content stringlengths 7 1.05M | fixed_cases stringlengths 1 1.28M |
|---|---|
'''
This module defines the RentalException class, which handles all exception of the type RentalException.
it does not depend on any other module.
'''
class RentalException(Exception):
'''
RentalException class handles all thrown exceptions of the type RentalException. It inherits the Exception
class.
'''
def __init__(self, message):
self._message = message
def __repr__(self, *args, **kwargs):
return "Error! " + self._message
| """
This module defines the RentalException class, which handles all exception of the type RentalException.
it does not depend on any other module.
"""
class Rentalexception(Exception):
"""
RentalException class handles all thrown exceptions of the type RentalException. It inherits the Exception
class.
"""
def __init__(self, message):
self._message = message
def __repr__(self, *args, **kwargs):
return 'Error! ' + self._message |
class Loss(object):
def __init__(self):
self.output = 0
self.input = 0
def get_output(self, inp, target):
pass
def get_input_gradient(self, target):
pass
| class Loss(object):
def __init__(self):
self.output = 0
self.input = 0
def get_output(self, inp, target):
pass
def get_input_gradient(self, target):
pass |
#!/user/bin/python
'''Compute the Edit Distance Between Two Strings
The edit-distance between two strings is the minimum number of operations
(insertions, deletions, and substitutions of symbols) to transform one string
into another
'''
# Uses python3
def edit_distance(s, t):
#D[i,0] = i
#D[0,j] = j
m = len(s)
n = len(t)
d = []
for i in range(len(s) + 1):
d.append([i])
del d[0][0]
for j in range(len(t) + 1):
d[0].append(j)
for j in range(1, len(t)+1):
for i in range(1, len(s)+1):
insertion = d[i][j-1] + 1
deletion = d[i-1][j] + 1
match = d[i-1][j-1]
mismatch = d[i-1][j-1] + 1
if s[i-1] == t[j-1]:
d[i].insert(j, match)
else:
minimum = min(insertion, deletion, mismatch)
d[i].insert(j, minimum)
editDist = d[-1][-1]
return editDist
if __name__ == "__main__":
print(edit_distance(input(), input()))
| """Compute the Edit Distance Between Two Strings
The edit-distance between two strings is the minimum number of operations
(insertions, deletions, and substitutions of symbols) to transform one string
into another
"""
def edit_distance(s, t):
m = len(s)
n = len(t)
d = []
for i in range(len(s) + 1):
d.append([i])
del d[0][0]
for j in range(len(t) + 1):
d[0].append(j)
for j in range(1, len(t) + 1):
for i in range(1, len(s) + 1):
insertion = d[i][j - 1] + 1
deletion = d[i - 1][j] + 1
match = d[i - 1][j - 1]
mismatch = d[i - 1][j - 1] + 1
if s[i - 1] == t[j - 1]:
d[i].insert(j, match)
else:
minimum = min(insertion, deletion, mismatch)
d[i].insert(j, minimum)
edit_dist = d[-1][-1]
return editDist
if __name__ == '__main__':
print(edit_distance(input(), input())) |
class iron():
def __init__(self,name,kg):
self.kg = kg
self.name = name
def changeKg(self,newValue):
self.kg = newValue
def changeName(self,newName):
self.newName
| class Iron:
def __init__(self, name, kg):
self.kg = kg
self.name = name
def change_kg(self, newValue):
self.kg = newValue
def change_name(self, newName):
self.newName |
def calculate_power(base, power):
if not power:
return 1
if not power % 2:
return calculate_power(base, power // 2) * calculate_power(base, power // 2)
else:
return calculate_power(base, power // 2) * calculate_power(base, power // 2) * base
if __name__ == "__main__":
a = int(input("Enter base: "))
n = int(input("Enter exponent: "))
print("{}^{} = {}".format(a, n, calculate_power(a, n))) | def calculate_power(base, power):
if not power:
return 1
if not power % 2:
return calculate_power(base, power // 2) * calculate_power(base, power // 2)
else:
return calculate_power(base, power // 2) * calculate_power(base, power // 2) * base
if __name__ == '__main__':
a = int(input('Enter base: '))
n = int(input('Enter exponent: '))
print('{}^{} = {}'.format(a, n, calculate_power(a, n))) |
class Node:
def __init__(self, data, nextNode=None):
self.data = data
self.next = nextNode
# find middle uses a slow pointer and fast pointer (1 ahead) to find the middle
# element of a singly linked list
def find_middle(self):
slow_pointer = self
fast_pointer = self
while fast_pointer.next and fast_pointer.next.next:
slow_pointer = slow_pointer.next
fast_pointer = fast_pointer.next.next
return slow_pointer.data
# test find_middle function
n6 = Node(7)
n5 = Node(6, n6)
n4 = Node(5, n5)
n3 = Node(4, n4)
n2 = Node(3, n3)
n1 = Node(2, n2)
head = Node(1, n1)
middle = head.find_middle()
print("Linked List: ", "1 -> 2 -> 3 -> 4 -> 5 -> 6 -> 7")
print("Middle Node: ", middle)
| class Node:
def __init__(self, data, nextNode=None):
self.data = data
self.next = nextNode
def find_middle(self):
slow_pointer = self
fast_pointer = self
while fast_pointer.next and fast_pointer.next.next:
slow_pointer = slow_pointer.next
fast_pointer = fast_pointer.next.next
return slow_pointer.data
n6 = node(7)
n5 = node(6, n6)
n4 = node(5, n5)
n3 = node(4, n4)
n2 = node(3, n3)
n1 = node(2, n2)
head = node(1, n1)
middle = head.find_middle()
print('Linked List: ', '1 -> 2 -> 3 -> 4 -> 5 -> 6 -> 7')
print('Middle Node: ', middle) |
def extract_cfg(cfg, prefix, sep='.'):
out = {}
for key,val in cfg.items():
if not key.startswith(prefix): continue
key = key[len(prefix)+len(sep):]
if sep in key or not key: continue
out[key] = val
return out
if __name__=="__main__":
cfg = {
'a.1':'aaa',
'a.2':'bbb',
'a.x.1':'ccc',
'a.x.2':'ddd',
'b.x':'eee',
}
print(extract_cfg(cfg,'a.x'))
| def extract_cfg(cfg, prefix, sep='.'):
out = {}
for (key, val) in cfg.items():
if not key.startswith(prefix):
continue
key = key[len(prefix) + len(sep):]
if sep in key or not key:
continue
out[key] = val
return out
if __name__ == '__main__':
cfg = {'a.1': 'aaa', 'a.2': 'bbb', 'a.x.1': 'ccc', 'a.x.2': 'ddd', 'b.x': 'eee'}
print(extract_cfg(cfg, 'a.x')) |
'''
Given inorder and postorder traversal of a tree, construct the binary tree.
Note:
You may assume that duplicates do not exist in the tree.
For example, given
inorder = [9,3,15,20,7]
postorder = [9,15,7,20,3]
Return the following binary tree:
3
/ \
9 20
/ \
15 7
'''
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, x):
# self.val = x
# self.left = None
# self.right = None
class Solution:
def buildTree(self, inorder: List[int], postorder: List[int]) -> TreeNode:
# if not inorder or not postorder:
# return None
if inorder:
ind = inorder.index(postorder.pop())
root = TreeNode(inorder[ind])
root.right = self.buildTree(inorder[ind+1:], postorder)
root.left = self.buildTree(inorder[0:ind], postorder)
return root | """
Given inorder and postorder traversal of a tree, construct the binary tree.
Note:
You may assume that duplicates do not exist in the tree.
For example, given
inorder = [9,3,15,20,7]
postorder = [9,15,7,20,3]
Return the following binary tree:
3
/ 9 20
/ 15 7
"""
class Solution:
def build_tree(self, inorder: List[int], postorder: List[int]) -> TreeNode:
if inorder:
ind = inorder.index(postorder.pop())
root = tree_node(inorder[ind])
root.right = self.buildTree(inorder[ind + 1:], postorder)
root.left = self.buildTree(inorder[0:ind], postorder)
return root |
class SmMarket:
def __init__(self):
self.name = ""
self.product_dic = {}
def add_category(self, product):
self.product_dic[product.code] = product | class Smmarket:
def __init__(self):
self.name = ''
self.product_dic = {}
def add_category(self, product):
self.product_dic[product.code] = product |
#project
print("welcome to the Band name generator")
city_name = input("Enter the city you were born: ")
pet_name = input("Enter your pet name: ")
print(f"your band name could be {city_name} {pet_name}")
#coding exercise(Print)
print("Day 1 - Python Print Function")
print("The function is declared like this:")
print("print(\"what to print\")")
#coding exercise(Print with new line)
print('Day 1 - String Manipulation\nString Concatenation is done with the "+" sign.\ne.g. print("Hello " + "world")\nNew lines can be created with a backslash and n.')
#coding exercise with len,input and print function
print(len(input("What is your name?\n")))
#coding exercise for swapping numbers(variables)
a = input("a: ")
b = input("b: ")
a,b = b,a
print("a: ",a)
print("b: ",b)
| print('welcome to the Band name generator')
city_name = input('Enter the city you were born: ')
pet_name = input('Enter your pet name: ')
print(f'your band name could be {city_name} {pet_name}')
print('Day 1 - Python Print Function')
print('The function is declared like this:')
print('print("what to print")')
print('Day 1 - String Manipulation\nString Concatenation is done with the "+" sign.\ne.g. print("Hello " + "world")\nNew lines can be created with a backslash and n.')
print(len(input('What is your name?\n')))
a = input('a: ')
b = input('b: ')
(a, b) = (b, a)
print('a: ', a)
print('b: ', b) |
num1=int(input("Enter first number :- "))
num2=int(input("Enter second number :- "))
print("Which opertation you want apply 1.add, 2.sub, 3.div")
op=input()
def add():
c=num1+num2
print("After Add",c)
def sub():
c=num1-num2
print("After sub",c)
def div():
c=num1/num2
print("After div",c)
def again():
print("If you want to perform any other operation")
print("say Yes or y else NO or n")
ans=input()
if ans=="yes" or ans=="y":
cal()
else:
print(" Good Bye")
def cal():
if op=='1' or op=="add" or op=="1.add":
add()
elif op=='2' or op=="sub" or op=="2.sub":
sub()
elif op=='3' or op=="div" or op=="3.div":
div()
else:
print("Invalid Operation")
again()
cal()
again()
| num1 = int(input('Enter first number :- '))
num2 = int(input('Enter second number :- '))
print('Which opertation you want apply 1.add, 2.sub, 3.div')
op = input()
def add():
c = num1 + num2
print('After Add', c)
def sub():
c = num1 - num2
print('After sub', c)
def div():
c = num1 / num2
print('After div', c)
def again():
print('If you want to perform any other operation')
print('say Yes or y else NO or n')
ans = input()
if ans == 'yes' or ans == 'y':
cal()
else:
print(' Good Bye')
def cal():
if op == '1' or op == 'add' or op == '1.add':
add()
elif op == '2' or op == 'sub' or op == '2.sub':
sub()
elif op == '3' or op == 'div' or op == '3.div':
div()
else:
print('Invalid Operation')
again()
cal()
again() |
def get_odd_and_even_sets(n):
odd_nums = set()
even_nums = set()
for line in range(1, n + 1):
name = input()
name_ascii_sum = sum([ord(char) for char in name])
devised_num = name_ascii_sum // line
if devised_num % 2 == 0:
even_nums.add(devised_num)
else:
odd_nums.add(devised_num)
return odd_nums, even_nums
def print_result(odd_nums_sum, even_nums_sum, odd_nums, even_nums):
if odd_nums_sum == even_nums_sum:
union_values = odd_nums.union(even_nums)
print(', '.join(map(str, union_values)))
elif odd_nums_sum > even_nums_sum:
different_values = odd_nums.difference(even_nums)
print(', '.join(map(str, different_values)))
else:
symmetric_different_values = even_nums.symmetric_difference(odd_nums)
print(', '.join(map(str, symmetric_different_values)))
odd_nums, even_nums = get_odd_and_even_sets(int(input()))
odd_nums_sum = sum(odd_nums)
even_nums_sum = sum(even_nums)
print_result(odd_nums_sum, even_nums_sum, odd_nums, even_nums)
| def get_odd_and_even_sets(n):
odd_nums = set()
even_nums = set()
for line in range(1, n + 1):
name = input()
name_ascii_sum = sum([ord(char) for char in name])
devised_num = name_ascii_sum // line
if devised_num % 2 == 0:
even_nums.add(devised_num)
else:
odd_nums.add(devised_num)
return (odd_nums, even_nums)
def print_result(odd_nums_sum, even_nums_sum, odd_nums, even_nums):
if odd_nums_sum == even_nums_sum:
union_values = odd_nums.union(even_nums)
print(', '.join(map(str, union_values)))
elif odd_nums_sum > even_nums_sum:
different_values = odd_nums.difference(even_nums)
print(', '.join(map(str, different_values)))
else:
symmetric_different_values = even_nums.symmetric_difference(odd_nums)
print(', '.join(map(str, symmetric_different_values)))
(odd_nums, even_nums) = get_odd_and_even_sets(int(input()))
odd_nums_sum = sum(odd_nums)
even_nums_sum = sum(even_nums)
print_result(odd_nums_sum, even_nums_sum, odd_nums, even_nums) |
class Debugger:
def __init__(self):
self.collectors = {}
def add_collector(self, collector):
self.collectors.update({collector.name: collector})
return self
def get_collector(self, name):
return self.collectors[name]
| class Debugger:
def __init__(self):
self.collectors = {}
def add_collector(self, collector):
self.collectors.update({collector.name: collector})
return self
def get_collector(self, name):
return self.collectors[name] |
# Only these modalities are available for query
ALLOWED_MODALITIES = ['bold', 'T1w', 'T2w']
STRUCTURAL_MODALITIES = ['T1w', 'T2w']
# Name of a subdirectory to hold fetched query results
FETCHED_DIR = 'fetched'
# Name of a subdirectory containing MRIQC group results used as inputs.
INPUTS_DIR = 'inputs'
# Name of the subdirectory which holds output reports.
REPORTS_DIR = 'reports'
# File extensions for report files and BIDS-compliant data files.
BIDS_DATA_EXT = '.tsv'
PLOT_EXT = '.png'
REPORTS_EXT = '.html'
# Symbolic exit codes for various error exit scenarios
INPUT_FILE_EXIT_CODE = 10
OUTPUT_FILE_EXIT_CODE = 11
QUERY_FILE_EXIT_CODE = 12
FETCHED_DIR_EXIT_CODE = 20
INPUTS_DIR_EXIT_CODE = 21
REPORTS_DIR_EXIT_CODE = 22
NUM_RECS_EXIT_CODE = 30
| allowed_modalities = ['bold', 'T1w', 'T2w']
structural_modalities = ['T1w', 'T2w']
fetched_dir = 'fetched'
inputs_dir = 'inputs'
reports_dir = 'reports'
bids_data_ext = '.tsv'
plot_ext = '.png'
reports_ext = '.html'
input_file_exit_code = 10
output_file_exit_code = 11
query_file_exit_code = 12
fetched_dir_exit_code = 20
inputs_dir_exit_code = 21
reports_dir_exit_code = 22
num_recs_exit_code = 30 |
# Problem Statement: https://www.hackerrank.com/challenges/symmetric-difference/problem
_, M = int(input()), set(map(int, input().split()))
_, N = int(input()), set(map(int, input().split()))
print(*sorted(M ^ N), sep='\n') | (_, m) = (int(input()), set(map(int, input().split())))
(_, n) = (int(input()), set(map(int, input().split())))
print(*sorted(M ^ N), sep='\n') |
# The manage.py of the {{ project_name }} test project
# template context:
project_name = '{{ project_name }}'
project_directory = '{{ project_directory }}'
secret_key = '{{ secret_key }}'
| project_name = '{{ project_name }}'
project_directory = '{{ project_directory }}'
secret_key = '{{ secret_key }}' |
class PaymentStrategy(object):
def get_payment_metadata(self,service_client):
pass
def get_price(self,service_client):
pass
| class Paymentstrategy(object):
def get_payment_metadata(self, service_client):
pass
def get_price(self, service_client):
pass |
#this program demonstrates several functions of the list class
x = [0.0, 3.0, 5.0, 2.5, 3.7]
print(type(x)) #prints datatype of x (list)
x.pop(2) #remove the 3rd element of x (5.0)
print(x)
x.remove(2.5) #remove the element 2.5 (index 2)
print(x)
x.append(1.2) #add a new element to the end (1.2)
print(x)
y = x.copy() #make a copy of x's current state (y)
print(y)
print(y.count(0.0)) #print the number of elements equal to 0.0 (1)
print(y.index(3.7)) #print the index of the element 3.7 (2)
y.sort() #sort the list y by value
print(y)
y.reverse() #reverse the order of elements in list y
print(y)
y.clear() #remove all elements from y
print(y) | x = [0.0, 3.0, 5.0, 2.5, 3.7]
print(type(x))
x.pop(2)
print(x)
x.remove(2.5)
print(x)
x.append(1.2)
print(x)
y = x.copy()
print(y)
print(y.count(0.0))
print(y.index(3.7))
y.sort()
print(y)
y.reverse()
print(y)
y.clear()
print(y) |
# Enter your code here. Read input from STDIN. Print output to STDOUT
size = int(input())
nums = list(map(int, input().split()))
weights = list(map(int, input().split()))
weighted_sum = 0
for i in range(size):
weighted_sum += nums[i] * weights[i]
print(round(weighted_sum / sum(weights), 1))
| size = int(input())
nums = list(map(int, input().split()))
weights = list(map(int, input().split()))
weighted_sum = 0
for i in range(size):
weighted_sum += nums[i] * weights[i]
print(round(weighted_sum / sum(weights), 1)) |
# Lower-level functionality for build config.
# The functions in this file might be referred by tensorflow.bzl. They have to
# be separate to avoid cyclic references.
WITH_XLA_SUPPORT = True
def tf_cuda_tests_tags():
return ["local"]
def tf_sycl_tests_tags():
return ["local"]
def tf_additional_plugin_deps():
deps = []
if WITH_XLA_SUPPORT:
deps.append("//tensorflow/compiler/jit")
return deps
def tf_additional_xla_deps_py():
return []
def tf_additional_license_deps():
licenses = []
if WITH_XLA_SUPPORT:
licenses.append("@llvm//:LICENSE.TXT")
return licenses
| with_xla_support = True
def tf_cuda_tests_tags():
return ['local']
def tf_sycl_tests_tags():
return ['local']
def tf_additional_plugin_deps():
deps = []
if WITH_XLA_SUPPORT:
deps.append('//tensorflow/compiler/jit')
return deps
def tf_additional_xla_deps_py():
return []
def tf_additional_license_deps():
licenses = []
if WITH_XLA_SUPPORT:
licenses.append('@llvm//:LICENSE.TXT')
return licenses |
def estimation(text,img_num):
len_text = len(text)
read_time = (len_text/1000) + img_num*0.2
if read_time < 1:
return 1
return round(read_time) | def estimation(text, img_num):
len_text = len(text)
read_time = len_text / 1000 + img_num * 0.2
if read_time < 1:
return 1
return round(read_time) |
numbers = [10, 20, 300, 40, 50]
# random indexing --> O(1) get items if we know the index !!!
print(numbers[4])
# it can store different data types
# numbers[1] = "Adam"
# iteration methods
# for i in range(len(numbers)):
# print(numbers[i])
# for num in numbers:
# print(num)
# remove last two items
print(numbers[:-2])
# show only first 2 items
print(numbers[0:2])
# show 3rd item onwards
print(numbers[2:])
# get the highest number in the array
# O(n) linear time complexity
# this type of search is slow on large array
maximum = numbers[0]
for num in numbers:
if num > maximum:
maximum = num
print(maximum)
| numbers = [10, 20, 300, 40, 50]
print(numbers[4])
print(numbers[:-2])
print(numbers[0:2])
print(numbers[2:])
maximum = numbers[0]
for num in numbers:
if num > maximum:
maximum = num
print(maximum) |
''' Example of python control structures '''
a = 5
b = int(input("Enter an integer: "))
# If-then-else statment
if a < b:
print('{} is less than {}'.format(a,b))
elif a > b:
print('{} is greater than {}'.format(a,b))
else:
print('{} is equal to {}'.format(a,b))
# While loop
ii = 0
print("While loop:")
while ii <= b:
print( "Your number = {}, loop variable = {}".format(b,ii))
ii+=1
# For loop
print("For loop:")
for ii in range(b):
print(" for: loop variable = {}".format(ii))
print("Iterate over a list:")
for ss in ['This is', 'a list', 'of strings']:
print(ss)
# break & continue
for ii in range(100000):
if ii > b:
print("Breaking at {}".format(ii))
break
print("Continue if not divisible by 3:")
for ii in range(b+1):
if not (ii % 3) == 0:
continue
print(" {}".format(ii))
| """ Example of python control structures """
a = 5
b = int(input('Enter an integer: '))
if a < b:
print('{} is less than {}'.format(a, b))
elif a > b:
print('{} is greater than {}'.format(a, b))
else:
print('{} is equal to {}'.format(a, b))
ii = 0
print('While loop:')
while ii <= b:
print('Your number = {}, loop variable = {}'.format(b, ii))
ii += 1
print('For loop:')
for ii in range(b):
print(' for: loop variable = {}'.format(ii))
print('Iterate over a list:')
for ss in ['This is', 'a list', 'of strings']:
print(ss)
for ii in range(100000):
if ii > b:
print('Breaking at {}'.format(ii))
break
print('Continue if not divisible by 3:')
for ii in range(b + 1):
if not ii % 3 == 0:
continue
print(' {}'.format(ii)) |
'''
Created on Apr 2, 2021
@author: mballance
'''
class InitializeReq(object):
def __init__(self):
self.module = None
self.entry = None
def dump(self):
pass
@staticmethod
def load(msg) -> 'InitializeReq':
ret = InitializeReq()
if "module" in msg.keys():
ret.module = msg["module"]
if "entry" in msg.keys():
ret.entry = msg["entry"]
return ret
| """
Created on Apr 2, 2021
@author: mballance
"""
class Initializereq(object):
def __init__(self):
self.module = None
self.entry = None
def dump(self):
pass
@staticmethod
def load(msg) -> 'InitializeReq':
ret = initialize_req()
if 'module' in msg.keys():
ret.module = msg['module']
if 'entry' in msg.keys():
ret.entry = msg['entry']
return ret |
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def isSameTree(self, p: TreeNode, q: TreeNode) -> bool:
ans = True
def traversal(node_p, node_q):
nonlocal ans
if node_p is None and node_q is None:
return
if node_p is None or node_q is None:
ans = False
return
if node_p.val != node_q.val:
ans = False
return
traversal(node_p.left, node_q.left)
traversal(node_p.right, node_q.right)
traversal(p, q)
return ans
| class Solution:
def is_same_tree(self, p: TreeNode, q: TreeNode) -> bool:
ans = True
def traversal(node_p, node_q):
nonlocal ans
if node_p is None and node_q is None:
return
if node_p is None or node_q is None:
ans = False
return
if node_p.val != node_q.val:
ans = False
return
traversal(node_p.left, node_q.left)
traversal(node_p.right, node_q.right)
traversal(p, q)
return ans |
'''Many Values to Multiple Variables
Python allows you to assign values to multiple variables in one line:'''
x = y = z = "Orange"
print(x)
print(y)
print(z) | """Many Values to Multiple Variables
Python allows you to assign values to multiple variables in one line:"""
x = y = z = 'Orange'
print(x)
print(y)
print(z) |
#
# @lc app=leetcode id=795 lang=python3
#
# [795] Number of Subarrays with Bounded Maximum
#
# https://leetcode.com/problems/number-of-subarrays-with-bounded-maximum/description/
#
# algorithms
# Medium (48.43%)
# Likes: 1143
# Dislikes: 78
# Total Accepted: 40.2K
# Total Submissions: 77.7K
# Testcase Example: '[2,1,4,3]\n2\n3'
#
# We are given an array nums of positive integers, and two positive integers
# left and right (left <= right).
#
# Return the number of (contiguous, non-empty) subarrays such that the value of
# the maximum array element in that subarray is at least left and at most
# right.
#
#
# Example:
# Input:
# nums = [2, 1, 4, 3]
# left = 2
# right = 3
# Output: 3
# Explanation: There are three subarrays that meet the requirements: [2], [2,
# 1], [3].
#
#
# Note:
#
#
# left, right, and nums[i] will be an integer in the range [0, 10^9].
# The length of nums will be in the range of [1, 50000].
#
#
#
# @lc code=start
class Solution:
def numSubarrayBoundedMax(self, nums: List[int], left: int, right: int) -> int:
i = 0
curr = 0
res = 0
for j in range(len(nums)):
if left <= nums[j] <= right:
curr = j - i + 1
res += j - i + 1
elif nums[j] < left:
res += curr
else:
i = j + 1
curr = 0
return res
# @lc code=end
| class Solution:
def num_subarray_bounded_max(self, nums: List[int], left: int, right: int) -> int:
i = 0
curr = 0
res = 0
for j in range(len(nums)):
if left <= nums[j] <= right:
curr = j - i + 1
res += j - i + 1
elif nums[j] < left:
res += curr
else:
i = j + 1
curr = 0
return res |
class Human:
def __init__(self, xref_id):
self.xref_id = xref_id
self.name = None
self.father = None
self.mother = None
self.pos = None
def __repr__(self):
return "[ {} : {} - {} {} - {} ]".format(
self.xref_id,
self.name,
self.father,
self.mother,
self.pos
)
| class Human:
def __init__(self, xref_id):
self.xref_id = xref_id
self.name = None
self.father = None
self.mother = None
self.pos = None
def __repr__(self):
return '[ {} : {} - {} {} - {} ]'.format(self.xref_id, self.name, self.father, self.mother, self.pos) |
class Cell:
def __init__(self, row, col):
self.row = row
self.col = col
self.links = []
self.north = None
self.south = None
self.east = None
self.west = None
def neighbors(self):
n = []
self.north and n.append(self.north)
self.south and n.append(self.south)
self.east and n.append(self.east)
self.west and n.append(self.west)
return n
def link(self, cell, bidirectional=True):
self.links.append(cell)
if bidirectional:
cell.link(self, False)
def unlink(self, cell, bidirectional=True):
self.links.remove(cell)
if bidirectional:
cell.unlink(self, False)
def isLinked(self, cell):
isLinked = True if cell in self.links else False
return isLinked
| class Cell:
def __init__(self, row, col):
self.row = row
self.col = col
self.links = []
self.north = None
self.south = None
self.east = None
self.west = None
def neighbors(self):
n = []
self.north and n.append(self.north)
self.south and n.append(self.south)
self.east and n.append(self.east)
self.west and n.append(self.west)
return n
def link(self, cell, bidirectional=True):
self.links.append(cell)
if bidirectional:
cell.link(self, False)
def unlink(self, cell, bidirectional=True):
self.links.remove(cell)
if bidirectional:
cell.unlink(self, False)
def is_linked(self, cell):
is_linked = True if cell in self.links else False
return isLinked |
class Notifier(object):
def notify(self, title, message, retry_forever=False):
raise NotImplementedError()
def _resolve_params(self, title, message):
if callable(title):
title = title()
if callable(message):
message = message()
return title, message
| class Notifier(object):
def notify(self, title, message, retry_forever=False):
raise not_implemented_error()
def _resolve_params(self, title, message):
if callable(title):
title = title()
if callable(message):
message = message()
return (title, message) |
n = int(input())
c=0
for _ in range(n):
p, q = list(map(int, input().split()))
if q-p >=2:
c= c+1
print(c)
| n = int(input())
c = 0
for _ in range(n):
(p, q) = list(map(int, input().split()))
if q - p >= 2:
c = c + 1
print(c) |
class Solution:
def smallestRangeI(self, nums: List[int], k: int) -> int:
minNum,maxNum = min(nums),max(nums)
if maxNum-minNum>=2*k:
return maxNum-minNum-2*k
else:
return 0 | class Solution:
def smallest_range_i(self, nums: List[int], k: int) -> int:
(min_num, max_num) = (min(nums), max(nums))
if maxNum - minNum >= 2 * k:
return maxNum - minNum - 2 * k
else:
return 0 |
# Q7: What is the time complexity of
# i = 1, 2, 4, 8, 16, ..., 2^k
# El bucle termina para: i >= n
# 2^k = n
# k = log_2(n)
# O(log_2(n))
# Algoritmo
# for (i = 1; i < n; i = i*2) {
# statement;
# }
i = 1
n = 10
while i < n:
print(i)
i = i*2 | i = 1
n = 10
while i < n:
print(i)
i = i * 2 |
code_map = {
"YEAR": "year",
"MALE": "male population",
"FEMALE": "female population",
"M_MALE": "matable male population",
"M_FEMALE": "matable female population",
"C_PROB": "concieving probability",
"M_AGE_START": "starting age of mating",
"M_AGE_END": "ending age of mating",
"MX_AGE": "maximum age",
"MT_PROB": "mutation probability",
"OF_FACTOR": "offspring factor",
"AGE_DTH": "dependency of age on death",
"FIT_DTH": "dependency of fitness on death",
"AFR_DTH": "dependency ratio of age and fitness on death",
"HT_SP": "dependency of height on speed",
"HT_ST": "dependency of height on stamina",
"HT_VT": "dependency of height on vitality",
"WT_SP": "dependency of weight on speed",
"WT_ST": "dependency of weight on stamina",
"WT_VT": "dependency of weight on vitality",
"VT_AP": "dependency of vitality on appetite",
"VT_SP": "dependency of vitality on speed",
"ST_AP": "dependency of stamina on appetite",
"ST_SP": "dependency of stamina on speed",
"TMB_AP": "theoretical maximum base appetite",
"TMB_HT": "theoretical maximum base height",
"TMB_SP": "theoretical maximum base speed",
"TMB_ST": "theoretical maximum base stamina",
"TMB_VT": "theoretical maximum base vitality",
"TMB_WT": "theoretical maximum base appetite",
"TM_HT": "theoretical maximum height",
"TM_SP": "theoretical maximum speed",
"TM_WT": "theoretical maximum weight",
"TMM_HT": "theoretical maximum height multiplier",
"TMM_SP": "theoretical maximum speed multiplier",
"TMM_ST": "theoretical maximum stamina multiplier",
"TMM_VT": "theoretical maximum vitality multiplier",
"TMM_WT": "theoretical maximum weight multiplier",
"SL_FACTOR": "sleep restore factor",
"AVG_GEN": "average generation",
"AVG_IMM": "average immunity",
"AVG_AGE": "average age",
"AVG_HT": "average height",
"AVG_WT": "average weight",
"AVGMA_AP": "average maximum appetite",
"AVGMA_SP": "average maximum speed",
"AVGMA_ST": "average maximum stamina",
"AVGMA_VT": "average maximum vitality",
"AVG_SFIT": "average static fitness",
"AVG_DTHF": "average death factor",
"AVG_VIS": "average vision radius",
}
def title_case(s):
res = ''
for word in s.split(' '):
if word:
res += word[0].upper()
if len(word) > 1:
res += word[1:]
res += ' '
return res.strip()
def sentence_case(s):
res = ''
if s:
res += s[0].upper()
if len(s) > 1:
res += s[1:]
return res.strip() | code_map = {'YEAR': 'year', 'MALE': 'male population', 'FEMALE': 'female population', 'M_MALE': 'matable male population', 'M_FEMALE': 'matable female population', 'C_PROB': 'concieving probability', 'M_AGE_START': 'starting age of mating', 'M_AGE_END': 'ending age of mating', 'MX_AGE': 'maximum age', 'MT_PROB': 'mutation probability', 'OF_FACTOR': 'offspring factor', 'AGE_DTH': 'dependency of age on death', 'FIT_DTH': 'dependency of fitness on death', 'AFR_DTH': 'dependency ratio of age and fitness on death', 'HT_SP': 'dependency of height on speed', 'HT_ST': 'dependency of height on stamina', 'HT_VT': 'dependency of height on vitality', 'WT_SP': 'dependency of weight on speed', 'WT_ST': 'dependency of weight on stamina', 'WT_VT': 'dependency of weight on vitality', 'VT_AP': 'dependency of vitality on appetite', 'VT_SP': 'dependency of vitality on speed', 'ST_AP': 'dependency of stamina on appetite', 'ST_SP': 'dependency of stamina on speed', 'TMB_AP': 'theoretical maximum base appetite', 'TMB_HT': 'theoretical maximum base height', 'TMB_SP': 'theoretical maximum base speed', 'TMB_ST': 'theoretical maximum base stamina', 'TMB_VT': 'theoretical maximum base vitality', 'TMB_WT': 'theoretical maximum base appetite', 'TM_HT': 'theoretical maximum height', 'TM_SP': 'theoretical maximum speed', 'TM_WT': 'theoretical maximum weight', 'TMM_HT': 'theoretical maximum height multiplier', 'TMM_SP': 'theoretical maximum speed multiplier', 'TMM_ST': 'theoretical maximum stamina multiplier', 'TMM_VT': 'theoretical maximum vitality multiplier', 'TMM_WT': 'theoretical maximum weight multiplier', 'SL_FACTOR': 'sleep restore factor', 'AVG_GEN': 'average generation', 'AVG_IMM': 'average immunity', 'AVG_AGE': 'average age', 'AVG_HT': 'average height', 'AVG_WT': 'average weight', 'AVGMA_AP': 'average maximum appetite', 'AVGMA_SP': 'average maximum speed', 'AVGMA_ST': 'average maximum stamina', 'AVGMA_VT': 'average maximum vitality', 'AVG_SFIT': 'average static fitness', 'AVG_DTHF': 'average death factor', 'AVG_VIS': 'average vision radius'}
def title_case(s):
res = ''
for word in s.split(' '):
if word:
res += word[0].upper()
if len(word) > 1:
res += word[1:]
res += ' '
return res.strip()
def sentence_case(s):
res = ''
if s:
res += s[0].upper()
if len(s) > 1:
res += s[1:]
return res.strip() |
txt = "I like bananas"
x = txt.replace("bananas", "mangoes")
print(x)
txt = "one one was a race horse and two two was one too."
x = txt.replace("one", "three")
print(x)
txt = "one one was a race horse, two two was one too."
x = txt.replace("one", "three", 1)
print(x)
txt = "For only {price:.2f} dollars!"
print(txt.format(price = 49))
txt1 = "My name is {fname}, I'm {age}".format(fname = "John", age = 36)
txt2 = "My name is {0}, I'm {1}".format("John",36)
txt3 = "My name is {}, I'm {}".format("John",36)
txt = "banana"
x = txt.center(15)
print(x)
txt = "banana"
x = txt.center(20, "/")
print(x)
txt = "Hello, And Welcome To My World!"
x = txt.casefold()
print(x)
txt = "Hello, And Welcome To My World!"
x = txt.upper()
print(x)
txt = "Company12"
x = txt.isalnum()
print(x)
txt = "Company!@#$"
x = txt.isalnum()
print(x)
txt = "welcome to the jungle"
x = txt.split()
print(x)
txt = "hello? my name is Peter? I am 26 years old"
x = txt.split("?")
print(x)
txt = "apple#banana#cherry#orange"
x = txt.split("#")
print(x)
| txt = 'I like bananas'
x = txt.replace('bananas', 'mangoes')
print(x)
txt = 'one one was a race horse and two two was one too.'
x = txt.replace('one', 'three')
print(x)
txt = 'one one was a race horse, two two was one too.'
x = txt.replace('one', 'three', 1)
print(x)
txt = 'For only {price:.2f} dollars!'
print(txt.format(price=49))
txt1 = "My name is {fname}, I'm {age}".format(fname='John', age=36)
txt2 = "My name is {0}, I'm {1}".format('John', 36)
txt3 = "My name is {}, I'm {}".format('John', 36)
txt = 'banana'
x = txt.center(15)
print(x)
txt = 'banana'
x = txt.center(20, '/')
print(x)
txt = 'Hello, And Welcome To My World!'
x = txt.casefold()
print(x)
txt = 'Hello, And Welcome To My World!'
x = txt.upper()
print(x)
txt = 'Company12'
x = txt.isalnum()
print(x)
txt = 'Company!@#$'
x = txt.isalnum()
print(x)
txt = 'welcome to the jungle'
x = txt.split()
print(x)
txt = 'hello? my name is Peter? I am 26 years old'
x = txt.split('?')
print(x)
txt = 'apple#banana#cherry#orange'
x = txt.split('#')
print(x) |
class Solution:
def gameOfLife(self, board: List[List[int]]) -> None:
# 0 -> 0 status = 0
# 1 -> 1 status = 1
# 1 -> 0 status = 2
# 0 -> 1 status = 3
m, n = len(board), len(board[0])
directions = [(-1,-1),(0,-1),(1,-1),(-1,0),(1,0),(-1,1),(0,1),(1,1)]
for x in range(m):
for y in range(n):
lives = 0
for dx, dy in directions:
nx = x + dx
ny = y + dy
if 0<=nx<m and 0<=ny<n and (board[nx][ny] == 1 or board[nx][ny] == 2) :
lives+=1
if board[x][y] == 0 and lives==3: # rule 4
board[x][y] = 3
elif board[x][y] == 1 and (lives<2 or lives>3):
board[x][y] = 2
for x in range(m):
for y in range(n):
board[x][y] = board[x][y]%2
return board | class Solution:
def game_of_life(self, board: List[List[int]]) -> None:
(m, n) = (len(board), len(board[0]))
directions = [(-1, -1), (0, -1), (1, -1), (-1, 0), (1, 0), (-1, 1), (0, 1), (1, 1)]
for x in range(m):
for y in range(n):
lives = 0
for (dx, dy) in directions:
nx = x + dx
ny = y + dy
if 0 <= nx < m and 0 <= ny < n and (board[nx][ny] == 1 or board[nx][ny] == 2):
lives += 1
if board[x][y] == 0 and lives == 3:
board[x][y] = 3
elif board[x][y] == 1 and (lives < 2 or lives > 3):
board[x][y] = 2
for x in range(m):
for y in range(n):
board[x][y] = board[x][y] % 2
return board |
def calc(x,y,ops):
if ops not in "+-*/":
return "only +-*/!!!!!"
if ops=="+":
return (str(x) +""+ ops +str(y)+"="+str(x+y))
elif ops=="-":
return (str(x) +""+ ops +str(y)+"="+str(x-y))
elif ops == "*":
return (str(x) + "" + ops + str(y) + "=" + str(x * y))
elif ops == "/":
return (str(x) + "" + ops + str(y) + "=" + str(x / y))
while True:
x=int(input("please enter first number"))
y=int(input("please enter second number"))
ops=input("choose between +,-,*,/")
print(calc(x,y,ops))
| def calc(x, y, ops):
if ops not in '+-*/':
return 'only +-*/!!!!!'
if ops == '+':
return str(x) + '' + ops + str(y) + '=' + str(x + y)
elif ops == '-':
return str(x) + '' + ops + str(y) + '=' + str(x - y)
elif ops == '*':
return str(x) + '' + ops + str(y) + '=' + str(x * y)
elif ops == '/':
return str(x) + '' + ops + str(y) + '=' + str(x / y)
while True:
x = int(input('please enter first number'))
y = int(input('please enter second number'))
ops = input('choose between +,-,*,/')
print(calc(x, y, ops)) |
n = int(input())
length = 0
while True:
length += 1
n //= 10
if n == 0:
break
print('Length is', length)
| n = int(input())
length = 0
while True:
length += 1
n //= 10
if n == 0:
break
print('Length is', length) |
''' '+' Plus Operator shows polymorphism. It is overloaded to perform multiple things, so we can call it polymorphic. '''
x = 10
y = 20
print(x+y)
s1 = 'Hello'
s2 = " How are you?"
print(s1+s2)
l1 = [1,2,3]
l2 = [4,5,6]
print(l1+l2)
| """ '+' Plus Operator shows polymorphism. It is overloaded to perform multiple things, so we can call it polymorphic. """
x = 10
y = 20
print(x + y)
s1 = 'Hello'
s2 = ' How are you?'
print(s1 + s2)
l1 = [1, 2, 3]
l2 = [4, 5, 6]
print(l1 + l2) |
people = 50 #defines the people variable
cars = 10 #defines the cars variable
trucks = 35 #defines the trucks variable
if cars > people or trucks < cars: #sets up the first branch
print("We should take the cars.") #print that runs if the if above is true
elif cars < people: #sets up second branch that runs if the first one is not true
print("We should not take the cars.") #print that runs if the elif above is true
else: #sets up third and last branch that will run if the above ifs are not true
print("We can't decide.") #print that runs if the else above is true
if trucks > cars:#sets up the first branch
print("That's too many trucks.")#print that runs if the if above is true
elif trucks < cars:#sets up second branch that runs if the first one is not true
print("Maybe we could take the trucks.")#print that runs if the elif above is true
else:#sets up third and last branch that will run if the above ifs are not true
print("We still can't decide.")#print that runs if the else above is true
if people > trucks:#sets up the first branch
print("Alright, let's just take the trucks.")#print that runs if the if above is true
else: #sets up second and last branch
print("Fine, let's stay home then.")#print that runs if the else above is true
| people = 50
cars = 10
trucks = 35
if cars > people or trucks < cars:
print('We should take the cars.')
elif cars < people:
print('We should not take the cars.')
else:
print("We can't decide.")
if trucks > cars:
print("That's too many trucks.")
elif trucks < cars:
print('Maybe we could take the trucks.')
else:
print("We still can't decide.")
if people > trucks:
print("Alright, let's just take the trucks.")
else:
print("Fine, let's stay home then.") |
DESEncryptParam = "key(16 Hex Chars), Number of rounds"
INITIAL_PERMUTATION = [58, 50, 42, 34, 26, 18, 10, 2,
60, 52, 44, 36, 28, 20, 12, 4,
62, 54, 46, 38, 30, 22, 14, 6,
64, 56, 48, 40, 32, 24, 16, 8,
57, 49, 41, 33, 25, 17, 9, 1,
59, 51, 43, 35, 27, 19, 11, 3,
61, 53, 45, 37, 29, 21, 13, 5,
63, 55, 47, 39, 31, 23, 15, 7]
PERMUTED_CHOICE_1 = [57, 49, 41, 33, 25, 17, 9,
1, 58, 50, 42, 34, 26, 18,
10, 2, 59, 51, 43, 35, 27,
19, 11, 3, 60, 52, 44, 36,
63, 55, 47, 39, 31, 23, 15,
7, 62, 54, 46, 38, 30, 22,
14, 6, 61, 53, 45, 37, 29,
21, 13, 5, 28, 20, 12, 4]
PERMUTED_CHOICE_2 = [14, 17, 11, 24, 1, 5, 3, 28,
15, 6, 21, 10, 23, 19, 12, 4,
26, 8, 16, 7, 27, 20, 13, 2,
41, 52, 31, 37, 47, 55, 30, 40,
51, 45, 33, 48, 44, 49, 39, 56,
34, 53, 46, 42, 50, 36, 29, 32]
EXPANSION_PERMUTATION = [32, 1, 2, 3, 4, 5,
4, 5, 6, 7, 8, 9,
8, 9, 10, 11, 12, 13,
12, 13, 14, 15, 16, 17,
16, 17, 18, 19, 20, 21,
20, 21, 22, 23, 24, 25,
24, 25, 26, 27, 28, 29,
28, 29, 30, 31, 32, 1]
S_BOX = [
[[14, 4, 13, 1, 2, 15, 11, 8, 3, 10, 6, 12, 5, 9, 0, 7],
[0, 15, 7, 4, 14, 2, 13, 1, 10, 6, 12, 11, 9, 5, 3, 8],
[4, 1, 14, 8, 13, 6, 2, 11, 15, 12, 9, 7, 3, 10, 5, 0],
[15, 12, 8, 2, 4, 9, 1, 7, 5, 11, 3, 14, 10, 0, 6, 13],
],
[[15, 1, 8, 14, 6, 11, 3, 4, 9, 7, 2, 13, 12, 0, 5, 10],
[3, 13, 4, 7, 15, 2, 8, 14, 12, 0, 1, 10, 6, 9, 11, 5],
[0, 14, 7, 11, 10, 4, 13, 1, 5, 8, 12, 6, 9, 3, 2, 15],
[13, 8, 10, 1, 3, 15, 4, 2, 11, 6, 7, 12, 0, 5, 14, 9],
],
[[10, 0, 9, 14, 6, 3, 15, 5, 1, 13, 12, 7, 11, 4, 2, 8],
[13, 7, 0, 9, 3, 4, 6, 10, 2, 8, 5, 14, 12, 11, 15, 1],
[13, 6, 4, 9, 8, 15, 3, 0, 11, 1, 2, 12, 5, 10, 14, 7],
[1, 10, 13, 0, 6, 9, 8, 7, 4, 15, 14, 3, 11, 5, 2, 12],
],
[[7, 13, 14, 3, 0, 6, 9, 10, 1, 2, 8, 5, 11, 12, 4, 15],
[13, 8, 11, 5, 6, 15, 0, 3, 4, 7, 2, 12, 1, 10, 14, 9],
[10, 6, 9, 0, 12, 11, 7, 13, 15, 1, 3, 14, 5, 2, 8, 4],
[3, 15, 0, 6, 10, 1, 13, 8, 9, 4, 5, 11, 12, 7, 2, 14],
],
[[2, 12, 4, 1, 7, 10, 11, 6, 8, 5, 3, 15, 13, 0, 14, 9],
[14, 11, 2, 12, 4, 7, 13, 1, 5, 0, 15, 10, 3, 9, 8, 6],
[4, 2, 1, 11, 10, 13, 7, 8, 15, 9, 12, 5, 6, 3, 0, 14],
[11, 8, 12, 7, 1, 14, 2, 13, 6, 15, 0, 9, 10, 4, 5, 3],
],
[[12, 1, 10, 15, 9, 2, 6, 8, 0, 13, 3, 4, 14, 7, 5, 11],
[10, 15, 4, 2, 7, 12, 9, 5, 6, 1, 13, 14, 0, 11, 3, 8],
[9, 14, 15, 5, 2, 8, 12, 3, 7, 0, 4, 10, 1, 13, 11, 6],
[4, 3, 2, 12, 9, 5, 15, 10, 11, 14, 1, 7, 6, 0, 8, 13],
],
[[4, 11, 2, 14, 15, 0, 8, 13, 3, 12, 9, 7, 5, 10, 6, 1],
[13, 0, 11, 7, 4, 9, 1, 10, 14, 3, 5, 12, 2, 15, 8, 6],
[1, 4, 11, 13, 12, 3, 7, 14, 10, 15, 6, 8, 0, 5, 9, 2],
[6, 11, 13, 8, 1, 4, 10, 7, 9, 5, 0, 15, 14, 2, 3, 12],
],
[[13, 2, 8, 4, 6, 15, 11, 1, 10, 9, 3, 14, 5, 0, 12, 7],
[1, 15, 13, 8, 10, 3, 7, 4, 12, 5, 6, 11, 0, 14, 9, 2],
[7, 11, 4, 1, 9, 12, 14, 2, 0, 6, 10, 13, 15, 3, 5, 8],
[2, 1, 14, 7, 4, 10, 8, 13, 15, 12, 9, 0, 3, 5, 6, 11],
]
]
PERMUTATION_TABLE = [16, 7, 20, 21, 29, 12, 28, 17,
1, 15, 23, 26, 5, 18, 31, 10,
2, 8, 24, 14, 32, 27, 3, 9,
19, 13, 30, 6, 22, 11, 4, 25]
FINAL_PERMUTATION = [40, 8, 48, 16, 56, 24, 64, 32,
39, 7, 47, 15, 55, 23, 63, 31,
38, 6, 46, 14, 54, 22, 62, 30,
37, 5, 45, 13, 53, 21, 61, 29,
36, 4, 44, 12, 52, 20, 60, 28,
35, 3, 43, 11, 51, 19, 59, 27,
34, 2, 42, 10, 50, 18, 58, 26,
33, 1, 41, 9, 49, 17, 57, 25]
SHIFT = [1, 1, 2, 2, 2, 2, 2, 2, 1, 2, 2, 2, 2, 2, 2, 1]
def toBin(input):
binval = bin(input)[2:]
while len(binval) < 4:
binval = "0" + binval
return binval
def hexToBin(input):
return bin(int(input, 16))[2:].zfill(64)
def substitute(input):
subblocks = splitToArrOfN(input, 6)
result = []
for i in range(len(subblocks)):
block = subblocks[i]
row = int(str(block[0])+str(block[5]), 2)
column = int(''.join([str(x) for x in block[1:][:-1]]), 2)
result += [int(x) for x in toBin(S_BOX[i][row][column])]
return result
def splitToArrOfN(listToSplit, newSize):
return [listToSplit[k:k+newSize] for k in range(0, len(listToSplit), newSize)]
def xor(operand1, operand2):
return [int(operand1[i]) ^ int(operand2[i]) for i in range(len(operand1))]
def shift(operand1, operand2, shiftAmount):
return operand1[shiftAmount:] + operand1[:shiftAmount], operand2[shiftAmount:] + operand2[:shiftAmount]
def permut(block, table):
return [block[x-1] for x in table]
def getKeys(initialKey):
keys = []
left, right = splitToArrOfN(
permut(hexToBin(initialKey), PERMUTED_CHOICE_1), 28)
for i in range(16):
left, right = shift(left, right, SHIFT[i])
keys.append(permut(left + right, PERMUTED_CHOICE_2))
return keys
def DESEncrypt(input, param):
key, numberOfRounds = param
numberOfRounds = int(numberOfRounds)
keys = getKeys(key)
currentPhase = input[0].strip()
for _ in range(numberOfRounds):
result = []
for block in splitToArrOfN(currentPhase, 16):
block = permut(hexToBin(block), INITIAL_PERMUTATION)
left, right = splitToArrOfN(block, 32)
intermediateValue = None
for i in range(16):
rightPermuted = permut(right, EXPANSION_PERMUTATION)
intermediateValue = xor(keys[i], rightPermuted)
intermediateValue = substitute(intermediateValue)
intermediateValue = permut(
intermediateValue, PERMUTATION_TABLE)
intermediateValue = xor(left, intermediateValue)
left, right = right, intermediateValue
result += permut(right+left, FINAL_PERMUTATION)
currentPhase = ''.join([hex(int(''.join(map(str, i)), 2))[
2] for i in splitToArrOfN(result, 4)])
return [currentPhase.upper()]
def DESDecrypt(input, param):
key, numberOfRounds = param
numberOfRounds = int(numberOfRounds)
keys = getKeys(key)
currentPhase = input[0].strip()
for _ in range(numberOfRounds):
result = []
for block in splitToArrOfN(currentPhase, 16):
block = permut(hexToBin(block), INITIAL_PERMUTATION)
left, right = splitToArrOfN(block, 32)
intermediateValue = None
for i in range(16):
rightPermuted = permut(right, EXPANSION_PERMUTATION)
intermediateValue = xor(keys[15-i], rightPermuted)
intermediateValue = substitute(intermediateValue)
intermediateValue = permut(
intermediateValue, PERMUTATION_TABLE)
intermediateValue = xor(left, intermediateValue)
left, right = right, intermediateValue
result += permut(right+left, FINAL_PERMUTATION)
currentPhase = ''.join([hex(int(''.join(map(str, i)), 2))[
2] for i in splitToArrOfN(result, 4)])
return [currentPhase.upper()]
| des_encrypt_param = 'key(16 Hex Chars), Number of rounds'
initial_permutation = [58, 50, 42, 34, 26, 18, 10, 2, 60, 52, 44, 36, 28, 20, 12, 4, 62, 54, 46, 38, 30, 22, 14, 6, 64, 56, 48, 40, 32, 24, 16, 8, 57, 49, 41, 33, 25, 17, 9, 1, 59, 51, 43, 35, 27, 19, 11, 3, 61, 53, 45, 37, 29, 21, 13, 5, 63, 55, 47, 39, 31, 23, 15, 7]
permuted_choice_1 = [57, 49, 41, 33, 25, 17, 9, 1, 58, 50, 42, 34, 26, 18, 10, 2, 59, 51, 43, 35, 27, 19, 11, 3, 60, 52, 44, 36, 63, 55, 47, 39, 31, 23, 15, 7, 62, 54, 46, 38, 30, 22, 14, 6, 61, 53, 45, 37, 29, 21, 13, 5, 28, 20, 12, 4]
permuted_choice_2 = [14, 17, 11, 24, 1, 5, 3, 28, 15, 6, 21, 10, 23, 19, 12, 4, 26, 8, 16, 7, 27, 20, 13, 2, 41, 52, 31, 37, 47, 55, 30, 40, 51, 45, 33, 48, 44, 49, 39, 56, 34, 53, 46, 42, 50, 36, 29, 32]
expansion_permutation = [32, 1, 2, 3, 4, 5, 4, 5, 6, 7, 8, 9, 8, 9, 10, 11, 12, 13, 12, 13, 14, 15, 16, 17, 16, 17, 18, 19, 20, 21, 20, 21, 22, 23, 24, 25, 24, 25, 26, 27, 28, 29, 28, 29, 30, 31, 32, 1]
s_box = [[[14, 4, 13, 1, 2, 15, 11, 8, 3, 10, 6, 12, 5, 9, 0, 7], [0, 15, 7, 4, 14, 2, 13, 1, 10, 6, 12, 11, 9, 5, 3, 8], [4, 1, 14, 8, 13, 6, 2, 11, 15, 12, 9, 7, 3, 10, 5, 0], [15, 12, 8, 2, 4, 9, 1, 7, 5, 11, 3, 14, 10, 0, 6, 13]], [[15, 1, 8, 14, 6, 11, 3, 4, 9, 7, 2, 13, 12, 0, 5, 10], [3, 13, 4, 7, 15, 2, 8, 14, 12, 0, 1, 10, 6, 9, 11, 5], [0, 14, 7, 11, 10, 4, 13, 1, 5, 8, 12, 6, 9, 3, 2, 15], [13, 8, 10, 1, 3, 15, 4, 2, 11, 6, 7, 12, 0, 5, 14, 9]], [[10, 0, 9, 14, 6, 3, 15, 5, 1, 13, 12, 7, 11, 4, 2, 8], [13, 7, 0, 9, 3, 4, 6, 10, 2, 8, 5, 14, 12, 11, 15, 1], [13, 6, 4, 9, 8, 15, 3, 0, 11, 1, 2, 12, 5, 10, 14, 7], [1, 10, 13, 0, 6, 9, 8, 7, 4, 15, 14, 3, 11, 5, 2, 12]], [[7, 13, 14, 3, 0, 6, 9, 10, 1, 2, 8, 5, 11, 12, 4, 15], [13, 8, 11, 5, 6, 15, 0, 3, 4, 7, 2, 12, 1, 10, 14, 9], [10, 6, 9, 0, 12, 11, 7, 13, 15, 1, 3, 14, 5, 2, 8, 4], [3, 15, 0, 6, 10, 1, 13, 8, 9, 4, 5, 11, 12, 7, 2, 14]], [[2, 12, 4, 1, 7, 10, 11, 6, 8, 5, 3, 15, 13, 0, 14, 9], [14, 11, 2, 12, 4, 7, 13, 1, 5, 0, 15, 10, 3, 9, 8, 6], [4, 2, 1, 11, 10, 13, 7, 8, 15, 9, 12, 5, 6, 3, 0, 14], [11, 8, 12, 7, 1, 14, 2, 13, 6, 15, 0, 9, 10, 4, 5, 3]], [[12, 1, 10, 15, 9, 2, 6, 8, 0, 13, 3, 4, 14, 7, 5, 11], [10, 15, 4, 2, 7, 12, 9, 5, 6, 1, 13, 14, 0, 11, 3, 8], [9, 14, 15, 5, 2, 8, 12, 3, 7, 0, 4, 10, 1, 13, 11, 6], [4, 3, 2, 12, 9, 5, 15, 10, 11, 14, 1, 7, 6, 0, 8, 13]], [[4, 11, 2, 14, 15, 0, 8, 13, 3, 12, 9, 7, 5, 10, 6, 1], [13, 0, 11, 7, 4, 9, 1, 10, 14, 3, 5, 12, 2, 15, 8, 6], [1, 4, 11, 13, 12, 3, 7, 14, 10, 15, 6, 8, 0, 5, 9, 2], [6, 11, 13, 8, 1, 4, 10, 7, 9, 5, 0, 15, 14, 2, 3, 12]], [[13, 2, 8, 4, 6, 15, 11, 1, 10, 9, 3, 14, 5, 0, 12, 7], [1, 15, 13, 8, 10, 3, 7, 4, 12, 5, 6, 11, 0, 14, 9, 2], [7, 11, 4, 1, 9, 12, 14, 2, 0, 6, 10, 13, 15, 3, 5, 8], [2, 1, 14, 7, 4, 10, 8, 13, 15, 12, 9, 0, 3, 5, 6, 11]]]
permutation_table = [16, 7, 20, 21, 29, 12, 28, 17, 1, 15, 23, 26, 5, 18, 31, 10, 2, 8, 24, 14, 32, 27, 3, 9, 19, 13, 30, 6, 22, 11, 4, 25]
final_permutation = [40, 8, 48, 16, 56, 24, 64, 32, 39, 7, 47, 15, 55, 23, 63, 31, 38, 6, 46, 14, 54, 22, 62, 30, 37, 5, 45, 13, 53, 21, 61, 29, 36, 4, 44, 12, 52, 20, 60, 28, 35, 3, 43, 11, 51, 19, 59, 27, 34, 2, 42, 10, 50, 18, 58, 26, 33, 1, 41, 9, 49, 17, 57, 25]
shift = [1, 1, 2, 2, 2, 2, 2, 2, 1, 2, 2, 2, 2, 2, 2, 1]
def to_bin(input):
binval = bin(input)[2:]
while len(binval) < 4:
binval = '0' + binval
return binval
def hex_to_bin(input):
return bin(int(input, 16))[2:].zfill(64)
def substitute(input):
subblocks = split_to_arr_of_n(input, 6)
result = []
for i in range(len(subblocks)):
block = subblocks[i]
row = int(str(block[0]) + str(block[5]), 2)
column = int(''.join([str(x) for x in block[1:][:-1]]), 2)
result += [int(x) for x in to_bin(S_BOX[i][row][column])]
return result
def split_to_arr_of_n(listToSplit, newSize):
return [listToSplit[k:k + newSize] for k in range(0, len(listToSplit), newSize)]
def xor(operand1, operand2):
return [int(operand1[i]) ^ int(operand2[i]) for i in range(len(operand1))]
def shift(operand1, operand2, shiftAmount):
return (operand1[shiftAmount:] + operand1[:shiftAmount], operand2[shiftAmount:] + operand2[:shiftAmount])
def permut(block, table):
return [block[x - 1] for x in table]
def get_keys(initialKey):
keys = []
(left, right) = split_to_arr_of_n(permut(hex_to_bin(initialKey), PERMUTED_CHOICE_1), 28)
for i in range(16):
(left, right) = shift(left, right, SHIFT[i])
keys.append(permut(left + right, PERMUTED_CHOICE_2))
return keys
def des_encrypt(input, param):
(key, number_of_rounds) = param
number_of_rounds = int(numberOfRounds)
keys = get_keys(key)
current_phase = input[0].strip()
for _ in range(numberOfRounds):
result = []
for block in split_to_arr_of_n(currentPhase, 16):
block = permut(hex_to_bin(block), INITIAL_PERMUTATION)
(left, right) = split_to_arr_of_n(block, 32)
intermediate_value = None
for i in range(16):
right_permuted = permut(right, EXPANSION_PERMUTATION)
intermediate_value = xor(keys[i], rightPermuted)
intermediate_value = substitute(intermediateValue)
intermediate_value = permut(intermediateValue, PERMUTATION_TABLE)
intermediate_value = xor(left, intermediateValue)
(left, right) = (right, intermediateValue)
result += permut(right + left, FINAL_PERMUTATION)
current_phase = ''.join([hex(int(''.join(map(str, i)), 2))[2] for i in split_to_arr_of_n(result, 4)])
return [currentPhase.upper()]
def des_decrypt(input, param):
(key, number_of_rounds) = param
number_of_rounds = int(numberOfRounds)
keys = get_keys(key)
current_phase = input[0].strip()
for _ in range(numberOfRounds):
result = []
for block in split_to_arr_of_n(currentPhase, 16):
block = permut(hex_to_bin(block), INITIAL_PERMUTATION)
(left, right) = split_to_arr_of_n(block, 32)
intermediate_value = None
for i in range(16):
right_permuted = permut(right, EXPANSION_PERMUTATION)
intermediate_value = xor(keys[15 - i], rightPermuted)
intermediate_value = substitute(intermediateValue)
intermediate_value = permut(intermediateValue, PERMUTATION_TABLE)
intermediate_value = xor(left, intermediateValue)
(left, right) = (right, intermediateValue)
result += permut(right + left, FINAL_PERMUTATION)
current_phase = ''.join([hex(int(''.join(map(str, i)), 2))[2] for i in split_to_arr_of_n(result, 4)])
return [currentPhase.upper()] |
class WikipediaKnowledge:
@staticmethod
def all_wikipedia_language_codes_order_by_importance():
# list from https://meta.wikimedia.org/wiki/List_of_Wikipedias as of 2017-10-07
# ordered by article count except some for extreme bot spam
# should use https://stackoverflow.com/questions/33608751/retrieve-a-list-of-all-wikipedia-languages-programmatically
# probably via wikipedia connection library
return ['en', 'de', 'fr', 'nl', 'ru', 'it', 'es', 'pl',
'vi', 'ja', 'pt', 'zh', 'uk', 'fa', 'ca', 'ar', 'no', 'sh', 'fi',
'hu', 'id', 'ko', 'cs', 'ro', 'sr', 'ms', 'tr', 'eu', 'eo', 'bg',
'hy', 'da', 'zh-min-nan', 'sk', 'min', 'kk', 'he', 'lt', 'hr',
'ce', 'et', 'sl', 'be', 'gl', 'el', 'nn', 'uz', 'simple', 'la',
'az', 'ur', 'hi', 'vo', 'th', 'ka', 'ta', 'cy', 'mk', 'mg', 'oc',
'tl', 'ky', 'lv', 'bs', 'tt', 'new', 'sq', 'tg', 'te', 'pms',
'br', 'be-tarask', 'zh-yue', 'bn', 'ml', 'ht', 'ast', 'lb', 'jv',
'mr', 'azb', 'af', 'sco', 'pnb', 'ga', 'is', 'cv', 'ba', 'fy',
'su', 'sw', 'my', 'lmo', 'an', 'yo', 'ne', 'gu', 'io', 'pa',
'nds', 'scn', 'bpy', 'als', 'bar', 'ku', 'kn', 'ia', 'qu', 'ckb',
'mn', 'arz', 'bat-smg', 'wa', 'gd', 'nap', 'bug', 'yi', 'am',
'si', 'cdo', 'map-bms', 'or', 'fo', 'mzn', 'hsb', 'xmf', 'li',
'mai', 'sah', 'sa', 'vec', 'ilo', 'os', 'mrj', 'hif', 'mhr', 'bh',
'roa-tara', 'eml', 'diq', 'pam', 'ps', 'sd', 'hak', 'nso', 'se',
'ace', 'bcl', 'mi', 'nah', 'zh-classical', 'nds-nl', 'szl', 'gan',
'vls', 'rue', 'wuu', 'bo', 'glk', 'vep', 'sc', 'fiu-vro', 'frr',
'co', 'crh', 'km', 'lrc', 'tk', 'kv', 'csb', 'so', 'gv', 'as',
'lad', 'zea', 'ay', 'udm', 'myv', 'lez', 'kw', 'stq', 'ie',
'nrm', 'nv', 'pcd', 'mwl', 'rm', 'koi', 'gom', 'ug', 'lij', 'ab',
'gn', 'mt', 'fur', 'dsb', 'cbk-zam', 'dv', 'ang', 'ln', 'ext',
'kab', 'sn', 'ksh', 'lo', 'gag', 'frp', 'pag', 'pi', 'olo', 'av',
'dty', 'xal', 'pfl', 'krc', 'haw', 'bxr', 'kaa', 'pap', 'rw',
'pdc', 'bjn', 'to', 'nov', 'kl', 'arc', 'jam', 'kbd', 'ha', 'tpi',
'tyv', 'tet', 'ig', 'ki', 'na', 'lbe', 'roa-rup', 'jbo', 'ty',
'mdf', 'kg', 'za', 'wo', 'lg', 'bi', 'srn', 'zu', 'chr', 'tcy',
'ltg', 'sm', 'om', 'xh', 'tn', 'pih', 'chy', 'rmy', 'tw', 'cu',
'kbp', 'tum', 'ts', 'st', 'got', 'rn', 'pnt', 'ss', 'fj', 'bm',
'ch', 'ady', 'iu', 'mo', 'ny', 'ee', 'ks', 'ak', 'ik', 've', 'sg',
'dz', 'ff', 'ti', 'cr', 'atj', 'din', 'ng', 'cho', 'kj', 'mh',
'ho', 'ii', 'aa', 'mus', 'hz', 'kr',
# degraded due to major low-quality bot spam
'ceb', 'sv', 'war'
]
| class Wikipediaknowledge:
@staticmethod
def all_wikipedia_language_codes_order_by_importance():
return ['en', 'de', 'fr', 'nl', 'ru', 'it', 'es', 'pl', 'vi', 'ja', 'pt', 'zh', 'uk', 'fa', 'ca', 'ar', 'no', 'sh', 'fi', 'hu', 'id', 'ko', 'cs', 'ro', 'sr', 'ms', 'tr', 'eu', 'eo', 'bg', 'hy', 'da', 'zh-min-nan', 'sk', 'min', 'kk', 'he', 'lt', 'hr', 'ce', 'et', 'sl', 'be', 'gl', 'el', 'nn', 'uz', 'simple', 'la', 'az', 'ur', 'hi', 'vo', 'th', 'ka', 'ta', 'cy', 'mk', 'mg', 'oc', 'tl', 'ky', 'lv', 'bs', 'tt', 'new', 'sq', 'tg', 'te', 'pms', 'br', 'be-tarask', 'zh-yue', 'bn', 'ml', 'ht', 'ast', 'lb', 'jv', 'mr', 'azb', 'af', 'sco', 'pnb', 'ga', 'is', 'cv', 'ba', 'fy', 'su', 'sw', 'my', 'lmo', 'an', 'yo', 'ne', 'gu', 'io', 'pa', 'nds', 'scn', 'bpy', 'als', 'bar', 'ku', 'kn', 'ia', 'qu', 'ckb', 'mn', 'arz', 'bat-smg', 'wa', 'gd', 'nap', 'bug', 'yi', 'am', 'si', 'cdo', 'map-bms', 'or', 'fo', 'mzn', 'hsb', 'xmf', 'li', 'mai', 'sah', 'sa', 'vec', 'ilo', 'os', 'mrj', 'hif', 'mhr', 'bh', 'roa-tara', 'eml', 'diq', 'pam', 'ps', 'sd', 'hak', 'nso', 'se', 'ace', 'bcl', 'mi', 'nah', 'zh-classical', 'nds-nl', 'szl', 'gan', 'vls', 'rue', 'wuu', 'bo', 'glk', 'vep', 'sc', 'fiu-vro', 'frr', 'co', 'crh', 'km', 'lrc', 'tk', 'kv', 'csb', 'so', 'gv', 'as', 'lad', 'zea', 'ay', 'udm', 'myv', 'lez', 'kw', 'stq', 'ie', 'nrm', 'nv', 'pcd', 'mwl', 'rm', 'koi', 'gom', 'ug', 'lij', 'ab', 'gn', 'mt', 'fur', 'dsb', 'cbk-zam', 'dv', 'ang', 'ln', 'ext', 'kab', 'sn', 'ksh', 'lo', 'gag', 'frp', 'pag', 'pi', 'olo', 'av', 'dty', 'xal', 'pfl', 'krc', 'haw', 'bxr', 'kaa', 'pap', 'rw', 'pdc', 'bjn', 'to', 'nov', 'kl', 'arc', 'jam', 'kbd', 'ha', 'tpi', 'tyv', 'tet', 'ig', 'ki', 'na', 'lbe', 'roa-rup', 'jbo', 'ty', 'mdf', 'kg', 'za', 'wo', 'lg', 'bi', 'srn', 'zu', 'chr', 'tcy', 'ltg', 'sm', 'om', 'xh', 'tn', 'pih', 'chy', 'rmy', 'tw', 'cu', 'kbp', 'tum', 'ts', 'st', 'got', 'rn', 'pnt', 'ss', 'fj', 'bm', 'ch', 'ady', 'iu', 'mo', 'ny', 'ee', 'ks', 'ak', 'ik', 've', 'sg', 'dz', 'ff', 'ti', 'cr', 'atj', 'din', 'ng', 'cho', 'kj', 'mh', 'ho', 'ii', 'aa', 'mus', 'hz', 'kr', 'ceb', 'sv', 'war'] |
# -*- coding:utf-8 -*-
# @Script: rotate_array.py
# @Author: Pradip Patil
# @Contact: @pradip__patil
# @Created: 2019-04-01 21:36:57
# @Last Modified By: Pradip Patil
# @Last Modified: 2019-04-01 22:44:02
# @Description: https://leetcode.com/problems/rotate-array/
'''
Given an array, rotate the array to the right by k steps, where k is non-negative.
Example 1:
Input: [1,2,3,4,5,6,7] and k = 3
Output: [5,6,7,1,2,3,4]
Explanation:
rotate 1 steps to the right: [7,1,2,3,4,5,6]
rotate 2 steps to the right: [6,7,1,2,3,4,5]
rotate 3 steps to the right: [5,6,7,1,2,3,4]
Example 2:
Input: [-1,-100,3,99] and k = 2
Output: [3,99,-1,-100]
Explanation:
rotate 1 steps to the right: [99,-1,-100,3]
rotate 2 steps to the right: [3,99,-1,-100]
Note:
Try to come up as many solutions as you can, there are at least 3 different ways to solve this problem.
Could you do it in-place with O(1) extra space?
'''
class Solution:
def reverse(self, nums, start, end):
while start < end:
temp = nums[start]
nums[start] = nums[end]
nums[end] = temp
start += 1
end -= 1
def rotate(self, nums, k):
k %= len(nums)
self.reverse(nums, 0, len(nums)-1)
self.reverse(nums, 0, k-1)
self.reverse(nums, k, len(nums)-1)
return nums
# Using builtins
class Solution_1:
def rotate(self, nums, k):
l = len(nums)
k %= l
nums[0:l] = nums[-k:] + nums[:-k]
return nums
if __name__ == "__main__":
print(Solution().rotate([-1, -100, 3, 99], 2))
print(Solution_1().rotate([-1, -100, 3, 99], 2))
print(Solution().rotate([1, 2, 3, 4, 5, 6, 7], 3))
print(Solution_1().rotate([1, 2, 3, 4, 5, 6, 7], 3))
| """
Given an array, rotate the array to the right by k steps, where k is non-negative.
Example 1:
Input: [1,2,3,4,5,6,7] and k = 3
Output: [5,6,7,1,2,3,4]
Explanation:
rotate 1 steps to the right: [7,1,2,3,4,5,6]
rotate 2 steps to the right: [6,7,1,2,3,4,5]
rotate 3 steps to the right: [5,6,7,1,2,3,4]
Example 2:
Input: [-1,-100,3,99] and k = 2
Output: [3,99,-1,-100]
Explanation:
rotate 1 steps to the right: [99,-1,-100,3]
rotate 2 steps to the right: [3,99,-1,-100]
Note:
Try to come up as many solutions as you can, there are at least 3 different ways to solve this problem.
Could you do it in-place with O(1) extra space?
"""
class Solution:
def reverse(self, nums, start, end):
while start < end:
temp = nums[start]
nums[start] = nums[end]
nums[end] = temp
start += 1
end -= 1
def rotate(self, nums, k):
k %= len(nums)
self.reverse(nums, 0, len(nums) - 1)
self.reverse(nums, 0, k - 1)
self.reverse(nums, k, len(nums) - 1)
return nums
class Solution_1:
def rotate(self, nums, k):
l = len(nums)
k %= l
nums[0:l] = nums[-k:] + nums[:-k]
return nums
if __name__ == '__main__':
print(solution().rotate([-1, -100, 3, 99], 2))
print(solution_1().rotate([-1, -100, 3, 99], 2))
print(solution().rotate([1, 2, 3, 4, 5, 6, 7], 3))
print(solution_1().rotate([1, 2, 3, 4, 5, 6, 7], 3)) |
class TrainingConfig():
batch_size=64
lr=0.001
epoches=20
print_step=15
class BertMRCTrainingConfig(TrainingConfig):
batch_size=64
lr=1e-5
epoches=5
class TransformerConfig(TrainingConfig):
pass
class HBTTrainingConfig(TrainingConfig):
batch_size=32
lr=1e-5
epoch=20
| class Trainingconfig:
batch_size = 64
lr = 0.001
epoches = 20
print_step = 15
class Bertmrctrainingconfig(TrainingConfig):
batch_size = 64
lr = 1e-05
epoches = 5
class Transformerconfig(TrainingConfig):
pass
class Hbttrainingconfig(TrainingConfig):
batch_size = 32
lr = 1e-05
epoch = 20 |
# mouse
MOUSE_BEFORE_DELAY = 0.1
MOUSE_AFTER_DELAY = 0.1
MOUSE_PRESS_TIME = 0.2
MOUSE_INTERVAL = 0.2
# keyboard
KEYBOARD_BEFORE_DELAY = 0.05
KEYBOARD_AFTER_DELAY = 0.05
KEYBOARD_PRESS_TIME = 0.15
KEYBOARD_INTERVAL = 0.1
# clipbaord
CLIPBOARD_CHARSET = 'gbk'
# window
WINDOW_TITLE = 'Program Manager'
WINDOW_MANAGE_TIMEOUT = 5
WINDOW_NEW_BUILD_TIMEOUT = 5
# image
IMAGE_SCREENSHOT_POSITION_DEFAULT = (0,0)
IMAGE_SCREENSHOT_SIZE_DEFAULT = (1920,1080)
| mouse_before_delay = 0.1
mouse_after_delay = 0.1
mouse_press_time = 0.2
mouse_interval = 0.2
keyboard_before_delay = 0.05
keyboard_after_delay = 0.05
keyboard_press_time = 0.15
keyboard_interval = 0.1
clipboard_charset = 'gbk'
window_title = 'Program Manager'
window_manage_timeout = 5
window_new_build_timeout = 5
image_screenshot_position_default = (0, 0)
image_screenshot_size_default = (1920, 1080) |
class Student(object):
def __init__(self, name):
self.name = name
def __str__(self):
return 'Student object (name: %s)' % self.name
def __call__(self):
print('My name 111111111is %s.' % self.name)
print("-----------------------")
ffl = Student('ffl')
print("ffl-->", ffl)
print("ffl-11->", ffl())
# f = lambda:34
# print(f)
# print(f())
| class Student(object):
def __init__(self, name):
self.name = name
def __str__(self):
return 'Student object (name: %s)' % self.name
def __call__(self):
print('My name 111111111is %s.' % self.name)
print('-----------------------')
ffl = student('ffl')
print('ffl-->', ffl)
print('ffl-11->', ffl()) |
LIMIT = 2000000;
def solve(limit):
a = 0
dam = limit
for i in range(2, 101):
for j in range(i, 101):
d = abs(i*(i + 1) * j*(j + 1)/4 - limit)
if d < dam:
a, dam = i * j, d
return a
if __name__ == "__main__":
print(solve(LIMIT))
| limit = 2000000
def solve(limit):
a = 0
dam = limit
for i in range(2, 101):
for j in range(i, 101):
d = abs(i * (i + 1) * j * (j + 1) / 4 - limit)
if d < dam:
(a, dam) = (i * j, d)
return a
if __name__ == '__main__':
print(solve(LIMIT)) |
for _ in range(int(input())):
l,r=map(int,input().split())
b=r
a=r//2+1
if a<l:
a=l
if a>r:
a=r
print(b%a) | for _ in range(int(input())):
(l, r) = map(int, input().split())
b = r
a = r // 2 + 1
if a < l:
a = l
if a > r:
a = r
print(b % a) |
print('Please think of a number between 0 and 100!')
x = 54
low = 0
high = 100
guessed = False
while not guessed:
guess = (low + high)/2
print('Is your secret number ' + str(guess)+'?')
s = raw_input("Enter 'h' to indicate the guess is too high.\
Enter 'l' to indicate the guess is too low. Enter \
'c' to indicate I guessed correctly.")
if s == 'c':
guessed = True
elif s == 'l':
low = guess
elif s == 'h':
high = guess
else :
print('Sorry, I did not understand your input.')
print('Game over. Your secret number was: '+str(guess))
| print('Please think of a number between 0 and 100!')
x = 54
low = 0
high = 100
guessed = False
while not guessed:
guess = (low + high) / 2
print('Is your secret number ' + str(guess) + '?')
s = raw_input("Enter 'h' to indicate the guess is too high. Enter 'l' to indicate the guess is too low. Enter 'c' to indicate I guessed correctly.")
if s == 'c':
guessed = True
elif s == 'l':
low = guess
elif s == 'h':
high = guess
else:
print('Sorry, I did not understand your input.')
print('Game over. Your secret number was: ' + str(guess)) |
# abcabc
# g_left = a, g_right = b
#
class Solution(object):
def __convert(self, x):
return ord(x) - ord('a') + 1
def distinctEchoSubstrings(self, text):
if len(text) == 1:
return 0
m = int(1e9 + 9)
p = 31
p_pow = 1
g_left = self.__convert(text[0])
g_right = self.__convert(text[1])
hashes = set()
for ws in range(1, len(text)):
left = g_left
right = g_right
for mid in range(len(text) - ws):
if left == right:
hashes.add(left)
first_left = self.__convert(text[ws + mid - 1]) * p_pow
last_left = self.__convert(text[ws + mid])
left = (p * (left - first_left) + last_left) % m
first_right = self.__convert(text[ws * 2 + mid -1]) * p_pow
last_right = self.__convert(text[ws * 2 + mid])
right = (p * (right - first_right) + last_right) % m
for i in range(ws, ws * 2):
first_right = self.__convert()
g_right = (p * (g_right - self.__convert(text[ws]) * p_pow))
p_pow = p_pow * p
g_left = (p * g_left + self.__convert(text[ws])) % m
if __name__ == '__main__':
s = Solution()
n = s.distinctEchoSubstrings("abab")
print(n)
| class Solution(object):
def __convert(self, x):
return ord(x) - ord('a') + 1
def distinct_echo_substrings(self, text):
if len(text) == 1:
return 0
m = int(1000000000.0 + 9)
p = 31
p_pow = 1
g_left = self.__convert(text[0])
g_right = self.__convert(text[1])
hashes = set()
for ws in range(1, len(text)):
left = g_left
right = g_right
for mid in range(len(text) - ws):
if left == right:
hashes.add(left)
first_left = self.__convert(text[ws + mid - 1]) * p_pow
last_left = self.__convert(text[ws + mid])
left = (p * (left - first_left) + last_left) % m
first_right = self.__convert(text[ws * 2 + mid - 1]) * p_pow
last_right = self.__convert(text[ws * 2 + mid])
right = (p * (right - first_right) + last_right) % m
for i in range(ws, ws * 2):
first_right = self.__convert()
g_right = p * (g_right - self.__convert(text[ws]) * p_pow)
p_pow = p_pow * p
g_left = (p * g_left + self.__convert(text[ws])) % m
if __name__ == '__main__':
s = solution()
n = s.distinctEchoSubstrings('abab')
print(n) |
description = 'nGI backpack setup at ICON.'
display_order = 35
pvprefix = 'SQ:ICON:ngiB:'
includes = ['ngi_g0']
excludes = ['ngi_xingi_gratings']
devices = dict(
g1_rz = device('nicos_ess.devices.epics.motor.EpicsMotor',
epicstimeout = 3.0,
description = 'nGI Interferometer Grating Rotation G1 (Backpack)',
motorpv = pvprefix + 'g1rz',
errormsgpv = pvprefix + 'g1rz-MsgTxt',
precision = 0.01,
),
g1_tz = device('nicos_ess.devices.epics.motor.EpicsMotor',
epicstimeout = 3.0,
description = 'nGI Interferometer Grating Talbot G1 (Backpack)',
motorpv = pvprefix + 'g1tz',
errormsgpv = pvprefix + 'g1tz-MsgTxt',
precision = 0.01,
),
g2_rz = device('nicos_ess.devices.epics.motor.EpicsMotor',
epicstimeout = 3.0,
description = 'nGI Interferometer Grating Rotation G2 (Backpack)',
motorpv = pvprefix + 'g2rz',
errormsgpv = pvprefix + 'g2rz-MsgTxt',
precision = 0.01,
)
)
| description = 'nGI backpack setup at ICON.'
display_order = 35
pvprefix = 'SQ:ICON:ngiB:'
includes = ['ngi_g0']
excludes = ['ngi_xingi_gratings']
devices = dict(g1_rz=device('nicos_ess.devices.epics.motor.EpicsMotor', epicstimeout=3.0, description='nGI Interferometer Grating Rotation G1 (Backpack)', motorpv=pvprefix + 'g1rz', errormsgpv=pvprefix + 'g1rz-MsgTxt', precision=0.01), g1_tz=device('nicos_ess.devices.epics.motor.EpicsMotor', epicstimeout=3.0, description='nGI Interferometer Grating Talbot G1 (Backpack)', motorpv=pvprefix + 'g1tz', errormsgpv=pvprefix + 'g1tz-MsgTxt', precision=0.01), g2_rz=device('nicos_ess.devices.epics.motor.EpicsMotor', epicstimeout=3.0, description='nGI Interferometer Grating Rotation G2 (Backpack)', motorpv=pvprefix + 'g2rz', errormsgpv=pvprefix + 'g2rz-MsgTxt', precision=0.01)) |
# Input: Two strings, Pattern and Genome
# Output: A list containing all starting positions where Pattern appears as a substring of Genome
def PatternMatching(pattern, genome):
positions = [] # output variable
# your code here
for i in range(len(genome)-len(pattern)+1):
if genome[i:i+len(pattern)] == pattern:
positions.append(i)
return positions
# Input: Strings Pattern and Text along with an integer d
# Output: A list containing all starting positions where Pattern appears
# as a substring of Text with at most d mismatches
def ApproximatePatternMatching(pattern, genome, d):
positions = [] # output variable
for i in range(len(genome)-len(pattern)+1):
variants = HammingDistance(pattern,genome[i:i+len(pattern)])
if variants <= d:
positions.append(i)
return positions
'''
Input: Strings Pattern and Text
Output: The number of times Pattern appears in Text
PatternCount("ACTAT", "ACAACTATGCATACTATCGGGAACTATCCT") = 3.
'''
def PatternCount(Pattern, Text):
count = 0
for i in range(len(Text)-len(Pattern)+1):
if Text[i:i+len(Pattern)] == Pattern:
count = count+1
return count
# Input: Strings Pattern and Text, and an integer d
# Output: The number of times Pattern appears in Text with at most d mismatches
def ApproximatePatternCount(Pattern, Text, d):
count = 0
for i in range(len(Text)-len(Pattern)+1):
variants = HammingDistance(Pattern,Text[i:i+len(Pattern)])
if variants <= d:
count = count + 1
return count
'''
Input: Strings Text and integer k
Output: The dictionary of the count of every k-mer string
CountDict("CGATATATCCATAG",3) = {0: 1, 1: 1, 2: 3, 3: 2, 4: 3, 5: 2, 6: 1, 7: 1, 8: 1, 9: 1, 10: 3, 11: 1}.
'''
def CountDict(Text, k):
Count = {}
for i in range(len(Text)-k+1):
Pattern = Text[i:i+k]
Count[i] = PatternCount(Pattern, Text)
return Count
'''
Input: a list of items
Output: the non-duplicate items
Remove_duplicates([1,2,3,3]) = [1,2,3]
'''
def Remove_duplicates(Items):
ItemsNoDuplicates = [] # output variable
ItemsNoDuplicates = list(set(Items))
return ItemsNoDuplicates
'''
Input: Strings Text and integer k
Output: The freqent k-mer
FrequentWords("GATCCAGATCCCCATAC",2) = "CC".
'''
def FrequentWords(Text, k):
FrequentPatterns = []
Count = CountDict(Text, k)
m= max(Count.values())
for i in Count:
if Count[i] == m:
FrequentPatterns.append(Text[i:i+k])
FrequentPatternsNoDuplicates = Remove_duplicates(FrequentPatterns)
return FrequentPatternsNoDuplicates
# Input: Strings Genome and symbol
# Output: SymbolArray(Genome, symbol)
def SymbolArray(Genome, symbol):
array = {}
n = len(Genome)
ExtendedGenome = Genome + Genome[0:n//2]
for i in range(n):
array[i] = PatternCount(symbol, ExtendedGenome[i:i+(n//2)])
return array
# Input: Strings Genome and symbol
# Output: FasterSymbolArray(Genome, symbol)
def FasterSymbolArray(Genome, symbol):
array = {}
n = len(Genome)
ExtendedGenome = Genome + Genome[0:n//2]
array[0] = PatternCount(symbol, Genome[0:n//2])
for i in range(1, n):
array[i] = array[i-1]
if ExtendedGenome[i-1] == symbol:
array[i] = array[i]-1
if ExtendedGenome[i+(n//2)-1] == symbol:
array[i] = array[i]+1
return array
# Input: A String Genome
# Output: Skew(Genome)
def Skew(Genome):
n = len(Genome)
skew = {} #initializing the dictionary
skew[0] = 0
for i in range(1,n+1):
skew[i] = skew[i-1]
if Genome[i-1] == 'G':
skew[i] = skew[i] + 1
if Genome[i-1] == 'C':
skew[i] = skew[i] - 1
return skew
# Input: A DNA string Genome
# Output: A list containing all integers i minimizing Skew(Prefix_i(Text)) over all values of i (from 0 to |Genome|)
def MinimumSkew(Genome):
positions = [] # output variable
# your code here
a_skew = Skew(Genome)
values = list(a_skew.values())
min_value = min(values)
for i in range(len(a_skew)):
if (a_skew[i] == min_value):
positions.append(i)
return positions
# Input: Two strings p and q (same length)
# Output: An integer value representing the Hamming Distance between p and q.
def HammingDistance(p, q):
m = len(p)
n = len(q)
result = 0
if (m != n):
return result
else:
for i in range(n):
if (p[i] != q[i]):
result = result + 1
return result
### DO NOT MODIFY THE CODE BELOW THIS LINE ###
if __name__ == '__main__':
#target ='TGATCA'
gene =str('ATCAATGATCAACGTAAGCTTCTAAGCATGATCAAGGTGCTCACACAGTTTATCCACAACCTGAGTGGATGACATCAAGATAGGTCGTTGTATCTCCTTCCTCTCGTACTCTCATGACCACGGAAAGATGATCAAGAGAGGATGATTTCTTGGCCATATCGCAATGAATACTTGTGACTTGTGCTTCCAATTGACATCTTCAGCGCCATATTGCGCTGGCCAAGGTGACGGAGCGGGATTACGAAAGCATGATCATGGCTGTTGTTCTGTTTATCTTGTTTTGACTGAGACTTGTTAGGATAGACGGTTTTTCATCACTGACTAGCCAAAGCCTTACTCTGCCTGACATCGACCGTAAATTGATAATGAATTTACATGCTTCCGCGACGATTTACCTCTTGATCATCGATCCGATTGAAGATCTTCAATTGTTAATTCTCTTGCCTCGACTCATAGCCATGATGAGCTCTTGATCATGTTTCCTTAACCCTCTATTTTTTACGGAAGAATGATCAAGCTGCTGCTCTTGATCATCGTTTC')
#print(PatternCount(target, gene))
#print (CountDict(gene,10))
print (FrequentWords(gene,10))
#print(PatternCount("TGT", "ACTGTACGATGATGTGTGTCAAAG"))
#print(PatternMatching('ATAT','GATATATGCATATACTT'))
# print(SymbolArray('AAAAGGGG','A'))
# print(FasterSymbolArray('AAAAGGGG','A'))
# print(Skew('CATGGGCATCGGCCATACGCC'))
# print(MinimumSkew('CATTCCAGTACTTCGATGATGGCGTGAAGA'))
# print(MinimumSkew('TAAAGACTGCCGAGAGGCCAACACGAGTGCTAGAACGAGGGGCGTAAACGCGGGTCCGAT'))
# print(HammingDistance('GGGCCGTTGGT','GGACCGTTGAC'))
# print(ApproximatePatternMatching('ATTCTGGA','CGCCCGAATCCAGAACGCATTCCCATATTTCGGGACCACTGGCCTCCACGGTACGGACGTCAATCAAAT',3))
# print(ApproximatePatternCount('GAGG','TTTAGAGCCTTCAGAGG',2))
# print(HammingDistance('CTTGAAGTGGACCTCTAGTTCCTCTACAAAGAACAGGTTGACCTGTCGCGAAG','ATGCCTTACCTAGATGCAATGACGGACGTATTCCTTTTGCCTCAACGGCTCCT')) | def pattern_matching(pattern, genome):
positions = []
for i in range(len(genome) - len(pattern) + 1):
if genome[i:i + len(pattern)] == pattern:
positions.append(i)
return positions
def approximate_pattern_matching(pattern, genome, d):
positions = []
for i in range(len(genome) - len(pattern) + 1):
variants = hamming_distance(pattern, genome[i:i + len(pattern)])
if variants <= d:
positions.append(i)
return positions
'\nInput: Strings Pattern and Text\nOutput: The number of times Pattern appears in Text\nPatternCount("ACTAT", "ACAACTATGCATACTATCGGGAACTATCCT") = 3.\n'
def pattern_count(Pattern, Text):
count = 0
for i in range(len(Text) - len(Pattern) + 1):
if Text[i:i + len(Pattern)] == Pattern:
count = count + 1
return count
def approximate_pattern_count(Pattern, Text, d):
count = 0
for i in range(len(Text) - len(Pattern) + 1):
variants = hamming_distance(Pattern, Text[i:i + len(Pattern)])
if variants <= d:
count = count + 1
return count
'\nInput: Strings Text and integer k\nOutput: The dictionary of the count of every k-mer string \nCountDict("CGATATATCCATAG",3) = {0: 1, 1: 1, 2: 3, 3: 2, 4: 3, 5: 2, 6: 1, 7: 1, 8: 1, 9: 1, 10: 3, 11: 1}.\n'
def count_dict(Text, k):
count = {}
for i in range(len(Text) - k + 1):
pattern = Text[i:i + k]
Count[i] = pattern_count(Pattern, Text)
return Count
'\nInput: a list of items\nOutput: the non-duplicate items \nRemove_duplicates([1,2,3,3]) = [1,2,3]\n'
def remove_duplicates(Items):
items_no_duplicates = []
items_no_duplicates = list(set(Items))
return ItemsNoDuplicates
'\nInput: Strings Text and integer k\nOutput: The freqent k-mer \nFrequentWords("GATCCAGATCCCCATAC",2) = "CC".\n'
def frequent_words(Text, k):
frequent_patterns = []
count = count_dict(Text, k)
m = max(Count.values())
for i in Count:
if Count[i] == m:
FrequentPatterns.append(Text[i:i + k])
frequent_patterns_no_duplicates = remove_duplicates(FrequentPatterns)
return FrequentPatternsNoDuplicates
def symbol_array(Genome, symbol):
array = {}
n = len(Genome)
extended_genome = Genome + Genome[0:n // 2]
for i in range(n):
array[i] = pattern_count(symbol, ExtendedGenome[i:i + n // 2])
return array
def faster_symbol_array(Genome, symbol):
array = {}
n = len(Genome)
extended_genome = Genome + Genome[0:n // 2]
array[0] = pattern_count(symbol, Genome[0:n // 2])
for i in range(1, n):
array[i] = array[i - 1]
if ExtendedGenome[i - 1] == symbol:
array[i] = array[i] - 1
if ExtendedGenome[i + n // 2 - 1] == symbol:
array[i] = array[i] + 1
return array
def skew(Genome):
n = len(Genome)
skew = {}
skew[0] = 0
for i in range(1, n + 1):
skew[i] = skew[i - 1]
if Genome[i - 1] == 'G':
skew[i] = skew[i] + 1
if Genome[i - 1] == 'C':
skew[i] = skew[i] - 1
return skew
def minimum_skew(Genome):
positions = []
a_skew = skew(Genome)
values = list(a_skew.values())
min_value = min(values)
for i in range(len(a_skew)):
if a_skew[i] == min_value:
positions.append(i)
return positions
def hamming_distance(p, q):
m = len(p)
n = len(q)
result = 0
if m != n:
return result
else:
for i in range(n):
if p[i] != q[i]:
result = result + 1
return result
if __name__ == '__main__':
gene = str('ATCAATGATCAACGTAAGCTTCTAAGCATGATCAAGGTGCTCACACAGTTTATCCACAACCTGAGTGGATGACATCAAGATAGGTCGTTGTATCTCCTTCCTCTCGTACTCTCATGACCACGGAAAGATGATCAAGAGAGGATGATTTCTTGGCCATATCGCAATGAATACTTGTGACTTGTGCTTCCAATTGACATCTTCAGCGCCATATTGCGCTGGCCAAGGTGACGGAGCGGGATTACGAAAGCATGATCATGGCTGTTGTTCTGTTTATCTTGTTTTGACTGAGACTTGTTAGGATAGACGGTTTTTCATCACTGACTAGCCAAAGCCTTACTCTGCCTGACATCGACCGTAAATTGATAATGAATTTACATGCTTCCGCGACGATTTACCTCTTGATCATCGATCCGATTGAAGATCTTCAATTGTTAATTCTCTTGCCTCGACTCATAGCCATGATGAGCTCTTGATCATGTTTCCTTAACCCTCTATTTTTTACGGAAGAATGATCAAGCTGCTGCTCTTGATCATCGTTTC')
print(frequent_words(gene, 10)) |
def encodenum(num):
num = str(num)
line =""
for c in num:
line += chr(int(c) + ord('a'))
return line
def decodenum(line):
num = ""
for c in line:
num += str(ord(c)-ord('a'))
return num | def encodenum(num):
num = str(num)
line = ''
for c in num:
line += chr(int(c) + ord('a'))
return line
def decodenum(line):
num = ''
for c in line:
num += str(ord(c) - ord('a'))
return num |
class exemplo():
def __init__(self):
pass
def thg_print(darkcode):
print(darkcode)
| class Exemplo:
def __init__(self):
pass
def thg_print(darkcode):
print(darkcode) |
class Foo():
_myprop = 3
@property
def myprop(self):
return self.__class__._myprop
@myprop.setter
def myprop(self, val):
self.__class__._myprop = val
f = Foo()
g = Foo()
print(f.myprop, g.myprop)
f.myprop = 4
print(f.myprop, g.myprop)
| class Foo:
_myprop = 3
@property
def myprop(self):
return self.__class__._myprop
@myprop.setter
def myprop(self, val):
self.__class__._myprop = val
f = foo()
g = foo()
print(f.myprop, g.myprop)
f.myprop = 4
print(f.myprop, g.myprop) |
#author: Lynijah
# date: 07-01-2021
def blank():
return print(" ")
# --------------- Section 1 --------------- #
# ---------- Integers and Floats ---------- #
# you may use floats or integers for these operations, it is at your discretion
# addition
# instructions
# 1 - create a print statement that prints the sum of two numbers
# 2 - create a print statement that prints the sum of three numbers
# 3 - create a print statement the prints the sum of two negative numbers
print("Addition Section")
print(2006+2000)
print(2000+9000+4)
print(-4 + -7)
blank()
# subtraction
# instructions
# 1 - create a print statement that prints the difference of two numbers
# 2 - create a print statement that prints the difference of three numbers
# 3 - create a print statement the prints the difference of two negative numbers
print("Subtraction Section")
print(2006-2000)
print(2000-10-90)
print(-4 - -7)
blank()
# multiplication and true division
# instructions
# 1 - create a print statement the prints the product of two numbers
# 2 - create a print statement that prints the dividend of two numbers
# 3 - create a print statement that evaluates an operation using both multiplication and division
print("Multiplication And True Division Section")
print(6*2000)
print(2000/9)
print(5*8/2)
blank()
# floor division
# instructions
# 1 - using floor division, print the dividend of two numbers.
print("Floor Division Section")
print(200//9)
blank()
# exponentiation
# instructions
# 1 - using exponentiation, print the power of two numbers
print("Exponent Section")
print(50**11)
blank()
# modulus
# instructions
# 1 - using modulus, print the remainder of two numbers
print("Modulus Section")
print(1083108323%22)
# --------------- Section 2 --------------- #
# ---------- String Concatenation --------- #
# concatenation
# instructions
# 1 - print the concatenation of your first and last name
print(" ")
print("Name")
x = "Lynijah "
y = "Russell"
z = x + y
print(z)
print(" ")
# 2 - print the concatenation of five animals you like
a = "Cats "
b = "Dogs "
c = "Bunnies "
d = "Merecats "
e = "Ducks"
f = a+b+c+d+e
print(f)
# 3 - print the concatenation of each word in a phrase
print(" ")
print("My name is", x , y, "and my favorite animals are", a,",",c,",",d,",",e)
# duplication
# instructions
# 1 - print the duplpication of your first 5 times
print(" ")
print("Duplication")
print("Lynijah"*5)
# 2 - print the duplication of a song you like 10 times
print("I'm not pretty"*10)
print(" ")
# concatenation and duplpication
# instructions
print("Concatenation")
# 1 - print the concatenation of two strings duplicated 3 times each
print("hey gurllll "*3 + "MWUHAHAHAHAHHAHAHAH "*3)
| def blank():
return print(' ')
print('Addition Section')
print(2006 + 2000)
print(2000 + 9000 + 4)
print(-4 + -7)
blank()
print('Subtraction Section')
print(2006 - 2000)
print(2000 - 10 - 90)
print(-4 - -7)
blank()
print('Multiplication And True Division Section')
print(6 * 2000)
print(2000 / 9)
print(5 * 8 / 2)
blank()
print('Floor Division Section')
print(200 // 9)
blank()
print('Exponent Section')
print(50 ** 11)
blank()
print('Modulus Section')
print(1083108323 % 22)
print(' ')
print('Name')
x = 'Lynijah '
y = 'Russell'
z = x + y
print(z)
print(' ')
a = 'Cats '
b = 'Dogs '
c = 'Bunnies '
d = 'Merecats '
e = 'Ducks'
f = a + b + c + d + e
print(f)
print(' ')
print('My name is', x, y, 'and my favorite animals are', a, ',', c, ',', d, ',', e)
print(' ')
print('Duplication')
print('Lynijah' * 5)
print("I'm not pretty" * 10)
print(' ')
print('Concatenation')
print('hey gurllll ' * 3 + 'MWUHAHAHAHAHHAHAHAH ' * 3) |
#
# PySNMP MIB module CISCO-ENTITY-REDUNDANCY-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/CISCO-ENTITY-REDUNDANCY-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 17:39:51 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
Integer, ObjectIdentifier, OctetString = mibBuilder.importSymbols("ASN1", "Integer", "ObjectIdentifier", "OctetString")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueRangeConstraint, ConstraintsUnion, ConstraintsIntersection, ValueSizeConstraint, SingleValueConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueRangeConstraint", "ConstraintsUnion", "ConstraintsIntersection", "ValueSizeConstraint", "SingleValueConstraint")
CeRedunSwitchCommand, CeRedunReasonCategories, CeRedunType, CeRedunStateCategories, CeRedunScope, CeRedunMode, CeRedunMbrStatus, CeRedunArch = mibBuilder.importSymbols("CISCO-ENTITY-REDUNDANCY-TC-MIB", "CeRedunSwitchCommand", "CeRedunReasonCategories", "CeRedunType", "CeRedunStateCategories", "CeRedunScope", "CeRedunMode", "CeRedunMbrStatus", "CeRedunArch")
ciscoMgmt, = mibBuilder.importSymbols("CISCO-SMI", "ciscoMgmt")
PhysicalIndex, = mibBuilder.importSymbols("ENTITY-MIB", "PhysicalIndex")
InetAddress, InetAddressType = mibBuilder.importSymbols("INET-ADDRESS-MIB", "InetAddress", "InetAddressType")
SnmpAdminString, = mibBuilder.importSymbols("SNMP-FRAMEWORK-MIB", "SnmpAdminString")
ObjectGroup, NotificationGroup, ModuleCompliance = mibBuilder.importSymbols("SNMPv2-CONF", "ObjectGroup", "NotificationGroup", "ModuleCompliance")
Counter64, ModuleIdentity, TimeTicks, MibIdentifier, MibScalar, MibTable, MibTableRow, MibTableColumn, Counter32, Bits, iso, Gauge32, Unsigned32, NotificationType, ObjectIdentity, IpAddress, Integer32 = mibBuilder.importSymbols("SNMPv2-SMI", "Counter64", "ModuleIdentity", "TimeTicks", "MibIdentifier", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Counter32", "Bits", "iso", "Gauge32", "Unsigned32", "NotificationType", "ObjectIdentity", "IpAddress", "Integer32")
TimeStamp, DisplayString, TextualConvention, RowStatus, TruthValue, StorageType, AutonomousType = mibBuilder.importSymbols("SNMPv2-TC", "TimeStamp", "DisplayString", "TextualConvention", "RowStatus", "TruthValue", "StorageType", "AutonomousType")
ciscoEntityRedunMIB = ModuleIdentity((1, 3, 6, 1, 4, 1, 9, 9, 498))
ciscoEntityRedunMIB.setRevisions(('2005-10-01 00:00',))
if mibBuilder.loadTexts: ciscoEntityRedunMIB.setLastUpdated('200510010000Z')
if mibBuilder.loadTexts: ciscoEntityRedunMIB.setOrganization('Cisco Systems, Inc.')
ciscoEntityRedunMIBNotifs = MibIdentifier((1, 3, 6, 1, 4, 1, 9, 9, 498, 0))
ciscoEntityRedunMIBObjects = MibIdentifier((1, 3, 6, 1, 4, 1, 9, 9, 498, 1))
ciscoEntityRedunMIBConform = MibIdentifier((1, 3, 6, 1, 4, 1, 9, 9, 498, 2))
ceRedunGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1))
ceRedunGroupTypesTable = MibTable((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1), )
if mibBuilder.loadTexts: ceRedunGroupTypesTable.setStatus('current')
ceRedunGroupTypesEntry = MibTableRow((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1), ).setIndexNames((0, "CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupTypeIndex"))
if mibBuilder.loadTexts: ceRedunGroupTypesEntry.setStatus('current')
ceRedunGroupTypeIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1, 1), Unsigned32())
if mibBuilder.loadTexts: ceRedunGroupTypeIndex.setStatus('current')
ceRedunGroupTypeName = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1, 2), SnmpAdminString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunGroupTypeName.setStatus('current')
ceRedunGroupCounts = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1, 3), Gauge32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunGroupCounts.setStatus('current')
ceRedunNextUnusedGroupIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1, 4), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunNextUnusedGroupIndex.setStatus('current')
ceRedunMaxMbrsInGroup = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1, 5), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunMaxMbrsInGroup.setStatus('current')
ceRedunUsesGroupName = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1, 6), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunUsesGroupName.setStatus('current')
ceRedunGroupDefinitionChanged = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1, 7), TimeStamp()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunGroupDefinitionChanged.setStatus('current')
ceRedunVendorTypesTable = MibTable((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 2), )
if mibBuilder.loadTexts: ceRedunVendorTypesTable.setStatus('current')
ceRedunVendorTypesEntry = MibTableRow((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 2, 1), ).setIndexNames((0, "CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupTypeIndex"), (0, "CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunVendorType"))
if mibBuilder.loadTexts: ceRedunVendorTypesEntry.setStatus('current')
ceRedunVendorType = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 2, 1, 1), AutonomousType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunVendorType.setStatus('current')
ceRedunInternalStatesTable = MibTable((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 3), )
if mibBuilder.loadTexts: ceRedunInternalStatesTable.setStatus('current')
ceRedunInternalStatesEntry = MibTableRow((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 3, 1), ).setIndexNames((0, "CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupTypeIndex"), (0, "CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunInternalStateIndex"))
if mibBuilder.loadTexts: ceRedunInternalStatesEntry.setStatus('current')
ceRedunInternalStateIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 3, 1, 1), Unsigned32())
if mibBuilder.loadTexts: ceRedunInternalStateIndex.setStatus('current')
ceRedunStateCategory = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 3, 1, 2), CeRedunStateCategories()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunStateCategory.setStatus('current')
ceRedunInternalStateDescr = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 3, 1, 3), SnmpAdminString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunInternalStateDescr.setStatus('current')
ceRedunSwitchoverReasonTable = MibTable((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 4), )
if mibBuilder.loadTexts: ceRedunSwitchoverReasonTable.setStatus('current')
ceRedunSwitchoverReasonEntry = MibTableRow((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 4, 1), ).setIndexNames((0, "CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupTypeIndex"), (0, "CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunSwitchoverReasonIndex"))
if mibBuilder.loadTexts: ceRedunSwitchoverReasonEntry.setStatus('current')
ceRedunSwitchoverReasonIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 4, 1, 1), Unsigned32())
if mibBuilder.loadTexts: ceRedunSwitchoverReasonIndex.setStatus('current')
ceRedunReasonCategory = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 4, 1, 2), CeRedunReasonCategories()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunReasonCategory.setStatus('current')
ceRedunSwitchoverReasonDescr = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 4, 1, 3), SnmpAdminString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunSwitchoverReasonDescr.setStatus('current')
ceRedunGroupLastChanged = MibScalar((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 5), TimeStamp()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunGroupLastChanged.setStatus('current')
ceRedunGroupTable = MibTable((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6), )
if mibBuilder.loadTexts: ceRedunGroupTable.setStatus('current')
ceRedunGroupEntry = MibTableRow((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1), ).setIndexNames((0, "CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupTypeIndex"), (0, "CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupIndex"))
if mibBuilder.loadTexts: ceRedunGroupEntry.setStatus('current')
ceRedunGroupIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 1), Unsigned32())
if mibBuilder.loadTexts: ceRedunGroupIndex.setStatus('current')
ceRedunGroupString = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 2), SnmpAdminString()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunGroupString.setStatus('current')
ceRedunGroupRedunType = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 3), CeRedunType()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunGroupRedunType.setStatus('current')
ceRedunGroupScope = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 4), CeRedunScope().clone('local')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunGroupScope.setStatus('current')
ceRedunGroupArch = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 5), CeRedunArch().clone('onePlusOne')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunGroupArch.setStatus('current')
ceRedunGroupRevert = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 6), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("nonrevertive", 1), ("revertive", 2)))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunGroupRevert.setStatus('current')
ceRedunGroupWaitToRestore = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 7), Unsigned32().clone(300)).setUnits('seconds').setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunGroupWaitToRestore.setStatus('current')
ceRedunGroupDirection = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 8), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("unidirectional", 1), ("bidirectional", 2)))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunGroupDirection.setStatus('current')
ceRedunGroupStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 9), StorageType().clone('volatile')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunGroupStorageType.setStatus('current')
ceRedunGroupRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 10), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunGroupRowStatus.setStatus('current')
ceRedunMembers = MibIdentifier((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2))
ceRedunMbrLastChanged = MibScalar((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 1), TimeStamp()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunMbrLastChanged.setStatus('current')
ceRedunMbrConfigTable = MibTable((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2), )
if mibBuilder.loadTexts: ceRedunMbrConfigTable.setStatus('current')
ceRedunMbrConfigEntry = MibTableRow((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1), ).setIndexNames((0, "CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupTypeIndex"), (0, "CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupIndex"), (0, "CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrNumber"))
if mibBuilder.loadTexts: ceRedunMbrConfigEntry.setStatus('current')
ceRedunMbrNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 1), Unsigned32())
if mibBuilder.loadTexts: ceRedunMbrNumber.setStatus('current')
ceRedunMbrPhysIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 2), PhysicalIndex()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunMbrPhysIndex.setStatus('current')
ceRedunMbrMode = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 3), CeRedunMode()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunMbrMode.setStatus('current')
ceRedunMbrAddressType = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 4), InetAddressType()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunMbrAddressType.setStatus('current')
ceRedunMbrRemoteAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 5), InetAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunMbrRemoteAddress.setStatus('current')
ceRedunMbrPriority = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 6), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("low", 1), ("high", 2))).clone('low')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunMbrPriority.setStatus('current')
ceRedunMbrStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 8), StorageType().clone('volatile')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunMbrStorageType.setStatus('current')
ceRedunMbrRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 9), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: ceRedunMbrRowStatus.setStatus('current')
ceRedunMbrStatusLastChanged = MibScalar((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 3), TimeStamp()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunMbrStatusLastChanged.setStatus('current')
ceRedunMbrStatusTable = MibTable((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4), )
if mibBuilder.loadTexts: ceRedunMbrStatusTable.setStatus('current')
ceRedunMbrStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1), )
ceRedunMbrConfigEntry.registerAugmentions(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrStatusEntry"))
ceRedunMbrStatusEntry.setIndexNames(*ceRedunMbrConfigEntry.getIndexNames())
if mibBuilder.loadTexts: ceRedunMbrStatusEntry.setStatus('current')
ceRedunMbrStatusCurrent = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1, 1), CeRedunMbrStatus()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunMbrStatusCurrent.setStatus('current')
ceRedunMbrProtectingMbr = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1, 2), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunMbrProtectingMbr.setStatus('current')
ceRedunMbrInternalState = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunMbrInternalState.setStatus('current')
ceRedunMbrSwitchoverCounts = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1, 4), Gauge32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunMbrSwitchoverCounts.setStatus('current')
ceRedunMbrLastSwitchover = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1, 5), TimeStamp()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunMbrLastSwitchover.setStatus('current')
ceRedunMbrSwitchoverReason = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1, 6), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunMbrSwitchoverReason.setStatus('current')
ceRedunMbrSwitchoverSeconds = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1, 8), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: ceRedunMbrSwitchoverSeconds.setStatus('current')
ceRedunCommandTable = MibTable((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 3), )
if mibBuilder.loadTexts: ceRedunCommandTable.setStatus('current')
ceRedunCommandEntry = MibTableRow((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 3, 1), ).setIndexNames((0, "CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupTypeIndex"), (0, "CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupIndex"))
if mibBuilder.loadTexts: ceRedunCommandEntry.setStatus('current')
ceRedunCommandMbrNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 3, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(-1, 2147483647))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: ceRedunCommandMbrNumber.setStatus('current')
ceRedunCommandSwitch = MibTableColumn((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 3, 1, 2), CeRedunSwitchCommand()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: ceRedunCommandSwitch.setStatus('current')
ceRedunEnableSwitchoverNotifs = MibScalar((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 4), TruthValue().clone('false')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: ceRedunEnableSwitchoverNotifs.setStatus('current')
ceRedunEnableStatusChangeNotifs = MibScalar((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 5), TruthValue().clone('false')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: ceRedunEnableStatusChangeNotifs.setStatus('current')
ceRedunEventSwitchover = NotificationType((1, 3, 6, 1, 4, 1, 9, 9, 498, 0, 1)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrProtectingMbr"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrStatusCurrent"))
if mibBuilder.loadTexts: ceRedunEventSwitchover.setStatus('current')
ceRedunProtectStatusChange = NotificationType((1, 3, 6, 1, 4, 1, 9, 9, 498, 0, 2)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrStatusCurrent"))
if mibBuilder.loadTexts: ceRedunProtectStatusChange.setStatus('current')
ceRedunCompliances = MibIdentifier((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 1))
ceRedunGroups = MibIdentifier((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2))
ceRedunCompliance = ModuleCompliance((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 1, 1)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupTypeGroup"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupObjects"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMemberConfig"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMemberStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunCompliance = ceRedunCompliance.setStatus('current')
ceRedunGroupTypeGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 1)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunNextUnusedGroupIndex"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMaxMbrsInGroup"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunUsesGroupName"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupDefinitionChanged"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunGroupTypeGroup = ceRedunGroupTypeGroup.setStatus('current')
ceRedunOptionalGroupTypes = ObjectGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 2)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupTypeName"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupCounts"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunOptionalGroupTypes = ceRedunOptionalGroupTypes.setStatus('current')
ceRedunInternalStates = ObjectGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 3)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunStateCategory"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunInternalStateDescr"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunInternalStates = ceRedunInternalStates.setStatus('current')
ceRedunSwitchoverReason = ObjectGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 4)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunReasonCategory"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunSwitchoverReasonDescr"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunSwitchoverReason = ceRedunSwitchoverReason.setStatus('current')
ceRedunGroupObjects = ObjectGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 5)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupLastChanged"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupString"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupRedunType"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupScope"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupArch"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupStorageType"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupRowStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunGroupObjects = ceRedunGroupObjects.setStatus('current')
ceRedunRevertiveGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 6)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupRevert"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupWaitToRestore"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunRevertiveGroup = ceRedunRevertiveGroup.setStatus('current')
ceRedunBidirectional = ObjectGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 7)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunGroupDirection"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunBidirectional = ceRedunBidirectional.setStatus('current')
ceRedunMemberConfig = ObjectGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 8)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrLastChanged"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrPhysIndex"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrMode"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrStorageType"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrRowStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunMemberConfig = ceRedunMemberConfig.setStatus('current')
ceRedunRemoteSystem = ObjectGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 9)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrAddressType"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrRemoteAddress"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunRemoteSystem = ceRedunRemoteSystem.setStatus('current')
ceRedunOneToN = ObjectGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 10)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrPriority"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunOneToN = ceRedunOneToN.setStatus('current')
ceRedunMemberStatus = ObjectGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 11)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrStatusLastChanged"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrStatusCurrent"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrProtectingMbr"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrSwitchoverCounts"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrLastSwitchover"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunMemberStatus = ceRedunMemberStatus.setStatus('current')
ceRedunOptionalMbrStatus = ObjectGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 12)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrInternalState"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrSwitchoverReason"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunMbrSwitchoverSeconds"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunOptionalMbrStatus = ceRedunOptionalMbrStatus.setStatus('current')
ceRedunCommandsGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 13)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunCommandMbrNumber"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunCommandSwitch"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunCommandsGroup = ceRedunCommandsGroup.setStatus('current')
ceRedunNotifEnables = ObjectGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 14)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunEnableSwitchoverNotifs"), ("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunEnableStatusChangeNotifs"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunNotifEnables = ceRedunNotifEnables.setStatus('current')
ceRedunSwitchNotifGroup = NotificationGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 15)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunEventSwitchover"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunSwitchNotifGroup = ceRedunSwitchNotifGroup.setStatus('current')
ceRedunProtectStatusNotifGroup = NotificationGroup((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 16)).setObjects(("CISCO-ENTITY-REDUNDANCY-MIB", "ceRedunProtectStatusChange"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ceRedunProtectStatusNotifGroup = ceRedunProtectStatusNotifGroup.setStatus('current')
mibBuilder.exportSymbols("CISCO-ENTITY-REDUNDANCY-MIB", ceRedunCompliance=ceRedunCompliance, ceRedunSwitchoverReasonDescr=ceRedunSwitchoverReasonDescr, ceRedunMbrInternalState=ceRedunMbrInternalState, ceRedunUsesGroupName=ceRedunUsesGroupName, ceRedunSwitchoverReason=ceRedunSwitchoverReason, ceRedunEnableSwitchoverNotifs=ceRedunEnableSwitchoverNotifs, ceRedunGroups=ceRedunGroups, ceRedunGroup=ceRedunGroup, ciscoEntityRedunMIB=ciscoEntityRedunMIB, ceRedunStateCategory=ceRedunStateCategory, ceRedunGroupScope=ceRedunGroupScope, ceRedunGroupTypesTable=ceRedunGroupTypesTable, ceRedunMbrRowStatus=ceRedunMbrRowStatus, ceRedunCommandTable=ceRedunCommandTable, ceRedunCommandMbrNumber=ceRedunCommandMbrNumber, PYSNMP_MODULE_ID=ciscoEntityRedunMIB, ciscoEntityRedunMIBObjects=ciscoEntityRedunMIBObjects, ceRedunRevertiveGroup=ceRedunRevertiveGroup, ceRedunInternalStateDescr=ceRedunInternalStateDescr, ceRedunMbrSwitchoverReason=ceRedunMbrSwitchoverReason, ceRedunNextUnusedGroupIndex=ceRedunNextUnusedGroupIndex, ceRedunMbrLastChanged=ceRedunMbrLastChanged, ceRedunGroupStorageType=ceRedunGroupStorageType, ceRedunMaxMbrsInGroup=ceRedunMaxMbrsInGroup, ceRedunSwitchoverReasonEntry=ceRedunSwitchoverReasonEntry, ceRedunSwitchoverReasonIndex=ceRedunSwitchoverReasonIndex, ceRedunGroupObjects=ceRedunGroupObjects, ceRedunOneToN=ceRedunOneToN, ceRedunCommandSwitch=ceRedunCommandSwitch, ceRedunSwitchoverReasonTable=ceRedunSwitchoverReasonTable, ceRedunGroupCounts=ceRedunGroupCounts, ceRedunEnableStatusChangeNotifs=ceRedunEnableStatusChangeNotifs, ceRedunProtectStatusChange=ceRedunProtectStatusChange, ceRedunVendorTypesTable=ceRedunVendorTypesTable, ceRedunMbrStatusCurrent=ceRedunMbrStatusCurrent, ceRedunGroupArch=ceRedunGroupArch, ceRedunEventSwitchover=ceRedunEventSwitchover, ceRedunNotifEnables=ceRedunNotifEnables, ceRedunGroupDirection=ceRedunGroupDirection, ceRedunVendorTypesEntry=ceRedunVendorTypesEntry, ceRedunGroupRedunType=ceRedunGroupRedunType, ceRedunInternalStates=ceRedunInternalStates, ceRedunGroupEntry=ceRedunGroupEntry, ceRedunGroupTable=ceRedunGroupTable, ceRedunMbrAddressType=ceRedunMbrAddressType, ceRedunReasonCategory=ceRedunReasonCategory, ceRedunGroupWaitToRestore=ceRedunGroupWaitToRestore, ceRedunMbrConfigTable=ceRedunMbrConfigTable, ceRedunOptionalMbrStatus=ceRedunOptionalMbrStatus, ceRedunInternalStateIndex=ceRedunInternalStateIndex, ceRedunGroupTypeIndex=ceRedunGroupTypeIndex, ceRedunGroupRevert=ceRedunGroupRevert, ceRedunMbrConfigEntry=ceRedunMbrConfigEntry, ceRedunCompliances=ceRedunCompliances, ceRedunMemberStatus=ceRedunMemberStatus, ciscoEntityRedunMIBConform=ciscoEntityRedunMIBConform, ceRedunMbrStorageType=ceRedunMbrStorageType, ceRedunMbrPriority=ceRedunMbrPriority, ceRedunInternalStatesTable=ceRedunInternalStatesTable, ceRedunMbrMode=ceRedunMbrMode, ceRedunMbrSwitchoverSeconds=ceRedunMbrSwitchoverSeconds, ceRedunCommandsGroup=ceRedunCommandsGroup, ceRedunOptionalGroupTypes=ceRedunOptionalGroupTypes, ceRedunMbrProtectingMbr=ceRedunMbrProtectingMbr, ceRedunGroupTypeName=ceRedunGroupTypeName, ceRedunRemoteSystem=ceRedunRemoteSystem, ceRedunInternalStatesEntry=ceRedunInternalStatesEntry, ceRedunGroupIndex=ceRedunGroupIndex, ceRedunGroupTypesEntry=ceRedunGroupTypesEntry, ceRedunBidirectional=ceRedunBidirectional, ceRedunMbrLastSwitchover=ceRedunMbrLastSwitchover, ceRedunMbrSwitchoverCounts=ceRedunMbrSwitchoverCounts, ceRedunMbrRemoteAddress=ceRedunMbrRemoteAddress, ceRedunProtectStatusNotifGroup=ceRedunProtectStatusNotifGroup, ceRedunMbrPhysIndex=ceRedunMbrPhysIndex, ceRedunVendorType=ceRedunVendorType, ceRedunGroupRowStatus=ceRedunGroupRowStatus, ceRedunGroupTypeGroup=ceRedunGroupTypeGroup, ceRedunMbrStatusLastChanged=ceRedunMbrStatusLastChanged, ceRedunSwitchNotifGroup=ceRedunSwitchNotifGroup, ceRedunGroupString=ceRedunGroupString, ciscoEntityRedunMIBNotifs=ciscoEntityRedunMIBNotifs, ceRedunMbrStatusTable=ceRedunMbrStatusTable, ceRedunMbrStatusEntry=ceRedunMbrStatusEntry, ceRedunMembers=ceRedunMembers, ceRedunMbrNumber=ceRedunMbrNumber, ceRedunGroupLastChanged=ceRedunGroupLastChanged, ceRedunGroupDefinitionChanged=ceRedunGroupDefinitionChanged, ceRedunCommandEntry=ceRedunCommandEntry, ceRedunMemberConfig=ceRedunMemberConfig)
| (integer, object_identifier, octet_string) = mibBuilder.importSymbols('ASN1', 'Integer', 'ObjectIdentifier', 'OctetString')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(value_range_constraint, constraints_union, constraints_intersection, value_size_constraint, single_value_constraint) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ValueRangeConstraint', 'ConstraintsUnion', 'ConstraintsIntersection', 'ValueSizeConstraint', 'SingleValueConstraint')
(ce_redun_switch_command, ce_redun_reason_categories, ce_redun_type, ce_redun_state_categories, ce_redun_scope, ce_redun_mode, ce_redun_mbr_status, ce_redun_arch) = mibBuilder.importSymbols('CISCO-ENTITY-REDUNDANCY-TC-MIB', 'CeRedunSwitchCommand', 'CeRedunReasonCategories', 'CeRedunType', 'CeRedunStateCategories', 'CeRedunScope', 'CeRedunMode', 'CeRedunMbrStatus', 'CeRedunArch')
(cisco_mgmt,) = mibBuilder.importSymbols('CISCO-SMI', 'ciscoMgmt')
(physical_index,) = mibBuilder.importSymbols('ENTITY-MIB', 'PhysicalIndex')
(inet_address, inet_address_type) = mibBuilder.importSymbols('INET-ADDRESS-MIB', 'InetAddress', 'InetAddressType')
(snmp_admin_string,) = mibBuilder.importSymbols('SNMP-FRAMEWORK-MIB', 'SnmpAdminString')
(object_group, notification_group, module_compliance) = mibBuilder.importSymbols('SNMPv2-CONF', 'ObjectGroup', 'NotificationGroup', 'ModuleCompliance')
(counter64, module_identity, time_ticks, mib_identifier, mib_scalar, mib_table, mib_table_row, mib_table_column, counter32, bits, iso, gauge32, unsigned32, notification_type, object_identity, ip_address, integer32) = mibBuilder.importSymbols('SNMPv2-SMI', 'Counter64', 'ModuleIdentity', 'TimeTicks', 'MibIdentifier', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'Counter32', 'Bits', 'iso', 'Gauge32', 'Unsigned32', 'NotificationType', 'ObjectIdentity', 'IpAddress', 'Integer32')
(time_stamp, display_string, textual_convention, row_status, truth_value, storage_type, autonomous_type) = mibBuilder.importSymbols('SNMPv2-TC', 'TimeStamp', 'DisplayString', 'TextualConvention', 'RowStatus', 'TruthValue', 'StorageType', 'AutonomousType')
cisco_entity_redun_mib = module_identity((1, 3, 6, 1, 4, 1, 9, 9, 498))
ciscoEntityRedunMIB.setRevisions(('2005-10-01 00:00',))
if mibBuilder.loadTexts:
ciscoEntityRedunMIB.setLastUpdated('200510010000Z')
if mibBuilder.loadTexts:
ciscoEntityRedunMIB.setOrganization('Cisco Systems, Inc.')
cisco_entity_redun_mib_notifs = mib_identifier((1, 3, 6, 1, 4, 1, 9, 9, 498, 0))
cisco_entity_redun_mib_objects = mib_identifier((1, 3, 6, 1, 4, 1, 9, 9, 498, 1))
cisco_entity_redun_mib_conform = mib_identifier((1, 3, 6, 1, 4, 1, 9, 9, 498, 2))
ce_redun_group = mib_identifier((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1))
ce_redun_group_types_table = mib_table((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1))
if mibBuilder.loadTexts:
ceRedunGroupTypesTable.setStatus('current')
ce_redun_group_types_entry = mib_table_row((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1)).setIndexNames((0, 'CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupTypeIndex'))
if mibBuilder.loadTexts:
ceRedunGroupTypesEntry.setStatus('current')
ce_redun_group_type_index = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1, 1), unsigned32())
if mibBuilder.loadTexts:
ceRedunGroupTypeIndex.setStatus('current')
ce_redun_group_type_name = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1, 2), snmp_admin_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunGroupTypeName.setStatus('current')
ce_redun_group_counts = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1, 3), gauge32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunGroupCounts.setStatus('current')
ce_redun_next_unused_group_index = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1, 4), unsigned32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunNextUnusedGroupIndex.setStatus('current')
ce_redun_max_mbrs_in_group = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1, 5), unsigned32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunMaxMbrsInGroup.setStatus('current')
ce_redun_uses_group_name = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1, 6), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunUsesGroupName.setStatus('current')
ce_redun_group_definition_changed = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 1, 1, 7), time_stamp()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunGroupDefinitionChanged.setStatus('current')
ce_redun_vendor_types_table = mib_table((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 2))
if mibBuilder.loadTexts:
ceRedunVendorTypesTable.setStatus('current')
ce_redun_vendor_types_entry = mib_table_row((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 2, 1)).setIndexNames((0, 'CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupTypeIndex'), (0, 'CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunVendorType'))
if mibBuilder.loadTexts:
ceRedunVendorTypesEntry.setStatus('current')
ce_redun_vendor_type = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 2, 1, 1), autonomous_type()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunVendorType.setStatus('current')
ce_redun_internal_states_table = mib_table((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 3))
if mibBuilder.loadTexts:
ceRedunInternalStatesTable.setStatus('current')
ce_redun_internal_states_entry = mib_table_row((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 3, 1)).setIndexNames((0, 'CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupTypeIndex'), (0, 'CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunInternalStateIndex'))
if mibBuilder.loadTexts:
ceRedunInternalStatesEntry.setStatus('current')
ce_redun_internal_state_index = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 3, 1, 1), unsigned32())
if mibBuilder.loadTexts:
ceRedunInternalStateIndex.setStatus('current')
ce_redun_state_category = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 3, 1, 2), ce_redun_state_categories()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunStateCategory.setStatus('current')
ce_redun_internal_state_descr = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 3, 1, 3), snmp_admin_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunInternalStateDescr.setStatus('current')
ce_redun_switchover_reason_table = mib_table((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 4))
if mibBuilder.loadTexts:
ceRedunSwitchoverReasonTable.setStatus('current')
ce_redun_switchover_reason_entry = mib_table_row((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 4, 1)).setIndexNames((0, 'CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupTypeIndex'), (0, 'CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunSwitchoverReasonIndex'))
if mibBuilder.loadTexts:
ceRedunSwitchoverReasonEntry.setStatus('current')
ce_redun_switchover_reason_index = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 4, 1, 1), unsigned32())
if mibBuilder.loadTexts:
ceRedunSwitchoverReasonIndex.setStatus('current')
ce_redun_reason_category = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 4, 1, 2), ce_redun_reason_categories()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunReasonCategory.setStatus('current')
ce_redun_switchover_reason_descr = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 4, 1, 3), snmp_admin_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunSwitchoverReasonDescr.setStatus('current')
ce_redun_group_last_changed = mib_scalar((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 5), time_stamp()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunGroupLastChanged.setStatus('current')
ce_redun_group_table = mib_table((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6))
if mibBuilder.loadTexts:
ceRedunGroupTable.setStatus('current')
ce_redun_group_entry = mib_table_row((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1)).setIndexNames((0, 'CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupTypeIndex'), (0, 'CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupIndex'))
if mibBuilder.loadTexts:
ceRedunGroupEntry.setStatus('current')
ce_redun_group_index = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 1), unsigned32())
if mibBuilder.loadTexts:
ceRedunGroupIndex.setStatus('current')
ce_redun_group_string = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 2), snmp_admin_string()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunGroupString.setStatus('current')
ce_redun_group_redun_type = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 3), ce_redun_type()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunGroupRedunType.setStatus('current')
ce_redun_group_scope = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 4), ce_redun_scope().clone('local')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunGroupScope.setStatus('current')
ce_redun_group_arch = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 5), ce_redun_arch().clone('onePlusOne')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunGroupArch.setStatus('current')
ce_redun_group_revert = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 6), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('nonrevertive', 1), ('revertive', 2)))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunGroupRevert.setStatus('current')
ce_redun_group_wait_to_restore = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 7), unsigned32().clone(300)).setUnits('seconds').setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunGroupWaitToRestore.setStatus('current')
ce_redun_group_direction = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 8), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('unidirectional', 1), ('bidirectional', 2)))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunGroupDirection.setStatus('current')
ce_redun_group_storage_type = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 9), storage_type().clone('volatile')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunGroupStorageType.setStatus('current')
ce_redun_group_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 1, 6, 1, 10), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunGroupRowStatus.setStatus('current')
ce_redun_members = mib_identifier((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2))
ce_redun_mbr_last_changed = mib_scalar((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 1), time_stamp()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunMbrLastChanged.setStatus('current')
ce_redun_mbr_config_table = mib_table((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2))
if mibBuilder.loadTexts:
ceRedunMbrConfigTable.setStatus('current')
ce_redun_mbr_config_entry = mib_table_row((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1)).setIndexNames((0, 'CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupTypeIndex'), (0, 'CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupIndex'), (0, 'CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrNumber'))
if mibBuilder.loadTexts:
ceRedunMbrConfigEntry.setStatus('current')
ce_redun_mbr_number = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 1), unsigned32())
if mibBuilder.loadTexts:
ceRedunMbrNumber.setStatus('current')
ce_redun_mbr_phys_index = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 2), physical_index()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunMbrPhysIndex.setStatus('current')
ce_redun_mbr_mode = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 3), ce_redun_mode()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunMbrMode.setStatus('current')
ce_redun_mbr_address_type = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 4), inet_address_type()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunMbrAddressType.setStatus('current')
ce_redun_mbr_remote_address = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 5), inet_address()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunMbrRemoteAddress.setStatus('current')
ce_redun_mbr_priority = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 6), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('low', 1), ('high', 2))).clone('low')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunMbrPriority.setStatus('current')
ce_redun_mbr_storage_type = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 8), storage_type().clone('volatile')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunMbrStorageType.setStatus('current')
ce_redun_mbr_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 2, 1, 9), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
ceRedunMbrRowStatus.setStatus('current')
ce_redun_mbr_status_last_changed = mib_scalar((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 3), time_stamp()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunMbrStatusLastChanged.setStatus('current')
ce_redun_mbr_status_table = mib_table((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4))
if mibBuilder.loadTexts:
ceRedunMbrStatusTable.setStatus('current')
ce_redun_mbr_status_entry = mib_table_row((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1))
ceRedunMbrConfigEntry.registerAugmentions(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrStatusEntry'))
ceRedunMbrStatusEntry.setIndexNames(*ceRedunMbrConfigEntry.getIndexNames())
if mibBuilder.loadTexts:
ceRedunMbrStatusEntry.setStatus('current')
ce_redun_mbr_status_current = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1, 1), ce_redun_mbr_status()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunMbrStatusCurrent.setStatus('current')
ce_redun_mbr_protecting_mbr = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1, 2), unsigned32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunMbrProtectingMbr.setStatus('current')
ce_redun_mbr_internal_state = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1, 3), unsigned32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunMbrInternalState.setStatus('current')
ce_redun_mbr_switchover_counts = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1, 4), gauge32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunMbrSwitchoverCounts.setStatus('current')
ce_redun_mbr_last_switchover = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1, 5), time_stamp()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunMbrLastSwitchover.setStatus('current')
ce_redun_mbr_switchover_reason = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1, 6), unsigned32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunMbrSwitchoverReason.setStatus('current')
ce_redun_mbr_switchover_seconds = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 2, 4, 1, 8), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
ceRedunMbrSwitchoverSeconds.setStatus('current')
ce_redun_command_table = mib_table((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 3))
if mibBuilder.loadTexts:
ceRedunCommandTable.setStatus('current')
ce_redun_command_entry = mib_table_row((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 3, 1)).setIndexNames((0, 'CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupTypeIndex'), (0, 'CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupIndex'))
if mibBuilder.loadTexts:
ceRedunCommandEntry.setStatus('current')
ce_redun_command_mbr_number = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 3, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(-1, 2147483647))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
ceRedunCommandMbrNumber.setStatus('current')
ce_redun_command_switch = mib_table_column((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 3, 1, 2), ce_redun_switch_command()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
ceRedunCommandSwitch.setStatus('current')
ce_redun_enable_switchover_notifs = mib_scalar((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 4), truth_value().clone('false')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
ceRedunEnableSwitchoverNotifs.setStatus('current')
ce_redun_enable_status_change_notifs = mib_scalar((1, 3, 6, 1, 4, 1, 9, 9, 498, 1, 5), truth_value().clone('false')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
ceRedunEnableStatusChangeNotifs.setStatus('current')
ce_redun_event_switchover = notification_type((1, 3, 6, 1, 4, 1, 9, 9, 498, 0, 1)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrProtectingMbr'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrStatusCurrent'))
if mibBuilder.loadTexts:
ceRedunEventSwitchover.setStatus('current')
ce_redun_protect_status_change = notification_type((1, 3, 6, 1, 4, 1, 9, 9, 498, 0, 2)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrStatusCurrent'))
if mibBuilder.loadTexts:
ceRedunProtectStatusChange.setStatus('current')
ce_redun_compliances = mib_identifier((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 1))
ce_redun_groups = mib_identifier((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2))
ce_redun_compliance = module_compliance((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 1, 1)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupTypeGroup'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupObjects'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMemberConfig'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMemberStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_compliance = ceRedunCompliance.setStatus('current')
ce_redun_group_type_group = object_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 1)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunNextUnusedGroupIndex'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMaxMbrsInGroup'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunUsesGroupName'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupDefinitionChanged'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_group_type_group = ceRedunGroupTypeGroup.setStatus('current')
ce_redun_optional_group_types = object_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 2)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupTypeName'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupCounts'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_optional_group_types = ceRedunOptionalGroupTypes.setStatus('current')
ce_redun_internal_states = object_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 3)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunStateCategory'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunInternalStateDescr'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_internal_states = ceRedunInternalStates.setStatus('current')
ce_redun_switchover_reason = object_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 4)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunReasonCategory'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunSwitchoverReasonDescr'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_switchover_reason = ceRedunSwitchoverReason.setStatus('current')
ce_redun_group_objects = object_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 5)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupLastChanged'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupString'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupRedunType'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupScope'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupArch'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupStorageType'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupRowStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_group_objects = ceRedunGroupObjects.setStatus('current')
ce_redun_revertive_group = object_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 6)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupRevert'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupWaitToRestore'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_revertive_group = ceRedunRevertiveGroup.setStatus('current')
ce_redun_bidirectional = object_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 7)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunGroupDirection'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_bidirectional = ceRedunBidirectional.setStatus('current')
ce_redun_member_config = object_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 8)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrLastChanged'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrPhysIndex'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrMode'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrStorageType'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrRowStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_member_config = ceRedunMemberConfig.setStatus('current')
ce_redun_remote_system = object_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 9)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrAddressType'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrRemoteAddress'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_remote_system = ceRedunRemoteSystem.setStatus('current')
ce_redun_one_to_n = object_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 10)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrPriority'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_one_to_n = ceRedunOneToN.setStatus('current')
ce_redun_member_status = object_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 11)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrStatusLastChanged'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrStatusCurrent'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrProtectingMbr'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrSwitchoverCounts'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrLastSwitchover'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_member_status = ceRedunMemberStatus.setStatus('current')
ce_redun_optional_mbr_status = object_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 12)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrInternalState'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrSwitchoverReason'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunMbrSwitchoverSeconds'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_optional_mbr_status = ceRedunOptionalMbrStatus.setStatus('current')
ce_redun_commands_group = object_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 13)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunCommandMbrNumber'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunCommandSwitch'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_commands_group = ceRedunCommandsGroup.setStatus('current')
ce_redun_notif_enables = object_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 14)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunEnableSwitchoverNotifs'), ('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunEnableStatusChangeNotifs'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_notif_enables = ceRedunNotifEnables.setStatus('current')
ce_redun_switch_notif_group = notification_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 15)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunEventSwitchover'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_switch_notif_group = ceRedunSwitchNotifGroup.setStatus('current')
ce_redun_protect_status_notif_group = notification_group((1, 3, 6, 1, 4, 1, 9, 9, 498, 2, 2, 16)).setObjects(('CISCO-ENTITY-REDUNDANCY-MIB', 'ceRedunProtectStatusChange'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
ce_redun_protect_status_notif_group = ceRedunProtectStatusNotifGroup.setStatus('current')
mibBuilder.exportSymbols('CISCO-ENTITY-REDUNDANCY-MIB', ceRedunCompliance=ceRedunCompliance, ceRedunSwitchoverReasonDescr=ceRedunSwitchoverReasonDescr, ceRedunMbrInternalState=ceRedunMbrInternalState, ceRedunUsesGroupName=ceRedunUsesGroupName, ceRedunSwitchoverReason=ceRedunSwitchoverReason, ceRedunEnableSwitchoverNotifs=ceRedunEnableSwitchoverNotifs, ceRedunGroups=ceRedunGroups, ceRedunGroup=ceRedunGroup, ciscoEntityRedunMIB=ciscoEntityRedunMIB, ceRedunStateCategory=ceRedunStateCategory, ceRedunGroupScope=ceRedunGroupScope, ceRedunGroupTypesTable=ceRedunGroupTypesTable, ceRedunMbrRowStatus=ceRedunMbrRowStatus, ceRedunCommandTable=ceRedunCommandTable, ceRedunCommandMbrNumber=ceRedunCommandMbrNumber, PYSNMP_MODULE_ID=ciscoEntityRedunMIB, ciscoEntityRedunMIBObjects=ciscoEntityRedunMIBObjects, ceRedunRevertiveGroup=ceRedunRevertiveGroup, ceRedunInternalStateDescr=ceRedunInternalStateDescr, ceRedunMbrSwitchoverReason=ceRedunMbrSwitchoverReason, ceRedunNextUnusedGroupIndex=ceRedunNextUnusedGroupIndex, ceRedunMbrLastChanged=ceRedunMbrLastChanged, ceRedunGroupStorageType=ceRedunGroupStorageType, ceRedunMaxMbrsInGroup=ceRedunMaxMbrsInGroup, ceRedunSwitchoverReasonEntry=ceRedunSwitchoverReasonEntry, ceRedunSwitchoverReasonIndex=ceRedunSwitchoverReasonIndex, ceRedunGroupObjects=ceRedunGroupObjects, ceRedunOneToN=ceRedunOneToN, ceRedunCommandSwitch=ceRedunCommandSwitch, ceRedunSwitchoverReasonTable=ceRedunSwitchoverReasonTable, ceRedunGroupCounts=ceRedunGroupCounts, ceRedunEnableStatusChangeNotifs=ceRedunEnableStatusChangeNotifs, ceRedunProtectStatusChange=ceRedunProtectStatusChange, ceRedunVendorTypesTable=ceRedunVendorTypesTable, ceRedunMbrStatusCurrent=ceRedunMbrStatusCurrent, ceRedunGroupArch=ceRedunGroupArch, ceRedunEventSwitchover=ceRedunEventSwitchover, ceRedunNotifEnables=ceRedunNotifEnables, ceRedunGroupDirection=ceRedunGroupDirection, ceRedunVendorTypesEntry=ceRedunVendorTypesEntry, ceRedunGroupRedunType=ceRedunGroupRedunType, ceRedunInternalStates=ceRedunInternalStates, ceRedunGroupEntry=ceRedunGroupEntry, ceRedunGroupTable=ceRedunGroupTable, ceRedunMbrAddressType=ceRedunMbrAddressType, ceRedunReasonCategory=ceRedunReasonCategory, ceRedunGroupWaitToRestore=ceRedunGroupWaitToRestore, ceRedunMbrConfigTable=ceRedunMbrConfigTable, ceRedunOptionalMbrStatus=ceRedunOptionalMbrStatus, ceRedunInternalStateIndex=ceRedunInternalStateIndex, ceRedunGroupTypeIndex=ceRedunGroupTypeIndex, ceRedunGroupRevert=ceRedunGroupRevert, ceRedunMbrConfigEntry=ceRedunMbrConfigEntry, ceRedunCompliances=ceRedunCompliances, ceRedunMemberStatus=ceRedunMemberStatus, ciscoEntityRedunMIBConform=ciscoEntityRedunMIBConform, ceRedunMbrStorageType=ceRedunMbrStorageType, ceRedunMbrPriority=ceRedunMbrPriority, ceRedunInternalStatesTable=ceRedunInternalStatesTable, ceRedunMbrMode=ceRedunMbrMode, ceRedunMbrSwitchoverSeconds=ceRedunMbrSwitchoverSeconds, ceRedunCommandsGroup=ceRedunCommandsGroup, ceRedunOptionalGroupTypes=ceRedunOptionalGroupTypes, ceRedunMbrProtectingMbr=ceRedunMbrProtectingMbr, ceRedunGroupTypeName=ceRedunGroupTypeName, ceRedunRemoteSystem=ceRedunRemoteSystem, ceRedunInternalStatesEntry=ceRedunInternalStatesEntry, ceRedunGroupIndex=ceRedunGroupIndex, ceRedunGroupTypesEntry=ceRedunGroupTypesEntry, ceRedunBidirectional=ceRedunBidirectional, ceRedunMbrLastSwitchover=ceRedunMbrLastSwitchover, ceRedunMbrSwitchoverCounts=ceRedunMbrSwitchoverCounts, ceRedunMbrRemoteAddress=ceRedunMbrRemoteAddress, ceRedunProtectStatusNotifGroup=ceRedunProtectStatusNotifGroup, ceRedunMbrPhysIndex=ceRedunMbrPhysIndex, ceRedunVendorType=ceRedunVendorType, ceRedunGroupRowStatus=ceRedunGroupRowStatus, ceRedunGroupTypeGroup=ceRedunGroupTypeGroup, ceRedunMbrStatusLastChanged=ceRedunMbrStatusLastChanged, ceRedunSwitchNotifGroup=ceRedunSwitchNotifGroup, ceRedunGroupString=ceRedunGroupString, ciscoEntityRedunMIBNotifs=ciscoEntityRedunMIBNotifs, ceRedunMbrStatusTable=ceRedunMbrStatusTable, ceRedunMbrStatusEntry=ceRedunMbrStatusEntry, ceRedunMembers=ceRedunMembers, ceRedunMbrNumber=ceRedunMbrNumber, ceRedunGroupLastChanged=ceRedunGroupLastChanged, ceRedunGroupDefinitionChanged=ceRedunGroupDefinitionChanged, ceRedunCommandEntry=ceRedunCommandEntry, ceRedunMemberConfig=ceRedunMemberConfig) |
message = "This is a message!"
print(message)
message = "This is a new message!"
print(message) | message = 'This is a message!'
print(message)
message = 'This is a new message!'
print(message) |
# author: Roy Kid
# contact: lijichen365@126.com
# date: 2021-09-20
# version: 0.0.1
def flat_kwargs(kwargs):
tmp = []
values = list(kwargs.values())
lenValue = len(values[0])
for v in values:
assert len(v) == lenValue, 'kwargs request aligned value'
for i in range(lenValue):
tmp.append({})
for k, v in kwargs.items():
for i, vv in enumerate(v):
tmp[i].update({k: vv})
return tmp
a = {'A': [1, 2, 3, 4], 'B': [2, 3, 4, 5]}
print(flat_kwargs(a)) | def flat_kwargs(kwargs):
tmp = []
values = list(kwargs.values())
len_value = len(values[0])
for v in values:
assert len(v) == lenValue, 'kwargs request aligned value'
for i in range(lenValue):
tmp.append({})
for (k, v) in kwargs.items():
for (i, vv) in enumerate(v):
tmp[i].update({k: vv})
return tmp
a = {'A': [1, 2, 3, 4], 'B': [2, 3, 4, 5]}
print(flat_kwargs(a)) |
# Created by MechAviv
# Kinesis Introduction
# Map ID :: 331001120
# Hideout :: Training Room 2
KINESIS = 1531000
JAY = 1531001
if "1" not in sm.getQuestEx(22700, "E2"):
sm.setNpcOverrideBoxChat(KINESIS)
sm.sendNext("Jay, I feel so slow walking around like this. I'm going to switch to my speedier moves.")
sm.setNpcOverrideBoxChat(JAY)
sm.sendSay("#face9#Fine, whatever! Just ignore the test plan I spent hours on... Okay, I updated my database with your #bTriple Jump#k and #bAttack Skills#k for the final stage. Go nuts, dude.")
sm.lockForIntro()
sm.playSound("Sound/Field.img/masteryBook/EnchantSuccess")
sm.showClearStageExpWindow(600)
sm.giveExp(600)
sm.playExclSoundWithDownBGM("Voice3.img/Kinesis/guide_04", 100)
sm.sendDelay(2500)
sm.unlockForIntro()
sm.warp(331001130, 0)
sm.setQuestEx(22700, "E1", "1") | kinesis = 1531000
jay = 1531001
if '1' not in sm.getQuestEx(22700, 'E2'):
sm.setNpcOverrideBoxChat(KINESIS)
sm.sendNext("Jay, I feel so slow walking around like this. I'm going to switch to my speedier moves.")
sm.setNpcOverrideBoxChat(JAY)
sm.sendSay('#face9#Fine, whatever! Just ignore the test plan I spent hours on... Okay, I updated my database with your #bTriple Jump#k and #bAttack Skills#k for the final stage. Go nuts, dude.')
sm.lockForIntro()
sm.playSound('Sound/Field.img/masteryBook/EnchantSuccess')
sm.showClearStageExpWindow(600)
sm.giveExp(600)
sm.playExclSoundWithDownBGM('Voice3.img/Kinesis/guide_04', 100)
sm.sendDelay(2500)
sm.unlockForIntro()
sm.warp(331001130, 0)
sm.setQuestEx(22700, 'E1', '1') |
def do_something(x):
sq_x=x**2
return (sq_x) # this will make it much easier in future problems to see that something is actually happening
| def do_something(x):
sq_x = x ** 2
return sq_x |
class SetUp:
base = "http://localhost:8890/"
URL = "http://localhost:8890/notebooks/test/testing.ipynb"
kernel_link = "#kernellink"
start_kernel = "link=Restart & Run All"
start_confirm = "(.//*[normalize-space(text()) and normalize-space(.)='Continue Running'])[1]/following::button[1]"
title = '//div[@class=" title"]'
class Header:
head = '//div[@class=" title"]/h1'
logo = "//div[@class='logo']"
class GeneralInfo:
# test the info headings
base_path = "//div[contains(@class,'options')]"
backend = base_path + "/div[1]"
opt_level = base_path + "/div[2]"
qiskit_v, terra_v = (base_path + "/div[3]"), (base_path + "/div[4]")
class Params:
# check the params set for trebugger
param_button = "//button[@title='Params for transpilation']"
key = '//p[@class="params-key"]'
value = '//p[@class="params-value"]'
class Summary:
# check the summary headings
# check the circuit stat headings
panel = "//div[@id = 'notebook-container']/div/div[2]/div[2]/div/div[3]/div/div[5]"
header = panel + "/div/div/h2"
transform_label = "//p[@class='transform-label']"
analyse_label = "//p[@class='analyse-label']"
stats_base1 = "//div[@id='notebook-container']/div[1]/div[2]/div[2]/div/div[3]/div/div[5]/div[2]"
stats_base2 = "/div/p[1]"
@classmethod
def stat_path(cls, num):
num += 2 # starts from 3
return cls.stats_base1 + f"/div[{num}]" + cls.stats_base2
class TimelinePanel:
# general
# a. Displaying list of passes
main_button = '//*[@id="notebook-container"]/div[1]/div[2]/div[2]/div/div[3]/div/div[6]/button'
# b. Displaying circuit stats for each pass
step = "//*[@id='notebook-container']/div[1]/div[2]/div[2]/div/div[3]/div/div[6]/div/div/div/div[1]"
pass_name = step + "/div[2]/div/p"
time_taken = step + "/div[3]"
stats = {"Depth": "4", "Size": "5", "Width": "4", "1Q ops": "3", "2Q ops": "1"}
pass_button = step + "/div[1]/button"
@classmethod
def get_stat(cls, num, index):
num += 4
return cls.step + f"/div[{num}]/div/span[{index}]"
# c. Highlight changed circuit stats
# 2. Check the uncollapsed view with :
diff_link = '//input[@title="Highlight diff"]'
# a. Provide pass docs
# b. Provide circuit plot
# c. Provide log panel
# d. Provide property set
tabs = []
names = ["img", "prop", "log", "doc"]
for i in range(4):
tabs.append({"name": names[i], "path": f"//li[@id='tab-key-{i}']"})
# highlights
highlight_step = '//*[@id="notebook-container"]/div[1]/div[2]/div[2]/div/div[3]/div/div[6]/div/div/div/div[19]'
# divs 4,5 and 7 contain the highlights
highlights = [
highlight_step + "/div[4]",
highlight_step + "/div[5]",
highlight_step + "/div[7]",
]
class Downloads:
circuit_img = "//li[@id='tab-key-0']"
base_path = '//div[@class="circuit-export-wpr"]'
# Provide download in qasm
# provide download in qpy
# provide download in img
formats = {".png": "/a[1]", ".qpy": "/a[2]", ".qasm": "/a[3]"}
| class Setup:
base = 'http://localhost:8890/'
url = 'http://localhost:8890/notebooks/test/testing.ipynb'
kernel_link = '#kernellink'
start_kernel = 'link=Restart & Run All'
start_confirm = "(.//*[normalize-space(text()) and normalize-space(.)='Continue Running'])[1]/following::button[1]"
title = '//div[@class=" title"]'
class Header:
head = '//div[@class=" title"]/h1'
logo = "//div[@class='logo']"
class Generalinfo:
base_path = "//div[contains(@class,'options')]"
backend = base_path + '/div[1]'
opt_level = base_path + '/div[2]'
(qiskit_v, terra_v) = (base_path + '/div[3]', base_path + '/div[4]')
class Params:
param_button = "//button[@title='Params for transpilation']"
key = '//p[@class="params-key"]'
value = '//p[@class="params-value"]'
class Summary:
panel = "//div[@id = 'notebook-container']/div/div[2]/div[2]/div/div[3]/div/div[5]"
header = panel + '/div/div/h2'
transform_label = "//p[@class='transform-label']"
analyse_label = "//p[@class='analyse-label']"
stats_base1 = "//div[@id='notebook-container']/div[1]/div[2]/div[2]/div/div[3]/div/div[5]/div[2]"
stats_base2 = '/div/p[1]'
@classmethod
def stat_path(cls, num):
num += 2
return cls.stats_base1 + f'/div[{num}]' + cls.stats_base2
class Timelinepanel:
main_button = '//*[@id="notebook-container"]/div[1]/div[2]/div[2]/div/div[3]/div/div[6]/button'
step = "//*[@id='notebook-container']/div[1]/div[2]/div[2]/div/div[3]/div/div[6]/div/div/div/div[1]"
pass_name = step + '/div[2]/div/p'
time_taken = step + '/div[3]'
stats = {'Depth': '4', 'Size': '5', 'Width': '4', '1Q ops': '3', '2Q ops': '1'}
pass_button = step + '/div[1]/button'
@classmethod
def get_stat(cls, num, index):
num += 4
return cls.step + f'/div[{num}]/div/span[{index}]'
diff_link = '//input[@title="Highlight diff"]'
tabs = []
names = ['img', 'prop', 'log', 'doc']
for i in range(4):
tabs.append({'name': names[i], 'path': f"//li[@id='tab-key-{i}']"})
highlight_step = '//*[@id="notebook-container"]/div[1]/div[2]/div[2]/div/div[3]/div/div[6]/div/div/div/div[19]'
highlights = [highlight_step + '/div[4]', highlight_step + '/div[5]', highlight_step + '/div[7]']
class Downloads:
circuit_img = "//li[@id='tab-key-0']"
base_path = '//div[@class="circuit-export-wpr"]'
formats = {'.png': '/a[1]', '.qpy': '/a[2]', '.qasm': '/a[3]'} |
# int object is immutable
age = 30
print(id(age)) # id is used to get a object reference id
age = 40
print(id(age))
# list is mutable
series1 = [1, 2, 3]
series2 = series1
print(id(series1))
print(id(series1))
series1[1] = 10
print(series1)
print(series2)
print(id(series1))
print(id(series1))
# is operator can be used for object equality
series1 = [1, 2, 3]
series2 = [1, 2, 3]
print(series1 is series2) # reference equality
print(series1 == series2) # value equality
| age = 30
print(id(age))
age = 40
print(id(age))
series1 = [1, 2, 3]
series2 = series1
print(id(series1))
print(id(series1))
series1[1] = 10
print(series1)
print(series2)
print(id(series1))
print(id(series1))
series1 = [1, 2, 3]
series2 = [1, 2, 3]
print(series1 is series2)
print(series1 == series2) |
class Node:
def __init__(self, value, next=None):
self.value = value
self.next = next
def has_cycle(head):
fast = head
slow = head
while slow != None and fast.next:
slow = slow.next
fast = fast.next.next
if slow == fast:
return True
return False
def get_length(seed):
ptr = seed.next
L = 1
while ptr != seed:
ptr = ptr.next
L += 1
return L
def find_start(head, length):
ptr1 = head
ptr2 = head
for i in range(length):
ptr1 = ptr1.next
while ptr1 != ptr2:
ptr1 = ptr1.next
ptr2 = ptr2.next
return ptr1.value
def find_duplicate(head):
fast = head
slow = head
while slow != None and fast.next:
slow = slow.next # slow = A[slow]
fast = fast.next.next # fast = A[ A[fast] ]
if slow == fast:
L = get_length(slow)
break
if L == 0:
return -1
return find_start(head, L)
def main():
head = Node(2)
head.next = Node(1)
head.next.next = Node(3)
head.next.next.next = Node(4)
head.next.next.next.next = head.next
print(find_duplicate(head))
main()
| class Node:
def __init__(self, value, next=None):
self.value = value
self.next = next
def has_cycle(head):
fast = head
slow = head
while slow != None and fast.next:
slow = slow.next
fast = fast.next.next
if slow == fast:
return True
return False
def get_length(seed):
ptr = seed.next
l = 1
while ptr != seed:
ptr = ptr.next
l += 1
return L
def find_start(head, length):
ptr1 = head
ptr2 = head
for i in range(length):
ptr1 = ptr1.next
while ptr1 != ptr2:
ptr1 = ptr1.next
ptr2 = ptr2.next
return ptr1.value
def find_duplicate(head):
fast = head
slow = head
while slow != None and fast.next:
slow = slow.next
fast = fast.next.next
if slow == fast:
l = get_length(slow)
break
if L == 0:
return -1
return find_start(head, L)
def main():
head = node(2)
head.next = node(1)
head.next.next = node(3)
head.next.next.next = node(4)
head.next.next.next.next = head.next
print(find_duplicate(head))
main() |
__author__ = 'rene_esteves'
def factorial(input):
if input < 1: # base case
return 1
else:
return input * factorial(input - 1) # recursive call
def sum(input):
if input == 1: # base_case
return 1
else:
return input + sum(input - 1) # recursive call
def fibonacci(input):
if input == 1 or input == 0: # base_case
print("PAROU")
return 1
else:
return fibonacci(input - 1) + fibonacci(input - 2) # recursive call
# ====
def cres_natural_order(input):
if input == 0: # base_case
return print(input, "- ", end="")
else:
cres_natural_order(input - 1) # recursive call
return print(input, "- ", end="")
def descres_natural_order(input):
if input == 0: # base_case
return print(input, end="")
else:
print(input, "- ", end="")
return descres_natural_order(input - 1) # recursive call
def array_max(array, position):
if position >= 0: # base case
maior = int(array_max(array, position - 1)) # recursive call
if position < len(array): # vet size
if (maior > array[position]):
return maior
else:
return array[position]
return maior # final return
else:
return 0 # first valid return
def is_true(array, position, value):
if len(array) > position: # base_case
if array[position] == value:
return True
else:
return is_true(array, position + 1, value) # recursive call
else:
return False
def seekvalue(array, position, value):
if position >= 0: # base case
is_true = seekvalue(array, position - 1, value) # recursive call
if position < len(array) and is_true is not True: # vet lenght and valid return
if array[position] == value:
return True
else:
return False
return is_true # final return
else:
return False # first valid return
def binary_search(array, start, end, value):
middle = int((start + end) / 2)
if array[middle] == value:
return True
else:
if start == end:
return False
else:
if (value < array[middle]):
return binary_search(array, start, middle - 1, value)
else:
return binary_search(array, middle + 1, end, value)
def sum_array(array, position):
if len(array) == position: # base_case
return 0
else:
return array[position] + sum_array(array, position + 1) # recursive call
def invt_array(array, position): # TODO there's something wrong
if len(array) - 1 == position: # base_case
return print(array[position])
else:
array[len(array) - position - 1] = invt_array(array, position + 1) # recursive call
return print(array[position])
# ====
def decimal_to_binary(input):
if input <= 0: # base case
return str("")
else:
return decimal_to_binary(int(input / 2)) + str(input % 2) # recursive call
def factoring(input):
if input == 1: # base case
return 1
else:
return float(factoring(input - 1) + 1 / input) # recursive call
def exp(base, expo):
if expo == 0: # base case
return 1
else:
return exp(base, expo - 1) * base # recursive call
def sumdig(input):
if input < 0:
return sumdig(- input) # recursive call for negative numbers
if input == 0: # base case
return 0
else:
return input % 10 + int(sumdig(input / 10)) # recursive call
def invdig(input, size):
if input < 1: # base case
return 0
else:
return int(input % 10) * pow(10, size) + int(invdig(input / 10, size - 1)) # recursive call
def josephus(elements, interval):
if elements == 1:
return 1
else:
print(elements, interval)
return (josephus(elements - 1, interval) + interval) % elements
def triangle(input):
if input == 1: # base case
return 1
else:
return triangle(input - 1) + input # recursive call
def quad(input):
if input == 2: # base case
return 2
else:
return quad(input - 1) + (2 * input - 1) # recursive call
def mdc(p, q):
if q == 0: # base case
return p
else:
return mdc(q, p % q) # recursive call
def seekvalue2(array, position, value):
if position >= 0: # base case
if array[position] == value:
return True
else:
return seekvalue2(array, position - 1, value) # recursive call
else:
return False # worst case
def buscabinaria(array, inicio, fim, valor):
if inicio <= fim:
meio = int((inicio + fim) / 2)
if array[meio] == valor:
return True
else:
if array[meio] > valor:
return buscabinaria(array, inicio, meio - 1, valor)
else:
return buscabinaria(array, meio + 1, fim, valor)
else:
return False
def inverter(numero, expo):
print("numero", numero)
if numero == 0:
return numero
else:
return (int(numero % 10) * pow(10, expo)) + inverter(int(numero / 10), expo - 1)
v = []
def inv_array(i, f):
if i < f:
aux = v[i]
v[i] = v[f]
v[f] = aux
inv_array(i + 1, f - 1)
| __author__ = 'rene_esteves'
def factorial(input):
if input < 1:
return 1
else:
return input * factorial(input - 1)
def sum(input):
if input == 1:
return 1
else:
return input + sum(input - 1)
def fibonacci(input):
if input == 1 or input == 0:
print('PAROU')
return 1
else:
return fibonacci(input - 1) + fibonacci(input - 2)
def cres_natural_order(input):
if input == 0:
return print(input, '- ', end='')
else:
cres_natural_order(input - 1)
return print(input, '- ', end='')
def descres_natural_order(input):
if input == 0:
return print(input, end='')
else:
print(input, '- ', end='')
return descres_natural_order(input - 1)
def array_max(array, position):
if position >= 0:
maior = int(array_max(array, position - 1))
if position < len(array):
if maior > array[position]:
return maior
else:
return array[position]
return maior
else:
return 0
def is_true(array, position, value):
if len(array) > position:
if array[position] == value:
return True
else:
return is_true(array, position + 1, value)
else:
return False
def seekvalue(array, position, value):
if position >= 0:
is_true = seekvalue(array, position - 1, value)
if position < len(array) and is_true is not True:
if array[position] == value:
return True
else:
return False
return is_true
else:
return False
def binary_search(array, start, end, value):
middle = int((start + end) / 2)
if array[middle] == value:
return True
elif start == end:
return False
elif value < array[middle]:
return binary_search(array, start, middle - 1, value)
else:
return binary_search(array, middle + 1, end, value)
def sum_array(array, position):
if len(array) == position:
return 0
else:
return array[position] + sum_array(array, position + 1)
def invt_array(array, position):
if len(array) - 1 == position:
return print(array[position])
else:
array[len(array) - position - 1] = invt_array(array, position + 1)
return print(array[position])
def decimal_to_binary(input):
if input <= 0:
return str('')
else:
return decimal_to_binary(int(input / 2)) + str(input % 2)
def factoring(input):
if input == 1:
return 1
else:
return float(factoring(input - 1) + 1 / input)
def exp(base, expo):
if expo == 0:
return 1
else:
return exp(base, expo - 1) * base
def sumdig(input):
if input < 0:
return sumdig(-input)
if input == 0:
return 0
else:
return input % 10 + int(sumdig(input / 10))
def invdig(input, size):
if input < 1:
return 0
else:
return int(input % 10) * pow(10, size) + int(invdig(input / 10, size - 1))
def josephus(elements, interval):
if elements == 1:
return 1
else:
print(elements, interval)
return (josephus(elements - 1, interval) + interval) % elements
def triangle(input):
if input == 1:
return 1
else:
return triangle(input - 1) + input
def quad(input):
if input == 2:
return 2
else:
return quad(input - 1) + (2 * input - 1)
def mdc(p, q):
if q == 0:
return p
else:
return mdc(q, p % q)
def seekvalue2(array, position, value):
if position >= 0:
if array[position] == value:
return True
else:
return seekvalue2(array, position - 1, value)
else:
return False
def buscabinaria(array, inicio, fim, valor):
if inicio <= fim:
meio = int((inicio + fim) / 2)
if array[meio] == valor:
return True
elif array[meio] > valor:
return buscabinaria(array, inicio, meio - 1, valor)
else:
return buscabinaria(array, meio + 1, fim, valor)
else:
return False
def inverter(numero, expo):
print('numero', numero)
if numero == 0:
return numero
else:
return int(numero % 10) * pow(10, expo) + inverter(int(numero / 10), expo - 1)
v = []
def inv_array(i, f):
if i < f:
aux = v[i]
v[i] = v[f]
v[f] = aux
inv_array(i + 1, f - 1) |
class MySQL:
def __init__(self, db):
self.__db = db
def pre_load(self):
# do nothing
return
def load(self, check_id, results):
for result in results:
responsetime = result.get('responsetime', None)
self.__db.query(
'REPLACE INTO pingdom_check_result (`check_id`, `at`, `probe_id`, `status`, `status_desc`, `status_desc_long`, `response_time`)\
VALUES (:check_id, FROM_UNIXTIME(:at), :probe_id, :status, :status_desc, :status_desc_long, :response_time)',
check_id=check_id,
at=result['time'],
probe_id=result['probeid'],
status=result['status'],
status_desc=result['statusdesc'],
status_desc_long=result['statusdesclong'],
response_time=responsetime
)
| class Mysql:
def __init__(self, db):
self.__db = db
def pre_load(self):
return
def load(self, check_id, results):
for result in results:
responsetime = result.get('responsetime', None)
self.__db.query('REPLACE INTO pingdom_check_result (`check_id`, `at`, `probe_id`, `status`, `status_desc`, `status_desc_long`, `response_time`) VALUES (:check_id, FROM_UNIXTIME(:at), :probe_id, :status, :status_desc, :status_desc_long, :response_time)', check_id=check_id, at=result['time'], probe_id=result['probeid'], status=result['status'], status_desc=result['statusdesc'], status_desc_long=result['statusdesclong'], response_time=responsetime) |
#
# PySNMP MIB module OPT-IF-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/OPT-IF-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 20:26:00 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
ObjectIdentifier, Integer, OctetString = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "Integer", "OctetString")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueRangeConstraint, ConstraintsIntersection, ValueSizeConstraint, SingleValueConstraint, ConstraintsUnion = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueRangeConstraint", "ConstraintsIntersection", "ValueSizeConstraint", "SingleValueConstraint", "ConstraintsUnion")
ifIndex, = mibBuilder.importSymbols("IF-MIB", "ifIndex")
SnmpAdminString, = mibBuilder.importSymbols("SNMP-FRAMEWORK-MIB", "SnmpAdminString")
ModuleCompliance, ObjectGroup, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "ObjectGroup", "NotificationGroup")
Integer32, Bits, Counter64, MibIdentifier, MibScalar, MibTable, MibTableRow, MibTableColumn, TimeTicks, Gauge32, iso, Unsigned32, ModuleIdentity, Counter32, ObjectIdentity, transmission, IpAddress, NotificationType = mibBuilder.importSymbols("SNMPv2-SMI", "Integer32", "Bits", "Counter64", "MibIdentifier", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "TimeTicks", "Gauge32", "iso", "Unsigned32", "ModuleIdentity", "Counter32", "ObjectIdentity", "transmission", "IpAddress", "NotificationType")
DisplayString, TruthValue, TextualConvention, RowPointer, RowStatus = mibBuilder.importSymbols("SNMPv2-TC", "DisplayString", "TruthValue", "TextualConvention", "RowPointer", "RowStatus")
optIfMibModule = ModuleIdentity((1, 3, 6, 1, 2, 1, 10, 133))
optIfMibModule.setRevisions(('2003-08-13 00:00',))
if mibBuilder.loadTexts: optIfMibModule.setLastUpdated('200308130000Z')
if mibBuilder.loadTexts: optIfMibModule.setOrganization('IETF AToM MIB Working Group')
class OptIfAcTI(TextualConvention, OctetString):
status = 'current'
subtypeSpec = OctetString.subtypeSpec + ValueSizeConstraint(64, 64)
fixedLength = 64
class OptIfBitRateK(TextualConvention, Integer32):
status = 'current'
class OptIfDEGM(TextualConvention, Unsigned32):
status = 'current'
subtypeSpec = Unsigned32.subtypeSpec + ValueRangeConstraint(2, 10)
class OptIfDEGThr(TextualConvention, Unsigned32):
status = 'current'
subtypeSpec = Unsigned32.subtypeSpec + ValueRangeConstraint(1, 100)
class OptIfDirectionality(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3))
namedValues = NamedValues(("sink", 1), ("source", 2), ("bidirectional", 3))
class OptIfSinkOrSource(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2))
namedValues = NamedValues(("sink", 1), ("source", 2))
class OptIfExDAPI(TextualConvention, OctetString):
status = 'current'
subtypeSpec = OctetString.subtypeSpec + ValueSizeConstraint(16, 16)
fixedLength = 16
class OptIfExSAPI(TextualConvention, OctetString):
status = 'current'
subtypeSpec = OctetString.subtypeSpec + ValueSizeConstraint(16, 16)
fixedLength = 16
class OptIfIntervalNumber(TextualConvention, Unsigned32):
status = 'current'
subtypeSpec = Unsigned32.subtypeSpec + ValueRangeConstraint(1, 96)
class OptIfTIMDetMode(TextualConvention, Integer32):
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))
namedValues = NamedValues(("off", 1), ("dapi", 2), ("sapi", 3), ("both", 4))
class OptIfTxTI(TextualConvention, OctetString):
status = 'current'
subtypeSpec = OctetString.subtypeSpec + ValueSizeConstraint(64, 64)
fixedLength = 64
optIfObjects = MibIdentifier((1, 3, 6, 1, 2, 1, 10, 133, 1))
optIfConfs = MibIdentifier((1, 3, 6, 1, 2, 1, 10, 133, 2))
optIfOTMn = MibIdentifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 1))
optIfPerfMon = MibIdentifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 2))
optIfOTSn = MibIdentifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 3))
optIfOMSn = MibIdentifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 4))
optIfOChGroup = MibIdentifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 5))
optIfOCh = MibIdentifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 6))
optIfOTUk = MibIdentifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 7))
optIfODUk = MibIdentifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 8))
optIfODUkT = MibIdentifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 9))
optIfGroups = MibIdentifier((1, 3, 6, 1, 2, 1, 10, 133, 2, 1))
optIfCompl = MibIdentifier((1, 3, 6, 1, 2, 1, 10, 133, 2, 2))
optIfOTMnTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1), )
if mibBuilder.loadTexts: optIfOTMnTable.setStatus('current')
optIfOTMnEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOTMnEntry.setStatus('current')
optIfOTMnOrder = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 900))).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTMnOrder.setStatus('current')
optIfOTMnReduced = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1, 1, 2), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTMnReduced.setStatus('current')
optIfOTMnBitRates = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1, 1, 3), Bits().clone(namedValues=NamedValues(("bitRateK1", 0), ("bitRateK2", 1), ("bitRateK3", 2)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTMnBitRates.setStatus('current')
optIfOTMnInterfaceType = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1, 1, 4), SnmpAdminString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTMnInterfaceType.setStatus('current')
optIfOTMnTcmMax = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1, 1, 5), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 6))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTMnTcmMax.setStatus('current')
optIfOTMnOpticalReach = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1, 1, 6), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4, 5))).clone(namedValues=NamedValues(("intraOffice", 1), ("shortHaul", 2), ("longHaul", 3), ("veryLongHaul", 4), ("ultraLongHaul", 5)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTMnOpticalReach.setStatus('current')
optIfPerfMonIntervalTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 2, 1), )
if mibBuilder.loadTexts: optIfPerfMonIntervalTable.setStatus('current')
optIfPerfMonIntervalEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 2, 1, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfPerfMonIntervalEntry.setStatus('current')
optIfPerfMonCurrentTimeElapsed = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 2, 1, 1, 1), Gauge32().subtype(subtypeSpec=ValueRangeConstraint(0, 900))).setUnits('seconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfPerfMonCurrentTimeElapsed.setStatus('current')
optIfPerfMonCurDayTimeElapsed = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 2, 1, 1, 2), Gauge32().subtype(subtypeSpec=ValueRangeConstraint(0, 86400))).setUnits('seconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfPerfMonCurDayTimeElapsed.setStatus('current')
optIfPerfMonIntervalNumIntervals = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 2, 1, 1, 3), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 96))).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfPerfMonIntervalNumIntervals.setStatus('current')
optIfPerfMonIntervalNumInvalidIntervals = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 2, 1, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 96))).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfPerfMonIntervalNumInvalidIntervals.setStatus('current')
optIfOTSnConfigTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1), )
if mibBuilder.loadTexts: optIfOTSnConfigTable.setStatus('current')
optIfOTSnConfigEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOTSnConfigEntry.setStatus('current')
optIfOTSnDirectionality = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 1), OptIfDirectionality()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnDirectionality.setStatus('current')
optIfOTSnAprStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 2), SnmpAdminString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnAprStatus.setStatus('current')
optIfOTSnAprControl = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 3), SnmpAdminString()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTSnAprControl.setStatus('current')
optIfOTSnTraceIdentifierTransmitted = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 4), OptIfTxTI()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTSnTraceIdentifierTransmitted.setStatus('current')
optIfOTSnDAPIExpected = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 5), OptIfExDAPI()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTSnDAPIExpected.setStatus('current')
optIfOTSnSAPIExpected = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 6), OptIfExSAPI()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTSnSAPIExpected.setStatus('current')
optIfOTSnTraceIdentifierAccepted = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 7), OptIfAcTI()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnTraceIdentifierAccepted.setStatus('current')
optIfOTSnTIMDetMode = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 8), OptIfTIMDetMode()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTSnTIMDetMode.setStatus('current')
optIfOTSnTIMActEnabled = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 9), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTSnTIMActEnabled.setStatus('current')
optIfOTSnCurrentStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 10), Bits().clone(namedValues=NamedValues(("bdiP", 0), ("bdiO", 1), ("bdi", 2), ("tim", 3), ("losP", 4), ("losO", 5), ("los", 6)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnCurrentStatus.setStatus('current')
optIfOTSnSinkCurrentTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2), )
if mibBuilder.loadTexts: optIfOTSnSinkCurrentTable.setStatus('current')
optIfOTSnSinkCurrentEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOTSnSinkCurrentEntry.setStatus('current')
optIfOTSnSinkCurrentSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkCurrentSuspectedFlag.setStatus('current')
optIfOTSnSinkCurrentInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkCurrentInputPower.setStatus('current')
optIfOTSnSinkCurrentLowInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkCurrentLowInputPower.setStatus('current')
optIfOTSnSinkCurrentHighInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkCurrentHighInputPower.setStatus('current')
optIfOTSnSinkCurrentLowerInputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTSnSinkCurrentLowerInputPowerThreshold.setStatus('current')
optIfOTSnSinkCurrentUpperInputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTSnSinkCurrentUpperInputPowerThreshold.setStatus('current')
optIfOTSnSinkCurrentOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkCurrentOutputPower.setStatus('current')
optIfOTSnSinkCurrentLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 8), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkCurrentLowOutputPower.setStatus('current')
optIfOTSnSinkCurrentHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 9), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkCurrentHighOutputPower.setStatus('current')
optIfOTSnSinkCurrentLowerOutputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 10), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTSnSinkCurrentLowerOutputPowerThreshold.setStatus('current')
optIfOTSnSinkCurrentUpperOutputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 11), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTSnSinkCurrentUpperOutputPowerThreshold.setStatus('current')
optIfOTSnSinkIntervalTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3), )
if mibBuilder.loadTexts: optIfOTSnSinkIntervalTable.setStatus('current')
optIfOTSnSinkIntervalEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "OPT-IF-MIB", "optIfOTSnSinkIntervalNumber"))
if mibBuilder.loadTexts: optIfOTSnSinkIntervalEntry.setStatus('current')
optIfOTSnSinkIntervalNumber = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 1), OptIfIntervalNumber())
if mibBuilder.loadTexts: optIfOTSnSinkIntervalNumber.setStatus('current')
optIfOTSnSinkIntervalSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 2), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkIntervalSuspectedFlag.setStatus('current')
optIfOTSnSinkIntervalLastInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkIntervalLastInputPower.setStatus('current')
optIfOTSnSinkIntervalLowInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkIntervalLowInputPower.setStatus('current')
optIfOTSnSinkIntervalHighInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkIntervalHighInputPower.setStatus('current')
optIfOTSnSinkIntervalLastOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkIntervalLastOutputPower.setStatus('current')
optIfOTSnSinkIntervalLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkIntervalLowOutputPower.setStatus('current')
optIfOTSnSinkIntervalHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 8), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkIntervalHighOutputPower.setStatus('current')
optIfOTSnSinkCurDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 4), )
if mibBuilder.loadTexts: optIfOTSnSinkCurDayTable.setStatus('current')
optIfOTSnSinkCurDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 4, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOTSnSinkCurDayEntry.setStatus('current')
optIfOTSnSinkCurDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 4, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkCurDaySuspectedFlag.setStatus('current')
optIfOTSnSinkCurDayLowInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 4, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkCurDayLowInputPower.setStatus('current')
optIfOTSnSinkCurDayHighInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 4, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkCurDayHighInputPower.setStatus('current')
optIfOTSnSinkCurDayLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 4, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkCurDayLowOutputPower.setStatus('current')
optIfOTSnSinkCurDayHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 4, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkCurDayHighOutputPower.setStatus('current')
optIfOTSnSinkPrevDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5), )
if mibBuilder.loadTexts: optIfOTSnSinkPrevDayTable.setStatus('current')
optIfOTSnSinkPrevDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOTSnSinkPrevDayEntry.setStatus('current')
optIfOTSnSinkPrevDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkPrevDaySuspectedFlag.setStatus('current')
optIfOTSnSinkPrevDayLastInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkPrevDayLastInputPower.setStatus('current')
optIfOTSnSinkPrevDayLowInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkPrevDayLowInputPower.setStatus('current')
optIfOTSnSinkPrevDayHighInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkPrevDayHighInputPower.setStatus('current')
optIfOTSnSinkPrevDayLastOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkPrevDayLastOutputPower.setStatus('current')
optIfOTSnSinkPrevDayLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkPrevDayLowOutputPower.setStatus('current')
optIfOTSnSinkPrevDayHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSinkPrevDayHighOutputPower.setStatus('current')
optIfOTSnSrcCurrentTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6), )
if mibBuilder.loadTexts: optIfOTSnSrcCurrentTable.setStatus('current')
optIfOTSnSrcCurrentEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOTSnSrcCurrentEntry.setStatus('current')
optIfOTSnSrcCurrentSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcCurrentSuspectedFlag.setStatus('current')
optIfOTSnSrcCurrentOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcCurrentOutputPower.setStatus('current')
optIfOTSnSrcCurrentLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcCurrentLowOutputPower.setStatus('current')
optIfOTSnSrcCurrentHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcCurrentHighOutputPower.setStatus('current')
optIfOTSnSrcCurrentLowerOutputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTSnSrcCurrentLowerOutputPowerThreshold.setStatus('current')
optIfOTSnSrcCurrentUpperOutputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTSnSrcCurrentUpperOutputPowerThreshold.setStatus('current')
optIfOTSnSrcCurrentInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcCurrentInputPower.setStatus('current')
optIfOTSnSrcCurrentLowInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 8), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcCurrentLowInputPower.setStatus('current')
optIfOTSnSrcCurrentHighInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 9), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcCurrentHighInputPower.setStatus('current')
optIfOTSnSrcCurrentLowerInputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 10), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTSnSrcCurrentLowerInputPowerThreshold.setStatus('current')
optIfOTSnSrcCurrentUpperInputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 11), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTSnSrcCurrentUpperInputPowerThreshold.setStatus('current')
optIfOTSnSrcIntervalTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7), )
if mibBuilder.loadTexts: optIfOTSnSrcIntervalTable.setStatus('current')
optIfOTSnSrcIntervalEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "OPT-IF-MIB", "optIfOTSnSrcIntervalNumber"))
if mibBuilder.loadTexts: optIfOTSnSrcIntervalEntry.setStatus('current')
optIfOTSnSrcIntervalNumber = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 1), OptIfIntervalNumber())
if mibBuilder.loadTexts: optIfOTSnSrcIntervalNumber.setStatus('current')
optIfOTSnSrcIntervalSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 2), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcIntervalSuspectedFlag.setStatus('current')
optIfOTSnSrcIntervalLastOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcIntervalLastOutputPower.setStatus('current')
optIfOTSnSrcIntervalLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcIntervalLowOutputPower.setStatus('current')
optIfOTSnSrcIntervalHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcIntervalHighOutputPower.setStatus('current')
optIfOTSnSrcIntervalLastInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcIntervalLastInputPower.setStatus('current')
optIfOTSnSrcIntervalLowInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcIntervalLowInputPower.setStatus('current')
optIfOTSnSrcIntervalHighInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 8), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcIntervalHighInputPower.setStatus('current')
optIfOTSnSrcCurDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 8), )
if mibBuilder.loadTexts: optIfOTSnSrcCurDayTable.setStatus('current')
optIfOTSnSrcCurDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 8, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOTSnSrcCurDayEntry.setStatus('current')
optIfOTSnSrcCurDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 8, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcCurDaySuspectedFlag.setStatus('current')
optIfOTSnSrcCurDayLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 8, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcCurDayLowOutputPower.setStatus('current')
optIfOTSnSrcCurDayHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 8, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcCurDayHighOutputPower.setStatus('current')
optIfOTSnSrcCurDayLowInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 8, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcCurDayLowInputPower.setStatus('current')
optIfOTSnSrcCurDayHighInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 8, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcCurDayHighInputPower.setStatus('current')
optIfOTSnSrcPrevDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9), )
if mibBuilder.loadTexts: optIfOTSnSrcPrevDayTable.setStatus('current')
optIfOTSnSrcPrevDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOTSnSrcPrevDayEntry.setStatus('current')
optIfOTSnSrcPrevDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcPrevDaySuspectedFlag.setStatus('current')
optIfOTSnSrcPrevDayLastOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcPrevDayLastOutputPower.setStatus('current')
optIfOTSnSrcPrevDayLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcPrevDayLowOutputPower.setStatus('current')
optIfOTSnSrcPrevDayHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcPrevDayHighOutputPower.setStatus('current')
optIfOTSnSrcPrevDayLastInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcPrevDayLastInputPower.setStatus('current')
optIfOTSnSrcPrevDayLowInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcPrevDayLowInputPower.setStatus('current')
optIfOTSnSrcPrevDayHighInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTSnSrcPrevDayHighInputPower.setStatus('current')
optIfOMSnConfigTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 1), )
if mibBuilder.loadTexts: optIfOMSnConfigTable.setStatus('current')
optIfOMSnConfigEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 1, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOMSnConfigEntry.setStatus('current')
optIfOMSnDirectionality = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 1, 1, 1), OptIfDirectionality()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnDirectionality.setStatus('current')
optIfOMSnCurrentStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 1, 1, 2), Bits().clone(namedValues=NamedValues(("ssfP", 0), ("ssfO", 1), ("ssf", 2), ("bdiP", 3), ("bdiO", 4), ("bdi", 5), ("losP", 6)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnCurrentStatus.setStatus('current')
optIfOMSnSinkCurrentTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2), )
if mibBuilder.loadTexts: optIfOMSnSinkCurrentTable.setStatus('current')
optIfOMSnSinkCurrentEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOMSnSinkCurrentEntry.setStatus('current')
optIfOMSnSinkCurrentSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkCurrentSuspectedFlag.setStatus('current')
optIfOMSnSinkCurrentAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkCurrentAggregatedInputPower.setStatus('current')
optIfOMSnSinkCurrentLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkCurrentLowAggregatedInputPower.setStatus('current')
optIfOMSnSinkCurrentHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkCurrentHighAggregatedInputPower.setStatus('current')
optIfOMSnSinkCurrentLowerInputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOMSnSinkCurrentLowerInputPowerThreshold.setStatus('current')
optIfOMSnSinkCurrentUpperInputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOMSnSinkCurrentUpperInputPowerThreshold.setStatus('current')
optIfOMSnSinkCurrentOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkCurrentOutputPower.setStatus('current')
optIfOMSnSinkCurrentLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 8), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkCurrentLowOutputPower.setStatus('current')
optIfOMSnSinkCurrentHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 9), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkCurrentHighOutputPower.setStatus('current')
optIfOMSnSinkCurrentLowerOutputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 10), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOMSnSinkCurrentLowerOutputPowerThreshold.setStatus('current')
optIfOMSnSinkCurrentUpperOutputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 11), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOMSnSinkCurrentUpperOutputPowerThreshold.setStatus('current')
optIfOMSnSinkIntervalTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3), )
if mibBuilder.loadTexts: optIfOMSnSinkIntervalTable.setStatus('current')
optIfOMSnSinkIntervalEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "OPT-IF-MIB", "optIfOMSnSinkIntervalNumber"))
if mibBuilder.loadTexts: optIfOMSnSinkIntervalEntry.setStatus('current')
optIfOMSnSinkIntervalNumber = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 1), OptIfIntervalNumber())
if mibBuilder.loadTexts: optIfOMSnSinkIntervalNumber.setStatus('current')
optIfOMSnSinkIntervalSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 2), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkIntervalSuspectedFlag.setStatus('current')
optIfOMSnSinkIntervalLastAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkIntervalLastAggregatedInputPower.setStatus('current')
optIfOMSnSinkIntervalLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkIntervalLowAggregatedInputPower.setStatus('current')
optIfOMSnSinkIntervalHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkIntervalHighAggregatedInputPower.setStatus('current')
optIfOMSnSinkIntervalLastOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkIntervalLastOutputPower.setStatus('current')
optIfOMSnSinkIntervalLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkIntervalLowOutputPower.setStatus('current')
optIfOMSnSinkIntervalHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 8), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkIntervalHighOutputPower.setStatus('current')
optIfOMSnSinkCurDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 4), )
if mibBuilder.loadTexts: optIfOMSnSinkCurDayTable.setStatus('current')
optIfOMSnSinkCurDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 4, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOMSnSinkCurDayEntry.setStatus('current')
optIfOMSnSinkCurDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 4, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkCurDaySuspectedFlag.setStatus('current')
optIfOMSnSinkCurDayLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 4, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkCurDayLowAggregatedInputPower.setStatus('current')
optIfOMSnSinkCurDayHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 4, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkCurDayHighAggregatedInputPower.setStatus('current')
optIfOMSnSinkCurDayLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 4, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkCurDayLowOutputPower.setStatus('current')
optIfOMSnSinkCurDayHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 4, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkCurDayHighOutputPower.setStatus('current')
optIfOMSnSinkPrevDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5), )
if mibBuilder.loadTexts: optIfOMSnSinkPrevDayTable.setStatus('current')
optIfOMSnSinkPrevDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOMSnSinkPrevDayEntry.setStatus('current')
optIfOMSnSinkPrevDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkPrevDaySuspectedFlag.setStatus('current')
optIfOMSnSinkPrevDayLastAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkPrevDayLastAggregatedInputPower.setStatus('current')
optIfOMSnSinkPrevDayLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkPrevDayLowAggregatedInputPower.setStatus('current')
optIfOMSnSinkPrevDayHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkPrevDayHighAggregatedInputPower.setStatus('current')
optIfOMSnSinkPrevDayLastOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkPrevDayLastOutputPower.setStatus('current')
optIfOMSnSinkPrevDayLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkPrevDayLowOutputPower.setStatus('current')
optIfOMSnSinkPrevDayHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSinkPrevDayHighOutputPower.setStatus('current')
optIfOMSnSrcCurrentTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6), )
if mibBuilder.loadTexts: optIfOMSnSrcCurrentTable.setStatus('current')
optIfOMSnSrcCurrentEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOMSnSrcCurrentEntry.setStatus('current')
optIfOMSnSrcCurrentSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcCurrentSuspectedFlag.setStatus('current')
optIfOMSnSrcCurrentOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcCurrentOutputPower.setStatus('current')
optIfOMSnSrcCurrentLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcCurrentLowOutputPower.setStatus('current')
optIfOMSnSrcCurrentHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcCurrentHighOutputPower.setStatus('current')
optIfOMSnSrcCurrentLowerOutputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOMSnSrcCurrentLowerOutputPowerThreshold.setStatus('current')
optIfOMSnSrcCurrentUpperOutputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOMSnSrcCurrentUpperOutputPowerThreshold.setStatus('current')
optIfOMSnSrcCurrentAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcCurrentAggregatedInputPower.setStatus('current')
optIfOMSnSrcCurrentLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 8), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcCurrentLowAggregatedInputPower.setStatus('current')
optIfOMSnSrcCurrentHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 9), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcCurrentHighAggregatedInputPower.setStatus('current')
optIfOMSnSrcCurrentLowerInputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 10), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOMSnSrcCurrentLowerInputPowerThreshold.setStatus('current')
optIfOMSnSrcCurrentUpperInputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 11), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOMSnSrcCurrentUpperInputPowerThreshold.setStatus('current')
optIfOMSnSrcIntervalTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7), )
if mibBuilder.loadTexts: optIfOMSnSrcIntervalTable.setStatus('current')
optIfOMSnSrcIntervalEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "OPT-IF-MIB", "optIfOMSnSrcIntervalNumber"))
if mibBuilder.loadTexts: optIfOMSnSrcIntervalEntry.setStatus('current')
optIfOMSnSrcIntervalNumber = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 1), OptIfIntervalNumber())
if mibBuilder.loadTexts: optIfOMSnSrcIntervalNumber.setStatus('current')
optIfOMSnSrcIntervalSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 2), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcIntervalSuspectedFlag.setStatus('current')
optIfOMSnSrcIntervalLastOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcIntervalLastOutputPower.setStatus('current')
optIfOMSnSrcIntervalLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcIntervalLowOutputPower.setStatus('current')
optIfOMSnSrcIntervalHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcIntervalHighOutputPower.setStatus('current')
optIfOMSnSrcIntervalLastAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcIntervalLastAggregatedInputPower.setStatus('current')
optIfOMSnSrcIntervalLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcIntervalLowAggregatedInputPower.setStatus('current')
optIfOMSnSrcIntervalHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 8), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcIntervalHighAggregatedInputPower.setStatus('current')
optIfOMSnSrcCurDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 8), )
if mibBuilder.loadTexts: optIfOMSnSrcCurDayTable.setStatus('current')
optIfOMSnSrcCurDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 8, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOMSnSrcCurDayEntry.setStatus('current')
optIfOMSnSrcCurDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 8, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcCurDaySuspectedFlag.setStatus('current')
optIfOMSnSrcCurDayLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 8, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcCurDayLowOutputPower.setStatus('current')
optIfOMSnSrcCurDayHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 8, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcCurDayHighOutputPower.setStatus('current')
optIfOMSnSrcCurDayLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 8, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcCurDayLowAggregatedInputPower.setStatus('current')
optIfOMSnSrcCurDayHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 8, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcCurDayHighAggregatedInputPower.setStatus('current')
optIfOMSnSrcPrevDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9), )
if mibBuilder.loadTexts: optIfOMSnSrcPrevDayTable.setStatus('current')
optIfOMSnSrcPrevDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOMSnSrcPrevDayEntry.setStatus('current')
optIfOMSnSrcPrevDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcPrevDaySuspectedFlag.setStatus('current')
optIfOMSnSrcPrevDayLastOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcPrevDayLastOutputPower.setStatus('current')
optIfOMSnSrcPrevDayLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcPrevDayLowOutputPower.setStatus('current')
optIfOMSnSrcPrevDayHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcPrevDayHighOutputPower.setStatus('current')
optIfOMSnSrcPrevDayLastAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcPrevDayLastAggregatedInputPower.setStatus('current')
optIfOMSnSrcPrevDayLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcPrevDayLowAggregatedInputPower.setStatus('current')
optIfOMSnSrcPrevDayHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOMSnSrcPrevDayHighAggregatedInputPower.setStatus('current')
optIfOChGroupConfigTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 1), )
if mibBuilder.loadTexts: optIfOChGroupConfigTable.setStatus('current')
optIfOChGroupConfigEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 1, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOChGroupConfigEntry.setStatus('current')
optIfOChGroupDirectionality = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 1, 1, 1), OptIfDirectionality()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupDirectionality.setStatus('current')
optIfOChGroupSinkCurrentTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2), )
if mibBuilder.loadTexts: optIfOChGroupSinkCurrentTable.setStatus('current')
optIfOChGroupSinkCurrentEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOChGroupSinkCurrentEntry.setStatus('current')
optIfOChGroupSinkCurrentSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkCurrentSuspectedFlag.setStatus('current')
optIfOChGroupSinkCurrentAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkCurrentAggregatedInputPower.setStatus('current')
optIfOChGroupSinkCurrentLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkCurrentLowAggregatedInputPower.setStatus('current')
optIfOChGroupSinkCurrentHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkCurrentHighAggregatedInputPower.setStatus('current')
optIfOChGroupSinkCurrentLowerInputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOChGroupSinkCurrentLowerInputPowerThreshold.setStatus('current')
optIfOChGroupSinkCurrentUpperInputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOChGroupSinkCurrentUpperInputPowerThreshold.setStatus('current')
optIfOChGroupSinkCurrentOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkCurrentOutputPower.setStatus('current')
optIfOChGroupSinkCurrentLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 8), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkCurrentLowOutputPower.setStatus('current')
optIfOChGroupSinkCurrentHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 9), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkCurrentHighOutputPower.setStatus('current')
optIfOChGroupSinkCurrentLowerOutputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 10), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOChGroupSinkCurrentLowerOutputPowerThreshold.setStatus('current')
optIfOChGroupSinkCurrentUpperOutputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 11), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOChGroupSinkCurrentUpperOutputPowerThreshold.setStatus('current')
optIfOChGroupSinkIntervalTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3), )
if mibBuilder.loadTexts: optIfOChGroupSinkIntervalTable.setStatus('current')
optIfOChGroupSinkIntervalEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "OPT-IF-MIB", "optIfOChGroupSinkIntervalNumber"))
if mibBuilder.loadTexts: optIfOChGroupSinkIntervalEntry.setStatus('current')
optIfOChGroupSinkIntervalNumber = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 1), OptIfIntervalNumber())
if mibBuilder.loadTexts: optIfOChGroupSinkIntervalNumber.setStatus('current')
optIfOChGroupSinkIntervalSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 2), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkIntervalSuspectedFlag.setStatus('current')
optIfOChGroupSinkIntervalLastAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkIntervalLastAggregatedInputPower.setStatus('current')
optIfOChGroupSinkIntervalLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkIntervalLowAggregatedInputPower.setStatus('current')
optIfOChGroupSinkIntervalHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkIntervalHighAggregatedInputPower.setStatus('current')
optIfOChGroupSinkIntervalLastOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkIntervalLastOutputPower.setStatus('current')
optIfOChGroupSinkIntervalLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkIntervalLowOutputPower.setStatus('current')
optIfOChGroupSinkIntervalHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 8), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkIntervalHighOutputPower.setStatus('current')
optIfOChGroupSinkCurDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 4), )
if mibBuilder.loadTexts: optIfOChGroupSinkCurDayTable.setStatus('current')
optIfOChGroupSinkCurDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 4, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOChGroupSinkCurDayEntry.setStatus('current')
optIfOChGroupSinkCurDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 4, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkCurDaySuspectedFlag.setStatus('current')
optIfOChGroupSinkCurDayLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 4, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkCurDayLowAggregatedInputPower.setStatus('current')
optIfOChGroupSinkCurDayHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 4, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkCurDayHighAggregatedInputPower.setStatus('current')
optIfOChGroupSinkCurDayLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 4, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkCurDayLowOutputPower.setStatus('current')
optIfOChGroupSinkCurDayHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 4, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkCurDayHighOutputPower.setStatus('current')
optIfOChGroupSinkPrevDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5), )
if mibBuilder.loadTexts: optIfOChGroupSinkPrevDayTable.setStatus('current')
optIfOChGroupSinkPrevDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOChGroupSinkPrevDayEntry.setStatus('current')
optIfOChGroupSinkPrevDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkPrevDaySuspectedFlag.setStatus('current')
optIfOChGroupSinkPrevDayLastAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkPrevDayLastAggregatedInputPower.setStatus('current')
optIfOChGroupSinkPrevDayLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkPrevDayLowAggregatedInputPower.setStatus('current')
optIfOChGroupSinkPrevDayHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkPrevDayHighAggregatedInputPower.setStatus('current')
optIfOChGroupSinkPrevDayLastOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkPrevDayLastOutputPower.setStatus('current')
optIfOChGroupSinkPrevDayLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkPrevDayLowOutputPower.setStatus('current')
optIfOChGroupSinkPrevDayHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSinkPrevDayHighOutputPower.setStatus('current')
optIfOChGroupSrcCurrentTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6), )
if mibBuilder.loadTexts: optIfOChGroupSrcCurrentTable.setStatus('current')
optIfOChGroupSrcCurrentEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOChGroupSrcCurrentEntry.setStatus('current')
optIfOChGroupSrcCurrentSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcCurrentSuspectedFlag.setStatus('current')
optIfOChGroupSrcCurrentOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcCurrentOutputPower.setStatus('current')
optIfOChGroupSrcCurrentLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcCurrentLowOutputPower.setStatus('current')
optIfOChGroupSrcCurrentHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcCurrentHighOutputPower.setStatus('current')
optIfOChGroupSrcCurrentLowerOutputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOChGroupSrcCurrentLowerOutputPowerThreshold.setStatus('current')
optIfOChGroupSrcCurrentUpperOutputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOChGroupSrcCurrentUpperOutputPowerThreshold.setStatus('current')
optIfOChGroupSrcCurrentAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcCurrentAggregatedInputPower.setStatus('current')
optIfOChGroupSrcCurrentLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 8), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcCurrentLowAggregatedInputPower.setStatus('current')
optIfOChGroupSrcCurrentHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 9), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcCurrentHighAggregatedInputPower.setStatus('current')
optIfOChGroupSrcCurrentLowerInputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 10), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOChGroupSrcCurrentLowerInputPowerThreshold.setStatus('current')
optIfOChGroupSrcCurrentUpperInputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 11), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOChGroupSrcCurrentUpperInputPowerThreshold.setStatus('current')
optIfOChGroupSrcIntervalTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7), )
if mibBuilder.loadTexts: optIfOChGroupSrcIntervalTable.setStatus('current')
optIfOChGroupSrcIntervalEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "OPT-IF-MIB", "optIfOChGroupSrcIntervalNumber"))
if mibBuilder.loadTexts: optIfOChGroupSrcIntervalEntry.setStatus('current')
optIfOChGroupSrcIntervalNumber = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 1), OptIfIntervalNumber())
if mibBuilder.loadTexts: optIfOChGroupSrcIntervalNumber.setStatus('current')
optIfOChGroupSrcIntervalSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 2), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcIntervalSuspectedFlag.setStatus('current')
optIfOChGroupSrcIntervalLastOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcIntervalLastOutputPower.setStatus('current')
optIfOChGroupSrcIntervalLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcIntervalLowOutputPower.setStatus('current')
optIfOChGroupSrcIntervalHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcIntervalHighOutputPower.setStatus('current')
optIfOChGroupSrcIntervalLastAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcIntervalLastAggregatedInputPower.setStatus('current')
optIfOChGroupSrcIntervalLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcIntervalLowAggregatedInputPower.setStatus('current')
optIfOChGroupSrcIntervalHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 8), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcIntervalHighAggregatedInputPower.setStatus('current')
optIfOChGroupSrcCurDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 8), )
if mibBuilder.loadTexts: optIfOChGroupSrcCurDayTable.setStatus('current')
optIfOChGroupSrcCurDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 8, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOChGroupSrcCurDayEntry.setStatus('current')
optIfOChGroupSrcCurDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 8, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcCurDaySuspectedFlag.setStatus('current')
optIfOChGroupSrcCurDayLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 8, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcCurDayLowOutputPower.setStatus('current')
optIfOChGroupSrcCurDayHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 8, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcCurDayHighOutputPower.setStatus('current')
optIfOChGroupSrcCurDayLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 8, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcCurDayLowAggregatedInputPower.setStatus('current')
optIfOChGroupSrcCurDayHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 8, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcCurDayHighAggregatedInputPower.setStatus('current')
optIfOChGroupSrcPrevDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9), )
if mibBuilder.loadTexts: optIfOChGroupSrcPrevDayTable.setStatus('current')
optIfOChGroupSrcPrevDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOChGroupSrcPrevDayEntry.setStatus('current')
optIfOChGroupSrcPrevDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcPrevDaySuspectedFlag.setStatus('current')
optIfOChGroupSrcPrevDayLastOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcPrevDayLastOutputPower.setStatus('current')
optIfOChGroupSrcPrevDayLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcPrevDayLowOutputPower.setStatus('current')
optIfOChGroupSrcPrevDayHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcPrevDayHighOutputPower.setStatus('current')
optIfOChGroupSrcPrevDayLastAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcPrevDayLastAggregatedInputPower.setStatus('current')
optIfOChGroupSrcPrevDayLowAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcPrevDayLowAggregatedInputPower.setStatus('current')
optIfOChGroupSrcPrevDayHighAggregatedInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1, 7), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChGroupSrcPrevDayHighAggregatedInputPower.setStatus('current')
optIfOChConfigTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 1), )
if mibBuilder.loadTexts: optIfOChConfigTable.setStatus('current')
optIfOChConfigEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 1, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOChConfigEntry.setStatus('current')
optIfOChDirectionality = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 1, 1, 1), OptIfDirectionality()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChDirectionality.setStatus('current')
optIfOChCurrentStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 1, 1, 2), Bits().clone(namedValues=NamedValues(("losP", 0), ("los", 1), ("oci", 2), ("ssfP", 3), ("ssfO", 4), ("ssf", 5)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChCurrentStatus.setStatus('current')
optIfOChSinkCurrentTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2), )
if mibBuilder.loadTexts: optIfOChSinkCurrentTable.setStatus('current')
optIfOChSinkCurrentEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOChSinkCurrentEntry.setStatus('current')
optIfOChSinkCurrentSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSinkCurrentSuspectedFlag.setStatus('current')
optIfOChSinkCurrentInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSinkCurrentInputPower.setStatus('current')
optIfOChSinkCurrentLowInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSinkCurrentLowInputPower.setStatus('current')
optIfOChSinkCurrentHighInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSinkCurrentHighInputPower.setStatus('current')
optIfOChSinkCurrentLowerInputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOChSinkCurrentLowerInputPowerThreshold.setStatus('current')
optIfOChSinkCurrentUpperInputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOChSinkCurrentUpperInputPowerThreshold.setStatus('current')
optIfOChSinkIntervalTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 3), )
if mibBuilder.loadTexts: optIfOChSinkIntervalTable.setStatus('current')
optIfOChSinkIntervalEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 3, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "OPT-IF-MIB", "optIfOChSinkIntervalNumber"))
if mibBuilder.loadTexts: optIfOChSinkIntervalEntry.setStatus('current')
optIfOChSinkIntervalNumber = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 3, 1, 1), OptIfIntervalNumber())
if mibBuilder.loadTexts: optIfOChSinkIntervalNumber.setStatus('current')
optIfOChSinkIntervalSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 3, 1, 2), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSinkIntervalSuspectedFlag.setStatus('current')
optIfOChSinkIntervalLastInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 3, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSinkIntervalLastInputPower.setStatus('current')
optIfOChSinkIntervalLowInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 3, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSinkIntervalLowInputPower.setStatus('current')
optIfOChSinkIntervalHighInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 3, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSinkIntervalHighInputPower.setStatus('current')
optIfOChSinkCurDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 4), )
if mibBuilder.loadTexts: optIfOChSinkCurDayTable.setStatus('current')
optIfOChSinkCurDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 4, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOChSinkCurDayEntry.setStatus('current')
optIfOChSinkCurDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 4, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSinkCurDaySuspectedFlag.setStatus('current')
optIfOChSinkCurDayLowInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 4, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSinkCurDayLowInputPower.setStatus('current')
optIfOChSinkCurDayHighInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 4, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSinkCurDayHighInputPower.setStatus('current')
optIfOChSinkPrevDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 5), )
if mibBuilder.loadTexts: optIfOChSinkPrevDayTable.setStatus('current')
optIfOChSinkPrevDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 5, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOChSinkPrevDayEntry.setStatus('current')
optIfOChSinkPrevDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 5, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSinkPrevDaySuspectedFlag.setStatus('current')
optIfOChSinkPrevDayLastInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 5, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSinkPrevDayLastInputPower.setStatus('current')
optIfOChSinkPrevDayLowInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 5, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSinkPrevDayLowInputPower.setStatus('current')
optIfOChSinkPrevDayHighInputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 5, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSinkPrevDayHighInputPower.setStatus('current')
optIfOChSrcCurrentTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6), )
if mibBuilder.loadTexts: optIfOChSrcCurrentTable.setStatus('current')
optIfOChSrcCurrentEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOChSrcCurrentEntry.setStatus('current')
optIfOChSrcCurrentSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSrcCurrentSuspectedFlag.setStatus('current')
optIfOChSrcCurrentOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSrcCurrentOutputPower.setStatus('current')
optIfOChSrcCurrentLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSrcCurrentLowOutputPower.setStatus('current')
optIfOChSrcCurrentHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSrcCurrentHighOutputPower.setStatus('current')
optIfOChSrcCurrentLowerOutputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOChSrcCurrentLowerOutputPowerThreshold.setStatus('current')
optIfOChSrcCurrentUpperOutputPowerThreshold = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6, 1, 6), Integer32()).setUnits('0.1 dbm').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOChSrcCurrentUpperOutputPowerThreshold.setStatus('current')
optIfOChSrcIntervalTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 7), )
if mibBuilder.loadTexts: optIfOChSrcIntervalTable.setStatus('current')
optIfOChSrcIntervalEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 7, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "OPT-IF-MIB", "optIfOChSrcIntervalNumber"))
if mibBuilder.loadTexts: optIfOChSrcIntervalEntry.setStatus('current')
optIfOChSrcIntervalNumber = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 7, 1, 1), OptIfIntervalNumber())
if mibBuilder.loadTexts: optIfOChSrcIntervalNumber.setStatus('current')
optIfOChSrcIntervalSuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 7, 1, 2), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSrcIntervalSuspectedFlag.setStatus('current')
optIfOChSrcIntervalLastOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 7, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSrcIntervalLastOutputPower.setStatus('current')
optIfOChSrcIntervalLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 7, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSrcIntervalLowOutputPower.setStatus('current')
optIfOChSrcIntervalHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 7, 1, 5), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSrcIntervalHighOutputPower.setStatus('current')
optIfOChSrcCurDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 8), )
if mibBuilder.loadTexts: optIfOChSrcCurDayTable.setStatus('current')
optIfOChSrcCurDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 8, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOChSrcCurDayEntry.setStatus('current')
optIfOChSrcCurDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 8, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSrcCurDaySuspectedFlag.setStatus('current')
optIfOChSrcCurDayLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 8, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSrcCurDayLowOutputPower.setStatus('current')
optIfOChSrcCurDayHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 8, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSrcCurDayHighOutputPower.setStatus('current')
optIfOChSrcPrevDayTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 9), )
if mibBuilder.loadTexts: optIfOChSrcPrevDayTable.setStatus('current')
optIfOChSrcPrevDayEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 9, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOChSrcPrevDayEntry.setStatus('current')
optIfOChSrcPrevDaySuspectedFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 9, 1, 1), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSrcPrevDaySuspectedFlag.setStatus('current')
optIfOChSrcPrevDayLastOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 9, 1, 2), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSrcPrevDayLastOutputPower.setStatus('current')
optIfOChSrcPrevDayLowOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 9, 1, 3), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSrcPrevDayLowOutputPower.setStatus('current')
optIfOChSrcPrevDayHighOutputPower = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 9, 1, 4), Integer32()).setUnits('0.1 dbm').setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOChSrcPrevDayHighOutputPower.setStatus('current')
optIfOTUkConfigTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1), )
if mibBuilder.loadTexts: optIfOTUkConfigTable.setStatus('current')
optIfOTUkConfigEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfOTUkConfigEntry.setStatus('current')
optIfOTUkDirectionality = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 1), OptIfDirectionality()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTUkDirectionality.setStatus('current')
optIfOTUkBitRateK = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 2), OptIfBitRateK()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTUkBitRateK.setStatus('current')
optIfOTUkTraceIdentifierTransmitted = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 3), OptIfTxTI()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTUkTraceIdentifierTransmitted.setStatus('current')
optIfOTUkDAPIExpected = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 4), OptIfExDAPI()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTUkDAPIExpected.setStatus('current')
optIfOTUkSAPIExpected = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 5), OptIfExSAPI()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTUkSAPIExpected.setStatus('current')
optIfOTUkTraceIdentifierAccepted = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 6), OptIfAcTI()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTUkTraceIdentifierAccepted.setStatus('current')
optIfOTUkTIMDetMode = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 7), OptIfTIMDetMode()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTUkTIMDetMode.setStatus('current')
optIfOTUkTIMActEnabled = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 8), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTUkTIMActEnabled.setStatus('current')
optIfOTUkDEGThr = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 9), OptIfDEGThr()).setUnits('percentage').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTUkDEGThr.setStatus('current')
optIfOTUkDEGM = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 10), OptIfDEGM()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTUkDEGM.setStatus('current')
optIfOTUkSinkAdaptActive = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 11), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTUkSinkAdaptActive.setStatus('current')
optIfOTUkSourceAdaptActive = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 12), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTUkSourceAdaptActive.setStatus('current')
optIfOTUkSinkFECEnabled = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 13), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfOTUkSinkFECEnabled.setStatus('current')
optIfOTUkCurrentStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 14), Bits().clone(namedValues=NamedValues(("tim", 0), ("deg", 1), ("bdi", 2), ("ssf", 3), ("lof", 4), ("ais", 5), ("lom", 6)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfOTUkCurrentStatus.setStatus('current')
optIfGCC0ConfigTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 2), )
if mibBuilder.loadTexts: optIfGCC0ConfigTable.setStatus('current')
optIfGCC0ConfigEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 2, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "OPT-IF-MIB", "optIfGCC0Directionality"))
if mibBuilder.loadTexts: optIfGCC0ConfigEntry.setStatus('current')
optIfGCC0Directionality = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 2, 1, 1), OptIfDirectionality())
if mibBuilder.loadTexts: optIfGCC0Directionality.setStatus('current')
optIfGCC0Application = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 2, 1, 2), SnmpAdminString()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfGCC0Application.setStatus('current')
optIfGCC0RowStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 2, 1, 3), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfGCC0RowStatus.setStatus('current')
optIfODUkConfigTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 1), )
if mibBuilder.loadTexts: optIfODUkConfigTable.setStatus('current')
optIfODUkConfigEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 1, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfODUkConfigEntry.setStatus('current')
optIfODUkDirectionality = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 1, 1, 1), OptIfDirectionality()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfODUkDirectionality.setStatus('current')
optIfODUkBitRateK = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 1, 1, 2), OptIfBitRateK()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfODUkBitRateK.setStatus('current')
optIfODUkTcmFieldsInUse = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 1, 1, 3), Bits().clone(namedValues=NamedValues(("tcmField1", 0), ("tcmField2", 1), ("tcmField3", 2), ("tcmField4", 3), ("tcmField5", 4), ("tcmField6", 5)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfODUkTcmFieldsInUse.setStatus('current')
optIfODUkPositionSeqCurrentSize = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 1, 1, 4), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfODUkPositionSeqCurrentSize.setStatus('current')
optIfODUkTtpPresent = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 1, 1, 5), TruthValue()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfODUkTtpPresent.setStatus('current')
optIfODUkTtpConfigTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2), )
if mibBuilder.loadTexts: optIfODUkTtpConfigTable.setStatus('current')
optIfODUkTtpConfigEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: optIfODUkTtpConfigEntry.setStatus('current')
optIfODUkTtpTraceIdentifierTransmitted = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 1), OptIfTxTI()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfODUkTtpTraceIdentifierTransmitted.setStatus('current')
optIfODUkTtpDAPIExpected = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 2), OptIfExDAPI()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfODUkTtpDAPIExpected.setStatus('current')
optIfODUkTtpSAPIExpected = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 3), OptIfExSAPI()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfODUkTtpSAPIExpected.setStatus('current')
optIfODUkTtpTraceIdentifierAccepted = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 4), OptIfAcTI()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfODUkTtpTraceIdentifierAccepted.setStatus('current')
optIfODUkTtpTIMDetMode = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 5), OptIfTIMDetMode()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfODUkTtpTIMDetMode.setStatus('current')
optIfODUkTtpTIMActEnabled = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 6), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfODUkTtpTIMActEnabled.setStatus('current')
optIfODUkTtpDEGThr = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 7), OptIfDEGThr()).setUnits('percentage').setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfODUkTtpDEGThr.setStatus('current')
optIfODUkTtpDEGM = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 8), OptIfDEGM()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: optIfODUkTtpDEGM.setStatus('current')
optIfODUkTtpCurrentStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 9), Bits().clone(namedValues=NamedValues(("oci", 0), ("lck", 1), ("tim", 2), ("deg", 3), ("bdi", 4), ("ssf", 5)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfODUkTtpCurrentStatus.setStatus('current')
optIfODUkPositionSeqTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 3), )
if mibBuilder.loadTexts: optIfODUkPositionSeqTable.setStatus('current')
optIfODUkPositionSeqEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 3, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "OPT-IF-MIB", "optIfODUkPositionSeqIndex"))
if mibBuilder.loadTexts: optIfODUkPositionSeqEntry.setStatus('current')
optIfODUkPositionSeqIndex = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 3, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 4294967295)))
if mibBuilder.loadTexts: optIfODUkPositionSeqIndex.setStatus('current')
optIfODUkPositionSeqPosition = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 3, 1, 2), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfODUkPositionSeqPosition.setStatus('current')
optIfODUkPositionSeqPointer = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 3, 1, 3), RowPointer()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfODUkPositionSeqPointer.setStatus('current')
optIfODUkNimConfigTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4), )
if mibBuilder.loadTexts: optIfODUkNimConfigTable.setStatus('current')
optIfODUkNimConfigEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "OPT-IF-MIB", "optIfODUkNimDirectionality"))
if mibBuilder.loadTexts: optIfODUkNimConfigEntry.setStatus('current')
optIfODUkNimDirectionality = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 1), OptIfSinkOrSource())
if mibBuilder.loadTexts: optIfODUkNimDirectionality.setStatus('current')
optIfODUkNimDAPIExpected = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 2), OptIfExDAPI()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkNimDAPIExpected.setStatus('current')
optIfODUkNimSAPIExpected = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 3), OptIfExSAPI()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkNimSAPIExpected.setStatus('current')
optIfODUkNimTraceIdentifierAccepted = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 4), OptIfAcTI()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfODUkNimTraceIdentifierAccepted.setStatus('current')
optIfODUkNimTIMDetMode = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 5), OptIfTIMDetMode()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkNimTIMDetMode.setStatus('current')
optIfODUkNimTIMActEnabled = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 6), TruthValue()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkNimTIMActEnabled.setStatus('current')
optIfODUkNimDEGThr = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 7), OptIfDEGThr()).setUnits('percentage').setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkNimDEGThr.setStatus('current')
optIfODUkNimDEGM = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 8), OptIfDEGM()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkNimDEGM.setStatus('current')
optIfODUkNimCurrentStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 9), Bits().clone(namedValues=NamedValues(("oci", 0), ("lck", 1), ("tim", 2), ("deg", 3), ("bdi", 4), ("ssf", 5)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfODUkNimCurrentStatus.setStatus('current')
optIfODUkNimRowStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 10), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkNimRowStatus.setStatus('current')
optIfGCC12ConfigTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 5), )
if mibBuilder.loadTexts: optIfGCC12ConfigTable.setStatus('current')
optIfGCC12ConfigEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 5, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "OPT-IF-MIB", "optIfGCC12Codirectional"), (0, "OPT-IF-MIB", "optIfGCC12GCCAccess"))
if mibBuilder.loadTexts: optIfGCC12ConfigEntry.setStatus('current')
optIfGCC12Codirectional = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 5, 1, 1), TruthValue())
if mibBuilder.loadTexts: optIfGCC12Codirectional.setStatus('current')
optIfGCC12GCCAccess = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 5, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("gcc1", 1), ("gcc2", 2), ("gcc1and2", 3))))
if mibBuilder.loadTexts: optIfGCC12GCCAccess.setStatus('current')
optIfGCC12GCCPassThrough = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 5, 1, 3), TruthValue()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfGCC12GCCPassThrough.setStatus('current')
optIfGCC12Application = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 5, 1, 4), SnmpAdminString()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfGCC12Application.setStatus('current')
optIfGCC12RowStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 5, 1, 5), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfGCC12RowStatus.setStatus('current')
optIfODUkTConfigTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1), )
if mibBuilder.loadTexts: optIfODUkTConfigTable.setStatus('current')
optIfODUkTConfigEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "OPT-IF-MIB", "optIfODUkTTcmField"), (0, "OPT-IF-MIB", "optIfODUkTCodirectional"))
if mibBuilder.loadTexts: optIfODUkTConfigEntry.setStatus('current')
optIfODUkTTcmField = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 6)))
if mibBuilder.loadTexts: optIfODUkTTcmField.setStatus('current')
optIfODUkTCodirectional = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 2), TruthValue())
if mibBuilder.loadTexts: optIfODUkTCodirectional.setStatus('current')
optIfODUkTTraceIdentifierTransmitted = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 3), OptIfTxTI()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTTraceIdentifierTransmitted.setStatus('current')
optIfODUkTDAPIExpected = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 4), OptIfExDAPI()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTDAPIExpected.setStatus('current')
optIfODUkTSAPIExpected = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 5), OptIfExSAPI()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTSAPIExpected.setStatus('current')
optIfODUkTTraceIdentifierAccepted = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 6), OptIfAcTI()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfODUkTTraceIdentifierAccepted.setStatus('current')
optIfODUkTTIMDetMode = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 7), OptIfTIMDetMode()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTTIMDetMode.setStatus('current')
optIfODUkTTIMActEnabled = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 8), TruthValue()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTTIMActEnabled.setStatus('current')
optIfODUkTDEGThr = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 9), OptIfDEGThr()).setUnits('percentage').setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTDEGThr.setStatus('current')
optIfODUkTDEGM = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 10), OptIfDEGM()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTDEGM.setStatus('current')
optIfODUkTSinkMode = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 11), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("operational", 1), ("monitor", 2)))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTSinkMode.setStatus('current')
optIfODUkTSinkLockSignalAdminState = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 12), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("locked", 1), ("normal", 2)))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTSinkLockSignalAdminState.setStatus('current')
optIfODUkTSourceLockSignalAdminState = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 13), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("locked", 1), ("normal", 2)))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTSourceLockSignalAdminState.setStatus('current')
optIfODUkTCurrentStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 14), Bits().clone(namedValues=NamedValues(("oci", 0), ("lck", 1), ("tim", 2), ("deg", 3), ("bdi", 4), ("ssf", 5)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfODUkTCurrentStatus.setStatus('current')
optIfODUkTRowStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 15), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTRowStatus.setStatus('current')
optIfODUkTNimConfigTable = MibTable((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2), )
if mibBuilder.loadTexts: optIfODUkTNimConfigTable.setStatus('current')
optIfODUkTNimConfigEntry = MibTableRow((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "OPT-IF-MIB", "optIfODUkTNimTcmField"), (0, "OPT-IF-MIB", "optIfODUkTNimDirectionality"))
if mibBuilder.loadTexts: optIfODUkTNimConfigEntry.setStatus('current')
optIfODUkTNimTcmField = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 6)))
if mibBuilder.loadTexts: optIfODUkTNimTcmField.setStatus('current')
optIfODUkTNimDirectionality = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 2), OptIfSinkOrSource())
if mibBuilder.loadTexts: optIfODUkTNimDirectionality.setStatus('current')
optIfODUkTNimDAPIExpected = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 3), OptIfExDAPI()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTNimDAPIExpected.setStatus('current')
optIfODUkTNimSAPIExpected = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 4), OptIfExSAPI()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTNimSAPIExpected.setStatus('current')
optIfODUkTNimTraceIdentifierAccepted = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 5), OptIfAcTI()).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfODUkTNimTraceIdentifierAccepted.setStatus('current')
optIfODUkTNimTIMDetMode = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 6), OptIfTIMDetMode()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTNimTIMDetMode.setStatus('current')
optIfODUkTNimTIMActEnabled = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 7), TruthValue()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTNimTIMActEnabled.setStatus('current')
optIfODUkTNimDEGThr = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 8), OptIfDEGThr()).setUnits('percentage').setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTNimDEGThr.setStatus('current')
optIfODUkTNimDEGM = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 9), OptIfDEGM()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTNimDEGM.setStatus('current')
optIfODUkTNimCurrentStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 10), Bits().clone(namedValues=NamedValues(("oci", 0), ("lck", 1), ("tim", 2), ("deg", 3), ("bdi", 4), ("ssf", 5)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: optIfODUkTNimCurrentStatus.setStatus('current')
optIfODUkTNimRowStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 11), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: optIfODUkTNimRowStatus.setStatus('current')
optIfOTMnGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 1)).setObjects(("OPT-IF-MIB", "optIfOTMnOrder"), ("OPT-IF-MIB", "optIfOTMnReduced"), ("OPT-IF-MIB", "optIfOTMnBitRates"), ("OPT-IF-MIB", "optIfOTMnInterfaceType"), ("OPT-IF-MIB", "optIfOTMnTcmMax"), ("OPT-IF-MIB", "optIfOTMnOpticalReach"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOTMnGroup = optIfOTMnGroup.setStatus('current')
optIfPerfMonGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 2)).setObjects(("OPT-IF-MIB", "optIfPerfMonCurrentTimeElapsed"), ("OPT-IF-MIB", "optIfPerfMonCurDayTimeElapsed"), ("OPT-IF-MIB", "optIfPerfMonIntervalNumIntervals"), ("OPT-IF-MIB", "optIfPerfMonIntervalNumInvalidIntervals"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfPerfMonGroup = optIfPerfMonGroup.setStatus('current')
optIfOTSnCommonGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 3)).setObjects(("OPT-IF-MIB", "optIfOTSnDirectionality"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOTSnCommonGroup = optIfOTSnCommonGroup.setStatus('current')
optIfOTSnSourceGroupFull = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 4)).setObjects(("OPT-IF-MIB", "optIfOTSnTraceIdentifierTransmitted"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOTSnSourceGroupFull = optIfOTSnSourceGroupFull.setStatus('current')
optIfOTSnAPRStatusGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 5)).setObjects(("OPT-IF-MIB", "optIfOTSnAprStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOTSnAPRStatusGroup = optIfOTSnAPRStatusGroup.setStatus('current')
optIfOTSnAPRControlGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 6)).setObjects(("OPT-IF-MIB", "optIfOTSnAprControl"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOTSnAPRControlGroup = optIfOTSnAPRControlGroup.setStatus('current')
optIfOTSnSinkGroupBasic = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 7)).setObjects(("OPT-IF-MIB", "optIfOTSnCurrentStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOTSnSinkGroupBasic = optIfOTSnSinkGroupBasic.setStatus('current')
optIfOTSnSinkGroupFull = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 8)).setObjects(("OPT-IF-MIB", "optIfOTSnDAPIExpected"), ("OPT-IF-MIB", "optIfOTSnSAPIExpected"), ("OPT-IF-MIB", "optIfOTSnTraceIdentifierAccepted"), ("OPT-IF-MIB", "optIfOTSnTIMDetMode"), ("OPT-IF-MIB", "optIfOTSnTIMActEnabled"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOTSnSinkGroupFull = optIfOTSnSinkGroupFull.setStatus('current')
optIfOTSnSinkPreOtnPMGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 9)).setObjects(("OPT-IF-MIB", "optIfOTSnSinkCurrentSuspectedFlag"), ("OPT-IF-MIB", "optIfOTSnSinkCurrentInputPower"), ("OPT-IF-MIB", "optIfOTSnSinkCurrentLowInputPower"), ("OPT-IF-MIB", "optIfOTSnSinkCurrentHighInputPower"), ("OPT-IF-MIB", "optIfOTSnSinkCurrentOutputPower"), ("OPT-IF-MIB", "optIfOTSnSinkCurrentLowOutputPower"), ("OPT-IF-MIB", "optIfOTSnSinkCurrentHighOutputPower"), ("OPT-IF-MIB", "optIfOTSnSinkIntervalSuspectedFlag"), ("OPT-IF-MIB", "optIfOTSnSinkIntervalLastInputPower"), ("OPT-IF-MIB", "optIfOTSnSinkIntervalLowInputPower"), ("OPT-IF-MIB", "optIfOTSnSinkIntervalHighInputPower"), ("OPT-IF-MIB", "optIfOTSnSinkIntervalLastOutputPower"), ("OPT-IF-MIB", "optIfOTSnSinkIntervalLowOutputPower"), ("OPT-IF-MIB", "optIfOTSnSinkIntervalHighOutputPower"), ("OPT-IF-MIB", "optIfOTSnSinkCurDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOTSnSinkCurDayLowInputPower"), ("OPT-IF-MIB", "optIfOTSnSinkCurDayHighInputPower"), ("OPT-IF-MIB", "optIfOTSnSinkCurDayLowOutputPower"), ("OPT-IF-MIB", "optIfOTSnSinkCurDayHighOutputPower"), ("OPT-IF-MIB", "optIfOTSnSinkPrevDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOTSnSinkPrevDayLastInputPower"), ("OPT-IF-MIB", "optIfOTSnSinkPrevDayLowInputPower"), ("OPT-IF-MIB", "optIfOTSnSinkPrevDayHighInputPower"), ("OPT-IF-MIB", "optIfOTSnSinkPrevDayLastOutputPower"), ("OPT-IF-MIB", "optIfOTSnSinkPrevDayLowOutputPower"), ("OPT-IF-MIB", "optIfOTSnSinkPrevDayHighOutputPower"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOTSnSinkPreOtnPMGroup = optIfOTSnSinkPreOtnPMGroup.setStatus('current')
optIfOTSnSinkPreOtnPMThresholdGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 10)).setObjects(("OPT-IF-MIB", "optIfOTSnSinkCurrentLowerInputPowerThreshold"), ("OPT-IF-MIB", "optIfOTSnSinkCurrentUpperInputPowerThreshold"), ("OPT-IF-MIB", "optIfOTSnSinkCurrentLowerOutputPowerThreshold"), ("OPT-IF-MIB", "optIfOTSnSinkCurrentUpperOutputPowerThreshold"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOTSnSinkPreOtnPMThresholdGroup = optIfOTSnSinkPreOtnPMThresholdGroup.setStatus('current')
optIfOTSnSourcePreOtnPMGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 11)).setObjects(("OPT-IF-MIB", "optIfOTSnSrcCurrentSuspectedFlag"), ("OPT-IF-MIB", "optIfOTSnSrcCurrentOutputPower"), ("OPT-IF-MIB", "optIfOTSnSrcCurrentLowOutputPower"), ("OPT-IF-MIB", "optIfOTSnSrcCurrentHighOutputPower"), ("OPT-IF-MIB", "optIfOTSnSrcCurrentInputPower"), ("OPT-IF-MIB", "optIfOTSnSrcCurrentLowInputPower"), ("OPT-IF-MIB", "optIfOTSnSrcCurrentHighInputPower"), ("OPT-IF-MIB", "optIfOTSnSrcIntervalSuspectedFlag"), ("OPT-IF-MIB", "optIfOTSnSrcIntervalLastOutputPower"), ("OPT-IF-MIB", "optIfOTSnSrcIntervalLowOutputPower"), ("OPT-IF-MIB", "optIfOTSnSrcIntervalHighOutputPower"), ("OPT-IF-MIB", "optIfOTSnSrcIntervalLastInputPower"), ("OPT-IF-MIB", "optIfOTSnSrcIntervalLowInputPower"), ("OPT-IF-MIB", "optIfOTSnSrcIntervalHighInputPower"), ("OPT-IF-MIB", "optIfOTSnSrcCurDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOTSnSrcCurDayLowOutputPower"), ("OPT-IF-MIB", "optIfOTSnSrcCurDayHighOutputPower"), ("OPT-IF-MIB", "optIfOTSnSrcCurDayLowInputPower"), ("OPT-IF-MIB", "optIfOTSnSrcCurDayHighInputPower"), ("OPT-IF-MIB", "optIfOTSnSrcPrevDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOTSnSrcPrevDayLastOutputPower"), ("OPT-IF-MIB", "optIfOTSnSrcPrevDayLowOutputPower"), ("OPT-IF-MIB", "optIfOTSnSrcPrevDayHighOutputPower"), ("OPT-IF-MIB", "optIfOTSnSrcPrevDayLastInputPower"), ("OPT-IF-MIB", "optIfOTSnSrcPrevDayLowInputPower"), ("OPT-IF-MIB", "optIfOTSnSrcPrevDayHighInputPower"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOTSnSourcePreOtnPMGroup = optIfOTSnSourcePreOtnPMGroup.setStatus('current')
optIfOTSnSourcePreOtnPMThresholdGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 12)).setObjects(("OPT-IF-MIB", "optIfOTSnSrcCurrentLowerOutputPowerThreshold"), ("OPT-IF-MIB", "optIfOTSnSrcCurrentUpperOutputPowerThreshold"), ("OPT-IF-MIB", "optIfOTSnSrcCurrentLowerInputPowerThreshold"), ("OPT-IF-MIB", "optIfOTSnSrcCurrentUpperInputPowerThreshold"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOTSnSourcePreOtnPMThresholdGroup = optIfOTSnSourcePreOtnPMThresholdGroup.setStatus('current')
optIfOMSnCommonGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 13)).setObjects(("OPT-IF-MIB", "optIfOMSnDirectionality"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOMSnCommonGroup = optIfOMSnCommonGroup.setStatus('current')
optIfOMSnSinkGroupBasic = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 14)).setObjects(("OPT-IF-MIB", "optIfOMSnCurrentStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOMSnSinkGroupBasic = optIfOMSnSinkGroupBasic.setStatus('current')
optIfOMSnSinkPreOtnPMGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 15)).setObjects(("OPT-IF-MIB", "optIfOMSnSinkCurrentSuspectedFlag"), ("OPT-IF-MIB", "optIfOMSnSinkCurrentAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSinkCurrentLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSinkCurrentHighAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSinkCurrentOutputPower"), ("OPT-IF-MIB", "optIfOMSnSinkCurrentLowOutputPower"), ("OPT-IF-MIB", "optIfOMSnSinkCurrentHighOutputPower"), ("OPT-IF-MIB", "optIfOMSnSinkIntervalSuspectedFlag"), ("OPT-IF-MIB", "optIfOMSnSinkIntervalLastAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSinkIntervalLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSinkIntervalHighAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSinkIntervalLastOutputPower"), ("OPT-IF-MIB", "optIfOMSnSinkIntervalLowOutputPower"), ("OPT-IF-MIB", "optIfOMSnSinkIntervalHighOutputPower"), ("OPT-IF-MIB", "optIfOMSnSinkCurDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOMSnSinkCurDayLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSinkCurDayHighAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSinkCurDayLowOutputPower"), ("OPT-IF-MIB", "optIfOMSnSinkCurDayHighOutputPower"), ("OPT-IF-MIB", "optIfOMSnSinkPrevDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOMSnSinkPrevDayLastAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSinkPrevDayLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSinkPrevDayHighAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSinkPrevDayLastOutputPower"), ("OPT-IF-MIB", "optIfOMSnSinkPrevDayLowOutputPower"), ("OPT-IF-MIB", "optIfOMSnSinkPrevDayHighOutputPower"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOMSnSinkPreOtnPMGroup = optIfOMSnSinkPreOtnPMGroup.setStatus('current')
optIfOMSnSinkPreOtnPMThresholdGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 16)).setObjects(("OPT-IF-MIB", "optIfOMSnSinkCurrentLowerInputPowerThreshold"), ("OPT-IF-MIB", "optIfOMSnSinkCurrentUpperInputPowerThreshold"), ("OPT-IF-MIB", "optIfOMSnSinkCurrentLowerOutputPowerThreshold"), ("OPT-IF-MIB", "optIfOMSnSinkCurrentUpperOutputPowerThreshold"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOMSnSinkPreOtnPMThresholdGroup = optIfOMSnSinkPreOtnPMThresholdGroup.setStatus('current')
optIfOMSnSourcePreOtnPMGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 17)).setObjects(("OPT-IF-MIB", "optIfOMSnSrcCurrentSuspectedFlag"), ("OPT-IF-MIB", "optIfOMSnSrcCurrentOutputPower"), ("OPT-IF-MIB", "optIfOMSnSrcCurrentLowOutputPower"), ("OPT-IF-MIB", "optIfOMSnSrcCurrentHighOutputPower"), ("OPT-IF-MIB", "optIfOMSnSrcCurrentAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSrcCurrentLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSrcCurrentHighAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSrcIntervalSuspectedFlag"), ("OPT-IF-MIB", "optIfOMSnSrcIntervalLastOutputPower"), ("OPT-IF-MIB", "optIfOMSnSrcIntervalLowOutputPower"), ("OPT-IF-MIB", "optIfOMSnSrcIntervalHighOutputPower"), ("OPT-IF-MIB", "optIfOMSnSrcIntervalLastAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSrcIntervalLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSrcIntervalHighAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSrcCurDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOMSnSrcCurDayLowOutputPower"), ("OPT-IF-MIB", "optIfOMSnSrcCurDayHighOutputPower"), ("OPT-IF-MIB", "optIfOMSnSrcCurDayLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSrcCurDayHighAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSrcPrevDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOMSnSrcPrevDayLastOutputPower"), ("OPT-IF-MIB", "optIfOMSnSrcPrevDayLowOutputPower"), ("OPT-IF-MIB", "optIfOMSnSrcPrevDayHighOutputPower"), ("OPT-IF-MIB", "optIfOMSnSrcPrevDayLastAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSrcPrevDayLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOMSnSrcPrevDayHighAggregatedInputPower"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOMSnSourcePreOtnPMGroup = optIfOMSnSourcePreOtnPMGroup.setStatus('current')
optIfOMSnSourcePreOtnPMThresholdGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 18)).setObjects(("OPT-IF-MIB", "optIfOMSnSrcCurrentLowerOutputPowerThreshold"), ("OPT-IF-MIB", "optIfOMSnSrcCurrentUpperOutputPowerThreshold"), ("OPT-IF-MIB", "optIfOMSnSrcCurrentLowerInputPowerThreshold"), ("OPT-IF-MIB", "optIfOMSnSrcCurrentUpperInputPowerThreshold"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOMSnSourcePreOtnPMThresholdGroup = optIfOMSnSourcePreOtnPMThresholdGroup.setStatus('current')
optIfOChGroupCommonGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 19)).setObjects(("OPT-IF-MIB", "optIfOChGroupDirectionality"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOChGroupCommonGroup = optIfOChGroupCommonGroup.setStatus('current')
optIfOChGroupSinkPreOtnPMGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 20)).setObjects(("OPT-IF-MIB", "optIfOChGroupSinkCurrentSuspectedFlag"), ("OPT-IF-MIB", "optIfOChGroupSinkCurrentAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkCurrentLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkCurrentHighAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkCurrentOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkCurrentLowOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkCurrentHighOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkIntervalSuspectedFlag"), ("OPT-IF-MIB", "optIfOChGroupSinkIntervalLastAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkIntervalLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkIntervalHighAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkIntervalLastOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkIntervalLowOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkIntervalHighOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkCurDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOChGroupSinkCurDayLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkCurDayHighAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkCurDayLowOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkCurDayHighOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkPrevDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOChGroupSinkPrevDayLastAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkPrevDayLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkPrevDayHighAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkPrevDayLastOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkPrevDayLowOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSinkPrevDayHighOutputPower"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOChGroupSinkPreOtnPMGroup = optIfOChGroupSinkPreOtnPMGroup.setStatus('current')
optIfOChGroupSinkPreOtnPMThresholdGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 21)).setObjects(("OPT-IF-MIB", "optIfOChGroupSinkCurrentLowerInputPowerThreshold"), ("OPT-IF-MIB", "optIfOChGroupSinkCurrentUpperInputPowerThreshold"), ("OPT-IF-MIB", "optIfOChGroupSinkCurrentLowerOutputPowerThreshold"), ("OPT-IF-MIB", "optIfOChGroupSinkCurrentUpperOutputPowerThreshold"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOChGroupSinkPreOtnPMThresholdGroup = optIfOChGroupSinkPreOtnPMThresholdGroup.setStatus('current')
optIfOChGroupSourcePreOtnPMGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 22)).setObjects(("OPT-IF-MIB", "optIfOChGroupSrcCurrentSuspectedFlag"), ("OPT-IF-MIB", "optIfOChGroupSrcCurrentOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcCurrentLowOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcCurrentHighOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcCurrentAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcCurrentLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcCurrentHighAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcIntervalSuspectedFlag"), ("OPT-IF-MIB", "optIfOChGroupSrcIntervalLastOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcIntervalLowOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcIntervalHighOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcIntervalLastAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcIntervalLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcIntervalHighAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcCurDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOChGroupSrcCurDayLowOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcCurDayHighOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcCurDayLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcCurDayHighAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcPrevDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOChGroupSrcPrevDayLastOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcPrevDayLowOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcPrevDayHighOutputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcPrevDayLastAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcPrevDayLowAggregatedInputPower"), ("OPT-IF-MIB", "optIfOChGroupSrcPrevDayHighAggregatedInputPower"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOChGroupSourcePreOtnPMGroup = optIfOChGroupSourcePreOtnPMGroup.setStatus('current')
optIfOChGroupSourcePreOtnPMThresholdGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 23)).setObjects(("OPT-IF-MIB", "optIfOChGroupSrcCurrentLowerOutputPowerThreshold"), ("OPT-IF-MIB", "optIfOChGroupSrcCurrentUpperOutputPowerThreshold"), ("OPT-IF-MIB", "optIfOChGroupSrcCurrentLowerInputPowerThreshold"), ("OPT-IF-MIB", "optIfOChGroupSrcCurrentUpperInputPowerThreshold"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOChGroupSourcePreOtnPMThresholdGroup = optIfOChGroupSourcePreOtnPMThresholdGroup.setStatus('current')
optIfOChCommonGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 24)).setObjects(("OPT-IF-MIB", "optIfOChDirectionality"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOChCommonGroup = optIfOChCommonGroup.setStatus('current')
optIfOChSinkGroupBasic = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 25)).setObjects(("OPT-IF-MIB", "optIfOChCurrentStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOChSinkGroupBasic = optIfOChSinkGroupBasic.setStatus('current')
optIfOChSinkPreOtnPMGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 26)).setObjects(("OPT-IF-MIB", "optIfOChSinkCurrentSuspectedFlag"), ("OPT-IF-MIB", "optIfOChSinkCurrentInputPower"), ("OPT-IF-MIB", "optIfOChSinkCurrentLowInputPower"), ("OPT-IF-MIB", "optIfOChSinkCurrentHighInputPower"), ("OPT-IF-MIB", "optIfOChSinkIntervalSuspectedFlag"), ("OPT-IF-MIB", "optIfOChSinkIntervalLastInputPower"), ("OPT-IF-MIB", "optIfOChSinkIntervalLowInputPower"), ("OPT-IF-MIB", "optIfOChSinkIntervalHighInputPower"), ("OPT-IF-MIB", "optIfOChSinkCurDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOChSinkCurDayLowInputPower"), ("OPT-IF-MIB", "optIfOChSinkCurDayHighInputPower"), ("OPT-IF-MIB", "optIfOChSinkPrevDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOChSinkPrevDayLastInputPower"), ("OPT-IF-MIB", "optIfOChSinkPrevDayLowInputPower"), ("OPT-IF-MIB", "optIfOChSinkPrevDayHighInputPower"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOChSinkPreOtnPMGroup = optIfOChSinkPreOtnPMGroup.setStatus('current')
optIfOChSinkPreOtnPMThresholdGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 27)).setObjects(("OPT-IF-MIB", "optIfOChSinkCurrentLowerInputPowerThreshold"), ("OPT-IF-MIB", "optIfOChSinkCurrentUpperInputPowerThreshold"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOChSinkPreOtnPMThresholdGroup = optIfOChSinkPreOtnPMThresholdGroup.setStatus('current')
optIfOChSourcePreOtnPMGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 28)).setObjects(("OPT-IF-MIB", "optIfOChSrcCurrentSuspectedFlag"), ("OPT-IF-MIB", "optIfOChSrcCurrentOutputPower"), ("OPT-IF-MIB", "optIfOChSrcCurrentLowOutputPower"), ("OPT-IF-MIB", "optIfOChSrcCurrentHighOutputPower"), ("OPT-IF-MIB", "optIfOChSrcIntervalSuspectedFlag"), ("OPT-IF-MIB", "optIfOChSrcIntervalLastOutputPower"), ("OPT-IF-MIB", "optIfOChSrcIntervalLowOutputPower"), ("OPT-IF-MIB", "optIfOChSrcIntervalHighOutputPower"), ("OPT-IF-MIB", "optIfOChSrcCurDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOChSrcCurDayLowOutputPower"), ("OPT-IF-MIB", "optIfOChSrcCurDayHighOutputPower"), ("OPT-IF-MIB", "optIfOChSrcPrevDaySuspectedFlag"), ("OPT-IF-MIB", "optIfOChSrcPrevDayLastOutputPower"), ("OPT-IF-MIB", "optIfOChSrcPrevDayLowOutputPower"), ("OPT-IF-MIB", "optIfOChSrcPrevDayHighOutputPower"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOChSourcePreOtnPMGroup = optIfOChSourcePreOtnPMGroup.setStatus('current')
optIfOChSourcePreOtnPMThresholdGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 29)).setObjects(("OPT-IF-MIB", "optIfOChSrcCurrentLowerOutputPowerThreshold"), ("OPT-IF-MIB", "optIfOChSrcCurrentUpperOutputPowerThreshold"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOChSourcePreOtnPMThresholdGroup = optIfOChSourcePreOtnPMThresholdGroup.setStatus('current')
optIfOTUkCommonGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 30)).setObjects(("OPT-IF-MIB", "optIfOTUkDirectionality"), ("OPT-IF-MIB", "optIfOTUkBitRateK"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOTUkCommonGroup = optIfOTUkCommonGroup.setStatus('current')
optIfOTUkSourceGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 31)).setObjects(("OPT-IF-MIB", "optIfOTUkTraceIdentifierTransmitted"), ("OPT-IF-MIB", "optIfOTUkSourceAdaptActive"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOTUkSourceGroup = optIfOTUkSourceGroup.setStatus('current')
optIfOTUkSinkGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 32)).setObjects(("OPT-IF-MIB", "optIfOTUkDAPIExpected"), ("OPT-IF-MIB", "optIfOTUkSAPIExpected"), ("OPT-IF-MIB", "optIfOTUkTraceIdentifierAccepted"), ("OPT-IF-MIB", "optIfOTUkTIMDetMode"), ("OPT-IF-MIB", "optIfOTUkTIMActEnabled"), ("OPT-IF-MIB", "optIfOTUkDEGThr"), ("OPT-IF-MIB", "optIfOTUkDEGM"), ("OPT-IF-MIB", "optIfOTUkSinkAdaptActive"), ("OPT-IF-MIB", "optIfOTUkSinkFECEnabled"), ("OPT-IF-MIB", "optIfOTUkCurrentStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOTUkSinkGroup = optIfOTUkSinkGroup.setStatus('current')
optIfGCC0Group = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 33)).setObjects(("OPT-IF-MIB", "optIfGCC0Application"), ("OPT-IF-MIB", "optIfGCC0RowStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfGCC0Group = optIfGCC0Group.setStatus('current')
optIfODUkGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 34)).setObjects(("OPT-IF-MIB", "optIfODUkDirectionality"), ("OPT-IF-MIB", "optIfODUkBitRateK"), ("OPT-IF-MIB", "optIfODUkTcmFieldsInUse"), ("OPT-IF-MIB", "optIfODUkPositionSeqCurrentSize"), ("OPT-IF-MIB", "optIfODUkPositionSeqPosition"), ("OPT-IF-MIB", "optIfODUkPositionSeqPointer"), ("OPT-IF-MIB", "optIfODUkTtpPresent"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfODUkGroup = optIfODUkGroup.setStatus('current')
optIfODUkTtpSourceGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 35)).setObjects(("OPT-IF-MIB", "optIfODUkTtpTraceIdentifierTransmitted"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfODUkTtpSourceGroup = optIfODUkTtpSourceGroup.setStatus('current')
optIfODUkTtpSinkGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 36)).setObjects(("OPT-IF-MIB", "optIfODUkTtpDAPIExpected"), ("OPT-IF-MIB", "optIfODUkTtpSAPIExpected"), ("OPT-IF-MIB", "optIfODUkTtpTraceIdentifierAccepted"), ("OPT-IF-MIB", "optIfODUkTtpTIMDetMode"), ("OPT-IF-MIB", "optIfODUkTtpTIMActEnabled"), ("OPT-IF-MIB", "optIfODUkTtpDEGThr"), ("OPT-IF-MIB", "optIfODUkTtpDEGM"), ("OPT-IF-MIB", "optIfODUkTtpCurrentStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfODUkTtpSinkGroup = optIfODUkTtpSinkGroup.setStatus('current')
optIfODUkNimGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 37)).setObjects(("OPT-IF-MIB", "optIfODUkNimDAPIExpected"), ("OPT-IF-MIB", "optIfODUkNimSAPIExpected"), ("OPT-IF-MIB", "optIfODUkNimTraceIdentifierAccepted"), ("OPT-IF-MIB", "optIfODUkNimTIMDetMode"), ("OPT-IF-MIB", "optIfODUkNimTIMActEnabled"), ("OPT-IF-MIB", "optIfODUkNimDEGThr"), ("OPT-IF-MIB", "optIfODUkNimDEGM"), ("OPT-IF-MIB", "optIfODUkNimCurrentStatus"), ("OPT-IF-MIB", "optIfODUkNimRowStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfODUkNimGroup = optIfODUkNimGroup.setStatus('current')
optIfGCC12Group = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 38)).setObjects(("OPT-IF-MIB", "optIfGCC12GCCPassThrough"), ("OPT-IF-MIB", "optIfGCC12Application"), ("OPT-IF-MIB", "optIfGCC12RowStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfGCC12Group = optIfGCC12Group.setStatus('current')
optIfODUkTCommonGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 39)).setObjects(("OPT-IF-MIB", "optIfODUkTRowStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfODUkTCommonGroup = optIfODUkTCommonGroup.setStatus('current')
optIfODUkTSourceGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 40)).setObjects(("OPT-IF-MIB", "optIfODUkTTraceIdentifierTransmitted"), ("OPT-IF-MIB", "optIfODUkTSourceLockSignalAdminState"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfODUkTSourceGroup = optIfODUkTSourceGroup.setStatus('current')
optIfODUkTSinkGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 41)).setObjects(("OPT-IF-MIB", "optIfODUkTDAPIExpected"), ("OPT-IF-MIB", "optIfODUkTSAPIExpected"), ("OPT-IF-MIB", "optIfODUkTTraceIdentifierAccepted"), ("OPT-IF-MIB", "optIfODUkTTIMDetMode"), ("OPT-IF-MIB", "optIfODUkTTIMActEnabled"), ("OPT-IF-MIB", "optIfODUkTDEGThr"), ("OPT-IF-MIB", "optIfODUkTDEGM"), ("OPT-IF-MIB", "optIfODUkTCurrentStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfODUkTSinkGroup = optIfODUkTSinkGroup.setStatus('current')
optIfODUkTSinkGroupCtp = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 42)).setObjects(("OPT-IF-MIB", "optIfODUkTSinkMode"), ("OPT-IF-MIB", "optIfODUkTSinkLockSignalAdminState"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfODUkTSinkGroupCtp = optIfODUkTSinkGroupCtp.setStatus('current')
optIfODUkTNimGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 43)).setObjects(("OPT-IF-MIB", "optIfODUkTNimDAPIExpected"), ("OPT-IF-MIB", "optIfODUkTNimSAPIExpected"), ("OPT-IF-MIB", "optIfODUkTNimTraceIdentifierAccepted"), ("OPT-IF-MIB", "optIfODUkTNimTIMDetMode"), ("OPT-IF-MIB", "optIfODUkTNimTIMActEnabled"), ("OPT-IF-MIB", "optIfODUkTNimDEGThr"), ("OPT-IF-MIB", "optIfODUkTNimDEGM"), ("OPT-IF-MIB", "optIfODUkTNimCurrentStatus"), ("OPT-IF-MIB", "optIfODUkTNimRowStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfODUkTNimGroup = optIfODUkTNimGroup.setStatus('current')
optIfOtnConfigCompl = ModuleCompliance((1, 3, 6, 1, 2, 1, 10, 133, 2, 2, 1)).setObjects(("OPT-IF-MIB", "optIfOTMnGroup"), ("OPT-IF-MIB", "optIfOTSnCommonGroup"), ("OPT-IF-MIB", "optIfOTSnSourceGroupFull"), ("OPT-IF-MIB", "optIfOTSnAPRStatusGroup"), ("OPT-IF-MIB", "optIfOTSnAPRControlGroup"), ("OPT-IF-MIB", "optIfOTSnSinkGroupBasic"), ("OPT-IF-MIB", "optIfOTSnSinkGroupFull"), ("OPT-IF-MIB", "optIfOMSnCommonGroup"), ("OPT-IF-MIB", "optIfOMSnSinkGroupBasic"), ("OPT-IF-MIB", "optIfOChGroupCommonGroup"), ("OPT-IF-MIB", "optIfOChCommonGroup"), ("OPT-IF-MIB", "optIfOChSinkGroupBasic"), ("OPT-IF-MIB", "optIfOTUkCommonGroup"), ("OPT-IF-MIB", "optIfOTUkSourceGroup"), ("OPT-IF-MIB", "optIfOTUkSinkGroup"), ("OPT-IF-MIB", "optIfGCC0Group"), ("OPT-IF-MIB", "optIfODUkGroup"), ("OPT-IF-MIB", "optIfODUkTtpSourceGroup"), ("OPT-IF-MIB", "optIfODUkTtpSinkGroup"), ("OPT-IF-MIB", "optIfODUkNimGroup"), ("OPT-IF-MIB", "optIfGCC12Group"), ("OPT-IF-MIB", "optIfODUkTCommonGroup"), ("OPT-IF-MIB", "optIfODUkTSourceGroup"), ("OPT-IF-MIB", "optIfODUkTSinkGroup"), ("OPT-IF-MIB", "optIfODUkTSinkGroupCtp"), ("OPT-IF-MIB", "optIfODUkTNimGroup"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfOtnConfigCompl = optIfOtnConfigCompl.setStatus('current')
optIfPreOtnPMCompl = ModuleCompliance((1, 3, 6, 1, 2, 1, 10, 133, 2, 2, 2)).setObjects(("OPT-IF-MIB", "optIfPerfMonGroup"), ("OPT-IF-MIB", "optIfOTSnSinkPreOtnPMGroup"), ("OPT-IF-MIB", "optIfOTSnSinkPreOtnPMThresholdGroup"), ("OPT-IF-MIB", "optIfOTSnSourcePreOtnPMGroup"), ("OPT-IF-MIB", "optIfOTSnSourcePreOtnPMThresholdGroup"), ("OPT-IF-MIB", "optIfOMSnSinkPreOtnPMGroup"), ("OPT-IF-MIB", "optIfOMSnSinkPreOtnPMThresholdGroup"), ("OPT-IF-MIB", "optIfOMSnSourcePreOtnPMGroup"), ("OPT-IF-MIB", "optIfOMSnSourcePreOtnPMThresholdGroup"), ("OPT-IF-MIB", "optIfOChGroupSinkPreOtnPMGroup"), ("OPT-IF-MIB", "optIfOChGroupSinkPreOtnPMThresholdGroup"), ("OPT-IF-MIB", "optIfOChGroupSourcePreOtnPMGroup"), ("OPT-IF-MIB", "optIfOChGroupSourcePreOtnPMThresholdGroup"), ("OPT-IF-MIB", "optIfOChSinkPreOtnPMGroup"), ("OPT-IF-MIB", "optIfOChSinkPreOtnPMThresholdGroup"), ("OPT-IF-MIB", "optIfOChSourcePreOtnPMGroup"), ("OPT-IF-MIB", "optIfOChSourcePreOtnPMThresholdGroup"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
optIfPreOtnPMCompl = optIfPreOtnPMCompl.setStatus('current')
mibBuilder.exportSymbols("OPT-IF-MIB", optIfOChSinkIntervalHighInputPower=optIfOChSinkIntervalHighInputPower, optIfOChSrcCurrentHighOutputPower=optIfOChSrcCurrentHighOutputPower, optIfOTSnSrcIntervalLowOutputPower=optIfOTSnSrcIntervalLowOutputPower, optIfOTMnInterfaceType=optIfOTMnInterfaceType, optIfOTSnSinkCurrentLowOutputPower=optIfOTSnSinkCurrentLowOutputPower, optIfOMSnSrcCurrentEntry=optIfOMSnSrcCurrentEntry, optIfODUkNimTIMDetMode=optIfODUkNimTIMDetMode, optIfOTSnSinkCurDayEntry=optIfOTSnSinkCurDayEntry, optIfOChSrcCurDayTable=optIfOChSrcCurDayTable, optIfOMSnSinkCurrentHighOutputPower=optIfOMSnSinkCurrentHighOutputPower, optIfOMSnSrcCurDayLowAggregatedInputPower=optIfOMSnSrcCurDayLowAggregatedInputPower, optIfOChSinkCurrentLowInputPower=optIfOChSinkCurrentLowInputPower, optIfOChSinkCurrentLowerInputPowerThreshold=optIfOChSinkCurrentLowerInputPowerThreshold, optIfOTSnSinkIntervalHighInputPower=optIfOTSnSinkIntervalHighInputPower, optIfOTSnSinkPreOtnPMThresholdGroup=optIfOTSnSinkPreOtnPMThresholdGroup, optIfOChSinkCurDayTable=optIfOChSinkCurDayTable, optIfOChGroupSrcPrevDayLastOutputPower=optIfOChGroupSrcPrevDayLastOutputPower, optIfOTSnSinkCurDayHighOutputPower=optIfOTSnSinkCurDayHighOutputPower, optIfOMSnSinkIntervalLastOutputPower=optIfOMSnSinkIntervalLastOutputPower, optIfOChGroupSrcCurrentHighOutputPower=optIfOChGroupSrcCurrentHighOutputPower, optIfOTSnAprStatus=optIfOTSnAprStatus, optIfODUkTTraceIdentifierAccepted=optIfODUkTTraceIdentifierAccepted, optIfOTSnSourceGroupFull=optIfOTSnSourceGroupFull, optIfOChGroupSinkIntervalHighAggregatedInputPower=optIfOChGroupSinkIntervalHighAggregatedInputPower, optIfODUkTSourceLockSignalAdminState=optIfODUkTSourceLockSignalAdminState, optIfOMSnSrcCurrentSuspectedFlag=optIfOMSnSrcCurrentSuspectedFlag, optIfOChGroupSrcIntervalTable=optIfOChGroupSrcIntervalTable, optIfOMSnSinkPrevDayHighOutputPower=optIfOMSnSinkPrevDayHighOutputPower, optIfODUkTCommonGroup=optIfODUkTCommonGroup, optIfOChSinkIntervalEntry=optIfOChSinkIntervalEntry, optIfOTSnSrcPrevDaySuspectedFlag=optIfOTSnSrcPrevDaySuspectedFlag, optIfOMSnSrcCurrentAggregatedInputPower=optIfOMSnSrcCurrentAggregatedInputPower, optIfOTSnSinkCurrentUpperOutputPowerThreshold=optIfOTSnSinkCurrentUpperOutputPowerThreshold, optIfOTSnSinkPrevDaySuspectedFlag=optIfOTSnSinkPrevDaySuspectedFlag, optIfOChGroupSrcCurDayTable=optIfOChGroupSrcCurDayTable, optIfOTSnSinkIntervalSuspectedFlag=optIfOTSnSinkIntervalSuspectedFlag, optIfOChGroupSinkIntervalLastAggregatedInputPower=optIfOChGroupSinkIntervalLastAggregatedInputPower, OptIfTIMDetMode=OptIfTIMDetMode, optIfOChGroupSinkPrevDayTable=optIfOChGroupSinkPrevDayTable, optIfOTUkConfigEntry=optIfOTUkConfigEntry, optIfOTSnSinkCurDayLowOutputPower=optIfOTSnSinkCurDayLowOutputPower, optIfOChGroupSrcCurDaySuspectedFlag=optIfOChGroupSrcCurDaySuspectedFlag, optIfOChSrcPrevDayLowOutputPower=optIfOChSrcPrevDayLowOutputPower, optIfOMSnSinkCurrentHighAggregatedInputPower=optIfOMSnSinkCurrentHighAggregatedInputPower, optIfOtnConfigCompl=optIfOtnConfigCompl, optIfOMSnSrcCurDayHighOutputPower=optIfOMSnSrcCurDayHighOutputPower, optIfOTSnSrcCurrentEntry=optIfOTSnSrcCurrentEntry, optIfOTSnSrcPrevDayLastInputPower=optIfOTSnSrcPrevDayLastInputPower, optIfGCC12ConfigTable=optIfGCC12ConfigTable, optIfOMSnSinkCurrentLowerOutputPowerThreshold=optIfOMSnSinkCurrentLowerOutputPowerThreshold, optIfGCC12GCCAccess=optIfGCC12GCCAccess, optIfGCC0Application=optIfGCC0Application, optIfOMSnSrcCurrentLowAggregatedInputPower=optIfOMSnSrcCurrentLowAggregatedInputPower, optIfOTSnSrcCurDayHighInputPower=optIfOTSnSrcCurDayHighInputPower, optIfODUkTTraceIdentifierTransmitted=optIfODUkTTraceIdentifierTransmitted, optIfPerfMonGroup=optIfPerfMonGroup, optIfOChGroupSinkPrevDayHighAggregatedInputPower=optIfOChGroupSinkPrevDayHighAggregatedInputPower, optIfOTSnSrcPrevDayLastOutputPower=optIfOTSnSrcPrevDayLastOutputPower, optIfOTSnSinkCurrentLowerOutputPowerThreshold=optIfOTSnSinkCurrentLowerOutputPowerThreshold, optIfOMSnSrcCurrentLowerInputPowerThreshold=optIfOMSnSrcCurrentLowerInputPowerThreshold, optIfGroups=optIfGroups, optIfOMSnSrcIntervalHighOutputPower=optIfOMSnSrcIntervalHighOutputPower, optIfOChGroupSinkCurDayLowAggregatedInputPower=optIfOChGroupSinkCurDayLowAggregatedInputPower, optIfODUkPositionSeqPosition=optIfODUkPositionSeqPosition, optIfOMSnSrcCurDayTable=optIfOMSnSrcCurDayTable, OptIfExDAPI=OptIfExDAPI, optIfOTSnSrcPrevDayLowOutputPower=optIfOTSnSrcPrevDayLowOutputPower, optIfGCC12Codirectional=optIfGCC12Codirectional, optIfOChSourcePreOtnPMThresholdGroup=optIfOChSourcePreOtnPMThresholdGroup, optIfGCC12ConfigEntry=optIfGCC12ConfigEntry, optIfODUkTCurrentStatus=optIfODUkTCurrentStatus, optIfOChSrcPrevDayEntry=optIfOChSrcPrevDayEntry, optIfOMSnSrcIntervalLowAggregatedInputPower=optIfOMSnSrcIntervalLowAggregatedInputPower, optIfConfs=optIfConfs, optIfODUkTtpSinkGroup=optIfODUkTtpSinkGroup, optIfGCC0ConfigTable=optIfGCC0ConfigTable, optIfOTUkDEGM=optIfOTUkDEGM, optIfODUkTNimSAPIExpected=optIfODUkTNimSAPIExpected, optIfOMSnSrcPrevDayTable=optIfOMSnSrcPrevDayTable, optIfOChGroupSrcPrevDayHighAggregatedInputPower=optIfOChGroupSrcPrevDayHighAggregatedInputPower, optIfOChGroupCommonGroup=optIfOChGroupCommonGroup, optIfOChGroupSinkIntervalHighOutputPower=optIfOChGroupSinkIntervalHighOutputPower, optIfOTSnSinkPrevDayLastInputPower=optIfOTSnSinkPrevDayLastInputPower, optIfOChGroupSrcCurrentLowerInputPowerThreshold=optIfOChGroupSrcCurrentLowerInputPowerThreshold, optIfOMSnSinkIntervalSuspectedFlag=optIfOMSnSinkIntervalSuspectedFlag, optIfOMSnSrcCurrentTable=optIfOMSnSrcCurrentTable, optIfOTSnSinkPrevDayTable=optIfOTSnSinkPrevDayTable, OptIfSinkOrSource=OptIfSinkOrSource, optIfOChGroupSrcIntervalLastOutputPower=optIfOChGroupSrcIntervalLastOutputPower, optIfODUkTcmFieldsInUse=optIfODUkTcmFieldsInUse, optIfOTSnSrcCurDayTable=optIfOTSnSrcCurDayTable, optIfODUkTNimConfigEntry=optIfODUkTNimConfigEntry, optIfOChSinkCurDayHighInputPower=optIfOChSinkCurDayHighInputPower, optIfOMSnSinkIntervalEntry=optIfOMSnSinkIntervalEntry, optIfODUkTNimDEGThr=optIfODUkTNimDEGThr, optIfOMSnSinkPrevDayLowOutputPower=optIfOMSnSinkPrevDayLowOutputPower, optIfOTSnSinkCurrentOutputPower=optIfOTSnSinkCurrentOutputPower, optIfPerfMonIntervalTable=optIfPerfMonIntervalTable, optIfOMSnSinkIntervalHighOutputPower=optIfOMSnSinkIntervalHighOutputPower, optIfOMSnCurrentStatus=optIfOMSnCurrentStatus, optIfMibModule=optIfMibModule, optIfOChGroupDirectionality=optIfOChGroupDirectionality, optIfODUkTtpConfigEntry=optIfODUkTtpConfigEntry, optIfODUkTtpPresent=optIfODUkTtpPresent, optIfODUkTNimTcmField=optIfODUkTNimTcmField, optIfOChSrcCurDayHighOutputPower=optIfOChSrcCurDayHighOutputPower, optIfOTUkTIMActEnabled=optIfOTUkTIMActEnabled, optIfOChSrcCurrentEntry=optIfOChSrcCurrentEntry, optIfODUkTSourceGroup=optIfODUkTSourceGroup, optIfOMSnSrcCurrentLowOutputPower=optIfOMSnSrcCurrentLowOutputPower, optIfOChSrcCurrentOutputPower=optIfOChSrcCurrentOutputPower, optIfOChGroupSourcePreOtnPMThresholdGroup=optIfOChGroupSourcePreOtnPMThresholdGroup, optIfOMSnSinkPrevDayLowAggregatedInputPower=optIfOMSnSinkPrevDayLowAggregatedInputPower, optIfOMSnSinkCurrentOutputPower=optIfOMSnSinkCurrentOutputPower, optIfOChGroupSrcCurDayLowOutputPower=optIfOChGroupSrcCurDayLowOutputPower, optIfOMSnSrcCurrentHighAggregatedInputPower=optIfOMSnSrcCurrentHighAggregatedInputPower, optIfOTSnAPRControlGroup=optIfOTSnAPRControlGroup, optIfODUkNimDEGM=optIfODUkNimDEGM, optIfOMSnSrcIntervalHighAggregatedInputPower=optIfOMSnSrcIntervalHighAggregatedInputPower, optIfODUkPositionSeqEntry=optIfODUkPositionSeqEntry, optIfODUk=optIfODUk, optIfOChGroupSinkCurrentUpperInputPowerThreshold=optIfOChGroupSinkCurrentUpperInputPowerThreshold, optIfOChGroupSinkCurDayHighOutputPower=optIfOChGroupSinkCurDayHighOutputPower, optIfOChGroupSinkCurrentLowerOutputPowerThreshold=optIfOChGroupSinkCurrentLowerOutputPowerThreshold, optIfOTMnReduced=optIfOTMnReduced, optIfOMSnSinkCurDayHighOutputPower=optIfOMSnSinkCurDayHighOutputPower, optIfOTSnSinkIntervalNumber=optIfOTSnSinkIntervalNumber, optIfOChGroupSourcePreOtnPMGroup=optIfOChGroupSourcePreOtnPMGroup, optIfOTSnAprControl=optIfOTSnAprControl, optIfOChSinkIntervalNumber=optIfOChSinkIntervalNumber, optIfOMSnSinkPrevDayLastAggregatedInputPower=optIfOMSnSinkPrevDayLastAggregatedInputPower, optIfODUkTTIMDetMode=optIfODUkTTIMDetMode, optIfODUkTNimRowStatus=optIfODUkTNimRowStatus, optIfOChSrcIntervalHighOutputPower=optIfOChSrcIntervalHighOutputPower, optIfODUkTNimCurrentStatus=optIfODUkTNimCurrentStatus, optIfODUkTtpSourceGroup=optIfODUkTtpSourceGroup, optIfOTSnSrcIntervalEntry=optIfOTSnSrcIntervalEntry, optIfPerfMonIntervalNumIntervals=optIfPerfMonIntervalNumIntervals, optIfOChSrcCurDaySuspectedFlag=optIfOChSrcCurDaySuspectedFlag, optIfOTUkSinkFECEnabled=optIfOTUkSinkFECEnabled, optIfOTSnSinkCurrentLowerInputPowerThreshold=optIfOTSnSinkCurrentLowerInputPowerThreshold, optIfOChSrcCurrentLowOutputPower=optIfOChSrcCurrentLowOutputPower, optIfOChGroupSrcPrevDayHighOutputPower=optIfOChGroupSrcPrevDayHighOutputPower, OptIfDirectionality=OptIfDirectionality, optIfOMSnSrcCurrentHighOutputPower=optIfOMSnSrcCurrentHighOutputPower, optIfOTSnSourcePreOtnPMGroup=optIfOTSnSourcePreOtnPMGroup, optIfOMSnSinkGroupBasic=optIfOMSnSinkGroupBasic, optIfODUkGroup=optIfODUkGroup, optIfOTSnSrcCurrentUpperOutputPowerThreshold=optIfOTSnSrcCurrentUpperOutputPowerThreshold, optIfOChGroupSinkCurrentUpperOutputPowerThreshold=optIfOChGroupSinkCurrentUpperOutputPowerThreshold, optIfOChGroupSrcCurrentAggregatedInputPower=optIfOChGroupSrcCurrentAggregatedInputPower, optIfOMSnConfigEntry=optIfOMSnConfigEntry, optIfOChSinkIntervalLastInputPower=optIfOChSinkIntervalLastInputPower, optIfOMSnSinkCurrentUpperOutputPowerThreshold=optIfOMSnSinkCurrentUpperOutputPowerThreshold, optIfOTUkBitRateK=optIfOTUkBitRateK, optIfOChGroupSrcIntervalLowOutputPower=optIfOChGroupSrcIntervalLowOutputPower, OptIfIntervalNumber=OptIfIntervalNumber, optIfOChSinkCurrentSuspectedFlag=optIfOChSinkCurrentSuspectedFlag, optIfOChGroupSrcIntervalHighOutputPower=optIfOChGroupSrcIntervalHighOutputPower, optIfODUkPositionSeqPointer=optIfODUkPositionSeqPointer, optIfODUkTNimTIMDetMode=optIfODUkTNimTIMDetMode, optIfOChGroupSinkPrevDayLowAggregatedInputPower=optIfOChGroupSinkPrevDayLowAggregatedInputPower, optIfOTUkDEGThr=optIfOTUkDEGThr, optIfObjects=optIfObjects, optIfOTSnCurrentStatus=optIfOTSnCurrentStatus, optIfOChSrcIntervalTable=optIfOChSrcIntervalTable, optIfOChCurrentStatus=optIfOChCurrentStatus, optIfOChSinkCurDayEntry=optIfOChSinkCurDayEntry, optIfOChSinkPreOtnPMThresholdGroup=optIfOChSinkPreOtnPMThresholdGroup, optIfOTSnSrcCurDaySuspectedFlag=optIfOTSnSrcCurDaySuspectedFlag, optIfOMSnSinkCurrentEntry=optIfOMSnSinkCurrentEntry, optIfOChDirectionality=optIfOChDirectionality, optIfODUkTtpTIMActEnabled=optIfODUkTtpTIMActEnabled, optIfOChSrcCurDayLowOutputPower=optIfOChSrcCurDayLowOutputPower, optIfOChGroupSinkIntervalLastOutputPower=optIfOChGroupSinkIntervalLastOutputPower, optIfOChGroupSinkIntervalLowOutputPower=optIfOChGroupSinkIntervalLowOutputPower, optIfOTSnSinkGroupFull=optIfOTSnSinkGroupFull, optIfOTSnSrcCurrentHighInputPower=optIfOTSnSrcCurrentHighInputPower, optIfOChGroupSrcIntervalLastAggregatedInputPower=optIfOChGroupSrcIntervalLastAggregatedInputPower, optIfOMSnCommonGroup=optIfOMSnCommonGroup, optIfOMSnSinkPrevDayTable=optIfOMSnSinkPrevDayTable, optIfOChGroupSinkPrevDayLastOutputPower=optIfOChGroupSinkPrevDayLastOutputPower, optIfOChSinkPrevDaySuspectedFlag=optIfOChSinkPrevDaySuspectedFlag, optIfGCC0ConfigEntry=optIfGCC0ConfigEntry, optIfODUkTtpDEGThr=optIfODUkTtpDEGThr, optIfODUkTCodirectional=optIfODUkTCodirectional, optIfOChSinkIntervalTable=optIfOChSinkIntervalTable, optIfPreOtnPMCompl=optIfPreOtnPMCompl, optIfOTUkTIMDetMode=optIfOTUkTIMDetMode, optIfOTUkSourceGroup=optIfOTUkSourceGroup, optIfOChGroupSinkCurrentTable=optIfOChGroupSinkCurrentTable, optIfOChGroupSinkIntervalEntry=optIfOChGroupSinkIntervalEntry, optIfOChSinkCurrentEntry=optIfOChSinkCurrentEntry, optIfOTSnSrcIntervalNumber=optIfOTSnSrcIntervalNumber, optIfOTSnSrcCurDayLowInputPower=optIfOTSnSrcCurDayLowInputPower, optIfOMSnSinkCurDaySuspectedFlag=optIfOMSnSinkCurDaySuspectedFlag, optIfOTSnSrcPrevDayTable=optIfOTSnSrcPrevDayTable, optIfOMSn=optIfOMSn, optIfOTUk=optIfOTUk, optIfOChGroupSrcCurDayEntry=optIfOChGroupSrcCurDayEntry, optIfOTSnDirectionality=optIfOTSnDirectionality, optIfOTSnDAPIExpected=optIfOTSnDAPIExpected, optIfOMSnSrcCurDaySuspectedFlag=optIfOMSnSrcCurDaySuspectedFlag, optIfOTUkConfigTable=optIfOTUkConfigTable, optIfOChGroupSrcIntervalNumber=optIfOChGroupSrcIntervalNumber, optIfOTSnSrcCurrentInputPower=optIfOTSnSrcCurrentInputPower, optIfOMSnDirectionality=optIfOMSnDirectionality, optIfOChGroupSinkIntervalNumber=optIfOChGroupSinkIntervalNumber, optIfOChGroupSinkCurDaySuspectedFlag=optIfOChGroupSinkCurDaySuspectedFlag, optIfOChGroup=optIfOChGroup, optIfOTSnSinkCurrentHighOutputPower=optIfOTSnSinkCurrentHighOutputPower, optIfODUkPositionSeqTable=optIfODUkPositionSeqTable, optIfOMSnSinkIntervalTable=optIfOMSnSinkIntervalTable, optIfOChGroupSrcPrevDayLastAggregatedInputPower=optIfOChGroupSrcPrevDayLastAggregatedInputPower, optIfOChSrcIntervalLastOutputPower=optIfOChSrcIntervalLastOutputPower, optIfCompl=optIfCompl, optIfOMSnSrcPrevDayLastAggregatedInputPower=optIfOMSnSrcPrevDayLastAggregatedInputPower, optIfOChGroupSinkCurrentOutputPower=optIfOChGroupSinkCurrentOutputPower, optIfOMSnSinkIntervalLowOutputPower=optIfOMSnSinkIntervalLowOutputPower, optIfOMSnSinkCurrentUpperInputPowerThreshold=optIfOMSnSinkCurrentUpperInputPowerThreshold, optIfPerfMonIntervalNumInvalidIntervals=optIfPerfMonIntervalNumInvalidIntervals, optIfOChSrcCurrentSuspectedFlag=optIfOChSrcCurrentSuspectedFlag, optIfOMSnSinkPrevDayLastOutputPower=optIfOMSnSinkPrevDayLastOutputPower, optIfOChSinkPrevDayLastInputPower=optIfOChSinkPrevDayLastInputPower, optIfODUkNimCurrentStatus=optIfODUkNimCurrentStatus, optIfOTSnSrcIntervalTable=optIfOTSnSrcIntervalTable, optIfOMSnSinkCurrentSuspectedFlag=optIfOMSnSinkCurrentSuspectedFlag, optIfOChGroupSrcCurrentLowerOutputPowerThreshold=optIfOChGroupSrcCurrentLowerOutputPowerThreshold, optIfODUkNimRowStatus=optIfODUkNimRowStatus, optIfOChSrcPrevDayLastOutputPower=optIfOChSrcPrevDayLastOutputPower, optIfOChGroupSrcCurrentHighAggregatedInputPower=optIfOChGroupSrcCurrentHighAggregatedInputPower, optIfODUkTNimDirectionality=optIfODUkTNimDirectionality, optIfOTSnSinkCurrentInputPower=optIfOTSnSinkCurrentInputPower, optIfOTUkCommonGroup=optIfOTUkCommonGroup, optIfOTSnSrcIntervalLastInputPower=optIfOTSnSrcIntervalLastInputPower, optIfOChSrcCurrentLowerOutputPowerThreshold=optIfOChSrcCurrentLowerOutputPowerThreshold, optIfOChSinkIntervalSuspectedFlag=optIfOChSinkIntervalSuspectedFlag, optIfODUkTtpDAPIExpected=optIfODUkTtpDAPIExpected, optIfOTMnTcmMax=optIfOTMnTcmMax, optIfOChGroupSrcIntervalLowAggregatedInputPower=optIfOChGroupSrcIntervalLowAggregatedInputPower, optIfODUkNimConfigTable=optIfODUkNimConfigTable, optIfOTUkSinkGroup=optIfOTUkSinkGroup, optIfODUkTDEGThr=optIfODUkTDEGThr, optIfOTUkSourceAdaptActive=optIfOTUkSourceAdaptActive, optIfOTSnConfigEntry=optIfOTSnConfigEntry, optIfODUkNimSAPIExpected=optIfODUkNimSAPIExpected, optIfODUkTNimDEGM=optIfODUkTNimDEGM, optIfOTSnSourcePreOtnPMThresholdGroup=optIfOTSnSourcePreOtnPMThresholdGroup, optIfOChSrcPrevDayHighOutputPower=optIfOChSrcPrevDayHighOutputPower, optIfOTUkTraceIdentifierAccepted=optIfOTUkTraceIdentifierAccepted, optIfOMSnSrcPrevDayLowOutputPower=optIfOMSnSrcPrevDayLowOutputPower, optIfODUkTNimTraceIdentifierAccepted=optIfODUkTNimTraceIdentifierAccepted, optIfODUkTtpConfigTable=optIfODUkTtpConfigTable, optIfOChGroupSrcCurrentSuspectedFlag=optIfOChGroupSrcCurrentSuspectedFlag)
mibBuilder.exportSymbols("OPT-IF-MIB", optIfOTSnSinkCurrentLowInputPower=optIfOTSnSinkCurrentLowInputPower, optIfOTUkTraceIdentifierTransmitted=optIfOTUkTraceIdentifierTransmitted, optIfOChGroupSinkCurrentLowAggregatedInputPower=optIfOChGroupSinkCurrentLowAggregatedInputPower, optIfOChSrcPrevDayTable=optIfOChSrcPrevDayTable, optIfOTSnTraceIdentifierTransmitted=optIfOTSnTraceIdentifierTransmitted, optIfGCC0Group=optIfGCC0Group, OptIfTxTI=OptIfTxTI, optIfOChGroupSrcIntervalEntry=optIfOChGroupSrcIntervalEntry, optIfOTSnSinkPrevDayLowInputPower=optIfOTSnSinkPrevDayLowInputPower, optIfODUkBitRateK=optIfODUkBitRateK, optIfOChSinkIntervalLowInputPower=optIfOChSinkIntervalLowInputPower, optIfODUkTSinkGroup=optIfODUkTSinkGroup, optIfOTMnBitRates=optIfOTMnBitRates, optIfODUkNimDAPIExpected=optIfODUkNimDAPIExpected, optIfOChSourcePreOtnPMGroup=optIfOChSourcePreOtnPMGroup, optIfOTSnSrcPrevDayHighInputPower=optIfOTSnSrcPrevDayHighInputPower, optIfOMSnSinkIntervalNumber=optIfOMSnSinkIntervalNumber, optIfOChGroupSrcPrevDayTable=optIfOChGroupSrcPrevDayTable, optIfOChSinkPreOtnPMGroup=optIfOChSinkPreOtnPMGroup, optIfOMSnSinkIntervalHighAggregatedInputPower=optIfOMSnSinkIntervalHighAggregatedInputPower, optIfPerfMonCurDayTimeElapsed=optIfPerfMonCurDayTimeElapsed, optIfOTSnSinkCurDaySuspectedFlag=optIfOTSnSinkCurDaySuspectedFlag, optIfODUkTSinkLockSignalAdminState=optIfODUkTSinkLockSignalAdminState, optIfOChSrcCurrentTable=optIfOChSrcCurrentTable, optIfOChSrcIntervalSuspectedFlag=optIfOChSrcIntervalSuspectedFlag, optIfOTSnSinkIntervalLowOutputPower=optIfOTSnSinkIntervalLowOutputPower, optIfODUkTSinkGroupCtp=optIfODUkTSinkGroupCtp, optIfOTSn=optIfOTSn, optIfOMSnSrcCurDayHighAggregatedInputPower=optIfOMSnSrcCurDayHighAggregatedInputPower, optIfOChSinkGroupBasic=optIfOChSinkGroupBasic, optIfOTSnSinkCurrentUpperInputPowerThreshold=optIfOTSnSinkCurrentUpperInputPowerThreshold, optIfOMSnSrcPrevDayEntry=optIfOMSnSrcPrevDayEntry, optIfOChGroupSinkPrevDayEntry=optIfOChGroupSinkPrevDayEntry, optIfODUkTSAPIExpected=optIfODUkTSAPIExpected, optIfOChGroupSinkCurrentLowerInputPowerThreshold=optIfOChGroupSinkCurrentLowerInputPowerThreshold, optIfOChGroupSinkIntervalTable=optIfOChGroupSinkIntervalTable, optIfOMSnSrcIntervalLowOutputPower=optIfOMSnSrcIntervalLowOutputPower, optIfOTSnConfigTable=optIfOTSnConfigTable, optIfOChGroupSrcCurrentOutputPower=optIfOChGroupSrcCurrentOutputPower, optIfOTSnSrcIntervalLastOutputPower=optIfOTSnSrcIntervalLastOutputPower, optIfOTSnSinkCurrentTable=optIfOTSnSinkCurrentTable, optIfOMSnSinkCurDayTable=optIfOMSnSinkCurDayTable, optIfOChGroupSinkPreOtnPMThresholdGroup=optIfOChGroupSinkPreOtnPMThresholdGroup, optIfOTMnOrder=optIfOTMnOrder, optIfOChSrcCurDayEntry=optIfOChSrcCurDayEntry, optIfOChGroupSinkCurDayEntry=optIfOChGroupSinkCurDayEntry, optIfOChGroupSrcCurrentUpperInputPowerThreshold=optIfOChGroupSrcCurrentUpperInputPowerThreshold, optIfPerfMonCurrentTimeElapsed=optIfPerfMonCurrentTimeElapsed, optIfOTSnSrcCurDayHighOutputPower=optIfOTSnSrcCurDayHighOutputPower, optIfOChSrcIntervalNumber=optIfOChSrcIntervalNumber, optIfGCC12Application=optIfGCC12Application, optIfOTSnSinkCurrentSuspectedFlag=optIfOTSnSinkCurrentSuspectedFlag, optIfOTUkCurrentStatus=optIfOTUkCurrentStatus, optIfOTSnSinkIntervalEntry=optIfOTSnSinkIntervalEntry, optIfOChGroupSrcCurDayHighAggregatedInputPower=optIfOChGroupSrcCurDayHighAggregatedInputPower, optIfOTSnSrcCurDayEntry=optIfOTSnSrcCurDayEntry, optIfOMSnSrcIntervalEntry=optIfOMSnSrcIntervalEntry, optIfOMSnConfigTable=optIfOMSnConfigTable, optIfOTSnSrcPrevDayEntry=optIfOTSnSrcPrevDayEntry, optIfOTSnSinkPrevDayLowOutputPower=optIfOTSnSinkPrevDayLowOutputPower, optIfODUkTtpTIMDetMode=optIfODUkTtpTIMDetMode, optIfOTSnSinkPrevDayHighOutputPower=optIfOTSnSinkPrevDayHighOutputPower, optIfOTSnSinkCurrentHighInputPower=optIfOTSnSinkCurrentHighInputPower, optIfODUkTDEGM=optIfODUkTDEGM, optIfOTSnSinkPreOtnPMGroup=optIfOTSnSinkPreOtnPMGroup, optIfOChGroupSinkPrevDayHighOutputPower=optIfOChGroupSinkPrevDayHighOutputPower, optIfGCC12RowStatus=optIfGCC12RowStatus, optIfODUkT=optIfODUkT, optIfOTSnSAPIExpected=optIfOTSnSAPIExpected, optIfOChSrcPrevDaySuspectedFlag=optIfOChSrcPrevDaySuspectedFlag, optIfOChSinkPrevDayHighInputPower=optIfOChSinkPrevDayHighInputPower, optIfOTSnSrcIntervalHighOutputPower=optIfOTSnSrcIntervalHighOutputPower, optIfOMSnSinkCurDayHighAggregatedInputPower=optIfOMSnSinkCurDayHighAggregatedInputPower, optIfOChGroupSrcCurrentUpperOutputPowerThreshold=optIfOChGroupSrcCurrentUpperOutputPowerThreshold, optIfOMSnSrcCurDayEntry=optIfOMSnSrcCurDayEntry, optIfOChGroupSinkIntervalSuspectedFlag=optIfOChGroupSinkIntervalSuspectedFlag, optIfOTUkDirectionality=optIfOTUkDirectionality, optIfOTSnSrcPrevDayLowInputPower=optIfOTSnSrcPrevDayLowInputPower, optIfOChGroupSrcCurrentTable=optIfOChGroupSrcCurrentTable, optIfODUkNimConfigEntry=optIfODUkNimConfigEntry, optIfOChGroupSinkCurrentAggregatedInputPower=optIfOChGroupSinkCurrentAggregatedInputPower, optIfODUkTtpTraceIdentifierTransmitted=optIfODUkTtpTraceIdentifierTransmitted, optIfOTMnEntry=optIfOTMnEntry, optIfODUkPositionSeqIndex=optIfODUkPositionSeqIndex, optIfOChGroupSrcPrevDaySuspectedFlag=optIfOChGroupSrcPrevDaySuspectedFlag, optIfOChGroupSrcPrevDayLowAggregatedInputPower=optIfOChGroupSrcPrevDayLowAggregatedInputPower, optIfODUkNimTIMActEnabled=optIfODUkNimTIMActEnabled, optIfOChSrcIntervalEntry=optIfOChSrcIntervalEntry, optIfOMSnSourcePreOtnPMThresholdGroup=optIfOMSnSourcePreOtnPMThresholdGroup, optIfOTSnSrcCurrentLowInputPower=optIfOTSnSrcCurrentLowInputPower, optIfOTSnSinkCurDayTable=optIfOTSnSinkCurDayTable, optIfODUkNimDEGThr=optIfODUkNimDEGThr, optIfODUkTTIMActEnabled=optIfODUkTTIMActEnabled, optIfODUkTRowStatus=optIfODUkTRowStatus, optIfOTSnTraceIdentifierAccepted=optIfOTSnTraceIdentifierAccepted, optIfODUkTSinkMode=optIfODUkTSinkMode, optIfOChGroupSrcCurrentEntry=optIfOChGroupSrcCurrentEntry, optIfOTSnTIMDetMode=optIfOTSnTIMDetMode, optIfOMSnSrcCurDayLowOutputPower=optIfOMSnSrcCurDayLowOutputPower, optIfOMSnSrcPrevDayHighOutputPower=optIfOMSnSrcPrevDayHighOutputPower, optIfOTMnGroup=optIfOTMnGroup, optIfODUkTConfigTable=optIfODUkTConfigTable, optIfOTSnSinkIntervalLastOutputPower=optIfOTSnSinkIntervalLastOutputPower, optIfOChGroupSinkPreOtnPMGroup=optIfOChGroupSinkPreOtnPMGroup, optIfGCC0RowStatus=optIfGCC0RowStatus, OptIfExSAPI=OptIfExSAPI, optIfOTSnSinkCurDayHighInputPower=optIfOTSnSinkCurDayHighInputPower, optIfOTSnSrcCurrentLowerOutputPowerThreshold=optIfOTSnSrcCurrentLowerOutputPowerThreshold, optIfOChConfigEntry=optIfOChConfigEntry, optIfOMSnSrcCurrentLowerOutputPowerThreshold=optIfOMSnSrcCurrentLowerOutputPowerThreshold, optIfOTSnSinkCurrentEntry=optIfOTSnSinkCurrentEntry, optIfOTSnSrcCurrentHighOutputPower=optIfOTSnSrcCurrentHighOutputPower, optIfODUkTtpSAPIExpected=optIfODUkTtpSAPIExpected, optIfOTSnSinkIntervalHighOutputPower=optIfOTSnSinkIntervalHighOutputPower, optIfOTSnSrcCurrentLowOutputPower=optIfOTSnSrcCurrentLowOutputPower, optIfODUkTNimConfigTable=optIfODUkTNimConfigTable, optIfOMSnSinkCurrentTable=optIfOMSnSinkCurrentTable, optIfOChGroupSinkCurDayHighAggregatedInputPower=optIfOChGroupSinkCurDayHighAggregatedInputPower, optIfOTMnOpticalReach=optIfOTMnOpticalReach, optIfOChGroupSinkCurrentEntry=optIfOChGroupSinkCurrentEntry, optIfOMSnSinkPrevDaySuspectedFlag=optIfOMSnSinkPrevDaySuspectedFlag, optIfOMSnSinkPreOtnPMGroup=optIfOMSnSinkPreOtnPMGroup, optIfOChGroupSrcCurrentLowAggregatedInputPower=optIfOChGroupSrcCurrentLowAggregatedInputPower, optIfOTSnSinkPrevDayLastOutputPower=optIfOTSnSinkPrevDayLastOutputPower, optIfOChSinkPrevDayLowInputPower=optIfOChSinkPrevDayLowInputPower, optIfOMSnSinkIntervalLastAggregatedInputPower=optIfOMSnSinkIntervalLastAggregatedInputPower, OptIfDEGM=OptIfDEGM, optIfOMSnSinkCurDayLowAggregatedInputPower=optIfOMSnSinkCurDayLowAggregatedInputPower, optIfOMSnSrcPrevDayLowAggregatedInputPower=optIfOMSnSrcPrevDayLowAggregatedInputPower, optIfOTUkSinkAdaptActive=optIfOTUkSinkAdaptActive, optIfOTSnSinkGroupBasic=optIfOTSnSinkGroupBasic, optIfOChSinkCurrentInputPower=optIfOChSinkCurrentInputPower, optIfOChConfigTable=optIfOChConfigTable, optIfOTSnSrcCurrentSuspectedFlag=optIfOTSnSrcCurrentSuspectedFlag, optIfOTSnSinkIntervalLowInputPower=optIfOTSnSinkIntervalLowInputPower, optIfOMSnSrcCurrentUpperInputPowerThreshold=optIfOMSnSrcCurrentUpperInputPowerThreshold, optIfOChGroupConfigTable=optIfOChGroupConfigTable, optIfOChSinkPrevDayEntry=optIfOChSinkPrevDayEntry, optIfOChGroupSinkPrevDaySuspectedFlag=optIfOChGroupSinkPrevDaySuspectedFlag, optIfOChSinkPrevDayTable=optIfOChSinkPrevDayTable, optIfOMSnSinkPrevDayHighAggregatedInputPower=optIfOMSnSinkPrevDayHighAggregatedInputPower, optIfGCC12GCCPassThrough=optIfGCC12GCCPassThrough, optIfOChGroupSrcCurDayLowAggregatedInputPower=optIfOChGroupSrcCurDayLowAggregatedInputPower, optIfOTSnSrcPrevDayHighOutputPower=optIfOTSnSrcPrevDayHighOutputPower, optIfOMSnSrcIntervalTable=optIfOMSnSrcIntervalTable, optIfOTSnSinkPrevDayEntry=optIfOTSnSinkPrevDayEntry, optIfOChGroupConfigEntry=optIfOChGroupConfigEntry, optIfPerfMon=optIfPerfMon, optIfODUkConfigTable=optIfODUkConfigTable, optIfODUkTtpDEGM=optIfODUkTtpDEGM, optIfOTSnSrcCurrentLowerInputPowerThreshold=optIfOTSnSrcCurrentLowerInputPowerThreshold, optIfOTSnSinkPrevDayHighInputPower=optIfOTSnSinkPrevDayHighInputPower, optIfOMSnSinkCurDayLowOutputPower=optIfOMSnSinkCurDayLowOutputPower, OptIfAcTI=OptIfAcTI, optIfOChGroupSinkPrevDayLastAggregatedInputPower=optIfOChGroupSinkPrevDayLastAggregatedInputPower, optIfOTSnSinkIntervalLastInputPower=optIfOTSnSinkIntervalLastInputPower, optIfODUkTtpCurrentStatus=optIfODUkTtpCurrentStatus, optIfOTMn=optIfOTMn, optIfOTSnSrcIntervalHighInputPower=optIfOTSnSrcIntervalHighInputPower, optIfOChGroupSrcPrevDayEntry=optIfOChGroupSrcPrevDayEntry, optIfOTSnSrcCurrentTable=optIfOTSnSrcCurrentTable, optIfPerfMonIntervalEntry=optIfPerfMonIntervalEntry, optIfOChGroupSinkCurrentLowOutputPower=optIfOChGroupSinkCurrentLowOutputPower, optIfOChGroupSinkPrevDayLowOutputPower=optIfOChGroupSinkPrevDayLowOutputPower, optIfOMSnSinkIntervalLowAggregatedInputPower=optIfOMSnSinkIntervalLowAggregatedInputPower, optIfODUkConfigEntry=optIfODUkConfigEntry, optIfOMSnSinkPreOtnPMThresholdGroup=optIfOMSnSinkPreOtnPMThresholdGroup, PYSNMP_MODULE_ID=optIfMibModule, optIfOChGroupSrcCurrentLowOutputPower=optIfOChGroupSrcCurrentLowOutputPower, optIfOMSnSinkCurrentLowerInputPowerThreshold=optIfOMSnSinkCurrentLowerInputPowerThreshold, optIfOMSnSrcIntervalNumber=optIfOMSnSrcIntervalNumber, optIfOChGroupSinkCurrentSuspectedFlag=optIfOChGroupSinkCurrentSuspectedFlag, optIfOChSinkCurDayLowInputPower=optIfOChSinkCurDayLowInputPower, optIfODUkNimTraceIdentifierAccepted=optIfODUkNimTraceIdentifierAccepted, optIfOChGroupSinkCurDayTable=optIfOChGroupSinkCurDayTable, optIfODUkNimGroup=optIfODUkNimGroup, optIfOMSnSrcPrevDayLastOutputPower=optIfOMSnSrcPrevDayLastOutputPower, optIfOChGroupSrcIntervalHighAggregatedInputPower=optIfOChGroupSrcIntervalHighAggregatedInputPower, optIfOChGroupSinkCurrentHighAggregatedInputPower=optIfOChGroupSinkCurrentHighAggregatedInputPower, optIfOTSnSrcCurrentUpperInputPowerThreshold=optIfOTSnSrcCurrentUpperInputPowerThreshold, optIfOMSnSinkCurDayEntry=optIfOMSnSinkCurDayEntry, optIfOChSrcIntervalLowOutputPower=optIfOChSrcIntervalLowOutputPower, OptIfBitRateK=OptIfBitRateK, optIfOChGroupSrcIntervalSuspectedFlag=optIfOChGroupSrcIntervalSuspectedFlag, optIfODUkDirectionality=optIfODUkDirectionality, optIfOTSnSrcCurDayLowOutputPower=optIfOTSnSrcCurDayLowOutputPower, optIfODUkTNimGroup=optIfODUkTNimGroup, optIfOMSnSrcCurrentOutputPower=optIfOMSnSrcCurrentOutputPower, optIfOTSnTIMActEnabled=optIfOTSnTIMActEnabled, optIfOTSnSinkIntervalTable=optIfOTSnSinkIntervalTable, optIfOTSnCommonGroup=optIfOTSnCommonGroup, optIfOTSnSrcIntervalSuspectedFlag=optIfOTSnSrcIntervalSuspectedFlag, optIfOTSnSrcIntervalLowInputPower=optIfOTSnSrcIntervalLowInputPower, optIfOMSnSrcIntervalLastOutputPower=optIfOMSnSrcIntervalLastOutputPower, optIfOChSrcCurrentUpperOutputPowerThreshold=optIfOChSrcCurrentUpperOutputPowerThreshold, optIfOMSnSrcPrevDaySuspectedFlag=optIfOMSnSrcPrevDaySuspectedFlag, optIfOMSnSinkCurrentLowAggregatedInputPower=optIfOMSnSinkCurrentLowAggregatedInputPower, optIfOTUkDAPIExpected=optIfOTUkDAPIExpected, optIfODUkTConfigEntry=optIfODUkTConfigEntry, optIfOChCommonGroup=optIfOChCommonGroup, optIfOTUkSAPIExpected=optIfOTUkSAPIExpected, optIfODUkTDAPIExpected=optIfODUkTDAPIExpected, optIfOTSnSrcCurrentOutputPower=optIfOTSnSrcCurrentOutputPower, optIfOChSinkCurrentHighInputPower=optIfOChSinkCurrentHighInputPower, optIfOMSnSinkPrevDayEntry=optIfOMSnSinkPrevDayEntry, optIfOCh=optIfOCh, optIfOTMnTable=optIfOTMnTable, optIfOTSnSinkCurDayLowInputPower=optIfOTSnSinkCurDayLowInputPower, optIfOMSnSinkCurrentLowOutputPower=optIfOMSnSinkCurrentLowOutputPower, optIfOChSinkCurDaySuspectedFlag=optIfOChSinkCurDaySuspectedFlag, optIfODUkTNimDAPIExpected=optIfODUkTNimDAPIExpected, optIfOTSnAPRStatusGroup=optIfOTSnAPRStatusGroup, OptIfDEGThr=OptIfDEGThr, optIfOChGroupSrcCurDayHighOutputPower=optIfOChGroupSrcCurDayHighOutputPower, optIfOChGroupSrcPrevDayLowOutputPower=optIfOChGroupSrcPrevDayLowOutputPower, optIfGCC0Directionality=optIfGCC0Directionality, optIfODUkNimDirectionality=optIfODUkNimDirectionality, optIfOChGroupSinkCurDayLowOutputPower=optIfOChGroupSinkCurDayLowOutputPower, optIfOChGroupSinkCurrentHighOutputPower=optIfOChGroupSinkCurrentHighOutputPower, optIfODUkPositionSeqCurrentSize=optIfODUkPositionSeqCurrentSize, optIfOChGroupSinkIntervalLowAggregatedInputPower=optIfOChGroupSinkIntervalLowAggregatedInputPower, optIfODUkTNimTIMActEnabled=optIfODUkTNimTIMActEnabled, optIfGCC12Group=optIfGCC12Group, optIfOChSinkCurrentUpperInputPowerThreshold=optIfOChSinkCurrentUpperInputPowerThreshold, optIfODUkTTcmField=optIfODUkTTcmField, optIfOMSnSrcPrevDayHighAggregatedInputPower=optIfOMSnSrcPrevDayHighAggregatedInputPower, optIfOMSnSrcIntervalSuspectedFlag=optIfOMSnSrcIntervalSuspectedFlag, optIfOChSinkCurrentTable=optIfOChSinkCurrentTable, optIfOMSnSrcCurrentUpperOutputPowerThreshold=optIfOMSnSrcCurrentUpperOutputPowerThreshold, optIfOMSnSourcePreOtnPMGroup=optIfOMSnSourcePreOtnPMGroup, optIfOMSnSinkCurrentAggregatedInputPower=optIfOMSnSinkCurrentAggregatedInputPower, optIfODUkTtpTraceIdentifierAccepted=optIfODUkTtpTraceIdentifierAccepted, optIfOMSnSrcIntervalLastAggregatedInputPower=optIfOMSnSrcIntervalLastAggregatedInputPower)
| (object_identifier, integer, octet_string) = mibBuilder.importSymbols('ASN1', 'ObjectIdentifier', 'Integer', 'OctetString')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(value_range_constraint, constraints_intersection, value_size_constraint, single_value_constraint, constraints_union) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ValueRangeConstraint', 'ConstraintsIntersection', 'ValueSizeConstraint', 'SingleValueConstraint', 'ConstraintsUnion')
(if_index,) = mibBuilder.importSymbols('IF-MIB', 'ifIndex')
(snmp_admin_string,) = mibBuilder.importSymbols('SNMP-FRAMEWORK-MIB', 'SnmpAdminString')
(module_compliance, object_group, notification_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'ObjectGroup', 'NotificationGroup')
(integer32, bits, counter64, mib_identifier, mib_scalar, mib_table, mib_table_row, mib_table_column, time_ticks, gauge32, iso, unsigned32, module_identity, counter32, object_identity, transmission, ip_address, notification_type) = mibBuilder.importSymbols('SNMPv2-SMI', 'Integer32', 'Bits', 'Counter64', 'MibIdentifier', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'TimeTicks', 'Gauge32', 'iso', 'Unsigned32', 'ModuleIdentity', 'Counter32', 'ObjectIdentity', 'transmission', 'IpAddress', 'NotificationType')
(display_string, truth_value, textual_convention, row_pointer, row_status) = mibBuilder.importSymbols('SNMPv2-TC', 'DisplayString', 'TruthValue', 'TextualConvention', 'RowPointer', 'RowStatus')
opt_if_mib_module = module_identity((1, 3, 6, 1, 2, 1, 10, 133))
optIfMibModule.setRevisions(('2003-08-13 00:00',))
if mibBuilder.loadTexts:
optIfMibModule.setLastUpdated('200308130000Z')
if mibBuilder.loadTexts:
optIfMibModule.setOrganization('IETF AToM MIB Working Group')
class Optifacti(TextualConvention, OctetString):
status = 'current'
subtype_spec = OctetString.subtypeSpec + value_size_constraint(64, 64)
fixed_length = 64
class Optifbitratek(TextualConvention, Integer32):
status = 'current'
class Optifdegm(TextualConvention, Unsigned32):
status = 'current'
subtype_spec = Unsigned32.subtypeSpec + value_range_constraint(2, 10)
class Optifdegthr(TextualConvention, Unsigned32):
status = 'current'
subtype_spec = Unsigned32.subtypeSpec + value_range_constraint(1, 100)
class Optifdirectionality(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3))
named_values = named_values(('sink', 1), ('source', 2), ('bidirectional', 3))
class Optifsinkorsource(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2))
named_values = named_values(('sink', 1), ('source', 2))
class Optifexdapi(TextualConvention, OctetString):
status = 'current'
subtype_spec = OctetString.subtypeSpec + value_size_constraint(16, 16)
fixed_length = 16
class Optifexsapi(TextualConvention, OctetString):
status = 'current'
subtype_spec = OctetString.subtypeSpec + value_size_constraint(16, 16)
fixed_length = 16
class Optifintervalnumber(TextualConvention, Unsigned32):
status = 'current'
subtype_spec = Unsigned32.subtypeSpec + value_range_constraint(1, 96)
class Optiftimdetmode(TextualConvention, Integer32):
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3, 4))
named_values = named_values(('off', 1), ('dapi', 2), ('sapi', 3), ('both', 4))
class Optiftxti(TextualConvention, OctetString):
status = 'current'
subtype_spec = OctetString.subtypeSpec + value_size_constraint(64, 64)
fixed_length = 64
opt_if_objects = mib_identifier((1, 3, 6, 1, 2, 1, 10, 133, 1))
opt_if_confs = mib_identifier((1, 3, 6, 1, 2, 1, 10, 133, 2))
opt_if_ot_mn = mib_identifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 1))
opt_if_perf_mon = mib_identifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 2))
opt_if_ot_sn = mib_identifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 3))
opt_if_om_sn = mib_identifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 4))
opt_if_o_ch_group = mib_identifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 5))
opt_if_o_ch = mib_identifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 6))
opt_if_ot_uk = mib_identifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 7))
opt_if_od_uk = mib_identifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 8))
opt_if_od_uk_t = mib_identifier((1, 3, 6, 1, 2, 1, 10, 133, 1, 9))
opt_if_groups = mib_identifier((1, 3, 6, 1, 2, 1, 10, 133, 2, 1))
opt_if_compl = mib_identifier((1, 3, 6, 1, 2, 1, 10, 133, 2, 2))
opt_if_ot_mn_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1))
if mibBuilder.loadTexts:
optIfOTMnTable.setStatus('current')
opt_if_ot_mn_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOTMnEntry.setStatus('current')
opt_if_ot_mn_order = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1, 1, 1), unsigned32().subtype(subtypeSpec=value_range_constraint(1, 900))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTMnOrder.setStatus('current')
opt_if_ot_mn_reduced = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1, 1, 2), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTMnReduced.setStatus('current')
opt_if_ot_mn_bit_rates = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1, 1, 3), bits().clone(namedValues=named_values(('bitRateK1', 0), ('bitRateK2', 1), ('bitRateK3', 2)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTMnBitRates.setStatus('current')
opt_if_ot_mn_interface_type = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1, 1, 4), snmp_admin_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTMnInterfaceType.setStatus('current')
opt_if_ot_mn_tcm_max = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1, 1, 5), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 6))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTMnTcmMax.setStatus('current')
opt_if_ot_mn_optical_reach = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 1, 1, 1, 6), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4, 5))).clone(namedValues=named_values(('intraOffice', 1), ('shortHaul', 2), ('longHaul', 3), ('veryLongHaul', 4), ('ultraLongHaul', 5)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTMnOpticalReach.setStatus('current')
opt_if_perf_mon_interval_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 2, 1))
if mibBuilder.loadTexts:
optIfPerfMonIntervalTable.setStatus('current')
opt_if_perf_mon_interval_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 2, 1, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfPerfMonIntervalEntry.setStatus('current')
opt_if_perf_mon_current_time_elapsed = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 2, 1, 1, 1), gauge32().subtype(subtypeSpec=value_range_constraint(0, 900))).setUnits('seconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfPerfMonCurrentTimeElapsed.setStatus('current')
opt_if_perf_mon_cur_day_time_elapsed = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 2, 1, 1, 2), gauge32().subtype(subtypeSpec=value_range_constraint(0, 86400))).setUnits('seconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfPerfMonCurDayTimeElapsed.setStatus('current')
opt_if_perf_mon_interval_num_intervals = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 2, 1, 1, 3), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 96))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfPerfMonIntervalNumIntervals.setStatus('current')
opt_if_perf_mon_interval_num_invalid_intervals = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 2, 1, 1, 4), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 96))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfPerfMonIntervalNumInvalidIntervals.setStatus('current')
opt_if_ot_sn_config_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1))
if mibBuilder.loadTexts:
optIfOTSnConfigTable.setStatus('current')
opt_if_ot_sn_config_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOTSnConfigEntry.setStatus('current')
opt_if_ot_sn_directionality = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 1), opt_if_directionality()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnDirectionality.setStatus('current')
opt_if_ot_sn_apr_status = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 2), snmp_admin_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnAprStatus.setStatus('current')
opt_if_ot_sn_apr_control = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 3), snmp_admin_string()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTSnAprControl.setStatus('current')
opt_if_ot_sn_trace_identifier_transmitted = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 4), opt_if_tx_ti()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTSnTraceIdentifierTransmitted.setStatus('current')
opt_if_ot_sn_dapi_expected = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 5), opt_if_ex_dapi()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTSnDAPIExpected.setStatus('current')
opt_if_ot_sn_sapi_expected = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 6), opt_if_ex_sapi()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTSnSAPIExpected.setStatus('current')
opt_if_ot_sn_trace_identifier_accepted = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 7), opt_if_ac_ti()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnTraceIdentifierAccepted.setStatus('current')
opt_if_ot_sn_tim_det_mode = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 8), opt_if_tim_det_mode()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTSnTIMDetMode.setStatus('current')
opt_if_ot_sn_tim_act_enabled = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 9), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTSnTIMActEnabled.setStatus('current')
opt_if_ot_sn_current_status = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 1, 1, 10), bits().clone(namedValues=named_values(('bdiP', 0), ('bdiO', 1), ('bdi', 2), ('tim', 3), ('losP', 4), ('losO', 5), ('los', 6)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnCurrentStatus.setStatus('current')
opt_if_ot_sn_sink_current_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2))
if mibBuilder.loadTexts:
optIfOTSnSinkCurrentTable.setStatus('current')
opt_if_ot_sn_sink_current_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOTSnSinkCurrentEntry.setStatus('current')
opt_if_ot_sn_sink_current_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkCurrentSuspectedFlag.setStatus('current')
opt_if_ot_sn_sink_current_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkCurrentInputPower.setStatus('current')
opt_if_ot_sn_sink_current_low_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkCurrentLowInputPower.setStatus('current')
opt_if_ot_sn_sink_current_high_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkCurrentHighInputPower.setStatus('current')
opt_if_ot_sn_sink_current_lower_input_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTSnSinkCurrentLowerInputPowerThreshold.setStatus('current')
opt_if_ot_sn_sink_current_upper_input_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTSnSinkCurrentUpperInputPowerThreshold.setStatus('current')
opt_if_ot_sn_sink_current_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkCurrentOutputPower.setStatus('current')
opt_if_ot_sn_sink_current_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 8), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkCurrentLowOutputPower.setStatus('current')
opt_if_ot_sn_sink_current_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 9), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkCurrentHighOutputPower.setStatus('current')
opt_if_ot_sn_sink_current_lower_output_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 10), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTSnSinkCurrentLowerOutputPowerThreshold.setStatus('current')
opt_if_ot_sn_sink_current_upper_output_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 2, 1, 11), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTSnSinkCurrentUpperOutputPowerThreshold.setStatus('current')
opt_if_ot_sn_sink_interval_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3))
if mibBuilder.loadTexts:
optIfOTSnSinkIntervalTable.setStatus('current')
opt_if_ot_sn_sink_interval_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'), (0, 'OPT-IF-MIB', 'optIfOTSnSinkIntervalNumber'))
if mibBuilder.loadTexts:
optIfOTSnSinkIntervalEntry.setStatus('current')
opt_if_ot_sn_sink_interval_number = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 1), opt_if_interval_number())
if mibBuilder.loadTexts:
optIfOTSnSinkIntervalNumber.setStatus('current')
opt_if_ot_sn_sink_interval_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 2), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkIntervalSuspectedFlag.setStatus('current')
opt_if_ot_sn_sink_interval_last_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkIntervalLastInputPower.setStatus('current')
opt_if_ot_sn_sink_interval_low_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkIntervalLowInputPower.setStatus('current')
opt_if_ot_sn_sink_interval_high_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkIntervalHighInputPower.setStatus('current')
opt_if_ot_sn_sink_interval_last_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkIntervalLastOutputPower.setStatus('current')
opt_if_ot_sn_sink_interval_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkIntervalLowOutputPower.setStatus('current')
opt_if_ot_sn_sink_interval_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 3, 1, 8), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkIntervalHighOutputPower.setStatus('current')
opt_if_ot_sn_sink_cur_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 4))
if mibBuilder.loadTexts:
optIfOTSnSinkCurDayTable.setStatus('current')
opt_if_ot_sn_sink_cur_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 4, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOTSnSinkCurDayEntry.setStatus('current')
opt_if_ot_sn_sink_cur_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 4, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkCurDaySuspectedFlag.setStatus('current')
opt_if_ot_sn_sink_cur_day_low_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 4, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkCurDayLowInputPower.setStatus('current')
opt_if_ot_sn_sink_cur_day_high_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 4, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkCurDayHighInputPower.setStatus('current')
opt_if_ot_sn_sink_cur_day_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 4, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkCurDayLowOutputPower.setStatus('current')
opt_if_ot_sn_sink_cur_day_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 4, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkCurDayHighOutputPower.setStatus('current')
opt_if_ot_sn_sink_prev_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5))
if mibBuilder.loadTexts:
optIfOTSnSinkPrevDayTable.setStatus('current')
opt_if_ot_sn_sink_prev_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOTSnSinkPrevDayEntry.setStatus('current')
opt_if_ot_sn_sink_prev_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkPrevDaySuspectedFlag.setStatus('current')
opt_if_ot_sn_sink_prev_day_last_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkPrevDayLastInputPower.setStatus('current')
opt_if_ot_sn_sink_prev_day_low_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkPrevDayLowInputPower.setStatus('current')
opt_if_ot_sn_sink_prev_day_high_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkPrevDayHighInputPower.setStatus('current')
opt_if_ot_sn_sink_prev_day_last_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkPrevDayLastOutputPower.setStatus('current')
opt_if_ot_sn_sink_prev_day_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkPrevDayLowOutputPower.setStatus('current')
opt_if_ot_sn_sink_prev_day_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 5, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSinkPrevDayHighOutputPower.setStatus('current')
opt_if_ot_sn_src_current_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6))
if mibBuilder.loadTexts:
optIfOTSnSrcCurrentTable.setStatus('current')
opt_if_ot_sn_src_current_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOTSnSrcCurrentEntry.setStatus('current')
opt_if_ot_sn_src_current_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcCurrentSuspectedFlag.setStatus('current')
opt_if_ot_sn_src_current_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcCurrentOutputPower.setStatus('current')
opt_if_ot_sn_src_current_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcCurrentLowOutputPower.setStatus('current')
opt_if_ot_sn_src_current_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcCurrentHighOutputPower.setStatus('current')
opt_if_ot_sn_src_current_lower_output_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTSnSrcCurrentLowerOutputPowerThreshold.setStatus('current')
opt_if_ot_sn_src_current_upper_output_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTSnSrcCurrentUpperOutputPowerThreshold.setStatus('current')
opt_if_ot_sn_src_current_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcCurrentInputPower.setStatus('current')
opt_if_ot_sn_src_current_low_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 8), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcCurrentLowInputPower.setStatus('current')
opt_if_ot_sn_src_current_high_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 9), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcCurrentHighInputPower.setStatus('current')
opt_if_ot_sn_src_current_lower_input_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 10), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTSnSrcCurrentLowerInputPowerThreshold.setStatus('current')
opt_if_ot_sn_src_current_upper_input_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 6, 1, 11), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTSnSrcCurrentUpperInputPowerThreshold.setStatus('current')
opt_if_ot_sn_src_interval_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7))
if mibBuilder.loadTexts:
optIfOTSnSrcIntervalTable.setStatus('current')
opt_if_ot_sn_src_interval_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'), (0, 'OPT-IF-MIB', 'optIfOTSnSrcIntervalNumber'))
if mibBuilder.loadTexts:
optIfOTSnSrcIntervalEntry.setStatus('current')
opt_if_ot_sn_src_interval_number = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 1), opt_if_interval_number())
if mibBuilder.loadTexts:
optIfOTSnSrcIntervalNumber.setStatus('current')
opt_if_ot_sn_src_interval_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 2), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcIntervalSuspectedFlag.setStatus('current')
opt_if_ot_sn_src_interval_last_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcIntervalLastOutputPower.setStatus('current')
opt_if_ot_sn_src_interval_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcIntervalLowOutputPower.setStatus('current')
opt_if_ot_sn_src_interval_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcIntervalHighOutputPower.setStatus('current')
opt_if_ot_sn_src_interval_last_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcIntervalLastInputPower.setStatus('current')
opt_if_ot_sn_src_interval_low_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcIntervalLowInputPower.setStatus('current')
opt_if_ot_sn_src_interval_high_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 7, 1, 8), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcIntervalHighInputPower.setStatus('current')
opt_if_ot_sn_src_cur_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 8))
if mibBuilder.loadTexts:
optIfOTSnSrcCurDayTable.setStatus('current')
opt_if_ot_sn_src_cur_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 8, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOTSnSrcCurDayEntry.setStatus('current')
opt_if_ot_sn_src_cur_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 8, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcCurDaySuspectedFlag.setStatus('current')
opt_if_ot_sn_src_cur_day_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 8, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcCurDayLowOutputPower.setStatus('current')
opt_if_ot_sn_src_cur_day_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 8, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcCurDayHighOutputPower.setStatus('current')
opt_if_ot_sn_src_cur_day_low_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 8, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcCurDayLowInputPower.setStatus('current')
opt_if_ot_sn_src_cur_day_high_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 8, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcCurDayHighInputPower.setStatus('current')
opt_if_ot_sn_src_prev_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9))
if mibBuilder.loadTexts:
optIfOTSnSrcPrevDayTable.setStatus('current')
opt_if_ot_sn_src_prev_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOTSnSrcPrevDayEntry.setStatus('current')
opt_if_ot_sn_src_prev_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcPrevDaySuspectedFlag.setStatus('current')
opt_if_ot_sn_src_prev_day_last_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcPrevDayLastOutputPower.setStatus('current')
opt_if_ot_sn_src_prev_day_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcPrevDayLowOutputPower.setStatus('current')
opt_if_ot_sn_src_prev_day_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcPrevDayHighOutputPower.setStatus('current')
opt_if_ot_sn_src_prev_day_last_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcPrevDayLastInputPower.setStatus('current')
opt_if_ot_sn_src_prev_day_low_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcPrevDayLowInputPower.setStatus('current')
opt_if_ot_sn_src_prev_day_high_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 3, 9, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTSnSrcPrevDayHighInputPower.setStatus('current')
opt_if_om_sn_config_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 1))
if mibBuilder.loadTexts:
optIfOMSnConfigTable.setStatus('current')
opt_if_om_sn_config_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 1, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOMSnConfigEntry.setStatus('current')
opt_if_om_sn_directionality = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 1, 1, 1), opt_if_directionality()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnDirectionality.setStatus('current')
opt_if_om_sn_current_status = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 1, 1, 2), bits().clone(namedValues=named_values(('ssfP', 0), ('ssfO', 1), ('ssf', 2), ('bdiP', 3), ('bdiO', 4), ('bdi', 5), ('losP', 6)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnCurrentStatus.setStatus('current')
opt_if_om_sn_sink_current_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2))
if mibBuilder.loadTexts:
optIfOMSnSinkCurrentTable.setStatus('current')
opt_if_om_sn_sink_current_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOMSnSinkCurrentEntry.setStatus('current')
opt_if_om_sn_sink_current_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkCurrentSuspectedFlag.setStatus('current')
opt_if_om_sn_sink_current_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkCurrentAggregatedInputPower.setStatus('current')
opt_if_om_sn_sink_current_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkCurrentLowAggregatedInputPower.setStatus('current')
opt_if_om_sn_sink_current_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkCurrentHighAggregatedInputPower.setStatus('current')
opt_if_om_sn_sink_current_lower_input_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOMSnSinkCurrentLowerInputPowerThreshold.setStatus('current')
opt_if_om_sn_sink_current_upper_input_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOMSnSinkCurrentUpperInputPowerThreshold.setStatus('current')
opt_if_om_sn_sink_current_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkCurrentOutputPower.setStatus('current')
opt_if_om_sn_sink_current_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 8), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkCurrentLowOutputPower.setStatus('current')
opt_if_om_sn_sink_current_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 9), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkCurrentHighOutputPower.setStatus('current')
opt_if_om_sn_sink_current_lower_output_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 10), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOMSnSinkCurrentLowerOutputPowerThreshold.setStatus('current')
opt_if_om_sn_sink_current_upper_output_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 2, 1, 11), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOMSnSinkCurrentUpperOutputPowerThreshold.setStatus('current')
opt_if_om_sn_sink_interval_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3))
if mibBuilder.loadTexts:
optIfOMSnSinkIntervalTable.setStatus('current')
opt_if_om_sn_sink_interval_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'), (0, 'OPT-IF-MIB', 'optIfOMSnSinkIntervalNumber'))
if mibBuilder.loadTexts:
optIfOMSnSinkIntervalEntry.setStatus('current')
opt_if_om_sn_sink_interval_number = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 1), opt_if_interval_number())
if mibBuilder.loadTexts:
optIfOMSnSinkIntervalNumber.setStatus('current')
opt_if_om_sn_sink_interval_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 2), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkIntervalSuspectedFlag.setStatus('current')
opt_if_om_sn_sink_interval_last_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkIntervalLastAggregatedInputPower.setStatus('current')
opt_if_om_sn_sink_interval_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkIntervalLowAggregatedInputPower.setStatus('current')
opt_if_om_sn_sink_interval_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkIntervalHighAggregatedInputPower.setStatus('current')
opt_if_om_sn_sink_interval_last_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkIntervalLastOutputPower.setStatus('current')
opt_if_om_sn_sink_interval_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkIntervalLowOutputPower.setStatus('current')
opt_if_om_sn_sink_interval_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 3, 1, 8), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkIntervalHighOutputPower.setStatus('current')
opt_if_om_sn_sink_cur_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 4))
if mibBuilder.loadTexts:
optIfOMSnSinkCurDayTable.setStatus('current')
opt_if_om_sn_sink_cur_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 4, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOMSnSinkCurDayEntry.setStatus('current')
opt_if_om_sn_sink_cur_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 4, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkCurDaySuspectedFlag.setStatus('current')
opt_if_om_sn_sink_cur_day_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 4, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkCurDayLowAggregatedInputPower.setStatus('current')
opt_if_om_sn_sink_cur_day_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 4, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkCurDayHighAggregatedInputPower.setStatus('current')
opt_if_om_sn_sink_cur_day_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 4, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkCurDayLowOutputPower.setStatus('current')
opt_if_om_sn_sink_cur_day_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 4, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkCurDayHighOutputPower.setStatus('current')
opt_if_om_sn_sink_prev_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5))
if mibBuilder.loadTexts:
optIfOMSnSinkPrevDayTable.setStatus('current')
opt_if_om_sn_sink_prev_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOMSnSinkPrevDayEntry.setStatus('current')
opt_if_om_sn_sink_prev_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkPrevDaySuspectedFlag.setStatus('current')
opt_if_om_sn_sink_prev_day_last_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkPrevDayLastAggregatedInputPower.setStatus('current')
opt_if_om_sn_sink_prev_day_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkPrevDayLowAggregatedInputPower.setStatus('current')
opt_if_om_sn_sink_prev_day_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkPrevDayHighAggregatedInputPower.setStatus('current')
opt_if_om_sn_sink_prev_day_last_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkPrevDayLastOutputPower.setStatus('current')
opt_if_om_sn_sink_prev_day_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkPrevDayLowOutputPower.setStatus('current')
opt_if_om_sn_sink_prev_day_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 5, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSinkPrevDayHighOutputPower.setStatus('current')
opt_if_om_sn_src_current_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6))
if mibBuilder.loadTexts:
optIfOMSnSrcCurrentTable.setStatus('current')
opt_if_om_sn_src_current_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOMSnSrcCurrentEntry.setStatus('current')
opt_if_om_sn_src_current_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcCurrentSuspectedFlag.setStatus('current')
opt_if_om_sn_src_current_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcCurrentOutputPower.setStatus('current')
opt_if_om_sn_src_current_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcCurrentLowOutputPower.setStatus('current')
opt_if_om_sn_src_current_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcCurrentHighOutputPower.setStatus('current')
opt_if_om_sn_src_current_lower_output_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOMSnSrcCurrentLowerOutputPowerThreshold.setStatus('current')
opt_if_om_sn_src_current_upper_output_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOMSnSrcCurrentUpperOutputPowerThreshold.setStatus('current')
opt_if_om_sn_src_current_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcCurrentAggregatedInputPower.setStatus('current')
opt_if_om_sn_src_current_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 8), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcCurrentLowAggregatedInputPower.setStatus('current')
opt_if_om_sn_src_current_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 9), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcCurrentHighAggregatedInputPower.setStatus('current')
opt_if_om_sn_src_current_lower_input_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 10), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOMSnSrcCurrentLowerInputPowerThreshold.setStatus('current')
opt_if_om_sn_src_current_upper_input_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 6, 1, 11), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOMSnSrcCurrentUpperInputPowerThreshold.setStatus('current')
opt_if_om_sn_src_interval_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7))
if mibBuilder.loadTexts:
optIfOMSnSrcIntervalTable.setStatus('current')
opt_if_om_sn_src_interval_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'), (0, 'OPT-IF-MIB', 'optIfOMSnSrcIntervalNumber'))
if mibBuilder.loadTexts:
optIfOMSnSrcIntervalEntry.setStatus('current')
opt_if_om_sn_src_interval_number = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 1), opt_if_interval_number())
if mibBuilder.loadTexts:
optIfOMSnSrcIntervalNumber.setStatus('current')
opt_if_om_sn_src_interval_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 2), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcIntervalSuspectedFlag.setStatus('current')
opt_if_om_sn_src_interval_last_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcIntervalLastOutputPower.setStatus('current')
opt_if_om_sn_src_interval_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcIntervalLowOutputPower.setStatus('current')
opt_if_om_sn_src_interval_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcIntervalHighOutputPower.setStatus('current')
opt_if_om_sn_src_interval_last_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcIntervalLastAggregatedInputPower.setStatus('current')
opt_if_om_sn_src_interval_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcIntervalLowAggregatedInputPower.setStatus('current')
opt_if_om_sn_src_interval_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 7, 1, 8), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcIntervalHighAggregatedInputPower.setStatus('current')
opt_if_om_sn_src_cur_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 8))
if mibBuilder.loadTexts:
optIfOMSnSrcCurDayTable.setStatus('current')
opt_if_om_sn_src_cur_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 8, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOMSnSrcCurDayEntry.setStatus('current')
opt_if_om_sn_src_cur_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 8, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcCurDaySuspectedFlag.setStatus('current')
opt_if_om_sn_src_cur_day_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 8, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcCurDayLowOutputPower.setStatus('current')
opt_if_om_sn_src_cur_day_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 8, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcCurDayHighOutputPower.setStatus('current')
opt_if_om_sn_src_cur_day_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 8, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcCurDayLowAggregatedInputPower.setStatus('current')
opt_if_om_sn_src_cur_day_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 8, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcCurDayHighAggregatedInputPower.setStatus('current')
opt_if_om_sn_src_prev_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9))
if mibBuilder.loadTexts:
optIfOMSnSrcPrevDayTable.setStatus('current')
opt_if_om_sn_src_prev_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOMSnSrcPrevDayEntry.setStatus('current')
opt_if_om_sn_src_prev_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcPrevDaySuspectedFlag.setStatus('current')
opt_if_om_sn_src_prev_day_last_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcPrevDayLastOutputPower.setStatus('current')
opt_if_om_sn_src_prev_day_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcPrevDayLowOutputPower.setStatus('current')
opt_if_om_sn_src_prev_day_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcPrevDayHighOutputPower.setStatus('current')
opt_if_om_sn_src_prev_day_last_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcPrevDayLastAggregatedInputPower.setStatus('current')
opt_if_om_sn_src_prev_day_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcPrevDayLowAggregatedInputPower.setStatus('current')
opt_if_om_sn_src_prev_day_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 4, 9, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOMSnSrcPrevDayHighAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_config_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 1))
if mibBuilder.loadTexts:
optIfOChGroupConfigTable.setStatus('current')
opt_if_o_ch_group_config_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 1, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOChGroupConfigEntry.setStatus('current')
opt_if_o_ch_group_directionality = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 1, 1, 1), opt_if_directionality()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupDirectionality.setStatus('current')
opt_if_o_ch_group_sink_current_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2))
if mibBuilder.loadTexts:
optIfOChGroupSinkCurrentTable.setStatus('current')
opt_if_o_ch_group_sink_current_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOChGroupSinkCurrentEntry.setStatus('current')
opt_if_o_ch_group_sink_current_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurrentSuspectedFlag.setStatus('current')
opt_if_o_ch_group_sink_current_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurrentAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_sink_current_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurrentLowAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_sink_current_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurrentHighAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_sink_current_lower_input_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurrentLowerInputPowerThreshold.setStatus('current')
opt_if_o_ch_group_sink_current_upper_input_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurrentUpperInputPowerThreshold.setStatus('current')
opt_if_o_ch_group_sink_current_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurrentOutputPower.setStatus('current')
opt_if_o_ch_group_sink_current_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 8), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurrentLowOutputPower.setStatus('current')
opt_if_o_ch_group_sink_current_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 9), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurrentHighOutputPower.setStatus('current')
opt_if_o_ch_group_sink_current_lower_output_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 10), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurrentLowerOutputPowerThreshold.setStatus('current')
opt_if_o_ch_group_sink_current_upper_output_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 2, 1, 11), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurrentUpperOutputPowerThreshold.setStatus('current')
opt_if_o_ch_group_sink_interval_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3))
if mibBuilder.loadTexts:
optIfOChGroupSinkIntervalTable.setStatus('current')
opt_if_o_ch_group_sink_interval_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'), (0, 'OPT-IF-MIB', 'optIfOChGroupSinkIntervalNumber'))
if mibBuilder.loadTexts:
optIfOChGroupSinkIntervalEntry.setStatus('current')
opt_if_o_ch_group_sink_interval_number = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 1), opt_if_interval_number())
if mibBuilder.loadTexts:
optIfOChGroupSinkIntervalNumber.setStatus('current')
opt_if_o_ch_group_sink_interval_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 2), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkIntervalSuspectedFlag.setStatus('current')
opt_if_o_ch_group_sink_interval_last_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkIntervalLastAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_sink_interval_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkIntervalLowAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_sink_interval_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkIntervalHighAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_sink_interval_last_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkIntervalLastOutputPower.setStatus('current')
opt_if_o_ch_group_sink_interval_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkIntervalLowOutputPower.setStatus('current')
opt_if_o_ch_group_sink_interval_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 3, 1, 8), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkIntervalHighOutputPower.setStatus('current')
opt_if_o_ch_group_sink_cur_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 4))
if mibBuilder.loadTexts:
optIfOChGroupSinkCurDayTable.setStatus('current')
opt_if_o_ch_group_sink_cur_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 4, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOChGroupSinkCurDayEntry.setStatus('current')
opt_if_o_ch_group_sink_cur_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 4, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurDaySuspectedFlag.setStatus('current')
opt_if_o_ch_group_sink_cur_day_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 4, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurDayLowAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_sink_cur_day_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 4, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurDayHighAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_sink_cur_day_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 4, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurDayLowOutputPower.setStatus('current')
opt_if_o_ch_group_sink_cur_day_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 4, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkCurDayHighOutputPower.setStatus('current')
opt_if_o_ch_group_sink_prev_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5))
if mibBuilder.loadTexts:
optIfOChGroupSinkPrevDayTable.setStatus('current')
opt_if_o_ch_group_sink_prev_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOChGroupSinkPrevDayEntry.setStatus('current')
opt_if_o_ch_group_sink_prev_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkPrevDaySuspectedFlag.setStatus('current')
opt_if_o_ch_group_sink_prev_day_last_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkPrevDayLastAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_sink_prev_day_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkPrevDayLowAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_sink_prev_day_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkPrevDayHighAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_sink_prev_day_last_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkPrevDayLastOutputPower.setStatus('current')
opt_if_o_ch_group_sink_prev_day_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkPrevDayLowOutputPower.setStatus('current')
opt_if_o_ch_group_sink_prev_day_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 5, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSinkPrevDayHighOutputPower.setStatus('current')
opt_if_o_ch_group_src_current_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6))
if mibBuilder.loadTexts:
optIfOChGroupSrcCurrentTable.setStatus('current')
opt_if_o_ch_group_src_current_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOChGroupSrcCurrentEntry.setStatus('current')
opt_if_o_ch_group_src_current_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurrentSuspectedFlag.setStatus('current')
opt_if_o_ch_group_src_current_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurrentOutputPower.setStatus('current')
opt_if_o_ch_group_src_current_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurrentLowOutputPower.setStatus('current')
opt_if_o_ch_group_src_current_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurrentHighOutputPower.setStatus('current')
opt_if_o_ch_group_src_current_lower_output_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurrentLowerOutputPowerThreshold.setStatus('current')
opt_if_o_ch_group_src_current_upper_output_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurrentUpperOutputPowerThreshold.setStatus('current')
opt_if_o_ch_group_src_current_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurrentAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_src_current_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 8), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurrentLowAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_src_current_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 9), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurrentHighAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_src_current_lower_input_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 10), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurrentLowerInputPowerThreshold.setStatus('current')
opt_if_o_ch_group_src_current_upper_input_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 6, 1, 11), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurrentUpperInputPowerThreshold.setStatus('current')
opt_if_o_ch_group_src_interval_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7))
if mibBuilder.loadTexts:
optIfOChGroupSrcIntervalTable.setStatus('current')
opt_if_o_ch_group_src_interval_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'), (0, 'OPT-IF-MIB', 'optIfOChGroupSrcIntervalNumber'))
if mibBuilder.loadTexts:
optIfOChGroupSrcIntervalEntry.setStatus('current')
opt_if_o_ch_group_src_interval_number = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 1), opt_if_interval_number())
if mibBuilder.loadTexts:
optIfOChGroupSrcIntervalNumber.setStatus('current')
opt_if_o_ch_group_src_interval_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 2), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcIntervalSuspectedFlag.setStatus('current')
opt_if_o_ch_group_src_interval_last_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcIntervalLastOutputPower.setStatus('current')
opt_if_o_ch_group_src_interval_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcIntervalLowOutputPower.setStatus('current')
opt_if_o_ch_group_src_interval_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcIntervalHighOutputPower.setStatus('current')
opt_if_o_ch_group_src_interval_last_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcIntervalLastAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_src_interval_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcIntervalLowAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_src_interval_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 7, 1, 8), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcIntervalHighAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_src_cur_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 8))
if mibBuilder.loadTexts:
optIfOChGroupSrcCurDayTable.setStatus('current')
opt_if_o_ch_group_src_cur_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 8, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOChGroupSrcCurDayEntry.setStatus('current')
opt_if_o_ch_group_src_cur_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 8, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurDaySuspectedFlag.setStatus('current')
opt_if_o_ch_group_src_cur_day_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 8, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurDayLowOutputPower.setStatus('current')
opt_if_o_ch_group_src_cur_day_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 8, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurDayHighOutputPower.setStatus('current')
opt_if_o_ch_group_src_cur_day_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 8, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurDayLowAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_src_cur_day_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 8, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcCurDayHighAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_src_prev_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9))
if mibBuilder.loadTexts:
optIfOChGroupSrcPrevDayTable.setStatus('current')
opt_if_o_ch_group_src_prev_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOChGroupSrcPrevDayEntry.setStatus('current')
opt_if_o_ch_group_src_prev_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcPrevDaySuspectedFlag.setStatus('current')
opt_if_o_ch_group_src_prev_day_last_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcPrevDayLastOutputPower.setStatus('current')
opt_if_o_ch_group_src_prev_day_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcPrevDayLowOutputPower.setStatus('current')
opt_if_o_ch_group_src_prev_day_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcPrevDayHighOutputPower.setStatus('current')
opt_if_o_ch_group_src_prev_day_last_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcPrevDayLastAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_src_prev_day_low_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcPrevDayLowAggregatedInputPower.setStatus('current')
opt_if_o_ch_group_src_prev_day_high_aggregated_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 5, 9, 1, 7), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChGroupSrcPrevDayHighAggregatedInputPower.setStatus('current')
opt_if_o_ch_config_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 1))
if mibBuilder.loadTexts:
optIfOChConfigTable.setStatus('current')
opt_if_o_ch_config_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 1, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOChConfigEntry.setStatus('current')
opt_if_o_ch_directionality = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 1, 1, 1), opt_if_directionality()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChDirectionality.setStatus('current')
opt_if_o_ch_current_status = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 1, 1, 2), bits().clone(namedValues=named_values(('losP', 0), ('los', 1), ('oci', 2), ('ssfP', 3), ('ssfO', 4), ('ssf', 5)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChCurrentStatus.setStatus('current')
opt_if_o_ch_sink_current_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2))
if mibBuilder.loadTexts:
optIfOChSinkCurrentTable.setStatus('current')
opt_if_o_ch_sink_current_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOChSinkCurrentEntry.setStatus('current')
opt_if_o_ch_sink_current_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSinkCurrentSuspectedFlag.setStatus('current')
opt_if_o_ch_sink_current_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSinkCurrentInputPower.setStatus('current')
opt_if_o_ch_sink_current_low_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSinkCurrentLowInputPower.setStatus('current')
opt_if_o_ch_sink_current_high_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSinkCurrentHighInputPower.setStatus('current')
opt_if_o_ch_sink_current_lower_input_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOChSinkCurrentLowerInputPowerThreshold.setStatus('current')
opt_if_o_ch_sink_current_upper_input_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 2, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOChSinkCurrentUpperInputPowerThreshold.setStatus('current')
opt_if_o_ch_sink_interval_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 3))
if mibBuilder.loadTexts:
optIfOChSinkIntervalTable.setStatus('current')
opt_if_o_ch_sink_interval_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 3, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'), (0, 'OPT-IF-MIB', 'optIfOChSinkIntervalNumber'))
if mibBuilder.loadTexts:
optIfOChSinkIntervalEntry.setStatus('current')
opt_if_o_ch_sink_interval_number = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 3, 1, 1), opt_if_interval_number())
if mibBuilder.loadTexts:
optIfOChSinkIntervalNumber.setStatus('current')
opt_if_o_ch_sink_interval_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 3, 1, 2), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSinkIntervalSuspectedFlag.setStatus('current')
opt_if_o_ch_sink_interval_last_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 3, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSinkIntervalLastInputPower.setStatus('current')
opt_if_o_ch_sink_interval_low_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 3, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSinkIntervalLowInputPower.setStatus('current')
opt_if_o_ch_sink_interval_high_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 3, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSinkIntervalHighInputPower.setStatus('current')
opt_if_o_ch_sink_cur_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 4))
if mibBuilder.loadTexts:
optIfOChSinkCurDayTable.setStatus('current')
opt_if_o_ch_sink_cur_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 4, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOChSinkCurDayEntry.setStatus('current')
opt_if_o_ch_sink_cur_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 4, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSinkCurDaySuspectedFlag.setStatus('current')
opt_if_o_ch_sink_cur_day_low_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 4, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSinkCurDayLowInputPower.setStatus('current')
opt_if_o_ch_sink_cur_day_high_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 4, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSinkCurDayHighInputPower.setStatus('current')
opt_if_o_ch_sink_prev_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 5))
if mibBuilder.loadTexts:
optIfOChSinkPrevDayTable.setStatus('current')
opt_if_o_ch_sink_prev_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 5, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOChSinkPrevDayEntry.setStatus('current')
opt_if_o_ch_sink_prev_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 5, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSinkPrevDaySuspectedFlag.setStatus('current')
opt_if_o_ch_sink_prev_day_last_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 5, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSinkPrevDayLastInputPower.setStatus('current')
opt_if_o_ch_sink_prev_day_low_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 5, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSinkPrevDayLowInputPower.setStatus('current')
opt_if_o_ch_sink_prev_day_high_input_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 5, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSinkPrevDayHighInputPower.setStatus('current')
opt_if_o_ch_src_current_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6))
if mibBuilder.loadTexts:
optIfOChSrcCurrentTable.setStatus('current')
opt_if_o_ch_src_current_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOChSrcCurrentEntry.setStatus('current')
opt_if_o_ch_src_current_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSrcCurrentSuspectedFlag.setStatus('current')
opt_if_o_ch_src_current_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSrcCurrentOutputPower.setStatus('current')
opt_if_o_ch_src_current_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSrcCurrentLowOutputPower.setStatus('current')
opt_if_o_ch_src_current_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSrcCurrentHighOutputPower.setStatus('current')
opt_if_o_ch_src_current_lower_output_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOChSrcCurrentLowerOutputPowerThreshold.setStatus('current')
opt_if_o_ch_src_current_upper_output_power_threshold = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 6, 1, 6), integer32()).setUnits('0.1 dbm').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOChSrcCurrentUpperOutputPowerThreshold.setStatus('current')
opt_if_o_ch_src_interval_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 7))
if mibBuilder.loadTexts:
optIfOChSrcIntervalTable.setStatus('current')
opt_if_o_ch_src_interval_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 7, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'), (0, 'OPT-IF-MIB', 'optIfOChSrcIntervalNumber'))
if mibBuilder.loadTexts:
optIfOChSrcIntervalEntry.setStatus('current')
opt_if_o_ch_src_interval_number = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 7, 1, 1), opt_if_interval_number())
if mibBuilder.loadTexts:
optIfOChSrcIntervalNumber.setStatus('current')
opt_if_o_ch_src_interval_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 7, 1, 2), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSrcIntervalSuspectedFlag.setStatus('current')
opt_if_o_ch_src_interval_last_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 7, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSrcIntervalLastOutputPower.setStatus('current')
opt_if_o_ch_src_interval_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 7, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSrcIntervalLowOutputPower.setStatus('current')
opt_if_o_ch_src_interval_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 7, 1, 5), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSrcIntervalHighOutputPower.setStatus('current')
opt_if_o_ch_src_cur_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 8))
if mibBuilder.loadTexts:
optIfOChSrcCurDayTable.setStatus('current')
opt_if_o_ch_src_cur_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 8, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOChSrcCurDayEntry.setStatus('current')
opt_if_o_ch_src_cur_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 8, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSrcCurDaySuspectedFlag.setStatus('current')
opt_if_o_ch_src_cur_day_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 8, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSrcCurDayLowOutputPower.setStatus('current')
opt_if_o_ch_src_cur_day_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 8, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSrcCurDayHighOutputPower.setStatus('current')
opt_if_o_ch_src_prev_day_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 9))
if mibBuilder.loadTexts:
optIfOChSrcPrevDayTable.setStatus('current')
opt_if_o_ch_src_prev_day_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 9, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOChSrcPrevDayEntry.setStatus('current')
opt_if_o_ch_src_prev_day_suspected_flag = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 9, 1, 1), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSrcPrevDaySuspectedFlag.setStatus('current')
opt_if_o_ch_src_prev_day_last_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 9, 1, 2), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSrcPrevDayLastOutputPower.setStatus('current')
opt_if_o_ch_src_prev_day_low_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 9, 1, 3), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSrcPrevDayLowOutputPower.setStatus('current')
opt_if_o_ch_src_prev_day_high_output_power = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 6, 9, 1, 4), integer32()).setUnits('0.1 dbm').setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOChSrcPrevDayHighOutputPower.setStatus('current')
opt_if_ot_uk_config_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1))
if mibBuilder.loadTexts:
optIfOTUkConfigTable.setStatus('current')
opt_if_ot_uk_config_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfOTUkConfigEntry.setStatus('current')
opt_if_ot_uk_directionality = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 1), opt_if_directionality()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTUkDirectionality.setStatus('current')
opt_if_ot_uk_bit_rate_k = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 2), opt_if_bit_rate_k()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTUkBitRateK.setStatus('current')
opt_if_ot_uk_trace_identifier_transmitted = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 3), opt_if_tx_ti()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTUkTraceIdentifierTransmitted.setStatus('current')
opt_if_ot_uk_dapi_expected = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 4), opt_if_ex_dapi()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTUkDAPIExpected.setStatus('current')
opt_if_ot_uk_sapi_expected = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 5), opt_if_ex_sapi()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTUkSAPIExpected.setStatus('current')
opt_if_ot_uk_trace_identifier_accepted = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 6), opt_if_ac_ti()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTUkTraceIdentifierAccepted.setStatus('current')
opt_if_ot_uk_tim_det_mode = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 7), opt_if_tim_det_mode()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTUkTIMDetMode.setStatus('current')
opt_if_ot_uk_tim_act_enabled = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 8), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTUkTIMActEnabled.setStatus('current')
opt_if_ot_uk_deg_thr = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 9), opt_if_deg_thr()).setUnits('percentage').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTUkDEGThr.setStatus('current')
opt_if_ot_uk_degm = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 10), opt_if_degm()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTUkDEGM.setStatus('current')
opt_if_ot_uk_sink_adapt_active = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 11), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTUkSinkAdaptActive.setStatus('current')
opt_if_ot_uk_source_adapt_active = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 12), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTUkSourceAdaptActive.setStatus('current')
opt_if_ot_uk_sink_fec_enabled = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 13), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfOTUkSinkFECEnabled.setStatus('current')
opt_if_ot_uk_current_status = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 1, 1, 14), bits().clone(namedValues=named_values(('tim', 0), ('deg', 1), ('bdi', 2), ('ssf', 3), ('lof', 4), ('ais', 5), ('lom', 6)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfOTUkCurrentStatus.setStatus('current')
opt_if_gcc0_config_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 2))
if mibBuilder.loadTexts:
optIfGCC0ConfigTable.setStatus('current')
opt_if_gcc0_config_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 2, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'), (0, 'OPT-IF-MIB', 'optIfGCC0Directionality'))
if mibBuilder.loadTexts:
optIfGCC0ConfigEntry.setStatus('current')
opt_if_gcc0_directionality = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 2, 1, 1), opt_if_directionality())
if mibBuilder.loadTexts:
optIfGCC0Directionality.setStatus('current')
opt_if_gcc0_application = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 2, 1, 2), snmp_admin_string()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfGCC0Application.setStatus('current')
opt_if_gcc0_row_status = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 7, 2, 1, 3), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfGCC0RowStatus.setStatus('current')
opt_if_od_uk_config_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 1))
if mibBuilder.loadTexts:
optIfODUkConfigTable.setStatus('current')
opt_if_od_uk_config_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 1, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfODUkConfigEntry.setStatus('current')
opt_if_od_uk_directionality = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 1, 1, 1), opt_if_directionality()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfODUkDirectionality.setStatus('current')
opt_if_od_uk_bit_rate_k = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 1, 1, 2), opt_if_bit_rate_k()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfODUkBitRateK.setStatus('current')
opt_if_od_uk_tcm_fields_in_use = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 1, 1, 3), bits().clone(namedValues=named_values(('tcmField1', 0), ('tcmField2', 1), ('tcmField3', 2), ('tcmField4', 3), ('tcmField5', 4), ('tcmField6', 5)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfODUkTcmFieldsInUse.setStatus('current')
opt_if_od_uk_position_seq_current_size = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 1, 1, 4), unsigned32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfODUkPositionSeqCurrentSize.setStatus('current')
opt_if_od_uk_ttp_present = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 1, 1, 5), truth_value()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfODUkTtpPresent.setStatus('current')
opt_if_od_uk_ttp_config_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2))
if mibBuilder.loadTexts:
optIfODUkTtpConfigTable.setStatus('current')
opt_if_od_uk_ttp_config_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
optIfODUkTtpConfigEntry.setStatus('current')
opt_if_od_uk_ttp_trace_identifier_transmitted = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 1), opt_if_tx_ti()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfODUkTtpTraceIdentifierTransmitted.setStatus('current')
opt_if_od_uk_ttp_dapi_expected = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 2), opt_if_ex_dapi()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfODUkTtpDAPIExpected.setStatus('current')
opt_if_od_uk_ttp_sapi_expected = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 3), opt_if_ex_sapi()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfODUkTtpSAPIExpected.setStatus('current')
opt_if_od_uk_ttp_trace_identifier_accepted = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 4), opt_if_ac_ti()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfODUkTtpTraceIdentifierAccepted.setStatus('current')
opt_if_od_uk_ttp_tim_det_mode = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 5), opt_if_tim_det_mode()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfODUkTtpTIMDetMode.setStatus('current')
opt_if_od_uk_ttp_tim_act_enabled = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 6), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfODUkTtpTIMActEnabled.setStatus('current')
opt_if_od_uk_ttp_deg_thr = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 7), opt_if_deg_thr()).setUnits('percentage').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfODUkTtpDEGThr.setStatus('current')
opt_if_od_uk_ttp_degm = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 8), opt_if_degm()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
optIfODUkTtpDEGM.setStatus('current')
opt_if_od_uk_ttp_current_status = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 2, 1, 9), bits().clone(namedValues=named_values(('oci', 0), ('lck', 1), ('tim', 2), ('deg', 3), ('bdi', 4), ('ssf', 5)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfODUkTtpCurrentStatus.setStatus('current')
opt_if_od_uk_position_seq_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 3))
if mibBuilder.loadTexts:
optIfODUkPositionSeqTable.setStatus('current')
opt_if_od_uk_position_seq_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 3, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'), (0, 'OPT-IF-MIB', 'optIfODUkPositionSeqIndex'))
if mibBuilder.loadTexts:
optIfODUkPositionSeqEntry.setStatus('current')
opt_if_od_uk_position_seq_index = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 3, 1, 1), unsigned32().subtype(subtypeSpec=value_range_constraint(1, 4294967295)))
if mibBuilder.loadTexts:
optIfODUkPositionSeqIndex.setStatus('current')
opt_if_od_uk_position_seq_position = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 3, 1, 2), unsigned32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfODUkPositionSeqPosition.setStatus('current')
opt_if_od_uk_position_seq_pointer = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 3, 1, 3), row_pointer()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfODUkPositionSeqPointer.setStatus('current')
opt_if_od_uk_nim_config_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4))
if mibBuilder.loadTexts:
optIfODUkNimConfigTable.setStatus('current')
opt_if_od_uk_nim_config_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'), (0, 'OPT-IF-MIB', 'optIfODUkNimDirectionality'))
if mibBuilder.loadTexts:
optIfODUkNimConfigEntry.setStatus('current')
opt_if_od_uk_nim_directionality = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 1), opt_if_sink_or_source())
if mibBuilder.loadTexts:
optIfODUkNimDirectionality.setStatus('current')
opt_if_od_uk_nim_dapi_expected = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 2), opt_if_ex_dapi()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkNimDAPIExpected.setStatus('current')
opt_if_od_uk_nim_sapi_expected = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 3), opt_if_ex_sapi()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkNimSAPIExpected.setStatus('current')
opt_if_od_uk_nim_trace_identifier_accepted = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 4), opt_if_ac_ti()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfODUkNimTraceIdentifierAccepted.setStatus('current')
opt_if_od_uk_nim_tim_det_mode = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 5), opt_if_tim_det_mode()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkNimTIMDetMode.setStatus('current')
opt_if_od_uk_nim_tim_act_enabled = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 6), truth_value()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkNimTIMActEnabled.setStatus('current')
opt_if_od_uk_nim_deg_thr = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 7), opt_if_deg_thr()).setUnits('percentage').setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkNimDEGThr.setStatus('current')
opt_if_od_uk_nim_degm = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 8), opt_if_degm()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkNimDEGM.setStatus('current')
opt_if_od_uk_nim_current_status = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 9), bits().clone(namedValues=named_values(('oci', 0), ('lck', 1), ('tim', 2), ('deg', 3), ('bdi', 4), ('ssf', 5)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfODUkNimCurrentStatus.setStatus('current')
opt_if_od_uk_nim_row_status = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 4, 1, 10), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkNimRowStatus.setStatus('current')
opt_if_gcc12_config_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 5))
if mibBuilder.loadTexts:
optIfGCC12ConfigTable.setStatus('current')
opt_if_gcc12_config_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 5, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'), (0, 'OPT-IF-MIB', 'optIfGCC12Codirectional'), (0, 'OPT-IF-MIB', 'optIfGCC12GCCAccess'))
if mibBuilder.loadTexts:
optIfGCC12ConfigEntry.setStatus('current')
opt_if_gcc12_codirectional = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 5, 1, 1), truth_value())
if mibBuilder.loadTexts:
optIfGCC12Codirectional.setStatus('current')
opt_if_gcc12_gcc_access = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 5, 1, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('gcc1', 1), ('gcc2', 2), ('gcc1and2', 3))))
if mibBuilder.loadTexts:
optIfGCC12GCCAccess.setStatus('current')
opt_if_gcc12_gcc_pass_through = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 5, 1, 3), truth_value()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfGCC12GCCPassThrough.setStatus('current')
opt_if_gcc12_application = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 5, 1, 4), snmp_admin_string()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfGCC12Application.setStatus('current')
opt_if_gcc12_row_status = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 8, 5, 1, 5), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfGCC12RowStatus.setStatus('current')
opt_if_od_uk_t_config_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1))
if mibBuilder.loadTexts:
optIfODUkTConfigTable.setStatus('current')
opt_if_od_uk_t_config_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'), (0, 'OPT-IF-MIB', 'optIfODUkTTcmField'), (0, 'OPT-IF-MIB', 'optIfODUkTCodirectional'))
if mibBuilder.loadTexts:
optIfODUkTConfigEntry.setStatus('current')
opt_if_od_uk_t_tcm_field = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 1), unsigned32().subtype(subtypeSpec=value_range_constraint(1, 6)))
if mibBuilder.loadTexts:
optIfODUkTTcmField.setStatus('current')
opt_if_od_uk_t_codirectional = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 2), truth_value())
if mibBuilder.loadTexts:
optIfODUkTCodirectional.setStatus('current')
opt_if_od_uk_t_trace_identifier_transmitted = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 3), opt_if_tx_ti()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTTraceIdentifierTransmitted.setStatus('current')
opt_if_od_uk_tdapi_expected = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 4), opt_if_ex_dapi()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTDAPIExpected.setStatus('current')
opt_if_od_uk_tsapi_expected = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 5), opt_if_ex_sapi()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTSAPIExpected.setStatus('current')
opt_if_od_uk_t_trace_identifier_accepted = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 6), opt_if_ac_ti()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfODUkTTraceIdentifierAccepted.setStatus('current')
opt_if_od_uk_ttim_det_mode = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 7), opt_if_tim_det_mode()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTTIMDetMode.setStatus('current')
opt_if_od_uk_ttim_act_enabled = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 8), truth_value()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTTIMActEnabled.setStatus('current')
opt_if_od_uk_tdeg_thr = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 9), opt_if_deg_thr()).setUnits('percentage').setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTDEGThr.setStatus('current')
opt_if_od_uk_tdegm = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 10), opt_if_degm()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTDEGM.setStatus('current')
opt_if_od_uk_t_sink_mode = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 11), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('operational', 1), ('monitor', 2)))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTSinkMode.setStatus('current')
opt_if_od_uk_t_sink_lock_signal_admin_state = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 12), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('locked', 1), ('normal', 2)))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTSinkLockSignalAdminState.setStatus('current')
opt_if_od_uk_t_source_lock_signal_admin_state = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 13), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('locked', 1), ('normal', 2)))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTSourceLockSignalAdminState.setStatus('current')
opt_if_od_uk_t_current_status = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 14), bits().clone(namedValues=named_values(('oci', 0), ('lck', 1), ('tim', 2), ('deg', 3), ('bdi', 4), ('ssf', 5)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfODUkTCurrentStatus.setStatus('current')
opt_if_od_uk_t_row_status = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 1, 1, 15), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTRowStatus.setStatus('current')
opt_if_od_uk_t_nim_config_table = mib_table((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2))
if mibBuilder.loadTexts:
optIfODUkTNimConfigTable.setStatus('current')
opt_if_od_uk_t_nim_config_entry = mib_table_row((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'), (0, 'OPT-IF-MIB', 'optIfODUkTNimTcmField'), (0, 'OPT-IF-MIB', 'optIfODUkTNimDirectionality'))
if mibBuilder.loadTexts:
optIfODUkTNimConfigEntry.setStatus('current')
opt_if_od_uk_t_nim_tcm_field = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 1), unsigned32().subtype(subtypeSpec=value_range_constraint(1, 6)))
if mibBuilder.loadTexts:
optIfODUkTNimTcmField.setStatus('current')
opt_if_od_uk_t_nim_directionality = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 2), opt_if_sink_or_source())
if mibBuilder.loadTexts:
optIfODUkTNimDirectionality.setStatus('current')
opt_if_od_uk_t_nim_dapi_expected = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 3), opt_if_ex_dapi()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTNimDAPIExpected.setStatus('current')
opt_if_od_uk_t_nim_sapi_expected = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 4), opt_if_ex_sapi()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTNimSAPIExpected.setStatus('current')
opt_if_od_uk_t_nim_trace_identifier_accepted = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 5), opt_if_ac_ti()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfODUkTNimTraceIdentifierAccepted.setStatus('current')
opt_if_od_uk_t_nim_tim_det_mode = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 6), opt_if_tim_det_mode()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTNimTIMDetMode.setStatus('current')
opt_if_od_uk_t_nim_tim_act_enabled = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 7), truth_value()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTNimTIMActEnabled.setStatus('current')
opt_if_od_uk_t_nim_deg_thr = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 8), opt_if_deg_thr()).setUnits('percentage').setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTNimDEGThr.setStatus('current')
opt_if_od_uk_t_nim_degm = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 9), opt_if_degm()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTNimDEGM.setStatus('current')
opt_if_od_uk_t_nim_current_status = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 10), bits().clone(namedValues=named_values(('oci', 0), ('lck', 1), ('tim', 2), ('deg', 3), ('bdi', 4), ('ssf', 5)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
optIfODUkTNimCurrentStatus.setStatus('current')
opt_if_od_uk_t_nim_row_status = mib_table_column((1, 3, 6, 1, 2, 1, 10, 133, 1, 9, 2, 1, 11), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
optIfODUkTNimRowStatus.setStatus('current')
opt_if_ot_mn_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 1)).setObjects(('OPT-IF-MIB', 'optIfOTMnOrder'), ('OPT-IF-MIB', 'optIfOTMnReduced'), ('OPT-IF-MIB', 'optIfOTMnBitRates'), ('OPT-IF-MIB', 'optIfOTMnInterfaceType'), ('OPT-IF-MIB', 'optIfOTMnTcmMax'), ('OPT-IF-MIB', 'optIfOTMnOpticalReach'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_ot_mn_group = optIfOTMnGroup.setStatus('current')
opt_if_perf_mon_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 2)).setObjects(('OPT-IF-MIB', 'optIfPerfMonCurrentTimeElapsed'), ('OPT-IF-MIB', 'optIfPerfMonCurDayTimeElapsed'), ('OPT-IF-MIB', 'optIfPerfMonIntervalNumIntervals'), ('OPT-IF-MIB', 'optIfPerfMonIntervalNumInvalidIntervals'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_perf_mon_group = optIfPerfMonGroup.setStatus('current')
opt_if_ot_sn_common_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 3)).setObjects(('OPT-IF-MIB', 'optIfOTSnDirectionality'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_ot_sn_common_group = optIfOTSnCommonGroup.setStatus('current')
opt_if_ot_sn_source_group_full = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 4)).setObjects(('OPT-IF-MIB', 'optIfOTSnTraceIdentifierTransmitted'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_ot_sn_source_group_full = optIfOTSnSourceGroupFull.setStatus('current')
opt_if_ot_sn_apr_status_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 5)).setObjects(('OPT-IF-MIB', 'optIfOTSnAprStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_ot_sn_apr_status_group = optIfOTSnAPRStatusGroup.setStatus('current')
opt_if_ot_sn_apr_control_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 6)).setObjects(('OPT-IF-MIB', 'optIfOTSnAprControl'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_ot_sn_apr_control_group = optIfOTSnAPRControlGroup.setStatus('current')
opt_if_ot_sn_sink_group_basic = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 7)).setObjects(('OPT-IF-MIB', 'optIfOTSnCurrentStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_ot_sn_sink_group_basic = optIfOTSnSinkGroupBasic.setStatus('current')
opt_if_ot_sn_sink_group_full = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 8)).setObjects(('OPT-IF-MIB', 'optIfOTSnDAPIExpected'), ('OPT-IF-MIB', 'optIfOTSnSAPIExpected'), ('OPT-IF-MIB', 'optIfOTSnTraceIdentifierAccepted'), ('OPT-IF-MIB', 'optIfOTSnTIMDetMode'), ('OPT-IF-MIB', 'optIfOTSnTIMActEnabled'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_ot_sn_sink_group_full = optIfOTSnSinkGroupFull.setStatus('current')
opt_if_ot_sn_sink_pre_otn_pm_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 9)).setObjects(('OPT-IF-MIB', 'optIfOTSnSinkCurrentSuspectedFlag'), ('OPT-IF-MIB', 'optIfOTSnSinkCurrentInputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkCurrentLowInputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkCurrentHighInputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkCurrentOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkCurrentLowOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkCurrentHighOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkIntervalSuspectedFlag'), ('OPT-IF-MIB', 'optIfOTSnSinkIntervalLastInputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkIntervalLowInputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkIntervalHighInputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkIntervalLastOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkIntervalLowOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkIntervalHighOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkCurDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOTSnSinkCurDayLowInputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkCurDayHighInputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkCurDayLowOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkCurDayHighOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkPrevDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOTSnSinkPrevDayLastInputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkPrevDayLowInputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkPrevDayHighInputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkPrevDayLastOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkPrevDayLowOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSinkPrevDayHighOutputPower'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_ot_sn_sink_pre_otn_pm_group = optIfOTSnSinkPreOtnPMGroup.setStatus('current')
opt_if_ot_sn_sink_pre_otn_pm_threshold_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 10)).setObjects(('OPT-IF-MIB', 'optIfOTSnSinkCurrentLowerInputPowerThreshold'), ('OPT-IF-MIB', 'optIfOTSnSinkCurrentUpperInputPowerThreshold'), ('OPT-IF-MIB', 'optIfOTSnSinkCurrentLowerOutputPowerThreshold'), ('OPT-IF-MIB', 'optIfOTSnSinkCurrentUpperOutputPowerThreshold'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_ot_sn_sink_pre_otn_pm_threshold_group = optIfOTSnSinkPreOtnPMThresholdGroup.setStatus('current')
opt_if_ot_sn_source_pre_otn_pm_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 11)).setObjects(('OPT-IF-MIB', 'optIfOTSnSrcCurrentSuspectedFlag'), ('OPT-IF-MIB', 'optIfOTSnSrcCurrentOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcCurrentLowOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcCurrentHighOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcCurrentInputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcCurrentLowInputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcCurrentHighInputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcIntervalSuspectedFlag'), ('OPT-IF-MIB', 'optIfOTSnSrcIntervalLastOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcIntervalLowOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcIntervalHighOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcIntervalLastInputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcIntervalLowInputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcIntervalHighInputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcCurDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOTSnSrcCurDayLowOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcCurDayHighOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcCurDayLowInputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcCurDayHighInputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcPrevDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOTSnSrcPrevDayLastOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcPrevDayLowOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcPrevDayHighOutputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcPrevDayLastInputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcPrevDayLowInputPower'), ('OPT-IF-MIB', 'optIfOTSnSrcPrevDayHighInputPower'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_ot_sn_source_pre_otn_pm_group = optIfOTSnSourcePreOtnPMGroup.setStatus('current')
opt_if_ot_sn_source_pre_otn_pm_threshold_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 12)).setObjects(('OPT-IF-MIB', 'optIfOTSnSrcCurrentLowerOutputPowerThreshold'), ('OPT-IF-MIB', 'optIfOTSnSrcCurrentUpperOutputPowerThreshold'), ('OPT-IF-MIB', 'optIfOTSnSrcCurrentLowerInputPowerThreshold'), ('OPT-IF-MIB', 'optIfOTSnSrcCurrentUpperInputPowerThreshold'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_ot_sn_source_pre_otn_pm_threshold_group = optIfOTSnSourcePreOtnPMThresholdGroup.setStatus('current')
opt_if_om_sn_common_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 13)).setObjects(('OPT-IF-MIB', 'optIfOMSnDirectionality'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_om_sn_common_group = optIfOMSnCommonGroup.setStatus('current')
opt_if_om_sn_sink_group_basic = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 14)).setObjects(('OPT-IF-MIB', 'optIfOMSnCurrentStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_om_sn_sink_group_basic = optIfOMSnSinkGroupBasic.setStatus('current')
opt_if_om_sn_sink_pre_otn_pm_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 15)).setObjects(('OPT-IF-MIB', 'optIfOMSnSinkCurrentSuspectedFlag'), ('OPT-IF-MIB', 'optIfOMSnSinkCurrentAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkCurrentLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkCurrentHighAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkCurrentOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkCurrentLowOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkCurrentHighOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkIntervalSuspectedFlag'), ('OPT-IF-MIB', 'optIfOMSnSinkIntervalLastAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkIntervalLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkIntervalHighAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkIntervalLastOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkIntervalLowOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkIntervalHighOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkCurDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOMSnSinkCurDayLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkCurDayHighAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkCurDayLowOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkCurDayHighOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkPrevDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOMSnSinkPrevDayLastAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkPrevDayLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkPrevDayHighAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkPrevDayLastOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkPrevDayLowOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSinkPrevDayHighOutputPower'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_om_sn_sink_pre_otn_pm_group = optIfOMSnSinkPreOtnPMGroup.setStatus('current')
opt_if_om_sn_sink_pre_otn_pm_threshold_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 16)).setObjects(('OPT-IF-MIB', 'optIfOMSnSinkCurrentLowerInputPowerThreshold'), ('OPT-IF-MIB', 'optIfOMSnSinkCurrentUpperInputPowerThreshold'), ('OPT-IF-MIB', 'optIfOMSnSinkCurrentLowerOutputPowerThreshold'), ('OPT-IF-MIB', 'optIfOMSnSinkCurrentUpperOutputPowerThreshold'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_om_sn_sink_pre_otn_pm_threshold_group = optIfOMSnSinkPreOtnPMThresholdGroup.setStatus('current')
opt_if_om_sn_source_pre_otn_pm_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 17)).setObjects(('OPT-IF-MIB', 'optIfOMSnSrcCurrentSuspectedFlag'), ('OPT-IF-MIB', 'optIfOMSnSrcCurrentOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcCurrentLowOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcCurrentHighOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcCurrentAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcCurrentLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcCurrentHighAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcIntervalSuspectedFlag'), ('OPT-IF-MIB', 'optIfOMSnSrcIntervalLastOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcIntervalLowOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcIntervalHighOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcIntervalLastAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcIntervalLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcIntervalHighAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcCurDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOMSnSrcCurDayLowOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcCurDayHighOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcCurDayLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcCurDayHighAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcPrevDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOMSnSrcPrevDayLastOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcPrevDayLowOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcPrevDayHighOutputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcPrevDayLastAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcPrevDayLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOMSnSrcPrevDayHighAggregatedInputPower'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_om_sn_source_pre_otn_pm_group = optIfOMSnSourcePreOtnPMGroup.setStatus('current')
opt_if_om_sn_source_pre_otn_pm_threshold_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 18)).setObjects(('OPT-IF-MIB', 'optIfOMSnSrcCurrentLowerOutputPowerThreshold'), ('OPT-IF-MIB', 'optIfOMSnSrcCurrentUpperOutputPowerThreshold'), ('OPT-IF-MIB', 'optIfOMSnSrcCurrentLowerInputPowerThreshold'), ('OPT-IF-MIB', 'optIfOMSnSrcCurrentUpperInputPowerThreshold'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_om_sn_source_pre_otn_pm_threshold_group = optIfOMSnSourcePreOtnPMThresholdGroup.setStatus('current')
opt_if_o_ch_group_common_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 19)).setObjects(('OPT-IF-MIB', 'optIfOChGroupDirectionality'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_o_ch_group_common_group = optIfOChGroupCommonGroup.setStatus('current')
opt_if_o_ch_group_sink_pre_otn_pm_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 20)).setObjects(('OPT-IF-MIB', 'optIfOChGroupSinkCurrentSuspectedFlag'), ('OPT-IF-MIB', 'optIfOChGroupSinkCurrentAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkCurrentLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkCurrentHighAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkCurrentOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkCurrentLowOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkCurrentHighOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkIntervalSuspectedFlag'), ('OPT-IF-MIB', 'optIfOChGroupSinkIntervalLastAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkIntervalLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkIntervalHighAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkIntervalLastOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkIntervalLowOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkIntervalHighOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkCurDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOChGroupSinkCurDayLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkCurDayHighAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkCurDayLowOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkCurDayHighOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkPrevDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOChGroupSinkPrevDayLastAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkPrevDayLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkPrevDayHighAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkPrevDayLastOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkPrevDayLowOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSinkPrevDayHighOutputPower'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_o_ch_group_sink_pre_otn_pm_group = optIfOChGroupSinkPreOtnPMGroup.setStatus('current')
opt_if_o_ch_group_sink_pre_otn_pm_threshold_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 21)).setObjects(('OPT-IF-MIB', 'optIfOChGroupSinkCurrentLowerInputPowerThreshold'), ('OPT-IF-MIB', 'optIfOChGroupSinkCurrentUpperInputPowerThreshold'), ('OPT-IF-MIB', 'optIfOChGroupSinkCurrentLowerOutputPowerThreshold'), ('OPT-IF-MIB', 'optIfOChGroupSinkCurrentUpperOutputPowerThreshold'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_o_ch_group_sink_pre_otn_pm_threshold_group = optIfOChGroupSinkPreOtnPMThresholdGroup.setStatus('current')
opt_if_o_ch_group_source_pre_otn_pm_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 22)).setObjects(('OPT-IF-MIB', 'optIfOChGroupSrcCurrentSuspectedFlag'), ('OPT-IF-MIB', 'optIfOChGroupSrcCurrentOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcCurrentLowOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcCurrentHighOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcCurrentAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcCurrentLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcCurrentHighAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcIntervalSuspectedFlag'), ('OPT-IF-MIB', 'optIfOChGroupSrcIntervalLastOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcIntervalLowOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcIntervalHighOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcIntervalLastAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcIntervalLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcIntervalHighAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcCurDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOChGroupSrcCurDayLowOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcCurDayHighOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcCurDayLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcCurDayHighAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcPrevDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOChGroupSrcPrevDayLastOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcPrevDayLowOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcPrevDayHighOutputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcPrevDayLastAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcPrevDayLowAggregatedInputPower'), ('OPT-IF-MIB', 'optIfOChGroupSrcPrevDayHighAggregatedInputPower'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_o_ch_group_source_pre_otn_pm_group = optIfOChGroupSourcePreOtnPMGroup.setStatus('current')
opt_if_o_ch_group_source_pre_otn_pm_threshold_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 23)).setObjects(('OPT-IF-MIB', 'optIfOChGroupSrcCurrentLowerOutputPowerThreshold'), ('OPT-IF-MIB', 'optIfOChGroupSrcCurrentUpperOutputPowerThreshold'), ('OPT-IF-MIB', 'optIfOChGroupSrcCurrentLowerInputPowerThreshold'), ('OPT-IF-MIB', 'optIfOChGroupSrcCurrentUpperInputPowerThreshold'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_o_ch_group_source_pre_otn_pm_threshold_group = optIfOChGroupSourcePreOtnPMThresholdGroup.setStatus('current')
opt_if_o_ch_common_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 24)).setObjects(('OPT-IF-MIB', 'optIfOChDirectionality'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_o_ch_common_group = optIfOChCommonGroup.setStatus('current')
opt_if_o_ch_sink_group_basic = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 25)).setObjects(('OPT-IF-MIB', 'optIfOChCurrentStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_o_ch_sink_group_basic = optIfOChSinkGroupBasic.setStatus('current')
opt_if_o_ch_sink_pre_otn_pm_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 26)).setObjects(('OPT-IF-MIB', 'optIfOChSinkCurrentSuspectedFlag'), ('OPT-IF-MIB', 'optIfOChSinkCurrentInputPower'), ('OPT-IF-MIB', 'optIfOChSinkCurrentLowInputPower'), ('OPT-IF-MIB', 'optIfOChSinkCurrentHighInputPower'), ('OPT-IF-MIB', 'optIfOChSinkIntervalSuspectedFlag'), ('OPT-IF-MIB', 'optIfOChSinkIntervalLastInputPower'), ('OPT-IF-MIB', 'optIfOChSinkIntervalLowInputPower'), ('OPT-IF-MIB', 'optIfOChSinkIntervalHighInputPower'), ('OPT-IF-MIB', 'optIfOChSinkCurDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOChSinkCurDayLowInputPower'), ('OPT-IF-MIB', 'optIfOChSinkCurDayHighInputPower'), ('OPT-IF-MIB', 'optIfOChSinkPrevDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOChSinkPrevDayLastInputPower'), ('OPT-IF-MIB', 'optIfOChSinkPrevDayLowInputPower'), ('OPT-IF-MIB', 'optIfOChSinkPrevDayHighInputPower'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_o_ch_sink_pre_otn_pm_group = optIfOChSinkPreOtnPMGroup.setStatus('current')
opt_if_o_ch_sink_pre_otn_pm_threshold_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 27)).setObjects(('OPT-IF-MIB', 'optIfOChSinkCurrentLowerInputPowerThreshold'), ('OPT-IF-MIB', 'optIfOChSinkCurrentUpperInputPowerThreshold'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_o_ch_sink_pre_otn_pm_threshold_group = optIfOChSinkPreOtnPMThresholdGroup.setStatus('current')
opt_if_o_ch_source_pre_otn_pm_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 28)).setObjects(('OPT-IF-MIB', 'optIfOChSrcCurrentSuspectedFlag'), ('OPT-IF-MIB', 'optIfOChSrcCurrentOutputPower'), ('OPT-IF-MIB', 'optIfOChSrcCurrentLowOutputPower'), ('OPT-IF-MIB', 'optIfOChSrcCurrentHighOutputPower'), ('OPT-IF-MIB', 'optIfOChSrcIntervalSuspectedFlag'), ('OPT-IF-MIB', 'optIfOChSrcIntervalLastOutputPower'), ('OPT-IF-MIB', 'optIfOChSrcIntervalLowOutputPower'), ('OPT-IF-MIB', 'optIfOChSrcIntervalHighOutputPower'), ('OPT-IF-MIB', 'optIfOChSrcCurDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOChSrcCurDayLowOutputPower'), ('OPT-IF-MIB', 'optIfOChSrcCurDayHighOutputPower'), ('OPT-IF-MIB', 'optIfOChSrcPrevDaySuspectedFlag'), ('OPT-IF-MIB', 'optIfOChSrcPrevDayLastOutputPower'), ('OPT-IF-MIB', 'optIfOChSrcPrevDayLowOutputPower'), ('OPT-IF-MIB', 'optIfOChSrcPrevDayHighOutputPower'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_o_ch_source_pre_otn_pm_group = optIfOChSourcePreOtnPMGroup.setStatus('current')
opt_if_o_ch_source_pre_otn_pm_threshold_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 29)).setObjects(('OPT-IF-MIB', 'optIfOChSrcCurrentLowerOutputPowerThreshold'), ('OPT-IF-MIB', 'optIfOChSrcCurrentUpperOutputPowerThreshold'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_o_ch_source_pre_otn_pm_threshold_group = optIfOChSourcePreOtnPMThresholdGroup.setStatus('current')
opt_if_ot_uk_common_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 30)).setObjects(('OPT-IF-MIB', 'optIfOTUkDirectionality'), ('OPT-IF-MIB', 'optIfOTUkBitRateK'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_ot_uk_common_group = optIfOTUkCommonGroup.setStatus('current')
opt_if_ot_uk_source_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 31)).setObjects(('OPT-IF-MIB', 'optIfOTUkTraceIdentifierTransmitted'), ('OPT-IF-MIB', 'optIfOTUkSourceAdaptActive'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_ot_uk_source_group = optIfOTUkSourceGroup.setStatus('current')
opt_if_ot_uk_sink_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 32)).setObjects(('OPT-IF-MIB', 'optIfOTUkDAPIExpected'), ('OPT-IF-MIB', 'optIfOTUkSAPIExpected'), ('OPT-IF-MIB', 'optIfOTUkTraceIdentifierAccepted'), ('OPT-IF-MIB', 'optIfOTUkTIMDetMode'), ('OPT-IF-MIB', 'optIfOTUkTIMActEnabled'), ('OPT-IF-MIB', 'optIfOTUkDEGThr'), ('OPT-IF-MIB', 'optIfOTUkDEGM'), ('OPT-IF-MIB', 'optIfOTUkSinkAdaptActive'), ('OPT-IF-MIB', 'optIfOTUkSinkFECEnabled'), ('OPT-IF-MIB', 'optIfOTUkCurrentStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_ot_uk_sink_group = optIfOTUkSinkGroup.setStatus('current')
opt_if_gcc0_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 33)).setObjects(('OPT-IF-MIB', 'optIfGCC0Application'), ('OPT-IF-MIB', 'optIfGCC0RowStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_gcc0_group = optIfGCC0Group.setStatus('current')
opt_if_od_uk_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 34)).setObjects(('OPT-IF-MIB', 'optIfODUkDirectionality'), ('OPT-IF-MIB', 'optIfODUkBitRateK'), ('OPT-IF-MIB', 'optIfODUkTcmFieldsInUse'), ('OPT-IF-MIB', 'optIfODUkPositionSeqCurrentSize'), ('OPT-IF-MIB', 'optIfODUkPositionSeqPosition'), ('OPT-IF-MIB', 'optIfODUkPositionSeqPointer'), ('OPT-IF-MIB', 'optIfODUkTtpPresent'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_od_uk_group = optIfODUkGroup.setStatus('current')
opt_if_od_uk_ttp_source_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 35)).setObjects(('OPT-IF-MIB', 'optIfODUkTtpTraceIdentifierTransmitted'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_od_uk_ttp_source_group = optIfODUkTtpSourceGroup.setStatus('current')
opt_if_od_uk_ttp_sink_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 36)).setObjects(('OPT-IF-MIB', 'optIfODUkTtpDAPIExpected'), ('OPT-IF-MIB', 'optIfODUkTtpSAPIExpected'), ('OPT-IF-MIB', 'optIfODUkTtpTraceIdentifierAccepted'), ('OPT-IF-MIB', 'optIfODUkTtpTIMDetMode'), ('OPT-IF-MIB', 'optIfODUkTtpTIMActEnabled'), ('OPT-IF-MIB', 'optIfODUkTtpDEGThr'), ('OPT-IF-MIB', 'optIfODUkTtpDEGM'), ('OPT-IF-MIB', 'optIfODUkTtpCurrentStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_od_uk_ttp_sink_group = optIfODUkTtpSinkGroup.setStatus('current')
opt_if_od_uk_nim_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 37)).setObjects(('OPT-IF-MIB', 'optIfODUkNimDAPIExpected'), ('OPT-IF-MIB', 'optIfODUkNimSAPIExpected'), ('OPT-IF-MIB', 'optIfODUkNimTraceIdentifierAccepted'), ('OPT-IF-MIB', 'optIfODUkNimTIMDetMode'), ('OPT-IF-MIB', 'optIfODUkNimTIMActEnabled'), ('OPT-IF-MIB', 'optIfODUkNimDEGThr'), ('OPT-IF-MIB', 'optIfODUkNimDEGM'), ('OPT-IF-MIB', 'optIfODUkNimCurrentStatus'), ('OPT-IF-MIB', 'optIfODUkNimRowStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_od_uk_nim_group = optIfODUkNimGroup.setStatus('current')
opt_if_gcc12_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 38)).setObjects(('OPT-IF-MIB', 'optIfGCC12GCCPassThrough'), ('OPT-IF-MIB', 'optIfGCC12Application'), ('OPT-IF-MIB', 'optIfGCC12RowStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_gcc12_group = optIfGCC12Group.setStatus('current')
opt_if_od_uk_t_common_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 39)).setObjects(('OPT-IF-MIB', 'optIfODUkTRowStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_od_uk_t_common_group = optIfODUkTCommonGroup.setStatus('current')
opt_if_od_uk_t_source_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 40)).setObjects(('OPT-IF-MIB', 'optIfODUkTTraceIdentifierTransmitted'), ('OPT-IF-MIB', 'optIfODUkTSourceLockSignalAdminState'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_od_uk_t_source_group = optIfODUkTSourceGroup.setStatus('current')
opt_if_od_uk_t_sink_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 41)).setObjects(('OPT-IF-MIB', 'optIfODUkTDAPIExpected'), ('OPT-IF-MIB', 'optIfODUkTSAPIExpected'), ('OPT-IF-MIB', 'optIfODUkTTraceIdentifierAccepted'), ('OPT-IF-MIB', 'optIfODUkTTIMDetMode'), ('OPT-IF-MIB', 'optIfODUkTTIMActEnabled'), ('OPT-IF-MIB', 'optIfODUkTDEGThr'), ('OPT-IF-MIB', 'optIfODUkTDEGM'), ('OPT-IF-MIB', 'optIfODUkTCurrentStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_od_uk_t_sink_group = optIfODUkTSinkGroup.setStatus('current')
opt_if_od_uk_t_sink_group_ctp = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 42)).setObjects(('OPT-IF-MIB', 'optIfODUkTSinkMode'), ('OPT-IF-MIB', 'optIfODUkTSinkLockSignalAdminState'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_od_uk_t_sink_group_ctp = optIfODUkTSinkGroupCtp.setStatus('current')
opt_if_od_uk_t_nim_group = object_group((1, 3, 6, 1, 2, 1, 10, 133, 2, 1, 43)).setObjects(('OPT-IF-MIB', 'optIfODUkTNimDAPIExpected'), ('OPT-IF-MIB', 'optIfODUkTNimSAPIExpected'), ('OPT-IF-MIB', 'optIfODUkTNimTraceIdentifierAccepted'), ('OPT-IF-MIB', 'optIfODUkTNimTIMDetMode'), ('OPT-IF-MIB', 'optIfODUkTNimTIMActEnabled'), ('OPT-IF-MIB', 'optIfODUkTNimDEGThr'), ('OPT-IF-MIB', 'optIfODUkTNimDEGM'), ('OPT-IF-MIB', 'optIfODUkTNimCurrentStatus'), ('OPT-IF-MIB', 'optIfODUkTNimRowStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_od_uk_t_nim_group = optIfODUkTNimGroup.setStatus('current')
opt_if_otn_config_compl = module_compliance((1, 3, 6, 1, 2, 1, 10, 133, 2, 2, 1)).setObjects(('OPT-IF-MIB', 'optIfOTMnGroup'), ('OPT-IF-MIB', 'optIfOTSnCommonGroup'), ('OPT-IF-MIB', 'optIfOTSnSourceGroupFull'), ('OPT-IF-MIB', 'optIfOTSnAPRStatusGroup'), ('OPT-IF-MIB', 'optIfOTSnAPRControlGroup'), ('OPT-IF-MIB', 'optIfOTSnSinkGroupBasic'), ('OPT-IF-MIB', 'optIfOTSnSinkGroupFull'), ('OPT-IF-MIB', 'optIfOMSnCommonGroup'), ('OPT-IF-MIB', 'optIfOMSnSinkGroupBasic'), ('OPT-IF-MIB', 'optIfOChGroupCommonGroup'), ('OPT-IF-MIB', 'optIfOChCommonGroup'), ('OPT-IF-MIB', 'optIfOChSinkGroupBasic'), ('OPT-IF-MIB', 'optIfOTUkCommonGroup'), ('OPT-IF-MIB', 'optIfOTUkSourceGroup'), ('OPT-IF-MIB', 'optIfOTUkSinkGroup'), ('OPT-IF-MIB', 'optIfGCC0Group'), ('OPT-IF-MIB', 'optIfODUkGroup'), ('OPT-IF-MIB', 'optIfODUkTtpSourceGroup'), ('OPT-IF-MIB', 'optIfODUkTtpSinkGroup'), ('OPT-IF-MIB', 'optIfODUkNimGroup'), ('OPT-IF-MIB', 'optIfGCC12Group'), ('OPT-IF-MIB', 'optIfODUkTCommonGroup'), ('OPT-IF-MIB', 'optIfODUkTSourceGroup'), ('OPT-IF-MIB', 'optIfODUkTSinkGroup'), ('OPT-IF-MIB', 'optIfODUkTSinkGroupCtp'), ('OPT-IF-MIB', 'optIfODUkTNimGroup'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_otn_config_compl = optIfOtnConfigCompl.setStatus('current')
opt_if_pre_otn_pm_compl = module_compliance((1, 3, 6, 1, 2, 1, 10, 133, 2, 2, 2)).setObjects(('OPT-IF-MIB', 'optIfPerfMonGroup'), ('OPT-IF-MIB', 'optIfOTSnSinkPreOtnPMGroup'), ('OPT-IF-MIB', 'optIfOTSnSinkPreOtnPMThresholdGroup'), ('OPT-IF-MIB', 'optIfOTSnSourcePreOtnPMGroup'), ('OPT-IF-MIB', 'optIfOTSnSourcePreOtnPMThresholdGroup'), ('OPT-IF-MIB', 'optIfOMSnSinkPreOtnPMGroup'), ('OPT-IF-MIB', 'optIfOMSnSinkPreOtnPMThresholdGroup'), ('OPT-IF-MIB', 'optIfOMSnSourcePreOtnPMGroup'), ('OPT-IF-MIB', 'optIfOMSnSourcePreOtnPMThresholdGroup'), ('OPT-IF-MIB', 'optIfOChGroupSinkPreOtnPMGroup'), ('OPT-IF-MIB', 'optIfOChGroupSinkPreOtnPMThresholdGroup'), ('OPT-IF-MIB', 'optIfOChGroupSourcePreOtnPMGroup'), ('OPT-IF-MIB', 'optIfOChGroupSourcePreOtnPMThresholdGroup'), ('OPT-IF-MIB', 'optIfOChSinkPreOtnPMGroup'), ('OPT-IF-MIB', 'optIfOChSinkPreOtnPMThresholdGroup'), ('OPT-IF-MIB', 'optIfOChSourcePreOtnPMGroup'), ('OPT-IF-MIB', 'optIfOChSourcePreOtnPMThresholdGroup'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
opt_if_pre_otn_pm_compl = optIfPreOtnPMCompl.setStatus('current')
mibBuilder.exportSymbols('OPT-IF-MIB', optIfOChSinkIntervalHighInputPower=optIfOChSinkIntervalHighInputPower, optIfOChSrcCurrentHighOutputPower=optIfOChSrcCurrentHighOutputPower, optIfOTSnSrcIntervalLowOutputPower=optIfOTSnSrcIntervalLowOutputPower, optIfOTMnInterfaceType=optIfOTMnInterfaceType, optIfOTSnSinkCurrentLowOutputPower=optIfOTSnSinkCurrentLowOutputPower, optIfOMSnSrcCurrentEntry=optIfOMSnSrcCurrentEntry, optIfODUkNimTIMDetMode=optIfODUkNimTIMDetMode, optIfOTSnSinkCurDayEntry=optIfOTSnSinkCurDayEntry, optIfOChSrcCurDayTable=optIfOChSrcCurDayTable, optIfOMSnSinkCurrentHighOutputPower=optIfOMSnSinkCurrentHighOutputPower, optIfOMSnSrcCurDayLowAggregatedInputPower=optIfOMSnSrcCurDayLowAggregatedInputPower, optIfOChSinkCurrentLowInputPower=optIfOChSinkCurrentLowInputPower, optIfOChSinkCurrentLowerInputPowerThreshold=optIfOChSinkCurrentLowerInputPowerThreshold, optIfOTSnSinkIntervalHighInputPower=optIfOTSnSinkIntervalHighInputPower, optIfOTSnSinkPreOtnPMThresholdGroup=optIfOTSnSinkPreOtnPMThresholdGroup, optIfOChSinkCurDayTable=optIfOChSinkCurDayTable, optIfOChGroupSrcPrevDayLastOutputPower=optIfOChGroupSrcPrevDayLastOutputPower, optIfOTSnSinkCurDayHighOutputPower=optIfOTSnSinkCurDayHighOutputPower, optIfOMSnSinkIntervalLastOutputPower=optIfOMSnSinkIntervalLastOutputPower, optIfOChGroupSrcCurrentHighOutputPower=optIfOChGroupSrcCurrentHighOutputPower, optIfOTSnAprStatus=optIfOTSnAprStatus, optIfODUkTTraceIdentifierAccepted=optIfODUkTTraceIdentifierAccepted, optIfOTSnSourceGroupFull=optIfOTSnSourceGroupFull, optIfOChGroupSinkIntervalHighAggregatedInputPower=optIfOChGroupSinkIntervalHighAggregatedInputPower, optIfODUkTSourceLockSignalAdminState=optIfODUkTSourceLockSignalAdminState, optIfOMSnSrcCurrentSuspectedFlag=optIfOMSnSrcCurrentSuspectedFlag, optIfOChGroupSrcIntervalTable=optIfOChGroupSrcIntervalTable, optIfOMSnSinkPrevDayHighOutputPower=optIfOMSnSinkPrevDayHighOutputPower, optIfODUkTCommonGroup=optIfODUkTCommonGroup, optIfOChSinkIntervalEntry=optIfOChSinkIntervalEntry, optIfOTSnSrcPrevDaySuspectedFlag=optIfOTSnSrcPrevDaySuspectedFlag, optIfOMSnSrcCurrentAggregatedInputPower=optIfOMSnSrcCurrentAggregatedInputPower, optIfOTSnSinkCurrentUpperOutputPowerThreshold=optIfOTSnSinkCurrentUpperOutputPowerThreshold, optIfOTSnSinkPrevDaySuspectedFlag=optIfOTSnSinkPrevDaySuspectedFlag, optIfOChGroupSrcCurDayTable=optIfOChGroupSrcCurDayTable, optIfOTSnSinkIntervalSuspectedFlag=optIfOTSnSinkIntervalSuspectedFlag, optIfOChGroupSinkIntervalLastAggregatedInputPower=optIfOChGroupSinkIntervalLastAggregatedInputPower, OptIfTIMDetMode=OptIfTIMDetMode, optIfOChGroupSinkPrevDayTable=optIfOChGroupSinkPrevDayTable, optIfOTUkConfigEntry=optIfOTUkConfigEntry, optIfOTSnSinkCurDayLowOutputPower=optIfOTSnSinkCurDayLowOutputPower, optIfOChGroupSrcCurDaySuspectedFlag=optIfOChGroupSrcCurDaySuspectedFlag, optIfOChSrcPrevDayLowOutputPower=optIfOChSrcPrevDayLowOutputPower, optIfOMSnSinkCurrentHighAggregatedInputPower=optIfOMSnSinkCurrentHighAggregatedInputPower, optIfOtnConfigCompl=optIfOtnConfigCompl, optIfOMSnSrcCurDayHighOutputPower=optIfOMSnSrcCurDayHighOutputPower, optIfOTSnSrcCurrentEntry=optIfOTSnSrcCurrentEntry, optIfOTSnSrcPrevDayLastInputPower=optIfOTSnSrcPrevDayLastInputPower, optIfGCC12ConfigTable=optIfGCC12ConfigTable, optIfOMSnSinkCurrentLowerOutputPowerThreshold=optIfOMSnSinkCurrentLowerOutputPowerThreshold, optIfGCC12GCCAccess=optIfGCC12GCCAccess, optIfGCC0Application=optIfGCC0Application, optIfOMSnSrcCurrentLowAggregatedInputPower=optIfOMSnSrcCurrentLowAggregatedInputPower, optIfOTSnSrcCurDayHighInputPower=optIfOTSnSrcCurDayHighInputPower, optIfODUkTTraceIdentifierTransmitted=optIfODUkTTraceIdentifierTransmitted, optIfPerfMonGroup=optIfPerfMonGroup, optIfOChGroupSinkPrevDayHighAggregatedInputPower=optIfOChGroupSinkPrevDayHighAggregatedInputPower, optIfOTSnSrcPrevDayLastOutputPower=optIfOTSnSrcPrevDayLastOutputPower, optIfOTSnSinkCurrentLowerOutputPowerThreshold=optIfOTSnSinkCurrentLowerOutputPowerThreshold, optIfOMSnSrcCurrentLowerInputPowerThreshold=optIfOMSnSrcCurrentLowerInputPowerThreshold, optIfGroups=optIfGroups, optIfOMSnSrcIntervalHighOutputPower=optIfOMSnSrcIntervalHighOutputPower, optIfOChGroupSinkCurDayLowAggregatedInputPower=optIfOChGroupSinkCurDayLowAggregatedInputPower, optIfODUkPositionSeqPosition=optIfODUkPositionSeqPosition, optIfOMSnSrcCurDayTable=optIfOMSnSrcCurDayTable, OptIfExDAPI=OptIfExDAPI, optIfOTSnSrcPrevDayLowOutputPower=optIfOTSnSrcPrevDayLowOutputPower, optIfGCC12Codirectional=optIfGCC12Codirectional, optIfOChSourcePreOtnPMThresholdGroup=optIfOChSourcePreOtnPMThresholdGroup, optIfGCC12ConfigEntry=optIfGCC12ConfigEntry, optIfODUkTCurrentStatus=optIfODUkTCurrentStatus, optIfOChSrcPrevDayEntry=optIfOChSrcPrevDayEntry, optIfOMSnSrcIntervalLowAggregatedInputPower=optIfOMSnSrcIntervalLowAggregatedInputPower, optIfConfs=optIfConfs, optIfODUkTtpSinkGroup=optIfODUkTtpSinkGroup, optIfGCC0ConfigTable=optIfGCC0ConfigTable, optIfOTUkDEGM=optIfOTUkDEGM, optIfODUkTNimSAPIExpected=optIfODUkTNimSAPIExpected, optIfOMSnSrcPrevDayTable=optIfOMSnSrcPrevDayTable, optIfOChGroupSrcPrevDayHighAggregatedInputPower=optIfOChGroupSrcPrevDayHighAggregatedInputPower, optIfOChGroupCommonGroup=optIfOChGroupCommonGroup, optIfOChGroupSinkIntervalHighOutputPower=optIfOChGroupSinkIntervalHighOutputPower, optIfOTSnSinkPrevDayLastInputPower=optIfOTSnSinkPrevDayLastInputPower, optIfOChGroupSrcCurrentLowerInputPowerThreshold=optIfOChGroupSrcCurrentLowerInputPowerThreshold, optIfOMSnSinkIntervalSuspectedFlag=optIfOMSnSinkIntervalSuspectedFlag, optIfOMSnSrcCurrentTable=optIfOMSnSrcCurrentTable, optIfOTSnSinkPrevDayTable=optIfOTSnSinkPrevDayTable, OptIfSinkOrSource=OptIfSinkOrSource, optIfOChGroupSrcIntervalLastOutputPower=optIfOChGroupSrcIntervalLastOutputPower, optIfODUkTcmFieldsInUse=optIfODUkTcmFieldsInUse, optIfOTSnSrcCurDayTable=optIfOTSnSrcCurDayTable, optIfODUkTNimConfigEntry=optIfODUkTNimConfigEntry, optIfOChSinkCurDayHighInputPower=optIfOChSinkCurDayHighInputPower, optIfOMSnSinkIntervalEntry=optIfOMSnSinkIntervalEntry, optIfODUkTNimDEGThr=optIfODUkTNimDEGThr, optIfOMSnSinkPrevDayLowOutputPower=optIfOMSnSinkPrevDayLowOutputPower, optIfOTSnSinkCurrentOutputPower=optIfOTSnSinkCurrentOutputPower, optIfPerfMonIntervalTable=optIfPerfMonIntervalTable, optIfOMSnSinkIntervalHighOutputPower=optIfOMSnSinkIntervalHighOutputPower, optIfOMSnCurrentStatus=optIfOMSnCurrentStatus, optIfMibModule=optIfMibModule, optIfOChGroupDirectionality=optIfOChGroupDirectionality, optIfODUkTtpConfigEntry=optIfODUkTtpConfigEntry, optIfODUkTtpPresent=optIfODUkTtpPresent, optIfODUkTNimTcmField=optIfODUkTNimTcmField, optIfOChSrcCurDayHighOutputPower=optIfOChSrcCurDayHighOutputPower, optIfOTUkTIMActEnabled=optIfOTUkTIMActEnabled, optIfOChSrcCurrentEntry=optIfOChSrcCurrentEntry, optIfODUkTSourceGroup=optIfODUkTSourceGroup, optIfOMSnSrcCurrentLowOutputPower=optIfOMSnSrcCurrentLowOutputPower, optIfOChSrcCurrentOutputPower=optIfOChSrcCurrentOutputPower, optIfOChGroupSourcePreOtnPMThresholdGroup=optIfOChGroupSourcePreOtnPMThresholdGroup, optIfOMSnSinkPrevDayLowAggregatedInputPower=optIfOMSnSinkPrevDayLowAggregatedInputPower, optIfOMSnSinkCurrentOutputPower=optIfOMSnSinkCurrentOutputPower, optIfOChGroupSrcCurDayLowOutputPower=optIfOChGroupSrcCurDayLowOutputPower, optIfOMSnSrcCurrentHighAggregatedInputPower=optIfOMSnSrcCurrentHighAggregatedInputPower, optIfOTSnAPRControlGroup=optIfOTSnAPRControlGroup, optIfODUkNimDEGM=optIfODUkNimDEGM, optIfOMSnSrcIntervalHighAggregatedInputPower=optIfOMSnSrcIntervalHighAggregatedInputPower, optIfODUkPositionSeqEntry=optIfODUkPositionSeqEntry, optIfODUk=optIfODUk, optIfOChGroupSinkCurrentUpperInputPowerThreshold=optIfOChGroupSinkCurrentUpperInputPowerThreshold, optIfOChGroupSinkCurDayHighOutputPower=optIfOChGroupSinkCurDayHighOutputPower, optIfOChGroupSinkCurrentLowerOutputPowerThreshold=optIfOChGroupSinkCurrentLowerOutputPowerThreshold, optIfOTMnReduced=optIfOTMnReduced, optIfOMSnSinkCurDayHighOutputPower=optIfOMSnSinkCurDayHighOutputPower, optIfOTSnSinkIntervalNumber=optIfOTSnSinkIntervalNumber, optIfOChGroupSourcePreOtnPMGroup=optIfOChGroupSourcePreOtnPMGroup, optIfOTSnAprControl=optIfOTSnAprControl, optIfOChSinkIntervalNumber=optIfOChSinkIntervalNumber, optIfOMSnSinkPrevDayLastAggregatedInputPower=optIfOMSnSinkPrevDayLastAggregatedInputPower, optIfODUkTTIMDetMode=optIfODUkTTIMDetMode, optIfODUkTNimRowStatus=optIfODUkTNimRowStatus, optIfOChSrcIntervalHighOutputPower=optIfOChSrcIntervalHighOutputPower, optIfODUkTNimCurrentStatus=optIfODUkTNimCurrentStatus, optIfODUkTtpSourceGroup=optIfODUkTtpSourceGroup, optIfOTSnSrcIntervalEntry=optIfOTSnSrcIntervalEntry, optIfPerfMonIntervalNumIntervals=optIfPerfMonIntervalNumIntervals, optIfOChSrcCurDaySuspectedFlag=optIfOChSrcCurDaySuspectedFlag, optIfOTUkSinkFECEnabled=optIfOTUkSinkFECEnabled, optIfOTSnSinkCurrentLowerInputPowerThreshold=optIfOTSnSinkCurrentLowerInputPowerThreshold, optIfOChSrcCurrentLowOutputPower=optIfOChSrcCurrentLowOutputPower, optIfOChGroupSrcPrevDayHighOutputPower=optIfOChGroupSrcPrevDayHighOutputPower, OptIfDirectionality=OptIfDirectionality, optIfOMSnSrcCurrentHighOutputPower=optIfOMSnSrcCurrentHighOutputPower, optIfOTSnSourcePreOtnPMGroup=optIfOTSnSourcePreOtnPMGroup, optIfOMSnSinkGroupBasic=optIfOMSnSinkGroupBasic, optIfODUkGroup=optIfODUkGroup, optIfOTSnSrcCurrentUpperOutputPowerThreshold=optIfOTSnSrcCurrentUpperOutputPowerThreshold, optIfOChGroupSinkCurrentUpperOutputPowerThreshold=optIfOChGroupSinkCurrentUpperOutputPowerThreshold, optIfOChGroupSrcCurrentAggregatedInputPower=optIfOChGroupSrcCurrentAggregatedInputPower, optIfOMSnConfigEntry=optIfOMSnConfigEntry, optIfOChSinkIntervalLastInputPower=optIfOChSinkIntervalLastInputPower, optIfOMSnSinkCurrentUpperOutputPowerThreshold=optIfOMSnSinkCurrentUpperOutputPowerThreshold, optIfOTUkBitRateK=optIfOTUkBitRateK, optIfOChGroupSrcIntervalLowOutputPower=optIfOChGroupSrcIntervalLowOutputPower, OptIfIntervalNumber=OptIfIntervalNumber, optIfOChSinkCurrentSuspectedFlag=optIfOChSinkCurrentSuspectedFlag, optIfOChGroupSrcIntervalHighOutputPower=optIfOChGroupSrcIntervalHighOutputPower, optIfODUkPositionSeqPointer=optIfODUkPositionSeqPointer, optIfODUkTNimTIMDetMode=optIfODUkTNimTIMDetMode, optIfOChGroupSinkPrevDayLowAggregatedInputPower=optIfOChGroupSinkPrevDayLowAggregatedInputPower, optIfOTUkDEGThr=optIfOTUkDEGThr, optIfObjects=optIfObjects, optIfOTSnCurrentStatus=optIfOTSnCurrentStatus, optIfOChSrcIntervalTable=optIfOChSrcIntervalTable, optIfOChCurrentStatus=optIfOChCurrentStatus, optIfOChSinkCurDayEntry=optIfOChSinkCurDayEntry, optIfOChSinkPreOtnPMThresholdGroup=optIfOChSinkPreOtnPMThresholdGroup, optIfOTSnSrcCurDaySuspectedFlag=optIfOTSnSrcCurDaySuspectedFlag, optIfOMSnSinkCurrentEntry=optIfOMSnSinkCurrentEntry, optIfOChDirectionality=optIfOChDirectionality, optIfODUkTtpTIMActEnabled=optIfODUkTtpTIMActEnabled, optIfOChSrcCurDayLowOutputPower=optIfOChSrcCurDayLowOutputPower, optIfOChGroupSinkIntervalLastOutputPower=optIfOChGroupSinkIntervalLastOutputPower, optIfOChGroupSinkIntervalLowOutputPower=optIfOChGroupSinkIntervalLowOutputPower, optIfOTSnSinkGroupFull=optIfOTSnSinkGroupFull, optIfOTSnSrcCurrentHighInputPower=optIfOTSnSrcCurrentHighInputPower, optIfOChGroupSrcIntervalLastAggregatedInputPower=optIfOChGroupSrcIntervalLastAggregatedInputPower, optIfOMSnCommonGroup=optIfOMSnCommonGroup, optIfOMSnSinkPrevDayTable=optIfOMSnSinkPrevDayTable, optIfOChGroupSinkPrevDayLastOutputPower=optIfOChGroupSinkPrevDayLastOutputPower, optIfOChSinkPrevDaySuspectedFlag=optIfOChSinkPrevDaySuspectedFlag, optIfGCC0ConfigEntry=optIfGCC0ConfigEntry, optIfODUkTtpDEGThr=optIfODUkTtpDEGThr, optIfODUkTCodirectional=optIfODUkTCodirectional, optIfOChSinkIntervalTable=optIfOChSinkIntervalTable, optIfPreOtnPMCompl=optIfPreOtnPMCompl, optIfOTUkTIMDetMode=optIfOTUkTIMDetMode, optIfOTUkSourceGroup=optIfOTUkSourceGroup, optIfOChGroupSinkCurrentTable=optIfOChGroupSinkCurrentTable, optIfOChGroupSinkIntervalEntry=optIfOChGroupSinkIntervalEntry, optIfOChSinkCurrentEntry=optIfOChSinkCurrentEntry, optIfOTSnSrcIntervalNumber=optIfOTSnSrcIntervalNumber, optIfOTSnSrcCurDayLowInputPower=optIfOTSnSrcCurDayLowInputPower, optIfOMSnSinkCurDaySuspectedFlag=optIfOMSnSinkCurDaySuspectedFlag, optIfOTSnSrcPrevDayTable=optIfOTSnSrcPrevDayTable, optIfOMSn=optIfOMSn, optIfOTUk=optIfOTUk, optIfOChGroupSrcCurDayEntry=optIfOChGroupSrcCurDayEntry, optIfOTSnDirectionality=optIfOTSnDirectionality, optIfOTSnDAPIExpected=optIfOTSnDAPIExpected, optIfOMSnSrcCurDaySuspectedFlag=optIfOMSnSrcCurDaySuspectedFlag, optIfOTUkConfigTable=optIfOTUkConfigTable, optIfOChGroupSrcIntervalNumber=optIfOChGroupSrcIntervalNumber, optIfOTSnSrcCurrentInputPower=optIfOTSnSrcCurrentInputPower, optIfOMSnDirectionality=optIfOMSnDirectionality, optIfOChGroupSinkIntervalNumber=optIfOChGroupSinkIntervalNumber, optIfOChGroupSinkCurDaySuspectedFlag=optIfOChGroupSinkCurDaySuspectedFlag, optIfOChGroup=optIfOChGroup, optIfOTSnSinkCurrentHighOutputPower=optIfOTSnSinkCurrentHighOutputPower, optIfODUkPositionSeqTable=optIfODUkPositionSeqTable, optIfOMSnSinkIntervalTable=optIfOMSnSinkIntervalTable, optIfOChGroupSrcPrevDayLastAggregatedInputPower=optIfOChGroupSrcPrevDayLastAggregatedInputPower, optIfOChSrcIntervalLastOutputPower=optIfOChSrcIntervalLastOutputPower, optIfCompl=optIfCompl, optIfOMSnSrcPrevDayLastAggregatedInputPower=optIfOMSnSrcPrevDayLastAggregatedInputPower, optIfOChGroupSinkCurrentOutputPower=optIfOChGroupSinkCurrentOutputPower, optIfOMSnSinkIntervalLowOutputPower=optIfOMSnSinkIntervalLowOutputPower, optIfOMSnSinkCurrentUpperInputPowerThreshold=optIfOMSnSinkCurrentUpperInputPowerThreshold, optIfPerfMonIntervalNumInvalidIntervals=optIfPerfMonIntervalNumInvalidIntervals, optIfOChSrcCurrentSuspectedFlag=optIfOChSrcCurrentSuspectedFlag, optIfOMSnSinkPrevDayLastOutputPower=optIfOMSnSinkPrevDayLastOutputPower, optIfOChSinkPrevDayLastInputPower=optIfOChSinkPrevDayLastInputPower, optIfODUkNimCurrentStatus=optIfODUkNimCurrentStatus, optIfOTSnSrcIntervalTable=optIfOTSnSrcIntervalTable, optIfOMSnSinkCurrentSuspectedFlag=optIfOMSnSinkCurrentSuspectedFlag, optIfOChGroupSrcCurrentLowerOutputPowerThreshold=optIfOChGroupSrcCurrentLowerOutputPowerThreshold, optIfODUkNimRowStatus=optIfODUkNimRowStatus, optIfOChSrcPrevDayLastOutputPower=optIfOChSrcPrevDayLastOutputPower, optIfOChGroupSrcCurrentHighAggregatedInputPower=optIfOChGroupSrcCurrentHighAggregatedInputPower, optIfODUkTNimDirectionality=optIfODUkTNimDirectionality, optIfOTSnSinkCurrentInputPower=optIfOTSnSinkCurrentInputPower, optIfOTUkCommonGroup=optIfOTUkCommonGroup, optIfOTSnSrcIntervalLastInputPower=optIfOTSnSrcIntervalLastInputPower, optIfOChSrcCurrentLowerOutputPowerThreshold=optIfOChSrcCurrentLowerOutputPowerThreshold, optIfOChSinkIntervalSuspectedFlag=optIfOChSinkIntervalSuspectedFlag, optIfODUkTtpDAPIExpected=optIfODUkTtpDAPIExpected, optIfOTMnTcmMax=optIfOTMnTcmMax, optIfOChGroupSrcIntervalLowAggregatedInputPower=optIfOChGroupSrcIntervalLowAggregatedInputPower, optIfODUkNimConfigTable=optIfODUkNimConfigTable, optIfOTUkSinkGroup=optIfOTUkSinkGroup, optIfODUkTDEGThr=optIfODUkTDEGThr, optIfOTUkSourceAdaptActive=optIfOTUkSourceAdaptActive, optIfOTSnConfigEntry=optIfOTSnConfigEntry, optIfODUkNimSAPIExpected=optIfODUkNimSAPIExpected, optIfODUkTNimDEGM=optIfODUkTNimDEGM, optIfOTSnSourcePreOtnPMThresholdGroup=optIfOTSnSourcePreOtnPMThresholdGroup, optIfOChSrcPrevDayHighOutputPower=optIfOChSrcPrevDayHighOutputPower, optIfOTUkTraceIdentifierAccepted=optIfOTUkTraceIdentifierAccepted, optIfOMSnSrcPrevDayLowOutputPower=optIfOMSnSrcPrevDayLowOutputPower, optIfODUkTNimTraceIdentifierAccepted=optIfODUkTNimTraceIdentifierAccepted, optIfODUkTtpConfigTable=optIfODUkTtpConfigTable, optIfOChGroupSrcCurrentSuspectedFlag=optIfOChGroupSrcCurrentSuspectedFlag)
mibBuilder.exportSymbols('OPT-IF-MIB', optIfOTSnSinkCurrentLowInputPower=optIfOTSnSinkCurrentLowInputPower, optIfOTUkTraceIdentifierTransmitted=optIfOTUkTraceIdentifierTransmitted, optIfOChGroupSinkCurrentLowAggregatedInputPower=optIfOChGroupSinkCurrentLowAggregatedInputPower, optIfOChSrcPrevDayTable=optIfOChSrcPrevDayTable, optIfOTSnTraceIdentifierTransmitted=optIfOTSnTraceIdentifierTransmitted, optIfGCC0Group=optIfGCC0Group, OptIfTxTI=OptIfTxTI, optIfOChGroupSrcIntervalEntry=optIfOChGroupSrcIntervalEntry, optIfOTSnSinkPrevDayLowInputPower=optIfOTSnSinkPrevDayLowInputPower, optIfODUkBitRateK=optIfODUkBitRateK, optIfOChSinkIntervalLowInputPower=optIfOChSinkIntervalLowInputPower, optIfODUkTSinkGroup=optIfODUkTSinkGroup, optIfOTMnBitRates=optIfOTMnBitRates, optIfODUkNimDAPIExpected=optIfODUkNimDAPIExpected, optIfOChSourcePreOtnPMGroup=optIfOChSourcePreOtnPMGroup, optIfOTSnSrcPrevDayHighInputPower=optIfOTSnSrcPrevDayHighInputPower, optIfOMSnSinkIntervalNumber=optIfOMSnSinkIntervalNumber, optIfOChGroupSrcPrevDayTable=optIfOChGroupSrcPrevDayTable, optIfOChSinkPreOtnPMGroup=optIfOChSinkPreOtnPMGroup, optIfOMSnSinkIntervalHighAggregatedInputPower=optIfOMSnSinkIntervalHighAggregatedInputPower, optIfPerfMonCurDayTimeElapsed=optIfPerfMonCurDayTimeElapsed, optIfOTSnSinkCurDaySuspectedFlag=optIfOTSnSinkCurDaySuspectedFlag, optIfODUkTSinkLockSignalAdminState=optIfODUkTSinkLockSignalAdminState, optIfOChSrcCurrentTable=optIfOChSrcCurrentTable, optIfOChSrcIntervalSuspectedFlag=optIfOChSrcIntervalSuspectedFlag, optIfOTSnSinkIntervalLowOutputPower=optIfOTSnSinkIntervalLowOutputPower, optIfODUkTSinkGroupCtp=optIfODUkTSinkGroupCtp, optIfOTSn=optIfOTSn, optIfOMSnSrcCurDayHighAggregatedInputPower=optIfOMSnSrcCurDayHighAggregatedInputPower, optIfOChSinkGroupBasic=optIfOChSinkGroupBasic, optIfOTSnSinkCurrentUpperInputPowerThreshold=optIfOTSnSinkCurrentUpperInputPowerThreshold, optIfOMSnSrcPrevDayEntry=optIfOMSnSrcPrevDayEntry, optIfOChGroupSinkPrevDayEntry=optIfOChGroupSinkPrevDayEntry, optIfODUkTSAPIExpected=optIfODUkTSAPIExpected, optIfOChGroupSinkCurrentLowerInputPowerThreshold=optIfOChGroupSinkCurrentLowerInputPowerThreshold, optIfOChGroupSinkIntervalTable=optIfOChGroupSinkIntervalTable, optIfOMSnSrcIntervalLowOutputPower=optIfOMSnSrcIntervalLowOutputPower, optIfOTSnConfigTable=optIfOTSnConfigTable, optIfOChGroupSrcCurrentOutputPower=optIfOChGroupSrcCurrentOutputPower, optIfOTSnSrcIntervalLastOutputPower=optIfOTSnSrcIntervalLastOutputPower, optIfOTSnSinkCurrentTable=optIfOTSnSinkCurrentTable, optIfOMSnSinkCurDayTable=optIfOMSnSinkCurDayTable, optIfOChGroupSinkPreOtnPMThresholdGroup=optIfOChGroupSinkPreOtnPMThresholdGroup, optIfOTMnOrder=optIfOTMnOrder, optIfOChSrcCurDayEntry=optIfOChSrcCurDayEntry, optIfOChGroupSinkCurDayEntry=optIfOChGroupSinkCurDayEntry, optIfOChGroupSrcCurrentUpperInputPowerThreshold=optIfOChGroupSrcCurrentUpperInputPowerThreshold, optIfPerfMonCurrentTimeElapsed=optIfPerfMonCurrentTimeElapsed, optIfOTSnSrcCurDayHighOutputPower=optIfOTSnSrcCurDayHighOutputPower, optIfOChSrcIntervalNumber=optIfOChSrcIntervalNumber, optIfGCC12Application=optIfGCC12Application, optIfOTSnSinkCurrentSuspectedFlag=optIfOTSnSinkCurrentSuspectedFlag, optIfOTUkCurrentStatus=optIfOTUkCurrentStatus, optIfOTSnSinkIntervalEntry=optIfOTSnSinkIntervalEntry, optIfOChGroupSrcCurDayHighAggregatedInputPower=optIfOChGroupSrcCurDayHighAggregatedInputPower, optIfOTSnSrcCurDayEntry=optIfOTSnSrcCurDayEntry, optIfOMSnSrcIntervalEntry=optIfOMSnSrcIntervalEntry, optIfOMSnConfigTable=optIfOMSnConfigTable, optIfOTSnSrcPrevDayEntry=optIfOTSnSrcPrevDayEntry, optIfOTSnSinkPrevDayLowOutputPower=optIfOTSnSinkPrevDayLowOutputPower, optIfODUkTtpTIMDetMode=optIfODUkTtpTIMDetMode, optIfOTSnSinkPrevDayHighOutputPower=optIfOTSnSinkPrevDayHighOutputPower, optIfOTSnSinkCurrentHighInputPower=optIfOTSnSinkCurrentHighInputPower, optIfODUkTDEGM=optIfODUkTDEGM, optIfOTSnSinkPreOtnPMGroup=optIfOTSnSinkPreOtnPMGroup, optIfOChGroupSinkPrevDayHighOutputPower=optIfOChGroupSinkPrevDayHighOutputPower, optIfGCC12RowStatus=optIfGCC12RowStatus, optIfODUkT=optIfODUkT, optIfOTSnSAPIExpected=optIfOTSnSAPIExpected, optIfOChSrcPrevDaySuspectedFlag=optIfOChSrcPrevDaySuspectedFlag, optIfOChSinkPrevDayHighInputPower=optIfOChSinkPrevDayHighInputPower, optIfOTSnSrcIntervalHighOutputPower=optIfOTSnSrcIntervalHighOutputPower, optIfOMSnSinkCurDayHighAggregatedInputPower=optIfOMSnSinkCurDayHighAggregatedInputPower, optIfOChGroupSrcCurrentUpperOutputPowerThreshold=optIfOChGroupSrcCurrentUpperOutputPowerThreshold, optIfOMSnSrcCurDayEntry=optIfOMSnSrcCurDayEntry, optIfOChGroupSinkIntervalSuspectedFlag=optIfOChGroupSinkIntervalSuspectedFlag, optIfOTUkDirectionality=optIfOTUkDirectionality, optIfOTSnSrcPrevDayLowInputPower=optIfOTSnSrcPrevDayLowInputPower, optIfOChGroupSrcCurrentTable=optIfOChGroupSrcCurrentTable, optIfODUkNimConfigEntry=optIfODUkNimConfigEntry, optIfOChGroupSinkCurrentAggregatedInputPower=optIfOChGroupSinkCurrentAggregatedInputPower, optIfODUkTtpTraceIdentifierTransmitted=optIfODUkTtpTraceIdentifierTransmitted, optIfOTMnEntry=optIfOTMnEntry, optIfODUkPositionSeqIndex=optIfODUkPositionSeqIndex, optIfOChGroupSrcPrevDaySuspectedFlag=optIfOChGroupSrcPrevDaySuspectedFlag, optIfOChGroupSrcPrevDayLowAggregatedInputPower=optIfOChGroupSrcPrevDayLowAggregatedInputPower, optIfODUkNimTIMActEnabled=optIfODUkNimTIMActEnabled, optIfOChSrcIntervalEntry=optIfOChSrcIntervalEntry, optIfOMSnSourcePreOtnPMThresholdGroup=optIfOMSnSourcePreOtnPMThresholdGroup, optIfOTSnSrcCurrentLowInputPower=optIfOTSnSrcCurrentLowInputPower, optIfOTSnSinkCurDayTable=optIfOTSnSinkCurDayTable, optIfODUkNimDEGThr=optIfODUkNimDEGThr, optIfODUkTTIMActEnabled=optIfODUkTTIMActEnabled, optIfODUkTRowStatus=optIfODUkTRowStatus, optIfOTSnTraceIdentifierAccepted=optIfOTSnTraceIdentifierAccepted, optIfODUkTSinkMode=optIfODUkTSinkMode, optIfOChGroupSrcCurrentEntry=optIfOChGroupSrcCurrentEntry, optIfOTSnTIMDetMode=optIfOTSnTIMDetMode, optIfOMSnSrcCurDayLowOutputPower=optIfOMSnSrcCurDayLowOutputPower, optIfOMSnSrcPrevDayHighOutputPower=optIfOMSnSrcPrevDayHighOutputPower, optIfOTMnGroup=optIfOTMnGroup, optIfODUkTConfigTable=optIfODUkTConfigTable, optIfOTSnSinkIntervalLastOutputPower=optIfOTSnSinkIntervalLastOutputPower, optIfOChGroupSinkPreOtnPMGroup=optIfOChGroupSinkPreOtnPMGroup, optIfGCC0RowStatus=optIfGCC0RowStatus, OptIfExSAPI=OptIfExSAPI, optIfOTSnSinkCurDayHighInputPower=optIfOTSnSinkCurDayHighInputPower, optIfOTSnSrcCurrentLowerOutputPowerThreshold=optIfOTSnSrcCurrentLowerOutputPowerThreshold, optIfOChConfigEntry=optIfOChConfigEntry, optIfOMSnSrcCurrentLowerOutputPowerThreshold=optIfOMSnSrcCurrentLowerOutputPowerThreshold, optIfOTSnSinkCurrentEntry=optIfOTSnSinkCurrentEntry, optIfOTSnSrcCurrentHighOutputPower=optIfOTSnSrcCurrentHighOutputPower, optIfODUkTtpSAPIExpected=optIfODUkTtpSAPIExpected, optIfOTSnSinkIntervalHighOutputPower=optIfOTSnSinkIntervalHighOutputPower, optIfOTSnSrcCurrentLowOutputPower=optIfOTSnSrcCurrentLowOutputPower, optIfODUkTNimConfigTable=optIfODUkTNimConfigTable, optIfOMSnSinkCurrentTable=optIfOMSnSinkCurrentTable, optIfOChGroupSinkCurDayHighAggregatedInputPower=optIfOChGroupSinkCurDayHighAggregatedInputPower, optIfOTMnOpticalReach=optIfOTMnOpticalReach, optIfOChGroupSinkCurrentEntry=optIfOChGroupSinkCurrentEntry, optIfOMSnSinkPrevDaySuspectedFlag=optIfOMSnSinkPrevDaySuspectedFlag, optIfOMSnSinkPreOtnPMGroup=optIfOMSnSinkPreOtnPMGroup, optIfOChGroupSrcCurrentLowAggregatedInputPower=optIfOChGroupSrcCurrentLowAggregatedInputPower, optIfOTSnSinkPrevDayLastOutputPower=optIfOTSnSinkPrevDayLastOutputPower, optIfOChSinkPrevDayLowInputPower=optIfOChSinkPrevDayLowInputPower, optIfOMSnSinkIntervalLastAggregatedInputPower=optIfOMSnSinkIntervalLastAggregatedInputPower, OptIfDEGM=OptIfDEGM, optIfOMSnSinkCurDayLowAggregatedInputPower=optIfOMSnSinkCurDayLowAggregatedInputPower, optIfOMSnSrcPrevDayLowAggregatedInputPower=optIfOMSnSrcPrevDayLowAggregatedInputPower, optIfOTUkSinkAdaptActive=optIfOTUkSinkAdaptActive, optIfOTSnSinkGroupBasic=optIfOTSnSinkGroupBasic, optIfOChSinkCurrentInputPower=optIfOChSinkCurrentInputPower, optIfOChConfigTable=optIfOChConfigTable, optIfOTSnSrcCurrentSuspectedFlag=optIfOTSnSrcCurrentSuspectedFlag, optIfOTSnSinkIntervalLowInputPower=optIfOTSnSinkIntervalLowInputPower, optIfOMSnSrcCurrentUpperInputPowerThreshold=optIfOMSnSrcCurrentUpperInputPowerThreshold, optIfOChGroupConfigTable=optIfOChGroupConfigTable, optIfOChSinkPrevDayEntry=optIfOChSinkPrevDayEntry, optIfOChGroupSinkPrevDaySuspectedFlag=optIfOChGroupSinkPrevDaySuspectedFlag, optIfOChSinkPrevDayTable=optIfOChSinkPrevDayTable, optIfOMSnSinkPrevDayHighAggregatedInputPower=optIfOMSnSinkPrevDayHighAggregatedInputPower, optIfGCC12GCCPassThrough=optIfGCC12GCCPassThrough, optIfOChGroupSrcCurDayLowAggregatedInputPower=optIfOChGroupSrcCurDayLowAggregatedInputPower, optIfOTSnSrcPrevDayHighOutputPower=optIfOTSnSrcPrevDayHighOutputPower, optIfOMSnSrcIntervalTable=optIfOMSnSrcIntervalTable, optIfOTSnSinkPrevDayEntry=optIfOTSnSinkPrevDayEntry, optIfOChGroupConfigEntry=optIfOChGroupConfigEntry, optIfPerfMon=optIfPerfMon, optIfODUkConfigTable=optIfODUkConfigTable, optIfODUkTtpDEGM=optIfODUkTtpDEGM, optIfOTSnSrcCurrentLowerInputPowerThreshold=optIfOTSnSrcCurrentLowerInputPowerThreshold, optIfOTSnSinkPrevDayHighInputPower=optIfOTSnSinkPrevDayHighInputPower, optIfOMSnSinkCurDayLowOutputPower=optIfOMSnSinkCurDayLowOutputPower, OptIfAcTI=OptIfAcTI, optIfOChGroupSinkPrevDayLastAggregatedInputPower=optIfOChGroupSinkPrevDayLastAggregatedInputPower, optIfOTSnSinkIntervalLastInputPower=optIfOTSnSinkIntervalLastInputPower, optIfODUkTtpCurrentStatus=optIfODUkTtpCurrentStatus, optIfOTMn=optIfOTMn, optIfOTSnSrcIntervalHighInputPower=optIfOTSnSrcIntervalHighInputPower, optIfOChGroupSrcPrevDayEntry=optIfOChGroupSrcPrevDayEntry, optIfOTSnSrcCurrentTable=optIfOTSnSrcCurrentTable, optIfPerfMonIntervalEntry=optIfPerfMonIntervalEntry, optIfOChGroupSinkCurrentLowOutputPower=optIfOChGroupSinkCurrentLowOutputPower, optIfOChGroupSinkPrevDayLowOutputPower=optIfOChGroupSinkPrevDayLowOutputPower, optIfOMSnSinkIntervalLowAggregatedInputPower=optIfOMSnSinkIntervalLowAggregatedInputPower, optIfODUkConfigEntry=optIfODUkConfigEntry, optIfOMSnSinkPreOtnPMThresholdGroup=optIfOMSnSinkPreOtnPMThresholdGroup, PYSNMP_MODULE_ID=optIfMibModule, optIfOChGroupSrcCurrentLowOutputPower=optIfOChGroupSrcCurrentLowOutputPower, optIfOMSnSinkCurrentLowerInputPowerThreshold=optIfOMSnSinkCurrentLowerInputPowerThreshold, optIfOMSnSrcIntervalNumber=optIfOMSnSrcIntervalNumber, optIfOChGroupSinkCurrentSuspectedFlag=optIfOChGroupSinkCurrentSuspectedFlag, optIfOChSinkCurDayLowInputPower=optIfOChSinkCurDayLowInputPower, optIfODUkNimTraceIdentifierAccepted=optIfODUkNimTraceIdentifierAccepted, optIfOChGroupSinkCurDayTable=optIfOChGroupSinkCurDayTable, optIfODUkNimGroup=optIfODUkNimGroup, optIfOMSnSrcPrevDayLastOutputPower=optIfOMSnSrcPrevDayLastOutputPower, optIfOChGroupSrcIntervalHighAggregatedInputPower=optIfOChGroupSrcIntervalHighAggregatedInputPower, optIfOChGroupSinkCurrentHighAggregatedInputPower=optIfOChGroupSinkCurrentHighAggregatedInputPower, optIfOTSnSrcCurrentUpperInputPowerThreshold=optIfOTSnSrcCurrentUpperInputPowerThreshold, optIfOMSnSinkCurDayEntry=optIfOMSnSinkCurDayEntry, optIfOChSrcIntervalLowOutputPower=optIfOChSrcIntervalLowOutputPower, OptIfBitRateK=OptIfBitRateK, optIfOChGroupSrcIntervalSuspectedFlag=optIfOChGroupSrcIntervalSuspectedFlag, optIfODUkDirectionality=optIfODUkDirectionality, optIfOTSnSrcCurDayLowOutputPower=optIfOTSnSrcCurDayLowOutputPower, optIfODUkTNimGroup=optIfODUkTNimGroup, optIfOMSnSrcCurrentOutputPower=optIfOMSnSrcCurrentOutputPower, optIfOTSnTIMActEnabled=optIfOTSnTIMActEnabled, optIfOTSnSinkIntervalTable=optIfOTSnSinkIntervalTable, optIfOTSnCommonGroup=optIfOTSnCommonGroup, optIfOTSnSrcIntervalSuspectedFlag=optIfOTSnSrcIntervalSuspectedFlag, optIfOTSnSrcIntervalLowInputPower=optIfOTSnSrcIntervalLowInputPower, optIfOMSnSrcIntervalLastOutputPower=optIfOMSnSrcIntervalLastOutputPower, optIfOChSrcCurrentUpperOutputPowerThreshold=optIfOChSrcCurrentUpperOutputPowerThreshold, optIfOMSnSrcPrevDaySuspectedFlag=optIfOMSnSrcPrevDaySuspectedFlag, optIfOMSnSinkCurrentLowAggregatedInputPower=optIfOMSnSinkCurrentLowAggregatedInputPower, optIfOTUkDAPIExpected=optIfOTUkDAPIExpected, optIfODUkTConfigEntry=optIfODUkTConfigEntry, optIfOChCommonGroup=optIfOChCommonGroup, optIfOTUkSAPIExpected=optIfOTUkSAPIExpected, optIfODUkTDAPIExpected=optIfODUkTDAPIExpected, optIfOTSnSrcCurrentOutputPower=optIfOTSnSrcCurrentOutputPower, optIfOChSinkCurrentHighInputPower=optIfOChSinkCurrentHighInputPower, optIfOMSnSinkPrevDayEntry=optIfOMSnSinkPrevDayEntry, optIfOCh=optIfOCh, optIfOTMnTable=optIfOTMnTable, optIfOTSnSinkCurDayLowInputPower=optIfOTSnSinkCurDayLowInputPower, optIfOMSnSinkCurrentLowOutputPower=optIfOMSnSinkCurrentLowOutputPower, optIfOChSinkCurDaySuspectedFlag=optIfOChSinkCurDaySuspectedFlag, optIfODUkTNimDAPIExpected=optIfODUkTNimDAPIExpected, optIfOTSnAPRStatusGroup=optIfOTSnAPRStatusGroup, OptIfDEGThr=OptIfDEGThr, optIfOChGroupSrcCurDayHighOutputPower=optIfOChGroupSrcCurDayHighOutputPower, optIfOChGroupSrcPrevDayLowOutputPower=optIfOChGroupSrcPrevDayLowOutputPower, optIfGCC0Directionality=optIfGCC0Directionality, optIfODUkNimDirectionality=optIfODUkNimDirectionality, optIfOChGroupSinkCurDayLowOutputPower=optIfOChGroupSinkCurDayLowOutputPower, optIfOChGroupSinkCurrentHighOutputPower=optIfOChGroupSinkCurrentHighOutputPower, optIfODUkPositionSeqCurrentSize=optIfODUkPositionSeqCurrentSize, optIfOChGroupSinkIntervalLowAggregatedInputPower=optIfOChGroupSinkIntervalLowAggregatedInputPower, optIfODUkTNimTIMActEnabled=optIfODUkTNimTIMActEnabled, optIfGCC12Group=optIfGCC12Group, optIfOChSinkCurrentUpperInputPowerThreshold=optIfOChSinkCurrentUpperInputPowerThreshold, optIfODUkTTcmField=optIfODUkTTcmField, optIfOMSnSrcPrevDayHighAggregatedInputPower=optIfOMSnSrcPrevDayHighAggregatedInputPower, optIfOMSnSrcIntervalSuspectedFlag=optIfOMSnSrcIntervalSuspectedFlag, optIfOChSinkCurrentTable=optIfOChSinkCurrentTable, optIfOMSnSrcCurrentUpperOutputPowerThreshold=optIfOMSnSrcCurrentUpperOutputPowerThreshold, optIfOMSnSourcePreOtnPMGroup=optIfOMSnSourcePreOtnPMGroup, optIfOMSnSinkCurrentAggregatedInputPower=optIfOMSnSinkCurrentAggregatedInputPower, optIfODUkTtpTraceIdentifierAccepted=optIfODUkTtpTraceIdentifierAccepted, optIfOMSnSrcIntervalLastAggregatedInputPower=optIfOMSnSrcIntervalLastAggregatedInputPower) |
def checkrootpos(root, params):
a, b, c, d = params
return a * root**3 + b * root**2 + c * root + d > 0
def checkrootneg(root, params):
a, b, c, d = params
return a * root**3 + b * root**2 + c * root + d < 0
def fbinsearch(l, r, eps, check, params):
while l + eps < r:
m = (l + r) / 2
if check(m, params):
r = m
else:
l = m
return l
a, b, c, d = map(int, input().split())
eps = 0.0000000001
l = -10000000
r = 10000000
if a > 0:
x = fbinsearch(l, r, eps, checkrootpos, (a, b, c, d))
else:
x = fbinsearch(l, r, eps, checkrootneg, (a, b, c, d))
print(x) | def checkrootpos(root, params):
(a, b, c, d) = params
return a * root ** 3 + b * root ** 2 + c * root + d > 0
def checkrootneg(root, params):
(a, b, c, d) = params
return a * root ** 3 + b * root ** 2 + c * root + d < 0
def fbinsearch(l, r, eps, check, params):
while l + eps < r:
m = (l + r) / 2
if check(m, params):
r = m
else:
l = m
return l
(a, b, c, d) = map(int, input().split())
eps = 1e-10
l = -10000000
r = 10000000
if a > 0:
x = fbinsearch(l, r, eps, checkrootpos, (a, b, c, d))
else:
x = fbinsearch(l, r, eps, checkrootneg, (a, b, c, d))
print(x) |
LOWER_BOUND = -2147483648
UPPER_BOUND = 2147483647
def solve(i: int) -> int:
base = 10
digit_arr = []
mult = 1 if i > 0 else -1
num = abs(i)
while num:
digit_arr.append(num % base)
num //= base
reverse_num = 0
for digit in digit_arr[::-1]:
reverse_num += mult * digit
mult *= base
return reverse_num if LOWER_BOUND <= reverse_num <= UPPER_BOUND else 0
def execute_tests() -> None:
simple_case_123 = (123, 321)
simple_case_321 = (321, 123)
long_case_453412 = (453412, 214354)
zero = (0, 0)
one = (1, 1)
min_allowed = (-8463847412, -2147483648)
too_small = (-9463847412, 0)
too_big = (1534236469, 0)
for test_case in [
simple_case_123,
simple_case_321,
long_case_453412,
zero,
one,
min_allowed,
too_small,
too_big
]:
test(*test_case)
def test(i: int, expected: int) -> None:
answer = solve(i)
print(i, "reversed is", answer, "expected:", expected)
assert answer == expected
def main() -> None:
return execute_tests()
if __name__ == '__main__':
main()
| lower_bound = -2147483648
upper_bound = 2147483647
def solve(i: int) -> int:
base = 10
digit_arr = []
mult = 1 if i > 0 else -1
num = abs(i)
while num:
digit_arr.append(num % base)
num //= base
reverse_num = 0
for digit in digit_arr[::-1]:
reverse_num += mult * digit
mult *= base
return reverse_num if LOWER_BOUND <= reverse_num <= UPPER_BOUND else 0
def execute_tests() -> None:
simple_case_123 = (123, 321)
simple_case_321 = (321, 123)
long_case_453412 = (453412, 214354)
zero = (0, 0)
one = (1, 1)
min_allowed = (-8463847412, -2147483648)
too_small = (-9463847412, 0)
too_big = (1534236469, 0)
for test_case in [simple_case_123, simple_case_321, long_case_453412, zero, one, min_allowed, too_small, too_big]:
test(*test_case)
def test(i: int, expected: int) -> None:
answer = solve(i)
print(i, 'reversed is', answer, 'expected:', expected)
assert answer == expected
def main() -> None:
return execute_tests()
if __name__ == '__main__':
main() |
class MultiSerializerMixin:
def get_serializer_class(self):
return self.serializer_classes[self.action]
| class Multiserializermixin:
def get_serializer_class(self):
return self.serializer_classes[self.action] |
# While loops practice
# PART A
ages = [5, 6, 24, 32, 21, 70]
counter = 0
while ages[counter] < 30:
print("Part A - The ages is : " +str(ages[counter]))
counter+=1
print("Part A - The value that caused the loop to stop : " +str(ages[counter]))
print("\n")
# PART B
counter = 0
while ages[counter] < 30:
if ages[counter] > 20 :
print("Part B - Print the value that stopped the loop : " +str(ages[counter]))
break
counter +=1
print("\n")
# PART C
counter = 0
while ages[counter] < 70:
ages[counter] = ages[counter] + 2
print("Part C - Cell's new value is : " +str(ages[counter]))
counter +=1
else:
print("Part C - I'm inside 'else' because the number : " +str(ages[counter]))
| ages = [5, 6, 24, 32, 21, 70]
counter = 0
while ages[counter] < 30:
print('Part A - The ages is : ' + str(ages[counter]))
counter += 1
print('Part A - The value that caused the loop to stop : ' + str(ages[counter]))
print('\n')
counter = 0
while ages[counter] < 30:
if ages[counter] > 20:
print('Part B - Print the value that stopped the loop : ' + str(ages[counter]))
break
counter += 1
print('\n')
counter = 0
while ages[counter] < 70:
ages[counter] = ages[counter] + 2
print("Part C - Cell's new value is : " + str(ages[counter]))
counter += 1
else:
print("Part C - I'm inside 'else' because the number : " + str(ages[counter])) |
def out_red(text):
return "\033[31m {}" .format(text)
def out_yellow(text):
return "\033[33m {}" .format(text)
def out_green(text):
return "\033[32m {}" .format(text)
| def out_red(text):
return '\x1b[31m {}'.format(text)
def out_yellow(text):
return '\x1b[33m {}'.format(text)
def out_green(text):
return '\x1b[32m {}'.format(text) |
# vowels list
vowels = ['e', 'a', 'u', 'o', 'i']
# sort the vowels
vowels.sort()
# print vowels
print('Sorted list:', vowels)
| vowels = ['e', 'a', 'u', 'o', 'i']
vowels.sort()
print('Sorted list:', vowels) |
# set the path-to-files
TRAIN_FILE = "/home/luban/work_jupyter/point_rec_data/train.csv"
TEST_FILE = "/home/luban/work_jupyter/point_rec_data/test.csv"
SUB_DIR = "./output"
NUM_SPLITS = 3
RANDOM_SEED = 2017
# types of columns of the dataset dataframe
CATEGORICAL_COLS = [
'common.os',
'common.loc_provider',
'time.time',
'time.week',
]
NUMERIC_COLS = [
# binary
'personal.cur_rectangle',
# numeric
'common.loc_accuracy',
'walk.spherical_dist',
'walk.spherical_dist_ratio_on_pop',
'his_heat.absorb_offset'
# feature engineering
# "missing_feat", "ps_car_13_x_ps_reg_03",
]
IGNORE_COLS = [
"id",
"target",
'common.city_id',
'his_heat.weight_on_pos',
'his_heat.weight_on_link',
'his_heat.weight_on_route',
'his_heat.hottest_offset',
'his_heat.hottest_value',
'his_heat.nearest_offset',
'his_heat.nearest_value',
'his_heat.weight_on_pos_ratio',
'his_heat.weight_on_link_ratio',
'his_heat.weight_on_route_ratio',
'his_heat.pos_link_weight_ratio',
'his_heat.hottest_offset_ratio',
'his_heat.hottest_offset_pop_ratio',
'his_heat.hottest_value_ratio',
'his_heat.hottest_value_pop_ratio',
'his_heat.nearest_offset_ratio',
'his_heat.nearest_offset_pop_ratio',
'his_heat.nearest_value_ratio',
'his_heat.nearest_value_pop_ratio',
'his_heat.nearest_hottest_offset_ratio',
'his_heat.nearest_hottest_value_ratio',
'his_heat.hottest_value_offset_ratio',
'his_heat.nearest_value_offset_ratio',
'his_heat.hottest_pos_weight_ratio',
'his_heat.nearest_pos_weight_ratio',
'heat.link_cluster_point_heat',
'onsite_30.order_cnt',
'onsite_30.aboard_offset_median',
'onsite_30.aboard_onsite_rate_20',
'onsite_30.aboard_onsite_rate_30',
'onsite_30.aboard_onsite_rate_40',
'onsite_30.charge_offset_median',
'onsite_30.charge_onsite_rate_20',
'onsite_30.charge_onsite_rate_30',
'onsite_30.charge_onsite_rate_40',
'onsite_60.order_cnt',
'onsite_60.aboard_offset_median',
'onsite_60.aboard_onsite_rate_20',
'onsite_60.aboard_onsite_rate_30',
'onsite_60.aboard_onsite_rate_40',
'onsite_60.charge_offset_median',
'onsite_60.charge_onsite_rate_20',
'onsite_60.charge_onsite_rate_30',
'onsite_60.charge_onsite_rate_40',
'onsite_90.order_cnt',
'onsite_90.aboard_offset_median',
'onsite_90.aboard_onsite_rate_20',
'onsite_90.aboard_onsite_rate_30',
'onsite_90.aboard_onsite_rate_40',
'onsite_90.charge_offset_median',
'onsite_90.charge_onsite_rate_20',
'onsite_90.charge_onsite_rate_30',
'onsite_90.charge_onsite_rate_40',
'onsite_180.order_cnt',
'onsite_180.aboard_offset_median',
'onsite_180.aboard_onsite_rate_20',
'onsite_180.aboard_onsite_rate_30',
'onsite_180.aboard_onsite_rate_40',
'onsite_180.charge_offset_median',
'onsite_180.charge_onsite_rate_20',
'onsite_180.charge_onsite_rate_30',
'onsite_180.charge_onsite_rate_40',
'personal.dist_to_cur_center',
'personal.cur_radius',
'personal.b4mm_cnt',
'personal.origin_stat_0',
'personal.origin_stat_1',
'personal.origin_stat_from_last_0_0',
'personal.origin_stat_from_last_0_1',
'personal.origin_stat_from_last_1_0',
'personal.origin_stat_from_last_1_1',
'personal.origin_stat_from_last_2_0',
'personal.origin_stat_from_last_2_1',
'personal.origin_stat_from_last_3_0',
'personal.origin_stat_from_last_3_1',
'personal.origin_stat_from_now_0_0',
'personal.origin_stat_from_now_0_1',
'personal.origin_stat_from_now_1_0',
'personal.origin_stat_from_now_1_1',
'personal.origin_stat_from_now_2_0',
'personal.origin_stat_from_now_2_1',
'personal.origin_stat_from_now_3_0',
'personal.origin_stat_from_now_3_1',
'personal.move_stat_date_diff',
'personal.move_stat_0',
'personal.move_stat_1',
'personal.move_stat_2',
'personal.move_stat_3',
'personal.move_stat_from_last_0_0',
'personal.move_stat_from_last_0_1',
'personal.move_stat_from_last_0_2',
'personal.move_stat_from_last_0_3',
'personal.move_stat_from_last_1_0',
'personal.move_stat_from_last_1_1',
'personal.move_stat_from_last_1_2',
'personal.move_stat_from_last_1_3',
'personal.move_stat_from_last_2_0',
'personal.move_stat_from_last_2_1',
'personal.move_stat_from_last_2_2',
'personal.move_stat_from_last_2_3',
'personal.move_stat_from_last_3_0',
'personal.move_stat_from_last_3_1',
'personal.move_stat_from_last_3_2',
'personal.move_stat_from_last_3_3',
'personal.move_stat_from_now_0_0',
'personal.move_stat_from_now_0_1',
'personal.move_stat_from_now_0_2',
'personal.move_stat_from_now_0_3',
'personal.move_stat_from_now_1_0',
'personal.move_stat_from_now_1_1',
'personal.move_stat_from_now_1_2',
'personal.move_stat_from_now_1_3',
'personal.move_stat_from_now_2_0',
'personal.move_stat_from_now_2_1',
'personal.move_stat_from_now_2_2',
'personal.move_stat_from_now_2_3',
'personal.move_stat_from_now_3_0',
'personal.move_stat_from_now_3_1',
'personal.move_stat_from_now_3_2',
'personal.move_stat_from_now_3_3'
]
| train_file = '/home/luban/work_jupyter/point_rec_data/train.csv'
test_file = '/home/luban/work_jupyter/point_rec_data/test.csv'
sub_dir = './output'
num_splits = 3
random_seed = 2017
categorical_cols = ['common.os', 'common.loc_provider', 'time.time', 'time.week']
numeric_cols = ['personal.cur_rectangle', 'common.loc_accuracy', 'walk.spherical_dist', 'walk.spherical_dist_ratio_on_pop', 'his_heat.absorb_offset']
ignore_cols = ['id', 'target', 'common.city_id', 'his_heat.weight_on_pos', 'his_heat.weight_on_link', 'his_heat.weight_on_route', 'his_heat.hottest_offset', 'his_heat.hottest_value', 'his_heat.nearest_offset', 'his_heat.nearest_value', 'his_heat.weight_on_pos_ratio', 'his_heat.weight_on_link_ratio', 'his_heat.weight_on_route_ratio', 'his_heat.pos_link_weight_ratio', 'his_heat.hottest_offset_ratio', 'his_heat.hottest_offset_pop_ratio', 'his_heat.hottest_value_ratio', 'his_heat.hottest_value_pop_ratio', 'his_heat.nearest_offset_ratio', 'his_heat.nearest_offset_pop_ratio', 'his_heat.nearest_value_ratio', 'his_heat.nearest_value_pop_ratio', 'his_heat.nearest_hottest_offset_ratio', 'his_heat.nearest_hottest_value_ratio', 'his_heat.hottest_value_offset_ratio', 'his_heat.nearest_value_offset_ratio', 'his_heat.hottest_pos_weight_ratio', 'his_heat.nearest_pos_weight_ratio', 'heat.link_cluster_point_heat', 'onsite_30.order_cnt', 'onsite_30.aboard_offset_median', 'onsite_30.aboard_onsite_rate_20', 'onsite_30.aboard_onsite_rate_30', 'onsite_30.aboard_onsite_rate_40', 'onsite_30.charge_offset_median', 'onsite_30.charge_onsite_rate_20', 'onsite_30.charge_onsite_rate_30', 'onsite_30.charge_onsite_rate_40', 'onsite_60.order_cnt', 'onsite_60.aboard_offset_median', 'onsite_60.aboard_onsite_rate_20', 'onsite_60.aboard_onsite_rate_30', 'onsite_60.aboard_onsite_rate_40', 'onsite_60.charge_offset_median', 'onsite_60.charge_onsite_rate_20', 'onsite_60.charge_onsite_rate_30', 'onsite_60.charge_onsite_rate_40', 'onsite_90.order_cnt', 'onsite_90.aboard_offset_median', 'onsite_90.aboard_onsite_rate_20', 'onsite_90.aboard_onsite_rate_30', 'onsite_90.aboard_onsite_rate_40', 'onsite_90.charge_offset_median', 'onsite_90.charge_onsite_rate_20', 'onsite_90.charge_onsite_rate_30', 'onsite_90.charge_onsite_rate_40', 'onsite_180.order_cnt', 'onsite_180.aboard_offset_median', 'onsite_180.aboard_onsite_rate_20', 'onsite_180.aboard_onsite_rate_30', 'onsite_180.aboard_onsite_rate_40', 'onsite_180.charge_offset_median', 'onsite_180.charge_onsite_rate_20', 'onsite_180.charge_onsite_rate_30', 'onsite_180.charge_onsite_rate_40', 'personal.dist_to_cur_center', 'personal.cur_radius', 'personal.b4mm_cnt', 'personal.origin_stat_0', 'personal.origin_stat_1', 'personal.origin_stat_from_last_0_0', 'personal.origin_stat_from_last_0_1', 'personal.origin_stat_from_last_1_0', 'personal.origin_stat_from_last_1_1', 'personal.origin_stat_from_last_2_0', 'personal.origin_stat_from_last_2_1', 'personal.origin_stat_from_last_3_0', 'personal.origin_stat_from_last_3_1', 'personal.origin_stat_from_now_0_0', 'personal.origin_stat_from_now_0_1', 'personal.origin_stat_from_now_1_0', 'personal.origin_stat_from_now_1_1', 'personal.origin_stat_from_now_2_0', 'personal.origin_stat_from_now_2_1', 'personal.origin_stat_from_now_3_0', 'personal.origin_stat_from_now_3_1', 'personal.move_stat_date_diff', 'personal.move_stat_0', 'personal.move_stat_1', 'personal.move_stat_2', 'personal.move_stat_3', 'personal.move_stat_from_last_0_0', 'personal.move_stat_from_last_0_1', 'personal.move_stat_from_last_0_2', 'personal.move_stat_from_last_0_3', 'personal.move_stat_from_last_1_0', 'personal.move_stat_from_last_1_1', 'personal.move_stat_from_last_1_2', 'personal.move_stat_from_last_1_3', 'personal.move_stat_from_last_2_0', 'personal.move_stat_from_last_2_1', 'personal.move_stat_from_last_2_2', 'personal.move_stat_from_last_2_3', 'personal.move_stat_from_last_3_0', 'personal.move_stat_from_last_3_1', 'personal.move_stat_from_last_3_2', 'personal.move_stat_from_last_3_3', 'personal.move_stat_from_now_0_0', 'personal.move_stat_from_now_0_1', 'personal.move_stat_from_now_0_2', 'personal.move_stat_from_now_0_3', 'personal.move_stat_from_now_1_0', 'personal.move_stat_from_now_1_1', 'personal.move_stat_from_now_1_2', 'personal.move_stat_from_now_1_3', 'personal.move_stat_from_now_2_0', 'personal.move_stat_from_now_2_1', 'personal.move_stat_from_now_2_2', 'personal.move_stat_from_now_2_3', 'personal.move_stat_from_now_3_0', 'personal.move_stat_from_now_3_1', 'personal.move_stat_from_now_3_2', 'personal.move_stat_from_now_3_3'] |
HIVE_CONFIG = {
"host": '127.0.0.1',
"port": 10000,
"username": 'username',
"password": 'password'
}
MYSQL_CONFIG = {
'test':
{
"host": "127.0.0.1",
"port": 3306,
"user": "username",
"password": "password",
"database": "default"},
'prod':
{
"host": "127.0.0.1",
"port": 3306,
"user": "username",
"password": "password",
"database": "default"},
}
| hive_config = {'host': '127.0.0.1', 'port': 10000, 'username': 'username', 'password': 'password'}
mysql_config = {'test': {'host': '127.0.0.1', 'port': 3306, 'user': 'username', 'password': 'password', 'database': 'default'}, 'prod': {'host': '127.0.0.1', 'port': 3306, 'user': 'username', 'password': 'password', 'database': 'default'}} |
# mock.py
# Metadata
NAME = 'mock'
ENABLE = True
PATTERN = r'^!mock (?P<phrase>.*)'
USAGE = '''Usage: !mock <phrase>
Given a phrase, this translates the phrase into a mocking spongebob phrase.
Example:
> !mock it should work on slack and irc
iT ShOuLd wOrK On sLaCk aNd iRc
'''
# Command
async def mock(bot, message, phrase):
phrase = phrase.lower().rstrip()
response = ''
for count, letter in enumerate(phrase):
if count % 2:
letter = letter.upper()
response += letter
return message.with_body(response)
# Register
def register(bot):
return (
('command', PATTERN, mock),
)
# vim: set sts=4 sw=4 ts=8 expandtab ft=python:
| name = 'mock'
enable = True
pattern = '^!mock (?P<phrase>.*)'
usage = 'Usage: !mock <phrase>\nGiven a phrase, this translates the phrase into a mocking spongebob phrase.\nExample:\n > !mock it should work on slack and irc\n iT ShOuLd wOrK On sLaCk aNd iRc\n'
async def mock(bot, message, phrase):
phrase = phrase.lower().rstrip()
response = ''
for (count, letter) in enumerate(phrase):
if count % 2:
letter = letter.upper()
response += letter
return message.with_body(response)
def register(bot):
return (('command', PATTERN, mock),) |
# Check For Vowel in a sentence....
s = input("Enter String: ")
s = s.lower()
f = 0
for i in range(0, len(s)):
if(s[i] == 'a' or s[i] == 'e' or s[i] == 'i' or s[i] == 'o' or s[i] == 'u'):
f = 2
break
else:
f = 1
if f > 1:
print("Yes, Present")
else:
print("No, Not Present")
| s = input('Enter String: ')
s = s.lower()
f = 0
for i in range(0, len(s)):
if s[i] == 'a' or s[i] == 'e' or s[i] == 'i' or (s[i] == 'o') or (s[i] == 'u'):
f = 2
break
else:
f = 1
if f > 1:
print('Yes, Present')
else:
print('No, Not Present') |
# Given a 2D grid, each cell is either a wall 'W',
# an enemy 'E' or empty '0' (the number zero),
# return the maximum enemies you can kill using one bomb.
# The bomb kills all the enemies in the same row and column from
# the planted point until it hits the wall since the wall is too strong
# to be destroyed.
# Note that you can only put the bomb at an empty cell.
# Example:
# For the given grid
# 0 E 0 0
# E 0 W E
# 0 E 0 0
# return 3. (Placing a bomb at (1,1) kills 3 enemies)
def max_killed_enemies(grid):
if not grid: return 0
m, n = len(grid), len(grid[0])
max_killed = 0
row_e, col_e = 0, [0] * n
for i in range(m):
for j in range(n):
if j == 0 or grid[i][j-1] == 'W':
row_e = row_kills(grid, i, j)
if i == 0 or grid[i-1][j] == 'W':
col_e[j] = col_kills(grid, i, j)
if grid[i][j] == '0':
max_killed = max(max_killed, row_e + col_e[j])
return max_killed
# calculate killed enemies for row i from column j
def row_kills(grid, i, j):
num = 0
while j < len(grid[0]) and grid[i][j] != 'W':
if grid[i][j] == 'E':
num += 1
j += 1
return num
# calculate killed enemies for column j from row i
def col_kills(grid, i, j):
num = 0
while i < len(grid) and grid[i][j] != 'W':
if grid[i][j] == 'E':
num += 1
i += 1
return num
grid = [
["0", "E", "0", "E"],
["E", "E", "E", "0"],
["E", "0", "W", "E"],
["0", "E", "0", "0"]]
print(grid)
print(max_killed_enemies(grid))
| def max_killed_enemies(grid):
if not grid:
return 0
(m, n) = (len(grid), len(grid[0]))
max_killed = 0
(row_e, col_e) = (0, [0] * n)
for i in range(m):
for j in range(n):
if j == 0 or grid[i][j - 1] == 'W':
row_e = row_kills(grid, i, j)
if i == 0 or grid[i - 1][j] == 'W':
col_e[j] = col_kills(grid, i, j)
if grid[i][j] == '0':
max_killed = max(max_killed, row_e + col_e[j])
return max_killed
def row_kills(grid, i, j):
num = 0
while j < len(grid[0]) and grid[i][j] != 'W':
if grid[i][j] == 'E':
num += 1
j += 1
return num
def col_kills(grid, i, j):
num = 0
while i < len(grid) and grid[i][j] != 'W':
if grid[i][j] == 'E':
num += 1
i += 1
return num
grid = [['0', 'E', '0', 'E'], ['E', 'E', 'E', '0'], ['E', '0', 'W', 'E'], ['0', 'E', '0', '0']]
print(grid)
print(max_killed_enemies(grid)) |
def insertion_sort(arr):
isSorted = None
while not isSorted:
isSorted = True
for x,val in enumerate(arr):
try:
if val>arr[x+1]:
temp = arr[x]
arr[x] = arr[x+1]
arr[x+1] = temp
isSorted = False
except IndexError:
x-=1
return arr
print(insertion_sort([5,3,1,2,10,5,7,4,5]))
print(insertion_sort([1,2,3]))
print(insertion_sort([3,2,1,4,4,4,10,1000]))
| def insertion_sort(arr):
is_sorted = None
while not isSorted:
is_sorted = True
for (x, val) in enumerate(arr):
try:
if val > arr[x + 1]:
temp = arr[x]
arr[x] = arr[x + 1]
arr[x + 1] = temp
is_sorted = False
except IndexError:
x -= 1
return arr
print(insertion_sort([5, 3, 1, 2, 10, 5, 7, 4, 5]))
print(insertion_sort([1, 2, 3]))
print(insertion_sort([3, 2, 1, 4, 4, 4, 10, 1000])) |
# -*- coding: utf-8 -*-
def main():
a, b = map(int, input().split())
a -= 1
b -= 1
n = 100
grid = [['.'] * n for _ in range(n // 2)]
for _ in range(n // 2):
grid.append(['#'] * n)
print(n, n)
for i in range(0, n // 2, 2):
for j in range(0, n, 2):
if b > 0:
grid[i][j] = '#'
b -= 1
else:
break
for i in range(51, n, 2):
for j in range(0, n, 2):
if a > 0:
grid[i][j] = '.'
a -= 1
else:
break
for g in grid:
print(''.join(map(str, g)))
if __name__ == '__main__':
main()
| def main():
(a, b) = map(int, input().split())
a -= 1
b -= 1
n = 100
grid = [['.'] * n for _ in range(n // 2)]
for _ in range(n // 2):
grid.append(['#'] * n)
print(n, n)
for i in range(0, n // 2, 2):
for j in range(0, n, 2):
if b > 0:
grid[i][j] = '#'
b -= 1
else:
break
for i in range(51, n, 2):
for j in range(0, n, 2):
if a > 0:
grid[i][j] = '.'
a -= 1
else:
break
for g in grid:
print(''.join(map(str, g)))
if __name__ == '__main__':
main() |
# Constant values
IS_COLD_START = True
WARM_ACTION_INDENTIFIER = 'warm_up'
DEFAULT_WARM_METHOD = 'sleep'
| is_cold_start = True
warm_action_indentifier = 'warm_up'
default_warm_method = 'sleep' |
def test_endpoint_with_var2(client):
response = client.get("/items2/2")
assert response.status_code == 200
assert response.json() == {"item_id": 2}
| def test_endpoint_with_var2(client):
response = client.get('/items2/2')
assert response.status_code == 200
assert response.json() == {'item_id': 2} |
class SampleClass:
@staticmethod
def sample_method(a, b):
return a + b
| class Sampleclass:
@staticmethod
def sample_method(a, b):
return a + b |
name = "S - Density Squares"
description = "Trigger randomly placed squares"
knob1 = "Square Size"
knob2 = "Density"
knob3 = "Line Width"
knob4 = "Color"
released = "March 21 2017"
| name = 'S - Density Squares'
description = 'Trigger randomly placed squares'
knob1 = 'Square Size'
knob2 = 'Density'
knob3 = 'Line Width'
knob4 = 'Color'
released = 'March 21 2017' |
'''
Interface Genie Ops Object Outputs for IOSXR.
'''
class InterfaceOutput(object):
ShowInterfacesDetail = {
'GigabitEthernet0/0/0/0': {
'auto_negotiate': True,
'bandwidth': 768,
'counters': {'carrier_transitions': 0,
'drops': 0,
'in_abort': 0,
'in_broadcast_pkts': 0,
'in_crc_errors': 0,
'in_discards': 0,
'in_errors': 0,
'in_frame': 0,
'in_giants': 0,
'in_ignored': 0,
'in_multicast_pkts': 0,
'in_octets': 0,
'in_overrun': 0,
'in_parity': 0,
'in_pkts': 0,
'in_runts': 0,
'in_throttles': 0,
'last_clear': 'never',
'out_applique': 0,
'out_broadcast_pkts': 0,
'out_buffer_failures': 0,
'out_buffer_swapped_out': 0,
'out_discards': 0,
'out_errors': 0,
'out_multicast_pkts': 0,
'out_octets': 0,
'out_pkts': 0,
'out_resets': 0,
'out_underruns': 0,
'rate': {'in_rate': 0,
'in_rate_pkts': 0,
'load_interval': 30,
'out_rate': 0,
'out_rate_pkts': 0}},
'description': 'desc',
'duplex_mode': 'full',
'enabled': False,
'encapsulations': {'encapsulation': 'ARPA'},
'flow_control': {'flow_control_receive': False,
'flow_control_send': False},
'interface_state': 0,
'ipv4': {'10.1.1.1/24': {'ip': '10.1.1.1',
'prefix_length': '24'}},
'last_input': 'never',
'last_output': 'never',
'line_protocol': 'administratively down',
'location': 'unknown',
'loopback_status': 'not set',
'mac_address': 'aaaa.bbbb.cccc',
'mtu': 1600,
'phys_address': '5254.0077.9407',
'port_speed': '1000Mb/s',
'reliability': '255/255',
'rxload': '0/255',
'txload': '0/255',
'types': 'GigabitEthernet'},
'GigabitEthernet0/0/0/0.10': {
'bandwidth': 768,
'counters': {'drops': 0,
'in_broadcast_pkts': 0,
'in_discards': 0,
'in_multicast_pkts': 0,
'in_octets': 0,
'in_pkts': 0,
'last_clear': 'never',
'out_broadcast_pkts': 0,
'out_discards': 0,
'out_multicast_pkts': 0,
'out_octets': 0,
'out_pkts': 0,
'rate': {'in_rate': 0,
'in_rate_pkts': 0,
'load_interval': 5,
'out_rate': 0,
'out_rate_pkts': 0}},
'enabled': False,
'encapsulations': {'encapsulation': '802.1Q '
'Virtual '
'LAN',
'first_dot1q': '10',
'second_dot1q': '10'},
'interface_state': 0,
'last_input': 'never',
'last_output': 'never',
'line_protocol': 'administratively down',
'loopback_status': 'not set',
'mtu': 1608,
'reliability': '255/255',
'rxload': '0/255',
'txload': '0/255'},
'GigabitEthernet0/0/0/0.20': {
'bandwidth': 768,
'counters': {'drops': 0,
'in_broadcast_pkts': 0,
'in_discards': 0,
'in_multicast_pkts': 0,
'in_octets': 0,
'in_pkts': 0,
'last_clear': 'never',
'out_broadcast_pkts': 0,
'out_discards': 0,
'out_multicast_pkts': 0,
'out_octets': 0,
'out_pkts': 0,
'rate': {'in_rate': 0,
'in_rate_pkts': 0,
'load_interval': 5,
'out_rate': 0,
'out_rate_pkts': 0}},
'enabled': False,
'encapsulations': {'encapsulation': '802.1Q '
'Virtual '
'LAN',
'first_dot1q': '20'},
'interface_state': 0,
'last_input': 'never',
'last_output': 'never',
'line_protocol': 'administratively down',
'loopback_status': 'not set',
'mtu': 1604,
'reliability': '255/255',
'rxload': '0/255',
'txload': '0/255'},
'MgmtEth0/0/CPU0/0': {
'auto_negotiate': True,
'bandwidth': 0,
'counters': {'carrier_transitions': 0,
'drops': 0,
'in_abort': 0,
'in_broadcast_pkts': 0,
'in_crc_errors': 0,
'in_discards': 0,
'in_errors': 0,
'in_frame': 0,
'in_giants': 0,
'in_ignored': 0,
'in_multicast_pkts': 0,
'in_octets': 0,
'in_overrun': 0,
'in_parity': 0,
'in_pkts': 0,
'in_runts': 0,
'in_throttles': 0,
'last_clear': 'never',
'out_applique': 0,
'out_broadcast_pkts': 0,
'out_buffer_failures': 0,
'out_buffer_swapped_out': 0,
'out_discards': 0,
'out_errors': 0,
'out_multicast_pkts': 0,
'out_octets': 0,
'out_pkts': 0,
'out_resets': 0,
'out_underruns': 0,
'rate': {'in_rate': 0,
'in_rate_pkts': 0,
'load_interval': 5,
'out_rate': 0,
'out_rate_pkts': 0}},
'duplex_mode': 'duplex unknown',
'enabled': False,
'encapsulations': {'encapsulation': 'ARPA'},
'flow_control': {'flow_control_receive': False,
'flow_control_send': False},
'interface_state': 0,
'last_input': 'never',
'last_output': 'never',
'line_protocol': 'administratively down',
'location': 'unknown',
'loopback_status': 'not set',
'mac_address': '5254.00c3.6c43',
'mtu': 1514,
'phys_address': '5254.00c3.6c43',
'port_speed': '0Kb/s',
'reliability': '255/255',
'rxload': 'Unknown',
'txload': 'Unknown',
'types': 'Management Ethernet'},
'Null0': {
'bandwidth': 0,
'counters': {'drops': 0,
'in_broadcast_pkts': 0,
'in_discards': 0,
'in_multicast_pkts': 0,
'in_octets': 0,
'in_pkts': 0,
'last_clear': 'never',
'out_broadcast_pkts': 0,
'out_discards': 0,
'out_multicast_pkts': 0,
'out_octets': 0,
'out_pkts': 0,
'rate': {'in_rate': 0,
'in_rate_pkts': 0,
'load_interval': 5,
'out_rate': 0,
'out_rate_pkts': 0}},
'enabled': True,
'encapsulations': {'encapsulation': 'Null'},
'last_input': 'never',
'last_output': 'never',
'line_protocol': 'up',
'loopback_status': 'not set',
'mtu': 1500,
'reliability': '255/255',
'rxload': 'Unknown',
'txload': 'Unknown',
'types': 'Null'}
}
ShowEthernetTags = {
"GigabitEthernet0/0/0/0.10": {
"rewrite_num_of_tags_push": 0,
"status": "up",
"rewrite_num_of_tags_pop": 1,
"mtu": 1518,
"outer_vlan": ".1Q:10",
"vlan_id": "10"
},
"GigabitEthernet0/0/0/0.20": {
"rewrite_num_of_tags_push": 0,
"status": "up",
"rewrite_num_of_tags_pop": 1,
"mtu": 1518,
"outer_vlan": ".1Q:20",
"vlan_id": "20"
}
}
ShowIpv6VrfAllInterface = {
'GigabitEthernet0/0/0/0': {
'enabled': True,
'int_status': 'shutdown',
'ipv6': {'2001:db8:1:1::1/64': {'ipv6': '2001:db8:1:1::1',
'ipv6_prefix_length': '64',
'ipv6_status': 'tentative',
'ipv6_subnet': '2001:db8:1:1::'},
'2001:db8:2:2::2/64': {'ipv6': '2001:db8:2:2::2',
'ipv6_prefix_length': '64',
'ipv6_status': 'tentative',
'ipv6_subnet': '2001:db8:2:2::'},
'2001:db8:3:3:a8aa:bbff:febb:cccc/64': {'ipv6': '2001:db8:3:3:a8aa:bbff:febb:cccc',
'ipv6_eui64': True,
'ipv6_prefix_length': '64',
'ipv6_status': 'tentative',
'ipv6_subnet': '2001:db8:3:3::'},
'2001:db8:4:4::4/64': {'ipv6': '2001:db8:4:4::4',
'ipv6_prefix_length': '64',
'ipv6_route_tag': '10',
'ipv6_status': 'tentative',
'ipv6_subnet': '2001:db8:4:4::'},
'auto_config_state': 'stateless',
'complete_glean_adj': '0',
'complete_protocol_adj': '0',
'dropped_glean_req': '0',
'dropped_protocol_req': '0',
'icmp_redirects': 'disabled',
'icmp_unreachables': 'enabled',
'in_access_list': 'not set',
'incomplete_glean_adj': '0',
'incomplete_protocol_adj': '0',
'ipv6_link_local': 'fe80::a8aa:bbff:febb:cccc',
'ipv6_link_local_state': 'tentative',
'ipv6_mtu': '1600',
'ipv6_mtu_available': '1586',
'nd_adv_retrans_int': '0',
'nd_cache_limit': '1000000000',
'nd_reachable_time': '0',
'out_access_list': 'not set',
'table_id': '0xe0800011'},
'ipv6_enabled': False,
'oper_status': 'down',
'vrf': 'VRF1',
'vrf_id': '0x60000002'},
'GigabitEthernet0/0/0/0.10': {'enabled': False,
'int_status': 'shutdown',
'ipv6_enabled': False,
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'},
'GigabitEthernet0/0/0/0.20': {'enabled': False,
'int_status': 'shutdown',
'ipv6_enabled': False,
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'},
'GigabitEthernet0/0/0/1': {'enabled': False,
'int_status': 'shutdown',
'ipv6_enabled': False,
'oper_status': 'down',
'vrf': 'VRF2',
'vrf_id': '0x60000003'},
'GigabitEthernet0/0/0/2': {'enabled': False,
'int_status': 'shutdown',
'ipv6_enabled': False,
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'},
'GigabitEthernet0/0/0/3': {'enabled': False,
'int_status': 'shutdown',
'ipv6_enabled': False,
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'},
'GigabitEthernet0/0/0/4': {'enabled': False,
'int_status': 'shutdown',
'ipv6_enabled': False,
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'},
'GigabitEthernet0/0/0/5': {'enabled': False,
'int_status': 'shutdown',
'ipv6_enabled': False,
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'},
'GigabitEthernet0/0/0/6': {'enabled': False,
'int_status': 'shutdown',
'ipv6_enabled': False,
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'},
'MgmtEth0/0/CPU0/0': {'enabled': False,
'int_status': 'shutdown',
'ipv6_enabled': False,
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'}
}
ShowIpv4VrfAllInterface = {
'GigabitEthernet0/0/0/0': {
'int_status': 'shutdown',
'ipv4': {'10.1.1.1/24': {'ip': '10.1.1.1',
'prefix_length': '24',
'route_tag': 50},
'10.2.2.2/24': {'arp': 'disabled',
'broadcast_forwarding': 'disabled',
'helper_address': 'not '
'set',
'icmp_redirects': 'never '
'sent',
'icmp_replies': 'never '
'sent',
'icmp_unreachables': 'always '
'sent',
'in_access_list': 'not '
'set',
'ip': '10.2.2.2',
'mtu': 1600,
'mtu_available': 1586,
'out_access_list': 'not '
'set',
'prefix_length': '24',
'secondary': True,
'table_id': '0xe0000011'},
'unnumbered': {'unnumbered_int': '111.111.111.111/32',
'unnumbered_intf_ref': 'Loopback11'}},
'oper_status': 'down',
'vrf': 'VRF1',
'vrf_id': '0x60000002'},
'GigabitEthernet0/0/0/0.10': {'int_status': 'shutdown',
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'},
'GigabitEthernet0/0/0/0.20': {'int_status': 'shutdown',
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'},
'GigabitEthernet0/0/0/1': {'int_status': 'shutdown',
'oper_status': 'down',
'vrf': 'VRF2',
'vrf_id': '0x60000003'},
'GigabitEthernet0/0/0/2': {'int_status': 'shutdown',
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'},
'GigabitEthernet0/0/0/3': {'int_status': 'shutdown',
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'},
'GigabitEthernet0/0/0/4': {'int_status': 'shutdown',
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'},
'GigabitEthernet0/0/0/5': {'int_status': 'shutdown',
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'},
'GigabitEthernet0/0/0/6': {'int_status': 'shutdown',
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'},
'MgmtEth0/0/CPU0/0': {'int_status': 'shutdown',
'oper_status': 'down',
'vrf': 'default',
'vrf_id': '0x60000000'}
}
ShowVrfAllDetail = {
"VRF1": {
"description": "not set",
"vrf_mode": "Regular",
"address_family": {
"ipv6 unicast": {
"route_target": {
"400:1": {
"rt_type": "import",
"route_target": "400:1"
},
"300:1": {
"rt_type": "import",
"route_target": "300:1"
},
"200:1": {
"rt_type": "both",
"route_target": "200:1"
},
"200:2": {
"rt_type": "import",
"route_target": "200:2"
}
}
},
"ipv4 unicast": {
"route_target": {
"400:1": {
"rt_type": "import",
"route_target": "400:1"
},
"300:1": {
"rt_type": "import",
"route_target": "300:1"
},
"200:1": {
"rt_type": "both",
"route_target": "200:1"
},
"200:2": {
"rt_type": "import",
"route_target": "200:2"
}
}
}
},
"route_distinguisher": "200:1",
"interfaces": [
"GigabitEthernet0/0/0/1"
]
},
"VRF2": {
"description": "not set",
"vrf_mode": "Regular",
"address_family": {
"ipv6 unicast": {
"route_target": {
"200:2": {
"rt_type": "both",
"route_target": "200:2"
}
}
},
"ipv4 unicast": {
"route_target": {
"200:2": {
"rt_type": "both",
"route_target": "200:2"
}
}
}
},
"route_distinguisher": "200:2",
"interfaces": [
"GigabitEthernet0/0/0/2"
]}
}
ShowInterfacesAccounting = \
{
"GigabitEthernet0/0/0/0": {
"accounting": {
"arp": {
"chars_in": 378,
"chars_out": 378,
"pkts_in": 9,
"pkts_out": 9
},
"ipv4_multicast": {
"chars_in": 0,
"chars_out": 843700,
"pkts_in": 0,
"pkts_out": 10514
},
"ipv4_unicast": {
"chars_in": 1226852,
"chars_out": 887519,
"pkts_in": 19254,
"pkts_out": 13117
}
}
},
"GigabitEthernet0/0/0/1": {
"accounting": {
"arp": {
"chars_in": 378,
"chars_out": 378,
"pkts_in": 9,
"pkts_out": 9
},
"ipv4_multicast": {
"chars_in": 0,
"chars_out": 844816,
"pkts_in": 0,
"pkts_out": 10530
},
"ipv4_unicast": {
"chars_in": 843784,
"chars_out": 1764,
"pkts_in": 10539,
"pkts_out": 26
}
}
}
}
InterfaceOpsOutput_info = {
"Null0": {
"mtu": 1500,
"type": "Null",
"enabled": True,
"bandwidth": 0,
"counters": {
"in_octets": 0,
"out_broadcast_pkts": 0,
"out_pkts": 0,
"in_discards": 0,
"in_pkts": 0,
"in_multicast_pkts": 0,
"in_broadcast_pkts": 0,
"rate": {
"out_rate": 0,
"out_rate_pkts": 0,
"in_rate_pkts": 0,
"load_interval": 5,
"in_rate": 0
},
"last_clear": "never",
"out_multicast_pkts": 0,
"out_octets": 0
},
"encapsulation": {
"encapsulation": "Null"
},
},
"MgmtEth0/0/CPU0/0": {
"mtu": 1514,
"mac_address": "5254.00c3.6c43",
"flow_control": {
"flow_control_receive": False,
"flow_control_send": False
},
"type": "Management Ethernet",
"enabled": False,
"encapsulation": {
"encapsulation": "ARPA"
},
"auto_negotiate": True,
"bandwidth": 0,
"counters": {
"out_broadcast_pkts": 0,
"in_multicast_pkts": 0,
"in_crc_errors": 0,
"in_pkts": 0,
"in_errors": 0,
"in_broadcast_pkts": 0,
"out_multicast_pkts": 0,
"out_errors": 0,
"in_octets": 0,
"rate": {
"out_rate": 0,
"out_rate_pkts": 0,
"in_rate_pkts": 0,
"load_interval": 5,
"in_rate": 0
},
"out_pkts": 0,
"in_discards": 0,
"last_clear": "never",
"out_octets": 0
},
"duplex_mode": "duplex unknown",
"port_speed": "0Kb/s",
"phys_address": "5254.00c3.6c43",
"ipv6": {
"enabled": False
}
},
"GigabitEthernet0/0/0/5": {
"ipv6": {
"enabled": False
}
},
"GigabitEthernet0/0/0/4": {
"ipv6": {
"enabled": False
}
},
"GigabitEthernet0/0/0/0": {
"mtu": 1600,
"mac_address": "aaaa.bbbb.cccc",
"description": "desc",
"duplex_mode": "full",
"type": "GigabitEthernet",
"enabled": False,
"encapsulation": {
"encapsulation": "ARPA"
},
"auto_negotiate": True,
"ipv4": {
"10.1.1.1/24": {
"ip": "10.1.1.1",
"prefix_length": "24",
"route_tag": 50},
"10.2.2.2/24": {
"ip": '10.2.2.2',
'prefix_length': '24',
'secondary': True},
"unnumbered": {
"unnumbered_intf_ref": "Loopback11"
}
},
"bandwidth": 768,
"accounting": {
"arp": {
"chars_in": 378,
"chars_out": 378,
"pkts_in": 9,
"pkts_out": 9
},
"ipv4_multicast": {
"chars_in": 0,
"chars_out": 843700,
"pkts_in": 0,
"pkts_out": 10514
},
"ipv4_unicast": {
"chars_in": 1226852,
"chars_out": 887519,
"pkts_in": 19254,
"pkts_out": 13117
}
},
"counters": {
"out_broadcast_pkts": 0,
"in_multicast_pkts": 0,
"in_crc_errors": 0,
"in_pkts": 0,
"in_errors": 0,
"in_broadcast_pkts": 0,
"out_multicast_pkts": 0,
"out_errors": 0,
"in_octets": 0,
"rate": {
"out_rate": 0,
"out_rate_pkts": 0,
"in_rate_pkts": 0,
"load_interval": 30,
"in_rate": 0
},
"out_pkts": 0,
"in_discards": 0,
"last_clear": "never",
"out_octets": 0
},
"flow_control": {
"flow_control_receive": False,
"flow_control_send": False
},
"port_speed": "1000Mb/s",
"phys_address": "5254.0077.9407",
"ipv6": {
"2001:db8:2:2::2/64": {
"status": "tentative",
"ip": "2001:db8:2:2::2",
"prefix_length": "64"
},
"2001:db8:1:1::1/64": {
"status": "tentative",
"ip": "2001:db8:1:1::1",
"prefix_length": "64"
},
"enabled": False,
"2001:db8:4:4::4/64": {
"status": "tentative",
"route_tag": "10",
"ip": "2001:db8:4:4::4",
"prefix_length": "64"
},
"2001:db8:3:3:a8aa:bbff:febb:cccc/64": {
"status": "tentative",
"ip": "2001:db8:3:3:a8aa:bbff:febb:cccc",
"prefix_length": "64",
"eui64": True
}
}
},
"GigabitEthernet0/0/0/1": {
"vrf": "VRF1",
"ipv6": {
"enabled": False
},
"accounting": {
"arp": {
"chars_in": 378,
"chars_out": 378,
"pkts_in": 9,
"pkts_out": 9
},
"ipv4_multicast": {
"chars_in": 0,
"chars_out": 844816,
"pkts_in": 0,
"pkts_out": 10530
},
"ipv4_unicast": {
"chars_in": 843784,
"chars_out": 1764,
"pkts_in": 10539,
"pkts_out": 26
}
}
},
"GigabitEthernet0/0/0/6": {
"ipv6": {
"enabled": False
}
},
"GigabitEthernet0/0/0/0.20": {
"mtu": 1604,
"counters": {
"in_octets": 0,
"out_broadcast_pkts": 0,
"out_pkts": 0,
"in_discards": 0,
"in_pkts": 0,
"in_multicast_pkts": 0,
"in_broadcast_pkts": 0,
"rate": {
"out_rate": 0,
"out_rate_pkts": 0,
"in_rate_pkts": 0,
"load_interval": 5,
"in_rate": 0
},
"last_clear": "never",
"out_multicast_pkts": 0,
"out_octets": 0
},
"enabled": False,
"bandwidth": 768,
"vlan_id": '20',
"encapsulation": {
"encapsulation": "802.1Q Virtual LAN",
"first_dot1q": "20"
},
"ipv6": {
"enabled": False
}
},
"GigabitEthernet0/0/0/2": {
"vrf": "VRF2",
"ipv6": {
"enabled": False
}
},
"GigabitEthernet0/0/0/3": {
"ipv6": {
"enabled": False
}
},
"GigabitEthernet0/0/0/0.10": {
"mtu": 1608,
"counters": {
"in_octets": 0,
"out_broadcast_pkts": 0,
"out_pkts": 0,
"in_discards": 0,
"in_pkts": 0,
"in_multicast_pkts": 0,
"in_broadcast_pkts": 0,
"rate": {
"out_rate": 0,
"out_rate_pkts": 0,
"in_rate_pkts": 0,
"load_interval": 5,
"in_rate": 0
},
"last_clear": "never",
"out_multicast_pkts": 0,
"out_octets": 0
},
"enabled": False,
"bandwidth": 768,
"vlan_id": '10',
"encapsulation": {
"encapsulation": "802.1Q Virtual LAN",
"first_dot1q": "10",
"second_dot1q": "10"
},
"ipv6": {
"enabled": False
}
}
}
| """
Interface Genie Ops Object Outputs for IOSXR.
"""
class Interfaceoutput(object):
show_interfaces_detail = {'GigabitEthernet0/0/0/0': {'auto_negotiate': True, 'bandwidth': 768, 'counters': {'carrier_transitions': 0, 'drops': 0, 'in_abort': 0, 'in_broadcast_pkts': 0, 'in_crc_errors': 0, 'in_discards': 0, 'in_errors': 0, 'in_frame': 0, 'in_giants': 0, 'in_ignored': 0, 'in_multicast_pkts': 0, 'in_octets': 0, 'in_overrun': 0, 'in_parity': 0, 'in_pkts': 0, 'in_runts': 0, 'in_throttles': 0, 'last_clear': 'never', 'out_applique': 0, 'out_broadcast_pkts': 0, 'out_buffer_failures': 0, 'out_buffer_swapped_out': 0, 'out_discards': 0, 'out_errors': 0, 'out_multicast_pkts': 0, 'out_octets': 0, 'out_pkts': 0, 'out_resets': 0, 'out_underruns': 0, 'rate': {'in_rate': 0, 'in_rate_pkts': 0, 'load_interval': 30, 'out_rate': 0, 'out_rate_pkts': 0}}, 'description': 'desc', 'duplex_mode': 'full', 'enabled': False, 'encapsulations': {'encapsulation': 'ARPA'}, 'flow_control': {'flow_control_receive': False, 'flow_control_send': False}, 'interface_state': 0, 'ipv4': {'10.1.1.1/24': {'ip': '10.1.1.1', 'prefix_length': '24'}}, 'last_input': 'never', 'last_output': 'never', 'line_protocol': 'administratively down', 'location': 'unknown', 'loopback_status': 'not set', 'mac_address': 'aaaa.bbbb.cccc', 'mtu': 1600, 'phys_address': '5254.0077.9407', 'port_speed': '1000Mb/s', 'reliability': '255/255', 'rxload': '0/255', 'txload': '0/255', 'types': 'GigabitEthernet'}, 'GigabitEthernet0/0/0/0.10': {'bandwidth': 768, 'counters': {'drops': 0, 'in_broadcast_pkts': 0, 'in_discards': 0, 'in_multicast_pkts': 0, 'in_octets': 0, 'in_pkts': 0, 'last_clear': 'never', 'out_broadcast_pkts': 0, 'out_discards': 0, 'out_multicast_pkts': 0, 'out_octets': 0, 'out_pkts': 0, 'rate': {'in_rate': 0, 'in_rate_pkts': 0, 'load_interval': 5, 'out_rate': 0, 'out_rate_pkts': 0}}, 'enabled': False, 'encapsulations': {'encapsulation': '802.1Q Virtual LAN', 'first_dot1q': '10', 'second_dot1q': '10'}, 'interface_state': 0, 'last_input': 'never', 'last_output': 'never', 'line_protocol': 'administratively down', 'loopback_status': 'not set', 'mtu': 1608, 'reliability': '255/255', 'rxload': '0/255', 'txload': '0/255'}, 'GigabitEthernet0/0/0/0.20': {'bandwidth': 768, 'counters': {'drops': 0, 'in_broadcast_pkts': 0, 'in_discards': 0, 'in_multicast_pkts': 0, 'in_octets': 0, 'in_pkts': 0, 'last_clear': 'never', 'out_broadcast_pkts': 0, 'out_discards': 0, 'out_multicast_pkts': 0, 'out_octets': 0, 'out_pkts': 0, 'rate': {'in_rate': 0, 'in_rate_pkts': 0, 'load_interval': 5, 'out_rate': 0, 'out_rate_pkts': 0}}, 'enabled': False, 'encapsulations': {'encapsulation': '802.1Q Virtual LAN', 'first_dot1q': '20'}, 'interface_state': 0, 'last_input': 'never', 'last_output': 'never', 'line_protocol': 'administratively down', 'loopback_status': 'not set', 'mtu': 1604, 'reliability': '255/255', 'rxload': '0/255', 'txload': '0/255'}, 'MgmtEth0/0/CPU0/0': {'auto_negotiate': True, 'bandwidth': 0, 'counters': {'carrier_transitions': 0, 'drops': 0, 'in_abort': 0, 'in_broadcast_pkts': 0, 'in_crc_errors': 0, 'in_discards': 0, 'in_errors': 0, 'in_frame': 0, 'in_giants': 0, 'in_ignored': 0, 'in_multicast_pkts': 0, 'in_octets': 0, 'in_overrun': 0, 'in_parity': 0, 'in_pkts': 0, 'in_runts': 0, 'in_throttles': 0, 'last_clear': 'never', 'out_applique': 0, 'out_broadcast_pkts': 0, 'out_buffer_failures': 0, 'out_buffer_swapped_out': 0, 'out_discards': 0, 'out_errors': 0, 'out_multicast_pkts': 0, 'out_octets': 0, 'out_pkts': 0, 'out_resets': 0, 'out_underruns': 0, 'rate': {'in_rate': 0, 'in_rate_pkts': 0, 'load_interval': 5, 'out_rate': 0, 'out_rate_pkts': 0}}, 'duplex_mode': 'duplex unknown', 'enabled': False, 'encapsulations': {'encapsulation': 'ARPA'}, 'flow_control': {'flow_control_receive': False, 'flow_control_send': False}, 'interface_state': 0, 'last_input': 'never', 'last_output': 'never', 'line_protocol': 'administratively down', 'location': 'unknown', 'loopback_status': 'not set', 'mac_address': '5254.00c3.6c43', 'mtu': 1514, 'phys_address': '5254.00c3.6c43', 'port_speed': '0Kb/s', 'reliability': '255/255', 'rxload': 'Unknown', 'txload': 'Unknown', 'types': 'Management Ethernet'}, 'Null0': {'bandwidth': 0, 'counters': {'drops': 0, 'in_broadcast_pkts': 0, 'in_discards': 0, 'in_multicast_pkts': 0, 'in_octets': 0, 'in_pkts': 0, 'last_clear': 'never', 'out_broadcast_pkts': 0, 'out_discards': 0, 'out_multicast_pkts': 0, 'out_octets': 0, 'out_pkts': 0, 'rate': {'in_rate': 0, 'in_rate_pkts': 0, 'load_interval': 5, 'out_rate': 0, 'out_rate_pkts': 0}}, 'enabled': True, 'encapsulations': {'encapsulation': 'Null'}, 'last_input': 'never', 'last_output': 'never', 'line_protocol': 'up', 'loopback_status': 'not set', 'mtu': 1500, 'reliability': '255/255', 'rxload': 'Unknown', 'txload': 'Unknown', 'types': 'Null'}}
show_ethernet_tags = {'GigabitEthernet0/0/0/0.10': {'rewrite_num_of_tags_push': 0, 'status': 'up', 'rewrite_num_of_tags_pop': 1, 'mtu': 1518, 'outer_vlan': '.1Q:10', 'vlan_id': '10'}, 'GigabitEthernet0/0/0/0.20': {'rewrite_num_of_tags_push': 0, 'status': 'up', 'rewrite_num_of_tags_pop': 1, 'mtu': 1518, 'outer_vlan': '.1Q:20', 'vlan_id': '20'}}
show_ipv6_vrf_all_interface = {'GigabitEthernet0/0/0/0': {'enabled': True, 'int_status': 'shutdown', 'ipv6': {'2001:db8:1:1::1/64': {'ipv6': '2001:db8:1:1::1', 'ipv6_prefix_length': '64', 'ipv6_status': 'tentative', 'ipv6_subnet': '2001:db8:1:1::'}, '2001:db8:2:2::2/64': {'ipv6': '2001:db8:2:2::2', 'ipv6_prefix_length': '64', 'ipv6_status': 'tentative', 'ipv6_subnet': '2001:db8:2:2::'}, '2001:db8:3:3:a8aa:bbff:febb:cccc/64': {'ipv6': '2001:db8:3:3:a8aa:bbff:febb:cccc', 'ipv6_eui64': True, 'ipv6_prefix_length': '64', 'ipv6_status': 'tentative', 'ipv6_subnet': '2001:db8:3:3::'}, '2001:db8:4:4::4/64': {'ipv6': '2001:db8:4:4::4', 'ipv6_prefix_length': '64', 'ipv6_route_tag': '10', 'ipv6_status': 'tentative', 'ipv6_subnet': '2001:db8:4:4::'}, 'auto_config_state': 'stateless', 'complete_glean_adj': '0', 'complete_protocol_adj': '0', 'dropped_glean_req': '0', 'dropped_protocol_req': '0', 'icmp_redirects': 'disabled', 'icmp_unreachables': 'enabled', 'in_access_list': 'not set', 'incomplete_glean_adj': '0', 'incomplete_protocol_adj': '0', 'ipv6_link_local': 'fe80::a8aa:bbff:febb:cccc', 'ipv6_link_local_state': 'tentative', 'ipv6_mtu': '1600', 'ipv6_mtu_available': '1586', 'nd_adv_retrans_int': '0', 'nd_cache_limit': '1000000000', 'nd_reachable_time': '0', 'out_access_list': 'not set', 'table_id': '0xe0800011'}, 'ipv6_enabled': False, 'oper_status': 'down', 'vrf': 'VRF1', 'vrf_id': '0x60000002'}, 'GigabitEthernet0/0/0/0.10': {'enabled': False, 'int_status': 'shutdown', 'ipv6_enabled': False, 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}, 'GigabitEthernet0/0/0/0.20': {'enabled': False, 'int_status': 'shutdown', 'ipv6_enabled': False, 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}, 'GigabitEthernet0/0/0/1': {'enabled': False, 'int_status': 'shutdown', 'ipv6_enabled': False, 'oper_status': 'down', 'vrf': 'VRF2', 'vrf_id': '0x60000003'}, 'GigabitEthernet0/0/0/2': {'enabled': False, 'int_status': 'shutdown', 'ipv6_enabled': False, 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}, 'GigabitEthernet0/0/0/3': {'enabled': False, 'int_status': 'shutdown', 'ipv6_enabled': False, 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}, 'GigabitEthernet0/0/0/4': {'enabled': False, 'int_status': 'shutdown', 'ipv6_enabled': False, 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}, 'GigabitEthernet0/0/0/5': {'enabled': False, 'int_status': 'shutdown', 'ipv6_enabled': False, 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}, 'GigabitEthernet0/0/0/6': {'enabled': False, 'int_status': 'shutdown', 'ipv6_enabled': False, 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}, 'MgmtEth0/0/CPU0/0': {'enabled': False, 'int_status': 'shutdown', 'ipv6_enabled': False, 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}}
show_ipv4_vrf_all_interface = {'GigabitEthernet0/0/0/0': {'int_status': 'shutdown', 'ipv4': {'10.1.1.1/24': {'ip': '10.1.1.1', 'prefix_length': '24', 'route_tag': 50}, '10.2.2.2/24': {'arp': 'disabled', 'broadcast_forwarding': 'disabled', 'helper_address': 'not set', 'icmp_redirects': 'never sent', 'icmp_replies': 'never sent', 'icmp_unreachables': 'always sent', 'in_access_list': 'not set', 'ip': '10.2.2.2', 'mtu': 1600, 'mtu_available': 1586, 'out_access_list': 'not set', 'prefix_length': '24', 'secondary': True, 'table_id': '0xe0000011'}, 'unnumbered': {'unnumbered_int': '111.111.111.111/32', 'unnumbered_intf_ref': 'Loopback11'}}, 'oper_status': 'down', 'vrf': 'VRF1', 'vrf_id': '0x60000002'}, 'GigabitEthernet0/0/0/0.10': {'int_status': 'shutdown', 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}, 'GigabitEthernet0/0/0/0.20': {'int_status': 'shutdown', 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}, 'GigabitEthernet0/0/0/1': {'int_status': 'shutdown', 'oper_status': 'down', 'vrf': 'VRF2', 'vrf_id': '0x60000003'}, 'GigabitEthernet0/0/0/2': {'int_status': 'shutdown', 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}, 'GigabitEthernet0/0/0/3': {'int_status': 'shutdown', 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}, 'GigabitEthernet0/0/0/4': {'int_status': 'shutdown', 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}, 'GigabitEthernet0/0/0/5': {'int_status': 'shutdown', 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}, 'GigabitEthernet0/0/0/6': {'int_status': 'shutdown', 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}, 'MgmtEth0/0/CPU0/0': {'int_status': 'shutdown', 'oper_status': 'down', 'vrf': 'default', 'vrf_id': '0x60000000'}}
show_vrf_all_detail = {'VRF1': {'description': 'not set', 'vrf_mode': 'Regular', 'address_family': {'ipv6 unicast': {'route_target': {'400:1': {'rt_type': 'import', 'route_target': '400:1'}, '300:1': {'rt_type': 'import', 'route_target': '300:1'}, '200:1': {'rt_type': 'both', 'route_target': '200:1'}, '200:2': {'rt_type': 'import', 'route_target': '200:2'}}}, 'ipv4 unicast': {'route_target': {'400:1': {'rt_type': 'import', 'route_target': '400:1'}, '300:1': {'rt_type': 'import', 'route_target': '300:1'}, '200:1': {'rt_type': 'both', 'route_target': '200:1'}, '200:2': {'rt_type': 'import', 'route_target': '200:2'}}}}, 'route_distinguisher': '200:1', 'interfaces': ['GigabitEthernet0/0/0/1']}, 'VRF2': {'description': 'not set', 'vrf_mode': 'Regular', 'address_family': {'ipv6 unicast': {'route_target': {'200:2': {'rt_type': 'both', 'route_target': '200:2'}}}, 'ipv4 unicast': {'route_target': {'200:2': {'rt_type': 'both', 'route_target': '200:2'}}}}, 'route_distinguisher': '200:2', 'interfaces': ['GigabitEthernet0/0/0/2']}}
show_interfaces_accounting = {'GigabitEthernet0/0/0/0': {'accounting': {'arp': {'chars_in': 378, 'chars_out': 378, 'pkts_in': 9, 'pkts_out': 9}, 'ipv4_multicast': {'chars_in': 0, 'chars_out': 843700, 'pkts_in': 0, 'pkts_out': 10514}, 'ipv4_unicast': {'chars_in': 1226852, 'chars_out': 887519, 'pkts_in': 19254, 'pkts_out': 13117}}}, 'GigabitEthernet0/0/0/1': {'accounting': {'arp': {'chars_in': 378, 'chars_out': 378, 'pkts_in': 9, 'pkts_out': 9}, 'ipv4_multicast': {'chars_in': 0, 'chars_out': 844816, 'pkts_in': 0, 'pkts_out': 10530}, 'ipv4_unicast': {'chars_in': 843784, 'chars_out': 1764, 'pkts_in': 10539, 'pkts_out': 26}}}}
interface_ops_output_info = {'Null0': {'mtu': 1500, 'type': 'Null', 'enabled': True, 'bandwidth': 0, 'counters': {'in_octets': 0, 'out_broadcast_pkts': 0, 'out_pkts': 0, 'in_discards': 0, 'in_pkts': 0, 'in_multicast_pkts': 0, 'in_broadcast_pkts': 0, 'rate': {'out_rate': 0, 'out_rate_pkts': 0, 'in_rate_pkts': 0, 'load_interval': 5, 'in_rate': 0}, 'last_clear': 'never', 'out_multicast_pkts': 0, 'out_octets': 0}, 'encapsulation': {'encapsulation': 'Null'}}, 'MgmtEth0/0/CPU0/0': {'mtu': 1514, 'mac_address': '5254.00c3.6c43', 'flow_control': {'flow_control_receive': False, 'flow_control_send': False}, 'type': 'Management Ethernet', 'enabled': False, 'encapsulation': {'encapsulation': 'ARPA'}, 'auto_negotiate': True, 'bandwidth': 0, 'counters': {'out_broadcast_pkts': 0, 'in_multicast_pkts': 0, 'in_crc_errors': 0, 'in_pkts': 0, 'in_errors': 0, 'in_broadcast_pkts': 0, 'out_multicast_pkts': 0, 'out_errors': 0, 'in_octets': 0, 'rate': {'out_rate': 0, 'out_rate_pkts': 0, 'in_rate_pkts': 0, 'load_interval': 5, 'in_rate': 0}, 'out_pkts': 0, 'in_discards': 0, 'last_clear': 'never', 'out_octets': 0}, 'duplex_mode': 'duplex unknown', 'port_speed': '0Kb/s', 'phys_address': '5254.00c3.6c43', 'ipv6': {'enabled': False}}, 'GigabitEthernet0/0/0/5': {'ipv6': {'enabled': False}}, 'GigabitEthernet0/0/0/4': {'ipv6': {'enabled': False}}, 'GigabitEthernet0/0/0/0': {'mtu': 1600, 'mac_address': 'aaaa.bbbb.cccc', 'description': 'desc', 'duplex_mode': 'full', 'type': 'GigabitEthernet', 'enabled': False, 'encapsulation': {'encapsulation': 'ARPA'}, 'auto_negotiate': True, 'ipv4': {'10.1.1.1/24': {'ip': '10.1.1.1', 'prefix_length': '24', 'route_tag': 50}, '10.2.2.2/24': {'ip': '10.2.2.2', 'prefix_length': '24', 'secondary': True}, 'unnumbered': {'unnumbered_intf_ref': 'Loopback11'}}, 'bandwidth': 768, 'accounting': {'arp': {'chars_in': 378, 'chars_out': 378, 'pkts_in': 9, 'pkts_out': 9}, 'ipv4_multicast': {'chars_in': 0, 'chars_out': 843700, 'pkts_in': 0, 'pkts_out': 10514}, 'ipv4_unicast': {'chars_in': 1226852, 'chars_out': 887519, 'pkts_in': 19254, 'pkts_out': 13117}}, 'counters': {'out_broadcast_pkts': 0, 'in_multicast_pkts': 0, 'in_crc_errors': 0, 'in_pkts': 0, 'in_errors': 0, 'in_broadcast_pkts': 0, 'out_multicast_pkts': 0, 'out_errors': 0, 'in_octets': 0, 'rate': {'out_rate': 0, 'out_rate_pkts': 0, 'in_rate_pkts': 0, 'load_interval': 30, 'in_rate': 0}, 'out_pkts': 0, 'in_discards': 0, 'last_clear': 'never', 'out_octets': 0}, 'flow_control': {'flow_control_receive': False, 'flow_control_send': False}, 'port_speed': '1000Mb/s', 'phys_address': '5254.0077.9407', 'ipv6': {'2001:db8:2:2::2/64': {'status': 'tentative', 'ip': '2001:db8:2:2::2', 'prefix_length': '64'}, '2001:db8:1:1::1/64': {'status': 'tentative', 'ip': '2001:db8:1:1::1', 'prefix_length': '64'}, 'enabled': False, '2001:db8:4:4::4/64': {'status': 'tentative', 'route_tag': '10', 'ip': '2001:db8:4:4::4', 'prefix_length': '64'}, '2001:db8:3:3:a8aa:bbff:febb:cccc/64': {'status': 'tentative', 'ip': '2001:db8:3:3:a8aa:bbff:febb:cccc', 'prefix_length': '64', 'eui64': True}}}, 'GigabitEthernet0/0/0/1': {'vrf': 'VRF1', 'ipv6': {'enabled': False}, 'accounting': {'arp': {'chars_in': 378, 'chars_out': 378, 'pkts_in': 9, 'pkts_out': 9}, 'ipv4_multicast': {'chars_in': 0, 'chars_out': 844816, 'pkts_in': 0, 'pkts_out': 10530}, 'ipv4_unicast': {'chars_in': 843784, 'chars_out': 1764, 'pkts_in': 10539, 'pkts_out': 26}}}, 'GigabitEthernet0/0/0/6': {'ipv6': {'enabled': False}}, 'GigabitEthernet0/0/0/0.20': {'mtu': 1604, 'counters': {'in_octets': 0, 'out_broadcast_pkts': 0, 'out_pkts': 0, 'in_discards': 0, 'in_pkts': 0, 'in_multicast_pkts': 0, 'in_broadcast_pkts': 0, 'rate': {'out_rate': 0, 'out_rate_pkts': 0, 'in_rate_pkts': 0, 'load_interval': 5, 'in_rate': 0}, 'last_clear': 'never', 'out_multicast_pkts': 0, 'out_octets': 0}, 'enabled': False, 'bandwidth': 768, 'vlan_id': '20', 'encapsulation': {'encapsulation': '802.1Q Virtual LAN', 'first_dot1q': '20'}, 'ipv6': {'enabled': False}}, 'GigabitEthernet0/0/0/2': {'vrf': 'VRF2', 'ipv6': {'enabled': False}}, 'GigabitEthernet0/0/0/3': {'ipv6': {'enabled': False}}, 'GigabitEthernet0/0/0/0.10': {'mtu': 1608, 'counters': {'in_octets': 0, 'out_broadcast_pkts': 0, 'out_pkts': 0, 'in_discards': 0, 'in_pkts': 0, 'in_multicast_pkts': 0, 'in_broadcast_pkts': 0, 'rate': {'out_rate': 0, 'out_rate_pkts': 0, 'in_rate_pkts': 0, 'load_interval': 5, 'in_rate': 0}, 'last_clear': 'never', 'out_multicast_pkts': 0, 'out_octets': 0}, 'enabled': False, 'bandwidth': 768, 'vlan_id': '10', 'encapsulation': {'encapsulation': '802.1Q Virtual LAN', 'first_dot1q': '10', 'second_dot1q': '10'}, 'ipv6': {'enabled': False}}} |
# Least Recently Used Cache
#
# The LRU caching scheme remove the least recently used data when the cache is full and a new page is referenced which is not there in cache.
#
# We use two data structures to implement an LRU Cache:
# - Double Linked List: The maximum size of the queue will be equal to the total number of frames available (cache size). The most recently used pages will be near front end and least recently pages will be near the rear end.
# - HashMap: a Hash with page number as key and address of the corresponding queue node as value.
#
# When a page is referenced, the required page may be in the memory:
# - If it is in the memory, we need to detach the node of the list and bring it to the front of the queue.
# - If the required page is not in memory, we add a new node to the front of the queue and update the corresponding node address in the hash.
# - If the queue is full, we remove a node from the rear of the queue, and add the new node to the front of the queue.
class Node:
'''Double Linked List node implemetation for handling LRU Cache data'''
def __init__(self, key, value):
self.value = value
self.key = key
self.prev = None
self.next = None
def __repr__(self):
return f"Node({self.key}, {self.value})"
def __str__(self):
return f"Node({self.key}, {self.value})"
class Deque:
'''Deque implementation using Double Linked List, with a method to keep track of nodes access.'''
def __init__(self):
self.head = None
self.tail = None
self.num_elements = 0
def enqueue(self, new_node):
'''Nodes are enqueued on tail (newtest pointer)'''
if self.tail is None:
self.tail = new_node
self.head = self.tail
else:
self.tail.next = new_node
new_node.prev = self.tail
self.tail = new_node
self.num_elements += 1
def dequeue(self):
'''Nodes are dequeued on head (oldest poitner)'''
if self.head is None:
return None
else:
key = self.head.key
self.head = self.head.next
if self.head:
self.head.prev = None
self.num_elements -= 1
return key
def access(self, node):
'''An access should deque a random node and enqueue again'''
if node is None or self.tail == node:
# Base cases
return
if self.head == node:
# If is the oldest, move the Head
self.head = node.next
self.head.prev = None
else:
# Otherwise, detach the node
node.prev.next = node.next
node.next.prev = node.prev
# Link the node to the Tail
self.tail.next = node
node.prev = self.tail
node.next = None
# Move the Tail
self.tail = node
def size(self):
return self.num_elements
def to_list(self):
output = list()
node = self.head
while node:
node_tuple = tuple([node.key, node.value])
output.append(node_tuple)
node = node.next
return output
def __repr__(self):
if self.num_elements > 0:
s = "(Oldest) : "
node = self.head
while node:
s += str(node)
if node.next is not None:
s += ", "
node = node.next
s += " (Newest)"
return s
else:
return "Deque: empty!"
class LRU_Cache:
'''LRU Cache data object implementation with O(1) time complexity'''
def __init__(self, capacity: int):
# Initialize class variables
self.lru_dict = dict()
self.lru_deque = Deque()
self.capacity = capacity
def get(self, key: int) -> int:
# Retrieve item from provided key, using the hash map. Return -1 if nonexistent.
if key in self.lru_dict:
node = self.lru_dict[key]
self.lru_deque.access(node)
return node.value
else:
return -1
def put(self, key: int, value: int) -> None:
# Set the value if the key is not present in the cache. If the cache is at capacity remove the oldest item.
if key not in self.lru_dict:
if self.capacity < 1:
return -1
if self.lru_deque.size() >= self.capacity:
# Quick access the oldest element by using the deque
old_node = self.lru_deque.dequeue()
del self.lru_dict[old_node]
new_node = Node(key, value)
self.lru_deque.enqueue(new_node)
self.lru_dict[key] = new_node
else:
node = self.lru_dict[key]
node.value = value
self.lru_deque.access(node)
def to_list(self):
return self.lru_deque.to_list()
def __repr__(self):
if self.lru_deque.num_elements > 0:
s = "LRU_Cache: (Oldest) : "
node = self.lru_deque.head
while node:
s += str(node)
if node.next is not None:
s += ", "
node = node.next
s += " (Newest)"
return s
else:
return "LRU_Cache: empty!"
# Tests cases
# Utility function
def Test_LRU_Cache(test_name, op_list, val_list, result_list, is_debug = False):
lru_cache = None
out_list = []
print(f"{test_name:>25s}: ", end = '')
# Use the operations
for op, val, res in zip(op_list, val_list, result_list):
out = None
if op == "LRUCache":
lru_cache = LRU_Cache(val[0])
elif op == "put":
lru_cache.put(val[0], val[1])
elif op == "get":
out = lru_cache.get(val[0])
out_list.append(out)
if out != res:
print(f"Fail: [LRU Cache content: {lru_cache.to_list()}, op: {op}, val: {val}, res: {res}")
return
if is_debug and op != "LRUCache":
print(f" {op}({val}), dict: {len(lru_cache.lru_dict)}, deque: {lru_cache.lru_deque.size()}")
print(f" dict: {lru_cache.lru_dict}")
print(f" deque: {lru_cache.lru_deque}")
print("Pass")
# Check LRU_Cache
print("\nTesting LRU Cache with access control\n")
# Test Miss LRU access
op_list = ["LRUCache","get"]
val_list = [[5],[1]]
result_list = [None,-1,]
Test_LRU_Cache("Miss LRU access", op_list, val_list, result_list)
# Test Exceed LRU capacity
op_list = ["LRUCache","put","put","put","put","put","get","get"]
val_list = [[3],[1,11],[2,22],[3,33],[4,44],[5,55],[2],[3]]
result_list = [None,None,None,None,None,None,-1,33]
Test_LRU_Cache("Exceed LRU capacity", op_list, val_list, result_list)
# Test Access central element
op_list = ["LRUCache","put","put","put","put","put","get"]
val_list = [[5],[1,11],[2,22],[3,33],[4,44],[5,55],[3]]
result_list = [None,None,None,None,None,None,33]
Test_LRU_Cache("Access central element", op_list, val_list, result_list)
# Test Access last element
op_list = ["LRUCache","put","put","put","put","put","get"]
val_list = [[5],[1,11],[2,22],[3,33],[4,44],[5,55],[5]]
result_list = [None,None,None,None,None,None,55]
Test_LRU_Cache("Access last element", op_list, val_list, result_list)
# Test Access first element
op_list = ["LRUCache","put","put","put","put","put","get"]
val_list = [[5],[1,11],[2,22],[3,33],[4,44],[5,55],[1]]
result_list = [None,None,None,None,None,None,11]
Test_LRU_Cache("Access first element", op_list, val_list, result_list)
# Test for updating value
op_list = ["LRUCache","put","get","put","get"]
val_list = [[5],[1,1],[2],[1,11111],[1]]
result_list = [None,None,-1,None,11111]
Test_LRU_Cache("Updating value", op_list, val_list, result_list)
# Test for zero capacity
op_list = ["LRUCache","put","get"]
val_list = [[0],[1,1],[1]]
result_list = [None,None,-1]
Test_LRU_Cache("Zero capacity", op_list, val_list, result_list)
# Test Update 2
op_list = ["LRUCache","put","put","put","get","put","get","put","get","get","get","get"]
val_list = [[2],[1,1],[2,2],[2,3],[2],[3,3],[2],[4,4],[1],[2],[3],[4]]
result_list = [None,None,None,None,3,None,3,None,-1,3,-1,4]
Test_LRU_Cache("Update 2", op_list, val_list, result_list)
# Test One element Deque add
op_list = ["LRUCache","put","get","put","get","get"]
val_list = [[1],[2,1],[2],[3,2],[2],[3]]
result_list = [None,None,1,None,-1,2]
Test_LRU_Cache("One element Deque add", op_list, val_list, result_list)
# Test Update and get
op_list = ["LRUCache","put","put","put","put","get","get"]
val_list = [[2],[2,1],[1,1],[2,3],[4,1],[1],[2]]
result_list = [None, None, None, None, None, -1, 3]
Test_LRU_Cache("Update and get", op_list, val_list, result_list)
# Test Long list
op_list = ["LRUCache","put","put","put","put","put","get","put","get","get","put","get","put","put","put","get","put","get","get","get","get","put","put","get","get","get","put","put","get","put","get","put","get","get","get","put","put","put","get","put","get","get","put","put","get","put","put","put","put","get","put","put","get","put","put","get","put","put","put","put","put","get","put","put","get","put","get","get","get","put","get","get","put","put","put","put","get","put","put","put","put","get","get","get","put","put","put","get","put","put","put","get","put","put","put","get","get","get","put","put","put","put","get","put","put","put","put","put","put","put"]
val_list = [[10],[10,13],[3,17],[6,11],[10,5],[9,10],[13],[2,19],[2],[3],[5,25],[8],[9,22],[5,5],[1,30],[11],[9,12],[7],[5],[8],[9],[4,30],[9,3],[9],[10],[10],[6,14],[3,1],[3],[10,11],[8],[2,14],[1],[5],[4],[11,4],[12,24],[5,18],[13],[7,23],[8],[12],[3,27],[2,12],[5],[2,9],[13,4],[8,18],[1,7],[6],[9,29],[8,21],[5],[6,30],[1,12],[10],[4,15],[7,22],[11,26],[8,17],[9,29],[5],[3,4],[11,30],[12],[4,29],[3],[9],[6],[3,4],[1],[10],[3,29],[10,28],[1,20],[11,13],[3],[3,12],[3,8],[10,9],[3,26],[8],[7],[5],[13,17],[2,27],[11,15],[12],[9,19],[2,15],[3,16],[1],[12,17],[9,1],[6,19],[4],[5],[5],[8,1],[11,7],[5,2],[9,28],[1],[2,2],[7,4],[4,22],[7,24],[9,26],[13,28],[11,26]]
result_list = [None, None, None, None, None, None, -1, None, 19, 17, None, -1, None, None, None, -1, None, -1, 5, -1, 12, None, None, 3, 5, 5, None, None, 1, None, -1, None, 30, 5, 30, None, None, None, -1, None, -1, 24, None, None, 18, None, None, None, None, -1, None, None, 18, None, None, -1, None, None, None, None, None, 18, None, None, -1, None, 4, 29, 30, None, 12, -1, None, None, None, None, 29, None, None, None, None, 17, 22, 18, None, None, None, -1, None, None, None, 20, None, None, None, -1, 18, 18, None, None, None, None, 20, None, None, None, None, None, None, None]
Test_LRU_Cache("Long list", op_list, val_list, result_list)
| class Node:
"""Double Linked List node implemetation for handling LRU Cache data"""
def __init__(self, key, value):
self.value = value
self.key = key
self.prev = None
self.next = None
def __repr__(self):
return f'Node({self.key}, {self.value})'
def __str__(self):
return f'Node({self.key}, {self.value})'
class Deque:
"""Deque implementation using Double Linked List, with a method to keep track of nodes access."""
def __init__(self):
self.head = None
self.tail = None
self.num_elements = 0
def enqueue(self, new_node):
"""Nodes are enqueued on tail (newtest pointer)"""
if self.tail is None:
self.tail = new_node
self.head = self.tail
else:
self.tail.next = new_node
new_node.prev = self.tail
self.tail = new_node
self.num_elements += 1
def dequeue(self):
"""Nodes are dequeued on head (oldest poitner)"""
if self.head is None:
return None
else:
key = self.head.key
self.head = self.head.next
if self.head:
self.head.prev = None
self.num_elements -= 1
return key
def access(self, node):
"""An access should deque a random node and enqueue again"""
if node is None or self.tail == node:
return
if self.head == node:
self.head = node.next
self.head.prev = None
else:
node.prev.next = node.next
node.next.prev = node.prev
self.tail.next = node
node.prev = self.tail
node.next = None
self.tail = node
def size(self):
return self.num_elements
def to_list(self):
output = list()
node = self.head
while node:
node_tuple = tuple([node.key, node.value])
output.append(node_tuple)
node = node.next
return output
def __repr__(self):
if self.num_elements > 0:
s = '(Oldest) : '
node = self.head
while node:
s += str(node)
if node.next is not None:
s += ', '
node = node.next
s += ' (Newest)'
return s
else:
return 'Deque: empty!'
class Lru_Cache:
"""LRU Cache data object implementation with O(1) time complexity"""
def __init__(self, capacity: int):
self.lru_dict = dict()
self.lru_deque = deque()
self.capacity = capacity
def get(self, key: int) -> int:
if key in self.lru_dict:
node = self.lru_dict[key]
self.lru_deque.access(node)
return node.value
else:
return -1
def put(self, key: int, value: int) -> None:
if key not in self.lru_dict:
if self.capacity < 1:
return -1
if self.lru_deque.size() >= self.capacity:
old_node = self.lru_deque.dequeue()
del self.lru_dict[old_node]
new_node = node(key, value)
self.lru_deque.enqueue(new_node)
self.lru_dict[key] = new_node
else:
node = self.lru_dict[key]
node.value = value
self.lru_deque.access(node)
def to_list(self):
return self.lru_deque.to_list()
def __repr__(self):
if self.lru_deque.num_elements > 0:
s = 'LRU_Cache: (Oldest) : '
node = self.lru_deque.head
while node:
s += str(node)
if node.next is not None:
s += ', '
node = node.next
s += ' (Newest)'
return s
else:
return 'LRU_Cache: empty!'
def test_lru__cache(test_name, op_list, val_list, result_list, is_debug=False):
lru_cache = None
out_list = []
print(f'{test_name:>25s}: ', end='')
for (op, val, res) in zip(op_list, val_list, result_list):
out = None
if op == 'LRUCache':
lru_cache = lru__cache(val[0])
elif op == 'put':
lru_cache.put(val[0], val[1])
elif op == 'get':
out = lru_cache.get(val[0])
out_list.append(out)
if out != res:
print(f'Fail: [LRU Cache content: {lru_cache.to_list()}, op: {op}, val: {val}, res: {res}')
return
if is_debug and op != 'LRUCache':
print(f' {op}({val}), dict: {len(lru_cache.lru_dict)}, deque: {lru_cache.lru_deque.size()}')
print(f' dict: {lru_cache.lru_dict}')
print(f' deque: {lru_cache.lru_deque}')
print('Pass')
print('\nTesting LRU Cache with access control\n')
op_list = ['LRUCache', 'get']
val_list = [[5], [1]]
result_list = [None, -1]
test_lru__cache('Miss LRU access', op_list, val_list, result_list)
op_list = ['LRUCache', 'put', 'put', 'put', 'put', 'put', 'get', 'get']
val_list = [[3], [1, 11], [2, 22], [3, 33], [4, 44], [5, 55], [2], [3]]
result_list = [None, None, None, None, None, None, -1, 33]
test_lru__cache('Exceed LRU capacity', op_list, val_list, result_list)
op_list = ['LRUCache', 'put', 'put', 'put', 'put', 'put', 'get']
val_list = [[5], [1, 11], [2, 22], [3, 33], [4, 44], [5, 55], [3]]
result_list = [None, None, None, None, None, None, 33]
test_lru__cache('Access central element', op_list, val_list, result_list)
op_list = ['LRUCache', 'put', 'put', 'put', 'put', 'put', 'get']
val_list = [[5], [1, 11], [2, 22], [3, 33], [4, 44], [5, 55], [5]]
result_list = [None, None, None, None, None, None, 55]
test_lru__cache('Access last element', op_list, val_list, result_list)
op_list = ['LRUCache', 'put', 'put', 'put', 'put', 'put', 'get']
val_list = [[5], [1, 11], [2, 22], [3, 33], [4, 44], [5, 55], [1]]
result_list = [None, None, None, None, None, None, 11]
test_lru__cache('Access first element', op_list, val_list, result_list)
op_list = ['LRUCache', 'put', 'get', 'put', 'get']
val_list = [[5], [1, 1], [2], [1, 11111], [1]]
result_list = [None, None, -1, None, 11111]
test_lru__cache('Updating value', op_list, val_list, result_list)
op_list = ['LRUCache', 'put', 'get']
val_list = [[0], [1, 1], [1]]
result_list = [None, None, -1]
test_lru__cache('Zero capacity', op_list, val_list, result_list)
op_list = ['LRUCache', 'put', 'put', 'put', 'get', 'put', 'get', 'put', 'get', 'get', 'get', 'get']
val_list = [[2], [1, 1], [2, 2], [2, 3], [2], [3, 3], [2], [4, 4], [1], [2], [3], [4]]
result_list = [None, None, None, None, 3, None, 3, None, -1, 3, -1, 4]
test_lru__cache('Update 2', op_list, val_list, result_list)
op_list = ['LRUCache', 'put', 'get', 'put', 'get', 'get']
val_list = [[1], [2, 1], [2], [3, 2], [2], [3]]
result_list = [None, None, 1, None, -1, 2]
test_lru__cache('One element Deque add', op_list, val_list, result_list)
op_list = ['LRUCache', 'put', 'put', 'put', 'put', 'get', 'get']
val_list = [[2], [2, 1], [1, 1], [2, 3], [4, 1], [1], [2]]
result_list = [None, None, None, None, None, -1, 3]
test_lru__cache('Update and get', op_list, val_list, result_list)
op_list = ['LRUCache', 'put', 'put', 'put', 'put', 'put', 'get', 'put', 'get', 'get', 'put', 'get', 'put', 'put', 'put', 'get', 'put', 'get', 'get', 'get', 'get', 'put', 'put', 'get', 'get', 'get', 'put', 'put', 'get', 'put', 'get', 'put', 'get', 'get', 'get', 'put', 'put', 'put', 'get', 'put', 'get', 'get', 'put', 'put', 'get', 'put', 'put', 'put', 'put', 'get', 'put', 'put', 'get', 'put', 'put', 'get', 'put', 'put', 'put', 'put', 'put', 'get', 'put', 'put', 'get', 'put', 'get', 'get', 'get', 'put', 'get', 'get', 'put', 'put', 'put', 'put', 'get', 'put', 'put', 'put', 'put', 'get', 'get', 'get', 'put', 'put', 'put', 'get', 'put', 'put', 'put', 'get', 'put', 'put', 'put', 'get', 'get', 'get', 'put', 'put', 'put', 'put', 'get', 'put', 'put', 'put', 'put', 'put', 'put', 'put']
val_list = [[10], [10, 13], [3, 17], [6, 11], [10, 5], [9, 10], [13], [2, 19], [2], [3], [5, 25], [8], [9, 22], [5, 5], [1, 30], [11], [9, 12], [7], [5], [8], [9], [4, 30], [9, 3], [9], [10], [10], [6, 14], [3, 1], [3], [10, 11], [8], [2, 14], [1], [5], [4], [11, 4], [12, 24], [5, 18], [13], [7, 23], [8], [12], [3, 27], [2, 12], [5], [2, 9], [13, 4], [8, 18], [1, 7], [6], [9, 29], [8, 21], [5], [6, 30], [1, 12], [10], [4, 15], [7, 22], [11, 26], [8, 17], [9, 29], [5], [3, 4], [11, 30], [12], [4, 29], [3], [9], [6], [3, 4], [1], [10], [3, 29], [10, 28], [1, 20], [11, 13], [3], [3, 12], [3, 8], [10, 9], [3, 26], [8], [7], [5], [13, 17], [2, 27], [11, 15], [12], [9, 19], [2, 15], [3, 16], [1], [12, 17], [9, 1], [6, 19], [4], [5], [5], [8, 1], [11, 7], [5, 2], [9, 28], [1], [2, 2], [7, 4], [4, 22], [7, 24], [9, 26], [13, 28], [11, 26]]
result_list = [None, None, None, None, None, None, -1, None, 19, 17, None, -1, None, None, None, -1, None, -1, 5, -1, 12, None, None, 3, 5, 5, None, None, 1, None, -1, None, 30, 5, 30, None, None, None, -1, None, -1, 24, None, None, 18, None, None, None, None, -1, None, None, 18, None, None, -1, None, None, None, None, None, 18, None, None, -1, None, 4, 29, 30, None, 12, -1, None, None, None, None, 29, None, None, None, None, 17, 22, 18, None, None, None, -1, None, None, None, 20, None, None, None, -1, 18, 18, None, None, None, None, 20, None, None, None, None, None, None, None]
test_lru__cache('Long list', op_list, val_list, result_list) |
#python 3.5.2
'''
With the Remained Methods first you count the number of elements you what to store. So the length of the
array will eaual the number of elements you want so each element will have place to be stored. When you
do the divide by array length the remainer will always to equal or less than the number of element in the
array.
The folding method for constructing hash functions begins by dividing the item into equal-size pieces
(the last piece may not be of equal size). These pieces are then added together to give the resulting
hash value. For example, if our item was the phone number 436-555-4601, we would take the digits and
divide them into groups of 2 (43,65,55,46,01). After the addition, 43+65+55+46+01, we get 210.
If we assume our hash table has 11 slots, then we need to perform the extra step of dividing by
11 and keeping the remainder. In this case 210 % 11 is 1, so the phone number 436-555-4601 hashes
to slot 1. Some folding methods go one step further and reverse every other piece before the addition.
For the above example, we get 43+56+55+64+01=219 which gives 219 % 11=10.
'''
def convertPhoneNo(phoneNo):
firstNo = int(phoneNo[0])*10 + int(phoneNo[1])
secondNo = int(phoneNo[2])*10 + int(phoneNo[4])
thirdNo = int(phoneNo[5])*10 + int(phoneNo[6])
fourthNo = int(phoneNo[8])*10 + int(phoneNo[9])
fifthNo = int(phoneNo[10])*10 + int(phoneNo[11])
result =firstNo+secondNo+thirdNo+fourthNo+fifthNo
print( phoneNo ," = ", result )
return result
def hash( length ):
def remainderMethod(phoneNo):
element = convertPhoneNo(phoneNo)
print( element , ' % ', length, ' = ', element % length)
return element % length
return remainderMethod
def insertHash( elementList ):
resultsList = [None] * len( elementList )
func = hash( len( elementList ) )
for element in elementList:
index = func(element)
while resultsList [ index ] != None:
print('Collision Index: ' , index)
#if we at the last element in array go to first element in array
if index == len( elementList ) -1:
index = 0
else:
index = index +1
resultsList[index] = element
print( 'Insert Index: ', index)
print( resultsList )
print( '-'*20 )
print( '-'*20 )
return resultsList
print ( insertHash( ['436-555-4601','436-555-4600','436-555-4611','436-555-4621','436-555-4634'] ) )
'''
OUTPUT:
436-555-4601 = 210
210 % 5 = 0
Insert Index: 0
['436-555-4601', None, None, None, None]
--------------------
436-555-4600 = 209
209 % 5 = 4
Insert Index: 4
['436-555-4601', None, None, None, '436-555-4600']
--------------------
436-555-4611 = 220
220 % 5 = 0
Collision Index: 0
Insert Index: 1
['436-555-4601', '436-555-4611', None, None, '436-555-4600']
--------------------
436-555-4621 = 230
230 % 5 = 0
Collision Index: 0
Collision Index: 1
Insert Index: 2
['436-555-4601', '436-555-4611', '436-555-4621', None, '436-555-4600']
--------------------
436-555-4634 = 243
243 % 5 = 3
Insert Index: 3
['436-555-4601', '436-555-4611', '436-555-4621', '436-555-4634', '436-555-4600']
--------------------
--------------------
['436-555-4601', '436-555-4611', '436-555-4621', '436-555-4634', '436-555-4600']
'''
| """
With the Remained Methods first you count the number of elements you what to store. So the length of the
array will eaual the number of elements you want so each element will have place to be stored. When you
do the divide by array length the remainer will always to equal or less than the number of element in the
array.
The folding method for constructing hash functions begins by dividing the item into equal-size pieces
(the last piece may not be of equal size). These pieces are then added together to give the resulting
hash value. For example, if our item was the phone number 436-555-4601, we would take the digits and
divide them into groups of 2 (43,65,55,46,01). After the addition, 43+65+55+46+01, we get 210.
If we assume our hash table has 11 slots, then we need to perform the extra step of dividing by
11 and keeping the remainder. In this case 210 % 11 is 1, so the phone number 436-555-4601 hashes
to slot 1. Some folding methods go one step further and reverse every other piece before the addition.
For the above example, we get 43+56+55+64+01=219 which gives 219 % 11=10.
"""
def convert_phone_no(phoneNo):
first_no = int(phoneNo[0]) * 10 + int(phoneNo[1])
second_no = int(phoneNo[2]) * 10 + int(phoneNo[4])
third_no = int(phoneNo[5]) * 10 + int(phoneNo[6])
fourth_no = int(phoneNo[8]) * 10 + int(phoneNo[9])
fifth_no = int(phoneNo[10]) * 10 + int(phoneNo[11])
result = firstNo + secondNo + thirdNo + fourthNo + fifthNo
print(phoneNo, ' = ', result)
return result
def hash(length):
def remainder_method(phoneNo):
element = convert_phone_no(phoneNo)
print(element, ' % ', length, ' = ', element % length)
return element % length
return remainderMethod
def insert_hash(elementList):
results_list = [None] * len(elementList)
func = hash(len(elementList))
for element in elementList:
index = func(element)
while resultsList[index] != None:
print('Collision Index: ', index)
if index == len(elementList) - 1:
index = 0
else:
index = index + 1
resultsList[index] = element
print('Insert Index: ', index)
print(resultsList)
print('-' * 20)
print('-' * 20)
return resultsList
print(insert_hash(['436-555-4601', '436-555-4600', '436-555-4611', '436-555-4621', '436-555-4634']))
"\nOUTPUT:\n\n436-555-4601 = 210\n210 % 5 = 0\nInsert Index: 0\n['436-555-4601', None, None, None, None]\n--------------------\n436-555-4600 = 209\n209 % 5 = 4\nInsert Index: 4\n['436-555-4601', None, None, None, '436-555-4600']\n--------------------\n436-555-4611 = 220\n220 % 5 = 0\nCollision Index: 0\nInsert Index: 1\n['436-555-4601', '436-555-4611', None, None, '436-555-4600']\n--------------------\n436-555-4621 = 230\n230 % 5 = 0\nCollision Index: 0\nCollision Index: 1\nInsert Index: 2\n['436-555-4601', '436-555-4611', '436-555-4621', None, '436-555-4600']\n--------------------\n436-555-4634 = 243\n243 % 5 = 3\nInsert Index: 3\n['436-555-4601', '436-555-4611', '436-555-4621', '436-555-4634', '436-555-4600']\n--------------------\n--------------------\n['436-555-4601', '436-555-4611', '436-555-4621', '436-555-4634', '436-555-4600']\n\n" |
def secti(a, b):
return a + b
if __name__ == '__main__':
print(secti(1, 2))
# https://stackoverflow.com/questions/419163/what-does-if-name-main-do
| def secti(a, b):
return a + b
if __name__ == '__main__':
print(secti(1, 2)) |
weights_path = './weights'
#pre trained model
name_model = 'model_unet'
#directory where read noisy sound to denoise
audio_dir_prediction = './mypredictions/input/'
#directory to save the denoise sound
dir_save_prediction = './mypredictions/output/'
#Name noisy sound file to denoise
#audio_input_prediction = args.audio_input_prediction
#Name of denoised sound file to save
#audio_output_prediction = args.audio_output_prediction
# Sample rate to read audio
sample_rate = 8000
# Minimum duration of audio files to consider
min_duration = 1.0
#Frame length for training data
frame_length = 8064
# hop length for sound files
hop_length_frame = 8064
#nb of points for fft(for spectrogram computation)
n_fft = 255
#hop length for fft
hop_length_fft = 63 | weights_path = './weights'
name_model = 'model_unet'
audio_dir_prediction = './mypredictions/input/'
dir_save_prediction = './mypredictions/output/'
sample_rate = 8000
min_duration = 1.0
frame_length = 8064
hop_length_frame = 8064
n_fft = 255
hop_length_fft = 63 |
BOT_NAME = 'books_images'
SPIDER_MODULES = ['books_images.spiders']
NEWSPIDER_MODULE = 'books_images.spiders'
ROBOTSTXT_OBEY = True
ITEM_PIPELINES = {
'books_images.pipelines.BooksImagesPipeline': 1
}
FILES_STORE = r'downloaded'
# Change this to your path
DOWNLOAD_DELAY = 2
# Change to 0 for fastest crawl
| bot_name = 'books_images'
spider_modules = ['books_images.spiders']
newspider_module = 'books_images.spiders'
robotstxt_obey = True
item_pipelines = {'books_images.pipelines.BooksImagesPipeline': 1}
files_store = 'downloaded'
download_delay = 2 |
#punto1
def triangulo(a,b):
area = (b * a)/2
print(area)
triangulo(30,50)
| def triangulo(a, b):
area = b * a / 2
print(area)
triangulo(30, 50) |
area = float(input())
kgInM = float(input())
badGrape = float(input())
allGrape = area * kgInM
restGrape = allGrape - badGrape
rakia = restGrape * 45 / 100
sell = restGrape * 55 / 100
lRakia = (rakia / 7.5) * 9.80
lSell = sell * 1.5
print('%.2f' % lRakia)
print('%.2f' % lSell) | area = float(input())
kg_in_m = float(input())
bad_grape = float(input())
all_grape = area * kgInM
rest_grape = allGrape - badGrape
rakia = restGrape * 45 / 100
sell = restGrape * 55 / 100
l_rakia = rakia / 7.5 * 9.8
l_sell = sell * 1.5
print('%.2f' % lRakia)
print('%.2f' % lSell) |
inputFile = open("input/day7.txt", "r")
inputLines = inputFile.readlines()
listBagsWithoutShinyGold = []
listBagsWithShinyGold = []
listUncertain = []
def goldMiner():
for line in inputLines:
splittedLine = line.split()
bagColor = splittedLine[0] + splittedLine[1]
childrenBags = []
if splittedLine[4] == "no" or bagColor == "shinygold":
if bagColor not in listBagsWithoutShinyGold:
listBagsWithoutShinyGold.append(bagColor)
else:
someChildrenBags = True
counter = 5
while someChildrenBags:
childrenBags.append(splittedLine[counter] + splittedLine[counter + 1])
if (splittedLine[counter + 2] == "bag.") or (splittedLine[counter + 2] == "bags."):
someChildrenBags = False
counter = counter + 4
if "shinygold" in childrenBags:
if bagColor not in listBagsWithShinyGold:
listBagsWithShinyGold.append(bagColor)
else:
# Look into every children to see if they can have the bag
for childrenBag in childrenBags:
if childrenBag in listBagsWithShinyGold:
if bagColor not in listBagsWithShinyGold:
listBagsWithShinyGold.append(bagColor)
else:
if bagColor not in listUncertain:
listUncertain.append(bagColor)
goldMiner()
lastRunCount = 0
while lastRunCount != len(listBagsWithShinyGold):
lastRunCount = len(listBagsWithShinyGold)
goldMiner()
print("Bags that can eventually contain one shiny gold bag {}".format(len(listBagsWithShinyGold)))
def bagCounter(color):
for line in inputLines:
splittedLine = line.split()
bagColor = splittedLine[0] + splittedLine[1]
if bagColor == color:
childrenBags = []
someChildrenBags = True
counter = 4
while someChildrenBags:
childrenBags.append((splittedLine[counter + 1] + splittedLine[counter + 2], int(splittedLine[counter])))
if (splittedLine[counter + 3] == "bag.") or (splittedLine[counter + 3] == "bags."):
someChildrenBags = False
counter = counter + 4
return childrenBags
numberOfBags = 0
returnedBag = bagCounter("shinygold")
for bag in returnedBag:
numberOfBags = numberOfBags + bag[1]
# Need to go down further
print("Nested bags {}".format(numberOfBags))
inputFile.close()
| input_file = open('input/day7.txt', 'r')
input_lines = inputFile.readlines()
list_bags_without_shiny_gold = []
list_bags_with_shiny_gold = []
list_uncertain = []
def gold_miner():
for line in inputLines:
splitted_line = line.split()
bag_color = splittedLine[0] + splittedLine[1]
children_bags = []
if splittedLine[4] == 'no' or bagColor == 'shinygold':
if bagColor not in listBagsWithoutShinyGold:
listBagsWithoutShinyGold.append(bagColor)
else:
some_children_bags = True
counter = 5
while someChildrenBags:
childrenBags.append(splittedLine[counter] + splittedLine[counter + 1])
if splittedLine[counter + 2] == 'bag.' or splittedLine[counter + 2] == 'bags.':
some_children_bags = False
counter = counter + 4
if 'shinygold' in childrenBags:
if bagColor not in listBagsWithShinyGold:
listBagsWithShinyGold.append(bagColor)
else:
for children_bag in childrenBags:
if childrenBag in listBagsWithShinyGold:
if bagColor not in listBagsWithShinyGold:
listBagsWithShinyGold.append(bagColor)
elif bagColor not in listUncertain:
listUncertain.append(bagColor)
gold_miner()
last_run_count = 0
while lastRunCount != len(listBagsWithShinyGold):
last_run_count = len(listBagsWithShinyGold)
gold_miner()
print('Bags that can eventually contain one shiny gold bag {}'.format(len(listBagsWithShinyGold)))
def bag_counter(color):
for line in inputLines:
splitted_line = line.split()
bag_color = splittedLine[0] + splittedLine[1]
if bagColor == color:
children_bags = []
some_children_bags = True
counter = 4
while someChildrenBags:
childrenBags.append((splittedLine[counter + 1] + splittedLine[counter + 2], int(splittedLine[counter])))
if splittedLine[counter + 3] == 'bag.' or splittedLine[counter + 3] == 'bags.':
some_children_bags = False
counter = counter + 4
return childrenBags
number_of_bags = 0
returned_bag = bag_counter('shinygold')
for bag in returnedBag:
number_of_bags = numberOfBags + bag[1]
print('Nested bags {}'.format(numberOfBags))
inputFile.close() |
# Given an integer array nums, find the contiguous subarray (containing at least one number)
# which has the largest sum and return its sum.
# Example:
# Input: [-2,1,-3,4,-1,2,1,-5,4],
# Output: 6
# Explanation: [4,-1,2,1] has the largest sum = 6.
# Follow up:
# If you have figured out the O(n) solution, try coding another solution
# using the divide and conquer approach, which is more subtle.
class Solution:
def maxSubArray(self, nums):
total_sum = max_sum = nums[0]
for i in nums[1:]:
total_sum = max(i, total_sum+i)
max_sum = max(max_sum, total_sum)
return max_sum
if __name__ == "__main__":
nums = [-2,1,-3,4,-1,2,1,-5,4]
print(Solution().maxSubArray(nums)) | class Solution:
def max_sub_array(self, nums):
total_sum = max_sum = nums[0]
for i in nums[1:]:
total_sum = max(i, total_sum + i)
max_sum = max(max_sum, total_sum)
return max_sum
if __name__ == '__main__':
nums = [-2, 1, -3, 4, -1, 2, 1, -5, 4]
print(solution().maxSubArray(nums)) |
def sum2(nums):
if len(nums) >= 2 :
return (nums[0] + nums[1])
elif len(nums) == 1 :
return nums[0]
else :
return 0 | def sum2(nums):
if len(nums) >= 2:
return nums[0] + nums[1]
elif len(nums) == 1:
return nums[0]
else:
return 0 |
''' r : It opens the file to read-only. The file pointer exists at the beginning. The file
is by default open in this mode if no access mode is passed. '''
''' w : It opens the file to write only. It overwrites the file if previously exists
or creates a new one if no file exists with the same name. The file pointer
exists at the beginning of the file.'''
# change your parent dir accordingly
f = open("E:/GitHub/1) Git_Tutorials_Repo_Projects/core-python/Core_Python/ExFiles/FileMethod.txt",'w')
print("File Name : ",f.name)
print("File Modes : ",f.mode)
print("Return an integer number (file descriptor) of the file : ",f.fileno())
print("Readable : ",f.readable())
print("Writable : ",f.writable())
print("Returns the current position of file : ",f.tell())
print("Truncate : ",f.truncate())
f.close()
| """ r : It opens the file to read-only. The file pointer exists at the beginning. The file
is by default open in this mode if no access mode is passed. """
' w : It opens the file to write only. It overwrites the file if previously exists \n or creates a new one if no file exists with the same name. The file pointer \n exists at the beginning of the file.'
f = open('E:/GitHub/1) Git_Tutorials_Repo_Projects/core-python/Core_Python/ExFiles/FileMethod.txt', 'w')
print('File Name : ', f.name)
print('File Modes : ', f.mode)
print('Return an integer number (file descriptor) of the file : ', f.fileno())
print('Readable : ', f.readable())
print('Writable : ', f.writable())
print('Returns the current position of file : ', f.tell())
print('Truncate : ', f.truncate())
f.close() |
# !/usr/bin/env python3
#############################################################################
# #
# Program purpose: Displays a histogram from list data #
# Program Author : Happi Yvan <ivensteinpoker@gmail.com> #
# Creation Date : July 14, 2019 #
# #
#############################################################################
# URL: https://www.w3resource.com/python-exercises/python-basic-exercises.php
def histogram(someList, char):
for x in someList:
while x > 0:
print(f"{char}", end='')
x = x-1
print(f"\n")
if __name__ == "__main__":
randList = [3, 7, 4, 2, 6]
histogram(randList, '*')
| def histogram(someList, char):
for x in someList:
while x > 0:
print(f'{char}', end='')
x = x - 1
print(f'\n')
if __name__ == '__main__':
rand_list = [3, 7, 4, 2, 6]
histogram(randList, '*') |
class Dice(object):
def __init__(self, labels):
self.stat = labels
def roll_e(self):
self.stat[0], self.stat[2], self.stat[5], self.stat[3] = self.stat[3], self.stat[0], self.stat[2], self.stat[5]
def roll_w(self):
self.stat[0], self.stat[2], self.stat[5], self.stat[3] = self.stat[2], self.stat[5], self.stat[3], self.stat[0]
def roll_n(self):
self.stat[0], self.stat[1], self.stat[5], self.stat[4] = self.stat[1], self.stat[5], self.stat[4], self.stat[0]
def roll_s(self):
self.stat[0], self.stat[1], self.stat[5], self.stat[4] = self.stat[4], self.stat[0], self.stat[1], self.stat[5]
def get_top(self):
return self.stat[0]
dice = Dice(input().split())
commands = input()
for command in commands:
if command == "E":
dice.roll_e()
elif command == "W":
dice.roll_w()
elif command == "N":
dice.roll_n()
elif command == "S":
dice.roll_s()
print(dice.get_top())
| class Dice(object):
def __init__(self, labels):
self.stat = labels
def roll_e(self):
(self.stat[0], self.stat[2], self.stat[5], self.stat[3]) = (self.stat[3], self.stat[0], self.stat[2], self.stat[5])
def roll_w(self):
(self.stat[0], self.stat[2], self.stat[5], self.stat[3]) = (self.stat[2], self.stat[5], self.stat[3], self.stat[0])
def roll_n(self):
(self.stat[0], self.stat[1], self.stat[5], self.stat[4]) = (self.stat[1], self.stat[5], self.stat[4], self.stat[0])
def roll_s(self):
(self.stat[0], self.stat[1], self.stat[5], self.stat[4]) = (self.stat[4], self.stat[0], self.stat[1], self.stat[5])
def get_top(self):
return self.stat[0]
dice = dice(input().split())
commands = input()
for command in commands:
if command == 'E':
dice.roll_e()
elif command == 'W':
dice.roll_w()
elif command == 'N':
dice.roll_n()
elif command == 'S':
dice.roll_s()
print(dice.get_top()) |
def sum(number1, number2):
total = number1 + number2
print(total)
print("suma de 1 + 50")
sum(1,50)
print("suma de 1 + 500")
sum(500,1)
print("programa terminado") | def sum(number1, number2):
total = number1 + number2
print(total)
print('suma de 1 + 50')
sum(1, 50)
print('suma de 1 + 500')
sum(500, 1)
print('programa terminado') |
class Solution:
def isUgly(self, n: int) -> bool:
while True:
k=n
if n%2==0:
n=n//2
if n%3==0:
n=n//3
if n%5==0:
n=n//5
if k==n:
break
if n==1:
return True
| class Solution:
def is_ugly(self, n: int) -> bool:
while True:
k = n
if n % 2 == 0:
n = n // 2
if n % 3 == 0:
n = n // 3
if n % 5 == 0:
n = n // 5
if k == n:
break
if n == 1:
return True |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.