content stringlengths 7 1.05M | fixed_cases stringlengths 1 1.28M |
|---|---|
def file_to_id(outfile: str) -> str:
fn = outfile.split('.')[0]
assert(fn.startswith('blk'))
return fn[3:]
def id_int_to_outfile(fid_int: int, fid_len: int) -> str:
fid_s = str(fid_int)
prefix = (fid_len - len(fid_s)) * '0'
return f'blk{prefix+fid_s}.out'
def id_int_to_chunk_id(cid_int: int) -> str:
cid_s = str(cid_int)
return cid_s
| def file_to_id(outfile: str) -> str:
fn = outfile.split('.')[0]
assert fn.startswith('blk')
return fn[3:]
def id_int_to_outfile(fid_int: int, fid_len: int) -> str:
fid_s = str(fid_int)
prefix = (fid_len - len(fid_s)) * '0'
return f'blk{prefix + fid_s}.out'
def id_int_to_chunk_id(cid_int: int) -> str:
cid_s = str(cid_int)
return cid_s |
# problem statement: Given an array, find the total number of inversions of it. If (i < j) and (A[i] > A[j]), then pair (i, j) is called an inversion of an array A. We need to count all such pairs in the array.
# Function to find inversion count of a given list
def findInversionCount(A):
inversionCount = 0
for i in range(len(A) - 1):
for j in range(i + 1, len(A)):
if A[i] > A[j]:
inversionCount = inversionCount + 1
return inversionCount
if __name__ == '__main__':
A = [1, 9, 6, 4, 5]
print("Inversion count is", findInversionCount(A))
| def find_inversion_count(A):
inversion_count = 0
for i in range(len(A) - 1):
for j in range(i + 1, len(A)):
if A[i] > A[j]:
inversion_count = inversionCount + 1
return inversionCount
if __name__ == '__main__':
a = [1, 9, 6, 4, 5]
print('Inversion count is', find_inversion_count(A)) |
#
# PySNMP MIB module BLUECOAT-SG-PROXY-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/BLUECOAT-SG-PROXY-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 17:22:43 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
ObjectIdentifier, OctetString, Integer = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "OctetString", "Integer")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueSizeConstraint, ConstraintsIntersection, SingleValueConstraint, ValueRangeConstraint, ConstraintsUnion = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueSizeConstraint", "ConstraintsIntersection", "SingleValueConstraint", "ValueRangeConstraint", "ConstraintsUnion")
blueCoatMgmt, = mibBuilder.importSymbols("BLUECOAT-MIB", "blueCoatMgmt")
ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "NotificationGroup")
MibScalar, MibTable, MibTableRow, MibTableColumn, MibIdentifier, Bits, ModuleIdentity, TimeTicks, Unsigned32, ObjectIdentity, IpAddress, Integer32, Counter64, Gauge32, NotificationType, Counter32, iso = mibBuilder.importSymbols("SNMPv2-SMI", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "MibIdentifier", "Bits", "ModuleIdentity", "TimeTicks", "Unsigned32", "ObjectIdentity", "IpAddress", "Integer32", "Counter64", "Gauge32", "NotificationType", "Counter32", "iso")
DisplayString, TextualConvention = mibBuilder.importSymbols("SNMPv2-TC", "DisplayString", "TextualConvention")
bluecoatSGProxyMIB = ModuleIdentity((1, 3, 6, 1, 4, 1, 3417, 2, 11))
bluecoatSGProxyMIB.setRevisions(('2011-11-01 03:00', '2007-11-05 03:00', '2007-08-28 03:00',))
if mibBuilder.loadTexts: bluecoatSGProxyMIB.setLastUpdated('201111010300Z')
if mibBuilder.loadTexts: bluecoatSGProxyMIB.setOrganization('Blue Coat Systems, Inc.')
sgProxyConfig = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 1))
sgProxySystem = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2))
sgProxyHttp = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3))
sgProxyAdmin = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 1, 1), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyAdmin.setStatus('current')
sgProxySoftware = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 1, 2), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxySoftware.setStatus('current')
sgProxyVersion = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 1, 3), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyVersion.setStatus('current')
sgProxySerialNumber = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 1, 4), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxySerialNumber.setStatus('current')
sgProxyCpu = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1))
sgProxyCache = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 2))
sgProxyMemory = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 3))
sgProxyCpuCoreTable = MibTable((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4), )
if mibBuilder.loadTexts: sgProxyCpuCoreTable.setStatus('current')
sgProxyCpuUpTime = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 1), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuUpTime.setStatus('deprecated')
sgProxyCpuBusyTime = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 2), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuBusyTime.setStatus('deprecated')
sgProxyCpuIdleTime = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 3), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuIdleTime.setStatus('deprecated')
sgProxyCpuUpTimeSinceLastAccess = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 4), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuUpTimeSinceLastAccess.setStatus('deprecated')
sgProxyCpuBusyTimeSinceLastAccess = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 5), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuBusyTimeSinceLastAccess.setStatus('deprecated')
sgProxyCpuIdleTimeSinceLastAccess = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 6), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuIdleTimeSinceLastAccess.setStatus('deprecated')
sgProxyCpuBusyPerCent = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 7), Gauge32()).setUnits('Percentage').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuBusyPerCent.setStatus('deprecated')
sgProxyCpuIdlePerCent = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 8), Gauge32()).setUnits('Percentage').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuIdlePerCent.setStatus('deprecated')
sgProxyStorage = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 2, 1), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyStorage.setStatus('current')
sgProxyNumObjects = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 2, 2), Gauge32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyNumObjects.setStatus('current')
sgProxyMemAvailable = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 3, 1), Counter64()).setUnits('Bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyMemAvailable.setStatus('current')
sgProxyMemCacheUsage = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 3, 2), Counter64()).setUnits('Bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyMemCacheUsage.setStatus('current')
sgProxyMemSysUsage = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 3, 3), Counter64()).setUnits('Bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyMemSysUsage.setStatus('current')
sgProxyMemoryPressure = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 3, 4), Gauge32()).setUnits('Percentage').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyMemoryPressure.setStatus('current')
sgProxyCpuCoreTableEntry = MibTableRow((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1), ).setIndexNames((0, "BLUECOAT-SG-PROXY-MIB", "sgProxyCpuCoreIndex"))
if mibBuilder.loadTexts: sgProxyCpuCoreTableEntry.setStatus('current')
sgProxyCpuCoreIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 32)))
if mibBuilder.loadTexts: sgProxyCpuCoreIndex.setStatus('current')
sgProxyCpuCoreUpTime = MibTableColumn((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 2), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuCoreUpTime.setStatus('current')
sgProxyCpuCoreBusyTime = MibTableColumn((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 3), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuCoreBusyTime.setStatus('current')
sgProxyCpuCoreIdleTime = MibTableColumn((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 4), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuCoreIdleTime.setStatus('current')
sgProxyCpuCoreUpTimeSinceLastAccess = MibTableColumn((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 5), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuCoreUpTimeSinceLastAccess.setStatus('current')
sgProxyCpuCoreBusyTimeSinceLastAccess = MibTableColumn((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 6), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuCoreBusyTimeSinceLastAccess.setStatus('current')
sgProxyCpuCoreIdleTimeSinceLastAccess = MibTableColumn((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 7), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuCoreIdleTimeSinceLastAccess.setStatus('current')
sgProxyCpuCoreBusyPerCent = MibTableColumn((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 8), Gauge32()).setUnits('Percentage').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuCoreBusyPerCent.setStatus('current')
sgProxyCpuCoreIdlePerCent = MibTableColumn((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 9), Gauge32()).setUnits('Percentage').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyCpuCoreIdlePerCent.setStatus('current')
sgProxyHttpPerf = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1))
sgProxyHttpResponse = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2))
sgProxyHttpMedian = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3))
sgProxyHttpClient = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1))
sgProxyHttpServer = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 2))
sgProxyHttpConnections = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 3))
sgProxyHttpClientRequests = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 1), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpClientRequests.setStatus('current')
sgProxyHttpClientHits = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 2), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpClientHits.setStatus('current')
sgProxyHttpClientPartialHits = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 3), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpClientPartialHits.setStatus('current')
sgProxyHttpClientMisses = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 4), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpClientMisses.setStatus('current')
sgProxyHttpClientErrors = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 5), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpClientErrors.setStatus('current')
sgProxyHttpClientRequestRate = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 6), Gauge32()).setUnits('Requests Per Second').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpClientRequestRate.setStatus('current')
sgProxyHttpClientHitRate = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 7), Gauge32()).setUnits('Percentage').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpClientHitRate.setStatus('current')
sgProxyHttpClientByteHitRate = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 8), Gauge32()).setUnits('Percentage').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpClientByteHitRate.setStatus('current')
sgProxyHttpClientInBytes = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 9), Counter64()).setUnits('Bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpClientInBytes.setStatus('current')
sgProxyHttpClientOutBytes = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 10), Counter64()).setUnits('Bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpClientOutBytes.setStatus('current')
sgProxyHttpServerRequests = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 2, 1), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpServerRequests.setStatus('current')
sgProxyHttpServerErrors = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 2, 2), Counter64()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpServerErrors.setStatus('current')
sgProxyHttpServerInBytes = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 2, 3), Counter64()).setUnits('Bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpServerInBytes.setStatus('current')
sgProxyHttpServerOutBytes = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 2, 4), Counter64()).setUnits('Bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpServerOutBytes.setStatus('current')
sgProxyHttpClientConnections = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 3, 1), Gauge32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpClientConnections.setStatus('current')
sgProxyHttpClientConnectionsActive = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 3, 2), Gauge32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpClientConnectionsActive.setStatus('current')
sgProxyHttpClientConnectionsIdle = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 3, 3), Gauge32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpClientConnectionsIdle.setStatus('current')
sgProxyHttpServerConnections = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 3, 4), Gauge32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpServerConnections.setStatus('current')
sgProxyHttpServerConnectionsActive = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 3, 5), Gauge32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpServerConnectionsActive.setStatus('current')
sgProxyHttpServerConnectionsIdle = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 3, 6), Gauge32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpServerConnectionsIdle.setStatus('current')
sgProxyHttpResponseTime = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1))
sgProxyHttpResponseFirstByte = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 2))
sgProxyHttpResponseByteRate = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 3))
sgProxyHttpResponseSize = MibIdentifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 4))
sgProxyHttpServiceTimeAll = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 1), Gauge32()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpServiceTimeAll.setStatus('current')
sgProxyHttpServiceTimeHit = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 2), Gauge32()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpServiceTimeHit.setStatus('current')
sgProxyHttpServiceTimePartialHit = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 3), Gauge32()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpServiceTimePartialHit.setStatus('current')
sgProxyHttpServiceTimeMiss = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 4), Gauge32()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpServiceTimeMiss.setStatus('current')
sgProxyHttpTotalFetchTimeAll = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 5), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpTotalFetchTimeAll.setStatus('current')
sgProxyHttpTotalFetchTimeHit = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 6), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpTotalFetchTimeHit.setStatus('current')
sgProxyHttpTotalFetchTimePartialHit = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 7), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpTotalFetchTimePartialHit.setStatus('current')
sgProxyHttpTotalFetchTimeMiss = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 8), Counter64()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpTotalFetchTimeMiss.setStatus('current')
sgProxyHttpFirstByteAll = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 2, 1), Gauge32()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpFirstByteAll.setStatus('current')
sgProxyHttpFirstByteHit = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 2, 2), Gauge32()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpFirstByteHit.setStatus('current')
sgProxyHttpFirstBytePartialHit = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 2, 3), Gauge32()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpFirstBytePartialHit.setStatus('current')
sgProxyHttpFirstByteMiss = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 2, 4), Gauge32()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpFirstByteMiss.setStatus('current')
sgProxyHttpByteRateAll = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 3, 1), Gauge32()).setUnits('Bytes Per Second').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpByteRateAll.setStatus('current')
sgProxyHttpByteRateHit = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 3, 2), Gauge32()).setUnits('Bytes Per Second').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpByteRateHit.setStatus('current')
sgProxyHttpByteRatePartialHit = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 3, 3), Gauge32()).setUnits('Bytes Per Second').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpByteRatePartialHit.setStatus('current')
sgProxyHttpByteRateMiss = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 3, 4), Gauge32()).setUnits('Bytes Per Second').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpByteRateMiss.setStatus('current')
sgProxyHttpResponseSizeAll = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 4, 1), Gauge32()).setUnits('Bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpResponseSizeAll.setStatus('current')
sgProxyHttpResponseSizeHit = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 4, 2), Gauge32()).setUnits('Bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpResponseSizeHit.setStatus('current')
sgProxyHttpResponseSizePartialHit = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 4, 3), Gauge32()).setUnits('Bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpResponseSizePartialHit.setStatus('current')
sgProxyHttpResponseSizeMiss = MibScalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 4, 4), Gauge32()).setUnits('Bytes').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpResponseSizeMiss.setStatus('current')
sgProxyHttpMedianServiceTable = MibTable((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1), )
if mibBuilder.loadTexts: sgProxyHttpMedianServiceTable.setStatus('current')
sgProxyHttpMedianServiceEntry = MibTableRow((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1, 1), ).setIndexNames((0, "BLUECOAT-SG-PROXY-MIB", "sgProxyHttpMedianServiceTime"))
if mibBuilder.loadTexts: sgProxyHttpMedianServiceEntry.setStatus('current')
sgProxyHttpMedianServiceTime = MibTableColumn((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 5, 60))).clone(namedValues=NamedValues(("one", 1), ("five", 5), ("sixty", 60)))).setUnits('Minutes')
if mibBuilder.loadTexts: sgProxyHttpMedianServiceTime.setStatus('current')
sgProxyHttpMedianServiceTimeAll = MibTableColumn((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1, 1, 2), Gauge32()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpMedianServiceTimeAll.setStatus('current')
sgProxyHttpMedianServiceTimeHit = MibTableColumn((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1, 1, 3), Gauge32()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpMedianServiceTimeHit.setStatus('current')
sgProxyHttpMedianServiceTimePartialHit = MibTableColumn((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1, 1, 4), Gauge32()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpMedianServiceTimePartialHit.setStatus('current')
sgProxyHttpMedianServiceTimeMiss = MibTableColumn((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1, 1, 5), Gauge32()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyHttpMedianServiceTimeMiss.setStatus('current')
sgProxyDnsMedianServiceTime = MibTableColumn((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1, 1, 6), Gauge32()).setUnits('Milliseconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: sgProxyDnsMedianServiceTime.setStatus('current')
mibBuilder.exportSymbols("BLUECOAT-SG-PROXY-MIB", sgProxyHttpResponseSize=sgProxyHttpResponseSize, sgProxyHttpClientMisses=sgProxyHttpClientMisses, sgProxyHttpFirstByteHit=sgProxyHttpFirstByteHit, sgProxyHttpMedianServiceTime=sgProxyHttpMedianServiceTime, sgProxyCpuCoreBusyTime=sgProxyCpuCoreBusyTime, sgProxyHttpClientErrors=sgProxyHttpClientErrors, sgProxyDnsMedianServiceTime=sgProxyDnsMedianServiceTime, sgProxyHttpClientConnectionsActive=sgProxyHttpClientConnectionsActive, sgProxyHttpByteRateHit=sgProxyHttpByteRateHit, sgProxyHttpMedianServiceTimePartialHit=sgProxyHttpMedianServiceTimePartialHit, sgProxyCpuBusyPerCent=sgProxyCpuBusyPerCent, sgProxyHttpClient=sgProxyHttpClient, sgProxyHttpServiceTimeMiss=sgProxyHttpServiceTimeMiss, sgProxyHttpServiceTimePartialHit=sgProxyHttpServiceTimePartialHit, sgProxyHttpServiceTimeHit=sgProxyHttpServiceTimeHit, sgProxyCpuCoreBusyTimeSinceLastAccess=sgProxyCpuCoreBusyTimeSinceLastAccess, sgProxyCpuCoreTableEntry=sgProxyCpuCoreTableEntry, sgProxyHttpResponseTime=sgProxyHttpResponseTime, sgProxyHttpResponseFirstByte=sgProxyHttpResponseFirstByte, sgProxyHttpResponseSizePartialHit=sgProxyHttpResponseSizePartialHit, sgProxyHttpFirstByteMiss=sgProxyHttpFirstByteMiss, sgProxyHttpClientHitRate=sgProxyHttpClientHitRate, sgProxyHttpClientByteHitRate=sgProxyHttpClientByteHitRate, sgProxyHttpConnections=sgProxyHttpConnections, sgProxyHttpFirstBytePartialHit=sgProxyHttpFirstBytePartialHit, sgProxyStorage=sgProxyStorage, sgProxyMemSysUsage=sgProxyMemSysUsage, sgProxyMemAvailable=sgProxyMemAvailable, sgProxyHttpMedianServiceTimeHit=sgProxyHttpMedianServiceTimeHit, sgProxyMemory=sgProxyMemory, sgProxyCpuCoreIndex=sgProxyCpuCoreIndex, sgProxyHttpServer=sgProxyHttpServer, sgProxyHttpMedianServiceTimeAll=sgProxyHttpMedianServiceTimeAll, sgProxyCpuUpTimeSinceLastAccess=sgProxyCpuUpTimeSinceLastAccess, sgProxyCpuCoreIdlePerCent=sgProxyCpuCoreIdlePerCent, sgProxyHttpClientOutBytes=sgProxyHttpClientOutBytes, sgProxyHttpClientRequests=sgProxyHttpClientRequests, sgProxyHttpServiceTimeAll=sgProxyHttpServiceTimeAll, sgProxyHttpResponse=sgProxyHttpResponse, sgProxyHttpFirstByteAll=sgProxyHttpFirstByteAll, sgProxyHttpServerOutBytes=sgProxyHttpServerOutBytes, sgProxyHttpTotalFetchTimeAll=sgProxyHttpTotalFetchTimeAll, sgProxyHttpClientConnections=sgProxyHttpClientConnections, sgProxyCache=sgProxyCache, sgProxyConfig=sgProxyConfig, sgProxyHttpMedian=sgProxyHttpMedian, sgProxyCpuCoreUpTimeSinceLastAccess=sgProxyCpuCoreUpTimeSinceLastAccess, sgProxyHttpByteRateMiss=sgProxyHttpByteRateMiss, sgProxyHttpServerConnections=sgProxyHttpServerConnections, sgProxyAdmin=sgProxyAdmin, sgProxyHttpClientRequestRate=sgProxyHttpClientRequestRate, sgProxyCpuIdlePerCent=sgProxyCpuIdlePerCent, sgProxyHttpClientPartialHits=sgProxyHttpClientPartialHits, PYSNMP_MODULE_ID=bluecoatSGProxyMIB, sgProxyHttpClientHits=sgProxyHttpClientHits, sgProxyCpuCoreIdleTime=sgProxyCpuCoreIdleTime, sgProxyHttpServerRequests=sgProxyHttpServerRequests, sgProxyCpu=sgProxyCpu, sgProxyHttpByteRateAll=sgProxyHttpByteRateAll, sgProxyCpuIdleTime=sgProxyCpuIdleTime, sgProxyMemCacheUsage=sgProxyMemCacheUsage, sgProxyHttpServerErrors=sgProxyHttpServerErrors, sgProxyHttpTotalFetchTimeMiss=sgProxyHttpTotalFetchTimeMiss, sgProxyHttpServerConnectionsIdle=sgProxyHttpServerConnectionsIdle, sgProxyHttpMedianServiceTimeMiss=sgProxyHttpMedianServiceTimeMiss, sgProxyCpuBusyTimeSinceLastAccess=sgProxyCpuBusyTimeSinceLastAccess, sgProxySerialNumber=sgProxySerialNumber, sgProxyHttp=sgProxyHttp, sgProxyHttpByteRatePartialHit=sgProxyHttpByteRatePartialHit, sgProxyCpuCoreBusyPerCent=sgProxyCpuCoreBusyPerCent, sgProxyCpuCoreIdleTimeSinceLastAccess=sgProxyCpuCoreIdleTimeSinceLastAccess, sgProxyHttpResponseSizeAll=sgProxyHttpResponseSizeAll, sgProxyHttpClientConnectionsIdle=sgProxyHttpClientConnectionsIdle, sgProxyHttpResponseSizeMiss=sgProxyHttpResponseSizeMiss, sgProxyCpuUpTime=sgProxyCpuUpTime, sgProxyCpuCoreUpTime=sgProxyCpuCoreUpTime, sgProxyHttpMedianServiceTable=sgProxyHttpMedianServiceTable, sgProxyHttpServerInBytes=sgProxyHttpServerInBytes, sgProxyHttpClientInBytes=sgProxyHttpClientInBytes, sgProxyCpuBusyTime=sgProxyCpuBusyTime, sgProxyHttpResponseSizeHit=sgProxyHttpResponseSizeHit, sgProxySoftware=sgProxySoftware, sgProxyHttpPerf=sgProxyHttpPerf, sgProxyHttpResponseByteRate=sgProxyHttpResponseByteRate, bluecoatSGProxyMIB=bluecoatSGProxyMIB, sgProxyCpuCoreTable=sgProxyCpuCoreTable, sgProxyHttpServerConnectionsActive=sgProxyHttpServerConnectionsActive, sgProxySystem=sgProxySystem, sgProxyMemoryPressure=sgProxyMemoryPressure, sgProxyCpuIdleTimeSinceLastAccess=sgProxyCpuIdleTimeSinceLastAccess, sgProxyHttpMedianServiceEntry=sgProxyHttpMedianServiceEntry, sgProxyVersion=sgProxyVersion, sgProxyNumObjects=sgProxyNumObjects, sgProxyHttpTotalFetchTimePartialHit=sgProxyHttpTotalFetchTimePartialHit, sgProxyHttpTotalFetchTimeHit=sgProxyHttpTotalFetchTimeHit)
| (object_identifier, octet_string, integer) = mibBuilder.importSymbols('ASN1', 'ObjectIdentifier', 'OctetString', 'Integer')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(value_size_constraint, constraints_intersection, single_value_constraint, value_range_constraint, constraints_union) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ValueSizeConstraint', 'ConstraintsIntersection', 'SingleValueConstraint', 'ValueRangeConstraint', 'ConstraintsUnion')
(blue_coat_mgmt,) = mibBuilder.importSymbols('BLUECOAT-MIB', 'blueCoatMgmt')
(module_compliance, notification_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'NotificationGroup')
(mib_scalar, mib_table, mib_table_row, mib_table_column, mib_identifier, bits, module_identity, time_ticks, unsigned32, object_identity, ip_address, integer32, counter64, gauge32, notification_type, counter32, iso) = mibBuilder.importSymbols('SNMPv2-SMI', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'MibIdentifier', 'Bits', 'ModuleIdentity', 'TimeTicks', 'Unsigned32', 'ObjectIdentity', 'IpAddress', 'Integer32', 'Counter64', 'Gauge32', 'NotificationType', 'Counter32', 'iso')
(display_string, textual_convention) = mibBuilder.importSymbols('SNMPv2-TC', 'DisplayString', 'TextualConvention')
bluecoat_sg_proxy_mib = module_identity((1, 3, 6, 1, 4, 1, 3417, 2, 11))
bluecoatSGProxyMIB.setRevisions(('2011-11-01 03:00', '2007-11-05 03:00', '2007-08-28 03:00'))
if mibBuilder.loadTexts:
bluecoatSGProxyMIB.setLastUpdated('201111010300Z')
if mibBuilder.loadTexts:
bluecoatSGProxyMIB.setOrganization('Blue Coat Systems, Inc.')
sg_proxy_config = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 1))
sg_proxy_system = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2))
sg_proxy_http = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3))
sg_proxy_admin = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 1, 1), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyAdmin.setStatus('current')
sg_proxy_software = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 1, 2), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxySoftware.setStatus('current')
sg_proxy_version = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 1, 3), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyVersion.setStatus('current')
sg_proxy_serial_number = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 1, 4), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxySerialNumber.setStatus('current')
sg_proxy_cpu = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1))
sg_proxy_cache = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 2))
sg_proxy_memory = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 3))
sg_proxy_cpu_core_table = mib_table((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4))
if mibBuilder.loadTexts:
sgProxyCpuCoreTable.setStatus('current')
sg_proxy_cpu_up_time = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 1), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuUpTime.setStatus('deprecated')
sg_proxy_cpu_busy_time = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 2), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuBusyTime.setStatus('deprecated')
sg_proxy_cpu_idle_time = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 3), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuIdleTime.setStatus('deprecated')
sg_proxy_cpu_up_time_since_last_access = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 4), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuUpTimeSinceLastAccess.setStatus('deprecated')
sg_proxy_cpu_busy_time_since_last_access = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 5), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuBusyTimeSinceLastAccess.setStatus('deprecated')
sg_proxy_cpu_idle_time_since_last_access = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 6), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuIdleTimeSinceLastAccess.setStatus('deprecated')
sg_proxy_cpu_busy_per_cent = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 7), gauge32()).setUnits('Percentage').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuBusyPerCent.setStatus('deprecated')
sg_proxy_cpu_idle_per_cent = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 1, 8), gauge32()).setUnits('Percentage').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuIdlePerCent.setStatus('deprecated')
sg_proxy_storage = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 2, 1), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyStorage.setStatus('current')
sg_proxy_num_objects = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 2, 2), gauge32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyNumObjects.setStatus('current')
sg_proxy_mem_available = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 3, 1), counter64()).setUnits('Bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyMemAvailable.setStatus('current')
sg_proxy_mem_cache_usage = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 3, 2), counter64()).setUnits('Bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyMemCacheUsage.setStatus('current')
sg_proxy_mem_sys_usage = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 3, 3), counter64()).setUnits('Bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyMemSysUsage.setStatus('current')
sg_proxy_memory_pressure = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 3, 4), gauge32()).setUnits('Percentage').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyMemoryPressure.setStatus('current')
sg_proxy_cpu_core_table_entry = mib_table_row((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1)).setIndexNames((0, 'BLUECOAT-SG-PROXY-MIB', 'sgProxyCpuCoreIndex'))
if mibBuilder.loadTexts:
sgProxyCpuCoreTableEntry.setStatus('current')
sg_proxy_cpu_core_index = mib_table_column((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 32)))
if mibBuilder.loadTexts:
sgProxyCpuCoreIndex.setStatus('current')
sg_proxy_cpu_core_up_time = mib_table_column((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 2), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuCoreUpTime.setStatus('current')
sg_proxy_cpu_core_busy_time = mib_table_column((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 3), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuCoreBusyTime.setStatus('current')
sg_proxy_cpu_core_idle_time = mib_table_column((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 4), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuCoreIdleTime.setStatus('current')
sg_proxy_cpu_core_up_time_since_last_access = mib_table_column((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 5), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuCoreUpTimeSinceLastAccess.setStatus('current')
sg_proxy_cpu_core_busy_time_since_last_access = mib_table_column((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 6), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuCoreBusyTimeSinceLastAccess.setStatus('current')
sg_proxy_cpu_core_idle_time_since_last_access = mib_table_column((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 7), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuCoreIdleTimeSinceLastAccess.setStatus('current')
sg_proxy_cpu_core_busy_per_cent = mib_table_column((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 8), gauge32()).setUnits('Percentage').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuCoreBusyPerCent.setStatus('current')
sg_proxy_cpu_core_idle_per_cent = mib_table_column((1, 3, 6, 1, 4, 1, 3417, 2, 11, 2, 4, 1, 9), gauge32()).setUnits('Percentage').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyCpuCoreIdlePerCent.setStatus('current')
sg_proxy_http_perf = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1))
sg_proxy_http_response = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2))
sg_proxy_http_median = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3))
sg_proxy_http_client = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1))
sg_proxy_http_server = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 2))
sg_proxy_http_connections = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 3))
sg_proxy_http_client_requests = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 1), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpClientRequests.setStatus('current')
sg_proxy_http_client_hits = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 2), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpClientHits.setStatus('current')
sg_proxy_http_client_partial_hits = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 3), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpClientPartialHits.setStatus('current')
sg_proxy_http_client_misses = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 4), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpClientMisses.setStatus('current')
sg_proxy_http_client_errors = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 5), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpClientErrors.setStatus('current')
sg_proxy_http_client_request_rate = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 6), gauge32()).setUnits('Requests Per Second').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpClientRequestRate.setStatus('current')
sg_proxy_http_client_hit_rate = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 7), gauge32()).setUnits('Percentage').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpClientHitRate.setStatus('current')
sg_proxy_http_client_byte_hit_rate = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 8), gauge32()).setUnits('Percentage').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpClientByteHitRate.setStatus('current')
sg_proxy_http_client_in_bytes = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 9), counter64()).setUnits('Bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpClientInBytes.setStatus('current')
sg_proxy_http_client_out_bytes = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 1, 10), counter64()).setUnits('Bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpClientOutBytes.setStatus('current')
sg_proxy_http_server_requests = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 2, 1), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpServerRequests.setStatus('current')
sg_proxy_http_server_errors = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 2, 2), counter64()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpServerErrors.setStatus('current')
sg_proxy_http_server_in_bytes = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 2, 3), counter64()).setUnits('Bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpServerInBytes.setStatus('current')
sg_proxy_http_server_out_bytes = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 2, 4), counter64()).setUnits('Bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpServerOutBytes.setStatus('current')
sg_proxy_http_client_connections = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 3, 1), gauge32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpClientConnections.setStatus('current')
sg_proxy_http_client_connections_active = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 3, 2), gauge32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpClientConnectionsActive.setStatus('current')
sg_proxy_http_client_connections_idle = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 3, 3), gauge32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpClientConnectionsIdle.setStatus('current')
sg_proxy_http_server_connections = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 3, 4), gauge32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpServerConnections.setStatus('current')
sg_proxy_http_server_connections_active = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 3, 5), gauge32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpServerConnectionsActive.setStatus('current')
sg_proxy_http_server_connections_idle = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 1, 3, 6), gauge32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpServerConnectionsIdle.setStatus('current')
sg_proxy_http_response_time = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1))
sg_proxy_http_response_first_byte = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 2))
sg_proxy_http_response_byte_rate = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 3))
sg_proxy_http_response_size = mib_identifier((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 4))
sg_proxy_http_service_time_all = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 1), gauge32()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpServiceTimeAll.setStatus('current')
sg_proxy_http_service_time_hit = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 2), gauge32()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpServiceTimeHit.setStatus('current')
sg_proxy_http_service_time_partial_hit = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 3), gauge32()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpServiceTimePartialHit.setStatus('current')
sg_proxy_http_service_time_miss = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 4), gauge32()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpServiceTimeMiss.setStatus('current')
sg_proxy_http_total_fetch_time_all = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 5), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpTotalFetchTimeAll.setStatus('current')
sg_proxy_http_total_fetch_time_hit = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 6), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpTotalFetchTimeHit.setStatus('current')
sg_proxy_http_total_fetch_time_partial_hit = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 7), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpTotalFetchTimePartialHit.setStatus('current')
sg_proxy_http_total_fetch_time_miss = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 1, 8), counter64()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpTotalFetchTimeMiss.setStatus('current')
sg_proxy_http_first_byte_all = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 2, 1), gauge32()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpFirstByteAll.setStatus('current')
sg_proxy_http_first_byte_hit = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 2, 2), gauge32()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpFirstByteHit.setStatus('current')
sg_proxy_http_first_byte_partial_hit = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 2, 3), gauge32()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpFirstBytePartialHit.setStatus('current')
sg_proxy_http_first_byte_miss = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 2, 4), gauge32()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpFirstByteMiss.setStatus('current')
sg_proxy_http_byte_rate_all = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 3, 1), gauge32()).setUnits('Bytes Per Second').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpByteRateAll.setStatus('current')
sg_proxy_http_byte_rate_hit = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 3, 2), gauge32()).setUnits('Bytes Per Second').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpByteRateHit.setStatus('current')
sg_proxy_http_byte_rate_partial_hit = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 3, 3), gauge32()).setUnits('Bytes Per Second').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpByteRatePartialHit.setStatus('current')
sg_proxy_http_byte_rate_miss = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 3, 4), gauge32()).setUnits('Bytes Per Second').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpByteRateMiss.setStatus('current')
sg_proxy_http_response_size_all = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 4, 1), gauge32()).setUnits('Bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpResponseSizeAll.setStatus('current')
sg_proxy_http_response_size_hit = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 4, 2), gauge32()).setUnits('Bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpResponseSizeHit.setStatus('current')
sg_proxy_http_response_size_partial_hit = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 4, 3), gauge32()).setUnits('Bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpResponseSizePartialHit.setStatus('current')
sg_proxy_http_response_size_miss = mib_scalar((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 2, 4, 4), gauge32()).setUnits('Bytes').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpResponseSizeMiss.setStatus('current')
sg_proxy_http_median_service_table = mib_table((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1))
if mibBuilder.loadTexts:
sgProxyHttpMedianServiceTable.setStatus('current')
sg_proxy_http_median_service_entry = mib_table_row((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1, 1)).setIndexNames((0, 'BLUECOAT-SG-PROXY-MIB', 'sgProxyHttpMedianServiceTime'))
if mibBuilder.loadTexts:
sgProxyHttpMedianServiceEntry.setStatus('current')
sg_proxy_http_median_service_time = mib_table_column((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1, 1, 1), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 5, 60))).clone(namedValues=named_values(('one', 1), ('five', 5), ('sixty', 60)))).setUnits('Minutes')
if mibBuilder.loadTexts:
sgProxyHttpMedianServiceTime.setStatus('current')
sg_proxy_http_median_service_time_all = mib_table_column((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1, 1, 2), gauge32()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpMedianServiceTimeAll.setStatus('current')
sg_proxy_http_median_service_time_hit = mib_table_column((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1, 1, 3), gauge32()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpMedianServiceTimeHit.setStatus('current')
sg_proxy_http_median_service_time_partial_hit = mib_table_column((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1, 1, 4), gauge32()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpMedianServiceTimePartialHit.setStatus('current')
sg_proxy_http_median_service_time_miss = mib_table_column((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1, 1, 5), gauge32()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyHttpMedianServiceTimeMiss.setStatus('current')
sg_proxy_dns_median_service_time = mib_table_column((1, 3, 6, 1, 4, 1, 3417, 2, 11, 3, 3, 1, 1, 6), gauge32()).setUnits('Milliseconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
sgProxyDnsMedianServiceTime.setStatus('current')
mibBuilder.exportSymbols('BLUECOAT-SG-PROXY-MIB', sgProxyHttpResponseSize=sgProxyHttpResponseSize, sgProxyHttpClientMisses=sgProxyHttpClientMisses, sgProxyHttpFirstByteHit=sgProxyHttpFirstByteHit, sgProxyHttpMedianServiceTime=sgProxyHttpMedianServiceTime, sgProxyCpuCoreBusyTime=sgProxyCpuCoreBusyTime, sgProxyHttpClientErrors=sgProxyHttpClientErrors, sgProxyDnsMedianServiceTime=sgProxyDnsMedianServiceTime, sgProxyHttpClientConnectionsActive=sgProxyHttpClientConnectionsActive, sgProxyHttpByteRateHit=sgProxyHttpByteRateHit, sgProxyHttpMedianServiceTimePartialHit=sgProxyHttpMedianServiceTimePartialHit, sgProxyCpuBusyPerCent=sgProxyCpuBusyPerCent, sgProxyHttpClient=sgProxyHttpClient, sgProxyHttpServiceTimeMiss=sgProxyHttpServiceTimeMiss, sgProxyHttpServiceTimePartialHit=sgProxyHttpServiceTimePartialHit, sgProxyHttpServiceTimeHit=sgProxyHttpServiceTimeHit, sgProxyCpuCoreBusyTimeSinceLastAccess=sgProxyCpuCoreBusyTimeSinceLastAccess, sgProxyCpuCoreTableEntry=sgProxyCpuCoreTableEntry, sgProxyHttpResponseTime=sgProxyHttpResponseTime, sgProxyHttpResponseFirstByte=sgProxyHttpResponseFirstByte, sgProxyHttpResponseSizePartialHit=sgProxyHttpResponseSizePartialHit, sgProxyHttpFirstByteMiss=sgProxyHttpFirstByteMiss, sgProxyHttpClientHitRate=sgProxyHttpClientHitRate, sgProxyHttpClientByteHitRate=sgProxyHttpClientByteHitRate, sgProxyHttpConnections=sgProxyHttpConnections, sgProxyHttpFirstBytePartialHit=sgProxyHttpFirstBytePartialHit, sgProxyStorage=sgProxyStorage, sgProxyMemSysUsage=sgProxyMemSysUsage, sgProxyMemAvailable=sgProxyMemAvailable, sgProxyHttpMedianServiceTimeHit=sgProxyHttpMedianServiceTimeHit, sgProxyMemory=sgProxyMemory, sgProxyCpuCoreIndex=sgProxyCpuCoreIndex, sgProxyHttpServer=sgProxyHttpServer, sgProxyHttpMedianServiceTimeAll=sgProxyHttpMedianServiceTimeAll, sgProxyCpuUpTimeSinceLastAccess=sgProxyCpuUpTimeSinceLastAccess, sgProxyCpuCoreIdlePerCent=sgProxyCpuCoreIdlePerCent, sgProxyHttpClientOutBytes=sgProxyHttpClientOutBytes, sgProxyHttpClientRequests=sgProxyHttpClientRequests, sgProxyHttpServiceTimeAll=sgProxyHttpServiceTimeAll, sgProxyHttpResponse=sgProxyHttpResponse, sgProxyHttpFirstByteAll=sgProxyHttpFirstByteAll, sgProxyHttpServerOutBytes=sgProxyHttpServerOutBytes, sgProxyHttpTotalFetchTimeAll=sgProxyHttpTotalFetchTimeAll, sgProxyHttpClientConnections=sgProxyHttpClientConnections, sgProxyCache=sgProxyCache, sgProxyConfig=sgProxyConfig, sgProxyHttpMedian=sgProxyHttpMedian, sgProxyCpuCoreUpTimeSinceLastAccess=sgProxyCpuCoreUpTimeSinceLastAccess, sgProxyHttpByteRateMiss=sgProxyHttpByteRateMiss, sgProxyHttpServerConnections=sgProxyHttpServerConnections, sgProxyAdmin=sgProxyAdmin, sgProxyHttpClientRequestRate=sgProxyHttpClientRequestRate, sgProxyCpuIdlePerCent=sgProxyCpuIdlePerCent, sgProxyHttpClientPartialHits=sgProxyHttpClientPartialHits, PYSNMP_MODULE_ID=bluecoatSGProxyMIB, sgProxyHttpClientHits=sgProxyHttpClientHits, sgProxyCpuCoreIdleTime=sgProxyCpuCoreIdleTime, sgProxyHttpServerRequests=sgProxyHttpServerRequests, sgProxyCpu=sgProxyCpu, sgProxyHttpByteRateAll=sgProxyHttpByteRateAll, sgProxyCpuIdleTime=sgProxyCpuIdleTime, sgProxyMemCacheUsage=sgProxyMemCacheUsage, sgProxyHttpServerErrors=sgProxyHttpServerErrors, sgProxyHttpTotalFetchTimeMiss=sgProxyHttpTotalFetchTimeMiss, sgProxyHttpServerConnectionsIdle=sgProxyHttpServerConnectionsIdle, sgProxyHttpMedianServiceTimeMiss=sgProxyHttpMedianServiceTimeMiss, sgProxyCpuBusyTimeSinceLastAccess=sgProxyCpuBusyTimeSinceLastAccess, sgProxySerialNumber=sgProxySerialNumber, sgProxyHttp=sgProxyHttp, sgProxyHttpByteRatePartialHit=sgProxyHttpByteRatePartialHit, sgProxyCpuCoreBusyPerCent=sgProxyCpuCoreBusyPerCent, sgProxyCpuCoreIdleTimeSinceLastAccess=sgProxyCpuCoreIdleTimeSinceLastAccess, sgProxyHttpResponseSizeAll=sgProxyHttpResponseSizeAll, sgProxyHttpClientConnectionsIdle=sgProxyHttpClientConnectionsIdle, sgProxyHttpResponseSizeMiss=sgProxyHttpResponseSizeMiss, sgProxyCpuUpTime=sgProxyCpuUpTime, sgProxyCpuCoreUpTime=sgProxyCpuCoreUpTime, sgProxyHttpMedianServiceTable=sgProxyHttpMedianServiceTable, sgProxyHttpServerInBytes=sgProxyHttpServerInBytes, sgProxyHttpClientInBytes=sgProxyHttpClientInBytes, sgProxyCpuBusyTime=sgProxyCpuBusyTime, sgProxyHttpResponseSizeHit=sgProxyHttpResponseSizeHit, sgProxySoftware=sgProxySoftware, sgProxyHttpPerf=sgProxyHttpPerf, sgProxyHttpResponseByteRate=sgProxyHttpResponseByteRate, bluecoatSGProxyMIB=bluecoatSGProxyMIB, sgProxyCpuCoreTable=sgProxyCpuCoreTable, sgProxyHttpServerConnectionsActive=sgProxyHttpServerConnectionsActive, sgProxySystem=sgProxySystem, sgProxyMemoryPressure=sgProxyMemoryPressure, sgProxyCpuIdleTimeSinceLastAccess=sgProxyCpuIdleTimeSinceLastAccess, sgProxyHttpMedianServiceEntry=sgProxyHttpMedianServiceEntry, sgProxyVersion=sgProxyVersion, sgProxyNumObjects=sgProxyNumObjects, sgProxyHttpTotalFetchTimePartialHit=sgProxyHttpTotalFetchTimePartialHit, sgProxyHttpTotalFetchTimeHit=sgProxyHttpTotalFetchTimeHit) |
a = (42, 1)
print(f"First value of a: {a[0]}.")
# Set first value of a to 23:
a[0] = 23
print(f"First value of a: {a[0]}.")
| a = (42, 1)
print(f'First value of a: {a[0]}.')
a[0] = 23
print(f'First value of a: {a[0]}.') |
# coding=utf-8
class RpcRequest(object):
def __init__(self, method, params):
self._method = method
self._params = params
@property
def method(self):
return self._method
@property
def params(self):
return self._params
@property
def to_json(self):
return {
'method': self._method,
'params': self._params
}
| class Rpcrequest(object):
def __init__(self, method, params):
self._method = method
self._params = params
@property
def method(self):
return self._method
@property
def params(self):
return self._params
@property
def to_json(self):
return {'method': self._method, 'params': self._params} |
# original data
data = "75\n\
95 64\n\
17 47 82\n\
18 35 87 10\n\
20 04 82 47 65\n\
19 01 23 75 03 34\n\
88 02 77 73 07 63 67\n\
99 65 04 28 06 16 70 92\n\
41 41 26 56 83 40 80 70 33\n\
41 48 72 33 47 32 37 16 94 29\n\
53 71 44 65 25 43 91 52 97 51 14\n\
70 11 33 28 77 73 17 78 39 68 17 57\n\
91 71 52 38 17 14 91 43 58 50 27 29 48\n\
63 66 04 68 89 53 67 30 73 16 69 87 40 31\n\
04 62 98 27 23 09 70 98 73 93 38 53 60 04 23"
# data wrangling
l = data.split("\n")
triangle = []
for i in l:
k = i.split(' ')
n = []
for j in k:
n.append(int(j))
triangle.append(n)
if __name__ == "__main__":
for i in range(14, 0, -1):
for j in range(i):
if triangle[i][j] > triangle[i][j+1]:
triangle[i-1][j] += triangle[i][j]
else:
triangle[i-1][j] += triangle[i][j+1]
print(triangle[0][0])
| data = '75\n95 64\n17 47 82\n18 35 87 10\n20 04 82 47 65\n19 01 23 75 03 34\n88 02 77 73 07 63 67\n99 65 04 28 06 16 70 92\n41 41 26 56 83 40 80 70 33\n41 48 72 33 47 32 37 16 94 29\n53 71 44 65 25 43 91 52 97 51 14\n70 11 33 28 77 73 17 78 39 68 17 57\n91 71 52 38 17 14 91 43 58 50 27 29 48\n63 66 04 68 89 53 67 30 73 16 69 87 40 31\n04 62 98 27 23 09 70 98 73 93 38 53 60 04 23'
l = data.split('\n')
triangle = []
for i in l:
k = i.split(' ')
n = []
for j in k:
n.append(int(j))
triangle.append(n)
if __name__ == '__main__':
for i in range(14, 0, -1):
for j in range(i):
if triangle[i][j] > triangle[i][j + 1]:
triangle[i - 1][j] += triangle[i][j]
else:
triangle[i - 1][j] += triangle[i][j + 1]
print(triangle[0][0]) |
def encontra_impares(lista):
if len(lista) == 0:
return lista
if lista[0] % 2 == 0:
return encontra_impares(lista[1:])
return [lista[0]] + encontra_impares(lista[1:])
| def encontra_impares(lista):
if len(lista) == 0:
return lista
if lista[0] % 2 == 0:
return encontra_impares(lista[1:])
return [lista[0]] + encontra_impares(lista[1:]) |
# Kth smallest element
# Input:
# N = 6
# arr[] = 7 10 4 3 20 15
# K = 3
# Output : 7
# Explanation :
# 3rd smallest element in the given
# array is 7.
k = int(input())
arr = list(map(int,input().split()))
arr.sort()
print("\n")
print("{k}th min element is : ",arr[k-1])
print("{k}th max element is : ",arr[-k])
| k = int(input())
arr = list(map(int, input().split()))
arr.sort()
print('\n')
print('{k}th min element is : ', arr[k - 1])
print('{k}th max element is : ', arr[-k]) |
#Class for scrapers table
class Scrapers:
def __init__(self, cursor):
self.cursor = cursor
#read from db
#read all scaping jobs by progress
def getScrapingJobsByProgress(cursor, progress):
sql= "SELECT * from scrapers WHERE scrapers_progress=%s ORDER BY RANDOM()"
data = (progress)
cursor.execute(sql,(data,))
rows = cursor.fetchall()
return rows
#read all scaping jobs by progress
def getScrapingJobsByProgressSE(cursor, progress, se):
sql= "SELECT * from scrapers WHERE scrapers_progress=%s AND scrapers_se =%s ORDER BY RANDOM()"
data = (progress, se)
cursor.execute(sql,(data))
rows = cursor.fetchall()
return rows
#read scaping jobs by progress and query
def getScrapingJobsByQueryProgress(cursor, query_id, progress):
sql= "SELECT * FROM scrapers WHERE scrapers_queries_id = %s AND scrapers_progress = %s ORDER BY scrapers_start, scrapers_se ASC"
data = (query_id, progress)
cursor.execute(sql,(data))
rows = cursor.fetchall()
return rows
def getScrapingJobsByQueryProgressSE(cursor, query_id, progress, se):
sql= "SELECT * FROM scrapers WHERE scrapers_queries_id = %s AND scrapers_progress = %s AND scrapers_se = %s ORDER BY scrapers_start, scrapers_se"
data = (query_id, progress, se)
cursor.execute(sql,(data))
rows = cursor.fetchall()
return rows
#read scraping jobs by query
def getScrapingJobsByQuery(cursor, query_id):
sql= "SELECT * FROM scrapers WHERE scrapers_queries_id = %s ORDER BY scrapers_id"
data = (query_id)
cursor.execute(sql,(data,))
rows = cursor.fetchall()
return rows
#read scraping jobs by Search Engine
def getScrapingJobsBySE(cursor, query_id, search_engine):
sql= "SELECT count(scrapers_id) FROM scrapers WHERE scrapers_queries_id = %s AND scrapers_se =%s"
data = (query_id, search_engine)
cursor.execute(sql,(data))
rows = cursor.fetchall()
return rows
def getScrapingJobsByStudyQueries(cursor, study):
sql= "SELECT count(distinct(scrapers_queries_id)) from scrapers, queries WHERE scrapers_queries_id = queries_id AND scrapers_studies_id=%s"
data = (study)
cursor.execute(sql,(data,))
rows = cursor.fetchall()
return rows
#write to db
#generate scraping joby by queries
def insertScrapingJobs(cursor, query_id, study_id, query_string, search_engine, start, today):
cursor.execute(
"INSERT INTO scrapers (scrapers_queries_id, scrapers_studies_id, scrapers_queries_query, scrapers_se, scrapers_start, scrapers_date, scrapers_progress) VALUES (%s, %s, %s, %s, %s, %s, %s);", # remove parenthesis here, which ends the execute call
(query_id, study_id, query_string, search_engine, start, today, 0)
)
#update status of scraping job
def updateScrapingJob(cursor, job_id, progress):
cursor.execute(
"UPDATE scrapers SET scrapers_progress = %s WHERE scrapers_id = %s",
(progress, job_id)
)
#update status of scraping job by query; important for queries with a limited range of search results
def updateScrapingJobQuery(cursor, query_id, progress):
cursor.execute(
"UPDATE scrapers SET scrapers_progress = %s WHERE scrapers_queries_id = %s",
(progress, query_id)
)
#update status of scraping job by query; important for queries with a limited range of search results
def updateScrapingJobQuerySeJobId(cursor, query_id, progress, se, job_id):
cursor.execute(
"UPDATE scrapers SET scrapers_progress = %s WHERE scrapers_queries_id = %s AND scrapers_se = %s AND scrapers_id >= %s",
(progress, query_id, se, job_id)
)
#update scraping job by query and search engine
def updateScrapingJobQuerySearchEngine(cursor, query_id, search_engine, progress):
cursor.execute(
"UPDATE scrapers SET scrapers_progress = %s WHERE scrapers_queries_id = %s AND scrapers_se =%s",
(progress, query_id, search_engine)
)
#reset scraper_jobs
def resetScrapingJobs(cursor):
cursor.execute(
"DELETE FROM scrapers WHERE scrapers_progress = -1"
)
def getScrapingJobs(cursor, query_id, study_id, search_engine):
sql= "SELECT scrapers_id FROM scrapers WHERE scrapers_queries_id = %s AND scrapers_studies_id =%s AND scrapers_se = %s"
data = (query_id, study_id, search_engine)
cursor.execute(sql,(data))
rows = cursor.fetchall()
return rows
| class Scrapers:
def __init__(self, cursor):
self.cursor = cursor
def get_scraping_jobs_by_progress(cursor, progress):
sql = 'SELECT * from scrapers WHERE scrapers_progress=%s ORDER BY RANDOM()'
data = progress
cursor.execute(sql, (data,))
rows = cursor.fetchall()
return rows
def get_scraping_jobs_by_progress_se(cursor, progress, se):
sql = 'SELECT * from scrapers WHERE scrapers_progress=%s AND scrapers_se =%s ORDER BY RANDOM()'
data = (progress, se)
cursor.execute(sql, data)
rows = cursor.fetchall()
return rows
def get_scraping_jobs_by_query_progress(cursor, query_id, progress):
sql = 'SELECT * FROM scrapers WHERE scrapers_queries_id = %s AND scrapers_progress = %s ORDER BY scrapers_start, scrapers_se ASC'
data = (query_id, progress)
cursor.execute(sql, data)
rows = cursor.fetchall()
return rows
def get_scraping_jobs_by_query_progress_se(cursor, query_id, progress, se):
sql = 'SELECT * FROM scrapers WHERE scrapers_queries_id = %s AND scrapers_progress = %s AND scrapers_se = %s ORDER BY scrapers_start, scrapers_se'
data = (query_id, progress, se)
cursor.execute(sql, data)
rows = cursor.fetchall()
return rows
def get_scraping_jobs_by_query(cursor, query_id):
sql = 'SELECT * FROM scrapers WHERE scrapers_queries_id = %s ORDER BY scrapers_id'
data = query_id
cursor.execute(sql, (data,))
rows = cursor.fetchall()
return rows
def get_scraping_jobs_by_se(cursor, query_id, search_engine):
sql = 'SELECT count(scrapers_id) FROM scrapers WHERE scrapers_queries_id = %s AND scrapers_se =%s'
data = (query_id, search_engine)
cursor.execute(sql, data)
rows = cursor.fetchall()
return rows
def get_scraping_jobs_by_study_queries(cursor, study):
sql = 'SELECT count(distinct(scrapers_queries_id)) from scrapers, queries WHERE scrapers_queries_id = queries_id AND scrapers_studies_id=%s'
data = study
cursor.execute(sql, (data,))
rows = cursor.fetchall()
return rows
def insert_scraping_jobs(cursor, query_id, study_id, query_string, search_engine, start, today):
cursor.execute('INSERT INTO scrapers (scrapers_queries_id, scrapers_studies_id, scrapers_queries_query, scrapers_se, scrapers_start, scrapers_date, scrapers_progress) VALUES (%s, %s, %s, %s, %s, %s, %s);', (query_id, study_id, query_string, search_engine, start, today, 0))
def update_scraping_job(cursor, job_id, progress):
cursor.execute('UPDATE scrapers SET scrapers_progress = %s WHERE scrapers_id = %s', (progress, job_id))
def update_scraping_job_query(cursor, query_id, progress):
cursor.execute('UPDATE scrapers SET scrapers_progress = %s WHERE scrapers_queries_id = %s', (progress, query_id))
def update_scraping_job_query_se_job_id(cursor, query_id, progress, se, job_id):
cursor.execute('UPDATE scrapers SET scrapers_progress = %s WHERE scrapers_queries_id = %s AND scrapers_se = %s AND scrapers_id >= %s', (progress, query_id, se, job_id))
def update_scraping_job_query_search_engine(cursor, query_id, search_engine, progress):
cursor.execute('UPDATE scrapers SET scrapers_progress = %s WHERE scrapers_queries_id = %s AND scrapers_se =%s', (progress, query_id, search_engine))
def reset_scraping_jobs(cursor):
cursor.execute('DELETE FROM scrapers WHERE scrapers_progress = -1')
def get_scraping_jobs(cursor, query_id, study_id, search_engine):
sql = 'SELECT scrapers_id FROM scrapers WHERE scrapers_queries_id = %s AND scrapers_studies_id =%s AND scrapers_se = %s'
data = (query_id, study_id, search_engine)
cursor.execute(sql, data)
rows = cursor.fetchall()
return rows |
#
# PySNMP MIB module TIMETRA-IF-GROUP-HANDLER-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/TIMETRA-IF-GROUP-HANDLER-MIB
# Produced by pysmi-0.3.4 at Wed May 1 15:17:53 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
OctetString, ObjectIdentifier, Integer = mibBuilder.importSymbols("ASN1", "OctetString", "ObjectIdentifier", "Integer")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ConstraintsIntersection, ConstraintsUnion, ValueRangeConstraint, SingleValueConstraint, ValueSizeConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ConstraintsIntersection", "ConstraintsUnion", "ValueRangeConstraint", "SingleValueConstraint", "ValueSizeConstraint")
InterfaceIndexOrZero, = mibBuilder.importSymbols("IF-MIB", "InterfaceIndexOrZero")
ObjectGroup, ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ObjectGroup", "ModuleCompliance", "NotificationGroup")
Counter32, TimeTicks, Unsigned32, Integer32, Gauge32, ObjectIdentity, ModuleIdentity, MibScalar, MibTable, MibTableRow, MibTableColumn, Counter64, IpAddress, NotificationType, MibIdentifier, iso, Bits = mibBuilder.importSymbols("SNMPv2-SMI", "Counter32", "TimeTicks", "Unsigned32", "Integer32", "Gauge32", "ObjectIdentity", "ModuleIdentity", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Counter64", "IpAddress", "NotificationType", "MibIdentifier", "iso", "Bits")
DisplayString, TextualConvention, RowStatus, TimeStamp = mibBuilder.importSymbols("SNMPv2-TC", "DisplayString", "TextualConvention", "RowStatus", "TimeStamp")
tmnxChassisIndex, = mibBuilder.importSymbols("TIMETRA-CHASSIS-MIB", "tmnxChassisIndex")
tmnxSRNotifyPrefix, timetraSRMIBModules, tmnxSRConfs, tmnxSRObjs = mibBuilder.importSymbols("TIMETRA-GLOBAL-MIB", "tmnxSRNotifyPrefix", "timetraSRMIBModules", "tmnxSRConfs", "tmnxSRObjs")
tmnxPortPortID, = mibBuilder.importSymbols("TIMETRA-PORT-MIB", "tmnxPortPortID")
TmnxEncapVal, TmnxAdminState, TItemDescription, TmnxOperState = mibBuilder.importSymbols("TIMETRA-TC-MIB", "TmnxEncapVal", "TmnxAdminState", "TItemDescription", "TmnxOperState")
timetraIfGroupMIBModule = ModuleIdentity((1, 3, 6, 1, 4, 1, 6527, 1, 1, 3, 69))
timetraIfGroupMIBModule.setRevisions(('1909-02-28 00:00',))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
if mibBuilder.loadTexts: timetraIfGroupMIBModule.setRevisionsDescriptions(('Rev 1.0 28 Feb 2009 00:00 1.0 release of the TIMETRA-IF-GROUP-HANDLER-MIB.',))
if mibBuilder.loadTexts: timetraIfGroupMIBModule.setLastUpdated('0902280000Z')
if mibBuilder.loadTexts: timetraIfGroupMIBModule.setOrganization('Alcatel-Lucent')
if mibBuilder.loadTexts: timetraIfGroupMIBModule.setContactInfo('Alcatel-Lucent SROS Support Web: http://support.alcatel-lucent.com')
if mibBuilder.loadTexts: timetraIfGroupMIBModule.setDescription("This document is the SNMP MIB module to manage and provision the Interface Group Handler components of the Alcatel-Lucent SROS device. Copyright (c) 2009-2011 Alcatel-Lucent. All rights reserved. Reproduction of this document is authorized on the condition that the foregoing copyright notice is included. This SNMP MIB module (Specification) embodies Alcatel-Lucent's proprietary intellectual property. Alcatel-Lucent retains all title and ownership in the Specification, including any revisions. Alcatel-Lucent grants all interested parties a non-exclusive license to use and distribute an unmodified copy of this Specification in connection with management of Alcatel-Lucent products, and without fee, provided this copyright notice and license appear on all copies. This Specification is supplied 'as is', and Alcatel-Lucent makes no warranty, either express or implied, as to the use, operation, condition, or performance of the Specification.")
tmnxIfGroupObjs = MibIdentifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69))
tmnxIfGroupNotifyPrefix = MibIdentifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 3, 69))
tmnxIfGroupConformance = MibIdentifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69))
tmnxIfGroupConfigTimeStamps = MibIdentifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 0))
tmnxIfGroupConfigurations = MibIdentifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1))
tmnxIfGroupStatistics = MibIdentifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 2))
tmnxIfGroupNotifications = MibIdentifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 3, 69, 0))
tmnxIfGroupCompliances = MibIdentifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 1))
tmnxIfGroupGroups = MibIdentifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 2))
class TmnxIfGroupHandlerIndex(TextualConvention, Unsigned32):
description = 'The TmnxIfGroupHandlerIndex specifies the unique Interface Group Handler Identifier for an Interface Group Handler. The value zero (0) is only used by objects that reference a tmnxIfGroupHandlerConfigEntry. The value zero (0) represents an invalid index that specifies the object is not associated with an Interface Group Handler.'
status = 'current'
class TmnxIfGroupProtocolIndex(TextualConvention, Integer32):
description = 'The TmnxIfGroupProtocolIndex specifies the protocol used by an Interface Group Handler or member. The TmnxIfGroupProtocolIndex is defined as an enumeration of the following protocols: ipcp (1) -- IP Control Protocol ipv6cp (2) -- IPV6 Control Protocol mplscp (3) -- MPLS Control Protocol osicp (4) -- OSI Control Protocol'
status = 'current'
subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))
namedValues = NamedValues(("ipcp", 1), ("ipv6cp", 2), ("mplscp", 3), ("osicp", 4))
tmnxIfGrpHndlrCfgTblLastChanged = MibScalar((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 0, 1), TimeStamp()).setMaxAccess("readonly")
if mibBuilder.loadTexts: tmnxIfGrpHndlrCfgTblLastChanged.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGrpHndlrCfgTblLastChanged.setDescription('The tmnxIfGrpHndlrCfgTblLastChanged indicates the time, since system startup, when a row in the tmnxIfGroupHandlerConfigTable last changed.')
tmnxIfGroupHandlerConfigTable = MibTable((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 1), )
if mibBuilder.loadTexts: tmnxIfGroupHandlerConfigTable.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerConfigTable.setDescription('The tmnxIfGroupHandlerConfigTable consists of the Interface Group Handler configuration information.')
tmnxIfGroupHandlerConfigEntry = MibTableRow((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 1, 1), ).setIndexNames((0, "TIMETRA-CHASSIS-MIB", "tmnxChassisIndex"), (0, "TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHandlerIndex"))
if mibBuilder.loadTexts: tmnxIfGroupHandlerConfigEntry.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerConfigEntry.setDescription('The tmnxIfGroupHandlerConfigEntry contains information pertaining to an individual Interface Group Handler. Rows in this table are created and destroyed using the tmnxIfGroupHandlerRowStatus object.')
tmnxIfGroupHandlerIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 1, 1, 1), TmnxIfGroupHandlerIndex().subtype(subtypeSpec=ValueRangeConstraint(1, 4294967295)))
if mibBuilder.loadTexts: tmnxIfGroupHandlerIndex.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerIndex.setDescription('The tmnxIfGroupHandlerIndex specifies the row index of the Interface Group Handler.')
tmnxIfGroupHandlerRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 1, 1, 2), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: tmnxIfGroupHandlerRowStatus.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerRowStatus.setDescription('The tmnxIfGroupHandlerRowStatus controls the creation and deletion of row entries in the tmnxIfGroupHandlerConfigTable.')
tmnxIfGroupHandlerTimeStamp = MibTableColumn((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 1, 1, 3), TimeStamp()).setMaxAccess("readonly")
if mibBuilder.loadTexts: tmnxIfGroupHandlerTimeStamp.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerTimeStamp.setDescription('The tmnxIfGroupHandlerTimeStamp indicates the time, since system startup, of the last change to this row.')
tmnxIfGroupHandlerThreshold = MibTableColumn((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 1, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 8)).clone(1)).setMaxAccess("readcreate")
if mibBuilder.loadTexts: tmnxIfGroupHandlerThreshold.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerThreshold.setDescription('The value of tmnxIfGroupHandlerThreshold specifies the minimum number of Interface Group Handler Members that have to be active before the Interface Group Handler can be brought operationally up.')
tmnxIfGroupHandlerAdminStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 1, 1, 5), TmnxAdminState().clone('outOfService')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: tmnxIfGroupHandlerAdminStatus.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerAdminStatus.setDescription('The value of tmnxIfGroupHandlerAdminStatus specifies the administrative state of the Interface Group Handler.')
tmnxIfGroupHandlerProtoTable = MibTable((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 2), )
if mibBuilder.loadTexts: tmnxIfGroupHandlerProtoTable.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerProtoTable.setDescription('The tmnxIfGroupHandlerProtoTable consists of the operational status of the protocols per Interface Group Handler.')
tmnxIfGroupHandlerProtoEntry = MibTableRow((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 2, 1), ).setIndexNames((0, "TIMETRA-CHASSIS-MIB", "tmnxChassisIndex"), (0, "TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHandlerIndex"), (0, "TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHdlrProtoIndex"))
if mibBuilder.loadTexts: tmnxIfGroupHandlerProtoEntry.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerProtoEntry.setDescription("The tmnxIfGroupHandlerProtoEntry contains information pertaining to an individual Interface Group Handler's operational state. Rows in this table are created and destroyed by the system, and can not be created or deleted by SNMP SET operations. A row exists for every supported protocol for each Interface Group Handler entry.")
tmnxIfGroupHdlrProtoIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 2, 1, 1), TmnxIfGroupProtocolIndex())
if mibBuilder.loadTexts: tmnxIfGroupHdlrProtoIndex.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHdlrProtoIndex.setDescription('The tmnxIfGroupHdlrProtoIndex specifies the protocol index for the entry.')
tmnxIfGroupHdlrProtoStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 2, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2, 3, 4, 5))).clone(namedValues=NamedValues(("none", 0), ("blocked", 1), ("inhibited", 2), ("waiting", 3), ("pending", 4), ("up", 5)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: tmnxIfGroupHdlrProtoStatus.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHdlrProtoStatus.setDescription("The tmnxIfGroupHdlrProtoStatus indicates the operational state of the protocol for the Interface Group Handler. The valid states are: none (0) -- Initializing state. All member within the group are in state 'none (0)' for the given tmnxIfGroupHdlrProtoIndex. blocked (1) -- Administratively disabled. inhibited (2) -- Administratively enabled but tmnxIfGroupHandlerThreshold is not met for enough links that have tmnxIfGroupHdlrMemberProtoStatus set to 'ready (2)'. waiting (3) -- Administratively enabled but tmnxIfGroupHandlerThreshold is not met for enough links that have tmnxIfGroupHdlrMemberProtoStatus set to 'operational (4)' or better. pending (4) -- Administratively enabled but tmnxIfGroupHandlerThreshold is not met for enough links that have tmnxIfGroupHdlrMemberProtoStatus set to 'up (5)'. up (5) -- Administratively enabled but tmnxIfGroupHandlerThreshold is met with enough links that have tmnxIfGroupHdlrMemberProtoStatus set to 'up (5)'.")
tmnxIfGroupHdlrProtoActLinks = MibTableColumn((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 2, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: tmnxIfGroupHdlrProtoActLinks.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHdlrProtoActLinks.setDescription("The tmnxIfGroupHdlrProtoActLinks indicates the number of Interface Group Handler members with tmnxIfGroupHdlrProtoStatus set to 'up' (5).")
tmnxIfGroupHdlrProtoUpTime = MibTableColumn((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 2, 1, 4), Unsigned32()).setUnits('seconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: tmnxIfGroupHdlrProtoUpTime.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHdlrProtoUpTime.setDescription("The tmnxIfGroupHdlrProtoUpTime object indicates the time since the Interface Group Handler entered the 'up (5)' state indicated by the tmnxIfGroupHdlrProtoStatus object")
tmnxIfGrpHndlrMbrTblLastChanged = MibScalar((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 0, 2), TimeStamp()).setMaxAccess("readonly")
if mibBuilder.loadTexts: tmnxIfGrpHndlrMbrTblLastChanged.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGrpHndlrMbrTblLastChanged.setDescription('The tmnxIfGrpHndlrMbrTblLastChanged indicates the time, since system startup, when a row in the tmnxIfGroupHandlerMemberTable last changed.')
tmnxIfGroupHandlerMemberTable = MibTable((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 3), )
if mibBuilder.loadTexts: tmnxIfGroupHandlerMemberTable.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerMemberTable.setDescription('The tmnxIfGroupHandlerMemberTable consists of the members associated with the corresponding tmnxIfGroupHandlerConfigEntry.')
tmnxIfGroupHandlerMemberEntry = MibTableRow((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 3, 1), ).setIndexNames((0, "TIMETRA-CHASSIS-MIB", "tmnxChassisIndex"), (0, "TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHandlerIndex"), (0, "TIMETRA-PORT-MIB", "tmnxPortPortID"))
if mibBuilder.loadTexts: tmnxIfGroupHandlerMemberEntry.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerMemberEntry.setDescription('The tmnxIfGroupHandlerMemberEntry contains information pertaining to an individual member associated with a tmnxIfGroupHandlerConfigEntry. Rows in this table are created and destroyed using the tmnxIfGrpHandlerMemberRowStatus object.')
tmnxIfGrpHandlerMemberRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 3, 1, 1), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: tmnxIfGrpHandlerMemberRowStatus.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGrpHandlerMemberRowStatus.setDescription('The tmnxIfGrpHandlerMemberRowStatus controls the creation and deletion of row entries in the tmnxIfGroupHandlerMemberTable.')
tmnxIfGroupHdlrMemberProtoTable = MibTable((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 4), )
if mibBuilder.loadTexts: tmnxIfGroupHdlrMemberProtoTable.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHdlrMemberProtoTable.setDescription('The tmnxIfGroupHdlrMemberProtoTable consists of the information pertaining to the protocols per Interface Group Handler member.')
tmnxIfGroupHdlrMemberProtoEntry = MibTableRow((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 4, 1), ).setIndexNames((0, "TIMETRA-CHASSIS-MIB", "tmnxChassisIndex"), (0, "TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHandlerIndex"), (0, "TIMETRA-PORT-MIB", "tmnxPortPortID"), (0, "TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHdlrMemberProtoIndex"))
if mibBuilder.loadTexts: tmnxIfGroupHdlrMemberProtoEntry.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHdlrMemberProtoEntry.setDescription("The tmnxIfGroupHdlrMemberProtoEntry contains information pertaining to an individual Interface Group Handler's protocol information. Rows in this table are created and destroyed by the system, and can not be created or deleted by SNMP SET operations. A row exists for every supported protocol for each Interface Group Handler member entry.")
tmnxIfGroupHdlrMemberProtoIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 4, 1, 1), TmnxIfGroupProtocolIndex())
if mibBuilder.loadTexts: tmnxIfGroupHdlrMemberProtoIndex.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHdlrMemberProtoIndex.setDescription('The tmnxIfGroupHdlrMemberProtoIndex specifies the protocol index for the entry.')
tmnxIfGroupHdlrMemberProtoStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 4, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2, 3, 4, 5))).clone(namedValues=NamedValues(("none", 0), ("down", 1), ("ready", 2), ("running", 3), ("operational", 4), ("up", 5)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: tmnxIfGroupHdlrMemberProtoStatus.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHdlrMemberProtoStatus.setDescription("The tmnxIfGroupHdlrMemberProtoStatus indicates the operational state of the protocol for the Interface Group Handler member. Once a member has left the 'none (0)' state for a specific tmnxIfGroupHandlerIndex it will never return to the 'none (0)' state unless the member is removed from the group or an activity switch occurs, in which case, no state updates are required for the protocol and therefore the protocol is considered 'none (0)' once more. The valid states are: none (0) -- Initializing state. down (1) -- Not in a functional state. The object tmnxPortState is set to for this member is set to 'linkDown' or lower or this protocol is not configured properly. ready (2) -- Waiting for tmnxIfGroupHdlrMemberProtoStatus to be set to waiting or better to run this protocol. running (3) -- Protocol is running, but not operational. operational (4) -- Link is operational but we are waiting for tmnxIfGroupHdlrProtoStatus to be set to 'pending (4)' or better to leave this state. up (5) -- Protocol is decalared up.")
tmnxIfGroupHdlrMemberProtoUpTime = MibTableColumn((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 4, 1, 3), Unsigned32()).setUnits('seconds').setMaxAccess("readonly")
if mibBuilder.loadTexts: tmnxIfGroupHdlrMemberProtoUpTime.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHdlrMemberProtoUpTime.setDescription("The tmnxIfGroupHdlrMemberProtoUpTime object indicates the time since the member is 'up' (5)' as indicated by the tmnxIfGroupHdlrProtoStatus object.")
tmnxIfGroupHandlerProtoOprChange = NotificationType((1, 3, 6, 1, 4, 1, 6527, 3, 1, 3, 69, 0, 1)).setObjects(("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHandlerThreshold"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHandlerAdminStatus"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHdlrProtoStatus"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHdlrProtoActLinks"))
if mibBuilder.loadTexts: tmnxIfGroupHandlerProtoOprChange.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerProtoOprChange.setDescription("The tmnxIfGroupHandlerProtoOprChange notification indicates that the specified tmnxIfGroupHdlrProtoStatus has entered or left the 'up (5)' state.")
tmnxIfGroupHdlrMbrProtoOprChange = NotificationType((1, 3, 6, 1, 4, 1, 6527, 3, 1, 3, 69, 0, 2)).setObjects(("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHdlrMemberProtoStatus"))
if mibBuilder.loadTexts: tmnxIfGroupHdlrMbrProtoOprChange.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHdlrMbrProtoOprChange.setDescription("The tmnxIfGroupHdlrMbrProtoOprChange notification indicates that the specified tmnxIfGroupHdlrMemberProtoStatus has entered or left the 'up (5)' state.")
tmnxIfGroupHandlerCompliance = ModuleCompliance((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 1, 1)).setObjects(("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHandlerTimeStampGroup"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHandlerConfigGroup"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHandlerMemberGroup"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHandlerProtocolGroup"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHdlrNotificationGroup"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
tmnxIfGroupHandlerCompliance = tmnxIfGroupHandlerCompliance.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerCompliance.setDescription('The compliance statement for revision 1.0 of TIMETRA-IF-GROUP-HANDLER-MIB.')
tmnxIfGroupHandlerTimeStampGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 2, 1)).setObjects(("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGrpHndlrCfgTblLastChanged"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHandlerTimeStamp"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGrpHndlrMbrTblLastChanged"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
tmnxIfGroupHandlerTimeStampGroup = tmnxIfGroupHandlerTimeStampGroup.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerTimeStampGroup.setDescription('The group of objects that track configuration changes for the maintenance of Interface Group Handler for the 7x50.')
tmnxIfGroupHandlerConfigGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 2, 2)).setObjects(("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHandlerRowStatus"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHandlerThreshold"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHandlerAdminStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
tmnxIfGroupHandlerConfigGroup = tmnxIfGroupHandlerConfigGroup.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerConfigGroup.setDescription('The group of objects for management of Interface Group Handler configurations for the 7x50.')
tmnxIfGroupHandlerMemberGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 2, 3)).setObjects(("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGrpHandlerMemberRowStatus"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
tmnxIfGroupHandlerMemberGroup = tmnxIfGroupHandlerMemberGroup.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerMemberGroup.setDescription('The group of objects for management of Interface Group Handler Member configurations for the 7x50.')
tmnxIfGroupHandlerProtocolGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 2, 4)).setObjects(("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHdlrMemberProtoStatus"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHdlrMemberProtoUpTime"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHdlrProtoStatus"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHdlrProtoActLinks"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHdlrProtoUpTime"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
tmnxIfGroupHandlerProtocolGroup = tmnxIfGroupHandlerProtocolGroup.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHandlerProtocolGroup.setDescription('The group of objects for management of Interface Group Handler protocol configurations for the 7x50.')
tmnxIfGroupHdlrNotificationGroup = NotificationGroup((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 2, 5)).setObjects(("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHandlerProtoOprChange"), ("TIMETRA-IF-GROUP-HANDLER-MIB", "tmnxIfGroupHdlrMbrProtoOprChange"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
tmnxIfGroupHdlrNotificationGroup = tmnxIfGroupHdlrNotificationGroup.setStatus('current')
if mibBuilder.loadTexts: tmnxIfGroupHdlrNotificationGroup.setDescription('The tmnxIfGroupHdlrNotificationGroup consists of the notifications for generating events for Interface Group Handlers for the 7x50.')
mibBuilder.exportSymbols("TIMETRA-IF-GROUP-HANDLER-MIB", tmnxIfGroupHandlerRowStatus=tmnxIfGroupHandlerRowStatus, tmnxIfGroupHdlrProtoIndex=tmnxIfGroupHdlrProtoIndex, tmnxIfGroupHdlrMemberProtoUpTime=tmnxIfGroupHdlrMemberProtoUpTime, tmnxIfGroupHdlrMbrProtoOprChange=tmnxIfGroupHdlrMbrProtoOprChange, tmnxIfGroupHandlerTimeStampGroup=tmnxIfGroupHandlerTimeStampGroup, tmnxIfGroupHandlerProtocolGroup=tmnxIfGroupHandlerProtocolGroup, tmnxIfGroupConformance=tmnxIfGroupConformance, tmnxIfGroupHandlerProtoEntry=tmnxIfGroupHandlerProtoEntry, tmnxIfGroupNotifyPrefix=tmnxIfGroupNotifyPrefix, tmnxIfGroupCompliances=tmnxIfGroupCompliances, tmnxIfGrpHandlerMemberRowStatus=tmnxIfGrpHandlerMemberRowStatus, tmnxIfGroupHandlerMemberGroup=tmnxIfGroupHandlerMemberGroup, tmnxIfGroupConfigTimeStamps=tmnxIfGroupConfigTimeStamps, tmnxIfGroupHandlerProtoOprChange=tmnxIfGroupHandlerProtoOprChange, tmnxIfGrpHndlrCfgTblLastChanged=tmnxIfGrpHndlrCfgTblLastChanged, tmnxIfGroupNotifications=tmnxIfGroupNotifications, tmnxIfGroupHdlrProtoUpTime=tmnxIfGroupHdlrProtoUpTime, tmnxIfGroupHandlerConfigEntry=tmnxIfGroupHandlerConfigEntry, tmnxIfGroupHdlrMemberProtoEntry=tmnxIfGroupHdlrMemberProtoEntry, tmnxIfGroupHdlrProtoStatus=tmnxIfGroupHdlrProtoStatus, tmnxIfGroupHandlerProtoTable=tmnxIfGroupHandlerProtoTable, tmnxIfGroupHandlerCompliance=tmnxIfGroupHandlerCompliance, tmnxIfGroupHdlrMemberProtoIndex=tmnxIfGroupHdlrMemberProtoIndex, tmnxIfGroupStatistics=tmnxIfGroupStatistics, TmnxIfGroupHandlerIndex=TmnxIfGroupHandlerIndex, tmnxIfGroupHandlerConfigGroup=tmnxIfGroupHandlerConfigGroup, tmnxIfGroupHdlrMemberProtoTable=tmnxIfGroupHdlrMemberProtoTable, tmnxIfGroupHandlerTimeStamp=tmnxIfGroupHandlerTimeStamp, tmnxIfGroupHdlrProtoActLinks=tmnxIfGroupHdlrProtoActLinks, tmnxIfGroupHandlerConfigTable=tmnxIfGroupHandlerConfigTable, TmnxIfGroupProtocolIndex=TmnxIfGroupProtocolIndex, tmnxIfGroupHdlrNotificationGroup=tmnxIfGroupHdlrNotificationGroup, tmnxIfGroupObjs=tmnxIfGroupObjs, tmnxIfGroupHandlerIndex=tmnxIfGroupHandlerIndex, tmnxIfGroupHandlerThreshold=tmnxIfGroupHandlerThreshold, tmnxIfGroupHandlerAdminStatus=tmnxIfGroupHandlerAdminStatus, tmnxIfGroupHandlerMemberEntry=tmnxIfGroupHandlerMemberEntry, tmnxIfGroupConfigurations=tmnxIfGroupConfigurations, tmnxIfGrpHndlrMbrTblLastChanged=tmnxIfGrpHndlrMbrTblLastChanged, timetraIfGroupMIBModule=timetraIfGroupMIBModule, tmnxIfGroupHdlrMemberProtoStatus=tmnxIfGroupHdlrMemberProtoStatus, PYSNMP_MODULE_ID=timetraIfGroupMIBModule, tmnxIfGroupGroups=tmnxIfGroupGroups, tmnxIfGroupHandlerMemberTable=tmnxIfGroupHandlerMemberTable)
| (octet_string, object_identifier, integer) = mibBuilder.importSymbols('ASN1', 'OctetString', 'ObjectIdentifier', 'Integer')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(constraints_intersection, constraints_union, value_range_constraint, single_value_constraint, value_size_constraint) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ConstraintsIntersection', 'ConstraintsUnion', 'ValueRangeConstraint', 'SingleValueConstraint', 'ValueSizeConstraint')
(interface_index_or_zero,) = mibBuilder.importSymbols('IF-MIB', 'InterfaceIndexOrZero')
(object_group, module_compliance, notification_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ObjectGroup', 'ModuleCompliance', 'NotificationGroup')
(counter32, time_ticks, unsigned32, integer32, gauge32, object_identity, module_identity, mib_scalar, mib_table, mib_table_row, mib_table_column, counter64, ip_address, notification_type, mib_identifier, iso, bits) = mibBuilder.importSymbols('SNMPv2-SMI', 'Counter32', 'TimeTicks', 'Unsigned32', 'Integer32', 'Gauge32', 'ObjectIdentity', 'ModuleIdentity', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'Counter64', 'IpAddress', 'NotificationType', 'MibIdentifier', 'iso', 'Bits')
(display_string, textual_convention, row_status, time_stamp) = mibBuilder.importSymbols('SNMPv2-TC', 'DisplayString', 'TextualConvention', 'RowStatus', 'TimeStamp')
(tmnx_chassis_index,) = mibBuilder.importSymbols('TIMETRA-CHASSIS-MIB', 'tmnxChassisIndex')
(tmnx_sr_notify_prefix, timetra_srmib_modules, tmnx_sr_confs, tmnx_sr_objs) = mibBuilder.importSymbols('TIMETRA-GLOBAL-MIB', 'tmnxSRNotifyPrefix', 'timetraSRMIBModules', 'tmnxSRConfs', 'tmnxSRObjs')
(tmnx_port_port_id,) = mibBuilder.importSymbols('TIMETRA-PORT-MIB', 'tmnxPortPortID')
(tmnx_encap_val, tmnx_admin_state, t_item_description, tmnx_oper_state) = mibBuilder.importSymbols('TIMETRA-TC-MIB', 'TmnxEncapVal', 'TmnxAdminState', 'TItemDescription', 'TmnxOperState')
timetra_if_group_mib_module = module_identity((1, 3, 6, 1, 4, 1, 6527, 1, 1, 3, 69))
timetraIfGroupMIBModule.setRevisions(('1909-02-28 00:00',))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
if mibBuilder.loadTexts:
timetraIfGroupMIBModule.setRevisionsDescriptions(('Rev 1.0 28 Feb 2009 00:00 1.0 release of the TIMETRA-IF-GROUP-HANDLER-MIB.',))
if mibBuilder.loadTexts:
timetraIfGroupMIBModule.setLastUpdated('0902280000Z')
if mibBuilder.loadTexts:
timetraIfGroupMIBModule.setOrganization('Alcatel-Lucent')
if mibBuilder.loadTexts:
timetraIfGroupMIBModule.setContactInfo('Alcatel-Lucent SROS Support Web: http://support.alcatel-lucent.com')
if mibBuilder.loadTexts:
timetraIfGroupMIBModule.setDescription("This document is the SNMP MIB module to manage and provision the Interface Group Handler components of the Alcatel-Lucent SROS device. Copyright (c) 2009-2011 Alcatel-Lucent. All rights reserved. Reproduction of this document is authorized on the condition that the foregoing copyright notice is included. This SNMP MIB module (Specification) embodies Alcatel-Lucent's proprietary intellectual property. Alcatel-Lucent retains all title and ownership in the Specification, including any revisions. Alcatel-Lucent grants all interested parties a non-exclusive license to use and distribute an unmodified copy of this Specification in connection with management of Alcatel-Lucent products, and without fee, provided this copyright notice and license appear on all copies. This Specification is supplied 'as is', and Alcatel-Lucent makes no warranty, either express or implied, as to the use, operation, condition, or performance of the Specification.")
tmnx_if_group_objs = mib_identifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69))
tmnx_if_group_notify_prefix = mib_identifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 3, 69))
tmnx_if_group_conformance = mib_identifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69))
tmnx_if_group_config_time_stamps = mib_identifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 0))
tmnx_if_group_configurations = mib_identifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1))
tmnx_if_group_statistics = mib_identifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 2))
tmnx_if_group_notifications = mib_identifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 3, 69, 0))
tmnx_if_group_compliances = mib_identifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 1))
tmnx_if_group_groups = mib_identifier((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 2))
class Tmnxifgrouphandlerindex(TextualConvention, Unsigned32):
description = 'The TmnxIfGroupHandlerIndex specifies the unique Interface Group Handler Identifier for an Interface Group Handler. The value zero (0) is only used by objects that reference a tmnxIfGroupHandlerConfigEntry. The value zero (0) represents an invalid index that specifies the object is not associated with an Interface Group Handler.'
status = 'current'
class Tmnxifgroupprotocolindex(TextualConvention, Integer32):
description = 'The TmnxIfGroupProtocolIndex specifies the protocol used by an Interface Group Handler or member. The TmnxIfGroupProtocolIndex is defined as an enumeration of the following protocols: ipcp (1) -- IP Control Protocol ipv6cp (2) -- IPV6 Control Protocol mplscp (3) -- MPLS Control Protocol osicp (4) -- OSI Control Protocol'
status = 'current'
subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(1, 2, 3, 4))
named_values = named_values(('ipcp', 1), ('ipv6cp', 2), ('mplscp', 3), ('osicp', 4))
tmnx_if_grp_hndlr_cfg_tbl_last_changed = mib_scalar((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 0, 1), time_stamp()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
tmnxIfGrpHndlrCfgTblLastChanged.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGrpHndlrCfgTblLastChanged.setDescription('The tmnxIfGrpHndlrCfgTblLastChanged indicates the time, since system startup, when a row in the tmnxIfGroupHandlerConfigTable last changed.')
tmnx_if_group_handler_config_table = mib_table((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 1))
if mibBuilder.loadTexts:
tmnxIfGroupHandlerConfigTable.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerConfigTable.setDescription('The tmnxIfGroupHandlerConfigTable consists of the Interface Group Handler configuration information.')
tmnx_if_group_handler_config_entry = mib_table_row((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 1, 1)).setIndexNames((0, 'TIMETRA-CHASSIS-MIB', 'tmnxChassisIndex'), (0, 'TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHandlerIndex'))
if mibBuilder.loadTexts:
tmnxIfGroupHandlerConfigEntry.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerConfigEntry.setDescription('The tmnxIfGroupHandlerConfigEntry contains information pertaining to an individual Interface Group Handler. Rows in this table are created and destroyed using the tmnxIfGroupHandlerRowStatus object.')
tmnx_if_group_handler_index = mib_table_column((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 1, 1, 1), tmnx_if_group_handler_index().subtype(subtypeSpec=value_range_constraint(1, 4294967295)))
if mibBuilder.loadTexts:
tmnxIfGroupHandlerIndex.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerIndex.setDescription('The tmnxIfGroupHandlerIndex specifies the row index of the Interface Group Handler.')
tmnx_if_group_handler_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 1, 1, 2), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerRowStatus.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerRowStatus.setDescription('The tmnxIfGroupHandlerRowStatus controls the creation and deletion of row entries in the tmnxIfGroupHandlerConfigTable.')
tmnx_if_group_handler_time_stamp = mib_table_column((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 1, 1, 3), time_stamp()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerTimeStamp.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerTimeStamp.setDescription('The tmnxIfGroupHandlerTimeStamp indicates the time, since system startup, of the last change to this row.')
tmnx_if_group_handler_threshold = mib_table_column((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 1, 1, 4), unsigned32().subtype(subtypeSpec=value_range_constraint(1, 8)).clone(1)).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerThreshold.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerThreshold.setDescription('The value of tmnxIfGroupHandlerThreshold specifies the minimum number of Interface Group Handler Members that have to be active before the Interface Group Handler can be brought operationally up.')
tmnx_if_group_handler_admin_status = mib_table_column((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 1, 1, 5), tmnx_admin_state().clone('outOfService')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerAdminStatus.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerAdminStatus.setDescription('The value of tmnxIfGroupHandlerAdminStatus specifies the administrative state of the Interface Group Handler.')
tmnx_if_group_handler_proto_table = mib_table((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 2))
if mibBuilder.loadTexts:
tmnxIfGroupHandlerProtoTable.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerProtoTable.setDescription('The tmnxIfGroupHandlerProtoTable consists of the operational status of the protocols per Interface Group Handler.')
tmnx_if_group_handler_proto_entry = mib_table_row((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 2, 1)).setIndexNames((0, 'TIMETRA-CHASSIS-MIB', 'tmnxChassisIndex'), (0, 'TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHandlerIndex'), (0, 'TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHdlrProtoIndex'))
if mibBuilder.loadTexts:
tmnxIfGroupHandlerProtoEntry.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerProtoEntry.setDescription("The tmnxIfGroupHandlerProtoEntry contains information pertaining to an individual Interface Group Handler's operational state. Rows in this table are created and destroyed by the system, and can not be created or deleted by SNMP SET operations. A row exists for every supported protocol for each Interface Group Handler entry.")
tmnx_if_group_hdlr_proto_index = mib_table_column((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 2, 1, 1), tmnx_if_group_protocol_index())
if mibBuilder.loadTexts:
tmnxIfGroupHdlrProtoIndex.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrProtoIndex.setDescription('The tmnxIfGroupHdlrProtoIndex specifies the protocol index for the entry.')
tmnx_if_group_hdlr_proto_status = mib_table_column((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 2, 1, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2, 3, 4, 5))).clone(namedValues=named_values(('none', 0), ('blocked', 1), ('inhibited', 2), ('waiting', 3), ('pending', 4), ('up', 5)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrProtoStatus.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrProtoStatus.setDescription("The tmnxIfGroupHdlrProtoStatus indicates the operational state of the protocol for the Interface Group Handler. The valid states are: none (0) -- Initializing state. All member within the group are in state 'none (0)' for the given tmnxIfGroupHdlrProtoIndex. blocked (1) -- Administratively disabled. inhibited (2) -- Administratively enabled but tmnxIfGroupHandlerThreshold is not met for enough links that have tmnxIfGroupHdlrMemberProtoStatus set to 'ready (2)'. waiting (3) -- Administratively enabled but tmnxIfGroupHandlerThreshold is not met for enough links that have tmnxIfGroupHdlrMemberProtoStatus set to 'operational (4)' or better. pending (4) -- Administratively enabled but tmnxIfGroupHandlerThreshold is not met for enough links that have tmnxIfGroupHdlrMemberProtoStatus set to 'up (5)'. up (5) -- Administratively enabled but tmnxIfGroupHandlerThreshold is met with enough links that have tmnxIfGroupHdlrMemberProtoStatus set to 'up (5)'.")
tmnx_if_group_hdlr_proto_act_links = mib_table_column((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 2, 1, 3), unsigned32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrProtoActLinks.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrProtoActLinks.setDescription("The tmnxIfGroupHdlrProtoActLinks indicates the number of Interface Group Handler members with tmnxIfGroupHdlrProtoStatus set to 'up' (5).")
tmnx_if_group_hdlr_proto_up_time = mib_table_column((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 2, 1, 4), unsigned32()).setUnits('seconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrProtoUpTime.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrProtoUpTime.setDescription("The tmnxIfGroupHdlrProtoUpTime object indicates the time since the Interface Group Handler entered the 'up (5)' state indicated by the tmnxIfGroupHdlrProtoStatus object")
tmnx_if_grp_hndlr_mbr_tbl_last_changed = mib_scalar((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 0, 2), time_stamp()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
tmnxIfGrpHndlrMbrTblLastChanged.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGrpHndlrMbrTblLastChanged.setDescription('The tmnxIfGrpHndlrMbrTblLastChanged indicates the time, since system startup, when a row in the tmnxIfGroupHandlerMemberTable last changed.')
tmnx_if_group_handler_member_table = mib_table((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 3))
if mibBuilder.loadTexts:
tmnxIfGroupHandlerMemberTable.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerMemberTable.setDescription('The tmnxIfGroupHandlerMemberTable consists of the members associated with the corresponding tmnxIfGroupHandlerConfigEntry.')
tmnx_if_group_handler_member_entry = mib_table_row((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 3, 1)).setIndexNames((0, 'TIMETRA-CHASSIS-MIB', 'tmnxChassisIndex'), (0, 'TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHandlerIndex'), (0, 'TIMETRA-PORT-MIB', 'tmnxPortPortID'))
if mibBuilder.loadTexts:
tmnxIfGroupHandlerMemberEntry.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerMemberEntry.setDescription('The tmnxIfGroupHandlerMemberEntry contains information pertaining to an individual member associated with a tmnxIfGroupHandlerConfigEntry. Rows in this table are created and destroyed using the tmnxIfGrpHandlerMemberRowStatus object.')
tmnx_if_grp_handler_member_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 3, 1, 1), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
tmnxIfGrpHandlerMemberRowStatus.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGrpHandlerMemberRowStatus.setDescription('The tmnxIfGrpHandlerMemberRowStatus controls the creation and deletion of row entries in the tmnxIfGroupHandlerMemberTable.')
tmnx_if_group_hdlr_member_proto_table = mib_table((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 4))
if mibBuilder.loadTexts:
tmnxIfGroupHdlrMemberProtoTable.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrMemberProtoTable.setDescription('The tmnxIfGroupHdlrMemberProtoTable consists of the information pertaining to the protocols per Interface Group Handler member.')
tmnx_if_group_hdlr_member_proto_entry = mib_table_row((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 4, 1)).setIndexNames((0, 'TIMETRA-CHASSIS-MIB', 'tmnxChassisIndex'), (0, 'TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHandlerIndex'), (0, 'TIMETRA-PORT-MIB', 'tmnxPortPortID'), (0, 'TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHdlrMemberProtoIndex'))
if mibBuilder.loadTexts:
tmnxIfGroupHdlrMemberProtoEntry.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrMemberProtoEntry.setDescription("The tmnxIfGroupHdlrMemberProtoEntry contains information pertaining to an individual Interface Group Handler's protocol information. Rows in this table are created and destroyed by the system, and can not be created or deleted by SNMP SET operations. A row exists for every supported protocol for each Interface Group Handler member entry.")
tmnx_if_group_hdlr_member_proto_index = mib_table_column((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 4, 1, 1), tmnx_if_group_protocol_index())
if mibBuilder.loadTexts:
tmnxIfGroupHdlrMemberProtoIndex.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrMemberProtoIndex.setDescription('The tmnxIfGroupHdlrMemberProtoIndex specifies the protocol index for the entry.')
tmnx_if_group_hdlr_member_proto_status = mib_table_column((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 4, 1, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2, 3, 4, 5))).clone(namedValues=named_values(('none', 0), ('down', 1), ('ready', 2), ('running', 3), ('operational', 4), ('up', 5)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrMemberProtoStatus.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrMemberProtoStatus.setDescription("The tmnxIfGroupHdlrMemberProtoStatus indicates the operational state of the protocol for the Interface Group Handler member. Once a member has left the 'none (0)' state for a specific tmnxIfGroupHandlerIndex it will never return to the 'none (0)' state unless the member is removed from the group or an activity switch occurs, in which case, no state updates are required for the protocol and therefore the protocol is considered 'none (0)' once more. The valid states are: none (0) -- Initializing state. down (1) -- Not in a functional state. The object tmnxPortState is set to for this member is set to 'linkDown' or lower or this protocol is not configured properly. ready (2) -- Waiting for tmnxIfGroupHdlrMemberProtoStatus to be set to waiting or better to run this protocol. running (3) -- Protocol is running, but not operational. operational (4) -- Link is operational but we are waiting for tmnxIfGroupHdlrProtoStatus to be set to 'pending (4)' or better to leave this state. up (5) -- Protocol is decalared up.")
tmnx_if_group_hdlr_member_proto_up_time = mib_table_column((1, 3, 6, 1, 4, 1, 6527, 3, 1, 2, 69, 1, 4, 1, 3), unsigned32()).setUnits('seconds').setMaxAccess('readonly')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrMemberProtoUpTime.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrMemberProtoUpTime.setDescription("The tmnxIfGroupHdlrMemberProtoUpTime object indicates the time since the member is 'up' (5)' as indicated by the tmnxIfGroupHdlrProtoStatus object.")
tmnx_if_group_handler_proto_opr_change = notification_type((1, 3, 6, 1, 4, 1, 6527, 3, 1, 3, 69, 0, 1)).setObjects(('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHandlerThreshold'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHandlerAdminStatus'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHdlrProtoStatus'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHdlrProtoActLinks'))
if mibBuilder.loadTexts:
tmnxIfGroupHandlerProtoOprChange.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerProtoOprChange.setDescription("The tmnxIfGroupHandlerProtoOprChange notification indicates that the specified tmnxIfGroupHdlrProtoStatus has entered or left the 'up (5)' state.")
tmnx_if_group_hdlr_mbr_proto_opr_change = notification_type((1, 3, 6, 1, 4, 1, 6527, 3, 1, 3, 69, 0, 2)).setObjects(('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHdlrMemberProtoStatus'))
if mibBuilder.loadTexts:
tmnxIfGroupHdlrMbrProtoOprChange.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrMbrProtoOprChange.setDescription("The tmnxIfGroupHdlrMbrProtoOprChange notification indicates that the specified tmnxIfGroupHdlrMemberProtoStatus has entered or left the 'up (5)' state.")
tmnx_if_group_handler_compliance = module_compliance((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 1, 1)).setObjects(('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHandlerTimeStampGroup'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHandlerConfigGroup'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHandlerMemberGroup'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHandlerProtocolGroup'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHdlrNotificationGroup'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
tmnx_if_group_handler_compliance = tmnxIfGroupHandlerCompliance.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerCompliance.setDescription('The compliance statement for revision 1.0 of TIMETRA-IF-GROUP-HANDLER-MIB.')
tmnx_if_group_handler_time_stamp_group = object_group((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 2, 1)).setObjects(('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGrpHndlrCfgTblLastChanged'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHandlerTimeStamp'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGrpHndlrMbrTblLastChanged'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
tmnx_if_group_handler_time_stamp_group = tmnxIfGroupHandlerTimeStampGroup.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerTimeStampGroup.setDescription('The group of objects that track configuration changes for the maintenance of Interface Group Handler for the 7x50.')
tmnx_if_group_handler_config_group = object_group((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 2, 2)).setObjects(('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHandlerRowStatus'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHandlerThreshold'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHandlerAdminStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
tmnx_if_group_handler_config_group = tmnxIfGroupHandlerConfigGroup.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerConfigGroup.setDescription('The group of objects for management of Interface Group Handler configurations for the 7x50.')
tmnx_if_group_handler_member_group = object_group((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 2, 3)).setObjects(('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGrpHandlerMemberRowStatus'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
tmnx_if_group_handler_member_group = tmnxIfGroupHandlerMemberGroup.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerMemberGroup.setDescription('The group of objects for management of Interface Group Handler Member configurations for the 7x50.')
tmnx_if_group_handler_protocol_group = object_group((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 2, 4)).setObjects(('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHdlrMemberProtoStatus'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHdlrMemberProtoUpTime'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHdlrProtoStatus'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHdlrProtoActLinks'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHdlrProtoUpTime'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
tmnx_if_group_handler_protocol_group = tmnxIfGroupHandlerProtocolGroup.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHandlerProtocolGroup.setDescription('The group of objects for management of Interface Group Handler protocol configurations for the 7x50.')
tmnx_if_group_hdlr_notification_group = notification_group((1, 3, 6, 1, 4, 1, 6527, 3, 1, 1, 69, 2, 5)).setObjects(('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHandlerProtoOprChange'), ('TIMETRA-IF-GROUP-HANDLER-MIB', 'tmnxIfGroupHdlrMbrProtoOprChange'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
tmnx_if_group_hdlr_notification_group = tmnxIfGroupHdlrNotificationGroup.setStatus('current')
if mibBuilder.loadTexts:
tmnxIfGroupHdlrNotificationGroup.setDescription('The tmnxIfGroupHdlrNotificationGroup consists of the notifications for generating events for Interface Group Handlers for the 7x50.')
mibBuilder.exportSymbols('TIMETRA-IF-GROUP-HANDLER-MIB', tmnxIfGroupHandlerRowStatus=tmnxIfGroupHandlerRowStatus, tmnxIfGroupHdlrProtoIndex=tmnxIfGroupHdlrProtoIndex, tmnxIfGroupHdlrMemberProtoUpTime=tmnxIfGroupHdlrMemberProtoUpTime, tmnxIfGroupHdlrMbrProtoOprChange=tmnxIfGroupHdlrMbrProtoOprChange, tmnxIfGroupHandlerTimeStampGroup=tmnxIfGroupHandlerTimeStampGroup, tmnxIfGroupHandlerProtocolGroup=tmnxIfGroupHandlerProtocolGroup, tmnxIfGroupConformance=tmnxIfGroupConformance, tmnxIfGroupHandlerProtoEntry=tmnxIfGroupHandlerProtoEntry, tmnxIfGroupNotifyPrefix=tmnxIfGroupNotifyPrefix, tmnxIfGroupCompliances=tmnxIfGroupCompliances, tmnxIfGrpHandlerMemberRowStatus=tmnxIfGrpHandlerMemberRowStatus, tmnxIfGroupHandlerMemberGroup=tmnxIfGroupHandlerMemberGroup, tmnxIfGroupConfigTimeStamps=tmnxIfGroupConfigTimeStamps, tmnxIfGroupHandlerProtoOprChange=tmnxIfGroupHandlerProtoOprChange, tmnxIfGrpHndlrCfgTblLastChanged=tmnxIfGrpHndlrCfgTblLastChanged, tmnxIfGroupNotifications=tmnxIfGroupNotifications, tmnxIfGroupHdlrProtoUpTime=tmnxIfGroupHdlrProtoUpTime, tmnxIfGroupHandlerConfigEntry=tmnxIfGroupHandlerConfigEntry, tmnxIfGroupHdlrMemberProtoEntry=tmnxIfGroupHdlrMemberProtoEntry, tmnxIfGroupHdlrProtoStatus=tmnxIfGroupHdlrProtoStatus, tmnxIfGroupHandlerProtoTable=tmnxIfGroupHandlerProtoTable, tmnxIfGroupHandlerCompliance=tmnxIfGroupHandlerCompliance, tmnxIfGroupHdlrMemberProtoIndex=tmnxIfGroupHdlrMemberProtoIndex, tmnxIfGroupStatistics=tmnxIfGroupStatistics, TmnxIfGroupHandlerIndex=TmnxIfGroupHandlerIndex, tmnxIfGroupHandlerConfigGroup=tmnxIfGroupHandlerConfigGroup, tmnxIfGroupHdlrMemberProtoTable=tmnxIfGroupHdlrMemberProtoTable, tmnxIfGroupHandlerTimeStamp=tmnxIfGroupHandlerTimeStamp, tmnxIfGroupHdlrProtoActLinks=tmnxIfGroupHdlrProtoActLinks, tmnxIfGroupHandlerConfigTable=tmnxIfGroupHandlerConfigTable, TmnxIfGroupProtocolIndex=TmnxIfGroupProtocolIndex, tmnxIfGroupHdlrNotificationGroup=tmnxIfGroupHdlrNotificationGroup, tmnxIfGroupObjs=tmnxIfGroupObjs, tmnxIfGroupHandlerIndex=tmnxIfGroupHandlerIndex, tmnxIfGroupHandlerThreshold=tmnxIfGroupHandlerThreshold, tmnxIfGroupHandlerAdminStatus=tmnxIfGroupHandlerAdminStatus, tmnxIfGroupHandlerMemberEntry=tmnxIfGroupHandlerMemberEntry, tmnxIfGroupConfigurations=tmnxIfGroupConfigurations, tmnxIfGrpHndlrMbrTblLastChanged=tmnxIfGrpHndlrMbrTblLastChanged, timetraIfGroupMIBModule=timetraIfGroupMIBModule, tmnxIfGroupHdlrMemberProtoStatus=tmnxIfGroupHdlrMemberProtoStatus, PYSNMP_MODULE_ID=timetraIfGroupMIBModule, tmnxIfGroupGroups=tmnxIfGroupGroups, tmnxIfGroupHandlerMemberTable=tmnxIfGroupHandlerMemberTable) |
class JobResult():
def __init__(self, job, build_number, status):
self.job = job
self.build_number = int(build_number)
self.status = status
def __repr__(self):
return "job: %s, build number: %s, status: %s" % (self.job, self.build_number, self.status)
| class Jobresult:
def __init__(self, job, build_number, status):
self.job = job
self.build_number = int(build_number)
self.status = status
def __repr__(self):
return 'job: %s, build number: %s, status: %s' % (self.job, self.build_number, self.status) |
# Please refer to sanitizers.gni for detail.
load("@cc//:compiler.bzl", "is_linux", "is_x64")
load("//third_party/chromium/build/config:buildconfig.bzl", "IS_OFFICIAL_BUILD")
IS_HWASAN = False
IS_CFI = is_linux() and is_x64()
USE_CFI_CAST = False
USE_CFI_ICALL = is_linux() and is_x64() and IS_OFFICIAL_BUILD
USE_CFI_DIAG = False
USE_CFI_RECOVER = False
USING_SANITIZER = IS_HWASAN or USE_CFI_DIAG # and more
| load('@cc//:compiler.bzl', 'is_linux', 'is_x64')
load('//third_party/chromium/build/config:buildconfig.bzl', 'IS_OFFICIAL_BUILD')
is_hwasan = False
is_cfi = is_linux() and is_x64()
use_cfi_cast = False
use_cfi_icall = is_linux() and is_x64() and IS_OFFICIAL_BUILD
use_cfi_diag = False
use_cfi_recover = False
using_sanitizer = IS_HWASAN or USE_CFI_DIAG |
class Character:
def __init__(self, health, power):
self.health=health
self.power=power
class Hero(Character):
def __init__(self):
super(Hero, self).__init__(10,5)
class Goblin(Character):
def __init__(self):
super(Goblin, self).__init__(6,2) | class Character:
def __init__(self, health, power):
self.health = health
self.power = power
class Hero(Character):
def __init__(self):
super(Hero, self).__init__(10, 5)
class Goblin(Character):
def __init__(self):
super(Goblin, self).__init__(6, 2) |
def findDecision(obj): #obj[0]: Coupon, obj[1]: Education, obj[2]: Occupation
# {"feature": "Coupon", "instances": 8148, "metric_value": 0.4751, "depth": 1}
if obj[0]>1:
# {"feature": "Education", "instances": 5867, "metric_value": 0.4695, "depth": 2}
if obj[1]>0:
# {"feature": "Occupation", "instances": 3831, "metric_value": 0.476, "depth": 3}
if obj[2]<=19.12113309419569:
return 'True'
elif obj[2]>19.12113309419569:
return 'True'
else: return 'True'
elif obj[1]<=0:
# {"feature": "Occupation", "instances": 2036, "metric_value": 0.4536, "depth": 3}
if obj[2]<=19.16456021452013:
return 'True'
elif obj[2]>19.16456021452013:
return 'True'
else: return 'True'
else: return 'True'
elif obj[0]<=1:
# {"feature": "Occupation", "instances": 2281, "metric_value": 0.4847, "depth": 2}
if obj[2]>2.070384793617607:
# {"feature": "Education", "instances": 1816, "metric_value": 0.4893, "depth": 3}
if obj[1]>0:
return 'False'
elif obj[1]<=0:
return 'False'
else: return 'False'
elif obj[2]<=2.070384793617607:
# {"feature": "Education", "instances": 465, "metric_value": 0.4291, "depth": 3}
if obj[1]<=3:
return 'False'
elif obj[1]>3:
return 'True'
else: return 'True'
else: return 'False'
else: return 'False'
| def find_decision(obj):
if obj[0] > 1:
if obj[1] > 0:
if obj[2] <= 19.12113309419569:
return 'True'
elif obj[2] > 19.12113309419569:
return 'True'
else:
return 'True'
elif obj[1] <= 0:
if obj[2] <= 19.16456021452013:
return 'True'
elif obj[2] > 19.16456021452013:
return 'True'
else:
return 'True'
else:
return 'True'
elif obj[0] <= 1:
if obj[2] > 2.070384793617607:
if obj[1] > 0:
return 'False'
elif obj[1] <= 0:
return 'False'
else:
return 'False'
elif obj[2] <= 2.070384793617607:
if obj[1] <= 3:
return 'False'
elif obj[1] > 3:
return 'True'
else:
return 'True'
else:
return 'False'
else:
return 'False' |
class Progress:
prg = '|/-\\'
prg_len = len(prg)
def __init__(self, total=0):
self.i = 0
self.total = total
self.val = ''
self.update = self._progress if total else self._spin
def _spin(self):
self.i %= self.prg_len
self.val = self.prg[self.i]
def _progress(self):
self.val = f'{self.i*100/self.total:3.2f}%'
def __call__(self, desc=''):
self.i += 1
self.update()
print(f'\r{self.val} {desc[-40:]}', end='\x1b[1K')
if self.total != 0 and self.total == self.i:
self.__del__()
def __del__(self):
print('\r', end='\x1b[1K\r', flush=True)
| class Progress:
prg = '|/-\\'
prg_len = len(prg)
def __init__(self, total=0):
self.i = 0
self.total = total
self.val = ''
self.update = self._progress if total else self._spin
def _spin(self):
self.i %= self.prg_len
self.val = self.prg[self.i]
def _progress(self):
self.val = f'{self.i * 100 / self.total:3.2f}%'
def __call__(self, desc=''):
self.i += 1
self.update()
print(f'\r{self.val} {desc[-40:]}', end='\x1b[1K')
if self.total != 0 and self.total == self.i:
self.__del__()
def __del__(self):
print('\r', end='\x1b[1K\r', flush=True) |
n = int(input())
def encontrarCamino(viajes,temp,camino,CaminoActual,llaves):
if temp == "C-137" and CaminoActual!=0:
camino.append(CaminoActual)
return camino
else:
if temp in llaves:
for i in viajes[temp]:
caminos=encontrarCamino(viajes,i,camino,CaminoActual+1,llaves)
return caminos
else:
camino.append(-1)
return camino
for _ in range (0,n):
cant = int(input())
viajes = {}
inicio = "C-137"
final= ""
llaves = []
for j in range(0,cant):
temp = input()
dest = temp.split()
if dest[0] not in viajes:
llaves.append(dest[0])
viajes[dest[0]]=[dest[1]]
else:
viajes[dest[0]].append(dest[1])
final=dest[1]
camino = encontrarCamino(viajes,inicio,[],0,llaves)
bandera=True
camino.sort()
for i in camino:
if i != -1:
print("Pueden volver a C-137 en "+str(i)+" saltos")
bandera=False
break
if bandera:
print("Deambulan por el multiverso")
| n = int(input())
def encontrar_camino(viajes, temp, camino, CaminoActual, llaves):
if temp == 'C-137' and CaminoActual != 0:
camino.append(CaminoActual)
return camino
elif temp in llaves:
for i in viajes[temp]:
caminos = encontrar_camino(viajes, i, camino, CaminoActual + 1, llaves)
return caminos
else:
camino.append(-1)
return camino
for _ in range(0, n):
cant = int(input())
viajes = {}
inicio = 'C-137'
final = ''
llaves = []
for j in range(0, cant):
temp = input()
dest = temp.split()
if dest[0] not in viajes:
llaves.append(dest[0])
viajes[dest[0]] = [dest[1]]
else:
viajes[dest[0]].append(dest[1])
final = dest[1]
camino = encontrar_camino(viajes, inicio, [], 0, llaves)
bandera = True
camino.sort()
for i in camino:
if i != -1:
print('Pueden volver a C-137 en ' + str(i) + ' saltos')
bandera = False
break
if bandera:
print('Deambulan por el multiverso') |
#Find a Motif in DNA:
string = "AACTATGCAACTATGAAACTATGAACTATGATTCCAACTATGTAACTATGATGCATTAAACTATGAAACTATGAACTATGAACTATGAACTATGAAACTATGCGGAACTATGAACTATGGGGACAACTATGGAACTATGAGAACTATGTCAATTAACTATGCGTAACTATGGTCGAAACTATGAACTATGGAACTATGGCAACTATGCAAACTATGAAACTATGTAACTATGTGAAGGACGCACTAACTATGAGAAACTATGAACTATGAACTATGAACTATGCACGCGTTGTAACTATGATGACGATGAACTATGTATTAACTATGACCGAACTATGTCAACTATGTTTTAACTATGAAACTATGTAACTATGTGGTCAACTATGGCATTCCAACTATGGAACTATGAACTATGGTACCTAACTATGATCTGAAACTATGAACTATGGCAACTATGAACTATGGAAGAATCGCGGCTACCTTTCTCGAACTATGGAATTTAACTATGGAACTATGCTGAAACTATGAACCAAACTATGTAAACTATGAACTATGAAACTATGGCTAGAACTATGATGTAACTATGAAACTATGAACTATGAACTATGAACTATGGAACTATGGTTGATAACTATGCAACGGTACGATGGTCGTCAACTATGAACTATGGAAACTATGGAACTATGAACTATGTGTCAACTATGAACTATGTGGAACTATGCCTAAACTATGCTTCCTCTCACGTGTACGAAACTATGCGAAACTATGAACTATGATGCTCAATGAACTATGCAACTATGCTAACTATGTCTTTGTTCAACTATGACAACTATGTGGGCAACTATGAACTATGGGAACTATGAACTATGAACTATGTCATATATGAAGTAACTATGAACTATGAACTATGCAACTATGGAACTATGGAACTATGAAACTATGAACTATGGCAACTATGAAGCGAACTATGCAGAAACTATG"
for i in range(len(string)):
if string[i:].startswith("AACTATGAA"):
print(i + 1) | string = 'AACTATGCAACTATGAAACTATGAACTATGATTCCAACTATGTAACTATGATGCATTAAACTATGAAACTATGAACTATGAACTATGAACTATGAAACTATGCGGAACTATGAACTATGGGGACAACTATGGAACTATGAGAACTATGTCAATTAACTATGCGTAACTATGGTCGAAACTATGAACTATGGAACTATGGCAACTATGCAAACTATGAAACTATGTAACTATGTGAAGGACGCACTAACTATGAGAAACTATGAACTATGAACTATGAACTATGCACGCGTTGTAACTATGATGACGATGAACTATGTATTAACTATGACCGAACTATGTCAACTATGTTTTAACTATGAAACTATGTAACTATGTGGTCAACTATGGCATTCCAACTATGGAACTATGAACTATGGTACCTAACTATGATCTGAAACTATGAACTATGGCAACTATGAACTATGGAAGAATCGCGGCTACCTTTCTCGAACTATGGAATTTAACTATGGAACTATGCTGAAACTATGAACCAAACTATGTAAACTATGAACTATGAAACTATGGCTAGAACTATGATGTAACTATGAAACTATGAACTATGAACTATGAACTATGGAACTATGGTTGATAACTATGCAACGGTACGATGGTCGTCAACTATGAACTATGGAAACTATGGAACTATGAACTATGTGTCAACTATGAACTATGTGGAACTATGCCTAAACTATGCTTCCTCTCACGTGTACGAAACTATGCGAAACTATGAACTATGATGCTCAATGAACTATGCAACTATGCTAACTATGTCTTTGTTCAACTATGACAACTATGTGGGCAACTATGAACTATGGGAACTATGAACTATGAACTATGTCATATATGAAGTAACTATGAACTATGAACTATGCAACTATGGAACTATGGAACTATGAAACTATGAACTATGGCAACTATGAAGCGAACTATGCAGAAACTATG'
for i in range(len(string)):
if string[i:].startswith('AACTATGAA'):
print(i + 1) |
def single_number(numbers):
single = 0
for number in numbers:
single ^= number
return single
if __name__ == "__main__":
numbers = [3, 4, 2, 1, 3, 1, 4]
assert single_number(numbers) == 2
numbers = input("Enter list of repeated numbers: ")
numbers = map(int, numbers.split())
print(single_number(numbers))
| def single_number(numbers):
single = 0
for number in numbers:
single ^= number
return single
if __name__ == '__main__':
numbers = [3, 4, 2, 1, 3, 1, 4]
assert single_number(numbers) == 2
numbers = input('Enter list of repeated numbers: ')
numbers = map(int, numbers.split())
print(single_number(numbers)) |
# Name - Thilakarathna W M D U
# Email - dtdinidu7@gmail.com
# Date - 08/04/2020
tm = int(input()) # number of test cases
for t in range(1, tm+1):
lis = [int(i) for i in list(input())] # taking the input as list
strg = '('*lis[0] + str(lis[0]) # final string to be displayed
prev = lis[0] # track the previs count
for i in range(1, len(lis)): # loop through the list
tmp = lis[i]-prev
prev = lis[i]
if (tmp >= 0):
strg += '('*tmp
else:
strg += ')'*(-1*tmp)
strg += str(lis[i]) # adding the changes to the final strings to be displayed
strg += ')'*lis[-1]
print("Case #{}: {}".format(t, strg)) # print the final output
| tm = int(input())
for t in range(1, tm + 1):
lis = [int(i) for i in list(input())]
strg = '(' * lis[0] + str(lis[0])
prev = lis[0]
for i in range(1, len(lis)):
tmp = lis[i] - prev
prev = lis[i]
if tmp >= 0:
strg += '(' * tmp
else:
strg += ')' * (-1 * tmp)
strg += str(lis[i])
strg += ')' * lis[-1]
print('Case #{}: {}'.format(t, strg)) |
# Sample untracked-keys file
# If you get errors trying to 'import apikeys', do the following:
# 1) Copy this file to apikeys.py (keeping it in the package directory)
# 2) Replace all of the example values with real ones
# 3) Generate your own cookie key, possibly using urandom as per below
# You should then be able to start the server.
db_connect_string = ""
cookie_monster = "uqHHRiRIUyCIcB0RJJcv+T/Qc3wJS0p/jsyE1x36qBIa"
admin_address = "administrator"
site_url = "http://www.infiniteglitch.net"
# Generated like this:
# import base64, os; print(base64.b64encode(os.urandom(33)))
# These settings are used only for the sending of emails. The server will
# start with them at the defaults, but all email sending will fail.
system_email = 'server@example.com'
admin_email = 'username@example.com'
# Use https://pypi.org/project/Flask-SendGrid/ to implement SendGrid
SENDGRID_DEFAULT_FROM = "me@my.com"
SENDGRID_API_KEY = "SG.random-string-from-sendgrid"
| db_connect_string = ''
cookie_monster = 'uqHHRiRIUyCIcB0RJJcv+T/Qc3wJS0p/jsyE1x36qBIa'
admin_address = 'administrator'
site_url = 'http://www.infiniteglitch.net'
system_email = 'server@example.com'
admin_email = 'username@example.com'
sendgrid_default_from = 'me@my.com'
sendgrid_api_key = 'SG.random-string-from-sendgrid' |
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, x):
# self.val = x
# self.left = None
# self.right = None
class Solution:
def subtreeWithAllDeepest(self, root: TreeNode) -> TreeNode:
depths = [collections.defaultdict(list) for _ in range(500)]
self.mx = 0
def helper(node, depth):
if node:
l = helper(node.left, depth + 1)
r = helper(node.right, depth + 1)
ans = max(l, r)
self.mx = ans
depths[depth][ans].append(node)
return ans
else:
return depth - 1
helper(root, 0)
while True:
depths.pop()
if len(depths[-1][self.mx]) == 1:
return depths[-1][self.mx][0]
| class Solution:
def subtree_with_all_deepest(self, root: TreeNode) -> TreeNode:
depths = [collections.defaultdict(list) for _ in range(500)]
self.mx = 0
def helper(node, depth):
if node:
l = helper(node.left, depth + 1)
r = helper(node.right, depth + 1)
ans = max(l, r)
self.mx = ans
depths[depth][ans].append(node)
return ans
else:
return depth - 1
helper(root, 0)
while True:
depths.pop()
if len(depths[-1][self.mx]) == 1:
return depths[-1][self.mx][0] |
#
# PySNMP MIB module S5-CHASSIS-TRAP-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/S5-CHASSIS-TRAP-MIB
# Produced by pysmi-0.3.4 at Wed May 1 14:59:28 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
Integer, ObjectIdentifier, OctetString = mibBuilder.importSymbols("ASN1", "Integer", "ObjectIdentifier", "OctetString")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueSizeConstraint, ValueRangeConstraint, SingleValueConstraint, ConstraintsUnion, ConstraintsIntersection = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueSizeConstraint", "ValueRangeConstraint", "SingleValueConstraint", "ConstraintsUnion", "ConstraintsIntersection")
s5ChasComOperState, s5ChasComType, s5ChasNotifyFanDirection = mibBuilder.importSymbols("S5-CHASSIS-MIB", "s5ChasComOperState", "s5ChasComType", "s5ChasNotifyFanDirection")
s5ChaTrap, = mibBuilder.importSymbols("S5-ROOT-MIB", "s5ChaTrap")
NotificationGroup, ModuleCompliance = mibBuilder.importSymbols("SNMPv2-CONF", "NotificationGroup", "ModuleCompliance")
MibIdentifier, IpAddress, iso, MibScalar, MibTable, MibTableRow, MibTableColumn, TimeTicks, Unsigned32, Integer32, Gauge32, ObjectIdentity, ModuleIdentity, Bits, Counter64, Counter32, NotificationType = mibBuilder.importSymbols("SNMPv2-SMI", "MibIdentifier", "IpAddress", "iso", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "TimeTicks", "Unsigned32", "Integer32", "Gauge32", "ObjectIdentity", "ModuleIdentity", "Bits", "Counter64", "Counter32", "NotificationType")
DisplayString, TextualConvention = mibBuilder.importSymbols("SNMPv2-TC", "DisplayString", "TextualConvention")
s5ChassisTrapMib = ModuleIdentity((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0))
s5ChassisTrapMib.setRevisions(('2011-04-15 00:00', '2011-03-29 00:00', '2009-07-29 00:00', '2004-07-20 00:00',))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
if mibBuilder.loadTexts: s5ChassisTrapMib.setRevisionsDescriptions(('Version 125: Added s5CtrFanDirectionError and s5CtrHighTemperatureError.', 'Version 124: Added s5CtrFanRotationError.', 'Version 123: Fixed conversion to SMIv2', 'Version 122: Conversion to SMIv2',))
if mibBuilder.loadTexts: s5ChassisTrapMib.setLastUpdated('201104150000Z')
if mibBuilder.loadTexts: s5ChassisTrapMib.setOrganization('Nortel Networks')
if mibBuilder.loadTexts: s5ChassisTrapMib.setContactInfo('Nortel Networks')
if mibBuilder.loadTexts: s5ChassisTrapMib.setDescription("5000 Chassis Trap MIB Copyright 1993-2004 Nortel Networks, Inc. All rights reserved. This Nortel Networks SNMP Management Information Base Specification (Specification) embodies Nortel Networks' confidential and proprietary intellectual property. Nortel Networks retains all title and ownership in the Specification, including any revisions. This Specification is supplied 'AS IS,' and Nortel Networks makes no warranty, either express or implied, as to the use, operation, condition, or performance of the Specification.")
s5CtrHotSwap = NotificationType((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 1)).setObjects(("S5-CHASSIS-MIB", "s5ChasComType"), ("S5-CHASSIS-MIB", "s5ChasComOperState"))
if mibBuilder.loadTexts: s5CtrHotSwap.setStatus('current')
if mibBuilder.loadTexts: s5CtrHotSwap.setDescription('A component or sub-component was inserted or deinserted in the chassis. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that was inserted or deinserted, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component. The value is removed(3) when the item is removed.')
s5CtrProblem = NotificationType((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 2)).setObjects(("S5-CHASSIS-MIB", "s5ChasComType"), ("S5-CHASSIS-MIB", "s5ChasComOperState"))
if mibBuilder.loadTexts: s5CtrProblem.setStatus('current')
if mibBuilder.loadTexts: s5CtrProblem.setDescription('A component or sub-component has a problem condition, either warning, nonfatal, or fatal. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that has the problem condition, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component.')
s5CtrUnitUp = NotificationType((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 3)).setObjects(("S5-CHASSIS-MIB", "s5ChasComType"), ("S5-CHASSIS-MIB", "s5ChasComOperState"))
if mibBuilder.loadTexts: s5CtrUnitUp.setStatus('current')
if mibBuilder.loadTexts: s5CtrUnitUp.setDescription('A component or sub-component has been newly detected. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that has the problem condition, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component.')
s5CtrUnitDown = NotificationType((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 4)).setObjects(("S5-CHASSIS-MIB", "s5ChasComType"), ("S5-CHASSIS-MIB", "s5ChasComOperState"))
if mibBuilder.loadTexts: s5CtrUnitDown.setStatus('current')
if mibBuilder.loadTexts: s5CtrUnitDown.setDescription('A component or sub-component is no longer detected. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that has the problem condition, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component.')
s5CtrNewHotSwap = NotificationType((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0, 1)).setObjects(("S5-CHASSIS-MIB", "s5ChasComType"), ("S5-CHASSIS-MIB", "s5ChasComOperState"))
if mibBuilder.loadTexts: s5CtrNewHotSwap.setStatus('current')
if mibBuilder.loadTexts: s5CtrNewHotSwap.setDescription('A component or sub-component was inserted or deinserted in the chassis. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that was inserted or deinserted, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component. The value is removed(3) when the item is removed.')
s5CtrNewProblem = NotificationType((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0, 2)).setObjects(("S5-CHASSIS-MIB", "s5ChasComType"), ("S5-CHASSIS-MIB", "s5ChasComOperState"))
if mibBuilder.loadTexts: s5CtrNewProblem.setStatus('current')
if mibBuilder.loadTexts: s5CtrNewProblem.setDescription('A component or sub-component has a problem condition, either warning, nonfatal, or fatal. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that has the problem condition, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component.')
s5CtrNewUnitUp = NotificationType((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0, 3)).setObjects(("S5-CHASSIS-MIB", "s5ChasComType"), ("S5-CHASSIS-MIB", "s5ChasComOperState"))
if mibBuilder.loadTexts: s5CtrNewUnitUp.setStatus('current')
if mibBuilder.loadTexts: s5CtrNewUnitUp.setDescription('A component or sub-component has been newly detected. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that has the problem condition, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component.')
s5CtrNewUnitDown = NotificationType((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0, 4)).setObjects(("S5-CHASSIS-MIB", "s5ChasComType"), ("S5-CHASSIS-MIB", "s5ChasComOperState"))
if mibBuilder.loadTexts: s5CtrNewUnitDown.setStatus('current')
if mibBuilder.loadTexts: s5CtrNewUnitDown.setDescription('A component or sub-component is no longer detected. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that has the problem condition, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component.')
s5CtrFanRotationError = NotificationType((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0, 5)).setObjects(("S5-CHASSIS-MIB", "s5ChasComType"), ("S5-CHASSIS-MIB", "s5ChasComOperState"))
if mibBuilder.loadTexts: s5CtrFanRotationError.setStatus('current')
if mibBuilder.loadTexts: s5CtrFanRotationError.setDescription("A fan component's rotation is incorrect.")
s5CtrFanDirectionError = NotificationType((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0, 6)).setObjects(("S5-CHASSIS-MIB", "s5ChasComType"), ("S5-CHASSIS-MIB", "s5ChasComOperState"), ("S5-CHASSIS-MIB", "s5ChasNotifyFanDirection"))
if mibBuilder.loadTexts: s5CtrFanDirectionError.setStatus('current')
if mibBuilder.loadTexts: s5CtrFanDirectionError.setDescription("A fan component's direction is incorrect.")
s5CtrHighTemperatureError = NotificationType((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0, 7)).setObjects(("S5-CHASSIS-MIB", "s5ChasComType"), ("S5-CHASSIS-MIB", "s5ChasComOperState"))
if mibBuilder.loadTexts: s5CtrHighTemperatureError.setStatus('current')
if mibBuilder.loadTexts: s5CtrHighTemperatureError.setDescription('The system is overheated.')
mibBuilder.exportSymbols("S5-CHASSIS-TRAP-MIB", s5CtrUnitDown=s5CtrUnitDown, s5CtrNewProblem=s5CtrNewProblem, s5CtrUnitUp=s5CtrUnitUp, s5CtrHighTemperatureError=s5CtrHighTemperatureError, PYSNMP_MODULE_ID=s5ChassisTrapMib, s5CtrNewUnitUp=s5CtrNewUnitUp, s5CtrProblem=s5CtrProblem, s5CtrFanDirectionError=s5CtrFanDirectionError, s5CtrNewUnitDown=s5CtrNewUnitDown, s5ChassisTrapMib=s5ChassisTrapMib, s5CtrFanRotationError=s5CtrFanRotationError, s5CtrNewHotSwap=s5CtrNewHotSwap, s5CtrHotSwap=s5CtrHotSwap)
| (integer, object_identifier, octet_string) = mibBuilder.importSymbols('ASN1', 'Integer', 'ObjectIdentifier', 'OctetString')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(value_size_constraint, value_range_constraint, single_value_constraint, constraints_union, constraints_intersection) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ValueSizeConstraint', 'ValueRangeConstraint', 'SingleValueConstraint', 'ConstraintsUnion', 'ConstraintsIntersection')
(s5_chas_com_oper_state, s5_chas_com_type, s5_chas_notify_fan_direction) = mibBuilder.importSymbols('S5-CHASSIS-MIB', 's5ChasComOperState', 's5ChasComType', 's5ChasNotifyFanDirection')
(s5_cha_trap,) = mibBuilder.importSymbols('S5-ROOT-MIB', 's5ChaTrap')
(notification_group, module_compliance) = mibBuilder.importSymbols('SNMPv2-CONF', 'NotificationGroup', 'ModuleCompliance')
(mib_identifier, ip_address, iso, mib_scalar, mib_table, mib_table_row, mib_table_column, time_ticks, unsigned32, integer32, gauge32, object_identity, module_identity, bits, counter64, counter32, notification_type) = mibBuilder.importSymbols('SNMPv2-SMI', 'MibIdentifier', 'IpAddress', 'iso', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'TimeTicks', 'Unsigned32', 'Integer32', 'Gauge32', 'ObjectIdentity', 'ModuleIdentity', 'Bits', 'Counter64', 'Counter32', 'NotificationType')
(display_string, textual_convention) = mibBuilder.importSymbols('SNMPv2-TC', 'DisplayString', 'TextualConvention')
s5_chassis_trap_mib = module_identity((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0))
s5ChassisTrapMib.setRevisions(('2011-04-15 00:00', '2011-03-29 00:00', '2009-07-29 00:00', '2004-07-20 00:00'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
if mibBuilder.loadTexts:
s5ChassisTrapMib.setRevisionsDescriptions(('Version 125: Added s5CtrFanDirectionError and s5CtrHighTemperatureError.', 'Version 124: Added s5CtrFanRotationError.', 'Version 123: Fixed conversion to SMIv2', 'Version 122: Conversion to SMIv2'))
if mibBuilder.loadTexts:
s5ChassisTrapMib.setLastUpdated('201104150000Z')
if mibBuilder.loadTexts:
s5ChassisTrapMib.setOrganization('Nortel Networks')
if mibBuilder.loadTexts:
s5ChassisTrapMib.setContactInfo('Nortel Networks')
if mibBuilder.loadTexts:
s5ChassisTrapMib.setDescription("5000 Chassis Trap MIB Copyright 1993-2004 Nortel Networks, Inc. All rights reserved. This Nortel Networks SNMP Management Information Base Specification (Specification) embodies Nortel Networks' confidential and proprietary intellectual property. Nortel Networks retains all title and ownership in the Specification, including any revisions. This Specification is supplied 'AS IS,' and Nortel Networks makes no warranty, either express or implied, as to the use, operation, condition, or performance of the Specification.")
s5_ctr_hot_swap = notification_type((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 1)).setObjects(('S5-CHASSIS-MIB', 's5ChasComType'), ('S5-CHASSIS-MIB', 's5ChasComOperState'))
if mibBuilder.loadTexts:
s5CtrHotSwap.setStatus('current')
if mibBuilder.loadTexts:
s5CtrHotSwap.setDescription('A component or sub-component was inserted or deinserted in the chassis. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that was inserted or deinserted, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component. The value is removed(3) when the item is removed.')
s5_ctr_problem = notification_type((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 2)).setObjects(('S5-CHASSIS-MIB', 's5ChasComType'), ('S5-CHASSIS-MIB', 's5ChasComOperState'))
if mibBuilder.loadTexts:
s5CtrProblem.setStatus('current')
if mibBuilder.loadTexts:
s5CtrProblem.setDescription('A component or sub-component has a problem condition, either warning, nonfatal, or fatal. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that has the problem condition, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component.')
s5_ctr_unit_up = notification_type((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 3)).setObjects(('S5-CHASSIS-MIB', 's5ChasComType'), ('S5-CHASSIS-MIB', 's5ChasComOperState'))
if mibBuilder.loadTexts:
s5CtrUnitUp.setStatus('current')
if mibBuilder.loadTexts:
s5CtrUnitUp.setDescription('A component or sub-component has been newly detected. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that has the problem condition, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component.')
s5_ctr_unit_down = notification_type((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 4)).setObjects(('S5-CHASSIS-MIB', 's5ChasComType'), ('S5-CHASSIS-MIB', 's5ChasComOperState'))
if mibBuilder.loadTexts:
s5CtrUnitDown.setStatus('current')
if mibBuilder.loadTexts:
s5CtrUnitDown.setDescription('A component or sub-component is no longer detected. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that has the problem condition, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component.')
s5_ctr_new_hot_swap = notification_type((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0, 1)).setObjects(('S5-CHASSIS-MIB', 's5ChasComType'), ('S5-CHASSIS-MIB', 's5ChasComOperState'))
if mibBuilder.loadTexts:
s5CtrNewHotSwap.setStatus('current')
if mibBuilder.loadTexts:
s5CtrNewHotSwap.setDescription('A component or sub-component was inserted or deinserted in the chassis. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that was inserted or deinserted, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component. The value is removed(3) when the item is removed.')
s5_ctr_new_problem = notification_type((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0, 2)).setObjects(('S5-CHASSIS-MIB', 's5ChasComType'), ('S5-CHASSIS-MIB', 's5ChasComOperState'))
if mibBuilder.loadTexts:
s5CtrNewProblem.setStatus('current')
if mibBuilder.loadTexts:
s5CtrNewProblem.setDescription('A component or sub-component has a problem condition, either warning, nonfatal, or fatal. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that has the problem condition, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component.')
s5_ctr_new_unit_up = notification_type((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0, 3)).setObjects(('S5-CHASSIS-MIB', 's5ChasComType'), ('S5-CHASSIS-MIB', 's5ChasComOperState'))
if mibBuilder.loadTexts:
s5CtrNewUnitUp.setStatus('current')
if mibBuilder.loadTexts:
s5CtrNewUnitUp.setDescription('A component or sub-component has been newly detected. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that has the problem condition, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component.')
s5_ctr_new_unit_down = notification_type((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0, 4)).setObjects(('S5-CHASSIS-MIB', 's5ChasComType'), ('S5-CHASSIS-MIB', 's5ChasComOperState'))
if mibBuilder.loadTexts:
s5CtrNewUnitDown.setStatus('current')
if mibBuilder.loadTexts:
s5CtrNewUnitDown.setDescription('A component or sub-component is no longer detected. This trap is sent only once when the condition is first detected. The following values are returned: s5ChasComType........the type of the component (or sub-component) that has the problem condition, with the instance identifying the group, component, and sub-component. s5ChasComOperState...the operational status of the component or sub-component, with the instance identifying the group, component, and sub-component.')
s5_ctr_fan_rotation_error = notification_type((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0, 5)).setObjects(('S5-CHASSIS-MIB', 's5ChasComType'), ('S5-CHASSIS-MIB', 's5ChasComOperState'))
if mibBuilder.loadTexts:
s5CtrFanRotationError.setStatus('current')
if mibBuilder.loadTexts:
s5CtrFanRotationError.setDescription("A fan component's rotation is incorrect.")
s5_ctr_fan_direction_error = notification_type((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0, 6)).setObjects(('S5-CHASSIS-MIB', 's5ChasComType'), ('S5-CHASSIS-MIB', 's5ChasComOperState'), ('S5-CHASSIS-MIB', 's5ChasNotifyFanDirection'))
if mibBuilder.loadTexts:
s5CtrFanDirectionError.setStatus('current')
if mibBuilder.loadTexts:
s5CtrFanDirectionError.setDescription("A fan component's direction is incorrect.")
s5_ctr_high_temperature_error = notification_type((1, 3, 6, 1, 4, 1, 45, 1, 6, 2, 4, 0, 7)).setObjects(('S5-CHASSIS-MIB', 's5ChasComType'), ('S5-CHASSIS-MIB', 's5ChasComOperState'))
if mibBuilder.loadTexts:
s5CtrHighTemperatureError.setStatus('current')
if mibBuilder.loadTexts:
s5CtrHighTemperatureError.setDescription('The system is overheated.')
mibBuilder.exportSymbols('S5-CHASSIS-TRAP-MIB', s5CtrUnitDown=s5CtrUnitDown, s5CtrNewProblem=s5CtrNewProblem, s5CtrUnitUp=s5CtrUnitUp, s5CtrHighTemperatureError=s5CtrHighTemperatureError, PYSNMP_MODULE_ID=s5ChassisTrapMib, s5CtrNewUnitUp=s5CtrNewUnitUp, s5CtrProblem=s5CtrProblem, s5CtrFanDirectionError=s5CtrFanDirectionError, s5CtrNewUnitDown=s5CtrNewUnitDown, s5ChassisTrapMib=s5ChassisTrapMib, s5CtrFanRotationError=s5CtrFanRotationError, s5CtrNewHotSwap=s5CtrNewHotSwap, s5CtrHotSwap=s5CtrHotSwap) |
class Ssl(object):
FIELD_MAP = {
"domain": "domain",
"expires": "expires",
"issuer": "issuer",
"org": "org",
"subject": "subject",
"valid": "valid",
"version": "version"
}
def __init__(self):
self.domain = ""
self.expires = ""
self.issuer = ""
self.org = ""
self.subject = ""
self.valid = ""
self.version = ""
@staticmethod
def from_dictionary(ssl_dict: dict):
ssl = Ssl()
field_map = getattr(ssl.__class__, "FIELD_MAP")
for key_name in field_map:
if key_name in ssl_dict:
setattr(ssl, field_map[key_name], ssl_dict[key_name])
return ssl | class Ssl(object):
field_map = {'domain': 'domain', 'expires': 'expires', 'issuer': 'issuer', 'org': 'org', 'subject': 'subject', 'valid': 'valid', 'version': 'version'}
def __init__(self):
self.domain = ''
self.expires = ''
self.issuer = ''
self.org = ''
self.subject = ''
self.valid = ''
self.version = ''
@staticmethod
def from_dictionary(ssl_dict: dict):
ssl = ssl()
field_map = getattr(ssl.__class__, 'FIELD_MAP')
for key_name in field_map:
if key_name in ssl_dict:
setattr(ssl, field_map[key_name], ssl_dict[key_name])
return ssl |
cuenta = []
for i in range(0,20):
cuenta.append(i+1)
print("Primeros 3 elementos en la lista")
print(cuenta[slice(3)])
print()
print("3 elementos del medio")
print(cuenta[slice(7,10)])
print()
print("ultimos 3 elementos de la lista")
print(cuenta[slice(len(cuenta)-3,len(cuenta))]) | cuenta = []
for i in range(0, 20):
cuenta.append(i + 1)
print('Primeros 3 elementos en la lista')
print(cuenta[slice(3)])
print()
print('3 elementos del medio')
print(cuenta[slice(7, 10)])
print()
print('ultimos 3 elementos de la lista')
print(cuenta[slice(len(cuenta) - 3, len(cuenta))]) |
# -*- coding: utf-8 -*-
inputCoordInicialFinalFazenda = list(map(int, input().split()))
countTest = 1
while sum(inputCoordInicialFinalFazenda) != 0:
qntOcorrenciaMeteoro = int(input())
qntOcorrenciaMeteoroDentroFazenda = 0
tamanhoFazendaCoordX = abs(inputCoordInicialFinalFazenda[0] - inputCoordInicialFinalFazenda[2])
tamanhoFazendaCoordY = abs(inputCoordInicialFinalFazenda[1] - inputCoordInicialFinalFazenda[3])
for indiceOcorrenciaMeteoro in range(0,qntOcorrenciaMeteoro):
listInputCoordMeteoro = list(map(int, input().split()))
if listInputCoordMeteoro[0] >= inputCoordInicialFinalFazenda[0] and abs(listInputCoordMeteoro[0] - inputCoordInicialFinalFazenda[0]) <= tamanhoFazendaCoordX:
if listInputCoordMeteoro[1] <= inputCoordInicialFinalFazenda[1] and abs(listInputCoordMeteoro[1] - inputCoordInicialFinalFazenda[1]) <= tamanhoFazendaCoordY:
qntOcorrenciaMeteoroDentroFazenda += 1
print("Teste {}".format(countTest))
print("{}".format(qntOcorrenciaMeteoroDentroFazenda))
countTest += 1
inputCoordInicialFinalFazenda = list(map(int, input().split())) | input_coord_inicial_final_fazenda = list(map(int, input().split()))
count_test = 1
while sum(inputCoordInicialFinalFazenda) != 0:
qnt_ocorrencia_meteoro = int(input())
qnt_ocorrencia_meteoro_dentro_fazenda = 0
tamanho_fazenda_coord_x = abs(inputCoordInicialFinalFazenda[0] - inputCoordInicialFinalFazenda[2])
tamanho_fazenda_coord_y = abs(inputCoordInicialFinalFazenda[1] - inputCoordInicialFinalFazenda[3])
for indice_ocorrencia_meteoro in range(0, qntOcorrenciaMeteoro):
list_input_coord_meteoro = list(map(int, input().split()))
if listInputCoordMeteoro[0] >= inputCoordInicialFinalFazenda[0] and abs(listInputCoordMeteoro[0] - inputCoordInicialFinalFazenda[0]) <= tamanhoFazendaCoordX:
if listInputCoordMeteoro[1] <= inputCoordInicialFinalFazenda[1] and abs(listInputCoordMeteoro[1] - inputCoordInicialFinalFazenda[1]) <= tamanhoFazendaCoordY:
qnt_ocorrencia_meteoro_dentro_fazenda += 1
print('Teste {}'.format(countTest))
print('{}'.format(qntOcorrenciaMeteoroDentroFazenda))
count_test += 1
input_coord_inicial_final_fazenda = list(map(int, input().split())) |
endPoints={
"register" : "/register",
"checkKyc" : "/check_kyc",
"checkHandle" : "/check_handle",
"requestKyc" : "/request_kyc",
"issueSila" : "/issue_sila",
"redeemSila" : "/redeem_sila",
"transferSila" : "/transfer_sila",
"addCrypto" : "/add_crypto",
"addIdentity" : "/add_identity",
"createBond" : "/create_bond",
"checkHandle" : "/check_handle",
"getAccounts" : "/get_accounts",
"getTransactions" : "/get_transactions",
"registerOperator" : "/register_operator",
"linkAccount" : "/link_account",
"schemaUrl" : "https://api.silamoney.com/0.2/getmessage?emptymessage=%sTestMessage",
"apiUrl" : "https://%s.silamoney.com/0.2",
"silaBalanceProd" : "https://silatokenapi.silamoney.com/silaBalance",
"silaBalanceSandbox" : "https://sandbox.silatokenapi.silamoney.com/silaBalance"
} | end_points = {'register': '/register', 'checkKyc': '/check_kyc', 'checkHandle': '/check_handle', 'requestKyc': '/request_kyc', 'issueSila': '/issue_sila', 'redeemSila': '/redeem_sila', 'transferSila': '/transfer_sila', 'addCrypto': '/add_crypto', 'addIdentity': '/add_identity', 'createBond': '/create_bond', 'checkHandle': '/check_handle', 'getAccounts': '/get_accounts', 'getTransactions': '/get_transactions', 'registerOperator': '/register_operator', 'linkAccount': '/link_account', 'schemaUrl': 'https://api.silamoney.com/0.2/getmessage?emptymessage=%sTestMessage', 'apiUrl': 'https://%s.silamoney.com/0.2', 'silaBalanceProd': 'https://silatokenapi.silamoney.com/silaBalance', 'silaBalanceSandbox': 'https://sandbox.silatokenapi.silamoney.com/silaBalance'} |
id_to_channel = {}
# Official Studio Channels
id_to_channel['UC2-BeLxzUBSs0uSrmzWhJuQ'] = "20th Century Fox"
id_to_channel['UCor9rW6PgxSQ9vUPWQdnaYQ'] = "FoxSearchlight"
id_to_channel['UCz97F7dMxBNOfGYu3rx8aCw'] = "Sony Pictues"
id_to_channel['UCFqyJFbsV-uEcosvNhg0PaQ'] = "Sony Pictures India"
id_to_channel['UCjmJDM5pRKbUlVIzDYYWb6g'] = "Warner Bros"
id_to_channel['UCbxjDfYwfF8RjYBp5htJ38Q'] = "Warner Bros UK"
id_to_channel['UC9YHyj7QSkkSg2pjQ7M8Khg'] = "Paramount Movies"
id_to_channel['UCpVqzaoo6_5dKbmgFGK1M_Q'] = "Paramount Movies NL"
id_to_channel['UCq0OueAsdxH6b8nyAspwViw'] = "Universal Pictures"
id_to_channel['UCIHg3K4EaY-ziWc5CyzWAzQ'] = "UniversalMovies"
id_to_channel['UCZGYJFUizSax-yElQaFDp5Q'] = "Star Wars"
id_to_channel['UC_IRYSp4auq7hKLvziWVH6w'] = "Disney-Pixar"
id_to_channel['UCV3uIARCxZY6lWbeVVRZsKg'] = "DisneyMoviesOnDemand"
id_to_channel['UCuaFvcY4MhZY3U43mMt1dYQ'] = "Disney Movie Trailers"
id_to_channel['UC_976xMxPgzIa290Hqtk-9g'] = "Walt Disney Animation Studios"
id_to_channel['UCJ6nMHaJPZvsJ-HmUmj1SeA'] = "Lionsgate Movies"
id_to_channel['UCY26xU0-avwTJ6F6TzUZVEw'] = "DreamWorksTV"
# Third party channels
id_to_channel['UCi8e0iOVk1fEOogdfu4YgfA'] = "Movieclips Trailers"
id_to_channel['UCTCjFFoX1un-j7ni4B6HJ3Q'] = "Movieclips Classic Trailers"
id_to_channel['UCw7TdYd1d873DtdjkdKStUg'] = "White Yak Trailer"
id_to_channel['UCDoLDRl0RbBWPIwR2xjjneg'] = "Video Detective"
id_to_channel['UCpJN7kiUkDrH11p0GQhLyFw'] = "Movie Trailers Source"
id_to_channel['UCj4lFy4F5PqXD7d41mCKVYw'] = "MovieAccessTrailers"
id_to_channel['UCpo2fJvnalYlwN97ehhyfBQ'] = "hollywoodstreams"
id_to_channel['UCT0hbLDa-unWsnZ6Rjzkfug'] = "FilmSelect Trailer"
approved_channel_ids = id_to_channel.keys()
| id_to_channel = {}
id_to_channel['UC2-BeLxzUBSs0uSrmzWhJuQ'] = '20th Century Fox'
id_to_channel['UCor9rW6PgxSQ9vUPWQdnaYQ'] = 'FoxSearchlight'
id_to_channel['UCz97F7dMxBNOfGYu3rx8aCw'] = 'Sony Pictues'
id_to_channel['UCFqyJFbsV-uEcosvNhg0PaQ'] = 'Sony Pictures India'
id_to_channel['UCjmJDM5pRKbUlVIzDYYWb6g'] = 'Warner Bros'
id_to_channel['UCbxjDfYwfF8RjYBp5htJ38Q'] = 'Warner Bros UK'
id_to_channel['UC9YHyj7QSkkSg2pjQ7M8Khg'] = 'Paramount Movies'
id_to_channel['UCpVqzaoo6_5dKbmgFGK1M_Q'] = 'Paramount Movies NL'
id_to_channel['UCq0OueAsdxH6b8nyAspwViw'] = 'Universal Pictures'
id_to_channel['UCIHg3K4EaY-ziWc5CyzWAzQ'] = 'UniversalMovies'
id_to_channel['UCZGYJFUizSax-yElQaFDp5Q'] = 'Star Wars'
id_to_channel['UC_IRYSp4auq7hKLvziWVH6w'] = 'Disney-Pixar'
id_to_channel['UCV3uIARCxZY6lWbeVVRZsKg'] = 'DisneyMoviesOnDemand'
id_to_channel['UCuaFvcY4MhZY3U43mMt1dYQ'] = 'Disney Movie Trailers'
id_to_channel['UC_976xMxPgzIa290Hqtk-9g'] = 'Walt Disney Animation Studios'
id_to_channel['UCJ6nMHaJPZvsJ-HmUmj1SeA'] = 'Lionsgate Movies'
id_to_channel['UCY26xU0-avwTJ6F6TzUZVEw'] = 'DreamWorksTV'
id_to_channel['UCi8e0iOVk1fEOogdfu4YgfA'] = 'Movieclips Trailers'
id_to_channel['UCTCjFFoX1un-j7ni4B6HJ3Q'] = 'Movieclips Classic Trailers'
id_to_channel['UCw7TdYd1d873DtdjkdKStUg'] = 'White Yak Trailer'
id_to_channel['UCDoLDRl0RbBWPIwR2xjjneg'] = 'Video Detective'
id_to_channel['UCpJN7kiUkDrH11p0GQhLyFw'] = 'Movie Trailers Source'
id_to_channel['UCj4lFy4F5PqXD7d41mCKVYw'] = 'MovieAccessTrailers'
id_to_channel['UCpo2fJvnalYlwN97ehhyfBQ'] = 'hollywoodstreams'
id_to_channel['UCT0hbLDa-unWsnZ6Rjzkfug'] = 'FilmSelect Trailer'
approved_channel_ids = id_to_channel.keys() |
N=int(input())
v=[*map(int,input().split())]
ba=ba2=-1
last=-1
dec_start=False
for n,i in enumerate(v):
if i>=last:
if i>last:
if not dec_start:
ba=n
else:
ba2=n-1
break
else:
dec_start=True
last=i
if not dec_start:
print("1 1")
exit(0)
if ba>-1 and ba2==-1:
ba2=N-1
revv=v[ba:ba2+1]
revv=revv[::-1]
for i in range(len(revv)):
v[ba+i]=revv[i]
for i in range(1,len(v)):
if v[i]<v[i-1]:
print("impossible")
exit(0)
print(ba+1,ba2+1) | n = int(input())
v = [*map(int, input().split())]
ba = ba2 = -1
last = -1
dec_start = False
for (n, i) in enumerate(v):
if i >= last:
if i > last:
if not dec_start:
ba = n
else:
ba2 = n - 1
break
else:
dec_start = True
last = i
if not dec_start:
print('1 1')
exit(0)
if ba > -1 and ba2 == -1:
ba2 = N - 1
revv = v[ba:ba2 + 1]
revv = revv[::-1]
for i in range(len(revv)):
v[ba + i] = revv[i]
for i in range(1, len(v)):
if v[i] < v[i - 1]:
print('impossible')
exit(0)
print(ba + 1, ba2 + 1) |
class ModelManager:
models = [
{
'modelPath': 'core/models/mobilenet_ssd_v1_coco/frozen_inference_graph.pb',
'configPath': 'core/models/mobilenet_ssd_v1_coco/ssd_mobilenet_v1_coco_2017_11_17.pbtxt',
'classNames': {
0: 'background', 1: 'person', 2: 'bicycle', 3: 'car', 4: 'motorcycle', 5: 'airplane',
6: 'bus', 7: 'train', 8: 'truck', 9: 'boat', 10: 'traffic light', 11: 'fire hydrant',
13: 'stop sign', 14: 'parking meter', 15: 'bench', 16: 'bird', 17: 'cat',
18: 'dog', 19: 'horse', 20: 'sheep', 21: 'cow', 22: 'elephant', 23: 'bear',
24: 'zebra', 25: 'giraffe', 27: 'backpack', 28: 'umbrella', 31: 'handbag',
32: 'tie', 33: 'suitcase', 34: 'frisbee', 35: 'skis', 36: 'snowboard',
37: 'sports ball', 38: 'kite', 39: 'baseball bat', 40: 'baseball glove',
41: 'skateboard', 42: 'surfboard', 43: 'tennis racket', 44: 'bottle',
46: 'wine glass', 47: 'cup', 48: 'fork', 49: 'knife', 50: 'spoon',
51: 'bowl', 52: 'banana', 53: 'apple', 54: 'sandwich', 55: 'orange',
56: 'broccoli', 57: 'carrot', 58: 'hot dog', 59: 'pizza', 60: 'donut',
61: 'cake', 62: 'chair', 63: 'couch', 64: 'potted plant', 65: 'bed',
67: 'dining table', 70: 'toilet', 72: 'tv', 73: 'laptop', 74: 'mouse',
75: 'remote', 76: 'keyboard', 77: 'cell phone', 78: 'microwave', 79: 'oven',
80: 'toaster', 81: 'sink', 82: 'refrigerator', 84: 'book', 85: 'clock',
86: 'vase', 87: 'scissors', 88: 'teddy bear', 89: 'hair drier', 90: 'toothbrush'
}
},
{
'modelPath': 'core/models/mobilenet_ssd_v1_sports/frozen_inference_graph.pb',
'configPath': 'core/models/mobilenet_ssd_v1_sports/ssd_mobilenet_v1_sports_2020_10_04.pbtxt',
'classNames': {
0: 'background', 1: 'logo'
}
},
{
'modelPath': 'core/models/east_text_detection/frozen_east_text_detection.pb'
},
{
'modelPath': 'core/models/meijieru_crnn/crnn.onnx'
}
]
| class Modelmanager:
models = [{'modelPath': 'core/models/mobilenet_ssd_v1_coco/frozen_inference_graph.pb', 'configPath': 'core/models/mobilenet_ssd_v1_coco/ssd_mobilenet_v1_coco_2017_11_17.pbtxt', 'classNames': {0: 'background', 1: 'person', 2: 'bicycle', 3: 'car', 4: 'motorcycle', 5: 'airplane', 6: 'bus', 7: 'train', 8: 'truck', 9: 'boat', 10: 'traffic light', 11: 'fire hydrant', 13: 'stop sign', 14: 'parking meter', 15: 'bench', 16: 'bird', 17: 'cat', 18: 'dog', 19: 'horse', 20: 'sheep', 21: 'cow', 22: 'elephant', 23: 'bear', 24: 'zebra', 25: 'giraffe', 27: 'backpack', 28: 'umbrella', 31: 'handbag', 32: 'tie', 33: 'suitcase', 34: 'frisbee', 35: 'skis', 36: 'snowboard', 37: 'sports ball', 38: 'kite', 39: 'baseball bat', 40: 'baseball glove', 41: 'skateboard', 42: 'surfboard', 43: 'tennis racket', 44: 'bottle', 46: 'wine glass', 47: 'cup', 48: 'fork', 49: 'knife', 50: 'spoon', 51: 'bowl', 52: 'banana', 53: 'apple', 54: 'sandwich', 55: 'orange', 56: 'broccoli', 57: 'carrot', 58: 'hot dog', 59: 'pizza', 60: 'donut', 61: 'cake', 62: 'chair', 63: 'couch', 64: 'potted plant', 65: 'bed', 67: 'dining table', 70: 'toilet', 72: 'tv', 73: 'laptop', 74: 'mouse', 75: 'remote', 76: 'keyboard', 77: 'cell phone', 78: 'microwave', 79: 'oven', 80: 'toaster', 81: 'sink', 82: 'refrigerator', 84: 'book', 85: 'clock', 86: 'vase', 87: 'scissors', 88: 'teddy bear', 89: 'hair drier', 90: 'toothbrush'}}, {'modelPath': 'core/models/mobilenet_ssd_v1_sports/frozen_inference_graph.pb', 'configPath': 'core/models/mobilenet_ssd_v1_sports/ssd_mobilenet_v1_sports_2020_10_04.pbtxt', 'classNames': {0: 'background', 1: 'logo'}}, {'modelPath': 'core/models/east_text_detection/frozen_east_text_detection.pb'}, {'modelPath': 'core/models/meijieru_crnn/crnn.onnx'}] |
# Space: O(n)
# Time: O(n)
# Solution without collections library
# Definition for a binary tree node.
# class TreeNode(object):
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution():
def zigzagLevelOrder(self, root):
queue = [[root, 0]]
res = []
temp_res = []
level_status = 0
flag = 0
while queue:
cur_root, cur_level = queue.pop(0)
if level_status == cur_level:
temp_res.append(cur_root.val)
else:
level_status = cur_level
if flag == 0:
res.append(temp_res)
flag = 1
else:
res.append(temp_res[::-1])
flag = 0
temp_res = [cur_root.val]
if cur_root.left: queue.append([cur_root.left, cur_level + 1])
if cur_root.right: queue.append([cur_root.right, cur_level + 1])
if flag == 0:
res.append(temp_res)
else:
res.append(temp_res[::-1])
return res
| class Solution:
def zigzag_level_order(self, root):
queue = [[root, 0]]
res = []
temp_res = []
level_status = 0
flag = 0
while queue:
(cur_root, cur_level) = queue.pop(0)
if level_status == cur_level:
temp_res.append(cur_root.val)
else:
level_status = cur_level
if flag == 0:
res.append(temp_res)
flag = 1
else:
res.append(temp_res[::-1])
flag = 0
temp_res = [cur_root.val]
if cur_root.left:
queue.append([cur_root.left, cur_level + 1])
if cur_root.right:
queue.append([cur_root.right, cur_level + 1])
if flag == 0:
res.append(temp_res)
else:
res.append(temp_res[::-1])
return res |
# adds a and b
def addNumbers(a, b):
return a+b
# subtracts a and b
def subNumbers(a, b):
return a-b | def add_numbers(a, b):
return a + b
def sub_numbers(a, b):
return a - b |
# Evaluation function
CAPACITY_SCALAR = 0.25
TARGET_SCORE = 1e4
# Bed update generation
TIMESTEP = 50
UPDATE_CASES = ["normal_to_corona", "corona_leaves_hosp"]
BED_UPDATE_PROB = 10
# Hospitals initialization
NUMBER_FREE_BEDS = 25
NUMBER_CORONA_BEDS = 5
NUMBER_FREE_CORONA_BEDS = 3
NUMBER_CORONA_PAT_IN_NORMAL_BED = 1
SEVERITY_FOR_CORONA_BED = 0.8
# Properties for request generation
NUMBER_PATIENTS = 10000
NUMBER_DAYS = 150
LAT_DELTA = 0.1
LON_DELTA = 0.1
NUMBER_INITALLY_INFECTED = 10
EXPONENTIAL_RATE = 0.15
# Vehicle Properties
MAX_VEHICLE_RANGE = 100
# Precomputing parameters
NBR_SEGMENTS = 200
| capacity_scalar = 0.25
target_score = 10000.0
timestep = 50
update_cases = ['normal_to_corona', 'corona_leaves_hosp']
bed_update_prob = 10
number_free_beds = 25
number_corona_beds = 5
number_free_corona_beds = 3
number_corona_pat_in_normal_bed = 1
severity_for_corona_bed = 0.8
number_patients = 10000
number_days = 150
lat_delta = 0.1
lon_delta = 0.1
number_initally_infected = 10
exponential_rate = 0.15
max_vehicle_range = 100
nbr_segments = 200 |
class HttpResponseException(Exception):
def __init__(self, http_response):
super(HttpResponseException, self).__init__(http_response)
self.http_response = http_response
| class Httpresponseexception(Exception):
def __init__(self, http_response):
super(HttpResponseException, self).__init__(http_response)
self.http_response = http_response |
User_Name=input('What is your name? ')
User_Age=input('How old are you? ')
User_Home=input('Where do you live? ')
print('Hello, ',User_Name)
print('Your age is ',User_Age)
print('You live in ',User_Home) | user__name = input('What is your name? ')
user__age = input('How old are you? ')
user__home = input('Where do you live? ')
print('Hello, ', User_Name)
print('Your age is ', User_Age)
print('You live in ', User_Home) |
def funA(fn):
print('A')
fn()
return "success"
@funA
def funB():
print('B')
print(funB)
a = funB
print(a)
class Category:
cake=lambda p: print(p)
c=Category()
c.cake() | def fun_a(fn):
print('A')
fn()
return 'success'
@funA
def fun_b():
print('B')
print(funB)
a = funB
print(a)
class Category:
cake = lambda p: print(p)
c = category()
c.cake() |
expected_output = {
'topo_id': {
'0': {
'topo_name': {
'EVPN-Multicast-BTV': {
'topo_type': 'L2VRF'}}},
'4294967294': {
'topo_name': {
'GLOBAL': {
'topo_type': 'N/A'}}},
'4294967295': {
'topo_name': {
'ALL': {
'topo_type': 'N/A'}}}}}
| expected_output = {'topo_id': {'0': {'topo_name': {'EVPN-Multicast-BTV': {'topo_type': 'L2VRF'}}}, '4294967294': {'topo_name': {'GLOBAL': {'topo_type': 'N/A'}}}, '4294967295': {'topo_name': {'ALL': {'topo_type': 'N/A'}}}}} |
num1 = int(input("Enter the first number"))
num2 = int(input("Enter second number"))
op = input("Enter operator")
if op == " + ":
print(num1+num2)
elif op == "-":
print("The subraction is", num1-num2)
elif op == "*":
print("The multiplication is ",num1*num2)
elif op == "/":
print("The division is", num1/num2)
else:
print("Invalid operator")
| num1 = int(input('Enter the first number'))
num2 = int(input('Enter second number'))
op = input('Enter operator')
if op == ' + ':
print(num1 + num2)
elif op == '-':
print('The subraction is', num1 - num2)
elif op == '*':
print('The multiplication is ', num1 * num2)
elif op == '/':
print('The division is', num1 / num2)
else:
print('Invalid operator') |
def add_common_params(parser):
parser.add_argument(
'--batch-size',
type=int,
default=64,
help='input batch size for training (default: 64)')
parser.add_argument(
'--test-batch-size',
type=int,
default=1000,
help='input batch size for testing (default: 1000)')
parser.add_argument(
'--epochs',
type=int,
default=20,
help='number of epochs to train (default: 10)')
parser.add_argument(
'--lr',
type=float,
default=0.01,
help='learning rate (default: 0.01)')
parser.add_argument(
'--momentum',
type=float,
default=0,
help='SGD momentum (default: 0)')
parser.add_argument(
'--seed',
type=int,
default=1,
help='random seed (default: 1)')
parser.add_argument(
'--log-interval',
type=int,
default=10,
help='how many batches to wait before logging training status')
parser.add_argument(
'--save-model',
action='store_true',
default=False,
help='For Saving the current Model')
def add_decentralized_params(parser):
parser.add_argument(
'--nodes',
type=int,
default=100,
help='number of nodes in decentralized setting (default: 1000)')
parser.add_argument(
'--sample-size',
type=int,
default=1000,
help='number of samples per node (default: 100)')
parser.add_argument(
'--committee-size',
type=int,
default=30,
help='number of nodes in committee (default: 100)')
parser.add_argument(
'--participants-size',
type=int,
default=30,
help='number of nodes selected as participants (default: 100)')
parser.add_argument(
'--byzantine',
type=float,
default=0.0,
help='% of actual byzantine nodes inside the node pool (default: 0, range: 0-1')
parser.add_argument(
'--expected-byzantine',
type=float,
default=0.0,
help='% of expected byzantine nodes inside the node pool (default: 0, range: 0-1')
parser.add_argument(
'--byzantine-mode',
type=str,
default='random',
help='type of byzantine effect to be used (random, label swap, np-norm) (default: random, in case of swap enter the format swap-{}-{}.')
parser.add_argument(
'--no-multiprocess',
action='store_true',
default=False,
help='turn off multiprocess mode (default: False)')
parser.add_argument(
'--aggregator',
type=str,
default='union-consensus',
choices=['union-consensus', 'krum', 'average', 'trimmed-mean'],
help='Choice of aggregator (default: union-consensus)')
| def add_common_params(parser):
parser.add_argument('--batch-size', type=int, default=64, help='input batch size for training (default: 64)')
parser.add_argument('--test-batch-size', type=int, default=1000, help='input batch size for testing (default: 1000)')
parser.add_argument('--epochs', type=int, default=20, help='number of epochs to train (default: 10)')
parser.add_argument('--lr', type=float, default=0.01, help='learning rate (default: 0.01)')
parser.add_argument('--momentum', type=float, default=0, help='SGD momentum (default: 0)')
parser.add_argument('--seed', type=int, default=1, help='random seed (default: 1)')
parser.add_argument('--log-interval', type=int, default=10, help='how many batches to wait before logging training status')
parser.add_argument('--save-model', action='store_true', default=False, help='For Saving the current Model')
def add_decentralized_params(parser):
parser.add_argument('--nodes', type=int, default=100, help='number of nodes in decentralized setting (default: 1000)')
parser.add_argument('--sample-size', type=int, default=1000, help='number of samples per node (default: 100)')
parser.add_argument('--committee-size', type=int, default=30, help='number of nodes in committee (default: 100)')
parser.add_argument('--participants-size', type=int, default=30, help='number of nodes selected as participants (default: 100)')
parser.add_argument('--byzantine', type=float, default=0.0, help='% of actual byzantine nodes inside the node pool (default: 0, range: 0-1')
parser.add_argument('--expected-byzantine', type=float, default=0.0, help='% of expected byzantine nodes inside the node pool (default: 0, range: 0-1')
parser.add_argument('--byzantine-mode', type=str, default='random', help='type of byzantine effect to be used (random, label swap, np-norm) (default: random, in case of swap enter the format swap-{}-{}.')
parser.add_argument('--no-multiprocess', action='store_true', default=False, help='turn off multiprocess mode (default: False)')
parser.add_argument('--aggregator', type=str, default='union-consensus', choices=['union-consensus', 'krum', 'average', 'trimmed-mean'], help='Choice of aggregator (default: union-consensus)') |
def div(a, b):
if b==0:
return "error"
else:
return a/b
def add(a,b):
return a+b
| def div(a, b):
if b == 0:
return 'error'
else:
return a / b
def add(a, b):
return a + b |
class Fibonacci:
def __init__(self):
self.memo = dict()
self.memo[1] = 1
self.memo[2] = 1
def __call__(self, N):
if N <= 0 or type(N) != int:
raise ValueError('Invalid argument: %s' % str(N) )
if N in self.memo:
return self.memo[N]
else:
ret = self(N-1) + self(N-2)
self.memo[N] = ret
return ret
fibonacci = Fibonacci()
print (fibonacci(15))
| class Fibonacci:
def __init__(self):
self.memo = dict()
self.memo[1] = 1
self.memo[2] = 1
def __call__(self, N):
if N <= 0 or type(N) != int:
raise value_error('Invalid argument: %s' % str(N))
if N in self.memo:
return self.memo[N]
else:
ret = self(N - 1) + self(N - 2)
self.memo[N] = ret
return ret
fibonacci = fibonacci()
print(fibonacci(15)) |
o = input()
e = input()
ans = ''
for i in range(min(len(o), len(e))):
ans += o[i]
ans += e[i]
if len(o) > len(e):
ans += o[len(o) - 1]
if len(o) < len(e):
ans += o[len(e) - 1]
print(ans)
| o = input()
e = input()
ans = ''
for i in range(min(len(o), len(e))):
ans += o[i]
ans += e[i]
if len(o) > len(e):
ans += o[len(o) - 1]
if len(o) < len(e):
ans += o[len(e) - 1]
print(ans) |
# FOR LOOP
print('This program prints all the even number upto n')
n=int(input('Enter the value of n '))
for i in range(0,n):
if(not i%2):
print(i) | print('This program prints all the even number upto n')
n = int(input('Enter the value of n '))
for i in range(0, n):
if not i % 2:
print(i) |
load("//:import_external.bzl", import_external = "safe_wix_scala_maven_import_external")
def dependencies():
import_external(
name = "org_joda_joda_convert",
artifact = "org.joda:joda-convert:2.1.1",
artifact_sha256 = "9b5ec53c4974be36fdf97ba026f3cec4106b8109bb9b484883c8d81c433991fb",
srcjar_sha256 = "9b73d3508f95165818637cc41e61031057e903dc4181522f49ff06e52b46c057",
)
| load('//:import_external.bzl', import_external='safe_wix_scala_maven_import_external')
def dependencies():
import_external(name='org_joda_joda_convert', artifact='org.joda:joda-convert:2.1.1', artifact_sha256='9b5ec53c4974be36fdf97ba026f3cec4106b8109bb9b484883c8d81c433991fb', srcjar_sha256='9b73d3508f95165818637cc41e61031057e903dc4181522f49ff06e52b46c057') |
sample_rate = 32000
window_size = 1024
hop_size = 500 # So that there are 64 frames per second
mel_bins = 64
fmin = 50 # Hz
fmax = 14000 # Hz
frames_per_second = sample_rate // hop_size
logmel_eps = -100 # This value indicates silence used for padding
labels = ['Accelerating_and_revving_and_vroom', 'Accordion', 'Acoustic_guitar',
'Applause', 'Bark', 'Bass_drum', 'Bass_guitar',
'Bathtub_(filling_or_washing)', 'Bicycle_bell', 'Burping_and_eructation',
'Bus', 'Buzz', 'Car_passing_by', 'Cheering', 'Chewing_and_mastication',
'Child_speech_and_kid_speaking', 'Chink_and_clink', 'Chirp_and_tweet',
'Church_bell', 'Clapping', 'Computer_keyboard', 'Crackle', 'Cricket',
'Crowd', 'Cupboard_open_or_close', 'Cutlery_and_silverware',
'Dishes_and_pots_and_pans', 'Drawer_open_or_close', 'Drip',
'Electric_guitar', 'Fart', 'Female_singing',
'Female_speech_and_woman_speaking', 'Fill_(with_liquid)',
'Finger_snapping', 'Frying_(food)', 'Gasp', 'Glockenspiel', 'Gong',
'Gurgling', 'Harmonica', 'Hi-hat', 'Hiss', 'Keys_jangling', 'Knock',
'Male_singing', 'Male_speech_and_man_speaking', 'Marimba_and_xylophone',
'Mechanical_fan', 'Meow', 'Microwave_oven', 'Motorcycle', 'Printer',
'Purr', 'Race_car_and_auto_racing', 'Raindrop', 'Run', 'Scissors',
'Screaming', 'Shatter', 'Sigh', 'Sink_(filling_or_washing)', 'Skateboard',
'Slam', 'Sneeze', 'Squeak', 'Stream', 'Strum', 'Tap', 'Tick-tock',
'Toilet_flush', 'Traffic_noise_and_roadway_noise', 'Trickle_and_dribble',
'Walk_and_footsteps', 'Water_tap_and_faucet', 'Waves_and_surf',
'Whispering', 'Writing', 'Yell', 'Zipper_(clothing)']
lb_to_idx = {lb: idx for idx, lb in enumerate(labels)}
idx_to_lb = {idx: lb for idx, lb in enumerate(labels)}
classes_num = len(labels)
folds_num = 4 | sample_rate = 32000
window_size = 1024
hop_size = 500
mel_bins = 64
fmin = 50
fmax = 14000
frames_per_second = sample_rate // hop_size
logmel_eps = -100
labels = ['Accelerating_and_revving_and_vroom', 'Accordion', 'Acoustic_guitar', 'Applause', 'Bark', 'Bass_drum', 'Bass_guitar', 'Bathtub_(filling_or_washing)', 'Bicycle_bell', 'Burping_and_eructation', 'Bus', 'Buzz', 'Car_passing_by', 'Cheering', 'Chewing_and_mastication', 'Child_speech_and_kid_speaking', 'Chink_and_clink', 'Chirp_and_tweet', 'Church_bell', 'Clapping', 'Computer_keyboard', 'Crackle', 'Cricket', 'Crowd', 'Cupboard_open_or_close', 'Cutlery_and_silverware', 'Dishes_and_pots_and_pans', 'Drawer_open_or_close', 'Drip', 'Electric_guitar', 'Fart', 'Female_singing', 'Female_speech_and_woman_speaking', 'Fill_(with_liquid)', 'Finger_snapping', 'Frying_(food)', 'Gasp', 'Glockenspiel', 'Gong', 'Gurgling', 'Harmonica', 'Hi-hat', 'Hiss', 'Keys_jangling', 'Knock', 'Male_singing', 'Male_speech_and_man_speaking', 'Marimba_and_xylophone', 'Mechanical_fan', 'Meow', 'Microwave_oven', 'Motorcycle', 'Printer', 'Purr', 'Race_car_and_auto_racing', 'Raindrop', 'Run', 'Scissors', 'Screaming', 'Shatter', 'Sigh', 'Sink_(filling_or_washing)', 'Skateboard', 'Slam', 'Sneeze', 'Squeak', 'Stream', 'Strum', 'Tap', 'Tick-tock', 'Toilet_flush', 'Traffic_noise_and_roadway_noise', 'Trickle_and_dribble', 'Walk_and_footsteps', 'Water_tap_and_faucet', 'Waves_and_surf', 'Whispering', 'Writing', 'Yell', 'Zipper_(clothing)']
lb_to_idx = {lb: idx for (idx, lb) in enumerate(labels)}
idx_to_lb = {idx: lb for (idx, lb) in enumerate(labels)}
classes_num = len(labels)
folds_num = 4 |
def get_customized_mapping(cls):
mapping = {
"fda_orphan_drug": {
"properties": {
"designated_date": {
"type": "date"
},
"designation_status": {
"normalizer": "keyword_lowercase_normalizer",
"type": "keyword"
},
"orphan_designation": {
"properties": {
"original_text": {
"type": "text",
"copy_to": [
"all"
]
},
"umls": {
"type": "text",
"copy_to": [
"all"
]
},
"parsed_text": {
"type": "text",
"copy_to": [
"all"
]
}
}
},
"marketing_approval_date": {
"type": "date"
},
"exclusivity_end_date": {
"type": "date"
},
"pubchem_cid": {
"type": "integer",
"copy_to": [
"all"
]
},
"inchikey": {
"normalizer": "keyword_lowercase_normalizer",
"type": "keyword"
},
"trade_name": {
"type": "text"
},
"approved_labeled_indication": {
"type": "text"
},
"exclusivity_protected_indication": {
"type": "text"
},
"pubchem_sid": {
"type": "text"
},
"generic_name": {
"type": "text",
"copy_to": [
"all"
]
},
"approval_status": {
"type": "text"
},
"sponsor": {
"type": "text",
"index": "false"
}
}
}
}
return mapping
| def get_customized_mapping(cls):
mapping = {'fda_orphan_drug': {'properties': {'designated_date': {'type': 'date'}, 'designation_status': {'normalizer': 'keyword_lowercase_normalizer', 'type': 'keyword'}, 'orphan_designation': {'properties': {'original_text': {'type': 'text', 'copy_to': ['all']}, 'umls': {'type': 'text', 'copy_to': ['all']}, 'parsed_text': {'type': 'text', 'copy_to': ['all']}}}, 'marketing_approval_date': {'type': 'date'}, 'exclusivity_end_date': {'type': 'date'}, 'pubchem_cid': {'type': 'integer', 'copy_to': ['all']}, 'inchikey': {'normalizer': 'keyword_lowercase_normalizer', 'type': 'keyword'}, 'trade_name': {'type': 'text'}, 'approved_labeled_indication': {'type': 'text'}, 'exclusivity_protected_indication': {'type': 'text'}, 'pubchem_sid': {'type': 'text'}, 'generic_name': {'type': 'text', 'copy_to': ['all']}, 'approval_status': {'type': 'text'}, 'sponsor': {'type': 'text', 'index': 'false'}}}}
return mapping |
#! python3
def mapear(funcao, lista):
return (funcao(elemento) for elemento in lista)
if __name__ =='__main__':
print(list(mapear(lambda x: x ** 2, [2, 3, 4]))) | def mapear(funcao, lista):
return (funcao(elemento) for elemento in lista)
if __name__ == '__main__':
print(list(mapear(lambda x: x ** 2, [2, 3, 4]))) |
class Hand:
def __init__(self, cards):
self.__cards = cards
self.__total = self.sum_cards(cards)
def __str__(self):
string = 'total: ' + str(self.total()) + ' '
for card in self.cards():
string += str(card)
string += ' '
return string
def add_card(self, card):
self.__cards.append(card)
self.__total = self.sum_cards(self.__cards)
def cards(self):
return self.__cards
def has_available_ace(self):
aces = [ card for card in self.__cards if card.is_ace() ]
if len(aces) == 0:
return False
other_than_ace = [ card for card in self.__cards if not card.is_ace() ]
total_sum_other_than_ace = self.sum_cards(other_than_ace)
return total_sum_other_than_ace <= (11 - len(aces))
def total(self):
return self.__total
def is_busted(self):
return 21 < self.total()
def sum_cards(self, cards):
aces = [ card for card in cards if card.is_ace() ]
other_than_ace = [ card for card in cards if not card.is_ace() ]
total = 0
for card in other_than_ace:
number = card.number()
if 10 <= number and number <= 13:
total += 10
else:
total += number
for card in aces:
number = card.number()
if (total + 11) <= 21:
total += 11
else:
total += number
return total
| class Hand:
def __init__(self, cards):
self.__cards = cards
self.__total = self.sum_cards(cards)
def __str__(self):
string = 'total: ' + str(self.total()) + ' '
for card in self.cards():
string += str(card)
string += ' '
return string
def add_card(self, card):
self.__cards.append(card)
self.__total = self.sum_cards(self.__cards)
def cards(self):
return self.__cards
def has_available_ace(self):
aces = [card for card in self.__cards if card.is_ace()]
if len(aces) == 0:
return False
other_than_ace = [card for card in self.__cards if not card.is_ace()]
total_sum_other_than_ace = self.sum_cards(other_than_ace)
return total_sum_other_than_ace <= 11 - len(aces)
def total(self):
return self.__total
def is_busted(self):
return 21 < self.total()
def sum_cards(self, cards):
aces = [card for card in cards if card.is_ace()]
other_than_ace = [card for card in cards if not card.is_ace()]
total = 0
for card in other_than_ace:
number = card.number()
if 10 <= number and number <= 13:
total += 10
else:
total += number
for card in aces:
number = card.number()
if total + 11 <= 21:
total += 11
else:
total += number
return total |
#!/usr/bin/env python3
# https://codeforces.com/problemset/problem/17/A
def f(l):
n,k = l
pl = [True]*(n+1) # TRUE=prime or not?
for i in range(2):
pl[i] = False
ll = n+1
i = 2
while i<ll:
if pl[i]: #only for prime
j = (i<<1)
while j<ll:
pl[j] = False #non-prime
j += i
i += 1
pp = [i for i in range(ll) if pl[i]][1:] #discard 2
nn = len(pp)
sl = [pp[i]+pp[i+1]+1 for i in range(nn-1)]
l = [pl[s] for s in sl if s<=n]
return sum(l)>=k
l = list(map(int,input().split())) #1e3, 1e3
print('YES' if f(l) else 'NO')
| def f(l):
(n, k) = l
pl = [True] * (n + 1)
for i in range(2):
pl[i] = False
ll = n + 1
i = 2
while i < ll:
if pl[i]:
j = i << 1
while j < ll:
pl[j] = False
j += i
i += 1
pp = [i for i in range(ll) if pl[i]][1:]
nn = len(pp)
sl = [pp[i] + pp[i + 1] + 1 for i in range(nn - 1)]
l = [pl[s] for s in sl if s <= n]
return sum(l) >= k
l = list(map(int, input().split()))
print('YES' if f(l) else 'NO') |
def luck_check(s):
if len(s) % 2 == 1:
s = s[:len(s)//2] + s[len(s)//2 + 1:]
return (sum(int(i) for i in s[:len(s)//2]) == sum(int(i)
for i in s[len(s)//2:]))
| def luck_check(s):
if len(s) % 2 == 1:
s = s[:len(s) // 2] + s[len(s) // 2 + 1:]
return sum((int(i) for i in s[:len(s) // 2])) == sum((int(i) for i in s[len(s) // 2:])) |
def open_door():
# TODO: This needs to be in the stdlib.
Driftwood.area.tilemap.layers[2].tile(4, 0).nowalk = None
Driftwood.area.tilemap.layers[2].tile(4, 0).setgid(27)
def open_door2():
Driftwood.area.tilemap.layers[2].tile(2, 0).nowalk = None
Driftwood.area.tilemap.layers[2].tile(2, 0).setgid(27)
def get_pearl():
if not _["inventory"].has("blue_pearl"):
Driftwood.area.tilemap.layers[2].tile(5, 3).nowalk = None
Driftwood.area.tilemap.layers[1].tile(5, 3).setgid(0)
_["inventory"].get("blue_pearl", 1)
_["inventory"].save()
if "blue_pearl_light" in Driftwood.vars and Driftwood.vars["blue_pearl_light"]:
Driftwood.light.kill(Driftwood.vars["blue_pearl_light"])
| def open_door():
Driftwood.area.tilemap.layers[2].tile(4, 0).nowalk = None
Driftwood.area.tilemap.layers[2].tile(4, 0).setgid(27)
def open_door2():
Driftwood.area.tilemap.layers[2].tile(2, 0).nowalk = None
Driftwood.area.tilemap.layers[2].tile(2, 0).setgid(27)
def get_pearl():
if not _['inventory'].has('blue_pearl'):
Driftwood.area.tilemap.layers[2].tile(5, 3).nowalk = None
Driftwood.area.tilemap.layers[1].tile(5, 3).setgid(0)
_['inventory'].get('blue_pearl', 1)
_['inventory'].save()
if 'blue_pearl_light' in Driftwood.vars and Driftwood.vars['blue_pearl_light']:
Driftwood.light.kill(Driftwood.vars['blue_pearl_light']) |
##########################################################
# Author: Raghav Sikaria
# LinkedIn: https://www.linkedin.com/in/raghavsikaria/
# Github: https://github.com/raghavsikaria
# Last Update: 31-5-2020
# Project: LeetCode May 31 Day 2020 Challenge - Day 31
##########################################################
# QUESTION
# This question is from the abovementioned challenge and can be found here on LeetCode: https://leetcode.com/explore/featured/card/may-leetcoding-challenge/538/week-5-may-29th-may-31st/3346/
############################################################################
# Given two words word1 and word2, find the minimum number of operations required to convert word1 to word2.
# You have the following 3 operations permitted on a word:
# Insert a character
# Delete a character
# Replace a character
# Example 1:
# Input: word1 = "horse", word2 = "ros"
# Output: 3
# Explanation:
# horse -> rorse (replace 'h' with 'r')
# rorse -> rose (remove 'r')
# rose -> ros (remove 'e')
# Example 2:
# Input: word1 = "intention", word2 = "execution"
# Output: 5
# Explanation:
# intention -> inention (remove 't')
# inention -> enention (replace 'i' with 'e')
# enention -> exention (replace 'n' with 'x')
# exention -> exection (replace 'n' with 'c')
# exection -> execution (insert 'u')
############################################################################
# ACCEPTED SOLUTION
# Standard DP problem
# I am glad I could do it
# But disheartened at the same time,
# that this was only because of my ADA Subject
# during my majors in CSE @ VIT
# Coming up with a bottom-up solution
# for a DP problem - is well - quite difficult!
# Ensures O(nm) Time and O(nm) Space complexity
class Solution:
def minDistance(self, word1: str, word2: str) -> int:
len_w1 = len(word1)
len_w2 = len(word2)
memoization_matrix = [[0]*(len_w1+1) for i in range(len_w2+1)]
for i in range(len_w2+1):
for j in range(len_w1+1):
if j == 0: memoization_matrix[i][j] = i
elif i == 0: memoization_matrix[i][j] = j
elif word1[j-1] == word2[i-1]: memoization_matrix[i][j] = memoization_matrix[i-1][j-1]
else:
memoization_matrix[i][j] = min(memoization_matrix[i-1][j-1], memoization_matrix[i-1][j], memoization_matrix[i][j-1]) + 1
return memoization_matrix[-1][-1] | class Solution:
def min_distance(self, word1: str, word2: str) -> int:
len_w1 = len(word1)
len_w2 = len(word2)
memoization_matrix = [[0] * (len_w1 + 1) for i in range(len_w2 + 1)]
for i in range(len_w2 + 1):
for j in range(len_w1 + 1):
if j == 0:
memoization_matrix[i][j] = i
elif i == 0:
memoization_matrix[i][j] = j
elif word1[j - 1] == word2[i - 1]:
memoization_matrix[i][j] = memoization_matrix[i - 1][j - 1]
else:
memoization_matrix[i][j] = min(memoization_matrix[i - 1][j - 1], memoization_matrix[i - 1][j], memoization_matrix[i][j - 1]) + 1
return memoization_matrix[-1][-1] |
# Pins [(606, 187), (331, 188), (469, 188), (188, 190), (549, 206), (397, 207), (243, 208), (483, 231), (312, 232), (401, 262)]
#Pins [(605, 164), (186, 165), (471, 165), (549, 184), (395, 185), (241, 186), (484, 210), (401, 243)]
mpins = [(606, 187), (331, 188), (469, 188), (188, 190), (549, 206), (397, 207), (243, 208), (483, 231), (312, 232), (401, 262)]
bpins = [(605, 164), (186, 165), (471, 165), (549, 184), (395, 185), (241, 186), (484, 210), (401, 262)]
if len(mpins) == 10:
masterPinLocation = mpins
for index, pin in enumerate(masterPinLocation):
print (index, pin)
print ('______________')
A = sorted(masterPinLocation, key = lambda k: [-k[1], k[0]])
B = sorted(bpins, key = lambda k: [-k[1], k[0]])
dec = [512,256,128,64,32,16,8,4,2,1]
print (A,B)
##
pattern =0
for pin10 in B:
for index, pin in enumerate(A):
diff = (pin10[0]-pin[0])**2 + (pin10[1]-pin[1])**2
if (diff < 800):
print(index,pin10,pin)
pattern = pattern + dec[index]
print(pattern,bin(pattern))
print("FFFF", str(bin(pattern)))
print(str(bin(pattern))[3:7]) | mpins = [(606, 187), (331, 188), (469, 188), (188, 190), (549, 206), (397, 207), (243, 208), (483, 231), (312, 232), (401, 262)]
bpins = [(605, 164), (186, 165), (471, 165), (549, 184), (395, 185), (241, 186), (484, 210), (401, 262)]
if len(mpins) == 10:
master_pin_location = mpins
for (index, pin) in enumerate(masterPinLocation):
print(index, pin)
print('______________')
a = sorted(masterPinLocation, key=lambda k: [-k[1], k[0]])
b = sorted(bpins, key=lambda k: [-k[1], k[0]])
dec = [512, 256, 128, 64, 32, 16, 8, 4, 2, 1]
print(A, B)
pattern = 0
for pin10 in B:
for (index, pin) in enumerate(A):
diff = (pin10[0] - pin[0]) ** 2 + (pin10[1] - pin[1]) ** 2
if diff < 800:
print(index, pin10, pin)
pattern = pattern + dec[index]
print(pattern, bin(pattern))
print('FFFF', str(bin(pattern)))
print(str(bin(pattern))[3:7]) |
# Reserved words
reserved = [
'class', 'in', 'inherits', 'isvoid', 'let', 'new', 'of', 'not',
'loop', 'pool', 'case', 'esac', 'if', 'then', 'else', 'fi', 'while'
]
tokens = [
'COMMENTINLINE', 'DARROW', 'CLASS', 'IN', 'INHERITS', 'ISVOID', 'LET',
'NEW', 'OF', 'NOT', 'LOOP', 'POOL', 'CASE', 'ESAC', 'IF', 'THEN', 'ELSE',
'FI', 'WHILE', 'ASSIGN', 'LE', 'PLUS', 'MINUS', 'MULT', 'DIV', 'LPAREN',
'RPAREN', 'LBRACE', 'RBRACE', 'DOT', 'COLON', 'COMMA', 'SEMI', 'EQ',
'NEG', 'LT', 'AT', 'TYPEID', 'OBJECTID', 'INT_CONST', 'STR_CONST',
'COMMENT', 'BOOL_CONST'
]
# Regex dos Tokens
t_DARROW = '=>'
t_ASSIGN = '<-'
t_LE = '<='
t_PLUS = r'\+'
t_MINUS = r'-'
t_MULT = r'\*'
t_DIV = r'/'
t_LPAREN = r'\('
t_RPAREN = r'\)'
t_LBRACE = r'\{'
t_RBRACE = r'\}'
t_DOT = r'\.'
t_COLON = ':'
t_COMMA = ','
t_SEMI = ';'
t_EQ = '='
t_NEG = '~'
t_LT = '<'
t_AT = '@'
t_ignore = ' \t\r\f'
# Handle objects_types_and_reserved_words
def t_ID(t):
r'[a-zA-Z_][a-zA-Z_0-9]*'
if t.value == 'true':
t.type = 'BOOL_CONST'
t.value = True
return t
if t.value == 'false':
t.type = 'BOOL_CONST'
t.value = False
return t
if t.value.lower() in reserved:
t.type = t.value.upper()
else:
if t.value[0].islower():
t.type = 'OBJECTID'
else:
t.type = 'TYPEID'
return t
def t_COMMENT(t):
r'--.* | \(\*.+[\n\*\w\s]*\*\)'
pass
def t_STRING(t):
r'\"[^"]*\"'
# Tira as aspas (only python 2)
t.value = t.value[1:-1].decode("string-escape")
t.type = 'STR_CONST'
return t
def t_INT_CONST(t):
r'\d+'
t.value = int(t.value)
return t
def t_NEWLINE(t):
r'\n+'
t.lexer.lineno += t.value.count("\n")
lerror = []
def t_error(t):
lr = (t.value[0], t.lineno, t.lexpos)
lerror.append(lr)
t.lexer.skip(1)
| reserved = ['class', 'in', 'inherits', 'isvoid', 'let', 'new', 'of', 'not', 'loop', 'pool', 'case', 'esac', 'if', 'then', 'else', 'fi', 'while']
tokens = ['COMMENTINLINE', 'DARROW', 'CLASS', 'IN', 'INHERITS', 'ISVOID', 'LET', 'NEW', 'OF', 'NOT', 'LOOP', 'POOL', 'CASE', 'ESAC', 'IF', 'THEN', 'ELSE', 'FI', 'WHILE', 'ASSIGN', 'LE', 'PLUS', 'MINUS', 'MULT', 'DIV', 'LPAREN', 'RPAREN', 'LBRACE', 'RBRACE', 'DOT', 'COLON', 'COMMA', 'SEMI', 'EQ', 'NEG', 'LT', 'AT', 'TYPEID', 'OBJECTID', 'INT_CONST', 'STR_CONST', 'COMMENT', 'BOOL_CONST']
t_darrow = '=>'
t_assign = '<-'
t_le = '<='
t_plus = '\\+'
t_minus = '-'
t_mult = '\\*'
t_div = '/'
t_lparen = '\\('
t_rparen = '\\)'
t_lbrace = '\\{'
t_rbrace = '\\}'
t_dot = '\\.'
t_colon = ':'
t_comma = ','
t_semi = ';'
t_eq = '='
t_neg = '~'
t_lt = '<'
t_at = '@'
t_ignore = ' \t\r\x0c'
def t_id(t):
"""[a-zA-Z_][a-zA-Z_0-9]*"""
if t.value == 'true':
t.type = 'BOOL_CONST'
t.value = True
return t
if t.value == 'false':
t.type = 'BOOL_CONST'
t.value = False
return t
if t.value.lower() in reserved:
t.type = t.value.upper()
elif t.value[0].islower():
t.type = 'OBJECTID'
else:
t.type = 'TYPEID'
return t
def t_comment(t):
"""--.* | \\(\\*.+[\\n\\*\\w\\s]*\\*\\)"""
pass
def t_string(t):
'''\\"[^"]*\\"'''
t.value = t.value[1:-1].decode('string-escape')
t.type = 'STR_CONST'
return t
def t_int_const(t):
"""\\d+"""
t.value = int(t.value)
return t
def t_newline(t):
"""\\n+"""
t.lexer.lineno += t.value.count('\n')
lerror = []
def t_error(t):
lr = (t.value[0], t.lineno, t.lexpos)
lerror.append(lr)
t.lexer.skip(1) |
#!/usr/bin/env python
if __name__ == "__main__":
print(__file__[0:-3])
elif __name__ == __file__[0:-3]:
print("__name__ isn't __main__")
else:
print("Hmm, something's fishy!" )
| if __name__ == '__main__':
print(__file__[0:-3])
elif __name__ == __file__[0:-3]:
print("__name__ isn't __main__")
else:
print("Hmm, something's fishy!") |
ships = {
"destroyer":[[[0,0], [0,1]], [[0,0],[1,0]]],
"submarine":[[[0,0], [0,1], [0,2]], [[0,0],[1,0], [2,0]]],
"cruiser": [[[0,0], [0,1], [0,2]], [[0,0],[1,0], [2,0]]],
"carrier": [[[0,0], [0,1], [0,2], [0,3], [0,4]], [[0,0],[1,0], [2,0], [3,0], [4,0]]]
}
shipSymbols = {"destroyer":1, "submarine":2, "cruiser":3, "carrier":4}
def matrixAddition(m1, m2):
m3 = []
for i in range(int((len(m1)+len(m2))/2)):
m3.append(m1[i]+m2[i])
return m3
#ShipName = Str, Origin = List (representing the upper/left most pos of the ship), orientation = Str ("vert", "hori"), array = the mapArray...
def plotShip(shipName, origin, orientation, array):
if orientation.lower() == "vert": shipData = ships[shipName.lower()][0]
if orientation.lower() == "hori": shipData = ships[shipName.lower()][1]
for point in shipData:
pixelPos = matrixAddition(origin, point)
if array[pixelPos[1]][pixelPos[0]] == 0:
try:
array[pixelPos[1]][pixelPos[0]] = shipSymbols[shipName.lower()]
except:
return [f"Failed to plot point {pixelPos[0]}, {pixelPos[1]}"]
else: return ["Cannot overwrite other ships."]
return [f"Sucessfully added: {shipName}", array]
| ships = {'destroyer': [[[0, 0], [0, 1]], [[0, 0], [1, 0]]], 'submarine': [[[0, 0], [0, 1], [0, 2]], [[0, 0], [1, 0], [2, 0]]], 'cruiser': [[[0, 0], [0, 1], [0, 2]], [[0, 0], [1, 0], [2, 0]]], 'carrier': [[[0, 0], [0, 1], [0, 2], [0, 3], [0, 4]], [[0, 0], [1, 0], [2, 0], [3, 0], [4, 0]]]}
ship_symbols = {'destroyer': 1, 'submarine': 2, 'cruiser': 3, 'carrier': 4}
def matrix_addition(m1, m2):
m3 = []
for i in range(int((len(m1) + len(m2)) / 2)):
m3.append(m1[i] + m2[i])
return m3
def plot_ship(shipName, origin, orientation, array):
if orientation.lower() == 'vert':
ship_data = ships[shipName.lower()][0]
if orientation.lower() == 'hori':
ship_data = ships[shipName.lower()][1]
for point in shipData:
pixel_pos = matrix_addition(origin, point)
if array[pixelPos[1]][pixelPos[0]] == 0:
try:
array[pixelPos[1]][pixelPos[0]] = shipSymbols[shipName.lower()]
except:
return [f'Failed to plot point {pixelPos[0]}, {pixelPos[1]}']
else:
return ['Cannot overwrite other ships.']
return [f'Sucessfully added: {shipName}', array] |
# what the heck is a class ?
## the class groups similar features together
## the init function in the class are the costructors
class Enemy:
life = 3
def __init__(self):
print("Enemy created")
def attack(self):
print('ouch')
self.life -= 1
def checklife(self):
if self.life <=0:
print('ian dead')
else:
print(str(self.life)+ 'life left')
#create an object
Enemy1 = Enemy()
Enemy1.attack()
Enemy1.checklife()
#class variables are different from instance varibles | class Enemy:
life = 3
def __init__(self):
print('Enemy created')
def attack(self):
print('ouch')
self.life -= 1
def checklife(self):
if self.life <= 0:
print('ian dead')
else:
print(str(self.life) + 'life left')
enemy1 = enemy()
Enemy1.attack()
Enemy1.checklife() |
sentence = "What is the Airspeed Velocity of an Unladen Swallow?"
list_words = sentence.split()
result = {word: len(word) for word in list_words}
print(result)
| sentence = 'What is the Airspeed Velocity of an Unladen Swallow?'
list_words = sentence.split()
result = {word: len(word) for word in list_words}
print(result) |
NUM_PAGES = 25
LIMIT = 500
FREQ = 0.1
STOP_LIST_FILE = "StopList.txt"
| num_pages = 25
limit = 500
freq = 0.1
stop_list_file = 'StopList.txt' |
# by Kami Bigdely
# Extract class
class Actor:
def __init__(self, first_name, last_name, birth_year, movies, email):
self.first_name = first_name
self.last_name = last_name
self.birth_year = birth_year
self.movies = movies
self.email = Email(email)
def send_email(self):
if self.birth_year > 1985:
print(self.first_name, self.last_name)
print('Movies Played: ', end='')
for m in self.movies:
print(m, end=', ')
print()
self.email.send_hiring_email()
class Email:
def __init__(self, email):
self.email = email
def send_hiring_email(self):
print("email sent to: ", self.email)
# first_names = ['elizabeth', 'Jim']
# last_names = ['debicki', 'Carrey']
# birth_year = [1990, 1962]
# movies = [['Tenet', 'Vita & Virgina', 'Guardians of the Galexy', 'The Great Gatsby'],\
# ['Ace Ventura', 'The Mask', 'Dubm and Dumber', 'The Truman Show', 'Yes Man']]
# emails = ['deb@makeschool.com', 'jim@makeschool.com']
elizabeth = Actor(
'Elizabeth', 'Debicki', 1990,
['Tenet', 'Vita & Virgina', 'Guardians of the Galexy', 'The Great Gatsby'],
'deb@makeschool.com'
)
jim = Actor(
'Jim', 'Carrey', 1962,
['Ace Ventura', 'The Mask', 'Dubm and Dumber', 'The Truman Show', 'Yes Man'],
'jim@makeschool.com'
)
elizabeth.send_email()
jim.send_email()
# for i, value in enumerate(emails):
# if birth_year[i] > 1985:
# print(first_names[i], last_names[i])
# print('Movies Played: ', end='')
# for m in movies[i]:
# print(m, end=', ')
# print()
# send_hiring_email(value)
| class Actor:
def __init__(self, first_name, last_name, birth_year, movies, email):
self.first_name = first_name
self.last_name = last_name
self.birth_year = birth_year
self.movies = movies
self.email = email(email)
def send_email(self):
if self.birth_year > 1985:
print(self.first_name, self.last_name)
print('Movies Played: ', end='')
for m in self.movies:
print(m, end=', ')
print()
self.email.send_hiring_email()
class Email:
def __init__(self, email):
self.email = email
def send_hiring_email(self):
print('email sent to: ', self.email)
elizabeth = actor('Elizabeth', 'Debicki', 1990, ['Tenet', 'Vita & Virgina', 'Guardians of the Galexy', 'The Great Gatsby'], 'deb@makeschool.com')
jim = actor('Jim', 'Carrey', 1962, ['Ace Ventura', 'The Mask', 'Dubm and Dumber', 'The Truman Show', 'Yes Man'], 'jim@makeschool.com')
elizabeth.send_email()
jim.send_email() |
#
# PySNMP MIB module MSERIES-ALARM-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/MSERIES-ALARM-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 20:05:41 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
Integer, OctetString, ObjectIdentifier = mibBuilder.importSymbols("ASN1", "Integer", "OctetString", "ObjectIdentifier")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueSizeConstraint, SingleValueConstraint, ValueRangeConstraint, ConstraintsIntersection, ConstraintsUnion = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueSizeConstraint", "SingleValueConstraint", "ValueRangeConstraint", "ConstraintsIntersection", "ConstraintsUnion")
mseries, = mibBuilder.importSymbols("MSERIES-MIB", "mseries")
PortType, AlarmNotificationType, AlarmProbableCause, AlarmPerceivedSeverity, UnitType = mibBuilder.importSymbols("MSERIES-TC", "PortType", "AlarmNotificationType", "AlarmProbableCause", "AlarmPerceivedSeverity", "UnitType")
ModuleCompliance, ObjectGroup, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "ObjectGroup", "NotificationGroup")
NotificationType, Gauge32, IpAddress, MibIdentifier, Bits, ObjectIdentity, Counter64, MibScalar, MibTable, MibTableRow, MibTableColumn, Integer32, TimeTicks, ModuleIdentity, iso, Counter32, Unsigned32 = mibBuilder.importSymbols("SNMPv2-SMI", "NotificationType", "Gauge32", "IpAddress", "MibIdentifier", "Bits", "ObjectIdentity", "Counter64", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Integer32", "TimeTicks", "ModuleIdentity", "iso", "Counter32", "Unsigned32")
TextualConvention, DateAndTime, DisplayString = mibBuilder.importSymbols("SNMPv2-TC", "TextualConvention", "DateAndTime", "DisplayString")
smartAlarm = ModuleIdentity((1, 3, 6, 1, 4, 1, 30826, 1, 1))
smartAlarm.setRevisions(('2014-02-12 14:15', '2013-10-15 13:41', '2011-12-05 00:00',))
if mibBuilder.loadTexts: smartAlarm.setLastUpdated('201402121415Z')
if mibBuilder.loadTexts: smartAlarm.setOrganization('SmartOptics')
alarmGeneral = MibIdentifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 1))
alarmActiveList = MibIdentifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2))
alarmLogList = MibIdentifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3))
alarmNotifications = MibIdentifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 4))
smartAlarmMIBConformance = MibIdentifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5))
smartAlarmGroups = MibIdentifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5, 1))
smartAlarmCompliances = MibIdentifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5, 2))
smartAlarmGeneralLastSeqNumber = MibScalar((1, 3, 6, 1, 4, 1, 30826, 1, 1, 1, 1), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: smartAlarmGeneralLastSeqNumber.setStatus('current')
smartAlarmGeneralHighestSeverity = MibScalar((1, 3, 6, 1, 4, 1, 30826, 1, 1, 1, 2), AlarmPerceivedSeverity()).setMaxAccess("readonly")
if mibBuilder.loadTexts: smartAlarmGeneralHighestSeverity.setStatus('current')
smartAlarmGeneralNumberActiveList = MibScalar((1, 3, 6, 1, 4, 1, 30826, 1, 1, 1, 3), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: smartAlarmGeneralNumberActiveList.setStatus('current')
smartAlarmGeneralNumberLogList = MibScalar((1, 3, 6, 1, 4, 1, 30826, 1, 1, 1, 4), Unsigned32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: smartAlarmGeneralNumberLogList.setStatus('current')
alarmActiveTable = MibTable((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1), )
if mibBuilder.loadTexts: alarmActiveTable.setStatus('current')
alarmEntry = MibTableRow((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1), ).setIndexNames((0, "MSERIES-ALARM-MIB", "alarmIndex"))
if mibBuilder.loadTexts: alarmEntry.setStatus('current')
alarmIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 2147483647))).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmIndex.setStatus('current')
alarmUnit = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 2), UnitType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmUnit.setStatus('current')
alarmPort = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 3), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmPort.setStatus('current')
alarmText = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 4), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmText.setStatus('current')
alarmSeverity = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 5), AlarmPerceivedSeverity()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmSeverity.setStatus('current')
alarmActivationTime = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 6), DateAndTime()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmActivationTime.setStatus('current')
alarmCeaseTime = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 7), DateAndTime()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmCeaseTime.setStatus('current')
alarmSeqNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 8), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmSeqNumber.setStatus('current')
alarmHostName = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 9), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmHostName.setStatus('current')
alarmPortName = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 10), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmPortName.setStatus('current')
alarmPortType = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 11), PortType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmPortType.setStatus('current')
alarmType = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 12), AlarmNotificationType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmType.setStatus('current')
alarmCause = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 13), AlarmProbableCause()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmCause.setStatus('current')
alarmPortAlias = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 14), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmPortAlias.setStatus('current')
alarmLogTable = MibTable((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1), )
if mibBuilder.loadTexts: alarmLogTable.setStatus('current')
alarmLogEntry = MibTableRow((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1), ).setIndexNames((0, "MSERIES-ALARM-MIB", "alarmLogIndex"))
if mibBuilder.loadTexts: alarmLogEntry.setStatus('current')
alarmLogIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 2147483647))).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmLogIndex.setStatus('current')
alarmLogUnit = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 2), UnitType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmLogUnit.setStatus('current')
alarmLogPort = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 3), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmLogPort.setStatus('current')
alarmLogText = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 4), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmLogText.setStatus('current')
alarmLogSeverity = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 5), AlarmPerceivedSeverity()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmLogSeverity.setStatus('current')
alarmLogActivationTime = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 6), DateAndTime()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmLogActivationTime.setStatus('current')
alarmLogCeaseTime = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 7), DateAndTime()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmLogCeaseTime.setStatus('current')
alarmLogSeqNumber = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 8), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmLogSeqNumber.setStatus('current')
alarmLogHostName = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 9), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmLogHostName.setStatus('current')
alarmLogPortName = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 10), DisplayString()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmLogPortName.setStatus('current')
alarmLogPortType = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 11), PortType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmLogPortType.setStatus('current')
alarmLogType = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 12), AlarmNotificationType()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmLogType.setStatus('current')
alarmLogCause = MibTableColumn((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 13), AlarmProbableCause()).setMaxAccess("readonly")
if mibBuilder.loadTexts: alarmLogCause.setStatus('current')
alarmNotifyPrefix = MibIdentifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 4, 0))
alarmNotificationCleared = NotificationType((1, 3, 6, 1, 4, 1, 30826, 1, 1, 4, 0, 1)).setObjects(("MSERIES-ALARM-MIB", "alarmIndex"), ("MSERIES-ALARM-MIB", "alarmUnit"), ("MSERIES-ALARM-MIB", "alarmPort"), ("MSERIES-ALARM-MIB", "alarmText"), ("MSERIES-ALARM-MIB", "alarmSeverity"), ("MSERIES-ALARM-MIB", "alarmActivationTime"), ("MSERIES-ALARM-MIB", "alarmCeaseTime"), ("MSERIES-ALARM-MIB", "alarmSeqNumber"), ("MSERIES-ALARM-MIB", "alarmHostName"), ("MSERIES-ALARM-MIB", "alarmPortName"), ("MSERIES-ALARM-MIB", "alarmPortType"), ("MSERIES-ALARM-MIB", "alarmPortAlias"))
if mibBuilder.loadTexts: alarmNotificationCleared.setStatus('current')
alarmNotificationWarning = NotificationType((1, 3, 6, 1, 4, 1, 30826, 1, 1, 4, 0, 2)).setObjects(("MSERIES-ALARM-MIB", "alarmIndex"), ("MSERIES-ALARM-MIB", "alarmUnit"), ("MSERIES-ALARM-MIB", "alarmPort"), ("MSERIES-ALARM-MIB", "alarmText"), ("MSERIES-ALARM-MIB", "alarmSeverity"), ("MSERIES-ALARM-MIB", "alarmActivationTime"), ("MSERIES-ALARM-MIB", "alarmCeaseTime"), ("MSERIES-ALARM-MIB", "alarmSeqNumber"), ("MSERIES-ALARM-MIB", "alarmHostName"), ("MSERIES-ALARM-MIB", "alarmPortName"), ("MSERIES-ALARM-MIB", "alarmPortType"), ("MSERIES-ALARM-MIB", "alarmPortAlias"))
if mibBuilder.loadTexts: alarmNotificationWarning.setStatus('current')
alarmNotificationMinor = NotificationType((1, 3, 6, 1, 4, 1, 30826, 1, 1, 4, 0, 3)).setObjects(("MSERIES-ALARM-MIB", "alarmIndex"), ("MSERIES-ALARM-MIB", "alarmUnit"), ("MSERIES-ALARM-MIB", "alarmPort"), ("MSERIES-ALARM-MIB", "alarmText"), ("MSERIES-ALARM-MIB", "alarmSeverity"), ("MSERIES-ALARM-MIB", "alarmActivationTime"), ("MSERIES-ALARM-MIB", "alarmCeaseTime"), ("MSERIES-ALARM-MIB", "alarmSeqNumber"), ("MSERIES-ALARM-MIB", "alarmHostName"), ("MSERIES-ALARM-MIB", "alarmPortName"), ("MSERIES-ALARM-MIB", "alarmPortType"), ("MSERIES-ALARM-MIB", "alarmPortAlias"))
if mibBuilder.loadTexts: alarmNotificationMinor.setStatus('current')
alarmNotificationMajor = NotificationType((1, 3, 6, 1, 4, 1, 30826, 1, 1, 4, 0, 4)).setObjects(("MSERIES-ALARM-MIB", "alarmIndex"), ("MSERIES-ALARM-MIB", "alarmUnit"), ("MSERIES-ALARM-MIB", "alarmPort"), ("MSERIES-ALARM-MIB", "alarmText"), ("MSERIES-ALARM-MIB", "alarmSeverity"), ("MSERIES-ALARM-MIB", "alarmActivationTime"), ("MSERIES-ALARM-MIB", "alarmCeaseTime"), ("MSERIES-ALARM-MIB", "alarmSeqNumber"), ("MSERIES-ALARM-MIB", "alarmHostName"), ("MSERIES-ALARM-MIB", "alarmPortName"), ("MSERIES-ALARM-MIB", "alarmPortType"), ("MSERIES-ALARM-MIB", "alarmPortAlias"))
if mibBuilder.loadTexts: alarmNotificationMajor.setStatus('current')
alarmNotificationCritical = NotificationType((1, 3, 6, 1, 4, 1, 30826, 1, 1, 4, 0, 5)).setObjects(("MSERIES-ALARM-MIB", "alarmIndex"), ("MSERIES-ALARM-MIB", "alarmUnit"), ("MSERIES-ALARM-MIB", "alarmPort"), ("MSERIES-ALARM-MIB", "alarmText"), ("MSERIES-ALARM-MIB", "alarmSeverity"), ("MSERIES-ALARM-MIB", "alarmActivationTime"), ("MSERIES-ALARM-MIB", "alarmCeaseTime"), ("MSERIES-ALARM-MIB", "alarmSeqNumber"), ("MSERIES-ALARM-MIB", "alarmHostName"), ("MSERIES-ALARM-MIB", "alarmPortName"), ("MSERIES-ALARM-MIB", "alarmPortType"), ("MSERIES-ALARM-MIB", "alarmPortAlias"))
if mibBuilder.loadTexts: alarmNotificationCritical.setStatus('current')
smartAlarmGeneralGroupV1 = ObjectGroup((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5, 1, 1)).setObjects(("MSERIES-ALARM-MIB", "smartAlarmGeneralLastSeqNumber"), ("MSERIES-ALARM-MIB", "smartAlarmGeneralHighestSeverity"), ("MSERIES-ALARM-MIB", "smartAlarmGeneralNumberActiveList"), ("MSERIES-ALARM-MIB", "smartAlarmGeneralNumberLogList"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
smartAlarmGeneralGroupV1 = smartAlarmGeneralGroupV1.setStatus('current')
smartAlarmNotificationGroupV1 = NotificationGroup((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5, 1, 2)).setObjects(("MSERIES-ALARM-MIB", "alarmNotificationCleared"), ("MSERIES-ALARM-MIB", "alarmNotificationCritical"), ("MSERIES-ALARM-MIB", "alarmNotificationMajor"), ("MSERIES-ALARM-MIB", "alarmNotificationMinor"), ("MSERIES-ALARM-MIB", "alarmNotificationWarning"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
smartAlarmNotificationGroupV1 = smartAlarmNotificationGroupV1.setStatus('current')
smartAlarmActiveTableGroupV1 = ObjectGroup((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5, 1, 3)).setObjects(("MSERIES-ALARM-MIB", "alarmIndex"), ("MSERIES-ALARM-MIB", "alarmUnit"), ("MSERIES-ALARM-MIB", "alarmPort"), ("MSERIES-ALARM-MIB", "alarmText"), ("MSERIES-ALARM-MIB", "alarmSeverity"), ("MSERIES-ALARM-MIB", "alarmActivationTime"), ("MSERIES-ALARM-MIB", "alarmCeaseTime"), ("MSERIES-ALARM-MIB", "alarmSeqNumber"), ("MSERIES-ALARM-MIB", "alarmHostName"), ("MSERIES-ALARM-MIB", "alarmPortName"), ("MSERIES-ALARM-MIB", "alarmPortType"), ("MSERIES-ALARM-MIB", "alarmType"), ("MSERIES-ALARM-MIB", "alarmCause"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
smartAlarmActiveTableGroupV1 = smartAlarmActiveTableGroupV1.setStatus('current')
smartAlarmLogTableGroupV1 = ObjectGroup((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5, 1, 4)).setObjects(("MSERIES-ALARM-MIB", "alarmLogIndex"), ("MSERIES-ALARM-MIB", "alarmLogUnit"), ("MSERIES-ALARM-MIB", "alarmLogPort"), ("MSERIES-ALARM-MIB", "alarmLogText"), ("MSERIES-ALARM-MIB", "alarmLogSeverity"), ("MSERIES-ALARM-MIB", "alarmLogActivationTime"), ("MSERIES-ALARM-MIB", "alarmLogCeaseTime"), ("MSERIES-ALARM-MIB", "alarmLogSeqNumber"), ("MSERIES-ALARM-MIB", "alarmLogHostName"), ("MSERIES-ALARM-MIB", "alarmLogPortName"), ("MSERIES-ALARM-MIB", "alarmLogPortType"), ("MSERIES-ALARM-MIB", "alarmLogType"), ("MSERIES-ALARM-MIB", "alarmLogCause"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
smartAlarmLogTableGroupV1 = smartAlarmLogTableGroupV1.setStatus('current')
smartAlarmBasicComplV1 = ModuleCompliance((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5, 2, 1)).setObjects(("MSERIES-ALARM-MIB", "smartAlarmGeneralGroupV1"), ("MSERIES-ALARM-MIB", "smartAlarmNotificationGroupV1"), ("MSERIES-ALARM-MIB", "smartAlarmActiveTableGroupV1"), ("MSERIES-ALARM-MIB", "smartAlarmLogTableGroupV1"))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
smartAlarmBasicComplV1 = smartAlarmBasicComplV1.setStatus('current')
mibBuilder.exportSymbols("MSERIES-ALARM-MIB", alarmLogActivationTime=alarmLogActivationTime, smartAlarmCompliances=smartAlarmCompliances, smartAlarmGeneralNumberActiveList=smartAlarmGeneralNumberActiveList, alarmNotifyPrefix=alarmNotifyPrefix, alarmEntry=alarmEntry, alarmLogUnit=alarmLogUnit, alarmNotificationMajor=alarmNotificationMajor, smartAlarmActiveTableGroupV1=smartAlarmActiveTableGroupV1, alarmHostName=alarmHostName, alarmCause=alarmCause, alarmLogType=alarmLogType, smartAlarmGroups=smartAlarmGroups, alarmPort=alarmPort, alarmType=alarmType, alarmNotifications=alarmNotifications, smartAlarmGeneralHighestSeverity=smartAlarmGeneralHighestSeverity, alarmSeverity=alarmSeverity, alarmActivationTime=alarmActivationTime, alarmLogHostName=alarmLogHostName, alarmActiveList=alarmActiveList, alarmCeaseTime=alarmCeaseTime, alarmPortName=alarmPortName, alarmLogPort=alarmLogPort, alarmLogIndex=alarmLogIndex, smartAlarmBasicComplV1=smartAlarmBasicComplV1, alarmUnit=alarmUnit, alarmNotificationWarning=alarmNotificationWarning, alarmNotificationCritical=alarmNotificationCritical, alarmLogEntry=alarmLogEntry, alarmSeqNumber=alarmSeqNumber, PYSNMP_MODULE_ID=smartAlarm, alarmNotificationMinor=alarmNotificationMinor, alarmPortAlias=alarmPortAlias, alarmLogPortType=alarmLogPortType, alarmText=alarmText, smartAlarmGeneralNumberLogList=smartAlarmGeneralNumberLogList, alarmLogPortName=alarmLogPortName, alarmIndex=alarmIndex, alarmPortType=alarmPortType, alarmLogTable=alarmLogTable, smartAlarmGeneralGroupV1=smartAlarmGeneralGroupV1, smartAlarm=smartAlarm, alarmLogCeaseTime=alarmLogCeaseTime, alarmLogCause=alarmLogCause, alarmLogSeverity=alarmLogSeverity, alarmLogList=alarmLogList, smartAlarmGeneralLastSeqNumber=smartAlarmGeneralLastSeqNumber, alarmLogSeqNumber=alarmLogSeqNumber, alarmNotificationCleared=alarmNotificationCleared, smartAlarmNotificationGroupV1=smartAlarmNotificationGroupV1, smartAlarmLogTableGroupV1=smartAlarmLogTableGroupV1, alarmActiveTable=alarmActiveTable, alarmLogText=alarmLogText, alarmGeneral=alarmGeneral, smartAlarmMIBConformance=smartAlarmMIBConformance)
| (integer, octet_string, object_identifier) = mibBuilder.importSymbols('ASN1', 'Integer', 'OctetString', 'ObjectIdentifier')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(value_size_constraint, single_value_constraint, value_range_constraint, constraints_intersection, constraints_union) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ValueSizeConstraint', 'SingleValueConstraint', 'ValueRangeConstraint', 'ConstraintsIntersection', 'ConstraintsUnion')
(mseries,) = mibBuilder.importSymbols('MSERIES-MIB', 'mseries')
(port_type, alarm_notification_type, alarm_probable_cause, alarm_perceived_severity, unit_type) = mibBuilder.importSymbols('MSERIES-TC', 'PortType', 'AlarmNotificationType', 'AlarmProbableCause', 'AlarmPerceivedSeverity', 'UnitType')
(module_compliance, object_group, notification_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'ObjectGroup', 'NotificationGroup')
(notification_type, gauge32, ip_address, mib_identifier, bits, object_identity, counter64, mib_scalar, mib_table, mib_table_row, mib_table_column, integer32, time_ticks, module_identity, iso, counter32, unsigned32) = mibBuilder.importSymbols('SNMPv2-SMI', 'NotificationType', 'Gauge32', 'IpAddress', 'MibIdentifier', 'Bits', 'ObjectIdentity', 'Counter64', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'Integer32', 'TimeTicks', 'ModuleIdentity', 'iso', 'Counter32', 'Unsigned32')
(textual_convention, date_and_time, display_string) = mibBuilder.importSymbols('SNMPv2-TC', 'TextualConvention', 'DateAndTime', 'DisplayString')
smart_alarm = module_identity((1, 3, 6, 1, 4, 1, 30826, 1, 1))
smartAlarm.setRevisions(('2014-02-12 14:15', '2013-10-15 13:41', '2011-12-05 00:00'))
if mibBuilder.loadTexts:
smartAlarm.setLastUpdated('201402121415Z')
if mibBuilder.loadTexts:
smartAlarm.setOrganization('SmartOptics')
alarm_general = mib_identifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 1))
alarm_active_list = mib_identifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2))
alarm_log_list = mib_identifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3))
alarm_notifications = mib_identifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 4))
smart_alarm_mib_conformance = mib_identifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5))
smart_alarm_groups = mib_identifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5, 1))
smart_alarm_compliances = mib_identifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5, 2))
smart_alarm_general_last_seq_number = mib_scalar((1, 3, 6, 1, 4, 1, 30826, 1, 1, 1, 1), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
smartAlarmGeneralLastSeqNumber.setStatus('current')
smart_alarm_general_highest_severity = mib_scalar((1, 3, 6, 1, 4, 1, 30826, 1, 1, 1, 2), alarm_perceived_severity()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
smartAlarmGeneralHighestSeverity.setStatus('current')
smart_alarm_general_number_active_list = mib_scalar((1, 3, 6, 1, 4, 1, 30826, 1, 1, 1, 3), unsigned32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
smartAlarmGeneralNumberActiveList.setStatus('current')
smart_alarm_general_number_log_list = mib_scalar((1, 3, 6, 1, 4, 1, 30826, 1, 1, 1, 4), unsigned32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
smartAlarmGeneralNumberLogList.setStatus('current')
alarm_active_table = mib_table((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1))
if mibBuilder.loadTexts:
alarmActiveTable.setStatus('current')
alarm_entry = mib_table_row((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1)).setIndexNames((0, 'MSERIES-ALARM-MIB', 'alarmIndex'))
if mibBuilder.loadTexts:
alarmEntry.setStatus('current')
alarm_index = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 1), unsigned32().subtype(subtypeSpec=value_range_constraint(1, 2147483647))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmIndex.setStatus('current')
alarm_unit = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 2), unit_type()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmUnit.setStatus('current')
alarm_port = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 3), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmPort.setStatus('current')
alarm_text = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 4), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmText.setStatus('current')
alarm_severity = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 5), alarm_perceived_severity()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmSeverity.setStatus('current')
alarm_activation_time = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 6), date_and_time()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmActivationTime.setStatus('current')
alarm_cease_time = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 7), date_and_time()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmCeaseTime.setStatus('current')
alarm_seq_number = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 8), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmSeqNumber.setStatus('current')
alarm_host_name = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 9), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmHostName.setStatus('current')
alarm_port_name = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 10), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmPortName.setStatus('current')
alarm_port_type = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 11), port_type()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmPortType.setStatus('current')
alarm_type = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 12), alarm_notification_type()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmType.setStatus('current')
alarm_cause = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 13), alarm_probable_cause()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmCause.setStatus('current')
alarm_port_alias = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 2, 1, 1, 14), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmPortAlias.setStatus('current')
alarm_log_table = mib_table((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1))
if mibBuilder.loadTexts:
alarmLogTable.setStatus('current')
alarm_log_entry = mib_table_row((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1)).setIndexNames((0, 'MSERIES-ALARM-MIB', 'alarmLogIndex'))
if mibBuilder.loadTexts:
alarmLogEntry.setStatus('current')
alarm_log_index = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 1), unsigned32().subtype(subtypeSpec=value_range_constraint(1, 2147483647))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmLogIndex.setStatus('current')
alarm_log_unit = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 2), unit_type()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmLogUnit.setStatus('current')
alarm_log_port = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 3), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmLogPort.setStatus('current')
alarm_log_text = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 4), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmLogText.setStatus('current')
alarm_log_severity = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 5), alarm_perceived_severity()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmLogSeverity.setStatus('current')
alarm_log_activation_time = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 6), date_and_time()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmLogActivationTime.setStatus('current')
alarm_log_cease_time = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 7), date_and_time()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmLogCeaseTime.setStatus('current')
alarm_log_seq_number = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 8), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmLogSeqNumber.setStatus('current')
alarm_log_host_name = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 9), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmLogHostName.setStatus('current')
alarm_log_port_name = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 10), display_string()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmLogPortName.setStatus('current')
alarm_log_port_type = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 11), port_type()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmLogPortType.setStatus('current')
alarm_log_type = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 12), alarm_notification_type()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmLogType.setStatus('current')
alarm_log_cause = mib_table_column((1, 3, 6, 1, 4, 1, 30826, 1, 1, 3, 1, 1, 13), alarm_probable_cause()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
alarmLogCause.setStatus('current')
alarm_notify_prefix = mib_identifier((1, 3, 6, 1, 4, 1, 30826, 1, 1, 4, 0))
alarm_notification_cleared = notification_type((1, 3, 6, 1, 4, 1, 30826, 1, 1, 4, 0, 1)).setObjects(('MSERIES-ALARM-MIB', 'alarmIndex'), ('MSERIES-ALARM-MIB', 'alarmUnit'), ('MSERIES-ALARM-MIB', 'alarmPort'), ('MSERIES-ALARM-MIB', 'alarmText'), ('MSERIES-ALARM-MIB', 'alarmSeverity'), ('MSERIES-ALARM-MIB', 'alarmActivationTime'), ('MSERIES-ALARM-MIB', 'alarmCeaseTime'), ('MSERIES-ALARM-MIB', 'alarmSeqNumber'), ('MSERIES-ALARM-MIB', 'alarmHostName'), ('MSERIES-ALARM-MIB', 'alarmPortName'), ('MSERIES-ALARM-MIB', 'alarmPortType'), ('MSERIES-ALARM-MIB', 'alarmPortAlias'))
if mibBuilder.loadTexts:
alarmNotificationCleared.setStatus('current')
alarm_notification_warning = notification_type((1, 3, 6, 1, 4, 1, 30826, 1, 1, 4, 0, 2)).setObjects(('MSERIES-ALARM-MIB', 'alarmIndex'), ('MSERIES-ALARM-MIB', 'alarmUnit'), ('MSERIES-ALARM-MIB', 'alarmPort'), ('MSERIES-ALARM-MIB', 'alarmText'), ('MSERIES-ALARM-MIB', 'alarmSeverity'), ('MSERIES-ALARM-MIB', 'alarmActivationTime'), ('MSERIES-ALARM-MIB', 'alarmCeaseTime'), ('MSERIES-ALARM-MIB', 'alarmSeqNumber'), ('MSERIES-ALARM-MIB', 'alarmHostName'), ('MSERIES-ALARM-MIB', 'alarmPortName'), ('MSERIES-ALARM-MIB', 'alarmPortType'), ('MSERIES-ALARM-MIB', 'alarmPortAlias'))
if mibBuilder.loadTexts:
alarmNotificationWarning.setStatus('current')
alarm_notification_minor = notification_type((1, 3, 6, 1, 4, 1, 30826, 1, 1, 4, 0, 3)).setObjects(('MSERIES-ALARM-MIB', 'alarmIndex'), ('MSERIES-ALARM-MIB', 'alarmUnit'), ('MSERIES-ALARM-MIB', 'alarmPort'), ('MSERIES-ALARM-MIB', 'alarmText'), ('MSERIES-ALARM-MIB', 'alarmSeverity'), ('MSERIES-ALARM-MIB', 'alarmActivationTime'), ('MSERIES-ALARM-MIB', 'alarmCeaseTime'), ('MSERIES-ALARM-MIB', 'alarmSeqNumber'), ('MSERIES-ALARM-MIB', 'alarmHostName'), ('MSERIES-ALARM-MIB', 'alarmPortName'), ('MSERIES-ALARM-MIB', 'alarmPortType'), ('MSERIES-ALARM-MIB', 'alarmPortAlias'))
if mibBuilder.loadTexts:
alarmNotificationMinor.setStatus('current')
alarm_notification_major = notification_type((1, 3, 6, 1, 4, 1, 30826, 1, 1, 4, 0, 4)).setObjects(('MSERIES-ALARM-MIB', 'alarmIndex'), ('MSERIES-ALARM-MIB', 'alarmUnit'), ('MSERIES-ALARM-MIB', 'alarmPort'), ('MSERIES-ALARM-MIB', 'alarmText'), ('MSERIES-ALARM-MIB', 'alarmSeverity'), ('MSERIES-ALARM-MIB', 'alarmActivationTime'), ('MSERIES-ALARM-MIB', 'alarmCeaseTime'), ('MSERIES-ALARM-MIB', 'alarmSeqNumber'), ('MSERIES-ALARM-MIB', 'alarmHostName'), ('MSERIES-ALARM-MIB', 'alarmPortName'), ('MSERIES-ALARM-MIB', 'alarmPortType'), ('MSERIES-ALARM-MIB', 'alarmPortAlias'))
if mibBuilder.loadTexts:
alarmNotificationMajor.setStatus('current')
alarm_notification_critical = notification_type((1, 3, 6, 1, 4, 1, 30826, 1, 1, 4, 0, 5)).setObjects(('MSERIES-ALARM-MIB', 'alarmIndex'), ('MSERIES-ALARM-MIB', 'alarmUnit'), ('MSERIES-ALARM-MIB', 'alarmPort'), ('MSERIES-ALARM-MIB', 'alarmText'), ('MSERIES-ALARM-MIB', 'alarmSeverity'), ('MSERIES-ALARM-MIB', 'alarmActivationTime'), ('MSERIES-ALARM-MIB', 'alarmCeaseTime'), ('MSERIES-ALARM-MIB', 'alarmSeqNumber'), ('MSERIES-ALARM-MIB', 'alarmHostName'), ('MSERIES-ALARM-MIB', 'alarmPortName'), ('MSERIES-ALARM-MIB', 'alarmPortType'), ('MSERIES-ALARM-MIB', 'alarmPortAlias'))
if mibBuilder.loadTexts:
alarmNotificationCritical.setStatus('current')
smart_alarm_general_group_v1 = object_group((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5, 1, 1)).setObjects(('MSERIES-ALARM-MIB', 'smartAlarmGeneralLastSeqNumber'), ('MSERIES-ALARM-MIB', 'smartAlarmGeneralHighestSeverity'), ('MSERIES-ALARM-MIB', 'smartAlarmGeneralNumberActiveList'), ('MSERIES-ALARM-MIB', 'smartAlarmGeneralNumberLogList'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
smart_alarm_general_group_v1 = smartAlarmGeneralGroupV1.setStatus('current')
smart_alarm_notification_group_v1 = notification_group((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5, 1, 2)).setObjects(('MSERIES-ALARM-MIB', 'alarmNotificationCleared'), ('MSERIES-ALARM-MIB', 'alarmNotificationCritical'), ('MSERIES-ALARM-MIB', 'alarmNotificationMajor'), ('MSERIES-ALARM-MIB', 'alarmNotificationMinor'), ('MSERIES-ALARM-MIB', 'alarmNotificationWarning'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
smart_alarm_notification_group_v1 = smartAlarmNotificationGroupV1.setStatus('current')
smart_alarm_active_table_group_v1 = object_group((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5, 1, 3)).setObjects(('MSERIES-ALARM-MIB', 'alarmIndex'), ('MSERIES-ALARM-MIB', 'alarmUnit'), ('MSERIES-ALARM-MIB', 'alarmPort'), ('MSERIES-ALARM-MIB', 'alarmText'), ('MSERIES-ALARM-MIB', 'alarmSeverity'), ('MSERIES-ALARM-MIB', 'alarmActivationTime'), ('MSERIES-ALARM-MIB', 'alarmCeaseTime'), ('MSERIES-ALARM-MIB', 'alarmSeqNumber'), ('MSERIES-ALARM-MIB', 'alarmHostName'), ('MSERIES-ALARM-MIB', 'alarmPortName'), ('MSERIES-ALARM-MIB', 'alarmPortType'), ('MSERIES-ALARM-MIB', 'alarmType'), ('MSERIES-ALARM-MIB', 'alarmCause'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
smart_alarm_active_table_group_v1 = smartAlarmActiveTableGroupV1.setStatus('current')
smart_alarm_log_table_group_v1 = object_group((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5, 1, 4)).setObjects(('MSERIES-ALARM-MIB', 'alarmLogIndex'), ('MSERIES-ALARM-MIB', 'alarmLogUnit'), ('MSERIES-ALARM-MIB', 'alarmLogPort'), ('MSERIES-ALARM-MIB', 'alarmLogText'), ('MSERIES-ALARM-MIB', 'alarmLogSeverity'), ('MSERIES-ALARM-MIB', 'alarmLogActivationTime'), ('MSERIES-ALARM-MIB', 'alarmLogCeaseTime'), ('MSERIES-ALARM-MIB', 'alarmLogSeqNumber'), ('MSERIES-ALARM-MIB', 'alarmLogHostName'), ('MSERIES-ALARM-MIB', 'alarmLogPortName'), ('MSERIES-ALARM-MIB', 'alarmLogPortType'), ('MSERIES-ALARM-MIB', 'alarmLogType'), ('MSERIES-ALARM-MIB', 'alarmLogCause'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
smart_alarm_log_table_group_v1 = smartAlarmLogTableGroupV1.setStatus('current')
smart_alarm_basic_compl_v1 = module_compliance((1, 3, 6, 1, 4, 1, 30826, 1, 1, 5, 2, 1)).setObjects(('MSERIES-ALARM-MIB', 'smartAlarmGeneralGroupV1'), ('MSERIES-ALARM-MIB', 'smartAlarmNotificationGroupV1'), ('MSERIES-ALARM-MIB', 'smartAlarmActiveTableGroupV1'), ('MSERIES-ALARM-MIB', 'smartAlarmLogTableGroupV1'))
if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0):
smart_alarm_basic_compl_v1 = smartAlarmBasicComplV1.setStatus('current')
mibBuilder.exportSymbols('MSERIES-ALARM-MIB', alarmLogActivationTime=alarmLogActivationTime, smartAlarmCompliances=smartAlarmCompliances, smartAlarmGeneralNumberActiveList=smartAlarmGeneralNumberActiveList, alarmNotifyPrefix=alarmNotifyPrefix, alarmEntry=alarmEntry, alarmLogUnit=alarmLogUnit, alarmNotificationMajor=alarmNotificationMajor, smartAlarmActiveTableGroupV1=smartAlarmActiveTableGroupV1, alarmHostName=alarmHostName, alarmCause=alarmCause, alarmLogType=alarmLogType, smartAlarmGroups=smartAlarmGroups, alarmPort=alarmPort, alarmType=alarmType, alarmNotifications=alarmNotifications, smartAlarmGeneralHighestSeverity=smartAlarmGeneralHighestSeverity, alarmSeverity=alarmSeverity, alarmActivationTime=alarmActivationTime, alarmLogHostName=alarmLogHostName, alarmActiveList=alarmActiveList, alarmCeaseTime=alarmCeaseTime, alarmPortName=alarmPortName, alarmLogPort=alarmLogPort, alarmLogIndex=alarmLogIndex, smartAlarmBasicComplV1=smartAlarmBasicComplV1, alarmUnit=alarmUnit, alarmNotificationWarning=alarmNotificationWarning, alarmNotificationCritical=alarmNotificationCritical, alarmLogEntry=alarmLogEntry, alarmSeqNumber=alarmSeqNumber, PYSNMP_MODULE_ID=smartAlarm, alarmNotificationMinor=alarmNotificationMinor, alarmPortAlias=alarmPortAlias, alarmLogPortType=alarmLogPortType, alarmText=alarmText, smartAlarmGeneralNumberLogList=smartAlarmGeneralNumberLogList, alarmLogPortName=alarmLogPortName, alarmIndex=alarmIndex, alarmPortType=alarmPortType, alarmLogTable=alarmLogTable, smartAlarmGeneralGroupV1=smartAlarmGeneralGroupV1, smartAlarm=smartAlarm, alarmLogCeaseTime=alarmLogCeaseTime, alarmLogCause=alarmLogCause, alarmLogSeverity=alarmLogSeverity, alarmLogList=alarmLogList, smartAlarmGeneralLastSeqNumber=smartAlarmGeneralLastSeqNumber, alarmLogSeqNumber=alarmLogSeqNumber, alarmNotificationCleared=alarmNotificationCleared, smartAlarmNotificationGroupV1=smartAlarmNotificationGroupV1, smartAlarmLogTableGroupV1=smartAlarmLogTableGroupV1, alarmActiveTable=alarmActiveTable, alarmLogText=alarmLogText, alarmGeneral=alarmGeneral, smartAlarmMIBConformance=smartAlarmMIBConformance) |
## allow us to use key value pairs
## create a program that will convert digit to num
## inside dic need {}
monthConversions = {
"Jan": "January",
"Feb": "February",
"Mar": "March",
"Apr": "April",
"May" : "May",
"Jun" : "June",
"Jul": "July",
"Aug" : "August",
"Sep" : "September",
"Oct" : "October",
"Nov" : "November",
"Dec": "December",
}
## key value can be anything as long as they are unique
### access them from the dic
## refer the key and then its going to go in dict and print the value
print(monthConversions["Jun"])
## second method
print(monthConversions.get("Lum", "Not a valid key"))## get fct specify default value that we want to use
| month_conversions = {'Jan': 'January', 'Feb': 'February', 'Mar': 'March', 'Apr': 'April', 'May': 'May', 'Jun': 'June', 'Jul': 'July', 'Aug': 'August', 'Sep': 'September', 'Oct': 'October', 'Nov': 'November', 'Dec': 'December'}
print(monthConversions['Jun'])
print(monthConversions.get('Lum', 'Not a valid key')) |
# Databricks notebook source
# MAGIC %md-sandbox
# MAGIC
# MAGIC <div style="text-align: center; line-height: 0; padding-top: 9px;">
# MAGIC <img src="https://databricks.com/wp-content/uploads/2018/03/db-academy-rgb-1200px.png" alt="Databricks Learning" style="width: 600px">
# MAGIC </div>
# COMMAND ----------
# MAGIC %md
# MAGIC # Conditionals and Loops
# MAGIC
# MAGIC ##  In this lesson you:<br><br>
# MAGIC
# MAGIC - Define syntax for writing lists and accessing their elements
# MAGIC - Apply basic control flow statements to write programs that:
# MAGIC - Repeat an action
# MAGIC - Apply a function to any item on a list
# MAGIC - Use conditional statements to how a program will execute
# COMMAND ----------
# MAGIC %md
# MAGIC ### 1) List
# MAGIC
# MAGIC Let's make a [list](https://www.w3schools.com/python/python_lists.asp) of what everyone ate for breakfast this morning.
# MAGIC
# MAGIC <img src="https://upload.wikimedia.org/wikipedia/commons/thumb/2/20/Scrambed_eggs.jpg/1280px-Scrambed_eggs.jpg" width="20%" height="10%">
# COMMAND ----------
breakfast_list = ["pancakes", "eggs", "waffles"]
# COMMAND ----------
# MAGIC %md
# MAGIC Let's get the first breakfast element from this list.
# MAGIC
# MAGIC **Note:** Everything in Python is 0-indexed, so the first element is at position 0.
# COMMAND ----------
breakfast_list[0]
# COMMAND ----------
# MAGIC %md
# MAGIC Let's get the last breakfast item from this list.
# COMMAND ----------
breakfast_list[-1]
# COMMAND ----------
# MAGIC %md
# MAGIC What if I want the second breakfast item and onwards?
# COMMAND ----------
breakfast_list[1:]
# COMMAND ----------
# MAGIC %md
# MAGIC Let's add an element to our list.
# COMMAND ----------
breakfast_list += ["apple"]
# The += is a short cut for
# breakfast_list = breakfast_list + ["apple"]
# COMMAND ----------
# MAGIC %md
# MAGIC ### 2) For Loops
# MAGIC
# MAGIC What if we wanted to print every breakfast we had this morning?
# MAGIC
# MAGIC Loops are a way to repeat a block of code while iterating over a sequence (["for-loop"](https://www.w3schools.com/python/python_for_loops.asp)). Notice how in the code below the syntax is:
# MAGIC
# MAGIC ```
# MAGIC for element in list:
# MAGIC do something
# MAGIC ```
# MAGIC
# MAGIC Anything you want executed multiple times needs to be indented inside the for loop. `food` is a temporary variable we define below, but you can call it anything you like.
# COMMAND ----------
for food in breakfast_list:
print(food)
print("This is executed once because it is outside the for loop")
# COMMAND ----------
# MAGIC %md
# MAGIC You can also get it to print out the index of the element in the list too, by using `enumerate`.
# COMMAND ----------
for i, food in enumerate(breakfast_list):
print(i, food)
# COMMAND ----------
# MAGIC %md
# MAGIC ### 3) Conditionals
# MAGIC
# MAGIC Sometimes, depending on certain conditions, we don't always want to execute every line of code. We can control this through using the `if`, `elif`, and `else` [conditionals](https://www.w3schools.com/python/python_conditions.asp).
# MAGIC
# MAGIC You are not required to have elif/else statements following an if statement.
# COMMAND ----------
if food == "eggs":
print("Make scrambled eggs")
elif food == "waffles":
print("I want maple syrup on my waffles")
else:
print(food)
# COMMAND ----------
# MAGIC %md
# MAGIC You can also nest these if/elif/else statements, or combine them with `or` & `and`
# COMMAND ----------
if food != "eggs":
if (food == "waffles") or (food == "pancakes"):
print("I want maple syrup on my waffles")
else:
print("It must be an apple")
else:
print(food)
# COMMAND ----------
# MAGIC %md
# MAGIC We can put these if/elif/else statements inside of a for loop.
# COMMAND ----------
for food in breakfast_list:
if food != "eggs":
if (food == "waffles") or (food == "pancakes"):
print("I want maple syrup on my waffles")
else:
print("It must be an apple")
else:
print(food)
# COMMAND ----------
# MAGIC %md
# MAGIC ### 4) Ranges
# MAGIC
# MAGIC A _range_ represents an _immutable_ sequence of numbers, and is commonly used for looping a specific number of times in `for` loops.
# COMMAND ----------
# Note that a range includes the start value and excludes the stop value
print("A range from 1 up to but not including 5")
for i in range(1, 5):
print(i)
# A start value of 0 is used if you don't specify a value
print("\nA range from 0 up to but not including 5")
for i in range(5):
print(i)
# COMMAND ----------
# MAGIC %md
# MAGIC A difference between lists and ranges is that a range is a _generator_, which generates the values when they are accessed rather than storing all of the values in memory. If necessary, you can use the `list()` built-in function to create a list by materializing all of the elements of a range.
# COMMAND ----------
values_range = range(5)
print(f"The original range: {values_range}")
values_list = list(values_range)
print(f"The materialized range as a list: {values_list}")
# COMMAND ----------
# MAGIC %md-sandbox
# MAGIC © 2021 Databricks, Inc. All rights reserved.<br/>
# MAGIC Apache, Apache Spark, Spark and the Spark logo are trademarks of the <a href="https://www.apache.org/">Apache Software Foundation</a>.<br/>
# MAGIC <br/>
# MAGIC <a href="https://databricks.com/privacy-policy">Privacy Policy</a> | <a href="https://databricks.com/terms-of-use">Terms of Use</a> | <a href="https://help.databricks.com/">Support</a>
| breakfast_list = ['pancakes', 'eggs', 'waffles']
breakfast_list[0]
breakfast_list[-1]
breakfast_list[1:]
breakfast_list += ['apple']
for food in breakfast_list:
print(food)
print('This is executed once because it is outside the for loop')
for (i, food) in enumerate(breakfast_list):
print(i, food)
if food == 'eggs':
print('Make scrambled eggs')
elif food == 'waffles':
print('I want maple syrup on my waffles')
else:
print(food)
if food != 'eggs':
if food == 'waffles' or food == 'pancakes':
print('I want maple syrup on my waffles')
else:
print('It must be an apple')
else:
print(food)
for food in breakfast_list:
if food != 'eggs':
if food == 'waffles' or food == 'pancakes':
print('I want maple syrup on my waffles')
else:
print('It must be an apple')
else:
print(food)
print('A range from 1 up to but not including 5')
for i in range(1, 5):
print(i)
print('\nA range from 0 up to but not including 5')
for i in range(5):
print(i)
values_range = range(5)
print(f'The original range: {values_range}')
values_list = list(values_range)
print(f'The materialized range as a list: {values_list}') |
directions = {
"E": [0, 1],
"S": [-1, 0],
"W": [0, -1],
"N": [1, 0],
}
cardinal = {
0: "E",
1: "S",
2: "W",
3: "N",
}
def travel(input):
cur_x = 0
cur_y = 0
facing = 0
for instruction in input:
action = instruction[0]
value = int(instruction[1:])
if action == "F":
cur_x += directions[cardinal[facing]][0]*value
cur_y += directions[cardinal[facing]][1]*value
elif action == "R":
facing = (facing + (value / 90)) % 4
elif action == "L":
facing = (facing - (value / 90)) % 4
else:
cur_x += directions[action][0]*value
cur_y += directions[action][1]*value
return abs(cur_x) + abs(cur_y)
input = open('12/input.txt').read().splitlines()
print(travel(input)) | directions = {'E': [0, 1], 'S': [-1, 0], 'W': [0, -1], 'N': [1, 0]}
cardinal = {0: 'E', 1: 'S', 2: 'W', 3: 'N'}
def travel(input):
cur_x = 0
cur_y = 0
facing = 0
for instruction in input:
action = instruction[0]
value = int(instruction[1:])
if action == 'F':
cur_x += directions[cardinal[facing]][0] * value
cur_y += directions[cardinal[facing]][1] * value
elif action == 'R':
facing = (facing + value / 90) % 4
elif action == 'L':
facing = (facing - value / 90) % 4
else:
cur_x += directions[action][0] * value
cur_y += directions[action][1] * value
return abs(cur_x) + abs(cur_y)
input = open('12/input.txt').read().splitlines()
print(travel(input)) |
#1 Manual way
def keep_evens (nums):
new_list = []
for num in nums:
if num % 2 == 0:
new_list.append(num)
return new_list
print(keep_evens([3, 4, 6, 7, 0, 1]))
#2
def keep_evens(nums):
new_seq = filter(lambda num: num %2 ==0, nums) #Instead of transforming an input like in map function
#in filter function we are not transforming, we are just making a binary decision. So, the first parameter
#is true or false ? if it's true we get if it's false we filtered out
return list(new_seq)
print(keep_evens([3, 4, 6, 7, 0, 1]))
#3
lst = ['witch','halloween','pumpkin','cat','candy','wagon','moon']
lst2 = list(filter(lambda word: 'o' in word, lst))
print(lst2) | def keep_evens(nums):
new_list = []
for num in nums:
if num % 2 == 0:
new_list.append(num)
return new_list
print(keep_evens([3, 4, 6, 7, 0, 1]))
def keep_evens(nums):
new_seq = filter(lambda num: num % 2 == 0, nums)
return list(new_seq)
print(keep_evens([3, 4, 6, 7, 0, 1]))
lst = ['witch', 'halloween', 'pumpkin', 'cat', 'candy', 'wagon', 'moon']
lst2 = list(filter(lambda word: 'o' in word, lst))
print(lst2) |
class Commands:
def __init__(self, player_id):
self.player_id = player_id
def attack(self, direction):
data = {
'command': 'attack',
'character_id': str(self.player_id),
'direction': direction
}
return data
def collect(self):
data = {
'command': 'collect',
'character_id': str(self.player_id)
}
return data
def idle(self):
data = {
'command': 'idle',
'character_id': str(self.player_id)
}
return data
def move(self, direction):
data = {
'command': 'move',
'character_id': str(self.player_id),
'direction': direction
}
return data
def rest(self):
data = {
'command': 'rest',
'character_id': str(self.player_id)
}
return data
def store(self):
data = {
'command': 'store',
'character_id': str(self.player_id)
}
return data | class Commands:
def __init__(self, player_id):
self.player_id = player_id
def attack(self, direction):
data = {'command': 'attack', 'character_id': str(self.player_id), 'direction': direction}
return data
def collect(self):
data = {'command': 'collect', 'character_id': str(self.player_id)}
return data
def idle(self):
data = {'command': 'idle', 'character_id': str(self.player_id)}
return data
def move(self, direction):
data = {'command': 'move', 'character_id': str(self.player_id), 'direction': direction}
return data
def rest(self):
data = {'command': 'rest', 'character_id': str(self.player_id)}
return data
def store(self):
data = {'command': 'store', 'character_id': str(self.player_id)}
return data |
class Room:
def __init__(
self, id, name, description, n_to=None, s_to=None, e_to=None, w_to=None
):
self.id = id
self.name = name
self.description = description
self.n_to = n_to
self.s_to = s_to
self.e_to = e_to
self.w_to = w_to
# def __repr__(self):
# pass
# def __str__(self):
# pass
class World:
def __init__(self, rooms=None):
self.rooms = rooms
pass
def move(self, direction):
pass
entrance = Room(
0,
"The Entrance",
"You are presented with the front door to an old rickety house to the north which looks like it could fall down at any time. A low lit street beacons you to the east, and a deafening sound is comming from the west!",
)
w_rooms = [entrance]
w = World(w_rooms)
print(entrance)
| class Room:
def __init__(self, id, name, description, n_to=None, s_to=None, e_to=None, w_to=None):
self.id = id
self.name = name
self.description = description
self.n_to = n_to
self.s_to = s_to
self.e_to = e_to
self.w_to = w_to
class World:
def __init__(self, rooms=None):
self.rooms = rooms
pass
def move(self, direction):
pass
entrance = room(0, 'The Entrance', 'You are presented with the front door to an old rickety house to the north which looks like it could fall down at any time. A low lit street beacons you to the east, and a deafening sound is comming from the west!')
w_rooms = [entrance]
w = world(w_rooms)
print(entrance) |
class Solution(object):
def intersect(self, nums1, nums2):
if len(nums1) > len(nums2):
nums1, nums2 = nums2, nums1
c = collections.Counter(nums1)
res = []
for i in nums2:
if c[i] > 0:
res += i,
c[i] -= 1
return res
| class Solution(object):
def intersect(self, nums1, nums2):
if len(nums1) > len(nums2):
(nums1, nums2) = (nums2, nums1)
c = collections.Counter(nums1)
res = []
for i in nums2:
if c[i] > 0:
res += (i,)
c[i] -= 1
return res |
# Released under the MIT License. See LICENSE for details.
#
# This file was automatically generated from "monkey_face.ma"
# pylint: disable=all
points = {}
# noinspection PyDictCreation
boxes = {}
boxes['area_of_interest_bounds'] = (-1.657177611, 4.132574186,
-1.580485661) + (0.0, 0.0, 0.0) + (
17.36258946, 10.49020453, 12.31460338)
points['ffa_spawn1'] = (-8.026373566, 3.349937889, -2.542088202) + (
0.9450583628, 0.9450583628, 1.181509268)
points['ffa_spawn2'] = (4.73470012, 3.308679998,
-2.757871588) + (0.9335931003, 1.0, 1.217352295)
points['ffa_spawn3'] = (-1.907161509, 3.326830784,
-6.572223028) + (4.080767643, 1.0, 0.2880331593)
points['ffa_spawn4'] = (-1.672823345, 3.326830784,
2.405442985) + (3.870724402, 1.0, 0.2880331593)
points['flag1'] = (-8.968414135, 3.35709348, -2.804123917)
points['flag2'] = (5.945128279, 3.354825248, -2.663635497)
points['flag_default'] = (-1.688166134, 3.392387172, -2.238613943)
boxes['map_bounds'] = (-1.615296127, 6.825502312, -2.200965435) + (
0.0, 0.0, 0.0) + (22.51905077, 12.21074608, 15.9079565)
points['powerup_spawn1'] = (-6.859406739, 4.429165244, -6.588618549)
points['powerup_spawn2'] = (-5.422572086, 4.228850685, 2.803988636)
points['powerup_spawn3'] = (3.148493267, 4.429165244, -6.588618549)
points['powerup_spawn4'] = (1.830377363, 4.228850685, 2.803988636)
points['shadow_lower_bottom'] = (-1.877364768, 0.9878677276, 5.50201662)
points['shadow_lower_top'] = (-1.877364768, 2.881511768, 5.50201662)
points['shadow_upper_bottom'] = (-1.877364768, 6.169020542, 5.50201662)
points['shadow_upper_top'] = (-1.877364768, 10.2492777, 5.50201662)
points['spawn1'] = (-8.026373566, 3.349937889,
-2.542088202) + (0.9450583628, 0.9450583628, 1.181509268)
points['spawn2'] = (4.73470012, 3.308679998, -2.757871588) + (0.9335931003,
1.0, 1.217352295)
| points = {}
boxes = {}
boxes['area_of_interest_bounds'] = (-1.657177611, 4.132574186, -1.580485661) + (0.0, 0.0, 0.0) + (17.36258946, 10.49020453, 12.31460338)
points['ffa_spawn1'] = (-8.026373566, 3.349937889, -2.542088202) + (0.9450583628, 0.9450583628, 1.181509268)
points['ffa_spawn2'] = (4.73470012, 3.308679998, -2.757871588) + (0.9335931003, 1.0, 1.217352295)
points['ffa_spawn3'] = (-1.907161509, 3.326830784, -6.572223028) + (4.080767643, 1.0, 0.2880331593)
points['ffa_spawn4'] = (-1.672823345, 3.326830784, 2.405442985) + (3.870724402, 1.0, 0.2880331593)
points['flag1'] = (-8.968414135, 3.35709348, -2.804123917)
points['flag2'] = (5.945128279, 3.354825248, -2.663635497)
points['flag_default'] = (-1.688166134, 3.392387172, -2.238613943)
boxes['map_bounds'] = (-1.615296127, 6.825502312, -2.200965435) + (0.0, 0.0, 0.0) + (22.51905077, 12.21074608, 15.9079565)
points['powerup_spawn1'] = (-6.859406739, 4.429165244, -6.588618549)
points['powerup_spawn2'] = (-5.422572086, 4.228850685, 2.803988636)
points['powerup_spawn3'] = (3.148493267, 4.429165244, -6.588618549)
points['powerup_spawn4'] = (1.830377363, 4.228850685, 2.803988636)
points['shadow_lower_bottom'] = (-1.877364768, 0.9878677276, 5.50201662)
points['shadow_lower_top'] = (-1.877364768, 2.881511768, 5.50201662)
points['shadow_upper_bottom'] = (-1.877364768, 6.169020542, 5.50201662)
points['shadow_upper_top'] = (-1.877364768, 10.2492777, 5.50201662)
points['spawn1'] = (-8.026373566, 3.349937889, -2.542088202) + (0.9450583628, 0.9450583628, 1.181509268)
points['spawn2'] = (4.73470012, 3.308679998, -2.757871588) + (0.9335931003, 1.0, 1.217352295) |
# PySNMP SMI module. Autogenerated from smidump -f python SNMP-VIEW-BASED-ACM-MIB
# by libsmi2pysnmp-0.1.3 at Tue Apr 3 16:57:42 2012,
# Python version sys.version_info(major=2, minor=7, micro=2, releaselevel='final', serial=0)
# Imports
( Integer, ObjectIdentifier, OctetString, ) = mibBuilder.importSymbols("ASN1", "Integer", "ObjectIdentifier", "OctetString")
( NamedValues, ) = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
( ConstraintsIntersection, ConstraintsUnion, SingleValueConstraint, ValueRangeConstraint, ValueSizeConstraint, ) = mibBuilder.importSymbols("ASN1-REFINEMENT", "ConstraintsIntersection", "ConstraintsUnion", "SingleValueConstraint", "ValueRangeConstraint", "ValueSizeConstraint")
( SnmpAdminString, SnmpSecurityLevel, SnmpSecurityModel, ) = mibBuilder.importSymbols("SNMP-FRAMEWORK-MIB", "SnmpAdminString", "SnmpSecurityLevel", "SnmpSecurityModel")
( ModuleCompliance, ObjectGroup, ) = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "ObjectGroup")
( Bits, Integer32, ModuleIdentity, MibIdentifier, MibScalar, MibTable, MibTableRow, MibTableColumn, TimeTicks, snmpModules, ) = mibBuilder.importSymbols("SNMPv2-SMI", "Bits", "Integer32", "ModuleIdentity", "MibIdentifier", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "TimeTicks", "snmpModules")
( RowStatus, StorageType, TestAndIncr, ) = mibBuilder.importSymbols("SNMPv2-TC", "RowStatus", "StorageType", "TestAndIncr")
# Objects
snmpVacmMIB = ModuleIdentity((1, 3, 6, 1, 6, 3, 16)).setRevisions(("2002-10-16 00:00","1999-01-20 00:00","1997-11-20 00:00",))
if mibBuilder.loadTexts: snmpVacmMIB.setOrganization("SNMPv3 Working Group")
if mibBuilder.loadTexts: snmpVacmMIB.setContactInfo("WG-email: snmpv3@lists.tislabs.com\nSubscribe: majordomo@lists.tislabs.com\n In message body: subscribe snmpv3\n\nCo-Chair: Russ Mundy\n Network Associates Laboratories\npostal: 15204 Omega Drive, Suite 300\n Rockville, MD 20850-4601\n USA\nemail: mundy@tislabs.com\nphone: +1 301-947-7107\n\nCo-Chair: David Harrington\n Enterasys Networks\nPostal: 35 Industrial Way\n P. O. Box 5004\n Rochester, New Hampshire 03866-5005\n USA\nEMail: dbh@enterasys.com\nPhone: +1 603-337-2614\n\nCo-editor: Bert Wijnen\n Lucent Technologies\npostal: Schagen 33\n 3461 GL Linschoten\n Netherlands\nemail: bwijnen@lucent.com\nphone: +31-348-480-685\n\nCo-editor: Randy Presuhn\n BMC Software, Inc.\n\npostal: 2141 North First Street\n San Jose, CA 95131\n USA\nemail: randy_presuhn@bmc.com\nphone: +1 408-546-1006\n\nCo-editor: Keith McCloghrie\n Cisco Systems, Inc.\npostal: 170 West Tasman Drive\n San Jose, CA 95134-1706\n USA\nemail: kzm@cisco.com\nphone: +1-408-526-5260")
if mibBuilder.loadTexts: snmpVacmMIB.setDescription("The management information definitions for the\nView-based Access Control Model for SNMP.\n\nCopyright (C) The Internet Society (2002). This\nversion of this MIB module is part of RFC 3415;\nsee the RFC itself for full legal notices.")
vacmMIBObjects = MibIdentifier((1, 3, 6, 1, 6, 3, 16, 1))
vacmContextTable = MibTable((1, 3, 6, 1, 6, 3, 16, 1, 1))
if mibBuilder.loadTexts: vacmContextTable.setDescription("The table of locally available contexts.\n\nThis table provides information to SNMP Command\n\nGenerator applications so that they can properly\nconfigure the vacmAccessTable to control access to\nall contexts at the SNMP entity.\n\nThis table may change dynamically if the SNMP entity\nallows that contexts are added/deleted dynamically\n(for instance when its configuration changes). Such\nchanges would happen only if the management\ninstrumentation at that SNMP entity recognizes more\n(or fewer) contexts.\n\nThe presence of entries in this table and of entries\nin the vacmAccessTable are independent. That is, a\ncontext identified by an entry in this table is not\nnecessarily referenced by any entries in the\nvacmAccessTable; and the context(s) referenced by an\nentry in the vacmAccessTable does not necessarily\ncurrently exist and thus need not be identified by an\nentry in this table.\n\nThis table must be made accessible via the default\ncontext so that Command Responder applications have\na standard way of retrieving the information.\n\nThis table is read-only. It cannot be configured via\nSNMP.")
vacmContextEntry = MibTableRow((1, 3, 6, 1, 6, 3, 16, 1, 1, 1)).setIndexNames((0, "SNMP-VIEW-BASED-ACM-MIB", "vacmContextName"))
if mibBuilder.loadTexts: vacmContextEntry.setDescription("Information about a particular context.")
vacmContextName = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 1, 1, 1), SnmpAdminString().subtype(subtypeSpec=ValueSizeConstraint(0, 32))).setMaxAccess("readonly")
if mibBuilder.loadTexts: vacmContextName.setDescription("A human readable name identifying a particular\ncontext at a particular SNMP entity.\n\nThe empty contextName (zero length) represents the\ndefault context.")
vacmSecurityToGroupTable = MibTable((1, 3, 6, 1, 6, 3, 16, 1, 2))
if mibBuilder.loadTexts: vacmSecurityToGroupTable.setDescription("This table maps a combination of securityModel and\nsecurityName into a groupName which is used to define\nan access control policy for a group of principals.")
vacmSecurityToGroupEntry = MibTableRow((1, 3, 6, 1, 6, 3, 16, 1, 2, 1)).setIndexNames((0, "SNMP-VIEW-BASED-ACM-MIB", "vacmSecurityModel"), (0, "SNMP-VIEW-BASED-ACM-MIB", "vacmSecurityName"))
if mibBuilder.loadTexts: vacmSecurityToGroupEntry.setDescription("An entry in this table maps the combination of a\nsecurityModel and securityName into a groupName.")
vacmSecurityModel = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 2, 1, 1), SnmpSecurityModel().subtype(subtypeSpec=ValueRangeConstraint(1, 2147483647))).setMaxAccess("noaccess")
if mibBuilder.loadTexts: vacmSecurityModel.setDescription("The Security Model, by which the vacmSecurityName\nreferenced by this entry is provided.\n\nNote, this object may not take the 'any' (0) value.")
vacmSecurityName = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 2, 1, 2), SnmpAdminString().subtype(subtypeSpec=ValueSizeConstraint(1, 32))).setMaxAccess("noaccess")
if mibBuilder.loadTexts: vacmSecurityName.setDescription("The securityName for the principal, represented in a\nSecurity Model independent format, which is mapped by\nthis entry to a groupName.")
vacmGroupName = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 2, 1, 3), SnmpAdminString().subtype(subtypeSpec=ValueSizeConstraint(1, 32))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: vacmGroupName.setDescription("The name of the group to which this entry (e.g., the\ncombination of securityModel and securityName)\nbelongs.\n\nThis groupName is used as index into the\nvacmAccessTable to select an access control policy.\nHowever, a value in this table does not imply that an\ninstance with the value exists in table vacmAccesTable.")
vacmSecurityToGroupStorageType = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 2, 1, 4), StorageType().clone('nonVolatile')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: vacmSecurityToGroupStorageType.setDescription("The storage type for this conceptual row.\nConceptual rows having the value 'permanent' need not\nallow write-access to any columnar objects in the row.")
vacmSecurityToGroupStatus = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 2, 1, 5), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: vacmSecurityToGroupStatus.setDescription("The status of this conceptual row.\n\nUntil instances of all corresponding columns are\nappropriately configured, the value of the\n\ncorresponding instance of the vacmSecurityToGroupStatus\ncolumn is 'notReady'.\n\nIn particular, a newly created row cannot be made\nactive until a value has been set for vacmGroupName.\n\nThe RowStatus TC [RFC2579] requires that this\nDESCRIPTION clause states under which circumstances\nother objects in this row can be modified:\n\nThe value of this object has no effect on whether\nother objects in this conceptual row can be modified.")
vacmAccessTable = MibTable((1, 3, 6, 1, 6, 3, 16, 1, 4))
if mibBuilder.loadTexts: vacmAccessTable.setDescription("The table of access rights for groups.\n\nEach entry is indexed by a groupName, a contextPrefix,\na securityModel and a securityLevel. To determine\nwhether access is allowed, one entry from this table\nneeds to be selected and the proper viewName from that\nentry must be used for access control checking.\n\nTo select the proper entry, follow these steps:\n\n1) the set of possible matches is formed by the\n intersection of the following sets of entries:\n\n the set of entries with identical vacmGroupName\n the union of these two sets:\n - the set with identical vacmAccessContextPrefix\n - the set of entries with vacmAccessContextMatch\n value of 'prefix' and matching\n vacmAccessContextPrefix\n intersected with the union of these two sets:\n - the set of entries with identical\n vacmSecurityModel\n - the set of entries with vacmSecurityModel\n value of 'any'\n intersected with the set of entries with\n vacmAccessSecurityLevel value less than or equal\n to the requested securityLevel\n\n2) if this set has only one member, we're done\n otherwise, it comes down to deciding how to weight\n the preferences between ContextPrefixes,\n SecurityModels, and SecurityLevels as follows:\n a) if the subset of entries with securityModel\n matching the securityModel in the message is\n not empty, then discard the rest.\n b) if the subset of entries with\n vacmAccessContextPrefix matching the contextName\n in the message is not empty,\n then discard the rest\n c) discard all entries with ContextPrefixes shorter\n than the longest one remaining in the set\n d) select the entry with the highest securityLevel\n\nPlease note that for securityLevel noAuthNoPriv, all\ngroups are really equivalent since the assumption that\nthe securityName has been authenticated does not hold.")
vacmAccessEntry = MibTableRow((1, 3, 6, 1, 6, 3, 16, 1, 4, 1)).setIndexNames((0, "SNMP-VIEW-BASED-ACM-MIB", "vacmGroupName"), (0, "SNMP-VIEW-BASED-ACM-MIB", "vacmAccessContextPrefix"), (0, "SNMP-VIEW-BASED-ACM-MIB", "vacmAccessSecurityModel"), (0, "SNMP-VIEW-BASED-ACM-MIB", "vacmAccessSecurityLevel"))
if mibBuilder.loadTexts: vacmAccessEntry.setDescription("An access right configured in the Local Configuration\nDatastore (LCD) authorizing access to an SNMP context.\n\nEntries in this table can use an instance value for\nobject vacmGroupName even if no entry in table\nvacmAccessSecurityToGroupTable has a corresponding\nvalue for object vacmGroupName.")
vacmAccessContextPrefix = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 1), SnmpAdminString().subtype(subtypeSpec=ValueSizeConstraint(0, 32))).setMaxAccess("noaccess")
if mibBuilder.loadTexts: vacmAccessContextPrefix.setDescription("In order to gain the access rights allowed by this\nconceptual row, a contextName must match exactly\n(if the value of vacmAccessContextMatch is 'exact')\nor partially (if the value of vacmAccessContextMatch\nis 'prefix') to the value of the instance of this\nobject.")
vacmAccessSecurityModel = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 2), SnmpSecurityModel()).setMaxAccess("noaccess")
if mibBuilder.loadTexts: vacmAccessSecurityModel.setDescription("In order to gain the access rights allowed by this\nconceptual row, this securityModel must be in use.")
vacmAccessSecurityLevel = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 3), SnmpSecurityLevel()).setMaxAccess("noaccess")
if mibBuilder.loadTexts: vacmAccessSecurityLevel.setDescription("The minimum level of security required in order to\ngain the access rights allowed by this conceptual\nrow. A securityLevel of noAuthNoPriv is less than\nauthNoPriv which in turn is less than authPriv.\n\nIf multiple entries are equally indexed except for\nthis vacmAccessSecurityLevel index, then the entry\nwhich has the highest value for\nvacmAccessSecurityLevel is selected.")
vacmAccessContextMatch = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 4), Integer().subtype(subtypeSpec=SingleValueConstraint(2,1,)).subtype(namedValues=NamedValues(("exact", 1), ("prefix", 2), )).clone(1)).setMaxAccess("readcreate")
if mibBuilder.loadTexts: vacmAccessContextMatch.setDescription("If the value of this object is exact(1), then all\nrows where the contextName exactly matches\nvacmAccessContextPrefix are selected.\n\nIf the value of this object is prefix(2), then all\nrows where the contextName whose starting octets\nexactly match vacmAccessContextPrefix are selected.\nThis allows for a simple form of wildcarding.")
vacmAccessReadViewName = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 5), SnmpAdminString().subtype(subtypeSpec=ValueSizeConstraint(0, 32)).clone('')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: vacmAccessReadViewName.setDescription("The value of an instance of this object identifies\nthe MIB view of the SNMP context to which this\nconceptual row authorizes read access.\n\nThe identified MIB view is that one for which the\nvacmViewTreeFamilyViewName has the same value as the\ninstance of this object; if the value is the empty\nstring or if there is no active MIB view having this\nvalue of vacmViewTreeFamilyViewName, then no access\nis granted.")
vacmAccessWriteViewName = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 6), SnmpAdminString().subtype(subtypeSpec=ValueSizeConstraint(0, 32)).clone('')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: vacmAccessWriteViewName.setDescription("The value of an instance of this object identifies\nthe MIB view of the SNMP context to which this\nconceptual row authorizes write access.\n\nThe identified MIB view is that one for which the\nvacmViewTreeFamilyViewName has the same value as the\ninstance of this object; if the value is the empty\nstring or if there is no active MIB view having this\nvalue of vacmViewTreeFamilyViewName, then no access\nis granted.")
vacmAccessNotifyViewName = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 7), SnmpAdminString().subtype(subtypeSpec=ValueSizeConstraint(0, 32)).clone('')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: vacmAccessNotifyViewName.setDescription("The value of an instance of this object identifies\nthe MIB view of the SNMP context to which this\nconceptual row authorizes access for notifications.\n\nThe identified MIB view is that one for which the\nvacmViewTreeFamilyViewName has the same value as the\ninstance of this object; if the value is the empty\nstring or if there is no active MIB view having this\nvalue of vacmViewTreeFamilyViewName, then no access\nis granted.")
vacmAccessStorageType = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 8), StorageType().clone('nonVolatile')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: vacmAccessStorageType.setDescription("The storage type for this conceptual row.\n\nConceptual rows having the value 'permanent' need not\nallow write-access to any columnar objects in the row.")
vacmAccessStatus = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 9), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: vacmAccessStatus.setDescription("The status of this conceptual row.\n\nThe RowStatus TC [RFC2579] requires that this\nDESCRIPTION clause states under which circumstances\nother objects in this row can be modified:\n\nThe value of this object has no effect on whether\nother objects in this conceptual row can be modified.")
vacmMIBViews = MibIdentifier((1, 3, 6, 1, 6, 3, 16, 1, 5))
vacmViewSpinLock = MibScalar((1, 3, 6, 1, 6, 3, 16, 1, 5, 1), TestAndIncr()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: vacmViewSpinLock.setDescription("An advisory lock used to allow cooperating SNMP\nCommand Generator applications to coordinate their\nuse of the Set operation in creating or modifying\nviews.\n\nWhen creating a new view or altering an existing\nview, it is important to understand the potential\ninteractions with other uses of the view. The\nvacmViewSpinLock should be retrieved. The name of\nthe view to be created should be determined to be\nunique by the SNMP Command Generator application by\nconsulting the vacmViewTreeFamilyTable. Finally,\nthe named view may be created (Set), including the\nadvisory lock.\nIf another SNMP Command Generator application has\naltered the views in the meantime, then the spin\nlock's value will have changed, and so this creation\nwill fail because it will specify the wrong value for\nthe spin lock.\n\nSince this is an advisory lock, the use of this lock\nis not enforced.")
vacmViewTreeFamilyTable = MibTable((1, 3, 6, 1, 6, 3, 16, 1, 5, 2))
if mibBuilder.loadTexts: vacmViewTreeFamilyTable.setDescription("Locally held information about families of subtrees\nwithin MIB views.\n\nEach MIB view is defined by two sets of view subtrees:\n - the included view subtrees, and\n - the excluded view subtrees.\nEvery such view subtree, both the included and the\n\nexcluded ones, is defined in this table.\n\nTo determine if a particular object instance is in\na particular MIB view, compare the object instance's\nOBJECT IDENTIFIER with each of the MIB view's active\nentries in this table. If none match, then the\nobject instance is not in the MIB view. If one or\nmore match, then the object instance is included in,\nor excluded from, the MIB view according to the\nvalue of vacmViewTreeFamilyType in the entry whose\nvalue of vacmViewTreeFamilySubtree has the most\nsub-identifiers. If multiple entries match and have\nthe same number of sub-identifiers (when wildcarding\nis specified with the value of vacmViewTreeFamilyMask),\nthen the lexicographically greatest instance of\nvacmViewTreeFamilyType determines the inclusion or\nexclusion.\n\nAn object instance's OBJECT IDENTIFIER X matches an\nactive entry in this table when the number of\nsub-identifiers in X is at least as many as in the\nvalue of vacmViewTreeFamilySubtree for the entry,\nand each sub-identifier in the value of\nvacmViewTreeFamilySubtree matches its corresponding\nsub-identifier in X. Two sub-identifiers match\neither if the corresponding bit of the value of\nvacmViewTreeFamilyMask for the entry is zero (the\n'wild card' value), or if they are equal.\n\nA 'family' of subtrees is the set of subtrees defined\nby a particular combination of values of\nvacmViewTreeFamilySubtree and vacmViewTreeFamilyMask.\n\nIn the case where no 'wild card' is defined in the\nvacmViewTreeFamilyMask, the family of subtrees reduces\nto a single subtree.\n\nWhen creating or changing MIB views, an SNMP Command\nGenerator application should utilize the\nvacmViewSpinLock to try to avoid collisions. See\nDESCRIPTION clause of vacmViewSpinLock.\n\nWhen creating MIB views, it is strongly advised that\nfirst the 'excluded' vacmViewTreeFamilyEntries are\ncreated and then the 'included' entries.\n\nWhen deleting MIB views, it is strongly advised that\nfirst the 'included' vacmViewTreeFamilyEntries are\n\ndeleted and then the 'excluded' entries.\n\nIf a create for an entry for instance-level access\ncontrol is received and the implementation does not\nsupport instance-level granularity, then an\ninconsistentName error must be returned.")
vacmViewTreeFamilyEntry = MibTableRow((1, 3, 6, 1, 6, 3, 16, 1, 5, 2, 1)).setIndexNames((0, "SNMP-VIEW-BASED-ACM-MIB", "vacmViewTreeFamilyViewName"), (0, "SNMP-VIEW-BASED-ACM-MIB", "vacmViewTreeFamilySubtree"))
if mibBuilder.loadTexts: vacmViewTreeFamilyEntry.setDescription("Information on a particular family of view subtrees\nincluded in or excluded from a particular SNMP\ncontext's MIB view.\n\nImplementations must not restrict the number of\nfamilies of view subtrees for a given MIB view,\nexcept as dictated by resource constraints on the\noverall number of entries in the\nvacmViewTreeFamilyTable.\n\nIf no conceptual rows exist in this table for a given\nMIB view (viewName), that view may be thought of as\nconsisting of the empty set of view subtrees.")
vacmViewTreeFamilyViewName = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 5, 2, 1, 1), SnmpAdminString().subtype(subtypeSpec=ValueSizeConstraint(1, 32))).setMaxAccess("noaccess")
if mibBuilder.loadTexts: vacmViewTreeFamilyViewName.setDescription("The human readable name for a family of view subtrees.")
vacmViewTreeFamilySubtree = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 5, 2, 1, 2), ObjectIdentifier()).setMaxAccess("noaccess")
if mibBuilder.loadTexts: vacmViewTreeFamilySubtree.setDescription("The MIB subtree which when combined with the\ncorresponding instance of vacmViewTreeFamilyMask\ndefines a family of view subtrees.")
vacmViewTreeFamilyMask = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 5, 2, 1, 3), OctetString().subtype(subtypeSpec=ValueSizeConstraint(0, 16)).clone('')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: vacmViewTreeFamilyMask.setDescription("The bit mask which, in combination with the\ncorresponding instance of vacmViewTreeFamilySubtree,\ndefines a family of view subtrees.\n\nEach bit of this bit mask corresponds to a\nsub-identifier of vacmViewTreeFamilySubtree, with the\nmost significant bit of the i-th octet of this octet\nstring value (extended if necessary, see below)\ncorresponding to the (8*i - 7)-th sub-identifier, and\nthe least significant bit of the i-th octet of this\noctet string corresponding to the (8*i)-th\nsub-identifier, where i is in the range 1 through 16.\n\nEach bit of this bit mask specifies whether or not\nthe corresponding sub-identifiers must match when\ndetermining if an OBJECT IDENTIFIER is in this\nfamily of view subtrees; a '1' indicates that an\nexact match must occur; a '0' indicates 'wild card',\ni.e., any sub-identifier value matches.\n\nThus, the OBJECT IDENTIFIER X of an object instance\nis contained in a family of view subtrees if, for\neach sub-identifier of the value of\nvacmViewTreeFamilySubtree, either:\n\n the i-th bit of vacmViewTreeFamilyMask is 0, or\n\n the i-th sub-identifier of X is equal to the i-th\n sub-identifier of the value of\n vacmViewTreeFamilySubtree.\n\nIf the value of this bit mask is M bits long and\n\nthere are more than M sub-identifiers in the\ncorresponding instance of vacmViewTreeFamilySubtree,\nthen the bit mask is extended with 1's to be the\nrequired length.\n\nNote that when the value of this object is the\nzero-length string, this extension rule results in\na mask of all-1's being used (i.e., no 'wild card'),\nand the family of view subtrees is the one view\nsubtree uniquely identified by the corresponding\ninstance of vacmViewTreeFamilySubtree.\n\nNote that masks of length greater than zero length\ndo not need to be supported. In this case this\nobject is made read-only.")
vacmViewTreeFamilyType = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 5, 2, 1, 4), Integer().subtype(subtypeSpec=SingleValueConstraint(1,2,)).subtype(namedValues=NamedValues(("included", 1), ("excluded", 2), )).clone(1)).setMaxAccess("readcreate")
if mibBuilder.loadTexts: vacmViewTreeFamilyType.setDescription("Indicates whether the corresponding instances of\nvacmViewTreeFamilySubtree and vacmViewTreeFamilyMask\ndefine a family of view subtrees which is included in\nor excluded from the MIB view.")
vacmViewTreeFamilyStorageType = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 5, 2, 1, 5), StorageType().clone('nonVolatile')).setMaxAccess("readcreate")
if mibBuilder.loadTexts: vacmViewTreeFamilyStorageType.setDescription("The storage type for this conceptual row.\n\nConceptual rows having the value 'permanent' need not\nallow write-access to any columnar objects in the row.")
vacmViewTreeFamilyStatus = MibTableColumn((1, 3, 6, 1, 6, 3, 16, 1, 5, 2, 1, 6), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: vacmViewTreeFamilyStatus.setDescription("The status of this conceptual row.\n\nThe RowStatus TC [RFC2579] requires that this\nDESCRIPTION clause states under which circumstances\nother objects in this row can be modified:\n\nThe value of this object has no effect on whether\nother objects in this conceptual row can be modified.")
vacmMIBConformance = MibIdentifier((1, 3, 6, 1, 6, 3, 16, 2))
vacmMIBCompliances = MibIdentifier((1, 3, 6, 1, 6, 3, 16, 2, 1))
vacmMIBGroups = MibIdentifier((1, 3, 6, 1, 6, 3, 16, 2, 2))
# Augmentions
# Groups
vacmBasicGroup = ObjectGroup((1, 3, 6, 1, 6, 3, 16, 2, 2, 1)).setObjects(*(("SNMP-VIEW-BASED-ACM-MIB", "vacmViewTreeFamilyStorageType"), ("SNMP-VIEW-BASED-ACM-MIB", "vacmAccessContextMatch"), ("SNMP-VIEW-BASED-ACM-MIB", "vacmAccessReadViewName"), ("SNMP-VIEW-BASED-ACM-MIB", "vacmViewTreeFamilyType"), ("SNMP-VIEW-BASED-ACM-MIB", "vacmGroupName"), ("SNMP-VIEW-BASED-ACM-MIB", "vacmSecurityToGroupStatus"), ("SNMP-VIEW-BASED-ACM-MIB", "vacmContextName"), ("SNMP-VIEW-BASED-ACM-MIB", "vacmAccessWriteViewName"), ("SNMP-VIEW-BASED-ACM-MIB", "vacmAccessNotifyViewName"), ("SNMP-VIEW-BASED-ACM-MIB", "vacmAccessStorageType"), ("SNMP-VIEW-BASED-ACM-MIB", "vacmViewTreeFamilyStatus"), ("SNMP-VIEW-BASED-ACM-MIB", "vacmAccessStatus"), ("SNMP-VIEW-BASED-ACM-MIB", "vacmSecurityToGroupStorageType"), ("SNMP-VIEW-BASED-ACM-MIB", "vacmViewTreeFamilyMask"), ("SNMP-VIEW-BASED-ACM-MIB", "vacmViewSpinLock"), ) )
if mibBuilder.loadTexts: vacmBasicGroup.setDescription("A collection of objects providing for remote\nconfiguration of an SNMP engine which implements\n\nthe SNMP View-based Access Control Model.")
# Compliances
vacmMIBCompliance = ModuleCompliance((1, 3, 6, 1, 6, 3, 16, 2, 1, 1)).setObjects(*(("SNMP-VIEW-BASED-ACM-MIB", "vacmBasicGroup"), ) )
if mibBuilder.loadTexts: vacmMIBCompliance.setDescription("The compliance statement for SNMP engines which\nimplement the SNMP View-based Access Control Model\nconfiguration MIB.")
# Exports
# Module identity
mibBuilder.exportSymbols("SNMP-VIEW-BASED-ACM-MIB", PYSNMP_MODULE_ID=snmpVacmMIB)
# Objects
mibBuilder.exportSymbols("SNMP-VIEW-BASED-ACM-MIB", snmpVacmMIB=snmpVacmMIB, vacmMIBObjects=vacmMIBObjects, vacmContextTable=vacmContextTable, vacmContextEntry=vacmContextEntry, vacmContextName=vacmContextName, vacmSecurityToGroupTable=vacmSecurityToGroupTable, vacmSecurityToGroupEntry=vacmSecurityToGroupEntry, vacmSecurityModel=vacmSecurityModel, vacmSecurityName=vacmSecurityName, vacmGroupName=vacmGroupName, vacmSecurityToGroupStorageType=vacmSecurityToGroupStorageType, vacmSecurityToGroupStatus=vacmSecurityToGroupStatus, vacmAccessTable=vacmAccessTable, vacmAccessEntry=vacmAccessEntry, vacmAccessContextPrefix=vacmAccessContextPrefix, vacmAccessSecurityModel=vacmAccessSecurityModel, vacmAccessSecurityLevel=vacmAccessSecurityLevel, vacmAccessContextMatch=vacmAccessContextMatch, vacmAccessReadViewName=vacmAccessReadViewName, vacmAccessWriteViewName=vacmAccessWriteViewName, vacmAccessNotifyViewName=vacmAccessNotifyViewName, vacmAccessStorageType=vacmAccessStorageType, vacmAccessStatus=vacmAccessStatus, vacmMIBViews=vacmMIBViews, vacmViewSpinLock=vacmViewSpinLock, vacmViewTreeFamilyTable=vacmViewTreeFamilyTable, vacmViewTreeFamilyEntry=vacmViewTreeFamilyEntry, vacmViewTreeFamilyViewName=vacmViewTreeFamilyViewName, vacmViewTreeFamilySubtree=vacmViewTreeFamilySubtree, vacmViewTreeFamilyMask=vacmViewTreeFamilyMask, vacmViewTreeFamilyType=vacmViewTreeFamilyType, vacmViewTreeFamilyStorageType=vacmViewTreeFamilyStorageType, vacmViewTreeFamilyStatus=vacmViewTreeFamilyStatus, vacmMIBConformance=vacmMIBConformance, vacmMIBCompliances=vacmMIBCompliances, vacmMIBGroups=vacmMIBGroups)
# Groups
mibBuilder.exportSymbols("SNMP-VIEW-BASED-ACM-MIB", vacmBasicGroup=vacmBasicGroup)
# Compliances
mibBuilder.exportSymbols("SNMP-VIEW-BASED-ACM-MIB", vacmMIBCompliance=vacmMIBCompliance)
| (integer, object_identifier, octet_string) = mibBuilder.importSymbols('ASN1', 'Integer', 'ObjectIdentifier', 'OctetString')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(constraints_intersection, constraints_union, single_value_constraint, value_range_constraint, value_size_constraint) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ConstraintsIntersection', 'ConstraintsUnion', 'SingleValueConstraint', 'ValueRangeConstraint', 'ValueSizeConstraint')
(snmp_admin_string, snmp_security_level, snmp_security_model) = mibBuilder.importSymbols('SNMP-FRAMEWORK-MIB', 'SnmpAdminString', 'SnmpSecurityLevel', 'SnmpSecurityModel')
(module_compliance, object_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'ObjectGroup')
(bits, integer32, module_identity, mib_identifier, mib_scalar, mib_table, mib_table_row, mib_table_column, time_ticks, snmp_modules) = mibBuilder.importSymbols('SNMPv2-SMI', 'Bits', 'Integer32', 'ModuleIdentity', 'MibIdentifier', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'TimeTicks', 'snmpModules')
(row_status, storage_type, test_and_incr) = mibBuilder.importSymbols('SNMPv2-TC', 'RowStatus', 'StorageType', 'TestAndIncr')
snmp_vacm_mib = module_identity((1, 3, 6, 1, 6, 3, 16)).setRevisions(('2002-10-16 00:00', '1999-01-20 00:00', '1997-11-20 00:00'))
if mibBuilder.loadTexts:
snmpVacmMIB.setOrganization('SNMPv3 Working Group')
if mibBuilder.loadTexts:
snmpVacmMIB.setContactInfo('WG-email: snmpv3@lists.tislabs.com\nSubscribe: majordomo@lists.tislabs.com\n In message body: subscribe snmpv3\n\nCo-Chair: Russ Mundy\n Network Associates Laboratories\npostal: 15204 Omega Drive, Suite 300\n Rockville, MD 20850-4601\n USA\nemail: mundy@tislabs.com\nphone: +1 301-947-7107\n\nCo-Chair: David Harrington\n Enterasys Networks\nPostal: 35 Industrial Way\n P. O. Box 5004\n Rochester, New Hampshire 03866-5005\n USA\nEMail: dbh@enterasys.com\nPhone: +1 603-337-2614\n\nCo-editor: Bert Wijnen\n Lucent Technologies\npostal: Schagen 33\n 3461 GL Linschoten\n Netherlands\nemail: bwijnen@lucent.com\nphone: +31-348-480-685\n\nCo-editor: Randy Presuhn\n BMC Software, Inc.\n\npostal: 2141 North First Street\n San Jose, CA 95131\n USA\nemail: randy_presuhn@bmc.com\nphone: +1 408-546-1006\n\nCo-editor: Keith McCloghrie\n Cisco Systems, Inc.\npostal: 170 West Tasman Drive\n San Jose, CA 95134-1706\n USA\nemail: kzm@cisco.com\nphone: +1-408-526-5260')
if mibBuilder.loadTexts:
snmpVacmMIB.setDescription('The management information definitions for the\nView-based Access Control Model for SNMP.\n\nCopyright (C) The Internet Society (2002). This\nversion of this MIB module is part of RFC 3415;\nsee the RFC itself for full legal notices.')
vacm_mib_objects = mib_identifier((1, 3, 6, 1, 6, 3, 16, 1))
vacm_context_table = mib_table((1, 3, 6, 1, 6, 3, 16, 1, 1))
if mibBuilder.loadTexts:
vacmContextTable.setDescription('The table of locally available contexts.\n\nThis table provides information to SNMP Command\n\nGenerator applications so that they can properly\nconfigure the vacmAccessTable to control access to\nall contexts at the SNMP entity.\n\nThis table may change dynamically if the SNMP entity\nallows that contexts are added/deleted dynamically\n(for instance when its configuration changes). Such\nchanges would happen only if the management\ninstrumentation at that SNMP entity recognizes more\n(or fewer) contexts.\n\nThe presence of entries in this table and of entries\nin the vacmAccessTable are independent. That is, a\ncontext identified by an entry in this table is not\nnecessarily referenced by any entries in the\nvacmAccessTable; and the context(s) referenced by an\nentry in the vacmAccessTable does not necessarily\ncurrently exist and thus need not be identified by an\nentry in this table.\n\nThis table must be made accessible via the default\ncontext so that Command Responder applications have\na standard way of retrieving the information.\n\nThis table is read-only. It cannot be configured via\nSNMP.')
vacm_context_entry = mib_table_row((1, 3, 6, 1, 6, 3, 16, 1, 1, 1)).setIndexNames((0, 'SNMP-VIEW-BASED-ACM-MIB', 'vacmContextName'))
if mibBuilder.loadTexts:
vacmContextEntry.setDescription('Information about a particular context.')
vacm_context_name = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 1, 1, 1), snmp_admin_string().subtype(subtypeSpec=value_size_constraint(0, 32))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
vacmContextName.setDescription('A human readable name identifying a particular\ncontext at a particular SNMP entity.\n\nThe empty contextName (zero length) represents the\ndefault context.')
vacm_security_to_group_table = mib_table((1, 3, 6, 1, 6, 3, 16, 1, 2))
if mibBuilder.loadTexts:
vacmSecurityToGroupTable.setDescription('This table maps a combination of securityModel and\nsecurityName into a groupName which is used to define\nan access control policy for a group of principals.')
vacm_security_to_group_entry = mib_table_row((1, 3, 6, 1, 6, 3, 16, 1, 2, 1)).setIndexNames((0, 'SNMP-VIEW-BASED-ACM-MIB', 'vacmSecurityModel'), (0, 'SNMP-VIEW-BASED-ACM-MIB', 'vacmSecurityName'))
if mibBuilder.loadTexts:
vacmSecurityToGroupEntry.setDescription('An entry in this table maps the combination of a\nsecurityModel and securityName into a groupName.')
vacm_security_model = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 2, 1, 1), snmp_security_model().subtype(subtypeSpec=value_range_constraint(1, 2147483647))).setMaxAccess('noaccess')
if mibBuilder.loadTexts:
vacmSecurityModel.setDescription("The Security Model, by which the vacmSecurityName\nreferenced by this entry is provided.\n\nNote, this object may not take the 'any' (0) value.")
vacm_security_name = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 2, 1, 2), snmp_admin_string().subtype(subtypeSpec=value_size_constraint(1, 32))).setMaxAccess('noaccess')
if mibBuilder.loadTexts:
vacmSecurityName.setDescription('The securityName for the principal, represented in a\nSecurity Model independent format, which is mapped by\nthis entry to a groupName.')
vacm_group_name = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 2, 1, 3), snmp_admin_string().subtype(subtypeSpec=value_size_constraint(1, 32))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
vacmGroupName.setDescription('The name of the group to which this entry (e.g., the\ncombination of securityModel and securityName)\nbelongs.\n\nThis groupName is used as index into the\nvacmAccessTable to select an access control policy.\nHowever, a value in this table does not imply that an\ninstance with the value exists in table vacmAccesTable.')
vacm_security_to_group_storage_type = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 2, 1, 4), storage_type().clone('nonVolatile')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
vacmSecurityToGroupStorageType.setDescription("The storage type for this conceptual row.\nConceptual rows having the value 'permanent' need not\nallow write-access to any columnar objects in the row.")
vacm_security_to_group_status = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 2, 1, 5), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
vacmSecurityToGroupStatus.setDescription("The status of this conceptual row.\n\nUntil instances of all corresponding columns are\nappropriately configured, the value of the\n\ncorresponding instance of the vacmSecurityToGroupStatus\ncolumn is 'notReady'.\n\nIn particular, a newly created row cannot be made\nactive until a value has been set for vacmGroupName.\n\nThe RowStatus TC [RFC2579] requires that this\nDESCRIPTION clause states under which circumstances\nother objects in this row can be modified:\n\nThe value of this object has no effect on whether\nother objects in this conceptual row can be modified.")
vacm_access_table = mib_table((1, 3, 6, 1, 6, 3, 16, 1, 4))
if mibBuilder.loadTexts:
vacmAccessTable.setDescription("The table of access rights for groups.\n\nEach entry is indexed by a groupName, a contextPrefix,\na securityModel and a securityLevel. To determine\nwhether access is allowed, one entry from this table\nneeds to be selected and the proper viewName from that\nentry must be used for access control checking.\n\nTo select the proper entry, follow these steps:\n\n1) the set of possible matches is formed by the\n intersection of the following sets of entries:\n\n the set of entries with identical vacmGroupName\n the union of these two sets:\n - the set with identical vacmAccessContextPrefix\n - the set of entries with vacmAccessContextMatch\n value of 'prefix' and matching\n vacmAccessContextPrefix\n intersected with the union of these two sets:\n - the set of entries with identical\n vacmSecurityModel\n - the set of entries with vacmSecurityModel\n value of 'any'\n intersected with the set of entries with\n vacmAccessSecurityLevel value less than or equal\n to the requested securityLevel\n\n2) if this set has only one member, we're done\n otherwise, it comes down to deciding how to weight\n the preferences between ContextPrefixes,\n SecurityModels, and SecurityLevels as follows:\n a) if the subset of entries with securityModel\n matching the securityModel in the message is\n not empty, then discard the rest.\n b) if the subset of entries with\n vacmAccessContextPrefix matching the contextName\n in the message is not empty,\n then discard the rest\n c) discard all entries with ContextPrefixes shorter\n than the longest one remaining in the set\n d) select the entry with the highest securityLevel\n\nPlease note that for securityLevel noAuthNoPriv, all\ngroups are really equivalent since the assumption that\nthe securityName has been authenticated does not hold.")
vacm_access_entry = mib_table_row((1, 3, 6, 1, 6, 3, 16, 1, 4, 1)).setIndexNames((0, 'SNMP-VIEW-BASED-ACM-MIB', 'vacmGroupName'), (0, 'SNMP-VIEW-BASED-ACM-MIB', 'vacmAccessContextPrefix'), (0, 'SNMP-VIEW-BASED-ACM-MIB', 'vacmAccessSecurityModel'), (0, 'SNMP-VIEW-BASED-ACM-MIB', 'vacmAccessSecurityLevel'))
if mibBuilder.loadTexts:
vacmAccessEntry.setDescription('An access right configured in the Local Configuration\nDatastore (LCD) authorizing access to an SNMP context.\n\nEntries in this table can use an instance value for\nobject vacmGroupName even if no entry in table\nvacmAccessSecurityToGroupTable has a corresponding\nvalue for object vacmGroupName.')
vacm_access_context_prefix = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 1), snmp_admin_string().subtype(subtypeSpec=value_size_constraint(0, 32))).setMaxAccess('noaccess')
if mibBuilder.loadTexts:
vacmAccessContextPrefix.setDescription("In order to gain the access rights allowed by this\nconceptual row, a contextName must match exactly\n(if the value of vacmAccessContextMatch is 'exact')\nor partially (if the value of vacmAccessContextMatch\nis 'prefix') to the value of the instance of this\nobject.")
vacm_access_security_model = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 2), snmp_security_model()).setMaxAccess('noaccess')
if mibBuilder.loadTexts:
vacmAccessSecurityModel.setDescription('In order to gain the access rights allowed by this\nconceptual row, this securityModel must be in use.')
vacm_access_security_level = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 3), snmp_security_level()).setMaxAccess('noaccess')
if mibBuilder.loadTexts:
vacmAccessSecurityLevel.setDescription('The minimum level of security required in order to\ngain the access rights allowed by this conceptual\nrow. A securityLevel of noAuthNoPriv is less than\nauthNoPriv which in turn is less than authPriv.\n\nIf multiple entries are equally indexed except for\nthis vacmAccessSecurityLevel index, then the entry\nwhich has the highest value for\nvacmAccessSecurityLevel is selected.')
vacm_access_context_match = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 4), integer().subtype(subtypeSpec=single_value_constraint(2, 1)).subtype(namedValues=named_values(('exact', 1), ('prefix', 2))).clone(1)).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
vacmAccessContextMatch.setDescription('If the value of this object is exact(1), then all\nrows where the contextName exactly matches\nvacmAccessContextPrefix are selected.\n\nIf the value of this object is prefix(2), then all\nrows where the contextName whose starting octets\nexactly match vacmAccessContextPrefix are selected.\nThis allows for a simple form of wildcarding.')
vacm_access_read_view_name = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 5), snmp_admin_string().subtype(subtypeSpec=value_size_constraint(0, 32)).clone('')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
vacmAccessReadViewName.setDescription('The value of an instance of this object identifies\nthe MIB view of the SNMP context to which this\nconceptual row authorizes read access.\n\nThe identified MIB view is that one for which the\nvacmViewTreeFamilyViewName has the same value as the\ninstance of this object; if the value is the empty\nstring or if there is no active MIB view having this\nvalue of vacmViewTreeFamilyViewName, then no access\nis granted.')
vacm_access_write_view_name = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 6), snmp_admin_string().subtype(subtypeSpec=value_size_constraint(0, 32)).clone('')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
vacmAccessWriteViewName.setDescription('The value of an instance of this object identifies\nthe MIB view of the SNMP context to which this\nconceptual row authorizes write access.\n\nThe identified MIB view is that one for which the\nvacmViewTreeFamilyViewName has the same value as the\ninstance of this object; if the value is the empty\nstring or if there is no active MIB view having this\nvalue of vacmViewTreeFamilyViewName, then no access\nis granted.')
vacm_access_notify_view_name = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 7), snmp_admin_string().subtype(subtypeSpec=value_size_constraint(0, 32)).clone('')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
vacmAccessNotifyViewName.setDescription('The value of an instance of this object identifies\nthe MIB view of the SNMP context to which this\nconceptual row authorizes access for notifications.\n\nThe identified MIB view is that one for which the\nvacmViewTreeFamilyViewName has the same value as the\ninstance of this object; if the value is the empty\nstring or if there is no active MIB view having this\nvalue of vacmViewTreeFamilyViewName, then no access\nis granted.')
vacm_access_storage_type = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 8), storage_type().clone('nonVolatile')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
vacmAccessStorageType.setDescription("The storage type for this conceptual row.\n\nConceptual rows having the value 'permanent' need not\nallow write-access to any columnar objects in the row.")
vacm_access_status = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 4, 1, 9), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
vacmAccessStatus.setDescription('The status of this conceptual row.\n\nThe RowStatus TC [RFC2579] requires that this\nDESCRIPTION clause states under which circumstances\nother objects in this row can be modified:\n\nThe value of this object has no effect on whether\nother objects in this conceptual row can be modified.')
vacm_mib_views = mib_identifier((1, 3, 6, 1, 6, 3, 16, 1, 5))
vacm_view_spin_lock = mib_scalar((1, 3, 6, 1, 6, 3, 16, 1, 5, 1), test_and_incr()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
vacmViewSpinLock.setDescription("An advisory lock used to allow cooperating SNMP\nCommand Generator applications to coordinate their\nuse of the Set operation in creating or modifying\nviews.\n\nWhen creating a new view or altering an existing\nview, it is important to understand the potential\ninteractions with other uses of the view. The\nvacmViewSpinLock should be retrieved. The name of\nthe view to be created should be determined to be\nunique by the SNMP Command Generator application by\nconsulting the vacmViewTreeFamilyTable. Finally,\nthe named view may be created (Set), including the\nadvisory lock.\nIf another SNMP Command Generator application has\naltered the views in the meantime, then the spin\nlock's value will have changed, and so this creation\nwill fail because it will specify the wrong value for\nthe spin lock.\n\nSince this is an advisory lock, the use of this lock\nis not enforced.")
vacm_view_tree_family_table = mib_table((1, 3, 6, 1, 6, 3, 16, 1, 5, 2))
if mibBuilder.loadTexts:
vacmViewTreeFamilyTable.setDescription("Locally held information about families of subtrees\nwithin MIB views.\n\nEach MIB view is defined by two sets of view subtrees:\n - the included view subtrees, and\n - the excluded view subtrees.\nEvery such view subtree, both the included and the\n\nexcluded ones, is defined in this table.\n\nTo determine if a particular object instance is in\na particular MIB view, compare the object instance's\nOBJECT IDENTIFIER with each of the MIB view's active\nentries in this table. If none match, then the\nobject instance is not in the MIB view. If one or\nmore match, then the object instance is included in,\nor excluded from, the MIB view according to the\nvalue of vacmViewTreeFamilyType in the entry whose\nvalue of vacmViewTreeFamilySubtree has the most\nsub-identifiers. If multiple entries match and have\nthe same number of sub-identifiers (when wildcarding\nis specified with the value of vacmViewTreeFamilyMask),\nthen the lexicographically greatest instance of\nvacmViewTreeFamilyType determines the inclusion or\nexclusion.\n\nAn object instance's OBJECT IDENTIFIER X matches an\nactive entry in this table when the number of\nsub-identifiers in X is at least as many as in the\nvalue of vacmViewTreeFamilySubtree for the entry,\nand each sub-identifier in the value of\nvacmViewTreeFamilySubtree matches its corresponding\nsub-identifier in X. Two sub-identifiers match\neither if the corresponding bit of the value of\nvacmViewTreeFamilyMask for the entry is zero (the\n'wild card' value), or if they are equal.\n\nA 'family' of subtrees is the set of subtrees defined\nby a particular combination of values of\nvacmViewTreeFamilySubtree and vacmViewTreeFamilyMask.\n\nIn the case where no 'wild card' is defined in the\nvacmViewTreeFamilyMask, the family of subtrees reduces\nto a single subtree.\n\nWhen creating or changing MIB views, an SNMP Command\nGenerator application should utilize the\nvacmViewSpinLock to try to avoid collisions. See\nDESCRIPTION clause of vacmViewSpinLock.\n\nWhen creating MIB views, it is strongly advised that\nfirst the 'excluded' vacmViewTreeFamilyEntries are\ncreated and then the 'included' entries.\n\nWhen deleting MIB views, it is strongly advised that\nfirst the 'included' vacmViewTreeFamilyEntries are\n\ndeleted and then the 'excluded' entries.\n\nIf a create for an entry for instance-level access\ncontrol is received and the implementation does not\nsupport instance-level granularity, then an\ninconsistentName error must be returned.")
vacm_view_tree_family_entry = mib_table_row((1, 3, 6, 1, 6, 3, 16, 1, 5, 2, 1)).setIndexNames((0, 'SNMP-VIEW-BASED-ACM-MIB', 'vacmViewTreeFamilyViewName'), (0, 'SNMP-VIEW-BASED-ACM-MIB', 'vacmViewTreeFamilySubtree'))
if mibBuilder.loadTexts:
vacmViewTreeFamilyEntry.setDescription("Information on a particular family of view subtrees\nincluded in or excluded from a particular SNMP\ncontext's MIB view.\n\nImplementations must not restrict the number of\nfamilies of view subtrees for a given MIB view,\nexcept as dictated by resource constraints on the\noverall number of entries in the\nvacmViewTreeFamilyTable.\n\nIf no conceptual rows exist in this table for a given\nMIB view (viewName), that view may be thought of as\nconsisting of the empty set of view subtrees.")
vacm_view_tree_family_view_name = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 5, 2, 1, 1), snmp_admin_string().subtype(subtypeSpec=value_size_constraint(1, 32))).setMaxAccess('noaccess')
if mibBuilder.loadTexts:
vacmViewTreeFamilyViewName.setDescription('The human readable name for a family of view subtrees.')
vacm_view_tree_family_subtree = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 5, 2, 1, 2), object_identifier()).setMaxAccess('noaccess')
if mibBuilder.loadTexts:
vacmViewTreeFamilySubtree.setDescription('The MIB subtree which when combined with the\ncorresponding instance of vacmViewTreeFamilyMask\ndefines a family of view subtrees.')
vacm_view_tree_family_mask = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 5, 2, 1, 3), octet_string().subtype(subtypeSpec=value_size_constraint(0, 16)).clone('')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
vacmViewTreeFamilyMask.setDescription("The bit mask which, in combination with the\ncorresponding instance of vacmViewTreeFamilySubtree,\ndefines a family of view subtrees.\n\nEach bit of this bit mask corresponds to a\nsub-identifier of vacmViewTreeFamilySubtree, with the\nmost significant bit of the i-th octet of this octet\nstring value (extended if necessary, see below)\ncorresponding to the (8*i - 7)-th sub-identifier, and\nthe least significant bit of the i-th octet of this\noctet string corresponding to the (8*i)-th\nsub-identifier, where i is in the range 1 through 16.\n\nEach bit of this bit mask specifies whether or not\nthe corresponding sub-identifiers must match when\ndetermining if an OBJECT IDENTIFIER is in this\nfamily of view subtrees; a '1' indicates that an\nexact match must occur; a '0' indicates 'wild card',\ni.e., any sub-identifier value matches.\n\nThus, the OBJECT IDENTIFIER X of an object instance\nis contained in a family of view subtrees if, for\neach sub-identifier of the value of\nvacmViewTreeFamilySubtree, either:\n\n the i-th bit of vacmViewTreeFamilyMask is 0, or\n\n the i-th sub-identifier of X is equal to the i-th\n sub-identifier of the value of\n vacmViewTreeFamilySubtree.\n\nIf the value of this bit mask is M bits long and\n\nthere are more than M sub-identifiers in the\ncorresponding instance of vacmViewTreeFamilySubtree,\nthen the bit mask is extended with 1's to be the\nrequired length.\n\nNote that when the value of this object is the\nzero-length string, this extension rule results in\na mask of all-1's being used (i.e., no 'wild card'),\nand the family of view subtrees is the one view\nsubtree uniquely identified by the corresponding\ninstance of vacmViewTreeFamilySubtree.\n\nNote that masks of length greater than zero length\ndo not need to be supported. In this case this\nobject is made read-only.")
vacm_view_tree_family_type = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 5, 2, 1, 4), integer().subtype(subtypeSpec=single_value_constraint(1, 2)).subtype(namedValues=named_values(('included', 1), ('excluded', 2))).clone(1)).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
vacmViewTreeFamilyType.setDescription('Indicates whether the corresponding instances of\nvacmViewTreeFamilySubtree and vacmViewTreeFamilyMask\ndefine a family of view subtrees which is included in\nor excluded from the MIB view.')
vacm_view_tree_family_storage_type = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 5, 2, 1, 5), storage_type().clone('nonVolatile')).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
vacmViewTreeFamilyStorageType.setDescription("The storage type for this conceptual row.\n\nConceptual rows having the value 'permanent' need not\nallow write-access to any columnar objects in the row.")
vacm_view_tree_family_status = mib_table_column((1, 3, 6, 1, 6, 3, 16, 1, 5, 2, 1, 6), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
vacmViewTreeFamilyStatus.setDescription('The status of this conceptual row.\n\nThe RowStatus TC [RFC2579] requires that this\nDESCRIPTION clause states under which circumstances\nother objects in this row can be modified:\n\nThe value of this object has no effect on whether\nother objects in this conceptual row can be modified.')
vacm_mib_conformance = mib_identifier((1, 3, 6, 1, 6, 3, 16, 2))
vacm_mib_compliances = mib_identifier((1, 3, 6, 1, 6, 3, 16, 2, 1))
vacm_mib_groups = mib_identifier((1, 3, 6, 1, 6, 3, 16, 2, 2))
vacm_basic_group = object_group((1, 3, 6, 1, 6, 3, 16, 2, 2, 1)).setObjects(*(('SNMP-VIEW-BASED-ACM-MIB', 'vacmViewTreeFamilyStorageType'), ('SNMP-VIEW-BASED-ACM-MIB', 'vacmAccessContextMatch'), ('SNMP-VIEW-BASED-ACM-MIB', 'vacmAccessReadViewName'), ('SNMP-VIEW-BASED-ACM-MIB', 'vacmViewTreeFamilyType'), ('SNMP-VIEW-BASED-ACM-MIB', 'vacmGroupName'), ('SNMP-VIEW-BASED-ACM-MIB', 'vacmSecurityToGroupStatus'), ('SNMP-VIEW-BASED-ACM-MIB', 'vacmContextName'), ('SNMP-VIEW-BASED-ACM-MIB', 'vacmAccessWriteViewName'), ('SNMP-VIEW-BASED-ACM-MIB', 'vacmAccessNotifyViewName'), ('SNMP-VIEW-BASED-ACM-MIB', 'vacmAccessStorageType'), ('SNMP-VIEW-BASED-ACM-MIB', 'vacmViewTreeFamilyStatus'), ('SNMP-VIEW-BASED-ACM-MIB', 'vacmAccessStatus'), ('SNMP-VIEW-BASED-ACM-MIB', 'vacmSecurityToGroupStorageType'), ('SNMP-VIEW-BASED-ACM-MIB', 'vacmViewTreeFamilyMask'), ('SNMP-VIEW-BASED-ACM-MIB', 'vacmViewSpinLock')))
if mibBuilder.loadTexts:
vacmBasicGroup.setDescription('A collection of objects providing for remote\nconfiguration of an SNMP engine which implements\n\nthe SNMP View-based Access Control Model.')
vacm_mib_compliance = module_compliance((1, 3, 6, 1, 6, 3, 16, 2, 1, 1)).setObjects(*(('SNMP-VIEW-BASED-ACM-MIB', 'vacmBasicGroup'),))
if mibBuilder.loadTexts:
vacmMIBCompliance.setDescription('The compliance statement for SNMP engines which\nimplement the SNMP View-based Access Control Model\nconfiguration MIB.')
mibBuilder.exportSymbols('SNMP-VIEW-BASED-ACM-MIB', PYSNMP_MODULE_ID=snmpVacmMIB)
mibBuilder.exportSymbols('SNMP-VIEW-BASED-ACM-MIB', snmpVacmMIB=snmpVacmMIB, vacmMIBObjects=vacmMIBObjects, vacmContextTable=vacmContextTable, vacmContextEntry=vacmContextEntry, vacmContextName=vacmContextName, vacmSecurityToGroupTable=vacmSecurityToGroupTable, vacmSecurityToGroupEntry=vacmSecurityToGroupEntry, vacmSecurityModel=vacmSecurityModel, vacmSecurityName=vacmSecurityName, vacmGroupName=vacmGroupName, vacmSecurityToGroupStorageType=vacmSecurityToGroupStorageType, vacmSecurityToGroupStatus=vacmSecurityToGroupStatus, vacmAccessTable=vacmAccessTable, vacmAccessEntry=vacmAccessEntry, vacmAccessContextPrefix=vacmAccessContextPrefix, vacmAccessSecurityModel=vacmAccessSecurityModel, vacmAccessSecurityLevel=vacmAccessSecurityLevel, vacmAccessContextMatch=vacmAccessContextMatch, vacmAccessReadViewName=vacmAccessReadViewName, vacmAccessWriteViewName=vacmAccessWriteViewName, vacmAccessNotifyViewName=vacmAccessNotifyViewName, vacmAccessStorageType=vacmAccessStorageType, vacmAccessStatus=vacmAccessStatus, vacmMIBViews=vacmMIBViews, vacmViewSpinLock=vacmViewSpinLock, vacmViewTreeFamilyTable=vacmViewTreeFamilyTable, vacmViewTreeFamilyEntry=vacmViewTreeFamilyEntry, vacmViewTreeFamilyViewName=vacmViewTreeFamilyViewName, vacmViewTreeFamilySubtree=vacmViewTreeFamilySubtree, vacmViewTreeFamilyMask=vacmViewTreeFamilyMask, vacmViewTreeFamilyType=vacmViewTreeFamilyType, vacmViewTreeFamilyStorageType=vacmViewTreeFamilyStorageType, vacmViewTreeFamilyStatus=vacmViewTreeFamilyStatus, vacmMIBConformance=vacmMIBConformance, vacmMIBCompliances=vacmMIBCompliances, vacmMIBGroups=vacmMIBGroups)
mibBuilder.exportSymbols('SNMP-VIEW-BASED-ACM-MIB', vacmBasicGroup=vacmBasicGroup)
mibBuilder.exportSymbols('SNMP-VIEW-BASED-ACM-MIB', vacmMIBCompliance=vacmMIBCompliance) |
W = 8
N = 4
wi = [3, 3, 5, 6]
ci = [3, 5, 10, 14]
d = [[0] * (W + 1) for i in range(N + 1)]
for i in range(1, N + 1):
for w in range(1, W + 1):
if wi[i-1] > w:
d[i][w] = d[i-1][w]
else:
d[i][w] = max(d[i-1][w], d[i-1][w-wi[i-1]]+ci[i-1])
print('\n'.join([' '.join(map(str, d[i])) for i in range(N + 1)]))
# Python3 program to find maximum
# achievable value with a knapsack
# of weight W and multiple instances allowed.
# Returns the maximum value
# with knapsack of W capacity
def unboundedKnapsack(W, n, val, wt):
# dp[i] is going to store maximum
# value with knapsack capacity i.
dp = [0 for i in range(W + 1)]
ans = 0
# Fill dp[] using above recursive formula
for i in range(W + 1):
for j in range(n):
if (wt[j] <= i):
dp[i] = max(dp[i], dp[i - wt[j]] + val[j])
print(dp)
return dp[W]
# Driver program
W = 5
val = [10]
wt = [2]
n = len(val)
print(unboundedKnapsack(W, n, val, wt))
# This code is contributed by Anant Agarwal. | w = 8
n = 4
wi = [3, 3, 5, 6]
ci = [3, 5, 10, 14]
d = [[0] * (W + 1) for i in range(N + 1)]
for i in range(1, N + 1):
for w in range(1, W + 1):
if wi[i - 1] > w:
d[i][w] = d[i - 1][w]
else:
d[i][w] = max(d[i - 1][w], d[i - 1][w - wi[i - 1]] + ci[i - 1])
print('\n'.join([' '.join(map(str, d[i])) for i in range(N + 1)]))
def unbounded_knapsack(W, n, val, wt):
dp = [0 for i in range(W + 1)]
ans = 0
for i in range(W + 1):
for j in range(n):
if wt[j] <= i:
dp[i] = max(dp[i], dp[i - wt[j]] + val[j])
print(dp)
return dp[W]
w = 5
val = [10]
wt = [2]
n = len(val)
print(unbounded_knapsack(W, n, val, wt)) |
def foo(i):
print(i)
for k in [1,2,3,4,5]:
foo(k)
| def foo(i):
print(i)
for k in [1, 2, 3, 4, 5]:
foo(k) |
class Solution:
def minOperations(self, n: int) -> int:
if n % 2 == 1:
n_2 = n // 2
return n_2 ** 2 + n_2
else:
n_2 = n // 2
return n_2 ** 2
| class Solution:
def min_operations(self, n: int) -> int:
if n % 2 == 1:
n_2 = n // 2
return n_2 ** 2 + n_2
else:
n_2 = n // 2
return n_2 ** 2 |
class FrameRole(object):
def __init__(self, source, description):
assert(isinstance(source, str))
assert(isinstance(description, str))
self.__source = source
self.__description = description
@property
def Source(self):
return self.__source
@property
def Description(self):
return self.__description | class Framerole(object):
def __init__(self, source, description):
assert isinstance(source, str)
assert isinstance(description, str)
self.__source = source
self.__description = description
@property
def source(self):
return self.__source
@property
def description(self):
return self.__description |
def f(x):
if x == 0:
return 0
return x + f(x - 1)
print(f(3))
# Output is 6 | def f(x):
if x == 0:
return 0
return x + f(x - 1)
print(f(3)) |
def M():
i=0
while i<6:
j=0
while j<5:
if (j==0 or j==4) or (i<3 and (i-j==0 or i+j==4)):
print("*",end=" ")
else:
print(end=" ")
j+=1
i+=1
print()
| def m():
i = 0
while i < 6:
j = 0
while j < 5:
if (j == 0 or j == 4) or (i < 3 and (i - j == 0 or i + j == 4)):
print('*', end=' ')
else:
print(end=' ')
j += 1
i += 1
print() |
class Vaca:
cola = True
da_leche = False
camina = False
def __init__(self, nombre, color, cola):
self._nombre = nombre
self.color = color
self.cola = cola
def info(self):
print("#"*30)
print("Nombre :", self._nombre)
print("Color:", self.color)
print("Cola:", ("Con cola" if(self.cola) else "Sin cola"))
print(("Esta caminando" if(self.camina) else "Esta detenida"))
print("#"*30)
def caminar(self):
self.camina = True
def detenerse(self):
self.camina = False
muu = Vaca("muu", "amarilla", True)
muu._nombre = "cambio de nombre"
muu.caminar()
muu.info()
clara_bella = Vaca("clara bella", "blanca", False)
muu.caminar()
muu.detenerse()
clara_bella.info()
| class Vaca:
cola = True
da_leche = False
camina = False
def __init__(self, nombre, color, cola):
self._nombre = nombre
self.color = color
self.cola = cola
def info(self):
print('#' * 30)
print('Nombre :', self._nombre)
print('Color:', self.color)
print('Cola:', 'Con cola' if self.cola else 'Sin cola')
print('Esta caminando' if self.camina else 'Esta detenida')
print('#' * 30)
def caminar(self):
self.camina = True
def detenerse(self):
self.camina = False
muu = vaca('muu', 'amarilla', True)
muu._nombre = 'cambio de nombre'
muu.caminar()
muu.info()
clara_bella = vaca('clara bella', 'blanca', False)
muu.caminar()
muu.detenerse()
clara_bella.info() |
#This program says Hello and asks for my name
print('Hello World')
print('What\'s your name?')#ask for their name
myName=input()
print('Nice to meet you,'+ myName)
print('your length name is : '+str(len(myName)))
print('Your age?')#ask for their age
myAge=input()
print('You will be '+str(int(myAge)+1)+' in a year.')
| print('Hello World')
print("What's your name?")
my_name = input()
print('Nice to meet you,' + myName)
print('your length name is : ' + str(len(myName)))
print('Your age?')
my_age = input()
print('You will be ' + str(int(myAge) + 1) + ' in a year.') |
STATS = [
{
"num_node_expansions": 8573,
"plan_length": 112,
"search_time": 9.18,
"total_time": 9.18
},
{
"num_node_expansions": 9432,
"plan_length": 109,
"search_time": 10.41,
"total_time": 10.41
},
{
"num_node_expansions": 11788,
"plan_length": 109,
"search_time": 16.73,
"total_time": 16.73
},
{
"num_node_expansions": 13267,
"plan_length": 104,
"search_time": 19.14,
"total_time": 19.14
},
{
"num_node_expansions": 10980,
"plan_length": 117,
"search_time": 18.89,
"total_time": 18.89
},
{
"num_node_expansions": 16049,
"plan_length": 125,
"search_time": 11.02,
"total_time": 11.02
},
{
"num_node_expansions": 11133,
"plan_length": 115,
"search_time": 6.61,
"total_time": 6.61
},
{
"num_node_expansions": 15591,
"plan_length": 118,
"search_time": 11.84,
"total_time": 11.84
},
{
"num_node_expansions": 10616,
"plan_length": 132,
"search_time": 6.75,
"total_time": 6.75
},
{
"num_node_expansions": 33633,
"plan_length": 143,
"search_time": 18.68,
"total_time": 18.68
},
{
"num_node_expansions": 3525,
"plan_length": 131,
"search_time": 23.75,
"total_time": 23.75
},
{
"num_node_expansions": 17952,
"plan_length": 140,
"search_time": 25.3,
"total_time": 25.3
},
{
"num_node_expansions": 7168,
"plan_length": 146,
"search_time": 5.53,
"total_time": 5.53
},
{
"num_node_expansions": 17825,
"plan_length": 140,
"search_time": 23.5,
"total_time": 23.5
},
{
"num_node_expansions": 16370,
"plan_length": 133,
"search_time": 12.0,
"total_time": 12.0
}
]
num_timeouts = 40
num_timeouts = 0
num_problems = 55
| stats = [{'num_node_expansions': 8573, 'plan_length': 112, 'search_time': 9.18, 'total_time': 9.18}, {'num_node_expansions': 9432, 'plan_length': 109, 'search_time': 10.41, 'total_time': 10.41}, {'num_node_expansions': 11788, 'plan_length': 109, 'search_time': 16.73, 'total_time': 16.73}, {'num_node_expansions': 13267, 'plan_length': 104, 'search_time': 19.14, 'total_time': 19.14}, {'num_node_expansions': 10980, 'plan_length': 117, 'search_time': 18.89, 'total_time': 18.89}, {'num_node_expansions': 16049, 'plan_length': 125, 'search_time': 11.02, 'total_time': 11.02}, {'num_node_expansions': 11133, 'plan_length': 115, 'search_time': 6.61, 'total_time': 6.61}, {'num_node_expansions': 15591, 'plan_length': 118, 'search_time': 11.84, 'total_time': 11.84}, {'num_node_expansions': 10616, 'plan_length': 132, 'search_time': 6.75, 'total_time': 6.75}, {'num_node_expansions': 33633, 'plan_length': 143, 'search_time': 18.68, 'total_time': 18.68}, {'num_node_expansions': 3525, 'plan_length': 131, 'search_time': 23.75, 'total_time': 23.75}, {'num_node_expansions': 17952, 'plan_length': 140, 'search_time': 25.3, 'total_time': 25.3}, {'num_node_expansions': 7168, 'plan_length': 146, 'search_time': 5.53, 'total_time': 5.53}, {'num_node_expansions': 17825, 'plan_length': 140, 'search_time': 23.5, 'total_time': 23.5}, {'num_node_expansions': 16370, 'plan_length': 133, 'search_time': 12.0, 'total_time': 12.0}]
num_timeouts = 40
num_timeouts = 0
num_problems = 55 |
#https://practice.geeksforgeeks.org/problems/subarray-with-0-sum-1587115621/1
#Complete this function
def subArrayExists(arr,n):
##Your code here
#Return true or false
sum=0
store =set()
for i in range(n):
sum+=arr[i]
if sum==0 or sum in store:
return 1
store.add(sum)
return 0
#{
# Driver Code Starts
#Initial Template for Python 3
def main():
T=int(input())
while(T>0):
n=int(input())
arr=[int(x) for x in input().strip().split()]
if(subArrayExists(arr,n)):
print("Yes")
else:
print("No")
T-=1
if __name__=="__main__":
main()
# } Driver Code Ends | def sub_array_exists(arr, n):
sum = 0
store = set()
for i in range(n):
sum += arr[i]
if sum == 0 or sum in store:
return 1
store.add(sum)
return 0
def main():
t = int(input())
while T > 0:
n = int(input())
arr = [int(x) for x in input().strip().split()]
if sub_array_exists(arr, n):
print('Yes')
else:
print('No')
t -= 1
if __name__ == '__main__':
main() |
def someAction_Decorator(func):
def wrapper(*args, **kwargs):
func(*args, **kwargs)
print("something else")
return wrapper
class someAction_ClassDecorator(object):
def __init__(self, func):
self.func = func
def __call__(self, *args, **kwargs):
self.func(self, *args, **kwargs)
print("something else")
class ConcreteObject(object):
@someAction_Decorator
def someAction(self):
print("something")
class ConcreteObject2(object):
@someAction_ClassDecorator
def someAction(self):
print("something")
class ConcreteObject3(object):
def someAction(self):
print("something")
if __name__ == "__main__":
obj = ConcreteObject()
obj.someAction()
obj2 = ConcreteObject2()
obj2.someAction()
| def some_action__decorator(func):
def wrapper(*args, **kwargs):
func(*args, **kwargs)
print('something else')
return wrapper
class Someaction_Classdecorator(object):
def __init__(self, func):
self.func = func
def __call__(self, *args, **kwargs):
self.func(self, *args, **kwargs)
print('something else')
class Concreteobject(object):
@someAction_Decorator
def some_action(self):
print('something')
class Concreteobject2(object):
@someAction_ClassDecorator
def some_action(self):
print('something')
class Concreteobject3(object):
def some_action(self):
print('something')
if __name__ == '__main__':
obj = concrete_object()
obj.someAction()
obj2 = concrete_object2()
obj2.someAction() |
#
# PySNMP MIB module HIRSCHMANN-MMP4-ROUTING-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/HIRSCHMANN-MMP4-ROUTING-MIB
# Produced by pysmi-0.3.4 at Mon Apr 29 19:18:18 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
Integer, OctetString, ObjectIdentifier = mibBuilder.importSymbols("ASN1", "Integer", "OctetString", "ObjectIdentifier")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ValueRangeConstraint, ValueSizeConstraint, SingleValueConstraint, ConstraintsIntersection, ConstraintsUnion = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueRangeConstraint", "ValueSizeConstraint", "SingleValueConstraint", "ConstraintsIntersection", "ConstraintsUnion")
hmPlatform4, = mibBuilder.importSymbols("HIRSCHMANN-MMP4-BASICL2-MIB", "hmPlatform4")
ospfVirtIfEntry, ospfIfEntry = mibBuilder.importSymbols("OSPF-MIB", "ospfVirtIfEntry", "ospfIfEntry")
rip2IfConfEntry, = mibBuilder.importSymbols("RIPv2-MIB", "rip2IfConfEntry")
ModuleCompliance, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "NotificationGroup")
Gauge32, TimeTicks, MibIdentifier, Counter32, ModuleIdentity, MibScalar, MibTable, MibTableRow, MibTableColumn, Unsigned32, Bits, Integer32, NotificationType, Counter64, IpAddress, iso, ObjectIdentity = mibBuilder.importSymbols("SNMPv2-SMI", "Gauge32", "TimeTicks", "MibIdentifier", "Counter32", "ModuleIdentity", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Unsigned32", "Bits", "Integer32", "NotificationType", "Counter64", "IpAddress", "iso", "ObjectIdentity")
RowStatus, DisplayString, TextualConvention, MacAddress, TruthValue = mibBuilder.importSymbols("SNMPv2-TC", "RowStatus", "DisplayString", "TextualConvention", "MacAddress", "TruthValue")
hmPlatform4Routing = ModuleIdentity((1, 3, 6, 1, 4, 1, 248, 15, 2))
hmPlatform4Routing.setRevisions(('2005-08-18 12:00', '2003-04-02 17:00',))
if mibBuilder.loadTexts: hmPlatform4Routing.setLastUpdated('200508181200Z')
if mibBuilder.loadTexts: hmPlatform4Routing.setOrganization('Hirschmann Automation and Control GmbH')
hmAgentSwitchArpGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 1))
hmAgentSwitchArpAgeoutTime = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(15, 21600)).clone(1200)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchArpAgeoutTime.setStatus('current')
hmAgentSwitchArpResponseTime = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 2), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 10))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchArpResponseTime.setStatus('current')
hmAgentSwitchArpMaxRetries = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 3), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 10))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchArpMaxRetries.setStatus('current')
hmAgentSwitchArpCacheSize = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 4), Integer32()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchArpCacheSize.setStatus('current')
hmAgentSwitchArpDynamicRenew = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 5), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2))).clone('enable')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchArpDynamicRenew.setStatus('current')
hmAgentSwitchArpTotalEntryCountCurrent = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 6), Gauge32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchArpTotalEntryCountCurrent.setStatus('current')
hmAgentSwitchArpTotalEntryCountPeak = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 7), Gauge32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchArpTotalEntryCountPeak.setStatus('current')
hmAgentSwitchArpStaticEntryCountCurrent = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 8), Gauge32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchArpStaticEntryCountCurrent.setStatus('current')
hmAgentSwitchArpStaticEntryCountMax = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 9), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchArpStaticEntryCountMax.setStatus('current')
hmAgentSwitchArpTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10), )
if mibBuilder.loadTexts: hmAgentSwitchArpTable.setStatus('current')
hmAgentSwitchArpEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10, 1), ).setIndexNames((0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentSwitchArpIpAddress"))
if mibBuilder.loadTexts: hmAgentSwitchArpEntry.setStatus('current')
hmAgentSwitchArpAge = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10, 1, 1), TimeTicks()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchArpAge.setStatus('current')
hmAgentSwitchArpIpAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10, 1, 2), IpAddress()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchArpIpAddress.setStatus('current')
hmAgentSwitchArpMacAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10, 1, 3), MacAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hmAgentSwitchArpMacAddress.setStatus('current')
hmAgentSwitchArpInterface = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10, 1, 4), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchArpInterface.setStatus('current')
hmAgentSwitchArpType = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10, 1, 5), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))).clone(namedValues=NamedValues(("local", 1), ("gateway", 2), ("static", 3), ("dynamic", 4)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchArpType.setStatus('current')
hmAgentSwitchArpStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10, 1, 6), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchArpStatus.setStatus('current')
hmAgentSwitchArpSparseLearn = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 11), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2))).clone('disable')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchArpSparseLearn.setStatus('current')
hmAgentSwitchIpGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 2))
hmAgentSwitchIpRoutingMode = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpRoutingMode.setStatus('current')
hmAgentSwitchIpVRRPMode = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpVRRPMode.setStatus('current')
hmAgentSwitchIpInterfaceTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3), )
if mibBuilder.loadTexts: hmAgentSwitchIpInterfaceTable.setStatus('current')
hmAgentSwitchIpInterfaceEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1), ).setIndexNames((0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentSwitchIpInterfaceIfIndex"))
if mibBuilder.loadTexts: hmAgentSwitchIpInterfaceEntry.setStatus('current')
hmAgentSwitchIpInterfaceIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchIpInterfaceIfIndex.setStatus('current')
hmAgentSwitchIpInterfaceIpAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 2), IpAddress()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpInterfaceIpAddress.setStatus('current')
hmAgentSwitchIpInterfaceNetMask = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 3), IpAddress()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpInterfaceNetMask.setStatus('current')
hmAgentSwitchIpInterfaceClearIp = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpInterfaceClearIp.setStatus('current')
hmAgentSwitchIpInterfaceRoutingMode = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 5), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpInterfaceRoutingMode.setStatus('current')
hmAgentSwitchIpInterfaceProxyARPMode = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 6), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2))).clone('disable')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpInterfaceProxyARPMode.setStatus('current')
hmAgentSwitchIpInterfaceMtuValue = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 7), Unsigned32().subtype(subtypeSpec=ConstraintsUnion(ValueRangeConstraint(0, 0), ValueRangeConstraint(68, 9000), ))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpInterfaceMtuValue.setStatus('current')
hmAgentSwitchIpInterfaceSlotNum = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 8), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchIpInterfaceSlotNum.setStatus('current')
hmAgentSwitchIpInterfacePortNum = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 9), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchIpInterfacePortNum.setStatus('current')
hmAgentSwitchIpInterfaceNetdirectedBCMode = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 10), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2))).clone('disable')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpInterfaceNetdirectedBCMode.setStatus('current')
hmAgentSwitchIpRouterDiscoveryTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4), )
if mibBuilder.loadTexts: hmAgentSwitchIpRouterDiscoveryTable.setStatus('current')
hmAgentSwitchIpRouterDiscoveryEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1), ).setIndexNames((0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentSwitchIpRouterDiscoveryIfIndex"))
if mibBuilder.loadTexts: hmAgentSwitchIpRouterDiscoveryEntry.setStatus('current')
hmAgentSwitchIpRouterDiscoveryIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchIpRouterDiscoveryIfIndex.setStatus('current')
hmAgentSwitchIpRouterDiscoveryAdvertiseMode = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2))).clone('enable')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpRouterDiscoveryAdvertiseMode.setStatus('current')
hmAgentSwitchIpRouterDiscoveryMaxAdvertisementInterval = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1, 3), Integer32().subtype(subtypeSpec=ValueRangeConstraint(4, 1800)).clone(600)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpRouterDiscoveryMaxAdvertisementInterval.setStatus('current')
hmAgentSwitchIpRouterDiscoveryMinAdvertisementInterval = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1, 4), Integer32().subtype(subtypeSpec=ValueRangeConstraint(3, 1800)).clone(450)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpRouterDiscoveryMinAdvertisementInterval.setStatus('current')
hmAgentSwitchIpRouterDiscoveryAdvertisementLifetime = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1, 5), Integer32().subtype(subtypeSpec=ValueRangeConstraint(4, 9000)).clone(1800)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpRouterDiscoveryAdvertisementLifetime.setStatus('current')
hmAgentSwitchIpRouterDiscoveryPreferenceLevel = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1, 6), Integer32()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpRouterDiscoveryPreferenceLevel.setStatus('current')
hmAgentSwitchIpRouterDiscoveryAdvertisementAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1, 7), IpAddress().clone(hexValue="E0000001")).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpRouterDiscoveryAdvertisementAddress.setStatus('current')
hmAgentSwitchIpVlanTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 5), )
if mibBuilder.loadTexts: hmAgentSwitchIpVlanTable.setStatus('current')
hmAgentSwitchIpVlanEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 5, 1), ).setIndexNames((0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentSwitchIpVlanId"))
if mibBuilder.loadTexts: hmAgentSwitchIpVlanEntry.setStatus('current')
hmAgentSwitchIpVlanId = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 5, 1, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchIpVlanId.setStatus('current')
hmAgentSwitchIpVlanIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 5, 1, 2), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchIpVlanIfIndex.setStatus('current')
hmAgentSwitchIpVlanRoutingStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 5, 1, 3), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hmAgentSwitchIpVlanRoutingStatus.setStatus('current')
hmAgentSwitchSecondaryAddressTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 6), )
if mibBuilder.loadTexts: hmAgentSwitchSecondaryAddressTable.setStatus('current')
hmAgentSwitchSecondaryAddressEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 6, 1), ).setIndexNames((0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentSwitchIpInterfaceIfIndex"), (0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentSwitchSecondaryIpAddress"))
if mibBuilder.loadTexts: hmAgentSwitchSecondaryAddressEntry.setStatus('current')
hmAgentSwitchSecondaryIpAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 6, 1, 1), IpAddress())
if mibBuilder.loadTexts: hmAgentSwitchSecondaryIpAddress.setStatus('current')
hmAgentSwitchSecondaryNetMask = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 6, 1, 2), IpAddress()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hmAgentSwitchSecondaryNetMask.setStatus('current')
hmAgentSwitchSecondaryStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 6, 1, 3), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hmAgentSwitchSecondaryStatus.setStatus('current')
hmAgentSwitchIpRoutePreferenceTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 7), )
if mibBuilder.loadTexts: hmAgentSwitchIpRoutePreferenceTable.setStatus('current')
hmAgentSwitchIpRoutePreferenceEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 7, 1), ).setIndexNames((0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentSwitchIpRoutePreferenceSource"))
if mibBuilder.loadTexts: hmAgentSwitchIpRoutePreferenceEntry.setStatus('current')
hmAgentSwitchIpRoutePreferenceSource = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 7, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4, 5, 6, 7))).clone(namedValues=NamedValues(("connected", 1), ("static", 2), ("ospf-intra", 3), ("ospf-inter", 4), ("ospf-ext-t1", 5), ("ospf-ext-t2", 6), ("rip", 7)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchIpRoutePreferenceSource.setStatus('current')
hmAgentSwitchIpRoutePreferenceValue = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 7, 1, 2), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 255))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpRoutePreferenceValue.setStatus('current')
hmAgentSwitchIpRouteStaticTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8), )
if mibBuilder.loadTexts: hmAgentSwitchIpRouteStaticTable.setStatus('current')
hmAgentSwitchIpRouteStaticEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8, 1), ).setIndexNames((0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentSwitchIpRouteStaticDestination"), (0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentSwitchIpRouteStaticDestinationMask"), (0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentSwitchIpRouteStaticNextHop"))
if mibBuilder.loadTexts: hmAgentSwitchIpRouteStaticEntry.setStatus('current')
hmAgentSwitchIpRouteStaticDestination = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8, 1, 1), IpAddress())
if mibBuilder.loadTexts: hmAgentSwitchIpRouteStaticDestination.setStatus('current')
hmAgentSwitchIpRouteStaticDestinationMask = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8, 1, 2), IpAddress())
if mibBuilder.loadTexts: hmAgentSwitchIpRouteStaticDestinationMask.setStatus('current')
hmAgentSwitchIpRouteStaticNextHop = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8, 1, 3), IpAddress())
if mibBuilder.loadTexts: hmAgentSwitchIpRouteStaticNextHop.setStatus('current')
hmAgentSwitchIpRouteStaticPreference = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8, 1, 4), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 255))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpRouteStaticPreference.setStatus('current')
hmAgentSwitchIpRouteStaticStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8, 1, 5), RowStatus()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpRouteStaticStatus.setStatus('current')
hmAgentSwitchIpRouteStaticTrackId = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8, 1, 6), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 65535))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpRouteStaticTrackId.setStatus('current')
hmAgentSwitchIpVlanSingleMacMode = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 100), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpVlanSingleMacMode.setStatus('current')
hmAgentSwitchIpTableSizesGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 101))
hmAgentSwitchIpTableSizeArp = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 101, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(300, 4096))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpTableSizeArp.setStatus('current')
hmAgentSwitchIpTableSizeUCRoutes = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 101, 2), Integer32().subtype(subtypeSpec=ValueRangeConstraint(300, 4096))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpTableSizeUCRoutes.setStatus('current')
hmAgentSwitchIpTableSizeMCRoutes = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 101, 3), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 512))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSwitchIpTableSizeMCRoutes.setStatus('current')
hmAgentSwitchIpCurrentTableSizeArp = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 101, 4), Integer32().subtype(subtypeSpec=ValueRangeConstraint(300, 4096))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchIpCurrentTableSizeArp.setStatus('current')
hmAgentSwitchIpCurrentTableSizeUCRoutes = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 101, 5), Integer32().subtype(subtypeSpec=ValueRangeConstraint(300, 4096))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchIpCurrentTableSizeUCRoutes.setStatus('current')
hmAgentSwitchIpCurrentTableSizeMCRoutes = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 101, 6), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 512))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentSwitchIpCurrentTableSizeMCRoutes.setStatus('current')
hmAgentRouterRipConfigGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 3))
hmAgentRouterRipAdminState = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRouterRipAdminState.setStatus('current')
hmAgentRouterRipSplitHorizonMode = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("none", 1), ("simple", 2), ("poisonReverse", 3))).clone('simple')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRouterRipSplitHorizonMode.setStatus('current')
hmAgentRouterRipAutoSummaryMode = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 3), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2))).clone('enable')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRouterRipAutoSummaryMode.setStatus('current')
hmAgentRouterRipHostRoutesAcceptMode = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2))).clone('enable')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRouterRipHostRoutesAcceptMode.setStatus('current')
hmAgentRouterRipDefaultMetric = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 5), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 15))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRouterRipDefaultMetric.setStatus('current')
hmAgentRouterRipDefaultMetricConfigured = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 6), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRouterRipDefaultMetricConfigured.setStatus('current')
hmAgentRouterRipDefaultInfoOriginate = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 7), TruthValue().clone('false')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRouterRipDefaultInfoOriginate.setStatus('current')
hmAgentRipRouteRedistTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8), )
if mibBuilder.loadTexts: hmAgentRipRouteRedistTable.setStatus('current')
hmAgentRipRouteRedistEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1), ).setIndexNames((0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentRipRouteRedistSource"))
if mibBuilder.loadTexts: hmAgentRipRouteRedistEntry.setStatus('current')
hmAgentRipRouteRedistSource = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))).clone(namedValues=NamedValues(("connected", 1), ("static", 2), ("ospf", 3), ("bgp", 4)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentRipRouteRedistSource.setStatus('current')
hmAgentRipRouteRedistMode = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2))).clone('disable')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRipRouteRedistMode.setStatus('current')
hmAgentRipRouteRedistMetric = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 3), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 15))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRipRouteRedistMetric.setStatus('current')
hmAgentRipRouteRedistMetricConfigured = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 4), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRipRouteRedistMetricConfigured.setStatus('current')
hmAgentRipRouteRedistMatchInternal = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 5), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("true", 1), ("false", 2), ("not-applicable", 3)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRipRouteRedistMatchInternal.setStatus('current')
hmAgentRipRouteRedistMatchExternal1 = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 6), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("true", 1), ("false", 2), ("not-applicable", 3)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRipRouteRedistMatchExternal1.setStatus('current')
hmAgentRipRouteRedistMatchExternal2 = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 7), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("true", 1), ("false", 2), ("not-applicable", 3)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRipRouteRedistMatchExternal2.setStatus('current')
hmAgentRipRouteRedistMatchNSSAExternal1 = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 8), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("true", 1), ("false", 2), ("not-applicable", 3)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRipRouteRedistMatchNSSAExternal1.setStatus('current')
hmAgentRipRouteRedistMatchNSSAExternal2 = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 9), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("true", 1), ("false", 2), ("not-applicable", 3)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRipRouteRedistMatchNSSAExternal2.setStatus('current')
hmAgentRipRouteRedistDistList = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 10), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 199))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRipRouteRedistDistList.setStatus('current')
hmAgentRipRouteRedistDistListConfigured = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 11), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRipRouteRedistDistListConfigured.setStatus('current')
hmAgentRip2IfConfTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 9), )
if mibBuilder.loadTexts: hmAgentRip2IfConfTable.setStatus('current')
hmAgentRip2IfConfEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 9, 1), )
rip2IfConfEntry.registerAugmentions(("HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentRip2IfConfEntry"))
hmAgentRip2IfConfEntry.setIndexNames(*rip2IfConfEntry.getIndexNames())
if mibBuilder.loadTexts: hmAgentRip2IfConfEntry.setStatus('current')
hmAgentRip2IfConfAuthKeyId = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 9, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 255))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hmAgentRip2IfConfAuthKeyId.setStatus('current')
hmAgentRip2InterfaceTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10), )
if mibBuilder.loadTexts: hmAgentRip2InterfaceTable.setStatus('current')
hmAgentRip2InterfaceEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1), ).setIndexNames((0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentRip2InterfaceIfIndex"))
if mibBuilder.loadTexts: hmAgentRip2InterfaceEntry.setStatus('current')
hmAgentRip2InterfaceIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 1), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentRip2InterfaceIfIndex.setStatus('current')
hmAgentRip2InterfaceAuthType = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("noAuthentication", 1), ("simplePassword", 2), ("md5", 3)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRip2InterfaceAuthType.setStatus('current')
hmAgentRip2InterfaceAuthKey = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 3), OctetString().subtype(subtypeSpec=ValueSizeConstraint(0, 16))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRip2InterfaceAuthKey.setStatus('current')
hmAgentRip2InterfaceAuthKeyId = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 4), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 255))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRip2InterfaceAuthKeyId.setStatus('current')
hmAgentRip2InterfaceSendVersion = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 5), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))).clone(namedValues=NamedValues(("doNotSend", 1), ("ripVersion1", 2), ("rip1Compatible", 3), ("ripVersion2", 4)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRip2InterfaceSendVersion.setStatus('current')
hmAgentRip2InterfaceReceiveVersion = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 6), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))).clone(namedValues=NamedValues(("rip1", 1), ("rip2", 2), ("rip1OrRip2", 3), ("doNotReceive", 4)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRip2InterfaceReceiveVersion.setStatus('current')
hmAgentRip2InterfaceAdminState = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 7), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRip2InterfaceAdminState.setStatus('current')
hmAgentRip2RcvBadPackets = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 8), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentRip2RcvBadPackets.setStatus('current')
hmAgentRip2RcvBadRoutes = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 9), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentRip2RcvBadRoutes.setStatus('current')
hmAgentRip2SentUpdates = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 10), Counter32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentRip2SentUpdates.setStatus('current')
hmAgentRouterRipUpdateTimerInterval = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 50), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 1000)).clone(30)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRouterRipUpdateTimerInterval.setStatus('current')
hmAgentRouterOspfConfigGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 4))
hmAgentOspfDefaultMetric = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 16777215))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfDefaultMetric.setStatus('current')
hmAgentOspfDefaultMetricConfigured = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 2), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfDefaultMetricConfigured.setStatus('current')
hmAgentOspfDefaultInfoOriginate = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 3), TruthValue().clone('false')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfDefaultInfoOriginate.setStatus('current')
hmAgentOspfDefaultInfoOriginateAlways = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 4), TruthValue().clone('false')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfDefaultInfoOriginateAlways.setStatus('current')
hmAgentOspfDefaultInfoOriginateMetric = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 5), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 16777215)).clone(10)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfDefaultInfoOriginateMetric.setStatus('current')
hmAgentOspfDefaultInfoOriginateMetricConfigured = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 6), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfDefaultInfoOriginateMetricConfigured.setStatus('current')
hmAgentOspfDefaultInfoOriginateMetricType = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 7), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("externalType1", 1), ("externalType2", 2))).clone(2)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfDefaultInfoOriginateMetricType.setStatus('current')
hmAgentOspfRouteRedistTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8), )
if mibBuilder.loadTexts: hmAgentOspfRouteRedistTable.setStatus('current')
hmAgentOspfRouteRedistEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1), ).setIndexNames((0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentOspfRouteRedistSource"))
if mibBuilder.loadTexts: hmAgentOspfRouteRedistEntry.setStatus('current')
hmAgentOspfRouteRedistSource = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))).clone(namedValues=NamedValues(("connected", 1), ("static", 2), ("rip", 3), ("bgp", 4)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmAgentOspfRouteRedistSource.setStatus('current')
hmAgentOspfRouteRedistMode = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2))).clone('disable')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfRouteRedistMode.setStatus('current')
hmAgentOspfRouteRedistMetric = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 3), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 16777215))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfRouteRedistMetric.setStatus('current')
hmAgentOspfRouteRedistMetricConfigured = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 4), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfRouteRedistMetricConfigured.setStatus('current')
hmAgentOspfRouteRedistMetricType = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 5), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("externalType1", 1), ("externalType2", 2))).clone('externalType2')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfRouteRedistMetricType.setStatus('current')
hmAgentOspfRouteRedistTag = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 6), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfRouteRedistTag.setStatus('current')
hmAgentOspfRouteRedistSubnets = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 7), TruthValue().clone('false')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfRouteRedistSubnets.setStatus('current')
hmAgentOspfRouteRedistDistList = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 8), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 199))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfRouteRedistDistList.setStatus('current')
hmAgentOspfRouteRedistDistListConfigured = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 9), TruthValue()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfRouteRedistDistListConfigured.setStatus('current')
hmAgentOspfIfTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 9), )
if mibBuilder.loadTexts: hmAgentOspfIfTable.setStatus('current')
hmAgentOspfIfEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 9, 1), )
ospfIfEntry.registerAugmentions(("HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentOspfIfEntry"))
hmAgentOspfIfEntry.setIndexNames(*ospfIfEntry.getIndexNames())
if mibBuilder.loadTexts: hmAgentOspfIfEntry.setStatus('current')
hmAgentOspfIfAuthKeyId = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 9, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 255))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hmAgentOspfIfAuthKeyId.setStatus('current')
hmAgentOspfIfIpMtuIgnoreFlag = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 9, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentOspfIfIpMtuIgnoreFlag.setStatus('current')
hmAgentOspfVirtIfTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 10), )
if mibBuilder.loadTexts: hmAgentOspfVirtIfTable.setStatus('current')
hmAgentOspfVirtIfEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 10, 1), )
ospfVirtIfEntry.registerAugmentions(("HIRSCHMANN-MMP4-ROUTING-MIB", "hmAgentOspfVirtIfEntry"))
hmAgentOspfVirtIfEntry.setIndexNames(*ospfVirtIfEntry.getIndexNames())
if mibBuilder.loadTexts: hmAgentOspfVirtIfEntry.setStatus('current')
hmAgentOspfVirtIfAuthKeyId = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 10, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 255))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hmAgentOspfVirtIfAuthKeyId.setStatus('current')
hmAgentRouterOspfRFC1583CompatibilityMode = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 11), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2))).clone('enable')).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRouterOspfRFC1583CompatibilityMode.setStatus('current')
hmAgentSnmpTrapFlagsConfigGroupLayer3 = MibIdentifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 5))
hmAgentSnmpVRRPNewMasterTrapFlag = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 5, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSnmpVRRPNewMasterTrapFlag.setStatus('current')
hmAgentSnmpVRRPAuthFailureTrapFlag = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 5, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentSnmpVRRPAuthFailureTrapFlag.setStatus('current')
hmAgentECMPGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 7))
hmAgentECMPOspfMaxPaths = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 7, 1), Integer32().clone(4)).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentECMPOspfMaxPaths.setStatus('current')
hmAgentRouterVrrpConfigGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 8))
hmAgentRouterVrrpAdminState = MibScalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 8, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmAgentRouterVrrpAdminState.setStatus('current')
hmVrrpExtGroup = MibIdentifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 9))
hmVrrpTrackingTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1), )
if mibBuilder.loadTexts: hmVrrpTrackingTable.setStatus('current')
hmVrrpTrackingEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1, 1), ).setIndexNames((0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmVrrpTrackIfIndex"), (0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmVrrpTrackVrid"), (0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmVrrpTrackId"))
if mibBuilder.loadTexts: hmVrrpTrackingEntry.setStatus('current')
hmVrrpTrackIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1, 1, 1), Integer32())
if mibBuilder.loadTexts: hmVrrpTrackIfIndex.setStatus('current')
hmVrrpTrackVrid = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1, 1, 2), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 255)))
if mibBuilder.loadTexts: hmVrrpTrackVrid.setStatus('current')
hmVrrpTrackId = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1, 1, 3), Integer32())
if mibBuilder.loadTexts: hmVrrpTrackId.setStatus('current')
hmVrrpTrackDecrement = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1, 1, 4), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 253))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmVrrpTrackDecrement.setStatus('current')
hmVrrpTrackOperStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1, 1, 5), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("up", 1), ("down", 2)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmVrrpTrackOperStatus.setStatus('current')
hmVrrpTrackRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1, 1, 6), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: hmVrrpTrackRowStatus.setStatus('current')
hmVrrpExtTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2), )
if mibBuilder.loadTexts: hmVrrpExtTable.setStatus('current')
hmVrrpExtEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1), ).setIndexNames((0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmVrrpExtIfIndex"), (0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmVrrpExtVrid"))
if mibBuilder.loadTexts: hmVrrpExtEntry.setStatus('current')
hmVrrpExtIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 1), Integer32())
if mibBuilder.loadTexts: hmVrrpExtIfIndex.setStatus('current')
hmVrrpExtVrid = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 2), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 255)))
if mibBuilder.loadTexts: hmVrrpExtVrid.setStatus('current')
hmVrrpExtDomainId = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 3), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 8))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmVrrpExtDomainId.setStatus('current')
hmVrrpExtDomainRole = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("none", 1), ("member", 2), ("supervisor", 3)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmVrrpExtDomainRole.setStatus('current')
hmVrrpExtDomainStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 5), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("noError", 1), ("noSupervisor", 2), ("supervisorDown", 3)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmVrrpExtDomainStatus.setStatus('current')
hmVrrpExtAdvertAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 6), IpAddress()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmVrrpExtAdvertAddress.setStatus('current')
hmVrrpExtAdvertTimer = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 7), Integer32().subtype(subtypeSpec=ValueRangeConstraint(100, 255000))).setUnits('milliseconds').setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmVrrpExtAdvertTimer.setStatus('current')
hmVrrpExtOperPriority = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 8), Integer32().subtype(subtypeSpec=ValueRangeConstraint(1, 255))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmVrrpExtOperPriority.setStatus('current')
hmVrrpExtNotifyAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 9), IpAddress()).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmVrrpExtNotifyAddress.setStatus('current')
hmVrrpExtNotifyLinkdown = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 10), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enable", 1), ("disable", 2)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmVrrpExtNotifyLinkdown.setStatus('current')
hmVrrpExtPreemptionDelay = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 11), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 65535))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmVrrpExtPreemptionDelay.setStatus('current')
hmVrrpDomainTable = MibTable((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3), )
if mibBuilder.loadTexts: hmVrrpDomainTable.setStatus('current')
hmVrrpDomainEntry = MibTableRow((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1), ).setIndexNames((0, "HIRSCHMANN-MMP4-ROUTING-MIB", "hmVrrpDomainId"))
if mibBuilder.loadTexts: hmVrrpDomainEntry.setStatus('current')
hmVrrpDomainId = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1, 1), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 8)))
if mibBuilder.loadTexts: hmVrrpDomainId.setStatus('current')
hmVrrpDomainMemberSendAdv = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("enabled", 1), ("disabled", 2)))).setMaxAccess("readwrite")
if mibBuilder.loadTexts: hmVrrpDomainMemberSendAdv.setStatus('current')
hmVrrpDomainStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1, 3), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("noError", 1), ("noSupervisor", 2), ("supervisorDown", 3)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmVrrpDomainStatus.setStatus('current')
hmVrrpDomainSupervisorIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1, 4), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmVrrpDomainSupervisorIfIndex.setStatus('current')
hmVrrpDomainSupervisorVrid = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1, 5), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 255))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmVrrpDomainSupervisorVrid.setStatus('current')
hmVrrpDomainOperPriority = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1, 6), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 255))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmVrrpDomainOperPriority.setStatus('current')
hmVrrpDomainSupervisorOperState = MibTableColumn((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1, 7), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))).clone(namedValues=NamedValues(("initialize", 1), ("backup", 2), ("master", 3), ("unknown", 4)))).setMaxAccess("readonly")
if mibBuilder.loadTexts: hmVrrpDomainSupervisorOperState.setStatus('current')
mibBuilder.exportSymbols("HIRSCHMANN-MMP4-ROUTING-MIB", hmAgentOspfDefaultInfoOriginateMetricType=hmAgentOspfDefaultInfoOriginateMetricType, hmAgentRouterOspfRFC1583CompatibilityMode=hmAgentRouterOspfRFC1583CompatibilityMode, hmAgentSwitchIpRouteStaticDestinationMask=hmAgentSwitchIpRouteStaticDestinationMask, hmAgentOspfRouteRedistMetricConfigured=hmAgentOspfRouteRedistMetricConfigured, hmAgentSwitchSecondaryAddressEntry=hmAgentSwitchSecondaryAddressEntry, hmAgentOspfIfEntry=hmAgentOspfIfEntry, hmVrrpDomainEntry=hmVrrpDomainEntry, hmVrrpDomainOperPriority=hmVrrpDomainOperPriority, hmAgentSwitchArpAge=hmAgentSwitchArpAge, hmAgentOspfRouteRedistSource=hmAgentOspfRouteRedistSource, hmAgentRipRouteRedistTable=hmAgentRipRouteRedistTable, hmAgentRipRouteRedistMatchExternal2=hmAgentRipRouteRedistMatchExternal2, hmAgentRipRouteRedistDistList=hmAgentRipRouteRedistDistList, hmVrrpExtPreemptionDelay=hmVrrpExtPreemptionDelay, hmVrrpTrackRowStatus=hmVrrpTrackRowStatus, hmAgentOspfIfIpMtuIgnoreFlag=hmAgentOspfIfIpMtuIgnoreFlag, hmAgentSwitchIpRouterDiscoveryPreferenceLevel=hmAgentSwitchIpRouterDiscoveryPreferenceLevel, hmVrrpExtVrid=hmVrrpExtVrid, hmAgentRipRouteRedistMetricConfigured=hmAgentRipRouteRedistMetricConfigured, hmAgentSwitchIpRouteStaticPreference=hmAgentSwitchIpRouteStaticPreference, hmAgentRip2InterfaceTable=hmAgentRip2InterfaceTable, hmAgentRip2RcvBadPackets=hmAgentRip2RcvBadPackets, hmAgentOspfIfTable=hmAgentOspfIfTable, hmAgentRip2InterfaceEntry=hmAgentRip2InterfaceEntry, hmAgentSwitchIpInterfaceRoutingMode=hmAgentSwitchIpInterfaceRoutingMode, hmAgentSwitchIpVlanTable=hmAgentSwitchIpVlanTable, hmAgentOspfRouteRedistMetricType=hmAgentOspfRouteRedistMetricType, hmAgentSwitchArpEntry=hmAgentSwitchArpEntry, hmAgentSwitchIpRoutingMode=hmAgentSwitchIpRoutingMode, hmAgentSwitchIpCurrentTableSizeUCRoutes=hmAgentSwitchIpCurrentTableSizeUCRoutes, hmVrrpDomainStatus=hmVrrpDomainStatus, hmAgentRip2InterfaceReceiveVersion=hmAgentRip2InterfaceReceiveVersion, hmAgentSwitchIpRouterDiscoveryMaxAdvertisementInterval=hmAgentSwitchIpRouterDiscoveryMaxAdvertisementInterval, hmAgentSwitchIpRouteStaticNextHop=hmAgentSwitchIpRouteStaticNextHop, hmAgentSwitchArpTotalEntryCountCurrent=hmAgentSwitchArpTotalEntryCountCurrent, hmAgentSwitchIpInterfaceProxyARPMode=hmAgentSwitchIpInterfaceProxyARPMode, hmAgentSnmpVRRPAuthFailureTrapFlag=hmAgentSnmpVRRPAuthFailureTrapFlag, hmAgentOspfDefaultMetricConfigured=hmAgentOspfDefaultMetricConfigured, hmAgentSnmpTrapFlagsConfigGroupLayer3=hmAgentSnmpTrapFlagsConfigGroupLayer3, hmAgentRip2InterfaceAdminState=hmAgentRip2InterfaceAdminState, hmVrrpExtOperPriority=hmVrrpExtOperPriority, hmAgentSwitchIpInterfaceNetdirectedBCMode=hmAgentSwitchIpInterfaceNetdirectedBCMode, hmAgentRouterVrrpConfigGroup=hmAgentRouterVrrpConfigGroup, hmVrrpDomainMemberSendAdv=hmVrrpDomainMemberSendAdv, hmAgentRip2IfConfEntry=hmAgentRip2IfConfEntry, hmAgentRipRouteRedistSource=hmAgentRipRouteRedistSource, hmAgentSnmpVRRPNewMasterTrapFlag=hmAgentSnmpVRRPNewMasterTrapFlag, hmVrrpExtEntry=hmVrrpExtEntry, hmAgentOspfRouteRedistMode=hmAgentOspfRouteRedistMode, hmVrrpTrackId=hmVrrpTrackId, hmAgentSwitchArpCacheSize=hmAgentSwitchArpCacheSize, hmAgentRouterRipAutoSummaryMode=hmAgentRouterRipAutoSummaryMode, hmAgentSwitchArpResponseTime=hmAgentSwitchArpResponseTime, hmAgentSwitchIpRoutePreferenceEntry=hmAgentSwitchIpRoutePreferenceEntry, hmAgentRip2InterfaceAuthType=hmAgentRip2InterfaceAuthType, hmAgentSwitchIpVlanEntry=hmAgentSwitchIpVlanEntry, hmAgentRouterRipSplitHorizonMode=hmAgentRouterRipSplitHorizonMode, hmAgentSwitchIpVRRPMode=hmAgentSwitchIpVRRPMode, hmAgentSwitchIpRouterDiscoveryAdvertisementAddress=hmAgentSwitchIpRouterDiscoveryAdvertisementAddress, hmAgentRouterRipDefaultMetricConfigured=hmAgentRouterRipDefaultMetricConfigured, hmAgentOspfDefaultInfoOriginate=hmAgentOspfDefaultInfoOriginate, hmAgentOspfVirtIfEntry=hmAgentOspfVirtIfEntry, hmVrrpExtNotifyAddress=hmVrrpExtNotifyAddress, hmVrrpExtGroup=hmVrrpExtGroup, hmAgentSwitchIpRoutePreferenceSource=hmAgentSwitchIpRoutePreferenceSource, hmVrrpDomainSupervisorVrid=hmVrrpDomainSupervisorVrid, hmAgentSwitchArpInterface=hmAgentSwitchArpInterface, hmAgentOspfRouteRedistMetric=hmAgentOspfRouteRedistMetric, hmVrrpDomainTable=hmVrrpDomainTable, hmAgentSwitchIpInterfaceClearIp=hmAgentSwitchIpInterfaceClearIp, hmAgentSwitchIpRouteStaticTable=hmAgentSwitchIpRouteStaticTable, hmVrrpExtDomainId=hmVrrpExtDomainId, hmAgentSwitchIpRouteStaticDestination=hmAgentSwitchIpRouteStaticDestination, hmAgentSwitchSecondaryIpAddress=hmAgentSwitchSecondaryIpAddress, hmAgentRip2InterfaceAuthKey=hmAgentRip2InterfaceAuthKey, hmAgentSwitchArpGroup=hmAgentSwitchArpGroup, hmAgentSwitchIpInterfaceNetMask=hmAgentSwitchIpInterfaceNetMask, hmAgentRipRouteRedistMatchNSSAExternal1=hmAgentRipRouteRedistMatchNSSAExternal1, hmPlatform4Routing=hmPlatform4Routing, hmAgentRip2SentUpdates=hmAgentRip2SentUpdates, hmAgentRipRouteRedistMetric=hmAgentRipRouteRedistMetric, hmAgentSwitchArpSparseLearn=hmAgentSwitchArpSparseLearn, hmAgentSwitchIpTableSizeMCRoutes=hmAgentSwitchIpTableSizeMCRoutes, hmAgentSwitchArpDynamicRenew=hmAgentSwitchArpDynamicRenew, hmAgentSwitchArpIpAddress=hmAgentSwitchArpIpAddress, hmVrrpTrackIfIndex=hmVrrpTrackIfIndex, hmAgentRip2RcvBadRoutes=hmAgentRip2RcvBadRoutes, hmAgentOspfRouteRedistSubnets=hmAgentOspfRouteRedistSubnets, hmAgentSwitchArpMacAddress=hmAgentSwitchArpMacAddress, hmAgentOspfRouteRedistDistList=hmAgentOspfRouteRedistDistList, hmVrrpDomainSupervisorIfIndex=hmVrrpDomainSupervisorIfIndex, hmAgentSwitchArpTable=hmAgentSwitchArpTable, hmVrrpDomainSupervisorOperState=hmVrrpDomainSupervisorOperState, hmVrrpTrackOperStatus=hmVrrpTrackOperStatus, hmAgentRouterRipHostRoutesAcceptMode=hmAgentRouterRipHostRoutesAcceptMode, hmVrrpExtAdvertTimer=hmVrrpExtAdvertTimer, hmAgentRouterVrrpAdminState=hmAgentRouterVrrpAdminState, hmVrrpTrackingEntry=hmVrrpTrackingEntry, hmAgentSwitchArpMaxRetries=hmAgentSwitchArpMaxRetries, hmAgentSwitchIpRouterDiscoveryEntry=hmAgentSwitchIpRouterDiscoveryEntry, hmAgentRipRouteRedistMatchNSSAExternal2=hmAgentRipRouteRedistMatchNSSAExternal2, hmAgentSwitchIpInterfaceEntry=hmAgentSwitchIpInterfaceEntry, hmAgentSwitchArpStaticEntryCountCurrent=hmAgentSwitchArpStaticEntryCountCurrent, hmAgentECMPGroup=hmAgentECMPGroup, hmAgentOspfIfAuthKeyId=hmAgentOspfIfAuthKeyId, hmAgentSwitchIpInterfaceIfIndex=hmAgentSwitchIpInterfaceIfIndex, hmAgentSwitchIpRouterDiscoveryTable=hmAgentSwitchIpRouterDiscoveryTable, hmAgentSwitchSecondaryStatus=hmAgentSwitchSecondaryStatus, hmAgentSwitchIpRouteStaticTrackId=hmAgentSwitchIpRouteStaticTrackId, hmAgentRip2InterfaceSendVersion=hmAgentRip2InterfaceSendVersion, hmAgentSwitchIpVlanId=hmAgentSwitchIpVlanId, hmAgentSwitchIpInterfacePortNum=hmAgentSwitchIpInterfacePortNum, hmVrrpTrackVrid=hmVrrpTrackVrid, hmAgentSwitchIpTableSizeUCRoutes=hmAgentSwitchIpTableSizeUCRoutes, hmAgentOspfDefaultInfoOriginateMetric=hmAgentOspfDefaultInfoOriginateMetric, hmAgentSwitchIpVlanRoutingStatus=hmAgentSwitchIpVlanRoutingStatus, hmVrrpDomainId=hmVrrpDomainId, hmAgentRouterOspfConfigGroup=hmAgentRouterOspfConfigGroup, hmAgentOspfRouteRedistDistListConfigured=hmAgentOspfRouteRedistDistListConfigured, hmVrrpTrackingTable=hmVrrpTrackingTable, hmAgentSwitchSecondaryAddressTable=hmAgentSwitchSecondaryAddressTable, hmAgentSwitchIpInterfaceMtuValue=hmAgentSwitchIpInterfaceMtuValue, hmAgentOspfDefaultInfoOriginateMetricConfigured=hmAgentOspfDefaultInfoOriginateMetricConfigured, hmAgentRip2InterfaceAuthKeyId=hmAgentRip2InterfaceAuthKeyId, hmAgentRouterRipAdminState=hmAgentRouterRipAdminState, hmAgentSwitchIpVlanIfIndex=hmAgentSwitchIpVlanIfIndex, hmAgentSwitchIpRouteStaticEntry=hmAgentSwitchIpRouteStaticEntry, hmAgentSwitchArpStatus=hmAgentSwitchArpStatus, hmAgentSwitchArpAgeoutTime=hmAgentSwitchArpAgeoutTime, hmAgentRipRouteRedistDistListConfigured=hmAgentRipRouteRedistDistListConfigured, hmAgentSwitchIpGroup=hmAgentSwitchIpGroup, hmAgentSwitchIpVlanSingleMacMode=hmAgentSwitchIpVlanSingleMacMode, hmAgentECMPOspfMaxPaths=hmAgentECMPOspfMaxPaths, hmVrrpExtAdvertAddress=hmVrrpExtAdvertAddress, hmAgentSwitchIpRouterDiscoveryIfIndex=hmAgentSwitchIpRouterDiscoveryIfIndex, hmAgentSwitchArpTotalEntryCountPeak=hmAgentSwitchArpTotalEntryCountPeak, hmAgentRip2InterfaceIfIndex=hmAgentRip2InterfaceIfIndex, hmAgentOspfDefaultInfoOriginateAlways=hmAgentOspfDefaultInfoOriginateAlways, hmAgentOspfVirtIfAuthKeyId=hmAgentOspfVirtIfAuthKeyId, hmAgentRipRouteRedistMatchExternal1=hmAgentRipRouteRedistMatchExternal1, hmAgentRip2IfConfAuthKeyId=hmAgentRip2IfConfAuthKeyId, hmAgentSwitchArpStaticEntryCountMax=hmAgentSwitchArpStaticEntryCountMax, hmAgentSwitchIpRoutePreferenceValue=hmAgentSwitchIpRoutePreferenceValue, hmVrrpExtDomainStatus=hmVrrpExtDomainStatus, hmAgentRipRouteRedistEntry=hmAgentRipRouteRedistEntry, hmAgentSwitchIpTableSizesGroup=hmAgentSwitchIpTableSizesGroup, hmVrrpExtIfIndex=hmVrrpExtIfIndex, hmVrrpExtTable=hmVrrpExtTable, hmAgentSwitchArpType=hmAgentSwitchArpType, hmAgentSwitchSecondaryNetMask=hmAgentSwitchSecondaryNetMask, hmAgentRouterRipConfigGroup=hmAgentRouterRipConfigGroup, hmAgentOspfDefaultMetric=hmAgentOspfDefaultMetric, hmAgentSwitchIpInterfaceSlotNum=hmAgentSwitchIpInterfaceSlotNum, hmAgentRouterRipDefaultMetric=hmAgentRouterRipDefaultMetric, hmAgentRouterRipUpdateTimerInterval=hmAgentRouterRipUpdateTimerInterval, hmAgentRipRouteRedistMatchInternal=hmAgentRipRouteRedistMatchInternal, hmAgentSwitchIpCurrentTableSizeArp=hmAgentSwitchIpCurrentTableSizeArp, hmAgentSwitchIpCurrentTableSizeMCRoutes=hmAgentSwitchIpCurrentTableSizeMCRoutes, hmAgentOspfRouteRedistTag=hmAgentOspfRouteRedistTag, hmAgentSwitchIpTableSizeArp=hmAgentSwitchIpTableSizeArp, hmAgentOspfRouteRedistEntry=hmAgentOspfRouteRedistEntry, hmAgentOspfVirtIfTable=hmAgentOspfVirtIfTable, hmAgentSwitchIpRouteStaticStatus=hmAgentSwitchIpRouteStaticStatus, hmVrrpExtDomainRole=hmVrrpExtDomainRole, hmAgentSwitchIpInterfaceTable=hmAgentSwitchIpInterfaceTable, hmAgentSwitchIpRouterDiscoveryMinAdvertisementInterval=hmAgentSwitchIpRouterDiscoveryMinAdvertisementInterval, hmAgentSwitchIpRoutePreferenceTable=hmAgentSwitchIpRoutePreferenceTable, hmAgentRip2IfConfTable=hmAgentRip2IfConfTable, hmAgentRipRouteRedistMode=hmAgentRipRouteRedistMode, hmVrrpTrackDecrement=hmVrrpTrackDecrement, hmAgentOspfRouteRedistTable=hmAgentOspfRouteRedistTable, hmAgentRouterRipDefaultInfoOriginate=hmAgentRouterRipDefaultInfoOriginate, hmAgentSwitchIpInterfaceIpAddress=hmAgentSwitchIpInterfaceIpAddress, hmAgentSwitchIpRouterDiscoveryAdvertiseMode=hmAgentSwitchIpRouterDiscoveryAdvertiseMode, hmVrrpExtNotifyLinkdown=hmVrrpExtNotifyLinkdown, PYSNMP_MODULE_ID=hmPlatform4Routing, hmAgentSwitchIpRouterDiscoveryAdvertisementLifetime=hmAgentSwitchIpRouterDiscoveryAdvertisementLifetime)
| (integer, octet_string, object_identifier) = mibBuilder.importSymbols('ASN1', 'Integer', 'OctetString', 'ObjectIdentifier')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(value_range_constraint, value_size_constraint, single_value_constraint, constraints_intersection, constraints_union) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ValueRangeConstraint', 'ValueSizeConstraint', 'SingleValueConstraint', 'ConstraintsIntersection', 'ConstraintsUnion')
(hm_platform4,) = mibBuilder.importSymbols('HIRSCHMANN-MMP4-BASICL2-MIB', 'hmPlatform4')
(ospf_virt_if_entry, ospf_if_entry) = mibBuilder.importSymbols('OSPF-MIB', 'ospfVirtIfEntry', 'ospfIfEntry')
(rip2_if_conf_entry,) = mibBuilder.importSymbols('RIPv2-MIB', 'rip2IfConfEntry')
(module_compliance, notification_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'NotificationGroup')
(gauge32, time_ticks, mib_identifier, counter32, module_identity, mib_scalar, mib_table, mib_table_row, mib_table_column, unsigned32, bits, integer32, notification_type, counter64, ip_address, iso, object_identity) = mibBuilder.importSymbols('SNMPv2-SMI', 'Gauge32', 'TimeTicks', 'MibIdentifier', 'Counter32', 'ModuleIdentity', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'Unsigned32', 'Bits', 'Integer32', 'NotificationType', 'Counter64', 'IpAddress', 'iso', 'ObjectIdentity')
(row_status, display_string, textual_convention, mac_address, truth_value) = mibBuilder.importSymbols('SNMPv2-TC', 'RowStatus', 'DisplayString', 'TextualConvention', 'MacAddress', 'TruthValue')
hm_platform4_routing = module_identity((1, 3, 6, 1, 4, 1, 248, 15, 2))
hmPlatform4Routing.setRevisions(('2005-08-18 12:00', '2003-04-02 17:00'))
if mibBuilder.loadTexts:
hmPlatform4Routing.setLastUpdated('200508181200Z')
if mibBuilder.loadTexts:
hmPlatform4Routing.setOrganization('Hirschmann Automation and Control GmbH')
hm_agent_switch_arp_group = mib_identifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 1))
hm_agent_switch_arp_ageout_time = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(15, 21600)).clone(1200)).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchArpAgeoutTime.setStatus('current')
hm_agent_switch_arp_response_time = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 2), integer32().subtype(subtypeSpec=value_range_constraint(1, 10))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchArpResponseTime.setStatus('current')
hm_agent_switch_arp_max_retries = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 3), integer32().subtype(subtypeSpec=value_range_constraint(0, 10))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchArpMaxRetries.setStatus('current')
hm_agent_switch_arp_cache_size = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 4), integer32()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchArpCacheSize.setStatus('current')
hm_agent_switch_arp_dynamic_renew = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 5), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2))).clone('enable')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchArpDynamicRenew.setStatus('current')
hm_agent_switch_arp_total_entry_count_current = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 6), gauge32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchArpTotalEntryCountCurrent.setStatus('current')
hm_agent_switch_arp_total_entry_count_peak = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 7), gauge32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchArpTotalEntryCountPeak.setStatus('current')
hm_agent_switch_arp_static_entry_count_current = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 8), gauge32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchArpStaticEntryCountCurrent.setStatus('current')
hm_agent_switch_arp_static_entry_count_max = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 9), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchArpStaticEntryCountMax.setStatus('current')
hm_agent_switch_arp_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10))
if mibBuilder.loadTexts:
hmAgentSwitchArpTable.setStatus('current')
hm_agent_switch_arp_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10, 1)).setIndexNames((0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentSwitchArpIpAddress'))
if mibBuilder.loadTexts:
hmAgentSwitchArpEntry.setStatus('current')
hm_agent_switch_arp_age = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10, 1, 1), time_ticks()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchArpAge.setStatus('current')
hm_agent_switch_arp_ip_address = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10, 1, 2), ip_address()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchArpIpAddress.setStatus('current')
hm_agent_switch_arp_mac_address = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10, 1, 3), mac_address()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hmAgentSwitchArpMacAddress.setStatus('current')
hm_agent_switch_arp_interface = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10, 1, 4), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchArpInterface.setStatus('current')
hm_agent_switch_arp_type = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10, 1, 5), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4))).clone(namedValues=named_values(('local', 1), ('gateway', 2), ('static', 3), ('dynamic', 4)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchArpType.setStatus('current')
hm_agent_switch_arp_status = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 10, 1, 6), row_status()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchArpStatus.setStatus('current')
hm_agent_switch_arp_sparse_learn = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 1, 11), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2))).clone('disable')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchArpSparseLearn.setStatus('current')
hm_agent_switch_ip_group = mib_identifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 2))
hm_agent_switch_ip_routing_mode = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 1), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpRoutingMode.setStatus('current')
hm_agent_switch_ip_vrrp_mode = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpVRRPMode.setStatus('current')
hm_agent_switch_ip_interface_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3))
if mibBuilder.loadTexts:
hmAgentSwitchIpInterfaceTable.setStatus('current')
hm_agent_switch_ip_interface_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1)).setIndexNames((0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentSwitchIpInterfaceIfIndex'))
if mibBuilder.loadTexts:
hmAgentSwitchIpInterfaceEntry.setStatus('current')
hm_agent_switch_ip_interface_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 1), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchIpInterfaceIfIndex.setStatus('current')
hm_agent_switch_ip_interface_ip_address = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 2), ip_address()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpInterfaceIpAddress.setStatus('current')
hm_agent_switch_ip_interface_net_mask = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 3), ip_address()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpInterfaceNetMask.setStatus('current')
hm_agent_switch_ip_interface_clear_ip = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 4), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpInterfaceClearIp.setStatus('current')
hm_agent_switch_ip_interface_routing_mode = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 5), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpInterfaceRoutingMode.setStatus('current')
hm_agent_switch_ip_interface_proxy_arp_mode = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 6), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2))).clone('disable')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpInterfaceProxyARPMode.setStatus('current')
hm_agent_switch_ip_interface_mtu_value = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 7), unsigned32().subtype(subtypeSpec=constraints_union(value_range_constraint(0, 0), value_range_constraint(68, 9000)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpInterfaceMtuValue.setStatus('current')
hm_agent_switch_ip_interface_slot_num = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 8), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchIpInterfaceSlotNum.setStatus('current')
hm_agent_switch_ip_interface_port_num = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 9), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchIpInterfacePortNum.setStatus('current')
hm_agent_switch_ip_interface_netdirected_bc_mode = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 3, 1, 10), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2))).clone('disable')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpInterfaceNetdirectedBCMode.setStatus('current')
hm_agent_switch_ip_router_discovery_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4))
if mibBuilder.loadTexts:
hmAgentSwitchIpRouterDiscoveryTable.setStatus('current')
hm_agent_switch_ip_router_discovery_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1)).setIndexNames((0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentSwitchIpRouterDiscoveryIfIndex'))
if mibBuilder.loadTexts:
hmAgentSwitchIpRouterDiscoveryEntry.setStatus('current')
hm_agent_switch_ip_router_discovery_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1, 1), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchIpRouterDiscoveryIfIndex.setStatus('current')
hm_agent_switch_ip_router_discovery_advertise_mode = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2))).clone('enable')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpRouterDiscoveryAdvertiseMode.setStatus('current')
hm_agent_switch_ip_router_discovery_max_advertisement_interval = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1, 3), integer32().subtype(subtypeSpec=value_range_constraint(4, 1800)).clone(600)).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpRouterDiscoveryMaxAdvertisementInterval.setStatus('current')
hm_agent_switch_ip_router_discovery_min_advertisement_interval = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1, 4), integer32().subtype(subtypeSpec=value_range_constraint(3, 1800)).clone(450)).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpRouterDiscoveryMinAdvertisementInterval.setStatus('current')
hm_agent_switch_ip_router_discovery_advertisement_lifetime = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1, 5), integer32().subtype(subtypeSpec=value_range_constraint(4, 9000)).clone(1800)).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpRouterDiscoveryAdvertisementLifetime.setStatus('current')
hm_agent_switch_ip_router_discovery_preference_level = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1, 6), integer32()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpRouterDiscoveryPreferenceLevel.setStatus('current')
hm_agent_switch_ip_router_discovery_advertisement_address = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 4, 1, 7), ip_address().clone(hexValue='E0000001')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpRouterDiscoveryAdvertisementAddress.setStatus('current')
hm_agent_switch_ip_vlan_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 5))
if mibBuilder.loadTexts:
hmAgentSwitchIpVlanTable.setStatus('current')
hm_agent_switch_ip_vlan_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 5, 1)).setIndexNames((0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentSwitchIpVlanId'))
if mibBuilder.loadTexts:
hmAgentSwitchIpVlanEntry.setStatus('current')
hm_agent_switch_ip_vlan_id = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 5, 1, 1), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchIpVlanId.setStatus('current')
hm_agent_switch_ip_vlan_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 5, 1, 2), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchIpVlanIfIndex.setStatus('current')
hm_agent_switch_ip_vlan_routing_status = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 5, 1, 3), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hmAgentSwitchIpVlanRoutingStatus.setStatus('current')
hm_agent_switch_secondary_address_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 6))
if mibBuilder.loadTexts:
hmAgentSwitchSecondaryAddressTable.setStatus('current')
hm_agent_switch_secondary_address_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 6, 1)).setIndexNames((0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentSwitchIpInterfaceIfIndex'), (0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentSwitchSecondaryIpAddress'))
if mibBuilder.loadTexts:
hmAgentSwitchSecondaryAddressEntry.setStatus('current')
hm_agent_switch_secondary_ip_address = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 6, 1, 1), ip_address())
if mibBuilder.loadTexts:
hmAgentSwitchSecondaryIpAddress.setStatus('current')
hm_agent_switch_secondary_net_mask = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 6, 1, 2), ip_address()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hmAgentSwitchSecondaryNetMask.setStatus('current')
hm_agent_switch_secondary_status = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 6, 1, 3), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hmAgentSwitchSecondaryStatus.setStatus('current')
hm_agent_switch_ip_route_preference_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 7))
if mibBuilder.loadTexts:
hmAgentSwitchIpRoutePreferenceTable.setStatus('current')
hm_agent_switch_ip_route_preference_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 7, 1)).setIndexNames((0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentSwitchIpRoutePreferenceSource'))
if mibBuilder.loadTexts:
hmAgentSwitchIpRoutePreferenceEntry.setStatus('current')
hm_agent_switch_ip_route_preference_source = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 7, 1, 1), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4, 5, 6, 7))).clone(namedValues=named_values(('connected', 1), ('static', 2), ('ospf-intra', 3), ('ospf-inter', 4), ('ospf-ext-t1', 5), ('ospf-ext-t2', 6), ('rip', 7)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchIpRoutePreferenceSource.setStatus('current')
hm_agent_switch_ip_route_preference_value = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 7, 1, 2), integer32().subtype(subtypeSpec=value_range_constraint(0, 255))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpRoutePreferenceValue.setStatus('current')
hm_agent_switch_ip_route_static_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8))
if mibBuilder.loadTexts:
hmAgentSwitchIpRouteStaticTable.setStatus('current')
hm_agent_switch_ip_route_static_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8, 1)).setIndexNames((0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentSwitchIpRouteStaticDestination'), (0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentSwitchIpRouteStaticDestinationMask'), (0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentSwitchIpRouteStaticNextHop'))
if mibBuilder.loadTexts:
hmAgentSwitchIpRouteStaticEntry.setStatus('current')
hm_agent_switch_ip_route_static_destination = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8, 1, 1), ip_address())
if mibBuilder.loadTexts:
hmAgentSwitchIpRouteStaticDestination.setStatus('current')
hm_agent_switch_ip_route_static_destination_mask = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8, 1, 2), ip_address())
if mibBuilder.loadTexts:
hmAgentSwitchIpRouteStaticDestinationMask.setStatus('current')
hm_agent_switch_ip_route_static_next_hop = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8, 1, 3), ip_address())
if mibBuilder.loadTexts:
hmAgentSwitchIpRouteStaticNextHop.setStatus('current')
hm_agent_switch_ip_route_static_preference = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8, 1, 4), integer32().subtype(subtypeSpec=value_range_constraint(1, 255))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpRouteStaticPreference.setStatus('current')
hm_agent_switch_ip_route_static_status = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8, 1, 5), row_status()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpRouteStaticStatus.setStatus('current')
hm_agent_switch_ip_route_static_track_id = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 8, 1, 6), integer32().subtype(subtypeSpec=value_range_constraint(0, 65535))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpRouteStaticTrackId.setStatus('current')
hm_agent_switch_ip_vlan_single_mac_mode = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 100), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpVlanSingleMacMode.setStatus('current')
hm_agent_switch_ip_table_sizes_group = mib_identifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 101))
hm_agent_switch_ip_table_size_arp = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 101, 1), integer32().subtype(subtypeSpec=value_range_constraint(300, 4096))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpTableSizeArp.setStatus('current')
hm_agent_switch_ip_table_size_uc_routes = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 101, 2), integer32().subtype(subtypeSpec=value_range_constraint(300, 4096))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpTableSizeUCRoutes.setStatus('current')
hm_agent_switch_ip_table_size_mc_routes = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 101, 3), integer32().subtype(subtypeSpec=value_range_constraint(0, 512))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSwitchIpTableSizeMCRoutes.setStatus('current')
hm_agent_switch_ip_current_table_size_arp = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 101, 4), integer32().subtype(subtypeSpec=value_range_constraint(300, 4096))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchIpCurrentTableSizeArp.setStatus('current')
hm_agent_switch_ip_current_table_size_uc_routes = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 101, 5), integer32().subtype(subtypeSpec=value_range_constraint(300, 4096))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchIpCurrentTableSizeUCRoutes.setStatus('current')
hm_agent_switch_ip_current_table_size_mc_routes = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 2, 101, 6), integer32().subtype(subtypeSpec=value_range_constraint(0, 512))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentSwitchIpCurrentTableSizeMCRoutes.setStatus('current')
hm_agent_router_rip_config_group = mib_identifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 3))
hm_agent_router_rip_admin_state = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 1), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRouterRipAdminState.setStatus('current')
hm_agent_router_rip_split_horizon_mode = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('none', 1), ('simple', 2), ('poisonReverse', 3))).clone('simple')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRouterRipSplitHorizonMode.setStatus('current')
hm_agent_router_rip_auto_summary_mode = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 3), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2))).clone('enable')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRouterRipAutoSummaryMode.setStatus('current')
hm_agent_router_rip_host_routes_accept_mode = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 4), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2))).clone('enable')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRouterRipHostRoutesAcceptMode.setStatus('current')
hm_agent_router_rip_default_metric = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 5), integer32().subtype(subtypeSpec=value_range_constraint(0, 15))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRouterRipDefaultMetric.setStatus('current')
hm_agent_router_rip_default_metric_configured = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 6), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRouterRipDefaultMetricConfigured.setStatus('current')
hm_agent_router_rip_default_info_originate = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 7), truth_value().clone('false')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRouterRipDefaultInfoOriginate.setStatus('current')
hm_agent_rip_route_redist_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8))
if mibBuilder.loadTexts:
hmAgentRipRouteRedistTable.setStatus('current')
hm_agent_rip_route_redist_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1)).setIndexNames((0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentRipRouteRedistSource'))
if mibBuilder.loadTexts:
hmAgentRipRouteRedistEntry.setStatus('current')
hm_agent_rip_route_redist_source = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 1), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4))).clone(namedValues=named_values(('connected', 1), ('static', 2), ('ospf', 3), ('bgp', 4)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentRipRouteRedistSource.setStatus('current')
hm_agent_rip_route_redist_mode = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2))).clone('disable')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRipRouteRedistMode.setStatus('current')
hm_agent_rip_route_redist_metric = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 3), integer32().subtype(subtypeSpec=value_range_constraint(0, 15))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRipRouteRedistMetric.setStatus('current')
hm_agent_rip_route_redist_metric_configured = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 4), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRipRouteRedistMetricConfigured.setStatus('current')
hm_agent_rip_route_redist_match_internal = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 5), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('true', 1), ('false', 2), ('not-applicable', 3)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRipRouteRedistMatchInternal.setStatus('current')
hm_agent_rip_route_redist_match_external1 = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 6), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('true', 1), ('false', 2), ('not-applicable', 3)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRipRouteRedistMatchExternal1.setStatus('current')
hm_agent_rip_route_redist_match_external2 = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 7), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('true', 1), ('false', 2), ('not-applicable', 3)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRipRouteRedistMatchExternal2.setStatus('current')
hm_agent_rip_route_redist_match_nssa_external1 = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 8), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('true', 1), ('false', 2), ('not-applicable', 3)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRipRouteRedistMatchNSSAExternal1.setStatus('current')
hm_agent_rip_route_redist_match_nssa_external2 = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 9), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('true', 1), ('false', 2), ('not-applicable', 3)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRipRouteRedistMatchNSSAExternal2.setStatus('current')
hm_agent_rip_route_redist_dist_list = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 10), unsigned32().subtype(subtypeSpec=value_range_constraint(1, 199))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRipRouteRedistDistList.setStatus('current')
hm_agent_rip_route_redist_dist_list_configured = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 8, 1, 11), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRipRouteRedistDistListConfigured.setStatus('current')
hm_agent_rip2_if_conf_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 9))
if mibBuilder.loadTexts:
hmAgentRip2IfConfTable.setStatus('current')
hm_agent_rip2_if_conf_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 9, 1))
rip2IfConfEntry.registerAugmentions(('HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentRip2IfConfEntry'))
hmAgentRip2IfConfEntry.setIndexNames(*rip2IfConfEntry.getIndexNames())
if mibBuilder.loadTexts:
hmAgentRip2IfConfEntry.setStatus('current')
hm_agent_rip2_if_conf_auth_key_id = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 9, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(0, 255))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hmAgentRip2IfConfAuthKeyId.setStatus('current')
hm_agent_rip2_interface_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10))
if mibBuilder.loadTexts:
hmAgentRip2InterfaceTable.setStatus('current')
hm_agent_rip2_interface_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1)).setIndexNames((0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentRip2InterfaceIfIndex'))
if mibBuilder.loadTexts:
hmAgentRip2InterfaceEntry.setStatus('current')
hm_agent_rip2_interface_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 1), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentRip2InterfaceIfIndex.setStatus('current')
hm_agent_rip2_interface_auth_type = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('noAuthentication', 1), ('simplePassword', 2), ('md5', 3)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRip2InterfaceAuthType.setStatus('current')
hm_agent_rip2_interface_auth_key = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 3), octet_string().subtype(subtypeSpec=value_size_constraint(0, 16))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRip2InterfaceAuthKey.setStatus('current')
hm_agent_rip2_interface_auth_key_id = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 4), integer32().subtype(subtypeSpec=value_range_constraint(0, 255))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRip2InterfaceAuthKeyId.setStatus('current')
hm_agent_rip2_interface_send_version = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 5), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4))).clone(namedValues=named_values(('doNotSend', 1), ('ripVersion1', 2), ('rip1Compatible', 3), ('ripVersion2', 4)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRip2InterfaceSendVersion.setStatus('current')
hm_agent_rip2_interface_receive_version = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 6), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4))).clone(namedValues=named_values(('rip1', 1), ('rip2', 2), ('rip1OrRip2', 3), ('doNotReceive', 4)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRip2InterfaceReceiveVersion.setStatus('current')
hm_agent_rip2_interface_admin_state = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 7), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRip2InterfaceAdminState.setStatus('current')
hm_agent_rip2_rcv_bad_packets = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 8), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentRip2RcvBadPackets.setStatus('current')
hm_agent_rip2_rcv_bad_routes = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 9), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentRip2RcvBadRoutes.setStatus('current')
hm_agent_rip2_sent_updates = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 10, 1, 10), counter32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentRip2SentUpdates.setStatus('current')
hm_agent_router_rip_update_timer_interval = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 3, 50), integer32().subtype(subtypeSpec=value_range_constraint(1, 1000)).clone(30)).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRouterRipUpdateTimerInterval.setStatus('current')
hm_agent_router_ospf_config_group = mib_identifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 4))
hm_agent_ospf_default_metric = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 1), integer32().subtype(subtypeSpec=value_range_constraint(1, 16777215))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfDefaultMetric.setStatus('current')
hm_agent_ospf_default_metric_configured = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 2), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfDefaultMetricConfigured.setStatus('current')
hm_agent_ospf_default_info_originate = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 3), truth_value().clone('false')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfDefaultInfoOriginate.setStatus('current')
hm_agent_ospf_default_info_originate_always = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 4), truth_value().clone('false')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfDefaultInfoOriginateAlways.setStatus('current')
hm_agent_ospf_default_info_originate_metric = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 5), integer32().subtype(subtypeSpec=value_range_constraint(0, 16777215)).clone(10)).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfDefaultInfoOriginateMetric.setStatus('current')
hm_agent_ospf_default_info_originate_metric_configured = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 6), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfDefaultInfoOriginateMetricConfigured.setStatus('current')
hm_agent_ospf_default_info_originate_metric_type = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 7), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('externalType1', 1), ('externalType2', 2))).clone(2)).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfDefaultInfoOriginateMetricType.setStatus('current')
hm_agent_ospf_route_redist_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8))
if mibBuilder.loadTexts:
hmAgentOspfRouteRedistTable.setStatus('current')
hm_agent_ospf_route_redist_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1)).setIndexNames((0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentOspfRouteRedistSource'))
if mibBuilder.loadTexts:
hmAgentOspfRouteRedistEntry.setStatus('current')
hm_agent_ospf_route_redist_source = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 1), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4))).clone(namedValues=named_values(('connected', 1), ('static', 2), ('rip', 3), ('bgp', 4)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmAgentOspfRouteRedistSource.setStatus('current')
hm_agent_ospf_route_redist_mode = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2))).clone('disable')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfRouteRedistMode.setStatus('current')
hm_agent_ospf_route_redist_metric = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 3), integer32().subtype(subtypeSpec=value_range_constraint(0, 16777215))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfRouteRedistMetric.setStatus('current')
hm_agent_ospf_route_redist_metric_configured = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 4), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfRouteRedistMetricConfigured.setStatus('current')
hm_agent_ospf_route_redist_metric_type = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 5), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('externalType1', 1), ('externalType2', 2))).clone('externalType2')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfRouteRedistMetricType.setStatus('current')
hm_agent_ospf_route_redist_tag = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 6), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 4294967295))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfRouteRedistTag.setStatus('current')
hm_agent_ospf_route_redist_subnets = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 7), truth_value().clone('false')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfRouteRedistSubnets.setStatus('current')
hm_agent_ospf_route_redist_dist_list = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 8), unsigned32().subtype(subtypeSpec=value_range_constraint(1, 199))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfRouteRedistDistList.setStatus('current')
hm_agent_ospf_route_redist_dist_list_configured = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 8, 1, 9), truth_value()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfRouteRedistDistListConfigured.setStatus('current')
hm_agent_ospf_if_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 9))
if mibBuilder.loadTexts:
hmAgentOspfIfTable.setStatus('current')
hm_agent_ospf_if_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 9, 1))
ospfIfEntry.registerAugmentions(('HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentOspfIfEntry'))
hmAgentOspfIfEntry.setIndexNames(*ospfIfEntry.getIndexNames())
if mibBuilder.loadTexts:
hmAgentOspfIfEntry.setStatus('current')
hm_agent_ospf_if_auth_key_id = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 9, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(0, 255))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hmAgentOspfIfAuthKeyId.setStatus('current')
hm_agent_ospf_if_ip_mtu_ignore_flag = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 9, 1, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentOspfIfIpMtuIgnoreFlag.setStatus('current')
hm_agent_ospf_virt_if_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 10))
if mibBuilder.loadTexts:
hmAgentOspfVirtIfTable.setStatus('current')
hm_agent_ospf_virt_if_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 10, 1))
ospfVirtIfEntry.registerAugmentions(('HIRSCHMANN-MMP4-ROUTING-MIB', 'hmAgentOspfVirtIfEntry'))
hmAgentOspfVirtIfEntry.setIndexNames(*ospfVirtIfEntry.getIndexNames())
if mibBuilder.loadTexts:
hmAgentOspfVirtIfEntry.setStatus('current')
hm_agent_ospf_virt_if_auth_key_id = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 10, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(0, 255))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hmAgentOspfVirtIfAuthKeyId.setStatus('current')
hm_agent_router_ospf_rfc1583_compatibility_mode = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 4, 11), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2))).clone('enable')).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRouterOspfRFC1583CompatibilityMode.setStatus('current')
hm_agent_snmp_trap_flags_config_group_layer3 = mib_identifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 5))
hm_agent_snmp_vrrp_new_master_trap_flag = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 5, 1), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSnmpVRRPNewMasterTrapFlag.setStatus('current')
hm_agent_snmp_vrrp_auth_failure_trap_flag = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 5, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentSnmpVRRPAuthFailureTrapFlag.setStatus('current')
hm_agent_ecmp_group = mib_identifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 7))
hm_agent_ecmp_ospf_max_paths = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 7, 1), integer32().clone(4)).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentECMPOspfMaxPaths.setStatus('current')
hm_agent_router_vrrp_config_group = mib_identifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 8))
hm_agent_router_vrrp_admin_state = mib_scalar((1, 3, 6, 1, 4, 1, 248, 15, 2, 8, 1), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmAgentRouterVrrpAdminState.setStatus('current')
hm_vrrp_ext_group = mib_identifier((1, 3, 6, 1, 4, 1, 248, 15, 2, 9))
hm_vrrp_tracking_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1))
if mibBuilder.loadTexts:
hmVrrpTrackingTable.setStatus('current')
hm_vrrp_tracking_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1, 1)).setIndexNames((0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmVrrpTrackIfIndex'), (0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmVrrpTrackVrid'), (0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmVrrpTrackId'))
if mibBuilder.loadTexts:
hmVrrpTrackingEntry.setStatus('current')
hm_vrrp_track_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1, 1, 1), integer32())
if mibBuilder.loadTexts:
hmVrrpTrackIfIndex.setStatus('current')
hm_vrrp_track_vrid = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1, 1, 2), integer32().subtype(subtypeSpec=value_range_constraint(1, 255)))
if mibBuilder.loadTexts:
hmVrrpTrackVrid.setStatus('current')
hm_vrrp_track_id = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1, 1, 3), integer32())
if mibBuilder.loadTexts:
hmVrrpTrackId.setStatus('current')
hm_vrrp_track_decrement = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1, 1, 4), integer32().subtype(subtypeSpec=value_range_constraint(1, 253))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmVrrpTrackDecrement.setStatus('current')
hm_vrrp_track_oper_status = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1, 1, 5), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('up', 1), ('down', 2)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmVrrpTrackOperStatus.setStatus('current')
hm_vrrp_track_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 1, 1, 6), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
hmVrrpTrackRowStatus.setStatus('current')
hm_vrrp_ext_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2))
if mibBuilder.loadTexts:
hmVrrpExtTable.setStatus('current')
hm_vrrp_ext_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1)).setIndexNames((0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmVrrpExtIfIndex'), (0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmVrrpExtVrid'))
if mibBuilder.loadTexts:
hmVrrpExtEntry.setStatus('current')
hm_vrrp_ext_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 1), integer32())
if mibBuilder.loadTexts:
hmVrrpExtIfIndex.setStatus('current')
hm_vrrp_ext_vrid = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 2), integer32().subtype(subtypeSpec=value_range_constraint(1, 255)))
if mibBuilder.loadTexts:
hmVrrpExtVrid.setStatus('current')
hm_vrrp_ext_domain_id = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 3), integer32().subtype(subtypeSpec=value_range_constraint(0, 8))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmVrrpExtDomainId.setStatus('current')
hm_vrrp_ext_domain_role = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 4), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('none', 1), ('member', 2), ('supervisor', 3)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmVrrpExtDomainRole.setStatus('current')
hm_vrrp_ext_domain_status = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 5), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('noError', 1), ('noSupervisor', 2), ('supervisorDown', 3)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmVrrpExtDomainStatus.setStatus('current')
hm_vrrp_ext_advert_address = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 6), ip_address()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmVrrpExtAdvertAddress.setStatus('current')
hm_vrrp_ext_advert_timer = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 7), integer32().subtype(subtypeSpec=value_range_constraint(100, 255000))).setUnits('milliseconds').setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmVrrpExtAdvertTimer.setStatus('current')
hm_vrrp_ext_oper_priority = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 8), integer32().subtype(subtypeSpec=value_range_constraint(1, 255))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmVrrpExtOperPriority.setStatus('current')
hm_vrrp_ext_notify_address = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 9), ip_address()).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmVrrpExtNotifyAddress.setStatus('current')
hm_vrrp_ext_notify_linkdown = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 10), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enable', 1), ('disable', 2)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmVrrpExtNotifyLinkdown.setStatus('current')
hm_vrrp_ext_preemption_delay = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 2, 1, 11), integer32().subtype(subtypeSpec=value_range_constraint(0, 65535))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmVrrpExtPreemptionDelay.setStatus('current')
hm_vrrp_domain_table = mib_table((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3))
if mibBuilder.loadTexts:
hmVrrpDomainTable.setStatus('current')
hm_vrrp_domain_entry = mib_table_row((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1)).setIndexNames((0, 'HIRSCHMANN-MMP4-ROUTING-MIB', 'hmVrrpDomainId'))
if mibBuilder.loadTexts:
hmVrrpDomainEntry.setStatus('current')
hm_vrrp_domain_id = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1, 1), integer32().subtype(subtypeSpec=value_range_constraint(0, 8)))
if mibBuilder.loadTexts:
hmVrrpDomainId.setStatus('current')
hm_vrrp_domain_member_send_adv = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('enabled', 1), ('disabled', 2)))).setMaxAccess('readwrite')
if mibBuilder.loadTexts:
hmVrrpDomainMemberSendAdv.setStatus('current')
hm_vrrp_domain_status = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1, 3), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('noError', 1), ('noSupervisor', 2), ('supervisorDown', 3)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmVrrpDomainStatus.setStatus('current')
hm_vrrp_domain_supervisor_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1, 4), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmVrrpDomainSupervisorIfIndex.setStatus('current')
hm_vrrp_domain_supervisor_vrid = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1, 5), integer32().subtype(subtypeSpec=value_range_constraint(0, 255))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmVrrpDomainSupervisorVrid.setStatus('current')
hm_vrrp_domain_oper_priority = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1, 6), integer32().subtype(subtypeSpec=value_range_constraint(0, 255))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmVrrpDomainOperPriority.setStatus('current')
hm_vrrp_domain_supervisor_oper_state = mib_table_column((1, 3, 6, 1, 4, 1, 248, 15, 2, 9, 3, 1, 7), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4))).clone(namedValues=named_values(('initialize', 1), ('backup', 2), ('master', 3), ('unknown', 4)))).setMaxAccess('readonly')
if mibBuilder.loadTexts:
hmVrrpDomainSupervisorOperState.setStatus('current')
mibBuilder.exportSymbols('HIRSCHMANN-MMP4-ROUTING-MIB', hmAgentOspfDefaultInfoOriginateMetricType=hmAgentOspfDefaultInfoOriginateMetricType, hmAgentRouterOspfRFC1583CompatibilityMode=hmAgentRouterOspfRFC1583CompatibilityMode, hmAgentSwitchIpRouteStaticDestinationMask=hmAgentSwitchIpRouteStaticDestinationMask, hmAgentOspfRouteRedistMetricConfigured=hmAgentOspfRouteRedistMetricConfigured, hmAgentSwitchSecondaryAddressEntry=hmAgentSwitchSecondaryAddressEntry, hmAgentOspfIfEntry=hmAgentOspfIfEntry, hmVrrpDomainEntry=hmVrrpDomainEntry, hmVrrpDomainOperPriority=hmVrrpDomainOperPriority, hmAgentSwitchArpAge=hmAgentSwitchArpAge, hmAgentOspfRouteRedistSource=hmAgentOspfRouteRedistSource, hmAgentRipRouteRedistTable=hmAgentRipRouteRedistTable, hmAgentRipRouteRedistMatchExternal2=hmAgentRipRouteRedistMatchExternal2, hmAgentRipRouteRedistDistList=hmAgentRipRouteRedistDistList, hmVrrpExtPreemptionDelay=hmVrrpExtPreemptionDelay, hmVrrpTrackRowStatus=hmVrrpTrackRowStatus, hmAgentOspfIfIpMtuIgnoreFlag=hmAgentOspfIfIpMtuIgnoreFlag, hmAgentSwitchIpRouterDiscoveryPreferenceLevel=hmAgentSwitchIpRouterDiscoveryPreferenceLevel, hmVrrpExtVrid=hmVrrpExtVrid, hmAgentRipRouteRedistMetricConfigured=hmAgentRipRouteRedistMetricConfigured, hmAgentSwitchIpRouteStaticPreference=hmAgentSwitchIpRouteStaticPreference, hmAgentRip2InterfaceTable=hmAgentRip2InterfaceTable, hmAgentRip2RcvBadPackets=hmAgentRip2RcvBadPackets, hmAgentOspfIfTable=hmAgentOspfIfTable, hmAgentRip2InterfaceEntry=hmAgentRip2InterfaceEntry, hmAgentSwitchIpInterfaceRoutingMode=hmAgentSwitchIpInterfaceRoutingMode, hmAgentSwitchIpVlanTable=hmAgentSwitchIpVlanTable, hmAgentOspfRouteRedistMetricType=hmAgentOspfRouteRedistMetricType, hmAgentSwitchArpEntry=hmAgentSwitchArpEntry, hmAgentSwitchIpRoutingMode=hmAgentSwitchIpRoutingMode, hmAgentSwitchIpCurrentTableSizeUCRoutes=hmAgentSwitchIpCurrentTableSizeUCRoutes, hmVrrpDomainStatus=hmVrrpDomainStatus, hmAgentRip2InterfaceReceiveVersion=hmAgentRip2InterfaceReceiveVersion, hmAgentSwitchIpRouterDiscoveryMaxAdvertisementInterval=hmAgentSwitchIpRouterDiscoveryMaxAdvertisementInterval, hmAgentSwitchIpRouteStaticNextHop=hmAgentSwitchIpRouteStaticNextHop, hmAgentSwitchArpTotalEntryCountCurrent=hmAgentSwitchArpTotalEntryCountCurrent, hmAgentSwitchIpInterfaceProxyARPMode=hmAgentSwitchIpInterfaceProxyARPMode, hmAgentSnmpVRRPAuthFailureTrapFlag=hmAgentSnmpVRRPAuthFailureTrapFlag, hmAgentOspfDefaultMetricConfigured=hmAgentOspfDefaultMetricConfigured, hmAgentSnmpTrapFlagsConfigGroupLayer3=hmAgentSnmpTrapFlagsConfigGroupLayer3, hmAgentRip2InterfaceAdminState=hmAgentRip2InterfaceAdminState, hmVrrpExtOperPriority=hmVrrpExtOperPriority, hmAgentSwitchIpInterfaceNetdirectedBCMode=hmAgentSwitchIpInterfaceNetdirectedBCMode, hmAgentRouterVrrpConfigGroup=hmAgentRouterVrrpConfigGroup, hmVrrpDomainMemberSendAdv=hmVrrpDomainMemberSendAdv, hmAgentRip2IfConfEntry=hmAgentRip2IfConfEntry, hmAgentRipRouteRedistSource=hmAgentRipRouteRedistSource, hmAgentSnmpVRRPNewMasterTrapFlag=hmAgentSnmpVRRPNewMasterTrapFlag, hmVrrpExtEntry=hmVrrpExtEntry, hmAgentOspfRouteRedistMode=hmAgentOspfRouteRedistMode, hmVrrpTrackId=hmVrrpTrackId, hmAgentSwitchArpCacheSize=hmAgentSwitchArpCacheSize, hmAgentRouterRipAutoSummaryMode=hmAgentRouterRipAutoSummaryMode, hmAgentSwitchArpResponseTime=hmAgentSwitchArpResponseTime, hmAgentSwitchIpRoutePreferenceEntry=hmAgentSwitchIpRoutePreferenceEntry, hmAgentRip2InterfaceAuthType=hmAgentRip2InterfaceAuthType, hmAgentSwitchIpVlanEntry=hmAgentSwitchIpVlanEntry, hmAgentRouterRipSplitHorizonMode=hmAgentRouterRipSplitHorizonMode, hmAgentSwitchIpVRRPMode=hmAgentSwitchIpVRRPMode, hmAgentSwitchIpRouterDiscoveryAdvertisementAddress=hmAgentSwitchIpRouterDiscoveryAdvertisementAddress, hmAgentRouterRipDefaultMetricConfigured=hmAgentRouterRipDefaultMetricConfigured, hmAgentOspfDefaultInfoOriginate=hmAgentOspfDefaultInfoOriginate, hmAgentOspfVirtIfEntry=hmAgentOspfVirtIfEntry, hmVrrpExtNotifyAddress=hmVrrpExtNotifyAddress, hmVrrpExtGroup=hmVrrpExtGroup, hmAgentSwitchIpRoutePreferenceSource=hmAgentSwitchIpRoutePreferenceSource, hmVrrpDomainSupervisorVrid=hmVrrpDomainSupervisorVrid, hmAgentSwitchArpInterface=hmAgentSwitchArpInterface, hmAgentOspfRouteRedistMetric=hmAgentOspfRouteRedistMetric, hmVrrpDomainTable=hmVrrpDomainTable, hmAgentSwitchIpInterfaceClearIp=hmAgentSwitchIpInterfaceClearIp, hmAgentSwitchIpRouteStaticTable=hmAgentSwitchIpRouteStaticTable, hmVrrpExtDomainId=hmVrrpExtDomainId, hmAgentSwitchIpRouteStaticDestination=hmAgentSwitchIpRouteStaticDestination, hmAgentSwitchSecondaryIpAddress=hmAgentSwitchSecondaryIpAddress, hmAgentRip2InterfaceAuthKey=hmAgentRip2InterfaceAuthKey, hmAgentSwitchArpGroup=hmAgentSwitchArpGroup, hmAgentSwitchIpInterfaceNetMask=hmAgentSwitchIpInterfaceNetMask, hmAgentRipRouteRedistMatchNSSAExternal1=hmAgentRipRouteRedistMatchNSSAExternal1, hmPlatform4Routing=hmPlatform4Routing, hmAgentRip2SentUpdates=hmAgentRip2SentUpdates, hmAgentRipRouteRedistMetric=hmAgentRipRouteRedistMetric, hmAgentSwitchArpSparseLearn=hmAgentSwitchArpSparseLearn, hmAgentSwitchIpTableSizeMCRoutes=hmAgentSwitchIpTableSizeMCRoutes, hmAgentSwitchArpDynamicRenew=hmAgentSwitchArpDynamicRenew, hmAgentSwitchArpIpAddress=hmAgentSwitchArpIpAddress, hmVrrpTrackIfIndex=hmVrrpTrackIfIndex, hmAgentRip2RcvBadRoutes=hmAgentRip2RcvBadRoutes, hmAgentOspfRouteRedistSubnets=hmAgentOspfRouteRedistSubnets, hmAgentSwitchArpMacAddress=hmAgentSwitchArpMacAddress, hmAgentOspfRouteRedistDistList=hmAgentOspfRouteRedistDistList, hmVrrpDomainSupervisorIfIndex=hmVrrpDomainSupervisorIfIndex, hmAgentSwitchArpTable=hmAgentSwitchArpTable, hmVrrpDomainSupervisorOperState=hmVrrpDomainSupervisorOperState, hmVrrpTrackOperStatus=hmVrrpTrackOperStatus, hmAgentRouterRipHostRoutesAcceptMode=hmAgentRouterRipHostRoutesAcceptMode, hmVrrpExtAdvertTimer=hmVrrpExtAdvertTimer, hmAgentRouterVrrpAdminState=hmAgentRouterVrrpAdminState, hmVrrpTrackingEntry=hmVrrpTrackingEntry, hmAgentSwitchArpMaxRetries=hmAgentSwitchArpMaxRetries, hmAgentSwitchIpRouterDiscoveryEntry=hmAgentSwitchIpRouterDiscoveryEntry, hmAgentRipRouteRedistMatchNSSAExternal2=hmAgentRipRouteRedistMatchNSSAExternal2, hmAgentSwitchIpInterfaceEntry=hmAgentSwitchIpInterfaceEntry, hmAgentSwitchArpStaticEntryCountCurrent=hmAgentSwitchArpStaticEntryCountCurrent, hmAgentECMPGroup=hmAgentECMPGroup, hmAgentOspfIfAuthKeyId=hmAgentOspfIfAuthKeyId, hmAgentSwitchIpInterfaceIfIndex=hmAgentSwitchIpInterfaceIfIndex, hmAgentSwitchIpRouterDiscoveryTable=hmAgentSwitchIpRouterDiscoveryTable, hmAgentSwitchSecondaryStatus=hmAgentSwitchSecondaryStatus, hmAgentSwitchIpRouteStaticTrackId=hmAgentSwitchIpRouteStaticTrackId, hmAgentRip2InterfaceSendVersion=hmAgentRip2InterfaceSendVersion, hmAgentSwitchIpVlanId=hmAgentSwitchIpVlanId, hmAgentSwitchIpInterfacePortNum=hmAgentSwitchIpInterfacePortNum, hmVrrpTrackVrid=hmVrrpTrackVrid, hmAgentSwitchIpTableSizeUCRoutes=hmAgentSwitchIpTableSizeUCRoutes, hmAgentOspfDefaultInfoOriginateMetric=hmAgentOspfDefaultInfoOriginateMetric, hmAgentSwitchIpVlanRoutingStatus=hmAgentSwitchIpVlanRoutingStatus, hmVrrpDomainId=hmVrrpDomainId, hmAgentRouterOspfConfigGroup=hmAgentRouterOspfConfigGroup, hmAgentOspfRouteRedistDistListConfigured=hmAgentOspfRouteRedistDistListConfigured, hmVrrpTrackingTable=hmVrrpTrackingTable, hmAgentSwitchSecondaryAddressTable=hmAgentSwitchSecondaryAddressTable, hmAgentSwitchIpInterfaceMtuValue=hmAgentSwitchIpInterfaceMtuValue, hmAgentOspfDefaultInfoOriginateMetricConfigured=hmAgentOspfDefaultInfoOriginateMetricConfigured, hmAgentRip2InterfaceAuthKeyId=hmAgentRip2InterfaceAuthKeyId, hmAgentRouterRipAdminState=hmAgentRouterRipAdminState, hmAgentSwitchIpVlanIfIndex=hmAgentSwitchIpVlanIfIndex, hmAgentSwitchIpRouteStaticEntry=hmAgentSwitchIpRouteStaticEntry, hmAgentSwitchArpStatus=hmAgentSwitchArpStatus, hmAgentSwitchArpAgeoutTime=hmAgentSwitchArpAgeoutTime, hmAgentRipRouteRedistDistListConfigured=hmAgentRipRouteRedistDistListConfigured, hmAgentSwitchIpGroup=hmAgentSwitchIpGroup, hmAgentSwitchIpVlanSingleMacMode=hmAgentSwitchIpVlanSingleMacMode, hmAgentECMPOspfMaxPaths=hmAgentECMPOspfMaxPaths, hmVrrpExtAdvertAddress=hmVrrpExtAdvertAddress, hmAgentSwitchIpRouterDiscoveryIfIndex=hmAgentSwitchIpRouterDiscoveryIfIndex, hmAgentSwitchArpTotalEntryCountPeak=hmAgentSwitchArpTotalEntryCountPeak, hmAgentRip2InterfaceIfIndex=hmAgentRip2InterfaceIfIndex, hmAgentOspfDefaultInfoOriginateAlways=hmAgentOspfDefaultInfoOriginateAlways, hmAgentOspfVirtIfAuthKeyId=hmAgentOspfVirtIfAuthKeyId, hmAgentRipRouteRedistMatchExternal1=hmAgentRipRouteRedistMatchExternal1, hmAgentRip2IfConfAuthKeyId=hmAgentRip2IfConfAuthKeyId, hmAgentSwitchArpStaticEntryCountMax=hmAgentSwitchArpStaticEntryCountMax, hmAgentSwitchIpRoutePreferenceValue=hmAgentSwitchIpRoutePreferenceValue, hmVrrpExtDomainStatus=hmVrrpExtDomainStatus, hmAgentRipRouteRedistEntry=hmAgentRipRouteRedistEntry, hmAgentSwitchIpTableSizesGroup=hmAgentSwitchIpTableSizesGroup, hmVrrpExtIfIndex=hmVrrpExtIfIndex, hmVrrpExtTable=hmVrrpExtTable, hmAgentSwitchArpType=hmAgentSwitchArpType, hmAgentSwitchSecondaryNetMask=hmAgentSwitchSecondaryNetMask, hmAgentRouterRipConfigGroup=hmAgentRouterRipConfigGroup, hmAgentOspfDefaultMetric=hmAgentOspfDefaultMetric, hmAgentSwitchIpInterfaceSlotNum=hmAgentSwitchIpInterfaceSlotNum, hmAgentRouterRipDefaultMetric=hmAgentRouterRipDefaultMetric, hmAgentRouterRipUpdateTimerInterval=hmAgentRouterRipUpdateTimerInterval, hmAgentRipRouteRedistMatchInternal=hmAgentRipRouteRedistMatchInternal, hmAgentSwitchIpCurrentTableSizeArp=hmAgentSwitchIpCurrentTableSizeArp, hmAgentSwitchIpCurrentTableSizeMCRoutes=hmAgentSwitchIpCurrentTableSizeMCRoutes, hmAgentOspfRouteRedistTag=hmAgentOspfRouteRedistTag, hmAgentSwitchIpTableSizeArp=hmAgentSwitchIpTableSizeArp, hmAgentOspfRouteRedistEntry=hmAgentOspfRouteRedistEntry, hmAgentOspfVirtIfTable=hmAgentOspfVirtIfTable, hmAgentSwitchIpRouteStaticStatus=hmAgentSwitchIpRouteStaticStatus, hmVrrpExtDomainRole=hmVrrpExtDomainRole, hmAgentSwitchIpInterfaceTable=hmAgentSwitchIpInterfaceTable, hmAgentSwitchIpRouterDiscoveryMinAdvertisementInterval=hmAgentSwitchIpRouterDiscoveryMinAdvertisementInterval, hmAgentSwitchIpRoutePreferenceTable=hmAgentSwitchIpRoutePreferenceTable, hmAgentRip2IfConfTable=hmAgentRip2IfConfTable, hmAgentRipRouteRedistMode=hmAgentRipRouteRedistMode, hmVrrpTrackDecrement=hmVrrpTrackDecrement, hmAgentOspfRouteRedistTable=hmAgentOspfRouteRedistTable, hmAgentRouterRipDefaultInfoOriginate=hmAgentRouterRipDefaultInfoOriginate, hmAgentSwitchIpInterfaceIpAddress=hmAgentSwitchIpInterfaceIpAddress, hmAgentSwitchIpRouterDiscoveryAdvertiseMode=hmAgentSwitchIpRouterDiscoveryAdvertiseMode, hmVrrpExtNotifyLinkdown=hmVrrpExtNotifyLinkdown, PYSNMP_MODULE_ID=hmPlatform4Routing, hmAgentSwitchIpRouterDiscoveryAdvertisementLifetime=hmAgentSwitchIpRouterDiscoveryAdvertisementLifetime) |
def feuer_frei(concentration, barrels):
fuel_hours = barrels * concentration
if fuel_hours < 100:
return '{} Stunden mehr Benzin ben\xf6tigt.'.format(100 - fuel_hours)
elif fuel_hours == 100:
return 'Perfekt!'
return fuel_hours - 100
| def feuer_frei(concentration, barrels):
fuel_hours = barrels * concentration
if fuel_hours < 100:
return '{} Stunden mehr Benzin benötigt.'.format(100 - fuel_hours)
elif fuel_hours == 100:
return 'Perfekt!'
return fuel_hours - 100 |
# Part 1
a_list = [1, 2, 3, 4, 5]
a = a_list[1]
b = a_list[3]
print(a)
print(b)
# Part 2
a_string = "FIT2085"
print(a_string[a])
print(a_string[b])
# Part 3
print("a = not True: " + str(not True))
print("b = 2 + 2 > 4: " + str(2 + 2 > 4))
print("c = not '0' == 0: " + str(not '0' == 0))
# Reassigning variables with non matching type values is possible
d = True
d = []
print("d = " + str(d))
# Converting a blank string to a boolean yields false
print("e = not \"\": " + str(not ""))
# Values that yield 'False' when converted to a boolean
false_values = [0, "", [], None]
for x in false_values:
print(str(x) + " converted to boolean is: " + str(bool(x)))
print("f = not 2 - len([a, \"potato\")): " + str(not 2 - len([a, "potato"])))
print("g = len(d): " + str(len([])))
print("h = not g: " + str(not 0))
print("i = len(d): " + str(len(['foo'])))
print("j = not 'foo': " + str(not "foo"))
print("k = not 4 % 1: " + str(not 4 % 1))
| a_list = [1, 2, 3, 4, 5]
a = a_list[1]
b = a_list[3]
print(a)
print(b)
a_string = 'FIT2085'
print(a_string[a])
print(a_string[b])
print('a = not True: ' + str(not True))
print('b = 2 + 2 > 4: ' + str(2 + 2 > 4))
print("c = not '0' == 0: " + str(not '0' == 0))
d = True
d = []
print('d = ' + str(d))
print('e = not "": ' + str(not ''))
false_values = [0, '', [], None]
for x in false_values:
print(str(x) + ' converted to boolean is: ' + str(bool(x)))
print('f = not 2 - len([a, "potato")): ' + str(not 2 - len([a, 'potato'])))
print('g = len(d): ' + str(len([])))
print('h = not g: ' + str(not 0))
print('i = len(d): ' + str(len(['foo'])))
print("j = not 'foo': " + str(not 'foo'))
print('k = not 4 % 1: ' + str(not 4 % 1)) |
n1 = float(input('Primeiro segmento: '))
n2 = float(input('Segundo segmento: '))
n3 = float(input('Terceiro segmento: '))
if n1 < n1 + n3 and n2 < n1 +n3 and n3 < n1 + n2:
print('Os segmentos podem formar um triangulo.')
if n1 == n2 == n3 == n1 :
print('EQUILATERO')
elif n1 != n2 != n3 != n1:
print('ESCALENO')
else:
print('ISOSCELES')
else:
print('Os segmentos acima NAO PODEM FORMAR triangulo.') | n1 = float(input('Primeiro segmento: '))
n2 = float(input('Segundo segmento: '))
n3 = float(input('Terceiro segmento: '))
if n1 < n1 + n3 and n2 < n1 + n3 and (n3 < n1 + n2):
print('Os segmentos podem formar um triangulo.')
if n1 == n2 == n3 == n1:
print('EQUILATERO')
elif n1 != n2 != n3 != n1:
print('ESCALENO')
else:
print('ISOSCELES')
else:
print('Os segmentos acima NAO PODEM FORMAR triangulo.') |
# dataset_paths = {
# 'celeba_train': '',
# 'celeba_test': '',
# 'celeba_train_sketch': '',
# 'celeba_test_sketch': '',
# 'celeba_train_segmentation': '',
# 'celeba_test_segmentation': '',
# 'ffhq': '',
# }
dataset_paths = {
'trump_train': '/media/ubuntu/Data1/data/Trump/trump-high-res-photos_aligned_bf_1024_dfl2ffhq_train',
'trump_test': '/media/ubuntu/Data1/data/Trump/trump-high-res-photos_aligned_bf_1024_dfl2ffhq_test',
}
model_paths = {
'stylegan_ffhq': 'pretrained_models/stylegan2-ffhq-config-f.pt',
'ir_se50': 'pretrained_models/model_ir_se50.pth',
'circular_face': 'pretrained_models/CurricularFace_Backbone.pth',
'mtcnn_pnet': 'pretrained_models/mtcnn/pnet.npy',
'mtcnn_rnet': 'pretrained_models/mtcnn/rnet.npy',
'mtcnn_onet': 'pretrained_models/mtcnn/onet.npy',
'shape_predictor': 'shape_predictor_68_face_landmarks.dat'
}
| dataset_paths = {'trump_train': '/media/ubuntu/Data1/data/Trump/trump-high-res-photos_aligned_bf_1024_dfl2ffhq_train', 'trump_test': '/media/ubuntu/Data1/data/Trump/trump-high-res-photos_aligned_bf_1024_dfl2ffhq_test'}
model_paths = {'stylegan_ffhq': 'pretrained_models/stylegan2-ffhq-config-f.pt', 'ir_se50': 'pretrained_models/model_ir_se50.pth', 'circular_face': 'pretrained_models/CurricularFace_Backbone.pth', 'mtcnn_pnet': 'pretrained_models/mtcnn/pnet.npy', 'mtcnn_rnet': 'pretrained_models/mtcnn/rnet.npy', 'mtcnn_onet': 'pretrained_models/mtcnn/onet.npy', 'shape_predictor': 'shape_predictor_68_face_landmarks.dat'} |
e = [int(x) for x in str(input()).split()]
q = e[0]
e = [int(x) for x in str(input()).split()]
for i in range(q):
n = int(input())
if n in e: print(0)
else:
print(1)
e.append(n)
| e = [int(x) for x in str(input()).split()]
q = e[0]
e = [int(x) for x in str(input()).split()]
for i in range(q):
n = int(input())
if n in e:
print(0)
else:
print(1)
e.append(n) |
#
# PySNMP MIB module ISPGRPEXT-MIB (http://snmplabs.com/pysmi)
# ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/ISPGRPEXT-MIB
# Produced by pysmi-0.3.4 at Wed May 1 13:57:33 2019
# On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4
# Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15)
#
ispgrpExt, = mibBuilder.importSymbols("APENT-MIB", "ispgrpExt")
ObjectIdentifier, OctetString, Integer = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "OctetString", "Integer")
NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues")
ConstraintsUnion, ValueSizeConstraint, ConstraintsIntersection, SingleValueConstraint, ValueRangeConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ConstraintsUnion", "ValueSizeConstraint", "ConstraintsIntersection", "SingleValueConstraint", "ValueRangeConstraint")
NotificationGroup, ModuleCompliance = mibBuilder.importSymbols("SNMPv2-CONF", "NotificationGroup", "ModuleCompliance")
MibScalar, MibTable, MibTableRow, MibTableColumn, IpAddress, MibIdentifier, NotificationType, Gauge32, iso, Counter64, Bits, ModuleIdentity, ObjectIdentity, Counter32, Unsigned32, TimeTicks, Integer32 = mibBuilder.importSymbols("SNMPv2-SMI", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "IpAddress", "MibIdentifier", "NotificationType", "Gauge32", "iso", "Counter64", "Bits", "ModuleIdentity", "ObjectIdentity", "Counter32", "Unsigned32", "TimeTicks", "Integer32")
DisplayString, TextualConvention, RowStatus = mibBuilder.importSymbols("SNMPv2-TC", "DisplayString", "TextualConvention", "RowStatus")
apIspgrpExtMib = ModuleIdentity((1, 3, 6, 1, 4, 1, 2467, 1, 27, 1))
if mibBuilder.loadTexts: apIspgrpExtMib.setLastUpdated('9710092000Z')
if mibBuilder.loadTexts: apIspgrpExtMib.setOrganization('ArrowPoint Communications Inc.')
if mibBuilder.loadTexts: apIspgrpExtMib.setContactInfo(' Postal: ArrowPoint Communications Inc. 50 Nagog Park Acton, Massachusetts 01720 Tel: +1 978-206-3000 option 1 E-Mail: support@arrowpoint.com')
if mibBuilder.loadTexts: apIspgrpExtMib.setDescription('The MIB module used to describe the ArrowPoint Communications ISP interface information')
apIspgrpTable = MibTable((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2), )
if mibBuilder.loadTexts: apIspgrpTable.setStatus('current')
if mibBuilder.loadTexts: apIspgrpTable.setDescription('A list of Interfaces configured as uplinks to the specified ISP.')
apIspgrpEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2, 1), ).setIndexNames((0, "ISPGRPEXT-MIB", "apIspgrpName"))
if mibBuilder.loadTexts: apIspgrpEntry.setStatus('current')
if mibBuilder.loadTexts: apIspgrpEntry.setDescription('A group of information to uniquely identify the uplinks to one or more ISPs.')
apIspgrpName = MibTableColumn((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2, 1, 1), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 16))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: apIspgrpName.setStatus('current')
if mibBuilder.loadTexts: apIspgrpName.setDescription('The name of the ISP connected to this composer.')
apIspgrpIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2, 1, 2), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: apIspgrpIndex.setStatus('current')
if mibBuilder.loadTexts: apIspgrpIndex.setDescription('The unique index for each ISP defined.')
apIspgrpTotalBwdth = MibTableColumn((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2, 1, 3), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: apIspgrpTotalBwdth.setStatus('current')
if mibBuilder.loadTexts: apIspgrpTotalBwdth.setDescription('The Total Bandwidth connected to the specified ISP.')
apIspgrpWebHostPipeBwdth = MibTableColumn((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2, 1, 4), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: apIspgrpWebHostPipeBwdth.setStatus('current')
if mibBuilder.loadTexts: apIspgrpWebHostPipeBwdth.setDescription('The amount of Bandwidth reserved for flow pipes to configured web hosts.')
apIspgrpMode = MibTableColumn((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2, 1, 5), Integer32().clone(1)).setMaxAccess("readcreate")
if mibBuilder.loadTexts: apIspgrpMode.setStatus('current')
if mibBuilder.loadTexts: apIspgrpMode.setDescription('This field signifies whether this ISP is considered the primary connection to the Internet or is a backup used only if the primary fails.')
apIspgrpStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2, 1, 6), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: apIspgrpStatus.setStatus('current')
if mibBuilder.loadTexts: apIspgrpStatus.setDescription('Status entry for this row ')
apIspLinkTable = MibTable((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3), )
if mibBuilder.loadTexts: apIspLinkTable.setStatus('current')
if mibBuilder.loadTexts: apIspLinkTable.setDescription('A list of uplinks connected to a specified ISP.')
apIspLinkEntry = MibTableRow((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3, 1), ).setIndexNames((0, "ISPGRPEXT-MIB", "apIspName"), (0, "ISPGRPEXT-MIB", "apIspLinkifIndex"))
if mibBuilder.loadTexts: apIspLinkEntry.setStatus('current')
if mibBuilder.loadTexts: apIspLinkEntry.setDescription('A record to describe each uplink to a specified ISP.')
apIspName = MibTableColumn((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3, 1, 1), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(1, 16))).setMaxAccess("readcreate")
if mibBuilder.loadTexts: apIspName.setStatus('current')
if mibBuilder.loadTexts: apIspName.setDescription('The name of the ISP which this uplink connects to.')
apIspLinkIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3, 1, 2), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: apIspLinkIndex.setStatus('current')
if mibBuilder.loadTexts: apIspLinkIndex.setDescription('The unique index for each ISP link configured on this box.')
apIspLinkifIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3, 1, 3), Integer32()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: apIspLinkifIndex.setStatus('current')
if mibBuilder.loadTexts: apIspLinkifIndex.setDescription('The If Index of the link being specified as an uplink.')
apIspLinkBwdthAlloc = MibTableColumn((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3, 1, 4), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: apIspLinkBwdthAlloc.setStatus('current')
if mibBuilder.loadTexts: apIspLinkBwdthAlloc.setDescription('The statistics of allocated Bandwidth for this link.')
apIspLinkBEBwdthAlloc = MibTableColumn((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3, 1, 5), Integer32()).setMaxAccess("readonly")
if mibBuilder.loadTexts: apIspLinkBEBwdthAlloc.setStatus('current')
if mibBuilder.loadTexts: apIspLinkBEBwdthAlloc.setDescription('The amount of best effort traffic allocated on this link.')
apIspLinkStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3, 1, 6), RowStatus()).setMaxAccess("readcreate")
if mibBuilder.loadTexts: apIspLinkStatus.setStatus('current')
if mibBuilder.loadTexts: apIspLinkStatus.setDescription('Status entry for this row ')
mibBuilder.exportSymbols("ISPGRPEXT-MIB", apIspgrpWebHostPipeBwdth=apIspgrpWebHostPipeBwdth, apIspLinkStatus=apIspLinkStatus, apIspLinkifIndex=apIspLinkifIndex, apIspgrpTotalBwdth=apIspgrpTotalBwdth, apIspgrpName=apIspgrpName, apIspLinkBEBwdthAlloc=apIspLinkBEBwdthAlloc, PYSNMP_MODULE_ID=apIspgrpExtMib, apIspgrpEntry=apIspgrpEntry, apIspgrpMode=apIspgrpMode, apIspLinkIndex=apIspLinkIndex, apIspLinkEntry=apIspLinkEntry, apIspName=apIspName, apIspgrpIndex=apIspgrpIndex, apIspLinkBwdthAlloc=apIspLinkBwdthAlloc, apIspgrpExtMib=apIspgrpExtMib, apIspgrpStatus=apIspgrpStatus, apIspgrpTable=apIspgrpTable, apIspLinkTable=apIspLinkTable)
| (ispgrp_ext,) = mibBuilder.importSymbols('APENT-MIB', 'ispgrpExt')
(object_identifier, octet_string, integer) = mibBuilder.importSymbols('ASN1', 'ObjectIdentifier', 'OctetString', 'Integer')
(named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues')
(constraints_union, value_size_constraint, constraints_intersection, single_value_constraint, value_range_constraint) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ConstraintsUnion', 'ValueSizeConstraint', 'ConstraintsIntersection', 'SingleValueConstraint', 'ValueRangeConstraint')
(notification_group, module_compliance) = mibBuilder.importSymbols('SNMPv2-CONF', 'NotificationGroup', 'ModuleCompliance')
(mib_scalar, mib_table, mib_table_row, mib_table_column, ip_address, mib_identifier, notification_type, gauge32, iso, counter64, bits, module_identity, object_identity, counter32, unsigned32, time_ticks, integer32) = mibBuilder.importSymbols('SNMPv2-SMI', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'IpAddress', 'MibIdentifier', 'NotificationType', 'Gauge32', 'iso', 'Counter64', 'Bits', 'ModuleIdentity', 'ObjectIdentity', 'Counter32', 'Unsigned32', 'TimeTicks', 'Integer32')
(display_string, textual_convention, row_status) = mibBuilder.importSymbols('SNMPv2-TC', 'DisplayString', 'TextualConvention', 'RowStatus')
ap_ispgrp_ext_mib = module_identity((1, 3, 6, 1, 4, 1, 2467, 1, 27, 1))
if mibBuilder.loadTexts:
apIspgrpExtMib.setLastUpdated('9710092000Z')
if mibBuilder.loadTexts:
apIspgrpExtMib.setOrganization('ArrowPoint Communications Inc.')
if mibBuilder.loadTexts:
apIspgrpExtMib.setContactInfo(' Postal: ArrowPoint Communications Inc. 50 Nagog Park Acton, Massachusetts 01720 Tel: +1 978-206-3000 option 1 E-Mail: support@arrowpoint.com')
if mibBuilder.loadTexts:
apIspgrpExtMib.setDescription('The MIB module used to describe the ArrowPoint Communications ISP interface information')
ap_ispgrp_table = mib_table((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2))
if mibBuilder.loadTexts:
apIspgrpTable.setStatus('current')
if mibBuilder.loadTexts:
apIspgrpTable.setDescription('A list of Interfaces configured as uplinks to the specified ISP.')
ap_ispgrp_entry = mib_table_row((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2, 1)).setIndexNames((0, 'ISPGRPEXT-MIB', 'apIspgrpName'))
if mibBuilder.loadTexts:
apIspgrpEntry.setStatus('current')
if mibBuilder.loadTexts:
apIspgrpEntry.setDescription('A group of information to uniquely identify the uplinks to one or more ISPs.')
ap_ispgrp_name = mib_table_column((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2, 1, 1), display_string().subtype(subtypeSpec=value_size_constraint(1, 16))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
apIspgrpName.setStatus('current')
if mibBuilder.loadTexts:
apIspgrpName.setDescription('The name of the ISP connected to this composer.')
ap_ispgrp_index = mib_table_column((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2, 1, 2), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
apIspgrpIndex.setStatus('current')
if mibBuilder.loadTexts:
apIspgrpIndex.setDescription('The unique index for each ISP defined.')
ap_ispgrp_total_bwdth = mib_table_column((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2, 1, 3), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
apIspgrpTotalBwdth.setStatus('current')
if mibBuilder.loadTexts:
apIspgrpTotalBwdth.setDescription('The Total Bandwidth connected to the specified ISP.')
ap_ispgrp_web_host_pipe_bwdth = mib_table_column((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2, 1, 4), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
apIspgrpWebHostPipeBwdth.setStatus('current')
if mibBuilder.loadTexts:
apIspgrpWebHostPipeBwdth.setDescription('The amount of Bandwidth reserved for flow pipes to configured web hosts.')
ap_ispgrp_mode = mib_table_column((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2, 1, 5), integer32().clone(1)).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
apIspgrpMode.setStatus('current')
if mibBuilder.loadTexts:
apIspgrpMode.setDescription('This field signifies whether this ISP is considered the primary connection to the Internet or is a backup used only if the primary fails.')
ap_ispgrp_status = mib_table_column((1, 3, 6, 1, 4, 1, 2467, 1, 27, 2, 1, 6), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
apIspgrpStatus.setStatus('current')
if mibBuilder.loadTexts:
apIspgrpStatus.setDescription('Status entry for this row ')
ap_isp_link_table = mib_table((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3))
if mibBuilder.loadTexts:
apIspLinkTable.setStatus('current')
if mibBuilder.loadTexts:
apIspLinkTable.setDescription('A list of uplinks connected to a specified ISP.')
ap_isp_link_entry = mib_table_row((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3, 1)).setIndexNames((0, 'ISPGRPEXT-MIB', 'apIspName'), (0, 'ISPGRPEXT-MIB', 'apIspLinkifIndex'))
if mibBuilder.loadTexts:
apIspLinkEntry.setStatus('current')
if mibBuilder.loadTexts:
apIspLinkEntry.setDescription('A record to describe each uplink to a specified ISP.')
ap_isp_name = mib_table_column((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3, 1, 1), display_string().subtype(subtypeSpec=value_size_constraint(1, 16))).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
apIspName.setStatus('current')
if mibBuilder.loadTexts:
apIspName.setDescription('The name of the ISP which this uplink connects to.')
ap_isp_link_index = mib_table_column((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3, 1, 2), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
apIspLinkIndex.setStatus('current')
if mibBuilder.loadTexts:
apIspLinkIndex.setDescription('The unique index for each ISP link configured on this box.')
ap_isp_linkif_index = mib_table_column((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3, 1, 3), integer32()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
apIspLinkifIndex.setStatus('current')
if mibBuilder.loadTexts:
apIspLinkifIndex.setDescription('The If Index of the link being specified as an uplink.')
ap_isp_link_bwdth_alloc = mib_table_column((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3, 1, 4), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
apIspLinkBwdthAlloc.setStatus('current')
if mibBuilder.loadTexts:
apIspLinkBwdthAlloc.setDescription('The statistics of allocated Bandwidth for this link.')
ap_isp_link_be_bwdth_alloc = mib_table_column((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3, 1, 5), integer32()).setMaxAccess('readonly')
if mibBuilder.loadTexts:
apIspLinkBEBwdthAlloc.setStatus('current')
if mibBuilder.loadTexts:
apIspLinkBEBwdthAlloc.setDescription('The amount of best effort traffic allocated on this link.')
ap_isp_link_status = mib_table_column((1, 3, 6, 1, 4, 1, 2467, 1, 27, 3, 1, 6), row_status()).setMaxAccess('readcreate')
if mibBuilder.loadTexts:
apIspLinkStatus.setStatus('current')
if mibBuilder.loadTexts:
apIspLinkStatus.setDescription('Status entry for this row ')
mibBuilder.exportSymbols('ISPGRPEXT-MIB', apIspgrpWebHostPipeBwdth=apIspgrpWebHostPipeBwdth, apIspLinkStatus=apIspLinkStatus, apIspLinkifIndex=apIspLinkifIndex, apIspgrpTotalBwdth=apIspgrpTotalBwdth, apIspgrpName=apIspgrpName, apIspLinkBEBwdthAlloc=apIspLinkBEBwdthAlloc, PYSNMP_MODULE_ID=apIspgrpExtMib, apIspgrpEntry=apIspgrpEntry, apIspgrpMode=apIspgrpMode, apIspLinkIndex=apIspLinkIndex, apIspLinkEntry=apIspLinkEntry, apIspName=apIspName, apIspgrpIndex=apIspgrpIndex, apIspLinkBwdthAlloc=apIspLinkBwdthAlloc, apIspgrpExtMib=apIspgrpExtMib, apIspgrpStatus=apIspgrpStatus, apIspgrpTable=apIspgrpTable, apIspLinkTable=apIspLinkTable) |
class Solution:
@staticmethod
def naive(nums):
s = set()
for i in nums:
if i in s: return True
s.add(i)
return False
| class Solution:
@staticmethod
def naive(nums):
s = set()
for i in nums:
if i in s:
return True
s.add(i)
return False |
foo = input("Team: ")
for c in foo:
print("Give me a " + c.upper() + "!" )
print("What does that spell? " + foo.upper() + "!")
foo = input("What animal would you like? ")
bar = input("How many? ")
if foo.isupper() == True:
print("Woah! No need to shout, you'll scare the animals!")
elif int(bar) == 0:
print("That's sad. No pet for you today.")
elif int(bar) == 1:
print("Great, here's your " + foo + "!")
elif int(bar) > 1:
print("Ok! " + str(bar) , str(foo) + "s coming right up!")
def is_notable(name):
# Write your function here.
if name[0] == "N" and len(name) > 4:
return True
else:
return False
# Write the rest of your program here.
foo = input("Type a nickname: ")
if is_notable(foo) == True:
print("That nickname is notable!")
else:
print("That nickname is not so notable!")
def cups_to_grams(cups, density):
# Convert cups to grams here.
# The density is in grams-per-cup.
answer = round(cups * density,1)
return answer
# Write the rest of your program here
food = input("What food? ")
cups = float(input("How much in cups? "))
gpc = float(input("How many grams per cup? "))
print(str(cups), "cups of",food,"is", str(cups_to_grams(cups, gpc)),"grams.")
def to_celsius(f):
# Calculate the temperature in Celsius
answer = round((f-32) * 5/9,1)
return answer
# Write the rest of your program here
fheight = float(input("Temp (F): "))
fheight = to_celsius(fheight)
if fheight < 5:
print(fheight, "C - Crikey it's cold!")
elif fheight >= 5 and fheight < 20:
print(fheight, "C - Getting a bit nippy!")
elif fheight >= 20 and fheight < 35:
print(fheight, "C - You beaut beach weather!")
else:
print(fheight, "C - Strewth, it's a scorcher!")
| foo = input('Team: ')
for c in foo:
print('Give me a ' + c.upper() + '!')
print('What does that spell? ' + foo.upper() + '!')
foo = input('What animal would you like? ')
bar = input('How many? ')
if foo.isupper() == True:
print("Woah! No need to shout, you'll scare the animals!")
elif int(bar) == 0:
print("That's sad. No pet for you today.")
elif int(bar) == 1:
print("Great, here's your " + foo + '!')
elif int(bar) > 1:
print('Ok! ' + str(bar), str(foo) + 's coming right up!')
def is_notable(name):
if name[0] == 'N' and len(name) > 4:
return True
else:
return False
foo = input('Type a nickname: ')
if is_notable(foo) == True:
print('That nickname is notable!')
else:
print('That nickname is not so notable!')
def cups_to_grams(cups, density):
answer = round(cups * density, 1)
return answer
food = input('What food? ')
cups = float(input('How much in cups? '))
gpc = float(input('How many grams per cup? '))
print(str(cups), 'cups of', food, 'is', str(cups_to_grams(cups, gpc)), 'grams.')
def to_celsius(f):
answer = round((f - 32) * 5 / 9, 1)
return answer
fheight = float(input('Temp (F): '))
fheight = to_celsius(fheight)
if fheight < 5:
print(fheight, "C - Crikey it's cold!")
elif fheight >= 5 and fheight < 20:
print(fheight, 'C - Getting a bit nippy!')
elif fheight >= 20 and fheight < 35:
print(fheight, 'C - You beaut beach weather!')
else:
print(fheight, "C - Strewth, it's a scorcher!") |
def main(request, response):
response.headers.set("Cache-Control", "no-store")
response.headers.set("Access-Control-Allow-Origin", request.headers.get("origin"))
response.headers.set("Access-Control-Allow-Credentials", "true")
uid = request.GET.first("uid", None)
if request.method == "OPTIONS":
response.headers.set("Access-Control-Allow-Methods", "PUT")
else:
username = request.auth.username
password = request.auth.password
if (not username) or (username != uid):
response.headers.set("WWW-Authenticate", "Basic realm='Test Realm/Cross Origin'")
response.status = 401
response.content = "Authentication cancelled"
else:
response.content = "User: " + username + ", Password: " + password
| def main(request, response):
response.headers.set('Cache-Control', 'no-store')
response.headers.set('Access-Control-Allow-Origin', request.headers.get('origin'))
response.headers.set('Access-Control-Allow-Credentials', 'true')
uid = request.GET.first('uid', None)
if request.method == 'OPTIONS':
response.headers.set('Access-Control-Allow-Methods', 'PUT')
else:
username = request.auth.username
password = request.auth.password
if not username or username != uid:
response.headers.set('WWW-Authenticate', "Basic realm='Test Realm/Cross Origin'")
response.status = 401
response.content = 'Authentication cancelled'
else:
response.content = 'User: ' + username + ', Password: ' + password |
#.q1 Multiply following matrices
#Using for loops and print the result.
a =[[1,2,3],
[4,5,6],
[7,8,9]]
b=[[111,22,33],
[44,55,56],
[47,86,19]]
mul=[[0,0,0],
[0,0,0],
[0,0,0]]
for i in range(3):
for j in range (3):
for k in range (3):
mul[i][j]+=a[i][k]*b[k][j]
for l in mul:
print(l)
| a = [[1, 2, 3], [4, 5, 6], [7, 8, 9]]
b = [[111, 22, 33], [44, 55, 56], [47, 86, 19]]
mul = [[0, 0, 0], [0, 0, 0], [0, 0, 0]]
for i in range(3):
for j in range(3):
for k in range(3):
mul[i][j] += a[i][k] * b[k][j]
for l in mul:
print(l) |
# 2020.08.07
# Problem Statement:
# https://leetcode.com/problems/search-insert-position/
class Solution:
def searchInsert(self, nums: List[int], target: int) -> int:
# check empty list
if len(nums) == 0: return 0
# check out of range, early return
if target < nums[0]: return 0
elif target > nums[-1]: return len(nums)
# initialize indexes for binary search and answer to return
left, right = 0, len(nums)
index = int((left+right)/2)
# do binary search
while True:
if nums[index] == target:
return index
elif nums[index] > target:
# find the index to insert
if index > 0 and nums[index-1] < target:
return index
else:
# search the left part
right = index
index = int((left+right)/2)
else:
# find the index to insert
if index < len(nums)-1 and nums[index+1] > target:
return index+1
else:
# search the right part
left = index
index = int((left+right)/2) | class Solution:
def search_insert(self, nums: List[int], target: int) -> int:
if len(nums) == 0:
return 0
if target < nums[0]:
return 0
elif target > nums[-1]:
return len(nums)
(left, right) = (0, len(nums))
index = int((left + right) / 2)
while True:
if nums[index] == target:
return index
elif nums[index] > target:
if index > 0 and nums[index - 1] < target:
return index
else:
right = index
index = int((left + right) / 2)
elif index < len(nums) - 1 and nums[index + 1] > target:
return index + 1
else:
left = index
index = int((left + right) / 2) |
#encoding:utf-8
subreddit = 'formula1'
# This is for your public telegram channel.
t_channel = '@r_formula1'
def send_post(submission, r2t):
return r2t.send_simple(submission)
| subreddit = 'formula1'
t_channel = '@r_formula1'
def send_post(submission, r2t):
return r2t.send_simple(submission) |
# take a number as an input from user and print a multiplication table of that number
def multiplication_table():
value = int(input('please type a number: '))
for num in range(1, 11):
print(f'{value} * {num} = {value * num}' )
multiplication_table() | def multiplication_table():
value = int(input('please type a number: '))
for num in range(1, 11):
print(f'{value} * {num} = {value * num}')
multiplication_table() |
STATE_FILENAME = ".state.json"
CACHE_DIR_REL = ".cache"
ARCHIVE_SUBDIR_REL = "archives"
SNAPSHOT_SUBDIR_REL = "snapshots"
| state_filename = '.state.json'
cache_dir_rel = '.cache'
archive_subdir_rel = 'archives'
snapshot_subdir_rel = 'snapshots' |
class JSError(Exception):
def __init__(self,ErrorInfo):
super(JSError,self).__init__()
self.errorinfo = ErrorInfo
def __str__(self):
return self.errorinfo | class Jserror(Exception):
def __init__(self, ErrorInfo):
super(JSError, self).__init__()
self.errorinfo = ErrorInfo
def __str__(self):
return self.errorinfo |
arr = ["eat", "tea", "tan", "ate", "nat", "bat"]
def is_anna(str1, str2):
chars = [0] * 26
if len(str1) != len(str2):
return False
for s1, s2 in zip(str1, str2):
is1 = ord(s1)
is2 = ord(s2)
chars[97 - is1] = chars[97 - is1] + 1
chars[97 - is2] = chars[97 - is2] - 1
for el in chars:
if el != 0:
return False
return True
res = []
anna_group = {}
for el in arr:
sorted_el = "".join(sorted(el))
if anna_group.get(sorted_el) == None:
anna_group[sorted_el] = []
anna_group[sorted_el].append(el)
else:
anna_group[sorted_el].append(el)
res = [grp_arr for grp_arr in anna_group.values()]
print(res)
| arr = ['eat', 'tea', 'tan', 'ate', 'nat', 'bat']
def is_anna(str1, str2):
chars = [0] * 26
if len(str1) != len(str2):
return False
for (s1, s2) in zip(str1, str2):
is1 = ord(s1)
is2 = ord(s2)
chars[97 - is1] = chars[97 - is1] + 1
chars[97 - is2] = chars[97 - is2] - 1
for el in chars:
if el != 0:
return False
return True
res = []
anna_group = {}
for el in arr:
sorted_el = ''.join(sorted(el))
if anna_group.get(sorted_el) == None:
anna_group[sorted_el] = []
anna_group[sorted_el].append(el)
else:
anna_group[sorted_el].append(el)
res = [grp_arr for grp_arr in anna_group.values()]
print(res) |
def fix_teen(n):
if (n >= 13 and n <= 14) or (n >= 17 and n <= 19):
return 0
def no_teen_sum(a, b, c):
abc = [a, b, c]
count = 0
for i in abc:
if fix_teen(i) != 0:
count += i
return count
| def fix_teen(n):
if n >= 13 and n <= 14 or (n >= 17 and n <= 19):
return 0
def no_teen_sum(a, b, c):
abc = [a, b, c]
count = 0
for i in abc:
if fix_teen(i) != 0:
count += i
return count |
if True :
print(True)
else :
print(False)
if not False :
print(True)
else :
print(False)
| if True:
print(True)
else:
print(False)
if not False:
print(True)
else:
print(False) |
def findSum(numbers, queries):
k = []
sum = 0
for i in range(len(queries)):
for j in range(len(queries[i])):
k.append(queries[i][j])
for l in range(k[0] + 1, k[1]):
if numbers[l] != 0:
sum = sum + numbers[l]
else:
sum += k[2]
print(numbers)
print(sum)
if __name__ == '__main__':
fptr = open(os.environ['OUTPUT_PATH'], 'w')
numbers_count = int(input().strip())
numbers = []
for _ in range(numbers_count):
numbers_item = int(input().strip())
numbers.append(numbers_item)
queries_rows = int(input().strip())
queries_columns = int(input().strip())
queries = []
for _ in range(queries_rows):
queries.append(list(map(int, input().rstrip().split())))
result = findSum(numbers, queries)
fptr.write('\n'.join(map(str, result)))
fptr.write('\n')
fptr.close()
| def find_sum(numbers, queries):
k = []
sum = 0
for i in range(len(queries)):
for j in range(len(queries[i])):
k.append(queries[i][j])
for l in range(k[0] + 1, k[1]):
if numbers[l] != 0:
sum = sum + numbers[l]
else:
sum += k[2]
print(numbers)
print(sum)
if __name__ == '__main__':
fptr = open(os.environ['OUTPUT_PATH'], 'w')
numbers_count = int(input().strip())
numbers = []
for _ in range(numbers_count):
numbers_item = int(input().strip())
numbers.append(numbers_item)
queries_rows = int(input().strip())
queries_columns = int(input().strip())
queries = []
for _ in range(queries_rows):
queries.append(list(map(int, input().rstrip().split())))
result = find_sum(numbers, queries)
fptr.write('\n'.join(map(str, result)))
fptr.write('\n')
fptr.close() |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.