanced_metabolites(data_dict: dict) -> bool:
"""
Checks if metabolites that are both consumed and produced in the stoichiometric matrix are marked as balanced and
the other way around. Checking for mass balances is more accurate though.
If everything is fine flag is 0, otherwise it is set to 1.
Args:
data_dict: a dictionary that represents the excel file with the GRASP model.
Returns:
Whether or not metabolites are marked balanced/fixed correctly.
"""
print('\nChecking if metabolites are both consumed and produced in the stoichiometric matrix, and if',
'so checks if they are marked as balanced in the mets sheet. However, the metabolite might be',
'balanced/not balanced anyways depending on the flux of the reactions that consume/produce it,',
'so take this with a grain of salt.\n')
flag = False
stoic_df = data_dict['stoic']
mets_df = data_dict['mets']
for i, met in enumerate(stoic_df.columns):
if stoic_df[met].gt(0).any() and stoic_df[met].lt(0).any():
if mets_df['balanced?'][i] == 0:
print(f'{met} is marked as not balanced but it seems to be balanced.')
flag = True
else:
if mets_df['balanced?'][i] == 1:
print(f'{met} is marked as balanced but it does not seem to be balanced.')
flag = True
if flag is False:
print('Everything seems to be OK.')
return flag |
def sum_of_digits(number):
"""
Calculating sum of digits of number
"""
sum = 0
number = abs(number)
while number > 0:
sum += number % 10
number = number // 10
return sum
def to_digits(number):
"""
Calculating the digits of the number
"""
digits = []
while number > 0:
digits.append(number % 10)
number = number // 10
digits.reverse()
return digits
def to_number(digits):
"""
Returning number containing digits
"""
number = 0
digits.reverse()
for digit_index in range(0, len(digits)):
number += digits[digit_index] * 10 ** digit_index
return number
def count_vowels(string):
"""
Calculating vowels
"""
vowels = "aeiouy"
return calculate_char_occurrences_in_str(vowels, string)
def count_consonants(string):
"""
Calculating consonants
"""
consonants = "bcdfghjklmnpqrstvwxz"
return calculate_char_occurrences_in_str(consonants, string)
def calculate_char_occurrences_in_str(characters, string):
"""
Calculating the occurrences
"""
occurrences = 0
string = string.casefold()
for character in characters:
occurrences += string.count(character)
return occurrences
def prime_number(number):
"""
Checks if a number is prime Checking for prime numbers
"""
for i in range(2, number - 1):
if number % i == 0:
return False
return number >= 1
def fact_digits(number):
"""
Calculating the sum of the factorials
"""
sum_fact = 0
for digit in to_digits(number):
sum_fact += fact(digit)
return sum_fact
def fact(number):
"""
Calculating the factorial of a number
"""
result = 1
for number in range(1, number + 1):
result *= number
return result
def fibonacci(elements_num):
"""
Calculating fibonacci sequence
"""
sequence = []
for i in range(1, elements_num + 1):
if i <= 2:
sequence.append(1)
continue
next_num = sequence[-2] + sequence[-1]
sequence.append(next_num)
return sequence
def fib_number(elements_num):
"""
Calculating fibonacci sequence
"""
string = ""
for number in fibonacci(elements_num):
string += str(number)
return int(string)
def palindrome(input):
"""
Checking for palindrome
"""
input = str(input)
return input[::-1] == input
def char_histogram(string):
"""
Map with characters
"""
result = {}
for char in string:
result[char] = string.count(char)
return result |
def consumer():
r = ''
while True:
n = yield r # 返回的是r, 通过send函数接收的是n, 通过next和send都可以唤醒执行
# if not n:
# return
print('[CONSUMER] consuming %s' % n)
r = '200 OK'
def produce(c):
n = 0
while n < 5:
n = n + 1
print('[PRODUCE] producing %s' % n)
r = c.send(n)
print('[PRODUCE] consumer return %s' % r)
c.close()
if __name__ == '__main__':
c = consumer()
next(c) # 必须使用None启动生成器 TypeError: can't send non-None value to a just-started generator
produce(c)
|
NUM_ALLELES = 3
ALLELE_PRIOR = 1.0 / NUM_ALLELES
ALPHA = 1.5
MINUS_INFINITE = -1000000000
mBound = 6
jA = 10.0
jB = 0.5
pA = 0.1
pD = 0.1
pC = 1.0 - pD
pI = 0.1
if __name__ == '__main__':
print('This is a configuration file!')
|
# The four adjacent digits in the 1000-digit number that have the greatest product are 9 × 9 × 8 × 9 = 5832.
#
# 73167176531330624919225119674426574742355349194934
# 96983520312774506326239578318016984801869478851843
# 85861560789112949495459501737958331952853208805511
# 12540698747158523863050715693290963295227443043557
# 66896648950445244523161731856403098711121722383113
# 62229893423380308135336276614282806444486645238749
# 30358907296290491560440772390713810515859307960866
# 70172427121883998797908792274921901699720888093776
# 65727333001053367881220235421809751254540594752243
# 52584907711670556013604839586446706324415722155397
# 53697817977846174064955149290862569321978468622482
# 83972241375657056057490261407972968652414535100474
# 82166370484403199890008895243450658541227588666881
# 16427171479924442928230863465674813919123162824586
# 17866458359124566529476545682848912883142607690042
# 24219022671055626321111109370544217506941658960408
# 07198403850962455444362981230987879927244284909188
# 84580156166097919133875499200524063689912560717606
# 05886116467109405077541002256983155200055935729725
# 71636269561882670428252483600823257530420752963450
#
# Find the thirteen adjacent digits in the 1000-digit number that have the greatest product. What is the value of this product?
#
# Answer: 23514624000
def run():
very_large_number = 7316717653133062491922511967442657474235534919493496983520312774506326239578318016984801869478851843858615607891129494954595017379583319528532088055111254069874715852386305071569329096329522744304355766896648950445244523161731856403098711121722383113622298934233803081353362766142828064444866452387493035890729629049156044077239071381051585930796086670172427121883998797908792274921901699720888093776657273330010533678812202354218097512545405947522435258490771167055601360483958644670632441572215539753697817977846174064955149290862569321978468622482839722413756570560574902614079729686524145351004748216637048440319989000889524345065854122758866688116427171479924442928230863465674813919123162824586178664583591245665294765456828489128831426076900422421902267105562632111110937054421750694165896040807198403850962455444362981230987879927244284909188845801561660979191338754992005240636899125607176060588611646710940507754100225698315520005593572972571636269561882670428252483600823257530420752963450
list = []
while very_large_number > 0:
list.append(very_large_number % 10)
very_large_number = very_large_number // 10
list.reverse()
hold = 0
for idx in range(0, len(list) - 13):
sum = list[idx]
for jdx in range(1, 13):
sum *= list[idx + jdx]
if sum > hold:
hold = sum
return hold
|
class A:
def feature1(self):
print("Feature 1 working")
def feature2(self):
print("Feature 2 working")
a1 = A()
a1.feature1()
class B(A):
def feature3(self):
print("feature 3 working")
def feature4(self):
print("feature 4 working")
b1 = B()
b1.feature2()
|
# Application Install Directory (Relative to Inside Container)
SNODAS_APP = '/app/cumulus/snodas/core'
# Archive of UNMASKED files downloaded from NSIDC
SNODAS_RAW_UNMASKED = '/app/data/snodas/raw_unmasked'
# Archive of MASKED files downloaded from NSIDC
SNODAS_RAW_MASKED = '/app/data/snodas/raw_masked'
|
expected_output = {
'vrf': {
'VRF501': {
'address_family': {
'ipv4': {
'routes': {
'192.168.111.1/32': {
'route': '192.168.111.1/32',
'active': True,
'source_protocol_codes': 'L',
'source_protocol': 'local',
'next_hop': {
'outgoing_interface': {
'Loopback501': {
'outgoing_interface': 'Loopback501',
'updated': '1d22h'
},
},
},
},
'192.168.4.0/24': {
'route': '192.168.4.0/24',
'active': True,
'source_protocol_codes': 'C',
'source_protocol': 'connected',
'next_hop': {
'outgoing_interface': {
'GigabitEthernet0/0/0/0.501': {
'outgoing_interface': 'GigabitEthernet0/0/0/0.501',
'updated': '20:03:59'
},
},
},
},
'192.168.4.1/32': {
'route': '192.168.4.1/32',
'active': True,
'source_protocol_codes': 'L',
'source_protocol': 'local',
'next_hop': {
'outgoing_interface': {
'GigabitEthernet0/0/0/0.501': {
'outgoing_interface': 'GigabitEthernet0/0/0/0.501',
'updated': '20:03:59'
},
},
},
},
},
},
},
'last_resort': {
'gateway': 'not set'
},
},
'VRF502': {
'address_family': {
'ipv4': {
'routes': {
'10.144.0.0/24': {
'route': '10.144.0.0/24',
'active': True,
'source_protocol_codes': 'B',
'source_protocol': 'bgp',
'route_preference': 20,
'metric': 0,
'next_hop': {
'next_hop_list': {
1: {
'index': 1,
'next_hop': '192.168.154.2',
'updated': '19:38:48'
},
},
},
},
'10.144.1.0/24': {
'route': '10.144.1.0/24',
'active': True,
'source_protocol_codes': 'B',
'source_protocol': 'bgp',
'route_preference': 20,
'metric': 0,
'next_hop': {
'next_hop_list': {
1: {
'index': 1,
'next_hop': '192.168.154.2',
'updated': '19:38:48'
},
},
},
},
'10.144.2.0/24': {
'route': '10.144.2.0/24',
'active': True,
'source_protocol_codes': 'B',
'source_protocol': 'bgp',
'route_preference': 20,
'metric': 0,
'next_hop': {
'next_hop_list': {
1: {
'index': 1,
'next_hop': '192.168.154.2',
'updated': '19:38:48'
},
},
},
},
'192.168.4.1/32': {
'route': '192.168.4.1/32',
'active': True,
'source_protocol_codes': 'L',
'source_protocol': 'local',
'next_hop': {
'outgoing_interface': {
'Loopback502': {
'outgoing_interface': 'Loopback502',
'updated': '1d22h'
},
},
},
},
'192.168.154.0/24': {
'route': '192.168.154.0/24',
'active': True,
'source_protocol_codes': 'C',
'source_protocol': 'connected',
'next_hop': {
'outgoing_interface': {
'GigabitEthernet0/0/0/0.502': {
'outgoing_interface': 'GigabitEthernet0/0/0/0.502',
'updated': '20:03:59'
},
},
},
},
'192.168.154.1/32': {
'route': '192.168.154.1/32',
'active': True,
'source_protocol_codes': 'L',
'source_protocol': 'local',
'next_hop': {
'outgoing_interface': {
'GigabitEthernet0/0/0/0.502': {
'outgoing_interface': 'GigabitEthernet0/0/0/0.502',
'updated': '20:03:59'
},
},
},
},
},
},
},
'last_resort': {
'gateway': 'not set'
},
},
},
}
|
class Node:
def __init__(self, name=None, terminal=False):
self._name = name
self._children = []
self._level = None
self._terminal = terminal
# ====================
# GETTERS E SETTERS
@property
def name(self):
return self._name
@name.setter
def name(self, value):
self._name = value
@property
def terminal(self):
return self._terminal
@terminal.setter
def terminal(self, value):
self._terminal = value
@property
def level(self):
return self._level
@level.setter
def level(self, value):
self._level = value
@property
def children(self):
return self._children
@children.setter
def children(self, child):
self._children.append(child)
|
def get_all_includes(comp_args, dst_includes):
i = 0
while i < len(comp_args):
curr_arg = comp_args[i].strip()
if curr_arg == "-isystem":
curr_arg1 = "-I" + comp_args[i+1].strip()
if curr_arg1 not in dst_includes:
dst_includes.append(curr_arg1)
if curr_arg == "-include":
curr_arg1 = comp_args[i+1].strip()
if "dhd_sec_feature.h" not in curr_arg1:
final_arg = curr_arg + " " + curr_arg1
if final_arg not in dst_includes:
dst_includes.append(final_arg)
if curr_arg[0:2] == "-I":
if curr_arg not in dst_includes:
if 'drivers' not in curr_arg and 'sound' not in curr_arg:
dst_includes.append(curr_arg)
i += 1
|
def push(data_json):
# A user pushes 1 or more commits to a repository.
repository = data_json['repository']
# repository_scm = repository['scm']
repository_name = repository['name']
repository_link = repository['links']['html']['href']
actor = data_json['actor']
actor_name = actor['display_name']
actor_profile = actor['links']['html']['href']
pushh = data_json['push']['changes'][0]
push_forced = pushh['forced']
push_created = pushh['created']
push_truncated = pushh['truncated']
push_closed = pushh['closed']
push_commits_all = pushh['commits']
commits_str = ""
for commit in push_commits_all:
commit_hash = commit['hash']
if len(commit_hash) > 7:
commit_hash = commit_hash[:7]
commit_link = commit['links']['html']['href']
# commit_summary = commit['summary']['raw']
commit_message = commit['message']
# commit_author_name = commit['author']['user']['display_name']
# commit_author_link = commit['author']['user']['links']['html']['href']
commits_str += '\n\t#{} [{}]({}) \n=> _{}_'.format(push_commits_all.index(commit),
commit_hash, commit_link,
commit_message)
push_link = pushh['links']['html']['href']
push_new = pushh['new']
push_old = pushh['old']
message = "[{}]({}) pushed to [{}]({})" \
" \nCompare: [compare]({})" \
" \nCommits: \n{}".format(actor_name,
actor_profile,
repository_name,
repository_link,
push_link,
commits_str
)
return message
|
"""
Messages for the :mod:`~django_dicom.models.managers` module.
"""
DATA_ELEMENT_CREATION_FAILURE = (
"Failed to create DataElement instance for:\n{data_element}\n{exception}"
)
HEADER_CREATION_FAILURE = "Failed to read header information!\n{exception}"
IMPORT_ERROR = (
"Failed to import {path}\nThe following exception was raised: {exception}"
)
PATIENT_UID_MISMATCH = "Patient UID mismatch! Image {image_uid} is associated with patient {db_value} in the database, but the provided header shows {patient_uid}"
SERVER_START = "Starting {n_servers} DICOM storage service class providers..."
# flake8: noqa: E501
|
# Māras
text = input("ievadi teikumu")
texta = []
words = text.split()
textb = [w[::-1] for w in words]
# for item in words:
# texta.append(item[::-1])
# textb = " ".join(texta) # so we do not have " " after last item
print(" ".join(textb))
|
class LifeCycle:
def __init__(self, id, label, composed_of):
self.id = id
self.label = label
self.composed_of = composed_of
|
a = []
maximum = 0
for _ in range(6):
tmp = [int(x) for x in str(input()).split(" ")]
a.append(tmp)
for i in range(6):
for j in range(6):
if (j + 2 < 6) and (i + 2 < 6):
result = a[i][j] + a[i][j+1] + a[i][j+2] + a[i+1][j+1] + a[i+2][j] + a[i+2][j+1] + a[i+2][j+2]
if(result > maximum):
maximum = result
print(maximum) |
def NumpyInList(array,l1):
for i in l1:
if i[0] == array[0] and i[1] == array[1]:
return True
return False
|
def create_matrix(size):
matrix = []
for _ in range(size):
matrix.append([int(x) for x in input().split()])
return matrix
def is_valid_cell(position, size):
row = position[0]
col = position[1]
return 0 <= row < size and 0 <= col < size
def print_matrix(matrix):
for row in matrix:
print(' '.join([str(x) for x in row]))
def count_alive_cells_and_sum_them(matrix, size):
alive_cells_count = 0
alive_cells_sum = 0
for r in range(size):
for c in range(size):
if matrix[r][c] > 0:
alive_cells_count += 1
alive_cells_sum += matrix[r][c]
return alive_cells_count, alive_cells_sum
size = int(input())
matrix = create_matrix(size)
base_matrix = matrix
bomb_coordinates = input().split()
target_rows = [-1, -1, -1, 0, 1, 1, 1, 0]
target_cols = [-1, 0, 1, 1, 1, 0, -1, -1]
for row_col in bomb_coordinates:
tokens = row_col.split(',')
row, col = int(tokens[0]), int(tokens[1])
current_bomb = base_matrix[row][col]
if base_matrix[row][col] > 0:
for i in range(8):
bombed_cell_position = [row + target_rows[i], col + target_cols[i]]
if is_valid_cell(bombed_cell_position, size):
cell_row = bombed_cell_position[0]
cell_col = bombed_cell_position[1]
if matrix[cell_row][cell_col] > 0:
matrix[cell_row][cell_col] -= current_bomb
matrix[row][col] = 0
base_matrix[row][col] = 0
alive_cells_count, alive_cells_sum = count_alive_cells_and_sum_them(matrix, size)
print(f"Alive cells: {alive_cells_count}")
print(f"Sum: {alive_cells_sum}")
print_matrix(matrix)
|
load(
"@io_bazel_rules_dotnet//dotnet/private:context.bzl",
"dotnet_context",
)
load(
"@io_bazel_rules_dotnet//dotnet/private:providers.bzl",
"DotnetLibrary",
)
load("@io_bazel_rules_dotnet//dotnet/private:rules/common.bzl", "collect_transitive_info")
def _libraryset_impl(ctx):
"""_libraryset_impl implements the set of libraries."""
dotnet = dotnet_context(ctx)
name = ctx.label.name
# Handle case of empty toolchain on linux and darwin
if dotnet.assembly == None:
library = dotnet.new_library(dotnet = dotnet)
return [library]
(transitive_refs, transitive_runfiles, transitive_deps) = collect_transitive_info(ctx.attr.deps)
library = dotnet.new_library(
dotnet = dotnet,
name = name,
deps = ctx.attr.deps,
transitive = transitive_deps,
runfiles = transitive_runfiles,
transitive_refs = transitive_refs,
)
return [
library,
DefaultInfo(
runfiles = ctx.runfiles(files = [], transitive_files = library.runfiles),
),
]
dotnet_libraryset = rule(
_libraryset_impl,
attrs = {
"deps": attr.label_list(providers = [DotnetLibrary]),
"dotnet_context_data": attr.label(default = Label("@io_bazel_rules_dotnet//:dotnet_context_data")),
},
toolchains = ["@io_bazel_rules_dotnet//dotnet:toolchain"],
executable = False,
)
core_libraryset = rule(
_libraryset_impl,
attrs = {
"deps": attr.label_list(providers = [DotnetLibrary]),
"dotnet_context_data": attr.label(default = Label("@io_bazel_rules_dotnet//:core_context_data")),
},
toolchains = ["@io_bazel_rules_dotnet//dotnet:toolchain_core"],
executable = False,
)
net_libraryset = rule(
_libraryset_impl,
attrs = {
"deps": attr.label_list(providers = [DotnetLibrary]),
"dotnet_context_data": attr.label(default = Label("@io_bazel_rules_dotnet//:net_context_data")),
},
toolchains = ["@io_bazel_rules_dotnet//dotnet:toolchain_net"],
executable = False,
)
|
# Basic syntax
#T# Table of contents
#C# Blocks of code
#C# Variables, constants, literals
#C# - Type hints
#C# Escape sequences and escaped chars
#C# Expressions
#C# Function calls
#C# Statements
#C# Multiline statements
#C# Multistatement lines
#C# Metadata
#T# Beginning of content
# |-------------------------------------------------------------
#T# run a Python file /path/to/file1.py in the operating system shell with
# SYNTAX python3 /path/to/file1.py
#T# output variables to stdout with the print function
# SYNTAX print(var1, var2, var3)
#T# the same can be done by simply typing the variable's name in the Python prompt
# SYNTAX var1
#T# get help about a symbol or name (function, attribute, etc.) with the help function, used in a script or in the Python prompt
# SYNTAX help(name1)
help(round)
# |-------------------------------------------------------------
#C# Blocks of code
# |-------------------------------------------------------------
#T# indentation acts as the delimiter (like braces)
if True:
int1 = 70
# |-------------------------------------------------------------
#C# Variables, constants, literals
# |-------------------------------------------------------------
#T# variables are dynamically typed. Literals are characters, numbers
str1 = 'str'
int1 = 5
#T# variable identifiers can only contain letters, numbers, and the underscore
var_aux1 = 0
#T# strings are created within quotation symbols, each quotation symbol type can be used inside the others as a normal character
str1 = 'sen1word1 sen1""""word2 sen1word3 sen1word4'
str1 = "sen2word1 sen2''''word2 sen2word3 sen2word4"
str1 = """sen3word1 sen3"'"'word2
sen3word3 sen3word4"""
#C# - Type hints
# |-----
#T# type hints are used when there is no autocompletion for an object that should have, this is because the type of a dynamic type can't be known at compile time
# SYNTAX obj1 = Constructor1() # type: Object_type1
#T# the type hint is written after the comment, the autocompletion of obj1 follows the type Object_type1
var1 = 8 # type: str
# var1. autocompletes as a string
# |-----
# |-------------------------------------------------------------
#C# Escape sequences and escaped chars
# |-------------------------------------------------------------
#T# an special kind of combination of literals are escape sequences and escaped chars, escape sequences mean something particular, e.g. the \n means newline, escaped chars make operators to become literals, e.g. the {{ makes a single curly brace to be taken literally
# SYNTAX \char1
#T# an escape starts with a backslash \ and is followed by char1 which is other character or characters, most commonly char1 is a single character
# SYNTAX {{
# SYNTAX }}
#T# in interpolated strings, duplicating the curly braces escapes them
str1 = f"Line1\n{{Line2}}"
#T# printing str1 gives the following
# Line1
# {Line2}
# |-------------------------------------------------------------
#C# Expressions
# |-------------------------------------------------------------
#T# expressions are evaluated and return a value
int1 = 5 + 3 - 7 # 1
# |-------------------------------------------------------------
#C# Function calls
# |-------------------------------------------------------------
#T# a function call is made with the function name followed by a pair of parentheses that contain the arguments separated by comma
#T# the function name can be separated by whitespace (but not a newline) from the arguments in parentheses
#T# basic output to stdout is done with the print function
print("Hello, Python!")
#T# basic input from stdin is done with the input function
var1 = input ("\nPlease enter var1 as input\n")
#T# the arguments to a function contain positional arguments and kwarg pairs
# SYNTAX func1(pos1, pos2, kwarg1 = value1, kwarg2 = value2)
# SYNTAX func1(pos1, pos2, kwargs1)
#T# pos1 and pos2 represent positional arguments so they must be written in that order of positions at the start of the parentheses
#T# kwarg1 = value1, and kwarg2 = value2 are kwarg value pairs that allow naming arguments, these can be written in any order
#T# kwargs1 are the kwarg value pairs, this is a shorthand notation to indicate the kwarg value pairs without writing them one by one
str1 = 'string to print'
print(str1, end = '\n') #| str1 is a positional argument, and the end kwarg is used to set the character at the end of the string
#T# a function signature is a short way to write how to use a function, commonly it contains the return value, the function name, and the arguments, which is the minimum needed
# SYNTAX value1 = func1(arg1, arg2, arg3)
# |-------------------------------------------------------------
#C# Statements
# |-------------------------------------------------------------
#T# a statement is a complete instruction
int1 = 5
#T# int1 = 5 is a statement, the variable int1 is made to point to the value 5
#T# the dot notation is used to access the namespace of an object
# SYNTAX obj1.name1.name2
#T# here the object obj1 has name1 in its namespace, and name1 has name2 in its namespace
int1 = 5
int1 = int1.bit_length() # 3
#T# the bit_length function is accessed using dot notation on an integer
#T# the pass keyword is used to create a no-op statement that does nothing, as a filler
pass
# |-------------------------------------------------------------
#C# Multiline statements
# |-------------------------------------------------------------
#T# a multiline statement is created with a backslash at the end of each line, a list can be continued without a comma at the end of the line
int1 = 5 + 6 + \
3 + 7 # 21
list1 = ['Mon', 'Wed'
'Fri', 'Sun']
# |-------------------------------------------------------------
#C# Multistatement lines
# |-------------------------------------------------------------
#T# multiple statements in the same line are separated with a semicolon
int1 = 9; int2 = 7; int3 = 0
# |-------------------------------------------------------------
#C# Metadata
# |-------------------------------------------------------------
#T# the character encoding of a python file can be declared with the `coding` metadata placed at the start of the file, for example:
# coding=utf-8
# |------------------------------------------------------------- |
"""
Given a number, return a string with dash `'-'` marks before and after each odd integer, but do not begin or end the string with a dash mark.
"""
def dashatize(num):
if not num and not (num == 0):
return 'None'
result = '-'.join(str(abs(num)))
copy_result = result[:]
occurrences = 0
for index, value in enumerate(result):
if value == '-':
# Check if there is need to be a '-' here.
if int(result[index - 1]) % 2 == 0 and int(result[index + 1]) % 2 == 0:
copy_result = copy_result[:index - occurrences] + copy_result[index + 1 - occurrences:]
occurrences += 1
return copy_result
|
(rows_count, columns_count) = map(int, input().split())
matrix = []
new_matrix = []
player_position = []
player_wins = False
for i in range(rows_count):
row = [x for x in input()]
if "P" in row:
player_position = [i, row.index("P")]
row[row.index("P")] = "."
row2 = row.copy()
matrix.append(row)
new_matrix.append(row2)
commands = list(input())
for command in commands:
next_player_position = []
if command == "U":
next_player_position = [player_position[0] - 1, player_position[1]]
elif command == "D":
next_player_position = [player_position[0] + 1, player_position[1]]
elif command == "L":
next_player_position = [player_position[0], player_position[1] - 1]
elif command == "R":
next_player_position = [player_position[0], player_position[1] + 1]
for r in range(rows_count):
for ch in range(columns_count):
if matrix[r][ch] == "B":
if r - 1 >= 0:
new_matrix[r - 1][ch] = "B"
if ch - 1 >= 0:
new_matrix[r][ch - 1] = "B"
if ch + 1 < columns_count:
new_matrix[r][ch + 1] = "B"
if r + 1 < rows_count:
new_matrix[r + 1][ch] = "B"
matrix = [x.copy() for x in new_matrix]
if 0 <= next_player_position[0] <= rows_count - 1 and 0 <= next_player_position[1] <= columns_count - 1:
player_position = next_player_position
if matrix[player_position[0]][player_position[1]] == "B":
break
else:
player_wins = True
break
[print("".join(x)) for x in matrix]
if player_wins:
print(f"won: {player_position[0]} {player_position[1]}")
else:
print(f"dead: {player_position[0]} {player_position[1]}")
|
"""django-dmarc-reporting"""
__author__ = "VirtualTam"
__title__ = "django-dmarc-reporting"
__version__ = '0.1'
default_app_config = 'dmarc_reporting.apps.DmarcReportingConfig'
|
coordinates_FFFFCC = ((149, 117),
(149, 118), (149, 119), (149, 120), (149, 121), (149, 122), (149, 123), (149, 124), (149, 125), (149, 126), (149, 127), (149, 128), (149, 129), (149, 130), (150, 111), (150, 112), (150, 113), (150, 114), (150, 115), (150, 116), (150, 131), (150, 133), (151, 107), (151, 108), (151, 109), (151, 110), (151, 117), (151, 118), (151, 119), (151, 120), (151, 121), (151, 122), (151, 123), (151, 124), (151, 125), (151, 126), (151, 127), (151, 128), (151, 129), (151, 130), (151, 135), (152, 104), (152, 106), (152, 111), (152, 112), (152, 113), (152, 114), (152, 115), (152, 116), (152, 117), (152, 118), (152, 119), (152, 120), (152, 121), (152, 122), (152, 123), (152, 124), (152, 125), (152, 126), (152, 127), (152, 128), (152, 129), (152, 130), (152, 131), (152, 132), (152, 133), (152, 137), (153, 102), (153, 103), (153, 107), (153, 108), (153, 109), (153, 110),
(153, 111), (153, 112), (153, 113), (153, 114), (153, 115), (153, 116), (153, 117), (153, 118), (153, 119), (153, 120), (153, 121), (153, 122), (153, 123), (153, 124), (153, 125), (153, 126), (153, 127), (153, 128), (153, 129), (153, 130), (153, 131), (153, 132), (153, 133), (153, 134), (153, 135), (153, 139), (154, 96), (154, 97), (154, 98), (154, 99), (154, 100), (154, 104), (154, 105), (154, 106), (154, 107), (154, 108), (154, 109), (154, 110), (154, 111), (154, 112), (154, 113), (154, 114), (154, 115), (154, 116), (154, 117), (154, 118), (154, 119), (154, 120), (154, 121), (154, 122), (154, 123), (154, 124), (154, 125), (154, 126), (154, 127), (154, 128), (154, 129), (154, 130), (154, 131), (154, 132), (154, 133), (154, 134), (154, 135), (154, 136), (154, 137), (154, 141), (155, 91), (155, 93), (155, 94), (155, 95), (155, 102), (155, 103),
(155, 104), (155, 105), (155, 106), (155, 107), (155, 108), (155, 109), (155, 110), (155, 111), (155, 112), (155, 113), (155, 114), (155, 115), (155, 116), (155, 117), (155, 118), (155, 119), (155, 120), (155, 121), (155, 122), (155, 123), (155, 124), (155, 125), (155, 126), (155, 127), (155, 128), (155, 129), (155, 130), (155, 131), (155, 132), (155, 133), (155, 134), (155, 135), (155, 136), (155, 137), (155, 138), (155, 139), (155, 143), (156, 90), (156, 96), (156, 97), (156, 98), (156, 99), (156, 100), (156, 101), (156, 102), (156, 103), (156, 104), (156, 105), (156, 106), (156, 107), (156, 108), (156, 109), (156, 110), (156, 111), (156, 112), (156, 113), (156, 114), (156, 115), (156, 116), (156, 117), (156, 118), (156, 119), (156, 120), (156, 121), (156, 122), (156, 123), (156, 124), (156, 125), (156, 126), (156, 127), (156, 128), (156, 129),
(156, 130), (156, 131), (156, 132), (156, 133), (156, 134), (156, 135), (156, 136), (156, 137), (156, 138), (156, 139), (156, 140), (156, 141), (156, 145), (157, 89), (157, 91), (157, 92), (157, 93), (157, 94), (157, 95), (157, 96), (157, 97), (157, 98), (157, 99), (157, 100), (157, 101), (157, 102), (157, 103), (157, 104), (157, 105), (157, 106), (157, 107), (157, 108), (157, 109), (157, 110), (157, 111), (157, 112), (157, 113), (157, 114), (157, 115), (157, 116), (157, 117), (157, 118), (157, 119), (157, 120), (157, 121), (157, 122), (157, 123), (157, 124), (157, 125), (157, 126), (157, 127), (157, 128), (157, 129), (157, 130), (157, 131), (157, 132), (157, 133), (157, 134), (157, 135), (157, 136), (157, 137), (157, 138), (157, 139), (157, 140), (157, 141), (157, 142), (157, 143), (157, 146), (158, 89), (158, 91), (158, 92), (158, 93),
(158, 94), (158, 95), (158, 96), (158, 97), (158, 98), (158, 99), (158, 100), (158, 101), (158, 102), (158, 103), (158, 104), (158, 105), (158, 106), (158, 107), (158, 108), (158, 109), (158, 110), (158, 111), (158, 112), (158, 113), (158, 114), (158, 115), (158, 116), (158, 117), (158, 118), (158, 119), (158, 120), (158, 121), (158, 122), (158, 123), (158, 124), (158, 125), (158, 126), (158, 127), (158, 128), (158, 129), (158, 130), (158, 131), (158, 132), (158, 133), (158, 134), (158, 135), (158, 136), (158, 137), (158, 138), (158, 139), (158, 140), (158, 141), (158, 142), (158, 143), (158, 144), (158, 146), (159, 89), (159, 91), (159, 92), (159, 93), (159, 94), (159, 95), (159, 96), (159, 97), (159, 98), (159, 99), (159, 100), (159, 101), (159, 102), (159, 103), (159, 104), (159, 105), (159, 106), (159, 107), (159, 108), (159, 109),
(159, 110), (159, 111), (159, 112), (159, 113), (159, 114), (159, 115), (159, 116), (159, 117), (159, 118), (159, 119), (159, 120), (159, 121), (159, 122), (159, 123), (159, 124), (159, 125), (159, 126), (159, 127), (159, 128), (159, 129), (159, 130), (159, 131), (159, 132), (159, 133), (159, 134), (159, 135), (159, 136), (159, 137), (159, 138), (159, 139), (159, 140), (159, 141), (159, 142), (159, 146), (160, 88), (160, 90), (160, 91), (160, 92), (160, 93), (160, 94), (160, 95), (160, 96), (160, 97), (160, 98), (160, 99), (160, 100), (160, 101), (160, 102), (160, 103), (160, 104), (160, 105), (160, 106), (160, 107), (160, 108), (160, 109), (160, 110), (160, 111), (160, 112), (160, 113), (160, 114), (160, 115), (160, 116), (160, 117), (160, 118), (160, 119), (160, 120), (160, 121), (160, 122), (160, 123), (160, 124), (160, 125), (160, 126),
(160, 127), (160, 128), (160, 129), (160, 130), (160, 131), (160, 132), (160, 133), (160, 134), (160, 135), (160, 136), (160, 137), (160, 138), (160, 139), (160, 140), (160, 141), (160, 145), (161, 86), (161, 89), (161, 90), (161, 91), (161, 92), (161, 93), (161, 94), (161, 95), (161, 96), (161, 97), (161, 98), (161, 99), (161, 100), (161, 101), (161, 102), (161, 103), (161, 104), (161, 105), (161, 106), (161, 107), (161, 108), (161, 109), (161, 110), (161, 111), (161, 112), (161, 113), (161, 114), (161, 115), (161, 116), (161, 117), (161, 118), (161, 119), (161, 120), (161, 121), (161, 122), (161, 123), (161, 124), (161, 125), (161, 126), (161, 127), (161, 128), (161, 129), (161, 130), (161, 131), (161, 132), (161, 133), (161, 134), (161, 135), (161, 136), (161, 137), (161, 138), (161, 139), (161, 140), (161, 142), (162, 84), (162, 85),
(162, 88), (162, 89), (162, 90), (162, 91), (162, 92), (162, 93), (162, 94), (162, 95), (162, 96), (162, 97), (162, 98), (162, 99), (162, 100), (162, 101), (162, 102), (162, 103), (162, 104), (162, 105), (162, 106), (162, 107), (162, 108), (162, 109), (162, 110), (162, 111), (162, 112), (162, 113), (162, 114), (162, 115), (162, 116), (162, 117), (162, 118), (162, 119), (162, 120), (162, 121), (162, 122), (162, 123), (162, 124), (162, 125), (162, 126), (162, 127), (162, 128), (162, 129), (162, 130), (162, 131), (162, 132), (162, 133), (162, 134), (162, 135), (162, 136), (162, 137), (162, 138), (162, 139), (162, 141), (163, 81), (163, 82), (163, 83), (163, 86), (163, 87), (163, 88), (163, 89), (163, 90), (163, 91), (163, 92), (163, 93), (163, 94), (163, 95), (163, 96), (163, 97), (163, 98), (163, 99), (163, 100), (163, 101),
(163, 102), (163, 103), (163, 104), (163, 105), (163, 106), (163, 107), (163, 108), (163, 109), (163, 110), (163, 111), (163, 112), (163, 113), (163, 114), (163, 115), (163, 116), (163, 117), (163, 118), (163, 119), (163, 120), (163, 121), (163, 122), (163, 123), (163, 124), (163, 125), (163, 126), (163, 127), (163, 128), (163, 129), (163, 130), (163, 131), (163, 132), (163, 133), (163, 134), (163, 135), (163, 136), (163, 137), (163, 138), (163, 140), (164, 76), (164, 77), (164, 78), (164, 79), (164, 84), (164, 85), (164, 86), (164, 87), (164, 88), (164, 89), (164, 90), (164, 91), (164, 92), (164, 93), (164, 94), (164, 95), (164, 96), (164, 97), (164, 98), (164, 99), (164, 100), (164, 101), (164, 102), (164, 103), (164, 104), (164, 105), (164, 106), (164, 107), (164, 108), (164, 109), (164, 110), (164, 111), (164, 112), (164, 113),
(164, 114), (164, 115), (164, 116), (164, 117), (164, 118), (164, 119), (164, 120), (164, 121), (164, 122), (164, 123), (164, 124), (164, 125), (164, 126), (164, 127), (164, 128), (164, 129), (164, 130), (164, 131), (164, 132), (164, 133), (164, 134), (164, 135), (164, 136), (164, 137), (164, 139), (165, 74), (165, 75), (165, 80), (165, 81), (165, 82), (165, 83), (165, 84), (165, 85), (165, 86), (165, 87), (165, 88), (165, 89), (165, 90), (165, 91), (165, 92), (165, 93), (165, 94), (165, 95), (165, 96), (165, 97), (165, 98), (165, 99), (165, 100), (165, 101), (165, 102), (165, 103), (165, 104), (165, 105), (165, 106), (165, 107), (165, 108), (165, 109), (165, 110), (165, 111), (165, 112), (165, 113), (165, 114), (165, 115), (165, 116), (165, 117), (165, 118), (165, 119), (165, 120), (165, 121), (165, 122), (165, 123), (165, 124),
(165, 125), (165, 126), (165, 127), (165, 128), (165, 129), (165, 130), (165, 131), (165, 132), (165, 133), (165, 134), (165, 135), (165, 136), (166, 72), (166, 76), (166, 77), (166, 78), (166, 79), (166, 80), (166, 81), (166, 82), (166, 83), (166, 84), (166, 85), (166, 86), (166, 87), (166, 88), (166, 89), (166, 90), (166, 91), (166, 92), (166, 93), (166, 94), (166, 95), (166, 96), (166, 97), (166, 98), (166, 99), (166, 100), (166, 101), (166, 102), (166, 103), (166, 104), (166, 105), (166, 106), (166, 107), (166, 108), (166, 109), (166, 110), (166, 111), (166, 112), (166, 113), (166, 114), (166, 115), (166, 116), (166, 117), (166, 118), (166, 119), (166, 120), (166, 121), (166, 122), (166, 123), (166, 124), (166, 125), (166, 126), (166, 127), (166, 128), (166, 129), (166, 130), (166, 131), (166, 132), (166, 133), (166, 134),
(166, 135), (166, 136), (166, 138), (167, 70), (167, 74), (167, 75), (167, 76), (167, 77), (167, 78), (167, 79), (167, 80), (167, 81), (167, 82), (167, 83), (167, 84), (167, 85), (167, 86), (167, 87), (167, 88), (167, 89), (167, 90), (167, 91), (167, 92), (167, 93), (167, 94), (167, 95), (167, 96), (167, 97), (167, 98), (167, 99), (167, 100), (167, 101), (167, 102), (167, 103), (167, 104), (167, 105), (167, 106), (167, 107), (167, 108), (167, 109), (167, 110), (167, 111), (167, 112), (167, 113), (167, 114), (167, 115), (167, 116), (167, 117), (167, 118), (167, 119), (167, 120), (167, 121), (167, 122), (167, 123), (167, 124), (167, 125), (167, 126), (167, 127), (167, 128), (167, 129), (167, 130), (167, 131), (167, 132), (167, 133), (167, 134), (167, 135), (167, 137), (168, 68), (168, 69), (168, 72), (168, 73), (168, 74),
(168, 75), (168, 76), (168, 77), (168, 78), (168, 79), (168, 80), (168, 81), (168, 82), (168, 83), (168, 84), (168, 85), (168, 86), (168, 87), (168, 88), (168, 89), (168, 90), (168, 91), (168, 92), (168, 93), (168, 94), (168, 95), (168, 96), (168, 97), (168, 98), (168, 99), (168, 100), (168, 101), (168, 102), (168, 103), (168, 104), (168, 105), (168, 106), (168, 107), (168, 108), (168, 109), (168, 110), (168, 111), (168, 112), (168, 113), (168, 114), (168, 115), (168, 116), (168, 117), (168, 118), (168, 119), (168, 120), (168, 121), (168, 122), (168, 123), (168, 124), (168, 125), (168, 126), (168, 127), (168, 128), (168, 129), (168, 130), (168, 131), (168, 132), (168, 133), (168, 134), (168, 136), (169, 67), (169, 70), (169, 71), (169, 72), (169, 73), (169, 74), (169, 75), (169, 76), (169, 77), (169, 78), (169, 79),
(169, 80), (169, 81), (169, 82), (169, 83), (169, 84), (169, 85), (169, 86), (169, 87), (169, 88), (169, 89), (169, 90), (169, 91), (169, 92), (169, 93), (169, 94), (169, 95), (169, 96), (169, 97), (169, 98), (169, 99), (169, 100), (169, 101), (169, 102), (169, 103), (169, 104), (169, 105), (169, 106), (169, 107), (169, 108), (169, 109), (169, 110), (169, 111), (169, 112), (169, 113), (169, 114), (169, 115), (169, 116), (169, 117), (169, 118), (169, 119), (169, 120), (169, 121), (169, 122), (169, 123), (169, 124), (169, 125), (169, 126), (169, 127), (169, 128), (169, 129), (169, 130), (169, 131), (169, 132), (169, 133), (169, 135), (170, 65), (170, 68), (170, 69), (170, 70), (170, 71), (170, 72), (170, 73), (170, 74), (170, 75), (170, 76), (170, 77), (170, 78), (170, 79), (170, 80), (170, 81), (170, 82), (170, 83),
(170, 84), (170, 85), (170, 86), (170, 87), (170, 88), (170, 89), (170, 90), (170, 91), (170, 92), (170, 93), (170, 94), (170, 95), (170, 96), (170, 97), (170, 98), (170, 99), (170, 100), (170, 101), (170, 102), (170, 103), (170, 104), (170, 105), (170, 106), (170, 107), (170, 108), (170, 109), (170, 110), (170, 111), (170, 112), (170, 113), (170, 114), (170, 115), (170, 116), (170, 117), (170, 118), (170, 119), (170, 120), (170, 121), (170, 122), (170, 123), (170, 124), (170, 125), (170, 126), (170, 127), (170, 128), (170, 129), (170, 130), (170, 131), (170, 132), (170, 133), (170, 135), (171, 64), (171, 67), (171, 68), (171, 69), (171, 70), (171, 71), (171, 72), (171, 73), (171, 74), (171, 75), (171, 76), (171, 77), (171, 78), (171, 79), (171, 80), (171, 81), (171, 82), (171, 83), (171, 84), (171, 85), (171, 86),
(171, 87), (171, 88), (171, 89), (171, 90), (171, 91), (171, 92), (171, 93), (171, 94), (171, 95), (171, 96), (171, 97), (171, 98), (171, 99), (171, 100), (171, 101), (171, 102), (171, 103), (171, 104), (171, 105), (171, 106), (171, 107), (171, 108), (171, 109), (171, 110), (171, 111), (171, 112), (171, 113), (171, 114), (171, 115), (171, 116), (171, 117), (171, 118), (171, 119), (171, 120), (171, 121), (171, 122), (171, 123), (171, 124), (171, 125), (171, 126), (171, 127), (171, 128), (171, 129), (171, 130), (171, 131), (171, 132), (171, 134), (172, 63), (172, 65), (172, 66), (172, 67), (172, 68), (172, 69), (172, 70), (172, 71), (172, 72), (172, 73), (172, 74), (172, 75), (172, 76), (172, 77), (172, 78), (172, 79), (172, 80), (172, 81), (172, 82), (172, 83), (172, 84), (172, 85), (172, 86), (172, 87), (172, 88),
(172, 89), (172, 90), (172, 91), (172, 92), (172, 93), (172, 94), (172, 95), (172, 96), (172, 97), (172, 98), (172, 99), (172, 100), (172, 101), (172, 102), (172, 103), (172, 104), (172, 105), (172, 106), (172, 107), (172, 108), (172, 109), (172, 110), (172, 111), (172, 112), (172, 113), (172, 114), (172, 115), (172, 116), (172, 117), (172, 118), (172, 119), (172, 120), (172, 121), (172, 122), (172, 123), (172, 124), (172, 125), (172, 126), (172, 127), (172, 128), (172, 129), (172, 130), (172, 131), (172, 133), (173, 61), (173, 64), (173, 65), (173, 66), (173, 67), (173, 68), (173, 69), (173, 70), (173, 71), (173, 72), (173, 73), (173, 74), (173, 75), (173, 76), (173, 77), (173, 78), (173, 79), (173, 80), (173, 81), (173, 82), (173, 83), (173, 84), (173, 85), (173, 86), (173, 87), (173, 88), (173, 89), (173, 90),
(173, 91), (173, 92), (173, 93), (173, 94), (173, 95), (173, 96), (173, 97), (173, 98), (173, 99), (173, 100), (173, 101), (173, 102), (173, 103), (173, 104), (173, 105), (173, 106), (173, 107), (173, 108), (173, 109), (173, 110), (173, 111), (173, 112), (173, 113), (173, 114), (173, 115), (173, 116), (173, 117), (173, 118), (173, 119), (173, 120), (173, 121), (173, 122), (173, 123), (173, 124), (173, 125), (173, 126), (173, 127), (173, 128), (173, 129), (173, 130), (173, 132), (174, 60), (174, 63), (174, 64), (174, 65), (174, 66), (174, 67), (174, 68), (174, 69), (174, 70), (174, 71), (174, 72), (174, 73), (174, 74), (174, 75), (174, 76), (174, 77), (174, 78), (174, 79), (174, 80), (174, 81), (174, 82), (174, 83), (174, 84), (174, 85), (174, 86), (174, 87), (174, 88), (174, 89), (174, 90), (174, 91), (174, 92),
(174, 93), (174, 94), (174, 95), (174, 96), (174, 97), (174, 100), (174, 101), (174, 102), (174, 103), (174, 104), (174, 105), (174, 106), (174, 107), (174, 108), (174, 109), (174, 110), (174, 111), (174, 112), (174, 113), (174, 114), (174, 115), (174, 116), (174, 117), (174, 118), (174, 119), (174, 120), (174, 121), (174, 122), (174, 123), (174, 124), (174, 125), (174, 126), (174, 127), (174, 128), (174, 129), (174, 130), (174, 132), (175, 59), (175, 61), (175, 62), (175, 63), (175, 64), (175, 65), (175, 66), (175, 67), (175, 68), (175, 69), (175, 70), (175, 71), (175, 72), (175, 73), (175, 74), (175, 75), (175, 76), (175, 77), (175, 78), (175, 79), (175, 80), (175, 81), (175, 82), (175, 83), (175, 84), (175, 85), (175, 86), (175, 87), (175, 88), (175, 89), (175, 90), (175, 91), (175, 92), (175, 97), (175, 98),
(175, 99), (175, 102), (175, 103), (175, 104), (175, 105), (175, 106), (175, 107), (175, 108), (175, 109), (175, 110), (175, 111), (175, 112), (175, 113), (175, 114), (175, 115), (175, 116), (175, 117), (175, 118), (175, 119), (175, 120), (175, 121), (175, 122), (175, 123), (175, 124), (175, 125), (175, 126), (175, 127), (175, 128), (175, 129), (175, 131), (176, 57), (176, 60), (176, 61), (176, 62), (176, 63), (176, 64), (176, 65), (176, 66), (176, 67), (176, 68), (176, 69), (176, 70), (176, 71), (176, 72), (176, 73), (176, 74), (176, 75), (176, 76), (176, 77), (176, 78), (176, 79), (176, 80), (176, 81), (176, 82), (176, 83), (176, 84), (176, 85), (176, 86), (176, 87), (176, 88), (176, 89), (176, 90), (176, 93), (176, 94), (176, 95), (176, 96), (176, 100), (176, 101), (176, 102), (176, 103), (176, 104), (176, 105),
(176, 106), (176, 107), (176, 108), (176, 109), (176, 110), (176, 111), (176, 112), (176, 113), (176, 114), (176, 115), (176, 116), (176, 117), (176, 118), (176, 119), (176, 120), (176, 121), (176, 122), (176, 123), (176, 124), (176, 125), (176, 126), (176, 127), (176, 128), (176, 130), (177, 56), (177, 59), (177, 60), (177, 61), (177, 62), (177, 63), (177, 64), (177, 65), (177, 66), (177, 67), (177, 68), (177, 69), (177, 70), (177, 71), (177, 72), (177, 73), (177, 74), (177, 75), (177, 76), (177, 77), (177, 78), (177, 79), (177, 80), (177, 81), (177, 82), (177, 83), (177, 84), (177, 85), (177, 86), (177, 87), (177, 91), (177, 92), (177, 102), (177, 104), (177, 105), (177, 106), (177, 107), (177, 108), (177, 109), (177, 110), (177, 111), (177, 112), (177, 113), (177, 114), (177, 115), (177, 116), (177, 117), (177, 118),
(177, 119), (177, 120), (177, 121), (177, 122), (177, 123), (177, 124), (177, 125), (177, 126), (177, 127), (177, 128), (177, 130), (178, 55), (178, 58), (178, 59), (178, 60), (178, 61), (178, 62), (178, 63), (178, 64), (178, 65), (178, 66), (178, 67), (178, 68), (178, 69), (178, 70), (178, 71), (178, 72), (178, 73), (178, 74), (178, 75), (178, 76), (178, 77), (178, 78), (178, 79), (178, 80), (178, 81), (178, 82), (178, 83), (178, 84), (178, 85), (178, 86), (178, 89), (178, 102), (178, 104), (178, 105), (178, 106), (178, 107), (178, 108), (178, 109), (178, 110), (178, 111), (178, 112), (178, 113), (178, 114), (178, 115), (178, 116), (178, 117), (178, 118), (178, 119), (178, 120), (178, 121), (178, 122), (178, 123), (178, 124), (178, 125), (178, 126), (178, 127), (178, 129), (179, 54), (179, 56), (179, 57), (179, 58),
(179, 59), (179, 60), (179, 61), (179, 62), (179, 63), (179, 64), (179, 65), (179, 66), (179, 67), (179, 68), (179, 69), (179, 70), (179, 71), (179, 72), (179, 73), (179, 74), (179, 75), (179, 76), (179, 77), (179, 78), (179, 79), (179, 80), (179, 81), (179, 82), (179, 83), (179, 84), (179, 87), (179, 102), (179, 104), (179, 105), (179, 106), (179, 107), (179, 108), (179, 109), (179, 110), (179, 111), (179, 112), (179, 113), (179, 114), (179, 115), (179, 116), (179, 117), (179, 118), (179, 119), (179, 120), (179, 121), (179, 122), (179, 123), (179, 124), (179, 125), (179, 126), (179, 128), (180, 53), (180, 55), (180, 56), (180, 57), (180, 58), (180, 59), (180, 60), (180, 61), (180, 62), (180, 63), (180, 64), (180, 65), (180, 66), (180, 67), (180, 68), (180, 69), (180, 70), (180, 71), (180, 72), (180, 73),
(180, 74), (180, 75), (180, 76), (180, 77), (180, 78), (180, 79), (180, 80), (180, 81), (180, 82), (180, 85), (180, 102), (180, 104), (180, 105), (180, 106), (180, 107), (180, 108), (180, 109), (180, 110), (180, 111), (180, 112), (180, 113), (180, 114), (180, 115), (180, 116), (180, 117), (180, 118), (180, 119), (180, 120), (180, 121), (180, 122), (180, 123), (180, 124), (180, 125), (180, 126), (180, 128), (181, 52), (181, 54), (181, 55), (181, 56), (181, 57), (181, 58), (181, 59), (181, 60), (181, 61), (181, 62), (181, 63), (181, 64), (181, 65), (181, 66), (181, 67), (181, 68), (181, 69), (181, 70), (181, 71), (181, 72), (181, 73), (181, 74), (181, 75), (181, 76), (181, 77), (181, 78), (181, 79), (181, 80), (181, 81), (181, 84), (181, 101), (181, 103), (181, 104), (181, 105), (181, 106), (181, 107), (181, 108),
(181, 109), (181, 110), (181, 111), (181, 112), (181, 113), (181, 114), (181, 115), (181, 116), (181, 117), (181, 118), (181, 119), (181, 120), (181, 121), (181, 122), (181, 123), (181, 124), (181, 125), (181, 127), (182, 51), (182, 53), (182, 54), (182, 55), (182, 56), (182, 57), (182, 58), (182, 59), (182, 60), (182, 61), (182, 62), (182, 63), (182, 64), (182, 65), (182, 66), (182, 67), (182, 68), (182, 69), (182, 70), (182, 71), (182, 72), (182, 73), (182, 74), (182, 75), (182, 76), (182, 77), (182, 78), (182, 79), (182, 82), (182, 100), (182, 102), (182, 103), (182, 104), (182, 105), (182, 106), (182, 107), (182, 108), (182, 109), (182, 110), (182, 111), (182, 112), (182, 113), (182, 114), (182, 115), (182, 116), (182, 117), (182, 118), (182, 119), (182, 120), (182, 121), (182, 122), (182, 123), (182, 124), (182, 125),
(182, 127), (183, 53), (183, 54), (183, 55), (183, 56), (183, 57), (183, 58), (183, 59), (183, 60), (183, 61), (183, 62), (183, 63), (183, 64), (183, 65), (183, 66), (183, 67), (183, 68), (183, 69), (183, 70), (183, 71), (183, 72), (183, 73), (183, 74), (183, 75), (183, 76), (183, 77), (183, 80), (183, 99), (183, 101), (183, 102), (183, 103), (183, 104), (183, 105), (183, 106), (183, 107), (183, 108), (183, 109), (183, 110), (183, 111), (183, 112), (183, 113), (183, 114), (183, 115), (183, 116), (183, 117), (183, 118), (183, 119), (183, 120), (183, 121), (183, 122), (183, 123), (183, 124), (183, 126), (184, 50), (184, 52), (184, 53), (184, 54), (184, 55), (184, 56), (184, 57), (184, 58), (184, 59), (184, 60), (184, 61), (184, 62), (184, 63), (184, 64), (184, 65), (184, 66), (184, 67), (184, 68), (184, 69),
(184, 70), (184, 71), (184, 72), (184, 73), (184, 74), (184, 75), (184, 76), (184, 79), (184, 97), (184, 100), (184, 101), (184, 102), (184, 103), (184, 104), (184, 105), (184, 106), (184, 107), (184, 108), (184, 109), (184, 110), (184, 111), (184, 112), (184, 113), (184, 114), (184, 115), (184, 116), (184, 117), (184, 118), (184, 119), (184, 120), (184, 121), (184, 122), (184, 123), (184, 125), (185, 49), (185, 51), (185, 52), (185, 53), (185, 54), (185, 55), (185, 56), (185, 57), (185, 58), (185, 59), (185, 60), (185, 61), (185, 62), (185, 63), (185, 64), (185, 65), (185, 66), (185, 67), (185, 68), (185, 69), (185, 70), (185, 71), (185, 72), (185, 73), (185, 74), (185, 77), (185, 94), (185, 95), (185, 96), (185, 99), (185, 100), (185, 101), (185, 102), (185, 103), (185, 104), (185, 105), (185, 106), (185, 107),
(185, 108), (185, 109), (185, 110), (185, 111), (185, 112), (185, 113), (185, 114), (185, 115), (185, 116), (185, 117), (185, 118), (185, 119), (185, 120), (185, 121), (185, 122), (185, 123), (185, 125), (186, 49), (186, 51), (186, 52), (186, 53), (186, 54), (186, 55), (186, 56), (186, 57), (186, 58), (186, 59), (186, 60), (186, 61), (186, 62), (186, 63), (186, 64), (186, 65), (186, 66), (186, 67), (186, 68), (186, 69), (186, 70), (186, 71), (186, 72), (186, 76), (186, 91), (186, 93), (186, 97), (186, 98), (186, 99), (186, 100), (186, 101), (186, 102), (186, 103), (186, 104), (186, 105), (186, 106), (186, 107), (186, 108), (186, 109), (186, 110), (186, 111), (186, 112), (186, 113), (186, 114), (186, 115), (186, 116), (186, 117), (186, 118), (186, 119), (187, 48), (187, 50), (187, 51), (187, 52), (187, 53), (187, 54),
(187, 55), (187, 56), (187, 57), (187, 58), (187, 59), (187, 60), (187, 61), (187, 62), (187, 63), (187, 64), (187, 65), (187, 66), (187, 67), (187, 68), (187, 69), (187, 70), (187, 71), (187, 74), (187, 88), (187, 89), (187, 90), (187, 94), (187, 95), (187, 96), (187, 97), (187, 98), (187, 99), (187, 100), (187, 101), (187, 102), (187, 103), (187, 104), (187, 105), (187, 106), (187, 107), (187, 108), (187, 109), (187, 110), (187, 111), (187, 112), (187, 113), (187, 114), (187, 115), (187, 116), (187, 117), (187, 118), (187, 121), (187, 122), (187, 124), (188, 48), (188, 50), (188, 51), (188, 52), (188, 53), (188, 54), (188, 55), (188, 56), (188, 57), (188, 58), (188, 59), (188, 60), (188, 61), (188, 62), (188, 63), (188, 64), (188, 65), (188, 66), (188, 67), (188, 68), (188, 69), (188, 72), (188, 85),
(188, 86), (188, 91), (188, 92), (188, 93), (188, 94), (188, 95), (188, 96), (188, 97), (188, 98), (188, 99), (188, 100), (188, 101), (188, 102), (188, 103), (188, 104), (188, 105), (188, 106), (188, 107), (188, 108), (188, 109), (188, 110), (188, 111), (188, 112), (188, 113), (188, 114), (188, 115), (188, 116), (188, 117), (188, 119), (189, 48), (189, 50), (189, 51), (189, 52), (189, 53), (189, 54), (189, 55), (189, 56), (189, 57), (189, 58), (189, 59), (189, 60), (189, 61), (189, 62), (189, 63), (189, 64), (189, 65), (189, 66), (189, 67), (189, 71), (189, 83), (189, 87), (189, 88), (189, 89), (189, 90), (189, 91), (189, 92), (189, 93), (189, 94), (189, 95), (189, 96), (189, 97), (189, 98), (189, 99), (189, 100), (189, 101), (189, 102), (189, 103), (189, 104), (189, 105), (189, 118), (190, 49), (190, 51),
(190, 52), (190, 53), (190, 54), (190, 55), (190, 56), (190, 57), (190, 58), (190, 59), (190, 60), (190, 61), (190, 62), (190, 63), (190, 64), (190, 65), (190, 66), (190, 69), (190, 81), (190, 85), (190, 86), (190, 87), (190, 88), (190, 89), (190, 90), (190, 91), (190, 92), (190, 93), (190, 94), (190, 95), (190, 96), (190, 106), (190, 107), (190, 108), (190, 109), (190, 110), (190, 111), (190, 112), (190, 113), (190, 114), (190, 115), (190, 116), (190, 118), (191, 49), (191, 51), (191, 52), (191, 53), (191, 54), (191, 55), (191, 56), (191, 57), (191, 58), (191, 59), (191, 60), (191, 61), (191, 62), (191, 63), (191, 64), (191, 67), (191, 80), (191, 83), (191, 84), (191, 85), (191, 86), (191, 97), (191, 98), (191, 99), (191, 100), (191, 101), (191, 102), (191, 103), (191, 104), (191, 105), (192, 49),
(192, 51), (192, 52), (192, 53), (192, 54), (192, 55), (192, 56), (192, 57), (192, 58), (192, 59), (192, 60), (192, 61), (192, 62), (192, 66), (192, 80), (192, 86), (192, 87), (192, 88), (192, 89), (192, 90), (192, 91), (192, 92), (192, 93), (192, 94), (192, 95), (192, 96), (193, 50), (193, 52), (193, 53), (193, 54), (193, 55), (193, 56), (193, 57), (193, 58), (193, 59), (193, 60), (193, 61), (193, 64), (193, 80), (193, 82), (193, 83), (193, 84), (193, 85), (193, 86), (194, 50), (194, 52), (194, 53), (194, 54), (194, 55), (194, 56), (194, 57), (194, 58), (194, 59), (194, 62), (195, 50), (195, 52), (195, 53), (195, 54), (195, 55), (195, 56), (195, 57), (195, 60), (196, 51), (196, 53), (196, 54), (196, 58), (196, 59), (197, 51), (197, 56), (197, 57), (198, 51), (198, 53), (198, 54),
(199, 51), (246, 54), (246, 57), (247, 54), (247, 58), (247, 59), (248, 54), (248, 56), (248, 57), (248, 61), (249, 54), (249, 56), (249, 57), (249, 58), (249, 59), (249, 63), (250, 53), (250, 55), (250, 56), (250, 57), (250, 58), (250, 59), (250, 60), (250, 61), (250, 62), (250, 65), (251, 53), (251, 55), (251, 56), (251, 57), (251, 58), (251, 59), (251, 60), (251, 61), (251, 62), (251, 63), (251, 67), (252, 53), (252, 55), (252, 56), (252, 57), (252, 58), (252, 59), (252, 60), (252, 61), (252, 62), (252, 63), (252, 64), (252, 65), (252, 68), (252, 69), (252, 84), (252, 86), (252, 87), (252, 88), (252, 89), (252, 90), (252, 91), (252, 92), (252, 93), (252, 94), (252, 95), (252, 96), (252, 97), (252, 98), (252, 99), (252, 100), (252, 101), (252, 102), (252, 103), (252, 104), (252, 105),
(252, 106), (252, 107), (252, 108), (252, 109), (252, 110), (252, 111), (252, 112), (252, 113), (252, 114), (252, 115), (252, 116), (252, 118), (253, 52), (253, 54), (253, 55), (253, 56), (253, 57), (253, 58), (253, 59), (253, 60), (253, 61), (253, 62), (253, 63), (253, 64), (253, 65), (253, 66), (253, 67), (253, 70), (253, 86), (253, 119), (254, 52), (254, 59), (254, 60), (254, 61), (254, 62), (254, 63), (254, 64), (254, 65), (254, 66), (254, 67), (254, 68), (254, 69), (254, 72), (254, 88), (254, 91), (254, 92), (254, 93), (254, 94), (254, 95), (254, 96), (254, 97), (254, 98), (254, 99), (254, 100), (254, 101), (254, 102), (254, 103), (254, 104), (254, 105), (254, 106), (254, 107), (254, 108), (254, 109), (254, 110), (254, 111), (254, 112), (254, 113), (254, 114), (254, 115), (254, 116), (254, 117), (254, 118),
(254, 121), (255, 52), (255, 54), (255, 55), (255, 56), (255, 57), (255, 60), (255, 61), (255, 62), (255, 63), (255, 64), (255, 65), (255, 66), (255, 67), (255, 68), (255, 69), (255, 70), (255, 73), (255, 89), (255, 93), (255, 94), (255, 95), (255, 96), (255, 97), (255, 98), (255, 99), (255, 100), (255, 101), (255, 102), (255, 103), (255, 104), (255, 105), (255, 106), (255, 107), (255, 108), (255, 109), (255, 110), (255, 111), (255, 112), (255, 113), (255, 114), (255, 115), (255, 116), (255, 117), (255, 118), (255, 119), (255, 121), (256, 51), (256, 59), (256, 62), (256, 63), (256, 64), (256, 65), (256, 66), (256, 67), (256, 68), (256, 69), (256, 70), (256, 71), (256, 72), (256, 75), (256, 91), (256, 95), (256, 96), (256, 97), (256, 98), (256, 99), (256, 100), (256, 101), (256, 102), (256, 103), (256, 104),
(256, 105), (256, 106), (256, 107), (256, 108), (256, 109), (256, 110), (256, 111), (256, 112), (256, 113), (256, 114), (256, 115), (256, 116), (256, 117), (256, 118), (256, 119), (256, 120), (256, 122), (257, 60), (257, 63), (257, 64), (257, 65), (257, 66), (257, 67), (257, 68), (257, 69), (257, 70), (257, 71), (257, 72), (257, 73), (257, 76), (257, 93), (257, 97), (257, 98), (257, 99), (257, 100), (257, 101), (257, 102), (257, 103), (257, 104), (257, 105), (257, 106), (257, 107), (257, 108), (257, 109), (257, 110), (257, 111), (257, 112), (257, 113), (257, 114), (257, 115), (257, 116), (257, 117), (257, 118), (257, 119), (257, 120), (257, 122), (258, 62), (258, 64), (258, 65), (258, 66), (258, 67), (258, 68), (258, 69), (258, 70), (258, 71), (258, 72), (258, 73), (258, 74), (258, 75), (258, 78), (258, 95), (258, 99),
(258, 100), (258, 101), (258, 102), (258, 103), (258, 104), (258, 105), (258, 106), (258, 107), (258, 108), (258, 109), (258, 110), (258, 111), (258, 112), (258, 113), (258, 114), (258, 115), (258, 116), (258, 117), (258, 118), (258, 119), (258, 120), (258, 121), (258, 123), (259, 63), (259, 65), (259, 66), (259, 67), (259, 68), (259, 69), (259, 70), (259, 71), (259, 72), (259, 73), (259, 74), (259, 75), (259, 76), (259, 79), (259, 97), (259, 101), (259, 102), (259, 103), (259, 104), (259, 105), (259, 106), (259, 107), (259, 108), (259, 109), (259, 110), (259, 111), (259, 112), (259, 113), (259, 114), (259, 115), (259, 116), (259, 117), (259, 118), (259, 119), (259, 120), (259, 121), (259, 122), (259, 123), (260, 64), (260, 67), (260, 68), (260, 69), (260, 70), (260, 71), (260, 72), (260, 73), (260, 74), (260, 75), (260, 76),
(260, 77), (260, 78), (260, 81), (260, 99), (260, 103), (260, 104), (260, 105), (260, 106), (260, 107), (260, 108), (260, 109), (260, 110), (260, 111), (260, 112), (260, 113), (260, 114), (260, 115), (260, 116), (260, 117), (260, 118), (260, 119), (260, 120), (260, 121), (260, 122), (260, 124), (261, 65), (261, 68), (261, 69), (261, 70), (261, 71), (261, 72), (261, 73), (261, 74), (261, 75), (261, 76), (261, 77), (261, 78), (261, 79), (261, 82), (261, 101), (261, 104), (261, 105), (261, 106), (261, 107), (261, 108), (261, 109), (261, 110), (261, 111), (261, 112), (261, 113), (261, 114), (261, 115), (261, 116), (261, 117), (261, 118), (261, 119), (261, 120), (261, 121), (261, 122), (261, 123), (261, 125), (262, 67), (262, 69), (262, 70), (262, 71), (262, 72), (262, 73), (262, 74), (262, 75), (262, 76), (262, 77), (262, 78),
(262, 79), (262, 80), (262, 81), (262, 83), (262, 103), (262, 106), (262, 107), (262, 108), (262, 109), (262, 110), (262, 111), (262, 112), (262, 113), (262, 114), (262, 115), (262, 116), (262, 117), (262, 118), (262, 119), (262, 120), (262, 121), (262, 122), (262, 123), (262, 124), (262, 126), (263, 68), (263, 70), (263, 71), (263, 72), (263, 73), (263, 74), (263, 75), (263, 76), (263, 77), (263, 78), (263, 79), (263, 80), (263, 81), (263, 82), (263, 85), (263, 105), (263, 108), (263, 109), (263, 110), (263, 111), (263, 112), (263, 113), (263, 114), (263, 115), (263, 116), (263, 117), (263, 118), (263, 119), (263, 120), (263, 121), (263, 122), (263, 123), (263, 124), (263, 126), (264, 69), (264, 72), (264, 73), (264, 74), (264, 75), (264, 76), (264, 77), (264, 78), (264, 79), (264, 80), (264, 81), (264, 82), (264, 83),
(264, 86), (264, 106), (264, 107), (264, 110), (264, 111), (264, 112), (264, 113), (264, 114), (264, 115), (264, 116), (264, 117), (264, 118), (264, 119), (264, 120), (264, 121), (264, 122), (264, 123), (264, 124), (264, 125), (264, 127), (265, 70), (265, 73), (265, 74), (265, 75), (265, 76), (265, 77), (265, 78), (265, 79), (265, 80), (265, 81), (265, 82), (265, 83), (265, 84), (265, 85), (265, 88), (265, 108), (265, 110), (265, 111), (265, 112), (265, 113), (265, 114), (265, 115), (265, 116), (265, 117), (265, 118), (265, 119), (265, 120), (265, 121), (265, 122), (265, 123), (265, 124), (265, 125), (265, 126), (265, 128), (266, 71), (266, 74), (266, 75), (266, 76), (266, 77), (266, 78), (266, 79), (266, 80), (266, 81), (266, 82), (266, 83), (266, 84), (266, 85), (266, 86), (266, 89), (266, 110), (266, 112), (266, 113),
(266, 114), (266, 115), (266, 116), (266, 117), (266, 118), (266, 119), (266, 120), (266, 121), (266, 122), (266, 123), (266, 124), (266, 125), (266, 126), (266, 127), (266, 129), (267, 73), (267, 75), (267, 76), (267, 77), (267, 78), (267, 79), (267, 80), (267, 81), (267, 82), (267, 83), (267, 84), (267, 85), (267, 86), (267, 87), (267, 88), (267, 91), (267, 110), (267, 112), (267, 113), (267, 114), (267, 115), (267, 116), (267, 117), (267, 118), (267, 119), (267, 120), (267, 121), (267, 122), (267, 123), (267, 124), (267, 125), (267, 126), (267, 127), (267, 128), (267, 130), (268, 74), (268, 76), (268, 77), (268, 78), (268, 79), (268, 80), (268, 81), (268, 82), (268, 83), (268, 84), (268, 85), (268, 86), (268, 87), (268, 88), (268, 89), (268, 93), (268, 107), (268, 108), (268, 109), (268, 110), (268, 111), (268, 112),
(268, 113), (268, 114), (268, 115), (268, 116), (268, 117), (268, 118), (268, 119), (268, 120), (268, 121), (268, 122), (268, 123), (268, 124), (268, 125), (268, 126), (268, 127), (268, 128), (268, 130), (269, 75), (269, 78), (269, 79), (269, 80), (269, 81), (269, 82), (269, 83), (269, 84), (269, 85), (269, 86), (269, 87), (269, 88), (269, 89), (269, 90), (269, 91), (269, 94), (269, 97), (269, 98), (269, 99), (269, 100), (269, 101), (269, 102), (269, 103), (269, 104), (269, 105), (269, 106), (269, 110), (269, 111), (269, 112), (269, 113), (269, 114), (269, 115), (269, 116), (269, 117), (269, 118), (269, 119), (269, 120), (269, 121), (269, 122), (269, 123), (269, 124), (269, 125), (269, 126), (269, 127), (269, 128), (269, 129), (269, 131), (270, 76), (270, 79), (270, 80), (270, 81), (270, 82), (270, 83), (270, 84), (270, 85),
(270, 86), (270, 87), (270, 88), (270, 89), (270, 90), (270, 91), (270, 92), (270, 93), (270, 96), (270, 106), (270, 107), (270, 108), (270, 109), (270, 110), (270, 111), (270, 112), (270, 113), (270, 114), (270, 115), (270, 116), (270, 117), (270, 118), (270, 119), (270, 120), (270, 121), (270, 122), (270, 123), (270, 124), (270, 125), (270, 126), (270, 127), (270, 128), (270, 129), (270, 130), (270, 132), (271, 77), (271, 80), (271, 81), (271, 82), (271, 83), (271, 84), (271, 85), (271, 86), (271, 87), (271, 88), (271, 89), (271, 90), (271, 91), (271, 92), (271, 93), (271, 94), (271, 95), (271, 97), (271, 98), (271, 99), (271, 100), (271, 101), (271, 102), (271, 103), (271, 104), (271, 105), (271, 106), (271, 107), (271, 108), (271, 109), (271, 110), (271, 111), (271, 112), (271, 113), (271, 114), (271, 115), (271, 116),
(271, 117), (271, 118), (271, 119), (271, 120), (271, 121), (271, 122), (271, 123), (271, 124), (271, 125), (271, 126), (271, 127), (271, 128), (271, 129), (271, 130), (271, 131), (271, 133), (272, 79), (272, 81), (272, 82), (272, 83), (272, 84), (272, 85), (272, 86), (272, 87), (272, 88), (272, 89), (272, 90), (272, 91), (272, 92), (272, 93), (272, 94), (272, 95), (272, 96), (272, 97), (272, 98), (272, 99), (272, 100), (272, 101), (272, 102), (272, 103), (272, 104), (272, 105), (272, 106), (272, 107), (272, 108), (272, 109), (272, 110), (272, 111), (272, 112), (272, 113), (272, 114), (272, 115), (272, 116), (272, 117), (272, 118), (272, 119), (272, 120), (272, 121), (272, 122), (272, 123), (272, 124), (272, 125), (272, 126), (272, 127), (272, 128), (272, 129), (272, 130), (272, 131), (272, 132), (272, 134), (273, 80), (273, 82),
(273, 83), (273, 84), (273, 85), (273, 86), (273, 87), (273, 88), (273, 89), (273, 90), (273, 91), (273, 92), (273, 93), (273, 94), (273, 95), (273, 96), (273, 97), (273, 98), (273, 99), (273, 100), (273, 101), (273, 102), (273, 103), (273, 104), (273, 105), (273, 106), (273, 107), (273, 108), (273, 109), (273, 110), (273, 111), (273, 112), (273, 113), (273, 114), (273, 115), (273, 116), (273, 117), (273, 118), (273, 119), (273, 120), (273, 121), (273, 122), (273, 123), (273, 124), (273, 125), (273, 126), (273, 127), (273, 128), (273, 129), (273, 130), (273, 131), (273, 132), (273, 133), (273, 135), (274, 81), (274, 83), (274, 84), (274, 85), (274, 86), (274, 87), (274, 88), (274, 89), (274, 90), (274, 91), (274, 92), (274, 93), (274, 94), (274, 95), (274, 96), (274, 97), (274, 98), (274, 99), (274, 100), (274, 101),
(274, 102), (274, 103), (274, 104), (274, 105), (274, 106), (274, 107), (274, 108), (274, 109), (274, 110), (274, 111), (274, 112), (274, 113), (274, 114), (274, 115), (274, 116), (274, 117), (274, 118), (274, 119), (274, 120), (274, 121), (274, 122), (274, 123), (274, 124), (274, 125), (274, 126), (274, 127), (274, 128), (274, 129), (274, 130), (274, 131), (274, 132), (274, 133), (274, 136), (275, 82), (275, 85), (275, 86), (275, 87), (275, 88), (275, 89), (275, 90), (275, 91), (275, 92), (275, 93), (275, 94), (275, 95), (275, 96), (275, 97), (275, 98), (275, 99), (275, 100), (275, 101), (275, 102), (275, 103), (275, 104), (275, 105), (275, 106), (275, 107), (275, 108), (275, 109), (275, 110), (275, 111), (275, 112), (275, 113), (275, 114), (275, 115), (275, 116), (275, 117), (275, 118), (275, 119), (275, 120), (275, 121), (275, 122),
(275, 123), (275, 124), (275, 125), (275, 126), (275, 127), (275, 128), (275, 129), (275, 130), (275, 131), (275, 132), (275, 133), (275, 134), (276, 83), (276, 86), (276, 87), (276, 88), (276, 89), (276, 90), (276, 91), (276, 92), (276, 93), (276, 94), (276, 95), (276, 96), (276, 97), (276, 98), (276, 99), (276, 100), (276, 101), (276, 102), (276, 103), (276, 104), (276, 105), (276, 106), (276, 107), (276, 108), (276, 109), (276, 110), (276, 111), (276, 112), (276, 113), (276, 114), (276, 115), (276, 116), (276, 117), (276, 118), (276, 119), (276, 120), (276, 121), (276, 122), (276, 123), (276, 124), (276, 125), (276, 126), (276, 127), (276, 128), (276, 129), (276, 130), (276, 131), (276, 132), (276, 133), (276, 134), (276, 135), (276, 137), (277, 84), (277, 87), (277, 88), (277, 89), (277, 90), (277, 91), (277, 92), (277, 93),
(277, 94), (277, 95), (277, 96), (277, 97), (277, 98), (277, 99), (277, 100), (277, 101), (277, 102), (277, 103), (277, 104), (277, 105), (277, 106), (277, 107), (277, 108), (277, 109), (277, 110), (277, 111), (277, 112), (277, 113), (277, 114), (277, 115), (277, 116), (277, 117), (277, 118), (277, 119), (277, 120), (277, 121), (277, 122), (277, 123), (277, 124), (277, 125), (277, 126), (277, 127), (277, 128), (277, 129), (277, 130), (277, 131), (277, 132), (277, 133), (277, 134), (277, 135), (277, 136), (277, 138), (278, 86), (278, 88), (278, 89), (278, 90), (278, 91), (278, 92), (278, 93), (278, 94), (278, 95), (278, 96), (278, 97), (278, 98), (278, 99), (278, 100), (278, 101), (278, 102), (278, 103), (278, 104), (278, 105), (278, 106), (278, 107), (278, 108), (278, 109), (278, 110), (278, 111), (278, 112), (278, 113), (278, 114),
(278, 115), (278, 116), (278, 117), (278, 118), (278, 119), (278, 120), (278, 121), (278, 122), (278, 123), (278, 124), (278, 125), (278, 126), (278, 127), (278, 128), (278, 129), (278, 130), (278, 131), (278, 132), (278, 133), (278, 134), (278, 135), (278, 136), (278, 137), (278, 139), (279, 87), (279, 89), (279, 90), (279, 91), (279, 92), (279, 93), (279, 94), (279, 95), (279, 96), (279, 97), (279, 98), (279, 99), (279, 100), (279, 101), (279, 102), (279, 103), (279, 104), (279, 105), (279, 106), (279, 107), (279, 108), (279, 109), (279, 110), (279, 111), (279, 112), (279, 113), (279, 114), (279, 115), (279, 116), (279, 117), (279, 118), (279, 119), (279, 120), (279, 121), (279, 122), (279, 123), (279, 124), (279, 125), (279, 126), (279, 127), (279, 128), (279, 129), (279, 130), (279, 131), (279, 132), (279, 133), (279, 134), (279, 135),
(279, 136), (279, 137), (279, 138), (279, 140), (280, 88), (280, 90), (280, 91), (280, 92), (280, 93), (280, 94), (280, 95), (280, 96), (280, 97), (280, 98), (280, 99), (280, 100), (280, 101), (280, 102), (280, 103), (280, 104), (280, 105), (280, 106), (280, 107), (280, 108), (280, 109), (280, 110), (280, 111), (280, 112), (280, 113), (280, 114), (280, 115), (280, 116), (280, 117), (280, 118), (280, 119), (280, 120), (280, 121), (280, 122), (280, 123), (280, 124), (280, 125), (280, 126), (280, 127), (280, 128), (280, 129), (280, 130), (280, 131), (280, 132), (280, 133), (280, 134), (280, 135), (280, 136), (280, 137), (280, 138), (280, 139), (280, 141), (281, 89), (281, 92), (281, 93), (281, 94), (281, 95), (281, 96), (281, 97), (281, 98), (281, 99), (281, 100), (281, 101), (281, 102), (281, 103), (281, 104), (281, 105), (281, 106),
(281, 107), (281, 108), (281, 109), (281, 110), (281, 111), (281, 112), (281, 113), (281, 114), (281, 115), (281, 116), (281, 117), (281, 118), (281, 119), (281, 120), (281, 121), (281, 122), (281, 123), (281, 124), (281, 125), (281, 126), (281, 127), (281, 128), (281, 129), (281, 130), (281, 131), (281, 132), (281, 133), (281, 134), (281, 135), (281, 136), (281, 137), (281, 138), (281, 139), (281, 140), (281, 142), (282, 90), (282, 93), (282, 94), (282, 95), (282, 96), (282, 97), (282, 98), (282, 99), (282, 100), (282, 101), (282, 102), (282, 103), (282, 104), (282, 105), (282, 106), (282, 107), (282, 108), (282, 109), (282, 110), (282, 111), (282, 112), (282, 113), (282, 114), (282, 115), (282, 116), (282, 117), (282, 118), (282, 119), (282, 120), (282, 121), (282, 122), (282, 123), (282, 124), (282, 125), (282, 126), (282, 127), (282, 128),
(282, 129), (282, 130), (282, 131), (282, 132), (282, 133), (282, 134), (282, 135), (282, 136), (282, 137), (282, 138), (282, 139), (282, 140), (282, 141), (282, 143), (283, 91), (283, 94), (283, 95), (283, 96), (283, 97), (283, 98), (283, 99), (283, 100), (283, 101), (283, 102), (283, 103), (283, 104), (283, 105), (283, 106), (283, 107), (283, 108), (283, 109), (283, 110), (283, 111), (283, 112), (283, 113), (283, 114), (283, 115), (283, 116), (283, 117), (283, 118), (283, 119), (283, 120), (283, 121), (283, 122), (283, 123), (283, 124), (283, 125), (283, 126), (283, 127), (283, 128), (283, 129), (283, 130), (283, 131), (283, 132), (283, 133), (283, 134), (283, 135), (283, 136), (283, 137), (283, 138), (283, 139), (283, 140), (283, 141), (283, 142), (283, 145), (284, 95), (284, 96), (284, 97), (284, 98), (284, 99), (284, 100), (284, 101),
(284, 102), (284, 103), (284, 104), (284, 105), (284, 106), (284, 107), (284, 108), (284, 109), (284, 110), (284, 111), (284, 112), (284, 113), (284, 114), (284, 115), (284, 116), (284, 117), (284, 118), (284, 119), (284, 120), (284, 121), (284, 122), (284, 123), (284, 124), (284, 125), (284, 126), (284, 127), (284, 128), (284, 129), (284, 130), (284, 131), (284, 132), (284, 133), (284, 134), (284, 135), (284, 136), (284, 137), (284, 138), (284, 139), (284, 140), (284, 141), (284, 142), (284, 143), (284, 146), (285, 94), (285, 96), (285, 97), (285, 98), (285, 99), (285, 100), (285, 101), (285, 102), (285, 103), (285, 104), (285, 105), (285, 106), (285, 107), (285, 108), (285, 109), (285, 110), (285, 111), (285, 112), (285, 113), (285, 114), (285, 115), (285, 116), (285, 117), (285, 118), (285, 119), (285, 120), (285, 121), (285, 122), (285, 123),
(285, 124), (285, 125), (285, 126), (285, 127), (285, 128), (285, 129), (285, 130), (285, 131), (285, 132), (285, 133), (285, 134), (285, 135), (285, 136), (285, 137), (285, 138), (285, 139), (285, 140), (285, 141), (285, 142), (285, 143), (285, 144), (285, 146), (286, 95), (286, 97), (286, 98), (286, 99), (286, 100), (286, 101), (286, 102), (286, 103), (286, 104), (286, 105), (286, 106), (286, 107), (286, 108), (286, 109), (286, 110), (286, 111), (286, 112), (286, 113), (286, 114), (286, 115), (286, 116), (286, 117), (286, 118), (286, 119), (286, 120), (286, 121), (286, 122), (286, 123), (286, 124), (286, 125), (286, 126), (286, 127), (286, 128), (286, 129), (286, 130), (286, 131), (286, 132), (286, 133), (286, 134), (286, 135), (286, 136), (286, 137), (286, 138), (286, 139), (286, 140), (286, 141), (286, 142), (286, 143), (286, 145), (287, 96),
(287, 98), (287, 99), (287, 100), (287, 101), (287, 102), (287, 103), (287, 104), (287, 105), (287, 106), (287, 107), (287, 108), (287, 109), (287, 110), (287, 111), (287, 112), (287, 113), (287, 114), (287, 115), (287, 116), (287, 117), (287, 118), (287, 119), (287, 120), (287, 121), (287, 122), (287, 123), (287, 124), (287, 125), (287, 126), (287, 127), (287, 128), (287, 129), (287, 130), (287, 131), (287, 132), (287, 133), (287, 134), (287, 135), (287, 136), (287, 137), (287, 138), (287, 139), (287, 140), (287, 141), (287, 142), (287, 143), (287, 145), (288, 97), (288, 99), (288, 100), (288, 101), (288, 102), (288, 103), (288, 104), (288, 105), (288, 106), (288, 107), (288, 108), (288, 109), (288, 110), (288, 111), (288, 112), (288, 113), (288, 114), (288, 115), (288, 116), (288, 117), (288, 118), (288, 119), (288, 120), (288, 121), (288, 122),
(288, 123), (288, 124), (288, 125), (288, 126), (288, 127), (288, 128), (288, 129), (288, 130), (288, 131), (288, 132), (288, 133), (288, 134), (288, 135), (288, 136), (288, 137), (288, 138), (288, 139), (288, 140), (288, 141), (288, 142), (288, 144), (289, 98), (289, 100), (289, 101), (289, 102), (289, 103), (289, 104), (289, 105), (289, 106), (289, 107), (289, 108), (289, 109), (289, 110), (289, 111), (289, 112), (289, 113), (289, 114), (289, 115), (289, 116), (289, 117), (289, 118), (289, 119), (289, 120), (289, 121), (289, 122), (289, 123), (289, 124), (289, 125), (289, 126), (289, 127), (289, 128), (289, 129), (289, 130), (289, 131), (289, 132), (289, 133), (289, 134), (289, 135), (289, 136), (289, 137), (289, 138), (289, 139), (289, 140), (289, 141), (290, 99), (290, 102), (290, 103), (290, 104), (290, 105), (290, 106), (290, 107), (290, 108),
(290, 109), (290, 110), (290, 111), (290, 112), (290, 113), (290, 114), (290, 115), (290, 116), (290, 117), (290, 118), (290, 119), (290, 120), (290, 121), (290, 122), (290, 123), (290, 124), (290, 125), (290, 126), (290, 127), (290, 128), (290, 129), (290, 130), (290, 131), (290, 132), (290, 133), (290, 134), (290, 135), (290, 136), (290, 137), (290, 138), (290, 139), (290, 140), (290, 143), (291, 100), (291, 103), (291, 104), (291, 105), (291, 106), (291, 107), (291, 108), (291, 109), (291, 110), (291, 111), (291, 112), (291, 113), (291, 114), (291, 115), (291, 116), (291, 117), (291, 118), (291, 119), (291, 120), (291, 121), (291, 122), (291, 123), (291, 124), (291, 125), (291, 126), (291, 127), (291, 128), (291, 129), (291, 130), (291, 131), (291, 132), (291, 133), (291, 134), (291, 135), (291, 136), (291, 137), (291, 138), (291, 139), (291, 141),
(292, 102), (292, 104), (292, 105), (292, 106), (292, 107), (292, 108), (292, 109), (292, 110), (292, 111), (292, 112), (292, 113), (292, 114), (292, 115), (292, 116), (292, 117), (292, 118), (292, 119), (292, 120), (292, 121), (292, 122), (292, 123), (292, 124), (292, 125), (292, 126), (292, 127), (292, 128), (292, 129), (292, 130), (292, 131), (292, 132), (292, 133), (292, 134), (292, 135), (292, 136), (292, 137), (292, 140), (293, 103), (293, 105), (293, 106), (293, 107), (293, 108), (293, 109), (293, 110), (293, 111), (293, 112), (293, 113), (293, 114), (293, 115), (293, 116), (293, 117), (293, 118), (293, 119), (293, 120), (293, 121), (293, 122), (293, 123), (293, 124), (293, 125), (293, 126), (293, 127), (293, 128), (293, 129), (293, 130), (293, 131), (293, 132), (293, 133), (293, 134), (293, 135), (293, 138), (293, 139), (294, 104), (294, 107),
(294, 108), (294, 109), (294, 110), (294, 111), (294, 112), (294, 113), (294, 114), (294, 115), (294, 116), (294, 117), (294, 118), (294, 119), (294, 120), (294, 121), (294, 122), (294, 123), (294, 124), (294, 125), (294, 126), (294, 127), (294, 128), (294, 129), (294, 130), (294, 131), (294, 132), (294, 133), (294, 137), (295, 105), (295, 108), (295, 109), (295, 110), (295, 111), (295, 112), (295, 113), (295, 114), (295, 115), (295, 116), (295, 117), (295, 118), (295, 119), (295, 120), (295, 121), (295, 122), (295, 123), (295, 124), (295, 125), (295, 126), (295, 127), (295, 128), (295, 129), (295, 130), (295, 135), (296, 106), (296, 109), (296, 110), (296, 111), (296, 112), (296, 113), (296, 114), (296, 115), (296, 116), (296, 117), (296, 118), (296, 119), (296, 120), (296, 121), (296, 122), (296, 123), (296, 124), (296, 125), (296, 126), (296, 131),
(296, 132), (297, 108), (297, 113), (297, 114), (297, 115), (297, 116), (297, 117), (297, 118), (297, 119), (297, 120), (297, 121), (297, 127), (297, 128), (297, 129), (297, 130), (298, 109), (298, 111), (298, 112), (298, 122), (298, 123), (298, 124), (298, 125), (298, 126), (299, 113), (299, 114), (299, 115), (299, 116), (299, 117), (299, 118), (299, 119), (299, 120), (299, 121), )
coordinates_993300 = ((222, 20),
(222, 22), (222, 23), (222, 24), (222, 25), (222, 26), (222, 27), (222, 28), (222, 29), (222, 30), (222, 31), (222, 32), (222, 33), (222, 34), (222, 35), (222, 36), (222, 37), (222, 38), (222, 39), (222, 40), (222, 41), (222, 42), (222, 43), (222, 44), (222, 45), (222, 46), (222, 47), (222, 48), (222, 49), (222, 50), (222, 51), (222, 52), (222, 53), (222, 55), (222, 73), (222, 75), (222, 76), (222, 77), (222, 78), (222, 79), (222, 80), (222, 81), (222, 82), (222, 83), (222, 84), (222, 85), (222, 86), (222, 87), (222, 88), (222, 89), (222, 90), (222, 91), (222, 92), (222, 93), (222, 94), (222, 95), (222, 96), (222, 97), (222, 98), (222, 99), (222, 100), (222, 101), (222, 102), (222, 103), (222, 104), (222, 105), (222, 106), (222, 107), (222, 108), (222, 109), (222, 110), (222, 111), (222, 112),
(222, 113), (222, 114), (222, 115), (222, 116), (222, 117), (222, 118), (222, 119), (222, 120), (222, 121), (222, 122), (222, 123), (222, 124), (222, 125), (222, 126), (222, 127), (222, 128), (222, 129), (222, 130), (222, 131), (222, 132), (222, 133), (222, 134), (222, 135), (222, 136), (222, 137), (222, 138), (222, 139), (222, 140), (222, 141), (222, 142), (222, 143), (222, 144), (222, 145), (222, 146), (222, 147), (222, 148), (222, 149), (222, 150), (222, 151), (222, 152), (222, 153), (222, 154), (222, 155), (222, 156), (222, 158), (223, 20), (223, 22), (223, 23), (223, 24), (223, 25), (223, 26), (223, 27), (223, 28), (223, 29), (223, 30), (223, 31), (223, 32), (223, 33), (223, 34), (223, 35), (223, 36), (223, 37), (223, 38), (223, 39), (223, 40), (223, 41), (223, 42), (223, 43), (223, 44), (223, 45), (223, 46), (223, 47),
(223, 48), (223, 49), (223, 50), (223, 51), (223, 52), (223, 53), (223, 55), (223, 73), (223, 75), (223, 76), (223, 77), (223, 78), (223, 79), (223, 80), (223, 81), (223, 82), (223, 83), (223, 84), (223, 85), (223, 86), (223, 87), (223, 88), (223, 89), (223, 90), (223, 91), (223, 92), (223, 93), (223, 94), (223, 95), (223, 96), (223, 97), (223, 98), (223, 99), (223, 100), (223, 101), (223, 102), (223, 103), (223, 104), (223, 105), (223, 106), (223, 107), (223, 108), (223, 109), (223, 110), (223, 111), (223, 112), (223, 113), (223, 114), (223, 115), (223, 116), (223, 117), (223, 118), (223, 119), (223, 120), (223, 121), (223, 122), (223, 123), (223, 124), (223, 125), (223, 126), (223, 127), (223, 128), (223, 129), (223, 130), (223, 131), (223, 132), (223, 133), (223, 134), (223, 135), (223, 136), (223, 137), (223, 138),
(223, 139), (223, 140), (223, 141), (223, 142), (223, 143), (223, 144), (223, 145), (223, 146), (223, 147), (223, 148), (223, 149), (223, 150), (223, 151), (223, 152), (223, 153), (223, 154), (223, 155), (223, 156), (223, 158), )
coordinates_FFFF7F = ((192, 109),
(192, 110), (192, 111), (192, 112), (192, 113), (192, 114), (192, 115), (192, 116), (192, 117), (192, 118), (192, 119), (192, 120), (192, 121), (193, 99), (193, 100), (193, 101), (193, 102), (193, 103), (193, 104), (193, 105), (193, 106), (193, 107), (193, 108), (193, 122), (193, 123), (193, 124), (193, 125), (194, 90), (194, 91), (194, 92), (194, 93), (194, 94), (194, 95), (194, 96), (194, 97), (194, 98), (194, 99), (194, 109), (194, 110), (194, 111), (194, 112), (194, 113), (194, 114), (194, 115), (194, 116), (194, 117), (194, 118), (194, 119), (194, 120), (194, 121), (194, 126), (194, 128), (195, 80), (195, 82), (195, 83), (195, 84), (195, 85), (195, 86), (195, 87), (195, 88), (195, 89), (195, 99), (195, 100), (195, 101), (195, 102), (195, 103), (195, 104), (195, 105), (195, 106), (195, 107), (195, 108), (195, 109), (195, 110),
(195, 111), (195, 112), (195, 113), (195, 114), (195, 115), (195, 116), (195, 117), (195, 118), (195, 119), (195, 120), (195, 121), (195, 122), (195, 123), (195, 124), (195, 125), (195, 129), (195, 130), (195, 131), (196, 80), (196, 90), (196, 91), (196, 92), (196, 93), (196, 94), (196, 95), (196, 96), (196, 97), (196, 98), (196, 99), (196, 100), (196, 101), (196, 102), (196, 103), (196, 104), (196, 105), (196, 106), (196, 107), (196, 108), (196, 109), (196, 110), (196, 111), (196, 112), (196, 113), (196, 114), (196, 115), (196, 116), (196, 117), (196, 118), (196, 119), (196, 120), (196, 121), (196, 122), (196, 123), (196, 124), (196, 125), (196, 126), (196, 127), (196, 128), (196, 132), (196, 133), (196, 134), (197, 80), (197, 82), (197, 83), (197, 84), (197, 85), (197, 86), (197, 87), (197, 88), (197, 89), (197, 90), (197, 91),
(197, 92), (197, 93), (197, 94), (197, 95), (197, 96), (197, 97), (197, 98), (197, 99), (197, 100), (197, 101), (197, 102), (197, 103), (197, 104), (197, 105), (197, 106), (197, 107), (197, 108), (197, 109), (197, 110), (197, 111), (197, 112), (197, 113), (197, 114), (197, 115), (197, 116), (197, 117), (197, 118), (197, 119), (197, 120), (197, 121), (197, 122), (197, 123), (197, 124), (197, 125), (197, 126), (197, 127), (197, 128), (197, 129), (197, 130), (197, 131), (197, 136), (197, 137), (198, 81), (198, 84), (198, 85), (198, 86), (198, 87), (198, 88), (198, 89), (198, 90), (198, 91), (198, 92), (198, 93), (198, 94), (198, 95), (198, 96), (198, 97), (198, 98), (198, 99), (198, 100), (198, 101), (198, 102), (198, 103), (198, 104), (198, 105), (198, 106), (198, 107), (198, 108), (198, 109), (198, 110), (198, 111), (198, 112),
(198, 113), (198, 114), (198, 115), (198, 116), (198, 117), (198, 118), (198, 119), (198, 120), (198, 121), (198, 122), (198, 123), (198, 124), (198, 125), (198, 126), (198, 127), (198, 128), (198, 129), (198, 130), (198, 131), (198, 132), (198, 133), (198, 134), (198, 135), (198, 139), (198, 140), (199, 82), (199, 86), (199, 87), (199, 88), (199, 89), (199, 90), (199, 91), (199, 92), (199, 93), (199, 94), (199, 95), (199, 96), (199, 97), (199, 98), (199, 99), (199, 100), (199, 101), (199, 102), (199, 103), (199, 104), (199, 105), (199, 106), (199, 107), (199, 108), (199, 109), (199, 110), (199, 111), (199, 112), (199, 113), (199, 114), (199, 115), (199, 116), (199, 117), (199, 118), (199, 119), (199, 120), (199, 121), (199, 122), (199, 123), (199, 124), (199, 125), (199, 126), (199, 127), (199, 128), (199, 129), (199, 130), (199, 131),
(199, 132), (199, 133), (199, 134), (199, 135), (199, 136), (199, 137), (199, 138), (199, 143), (200, 84), (200, 91), (200, 92), (200, 93), (200, 94), (200, 95), (200, 96), (200, 97), (200, 98), (200, 99), (200, 100), (200, 101), (200, 102), (200, 103), (200, 104), (200, 105), (200, 106), (200, 107), (200, 108), (200, 109), (200, 110), (200, 111), (200, 112), (200, 113), (200, 114), (200, 115), (200, 116), (200, 117), (200, 118), (200, 119), (200, 120), (200, 121), (200, 122), (200, 123), (200, 124), (200, 125), (200, 126), (200, 127), (200, 128), (200, 129), (200, 130), (200, 131), (200, 132), (200, 133), (200, 134), (200, 135), (200, 136), (200, 137), (200, 138), (200, 139), (200, 140), (200, 144), (200, 145), (200, 146), (201, 87), (201, 88), (201, 89), (201, 90), (201, 99), (201, 100), (201, 101), (201, 102), (201, 103), (201, 104),
(201, 105), (201, 106), (201, 107), (201, 108), (201, 109), (201, 110), (201, 111), (201, 112), (201, 113), (201, 114), (201, 115), (201, 116), (201, 117), (201, 118), (201, 119), (201, 120), (201, 121), (201, 122), (201, 123), (201, 124), (201, 125), (201, 126), (201, 127), (201, 128), (201, 129), (201, 130), (201, 131), (201, 132), (201, 133), (201, 134), (201, 135), (201, 136), (201, 137), (201, 138), (201, 139), (201, 140), (201, 141), (201, 142), (201, 143), (201, 148), (202, 91), (202, 92), (202, 93), (202, 94), (202, 95), (202, 96), (202, 97), (202, 98), (202, 104), (202, 105), (202, 106), (202, 107), (202, 108), (202, 109), (202, 110), (202, 111), (202, 112), (202, 113), (202, 114), (202, 115), (202, 116), (202, 117), (202, 118), (202, 119), (202, 120), (202, 121), (202, 122), (202, 123), (202, 124), (202, 125), (202, 126), (202, 127),
(202, 128), (202, 129), (202, 130), (202, 131), (202, 132), (202, 133), (202, 134), (202, 135), (202, 136), (202, 137), (202, 138), (202, 139), (202, 140), (202, 141), (202, 142), (202, 143), (202, 144), (202, 145), (202, 146), (202, 149), (203, 99), (203, 100), (203, 101), (203, 102), (203, 103), (203, 104), (203, 105), (203, 106), (203, 107), (203, 108), (203, 109), (203, 110), (203, 111), (203, 112), (203, 113), (203, 114), (203, 115), (203, 116), (203, 117), (203, 118), (203, 119), (203, 120), (203, 121), (203, 122), (203, 123), (203, 124), (203, 125), (203, 126), (203, 127), (203, 128), (203, 129), (203, 130), (203, 131), (203, 132), (203, 133), (203, 134), (203, 135), (203, 136), (203, 137), (203, 138), (203, 139), (203, 140), (203, 141), (203, 142), (203, 143), (203, 144), (203, 145), (203, 146), (203, 147), (203, 148), (203, 150), (204, 51),
(204, 53), (204, 54), (204, 55), (204, 56), (204, 57), (204, 58), (204, 59), (204, 104), (204, 105), (204, 106), (204, 107), (204, 108), (204, 109), (204, 110), (204, 111), (204, 112), (204, 113), (204, 114), (204, 115), (204, 116), (204, 117), (204, 118), (204, 119), (204, 120), (204, 121), (204, 122), (204, 123), (204, 124), (204, 125), (204, 126), (204, 127), (204, 128), (204, 129), (204, 130), (204, 131), (204, 132), (204, 133), (204, 134), (204, 135), (204, 136), (204, 137), (204, 138), (204, 139), (204, 140), (204, 141), (204, 142), (204, 143), (204, 144), (204, 145), (204, 146), (204, 147), (204, 148), (204, 150), (205, 51), (205, 59), (205, 60), (205, 61), (205, 62), (205, 63), (205, 64), (205, 65), (205, 66), (205, 67), (205, 68), (205, 69), (205, 70), (205, 71), (205, 104), (205, 106), (205, 107), (205, 108), (205, 109),
(205, 110), (205, 111), (205, 112), (205, 113), (205, 114), (205, 115), (205, 116), (205, 117), (205, 118), (205, 119), (205, 120), (205, 121), (205, 122), (205, 123), (205, 124), (205, 125), (205, 126), (205, 127), (205, 128), (205, 129), (205, 130), (205, 131), (205, 132), (205, 133), (205, 134), (205, 135), (205, 136), (205, 137), (205, 138), (205, 139), (205, 140), (205, 141), (205, 142), (205, 143), (205, 144), (205, 145), (205, 146), (205, 147), (205, 148), (205, 150), (206, 51), (206, 53), (206, 54), (206, 55), (206, 56), (206, 57), (206, 58), (206, 59), (206, 72), (206, 73), (206, 74), (206, 75), (206, 76), (206, 77), (206, 78), (206, 79), (206, 80), (206, 104), (206, 106), (206, 107), (206, 108), (206, 109), (206, 110), (206, 111), (206, 112), (206, 113), (206, 114), (206, 115), (206, 116), (206, 117), (206, 118), (206, 119),
(206, 120), (206, 121), (206, 122), (206, 123), (206, 124), (206, 125), (206, 126), (206, 127), (206, 128), (206, 129), (206, 130), (206, 131), (206, 132), (206, 133), (206, 134), (206, 135), (206, 136), (206, 137), (206, 138), (206, 139), (206, 140), (206, 141), (206, 142), (206, 143), (206, 144), (206, 145), (206, 146), (206, 147), (206, 148), (206, 149), (206, 151), (207, 50), (207, 52), (207, 53), (207, 54), (207, 55), (207, 56), (207, 57), (207, 58), (207, 59), (207, 60), (207, 61), (207, 62), (207, 63), (207, 64), (207, 65), (207, 66), (207, 67), (207, 68), (207, 69), (207, 70), (207, 71), (207, 81), (207, 82), (207, 83), (207, 103), (207, 105), (207, 106), (207, 107), (207, 108), (207, 109), (207, 110), (207, 111), (207, 112), (207, 113), (207, 114), (207, 115), (207, 116), (207, 117), (207, 118), (207, 119), (207, 120),
(207, 121), (207, 122), (207, 123), (207, 124), (207, 125), (207, 126), (207, 127), (207, 128), (207, 129), (207, 130), (207, 131), (207, 132), (207, 133), (207, 134), (207, 135), (207, 136), (207, 137), (207, 138), (207, 139), (207, 140), (207, 141), (207, 142), (207, 143), (207, 144), (207, 145), (207, 146), (207, 147), (207, 148), (207, 149), (207, 151), (208, 50), (208, 52), (208, 53), (208, 54), (208, 55), (208, 56), (208, 57), (208, 58), (208, 59), (208, 60), (208, 61), (208, 62), (208, 63), (208, 64), (208, 65), (208, 66), (208, 67), (208, 68), (208, 69), (208, 70), (208, 71), (208, 72), (208, 73), (208, 74), (208, 75), (208, 76), (208, 77), (208, 78), (208, 79), (208, 80), (208, 85), (208, 86), (208, 102), (208, 104), (208, 105), (208, 106), (208, 107), (208, 108), (208, 109), (208, 110), (208, 111), (208, 112),
(208, 113), (208, 114), (208, 115), (208, 116), (208, 117), (208, 118), (208, 119), (208, 120), (208, 121), (208, 122), (208, 123), (208, 124), (208, 125), (208, 126), (208, 127), (208, 128), (208, 129), (208, 130), (208, 131), (208, 132), (208, 133), (208, 134), (208, 135), (208, 136), (208, 137), (208, 138), (208, 139), (208, 140), (208, 141), (208, 142), (208, 143), (208, 144), (208, 145), (208, 146), (208, 147), (208, 148), (208, 149), (208, 151), (209, 49), (209, 51), (209, 52), (209, 53), (209, 54), (209, 55), (209, 56), (209, 57), (209, 58), (209, 59), (209, 60), (209, 61), (209, 62), (209, 63), (209, 64), (209, 65), (209, 66), (209, 67), (209, 68), (209, 69), (209, 70), (209, 71), (209, 72), (209, 73), (209, 74), (209, 75), (209, 76), (209, 77), (209, 78), (209, 79), (209, 80), (209, 81), (209, 82), (209, 83),
(209, 84), (209, 87), (209, 88), (209, 100), (209, 101), (209, 103), (209, 104), (209, 105), (209, 106), (209, 107), (209, 108), (209, 109), (209, 110), (209, 111), (209, 112), (209, 113), (209, 114), (209, 115), (209, 116), (209, 117), (209, 118), (209, 119), (209, 120), (209, 121), (209, 122), (209, 123), (209, 124), (209, 125), (209, 126), (209, 127), (209, 128), (209, 129), (209, 130), (209, 131), (209, 132), (209, 133), (209, 134), (209, 135), (209, 136), (209, 137), (209, 138), (209, 139), (209, 140), (209, 141), (209, 142), (209, 143), (209, 144), (209, 145), (209, 146), (209, 147), (209, 148), (209, 149), (209, 150), (209, 152), (210, 48), (210, 50), (210, 51), (210, 52), (210, 53), (210, 54), (210, 55), (210, 56), (210, 57), (210, 58), (210, 59), (210, 60), (210, 61), (210, 62), (210, 63), (210, 64), (210, 65), (210, 66),
(210, 67), (210, 68), (210, 69), (210, 70), (210, 71), (210, 72), (210, 73), (210, 74), (210, 75), (210, 76), (210, 77), (210, 78), (210, 79), (210, 80), (210, 81), (210, 82), (210, 83), (210, 84), (210, 85), (210, 86), (210, 89), (210, 90), (210, 91), (210, 92), (210, 93), (210, 94), (210, 95), (210, 96), (210, 97), (210, 98), (210, 99), (210, 102), (210, 103), (210, 104), (210, 105), (210, 106), (210, 107), (210, 108), (210, 109), (210, 110), (210, 111), (210, 112), (210, 113), (210, 114), (210, 115), (210, 116), (210, 117), (210, 118), (210, 119), (210, 120), (210, 121), (210, 122), (210, 123), (210, 124), (210, 125), (210, 126), (210, 127), (210, 128), (210, 129), (210, 130), (210, 131), (210, 132), (210, 133), (210, 134), (210, 135), (210, 136), (210, 137), (210, 138), (210, 139), (210, 140), (210, 141), (210, 142),
(210, 143), (210, 144), (210, 145), (210, 146), (210, 147), (210, 148), (210, 149), (210, 150), (210, 152), (211, 47), (211, 49), (211, 50), (211, 51), (211, 52), (211, 53), (211, 54), (211, 55), (211, 56), (211, 57), (211, 58), (211, 59), (211, 60), (211, 61), (211, 62), (211, 63), (211, 64), (211, 65), (211, 66), (211, 67), (211, 68), (211, 69), (211, 70), (211, 71), (211, 72), (211, 73), (211, 74), (211, 75), (211, 76), (211, 77), (211, 78), (211, 79), (211, 80), (211, 81), (211, 82), (211, 83), (211, 84), (211, 85), (211, 86), (211, 87), (211, 88), (211, 99), (211, 100), (211, 101), (211, 102), (211, 103), (211, 104), (211, 105), (211, 106), (211, 107), (211, 108), (211, 109), (211, 110), (211, 111), (211, 112), (211, 113), (211, 114), (211, 115), (211, 116), (211, 117), (211, 118), (211, 119), (211, 120),
(211, 121), (211, 122), (211, 123), (211, 124), (211, 125), (211, 126), (211, 127), (211, 128), (211, 129), (211, 130), (211, 131), (211, 132), (211, 133), (211, 134), (211, 135), (211, 136), (211, 137), (211, 138), (211, 139), (211, 140), (211, 141), (211, 142), (211, 143), (211, 144), (211, 145), (211, 146), (211, 147), (211, 148), (211, 149), (211, 150), (211, 151), (211, 153), (212, 46), (212, 48), (212, 49), (212, 50), (212, 51), (212, 52), (212, 53), (212, 54), (212, 55), (212, 56), (212, 57), (212, 58), (212, 59), (212, 60), (212, 61), (212, 62), (212, 63), (212, 64), (212, 65), (212, 66), (212, 67), (212, 68), (212, 69), (212, 70), (212, 71), (212, 72), (212, 73), (212, 74), (212, 75), (212, 76), (212, 77), (212, 78), (212, 79), (212, 80), (212, 81), (212, 82), (212, 83), (212, 84), (212, 85), (212, 86),
(212, 87), (212, 88), (212, 89), (212, 90), (212, 91), (212, 92), (212, 93), (212, 94), (212, 95), (212, 96), (212, 97), (212, 98), (212, 99), (212, 100), (212, 101), (212, 102), (212, 103), (212, 104), (212, 105), (212, 106), (212, 107), (212, 108), (212, 109), (212, 110), (212, 111), (212, 112), (212, 113), (212, 114), (212, 115), (212, 116), (212, 117), (212, 118), (212, 119), (212, 120), (212, 121), (212, 122), (212, 123), (212, 124), (212, 125), (212, 126), (212, 127), (212, 128), (212, 129), (212, 130), (212, 131), (212, 132), (212, 133), (212, 134), (212, 135), (212, 136), (212, 137), (212, 138), (212, 139), (212, 140), (212, 141), (212, 142), (212, 143), (212, 144), (212, 145), (212, 146), (212, 147), (212, 148), (212, 149), (212, 150), (212, 151), (212, 153), (213, 45), (213, 47), (213, 48), (213, 49), (213, 50), (213, 51),
(213, 52), (213, 53), (213, 54), (213, 55), (213, 56), (213, 57), (213, 58), (213, 59), (213, 60), (213, 61), (213, 62), (213, 63), (213, 64), (213, 65), (213, 66), (213, 67), (213, 68), (213, 69), (213, 70), (213, 71), (213, 72), (213, 73), (213, 74), (213, 75), (213, 76), (213, 77), (213, 78), (213, 79), (213, 80), (213, 81), (213, 82), (213, 83), (213, 84), (213, 85), (213, 86), (213, 87), (213, 88), (213, 89), (213, 90), (213, 91), (213, 92), (213, 93), (213, 94), (213, 95), (213, 96), (213, 97), (213, 98), (213, 99), (213, 100), (213, 101), (213, 102), (213, 103), (213, 104), (213, 105), (213, 106), (213, 107), (213, 108), (213, 109), (213, 110), (213, 111), (213, 112), (213, 113), (213, 114), (213, 115), (213, 116), (213, 117), (213, 118), (213, 119), (213, 120), (213, 121), (213, 122), (213, 123),
(213, 124), (213, 125), (213, 126), (213, 127), (213, 128), (213, 129), (213, 130), (213, 131), (213, 132), (213, 133), (213, 134), (213, 135), (213, 136), (213, 137), (213, 138), (213, 139), (213, 140), (213, 141), (213, 142), (213, 143), (213, 144), (213, 145), (213, 146), (213, 147), (213, 148), (213, 149), (213, 150), (213, 151), (213, 152), (213, 154), (214, 43), (214, 46), (214, 47), (214, 48), (214, 49), (214, 50), (214, 51), (214, 52), (214, 53), (214, 54), (214, 55), (214, 56), (214, 57), (214, 58), (214, 59), (214, 60), (214, 61), (214, 62), (214, 63), (214, 64), (214, 65), (214, 66), (214, 67), (214, 68), (214, 69), (214, 70), (214, 71), (214, 72), (214, 73), (214, 74), (214, 75), (214, 76), (214, 77), (214, 78), (214, 79), (214, 80), (214, 81), (214, 82), (214, 83), (214, 84), (214, 85), (214, 86),
(214, 87), (214, 88), (214, 89), (214, 90), (214, 91), (214, 92), (214, 93), (214, 94), (214, 95), (214, 96), (214, 97), (214, 98), (214, 99), (214, 100), (214, 101), (214, 102), (214, 103), (214, 104), (214, 105), (214, 106), (214, 107), (214, 108), (214, 109), (214, 110), (214, 111), (214, 112), (214, 113), (214, 114), (214, 115), (214, 116), (214, 117), (214, 118), (214, 119), (214, 120), (214, 121), (214, 122), (214, 123), (214, 124), (214, 125), (214, 126), (214, 127), (214, 128), (214, 129), (214, 130), (214, 131), (214, 132), (214, 133), (214, 134), (214, 135), (214, 136), (214, 137), (214, 138), (214, 139), (214, 140), (214, 141), (214, 142), (214, 143), (214, 144), (214, 145), (214, 146), (214, 147), (214, 148), (214, 149), (214, 150), (214, 151), (214, 152), (214, 154), (215, 42), (215, 45), (215, 46), (215, 47), (215, 48),
(215, 49), (215, 50), (215, 51), (215, 52), (215, 53), (215, 54), (215, 55), (215, 56), (215, 57), (215, 58), (215, 59), (215, 60), (215, 61), (215, 62), (215, 63), (215, 64), (215, 65), (215, 66), (215, 67), (215, 68), (215, 69), (215, 70), (215, 71), (215, 72), (215, 73), (215, 74), (215, 75), (215, 76), (215, 77), (215, 78), (215, 79), (215, 80), (215, 81), (215, 82), (215, 83), (215, 84), (215, 85), (215, 86), (215, 87), (215, 88), (215, 89), (215, 90), (215, 91), (215, 92), (215, 93), (215, 94), (215, 95), (215, 96), (215, 97), (215, 98), (215, 99), (215, 100), (215, 101), (215, 102), (215, 103), (215, 104), (215, 105), (215, 106), (215, 107), (215, 108), (215, 109), (215, 110), (215, 111), (215, 112), (215, 113), (215, 114), (215, 115), (215, 116), (215, 117), (215, 118), (215, 119), (215, 120),
(215, 121), (215, 122), (215, 123), (215, 124), (215, 125), (215, 126), (215, 127), (215, 128), (215, 129), (215, 130), (215, 131), (215, 132), (215, 133), (215, 134), (215, 135), (215, 136), (215, 137), (215, 138), (215, 139), (215, 140), (215, 141), (215, 142), (215, 143), (215, 144), (215, 145), (215, 146), (215, 147), (215, 148), (215, 149), (215, 150), (215, 151), (215, 152), (215, 153), (215, 155), (216, 41), (216, 44), (216, 45), (216, 46), (216, 47), (216, 48), (216, 49), (216, 50), (216, 51), (216, 52), (216, 53), (216, 54), (216, 55), (216, 56), (216, 57), (216, 58), (216, 59), (216, 60), (216, 61), (216, 62), (216, 63), (216, 69), (216, 72), (216, 73), (216, 74), (216, 75), (216, 76), (216, 77), (216, 78), (216, 79), (216, 80), (216, 81), (216, 82), (216, 83), (216, 84), (216, 85), (216, 86), (216, 87),
(216, 88), (216, 89), (216, 90), (216, 91), (216, 92), (216, 93), (216, 94), (216, 95), (216, 96), (216, 97), (216, 98), (216, 99), (216, 100), (216, 101), (216, 102), (216, 103), (216, 104), (216, 105), (216, 106), (216, 107), (216, 108), (216, 109), (216, 110), (216, 111), (216, 112), (216, 113), (216, 114), (216, 115), (216, 116), (216, 117), (216, 118), (216, 119), (216, 120), (216, 121), (216, 122), (216, 123), (216, 124), (216, 125), (216, 126), (216, 127), (216, 128), (216, 129), (216, 130), (216, 131), (216, 132), (216, 133), (216, 134), (216, 135), (216, 136), (216, 137), (216, 138), (216, 139), (216, 140), (216, 141), (216, 142), (216, 143), (216, 144), (216, 145), (216, 146), (216, 147), (216, 148), (216, 149), (216, 150), (216, 151), (216, 152), (216, 153), (216, 155), (217, 40), (217, 42), (217, 43), (217, 44), (217, 45),
(217, 46), (217, 47), (217, 48), (217, 49), (217, 50), (217, 51), (217, 52), (217, 53), (217, 54), (217, 55), (217, 56), (217, 57), (217, 58), (217, 59), (217, 60), (217, 64), (217, 65), (217, 66), (217, 67), (217, 68), (217, 69), (217, 70), (217, 71), (217, 73), (217, 74), (217, 75), (217, 76), (217, 77), (217, 78), (217, 79), (217, 80), (217, 81), (217, 82), (217, 83), (217, 84), (217, 85), (217, 86), (217, 87), (217, 88), (217, 89), (217, 90), (217, 91), (217, 92), (217, 93), (217, 94), (217, 95), (217, 96), (217, 97), (217, 98), (217, 99), (217, 100), (217, 101), (217, 102), (217, 103), (217, 104), (217, 105), (217, 106), (217, 107), (217, 108), (217, 109), (217, 110), (217, 111), (217, 112), (217, 113), (217, 114), (217, 115), (217, 116), (217, 117), (217, 118), (217, 119), (217, 120), (217, 121),
(217, 122), (217, 123), (217, 124), (217, 125), (217, 126), (217, 127), (217, 128), (217, 129), (217, 130), (217, 131), (217, 132), (217, 133), (217, 134), (217, 135), (217, 136), (217, 137), (217, 138), (217, 139), (217, 140), (217, 141), (217, 142), (217, 143), (217, 144), (217, 145), (217, 146), (217, 147), (217, 148), (217, 149), (217, 150), (217, 151), (217, 152), (217, 153), (217, 154), (217, 156), (218, 40), (218, 42), (218, 43), (218, 44), (218, 45), (218, 46), (218, 47), (218, 48), (218, 49), (218, 50), (218, 51), (218, 52), (218, 53), (218, 54), (218, 55), (218, 56), (218, 57), (218, 61), (218, 62), (218, 63), (218, 72), (218, 74), (218, 75), (218, 76), (218, 77), (218, 78), (218, 79), (218, 80), (218, 81), (218, 82), (218, 83), (218, 84), (218, 85), (218, 86), (218, 87), (218, 88), (218, 89), (218, 90),
(218, 91), (218, 92), (218, 93), (218, 94), (218, 95), (218, 96), (218, 97), (218, 98), (218, 99), (218, 100), (218, 101), (218, 102), (218, 103), (218, 104), (218, 105), (218, 106), (218, 107), (218, 108), (218, 109), (218, 110), (218, 111), (218, 112), (218, 113), (218, 114), (218, 115), (218, 116), (218, 117), (218, 118), (218, 119), (218, 120), (218, 121), (218, 122), (218, 123), (218, 124), (218, 125), (218, 126), (218, 127), (218, 128), (218, 129), (218, 130), (218, 131), (218, 132), (218, 133), (218, 134), (218, 135), (218, 136), (218, 137), (218, 138), (218, 139), (218, 140), (218, 141), (218, 142), (218, 143), (218, 144), (218, 145), (218, 146), (218, 147), (218, 148), (218, 149), (218, 150), (218, 151), (218, 152), (218, 153), (218, 154), (218, 155), (219, 39), (219, 58), (219, 60), (219, 73), (219, 158), (220, 39), (220, 41),
(220, 42), (220, 43), (220, 44), (220, 45), (220, 46), (220, 47), (220, 48), (220, 49), (220, 50), (220, 51), (220, 52), (220, 53), (220, 54), (220, 55), (220, 56), (220, 57), (220, 73), (220, 75), (220, 76), (220, 77), (220, 78), (220, 79), (220, 80), (220, 81), (220, 82), (220, 83), (220, 84), (220, 85), (220, 86), (220, 87), (220, 88), (220, 89), (220, 90), (220, 91), (220, 92), (220, 93), (220, 94), (220, 95), (220, 96), (220, 97), (220, 98), (220, 99), (220, 100), (220, 101), (220, 102), (220, 103), (220, 104), (220, 105), (220, 106), (220, 107), (220, 108), (220, 109), (220, 110), (220, 111), (220, 112), (220, 113), (220, 114), (220, 115), (220, 116), (220, 117), (220, 118), (220, 119), (220, 120), (220, 121), (220, 122), (220, 123), (220, 124), (220, 125), (220, 126), (220, 127), (220, 128), (220, 129),
(220, 130), (220, 131), (220, 132), (220, 133), (220, 134), (220, 135), (220, 136), (220, 137), (220, 138), (220, 139), (220, 140), (220, 141), (220, 142), (220, 143), (220, 144), (220, 145), (220, 146), (220, 147), (220, 148), (220, 149), (220, 150), (220, 151), (220, 152), (220, 153), (220, 154), (220, 155), (220, 156), (220, 158), (225, 43), (225, 45), (225, 46), (225, 47), (225, 48), (225, 49), (225, 50), (225, 51), (225, 52), (225, 53), (225, 54), (225, 55), (225, 56), (225, 58), (225, 72), (225, 74), (225, 75), (225, 76), (225, 77), (225, 78), (225, 79), (225, 80), (225, 81), (225, 82), (225, 83), (225, 84), (225, 85), (225, 86), (225, 87), (225, 88), (225, 89), (225, 90), (225, 91), (225, 92), (225, 93), (225, 94), (225, 95), (225, 96), (225, 97), (225, 98), (225, 99), (225, 100), (225, 101), (225, 102),
(225, 103), (225, 104), (225, 105), (225, 106), (225, 107), (225, 108), (225, 109), (225, 110), (225, 111), (225, 112), (225, 113), (225, 114), (225, 115), (225, 116), (225, 117), (225, 118), (225, 119), (225, 120), (225, 121), (225, 122), (225, 123), (225, 124), (225, 125), (225, 126), (225, 127), (225, 128), (225, 129), (225, 130), (225, 131), (225, 132), (225, 133), (225, 134), (225, 135), (225, 136), (225, 137), (225, 138), (225, 139), (225, 140), (225, 141), (225, 142), (225, 143), (225, 144), (225, 145), (225, 146), (225, 147), (225, 148), (225, 149), (225, 150), (225, 151), (225, 152), (225, 153), (225, 154), (225, 155), (225, 156), (225, 158), (226, 44), (226, 60), (226, 70), (226, 158), (227, 45), (227, 48), (227, 49), (227, 50), (227, 51), (227, 52), (227, 53), (227, 54), (227, 55), (227, 56), (227, 57), (227, 58), (227, 61),
(227, 69), (227, 72), (227, 73), (227, 74), (227, 75), (227, 76), (227, 77), (227, 78), (227, 79), (227, 80), (227, 81), (227, 82), (227, 83), (227, 84), (227, 85), (227, 86), (227, 87), (227, 88), (227, 89), (227, 90), (227, 91), (227, 92), (227, 93), (227, 94), (227, 95), (227, 96), (227, 97), (227, 98), (227, 99), (227, 100), (227, 101), (227, 102), (227, 103), (227, 104), (227, 105), (227, 106), (227, 107), (227, 108), (227, 109), (227, 110), (227, 111), (227, 112), (227, 113), (227, 114), (227, 115), (227, 116), (227, 117), (227, 118), (227, 119), (227, 120), (227, 121), (227, 122), (227, 123), (227, 124), (227, 125), (227, 126), (227, 127), (227, 128), (227, 129), (227, 130), (227, 131), (227, 132), (227, 133), (227, 134), (227, 135), (227, 136), (227, 137), (227, 138), (227, 139), (227, 140), (227, 141), (227, 142),
(227, 143), (227, 144), (227, 145), (227, 146), (227, 147), (227, 148), (227, 149), (227, 150), (227, 151), (227, 152), (227, 153), (227, 154), (227, 155), (227, 157), (228, 47), (228, 49), (228, 50), (228, 51), (228, 52), (228, 53), (228, 54), (228, 55), (228, 56), (228, 57), (228, 58), (228, 59), (228, 60), (228, 63), (228, 64), (228, 65), (228, 66), (228, 67), (228, 70), (228, 71), (228, 72), (228, 73), (228, 74), (228, 75), (228, 76), (228, 77), (228, 78), (228, 79), (228, 80), (228, 81), (228, 82), (228, 83), (228, 84), (228, 85), (228, 86), (228, 87), (228, 88), (228, 89), (228, 90), (228, 91), (228, 92), (228, 93), (228, 94), (228, 95), (228, 96), (228, 97), (228, 98), (228, 99), (228, 100), (228, 101), (228, 102), (228, 103), (228, 104), (228, 105), (228, 106), (228, 107), (228, 108), (228, 109),
(228, 110), (228, 111), (228, 112), (228, 113), (228, 114), (228, 115), (228, 116), (228, 117), (228, 118), (228, 119), (228, 120), (228, 121), (228, 122), (228, 123), (228, 124), (228, 125), (228, 126), (228, 127), (228, 128), (228, 129), (228, 130), (228, 131), (228, 132), (228, 133), (228, 134), (228, 135), (228, 136), (228, 137), (228, 138), (228, 139), (228, 140), (228, 141), (228, 142), (228, 143), (228, 144), (228, 145), (228, 146), (228, 147), (228, 148), (228, 149), (228, 150), (228, 151), (228, 152), (228, 153), (228, 154), (228, 155), (228, 157), (229, 48), (229, 50), (229, 51), (229, 52), (229, 53), (229, 54), (229, 55), (229, 56), (229, 57), (229, 58), (229, 59), (229, 60), (229, 61), (229, 62), (229, 69), (229, 70), (229, 71), (229, 72), (229, 73), (229, 74), (229, 75), (229, 76), (229, 77), (229, 78), (229, 79),
(229, 80), (229, 81), (229, 82), (229, 83), (229, 84), (229, 85), (229, 86), (229, 87), (229, 88), (229, 89), (229, 90), (229, 91), (229, 92), (229, 93), (229, 94), (229, 95), (229, 96), (229, 97), (229, 98), (229, 99), (229, 100), (229, 101), (229, 102), (229, 103), (229, 104), (229, 105), (229, 106), (229, 107), (229, 108), (229, 109), (229, 110), (229, 111), (229, 112), (229, 113), (229, 114), (229, 115), (229, 116), (229, 117), (229, 118), (229, 119), (229, 120), (229, 121), (229, 122), (229, 123), (229, 124), (229, 125), (229, 126), (229, 127), (229, 128), (229, 129), (229, 130), (229, 131), (229, 132), (229, 133), (229, 134), (229, 135), (229, 136), (229, 137), (229, 138), (229, 139), (229, 140), (229, 141), (229, 142), (229, 143), (229, 144), (229, 145), (229, 146), (229, 147), (229, 148), (229, 149), (229, 150), (229, 151),
(229, 152), (229, 153), (229, 154), (229, 155), (229, 157), (230, 49), (230, 51), (230, 52), (230, 53), (230, 54), (230, 55), (230, 56), (230, 57), (230, 58), (230, 59), (230, 60), (230, 61), (230, 62), (230, 63), (230, 64), (230, 65), (230, 66), (230, 67), (230, 68), (230, 69), (230, 70), (230, 71), (230, 72), (230, 73), (230, 74), (230, 75), (230, 76), (230, 77), (230, 78), (230, 79), (230, 80), (230, 81), (230, 82), (230, 83), (230, 84), (230, 85), (230, 86), (230, 87), (230, 88), (230, 89), (230, 90), (230, 91), (230, 92), (230, 93), (230, 94), (230, 95), (230, 96), (230, 97), (230, 98), (230, 99), (230, 100), (230, 101), (230, 102), (230, 103), (230, 104), (230, 105), (230, 106), (230, 107), (230, 108), (230, 109), (230, 110), (230, 111), (230, 112), (230, 113), (230, 114), (230, 115), (230, 116),
(230, 117), (230, 118), (230, 119), (230, 120), (230, 121), (230, 122), (230, 123), (230, 124), (230, 125), (230, 126), (230, 127), (230, 128), (230, 129), (230, 130), (230, 131), (230, 132), (230, 133), (230, 134), (230, 135), (230, 136), (230, 137), (230, 138), (230, 139), (230, 140), (230, 141), (230, 142), (230, 143), (230, 144), (230, 145), (230, 146), (230, 147), (230, 148), (230, 149), (230, 150), (230, 151), (230, 152), (230, 153), (230, 154), (230, 155), (230, 157), (231, 50), (231, 52), (231, 53), (231, 54), (231, 55), (231, 56), (231, 57), (231, 58), (231, 59), (231, 60), (231, 61), (231, 62), (231, 63), (231, 64), (231, 65), (231, 66), (231, 67), (231, 68), (231, 69), (231, 70), (231, 71), (231, 72), (231, 73), (231, 74), (231, 75), (231, 76), (231, 77), (231, 78), (231, 79), (231, 80), (231, 81), (231, 82),
(231, 83), (231, 84), (231, 85), (231, 86), (231, 87), (231, 88), (231, 89), (231, 90), (231, 91), (231, 92), (231, 93), (231, 94), (231, 95), (231, 96), (231, 97), (231, 98), (231, 99), (231, 100), (231, 101), (231, 102), (231, 103), (231, 104), (231, 105), (231, 106), (231, 107), (231, 108), (231, 109), (231, 110), (231, 111), (231, 112), (231, 113), (231, 114), (231, 115), (231, 116), (231, 117), (231, 118), (231, 119), (231, 120), (231, 121), (231, 122), (231, 123), (231, 124), (231, 125), (231, 126), (231, 127), (231, 128), (231, 129), (231, 130), (231, 131), (231, 132), (231, 133), (231, 134), (231, 135), (231, 136), (231, 137), (231, 138), (231, 139), (231, 140), (231, 141), (231, 142), (231, 143), (231, 144), (231, 145), (231, 146), (231, 147), (231, 148), (231, 149), (231, 150), (231, 151), (231, 152), (231, 153), (231, 154),
(231, 156), (232, 51), (232, 53), (232, 54), (232, 55), (232, 56), (232, 57), (232, 58), (232, 59), (232, 60), (232, 61), (232, 62), (232, 63), (232, 64), (232, 65), (232, 66), (232, 67), (232, 68), (232, 69), (232, 70), (232, 71), (232, 72), (232, 73), (232, 74), (232, 75), (232, 76), (232, 77), (232, 78), (232, 79), (232, 80), (232, 81), (232, 82), (232, 83), (232, 84), (232, 85), (232, 86), (232, 87), (232, 88), (232, 89), (232, 90), (232, 91), (232, 92), (232, 93), (232, 94), (232, 95), (232, 96), (232, 97), (232, 98), (232, 99), (232, 100), (232, 101), (232, 102), (232, 103), (232, 104), (232, 105), (232, 106), (232, 107), (232, 108), (232, 109), (232, 110), (232, 111), (232, 112), (232, 113), (232, 114), (232, 115), (232, 116), (232, 117), (232, 118), (232, 119), (232, 120), (232, 121), (232, 122),
(232, 123), (232, 124), (232, 125), (232, 126), (232, 127), (232, 128), (232, 129), (232, 130), (232, 131), (232, 132), (232, 133), (232, 134), (232, 135), (232, 136), (232, 137), (232, 138), (232, 139), (232, 140), (232, 141), (232, 142), (232, 143), (232, 144), (232, 145), (232, 146), (232, 147), (232, 148), (232, 149), (232, 150), (232, 151), (232, 152), (232, 153), (232, 154), (232, 156), (233, 52), (233, 54), (233, 55), (233, 56), (233, 57), (233, 58), (233, 59), (233, 60), (233, 61), (233, 62), (233, 63), (233, 64), (233, 65), (233, 66), (233, 67), (233, 68), (233, 69), (233, 70), (233, 71), (233, 72), (233, 73), (233, 74), (233, 75), (233, 76), (233, 77), (233, 78), (233, 79), (233, 80), (233, 81), (233, 82), (233, 83), (233, 84), (233, 85), (233, 86), (233, 87), (233, 88), (233, 89), (233, 90), (233, 91),
(233, 92), (233, 93), (233, 94), (233, 95), (233, 96), (233, 97), (233, 98), (233, 99), (233, 100), (233, 101), (233, 102), (233, 103), (233, 104), (233, 105), (233, 106), (233, 107), (233, 108), (233, 109), (233, 110), (233, 111), (233, 112), (233, 113), (233, 114), (233, 115), (233, 116), (233, 117), (233, 118), (233, 119), (233, 120), (233, 121), (233, 122), (233, 123), (233, 124), (233, 125), (233, 126), (233, 127), (233, 128), (233, 129), (233, 130), (233, 131), (233, 132), (233, 133), (233, 134), (233, 135), (233, 136), (233, 137), (233, 138), (233, 139), (233, 140), (233, 141), (233, 142), (233, 143), (233, 144), (233, 145), (233, 146), (233, 147), (233, 148), (233, 149), (233, 150), (233, 151), (233, 152), (233, 153), (233, 154), (233, 156), (234, 52), (234, 54), (234, 55), (234, 56), (234, 57), (234, 58), (234, 59), (234, 60),
(234, 61), (234, 62), (234, 63), (234, 64), (234, 65), (234, 66), (234, 67), (234, 68), (234, 69), (234, 70), (234, 71), (234, 72), (234, 73), (234, 74), (234, 75), (234, 76), (234, 77), (234, 78), (234, 79), (234, 80), (234, 81), (234, 85), (234, 86), (234, 101), (234, 102), (234, 103), (234, 104), (234, 105), (234, 106), (234, 107), (234, 108), (234, 109), (234, 110), (234, 111), (234, 112), (234, 113), (234, 114), (234, 115), (234, 116), (234, 117), (234, 118), (234, 119), (234, 120), (234, 121), (234, 122), (234, 123), (234, 124), (234, 125), (234, 126), (234, 127), (234, 128), (234, 129), (234, 130), (234, 131), (234, 132), (234, 133), (234, 134), (234, 135), (234, 136), (234, 137), (234, 138), (234, 139), (234, 140), (234, 141), (234, 142), (234, 143), (234, 144), (234, 145), (234, 146), (234, 147), (234, 148), (234, 149),
(234, 150), (234, 151), (234, 152), (234, 156), (235, 53), (235, 55), (235, 56), (235, 57), (235, 58), (235, 59), (235, 60), (235, 61), (235, 62), (235, 63), (235, 64), (235, 65), (235, 66), (235, 67), (235, 68), (235, 69), (235, 70), (235, 71), (235, 72), (235, 73), (235, 74), (235, 75), (235, 76), (235, 77), (235, 78), (235, 79), (235, 80), (235, 81), (235, 83), (235, 84), (235, 85), (235, 86), (235, 87), (235, 88), (235, 89), (235, 90), (235, 91), (235, 92), (235, 93), (235, 94), (235, 95), (235, 96), (235, 97), (235, 98), (235, 99), (235, 102), (235, 103), (235, 104), (235, 105), (235, 106), (235, 107), (235, 108), (235, 109), (235, 110), (235, 111), (235, 112), (235, 113), (235, 114), (235, 115), (235, 116), (235, 117), (235, 118), (235, 119), (235, 120), (235, 121), (235, 122), (235, 123), (235, 124),
(235, 125), (235, 126), (235, 127), (235, 128), (235, 129), (235, 130), (235, 131), (235, 132), (235, 133), (235, 134), (235, 135), (235, 136), (235, 137), (235, 138), (235, 139), (235, 140), (235, 141), (235, 142), (235, 143), (235, 144), (235, 145), (235, 146), (235, 147), (235, 148), (235, 149), (235, 150), (235, 153), (235, 155), (236, 53), (236, 55), (236, 56), (236, 57), (236, 58), (236, 59), (236, 60), (236, 61), (236, 62), (236, 63), (236, 64), (236, 65), (236, 66), (236, 67), (236, 68), (236, 69), (236, 70), (236, 71), (236, 72), (236, 73), (236, 74), (236, 75), (236, 76), (236, 77), (236, 78), (236, 79), (236, 81), (236, 101), (236, 103), (236, 104), (236, 105), (236, 106), (236, 107), (236, 108), (236, 109), (236, 110), (236, 111), (236, 112), (236, 113), (236, 114), (236, 115), (236, 116), (236, 117), (236, 118),
(236, 119), (236, 120), (236, 121), (236, 122), (236, 123), (236, 124), (236, 125), (236, 126), (236, 127), (236, 128), (236, 129), (236, 130), (236, 131), (236, 132), (236, 133), (236, 134), (236, 135), (236, 136), (236, 137), (236, 138), (236, 139), (236, 140), (236, 141), (236, 142), (236, 143), (236, 144), (236, 145), (236, 146), (236, 147), (236, 148), (236, 149), (236, 152), (237, 54), (237, 56), (237, 57), (237, 58), (237, 59), (237, 60), (237, 61), (237, 62), (237, 63), (237, 64), (237, 65), (237, 66), (237, 67), (237, 68), (237, 69), (237, 70), (237, 81), (237, 102), (237, 104), (237, 105), (237, 106), (237, 107), (237, 108), (237, 109), (237, 110), (237, 111), (237, 112), (237, 113), (237, 114), (237, 115), (237, 116), (237, 117), (237, 118), (237, 119), (237, 120), (237, 121), (237, 122), (237, 123), (237, 124), (237, 125),
(237, 126), (237, 127), (237, 128), (237, 129), (237, 130), (237, 131), (237, 132), (237, 133), (237, 134), (237, 135), (237, 136), (237, 137), (237, 138), (237, 139), (237, 140), (237, 141), (237, 142), (237, 143), (237, 144), (237, 145), (237, 146), (237, 147), (237, 150), (238, 54), (238, 56), (238, 57), (238, 58), (238, 59), (238, 60), (238, 61), (238, 62), (238, 63), (238, 64), (238, 71), (238, 72), (238, 73), (238, 74), (238, 75), (238, 76), (238, 77), (238, 78), (238, 80), (238, 103), (238, 105), (238, 106), (238, 107), (238, 108), (238, 109), (238, 110), (238, 111), (238, 112), (238, 113), (238, 114), (238, 115), (238, 116), (238, 117), (238, 118), (238, 119), (238, 120), (238, 121), (238, 122), (238, 123), (238, 124), (238, 125), (238, 126), (238, 127), (238, 128), (238, 129), (238, 130), (238, 131), (238, 132), (238, 133),
(238, 134), (238, 135), (238, 136), (238, 137), (238, 138), (238, 139), (238, 140), (238, 141), (238, 142), (238, 143), (238, 144), (238, 145), (238, 146), (238, 149), (239, 54), (239, 65), (239, 66), (239, 67), (239, 68), (239, 69), (239, 70), (239, 104), (239, 106), (239, 107), (239, 108), (239, 109), (239, 110), (239, 111), (239, 112), (239, 113), (239, 114), (239, 115), (239, 116), (239, 117), (239, 118), (239, 119), (239, 120), (239, 121), (239, 122), (239, 123), (239, 124), (239, 125), (239, 126), (239, 127), (239, 128), (239, 129), (239, 130), (239, 131), (239, 132), (239, 133), (239, 134), (239, 135), (239, 136), (239, 137), (239, 138), (239, 139), (239, 140), (239, 141), (239, 142), (239, 143), (239, 144), (239, 145), (240, 54), (240, 56), (240, 57), (240, 58), (240, 59), (240, 60), (240, 61), (240, 62), (240, 63), (240, 64),
(240, 104), (240, 106), (240, 107), (240, 108), (240, 109), (240, 110), (240, 111), (240, 112), (240, 113), (240, 114), (240, 115), (240, 116), (240, 117), (240, 118), (240, 119), (240, 120), (240, 121), (240, 122), (240, 123), (240, 124), (240, 125), (240, 126), (240, 127), (240, 128), (240, 129), (240, 130), (240, 131), (240, 132), (240, 133), (240, 134), (240, 135), (240, 136), (240, 137), (240, 138), (240, 139), (240, 140), (240, 141), (240, 142), (240, 143), (240, 144), (240, 146), (241, 54), (241, 55), (241, 104), (241, 106), (241, 107), (241, 108), (241, 109), (241, 110), (241, 111), (241, 112), (241, 113), (241, 114), (241, 115), (241, 116), (241, 117), (241, 118), (241, 119), (241, 120), (241, 121), (241, 122), (241, 123), (241, 124), (241, 125), (241, 126), (241, 127), (241, 128), (241, 129), (241, 130), (241, 131), (241, 132), (241, 133),
(241, 134), (241, 135), (241, 136), (241, 137), (241, 138), (241, 139), (241, 140), (241, 141), (241, 142), (241, 143), (241, 145), (242, 103), (242, 105), (242, 106), (242, 107), (242, 108), (242, 109), (242, 110), (242, 111), (242, 112), (242, 113), (242, 114), (242, 115), (242, 116), (242, 117), (242, 118), (242, 119), (242, 120), (242, 121), (242, 122), (242, 123), (242, 124), (242, 125), (242, 126), (242, 127), (242, 128), (242, 129), (242, 130), (242, 131), (242, 132), (242, 133), (242, 134), (242, 135), (242, 136), (242, 137), (242, 138), (242, 139), (242, 140), (242, 141), (242, 142), (243, 100), (243, 101), (243, 104), (243, 105), (243, 106), (243, 107), (243, 108), (243, 109), (243, 110), (243, 111), (243, 112), (243, 113), (243, 114), (243, 115), (243, 116), (243, 117), (243, 118), (243, 119), (243, 120), (243, 121), (243, 122), (243, 123),
(243, 124), (243, 125), (243, 126), (243, 127), (243, 128), (243, 129), (243, 130), (243, 131), (243, 132), (243, 133), (243, 134), (243, 135), (243, 136), (243, 137), (243, 138), (243, 139), (243, 140), (243, 141), (243, 142), (243, 144), (244, 90), (244, 91), (244, 92), (244, 93), (244, 94), (244, 95), (244, 96), (244, 97), (244, 98), (244, 99), (244, 103), (244, 104), (244, 105), (244, 106), (244, 107), (244, 108), (244, 109), (244, 110), (244, 111), (244, 112), (244, 113), (244, 114), (244, 115), (244, 116), (244, 117), (244, 118), (244, 119), (244, 120), (244, 121), (244, 122), (244, 123), (244, 124), (244, 125), (244, 126), (244, 127), (244, 128), (244, 129), (244, 130), (244, 131), (244, 132), (244, 133), (244, 134), (244, 135), (244, 136), (244, 137), (244, 138), (244, 139), (244, 140), (244, 141), (244, 143), (245, 86), (245, 88),
(245, 89), (245, 100), (245, 101), (245, 102), (245, 103), (245, 104), (245, 105), (245, 106), (245, 107), (245, 108), (245, 109), (245, 110), (245, 111), (245, 112), (245, 113), (245, 114), (245, 115), (245, 116), (245, 117), (245, 118), (245, 119), (245, 120), (245, 121), (245, 122), (245, 123), (245, 124), (245, 125), (245, 126), (245, 127), (245, 128), (245, 129), (245, 130), (245, 131), (245, 132), (245, 133), (245, 134), (245, 135), (245, 136), (245, 137), (245, 138), (245, 139), (245, 140), (245, 142), (246, 84), (246, 90), (246, 91), (246, 92), (246, 93), (246, 94), (246, 95), (246, 96), (246, 97), (246, 98), (246, 99), (246, 100), (246, 101), (246, 102), (246, 103), (246, 104), (246, 105), (246, 106), (246, 107), (246, 108), (246, 109), (246, 110), (246, 111), (246, 112), (246, 113), (246, 114), (246, 115), (246, 116), (246, 117),
(246, 118), (246, 119), (246, 120), (246, 121), (246, 122), (246, 123), (246, 124), (246, 125), (246, 126), (246, 127), (246, 128), (246, 129), (246, 130), (246, 131), (246, 132), (246, 133), (246, 134), (246, 135), (246, 136), (246, 137), (246, 138), (246, 139), (246, 141), (247, 83), (247, 86), (247, 87), (247, 88), (247, 89), (247, 90), (247, 91), (247, 92), (247, 93), (247, 94), (247, 95), (247, 96), (247, 97), (247, 98), (247, 99), (247, 100), (247, 101), (247, 102), (247, 103), (247, 104), (247, 105), (247, 106), (247, 107), (247, 108), (247, 109), (247, 110), (247, 111), (247, 112), (247, 113), (247, 114), (247, 115), (247, 116), (247, 117), (247, 118), (247, 119), (247, 120), (247, 121), (247, 122), (247, 123), (247, 124), (247, 125), (247, 126), (247, 127), (247, 128), (247, 129), (247, 130), (247, 131), (247, 132), (247, 133),
(247, 134), (247, 135), (247, 136), (247, 137), (247, 138), (247, 140), (248, 83), (248, 118), (248, 119), (248, 120), (248, 121), (248, 122), (248, 123), (248, 125), (248, 126), (248, 127), (248, 128), (248, 129), (248, 130), (248, 131), (248, 132), (248, 133), (248, 134), (248, 135), (248, 136), (248, 137), (248, 139), (249, 83), (249, 85), (249, 86), (249, 87), (249, 88), (249, 89), (249, 90), (249, 91), (249, 92), (249, 93), (249, 94), (249, 95), (249, 96), (249, 97), (249, 98), (249, 99), (249, 100), (249, 101), (249, 102), (249, 103), (249, 104), (249, 105), (249, 106), (249, 107), (249, 108), (249, 109), (249, 110), (249, 111), (249, 112), (249, 113), (249, 114), (249, 115), (249, 116), (249, 117), (249, 120), (249, 121), (249, 124), (249, 128), (249, 129), (249, 130), (249, 131), (249, 132), (249, 133), (249, 134), (249, 135),
(249, 136), (249, 138), (250, 83), (250, 118), (250, 121), (250, 122), (250, 126), (250, 130), (250, 131), (250, 132), (250, 133), (250, 134), (250, 137), (251, 128), (251, 136), (252, 121), (252, 130), (252, 132), (252, 134), )
coordinates_F8F8FF = ((164, 154),
(164, 155), (164, 156), (164, 157), (164, 158), (164, 159), (165, 151), (165, 153), (165, 161), (166, 151), (166, 154), (166, 155), (166, 156), (166, 157), (166, 158), (166, 159), (166, 161), (167, 150), (167, 152), (167, 153), (167, 154), (167, 155), (167, 156), (167, 157), (167, 158), (167, 160), (168, 150), (168, 152), (168, 153), (168, 154), (168, 155), (168, 156), (168, 157), (168, 159), (169, 149), (169, 151), (169, 152), (169, 153), (169, 154), (169, 155), (169, 156), (169, 158), (170, 148), (170, 150), (170, 151), (170, 152), (170, 153), (170, 154), (170, 155), (170, 156), (170, 158), (171, 147), (171, 149), (171, 150), (171, 151), (171, 152), (171, 153), (171, 154), (171, 155), (171, 156), (171, 158), (172, 146), (172, 148), (172, 149), (172, 150), (172, 151), (172, 152), (172, 153), (172, 154), (172, 155), (172, 156), (172, 158), (173, 146),
(173, 148), (173, 149), (173, 150), (173, 151), (173, 152), (173, 153), (173, 154), (173, 155), (173, 156), (173, 158), (174, 145), (174, 148), (174, 149), (174, 150), (174, 151), (174, 152), (174, 153), (174, 154), (174, 155), (174, 156), (174, 157), (174, 159), (175, 145), (175, 147), (175, 150), (175, 151), (175, 152), (175, 153), (175, 154), (175, 155), (175, 156), (175, 157), (175, 159), (176, 148), (176, 149), (176, 152), (176, 153), (176, 154), (176, 155), (176, 156), (176, 157), (176, 159), (177, 150), (177, 153), (177, 154), (177, 155), (177, 156), (177, 157), (177, 158), (177, 160), (178, 154), (178, 155), (178, 156), (178, 157), (178, 158), (178, 160), (179, 153), (179, 155), (179, 156), (179, 157), (179, 158), (179, 159), (179, 161), (180, 153), (180, 155), (180, 156), (180, 157), (180, 158), (180, 159), (180, 160), (180, 162), (181, 139),
(181, 154), (181, 156), (181, 157), (181, 158), (181, 159), (181, 160), (181, 162), (182, 139), (182, 155), (182, 157), (182, 158), (182, 159), (182, 160), (182, 161), (183, 138), (183, 155), (183, 157), (183, 158), (183, 159), (183, 160), (183, 161), (183, 162), (183, 165), (184, 137), (184, 156), (184, 158), (184, 159), (184, 160), (184, 161), (184, 162), (184, 163), (184, 164), (184, 166), (185, 136), (185, 137), (185, 156), (185, 158), (185, 159), (185, 160), (185, 161), (185, 162), (185, 163), (185, 164), (185, 165), (186, 135), (186, 137), (186, 157), (186, 159), (186, 160), (186, 161), (186, 162), (186, 163), (186, 164), (186, 165), (186, 166), (186, 169), (187, 134), (187, 136), (187, 137), (187, 157), (187, 159), (187, 160), (187, 161), (187, 162), (187, 163), (187, 164), (187, 165), (187, 166), (187, 167), (187, 170), (188, 133), (188, 135),
(188, 137), (188, 158), (188, 160), (188, 161), (188, 162), (188, 163), (188, 164), (188, 165), (188, 166), (188, 167), (188, 168), (189, 121), (189, 124), (189, 132), (189, 134), (189, 135), (189, 136), (189, 138), (189, 158), (189, 160), (189, 161), (189, 162), (189, 163), (189, 164), (189, 165), (189, 166), (189, 167), (189, 168), (189, 169), (189, 172), (189, 174), (190, 120), (190, 133), (190, 134), (190, 135), (190, 136), (190, 137), (190, 139), (190, 158), (190, 160), (190, 161), (190, 162), (190, 163), (190, 164), (190, 165), (190, 166), (190, 167), (190, 168), (190, 169), (190, 170), (190, 171), (190, 174), (191, 123), (191, 125), (191, 129), (191, 132), (191, 133), (191, 134), (191, 135), (191, 136), (191, 137), (191, 138), (191, 140), (191, 159), (191, 161), (191, 162), (191, 163), (191, 164), (191, 165), (191, 166), (191, 167), (191, 168),
(191, 169), (191, 170), (191, 171), (191, 172), (191, 174), (192, 127), (192, 128), (192, 133), (192, 134), (192, 135), (192, 136), (192, 137), (192, 138), (192, 139), (192, 142), (192, 159), (192, 161), (192, 162), (192, 163), (192, 164), (192, 165), (192, 166), (192, 167), (192, 168), (192, 169), (192, 170), (192, 171), (192, 172), (192, 174), (193, 130), (193, 132), (193, 136), (193, 137), (193, 138), (193, 139), (193, 140), (193, 144), (193, 159), (193, 161), (193, 162), (193, 163), (193, 164), (193, 165), (193, 166), (193, 167), (193, 168), (193, 169), (193, 170), (193, 171), (193, 173), (194, 133), (194, 134), (194, 135), (194, 139), (194, 140), (194, 141), (194, 142), (194, 145), (194, 146), (194, 147), (194, 160), (194, 162), (194, 163), (194, 164), (194, 165), (194, 166), (194, 167), (194, 168), (194, 169), (194, 170), (194, 171), (194, 173),
(195, 136), (195, 137), (195, 138), (195, 142), (195, 143), (195, 144), (195, 148), (195, 160), (195, 164), (195, 165), (195, 166), (195, 167), (195, 168), (195, 169), (195, 170), (195, 171), (195, 173), (196, 139), (196, 140), (196, 141), (196, 145), (196, 146), (196, 148), (196, 161), (196, 162), (196, 163), (196, 166), (196, 167), (196, 168), (196, 169), (196, 170), (196, 172), (197, 142), (197, 144), (197, 148), (197, 164), (197, 165), (197, 168), (197, 169), (197, 171), (198, 145), (198, 146), (198, 149), (198, 166), (198, 167), (198, 169), (198, 171), (199, 147), (199, 149), (199, 168), (199, 170), (200, 150), (200, 169), (200, 170), (201, 151), (201, 170), (202, 152), (202, 170), (203, 152), (204, 152), (204, 155), (205, 153), (205, 156), (205, 169), (206, 153), (206, 155), (206, 158), (206, 169), (207, 153), (207, 155), (207, 156), (207, 160),
(207, 161), (207, 167), (207, 169), (208, 154), (208, 156), (208, 157), (208, 158), (208, 162), (208, 163), (208, 164), (208, 165), (208, 166), (208, 169), (209, 154), (209, 156), (209, 157), (209, 158), (209, 159), (209, 160), (209, 161), (209, 167), (209, 169), (210, 155), (210, 156), (210, 157), (210, 158), (210, 159), (210, 160), (210, 161), (210, 162), (210, 163), (210, 164), (210, 165), (210, 166), (210, 167), (210, 169), (211, 155), (211, 157), (211, 158), (211, 159), (211, 160), (211, 161), (211, 162), (211, 163), (211, 164), (211, 165), (211, 166), (211, 167), (211, 169), (212, 155), (212, 157), (212, 158), (212, 159), (212, 160), (212, 161), (212, 162), (212, 163), (212, 164), (212, 165), (212, 166), (212, 167), (212, 169), (213, 156), (213, 158), (213, 159), (213, 160), (213, 161), (213, 162), (213, 163), (213, 164), (213, 165), (213, 166),
(213, 167), (214, 156), (214, 158), (214, 159), (214, 160), (214, 161), (214, 162), (214, 163), (214, 164), (214, 165), (214, 166), (214, 168), (215, 157), (215, 159), (215, 160), (215, 161), (215, 162), (215, 167), (216, 158), (216, 163), (216, 164), (216, 166), (217, 159), (217, 161), (217, 162), (225, 160), (225, 162), (226, 160), (226, 164), (226, 166), (227, 160), (227, 162), (227, 163), (227, 167), (227, 169), (228, 159), (228, 161), (228, 162), (228, 163), (228, 164), (228, 165), (228, 166), (228, 171), (229, 159), (229, 161), (229, 162), (229, 163), (229, 164), (229, 165), (229, 166), (229, 167), (229, 168), (229, 170), (230, 159), (230, 161), (230, 162), (230, 163), (230, 164), (230, 165), (230, 166), (230, 167), (230, 169), (231, 159), (231, 161), (231, 162), (231, 163), (231, 164), (231, 165), (231, 166), (231, 168), (232, 158), (232, 160),
(232, 161), (232, 162), (232, 163), (232, 164), (232, 165), (232, 166), (232, 168), (233, 158), (233, 160), (233, 161), (233, 162), (233, 163), (233, 164), (233, 165), (233, 166), (233, 167), (233, 168), (233, 169), (234, 158), (234, 167), (234, 169), (235, 158), (235, 160), (235, 161), (235, 162), (235, 163), (235, 164), (235, 165), (235, 166), (235, 170), (236, 167), (236, 170), (237, 155), (237, 169), (237, 171), (238, 152), (238, 155), (238, 170), (238, 171), (239, 150), (239, 154), (239, 170), (239, 172), (240, 149), (240, 152), (240, 154), (240, 170), (240, 172), (241, 148), (241, 150), (241, 151), (241, 153), (241, 170), (241, 173), (242, 147), (242, 149), (242, 150), (242, 169), (242, 171), (242, 173), (243, 146), (243, 148), (243, 149), (243, 152), (243, 169), (243, 171), (243, 172), (243, 174), (244, 145), (244, 147), (244, 148), (244, 151),
(244, 168), (244, 170), (244, 171), (244, 172), (244, 174), (245, 144), (245, 146), (245, 147), (245, 150), (245, 167), (245, 169), (245, 170), (245, 171), (245, 172), (245, 174), (246, 143), (246, 146), (246, 149), (246, 166), (246, 168), (246, 169), (246, 170), (246, 171), (246, 172), (246, 174), (247, 143), (247, 145), (247, 148), (247, 165), (247, 167), (247, 168), (247, 169), (247, 170), (247, 171), (247, 172), (247, 174), (248, 142), (248, 144), (248, 164), (248, 166), (248, 167), (248, 168), (248, 169), (248, 170), (248, 171), (248, 172), (248, 174), (249, 141), (249, 143), (249, 145), (249, 163), (249, 165), (249, 166), (249, 167), (249, 168), (249, 169), (249, 170), (249, 171), (249, 172), (249, 174), (250, 140), (250, 142), (250, 144), (250, 162), (250, 164), (250, 165), (250, 166), (250, 167), (250, 168), (250, 169), (250, 170), (250, 171),
(250, 172), (250, 174), (251, 139), (251, 141), (251, 143), (251, 161), (251, 163), (251, 164), (251, 165), (251, 166), (251, 167), (251, 168), (251, 169), (251, 170), (251, 171), (251, 172), (251, 174), (252, 140), (252, 141), (252, 161), (252, 163), (252, 164), (252, 165), (252, 166), (252, 167), (252, 168), (252, 169), (252, 170), (252, 171), (252, 172), (252, 174), (253, 136), (253, 139), (253, 140), (253, 142), (253, 160), (253, 162), (253, 163), (253, 164), (253, 165), (253, 166), (253, 167), (253, 168), (253, 169), (253, 170), (253, 171), (253, 172), (253, 174), (254, 133), (254, 135), (254, 138), (254, 139), (254, 141), (254, 160), (254, 162), (254, 163), (254, 164), (254, 165), (254, 166), (254, 167), (254, 168), (254, 169), (254, 170), (254, 171), (254, 172), (254, 174), (255, 136), (255, 137), (255, 138), (255, 140), (255, 159), (255, 161),
(255, 162), (255, 163), (255, 164), (255, 165), (255, 166), (255, 167), (255, 168), (255, 169), (255, 170), (255, 174), (256, 134), (256, 136), (256, 137), (256, 138), (256, 140), (256, 159), (256, 161), (256, 162), (256, 163), (256, 164), (256, 165), (256, 166), (256, 167), (256, 168), (256, 169), (256, 172), (256, 174), (257, 135), (257, 137), (257, 138), (257, 140), (257, 159), (257, 161), (257, 162), (257, 163), (257, 164), (257, 165), (257, 166), (257, 167), (257, 170), (258, 136), (258, 138), (258, 140), (258, 158), (258, 160), (258, 161), (258, 162), (258, 163), (258, 164), (258, 165), (258, 166), (258, 169), (259, 136), (259, 138), (259, 140), (259, 158), (259, 160), (259, 161), (259, 162), (259, 163), (259, 164), (259, 165), (259, 167), (260, 137), (260, 140), (260, 157), (260, 159), (260, 160), (260, 161), (260, 162), (260, 163), (260, 164),
(260, 166), (261, 138), (261, 140), (261, 157), (261, 159), (261, 160), (261, 161), (261, 162), (261, 163), (261, 165), (262, 138), (262, 141), (262, 156), (262, 158), (262, 159), (262, 160), (262, 161), (262, 162), (262, 163), (262, 165), (263, 139), (263, 142), (263, 156), (263, 158), (263, 159), (263, 160), (263, 161), (263, 162), (263, 164), (264, 140), (264, 155), (264, 157), (264, 158), (264, 159), (264, 160), (264, 161), (264, 163), (265, 142), (265, 144), (265, 155), (265, 157), (265, 158), (265, 159), (265, 160), (265, 161), (265, 163), (266, 144), (266, 145), (266, 154), (266, 156), (266, 157), (266, 158), (266, 159), (266, 160), (266, 162), (267, 145), (267, 146), (267, 153), (267, 155), (267, 156), (267, 157), (267, 158), (267, 159), (267, 160), (267, 162), (268, 146), (268, 147), (268, 152), (268, 154), (268, 155), (268, 156), (268, 157),
(268, 158), (268, 159), (268, 160), (268, 162), (269, 147), (269, 150), (269, 153), (269, 154), (269, 155), (269, 156), (269, 157), (269, 158), (269, 159), (269, 161), (270, 148), (270, 152), (270, 153), (270, 154), (270, 155), (270, 156), (270, 157), (270, 158), (270, 159), (270, 161), (271, 151), (271, 152), (271, 153), (271, 154), (271, 155), (271, 156), (271, 157), (271, 158), (271, 159), (271, 161), (272, 149), (272, 151), (272, 152), (272, 153), (272, 154), (272, 155), (272, 156), (272, 157), (272, 158), (272, 159), (272, 161), (273, 150), (273, 152), (273, 153), (273, 154), (273, 155), (273, 156), (273, 157), (273, 158), (273, 159), (273, 160), (273, 162), (274, 151), (274, 153), (274, 154), (274, 155), (274, 156), (274, 157), (274, 158), (274, 159), (274, 160), (274, 162), (275, 152), (275, 154), (275, 155), (275, 156), (275, 157), (275, 158),
(275, 159), (275, 160), (275, 161), (275, 162), (275, 164), (276, 152), (276, 154), (276, 155), (276, 156), (276, 157), (276, 158), (276, 159), (276, 160), (276, 161), (276, 162), (276, 164), (277, 153), (277, 155), (277, 156), (277, 157), (277, 158), (277, 159), (277, 160), (277, 161), (277, 163), (278, 153), (278, 155), (278, 156), (278, 157), (278, 158), (278, 159), (278, 160), (278, 163), (279, 154), (279, 156), (279, 157), (279, 158), (279, 159), (279, 162), (280, 154), (280, 156), (280, 157), (280, 160), (281, 154), (281, 159), (282, 155), (282, 157), )
coordinates_F45DF4 = ((177, 144),
(177, 146), (178, 94), (178, 95), (178, 96), (178, 97), (178, 98), (178, 100), (178, 143), (178, 147), (178, 149), (179, 91), (179, 93), (179, 100), (179, 142), (179, 144), (179, 145), (179, 146), (179, 150), (180, 89), (180, 94), (180, 95), (180, 96), (180, 97), (180, 99), (180, 142), (180, 144), (180, 145), (180, 146), (180, 147), (180, 148), (180, 149), (180, 151), (181, 87), (181, 91), (181, 92), (181, 93), (181, 94), (181, 95), (181, 99), (181, 141), (181, 143), (181, 144), (181, 145), (181, 146), (181, 147), (181, 148), (181, 149), (181, 150), (181, 152), (182, 85), (182, 86), (182, 89), (182, 90), (182, 91), (182, 92), (182, 97), (182, 141), (182, 143), (182, 144), (182, 145), (182, 146), (182, 147), (182, 148), (182, 149), (182, 150), (183, 84), (183, 87), (183, 88), (183, 89), (183, 93), (183, 94), (183, 95),
(183, 140), (183, 142), (183, 143), (183, 144), (183, 145), (183, 146), (183, 147), (183, 148), (183, 149), (183, 150), (183, 151), (183, 153), (184, 82), (184, 85), (184, 86), (184, 90), (184, 91), (184, 92), (184, 140), (184, 142), (184, 143), (184, 144), (184, 145), (184, 146), (184, 147), (184, 148), (184, 149), (184, 150), (184, 151), (184, 152), (184, 154), (185, 81), (185, 87), (185, 88), (185, 89), (185, 139), (185, 141), (185, 142), (185, 143), (185, 144), (185, 145), (185, 146), (185, 147), (185, 148), (185, 149), (185, 150), (185, 151), (185, 152), (185, 154), (186, 79), (186, 84), (186, 85), (186, 86), (186, 139), (186, 141), (186, 142), (186, 143), (186, 144), (186, 145), (186, 146), (186, 147), (186, 148), (186, 149), (186, 150), (186, 151), (186, 152), (186, 154), (187, 77), (187, 83), (187, 139), (187, 141), (187, 142),
(187, 143), (187, 144), (187, 145), (187, 146), (187, 147), (187, 148), (187, 149), (187, 150), (187, 151), (187, 152), (187, 153), (187, 155), (188, 76), (188, 79), (188, 81), (188, 139), (188, 142), (188, 143), (188, 144), (188, 145), (188, 146), (188, 147), (188, 148), (188, 149), (188, 150), (188, 151), (188, 152), (188, 153), (188, 155), (189, 74), (189, 77), (189, 78), (189, 80), (189, 140), (189, 144), (189, 145), (189, 146), (189, 147), (189, 148), (189, 149), (189, 150), (189, 151), (189, 152), (189, 153), (189, 154), (189, 156), (190, 72), (190, 76), (190, 77), (190, 79), (190, 142), (190, 146), (190, 147), (190, 148), (190, 149), (190, 150), (190, 151), (190, 152), (190, 153), (190, 154), (190, 156), (191, 71), (191, 74), (191, 75), (191, 76), (191, 78), (191, 144), (191, 148), (191, 149), (191, 150), (191, 151), (191, 152),
(191, 153), (191, 154), (191, 156), (192, 69), (192, 72), (192, 73), (192, 74), (192, 75), (192, 76), (192, 78), (192, 146), (192, 147), (192, 150), (192, 151), (192, 152), (192, 153), (192, 154), (192, 155), (192, 157), (193, 67), (193, 68), (193, 71), (193, 72), (193, 73), (193, 74), (193, 75), (193, 77), (193, 148), (193, 150), (193, 151), (193, 152), (193, 153), (193, 154), (193, 155), (193, 157), (194, 66), (194, 69), (194, 70), (194, 71), (194, 72), (194, 73), (194, 74), (194, 75), (194, 77), (194, 150), (194, 152), (194, 153), (194, 154), (194, 155), (194, 156), (194, 158), (195, 64), (195, 67), (195, 68), (195, 69), (195, 70), (195, 71), (195, 72), (195, 73), (195, 74), (195, 75), (195, 77), (195, 150), (195, 152), (195, 153), (195, 154), (195, 155), (195, 156), (195, 158), (196, 62), (196, 66), (196, 67),
(196, 68), (196, 69), (196, 70), (196, 71), (196, 72), (196, 73), (196, 74), (196, 75), (196, 76), (196, 78), (196, 150), (196, 152), (196, 153), (196, 154), (196, 155), (196, 156), (196, 157), (196, 159), (197, 60), (197, 64), (197, 65), (197, 66), (197, 67), (197, 68), (197, 69), (197, 70), (197, 71), (197, 72), (197, 73), (197, 74), (197, 75), (197, 76), (197, 78), (197, 151), (197, 153), (197, 154), (197, 155), (197, 156), (197, 157), (197, 158), (197, 160), (198, 58), (198, 59), (198, 62), (198, 63), (198, 64), (198, 65), (198, 66), (198, 67), (198, 68), (198, 69), (198, 70), (198, 71), (198, 72), (198, 73), (198, 74), (198, 75), (198, 76), (198, 77), (198, 79), (198, 151), (198, 153), (198, 154), (198, 155), (198, 156), (198, 157), (198, 158), (198, 159), (198, 162), (199, 56), (199, 57), (199, 60),
(199, 61), (199, 62), (199, 63), (199, 64), (199, 65), (199, 66), (199, 67), (199, 68), (199, 69), (199, 70), (199, 71), (199, 72), (199, 73), (199, 74), (199, 75), (199, 76), (199, 77), (199, 78), (199, 80), (199, 152), (199, 154), (199, 155), (199, 156), (199, 157), (199, 158), (199, 159), (199, 160), (199, 163), (199, 165), (200, 53), (200, 54), (200, 55), (200, 58), (200, 59), (200, 60), (200, 61), (200, 62), (200, 63), (200, 64), (200, 65), (200, 66), (200, 67), (200, 68), (200, 69), (200, 70), (200, 71), (200, 72), (200, 73), (200, 74), (200, 75), (200, 76), (200, 77), (200, 78), (200, 81), (200, 155), (200, 156), (200, 157), (200, 158), (200, 159), (200, 160), (200, 161), (200, 162), (200, 167), (201, 51), (201, 63), (201, 64), (201, 65), (201, 66), (201, 67), (201, 68), (201, 69), (201, 70),
(201, 71), (201, 72), (201, 73), (201, 74), (201, 75), (201, 76), (201, 77), (201, 78), (201, 79), (201, 82), (201, 154), (201, 156), (201, 157), (201, 158), (201, 159), (201, 160), (201, 161), (201, 162), (201, 163), (201, 164), (201, 165), (201, 168), (202, 51), (202, 53), (202, 54), (202, 55), (202, 56), (202, 57), (202, 58), (202, 59), (202, 60), (202, 61), (202, 62), (202, 63), (202, 75), (202, 76), (202, 77), (202, 78), (202, 79), (202, 80), (202, 81), (202, 84), (202, 85), (202, 155), (202, 158), (202, 159), (202, 160), (202, 161), (202, 162), (202, 163), (202, 164), (202, 165), (202, 166), (202, 168), (203, 64), (203, 65), (203, 66), (203, 67), (203, 68), (203, 69), (203, 70), (203, 71), (203, 72), (203, 73), (203, 74), (203, 86), (203, 87), (203, 88), (203, 156), (203, 160), (203, 161), (203, 162),
(203, 163), (203, 164), (203, 165), (203, 166), (203, 168), (204, 75), (204, 76), (204, 77), (204, 78), (204, 79), (204, 80), (204, 81), (204, 82), (204, 85), (204, 89), (204, 90), (204, 91), (204, 92), (204, 93), (204, 94), (204, 95), (204, 96), (204, 97), (204, 158), (204, 163), (204, 164), (204, 165), (204, 166), (204, 168), (205, 83), (205, 84), (205, 87), (205, 88), (205, 89), (205, 98), (205, 99), (205, 100), (205, 102), (205, 160), (205, 162), (205, 167), (206, 85), (206, 86), (206, 89), (206, 90), (206, 91), (206, 92), (206, 93), (206, 94), (206, 95), (206, 96), (206, 102), (206, 163), (206, 165), (206, 166), (207, 87), (207, 88), (207, 98), (207, 99), (207, 101), (208, 89), (208, 90), (208, 91), (208, 92), (208, 93), (208, 94), (208, 95), (208, 96), (208, 97), (237, 89), (237, 91), (237, 92),
(237, 93), (237, 94), (237, 95), (237, 96), (237, 97), (237, 99), (237, 157), (237, 159), (237, 160), (237, 161), (237, 162), (237, 163), (237, 164), (237, 165), (238, 88), (238, 100), (238, 157), (238, 166), (238, 167), (238, 168), (239, 87), (239, 89), (239, 90), (239, 91), (239, 92), (239, 93), (239, 94), (239, 95), (239, 96), (239, 97), (239, 98), (239, 99), (239, 101), (239, 157), (239, 159), (239, 160), (239, 161), (239, 162), (239, 163), (239, 164), (239, 165), (239, 168), (240, 73), (240, 74), (240, 75), (240, 76), (240, 77), (240, 78), (240, 79), (240, 80), (240, 81), (240, 82), (240, 83), (240, 84), (240, 85), (240, 88), (240, 89), (240, 90), (240, 91), (240, 92), (240, 93), (240, 94), (240, 95), (240, 96), (240, 97), (240, 98), (240, 102), (240, 156), (240, 158), (240, 159), (240, 160), (240, 161),
(240, 162), (240, 163), (240, 164), (240, 165), (240, 166), (240, 168), (241, 67), (241, 68), (241, 69), (241, 70), (241, 71), (241, 72), (241, 87), (241, 99), (241, 101), (241, 156), (241, 158), (241, 159), (241, 160), (241, 161), (241, 162), (241, 163), (241, 164), (241, 165), (241, 166), (241, 168), (242, 60), (242, 61), (242, 62), (242, 63), (242, 64), (242, 65), (242, 66), (242, 73), (242, 74), (242, 75), (242, 76), (242, 77), (242, 78), (242, 79), (242, 80), (242, 81), (242, 82), (242, 83), (242, 84), (242, 88), (242, 89), (242, 90), (242, 91), (242, 92), (242, 93), (242, 94), (242, 95), (242, 96), (242, 97), (242, 98), (242, 155), (242, 157), (242, 158), (242, 159), (242, 160), (242, 161), (242, 162), (242, 163), (242, 164), (242, 165), (242, 167), (243, 54), (243, 55), (243, 56), (243, 57), (243, 58),
(243, 59), (243, 67), (243, 68), (243, 69), (243, 70), (243, 71), (243, 72), (243, 73), (243, 74), (243, 75), (243, 76), (243, 77), (243, 78), (243, 79), (243, 80), (243, 81), (243, 82), (243, 85), (243, 86), (243, 87), (243, 154), (243, 156), (243, 157), (243, 158), (243, 159), (243, 160), (243, 161), (243, 162), (243, 163), (243, 164), (243, 166), (244, 54), (244, 55), (244, 57), (244, 61), (244, 62), (244, 63), (244, 64), (244, 65), (244, 66), (244, 67), (244, 68), (244, 69), (244, 70), (244, 71), (244, 72), (244, 73), (244, 74), (244, 75), (244, 76), (244, 77), (244, 78), (244, 79), (244, 80), (244, 81), (244, 84), (244, 153), (244, 155), (244, 156), (244, 157), (244, 158), (244, 159), (244, 160), (244, 161), (244, 162), (244, 163), (244, 165), (245, 59), (245, 60), (245, 63), (245, 64), (245, 65),
(245, 66), (245, 67), (245, 68), (245, 69), (245, 70), (245, 71), (245, 72), (245, 73), (245, 74), (245, 75), (245, 76), (245, 77), (245, 78), (245, 79), (245, 80), (245, 81), (245, 152), (245, 154), (245, 155), (245, 156), (245, 157), (245, 158), (245, 159), (245, 160), (245, 161), (245, 162), (245, 164), (246, 61), (246, 65), (246, 66), (246, 67), (246, 68), (246, 69), (246, 70), (246, 71), (246, 72), (246, 73), (246, 74), (246, 75), (246, 76), (246, 77), (246, 78), (246, 79), (246, 80), (246, 82), (246, 151), (246, 153), (246, 154), (246, 155), (246, 156), (246, 157), (246, 158), (246, 159), (246, 160), (246, 161), (246, 163), (247, 63), (247, 67), (247, 68), (247, 69), (247, 70), (247, 71), (247, 72), (247, 73), (247, 74), (247, 75), (247, 76), (247, 77), (247, 78), (247, 79), (247, 81), (247, 150),
(247, 152), (247, 153), (247, 154), (247, 155), (247, 156), (247, 157), (247, 158), (247, 159), (247, 160), (247, 162), (248, 65), (248, 69), (248, 70), (248, 71), (248, 72), (248, 73), (248, 74), (248, 75), (248, 76), (248, 77), (248, 78), (248, 79), (248, 81), (248, 149), (248, 151), (248, 152), (248, 153), (248, 154), (248, 155), (248, 156), (248, 157), (248, 158), (248, 159), (248, 161), (249, 67), (249, 70), (249, 71), (249, 72), (249, 73), (249, 74), (249, 75), (249, 76), (249, 77), (249, 78), (249, 80), (249, 148), (249, 150), (249, 151), (249, 152), (249, 153), (249, 154), (249, 155), (249, 156), (249, 157), (249, 158), (249, 160), (250, 69), (250, 72), (250, 73), (250, 74), (250, 75), (250, 76), (250, 77), (250, 78), (250, 80), (250, 147), (250, 149), (250, 150), (250, 151), (250, 152), (250, 153), (250, 154),
(250, 155), (250, 156), (250, 157), (250, 158), (250, 160), (251, 70), (251, 73), (251, 74), (251, 75), (251, 76), (251, 77), (251, 78), (251, 80), (251, 146), (251, 148), (251, 149), (251, 150), (251, 151), (251, 152), (251, 153), (251, 154), (251, 155), (251, 156), (251, 157), (251, 159), (252, 72), (252, 75), (252, 76), (252, 77), (252, 78), (252, 79), (252, 81), (252, 145), (252, 147), (252, 148), (252, 149), (252, 150), (252, 151), (252, 152), (252, 153), (252, 154), (252, 155), (252, 156), (252, 158), (253, 73), (253, 76), (253, 77), (253, 78), (253, 79), (253, 80), (253, 83), (253, 144), (253, 146), (253, 147), (253, 148), (253, 149), (253, 150), (253, 151), (253, 152), (253, 153), (253, 154), (253, 155), (253, 156), (253, 158), (254, 75), (254, 78), (254, 79), (254, 80), (254, 81), (254, 84), (254, 143), (254, 145),
(254, 146), (254, 147), (254, 148), (254, 149), (254, 150), (254, 151), (254, 152), (254, 153), (254, 154), (254, 155), (254, 157), (255, 76), (255, 79), (255, 80), (255, 81), (255, 82), (255, 83), (255, 86), (255, 143), (255, 145), (255, 146), (255, 147), (255, 148), (255, 149), (255, 150), (255, 151), (255, 152), (255, 153), (255, 154), (255, 155), (255, 157), (256, 78), (256, 81), (256, 82), (256, 83), (256, 84), (256, 88), (256, 142), (256, 144), (256, 145), (256, 146), (256, 147), (256, 148), (256, 149), (256, 150), (256, 151), (256, 152), (256, 153), (256, 154), (256, 155), (256, 157), (257, 79), (257, 82), (257, 83), (257, 84), (257, 85), (257, 86), (257, 89), (257, 142), (257, 144), (257, 145), (257, 146), (257, 147), (257, 148), (257, 149), (257, 150), (257, 151), (257, 152), (257, 153), (257, 154), (257, 156), (258, 81),
(258, 84), (258, 85), (258, 86), (258, 87), (258, 88), (258, 91), (258, 142), (258, 144), (258, 145), (258, 146), (258, 147), (258, 148), (258, 149), (258, 150), (258, 151), (258, 152), (258, 153), (258, 154), (258, 156), (259, 82), (259, 85), (259, 86), (259, 87), (259, 88), (259, 89), (259, 90), (259, 93), (259, 142), (259, 144), (259, 145), (259, 146), (259, 147), (259, 148), (259, 149), (259, 150), (259, 151), (259, 152), (259, 153), (259, 154), (259, 155), (259, 156), (260, 84), (260, 87), (260, 88), (260, 89), (260, 90), (260, 91), (260, 95), (260, 142), (260, 144), (260, 145), (260, 146), (260, 147), (260, 148), (260, 149), (260, 150), (260, 151), (260, 152), (260, 153), (260, 155), (261, 85), (261, 88), (261, 89), (261, 90), (261, 91), (261, 92), (261, 93), (261, 97), (261, 143), (261, 145), (261, 146), (261, 147),
(261, 148), (261, 149), (261, 150), (261, 151), (261, 152), (261, 153), (261, 155), (262, 87), (262, 90), (262, 91), (262, 92), (262, 93), (262, 94), (262, 95), (262, 99), (262, 143), (262, 145), (262, 146), (262, 147), (262, 148), (262, 149), (262, 150), (262, 151), (262, 152), (262, 154), (263, 88), (263, 91), (263, 92), (263, 93), (263, 94), (263, 95), (263, 96), (263, 97), (263, 101), (263, 144), (263, 146), (263, 147), (263, 148), (263, 149), (263, 150), (263, 151), (263, 152), (263, 154), (264, 90), (264, 93), (264, 94), (264, 95), (264, 96), (264, 97), (264, 98), (264, 99), (264, 103), (264, 145), (264, 147), (264, 148), (264, 149), (264, 150), (264, 151), (264, 153), (265, 91), (265, 94), (265, 95), (265, 96), (265, 97), (265, 98), (265, 99), (265, 100), (265, 101), (265, 105), (265, 146), (265, 148), (265, 149),
(265, 150), (265, 152), (266, 93), (266, 105), (266, 107), (266, 147), (266, 152), (267, 94), (267, 96), (267, 97), (267, 98), (267, 99), (267, 100), (267, 101), (267, 102), (267, 103), (267, 148), (267, 150), )
coordinates_FF5500 = ((168, 161),
(169, 161), (169, 165), (170, 160), (170, 162), (170, 163), (170, 166), (171, 160), (171, 162), (171, 163), (171, 164), (171, 165), (171, 167), (172, 160), (172, 161), (172, 162), (172, 163), (172, 164), (172, 165), (172, 166), (172, 168), (173, 161), (173, 163), (173, 164), (173, 165), (173, 166), (173, 168), (174, 161), (174, 163), (174, 164), (174, 165), (174, 166), (174, 167), (174, 169), (175, 161), (175, 163), (175, 164), (175, 165), (175, 166), (175, 167), (175, 168), (175, 169), (176, 162), (176, 164), (176, 165), (176, 166), (176, 167), (176, 168), (176, 170), (177, 162), (177, 164), (177, 165), (177, 166), (177, 167), (177, 168), (177, 169), (177, 170), (178, 163), (178, 165), (178, 166), (178, 167), (178, 168), (178, 169), (178, 171), (179, 163), (179, 165), (179, 166), (179, 167), (179, 168), (179, 169), (179, 171), (180, 164), (180, 167),
(180, 168), (180, 169), (180, 170), (180, 172), (181, 165), (181, 168), (181, 169), (181, 170), (181, 172), (182, 167), (182, 169), (182, 170), (182, 171), (182, 172), (182, 173), (183, 168), (183, 170), (183, 171), (183, 173), (184, 169), (184, 171), (184, 173), (185, 170), (185, 173), (186, 171), (186, 174), (187, 172), (187, 174), (258, 172), (258, 174), (259, 170), (260, 169), (260, 173), (261, 168), (261, 170), (261, 171), (261, 173), (262, 167), (262, 169), (262, 170), (262, 171), (262, 173), (263, 166), (263, 168), (263, 169), (263, 170), (263, 172), (264, 166), (264, 168), (264, 169), (264, 170), (264, 172), (265, 165), (265, 167), (265, 168), (265, 169), (265, 170), (265, 171), (265, 172), (266, 165), (266, 167), (266, 168), (266, 169), (266, 171), (267, 164), (267, 166), (267, 167), (267, 168), (267, 169), (267, 171), (268, 164), (268, 166),
(268, 167), (268, 168), (268, 170), (269, 164), (269, 166), (269, 167), (269, 168), (269, 170), (270, 163), (270, 164), (270, 165), (270, 166), (270, 167), (270, 169), (271, 163), (271, 165), (271, 166), (272, 168), (273, 164), (273, 167), )
coordinates_CC3300 = ((163, 143),
(164, 142), (164, 144), (165, 141), (165, 143), (165, 146), (165, 147), (165, 149), (166, 140), (166, 142), (166, 143), (166, 144), (167, 139), (167, 141), (167, 142), (167, 143), (167, 144), (167, 145), (167, 146), (167, 148), (168, 141), (168, 142), (168, 143), (168, 144), (168, 145), (168, 147), (169, 138), (169, 140), (169, 141), (169, 142), (169, 143), (169, 144), (169, 146), (170, 137), (170, 139), (170, 140), (170, 141), (170, 142), (170, 143), (170, 145), (171, 136), (171, 138), (171, 139), (171, 140), (171, 141), (171, 142), (171, 143), (171, 145), (172, 138), (172, 139), (172, 140), (172, 141), (172, 142), (172, 144), (173, 135), (173, 137), (173, 138), (173, 139), (173, 140), (173, 141), (173, 143), (174, 134), (174, 136), (174, 137), (174, 138), (174, 139), (174, 140), (174, 141), (174, 143), (175, 133), (175, 135), (175, 136), (175, 137),
(175, 138), (175, 139), (175, 140), (175, 141), (175, 143), (176, 133), (176, 135), (176, 136), (176, 137), (176, 138), (176, 139), (176, 140), (176, 143), (177, 132), (177, 134), (177, 135), (177, 136), (177, 137), (177, 138), (177, 139), (178, 131), (178, 133), (178, 134), (178, 135), (178, 136), (178, 137), (178, 138), (178, 140), (179, 131), (179, 133), (179, 134), (179, 135), (179, 136), (179, 137), (179, 139), (180, 130), (180, 132), (180, 133), (180, 134), (180, 135), (180, 136), (180, 138), (181, 131), (181, 132), (181, 133), (181, 134), (181, 135), (181, 137), (182, 129), (182, 131), (182, 132), (182, 133), (182, 134), (182, 136), (183, 128), (183, 130), (183, 131), (183, 132), (183, 133), (183, 135), (184, 128), (184, 130), (184, 131), (184, 132), (184, 134), (185, 127), (185, 129), (185, 130), (185, 131), (185, 133), (186, 127), (186, 129),
(186, 130), (186, 132), (187, 126), (187, 128), (187, 129), (187, 131), (188, 126), (188, 130), (189, 126), (189, 129), (190, 127), (252, 123), (252, 126), (253, 123), (253, 128), (254, 123), (254, 125), (254, 126), (254, 130), (255, 124), (255, 125), (255, 126), (255, 127), (255, 128), (255, 131), (256, 124), (256, 126), (256, 127), (256, 128), (256, 129), (256, 130), (256, 132), (257, 125), (257, 127), (257, 128), (257, 129), (257, 130), (257, 131), (257, 133), (258, 125), (258, 127), (258, 128), (258, 129), (258, 130), (258, 131), (258, 133), (259, 126), (259, 128), (259, 129), (259, 130), (259, 131), (259, 132), (259, 134), (260, 127), (260, 129), (260, 130), (260, 131), (260, 132), (260, 133), (260, 135), (261, 127), (261, 129), (261, 130), (261, 131), (261, 132), (261, 133), (261, 135), (262, 128), (262, 130), (262, 131), (262, 132), (262, 133),
(262, 134), (262, 136), (263, 129), (263, 131), (263, 132), (263, 133), (263, 134), (263, 135), (263, 137), (264, 130), (264, 132), (264, 133), (264, 134), (264, 135), (264, 136), (264, 138), (265, 130), (265, 132), (265, 133), (265, 134), (265, 135), (265, 136), (265, 137), (265, 139), (266, 131), (266, 133), (266, 134), (266, 135), (266, 136), (266, 137), (266, 138), (266, 140), (267, 132), (267, 134), (267, 135), (267, 136), (267, 137), (267, 138), (267, 139), (267, 142), (268, 133), (268, 135), (268, 136), (268, 137), (268, 138), (268, 139), (268, 140), (268, 143), (269, 134), (269, 136), (269, 137), (269, 138), (269, 139), (269, 140), (269, 141), (269, 142), (269, 144), (270, 137), (270, 138), (270, 139), (270, 140), (270, 141), (270, 142), (270, 143), (270, 145), (271, 135), (271, 137), (271, 138), (271, 139), (271, 140), (271, 141), (271, 142),
(271, 143), (271, 144), (271, 146), (272, 136), (272, 138), (272, 139), (272, 140), (272, 141), (272, 142), (272, 143), (272, 144), (272, 145), (272, 147), (273, 137), (273, 139), (273, 140), (273, 141), (273, 142), (273, 143), (273, 144), (273, 145), (273, 146), (273, 148), (274, 138), (274, 140), (274, 141), (274, 142), (274, 143), (274, 144), (274, 145), (274, 146), (275, 139), (275, 141), (275, 142), (275, 143), (275, 144), (275, 145), (275, 146), (275, 147), (275, 149), (276, 140), (276, 142), (276, 143), (276, 144), (276, 145), (276, 146), (276, 147), (276, 148), (276, 150), (277, 141), (277, 143), (277, 144), (277, 145), (277, 146), (277, 147), (277, 148), (277, 149), (278, 142), (278, 144), (278, 145), (278, 146), (278, 147), (278, 148), (278, 151), (279, 143), (279, 145), (279, 146), (279, 147), (279, 149), (279, 150), (279, 152), (280, 144),
(280, 146), (280, 148), (281, 145), (281, 147), (282, 146), )
coordinates_FFCCCC = ((159, 58),
(159, 59), (160, 58), (161, 58), (161, 59), (163, 58), (163, 59), (183, 29), (183, 31), (184, 27), (184, 34), (185, 25), (185, 28), (185, 29), (185, 30), (185, 31), (185, 32), (185, 35), (185, 36), (185, 37), (186, 24), (186, 27), (186, 28), (186, 29), (186, 30), (186, 31), (186, 32), (186, 33), (186, 34), (186, 38), (186, 40), (187, 23), (187, 25), (187, 26), (187, 27), (187, 28), (187, 29), (187, 30), (187, 31), (187, 32), (187, 33), (187, 34), (187, 35), (187, 36), (187, 37), (187, 40), (188, 22), (188, 24), (188, 25), (188, 26), (188, 27), (188, 28), (188, 29), (188, 30), (188, 31), (188, 32), (188, 33), (188, 34), (188, 35), (188, 36), (188, 37), (188, 38), (188, 39), (188, 41), (189, 24), (189, 25), (189, 26), (189, 27), (189, 28), (189, 29), (189, 30), (189, 31), (189, 32),
(189, 33), (189, 34), (189, 35), (189, 36), (189, 37), (189, 38), (189, 39), (189, 40), (189, 43), (189, 44), (189, 46), (190, 21), (190, 23), (190, 24), (190, 25), (190, 26), (190, 27), (190, 28), (190, 29), (190, 30), (190, 31), (190, 32), (190, 33), (190, 34), (190, 35), (190, 36), (190, 37), (190, 38), (190, 39), (190, 40), (190, 41), (190, 46), (191, 20), (191, 22), (191, 23), (191, 24), (191, 25), (191, 26), (191, 27), (191, 28), (191, 29), (191, 30), (191, 31), (191, 32), (191, 33), (191, 34), (191, 35), (191, 36), (191, 37), (191, 38), (191, 39), (191, 40), (191, 41), (191, 42), (191, 43), (191, 44), (191, 45), (191, 47), (192, 19), (192, 21), (192, 22), (192, 23), (192, 24), (192, 25), (192, 26), (192, 27), (192, 28), (192, 29), (192, 30), (192, 31), (192, 32), (192, 33),
(192, 34), (192, 35), (192, 36), (192, 37), (192, 38), (192, 39), (192, 40), (192, 41), (192, 42), (192, 43), (192, 44), (192, 45), (192, 47), (193, 19), (193, 21), (193, 22), (193, 23), (193, 24), (193, 25), (193, 26), (193, 27), (193, 28), (193, 29), (193, 30), (193, 31), (193, 32), (193, 33), (193, 34), (193, 35), (193, 36), (193, 37), (193, 38), (193, 39), (193, 40), (193, 41), (193, 42), (193, 43), (193, 44), (193, 45), (193, 47), (194, 18), (194, 20), (194, 21), (194, 22), (194, 23), (194, 24), (194, 25), (194, 26), (194, 27), (194, 28), (194, 29), (194, 30), (194, 31), (194, 32), (194, 33), (194, 34), (194, 35), (194, 36), (194, 37), (194, 38), (194, 39), (194, 40), (194, 41), (194, 42), (194, 43), (194, 44), (194, 45), (194, 46), (194, 48), (195, 18), (195, 20), (195, 21),
(195, 22), (195, 23), (195, 24), (195, 25), (195, 26), (195, 27), (195, 28), (195, 29), (195, 30), (195, 31), (195, 32), (195, 33), (195, 34), (195, 35), (195, 36), (195, 37), (195, 38), (195, 39), (195, 40), (195, 41), (195, 42), (195, 43), (195, 44), (195, 45), (195, 46), (195, 48), (196, 17), (196, 19), (196, 20), (196, 21), (196, 22), (196, 23), (196, 24), (196, 25), (196, 26), (196, 27), (196, 28), (196, 29), (196, 30), (196, 31), (196, 32), (196, 33), (196, 34), (196, 35), (196, 36), (196, 37), (196, 38), (196, 39), (196, 40), (196, 41), (196, 42), (196, 43), (196, 44), (196, 45), (196, 46), (196, 47), (196, 49), (197, 17), (197, 19), (197, 20), (197, 21), (197, 22), (197, 23), (197, 24), (197, 25), (197, 26), (197, 27), (197, 28), (197, 29), (197, 30), (197, 31), (197, 32),
(197, 33), (197, 34), (197, 35), (197, 36), (197, 37), (197, 38), (197, 39), (197, 40), (197, 41), (197, 42), (197, 43), (197, 44), (197, 45), (197, 46), (197, 47), (197, 49), (198, 16), (198, 18), (198, 19), (198, 20), (198, 21), (198, 22), (198, 23), (198, 24), (198, 25), (198, 26), (198, 27), (198, 28), (198, 29), (198, 30), (198, 31), (198, 32), (198, 33), (198, 34), (198, 35), (198, 36), (198, 37), (198, 38), (198, 39), (198, 40), (198, 41), (198, 42), (198, 43), (198, 44), (198, 45), (198, 46), (198, 47), (198, 49), (199, 16), (199, 18), (199, 19), (199, 20), (199, 21), (199, 22), (199, 23), (199, 24), (199, 25), (199, 26), (199, 27), (199, 28), (199, 29), (199, 30), (199, 31), (199, 32), (199, 33), (199, 34), (199, 35), (199, 36), (199, 37), (199, 38), (199, 39), (199, 40),
(199, 41), (199, 42), (199, 43), (199, 44), (199, 45), (199, 46), (199, 47), (199, 49), (200, 15), (200, 17), (200, 18), (200, 19), (200, 20), (200, 21), (200, 22), (200, 23), (200, 24), (200, 25), (200, 26), (200, 27), (200, 28), (200, 29), (200, 30), (200, 31), (200, 32), (200, 33), (200, 34), (200, 35), (200, 36), (200, 37), (200, 38), (200, 39), (200, 40), (200, 41), (200, 42), (200, 43), (200, 44), (200, 45), (200, 46), (200, 47), (200, 49), (201, 15), (201, 17), (201, 18), (201, 19), (201, 20), (201, 21), (201, 22), (201, 23), (201, 24), (201, 25), (201, 26), (201, 27), (201, 28), (201, 29), (201, 30), (201, 31), (201, 32), (201, 33), (201, 34), (201, 35), (201, 36), (201, 37), (201, 38), (201, 39), (201, 40), (201, 41), (201, 42), (201, 43), (201, 44), (201, 45), (201, 46),
(201, 47), (201, 49), (202, 15), (202, 17), (202, 18), (202, 19), (202, 20), (202, 21), (202, 22), (202, 23), (202, 24), (202, 25), (202, 26), (202, 27), (202, 28), (202, 29), (202, 30), (202, 31), (202, 32), (202, 33), (202, 34), (202, 35), (202, 36), (202, 37), (202, 38), (202, 39), (202, 40), (202, 41), (202, 42), (202, 43), (202, 44), (202, 45), (202, 46), (202, 47), (202, 49), (203, 14), (203, 16), (203, 17), (203, 18), (203, 19), (203, 20), (203, 21), (203, 22), (203, 23), (203, 24), (203, 25), (203, 26), (203, 27), (203, 28), (203, 29), (203, 30), (203, 31), (203, 32), (203, 33), (203, 34), (203, 35), (203, 36), (203, 37), (203, 38), (203, 39), (203, 40), (203, 41), (203, 42), (203, 43), (203, 44), (203, 45), (203, 46), (203, 47), (203, 49), (204, 14), (204, 16), (204, 17),
(204, 18), (204, 19), (204, 20), (204, 21), (204, 22), (204, 23), (204, 24), (204, 25), (204, 26), (204, 27), (204, 28), (204, 29), (204, 30), (204, 31), (204, 32), (204, 33), (204, 34), (204, 35), (204, 36), (204, 37), (204, 38), (204, 39), (204, 40), (204, 41), (204, 42), (204, 43), (204, 44), (204, 45), (204, 46), (204, 47), (204, 49), (205, 14), (205, 16), (205, 17), (205, 18), (205, 19), (205, 20), (205, 21), (205, 22), (205, 23), (205, 24), (205, 25), (205, 26), (205, 27), (205, 28), (205, 29), (205, 30), (205, 31), (205, 32), (205, 33), (205, 34), (205, 35), (205, 36), (205, 37), (205, 38), (205, 39), (205, 40), (205, 41), (205, 42), (205, 43), (205, 44), (205, 45), (205, 46), (205, 47), (205, 49), (206, 13), (206, 14), (206, 15), (206, 16), (206, 17), (206, 18), (206, 19),
(206, 20), (206, 21), (206, 22), (206, 23), (206, 24), (206, 25), (206, 26), (206, 27), (206, 28), (206, 29), (206, 30), (206, 31), (206, 32), (206, 33), (206, 34), (206, 35), (206, 36), (206, 37), (206, 38), (206, 39), (206, 40), (206, 41), (206, 42), (206, 43), (206, 44), (206, 45), (206, 46), (206, 47), (206, 48), (207, 13), (207, 15), (207, 16), (207, 17), (207, 18), (207, 19), (207, 20), (207, 21), (207, 22), (207, 23), (207, 24), (207, 25), (207, 26), (207, 27), (207, 28), (207, 29), (207, 30), (207, 31), (207, 32), (207, 33), (207, 34), (207, 35), (207, 36), (207, 37), (207, 38), (207, 39), (207, 40), (207, 41), (207, 42), (207, 43), (207, 44), (207, 45), (207, 46), (207, 48), (208, 13), (208, 15), (208, 16), (208, 17), (208, 18), (208, 19), (208, 20), (208, 21), (208, 22),
(208, 23), (208, 24), (208, 25), (208, 26), (208, 27), (208, 28), (208, 29), (208, 30), (208, 31), (208, 32), (208, 33), (208, 34), (208, 35), (208, 36), (208, 37), (208, 38), (208, 39), (208, 40), (208, 41), (208, 42), (208, 43), (208, 44), (208, 45), (208, 47), (209, 13), (209, 15), (209, 16), (209, 17), (209, 18), (209, 19), (209, 20), (209, 21), (209, 22), (209, 23), (209, 24), (209, 25), (209, 26), (209, 27), (209, 28), (209, 29), (209, 30), (209, 31), (209, 32), (209, 33), (209, 34), (209, 35), (209, 36), (209, 37), (209, 38), (209, 39), (209, 40), (209, 41), (209, 42), (209, 43), (209, 44), (209, 46), (210, 13), (210, 15), (210, 16), (210, 17), (210, 18), (210, 19), (210, 20), (210, 21), (210, 22), (210, 23), (210, 24), (210, 25), (210, 26), (210, 27), (210, 28), (210, 29),
(210, 30), (210, 31), (210, 32), (210, 33), (210, 34), (210, 35), (210, 36), (210, 37), (210, 38), (210, 39), (210, 40), (210, 41), (210, 42), (210, 43), (210, 45), (211, 13), (211, 15), (211, 16), (211, 17), (211, 18), (211, 19), (211, 20), (211, 21), (211, 22), (211, 23), (211, 24), (211, 25), (211, 26), (211, 27), (211, 28), (211, 29), (211, 30), (211, 31), (211, 32), (211, 33), (211, 34), (211, 35), (211, 36), (211, 37), (211, 38), (211, 39), (211, 40), (211, 41), (211, 42), (211, 44), (212, 15), (212, 16), (212, 17), (212, 18), (212, 19), (212, 20), (212, 21), (212, 22), (212, 23), (212, 24), (212, 25), (212, 26), (212, 27), (212, 28), (212, 29), (212, 30), (212, 31), (212, 32), (212, 33), (212, 34), (212, 35), (212, 36), (212, 37), (212, 38), (212, 39), (212, 40), (212, 41),
(212, 43), (213, 14), (213, 16), (213, 17), (213, 18), (213, 19), (213, 20), (213, 21), (213, 22), (213, 23), (213, 24), (213, 25), (213, 26), (213, 27), (213, 28), (213, 29), (213, 30), (213, 31), (213, 32), (213, 33), (213, 34), (213, 35), (213, 36), (213, 37), (213, 38), (213, 39), (213, 42), (214, 15), (214, 17), (214, 18), (214, 19), (214, 20), (214, 21), (214, 22), (214, 23), (214, 24), (214, 25), (214, 26), (214, 27), (214, 28), (214, 29), (214, 30), (214, 31), (214, 32), (214, 33), (214, 34), (214, 35), (214, 36), (214, 37), (214, 38), (214, 41), (215, 18), (215, 19), (215, 20), (215, 21), (215, 22), (215, 23), (215, 24), (215, 25), (215, 26), (215, 27), (215, 28), (215, 29), (215, 30), (215, 31), (215, 32), (215, 33), (215, 34), (215, 35), (215, 36), (215, 37), (215, 38),
(215, 40), (216, 16), (216, 18), (216, 19), (216, 20), (216, 21), (216, 22), (216, 23), (216, 24), (216, 25), (216, 26), (216, 27), (216, 28), (216, 29), (216, 30), (216, 31), (216, 32), (216, 33), (216, 34), (216, 35), (216, 36), (216, 37), (216, 39), (217, 17), (217, 19), (217, 20), (217, 21), (217, 22), (217, 23), (217, 24), (217, 25), (217, 26), (217, 27), (217, 28), (217, 29), (217, 30), (217, 31), (217, 32), (217, 33), (217, 34), (217, 35), (217, 36), (217, 38), (218, 18), (218, 20), (218, 21), (218, 22), (218, 23), (218, 24), (218, 25), (218, 26), (218, 27), (218, 28), (218, 29), (218, 30), (218, 31), (218, 32), (218, 33), (218, 34), (218, 35), (218, 37), (219, 19), (219, 37), (220, 20), (220, 22), (220, 23), (220, 24), (220, 25), (220, 26), (220, 27), (220, 28), (220, 29),
(220, 30), (220, 31), (220, 32), (220, 33), (220, 34), (220, 35), (220, 37), (225, 19), (225, 21), (225, 22), (225, 23), (225, 24), (225, 25), (225, 26), (225, 27), (225, 28), (225, 29), (225, 30), (225, 31), (225, 32), (225, 33), (225, 34), (225, 35), (225, 36), (225, 37), (225, 38), (225, 40), (226, 18), (226, 41), (227, 18), (227, 20), (227, 21), (227, 22), (227, 23), (227, 24), (227, 25), (227, 26), (227, 27), (227, 28), (227, 29), (227, 30), (227, 31), (227, 32), (227, 33), (227, 34), (227, 35), (227, 36), (227, 37), (227, 38), (227, 39), (227, 40), (228, 17), (228, 19), (228, 20), (228, 21), (228, 22), (228, 23), (228, 24), (228, 25), (228, 26), (228, 27), (228, 28), (228, 29), (228, 30), (228, 31), (228, 32), (228, 33), (228, 34), (228, 35), (228, 36), (228, 37), (228, 38),
(228, 39), (228, 40), (228, 41), (228, 44), (229, 16), (229, 18), (229, 19), (229, 20), (229, 21), (229, 22), (229, 23), (229, 24), (229, 25), (229, 26), (229, 27), (229, 28), (229, 29), (229, 30), (229, 31), (229, 32), (229, 33), (229, 34), (229, 35), (229, 36), (229, 37), (229, 38), (229, 39), (229, 40), (229, 41), (229, 42), (229, 45), (230, 15), (230, 17), (230, 18), (230, 19), (230, 20), (230, 21), (230, 22), (230, 23), (230, 24), (230, 25), (230, 26), (230, 27), (230, 28), (230, 29), (230, 30), (230, 31), (230, 32), (230, 33), (230, 34), (230, 35), (230, 36), (230, 37), (230, 38), (230, 39), (230, 40), (230, 41), (230, 42), (230, 43), (230, 44), (230, 46), (231, 14), (231, 16), (231, 17), (231, 18), (231, 19), (231, 20), (231, 21), (231, 22), (231, 23), (231, 24), (231, 25),
(231, 26), (231, 27), (231, 28), (231, 29), (231, 30), (231, 31), (231, 32), (231, 33), (231, 34), (231, 35), (231, 36), (231, 37), (231, 38), (231, 39), (231, 40), (231, 41), (231, 42), (231, 43), (231, 44), (231, 45), (232, 14), (232, 16), (232, 17), (232, 18), (232, 19), (232, 20), (232, 21), (232, 22), (232, 23), (232, 24), (232, 25), (232, 26), (232, 27), (232, 28), (232, 29), (232, 30), (232, 31), (232, 32), (232, 33), (232, 34), (232, 35), (232, 36), (232, 37), (232, 38), (232, 39), (232, 40), (232, 41), (232, 42), (232, 43), (232, 44), (232, 45), (232, 46), (232, 48), (233, 13), (233, 15), (233, 16), (233, 17), (233, 18), (233, 19), (233, 20), (233, 21), (233, 22), (233, 23), (233, 24), (233, 25), (233, 26), (233, 27), (233, 28), (233, 29), (233, 30), (233, 31), (233, 32),
(233, 33), (233, 34), (233, 35), (233, 36), (233, 37), (233, 38), (233, 39), (233, 40), (233, 41), (233, 42), (233, 43), (233, 44), (233, 45), (233, 46), (233, 47), (233, 49), (234, 13), (234, 15), (234, 16), (234, 17), (234, 18), (234, 19), (234, 20), (234, 21), (234, 22), (234, 23), (234, 24), (234, 25), (234, 26), (234, 27), (234, 28), (234, 29), (234, 30), (234, 31), (234, 32), (234, 33), (234, 34), (234, 35), (234, 36), (234, 37), (234, 38), (234, 39), (234, 40), (234, 41), (234, 42), (234, 43), (234, 44), (234, 45), (234, 46), (234, 47), (234, 48), (234, 50), (235, 13), (235, 15), (235, 16), (235, 17), (235, 18), (235, 19), (235, 20), (235, 21), (235, 22), (235, 23), (235, 24), (235, 25), (235, 26), (235, 27), (235, 28), (235, 29), (235, 30), (235, 31), (235, 32), (235, 33),
(235, 34), (235, 35), (235, 36), (235, 37), (235, 38), (235, 39), (235, 40), (235, 41), (235, 42), (235, 43), (235, 44), (235, 45), (235, 46), (235, 47), (235, 48), (235, 49), (235, 51), (236, 13), (236, 15), (236, 16), (236, 17), (236, 18), (236, 19), (236, 20), (236, 21), (236, 22), (236, 23), (236, 24), (236, 25), (236, 26), (236, 27), (236, 28), (236, 29), (236, 30), (236, 31), (236, 32), (236, 33), (236, 34), (236, 35), (236, 36), (236, 37), (236, 38), (236, 39), (236, 40), (236, 41), (236, 42), (236, 43), (236, 44), (236, 45), (236, 46), (236, 47), (236, 48), (236, 49), (236, 51), (237, 13), (237, 15), (237, 16), (237, 17), (237, 18), (237, 19), (237, 20), (237, 21), (237, 22), (237, 23), (237, 24), (237, 25), (237, 26), (237, 27), (237, 28), (237, 29), (237, 30), (237, 31),
(237, 32), (237, 33), (237, 34), (237, 35), (237, 36), (237, 37), (237, 38), (237, 39), (237, 40), (237, 41), (237, 42), (237, 43), (237, 44), (237, 45), (237, 46), (237, 47), (237, 48), (237, 49), (237, 51), (238, 12), (238, 13), (238, 14), (238, 15), (238, 16), (238, 17), (238, 18), (238, 19), (238, 20), (238, 21), (238, 22), (238, 23), (238, 24), (238, 25), (238, 26), (238, 27), (238, 28), (238, 29), (238, 30), (238, 31), (238, 32), (238, 33), (238, 34), (238, 35), (238, 36), (238, 37), (238, 38), (238, 39), (238, 40), (238, 41), (238, 42), (238, 43), (238, 44), (238, 45), (238, 46), (238, 47), (238, 48), (238, 49), (238, 50), (238, 52), (239, 13), (239, 15), (239, 16), (239, 17), (239, 18), (239, 19), (239, 20), (239, 21), (239, 22), (239, 23), (239, 24), (239, 25), (239, 26),
(239, 27), (239, 28), (239, 29), (239, 30), (239, 31), (239, 32), (239, 33), (239, 34), (239, 35), (239, 36), (239, 37), (239, 38), (239, 39), (239, 40), (239, 41), (239, 42), (239, 43), (239, 44), (239, 45), (239, 46), (239, 47), (239, 48), (239, 49), (239, 50), (239, 52), (240, 13), (240, 15), (240, 16), (240, 17), (240, 18), (240, 19), (240, 20), (240, 21), (240, 22), (240, 23), (240, 24), (240, 25), (240, 26), (240, 27), (240, 28), (240, 29), (240, 30), (240, 31), (240, 32), (240, 33), (240, 34), (240, 35), (240, 36), (240, 37), (240, 38), (240, 39), (240, 40), (240, 41), (240, 42), (240, 43), (240, 44), (240, 45), (240, 46), (240, 47), (240, 48), (240, 49), (240, 50), (240, 52), (241, 13), (241, 15), (241, 16), (241, 17), (241, 18), (241, 19), (241, 20), (241, 21), (241, 22),
(241, 23), (241, 24), (241, 25), (241, 26), (241, 27), (241, 28), (241, 29), (241, 30), (241, 31), (241, 32), (241, 33), (241, 34), (241, 35), (241, 36), (241, 37), (241, 38), (241, 39), (241, 40), (241, 41), (241, 42), (241, 43), (241, 44), (241, 45), (241, 46), (241, 47), (241, 48), (241, 49), (241, 50), (241, 52), (242, 13), (242, 15), (242, 16), (242, 17), (242, 18), (242, 19), (242, 20), (242, 21), (242, 22), (242, 23), (242, 24), (242, 25), (242, 26), (242, 27), (242, 28), (242, 29), (242, 30), (242, 31), (242, 32), (242, 33), (242, 34), (242, 35), (242, 36), (242, 37), (242, 38), (242, 39), (242, 40), (242, 41), (242, 42), (242, 43), (242, 44), (242, 45), (242, 46), (242, 47), (242, 48), (242, 49), (242, 50), (242, 52), (243, 13), (243, 15), (243, 16), (243, 17), (243, 18),
(243, 19), (243, 20), (243, 21), (243, 22), (243, 23), (243, 24), (243, 25), (243, 26), (243, 27), (243, 28), (243, 29), (243, 30), (243, 31), (243, 32), (243, 33), (243, 34), (243, 35), (243, 36), (243, 37), (243, 38), (243, 39), (243, 40), (243, 41), (243, 42), (243, 43), (243, 44), (243, 45), (243, 46), (243, 47), (243, 48), (243, 49), (243, 50), (243, 52), (244, 13), (244, 15), (244, 16), (244, 17), (244, 18), (244, 19), (244, 20), (244, 21), (244, 22), (244, 23), (244, 24), (244, 25), (244, 26), (244, 27), (244, 28), (244, 29), (244, 30), (244, 31), (244, 32), (244, 33), (244, 34), (244, 35), (244, 36), (244, 37), (244, 38), (244, 39), (244, 40), (244, 41), (244, 42), (244, 43), (244, 44), (244, 45), (244, 46), (244, 47), (244, 48), (244, 49), (244, 50), (244, 52), (245, 13),
(245, 15), (245, 16), (245, 17), (245, 18), (245, 19), (245, 20), (245, 21), (245, 22), (245, 23), (245, 24), (245, 25), (245, 26), (245, 27), (245, 28), (245, 29), (245, 30), (245, 31), (245, 32), (245, 33), (245, 34), (245, 35), (245, 36), (245, 37), (245, 38), (245, 39), (245, 40), (245, 41), (245, 42), (245, 43), (245, 44), (245, 45), (245, 46), (245, 47), (245, 48), (245, 49), (245, 50), (245, 52), (246, 14), (246, 16), (246, 17), (246, 18), (246, 19), (246, 20), (246, 21), (246, 22), (246, 23), (246, 24), (246, 25), (246, 26), (246, 27), (246, 28), (246, 29), (246, 30), (246, 31), (246, 32), (246, 33), (246, 34), (246, 35), (246, 36), (246, 37), (246, 38), (246, 39), (246, 40), (246, 41), (246, 42), (246, 43), (246, 44), (246, 45), (246, 46), (246, 47), (246, 48), (246, 49),
(246, 50), (246, 52), (247, 14), (247, 16), (247, 17), (247, 18), (247, 19), (247, 20), (247, 21), (247, 22), (247, 23), (247, 24), (247, 25), (247, 26), (247, 27), (247, 28), (247, 29), (247, 30), (247, 31), (247, 32), (247, 33), (247, 34), (247, 35), (247, 36), (247, 37), (247, 38), (247, 39), (247, 40), (247, 41), (247, 42), (247, 43), (247, 44), (247, 45), (247, 46), (247, 47), (247, 48), (247, 49), (247, 50), (247, 52), (248, 14), (248, 16), (248, 17), (248, 18), (248, 19), (248, 20), (248, 21), (248, 22), (248, 23), (248, 24), (248, 25), (248, 26), (248, 27), (248, 28), (248, 29), (248, 30), (248, 31), (248, 32), (248, 33), (248, 34), (248, 35), (248, 36), (248, 37), (248, 38), (248, 39), (248, 40), (248, 41), (248, 42), (248, 43), (248, 44), (248, 45), (248, 46), (248, 47),
(248, 48), (248, 49), (248, 50), (248, 52), (249, 15), (249, 17), (249, 18), (249, 19), (249, 20), (249, 21), (249, 22), (249, 23), (249, 24), (249, 25), (249, 26), (249, 27), (249, 28), (249, 29), (249, 30), (249, 31), (249, 32), (249, 33), (249, 34), (249, 35), (249, 36), (249, 37), (249, 38), (249, 39), (249, 40), (249, 41), (249, 42), (249, 43), (249, 44), (249, 45), (249, 46), (249, 47), (249, 48), (249, 49), (249, 51), (250, 15), (250, 17), (250, 18), (250, 19), (250, 20), (250, 21), (250, 22), (250, 23), (250, 24), (250, 25), (250, 26), (250, 27), (250, 28), (250, 29), (250, 30), (250, 31), (250, 32), (250, 33), (250, 34), (250, 35), (250, 36), (250, 37), (250, 38), (250, 39), (250, 40), (250, 41), (250, 42), (250, 43), (250, 44), (250, 45), (250, 46), (250, 47), (250, 48),
(250, 49), (250, 51), (251, 15), (251, 17), (251, 18), (251, 19), (251, 20), (251, 21), (251, 22), (251, 23), (251, 24), (251, 25), (251, 26), (251, 27), (251, 28), (251, 29), (251, 30), (251, 31), (251, 32), (251, 33), (251, 34), (251, 35), (251, 36), (251, 37), (251, 38), (251, 39), (251, 40), (251, 41), (251, 42), (251, 43), (251, 44), (251, 45), (251, 46), (251, 47), (251, 48), (251, 49), (251, 51), (252, 16), (252, 18), (252, 19), (252, 20), (252, 21), (252, 22), (252, 23), (252, 24), (252, 25), (252, 26), (252, 27), (252, 28), (252, 29), (252, 30), (252, 31), (252, 32), (252, 33), (252, 34), (252, 35), (252, 36), (252, 37), (252, 38), (252, 39), (252, 40), (252, 41), (252, 42), (252, 43), (252, 44), (252, 45), (252, 46), (252, 47), (252, 48), (252, 50), (253, 16), (253, 18),
(253, 19), (253, 20), (253, 21), (253, 22), (253, 23), (253, 24), (253, 25), (253, 26), (253, 27), (253, 28), (253, 29), (253, 30), (253, 31), (253, 32), (253, 33), (253, 34), (253, 35), (253, 36), (253, 37), (253, 38), (253, 39), (253, 40), (253, 41), (253, 42), (253, 43), (253, 44), (253, 45), (253, 46), (253, 47), (253, 48), (253, 50), (254, 17), (254, 19), (254, 20), (254, 21), (254, 22), (254, 23), (254, 24), (254, 25), (254, 26), (254, 27), (254, 28), (254, 29), (254, 30), (254, 31), (254, 32), (254, 33), (254, 34), (254, 35), (254, 36), (254, 37), (254, 38), (254, 39), (254, 40), (254, 41), (254, 42), (254, 43), (254, 44), (254, 45), (254, 46), (254, 50), (255, 18), (255, 20), (255, 21), (255, 22), (255, 23), (255, 24), (255, 25), (255, 26), (255, 27), (255, 28), (255, 29),
(255, 30), (255, 31), (255, 32), (255, 33), (255, 34), (255, 35), (255, 36), (255, 37), (255, 38), (255, 39), (255, 40), (255, 41), (255, 42), (255, 43), (255, 44), (255, 47), (255, 49), (256, 18), (256, 20), (256, 21), (256, 22), (256, 23), (256, 24), (256, 25), (256, 26), (256, 27), (256, 28), (256, 29), (256, 30), (256, 31), (256, 32), (256, 33), (256, 34), (256, 35), (256, 36), (256, 37), (256, 38), (256, 39), (256, 40), (256, 41), (256, 42), (256, 43), (256, 45), (256, 46), (256, 49), (257, 19), (257, 21), (257, 22), (257, 23), (257, 24), (257, 25), (257, 26), (257, 27), (257, 28), (257, 29), (257, 30), (257, 31), (257, 32), (257, 33), (257, 34), (257, 35), (257, 36), (257, 37), (257, 38), (257, 39), (257, 40), (257, 41), (257, 42), (257, 44), (258, 20), (258, 22), (258, 23),
(258, 24), (258, 25), (258, 26), (258, 27), (258, 28), (258, 29), (258, 30), (258, 31), (258, 32), (258, 33), (258, 34), (258, 35), (258, 36), (258, 37), (258, 38), (258, 43), (259, 23), (259, 24), (259, 25), (259, 26), (259, 27), (259, 28), (259, 29), (259, 30), (259, 31), (259, 32), (259, 33), (259, 34), (259, 35), (259, 39), (259, 40), (259, 41), (259, 43), (260, 22), (260, 25), (260, 26), (260, 27), (260, 28), (260, 29), (260, 30), (260, 31), (260, 32), (260, 36), (260, 37), (260, 38), (261, 23), (261, 33), (261, 34), (261, 35), (262, 25), (262, 26), (262, 27), (262, 28), (262, 29), (262, 30), (262, 31), (264, 48), (264, 50), (265, 52), (265, 53), (266, 49), (266, 51), (266, 54), (267, 50), (267, 53), (267, 56), (268, 51), (268, 54), (268, 57), (269, 53), (269, 55), (269, 56),
(270, 54), (270, 56), (270, 57), (271, 54), (271, 56), (271, 57), (271, 58), (271, 60), (272, 54), (272, 56), (272, 57), (272, 58), (272, 59), (272, 61), (273, 54), (273, 56), (273, 57), (273, 58), (273, 59), (273, 61), (274, 53), (274, 55), (274, 56), (274, 57), (274, 58), (274, 59), (274, 60), (274, 62), (275, 53), (275, 55), (275, 56), (275, 57), (275, 58), (275, 59), (275, 60), (275, 62), (276, 53), (276, 55), (276, 56), (276, 57), (276, 58), (276, 59), (276, 60), (276, 62), (277, 53), (277, 55), (277, 56), (277, 57), (277, 58), (277, 59), (277, 61), (278, 52), (278, 54), (278, 55), (278, 56), (278, 57), (278, 58), (278, 59), (278, 61), (279, 52), (279, 54), (279, 55), (279, 56), (279, 57), (279, 58), (279, 59), (279, 61), (280, 53), (280, 54), (280, 55), (280, 56), (280, 57),
(280, 58), (281, 53), (281, 60), (282, 54), (282, 56), (282, 57), (282, 59), )
coordinates_FF6600 = ((157, 76),
(157, 78), (158, 74), (158, 78), (158, 79), (159, 68), (159, 73), (159, 76), (159, 77), (159, 78), (159, 80), (159, 81), (159, 82), (159, 83), (159, 84), (159, 86), (160, 66), (160, 68), (160, 73), (160, 75), (160, 76), (160, 77), (160, 78), (160, 83), (160, 85), (161, 64), (161, 69), (161, 72), (161, 74), (161, 79), (161, 80), (161, 82), (162, 61), (162, 65), (162, 66), (162, 67), (162, 68), (162, 75), (162, 76), (162, 77), (162, 78), (163, 61), (163, 63), (163, 64), (163, 65), (163, 66), (163, 67), (163, 68), (163, 69), (163, 73), (163, 74), (164, 61), (164, 63), (164, 64), (164, 65), (164, 66), (164, 67), (164, 68), (164, 72), (165, 58), (165, 60), (165, 61), (165, 62), (165, 63), (165, 64), (165, 65), (165, 66), (165, 67), (165, 70), (166, 59), (166, 61), (166, 62), (166, 63),
(166, 64), (166, 65), (166, 68), (167, 60), (167, 62), (167, 63), (167, 64), (167, 67), (168, 60), (168, 61), (168, 62), (168, 65), (169, 61), (169, 64), (170, 60), (170, 62), (171, 61), (172, 57), (172, 60), (173, 55), (173, 58), (174, 54), (174, 57), (175, 52), (175, 56), (176, 50), (176, 55), (177, 49), (177, 54), (178, 47), (178, 50), (178, 53), (179, 46), (179, 49), (179, 52), (180, 45), (180, 47), (180, 48), (180, 49), (180, 51), (181, 44), (181, 46), (181, 47), (181, 48), (181, 50), (182, 43), (182, 45), (182, 46), (182, 47), (182, 49), (183, 42), (183, 44), (183, 45), (183, 46), (183, 48), (184, 42), (184, 44), (184, 45), (184, 47), (185, 42), (185, 44), (185, 45), (185, 47), (186, 42), (187, 43), (187, 46), (258, 46), (258, 48), (258, 49), (258, 50), (258, 51), (258, 52),
(258, 53), (258, 54), (258, 55), (258, 56), (258, 57), (258, 59), (259, 45), (259, 60), (260, 46), (260, 48), (260, 49), (260, 50), (260, 51), (260, 52), (260, 53), (260, 54), (260, 55), (260, 56), (260, 57), (260, 58), (260, 59), (260, 61), (261, 47), (261, 52), (261, 53), (261, 54), (261, 55), (261, 56), (261, 57), (261, 58), (261, 59), (261, 60), (261, 63), (262, 48), (262, 50), (262, 51), (262, 54), (262, 55), (262, 56), (262, 57), (262, 58), (262, 59), (262, 60), (262, 61), (262, 64), (263, 52), (263, 53), (263, 56), (263, 57), (263, 58), (263, 59), (263, 60), (263, 61), (263, 62), (263, 63), (263, 65), (264, 54), (264, 58), (264, 59), (264, 60), (264, 61), (264, 62), (264, 63), (264, 64), (264, 66), (265, 56), (265, 59), (265, 60), (265, 61), (265, 62), (265, 63), (265, 64),
(265, 65), (265, 68), (266, 58), (266, 60), (266, 61), (266, 62), (266, 63), (266, 64), (266, 65), (266, 66), (266, 69), (267, 59), (267, 61), (267, 62), (267, 63), (267, 64), (267, 65), (267, 66), (267, 67), (267, 70), (268, 60), (268, 62), (268, 63), (268, 64), (268, 65), (268, 66), (268, 67), (268, 68), (268, 69), (268, 71), (269, 61), (269, 63), (269, 64), (269, 65), (269, 66), (269, 67), (269, 68), (269, 69), (269, 70), (269, 72), (270, 62), (270, 64), (270, 65), (270, 66), (270, 67), (270, 68), (270, 69), (270, 70), (270, 71), (270, 74), (271, 63), (271, 65), (271, 66), (271, 67), (271, 68), (271, 69), (271, 70), (271, 71), (271, 72), (271, 75), (272, 63), (272, 65), (272, 66), (272, 67), (272, 68), (272, 69), (272, 70), (272, 71), (272, 72), (272, 73), (272, 76), (273, 64),
(273, 67), (273, 68), (273, 69), (273, 70), (273, 71), (273, 72), (273, 73), (273, 74), (273, 75), (273, 77), (274, 64), (274, 66), (274, 69), (274, 70), (274, 71), (274, 72), (274, 73), (274, 74), (274, 75), (274, 76), (274, 78), (275, 68), (275, 71), (275, 72), (275, 73), (275, 74), (275, 75), (275, 76), (275, 77), (275, 79), (276, 69), (276, 72), (276, 73), (276, 74), (276, 75), (276, 76), (276, 77), (276, 78), (276, 81), (277, 71), (277, 74), (277, 75), (277, 76), (277, 77), (277, 78), (277, 79), (277, 82), (278, 72), (278, 75), (278, 76), (278, 77), (278, 78), (278, 79), (278, 80), (278, 83), (279, 74), (279, 76), (279, 77), (279, 78), (279, 79), (279, 80), (279, 81), (279, 82), (279, 84), (280, 75), (280, 77), (280, 78), (280, 79), (280, 80), (280, 81), (280, 82), (280, 83),
(280, 85), (281, 76), (281, 79), (281, 80), (281, 81), (281, 82), (281, 83), (281, 84), (281, 86), (282, 77), (282, 80), (282, 81), (282, 82), (282, 83), (282, 84), (282, 85), (282, 88), (283, 81), (283, 82), (283, 83), (283, 84), (283, 85), (283, 86), (283, 89), (284, 80), (284, 82), (284, 83), (284, 84), (284, 85), (284, 86), (284, 87), (284, 90), (285, 81), (285, 83), (285, 84), (285, 85), (285, 86), (285, 87), (285, 88), (285, 89), (285, 91), (286, 82), (286, 85), (286, 86), (286, 87), (286, 88), (286, 89), (286, 90), (286, 92), (287, 83), (287, 86), (287, 87), (287, 88), (287, 89), (287, 90), (287, 91), (287, 93), (288, 84), (288, 87), (288, 88), (288, 89), (288, 90), (288, 94), (289, 86), (289, 89), (289, 90), (289, 92), (290, 87), (291, 90), )
coordinates_FF9966 = ((152, 74),
(152, 76), (153, 71), (153, 73), (153, 77), (154, 69), (154, 74), (154, 75), (154, 77), (155, 67), (155, 71), (155, 72), (155, 73), (155, 77), (156, 65), (156, 74), (156, 75), (157, 63), (157, 64), (157, 67), (157, 68), (157, 69), (157, 70), (157, 71), (157, 72), (158, 62), (158, 65), (158, 66), (159, 61), (159, 64), (160, 61), (160, 62), (276, 64), (276, 66), (277, 64), (277, 68), (278, 63), (278, 64), (278, 65), (278, 66), (278, 69), (279, 63), (279, 65), (279, 66), (279, 67), (279, 68), (279, 71), (280, 63), (280, 65), (280, 66), (280, 67), (280, 68), (280, 69), (280, 72), (281, 62), (281, 64), (281, 65), (281, 66), (281, 67), (281, 68), (281, 69), (281, 70), (281, 71), (281, 73), (282, 62), (282, 63), (282, 64), (282, 65), (282, 66), (282, 67), (282, 68), (282, 69), (282, 70),
(282, 71), (282, 72), (282, 75), (283, 63), (283, 64), (283, 65), (283, 66), (283, 67), (283, 68), (283, 69), (283, 70), (283, 71), (283, 72), (283, 73), (283, 76), (284, 58), (284, 62), (284, 63), (284, 64), (284, 65), (284, 66), (284, 67), (284, 68), (284, 69), (284, 70), (284, 71), (284, 72), (284, 73), (284, 74), (284, 77), (285, 58), (285, 60), (285, 61), (285, 62), (285, 63), (285, 64), (285, 65), (285, 66), (285, 67), (285, 68), (285, 69), (285, 70), (285, 71), (285, 72), (285, 73), (285, 74), (285, 75), (285, 76), (285, 78), (286, 59), (286, 61), (286, 62), (286, 63), (286, 64), (286, 65), (286, 66), (286, 67), (286, 68), (286, 69), (286, 70), (286, 71), (286, 72), (286, 73), (286, 74), (286, 75), (286, 76), (286, 77), (286, 79), (287, 60), (287, 62), (287, 63), (287, 64),
(287, 65), (287, 66), (287, 67), (287, 68), (287, 69), (287, 70), (287, 71), (287, 72), (287, 73), (287, 74), (287, 75), (287, 76), (287, 77), (287, 78), (288, 61), (288, 63), (288, 64), (288, 65), (288, 66), (288, 67), (288, 68), (288, 69), (288, 70), (288, 71), (288, 72), (288, 73), (288, 74), (288, 75), (288, 76), (288, 77), (288, 78), (288, 79), (288, 82), (289, 62), (289, 65), (289, 66), (289, 67), (289, 68), (289, 69), (289, 70), (289, 71), (289, 72), (289, 73), (289, 74), (289, 75), (289, 76), (289, 77), (289, 78), (289, 79), (289, 80), (289, 83), (290, 63), (290, 66), (290, 67), (290, 68), (290, 69), (290, 70), (290, 71), (290, 72), (290, 73), (290, 74), (290, 75), (290, 76), (290, 77), (290, 78), (290, 79), (290, 80), (290, 81), (290, 82), (290, 84), (291, 65), (291, 68),
(291, 69), (291, 70), (291, 71), (291, 72), (291, 73), (291, 74), (291, 75), (291, 76), (291, 77), (291, 78), (291, 79), (291, 80), (291, 81), (291, 82), (291, 83), (291, 86), (292, 66), (292, 69), (292, 70), (292, 71), (292, 72), (292, 73), (292, 74), (292, 75), (292, 76), (292, 77), (292, 78), (292, 79), (292, 80), (292, 81), (292, 82), (292, 83), (292, 84), (292, 87), (293, 68), (293, 71), (293, 72), (293, 73), (293, 74), (293, 75), (293, 76), (293, 77), (293, 78), (293, 79), (293, 80), (293, 81), (293, 82), (293, 83), (293, 84), (293, 85), (293, 89), (293, 90), (294, 69), (294, 73), (294, 74), (294, 75), (294, 76), (294, 77), (294, 78), (294, 79), (294, 80), (294, 81), (294, 82), (294, 83), (294, 89), (295, 71), (295, 75), (295, 76), (295, 77), (295, 78), (295, 79), (295, 80),
(295, 81), (295, 84), (295, 85), (295, 89), (296, 73), (296, 83), (296, 88), (296, 89), (297, 76), (297, 77), (297, 78), (297, 79), (297, 81), (297, 89), )
coordinates_CCFF33 = ((237, 83),
(237, 86), (238, 83), (238, 85), )
|
class TrimapError(Exception):
"""
Error when creating matting trimap.
"""
def __init__(self, err):
super(TrimapError, self).__init__(err)
class AnnError(Exception):
"""
Error with Input annotation.
"""
def __init__(self, err):
super(AnnError, self).__init__(err)
|
class WiktionaryParaphrase:
def __init__(self, lexunit_id: str, wiktionary_id: str, wiktionary_sense_id: int, wiktionary_sense: str,
edited: bool):
"""
This class holds the Wictionary paraphrase object. A wictionary paraphrase can be part of lexical units. The
contain a definition of the lexical unit which helps to differentiate between different sense of a word.
:param lexunit_id: The lexical unit id, this wictionary entry belongs to
:param wiktionary_id: The corresponding wictionary identifier
:param wiktionary_sense_id: The sense identifier
:param wiktionary_sense: The sense definition
:param edited: If this paraphrase was edited.
"""
self._lexunit_id = lexunit_id
self._wiktionary_id = wiktionary_id
self._wiktionary_sense_id = wiktionary_sense_id
self._wiktionary_sense = wiktionary_sense
self._edited = edited
def __repr__(self):
return f'Wictionary(LexUnit ID={self.lexunit_id}, definition={self.wiktionary_sense})'
@property
def lexunit_id(self):
return self._lexunit_id
@property
def wiktionary_id(self):
return self._wiktionary_id
@property
def wiktionary_sense_id(self):
return self._wiktionary_sense_id
@property
def wiktionary_sense(self):
return self._wiktionary_sense
@property
def edited(self):
return self._edited
|
class StockTrendPredictor:
def predict(self, headline: str) -> int:
r"""Predict stock trending from the given headline
Args:
headline: the news headline
Returns:
A prediction, 0 for not-changed or downward trend, 1 for upward trend
"""
pass
|
# Part 1: 187
# Part 2: 4723283400
class Slope():
def __init__(self, path):
"""
input path to text file
text file should contain map data consisting of "." for open spaces, "#" for trees
"""
# put file data into 2D array of characters "." and "#"
with open(path, "r") as f:
self._data = [line.strip() for line in f.readlines()]
self._loop_length = len(self._data[0])
def __len__(self):
"""
returns number of rows in the data map
"""
return len(self._data)
def __repr__(self):
return str(self._data)
def __iter__(self):
"""
generator for each row as a list of characters
"""
for i in self._data:
yield i
def slopecheck(self, right, down=1):
"""
right = number of spaces to move right (positive integer), can be 0, no default value
down = number of spaces to move down (positive integer). cannot be 0, default = 1
"""
if down < 1 or right < 0:
raise ValueError("Right slope cannot be below 0. Down slope cannot be below 1")
position = trees = skip = 0
for line in self:
if skip > 1:
skip -= 1
continue # skip this loop iteration
if line[position] == "#": # increase tree count
trees += 1
position = (position + right) % self._loop_length # move position to the right
skip = down # set number of lines to skip
return trees
if __name__ == "__main__":
test = Slope(r"2020\day3\input.txt")
t1 = test.slopecheck(3,1) # 187
t2 = test.slopecheck(1,1) # 86
t3 = test.slopecheck(5,1) # 75
t4 = test.slopecheck(7,1) # 89
t5 = test.slopecheck(1,2) # 44
print(t1)
print(t1 * t2 * t3 * t4 *t5)
|
#!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""
Base class. Eventually all optimizers will be implemented as classes with this
as the base class.
"""
class BaseOptimizer(object):
'''
Placeholder for now. Will eventually convert all methods to
instances of this class.
'''
pass |
class Solution(object):
def findMode(self, root):
"""
:type root: TreeNode
:rtype: List[int]
"""
global_val = list()
global_num = 0
if root is None:
return global_val
def in_traverse(root, result):
if root is None:
return
in_traverse(root.left, result)
result.append(root.val)
in_traverse(root.right, result)
result = list()
in_traverse(root, result)
pre_pointer = 0
post_pointer = 1
while post_pointer <= len(result) - 1:
if result[post_pointer] == result[pre_pointer]:
post_pointer += 1
else:
if post_pointer - pre_pointer > global_num:
global_val = [result[pre_pointer]]
global_num = post_pointer - pre_pointer
elif post_pointer - pre_pointer == global_num:
global_val.append(result[pre_pointer])
pre_pointer = post_pointer
post_pointer += 1
if post_pointer - pre_pointer > global_num:
global_val = [result[pre_pointer]]
elif post_pointer - pre_pointer == global_num:
global_val.append(result[pre_pointer])
return global_val |
#!/usr/bin/env python
# -*- coding: utf-8 -*-
#
# Copyright 2011 Yesudeep Mangalapilly <yesudeep@gmail.com>
# Copyright 2012 Google Inc. All Rights Reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
""":synopsis: Mother of all our Python projects.
:module: mom
How many times have you noticed a ``utils`` subpackage or module?
-----------------------------------------------------------------
Yeah. There is a lot of code duplication that occurs throughout
our Python-based projects and results in code that is harder
to maintain in the long term. Not to mention all the duplicate
test code and more maintenance.
Therefore, we have decided to move all those ``util`` modules and
subpackages to a central library, which we use throughout our projects.
If you have a ``utils`` module, chances are you're duplicating
and wasting effort whereas instead you could use tested code
provided by this library. If there's something not included in
this library and think it should, speak up.
.. automodule:: mom.builtins
.. automodule:: mom.collections
.. automodule:: mom.decorators
.. automodule:: mom.functional
.. automodule:: mom.itertools
.. automodule:: mom.math
.. automodule:: mom.mimeparse
.. automodule:: mom.string
"""
__author__ = "yesudeep@google.com (Yesudeep Mangalapilly)"
|
class EmailAddress:
def __init__(self, email):
self.email = email
self._email_tpl = tuple(self._email.split('@'))
def __str__(self):
return self.email
def __repr__(self):
return f"{EmailAddress.__name__}('{self.email}')"
@property
def email(self):
return self._email
@email.setter
def email(self, email):
self._email = str(email)
if not self._is_valid():
raise ValueError(f'{self.email} is not a valid email address')
@property
def user(self):
return self._email_tpl[0]
@property
def domain(self):
return self._email_tpl[1]
def _is_valid(self):
email_split = self._email.split('@')
if len(email_split) != 2:
return False
domain_split = email_split[1].split('.')
if len(domain_split) < 2:
return False
return True
|
class Settings():
"""A class to store all settings for Allien Invation."""
def __init__(self):
"""Initialize the game's static settings"""
# Screen Settings
self.screen_width = 800
self.screen_height = 600
# self.bg_color = (0, 0, 0)
self.bg_color = (10, 10, 10)
# Ship
self.ship_speed_factor = 1.5
self.ship_limit = 3
# bullet
self.bullet_speed_factor = 5
self.bullet_width = 3
self.bullet_height = 15
# self.bullet_color = (252, 248, 8) # 60, 60, 60
self.bullet_color = (255,255,0)
self.bullets_allowed = 3
# Alien
self.alien_speed_factor = 3
self.fleet_drop_speed = 20
self.fleet_direction = 1 # 1: right; -1: left
# How quickly the game speed up
self.speedup_scale = 1.1
# How quickly the alien point values increase
self.score_scale = 1.5
self.initialize_dynamic_settings()
def initialize_dynamic_settings(self):
"""Initialize settings that change throughout the game."""
self.ship_speed_factor = 10 # original: 1.5
self.bullet_speed_factor = 3
self.alien_speed_factor = 1
# fleet direction of 1 represents right; -1 represents left.
self.fleet_direction = 1
# scoring
self.alien_points = 50
def increase_speed(self):
"""Increase speed settings and alien point values."""
self.ship_speed_factor *= self.speedup_scale
self.bullet_speed_factor *= self.speedup_scale
self.alien_speed_factor *= self.speedup_scale * 1.3
self.alien_points = int(self.alien_points * self.score_scale)
|
x = int(input())
y = int(input())
ans = 0
if x > 0:
if y > 0:
ans = 1
else: ans = 4
else:
if y > 0:
ans = 2
else: ans = 3
print(ans) |
# filename : csc_checks.py
# description : check definitions (security best practices and CVEs)
# create date : 2018-05-07 14:07:33.569768
csc1_1 = {'check_name': 'csc1_1',
'check_type': 'check_in_simple',
'match1': 'banner motd',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'A banner shoud be set',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_2 = {'check_name': 'csc1_2',
'check_type': 'check_in_simple',
'match1': 'no cdp enable',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'CDP should not be enabled globally',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_3 = {'check_name': 'csc1_3',
'check_type': 'check_in_simple',
'match1': 'snmpv1',
'match2': 'n/a',
'required': 'no',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP version 1 should not be configured',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_4 = {'check_name': 'csc1_4',
'check_type': 'check_in_simple',
'match1': 'snmp-server host \d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3} traps version 2c',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP version 2c ',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_5 = {'check_name': 'csc1_5',
'check_type': 'check_parameter',
'match1': 'ssh key rsa',
'match2': '2048',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'RSA key length [2048]',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_6 = {'check_name': 'csc1_6',
'check_type': 'check_in_simple',
'match1': 'no ssh key dsa',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP source interface [mgmt0]',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_7 = {'check_name': 'csc1_7',
'check_type': 'check_parameter',
'match1': 'snmp-server source-interface traps',
'match2': 'mgmt0',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP source interface [mgmt0]',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_8 = {'check_name': 'csc1_8',
'check_type': 'check_parameter',
'match1': 'snmp-server location',
'match2': 'FR.*',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP location string',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_9 = {'check_name': 'csc1_9',
'check_type': 'check_parameter',
'match1': 'snmp-server host',
'match2': '\d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3}',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP destination server',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_10 = {'check_name': 'csc1_10',
'check_type': 'check_parameter',
'match1': 'snmp-server community',
'match2': 'your_community_string_here',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'SNMP community string',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_11 = {'check_name': 'csc1_11',
'check_type': 'check_parameter',
'match1': 'ntp server',
'match2': '\d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3}',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'NTP server have to be configured',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_12 = {'check_name': 'csc1_12',
'check_type': 'check_parameter',
'match1': 'ntp source-interface',
'match2': 'mgmt0',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'NTP source interface [mgmt0]',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_13 = {'check_name': 'csc1_13',
'check_type': 'check_in_simple',
'match1': 'no feature telnet',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'no feature telnet',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_14 = {'check_name': 'csc1_14',
'check_type': 'check_in_simple',
'match1': 'password strength-check',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'password strength-check',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_15 = {'check_name': 'csc1_15',
'check_type': 'check_in_simple',
'match1': 'password secure-mode',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'password secure-mode',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_16 = {'check_name': 'csc1_16',
'check_type': 'check_in_simple',
'match1': 'no ssh key dsa',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'no ssh key dsa',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_17 = {'check_name': 'csc1_17',
'check_type': 'check_in_simple',
'match1': 'aaa authentication login default group',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'aaa authentication login default group',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_18 = {'check_name': 'csc1_18',
'check_type': 'check_in_simple',
'match1': 'aaa authentication login console group',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'aaa authentication login console group',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_19 = {'check_name': 'csc1_19',
'check_type': 'check_in_simple',
'match1': 'no ip source-route',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'no ip source-route',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_20 = {'check_name': 'csc1_20',
'check_type': 'check_in_simple',
'match1': 'no ip igmp snooping',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'no ip igmp snooping',
'url': 'n/a',
'fix': 'Command to fix',}
csc1_21 = {'check_name': 'csc1_21',
'check_type': 'check_in_simple',
'match1': 'exec-timeout 15',
'match2': 'n/a',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'minimize axec timeout to 15s',
'url': 'n/a',
'fix': 'Command to fix',}
CVE_2018_0102 = {'check_name': 'CVE_2018_0102',
'check_type': 'check_two_parameters',
'match1': 'feature pong',
'match2': 'feature-set fabricpath',
'required': 'no',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'Affected versions: 7.2(2)d1(1), 7.2(2)d1(2), 7.2(1)d(1)',
'url': 'https://www.cvedetails.com/cve/CVE-2018-0102/',
'fix': 'Command to fix',}
CVE_2018_0090 = {'check_name': 'CVE_2018_0090',
'check_type': 'check_two_parameters',
'match1': 'cisco Nexus(20|30|55|56|60|70|77)00',
'match2': 'access-list',
'required': 'no',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'Affected versions: 7.3(2)n1(0.6), 8.3(0)kms(0.31), 8.8(3.5)s0',
'url': 'https://www.cvedetails.com/cve/CVE-2018-0090/',
'fix': 'Command to fix',}
CVE_2018_0092 = {'check_name': 'CVE_2018_0092',
'check_type': 'check_two_parameters',
'match1': 'cisco Nexus(30|36|90|95)00',
'match2': 'role network-operator',
'required': 'yes',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'Affected versions: 7.0(3)i5(2), 7.0(3)i6(1), 7.0(3)i7(1)',
'url': 'https://www.cvedetails.com/cve/CVE-2018-0092/',
'fix': 'Command to fix',}
CVE_2017_12341 = {'check_name': 'CVE_2017_12341',
'check_type': 'check_in_simple',
'match1': '8.1\(1\)|8.2\(1\)|8.1\(0.59\)s0',
'match2': 'n/a',
'required': 'no',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'Affected versions: 8.1(1), 8.2(1), 8.1(0.59)s0',
'url': 'https://www.cvedetails.com/cve/CVE-2017-12341/',
'fix': 'Command to fix',}
CVE_2017_12331 = {'check_name': 'CVE_2017_12331',
'check_type': 'check_two_parameters',
'match1': 'cisco Nexus(70|77)00',
'match2': '8.1\(1\)',
'required': 'no',
'result_ok': 'Test successful.',
'result_failed': 'Test failed.',
'info': 'Affected versions: 8.1(1)',
'url': 'https://www.cvedetails.com/cve/CVE-2017-12331/',
'fix': 'Command to fix',}
|
print("What is yas?")
word = input()
def isYas(word):
Yasses = True
state=0
for i in range(len(word)):
if word[i].isalpha():
if state == 0:
if word[i] in ["Y","y"]:
state=1
else:
Yasses = False
elif state == 1:
if word[i] in ["Y","y"]:
state=1
elif word[i] in ["A","a"]:
state=2
else:
Yasses = False
elif state == 2:
if word[i]in ["A","a"]:
state = 2
elif word[i]in ["S","s"]:
state = 3
else:
Yasses = False
elif state == 3:
if word[i]in ["S","s"]:
state = 3
else:
Yasses = False
if state != 3:
Yasses = False
return Yasses
isYas(word)
answer=isYas(word)
print(answer)
|
class NGram:
# @param {int} n a integer
# @param {str} string a string
def mapper(self, _, n, string):
# Write your code here
# Please use 'yield key, value' here
for i in range(len(string) - n + 1):
yield string[i:i + n], 1
# @param key is from mapper
# @param values is a set of value with the same key
def reducer(self, key, values):
# Write your code here
# Please use 'yield key, value' here
yield key, sum(values)
|
###################################################
## ##
## This file is part of the KinBot code v2.0 ##
## ##
## The contents are covered by the terms of the ##
## BSD 3-clause license included in the LICENSE ##
## file, found at the root. ##
## ##
## Copyright 2018 National Technology & ##
## Engineering Solutions of Sandia, LLC (NTESS). ##
## Under the terms of Contract DE-NA0003525 with ##
## NTESS, the U.S. Government retains certain ##
## rights to this software. ##
## ##
## Authors: ##
## Judit Zador ##
## Ruben Van de Vijver ##
## ##
###################################################
"""
Class to keep track fo the jobs and their id's
"""
# keys: job names
# values: job PBS id
job_ids = {}
|
class Vector:
def __init__(self,x,y):
self.x=x
self.y=y
def __repr__(self):
return str(self.x) +"i, "+ str(self.y)+"j"
def dotProduct(v1,v2):
return v1.x*v2.x + v1.y*v2.y |
# -*- coding: utf-8 -*-
"""
Author: @heyao
Created On: 2019/6/24 下午1:57
"""
|
class CalculatorException(Exception):
pass
class Calculator:
"""
This is a simple Calculator that performs basic addition, subtraction,
division, multiplication and root calculation of numbers.
"""
def __init__(self):
self.__val = 0
def add(self, num:int or float or complex):
"""add a number to the current value in the calculator"""
try:
self.__val += num
return self.__val
except Exception:
raise CalculatorException("Something went wrong. function add() takes only integers")
def subtract(self, num:int or float or complex):
"""subtract a number from the current value in the calculator"""
try:
self.__val -= num
return self.__val
except Exception:
raise CalculatorException("Something went wrong. Ensure to use the right input types")
def multiply(self, num:int or float or complex):
"""multiply a number with the current value in the calculator"""
self.__val *= num
return self.__val
def divide(self, num:int or float or complex):
"""divides the current value in the calculator by the given number"""
try:
self.__val /= num
return self.__val
except ZeroDivisionError:
raise CalculatorException("Something went wrong. "
"You are most likely attempting a division with 0")
def root(self, num:int):
"""gets the n root of the current value in the calculator"""
try:
self.__val **= (1/num)
return self.__val
except Exception:
raise CalculatorException("Something went wrong. "
"You are most likely attempting a division with 0")
def reset_memory(self):
"""clears all calculator history and resets the value to zero."""
self.__val = 0
return self.__val
|
#poly_limit=10
def poly_check(seq,poly_limit):
if 'A'*poly_limit not in seq and 'T'*poly_limit not in seq and 'G'*poly_limit not in seq and 'C'*poly_limit not in seq:
return True
else:
return False
def var_check(change_from, change_to, seq,var_limit):
ALL=['A','T','C','G']
tmp=[]
for one in ALL:
if one !=change_from.upper() and one !=change_to.upper():
tmp.append(one)
flag=1
for one in tmp:
if seq.count(one) < var_limit/(float(len(tmp))+2):
flag=0
if flag==1:
return True
else:
return False
def reverse_base(base):
base=base.upper()
if base=='A':
return 'T'
elif base=='C':
return 'G'
elif base=='G':
return 'C'
elif base=='T':
return 'A'
else:
return 'N'
def recover_sam(sam_in_dir,sam_out_dir, var_limit=20,poly_limit=10,rm_multi=0):
fi=open(sam_in_dir)
fo=open(sam_out_dir,'w')
for line in fi:
seq=line.split('\t')
if line[0]=='@':
fo.write(line)
elif seq[1]=='4' and seq[2]=='*':
break
elif seq[1]!='4' and len(seq)>=9:
seq=line.split('\t')
seq[9]=seq[9].upper()
seq[1]=int(seq[1])
if len(bin(seq[1]))>=7:
if bin(seq[1])[-3]!='1':
if bin(seq[1])[-5]=='1':
seq[1]='16'
else:
seq[1]='0'
seq[1]=str(seq[1])
record=bin(int(seq[0].split('_|_')[2]))[3:]
change_from=seq[0].split('_|_')[1].split('_')[0]
change_to=seq[0].split('_|_')[1].split('_')[2]
if len(bin(int(seq[1]))) > 5 and bin(int(seq[1]))[-5]=='1': #seq[1]=='16':
change_from=reverse_base(change_from)
change_to=reverse_base(change_to)
record=record[::-1]
else:
record=record
changed_read=seq[9]
i=0
recovered_read=''
while i<len(seq[9]):
if record[i]=='1' and seq[9][i]==change_to:
recovered_read += change_from
elif record[i]=='1' and seq[9][i]!=change_to:
#print "recover error in "+seq[0]
recovered_read += 'N'
else:
recovered_read += seq[9][i]
i=i+1
seq[9]=recovered_read
#fo.write(seq[0])
#if len(record)==len(seq[9]) and 'I' not in seq[5] and 'D' not in seq[5] and len(record)-changed_read.count(change_to) > 25 and poly_check(seq[9],poly_limit):
if len(record)==len(seq[9]) and len(record)-changed_read.count(change_to) > var_limit and poly_check(seq[9],poly_limit): #and var_check(change_from,change_to,seq[9],var_limit):
if (rm_multi==1 and "XA:Z:" not in line) or rm_multi==0:
fo.write(seq[0])
j=1
while j<len(seq):
fo.write('\t'+seq[j])
j=j+1
# 1+1
fo.close()
fi.close()
|
x = input()
if x == ".helpf":
print(".help : to show help menu")
|
"""Hello world module"""
def hello_func():
"""return 'Hello!'"""
return "Hello!"
def main():
"""print 'Hello!'"""
print(hello_func())
if __name__ == '__main__':
main()
|
class Config(object):
SQLALCHEMY_DATABASE_URI = 'sqlite:///app.db'
SQLALCHEMY_TRACK_MODIFICATIONS = False
SECRET_KEY = '1234567890'
SQLALCHEMY_ECHO = False
FLASK_ADMIN_SWATCH = 'united'
if __name__ == '__main__':
for key in Config.__dict__:
print(key, Config.__dict__[key]) |
# https://leetcode.com/problems/generate-a-string-with-characters-that-have-odd-counts
def generate_the_string(n):
if n % 2 == 0:
return 'a' * (n - 1) + 'b'
return 'a' * n |
class Queue2Stacks:
def __init__(self):
self.stack1 = []
self.stack2 = []
def size(self):
return len(self.stack1)
def isEmpty(self):
return self.stack1 == []
def enqueue(self,item):
self.stack1.append(item)
def dequeue(self):
if(self.stack2 != []):
return self.stack2.pop()
else:
if(self.stack1 == []):
return "empty!!"
else:
for x in range(len(self.stack1)):
self.stack2.append(self.stack1.pop())
return self.stack2.pop()
#return out
q = Queue2Stacks()
q.enqueue("h")
q.enqueue("a")
q.enqueue("r")
q.enqueue("s")
q.enqueue("h")
print(q.size())
print(q.dequeue())
print(q.dequeue())
q.enqueue("r")
q.enqueue("a")
q.enqueue("j")
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
q.enqueue(1)
q.enqueue(2)
q.enqueue(3)
print(q.dequeue())
print(q.dequeue())
print(q.dequeue())
print(q.dequeue()) |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.