content stringlengths 7 1.05M | fixed_cases stringlengths 1 1.28M |
|---|---|
class Mail:
def __init__(self, application, driver_config=None):
self.application = application
self.drivers = {}
self.driver_config = driver_config or {}
self.options = {}
def add_driver(self, name, driver):
self.drivers.update({name: driver})
def set_configuration(self, config):
self.driver_config = config
return self
def get_driver(self, name=None):
if name is None:
return self.drivers[self.driver_config.get("default")]
return self.drivers[name]
def get_config_options(self, driver=None):
if driver is None:
return self.driver_config.get(self.driver_config.get("default"), {})
return self.driver_config.get(driver, {})
def mailable(self, mailable):
self.options = mailable.set_application(self.application).build().get_options()
return self
def send(self, driver=None):
selected_driver = driver or self.options.get("driver", None)
self.options.update(self.get_config_options(selected_driver))
return self.get_driver(selected_driver).set_options(self.options).send()
| class Mail:
def __init__(self, application, driver_config=None):
self.application = application
self.drivers = {}
self.driver_config = driver_config or {}
self.options = {}
def add_driver(self, name, driver):
self.drivers.update({name: driver})
def set_configuration(self, config):
self.driver_config = config
return self
def get_driver(self, name=None):
if name is None:
return self.drivers[self.driver_config.get('default')]
return self.drivers[name]
def get_config_options(self, driver=None):
if driver is None:
return self.driver_config.get(self.driver_config.get('default'), {})
return self.driver_config.get(driver, {})
def mailable(self, mailable):
self.options = mailable.set_application(self.application).build().get_options()
return self
def send(self, driver=None):
selected_driver = driver or self.options.get('driver', None)
self.options.update(self.get_config_options(selected_driver))
return self.get_driver(selected_driver).set_options(self.options).send() |
#
# PySNMP MIB module H3C-BLG-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/H3C-BLG-MIB
# Produced by pysmi-0.3.4 at Wed May 1 13:21:27 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
OctetString, ObjectIdentifier, Integer = mibBuilder.importSymbols("ASN1", "OctetString", "ObjectIdentifier", "Integer")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
SingleValueConstraint, ConstraintsUnion, ConstraintsIntersection, ValueRangeConstraint, ValueSizeConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "SingleValueConstraint", "ConstraintsUnion", "ConstraintsIntersection", "ValueRangeConstraint", "ValueSizeConstraint")
h3cCommon, = mibBuilder.importSymbols("HUAWEI-3COM-OID-MIB", "h3cCommon")
ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "NotificationGroup")
MibIdentifier, TimeTicks, iso, Gauge32, ObjectIdentity, MibScalar, MibTable, MibTableRow, MibTableColumn, Unsigned32, Counter64, ModuleIdentity, Bits, NotificationType, IpAddress, Integer32, Counter32 = mibBuilder.importSymbols("SNMPv2-SMI", "MibIdentifier", "TimeTicks", "iso", "Gauge32", "ObjectIdentity", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Unsigned32", "Counter64", "ModuleIdentity", "Bits", "NotificationType", "IpAddress", "Integer32", "Counter32")
TextualConvention, DisplayString = mibBuilder.importSymbols("SNMPv2-TC", "TextualConvention", "DisplayString")
h3cBlg = ModuleIdentity((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108))
h3cBlg.setRevisions(('2009-09-15 11:11',))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
if mibBuilder.loadTexts: h3cBlg.setRevisionsDescriptions(('The initial version of this MIB.',))
if mibBuilder.loadTexts: h3cBlg.setLastUpdated('200909151111Z')
if mibBuilder.loadTexts: h3cBlg.setOrganization('H3C Technologies Co., Ltd.')
if mibBuilder.loadTexts: h3cBlg.setContactInfo('Platform Team H3C Technologies Co., Ltd. Hai-Dian District Beijing P.R. China Http://www.h3c.com Zip:100085')
if mibBuilder.loadTexts: h3cBlg.setDescription('This MIB module defines a set of basic objects for configuring switches and routers to set/get balance group information.')
class CounterClear(TextualConvention, Integer32):
description = "Cleared: reset the value of the group's counter. Nouse: 'nouse' will be returned when getting."
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2))
namedValues = NamedValues(("cleared", 1), ("nouse", 2))
h3cBlgObjects = MibIdentifier((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1))
h3cBlgStatsTable = MibTable((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1), )
if mibBuilder.loadTexts: h3cBlgStatsTable.setStatus('current')
if mibBuilder.loadTexts: h3cBlgStatsTable.setDescription('This table contains the statistics information about balance groups.')
h3cBlgStatsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1, 1), ).setIndexNames((0, "H3C-BLG-MIB", "h3cBlgIndex"))
if mibBuilder.loadTexts: h3cBlgStatsEntry.setStatus('current')
if mibBuilder.loadTexts: h3cBlgStatsEntry.setDescription('This list contains statistics information.')
h3cBlgIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 2147483647)))
if mibBuilder.loadTexts: h3cBlgIndex.setStatus('current')
if mibBuilder.loadTexts: h3cBlgIndex.setDescription('The index of the balance group.')
h3cBlgGroupTxPacketCount = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1, 1, 2), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: h3cBlgGroupTxPacketCount.setStatus('current')
if mibBuilder.loadTexts: h3cBlgGroupTxPacketCount.setDescription('When retrieved, this object returns the count of packets the balance group has sent.')
h3cBlgGroupRxPacketCount = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: h3cBlgGroupRxPacketCount.setStatus('current')
if mibBuilder.loadTexts: h3cBlgGroupRxPacketCount.setDescription('When retrieved, this object returns the count of packets the balance group has received.')
h3cBlgGroupTxByteCount = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: h3cBlgGroupTxByteCount.setStatus('current')
if mibBuilder.loadTexts: h3cBlgGroupTxByteCount.setDescription('When retrieved, this object returns the count of bytes the balance group has sent.')
h3cBlgGroupRxByteCount = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: h3cBlgGroupRxByteCount.setStatus('current')
if mibBuilder.loadTexts: h3cBlgGroupRxByteCount.setDescription('When retrieved, this object returns the count of bytes the balance group has received.')
h3cBlgGroupCountClear = MibTableColumn((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1, 1, 6), CounterClear()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: h3cBlgGroupCountClear.setStatus('current')
if mibBuilder.loadTexts: h3cBlgGroupCountClear.setDescription('This object is used to reset the counter of the balance group. Read operation is meaningless.')
mibBuilder.exportSymbols("H3C-BLG-MIB", h3cBlgIndex=h3cBlgIndex, h3cBlgObjects=h3cBlgObjects, h3cBlgStatsEntry=h3cBlgStatsEntry, h3cBlgGroupCountClear=h3cBlgGroupCountClear, h3cBlgGroupTxByteCount=h3cBlgGroupTxByteCount, PYSNMP_MODULE_ID=h3cBlg, h3cBlg=h3cBlg, h3cBlgGroupTxPacketCount=h3cBlgGroupTxPacketCount, h3cBlgGroupRxPacketCount=h3cBlgGroupRxPacketCount, CounterClear=CounterClear, h3cBlgGroupRxByteCount=h3cBlgGroupRxByteCount, h3cBlgStatsTable=h3cBlgStatsTable)
| (octet_string, object_identifier, integer) = mibBuilder.importSymbols('ASN1', 'OctetString', 'ObjectIdentifier', 'Integer')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(single_value_constraint, constraints_union, constraints_intersection, value_range_constraint, value_size_constraint) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'SingleValueConstraint', 'ConstraintsUnion', 'ConstraintsIntersection', 'ValueRangeConstraint', 'ValueSizeConstraint')
(h3c_common,) = mibBuilder.importSymbols('HUAWEI-3COM-OID-MIB', 'h3cCommon')
(module_compliance, notification_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'NotificationGroup')
(mib_identifier, time_ticks, iso, gauge32, object_identity, mib_scalar, mib_table, mib_table_row, mib_table_column, unsigned32, counter64, module_identity, bits, notification_type, ip_address, integer32, counter32) = mibBuilder.importSymbols('SNMPv2-SMI', 'MibIdentifier', 'TimeTicks', 'iso', 'Gauge32', 'ObjectIdentity', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'Unsigned32', 'Counter64', 'ModuleIdentity', 'Bits', 'NotificationType', 'IpAddress', 'Integer32', 'Counter32')
(textual_convention, display_string) = mibBuilder.importSymbols('SNMPv2-TC', 'TextualConvention', 'DisplayString')
h3c_blg = module_identity((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108))
h3cBlg.setRevisions(('2009-09-15 11:11',))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
if mibBuilder.loadTexts:
h3cBlg.setRevisionsDescriptions(('The initial version of this MIB.',))
if mibBuilder.loadTexts:
h3cBlg.setLastUpdated('200909151111Z')
if mibBuilder.loadTexts:
h3cBlg.setOrganization('H3C Technologies Co., Ltd.')
if mibBuilder.loadTexts:
h3cBlg.setContactInfo('Platform Team H3C Technologies Co., Ltd. Hai-Dian District Beijing P.R. China Http://www.h3c.com Zip:100085')
if mibBuilder.loadTexts:
h3cBlg.setDescription('This MIB module defines a set of basic objects for configuring switches and routers to set/get balance group information.')
class Counterclear(TextualConvention, Integer32):
description = "Cleared: reset the value of the group's counter. Nouse: 'nouse' will be returned when getting."
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2))
named_values = named_values(('cleared', 1), ('nouse', 2))
h3c_blg_objects = mib_identifier((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1))
h3c_blg_stats_table = mib_table((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1))
if mibBuilder.loadTexts:
h3cBlgStatsTable.setStatus('current')
if mibBuilder.loadTexts:
h3cBlgStatsTable.setDescription('This table contains the statistics information about balance groups.')
h3c_blg_stats_entry = mib_table_row((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1, 1)).setIndexNames((0, 'H3C-BLG-MIB', 'h3cBlgIndex'))
if mibBuilder.loadTexts:
h3cBlgStatsEntry.setStatus('current')
if mibBuilder.loadTexts:
h3cBlgStatsEntry.setDescription('This list contains statistics information.')
h3c_blg_index = mib_table_column((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 2147483647)))
if mibBuilder.loadTexts:
h3cBlgIndex.setStatus('current')
if mibBuilder.loadTexts:
h3cBlgIndex.setDescription('The index of the balance group.')
h3c_blg_group_tx_packet_count = mib_table_column((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1, 1, 2), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
h3cBlgGroupTxPacketCount.setStatus('current')
if mibBuilder.loadTexts:
h3cBlgGroupTxPacketCount.setDescription('When retrieved, this object returns the count of packets the balance group has sent.')
h3c_blg_group_rx_packet_count = mib_table_column((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1, 1, 3), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
h3cBlgGroupRxPacketCount.setStatus('current')
if mibBuilder.loadTexts:
h3cBlgGroupRxPacketCount.setDescription('When retrieved, this object returns the count of packets the balance group has received.')
h3c_blg_group_tx_byte_count = mib_table_column((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1, 1, 4), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
h3cBlgGroupTxByteCount.setStatus('current')
if mibBuilder.loadTexts:
h3cBlgGroupTxByteCount.setDescription('When retrieved, this object returns the count of bytes the balance group has sent.')
h3c_blg_group_rx_byte_count = mib_table_column((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1, 1, 5), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
h3cBlgGroupRxByteCount.setStatus('current')
if mibBuilder.loadTexts:
h3cBlgGroupRxByteCount.setDescription('When retrieved, this object returns the count of bytes the balance group has received.')
h3c_blg_group_count_clear = mib_table_column((1, 3, 6, 1, 4, 1, 2011, 10, 2, 108, 1, 1, 1, 6), counter_clear()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
h3cBlgGroupCountClear.setStatus('current')
if mibBuilder.loadTexts:
h3cBlgGroupCountClear.setDescription('This object is used to reset the counter of the balance group. Read operation is meaningless.')
mibBuilder.exportSymbols('H3C-BLG-MIB', h3cBlgIndex=h3cBlgIndex, h3cBlgObjects=h3cBlgObjects, h3cBlgStatsEntry=h3cBlgStatsEntry, h3cBlgGroupCountClear=h3cBlgGroupCountClear, h3cBlgGroupTxByteCount=h3cBlgGroupTxByteCount, PYSNMP_MODULE_ID=h3cBlg, h3cBlg=h3cBlg, h3cBlgGroupTxPacketCount=h3cBlgGroupTxPacketCount, h3cBlgGroupRxPacketCount=h3cBlgGroupRxPacketCount, CounterClear=CounterClear, h3cBlgGroupRxByteCount=h3cBlgGroupRxByteCount, h3cBlgStatsTable=h3cBlgStatsTable) |
class AutoTuneCommands(object):
_command = "ju"
def __init__(self, send_command):
self._send_command = send_command
async def call(self):
return await self._send_command(self._command, 1)
| class Autotunecommands(object):
_command = 'ju'
def __init__(self, send_command):
self._send_command = send_command
async def call(self):
return await self._send_command(self._command, 1) |
#Heap Sort as the name suggests, uses the heap data structure.
#First the array is converted into a binary heap. Then the first element which is the maximum elemet in case of a max-heap,
#is swapped with the last element so that the maximum element goes to the end of the array as it should be in a sorted array.
#Then the heap size is reduced by 1 and max-heapify function is called on the root.
#Time complexity is O(nlog N) in all cases and space complexity = O(1)
count = 0
def max_heapify(array, heap_size, i):
left = 2 * i + 1
right = 2 * i + 2
largest = i
global count
if left < heap_size:
count += 1
if array[left] > array[largest]:
largest = left
if right < heap_size:
count += 1
if array[right] > array[largest]:
largest = right
if largest != i:
array[i], array[largest] = array[largest], array[i]
max_heapify(array, heap_size, largest)
def build_heap(array):
heap_size = len(array)
for i in range ((heap_size//2),-1,-1):
max_heapify(array,heap_size, i)
def heap_sort(array):
heap_size = len(array)
build_heap(array)
print (f'Heap : {array}')
for i in range(heap_size-1,0,-1):
array[0], array[i] = array[i], array[0]
heap_size -= 1
max_heapify(array, heap_size, 0)
array = [5,9,3,10,45,2,0]
heap_sort(array)
print (array)
print(f'Number of comparisons = {count}')
'''
Heap : [45, 10, 3, 5, 9, 2, 0]
[0, 2, 3, 5, 9, 10, 45]
Number of comparisons = 22
'''
sorted_array = [5,6,7,8,9]
heap_sort(sorted_array)
print(sorted_array)
print(f'Number of comparisons = {count}')
'''
Heap : [9, 8, 7, 5, 6]
[5, 6, 7, 8, 9]
Number of comparisons = 12
'''
reverse_sorted_array = [9,8,7,6,5,4,3,2,1,0,-1,-2,-3,-4,-5,-6,-7,-8,-9,-10]
heap_sort(reverse_sorted_array)
print(reverse_sorted_array)
print(f'Number of comparisons = {count}')
'''
Heap : [9, 8, 7, 6, 5, 4, 3, 2, 1, 0, -1, -2, -3, -4, -5, -6, -7, -8, -9, -10]
[-10, -9, -8, -7, -6, -5, -4, -3, -2, -1, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9]
Number of comparisons = 105
''' | count = 0
def max_heapify(array, heap_size, i):
left = 2 * i + 1
right = 2 * i + 2
largest = i
global count
if left < heap_size:
count += 1
if array[left] > array[largest]:
largest = left
if right < heap_size:
count += 1
if array[right] > array[largest]:
largest = right
if largest != i:
(array[i], array[largest]) = (array[largest], array[i])
max_heapify(array, heap_size, largest)
def build_heap(array):
heap_size = len(array)
for i in range(heap_size // 2, -1, -1):
max_heapify(array, heap_size, i)
def heap_sort(array):
heap_size = len(array)
build_heap(array)
print(f'Heap : {array}')
for i in range(heap_size - 1, 0, -1):
(array[0], array[i]) = (array[i], array[0])
heap_size -= 1
max_heapify(array, heap_size, 0)
array = [5, 9, 3, 10, 45, 2, 0]
heap_sort(array)
print(array)
print(f'Number of comparisons = {count}')
'\nHeap : [45, 10, 3, 5, 9, 2, 0]\n[0, 2, 3, 5, 9, 10, 45]\nNumber of comparisons = 22\n'
sorted_array = [5, 6, 7, 8, 9]
heap_sort(sorted_array)
print(sorted_array)
print(f'Number of comparisons = {count}')
'\nHeap : [9, 8, 7, 5, 6]\n[5, 6, 7, 8, 9]\nNumber of comparisons = 12\n'
reverse_sorted_array = [9, 8, 7, 6, 5, 4, 3, 2, 1, 0, -1, -2, -3, -4, -5, -6, -7, -8, -9, -10]
heap_sort(reverse_sorted_array)
print(reverse_sorted_array)
print(f'Number of comparisons = {count}')
'\nHeap : [9, 8, 7, 6, 5, 4, 3, 2, 1, 0, -1, -2, -3, -4, -5, -6, -7, -8, -9, -10]\n[-10, -9, -8, -7, -6, -5, -4, -3, -2, -1, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9]\nNumber of comparisons = 105\n' |
class A:
def __init__(self, *, a):
pass
class B(A):
def __init__(self, a):
super().__init__(a=a) | class A:
def __init__(self, *, a):
pass
class B(A):
def __init__(self, a):
super().__init__(a=a) |
class Ball:
def __init__(self):
self.position = PVector(width * 0.5, height * 0.5)
self.w = 20
self.velocity = PVector(5, 5)
self.score_player_one = False
self.score_player_two = False
def show(self):
fill(255)
ellipse(self.position.x, self.position.y, self.w, self.w)
# TODO: Create a move() method that adds the velocity to the position
# Help: https://processing.org/reference/PVector_add_.html
# TODO: Create a border() method that checks for collision using the current possition
# Help: check if the x or y of the possition are outside the screen borders
# TODO: Create an update() method that simply calls the 2 methods you just created
| class Ball:
def __init__(self):
self.position = p_vector(width * 0.5, height * 0.5)
self.w = 20
self.velocity = p_vector(5, 5)
self.score_player_one = False
self.score_player_two = False
def show(self):
fill(255)
ellipse(self.position.x, self.position.y, self.w, self.w) |
ISOCHRONES_DATASET_NAME = "webapp_isochrones"
LOCATIONS_DATASET_NAME = "webapp_locations"
CUSTOMERS_DATASET_NAME = "webapp_customers"
CUSTOMERS_NO_FILTERING_COLUMNS = [
'id',
'customer_uuid',
'location_uuid',
'isochrone_type',
'distance_customer_location',
'isochrone_id',
'isochrone_amplitude',
'isochrone_label',
'isochrone_data',
'customer_id_denormalized',
'latitude',
'longitude',
'geo_point',
'city',
'department',
'region',
'country_iso'
]
CUSTOMER_COLUMNS_TO_SEND = [
"id",
"customer_uuid",
"isochrone_amplitude",
"longitude",
"latitude",
"filteringFeatures"
]
LOCATIONS_NO_FILTERING_COLUMNS = [
'address',
'id',
'latitude',
'longitude',
'geo_point',
'isochrone_5_min',
'isochrone_5_min_total_pop',
'isochrone_5_min_area',
'isochrone_5_min_reachfactor',
'isochrone_10_min',
'isochrone_10_min_total_pop',
'isochrone_10_min_area',
'isochrone_10_min_reachfactor',
'isochrone_15_min',
'isochrone_15_min_total_pop',
'isochrone_15_min_area',
'isochrone_15_min_reachfactor',
'isochrone_30_min',
'isochrone_30_min_total_pop',
'isochrone_30_min_area',
'isochrone_30_min_reachfactor',
'isochrone_45_min',
'isochrone_45_min_total_pop',
'isochrone_45_min_area',
'isochrone_45_min_reachfactor',
'isochrone_60_min',
'isochrone_60_min_total_pop',
'isochrone_60_min_area',
'isochrone_60_min_reachfactor',
'location_uuid'
]
LOCATION_COLUMNS_TO_SEND = [
"id",
"location_uuid",
"longitude",
"latitude",
"filteringFeatures",
"address",
"isochrones"
] | isochrones_dataset_name = 'webapp_isochrones'
locations_dataset_name = 'webapp_locations'
customers_dataset_name = 'webapp_customers'
customers_no_filtering_columns = ['id', 'customer_uuid', 'location_uuid', 'isochrone_type', 'distance_customer_location', 'isochrone_id', 'isochrone_amplitude', 'isochrone_label', 'isochrone_data', 'customer_id_denormalized', 'latitude', 'longitude', 'geo_point', 'city', 'department', 'region', 'country_iso']
customer_columns_to_send = ['id', 'customer_uuid', 'isochrone_amplitude', 'longitude', 'latitude', 'filteringFeatures']
locations_no_filtering_columns = ['address', 'id', 'latitude', 'longitude', 'geo_point', 'isochrone_5_min', 'isochrone_5_min_total_pop', 'isochrone_5_min_area', 'isochrone_5_min_reachfactor', 'isochrone_10_min', 'isochrone_10_min_total_pop', 'isochrone_10_min_area', 'isochrone_10_min_reachfactor', 'isochrone_15_min', 'isochrone_15_min_total_pop', 'isochrone_15_min_area', 'isochrone_15_min_reachfactor', 'isochrone_30_min', 'isochrone_30_min_total_pop', 'isochrone_30_min_area', 'isochrone_30_min_reachfactor', 'isochrone_45_min', 'isochrone_45_min_total_pop', 'isochrone_45_min_area', 'isochrone_45_min_reachfactor', 'isochrone_60_min', 'isochrone_60_min_total_pop', 'isochrone_60_min_area', 'isochrone_60_min_reachfactor', 'location_uuid']
location_columns_to_send = ['id', 'location_uuid', 'longitude', 'latitude', 'filteringFeatures', 'address', 'isochrones'] |
#
# PySNMP MIB module Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB
# Produced by pysmi-0.3.4 at Wed May 1 14:29:02 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
ObjectIdentifier, OctetString, Integer = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "OctetString", "Integer")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ConstraintsUnion, ValueRangeConstraint, ConstraintsIntersection, ValueSizeConstraint, SingleValueConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ConstraintsUnion", "ValueRangeConstraint", "ConstraintsIntersection", "ValueSizeConstraint", "SingleValueConstraint")
mscAtmIfVpc, mscAtmIfVccIndex, mscAtmIfVcc, mscAtmIfIndex, mscAtmIfVpcIndex, mscAtmIfVptIndex, mscAtmIfVptVccIndex, mscAtmIfVptVcc = mibBuilder.importSymbols("Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVpc", "mscAtmIfVccIndex", "mscAtmIfVcc", "mscAtmIfIndex", "mscAtmIfVpcIndex", "mscAtmIfVptIndex", "mscAtmIfVptVccIndex", "mscAtmIfVptVcc")
StorageType, RowStatus, DisplayString = mibBuilder.importSymbols("Nortel-MsCarrier-MscPassport-StandardTextualConventionsMIB", "StorageType", "RowStatus", "DisplayString")
NonReplicated, Link = mibBuilder.importSymbols("Nortel-MsCarrier-MscPassport-TextualConventionsMIB", "NonReplicated", "Link")
mscPassportMIBs, = mibBuilder.importSymbols("Nortel-MsCarrier-MscPassport-UsefulDefinitionsMIB", "mscPassportMIBs")
NotificationGroup, ModuleCompliance = mibBuilder.importSymbols("SNMPv2-CONF", "NotificationGroup", "ModuleCompliance")
Integer32, Counter32, Counter64, Gauge32, MibIdentifier, NotificationType, ObjectIdentity, MibScalar, MibTable, MibTableRow, MibTableColumn, ModuleIdentity, Unsigned32, TimeTicks, Bits, iso, IpAddress = mibBuilder.importSymbols("SNMPv2-SMI", "Integer32", "Counter32", "Counter64", "Gauge32", "MibIdentifier", "NotificationType", "ObjectIdentity", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "ModuleIdentity", "Unsigned32", "TimeTicks", "Bits", "iso", "IpAddress")
DisplayString, TextualConvention = mibBuilder.importSymbols("SNMPv2-TC", "DisplayString", "TextualConvention")
atmBearerServiceMIB = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64))
mscAtmIfVpcNrp = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4))
mscAtmIfVpcNrpRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 1), )
if mibBuilder.loadTexts: mscAtmIfVpcNrpRowStatusTable.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcNrpRowStatusTable.setDescription('This entry controls the addition and deletion of mscAtmIfVpcNrp components.')
mscAtmIfVpcNrpRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVpcIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVpcNrpIndex"))
if mibBuilder.loadTexts: mscAtmIfVpcNrpRowStatusEntry.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcNrpRowStatusEntry.setDescription('A single entry in the table represents a single mscAtmIfVpcNrp component.')
mscAtmIfVpcNrpRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 1, 1, 1), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVpcNrpRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcNrpRowStatus.setDescription('This variable is used as the basis for SNMP naming of mscAtmIfVpcNrp components. These components can be added and deleted.')
mscAtmIfVpcNrpComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscAtmIfVpcNrpComponentName.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcNrpComponentName.setDescription("This variable provides the component's string name for use with the ASCII Console Interface")
mscAtmIfVpcNrpStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscAtmIfVpcNrpStorageType.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcNrpStorageType.setDescription('This variable represents the storage type value for the mscAtmIfVpcNrp tables.')
mscAtmIfVpcNrpIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 1, 1, 10), NonReplicated())
if mibBuilder.loadTexts: mscAtmIfVpcNrpIndex.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcNrpIndex.setDescription('This variable represents the index for the mscAtmIfVpcNrp tables.')
mscAtmIfVpcNrpProvTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100), )
if mibBuilder.loadTexts: mscAtmIfVpcNrpProvTable.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcNrpProvTable.setDescription('This group contains the provisionable attributes for the Nrp component.')
mscAtmIfVpcNrpProvEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVpcIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVpcNrpIndex"))
if mibBuilder.loadTexts: mscAtmIfVpcNrpProvEntry.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcNrpProvEntry.setDescription('An entry in the mscAtmIfVpcNrpProvTable.')
mscAtmIfVpcNrpNextHop = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1, 10), Link()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVpcNrpNextHop.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcNrpNextHop.setDescription('This attribute specifies the Nrp component with which this Nrp is associated. A sample value is AtmIf/31 Vcc/0.32 Nrp.')
mscAtmIfVpcNrpConnectionPointType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1, 20), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 4))).clone(namedValues=NamedValues(("segmentEndPoint", 1), ("connectingPoint", 2), ("autoConfigure", 4))).clone('autoConfigure')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVpcNrpConnectionPointType.setStatus('obsolete')
if mibBuilder.loadTexts: mscAtmIfVpcNrpConnectionPointType.setDescription("This attribute specifies the connection point type desired for a Nrp component. The actual connection point type value is visible in the parent component's connectionPointType attribute. The desired connection point type can be specified directly as a segmentEndPoint or connectingPoint. If autoConfigure is specified, the switch will select the connection point type based on the type attribute of the associated AtmIf, choosing segmentEndPoint for a UNI-type ATM interface and connectingPoint for a PPI-type ATM interface. It is obsoleted. The value is mapped into oamSegmentBoundary attribute. segmentEndPoint is mapped into yes. connectingPoint is mapped into no. autoConfigure is mapped into sameAsInterface.")
mscAtmIfVpcNrpOamSegmentBoundary = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1, 30), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("no", 0), ("yes", 1), ("sameAsInterface", 2))).clone('sameAsInterface')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVpcNrpOamSegmentBoundary.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcNrpOamSegmentBoundary.setDescription("This attribute specifies the OAM segment boundary desired for a Nrp component. It affects the connection point type value visible in the parent component's connectionPointType attribute. The desired OAM segment boundary can be specified directly as yes, no or sameAsInterface. If sameAsInterface is specified, the OAM segment boundary is same as the oamSegmentBoundary attribute of the associated AtmIf and the switch will set the connectionPointType, choosing segmentEndPoint for a segment- boundary ATM interface and connectingPoint for a non-segment- boundary ATM interface.")
mscAtmIfVpcNrpTxAal5PartialPacketDiscard = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1, 31), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1))).clone(namedValues=NamedValues(("disabled", 0), ("enabled", 1))).clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVpcNrpTxAal5PartialPacketDiscard.setStatus('obsolete')
if mibBuilder.loadTexts: mscAtmIfVpcNrpTxAal5PartialPacketDiscard.setDescription("This attribute is obsolete in P4.2 and has been migrated under Vcd (Vpd) component. This attribute specifies whether the AAL5 Partial Packet Discard (PPD) feature has been enabled or disabled on the Nrp in the transmit direction. This feature allows the NRP to discard the remainder of a cell-forwarded AAL5 frame if a cell of this frame has been discarded due to congestion. This increases the 'goodput' of the link, since cells which are only going to be discarded by the AAL5 reassembly are not transmitted. When this attribute is set to enabled, the PPD feature is applied in the transmit direction. It should only be enabled for connections whose end points are performing AAL5 segmentation and reassembly. When this attribute is set to disabled, the PPD feature is not applied to traffic for this connection in the transmit direction. Note that specifying enabled for a non-AAL5 connection will cause all traffic to be discarded once congestion is encountered.")
mscAtmIfVpcNrpRxAal5PartialPacketDiscard = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1, 32), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("disabled", 0), ("enabled", 1), ("sameAsTx", 2))).clone('sameAsTx')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVpcNrpRxAal5PartialPacketDiscard.setStatus('obsolete')
if mibBuilder.loadTexts: mscAtmIfVpcNrpRxAal5PartialPacketDiscard.setDescription("This attribute is obsolete in P4.2 and has been migrated under Vcd (Vpd) component. This attribute specifies whether the AAL5 Partial Packet Discard (PPD) feature has been enabled or disabled on the Nrp in the receive direction. This feature allows the NRP to discard the remainder of a cell-forwarded AAL5 frame if a cell of this frame has been discarded due to congestion or usage parameter control (UPC). This increases the 'goodput' of the link, since cells which are only going to be discarded by the AAL5 reassembly are not transmitted. When this attribute is set to enabled, the PPD feature is applied in the receive direction. It should only be enabled for connections whose end points are performing AAL5 segmentation and reassembly. When this attribute is set to disabled, the PPD feature is not applied to traffic for this connection in the receive direction. When this attribute is set to sameAsTx, the PPD feature for traffic in the receive direction will be configured the same way as it is in the transmit direction. Note that specifying enabled for a non-AAL5 connection will cause all traffic to be discarded once congestion is encountered.")
mscAtmIfVpcNrpBandwidthElastic = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1, 33), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1))).clone(namedValues=NamedValues(("no", 0), ("yes", 1))).clone('no')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVpcNrpBandwidthElastic.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcNrpBandwidthElastic.setDescription('This attribute is only of importance for connections which are carried on a link with a variable bandwidth. For example, the bandwidth may be reduced in the event that one or more physical links in the IMA group fail, such that the originally requested bandwidth cannot be maintained. This attribute shows whether the application running on this connection can continue to operate if the bandwidth is reduced. If the bandwidth is reduced, the amount by which it is reduced will be displayed in the bandwidthReduction attribute. A value of yes, indicates that this connection is elastic, and the bandwidth may be reduced but the connection will not be released. Currently, this attribute should only be set to yes for situations where this Nrp is functioning as a loopback on one side of an IMA link. There are no other situations where this setting is valid. A value of no indicates that the bandwidth for this connection will not be reduced in the event of link bandwidth reduction. However, this connection may be released based on its holdingPriority.')
mscAtmIfVpcNrpOverrideHoldingPriority = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1, 34), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2, 3, 4, 6))).clone(namedValues=NamedValues(("n0", 0), ("n1", 1), ("n2", 2), ("n3", 3), ("n4", 4), ("noOverride", 6))).clone('noOverride')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVpcNrpOverrideHoldingPriority.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcNrpOverrideHoldingPriority.setDescription('This attribute specifies the holding priority of this connection. Holding priority is used when there is an IMA group where some physical links have failed. Holding priority determines the order in which connections are released. 4 is the lowest holding priority and is released first. 0 is a higher priority and is released last. The value specified in this attribute will override whatever holdingPriority that has been provisioned at the Vcd (or Vpd). If the value is left at the default of noOverride, the holdingPriority provisioned at the Vcd (or Vpd) will be used.')
mscAtmIfVpcMnrp = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12))
mscAtmIfVpcMnrpRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 1), )
if mibBuilder.loadTexts: mscAtmIfVpcMnrpRowStatusTable.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcMnrpRowStatusTable.setDescription('This entry controls the addition and deletion of mscAtmIfVpcMnrp components.')
mscAtmIfVpcMnrpRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVpcIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVpcMnrpIndex"))
if mibBuilder.loadTexts: mscAtmIfVpcMnrpRowStatusEntry.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcMnrpRowStatusEntry.setDescription('A single entry in the table represents a single mscAtmIfVpcMnrp component.')
mscAtmIfVpcMnrpRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 1, 1, 1), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVpcMnrpRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcMnrpRowStatus.setDescription('This variable is used as the basis for SNMP naming of mscAtmIfVpcMnrp components. These components can be added and deleted.')
mscAtmIfVpcMnrpComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscAtmIfVpcMnrpComponentName.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcMnrpComponentName.setDescription("This variable provides the component's string name for use with the ASCII Console Interface")
mscAtmIfVpcMnrpStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscAtmIfVpcMnrpStorageType.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcMnrpStorageType.setDescription('This variable represents the storage type value for the mscAtmIfVpcMnrp tables.')
mscAtmIfVpcMnrpIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 1, 1, 10), NonReplicated())
if mibBuilder.loadTexts: mscAtmIfVpcMnrpIndex.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcMnrpIndex.setDescription('This variable represents the index for the mscAtmIfVpcMnrp tables.')
mscAtmIfVpcMnrpProvTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 101), )
if mibBuilder.loadTexts: mscAtmIfVpcMnrpProvTable.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcMnrpProvTable.setDescription('This group contains the provisionable attributes for the Mnrp component.')
mscAtmIfVpcMnrpProvEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 101, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVpcIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVpcMnrpIndex"))
if mibBuilder.loadTexts: mscAtmIfVpcMnrpProvEntry.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcMnrpProvEntry.setDescription('An entry in the mscAtmIfVpcMnrpProvTable.')
mscAtmIfVpcMnrpOamSegmentBoundary = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 101, 1, 30), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("no", 0), ("yes", 1), ("sameAsInterface", 2))).clone('sameAsInterface')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVpcMnrpOamSegmentBoundary.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcMnrpOamSegmentBoundary.setDescription("This attribute specifies the OAM segment boundary desired for a Mnrp component. It affects the connection point type value visible in the parent component's connectionPointType attribute. The desired OAM segment boundary can be specified directly as yes, no or sameAsInterface. If sameAsInterface is specified, the OAM segment boundary is same as the oamSegmentBoundary attribute of the associated AtmIf and the switch will set the connectionPointType, choosing segmentEndPoint for a segment- boundary ATM interface and connectingPoint for a non-segment- boundary ATM interface.")
mscAtmIfVpcMnrpBandwidthElastic = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 101, 1, 33), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1))).clone(namedValues=NamedValues(("no", 0), ("yes", 1))).clone('no')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVpcMnrpBandwidthElastic.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcMnrpBandwidthElastic.setDescription('This attribute is only of importance for connections which are carried on a link with a variable bandwidth. For example, the bandwidth may be reduced in the event that one or more physical links in the IMA group fail, such that the originally requested bandwidth cannot be maintained. This attribute shows whether the application running on this connection can continue to operate if the bandwidth is reduced. If the bandwidth is reduced, the amount by which it is reduced will be displayed in the bandwidthReduction attribute. A value of yes, indicates that this connection is elastic, and the bandwidth may be reduced but the connection will not be released. Currently, this attribute should only be set to yes for situations where this Mnrp is functioning as a loopback on one side of an IMA link. There are no other situations where this setting is valid. A value of no indicates that the bandwidth for this connection will not be reduced in the event of link bandwidth reduction. However, this connection may be released based on its holdingPriority.')
mscAtmIfVpcMnrpOverrideHoldingPriority = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 101, 1, 34), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2, 3, 4, 6))).clone(namedValues=NamedValues(("n0", 0), ("n1", 1), ("n2", 2), ("n3", 3), ("n4", 4), ("noOverride", 6))).clone('noOverride')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVpcMnrpOverrideHoldingPriority.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcMnrpOverrideHoldingPriority.setDescription('This attribute specifies the holding priority of this connection. Holding priority is used when there is an IMA group where some physical links have failed. Holding priority determines the order in which connections are released. 4 is the lowest holding priority and is released first. 0 is a higher priority and is released last. The value specified in this attribute will override whatever holdingPriority that has been provisioned at the Vcd (or Vpd). If the value is left at the default of noOverride, the holdingPriority provisioned at the Vcd (or Vpd) will be used.')
mscAtmIfVpcMnrpNextHopsTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 658), )
if mibBuilder.loadTexts: mscAtmIfVpcMnrpNextHopsTable.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcMnrpNextHopsTable.setDescription('This attribute specifies the list of Nrp components with which this Mnrp is associated. A sample value is AtmIf/31 Vcc/0.32 Nrp. This attribute must be provisioned with at least one Nrp component under a compatible connection type.')
mscAtmIfVpcMnrpNextHopsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 658, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVpcIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVpcMnrpIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVpcMnrpNextHopsValue"))
if mibBuilder.loadTexts: mscAtmIfVpcMnrpNextHopsEntry.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcMnrpNextHopsEntry.setDescription('An entry in the mscAtmIfVpcMnrpNextHopsTable.')
mscAtmIfVpcMnrpNextHopsValue = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 658, 1, 1), Link()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVpcMnrpNextHopsValue.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcMnrpNextHopsValue.setDescription('This variable represents both the value and the index for the mscAtmIfVpcMnrpNextHopsTable.')
mscAtmIfVpcMnrpNextHopsRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 658, 1, 2), RowStatus()).setMaxAccess("writeonly")
if mibBuilder.loadTexts: mscAtmIfVpcMnrpNextHopsRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVpcMnrpNextHopsRowStatus.setDescription('This variable is used to control the addition and deletion of individual values of the mscAtmIfVpcMnrpNextHopsTable.')
mscAtmIfVccNrp = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4))
mscAtmIfVccNrpRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 1), )
if mibBuilder.loadTexts: mscAtmIfVccNrpRowStatusTable.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccNrpRowStatusTable.setDescription('This entry controls the addition and deletion of mscAtmIfVccNrp components.')
mscAtmIfVccNrpRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVccIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVccNrpIndex"))
if mibBuilder.loadTexts: mscAtmIfVccNrpRowStatusEntry.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccNrpRowStatusEntry.setDescription('A single entry in the table represents a single mscAtmIfVccNrp component.')
mscAtmIfVccNrpRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 1, 1, 1), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVccNrpRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccNrpRowStatus.setDescription('This variable is used as the basis for SNMP naming of mscAtmIfVccNrp components. These components can be added and deleted.')
mscAtmIfVccNrpComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscAtmIfVccNrpComponentName.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccNrpComponentName.setDescription("This variable provides the component's string name for use with the ASCII Console Interface")
mscAtmIfVccNrpStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscAtmIfVccNrpStorageType.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccNrpStorageType.setDescription('This variable represents the storage type value for the mscAtmIfVccNrp tables.')
mscAtmIfVccNrpIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 1, 1, 10), NonReplicated())
if mibBuilder.loadTexts: mscAtmIfVccNrpIndex.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccNrpIndex.setDescription('This variable represents the index for the mscAtmIfVccNrp tables.')
mscAtmIfVccNrpProvTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100), )
if mibBuilder.loadTexts: mscAtmIfVccNrpProvTable.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccNrpProvTable.setDescription('This group contains the provisionable attributes for the Nrp component.')
mscAtmIfVccNrpProvEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVccIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVccNrpIndex"))
if mibBuilder.loadTexts: mscAtmIfVccNrpProvEntry.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccNrpProvEntry.setDescription('An entry in the mscAtmIfVccNrpProvTable.')
mscAtmIfVccNrpNextHop = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1, 10), Link()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVccNrpNextHop.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccNrpNextHop.setDescription('This attribute specifies the Nrp component with which this Nrp is associated. A sample value is AtmIf/31 Vcc/0.32 Nrp.')
mscAtmIfVccNrpConnectionPointType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1, 20), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 4))).clone(namedValues=NamedValues(("segmentEndPoint", 1), ("connectingPoint", 2), ("autoConfigure", 4))).clone('autoConfigure')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVccNrpConnectionPointType.setStatus('obsolete')
if mibBuilder.loadTexts: mscAtmIfVccNrpConnectionPointType.setDescription("This attribute specifies the connection point type desired for a Nrp component. The actual connection point type value is visible in the parent component's connectionPointType attribute. The desired connection point type can be specified directly as a segmentEndPoint or connectingPoint. If autoConfigure is specified, the switch will select the connection point type based on the type attribute of the associated AtmIf, choosing segmentEndPoint for a UNI-type ATM interface and connectingPoint for a PPI-type ATM interface. It is obsoleted. The value is mapped into oamSegmentBoundary attribute. segmentEndPoint is mapped into yes. connectingPoint is mapped into no. autoConfigure is mapped into sameAsInterface.")
mscAtmIfVccNrpOamSegmentBoundary = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1, 30), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("no", 0), ("yes", 1), ("sameAsInterface", 2))).clone('sameAsInterface')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVccNrpOamSegmentBoundary.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccNrpOamSegmentBoundary.setDescription("This attribute specifies the OAM segment boundary desired for a Nrp component. It affects the connection point type value visible in the parent component's connectionPointType attribute. The desired OAM segment boundary can be specified directly as yes, no or sameAsInterface. If sameAsInterface is specified, the OAM segment boundary is same as the oamSegmentBoundary attribute of the associated AtmIf and the switch will set the connectionPointType, choosing segmentEndPoint for a segment- boundary ATM interface and connectingPoint for a non-segment- boundary ATM interface.")
mscAtmIfVccNrpTxAal5PartialPacketDiscard = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1, 31), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1))).clone(namedValues=NamedValues(("disabled", 0), ("enabled", 1))).clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVccNrpTxAal5PartialPacketDiscard.setStatus('obsolete')
if mibBuilder.loadTexts: mscAtmIfVccNrpTxAal5PartialPacketDiscard.setDescription("This attribute is obsolete in P4.2 and has been migrated under Vcd (Vpd) component. This attribute specifies whether the AAL5 Partial Packet Discard (PPD) feature has been enabled or disabled on the Nrp in the transmit direction. This feature allows the NRP to discard the remainder of a cell-forwarded AAL5 frame if a cell of this frame has been discarded due to congestion. This increases the 'goodput' of the link, since cells which are only going to be discarded by the AAL5 reassembly are not transmitted. When this attribute is set to enabled, the PPD feature is applied in the transmit direction. It should only be enabled for connections whose end points are performing AAL5 segmentation and reassembly. When this attribute is set to disabled, the PPD feature is not applied to traffic for this connection in the transmit direction. Note that specifying enabled for a non-AAL5 connection will cause all traffic to be discarded once congestion is encountered.")
mscAtmIfVccNrpRxAal5PartialPacketDiscard = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1, 32), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("disabled", 0), ("enabled", 1), ("sameAsTx", 2))).clone('sameAsTx')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVccNrpRxAal5PartialPacketDiscard.setStatus('obsolete')
if mibBuilder.loadTexts: mscAtmIfVccNrpRxAal5PartialPacketDiscard.setDescription("This attribute is obsolete in P4.2 and has been migrated under Vcd (Vpd) component. This attribute specifies whether the AAL5 Partial Packet Discard (PPD) feature has been enabled or disabled on the Nrp in the receive direction. This feature allows the NRP to discard the remainder of a cell-forwarded AAL5 frame if a cell of this frame has been discarded due to congestion or usage parameter control (UPC). This increases the 'goodput' of the link, since cells which are only going to be discarded by the AAL5 reassembly are not transmitted. When this attribute is set to enabled, the PPD feature is applied in the receive direction. It should only be enabled for connections whose end points are performing AAL5 segmentation and reassembly. When this attribute is set to disabled, the PPD feature is not applied to traffic for this connection in the receive direction. When this attribute is set to sameAsTx, the PPD feature for traffic in the receive direction will be configured the same way as it is in the transmit direction. Note that specifying enabled for a non-AAL5 connection will cause all traffic to be discarded once congestion is encountered.")
mscAtmIfVccNrpBandwidthElastic = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1, 33), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1))).clone(namedValues=NamedValues(("no", 0), ("yes", 1))).clone('no')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVccNrpBandwidthElastic.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccNrpBandwidthElastic.setDescription('This attribute is only of importance for connections which are carried on a link with a variable bandwidth. For example, the bandwidth may be reduced in the event that one or more physical links in the IMA group fail, such that the originally requested bandwidth cannot be maintained. This attribute shows whether the application running on this connection can continue to operate if the bandwidth is reduced. If the bandwidth is reduced, the amount by which it is reduced will be displayed in the bandwidthReduction attribute. A value of yes, indicates that this connection is elastic, and the bandwidth may be reduced but the connection will not be released. Currently, this attribute should only be set to yes for situations where this Nrp is functioning as a loopback on one side of an IMA link. There are no other situations where this setting is valid. A value of no indicates that the bandwidth for this connection will not be reduced in the event of link bandwidth reduction. However, this connection may be released based on its holdingPriority.')
mscAtmIfVccNrpOverrideHoldingPriority = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1, 34), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2, 3, 4, 6))).clone(namedValues=NamedValues(("n0", 0), ("n1", 1), ("n2", 2), ("n3", 3), ("n4", 4), ("noOverride", 6))).clone('noOverride')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVccNrpOverrideHoldingPriority.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccNrpOverrideHoldingPriority.setDescription('This attribute specifies the holding priority of this connection. Holding priority is used when there is an IMA group where some physical links have failed. Holding priority determines the order in which connections are released. 4 is the lowest holding priority and is released first. 0 is a higher priority and is released last. The value specified in this attribute will override whatever holdingPriority that has been provisioned at the Vcd (or Vpd). If the value is left at the default of noOverride, the holdingPriority provisioned at the Vcd (or Vpd) will be used.')
mscAtmIfVccMnrp = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13))
mscAtmIfVccMnrpRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 1), )
if mibBuilder.loadTexts: mscAtmIfVccMnrpRowStatusTable.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccMnrpRowStatusTable.setDescription('This entry controls the addition and deletion of mscAtmIfVccMnrp components.')
mscAtmIfVccMnrpRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVccIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVccMnrpIndex"))
if mibBuilder.loadTexts: mscAtmIfVccMnrpRowStatusEntry.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccMnrpRowStatusEntry.setDescription('A single entry in the table represents a single mscAtmIfVccMnrp component.')
mscAtmIfVccMnrpRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 1, 1, 1), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVccMnrpRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccMnrpRowStatus.setDescription('This variable is used as the basis for SNMP naming of mscAtmIfVccMnrp components. These components can be added and deleted.')
mscAtmIfVccMnrpComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscAtmIfVccMnrpComponentName.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccMnrpComponentName.setDescription("This variable provides the component's string name for use with the ASCII Console Interface")
mscAtmIfVccMnrpStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscAtmIfVccMnrpStorageType.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccMnrpStorageType.setDescription('This variable represents the storage type value for the mscAtmIfVccMnrp tables.')
mscAtmIfVccMnrpIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 1, 1, 10), NonReplicated())
if mibBuilder.loadTexts: mscAtmIfVccMnrpIndex.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccMnrpIndex.setDescription('This variable represents the index for the mscAtmIfVccMnrp tables.')
mscAtmIfVccMnrpProvTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 101), )
if mibBuilder.loadTexts: mscAtmIfVccMnrpProvTable.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccMnrpProvTable.setDescription('This group contains the provisionable attributes for the Mnrp component.')
mscAtmIfVccMnrpProvEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 101, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVccIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVccMnrpIndex"))
if mibBuilder.loadTexts: mscAtmIfVccMnrpProvEntry.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccMnrpProvEntry.setDescription('An entry in the mscAtmIfVccMnrpProvTable.')
mscAtmIfVccMnrpOamSegmentBoundary = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 101, 1, 30), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("no", 0), ("yes", 1), ("sameAsInterface", 2))).clone('sameAsInterface')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVccMnrpOamSegmentBoundary.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccMnrpOamSegmentBoundary.setDescription("This attribute specifies the OAM segment boundary desired for a Mnrp component. It affects the connection point type value visible in the parent component's connectionPointType attribute. The desired OAM segment boundary can be specified directly as yes, no or sameAsInterface. If sameAsInterface is specified, the OAM segment boundary is same as the oamSegmentBoundary attribute of the associated AtmIf and the switch will set the connectionPointType, choosing segmentEndPoint for a segment- boundary ATM interface and connectingPoint for a non-segment- boundary ATM interface.")
mscAtmIfVccMnrpBandwidthElastic = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 101, 1, 33), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1))).clone(namedValues=NamedValues(("no", 0), ("yes", 1))).clone('no')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVccMnrpBandwidthElastic.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccMnrpBandwidthElastic.setDescription('This attribute is only of importance for connections which are carried on a link with a variable bandwidth. For example, the bandwidth may be reduced in the event that one or more physical links in the IMA group fail, such that the originally requested bandwidth cannot be maintained. This attribute shows whether the application running on this connection can continue to operate if the bandwidth is reduced. If the bandwidth is reduced, the amount by which it is reduced will be displayed in the bandwidthReduction attribute. A value of yes, indicates that this connection is elastic, and the bandwidth may be reduced but the connection will not be released. Currently, this attribute should only be set to yes for situations where this Mnrp is functioning as a loopback on one side of an IMA link. There are no other situations where this setting is valid. A value of no indicates that the bandwidth for this connection will not be reduced in the event of link bandwidth reduction. However, this connection may be released based on its holdingPriority.')
mscAtmIfVccMnrpOverrideHoldingPriority = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 101, 1, 34), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2, 3, 4, 6))).clone(namedValues=NamedValues(("n0", 0), ("n1", 1), ("n2", 2), ("n3", 3), ("n4", 4), ("noOverride", 6))).clone('noOverride')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVccMnrpOverrideHoldingPriority.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccMnrpOverrideHoldingPriority.setDescription('This attribute specifies the holding priority of this connection. Holding priority is used when there is an IMA group where some physical links have failed. Holding priority determines the order in which connections are released. 4 is the lowest holding priority and is released first. 0 is a higher priority and is released last. The value specified in this attribute will override whatever holdingPriority that has been provisioned at the Vcd (or Vpd). If the value is left at the default of noOverride, the holdingPriority provisioned at the Vcd (or Vpd) will be used.')
mscAtmIfVccMnrpNextHopsTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 658), )
if mibBuilder.loadTexts: mscAtmIfVccMnrpNextHopsTable.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccMnrpNextHopsTable.setDescription('This attribute specifies the list of Nrp components with which this Mnrp is associated. A sample value is AtmIf/31 Vcc/0.32 Nrp. This attribute must be provisioned with at least one Nrp component under a compatible connection type.')
mscAtmIfVccMnrpNextHopsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 658, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVccIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVccMnrpIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVccMnrpNextHopsValue"))
if mibBuilder.loadTexts: mscAtmIfVccMnrpNextHopsEntry.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccMnrpNextHopsEntry.setDescription('An entry in the mscAtmIfVccMnrpNextHopsTable.')
mscAtmIfVccMnrpNextHopsValue = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 658, 1, 1), Link()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVccMnrpNextHopsValue.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccMnrpNextHopsValue.setDescription('This variable represents both the value and the index for the mscAtmIfVccMnrpNextHopsTable.')
mscAtmIfVccMnrpNextHopsRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 658, 1, 2), RowStatus()).setMaxAccess("writeonly")
if mibBuilder.loadTexts: mscAtmIfVccMnrpNextHopsRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVccMnrpNextHopsRowStatus.setDescription('This variable is used to control the addition and deletion of individual values of the mscAtmIfVccMnrpNextHopsTable.')
mscAtmIfVptVccNrp = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4))
mscAtmIfVptVccNrpRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 1), )
if mibBuilder.loadTexts: mscAtmIfVptVccNrpRowStatusTable.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccNrpRowStatusTable.setDescription('This entry controls the addition and deletion of mscAtmIfVptVccNrp components.')
mscAtmIfVptVccNrpRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVptIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVptVccIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVptVccNrpIndex"))
if mibBuilder.loadTexts: mscAtmIfVptVccNrpRowStatusEntry.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccNrpRowStatusEntry.setDescription('A single entry in the table represents a single mscAtmIfVptVccNrp component.')
mscAtmIfVptVccNrpRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 1, 1, 1), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVptVccNrpRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccNrpRowStatus.setDescription('This variable is used as the basis for SNMP naming of mscAtmIfVptVccNrp components. These components can be added and deleted.')
mscAtmIfVptVccNrpComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscAtmIfVptVccNrpComponentName.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccNrpComponentName.setDescription("This variable provides the component's string name for use with the ASCII Console Interface")
mscAtmIfVptVccNrpStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscAtmIfVptVccNrpStorageType.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccNrpStorageType.setDescription('This variable represents the storage type value for the mscAtmIfVptVccNrp tables.')
mscAtmIfVptVccNrpIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 1, 1, 10), NonReplicated())
if mibBuilder.loadTexts: mscAtmIfVptVccNrpIndex.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccNrpIndex.setDescription('This variable represents the index for the mscAtmIfVptVccNrp tables.')
mscAtmIfVptVccNrpProvTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100), )
if mibBuilder.loadTexts: mscAtmIfVptVccNrpProvTable.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccNrpProvTable.setDescription('This group contains the provisionable attributes for the Nrp component.')
mscAtmIfVptVccNrpProvEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVptIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVptVccIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVptVccNrpIndex"))
if mibBuilder.loadTexts: mscAtmIfVptVccNrpProvEntry.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccNrpProvEntry.setDescription('An entry in the mscAtmIfVptVccNrpProvTable.')
mscAtmIfVptVccNrpNextHop = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1, 10), Link()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVptVccNrpNextHop.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccNrpNextHop.setDescription('This attribute specifies the Nrp component with which this Nrp is associated. A sample value is AtmIf/31 Vcc/0.32 Nrp.')
mscAtmIfVptVccNrpConnectionPointType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1, 20), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 4))).clone(namedValues=NamedValues(("segmentEndPoint", 1), ("connectingPoint", 2), ("autoConfigure", 4))).clone('autoConfigure')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVptVccNrpConnectionPointType.setStatus('obsolete')
if mibBuilder.loadTexts: mscAtmIfVptVccNrpConnectionPointType.setDescription("This attribute specifies the connection point type desired for a Nrp component. The actual connection point type value is visible in the parent component's connectionPointType attribute. The desired connection point type can be specified directly as a segmentEndPoint or connectingPoint. If autoConfigure is specified, the switch will select the connection point type based on the type attribute of the associated AtmIf, choosing segmentEndPoint for a UNI-type ATM interface and connectingPoint for a PPI-type ATM interface. It is obsoleted. The value is mapped into oamSegmentBoundary attribute. segmentEndPoint is mapped into yes. connectingPoint is mapped into no. autoConfigure is mapped into sameAsInterface.")
mscAtmIfVptVccNrpOamSegmentBoundary = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1, 30), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("no", 0), ("yes", 1), ("sameAsInterface", 2))).clone('sameAsInterface')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVptVccNrpOamSegmentBoundary.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccNrpOamSegmentBoundary.setDescription("This attribute specifies the OAM segment boundary desired for a Nrp component. It affects the connection point type value visible in the parent component's connectionPointType attribute. The desired OAM segment boundary can be specified directly as yes, no or sameAsInterface. If sameAsInterface is specified, the OAM segment boundary is same as the oamSegmentBoundary attribute of the associated AtmIf and the switch will set the connectionPointType, choosing segmentEndPoint for a segment- boundary ATM interface and connectingPoint for a non-segment- boundary ATM interface.")
mscAtmIfVptVccNrpTxAal5PartialPacketDiscard = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1, 31), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1))).clone(namedValues=NamedValues(("disabled", 0), ("enabled", 1))).clone('disabled')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVptVccNrpTxAal5PartialPacketDiscard.setStatus('obsolete')
if mibBuilder.loadTexts: mscAtmIfVptVccNrpTxAal5PartialPacketDiscard.setDescription("This attribute is obsolete in P4.2 and has been migrated under Vcd (Vpd) component. This attribute specifies whether the AAL5 Partial Packet Discard (PPD) feature has been enabled or disabled on the Nrp in the transmit direction. This feature allows the NRP to discard the remainder of a cell-forwarded AAL5 frame if a cell of this frame has been discarded due to congestion. This increases the 'goodput' of the link, since cells which are only going to be discarded by the AAL5 reassembly are not transmitted. When this attribute is set to enabled, the PPD feature is applied in the transmit direction. It should only be enabled for connections whose end points are performing AAL5 segmentation and reassembly. When this attribute is set to disabled, the PPD feature is not applied to traffic for this connection in the transmit direction. Note that specifying enabled for a non-AAL5 connection will cause all traffic to be discarded once congestion is encountered.")
mscAtmIfVptVccNrpRxAal5PartialPacketDiscard = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1, 32), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("disabled", 0), ("enabled", 1), ("sameAsTx", 2))).clone('sameAsTx')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVptVccNrpRxAal5PartialPacketDiscard.setStatus('obsolete')
if mibBuilder.loadTexts: mscAtmIfVptVccNrpRxAal5PartialPacketDiscard.setDescription("This attribute is obsolete in P4.2 and has been migrated under Vcd (Vpd) component. This attribute specifies whether the AAL5 Partial Packet Discard (PPD) feature has been enabled or disabled on the Nrp in the receive direction. This feature allows the NRP to discard the remainder of a cell-forwarded AAL5 frame if a cell of this frame has been discarded due to congestion or usage parameter control (UPC). This increases the 'goodput' of the link, since cells which are only going to be discarded by the AAL5 reassembly are not transmitted. When this attribute is set to enabled, the PPD feature is applied in the receive direction. It should only be enabled for connections whose end points are performing AAL5 segmentation and reassembly. When this attribute is set to disabled, the PPD feature is not applied to traffic for this connection in the receive direction. When this attribute is set to sameAsTx, the PPD feature for traffic in the receive direction will be configured the same way as it is in the transmit direction. Note that specifying enabled for a non-AAL5 connection will cause all traffic to be discarded once congestion is encountered.")
mscAtmIfVptVccNrpBandwidthElastic = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1, 33), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1))).clone(namedValues=NamedValues(("no", 0), ("yes", 1))).clone('no')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVptVccNrpBandwidthElastic.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccNrpBandwidthElastic.setDescription('This attribute is only of importance for connections which are carried on a link with a variable bandwidth. For example, the bandwidth may be reduced in the event that one or more physical links in the IMA group fail, such that the originally requested bandwidth cannot be maintained. This attribute shows whether the application running on this connection can continue to operate if the bandwidth is reduced. If the bandwidth is reduced, the amount by which it is reduced will be displayed in the bandwidthReduction attribute. A value of yes, indicates that this connection is elastic, and the bandwidth may be reduced but the connection will not be released. Currently, this attribute should only be set to yes for situations where this Nrp is functioning as a loopback on one side of an IMA link. There are no other situations where this setting is valid. A value of no indicates that the bandwidth for this connection will not be reduced in the event of link bandwidth reduction. However, this connection may be released based on its holdingPriority.')
mscAtmIfVptVccNrpOverrideHoldingPriority = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1, 34), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2, 3, 4, 6))).clone(namedValues=NamedValues(("n0", 0), ("n1", 1), ("n2", 2), ("n3", 3), ("n4", 4), ("noOverride", 6))).clone('noOverride')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVptVccNrpOverrideHoldingPriority.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccNrpOverrideHoldingPriority.setDescription('This attribute specifies the holding priority of this connection. Holding priority is used when there is an IMA group where some physical links have failed. Holding priority determines the order in which connections are released. 4 is the lowest holding priority and is released first. 0 is a higher priority and is released last. The value specified in this attribute will override whatever holdingPriority that has been provisioned at the Vcd (or Vpd). If the value is left at the default of noOverride, the holdingPriority provisioned at the Vcd (or Vpd) will be used.')
mscAtmIfVptVccMnrp = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13))
mscAtmIfVptVccMnrpRowStatusTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 1), )
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpRowStatusTable.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpRowStatusTable.setDescription('This entry controls the addition and deletion of mscAtmIfVptVccMnrp components.')
mscAtmIfVptVccMnrpRowStatusEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 1, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVptIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVptVccIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVptVccMnrpIndex"))
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpRowStatusEntry.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpRowStatusEntry.setDescription('A single entry in the table represents a single mscAtmIfVptVccMnrp component.')
mscAtmIfVptVccMnrpRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 1, 1, 1), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpRowStatus.setDescription('This variable is used as the basis for SNMP naming of mscAtmIfVptVccMnrp components. These components can be added and deleted.')
mscAtmIfVptVccMnrpComponentName = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 1, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpComponentName.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpComponentName.setDescription("This variable provides the component's string name for use with the ASCII Console Interface")
mscAtmIfVptVccMnrpStorageType = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 1, 1, 4), StorageType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpStorageType.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpStorageType.setDescription('This variable represents the storage type value for the mscAtmIfVptVccMnrp tables.')
mscAtmIfVptVccMnrpIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 1, 1, 10), NonReplicated())
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpIndex.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpIndex.setDescription('This variable represents the index for the mscAtmIfVptVccMnrp tables.')
mscAtmIfVptVccMnrpProvTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 101), )
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpProvTable.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpProvTable.setDescription('This group contains the provisionable attributes for the Mnrp component.')
mscAtmIfVptVccMnrpProvEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 101, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVptIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVptVccIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVptVccMnrpIndex"))
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpProvEntry.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpProvEntry.setDescription('An entry in the mscAtmIfVptVccMnrpProvTable.')
mscAtmIfVptVccMnrpOamSegmentBoundary = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 101, 1, 30), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("no", 0), ("yes", 1), ("sameAsInterface", 2))).clone('sameAsInterface')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpOamSegmentBoundary.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpOamSegmentBoundary.setDescription("This attribute specifies the OAM segment boundary desired for a Mnrp component. It affects the connection point type value visible in the parent component's connectionPointType attribute. The desired OAM segment boundary can be specified directly as yes, no or sameAsInterface. If sameAsInterface is specified, the OAM segment boundary is same as the oamSegmentBoundary attribute of the associated AtmIf and the switch will set the connectionPointType, choosing segmentEndPoint for a segment- boundary ATM interface and connectingPoint for a non-segment- boundary ATM interface.")
mscAtmIfVptVccMnrpBandwidthElastic = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 101, 1, 33), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1))).clone(namedValues=NamedValues(("no", 0), ("yes", 1))).clone('no')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpBandwidthElastic.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpBandwidthElastic.setDescription('This attribute is only of importance for connections which are carried on a link with a variable bandwidth. For example, the bandwidth may be reduced in the event that one or more physical links in the IMA group fail, such that the originally requested bandwidth cannot be maintained. This attribute shows whether the application running on this connection can continue to operate if the bandwidth is reduced. If the bandwidth is reduced, the amount by which it is reduced will be displayed in the bandwidthReduction attribute. A value of yes, indicates that this connection is elastic, and the bandwidth may be reduced but the connection will not be released. Currently, this attribute should only be set to yes for situations where this Mnrp is functioning as a loopback on one side of an IMA link. There are no other situations where this setting is valid. A value of no indicates that the bandwidth for this connection will not be reduced in the event of link bandwidth reduction. However, this connection may be released based on its holdingPriority.')
mscAtmIfVptVccMnrpOverrideHoldingPriority = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 101, 1, 34), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2, 3, 4, 6))).clone(namedValues=NamedValues(("n0", 0), ("n1", 1), ("n2", 2), ("n3", 3), ("n4", 4), ("noOverride", 6))).clone('noOverride')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpOverrideHoldingPriority.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpOverrideHoldingPriority.setDescription('This attribute specifies the holding priority of this connection. Holding priority is used when there is an IMA group where some physical links have failed. Holding priority determines the order in which connections are released. 4 is the lowest holding priority and is released first. 0 is a higher priority and is released last. The value specified in this attribute will override whatever holdingPriority that has been provisioned at the Vcd (or Vpd). If the value is left at the default of noOverride, the holdingPriority provisioned at the Vcd (or Vpd) will be used.')
mscAtmIfVptVccMnrpNextHopsTable = MibTable((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 658), )
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpNextHopsTable.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpNextHopsTable.setDescription('This attribute specifies the list of Nrp components with which this Mnrp is associated. A sample value is AtmIf/31 Vcc/0.32 Nrp. This attribute must be provisioned with at least one Nrp component under a compatible connection type.')
mscAtmIfVptVccMnrpNextHopsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 658, 1), ).setIndexNames((0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVptIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmCoreMIB", "mscAtmIfVptVccIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVptVccMnrpIndex"), (0, "Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", "mscAtmIfVptVccMnrpNextHopsValue"))
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpNextHopsEntry.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpNextHopsEntry.setDescription('An entry in the mscAtmIfVptVccMnrpNextHopsTable.')
mscAtmIfVptVccMnrpNextHopsValue = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 658, 1, 1), Link()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpNextHopsValue.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpNextHopsValue.setDescription('This variable represents both the value and the index for the mscAtmIfVptVccMnrpNextHopsTable.')
mscAtmIfVptVccMnrpNextHopsRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 658, 1, 2), RowStatus()).setMaxAccess("writeonly")
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpNextHopsRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts: mscAtmIfVptVccMnrpNextHopsRowStatus.setDescription('This variable is used to control the addition and deletion of individual values of the mscAtmIfVptVccMnrpNextHopsTable.')
atmBearerServiceGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 1))
atmBearerServiceGroupCA = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 1, 1))
atmBearerServiceGroupCA02 = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 1, 1, 3))
atmBearerServiceGroupCA02A = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 1, 1, 3, 2))
atmBearerServiceCapabilities = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 3))
atmBearerServiceCapabilitiesCA = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 3, 1))
atmBearerServiceCapabilitiesCA02 = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 3, 1, 3))
atmBearerServiceCapabilitiesCA02A = MibIdentifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 3, 1, 3, 2))
mibBuilder.exportSymbols("Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB", mscAtmIfVpcNrpNextHop=mscAtmIfVpcNrpNextHop, mscAtmIfVpcMnrpIndex=mscAtmIfVpcMnrpIndex, mscAtmIfVccNrpConnectionPointType=mscAtmIfVccNrpConnectionPointType, mscAtmIfVptVccMnrpNextHopsTable=mscAtmIfVptVccMnrpNextHopsTable, atmBearerServiceGroupCA02=atmBearerServiceGroupCA02, mscAtmIfVpcNrpRowStatus=mscAtmIfVpcNrpRowStatus, mscAtmIfVccNrpIndex=mscAtmIfVccNrpIndex, mscAtmIfVptVccNrpBandwidthElastic=mscAtmIfVptVccNrpBandwidthElastic, mscAtmIfVccNrpStorageType=mscAtmIfVccNrpStorageType, mscAtmIfVccMnrpNextHopsTable=mscAtmIfVccMnrpNextHopsTable, mscAtmIfVptVccMnrpRowStatusTable=mscAtmIfVptVccMnrpRowStatusTable, mscAtmIfVpcMnrpProvTable=mscAtmIfVpcMnrpProvTable, mscAtmIfVpcMnrpNextHopsEntry=mscAtmIfVpcMnrpNextHopsEntry, mscAtmIfVpcMnrpOverrideHoldingPriority=mscAtmIfVpcMnrpOverrideHoldingPriority, mscAtmIfVccNrpComponentName=mscAtmIfVccNrpComponentName, mscAtmIfVptVccNrpRxAal5PartialPacketDiscard=mscAtmIfVptVccNrpRxAal5PartialPacketDiscard, mscAtmIfVpcMnrpRowStatus=mscAtmIfVpcMnrpRowStatus, atmBearerServiceGroupCA=atmBearerServiceGroupCA, mscAtmIfVptVccMnrpProvTable=mscAtmIfVptVccMnrpProvTable, mscAtmIfVpcNrpComponentName=mscAtmIfVpcNrpComponentName, mscAtmIfVccNrpRowStatusTable=mscAtmIfVccNrpRowStatusTable, mscAtmIfVpcNrpOamSegmentBoundary=mscAtmIfVpcNrpOamSegmentBoundary, mscAtmIfVptVccMnrpOverrideHoldingPriority=mscAtmIfVptVccMnrpOverrideHoldingPriority, mscAtmIfVptVccNrpOverrideHoldingPriority=mscAtmIfVptVccNrpOverrideHoldingPriority, mscAtmIfVccNrpRowStatusEntry=mscAtmIfVccNrpRowStatusEntry, mscAtmIfVptVccMnrpRowStatusEntry=mscAtmIfVptVccMnrpRowStatusEntry, mscAtmIfVccMnrpOamSegmentBoundary=mscAtmIfVccMnrpOamSegmentBoundary, mscAtmIfVptVccNrpStorageType=mscAtmIfVptVccNrpStorageType, mscAtmIfVccNrpOamSegmentBoundary=mscAtmIfVccNrpOamSegmentBoundary, mscAtmIfVpcMnrpNextHopsValue=mscAtmIfVpcMnrpNextHopsValue, mscAtmIfVptVccNrp=mscAtmIfVptVccNrp, mscAtmIfVptVccMnrpOamSegmentBoundary=mscAtmIfVptVccMnrpOamSegmentBoundary, mscAtmIfVccMnrpIndex=mscAtmIfVccMnrpIndex, mscAtmIfVccMnrpProvEntry=mscAtmIfVccMnrpProvEntry, mscAtmIfVpcMnrpBandwidthElastic=mscAtmIfVpcMnrpBandwidthElastic, mscAtmIfVpcNrpProvEntry=mscAtmIfVpcNrpProvEntry, mscAtmIfVccNrpTxAal5PartialPacketDiscard=mscAtmIfVccNrpTxAal5PartialPacketDiscard, atmBearerServiceCapabilitiesCA02A=atmBearerServiceCapabilitiesCA02A, mscAtmIfVccNrp=mscAtmIfVccNrp, mscAtmIfVpcNrpRowStatusEntry=mscAtmIfVpcNrpRowStatusEntry, mscAtmIfVpcNrpConnectionPointType=mscAtmIfVpcNrpConnectionPointType, mscAtmIfVpcMnrpNextHopsRowStatus=mscAtmIfVpcMnrpNextHopsRowStatus, mscAtmIfVpcNrpTxAal5PartialPacketDiscard=mscAtmIfVpcNrpTxAal5PartialPacketDiscard, mscAtmIfVccNrpOverrideHoldingPriority=mscAtmIfVccNrpOverrideHoldingPriority, mscAtmIfVpcNrpIndex=mscAtmIfVpcNrpIndex, mscAtmIfVptVccMnrpProvEntry=mscAtmIfVptVccMnrpProvEntry, mscAtmIfVpcNrpStorageType=mscAtmIfVpcNrpStorageType, mscAtmIfVptVccNrpConnectionPointType=mscAtmIfVptVccNrpConnectionPointType, mscAtmIfVccMnrp=mscAtmIfVccMnrp, mscAtmIfVccMnrpStorageType=mscAtmIfVccMnrpStorageType, mscAtmIfVccMnrpOverrideHoldingPriority=mscAtmIfVccMnrpOverrideHoldingPriority, atmBearerServiceGroup=atmBearerServiceGroup, mscAtmIfVptVccMnrpNextHopsEntry=mscAtmIfVptVccMnrpNextHopsEntry, mscAtmIfVpcNrpRowStatusTable=mscAtmIfVpcNrpRowStatusTable, mscAtmIfVpcMnrpRowStatusTable=mscAtmIfVpcMnrpRowStatusTable, atmBearerServiceGroupCA02A=atmBearerServiceGroupCA02A, mscAtmIfVptVccMnrpComponentName=mscAtmIfVptVccMnrpComponentName, mscAtmIfVccNrpBandwidthElastic=mscAtmIfVccNrpBandwidthElastic, mscAtmIfVptVccNrpRowStatus=mscAtmIfVptVccNrpRowStatus, mscAtmIfVpcMnrp=mscAtmIfVpcMnrp, mscAtmIfVptVccNrpOamSegmentBoundary=mscAtmIfVptVccNrpOamSegmentBoundary, mscAtmIfVptVccNrpComponentName=mscAtmIfVptVccNrpComponentName, mscAtmIfVptVccMnrpIndex=mscAtmIfVptVccMnrpIndex, mscAtmIfVpcNrpBandwidthElastic=mscAtmIfVpcNrpBandwidthElastic, mscAtmIfVccMnrpRowStatus=mscAtmIfVccMnrpRowStatus, atmBearerServiceCapabilitiesCA=atmBearerServiceCapabilitiesCA, mscAtmIfVpcNrpRxAal5PartialPacketDiscard=mscAtmIfVpcNrpRxAal5PartialPacketDiscard, mscAtmIfVptVccNrpProvEntry=mscAtmIfVptVccNrpProvEntry, mscAtmIfVccNrpRowStatus=mscAtmIfVccNrpRowStatus, mscAtmIfVccMnrpProvTable=mscAtmIfVccMnrpProvTable, mscAtmIfVccMnrpRowStatusEntry=mscAtmIfVccMnrpRowStatusEntry, mscAtmIfVptVccMnrpRowStatus=mscAtmIfVptVccMnrpRowStatus, mscAtmIfVccMnrpRowStatusTable=mscAtmIfVccMnrpRowStatusTable, mscAtmIfVptVccNrpRowStatusEntry=mscAtmIfVptVccNrpRowStatusEntry, mscAtmIfVpcNrpOverrideHoldingPriority=mscAtmIfVpcNrpOverrideHoldingPriority, mscAtmIfVptVccMnrp=mscAtmIfVptVccMnrp, mscAtmIfVpcNrpProvTable=mscAtmIfVpcNrpProvTable, mscAtmIfVpcMnrpOamSegmentBoundary=mscAtmIfVpcMnrpOamSegmentBoundary, mscAtmIfVpcMnrpNextHopsTable=mscAtmIfVpcMnrpNextHopsTable, mscAtmIfVccMnrpNextHopsEntry=mscAtmIfVccMnrpNextHopsEntry, atmBearerServiceCapabilitiesCA02=atmBearerServiceCapabilitiesCA02, mscAtmIfVccNrpRxAal5PartialPacketDiscard=mscAtmIfVccNrpRxAal5PartialPacketDiscard, mscAtmIfVpcMnrpProvEntry=mscAtmIfVpcMnrpProvEntry, mscAtmIfVpcMnrpComponentName=mscAtmIfVpcMnrpComponentName, mscAtmIfVpcMnrpRowStatusEntry=mscAtmIfVpcMnrpRowStatusEntry, mscAtmIfVpcNrp=mscAtmIfVpcNrp, atmBearerServiceCapabilities=atmBearerServiceCapabilities, mscAtmIfVptVccNrpProvTable=mscAtmIfVptVccNrpProvTable, mscAtmIfVptVccNrpRowStatusTable=mscAtmIfVptVccNrpRowStatusTable, mscAtmIfVccNrpProvTable=mscAtmIfVccNrpProvTable, mscAtmIfVptVccNrpNextHop=mscAtmIfVptVccNrpNextHop, mscAtmIfVptVccMnrpStorageType=mscAtmIfVptVccMnrpStorageType, mscAtmIfVptVccMnrpNextHopsValue=mscAtmIfVptVccMnrpNextHopsValue, mscAtmIfVpcMnrpStorageType=mscAtmIfVpcMnrpStorageType, mscAtmIfVccMnrpNextHopsValue=mscAtmIfVccMnrpNextHopsValue, mscAtmIfVptVccNrpTxAal5PartialPacketDiscard=mscAtmIfVptVccNrpTxAal5PartialPacketDiscard, mscAtmIfVptVccMnrpBandwidthElastic=mscAtmIfVptVccMnrpBandwidthElastic, mscAtmIfVptVccNrpIndex=mscAtmIfVptVccNrpIndex, mscAtmIfVccMnrpNextHopsRowStatus=mscAtmIfVccMnrpNextHopsRowStatus, mscAtmIfVccMnrpBandwidthElastic=mscAtmIfVccMnrpBandwidthElastic, mscAtmIfVccMnrpComponentName=mscAtmIfVccMnrpComponentName, mscAtmIfVptVccMnrpNextHopsRowStatus=mscAtmIfVptVccMnrpNextHopsRowStatus, atmBearerServiceMIB=atmBearerServiceMIB, mscAtmIfVccNrpNextHop=mscAtmIfVccNrpNextHop, mscAtmIfVccNrpProvEntry=mscAtmIfVccNrpProvEntry)
| (object_identifier, octet_string, integer) = mibBuilder.importSymbols('ASN1', 'ObjectIdentifier', 'OctetString', 'Integer')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(constraints_union, value_range_constraint, constraints_intersection, value_size_constraint, single_value_constraint) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ConstraintsUnion', 'ValueRangeConstraint', 'ConstraintsIntersection', 'ValueSizeConstraint', 'SingleValueConstraint')
(msc_atm_if_vpc, msc_atm_if_vcc_index, msc_atm_if_vcc, msc_atm_if_index, msc_atm_if_vpc_index, msc_atm_if_vpt_index, msc_atm_if_vpt_vcc_index, msc_atm_if_vpt_vcc) = mibBuilder.importSymbols('Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVpc', 'mscAtmIfVccIndex', 'mscAtmIfVcc', 'mscAtmIfIndex', 'mscAtmIfVpcIndex', 'mscAtmIfVptIndex', 'mscAtmIfVptVccIndex', 'mscAtmIfVptVcc')
(storage_type, row_status, display_string) = mibBuilder.importSymbols('Nortel-MsCarrier-MscPassport-StandardTextualConventionsMIB', 'StorageType', 'RowStatus', 'DisplayString')
(non_replicated, link) = mibBuilder.importSymbols('Nortel-MsCarrier-MscPassport-TextualConventionsMIB', 'NonReplicated', 'Link')
(msc_passport_mi_bs,) = mibBuilder.importSymbols('Nortel-MsCarrier-MscPassport-UsefulDefinitionsMIB', 'mscPassportMIBs')
(notification_group, module_compliance) = mibBuilder.importSymbols('SNMPv2-CONF', 'NotificationGroup', 'ModuleCompliance')
(integer32, counter32, counter64, gauge32, mib_identifier, notification_type, object_identity, mib_scalar, mib_table, mib_table_row, mib_table_column, module_identity, unsigned32, time_ticks, bits, iso, ip_address) = mibBuilder.importSymbols('SNMPv2-SMI', 'Integer32', 'Counter32', 'Counter64', 'Gauge32', 'MibIdentifier', 'NotificationType', 'ObjectIdentity', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'ModuleIdentity', 'Unsigned32', 'TimeTicks', 'Bits', 'iso', 'IpAddress')
(display_string, textual_convention) = mibBuilder.importSymbols('SNMPv2-TC', 'DisplayString', 'TextualConvention')
atm_bearer_service_mib = mib_identifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64))
msc_atm_if_vpc_nrp = mib_identifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4))
msc_atm_if_vpc_nrp_row_status_table = mib_table((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 1))
if mibBuilder.loadTexts:
mscAtmIfVpcNrpRowStatusTable.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpRowStatusTable.setDescription('This entry controls the addition and deletion of mscAtmIfVpcNrp components.')
msc_atm_if_vpc_nrp_row_status_entry = mib_table_row((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 1, 1)).setIndexNames((0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVpcIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVpcNrpIndex'))
if mibBuilder.loadTexts:
mscAtmIfVpcNrpRowStatusEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpRowStatusEntry.setDescription('A single entry in the table represents a single mscAtmIfVpcNrp component.')
msc_atm_if_vpc_nrp_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 1, 1, 1), row_status()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpRowStatus.setDescription('This variable is used as the basis for SNMP naming of mscAtmIfVpcNrp components. These components can be added and deleted.')
msc_atm_if_vpc_nrp_component_name = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 1, 1, 2), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpComponentName.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpComponentName.setDescription("This variable provides the component's string name for use with the ASCII Console Interface")
msc_atm_if_vpc_nrp_storage_type = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 1, 1, 4), storage_type()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpStorageType.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpStorageType.setDescription('This variable represents the storage type value for the mscAtmIfVpcNrp tables.')
msc_atm_if_vpc_nrp_index = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 1, 1, 10), non_replicated())
if mibBuilder.loadTexts:
mscAtmIfVpcNrpIndex.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpIndex.setDescription('This variable represents the index for the mscAtmIfVpcNrp tables.')
msc_atm_if_vpc_nrp_prov_table = mib_table((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100))
if mibBuilder.loadTexts:
mscAtmIfVpcNrpProvTable.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpProvTable.setDescription('This group contains the provisionable attributes for the Nrp component.')
msc_atm_if_vpc_nrp_prov_entry = mib_table_row((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1)).setIndexNames((0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVpcIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVpcNrpIndex'))
if mibBuilder.loadTexts:
mscAtmIfVpcNrpProvEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpProvEntry.setDescription('An entry in the mscAtmIfVpcNrpProvTable.')
msc_atm_if_vpc_nrp_next_hop = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1, 10), link()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpNextHop.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpNextHop.setDescription('This attribute specifies the Nrp component with which this Nrp is associated. A sample value is AtmIf/31 Vcc/0.32 Nrp.')
msc_atm_if_vpc_nrp_connection_point_type = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1, 20), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 4))).clone(namedValues=named_values(('segmentEndPoint', 1), ('connectingPoint', 2), ('autoConfigure', 4))).clone('autoConfigure')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpConnectionPointType.setStatus('obsolete')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpConnectionPointType.setDescription("This attribute specifies the connection point type desired for a Nrp component. The actual connection point type value is visible in the parent component's connectionPointType attribute. The desired connection point type can be specified directly as a segmentEndPoint or connectingPoint. If autoConfigure is specified, the switch will select the connection point type based on the type attribute of the associated AtmIf, choosing segmentEndPoint for a UNI-type ATM interface and connectingPoint for a PPI-type ATM interface. It is obsoleted. The value is mapped into oamSegmentBoundary attribute. segmentEndPoint is mapped into yes. connectingPoint is mapped into no. autoConfigure is mapped into sameAsInterface.")
msc_atm_if_vpc_nrp_oam_segment_boundary = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1, 30), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('no', 0), ('yes', 1), ('sameAsInterface', 2))).clone('sameAsInterface')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpOamSegmentBoundary.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpOamSegmentBoundary.setDescription("This attribute specifies the OAM segment boundary desired for a Nrp component. It affects the connection point type value visible in the parent component's connectionPointType attribute. The desired OAM segment boundary can be specified directly as yes, no or sameAsInterface. If sameAsInterface is specified, the OAM segment boundary is same as the oamSegmentBoundary attribute of the associated AtmIf and the switch will set the connectionPointType, choosing segmentEndPoint for a segment- boundary ATM interface and connectingPoint for a non-segment- boundary ATM interface.")
msc_atm_if_vpc_nrp_tx_aal5_partial_packet_discard = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1, 31), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1))).clone(namedValues=named_values(('disabled', 0), ('enabled', 1))).clone('disabled')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpTxAal5PartialPacketDiscard.setStatus('obsolete')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpTxAal5PartialPacketDiscard.setDescription("This attribute is obsolete in P4.2 and has been migrated under Vcd (Vpd) component. This attribute specifies whether the AAL5 Partial Packet Discard (PPD) feature has been enabled or disabled on the Nrp in the transmit direction. This feature allows the NRP to discard the remainder of a cell-forwarded AAL5 frame if a cell of this frame has been discarded due to congestion. This increases the 'goodput' of the link, since cells which are only going to be discarded by the AAL5 reassembly are not transmitted. When this attribute is set to enabled, the PPD feature is applied in the transmit direction. It should only be enabled for connections whose end points are performing AAL5 segmentation and reassembly. When this attribute is set to disabled, the PPD feature is not applied to traffic for this connection in the transmit direction. Note that specifying enabled for a non-AAL5 connection will cause all traffic to be discarded once congestion is encountered.")
msc_atm_if_vpc_nrp_rx_aal5_partial_packet_discard = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1, 32), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('disabled', 0), ('enabled', 1), ('sameAsTx', 2))).clone('sameAsTx')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpRxAal5PartialPacketDiscard.setStatus('obsolete')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpRxAal5PartialPacketDiscard.setDescription("This attribute is obsolete in P4.2 and has been migrated under Vcd (Vpd) component. This attribute specifies whether the AAL5 Partial Packet Discard (PPD) feature has been enabled or disabled on the Nrp in the receive direction. This feature allows the NRP to discard the remainder of a cell-forwarded AAL5 frame if a cell of this frame has been discarded due to congestion or usage parameter control (UPC). This increases the 'goodput' of the link, since cells which are only going to be discarded by the AAL5 reassembly are not transmitted. When this attribute is set to enabled, the PPD feature is applied in the receive direction. It should only be enabled for connections whose end points are performing AAL5 segmentation and reassembly. When this attribute is set to disabled, the PPD feature is not applied to traffic for this connection in the receive direction. When this attribute is set to sameAsTx, the PPD feature for traffic in the receive direction will be configured the same way as it is in the transmit direction. Note that specifying enabled for a non-AAL5 connection will cause all traffic to be discarded once congestion is encountered.")
msc_atm_if_vpc_nrp_bandwidth_elastic = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1, 33), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1))).clone(namedValues=named_values(('no', 0), ('yes', 1))).clone('no')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpBandwidthElastic.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpBandwidthElastic.setDescription('This attribute is only of importance for connections which are carried on a link with a variable bandwidth. For example, the bandwidth may be reduced in the event that one or more physical links in the IMA group fail, such that the originally requested bandwidth cannot be maintained. This attribute shows whether the application running on this connection can continue to operate if the bandwidth is reduced. If the bandwidth is reduced, the amount by which it is reduced will be displayed in the bandwidthReduction attribute. A value of yes, indicates that this connection is elastic, and the bandwidth may be reduced but the connection will not be released. Currently, this attribute should only be set to yes for situations where this Nrp is functioning as a loopback on one side of an IMA link. There are no other situations where this setting is valid. A value of no indicates that the bandwidth for this connection will not be reduced in the event of link bandwidth reduction. However, this connection may be released based on its holdingPriority.')
msc_atm_if_vpc_nrp_override_holding_priority = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 4, 100, 1, 34), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2, 3, 4, 6))).clone(namedValues=named_values(('n0', 0), ('n1', 1), ('n2', 2), ('n3', 3), ('n4', 4), ('noOverride', 6))).clone('noOverride')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpOverrideHoldingPriority.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcNrpOverrideHoldingPriority.setDescription('This attribute specifies the holding priority of this connection. Holding priority is used when there is an IMA group where some physical links have failed. Holding priority determines the order in which connections are released. 4 is the lowest holding priority and is released first. 0 is a higher priority and is released last. The value specified in this attribute will override whatever holdingPriority that has been provisioned at the Vcd (or Vpd). If the value is left at the default of noOverride, the holdingPriority provisioned at the Vcd (or Vpd) will be used.')
msc_atm_if_vpc_mnrp = mib_identifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12))
msc_atm_if_vpc_mnrp_row_status_table = mib_table((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 1))
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpRowStatusTable.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpRowStatusTable.setDescription('This entry controls the addition and deletion of mscAtmIfVpcMnrp components.')
msc_atm_if_vpc_mnrp_row_status_entry = mib_table_row((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 1, 1)).setIndexNames((0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVpcIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVpcMnrpIndex'))
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpRowStatusEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpRowStatusEntry.setDescription('A single entry in the table represents a single mscAtmIfVpcMnrp component.')
msc_atm_if_vpc_mnrp_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 1, 1, 1), row_status()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpRowStatus.setDescription('This variable is used as the basis for SNMP naming of mscAtmIfVpcMnrp components. These components can be added and deleted.')
msc_atm_if_vpc_mnrp_component_name = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 1, 1, 2), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpComponentName.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpComponentName.setDescription("This variable provides the component's string name for use with the ASCII Console Interface")
msc_atm_if_vpc_mnrp_storage_type = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 1, 1, 4), storage_type()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpStorageType.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpStorageType.setDescription('This variable represents the storage type value for the mscAtmIfVpcMnrp tables.')
msc_atm_if_vpc_mnrp_index = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 1, 1, 10), non_replicated())
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpIndex.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpIndex.setDescription('This variable represents the index for the mscAtmIfVpcMnrp tables.')
msc_atm_if_vpc_mnrp_prov_table = mib_table((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 101))
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpProvTable.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpProvTable.setDescription('This group contains the provisionable attributes for the Mnrp component.')
msc_atm_if_vpc_mnrp_prov_entry = mib_table_row((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 101, 1)).setIndexNames((0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVpcIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVpcMnrpIndex'))
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpProvEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpProvEntry.setDescription('An entry in the mscAtmIfVpcMnrpProvTable.')
msc_atm_if_vpc_mnrp_oam_segment_boundary = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 101, 1, 30), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('no', 0), ('yes', 1), ('sameAsInterface', 2))).clone('sameAsInterface')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpOamSegmentBoundary.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpOamSegmentBoundary.setDescription("This attribute specifies the OAM segment boundary desired for a Mnrp component. It affects the connection point type value visible in the parent component's connectionPointType attribute. The desired OAM segment boundary can be specified directly as yes, no or sameAsInterface. If sameAsInterface is specified, the OAM segment boundary is same as the oamSegmentBoundary attribute of the associated AtmIf and the switch will set the connectionPointType, choosing segmentEndPoint for a segment- boundary ATM interface and connectingPoint for a non-segment- boundary ATM interface.")
msc_atm_if_vpc_mnrp_bandwidth_elastic = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 101, 1, 33), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1))).clone(namedValues=named_values(('no', 0), ('yes', 1))).clone('no')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpBandwidthElastic.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpBandwidthElastic.setDescription('This attribute is only of importance for connections which are carried on a link with a variable bandwidth. For example, the bandwidth may be reduced in the event that one or more physical links in the IMA group fail, such that the originally requested bandwidth cannot be maintained. This attribute shows whether the application running on this connection can continue to operate if the bandwidth is reduced. If the bandwidth is reduced, the amount by which it is reduced will be displayed in the bandwidthReduction attribute. A value of yes, indicates that this connection is elastic, and the bandwidth may be reduced but the connection will not be released. Currently, this attribute should only be set to yes for situations where this Mnrp is functioning as a loopback on one side of an IMA link. There are no other situations where this setting is valid. A value of no indicates that the bandwidth for this connection will not be reduced in the event of link bandwidth reduction. However, this connection may be released based on its holdingPriority.')
msc_atm_if_vpc_mnrp_override_holding_priority = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 101, 1, 34), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2, 3, 4, 6))).clone(namedValues=named_values(('n0', 0), ('n1', 1), ('n2', 2), ('n3', 3), ('n4', 4), ('noOverride', 6))).clone('noOverride')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpOverrideHoldingPriority.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpOverrideHoldingPriority.setDescription('This attribute specifies the holding priority of this connection. Holding priority is used when there is an IMA group where some physical links have failed. Holding priority determines the order in which connections are released. 4 is the lowest holding priority and is released first. 0 is a higher priority and is released last. The value specified in this attribute will override whatever holdingPriority that has been provisioned at the Vcd (or Vpd). If the value is left at the default of noOverride, the holdingPriority provisioned at the Vcd (or Vpd) will be used.')
msc_atm_if_vpc_mnrp_next_hops_table = mib_table((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 658))
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpNextHopsTable.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpNextHopsTable.setDescription('This attribute specifies the list of Nrp components with which this Mnrp is associated. A sample value is AtmIf/31 Vcc/0.32 Nrp. This attribute must be provisioned with at least one Nrp component under a compatible connection type.')
msc_atm_if_vpc_mnrp_next_hops_entry = mib_table_row((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 658, 1)).setIndexNames((0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVpcIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVpcMnrpIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVpcMnrpNextHopsValue'))
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpNextHopsEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpNextHopsEntry.setDescription('An entry in the mscAtmIfVpcMnrpNextHopsTable.')
msc_atm_if_vpc_mnrp_next_hops_value = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 658, 1, 1), link()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpNextHopsValue.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpNextHopsValue.setDescription('This variable represents both the value and the index for the mscAtmIfVpcMnrpNextHopsTable.')
msc_atm_if_vpc_mnrp_next_hops_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 4, 12, 658, 1, 2), row_status()).setMaxAccess('writeonly')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpNextHopsRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVpcMnrpNextHopsRowStatus.setDescription('This variable is used to control the addition and deletion of individual values of the mscAtmIfVpcMnrpNextHopsTable.')
msc_atm_if_vcc_nrp = mib_identifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4))
msc_atm_if_vcc_nrp_row_status_table = mib_table((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 1))
if mibBuilder.loadTexts:
mscAtmIfVccNrpRowStatusTable.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccNrpRowStatusTable.setDescription('This entry controls the addition and deletion of mscAtmIfVccNrp components.')
msc_atm_if_vcc_nrp_row_status_entry = mib_table_row((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 1, 1)).setIndexNames((0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVccIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVccNrpIndex'))
if mibBuilder.loadTexts:
mscAtmIfVccNrpRowStatusEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccNrpRowStatusEntry.setDescription('A single entry in the table represents a single mscAtmIfVccNrp component.')
msc_atm_if_vcc_nrp_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 1, 1, 1), row_status()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVccNrpRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccNrpRowStatus.setDescription('This variable is used as the basis for SNMP naming of mscAtmIfVccNrp components. These components can be added and deleted.')
msc_atm_if_vcc_nrp_component_name = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 1, 1, 2), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
mscAtmIfVccNrpComponentName.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccNrpComponentName.setDescription("This variable provides the component's string name for use with the ASCII Console Interface")
msc_atm_if_vcc_nrp_storage_type = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 1, 1, 4), storage_type()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
mscAtmIfVccNrpStorageType.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccNrpStorageType.setDescription('This variable represents the storage type value for the mscAtmIfVccNrp tables.')
msc_atm_if_vcc_nrp_index = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 1, 1, 10), non_replicated())
if mibBuilder.loadTexts:
mscAtmIfVccNrpIndex.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccNrpIndex.setDescription('This variable represents the index for the mscAtmIfVccNrp tables.')
msc_atm_if_vcc_nrp_prov_table = mib_table((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100))
if mibBuilder.loadTexts:
mscAtmIfVccNrpProvTable.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccNrpProvTable.setDescription('This group contains the provisionable attributes for the Nrp component.')
msc_atm_if_vcc_nrp_prov_entry = mib_table_row((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1)).setIndexNames((0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVccIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVccNrpIndex'))
if mibBuilder.loadTexts:
mscAtmIfVccNrpProvEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccNrpProvEntry.setDescription('An entry in the mscAtmIfVccNrpProvTable.')
msc_atm_if_vcc_nrp_next_hop = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1, 10), link()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVccNrpNextHop.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccNrpNextHop.setDescription('This attribute specifies the Nrp component with which this Nrp is associated. A sample value is AtmIf/31 Vcc/0.32 Nrp.')
msc_atm_if_vcc_nrp_connection_point_type = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1, 20), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 4))).clone(namedValues=named_values(('segmentEndPoint', 1), ('connectingPoint', 2), ('autoConfigure', 4))).clone('autoConfigure')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVccNrpConnectionPointType.setStatus('obsolete')
if mibBuilder.loadTexts:
mscAtmIfVccNrpConnectionPointType.setDescription("This attribute specifies the connection point type desired for a Nrp component. The actual connection point type value is visible in the parent component's connectionPointType attribute. The desired connection point type can be specified directly as a segmentEndPoint or connectingPoint. If autoConfigure is specified, the switch will select the connection point type based on the type attribute of the associated AtmIf, choosing segmentEndPoint for a UNI-type ATM interface and connectingPoint for a PPI-type ATM interface. It is obsoleted. The value is mapped into oamSegmentBoundary attribute. segmentEndPoint is mapped into yes. connectingPoint is mapped into no. autoConfigure is mapped into sameAsInterface.")
msc_atm_if_vcc_nrp_oam_segment_boundary = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1, 30), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('no', 0), ('yes', 1), ('sameAsInterface', 2))).clone('sameAsInterface')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVccNrpOamSegmentBoundary.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccNrpOamSegmentBoundary.setDescription("This attribute specifies the OAM segment boundary desired for a Nrp component. It affects the connection point type value visible in the parent component's connectionPointType attribute. The desired OAM segment boundary can be specified directly as yes, no or sameAsInterface. If sameAsInterface is specified, the OAM segment boundary is same as the oamSegmentBoundary attribute of the associated AtmIf and the switch will set the connectionPointType, choosing segmentEndPoint for a segment- boundary ATM interface and connectingPoint for a non-segment- boundary ATM interface.")
msc_atm_if_vcc_nrp_tx_aal5_partial_packet_discard = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1, 31), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1))).clone(namedValues=named_values(('disabled', 0), ('enabled', 1))).clone('disabled')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVccNrpTxAal5PartialPacketDiscard.setStatus('obsolete')
if mibBuilder.loadTexts:
mscAtmIfVccNrpTxAal5PartialPacketDiscard.setDescription("This attribute is obsolete in P4.2 and has been migrated under Vcd (Vpd) component. This attribute specifies whether the AAL5 Partial Packet Discard (PPD) feature has been enabled or disabled on the Nrp in the transmit direction. This feature allows the NRP to discard the remainder of a cell-forwarded AAL5 frame if a cell of this frame has been discarded due to congestion. This increases the 'goodput' of the link, since cells which are only going to be discarded by the AAL5 reassembly are not transmitted. When this attribute is set to enabled, the PPD feature is applied in the transmit direction. It should only be enabled for connections whose end points are performing AAL5 segmentation and reassembly. When this attribute is set to disabled, the PPD feature is not applied to traffic for this connection in the transmit direction. Note that specifying enabled for a non-AAL5 connection will cause all traffic to be discarded once congestion is encountered.")
msc_atm_if_vcc_nrp_rx_aal5_partial_packet_discard = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1, 32), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('disabled', 0), ('enabled', 1), ('sameAsTx', 2))).clone('sameAsTx')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVccNrpRxAal5PartialPacketDiscard.setStatus('obsolete')
if mibBuilder.loadTexts:
mscAtmIfVccNrpRxAal5PartialPacketDiscard.setDescription("This attribute is obsolete in P4.2 and has been migrated under Vcd (Vpd) component. This attribute specifies whether the AAL5 Partial Packet Discard (PPD) feature has been enabled or disabled on the Nrp in the receive direction. This feature allows the NRP to discard the remainder of a cell-forwarded AAL5 frame if a cell of this frame has been discarded due to congestion or usage parameter control (UPC). This increases the 'goodput' of the link, since cells which are only going to be discarded by the AAL5 reassembly are not transmitted. When this attribute is set to enabled, the PPD feature is applied in the receive direction. It should only be enabled for connections whose end points are performing AAL5 segmentation and reassembly. When this attribute is set to disabled, the PPD feature is not applied to traffic for this connection in the receive direction. When this attribute is set to sameAsTx, the PPD feature for traffic in the receive direction will be configured the same way as it is in the transmit direction. Note that specifying enabled for a non-AAL5 connection will cause all traffic to be discarded once congestion is encountered.")
msc_atm_if_vcc_nrp_bandwidth_elastic = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1, 33), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1))).clone(namedValues=named_values(('no', 0), ('yes', 1))).clone('no')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVccNrpBandwidthElastic.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccNrpBandwidthElastic.setDescription('This attribute is only of importance for connections which are carried on a link with a variable bandwidth. For example, the bandwidth may be reduced in the event that one or more physical links in the IMA group fail, such that the originally requested bandwidth cannot be maintained. This attribute shows whether the application running on this connection can continue to operate if the bandwidth is reduced. If the bandwidth is reduced, the amount by which it is reduced will be displayed in the bandwidthReduction attribute. A value of yes, indicates that this connection is elastic, and the bandwidth may be reduced but the connection will not be released. Currently, this attribute should only be set to yes for situations where this Nrp is functioning as a loopback on one side of an IMA link. There are no other situations where this setting is valid. A value of no indicates that the bandwidth for this connection will not be reduced in the event of link bandwidth reduction. However, this connection may be released based on its holdingPriority.')
msc_atm_if_vcc_nrp_override_holding_priority = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 4, 100, 1, 34), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2, 3, 4, 6))).clone(namedValues=named_values(('n0', 0), ('n1', 1), ('n2', 2), ('n3', 3), ('n4', 4), ('noOverride', 6))).clone('noOverride')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVccNrpOverrideHoldingPriority.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccNrpOverrideHoldingPriority.setDescription('This attribute specifies the holding priority of this connection. Holding priority is used when there is an IMA group where some physical links have failed. Holding priority determines the order in which connections are released. 4 is the lowest holding priority and is released first. 0 is a higher priority and is released last. The value specified in this attribute will override whatever holdingPriority that has been provisioned at the Vcd (or Vpd). If the value is left at the default of noOverride, the holdingPriority provisioned at the Vcd (or Vpd) will be used.')
msc_atm_if_vcc_mnrp = mib_identifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13))
msc_atm_if_vcc_mnrp_row_status_table = mib_table((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 1))
if mibBuilder.loadTexts:
mscAtmIfVccMnrpRowStatusTable.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpRowStatusTable.setDescription('This entry controls the addition and deletion of mscAtmIfVccMnrp components.')
msc_atm_if_vcc_mnrp_row_status_entry = mib_table_row((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 1, 1)).setIndexNames((0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVccIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVccMnrpIndex'))
if mibBuilder.loadTexts:
mscAtmIfVccMnrpRowStatusEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpRowStatusEntry.setDescription('A single entry in the table represents a single mscAtmIfVccMnrp component.')
msc_atm_if_vcc_mnrp_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 1, 1, 1), row_status()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpRowStatus.setDescription('This variable is used as the basis for SNMP naming of mscAtmIfVccMnrp components. These components can be added and deleted.')
msc_atm_if_vcc_mnrp_component_name = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 1, 1, 2), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpComponentName.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpComponentName.setDescription("This variable provides the component's string name for use with the ASCII Console Interface")
msc_atm_if_vcc_mnrp_storage_type = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 1, 1, 4), storage_type()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpStorageType.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpStorageType.setDescription('This variable represents the storage type value for the mscAtmIfVccMnrp tables.')
msc_atm_if_vcc_mnrp_index = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 1, 1, 10), non_replicated())
if mibBuilder.loadTexts:
mscAtmIfVccMnrpIndex.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpIndex.setDescription('This variable represents the index for the mscAtmIfVccMnrp tables.')
msc_atm_if_vcc_mnrp_prov_table = mib_table((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 101))
if mibBuilder.loadTexts:
mscAtmIfVccMnrpProvTable.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpProvTable.setDescription('This group contains the provisionable attributes for the Mnrp component.')
msc_atm_if_vcc_mnrp_prov_entry = mib_table_row((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 101, 1)).setIndexNames((0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVccIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVccMnrpIndex'))
if mibBuilder.loadTexts:
mscAtmIfVccMnrpProvEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpProvEntry.setDescription('An entry in the mscAtmIfVccMnrpProvTable.')
msc_atm_if_vcc_mnrp_oam_segment_boundary = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 101, 1, 30), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('no', 0), ('yes', 1), ('sameAsInterface', 2))).clone('sameAsInterface')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpOamSegmentBoundary.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpOamSegmentBoundary.setDescription("This attribute specifies the OAM segment boundary desired for a Mnrp component. It affects the connection point type value visible in the parent component's connectionPointType attribute. The desired OAM segment boundary can be specified directly as yes, no or sameAsInterface. If sameAsInterface is specified, the OAM segment boundary is same as the oamSegmentBoundary attribute of the associated AtmIf and the switch will set the connectionPointType, choosing segmentEndPoint for a segment- boundary ATM interface and connectingPoint for a non-segment- boundary ATM interface.")
msc_atm_if_vcc_mnrp_bandwidth_elastic = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 101, 1, 33), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1))).clone(namedValues=named_values(('no', 0), ('yes', 1))).clone('no')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpBandwidthElastic.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpBandwidthElastic.setDescription('This attribute is only of importance for connections which are carried on a link with a variable bandwidth. For example, the bandwidth may be reduced in the event that one or more physical links in the IMA group fail, such that the originally requested bandwidth cannot be maintained. This attribute shows whether the application running on this connection can continue to operate if the bandwidth is reduced. If the bandwidth is reduced, the amount by which it is reduced will be displayed in the bandwidthReduction attribute. A value of yes, indicates that this connection is elastic, and the bandwidth may be reduced but the connection will not be released. Currently, this attribute should only be set to yes for situations where this Mnrp is functioning as a loopback on one side of an IMA link. There are no other situations where this setting is valid. A value of no indicates that the bandwidth for this connection will not be reduced in the event of link bandwidth reduction. However, this connection may be released based on its holdingPriority.')
msc_atm_if_vcc_mnrp_override_holding_priority = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 101, 1, 34), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2, 3, 4, 6))).clone(namedValues=named_values(('n0', 0), ('n1', 1), ('n2', 2), ('n3', 3), ('n4', 4), ('noOverride', 6))).clone('noOverride')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpOverrideHoldingPriority.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpOverrideHoldingPriority.setDescription('This attribute specifies the holding priority of this connection. Holding priority is used when there is an IMA group where some physical links have failed. Holding priority determines the order in which connections are released. 4 is the lowest holding priority and is released first. 0 is a higher priority and is released last. The value specified in this attribute will override whatever holdingPriority that has been provisioned at the Vcd (or Vpd). If the value is left at the default of noOverride, the holdingPriority provisioned at the Vcd (or Vpd) will be used.')
msc_atm_if_vcc_mnrp_next_hops_table = mib_table((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 658))
if mibBuilder.loadTexts:
mscAtmIfVccMnrpNextHopsTable.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpNextHopsTable.setDescription('This attribute specifies the list of Nrp components with which this Mnrp is associated. A sample value is AtmIf/31 Vcc/0.32 Nrp. This attribute must be provisioned with at least one Nrp component under a compatible connection type.')
msc_atm_if_vcc_mnrp_next_hops_entry = mib_table_row((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 658, 1)).setIndexNames((0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVccIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVccMnrpIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVccMnrpNextHopsValue'))
if mibBuilder.loadTexts:
mscAtmIfVccMnrpNextHopsEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpNextHopsEntry.setDescription('An entry in the mscAtmIfVccMnrpNextHopsTable.')
msc_atm_if_vcc_mnrp_next_hops_value = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 658, 1, 1), link()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpNextHopsValue.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpNextHopsValue.setDescription('This variable represents both the value and the index for the mscAtmIfVccMnrpNextHopsTable.')
msc_atm_if_vcc_mnrp_next_hops_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 5, 13, 658, 1, 2), row_status()).setMaxAccess('writeonly')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpNextHopsRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVccMnrpNextHopsRowStatus.setDescription('This variable is used to control the addition and deletion of individual values of the mscAtmIfVccMnrpNextHopsTable.')
msc_atm_if_vpt_vcc_nrp = mib_identifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4))
msc_atm_if_vpt_vcc_nrp_row_status_table = mib_table((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 1))
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpRowStatusTable.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpRowStatusTable.setDescription('This entry controls the addition and deletion of mscAtmIfVptVccNrp components.')
msc_atm_if_vpt_vcc_nrp_row_status_entry = mib_table_row((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 1, 1)).setIndexNames((0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVptIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVptVccIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVptVccNrpIndex'))
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpRowStatusEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpRowStatusEntry.setDescription('A single entry in the table represents a single mscAtmIfVptVccNrp component.')
msc_atm_if_vpt_vcc_nrp_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 1, 1, 1), row_status()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpRowStatus.setDescription('This variable is used as the basis for SNMP naming of mscAtmIfVptVccNrp components. These components can be added and deleted.')
msc_atm_if_vpt_vcc_nrp_component_name = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 1, 1, 2), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpComponentName.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpComponentName.setDescription("This variable provides the component's string name for use with the ASCII Console Interface")
msc_atm_if_vpt_vcc_nrp_storage_type = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 1, 1, 4), storage_type()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpStorageType.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpStorageType.setDescription('This variable represents the storage type value for the mscAtmIfVptVccNrp tables.')
msc_atm_if_vpt_vcc_nrp_index = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 1, 1, 10), non_replicated())
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpIndex.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpIndex.setDescription('This variable represents the index for the mscAtmIfVptVccNrp tables.')
msc_atm_if_vpt_vcc_nrp_prov_table = mib_table((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100))
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpProvTable.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpProvTable.setDescription('This group contains the provisionable attributes for the Nrp component.')
msc_atm_if_vpt_vcc_nrp_prov_entry = mib_table_row((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1)).setIndexNames((0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVptIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVptVccIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVptVccNrpIndex'))
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpProvEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpProvEntry.setDescription('An entry in the mscAtmIfVptVccNrpProvTable.')
msc_atm_if_vpt_vcc_nrp_next_hop = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1, 10), link()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpNextHop.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpNextHop.setDescription('This attribute specifies the Nrp component with which this Nrp is associated. A sample value is AtmIf/31 Vcc/0.32 Nrp.')
msc_atm_if_vpt_vcc_nrp_connection_point_type = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1, 20), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 4))).clone(namedValues=named_values(('segmentEndPoint', 1), ('connectingPoint', 2), ('autoConfigure', 4))).clone('autoConfigure')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpConnectionPointType.setStatus('obsolete')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpConnectionPointType.setDescription("This attribute specifies the connection point type desired for a Nrp component. The actual connection point type value is visible in the parent component's connectionPointType attribute. The desired connection point type can be specified directly as a segmentEndPoint or connectingPoint. If autoConfigure is specified, the switch will select the connection point type based on the type attribute of the associated AtmIf, choosing segmentEndPoint for a UNI-type ATM interface and connectingPoint for a PPI-type ATM interface. It is obsoleted. The value is mapped into oamSegmentBoundary attribute. segmentEndPoint is mapped into yes. connectingPoint is mapped into no. autoConfigure is mapped into sameAsInterface.")
msc_atm_if_vpt_vcc_nrp_oam_segment_boundary = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1, 30), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('no', 0), ('yes', 1), ('sameAsInterface', 2))).clone('sameAsInterface')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpOamSegmentBoundary.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpOamSegmentBoundary.setDescription("This attribute specifies the OAM segment boundary desired for a Nrp component. It affects the connection point type value visible in the parent component's connectionPointType attribute. The desired OAM segment boundary can be specified directly as yes, no or sameAsInterface. If sameAsInterface is specified, the OAM segment boundary is same as the oamSegmentBoundary attribute of the associated AtmIf and the switch will set the connectionPointType, choosing segmentEndPoint for a segment- boundary ATM interface and connectingPoint for a non-segment- boundary ATM interface.")
msc_atm_if_vpt_vcc_nrp_tx_aal5_partial_packet_discard = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1, 31), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1))).clone(namedValues=named_values(('disabled', 0), ('enabled', 1))).clone('disabled')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpTxAal5PartialPacketDiscard.setStatus('obsolete')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpTxAal5PartialPacketDiscard.setDescription("This attribute is obsolete in P4.2 and has been migrated under Vcd (Vpd) component. This attribute specifies whether the AAL5 Partial Packet Discard (PPD) feature has been enabled or disabled on the Nrp in the transmit direction. This feature allows the NRP to discard the remainder of a cell-forwarded AAL5 frame if a cell of this frame has been discarded due to congestion. This increases the 'goodput' of the link, since cells which are only going to be discarded by the AAL5 reassembly are not transmitted. When this attribute is set to enabled, the PPD feature is applied in the transmit direction. It should only be enabled for connections whose end points are performing AAL5 segmentation and reassembly. When this attribute is set to disabled, the PPD feature is not applied to traffic for this connection in the transmit direction. Note that specifying enabled for a non-AAL5 connection will cause all traffic to be discarded once congestion is encountered.")
msc_atm_if_vpt_vcc_nrp_rx_aal5_partial_packet_discard = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1, 32), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('disabled', 0), ('enabled', 1), ('sameAsTx', 2))).clone('sameAsTx')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpRxAal5PartialPacketDiscard.setStatus('obsolete')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpRxAal5PartialPacketDiscard.setDescription("This attribute is obsolete in P4.2 and has been migrated under Vcd (Vpd) component. This attribute specifies whether the AAL5 Partial Packet Discard (PPD) feature has been enabled or disabled on the Nrp in the receive direction. This feature allows the NRP to discard the remainder of a cell-forwarded AAL5 frame if a cell of this frame has been discarded due to congestion or usage parameter control (UPC). This increases the 'goodput' of the link, since cells which are only going to be discarded by the AAL5 reassembly are not transmitted. When this attribute is set to enabled, the PPD feature is applied in the receive direction. It should only be enabled for connections whose end points are performing AAL5 segmentation and reassembly. When this attribute is set to disabled, the PPD feature is not applied to traffic for this connection in the receive direction. When this attribute is set to sameAsTx, the PPD feature for traffic in the receive direction will be configured the same way as it is in the transmit direction. Note that specifying enabled for a non-AAL5 connection will cause all traffic to be discarded once congestion is encountered.")
msc_atm_if_vpt_vcc_nrp_bandwidth_elastic = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1, 33), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1))).clone(namedValues=named_values(('no', 0), ('yes', 1))).clone('no')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpBandwidthElastic.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpBandwidthElastic.setDescription('This attribute is only of importance for connections which are carried on a link with a variable bandwidth. For example, the bandwidth may be reduced in the event that one or more physical links in the IMA group fail, such that the originally requested bandwidth cannot be maintained. This attribute shows whether the application running on this connection can continue to operate if the bandwidth is reduced. If the bandwidth is reduced, the amount by which it is reduced will be displayed in the bandwidthReduction attribute. A value of yes, indicates that this connection is elastic, and the bandwidth may be reduced but the connection will not be released. Currently, this attribute should only be set to yes for situations where this Nrp is functioning as a loopback on one side of an IMA link. There are no other situations where this setting is valid. A value of no indicates that the bandwidth for this connection will not be reduced in the event of link bandwidth reduction. However, this connection may be released based on its holdingPriority.')
msc_atm_if_vpt_vcc_nrp_override_holding_priority = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 4, 100, 1, 34), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2, 3, 4, 6))).clone(namedValues=named_values(('n0', 0), ('n1', 1), ('n2', 2), ('n3', 3), ('n4', 4), ('noOverride', 6))).clone('noOverride')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpOverrideHoldingPriority.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccNrpOverrideHoldingPriority.setDescription('This attribute specifies the holding priority of this connection. Holding priority is used when there is an IMA group where some physical links have failed. Holding priority determines the order in which connections are released. 4 is the lowest holding priority and is released first. 0 is a higher priority and is released last. The value specified in this attribute will override whatever holdingPriority that has been provisioned at the Vcd (or Vpd). If the value is left at the default of noOverride, the holdingPriority provisioned at the Vcd (or Vpd) will be used.')
msc_atm_if_vpt_vcc_mnrp = mib_identifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13))
msc_atm_if_vpt_vcc_mnrp_row_status_table = mib_table((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 1))
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpRowStatusTable.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpRowStatusTable.setDescription('This entry controls the addition and deletion of mscAtmIfVptVccMnrp components.')
msc_atm_if_vpt_vcc_mnrp_row_status_entry = mib_table_row((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 1, 1)).setIndexNames((0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVptIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVptVccIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVptVccMnrpIndex'))
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpRowStatusEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpRowStatusEntry.setDescription('A single entry in the table represents a single mscAtmIfVptVccMnrp component.')
msc_atm_if_vpt_vcc_mnrp_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 1, 1, 1), row_status()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpRowStatus.setDescription('This variable is used as the basis for SNMP naming of mscAtmIfVptVccMnrp components. These components can be added and deleted.')
msc_atm_if_vpt_vcc_mnrp_component_name = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 1, 1, 2), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpComponentName.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpComponentName.setDescription("This variable provides the component's string name for use with the ASCII Console Interface")
msc_atm_if_vpt_vcc_mnrp_storage_type = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 1, 1, 4), storage_type()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpStorageType.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpStorageType.setDescription('This variable represents the storage type value for the mscAtmIfVptVccMnrp tables.')
msc_atm_if_vpt_vcc_mnrp_index = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 1, 1, 10), non_replicated())
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpIndex.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpIndex.setDescription('This variable represents the index for the mscAtmIfVptVccMnrp tables.')
msc_atm_if_vpt_vcc_mnrp_prov_table = mib_table((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 101))
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpProvTable.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpProvTable.setDescription('This group contains the provisionable attributes for the Mnrp component.')
msc_atm_if_vpt_vcc_mnrp_prov_entry = mib_table_row((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 101, 1)).setIndexNames((0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVptIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVptVccIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVptVccMnrpIndex'))
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpProvEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpProvEntry.setDescription('An entry in the mscAtmIfVptVccMnrpProvTable.')
msc_atm_if_vpt_vcc_mnrp_oam_segment_boundary = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 101, 1, 30), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('no', 0), ('yes', 1), ('sameAsInterface', 2))).clone('sameAsInterface')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpOamSegmentBoundary.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpOamSegmentBoundary.setDescription("This attribute specifies the OAM segment boundary desired for a Mnrp component. It affects the connection point type value visible in the parent component's connectionPointType attribute. The desired OAM segment boundary can be specified directly as yes, no or sameAsInterface. If sameAsInterface is specified, the OAM segment boundary is same as the oamSegmentBoundary attribute of the associated AtmIf and the switch will set the connectionPointType, choosing segmentEndPoint for a segment- boundary ATM interface and connectingPoint for a non-segment- boundary ATM interface.")
msc_atm_if_vpt_vcc_mnrp_bandwidth_elastic = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 101, 1, 33), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1))).clone(namedValues=named_values(('no', 0), ('yes', 1))).clone('no')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpBandwidthElastic.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpBandwidthElastic.setDescription('This attribute is only of importance for connections which are carried on a link with a variable bandwidth. For example, the bandwidth may be reduced in the event that one or more physical links in the IMA group fail, such that the originally requested bandwidth cannot be maintained. This attribute shows whether the application running on this connection can continue to operate if the bandwidth is reduced. If the bandwidth is reduced, the amount by which it is reduced will be displayed in the bandwidthReduction attribute. A value of yes, indicates that this connection is elastic, and the bandwidth may be reduced but the connection will not be released. Currently, this attribute should only be set to yes for situations where this Mnrp is functioning as a loopback on one side of an IMA link. There are no other situations where this setting is valid. A value of no indicates that the bandwidth for this connection will not be reduced in the event of link bandwidth reduction. However, this connection may be released based on its holdingPriority.')
msc_atm_if_vpt_vcc_mnrp_override_holding_priority = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 101, 1, 34), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2, 3, 4, 6))).clone(namedValues=named_values(('n0', 0), ('n1', 1), ('n2', 2), ('n3', 3), ('n4', 4), ('noOverride', 6))).clone('noOverride')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpOverrideHoldingPriority.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpOverrideHoldingPriority.setDescription('This attribute specifies the holding priority of this connection. Holding priority is used when there is an IMA group where some physical links have failed. Holding priority determines the order in which connections are released. 4 is the lowest holding priority and is released first. 0 is a higher priority and is released last. The value specified in this attribute will override whatever holdingPriority that has been provisioned at the Vcd (or Vpd). If the value is left at the default of noOverride, the holdingPriority provisioned at the Vcd (or Vpd) will be used.')
msc_atm_if_vpt_vcc_mnrp_next_hops_table = mib_table((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 658))
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpNextHopsTable.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpNextHopsTable.setDescription('This attribute specifies the list of Nrp components with which this Mnrp is associated. A sample value is AtmIf/31 Vcc/0.32 Nrp. This attribute must be provisioned with at least one Nrp component under a compatible connection type.')
msc_atm_if_vpt_vcc_mnrp_next_hops_entry = mib_table_row((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 658, 1)).setIndexNames((0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVptIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmCoreMIB', 'mscAtmIfVptVccIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVptVccMnrpIndex'), (0, 'Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', 'mscAtmIfVptVccMnrpNextHopsValue'))
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpNextHopsEntry.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpNextHopsEntry.setDescription('An entry in the mscAtmIfVptVccMnrpNextHopsTable.')
msc_atm_if_vpt_vcc_mnrp_next_hops_value = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 658, 1, 1), link()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpNextHopsValue.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpNextHopsValue.setDescription('This variable represents both the value and the index for the mscAtmIfVptVccMnrpNextHopsTable.')
msc_atm_if_vpt_vcc_mnrp_next_hops_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 562, 36, 2, 1, 114, 9, 20, 13, 658, 1, 2), row_status()).setMaxAccess('writeonly')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpNextHopsRowStatus.setStatus('mandatory')
if mibBuilder.loadTexts:
mscAtmIfVptVccMnrpNextHopsRowStatus.setDescription('This variable is used to control the addition and deletion of individual values of the mscAtmIfVptVccMnrpNextHopsTable.')
atm_bearer_service_group = mib_identifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 1))
atm_bearer_service_group_ca = mib_identifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 1, 1))
atm_bearer_service_group_ca02 = mib_identifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 1, 1, 3))
atm_bearer_service_group_ca02_a = mib_identifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 1, 1, 3, 2))
atm_bearer_service_capabilities = mib_identifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 3))
atm_bearer_service_capabilities_ca = mib_identifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 3, 1))
atm_bearer_service_capabilities_ca02 = mib_identifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 3, 1, 3))
atm_bearer_service_capabilities_ca02_a = mib_identifier((1, 3, 6, 1, 4, 1, 562, 36, 2, 2, 64, 3, 1, 3, 2))
mibBuilder.exportSymbols('Nortel-MsCarrier-MscPassport-AtmBearerServiceMIB', mscAtmIfVpcNrpNextHop=mscAtmIfVpcNrpNextHop, mscAtmIfVpcMnrpIndex=mscAtmIfVpcMnrpIndex, mscAtmIfVccNrpConnectionPointType=mscAtmIfVccNrpConnectionPointType, mscAtmIfVptVccMnrpNextHopsTable=mscAtmIfVptVccMnrpNextHopsTable, atmBearerServiceGroupCA02=atmBearerServiceGroupCA02, mscAtmIfVpcNrpRowStatus=mscAtmIfVpcNrpRowStatus, mscAtmIfVccNrpIndex=mscAtmIfVccNrpIndex, mscAtmIfVptVccNrpBandwidthElastic=mscAtmIfVptVccNrpBandwidthElastic, mscAtmIfVccNrpStorageType=mscAtmIfVccNrpStorageType, mscAtmIfVccMnrpNextHopsTable=mscAtmIfVccMnrpNextHopsTable, mscAtmIfVptVccMnrpRowStatusTable=mscAtmIfVptVccMnrpRowStatusTable, mscAtmIfVpcMnrpProvTable=mscAtmIfVpcMnrpProvTable, mscAtmIfVpcMnrpNextHopsEntry=mscAtmIfVpcMnrpNextHopsEntry, mscAtmIfVpcMnrpOverrideHoldingPriority=mscAtmIfVpcMnrpOverrideHoldingPriority, mscAtmIfVccNrpComponentName=mscAtmIfVccNrpComponentName, mscAtmIfVptVccNrpRxAal5PartialPacketDiscard=mscAtmIfVptVccNrpRxAal5PartialPacketDiscard, mscAtmIfVpcMnrpRowStatus=mscAtmIfVpcMnrpRowStatus, atmBearerServiceGroupCA=atmBearerServiceGroupCA, mscAtmIfVptVccMnrpProvTable=mscAtmIfVptVccMnrpProvTable, mscAtmIfVpcNrpComponentName=mscAtmIfVpcNrpComponentName, mscAtmIfVccNrpRowStatusTable=mscAtmIfVccNrpRowStatusTable, mscAtmIfVpcNrpOamSegmentBoundary=mscAtmIfVpcNrpOamSegmentBoundary, mscAtmIfVptVccMnrpOverrideHoldingPriority=mscAtmIfVptVccMnrpOverrideHoldingPriority, mscAtmIfVptVccNrpOverrideHoldingPriority=mscAtmIfVptVccNrpOverrideHoldingPriority, mscAtmIfVccNrpRowStatusEntry=mscAtmIfVccNrpRowStatusEntry, mscAtmIfVptVccMnrpRowStatusEntry=mscAtmIfVptVccMnrpRowStatusEntry, mscAtmIfVccMnrpOamSegmentBoundary=mscAtmIfVccMnrpOamSegmentBoundary, mscAtmIfVptVccNrpStorageType=mscAtmIfVptVccNrpStorageType, mscAtmIfVccNrpOamSegmentBoundary=mscAtmIfVccNrpOamSegmentBoundary, mscAtmIfVpcMnrpNextHopsValue=mscAtmIfVpcMnrpNextHopsValue, mscAtmIfVptVccNrp=mscAtmIfVptVccNrp, mscAtmIfVptVccMnrpOamSegmentBoundary=mscAtmIfVptVccMnrpOamSegmentBoundary, mscAtmIfVccMnrpIndex=mscAtmIfVccMnrpIndex, mscAtmIfVccMnrpProvEntry=mscAtmIfVccMnrpProvEntry, mscAtmIfVpcMnrpBandwidthElastic=mscAtmIfVpcMnrpBandwidthElastic, mscAtmIfVpcNrpProvEntry=mscAtmIfVpcNrpProvEntry, mscAtmIfVccNrpTxAal5PartialPacketDiscard=mscAtmIfVccNrpTxAal5PartialPacketDiscard, atmBearerServiceCapabilitiesCA02A=atmBearerServiceCapabilitiesCA02A, mscAtmIfVccNrp=mscAtmIfVccNrp, mscAtmIfVpcNrpRowStatusEntry=mscAtmIfVpcNrpRowStatusEntry, mscAtmIfVpcNrpConnectionPointType=mscAtmIfVpcNrpConnectionPointType, mscAtmIfVpcMnrpNextHopsRowStatus=mscAtmIfVpcMnrpNextHopsRowStatus, mscAtmIfVpcNrpTxAal5PartialPacketDiscard=mscAtmIfVpcNrpTxAal5PartialPacketDiscard, mscAtmIfVccNrpOverrideHoldingPriority=mscAtmIfVccNrpOverrideHoldingPriority, mscAtmIfVpcNrpIndex=mscAtmIfVpcNrpIndex, mscAtmIfVptVccMnrpProvEntry=mscAtmIfVptVccMnrpProvEntry, mscAtmIfVpcNrpStorageType=mscAtmIfVpcNrpStorageType, mscAtmIfVptVccNrpConnectionPointType=mscAtmIfVptVccNrpConnectionPointType, mscAtmIfVccMnrp=mscAtmIfVccMnrp, mscAtmIfVccMnrpStorageType=mscAtmIfVccMnrpStorageType, mscAtmIfVccMnrpOverrideHoldingPriority=mscAtmIfVccMnrpOverrideHoldingPriority, atmBearerServiceGroup=atmBearerServiceGroup, mscAtmIfVptVccMnrpNextHopsEntry=mscAtmIfVptVccMnrpNextHopsEntry, mscAtmIfVpcNrpRowStatusTable=mscAtmIfVpcNrpRowStatusTable, mscAtmIfVpcMnrpRowStatusTable=mscAtmIfVpcMnrpRowStatusTable, atmBearerServiceGroupCA02A=atmBearerServiceGroupCA02A, mscAtmIfVptVccMnrpComponentName=mscAtmIfVptVccMnrpComponentName, mscAtmIfVccNrpBandwidthElastic=mscAtmIfVccNrpBandwidthElastic, mscAtmIfVptVccNrpRowStatus=mscAtmIfVptVccNrpRowStatus, mscAtmIfVpcMnrp=mscAtmIfVpcMnrp, mscAtmIfVptVccNrpOamSegmentBoundary=mscAtmIfVptVccNrpOamSegmentBoundary, mscAtmIfVptVccNrpComponentName=mscAtmIfVptVccNrpComponentName, mscAtmIfVptVccMnrpIndex=mscAtmIfVptVccMnrpIndex, mscAtmIfVpcNrpBandwidthElastic=mscAtmIfVpcNrpBandwidthElastic, mscAtmIfVccMnrpRowStatus=mscAtmIfVccMnrpRowStatus, atmBearerServiceCapabilitiesCA=atmBearerServiceCapabilitiesCA, mscAtmIfVpcNrpRxAal5PartialPacketDiscard=mscAtmIfVpcNrpRxAal5PartialPacketDiscard, mscAtmIfVptVccNrpProvEntry=mscAtmIfVptVccNrpProvEntry, mscAtmIfVccNrpRowStatus=mscAtmIfVccNrpRowStatus, mscAtmIfVccMnrpProvTable=mscAtmIfVccMnrpProvTable, mscAtmIfVccMnrpRowStatusEntry=mscAtmIfVccMnrpRowStatusEntry, mscAtmIfVptVccMnrpRowStatus=mscAtmIfVptVccMnrpRowStatus, mscAtmIfVccMnrpRowStatusTable=mscAtmIfVccMnrpRowStatusTable, mscAtmIfVptVccNrpRowStatusEntry=mscAtmIfVptVccNrpRowStatusEntry, mscAtmIfVpcNrpOverrideHoldingPriority=mscAtmIfVpcNrpOverrideHoldingPriority, mscAtmIfVptVccMnrp=mscAtmIfVptVccMnrp, mscAtmIfVpcNrpProvTable=mscAtmIfVpcNrpProvTable, mscAtmIfVpcMnrpOamSegmentBoundary=mscAtmIfVpcMnrpOamSegmentBoundary, mscAtmIfVpcMnrpNextHopsTable=mscAtmIfVpcMnrpNextHopsTable, mscAtmIfVccMnrpNextHopsEntry=mscAtmIfVccMnrpNextHopsEntry, atmBearerServiceCapabilitiesCA02=atmBearerServiceCapabilitiesCA02, mscAtmIfVccNrpRxAal5PartialPacketDiscard=mscAtmIfVccNrpRxAal5PartialPacketDiscard, mscAtmIfVpcMnrpProvEntry=mscAtmIfVpcMnrpProvEntry, mscAtmIfVpcMnrpComponentName=mscAtmIfVpcMnrpComponentName, mscAtmIfVpcMnrpRowStatusEntry=mscAtmIfVpcMnrpRowStatusEntry, mscAtmIfVpcNrp=mscAtmIfVpcNrp, atmBearerServiceCapabilities=atmBearerServiceCapabilities, mscAtmIfVptVccNrpProvTable=mscAtmIfVptVccNrpProvTable, mscAtmIfVptVccNrpRowStatusTable=mscAtmIfVptVccNrpRowStatusTable, mscAtmIfVccNrpProvTable=mscAtmIfVccNrpProvTable, mscAtmIfVptVccNrpNextHop=mscAtmIfVptVccNrpNextHop, mscAtmIfVptVccMnrpStorageType=mscAtmIfVptVccMnrpStorageType, mscAtmIfVptVccMnrpNextHopsValue=mscAtmIfVptVccMnrpNextHopsValue, mscAtmIfVpcMnrpStorageType=mscAtmIfVpcMnrpStorageType, mscAtmIfVccMnrpNextHopsValue=mscAtmIfVccMnrpNextHopsValue, mscAtmIfVptVccNrpTxAal5PartialPacketDiscard=mscAtmIfVptVccNrpTxAal5PartialPacketDiscard, mscAtmIfVptVccMnrpBandwidthElastic=mscAtmIfVptVccMnrpBandwidthElastic, mscAtmIfVptVccNrpIndex=mscAtmIfVptVccNrpIndex, mscAtmIfVccMnrpNextHopsRowStatus=mscAtmIfVccMnrpNextHopsRowStatus, mscAtmIfVccMnrpBandwidthElastic=mscAtmIfVccMnrpBandwidthElastic, mscAtmIfVccMnrpComponentName=mscAtmIfVccMnrpComponentName, mscAtmIfVptVccMnrpNextHopsRowStatus=mscAtmIfVptVccMnrpNextHopsRowStatus, atmBearerServiceMIB=atmBearerServiceMIB, mscAtmIfVccNrpNextHop=mscAtmIfVccNrpNextHop, mscAtmIfVccNrpProvEntry=mscAtmIfVccNrpProvEntry) |
class Solution:
def XXX(self, a: str, b: str) -> str:
if len(a) < len(b):
a, b = b, a
b = '0' * (len(a) - len(b)) + b
c = []
flag = 0
for i in range(1, len(a) + 1):
c.insert(0, str( (int(a[-i]) + int(b[-i]) + flag) % 2))
flag = ( int(a[-i]) + int(b[-i]) + flag ) // 2
if flag != 0:
c.insert(0, str(flag))
return ''.join(c)
| class Solution:
def xxx(self, a: str, b: str) -> str:
if len(a) < len(b):
(a, b) = (b, a)
b = '0' * (len(a) - len(b)) + b
c = []
flag = 0
for i in range(1, len(a) + 1):
c.insert(0, str((int(a[-i]) + int(b[-i]) + flag) % 2))
flag = (int(a[-i]) + int(b[-i]) + flag) // 2
if flag != 0:
c.insert(0, str(flag))
return ''.join(c) |
def application(environment, start_response):
response_body = (
'Greetings to all Python developers! '
'This is standard WSGI handler.'
)
status = '200 OK'
response_headers = [
('Content-Type', 'text/plain'),
('Content-Length', str(len(response_body))),
]
start_response(status, response_headers)
return [response_body]
| def application(environment, start_response):
response_body = 'Greetings to all Python developers! This is standard WSGI handler.'
status = '200 OK'
response_headers = [('Content-Type', 'text/plain'), ('Content-Length', str(len(response_body)))]
start_response(status, response_headers)
return [response_body] |
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def isValidBST(self, root: TreeNode) -> bool:
if not root:
return True
stack=[(root,-math.inf,math.inf)]
while stack:
node,lower,upper=stack.pop()
if node:
val=node.val
print(val,lower,upper)
if val<=lower or val>=upper:
return False
stack.append((node.right,val,upper))
stack.append((node.left,lower,val))
return True
| class Solution:
def is_valid_bst(self, root: TreeNode) -> bool:
if not root:
return True
stack = [(root, -math.inf, math.inf)]
while stack:
(node, lower, upper) = stack.pop()
if node:
val = node.val
print(val, lower, upper)
if val <= lower or val >= upper:
return False
stack.append((node.right, val, upper))
stack.append((node.left, lower, val))
return True |
def test_soap(app):
project_list = app.soap.get_project_name_list("administrator", "root")
print("\n" + str(project_list))
print(len(project_list))
| def test_soap(app):
project_list = app.soap.get_project_name_list('administrator', 'root')
print('\n' + str(project_list))
print(len(project_list)) |
MOCK_DATA = [
{
"symbol": "AMD",
"companyName": "Advanced Micro Devices Inc.",
"exchange": "NASDAQ Capital Market",
"industry": "Semiconductors",
"website": "http://www.amd.com",
"description": "Advanced Micro Devices Inc designs and produces microprocessors and low-power processor solutions for the computer, communications, and consumer electronics industries.",
"CEO": "Lisa T. Su",
"issueType": "cs",
"sector": "Technology"
},
{
"symbol": "AAPL",
"companyName": "Apple Inc.",
"exchange": "Nasdaq Global Select",
"industry": "Computer Hardware",
"website": "http://www.apple.com",
"description": "Apple Inc is an American multinational technology company. It designs, manufactures, and markets mobile communication and media devices, personal computers, and portable digital music players.",
"CEO": "Timothy D. Cook",
"issueType": "cs",
"sector": "Technology",
},
{
"symbol": "CRAY",
"companyName": "Cray Inc",
"exchange": "Nasdaq Global Select",
"industry": "Computer Hardware",
"website": "http://www.cray.com",
"description": "Cray Inc designs, develops, and supports high-performance computer systems, commonly known as supercomputers and/or clusters, and provide storage solutions, software and engineering services related to HPC systems.",
"CEO": "Peter J. Ungaro",
"issueType": "cs",
"sector": "Technology"
},
{
"symbol": "ATVI",
"companyName": "Activision Blizzard Inc",
"exchange": "Nasdaq Global Select",
"industry": "Application Software",
"website": "http://www.activisionblizzard.com",
"description": "Activision Blizzard is a developer and publisher of interactive entertainment content and services. It develops and distributes content and services on video game consoles, personal computers, and mobile devices.",
"CEO": "Robert A. Kotick",
"issueType": "cs",
"sector": "Technology"
},
{
"symbol": "GOOG",
"companyName": "Alphabet Inc.",
"exchange": "Nasdaq Global Select",
"industry": "Online Media",
"website": "https://www.abc.xyz",
"description": "Alphabet Inc is a provider of internet content products and portals. Its suite of brands includes Search, Android, YouTube, Apps, Maps & Ads.",
"CEO": "Larry Page",
"issueType": "cs",
"sector": "Technology"
},
{
"symbol": "TWTR",
"companyName": "Twitter Inc.",
"exchange": "New York Stock Exchange",
"industry": "Online Media",
"website": "https://www.twitter.com",
"description": "Twitter Inc is a social networking platform for public self-expression and conversation in real time. Its services are live, which includes live commentary, live connections, and live conversations. It generates a majority of its revenue from advertising.",
"CEO": "Jack Dorsey",
"issueType": "cs",
"sector": "Technology"
},
{
"symbol": "CARB",
"companyName": "Carbonite Inc.",
"exchange": "NASDAQ Global Market",
"industry": "Application Software",
"website": "http://www.carbonite.com",
"description": "Carbonite Inc provides data protection solutions including cloud, hybrid, and on-premise backup and restores, disaster recovery as a service and email archiving. It offers annual and multi-year cloud backup plans for multi-year subscriptions.",
"CEO": "Mohamad Ali",
"issueType": "cs",
"sector": "Technology"
},
{
"symbol": "WDC",
"companyName": "Western Digital Corporation",
"exchange": "Nasdaq Global Select",
"industry": "Computer Hardware",
"website": "https://www.wdc.com",
"description": "Western Digital Corp is the global leader in the hard disk drive market. It develops, manufactures, and provides data storage solutions that enable consumers to create, manage, experience and preserve digital content. Its products include HDDs and SSDs.",
"CEO": "Stephen D. Milligan",
"issueType": "cs",
"sector": "Technology"
},
{
"symbol": "INTC",
"companyName": "Intel Corporation",
"exchange": "Nasdaq Global Select",
"industry": "Semiconductors",
"website": "http://www.intel.com",
"description": "Intel Corp is the world's largest chipmaker. It engaged in making a semiconductor chip. It designs and manufactures integrated digital technology products like integrated circuits, for industries such as computing and communications.",
"CEO": "Brian M. Krzanich",
"issueType": "cs",
"sector": "Technology"
},
{
"symbol": "CSCO",
"companyName": "Cisco Systems Inc.",
"exchange": "Nasdaq Global Select",
"industry": "Communication Equipment",
"website": "http://www.cisco.com",
"description": "Cisco Systems Inc is a supplier of data networking equipment and software. Its products include routers, switches, access equipment, and security and network management software which allow data communication among dispersed computer networks.",
"CEO": "Charles Robbins",
"issueType": "cs",
"sector": "Technology"
}
]
| mock_data = [{'symbol': 'AMD', 'companyName': 'Advanced Micro Devices Inc.', 'exchange': 'NASDAQ Capital Market', 'industry': 'Semiconductors', 'website': 'http://www.amd.com', 'description': 'Advanced Micro Devices Inc designs and produces microprocessors and low-power processor solutions for the computer, communications, and consumer electronics industries.', 'CEO': 'Lisa T. Su', 'issueType': 'cs', 'sector': 'Technology'}, {'symbol': 'AAPL', 'companyName': 'Apple Inc.', 'exchange': 'Nasdaq Global Select', 'industry': 'Computer Hardware', 'website': 'http://www.apple.com', 'description': 'Apple Inc is an American multinational technology company. It designs, manufactures, and markets mobile communication and media devices, personal computers, and portable digital music players.', 'CEO': 'Timothy D. Cook', 'issueType': 'cs', 'sector': 'Technology'}, {'symbol': 'CRAY', 'companyName': 'Cray Inc', 'exchange': 'Nasdaq Global Select', 'industry': 'Computer Hardware', 'website': 'http://www.cray.com', 'description': 'Cray Inc designs, develops, and supports high-performance computer systems, commonly known as supercomputers and/or clusters, and provide storage solutions, software and engineering services related to HPC systems.', 'CEO': 'Peter J. Ungaro', 'issueType': 'cs', 'sector': 'Technology'}, {'symbol': 'ATVI', 'companyName': 'Activision Blizzard Inc', 'exchange': 'Nasdaq Global Select', 'industry': 'Application Software', 'website': 'http://www.activisionblizzard.com', 'description': 'Activision Blizzard is a developer and publisher of interactive entertainment content and services. It develops and distributes content and services on video game consoles, personal computers, and mobile devices.', 'CEO': 'Robert A. Kotick', 'issueType': 'cs', 'sector': 'Technology'}, {'symbol': 'GOOG', 'companyName': 'Alphabet Inc.', 'exchange': 'Nasdaq Global Select', 'industry': 'Online Media', 'website': 'https://www.abc.xyz', 'description': 'Alphabet Inc is a provider of internet content products and portals. Its suite of brands includes Search, Android, YouTube, Apps, Maps & Ads.', 'CEO': 'Larry Page', 'issueType': 'cs', 'sector': 'Technology'}, {'symbol': 'TWTR', 'companyName': 'Twitter Inc.', 'exchange': 'New York Stock Exchange', 'industry': 'Online Media', 'website': 'https://www.twitter.com', 'description': 'Twitter Inc is a social networking platform for public self-expression and conversation in real time. Its services are live, which includes live commentary, live connections, and live conversations. It generates a majority of its revenue from advertising.', 'CEO': 'Jack Dorsey', 'issueType': 'cs', 'sector': 'Technology'}, {'symbol': 'CARB', 'companyName': 'Carbonite Inc.', 'exchange': 'NASDAQ Global Market', 'industry': 'Application Software', 'website': 'http://www.carbonite.com', 'description': 'Carbonite Inc provides data protection solutions including cloud, hybrid, and on-premise backup and restores, disaster recovery as a service and email archiving. It offers annual and multi-year cloud backup plans for multi-year subscriptions.', 'CEO': 'Mohamad Ali', 'issueType': 'cs', 'sector': 'Technology'}, {'symbol': 'WDC', 'companyName': 'Western Digital Corporation', 'exchange': 'Nasdaq Global Select', 'industry': 'Computer Hardware', 'website': 'https://www.wdc.com', 'description': 'Western Digital Corp is the global leader in the hard disk drive market. It develops, manufactures, and provides data storage solutions that enable consumers to create, manage, experience and preserve digital content. Its products include HDDs and SSDs.', 'CEO': 'Stephen D. Milligan', 'issueType': 'cs', 'sector': 'Technology'}, {'symbol': 'INTC', 'companyName': 'Intel Corporation', 'exchange': 'Nasdaq Global Select', 'industry': 'Semiconductors', 'website': 'http://www.intel.com', 'description': "Intel Corp is the world's largest chipmaker. It engaged in making a semiconductor chip. It designs and manufactures integrated digital technology products like integrated circuits, for industries such as computing and communications.", 'CEO': 'Brian M. Krzanich', 'issueType': 'cs', 'sector': 'Technology'}, {'symbol': 'CSCO', 'companyName': 'Cisco Systems Inc.', 'exchange': 'Nasdaq Global Select', 'industry': 'Communication Equipment', 'website': 'http://www.cisco.com', 'description': 'Cisco Systems Inc is a supplier of data networking equipment and software. Its products include routers, switches, access equipment, and security and network management software which allow data communication among dispersed computer networks.', 'CEO': 'Charles Robbins', 'issueType': 'cs', 'sector': 'Technology'}] |
class Solution:
# O(n) time | O(1) space - where n is the length of the input list.
def maxProfit(self, prices: List[int]) -> int:
minPrice = prices[0]
maxProfit = 0
for i in range(1, len(prices)):
if prices[i] < minPrice:
minPrice = prices[i]
elif prices[i] - minPrice > maxProfit:
maxProfit = prices[i] - minPrice
return maxProfit
| class Solution:
def max_profit(self, prices: List[int]) -> int:
min_price = prices[0]
max_profit = 0
for i in range(1, len(prices)):
if prices[i] < minPrice:
min_price = prices[i]
elif prices[i] - minPrice > maxProfit:
max_profit = prices[i] - minPrice
return maxProfit |
class Article:
def __init__(self,title,urlToImage,description,url,author):
self.title=title
self.urlToImage=urlToImage
self.description=description
self.author=author
self.url=url
class Source:
def __init__(self,name,description):
self.name=name
self.description=description
| class Article:
def __init__(self, title, urlToImage, description, url, author):
self.title = title
self.urlToImage = urlToImage
self.description = description
self.author = author
self.url = url
class Source:
def __init__(self, name, description):
self.name = name
self.description = description |
def findDecision(obj): #obj[0]: Passanger, obj[1]: Time, obj[2]: Coupon, obj[3]: Coupon_validity, obj[4]: Gender, obj[5]: Age, obj[6]: Children, obj[7]: Education, obj[8]: Occupation, obj[9]: Income, obj[10]: Bar, obj[11]: Coffeehouse, obj[12]: Restaurant20to50, obj[13]: Direction_same, obj[14]: Distance
# {"feature": "Children", "instances": 34, "metric_value": 0.9082, "depth": 1}
if obj[6]>0:
# {"feature": "Bar", "instances": 17, "metric_value": 0.9774, "depth": 2}
if obj[10]<=1.0:
# {"feature": "Time", "instances": 12, "metric_value": 0.9799, "depth": 3}
if obj[1]>0:
# {"feature": "Restaurant20to50", "instances": 8, "metric_value": 0.9544, "depth": 4}
if obj[12]<=1.0:
return 'False'
elif obj[12]>1.0:
return 'True'
else: return 'True'
elif obj[1]<=0:
return 'True'
else: return 'True'
elif obj[10]>1.0:
return 'False'
else: return 'False'
elif obj[6]<=0:
# {"feature": "Age", "instances": 17, "metric_value": 0.3228, "depth": 2}
if obj[5]>0:
return 'True'
elif obj[5]<=0:
# {"feature": "Passanger", "instances": 3, "metric_value": 0.9183, "depth": 3}
if obj[0]<=1:
return 'True'
elif obj[0]>1:
return 'False'
else: return 'False'
else: return 'True'
else: return 'True'
| def find_decision(obj):
if obj[6] > 0:
if obj[10] <= 1.0:
if obj[1] > 0:
if obj[12] <= 1.0:
return 'False'
elif obj[12] > 1.0:
return 'True'
else:
return 'True'
elif obj[1] <= 0:
return 'True'
else:
return 'True'
elif obj[10] > 1.0:
return 'False'
else:
return 'False'
elif obj[6] <= 0:
if obj[5] > 0:
return 'True'
elif obj[5] <= 0:
if obj[0] <= 1:
return 'True'
elif obj[0] > 1:
return 'False'
else:
return 'False'
else:
return 'True'
else:
return 'True' |
class Solution:
def XXX(self, nums: List[int]) -> bool:
nextdis = 0
curdis = 0
for i in range(len(nums)):
nextdis = max(i+nums[i], nextdis)
if i==curdis:
curdis = nextdis
if nextdis >= len(nums)-1:
return True
return False
| class Solution:
def xxx(self, nums: List[int]) -> bool:
nextdis = 0
curdis = 0
for i in range(len(nums)):
nextdis = max(i + nums[i], nextdis)
if i == curdis:
curdis = nextdis
if nextdis >= len(nums) - 1:
return True
return False |
name = 'pyjoystick'
version = '1.2.4'
description = 'Tools to get Joystick events.'
url = 'https://github.com/justengel/pyjoystick'
author = 'Justin Engel'
author_email = 'jengel@sealandaire.com'
| name = 'pyjoystick'
version = '1.2.4'
description = 'Tools to get Joystick events.'
url = 'https://github.com/justengel/pyjoystick'
author = 'Justin Engel'
author_email = 'jengel@sealandaire.com' |
pi = "141592653589793238462643383279502884197169399375105820974944592307816406286208998628034825342117067982148086513282306647093844609550582231725359408128"
pi += "4811174502841027019385211055596446229489549303819644288109756659334461284756482337867831652712019091456485669234603486104543266482133936072602491412737245870066"
pi += "0631558817488152092096282925409171536436789259036001133053054882046652138414695194151160943305727036575959195309218611738193261179310511854807446237996274956735"
pi += "1885752724 891227938183011949129833673362440656643086021394946395224737190702179860943702770539217176293176752384674818467669405132000568127145263560827785771342"
pi += "7577896091 736371787214684409012249534301465495853710507922796892589235420199561121290219608640344181598136297747713099605187072113499999983729780499510597317328"
pi += "1609631859502445945534690830264252230825334468503526193118817101000313783875288658753320838142061717766914730359825349042875546873115956286388235378759375195778"
pi += "18577805321712268066130019278766111959092164201989"
a = int(input())
print(pi[a-1])
| pi = '141592653589793238462643383279502884197169399375105820974944592307816406286208998628034825342117067982148086513282306647093844609550582231725359408128'
pi += '4811174502841027019385211055596446229489549303819644288109756659334461284756482337867831652712019091456485669234603486104543266482133936072602491412737245870066'
pi += '0631558817488152092096282925409171536436789259036001133053054882046652138414695194151160943305727036575959195309218611738193261179310511854807446237996274956735'
pi += '1885752724 891227938183011949129833673362440656643086021394946395224737190702179860943702770539217176293176752384674818467669405132000568127145263560827785771342'
pi += '7577896091 736371787214684409012249534301465495853710507922796892589235420199561121290219608640344181598136297747713099605187072113499999983729780499510597317328'
pi += '1609631859502445945534690830264252230825334468503526193118817101000313783875288658753320838142061717766914730359825349042875546873115956286388235378759375195778'
pi += '18577805321712268066130019278766111959092164201989'
a = int(input())
print(pi[a - 1]) |
#Before running this code we should run 2 commands in command prompt they are :-
#1) pip install Image
#2) pip install qrcodeimport qrcode
code=qrcode.QRCode(version=5,box_size=15,border=5)
link=input("copy the content:")
code.add_data(link)
code.make(fit=True)
img=code.make_image(fill="black",back_color="white")
img.save(input("Enter the Qrcode name:")+".png") | code = qrcode.QRCode(version=5, box_size=15, border=5)
link = input('copy the content:')
code.add_data(link)
code.make(fit=True)
img = code.make_image(fill='black', back_color='white')
img.save(input('Enter the Qrcode name:') + '.png') |
def find_outlier(integers):
even, odd = [], []
for i in sorted(integers):
if i % 2 != 0:
odd.append(i)
else:
even.append(i)
if len(even) > 1 and len(odd) != 0:
return odd[0]
elif len(odd) > 1 and len(even) != 0:
return even[0]
| def find_outlier(integers):
(even, odd) = ([], [])
for i in sorted(integers):
if i % 2 != 0:
odd.append(i)
else:
even.append(i)
if len(even) > 1 and len(odd) != 0:
return odd[0]
elif len(odd) > 1 and len(even) != 0:
return even[0] |
#Thea M Factorial of a positive no
def func_factorial(n):
# factorial is n * by all the '+' no less than it
#n= 7
#if n == 1:
# if n is 1 return 1
#return n
#else:
#return n * (n-1)
#
# Python program to find the factorial of a number provided by the user.
# change the value for a different result
#n= 7
# uncomment to take input from the user
#num = int(input("Enter a number: "))
factorial = 1
# check if the number is negative, positive or zero
if n < 0:
print("not doing factorial for zero")
elif n == 0:
print("The factorial of 0 is 1")
else:
for i in range(1,n + 1):
factorial = factorial*i
print("The factorial of",n,"is",factorial)
func_factorial (7)
| def func_factorial(n):
factorial = 1
if n < 0:
print('not doing factorial for zero')
elif n == 0:
print('The factorial of 0 is 1')
else:
for i in range(1, n + 1):
factorial = factorial * i
print('The factorial of', n, 'is', factorial)
func_factorial(7) |
def build_ast_dictionary(code, prefix=tuple(), d=None):
if d is None:
d = dict()
if prefix == tuple():
d['total'] = code
else:
d[prefix] = code
tag, subcode = code
if isinstance(subcode, list):
for i, subitem in enumerate(subcode):
build_ast_dictionary(subitem, prefix=prefix + (i,), d=d)
return d
| def build_ast_dictionary(code, prefix=tuple(), d=None):
if d is None:
d = dict()
if prefix == tuple():
d['total'] = code
else:
d[prefix] = code
(tag, subcode) = code
if isinstance(subcode, list):
for (i, subitem) in enumerate(subcode):
build_ast_dictionary(subitem, prefix=prefix + (i,), d=d)
return d |
_base_ = [
'../_base_/models/upernet_swin.py', '../_base_/datasets/Vaihingen.py',
'../_base_/default_runtime.py', '../_base_/schedules/schedule_80k.py'
]
model = dict(
pretrained='pretrain/swin_tiny_patch4_window7_224.pth',
backbone=dict(
embed_dims=96,
depths=[2, 2, 6, 2],
num_heads=[3, 6, 12, 24],
window_size=7,
use_abs_pos_embed=False,
drop_path_rate=0.3,
patch_norm=True),
decode_head=dict(in_channels=[96, 192, 384, 768], num_classes=6),
auxiliary_head=dict(in_channels=384, num_classes=6),
test_cfg=dict(mode='slide',crop_size=(256,256),stride=(171,171)))
optimizer = dict(
_delete_=True,
type='AdamW',
lr=0.00006,
betas=(0.9, 0.999),
weight_decay=0.01,
paramwise_cfg=dict(
custom_keys={
'absolute_pos_embed': dict(decay_mult=0.),
'relative_position_bias_table': dict(decay_mult=0.),
'norm': dict(decay_mult=0.)
}))
lr_config = dict(
_delete_=True,
policy='poly',
warmup='linear',
warmup_iters=1500,
warmup_ratio=1e-6,
power=1.0,
min_lr=0.0,
by_epoch=False)
data = dict(samples_per_gpu=2, workers_per_gpu=2)
evaluation = dict(metric=['mIoU', 'mFscore'], save_best='mIoU')
| _base_ = ['../_base_/models/upernet_swin.py', '../_base_/datasets/Vaihingen.py', '../_base_/default_runtime.py', '../_base_/schedules/schedule_80k.py']
model = dict(pretrained='pretrain/swin_tiny_patch4_window7_224.pth', backbone=dict(embed_dims=96, depths=[2, 2, 6, 2], num_heads=[3, 6, 12, 24], window_size=7, use_abs_pos_embed=False, drop_path_rate=0.3, patch_norm=True), decode_head=dict(in_channels=[96, 192, 384, 768], num_classes=6), auxiliary_head=dict(in_channels=384, num_classes=6), test_cfg=dict(mode='slide', crop_size=(256, 256), stride=(171, 171)))
optimizer = dict(_delete_=True, type='AdamW', lr=6e-05, betas=(0.9, 0.999), weight_decay=0.01, paramwise_cfg=dict(custom_keys={'absolute_pos_embed': dict(decay_mult=0.0), 'relative_position_bias_table': dict(decay_mult=0.0), 'norm': dict(decay_mult=0.0)}))
lr_config = dict(_delete_=True, policy='poly', warmup='linear', warmup_iters=1500, warmup_ratio=1e-06, power=1.0, min_lr=0.0, by_epoch=False)
data = dict(samples_per_gpu=2, workers_per_gpu=2)
evaluation = dict(metric=['mIoU', 'mFscore'], save_best='mIoU') |
num = 1
for i in range(5):
for j in range(i+1):
print(num, end=" ")
num+=1
print() | num = 1
for i in range(5):
for j in range(i + 1):
print(num, end=' ')
num += 1
print() |
class Quiz:
def __init__(self,question, alt, correct):
self.question = question
self.alt = alt
self.correct = correct
self.s =""
for a in range(len(self.alt)):
self.s =self.s+str(a+1)+". "+self.alt[a]+"\n"
def corect_ansrer_txt(self):
return "correct anser is:{self.alt[self.correct-1]}".format(self=self)
def __str__(self,*args,**kwargs):
return "{self.question}\n{self.s}".format(self=self)
class Player:
def __init__(self,name,Score):
self.score=0
self.name=name
def Correct(self):
self.score+=1
def Print_Score(self):
print(f"{self.name} score is {self.score}")
return self.score
def __str__(self):
return "{self.name}".format(self=self)
def Add_players(Player_Nr):
List_of_players=[]
for l in range(Player_Nr):
p=Player(input(f"Player{l+1}s name?"),0)
List_of_players.append(p)
return List_of_players
if __name__=="__main__":
file = open("C:/Users/bmm1/Dat120_Ovning9/sporsmaalsfil.txt", encoding="UTF8")
Nr_players = int(input("Select number of players"))
PlayerL = Add_players(Nr_players)
ScoreL = []
for line in file:
line = line.replace("[", "").replace("]","")
Qst_Ans = line.split(":")
Alt = Qst_Ans[2].replace(" ","").split(",")
Qst_Ans.pop()
int(Qst_Ans[1])
CorrectWrongL = []
Qst= Quiz(Qst_Ans[0], Alt, Qst_Ans[1])
print(Qst)
for a in range(Nr_players):
anser = int(input(f"{PlayerL[a]} select your anser"))
Correct = int(Qst_Ans[1])
if anser == Correct+1:
PlayerL[a].Correct()
CorrectWrongL.append("Correct")
else:
CorrectWrongL.append("Wrong")
print(f"Correct anser is {Alt[Correct]}")
for z in range(len(CorrectWrongL)):
print(f"{PlayerL[z]}'s anser is {CorrectWrongL[z]}")
print("")
for d in range(len(PlayerL)):
SL = PlayerL[d].Print_Score()
ScoreL.append(SL)
max_value = max(ScoreL)
max_index = ScoreL.index(max_value)
print(f"{PlayerL[max_index]} won")
| class Quiz:
def __init__(self, question, alt, correct):
self.question = question
self.alt = alt
self.correct = correct
self.s = ''
for a in range(len(self.alt)):
self.s = self.s + str(a + 1) + '. ' + self.alt[a] + '\n'
def corect_ansrer_txt(self):
return 'correct anser is:{self.alt[self.correct-1]}'.format(self=self)
def __str__(self, *args, **kwargs):
return '{self.question}\n{self.s}'.format(self=self)
class Player:
def __init__(self, name, Score):
self.score = 0
self.name = name
def correct(self):
self.score += 1
def print__score(self):
print(f'{self.name} score is {self.score}')
return self.score
def __str__(self):
return '{self.name}'.format(self=self)
def add_players(Player_Nr):
list_of_players = []
for l in range(Player_Nr):
p = player(input(f'Player{l + 1}s name?'), 0)
List_of_players.append(p)
return List_of_players
if __name__ == '__main__':
file = open('C:/Users/bmm1/Dat120_Ovning9/sporsmaalsfil.txt', encoding='UTF8')
nr_players = int(input('Select number of players'))
player_l = add_players(Nr_players)
score_l = []
for line in file:
line = line.replace('[', '').replace(']', '')
qst__ans = line.split(':')
alt = Qst_Ans[2].replace(' ', '').split(',')
Qst_Ans.pop()
int(Qst_Ans[1])
correct_wrong_l = []
qst = quiz(Qst_Ans[0], Alt, Qst_Ans[1])
print(Qst)
for a in range(Nr_players):
anser = int(input(f'{PlayerL[a]} select your anser'))
correct = int(Qst_Ans[1])
if anser == Correct + 1:
PlayerL[a].Correct()
CorrectWrongL.append('Correct')
else:
CorrectWrongL.append('Wrong')
print(f'Correct anser is {Alt[Correct]}')
for z in range(len(CorrectWrongL)):
print(f"{PlayerL[z]}'s anser is {CorrectWrongL[z]}")
print('')
for d in range(len(PlayerL)):
sl = PlayerL[d].Print_Score()
ScoreL.append(SL)
max_value = max(ScoreL)
max_index = ScoreL.index(max_value)
print(f'{PlayerL[max_index]} won') |
program_list = []
def execute_command_with_params(input):
command, params = input.split(sep=" ", maxsplit=1)
if command == "insert":
i, e = map(int, params.split(sep=" ", maxsplit=1))
program_list.insert(i, e)
if command == "remove":
e = int(params)
program_list.remove(e)
if command == "append":
e = int(params)
program_list.append(e)
def execute_simple_command(input):
if input == "print":
print(program_list)
if input == "sort":
program_list.sort()
if input == "pop":
program_list.pop()
if input == "reverse":
program_list.reverse()
if __name__ == '__main__':
commands = list()
n = int(input())
for _ in range(n):
commands.append(input())
for command in commands:
if ' ' in command:
execute_command_with_params(command)
else:
execute_simple_command(command)
| program_list = []
def execute_command_with_params(input):
(command, params) = input.split(sep=' ', maxsplit=1)
if command == 'insert':
(i, e) = map(int, params.split(sep=' ', maxsplit=1))
program_list.insert(i, e)
if command == 'remove':
e = int(params)
program_list.remove(e)
if command == 'append':
e = int(params)
program_list.append(e)
def execute_simple_command(input):
if input == 'print':
print(program_list)
if input == 'sort':
program_list.sort()
if input == 'pop':
program_list.pop()
if input == 'reverse':
program_list.reverse()
if __name__ == '__main__':
commands = list()
n = int(input())
for _ in range(n):
commands.append(input())
for command in commands:
if ' ' in command:
execute_command_with_params(command)
else:
execute_simple_command(command) |
def help():
help_file = "help.txt"
with open(help_file) as help:
content = help.read()
return(content)
| def help():
help_file = 'help.txt'
with open(help_file) as help:
content = help.read()
return content |
def euclide_e(a, n):
u, v = 1, 0
u1, v1 = 0, 1
while n > 0:
u1_t = u - a // n * u1
v1_t = v - a // n * v1
u, v = u1, v1
u1, v1 = u1_t, v1_t
a, n = n, a - a // n * n;
return [u, v, a]
print(euclide_e(39, 5))
| def euclide_e(a, n):
(u, v) = (1, 0)
(u1, v1) = (0, 1)
while n > 0:
u1_t = u - a // n * u1
v1_t = v - a // n * v1
(u, v) = (u1, v1)
(u1, v1) = (u1_t, v1_t)
(a, n) = (n, a - a // n * n)
return [u, v, a]
print(euclide_e(39, 5)) |
# Third-party dependencies fetched by Bazel
# Unlike WORKSPACE, the content of this file is unordered.
# We keep them separate to make the WORKSPACE file more maintainable.
# Install the nodejs "bootstrap" package
# This provides the basic tools for running and packaging nodejs programs in Bazel
load("@bazel_tools//tools/build_defs/repo:http.bzl", "http_archive")
def fetch_dependencies():
http_archive(
name = "build_bazel_rules_nodejs",
sha256 = "8f5f192ba02319254aaf2cdcca00ec12eaafeb979a80a1e946773c520ae0a2c9",
urls = ["https://github.com/bazelbuild/rules_nodejs/releases/download/3.7.0/rules_nodejs-3.7.0.tar.gz"],
)
http_archive(
name = "io_bazel_rules_go",
sha256 = "8e968b5fcea1d2d64071872b12737bbb5514524ee5f0a4f54f5920266c261acb",
urls = [
"https://mirror.bazel.build/github.com/bazelbuild/rules_go/releases/download/v0.28.0/rules_go-v0.28.0.zip",
"https://github.com/bazelbuild/rules_go/releases/download/v0.28.0/rules_go-v0.28.0.zip",
],
)
http_archive(
name = "bazel_gazelle",
sha256 = "62ca106be173579c0a167deb23358fdfe71ffa1e4cfdddf5582af26520f1c66f",
urls = [
"https://mirror.bazel.build/github.com/bazelbuild/bazel-gazelle/releases/download/v0.23.0/bazel-gazelle-v0.23.0.tar.gz",
"https://github.com/bazelbuild/bazel-gazelle/releases/download/v0.23.0/bazel-gazelle-v0.23.0.tar.gz",
],
)
| load('@bazel_tools//tools/build_defs/repo:http.bzl', 'http_archive')
def fetch_dependencies():
http_archive(name='build_bazel_rules_nodejs', sha256='8f5f192ba02319254aaf2cdcca00ec12eaafeb979a80a1e946773c520ae0a2c9', urls=['https://github.com/bazelbuild/rules_nodejs/releases/download/3.7.0/rules_nodejs-3.7.0.tar.gz'])
http_archive(name='io_bazel_rules_go', sha256='8e968b5fcea1d2d64071872b12737bbb5514524ee5f0a4f54f5920266c261acb', urls=['https://mirror.bazel.build/github.com/bazelbuild/rules_go/releases/download/v0.28.0/rules_go-v0.28.0.zip', 'https://github.com/bazelbuild/rules_go/releases/download/v0.28.0/rules_go-v0.28.0.zip'])
http_archive(name='bazel_gazelle', sha256='62ca106be173579c0a167deb23358fdfe71ffa1e4cfdddf5582af26520f1c66f', urls=['https://mirror.bazel.build/github.com/bazelbuild/bazel-gazelle/releases/download/v0.23.0/bazel-gazelle-v0.23.0.tar.gz', 'https://github.com/bazelbuild/bazel-gazelle/releases/download/v0.23.0/bazel-gazelle-v0.23.0.tar.gz']) |
class Solution:
def allPathsSourceTarget(self, graph: List[List[int]]) -> List[List[int]]:
def dfs(cur, path):
if cur == len(graph) - 1:
res.append(path)
else:
for i in graph[cur]:
dfs(i, path + [i])
res = []
dfs(0, [0])
return res | class Solution:
def all_paths_source_target(self, graph: List[List[int]]) -> List[List[int]]:
def dfs(cur, path):
if cur == len(graph) - 1:
res.append(path)
else:
for i in graph[cur]:
dfs(i, path + [i])
res = []
dfs(0, [0])
return res |
# model settings
# norm_cfg = dict(type='BN', requires_grad=False)
model = dict(
type='FasterRCNN',
pretrained='open-mmlab://resnext101_32x4d', #resnet50_caffe
backbone=dict(
type='ResNeXt',
depth=101, #50
groups=32,
num_stages=3,
strides=(1, 2, 2),
dilations=(1, 1, 1),
out_indices=(2, ),
frozen_stages=1,
# norm_cfg=norm_cfg,
# norm_eval=True,
style='pytorch'),
shared_head=dict(
type='ResxLayer',
depth=101, #50
stage=3,
stride=1,
dilation=2,
style='pytorch',
# norm_cfg=norm_cfg,
# norm_eval=True
),
rpn_head=dict(
type='RPNHead',
in_channels=1024,
feat_channels=512,
anchor_scales=[2, 4, 8, 16, 32],
anchor_ratios=[0.5, 1.0, 2.0],
anchor_strides=[16],
target_means=[.0, .0, .0, .0],
target_stds=[1.0, 1.0, 1.0, 1.0],
loss_cls=dict(
type='CrossEntropyLoss', use_sigmoid=True, loss_weight=1.0),
loss_bbox=dict(type='SmoothL1Loss', beta=1.0 / 9.0, loss_weight=1.0)),
bbox_roi_extractor=dict(
type='SingleRoIExtractor',
roi_layer=dict(type='RoIAlign', out_size=7, sample_num=2),
out_channels=1024,
featmap_strides=[16]),
bbox_head=dict(
type='BBoxHead',
with_avg_pool=False, #True
roi_feat_size=7,
in_channels=1024,
num_classes=31,
target_means=[0., 0., 0., 0.],
target_stds=[0.1, 0.1, 0.2, 0.2],
reg_class_agnostic=False, #False
loss_cls=dict(
type='CrossEntropyLoss', use_sigmoid=False, loss_weight=1.0),
loss_bbox=dict(type='SmoothL1Loss', beta=1.0, loss_weight=1.0)),
selsa_head=dict(
type='SelsaHead',
in_channels=256,
out_channels=1024,
nongt_dim=3, # number of frames
feat_dim=1024, # 1024
dim=[1024, 1024, 1024],
# norm_cfg=norm_cfg,
# norm_eval=True,
apply=True)
)
# model training and testing settings
train_cfg = dict(
rpn=dict(
assigner=dict(
type='MaxIoUAssigner',
pos_iou_thr=0.7,
neg_iou_thr=0.3,
min_pos_iou=0.3,
ignore_iof_thr=-1),
sampler=dict(
type='RandomSampler',
num=256,
pos_fraction=0.5,
neg_pos_ub=-1,
add_gt_as_proposals=False),
allowed_border=-1, #0
pos_weight=-1,
debug=False),
rpn_proposal=dict(
nms_across_levels=False,
nms_pre=12000,
nms_post=2000,
max_num=2000,
nms_thr=0.7,
min_bbox_size=0),
rcnn=dict(
assigner=dict(
type='MaxIoUAssigner',
pos_iou_thr=0.5,
neg_iou_thr=0.5,
min_pos_iou=0.5,
ignore_iof_thr=-1),
sampler=dict(
type='OHEMSampler',
num=512, #512
pos_fraction=0.25, #0.25
neg_pos_ub=-1,
add_gt_as_proposals=True),
NUM_OHEM=None,
pos_weight=-1,
debug=False)
)
test_cfg = dict(
rpn=dict(
nms_across_levels=False,
nms_pre=6000,
nms_post=1000,
max_num=300, #1000
nms_thr=0.7,
min_bbox_size=0),
rcnn=dict(
score_thr=0.001, nms=dict(type='nms', iou_thr=0.5), max_per_img=300)) #0.05
# dataset settings
dataset_type = 'VIDDataset'
data_root = '/media/data1/jliang/dataset/ILSVRC/'
# img_norm_cfg = dict(
# mean=[102.9801, 115.9465, 122.7717], std=[1.0, 1.0, 1.0], to_rgb=False) #maybe need to change
img_norm_cfg = dict(
mean=[123.675, 116.28, 103.53], std=[58.395, 57.12, 57.375], to_rgb=True)
train_pipeline = [
dict(type='LoadImageFromFile', to_float32=True), #add to_float32=True
dict(type='LoadAnnotations', with_bbox=True),
dict(
type='PhotoMetricDistortion',
brightness_delta=32,
contrast_range=(0.5, 1.5),
saturation_range=(0.5, 1.5),
hue_delta=18),
dict(
type='Expand',
mean=img_norm_cfg['mean'],
to_rgb=img_norm_cfg['to_rgb'],
ratio_range=(1, 4)), #(1,4)
dict(
type='MinIoURandomCrop',
min_ious=(0.1, 0.3, 0.5, 0.7, 0.9), #(0.1, 0.3, 0.5, 0.7, 0.9)
min_crop_size=0.3),
dict(type='Resize', img_scale=(600, 1000), keep_ratio=True),
# when remove the crop, the gpu-util will be 100% then suspend
dict(type='RandomCrop', crop_size=(4096, 4096)),
dict(type='RandomFlip', flip_ratio=0.5),
dict(type='Normalize', **img_norm_cfg),
dict(type='Pad', size_divisor=32),
dict(type='DefaultFormatBundle'),
dict(type='Collect', keys=['img', 'gt_bboxes', 'gt_labels']),
]
test_pipeline = [
dict(type='LoadImageFromFile'),
dict(
type='MultiScaleFlipAug',
img_scale=(600, 1000),
flip=False,
transforms=[
dict(type='Resize', keep_ratio=True),
dict(type='RandomCrop', crop_size=(4096, 4096)),
dict(type='RandomFlip'),
dict(type='Normalize', **img_norm_cfg),
dict(type='Pad', size_divisor=32),
dict(type='ImageToTensor', keys=['img']),
dict(type='Collect', keys=['img'], meta_keys=('filename', 'ori_shape', 'img_shape', 'pad_shape',
'scale_factor', 'flip', 'img_norm_cfg', 'img_info')),
])
]
data = dict(
imgs_per_gpu=1,
workers_per_gpu=2,
train=dict(
type=dataset_type,
image_set='DET_train_30classes+VID_train_15frames',#VID_train_15frames
ann_file=data_root,
img_prefix=data_root,
pipeline=train_pipeline,
selsa_offset=dict(MAX_OFFSET=9,MIN_OFFSET=-9)),
val=dict(
type=dataset_type,
image_set='VID_val_frames_o',
ann_file=data_root,
img_prefix=data_root,
pipeline=test_pipeline),
test=dict(
type=dataset_type,
image_set='VID_val_videos', #VID_val_videos_o VID_val_videos_frames VID_val_videos_class_mofbg
ann_file=data_root,
img_prefix=data_root,
pipeline=test_pipeline,
selsa_offset=dict(MAX_OFFSET=9, MIN_OFFSET=-9)))
evaluation = dict(interval=1) #control eval interval epoch
# optimizer
optimizer = dict(type='SGD', lr=0.00125, momentum=0.9, weight_decay=0.0001)
optimizer_config = dict(grad_clip=dict(max_norm=35, norm_type=2))
# learning policy
lr_config = dict(
policy='step',
warmup='linear',
warmup_iters=500,
warmup_ratio=1.0 / 3,
step=[11, 14])
checkpoint_config = dict(interval=1)
# yapf:disable
log_config = dict(
interval=1000,
hooks=[
dict(type='TextLoggerHook'),
# dict(type='TensorboardLoggerHook')
])
# yapf:enable
# runtime settings
total_epochs = 15
dist_params = dict(backend='nccl')
log_level = 'INFO'
work_dir = './work_dirs/faster_rcnn_r101_caffe_c4_1x_gsfa/resnext'
load_from = None
resume_from = None
workflow = [('train', 1)]
| model = dict(type='FasterRCNN', pretrained='open-mmlab://resnext101_32x4d', backbone=dict(type='ResNeXt', depth=101, groups=32, num_stages=3, strides=(1, 2, 2), dilations=(1, 1, 1), out_indices=(2,), frozen_stages=1, style='pytorch'), shared_head=dict(type='ResxLayer', depth=101, stage=3, stride=1, dilation=2, style='pytorch'), rpn_head=dict(type='RPNHead', in_channels=1024, feat_channels=512, anchor_scales=[2, 4, 8, 16, 32], anchor_ratios=[0.5, 1.0, 2.0], anchor_strides=[16], target_means=[0.0, 0.0, 0.0, 0.0], target_stds=[1.0, 1.0, 1.0, 1.0], loss_cls=dict(type='CrossEntropyLoss', use_sigmoid=True, loss_weight=1.0), loss_bbox=dict(type='SmoothL1Loss', beta=1.0 / 9.0, loss_weight=1.0)), bbox_roi_extractor=dict(type='SingleRoIExtractor', roi_layer=dict(type='RoIAlign', out_size=7, sample_num=2), out_channels=1024, featmap_strides=[16]), bbox_head=dict(type='BBoxHead', with_avg_pool=False, roi_feat_size=7, in_channels=1024, num_classes=31, target_means=[0.0, 0.0, 0.0, 0.0], target_stds=[0.1, 0.1, 0.2, 0.2], reg_class_agnostic=False, loss_cls=dict(type='CrossEntropyLoss', use_sigmoid=False, loss_weight=1.0), loss_bbox=dict(type='SmoothL1Loss', beta=1.0, loss_weight=1.0)), selsa_head=dict(type='SelsaHead', in_channels=256, out_channels=1024, nongt_dim=3, feat_dim=1024, dim=[1024, 1024, 1024], apply=True))
train_cfg = dict(rpn=dict(assigner=dict(type='MaxIoUAssigner', pos_iou_thr=0.7, neg_iou_thr=0.3, min_pos_iou=0.3, ignore_iof_thr=-1), sampler=dict(type='RandomSampler', num=256, pos_fraction=0.5, neg_pos_ub=-1, add_gt_as_proposals=False), allowed_border=-1, pos_weight=-1, debug=False), rpn_proposal=dict(nms_across_levels=False, nms_pre=12000, nms_post=2000, max_num=2000, nms_thr=0.7, min_bbox_size=0), rcnn=dict(assigner=dict(type='MaxIoUAssigner', pos_iou_thr=0.5, neg_iou_thr=0.5, min_pos_iou=0.5, ignore_iof_thr=-1), sampler=dict(type='OHEMSampler', num=512, pos_fraction=0.25, neg_pos_ub=-1, add_gt_as_proposals=True), NUM_OHEM=None, pos_weight=-1, debug=False))
test_cfg = dict(rpn=dict(nms_across_levels=False, nms_pre=6000, nms_post=1000, max_num=300, nms_thr=0.7, min_bbox_size=0), rcnn=dict(score_thr=0.001, nms=dict(type='nms', iou_thr=0.5), max_per_img=300))
dataset_type = 'VIDDataset'
data_root = '/media/data1/jliang/dataset/ILSVRC/'
img_norm_cfg = dict(mean=[123.675, 116.28, 103.53], std=[58.395, 57.12, 57.375], to_rgb=True)
train_pipeline = [dict(type='LoadImageFromFile', to_float32=True), dict(type='LoadAnnotations', with_bbox=True), dict(type='PhotoMetricDistortion', brightness_delta=32, contrast_range=(0.5, 1.5), saturation_range=(0.5, 1.5), hue_delta=18), dict(type='Expand', mean=img_norm_cfg['mean'], to_rgb=img_norm_cfg['to_rgb'], ratio_range=(1, 4)), dict(type='MinIoURandomCrop', min_ious=(0.1, 0.3, 0.5, 0.7, 0.9), min_crop_size=0.3), dict(type='Resize', img_scale=(600, 1000), keep_ratio=True), dict(type='RandomCrop', crop_size=(4096, 4096)), dict(type='RandomFlip', flip_ratio=0.5), dict(type='Normalize', **img_norm_cfg), dict(type='Pad', size_divisor=32), dict(type='DefaultFormatBundle'), dict(type='Collect', keys=['img', 'gt_bboxes', 'gt_labels'])]
test_pipeline = [dict(type='LoadImageFromFile'), dict(type='MultiScaleFlipAug', img_scale=(600, 1000), flip=False, transforms=[dict(type='Resize', keep_ratio=True), dict(type='RandomCrop', crop_size=(4096, 4096)), dict(type='RandomFlip'), dict(type='Normalize', **img_norm_cfg), dict(type='Pad', size_divisor=32), dict(type='ImageToTensor', keys=['img']), dict(type='Collect', keys=['img'], meta_keys=('filename', 'ori_shape', 'img_shape', 'pad_shape', 'scale_factor', 'flip', 'img_norm_cfg', 'img_info'))])]
data = dict(imgs_per_gpu=1, workers_per_gpu=2, train=dict(type=dataset_type, image_set='DET_train_30classes+VID_train_15frames', ann_file=data_root, img_prefix=data_root, pipeline=train_pipeline, selsa_offset=dict(MAX_OFFSET=9, MIN_OFFSET=-9)), val=dict(type=dataset_type, image_set='VID_val_frames_o', ann_file=data_root, img_prefix=data_root, pipeline=test_pipeline), test=dict(type=dataset_type, image_set='VID_val_videos', ann_file=data_root, img_prefix=data_root, pipeline=test_pipeline, selsa_offset=dict(MAX_OFFSET=9, MIN_OFFSET=-9)))
evaluation = dict(interval=1)
optimizer = dict(type='SGD', lr=0.00125, momentum=0.9, weight_decay=0.0001)
optimizer_config = dict(grad_clip=dict(max_norm=35, norm_type=2))
lr_config = dict(policy='step', warmup='linear', warmup_iters=500, warmup_ratio=1.0 / 3, step=[11, 14])
checkpoint_config = dict(interval=1)
log_config = dict(interval=1000, hooks=[dict(type='TextLoggerHook')])
total_epochs = 15
dist_params = dict(backend='nccl')
log_level = 'INFO'
work_dir = './work_dirs/faster_rcnn_r101_caffe_c4_1x_gsfa/resnext'
load_from = None
resume_from = None
workflow = [('train', 1)] |
def resolve():
'''
code here
'''
N, H = [int(item) for item in input().split()]
ab = [[int(item) for item in input().split()] for _ in range(N)]
a_max = max(ab, key=lambda x:x[0])
res = H // a_max
if H % a_max != 0:
res += 1
temp_attack = res * a_max
b_delta = [b - a_max for a, b in ab]
throw_atk_sum = 0
throw_num = 0
for item in b_delta:
if b_delta > 0:
throw_atk_sum += item
throw_num += 1
if throw_atk_sum < temp_attack:
reduce_num = throw_atk_sum//a_max
print(res - reduce_num)
else:
res = 0
for a, b in ab:
H -= b
res += 1
if H <= 0:
break
print(res)
if __name__ == "__main__":
resolve()
| def resolve():
"""
code here
"""
(n, h) = [int(item) for item in input().split()]
ab = [[int(item) for item in input().split()] for _ in range(N)]
a_max = max(ab, key=lambda x: x[0])
res = H // a_max
if H % a_max != 0:
res += 1
temp_attack = res * a_max
b_delta = [b - a_max for (a, b) in ab]
throw_atk_sum = 0
throw_num = 0
for item in b_delta:
if b_delta > 0:
throw_atk_sum += item
throw_num += 1
if throw_atk_sum < temp_attack:
reduce_num = throw_atk_sum // a_max
print(res - reduce_num)
else:
res = 0
for (a, b) in ab:
h -= b
res += 1
if H <= 0:
break
print(res)
if __name__ == '__main__':
resolve() |
def parensvalid(stringInput):
opencount = 0
closedcount = 0
for i in range(0, len(stringInput), 1):
if stringInput[i] == "(":
opencount += 1
elif stringInput[i] == ")":
closedcount += 1
if closedcount > opencount:
return False
if opencount != closedcount:
return False
else:
return True
print(parensvalid(")(()"))
def parenvalid2(stringInput):
# your code here
count = 0
# closedcount = 0
for i in range(0, len(stringInput), 1):
if stringInput[i] == "(":
count += 1
elif stringInput[i] == ")":
count -= 1
if count < 0:
return False
if count == 0:
return True
else:
return False
print(parenvalid2(")(()")) | def parensvalid(stringInput):
opencount = 0
closedcount = 0
for i in range(0, len(stringInput), 1):
if stringInput[i] == '(':
opencount += 1
elif stringInput[i] == ')':
closedcount += 1
if closedcount > opencount:
return False
if opencount != closedcount:
return False
else:
return True
print(parensvalid(')(()'))
def parenvalid2(stringInput):
count = 0
for i in range(0, len(stringInput), 1):
if stringInput[i] == '(':
count += 1
elif stringInput[i] == ')':
count -= 1
if count < 0:
return False
if count == 0:
return True
else:
return False
print(parenvalid2(')(()')) |
expected_output = {
"operation_summary": {
1: {
"command": "rollback",
"duration": "00:00:04",
"end_date": "2021-11-02",
"end_time": "06:50:48",
"op_id": 1,
"start_date": "2021-11-02",
"start_time": "06:50:44",
"status": "Fail",
"uuid": "2021_11_02_06_50_44_op_rollback",
},
2: {
"command": "rollback",
"duration": "00:00:05",
"end_date": "2021-11-02",
"end_time": "05:52:04",
"op_id": 1,
"start_date": "2021-11-02",
"start_time": "05:51:59",
"status": "Fail",
"uuid": "2021_11_02_05_51_59_op_rollback",
},
3: {
"command": "rollback",
"duration": "00:00:07",
"end_date": "2021-10-29",
"end_time": "12:44:21",
"op_id": 1,
"start_date": "2021-10-29",
"start_time": "12:44:14",
"status": "Fail",
"uuid": "2021_10_29_12_44_14_op_rollback",
},
4: {
"command": "commit",
"duration": "00:00:04",
"end_date": "2021-10-21",
"end_time": "16:34:06",
"op_id": 1,
"start_date": "2021-10-21",
"start_time": "16:34:02",
"status": "OK",
"uuid": "2021_10_21_16_34_02_op_commit",
},
}
}
| expected_output = {'operation_summary': {1: {'command': 'rollback', 'duration': '00:00:04', 'end_date': '2021-11-02', 'end_time': '06:50:48', 'op_id': 1, 'start_date': '2021-11-02', 'start_time': '06:50:44', 'status': 'Fail', 'uuid': '2021_11_02_06_50_44_op_rollback'}, 2: {'command': 'rollback', 'duration': '00:00:05', 'end_date': '2021-11-02', 'end_time': '05:52:04', 'op_id': 1, 'start_date': '2021-11-02', 'start_time': '05:51:59', 'status': 'Fail', 'uuid': '2021_11_02_05_51_59_op_rollback'}, 3: {'command': 'rollback', 'duration': '00:00:07', 'end_date': '2021-10-29', 'end_time': '12:44:21', 'op_id': 1, 'start_date': '2021-10-29', 'start_time': '12:44:14', 'status': 'Fail', 'uuid': '2021_10_29_12_44_14_op_rollback'}, 4: {'command': 'commit', 'duration': '00:00:04', 'end_date': '2021-10-21', 'end_time': '16:34:06', 'op_id': 1, 'start_date': '2021-10-21', 'start_time': '16:34:02', 'status': 'OK', 'uuid': '2021_10_21_16_34_02_op_commit'}}} |
a = int(input("Input number a:\n"))
b = int(input("Input number b:\n"))
print(f"a + b = {a+b}")
print(f"a - b = {a-b}")
print(f"a * b = {a*b}")
print(f"a / b = {a/b}")
print(f"a ** b = {a**b}")
| a = int(input('Input number a:\n'))
b = int(input('Input number b:\n'))
print(f'a + b = {a + b}')
print(f'a - b = {a - b}')
print(f'a * b = {a * b}')
print(f'a / b = {a / b}')
print(f'a ** b = {a ** b}') |
NAME = "vt2geojson"
DESCRIPTION = "Dump vector tiles to GeoJSON from remote URLs or local system files."
AUTHOR = "Theophile Dancoisne"
AUTHOR_EMAIL = "dancoisne.theophile@gmail.com"
URL = "https://github.com/Amyantis/python-vt2geojson"
__version__ = "0.2.1"
| name = 'vt2geojson'
description = 'Dump vector tiles to GeoJSON from remote URLs or local system files.'
author = 'Theophile Dancoisne'
author_email = 'dancoisne.theophile@gmail.com'
url = 'https://github.com/Amyantis/python-vt2geojson'
__version__ = '0.2.1' |
n= int(input())
my_dict = {}
for i in range((n*(n-1))//2):
mylist = []
x, y, z = input().split()
mylist.append(x)
mylist.append(y)
mylist.append(z)
first_t=mylist[0]
second_t = mylist[1]
first_t_score = mylist[2][0]
second_t_score = mylist[2][2]
if first_t_score<second_t_score:
scorefinalfirst=0
scorefinalsecond =3
if (first_t=='A' and second_t=='B') or (first_t=='B' and second_t=='C') or (first_t=='A' and second_t=='C'):
if first_t in my_dict:
my_dict[first_t] += 0
else:
my_dict[first_t]= 0
if second_t in my_dict:
my_dict[second_t] += 3
else:
my_dict[second_t] = 3
elif first_t_score == second_t_score:
if (first_t == 'A' and second_t == 'B') or (first_t == 'B' and second_t == 'C') or (
first_t == 'A' and second_t == 'C'):
if first_t in my_dict:
my_dict[first_t] += 1
else:
my_dict[first_t] = 1
if second_t in my_dict:
my_dict[second_t] += 1
else:
my_dict[second_t] = 1
else:
scorefinalfirst = 3
scorefinalsecond=0
if (first_t == 'A' and second_t == 'B') or (first_t == 'B' and second_t == 'C') or (first_t == 'A' and second_t == 'C'):
if first_t in my_dict:
my_dict[first_t] += 3
else:
my_dict[first_t] = 3
if second_t in my_dict:
my_dict[second_t] += 0
else:
my_dict[second_t] = 0
Keymax = max(my_dict, key=my_dict.get)
print(Keymax,my_dict[Keymax])
| n = int(input())
my_dict = {}
for i in range(n * (n - 1) // 2):
mylist = []
(x, y, z) = input().split()
mylist.append(x)
mylist.append(y)
mylist.append(z)
first_t = mylist[0]
second_t = mylist[1]
first_t_score = mylist[2][0]
second_t_score = mylist[2][2]
if first_t_score < second_t_score:
scorefinalfirst = 0
scorefinalsecond = 3
if first_t == 'A' and second_t == 'B' or (first_t == 'B' and second_t == 'C') or (first_t == 'A' and second_t == 'C'):
if first_t in my_dict:
my_dict[first_t] += 0
else:
my_dict[first_t] = 0
if second_t in my_dict:
my_dict[second_t] += 3
else:
my_dict[second_t] = 3
elif first_t_score == second_t_score:
if first_t == 'A' and second_t == 'B' or (first_t == 'B' and second_t == 'C') or (first_t == 'A' and second_t == 'C'):
if first_t in my_dict:
my_dict[first_t] += 1
else:
my_dict[first_t] = 1
if second_t in my_dict:
my_dict[second_t] += 1
else:
my_dict[second_t] = 1
else:
scorefinalfirst = 3
scorefinalsecond = 0
if first_t == 'A' and second_t == 'B' or (first_t == 'B' and second_t == 'C') or (first_t == 'A' and second_t == 'C'):
if first_t in my_dict:
my_dict[first_t] += 3
else:
my_dict[first_t] = 3
if second_t in my_dict:
my_dict[second_t] += 0
else:
my_dict[second_t] = 0
keymax = max(my_dict, key=my_dict.get)
print(Keymax, my_dict[Keymax]) |
'''
Katie Naughton
Final Project
Intro to Programming
Sources:
'''
| """
Katie Naughton
Final Project
Intro to Programming
Sources:
""" |
# https://leetcode.com/problems/remove-duplicate-letters/
# Given a string s, remove duplicate letters so that every letter appears once and
# only once. You must make sure your result is the smallest in lexicographical
# order among all possible results.
################################################################################
# record last postion of each char
# use stack and pop previous chars when i) new char is smaller and ii) we can add the popped char back later
class Solution:
def removeDuplicateLetters(self, s: str) -> str:
last_pos = {}
for idx, char in enumerate(s):
last_pos[char] = idx
stack = []
for idx, char in enumerate(s):
if char not in stack:
# pop the previous chars if the new char is smaller
# but only when we can add the popped char back: idx < last_pos[popped_char]
while stack and char < stack[-1] and idx < last_pos[stack[-1]]:
stack.pop()
stack.append(char)
return ''.join(stack)
| class Solution:
def remove_duplicate_letters(self, s: str) -> str:
last_pos = {}
for (idx, char) in enumerate(s):
last_pos[char] = idx
stack = []
for (idx, char) in enumerate(s):
if char not in stack:
while stack and char < stack[-1] and (idx < last_pos[stack[-1]]):
stack.pop()
stack.append(char)
return ''.join(stack) |
def random_gauss(mean, standard_deviation):
sum = 0
for _ in range(12):
sum = sum + random()
centered_around_zero = sum - 6
deviated = centered_around_zero * standard_deviation
gauss_value = deviated + mean
return gauss_value
# use the returned value as the next seed
# and use any number (for example time) as the starting seed
# pick a, b and c appropriately
def random(seed, a, b, c):
rand = (a*seed + b) % c
return rand
| def random_gauss(mean, standard_deviation):
sum = 0
for _ in range(12):
sum = sum + random()
centered_around_zero = sum - 6
deviated = centered_around_zero * standard_deviation
gauss_value = deviated + mean
return gauss_value
def random(seed, a, b, c):
rand = (a * seed + b) % c
return rand |
class Point2D():
def __init__(self, x,y):
self.coord = [x,y]
def __str__(self):
return f'Point:({self.coord[0]},{self.coord[1]})'
def __eq__(self,other):
return (self.coord[0]==other.coord[0])&(self.coord[1]==other.coord[1])
def __ne__(self,other):
return (self.coord[0]!=other.coord[0])&(self.coord[1]!=other.coord[1])
def __gt__(self,other):
return (self.distance()>other.distance())
def __le__(self,other):
return (self.distance()<=other.distance())
def __ge__(self,other):
return (self.distance()>=other.distance())
def __ne__(self,other):
return (self.coord[0]!=other.coord[0])&(self.coord[1]!=other.coord[1])
def distance(self):
return (self.coord[0]**2+self.coord[1]**2)**0.5
if __name__=='__main__':
point1 = Point2D(1,1) | class Point2D:
def __init__(self, x, y):
self.coord = [x, y]
def __str__(self):
return f'Point:({self.coord[0]},{self.coord[1]})'
def __eq__(self, other):
return (self.coord[0] == other.coord[0]) & (self.coord[1] == other.coord[1])
def __ne__(self, other):
return (self.coord[0] != other.coord[0]) & (self.coord[1] != other.coord[1])
def __gt__(self, other):
return self.distance() > other.distance()
def __le__(self, other):
return self.distance() <= other.distance()
def __ge__(self, other):
return self.distance() >= other.distance()
def __ne__(self, other):
return (self.coord[0] != other.coord[0]) & (self.coord[1] != other.coord[1])
def distance(self):
return (self.coord[0] ** 2 + self.coord[1] ** 2) ** 0.5
if __name__ == '__main__':
point1 = point2_d(1, 1) |
# Dictionary Carrent book with attributes
currentBook = {
"title": "Possibility of an Island",
"author": "Michel Houellebecq",
"price": 40
}
print(currentBook)
print(currentBook["author"])
currentBook["ISBN"] = "374795"
print("The Current book has these values:")
for value in currentBook.values():
print(" => {}".format(value)) | current_book = {'title': 'Possibility of an Island', 'author': 'Michel Houellebecq', 'price': 40}
print(currentBook)
print(currentBook['author'])
currentBook['ISBN'] = '374795'
print('The Current book has these values:')
for value in currentBook.values():
print(' => {}'.format(value)) |
# optimizes artifacts per roll, not exact values
# e.g. a +20 artifact has 5 rolls total
# rolls are averaged, with data from
# https://genshin-impact.fandom.com/wiki/Artifacts/Stats
# ===============================================
# how this works:
# ===============================================
# our damage equation will be a profit function
# w(atk, er, cr, cd, em, incdmg, ...)
# specifically, it'll look something like
# w = f(atk, er, cr, incdmg...) +
# f(atk, er, cr, cd, incdmg, ...) + f(em, ...)
# in order to write this as a dynamic program,
# ie in order to make this problem decomposable,
# we'll split these into a three-level DP
# first level: will brute force search over # rolls
# into EM (Rolls_em) v. # rolls into everything else
# (Rolls_other)
# second level: DP will search over total number of rolls
# use (where the max #rolls is now Rolls_other) and
# if we only measure dmg for stats up to
# 1:ATK%, 2:ER%, 3:CR+CD
# for a total of 3 stats
# third level: the calculation of rolls into CR
# and rolls into CD will be done with a
# brute force search with function like
# (1 - CR) + CR(CD)
# Total runtime is o(max_rolls^2) cuz we do access in O(1)
# ===============================================
# ===============================================
# some extra things to be aware about
# ===============================================
# 1. substats cannot be rolled if its the same as main stat
# 2. This formulization only works for electro, anemo, and geo,
# though you can reframe the em part to make it for others
# 3. also we only assume 5 star artifacts, for a total
# of 5*5 = 25 rolls
# 4. this doesn't consider HP, DEF, or flat ATK because
# we optimize for DPS
# ===============================================
# ===============================================
# Fact-checking:
# ===============================================
# This has been fact-checked by comparing results
# of
# ofc, any discovery of potential bugs is welcome
# plz dm me on LisaMains server at Patatartiner#5916
# ===============================================
# NOTICE: rolls_cap is not enabled. TODO
MAX_ROLLS=5
dp_stat_order = ["ATKb", "ERb", "CRCDb"]
max_num_stats = len(dp_stat_order)
# ------------------------------------------------
# create max_dmg/max_config arrays for fast access
# ------------------------------------------------
dp_statlv = [[(0,None) for i in range(max_num_stats+1)]
for j in range(MAX_ROLLS+1)]
crcdlv = [(0, None) for j in range(MAX_ROLLS)]
# ------------------------------------------------
# ------------------------------------------------
# damage formulae
# ------------------------------------------------
def transformative_em_rolls_dmg(_rolls_em, _curr_stats):
return _rolls_em*2-3
def atk_rolls_dmg(_rolls_atk, _curr_stats):
return _rolls_atk*1.5
def er_rolls_dmg_multi(_rolls_er, _curr_stats):
# returns damage for most optimal playstyle
return _rolls_er+2
def crcd_rolls_dmg_calcd(_rolls, _curr_stats):
return crcdlv[_rolls][0]
def crcd_rolls_dmg(_rolls_cr, _rolls_cd, _curr_stats):
return (1-_rolls_cr)+(_rolls_cr)*(_rolls_cd)
stat_rolls_dmg = [atk_rolls_dmg, er_rolls_dmg_multi,
crcd_rolls_dmg_calcd]
# ------------------------------------------------
def artifact_optimizer_default(curr_stats,
roll_caps):
return artifact_optimizerv0(MAX_ROLLS,
curr_stats,
roll_caps)
def artifact_optimizerv0(n_rolls_total,
curr_stats,
roll_caps):
# fill out crcdlv
for i in range(n_rolls_total):
crcdlv[i] = third_level(i, curr_stats)
# fill out dp_statlv
second_level(n_rolls_total, curr_stats, 3)
# compute first level
best_dmg, best_dmg_config = first_level(n_rolls_total, curr_stats)
return (best_dmg, best_dmg_config)
def first_level(max_rolls,
curr_stats):
curr_max_dmg = 1
curr_max_config = None
for i in range(max_rolls):
other_dmg = dp_statlv[max_rolls-i][max_num_stats][0]
transf_dmg = transformative_em_rolls_dmg(i, curr_stats)
new_dmg = other_dmg + transf_dmg
if (curr_max_dmg < new_dmg):
curr_max_dmg = new_dmg
curr_max_config = i
return (curr_max_dmg, curr_max_config)
def print_dp_statlv():
for i in dp_statlv:
print(i)
def second_level(rolls_used, curr_stats,
num_calc_stats,
rolls_cap=None,
max_rolls=MAX_ROLLS):
print_dp_statlv()
ncs = num_calc_stats
stat_i = num_calc_stats - 1 # sorry indexing is weird
prev_calc = num_calc_stats - 1
tmp_stat_i_config = 0
print("rolls used ", rolls_used, " ncs ", ncs)
if (dp_statlv[rolls_used][ncs][1] is not None):
return dp_statlv[rolls_used][ncs]
curr_max_dmg = 1
curr_max_config = [0,0,0]
# base cases (1,[0,0,0])
if(num_calc_stats == 0): return (curr_max_dmg, curr_max_config)
if(rolls_used == 0): return (curr_max_dmg, curr_max_config)
for i in range(rolls_used):
stat_dmg, stat_config = second_level(rolls_used-i,
curr_stats,
prev_calc,
rolls_cap, max_rolls)
new_dmg = stat_dmg
new_dmg *= stat_rolls_dmg[stat_i](tmp_stat_i_config, curr_stats)
if (new_dmg > curr_max_dmg):
curr_max_dmg = new_dmg
curr_max_config = stat_config
curr_max_config[stat_i] = tmp_stat_i_config
tmp_stat_i_config += 1
dp_statlv[rolls_used][ncs] = (curr_max_dmg, curr_max_config)
return dp_statlv[rolls_used][ncs]
def third_level(rolls_used, curr_stats,
rolls_cap=None):
curr_max_dmg = 1
curr_max_config = None
for i in range(rolls_used):
new_dmg = crcd_rolls_dmg(i,rolls_used-i,curr_stats)
if (curr_max_dmg < new_dmg):
curr_max_dmg = new_dmg
curr_max_config = i
return (curr_max_dmg, curr_max_config)
| max_rolls = 5
dp_stat_order = ['ATKb', 'ERb', 'CRCDb']
max_num_stats = len(dp_stat_order)
dp_statlv = [[(0, None) for i in range(max_num_stats + 1)] for j in range(MAX_ROLLS + 1)]
crcdlv = [(0, None) for j in range(MAX_ROLLS)]
def transformative_em_rolls_dmg(_rolls_em, _curr_stats):
return _rolls_em * 2 - 3
def atk_rolls_dmg(_rolls_atk, _curr_stats):
return _rolls_atk * 1.5
def er_rolls_dmg_multi(_rolls_er, _curr_stats):
return _rolls_er + 2
def crcd_rolls_dmg_calcd(_rolls, _curr_stats):
return crcdlv[_rolls][0]
def crcd_rolls_dmg(_rolls_cr, _rolls_cd, _curr_stats):
return 1 - _rolls_cr + _rolls_cr * _rolls_cd
stat_rolls_dmg = [atk_rolls_dmg, er_rolls_dmg_multi, crcd_rolls_dmg_calcd]
def artifact_optimizer_default(curr_stats, roll_caps):
return artifact_optimizerv0(MAX_ROLLS, curr_stats, roll_caps)
def artifact_optimizerv0(n_rolls_total, curr_stats, roll_caps):
for i in range(n_rolls_total):
crcdlv[i] = third_level(i, curr_stats)
second_level(n_rolls_total, curr_stats, 3)
(best_dmg, best_dmg_config) = first_level(n_rolls_total, curr_stats)
return (best_dmg, best_dmg_config)
def first_level(max_rolls, curr_stats):
curr_max_dmg = 1
curr_max_config = None
for i in range(max_rolls):
other_dmg = dp_statlv[max_rolls - i][max_num_stats][0]
transf_dmg = transformative_em_rolls_dmg(i, curr_stats)
new_dmg = other_dmg + transf_dmg
if curr_max_dmg < new_dmg:
curr_max_dmg = new_dmg
curr_max_config = i
return (curr_max_dmg, curr_max_config)
def print_dp_statlv():
for i in dp_statlv:
print(i)
def second_level(rolls_used, curr_stats, num_calc_stats, rolls_cap=None, max_rolls=MAX_ROLLS):
print_dp_statlv()
ncs = num_calc_stats
stat_i = num_calc_stats - 1
prev_calc = num_calc_stats - 1
tmp_stat_i_config = 0
print('rolls used ', rolls_used, ' ncs ', ncs)
if dp_statlv[rolls_used][ncs][1] is not None:
return dp_statlv[rolls_used][ncs]
curr_max_dmg = 1
curr_max_config = [0, 0, 0]
if num_calc_stats == 0:
return (curr_max_dmg, curr_max_config)
if rolls_used == 0:
return (curr_max_dmg, curr_max_config)
for i in range(rolls_used):
(stat_dmg, stat_config) = second_level(rolls_used - i, curr_stats, prev_calc, rolls_cap, max_rolls)
new_dmg = stat_dmg
new_dmg *= stat_rolls_dmg[stat_i](tmp_stat_i_config, curr_stats)
if new_dmg > curr_max_dmg:
curr_max_dmg = new_dmg
curr_max_config = stat_config
curr_max_config[stat_i] = tmp_stat_i_config
tmp_stat_i_config += 1
dp_statlv[rolls_used][ncs] = (curr_max_dmg, curr_max_config)
return dp_statlv[rolls_used][ncs]
def third_level(rolls_used, curr_stats, rolls_cap=None):
curr_max_dmg = 1
curr_max_config = None
for i in range(rolls_used):
new_dmg = crcd_rolls_dmg(i, rolls_used - i, curr_stats)
if curr_max_dmg < new_dmg:
curr_max_dmg = new_dmg
curr_max_config = i
return (curr_max_dmg, curr_max_config) |
def fo1():
print('1')
print('2')
print('3')
def main():
fo1()
print('a')
print('b')
print('c')
main() | def fo1():
print('1')
print('2')
print('3')
def main():
fo1()
print('a')
print('b')
print('c')
main() |
#!/usr/bin/python3
def solve(input_fname):
lines = []
pos = depth = aim = 0
with open(input_fname) as ifile:
for line in ifile:
lines.append(line.strip().split())
for cmd, unit in lines:
unit = int(unit)
if cmd == "forward":
pos += unit
depth += aim * unit
elif cmd == "up":
aim -= unit
elif cmd == "down":
aim += unit
return pos * depth
if __name__ == "__main__":
print(solve("../inputs/day2-demo.in"))
| def solve(input_fname):
lines = []
pos = depth = aim = 0
with open(input_fname) as ifile:
for line in ifile:
lines.append(line.strip().split())
for (cmd, unit) in lines:
unit = int(unit)
if cmd == 'forward':
pos += unit
depth += aim * unit
elif cmd == 'up':
aim -= unit
elif cmd == 'down':
aim += unit
return pos * depth
if __name__ == '__main__':
print(solve('../inputs/day2-demo.in')) |
{
"files.associations": {
"**/*.html": "html",
"**/templates/**/*.html": "django-html",
"**/templates/**/*": "django-txt",
"**/requirements{/**,*}.{txt,in}": "pip-requirements"
},
"emmet.includeLanguages": {
"django-html": "html"
},
"python.pythonPath": "/usr/local/bin/python3"
}
| {'files.associations': {'**/*.html': 'html', '**/templates/**/*.html': 'django-html', '**/templates/**/*': 'django-txt', '**/requirements{/**,*}.{txt,in}': 'pip-requirements'}, 'emmet.includeLanguages': {'django-html': 'html'}, 'python.pythonPath': '/usr/local/bin/python3'} |
class DevConfig(object):
DEBUG = True
SQLALCHEMY_DATABASE_URI = 'sqlite:////tmp/octocd'
SQLALCHEMY_TRACK_MODIFICATIONS = False
SECRET_KEY = 'DEV_KEY'
| class Devconfig(object):
debug = True
sqlalchemy_database_uri = 'sqlite:////tmp/octocd'
sqlalchemy_track_modifications = False
secret_key = 'DEV_KEY' |
class Education:
def __init__(self, school, time, title, desc):
self.school = school
self.time = time
self.title = title
self.desc = desc | class Education:
def __init__(self, school, time, title, desc):
self.school = school
self.time = time
self.title = title
self.desc = desc |
'''
## The PyLCONF
A LCONF parser and emitter for Python.
### Web Presence
* PyLCONF [web site](http://lconf-data-serialization-format.github.io/PyLCONF/)
* PyLCONF [github repository](https://github.com/LCONF-Data-Serialization-Format/PyLCONF/)
### Copyrights & Licenses
The *PyLCONF package* is licensed under the MIT "Expat" License:
> Copyright (c) 2014 - 2015, **peter1000** <https://github.com/peter1000>.
'''
__version__ = '0.1.0'
__project_name__ = 'PyLCONF'
__title__ = 'A LCONF parser and emitter for Python.'
__author__ = '**peter1000** https://github.com/peter1000'
__copyright__ = 'Copyright (c) 2014 - 2015, ' + __author__
__license__ = 'MIT "Expat" license: Consult LICENSE.md'
| """
## The PyLCONF
A LCONF parser and emitter for Python.
### Web Presence
* PyLCONF [web site](http://lconf-data-serialization-format.github.io/PyLCONF/)
* PyLCONF [github repository](https://github.com/LCONF-Data-Serialization-Format/PyLCONF/)
### Copyrights & Licenses
The *PyLCONF package* is licensed under the MIT "Expat" License:
> Copyright (c) 2014 - 2015, **peter1000** <https://github.com/peter1000>.
"""
__version__ = '0.1.0'
__project_name__ = 'PyLCONF'
__title__ = 'A LCONF parser and emitter for Python.'
__author__ = '**peter1000** https://github.com/peter1000'
__copyright__ = 'Copyright (c) 2014 - 2015, ' + __author__
__license__ = 'MIT "Expat" license: Consult LICENSE.md' |
#!/usr/bin/env python3
class FilterMiddleware(object):
def __init__(self, wsgi_app):
self.wsgi_app = wsgi_app
self.blacklist = ["sqlmap", "dirbuster"]
def __call__(self, environ, start_response):
try:
if any((x for x in self.blacklist if x in environ["HTTP_USER_AGENT"].lower())):
start_response("503 Internal Server Error", [])
return [b"Something went wrong."]
except KeyError:
pass
return None
| class Filtermiddleware(object):
def __init__(self, wsgi_app):
self.wsgi_app = wsgi_app
self.blacklist = ['sqlmap', 'dirbuster']
def __call__(self, environ, start_response):
try:
if any((x for x in self.blacklist if x in environ['HTTP_USER_AGENT'].lower())):
start_response('503 Internal Server Error', [])
return [b'Something went wrong.']
except KeyError:
pass
return None |
w, b = input().split()
w = int(w)
b = float(b)
if (w % 5 == 0 and b>(w+.5)):
b = b - w - 0.5
print('%.2f' % b)
else:
print('%.2f' % b) | (w, b) = input().split()
w = int(w)
b = float(b)
if w % 5 == 0 and b > w + 0.5:
b = b - w - 0.5
print('%.2f' % b)
else:
print('%.2f' % b) |
def valid_card(card):
return (
not sum(
[
d if i & 1 else d % 5 * 2 + d / 5
for i, d in enumerate(map(int, card.replace(" ", "")))
]
)
% 10
)
| def valid_card(card):
return not sum([d if i & 1 else d % 5 * 2 + d / 5 for (i, d) in enumerate(map(int, card.replace(' ', '')))]) % 10 |
def XPLMFindCommand(command):
return 1
def XPLMCommandOnce(commandID):
pass
| def xplm_find_command(command):
return 1
def xplm_command_once(commandID):
pass |
SERVICE_KPI_HOOK = (u"kpi_hook", u"KPI Hook POST")
SERVICE_CHOICES = (
SERVICE_KPI_HOOK,
)
default_app_config = "onadata.apps.restservice.app.RestServiceConfig"
| service_kpi_hook = (u'kpi_hook', u'KPI Hook POST')
service_choices = (SERVICE_KPI_HOOK,)
default_app_config = 'onadata.apps.restservice.app.RestServiceConfig' |
# ---- ratings ----
urlpatterns += patterns('',
(r'^ratings/', include('ratings.urls')),
) | urlpatterns += patterns('', ('^ratings/', include('ratings.urls'))) |
# Total Purchase
# Simple Regsiter Program
print("In the fields below, enter the prices of five items")
totalAmount = float(input("What is the price of the first item? "))
totalAmount += float(input("What is the price of the second item? "))
totalAmount += float(input("What is the price of the third item? "))
totalAmount += float(input("What is the price of the fourth item? "))
totalAmount += float(input("What is the price of the fifth item? "))
print()
salesTax = totalAmount * .07
print(f'The sales tax is ${salesTax:,.2f}')
print(f'The total is ${salesTax + totalAmount:,.2f}') | print('In the fields below, enter the prices of five items')
total_amount = float(input('What is the price of the first item? '))
total_amount += float(input('What is the price of the second item? '))
total_amount += float(input('What is the price of the third item? '))
total_amount += float(input('What is the price of the fourth item? '))
total_amount += float(input('What is the price of the fifth item? '))
print()
sales_tax = totalAmount * 0.07
print(f'The sales tax is ${salesTax:,.2f}')
print(f'The total is ${salesTax + totalAmount:,.2f}') |
n = int(input())
ans = n//4*"abcd"
if n%4==1:
ans += "a"
elif n%4==2:
ans += "ab"
elif n%4==3:
ans += "abc"
print(ans)
| n = int(input())
ans = n // 4 * 'abcd'
if n % 4 == 1:
ans += 'a'
elif n % 4 == 2:
ans += 'ab'
elif n % 4 == 3:
ans += 'abc'
print(ans) |
# Trigger: com.android.internal.telephony.gsm.GSMPhone.handleMessage(Landroid/os/Message;)V
# Callback: android.content.Context.sendOrderedBroadcast(Landroid/content/Intent;Ljava/lang/String;ILandroid/content/BroadcastReceiver;Landroid/os/Handler;ILjava/lang/String;Landroid/os/Bundle;)V
IFAv0 = Int('IFAv0') # <Input1>.what
s.add((IFAv0 == 16))
| if_av0 = int('IFAv0')
s.add(IFAv0 == 16) |
LOGFILE = '/tmp/robots.log'
def log(msg):
with open(LOGFILE, 'a') as f:
f.write(str(msg)+'\n')
| logfile = '/tmp/robots.log'
def log(msg):
with open(LOGFILE, 'a') as f:
f.write(str(msg) + '\n') |
## Beginner Series #2 Clock
## 8 kyu
## https://www.codewars.com/kata/55f9bca8ecaa9eac7100004a
def past(h, m, s):
hours = h * 60 * 60 * 1000
minutes = m * 60 * 1000
seconds = s * 1000
return hours + minutes + seconds
| def past(h, m, s):
hours = h * 60 * 60 * 1000
minutes = m * 60 * 1000
seconds = s * 1000
return hours + minutes + seconds |
miles = 1000.0 # A floating point
name = "John" # A string
print(miles)
print(name)
| miles = 1000.0
name = 'John'
print(miles)
print(name) |
class ScriptPlatformScriptGen:
def __init__(self):
pass
def GenerateScriptStart(self):
Script = "var layers = null;\r\n"
Script += "var filePath = activeDocument.fullName.path;\r\n"
Script += "var newDoc = app.activeDocument.duplicate();\r\n"
Script += "app.activeDocument = newDoc;\r\n"
#Script += "app.activeDocument.bringToFront();\r\n"
Script += 'var idCnvM = charIDToTypeID( "CnvM" );' + "\n"
Script += 'var desc89 = new ActionDescriptor();' + "\n"
Script += 'var idT = charIDToTypeID( "T " );' + "\n"
Script += 'var idRGBM = charIDToTypeID( "RGBM" );' + "\n"
Script += 'desc89.putClass( idT, idRGBM );' + "\n"
Script += 'var idMrge = charIDToTypeID( "Mrge" );' + "\n"
Script += 'desc89.putBoolean( idMrge, false );' + "\n"
Script += 'var idRstr = charIDToTypeID( "Rstr" );' + "\n"
Script += 'desc89.putBoolean( idRstr, false );' + "\n"
Script += 'executeAction( idCnvM, desc89, DialogModes.NO );' + "\n"
return Script
def GenerateCardEnd(self, sheet, row):
Script = '// Save Image' + "\r\n"
Script += 'pngOptions = new PNGSaveOptions();' + "\r\n"
Script += 'pngOptions.compression = 0;' + "\r\n"
Script += 'pngOptions.interlaced = false;' + "\r\n"
Script += '' + "\r\n"
Script += 'savePath = File(filePath + "/' + sheet.cell_value(row,0).replace(".","") + '.png");' + "\r\n"
Script += '' + "\r\n"
Script += 'app.activeDocument.saveAs(savePath, pngOptions, true, Extension.LOWERCASE);' + "\r\n"
Script += '' + "\r\n"
return Script
def GenerateScriptEnd(self):
return "app.activeDocument.close(SaveOptions.DONOTSAVECHANGES);\r\n"
| class Scriptplatformscriptgen:
def __init__(self):
pass
def generate_script_start(self):
script = 'var layers = null;\r\n'
script += 'var filePath = activeDocument.fullName.path;\r\n'
script += 'var newDoc = app.activeDocument.duplicate();\r\n'
script += 'app.activeDocument = newDoc;\r\n'
script += 'var idCnvM = charIDToTypeID( "CnvM" );' + '\n'
script += 'var desc89 = new ActionDescriptor();' + '\n'
script += 'var idT = charIDToTypeID( "T " );' + '\n'
script += 'var idRGBM = charIDToTypeID( "RGBM" );' + '\n'
script += 'desc89.putClass( idT, idRGBM );' + '\n'
script += 'var idMrge = charIDToTypeID( "Mrge" );' + '\n'
script += 'desc89.putBoolean( idMrge, false );' + '\n'
script += 'var idRstr = charIDToTypeID( "Rstr" );' + '\n'
script += 'desc89.putBoolean( idRstr, false );' + '\n'
script += 'executeAction( idCnvM, desc89, DialogModes.NO );' + '\n'
return Script
def generate_card_end(self, sheet, row):
script = '// Save Image' + '\r\n'
script += 'pngOptions = new PNGSaveOptions();' + '\r\n'
script += 'pngOptions.compression = 0;' + '\r\n'
script += 'pngOptions.interlaced = false;' + '\r\n'
script += '' + '\r\n'
script += 'savePath = File(filePath + "/' + sheet.cell_value(row, 0).replace('.', '') + '.png");' + '\r\n'
script += '' + '\r\n'
script += 'app.activeDocument.saveAs(savePath, pngOptions, true, Extension.LOWERCASE);' + '\r\n'
script += '' + '\r\n'
return Script
def generate_script_end(self):
return 'app.activeDocument.close(SaveOptions.DONOTSAVECHANGES);\r\n' |
class MyClass:
pass
var: [MyClass] = MyClass() | class Myclass:
pass
var: [MyClass] = my_class() |
## Get the mean of an array
## 8 kyu
## https://www.codewars.com/kata/563e320cee5dddcf77000158
def get_average(marks):
return sum(marks) // len(marks)
| def get_average(marks):
return sum(marks) // len(marks) |
def main():
s=[]
minlen = 257
n=int(input())
for i in range(n):
s.append(list(input()))
s[i].reverse()
if len(s[i])<minlen: minlen = len(s[i])
kuchiguse = 0
nai = False
for i in range(minlen):
same = True
for j in range(1,n):
if s[j][i] != s[0][i]:
same = False
break
if(same): kuchiguse += 1
else: break
if kuchiguse:
print(''.join(s[0][kuchiguse-1::-1]))
else:
print('nai')
main() | def main():
s = []
minlen = 257
n = int(input())
for i in range(n):
s.append(list(input()))
s[i].reverse()
if len(s[i]) < minlen:
minlen = len(s[i])
kuchiguse = 0
nai = False
for i in range(minlen):
same = True
for j in range(1, n):
if s[j][i] != s[0][i]:
same = False
break
if same:
kuchiguse += 1
else:
break
if kuchiguse:
print(''.join(s[0][kuchiguse - 1::-1]))
else:
print('nai')
main() |
lorem_file = open("lorem.txt")
for line in lorem_file:
print(line.rstrip())
lorem_file.close()
| lorem_file = open('lorem.txt')
for line in lorem_file:
print(line.rstrip())
lorem_file.close() |
class Articles:
'''
articles class to define article objects
'''
def __init__(self,id,author,description,url,urlToImage,publishedAt,content):
self.id = id
self.author = author
self.description = description
self.url = url
self.urlToImage = urlToImage
self.publishedAt = publishedAt
self.content = content
class News:
'''
News class to define news objects
'''
def __init__(self,id,name,description,url,category,country):
self.id = id
self.name = name
self.description = description
self.url = "https://www.youtube.com/watch?v=RN75zSpYp7M"+ url
self.category = category
self.country = country | class Articles:
"""
articles class to define article objects
"""
def __init__(self, id, author, description, url, urlToImage, publishedAt, content):
self.id = id
self.author = author
self.description = description
self.url = url
self.urlToImage = urlToImage
self.publishedAt = publishedAt
self.content = content
class News:
"""
News class to define news objects
"""
def __init__(self, id, name, description, url, category, country):
self.id = id
self.name = name
self.description = description
self.url = 'https://www.youtube.com/watch?v=RN75zSpYp7M' + url
self.category = category
self.country = country |
#Activity 9
def factorial(n):
f = 1
for i in range (1, n + 1):
f = f * i
return f
def pascal(n):
for i in range (n):
for j in range (1, n - i):
print(" ", end = '')
for k in range (0, i + 1):
c = int(factorial(i) / (factorial(k) * factorial(i-k)))
print(" ", c, end = "")
print()
n=int(input("Enter the number of rows: "))
pascal(n) | def factorial(n):
f = 1
for i in range(1, n + 1):
f = f * i
return f
def pascal(n):
for i in range(n):
for j in range(1, n - i):
print(' ', end='')
for k in range(0, i + 1):
c = int(factorial(i) / (factorial(k) * factorial(i - k)))
print(' ', c, end='')
print()
n = int(input('Enter the number of rows: '))
pascal(n) |
#!/usr/bin/env python
# coding: utf-8
# In[2]:
for i in range(0, 6):
if i == 3:
print("skip 3")
continue
print(i)
# In[3]:
for i in range(0, 6):
if i == 3:
print("skip 3")
break
print(i)
| for i in range(0, 6):
if i == 3:
print('skip 3')
continue
print(i)
for i in range(0, 6):
if i == 3:
print('skip 3')
break
print(i) |
# Copyright (c) 2012 The Chromium Authors. All rights reserved.
# Use of this source code is governed by a BSD-style license that can be
# found in the LICENSE file.
{
'conditions': [
['OS=="android"', {
'targets': [
{
'target_name': 'native_test_apk',
'message': 'building native test apk',
'type': 'none',
'dependencies': [
'native_test_native_code',
],
'actions': [
{
'action_name': 'native_test_apk',
'inputs': [
'<(DEPTH)/testing/android/native_test_apk.xml',
'<!@(find <(DEPTH)/testing/android -name "*.java")',
'native_test_launcher.cc'
],
'outputs': [
# Awkwardly, we build a Debug APK even when gyp is in
# Release mode. I don't think it matters (e.g. we're
# probably happy to not codesign) but naming should be
# fixed. The -debug name is an aspect of the android
# SDK antfiles (e.g. ${sdk.dir}/tools/ant/build.xml)
'<(PRODUCT_DIR)/ChromeNativeTests-debug.apk',
],
'action': [
'ant',
'-DPRODUCT_DIR=<(ant_build_out)',
'-buildfile',
'<(DEPTH)/testing/android/native_test_apk.xml',
]
}
],
},
{
'target_name': 'native_test_native_code',
'message': 'building native pieces of native test package',
'type': 'static_library',
'sources': [
'native_test_launcher.cc',
],
'direct_dependent_settings': {
'ldflags!': [
# JNI_OnLoad is implemented in a .a and we need to
# re-export in the .so.
'-Wl,--exclude-libs=ALL',
],
},
'dependencies': [
'../../base/base.gyp:base',
'../../base/base.gyp:test_support_base',
'../gtest.gyp:gtest',
'native_test_jni_headers',
],
},
{
'target_name': 'native_test_jni_headers',
'type': 'none',
'actions': [
{
'action_name': 'generate_jni_headers',
'inputs': [
'../../base/android/jni_generator/jni_generator.py',
'java/src/org/chromium/native_test/ChromeNativeTestActivity.java'
],
'outputs': [
'<(SHARED_INTERMEDIATE_DIR)/testing/android/jni/'
'chrome_native_test_activity_jni.h',
],
'action': [
'python',
'../../base/android/jni_generator/jni_generator.py',
'-o',
'<@(_inputs)',
'<@(_outputs)',
],
}
],
# So generated jni headers can be found by targets that
# depend on this.
'direct_dependent_settings': {
'include_dirs': [
'<(SHARED_INTERMEDIATE_DIR)',
],
},
},
],
}]
],
}
| {'conditions': [['OS=="android"', {'targets': [{'target_name': 'native_test_apk', 'message': 'building native test apk', 'type': 'none', 'dependencies': ['native_test_native_code'], 'actions': [{'action_name': 'native_test_apk', 'inputs': ['<(DEPTH)/testing/android/native_test_apk.xml', '<!@(find <(DEPTH)/testing/android -name "*.java")', 'native_test_launcher.cc'], 'outputs': ['<(PRODUCT_DIR)/ChromeNativeTests-debug.apk'], 'action': ['ant', '-DPRODUCT_DIR=<(ant_build_out)', '-buildfile', '<(DEPTH)/testing/android/native_test_apk.xml']}]}, {'target_name': 'native_test_native_code', 'message': 'building native pieces of native test package', 'type': 'static_library', 'sources': ['native_test_launcher.cc'], 'direct_dependent_settings': {'ldflags!': ['-Wl,--exclude-libs=ALL']}, 'dependencies': ['../../base/base.gyp:base', '../../base/base.gyp:test_support_base', '../gtest.gyp:gtest', 'native_test_jni_headers']}, {'target_name': 'native_test_jni_headers', 'type': 'none', 'actions': [{'action_name': 'generate_jni_headers', 'inputs': ['../../base/android/jni_generator/jni_generator.py', 'java/src/org/chromium/native_test/ChromeNativeTestActivity.java'], 'outputs': ['<(SHARED_INTERMEDIATE_DIR)/testing/android/jni/chrome_native_test_activity_jni.h'], 'action': ['python', '../../base/android/jni_generator/jni_generator.py', '-o', '<@(_inputs)', '<@(_outputs)']}], 'direct_dependent_settings': {'include_dirs': ['<(SHARED_INTERMEDIATE_DIR)']}}]}]]} |
def declarations(declaration):
if len(declaration[2][0]) > 1:
string = '%s _%s[%s];\n' %(
declaration[3][0],
declaration[0],
']['.join([
str(int(ranges[2]) - int(ranges[1]) + 1)
for ranges in declaration[2]
if len(ranges) > 1
])
)
string += '%s __%s(void) {\n' %(
declaration[3][0],
declaration[0]
)
count = 1
for nested in range(len(declaration[2])):
if len(declaration[2][nested]) > 1:
string += '%sfor(int %s = 0; %s < %s; ++%s)\n' %(
'\t' + '\t' * nested,
declaration[1][nested],
declaration[1][nested],
str(int(declaration[2][nested][2]) - int(declaration[2][nested][1]) + 1),
declaration[1][nested]
)
count += 1
string += '%s_%s[%s] = %s;\n\treturn %s;\n}\n%s ___%s = __%s();\n' %(
'\t' * count,
declaration[0],
']['.join([
datatypes
for datatypes, ranges in zip(declaration[1], declaration[2])
if len(ranges) > 1
]),
declaration[3][1],
declaration[3][1],
declaration[3][0],
declaration[0],
declaration[0]
)
string += '%s %s(%s) {\n\tif(_%s[%s] != %s)\n\t\treturn _%s[%s];\n' %(
declaration[3][0],
declaration[0],
', '.join([
ranges[0] + ' ' + datatypes
for ranges, datatypes in zip(declaration[2], declaration[1])
]),
declaration[0],
']['.join([
datatypes
for datatypes, ranges in zip(declaration[1], declaration[2])
if len(ranges) > 1
]),
declaration[3][1],
declaration[0],
']['.join([
datatypes
for datatypes, ranges in zip(declaration[1], declaration[2])
if len(ranges) > 1
])
)
else:
string = '%s %s(%s) {\n' %(
declaration[3][0],
declaration[0],
','.join([
ranges[0] + ' ' + datatypes
for ranges, datatypes in zip(declaration[2], declaration[1])
])
)
return string
def definitions(definition, declaration):
if len(declaration[2][0]) > 1:
string = '_%s[%s] = %s;\nreturn _%s[%s];\n' %(
declaration[0],
']['.join([
datatypes
for datatypes, ranges in zip(declaration[1], declaration[2])
if len(ranges) > 1
]),
definition[0].strip(),
declaration[0],
']['.join([
datatypes
for datatypes, ranges in zip(declaration[1], declaration[2])
if len(ranges) > 1
])
)
else:
string = 'return %s;\n' %(definition[0].strip())
return string
def iterations(iteration):
string = 'for(int %s = %s; %s %s %s; %s %s= %s) {\n' %(
iteration[0],
iteration[1].strip(),
iteration[0],
'<=' if iteration[3] == '+' else '>=',
iteration[2].strip(),
iteration[0],
iteration[3],
'1' if len(iteration) == 4 else iteration[4]
)
return string
def inquisitions(inquisition):
string = 'if(%s) {\n' %(
inquisition[0]
)
return string
def statements(statement):
string = '%s;\n' %(';\n'.join([line.strip() for line in statement[0].split(';') if line.strip()]))
return string
def blanks(blank):
string = '}\n'
return string
def programs(program):
scope = list()
metaprogram = str()
declaration = None
for line in program:
if line[0][0] == 'blanks':
while scope:
scope.pop()
metaprogram += '\t' * len(scope) + '\t' + blanks(None)
metaprogram += '\t' * len(scope) + blanks(None)
declaration = None
continue
i = 0
while i < len(scope) and i < len(line):
if scope[i] != line[i]:
break
i += 1
for j in range(i, len(scope)):
scope.pop()
metaprogram += '\t' * len(scope) + '\t' + blanks(None)
for j in range(i, len(line)):
if line[j][0] == 'declarations':
metaprogram += declarations(line[j][2])
declaration = line[j][2]
if line[j][0] == 'definitions':
metaprogram += ('\n').join(['\t' * len(scope) + '\t' + string for string in definitions(line[j][2], declaration).split('\n') if string]) + '\n'
if line[j][0] == 'iterations':
scope.append(line[j])
metaprogram += '\t' * len(scope) + iterations(line[j][2])
if line[j][0] == 'statements':
if j == len(line) - 1:
metaprogram += '\t' * len(scope) + '\t' + statements(line[j][2])
else:
scope.append(line[j])
metaprogram += '\t' * len(scope) + inquisitions(line[j][2])
return metaprogram
| def declarations(declaration):
if len(declaration[2][0]) > 1:
string = '%s _%s[%s];\n' % (declaration[3][0], declaration[0], ']['.join([str(int(ranges[2]) - int(ranges[1]) + 1) for ranges in declaration[2] if len(ranges) > 1]))
string += '%s __%s(void) {\n' % (declaration[3][0], declaration[0])
count = 1
for nested in range(len(declaration[2])):
if len(declaration[2][nested]) > 1:
string += '%sfor(int %s = 0; %s < %s; ++%s)\n' % ('\t' + '\t' * nested, declaration[1][nested], declaration[1][nested], str(int(declaration[2][nested][2]) - int(declaration[2][nested][1]) + 1), declaration[1][nested])
count += 1
string += '%s_%s[%s] = %s;\n\treturn %s;\n}\n%s ___%s = __%s();\n' % ('\t' * count, declaration[0], ']['.join([datatypes for (datatypes, ranges) in zip(declaration[1], declaration[2]) if len(ranges) > 1]), declaration[3][1], declaration[3][1], declaration[3][0], declaration[0], declaration[0])
string += '%s %s(%s) {\n\tif(_%s[%s] != %s)\n\t\treturn _%s[%s];\n' % (declaration[3][0], declaration[0], ', '.join([ranges[0] + ' ' + datatypes for (ranges, datatypes) in zip(declaration[2], declaration[1])]), declaration[0], ']['.join([datatypes for (datatypes, ranges) in zip(declaration[1], declaration[2]) if len(ranges) > 1]), declaration[3][1], declaration[0], ']['.join([datatypes for (datatypes, ranges) in zip(declaration[1], declaration[2]) if len(ranges) > 1]))
else:
string = '%s %s(%s) {\n' % (declaration[3][0], declaration[0], ','.join([ranges[0] + ' ' + datatypes for (ranges, datatypes) in zip(declaration[2], declaration[1])]))
return string
def definitions(definition, declaration):
if len(declaration[2][0]) > 1:
string = '_%s[%s] = %s;\nreturn _%s[%s];\n' % (declaration[0], ']['.join([datatypes for (datatypes, ranges) in zip(declaration[1], declaration[2]) if len(ranges) > 1]), definition[0].strip(), declaration[0], ']['.join([datatypes for (datatypes, ranges) in zip(declaration[1], declaration[2]) if len(ranges) > 1]))
else:
string = 'return %s;\n' % definition[0].strip()
return string
def iterations(iteration):
string = 'for(int %s = %s; %s %s %s; %s %s= %s) {\n' % (iteration[0], iteration[1].strip(), iteration[0], '<=' if iteration[3] == '+' else '>=', iteration[2].strip(), iteration[0], iteration[3], '1' if len(iteration) == 4 else iteration[4])
return string
def inquisitions(inquisition):
string = 'if(%s) {\n' % inquisition[0]
return string
def statements(statement):
string = '%s;\n' % ';\n'.join([line.strip() for line in statement[0].split(';') if line.strip()])
return string
def blanks(blank):
string = '}\n'
return string
def programs(program):
scope = list()
metaprogram = str()
declaration = None
for line in program:
if line[0][0] == 'blanks':
while scope:
scope.pop()
metaprogram += '\t' * len(scope) + '\t' + blanks(None)
metaprogram += '\t' * len(scope) + blanks(None)
declaration = None
continue
i = 0
while i < len(scope) and i < len(line):
if scope[i] != line[i]:
break
i += 1
for j in range(i, len(scope)):
scope.pop()
metaprogram += '\t' * len(scope) + '\t' + blanks(None)
for j in range(i, len(line)):
if line[j][0] == 'declarations':
metaprogram += declarations(line[j][2])
declaration = line[j][2]
if line[j][0] == 'definitions':
metaprogram += '\n'.join(['\t' * len(scope) + '\t' + string for string in definitions(line[j][2], declaration).split('\n') if string]) + '\n'
if line[j][0] == 'iterations':
scope.append(line[j])
metaprogram += '\t' * len(scope) + iterations(line[j][2])
if line[j][0] == 'statements':
if j == len(line) - 1:
metaprogram += '\t' * len(scope) + '\t' + statements(line[j][2])
else:
scope.append(line[j])
metaprogram += '\t' * len(scope) + inquisitions(line[j][2])
return metaprogram |
class RainyRoad:
def isReachable(self, road):
for i, j in zip(*road):
if i == j == 'W':
return 'NO'
return 'YES'
| class Rainyroad:
def is_reachable(self, road):
for (i, j) in zip(*road):
if i == j == 'W':
return 'NO'
return 'YES' |
data_path = '../data'
app_path = '../web-app'
naics_dict = {
'11': 'Agriculture, Forestry, Fishing, and Hunting',
'21': 'Mining, Quarrying, and Oil and Gas Extraction',
'22': 'Utilities',
'23': 'Construction',
'31': 'Manufacturing',
'32': 'Manufacturing',
'33': 'Manufacturing',
'42': 'Wholesale Trade',
'44': 'Retail Trade',
'45': 'Retail Trade',
'48': 'Transportation and Warehousing',
'49': 'Transportation and Warehousing',
'51': 'Information',
'52': 'Finance and Insurance',
'53': 'Real Estate Rental and Leasing',
'54': 'Professional, Scientific, and Technical Services',
'55': 'Management of Companies and Enterprises',
'56': 'Administrative and Support and Waste Management and Remediation Services',
'61': 'Educational services',
'62': 'Health Care and Social Assistance',
'71': 'Arts, Entertainment, and Recreation',
'72': 'Accommodation and Food Services',
'81': 'Other Services (except Public Administration)',
'92': 'Public Administration'
}
# Party affiliatoin of state governor, as of April 2019
# https://en.wikipedia.org/wiki/List_of_United_States_governors
gov_dict = {
'AL': 'R',
'AK': 'R',
'AZ': 'R',
'AR': 'R',
'CA': 'D',
'CO': 'D',
'CT': 'D',
'DE': 'D',
'FL': 'R',
'GA': 'R',
'HI': 'D',
'ID': 'R',
'IL': 'D',
'IN': 'R',
'IA': 'R',
'KS': 'D',
'KY': 'R',
'LA': 'D',
'ME': 'D',
'MD': 'R',
'MA': 'R',
'MI': 'D',
'MN': 'D',
'MS': 'R',
'MO': 'R',
'MT': 'D',
'NB': 'R',
'NV': 'D',
'NH': 'R',
'NJ': 'D',
'NM': 'D',
'NY': 'D',
'NC': 'D',
'ND': 'R',
'OH': 'R',
'OK': 'R',
'OR': 'D',
'PA': 'D',
'RI': 'D',
'SC': 'R',
'SD': 'R',
'TN': 'R',
'TX': 'R',
'UT': 'R',
'VT': 'R',
'VA': 'D',
'WA': 'D',
'WV': 'R',
'WI': 'D',
'WY': 'R',
'PR': 'NP',
}
#naics_dict = {
# '11': 'Agriculture, Forestry, Fishing, and Hunting',
# '2111': 'Oil and Gas Extraction',
# '2121': 'Coal Mining',
# '2122': 'Metal Ore Mining',
# '2123': 'Nonmetallic Mineral Mining and Quarrying',
# '2131': 'Support Activities for Mining',
# '2211': 'Electric Power Generation, Transmission, and Distribution',
# '2212': 'Natural Gas Distribution',
# '2213': 'Water, Sewage, and Other Systems',
# '23': 'Construction',
# '31': 'Manufacturing',
# '32': 'Manufacturing',
# '33': 'Manufacturing',
# '42': 'Wholesale Trade',
# '44': 'Retail Trade',
# '45': 'Retail Trade',
# '48': 'Transportation and Warehousing',
# '4862': 'Pipeline Transportation of Oil or Natural Gas',
# '49': 'Transportation and Warehousing',
# '51': 'Information',
# '52': 'Finance and Insurance',
# '53': 'Real Estate Rental and Leasing',
# '54': 'Professional, Scientific, and Technical Services',
# '55': 'Management of Companies and Enterprises',
# '56': 'Administrative and Support and Waste Management and Remediation Services',
# '61': 'Educational services',
# '62': 'Health Care and Social Assistance',
# '71': 'Arts, Entertainment, and Recreation',
# '72': 'Accommodation and Food Services',
# '81': 'Other Services (except Public Administration)',
# '92': 'Public Administration'
#} | data_path = '../data'
app_path = '../web-app'
naics_dict = {'11': 'Agriculture, Forestry, Fishing, and Hunting', '21': 'Mining, Quarrying, and Oil and Gas Extraction', '22': 'Utilities', '23': 'Construction', '31': 'Manufacturing', '32': 'Manufacturing', '33': 'Manufacturing', '42': 'Wholesale Trade', '44': 'Retail Trade', '45': 'Retail Trade', '48': 'Transportation and Warehousing', '49': 'Transportation and Warehousing', '51': 'Information', '52': 'Finance and Insurance', '53': 'Real Estate Rental and Leasing', '54': 'Professional, Scientific, and Technical Services', '55': 'Management of Companies and Enterprises', '56': 'Administrative and Support and Waste Management and Remediation Services', '61': 'Educational services', '62': 'Health Care and Social Assistance', '71': 'Arts, Entertainment, and Recreation', '72': 'Accommodation and Food Services', '81': 'Other Services (except Public Administration)', '92': 'Public Administration'}
gov_dict = {'AL': 'R', 'AK': 'R', 'AZ': 'R', 'AR': 'R', 'CA': 'D', 'CO': 'D', 'CT': 'D', 'DE': 'D', 'FL': 'R', 'GA': 'R', 'HI': 'D', 'ID': 'R', 'IL': 'D', 'IN': 'R', 'IA': 'R', 'KS': 'D', 'KY': 'R', 'LA': 'D', 'ME': 'D', 'MD': 'R', 'MA': 'R', 'MI': 'D', 'MN': 'D', 'MS': 'R', 'MO': 'R', 'MT': 'D', 'NB': 'R', 'NV': 'D', 'NH': 'R', 'NJ': 'D', 'NM': 'D', 'NY': 'D', 'NC': 'D', 'ND': 'R', 'OH': 'R', 'OK': 'R', 'OR': 'D', 'PA': 'D', 'RI': 'D', 'SC': 'R', 'SD': 'R', 'TN': 'R', 'TX': 'R', 'UT': 'R', 'VT': 'R', 'VA': 'D', 'WA': 'D', 'WV': 'R', 'WI': 'D', 'WY': 'R', 'PR': 'NP'} |
sample_sizes = [100, 500, 1000, 5000, 10000, 15000, y.size]
scores_sample_sizes = {}
rng = np.random.RandomState(0)
for n_samples in sample_sizes:
sample_idx = rng.choice(
np.arange(y.size), size=n_samples, replace=False
)
X_sampled, y_sampled = X.iloc[sample_idx], y[sample_idx]
size, score = make_cv_analysis(regressor, X_sampled, y_sampled)
scores_sample_sizes[size] = score
scores_sample_sizes = pd.DataFrame(scores_sample_sizes)
sns.displot(scores_sample_sizes, kind="kde")
plt.xlim([10, 90])
_ = plt.xlabel("Mean absolute error (k$)")
| sample_sizes = [100, 500, 1000, 5000, 10000, 15000, y.size]
scores_sample_sizes = {}
rng = np.random.RandomState(0)
for n_samples in sample_sizes:
sample_idx = rng.choice(np.arange(y.size), size=n_samples, replace=False)
(x_sampled, y_sampled) = (X.iloc[sample_idx], y[sample_idx])
(size, score) = make_cv_analysis(regressor, X_sampled, y_sampled)
scores_sample_sizes[size] = score
scores_sample_sizes = pd.DataFrame(scores_sample_sizes)
sns.displot(scores_sample_sizes, kind='kde')
plt.xlim([10, 90])
_ = plt.xlabel('Mean absolute error (k$)') |
'''Given: A DNA string s
s
of length at most 1000 nt.
Return: Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s
'''
s = 'AGACTCGCGCACTCACGATGAATCCCAAGACAGCCTGGCGGAGTATGGTACTACGGCCGTCCTCACCAAGGCATTTCGGTCCGAGTAGCGGATTGTGTGCCAGCCCTGAGGGCGAGTTATGGGCTCATTCGGGAGACGTATGTACGAGCCTGATCGTTCGTCTGCATCGCTCTAATGTTTATCGACAGCCTTACCACTGTTTGAGTCGATGCAAGACCTGTTTCTTCAGCGCATTCACAGAGTGGCGCGAGACATACCACCAATACATAAGCGTAATTCTTACCGGCGTAGATCCCTAGGAGAGATCCAGCAAACTCGTTGTCATGGGTGACCGATACGCTCCTCAGTGGTCTCGACGGTTGTCTAGACGCGTCGTGCCGACAGTTGGCAATGCCAGTGGATCCGCATCCGAATTTCATGTGCTTTTAGAGCTTCGCTCATGCGTTCCACCGCCACGAGGCCAGCGAGGTGAGCCTTTTCCGGGAAGCCAACTGCACGGATCGCCCACTAGTGGATGAGCCACACTAAACATAGAATGAAACCCCGACCCCAACACGCCACCGTGTGTCGGGGATATTAGCCAACATTTGGTTTTGAGCGTTCCTCGGACCAGCTTCTCGATATACACGGAGCCTTCGGGATTCTGTCCCCTACCCTACCGCAGTCATATTCGGAGTCGGCTGGATCTCGATTCGTCTGGCAACCTGGGGTTTGTCATGCGGCAGGCCAGCTGCCTTGTCAAAGCCTATCGTCCCCAGGGGAACCAGGTAGAGGGTCGTGGTGTCGTAAGGAGACGCGTCGTGGCGACCACCTCAATCCGAGACGGCGACAAACATTTGCCGTTCCGTATAGGTACCTCCTAAGGTCGTCGAACTTCTAAGTCTCTGAATCTCCAGAACTCAATTCAGCGGATGGTAATGTCTCACAAGACTCGCTTGAGGCGGGCCCAT'
a = 'A'
c = 'C'
g = 'G'
t = 'T'
acount = 0
ccount = 0
gcount = 0
tcount = 0
for i in range(0, len(s)):
if a == s[i]:
acount += 1
elif c == s[i]:
ccount += 1
elif g == s[i]:
gcount += 1
elif t == s[i]:
tcount += 1
print(acount, ccount, gcount, tcount)
| """Given: A DNA string s
s
of length at most 1000 nt.
Return: Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s
"""
s = 'AGACTCGCGCACTCACGATGAATCCCAAGACAGCCTGGCGGAGTATGGTACTACGGCCGTCCTCACCAAGGCATTTCGGTCCGAGTAGCGGATTGTGTGCCAGCCCTGAGGGCGAGTTATGGGCTCATTCGGGAGACGTATGTACGAGCCTGATCGTTCGTCTGCATCGCTCTAATGTTTATCGACAGCCTTACCACTGTTTGAGTCGATGCAAGACCTGTTTCTTCAGCGCATTCACAGAGTGGCGCGAGACATACCACCAATACATAAGCGTAATTCTTACCGGCGTAGATCCCTAGGAGAGATCCAGCAAACTCGTTGTCATGGGTGACCGATACGCTCCTCAGTGGTCTCGACGGTTGTCTAGACGCGTCGTGCCGACAGTTGGCAATGCCAGTGGATCCGCATCCGAATTTCATGTGCTTTTAGAGCTTCGCTCATGCGTTCCACCGCCACGAGGCCAGCGAGGTGAGCCTTTTCCGGGAAGCCAACTGCACGGATCGCCCACTAGTGGATGAGCCACACTAAACATAGAATGAAACCCCGACCCCAACACGCCACCGTGTGTCGGGGATATTAGCCAACATTTGGTTTTGAGCGTTCCTCGGACCAGCTTCTCGATATACACGGAGCCTTCGGGATTCTGTCCCCTACCCTACCGCAGTCATATTCGGAGTCGGCTGGATCTCGATTCGTCTGGCAACCTGGGGTTTGTCATGCGGCAGGCCAGCTGCCTTGTCAAAGCCTATCGTCCCCAGGGGAACCAGGTAGAGGGTCGTGGTGTCGTAAGGAGACGCGTCGTGGCGACCACCTCAATCCGAGACGGCGACAAACATTTGCCGTTCCGTATAGGTACCTCCTAAGGTCGTCGAACTTCTAAGTCTCTGAATCTCCAGAACTCAATTCAGCGGATGGTAATGTCTCACAAGACTCGCTTGAGGCGGGCCCAT'
a = 'A'
c = 'C'
g = 'G'
t = 'T'
acount = 0
ccount = 0
gcount = 0
tcount = 0
for i in range(0, len(s)):
if a == s[i]:
acount += 1
elif c == s[i]:
ccount += 1
elif g == s[i]:
gcount += 1
elif t == s[i]:
tcount += 1
print(acount, ccount, gcount, tcount) |
# 200020001
if 2400 == chr.getJob():
sm.warp(915010000, 1)# should be instance ?
elif 2410 <= chr.getJob() <= 2411:
sm.warp(915020000, 2)
else:
sm.chat("Only Phantoms can enter.")
sm.dispose()
| if 2400 == chr.getJob():
sm.warp(915010000, 1)
elif 2410 <= chr.getJob() <= 2411:
sm.warp(915020000, 2)
else:
sm.chat('Only Phantoms can enter.')
sm.dispose() |
[
{'base_name': 'HEASARC_swiftmastr',
'service_type': 'tap',
'access_url': 'https://heasarc.gsfc.nasa.gov/xamin/vo/tap',
'adql':'''
SELECT
*
FROM swiftmastr
WHERE
1=CONTAINS(POINT('ICRS', ra, dec),
CIRCLE('ICRS', {}, {}, {}))
'''
}
]
| [{'base_name': 'HEASARC_swiftmastr', 'service_type': 'tap', 'access_url': 'https://heasarc.gsfc.nasa.gov/xamin/vo/tap', 'adql': "\nSELECT\n *\n FROM swiftmastr\n WHERE \n 1=CONTAINS(POINT('ICRS', ra, dec),\n CIRCLE('ICRS', {}, {}, {}))\n "}] |
#Los atributos describen las caracteristicas de los objetos, las clases es donde declaramos estos atributos,el atributo se utiliza segun las variables o tipos de datos que disponemos en python
# Metodos son acciones/funciones
# Constructor o inicializador para inicializar los objetos de una forma predeterminada que podemos indicar.
class Persona:
#pass
nBrazos=0 # atributos
nPiernas=0
cabello=True
cCabello="Defecto"
hambre=0 # con hmabre sera 10 y sin hambre 0
def __init__(self): # Constructor
self.nBrazos=2
self.nPiernas=2
def dormir():
pass
def comer(self): # con self modifica el atributo hambre de mis mismo es de cir de Persona
self.hambre=5
class Hombre(Persona):#Herencia Simple de la clase hombre se le incluye a la clase entre parentesis la clase de la que esta herendando
#pass
nombre="Defecto"
sexo="M"
def cambiarNombre(self,nombre):#Metodo que modifica nuestro atributo y reciben parametros.
self.nombre=nombre
class Mujer(Persona):
#pass
nombre="Defecto"
sexo="F"
#Ejecutando el metodo comer de la clase Persona con la clase Hombre
jose=Hombre()
jose.comer()#Asi accedemos a los metodos del objeto
print(jose.hambre)#Asi accedemos a los atributos del objeto
| class Persona:
n_brazos = 0
n_piernas = 0
cabello = True
c_cabello = 'Defecto'
hambre = 0
def __init__(self):
self.nBrazos = 2
self.nPiernas = 2
def dormir():
pass
def comer(self):
self.hambre = 5
class Hombre(Persona):
nombre = 'Defecto'
sexo = 'M'
def cambiar_nombre(self, nombre):
self.nombre = nombre
class Mujer(Persona):
nombre = 'Defecto'
sexo = 'F'
jose = hombre()
jose.comer()
print(jose.hambre) |
BATCH_SIZE = 16
PROPOSAL_NUM = 6
CAT_NUM = 4
INPUT_SIZE = (448, 448) # (w, h)
LR = 0.0001
WD = 1e-4
SAVE_FREQ = 1
resume = ''
test_model = './checkpoints/model.ckpt'
save_dir = './trainlog/'
| batch_size = 16
proposal_num = 6
cat_num = 4
input_size = (448, 448)
lr = 0.0001
wd = 0.0001
save_freq = 1
resume = ''
test_model = './checkpoints/model.ckpt'
save_dir = './trainlog/' |
class Credentials:
BASE_URL = "http://localhost:8080"
# Login Page
LOGIN_PAGE_TITLE = "OpenProject"
USERNAME = "admin"
PASSWORD = "qazwsxedcr"
# Home Page
HOME_PAGE_TITLE = "OpenProject"
HOME_PAGE_SELECTED_PROJECT = "TestProject1"
# New Project page
NEW_PROJECT_PAGE_TITLE = "New project | OpenProject"
NEW_PROJECT_NAME = "Hello World! 1#2@3"
NEW_PROJECT_DESCRIPTION = "French fries, or simply fries, chips, finger chips, hot chips or French-fried potatoes, are deep-fried potatoes, which have been cut into batons."
NEW_PROJECT_STATUS = "On track"
# Project Overview Page
PROJECT_OVERVIEW_PAGE_TITLE = "Overview"
# Work Packages Page
WORK_PACKAGES_PAGE_TITLE_1 = "Work Packages | {} | OpenProject"
WORK_PACKAGES_PAGE_TITLE_2 = "All open | {} | OpenProject"
WORK_PACKAGE_FORM_TITLE = "New TASK"
NEW_TASK_TYPE = "TASK"
NEW_TASK_SUBJECT = "My Task 1"
NEW_TASK_DESCRIPTION = "123 @ # $ ./ - Lorem ipsum dolor sit amet, consectetur adipiscing elit. In eleifend at magna eu lobortis. Vestibulum ante ipsum primis in faucibus orci luctus et " \
"ultrices posuere cubilia curae; Aenean quis sodales lacus. Interdum et malesuada fames ac ante ipsum primis in faucibus. Phasellus accumsan consectetur arcu, " \
"eu pellentesque nunc gravida et. Sed posuere non massa sit amet mattis. Aenean fermentum euismod purus, id elementum nisl vulputate nec. Integer quis urna molestie, " \
"interdum orci quis, molestie ligula. Suspendisse potenti. Etiam placerat, turpis id convallis sagittis, magna metus porta eros, in finibus sapien arcu ac tortor. " \
"Praesent tempus, nibh ornare pulvinar placerat, augue elit dictum arcu, sit amet ultricies erat ante fermentum metus. "
NEW_WORK_PACKAGE_PAGE_TITLE = "New work package | {} | OpenProject"
CREATED_TASK_PAGE_TITLE = "Task: {} (#{}) | {} | OpenProject"
| class Credentials:
base_url = 'http://localhost:8080'
login_page_title = 'OpenProject'
username = 'admin'
password = 'qazwsxedcr'
home_page_title = 'OpenProject'
home_page_selected_project = 'TestProject1'
new_project_page_title = 'New project | OpenProject'
new_project_name = 'Hello World! 1#2@3'
new_project_description = 'French fries, or simply fries, chips, finger chips, hot chips or French-fried potatoes, are deep-fried potatoes, which have been cut into batons.'
new_project_status = 'On track'
project_overview_page_title = 'Overview'
work_packages_page_title_1 = 'Work Packages | {} | OpenProject'
work_packages_page_title_2 = 'All open | {} | OpenProject'
work_package_form_title = 'New TASK'
new_task_type = 'TASK'
new_task_subject = 'My Task 1'
new_task_description = '123 @ # $ ./ - Lorem ipsum dolor sit amet, consectetur adipiscing elit. In eleifend at magna eu lobortis. Vestibulum ante ipsum primis in faucibus orci luctus et ultrices posuere cubilia curae; Aenean quis sodales lacus. Interdum et malesuada fames ac ante ipsum primis in faucibus. Phasellus accumsan consectetur arcu, eu pellentesque nunc gravida et. Sed posuere non massa sit amet mattis. Aenean fermentum euismod purus, id elementum nisl vulputate nec. Integer quis urna molestie, interdum orci quis, molestie ligula. Suspendisse potenti. Etiam placerat, turpis id convallis sagittis, magna metus porta eros, in finibus sapien arcu ac tortor. Praesent tempus, nibh ornare pulvinar placerat, augue elit dictum arcu, sit amet ultricies erat ante fermentum metus. '
new_work_package_page_title = 'New work package | {} | OpenProject'
created_task_page_title = 'Task: {} (#{}) | {} | OpenProject' |
x1 = float(input("Enter x1: "))
y1 = float(input("Enter y1: "))
x2 = float(input("Enter x2: "))
y2 = float(input("Enter y2: "))
m = (y2 - y1) / (x2 - x1)
print("Gradient is {:g}".format(m))
c = y1 - (m * x1)
print("y-int is {:g}".format(c))
print("Equation: y = {:g}x + {:g}".format(m,c)) | x1 = float(input('Enter x1: '))
y1 = float(input('Enter y1: '))
x2 = float(input('Enter x2: '))
y2 = float(input('Enter y2: '))
m = (y2 - y1) / (x2 - x1)
print('Gradient is {:g}'.format(m))
c = y1 - m * x1
print('y-int is {:g}'.format(c))
print('Equation: y = {:g}x + {:g}'.format(m, c)) |
# See https://developers.notion.com/reference/request-limits
RICH_TEXT_CONTENT_MAX_LENGTH = 2000
RICH_TEXT_LINK_MAX_LENGTH = 1000
EQUATION_EXPRESSION_MAX_LENGTH = 1000 | rich_text_content_max_length = 2000
rich_text_link_max_length = 1000
equation_expression_max_length = 1000 |
#---
def plotUAVcontrolSignals(df,plt):
## - Plot the Control Signals
fig, axs = plt.subplots(2,2, sharex=True)
fig.suptitle("Control Signals (Executed by the Drone)")
# ---------- u_\theta
axs[0,0].plot(df['time'], df['A.pSCU[0]'])
axs[0,0].set(ylabel=r'$u_{\theta}~$ [rad]')
axs[0,0].grid(True)
axs[0,0].set(xlim=(min(df['time']), max(df['time'])),
ylim=(min(df['A.pSCU[0]'])-0.025, max(df['A.pSCU[0]'])+0.025))
# ---------- u_\phi
axs[0,1].plot(df['time'], df['U[1]'])
axs[0,1].set(ylabel=r'$u_{\phi}~$ [rad]')
axs[0,1].grid(True)
axs[0,1].set(xlim=(min(df['time']), max(df['time'])),
ylim=(min(df['U[1]'])-0.025, max(df['U[1]'])+0.025))
# ---------- u_{\Dot{\psi}}
axs[1,0].plot(df['time'], df['U[2]'])
axs[1,0].set(xlabel='time [$s$]', ylabel='$u_{\dot{\psi}}~$ [rad/s]')
axs[1,0].grid(True)
axs[1,0].set(xlim=(min(df['time']), max(df['time'])),
ylim=(min(df['U[2]'])-0.025, max(df['U[2]'])+0.025))
# ---------- u_{\Dot{z}}
axs[1,1].plot(df['time'], df['U[3]'])
axs[1,1].set(xlabel='time [$s$]', ylabel='$u_{z}~$ [m/s]')
axs[1,1].grid(True)
axs[1,1].set(xlim=(min(df['time']), max(df['time'])),
ylim=(min(df['U[3]'])-0.025, max(df['U[3]'])+0.025))
Fig = plt.gcf()
plt.show()
# the axes attributes need to be set before the call to subplot
plt.rcParams.update({
"grid.color": "0.5",
"grid.linestyle": "--",
"grid.linewidth": 0.25,
"lines.linewidth": 1,
"lines.color": "g"})
plt.rcParams.update({
"text.usetex": True,
"font.family": "sans-serif",
"font.sans-serif": ["Helvetica"]})
# set font of all elements to size 15
plt.rcParams['figure.figsize'] = (22,8)
plt.rc('font', size=26)
plt.rc('axes', titlesize=25)
plt.rc('text', usetex=True)
plt.rc('font', family='serif')
print('\n')
plt.show()
return fig
| def plot_ua_vcontrol_signals(df, plt):
(fig, axs) = plt.subplots(2, 2, sharex=True)
fig.suptitle('Control Signals (Executed by the Drone)')
axs[0, 0].plot(df['time'], df['A.pSCU[0]'])
axs[0, 0].set(ylabel='$u_{\\theta}~$ [rad]')
axs[0, 0].grid(True)
axs[0, 0].set(xlim=(min(df['time']), max(df['time'])), ylim=(min(df['A.pSCU[0]']) - 0.025, max(df['A.pSCU[0]']) + 0.025))
axs[0, 1].plot(df['time'], df['U[1]'])
axs[0, 1].set(ylabel='$u_{\\phi}~$ [rad]')
axs[0, 1].grid(True)
axs[0, 1].set(xlim=(min(df['time']), max(df['time'])), ylim=(min(df['U[1]']) - 0.025, max(df['U[1]']) + 0.025))
axs[1, 0].plot(df['time'], df['U[2]'])
axs[1, 0].set(xlabel='time [$s$]', ylabel='$u_{\\dot{\\psi}}~$ [rad/s]')
axs[1, 0].grid(True)
axs[1, 0].set(xlim=(min(df['time']), max(df['time'])), ylim=(min(df['U[2]']) - 0.025, max(df['U[2]']) + 0.025))
axs[1, 1].plot(df['time'], df['U[3]'])
axs[1, 1].set(xlabel='time [$s$]', ylabel='$u_{z}~$ [m/s]')
axs[1, 1].grid(True)
axs[1, 1].set(xlim=(min(df['time']), max(df['time'])), ylim=(min(df['U[3]']) - 0.025, max(df['U[3]']) + 0.025))
fig = plt.gcf()
plt.show()
plt.rcParams.update({'grid.color': '0.5', 'grid.linestyle': '--', 'grid.linewidth': 0.25, 'lines.linewidth': 1, 'lines.color': 'g'})
plt.rcParams.update({'text.usetex': True, 'font.family': 'sans-serif', 'font.sans-serif': ['Helvetica']})
plt.rcParams['figure.figsize'] = (22, 8)
plt.rc('font', size=26)
plt.rc('axes', titlesize=25)
plt.rc('text', usetex=True)
plt.rc('font', family='serif')
print('\n')
plt.show()
return fig |
def arr_pair_sum(arr, k):
# edge case
if len(arr) < 2:
return
# set for tracking
seen = set()
output = set()
for num in arr:
target = k - num
if target not in seen:
seen.add(num)
else:
output.add((min(num, target), max(num, target)))
return len(output)
print(arr_pair_sum([1, 3, 2, 2], 4))
| def arr_pair_sum(arr, k):
if len(arr) < 2:
return
seen = set()
output = set()
for num in arr:
target = k - num
if target not in seen:
seen.add(num)
else:
output.add((min(num, target), max(num, target)))
return len(output)
print(arr_pair_sum([1, 3, 2, 2], 4)) |
def sanitize(time_string):
if "-" in time_string:
splitter = "-"
elif ":" in time_string:
splitter = ":"
else:
return time_string
(mins, secs) = time_string.split(splitter)
return mins + "." + secs
with open("james.txt") as jaf:
data = jaf.readline()
james = sorted([sanitize(each_t) for each_t in data.strip().split(",")])
with open("julie.txt") as jaf:
data = jaf.readline()
julie = sorted([sanitize(each_t) for each_t in data.strip().split(",")])
with open("mikey.txt") as jaf:
data = jaf.readline()
mikey = sorted([sanitize(each_t) for each_t in data.strip().split(",")])
with open("sarah.txt") as jaf:
data = jaf.readline()
sarah = sorted([sanitize(each_t) for each_t in data.strip().split(",")])
clean_james = []
clean_julie = []
clean_mikey = []
clean_sarah = []
for each_t in james:
if each_t not in clean_james:
clean_james.append(sanitize(each_t))
for each_t in julie:
if each_t not in clean_julie:
clean_julie.append(sanitize(each_t))
for each_t in mikey:
if each_t not in clean_mikey:
clean_mikey.append(sanitize(each_t))
for each_t in sarah:
if each_t not in clean_sarah:
clean_sarah.append(sanitize(each_t))
print(clean_james[0:3])
print(clean_julie[0:3])
print(clean_mikey[0:3])
print(clean_sarah[0:3])
| def sanitize(time_string):
if '-' in time_string:
splitter = '-'
elif ':' in time_string:
splitter = ':'
else:
return time_string
(mins, secs) = time_string.split(splitter)
return mins + '.' + secs
with open('james.txt') as jaf:
data = jaf.readline()
james = sorted([sanitize(each_t) for each_t in data.strip().split(',')])
with open('julie.txt') as jaf:
data = jaf.readline()
julie = sorted([sanitize(each_t) for each_t in data.strip().split(',')])
with open('mikey.txt') as jaf:
data = jaf.readline()
mikey = sorted([sanitize(each_t) for each_t in data.strip().split(',')])
with open('sarah.txt') as jaf:
data = jaf.readline()
sarah = sorted([sanitize(each_t) for each_t in data.strip().split(',')])
clean_james = []
clean_julie = []
clean_mikey = []
clean_sarah = []
for each_t in james:
if each_t not in clean_james:
clean_james.append(sanitize(each_t))
for each_t in julie:
if each_t not in clean_julie:
clean_julie.append(sanitize(each_t))
for each_t in mikey:
if each_t not in clean_mikey:
clean_mikey.append(sanitize(each_t))
for each_t in sarah:
if each_t not in clean_sarah:
clean_sarah.append(sanitize(each_t))
print(clean_james[0:3])
print(clean_julie[0:3])
print(clean_mikey[0:3])
print(clean_sarah[0:3]) |
# Backport of str.removeprefix.
# TODO Remove when minimum python version is 3.9 or above
def removeprefix(string: str, prefix: str) -> str:
if string.startswith(prefix):
return string[len(prefix) :]
return string
| def removeprefix(string: str, prefix: str) -> str:
if string.startswith(prefix):
return string[len(prefix):]
return string |
# Some magic data values exist.
# They often represent missing data. More information can be found at the following link.
# https://www.census.gov/data/developers/data-sets/acs-1year/notes-on-acs-estimate-and-annotation-values.html
class Magic:
MISSING_VALUES = [
None,
-999999999,
-888888888,
-666666666,
-555555555,
-333333333,
-222222222,
]
| class Magic:
missing_values = [None, -999999999, -888888888, -666666666, -555555555, -333333333, -222222222] |
def sample(task):
if task is not logistic:
raise NotImplementedError
# Parametric Generator for Logistic Regression Task (TODO: Generalize for Task - Parameter Specification)
theta = [np.random.uniform( 1, 10),
np.random.uniform( 1, 10),
np.random.uniform(-1, 1)]
return task(sample_space, theta), theta
def sample_points(task, batch_size):
# Sample Random Points from Sample Space
idx = np.random.choice(np.arange(len(sample_space)), batch_size, replace = False)
return sample_space[idx[:,None]], task[idx[:,None]]
def meta_sample(radius, count):
# Generate Sample Space of Specified Radius
sample_space = np.linspace(-radius, radius, count)
return sample_space | def sample(task):
if task is not logistic:
raise NotImplementedError
theta = [np.random.uniform(1, 10), np.random.uniform(1, 10), np.random.uniform(-1, 1)]
return (task(sample_space, theta), theta)
def sample_points(task, batch_size):
idx = np.random.choice(np.arange(len(sample_space)), batch_size, replace=False)
return (sample_space[idx[:, None]], task[idx[:, None]])
def meta_sample(radius, count):
sample_space = np.linspace(-radius, radius, count)
return sample_space |
def read_input():
joltages = []
with open('day10_input.txt') as input_file:
for line in input_file:
line = line.strip()
joltages.append( int(line) )
return joltages
# Find a chain that uses all of your adapters to connect the charging outlet
# to your device's built-in adapter and count the joltage differences
# between the charging outlet, the adapters, and your device. What is
# the number of 1-jolt differences multiplied by the number of 3-jolt
# differences?
def part1(joltages):
# 1 in position 3 as there's an implicit 3 jolt jump
# as the last step
diffs = [0, 0, 0, 1]
for i in range(1, len(joltages)):
diff = joltages[i] - joltages[i-1]
diffs[diff] += 1
return diffs
# Part 2: What is the total number of distinct ways you can arrange
# the adapters to connect the charging outlet to your device?
def part2(joltages, joltage_jumps):
# observation: 3-jolt jumps are mandatory and so don't count for anything
# How many possibilites does a run of n consecutive 1-jolt jumps allow for?
# Find all the runs of 1-jumps, then how many possibilites they provide,
# then multiply them all.
# Consider runs x, x+1, x+2, ..., x+N
# For N=2, the 2 possibilities are:
# 0, 1, 2 OR 0, 2
# For N=3, the 4 possibilities are:
# 0, 1, 2, 3 OR 0, 2, 3 OR 0, 1, 3 OR 0, 3
# For N=4, the 7 possibilities are:
# 0, 1, 2, 3, 4 OR 0, 2, 3, 4 OR 0, 1, 3, 4 OR 0, 1, 2, 4 OR
# 0, 1, 4 OR 0, 2, 4 OR 0, 3, 4
# There must be a more satisfying way to do this but N=4 is all that was
# needed to solve the problem
permutations = [1, 1, 2, 4, 7]
one_jump_runs = []
run_length = 0
for i in range(1, len(joltages)):
diff = joltages[i] - joltages[i - 1]
if diff == 1:
run_length += 1
else:
one_jump_runs.append(run_length)
run_length = 0
one_jump_runs.append(run_length)
one_jump_runs = list(filter(lambda x: x > 1, one_jump_runs))
total_possibilities = 1
for run_length in one_jump_runs:
total_possibilities *= permutations[run_length]
return total_possibilities
joltages = read_input()
joltages.append(0) # add implicit 0 that forms the start of the chain
joltages = sorted(joltages)
joltage_jumps = part1(joltages)
print("Part 1: product of 1-jolt jumps with 3-jolt jumps : {}"
.format(joltage_jumps[1] * joltage_jumps[3]))
print("Part 2: Total possible arrangements of adapters {}".format(part2(joltages, joltage_jumps)))
| def read_input():
joltages = []
with open('day10_input.txt') as input_file:
for line in input_file:
line = line.strip()
joltages.append(int(line))
return joltages
def part1(joltages):
diffs = [0, 0, 0, 1]
for i in range(1, len(joltages)):
diff = joltages[i] - joltages[i - 1]
diffs[diff] += 1
return diffs
def part2(joltages, joltage_jumps):
permutations = [1, 1, 2, 4, 7]
one_jump_runs = []
run_length = 0
for i in range(1, len(joltages)):
diff = joltages[i] - joltages[i - 1]
if diff == 1:
run_length += 1
else:
one_jump_runs.append(run_length)
run_length = 0
one_jump_runs.append(run_length)
one_jump_runs = list(filter(lambda x: x > 1, one_jump_runs))
total_possibilities = 1
for run_length in one_jump_runs:
total_possibilities *= permutations[run_length]
return total_possibilities
joltages = read_input()
joltages.append(0)
joltages = sorted(joltages)
joltage_jumps = part1(joltages)
print('Part 1: product of 1-jolt jumps with 3-jolt jumps : {}'.format(joltage_jumps[1] * joltage_jumps[3]))
print('Part 2: Total possible arrangements of adapters {}'.format(part2(joltages, joltage_jumps))) |
def main(request, response):
response.headers.set(b"Access-Control-Allow-Origin", request.headers.get(b"origin"))
token = request.GET[b"token"]
request.server.stash.put(token, b"")
response.content = b"PASS"
| def main(request, response):
response.headers.set(b'Access-Control-Allow-Origin', request.headers.get(b'origin'))
token = request.GET[b'token']
request.server.stash.put(token, b'')
response.content = b'PASS' |
class Address:
def __init__(self, street_address, city, country):
self.country = country
self.city = city
self.street_address = street_address
def __str__(self):
return f'{self.street_address}, {self.city}, {self.country}'
| class Address:
def __init__(self, street_address, city, country):
self.country = country
self.city = city
self.street_address = street_address
def __str__(self):
return f'{self.street_address}, {self.city}, {self.country}' |
def extractBetwixtedtranslationsBlogspotCom(item):
'''
Parser for 'betwixtedtranslations.blogspot.com'
'''
vol, chp, frag, postfix = extractVolChapterFragmentPostfix(item['title'])
if not (chp or vol) or "preview" in item['title'].lower():
return None
tagmap = [
('Transmigrated Senior Martial Brother', 'Transmigrated Senior Martial Brother', 'translated'),
('Part-Time Taoist Priest', 'Part-Time Taoist Priest', 'translated'),
('Criminal Psychology', 'Criminal Psychology', 'translated'),
('Death Progress Bar', 'Death Progress Bar', 'translated'),
('King of Classical Music', 'King of Classical Music', 'translated'),
('Everyday I Get up to See the Villain Stealing the Show', 'Everyday I Get up to See the Villain Stealing the Show', 'translated'),
('where is our agreement to be each other\'s arch rivals?', 'where is our agreement to be each other\'s arch rivals?', 'translated'),
('Gentle Beast', 'Gentle Beast', 'translated'),
('Epiphanies of Rebirth', 'Epiphanies of Rebirth', 'translated'),
]
for tagname, name, tl_type in tagmap:
if tagname in item['tags']:
return buildReleaseMessageWithType(item, name, vol, chp, frag=frag, postfix=postfix, tl_type=tl_type)
return False | def extract_betwixtedtranslations_blogspot_com(item):
"""
Parser for 'betwixtedtranslations.blogspot.com'
"""
(vol, chp, frag, postfix) = extract_vol_chapter_fragment_postfix(item['title'])
if not (chp or vol) or 'preview' in item['title'].lower():
return None
tagmap = [('Transmigrated Senior Martial Brother', 'Transmigrated Senior Martial Brother', 'translated'), ('Part-Time Taoist Priest', 'Part-Time Taoist Priest', 'translated'), ('Criminal Psychology', 'Criminal Psychology', 'translated'), ('Death Progress Bar', 'Death Progress Bar', 'translated'), ('King of Classical Music', 'King of Classical Music', 'translated'), ('Everyday I Get up to See the Villain Stealing the Show', 'Everyday I Get up to See the Villain Stealing the Show', 'translated'), ("where is our agreement to be each other's arch rivals?", "where is our agreement to be each other's arch rivals?", 'translated'), ('Gentle Beast', 'Gentle Beast', 'translated'), ('Epiphanies of Rebirth', 'Epiphanies of Rebirth', 'translated')]
for (tagname, name, tl_type) in tagmap:
if tagname in item['tags']:
return build_release_message_with_type(item, name, vol, chp, frag=frag, postfix=postfix, tl_type=tl_type)
return False |
#
# This file contains the Python code from Program 16.20 of
# "Data Structures and Algorithms
# with Object-Oriented Design Patterns in Python"
# by Bruno R. Preiss.
#
# Copyright (c) 2003 by Bruno R. Preiss, P.Eng. All rights reserved.
#
# http://www.brpreiss.com/books/opus7/programs/pgm16_20.txt
#
class Algorithms(object):
class EarliestTimeVisitor(Visitor):
def __init__(self, earliestTime):
super(Algorithms.EarliestTimeVisitor,self).__init__()
self._earliestTime = earliestTime
def visit(self, w):
t = self._earliestTime[0]
for e in w.incidentEdges:
t = max(t,
self._earliestTime[e.v0.number] + e.weight)
self._earliestTime[w.number] = t
| class Algorithms(object):
class Earliesttimevisitor(Visitor):
def __init__(self, earliestTime):
super(Algorithms.EarliestTimeVisitor, self).__init__()
self._earliestTime = earliestTime
def visit(self, w):
t = self._earliestTime[0]
for e in w.incidentEdges:
t = max(t, self._earliestTime[e.v0.number] + e.weight)
self._earliestTime[w.number] = t |
day_num = 15
file_load = open("input/day15.txt", "r")
file_in = file_load.read()
file_load.close()
file_in = list(map(int, file_in.split(",")))
def run():
def game(input_in, round_hunt):
num_last = {}
for temp_pos, temp_num in enumerate(input_in, 1):
num_last[temp_num] = temp_pos
game_round = len(input_in)
game_next = 0
for game_round in range(len(input_in) + 1, round_hunt):
if game_next not in num_last:
num_last[game_next] = game_round
game_next = 0
else:
temp_next = game_round - num_last[game_next]
num_last[game_next] = game_round
game_next = temp_next
return game_next
return game(file_in, 2020), game(file_in, 30000000)
if __name__ == "__main__":
print(run()) | day_num = 15
file_load = open('input/day15.txt', 'r')
file_in = file_load.read()
file_load.close()
file_in = list(map(int, file_in.split(',')))
def run():
def game(input_in, round_hunt):
num_last = {}
for (temp_pos, temp_num) in enumerate(input_in, 1):
num_last[temp_num] = temp_pos
game_round = len(input_in)
game_next = 0
for game_round in range(len(input_in) + 1, round_hunt):
if game_next not in num_last:
num_last[game_next] = game_round
game_next = 0
else:
temp_next = game_round - num_last[game_next]
num_last[game_next] = game_round
game_next = temp_next
return game_next
return (game(file_in, 2020), game(file_in, 30000000))
if __name__ == '__main__':
print(run()) |
def findDuplicatesSequence(sequence):
stringySequence = str(sequence)
while stringySequence[0] == stringySequence[-1]:
stringySequence = stringySequence[-1] + stringySequence[0:-1]
iterableSequenceDuplicates = (re.finditer(r"(\d)\1+", str(stringySequence)))
duplicatesList = [iterable[0] for iterable in iterableSequenceDuplicates]
filteredDuplicatesList = []
for duplicates in duplicatesList:
duplicates = duplicates[:-1]
filteredDuplicatesList.append(duplicates)
counter = 0
for duplicates in filteredDuplicatesList:
int(duplicates[0])
counter += int(duplicates[0]) * len(duplicates)
print(counter)
return counter
| def find_duplicates_sequence(sequence):
stringy_sequence = str(sequence)
while stringySequence[0] == stringySequence[-1]:
stringy_sequence = stringySequence[-1] + stringySequence[0:-1]
iterable_sequence_duplicates = re.finditer('(\\d)\\1+', str(stringySequence))
duplicates_list = [iterable[0] for iterable in iterableSequenceDuplicates]
filtered_duplicates_list = []
for duplicates in duplicatesList:
duplicates = duplicates[:-1]
filteredDuplicatesList.append(duplicates)
counter = 0
for duplicates in filteredDuplicatesList:
int(duplicates[0])
counter += int(duplicates[0]) * len(duplicates)
print(counter)
return counter |
#
# PySNMP MIB module NNCBELLCOREGR820DS1STATISTICS-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/NNCBELLCOREGR820DS1STATISTICS-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 20:13:04 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
ObjectIdentifier, OctetString, Integer = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "OctetString", "Integer")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueRangeConstraint, ConstraintsIntersection, ValueSizeConstraint, SingleValueConstraint, ConstraintsUnion = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueRangeConstraint", "ConstraintsIntersection", "ValueSizeConstraint", "SingleValueConstraint", "ConstraintsUnion")
ifIndex, = mibBuilder.importSymbols("IF-MIB", "ifIndex")
nncExtensions, = mibBuilder.importSymbols("NNCGNI0001-SMI", "nncExtensions")
ObjectGroup, NotificationGroup, ModuleCompliance = mibBuilder.importSymbols("SNMPv2-CONF", "ObjectGroup", "NotificationGroup", "ModuleCompliance")
MibIdentifier, NotificationType, IpAddress, ObjectIdentity, TimeTicks, Unsigned32, MibScalar, MibTable, MibTableRow, MibTableColumn, ModuleIdentity, Gauge32, iso, Counter64, Integer32, Bits, Counter32 = mibBuilder.importSymbols("SNMPv2-SMI", "MibIdentifier", "NotificationType", "IpAddress", "ObjectIdentity", "TimeTicks", "Unsigned32", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "ModuleIdentity", "Gauge32", "iso", "Counter64", "Integer32", "Bits", "Counter32")
TextualConvention, DisplayString = mibBuilder.importSymbols("SNMPv2-TC", "TextualConvention", "DisplayString")
nncBellcoreGR820Ds1Statistics = ModuleIdentity((1, 3, 6, 1, 4, 1, 123, 3, 70))
if mibBuilder.loadTexts: nncBellcoreGR820Ds1Statistics.setLastUpdated('9902151200Z')
if mibBuilder.loadTexts: nncBellcoreGR820Ds1Statistics.setOrganization('Newbridge Networks Corporation')
nncBellcoreGR820Ds1StatisticsObjects = MibIdentifier((1, 3, 6, 1, 4, 1, 123, 3, 70, 1))
nncBellcoreGR820Ds1StatisticsGroups = MibIdentifier((1, 3, 6, 1, 4, 1, 123, 3, 70, 2))
nncBellcoreGR820Ds1StatisticsCompliances = MibIdentifier((1, 3, 6, 1, 4, 1, 123, 3, 70, 3))
nncBellcoreGR820Ds1CurrStatsTable = MibTable((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1), )
if mibBuilder.loadTexts: nncBellcoreGR820Ds1CurrStatsTable.setStatus('current')
nncBellcoreGR820Ds1CurrStatsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: nncBellcoreGR820Ds1CurrStatsEntry.setStatus('current')
nncBellcoreGR820Ds1CurrLineCV = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 1), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1CurrLineCV.setStatus('current')
nncBellcoreGR820Ds1CurrLineES = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 2), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1CurrLineES.setStatus('current')
nncBellcoreGR820Ds1CurrLineLOSS = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 3), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1CurrLineLOSS.setStatus('current')
nncBellcoreGR820Ds1CurrPathCV = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 4), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1CurrPathCV.setStatus('current')
nncBellcoreGR820Ds1CurrPathES = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 5), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1CurrPathES.setStatus('current')
nncBellcoreGR820Ds1CurrPathSES = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 6), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1CurrPathSES.setStatus('current')
nncBellcoreGR820Ds1CurrPathAISS = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 7), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1CurrPathAISS.setStatus('current')
nncBellcoreGR820Ds1CurrPathCSS = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 8), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1CurrPathCSS.setStatus('current')
nncBellcoreGR820Ds1CurrPathUAS = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 9), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1CurrPathUAS.setStatus('current')
nncBellcoreGR820Ds1CurrPathSAS = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 10), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1CurrPathSAS.setStatus('current')
nncBellcoreGR820Ds1CurrPathFC = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 11), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1CurrPathFC.setStatus('current')
nncBellcoreGR820Ds1IntervalStatsTable = MibTable((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2), )
if mibBuilder.loadTexts: nncBellcoreGR820Ds1IntervalStatsTable.setStatus('current')
nncBellcoreGR820Ds1IntervalStatsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"), (0, "NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1IntervalIndex"))
if mibBuilder.loadTexts: nncBellcoreGR820Ds1IntervalStatsEntry.setStatus('current')
nncBellcoreGR820Ds1IntervalIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 96))).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1IntervalIndex.setStatus('current')
nncBellcoreGR820Ds1IntervalLineCV = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 2), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1IntervalLineCV.setStatus('current')
nncBellcoreGR820Ds1IntervalLineES = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 3), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1IntervalLineES.setStatus('current')
nncBellcoreGR820Ds1IntervalLineLOSS = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 4), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1IntervalLineLOSS.setStatus('current')
nncBellcoreGR820Ds1IntervalPathCV = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 5), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1IntervalPathCV.setStatus('current')
nncBellcoreGR820Ds1IntervalPathES = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 6), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1IntervalPathES.setStatus('current')
nncBellcoreGR820Ds1IntervalPathSES = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 7), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1IntervalPathSES.setStatus('current')
nncBellcoreGR820Ds1IntervalPathAISS = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 8), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1IntervalPathAISS.setStatus('current')
nncBellcoreGR820Ds1IntervalPathCSS = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 9), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1IntervalPathCSS.setStatus('current')
nncBellcoreGR820Ds1IntervalPathUAS = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 10), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1IntervalPathUAS.setStatus('current')
nncBellcoreGR820Ds1IntervalPathSAS = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 11), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1IntervalPathSAS.setStatus('current')
nncBellcoreGR820Ds1IntervalPathFC = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 12), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1IntervalPathFC.setStatus('current')
nncBellcoreGR820Ds1TotalStatsTable = MibTable((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3), )
if mibBuilder.loadTexts: nncBellcoreGR820Ds1TotalStatsTable.setStatus('current')
nncBellcoreGR820Ds1TotalStatsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1), ).setIndexNames((0, "IF-MIB", "ifIndex"))
if mibBuilder.loadTexts: nncBellcoreGR820Ds1TotalStatsEntry.setStatus('current')
nncBellcoreGR820Ds1TotalLineCV = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 1), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1TotalLineCV.setStatus('current')
nncBellcoreGR820Ds1TotalLineES = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 2), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1TotalLineES.setStatus('current')
nncBellcoreGR820Ds1TotalLineLOSS = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 3), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1TotalLineLOSS.setStatus('current')
nncBellcoreGR820Ds1TotalPathCV = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 4), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1TotalPathCV.setStatus('current')
nncBellcoreGR820Ds1TotalPathES = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 5), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1TotalPathES.setStatus('current')
nncBellcoreGR820Ds1TotalPathSES = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 6), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1TotalPathSES.setStatus('current')
nncBellcoreGR820Ds1TotalPathAISS = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 7), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1TotalPathAISS.setStatus('current')
nncBellcoreGR820Ds1TotalPathCSS = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 8), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1TotalPathCSS.setStatus('current')
nncBellcoreGR820Ds1TotalPathUAS = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 9), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1TotalPathUAS.setStatus('current')
nncBellcoreGR820Ds1TotalPathSAS = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 10), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1TotalPathSAS.setStatus('current')
nncBellcoreGR820Ds1TotalPathFC = MibTableColumn((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 11), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: nncBellcoreGR820Ds1TotalPathFC.setStatus('current')
nncBellcoreGR820Ds1CurrStatsGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 123, 3, 70, 2, 1)).setObjects(("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1CurrLineCV"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1CurrLineES"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1CurrLineLOSS"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1CurrPathCV"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1CurrPathES"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1CurrPathSES"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1CurrPathAISS"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1CurrPathCSS"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1CurrPathUAS"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1CurrPathSAS"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1CurrPathFC"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
nncBellcoreGR820Ds1CurrStatsGroup = nncBellcoreGR820Ds1CurrStatsGroup.setStatus('current')
nncBellcoreGR820Ds1IntervalStatsGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 123, 3, 70, 2, 2)).setObjects(("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1IntervalIndex"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1IntervalLineCV"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1IntervalLineES"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1IntervalLineLOSS"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1IntervalPathCV"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1IntervalPathES"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1IntervalPathSES"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1IntervalPathAISS"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1IntervalPathCSS"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1IntervalPathUAS"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1IntervalPathSAS"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1IntervalPathFC"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
nncBellcoreGR820Ds1IntervalStatsGroup = nncBellcoreGR820Ds1IntervalStatsGroup.setStatus('current')
nncBellcoreGR820Ds1TotalStatsGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 123, 3, 70, 2, 3)).setObjects(("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1TotalLineCV"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1TotalLineES"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1TotalLineLOSS"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1TotalPathCV"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1TotalPathES"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1TotalPathSES"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1TotalPathAISS"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1TotalPathCSS"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1TotalPathUAS"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1TotalPathSAS"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1TotalPathFC"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
nncBellcoreGR820Ds1TotalStatsGroup = nncBellcoreGR820Ds1TotalStatsGroup.setStatus('current')
nncBellcoreGR820Ds1StatisticsCompliance = ModuleCompliance((1, 3, 6, 1, 4, 1, 123, 3, 70, 3, 1)).setObjects(("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1CurrStatsGroup"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1IntervalStatsGroup"), ("NNCBELLCOREGR820DS1STATISTICS-MIB", "nncBellcoreGR820Ds1TotalStatsGroup"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
nncBellcoreGR820Ds1StatisticsCompliance = nncBellcoreGR820Ds1StatisticsCompliance.setStatus('current')
mibBuilder.exportSymbols("NNCBELLCOREGR820DS1STATISTICS-MIB", nncBellcoreGR820Ds1TotalPathSAS=nncBellcoreGR820Ds1TotalPathSAS, nncBellcoreGR820Ds1TotalStatsEntry=nncBellcoreGR820Ds1TotalStatsEntry, nncBellcoreGR820Ds1TotalStatsGroup=nncBellcoreGR820Ds1TotalStatsGroup, nncBellcoreGR820Ds1CurrLineLOSS=nncBellcoreGR820Ds1CurrLineLOSS, nncBellcoreGR820Ds1CurrStatsGroup=nncBellcoreGR820Ds1CurrStatsGroup, nncBellcoreGR820Ds1IntervalPathCSS=nncBellcoreGR820Ds1IntervalPathCSS, nncBellcoreGR820Ds1IntervalPathFC=nncBellcoreGR820Ds1IntervalPathFC, nncBellcoreGR820Ds1TotalLineES=nncBellcoreGR820Ds1TotalLineES, nncBellcoreGR820Ds1TotalPathSES=nncBellcoreGR820Ds1TotalPathSES, nncBellcoreGR820Ds1CurrPathES=nncBellcoreGR820Ds1CurrPathES, nncBellcoreGR820Ds1TotalPathES=nncBellcoreGR820Ds1TotalPathES, nncBellcoreGR820Ds1CurrLineES=nncBellcoreGR820Ds1CurrLineES, nncBellcoreGR820Ds1CurrStatsTable=nncBellcoreGR820Ds1CurrStatsTable, nncBellcoreGR820Ds1CurrStatsEntry=nncBellcoreGR820Ds1CurrStatsEntry, nncBellcoreGR820Ds1TotalPathAISS=nncBellcoreGR820Ds1TotalPathAISS, nncBellcoreGR820Ds1CurrPathSAS=nncBellcoreGR820Ds1CurrPathSAS, nncBellcoreGR820Ds1IntervalPathUAS=nncBellcoreGR820Ds1IntervalPathUAS, nncBellcoreGR820Ds1IntervalStatsGroup=nncBellcoreGR820Ds1IntervalStatsGroup, nncBellcoreGR820Ds1CurrPathSES=nncBellcoreGR820Ds1CurrPathSES, nncBellcoreGR820Ds1IntervalPathSAS=nncBellcoreGR820Ds1IntervalPathSAS, nncBellcoreGR820Ds1Statistics=nncBellcoreGR820Ds1Statistics, nncBellcoreGR820Ds1StatisticsObjects=nncBellcoreGR820Ds1StatisticsObjects, nncBellcoreGR820Ds1CurrPathCV=nncBellcoreGR820Ds1CurrPathCV, nncBellcoreGR820Ds1TotalLineLOSS=nncBellcoreGR820Ds1TotalLineLOSS, nncBellcoreGR820Ds1IntervalStatsEntry=nncBellcoreGR820Ds1IntervalStatsEntry, nncBellcoreGR820Ds1TotalLineCV=nncBellcoreGR820Ds1TotalLineCV, nncBellcoreGR820Ds1TotalStatsTable=nncBellcoreGR820Ds1TotalStatsTable, nncBellcoreGR820Ds1IntervalIndex=nncBellcoreGR820Ds1IntervalIndex, PYSNMP_MODULE_ID=nncBellcoreGR820Ds1Statistics, nncBellcoreGR820Ds1CurrLineCV=nncBellcoreGR820Ds1CurrLineCV, nncBellcoreGR820Ds1CurrPathAISS=nncBellcoreGR820Ds1CurrPathAISS, nncBellcoreGR820Ds1TotalPathUAS=nncBellcoreGR820Ds1TotalPathUAS, nncBellcoreGR820Ds1TotalPathCSS=nncBellcoreGR820Ds1TotalPathCSS, nncBellcoreGR820Ds1CurrPathFC=nncBellcoreGR820Ds1CurrPathFC, nncBellcoreGR820Ds1IntervalPathSES=nncBellcoreGR820Ds1IntervalPathSES, nncBellcoreGR820Ds1StatisticsGroups=nncBellcoreGR820Ds1StatisticsGroups, nncBellcoreGR820Ds1IntervalStatsTable=nncBellcoreGR820Ds1IntervalStatsTable, nncBellcoreGR820Ds1TotalPathFC=nncBellcoreGR820Ds1TotalPathFC, nncBellcoreGR820Ds1TotalPathCV=nncBellcoreGR820Ds1TotalPathCV, nncBellcoreGR820Ds1IntervalLineES=nncBellcoreGR820Ds1IntervalLineES, nncBellcoreGR820Ds1IntervalPathCV=nncBellcoreGR820Ds1IntervalPathCV, nncBellcoreGR820Ds1StatisticsCompliances=nncBellcoreGR820Ds1StatisticsCompliances, nncBellcoreGR820Ds1IntervalPathES=nncBellcoreGR820Ds1IntervalPathES, nncBellcoreGR820Ds1IntervalLineCV=nncBellcoreGR820Ds1IntervalLineCV, nncBellcoreGR820Ds1CurrPathCSS=nncBellcoreGR820Ds1CurrPathCSS, nncBellcoreGR820Ds1IntervalLineLOSS=nncBellcoreGR820Ds1IntervalLineLOSS, nncBellcoreGR820Ds1CurrPathUAS=nncBellcoreGR820Ds1CurrPathUAS, nncBellcoreGR820Ds1IntervalPathAISS=nncBellcoreGR820Ds1IntervalPathAISS, nncBellcoreGR820Ds1StatisticsCompliance=nncBellcoreGR820Ds1StatisticsCompliance)
| (object_identifier, octet_string, integer) = mibBuilder.importSymbols('ASN1', 'ObjectIdentifier', 'OctetString', 'Integer')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(value_range_constraint, constraints_intersection, value_size_constraint, single_value_constraint, constraints_union) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ValueRangeConstraint', 'ConstraintsIntersection', 'ValueSizeConstraint', 'SingleValueConstraint', 'ConstraintsUnion')
(if_index,) = mibBuilder.importSymbols('IF-MIB', 'ifIndex')
(nnc_extensions,) = mibBuilder.importSymbols('NNCGNI0001-SMI', 'nncExtensions')
(object_group, notification_group, module_compliance) = mibBuilder.importSymbols('SNMPv2-CONF', 'ObjectGroup', 'NotificationGroup', 'ModuleCompliance')
(mib_identifier, notification_type, ip_address, object_identity, time_ticks, unsigned32, mib_scalar, mib_table, mib_table_row, mib_table_column, module_identity, gauge32, iso, counter64, integer32, bits, counter32) = mibBuilder.importSymbols('SNMPv2-SMI', 'MibIdentifier', 'NotificationType', 'IpAddress', 'ObjectIdentity', 'TimeTicks', 'Unsigned32', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'ModuleIdentity', 'Gauge32', 'iso', 'Counter64', 'Integer32', 'Bits', 'Counter32')
(textual_convention, display_string) = mibBuilder.importSymbols('SNMPv2-TC', 'TextualConvention', 'DisplayString')
nnc_bellcore_gr820_ds1_statistics = module_identity((1, 3, 6, 1, 4, 1, 123, 3, 70))
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1Statistics.setLastUpdated('9902151200Z')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1Statistics.setOrganization('Newbridge Networks Corporation')
nnc_bellcore_gr820_ds1_statistics_objects = mib_identifier((1, 3, 6, 1, 4, 1, 123, 3, 70, 1))
nnc_bellcore_gr820_ds1_statistics_groups = mib_identifier((1, 3, 6, 1, 4, 1, 123, 3, 70, 2))
nnc_bellcore_gr820_ds1_statistics_compliances = mib_identifier((1, 3, 6, 1, 4, 1, 123, 3, 70, 3))
nnc_bellcore_gr820_ds1_curr_stats_table = mib_table((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1))
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1CurrStatsTable.setStatus('current')
nnc_bellcore_gr820_ds1_curr_stats_entry = mib_table_row((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1CurrStatsEntry.setStatus('current')
nnc_bellcore_gr820_ds1_curr_line_cv = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 1), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1CurrLineCV.setStatus('current')
nnc_bellcore_gr820_ds1_curr_line_es = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 2), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1CurrLineES.setStatus('current')
nnc_bellcore_gr820_ds1_curr_line_loss = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 3), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1CurrLineLOSS.setStatus('current')
nnc_bellcore_gr820_ds1_curr_path_cv = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 4), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1CurrPathCV.setStatus('current')
nnc_bellcore_gr820_ds1_curr_path_es = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 5), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1CurrPathES.setStatus('current')
nnc_bellcore_gr820_ds1_curr_path_ses = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 6), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1CurrPathSES.setStatus('current')
nnc_bellcore_gr820_ds1_curr_path_aiss = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 7), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1CurrPathAISS.setStatus('current')
nnc_bellcore_gr820_ds1_curr_path_css = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 8), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1CurrPathCSS.setStatus('current')
nnc_bellcore_gr820_ds1_curr_path_uas = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 9), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1CurrPathUAS.setStatus('current')
nnc_bellcore_gr820_ds1_curr_path_sas = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 10), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1CurrPathSAS.setStatus('current')
nnc_bellcore_gr820_ds1_curr_path_fc = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 1, 1, 11), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1CurrPathFC.setStatus('current')
nnc_bellcore_gr820_ds1_interval_stats_table = mib_table((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2))
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1IntervalStatsTable.setStatus('current')
nnc_bellcore_gr820_ds1_interval_stats_entry = mib_table_row((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'), (0, 'NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1IntervalIndex'))
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1IntervalStatsEntry.setStatus('current')
nnc_bellcore_gr820_ds1_interval_index = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 96))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1IntervalIndex.setStatus('current')
nnc_bellcore_gr820_ds1_interval_line_cv = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 2), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1IntervalLineCV.setStatus('current')
nnc_bellcore_gr820_ds1_interval_line_es = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 3), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1IntervalLineES.setStatus('current')
nnc_bellcore_gr820_ds1_interval_line_loss = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 4), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1IntervalLineLOSS.setStatus('current')
nnc_bellcore_gr820_ds1_interval_path_cv = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 5), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1IntervalPathCV.setStatus('current')
nnc_bellcore_gr820_ds1_interval_path_es = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 6), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1IntervalPathES.setStatus('current')
nnc_bellcore_gr820_ds1_interval_path_ses = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 7), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1IntervalPathSES.setStatus('current')
nnc_bellcore_gr820_ds1_interval_path_aiss = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 8), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1IntervalPathAISS.setStatus('current')
nnc_bellcore_gr820_ds1_interval_path_css = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 9), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1IntervalPathCSS.setStatus('current')
nnc_bellcore_gr820_ds1_interval_path_uas = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 10), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1IntervalPathUAS.setStatus('current')
nnc_bellcore_gr820_ds1_interval_path_sas = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 11), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1IntervalPathSAS.setStatus('current')
nnc_bellcore_gr820_ds1_interval_path_fc = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 2, 1, 12), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1IntervalPathFC.setStatus('current')
nnc_bellcore_gr820_ds1_total_stats_table = mib_table((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3))
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1TotalStatsTable.setStatus('current')
nnc_bellcore_gr820_ds1_total_stats_entry = mib_table_row((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1)).setIndexNames((0, 'IF-MIB', 'ifIndex'))
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1TotalStatsEntry.setStatus('current')
nnc_bellcore_gr820_ds1_total_line_cv = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 1), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1TotalLineCV.setStatus('current')
nnc_bellcore_gr820_ds1_total_line_es = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 2), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1TotalLineES.setStatus('current')
nnc_bellcore_gr820_ds1_total_line_loss = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 3), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1TotalLineLOSS.setStatus('current')
nnc_bellcore_gr820_ds1_total_path_cv = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 4), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1TotalPathCV.setStatus('current')
nnc_bellcore_gr820_ds1_total_path_es = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 5), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1TotalPathES.setStatus('current')
nnc_bellcore_gr820_ds1_total_path_ses = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 6), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1TotalPathSES.setStatus('current')
nnc_bellcore_gr820_ds1_total_path_aiss = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 7), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1TotalPathAISS.setStatus('current')
nnc_bellcore_gr820_ds1_total_path_css = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 8), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1TotalPathCSS.setStatus('current')
nnc_bellcore_gr820_ds1_total_path_uas = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 9), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1TotalPathUAS.setStatus('current')
nnc_bellcore_gr820_ds1_total_path_sas = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 10), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1TotalPathSAS.setStatus('current')
nnc_bellcore_gr820_ds1_total_path_fc = mib_table_column((1, 3, 6, 1, 4, 1, 123, 3, 70, 1, 3, 1, 11), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
nncBellcoreGR820Ds1TotalPathFC.setStatus('current')
nnc_bellcore_gr820_ds1_curr_stats_group = object_group((1, 3, 6, 1, 4, 1, 123, 3, 70, 2, 1)).setObjects(('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1CurrLineCV'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1CurrLineES'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1CurrLineLOSS'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1CurrPathCV'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1CurrPathES'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1CurrPathSES'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1CurrPathAISS'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1CurrPathCSS'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1CurrPathUAS'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1CurrPathSAS'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1CurrPathFC'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
nnc_bellcore_gr820_ds1_curr_stats_group = nncBellcoreGR820Ds1CurrStatsGroup.setStatus('current')
nnc_bellcore_gr820_ds1_interval_stats_group = object_group((1, 3, 6, 1, 4, 1, 123, 3, 70, 2, 2)).setObjects(('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1IntervalIndex'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1IntervalLineCV'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1IntervalLineES'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1IntervalLineLOSS'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1IntervalPathCV'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1IntervalPathES'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1IntervalPathSES'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1IntervalPathAISS'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1IntervalPathCSS'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1IntervalPathUAS'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1IntervalPathSAS'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1IntervalPathFC'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
nnc_bellcore_gr820_ds1_interval_stats_group = nncBellcoreGR820Ds1IntervalStatsGroup.setStatus('current')
nnc_bellcore_gr820_ds1_total_stats_group = object_group((1, 3, 6, 1, 4, 1, 123, 3, 70, 2, 3)).setObjects(('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1TotalLineCV'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1TotalLineES'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1TotalLineLOSS'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1TotalPathCV'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1TotalPathES'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1TotalPathSES'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1TotalPathAISS'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1TotalPathCSS'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1TotalPathUAS'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1TotalPathSAS'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1TotalPathFC'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
nnc_bellcore_gr820_ds1_total_stats_group = nncBellcoreGR820Ds1TotalStatsGroup.setStatus('current')
nnc_bellcore_gr820_ds1_statistics_compliance = module_compliance((1, 3, 6, 1, 4, 1, 123, 3, 70, 3, 1)).setObjects(('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1CurrStatsGroup'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1IntervalStatsGroup'), ('NNCBELLCOREGR820DS1STATISTICS-MIB', 'nncBellcoreGR820Ds1TotalStatsGroup'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
nnc_bellcore_gr820_ds1_statistics_compliance = nncBellcoreGR820Ds1StatisticsCompliance.setStatus('current')
mibBuilder.exportSymbols('NNCBELLCOREGR820DS1STATISTICS-MIB', nncBellcoreGR820Ds1TotalPathSAS=nncBellcoreGR820Ds1TotalPathSAS, nncBellcoreGR820Ds1TotalStatsEntry=nncBellcoreGR820Ds1TotalStatsEntry, nncBellcoreGR820Ds1TotalStatsGroup=nncBellcoreGR820Ds1TotalStatsGroup, nncBellcoreGR820Ds1CurrLineLOSS=nncBellcoreGR820Ds1CurrLineLOSS, nncBellcoreGR820Ds1CurrStatsGroup=nncBellcoreGR820Ds1CurrStatsGroup, nncBellcoreGR820Ds1IntervalPathCSS=nncBellcoreGR820Ds1IntervalPathCSS, nncBellcoreGR820Ds1IntervalPathFC=nncBellcoreGR820Ds1IntervalPathFC, nncBellcoreGR820Ds1TotalLineES=nncBellcoreGR820Ds1TotalLineES, nncBellcoreGR820Ds1TotalPathSES=nncBellcoreGR820Ds1TotalPathSES, nncBellcoreGR820Ds1CurrPathES=nncBellcoreGR820Ds1CurrPathES, nncBellcoreGR820Ds1TotalPathES=nncBellcoreGR820Ds1TotalPathES, nncBellcoreGR820Ds1CurrLineES=nncBellcoreGR820Ds1CurrLineES, nncBellcoreGR820Ds1CurrStatsTable=nncBellcoreGR820Ds1CurrStatsTable, nncBellcoreGR820Ds1CurrStatsEntry=nncBellcoreGR820Ds1CurrStatsEntry, nncBellcoreGR820Ds1TotalPathAISS=nncBellcoreGR820Ds1TotalPathAISS, nncBellcoreGR820Ds1CurrPathSAS=nncBellcoreGR820Ds1CurrPathSAS, nncBellcoreGR820Ds1IntervalPathUAS=nncBellcoreGR820Ds1IntervalPathUAS, nncBellcoreGR820Ds1IntervalStatsGroup=nncBellcoreGR820Ds1IntervalStatsGroup, nncBellcoreGR820Ds1CurrPathSES=nncBellcoreGR820Ds1CurrPathSES, nncBellcoreGR820Ds1IntervalPathSAS=nncBellcoreGR820Ds1IntervalPathSAS, nncBellcoreGR820Ds1Statistics=nncBellcoreGR820Ds1Statistics, nncBellcoreGR820Ds1StatisticsObjects=nncBellcoreGR820Ds1StatisticsObjects, nncBellcoreGR820Ds1CurrPathCV=nncBellcoreGR820Ds1CurrPathCV, nncBellcoreGR820Ds1TotalLineLOSS=nncBellcoreGR820Ds1TotalLineLOSS, nncBellcoreGR820Ds1IntervalStatsEntry=nncBellcoreGR820Ds1IntervalStatsEntry, nncBellcoreGR820Ds1TotalLineCV=nncBellcoreGR820Ds1TotalLineCV, nncBellcoreGR820Ds1TotalStatsTable=nncBellcoreGR820Ds1TotalStatsTable, nncBellcoreGR820Ds1IntervalIndex=nncBellcoreGR820Ds1IntervalIndex, PYSNMP_MODULE_ID=nncBellcoreGR820Ds1Statistics, nncBellcoreGR820Ds1CurrLineCV=nncBellcoreGR820Ds1CurrLineCV, nncBellcoreGR820Ds1CurrPathAISS=nncBellcoreGR820Ds1CurrPathAISS, nncBellcoreGR820Ds1TotalPathUAS=nncBellcoreGR820Ds1TotalPathUAS, nncBellcoreGR820Ds1TotalPathCSS=nncBellcoreGR820Ds1TotalPathCSS, nncBellcoreGR820Ds1CurrPathFC=nncBellcoreGR820Ds1CurrPathFC, nncBellcoreGR820Ds1IntervalPathSES=nncBellcoreGR820Ds1IntervalPathSES, nncBellcoreGR820Ds1StatisticsGroups=nncBellcoreGR820Ds1StatisticsGroups, nncBellcoreGR820Ds1IntervalStatsTable=nncBellcoreGR820Ds1IntervalStatsTable, nncBellcoreGR820Ds1TotalPathFC=nncBellcoreGR820Ds1TotalPathFC, nncBellcoreGR820Ds1TotalPathCV=nncBellcoreGR820Ds1TotalPathCV, nncBellcoreGR820Ds1IntervalLineES=nncBellcoreGR820Ds1IntervalLineES, nncBellcoreGR820Ds1IntervalPathCV=nncBellcoreGR820Ds1IntervalPathCV, nncBellcoreGR820Ds1StatisticsCompliances=nncBellcoreGR820Ds1StatisticsCompliances, nncBellcoreGR820Ds1IntervalPathES=nncBellcoreGR820Ds1IntervalPathES, nncBellcoreGR820Ds1IntervalLineCV=nncBellcoreGR820Ds1IntervalLineCV, nncBellcoreGR820Ds1CurrPathCSS=nncBellcoreGR820Ds1CurrPathCSS, nncBellcoreGR820Ds1IntervalLineLOSS=nncBellcoreGR820Ds1IntervalLineLOSS, nncBellcoreGR820Ds1CurrPathUAS=nncBellcoreGR820Ds1CurrPathUAS, nncBellcoreGR820Ds1IntervalPathAISS=nncBellcoreGR820Ds1IntervalPathAISS, nncBellcoreGR820Ds1StatisticsCompliance=nncBellcoreGR820Ds1StatisticsCompliance) |
cities = [
{
"city": "New York",
"growth_from_2000_to_2013": "4.8%",
"latitude": 40.7127837,
"longitude": -74.0059413,
"population": "8405837",
"rank": "1",
"state": "New York",
},
{
"city": "Los Angeles",
"growth_from_2000_to_2013": "4.8%",
"latitude": 34.0522342,
"longitude": -118.2436849,
"population": "3884307",
"rank": "2",
"state": "California",
},
{
"city": "Chicago",
"growth_from_2000_to_2013": "-6.1%",
"latitude": 41.8781136,
"longitude": -87.6297982,
"population": "2718782",
"rank": "3",
"state": "Illinois",
},
{
"city": "Houston",
"growth_from_2000_to_2013": "11.0%",
"latitude": 29.7604267,
"longitude": -95.3698028,
"population": "2195914",
"rank": "4",
"state": "Texas",
},
{
"city": "Philadelphia",
"growth_from_2000_to_2013": "2.6%",
"latitude": 39.9525839,
"longitude": -75.1652215,
"population": "1553165",
"rank": "5",
"state": "Pennsylvania",
},
{
"city": "Phoenix",
"growth_from_2000_to_2013": "14.0%",
"latitude": 33.4483771,
"longitude": -112.0740373,
"population": "1513367",
"rank": "6",
"state": "Arizona",
},
{
"city": "San Antonio",
"growth_from_2000_to_2013": "21.0%",
"latitude": 29.4241219,
"longitude": -98.49362819999999,
"population": "1409019",
"rank": "7",
"state": "Texas",
},
{
"city": "San Diego",
"growth_from_2000_to_2013": "10.5%",
"latitude": 32.715738,
"longitude": -117.1610838,
"population": "1355896",
"rank": "8",
"state": "California",
},
{
"city": "Dallas",
"growth_from_2000_to_2013": "5.6%",
"latitude": 32.7766642,
"longitude": -96.79698789999999,
"population": "1257676",
"rank": "9",
"state": "Texas",
},
{
"city": "San Jose",
"growth_from_2000_to_2013": "10.5%",
"latitude": 37.3382082,
"longitude": -121.8863286,
"population": "998537",
"rank": "10",
"state": "California",
},
{
"city": "Austin",
"growth_from_2000_to_2013": "31.7%",
"latitude": 30.267153,
"longitude": -97.7430608,
"population": "885400",
"rank": "11",
"state": "Texas",
},
{
"city": "Indianapolis",
"growth_from_2000_to_2013": "7.8%",
"latitude": 39.768403,
"longitude": -86.158068,
"population": "843393",
"rank": "12",
"state": "Indiana",
},
{
"city": "Jacksonville",
"growth_from_2000_to_2013": "14.3%",
"latitude": 30.3321838,
"longitude": -81.65565099999999,
"population": "842583",
"rank": "13",
"state": "Florida",
},
{
"city": "San Francisco",
"growth_from_2000_to_2013": "7.7%",
"latitude": 37.7749295,
"longitude": -122.4194155,
"population": "837442",
"rank": "14",
"state": "California",
},
{
"city": "Columbus",
"growth_from_2000_to_2013": "14.8%",
"latitude": 39.9611755,
"longitude": -82.99879419999999,
"population": "822553",
"rank": "15",
"state": "Ohio",
},
{
"city": "Charlotte",
"growth_from_2000_to_2013": "39.1%",
"latitude": 35.2270869,
"longitude": -80.8431267,
"population": "792862",
"rank": "16",
"state": "North Carolina",
},
{
"city": "Fort Worth",
"growth_from_2000_to_2013": "45.1%",
"latitude": 32.7554883,
"longitude": -97.3307658,
"population": "792727",
"rank": "17",
"state": "Texas",
},
{
"city": "Detroit",
"growth_from_2000_to_2013": "-27.1%",
"latitude": 42.331427,
"longitude": -83.0457538,
"population": "688701",
"rank": "18",
"state": "Michigan",
},
{
"city": "El Paso",
"growth_from_2000_to_2013": "19.4%",
"latitude": 31.7775757,
"longitude": -106.4424559,
"population": "674433",
"rank": "19",
"state": "Texas",
},
{
"city": "Memphis",
"growth_from_2000_to_2013": "-5.3%",
"latitude": 35.1495343,
"longitude": -90.0489801,
"population": "653450",
"rank": "20",
"state": "Tennessee",
},
{
"city": "Seattle",
"growth_from_2000_to_2013": "15.6%",
"latitude": 47.6062095,
"longitude": -122.3320708,
"population": "652405",
"rank": "21",
"state": "Washington",
},
{
"city": "Denver",
"growth_from_2000_to_2013": "16.7%",
"latitude": 39.7392358,
"longitude": -104.990251,
"population": "649495",
"rank": "22",
"state": "Colorado",
},
{
"city": "Washington",
"growth_from_2000_to_2013": "13.0%",
"latitude": 38.9071923,
"longitude": -77.0368707,
"population": "646449",
"rank": "23",
"state": "District of Columbia",
},
{
"city": "Boston",
"growth_from_2000_to_2013": "9.4%",
"latitude": 42.3600825,
"longitude": -71.0588801,
"population": "645966",
"rank": "24",
"state": "Massachusetts",
},
{
"city": "Nashville-Davidson",
"growth_from_2000_to_2013": "16.2%",
"latitude": 36.1626638,
"longitude": -86.7816016,
"population": "634464",
"rank": "25",
"state": "Tennessee",
},
{
"city": "Baltimore",
"growth_from_2000_to_2013": "-4.0%",
"latitude": 39.2903848,
"longitude": -76.6121893,
"population": "622104",
"rank": "26",
"state": "Maryland",
},
{
"city": "Oklahoma City",
"growth_from_2000_to_2013": "20.2%",
"latitude": 35.4675602,
"longitude": -97.5164276,
"population": "610613",
"rank": "27",
"state": "Oklahoma",
},
{
"city": "Louisville/Jefferson County",
"growth_from_2000_to_2013": "10.0%",
"latitude": 38.2526647,
"longitude": -85.7584557,
"population": "609893",
"rank": "28",
"state": "Kentucky",
},
{
"city": "Portland",
"growth_from_2000_to_2013": "15.0%",
"latitude": 45.5230622,
"longitude": -122.6764816,
"population": "609456",
"rank": "29",
"state": "Oregon",
},
{
"city": "Las Vegas",
"growth_from_2000_to_2013": "24.5%",
"latitude": 36.1699412,
"longitude": -115.1398296,
"population": "603488",
"rank": "30",
"state": "Nevada",
},
{
"city": "Milwaukee",
"growth_from_2000_to_2013": "0.3%",
"latitude": 43.0389025,
"longitude": -87.9064736,
"population": "599164",
"rank": "31",
"state": "Wisconsin",
},
{
"city": "Albuquerque",
"growth_from_2000_to_2013": "23.5%",
"latitude": 35.0853336,
"longitude": -106.6055534,
"population": "556495",
"rank": "32",
"state": "New Mexico",
},
{
"city": "Tucson",
"growth_from_2000_to_2013": "7.5%",
"latitude": 32.2217429,
"longitude": -110.926479,
"population": "526116",
"rank": "33",
"state": "Arizona",
},
{
"city": "Fresno",
"growth_from_2000_to_2013": "18.3%",
"latitude": 36.7468422,
"longitude": -119.7725868,
"population": "509924",
"rank": "34",
"state": "California",
},
{
"city": "Sacramento",
"growth_from_2000_to_2013": "17.2%",
"latitude": 38.5815719,
"longitude": -121.4943996,
"population": "479686",
"rank": "35",
"state": "California",
},
{
"city": "Long Beach",
"growth_from_2000_to_2013": "1.5%",
"latitude": 33.7700504,
"longitude": -118.1937395,
"population": "469428",
"rank": "36",
"state": "California",
},
{
"city": "Kansas City",
"growth_from_2000_to_2013": "5.5%",
"latitude": 39.0997265,
"longitude": -94.5785667,
"population": "467007",
"rank": "37",
"state": "Missouri",
},
{
"city": "Mesa",
"growth_from_2000_to_2013": "13.5%",
"latitude": 33.4151843,
"longitude": -111.8314724,
"population": "457587",
"rank": "38",
"state": "Arizona",
},
{
"city": "Virginia Beach",
"growth_from_2000_to_2013": "5.1%",
"latitude": 36.8529263,
"longitude": -75.97798499999999,
"population": "448479",
"rank": "39",
"state": "Virginia",
},
{
"city": "Atlanta",
"growth_from_2000_to_2013": "6.2%",
"latitude": 33.7489954,
"longitude": -84.3879824,
"population": "447841",
"rank": "40",
"state": "Georgia",
},
{
"city": "Colorado Springs",
"growth_from_2000_to_2013": "21.4%",
"latitude": 38.8338816,
"longitude": -104.8213634,
"population": "439886",
"rank": "41",
"state": "Colorado",
},
{
"city": "Omaha",
"growth_from_2000_to_2013": "5.9%",
"latitude": 41.2523634,
"longitude": -95.99798829999999,
"population": "434353",
"rank": "42",
"state": "Nebraska",
},
{
"city": "Raleigh",
"growth_from_2000_to_2013": "48.7%",
"latitude": 35.7795897,
"longitude": -78.6381787,
"population": "431746",
"rank": "43",
"state": "North Carolina",
},
{
"city": "Miami",
"growth_from_2000_to_2013": "14.9%",
"latitude": 25.7616798,
"longitude": -80.1917902,
"population": "417650",
"rank": "44",
"state": "Florida",
},
{
"city": "Oakland",
"growth_from_2000_to_2013": "1.3%",
"latitude": 37.8043637,
"longitude": -122.2711137,
"population": "406253",
"rank": "45",
"state": "California",
},
{
"city": "Minneapolis",
"growth_from_2000_to_2013": "4.5%",
"latitude": 44.977753,
"longitude": -93.2650108,
"population": "400070",
"rank": "46",
"state": "Minnesota",
},
{
"city": "Tulsa",
"growth_from_2000_to_2013": "1.3%",
"latitude": 36.1539816,
"longitude": -95.99277500000001,
"population": "398121",
"rank": "47",
"state": "Oklahoma",
},
{
"city": "Cleveland",
"growth_from_2000_to_2013": "-18.1%",
"latitude": 41.49932,
"longitude": -81.6943605,
"population": "390113",
"rank": "48",
"state": "Ohio",
},
{
"city": "Wichita",
"growth_from_2000_to_2013": "9.7%",
"latitude": 37.688889,
"longitude": -97.336111,
"population": "386552",
"rank": "49",
"state": "Kansas",
},
{
"city": "Arlington",
"growth_from_2000_to_2013": "13.3%",
"latitude": 32.735687,
"longitude": -97.10806559999999,
"population": "379577",
"rank": "50",
"state": "Texas",
},
{
"city": "New Orleans",
"growth_from_2000_to_2013": "-21.6%",
"latitude": 29.95106579999999,
"longitude": -90.0715323,
"population": "378715",
"rank": "51",
"state": "Louisiana",
},
{
"city": "Bakersfield",
"growth_from_2000_to_2013": "48.4%",
"latitude": 35.3732921,
"longitude": -119.0187125,
"population": "363630",
"rank": "52",
"state": "California",
},
{
"city": "Tampa",
"growth_from_2000_to_2013": "16.0%",
"latitude": 27.950575,
"longitude": -82.4571776,
"population": "352957",
"rank": "53",
"state": "Florida",
},
{
"city": "Honolulu",
"growth_from_2000_to_2013": "-6.2%",
"latitude": 21.3069444,
"longitude": -157.8583333,
"population": "347884",
"rank": "54",
"state": "Hawaii",
},
{
"city": "Aurora",
"growth_from_2000_to_2013": "24.4%",
"latitude": 39.7294319,
"longitude": -104.8319195,
"population": "345803",
"rank": "55",
"state": "Colorado",
},
{
"city": "Anaheim",
"growth_from_2000_to_2013": "4.7%",
"latitude": 33.8352932,
"longitude": -117.9145036,
"population": "345012",
"rank": "56",
"state": "California",
},
{
"city": "Santa Ana",
"growth_from_2000_to_2013": "-1.2%",
"latitude": 33.7455731,
"longitude": -117.8678338,
"population": "334227",
"rank": "57",
"state": "California",
},
{
"city": "St. Louis",
"growth_from_2000_to_2013": "-8.2%",
"latitude": 38.6270025,
"longitude": -90.19940419999999,
"population": "318416",
"rank": "58",
"state": "Missouri",
},
{
"city": "Riverside",
"growth_from_2000_to_2013": "22.5%",
"latitude": 33.9533487,
"longitude": -117.3961564,
"population": "316619",
"rank": "59",
"state": "California",
},
{
"city": "Corpus Christi",
"growth_from_2000_to_2013": "14.1%",
"latitude": 27.8005828,
"longitude": -97.39638099999999,
"population": "316381",
"rank": "60",
"state": "Texas",
},
{
"city": "Lexington-Fayette",
"growth_from_2000_to_2013": "18.0%",
"latitude": 38.0405837,
"longitude": -84.5037164,
"population": "308428",
"rank": "61",
"state": "Kentucky",
},
{
"city": "Pittsburgh",
"growth_from_2000_to_2013": "-8.3%",
"latitude": 40.44062479999999,
"longitude": -79.9958864,
"population": "305841",
"rank": "62",
"state": "Pennsylvania",
},
{
"city": "Anchorage",
"growth_from_2000_to_2013": "15.4%",
"latitude": 61.2180556,
"longitude": -149.9002778,
"population": "300950",
"rank": "63",
"state": "Alaska",
},
{
"city": "Stockton",
"growth_from_2000_to_2013": "21.8%",
"latitude": 37.9577016,
"longitude": -121.2907796,
"population": "298118",
"rank": "64",
"state": "California",
},
{
"city": "Cincinnati",
"growth_from_2000_to_2013": "-10.1%",
"latitude": 39.1031182,
"longitude": -84.5120196,
"population": "297517",
"rank": "65",
"state": "Ohio",
},
{
"city": "St. Paul",
"growth_from_2000_to_2013": "2.8%",
"latitude": 44.9537029,
"longitude": -93.0899578,
"population": "294873",
"rank": "66",
"state": "Minnesota",
},
{
"city": "Toledo",
"growth_from_2000_to_2013": "-10.0%",
"latitude": 41.6639383,
"longitude": -83.55521200000001,
"population": "282313",
"rank": "67",
"state": "Ohio",
},
{
"city": "Greensboro",
"growth_from_2000_to_2013": "22.3%",
"latitude": 36.0726354,
"longitude": -79.7919754,
"population": "279639",
"rank": "68",
"state": "North Carolina",
},
{
"city": "Newark",
"growth_from_2000_to_2013": "2.1%",
"latitude": 40.735657,
"longitude": -74.1723667,
"population": "278427",
"rank": "69",
"state": "New Jersey",
},
{
"city": "Plano",
"growth_from_2000_to_2013": "22.4%",
"latitude": 33.0198431,
"longitude": -96.6988856,
"population": "274409",
"rank": "70",
"state": "Texas",
},
{
"city": "Henderson",
"growth_from_2000_to_2013": "51.0%",
"latitude": 36.0395247,
"longitude": -114.9817213,
"population": "270811",
"rank": "71",
"state": "Nevada",
},
{
"city": "Lincoln",
"growth_from_2000_to_2013": "18.0%",
"latitude": 40.8257625,
"longitude": -96.6851982,
"population": "268738",
"rank": "72",
"state": "Nebraska",
},
{
"city": "Buffalo",
"growth_from_2000_to_2013": "-11.3%",
"latitude": 42.88644679999999,
"longitude": -78.8783689,
"population": "258959",
"rank": "73",
"state": "New York",
},
{
"city": "Jersey City",
"growth_from_2000_to_2013": "7.2%",
"latitude": 40.72815749999999,
"longitude": -74.0776417,
"population": "257342",
"rank": "74",
"state": "New Jersey",
},
{
"city": "Chula Vista",
"growth_from_2000_to_2013": "46.2%",
"latitude": 32.6400541,
"longitude": -117.0841955,
"population": "256780",
"rank": "75",
"state": "California",
},
{
"city": "Fort Wayne",
"growth_from_2000_to_2013": "1.0%",
"latitude": 41.079273,
"longitude": -85.1393513,
"population": "256496",
"rank": "76",
"state": "Indiana",
},
{
"city": "Orlando",
"growth_from_2000_to_2013": "31.2%",
"latitude": 28.5383355,
"longitude": -81.3792365,
"population": "255483",
"rank": "77",
"state": "Florida",
},
{
"city": "St. Petersburg",
"growth_from_2000_to_2013": "0.3%",
"latitude": 27.773056,
"longitude": -82.64,
"population": "249688",
"rank": "78",
"state": "Florida",
},
{
"city": "Chandler",
"growth_from_2000_to_2013": "38.7%",
"latitude": 33.3061605,
"longitude": -111.8412502,
"population": "249146",
"rank": "79",
"state": "Arizona",
},
{
"city": "Laredo",
"growth_from_2000_to_2013": "38.2%",
"latitude": 27.5305671,
"longitude": -99.48032409999999,
"population": "248142",
"rank": "80",
"state": "Texas",
},
{
"city": "Norfolk",
"growth_from_2000_to_2013": "5.0%",
"latitude": 36.8507689,
"longitude": -76.28587259999999,
"population": "246139",
"rank": "81",
"state": "Virginia",
},
{
"city": "Durham",
"growth_from_2000_to_2013": "29.9%",
"latitude": 35.9940329,
"longitude": -78.898619,
"population": "245475",
"rank": "82",
"state": "North Carolina",
},
{
"city": "Madison",
"growth_from_2000_to_2013": "15.8%",
"latitude": 43.0730517,
"longitude": -89.4012302,
"population": "243344",
"rank": "83",
"state": "Wisconsin",
},
{
"city": "Lubbock",
"growth_from_2000_to_2013": "19.6%",
"latitude": 33.5778631,
"longitude": -101.8551665,
"population": "239538",
"rank": "84",
"state": "Texas",
},
{
"city": "Irvine",
"growth_from_2000_to_2013": "61.3%",
"latitude": 33.6839473,
"longitude": -117.7946942,
"population": "236716",
"rank": "85",
"state": "California",
},
{
"city": "Winston-Salem",
"growth_from_2000_to_2013": "16.9%",
"latitude": 36.09985959999999,
"longitude": -80.244216,
"population": "236441",
"rank": "86",
"state": "North Carolina",
},
{
"city": "Glendale",
"growth_from_2000_to_2013": "5.7%",
"latitude": 33.5386523,
"longitude": -112.1859866,
"population": "234632",
"rank": "87",
"state": "Arizona",
},
{
"city": "Garland",
"growth_from_2000_to_2013": "8.5%",
"latitude": 32.912624,
"longitude": -96.63888329999999,
"population": "234566",
"rank": "88",
"state": "Texas",
},
{
"city": "Hialeah",
"growth_from_2000_to_2013": "3.2%",
"latitude": 25.8575963,
"longitude": -80.2781057,
"population": "233394",
"rank": "89",
"state": "Florida",
},
{
"city": "Reno",
"growth_from_2000_to_2013": "26.8%",
"latitude": 39.5296329,
"longitude": -119.8138027,
"population": "233294",
"rank": "90",
"state": "Nevada",
},
{
"city": "Chesapeake",
"growth_from_2000_to_2013": "15.1%",
"latitude": 36.7682088,
"longitude": -76.2874927,
"population": "230571",
"rank": "91",
"state": "Virginia",
},
{
"city": "Gilbert",
"growth_from_2000_to_2013": "96.0%",
"latitude": 33.3528264,
"longitude": -111.789027,
"population": "229972",
"rank": "92",
"state": "Arizona",
},
{
"city": "Baton Rouge",
"growth_from_2000_to_2013": "0.4%",
"latitude": 30.4582829,
"longitude": -91.1403196,
"population": "229426",
"rank": "93",
"state": "Louisiana",
},
{
"city": "Irving",
"growth_from_2000_to_2013": "19.1%",
"latitude": 32.8140177,
"longitude": -96.9488945,
"population": "228653",
"rank": "94",
"state": "Texas",
},
{
"city": "Scottsdale",
"growth_from_2000_to_2013": "11.0%",
"latitude": 33.4941704,
"longitude": -111.9260519,
"population": "226918",
"rank": "95",
"state": "Arizona",
},
{
"city": "North Las Vegas",
"growth_from_2000_to_2013": "92.2%",
"latitude": 36.1988592,
"longitude": -115.1175013,
"population": "226877",
"rank": "96",
"state": "Nevada",
},
{
"city": "Fremont",
"growth_from_2000_to_2013": "10.0%",
"latitude": 37.5482697,
"longitude": -121.9885719,
"population": "224922",
"rank": "97",
"state": "California",
},
{
"city": "Boise City",
"growth_from_2000_to_2013": "9.5%",
"latitude": 43.6187102,
"longitude": -116.2146068,
"population": "214237",
"rank": "98",
"state": "Idaho",
},
{
"city": "Richmond",
"growth_from_2000_to_2013": "8.2%",
"latitude": 37.5407246,
"longitude": -77.4360481,
"population": "214114",
"rank": "99",
"state": "Virginia",
},
{
"city": "San Bernardino",
"growth_from_2000_to_2013": "13.0%",
"latitude": 34.1083449,
"longitude": -117.2897652,
"population": "213708",
"rank": "100",
"state": "California",
},
{
"city": "Birmingham",
"growth_from_2000_to_2013": "-12.3%",
"latitude": 33.5206608,
"longitude": -86.80248999999999,
"population": "212113",
"rank": "101",
"state": "Alabama",
},
{
"city": "Spokane",
"growth_from_2000_to_2013": "7.0%",
"latitude": 47.6587802,
"longitude": -117.4260466,
"population": "210721",
"rank": "102",
"state": "Washington",
},
{
"city": "Rochester",
"growth_from_2000_to_2013": "-4.1%",
"latitude": 43.16103,
"longitude": -77.6109219,
"population": "210358",
"rank": "103",
"state": "New York",
},
{
"city": "Des Moines",
"growth_from_2000_to_2013": "3.9%",
"latitude": 41.6005448,
"longitude": -93.6091064,
"population": "207510",
"rank": "104",
"state": "Iowa",
},
{
"city": "Modesto",
"growth_from_2000_to_2013": "7.7%",
"latitude": 37.63909719999999,
"longitude": -120.9968782,
"population": "204933",
"rank": "105",
"state": "California",
},
{
"city": "Fayetteville",
"growth_from_2000_to_2013": "2.4%",
"latitude": 35.0526641,
"longitude": -78.87835849999999,
"population": "204408",
"rank": "106",
"state": "North Carolina",
},
{
"city": "Tacoma",
"growth_from_2000_to_2013": "4.9%",
"latitude": 47.2528768,
"longitude": -122.4442906,
"population": "203446",
"rank": "107",
"state": "Washington",
},
{
"city": "Oxnard",
"growth_from_2000_to_2013": "18.2%",
"latitude": 34.1975048,
"longitude": -119.1770516,
"population": "203007",
"rank": "108",
"state": "California",
},
{
"city": "Fontana",
"growth_from_2000_to_2013": "38.3%",
"latitude": 34.0922335,
"longitude": -117.435048,
"population": "203003",
"rank": "109",
"state": "California",
},
{
"city": "Columbus",
"growth_from_2000_to_2013": "8.7%",
"latitude": 32.4609764,
"longitude": -84.9877094,
"population": "202824",
"rank": "110",
"state": "Georgia",
},
{
"city": "Montgomery",
"growth_from_2000_to_2013": "-0.1%",
"latitude": 32.3668052,
"longitude": -86.2999689,
"population": "201332",
"rank": "111",
"state": "Alabama",
},
{
"city": "Moreno Valley",
"growth_from_2000_to_2013": "40.4%",
"latitude": 33.9424658,
"longitude": -117.2296717,
"population": "201175",
"rank": "112",
"state": "California",
},
{
"city": "Shreveport",
"growth_from_2000_to_2013": "-0.1%",
"latitude": 32.5251516,
"longitude": -93.7501789,
"population": "200327",
"rank": "113",
"state": "Louisiana",
},
{
"city": "Aurora",
"growth_from_2000_to_2013": "38.4%",
"latitude": 41.7605849,
"longitude": -88.32007150000001,
"population": "199963",
"rank": "114",
"state": "Illinois",
},
{
"city": "Yonkers",
"growth_from_2000_to_2013": "1.8%",
"latitude": 40.9312099,
"longitude": -73.89874689999999,
"population": "199766",
"rank": "115",
"state": "New York",
},
{
"city": "Akron",
"growth_from_2000_to_2013": "-8.6%",
"latitude": 41.0814447,
"longitude": -81.51900529999999,
"population": "198100",
"rank": "116",
"state": "Ohio",
},
{
"city": "Huntington Beach",
"growth_from_2000_to_2013": "3.9%",
"latitude": 33.660297,
"longitude": -117.9992265,
"population": "197575",
"rank": "117",
"state": "California",
},
{
"city": "Little Rock",
"growth_from_2000_to_2013": "7.6%",
"latitude": 34.7464809,
"longitude": -92.28959479999999,
"population": "197357",
"rank": "118",
"state": "Arkansas",
},
{
"city": "Augusta-Richmond County",
"growth_from_2000_to_2013": "1.1%",
"latitude": 33.4734978,
"longitude": -82.0105148,
"population": "197350",
"rank": "119",
"state": "Georgia",
},
{
"city": "Amarillo",
"growth_from_2000_to_2013": "12.8%",
"latitude": 35.2219971,
"longitude": -101.8312969,
"population": "196429",
"rank": "120",
"state": "Texas",
},
{
"city": "Glendale",
"growth_from_2000_to_2013": "0.3%",
"latitude": 34.1425078,
"longitude": -118.255075,
"population": "196021",
"rank": "121",
"state": "California",
},
{
"city": "Mobile",
"growth_from_2000_to_2013": "-1.9%",
"latitude": 30.6953657,
"longitude": -88.0398912,
"population": "194899",
"rank": "122",
"state": "Alabama",
},
{
"city": "Grand Rapids",
"growth_from_2000_to_2013": "-2.8%",
"latitude": 42.9633599,
"longitude": -85.6680863,
"population": "192294",
"rank": "123",
"state": "Michigan",
},
{
"city": "Salt Lake City",
"growth_from_2000_to_2013": "5.1%",
"latitude": 40.7607793,
"longitude": -111.8910474,
"population": "191180",
"rank": "124",
"state": "Utah",
},
{
"city": "Tallahassee",
"growth_from_2000_to_2013": "21.8%",
"latitude": 30.4382559,
"longitude": -84.28073289999999,
"population": "186411",
"rank": "125",
"state": "Florida",
},
{
"city": "Huntsville",
"growth_from_2000_to_2013": "16.3%",
"latitude": 34.7303688,
"longitude": -86.5861037,
"population": "186254",
"rank": "126",
"state": "Alabama",
},
{
"city": "Grand Prairie",
"growth_from_2000_to_2013": "43.1%",
"latitude": 32.7459645,
"longitude": -96.99778459999999,
"population": "183372",
"rank": "127",
"state": "Texas",
},
{
"city": "Knoxville",
"growth_from_2000_to_2013": "3.9%",
"latitude": 35.9606384,
"longitude": -83.9207392,
"population": "183270",
"rank": "128",
"state": "Tennessee",
},
{
"city": "Worcester",
"growth_from_2000_to_2013": "5.8%",
"latitude": 42.2625932,
"longitude": -71.8022934,
"population": "182544",
"rank": "129",
"state": "Massachusetts",
},
{
"city": "Newport News",
"growth_from_2000_to_2013": "0.9%",
"latitude": 37.0870821,
"longitude": -76.4730122,
"population": "182020",
"rank": "130",
"state": "Virginia",
},
{
"city": "Brownsville",
"growth_from_2000_to_2013": "26.8%",
"latitude": 25.9017472,
"longitude": -97.4974838,
"population": "181860",
"rank": "131",
"state": "Texas",
},
{
"city": "Overland Park",
"growth_from_2000_to_2013": "19.4%",
"latitude": 38.9822282,
"longitude": -94.6707917,
"population": "181260",
"rank": "132",
"state": "Kansas",
},
{
"city": "Santa Clarita",
"growth_from_2000_to_2013": "15.3%",
"latitude": 34.3916641,
"longitude": -118.542586,
"population": "179590",
"rank": "133",
"state": "California",
},
{
"city": "Providence",
"growth_from_2000_to_2013": "2.3%",
"latitude": 41.8239891,
"longitude": -71.4128343,
"population": "177994",
"rank": "134",
"state": "Rhode Island",
},
{
"city": "Garden Grove",
"growth_from_2000_to_2013": "5.8%",
"latitude": 33.7739053,
"longitude": -117.9414477,
"population": "175140",
"rank": "135",
"state": "California",
},
{
"city": "Chattanooga",
"growth_from_2000_to_2013": "10.5%",
"latitude": 35.0456297,
"longitude": -85.3096801,
"population": "173366",
"rank": "136",
"state": "Tennessee",
},
{
"city": "Oceanside",
"growth_from_2000_to_2013": "6.6%",
"latitude": 33.1958696,
"longitude": -117.3794834,
"population": "172794",
"rank": "137",
"state": "California",
},
{
"city": "Jackson",
"growth_from_2000_to_2013": "-6.8%",
"latitude": 32.2987573,
"longitude": -90.1848103,
"population": "172638",
"rank": "138",
"state": "Mississippi",
},
{
"city": "Fort Lauderdale",
"growth_from_2000_to_2013": "0.7%",
"latitude": 26.1224386,
"longitude": -80.13731740000001,
"population": "172389",
"rank": "139",
"state": "Florida",
},
{
"city": "Santa Rosa",
"growth_from_2000_to_2013": "15.2%",
"latitude": 38.440429,
"longitude": -122.7140548,
"population": "171990",
"rank": "140",
"state": "California",
},
{
"city": "Rancho Cucamonga",
"growth_from_2000_to_2013": "32.7%",
"latitude": 34.10639889999999,
"longitude": -117.5931084,
"population": "171386",
"rank": "141",
"state": "California",
},
{
"city": "Port St. Lucie",
"growth_from_2000_to_2013": "91.7%",
"latitude": 27.2730492,
"longitude": -80.3582261,
"population": "171016",
"rank": "142",
"state": "Florida",
},
{
"city": "Tempe",
"growth_from_2000_to_2013": "5.8%",
"latitude": 33.4255104,
"longitude": -111.9400054,
"population": "168228",
"rank": "143",
"state": "Arizona",
},
{
"city": "Ontario",
"growth_from_2000_to_2013": "5.5%",
"latitude": 34.0633443,
"longitude": -117.6508876,
"population": "167500",
"rank": "144",
"state": "California",
},
{
"city": "Vancouver",
"growth_from_2000_to_2013": "14.2%",
"latitude": 45.6387281,
"longitude": -122.6614861,
"population": "167405",
"rank": "145",
"state": "Washington",
},
{
"city": "Cape Coral",
"growth_from_2000_to_2013": "60.4%",
"latitude": 26.5628537,
"longitude": -81.9495331,
"population": "165831",
"rank": "146",
"state": "Florida",
},
{
"city": "Sioux Falls",
"growth_from_2000_to_2013": "31.1%",
"latitude": 43.5445959,
"longitude": -96.73110340000001,
"population": "164676",
"rank": "147",
"state": "South Dakota",
},
{
"city": "Springfield",
"growth_from_2000_to_2013": "7.8%",
"latitude": 37.2089572,
"longitude": -93.29229889999999,
"population": "164122",
"rank": "148",
"state": "Missouri",
},
{
"city": "Peoria",
"growth_from_2000_to_2013": "46.5%",
"latitude": 33.5805955,
"longitude": -112.2373779,
"population": "162592",
"rank": "149",
"state": "Arizona",
},
{
"city": "Pembroke Pines",
"growth_from_2000_to_2013": "17.4%",
"latitude": 26.007765,
"longitude": -80.2962555,
"population": "162329",
"rank": "150",
"state": "Florida",
},
{
"city": "Elk Grove",
"growth_from_2000_to_2013": "97.1%",
"latitude": 38.4087993,
"longitude": -121.3716178,
"population": "161007",
"rank": "151",
"state": "California",
},
{
"city": "Salem",
"growth_from_2000_to_2013": "16.4%",
"latitude": 44.9428975,
"longitude": -123.0350963,
"population": "160614",
"rank": "152",
"state": "Oregon",
},
{
"city": "Lancaster",
"growth_from_2000_to_2013": "33.8%",
"latitude": 34.6867846,
"longitude": -118.1541632,
"population": "159523",
"rank": "153",
"state": "California",
},
{
"city": "Corona",
"growth_from_2000_to_2013": "23.6%",
"latitude": 33.8752935,
"longitude": -117.5664384,
"population": "159503",
"rank": "154",
"state": "California",
},
{
"city": "Eugene",
"growth_from_2000_to_2013": "14.4%",
"latitude": 44.0520691,
"longitude": -123.0867536,
"population": "159190",
"rank": "155",
"state": "Oregon",
},
{
"city": "Palmdale",
"growth_from_2000_to_2013": "33.7%",
"latitude": 34.5794343,
"longitude": -118.1164613,
"population": "157161",
"rank": "156",
"state": "California",
},
{
"city": "Salinas",
"growth_from_2000_to_2013": "8.4%",
"latitude": 36.6777372,
"longitude": -121.6555013,
"population": "155662",
"rank": "157",
"state": "California",
},
{
"city": "Springfield",
"growth_from_2000_to_2013": "1.1%",
"latitude": 42.1014831,
"longitude": -72.589811,
"population": "153703",
"rank": "158",
"state": "Massachusetts",
},
{
"city": "Pasadena",
"growth_from_2000_to_2013": "7.5%",
"latitude": 29.6910625,
"longitude": -95.2091006,
"population": "152735",
"rank": "159",
"state": "Texas",
},
{
"city": "Fort Collins",
"growth_from_2000_to_2013": "26.6%",
"latitude": 40.5852602,
"longitude": -105.084423,
"population": "152061",
"rank": "160",
"state": "Colorado",
},
{
"city": "Hayward",
"growth_from_2000_to_2013": "7.5%",
"latitude": 37.6688205,
"longitude": -122.0807964,
"population": "151574",
"rank": "161",
"state": "California",
},
{
"city": "Pomona",
"growth_from_2000_to_2013": "2.1%",
"latitude": 34.055103,
"longitude": -117.7499909,
"population": "151348",
"rank": "162",
"state": "California",
},
{
"city": "Cary",
"growth_from_2000_to_2013": "55.1%",
"latitude": 35.79154,
"longitude": -78.7811169,
"population": "151088",
"rank": "163",
"state": "North Carolina",
},
{
"city": "Rockford",
"growth_from_2000_to_2013": "-1.0%",
"latitude": 42.2711311,
"longitude": -89.0939952,
"population": "150251",
"rank": "164",
"state": "Illinois",
},
{
"city": "Alexandria",
"growth_from_2000_to_2013": "15.0%",
"latitude": 38.8048355,
"longitude": -77.0469214,
"population": "148892",
"rank": "165",
"state": "Virginia",
},
{
"city": "Escondido",
"growth_from_2000_to_2013": "10.7%",
"latitude": 33.1192068,
"longitude": -117.086421,
"population": "148738",
"rank": "166",
"state": "California",
},
{
"city": "McKinney",
"growth_from_2000_to_2013": "165.3%",
"latitude": 33.1972465,
"longitude": -96.6397822,
"population": "148559",
"rank": "167",
"state": "Texas",
},
{
"city": "Kansas City",
"growth_from_2000_to_2013": "1.1%",
"latitude": 39.114053,
"longitude": -94.6274636,
"population": "148483",
"rank": "168",
"state": "Kansas",
},
{
"city": "Joliet",
"growth_from_2000_to_2013": "36.5%",
"latitude": 41.525031,
"longitude": -88.0817251,
"population": "147806",
"rank": "169",
"state": "Illinois",
},
{
"city": "Sunnyvale",
"growth_from_2000_to_2013": "11.9%",
"latitude": 37.36883,
"longitude": -122.0363496,
"population": "147559",
"rank": "170",
"state": "California",
},
{
"city": "Torrance",
"growth_from_2000_to_2013": "6.6%",
"latitude": 33.8358492,
"longitude": -118.3406288,
"population": "147478",
"rank": "171",
"state": "California",
},
{
"city": "Bridgeport",
"growth_from_2000_to_2013": "5.4%",
"latitude": 41.1865478,
"longitude": -73.19517669999999,
"population": "147216",
"rank": "172",
"state": "Connecticut",
},
{
"city": "Lakewood",
"growth_from_2000_to_2013": "1.9%",
"latitude": 39.7047095,
"longitude": -105.0813734,
"population": "147214",
"rank": "173",
"state": "Colorado",
},
{
"city": "Hollywood",
"growth_from_2000_to_2013": "4.8%",
"latitude": 26.0112014,
"longitude": -80.1494901,
"population": "146526",
"rank": "174",
"state": "Florida",
},
{
"city": "Paterson",
"growth_from_2000_to_2013": "-2.2%",
"latitude": 40.9167654,
"longitude": -74.17181099999999,
"population": "145948",
"rank": "175",
"state": "New Jersey",
},
{
"city": "Naperville",
"growth_from_2000_to_2013": "12.0%",
"latitude": 41.7508391,
"longitude": -88.1535352,
"population": "144864",
"rank": "176",
"state": "Illinois",
},
{
"city": "Syracuse",
"growth_from_2000_to_2013": "-0.9%",
"latitude": 43.0481221,
"longitude": -76.14742439999999,
"population": "144669",
"rank": "177",
"state": "New York",
},
{
"city": "Mesquite",
"growth_from_2000_to_2013": "14.7%",
"latitude": 32.76679550000001,
"longitude": -96.5991593,
"population": "143484",
"rank": "178",
"state": "Texas",
},
{
"city": "Dayton",
"growth_from_2000_to_2013": "-13.5%",
"latitude": 39.7589478,
"longitude": -84.1916069,
"population": "143355",
"rank": "179",
"state": "Ohio",
},
{
"city": "Savannah",
"growth_from_2000_to_2013": "7.5%",
"latitude": 32.0835407,
"longitude": -81.09983419999999,
"population": "142772",
"rank": "180",
"state": "Georgia",
},
{
"city": "Clarksville",
"growth_from_2000_to_2013": "36.9%",
"latitude": 36.5297706,
"longitude": -87.3594528,
"population": "142357",
"rank": "181",
"state": "Tennessee",
},
{
"city": "Orange",
"growth_from_2000_to_2013": "7.7%",
"latitude": 33.7877944,
"longitude": -117.8531119,
"population": "139969",
"rank": "182",
"state": "California",
},
{
"city": "Pasadena",
"growth_from_2000_to_2013": "3.8%",
"latitude": 34.1477849,
"longitude": -118.1445155,
"population": "139731",
"rank": "183",
"state": "California",
},
{
"city": "Fullerton",
"growth_from_2000_to_2013": "9.8%",
"latitude": 33.8703596,
"longitude": -117.9242966,
"population": "138981",
"rank": "184",
"state": "California",
},
{
"city": "Killeen",
"growth_from_2000_to_2013": "52.1%",
"latitude": 31.1171194,
"longitude": -97.72779589999999,
"population": "137147",
"rank": "185",
"state": "Texas",
},
{
"city": "Frisco",
"growth_from_2000_to_2013": "287.7%",
"latitude": 33.1506744,
"longitude": -96.82361159999999,
"population": "136791",
"rank": "186",
"state": "Texas",
},
{
"city": "Hampton",
"growth_from_2000_to_2013": "-6.6%",
"latitude": 37.0298687,
"longitude": -76.34522179999999,
"population": "136699",
"rank": "187",
"state": "Virginia",
},
{
"city": "McAllen",
"growth_from_2000_to_2013": "27.6%",
"latitude": 26.2034071,
"longitude": -98.23001239999999,
"population": "136639",
"rank": "188",
"state": "Texas",
},
{
"city": "Warren",
"growth_from_2000_to_2013": "-2.3%",
"latitude": 42.5144566,
"longitude": -83.01465259999999,
"population": "134873",
"rank": "189",
"state": "Michigan",
},
{
"city": "Bellevue",
"growth_from_2000_to_2013": "19.1%",
"latitude": 47.610377,
"longitude": -122.2006786,
"population": "133992",
"rank": "190",
"state": "Washington",
},
{
"city": "West Valley City",
"growth_from_2000_to_2013": "22.2%",
"latitude": 40.6916132,
"longitude": -112.0010501,
"population": "133579",
"rank": "191",
"state": "Utah",
},
{
"city": "Columbia",
"growth_from_2000_to_2013": "11.7%",
"latitude": 34.0007104,
"longitude": -81.0348144,
"population": "133358",
"rank": "192",
"state": "South Carolina",
},
{
"city": "Olathe",
"growth_from_2000_to_2013": "40.4%",
"latitude": 38.8813958,
"longitude": -94.81912849999999,
"population": "131885",
"rank": "193",
"state": "Kansas",
},
{
"city": "Sterling Heights",
"growth_from_2000_to_2013": "5.2%",
"latitude": 42.5803122,
"longitude": -83.0302033,
"population": "131224",
"rank": "194",
"state": "Michigan",
},
{
"city": "New Haven",
"growth_from_2000_to_2013": "5.5%",
"latitude": 41.308274,
"longitude": -72.9278835,
"population": "130660",
"rank": "195",
"state": "Connecticut",
},
{
"city": "Miramar",
"growth_from_2000_to_2013": "74.7%",
"latitude": 25.9860762,
"longitude": -80.30356019999999,
"population": "130288",
"rank": "196",
"state": "Florida",
},
{
"city": "Waco",
"growth_from_2000_to_2013": "12.5%",
"latitude": 31.549333,
"longitude": -97.1466695,
"population": "129030",
"rank": "197",
"state": "Texas",
},
{
"city": "Thousand Oaks",
"growth_from_2000_to_2013": "9.5%",
"latitude": 34.1705609,
"longitude": -118.8375937,
"population": "128731",
"rank": "198",
"state": "California",
},
{
"city": "Cedar Rapids",
"growth_from_2000_to_2013": "5.4%",
"latitude": 41.9778795,
"longitude": -91.6656232,
"population": "128429",
"rank": "199",
"state": "Iowa",
},
{
"city": "Charleston",
"growth_from_2000_to_2013": "29.2%",
"latitude": 32.7764749,
"longitude": -79.93105120000001,
"population": "127999",
"rank": "200",
"state": "South Carolina",
},
{
"city": "Visalia",
"growth_from_2000_to_2013": "33.6%",
"latitude": 36.3302284,
"longitude": -119.2920585,
"population": "127763",
"rank": "201",
"state": "California",
},
{
"city": "Topeka",
"growth_from_2000_to_2013": "3.4%",
"latitude": 39.0558235,
"longitude": -95.68901849999999,
"population": "127679",
"rank": "202",
"state": "Kansas",
},
{
"city": "Elizabeth",
"growth_from_2000_to_2013": "5.5%",
"latitude": 40.6639916,
"longitude": -74.2107006,
"population": "127558",
"rank": "203",
"state": "New Jersey",
},
{
"city": "Gainesville",
"growth_from_2000_to_2013": "12.8%",
"latitude": 29.6516344,
"longitude": -82.32482619999999,
"population": "127488",
"rank": "204",
"state": "Florida",
},
{
"city": "Thornton",
"growth_from_2000_to_2013": "52.9%",
"latitude": 39.8680412,
"longitude": -104.9719243,
"population": "127359",
"rank": "205",
"state": "Colorado",
},
{
"city": "Roseville",
"growth_from_2000_to_2013": "56.2%",
"latitude": 38.7521235,
"longitude": -121.2880059,
"population": "127035",
"rank": "206",
"state": "California",
},
{
"city": "Carrollton",
"growth_from_2000_to_2013": "14.9%",
"latitude": 32.9756415,
"longitude": -96.8899636,
"population": "126700",
"rank": "207",
"state": "Texas",
},
{
"city": "Coral Springs",
"growth_from_2000_to_2013": "5.7%",
"latitude": 26.271192,
"longitude": -80.2706044,
"population": "126604",
"rank": "208",
"state": "Florida",
},
{
"city": "Stamford",
"growth_from_2000_to_2013": "7.6%",
"latitude": 41.0534302,
"longitude": -73.5387341,
"population": "126456",
"rank": "209",
"state": "Connecticut",
},
{
"city": "Simi Valley",
"growth_from_2000_to_2013": "12.6%",
"latitude": 34.2694474,
"longitude": -118.781482,
"population": "126181",
"rank": "210",
"state": "California",
},
{
"city": "Concord",
"growth_from_2000_to_2013": "2.9%",
"latitude": 37.9779776,
"longitude": -122.0310733,
"population": "125880",
"rank": "211",
"state": "California",
},
{
"city": "Hartford",
"growth_from_2000_to_2013": "0.6%",
"latitude": 41.76371109999999,
"longitude": -72.6850932,
"population": "125017",
"rank": "212",
"state": "Connecticut",
},
{
"city": "Kent",
"growth_from_2000_to_2013": "54.3%",
"latitude": 47.3809335,
"longitude": -122.2348431,
"population": "124435",
"rank": "213",
"state": "Washington",
},
{
"city": "Lafayette",
"growth_from_2000_to_2013": "11.0%",
"latitude": 30.2240897,
"longitude": -92.0198427,
"population": "124276",
"rank": "214",
"state": "Louisiana",
},
{
"city": "Midland",
"growth_from_2000_to_2013": "30.4%",
"latitude": 31.9973456,
"longitude": -102.0779146,
"population": "123933",
"rank": "215",
"state": "Texas",
},
{
"city": "Surprise",
"growth_from_2000_to_2013": "281.9%",
"latitude": 33.6292337,
"longitude": -112.3679279,
"population": "123546",
"rank": "216",
"state": "Arizona",
},
{
"city": "Denton",
"growth_from_2000_to_2013": "47.1%",
"latitude": 33.2148412,
"longitude": -97.13306829999999,
"population": "123099",
"rank": "217",
"state": "Texas",
},
{
"city": "Victorville",
"growth_from_2000_to_2013": "87.6%",
"latitude": 34.5362184,
"longitude": -117.2927641,
"population": "121096",
"rank": "218",
"state": "California",
},
{
"city": "Evansville",
"growth_from_2000_to_2013": "-0.8%",
"latitude": 37.9715592,
"longitude": -87.5710898,
"population": "120310",
"rank": "219",
"state": "Indiana",
},
{
"city": "Santa Clara",
"growth_from_2000_to_2013": "17.4%",
"latitude": 37.3541079,
"longitude": -121.9552356,
"population": "120245",
"rank": "220",
"state": "California",
},
{
"city": "Abilene",
"growth_from_2000_to_2013": "3.6%",
"latitude": 32.4487364,
"longitude": -99.73314390000002,
"population": "120099",
"rank": "221",
"state": "Texas",
},
{
"city": "Athens-Clarke County",
"growth_from_2000_to_2013": "19.0%",
"latitude": 33.9519347,
"longitude": -83.357567,
"population": "119980",
"rank": "222",
"state": "Georgia",
},
{
"city": "Vallejo",
"growth_from_2000_to_2013": "1.2%",
"latitude": 38.1040864,
"longitude": -122.2566367,
"population": "118837",
"rank": "223",
"state": "California",
},
{
"city": "Allentown",
"growth_from_2000_to_2013": "11.2%",
"latitude": 40.6084305,
"longitude": -75.4901833,
"population": "118577",
"rank": "224",
"state": "Pennsylvania",
},
{
"city": "Norman",
"growth_from_2000_to_2013": "22.0%",
"latitude": 35.2225668,
"longitude": -97.4394777,
"population": "118197",
"rank": "225",
"state": "Oklahoma",
},
{
"city": "Beaumont",
"growth_from_2000_to_2013": "3.7%",
"latitude": 30.080174,
"longitude": -94.1265562,
"population": "117796",
"rank": "226",
"state": "Texas",
},
{
"city": "Independence",
"growth_from_2000_to_2013": "3.2%",
"latitude": 39.0911161,
"longitude": -94.41550679999999,
"population": "117240",
"rank": "227",
"state": "Missouri",
},
{
"city": "Murfreesboro",
"growth_from_2000_to_2013": "65.1%",
"latitude": 35.8456213,
"longitude": -86.39027,
"population": "117044",
"rank": "228",
"state": "Tennessee",
},
{
"city": "Ann Arbor",
"growth_from_2000_to_2013": "2.0%",
"latitude": 42.2808256,
"longitude": -83.7430378,
"population": "117025",
"rank": "229",
"state": "Michigan",
},
{
"city": "Springfield",
"growth_from_2000_to_2013": "4.2%",
"latitude": 39.78172130000001,
"longitude": -89.6501481,
"population": "117006",
"rank": "230",
"state": "Illinois",
},
{
"city": "Berkeley",
"growth_from_2000_to_2013": "13.3%",
"latitude": 37.8715926,
"longitude": -122.272747,
"population": "116768",
"rank": "231",
"state": "California",
},
{
"city": "Peoria",
"growth_from_2000_to_2013": "3.0%",
"latitude": 40.6936488,
"longitude": -89.5889864,
"population": "116513",
"rank": "232",
"state": "Illinois",
},
{
"city": "Provo",
"growth_from_2000_to_2013": "10.0%",
"latitude": 40.2338438,
"longitude": -111.6585337,
"population": "116288",
"rank": "233",
"state": "Utah",
},
{
"city": "El Monte",
"growth_from_2000_to_2013": "-0.4%",
"latitude": 34.0686206,
"longitude": -118.0275667,
"population": "115708",
"rank": "234",
"state": "California",
},
{
"city": "Columbia",
"growth_from_2000_to_2013": "34.0%",
"latitude": 38.9517053,
"longitude": -92.3340724,
"population": "115276",
"rank": "235",
"state": "Missouri",
},
{
"city": "Lansing",
"growth_from_2000_to_2013": "-4.4%",
"latitude": 42.732535,
"longitude": -84.5555347,
"population": "113972",
"rank": "236",
"state": "Michigan",
},
{
"city": "Fargo",
"growth_from_2000_to_2013": "24.9%",
"latitude": 46.8771863,
"longitude": -96.7898034,
"population": "113658",
"rank": "237",
"state": "North Dakota",
},
{
"city": "Downey",
"growth_from_2000_to_2013": "5.3%",
"latitude": 33.9401088,
"longitude": -118.1331593,
"population": "113242",
"rank": "238",
"state": "California",
},
{
"city": "Costa Mesa",
"growth_from_2000_to_2013": "2.4%",
"latitude": 33.6411316,
"longitude": -117.9186689,
"population": "112174",
"rank": "239",
"state": "California",
},
{
"city": "Wilmington",
"growth_from_2000_to_2013": "24.8%",
"latitude": 34.2257255,
"longitude": -77.9447102,
"population": "112067",
"rank": "240",
"state": "North Carolina",
},
{
"city": "Arvada",
"growth_from_2000_to_2013": "9.2%",
"latitude": 39.8027644,
"longitude": -105.0874842,
"population": "111707",
"rank": "241",
"state": "Colorado",
},
{
"city": "Inglewood",
"growth_from_2000_to_2013": "-1.0%",
"latitude": 33.9616801,
"longitude": -118.3531311,
"population": "111542",
"rank": "242",
"state": "California",
},
{
"city": "Miami Gardens",
"growth_from_2000_to_2013": "10.5%",
"latitude": 25.9420377,
"longitude": -80.2456045,
"population": "111378",
"rank": "243",
"state": "Florida",
},
{
"city": "Carlsbad",
"growth_from_2000_to_2013": "39.7%",
"latitude": 33.1580933,
"longitude": -117.3505939,
"population": "110972",
"rank": "244",
"state": "California",
},
{
"city": "Westminster",
"growth_from_2000_to_2013": "9.4%",
"latitude": 39.8366528,
"longitude": -105.0372046,
"population": "110945",
"rank": "245",
"state": "Colorado",
},
{
"city": "Rochester",
"growth_from_2000_to_2013": "23.9%",
"latitude": 44.0121221,
"longitude": -92.4801989,
"population": "110742",
"rank": "246",
"state": "Minnesota",
},
{
"city": "Odessa",
"growth_from_2000_to_2013": "22.3%",
"latitude": 31.8456816,
"longitude": -102.3676431,
"population": "110720",
"rank": "247",
"state": "Texas",
},
{
"city": "Manchester",
"growth_from_2000_to_2013": "2.9%",
"latitude": 42.9956397,
"longitude": -71.4547891,
"population": "110378",
"rank": "248",
"state": "New Hampshire",
},
{
"city": "Elgin",
"growth_from_2000_to_2013": "16.0%",
"latitude": 42.0354084,
"longitude": -88.2825668,
"population": "110145",
"rank": "249",
"state": "Illinois",
},
{
"city": "West Jordan",
"growth_from_2000_to_2013": "38.4%",
"latitude": 40.6096698,
"longitude": -111.9391031,
"population": "110077",
"rank": "250",
"state": "Utah",
},
{
"city": "Round Rock",
"growth_from_2000_to_2013": "81.0%",
"latitude": 30.5082551,
"longitude": -97.678896,
"population": "109821",
"rank": "251",
"state": "Texas",
},
{
"city": "Clearwater",
"growth_from_2000_to_2013": "0.1%",
"latitude": 27.9658533,
"longitude": -82.8001026,
"population": "109703",
"rank": "252",
"state": "Florida",
},
{
"city": "Waterbury",
"growth_from_2000_to_2013": "2.2%",
"latitude": 41.5581525,
"longitude": -73.0514965,
"population": "109676",
"rank": "253",
"state": "Connecticut",
},
{
"city": "Gresham",
"growth_from_2000_to_2013": "20.7%",
"latitude": 45.5001357,
"longitude": -122.4302013,
"population": "109397",
"rank": "254",
"state": "Oregon",
},
{
"city": "Fairfield",
"growth_from_2000_to_2013": "12.8%",
"latitude": 38.24935809999999,
"longitude": -122.0399663,
"population": "109320",
"rank": "255",
"state": "California",
},
{
"city": "Billings",
"growth_from_2000_to_2013": "18.6%",
"latitude": 45.7832856,
"longitude": -108.5006904,
"population": "109059",
"rank": "256",
"state": "Montana",
},
{
"city": "Lowell",
"growth_from_2000_to_2013": "3.4%",
"latitude": 42.6334247,
"longitude": -71.31617179999999,
"population": "108861",
"rank": "257",
"state": "Massachusetts",
},
{
"city": "San Buenaventura (Ventura)",
"growth_from_2000_to_2013": "7.4%",
"latitude": 34.274646,
"longitude": -119.2290316,
"population": "108817",
"rank": "258",
"state": "California",
},
{
"city": "Pueblo",
"growth_from_2000_to_2013": "5.9%",
"latitude": 38.2544472,
"longitude": -104.6091409,
"population": "108249",
"rank": "259",
"state": "Colorado",
},
{
"city": "High Point",
"growth_from_2000_to_2013": "24.3%",
"latitude": 35.9556923,
"longitude": -80.0053176,
"population": "107741",
"rank": "260",
"state": "North Carolina",
},
{
"city": "West Covina",
"growth_from_2000_to_2013": "2.3%",
"latitude": 34.0686208,
"longitude": -117.9389526,
"population": "107740",
"rank": "261",
"state": "California",
},
{
"city": "Richmond",
"growth_from_2000_to_2013": "7.9%",
"latitude": 37.9357576,
"longitude": -122.3477486,
"population": "107571",
"rank": "262",
"state": "California",
},
{
"city": "Murrieta",
"growth_from_2000_to_2013": "107.4%",
"latitude": 33.5539143,
"longitude": -117.2139232,
"population": "107479",
"rank": "263",
"state": "California",
},
{
"city": "Cambridge",
"growth_from_2000_to_2013": "5.5%",
"latitude": 42.3736158,
"longitude": -71.10973349999999,
"population": "107289",
"rank": "264",
"state": "Massachusetts",
},
{
"city": "Antioch",
"growth_from_2000_to_2013": "16.9%",
"latitude": 38.0049214,
"longitude": -121.805789,
"population": "107100",
"rank": "265",
"state": "California",
},
{
"city": "Temecula",
"growth_from_2000_to_2013": "55.4%",
"latitude": 33.4936391,
"longitude": -117.1483648,
"population": "106780",
"rank": "266",
"state": "California",
},
{
"city": "Norwalk",
"growth_from_2000_to_2013": "1.9%",
"latitude": 33.9022367,
"longitude": -118.081733,
"population": "106589",
"rank": "267",
"state": "California",
},
{
"city": "Centennial",
"growth_from_2000_to_2013": "3.5%",
"latitude": 39.5807452,
"longitude": -104.8771726,
"population": "106114",
"rank": "268",
"state": "Colorado",
},
{
"city": "Everett",
"growth_from_2000_to_2013": "9.4%",
"latitude": 47.9789848,
"longitude": -122.2020794,
"population": "105370",
"rank": "269",
"state": "Washington",
},
{
"city": "Palm Bay",
"growth_from_2000_to_2013": "31.7%",
"latitude": 28.0344621,
"longitude": -80.5886646,
"population": "104898",
"rank": "270",
"state": "Florida",
},
{
"city": "Wichita Falls",
"growth_from_2000_to_2013": "0.7%",
"latitude": 33.9137085,
"longitude": -98.4933873,
"population": "104898",
"rank": "271",
"state": "Texas",
},
{
"city": "Green Bay",
"growth_from_2000_to_2013": "1.9%",
"latitude": 44.51915899999999,
"longitude": -88.019826,
"population": "104779",
"rank": "272",
"state": "Wisconsin",
},
{
"city": "Daly City",
"growth_from_2000_to_2013": "1.0%",
"latitude": 37.6879241,
"longitude": -122.4702079,
"population": "104739",
"rank": "273",
"state": "California",
},
{
"city": "Burbank",
"growth_from_2000_to_2013": "4.2%",
"latitude": 34.1808392,
"longitude": -118.3089661,
"population": "104709",
"rank": "274",
"state": "California",
},
{
"city": "Richardson",
"growth_from_2000_to_2013": "13.2%",
"latitude": 32.9483335,
"longitude": -96.7298519,
"population": "104475",
"rank": "275",
"state": "Texas",
},
{
"city": "Pompano Beach",
"growth_from_2000_to_2013": "4.0%",
"latitude": 26.2378597,
"longitude": -80.1247667,
"population": "104410",
"rank": "276",
"state": "Florida",
},
{
"city": "North Charleston",
"growth_from_2000_to_2013": "27.4%",
"latitude": 32.8546197,
"longitude": -79.9748103,
"population": "104054",
"rank": "277",
"state": "South Carolina",
},
{
"city": "Broken Arrow",
"growth_from_2000_to_2013": "28.2%",
"latitude": 36.060949,
"longitude": -95.7974526,
"population": "103500",
"rank": "278",
"state": "Oklahoma",
},
{
"city": "Boulder",
"growth_from_2000_to_2013": "9.0%",
"latitude": 40.0149856,
"longitude": -105.2705456,
"population": "103166",
"rank": "279",
"state": "Colorado",
},
{
"city": "West Palm Beach",
"growth_from_2000_to_2013": "23.5%",
"latitude": 26.7153424,
"longitude": -80.0533746,
"population": "102436",
"rank": "280",
"state": "Florida",
},
{
"city": "Santa Maria",
"growth_from_2000_to_2013": "30.9%",
"latitude": 34.9530337,
"longitude": -120.4357191,
"population": "102216",
"rank": "281",
"state": "California",
},
{
"city": "El Cajon",
"growth_from_2000_to_2013": "7.4%",
"latitude": 32.7947731,
"longitude": -116.9625269,
"population": "102211",
"rank": "282",
"state": "California",
},
{
"city": "Davenport",
"growth_from_2000_to_2013": "3.9%",
"latitude": 41.5236437,
"longitude": -90.5776367,
"population": "102157",
"rank": "283",
"state": "Iowa",
},
{
"city": "Rialto",
"growth_from_2000_to_2013": "9.8%",
"latitude": 34.1064001,
"longitude": -117.3703235,
"population": "101910",
"rank": "284",
"state": "California",
},
{
"city": "Las Cruces",
"growth_from_2000_to_2013": "37.6%",
"latitude": 32.3199396,
"longitude": -106.7636538,
"population": "101324",
"rank": "285",
"state": "New Mexico",
},
{
"city": "San Mateo",
"growth_from_2000_to_2013": "9.0%",
"latitude": 37.5629917,
"longitude": -122.3255254,
"population": "101128",
"rank": "286",
"state": "California",
},
{
"city": "Lewisville",
"growth_from_2000_to_2013": "28.9%",
"latitude": 33.046233,
"longitude": -96.994174,
"population": "101074",
"rank": "287",
"state": "Texas",
},
{
"city": "South Bend",
"growth_from_2000_to_2013": "-6.8%",
"latitude": 41.6763545,
"longitude": -86.25198979999999,
"population": "100886",
"rank": "288",
"state": "Indiana",
},
{
"city": "Lakeland",
"growth_from_2000_to_2013": "18.3%",
"latitude": 28.0394654,
"longitude": -81.9498042,
"population": "100710",
"rank": "289",
"state": "Florida",
},
{
"city": "Erie",
"growth_from_2000_to_2013": "-2.8%",
"latitude": 42.12922409999999,
"longitude": -80.085059,
"population": "100671",
"rank": "290",
"state": "Pennsylvania",
},
{
"city": "Tyler",
"growth_from_2000_to_2013": "18.6%",
"latitude": 32.3512601,
"longitude": -95.30106239999999,
"population": "100223",
"rank": "291",
"state": "Texas",
},
{
"city": "Pearland",
"growth_from_2000_to_2013": "117.2%",
"latitude": 29.5635666,
"longitude": -95.2860474,
"population": "100065",
"rank": "292",
"state": "Texas",
},
{
"city": "College Station",
"growth_from_2000_to_2013": "45.2%",
"latitude": 30.627977,
"longitude": -96.3344068,
"population": "100050",
"rank": "293",
"state": "Texas",
},
{
"city": "Kenosha",
"growth_from_2000_to_2013": "9.5%",
"latitude": 42.5847425,
"longitude": -87.82118539999999,
"population": "99889",
"rank": "294",
"state": "Wisconsin",
},
{
"city": "Sandy Springs",
"growth_from_2000_to_2013": "17.4%",
"latitude": 33.9304352,
"longitude": -84.3733147,
"population": "99770",
"rank": "295",
"state": "Georgia",
},
{
"city": "Clovis",
"growth_from_2000_to_2013": "42.6%",
"latitude": 36.8252277,
"longitude": -119.7029194,
"population": "99769",
"rank": "296",
"state": "California",
},
{
"city": "Flint",
"growth_from_2000_to_2013": "-20.0%",
"latitude": 43.0125274,
"longitude": -83.6874562,
"population": "99763",
"rank": "297",
"state": "Michigan",
},
{
"city": "Roanoke",
"growth_from_2000_to_2013": "3.8%",
"latitude": 37.2709704,
"longitude": -79.9414266,
"population": "98465",
"rank": "298",
"state": "Virginia",
},
{
"city": "Albany",
"growth_from_2000_to_2013": "4.1%",
"latitude": 42.6525793,
"longitude": -73.7562317,
"population": "98424",
"rank": "299",
"state": "New York",
},
{
"city": "Jurupa Valley",
"growth_from_2000_to_2013": "",
"latitude": 33.9971974,
"longitude": -117.4854802,
"population": "98030",
"rank": "300",
"state": "California",
},
{
"city": "Compton",
"growth_from_2000_to_2013": "4.5%",
"latitude": 33.8958492,
"longitude": -118.2200712,
"population": "97877",
"rank": "301",
"state": "California",
},
{
"city": "San Angelo",
"growth_from_2000_to_2013": "10.2%",
"latitude": 31.4637723,
"longitude": -100.4370375,
"population": "97492",
"rank": "302",
"state": "Texas",
},
{
"city": "Hillsboro",
"growth_from_2000_to_2013": "36.4%",
"latitude": 45.5228939,
"longitude": -122.989827,
"population": "97368",
"rank": "303",
"state": "Oregon",
},
{
"city": "Lawton",
"growth_from_2000_to_2013": "4.9%",
"latitude": 34.6035669,
"longitude": -98.39592909999999,
"population": "97151",
"rank": "304",
"state": "Oklahoma",
},
{
"city": "Renton",
"growth_from_2000_to_2013": "88.4%",
"latitude": 47.48287759999999,
"longitude": -122.2170661,
"population": "97003",
"rank": "305",
"state": "Washington",
},
{
"city": "Vista",
"growth_from_2000_to_2013": "7.7%",
"latitude": 33.2000368,
"longitude": -117.2425355,
"population": "96929",
"rank": "306",
"state": "California",
},
{
"city": "Davie",
"growth_from_2000_to_2013": "17.7%",
"latitude": 26.0764783,
"longitude": -80.25211569999999,
"population": "96830",
"rank": "307",
"state": "Florida",
},
{
"city": "Greeley",
"growth_from_2000_to_2013": "23.1%",
"latitude": 40.4233142,
"longitude": -104.7091322,
"population": "96539",
"rank": "308",
"state": "Colorado",
},
{
"city": "Mission Viejo",
"growth_from_2000_to_2013": "2.9%",
"latitude": 33.6000232,
"longitude": -117.6719953,
"population": "96346",
"rank": "309",
"state": "California",
},
{
"city": "Portsmouth",
"growth_from_2000_to_2013": "-4.2%",
"latitude": 36.8354258,
"longitude": -76.2982742,
"population": "96205",
"rank": "310",
"state": "Virginia",
},
{
"city": "Dearborn",
"growth_from_2000_to_2013": "-2.0%",
"latitude": 42.3222599,
"longitude": -83.17631449999999,
"population": "95884",
"rank": "311",
"state": "Michigan",
},
{
"city": "South Gate",
"growth_from_2000_to_2013": "-0.8%",
"latitude": 33.954737,
"longitude": -118.2120161,
"population": "95677",
"rank": "312",
"state": "California",
},
{
"city": "Tuscaloosa",
"growth_from_2000_to_2013": "21.1%",
"latitude": 33.2098407,
"longitude": -87.56917349999999,
"population": "95334",
"rank": "313",
"state": "Alabama",
},
{
"city": "Livonia",
"growth_from_2000_to_2013": "-5.4%",
"latitude": 42.36837,
"longitude": -83.35270969999999,
"population": "95208",
"rank": "314",
"state": "Michigan",
},
{
"city": "New Bedford",
"growth_from_2000_to_2013": "1.2%",
"latitude": 41.6362152,
"longitude": -70.93420499999999,
"population": "95078",
"rank": "315",
"state": "Massachusetts",
},
{
"city": "Vacaville",
"growth_from_2000_to_2013": "5.4%",
"latitude": 38.3565773,
"longitude": -121.9877444,
"population": "94275",
"rank": "316",
"state": "California",
},
{
"city": "Brockton",
"growth_from_2000_to_2013": "-0.3%",
"latitude": 42.0834335,
"longitude": -71.0183787,
"population": "94089",
"rank": "317",
"state": "Massachusetts",
},
{
"city": "Roswell",
"growth_from_2000_to_2013": "15.2%",
"latitude": 34.0232431,
"longitude": -84.3615555,
"population": "94034",
"rank": "318",
"state": "Georgia",
},
{
"city": "Beaverton",
"growth_from_2000_to_2013": "17.0%",
"latitude": 45.48706199999999,
"longitude": -122.8037102,
"population": "93542",
"rank": "319",
"state": "Oregon",
},
{
"city": "Quincy",
"growth_from_2000_to_2013": "5.8%",
"latitude": 42.2528772,
"longitude": -71.0022705,
"population": "93494",
"rank": "320",
"state": "Massachusetts",
},
{
"city": "Sparks",
"growth_from_2000_to_2013": "39.4%",
"latitude": 39.5349112,
"longitude": -119.7526886,
"population": "93282",
"rank": "321",
"state": "Nevada",
},
{
"city": "Yakima",
"growth_from_2000_to_2013": "11.7%",
"latitude": 46.6020711,
"longitude": -120.5058987,
"population": "93257",
"rank": "322",
"state": "Washington",
},
{
"city": "Lee's Summit",
"growth_from_2000_to_2013": "31.2%",
"latitude": 38.9108408,
"longitude": -94.3821724,
"population": "93184",
"rank": "323",
"state": "Missouri",
},
{
"city": "Federal Way",
"growth_from_2000_to_2013": "8.8%",
"latitude": 47.3223221,
"longitude": -122.3126222,
"population": "92734",
"rank": "324",
"state": "Washington",
},
{
"city": "Carson",
"growth_from_2000_to_2013": "2.9%",
"latitude": 33.8316745,
"longitude": -118.281693,
"population": "92599",
"rank": "325",
"state": "California",
},
{
"city": "Santa Monica",
"growth_from_2000_to_2013": "9.6%",
"latitude": 34.0194543,
"longitude": -118.4911912,
"population": "92472",
"rank": "326",
"state": "California",
},
{
"city": "Hesperia",
"growth_from_2000_to_2013": "46.1%",
"latitude": 34.4263886,
"longitude": -117.3008784,
"population": "92147",
"rank": "327",
"state": "California",
},
{
"city": "Allen",
"growth_from_2000_to_2013": "104.0%",
"latitude": 33.1031744,
"longitude": -96.67055030000002,
"population": "92020",
"rank": "328",
"state": "Texas",
},
{
"city": "Rio Rancho",
"growth_from_2000_to_2013": "74.4%",
"latitude": 35.2327544,
"longitude": -106.6630437,
"population": "91956",
"rank": "329",
"state": "New Mexico",
},
{
"city": "Yuma",
"growth_from_2000_to_2013": "16.2%",
"latitude": 32.6926512,
"longitude": -114.6276916,
"population": "91923",
"rank": "330",
"state": "Arizona",
},
{
"city": "Westminster",
"growth_from_2000_to_2013": "3.9%",
"latitude": 33.7513419,
"longitude": -117.9939921,
"population": "91739",
"rank": "331",
"state": "California",
},
{
"city": "Orem",
"growth_from_2000_to_2013": "8.5%",
"latitude": 40.2968979,
"longitude": -111.6946475,
"population": "91648",
"rank": "332",
"state": "Utah",
},
{
"city": "Lynn",
"growth_from_2000_to_2013": "2.6%",
"latitude": 42.46676300000001,
"longitude": -70.9494938,
"population": "91589",
"rank": "333",
"state": "Massachusetts",
},
{
"city": "Redding",
"growth_from_2000_to_2013": "11.9%",
"latitude": 40.5865396,
"longitude": -122.3916754,
"population": "91119",
"rank": "334",
"state": "California",
},
{
"city": "Spokane Valley",
"growth_from_2000_to_2013": "12.6%",
"latitude": 47.6732281,
"longitude": -117.2393748,
"population": "91113",
"rank": "335",
"state": "Washington",
},
{
"city": "Miami Beach",
"growth_from_2000_to_2013": "3.3%",
"latitude": 25.790654,
"longitude": -80.1300455,
"population": "91026",
"rank": "336",
"state": "Florida",
},
{
"city": "League City",
"growth_from_2000_to_2013": "98.3%",
"latitude": 29.5074538,
"longitude": -95.0949303,
"population": "90983",
"rank": "337",
"state": "Texas",
},
{
"city": "Lawrence",
"growth_from_2000_to_2013": "12.7%",
"latitude": 38.9716689,
"longitude": -95.2352501,
"population": "90811",
"rank": "338",
"state": "Kansas",
},
{
"city": "Santa Barbara",
"growth_from_2000_to_2013": "0.9%",
"latitude": 34.4208305,
"longitude": -119.6981901,
"population": "90412",
"rank": "339",
"state": "California",
},
{
"city": "Plantation",
"growth_from_2000_to_2013": "8.6%",
"latitude": 26.1275862,
"longitude": -80.23310359999999,
"population": "90268",
"rank": "340",
"state": "Florida",
},
{
"city": "Sandy",
"growth_from_2000_to_2013": "1.3%",
"latitude": 40.5649781,
"longitude": -111.8389726,
"population": "90231",
"rank": "341",
"state": "Utah",
},
{
"city": "Sunrise",
"growth_from_2000_to_2013": "4.6%",
"latitude": 26.1669711,
"longitude": -80.25659499999999,
"population": "90116",
"rank": "342",
"state": "Florida",
},
{
"city": "Macon",
"growth_from_2000_to_2013": "-7.3%",
"latitude": 32.8406946,
"longitude": -83.6324022,
"population": "89981",
"rank": "343",
"state": "Georgia",
},
{
"city": "Longmont",
"growth_from_2000_to_2013": "24.4%",
"latitude": 40.1672068,
"longitude": -105.1019275,
"population": "89919",
"rank": "344",
"state": "Colorado",
},
{
"city": "Boca Raton",
"growth_from_2000_to_2013": "7.5%",
"latitude": 26.3683064,
"longitude": -80.1289321,
"population": "89407",
"rank": "345",
"state": "Florida",
},
{
"city": "San Marcos",
"growth_from_2000_to_2013": "60.0%",
"latitude": 33.1433723,
"longitude": -117.1661449,
"population": "89387",
"rank": "346",
"state": "California",
},
{
"city": "Greenville",
"growth_from_2000_to_2013": "41.9%",
"latitude": 35.612661,
"longitude": -77.3663538,
"population": "89130",
"rank": "347",
"state": "North Carolina",
},
{
"city": "Waukegan",
"growth_from_2000_to_2013": "0.5%",
"latitude": 42.3636331,
"longitude": -87.84479379999999,
"population": "88826",
"rank": "348",
"state": "Illinois",
},
{
"city": "Fall River",
"growth_from_2000_to_2013": "-3.7%",
"latitude": 41.7014912,
"longitude": -71.1550451,
"population": "88697",
"rank": "349",
"state": "Massachusetts",
},
{
"city": "Chico",
"growth_from_2000_to_2013": "14.2%",
"latitude": 39.7284944,
"longitude": -121.8374777,
"population": "88077",
"rank": "350",
"state": "California",
},
{
"city": "Newton",
"growth_from_2000_to_2013": "4.9%",
"latitude": 42.3370413,
"longitude": -71.20922139999999,
"population": "87971",
"rank": "351",
"state": "Massachusetts",
},
{
"city": "San Leandro",
"growth_from_2000_to_2013": "10.3%",
"latitude": 37.7249296,
"longitude": -122.1560768,
"population": "87965",
"rank": "352",
"state": "California",
},
{
"city": "Reading",
"growth_from_2000_to_2013": "8.0%",
"latitude": 40.3356483,
"longitude": -75.9268747,
"population": "87893",
"rank": "353",
"state": "Pennsylvania",
},
{
"city": "Norwalk",
"growth_from_2000_to_2013": "5.6%",
"latitude": 41.11774399999999,
"longitude": -73.4081575,
"population": "87776",
"rank": "354",
"state": "Connecticut",
},
{
"city": "Fort Smith",
"growth_from_2000_to_2013": "8.6%",
"latitude": 35.3859242,
"longitude": -94.39854749999999,
"population": "87650",
"rank": "355",
"state": "Arkansas",
},
{
"city": "Newport Beach",
"growth_from_2000_to_2013": "10.4%",
"latitude": 33.6189101,
"longitude": -117.9289469,
"population": "87273",
"rank": "356",
"state": "California",
},
{
"city": "Asheville",
"growth_from_2000_to_2013": "19.6%",
"latitude": 35.5950581,
"longitude": -82.5514869,
"population": "87236",
"rank": "357",
"state": "North Carolina",
},
{
"city": "Nashua",
"growth_from_2000_to_2013": "0.4%",
"latitude": 42.7653662,
"longitude": -71.46756599999999,
"population": "87137",
"rank": "358",
"state": "New Hampshire",
},
{
"city": "Edmond",
"growth_from_2000_to_2013": "26.9%",
"latitude": 35.6528323,
"longitude": -97.47809540000002,
"population": "87004",
"rank": "359",
"state": "Oklahoma",
},
{
"city": "Whittier",
"growth_from_2000_to_2013": "3.3%",
"latitude": 33.9791793,
"longitude": -118.032844,
"population": "86635",
"rank": "360",
"state": "California",
},
{
"city": "Nampa",
"growth_from_2000_to_2013": "57.9%",
"latitude": 43.5407172,
"longitude": -116.5634624,
"population": "86518",
"rank": "361",
"state": "Idaho",
},
{
"city": "Bloomington",
"growth_from_2000_to_2013": "1.3%",
"latitude": 44.840798,
"longitude": -93.2982799,
"population": "86319",
"rank": "362",
"state": "Minnesota",
},
{
"city": "Deltona",
"growth_from_2000_to_2013": "23.1%",
"latitude": 28.9005446,
"longitude": -81.26367379999999,
"population": "86290",
"rank": "363",
"state": "Florida",
},
{
"city": "Hawthorne",
"growth_from_2000_to_2013": "2.3%",
"latitude": 33.9164032,
"longitude": -118.3525748,
"population": "86199",
"rank": "364",
"state": "California",
},
{
"city": "Duluth",
"growth_from_2000_to_2013": "-0.1%",
"latitude": 46.78667189999999,
"longitude": -92.1004852,
"population": "86128",
"rank": "365",
"state": "Minnesota",
},
{
"city": "Carmel",
"growth_from_2000_to_2013": "60.4%",
"latitude": 39.978371,
"longitude": -86.1180435,
"population": "85927",
"rank": "366",
"state": "Indiana",
},
{
"city": "Suffolk",
"growth_from_2000_to_2013": "33.5%",
"latitude": 36.7282054,
"longitude": -76.5835621,
"population": "85728",
"rank": "367",
"state": "Virginia",
},
{
"city": "Clifton",
"growth_from_2000_to_2013": "7.9%",
"latitude": 40.8584328,
"longitude": -74.16375529999999,
"population": "85390",
"rank": "368",
"state": "New Jersey",
},
{
"city": "Citrus Heights",
"growth_from_2000_to_2013": "-0.1%",
"latitude": 38.7071247,
"longitude": -121.2810611,
"population": "85285",
"rank": "369",
"state": "California",
},
{
"city": "Livermore",
"growth_from_2000_to_2013": "15.1%",
"latitude": 37.6818745,
"longitude": -121.7680088,
"population": "85156",
"rank": "370",
"state": "California",
},
{
"city": "Tracy",
"growth_from_2000_to_2013": "45.9%",
"latitude": 37.7396513,
"longitude": -121.4252227,
"population": "84691",
"rank": "371",
"state": "California",
},
{
"city": "Alhambra",
"growth_from_2000_to_2013": "-0.7%",
"latitude": 34.095287,
"longitude": -118.1270146,
"population": "84577",
"rank": "372",
"state": "California",
},
{
"city": "Kirkland",
"growth_from_2000_to_2013": "87.5%",
"latitude": 47.6814875,
"longitude": -122.2087353,
"population": "84430",
"rank": "373",
"state": "Washington",
},
{
"city": "Trenton",
"growth_from_2000_to_2013": "-1.2%",
"latitude": 40.2170534,
"longitude": -74.7429384,
"population": "84349",
"rank": "374",
"state": "New Jersey",
},
{
"city": "Ogden",
"growth_from_2000_to_2013": "8.6%",
"latitude": 41.223,
"longitude": -111.9738304,
"population": "84249",
"rank": "375",
"state": "Utah",
},
{
"city": "Hoover",
"growth_from_2000_to_2013": "32.7%",
"latitude": 33.4053867,
"longitude": -86.8113781,
"population": "84126",
"rank": "376",
"state": "Alabama",
},
{
"city": "Cicero",
"growth_from_2000_to_2013": "-1.6%",
"latitude": 41.8455877,
"longitude": -87.7539448,
"population": "84103",
"rank": "377",
"state": "Illinois",
},
{
"city": "Fishers",
"growth_from_2000_to_2013": "114.8%",
"latitude": 39.9567548,
"longitude": -86.01335,
"population": "83891",
"rank": "378",
"state": "Indiana",
},
{
"city": "Sugar Land",
"growth_from_2000_to_2013": "29.1%",
"latitude": 29.6196787,
"longitude": -95.6349463,
"population": "83860",
"rank": "379",
"state": "Texas",
},
{
"city": "Danbury",
"growth_from_2000_to_2013": "11.4%",
"latitude": 41.394817,
"longitude": -73.4540111,
"population": "83684",
"rank": "380",
"state": "Connecticut",
},
{
"city": "Meridian",
"growth_from_2000_to_2013": "127.6%",
"latitude": 43.6121087,
"longitude": -116.3915131,
"population": "83596",
"rank": "381",
"state": "Idaho",
},
{
"city": "Indio",
"growth_from_2000_to_2013": "66.0%",
"latitude": 33.7205771,
"longitude": -116.2155619,
"population": "83539",
"rank": "382",
"state": "California",
},
{
"city": "Concord",
"growth_from_2000_to_2013": "47.4%",
"latitude": 35.4087517,
"longitude": -80.579511,
"population": "83506",
"rank": "383",
"state": "North Carolina",
},
{
"city": "Menifee",
"growth_from_2000_to_2013": "95.0%",
"latitude": 33.6971468,
"longitude": -117.185294,
"population": "83447",
"rank": "384",
"state": "California",
},
{
"city": "Champaign",
"growth_from_2000_to_2013": "18.3%",
"latitude": 40.1164204,
"longitude": -88.2433829,
"population": "83424",
"rank": "385",
"state": "Illinois",
},
{
"city": "Buena Park",
"growth_from_2000_to_2013": "6.1%",
"latitude": 33.8675143,
"longitude": -117.9981181,
"population": "82882",
"rank": "386",
"state": "California",
},
{
"city": "Troy",
"growth_from_2000_to_2013": "2.2%",
"latitude": 42.6064095,
"longitude": -83.1497751,
"population": "82821",
"rank": "387",
"state": "Michigan",
},
{
"city": "O'Fallon",
"growth_from_2000_to_2013": "62.6%",
"latitude": 38.8106075,
"longitude": -90.69984769999999,
"population": "82809",
"rank": "388",
"state": "Missouri",
},
{
"city": "Johns Creek",
"growth_from_2000_to_2013": "36.5%",
"latitude": 34.0289259,
"longitude": -84.198579,
"population": "82788",
"rank": "389",
"state": "Georgia",
},
{
"city": "Bellingham",
"growth_from_2000_to_2013": "21.8%",
"latitude": 48.74908,
"longitude": -122.4781473,
"population": "82631",
"rank": "390",
"state": "Washington",
},
{
"city": "Westland",
"growth_from_2000_to_2013": "-4.7%",
"latitude": 42.32420399999999,
"longitude": -83.400211,
"population": "82578",
"rank": "391",
"state": "Michigan",
},
{
"city": "Bloomington",
"growth_from_2000_to_2013": "16.1%",
"latitude": 39.165325,
"longitude": -86.52638569999999,
"population": "82575",
"rank": "392",
"state": "Indiana",
},
{
"city": "Sioux City",
"growth_from_2000_to_2013": "-2.9%",
"latitude": 42.4999942,
"longitude": -96.40030689999999,
"population": "82459",
"rank": "393",
"state": "Iowa",
},
{
"city": "Warwick",
"growth_from_2000_to_2013": "-4.6%",
"latitude": 41.7001009,
"longitude": -71.4161671,
"population": "81971",
"rank": "394",
"state": "Rhode Island",
},
{
"city": "Hemet",
"growth_from_2000_to_2013": "37.6%",
"latitude": 33.7475203,
"longitude": -116.9719684,
"population": "81750",
"rank": "395",
"state": "California",
},
{
"city": "Longview",
"growth_from_2000_to_2013": "11.6%",
"latitude": 32.5007037,
"longitude": -94.74048909999999,
"population": "81443",
"rank": "396",
"state": "Texas",
},
{
"city": "Farmington Hills",
"growth_from_2000_to_2013": "-0.9%",
"latitude": 42.4989936,
"longitude": -83.3677168,
"population": "81295",
"rank": "397",
"state": "Michigan",
},
{
"city": "Bend",
"growth_from_2000_to_2013": "54.3%",
"latitude": 44.0581728,
"longitude": -121.3153096,
"population": "81236",
"rank": "398",
"state": "Oregon",
},
{
"city": "Lakewood",
"growth_from_2000_to_2013": "2.1%",
"latitude": 33.8536269,
"longitude": -118.1339563,
"population": "81121",
"rank": "399",
"state": "California",
},
{
"city": "Merced",
"growth_from_2000_to_2013": "25.4%",
"latitude": 37.3021632,
"longitude": -120.4829677,
"population": "81102",
"rank": "400",
"state": "California",
},
{
"city": "Mission",
"growth_from_2000_to_2013": "74.5%",
"latitude": 26.2159066,
"longitude": -98.32529319999999,
"population": "81050",
"rank": "401",
"state": "Texas",
},
{
"city": "Chino",
"growth_from_2000_to_2013": "15.6%",
"latitude": 34.0122346,
"longitude": -117.688944,
"population": "80988",
"rank": "402",
"state": "California",
},
{
"city": "Redwood City",
"growth_from_2000_to_2013": "7.1%",
"latitude": 37.48521520000001,
"longitude": -122.2363548,
"population": "80872",
"rank": "403",
"state": "California",
},
{
"city": "Edinburg",
"growth_from_2000_to_2013": "65.1%",
"latitude": 26.3017374,
"longitude": -98.1633432,
"population": "80836",
"rank": "404",
"state": "Texas",
},
{
"city": "Cranston",
"growth_from_2000_to_2013": "1.4%",
"latitude": 41.7798226,
"longitude": -71.4372796,
"population": "80566",
"rank": "405",
"state": "Rhode Island",
},
{
"city": "Parma",
"growth_from_2000_to_2013": "-5.9%",
"latitude": 41.4047742,
"longitude": -81.7229086,
"population": "80429",
"rank": "406",
"state": "Ohio",
},
{
"city": "New Rochelle",
"growth_from_2000_to_2013": "9.9%",
"latitude": 40.9114882,
"longitude": -73.7823549,
"population": "79446",
"rank": "407",
"state": "New York",
},
{
"city": "Lake Forest",
"growth_from_2000_to_2013": "4.2%",
"latitude": 33.6469661,
"longitude": -117.689218,
"population": "79312",
"rank": "408",
"state": "California",
},
{
"city": "Napa",
"growth_from_2000_to_2013": "8.4%",
"latitude": 38.2975381,
"longitude": -122.286865,
"population": "79068",
"rank": "409",
"state": "California",
},
{
"city": "Hammond",
"growth_from_2000_to_2013": "-4.6%",
"latitude": 41.5833688,
"longitude": -87.5000412,
"population": "78967",
"rank": "410",
"state": "Indiana",
},
{
"city": "Fayetteville",
"growth_from_2000_to_2013": "32.9%",
"latitude": 36.0625795,
"longitude": -94.1574263,
"population": "78960",
"rank": "411",
"state": "Arkansas",
},
{
"city": "Bloomington",
"growth_from_2000_to_2013": "20.1%",
"latitude": 40.4842027,
"longitude": -88.99368729999999,
"population": "78902",
"rank": "412",
"state": "Illinois",
},
{
"city": "Avondale",
"growth_from_2000_to_2013": "111.5%",
"latitude": 33.4355977,
"longitude": -112.3496021,
"population": "78822",
"rank": "413",
"state": "Arizona",
},
{
"city": "Somerville",
"growth_from_2000_to_2013": "1.6%",
"latitude": 42.3875968,
"longitude": -71.0994968,
"population": "78804",
"rank": "414",
"state": "Massachusetts",
},
{
"city": "Palm Coast",
"growth_from_2000_to_2013": "137.2%",
"latitude": 29.5844524,
"longitude": -81.20786989999999,
"population": "78740",
"rank": "415",
"state": "Florida",
},
{
"city": "Bryan",
"growth_from_2000_to_2013": "19.3%",
"latitude": 30.6743643,
"longitude": -96.3699632,
"population": "78709",
"rank": "416",
"state": "Texas",
},
{
"city": "Gary",
"growth_from_2000_to_2013": "-23.4%",
"latitude": 41.5933696,
"longitude": -87.3464271,
"population": "78450",
"rank": "417",
"state": "Indiana",
},
{
"city": "Largo",
"growth_from_2000_to_2013": "5.1%",
"latitude": 27.9094665,
"longitude": -82.7873244,
"population": "78409",
"rank": "418",
"state": "Florida",
},
{
"city": "Brooklyn Park",
"growth_from_2000_to_2013": "16.0%",
"latitude": 45.0941315,
"longitude": -93.3563405,
"population": "78373",
"rank": "419",
"state": "Minnesota",
},
{
"city": "Tustin",
"growth_from_2000_to_2013": "15.6%",
"latitude": 33.7458511,
"longitude": -117.826166,
"population": "78327",
"rank": "420",
"state": "California",
},
{
"city": "Racine",
"growth_from_2000_to_2013": "-4.4%",
"latitude": 42.7261309,
"longitude": -87.78285230000002,
"population": "78199",
"rank": "421",
"state": "Wisconsin",
},
{
"city": "Deerfield Beach",
"growth_from_2000_to_2013": "4.8%",
"latitude": 26.3184123,
"longitude": -80.09976569999999,
"population": "78041",
"rank": "422",
"state": "Florida",
},
{
"city": "Lynchburg",
"growth_from_2000_to_2013": "19.5%",
"latitude": 37.4137536,
"longitude": -79.14224639999999,
"population": "78014",
"rank": "423",
"state": "Virginia",
},
{
"city": "Mountain View",
"growth_from_2000_to_2013": "10.1%",
"latitude": 37.3860517,
"longitude": -122.0838511,
"population": "77846",
"rank": "424",
"state": "California",
},
{
"city": "Medford",
"growth_from_2000_to_2013": "17.1%",
"latitude": 42.3265152,
"longitude": -122.8755949,
"population": "77677",
"rank": "425",
"state": "Oregon",
},
{
"city": "Lawrence",
"growth_from_2000_to_2013": "7.5%",
"latitude": 42.7070354,
"longitude": -71.1631137,
"population": "77657",
"rank": "426",
"state": "Massachusetts",
},
{
"city": "Bellflower",
"growth_from_2000_to_2013": "6.3%",
"latitude": 33.8816818,
"longitude": -118.1170117,
"population": "77593",
"rank": "427",
"state": "California",
},
{
"city": "Melbourne",
"growth_from_2000_to_2013": "5.9%",
"latitude": 28.0836269,
"longitude": -80.60810889999999,
"population": "77508",
"rank": "428",
"state": "Florida",
},
{
"city": "St. Joseph",
"growth_from_2000_to_2013": "4.1%",
"latitude": 39.7674578,
"longitude": -94.84668099999999,
"population": "77147",
"rank": "429",
"state": "Missouri",
},
{
"city": "Camden",
"growth_from_2000_to_2013": "-3.6%",
"latitude": 39.9259463,
"longitude": -75.1196199,
"population": "76903",
"rank": "430",
"state": "New Jersey",
},
{
"city": "St. George",
"growth_from_2000_to_2013": "53.1%",
"latitude": 37.0965278,
"longitude": -113.5684164,
"population": "76817",
"rank": "431",
"state": "Utah",
},
{
"city": "Kennewick",
"growth_from_2000_to_2013": "29.1%",
"latitude": 46.2112458,
"longitude": -119.1372338,
"population": "76762",
"rank": "432",
"state": "Washington",
},
{
"city": "Baldwin Park",
"growth_from_2000_to_2013": "0.8%",
"latitude": 34.0852868,
"longitude": -117.9608978,
"population": "76635",
"rank": "433",
"state": "California",
},
{
"city": "Chino Hills",
"growth_from_2000_to_2013": "13.6%",
"latitude": 33.9898188,
"longitude": -117.7325848,
"population": "76572",
"rank": "434",
"state": "California",
},
{
"city": "Alameda",
"growth_from_2000_to_2013": "5.4%",
"latitude": 37.7652065,
"longitude": -122.2416355,
"population": "76419",
"rank": "435",
"state": "California",
},
{
"city": "Albany",
"growth_from_2000_to_2013": "-0.6%",
"latitude": 31.5785074,
"longitude": -84.15574099999999,
"population": "76185",
"rank": "436",
"state": "Georgia",
},
{
"city": "Arlington Heights",
"growth_from_2000_to_2013": "-0.6%",
"latitude": 42.0883603,
"longitude": -87.98062650000001,
"population": "75994",
"rank": "437",
"state": "Illinois",
},
{
"city": "Scranton",
"growth_from_2000_to_2013": "0.0%",
"latitude": 41.408969,
"longitude": -75.66241219999999,
"population": "75806",
"rank": "438",
"state": "Pennsylvania",
},
{
"city": "Evanston",
"growth_from_2000_to_2013": "1.9%",
"latitude": 42.0450722,
"longitude": -87.68769689999999,
"population": "75570",
"rank": "439",
"state": "Illinois",
},
{
"city": "Kalamazoo",
"growth_from_2000_to_2013": "-1.9%",
"latitude": 42.2917069,
"longitude": -85.5872286,
"population": "75548",
"rank": "440",
"state": "Michigan",
},
{
"city": "Baytown",
"growth_from_2000_to_2013": "13.1%",
"latitude": 29.7355047,
"longitude": -94.97742740000001,
"population": "75418",
"rank": "441",
"state": "Texas",
},
{
"city": "Upland",
"growth_from_2000_to_2013": "9.5%",
"latitude": 34.09751,
"longitude": -117.6483876,
"population": "75413",
"rank": "442",
"state": "California",
},
{
"city": "Springdale",
"growth_from_2000_to_2013": "57.1%",
"latitude": 36.18674420000001,
"longitude": -94.1288141,
"population": "75229",
"rank": "443",
"state": "Arkansas",
},
{
"city": "Bethlehem",
"growth_from_2000_to_2013": "5.2%",
"latitude": 40.6259316,
"longitude": -75.37045789999999,
"population": "75018",
"rank": "444",
"state": "Pennsylvania",
},
{
"city": "Schaumburg",
"growth_from_2000_to_2013": "-0.5%",
"latitude": 42.0333607,
"longitude": -88.0834059,
"population": "74907",
"rank": "445",
"state": "Illinois",
},
{
"city": "Mount Pleasant",
"growth_from_2000_to_2013": "53.2%",
"latitude": 32.8323225,
"longitude": -79.82842579999999,
"population": "74885",
"rank": "446",
"state": "South Carolina",
},
{
"city": "Auburn",
"growth_from_2000_to_2013": "34.9%",
"latitude": 47.30732279999999,
"longitude": -122.2284532,
"population": "74860",
"rank": "447",
"state": "Washington",
},
{
"city": "Decatur",
"growth_from_2000_to_2013": "-8.7%",
"latitude": 39.8403147,
"longitude": -88.9548001,
"population": "74710",
"rank": "448",
"state": "Illinois",
},
{
"city": "San Ramon",
"growth_from_2000_to_2013": "65.8%",
"latitude": 37.7799273,
"longitude": -121.9780153,
"population": "74513",
"rank": "449",
"state": "California",
},
{
"city": "Pleasanton",
"growth_from_2000_to_2013": "15.2%",
"latitude": 37.6624312,
"longitude": -121.8746789,
"population": "74110",
"rank": "450",
"state": "California",
},
{
"city": "Wyoming",
"growth_from_2000_to_2013": "6.5%",
"latitude": 42.9133602,
"longitude": -85.7053085,
"population": "74100",
"rank": "451",
"state": "Michigan",
},
{
"city": "Lake Charles",
"growth_from_2000_to_2013": "3.0%",
"latitude": 30.2265949,
"longitude": -93.2173758,
"population": "74024",
"rank": "452",
"state": "Louisiana",
},
{
"city": "Plymouth",
"growth_from_2000_to_2013": "12.0%",
"latitude": 45.0105194,
"longitude": -93.4555093,
"population": "73987",
"rank": "453",
"state": "Minnesota",
},
{
"city": "Bolingbrook",
"growth_from_2000_to_2013": "29.7%",
"latitude": 41.69864159999999,
"longitude": -88.0683955,
"population": "73936",
"rank": "454",
"state": "Illinois",
},
{
"city": "Pharr",
"growth_from_2000_to_2013": "55.7%",
"latitude": 26.1947962,
"longitude": -98.1836216,
"population": "73790",
"rank": "455",
"state": "Texas",
},
{
"city": "Appleton",
"growth_from_2000_to_2013": "4.5%",
"latitude": 44.2619309,
"longitude": -88.41538469999999,
"population": "73596",
"rank": "456",
"state": "Wisconsin",
},
{
"city": "Gastonia",
"growth_from_2000_to_2013": "8.2%",
"latitude": 35.262082,
"longitude": -81.18730049999999,
"population": "73209",
"rank": "457",
"state": "North Carolina",
},
{
"city": "Folsom",
"growth_from_2000_to_2013": "38.6%",
"latitude": 38.6779591,
"longitude": -121.1760583,
"population": "73098",
"rank": "458",
"state": "California",
},
{
"city": "Southfield",
"growth_from_2000_to_2013": "-6.7%",
"latitude": 42.4733688,
"longitude": -83.2218731,
"population": "73006",
"rank": "459",
"state": "Michigan",
},
{
"city": "Rochester Hills",
"growth_from_2000_to_2013": "5.7%",
"latitude": 42.65836609999999,
"longitude": -83.1499322,
"population": "72952",
"rank": "460",
"state": "Michigan",
},
{
"city": "New Britain",
"growth_from_2000_to_2013": "1.9%",
"latitude": 41.6612104,
"longitude": -72.7795419,
"population": "72939",
"rank": "461",
"state": "Connecticut",
},
{
"city": "Goodyear",
"growth_from_2000_to_2013": "271.0%",
"latitude": 33.4353394,
"longitude": -112.3576567,
"population": "72864",
"rank": "462",
"state": "Arizona",
},
{
"city": "Canton",
"growth_from_2000_to_2013": "-10.3%",
"latitude": 40.79894729999999,
"longitude": -81.378447,
"population": "72535",
"rank": "463",
"state": "Ohio",
},
{
"city": "Warner Robins",
"growth_from_2000_to_2013": "45.7%",
"latitude": 32.6130007,
"longitude": -83.624201,
"population": "72531",
"rank": "464",
"state": "Georgia",
},
{
"city": "Union City",
"growth_from_2000_to_2013": "7.4%",
"latitude": 37.5933918,
"longitude": -122.0438298,
"population": "72528",
"rank": "465",
"state": "California",
},
{
"city": "Perris",
"growth_from_2000_to_2013": "98.7%",
"latitude": 33.7825194,
"longitude": -117.2286478,
"population": "72326",
"rank": "466",
"state": "California",
},
{
"city": "Manteca",
"growth_from_2000_to_2013": "42.7%",
"latitude": 37.7974273,
"longitude": -121.2160526,
"population": "71948",
"rank": "467",
"state": "California",
},
{
"city": "Iowa City",
"growth_from_2000_to_2013": "13.8%",
"latitude": 41.6611277,
"longitude": -91.5301683,
"population": "71591",
"rank": "468",
"state": "Iowa",
},
{
"city": "Jonesboro",
"growth_from_2000_to_2013": "28.3%",
"latitude": 35.84229670000001,
"longitude": -90.704279,
"population": "71551",
"rank": "469",
"state": "Arkansas",
},
{
"city": "Wilmington",
"growth_from_2000_to_2013": "-1.6%",
"latitude": 39.7390721,
"longitude": -75.5397878,
"population": "71525",
"rank": "470",
"state": "Delaware",
},
{
"city": "Lynwood",
"growth_from_2000_to_2013": "2.0%",
"latitude": 33.930293,
"longitude": -118.2114603,
"population": "71371",
"rank": "471",
"state": "California",
},
{
"city": "Loveland",
"growth_from_2000_to_2013": "37.4%",
"latitude": 40.3977612,
"longitude": -105.0749801,
"population": "71334",
"rank": "472",
"state": "Colorado",
},
{
"city": "Pawtucket",
"growth_from_2000_to_2013": "-2.5%",
"latitude": 41.878711,
"longitude": -71.38255579999999,
"population": "71172",
"rank": "473",
"state": "Rhode Island",
},
{
"city": "Boynton Beach",
"growth_from_2000_to_2013": "17.3%",
"latitude": 26.5317866,
"longitude": -80.0905465,
"population": "71097",
"rank": "474",
"state": "Florida",
},
{
"city": "Waukesha",
"growth_from_2000_to_2013": "8.0%",
"latitude": 43.0116784,
"longitude": -88.2314813,
"population": "71016",
"rank": "475",
"state": "Wisconsin",
},
{
"city": "Gulfport",
"growth_from_2000_to_2013": "-0.6%",
"latitude": 30.3674198,
"longitude": -89.0928155,
"population": "71012",
"rank": "476",
"state": "Mississippi",
},
{
"city": "Apple Valley",
"growth_from_2000_to_2013": "29.9%",
"latitude": 34.5008311,
"longitude": -117.1858759,
"population": "70924",
"rank": "477",
"state": "California",
},
{
"city": "Passaic",
"growth_from_2000_to_2013": "4.3%",
"latitude": 40.8567662,
"longitude": -74.1284764,
"population": "70868",
"rank": "478",
"state": "New Jersey",
},
{
"city": "Rapid City",
"growth_from_2000_to_2013": "17.9%",
"latitude": 44.0805434,
"longitude": -103.2310149,
"population": "70812",
"rank": "479",
"state": "South Dakota",
},
{
"city": "Layton",
"growth_from_2000_to_2013": "20.2%",
"latitude": 41.0602216,
"longitude": -111.9710529,
"population": "70790",
"rank": "480",
"state": "Utah",
},
{
"city": "Lafayette",
"growth_from_2000_to_2013": "14.5%",
"latitude": 40.4167022,
"longitude": -86.87528689999999,
"population": "70373",
"rank": "481",
"state": "Indiana",
},
{
"city": "Turlock",
"growth_from_2000_to_2013": "23.5%",
"latitude": 37.4946568,
"longitude": -120.8465941,
"population": "70365",
"rank": "482",
"state": "California",
},
{
"city": "Muncie",
"growth_from_2000_to_2013": "-0.7%",
"latitude": 40.1933767,
"longitude": -85.3863599,
"population": "70316",
"rank": "483",
"state": "Indiana",
},
{
"city": "Temple",
"growth_from_2000_to_2013": "27.1%",
"latitude": 31.0982344,
"longitude": -97.342782,
"population": "70190",
"rank": "484",
"state": "Texas",
},
{
"city": "Missouri City",
"growth_from_2000_to_2013": "31.1%",
"latitude": 29.6185669,
"longitude": -95.5377215,
"population": "70185",
"rank": "485",
"state": "Texas",
},
{
"city": "Redlands",
"growth_from_2000_to_2013": "9.4%",
"latitude": 34.0555693,
"longitude": -117.1825381,
"population": "69999",
"rank": "486",
"state": "California",
},
{
"city": "Santa Fe",
"growth_from_2000_to_2013": "10.5%",
"latitude": 35.6869752,
"longitude": -105.937799,
"population": "69976",
"rank": "487",
"state": "New Mexico",
},
{
"city": "Lauderhill",
"growth_from_2000_to_2013": "4.2%",
"latitude": 26.1403635,
"longitude": -80.2133808,
"population": "69813",
"rank": "488",
"state": "Florida",
},
{
"city": "Milpitas",
"growth_from_2000_to_2013": "11.0%",
"latitude": 37.4323341,
"longitude": -121.8995741,
"population": "69783",
"rank": "489",
"state": "California",
},
{
"city": "Palatine",
"growth_from_2000_to_2013": "4.5%",
"latitude": 42.1103041,
"longitude": -88.03424000000001,
"population": "69350",
"rank": "490",
"state": "Illinois",
},
{
"city": "Missoula",
"growth_from_2000_to_2013": "19.7%",
"latitude": 46.87871759999999,
"longitude": -113.996586,
"population": "69122",
"rank": "491",
"state": "Montana",
},
{
"city": "Rock Hill",
"growth_from_2000_to_2013": "36.0%",
"latitude": 34.9248667,
"longitude": -81.02507840000001,
"population": "69103",
"rank": "492",
"state": "South Carolina",
},
{
"city": "Jacksonville",
"growth_from_2000_to_2013": "5.0%",
"latitude": 34.7540524,
"longitude": -77.4302414,
"population": "69079",
"rank": "493",
"state": "North Carolina",
},
{
"city": "Franklin",
"growth_from_2000_to_2013": "48.5%",
"latitude": 35.9250637,
"longitude": -86.8688899,
"population": "68886",
"rank": "494",
"state": "Tennessee",
},
{
"city": "Flagstaff",
"growth_from_2000_to_2013": "29.3%",
"latitude": 35.1982836,
"longitude": -111.651302,
"population": "68667",
"rank": "495",
"state": "Arizona",
},
{
"city": "Flower Mound",
"growth_from_2000_to_2013": "32.5%",
"latitude": 33.0145673,
"longitude": -97.0969552,
"population": "68609",
"rank": "496",
"state": "Texas",
},
{
"city": "Weston",
"growth_from_2000_to_2013": "34.5%",
"latitude": 26.1003654,
"longitude": -80.3997748,
"population": "68388",
"rank": "497",
"state": "Florida",
},
{
"city": "Waterloo",
"growth_from_2000_to_2013": "-0.5%",
"latitude": 42.492786,
"longitude": -92.34257749999999,
"population": "68366",
"rank": "498",
"state": "Iowa",
},
{
"city": "Union City",
"growth_from_2000_to_2013": "1.7%",
"latitude": 40.6975898,
"longitude": -74.26316349999999,
"population": "68247",
"rank": "499",
"state": "New Jersey",
},
{
"city": "Mount Vernon",
"growth_from_2000_to_2013": "-0.2%",
"latitude": 40.9125992,
"longitude": -73.8370786,
"population": "68224",
"rank": "500",
"state": "New York",
},
{
"city": "Fort Myers",
"growth_from_2000_to_2013": "31.2%",
"latitude": 26.640628,
"longitude": -81.8723084,
"population": "68190",
"rank": "501",
"state": "Florida",
},
{
"city": "Dothan",
"growth_from_2000_to_2013": "16.6%",
"latitude": 31.2232313,
"longitude": -85.3904888,
"population": "68001",
"rank": "502",
"state": "Alabama",
},
{
"city": "Rancho Cordova",
"growth_from_2000_to_2013": "26.4%",
"latitude": 38.5890723,
"longitude": -121.302728,
"population": "67911",
"rank": "503",
"state": "California",
},
{
"city": "Redondo Beach",
"growth_from_2000_to_2013": "6.7%",
"latitude": 33.8491816,
"longitude": -118.3884078,
"population": "67815",
"rank": "504",
"state": "California",
},
{
"city": "Jackson",
"growth_from_2000_to_2013": "12.9%",
"latitude": 35.6145169,
"longitude": -88.81394689999999,
"population": "67685",
"rank": "505",
"state": "Tennessee",
},
{
"city": "Pasco",
"growth_from_2000_to_2013": "98.5%",
"latitude": 46.2395793,
"longitude": -119.1005657,
"population": "67599",
"rank": "506",
"state": "Washington",
},
{
"city": "St. Charles",
"growth_from_2000_to_2013": "11.3%",
"latitude": 38.7881062,
"longitude": -90.4974359,
"population": "67569",
"rank": "507",
"state": "Missouri",
},
{
"city": "Eau Claire",
"growth_from_2000_to_2013": "8.7%",
"latitude": 44.811349,
"longitude": -91.4984941,
"population": "67545",
"rank": "508",
"state": "Wisconsin",
},
{
"city": "North Richland Hills",
"growth_from_2000_to_2013": "20.2%",
"latitude": 32.8342952,
"longitude": -97.2289029,
"population": "67317",
"rank": "509",
"state": "Texas",
},
{
"city": "Bismarck",
"growth_from_2000_to_2013": "20.1%",
"latitude": 46.8083268,
"longitude": -100.7837392,
"population": "67034",
"rank": "510",
"state": "North Dakota",
},
{
"city": "Yorba Linda",
"growth_from_2000_to_2013": "13.4%",
"latitude": 33.8886259,
"longitude": -117.8131125,
"population": "67032",
"rank": "511",
"state": "California",
},
{
"city": "Kenner",
"growth_from_2000_to_2013": "-4.8%",
"latitude": 29.9940924,
"longitude": -90.2417434,
"population": "66975",
"rank": "512",
"state": "Louisiana",
},
{
"city": "Walnut Creek",
"growth_from_2000_to_2013": "3.5%",
"latitude": 37.9100783,
"longitude": -122.0651819,
"population": "66900",
"rank": "513",
"state": "California",
},
{
"city": "Frederick",
"growth_from_2000_to_2013": "25.9%",
"latitude": 39.41426879999999,
"longitude": -77.4105409,
"population": "66893",
"rank": "514",
"state": "Maryland",
},
{
"city": "Oshkosh",
"growth_from_2000_to_2013": "5.3%",
"latitude": 44.0247062,
"longitude": -88.5426136,
"population": "66778",
"rank": "515",
"state": "Wisconsin",
},
{
"city": "Pittsburg",
"growth_from_2000_to_2013": "16.6%",
"latitude": 38.0279762,
"longitude": -121.8846806,
"population": "66695",
"rank": "516",
"state": "California",
},
{
"city": "Palo Alto",
"growth_from_2000_to_2013": "13.7%",
"latitude": 37.4418834,
"longitude": -122.1430195,
"population": "66642",
"rank": "517",
"state": "California",
},
{
"city": "Bossier City",
"growth_from_2000_to_2013": "17.4%",
"latitude": 32.5159852,
"longitude": -93.7321228,
"population": "66333",
"rank": "518",
"state": "Louisiana",
},
{
"city": "Portland",
"growth_from_2000_to_2013": "3.2%",
"latitude": 43.66147100000001,
"longitude": -70.2553259,
"population": "66318",
"rank": "519",
"state": "Maine",
},
{
"city": "St. Cloud",
"growth_from_2000_to_2013": "10.9%",
"latitude": 45.5579451,
"longitude": -94.16324039999999,
"population": "66297",
"rank": "520",
"state": "Minnesota",
},
{
"city": "Davis",
"growth_from_2000_to_2013": "11.9%",
"latitude": 38.5449065,
"longitude": -121.7405167,
"population": "66205",
"rank": "521",
"state": "California",
},
{
"city": "South San Francisco",
"growth_from_2000_to_2013": "9.1%",
"latitude": 37.654656,
"longitude": -122.4077498,
"population": "66174",
"rank": "522",
"state": "California",
},
{
"city": "Camarillo",
"growth_from_2000_to_2013": "14.9%",
"latitude": 34.2163937,
"longitude": -119.0376023,
"population": "66086",
"rank": "523",
"state": "California",
},
{
"city": "North Little Rock",
"growth_from_2000_to_2013": "9.0%",
"latitude": 34.769536,
"longitude": -92.2670941,
"population": "66075",
"rank": "524",
"state": "Arkansas",
},
{
"city": "Schenectady",
"growth_from_2000_to_2013": "6.7%",
"latitude": 42.8142432,
"longitude": -73.9395687,
"population": "65902",
"rank": "525",
"state": "New York",
},
{
"city": "Gaithersburg",
"growth_from_2000_to_2013": "24.2%",
"latitude": 39.1434406,
"longitude": -77.2013705,
"population": "65690",
"rank": "526",
"state": "Maryland",
},
{
"city": "Harlingen",
"growth_from_2000_to_2013": "11.6%",
"latitude": 26.1906306,
"longitude": -97.69610259999999,
"population": "65665",
"rank": "527",
"state": "Texas",
},
{
"city": "Woodbury",
"growth_from_2000_to_2013": "39.8%",
"latitude": 44.9238552,
"longitude": -92.9593797,
"population": "65656",
"rank": "528",
"state": "Minnesota",
},
{
"city": "Eagan",
"growth_from_2000_to_2013": "2.6%",
"latitude": 44.8041322,
"longitude": -93.1668858,
"population": "65453",
"rank": "529",
"state": "Minnesota",
},
{
"city": "Yuba City",
"growth_from_2000_to_2013": "27.9%",
"latitude": 39.1404477,
"longitude": -121.6169108,
"population": "65416",
"rank": "530",
"state": "California",
},
{
"city": "Maple Grove",
"growth_from_2000_to_2013": "27.3%",
"latitude": 45.0724642,
"longitude": -93.4557877,
"population": "65415",
"rank": "531",
"state": "Minnesota",
},
{
"city": "Youngstown",
"growth_from_2000_to_2013": "-20.2%",
"latitude": 41.0997803,
"longitude": -80.6495194,
"population": "65184",
"rank": "532",
"state": "Ohio",
},
{
"city": "Skokie",
"growth_from_2000_to_2013": "2.8%",
"latitude": 42.0324025,
"longitude": -87.7416246,
"population": "65176",
"rank": "533",
"state": "Illinois",
},
{
"city": "Kissimmee",
"growth_from_2000_to_2013": "32.6%",
"latitude": 28.2919557,
"longitude": -81.40757099999999,
"population": "65173",
"rank": "534",
"state": "Florida",
},
{
"city": "Johnson City",
"growth_from_2000_to_2013": "16.2%",
"latitude": 36.3134397,
"longitude": -82.3534727,
"population": "65123",
"rank": "535",
"state": "Tennessee",
},
{
"city": "Victoria",
"growth_from_2000_to_2013": "7.5%",
"latitude": 28.8052674,
"longitude": -97.0035982,
"population": "65098",
"rank": "536",
"state": "Texas",
},
{
"city": "San Clemente",
"growth_from_2000_to_2013": "28.6%",
"latitude": 33.4269728,
"longitude": -117.6119925,
"population": "65040",
"rank": "537",
"state": "California",
},
{
"city": "Bayonne",
"growth_from_2000_to_2013": "5.1%",
"latitude": 40.6687141,
"longitude": -74.1143091,
"population": "65028",
"rank": "538",
"state": "New Jersey",
},
{
"city": "Laguna Niguel",
"growth_from_2000_to_2013": "2.8%",
"latitude": 33.5225261,
"longitude": -117.7075526,
"population": "64652",
"rank": "539",
"state": "California",
},
{
"city": "East Orange",
"growth_from_2000_to_2013": "-7.4%",
"latitude": 40.767323,
"longitude": -74.2048677,
"population": "64544",
"rank": "540",
"state": "New Jersey",
},
{
"city": "Shawnee",
"growth_from_2000_to_2013": "32.2%",
"latitude": 39.02284849999999,
"longitude": -94.7151865,
"population": "64323",
"rank": "541",
"state": "Kansas",
},
{
"city": "Homestead",
"growth_from_2000_to_2013": "100.7%",
"latitude": 25.4687224,
"longitude": -80.4775569,
"population": "64079",
"rank": "542",
"state": "Florida",
},
{
"city": "Rockville",
"growth_from_2000_to_2013": "34.0%",
"latitude": 39.0839973,
"longitude": -77.1527578,
"population": "64072",
"rank": "544",
"state": "Maryland",
},
{
"city": "Delray Beach",
"growth_from_2000_to_2013": "6.1%",
"latitude": 26.4614625,
"longitude": -80.0728201,
"population": "64072",
"rank": "543",
"state": "Florida",
},
{
"city": "Janesville",
"growth_from_2000_to_2013": "5.6%",
"latitude": 42.6827885,
"longitude": -89.0187222,
"population": "63820",
"rank": "545",
"state": "Wisconsin",
},
{
"city": "Conway",
"growth_from_2000_to_2013": "46.1%",
"latitude": 35.0886963,
"longitude": -92.4421011,
"population": "63816",
"rank": "546",
"state": "Arkansas",
},
{
"city": "Pico Rivera",
"growth_from_2000_to_2013": "0.4%",
"latitude": 33.9830688,
"longitude": -118.096735,
"population": "63771",
"rank": "547",
"state": "California",
},
{
"city": "Lorain",
"growth_from_2000_to_2013": "-7.2%",
"latitude": 41.452819,
"longitude": -82.1823746,
"population": "63710",
"rank": "548",
"state": "Ohio",
},
{
"city": "Montebello",
"growth_from_2000_to_2013": "2.0%",
"latitude": 34.0165053,
"longitude": -118.1137535,
"population": "63495",
"rank": "549",
"state": "California",
},
{
"city": "Lodi",
"growth_from_2000_to_2013": "10.1%",
"latitude": 38.1341477,
"longitude": -121.2722194,
"population": "63338",
"rank": "550",
"state": "California",
},
{
"city": "New Braunfels",
"growth_from_2000_to_2013": "64.0%",
"latitude": 29.7030024,
"longitude": -98.1244531,
"population": "63279",
"rank": "551",
"state": "Texas",
},
{
"city": "Marysville",
"growth_from_2000_to_2013": "115.7%",
"latitude": 48.0517637,
"longitude": -122.1770818,
"population": "63269",
"rank": "552",
"state": "Washington",
},
{
"city": "Tamarac",
"growth_from_2000_to_2013": "12.9%",
"latitude": 26.2128609,
"longitude": -80.2497707,
"population": "63155",
"rank": "553",
"state": "Florida",
},
{
"city": "Madera",
"growth_from_2000_to_2013": "44.4%",
"latitude": 36.9613356,
"longitude": -120.0607176,
"population": "63105",
"rank": "554",
"state": "California",
},
{
"city": "Conroe",
"growth_from_2000_to_2013": "61.9%",
"latitude": 30.3118769,
"longitude": -95.45605119999999,
"population": "63032",
"rank": "555",
"state": "Texas",
},
{
"city": "Santa Cruz",
"growth_from_2000_to_2013": "12.5%",
"latitude": 36.9741171,
"longitude": -122.0307963,
"population": "62864",
"rank": "556",
"state": "California",
},
{
"city": "Eden Prairie",
"growth_from_2000_to_2013": "13.3%",
"latitude": 44.8546856,
"longitude": -93.47078599999999,
"population": "62603",
"rank": "557",
"state": "Minnesota",
},
{
"city": "Cheyenne",
"growth_from_2000_to_2013": "16.9%",
"latitude": 41.1399814,
"longitude": -104.8202462,
"population": "62448",
"rank": "558",
"state": "Wyoming",
},
{
"city": "Daytona Beach",
"growth_from_2000_to_2013": "-2.3%",
"latitude": 29.2108147,
"longitude": -81.0228331,
"population": "62316",
"rank": "559",
"state": "Florida",
},
{
"city": "Alpharetta",
"growth_from_2000_to_2013": "33.6%",
"latitude": 34.0753762,
"longitude": -84.2940899,
"population": "62298",
"rank": "560",
"state": "Georgia",
},
{
"city": "Hamilton",
"growth_from_2000_to_2013": "2.7%",
"latitude": 39.3995008,
"longitude": -84.5613355,
"population": "62258",
"rank": "561",
"state": "Ohio",
},
{
"city": "Waltham",
"growth_from_2000_to_2013": "5.0%",
"latitude": 42.3764852,
"longitude": -71.2356113,
"population": "62227",
"rank": "562",
"state": "Massachusetts",
},
{
"city": "Coon Rapids",
"growth_from_2000_to_2013": "0.6%",
"latitude": 45.1732394,
"longitude": -93.30300629999999,
"population": "62103",
"rank": "563",
"state": "Minnesota",
},
{
"city": "Haverhill",
"growth_from_2000_to_2013": "5.0%",
"latitude": 42.7762015,
"longitude": -71.0772796,
"population": "62088",
"rank": "564",
"state": "Massachusetts",
},
{
"city": "Council Bluffs",
"growth_from_2000_to_2013": "6.2%",
"latitude": 41.2619444,
"longitude": -95.8608333,
"population": "61969",
"rank": "565",
"state": "Iowa",
},
{
"city": "Taylor",
"growth_from_2000_to_2013": "-6.3%",
"latitude": 42.240872,
"longitude": -83.2696509,
"population": "61817",
"rank": "566",
"state": "Michigan",
},
{
"city": "Utica",
"growth_from_2000_to_2013": "2.2%",
"latitude": 43.100903,
"longitude": -75.232664,
"population": "61808",
"rank": "567",
"state": "New York",
},
{
"city": "Ames",
"growth_from_2000_to_2013": "21.3%",
"latitude": 42.034722,
"longitude": -93.61999999999999,
"population": "61792",
"rank": "568",
"state": "Iowa",
},
{
"city": "La Habra",
"growth_from_2000_to_2013": "3.6%",
"latitude": 33.9319578,
"longitude": -117.9461734,
"population": "61653",
"rank": "569",
"state": "California",
},
{
"city": "Encinitas",
"growth_from_2000_to_2013": "5.8%",
"latitude": 33.0369867,
"longitude": -117.2919818,
"population": "61588",
"rank": "570",
"state": "California",
},
{
"city": "Bowling Green",
"growth_from_2000_to_2013": "24.1%",
"latitude": 36.9685219,
"longitude": -86.4808043,
"population": "61488",
"rank": "571",
"state": "Kentucky",
},
{
"city": "Burnsville",
"growth_from_2000_to_2013": "1.9%",
"latitude": 44.7677424,
"longitude": -93.27772259999999,
"population": "61434",
"rank": "572",
"state": "Minnesota",
},
{
"city": "Greenville",
"growth_from_2000_to_2013": "8.2%",
"latitude": 34.85261759999999,
"longitude": -82.3940104,
"population": "61397",
"rank": "573",
"state": "South Carolina",
},
{
"city": "West Des Moines",
"growth_from_2000_to_2013": "29.8%",
"latitude": 41.5772115,
"longitude": -93.711332,
"population": "61255",
"rank": "574",
"state": "Iowa",
},
{
"city": "Cedar Park",
"growth_from_2000_to_2013": "134.3%",
"latitude": 30.505198,
"longitude": -97.8202888,
"population": "61238",
"rank": "575",
"state": "Texas",
},
{
"city": "Tulare",
"growth_from_2000_to_2013": "33.3%",
"latitude": 36.2077288,
"longitude": -119.3473379,
"population": "61170",
"rank": "576",
"state": "California",
},
{
"city": "Monterey Park",
"growth_from_2000_to_2013": "1.5%",
"latitude": 34.0625106,
"longitude": -118.1228476,
"population": "61085",
"rank": "577",
"state": "California",
},
{
"city": "Vineland",
"growth_from_2000_to_2013": "9.3%",
"latitude": 39.4863773,
"longitude": -75.02596369999999,
"population": "61050",
"rank": "578",
"state": "New Jersey",
},
{
"city": "Terre Haute",
"growth_from_2000_to_2013": "2.5%",
"latitude": 39.4667034,
"longitude": -87.41390919999999,
"population": "61025",
"rank": "579",
"state": "Indiana",
},
{
"city": "North Miami",
"growth_from_2000_to_2013": "2.0%",
"latitude": 25.8900949,
"longitude": -80.1867138,
"population": "61007",
"rank": "580",
"state": "Florida",
},
{
"city": "Mansfield",
"growth_from_2000_to_2013": "114.2%",
"latitude": 32.5631924,
"longitude": -97.1416768,
"population": "60872",
"rank": "581",
"state": "Texas",
},
{
"city": "West Allis",
"growth_from_2000_to_2013": "-0.6%",
"latitude": 43.0166806,
"longitude": -88.0070315,
"population": "60697",
"rank": "582",
"state": "Wisconsin",
},
{
"city": "Bristol",
"growth_from_2000_to_2013": "0.4%",
"latitude": 41.67176480000001,
"longitude": -72.9492703,
"population": "60568",
"rank": "583",
"state": "Connecticut",
},
{
"city": "Taylorsville",
"growth_from_2000_to_2013": "2.9%",
"latitude": 40.66772479999999,
"longitude": -111.9388258,
"population": "60519",
"rank": "584",
"state": "Utah",
},
{
"city": "Malden",
"growth_from_2000_to_2013": "7.4%",
"latitude": 42.4250964,
"longitude": -71.066163,
"population": "60509",
"rank": "585",
"state": "Massachusetts",
},
{
"city": "Meriden",
"growth_from_2000_to_2013": "3.7%",
"latitude": 41.5381535,
"longitude": -72.80704349999999,
"population": "60456",
"rank": "586",
"state": "Connecticut",
},
{
"city": "Blaine",
"growth_from_2000_to_2013": "32.8%",
"latitude": 45.1607987,
"longitude": -93.23494889999999,
"population": "60407",
"rank": "587",
"state": "Minnesota",
},
{
"city": "Wellington",
"growth_from_2000_to_2013": "55.0%",
"latitude": 26.6617635,
"longitude": -80.2683571,
"population": "60202",
"rank": "588",
"state": "Florida",
},
{
"city": "Cupertino",
"growth_from_2000_to_2013": "14.3%",
"latitude": 37.3229978,
"longitude": -122.0321823,
"population": "60189",
"rank": "589",
"state": "California",
},
{
"city": "Springfield",
"growth_from_2000_to_2013": "12.4%",
"latitude": 44.0462362,
"longitude": -123.0220289,
"population": "60177",
"rank": "590",
"state": "Oregon",
},
{
"city": "Rogers",
"growth_from_2000_to_2013": "50.6%",
"latitude": 36.3320196,
"longitude": -94.1185366,
"population": "60112",
"rank": "591",
"state": "Arkansas",
},
{
"city": "St. Clair Shores",
"growth_from_2000_to_2013": "-4.6%",
"latitude": 42.4974085,
"longitude": -82.89636039999999,
"population": "60070",
"rank": "592",
"state": "Michigan",
},
{
"city": "Gardena",
"growth_from_2000_to_2013": "3.4%",
"latitude": 33.8883487,
"longitude": -118.3089624,
"population": "59957",
"rank": "593",
"state": "California",
},
{
"city": "Pontiac",
"growth_from_2000_to_2013": "-11.4%",
"latitude": 42.6389216,
"longitude": -83.29104679999999,
"population": "59887",
"rank": "594",
"state": "Michigan",
},
{
"city": "National City",
"growth_from_2000_to_2013": "10.1%",
"latitude": 32.6781085,
"longitude": -117.0991967,
"population": "59834",
"rank": "595",
"state": "California",
},
{
"city": "Grand Junction",
"growth_from_2000_to_2013": "30.9%",
"latitude": 39.0638705,
"longitude": -108.5506486,
"population": "59778",
"rank": "596",
"state": "Colorado",
},
{
"city": "Rocklin",
"growth_from_2000_to_2013": "60.3%",
"latitude": 38.7907339,
"longitude": -121.2357828,
"population": "59738",
"rank": "597",
"state": "California",
},
{
"city": "Chapel Hill",
"growth_from_2000_to_2013": "24.1%",
"latitude": 35.9131996,
"longitude": -79.0558445,
"population": "59635",
"rank": "598",
"state": "North Carolina",
},
{
"city": "Casper",
"growth_from_2000_to_2013": "19.9%",
"latitude": 42.866632,
"longitude": -106.313081,
"population": "59628",
"rank": "599",
"state": "Wyoming",
},
{
"city": "Broomfield",
"growth_from_2000_to_2013": "50.3%",
"latitude": 39.9205411,
"longitude": -105.0866504,
"population": "59471",
"rank": "600",
"state": "Colorado",
},
{
"city": "Petaluma",
"growth_from_2000_to_2013": "8.4%",
"latitude": 38.232417,
"longitude": -122.6366524,
"population": "59440",
"rank": "601",
"state": "California",
},
{
"city": "South Jordan",
"growth_from_2000_to_2013": "100.1%",
"latitude": 40.5621704,
"longitude": -111.929658,
"population": "59366",
"rank": "602",
"state": "Utah",
},
{
"city": "Springfield",
"growth_from_2000_to_2013": "-9.8%",
"latitude": 39.9242266,
"longitude": -83.8088171,
"population": "59357",
"rank": "603",
"state": "Ohio",
},
{
"city": "Great Falls",
"growth_from_2000_to_2013": "3.9%",
"latitude": 47.4941836,
"longitude": -111.2833449,
"population": "59351",
"rank": "604",
"state": "Montana",
},
{
"city": "Lancaster",
"growth_from_2000_to_2013": "4.5%",
"latitude": 40.0378755,
"longitude": -76.3055144,
"population": "59325",
"rank": "605",
"state": "Pennsylvania",
},
{
"city": "North Port",
"growth_from_2000_to_2013": "154.6%",
"latitude": 27.044224,
"longitude": -82.2359254,
"population": "59212",
"rank": "606",
"state": "Florida",
},
{
"city": "Lakewood",
"growth_from_2000_to_2013": "1.1%",
"latitude": 47.1717649,
"longitude": -122.518458,
"population": "59097",
"rank": "607",
"state": "Washington",
},
{
"city": "Marietta",
"growth_from_2000_to_2013": "-3.8%",
"latitude": 33.95260200000001,
"longitude": -84.5499327,
"population": "59089",
"rank": "608",
"state": "Georgia",
},
{
"city": "San Rafael",
"growth_from_2000_to_2013": "5.0%",
"latitude": 37.9735346,
"longitude": -122.5310874,
"population": "58994",
"rank": "609",
"state": "California",
},
{
"city": "Royal Oak",
"growth_from_2000_to_2013": "-1.7%",
"latitude": 42.4894801,
"longitude": -83.1446485,
"population": "58946",
"rank": "610",
"state": "Michigan",
},
{
"city": "Des Plaines",
"growth_from_2000_to_2013": "3.2%",
"latitude": 42.0333623,
"longitude": -87.88339909999999,
"population": "58918",
"rank": "611",
"state": "Illinois",
},
{
"city": "Huntington Park",
"growth_from_2000_to_2013": "-4.1%",
"latitude": 33.9816812,
"longitude": -118.2250725,
"population": "58879",
"rank": "612",
"state": "California",
},
{
"city": "La Mesa",
"growth_from_2000_to_2013": "6.9%",
"latitude": 32.7678287,
"longitude": -117.0230839,
"population": "58642",
"rank": "613",
"state": "California",
},
{
"city": "Orland Park",
"growth_from_2000_to_2013": "13.9%",
"latitude": 41.6303103,
"longitude": -87.85394250000002,
"population": "58590",
"rank": "614",
"state": "Illinois",
},
{
"city": "Auburn",
"growth_from_2000_to_2013": "26.4%",
"latitude": 32.6098566,
"longitude": -85.48078249999999,
"population": "58582",
"rank": "615",
"state": "Alabama",
},
{
"city": "Lakeville",
"growth_from_2000_to_2013": "34.3%",
"latitude": 44.6496868,
"longitude": -93.24271999999999,
"population": "58562",
"rank": "616",
"state": "Minnesota",
},
{
"city": "Owensboro",
"growth_from_2000_to_2013": "7.7%",
"latitude": 37.7719074,
"longitude": -87.1111676,
"population": "58416",
"rank": "617",
"state": "Kentucky",
},
{
"city": "Moore",
"growth_from_2000_to_2013": "41.5%",
"latitude": 35.3395079,
"longitude": -97.48670279999999,
"population": "58414",
"rank": "618",
"state": "Oklahoma",
},
{
"city": "Jupiter",
"growth_from_2000_to_2013": "46.2%",
"latitude": 26.9342246,
"longitude": -80.0942087,
"population": "58298",
"rank": "619",
"state": "Florida",
},
{
"city": "Idaho Falls",
"growth_from_2000_to_2013": "14.0%",
"latitude": 43.49165139999999,
"longitude": -112.0339645,
"population": "58292",
"rank": "620",
"state": "Idaho",
},
{
"city": "Dubuque",
"growth_from_2000_to_2013": "0.9%",
"latitude": 42.5005583,
"longitude": -90.66457179999999,
"population": "58253",
"rank": "621",
"state": "Iowa",
},
{
"city": "Bartlett",
"growth_from_2000_to_2013": "31.7%",
"latitude": 35.2045328,
"longitude": -89.8739753,
"population": "58226",
"rank": "622",
"state": "Tennessee",
},
{
"city": "Rowlett",
"growth_from_2000_to_2013": "28.6%",
"latitude": 32.9029017,
"longitude": -96.56388,
"population": "58043",
"rank": "623",
"state": "Texas",
},
{
"city": "Novi",
"growth_from_2000_to_2013": "22.0%",
"latitude": 42.48059,
"longitude": -83.4754913,
"population": "57960",
"rank": "624",
"state": "Michigan",
},
{
"city": "White Plains",
"growth_from_2000_to_2013": "8.5%",
"latitude": 41.03398620000001,
"longitude": -73.7629097,
"population": "57866",
"rank": "625",
"state": "New York",
},
{
"city": "Arcadia",
"growth_from_2000_to_2013": "8.3%",
"latitude": 34.1397292,
"longitude": -118.0353449,
"population": "57639",
"rank": "626",
"state": "California",
},
{
"city": "Redmond",
"growth_from_2000_to_2013": "26.0%",
"latitude": 47.6739881,
"longitude": -122.121512,
"population": "57530",
"rank": "627",
"state": "Washington",
},
{
"city": "Lake Elsinore",
"growth_from_2000_to_2013": "96.5%",
"latitude": 33.6680772,
"longitude": -117.3272615,
"population": "57525",
"rank": "628",
"state": "California",
},
{
"city": "Ocala",
"growth_from_2000_to_2013": "20.8%",
"latitude": 29.1871986,
"longitude": -82.14009229999999,
"population": "57468",
"rank": "629",
"state": "Florida",
},
{
"city": "Tinley Park",
"growth_from_2000_to_2013": "16.3%",
"latitude": 41.5731442,
"longitude": -87.7932939,
"population": "57282",
"rank": "630",
"state": "Illinois",
},
{
"city": "Port Orange",
"growth_from_2000_to_2013": "22.8%",
"latitude": 29.1383165,
"longitude": -80.9956105,
"population": "57203",
"rank": "631",
"state": "Florida",
},
{
"city": "Medford",
"growth_from_2000_to_2013": "2.7%",
"latitude": 42.4184296,
"longitude": -71.1061639,
"population": "57170",
"rank": "632",
"state": "Massachusetts",
},
{
"city": "Oak Lawn",
"growth_from_2000_to_2013": "3.3%",
"latitude": 41.719978,
"longitude": -87.7479528,
"population": "57073",
"rank": "633",
"state": "Illinois",
},
{
"city": "Rocky Mount",
"growth_from_2000_to_2013": "-3.1%",
"latitude": 35.9382103,
"longitude": -77.7905339,
"population": "56954",
"rank": "634",
"state": "North Carolina",
},
{
"city": "Kokomo",
"growth_from_2000_to_2013": "21.3%",
"latitude": 40.486427,
"longitude": -86.13360329999999,
"population": "56895",
"rank": "635",
"state": "Indiana",
},
{
"city": "Coconut Creek",
"growth_from_2000_to_2013": "28.4%",
"latitude": 26.2517482,
"longitude": -80.17893509999999,
"population": "56792",
"rank": "636",
"state": "Florida",
},
{
"city": "Bowie",
"growth_from_2000_to_2013": "8.6%",
"latitude": 39.0067768,
"longitude": -76.77913649999999,
"population": "56759",
"rank": "637",
"state": "Maryland",
},
{
"city": "Berwyn",
"growth_from_2000_to_2013": "5.1%",
"latitude": 41.85058739999999,
"longitude": -87.7936685,
"population": "56758",
"rank": "638",
"state": "Illinois",
},
{
"city": "Midwest City",
"growth_from_2000_to_2013": "4.5%",
"latitude": 35.4495065,
"longitude": -97.3967019,
"population": "56756",
"rank": "639",
"state": "Oklahoma",
},
{
"city": "Fountain Valley",
"growth_from_2000_to_2013": "3.0%",
"latitude": 33.7091847,
"longitude": -117.9536697,
"population": "56707",
"rank": "640",
"state": "California",
},
{
"city": "Buckeye",
"growth_from_2000_to_2013": "480.9%",
"latitude": 33.3703197,
"longitude": -112.5837766,
"population": "56683",
"rank": "641",
"state": "Arizona",
},
{
"city": "Dearborn Heights",
"growth_from_2000_to_2013": "-3.0%",
"latitude": 42.3369816,
"longitude": -83.27326269999999,
"population": "56620",
"rank": "642",
"state": "Michigan",
},
{
"city": "Woodland",
"growth_from_2000_to_2013": "13.8%",
"latitude": 38.67851570000001,
"longitude": -121.7732971,
"population": "56590",
"rank": "643",
"state": "California",
},
{
"city": "Noblesville",
"growth_from_2000_to_2013": "88.1%",
"latitude": 40.0455917,
"longitude": -86.0085955,
"population": "56540",
"rank": "644",
"state": "Indiana",
},
{
"city": "Valdosta",
"growth_from_2000_to_2013": "22.3%",
"latitude": 30.8327022,
"longitude": -83.2784851,
"population": "56481",
"rank": "645",
"state": "Georgia",
},
{
"city": "Diamond Bar",
"growth_from_2000_to_2013": "0.1%",
"latitude": 34.0286226,
"longitude": -117.8103367,
"population": "56449",
"rank": "646",
"state": "California",
},
{
"city": "Manhattan",
"growth_from_2000_to_2013": "22.8%",
"latitude": 39.18360819999999,
"longitude": -96.57166939999999,
"population": "56143",
"rank": "647",
"state": "Kansas",
},
{
"city": "Santee",
"growth_from_2000_to_2013": "5.7%",
"latitude": 32.8383828,
"longitude": -116.9739167,
"population": "56105",
"rank": "648",
"state": "California",
},
{
"city": "Taunton",
"growth_from_2000_to_2013": "0.0%",
"latitude": 41.900101,
"longitude": -71.0897674,
"population": "56069",
"rank": "649",
"state": "Massachusetts",
},
{
"city": "Sanford",
"growth_from_2000_to_2013": "42.8%",
"latitude": 28.8028612,
"longitude": -81.269453,
"population": "56002",
"rank": "650",
"state": "Florida",
},
{
"city": "Kettering",
"growth_from_2000_to_2013": "-3.1%",
"latitude": 39.68950359999999,
"longitude": -84.1688274,
"population": "55870",
"rank": "651",
"state": "Ohio",
},
{
"city": "New Brunswick",
"growth_from_2000_to_2013": "15.5%",
"latitude": 40.4862157,
"longitude": -74.4518188,
"population": "55831",
"rank": "652",
"state": "New Jersey",
},
{
"city": "Decatur",
"growth_from_2000_to_2013": "3.1%",
"latitude": 34.6059253,
"longitude": -86.9833417,
"population": "55816",
"rank": "653",
"state": "Alabama",
},
{
"city": "Chicopee",
"growth_from_2000_to_2013": "1.7%",
"latitude": 42.1487043,
"longitude": -72.6078672,
"population": "55717",
"rank": "654",
"state": "Massachusetts",
},
{
"city": "Anderson",
"growth_from_2000_to_2013": "-6.6%",
"latitude": 40.1053196,
"longitude": -85.6802541,
"population": "55670",
"rank": "655",
"state": "Indiana",
},
{
"city": "Margate",
"growth_from_2000_to_2013": "2.7%",
"latitude": 26.2445263,
"longitude": -80.206436,
"population": "55456",
"rank": "656",
"state": "Florida",
},
{
"city": "Weymouth Town",
"growth_from_2000_to_2013": "",
"latitude": 42.2180724,
"longitude": -70.94103559999999,
"population": "55419",
"rank": "657",
"state": "Massachusetts",
},
{
"city": "Hempstead",
"growth_from_2000_to_2013": "4.0%",
"latitude": 40.7062128,
"longitude": -73.6187397,
"population": "55361",
"rank": "658",
"state": "New York",
},
{
"city": "Corvallis",
"growth_from_2000_to_2013": "11.8%",
"latitude": 44.5645659,
"longitude": -123.2620435,
"population": "55298",
"rank": "659",
"state": "Oregon",
},
{
"city": "Eastvale",
"growth_from_2000_to_2013": "",
"latitude": 33.952463,
"longitude": -117.5848025,
"population": "55191",
"rank": "660",
"state": "California",
},
{
"city": "Porterville",
"growth_from_2000_to_2013": "20.1%",
"latitude": 36.06523,
"longitude": -119.0167679,
"population": "55174",
"rank": "661",
"state": "California",
},
{
"city": "West Haven",
"growth_from_2000_to_2013": "5.1%",
"latitude": 41.2705484,
"longitude": -72.9469711,
"population": "55046",
"rank": "662",
"state": "Connecticut",
},
{
"city": "Brentwood",
"growth_from_2000_to_2013": "122.3%",
"latitude": 37.931868,
"longitude": -121.6957863,
"population": "55000",
"rank": "663",
"state": "California",
},
{
"city": "Paramount",
"growth_from_2000_to_2013": "-0.7%",
"latitude": 33.8894598,
"longitude": -118.1597911,
"population": "54980",
"rank": "664",
"state": "California",
},
{
"city": "Grand Forks",
"growth_from_2000_to_2013": "11.5%",
"latitude": 47.9252568,
"longitude": -97.0328547,
"population": "54932",
"rank": "665",
"state": "North Dakota",
},
{
"city": "Georgetown",
"growth_from_2000_to_2013": "91.9%",
"latitude": 30.6332618,
"longitude": -97.6779842,
"population": "54898",
"rank": "666",
"state": "Texas",
},
{
"city": "St. Peters",
"growth_from_2000_to_2013": "6.5%",
"latitude": 38.7874699,
"longitude": -90.6298922,
"population": "54842",
"rank": "667",
"state": "Missouri",
},
{
"city": "Shoreline",
"growth_from_2000_to_2013": "2.9%",
"latitude": 47.7556531,
"longitude": -122.3415178,
"population": "54790",
"rank": "668",
"state": "Washington",
},
{
"city": "Mount Prospect",
"growth_from_2000_to_2013": "-2.5%",
"latitude": 42.0664167,
"longitude": -87.9372908,
"population": "54771",
"rank": "669",
"state": "Illinois",
},
{
"city": "Hanford",
"growth_from_2000_to_2013": "30.3%",
"latitude": 36.3274502,
"longitude": -119.6456844,
"population": "54686",
"rank": "670",
"state": "California",
},
{
"city": "Normal",
"growth_from_2000_to_2013": "19.7%",
"latitude": 40.5142026,
"longitude": -88.9906312,
"population": "54664",
"rank": "671",
"state": "Illinois",
},
{
"city": "Rosemead",
"growth_from_2000_to_2013": "1.7%",
"latitude": 34.0805651,
"longitude": -118.072846,
"population": "54561",
"rank": "672",
"state": "California",
},
{
"city": "Lehi",
"growth_from_2000_to_2013": "176.3%",
"latitude": 40.3916172,
"longitude": -111.8507662,
"population": "54382",
"rank": "673",
"state": "Utah",
},
{
"city": "Pocatello",
"growth_from_2000_to_2013": "5.4%",
"latitude": 42.8713032,
"longitude": -112.4455344,
"population": "54350",
"rank": "674",
"state": "Idaho",
},
{
"city": "Highland",
"growth_from_2000_to_2013": "21.0%",
"latitude": 34.1283442,
"longitude": -117.2086513,
"population": "54291",
"rank": "675",
"state": "California",
},
{
"city": "Novato",
"growth_from_2000_to_2013": "13.3%",
"latitude": 38.1074198,
"longitude": -122.5697032,
"population": "54194",
"rank": "676",
"state": "California",
},
{
"city": "Port Arthur",
"growth_from_2000_to_2013": "-6.0%",
"latitude": 29.8849504,
"longitude": -93.93994699999999,
"population": "54135",
"rank": "677",
"state": "Texas",
},
{
"city": "Carson City",
"growth_from_2000_to_2013": "2.9%",
"latitude": 39.1637984,
"longitude": -119.7674034,
"population": "54080",
"rank": "678",
"state": "Nevada",
},
{
"city": "San Marcos",
"growth_from_2000_to_2013": "48.5%",
"latitude": 29.8832749,
"longitude": -97.9413941,
"population": "54076",
"rank": "679",
"state": "Texas",
},
{
"city": "Hendersonville",
"growth_from_2000_to_2013": "31.7%",
"latitude": 36.3047735,
"longitude": -86.6199957,
"population": "54068",
"rank": "680",
"state": "Tennessee",
},
{
"city": "Elyria",
"growth_from_2000_to_2013": "-3.7%",
"latitude": 41.3683798,
"longitude": -82.10764859999999,
"population": "53956",
"rank": "681",
"state": "Ohio",
},
{
"city": "Revere",
"growth_from_2000_to_2013": "13.4%",
"latitude": 42.4084302,
"longitude": -71.0119948,
"population": "53756",
"rank": "682",
"state": "Massachusetts",
},
{
"city": "Pflugerville",
"growth_from_2000_to_2013": "123.4%",
"latitude": 30.4393696,
"longitude": -97.62000429999999,
"population": "53752",
"rank": "683",
"state": "Texas",
},
{
"city": "Greenwood",
"growth_from_2000_to_2013": "46.0%",
"latitude": 39.6136578,
"longitude": -86.10665259999999,
"population": "53665",
"rank": "684",
"state": "Indiana",
},
{
"city": "Bellevue",
"growth_from_2000_to_2013": "20.5%",
"latitude": 41.1543623,
"longitude": -95.9145568,
"population": "53663",
"rank": "685",
"state": "Nebraska",
},
{
"city": "Wheaton",
"growth_from_2000_to_2013": "-3.4%",
"latitude": 41.8661403,
"longitude": -88.1070127,
"population": "53648",
"rank": "686",
"state": "Illinois",
},
{
"city": "Smyrna",
"growth_from_2000_to_2013": "20.0%",
"latitude": 33.8839926,
"longitude": -84.51437609999999,
"population": "53438",
"rank": "687",
"state": "Georgia",
},
{
"city": "Sarasota",
"growth_from_2000_to_2013": "1.4%",
"latitude": 27.3364347,
"longitude": -82.53065269999999,
"population": "53326",
"rank": "688",
"state": "Florida",
},
{
"city": "Blue Springs",
"growth_from_2000_to_2013": "9.9%",
"latitude": 39.0169509,
"longitude": -94.2816148,
"population": "53294",
"rank": "689",
"state": "Missouri",
},
{
"city": "Colton",
"growth_from_2000_to_2013": "10.8%",
"latitude": 34.0739016,
"longitude": -117.3136547,
"population": "53243",
"rank": "690",
"state": "California",
},
{
"city": "Euless",
"growth_from_2000_to_2013": "15.1%",
"latitude": 32.8370727,
"longitude": -97.08195409999999,
"population": "53224",
"rank": "691",
"state": "Texas",
},
{
"city": "Castle Rock",
"growth_from_2000_to_2013": "153.5%",
"latitude": 39.3722121,
"longitude": -104.8560902,
"population": "53063",
"rank": "692",
"state": "Colorado",
},
{
"city": "Cathedral City",
"growth_from_2000_to_2013": "23.2%",
"latitude": 33.7805388,
"longitude": -116.4668036,
"population": "52977",
"rank": "693",
"state": "California",
},
{
"city": "Kingsport",
"growth_from_2000_to_2013": "16.7%",
"latitude": 36.548434,
"longitude": -82.5618186,
"population": "52962",
"rank": "694",
"state": "Tennessee",
},
{
"city": "Lake Havasu City",
"growth_from_2000_to_2013": "24.6%",
"latitude": 34.483901,
"longitude": -114.3224548,
"population": "52844",
"rank": "695",
"state": "Arizona",
},
{
"city": "Pensacola",
"growth_from_2000_to_2013": "-6.0%",
"latitude": 30.42130899999999,
"longitude": -87.2169149,
"population": "52703",
"rank": "696",
"state": "Florida",
},
{
"city": "Hoboken",
"growth_from_2000_to_2013": "35.8%",
"latitude": 40.7439905,
"longitude": -74.0323626,
"population": "52575",
"rank": "697",
"state": "New Jersey",
},
{
"city": "Yucaipa",
"growth_from_2000_to_2013": "26.8%",
"latitude": 34.033625,
"longitude": -117.0430865,
"population": "52536",
"rank": "698",
"state": "California",
},
{
"city": "Watsonville",
"growth_from_2000_to_2013": "12.7%",
"latitude": 36.910231,
"longitude": -121.7568946,
"population": "52477",
"rank": "699",
"state": "California",
},
{
"city": "Richland",
"growth_from_2000_to_2013": "34.6%",
"latitude": 46.2856907,
"longitude": -119.2844621,
"population": "52413",
"rank": "700",
"state": "Washington",
},
{
"city": "Delano",
"growth_from_2000_to_2013": "31.8%",
"latitude": 35.7688425,
"longitude": -119.2470536,
"population": "52403",
"rank": "701",
"state": "California",
},
{
"city": "Hoffman Estates",
"growth_from_2000_to_2013": "5.4%",
"latitude": 42.0629915,
"longitude": -88.12271989999999,
"population": "52398",
"rank": "702",
"state": "Illinois",
},
{
"city": "Florissant",
"growth_from_2000_to_2013": "-2.8%",
"latitude": 38.789217,
"longitude": -90.322614,
"population": "52363",
"rank": "703",
"state": "Missouri",
},
{
"city": "Placentia",
"growth_from_2000_to_2013": "11.8%",
"latitude": 33.8722371,
"longitude": -117.8703363,
"population": "52206",
"rank": "704",
"state": "California",
},
{
"city": "West New York",
"growth_from_2000_to_2013": "13.3%",
"latitude": 40.7878788,
"longitude": -74.0143064,
"population": "52122",
"rank": "705",
"state": "New Jersey",
},
{
"city": "Dublin",
"growth_from_2000_to_2013": "70.0%",
"latitude": 37.7021521,
"longitude": -121.9357918,
"population": "52105",
"rank": "706",
"state": "California",
},
{
"city": "Oak Park",
"growth_from_2000_to_2013": "-0.8%",
"latitude": 41.8850317,
"longitude": -87.7845025,
"population": "52066",
"rank": "707",
"state": "Illinois",
},
{
"city": "Peabody",
"growth_from_2000_to_2013": "7.5%",
"latitude": 42.5278731,
"longitude": -70.9286609,
"population": "52044",
"rank": "708",
"state": "Massachusetts",
},
{
"city": "Perth Amboy",
"growth_from_2000_to_2013": "9.7%",
"latitude": 40.5067723,
"longitude": -74.2654234,
"population": "51982",
"rank": "709",
"state": "New Jersey",
},
{
"city": "Battle Creek",
"growth_from_2000_to_2013": "-2.8%",
"latitude": 42.3211522,
"longitude": -85.17971419999999,
"population": "51848",
"rank": "710",
"state": "Michigan",
},
{
"city": "Bradenton",
"growth_from_2000_to_2013": "3.4%",
"latitude": 27.4989278,
"longitude": -82.5748194,
"population": "51763",
"rank": "711",
"state": "Florida",
},
{
"city": "Gilroy",
"growth_from_2000_to_2013": "23.9%",
"latitude": 37.0057816,
"longitude": -121.5682751,
"population": "51701",
"rank": "712",
"state": "California",
},
{
"city": "Milford",
"growth_from_2000_to_2013": "1.8%",
"latitude": 41.2306979,
"longitude": -73.064036,
"population": "51644",
"rank": "713",
"state": "Connecticut",
},
{
"city": "Albany",
"growth_from_2000_to_2013": "25.5%",
"latitude": 44.6365107,
"longitude": -123.1059282,
"population": "51583",
"rank": "714",
"state": "Oregon",
},
{
"city": "Ankeny",
"growth_from_2000_to_2013": "86.9%",
"latitude": 41.7317884,
"longitude": -93.6001278,
"population": "51567",
"rank": "715",
"state": "Iowa",
},
{
"city": "La Crosse",
"growth_from_2000_to_2013": "-0.8%",
"latitude": 43.8013556,
"longitude": -91.23958069999999,
"population": "51522",
"rank": "716",
"state": "Wisconsin",
},
{
"city": "Burlington",
"growth_from_2000_to_2013": "12.1%",
"latitude": 36.0956918,
"longitude": -79.43779909999999,
"population": "51510",
"rank": "717",
"state": "North Carolina",
},
{
"city": "DeSoto",
"growth_from_2000_to_2013": "36.0%",
"latitude": 32.5896998,
"longitude": -96.8570738,
"population": "51483",
"rank": "718",
"state": "Texas",
},
{
"city": "Harrisonburg",
"growth_from_2000_to_2013": "27.1%",
"latitude": 38.4495688,
"longitude": -78.8689155,
"population": "51395",
"rank": "719",
"state": "Virginia",
},
{
"city": "Minnetonka",
"growth_from_2000_to_2013": "0.4%",
"latitude": 44.9211836,
"longitude": -93.4687489,
"population": "51368",
"rank": "720",
"state": "Minnesota",
},
{
"city": "Elkhart",
"growth_from_2000_to_2013": "-2.5%",
"latitude": 41.6819935,
"longitude": -85.9766671,
"population": "51265",
"rank": "721",
"state": "Indiana",
},
{
"city": "Lakewood",
"growth_from_2000_to_2013": "-9.4%",
"latitude": 41.4819932,
"longitude": -81.7981908,
"population": "51143",
"rank": "722",
"state": "Ohio",
},
{
"city": "Glendora",
"growth_from_2000_to_2013": "3.1%",
"latitude": 34.1361187,
"longitude": -117.865339,
"population": "51074",
"rank": "723",
"state": "California",
},
{
"city": "Southaven",
"growth_from_2000_to_2013": "72.8%",
"latitude": 34.9889818,
"longitude": -90.0125913,
"population": "50997",
"rank": "724",
"state": "Mississippi",
},
{
"city": "Charleston",
"growth_from_2000_to_2013": "-4.7%",
"latitude": 38.3498195,
"longitude": -81.6326234,
"population": "50821",
"rank": "725",
"state": "West Virginia",
},
{
"city": "Joplin",
"growth_from_2000_to_2013": "11.2%",
"latitude": 37.08422710000001,
"longitude": -94.51328099999999,
"population": "50789",
"rank": "726",
"state": "Missouri",
},
{
"city": "Enid",
"growth_from_2000_to_2013": "8.1%",
"latitude": 36.3955891,
"longitude": -97.8783911,
"population": "50725",
"rank": "727",
"state": "Oklahoma",
},
{
"city": "Palm Beach Gardens",
"growth_from_2000_to_2013": "39.6%",
"latitude": 26.8233946,
"longitude": -80.13865469999999,
"population": "50699",
"rank": "728",
"state": "Florida",
},
{
"city": "Brookhaven",
"growth_from_2000_to_2013": "",
"latitude": 33.8651033,
"longitude": -84.3365917,
"population": "50603",
"rank": "729",
"state": "Georgia",
},
{
"city": "Plainfield",
"growth_from_2000_to_2013": "5.7%",
"latitude": 40.6337136,
"longitude": -74.4073736,
"population": "50588",
"rank": "730",
"state": "New Jersey",
},
{
"city": "Grand Island",
"growth_from_2000_to_2013": "16.0%",
"latitude": 40.9263957,
"longitude": -98.3420118,
"population": "50550",
"rank": "731",
"state": "Nebraska",
},
{
"city": "Palm Desert",
"growth_from_2000_to_2013": "13.2%",
"latitude": 33.7222445,
"longitude": -116.3744556,
"population": "50508",
"rank": "732",
"state": "California",
},
{
"city": "Huntersville",
"growth_from_2000_to_2013": "92.9%",
"latitude": 35.410694,
"longitude": -80.84285040000002,
"population": "50458",
"rank": "733",
"state": "North Carolina",
},
{
"city": "Tigard",
"growth_from_2000_to_2013": "17.8%",
"latitude": 45.4312294,
"longitude": -122.7714861,
"population": "50444",
"rank": "734",
"state": "Oregon",
},
{
"city": "Lenexa",
"growth_from_2000_to_2013": "24.6%",
"latitude": 38.9536174,
"longitude": -94.73357089999999,
"population": "50344",
"rank": "735",
"state": "Kansas",
},
{
"city": "Saginaw",
"growth_from_2000_to_2013": "-18.2%",
"latitude": 43.4194699,
"longitude": -83.9508068,
"population": "50303",
"rank": "736",
"state": "Michigan",
},
{
"city": "Kentwood",
"growth_from_2000_to_2013": "10.5%",
"latitude": 42.8694731,
"longitude": -85.64474919999999,
"population": "50233",
"rank": "737",
"state": "Michigan",
},
{
"city": "Doral",
"growth_from_2000_to_2013": "137.6%",
"latitude": 25.8195424,
"longitude": -80.3553302,
"population": "50213",
"rank": "738",
"state": "Florida",
},
{
"city": "Apple Valley",
"growth_from_2000_to_2013": "9.2%",
"latitude": 44.7319094,
"longitude": -93.21772000000001,
"population": "50201",
"rank": "739",
"state": "Minnesota",
},
{
"city": "Grapevine",
"growth_from_2000_to_2013": "17.6%",
"latitude": 32.9342919,
"longitude": -97.0780654,
"population": "50195",
"rank": "740",
"state": "Texas",
},
{
"city": "Aliso Viejo",
"growth_from_2000_to_2013": "25.4%",
"latitude": 33.5676842,
"longitude": -117.7256083,
"population": "50175",
"rank": "741",
"state": "California",
},
{
"city": "Sammamish",
"growth_from_2000_to_2013": "44.1%",
"latitude": 47.61626829999999,
"longitude": -122.0355736,
"population": "50169",
"rank": "742",
"state": "Washington",
},
{
"city": "Casa Grande",
"growth_from_2000_to_2013": "86.0%",
"latitude": 32.8795022,
"longitude": -111.7573521,
"population": "50111",
"rank": "743",
"state": "Arizona",
},
{
"city": "Pinellas Park",
"growth_from_2000_to_2013": "5.9%",
"latitude": 27.8428025,
"longitude": -82.6995443,
"population": "49998",
"rank": "744",
"state": "Florida",
},
{
"city": "Troy",
"growth_from_2000_to_2013": "1.5%",
"latitude": 42.7284117,
"longitude": -73.69178509999999,
"population": "49974",
"rank": "745",
"state": "New York",
},
{
"city": "West Sacramento",
"growth_from_2000_to_2013": "55.6%",
"latitude": 38.5804609,
"longitude": -121.530234,
"population": "49891",
"rank": "746",
"state": "California",
},
{
"city": "Burien",
"growth_from_2000_to_2013": "56.7%",
"latitude": 47.4703767,
"longitude": -122.3467918,
"population": "49858",
"rank": "747",
"state": "Washington",
},
{
"city": "Commerce City",
"growth_from_2000_to_2013": "135.4%",
"latitude": 39.8083196,
"longitude": -104.9338675,
"population": "49799",
"rank": "748",
"state": "Colorado",
},
{
"city": "Monroe",
"growth_from_2000_to_2013": "-6.1%",
"latitude": 32.5093109,
"longitude": -92.1193012,
"population": "49761",
"rank": "749",
"state": "Louisiana",
},
{
"city": "Cerritos",
"growth_from_2000_to_2013": "-3.6%",
"latitude": 33.8583483,
"longitude": -118.0647871,
"population": "49707",
"rank": "750",
"state": "California",
},
{
"city": "Downers Grove",
"growth_from_2000_to_2013": "0.0%",
"latitude": 41.8089191,
"longitude": -88.01117459999999,
"population": "49670",
"rank": "751",
"state": "Illinois",
},
{
"city": "Coral Gables",
"growth_from_2000_to_2013": "16.1%",
"latitude": 25.72149,
"longitude": -80.2683838,
"population": "49631",
"rank": "752",
"state": "Florida",
},
{
"city": "Wilson",
"growth_from_2000_to_2013": "10.1%",
"latitude": 35.7212689,
"longitude": -77.9155395,
"population": "49628",
"rank": "753",
"state": "North Carolina",
},
{
"city": "Niagara Falls",
"growth_from_2000_to_2013": "-10.8%",
"latitude": 43.0962143,
"longitude": -79.0377388,
"population": "49468",
"rank": "754",
"state": "New York",
},
{
"city": "Poway",
"growth_from_2000_to_2013": "2.4%",
"latitude": 32.9628232,
"longitude": -117.0358646,
"population": "49417",
"rank": "755",
"state": "California",
},
{
"city": "Edina",
"growth_from_2000_to_2013": "4.1%",
"latitude": 44.8896866,
"longitude": -93.3499489,
"population": "49376",
"rank": "756",
"state": "Minnesota",
},
{
"city": "Cuyahoga Falls",
"growth_from_2000_to_2013": "-0.2%",
"latitude": 41.1339449,
"longitude": -81.48455849999999,
"population": "49267",
"rank": "757",
"state": "Ohio",
},
{
"city": "Rancho Santa Margarita",
"growth_from_2000_to_2013": "4.6%",
"latitude": 33.640855,
"longitude": -117.603104,
"population": "49228",
"rank": "758",
"state": "California",
},
{
"city": "Harrisburg",
"growth_from_2000_to_2013": "0.6%",
"latitude": 40.2731911,
"longitude": -76.8867008,
"population": "49188",
"rank": "759",
"state": "Pennsylvania",
},
{
"city": "Huntington",
"growth_from_2000_to_2013": "-5.0%",
"latitude": 38.4192496,
"longitude": -82.44515400000002,
"population": "49177",
"rank": "760",
"state": "West Virginia",
},
{
"city": "La Mirada",
"growth_from_2000_to_2013": "4.6%",
"latitude": 33.9172357,
"longitude": -118.0120086,
"population": "49133",
"rank": "761",
"state": "California",
},
{
"city": "Cypress",
"growth_from_2000_to_2013": "5.3%",
"latitude": 33.8169599,
"longitude": -118.0372852,
"population": "49087",
"rank": "762",
"state": "California",
},
{
"city": "Caldwell",
"growth_from_2000_to_2013": "77.1%",
"latitude": 43.66293839999999,
"longitude": -116.6873596,
"population": "48957",
"rank": "763",
"state": "Idaho",
},
{
"city": "Logan",
"growth_from_2000_to_2013": "14.5%",
"latitude": 41.7369803,
"longitude": -111.8338359,
"population": "48913",
"rank": "764",
"state": "Utah",
},
{
"city": "Galveston",
"growth_from_2000_to_2013": "-15.2%",
"latitude": 29.3013479,
"longitude": -94.7976958,
"population": "48733",
"rank": "765",
"state": "Texas",
},
{
"city": "Sheboygan",
"growth_from_2000_to_2013": "-3.9%",
"latitude": 43.7508284,
"longitude": -87.71453,
"population": "48725",
"rank": "766",
"state": "Wisconsin",
},
{
"city": "Middletown",
"growth_from_2000_to_2013": "-5.7%",
"latitude": 39.5150576,
"longitude": -84.39827629999999,
"population": "48630",
"rank": "767",
"state": "Ohio",
},
{
"city": "Murray",
"growth_from_2000_to_2013": "6.6%",
"latitude": 40.6668916,
"longitude": -111.8879909,
"population": "48612",
"rank": "768",
"state": "Utah",
},
{
"city": "Roswell",
"growth_from_2000_to_2013": "7.5%",
"latitude": 33.3942655,
"longitude": -104.5230242,
"population": "48611",
"rank": "769",
"state": "New Mexico",
},
{
"city": "Parker",
"growth_from_2000_to_2013": "96.4%",
"latitude": 39.5186002,
"longitude": -104.7613633,
"population": "48608",
"rank": "770",
"state": "Colorado",
},
{
"city": "Bedford",
"growth_from_2000_to_2013": "2.9%",
"latitude": 32.844017,
"longitude": -97.1430671,
"population": "48592",
"rank": "771",
"state": "Texas",
},
{
"city": "East Lansing",
"growth_from_2000_to_2013": "4.2%",
"latitude": 42.7369792,
"longitude": -84.48386540000001,
"population": "48554",
"rank": "772",
"state": "Michigan",
},
{
"city": "Methuen",
"growth_from_2000_to_2013": "10.3%",
"latitude": 42.7262016,
"longitude": -71.1908924,
"population": "48514",
"rank": "773",
"state": "Massachusetts",
},
{
"city": "Covina",
"growth_from_2000_to_2013": "3.3%",
"latitude": 34.0900091,
"longitude": -117.8903397,
"population": "48508",
"rank": "774",
"state": "California",
},
{
"city": "Alexandria",
"growth_from_2000_to_2013": "4.1%",
"latitude": 31.3112936,
"longitude": -92.4451371,
"population": "48426",
"rank": "775",
"state": "Louisiana",
},
{
"city": "Olympia",
"growth_from_2000_to_2013": "12.1%",
"latitude": 47.0378741,
"longitude": -122.9006951,
"population": "48338",
"rank": "776",
"state": "Washington",
},
{
"city": "Euclid",
"growth_from_2000_to_2013": "-8.4%",
"latitude": 41.5931049,
"longitude": -81.5267873,
"population": "48139",
"rank": "777",
"state": "Ohio",
},
{
"city": "Mishawaka",
"growth_from_2000_to_2013": "2.0%",
"latitude": 41.6619927,
"longitude": -86.15861559999999,
"population": "47989",
"rank": "778",
"state": "Indiana",
},
{
"city": "Salina",
"growth_from_2000_to_2013": "4.5%",
"latitude": 38.8402805,
"longitude": -97.61142369999999,
"population": "47846",
"rank": "779",
"state": "Kansas",
},
{
"city": "Azusa",
"growth_from_2000_to_2013": "6.7%",
"latitude": 34.1336186,
"longitude": -117.9075627,
"population": "47842",
"rank": "780",
"state": "California",
},
{
"city": "Newark",
"growth_from_2000_to_2013": "3.1%",
"latitude": 40.0581205,
"longitude": -82.4012642,
"population": "47777",
"rank": "781",
"state": "Ohio",
},
{
"city": "Chesterfield",
"growth_from_2000_to_2013": "1.9%",
"latitude": 38.6631083,
"longitude": -90.5770675,
"population": "47749",
"rank": "782",
"state": "Missouri",
},
{
"city": "Leesburg",
"growth_from_2000_to_2013": "66.0%",
"latitude": 39.1156615,
"longitude": -77.56360149999999,
"population": "47673",
"rank": "783",
"state": "Virginia",
},
{
"city": "Dunwoody",
"growth_from_2000_to_2013": "",
"latitude": 33.9462125,
"longitude": -84.3346473,
"population": "47591",
"rank": "784",
"state": "Georgia",
},
{
"city": "Hattiesburg",
"growth_from_2000_to_2013": "3.1%",
"latitude": 31.3271189,
"longitude": -89.29033919999999,
"population": "47556",
"rank": "785",
"state": "Mississippi",
},
{
"city": "Roseville",
"growth_from_2000_to_2013": "-1.0%",
"latitude": 42.4972583,
"longitude": -82.9371409,
"population": "47555",
"rank": "786",
"state": "Michigan",
},
{
"city": "Bonita Springs",
"growth_from_2000_to_2013": "43.8%",
"latitude": 26.339806,
"longitude": -81.7786972,
"population": "47547",
"rank": "787",
"state": "Florida",
},
{
"city": "Portage",
"growth_from_2000_to_2013": "5.7%",
"latitude": 42.2011538,
"longitude": -85.5800022,
"population": "47523",
"rank": "788",
"state": "Michigan",
},
{
"city": "St. Louis Park",
"growth_from_2000_to_2013": "7.3%",
"latitude": 44.9597376,
"longitude": -93.3702186,
"population": "47411",
"rank": "789",
"state": "Minnesota",
},
{
"city": "Collierville",
"growth_from_2000_to_2013": "43.4%",
"latitude": 35.042036,
"longitude": -89.6645266,
"population": "47333",
"rank": "790",
"state": "Tennessee",
},
{
"city": "Middletown",
"growth_from_2000_to_2013": "3.6%",
"latitude": 41.5623209,
"longitude": -72.6506488,
"population": "47333",
"rank": "791",
"state": "Connecticut",
},
{
"city": "Stillwater",
"growth_from_2000_to_2013": "20.1%",
"latitude": 36.1156071,
"longitude": -97.0583681,
"population": "47186",
"rank": "792",
"state": "Oklahoma",
},
{
"city": "East Providence",
"growth_from_2000_to_2013": "-3.3%",
"latitude": 41.8137116,
"longitude": -71.3700545,
"population": "47149",
"rank": "793",
"state": "Rhode Island",
},
{
"city": "Lawrence",
"growth_from_2000_to_2013": "20.5%",
"latitude": 39.8386516,
"longitude": -86.0252612,
"population": "47135",
"rank": "794",
"state": "Indiana",
},
{
"city": "Wauwatosa",
"growth_from_2000_to_2013": "0.0%",
"latitude": 43.0494572,
"longitude": -88.0075875,
"population": "47134",
"rank": "795",
"state": "Wisconsin",
},
{
"city": "Mentor",
"growth_from_2000_to_2013": "-6.6%",
"latitude": 41.6661573,
"longitude": -81.339552,
"population": "46979",
"rank": "796",
"state": "Ohio",
},
{
"city": "Ceres",
"growth_from_2000_to_2013": "34.0%",
"latitude": 37.5949316,
"longitude": -120.9577098,
"population": "46714",
"rank": "797",
"state": "California",
},
{
"city": "Cedar Hill",
"growth_from_2000_to_2013": "42.4%",
"latitude": 32.5884689,
"longitude": -96.9561152,
"population": "46663",
"rank": "798",
"state": "Texas",
},
{
"city": "Mansfield",
"growth_from_2000_to_2013": "-10.1%",
"latitude": 40.75839,
"longitude": -82.5154471,
"population": "46454",
"rank": "799",
"state": "Ohio",
},
{
"city": "Binghamton",
"growth_from_2000_to_2013": "-1.7%",
"latitude": 42.09868669999999,
"longitude": -75.91797380000001,
"population": "46444",
"rank": "800",
"state": "New York",
},
{
"city": "Coeur d'Alene",
"growth_from_2000_to_2013": "32.8%",
"latitude": 47.6776832,
"longitude": -116.7804664,
"population": "46402",
"rank": "801",
"state": "Idaho",
},
{
"city": "San Luis Obispo",
"growth_from_2000_to_2013": "4.4%",
"latitude": 35.2827524,
"longitude": -120.6596156,
"population": "46377",
"rank": "802",
"state": "California",
},
{
"city": "Minot",
"growth_from_2000_to_2013": "26.6%",
"latitude": 48.2329668,
"longitude": -101.2922906,
"population": "46321",
"rank": "803",
"state": "North Dakota",
},
{
"city": "Palm Springs",
"growth_from_2000_to_2013": "7.7%",
"latitude": 33.8302961,
"longitude": -116.5452921,
"population": "46281",
"rank": "804",
"state": "California",
},
{
"city": "Pine Bluff",
"growth_from_2000_to_2013": "-16.2%",
"latitude": 34.2284312,
"longitude": -92.00319549999999,
"population": "46094",
"rank": "805",
"state": "Arkansas",
},
{
"city": "Texas City",
"growth_from_2000_to_2013": "10.3%",
"latitude": 29.383845,
"longitude": -94.9027002,
"population": "46081",
"rank": "806",
"state": "Texas",
},
{
"city": "Summerville",
"growth_from_2000_to_2013": "62.9%",
"latitude": 33.0185039,
"longitude": -80.17564809999999,
"population": "46074",
"rank": "807",
"state": "South Carolina",
},
{
"city": "Twin Falls",
"growth_from_2000_to_2013": "31.5%",
"latitude": 42.5629668,
"longitude": -114.4608711,
"population": "45981",
"rank": "808",
"state": "Idaho",
},
{
"city": "Jeffersonville",
"growth_from_2000_to_2013": "53.3%",
"latitude": 38.2775702,
"longitude": -85.7371847,
"population": "45929",
"rank": "809",
"state": "Indiana",
},
{
"city": "San Jacinto",
"growth_from_2000_to_2013": "91.8%",
"latitude": 33.7839084,
"longitude": -116.958635,
"population": "45851",
"rank": "810",
"state": "California",
},
{
"city": "Madison",
"growth_from_2000_to_2013": "53.7%",
"latitude": 34.6992579,
"longitude": -86.74833180000002,
"population": "45799",
"rank": "811",
"state": "Alabama",
},
{
"city": "Altoona",
"growth_from_2000_to_2013": "-7.3%",
"latitude": 40.5186809,
"longitude": -78.3947359,
"population": "45796",
"rank": "812",
"state": "Pennsylvania",
},
{
"city": "Columbus",
"growth_from_2000_to_2013": "16.4%",
"latitude": 39.2014404,
"longitude": -85.9213796,
"population": "45775",
"rank": "813",
"state": "Indiana",
},
{
"city": "Beavercreek",
"growth_from_2000_to_2013": "19.0%",
"latitude": 39.7092262,
"longitude": -84.06326849999999,
"population": "45712",
"rank": "814",
"state": "Ohio",
},
{
"city": "Apopka",
"growth_from_2000_to_2013": "63.9%",
"latitude": 28.6934076,
"longitude": -81.5322149,
"population": "45587",
"rank": "815",
"state": "Florida",
},
{
"city": "Elmhurst",
"growth_from_2000_to_2013": "5.7%",
"latitude": 41.8994744,
"longitude": -87.9403418,
"population": "45556",
"rank": "816",
"state": "Illinois",
},
{
"city": "Maricopa",
"growth_from_2000_to_2013": "2503.4%",
"latitude": 33.0581063,
"longitude": -112.0476423,
"population": "45508",
"rank": "817",
"state": "Arizona",
},
{
"city": "Farmington",
"growth_from_2000_to_2013": "18.1%",
"latitude": 36.72805830000001,
"longitude": -108.2186856,
"population": "45426",
"rank": "818",
"state": "New Mexico",
},
{
"city": "Glenview",
"growth_from_2000_to_2013": "5.2%",
"latitude": 42.0697509,
"longitude": -87.7878408,
"population": "45417",
"rank": "819",
"state": "Illinois",
},
{
"city": "Cleveland Heights",
"growth_from_2000_to_2013": "-10.3%",
"latitude": 41.5200518,
"longitude": -81.556235,
"population": "45394",
"rank": "820",
"state": "Ohio",
},
{
"city": "Draper",
"growth_from_2000_to_2013": "77.4%",
"latitude": 40.5246711,
"longitude": -111.8638226,
"population": "45285",
"rank": "821",
"state": "Utah",
},
{
"city": "Lincoln",
"growth_from_2000_to_2013": "285.2%",
"latitude": 38.891565,
"longitude": -121.2930079,
"population": "45237",
"rank": "822",
"state": "California",
},
{
"city": "Sierra Vista",
"growth_from_2000_to_2013": "19.3%",
"latitude": 31.5455001,
"longitude": -110.2772856,
"population": "45129",
"rank": "823",
"state": "Arizona",
},
{
"city": "Lacey",
"growth_from_2000_to_2013": "41.7%",
"latitude": 47.03426289999999,
"longitude": -122.8231915,
"population": "44919",
"rank": "824",
"state": "Washington",
},
{
"city": "Biloxi",
"growth_from_2000_to_2013": "-11.5%",
"latitude": 30.3960318,
"longitude": -88.88530779999999,
"population": "44820",
"rank": "825",
"state": "Mississippi",
},
{
"city": "Strongsville",
"growth_from_2000_to_2013": "1.9%",
"latitude": 41.3144966,
"longitude": -81.83569,
"population": "44730",
"rank": "826",
"state": "Ohio",
},
{
"city": "Barnstable Town",
"growth_from_2000_to_2013": "-7.1%",
"latitude": 41.7003208,
"longitude": -70.3002024,
"population": "44641",
"rank": "827",
"state": "Massachusetts",
},
{
"city": "Wylie",
"growth_from_2000_to_2013": "185.2%",
"latitude": 33.0151201,
"longitude": -96.5388789,
"population": "44575",
"rank": "828",
"state": "Texas",
},
{
"city": "Sayreville",
"growth_from_2000_to_2013": "9.6%",
"latitude": 40.45940210000001,
"longitude": -74.360846,
"population": "44412",
"rank": "829",
"state": "New Jersey",
},
{
"city": "Kannapolis",
"growth_from_2000_to_2013": "18.6%",
"latitude": 35.4873613,
"longitude": -80.6217341,
"population": "44359",
"rank": "830",
"state": "North Carolina",
},
{
"city": "Charlottesville",
"growth_from_2000_to_2013": "10.5%",
"latitude": 38.0293059,
"longitude": -78.47667810000002,
"population": "44349",
"rank": "831",
"state": "Virginia",
},
{
"city": "Littleton",
"growth_from_2000_to_2013": "9.4%",
"latitude": 39.613321,
"longitude": -105.0166498,
"population": "44275",
"rank": "832",
"state": "Colorado",
},
{
"city": "Titusville",
"growth_from_2000_to_2013": "7.8%",
"latitude": 28.6122187,
"longitude": -80.8075537,
"population": "44206",
"rank": "833",
"state": "Florida",
},
{
"city": "Hackensack",
"growth_from_2000_to_2013": "2.9%",
"latitude": 40.8859325,
"longitude": -74.0434736,
"population": "44113",
"rank": "834",
"state": "New Jersey",
},
{
"city": "Newark",
"growth_from_2000_to_2013": "3.3%",
"latitude": 37.5296593,
"longitude": -122.0402399,
"population": "44096",
"rank": "835",
"state": "California",
},
{
"city": "Pittsfield",
"growth_from_2000_to_2013": "-3.6%",
"latitude": 42.4500845,
"longitude": -73.2453824,
"population": "44057",
"rank": "836",
"state": "Massachusetts",
},
{
"city": "York",
"growth_from_2000_to_2013": "6.4%",
"latitude": 39.9625984,
"longitude": -76.727745,
"population": "43935",
"rank": "837",
"state": "Pennsylvania",
},
{
"city": "Lombard",
"growth_from_2000_to_2013": "2.9%",
"latitude": 41.8800296,
"longitude": -88.00784349999999,
"population": "43907",
"rank": "838",
"state": "Illinois",
},
{
"city": "Attleboro",
"growth_from_2000_to_2013": "4.6%",
"latitude": 41.94454409999999,
"longitude": -71.2856082,
"population": "43886",
"rank": "839",
"state": "Massachusetts",
},
{
"city": "DeKalb",
"growth_from_2000_to_2013": "11.8%",
"latitude": 41.9294736,
"longitude": -88.75036469999999,
"population": "43849",
"rank": "840",
"state": "Illinois",
},
{
"city": "Blacksburg",
"growth_from_2000_to_2013": "9.4%",
"latitude": 37.2295733,
"longitude": -80.4139393,
"population": "43609",
"rank": "841",
"state": "Virginia",
},
{
"city": "Dublin",
"growth_from_2000_to_2013": "37.6%",
"latitude": 40.0992294,
"longitude": -83.1140771,
"population": "43607",
"rank": "842",
"state": "Ohio",
},
{
"city": "Haltom City",
"growth_from_2000_to_2013": "11.4%",
"latitude": 32.7995738,
"longitude": -97.26918169999999,
"population": "43580",
"rank": "843",
"state": "Texas",
},
{
"city": "Lompoc",
"growth_from_2000_to_2013": "5.5%",
"latitude": 34.6391501,
"longitude": -120.4579409,
"population": "43509",
"rank": "844",
"state": "California",
},
{
"city": "El Centro",
"growth_from_2000_to_2013": "13.7%",
"latitude": 32.792,
"longitude": -115.5630514,
"population": "43363",
"rank": "845",
"state": "California",
},
{
"city": "Danville",
"growth_from_2000_to_2013": "3.7%",
"latitude": 37.8215929,
"longitude": -121.9999606,
"population": "43341",
"rank": "846",
"state": "California",
},
{
"city": "Jefferson City",
"growth_from_2000_to_2013": "6.7%",
"latitude": 38.57670170000001,
"longitude": -92.1735164,
"population": "43330",
"rank": "847",
"state": "Missouri",
},
{
"city": "Cutler Bay",
"growth_from_2000_to_2013": "42.9%",
"latitude": 25.5808323,
"longitude": -80.34685929999999,
"population": "43328",
"rank": "848",
"state": "Florida",
},
{
"city": "Oakland Park",
"growth_from_2000_to_2013": "2.7%",
"latitude": 26.1723065,
"longitude": -80.1319893,
"population": "43286",
"rank": "849",
"state": "Florida",
},
{
"city": "North Miami Beach",
"growth_from_2000_to_2013": "3.6%",
"latitude": 25.9331488,
"longitude": -80.1625463,
"population": "43250",
"rank": "850",
"state": "Florida",
},
{
"city": "Freeport",
"growth_from_2000_to_2013": "-1.4%",
"latitude": 40.6576022,
"longitude": -73.58318349999999,
"population": "43167",
"rank": "851",
"state": "New York",
},
{
"city": "Moline",
"growth_from_2000_to_2013": "-1.9%",
"latitude": 41.5067003,
"longitude": -90.51513419999999,
"population": "43116",
"rank": "852",
"state": "Illinois",
},
{
"city": "Coachella",
"growth_from_2000_to_2013": "88.4%",
"latitude": 33.6803003,
"longitude": -116.173894,
"population": "43092",
"rank": "853",
"state": "California",
},
{
"city": "Fort Pierce",
"growth_from_2000_to_2013": "6.9%",
"latitude": 27.4467056,
"longitude": -80.3256056,
"population": "43074",
"rank": "854",
"state": "Florida",
},
{
"city": "Smyrna",
"growth_from_2000_to_2013": "54.9%",
"latitude": 35.9828412,
"longitude": -86.5186045,
"population": "43060",
"rank": "855",
"state": "Tennessee",
},
{
"city": "Bountiful",
"growth_from_2000_to_2013": "3.9%",
"latitude": 40.8893895,
"longitude": -111.880771,
"population": "43023",
"rank": "856",
"state": "Utah",
},
{
"city": "Fond du Lac",
"growth_from_2000_to_2013": "1.7%",
"latitude": 43.7730448,
"longitude": -88.4470508,
"population": "42970",
"rank": "857",
"state": "Wisconsin",
},
{
"city": "Everett",
"growth_from_2000_to_2013": "12.1%",
"latitude": 42.40843,
"longitude": -71.0536625,
"population": "42935",
"rank": "858",
"state": "Massachusetts",
},
{
"city": "Danville",
"growth_from_2000_to_2013": "-11.0%",
"latitude": 36.5859718,
"longitude": -79.39502279999999,
"population": "42907",
"rank": "859",
"state": "Virginia",
},
{
"city": "Keller",
"growth_from_2000_to_2013": "53.3%",
"latitude": 32.9341893,
"longitude": -97.229298,
"population": "42907",
"rank": "860",
"state": "Texas",
},
{
"city": "Belleville",
"growth_from_2000_to_2013": "1.2%",
"latitude": 38.5200504,
"longitude": -89.9839935,
"population": "42895",
"rank": "861",
"state": "Illinois",
},
{
"city": "Bell Gardens",
"growth_from_2000_to_2013": "-2.7%",
"latitude": 33.9652918,
"longitude": -118.1514588,
"population": "42889",
"rank": "862",
"state": "California",
},
{
"city": "Cleveland",
"growth_from_2000_to_2013": "14.1%",
"latitude": 35.1595182,
"longitude": -84.8766115,
"population": "42774",
"rank": "863",
"state": "Tennessee",
},
{
"city": "North Lauderdale",
"growth_from_2000_to_2013": "10.8%",
"latitude": 26.217305,
"longitude": -80.2258811,
"population": "42757",
"rank": "864",
"state": "Florida",
},
{
"city": "Fairfield",
"growth_from_2000_to_2013": "1.2%",
"latitude": 39.3454673,
"longitude": -84.5603187,
"population": "42635",
"rank": "865",
"state": "Ohio",
},
{
"city": "Salem",
"growth_from_2000_to_2013": "5.1%",
"latitude": 42.51954,
"longitude": -70.8967155,
"population": "42544",
"rank": "866",
"state": "Massachusetts",
},
{
"city": "Rancho Palos Verdes",
"growth_from_2000_to_2013": "2.9%",
"latitude": 33.7444613,
"longitude": -118.3870173,
"population": "42448",
"rank": "867",
"state": "California",
},
{
"city": "San Bruno",
"growth_from_2000_to_2013": "5.6%",
"latitude": 37.6304904,
"longitude": -122.4110835,
"population": "42443",
"rank": "868",
"state": "California",
},
{
"city": "Concord",
"growth_from_2000_to_2013": "4.1%",
"latitude": 43.2081366,
"longitude": -71.5375718,
"population": "42419",
"rank": "869",
"state": "New Hampshire",
},
{
"city": "Burlington",
"growth_from_2000_to_2013": "6.1%",
"latitude": 44.4758825,
"longitude": -73.21207199999999,
"population": "42284",
"rank": "870",
"state": "Vermont",
},
{
"city": "Apex",
"growth_from_2000_to_2013": "98.8%",
"latitude": 35.732652,
"longitude": -78.85028559999999,
"population": "42214",
"rank": "871",
"state": "North Carolina",
},
{
"city": "Midland",
"growth_from_2000_to_2013": "0.9%",
"latitude": 43.6155825,
"longitude": -84.2472116,
"population": "42181",
"rank": "872",
"state": "Michigan",
},
{
"city": "Altamonte Springs",
"growth_from_2000_to_2013": "2.0%",
"latitude": 28.6611089,
"longitude": -81.3656242,
"population": "42150",
"rank": "873",
"state": "Florida",
},
{
"city": "Hutchinson",
"growth_from_2000_to_2013": "0.1%",
"latitude": 38.0608445,
"longitude": -97.92977429999999,
"population": "41889",
"rank": "874",
"state": "Kansas",
},
{
"city": "Buffalo Grove",
"growth_from_2000_to_2013": "-3.4%",
"latitude": 42.1662831,
"longitude": -87.9631308,
"population": "41778",
"rank": "875",
"state": "Illinois",
},
{
"city": "Urbandale",
"growth_from_2000_to_2013": "41.5%",
"latitude": 41.6266555,
"longitude": -93.71216559999999,
"population": "41776",
"rank": "876",
"state": "Iowa",
},
{
"city": "State College",
"growth_from_2000_to_2013": "8.7%",
"latitude": 40.7933949,
"longitude": -77.8600012,
"population": "41757",
"rank": "877",
"state": "Pennsylvania",
},
{
"city": "Urbana",
"growth_from_2000_to_2013": "10.3%",
"latitude": 40.1105875,
"longitude": -88.2072697,
"population": "41752",
"rank": "878",
"state": "Illinois",
},
{
"city": "Plainfield",
"growth_from_2000_to_2013": "203.6%",
"latitude": 41.632223,
"longitude": -88.2120315,
"population": "41734",
"rank": "879",
"state": "Illinois",
},
{
"city": "Manassas",
"growth_from_2000_to_2013": "19.5%",
"latitude": 38.7509488,
"longitude": -77.47526669999999,
"population": "41705",
"rank": "880",
"state": "Virginia",
},
{
"city": "Bartlett",
"growth_from_2000_to_2013": "13.1%",
"latitude": 41.9950276,
"longitude": -88.1856301,
"population": "41679",
"rank": "881",
"state": "Illinois",
},
{
"city": "Kearny",
"growth_from_2000_to_2013": "2.8%",
"latitude": 40.7684342,
"longitude": -74.1454214,
"population": "41664",
"rank": "882",
"state": "New Jersey",
},
{
"city": "Oro Valley",
"growth_from_2000_to_2013": "27.0%",
"latitude": 32.3909071,
"longitude": -110.966488,
"population": "41627",
"rank": "883",
"state": "Arizona",
},
{
"city": "Findlay",
"growth_from_2000_to_2013": "5.8%",
"latitude": 41.04422,
"longitude": -83.6499321,
"population": "41512",
"rank": "884",
"state": "Ohio",
},
{
"city": "Rohnert Park",
"growth_from_2000_to_2013": "0.0%",
"latitude": 38.3396367,
"longitude": -122.7010984,
"population": "41398",
"rank": "885",
"state": "California",
},
{
"city": "Westfield",
"growth_from_2000_to_2013": "3.0%",
"latitude": 42.1250929,
"longitude": -72.749538,
"population": "41301",
"rank": "887",
"state": "Massachusetts",
},
{
"city": "Linden",
"growth_from_2000_to_2013": "4.7%",
"latitude": 40.6220478,
"longitude": -74.24459019999999,
"population": "41301",
"rank": "886",
"state": "New Jersey",
},
{
"city": "Sumter",
"growth_from_2000_to_2013": "1.3%",
"latitude": 33.9204354,
"longitude": -80.3414693,
"population": "41190",
"rank": "888",
"state": "South Carolina",
},
{
"city": "Wilkes-Barre",
"growth_from_2000_to_2013": "-4.3%",
"latitude": 41.2459149,
"longitude": -75.88130749999999,
"population": "41108",
"rank": "889",
"state": "Pennsylvania",
},
{
"city": "Woonsocket",
"growth_from_2000_to_2013": "-5.2%",
"latitude": 42.00287609999999,
"longitude": -71.51478390000001,
"population": "41026",
"rank": "890",
"state": "Rhode Island",
},
{
"city": "Leominster",
"growth_from_2000_to_2013": "-1.1%",
"latitude": 42.5250906,
"longitude": -71.759794,
"population": "41002",
"rank": "891",
"state": "Massachusetts",
},
{
"city": "Shelton",
"growth_from_2000_to_2013": "7.3%",
"latitude": 41.3164856,
"longitude": -73.0931641,
"population": "40999",
"rank": "892",
"state": "Connecticut",
},
{
"city": "Brea",
"growth_from_2000_to_2013": "15.2%",
"latitude": 33.9166805,
"longitude": -117.9000604,
"population": "40963",
"rank": "893",
"state": "California",
},
{
"city": "Covington",
"growth_from_2000_to_2013": "-4.7%",
"latitude": 39.0836712,
"longitude": -84.5085536,
"population": "40956",
"rank": "894",
"state": "Kentucky",
},
{
"city": "Rockwall",
"growth_from_2000_to_2013": "117.2%",
"latitude": 32.93123360000001,
"longitude": -96.4597089,
"population": "40922",
"rank": "895",
"state": "Texas",
},
{
"city": "Meridian",
"growth_from_2000_to_2013": "-0.9%",
"latitude": 32.3643098,
"longitude": -88.703656,
"population": "40921",
"rank": "896",
"state": "Mississippi",
},
{
"city": "Riverton",
"growth_from_2000_to_2013": "61.6%",
"latitude": 40.521893,
"longitude": -111.9391023,
"population": "40921",
"rank": "897",
"state": "Utah",
},
{
"city": "St. Cloud",
"growth_from_2000_to_2013": "86.2%",
"latitude": 28.2489016,
"longitude": -81.2811801,
"population": "40918",
"rank": "898",
"state": "Florida",
},
{
"city": "Quincy",
"growth_from_2000_to_2013": "0.5%",
"latitude": 39.9356016,
"longitude": -91.4098726,
"population": "40915",
"rank": "899",
"state": "Illinois",
},
{
"city": "Morgan Hill",
"growth_from_2000_to_2013": "19.5%",
"latitude": 37.1305012,
"longitude": -121.6543901,
"population": "40836",
"rank": "900",
"state": "California",
},
{
"city": "Warren",
"growth_from_2000_to_2013": "-15.2%",
"latitude": 41.2375569,
"longitude": -80.81841659999999,
"population": "40768",
"rank": "901",
"state": "Ohio",
},
{
"city": "Edmonds",
"growth_from_2000_to_2013": "2.9%",
"latitude": 47.8106521,
"longitude": -122.3773552,
"population": "40727",
"rank": "902",
"state": "Washington",
},
{
"city": "Burleson",
"growth_from_2000_to_2013": "85.3%",
"latitude": 32.5420821,
"longitude": -97.3208492,
"population": "40714",
"rank": "903",
"state": "Texas",
},
{
"city": "Beverly",
"growth_from_2000_to_2013": "2.0%",
"latitude": 42.5584283,
"longitude": -70.880049,
"population": "40664",
"rank": "904",
"state": "Massachusetts",
},
{
"city": "Mankato",
"growth_from_2000_to_2013": "24.7%",
"latitude": 44.1635775,
"longitude": -93.99939959999999,
"population": "40641",
"rank": "905",
"state": "Minnesota",
},
{
"city": "Hagerstown",
"growth_from_2000_to_2013": "10.4%",
"latitude": 39.6417629,
"longitude": -77.71999319999999,
"population": "40612",
"rank": "906",
"state": "Maryland",
},
{
"city": "Prescott",
"growth_from_2000_to_2013": "18.1%",
"latitude": 34.5400242,
"longitude": -112.4685025,
"population": "40590",
"rank": "907",
"state": "Arizona",
},
{
"city": "Campbell",
"growth_from_2000_to_2013": "4.2%",
"latitude": 37.2871651,
"longitude": -121.9499568,
"population": "40584",
"rank": "908",
"state": "California",
},
{
"city": "Cedar Falls",
"growth_from_2000_to_2013": "12.0%",
"latitude": 42.5348993,
"longitude": -92.4453161,
"population": "40566",
"rank": "909",
"state": "Iowa",
},
{
"city": "Beaumont",
"growth_from_2000_to_2013": "254.5%",
"latitude": 33.9294606,
"longitude": -116.977248,
"population": "40481",
"rank": "910",
"state": "California",
},
{
"city": "La Puente",
"growth_from_2000_to_2013": "-1.6%",
"latitude": 34.0200114,
"longitude": -117.9495083,
"population": "40435",
"rank": "911",
"state": "California",
},
{
"city": "Crystal Lake",
"growth_from_2000_to_2013": "5.3%",
"latitude": 42.2411344,
"longitude": -88.31619649999999,
"population": "40388",
"rank": "912",
"state": "Illinois",
},
{
"city": "Fitchburg",
"growth_from_2000_to_2013": "3.5%",
"latitude": 42.5834228,
"longitude": -71.8022955,
"population": "40383",
"rank": "913",
"state": "Massachusetts",
},
{
"city": "Carol Stream",
"growth_from_2000_to_2013": "-0.2%",
"latitude": 41.91252859999999,
"longitude": -88.13479269999999,
"population": "40379",
"rank": "914",
"state": "Illinois",
},
{
"city": "Hickory",
"growth_from_2000_to_2013": "7.0%",
"latitude": 35.7344538,
"longitude": -81.3444573,
"population": "40361",
"rank": "915",
"state": "North Carolina",
},
{
"city": "Streamwood",
"growth_from_2000_to_2013": "10.1%",
"latitude": 42.0255827,
"longitude": -88.17840849999999,
"population": "40351",
"rank": "916",
"state": "Illinois",
},
{
"city": "Norwich",
"growth_from_2000_to_2013": "11.6%",
"latitude": 41.5242649,
"longitude": -72.07591049999999,
"population": "40347",
"rank": "917",
"state": "Connecticut",
},
{
"city": "Coppell",
"growth_from_2000_to_2013": "10.3%",
"latitude": 32.9545687,
"longitude": -97.01500779999999,
"population": "40342",
"rank": "918",
"state": "Texas",
},
{
"city": "San Gabriel",
"growth_from_2000_to_2013": "0.9%",
"latitude": 34.09611110000001,
"longitude": -118.1058333,
"population": "40275",
"rank": "919",
"state": "California",
},
{
"city": "Holyoke",
"growth_from_2000_to_2013": "0.9%",
"latitude": 42.2042586,
"longitude": -72.6162009,
"population": "40249",
"rank": "920",
"state": "Massachusetts",
},
{
"city": "Bentonville",
"growth_from_2000_to_2013": "97.7%",
"latitude": 36.3728538,
"longitude": -94.2088172,
"population": "40167",
"rank": "921",
"state": "Arkansas",
},
{
"city": "Florence",
"growth_from_2000_to_2013": "10.2%",
"latitude": 34.79981,
"longitude": -87.677251,
"population": "40059",
"rank": "922",
"state": "Alabama",
},
{
"city": "Peachtree Corners",
"growth_from_2000_to_2013": "",
"latitude": 33.9698929,
"longitude": -84.2214551,
"population": "40059",
"rank": "923",
"state": "Georgia",
},
{
"city": "Brentwood",
"growth_from_2000_to_2013": "51.9%",
"latitude": 36.0331164,
"longitude": -86.78277720000001,
"population": "40021",
"rank": "924",
"state": "Tennessee",
},
{
"city": "Bozeman",
"growth_from_2000_to_2013": "41.9%",
"latitude": 45.6769979,
"longitude": -111.0429339,
"population": "39860",
"rank": "925",
"state": "Montana",
},
{
"city": "New Berlin",
"growth_from_2000_to_2013": "3.6%",
"latitude": 42.9764027,
"longitude": -88.1084224,
"population": "39834",
"rank": "926",
"state": "Wisconsin",
},
{
"city": "Goose Creek",
"growth_from_2000_to_2013": "26.1%",
"latitude": 32.9810059,
"longitude": -80.03258670000001,
"population": "39823",
"rank": "927",
"state": "South Carolina",
},
{
"city": "Huntsville",
"growth_from_2000_to_2013": "13.2%",
"latitude": 30.7235263,
"longitude": -95.55077709999999,
"population": "39795",
"rank": "928",
"state": "Texas",
},
{
"city": "Prescott Valley",
"growth_from_2000_to_2013": "62.9%",
"latitude": 34.6100243,
"longitude": -112.315721,
"population": "39791",
"rank": "929",
"state": "Arizona",
},
{
"city": "Maplewood",
"growth_from_2000_to_2013": "12.3%",
"latitude": 44.9530215,
"longitude": -92.9952153,
"population": "39765",
"rank": "930",
"state": "Minnesota",
},
{
"city": "Romeoville",
"growth_from_2000_to_2013": "79.5%",
"latitude": 41.6475306,
"longitude": -88.0895061,
"population": "39650",
"rank": "931",
"state": "Illinois",
},
{
"city": "Duncanville",
"growth_from_2000_to_2013": "9.7%",
"latitude": 32.6518004,
"longitude": -96.9083366,
"population": "39605",
"rank": "932",
"state": "Texas",
},
{
"city": "Atlantic City",
"growth_from_2000_to_2013": "-2.2%",
"latitude": 39.3642834,
"longitude": -74.4229266,
"population": "39551",
"rank": "933",
"state": "New Jersey",
},
{
"city": "Clovis",
"growth_from_2000_to_2013": "21.3%",
"latitude": 34.4047987,
"longitude": -103.2052272,
"population": "39508",
"rank": "934",
"state": "New Mexico",
},
{
"city": "The Colony",
"growth_from_2000_to_2013": "45.7%",
"latitude": 33.0806083,
"longitude": -96.89283089999999,
"population": "39458",
"rank": "935",
"state": "Texas",
},
{
"city": "Culver City",
"growth_from_2000_to_2013": "1.3%",
"latitude": 34.0211224,
"longitude": -118.3964665,
"population": "39428",
"rank": "936",
"state": "California",
},
{
"city": "Marlborough",
"growth_from_2000_to_2013": "7.6%",
"latitude": 42.3459271,
"longitude": -71.5522874,
"population": "39414",
"rank": "937",
"state": "Massachusetts",
},
{
"city": "Hilton Head Island",
"growth_from_2000_to_2013": "16.0%",
"latitude": 32.216316,
"longitude": -80.752608,
"population": "39412",
"rank": "938",
"state": "South Carolina",
},
{
"city": "Moorhead",
"growth_from_2000_to_2013": "21.3%",
"latitude": 46.8737648,
"longitude": -96.76780389999999,
"population": "39398",
"rank": "939",
"state": "Minnesota",
},
{
"city": "Calexico",
"growth_from_2000_to_2013": "44.0%",
"latitude": 32.6789476,
"longitude": -115.4988834,
"population": "39389",
"rank": "940",
"state": "California",
},
{
"city": "Bullhead City",
"growth_from_2000_to_2013": "15.9%",
"latitude": 35.1359386,
"longitude": -114.5285981,
"population": "39383",
"rank": "941",
"state": "Arizona",
},
{
"city": "Germantown",
"growth_from_2000_to_2013": "4.1%",
"latitude": 35.0867577,
"longitude": -89.8100858,
"population": "39375",
"rank": "942",
"state": "Tennessee",
},
{
"city": "La Quinta",
"growth_from_2000_to_2013": "59.9%",
"latitude": 33.6633573,
"longitude": -116.3100095,
"population": "39331",
"rank": "943",
"state": "California",
},
{
"city": "Lancaster",
"growth_from_2000_to_2013": "10.7%",
"latitude": 39.7136754,
"longitude": -82.5993294,
"population": "39325",
"rank": "944",
"state": "Ohio",
},
{
"city": "Wausau",
"growth_from_2000_to_2013": "1.7%",
"latitude": 44.9591352,
"longitude": -89.6301221,
"population": "39309",
"rank": "945",
"state": "Wisconsin",
},
{
"city": "Sherman",
"growth_from_2000_to_2013": "11.6%",
"latitude": 33.6356618,
"longitude": -96.6088805,
"population": "39296",
"rank": "946",
"state": "Texas",
},
{
"city": "Ocoee",
"growth_from_2000_to_2013": "57.9%",
"latitude": 28.5691677,
"longitude": -81.5439619,
"population": "39172",
"rank": "947",
"state": "Florida",
},
{
"city": "Shakopee",
"growth_from_2000_to_2013": "85.7%",
"latitude": 44.7973962,
"longitude": -93.5272861,
"population": "39167",
"rank": "948",
"state": "Minnesota",
},
{
"city": "Woburn",
"growth_from_2000_to_2013": "4.4%",
"latitude": 42.4792618,
"longitude": -71.1522765,
"population": "39083",
"rank": "949",
"state": "Massachusetts",
},
{
"city": "Bremerton",
"growth_from_2000_to_2013": "4.9%",
"latitude": 47.5673202,
"longitude": -122.6329356,
"population": "39056",
"rank": "950",
"state": "Washington",
},
{
"city": "Rock Island",
"growth_from_2000_to_2013": "-1.9%",
"latitude": 41.5094771,
"longitude": -90.5787476,
"population": "38877",
"rank": "951",
"state": "Illinois",
},
{
"city": "Muskogee",
"growth_from_2000_to_2013": "-0.7%",
"latitude": 35.7478769,
"longitude": -95.3696909,
"population": "38863",
"rank": "952",
"state": "Oklahoma",
},
{
"city": "Cape Girardeau",
"growth_from_2000_to_2013": "9.4%",
"latitude": 37.3058839,
"longitude": -89.51814759999999,
"population": "38816",
"rank": "953",
"state": "Missouri",
},
{
"city": "Annapolis",
"growth_from_2000_to_2013": "7.6%",
"latitude": 38.9784453,
"longitude": -76.4921829,
"population": "38722",
"rank": "954",
"state": "Maryland",
},
{
"city": "Greenacres",
"growth_from_2000_to_2013": "35.5%",
"latitude": 26.6276276,
"longitude": -80.1353896,
"population": "38696",
"rank": "955",
"state": "Florida",
},
{
"city": "Ormond Beach",
"growth_from_2000_to_2013": "5.8%",
"latitude": 29.2858129,
"longitude": -81.0558894,
"population": "38661",
"rank": "956",
"state": "Florida",
},
{
"city": "Hallandale Beach",
"growth_from_2000_to_2013": "12.4%",
"latitude": 25.9812024,
"longitude": -80.14837899999999,
"population": "38632",
"rank": "957",
"state": "Florida",
},
{
"city": "Stanton",
"growth_from_2000_to_2013": "2.8%",
"latitude": 33.8025155,
"longitude": -117.9931165,
"population": "38623",
"rank": "958",
"state": "California",
},
{
"city": "Puyallup",
"growth_from_2000_to_2013": "11.8%",
"latitude": 47.1853785,
"longitude": -122.2928974,
"population": "38609",
"rank": "959",
"state": "Washington",
},
{
"city": "Pacifica",
"growth_from_2000_to_2013": "0.5%",
"latitude": 37.6138253,
"longitude": -122.4869194,
"population": "38606",
"rank": "960",
"state": "California",
},
{
"city": "Hanover Park",
"growth_from_2000_to_2013": "0.6%",
"latitude": 41.9994722,
"longitude": -88.1450735,
"population": "38510",
"rank": "961",
"state": "Illinois",
},
{
"city": "Hurst",
"growth_from_2000_to_2013": "5.8%",
"latitude": 32.8234621,
"longitude": -97.1705678,
"population": "38448",
"rank": "962",
"state": "Texas",
},
{
"city": "Lima",
"growth_from_2000_to_2013": "-8.1%",
"latitude": 40.742551,
"longitude": -84.1052256,
"population": "38355",
"rank": "963",
"state": "Ohio",
},
{
"city": "Marana",
"growth_from_2000_to_2013": "166.2%",
"latitude": 32.436381,
"longitude": -111.2224422,
"population": "38290",
"rank": "964",
"state": "Arizona",
},
{
"city": "Carpentersville",
"growth_from_2000_to_2013": "22.8%",
"latitude": 42.1211364,
"longitude": -88.2578582,
"population": "38241",
"rank": "965",
"state": "Illinois",
},
{
"city": "Oakley",
"growth_from_2000_to_2013": "47.7%",
"latitude": 37.9974219,
"longitude": -121.7124536,
"population": "38194",
"rank": "966",
"state": "California",
},
{
"city": "Huber Heights",
"growth_from_2000_to_2013": "-0.2%",
"latitude": 39.843947,
"longitude": -84.12466080000002,
"population": "38142",
"rank": "967",
"state": "Ohio",
},
{
"city": "Lancaster",
"growth_from_2000_to_2013": "46.4%",
"latitude": 32.5920798,
"longitude": -96.7561082,
"population": "38071",
"rank": "968",
"state": "Texas",
},
{
"city": "Montclair",
"growth_from_2000_to_2013": "12.1%",
"latitude": 34.0775104,
"longitude": -117.6897776,
"population": "38027",
"rank": "969",
"state": "California",
},
{
"city": "Wheeling",
"growth_from_2000_to_2013": "4.8%",
"latitude": 42.1391927,
"longitude": -87.9289591,
"population": "38015",
"rank": "970",
"state": "Illinois",
},
{
"city": "Brookfield",
"growth_from_2000_to_2013": "-1.9%",
"latitude": 43.0605671,
"longitude": -88.1064787,
"population": "37999",
"rank": "971",
"state": "Wisconsin",
},
{
"city": "Park Ridge",
"growth_from_2000_to_2013": "0.1%",
"latitude": 42.0111412,
"longitude": -87.84061919999999,
"population": "37839",
"rank": "972",
"state": "Illinois",
},
{
"city": "Florence",
"growth_from_2000_to_2013": "19.8%",
"latitude": 34.1954331,
"longitude": -79.7625625,
"population": "37792",
"rank": "973",
"state": "South Carolina",
},
{
"city": "Roy",
"growth_from_2000_to_2013": "13.3%",
"latitude": 41.1616108,
"longitude": -112.0263313,
"population": "37733",
"rank": "974",
"state": "Utah",
},
{
"city": "Winter Garden",
"growth_from_2000_to_2013": "142.5%",
"latitude": 28.5652787,
"longitude": -81.58618469999999,
"population": "37711",
"rank": "975",
"state": "Florida",
},
{
"city": "Chelsea",
"growth_from_2000_to_2013": "7.3%",
"latitude": 42.3917638,
"longitude": -71.0328284,
"population": "37670",
"rank": "976",
"state": "Massachusetts",
},
{
"city": "Valley Stream",
"growth_from_2000_to_2013": "3.6%",
"latitude": 40.6642699,
"longitude": -73.70846449999999,
"population": "37659",
"rank": "977",
"state": "New York",
},
{
"city": "Spartanburg",
"growth_from_2000_to_2013": "-6.2%",
"latitude": 34.9495672,
"longitude": -81.9320482,
"population": "37647",
"rank": "978",
"state": "South Carolina",
},
{
"city": "Lake Oswego",
"growth_from_2000_to_2013": "5.3%",
"latitude": 45.42067489999999,
"longitude": -122.6706498,
"population": "37610",
"rank": "979",
"state": "Oregon",
},
{
"city": "Friendswood",
"growth_from_2000_to_2013": "28.6%",
"latitude": 29.5293998,
"longitude": -95.2010447,
"population": "37587",
"rank": "980",
"state": "Texas",
},
{
"city": "Westerville",
"growth_from_2000_to_2013": "5.7%",
"latitude": 40.1261743,
"longitude": -82.92906959999999,
"population": "37530",
"rank": "981",
"state": "Ohio",
},
{
"city": "Northglenn",
"growth_from_2000_to_2013": "15.5%",
"latitude": 39.8961821,
"longitude": -104.9811468,
"population": "37499",
"rank": "982",
"state": "Colorado",
},
{
"city": "Phenix City",
"growth_from_2000_to_2013": "31.9%",
"latitude": 32.4709761,
"longitude": -85.0007653,
"population": "37498",
"rank": "983",
"state": "Alabama",
},
{
"city": "Grove City",
"growth_from_2000_to_2013": "35.6%",
"latitude": 39.88145189999999,
"longitude": -83.0929644,
"population": "37490",
"rank": "984",
"state": "Ohio",
},
{
"city": "Texarkana",
"growth_from_2000_to_2013": "7.4%",
"latitude": 33.425125,
"longitude": -94.04768820000001,
"population": "37442",
"rank": "985",
"state": "Texas",
},
{
"city": "Addison",
"growth_from_2000_to_2013": "2.6%",
"latitude": 41.931696,
"longitude": -87.9889556,
"population": "37385",
"rank": "986",
"state": "Illinois",
},
{
"city": "Dover",
"growth_from_2000_to_2013": "16.0%",
"latitude": 39.158168,
"longitude": -75.5243682,
"population": "37366",
"rank": "987",
"state": "Delaware",
},
{
"city": "Lincoln Park",
"growth_from_2000_to_2013": "-6.7%",
"latitude": 42.2505943,
"longitude": -83.1785361,
"population": "37313",
"rank": "988",
"state": "Michigan",
},
{
"city": "Calumet City",
"growth_from_2000_to_2013": "-4.5%",
"latitude": 41.6155909,
"longitude": -87.5294871,
"population": "37240",
"rank": "989",
"state": "Illinois",
},
{
"city": "Muskegon",
"growth_from_2000_to_2013": "-7.1%",
"latitude": 43.2341813,
"longitude": -86.24839209999999,
"population": "37213",
"rank": "990",
"state": "Michigan",
},
{
"city": "Aventura",
"growth_from_2000_to_2013": "47.2%",
"latitude": 25.9564812,
"longitude": -80.1392121,
"population": "37199",
"rank": "991",
"state": "Florida",
},
{
"city": "Martinez",
"growth_from_2000_to_2013": "3.4%",
"latitude": 38.0193657,
"longitude": -122.1341321,
"population": "37165",
"rank": "992",
"state": "California",
},
{
"city": "Greenfield",
"growth_from_2000_to_2013": "4.8%",
"latitude": 42.9614039,
"longitude": -88.0125865,
"population": "37159",
"rank": "993",
"state": "Wisconsin",
},
{
"city": "Apache Junction",
"growth_from_2000_to_2013": "15.7%",
"latitude": 33.4150485,
"longitude": -111.5495777,
"population": "37130",
"rank": "994",
"state": "Arizona",
},
{
"city": "Monrovia",
"growth_from_2000_to_2013": "0.2%",
"latitude": 34.1442616,
"longitude": -118.0019482,
"population": "37101",
"rank": "995",
"state": "California",
},
{
"city": "Weslaco",
"growth_from_2000_to_2013": "28.8%",
"latitude": 26.1595194,
"longitude": -97.9908366,
"population": "37093",
"rank": "996",
"state": "Texas",
},
{
"city": "Keizer",
"growth_from_2000_to_2013": "14.4%",
"latitude": 44.9901194,
"longitude": -123.0262077,
"population": "37064",
"rank": "997",
"state": "Oregon",
},
{
"city": "Spanish Fork",
"growth_from_2000_to_2013": "78.1%",
"latitude": 40.114955,
"longitude": -111.654923,
"population": "36956",
"rank": "998",
"state": "Utah",
},
{
"city": "Beloit",
"growth_from_2000_to_2013": "2.9%",
"latitude": 42.5083482,
"longitude": -89.03177649999999,
"population": "36888",
"rank": "999",
"state": "Wisconsin",
},
{
"city": "Panama City",
"growth_from_2000_to_2013": "0.1%",
"latitude": 30.1588129,
"longitude": -85.6602058,
"population": "36877",
"rank": "1000",
"state": "Florida",
},
]
| cities = [{'city': 'New York', 'growth_from_2000_to_2013': '4.8%', 'latitude': 40.7127837, 'longitude': -74.0059413, 'population': '8405837', 'rank': '1', 'state': 'New York'}, {'city': 'Los Angeles', 'growth_from_2000_to_2013': '4.8%', 'latitude': 34.0522342, 'longitude': -118.2436849, 'population': '3884307', 'rank': '2', 'state': 'California'}, {'city': 'Chicago', 'growth_from_2000_to_2013': '-6.1%', 'latitude': 41.8781136, 'longitude': -87.6297982, 'population': '2718782', 'rank': '3', 'state': 'Illinois'}, {'city': 'Houston', 'growth_from_2000_to_2013': '11.0%', 'latitude': 29.7604267, 'longitude': -95.3698028, 'population': '2195914', 'rank': '4', 'state': 'Texas'}, {'city': 'Philadelphia', 'growth_from_2000_to_2013': '2.6%', 'latitude': 39.9525839, 'longitude': -75.1652215, 'population': '1553165', 'rank': '5', 'state': 'Pennsylvania'}, {'city': 'Phoenix', 'growth_from_2000_to_2013': '14.0%', 'latitude': 33.4483771, 'longitude': -112.0740373, 'population': '1513367', 'rank': '6', 'state': 'Arizona'}, {'city': 'San Antonio', 'growth_from_2000_to_2013': '21.0%', 'latitude': 29.4241219, 'longitude': -98.49362819999999, 'population': '1409019', 'rank': '7', 'state': 'Texas'}, {'city': 'San Diego', 'growth_from_2000_to_2013': '10.5%', 'latitude': 32.715738, 'longitude': -117.1610838, 'population': '1355896', 'rank': '8', 'state': 'California'}, {'city': 'Dallas', 'growth_from_2000_to_2013': '5.6%', 'latitude': 32.7766642, 'longitude': -96.79698789999999, 'population': '1257676', 'rank': '9', 'state': 'Texas'}, {'city': 'San Jose', 'growth_from_2000_to_2013': '10.5%', 'latitude': 37.3382082, 'longitude': -121.8863286, 'population': '998537', 'rank': '10', 'state': 'California'}, {'city': 'Austin', 'growth_from_2000_to_2013': '31.7%', 'latitude': 30.267153, 'longitude': -97.7430608, 'population': '885400', 'rank': '11', 'state': 'Texas'}, {'city': 'Indianapolis', 'growth_from_2000_to_2013': '7.8%', 'latitude': 39.768403, 'longitude': -86.158068, 'population': '843393', 'rank': '12', 'state': 'Indiana'}, {'city': 'Jacksonville', 'growth_from_2000_to_2013': '14.3%', 'latitude': 30.3321838, 'longitude': -81.65565099999999, 'population': '842583', 'rank': '13', 'state': 'Florida'}, {'city': 'San Francisco', 'growth_from_2000_to_2013': '7.7%', 'latitude': 37.7749295, 'longitude': -122.4194155, 'population': '837442', 'rank': '14', 'state': 'California'}, {'city': 'Columbus', 'growth_from_2000_to_2013': '14.8%', 'latitude': 39.9611755, 'longitude': -82.99879419999999, 'population': '822553', 'rank': '15', 'state': 'Ohio'}, {'city': 'Charlotte', 'growth_from_2000_to_2013': '39.1%', 'latitude': 35.2270869, 'longitude': -80.8431267, 'population': '792862', 'rank': '16', 'state': 'North Carolina'}, {'city': 'Fort Worth', 'growth_from_2000_to_2013': '45.1%', 'latitude': 32.7554883, 'longitude': -97.3307658, 'population': '792727', 'rank': '17', 'state': 'Texas'}, {'city': 'Detroit', 'growth_from_2000_to_2013': '-27.1%', 'latitude': 42.331427, 'longitude': -83.0457538, 'population': '688701', 'rank': '18', 'state': 'Michigan'}, {'city': 'El Paso', 'growth_from_2000_to_2013': '19.4%', 'latitude': 31.7775757, 'longitude': -106.4424559, 'population': '674433', 'rank': '19', 'state': 'Texas'}, {'city': 'Memphis', 'growth_from_2000_to_2013': '-5.3%', 'latitude': 35.1495343, 'longitude': -90.0489801, 'population': '653450', 'rank': '20', 'state': 'Tennessee'}, {'city': 'Seattle', 'growth_from_2000_to_2013': '15.6%', 'latitude': 47.6062095, 'longitude': -122.3320708, 'population': '652405', 'rank': '21', 'state': 'Washington'}, {'city': 'Denver', 'growth_from_2000_to_2013': '16.7%', 'latitude': 39.7392358, 'longitude': -104.990251, 'population': '649495', 'rank': '22', 'state': 'Colorado'}, {'city': 'Washington', 'growth_from_2000_to_2013': '13.0%', 'latitude': 38.9071923, 'longitude': -77.0368707, 'population': '646449', 'rank': '23', 'state': 'District of Columbia'}, {'city': 'Boston', 'growth_from_2000_to_2013': '9.4%', 'latitude': 42.3600825, 'longitude': -71.0588801, 'population': '645966', 'rank': '24', 'state': 'Massachusetts'}, {'city': 'Nashville-Davidson', 'growth_from_2000_to_2013': '16.2%', 'latitude': 36.1626638, 'longitude': -86.7816016, 'population': '634464', 'rank': '25', 'state': 'Tennessee'}, {'city': 'Baltimore', 'growth_from_2000_to_2013': '-4.0%', 'latitude': 39.2903848, 'longitude': -76.6121893, 'population': '622104', 'rank': '26', 'state': 'Maryland'}, {'city': 'Oklahoma City', 'growth_from_2000_to_2013': '20.2%', 'latitude': 35.4675602, 'longitude': -97.5164276, 'population': '610613', 'rank': '27', 'state': 'Oklahoma'}, {'city': 'Louisville/Jefferson County', 'growth_from_2000_to_2013': '10.0%', 'latitude': 38.2526647, 'longitude': -85.7584557, 'population': '609893', 'rank': '28', 'state': 'Kentucky'}, {'city': 'Portland', 'growth_from_2000_to_2013': '15.0%', 'latitude': 45.5230622, 'longitude': -122.6764816, 'population': '609456', 'rank': '29', 'state': 'Oregon'}, {'city': 'Las Vegas', 'growth_from_2000_to_2013': '24.5%', 'latitude': 36.1699412, 'longitude': -115.1398296, 'population': '603488', 'rank': '30', 'state': 'Nevada'}, {'city': 'Milwaukee', 'growth_from_2000_to_2013': '0.3%', 'latitude': 43.0389025, 'longitude': -87.9064736, 'population': '599164', 'rank': '31', 'state': 'Wisconsin'}, {'city': 'Albuquerque', 'growth_from_2000_to_2013': '23.5%', 'latitude': 35.0853336, 'longitude': -106.6055534, 'population': '556495', 'rank': '32', 'state': 'New Mexico'}, {'city': 'Tucson', 'growth_from_2000_to_2013': '7.5%', 'latitude': 32.2217429, 'longitude': -110.926479, 'population': '526116', 'rank': '33', 'state': 'Arizona'}, {'city': 'Fresno', 'growth_from_2000_to_2013': '18.3%', 'latitude': 36.7468422, 'longitude': -119.7725868, 'population': '509924', 'rank': '34', 'state': 'California'}, {'city': 'Sacramento', 'growth_from_2000_to_2013': '17.2%', 'latitude': 38.5815719, 'longitude': -121.4943996, 'population': '479686', 'rank': '35', 'state': 'California'}, {'city': 'Long Beach', 'growth_from_2000_to_2013': '1.5%', 'latitude': 33.7700504, 'longitude': -118.1937395, 'population': '469428', 'rank': '36', 'state': 'California'}, {'city': 'Kansas City', 'growth_from_2000_to_2013': '5.5%', 'latitude': 39.0997265, 'longitude': -94.5785667, 'population': '467007', 'rank': '37', 'state': 'Missouri'}, {'city': 'Mesa', 'growth_from_2000_to_2013': '13.5%', 'latitude': 33.4151843, 'longitude': -111.8314724, 'population': '457587', 'rank': '38', 'state': 'Arizona'}, {'city': 'Virginia Beach', 'growth_from_2000_to_2013': '5.1%', 'latitude': 36.8529263, 'longitude': -75.97798499999999, 'population': '448479', 'rank': '39', 'state': 'Virginia'}, {'city': 'Atlanta', 'growth_from_2000_to_2013': '6.2%', 'latitude': 33.7489954, 'longitude': -84.3879824, 'population': '447841', 'rank': '40', 'state': 'Georgia'}, {'city': 'Colorado Springs', 'growth_from_2000_to_2013': '21.4%', 'latitude': 38.8338816, 'longitude': -104.8213634, 'population': '439886', 'rank': '41', 'state': 'Colorado'}, {'city': 'Omaha', 'growth_from_2000_to_2013': '5.9%', 'latitude': 41.2523634, 'longitude': -95.99798829999999, 'population': '434353', 'rank': '42', 'state': 'Nebraska'}, {'city': 'Raleigh', 'growth_from_2000_to_2013': '48.7%', 'latitude': 35.7795897, 'longitude': -78.6381787, 'population': '431746', 'rank': '43', 'state': 'North Carolina'}, {'city': 'Miami', 'growth_from_2000_to_2013': '14.9%', 'latitude': 25.7616798, 'longitude': -80.1917902, 'population': '417650', 'rank': '44', 'state': 'Florida'}, {'city': 'Oakland', 'growth_from_2000_to_2013': '1.3%', 'latitude': 37.8043637, 'longitude': -122.2711137, 'population': '406253', 'rank': '45', 'state': 'California'}, {'city': 'Minneapolis', 'growth_from_2000_to_2013': '4.5%', 'latitude': 44.977753, 'longitude': -93.2650108, 'population': '400070', 'rank': '46', 'state': 'Minnesota'}, {'city': 'Tulsa', 'growth_from_2000_to_2013': '1.3%', 'latitude': 36.1539816, 'longitude': -95.99277500000001, 'population': '398121', 'rank': '47', 'state': 'Oklahoma'}, {'city': 'Cleveland', 'growth_from_2000_to_2013': '-18.1%', 'latitude': 41.49932, 'longitude': -81.6943605, 'population': '390113', 'rank': '48', 'state': 'Ohio'}, {'city': 'Wichita', 'growth_from_2000_to_2013': '9.7%', 'latitude': 37.688889, 'longitude': -97.336111, 'population': '386552', 'rank': '49', 'state': 'Kansas'}, {'city': 'Arlington', 'growth_from_2000_to_2013': '13.3%', 'latitude': 32.735687, 'longitude': -97.10806559999999, 'population': '379577', 'rank': '50', 'state': 'Texas'}, {'city': 'New Orleans', 'growth_from_2000_to_2013': '-21.6%', 'latitude': 29.95106579999999, 'longitude': -90.0715323, 'population': '378715', 'rank': '51', 'state': 'Louisiana'}, {'city': 'Bakersfield', 'growth_from_2000_to_2013': '48.4%', 'latitude': 35.3732921, 'longitude': -119.0187125, 'population': '363630', 'rank': '52', 'state': 'California'}, {'city': 'Tampa', 'growth_from_2000_to_2013': '16.0%', 'latitude': 27.950575, 'longitude': -82.4571776, 'population': '352957', 'rank': '53', 'state': 'Florida'}, {'city': 'Honolulu', 'growth_from_2000_to_2013': '-6.2%', 'latitude': 21.3069444, 'longitude': -157.8583333, 'population': '347884', 'rank': '54', 'state': 'Hawaii'}, {'city': 'Aurora', 'growth_from_2000_to_2013': '24.4%', 'latitude': 39.7294319, 'longitude': -104.8319195, 'population': '345803', 'rank': '55', 'state': 'Colorado'}, {'city': 'Anaheim', 'growth_from_2000_to_2013': '4.7%', 'latitude': 33.8352932, 'longitude': -117.9145036, 'population': '345012', 'rank': '56', 'state': 'California'}, {'city': 'Santa Ana', 'growth_from_2000_to_2013': '-1.2%', 'latitude': 33.7455731, 'longitude': -117.8678338, 'population': '334227', 'rank': '57', 'state': 'California'}, {'city': 'St. Louis', 'growth_from_2000_to_2013': '-8.2%', 'latitude': 38.6270025, 'longitude': -90.19940419999999, 'population': '318416', 'rank': '58', 'state': 'Missouri'}, {'city': 'Riverside', 'growth_from_2000_to_2013': '22.5%', 'latitude': 33.9533487, 'longitude': -117.3961564, 'population': '316619', 'rank': '59', 'state': 'California'}, {'city': 'Corpus Christi', 'growth_from_2000_to_2013': '14.1%', 'latitude': 27.8005828, 'longitude': -97.39638099999999, 'population': '316381', 'rank': '60', 'state': 'Texas'}, {'city': 'Lexington-Fayette', 'growth_from_2000_to_2013': '18.0%', 'latitude': 38.0405837, 'longitude': -84.5037164, 'population': '308428', 'rank': '61', 'state': 'Kentucky'}, {'city': 'Pittsburgh', 'growth_from_2000_to_2013': '-8.3%', 'latitude': 40.44062479999999, 'longitude': -79.9958864, 'population': '305841', 'rank': '62', 'state': 'Pennsylvania'}, {'city': 'Anchorage', 'growth_from_2000_to_2013': '15.4%', 'latitude': 61.2180556, 'longitude': -149.9002778, 'population': '300950', 'rank': '63', 'state': 'Alaska'}, {'city': 'Stockton', 'growth_from_2000_to_2013': '21.8%', 'latitude': 37.9577016, 'longitude': -121.2907796, 'population': '298118', 'rank': '64', 'state': 'California'}, {'city': 'Cincinnati', 'growth_from_2000_to_2013': '-10.1%', 'latitude': 39.1031182, 'longitude': -84.5120196, 'population': '297517', 'rank': '65', 'state': 'Ohio'}, {'city': 'St. Paul', 'growth_from_2000_to_2013': '2.8%', 'latitude': 44.9537029, 'longitude': -93.0899578, 'population': '294873', 'rank': '66', 'state': 'Minnesota'}, {'city': 'Toledo', 'growth_from_2000_to_2013': '-10.0%', 'latitude': 41.6639383, 'longitude': -83.55521200000001, 'population': '282313', 'rank': '67', 'state': 'Ohio'}, {'city': 'Greensboro', 'growth_from_2000_to_2013': '22.3%', 'latitude': 36.0726354, 'longitude': -79.7919754, 'population': '279639', 'rank': '68', 'state': 'North Carolina'}, {'city': 'Newark', 'growth_from_2000_to_2013': '2.1%', 'latitude': 40.735657, 'longitude': -74.1723667, 'population': '278427', 'rank': '69', 'state': 'New Jersey'}, {'city': 'Plano', 'growth_from_2000_to_2013': '22.4%', 'latitude': 33.0198431, 'longitude': -96.6988856, 'population': '274409', 'rank': '70', 'state': 'Texas'}, {'city': 'Henderson', 'growth_from_2000_to_2013': '51.0%', 'latitude': 36.0395247, 'longitude': -114.9817213, 'population': '270811', 'rank': '71', 'state': 'Nevada'}, {'city': 'Lincoln', 'growth_from_2000_to_2013': '18.0%', 'latitude': 40.8257625, 'longitude': -96.6851982, 'population': '268738', 'rank': '72', 'state': 'Nebraska'}, {'city': 'Buffalo', 'growth_from_2000_to_2013': '-11.3%', 'latitude': 42.88644679999999, 'longitude': -78.8783689, 'population': '258959', 'rank': '73', 'state': 'New York'}, {'city': 'Jersey City', 'growth_from_2000_to_2013': '7.2%', 'latitude': 40.72815749999999, 'longitude': -74.0776417, 'population': '257342', 'rank': '74', 'state': 'New Jersey'}, {'city': 'Chula Vista', 'growth_from_2000_to_2013': '46.2%', 'latitude': 32.6400541, 'longitude': -117.0841955, 'population': '256780', 'rank': '75', 'state': 'California'}, {'city': 'Fort Wayne', 'growth_from_2000_to_2013': '1.0%', 'latitude': 41.079273, 'longitude': -85.1393513, 'population': '256496', 'rank': '76', 'state': 'Indiana'}, {'city': 'Orlando', 'growth_from_2000_to_2013': '31.2%', 'latitude': 28.5383355, 'longitude': -81.3792365, 'population': '255483', 'rank': '77', 'state': 'Florida'}, {'city': 'St. Petersburg', 'growth_from_2000_to_2013': '0.3%', 'latitude': 27.773056, 'longitude': -82.64, 'population': '249688', 'rank': '78', 'state': 'Florida'}, {'city': 'Chandler', 'growth_from_2000_to_2013': '38.7%', 'latitude': 33.3061605, 'longitude': -111.8412502, 'population': '249146', 'rank': '79', 'state': 'Arizona'}, {'city': 'Laredo', 'growth_from_2000_to_2013': '38.2%', 'latitude': 27.5305671, 'longitude': -99.48032409999999, 'population': '248142', 'rank': '80', 'state': 'Texas'}, {'city': 'Norfolk', 'growth_from_2000_to_2013': '5.0%', 'latitude': 36.8507689, 'longitude': -76.28587259999999, 'population': '246139', 'rank': '81', 'state': 'Virginia'}, {'city': 'Durham', 'growth_from_2000_to_2013': '29.9%', 'latitude': 35.9940329, 'longitude': -78.898619, 'population': '245475', 'rank': '82', 'state': 'North Carolina'}, {'city': 'Madison', 'growth_from_2000_to_2013': '15.8%', 'latitude': 43.0730517, 'longitude': -89.4012302, 'population': '243344', 'rank': '83', 'state': 'Wisconsin'}, {'city': 'Lubbock', 'growth_from_2000_to_2013': '19.6%', 'latitude': 33.5778631, 'longitude': -101.8551665, 'population': '239538', 'rank': '84', 'state': 'Texas'}, {'city': 'Irvine', 'growth_from_2000_to_2013': '61.3%', 'latitude': 33.6839473, 'longitude': -117.7946942, 'population': '236716', 'rank': '85', 'state': 'California'}, {'city': 'Winston-Salem', 'growth_from_2000_to_2013': '16.9%', 'latitude': 36.09985959999999, 'longitude': -80.244216, 'population': '236441', 'rank': '86', 'state': 'North Carolina'}, {'city': 'Glendale', 'growth_from_2000_to_2013': '5.7%', 'latitude': 33.5386523, 'longitude': -112.1859866, 'population': '234632', 'rank': '87', 'state': 'Arizona'}, {'city': 'Garland', 'growth_from_2000_to_2013': '8.5%', 'latitude': 32.912624, 'longitude': -96.63888329999999, 'population': '234566', 'rank': '88', 'state': 'Texas'}, {'city': 'Hialeah', 'growth_from_2000_to_2013': '3.2%', 'latitude': 25.8575963, 'longitude': -80.2781057, 'population': '233394', 'rank': '89', 'state': 'Florida'}, {'city': 'Reno', 'growth_from_2000_to_2013': '26.8%', 'latitude': 39.5296329, 'longitude': -119.8138027, 'population': '233294', 'rank': '90', 'state': 'Nevada'}, {'city': 'Chesapeake', 'growth_from_2000_to_2013': '15.1%', 'latitude': 36.7682088, 'longitude': -76.2874927, 'population': '230571', 'rank': '91', 'state': 'Virginia'}, {'city': 'Gilbert', 'growth_from_2000_to_2013': '96.0%', 'latitude': 33.3528264, 'longitude': -111.789027, 'population': '229972', 'rank': '92', 'state': 'Arizona'}, {'city': 'Baton Rouge', 'growth_from_2000_to_2013': '0.4%', 'latitude': 30.4582829, 'longitude': -91.1403196, 'population': '229426', 'rank': '93', 'state': 'Louisiana'}, {'city': 'Irving', 'growth_from_2000_to_2013': '19.1%', 'latitude': 32.8140177, 'longitude': -96.9488945, 'population': '228653', 'rank': '94', 'state': 'Texas'}, {'city': 'Scottsdale', 'growth_from_2000_to_2013': '11.0%', 'latitude': 33.4941704, 'longitude': -111.9260519, 'population': '226918', 'rank': '95', 'state': 'Arizona'}, {'city': 'North Las Vegas', 'growth_from_2000_to_2013': '92.2%', 'latitude': 36.1988592, 'longitude': -115.1175013, 'population': '226877', 'rank': '96', 'state': 'Nevada'}, {'city': 'Fremont', 'growth_from_2000_to_2013': '10.0%', 'latitude': 37.5482697, 'longitude': -121.9885719, 'population': '224922', 'rank': '97', 'state': 'California'}, {'city': 'Boise City', 'growth_from_2000_to_2013': '9.5%', 'latitude': 43.6187102, 'longitude': -116.2146068, 'population': '214237', 'rank': '98', 'state': 'Idaho'}, {'city': 'Richmond', 'growth_from_2000_to_2013': '8.2%', 'latitude': 37.5407246, 'longitude': -77.4360481, 'population': '214114', 'rank': '99', 'state': 'Virginia'}, {'city': 'San Bernardino', 'growth_from_2000_to_2013': '13.0%', 'latitude': 34.1083449, 'longitude': -117.2897652, 'population': '213708', 'rank': '100', 'state': 'California'}, {'city': 'Birmingham', 'growth_from_2000_to_2013': '-12.3%', 'latitude': 33.5206608, 'longitude': -86.80248999999999, 'population': '212113', 'rank': '101', 'state': 'Alabama'}, {'city': 'Spokane', 'growth_from_2000_to_2013': '7.0%', 'latitude': 47.6587802, 'longitude': -117.4260466, 'population': '210721', 'rank': '102', 'state': 'Washington'}, {'city': 'Rochester', 'growth_from_2000_to_2013': '-4.1%', 'latitude': 43.16103, 'longitude': -77.6109219, 'population': '210358', 'rank': '103', 'state': 'New York'}, {'city': 'Des Moines', 'growth_from_2000_to_2013': '3.9%', 'latitude': 41.6005448, 'longitude': -93.6091064, 'population': '207510', 'rank': '104', 'state': 'Iowa'}, {'city': 'Modesto', 'growth_from_2000_to_2013': '7.7%', 'latitude': 37.63909719999999, 'longitude': -120.9968782, 'population': '204933', 'rank': '105', 'state': 'California'}, {'city': 'Fayetteville', 'growth_from_2000_to_2013': '2.4%', 'latitude': 35.0526641, 'longitude': -78.87835849999999, 'population': '204408', 'rank': '106', 'state': 'North Carolina'}, {'city': 'Tacoma', 'growth_from_2000_to_2013': '4.9%', 'latitude': 47.2528768, 'longitude': -122.4442906, 'population': '203446', 'rank': '107', 'state': 'Washington'}, {'city': 'Oxnard', 'growth_from_2000_to_2013': '18.2%', 'latitude': 34.1975048, 'longitude': -119.1770516, 'population': '203007', 'rank': '108', 'state': 'California'}, {'city': 'Fontana', 'growth_from_2000_to_2013': '38.3%', 'latitude': 34.0922335, 'longitude': -117.435048, 'population': '203003', 'rank': '109', 'state': 'California'}, {'city': 'Columbus', 'growth_from_2000_to_2013': '8.7%', 'latitude': 32.4609764, 'longitude': -84.9877094, 'population': '202824', 'rank': '110', 'state': 'Georgia'}, {'city': 'Montgomery', 'growth_from_2000_to_2013': '-0.1%', 'latitude': 32.3668052, 'longitude': -86.2999689, 'population': '201332', 'rank': '111', 'state': 'Alabama'}, {'city': 'Moreno Valley', 'growth_from_2000_to_2013': '40.4%', 'latitude': 33.9424658, 'longitude': -117.2296717, 'population': '201175', 'rank': '112', 'state': 'California'}, {'city': 'Shreveport', 'growth_from_2000_to_2013': '-0.1%', 'latitude': 32.5251516, 'longitude': -93.7501789, 'population': '200327', 'rank': '113', 'state': 'Louisiana'}, {'city': 'Aurora', 'growth_from_2000_to_2013': '38.4%', 'latitude': 41.7605849, 'longitude': -88.32007150000001, 'population': '199963', 'rank': '114', 'state': 'Illinois'}, {'city': 'Yonkers', 'growth_from_2000_to_2013': '1.8%', 'latitude': 40.9312099, 'longitude': -73.89874689999999, 'population': '199766', 'rank': '115', 'state': 'New York'}, {'city': 'Akron', 'growth_from_2000_to_2013': '-8.6%', 'latitude': 41.0814447, 'longitude': -81.51900529999999, 'population': '198100', 'rank': '116', 'state': 'Ohio'}, {'city': 'Huntington Beach', 'growth_from_2000_to_2013': '3.9%', 'latitude': 33.660297, 'longitude': -117.9992265, 'population': '197575', 'rank': '117', 'state': 'California'}, {'city': 'Little Rock', 'growth_from_2000_to_2013': '7.6%', 'latitude': 34.7464809, 'longitude': -92.28959479999999, 'population': '197357', 'rank': '118', 'state': 'Arkansas'}, {'city': 'Augusta-Richmond County', 'growth_from_2000_to_2013': '1.1%', 'latitude': 33.4734978, 'longitude': -82.0105148, 'population': '197350', 'rank': '119', 'state': 'Georgia'}, {'city': 'Amarillo', 'growth_from_2000_to_2013': '12.8%', 'latitude': 35.2219971, 'longitude': -101.8312969, 'population': '196429', 'rank': '120', 'state': 'Texas'}, {'city': 'Glendale', 'growth_from_2000_to_2013': '0.3%', 'latitude': 34.1425078, 'longitude': -118.255075, 'population': '196021', 'rank': '121', 'state': 'California'}, {'city': 'Mobile', 'growth_from_2000_to_2013': '-1.9%', 'latitude': 30.6953657, 'longitude': -88.0398912, 'population': '194899', 'rank': '122', 'state': 'Alabama'}, {'city': 'Grand Rapids', 'growth_from_2000_to_2013': '-2.8%', 'latitude': 42.9633599, 'longitude': -85.6680863, 'population': '192294', 'rank': '123', 'state': 'Michigan'}, {'city': 'Salt Lake City', 'growth_from_2000_to_2013': '5.1%', 'latitude': 40.7607793, 'longitude': -111.8910474, 'population': '191180', 'rank': '124', 'state': 'Utah'}, {'city': 'Tallahassee', 'growth_from_2000_to_2013': '21.8%', 'latitude': 30.4382559, 'longitude': -84.28073289999999, 'population': '186411', 'rank': '125', 'state': 'Florida'}, {'city': 'Huntsville', 'growth_from_2000_to_2013': '16.3%', 'latitude': 34.7303688, 'longitude': -86.5861037, 'population': '186254', 'rank': '126', 'state': 'Alabama'}, {'city': 'Grand Prairie', 'growth_from_2000_to_2013': '43.1%', 'latitude': 32.7459645, 'longitude': -96.99778459999999, 'population': '183372', 'rank': '127', 'state': 'Texas'}, {'city': 'Knoxville', 'growth_from_2000_to_2013': '3.9%', 'latitude': 35.9606384, 'longitude': -83.9207392, 'population': '183270', 'rank': '128', 'state': 'Tennessee'}, {'city': 'Worcester', 'growth_from_2000_to_2013': '5.8%', 'latitude': 42.2625932, 'longitude': -71.8022934, 'population': '182544', 'rank': '129', 'state': 'Massachusetts'}, {'city': 'Newport News', 'growth_from_2000_to_2013': '0.9%', 'latitude': 37.0870821, 'longitude': -76.4730122, 'population': '182020', 'rank': '130', 'state': 'Virginia'}, {'city': 'Brownsville', 'growth_from_2000_to_2013': '26.8%', 'latitude': 25.9017472, 'longitude': -97.4974838, 'population': '181860', 'rank': '131', 'state': 'Texas'}, {'city': 'Overland Park', 'growth_from_2000_to_2013': '19.4%', 'latitude': 38.9822282, 'longitude': -94.6707917, 'population': '181260', 'rank': '132', 'state': 'Kansas'}, {'city': 'Santa Clarita', 'growth_from_2000_to_2013': '15.3%', 'latitude': 34.3916641, 'longitude': -118.542586, 'population': '179590', 'rank': '133', 'state': 'California'}, {'city': 'Providence', 'growth_from_2000_to_2013': '2.3%', 'latitude': 41.8239891, 'longitude': -71.4128343, 'population': '177994', 'rank': '134', 'state': 'Rhode Island'}, {'city': 'Garden Grove', 'growth_from_2000_to_2013': '5.8%', 'latitude': 33.7739053, 'longitude': -117.9414477, 'population': '175140', 'rank': '135', 'state': 'California'}, {'city': 'Chattanooga', 'growth_from_2000_to_2013': '10.5%', 'latitude': 35.0456297, 'longitude': -85.3096801, 'population': '173366', 'rank': '136', 'state': 'Tennessee'}, {'city': 'Oceanside', 'growth_from_2000_to_2013': '6.6%', 'latitude': 33.1958696, 'longitude': -117.3794834, 'population': '172794', 'rank': '137', 'state': 'California'}, {'city': 'Jackson', 'growth_from_2000_to_2013': '-6.8%', 'latitude': 32.2987573, 'longitude': -90.1848103, 'population': '172638', 'rank': '138', 'state': 'Mississippi'}, {'city': 'Fort Lauderdale', 'growth_from_2000_to_2013': '0.7%', 'latitude': 26.1224386, 'longitude': -80.13731740000001, 'population': '172389', 'rank': '139', 'state': 'Florida'}, {'city': 'Santa Rosa', 'growth_from_2000_to_2013': '15.2%', 'latitude': 38.440429, 'longitude': -122.7140548, 'population': '171990', 'rank': '140', 'state': 'California'}, {'city': 'Rancho Cucamonga', 'growth_from_2000_to_2013': '32.7%', 'latitude': 34.10639889999999, 'longitude': -117.5931084, 'population': '171386', 'rank': '141', 'state': 'California'}, {'city': 'Port St. Lucie', 'growth_from_2000_to_2013': '91.7%', 'latitude': 27.2730492, 'longitude': -80.3582261, 'population': '171016', 'rank': '142', 'state': 'Florida'}, {'city': 'Tempe', 'growth_from_2000_to_2013': '5.8%', 'latitude': 33.4255104, 'longitude': -111.9400054, 'population': '168228', 'rank': '143', 'state': 'Arizona'}, {'city': 'Ontario', 'growth_from_2000_to_2013': '5.5%', 'latitude': 34.0633443, 'longitude': -117.6508876, 'population': '167500', 'rank': '144', 'state': 'California'}, {'city': 'Vancouver', 'growth_from_2000_to_2013': '14.2%', 'latitude': 45.6387281, 'longitude': -122.6614861, 'population': '167405', 'rank': '145', 'state': 'Washington'}, {'city': 'Cape Coral', 'growth_from_2000_to_2013': '60.4%', 'latitude': 26.5628537, 'longitude': -81.9495331, 'population': '165831', 'rank': '146', 'state': 'Florida'}, {'city': 'Sioux Falls', 'growth_from_2000_to_2013': '31.1%', 'latitude': 43.5445959, 'longitude': -96.73110340000001, 'population': '164676', 'rank': '147', 'state': 'South Dakota'}, {'city': 'Springfield', 'growth_from_2000_to_2013': '7.8%', 'latitude': 37.2089572, 'longitude': -93.29229889999999, 'population': '164122', 'rank': '148', 'state': 'Missouri'}, {'city': 'Peoria', 'growth_from_2000_to_2013': '46.5%', 'latitude': 33.5805955, 'longitude': -112.2373779, 'population': '162592', 'rank': '149', 'state': 'Arizona'}, {'city': 'Pembroke Pines', 'growth_from_2000_to_2013': '17.4%', 'latitude': 26.007765, 'longitude': -80.2962555, 'population': '162329', 'rank': '150', 'state': 'Florida'}, {'city': 'Elk Grove', 'growth_from_2000_to_2013': '97.1%', 'latitude': 38.4087993, 'longitude': -121.3716178, 'population': '161007', 'rank': '151', 'state': 'California'}, {'city': 'Salem', 'growth_from_2000_to_2013': '16.4%', 'latitude': 44.9428975, 'longitude': -123.0350963, 'population': '160614', 'rank': '152', 'state': 'Oregon'}, {'city': 'Lancaster', 'growth_from_2000_to_2013': '33.8%', 'latitude': 34.6867846, 'longitude': -118.1541632, 'population': '159523', 'rank': '153', 'state': 'California'}, {'city': 'Corona', 'growth_from_2000_to_2013': '23.6%', 'latitude': 33.8752935, 'longitude': -117.5664384, 'population': '159503', 'rank': '154', 'state': 'California'}, {'city': 'Eugene', 'growth_from_2000_to_2013': '14.4%', 'latitude': 44.0520691, 'longitude': -123.0867536, 'population': '159190', 'rank': '155', 'state': 'Oregon'}, {'city': 'Palmdale', 'growth_from_2000_to_2013': '33.7%', 'latitude': 34.5794343, 'longitude': -118.1164613, 'population': '157161', 'rank': '156', 'state': 'California'}, {'city': 'Salinas', 'growth_from_2000_to_2013': '8.4%', 'latitude': 36.6777372, 'longitude': -121.6555013, 'population': '155662', 'rank': '157', 'state': 'California'}, {'city': 'Springfield', 'growth_from_2000_to_2013': '1.1%', 'latitude': 42.1014831, 'longitude': -72.589811, 'population': '153703', 'rank': '158', 'state': 'Massachusetts'}, {'city': 'Pasadena', 'growth_from_2000_to_2013': '7.5%', 'latitude': 29.6910625, 'longitude': -95.2091006, 'population': '152735', 'rank': '159', 'state': 'Texas'}, {'city': 'Fort Collins', 'growth_from_2000_to_2013': '26.6%', 'latitude': 40.5852602, 'longitude': -105.084423, 'population': '152061', 'rank': '160', 'state': 'Colorado'}, {'city': 'Hayward', 'growth_from_2000_to_2013': '7.5%', 'latitude': 37.6688205, 'longitude': -122.0807964, 'population': '151574', 'rank': '161', 'state': 'California'}, {'city': 'Pomona', 'growth_from_2000_to_2013': '2.1%', 'latitude': 34.055103, 'longitude': -117.7499909, 'population': '151348', 'rank': '162', 'state': 'California'}, {'city': 'Cary', 'growth_from_2000_to_2013': '55.1%', 'latitude': 35.79154, 'longitude': -78.7811169, 'population': '151088', 'rank': '163', 'state': 'North Carolina'}, {'city': 'Rockford', 'growth_from_2000_to_2013': '-1.0%', 'latitude': 42.2711311, 'longitude': -89.0939952, 'population': '150251', 'rank': '164', 'state': 'Illinois'}, {'city': 'Alexandria', 'growth_from_2000_to_2013': '15.0%', 'latitude': 38.8048355, 'longitude': -77.0469214, 'population': '148892', 'rank': '165', 'state': 'Virginia'}, {'city': 'Escondido', 'growth_from_2000_to_2013': '10.7%', 'latitude': 33.1192068, 'longitude': -117.086421, 'population': '148738', 'rank': '166', 'state': 'California'}, {'city': 'McKinney', 'growth_from_2000_to_2013': '165.3%', 'latitude': 33.1972465, 'longitude': -96.6397822, 'population': '148559', 'rank': '167', 'state': 'Texas'}, {'city': 'Kansas City', 'growth_from_2000_to_2013': '1.1%', 'latitude': 39.114053, 'longitude': -94.6274636, 'population': '148483', 'rank': '168', 'state': 'Kansas'}, {'city': 'Joliet', 'growth_from_2000_to_2013': '36.5%', 'latitude': 41.525031, 'longitude': -88.0817251, 'population': '147806', 'rank': '169', 'state': 'Illinois'}, {'city': 'Sunnyvale', 'growth_from_2000_to_2013': '11.9%', 'latitude': 37.36883, 'longitude': -122.0363496, 'population': '147559', 'rank': '170', 'state': 'California'}, {'city': 'Torrance', 'growth_from_2000_to_2013': '6.6%', 'latitude': 33.8358492, 'longitude': -118.3406288, 'population': '147478', 'rank': '171', 'state': 'California'}, {'city': 'Bridgeport', 'growth_from_2000_to_2013': '5.4%', 'latitude': 41.1865478, 'longitude': -73.19517669999999, 'population': '147216', 'rank': '172', 'state': 'Connecticut'}, {'city': 'Lakewood', 'growth_from_2000_to_2013': '1.9%', 'latitude': 39.7047095, 'longitude': -105.0813734, 'population': '147214', 'rank': '173', 'state': 'Colorado'}, {'city': 'Hollywood', 'growth_from_2000_to_2013': '4.8%', 'latitude': 26.0112014, 'longitude': -80.1494901, 'population': '146526', 'rank': '174', 'state': 'Florida'}, {'city': 'Paterson', 'growth_from_2000_to_2013': '-2.2%', 'latitude': 40.9167654, 'longitude': -74.17181099999999, 'population': '145948', 'rank': '175', 'state': 'New Jersey'}, {'city': 'Naperville', 'growth_from_2000_to_2013': '12.0%', 'latitude': 41.7508391, 'longitude': -88.1535352, 'population': '144864', 'rank': '176', 'state': 'Illinois'}, {'city': 'Syracuse', 'growth_from_2000_to_2013': '-0.9%', 'latitude': 43.0481221, 'longitude': -76.14742439999999, 'population': '144669', 'rank': '177', 'state': 'New York'}, {'city': 'Mesquite', 'growth_from_2000_to_2013': '14.7%', 'latitude': 32.76679550000001, 'longitude': -96.5991593, 'population': '143484', 'rank': '178', 'state': 'Texas'}, {'city': 'Dayton', 'growth_from_2000_to_2013': '-13.5%', 'latitude': 39.7589478, 'longitude': -84.1916069, 'population': '143355', 'rank': '179', 'state': 'Ohio'}, {'city': 'Savannah', 'growth_from_2000_to_2013': '7.5%', 'latitude': 32.0835407, 'longitude': -81.09983419999999, 'population': '142772', 'rank': '180', 'state': 'Georgia'}, {'city': 'Clarksville', 'growth_from_2000_to_2013': '36.9%', 'latitude': 36.5297706, 'longitude': -87.3594528, 'population': '142357', 'rank': '181', 'state': 'Tennessee'}, {'city': 'Orange', 'growth_from_2000_to_2013': '7.7%', 'latitude': 33.7877944, 'longitude': -117.8531119, 'population': '139969', 'rank': '182', 'state': 'California'}, {'city': 'Pasadena', 'growth_from_2000_to_2013': '3.8%', 'latitude': 34.1477849, 'longitude': -118.1445155, 'population': '139731', 'rank': '183', 'state': 'California'}, {'city': 'Fullerton', 'growth_from_2000_to_2013': '9.8%', 'latitude': 33.8703596, 'longitude': -117.9242966, 'population': '138981', 'rank': '184', 'state': 'California'}, {'city': 'Killeen', 'growth_from_2000_to_2013': '52.1%', 'latitude': 31.1171194, 'longitude': -97.72779589999999, 'population': '137147', 'rank': '185', 'state': 'Texas'}, {'city': 'Frisco', 'growth_from_2000_to_2013': '287.7%', 'latitude': 33.1506744, 'longitude': -96.82361159999999, 'population': '136791', 'rank': '186', 'state': 'Texas'}, {'city': 'Hampton', 'growth_from_2000_to_2013': '-6.6%', 'latitude': 37.0298687, 'longitude': -76.34522179999999, 'population': '136699', 'rank': '187', 'state': 'Virginia'}, {'city': 'McAllen', 'growth_from_2000_to_2013': '27.6%', 'latitude': 26.2034071, 'longitude': -98.23001239999999, 'population': '136639', 'rank': '188', 'state': 'Texas'}, {'city': 'Warren', 'growth_from_2000_to_2013': '-2.3%', 'latitude': 42.5144566, 'longitude': -83.01465259999999, 'population': '134873', 'rank': '189', 'state': 'Michigan'}, {'city': 'Bellevue', 'growth_from_2000_to_2013': '19.1%', 'latitude': 47.610377, 'longitude': -122.2006786, 'population': '133992', 'rank': '190', 'state': 'Washington'}, {'city': 'West Valley City', 'growth_from_2000_to_2013': '22.2%', 'latitude': 40.6916132, 'longitude': -112.0010501, 'population': '133579', 'rank': '191', 'state': 'Utah'}, {'city': 'Columbia', 'growth_from_2000_to_2013': '11.7%', 'latitude': 34.0007104, 'longitude': -81.0348144, 'population': '133358', 'rank': '192', 'state': 'South Carolina'}, {'city': 'Olathe', 'growth_from_2000_to_2013': '40.4%', 'latitude': 38.8813958, 'longitude': -94.81912849999999, 'population': '131885', 'rank': '193', 'state': 'Kansas'}, {'city': 'Sterling Heights', 'growth_from_2000_to_2013': '5.2%', 'latitude': 42.5803122, 'longitude': -83.0302033, 'population': '131224', 'rank': '194', 'state': 'Michigan'}, {'city': 'New Haven', 'growth_from_2000_to_2013': '5.5%', 'latitude': 41.308274, 'longitude': -72.9278835, 'population': '130660', 'rank': '195', 'state': 'Connecticut'}, {'city': 'Miramar', 'growth_from_2000_to_2013': '74.7%', 'latitude': 25.9860762, 'longitude': -80.30356019999999, 'population': '130288', 'rank': '196', 'state': 'Florida'}, {'city': 'Waco', 'growth_from_2000_to_2013': '12.5%', 'latitude': 31.549333, 'longitude': -97.1466695, 'population': '129030', 'rank': '197', 'state': 'Texas'}, {'city': 'Thousand Oaks', 'growth_from_2000_to_2013': '9.5%', 'latitude': 34.1705609, 'longitude': -118.8375937, 'population': '128731', 'rank': '198', 'state': 'California'}, {'city': 'Cedar Rapids', 'growth_from_2000_to_2013': '5.4%', 'latitude': 41.9778795, 'longitude': -91.6656232, 'population': '128429', 'rank': '199', 'state': 'Iowa'}, {'city': 'Charleston', 'growth_from_2000_to_2013': '29.2%', 'latitude': 32.7764749, 'longitude': -79.93105120000001, 'population': '127999', 'rank': '200', 'state': 'South Carolina'}, {'city': 'Visalia', 'growth_from_2000_to_2013': '33.6%', 'latitude': 36.3302284, 'longitude': -119.2920585, 'population': '127763', 'rank': '201', 'state': 'California'}, {'city': 'Topeka', 'growth_from_2000_to_2013': '3.4%', 'latitude': 39.0558235, 'longitude': -95.68901849999999, 'population': '127679', 'rank': '202', 'state': 'Kansas'}, {'city': 'Elizabeth', 'growth_from_2000_to_2013': '5.5%', 'latitude': 40.6639916, 'longitude': -74.2107006, 'population': '127558', 'rank': '203', 'state': 'New Jersey'}, {'city': 'Gainesville', 'growth_from_2000_to_2013': '12.8%', 'latitude': 29.6516344, 'longitude': -82.32482619999999, 'population': '127488', 'rank': '204', 'state': 'Florida'}, {'city': 'Thornton', 'growth_from_2000_to_2013': '52.9%', 'latitude': 39.8680412, 'longitude': -104.9719243, 'population': '127359', 'rank': '205', 'state': 'Colorado'}, {'city': 'Roseville', 'growth_from_2000_to_2013': '56.2%', 'latitude': 38.7521235, 'longitude': -121.2880059, 'population': '127035', 'rank': '206', 'state': 'California'}, {'city': 'Carrollton', 'growth_from_2000_to_2013': '14.9%', 'latitude': 32.9756415, 'longitude': -96.8899636, 'population': '126700', 'rank': '207', 'state': 'Texas'}, {'city': 'Coral Springs', 'growth_from_2000_to_2013': '5.7%', 'latitude': 26.271192, 'longitude': -80.2706044, 'population': '126604', 'rank': '208', 'state': 'Florida'}, {'city': 'Stamford', 'growth_from_2000_to_2013': '7.6%', 'latitude': 41.0534302, 'longitude': -73.5387341, 'population': '126456', 'rank': '209', 'state': 'Connecticut'}, {'city': 'Simi Valley', 'growth_from_2000_to_2013': '12.6%', 'latitude': 34.2694474, 'longitude': -118.781482, 'population': '126181', 'rank': '210', 'state': 'California'}, {'city': 'Concord', 'growth_from_2000_to_2013': '2.9%', 'latitude': 37.9779776, 'longitude': -122.0310733, 'population': '125880', 'rank': '211', 'state': 'California'}, {'city': 'Hartford', 'growth_from_2000_to_2013': '0.6%', 'latitude': 41.76371109999999, 'longitude': -72.6850932, 'population': '125017', 'rank': '212', 'state': 'Connecticut'}, {'city': 'Kent', 'growth_from_2000_to_2013': '54.3%', 'latitude': 47.3809335, 'longitude': -122.2348431, 'population': '124435', 'rank': '213', 'state': 'Washington'}, {'city': 'Lafayette', 'growth_from_2000_to_2013': '11.0%', 'latitude': 30.2240897, 'longitude': -92.0198427, 'population': '124276', 'rank': '214', 'state': 'Louisiana'}, {'city': 'Midland', 'growth_from_2000_to_2013': '30.4%', 'latitude': 31.9973456, 'longitude': -102.0779146, 'population': '123933', 'rank': '215', 'state': 'Texas'}, {'city': 'Surprise', 'growth_from_2000_to_2013': '281.9%', 'latitude': 33.6292337, 'longitude': -112.3679279, 'population': '123546', 'rank': '216', 'state': 'Arizona'}, {'city': 'Denton', 'growth_from_2000_to_2013': '47.1%', 'latitude': 33.2148412, 'longitude': -97.13306829999999, 'population': '123099', 'rank': '217', 'state': 'Texas'}, {'city': 'Victorville', 'growth_from_2000_to_2013': '87.6%', 'latitude': 34.5362184, 'longitude': -117.2927641, 'population': '121096', 'rank': '218', 'state': 'California'}, {'city': 'Evansville', 'growth_from_2000_to_2013': '-0.8%', 'latitude': 37.9715592, 'longitude': -87.5710898, 'population': '120310', 'rank': '219', 'state': 'Indiana'}, {'city': 'Santa Clara', 'growth_from_2000_to_2013': '17.4%', 'latitude': 37.3541079, 'longitude': -121.9552356, 'population': '120245', 'rank': '220', 'state': 'California'}, {'city': 'Abilene', 'growth_from_2000_to_2013': '3.6%', 'latitude': 32.4487364, 'longitude': -99.73314390000002, 'population': '120099', 'rank': '221', 'state': 'Texas'}, {'city': 'Athens-Clarke County', 'growth_from_2000_to_2013': '19.0%', 'latitude': 33.9519347, 'longitude': -83.357567, 'population': '119980', 'rank': '222', 'state': 'Georgia'}, {'city': 'Vallejo', 'growth_from_2000_to_2013': '1.2%', 'latitude': 38.1040864, 'longitude': -122.2566367, 'population': '118837', 'rank': '223', 'state': 'California'}, {'city': 'Allentown', 'growth_from_2000_to_2013': '11.2%', 'latitude': 40.6084305, 'longitude': -75.4901833, 'population': '118577', 'rank': '224', 'state': 'Pennsylvania'}, {'city': 'Norman', 'growth_from_2000_to_2013': '22.0%', 'latitude': 35.2225668, 'longitude': -97.4394777, 'population': '118197', 'rank': '225', 'state': 'Oklahoma'}, {'city': 'Beaumont', 'growth_from_2000_to_2013': '3.7%', 'latitude': 30.080174, 'longitude': -94.1265562, 'population': '117796', 'rank': '226', 'state': 'Texas'}, {'city': 'Independence', 'growth_from_2000_to_2013': '3.2%', 'latitude': 39.0911161, 'longitude': -94.41550679999999, 'population': '117240', 'rank': '227', 'state': 'Missouri'}, {'city': 'Murfreesboro', 'growth_from_2000_to_2013': '65.1%', 'latitude': 35.8456213, 'longitude': -86.39027, 'population': '117044', 'rank': '228', 'state': 'Tennessee'}, {'city': 'Ann Arbor', 'growth_from_2000_to_2013': '2.0%', 'latitude': 42.2808256, 'longitude': -83.7430378, 'population': '117025', 'rank': '229', 'state': 'Michigan'}, {'city': 'Springfield', 'growth_from_2000_to_2013': '4.2%', 'latitude': 39.78172130000001, 'longitude': -89.6501481, 'population': '117006', 'rank': '230', 'state': 'Illinois'}, {'city': 'Berkeley', 'growth_from_2000_to_2013': '13.3%', 'latitude': 37.8715926, 'longitude': -122.272747, 'population': '116768', 'rank': '231', 'state': 'California'}, {'city': 'Peoria', 'growth_from_2000_to_2013': '3.0%', 'latitude': 40.6936488, 'longitude': -89.5889864, 'population': '116513', 'rank': '232', 'state': 'Illinois'}, {'city': 'Provo', 'growth_from_2000_to_2013': '10.0%', 'latitude': 40.2338438, 'longitude': -111.6585337, 'population': '116288', 'rank': '233', 'state': 'Utah'}, {'city': 'El Monte', 'growth_from_2000_to_2013': '-0.4%', 'latitude': 34.0686206, 'longitude': -118.0275667, 'population': '115708', 'rank': '234', 'state': 'California'}, {'city': 'Columbia', 'growth_from_2000_to_2013': '34.0%', 'latitude': 38.9517053, 'longitude': -92.3340724, 'population': '115276', 'rank': '235', 'state': 'Missouri'}, {'city': 'Lansing', 'growth_from_2000_to_2013': '-4.4%', 'latitude': 42.732535, 'longitude': -84.5555347, 'population': '113972', 'rank': '236', 'state': 'Michigan'}, {'city': 'Fargo', 'growth_from_2000_to_2013': '24.9%', 'latitude': 46.8771863, 'longitude': -96.7898034, 'population': '113658', 'rank': '237', 'state': 'North Dakota'}, {'city': 'Downey', 'growth_from_2000_to_2013': '5.3%', 'latitude': 33.9401088, 'longitude': -118.1331593, 'population': '113242', 'rank': '238', 'state': 'California'}, {'city': 'Costa Mesa', 'growth_from_2000_to_2013': '2.4%', 'latitude': 33.6411316, 'longitude': -117.9186689, 'population': '112174', 'rank': '239', 'state': 'California'}, {'city': 'Wilmington', 'growth_from_2000_to_2013': '24.8%', 'latitude': 34.2257255, 'longitude': -77.9447102, 'population': '112067', 'rank': '240', 'state': 'North Carolina'}, {'city': 'Arvada', 'growth_from_2000_to_2013': '9.2%', 'latitude': 39.8027644, 'longitude': -105.0874842, 'population': '111707', 'rank': '241', 'state': 'Colorado'}, {'city': 'Inglewood', 'growth_from_2000_to_2013': '-1.0%', 'latitude': 33.9616801, 'longitude': -118.3531311, 'population': '111542', 'rank': '242', 'state': 'California'}, {'city': 'Miami Gardens', 'growth_from_2000_to_2013': '10.5%', 'latitude': 25.9420377, 'longitude': -80.2456045, 'population': '111378', 'rank': '243', 'state': 'Florida'}, {'city': 'Carlsbad', 'growth_from_2000_to_2013': '39.7%', 'latitude': 33.1580933, 'longitude': -117.3505939, 'population': '110972', 'rank': '244', 'state': 'California'}, {'city': 'Westminster', 'growth_from_2000_to_2013': '9.4%', 'latitude': 39.8366528, 'longitude': -105.0372046, 'population': '110945', 'rank': '245', 'state': 'Colorado'}, {'city': 'Rochester', 'growth_from_2000_to_2013': '23.9%', 'latitude': 44.0121221, 'longitude': -92.4801989, 'population': '110742', 'rank': '246', 'state': 'Minnesota'}, {'city': 'Odessa', 'growth_from_2000_to_2013': '22.3%', 'latitude': 31.8456816, 'longitude': -102.3676431, 'population': '110720', 'rank': '247', 'state': 'Texas'}, {'city': 'Manchester', 'growth_from_2000_to_2013': '2.9%', 'latitude': 42.9956397, 'longitude': -71.4547891, 'population': '110378', 'rank': '248', 'state': 'New Hampshire'}, {'city': 'Elgin', 'growth_from_2000_to_2013': '16.0%', 'latitude': 42.0354084, 'longitude': -88.2825668, 'population': '110145', 'rank': '249', 'state': 'Illinois'}, {'city': 'West Jordan', 'growth_from_2000_to_2013': '38.4%', 'latitude': 40.6096698, 'longitude': -111.9391031, 'population': '110077', 'rank': '250', 'state': 'Utah'}, {'city': 'Round Rock', 'growth_from_2000_to_2013': '81.0%', 'latitude': 30.5082551, 'longitude': -97.678896, 'population': '109821', 'rank': '251', 'state': 'Texas'}, {'city': 'Clearwater', 'growth_from_2000_to_2013': '0.1%', 'latitude': 27.9658533, 'longitude': -82.8001026, 'population': '109703', 'rank': '252', 'state': 'Florida'}, {'city': 'Waterbury', 'growth_from_2000_to_2013': '2.2%', 'latitude': 41.5581525, 'longitude': -73.0514965, 'population': '109676', 'rank': '253', 'state': 'Connecticut'}, {'city': 'Gresham', 'growth_from_2000_to_2013': '20.7%', 'latitude': 45.5001357, 'longitude': -122.4302013, 'population': '109397', 'rank': '254', 'state': 'Oregon'}, {'city': 'Fairfield', 'growth_from_2000_to_2013': '12.8%', 'latitude': 38.24935809999999, 'longitude': -122.0399663, 'population': '109320', 'rank': '255', 'state': 'California'}, {'city': 'Billings', 'growth_from_2000_to_2013': '18.6%', 'latitude': 45.7832856, 'longitude': -108.5006904, 'population': '109059', 'rank': '256', 'state': 'Montana'}, {'city': 'Lowell', 'growth_from_2000_to_2013': '3.4%', 'latitude': 42.6334247, 'longitude': -71.31617179999999, 'population': '108861', 'rank': '257', 'state': 'Massachusetts'}, {'city': 'San Buenaventura (Ventura)', 'growth_from_2000_to_2013': '7.4%', 'latitude': 34.274646, 'longitude': -119.2290316, 'population': '108817', 'rank': '258', 'state': 'California'}, {'city': 'Pueblo', 'growth_from_2000_to_2013': '5.9%', 'latitude': 38.2544472, 'longitude': -104.6091409, 'population': '108249', 'rank': '259', 'state': 'Colorado'}, {'city': 'High Point', 'growth_from_2000_to_2013': '24.3%', 'latitude': 35.9556923, 'longitude': -80.0053176, 'population': '107741', 'rank': '260', 'state': 'North Carolina'}, {'city': 'West Covina', 'growth_from_2000_to_2013': '2.3%', 'latitude': 34.0686208, 'longitude': -117.9389526, 'population': '107740', 'rank': '261', 'state': 'California'}, {'city': 'Richmond', 'growth_from_2000_to_2013': '7.9%', 'latitude': 37.9357576, 'longitude': -122.3477486, 'population': '107571', 'rank': '262', 'state': 'California'}, {'city': 'Murrieta', 'growth_from_2000_to_2013': '107.4%', 'latitude': 33.5539143, 'longitude': -117.2139232, 'population': '107479', 'rank': '263', 'state': 'California'}, {'city': 'Cambridge', 'growth_from_2000_to_2013': '5.5%', 'latitude': 42.3736158, 'longitude': -71.10973349999999, 'population': '107289', 'rank': '264', 'state': 'Massachusetts'}, {'city': 'Antioch', 'growth_from_2000_to_2013': '16.9%', 'latitude': 38.0049214, 'longitude': -121.805789, 'population': '107100', 'rank': '265', 'state': 'California'}, {'city': 'Temecula', 'growth_from_2000_to_2013': '55.4%', 'latitude': 33.4936391, 'longitude': -117.1483648, 'population': '106780', 'rank': '266', 'state': 'California'}, {'city': 'Norwalk', 'growth_from_2000_to_2013': '1.9%', 'latitude': 33.9022367, 'longitude': -118.081733, 'population': '106589', 'rank': '267', 'state': 'California'}, {'city': 'Centennial', 'growth_from_2000_to_2013': '3.5%', 'latitude': 39.5807452, 'longitude': -104.8771726, 'population': '106114', 'rank': '268', 'state': 'Colorado'}, {'city': 'Everett', 'growth_from_2000_to_2013': '9.4%', 'latitude': 47.9789848, 'longitude': -122.2020794, 'population': '105370', 'rank': '269', 'state': 'Washington'}, {'city': 'Palm Bay', 'growth_from_2000_to_2013': '31.7%', 'latitude': 28.0344621, 'longitude': -80.5886646, 'population': '104898', 'rank': '270', 'state': 'Florida'}, {'city': 'Wichita Falls', 'growth_from_2000_to_2013': '0.7%', 'latitude': 33.9137085, 'longitude': -98.4933873, 'population': '104898', 'rank': '271', 'state': 'Texas'}, {'city': 'Green Bay', 'growth_from_2000_to_2013': '1.9%', 'latitude': 44.51915899999999, 'longitude': -88.019826, 'population': '104779', 'rank': '272', 'state': 'Wisconsin'}, {'city': 'Daly City', 'growth_from_2000_to_2013': '1.0%', 'latitude': 37.6879241, 'longitude': -122.4702079, 'population': '104739', 'rank': '273', 'state': 'California'}, {'city': 'Burbank', 'growth_from_2000_to_2013': '4.2%', 'latitude': 34.1808392, 'longitude': -118.3089661, 'population': '104709', 'rank': '274', 'state': 'California'}, {'city': 'Richardson', 'growth_from_2000_to_2013': '13.2%', 'latitude': 32.9483335, 'longitude': -96.7298519, 'population': '104475', 'rank': '275', 'state': 'Texas'}, {'city': 'Pompano Beach', 'growth_from_2000_to_2013': '4.0%', 'latitude': 26.2378597, 'longitude': -80.1247667, 'population': '104410', 'rank': '276', 'state': 'Florida'}, {'city': 'North Charleston', 'growth_from_2000_to_2013': '27.4%', 'latitude': 32.8546197, 'longitude': -79.9748103, 'population': '104054', 'rank': '277', 'state': 'South Carolina'}, {'city': 'Broken Arrow', 'growth_from_2000_to_2013': '28.2%', 'latitude': 36.060949, 'longitude': -95.7974526, 'population': '103500', 'rank': '278', 'state': 'Oklahoma'}, {'city': 'Boulder', 'growth_from_2000_to_2013': '9.0%', 'latitude': 40.0149856, 'longitude': -105.2705456, 'population': '103166', 'rank': '279', 'state': 'Colorado'}, {'city': 'West Palm Beach', 'growth_from_2000_to_2013': '23.5%', 'latitude': 26.7153424, 'longitude': -80.0533746, 'population': '102436', 'rank': '280', 'state': 'Florida'}, {'city': 'Santa Maria', 'growth_from_2000_to_2013': '30.9%', 'latitude': 34.9530337, 'longitude': -120.4357191, 'population': '102216', 'rank': '281', 'state': 'California'}, {'city': 'El Cajon', 'growth_from_2000_to_2013': '7.4%', 'latitude': 32.7947731, 'longitude': -116.9625269, 'population': '102211', 'rank': '282', 'state': 'California'}, {'city': 'Davenport', 'growth_from_2000_to_2013': '3.9%', 'latitude': 41.5236437, 'longitude': -90.5776367, 'population': '102157', 'rank': '283', 'state': 'Iowa'}, {'city': 'Rialto', 'growth_from_2000_to_2013': '9.8%', 'latitude': 34.1064001, 'longitude': -117.3703235, 'population': '101910', 'rank': '284', 'state': 'California'}, {'city': 'Las Cruces', 'growth_from_2000_to_2013': '37.6%', 'latitude': 32.3199396, 'longitude': -106.7636538, 'population': '101324', 'rank': '285', 'state': 'New Mexico'}, {'city': 'San Mateo', 'growth_from_2000_to_2013': '9.0%', 'latitude': 37.5629917, 'longitude': -122.3255254, 'population': '101128', 'rank': '286', 'state': 'California'}, {'city': 'Lewisville', 'growth_from_2000_to_2013': '28.9%', 'latitude': 33.046233, 'longitude': -96.994174, 'population': '101074', 'rank': '287', 'state': 'Texas'}, {'city': 'South Bend', 'growth_from_2000_to_2013': '-6.8%', 'latitude': 41.6763545, 'longitude': -86.25198979999999, 'population': '100886', 'rank': '288', 'state': 'Indiana'}, {'city': 'Lakeland', 'growth_from_2000_to_2013': '18.3%', 'latitude': 28.0394654, 'longitude': -81.9498042, 'population': '100710', 'rank': '289', 'state': 'Florida'}, {'city': 'Erie', 'growth_from_2000_to_2013': '-2.8%', 'latitude': 42.12922409999999, 'longitude': -80.085059, 'population': '100671', 'rank': '290', 'state': 'Pennsylvania'}, {'city': 'Tyler', 'growth_from_2000_to_2013': '18.6%', 'latitude': 32.3512601, 'longitude': -95.30106239999999, 'population': '100223', 'rank': '291', 'state': 'Texas'}, {'city': 'Pearland', 'growth_from_2000_to_2013': '117.2%', 'latitude': 29.5635666, 'longitude': -95.2860474, 'population': '100065', 'rank': '292', 'state': 'Texas'}, {'city': 'College Station', 'growth_from_2000_to_2013': '45.2%', 'latitude': 30.627977, 'longitude': -96.3344068, 'population': '100050', 'rank': '293', 'state': 'Texas'}, {'city': 'Kenosha', 'growth_from_2000_to_2013': '9.5%', 'latitude': 42.5847425, 'longitude': -87.82118539999999, 'population': '99889', 'rank': '294', 'state': 'Wisconsin'}, {'city': 'Sandy Springs', 'growth_from_2000_to_2013': '17.4%', 'latitude': 33.9304352, 'longitude': -84.3733147, 'population': '99770', 'rank': '295', 'state': 'Georgia'}, {'city': 'Clovis', 'growth_from_2000_to_2013': '42.6%', 'latitude': 36.8252277, 'longitude': -119.7029194, 'population': '99769', 'rank': '296', 'state': 'California'}, {'city': 'Flint', 'growth_from_2000_to_2013': '-20.0%', 'latitude': 43.0125274, 'longitude': -83.6874562, 'population': '99763', 'rank': '297', 'state': 'Michigan'}, {'city': 'Roanoke', 'growth_from_2000_to_2013': '3.8%', 'latitude': 37.2709704, 'longitude': -79.9414266, 'population': '98465', 'rank': '298', 'state': 'Virginia'}, {'city': 'Albany', 'growth_from_2000_to_2013': '4.1%', 'latitude': 42.6525793, 'longitude': -73.7562317, 'population': '98424', 'rank': '299', 'state': 'New York'}, {'city': 'Jurupa Valley', 'growth_from_2000_to_2013': '', 'latitude': 33.9971974, 'longitude': -117.4854802, 'population': '98030', 'rank': '300', 'state': 'California'}, {'city': 'Compton', 'growth_from_2000_to_2013': '4.5%', 'latitude': 33.8958492, 'longitude': -118.2200712, 'population': '97877', 'rank': '301', 'state': 'California'}, {'city': 'San Angelo', 'growth_from_2000_to_2013': '10.2%', 'latitude': 31.4637723, 'longitude': -100.4370375, 'population': '97492', 'rank': '302', 'state': 'Texas'}, {'city': 'Hillsboro', 'growth_from_2000_to_2013': '36.4%', 'latitude': 45.5228939, 'longitude': -122.989827, 'population': '97368', 'rank': '303', 'state': 'Oregon'}, {'city': 'Lawton', 'growth_from_2000_to_2013': '4.9%', 'latitude': 34.6035669, 'longitude': -98.39592909999999, 'population': '97151', 'rank': '304', 'state': 'Oklahoma'}, {'city': 'Renton', 'growth_from_2000_to_2013': '88.4%', 'latitude': 47.48287759999999, 'longitude': -122.2170661, 'population': '97003', 'rank': '305', 'state': 'Washington'}, {'city': 'Vista', 'growth_from_2000_to_2013': '7.7%', 'latitude': 33.2000368, 'longitude': -117.2425355, 'population': '96929', 'rank': '306', 'state': 'California'}, {'city': 'Davie', 'growth_from_2000_to_2013': '17.7%', 'latitude': 26.0764783, 'longitude': -80.25211569999999, 'population': '96830', 'rank': '307', 'state': 'Florida'}, {'city': 'Greeley', 'growth_from_2000_to_2013': '23.1%', 'latitude': 40.4233142, 'longitude': -104.7091322, 'population': '96539', 'rank': '308', 'state': 'Colorado'}, {'city': 'Mission Viejo', 'growth_from_2000_to_2013': '2.9%', 'latitude': 33.6000232, 'longitude': -117.6719953, 'population': '96346', 'rank': '309', 'state': 'California'}, {'city': 'Portsmouth', 'growth_from_2000_to_2013': '-4.2%', 'latitude': 36.8354258, 'longitude': -76.2982742, 'population': '96205', 'rank': '310', 'state': 'Virginia'}, {'city': 'Dearborn', 'growth_from_2000_to_2013': '-2.0%', 'latitude': 42.3222599, 'longitude': -83.17631449999999, 'population': '95884', 'rank': '311', 'state': 'Michigan'}, {'city': 'South Gate', 'growth_from_2000_to_2013': '-0.8%', 'latitude': 33.954737, 'longitude': -118.2120161, 'population': '95677', 'rank': '312', 'state': 'California'}, {'city': 'Tuscaloosa', 'growth_from_2000_to_2013': '21.1%', 'latitude': 33.2098407, 'longitude': -87.56917349999999, 'population': '95334', 'rank': '313', 'state': 'Alabama'}, {'city': 'Livonia', 'growth_from_2000_to_2013': '-5.4%', 'latitude': 42.36837, 'longitude': -83.35270969999999, 'population': '95208', 'rank': '314', 'state': 'Michigan'}, {'city': 'New Bedford', 'growth_from_2000_to_2013': '1.2%', 'latitude': 41.6362152, 'longitude': -70.93420499999999, 'population': '95078', 'rank': '315', 'state': 'Massachusetts'}, {'city': 'Vacaville', 'growth_from_2000_to_2013': '5.4%', 'latitude': 38.3565773, 'longitude': -121.9877444, 'population': '94275', 'rank': '316', 'state': 'California'}, {'city': 'Brockton', 'growth_from_2000_to_2013': '-0.3%', 'latitude': 42.0834335, 'longitude': -71.0183787, 'population': '94089', 'rank': '317', 'state': 'Massachusetts'}, {'city': 'Roswell', 'growth_from_2000_to_2013': '15.2%', 'latitude': 34.0232431, 'longitude': -84.3615555, 'population': '94034', 'rank': '318', 'state': 'Georgia'}, {'city': 'Beaverton', 'growth_from_2000_to_2013': '17.0%', 'latitude': 45.48706199999999, 'longitude': -122.8037102, 'population': '93542', 'rank': '319', 'state': 'Oregon'}, {'city': 'Quincy', 'growth_from_2000_to_2013': '5.8%', 'latitude': 42.2528772, 'longitude': -71.0022705, 'population': '93494', 'rank': '320', 'state': 'Massachusetts'}, {'city': 'Sparks', 'growth_from_2000_to_2013': '39.4%', 'latitude': 39.5349112, 'longitude': -119.7526886, 'population': '93282', 'rank': '321', 'state': 'Nevada'}, {'city': 'Yakima', 'growth_from_2000_to_2013': '11.7%', 'latitude': 46.6020711, 'longitude': -120.5058987, 'population': '93257', 'rank': '322', 'state': 'Washington'}, {'city': "Lee's Summit", 'growth_from_2000_to_2013': '31.2%', 'latitude': 38.9108408, 'longitude': -94.3821724, 'population': '93184', 'rank': '323', 'state': 'Missouri'}, {'city': 'Federal Way', 'growth_from_2000_to_2013': '8.8%', 'latitude': 47.3223221, 'longitude': -122.3126222, 'population': '92734', 'rank': '324', 'state': 'Washington'}, {'city': 'Carson', 'growth_from_2000_to_2013': '2.9%', 'latitude': 33.8316745, 'longitude': -118.281693, 'population': '92599', 'rank': '325', 'state': 'California'}, {'city': 'Santa Monica', 'growth_from_2000_to_2013': '9.6%', 'latitude': 34.0194543, 'longitude': -118.4911912, 'population': '92472', 'rank': '326', 'state': 'California'}, {'city': 'Hesperia', 'growth_from_2000_to_2013': '46.1%', 'latitude': 34.4263886, 'longitude': -117.3008784, 'population': '92147', 'rank': '327', 'state': 'California'}, {'city': 'Allen', 'growth_from_2000_to_2013': '104.0%', 'latitude': 33.1031744, 'longitude': -96.67055030000002, 'population': '92020', 'rank': '328', 'state': 'Texas'}, {'city': 'Rio Rancho', 'growth_from_2000_to_2013': '74.4%', 'latitude': 35.2327544, 'longitude': -106.6630437, 'population': '91956', 'rank': '329', 'state': 'New Mexico'}, {'city': 'Yuma', 'growth_from_2000_to_2013': '16.2%', 'latitude': 32.6926512, 'longitude': -114.6276916, 'population': '91923', 'rank': '330', 'state': 'Arizona'}, {'city': 'Westminster', 'growth_from_2000_to_2013': '3.9%', 'latitude': 33.7513419, 'longitude': -117.9939921, 'population': '91739', 'rank': '331', 'state': 'California'}, {'city': 'Orem', 'growth_from_2000_to_2013': '8.5%', 'latitude': 40.2968979, 'longitude': -111.6946475, 'population': '91648', 'rank': '332', 'state': 'Utah'}, {'city': 'Lynn', 'growth_from_2000_to_2013': '2.6%', 'latitude': 42.46676300000001, 'longitude': -70.9494938, 'population': '91589', 'rank': '333', 'state': 'Massachusetts'}, {'city': 'Redding', 'growth_from_2000_to_2013': '11.9%', 'latitude': 40.5865396, 'longitude': -122.3916754, 'population': '91119', 'rank': '334', 'state': 'California'}, {'city': 'Spokane Valley', 'growth_from_2000_to_2013': '12.6%', 'latitude': 47.6732281, 'longitude': -117.2393748, 'population': '91113', 'rank': '335', 'state': 'Washington'}, {'city': 'Miami Beach', 'growth_from_2000_to_2013': '3.3%', 'latitude': 25.790654, 'longitude': -80.1300455, 'population': '91026', 'rank': '336', 'state': 'Florida'}, {'city': 'League City', 'growth_from_2000_to_2013': '98.3%', 'latitude': 29.5074538, 'longitude': -95.0949303, 'population': '90983', 'rank': '337', 'state': 'Texas'}, {'city': 'Lawrence', 'growth_from_2000_to_2013': '12.7%', 'latitude': 38.9716689, 'longitude': -95.2352501, 'population': '90811', 'rank': '338', 'state': 'Kansas'}, {'city': 'Santa Barbara', 'growth_from_2000_to_2013': '0.9%', 'latitude': 34.4208305, 'longitude': -119.6981901, 'population': '90412', 'rank': '339', 'state': 'California'}, {'city': 'Plantation', 'growth_from_2000_to_2013': '8.6%', 'latitude': 26.1275862, 'longitude': -80.23310359999999, 'population': '90268', 'rank': '340', 'state': 'Florida'}, {'city': 'Sandy', 'growth_from_2000_to_2013': '1.3%', 'latitude': 40.5649781, 'longitude': -111.8389726, 'population': '90231', 'rank': '341', 'state': 'Utah'}, {'city': 'Sunrise', 'growth_from_2000_to_2013': '4.6%', 'latitude': 26.1669711, 'longitude': -80.25659499999999, 'population': '90116', 'rank': '342', 'state': 'Florida'}, {'city': 'Macon', 'growth_from_2000_to_2013': '-7.3%', 'latitude': 32.8406946, 'longitude': -83.6324022, 'population': '89981', 'rank': '343', 'state': 'Georgia'}, {'city': 'Longmont', 'growth_from_2000_to_2013': '24.4%', 'latitude': 40.1672068, 'longitude': -105.1019275, 'population': '89919', 'rank': '344', 'state': 'Colorado'}, {'city': 'Boca Raton', 'growth_from_2000_to_2013': '7.5%', 'latitude': 26.3683064, 'longitude': -80.1289321, 'population': '89407', 'rank': '345', 'state': 'Florida'}, {'city': 'San Marcos', 'growth_from_2000_to_2013': '60.0%', 'latitude': 33.1433723, 'longitude': -117.1661449, 'population': '89387', 'rank': '346', 'state': 'California'}, {'city': 'Greenville', 'growth_from_2000_to_2013': '41.9%', 'latitude': 35.612661, 'longitude': -77.3663538, 'population': '89130', 'rank': '347', 'state': 'North Carolina'}, {'city': 'Waukegan', 'growth_from_2000_to_2013': '0.5%', 'latitude': 42.3636331, 'longitude': -87.84479379999999, 'population': '88826', 'rank': '348', 'state': 'Illinois'}, {'city': 'Fall River', 'growth_from_2000_to_2013': '-3.7%', 'latitude': 41.7014912, 'longitude': -71.1550451, 'population': '88697', 'rank': '349', 'state': 'Massachusetts'}, {'city': 'Chico', 'growth_from_2000_to_2013': '14.2%', 'latitude': 39.7284944, 'longitude': -121.8374777, 'population': '88077', 'rank': '350', 'state': 'California'}, {'city': 'Newton', 'growth_from_2000_to_2013': '4.9%', 'latitude': 42.3370413, 'longitude': -71.20922139999999, 'population': '87971', 'rank': '351', 'state': 'Massachusetts'}, {'city': 'San Leandro', 'growth_from_2000_to_2013': '10.3%', 'latitude': 37.7249296, 'longitude': -122.1560768, 'population': '87965', 'rank': '352', 'state': 'California'}, {'city': 'Reading', 'growth_from_2000_to_2013': '8.0%', 'latitude': 40.3356483, 'longitude': -75.9268747, 'population': '87893', 'rank': '353', 'state': 'Pennsylvania'}, {'city': 'Norwalk', 'growth_from_2000_to_2013': '5.6%', 'latitude': 41.11774399999999, 'longitude': -73.4081575, 'population': '87776', 'rank': '354', 'state': 'Connecticut'}, {'city': 'Fort Smith', 'growth_from_2000_to_2013': '8.6%', 'latitude': 35.3859242, 'longitude': -94.39854749999999, 'population': '87650', 'rank': '355', 'state': 'Arkansas'}, {'city': 'Newport Beach', 'growth_from_2000_to_2013': '10.4%', 'latitude': 33.6189101, 'longitude': -117.9289469, 'population': '87273', 'rank': '356', 'state': 'California'}, {'city': 'Asheville', 'growth_from_2000_to_2013': '19.6%', 'latitude': 35.5950581, 'longitude': -82.5514869, 'population': '87236', 'rank': '357', 'state': 'North Carolina'}, {'city': 'Nashua', 'growth_from_2000_to_2013': '0.4%', 'latitude': 42.7653662, 'longitude': -71.46756599999999, 'population': '87137', 'rank': '358', 'state': 'New Hampshire'}, {'city': 'Edmond', 'growth_from_2000_to_2013': '26.9%', 'latitude': 35.6528323, 'longitude': -97.47809540000002, 'population': '87004', 'rank': '359', 'state': 'Oklahoma'}, {'city': 'Whittier', 'growth_from_2000_to_2013': '3.3%', 'latitude': 33.9791793, 'longitude': -118.032844, 'population': '86635', 'rank': '360', 'state': 'California'}, {'city': 'Nampa', 'growth_from_2000_to_2013': '57.9%', 'latitude': 43.5407172, 'longitude': -116.5634624, 'population': '86518', 'rank': '361', 'state': 'Idaho'}, {'city': 'Bloomington', 'growth_from_2000_to_2013': '1.3%', 'latitude': 44.840798, 'longitude': -93.2982799, 'population': '86319', 'rank': '362', 'state': 'Minnesota'}, {'city': 'Deltona', 'growth_from_2000_to_2013': '23.1%', 'latitude': 28.9005446, 'longitude': -81.26367379999999, 'population': '86290', 'rank': '363', 'state': 'Florida'}, {'city': 'Hawthorne', 'growth_from_2000_to_2013': '2.3%', 'latitude': 33.9164032, 'longitude': -118.3525748, 'population': '86199', 'rank': '364', 'state': 'California'}, {'city': 'Duluth', 'growth_from_2000_to_2013': '-0.1%', 'latitude': 46.78667189999999, 'longitude': -92.1004852, 'population': '86128', 'rank': '365', 'state': 'Minnesota'}, {'city': 'Carmel', 'growth_from_2000_to_2013': '60.4%', 'latitude': 39.978371, 'longitude': -86.1180435, 'population': '85927', 'rank': '366', 'state': 'Indiana'}, {'city': 'Suffolk', 'growth_from_2000_to_2013': '33.5%', 'latitude': 36.7282054, 'longitude': -76.5835621, 'population': '85728', 'rank': '367', 'state': 'Virginia'}, {'city': 'Clifton', 'growth_from_2000_to_2013': '7.9%', 'latitude': 40.8584328, 'longitude': -74.16375529999999, 'population': '85390', 'rank': '368', 'state': 'New Jersey'}, {'city': 'Citrus Heights', 'growth_from_2000_to_2013': '-0.1%', 'latitude': 38.7071247, 'longitude': -121.2810611, 'population': '85285', 'rank': '369', 'state': 'California'}, {'city': 'Livermore', 'growth_from_2000_to_2013': '15.1%', 'latitude': 37.6818745, 'longitude': -121.7680088, 'population': '85156', 'rank': '370', 'state': 'California'}, {'city': 'Tracy', 'growth_from_2000_to_2013': '45.9%', 'latitude': 37.7396513, 'longitude': -121.4252227, 'population': '84691', 'rank': '371', 'state': 'California'}, {'city': 'Alhambra', 'growth_from_2000_to_2013': '-0.7%', 'latitude': 34.095287, 'longitude': -118.1270146, 'population': '84577', 'rank': '372', 'state': 'California'}, {'city': 'Kirkland', 'growth_from_2000_to_2013': '87.5%', 'latitude': 47.6814875, 'longitude': -122.2087353, 'population': '84430', 'rank': '373', 'state': 'Washington'}, {'city': 'Trenton', 'growth_from_2000_to_2013': '-1.2%', 'latitude': 40.2170534, 'longitude': -74.7429384, 'population': '84349', 'rank': '374', 'state': 'New Jersey'}, {'city': 'Ogden', 'growth_from_2000_to_2013': '8.6%', 'latitude': 41.223, 'longitude': -111.9738304, 'population': '84249', 'rank': '375', 'state': 'Utah'}, {'city': 'Hoover', 'growth_from_2000_to_2013': '32.7%', 'latitude': 33.4053867, 'longitude': -86.8113781, 'population': '84126', 'rank': '376', 'state': 'Alabama'}, {'city': 'Cicero', 'growth_from_2000_to_2013': '-1.6%', 'latitude': 41.8455877, 'longitude': -87.7539448, 'population': '84103', 'rank': '377', 'state': 'Illinois'}, {'city': 'Fishers', 'growth_from_2000_to_2013': '114.8%', 'latitude': 39.9567548, 'longitude': -86.01335, 'population': '83891', 'rank': '378', 'state': 'Indiana'}, {'city': 'Sugar Land', 'growth_from_2000_to_2013': '29.1%', 'latitude': 29.6196787, 'longitude': -95.6349463, 'population': '83860', 'rank': '379', 'state': 'Texas'}, {'city': 'Danbury', 'growth_from_2000_to_2013': '11.4%', 'latitude': 41.394817, 'longitude': -73.4540111, 'population': '83684', 'rank': '380', 'state': 'Connecticut'}, {'city': 'Meridian', 'growth_from_2000_to_2013': '127.6%', 'latitude': 43.6121087, 'longitude': -116.3915131, 'population': '83596', 'rank': '381', 'state': 'Idaho'}, {'city': 'Indio', 'growth_from_2000_to_2013': '66.0%', 'latitude': 33.7205771, 'longitude': -116.2155619, 'population': '83539', 'rank': '382', 'state': 'California'}, {'city': 'Concord', 'growth_from_2000_to_2013': '47.4%', 'latitude': 35.4087517, 'longitude': -80.579511, 'population': '83506', 'rank': '383', 'state': 'North Carolina'}, {'city': 'Menifee', 'growth_from_2000_to_2013': '95.0%', 'latitude': 33.6971468, 'longitude': -117.185294, 'population': '83447', 'rank': '384', 'state': 'California'}, {'city': 'Champaign', 'growth_from_2000_to_2013': '18.3%', 'latitude': 40.1164204, 'longitude': -88.2433829, 'population': '83424', 'rank': '385', 'state': 'Illinois'}, {'city': 'Buena Park', 'growth_from_2000_to_2013': '6.1%', 'latitude': 33.8675143, 'longitude': -117.9981181, 'population': '82882', 'rank': '386', 'state': 'California'}, {'city': 'Troy', 'growth_from_2000_to_2013': '2.2%', 'latitude': 42.6064095, 'longitude': -83.1497751, 'population': '82821', 'rank': '387', 'state': 'Michigan'}, {'city': "O'Fallon", 'growth_from_2000_to_2013': '62.6%', 'latitude': 38.8106075, 'longitude': -90.69984769999999, 'population': '82809', 'rank': '388', 'state': 'Missouri'}, {'city': 'Johns Creek', 'growth_from_2000_to_2013': '36.5%', 'latitude': 34.0289259, 'longitude': -84.198579, 'population': '82788', 'rank': '389', 'state': 'Georgia'}, {'city': 'Bellingham', 'growth_from_2000_to_2013': '21.8%', 'latitude': 48.74908, 'longitude': -122.4781473, 'population': '82631', 'rank': '390', 'state': 'Washington'}, {'city': 'Westland', 'growth_from_2000_to_2013': '-4.7%', 'latitude': 42.32420399999999, 'longitude': -83.400211, 'population': '82578', 'rank': '391', 'state': 'Michigan'}, {'city': 'Bloomington', 'growth_from_2000_to_2013': '16.1%', 'latitude': 39.165325, 'longitude': -86.52638569999999, 'population': '82575', 'rank': '392', 'state': 'Indiana'}, {'city': 'Sioux City', 'growth_from_2000_to_2013': '-2.9%', 'latitude': 42.4999942, 'longitude': -96.40030689999999, 'population': '82459', 'rank': '393', 'state': 'Iowa'}, {'city': 'Warwick', 'growth_from_2000_to_2013': '-4.6%', 'latitude': 41.7001009, 'longitude': -71.4161671, 'population': '81971', 'rank': '394', 'state': 'Rhode Island'}, {'city': 'Hemet', 'growth_from_2000_to_2013': '37.6%', 'latitude': 33.7475203, 'longitude': -116.9719684, 'population': '81750', 'rank': '395', 'state': 'California'}, {'city': 'Longview', 'growth_from_2000_to_2013': '11.6%', 'latitude': 32.5007037, 'longitude': -94.74048909999999, 'population': '81443', 'rank': '396', 'state': 'Texas'}, {'city': 'Farmington Hills', 'growth_from_2000_to_2013': '-0.9%', 'latitude': 42.4989936, 'longitude': -83.3677168, 'population': '81295', 'rank': '397', 'state': 'Michigan'}, {'city': 'Bend', 'growth_from_2000_to_2013': '54.3%', 'latitude': 44.0581728, 'longitude': -121.3153096, 'population': '81236', 'rank': '398', 'state': 'Oregon'}, {'city': 'Lakewood', 'growth_from_2000_to_2013': '2.1%', 'latitude': 33.8536269, 'longitude': -118.1339563, 'population': '81121', 'rank': '399', 'state': 'California'}, {'city': 'Merced', 'growth_from_2000_to_2013': '25.4%', 'latitude': 37.3021632, 'longitude': -120.4829677, 'population': '81102', 'rank': '400', 'state': 'California'}, {'city': 'Mission', 'growth_from_2000_to_2013': '74.5%', 'latitude': 26.2159066, 'longitude': -98.32529319999999, 'population': '81050', 'rank': '401', 'state': 'Texas'}, {'city': 'Chino', 'growth_from_2000_to_2013': '15.6%', 'latitude': 34.0122346, 'longitude': -117.688944, 'population': '80988', 'rank': '402', 'state': 'California'}, {'city': 'Redwood City', 'growth_from_2000_to_2013': '7.1%', 'latitude': 37.48521520000001, 'longitude': -122.2363548, 'population': '80872', 'rank': '403', 'state': 'California'}, {'city': 'Edinburg', 'growth_from_2000_to_2013': '65.1%', 'latitude': 26.3017374, 'longitude': -98.1633432, 'population': '80836', 'rank': '404', 'state': 'Texas'}, {'city': 'Cranston', 'growth_from_2000_to_2013': '1.4%', 'latitude': 41.7798226, 'longitude': -71.4372796, 'population': '80566', 'rank': '405', 'state': 'Rhode Island'}, {'city': 'Parma', 'growth_from_2000_to_2013': '-5.9%', 'latitude': 41.4047742, 'longitude': -81.7229086, 'population': '80429', 'rank': '406', 'state': 'Ohio'}, {'city': 'New Rochelle', 'growth_from_2000_to_2013': '9.9%', 'latitude': 40.9114882, 'longitude': -73.7823549, 'population': '79446', 'rank': '407', 'state': 'New York'}, {'city': 'Lake Forest', 'growth_from_2000_to_2013': '4.2%', 'latitude': 33.6469661, 'longitude': -117.689218, 'population': '79312', 'rank': '408', 'state': 'California'}, {'city': 'Napa', 'growth_from_2000_to_2013': '8.4%', 'latitude': 38.2975381, 'longitude': -122.286865, 'population': '79068', 'rank': '409', 'state': 'California'}, {'city': 'Hammond', 'growth_from_2000_to_2013': '-4.6%', 'latitude': 41.5833688, 'longitude': -87.5000412, 'population': '78967', 'rank': '410', 'state': 'Indiana'}, {'city': 'Fayetteville', 'growth_from_2000_to_2013': '32.9%', 'latitude': 36.0625795, 'longitude': -94.1574263, 'population': '78960', 'rank': '411', 'state': 'Arkansas'}, {'city': 'Bloomington', 'growth_from_2000_to_2013': '20.1%', 'latitude': 40.4842027, 'longitude': -88.99368729999999, 'population': '78902', 'rank': '412', 'state': 'Illinois'}, {'city': 'Avondale', 'growth_from_2000_to_2013': '111.5%', 'latitude': 33.4355977, 'longitude': -112.3496021, 'population': '78822', 'rank': '413', 'state': 'Arizona'}, {'city': 'Somerville', 'growth_from_2000_to_2013': '1.6%', 'latitude': 42.3875968, 'longitude': -71.0994968, 'population': '78804', 'rank': '414', 'state': 'Massachusetts'}, {'city': 'Palm Coast', 'growth_from_2000_to_2013': '137.2%', 'latitude': 29.5844524, 'longitude': -81.20786989999999, 'population': '78740', 'rank': '415', 'state': 'Florida'}, {'city': 'Bryan', 'growth_from_2000_to_2013': '19.3%', 'latitude': 30.6743643, 'longitude': -96.3699632, 'population': '78709', 'rank': '416', 'state': 'Texas'}, {'city': 'Gary', 'growth_from_2000_to_2013': '-23.4%', 'latitude': 41.5933696, 'longitude': -87.3464271, 'population': '78450', 'rank': '417', 'state': 'Indiana'}, {'city': 'Largo', 'growth_from_2000_to_2013': '5.1%', 'latitude': 27.9094665, 'longitude': -82.7873244, 'population': '78409', 'rank': '418', 'state': 'Florida'}, {'city': 'Brooklyn Park', 'growth_from_2000_to_2013': '16.0%', 'latitude': 45.0941315, 'longitude': -93.3563405, 'population': '78373', 'rank': '419', 'state': 'Minnesota'}, {'city': 'Tustin', 'growth_from_2000_to_2013': '15.6%', 'latitude': 33.7458511, 'longitude': -117.826166, 'population': '78327', 'rank': '420', 'state': 'California'}, {'city': 'Racine', 'growth_from_2000_to_2013': '-4.4%', 'latitude': 42.7261309, 'longitude': -87.78285230000002, 'population': '78199', 'rank': '421', 'state': 'Wisconsin'}, {'city': 'Deerfield Beach', 'growth_from_2000_to_2013': '4.8%', 'latitude': 26.3184123, 'longitude': -80.09976569999999, 'population': '78041', 'rank': '422', 'state': 'Florida'}, {'city': 'Lynchburg', 'growth_from_2000_to_2013': '19.5%', 'latitude': 37.4137536, 'longitude': -79.14224639999999, 'population': '78014', 'rank': '423', 'state': 'Virginia'}, {'city': 'Mountain View', 'growth_from_2000_to_2013': '10.1%', 'latitude': 37.3860517, 'longitude': -122.0838511, 'population': '77846', 'rank': '424', 'state': 'California'}, {'city': 'Medford', 'growth_from_2000_to_2013': '17.1%', 'latitude': 42.3265152, 'longitude': -122.8755949, 'population': '77677', 'rank': '425', 'state': 'Oregon'}, {'city': 'Lawrence', 'growth_from_2000_to_2013': '7.5%', 'latitude': 42.7070354, 'longitude': -71.1631137, 'population': '77657', 'rank': '426', 'state': 'Massachusetts'}, {'city': 'Bellflower', 'growth_from_2000_to_2013': '6.3%', 'latitude': 33.8816818, 'longitude': -118.1170117, 'population': '77593', 'rank': '427', 'state': 'California'}, {'city': 'Melbourne', 'growth_from_2000_to_2013': '5.9%', 'latitude': 28.0836269, 'longitude': -80.60810889999999, 'population': '77508', 'rank': '428', 'state': 'Florida'}, {'city': 'St. Joseph', 'growth_from_2000_to_2013': '4.1%', 'latitude': 39.7674578, 'longitude': -94.84668099999999, 'population': '77147', 'rank': '429', 'state': 'Missouri'}, {'city': 'Camden', 'growth_from_2000_to_2013': '-3.6%', 'latitude': 39.9259463, 'longitude': -75.1196199, 'population': '76903', 'rank': '430', 'state': 'New Jersey'}, {'city': 'St. George', 'growth_from_2000_to_2013': '53.1%', 'latitude': 37.0965278, 'longitude': -113.5684164, 'population': '76817', 'rank': '431', 'state': 'Utah'}, {'city': 'Kennewick', 'growth_from_2000_to_2013': '29.1%', 'latitude': 46.2112458, 'longitude': -119.1372338, 'population': '76762', 'rank': '432', 'state': 'Washington'}, {'city': 'Baldwin Park', 'growth_from_2000_to_2013': '0.8%', 'latitude': 34.0852868, 'longitude': -117.9608978, 'population': '76635', 'rank': '433', 'state': 'California'}, {'city': 'Chino Hills', 'growth_from_2000_to_2013': '13.6%', 'latitude': 33.9898188, 'longitude': -117.7325848, 'population': '76572', 'rank': '434', 'state': 'California'}, {'city': 'Alameda', 'growth_from_2000_to_2013': '5.4%', 'latitude': 37.7652065, 'longitude': -122.2416355, 'population': '76419', 'rank': '435', 'state': 'California'}, {'city': 'Albany', 'growth_from_2000_to_2013': '-0.6%', 'latitude': 31.5785074, 'longitude': -84.15574099999999, 'population': '76185', 'rank': '436', 'state': 'Georgia'}, {'city': 'Arlington Heights', 'growth_from_2000_to_2013': '-0.6%', 'latitude': 42.0883603, 'longitude': -87.98062650000001, 'population': '75994', 'rank': '437', 'state': 'Illinois'}, {'city': 'Scranton', 'growth_from_2000_to_2013': '0.0%', 'latitude': 41.408969, 'longitude': -75.66241219999999, 'population': '75806', 'rank': '438', 'state': 'Pennsylvania'}, {'city': 'Evanston', 'growth_from_2000_to_2013': '1.9%', 'latitude': 42.0450722, 'longitude': -87.68769689999999, 'population': '75570', 'rank': '439', 'state': 'Illinois'}, {'city': 'Kalamazoo', 'growth_from_2000_to_2013': '-1.9%', 'latitude': 42.2917069, 'longitude': -85.5872286, 'population': '75548', 'rank': '440', 'state': 'Michigan'}, {'city': 'Baytown', 'growth_from_2000_to_2013': '13.1%', 'latitude': 29.7355047, 'longitude': -94.97742740000001, 'population': '75418', 'rank': '441', 'state': 'Texas'}, {'city': 'Upland', 'growth_from_2000_to_2013': '9.5%', 'latitude': 34.09751, 'longitude': -117.6483876, 'population': '75413', 'rank': '442', 'state': 'California'}, {'city': 'Springdale', 'growth_from_2000_to_2013': '57.1%', 'latitude': 36.18674420000001, 'longitude': -94.1288141, 'population': '75229', 'rank': '443', 'state': 'Arkansas'}, {'city': 'Bethlehem', 'growth_from_2000_to_2013': '5.2%', 'latitude': 40.6259316, 'longitude': -75.37045789999999, 'population': '75018', 'rank': '444', 'state': 'Pennsylvania'}, {'city': 'Schaumburg', 'growth_from_2000_to_2013': '-0.5%', 'latitude': 42.0333607, 'longitude': -88.0834059, 'population': '74907', 'rank': '445', 'state': 'Illinois'}, {'city': 'Mount Pleasant', 'growth_from_2000_to_2013': '53.2%', 'latitude': 32.8323225, 'longitude': -79.82842579999999, 'population': '74885', 'rank': '446', 'state': 'South Carolina'}, {'city': 'Auburn', 'growth_from_2000_to_2013': '34.9%', 'latitude': 47.30732279999999, 'longitude': -122.2284532, 'population': '74860', 'rank': '447', 'state': 'Washington'}, {'city': 'Decatur', 'growth_from_2000_to_2013': '-8.7%', 'latitude': 39.8403147, 'longitude': -88.9548001, 'population': '74710', 'rank': '448', 'state': 'Illinois'}, {'city': 'San Ramon', 'growth_from_2000_to_2013': '65.8%', 'latitude': 37.7799273, 'longitude': -121.9780153, 'population': '74513', 'rank': '449', 'state': 'California'}, {'city': 'Pleasanton', 'growth_from_2000_to_2013': '15.2%', 'latitude': 37.6624312, 'longitude': -121.8746789, 'population': '74110', 'rank': '450', 'state': 'California'}, {'city': 'Wyoming', 'growth_from_2000_to_2013': '6.5%', 'latitude': 42.9133602, 'longitude': -85.7053085, 'population': '74100', 'rank': '451', 'state': 'Michigan'}, {'city': 'Lake Charles', 'growth_from_2000_to_2013': '3.0%', 'latitude': 30.2265949, 'longitude': -93.2173758, 'population': '74024', 'rank': '452', 'state': 'Louisiana'}, {'city': 'Plymouth', 'growth_from_2000_to_2013': '12.0%', 'latitude': 45.0105194, 'longitude': -93.4555093, 'population': '73987', 'rank': '453', 'state': 'Minnesota'}, {'city': 'Bolingbrook', 'growth_from_2000_to_2013': '29.7%', 'latitude': 41.69864159999999, 'longitude': -88.0683955, 'population': '73936', 'rank': '454', 'state': 'Illinois'}, {'city': 'Pharr', 'growth_from_2000_to_2013': '55.7%', 'latitude': 26.1947962, 'longitude': -98.1836216, 'population': '73790', 'rank': '455', 'state': 'Texas'}, {'city': 'Appleton', 'growth_from_2000_to_2013': '4.5%', 'latitude': 44.2619309, 'longitude': -88.41538469999999, 'population': '73596', 'rank': '456', 'state': 'Wisconsin'}, {'city': 'Gastonia', 'growth_from_2000_to_2013': '8.2%', 'latitude': 35.262082, 'longitude': -81.18730049999999, 'population': '73209', 'rank': '457', 'state': 'North Carolina'}, {'city': 'Folsom', 'growth_from_2000_to_2013': '38.6%', 'latitude': 38.6779591, 'longitude': -121.1760583, 'population': '73098', 'rank': '458', 'state': 'California'}, {'city': 'Southfield', 'growth_from_2000_to_2013': '-6.7%', 'latitude': 42.4733688, 'longitude': -83.2218731, 'population': '73006', 'rank': '459', 'state': 'Michigan'}, {'city': 'Rochester Hills', 'growth_from_2000_to_2013': '5.7%', 'latitude': 42.65836609999999, 'longitude': -83.1499322, 'population': '72952', 'rank': '460', 'state': 'Michigan'}, {'city': 'New Britain', 'growth_from_2000_to_2013': '1.9%', 'latitude': 41.6612104, 'longitude': -72.7795419, 'population': '72939', 'rank': '461', 'state': 'Connecticut'}, {'city': 'Goodyear', 'growth_from_2000_to_2013': '271.0%', 'latitude': 33.4353394, 'longitude': -112.3576567, 'population': '72864', 'rank': '462', 'state': 'Arizona'}, {'city': 'Canton', 'growth_from_2000_to_2013': '-10.3%', 'latitude': 40.79894729999999, 'longitude': -81.378447, 'population': '72535', 'rank': '463', 'state': 'Ohio'}, {'city': 'Warner Robins', 'growth_from_2000_to_2013': '45.7%', 'latitude': 32.6130007, 'longitude': -83.624201, 'population': '72531', 'rank': '464', 'state': 'Georgia'}, {'city': 'Union City', 'growth_from_2000_to_2013': '7.4%', 'latitude': 37.5933918, 'longitude': -122.0438298, 'population': '72528', 'rank': '465', 'state': 'California'}, {'city': 'Perris', 'growth_from_2000_to_2013': '98.7%', 'latitude': 33.7825194, 'longitude': -117.2286478, 'population': '72326', 'rank': '466', 'state': 'California'}, {'city': 'Manteca', 'growth_from_2000_to_2013': '42.7%', 'latitude': 37.7974273, 'longitude': -121.2160526, 'population': '71948', 'rank': '467', 'state': 'California'}, {'city': 'Iowa City', 'growth_from_2000_to_2013': '13.8%', 'latitude': 41.6611277, 'longitude': -91.5301683, 'population': '71591', 'rank': '468', 'state': 'Iowa'}, {'city': 'Jonesboro', 'growth_from_2000_to_2013': '28.3%', 'latitude': 35.84229670000001, 'longitude': -90.704279, 'population': '71551', 'rank': '469', 'state': 'Arkansas'}, {'city': 'Wilmington', 'growth_from_2000_to_2013': '-1.6%', 'latitude': 39.7390721, 'longitude': -75.5397878, 'population': '71525', 'rank': '470', 'state': 'Delaware'}, {'city': 'Lynwood', 'growth_from_2000_to_2013': '2.0%', 'latitude': 33.930293, 'longitude': -118.2114603, 'population': '71371', 'rank': '471', 'state': 'California'}, {'city': 'Loveland', 'growth_from_2000_to_2013': '37.4%', 'latitude': 40.3977612, 'longitude': -105.0749801, 'population': '71334', 'rank': '472', 'state': 'Colorado'}, {'city': 'Pawtucket', 'growth_from_2000_to_2013': '-2.5%', 'latitude': 41.878711, 'longitude': -71.38255579999999, 'population': '71172', 'rank': '473', 'state': 'Rhode Island'}, {'city': 'Boynton Beach', 'growth_from_2000_to_2013': '17.3%', 'latitude': 26.5317866, 'longitude': -80.0905465, 'population': '71097', 'rank': '474', 'state': 'Florida'}, {'city': 'Waukesha', 'growth_from_2000_to_2013': '8.0%', 'latitude': 43.0116784, 'longitude': -88.2314813, 'population': '71016', 'rank': '475', 'state': 'Wisconsin'}, {'city': 'Gulfport', 'growth_from_2000_to_2013': '-0.6%', 'latitude': 30.3674198, 'longitude': -89.0928155, 'population': '71012', 'rank': '476', 'state': 'Mississippi'}, {'city': 'Apple Valley', 'growth_from_2000_to_2013': '29.9%', 'latitude': 34.5008311, 'longitude': -117.1858759, 'population': '70924', 'rank': '477', 'state': 'California'}, {'city': 'Passaic', 'growth_from_2000_to_2013': '4.3%', 'latitude': 40.8567662, 'longitude': -74.1284764, 'population': '70868', 'rank': '478', 'state': 'New Jersey'}, {'city': 'Rapid City', 'growth_from_2000_to_2013': '17.9%', 'latitude': 44.0805434, 'longitude': -103.2310149, 'population': '70812', 'rank': '479', 'state': 'South Dakota'}, {'city': 'Layton', 'growth_from_2000_to_2013': '20.2%', 'latitude': 41.0602216, 'longitude': -111.9710529, 'population': '70790', 'rank': '480', 'state': 'Utah'}, {'city': 'Lafayette', 'growth_from_2000_to_2013': '14.5%', 'latitude': 40.4167022, 'longitude': -86.87528689999999, 'population': '70373', 'rank': '481', 'state': 'Indiana'}, {'city': 'Turlock', 'growth_from_2000_to_2013': '23.5%', 'latitude': 37.4946568, 'longitude': -120.8465941, 'population': '70365', 'rank': '482', 'state': 'California'}, {'city': 'Muncie', 'growth_from_2000_to_2013': '-0.7%', 'latitude': 40.1933767, 'longitude': -85.3863599, 'population': '70316', 'rank': '483', 'state': 'Indiana'}, {'city': 'Temple', 'growth_from_2000_to_2013': '27.1%', 'latitude': 31.0982344, 'longitude': -97.342782, 'population': '70190', 'rank': '484', 'state': 'Texas'}, {'city': 'Missouri City', 'growth_from_2000_to_2013': '31.1%', 'latitude': 29.6185669, 'longitude': -95.5377215, 'population': '70185', 'rank': '485', 'state': 'Texas'}, {'city': 'Redlands', 'growth_from_2000_to_2013': '9.4%', 'latitude': 34.0555693, 'longitude': -117.1825381, 'population': '69999', 'rank': '486', 'state': 'California'}, {'city': 'Santa Fe', 'growth_from_2000_to_2013': '10.5%', 'latitude': 35.6869752, 'longitude': -105.937799, 'population': '69976', 'rank': '487', 'state': 'New Mexico'}, {'city': 'Lauderhill', 'growth_from_2000_to_2013': '4.2%', 'latitude': 26.1403635, 'longitude': -80.2133808, 'population': '69813', 'rank': '488', 'state': 'Florida'}, {'city': 'Milpitas', 'growth_from_2000_to_2013': '11.0%', 'latitude': 37.4323341, 'longitude': -121.8995741, 'population': '69783', 'rank': '489', 'state': 'California'}, {'city': 'Palatine', 'growth_from_2000_to_2013': '4.5%', 'latitude': 42.1103041, 'longitude': -88.03424000000001, 'population': '69350', 'rank': '490', 'state': 'Illinois'}, {'city': 'Missoula', 'growth_from_2000_to_2013': '19.7%', 'latitude': 46.87871759999999, 'longitude': -113.996586, 'population': '69122', 'rank': '491', 'state': 'Montana'}, {'city': 'Rock Hill', 'growth_from_2000_to_2013': '36.0%', 'latitude': 34.9248667, 'longitude': -81.02507840000001, 'population': '69103', 'rank': '492', 'state': 'South Carolina'}, {'city': 'Jacksonville', 'growth_from_2000_to_2013': '5.0%', 'latitude': 34.7540524, 'longitude': -77.4302414, 'population': '69079', 'rank': '493', 'state': 'North Carolina'}, {'city': 'Franklin', 'growth_from_2000_to_2013': '48.5%', 'latitude': 35.9250637, 'longitude': -86.8688899, 'population': '68886', 'rank': '494', 'state': 'Tennessee'}, {'city': 'Flagstaff', 'growth_from_2000_to_2013': '29.3%', 'latitude': 35.1982836, 'longitude': -111.651302, 'population': '68667', 'rank': '495', 'state': 'Arizona'}, {'city': 'Flower Mound', 'growth_from_2000_to_2013': '32.5%', 'latitude': 33.0145673, 'longitude': -97.0969552, 'population': '68609', 'rank': '496', 'state': 'Texas'}, {'city': 'Weston', 'growth_from_2000_to_2013': '34.5%', 'latitude': 26.1003654, 'longitude': -80.3997748, 'population': '68388', 'rank': '497', 'state': 'Florida'}, {'city': 'Waterloo', 'growth_from_2000_to_2013': '-0.5%', 'latitude': 42.492786, 'longitude': -92.34257749999999, 'population': '68366', 'rank': '498', 'state': 'Iowa'}, {'city': 'Union City', 'growth_from_2000_to_2013': '1.7%', 'latitude': 40.6975898, 'longitude': -74.26316349999999, 'population': '68247', 'rank': '499', 'state': 'New Jersey'}, {'city': 'Mount Vernon', 'growth_from_2000_to_2013': '-0.2%', 'latitude': 40.9125992, 'longitude': -73.8370786, 'population': '68224', 'rank': '500', 'state': 'New York'}, {'city': 'Fort Myers', 'growth_from_2000_to_2013': '31.2%', 'latitude': 26.640628, 'longitude': -81.8723084, 'population': '68190', 'rank': '501', 'state': 'Florida'}, {'city': 'Dothan', 'growth_from_2000_to_2013': '16.6%', 'latitude': 31.2232313, 'longitude': -85.3904888, 'population': '68001', 'rank': '502', 'state': 'Alabama'}, {'city': 'Rancho Cordova', 'growth_from_2000_to_2013': '26.4%', 'latitude': 38.5890723, 'longitude': -121.302728, 'population': '67911', 'rank': '503', 'state': 'California'}, {'city': 'Redondo Beach', 'growth_from_2000_to_2013': '6.7%', 'latitude': 33.8491816, 'longitude': -118.3884078, 'population': '67815', 'rank': '504', 'state': 'California'}, {'city': 'Jackson', 'growth_from_2000_to_2013': '12.9%', 'latitude': 35.6145169, 'longitude': -88.81394689999999, 'population': '67685', 'rank': '505', 'state': 'Tennessee'}, {'city': 'Pasco', 'growth_from_2000_to_2013': '98.5%', 'latitude': 46.2395793, 'longitude': -119.1005657, 'population': '67599', 'rank': '506', 'state': 'Washington'}, {'city': 'St. Charles', 'growth_from_2000_to_2013': '11.3%', 'latitude': 38.7881062, 'longitude': -90.4974359, 'population': '67569', 'rank': '507', 'state': 'Missouri'}, {'city': 'Eau Claire', 'growth_from_2000_to_2013': '8.7%', 'latitude': 44.811349, 'longitude': -91.4984941, 'population': '67545', 'rank': '508', 'state': 'Wisconsin'}, {'city': 'North Richland Hills', 'growth_from_2000_to_2013': '20.2%', 'latitude': 32.8342952, 'longitude': -97.2289029, 'population': '67317', 'rank': '509', 'state': 'Texas'}, {'city': 'Bismarck', 'growth_from_2000_to_2013': '20.1%', 'latitude': 46.8083268, 'longitude': -100.7837392, 'population': '67034', 'rank': '510', 'state': 'North Dakota'}, {'city': 'Yorba Linda', 'growth_from_2000_to_2013': '13.4%', 'latitude': 33.8886259, 'longitude': -117.8131125, 'population': '67032', 'rank': '511', 'state': 'California'}, {'city': 'Kenner', 'growth_from_2000_to_2013': '-4.8%', 'latitude': 29.9940924, 'longitude': -90.2417434, 'population': '66975', 'rank': '512', 'state': 'Louisiana'}, {'city': 'Walnut Creek', 'growth_from_2000_to_2013': '3.5%', 'latitude': 37.9100783, 'longitude': -122.0651819, 'population': '66900', 'rank': '513', 'state': 'California'}, {'city': 'Frederick', 'growth_from_2000_to_2013': '25.9%', 'latitude': 39.41426879999999, 'longitude': -77.4105409, 'population': '66893', 'rank': '514', 'state': 'Maryland'}, {'city': 'Oshkosh', 'growth_from_2000_to_2013': '5.3%', 'latitude': 44.0247062, 'longitude': -88.5426136, 'population': '66778', 'rank': '515', 'state': 'Wisconsin'}, {'city': 'Pittsburg', 'growth_from_2000_to_2013': '16.6%', 'latitude': 38.0279762, 'longitude': -121.8846806, 'population': '66695', 'rank': '516', 'state': 'California'}, {'city': 'Palo Alto', 'growth_from_2000_to_2013': '13.7%', 'latitude': 37.4418834, 'longitude': -122.1430195, 'population': '66642', 'rank': '517', 'state': 'California'}, {'city': 'Bossier City', 'growth_from_2000_to_2013': '17.4%', 'latitude': 32.5159852, 'longitude': -93.7321228, 'population': '66333', 'rank': '518', 'state': 'Louisiana'}, {'city': 'Portland', 'growth_from_2000_to_2013': '3.2%', 'latitude': 43.66147100000001, 'longitude': -70.2553259, 'population': '66318', 'rank': '519', 'state': 'Maine'}, {'city': 'St. Cloud', 'growth_from_2000_to_2013': '10.9%', 'latitude': 45.5579451, 'longitude': -94.16324039999999, 'population': '66297', 'rank': '520', 'state': 'Minnesota'}, {'city': 'Davis', 'growth_from_2000_to_2013': '11.9%', 'latitude': 38.5449065, 'longitude': -121.7405167, 'population': '66205', 'rank': '521', 'state': 'California'}, {'city': 'South San Francisco', 'growth_from_2000_to_2013': '9.1%', 'latitude': 37.654656, 'longitude': -122.4077498, 'population': '66174', 'rank': '522', 'state': 'California'}, {'city': 'Camarillo', 'growth_from_2000_to_2013': '14.9%', 'latitude': 34.2163937, 'longitude': -119.0376023, 'population': '66086', 'rank': '523', 'state': 'California'}, {'city': 'North Little Rock', 'growth_from_2000_to_2013': '9.0%', 'latitude': 34.769536, 'longitude': -92.2670941, 'population': '66075', 'rank': '524', 'state': 'Arkansas'}, {'city': 'Schenectady', 'growth_from_2000_to_2013': '6.7%', 'latitude': 42.8142432, 'longitude': -73.9395687, 'population': '65902', 'rank': '525', 'state': 'New York'}, {'city': 'Gaithersburg', 'growth_from_2000_to_2013': '24.2%', 'latitude': 39.1434406, 'longitude': -77.2013705, 'population': '65690', 'rank': '526', 'state': 'Maryland'}, {'city': 'Harlingen', 'growth_from_2000_to_2013': '11.6%', 'latitude': 26.1906306, 'longitude': -97.69610259999999, 'population': '65665', 'rank': '527', 'state': 'Texas'}, {'city': 'Woodbury', 'growth_from_2000_to_2013': '39.8%', 'latitude': 44.9238552, 'longitude': -92.9593797, 'population': '65656', 'rank': '528', 'state': 'Minnesota'}, {'city': 'Eagan', 'growth_from_2000_to_2013': '2.6%', 'latitude': 44.8041322, 'longitude': -93.1668858, 'population': '65453', 'rank': '529', 'state': 'Minnesota'}, {'city': 'Yuba City', 'growth_from_2000_to_2013': '27.9%', 'latitude': 39.1404477, 'longitude': -121.6169108, 'population': '65416', 'rank': '530', 'state': 'California'}, {'city': 'Maple Grove', 'growth_from_2000_to_2013': '27.3%', 'latitude': 45.0724642, 'longitude': -93.4557877, 'population': '65415', 'rank': '531', 'state': 'Minnesota'}, {'city': 'Youngstown', 'growth_from_2000_to_2013': '-20.2%', 'latitude': 41.0997803, 'longitude': -80.6495194, 'population': '65184', 'rank': '532', 'state': 'Ohio'}, {'city': 'Skokie', 'growth_from_2000_to_2013': '2.8%', 'latitude': 42.0324025, 'longitude': -87.7416246, 'population': '65176', 'rank': '533', 'state': 'Illinois'}, {'city': 'Kissimmee', 'growth_from_2000_to_2013': '32.6%', 'latitude': 28.2919557, 'longitude': -81.40757099999999, 'population': '65173', 'rank': '534', 'state': 'Florida'}, {'city': 'Johnson City', 'growth_from_2000_to_2013': '16.2%', 'latitude': 36.3134397, 'longitude': -82.3534727, 'population': '65123', 'rank': '535', 'state': 'Tennessee'}, {'city': 'Victoria', 'growth_from_2000_to_2013': '7.5%', 'latitude': 28.8052674, 'longitude': -97.0035982, 'population': '65098', 'rank': '536', 'state': 'Texas'}, {'city': 'San Clemente', 'growth_from_2000_to_2013': '28.6%', 'latitude': 33.4269728, 'longitude': -117.6119925, 'population': '65040', 'rank': '537', 'state': 'California'}, {'city': 'Bayonne', 'growth_from_2000_to_2013': '5.1%', 'latitude': 40.6687141, 'longitude': -74.1143091, 'population': '65028', 'rank': '538', 'state': 'New Jersey'}, {'city': 'Laguna Niguel', 'growth_from_2000_to_2013': '2.8%', 'latitude': 33.5225261, 'longitude': -117.7075526, 'population': '64652', 'rank': '539', 'state': 'California'}, {'city': 'East Orange', 'growth_from_2000_to_2013': '-7.4%', 'latitude': 40.767323, 'longitude': -74.2048677, 'population': '64544', 'rank': '540', 'state': 'New Jersey'}, {'city': 'Shawnee', 'growth_from_2000_to_2013': '32.2%', 'latitude': 39.02284849999999, 'longitude': -94.7151865, 'population': '64323', 'rank': '541', 'state': 'Kansas'}, {'city': 'Homestead', 'growth_from_2000_to_2013': '100.7%', 'latitude': 25.4687224, 'longitude': -80.4775569, 'population': '64079', 'rank': '542', 'state': 'Florida'}, {'city': 'Rockville', 'growth_from_2000_to_2013': '34.0%', 'latitude': 39.0839973, 'longitude': -77.1527578, 'population': '64072', 'rank': '544', 'state': 'Maryland'}, {'city': 'Delray Beach', 'growth_from_2000_to_2013': '6.1%', 'latitude': 26.4614625, 'longitude': -80.0728201, 'population': '64072', 'rank': '543', 'state': 'Florida'}, {'city': 'Janesville', 'growth_from_2000_to_2013': '5.6%', 'latitude': 42.6827885, 'longitude': -89.0187222, 'population': '63820', 'rank': '545', 'state': 'Wisconsin'}, {'city': 'Conway', 'growth_from_2000_to_2013': '46.1%', 'latitude': 35.0886963, 'longitude': -92.4421011, 'population': '63816', 'rank': '546', 'state': 'Arkansas'}, {'city': 'Pico Rivera', 'growth_from_2000_to_2013': '0.4%', 'latitude': 33.9830688, 'longitude': -118.096735, 'population': '63771', 'rank': '547', 'state': 'California'}, {'city': 'Lorain', 'growth_from_2000_to_2013': '-7.2%', 'latitude': 41.452819, 'longitude': -82.1823746, 'population': '63710', 'rank': '548', 'state': 'Ohio'}, {'city': 'Montebello', 'growth_from_2000_to_2013': '2.0%', 'latitude': 34.0165053, 'longitude': -118.1137535, 'population': '63495', 'rank': '549', 'state': 'California'}, {'city': 'Lodi', 'growth_from_2000_to_2013': '10.1%', 'latitude': 38.1341477, 'longitude': -121.2722194, 'population': '63338', 'rank': '550', 'state': 'California'}, {'city': 'New Braunfels', 'growth_from_2000_to_2013': '64.0%', 'latitude': 29.7030024, 'longitude': -98.1244531, 'population': '63279', 'rank': '551', 'state': 'Texas'}, {'city': 'Marysville', 'growth_from_2000_to_2013': '115.7%', 'latitude': 48.0517637, 'longitude': -122.1770818, 'population': '63269', 'rank': '552', 'state': 'Washington'}, {'city': 'Tamarac', 'growth_from_2000_to_2013': '12.9%', 'latitude': 26.2128609, 'longitude': -80.2497707, 'population': '63155', 'rank': '553', 'state': 'Florida'}, {'city': 'Madera', 'growth_from_2000_to_2013': '44.4%', 'latitude': 36.9613356, 'longitude': -120.0607176, 'population': '63105', 'rank': '554', 'state': 'California'}, {'city': 'Conroe', 'growth_from_2000_to_2013': '61.9%', 'latitude': 30.3118769, 'longitude': -95.45605119999999, 'population': '63032', 'rank': '555', 'state': 'Texas'}, {'city': 'Santa Cruz', 'growth_from_2000_to_2013': '12.5%', 'latitude': 36.9741171, 'longitude': -122.0307963, 'population': '62864', 'rank': '556', 'state': 'California'}, {'city': 'Eden Prairie', 'growth_from_2000_to_2013': '13.3%', 'latitude': 44.8546856, 'longitude': -93.47078599999999, 'population': '62603', 'rank': '557', 'state': 'Minnesota'}, {'city': 'Cheyenne', 'growth_from_2000_to_2013': '16.9%', 'latitude': 41.1399814, 'longitude': -104.8202462, 'population': '62448', 'rank': '558', 'state': 'Wyoming'}, {'city': 'Daytona Beach', 'growth_from_2000_to_2013': '-2.3%', 'latitude': 29.2108147, 'longitude': -81.0228331, 'population': '62316', 'rank': '559', 'state': 'Florida'}, {'city': 'Alpharetta', 'growth_from_2000_to_2013': '33.6%', 'latitude': 34.0753762, 'longitude': -84.2940899, 'population': '62298', 'rank': '560', 'state': 'Georgia'}, {'city': 'Hamilton', 'growth_from_2000_to_2013': '2.7%', 'latitude': 39.3995008, 'longitude': -84.5613355, 'population': '62258', 'rank': '561', 'state': 'Ohio'}, {'city': 'Waltham', 'growth_from_2000_to_2013': '5.0%', 'latitude': 42.3764852, 'longitude': -71.2356113, 'population': '62227', 'rank': '562', 'state': 'Massachusetts'}, {'city': 'Coon Rapids', 'growth_from_2000_to_2013': '0.6%', 'latitude': 45.1732394, 'longitude': -93.30300629999999, 'population': '62103', 'rank': '563', 'state': 'Minnesota'}, {'city': 'Haverhill', 'growth_from_2000_to_2013': '5.0%', 'latitude': 42.7762015, 'longitude': -71.0772796, 'population': '62088', 'rank': '564', 'state': 'Massachusetts'}, {'city': 'Council Bluffs', 'growth_from_2000_to_2013': '6.2%', 'latitude': 41.2619444, 'longitude': -95.8608333, 'population': '61969', 'rank': '565', 'state': 'Iowa'}, {'city': 'Taylor', 'growth_from_2000_to_2013': '-6.3%', 'latitude': 42.240872, 'longitude': -83.2696509, 'population': '61817', 'rank': '566', 'state': 'Michigan'}, {'city': 'Utica', 'growth_from_2000_to_2013': '2.2%', 'latitude': 43.100903, 'longitude': -75.232664, 'population': '61808', 'rank': '567', 'state': 'New York'}, {'city': 'Ames', 'growth_from_2000_to_2013': '21.3%', 'latitude': 42.034722, 'longitude': -93.61999999999999, 'population': '61792', 'rank': '568', 'state': 'Iowa'}, {'city': 'La Habra', 'growth_from_2000_to_2013': '3.6%', 'latitude': 33.9319578, 'longitude': -117.9461734, 'population': '61653', 'rank': '569', 'state': 'California'}, {'city': 'Encinitas', 'growth_from_2000_to_2013': '5.8%', 'latitude': 33.0369867, 'longitude': -117.2919818, 'population': '61588', 'rank': '570', 'state': 'California'}, {'city': 'Bowling Green', 'growth_from_2000_to_2013': '24.1%', 'latitude': 36.9685219, 'longitude': -86.4808043, 'population': '61488', 'rank': '571', 'state': 'Kentucky'}, {'city': 'Burnsville', 'growth_from_2000_to_2013': '1.9%', 'latitude': 44.7677424, 'longitude': -93.27772259999999, 'population': '61434', 'rank': '572', 'state': 'Minnesota'}, {'city': 'Greenville', 'growth_from_2000_to_2013': '8.2%', 'latitude': 34.85261759999999, 'longitude': -82.3940104, 'population': '61397', 'rank': '573', 'state': 'South Carolina'}, {'city': 'West Des Moines', 'growth_from_2000_to_2013': '29.8%', 'latitude': 41.5772115, 'longitude': -93.711332, 'population': '61255', 'rank': '574', 'state': 'Iowa'}, {'city': 'Cedar Park', 'growth_from_2000_to_2013': '134.3%', 'latitude': 30.505198, 'longitude': -97.8202888, 'population': '61238', 'rank': '575', 'state': 'Texas'}, {'city': 'Tulare', 'growth_from_2000_to_2013': '33.3%', 'latitude': 36.2077288, 'longitude': -119.3473379, 'population': '61170', 'rank': '576', 'state': 'California'}, {'city': 'Monterey Park', 'growth_from_2000_to_2013': '1.5%', 'latitude': 34.0625106, 'longitude': -118.1228476, 'population': '61085', 'rank': '577', 'state': 'California'}, {'city': 'Vineland', 'growth_from_2000_to_2013': '9.3%', 'latitude': 39.4863773, 'longitude': -75.02596369999999, 'population': '61050', 'rank': '578', 'state': 'New Jersey'}, {'city': 'Terre Haute', 'growth_from_2000_to_2013': '2.5%', 'latitude': 39.4667034, 'longitude': -87.41390919999999, 'population': '61025', 'rank': '579', 'state': 'Indiana'}, {'city': 'North Miami', 'growth_from_2000_to_2013': '2.0%', 'latitude': 25.8900949, 'longitude': -80.1867138, 'population': '61007', 'rank': '580', 'state': 'Florida'}, {'city': 'Mansfield', 'growth_from_2000_to_2013': '114.2%', 'latitude': 32.5631924, 'longitude': -97.1416768, 'population': '60872', 'rank': '581', 'state': 'Texas'}, {'city': 'West Allis', 'growth_from_2000_to_2013': '-0.6%', 'latitude': 43.0166806, 'longitude': -88.0070315, 'population': '60697', 'rank': '582', 'state': 'Wisconsin'}, {'city': 'Bristol', 'growth_from_2000_to_2013': '0.4%', 'latitude': 41.67176480000001, 'longitude': -72.9492703, 'population': '60568', 'rank': '583', 'state': 'Connecticut'}, {'city': 'Taylorsville', 'growth_from_2000_to_2013': '2.9%', 'latitude': 40.66772479999999, 'longitude': -111.9388258, 'population': '60519', 'rank': '584', 'state': 'Utah'}, {'city': 'Malden', 'growth_from_2000_to_2013': '7.4%', 'latitude': 42.4250964, 'longitude': -71.066163, 'population': '60509', 'rank': '585', 'state': 'Massachusetts'}, {'city': 'Meriden', 'growth_from_2000_to_2013': '3.7%', 'latitude': 41.5381535, 'longitude': -72.80704349999999, 'population': '60456', 'rank': '586', 'state': 'Connecticut'}, {'city': 'Blaine', 'growth_from_2000_to_2013': '32.8%', 'latitude': 45.1607987, 'longitude': -93.23494889999999, 'population': '60407', 'rank': '587', 'state': 'Minnesota'}, {'city': 'Wellington', 'growth_from_2000_to_2013': '55.0%', 'latitude': 26.6617635, 'longitude': -80.2683571, 'population': '60202', 'rank': '588', 'state': 'Florida'}, {'city': 'Cupertino', 'growth_from_2000_to_2013': '14.3%', 'latitude': 37.3229978, 'longitude': -122.0321823, 'population': '60189', 'rank': '589', 'state': 'California'}, {'city': 'Springfield', 'growth_from_2000_to_2013': '12.4%', 'latitude': 44.0462362, 'longitude': -123.0220289, 'population': '60177', 'rank': '590', 'state': 'Oregon'}, {'city': 'Rogers', 'growth_from_2000_to_2013': '50.6%', 'latitude': 36.3320196, 'longitude': -94.1185366, 'population': '60112', 'rank': '591', 'state': 'Arkansas'}, {'city': 'St. Clair Shores', 'growth_from_2000_to_2013': '-4.6%', 'latitude': 42.4974085, 'longitude': -82.89636039999999, 'population': '60070', 'rank': '592', 'state': 'Michigan'}, {'city': 'Gardena', 'growth_from_2000_to_2013': '3.4%', 'latitude': 33.8883487, 'longitude': -118.3089624, 'population': '59957', 'rank': '593', 'state': 'California'}, {'city': 'Pontiac', 'growth_from_2000_to_2013': '-11.4%', 'latitude': 42.6389216, 'longitude': -83.29104679999999, 'population': '59887', 'rank': '594', 'state': 'Michigan'}, {'city': 'National City', 'growth_from_2000_to_2013': '10.1%', 'latitude': 32.6781085, 'longitude': -117.0991967, 'population': '59834', 'rank': '595', 'state': 'California'}, {'city': 'Grand Junction', 'growth_from_2000_to_2013': '30.9%', 'latitude': 39.0638705, 'longitude': -108.5506486, 'population': '59778', 'rank': '596', 'state': 'Colorado'}, {'city': 'Rocklin', 'growth_from_2000_to_2013': '60.3%', 'latitude': 38.7907339, 'longitude': -121.2357828, 'population': '59738', 'rank': '597', 'state': 'California'}, {'city': 'Chapel Hill', 'growth_from_2000_to_2013': '24.1%', 'latitude': 35.9131996, 'longitude': -79.0558445, 'population': '59635', 'rank': '598', 'state': 'North Carolina'}, {'city': 'Casper', 'growth_from_2000_to_2013': '19.9%', 'latitude': 42.866632, 'longitude': -106.313081, 'population': '59628', 'rank': '599', 'state': 'Wyoming'}, {'city': 'Broomfield', 'growth_from_2000_to_2013': '50.3%', 'latitude': 39.9205411, 'longitude': -105.0866504, 'population': '59471', 'rank': '600', 'state': 'Colorado'}, {'city': 'Petaluma', 'growth_from_2000_to_2013': '8.4%', 'latitude': 38.232417, 'longitude': -122.6366524, 'population': '59440', 'rank': '601', 'state': 'California'}, {'city': 'South Jordan', 'growth_from_2000_to_2013': '100.1%', 'latitude': 40.5621704, 'longitude': -111.929658, 'population': '59366', 'rank': '602', 'state': 'Utah'}, {'city': 'Springfield', 'growth_from_2000_to_2013': '-9.8%', 'latitude': 39.9242266, 'longitude': -83.8088171, 'population': '59357', 'rank': '603', 'state': 'Ohio'}, {'city': 'Great Falls', 'growth_from_2000_to_2013': '3.9%', 'latitude': 47.4941836, 'longitude': -111.2833449, 'population': '59351', 'rank': '604', 'state': 'Montana'}, {'city': 'Lancaster', 'growth_from_2000_to_2013': '4.5%', 'latitude': 40.0378755, 'longitude': -76.3055144, 'population': '59325', 'rank': '605', 'state': 'Pennsylvania'}, {'city': 'North Port', 'growth_from_2000_to_2013': '154.6%', 'latitude': 27.044224, 'longitude': -82.2359254, 'population': '59212', 'rank': '606', 'state': 'Florida'}, {'city': 'Lakewood', 'growth_from_2000_to_2013': '1.1%', 'latitude': 47.1717649, 'longitude': -122.518458, 'population': '59097', 'rank': '607', 'state': 'Washington'}, {'city': 'Marietta', 'growth_from_2000_to_2013': '-3.8%', 'latitude': 33.95260200000001, 'longitude': -84.5499327, 'population': '59089', 'rank': '608', 'state': 'Georgia'}, {'city': 'San Rafael', 'growth_from_2000_to_2013': '5.0%', 'latitude': 37.9735346, 'longitude': -122.5310874, 'population': '58994', 'rank': '609', 'state': 'California'}, {'city': 'Royal Oak', 'growth_from_2000_to_2013': '-1.7%', 'latitude': 42.4894801, 'longitude': -83.1446485, 'population': '58946', 'rank': '610', 'state': 'Michigan'}, {'city': 'Des Plaines', 'growth_from_2000_to_2013': '3.2%', 'latitude': 42.0333623, 'longitude': -87.88339909999999, 'population': '58918', 'rank': '611', 'state': 'Illinois'}, {'city': 'Huntington Park', 'growth_from_2000_to_2013': '-4.1%', 'latitude': 33.9816812, 'longitude': -118.2250725, 'population': '58879', 'rank': '612', 'state': 'California'}, {'city': 'La Mesa', 'growth_from_2000_to_2013': '6.9%', 'latitude': 32.7678287, 'longitude': -117.0230839, 'population': '58642', 'rank': '613', 'state': 'California'}, {'city': 'Orland Park', 'growth_from_2000_to_2013': '13.9%', 'latitude': 41.6303103, 'longitude': -87.85394250000002, 'population': '58590', 'rank': '614', 'state': 'Illinois'}, {'city': 'Auburn', 'growth_from_2000_to_2013': '26.4%', 'latitude': 32.6098566, 'longitude': -85.48078249999999, 'population': '58582', 'rank': '615', 'state': 'Alabama'}, {'city': 'Lakeville', 'growth_from_2000_to_2013': '34.3%', 'latitude': 44.6496868, 'longitude': -93.24271999999999, 'population': '58562', 'rank': '616', 'state': 'Minnesota'}, {'city': 'Owensboro', 'growth_from_2000_to_2013': '7.7%', 'latitude': 37.7719074, 'longitude': -87.1111676, 'population': '58416', 'rank': '617', 'state': 'Kentucky'}, {'city': 'Moore', 'growth_from_2000_to_2013': '41.5%', 'latitude': 35.3395079, 'longitude': -97.48670279999999, 'population': '58414', 'rank': '618', 'state': 'Oklahoma'}, {'city': 'Jupiter', 'growth_from_2000_to_2013': '46.2%', 'latitude': 26.9342246, 'longitude': -80.0942087, 'population': '58298', 'rank': '619', 'state': 'Florida'}, {'city': 'Idaho Falls', 'growth_from_2000_to_2013': '14.0%', 'latitude': 43.49165139999999, 'longitude': -112.0339645, 'population': '58292', 'rank': '620', 'state': 'Idaho'}, {'city': 'Dubuque', 'growth_from_2000_to_2013': '0.9%', 'latitude': 42.5005583, 'longitude': -90.66457179999999, 'population': '58253', 'rank': '621', 'state': 'Iowa'}, {'city': 'Bartlett', 'growth_from_2000_to_2013': '31.7%', 'latitude': 35.2045328, 'longitude': -89.8739753, 'population': '58226', 'rank': '622', 'state': 'Tennessee'}, {'city': 'Rowlett', 'growth_from_2000_to_2013': '28.6%', 'latitude': 32.9029017, 'longitude': -96.56388, 'population': '58043', 'rank': '623', 'state': 'Texas'}, {'city': 'Novi', 'growth_from_2000_to_2013': '22.0%', 'latitude': 42.48059, 'longitude': -83.4754913, 'population': '57960', 'rank': '624', 'state': 'Michigan'}, {'city': 'White Plains', 'growth_from_2000_to_2013': '8.5%', 'latitude': 41.03398620000001, 'longitude': -73.7629097, 'population': '57866', 'rank': '625', 'state': 'New York'}, {'city': 'Arcadia', 'growth_from_2000_to_2013': '8.3%', 'latitude': 34.1397292, 'longitude': -118.0353449, 'population': '57639', 'rank': '626', 'state': 'California'}, {'city': 'Redmond', 'growth_from_2000_to_2013': '26.0%', 'latitude': 47.6739881, 'longitude': -122.121512, 'population': '57530', 'rank': '627', 'state': 'Washington'}, {'city': 'Lake Elsinore', 'growth_from_2000_to_2013': '96.5%', 'latitude': 33.6680772, 'longitude': -117.3272615, 'population': '57525', 'rank': '628', 'state': 'California'}, {'city': 'Ocala', 'growth_from_2000_to_2013': '20.8%', 'latitude': 29.1871986, 'longitude': -82.14009229999999, 'population': '57468', 'rank': '629', 'state': 'Florida'}, {'city': 'Tinley Park', 'growth_from_2000_to_2013': '16.3%', 'latitude': 41.5731442, 'longitude': -87.7932939, 'population': '57282', 'rank': '630', 'state': 'Illinois'}, {'city': 'Port Orange', 'growth_from_2000_to_2013': '22.8%', 'latitude': 29.1383165, 'longitude': -80.9956105, 'population': '57203', 'rank': '631', 'state': 'Florida'}, {'city': 'Medford', 'growth_from_2000_to_2013': '2.7%', 'latitude': 42.4184296, 'longitude': -71.1061639, 'population': '57170', 'rank': '632', 'state': 'Massachusetts'}, {'city': 'Oak Lawn', 'growth_from_2000_to_2013': '3.3%', 'latitude': 41.719978, 'longitude': -87.7479528, 'population': '57073', 'rank': '633', 'state': 'Illinois'}, {'city': 'Rocky Mount', 'growth_from_2000_to_2013': '-3.1%', 'latitude': 35.9382103, 'longitude': -77.7905339, 'population': '56954', 'rank': '634', 'state': 'North Carolina'}, {'city': 'Kokomo', 'growth_from_2000_to_2013': '21.3%', 'latitude': 40.486427, 'longitude': -86.13360329999999, 'population': '56895', 'rank': '635', 'state': 'Indiana'}, {'city': 'Coconut Creek', 'growth_from_2000_to_2013': '28.4%', 'latitude': 26.2517482, 'longitude': -80.17893509999999, 'population': '56792', 'rank': '636', 'state': 'Florida'}, {'city': 'Bowie', 'growth_from_2000_to_2013': '8.6%', 'latitude': 39.0067768, 'longitude': -76.77913649999999, 'population': '56759', 'rank': '637', 'state': 'Maryland'}, {'city': 'Berwyn', 'growth_from_2000_to_2013': '5.1%', 'latitude': 41.85058739999999, 'longitude': -87.7936685, 'population': '56758', 'rank': '638', 'state': 'Illinois'}, {'city': 'Midwest City', 'growth_from_2000_to_2013': '4.5%', 'latitude': 35.4495065, 'longitude': -97.3967019, 'population': '56756', 'rank': '639', 'state': 'Oklahoma'}, {'city': 'Fountain Valley', 'growth_from_2000_to_2013': '3.0%', 'latitude': 33.7091847, 'longitude': -117.9536697, 'population': '56707', 'rank': '640', 'state': 'California'}, {'city': 'Buckeye', 'growth_from_2000_to_2013': '480.9%', 'latitude': 33.3703197, 'longitude': -112.5837766, 'population': '56683', 'rank': '641', 'state': 'Arizona'}, {'city': 'Dearborn Heights', 'growth_from_2000_to_2013': '-3.0%', 'latitude': 42.3369816, 'longitude': -83.27326269999999, 'population': '56620', 'rank': '642', 'state': 'Michigan'}, {'city': 'Woodland', 'growth_from_2000_to_2013': '13.8%', 'latitude': 38.67851570000001, 'longitude': -121.7732971, 'population': '56590', 'rank': '643', 'state': 'California'}, {'city': 'Noblesville', 'growth_from_2000_to_2013': '88.1%', 'latitude': 40.0455917, 'longitude': -86.0085955, 'population': '56540', 'rank': '644', 'state': 'Indiana'}, {'city': 'Valdosta', 'growth_from_2000_to_2013': '22.3%', 'latitude': 30.8327022, 'longitude': -83.2784851, 'population': '56481', 'rank': '645', 'state': 'Georgia'}, {'city': 'Diamond Bar', 'growth_from_2000_to_2013': '0.1%', 'latitude': 34.0286226, 'longitude': -117.8103367, 'population': '56449', 'rank': '646', 'state': 'California'}, {'city': 'Manhattan', 'growth_from_2000_to_2013': '22.8%', 'latitude': 39.18360819999999, 'longitude': -96.57166939999999, 'population': '56143', 'rank': '647', 'state': 'Kansas'}, {'city': 'Santee', 'growth_from_2000_to_2013': '5.7%', 'latitude': 32.8383828, 'longitude': -116.9739167, 'population': '56105', 'rank': '648', 'state': 'California'}, {'city': 'Taunton', 'growth_from_2000_to_2013': '0.0%', 'latitude': 41.900101, 'longitude': -71.0897674, 'population': '56069', 'rank': '649', 'state': 'Massachusetts'}, {'city': 'Sanford', 'growth_from_2000_to_2013': '42.8%', 'latitude': 28.8028612, 'longitude': -81.269453, 'population': '56002', 'rank': '650', 'state': 'Florida'}, {'city': 'Kettering', 'growth_from_2000_to_2013': '-3.1%', 'latitude': 39.68950359999999, 'longitude': -84.1688274, 'population': '55870', 'rank': '651', 'state': 'Ohio'}, {'city': 'New Brunswick', 'growth_from_2000_to_2013': '15.5%', 'latitude': 40.4862157, 'longitude': -74.4518188, 'population': '55831', 'rank': '652', 'state': 'New Jersey'}, {'city': 'Decatur', 'growth_from_2000_to_2013': '3.1%', 'latitude': 34.6059253, 'longitude': -86.9833417, 'population': '55816', 'rank': '653', 'state': 'Alabama'}, {'city': 'Chicopee', 'growth_from_2000_to_2013': '1.7%', 'latitude': 42.1487043, 'longitude': -72.6078672, 'population': '55717', 'rank': '654', 'state': 'Massachusetts'}, {'city': 'Anderson', 'growth_from_2000_to_2013': '-6.6%', 'latitude': 40.1053196, 'longitude': -85.6802541, 'population': '55670', 'rank': '655', 'state': 'Indiana'}, {'city': 'Margate', 'growth_from_2000_to_2013': '2.7%', 'latitude': 26.2445263, 'longitude': -80.206436, 'population': '55456', 'rank': '656', 'state': 'Florida'}, {'city': 'Weymouth Town', 'growth_from_2000_to_2013': '', 'latitude': 42.2180724, 'longitude': -70.94103559999999, 'population': '55419', 'rank': '657', 'state': 'Massachusetts'}, {'city': 'Hempstead', 'growth_from_2000_to_2013': '4.0%', 'latitude': 40.7062128, 'longitude': -73.6187397, 'population': '55361', 'rank': '658', 'state': 'New York'}, {'city': 'Corvallis', 'growth_from_2000_to_2013': '11.8%', 'latitude': 44.5645659, 'longitude': -123.2620435, 'population': '55298', 'rank': '659', 'state': 'Oregon'}, {'city': 'Eastvale', 'growth_from_2000_to_2013': '', 'latitude': 33.952463, 'longitude': -117.5848025, 'population': '55191', 'rank': '660', 'state': 'California'}, {'city': 'Porterville', 'growth_from_2000_to_2013': '20.1%', 'latitude': 36.06523, 'longitude': -119.0167679, 'population': '55174', 'rank': '661', 'state': 'California'}, {'city': 'West Haven', 'growth_from_2000_to_2013': '5.1%', 'latitude': 41.2705484, 'longitude': -72.9469711, 'population': '55046', 'rank': '662', 'state': 'Connecticut'}, {'city': 'Brentwood', 'growth_from_2000_to_2013': '122.3%', 'latitude': 37.931868, 'longitude': -121.6957863, 'population': '55000', 'rank': '663', 'state': 'California'}, {'city': 'Paramount', 'growth_from_2000_to_2013': '-0.7%', 'latitude': 33.8894598, 'longitude': -118.1597911, 'population': '54980', 'rank': '664', 'state': 'California'}, {'city': 'Grand Forks', 'growth_from_2000_to_2013': '11.5%', 'latitude': 47.9252568, 'longitude': -97.0328547, 'population': '54932', 'rank': '665', 'state': 'North Dakota'}, {'city': 'Georgetown', 'growth_from_2000_to_2013': '91.9%', 'latitude': 30.6332618, 'longitude': -97.6779842, 'population': '54898', 'rank': '666', 'state': 'Texas'}, {'city': 'St. Peters', 'growth_from_2000_to_2013': '6.5%', 'latitude': 38.7874699, 'longitude': -90.6298922, 'population': '54842', 'rank': '667', 'state': 'Missouri'}, {'city': 'Shoreline', 'growth_from_2000_to_2013': '2.9%', 'latitude': 47.7556531, 'longitude': -122.3415178, 'population': '54790', 'rank': '668', 'state': 'Washington'}, {'city': 'Mount Prospect', 'growth_from_2000_to_2013': '-2.5%', 'latitude': 42.0664167, 'longitude': -87.9372908, 'population': '54771', 'rank': '669', 'state': 'Illinois'}, {'city': 'Hanford', 'growth_from_2000_to_2013': '30.3%', 'latitude': 36.3274502, 'longitude': -119.6456844, 'population': '54686', 'rank': '670', 'state': 'California'}, {'city': 'Normal', 'growth_from_2000_to_2013': '19.7%', 'latitude': 40.5142026, 'longitude': -88.9906312, 'population': '54664', 'rank': '671', 'state': 'Illinois'}, {'city': 'Rosemead', 'growth_from_2000_to_2013': '1.7%', 'latitude': 34.0805651, 'longitude': -118.072846, 'population': '54561', 'rank': '672', 'state': 'California'}, {'city': 'Lehi', 'growth_from_2000_to_2013': '176.3%', 'latitude': 40.3916172, 'longitude': -111.8507662, 'population': '54382', 'rank': '673', 'state': 'Utah'}, {'city': 'Pocatello', 'growth_from_2000_to_2013': '5.4%', 'latitude': 42.8713032, 'longitude': -112.4455344, 'population': '54350', 'rank': '674', 'state': 'Idaho'}, {'city': 'Highland', 'growth_from_2000_to_2013': '21.0%', 'latitude': 34.1283442, 'longitude': -117.2086513, 'population': '54291', 'rank': '675', 'state': 'California'}, {'city': 'Novato', 'growth_from_2000_to_2013': '13.3%', 'latitude': 38.1074198, 'longitude': -122.5697032, 'population': '54194', 'rank': '676', 'state': 'California'}, {'city': 'Port Arthur', 'growth_from_2000_to_2013': '-6.0%', 'latitude': 29.8849504, 'longitude': -93.93994699999999, 'population': '54135', 'rank': '677', 'state': 'Texas'}, {'city': 'Carson City', 'growth_from_2000_to_2013': '2.9%', 'latitude': 39.1637984, 'longitude': -119.7674034, 'population': '54080', 'rank': '678', 'state': 'Nevada'}, {'city': 'San Marcos', 'growth_from_2000_to_2013': '48.5%', 'latitude': 29.8832749, 'longitude': -97.9413941, 'population': '54076', 'rank': '679', 'state': 'Texas'}, {'city': 'Hendersonville', 'growth_from_2000_to_2013': '31.7%', 'latitude': 36.3047735, 'longitude': -86.6199957, 'population': '54068', 'rank': '680', 'state': 'Tennessee'}, {'city': 'Elyria', 'growth_from_2000_to_2013': '-3.7%', 'latitude': 41.3683798, 'longitude': -82.10764859999999, 'population': '53956', 'rank': '681', 'state': 'Ohio'}, {'city': 'Revere', 'growth_from_2000_to_2013': '13.4%', 'latitude': 42.4084302, 'longitude': -71.0119948, 'population': '53756', 'rank': '682', 'state': 'Massachusetts'}, {'city': 'Pflugerville', 'growth_from_2000_to_2013': '123.4%', 'latitude': 30.4393696, 'longitude': -97.62000429999999, 'population': '53752', 'rank': '683', 'state': 'Texas'}, {'city': 'Greenwood', 'growth_from_2000_to_2013': '46.0%', 'latitude': 39.6136578, 'longitude': -86.10665259999999, 'population': '53665', 'rank': '684', 'state': 'Indiana'}, {'city': 'Bellevue', 'growth_from_2000_to_2013': '20.5%', 'latitude': 41.1543623, 'longitude': -95.9145568, 'population': '53663', 'rank': '685', 'state': 'Nebraska'}, {'city': 'Wheaton', 'growth_from_2000_to_2013': '-3.4%', 'latitude': 41.8661403, 'longitude': -88.1070127, 'population': '53648', 'rank': '686', 'state': 'Illinois'}, {'city': 'Smyrna', 'growth_from_2000_to_2013': '20.0%', 'latitude': 33.8839926, 'longitude': -84.51437609999999, 'population': '53438', 'rank': '687', 'state': 'Georgia'}, {'city': 'Sarasota', 'growth_from_2000_to_2013': '1.4%', 'latitude': 27.3364347, 'longitude': -82.53065269999999, 'population': '53326', 'rank': '688', 'state': 'Florida'}, {'city': 'Blue Springs', 'growth_from_2000_to_2013': '9.9%', 'latitude': 39.0169509, 'longitude': -94.2816148, 'population': '53294', 'rank': '689', 'state': 'Missouri'}, {'city': 'Colton', 'growth_from_2000_to_2013': '10.8%', 'latitude': 34.0739016, 'longitude': -117.3136547, 'population': '53243', 'rank': '690', 'state': 'California'}, {'city': 'Euless', 'growth_from_2000_to_2013': '15.1%', 'latitude': 32.8370727, 'longitude': -97.08195409999999, 'population': '53224', 'rank': '691', 'state': 'Texas'}, {'city': 'Castle Rock', 'growth_from_2000_to_2013': '153.5%', 'latitude': 39.3722121, 'longitude': -104.8560902, 'population': '53063', 'rank': '692', 'state': 'Colorado'}, {'city': 'Cathedral City', 'growth_from_2000_to_2013': '23.2%', 'latitude': 33.7805388, 'longitude': -116.4668036, 'population': '52977', 'rank': '693', 'state': 'California'}, {'city': 'Kingsport', 'growth_from_2000_to_2013': '16.7%', 'latitude': 36.548434, 'longitude': -82.5618186, 'population': '52962', 'rank': '694', 'state': 'Tennessee'}, {'city': 'Lake Havasu City', 'growth_from_2000_to_2013': '24.6%', 'latitude': 34.483901, 'longitude': -114.3224548, 'population': '52844', 'rank': '695', 'state': 'Arizona'}, {'city': 'Pensacola', 'growth_from_2000_to_2013': '-6.0%', 'latitude': 30.42130899999999, 'longitude': -87.2169149, 'population': '52703', 'rank': '696', 'state': 'Florida'}, {'city': 'Hoboken', 'growth_from_2000_to_2013': '35.8%', 'latitude': 40.7439905, 'longitude': -74.0323626, 'population': '52575', 'rank': '697', 'state': 'New Jersey'}, {'city': 'Yucaipa', 'growth_from_2000_to_2013': '26.8%', 'latitude': 34.033625, 'longitude': -117.0430865, 'population': '52536', 'rank': '698', 'state': 'California'}, {'city': 'Watsonville', 'growth_from_2000_to_2013': '12.7%', 'latitude': 36.910231, 'longitude': -121.7568946, 'population': '52477', 'rank': '699', 'state': 'California'}, {'city': 'Richland', 'growth_from_2000_to_2013': '34.6%', 'latitude': 46.2856907, 'longitude': -119.2844621, 'population': '52413', 'rank': '700', 'state': 'Washington'}, {'city': 'Delano', 'growth_from_2000_to_2013': '31.8%', 'latitude': 35.7688425, 'longitude': -119.2470536, 'population': '52403', 'rank': '701', 'state': 'California'}, {'city': 'Hoffman Estates', 'growth_from_2000_to_2013': '5.4%', 'latitude': 42.0629915, 'longitude': -88.12271989999999, 'population': '52398', 'rank': '702', 'state': 'Illinois'}, {'city': 'Florissant', 'growth_from_2000_to_2013': '-2.8%', 'latitude': 38.789217, 'longitude': -90.322614, 'population': '52363', 'rank': '703', 'state': 'Missouri'}, {'city': 'Placentia', 'growth_from_2000_to_2013': '11.8%', 'latitude': 33.8722371, 'longitude': -117.8703363, 'population': '52206', 'rank': '704', 'state': 'California'}, {'city': 'West New York', 'growth_from_2000_to_2013': '13.3%', 'latitude': 40.7878788, 'longitude': -74.0143064, 'population': '52122', 'rank': '705', 'state': 'New Jersey'}, {'city': 'Dublin', 'growth_from_2000_to_2013': '70.0%', 'latitude': 37.7021521, 'longitude': -121.9357918, 'population': '52105', 'rank': '706', 'state': 'California'}, {'city': 'Oak Park', 'growth_from_2000_to_2013': '-0.8%', 'latitude': 41.8850317, 'longitude': -87.7845025, 'population': '52066', 'rank': '707', 'state': 'Illinois'}, {'city': 'Peabody', 'growth_from_2000_to_2013': '7.5%', 'latitude': 42.5278731, 'longitude': -70.9286609, 'population': '52044', 'rank': '708', 'state': 'Massachusetts'}, {'city': 'Perth Amboy', 'growth_from_2000_to_2013': '9.7%', 'latitude': 40.5067723, 'longitude': -74.2654234, 'population': '51982', 'rank': '709', 'state': 'New Jersey'}, {'city': 'Battle Creek', 'growth_from_2000_to_2013': '-2.8%', 'latitude': 42.3211522, 'longitude': -85.17971419999999, 'population': '51848', 'rank': '710', 'state': 'Michigan'}, {'city': 'Bradenton', 'growth_from_2000_to_2013': '3.4%', 'latitude': 27.4989278, 'longitude': -82.5748194, 'population': '51763', 'rank': '711', 'state': 'Florida'}, {'city': 'Gilroy', 'growth_from_2000_to_2013': '23.9%', 'latitude': 37.0057816, 'longitude': -121.5682751, 'population': '51701', 'rank': '712', 'state': 'California'}, {'city': 'Milford', 'growth_from_2000_to_2013': '1.8%', 'latitude': 41.2306979, 'longitude': -73.064036, 'population': '51644', 'rank': '713', 'state': 'Connecticut'}, {'city': 'Albany', 'growth_from_2000_to_2013': '25.5%', 'latitude': 44.6365107, 'longitude': -123.1059282, 'population': '51583', 'rank': '714', 'state': 'Oregon'}, {'city': 'Ankeny', 'growth_from_2000_to_2013': '86.9%', 'latitude': 41.7317884, 'longitude': -93.6001278, 'population': '51567', 'rank': '715', 'state': 'Iowa'}, {'city': 'La Crosse', 'growth_from_2000_to_2013': '-0.8%', 'latitude': 43.8013556, 'longitude': -91.23958069999999, 'population': '51522', 'rank': '716', 'state': 'Wisconsin'}, {'city': 'Burlington', 'growth_from_2000_to_2013': '12.1%', 'latitude': 36.0956918, 'longitude': -79.43779909999999, 'population': '51510', 'rank': '717', 'state': 'North Carolina'}, {'city': 'DeSoto', 'growth_from_2000_to_2013': '36.0%', 'latitude': 32.5896998, 'longitude': -96.8570738, 'population': '51483', 'rank': '718', 'state': 'Texas'}, {'city': 'Harrisonburg', 'growth_from_2000_to_2013': '27.1%', 'latitude': 38.4495688, 'longitude': -78.8689155, 'population': '51395', 'rank': '719', 'state': 'Virginia'}, {'city': 'Minnetonka', 'growth_from_2000_to_2013': '0.4%', 'latitude': 44.9211836, 'longitude': -93.4687489, 'population': '51368', 'rank': '720', 'state': 'Minnesota'}, {'city': 'Elkhart', 'growth_from_2000_to_2013': '-2.5%', 'latitude': 41.6819935, 'longitude': -85.9766671, 'population': '51265', 'rank': '721', 'state': 'Indiana'}, {'city': 'Lakewood', 'growth_from_2000_to_2013': '-9.4%', 'latitude': 41.4819932, 'longitude': -81.7981908, 'population': '51143', 'rank': '722', 'state': 'Ohio'}, {'city': 'Glendora', 'growth_from_2000_to_2013': '3.1%', 'latitude': 34.1361187, 'longitude': -117.865339, 'population': '51074', 'rank': '723', 'state': 'California'}, {'city': 'Southaven', 'growth_from_2000_to_2013': '72.8%', 'latitude': 34.9889818, 'longitude': -90.0125913, 'population': '50997', 'rank': '724', 'state': 'Mississippi'}, {'city': 'Charleston', 'growth_from_2000_to_2013': '-4.7%', 'latitude': 38.3498195, 'longitude': -81.6326234, 'population': '50821', 'rank': '725', 'state': 'West Virginia'}, {'city': 'Joplin', 'growth_from_2000_to_2013': '11.2%', 'latitude': 37.08422710000001, 'longitude': -94.51328099999999, 'population': '50789', 'rank': '726', 'state': 'Missouri'}, {'city': 'Enid', 'growth_from_2000_to_2013': '8.1%', 'latitude': 36.3955891, 'longitude': -97.8783911, 'population': '50725', 'rank': '727', 'state': 'Oklahoma'}, {'city': 'Palm Beach Gardens', 'growth_from_2000_to_2013': '39.6%', 'latitude': 26.8233946, 'longitude': -80.13865469999999, 'population': '50699', 'rank': '728', 'state': 'Florida'}, {'city': 'Brookhaven', 'growth_from_2000_to_2013': '', 'latitude': 33.8651033, 'longitude': -84.3365917, 'population': '50603', 'rank': '729', 'state': 'Georgia'}, {'city': 'Plainfield', 'growth_from_2000_to_2013': '5.7%', 'latitude': 40.6337136, 'longitude': -74.4073736, 'population': '50588', 'rank': '730', 'state': 'New Jersey'}, {'city': 'Grand Island', 'growth_from_2000_to_2013': '16.0%', 'latitude': 40.9263957, 'longitude': -98.3420118, 'population': '50550', 'rank': '731', 'state': 'Nebraska'}, {'city': 'Palm Desert', 'growth_from_2000_to_2013': '13.2%', 'latitude': 33.7222445, 'longitude': -116.3744556, 'population': '50508', 'rank': '732', 'state': 'California'}, {'city': 'Huntersville', 'growth_from_2000_to_2013': '92.9%', 'latitude': 35.410694, 'longitude': -80.84285040000002, 'population': '50458', 'rank': '733', 'state': 'North Carolina'}, {'city': 'Tigard', 'growth_from_2000_to_2013': '17.8%', 'latitude': 45.4312294, 'longitude': -122.7714861, 'population': '50444', 'rank': '734', 'state': 'Oregon'}, {'city': 'Lenexa', 'growth_from_2000_to_2013': '24.6%', 'latitude': 38.9536174, 'longitude': -94.73357089999999, 'population': '50344', 'rank': '735', 'state': 'Kansas'}, {'city': 'Saginaw', 'growth_from_2000_to_2013': '-18.2%', 'latitude': 43.4194699, 'longitude': -83.9508068, 'population': '50303', 'rank': '736', 'state': 'Michigan'}, {'city': 'Kentwood', 'growth_from_2000_to_2013': '10.5%', 'latitude': 42.8694731, 'longitude': -85.64474919999999, 'population': '50233', 'rank': '737', 'state': 'Michigan'}, {'city': 'Doral', 'growth_from_2000_to_2013': '137.6%', 'latitude': 25.8195424, 'longitude': -80.3553302, 'population': '50213', 'rank': '738', 'state': 'Florida'}, {'city': 'Apple Valley', 'growth_from_2000_to_2013': '9.2%', 'latitude': 44.7319094, 'longitude': -93.21772000000001, 'population': '50201', 'rank': '739', 'state': 'Minnesota'}, {'city': 'Grapevine', 'growth_from_2000_to_2013': '17.6%', 'latitude': 32.9342919, 'longitude': -97.0780654, 'population': '50195', 'rank': '740', 'state': 'Texas'}, {'city': 'Aliso Viejo', 'growth_from_2000_to_2013': '25.4%', 'latitude': 33.5676842, 'longitude': -117.7256083, 'population': '50175', 'rank': '741', 'state': 'California'}, {'city': 'Sammamish', 'growth_from_2000_to_2013': '44.1%', 'latitude': 47.61626829999999, 'longitude': -122.0355736, 'population': '50169', 'rank': '742', 'state': 'Washington'}, {'city': 'Casa Grande', 'growth_from_2000_to_2013': '86.0%', 'latitude': 32.8795022, 'longitude': -111.7573521, 'population': '50111', 'rank': '743', 'state': 'Arizona'}, {'city': 'Pinellas Park', 'growth_from_2000_to_2013': '5.9%', 'latitude': 27.8428025, 'longitude': -82.6995443, 'population': '49998', 'rank': '744', 'state': 'Florida'}, {'city': 'Troy', 'growth_from_2000_to_2013': '1.5%', 'latitude': 42.7284117, 'longitude': -73.69178509999999, 'population': '49974', 'rank': '745', 'state': 'New York'}, {'city': 'West Sacramento', 'growth_from_2000_to_2013': '55.6%', 'latitude': 38.5804609, 'longitude': -121.530234, 'population': '49891', 'rank': '746', 'state': 'California'}, {'city': 'Burien', 'growth_from_2000_to_2013': '56.7%', 'latitude': 47.4703767, 'longitude': -122.3467918, 'population': '49858', 'rank': '747', 'state': 'Washington'}, {'city': 'Commerce City', 'growth_from_2000_to_2013': '135.4%', 'latitude': 39.8083196, 'longitude': -104.9338675, 'population': '49799', 'rank': '748', 'state': 'Colorado'}, {'city': 'Monroe', 'growth_from_2000_to_2013': '-6.1%', 'latitude': 32.5093109, 'longitude': -92.1193012, 'population': '49761', 'rank': '749', 'state': 'Louisiana'}, {'city': 'Cerritos', 'growth_from_2000_to_2013': '-3.6%', 'latitude': 33.8583483, 'longitude': -118.0647871, 'population': '49707', 'rank': '750', 'state': 'California'}, {'city': 'Downers Grove', 'growth_from_2000_to_2013': '0.0%', 'latitude': 41.8089191, 'longitude': -88.01117459999999, 'population': '49670', 'rank': '751', 'state': 'Illinois'}, {'city': 'Coral Gables', 'growth_from_2000_to_2013': '16.1%', 'latitude': 25.72149, 'longitude': -80.2683838, 'population': '49631', 'rank': '752', 'state': 'Florida'}, {'city': 'Wilson', 'growth_from_2000_to_2013': '10.1%', 'latitude': 35.7212689, 'longitude': -77.9155395, 'population': '49628', 'rank': '753', 'state': 'North Carolina'}, {'city': 'Niagara Falls', 'growth_from_2000_to_2013': '-10.8%', 'latitude': 43.0962143, 'longitude': -79.0377388, 'population': '49468', 'rank': '754', 'state': 'New York'}, {'city': 'Poway', 'growth_from_2000_to_2013': '2.4%', 'latitude': 32.9628232, 'longitude': -117.0358646, 'population': '49417', 'rank': '755', 'state': 'California'}, {'city': 'Edina', 'growth_from_2000_to_2013': '4.1%', 'latitude': 44.8896866, 'longitude': -93.3499489, 'population': '49376', 'rank': '756', 'state': 'Minnesota'}, {'city': 'Cuyahoga Falls', 'growth_from_2000_to_2013': '-0.2%', 'latitude': 41.1339449, 'longitude': -81.48455849999999, 'population': '49267', 'rank': '757', 'state': 'Ohio'}, {'city': 'Rancho Santa Margarita', 'growth_from_2000_to_2013': '4.6%', 'latitude': 33.640855, 'longitude': -117.603104, 'population': '49228', 'rank': '758', 'state': 'California'}, {'city': 'Harrisburg', 'growth_from_2000_to_2013': '0.6%', 'latitude': 40.2731911, 'longitude': -76.8867008, 'population': '49188', 'rank': '759', 'state': 'Pennsylvania'}, {'city': 'Huntington', 'growth_from_2000_to_2013': '-5.0%', 'latitude': 38.4192496, 'longitude': -82.44515400000002, 'population': '49177', 'rank': '760', 'state': 'West Virginia'}, {'city': 'La Mirada', 'growth_from_2000_to_2013': '4.6%', 'latitude': 33.9172357, 'longitude': -118.0120086, 'population': '49133', 'rank': '761', 'state': 'California'}, {'city': 'Cypress', 'growth_from_2000_to_2013': '5.3%', 'latitude': 33.8169599, 'longitude': -118.0372852, 'population': '49087', 'rank': '762', 'state': 'California'}, {'city': 'Caldwell', 'growth_from_2000_to_2013': '77.1%', 'latitude': 43.66293839999999, 'longitude': -116.6873596, 'population': '48957', 'rank': '763', 'state': 'Idaho'}, {'city': 'Logan', 'growth_from_2000_to_2013': '14.5%', 'latitude': 41.7369803, 'longitude': -111.8338359, 'population': '48913', 'rank': '764', 'state': 'Utah'}, {'city': 'Galveston', 'growth_from_2000_to_2013': '-15.2%', 'latitude': 29.3013479, 'longitude': -94.7976958, 'population': '48733', 'rank': '765', 'state': 'Texas'}, {'city': 'Sheboygan', 'growth_from_2000_to_2013': '-3.9%', 'latitude': 43.7508284, 'longitude': -87.71453, 'population': '48725', 'rank': '766', 'state': 'Wisconsin'}, {'city': 'Middletown', 'growth_from_2000_to_2013': '-5.7%', 'latitude': 39.5150576, 'longitude': -84.39827629999999, 'population': '48630', 'rank': '767', 'state': 'Ohio'}, {'city': 'Murray', 'growth_from_2000_to_2013': '6.6%', 'latitude': 40.6668916, 'longitude': -111.8879909, 'population': '48612', 'rank': '768', 'state': 'Utah'}, {'city': 'Roswell', 'growth_from_2000_to_2013': '7.5%', 'latitude': 33.3942655, 'longitude': -104.5230242, 'population': '48611', 'rank': '769', 'state': 'New Mexico'}, {'city': 'Parker', 'growth_from_2000_to_2013': '96.4%', 'latitude': 39.5186002, 'longitude': -104.7613633, 'population': '48608', 'rank': '770', 'state': 'Colorado'}, {'city': 'Bedford', 'growth_from_2000_to_2013': '2.9%', 'latitude': 32.844017, 'longitude': -97.1430671, 'population': '48592', 'rank': '771', 'state': 'Texas'}, {'city': 'East Lansing', 'growth_from_2000_to_2013': '4.2%', 'latitude': 42.7369792, 'longitude': -84.48386540000001, 'population': '48554', 'rank': '772', 'state': 'Michigan'}, {'city': 'Methuen', 'growth_from_2000_to_2013': '10.3%', 'latitude': 42.7262016, 'longitude': -71.1908924, 'population': '48514', 'rank': '773', 'state': 'Massachusetts'}, {'city': 'Covina', 'growth_from_2000_to_2013': '3.3%', 'latitude': 34.0900091, 'longitude': -117.8903397, 'population': '48508', 'rank': '774', 'state': 'California'}, {'city': 'Alexandria', 'growth_from_2000_to_2013': '4.1%', 'latitude': 31.3112936, 'longitude': -92.4451371, 'population': '48426', 'rank': '775', 'state': 'Louisiana'}, {'city': 'Olympia', 'growth_from_2000_to_2013': '12.1%', 'latitude': 47.0378741, 'longitude': -122.9006951, 'population': '48338', 'rank': '776', 'state': 'Washington'}, {'city': 'Euclid', 'growth_from_2000_to_2013': '-8.4%', 'latitude': 41.5931049, 'longitude': -81.5267873, 'population': '48139', 'rank': '777', 'state': 'Ohio'}, {'city': 'Mishawaka', 'growth_from_2000_to_2013': '2.0%', 'latitude': 41.6619927, 'longitude': -86.15861559999999, 'population': '47989', 'rank': '778', 'state': 'Indiana'}, {'city': 'Salina', 'growth_from_2000_to_2013': '4.5%', 'latitude': 38.8402805, 'longitude': -97.61142369999999, 'population': '47846', 'rank': '779', 'state': 'Kansas'}, {'city': 'Azusa', 'growth_from_2000_to_2013': '6.7%', 'latitude': 34.1336186, 'longitude': -117.9075627, 'population': '47842', 'rank': '780', 'state': 'California'}, {'city': 'Newark', 'growth_from_2000_to_2013': '3.1%', 'latitude': 40.0581205, 'longitude': -82.4012642, 'population': '47777', 'rank': '781', 'state': 'Ohio'}, {'city': 'Chesterfield', 'growth_from_2000_to_2013': '1.9%', 'latitude': 38.6631083, 'longitude': -90.5770675, 'population': '47749', 'rank': '782', 'state': 'Missouri'}, {'city': 'Leesburg', 'growth_from_2000_to_2013': '66.0%', 'latitude': 39.1156615, 'longitude': -77.56360149999999, 'population': '47673', 'rank': '783', 'state': 'Virginia'}, {'city': 'Dunwoody', 'growth_from_2000_to_2013': '', 'latitude': 33.9462125, 'longitude': -84.3346473, 'population': '47591', 'rank': '784', 'state': 'Georgia'}, {'city': 'Hattiesburg', 'growth_from_2000_to_2013': '3.1%', 'latitude': 31.3271189, 'longitude': -89.29033919999999, 'population': '47556', 'rank': '785', 'state': 'Mississippi'}, {'city': 'Roseville', 'growth_from_2000_to_2013': '-1.0%', 'latitude': 42.4972583, 'longitude': -82.9371409, 'population': '47555', 'rank': '786', 'state': 'Michigan'}, {'city': 'Bonita Springs', 'growth_from_2000_to_2013': '43.8%', 'latitude': 26.339806, 'longitude': -81.7786972, 'population': '47547', 'rank': '787', 'state': 'Florida'}, {'city': 'Portage', 'growth_from_2000_to_2013': '5.7%', 'latitude': 42.2011538, 'longitude': -85.5800022, 'population': '47523', 'rank': '788', 'state': 'Michigan'}, {'city': 'St. Louis Park', 'growth_from_2000_to_2013': '7.3%', 'latitude': 44.9597376, 'longitude': -93.3702186, 'population': '47411', 'rank': '789', 'state': 'Minnesota'}, {'city': 'Collierville', 'growth_from_2000_to_2013': '43.4%', 'latitude': 35.042036, 'longitude': -89.6645266, 'population': '47333', 'rank': '790', 'state': 'Tennessee'}, {'city': 'Middletown', 'growth_from_2000_to_2013': '3.6%', 'latitude': 41.5623209, 'longitude': -72.6506488, 'population': '47333', 'rank': '791', 'state': 'Connecticut'}, {'city': 'Stillwater', 'growth_from_2000_to_2013': '20.1%', 'latitude': 36.1156071, 'longitude': -97.0583681, 'population': '47186', 'rank': '792', 'state': 'Oklahoma'}, {'city': 'East Providence', 'growth_from_2000_to_2013': '-3.3%', 'latitude': 41.8137116, 'longitude': -71.3700545, 'population': '47149', 'rank': '793', 'state': 'Rhode Island'}, {'city': 'Lawrence', 'growth_from_2000_to_2013': '20.5%', 'latitude': 39.8386516, 'longitude': -86.0252612, 'population': '47135', 'rank': '794', 'state': 'Indiana'}, {'city': 'Wauwatosa', 'growth_from_2000_to_2013': '0.0%', 'latitude': 43.0494572, 'longitude': -88.0075875, 'population': '47134', 'rank': '795', 'state': 'Wisconsin'}, {'city': 'Mentor', 'growth_from_2000_to_2013': '-6.6%', 'latitude': 41.6661573, 'longitude': -81.339552, 'population': '46979', 'rank': '796', 'state': 'Ohio'}, {'city': 'Ceres', 'growth_from_2000_to_2013': '34.0%', 'latitude': 37.5949316, 'longitude': -120.9577098, 'population': '46714', 'rank': '797', 'state': 'California'}, {'city': 'Cedar Hill', 'growth_from_2000_to_2013': '42.4%', 'latitude': 32.5884689, 'longitude': -96.9561152, 'population': '46663', 'rank': '798', 'state': 'Texas'}, {'city': 'Mansfield', 'growth_from_2000_to_2013': '-10.1%', 'latitude': 40.75839, 'longitude': -82.5154471, 'population': '46454', 'rank': '799', 'state': 'Ohio'}, {'city': 'Binghamton', 'growth_from_2000_to_2013': '-1.7%', 'latitude': 42.09868669999999, 'longitude': -75.91797380000001, 'population': '46444', 'rank': '800', 'state': 'New York'}, {'city': "Coeur d'Alene", 'growth_from_2000_to_2013': '32.8%', 'latitude': 47.6776832, 'longitude': -116.7804664, 'population': '46402', 'rank': '801', 'state': 'Idaho'}, {'city': 'San Luis Obispo', 'growth_from_2000_to_2013': '4.4%', 'latitude': 35.2827524, 'longitude': -120.6596156, 'population': '46377', 'rank': '802', 'state': 'California'}, {'city': 'Minot', 'growth_from_2000_to_2013': '26.6%', 'latitude': 48.2329668, 'longitude': -101.2922906, 'population': '46321', 'rank': '803', 'state': 'North Dakota'}, {'city': 'Palm Springs', 'growth_from_2000_to_2013': '7.7%', 'latitude': 33.8302961, 'longitude': -116.5452921, 'population': '46281', 'rank': '804', 'state': 'California'}, {'city': 'Pine Bluff', 'growth_from_2000_to_2013': '-16.2%', 'latitude': 34.2284312, 'longitude': -92.00319549999999, 'population': '46094', 'rank': '805', 'state': 'Arkansas'}, {'city': 'Texas City', 'growth_from_2000_to_2013': '10.3%', 'latitude': 29.383845, 'longitude': -94.9027002, 'population': '46081', 'rank': '806', 'state': 'Texas'}, {'city': 'Summerville', 'growth_from_2000_to_2013': '62.9%', 'latitude': 33.0185039, 'longitude': -80.17564809999999, 'population': '46074', 'rank': '807', 'state': 'South Carolina'}, {'city': 'Twin Falls', 'growth_from_2000_to_2013': '31.5%', 'latitude': 42.5629668, 'longitude': -114.4608711, 'population': '45981', 'rank': '808', 'state': 'Idaho'}, {'city': 'Jeffersonville', 'growth_from_2000_to_2013': '53.3%', 'latitude': 38.2775702, 'longitude': -85.7371847, 'population': '45929', 'rank': '809', 'state': 'Indiana'}, {'city': 'San Jacinto', 'growth_from_2000_to_2013': '91.8%', 'latitude': 33.7839084, 'longitude': -116.958635, 'population': '45851', 'rank': '810', 'state': 'California'}, {'city': 'Madison', 'growth_from_2000_to_2013': '53.7%', 'latitude': 34.6992579, 'longitude': -86.74833180000002, 'population': '45799', 'rank': '811', 'state': 'Alabama'}, {'city': 'Altoona', 'growth_from_2000_to_2013': '-7.3%', 'latitude': 40.5186809, 'longitude': -78.3947359, 'population': '45796', 'rank': '812', 'state': 'Pennsylvania'}, {'city': 'Columbus', 'growth_from_2000_to_2013': '16.4%', 'latitude': 39.2014404, 'longitude': -85.9213796, 'population': '45775', 'rank': '813', 'state': 'Indiana'}, {'city': 'Beavercreek', 'growth_from_2000_to_2013': '19.0%', 'latitude': 39.7092262, 'longitude': -84.06326849999999, 'population': '45712', 'rank': '814', 'state': 'Ohio'}, {'city': 'Apopka', 'growth_from_2000_to_2013': '63.9%', 'latitude': 28.6934076, 'longitude': -81.5322149, 'population': '45587', 'rank': '815', 'state': 'Florida'}, {'city': 'Elmhurst', 'growth_from_2000_to_2013': '5.7%', 'latitude': 41.8994744, 'longitude': -87.9403418, 'population': '45556', 'rank': '816', 'state': 'Illinois'}, {'city': 'Maricopa', 'growth_from_2000_to_2013': '2503.4%', 'latitude': 33.0581063, 'longitude': -112.0476423, 'population': '45508', 'rank': '817', 'state': 'Arizona'}, {'city': 'Farmington', 'growth_from_2000_to_2013': '18.1%', 'latitude': 36.72805830000001, 'longitude': -108.2186856, 'population': '45426', 'rank': '818', 'state': 'New Mexico'}, {'city': 'Glenview', 'growth_from_2000_to_2013': '5.2%', 'latitude': 42.0697509, 'longitude': -87.7878408, 'population': '45417', 'rank': '819', 'state': 'Illinois'}, {'city': 'Cleveland Heights', 'growth_from_2000_to_2013': '-10.3%', 'latitude': 41.5200518, 'longitude': -81.556235, 'population': '45394', 'rank': '820', 'state': 'Ohio'}, {'city': 'Draper', 'growth_from_2000_to_2013': '77.4%', 'latitude': 40.5246711, 'longitude': -111.8638226, 'population': '45285', 'rank': '821', 'state': 'Utah'}, {'city': 'Lincoln', 'growth_from_2000_to_2013': '285.2%', 'latitude': 38.891565, 'longitude': -121.2930079, 'population': '45237', 'rank': '822', 'state': 'California'}, {'city': 'Sierra Vista', 'growth_from_2000_to_2013': '19.3%', 'latitude': 31.5455001, 'longitude': -110.2772856, 'population': '45129', 'rank': '823', 'state': 'Arizona'}, {'city': 'Lacey', 'growth_from_2000_to_2013': '41.7%', 'latitude': 47.03426289999999, 'longitude': -122.8231915, 'population': '44919', 'rank': '824', 'state': 'Washington'}, {'city': 'Biloxi', 'growth_from_2000_to_2013': '-11.5%', 'latitude': 30.3960318, 'longitude': -88.88530779999999, 'population': '44820', 'rank': '825', 'state': 'Mississippi'}, {'city': 'Strongsville', 'growth_from_2000_to_2013': '1.9%', 'latitude': 41.3144966, 'longitude': -81.83569, 'population': '44730', 'rank': '826', 'state': 'Ohio'}, {'city': 'Barnstable Town', 'growth_from_2000_to_2013': '-7.1%', 'latitude': 41.7003208, 'longitude': -70.3002024, 'population': '44641', 'rank': '827', 'state': 'Massachusetts'}, {'city': 'Wylie', 'growth_from_2000_to_2013': '185.2%', 'latitude': 33.0151201, 'longitude': -96.5388789, 'population': '44575', 'rank': '828', 'state': 'Texas'}, {'city': 'Sayreville', 'growth_from_2000_to_2013': '9.6%', 'latitude': 40.45940210000001, 'longitude': -74.360846, 'population': '44412', 'rank': '829', 'state': 'New Jersey'}, {'city': 'Kannapolis', 'growth_from_2000_to_2013': '18.6%', 'latitude': 35.4873613, 'longitude': -80.6217341, 'population': '44359', 'rank': '830', 'state': 'North Carolina'}, {'city': 'Charlottesville', 'growth_from_2000_to_2013': '10.5%', 'latitude': 38.0293059, 'longitude': -78.47667810000002, 'population': '44349', 'rank': '831', 'state': 'Virginia'}, {'city': 'Littleton', 'growth_from_2000_to_2013': '9.4%', 'latitude': 39.613321, 'longitude': -105.0166498, 'population': '44275', 'rank': '832', 'state': 'Colorado'}, {'city': 'Titusville', 'growth_from_2000_to_2013': '7.8%', 'latitude': 28.6122187, 'longitude': -80.8075537, 'population': '44206', 'rank': '833', 'state': 'Florida'}, {'city': 'Hackensack', 'growth_from_2000_to_2013': '2.9%', 'latitude': 40.8859325, 'longitude': -74.0434736, 'population': '44113', 'rank': '834', 'state': 'New Jersey'}, {'city': 'Newark', 'growth_from_2000_to_2013': '3.3%', 'latitude': 37.5296593, 'longitude': -122.0402399, 'population': '44096', 'rank': '835', 'state': 'California'}, {'city': 'Pittsfield', 'growth_from_2000_to_2013': '-3.6%', 'latitude': 42.4500845, 'longitude': -73.2453824, 'population': '44057', 'rank': '836', 'state': 'Massachusetts'}, {'city': 'York', 'growth_from_2000_to_2013': '6.4%', 'latitude': 39.9625984, 'longitude': -76.727745, 'population': '43935', 'rank': '837', 'state': 'Pennsylvania'}, {'city': 'Lombard', 'growth_from_2000_to_2013': '2.9%', 'latitude': 41.8800296, 'longitude': -88.00784349999999, 'population': '43907', 'rank': '838', 'state': 'Illinois'}, {'city': 'Attleboro', 'growth_from_2000_to_2013': '4.6%', 'latitude': 41.94454409999999, 'longitude': -71.2856082, 'population': '43886', 'rank': '839', 'state': 'Massachusetts'}, {'city': 'DeKalb', 'growth_from_2000_to_2013': '11.8%', 'latitude': 41.9294736, 'longitude': -88.75036469999999, 'population': '43849', 'rank': '840', 'state': 'Illinois'}, {'city': 'Blacksburg', 'growth_from_2000_to_2013': '9.4%', 'latitude': 37.2295733, 'longitude': -80.4139393, 'population': '43609', 'rank': '841', 'state': 'Virginia'}, {'city': 'Dublin', 'growth_from_2000_to_2013': '37.6%', 'latitude': 40.0992294, 'longitude': -83.1140771, 'population': '43607', 'rank': '842', 'state': 'Ohio'}, {'city': 'Haltom City', 'growth_from_2000_to_2013': '11.4%', 'latitude': 32.7995738, 'longitude': -97.26918169999999, 'population': '43580', 'rank': '843', 'state': 'Texas'}, {'city': 'Lompoc', 'growth_from_2000_to_2013': '5.5%', 'latitude': 34.6391501, 'longitude': -120.4579409, 'population': '43509', 'rank': '844', 'state': 'California'}, {'city': 'El Centro', 'growth_from_2000_to_2013': '13.7%', 'latitude': 32.792, 'longitude': -115.5630514, 'population': '43363', 'rank': '845', 'state': 'California'}, {'city': 'Danville', 'growth_from_2000_to_2013': '3.7%', 'latitude': 37.8215929, 'longitude': -121.9999606, 'population': '43341', 'rank': '846', 'state': 'California'}, {'city': 'Jefferson City', 'growth_from_2000_to_2013': '6.7%', 'latitude': 38.57670170000001, 'longitude': -92.1735164, 'population': '43330', 'rank': '847', 'state': 'Missouri'}, {'city': 'Cutler Bay', 'growth_from_2000_to_2013': '42.9%', 'latitude': 25.5808323, 'longitude': -80.34685929999999, 'population': '43328', 'rank': '848', 'state': 'Florida'}, {'city': 'Oakland Park', 'growth_from_2000_to_2013': '2.7%', 'latitude': 26.1723065, 'longitude': -80.1319893, 'population': '43286', 'rank': '849', 'state': 'Florida'}, {'city': 'North Miami Beach', 'growth_from_2000_to_2013': '3.6%', 'latitude': 25.9331488, 'longitude': -80.1625463, 'population': '43250', 'rank': '850', 'state': 'Florida'}, {'city': 'Freeport', 'growth_from_2000_to_2013': '-1.4%', 'latitude': 40.6576022, 'longitude': -73.58318349999999, 'population': '43167', 'rank': '851', 'state': 'New York'}, {'city': 'Moline', 'growth_from_2000_to_2013': '-1.9%', 'latitude': 41.5067003, 'longitude': -90.51513419999999, 'population': '43116', 'rank': '852', 'state': 'Illinois'}, {'city': 'Coachella', 'growth_from_2000_to_2013': '88.4%', 'latitude': 33.6803003, 'longitude': -116.173894, 'population': '43092', 'rank': '853', 'state': 'California'}, {'city': 'Fort Pierce', 'growth_from_2000_to_2013': '6.9%', 'latitude': 27.4467056, 'longitude': -80.3256056, 'population': '43074', 'rank': '854', 'state': 'Florida'}, {'city': 'Smyrna', 'growth_from_2000_to_2013': '54.9%', 'latitude': 35.9828412, 'longitude': -86.5186045, 'population': '43060', 'rank': '855', 'state': 'Tennessee'}, {'city': 'Bountiful', 'growth_from_2000_to_2013': '3.9%', 'latitude': 40.8893895, 'longitude': -111.880771, 'population': '43023', 'rank': '856', 'state': 'Utah'}, {'city': 'Fond du Lac', 'growth_from_2000_to_2013': '1.7%', 'latitude': 43.7730448, 'longitude': -88.4470508, 'population': '42970', 'rank': '857', 'state': 'Wisconsin'}, {'city': 'Everett', 'growth_from_2000_to_2013': '12.1%', 'latitude': 42.40843, 'longitude': -71.0536625, 'population': '42935', 'rank': '858', 'state': 'Massachusetts'}, {'city': 'Danville', 'growth_from_2000_to_2013': '-11.0%', 'latitude': 36.5859718, 'longitude': -79.39502279999999, 'population': '42907', 'rank': '859', 'state': 'Virginia'}, {'city': 'Keller', 'growth_from_2000_to_2013': '53.3%', 'latitude': 32.9341893, 'longitude': -97.229298, 'population': '42907', 'rank': '860', 'state': 'Texas'}, {'city': 'Belleville', 'growth_from_2000_to_2013': '1.2%', 'latitude': 38.5200504, 'longitude': -89.9839935, 'population': '42895', 'rank': '861', 'state': 'Illinois'}, {'city': 'Bell Gardens', 'growth_from_2000_to_2013': '-2.7%', 'latitude': 33.9652918, 'longitude': -118.1514588, 'population': '42889', 'rank': '862', 'state': 'California'}, {'city': 'Cleveland', 'growth_from_2000_to_2013': '14.1%', 'latitude': 35.1595182, 'longitude': -84.8766115, 'population': '42774', 'rank': '863', 'state': 'Tennessee'}, {'city': 'North Lauderdale', 'growth_from_2000_to_2013': '10.8%', 'latitude': 26.217305, 'longitude': -80.2258811, 'population': '42757', 'rank': '864', 'state': 'Florida'}, {'city': 'Fairfield', 'growth_from_2000_to_2013': '1.2%', 'latitude': 39.3454673, 'longitude': -84.5603187, 'population': '42635', 'rank': '865', 'state': 'Ohio'}, {'city': 'Salem', 'growth_from_2000_to_2013': '5.1%', 'latitude': 42.51954, 'longitude': -70.8967155, 'population': '42544', 'rank': '866', 'state': 'Massachusetts'}, {'city': 'Rancho Palos Verdes', 'growth_from_2000_to_2013': '2.9%', 'latitude': 33.7444613, 'longitude': -118.3870173, 'population': '42448', 'rank': '867', 'state': 'California'}, {'city': 'San Bruno', 'growth_from_2000_to_2013': '5.6%', 'latitude': 37.6304904, 'longitude': -122.4110835, 'population': '42443', 'rank': '868', 'state': 'California'}, {'city': 'Concord', 'growth_from_2000_to_2013': '4.1%', 'latitude': 43.2081366, 'longitude': -71.5375718, 'population': '42419', 'rank': '869', 'state': 'New Hampshire'}, {'city': 'Burlington', 'growth_from_2000_to_2013': '6.1%', 'latitude': 44.4758825, 'longitude': -73.21207199999999, 'population': '42284', 'rank': '870', 'state': 'Vermont'}, {'city': 'Apex', 'growth_from_2000_to_2013': '98.8%', 'latitude': 35.732652, 'longitude': -78.85028559999999, 'population': '42214', 'rank': '871', 'state': 'North Carolina'}, {'city': 'Midland', 'growth_from_2000_to_2013': '0.9%', 'latitude': 43.6155825, 'longitude': -84.2472116, 'population': '42181', 'rank': '872', 'state': 'Michigan'}, {'city': 'Altamonte Springs', 'growth_from_2000_to_2013': '2.0%', 'latitude': 28.6611089, 'longitude': -81.3656242, 'population': '42150', 'rank': '873', 'state': 'Florida'}, {'city': 'Hutchinson', 'growth_from_2000_to_2013': '0.1%', 'latitude': 38.0608445, 'longitude': -97.92977429999999, 'population': '41889', 'rank': '874', 'state': 'Kansas'}, {'city': 'Buffalo Grove', 'growth_from_2000_to_2013': '-3.4%', 'latitude': 42.1662831, 'longitude': -87.9631308, 'population': '41778', 'rank': '875', 'state': 'Illinois'}, {'city': 'Urbandale', 'growth_from_2000_to_2013': '41.5%', 'latitude': 41.6266555, 'longitude': -93.71216559999999, 'population': '41776', 'rank': '876', 'state': 'Iowa'}, {'city': 'State College', 'growth_from_2000_to_2013': '8.7%', 'latitude': 40.7933949, 'longitude': -77.8600012, 'population': '41757', 'rank': '877', 'state': 'Pennsylvania'}, {'city': 'Urbana', 'growth_from_2000_to_2013': '10.3%', 'latitude': 40.1105875, 'longitude': -88.2072697, 'population': '41752', 'rank': '878', 'state': 'Illinois'}, {'city': 'Plainfield', 'growth_from_2000_to_2013': '203.6%', 'latitude': 41.632223, 'longitude': -88.2120315, 'population': '41734', 'rank': '879', 'state': 'Illinois'}, {'city': 'Manassas', 'growth_from_2000_to_2013': '19.5%', 'latitude': 38.7509488, 'longitude': -77.47526669999999, 'population': '41705', 'rank': '880', 'state': 'Virginia'}, {'city': 'Bartlett', 'growth_from_2000_to_2013': '13.1%', 'latitude': 41.9950276, 'longitude': -88.1856301, 'population': '41679', 'rank': '881', 'state': 'Illinois'}, {'city': 'Kearny', 'growth_from_2000_to_2013': '2.8%', 'latitude': 40.7684342, 'longitude': -74.1454214, 'population': '41664', 'rank': '882', 'state': 'New Jersey'}, {'city': 'Oro Valley', 'growth_from_2000_to_2013': '27.0%', 'latitude': 32.3909071, 'longitude': -110.966488, 'population': '41627', 'rank': '883', 'state': 'Arizona'}, {'city': 'Findlay', 'growth_from_2000_to_2013': '5.8%', 'latitude': 41.04422, 'longitude': -83.6499321, 'population': '41512', 'rank': '884', 'state': 'Ohio'}, {'city': 'Rohnert Park', 'growth_from_2000_to_2013': '0.0%', 'latitude': 38.3396367, 'longitude': -122.7010984, 'population': '41398', 'rank': '885', 'state': 'California'}, {'city': 'Westfield', 'growth_from_2000_to_2013': '3.0%', 'latitude': 42.1250929, 'longitude': -72.749538, 'population': '41301', 'rank': '887', 'state': 'Massachusetts'}, {'city': 'Linden', 'growth_from_2000_to_2013': '4.7%', 'latitude': 40.6220478, 'longitude': -74.24459019999999, 'population': '41301', 'rank': '886', 'state': 'New Jersey'}, {'city': 'Sumter', 'growth_from_2000_to_2013': '1.3%', 'latitude': 33.9204354, 'longitude': -80.3414693, 'population': '41190', 'rank': '888', 'state': 'South Carolina'}, {'city': 'Wilkes-Barre', 'growth_from_2000_to_2013': '-4.3%', 'latitude': 41.2459149, 'longitude': -75.88130749999999, 'population': '41108', 'rank': '889', 'state': 'Pennsylvania'}, {'city': 'Woonsocket', 'growth_from_2000_to_2013': '-5.2%', 'latitude': 42.00287609999999, 'longitude': -71.51478390000001, 'population': '41026', 'rank': '890', 'state': 'Rhode Island'}, {'city': 'Leominster', 'growth_from_2000_to_2013': '-1.1%', 'latitude': 42.5250906, 'longitude': -71.759794, 'population': '41002', 'rank': '891', 'state': 'Massachusetts'}, {'city': 'Shelton', 'growth_from_2000_to_2013': '7.3%', 'latitude': 41.3164856, 'longitude': -73.0931641, 'population': '40999', 'rank': '892', 'state': 'Connecticut'}, {'city': 'Brea', 'growth_from_2000_to_2013': '15.2%', 'latitude': 33.9166805, 'longitude': -117.9000604, 'population': '40963', 'rank': '893', 'state': 'California'}, {'city': 'Covington', 'growth_from_2000_to_2013': '-4.7%', 'latitude': 39.0836712, 'longitude': -84.5085536, 'population': '40956', 'rank': '894', 'state': 'Kentucky'}, {'city': 'Rockwall', 'growth_from_2000_to_2013': '117.2%', 'latitude': 32.93123360000001, 'longitude': -96.4597089, 'population': '40922', 'rank': '895', 'state': 'Texas'}, {'city': 'Meridian', 'growth_from_2000_to_2013': '-0.9%', 'latitude': 32.3643098, 'longitude': -88.703656, 'population': '40921', 'rank': '896', 'state': 'Mississippi'}, {'city': 'Riverton', 'growth_from_2000_to_2013': '61.6%', 'latitude': 40.521893, 'longitude': -111.9391023, 'population': '40921', 'rank': '897', 'state': 'Utah'}, {'city': 'St. Cloud', 'growth_from_2000_to_2013': '86.2%', 'latitude': 28.2489016, 'longitude': -81.2811801, 'population': '40918', 'rank': '898', 'state': 'Florida'}, {'city': 'Quincy', 'growth_from_2000_to_2013': '0.5%', 'latitude': 39.9356016, 'longitude': -91.4098726, 'population': '40915', 'rank': '899', 'state': 'Illinois'}, {'city': 'Morgan Hill', 'growth_from_2000_to_2013': '19.5%', 'latitude': 37.1305012, 'longitude': -121.6543901, 'population': '40836', 'rank': '900', 'state': 'California'}, {'city': 'Warren', 'growth_from_2000_to_2013': '-15.2%', 'latitude': 41.2375569, 'longitude': -80.81841659999999, 'population': '40768', 'rank': '901', 'state': 'Ohio'}, {'city': 'Edmonds', 'growth_from_2000_to_2013': '2.9%', 'latitude': 47.8106521, 'longitude': -122.3773552, 'population': '40727', 'rank': '902', 'state': 'Washington'}, {'city': 'Burleson', 'growth_from_2000_to_2013': '85.3%', 'latitude': 32.5420821, 'longitude': -97.3208492, 'population': '40714', 'rank': '903', 'state': 'Texas'}, {'city': 'Beverly', 'growth_from_2000_to_2013': '2.0%', 'latitude': 42.5584283, 'longitude': -70.880049, 'population': '40664', 'rank': '904', 'state': 'Massachusetts'}, {'city': 'Mankato', 'growth_from_2000_to_2013': '24.7%', 'latitude': 44.1635775, 'longitude': -93.99939959999999, 'population': '40641', 'rank': '905', 'state': 'Minnesota'}, {'city': 'Hagerstown', 'growth_from_2000_to_2013': '10.4%', 'latitude': 39.6417629, 'longitude': -77.71999319999999, 'population': '40612', 'rank': '906', 'state': 'Maryland'}, {'city': 'Prescott', 'growth_from_2000_to_2013': '18.1%', 'latitude': 34.5400242, 'longitude': -112.4685025, 'population': '40590', 'rank': '907', 'state': 'Arizona'}, {'city': 'Campbell', 'growth_from_2000_to_2013': '4.2%', 'latitude': 37.2871651, 'longitude': -121.9499568, 'population': '40584', 'rank': '908', 'state': 'California'}, {'city': 'Cedar Falls', 'growth_from_2000_to_2013': '12.0%', 'latitude': 42.5348993, 'longitude': -92.4453161, 'population': '40566', 'rank': '909', 'state': 'Iowa'}, {'city': 'Beaumont', 'growth_from_2000_to_2013': '254.5%', 'latitude': 33.9294606, 'longitude': -116.977248, 'population': '40481', 'rank': '910', 'state': 'California'}, {'city': 'La Puente', 'growth_from_2000_to_2013': '-1.6%', 'latitude': 34.0200114, 'longitude': -117.9495083, 'population': '40435', 'rank': '911', 'state': 'California'}, {'city': 'Crystal Lake', 'growth_from_2000_to_2013': '5.3%', 'latitude': 42.2411344, 'longitude': -88.31619649999999, 'population': '40388', 'rank': '912', 'state': 'Illinois'}, {'city': 'Fitchburg', 'growth_from_2000_to_2013': '3.5%', 'latitude': 42.5834228, 'longitude': -71.8022955, 'population': '40383', 'rank': '913', 'state': 'Massachusetts'}, {'city': 'Carol Stream', 'growth_from_2000_to_2013': '-0.2%', 'latitude': 41.91252859999999, 'longitude': -88.13479269999999, 'population': '40379', 'rank': '914', 'state': 'Illinois'}, {'city': 'Hickory', 'growth_from_2000_to_2013': '7.0%', 'latitude': 35.7344538, 'longitude': -81.3444573, 'population': '40361', 'rank': '915', 'state': 'North Carolina'}, {'city': 'Streamwood', 'growth_from_2000_to_2013': '10.1%', 'latitude': 42.0255827, 'longitude': -88.17840849999999, 'population': '40351', 'rank': '916', 'state': 'Illinois'}, {'city': 'Norwich', 'growth_from_2000_to_2013': '11.6%', 'latitude': 41.5242649, 'longitude': -72.07591049999999, 'population': '40347', 'rank': '917', 'state': 'Connecticut'}, {'city': 'Coppell', 'growth_from_2000_to_2013': '10.3%', 'latitude': 32.9545687, 'longitude': -97.01500779999999, 'population': '40342', 'rank': '918', 'state': 'Texas'}, {'city': 'San Gabriel', 'growth_from_2000_to_2013': '0.9%', 'latitude': 34.09611110000001, 'longitude': -118.1058333, 'population': '40275', 'rank': '919', 'state': 'California'}, {'city': 'Holyoke', 'growth_from_2000_to_2013': '0.9%', 'latitude': 42.2042586, 'longitude': -72.6162009, 'population': '40249', 'rank': '920', 'state': 'Massachusetts'}, {'city': 'Bentonville', 'growth_from_2000_to_2013': '97.7%', 'latitude': 36.3728538, 'longitude': -94.2088172, 'population': '40167', 'rank': '921', 'state': 'Arkansas'}, {'city': 'Florence', 'growth_from_2000_to_2013': '10.2%', 'latitude': 34.79981, 'longitude': -87.677251, 'population': '40059', 'rank': '922', 'state': 'Alabama'}, {'city': 'Peachtree Corners', 'growth_from_2000_to_2013': '', 'latitude': 33.9698929, 'longitude': -84.2214551, 'population': '40059', 'rank': '923', 'state': 'Georgia'}, {'city': 'Brentwood', 'growth_from_2000_to_2013': '51.9%', 'latitude': 36.0331164, 'longitude': -86.78277720000001, 'population': '40021', 'rank': '924', 'state': 'Tennessee'}, {'city': 'Bozeman', 'growth_from_2000_to_2013': '41.9%', 'latitude': 45.6769979, 'longitude': -111.0429339, 'population': '39860', 'rank': '925', 'state': 'Montana'}, {'city': 'New Berlin', 'growth_from_2000_to_2013': '3.6%', 'latitude': 42.9764027, 'longitude': -88.1084224, 'population': '39834', 'rank': '926', 'state': 'Wisconsin'}, {'city': 'Goose Creek', 'growth_from_2000_to_2013': '26.1%', 'latitude': 32.9810059, 'longitude': -80.03258670000001, 'population': '39823', 'rank': '927', 'state': 'South Carolina'}, {'city': 'Huntsville', 'growth_from_2000_to_2013': '13.2%', 'latitude': 30.7235263, 'longitude': -95.55077709999999, 'population': '39795', 'rank': '928', 'state': 'Texas'}, {'city': 'Prescott Valley', 'growth_from_2000_to_2013': '62.9%', 'latitude': 34.6100243, 'longitude': -112.315721, 'population': '39791', 'rank': '929', 'state': 'Arizona'}, {'city': 'Maplewood', 'growth_from_2000_to_2013': '12.3%', 'latitude': 44.9530215, 'longitude': -92.9952153, 'population': '39765', 'rank': '930', 'state': 'Minnesota'}, {'city': 'Romeoville', 'growth_from_2000_to_2013': '79.5%', 'latitude': 41.6475306, 'longitude': -88.0895061, 'population': '39650', 'rank': '931', 'state': 'Illinois'}, {'city': 'Duncanville', 'growth_from_2000_to_2013': '9.7%', 'latitude': 32.6518004, 'longitude': -96.9083366, 'population': '39605', 'rank': '932', 'state': 'Texas'}, {'city': 'Atlantic City', 'growth_from_2000_to_2013': '-2.2%', 'latitude': 39.3642834, 'longitude': -74.4229266, 'population': '39551', 'rank': '933', 'state': 'New Jersey'}, {'city': 'Clovis', 'growth_from_2000_to_2013': '21.3%', 'latitude': 34.4047987, 'longitude': -103.2052272, 'population': '39508', 'rank': '934', 'state': 'New Mexico'}, {'city': 'The Colony', 'growth_from_2000_to_2013': '45.7%', 'latitude': 33.0806083, 'longitude': -96.89283089999999, 'population': '39458', 'rank': '935', 'state': 'Texas'}, {'city': 'Culver City', 'growth_from_2000_to_2013': '1.3%', 'latitude': 34.0211224, 'longitude': -118.3964665, 'population': '39428', 'rank': '936', 'state': 'California'}, {'city': 'Marlborough', 'growth_from_2000_to_2013': '7.6%', 'latitude': 42.3459271, 'longitude': -71.5522874, 'population': '39414', 'rank': '937', 'state': 'Massachusetts'}, {'city': 'Hilton Head Island', 'growth_from_2000_to_2013': '16.0%', 'latitude': 32.216316, 'longitude': -80.752608, 'population': '39412', 'rank': '938', 'state': 'South Carolina'}, {'city': 'Moorhead', 'growth_from_2000_to_2013': '21.3%', 'latitude': 46.8737648, 'longitude': -96.76780389999999, 'population': '39398', 'rank': '939', 'state': 'Minnesota'}, {'city': 'Calexico', 'growth_from_2000_to_2013': '44.0%', 'latitude': 32.6789476, 'longitude': -115.4988834, 'population': '39389', 'rank': '940', 'state': 'California'}, {'city': 'Bullhead City', 'growth_from_2000_to_2013': '15.9%', 'latitude': 35.1359386, 'longitude': -114.5285981, 'population': '39383', 'rank': '941', 'state': 'Arizona'}, {'city': 'Germantown', 'growth_from_2000_to_2013': '4.1%', 'latitude': 35.0867577, 'longitude': -89.8100858, 'population': '39375', 'rank': '942', 'state': 'Tennessee'}, {'city': 'La Quinta', 'growth_from_2000_to_2013': '59.9%', 'latitude': 33.6633573, 'longitude': -116.3100095, 'population': '39331', 'rank': '943', 'state': 'California'}, {'city': 'Lancaster', 'growth_from_2000_to_2013': '10.7%', 'latitude': 39.7136754, 'longitude': -82.5993294, 'population': '39325', 'rank': '944', 'state': 'Ohio'}, {'city': 'Wausau', 'growth_from_2000_to_2013': '1.7%', 'latitude': 44.9591352, 'longitude': -89.6301221, 'population': '39309', 'rank': '945', 'state': 'Wisconsin'}, {'city': 'Sherman', 'growth_from_2000_to_2013': '11.6%', 'latitude': 33.6356618, 'longitude': -96.6088805, 'population': '39296', 'rank': '946', 'state': 'Texas'}, {'city': 'Ocoee', 'growth_from_2000_to_2013': '57.9%', 'latitude': 28.5691677, 'longitude': -81.5439619, 'population': '39172', 'rank': '947', 'state': 'Florida'}, {'city': 'Shakopee', 'growth_from_2000_to_2013': '85.7%', 'latitude': 44.7973962, 'longitude': -93.5272861, 'population': '39167', 'rank': '948', 'state': 'Minnesota'}, {'city': 'Woburn', 'growth_from_2000_to_2013': '4.4%', 'latitude': 42.4792618, 'longitude': -71.1522765, 'population': '39083', 'rank': '949', 'state': 'Massachusetts'}, {'city': 'Bremerton', 'growth_from_2000_to_2013': '4.9%', 'latitude': 47.5673202, 'longitude': -122.6329356, 'population': '39056', 'rank': '950', 'state': 'Washington'}, {'city': 'Rock Island', 'growth_from_2000_to_2013': '-1.9%', 'latitude': 41.5094771, 'longitude': -90.5787476, 'population': '38877', 'rank': '951', 'state': 'Illinois'}, {'city': 'Muskogee', 'growth_from_2000_to_2013': '-0.7%', 'latitude': 35.7478769, 'longitude': -95.3696909, 'population': '38863', 'rank': '952', 'state': 'Oklahoma'}, {'city': 'Cape Girardeau', 'growth_from_2000_to_2013': '9.4%', 'latitude': 37.3058839, 'longitude': -89.51814759999999, 'population': '38816', 'rank': '953', 'state': 'Missouri'}, {'city': 'Annapolis', 'growth_from_2000_to_2013': '7.6%', 'latitude': 38.9784453, 'longitude': -76.4921829, 'population': '38722', 'rank': '954', 'state': 'Maryland'}, {'city': 'Greenacres', 'growth_from_2000_to_2013': '35.5%', 'latitude': 26.6276276, 'longitude': -80.1353896, 'population': '38696', 'rank': '955', 'state': 'Florida'}, {'city': 'Ormond Beach', 'growth_from_2000_to_2013': '5.8%', 'latitude': 29.2858129, 'longitude': -81.0558894, 'population': '38661', 'rank': '956', 'state': 'Florida'}, {'city': 'Hallandale Beach', 'growth_from_2000_to_2013': '12.4%', 'latitude': 25.9812024, 'longitude': -80.14837899999999, 'population': '38632', 'rank': '957', 'state': 'Florida'}, {'city': 'Stanton', 'growth_from_2000_to_2013': '2.8%', 'latitude': 33.8025155, 'longitude': -117.9931165, 'population': '38623', 'rank': '958', 'state': 'California'}, {'city': 'Puyallup', 'growth_from_2000_to_2013': '11.8%', 'latitude': 47.1853785, 'longitude': -122.2928974, 'population': '38609', 'rank': '959', 'state': 'Washington'}, {'city': 'Pacifica', 'growth_from_2000_to_2013': '0.5%', 'latitude': 37.6138253, 'longitude': -122.4869194, 'population': '38606', 'rank': '960', 'state': 'California'}, {'city': 'Hanover Park', 'growth_from_2000_to_2013': '0.6%', 'latitude': 41.9994722, 'longitude': -88.1450735, 'population': '38510', 'rank': '961', 'state': 'Illinois'}, {'city': 'Hurst', 'growth_from_2000_to_2013': '5.8%', 'latitude': 32.8234621, 'longitude': -97.1705678, 'population': '38448', 'rank': '962', 'state': 'Texas'}, {'city': 'Lima', 'growth_from_2000_to_2013': '-8.1%', 'latitude': 40.742551, 'longitude': -84.1052256, 'population': '38355', 'rank': '963', 'state': 'Ohio'}, {'city': 'Marana', 'growth_from_2000_to_2013': '166.2%', 'latitude': 32.436381, 'longitude': -111.2224422, 'population': '38290', 'rank': '964', 'state': 'Arizona'}, {'city': 'Carpentersville', 'growth_from_2000_to_2013': '22.8%', 'latitude': 42.1211364, 'longitude': -88.2578582, 'population': '38241', 'rank': '965', 'state': 'Illinois'}, {'city': 'Oakley', 'growth_from_2000_to_2013': '47.7%', 'latitude': 37.9974219, 'longitude': -121.7124536, 'population': '38194', 'rank': '966', 'state': 'California'}, {'city': 'Huber Heights', 'growth_from_2000_to_2013': '-0.2%', 'latitude': 39.843947, 'longitude': -84.12466080000002, 'population': '38142', 'rank': '967', 'state': 'Ohio'}, {'city': 'Lancaster', 'growth_from_2000_to_2013': '46.4%', 'latitude': 32.5920798, 'longitude': -96.7561082, 'population': '38071', 'rank': '968', 'state': 'Texas'}, {'city': 'Montclair', 'growth_from_2000_to_2013': '12.1%', 'latitude': 34.0775104, 'longitude': -117.6897776, 'population': '38027', 'rank': '969', 'state': 'California'}, {'city': 'Wheeling', 'growth_from_2000_to_2013': '4.8%', 'latitude': 42.1391927, 'longitude': -87.9289591, 'population': '38015', 'rank': '970', 'state': 'Illinois'}, {'city': 'Brookfield', 'growth_from_2000_to_2013': '-1.9%', 'latitude': 43.0605671, 'longitude': -88.1064787, 'population': '37999', 'rank': '971', 'state': 'Wisconsin'}, {'city': 'Park Ridge', 'growth_from_2000_to_2013': '0.1%', 'latitude': 42.0111412, 'longitude': -87.84061919999999, 'population': '37839', 'rank': '972', 'state': 'Illinois'}, {'city': 'Florence', 'growth_from_2000_to_2013': '19.8%', 'latitude': 34.1954331, 'longitude': -79.7625625, 'population': '37792', 'rank': '973', 'state': 'South Carolina'}, {'city': 'Roy', 'growth_from_2000_to_2013': '13.3%', 'latitude': 41.1616108, 'longitude': -112.0263313, 'population': '37733', 'rank': '974', 'state': 'Utah'}, {'city': 'Winter Garden', 'growth_from_2000_to_2013': '142.5%', 'latitude': 28.5652787, 'longitude': -81.58618469999999, 'population': '37711', 'rank': '975', 'state': 'Florida'}, {'city': 'Chelsea', 'growth_from_2000_to_2013': '7.3%', 'latitude': 42.3917638, 'longitude': -71.0328284, 'population': '37670', 'rank': '976', 'state': 'Massachusetts'}, {'city': 'Valley Stream', 'growth_from_2000_to_2013': '3.6%', 'latitude': 40.6642699, 'longitude': -73.70846449999999, 'population': '37659', 'rank': '977', 'state': 'New York'}, {'city': 'Spartanburg', 'growth_from_2000_to_2013': '-6.2%', 'latitude': 34.9495672, 'longitude': -81.9320482, 'population': '37647', 'rank': '978', 'state': 'South Carolina'}, {'city': 'Lake Oswego', 'growth_from_2000_to_2013': '5.3%', 'latitude': 45.42067489999999, 'longitude': -122.6706498, 'population': '37610', 'rank': '979', 'state': 'Oregon'}, {'city': 'Friendswood', 'growth_from_2000_to_2013': '28.6%', 'latitude': 29.5293998, 'longitude': -95.2010447, 'population': '37587', 'rank': '980', 'state': 'Texas'}, {'city': 'Westerville', 'growth_from_2000_to_2013': '5.7%', 'latitude': 40.1261743, 'longitude': -82.92906959999999, 'population': '37530', 'rank': '981', 'state': 'Ohio'}, {'city': 'Northglenn', 'growth_from_2000_to_2013': '15.5%', 'latitude': 39.8961821, 'longitude': -104.9811468, 'population': '37499', 'rank': '982', 'state': 'Colorado'}, {'city': 'Phenix City', 'growth_from_2000_to_2013': '31.9%', 'latitude': 32.4709761, 'longitude': -85.0007653, 'population': '37498', 'rank': '983', 'state': 'Alabama'}, {'city': 'Grove City', 'growth_from_2000_to_2013': '35.6%', 'latitude': 39.88145189999999, 'longitude': -83.0929644, 'population': '37490', 'rank': '984', 'state': 'Ohio'}, {'city': 'Texarkana', 'growth_from_2000_to_2013': '7.4%', 'latitude': 33.425125, 'longitude': -94.04768820000001, 'population': '37442', 'rank': '985', 'state': 'Texas'}, {'city': 'Addison', 'growth_from_2000_to_2013': '2.6%', 'latitude': 41.931696, 'longitude': -87.9889556, 'population': '37385', 'rank': '986', 'state': 'Illinois'}, {'city': 'Dover', 'growth_from_2000_to_2013': '16.0%', 'latitude': 39.158168, 'longitude': -75.5243682, 'population': '37366', 'rank': '987', 'state': 'Delaware'}, {'city': 'Lincoln Park', 'growth_from_2000_to_2013': '-6.7%', 'latitude': 42.2505943, 'longitude': -83.1785361, 'population': '37313', 'rank': '988', 'state': 'Michigan'}, {'city': 'Calumet City', 'growth_from_2000_to_2013': '-4.5%', 'latitude': 41.6155909, 'longitude': -87.5294871, 'population': '37240', 'rank': '989', 'state': 'Illinois'}, {'city': 'Muskegon', 'growth_from_2000_to_2013': '-7.1%', 'latitude': 43.2341813, 'longitude': -86.24839209999999, 'population': '37213', 'rank': '990', 'state': 'Michigan'}, {'city': 'Aventura', 'growth_from_2000_to_2013': '47.2%', 'latitude': 25.9564812, 'longitude': -80.1392121, 'population': '37199', 'rank': '991', 'state': 'Florida'}, {'city': 'Martinez', 'growth_from_2000_to_2013': '3.4%', 'latitude': 38.0193657, 'longitude': -122.1341321, 'population': '37165', 'rank': '992', 'state': 'California'}, {'city': 'Greenfield', 'growth_from_2000_to_2013': '4.8%', 'latitude': 42.9614039, 'longitude': -88.0125865, 'population': '37159', 'rank': '993', 'state': 'Wisconsin'}, {'city': 'Apache Junction', 'growth_from_2000_to_2013': '15.7%', 'latitude': 33.4150485, 'longitude': -111.5495777, 'population': '37130', 'rank': '994', 'state': 'Arizona'}, {'city': 'Monrovia', 'growth_from_2000_to_2013': '0.2%', 'latitude': 34.1442616, 'longitude': -118.0019482, 'population': '37101', 'rank': '995', 'state': 'California'}, {'city': 'Weslaco', 'growth_from_2000_to_2013': '28.8%', 'latitude': 26.1595194, 'longitude': -97.9908366, 'population': '37093', 'rank': '996', 'state': 'Texas'}, {'city': 'Keizer', 'growth_from_2000_to_2013': '14.4%', 'latitude': 44.9901194, 'longitude': -123.0262077, 'population': '37064', 'rank': '997', 'state': 'Oregon'}, {'city': 'Spanish Fork', 'growth_from_2000_to_2013': '78.1%', 'latitude': 40.114955, 'longitude': -111.654923, 'population': '36956', 'rank': '998', 'state': 'Utah'}, {'city': 'Beloit', 'growth_from_2000_to_2013': '2.9%', 'latitude': 42.5083482, 'longitude': -89.03177649999999, 'population': '36888', 'rank': '999', 'state': 'Wisconsin'}, {'city': 'Panama City', 'growth_from_2000_to_2013': '0.1%', 'latitude': 30.1588129, 'longitude': -85.6602058, 'population': '36877', 'rank': '1000', 'state': 'Florida'}] |
class QualifierClassifier:
def __init__(self):
pass
@staticmethod
def get_qualifiers(act_state):
return {}
| class Qualifierclassifier:
def __init__(self):
pass
@staticmethod
def get_qualifiers(act_state):
return {} |
a=int(input("enter the first number:"))
b=int(input("enter the second number:"))
s=(a&b) #sum
print(s)
u=(a/b) #or
print(u)
k=(~a) #not
print(k)
m=(a^b) #x-or
print(m)
o=(a<<b) #left shift
print(o)
t=(a>>b) #right shift
print(t)
| a = int(input('enter the first number:'))
b = int(input('enter the second number:'))
s = a & b
print(s)
u = a / b
print(u)
k = ~a
print(k)
m = a ^ b
print(m)
o = a << b
print(o)
t = a >> b
print(t) |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.