content
stringlengths
7
1.05M
fixed_cases
stringlengths
1
1.28M
img_size = (992, 736) img_norm_cfg = dict(mean=[0, 0, 0], std=[255, 255, 255], to_rgb=True) train_pipeline = [ dict(type='LoadImageFromFile'), dict(type='LoadAnnotations', with_bbox=True), dict( type='MinIoURandomCrop', min_ious=(0.1, 0.3, 0.5, 0.7, 0.9), min_crop_size=0.3), dict( type='Resize', img_scale=[(992, 736), (896, 736), (1088, 736), (992, 672), (992, 800)], multiscale_mode='value', keep_ratio=False), dict(type='RandomFlip', flip_ratio=0.5), dict(type='Normalize', **img_norm_cfg), dict(type='DefaultFormatBundle'), dict(type='Collect', keys=['img', 'gt_bboxes', 'gt_labels']) ] test_pipeline = [ dict(type='LoadImageFromFile'), dict( type='MultiScaleFlipAug', img_scale=img_size, flip=False, transforms=[ dict(type='Resize', keep_ratio=False), dict(type='RandomFlip'), dict(type='Normalize', **img_norm_cfg), dict(type='ImageToTensor', keys=['img']), dict(type='Collect', keys=['img']) ]) ]
img_size = (992, 736) img_norm_cfg = dict(mean=[0, 0, 0], std=[255, 255, 255], to_rgb=True) train_pipeline = [dict(type='LoadImageFromFile'), dict(type='LoadAnnotations', with_bbox=True), dict(type='MinIoURandomCrop', min_ious=(0.1, 0.3, 0.5, 0.7, 0.9), min_crop_size=0.3), dict(type='Resize', img_scale=[(992, 736), (896, 736), (1088, 736), (992, 672), (992, 800)], multiscale_mode='value', keep_ratio=False), dict(type='RandomFlip', flip_ratio=0.5), dict(type='Normalize', **img_norm_cfg), dict(type='DefaultFormatBundle'), dict(type='Collect', keys=['img', 'gt_bboxes', 'gt_labels'])] test_pipeline = [dict(type='LoadImageFromFile'), dict(type='MultiScaleFlipAug', img_scale=img_size, flip=False, transforms=[dict(type='Resize', keep_ratio=False), dict(type='RandomFlip'), dict(type='Normalize', **img_norm_cfg), dict(type='ImageToTensor', keys=['img']), dict(type='Collect', keys=['img'])])]
global edge_id edge_id = 0 class Edge: def __init__(self, source, target, weight=1): global edge_id self.id = edge_id edge_id += 1 self.source = source self.target = target self.weight = weight
global edge_id edge_id = 0 class Edge: def __init__(self, source, target, weight=1): global edge_id self.id = edge_id edge_id += 1 self.source = source self.target = target self.weight = weight
def main(): # input N = int(input()) A = list(map(int, input().split())) B = list(map(int, input().split())) C = list(map(int, input().split())) # compute DA = [0]*N DBC =[0]*N for i in range(N): DA[A[i]-1] += 1 for i in range(N): DBC[B[C[i]-1]-1] += 1 s = 0 for i in range(N): s += DA[i]*DBC[i] # output print(s) if __name__ == '__main__': main()
def main(): n = int(input()) a = list(map(int, input().split())) b = list(map(int, input().split())) c = list(map(int, input().split())) da = [0] * N dbc = [0] * N for i in range(N): DA[A[i] - 1] += 1 for i in range(N): DBC[B[C[i] - 1] - 1] += 1 s = 0 for i in range(N): s += DA[i] * DBC[i] print(s) if __name__ == '__main__': main()
#This is given a list of mutations, and get the read names that contain the mutation #Note: We use the CS tag in the alignments, thus each alignment should contain this tag. class ReadsTracer(): def __init__(self): pass # def trace_reads_from_mutation(self): pass #only catch mismatch here def parse_snp_from_CS_tag(self, i_start_pos, s_CS_tag): pass
class Readstracer: def __init__(self): pass def trace_reads_from_mutation(self): pass def parse_snp_from_cs_tag(self, i_start_pos, s_CS_tag): pass
code ={ "CONTINUE":100, "SWITCHING_PROTOCOLS":101, "PROCESSING":101, "OK":200, "CREATED":201, "ACCEPTED":202, "NON_AUTHORITATIVE_INFORMATION":203, "NO_CONTENT":204, "RESET_CONTENT":205, "PARTIAL_CONTENT":206, "MULTI_STATUS":207, "ALREADY_REPORTED":208, "IM_USED":226, "MULTIPLE_CHOICES":300, "MOVED_PERMANENTLY":301, "FOUND":302, "SEE_OTHER":303, "NOT_MODIFIED":304, "USE_PROXY":305, "TEMPORARY_REDIRECT":307, "PERMANENT_REDIRECT":308, "BAD_REQUEST":400, "UNAUTHORIZED":401, "PAYMENT_REQUIRED":402, "FORBIDDEN":403, "NOT_FOUND":404, "METHOD_NOT_ALLOWED":405, "NOT_ACCEPTABLE":406, "PROXY_AUTHENTICATION_REQUIRED":407, "REQUEST_TIMEOUT":408, "CONFLICT":409, "GONE":410, "LENGTH_REQUIRED":411, "PRECONDITION_FAILED":412, "REQUEST_ENTITY_TOO_LARGE":413, "REQUEST_URI_TOO_LONG":414, "UNSUPPORTED_MEDIA_TYPE":415, "REQUEST_RANGE_NOT_SATISFIABLE":416, "EXPECTATION_FAILED":417, "UNPROCESSABLE_ENTITY":422, "LOCKED":423, "FAILED_DEPENDENCY":424, "UPGRADE_REQUIRED":426, "PRECONDITION_REQUIRED":428, "TOO_MANY_REQUESTS":429, "REQUEST_HEADER_FIELDS_TOO_LARGE":431, "INTERNAL_SERVER_ERROR":500, "NOT_IMPLEMENTED":501, "BAD_GATEWAY":502, "SERVICE_UNAVAILABLE":503, "GATEWAY_TIMEOUT":504, "HTTP_VERSION_NOT_SUPPORTED":505, "VARIANT_ALSO_NEGOTIATES":506, "INSUFFICIENT_STORAGE":507, "LOOP_DETECTED":508, "NOT_EXTENDED":510, "NETWORK_AUTHENTICATION_REQUIRED":511 }
code = {'CONTINUE': 100, 'SWITCHING_PROTOCOLS': 101, 'PROCESSING': 101, 'OK': 200, 'CREATED': 201, 'ACCEPTED': 202, 'NON_AUTHORITATIVE_INFORMATION': 203, 'NO_CONTENT': 204, 'RESET_CONTENT': 205, 'PARTIAL_CONTENT': 206, 'MULTI_STATUS': 207, 'ALREADY_REPORTED': 208, 'IM_USED': 226, 'MULTIPLE_CHOICES': 300, 'MOVED_PERMANENTLY': 301, 'FOUND': 302, 'SEE_OTHER': 303, 'NOT_MODIFIED': 304, 'USE_PROXY': 305, 'TEMPORARY_REDIRECT': 307, 'PERMANENT_REDIRECT': 308, 'BAD_REQUEST': 400, 'UNAUTHORIZED': 401, 'PAYMENT_REQUIRED': 402, 'FORBIDDEN': 403, 'NOT_FOUND': 404, 'METHOD_NOT_ALLOWED': 405, 'NOT_ACCEPTABLE': 406, 'PROXY_AUTHENTICATION_REQUIRED': 407, 'REQUEST_TIMEOUT': 408, 'CONFLICT': 409, 'GONE': 410, 'LENGTH_REQUIRED': 411, 'PRECONDITION_FAILED': 412, 'REQUEST_ENTITY_TOO_LARGE': 413, 'REQUEST_URI_TOO_LONG': 414, 'UNSUPPORTED_MEDIA_TYPE': 415, 'REQUEST_RANGE_NOT_SATISFIABLE': 416, 'EXPECTATION_FAILED': 417, 'UNPROCESSABLE_ENTITY': 422, 'LOCKED': 423, 'FAILED_DEPENDENCY': 424, 'UPGRADE_REQUIRED': 426, 'PRECONDITION_REQUIRED': 428, 'TOO_MANY_REQUESTS': 429, 'REQUEST_HEADER_FIELDS_TOO_LARGE': 431, 'INTERNAL_SERVER_ERROR': 500, 'NOT_IMPLEMENTED': 501, 'BAD_GATEWAY': 502, 'SERVICE_UNAVAILABLE': 503, 'GATEWAY_TIMEOUT': 504, 'HTTP_VERSION_NOT_SUPPORTED': 505, 'VARIANT_ALSO_NEGOTIATES': 506, 'INSUFFICIENT_STORAGE': 507, 'LOOP_DETECTED': 508, 'NOT_EXTENDED': 510, 'NETWORK_AUTHENTICATION_REQUIRED': 511}
# Space: O(n) # Time: O(n) class Solution: def maxArea(self, h, w, horizontalCuts, verticalCuts): horizontalCuts = [0] + horizontalCuts + [h] verticalCuts = [0] + verticalCuts + [w] horizontalCuts = sorted(horizontalCuts) verticalCuts = sorted(verticalCuts) h_max = max(horizontalCuts[i] - horizontalCuts[i - 1] for i in range(1, len(horizontalCuts))) v_max = max(verticalCuts[i] - verticalCuts[i - 1] for i in range(1, len(verticalCuts))) return (h_max * v_max) % (pow(10, 9) + 7)
class Solution: def max_area(self, h, w, horizontalCuts, verticalCuts): horizontal_cuts = [0] + horizontalCuts + [h] vertical_cuts = [0] + verticalCuts + [w] horizontal_cuts = sorted(horizontalCuts) vertical_cuts = sorted(verticalCuts) h_max = max((horizontalCuts[i] - horizontalCuts[i - 1] for i in range(1, len(horizontalCuts)))) v_max = max((verticalCuts[i] - verticalCuts[i - 1] for i in range(1, len(verticalCuts)))) return h_max * v_max % (pow(10, 9) + 7)
class chipManager(): def __init__(self,chipsize,chipNums): self.player1chips = chipNums self.player2chips = chipNums self.chipsize = chipsize def getP1Chips(): return self.player1chips def getP2Chips(): return self.player2chips def transferToDealer(txToDealer): if txToDealer: self.player1chips = self.player1chips - self.chipsize self.player2chips = self.player2chips + self.chipsize else: self.player1chips = self.player1chips + self.chipsize self.player2chips = self.player2chips - self.chipsize
class Chipmanager: def __init__(self, chipsize, chipNums): self.player1chips = chipNums self.player2chips = chipNums self.chipsize = chipsize def get_p1_chips(): return self.player1chips def get_p2_chips(): return self.player2chips def transfer_to_dealer(txToDealer): if txToDealer: self.player1chips = self.player1chips - self.chipsize self.player2chips = self.player2chips + self.chipsize else: self.player1chips = self.player1chips + self.chipsize self.player2chips = self.player2chips - self.chipsize
''' Catalan number `cat(n)`. Recursive formula: cat(5) = cat(0)*cat(4) + cat(1)*cat(3) + .. cat(4)*cat(0) Direct formula: cat(n) = (2n)! / (n+1)!(n)! Answer for: - Number of BST given the number of unique keys. - Number of binary trees with the same preorder traversal. - Number of balanced parantheses sequence --> HOW?? - Number of full binary trees with n+1 leaves. - Number of ways of associating n applications of a binary operator. For n = 3, for example, we have the following five different parenthesizations of four factors: ((ab)c)d (a(bc))d (ab)(cd) a((bc)d) a(b(cd)) Actually, successive applications of a binary operator can be represented in terms of a full binary tree. '''
""" Catalan number `cat(n)`. Recursive formula: cat(5) = cat(0)*cat(4) + cat(1)*cat(3) + .. cat(4)*cat(0) Direct formula: cat(n) = (2n)! / (n+1)!(n)! Answer for: - Number of BST given the number of unique keys. - Number of binary trees with the same preorder traversal. - Number of balanced parantheses sequence --> HOW?? - Number of full binary trees with n+1 leaves. - Number of ways of associating n applications of a binary operator. For n = 3, for example, we have the following five different parenthesizations of four factors: ((ab)c)d (a(bc))d (ab)(cd) a((bc)d) a(b(cd)) Actually, successive applications of a binary operator can be represented in terms of a full binary tree. """
# Input : arr[] = {15, 18, 2, 3, 6, 12} # Output: 2 # Explanation : Initial array must be {2, 3, # 6, 12, 15, 18}. We get the given array after # rotating the initial array twice. # Input : arr[] = {7, 9, 11, 12, 5} # Output: 4 # Input: arr[] = {7, 9, 11, 12, 15}; # Output: 0 def single_rotation(arr, l): temp = arr[0] for i in range(l - 1): arr[i] = arr[i + 1] arr[l - 1] = temp def find_min(arr, l): min = arr[0] for i in range(l): if min < arr[i]: min = arr[i] minimum = min for i in range(l): if min == arr[i]: index = i + 1 for i in range(index): single_rotation(arr, len(arr)) return index # def print_array(arr,l): # for i in range(l): # print(arr[i]) arr = [15, 18, 2, 3, 6, 12] rotations = find_min(arr, len(arr)) print("number of rotations:" + str(rotations)) # print_array(arr,len(arr)) print
def single_rotation(arr, l): temp = arr[0] for i in range(l - 1): arr[i] = arr[i + 1] arr[l - 1] = temp def find_min(arr, l): min = arr[0] for i in range(l): if min < arr[i]: min = arr[i] minimum = min for i in range(l): if min == arr[i]: index = i + 1 for i in range(index): single_rotation(arr, len(arr)) return index arr = [15, 18, 2, 3, 6, 12] rotations = find_min(arr, len(arr)) print('number of rotations:' + str(rotations)) print
__version__ = (1, 0, 0, "final", 0) ADMIN_PIPELINE_CSS = { 'admin_bs3': { 'source_filenames': ( 'admintools_bootstrap/chosen/chosen.css', 'admintools_bootstrap/lib/bootstrap-datetimepicker.css', 'admintools_bootstrap/lib/bootstrap-fileupload.scss', 'admintools_bootstrap/sass/admin.scss', 'admintools_bootstrap/css/mmenu.css', ), 'output_filename': 'css/admin_bs3.css', 'extra_context': { 'media': 'screen,projection', }, }, 'admin_bs3_dashboard': { 'source_filenames': ( 'admin_dashboard.css', 'admintools_bootstrap/sass/dashboard.scss', ), 'output_filename': 'css/admin_bs3_dashboard.css', 'extra_context': { 'media': 'screen,projection', }, }, } ADMIN_PIPELINE_JS = { 'admin_bs3': { 'source_filenames': ( 'admintools_bootstrap/js/lazyload.js', 'admintools_bootstrap/js/jquery-1.9.1.js', 'admintools_bootstrap/js/jquery-ui-1.10.3.custom.js', 'admintools_bootstrap/js/json2.js', 'admin_tools/js/jquery/jquery.cookie.min.js', 'admin_tools/js/jquery/jquery.dashboard.js', 'admin_tools/js/menu.js', 'admintools_bootstrap/chosen/chosen.jquery.js', 'admintools_bootstrap/js/bootstrap/dropdown.js', 'admintools_bootstrap/js/bootstrap/alert.js', 'admintools_bootstrap/js/bootstrap-datetimepicker.js', 'admintools_bootstrap/js/bootstrap-fileupload.js', 'admintools_bootstrap/js/dismissAddAnotherPopup.js', 'admintools_bootstrap/js/admin.js', ), 'output_filename': 'js/admin_bs3_dashboard.js', 'extra_context': { 'media': 'screen,projection', }, }, }
__version__ = (1, 0, 0, 'final', 0) admin_pipeline_css = {'admin_bs3': {'source_filenames': ('admintools_bootstrap/chosen/chosen.css', 'admintools_bootstrap/lib/bootstrap-datetimepicker.css', 'admintools_bootstrap/lib/bootstrap-fileupload.scss', 'admintools_bootstrap/sass/admin.scss', 'admintools_bootstrap/css/mmenu.css'), 'output_filename': 'css/admin_bs3.css', 'extra_context': {'media': 'screen,projection'}}, 'admin_bs3_dashboard': {'source_filenames': ('admin_dashboard.css', 'admintools_bootstrap/sass/dashboard.scss'), 'output_filename': 'css/admin_bs3_dashboard.css', 'extra_context': {'media': 'screen,projection'}}} admin_pipeline_js = {'admin_bs3': {'source_filenames': ('admintools_bootstrap/js/lazyload.js', 'admintools_bootstrap/js/jquery-1.9.1.js', 'admintools_bootstrap/js/jquery-ui-1.10.3.custom.js', 'admintools_bootstrap/js/json2.js', 'admin_tools/js/jquery/jquery.cookie.min.js', 'admin_tools/js/jquery/jquery.dashboard.js', 'admin_tools/js/menu.js', 'admintools_bootstrap/chosen/chosen.jquery.js', 'admintools_bootstrap/js/bootstrap/dropdown.js', 'admintools_bootstrap/js/bootstrap/alert.js', 'admintools_bootstrap/js/bootstrap-datetimepicker.js', 'admintools_bootstrap/js/bootstrap-fileupload.js', 'admintools_bootstrap/js/dismissAddAnotherPopup.js', 'admintools_bootstrap/js/admin.js'), 'output_filename': 'js/admin_bs3_dashboard.js', 'extra_context': {'media': 'screen,projection'}}}
t = int(input()) for _ in range(t): s = [s_temp for s_temp in input().strip()] #s_len = len(s) #s_first_half = s[:s_len//2] #s_second_half = s[s_len//2+s_len%2:][::-1] op = 0 for i in range(len(s)//2): #op += ord(max(s_first_half[i], s_second_half[i])) - ord(min(s_first_half[i], s_second_half[i])) op += abs(ord(s[i]) - ord(s[len(s)-i-1])) print (op)
t = int(input()) for _ in range(t): s = [s_temp for s_temp in input().strip()] op = 0 for i in range(len(s) // 2): op += abs(ord(s[i]) - ord(s[len(s) - i - 1])) print(op)
def n_lower_cases(string): return sum([int(c.islower()) for c in string]) def n_upper_cases(string): return sum([int(c.isupper()) for c in string]) def n_whitespace(string): cnt = 0.0 for c in string: if c == '_': cnt += 1 return cnt string = input() symb_amt = n_whitespace(string) + n_lower_cases(string) + n_upper_cases(string) print(n_whitespace(string) / len(string )) print(n_lower_cases(string) / len(string)) print(n_upper_cases(string) / len(string)) print( (len(string) - symb_amt) / len(string))
def n_lower_cases(string): return sum([int(c.islower()) for c in string]) def n_upper_cases(string): return sum([int(c.isupper()) for c in string]) def n_whitespace(string): cnt = 0.0 for c in string: if c == '_': cnt += 1 return cnt string = input() symb_amt = n_whitespace(string) + n_lower_cases(string) + n_upper_cases(string) print(n_whitespace(string) / len(string)) print(n_lower_cases(string) / len(string)) print(n_upper_cases(string) / len(string)) print((len(string) - symb_amt) / len(string))
#!/usr/bin/env python3 inp = "01111010110010011" def solve(target_len): # translate input into numbers state = [int(c) for c in inp] # generate data while len(state) < target_len: state += [0] + [1-i for i in state[::-1]] # compute checksujm state = state[:target_len] while len(state)%2 == 0: for i in range(int(len(state)/2)): state[i] = 1 if state[2*i] == state[2*i+1] else 0 state = state[:int(len(state)/2)] print(''.join(map(str, state))) solve(272) solve(35651584)
inp = '01111010110010011' def solve(target_len): state = [int(c) for c in inp] while len(state) < target_len: state += [0] + [1 - i for i in state[::-1]] state = state[:target_len] while len(state) % 2 == 0: for i in range(int(len(state) / 2)): state[i] = 1 if state[2 * i] == state[2 * i + 1] else 0 state = state[:int(len(state) / 2)] print(''.join(map(str, state))) solve(272) solve(35651584)
# Data Center URL DATA_FILES_BASE_URL = "https://www.meps.ahrq.gov/mepsweb/data_files/pufs/" DATA_STATS_BASE_URL = "https://www.meps.ahrq.gov/data_stats/download_data/pufs/" # Base Year List DATA_FILES_YEARS = [ 2018, 2017, 2016, 2015, 2014, 2013, 2012, 2011, 2010, 2009, 2008, 2007, 2006, 2005, ] BASE_MODELS = [ "DentalVisits", "EmergencyRoomVisits", "HomeHealth", "HospitalInpatientStays", "MedicalConditions", "OfficeBasedVisits", "OtherMedicalExpenses", "OutpatientVisits", "PopulationCharacteristics", "PrescribedMedicines", ] # Full Year Population Characteristics Data Files FYPCDF_PUF_LOOKUP = { 2018: "h209", 2017: "h201", 2016: "h192", 2015: "h181", 2014: "h171", 2013: "h163", 2012: "h155", 2011: "h147", 2010: "h138", 2009: "h129", 2008: "h121", 2007: "h113", 2006: "h105", 2005: "h97", } # Medical Conditions Data Files MCDF_PUF_LOOKUP = { 2018: "h207", 2017: "h199", 2016: "h190", 2015: "h180", 2014: "h170", 2013: "h162", 2012: "h154", 2011: "h146", 2010: "h137", 2009: "h128", 2008: "h120", 2007: "h112", 2006: "h104", 2005: "h96", } # Prescribed Medicines Data Files PMDF_PUF_LOOKUP = { 2018: "h206a", 2017: "h197a", 2016: "h188a", 2015: "h178a", 2014: "h168a", 2013: "h160a", 2012: "h152a", 2011: "h144a", 2010: "h135a", 2009: "h126a", 2008: "h118a", 2007: "h110a", 2006: "h102a", 2005: "h94a", } # Dental Visits Data Files DVDF_PUF_LOOKUP = { 2018: "h206b", 2017: "h197b", 2016: "h188b", 2015: "h178b", 2014: "h168b", 2013: "h160b", 2012: "h152b", 2011: "h144b", 2010: "h135b", 2009: "h126b", 2008: "h118b", 2007: "h110b", 2006: "h102b", 2005: "h94b", } # Other Medical Expenses Data Files OMEDF_PUF_LOOKUP = { 2018: "h206c", 2017: "h197c", 2016: "h188c", 2015: "h178c", 2014: "h168c", 2013: "h160c", 2012: "h152c", 2011: "h144c", 2010: "h135c", 2009: "h126c", 2008: "h118c", 2007: "h110c", 2006: "h102c", 2005: "h94c", } # Hospital Inpatient Stays Data Files HISDF_PUF_LOOKUP = { 2018: "h206d", 2017: "h197d", 2016: "h188d", 2015: "h178d", 2014: "h168d", 2013: "h160d", 2012: "h152d", 2011: "h144d", 2010: "h135d", 2009: "h126d", 2008: "h118d", 2007: "h110d", 2006: "h102d", 2005: "h94d", } # Emergency Room Visits Data Files ERVDF_PUF_LOOKUP = { 2018: "h206e", 2017: "h197e", 2016: "h188e", 2015: "h178e", 2014: "h168e", 2013: "h160e", 2012: "h152e", 2011: "h144e", 2010: "h135e", 2009: "h126e", 2008: "h118e", 2007: "h110e", 2006: "h102e", 2005: "h94e", } # Outpatient Visits Data Files OVDF_PUF_LOOKUP = { 2018: "h206f", 2017: "h197f", 2016: "h188f", 2015: "h178f", 2014: "h168f", 2013: "h160f", 2012: "h152f", 2011: "h144f", 2010: "h135f", 2009: "h126f", 2008: "h118f", 2007: "h110f", 2006: "h102f", 2005: "h94f", } # Office-Based Medical Provider Visits Data Files OBMPVDF_PUF_LOOKUP = { 2018: "h206g", 2017: "h197g", 2016: "h188g", 2015: "h178g", 2014: "h168g", 2013: "h160g", 2012: "h152g", 2011: "h144g", 2010: "h135g", 2009: "h126g", 2008: "h118g", 2007: "h110g", 2006: "h102g", 2005: "h94g", } # Home Health Data Files HHDF_PUF_LOOKUP = { 2018: "h206h", 2017: "h197h", 2016: "h188h", 2015: "h178h", 2014: "h168h", 2013: "h160h", 2012: "h152h", 2011: "h144h", 2010: "h135h", 2009: "h126h", 2008: "h118h", 2007: "h110h", 2006: "h102h", 2005: "h94h", }
data_files_base_url = 'https://www.meps.ahrq.gov/mepsweb/data_files/pufs/' data_stats_base_url = 'https://www.meps.ahrq.gov/data_stats/download_data/pufs/' data_files_years = [2018, 2017, 2016, 2015, 2014, 2013, 2012, 2011, 2010, 2009, 2008, 2007, 2006, 2005] base_models = ['DentalVisits', 'EmergencyRoomVisits', 'HomeHealth', 'HospitalInpatientStays', 'MedicalConditions', 'OfficeBasedVisits', 'OtherMedicalExpenses', 'OutpatientVisits', 'PopulationCharacteristics', 'PrescribedMedicines'] fypcdf_puf_lookup = {2018: 'h209', 2017: 'h201', 2016: 'h192', 2015: 'h181', 2014: 'h171', 2013: 'h163', 2012: 'h155', 2011: 'h147', 2010: 'h138', 2009: 'h129', 2008: 'h121', 2007: 'h113', 2006: 'h105', 2005: 'h97'} mcdf_puf_lookup = {2018: 'h207', 2017: 'h199', 2016: 'h190', 2015: 'h180', 2014: 'h170', 2013: 'h162', 2012: 'h154', 2011: 'h146', 2010: 'h137', 2009: 'h128', 2008: 'h120', 2007: 'h112', 2006: 'h104', 2005: 'h96'} pmdf_puf_lookup = {2018: 'h206a', 2017: 'h197a', 2016: 'h188a', 2015: 'h178a', 2014: 'h168a', 2013: 'h160a', 2012: 'h152a', 2011: 'h144a', 2010: 'h135a', 2009: 'h126a', 2008: 'h118a', 2007: 'h110a', 2006: 'h102a', 2005: 'h94a'} dvdf_puf_lookup = {2018: 'h206b', 2017: 'h197b', 2016: 'h188b', 2015: 'h178b', 2014: 'h168b', 2013: 'h160b', 2012: 'h152b', 2011: 'h144b', 2010: 'h135b', 2009: 'h126b', 2008: 'h118b', 2007: 'h110b', 2006: 'h102b', 2005: 'h94b'} omedf_puf_lookup = {2018: 'h206c', 2017: 'h197c', 2016: 'h188c', 2015: 'h178c', 2014: 'h168c', 2013: 'h160c', 2012: 'h152c', 2011: 'h144c', 2010: 'h135c', 2009: 'h126c', 2008: 'h118c', 2007: 'h110c', 2006: 'h102c', 2005: 'h94c'} hisdf_puf_lookup = {2018: 'h206d', 2017: 'h197d', 2016: 'h188d', 2015: 'h178d', 2014: 'h168d', 2013: 'h160d', 2012: 'h152d', 2011: 'h144d', 2010: 'h135d', 2009: 'h126d', 2008: 'h118d', 2007: 'h110d', 2006: 'h102d', 2005: 'h94d'} ervdf_puf_lookup = {2018: 'h206e', 2017: 'h197e', 2016: 'h188e', 2015: 'h178e', 2014: 'h168e', 2013: 'h160e', 2012: 'h152e', 2011: 'h144e', 2010: 'h135e', 2009: 'h126e', 2008: 'h118e', 2007: 'h110e', 2006: 'h102e', 2005: 'h94e'} ovdf_puf_lookup = {2018: 'h206f', 2017: 'h197f', 2016: 'h188f', 2015: 'h178f', 2014: 'h168f', 2013: 'h160f', 2012: 'h152f', 2011: 'h144f', 2010: 'h135f', 2009: 'h126f', 2008: 'h118f', 2007: 'h110f', 2006: 'h102f', 2005: 'h94f'} obmpvdf_puf_lookup = {2018: 'h206g', 2017: 'h197g', 2016: 'h188g', 2015: 'h178g', 2014: 'h168g', 2013: 'h160g', 2012: 'h152g', 2011: 'h144g', 2010: 'h135g', 2009: 'h126g', 2008: 'h118g', 2007: 'h110g', 2006: 'h102g', 2005: 'h94g'} hhdf_puf_lookup = {2018: 'h206h', 2017: 'h197h', 2016: 'h188h', 2015: 'h178h', 2014: 'h168h', 2013: 'h160h', 2012: 'h152h', 2011: 'h144h', 2010: 'h135h', 2009: 'h126h', 2008: 'h118h', 2007: 'h110h', 2006: 'h102h', 2005: 'h94h'}
class CompositorNodeFlip: axis = None def update(self): pass
class Compositornodeflip: axis = None def update(self): pass
def add_native_methods(clazz): def flattenAlternative__com_sun_org_apache_xalan_internal_xsltc_compiler_Pattern__com_sun_org_apache_xalan_internal_xsltc_compiler_Template__java_util_Map_java_lang_String__com_sun_org_apache_xalan_internal_xsltc_compiler_Key___(a0, a1, a2, a3, a4): raise NotImplementedError() clazz.flattenAlternative__com_sun_org_apache_xalan_internal_xsltc_compiler_Pattern__com_sun_org_apache_xalan_internal_xsltc_compiler_Template__java_util_Map_java_lang_String__com_sun_org_apache_xalan_internal_xsltc_compiler_Key___ = flattenAlternative__com_sun_org_apache_xalan_internal_xsltc_compiler_Pattern__com_sun_org_apache_xalan_internal_xsltc_compiler_Template__java_util_Map_java_lang_String__com_sun_org_apache_xalan_internal_xsltc_compiler_Key___
def add_native_methods(clazz): def flatten_alternative__com_sun_org_apache_xalan_internal_xsltc_compiler__pattern__com_sun_org_apache_xalan_internal_xsltc_compiler__template__java_util__map_java_lang__string__com_sun_org_apache_xalan_internal_xsltc_compiler__key___(a0, a1, a2, a3, a4): raise not_implemented_error() clazz.flattenAlternative__com_sun_org_apache_xalan_internal_xsltc_compiler_Pattern__com_sun_org_apache_xalan_internal_xsltc_compiler_Template__java_util_Map_java_lang_String__com_sun_org_apache_xalan_internal_xsltc_compiler_Key___ = flattenAlternative__com_sun_org_apache_xalan_internal_xsltc_compiler_Pattern__com_sun_org_apache_xalan_internal_xsltc_compiler_Template__java_util_Map_java_lang_String__com_sun_org_apache_xalan_internal_xsltc_compiler_Key___
entrada = str(input()).split(' ') p = int(entrada[0]) j1 = int(entrada[1]) j2 = int(entrada[2]) r = int(entrada[3]) a = int(entrada[4]) if r == 0 and a == 0: if (j1 + j2) % 2 == 0 and p == 1: print('Jogador 1 ganha!') elif (j1 + j2) % 2 != 0 and p == 0: print('Jogador 1 ganha!') else: print('Jogador 2 ganha!') elif r == 1 and a == 0: print('Jogador 1 ganha!') elif r == 0 and a == 1: print('Jogador 1 ganha!') elif r == 1 and a == 1: print('Jogador 2 ganha!')
entrada = str(input()).split(' ') p = int(entrada[0]) j1 = int(entrada[1]) j2 = int(entrada[2]) r = int(entrada[3]) a = int(entrada[4]) if r == 0 and a == 0: if (j1 + j2) % 2 == 0 and p == 1: print('Jogador 1 ganha!') elif (j1 + j2) % 2 != 0 and p == 0: print('Jogador 1 ganha!') else: print('Jogador 2 ganha!') elif r == 1 and a == 0: print('Jogador 1 ganha!') elif r == 0 and a == 1: print('Jogador 1 ganha!') elif r == 1 and a == 1: print('Jogador 2 ganha!')
# -*- coding: utf-8 -*- class VariableTypeAlreadyRegistered(Exception): pass class InvalidType(Exception): pass
class Variabletypealreadyregistered(Exception): pass class Invalidtype(Exception): pass
# Find Pivot Index ''' Given an array of integers nums, write a method that returns the "pivot" index of this array. We define the pivot index as the index where the sum of all the numbers to the left of the index is equal to the sum of all the numbers to the right of the index. If no such index exists, we should return -1. If there are multiple pivot indexes, you should return the left-most pivot index. Example 1: Input: nums = [1,7,3,6,5,6] Output: 3 Explanation: The sum of the numbers to the left of index 3 (nums[3] = 6) is equal to the sum of numbers to the right of index 3. Also, 3 is the first index where this occurs. Example 2: Input: nums = [1,2,3] Output: -1 Explanation: There is no index that satisfies the conditions in the problem statement. Constraints: The length of nums will be in the range [0, 10000]. Each element nums[i] will be an integer in the range [-1000, 1000]. Hide Hint #1 We can precompute prefix sums P[i] = nums[0] + nums[1] + ... + nums[i-1]. Then for each index, the left sum is P[i], and the right sum is P[P.length - 1] - P[i] - nums[i]. ''' class Solution: def pivotIndex(self, nums: List[int]) -> int: if not nums: return -1 lsum = 0 rsum = sum(nums) for i in range(len(nums)): rsum -= nums[i] if rsum == lsum: return i lsum += nums[i] return -1
""" Given an array of integers nums, write a method that returns the "pivot" index of this array. We define the pivot index as the index where the sum of all the numbers to the left of the index is equal to the sum of all the numbers to the right of the index. If no such index exists, we should return -1. If there are multiple pivot indexes, you should return the left-most pivot index. Example 1: Input: nums = [1,7,3,6,5,6] Output: 3 Explanation: The sum of the numbers to the left of index 3 (nums[3] = 6) is equal to the sum of numbers to the right of index 3. Also, 3 is the first index where this occurs. Example 2: Input: nums = [1,2,3] Output: -1 Explanation: There is no index that satisfies the conditions in the problem statement. Constraints: The length of nums will be in the range [0, 10000]. Each element nums[i] will be an integer in the range [-1000, 1000]. Hide Hint #1 We can precompute prefix sums P[i] = nums[0] + nums[1] + ... + nums[i-1]. Then for each index, the left sum is P[i], and the right sum is P[P.length - 1] - P[i] - nums[i]. """ class Solution: def pivot_index(self, nums: List[int]) -> int: if not nums: return -1 lsum = 0 rsum = sum(nums) for i in range(len(nums)): rsum -= nums[i] if rsum == lsum: return i lsum += nums[i] return -1
#!/usr/local/bin/python3.5 -u answer = 42 print(answer)
answer = 42 print(answer)
#!/bin/python3 h = list(map(int, input().strip().split(' '))) word = input().strip() max_height = 0 for w in word: i = ord(w)-97 max_height = max(max_height, h[i]) print (len(word)*max_height)
h = list(map(int, input().strip().split(' '))) word = input().strip() max_height = 0 for w in word: i = ord(w) - 97 max_height = max(max_height, h[i]) print(len(word) * max_height)
def hangman(word, letters): result = 0 a = 0 for item in letters: if 6 <= a: return False b = word.count(item) if 0 == b: a += 1 else: result += b return len(word) == result
def hangman(word, letters): result = 0 a = 0 for item in letters: if 6 <= a: return False b = word.count(item) if 0 == b: a += 1 else: result += b return len(word) == result
class AreaKnowledge: def __init__(self, text=None): self.text = text self._peoples_names = set() self.peoples_info = list() def set_text(self, text): self.text = text def update_people_photos(self, persons): for person in persons: self.update_people_photo(person.display_name, person.photo_id) def update_people_photo(self, name, photo_id): if name not in self._peoples_names: return for p in self.peoples_info: if name == p['name']: p['photo_id'] = photo_id return def add_people_names(self, names): for name in names: self.add_people(name, None) def add_people(self, name, photo_id): if name in self._peoples_names: return else: self._peoples_names.add(name) self.peoples_info.append(dict(name=name, photo_id=photo_id)) def get_mapping(self): return dict( area=self.text, peoples=self.peoples_info )
class Areaknowledge: def __init__(self, text=None): self.text = text self._peoples_names = set() self.peoples_info = list() def set_text(self, text): self.text = text def update_people_photos(self, persons): for person in persons: self.update_people_photo(person.display_name, person.photo_id) def update_people_photo(self, name, photo_id): if name not in self._peoples_names: return for p in self.peoples_info: if name == p['name']: p['photo_id'] = photo_id return def add_people_names(self, names): for name in names: self.add_people(name, None) def add_people(self, name, photo_id): if name in self._peoples_names: return else: self._peoples_names.add(name) self.peoples_info.append(dict(name=name, photo_id=photo_id)) def get_mapping(self): return dict(area=self.text, peoples=self.peoples_info)
class PTestException(Exception): pass class ScreenshotError(PTestException): pass
class Ptestexception(Exception): pass class Screenshoterror(PTestException): pass
# # PySNMP MIB module BFD-STD-MIB (http://snmplabs.com/pysmi) # ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/BFD-STD-MIB # Produced by pysmi-0.3.4 at Wed May 1 11:37:46 2019 # On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4 # Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15) # OctetString, Integer, ObjectIdentifier = mibBuilder.importSymbols("ASN1", "OctetString", "Integer", "ObjectIdentifier") NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues") ConstraintsUnion, ValueSizeConstraint, ConstraintsIntersection, ValueRangeConstraint, SingleValueConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ConstraintsUnion", "ValueSizeConstraint", "ConstraintsIntersection", "ValueRangeConstraint", "SingleValueConstraint") BfdSessIndexTC, BfdMultiplierTC, BfdIntervalTC, BfdCtrlSourcePortNumberTC, BfdCtrlDestPortNumberTC = mibBuilder.importSymbols("BFD-TC-STD-MIB", "BfdSessIndexTC", "BfdMultiplierTC", "BfdIntervalTC", "BfdCtrlSourcePortNumberTC", "BfdCtrlDestPortNumberTC") IndexIntegerNextFree, = mibBuilder.importSymbols("DIFFSERV-DSCP-TC", "IndexIntegerNextFree") IANAbfdSessAuthenticationTypeTC, IANAbfdSessAuthenticationKeyTC, IANAbfdSessTypeTC, IANAbfdDiagTC, IANAbfdSessStateTC, IANAbfdSessOperModeTC = mibBuilder.importSymbols("IANA-BFD-TC-STD-MIB", "IANAbfdSessAuthenticationTypeTC", "IANAbfdSessAuthenticationKeyTC", "IANAbfdSessTypeTC", "IANAbfdDiagTC", "IANAbfdSessStateTC", "IANAbfdSessOperModeTC") InterfaceIndexOrZero, = mibBuilder.importSymbols("IF-MIB", "InterfaceIndexOrZero") InetAddress, InetPortNumber, InetAddressType = mibBuilder.importSymbols("INET-ADDRESS-MIB", "InetAddress", "InetPortNumber", "InetAddressType") NotificationGroup, ObjectGroup, ModuleCompliance = mibBuilder.importSymbols("SNMPv2-CONF", "NotificationGroup", "ObjectGroup", "ModuleCompliance") MibIdentifier, Bits, NotificationType, TimeTicks, ModuleIdentity, Gauge32, Unsigned32, Counter64, IpAddress, ObjectIdentity, Counter32, iso, MibScalar, MibTable, MibTableRow, MibTableColumn, Integer32, mib_2 = mibBuilder.importSymbols("SNMPv2-SMI", "MibIdentifier", "Bits", "NotificationType", "TimeTicks", "ModuleIdentity", "Gauge32", "Unsigned32", "Counter64", "IpAddress", "ObjectIdentity", "Counter32", "iso", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Integer32", "mib-2") TimeStamp, TextualConvention, RowStatus, TruthValue, StorageType, DisplayString = mibBuilder.importSymbols("SNMPv2-TC", "TimeStamp", "TextualConvention", "RowStatus", "TruthValue", "StorageType", "DisplayString") bfdMIB = ModuleIdentity((1, 3, 6, 1, 2, 1, 222)) bfdMIB.setRevisions(('2014-08-12 00:00',)) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): if mibBuilder.loadTexts: bfdMIB.setRevisionsDescriptions(('Initial version. Published as RFC 7331.',)) if mibBuilder.loadTexts: bfdMIB.setLastUpdated('201408120000Z') if mibBuilder.loadTexts: bfdMIB.setOrganization('IETF Bidirectional Forwarding Detection Working Group') if mibBuilder.loadTexts: bfdMIB.setContactInfo('Thomas D. Nadeau Brocade Email: tnadeau@lucidvision.com Zafar Ali Cisco Systems, Inc. Email: zali@cisco.com Nobo Akiya Cisco Systems, Inc. Email: nobo@cisco.com Comments about this document should be emailed directly to the BFD Working Group mailing list at rtg-bfd@ietf.org') if mibBuilder.loadTexts: bfdMIB.setDescription("Bidirectional Forwarding Management Information Base. Copyright (c) 2014 IETF Trust and the persons identified as authors of the code. All rights reserved. Redistribution and use in source and binary forms, with or without modification, is permitted pursuant to, and subject to the license terms contained in, the Simplified BSD License set forth in Section 4.c of the IETF Trust's Legal Provisions Relating to IETF Documents (http://trustee.ietf.org/license-info).") bfdNotifications = MibIdentifier((1, 3, 6, 1, 2, 1, 222, 0)) bfdObjects = MibIdentifier((1, 3, 6, 1, 2, 1, 222, 1)) bfdConformance = MibIdentifier((1, 3, 6, 1, 2, 1, 222, 2)) bfdScalarObjects = MibIdentifier((1, 3, 6, 1, 2, 1, 222, 1, 1)) bfdAdminStatus = MibScalar((1, 3, 6, 1, 2, 1, 222, 1, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))).clone(namedValues=NamedValues(("enabled", 1), ("disabled", 2), ("adminDown", 3), ("down", 4)))).setMaxAccess("readwrite") if mibBuilder.loadTexts: bfdAdminStatus.setStatus('current') if mibBuilder.loadTexts: bfdAdminStatus.setDescription('The desired global administrative status of the BFD system in this device.') bfdOperStatus = MibScalar((1, 3, 6, 1, 2, 1, 222, 1, 1, 2), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("up", 1), ("down", 2), ("adminDown", 3)))).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdOperStatus.setStatus('current') if mibBuilder.loadTexts: bfdOperStatus.setDescription('Indicates the actual operational status of the BFD system in this device. When this value is down(2), all entries in the bfdSessTable MUST have their bfdSessOperStatus as down(2) as well. When this value is adminDown(3), all entries in the bfdSessTable MUST have their bfdSessOperStatus as adminDown(3) as well.') bfdNotificationsEnable = MibScalar((1, 3, 6, 1, 2, 1, 222, 1, 1, 3), TruthValue().clone('false')).setMaxAccess("readwrite") if mibBuilder.loadTexts: bfdNotificationsEnable.setReference('See also RFC3413 for explanation that notifications are under the ultimate control of the MIB modules in this document.') if mibBuilder.loadTexts: bfdNotificationsEnable.setStatus('current') if mibBuilder.loadTexts: bfdNotificationsEnable.setDescription('If this object is set to true(1), then it enables the emission of bfdSessUp and bfdSessDown notifications; otherwise these notifications are not emitted.') bfdSessIndexNext = MibScalar((1, 3, 6, 1, 2, 1, 222, 1, 1, 4), IndexIntegerNextFree().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessIndexNext.setStatus('current') if mibBuilder.loadTexts: bfdSessIndexNext.setDescription('This object contains an unused value for bfdSessIndex that can be used when creating entries in the table. A zero indicates that no entries are available, but MUST NOT be used as a valid index. ') bfdSessTable = MibTable((1, 3, 6, 1, 2, 1, 222, 1, 2), ) if mibBuilder.loadTexts: bfdSessTable.setReference('Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessTable.setStatus('current') if mibBuilder.loadTexts: bfdSessTable.setDescription('The BFD Session Table describes the BFD sessions.') bfdSessEntry = MibTableRow((1, 3, 6, 1, 2, 1, 222, 1, 2, 1), ).setIndexNames((0, "BFD-STD-MIB", "bfdSessIndex")) if mibBuilder.loadTexts: bfdSessEntry.setStatus('current') if mibBuilder.loadTexts: bfdSessEntry.setDescription('The BFD Session Entry describes BFD session.') bfdSessIndex = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 1), BfdSessIndexTC()) if mibBuilder.loadTexts: bfdSessIndex.setStatus('current') if mibBuilder.loadTexts: bfdSessIndex.setDescription('This object contains an index used to represent a unique BFD session on this device. Managers should obtain new values for row creation in this table by reading bfdSessIndexNext.') bfdSessVersionNumber = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 7)).clone(1)).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessVersionNumber.setReference('Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessVersionNumber.setStatus('current') if mibBuilder.loadTexts: bfdSessVersionNumber.setDescription('The version number of the BFD protocol that this session is running in. Write access is available for this object to provide ability to set desired version for this BFD session.') bfdSessType = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 3), IANAbfdSessTypeTC()).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessType.setStatus('current') if mibBuilder.loadTexts: bfdSessType.setDescription('This object specifies the type of this BFD session.') bfdSessDiscriminator = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 4), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(1, 4294967295))).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessDiscriminator.setStatus('current') if mibBuilder.loadTexts: bfdSessDiscriminator.setDescription('This object specifies the local discriminator for this BFD session, used to uniquely identify it.') bfdSessRemoteDiscr = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 5), Unsigned32().subtype(subtypeSpec=ConstraintsUnion(ValueRangeConstraint(0, 0), ValueRangeConstraint(1, 4294967295), ))).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessRemoteDiscr.setReference('Section 6.8.6, from Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessRemoteDiscr.setStatus('current') if mibBuilder.loadTexts: bfdSessRemoteDiscr.setDescription('This object specifies the session discriminator chosen by the remote system for this BFD session. The value may be zero(0) if the remote discriminator is not yet known or if the session is in the down or adminDown(1) state.') bfdSessDestinationUdpPort = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 6), BfdCtrlDestPortNumberTC()).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessDestinationUdpPort.setStatus('current') if mibBuilder.loadTexts: bfdSessDestinationUdpPort.setDescription("This object specifies the destination UDP port number used for this BFD session's control packets. The value may be zero(0) if the session is in adminDown(1) state.") bfdSessSourceUdpPort = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 7), BfdCtrlSourcePortNumberTC()).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessSourceUdpPort.setStatus('current') if mibBuilder.loadTexts: bfdSessSourceUdpPort.setDescription("This object specifies the source UDP port number used for this BFD session's control packets. The value may be zero(0) if the session is in adminDown(1) state. Upon creation of a new BFD session via this MIB, the value of zero(0) specified would permit the implementation to choose its own source port number.") bfdSessEchoSourceUdpPort = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 8), InetPortNumber()).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessEchoSourceUdpPort.setStatus('current') if mibBuilder.loadTexts: bfdSessEchoSourceUdpPort.setDescription("This object specifies the source UDP port number used for this BFD session's echo packets. The value may be zero(0) if the session is not running in the echo mode, or the session is in adminDown(1) state. Upon creation of a new BFD session via this MIB, the value of zero(0) would permit the implementation to choose its own source port number.") bfdSessAdminStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 9), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3, 4))).clone(namedValues=NamedValues(("enabled", 1), ("disabled", 2), ("adminDown", 3), ("down", 4)))).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessAdminStatus.setStatus('current') if mibBuilder.loadTexts: bfdSessAdminStatus.setDescription('Denotes the desired operational status of the BFD Session. A transition to enabled(1) will start the BFD state machine for the session. The state machine will have an initial state of down(2). A transition to disabled(2) will stop the BFD state machine for the session. The state machine may first transition to adminDown(1) prior to stopping. A transition to adminDown(3) will cause the BFD state machine to transition to adminDown(1), and will cause the session to remain in this state. A transition to down(4) will cause the BFD state machine to transition to down(2), and will cause the session to remain in this state. Care should be used in providing write access to this object without adequate authentication.') bfdSessOperStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 10), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2, 3))).clone(namedValues=NamedValues(("up", 1), ("down", 2), ("adminDown", 3)))).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessOperStatus.setStatus('current') if mibBuilder.loadTexts: bfdSessOperStatus.setDescription('Denotes the actual operational status of the BFD Session. If the value of bfdOperStatus is down(2), this value MUST eventually be down(2) as well. If the value of bfdOperStatus is adminDown(3), this value MUST eventually be adminDown(3) as well.') bfdSessState = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 11), IANAbfdSessStateTC()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessState.setStatus('current') if mibBuilder.loadTexts: bfdSessState.setDescription('Configured BFD session state.') bfdSessRemoteHeardFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 12), TruthValue()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessRemoteHeardFlag.setReference('Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessRemoteHeardFlag.setStatus('current') if mibBuilder.loadTexts: bfdSessRemoteHeardFlag.setDescription('This object specifies status of BFD packet reception from the remote system. Specifically, it is set to true(1) if the local system is actively receiving BFD packets from the remote system, and is set to false(2) if the local system has not received BFD packets recently (within the detection time) or if the local system is attempting to tear down the BFD session.') bfdSessDiag = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 13), IANAbfdDiagTC()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessDiag.setStatus('current') if mibBuilder.loadTexts: bfdSessDiag.setDescription("A diagnostic code specifying the local system's reason for the last transition of the session from up(4) to some other state.") bfdSessOperMode = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 14), IANAbfdSessOperModeTC()).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessOperMode.setStatus('current') if mibBuilder.loadTexts: bfdSessOperMode.setDescription('This object specifies the operational mode of this BFD session.') bfdSessDemandModeDesiredFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 15), TruthValue().clone('false')).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessDemandModeDesiredFlag.setStatus('current') if mibBuilder.loadTexts: bfdSessDemandModeDesiredFlag.setDescription("This object indicates that the local system's desire to use Demand mode. Specifically, it is set to true(1) if the local system wishes to use Demand mode or false(2) if not") bfdSessControlPlaneIndepFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 16), TruthValue().clone('false')).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessControlPlaneIndepFlag.setStatus('current') if mibBuilder.loadTexts: bfdSessControlPlaneIndepFlag.setDescription("This object indicates that the local system's ability to continue to function through a disruption of the control plane. Specifically, it is set to true(1) if the local system BFD implementation is independent of the control plane. Otherwise, the value is set to false(2)") bfdSessMultipointFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 17), TruthValue().clone('false')).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessMultipointFlag.setStatus('current') if mibBuilder.loadTexts: bfdSessMultipointFlag.setDescription('This object indicates the Multipoint (M) bit for this session. It is set to true(1) if Multipoint (M) bit is set to 1. Otherwise, the value is set to false(2)') bfdSessInterface = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 18), InterfaceIndexOrZero()).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessInterface.setStatus('current') if mibBuilder.loadTexts: bfdSessInterface.setDescription('This object contains an interface index used to indicate the interface which this BFD session is running on. This value can be zero if there is no interface associated with this BFD session.') bfdSessSrcAddrType = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 19), InetAddressType()).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessSrcAddrType.setStatus('current') if mibBuilder.loadTexts: bfdSessSrcAddrType.setDescription('This object specifies IP address type of the source IP address of this BFD session. The value of unknown(0) is allowed only when the session is singleHop(1) and the source IP address of this BFD session is derived from the outgoing interface, or when the BFD session is not associated with a specific interface. If any other unsupported values are attempted in a set operation, the agent MUST return an inconsistentValue error.') bfdSessSrcAddr = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 20), InetAddress().subtype(subtypeSpec=ValueSizeConstraint(4, 4)).setFixedLength(4)).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessSrcAddr.setStatus('current') if mibBuilder.loadTexts: bfdSessSrcAddr.setDescription('This object specifies the source IP address of this BFD session. The format of this object is controlled by the bfdSessSrcAddrType object.') bfdSessDstAddrType = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 21), InetAddressType()).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessDstAddrType.setStatus('current') if mibBuilder.loadTexts: bfdSessDstAddrType.setDescription('This object specifies IP address type of the neighboring IP address which is being monitored with this BFD session. The value of unknown(0) is allowed only when the session is singleHop(1) and the outgoing interface is of type point-to-point, or when the BFD session is not associated with a specific interface. If any other unsupported values are attempted in a set operation, the agent MUST return an inconsistentValue error.') bfdSessDstAddr = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 22), InetAddress().subtype(subtypeSpec=ValueSizeConstraint(4, 4)).setFixedLength(4)).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessDstAddr.setStatus('current') if mibBuilder.loadTexts: bfdSessDstAddr.setDescription('This object specifies the neighboring IP address which is being monitored with this BFD session. The format of this object is controlled by the bfdSessDstAddrType object.') bfdSessGTSM = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 23), TruthValue().clone('true')).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessGTSM.setReference('RFC5082, The Generalized TTL Security Mechanism (GTSM). RFC5881, Section 5') if mibBuilder.loadTexts: bfdSessGTSM.setStatus('current') if mibBuilder.loadTexts: bfdSessGTSM.setDescription('Setting the value of this object to false(2) will disable GTSM protection of the BFD session. GTSM MUST be enabled on a singleHop(1) session if no authentication is in use.') bfdSessGTSMTTL = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 24), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 255)).clone(255)).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessGTSMTTL.setReference('RFC5082, The Generalized TTL Security Mechanism (GTSM). RFC5881, Section 5') if mibBuilder.loadTexts: bfdSessGTSMTTL.setStatus('current') if mibBuilder.loadTexts: bfdSessGTSMTTL.setDescription('This object is valid only when bfdSessGTSM protection is enabled on the system. This object indicates the minimum allowed TTL for received BFD control packets. For a singleHop(1) session, if GTSM protection is enabled, this object SHOULD be set to maximum TTL value allowed for single hop. By default, GTSM is enabled and TTL value is 255. For a multihop session, updating of maximum TTL value allowed is likely required.') bfdSessDesiredMinTxInterval = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 25), BfdIntervalTC()).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessDesiredMinTxInterval.setReference('Section 4.1 from Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessDesiredMinTxInterval.setStatus('current') if mibBuilder.loadTexts: bfdSessDesiredMinTxInterval.setDescription('This object specifies the minimum interval, in microseconds, that the local system would like to use when transmitting BFD Control packets. The value of zero(0) is reserved in this case, and should not be used.') bfdSessReqMinRxInterval = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 26), BfdIntervalTC()).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessReqMinRxInterval.setReference('Section 4.1 from Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessReqMinRxInterval.setStatus('current') if mibBuilder.loadTexts: bfdSessReqMinRxInterval.setDescription('This object specifies the minimum interval, in microseconds, between received BFD Control packets the local system is capable of supporting. The value of zero(0) can be specified when the transmitting system does not want the remote system to send any periodic BFD control packets.') bfdSessReqMinEchoRxInterval = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 27), BfdIntervalTC()).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessReqMinEchoRxInterval.setStatus('current') if mibBuilder.loadTexts: bfdSessReqMinEchoRxInterval.setDescription('This object specifies the minimum interval, in microseconds, between received BFD Echo packets that this system is capable of supporting. Value must be zero(0) if this is a multihop BFD session.') bfdSessDetectMult = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 28), BfdMultiplierTC()).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessDetectMult.setStatus('current') if mibBuilder.loadTexts: bfdSessDetectMult.setDescription('This object specifies the Detect time multiplier.') bfdSessNegotiatedInterval = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 29), BfdIntervalTC()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessNegotiatedInterval.setStatus('current') if mibBuilder.loadTexts: bfdSessNegotiatedInterval.setDescription('This object specifies the negotiated interval, in microseconds, that the local system is transmitting BFD Control packets.') bfdSessNegotiatedEchoInterval = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 30), BfdIntervalTC()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessNegotiatedEchoInterval.setStatus('current') if mibBuilder.loadTexts: bfdSessNegotiatedEchoInterval.setDescription('This object specifies the negotiated interval, in microseconds, that the local system is transmitting BFD echo packets. Value is expected to be zero if the sessions is not running in echo mode.') bfdSessNegotiatedDetectMult = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 31), BfdMultiplierTC()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessNegotiatedDetectMult.setStatus('current') if mibBuilder.loadTexts: bfdSessNegotiatedDetectMult.setDescription('This object specifies the Detect time multiplier.') bfdSessAuthPresFlag = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 32), TruthValue().clone('false')).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessAuthPresFlag.setReference('Sections 4.2 - 4.4 from Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessAuthPresFlag.setStatus('current') if mibBuilder.loadTexts: bfdSessAuthPresFlag.setDescription("This object indicates that the local system's desire to use Authentication. Specifically, it is set to true(1) if the local system wishes the session to be authenticated or false(2) if not.") bfdSessAuthenticationType = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 33), IANAbfdSessAuthenticationTypeTC().clone('noAuthentication')).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessAuthenticationType.setReference('Sections 4.2 - 4.4 from Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessAuthenticationType.setStatus('current') if mibBuilder.loadTexts: bfdSessAuthenticationType.setDescription('The Authentication Type used for this BFD session. This field is valid only when the Authentication Present bit is set. Max-access to this object as well as other authentication related objects are set to read-create in order to support management of a single key ID at a time, key rotation is not handled. Key update in practice must be done by atomic update using a set containing all affected objects in the same varBindList or otherwise risk the session dropping.') bfdSessAuthenticationKeyID = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 34), Integer32().subtype(subtypeSpec=ConstraintsUnion(ValueRangeConstraint(-1, -1), ValueRangeConstraint(0, 255), )).clone(-1)).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessAuthenticationKeyID.setReference('Sections 4.2 - 4.4 from Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessAuthenticationKeyID.setStatus('current') if mibBuilder.loadTexts: bfdSessAuthenticationKeyID.setDescription('The authentication key ID in use for this session. This object permits multiple keys to be active simultaneously. The value -1 indicates that no Authentication Key ID will be present in the optional BFD Authentication Section.') bfdSessAuthenticationKey = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 35), IANAbfdSessAuthenticationKeyTC()).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessAuthenticationKey.setReference('Sections 4.2 - 4.4 from Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessAuthenticationKey.setStatus('current') if mibBuilder.loadTexts: bfdSessAuthenticationKey.setDescription('The authentication key. When the bfdSessAuthenticationType is simplePassword(1), the value of this object is the password present in the BFD packets. When the bfdSessAuthenticationType is one of the keyed authentication types, this value is used in the computation of the key present in the BFD authentication packet.') bfdSessStorageType = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 36), StorageType()).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessStorageType.setStatus('current') if mibBuilder.loadTexts: bfdSessStorageType.setDescription("This variable indicates the storage type for this object. Conceptual rows having the value 'permanent' need not allow write-access to any columnar objects in the row.") bfdSessRowStatus = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 37), RowStatus()).setMaxAccess("readcreate") if mibBuilder.loadTexts: bfdSessRowStatus.setStatus('current') if mibBuilder.loadTexts: bfdSessRowStatus.setDescription('This variable is used to create, modify, and/or delete a row in this table. When a row in this table has a row in the active(1) state, no objects in this row can be modified except the bfdSessRowStatus and bfdSessStorageType.') bfdSessPerfTable = MibTable((1, 3, 6, 1, 2, 1, 222, 1, 3), ) if mibBuilder.loadTexts: bfdSessPerfTable.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfTable.setDescription('This table specifies BFD Session performance counters.') bfdSessPerfEntry = MibTableRow((1, 3, 6, 1, 2, 1, 222, 1, 3, 1), ) bfdSessEntry.registerAugmentions(("BFD-STD-MIB", "bfdSessPerfEntry")) bfdSessPerfEntry.setIndexNames(*bfdSessEntry.getIndexNames()) if mibBuilder.loadTexts: bfdSessPerfEntry.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEntry.setDescription('An entry in this table is created by a BFD-enabled node for every BFD Session. bfdSessPerfDiscTime is used to indicate potential discontinuity for all counter objects in this table.') bfdSessPerfCtrlPktIn = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 1), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfCtrlPktIn.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfCtrlPktIn.setDescription('The total number of BFD control messages received for this BFD session. It MUST be equal to the least significant 32 bits of bfdSessPerfCtrlPktInHC if supported, and MUST do so with the rules spelled out in RFC 2863.') bfdSessPerfCtrlPktOut = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 2), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfCtrlPktOut.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfCtrlPktOut.setDescription('The total number of BFD control messages sent for this BFD session. It MUST be equal to the least significant 32 bits of bfdSessPerfCtrlPktOutHC if supported, and MUST do so with the rules spelled out in RFC 2863.') bfdSessPerfCtrlPktDrop = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 3), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfCtrlPktDrop.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfCtrlPktDrop.setDescription('The total number of BFD control messages received for this session yet dropped for being invalid. It MUST be equal to the least significant 32 bits of bfdSessPerfCtrlPktDropHC if supported, and MUST do so with the rules spelled out in RFC 2863.') bfdSessPerfCtrlPktDropLastTime = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 4), TimeStamp()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfCtrlPktDropLastTime.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfCtrlPktDropLastTime.setDescription('The value of sysUpTime on the most recent occasion at which received BFD control message for this session was dropped. If no such up event exists, this object contains a zero value.') bfdSessPerfEchoPktIn = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 5), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfEchoPktIn.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEchoPktIn.setDescription('The total number of BFD echo messages received for this BFD session. It MUST be equal to the least significant 32 bits of bfdSessPerfEchoPktInHC if supported, and MUST do so with the rules spelled out in RFC 2863.') bfdSessPerfEchoPktOut = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 6), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfEchoPktOut.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEchoPktOut.setDescription('The total number of BFD echo messages sent for this BFD session. It MUST be equal to the least significant 32 bits of bfdSessPerfEchoPktOutHC if supported, and MUST do so with the rules spelled out in RFC 2863.') bfdSessPerfEchoPktDrop = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 7), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfEchoPktDrop.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEchoPktDrop.setDescription('The total number of BFD echo messages received for this session yet dropped for being invalid. It MUST be equal to the least significant 32 bits of bfdSessPerfEchoPktDropHC if supported, and MUST do so with the rules spelled out in RFC 2863.') bfdSessPerfEchoPktDropLastTime = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 8), TimeStamp()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfEchoPktDropLastTime.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEchoPktDropLastTime.setDescription('The value of sysUpTime on the most recent occasion at which received BFD echo message for this session was dropped. If no such up event has been issued, this object contains a zero value.') bfdSessUpTime = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 9), TimeStamp()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessUpTime.setStatus('current') if mibBuilder.loadTexts: bfdSessUpTime.setDescription('The value of sysUpTime on the most recent occasion at which the session came up. If no such event has been issued, this object contains a zero value.') bfdSessPerfLastSessDownTime = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 10), TimeStamp()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfLastSessDownTime.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfLastSessDownTime.setDescription('The value of sysUpTime on the most recent occasion at which the last time communication was lost with the neighbor. If no down event has been issued this object contains a zero value.') bfdSessPerfLastCommLostDiag = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 11), IANAbfdDiagTC()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfLastCommLostDiag.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfLastCommLostDiag.setDescription('The BFD diag code for the last time communication was lost with the neighbor. If such an event has not been issued this object contains a zero value.') bfdSessPerfSessUpCount = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 12), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfSessUpCount.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfSessUpCount.setDescription('The number of times this session has gone into the Up state since the system last rebooted.') bfdSessPerfDiscTime = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 13), TimeStamp()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfDiscTime.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfDiscTime.setDescription('The value of sysUpTime on the most recent occasion at which any one or more of the session counters suffered a discontinuity. The relevant counters are the specific instances associated with this BFD session of any Counter32 object contained in the BfdSessPerfTable. If no such discontinuities have occurred since the last re-initialization of the local management subsystem, then this object contains a zero value.') bfdSessPerfCtrlPktInHC = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 14), Counter64()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfCtrlPktInHC.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfCtrlPktInHC.setDescription('This value represents the total number of BFD control messages received for this BFD session. The least significant 32 bits MUST equal to bfdSessPerfCtrlPktIn, and MUST do so with the rules spelled out in RFC 2863.') bfdSessPerfCtrlPktOutHC = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 15), Counter64()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfCtrlPktOutHC.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfCtrlPktOutHC.setDescription('This value represents the total number of BFD control messages transmitted for this BFD session. The least significant 32 bits MUST equal to bfdSessPerfCtrlPktOut, and MUST do so with the rules spelled out in RFC 2863.') bfdSessPerfCtrlPktDropHC = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 16), Counter64()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfCtrlPktDropHC.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfCtrlPktDropHC.setDescription('This value represents the total number of BFD control messages received for this BFD session yet dropped for being invalid. The least significant 32 bits MUST equal to bfdSessPerfCtrlPktDrop, and MUST do so with the rules spelled out in RFC 2863.') bfdSessPerfEchoPktInHC = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 17), Counter64()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfEchoPktInHC.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEchoPktInHC.setDescription('This value represents the total number of BFD echo messages received for this BFD session. The least significant 32 bits MUST equal to bfdSessPerfEchoPktIn, and MUST do so with the rules spelled out in RFC 2863.') bfdSessPerfEchoPktOutHC = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 18), Counter64()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfEchoPktOutHC.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEchoPktOutHC.setDescription('This value represents the total number of BFD echo messages transmitted for this BFD session. The least significant 32 bits MUST equal to bfdSessPerfEchoPktOut, and MUST do so with the rules spelled out in RFC 2863.') bfdSessPerfEchoPktDropHC = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 19), Counter64()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessPerfEchoPktDropHC.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEchoPktDropHC.setDescription('This value represents the total number of BFD echo messages received for this BFD session yet dropped for being invalid. The least significant 32 bits MUST equal to bfdSessPerfEchoPktDrop, and MUST do so with the rules spelled out in RFC 2863.') bfdSessDiscMapTable = MibTable((1, 3, 6, 1, 2, 1, 222, 1, 4), ) if mibBuilder.loadTexts: bfdSessDiscMapTable.setStatus('current') if mibBuilder.loadTexts: bfdSessDiscMapTable.setDescription("The BFD Session Discriminator Mapping Table maps a local discriminator value to associated BFD session's bfdSessIndex found in the bfdSessionTable.") bfdSessDiscMapEntry = MibTableRow((1, 3, 6, 1, 2, 1, 222, 1, 4, 1), ).setIndexNames((0, "BFD-STD-MIB", "bfdSessDiscriminator")) if mibBuilder.loadTexts: bfdSessDiscMapEntry.setStatus('current') if mibBuilder.loadTexts: bfdSessDiscMapEntry.setDescription('The BFD Session Discriminator Mapping Entry specifies a mapping between a local discriminator and a BFD session.') bfdSessDiscMapIndex = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 4, 1, 1), BfdSessIndexTC()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessDiscMapIndex.setStatus('current') if mibBuilder.loadTexts: bfdSessDiscMapIndex.setDescription('This object specifies a mapping between a local discriminator and a BFD Session in the BfdSessTable.') bfdSessIpMapTable = MibTable((1, 3, 6, 1, 2, 1, 222, 1, 5), ) if mibBuilder.loadTexts: bfdSessIpMapTable.setStatus('current') if mibBuilder.loadTexts: bfdSessIpMapTable.setDescription('The BFD Session IP Mapping Table maps given bfdSessInterface, bfdSessSrcAddrType, bfdSessSrcAddr, bfdSessDstAddrType and bfdSessDstAddr to an associated BFD session found in the bfdSessionTable.') bfdSessIpMapEntry = MibTableRow((1, 3, 6, 1, 2, 1, 222, 1, 5, 1), ).setIndexNames((0, "BFD-STD-MIB", "bfdSessInterface"), (0, "BFD-STD-MIB", "bfdSessSrcAddrType"), (0, "BFD-STD-MIB", "bfdSessSrcAddr"), (0, "BFD-STD-MIB", "bfdSessDstAddrType"), (0, "BFD-STD-MIB", "bfdSessDstAddr")) if mibBuilder.loadTexts: bfdSessIpMapEntry.setStatus('current') if mibBuilder.loadTexts: bfdSessIpMapEntry.setDescription('The BFD Session IP Map Entry contains a mapping from the IP information for a session, to the session in the bfdSessionTable.') bfdSessIpMapIndex = MibTableColumn((1, 3, 6, 1, 2, 1, 222, 1, 5, 1, 1), BfdSessIndexTC()).setMaxAccess("readonly") if mibBuilder.loadTexts: bfdSessIpMapIndex.setStatus('current') if mibBuilder.loadTexts: bfdSessIpMapIndex.setDescription('This object specifies the BfdSessIndexTC referred to by the indexes of this row. In essence, a mapping is provided between these indexes and the BfdSessTable.') bfdSessUp = NotificationType((1, 3, 6, 1, 2, 1, 222, 0, 1)).setObjects(("BFD-STD-MIB", "bfdSessDiag"), ("BFD-STD-MIB", "bfdSessDiag")) if mibBuilder.loadTexts: bfdSessUp.setStatus('current') if mibBuilder.loadTexts: bfdSessUp.setDescription('This notification is generated when the bfdSessState object for one or more contiguous entries in bfdSessTable are about to enter the up(4) state from some other state. The included values of bfdSessDiag MUST both be set equal to this new state (i.e: up(4)). The two instances of bfdSessDiag in this notification indicate the range of indexes that are affected. Note that all the indexes of the two ends of the range can be derived from the instance identifiers of these two objects. For the cases where a contiguous range of sessions have transitioned into the up(4) state at roughly the same time, the device SHOULD issue a single notification for each range of contiguous indexes in an effort to minimize the emission of a large number of notifications. If a notification has to be issued for just a single bfdSessEntry, then the instance identifier (and values) of the two bfdSessDiag objects MUST be the identical.') bfdSessDown = NotificationType((1, 3, 6, 1, 2, 1, 222, 0, 2)).setObjects(("BFD-STD-MIB", "bfdSessDiag"), ("BFD-STD-MIB", "bfdSessDiag")) if mibBuilder.loadTexts: bfdSessDown.setStatus('current') if mibBuilder.loadTexts: bfdSessDown.setDescription('This notification is generated when the bfdSessState object for one or more contiguous entries in bfdSessTable are about to enter the down(2) or adminDown(1) states from some other state. The included values of bfdSessDiag MUST both be set equal to this new state (i.e: down(2) or adminDown(1)). The two instances of bfdSessDiag in this notification indicate the range of indexes that are affected. Note that all the indexes of the two ends of the range can be derived from the instance identifiers of these two objects. For cases where a contiguous range of sessions have transitioned into the down(2) or adminDown(1) states at roughly the same time, the device SHOULD issue a single notification for each range of contiguous indexes in an effort to minimize the emission of a large number of notifications. If a notification has to be issued for just a single bfdSessEntry, then the instance identifier (and values) of the two bfdSessDiag objects MUST be the identical.') bfdGroups = MibIdentifier((1, 3, 6, 1, 2, 1, 222, 2, 1)) bfdCompliances = MibIdentifier((1, 3, 6, 1, 2, 1, 222, 2, 2)) bfdModuleFullCompliance = ModuleCompliance((1, 3, 6, 1, 2, 1, 222, 2, 2, 1)).setObjects(("BFD-STD-MIB", "bfdSessionGroup"), ("BFD-STD-MIB", "bfdSessionReadOnlyGroup"), ("BFD-STD-MIB", "bfdSessionPerfGroup"), ("BFD-STD-MIB", "bfdNotificationGroup"), ("BFD-STD-MIB", "bfdSessionPerfHCGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): bfdModuleFullCompliance = bfdModuleFullCompliance.setStatus('current') if mibBuilder.loadTexts: bfdModuleFullCompliance.setDescription('Compliance statement for agents that provide full support for the BFD-MIB module. Such devices can then be monitored and also be configured using this MIB module.') bfdModuleReadOnlyCompliance = ModuleCompliance((1, 3, 6, 1, 2, 1, 222, 2, 2, 2)).setObjects(("BFD-STD-MIB", "bfdSessionGroup"), ("BFD-STD-MIB", "bfdSessionReadOnlyGroup"), ("BFD-STD-MIB", "bfdSessionPerfGroup"), ("BFD-STD-MIB", "bfdNotificationGroup"), ("BFD-STD-MIB", "bfdSessionPerfHCGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): bfdModuleReadOnlyCompliance = bfdModuleReadOnlyCompliance.setStatus('current') if mibBuilder.loadTexts: bfdModuleReadOnlyCompliance.setDescription('Compliance requirement for implementations that only provide read-only support for BFD-MIB. Such devices can then be monitored but cannot be configured using this MIB module.') bfdSessionGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 222, 2, 1, 1)).setObjects(("BFD-STD-MIB", "bfdAdminStatus"), ("BFD-STD-MIB", "bfdOperStatus"), ("BFD-STD-MIB", "bfdNotificationsEnable"), ("BFD-STD-MIB", "bfdSessVersionNumber"), ("BFD-STD-MIB", "bfdSessType"), ("BFD-STD-MIB", "bfdSessIndexNext"), ("BFD-STD-MIB", "bfdSessDiscriminator"), ("BFD-STD-MIB", "bfdSessDestinationUdpPort"), ("BFD-STD-MIB", "bfdSessSourceUdpPort"), ("BFD-STD-MIB", "bfdSessEchoSourceUdpPort"), ("BFD-STD-MIB", "bfdSessAdminStatus"), ("BFD-STD-MIB", "bfdSessOperStatus"), ("BFD-STD-MIB", "bfdSessOperMode"), ("BFD-STD-MIB", "bfdSessDemandModeDesiredFlag"), ("BFD-STD-MIB", "bfdSessControlPlaneIndepFlag"), ("BFD-STD-MIB", "bfdSessMultipointFlag"), ("BFD-STD-MIB", "bfdSessInterface"), ("BFD-STD-MIB", "bfdSessSrcAddrType"), ("BFD-STD-MIB", "bfdSessSrcAddr"), ("BFD-STD-MIB", "bfdSessDstAddrType"), ("BFD-STD-MIB", "bfdSessDstAddr"), ("BFD-STD-MIB", "bfdSessGTSM"), ("BFD-STD-MIB", "bfdSessGTSMTTL"), ("BFD-STD-MIB", "bfdSessDesiredMinTxInterval"), ("BFD-STD-MIB", "bfdSessReqMinRxInterval"), ("BFD-STD-MIB", "bfdSessReqMinEchoRxInterval"), ("BFD-STD-MIB", "bfdSessDetectMult"), ("BFD-STD-MIB", "bfdSessAuthPresFlag"), ("BFD-STD-MIB", "bfdSessAuthenticationType"), ("BFD-STD-MIB", "bfdSessAuthenticationKeyID"), ("BFD-STD-MIB", "bfdSessAuthenticationKey"), ("BFD-STD-MIB", "bfdSessStorageType"), ("BFD-STD-MIB", "bfdSessRowStatus")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): bfdSessionGroup = bfdSessionGroup.setStatus('current') if mibBuilder.loadTexts: bfdSessionGroup.setDescription('Collection of objects needed for BFD sessions.') bfdSessionReadOnlyGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 222, 2, 1, 2)).setObjects(("BFD-STD-MIB", "bfdSessRemoteDiscr"), ("BFD-STD-MIB", "bfdSessState"), ("BFD-STD-MIB", "bfdSessRemoteHeardFlag"), ("BFD-STD-MIB", "bfdSessDiag"), ("BFD-STD-MIB", "bfdSessNegotiatedInterval"), ("BFD-STD-MIB", "bfdSessNegotiatedEchoInterval"), ("BFD-STD-MIB", "bfdSessNegotiatedDetectMult"), ("BFD-STD-MIB", "bfdSessDiscMapIndex"), ("BFD-STD-MIB", "bfdSessIpMapIndex")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): bfdSessionReadOnlyGroup = bfdSessionReadOnlyGroup.setStatus('current') if mibBuilder.loadTexts: bfdSessionReadOnlyGroup.setDescription('Collection of read-only objects needed for BFD sessions.') bfdSessionPerfGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 222, 2, 1, 3)).setObjects(("BFD-STD-MIB", "bfdSessPerfCtrlPktIn"), ("BFD-STD-MIB", "bfdSessPerfCtrlPktOut"), ("BFD-STD-MIB", "bfdSessPerfCtrlPktDrop"), ("BFD-STD-MIB", "bfdSessPerfCtrlPktDropLastTime"), ("BFD-STD-MIB", "bfdSessPerfEchoPktIn"), ("BFD-STD-MIB", "bfdSessPerfEchoPktOut"), ("BFD-STD-MIB", "bfdSessPerfEchoPktDrop"), ("BFD-STD-MIB", "bfdSessPerfEchoPktDropLastTime"), ("BFD-STD-MIB", "bfdSessUpTime"), ("BFD-STD-MIB", "bfdSessPerfLastSessDownTime"), ("BFD-STD-MIB", "bfdSessPerfLastCommLostDiag"), ("BFD-STD-MIB", "bfdSessPerfSessUpCount"), ("BFD-STD-MIB", "bfdSessPerfDiscTime")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): bfdSessionPerfGroup = bfdSessionPerfGroup.setStatus('current') if mibBuilder.loadTexts: bfdSessionPerfGroup.setDescription('Collection of objects needed to monitor the performance of BFD sessions.') bfdSessionPerfHCGroup = ObjectGroup((1, 3, 6, 1, 2, 1, 222, 2, 1, 4)).setObjects(("BFD-STD-MIB", "bfdSessPerfCtrlPktInHC"), ("BFD-STD-MIB", "bfdSessPerfCtrlPktOutHC"), ("BFD-STD-MIB", "bfdSessPerfCtrlPktDropHC"), ("BFD-STD-MIB", "bfdSessPerfEchoPktInHC"), ("BFD-STD-MIB", "bfdSessPerfEchoPktOutHC"), ("BFD-STD-MIB", "bfdSessPerfEchoPktDropHC")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): bfdSessionPerfHCGroup = bfdSessionPerfHCGroup.setStatus('current') if mibBuilder.loadTexts: bfdSessionPerfHCGroup.setDescription('Collection of objects needed to monitor the performance of BFD sessions for which the values of bfdSessPerfPktIn, bfdSessPerfPktOut wrap around too quickly.') bfdNotificationGroup = NotificationGroup((1, 3, 6, 1, 2, 1, 222, 2, 1, 5)).setObjects(("BFD-STD-MIB", "bfdSessUp"), ("BFD-STD-MIB", "bfdSessDown")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): bfdNotificationGroup = bfdNotificationGroup.setStatus('current') if mibBuilder.loadTexts: bfdNotificationGroup.setDescription('Set of notifications implemented in this module.') mibBuilder.exportSymbols("BFD-STD-MIB", bfdSessDstAddr=bfdSessDstAddr, bfdSessVersionNumber=bfdSessVersionNumber, bfdSessUp=bfdSessUp, bfdSessDiscMapIndex=bfdSessDiscMapIndex, bfdSessPerfLastSessDownTime=bfdSessPerfLastSessDownTime, bfdGroups=bfdGroups, PYSNMP_MODULE_ID=bfdMIB, bfdSessSourceUdpPort=bfdSessSourceUdpPort, bfdScalarObjects=bfdScalarObjects, bfdCompliances=bfdCompliances, bfdSessSrcAddr=bfdSessSrcAddr, bfdSessPerfCtrlPktDropHC=bfdSessPerfCtrlPktDropHC, bfdSessPerfCtrlPktIn=bfdSessPerfCtrlPktIn, bfdSessEchoSourceUdpPort=bfdSessEchoSourceUdpPort, bfdSessRemoteHeardFlag=bfdSessRemoteHeardFlag, bfdSessionGroup=bfdSessionGroup, bfdSessOperStatus=bfdSessOperStatus, bfdSessDestinationUdpPort=bfdSessDestinationUdpPort, bfdSessDetectMult=bfdSessDetectMult, bfdSessStorageType=bfdSessStorageType, bfdSessReqMinEchoRxInterval=bfdSessReqMinEchoRxInterval, bfdSessDiscriminator=bfdSessDiscriminator, bfdSessControlPlaneIndepFlag=bfdSessControlPlaneIndepFlag, bfdSessMultipointFlag=bfdSessMultipointFlag, bfdSessPerfEchoPktOutHC=bfdSessPerfEchoPktOutHC, bfdSessOperMode=bfdSessOperMode, bfdSessNegotiatedInterval=bfdSessNegotiatedInterval, bfdSessPerfEntry=bfdSessPerfEntry, bfdSessPerfSessUpCount=bfdSessPerfSessUpCount, bfdSessPerfCtrlPktOutHC=bfdSessPerfCtrlPktOutHC, bfdNotificationsEnable=bfdNotificationsEnable, bfdSessSrcAddrType=bfdSessSrcAddrType, bfdSessUpTime=bfdSessUpTime, bfdSessPerfEchoPktDropHC=bfdSessPerfEchoPktDropHC, bfdSessState=bfdSessState, bfdSessIpMapTable=bfdSessIpMapTable, bfdSessAuthenticationKeyID=bfdSessAuthenticationKeyID, bfdNotificationGroup=bfdNotificationGroup, bfdSessInterface=bfdSessInterface, bfdSessGTSMTTL=bfdSessGTSMTTL, bfdSessPerfLastCommLostDiag=bfdSessPerfLastCommLostDiag, bfdSessPerfEchoPktIn=bfdSessPerfEchoPktIn, bfdSessIndexNext=bfdSessIndexNext, bfdNotifications=bfdNotifications, bfdSessDstAddrType=bfdSessDstAddrType, bfdSessDiscMapEntry=bfdSessDiscMapEntry, bfdSessIpMapIndex=bfdSessIpMapIndex, bfdSessAuthPresFlag=bfdSessAuthPresFlag, bfdSessNegotiatedEchoInterval=bfdSessNegotiatedEchoInterval, bfdSessPerfCtrlPktOut=bfdSessPerfCtrlPktOut, bfdSessAuthenticationType=bfdSessAuthenticationType, bfdSessDiag=bfdSessDiag, bfdSessGTSM=bfdSessGTSM, bfdSessTable=bfdSessTable, bfdSessPerfCtrlPktDrop=bfdSessPerfCtrlPktDrop, bfdSessionPerfHCGroup=bfdSessionPerfHCGroup, bfdSessPerfTable=bfdSessPerfTable, bfdObjects=bfdObjects, bfdModuleFullCompliance=bfdModuleFullCompliance, bfdSessDesiredMinTxInterval=bfdSessDesiredMinTxInterval, bfdSessAuthenticationKey=bfdSessAuthenticationKey, bfdSessPerfCtrlPktInHC=bfdSessPerfCtrlPktInHC, bfdSessReqMinRxInterval=bfdSessReqMinRxInterval, bfdSessIpMapEntry=bfdSessIpMapEntry, bfdModuleReadOnlyCompliance=bfdModuleReadOnlyCompliance, bfdSessIndex=bfdSessIndex, bfdSessType=bfdSessType, bfdSessionPerfGroup=bfdSessionPerfGroup, bfdSessRemoteDiscr=bfdSessRemoteDiscr, bfdSessEntry=bfdSessEntry, bfdSessPerfDiscTime=bfdSessPerfDiscTime, bfdSessPerfEchoPktInHC=bfdSessPerfEchoPktInHC, bfdConformance=bfdConformance, bfdSessPerfCtrlPktDropLastTime=bfdSessPerfCtrlPktDropLastTime, bfdSessRowStatus=bfdSessRowStatus, bfdSessAdminStatus=bfdSessAdminStatus, bfdSessPerfEchoPktOut=bfdSessPerfEchoPktOut, bfdSessDown=bfdSessDown, bfdSessPerfEchoPktDropLastTime=bfdSessPerfEchoPktDropLastTime, bfdSessionReadOnlyGroup=bfdSessionReadOnlyGroup, bfdOperStatus=bfdOperStatus, bfdSessDiscMapTable=bfdSessDiscMapTable, bfdMIB=bfdMIB, bfdAdminStatus=bfdAdminStatus, bfdSessPerfEchoPktDrop=bfdSessPerfEchoPktDrop, bfdSessDemandModeDesiredFlag=bfdSessDemandModeDesiredFlag, bfdSessNegotiatedDetectMult=bfdSessNegotiatedDetectMult)
(octet_string, integer, object_identifier) = mibBuilder.importSymbols('ASN1', 'OctetString', 'Integer', 'ObjectIdentifier') (named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues') (constraints_union, value_size_constraint, constraints_intersection, value_range_constraint, single_value_constraint) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ConstraintsUnion', 'ValueSizeConstraint', 'ConstraintsIntersection', 'ValueRangeConstraint', 'SingleValueConstraint') (bfd_sess_index_tc, bfd_multiplier_tc, bfd_interval_tc, bfd_ctrl_source_port_number_tc, bfd_ctrl_dest_port_number_tc) = mibBuilder.importSymbols('BFD-TC-STD-MIB', 'BfdSessIndexTC', 'BfdMultiplierTC', 'BfdIntervalTC', 'BfdCtrlSourcePortNumberTC', 'BfdCtrlDestPortNumberTC') (index_integer_next_free,) = mibBuilder.importSymbols('DIFFSERV-DSCP-TC', 'IndexIntegerNextFree') (ian_abfd_sess_authentication_type_tc, ian_abfd_sess_authentication_key_tc, ian_abfd_sess_type_tc, ian_abfd_diag_tc, ian_abfd_sess_state_tc, ian_abfd_sess_oper_mode_tc) = mibBuilder.importSymbols('IANA-BFD-TC-STD-MIB', 'IANAbfdSessAuthenticationTypeTC', 'IANAbfdSessAuthenticationKeyTC', 'IANAbfdSessTypeTC', 'IANAbfdDiagTC', 'IANAbfdSessStateTC', 'IANAbfdSessOperModeTC') (interface_index_or_zero,) = mibBuilder.importSymbols('IF-MIB', 'InterfaceIndexOrZero') (inet_address, inet_port_number, inet_address_type) = mibBuilder.importSymbols('INET-ADDRESS-MIB', 'InetAddress', 'InetPortNumber', 'InetAddressType') (notification_group, object_group, module_compliance) = mibBuilder.importSymbols('SNMPv2-CONF', 'NotificationGroup', 'ObjectGroup', 'ModuleCompliance') (mib_identifier, bits, notification_type, time_ticks, module_identity, gauge32, unsigned32, counter64, ip_address, object_identity, counter32, iso, mib_scalar, mib_table, mib_table_row, mib_table_column, integer32, mib_2) = mibBuilder.importSymbols('SNMPv2-SMI', 'MibIdentifier', 'Bits', 'NotificationType', 'TimeTicks', 'ModuleIdentity', 'Gauge32', 'Unsigned32', 'Counter64', 'IpAddress', 'ObjectIdentity', 'Counter32', 'iso', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'Integer32', 'mib-2') (time_stamp, textual_convention, row_status, truth_value, storage_type, display_string) = mibBuilder.importSymbols('SNMPv2-TC', 'TimeStamp', 'TextualConvention', 'RowStatus', 'TruthValue', 'StorageType', 'DisplayString') bfd_mib = module_identity((1, 3, 6, 1, 2, 1, 222)) bfdMIB.setRevisions(('2014-08-12 00:00',)) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): if mibBuilder.loadTexts: bfdMIB.setRevisionsDescriptions(('Initial version. Published as RFC 7331.',)) if mibBuilder.loadTexts: bfdMIB.setLastUpdated('201408120000Z') if mibBuilder.loadTexts: bfdMIB.setOrganization('IETF Bidirectional Forwarding Detection Working Group') if mibBuilder.loadTexts: bfdMIB.setContactInfo('Thomas D. Nadeau Brocade Email: tnadeau@lucidvision.com Zafar Ali Cisco Systems, Inc. Email: zali@cisco.com Nobo Akiya Cisco Systems, Inc. Email: nobo@cisco.com Comments about this document should be emailed directly to the BFD Working Group mailing list at rtg-bfd@ietf.org') if mibBuilder.loadTexts: bfdMIB.setDescription("Bidirectional Forwarding Management Information Base. Copyright (c) 2014 IETF Trust and the persons identified as authors of the code. All rights reserved. Redistribution and use in source and binary forms, with or without modification, is permitted pursuant to, and subject to the license terms contained in, the Simplified BSD License set forth in Section 4.c of the IETF Trust's Legal Provisions Relating to IETF Documents (http://trustee.ietf.org/license-info).") bfd_notifications = mib_identifier((1, 3, 6, 1, 2, 1, 222, 0)) bfd_objects = mib_identifier((1, 3, 6, 1, 2, 1, 222, 1)) bfd_conformance = mib_identifier((1, 3, 6, 1, 2, 1, 222, 2)) bfd_scalar_objects = mib_identifier((1, 3, 6, 1, 2, 1, 222, 1, 1)) bfd_admin_status = mib_scalar((1, 3, 6, 1, 2, 1, 222, 1, 1, 1), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4))).clone(namedValues=named_values(('enabled', 1), ('disabled', 2), ('adminDown', 3), ('down', 4)))).setMaxAccess('readwrite') if mibBuilder.loadTexts: bfdAdminStatus.setStatus('current') if mibBuilder.loadTexts: bfdAdminStatus.setDescription('The desired global administrative status of the BFD system in this device.') bfd_oper_status = mib_scalar((1, 3, 6, 1, 2, 1, 222, 1, 1, 2), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('up', 1), ('down', 2), ('adminDown', 3)))).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdOperStatus.setStatus('current') if mibBuilder.loadTexts: bfdOperStatus.setDescription('Indicates the actual operational status of the BFD system in this device. When this value is down(2), all entries in the bfdSessTable MUST have their bfdSessOperStatus as down(2) as well. When this value is adminDown(3), all entries in the bfdSessTable MUST have their bfdSessOperStatus as adminDown(3) as well.') bfd_notifications_enable = mib_scalar((1, 3, 6, 1, 2, 1, 222, 1, 1, 3), truth_value().clone('false')).setMaxAccess('readwrite') if mibBuilder.loadTexts: bfdNotificationsEnable.setReference('See also RFC3413 for explanation that notifications are under the ultimate control of the MIB modules in this document.') if mibBuilder.loadTexts: bfdNotificationsEnable.setStatus('current') if mibBuilder.loadTexts: bfdNotificationsEnable.setDescription('If this object is set to true(1), then it enables the emission of bfdSessUp and bfdSessDown notifications; otherwise these notifications are not emitted.') bfd_sess_index_next = mib_scalar((1, 3, 6, 1, 2, 1, 222, 1, 1, 4), index_integer_next_free().subtype(subtypeSpec=value_range_constraint(0, 4294967295))).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessIndexNext.setStatus('current') if mibBuilder.loadTexts: bfdSessIndexNext.setDescription('This object contains an unused value for bfdSessIndex that can be used when creating entries in the table. A zero indicates that no entries are available, but MUST NOT be used as a valid index. ') bfd_sess_table = mib_table((1, 3, 6, 1, 2, 1, 222, 1, 2)) if mibBuilder.loadTexts: bfdSessTable.setReference('Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessTable.setStatus('current') if mibBuilder.loadTexts: bfdSessTable.setDescription('The BFD Session Table describes the BFD sessions.') bfd_sess_entry = mib_table_row((1, 3, 6, 1, 2, 1, 222, 1, 2, 1)).setIndexNames((0, 'BFD-STD-MIB', 'bfdSessIndex')) if mibBuilder.loadTexts: bfdSessEntry.setStatus('current') if mibBuilder.loadTexts: bfdSessEntry.setDescription('The BFD Session Entry describes BFD session.') bfd_sess_index = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 1), bfd_sess_index_tc()) if mibBuilder.loadTexts: bfdSessIndex.setStatus('current') if mibBuilder.loadTexts: bfdSessIndex.setDescription('This object contains an index used to represent a unique BFD session on this device. Managers should obtain new values for row creation in this table by reading bfdSessIndexNext.') bfd_sess_version_number = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 2), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 7)).clone(1)).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessVersionNumber.setReference('Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessVersionNumber.setStatus('current') if mibBuilder.loadTexts: bfdSessVersionNumber.setDescription('The version number of the BFD protocol that this session is running in. Write access is available for this object to provide ability to set desired version for this BFD session.') bfd_sess_type = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 3), ian_abfd_sess_type_tc()).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessType.setStatus('current') if mibBuilder.loadTexts: bfdSessType.setDescription('This object specifies the type of this BFD session.') bfd_sess_discriminator = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 4), unsigned32().subtype(subtypeSpec=value_range_constraint(1, 4294967295))).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessDiscriminator.setStatus('current') if mibBuilder.loadTexts: bfdSessDiscriminator.setDescription('This object specifies the local discriminator for this BFD session, used to uniquely identify it.') bfd_sess_remote_discr = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 5), unsigned32().subtype(subtypeSpec=constraints_union(value_range_constraint(0, 0), value_range_constraint(1, 4294967295)))).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessRemoteDiscr.setReference('Section 6.8.6, from Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessRemoteDiscr.setStatus('current') if mibBuilder.loadTexts: bfdSessRemoteDiscr.setDescription('This object specifies the session discriminator chosen by the remote system for this BFD session. The value may be zero(0) if the remote discriminator is not yet known or if the session is in the down or adminDown(1) state.') bfd_sess_destination_udp_port = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 6), bfd_ctrl_dest_port_number_tc()).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessDestinationUdpPort.setStatus('current') if mibBuilder.loadTexts: bfdSessDestinationUdpPort.setDescription("This object specifies the destination UDP port number used for this BFD session's control packets. The value may be zero(0) if the session is in adminDown(1) state.") bfd_sess_source_udp_port = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 7), bfd_ctrl_source_port_number_tc()).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessSourceUdpPort.setStatus('current') if mibBuilder.loadTexts: bfdSessSourceUdpPort.setDescription("This object specifies the source UDP port number used for this BFD session's control packets. The value may be zero(0) if the session is in adminDown(1) state. Upon creation of a new BFD session via this MIB, the value of zero(0) specified would permit the implementation to choose its own source port number.") bfd_sess_echo_source_udp_port = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 8), inet_port_number()).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessEchoSourceUdpPort.setStatus('current') if mibBuilder.loadTexts: bfdSessEchoSourceUdpPort.setDescription("This object specifies the source UDP port number used for this BFD session's echo packets. The value may be zero(0) if the session is not running in the echo mode, or the session is in adminDown(1) state. Upon creation of a new BFD session via this MIB, the value of zero(0) would permit the implementation to choose its own source port number.") bfd_sess_admin_status = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 9), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3, 4))).clone(namedValues=named_values(('enabled', 1), ('disabled', 2), ('adminDown', 3), ('down', 4)))).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessAdminStatus.setStatus('current') if mibBuilder.loadTexts: bfdSessAdminStatus.setDescription('Denotes the desired operational status of the BFD Session. A transition to enabled(1) will start the BFD state machine for the session. The state machine will have an initial state of down(2). A transition to disabled(2) will stop the BFD state machine for the session. The state machine may first transition to adminDown(1) prior to stopping. A transition to adminDown(3) will cause the BFD state machine to transition to adminDown(1), and will cause the session to remain in this state. A transition to down(4) will cause the BFD state machine to transition to down(2), and will cause the session to remain in this state. Care should be used in providing write access to this object without adequate authentication.') bfd_sess_oper_status = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 10), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2, 3))).clone(namedValues=named_values(('up', 1), ('down', 2), ('adminDown', 3)))).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessOperStatus.setStatus('current') if mibBuilder.loadTexts: bfdSessOperStatus.setDescription('Denotes the actual operational status of the BFD Session. If the value of bfdOperStatus is down(2), this value MUST eventually be down(2) as well. If the value of bfdOperStatus is adminDown(3), this value MUST eventually be adminDown(3) as well.') bfd_sess_state = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 11), ian_abfd_sess_state_tc()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessState.setStatus('current') if mibBuilder.loadTexts: bfdSessState.setDescription('Configured BFD session state.') bfd_sess_remote_heard_flag = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 12), truth_value()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessRemoteHeardFlag.setReference('Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessRemoteHeardFlag.setStatus('current') if mibBuilder.loadTexts: bfdSessRemoteHeardFlag.setDescription('This object specifies status of BFD packet reception from the remote system. Specifically, it is set to true(1) if the local system is actively receiving BFD packets from the remote system, and is set to false(2) if the local system has not received BFD packets recently (within the detection time) or if the local system is attempting to tear down the BFD session.') bfd_sess_diag = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 13), ian_abfd_diag_tc()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessDiag.setStatus('current') if mibBuilder.loadTexts: bfdSessDiag.setDescription("A diagnostic code specifying the local system's reason for the last transition of the session from up(4) to some other state.") bfd_sess_oper_mode = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 14), ian_abfd_sess_oper_mode_tc()).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessOperMode.setStatus('current') if mibBuilder.loadTexts: bfdSessOperMode.setDescription('This object specifies the operational mode of this BFD session.') bfd_sess_demand_mode_desired_flag = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 15), truth_value().clone('false')).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessDemandModeDesiredFlag.setStatus('current') if mibBuilder.loadTexts: bfdSessDemandModeDesiredFlag.setDescription("This object indicates that the local system's desire to use Demand mode. Specifically, it is set to true(1) if the local system wishes to use Demand mode or false(2) if not") bfd_sess_control_plane_indep_flag = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 16), truth_value().clone('false')).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessControlPlaneIndepFlag.setStatus('current') if mibBuilder.loadTexts: bfdSessControlPlaneIndepFlag.setDescription("This object indicates that the local system's ability to continue to function through a disruption of the control plane. Specifically, it is set to true(1) if the local system BFD implementation is independent of the control plane. Otherwise, the value is set to false(2)") bfd_sess_multipoint_flag = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 17), truth_value().clone('false')).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessMultipointFlag.setStatus('current') if mibBuilder.loadTexts: bfdSessMultipointFlag.setDescription('This object indicates the Multipoint (M) bit for this session. It is set to true(1) if Multipoint (M) bit is set to 1. Otherwise, the value is set to false(2)') bfd_sess_interface = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 18), interface_index_or_zero()).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessInterface.setStatus('current') if mibBuilder.loadTexts: bfdSessInterface.setDescription('This object contains an interface index used to indicate the interface which this BFD session is running on. This value can be zero if there is no interface associated with this BFD session.') bfd_sess_src_addr_type = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 19), inet_address_type()).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessSrcAddrType.setStatus('current') if mibBuilder.loadTexts: bfdSessSrcAddrType.setDescription('This object specifies IP address type of the source IP address of this BFD session. The value of unknown(0) is allowed only when the session is singleHop(1) and the source IP address of this BFD session is derived from the outgoing interface, or when the BFD session is not associated with a specific interface. If any other unsupported values are attempted in a set operation, the agent MUST return an inconsistentValue error.') bfd_sess_src_addr = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 20), inet_address().subtype(subtypeSpec=value_size_constraint(4, 4)).setFixedLength(4)).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessSrcAddr.setStatus('current') if mibBuilder.loadTexts: bfdSessSrcAddr.setDescription('This object specifies the source IP address of this BFD session. The format of this object is controlled by the bfdSessSrcAddrType object.') bfd_sess_dst_addr_type = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 21), inet_address_type()).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessDstAddrType.setStatus('current') if mibBuilder.loadTexts: bfdSessDstAddrType.setDescription('This object specifies IP address type of the neighboring IP address which is being monitored with this BFD session. The value of unknown(0) is allowed only when the session is singleHop(1) and the outgoing interface is of type point-to-point, or when the BFD session is not associated with a specific interface. If any other unsupported values are attempted in a set operation, the agent MUST return an inconsistentValue error.') bfd_sess_dst_addr = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 22), inet_address().subtype(subtypeSpec=value_size_constraint(4, 4)).setFixedLength(4)).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessDstAddr.setStatus('current') if mibBuilder.loadTexts: bfdSessDstAddr.setDescription('This object specifies the neighboring IP address which is being monitored with this BFD session. The format of this object is controlled by the bfdSessDstAddrType object.') bfd_sess_gtsm = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 23), truth_value().clone('true')).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessGTSM.setReference('RFC5082, The Generalized TTL Security Mechanism (GTSM). RFC5881, Section 5') if mibBuilder.loadTexts: bfdSessGTSM.setStatus('current') if mibBuilder.loadTexts: bfdSessGTSM.setDescription('Setting the value of this object to false(2) will disable GTSM protection of the BFD session. GTSM MUST be enabled on a singleHop(1) session if no authentication is in use.') bfd_sess_gtsmttl = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 24), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 255)).clone(255)).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessGTSMTTL.setReference('RFC5082, The Generalized TTL Security Mechanism (GTSM). RFC5881, Section 5') if mibBuilder.loadTexts: bfdSessGTSMTTL.setStatus('current') if mibBuilder.loadTexts: bfdSessGTSMTTL.setDescription('This object is valid only when bfdSessGTSM protection is enabled on the system. This object indicates the minimum allowed TTL for received BFD control packets. For a singleHop(1) session, if GTSM protection is enabled, this object SHOULD be set to maximum TTL value allowed for single hop. By default, GTSM is enabled and TTL value is 255. For a multihop session, updating of maximum TTL value allowed is likely required.') bfd_sess_desired_min_tx_interval = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 25), bfd_interval_tc()).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessDesiredMinTxInterval.setReference('Section 4.1 from Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessDesiredMinTxInterval.setStatus('current') if mibBuilder.loadTexts: bfdSessDesiredMinTxInterval.setDescription('This object specifies the minimum interval, in microseconds, that the local system would like to use when transmitting BFD Control packets. The value of zero(0) is reserved in this case, and should not be used.') bfd_sess_req_min_rx_interval = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 26), bfd_interval_tc()).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessReqMinRxInterval.setReference('Section 4.1 from Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessReqMinRxInterval.setStatus('current') if mibBuilder.loadTexts: bfdSessReqMinRxInterval.setDescription('This object specifies the minimum interval, in microseconds, between received BFD Control packets the local system is capable of supporting. The value of zero(0) can be specified when the transmitting system does not want the remote system to send any periodic BFD control packets.') bfd_sess_req_min_echo_rx_interval = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 27), bfd_interval_tc()).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessReqMinEchoRxInterval.setStatus('current') if mibBuilder.loadTexts: bfdSessReqMinEchoRxInterval.setDescription('This object specifies the minimum interval, in microseconds, between received BFD Echo packets that this system is capable of supporting. Value must be zero(0) if this is a multihop BFD session.') bfd_sess_detect_mult = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 28), bfd_multiplier_tc()).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessDetectMult.setStatus('current') if mibBuilder.loadTexts: bfdSessDetectMult.setDescription('This object specifies the Detect time multiplier.') bfd_sess_negotiated_interval = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 29), bfd_interval_tc()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessNegotiatedInterval.setStatus('current') if mibBuilder.loadTexts: bfdSessNegotiatedInterval.setDescription('This object specifies the negotiated interval, in microseconds, that the local system is transmitting BFD Control packets.') bfd_sess_negotiated_echo_interval = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 30), bfd_interval_tc()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessNegotiatedEchoInterval.setStatus('current') if mibBuilder.loadTexts: bfdSessNegotiatedEchoInterval.setDescription('This object specifies the negotiated interval, in microseconds, that the local system is transmitting BFD echo packets. Value is expected to be zero if the sessions is not running in echo mode.') bfd_sess_negotiated_detect_mult = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 31), bfd_multiplier_tc()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessNegotiatedDetectMult.setStatus('current') if mibBuilder.loadTexts: bfdSessNegotiatedDetectMult.setDescription('This object specifies the Detect time multiplier.') bfd_sess_auth_pres_flag = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 32), truth_value().clone('false')).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessAuthPresFlag.setReference('Sections 4.2 - 4.4 from Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessAuthPresFlag.setStatus('current') if mibBuilder.loadTexts: bfdSessAuthPresFlag.setDescription("This object indicates that the local system's desire to use Authentication. Specifically, it is set to true(1) if the local system wishes the session to be authenticated or false(2) if not.") bfd_sess_authentication_type = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 33), ian_abfd_sess_authentication_type_tc().clone('noAuthentication')).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessAuthenticationType.setReference('Sections 4.2 - 4.4 from Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessAuthenticationType.setStatus('current') if mibBuilder.loadTexts: bfdSessAuthenticationType.setDescription('The Authentication Type used for this BFD session. This field is valid only when the Authentication Present bit is set. Max-access to this object as well as other authentication related objects are set to read-create in order to support management of a single key ID at a time, key rotation is not handled. Key update in practice must be done by atomic update using a set containing all affected objects in the same varBindList or otherwise risk the session dropping.') bfd_sess_authentication_key_id = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 34), integer32().subtype(subtypeSpec=constraints_union(value_range_constraint(-1, -1), value_range_constraint(0, 255))).clone(-1)).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessAuthenticationKeyID.setReference('Sections 4.2 - 4.4 from Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessAuthenticationKeyID.setStatus('current') if mibBuilder.loadTexts: bfdSessAuthenticationKeyID.setDescription('The authentication key ID in use for this session. This object permits multiple keys to be active simultaneously. The value -1 indicates that no Authentication Key ID will be present in the optional BFD Authentication Section.') bfd_sess_authentication_key = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 35), ian_abfd_sess_authentication_key_tc()).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessAuthenticationKey.setReference('Sections 4.2 - 4.4 from Katz, D. and D. Ward, Bidirectional Forwarding Detection (BFD), RFC 5880, June 2012.') if mibBuilder.loadTexts: bfdSessAuthenticationKey.setStatus('current') if mibBuilder.loadTexts: bfdSessAuthenticationKey.setDescription('The authentication key. When the bfdSessAuthenticationType is simplePassword(1), the value of this object is the password present in the BFD packets. When the bfdSessAuthenticationType is one of the keyed authentication types, this value is used in the computation of the key present in the BFD authentication packet.') bfd_sess_storage_type = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 36), storage_type()).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessStorageType.setStatus('current') if mibBuilder.loadTexts: bfdSessStorageType.setDescription("This variable indicates the storage type for this object. Conceptual rows having the value 'permanent' need not allow write-access to any columnar objects in the row.") bfd_sess_row_status = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 2, 1, 37), row_status()).setMaxAccess('readcreate') if mibBuilder.loadTexts: bfdSessRowStatus.setStatus('current') if mibBuilder.loadTexts: bfdSessRowStatus.setDescription('This variable is used to create, modify, and/or delete a row in this table. When a row in this table has a row in the active(1) state, no objects in this row can be modified except the bfdSessRowStatus and bfdSessStorageType.') bfd_sess_perf_table = mib_table((1, 3, 6, 1, 2, 1, 222, 1, 3)) if mibBuilder.loadTexts: bfdSessPerfTable.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfTable.setDescription('This table specifies BFD Session performance counters.') bfd_sess_perf_entry = mib_table_row((1, 3, 6, 1, 2, 1, 222, 1, 3, 1)) bfdSessEntry.registerAugmentions(('BFD-STD-MIB', 'bfdSessPerfEntry')) bfdSessPerfEntry.setIndexNames(*bfdSessEntry.getIndexNames()) if mibBuilder.loadTexts: bfdSessPerfEntry.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEntry.setDescription('An entry in this table is created by a BFD-enabled node for every BFD Session. bfdSessPerfDiscTime is used to indicate potential discontinuity for all counter objects in this table.') bfd_sess_perf_ctrl_pkt_in = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 1), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfCtrlPktIn.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfCtrlPktIn.setDescription('The total number of BFD control messages received for this BFD session. It MUST be equal to the least significant 32 bits of bfdSessPerfCtrlPktInHC if supported, and MUST do so with the rules spelled out in RFC 2863.') bfd_sess_perf_ctrl_pkt_out = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 2), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfCtrlPktOut.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfCtrlPktOut.setDescription('The total number of BFD control messages sent for this BFD session. It MUST be equal to the least significant 32 bits of bfdSessPerfCtrlPktOutHC if supported, and MUST do so with the rules spelled out in RFC 2863.') bfd_sess_perf_ctrl_pkt_drop = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 3), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfCtrlPktDrop.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfCtrlPktDrop.setDescription('The total number of BFD control messages received for this session yet dropped for being invalid. It MUST be equal to the least significant 32 bits of bfdSessPerfCtrlPktDropHC if supported, and MUST do so with the rules spelled out in RFC 2863.') bfd_sess_perf_ctrl_pkt_drop_last_time = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 4), time_stamp()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfCtrlPktDropLastTime.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfCtrlPktDropLastTime.setDescription('The value of sysUpTime on the most recent occasion at which received BFD control message for this session was dropped. If no such up event exists, this object contains a zero value.') bfd_sess_perf_echo_pkt_in = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 5), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfEchoPktIn.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEchoPktIn.setDescription('The total number of BFD echo messages received for this BFD session. It MUST be equal to the least significant 32 bits of bfdSessPerfEchoPktInHC if supported, and MUST do so with the rules spelled out in RFC 2863.') bfd_sess_perf_echo_pkt_out = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 6), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfEchoPktOut.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEchoPktOut.setDescription('The total number of BFD echo messages sent for this BFD session. It MUST be equal to the least significant 32 bits of bfdSessPerfEchoPktOutHC if supported, and MUST do so with the rules spelled out in RFC 2863.') bfd_sess_perf_echo_pkt_drop = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 7), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfEchoPktDrop.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEchoPktDrop.setDescription('The total number of BFD echo messages received for this session yet dropped for being invalid. It MUST be equal to the least significant 32 bits of bfdSessPerfEchoPktDropHC if supported, and MUST do so with the rules spelled out in RFC 2863.') bfd_sess_perf_echo_pkt_drop_last_time = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 8), time_stamp()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfEchoPktDropLastTime.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEchoPktDropLastTime.setDescription('The value of sysUpTime on the most recent occasion at which received BFD echo message for this session was dropped. If no such up event has been issued, this object contains a zero value.') bfd_sess_up_time = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 9), time_stamp()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessUpTime.setStatus('current') if mibBuilder.loadTexts: bfdSessUpTime.setDescription('The value of sysUpTime on the most recent occasion at which the session came up. If no such event has been issued, this object contains a zero value.') bfd_sess_perf_last_sess_down_time = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 10), time_stamp()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfLastSessDownTime.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfLastSessDownTime.setDescription('The value of sysUpTime on the most recent occasion at which the last time communication was lost with the neighbor. If no down event has been issued this object contains a zero value.') bfd_sess_perf_last_comm_lost_diag = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 11), ian_abfd_diag_tc()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfLastCommLostDiag.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfLastCommLostDiag.setDescription('The BFD diag code for the last time communication was lost with the neighbor. If such an event has not been issued this object contains a zero value.') bfd_sess_perf_sess_up_count = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 12), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfSessUpCount.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfSessUpCount.setDescription('The number of times this session has gone into the Up state since the system last rebooted.') bfd_sess_perf_disc_time = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 13), time_stamp()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfDiscTime.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfDiscTime.setDescription('The value of sysUpTime on the most recent occasion at which any one or more of the session counters suffered a discontinuity. The relevant counters are the specific instances associated with this BFD session of any Counter32 object contained in the BfdSessPerfTable. If no such discontinuities have occurred since the last re-initialization of the local management subsystem, then this object contains a zero value.') bfd_sess_perf_ctrl_pkt_in_hc = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 14), counter64()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfCtrlPktInHC.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfCtrlPktInHC.setDescription('This value represents the total number of BFD control messages received for this BFD session. The least significant 32 bits MUST equal to bfdSessPerfCtrlPktIn, and MUST do so with the rules spelled out in RFC 2863.') bfd_sess_perf_ctrl_pkt_out_hc = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 15), counter64()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfCtrlPktOutHC.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfCtrlPktOutHC.setDescription('This value represents the total number of BFD control messages transmitted for this BFD session. The least significant 32 bits MUST equal to bfdSessPerfCtrlPktOut, and MUST do so with the rules spelled out in RFC 2863.') bfd_sess_perf_ctrl_pkt_drop_hc = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 16), counter64()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfCtrlPktDropHC.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfCtrlPktDropHC.setDescription('This value represents the total number of BFD control messages received for this BFD session yet dropped for being invalid. The least significant 32 bits MUST equal to bfdSessPerfCtrlPktDrop, and MUST do so with the rules spelled out in RFC 2863.') bfd_sess_perf_echo_pkt_in_hc = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 17), counter64()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfEchoPktInHC.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEchoPktInHC.setDescription('This value represents the total number of BFD echo messages received for this BFD session. The least significant 32 bits MUST equal to bfdSessPerfEchoPktIn, and MUST do so with the rules spelled out in RFC 2863.') bfd_sess_perf_echo_pkt_out_hc = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 18), counter64()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfEchoPktOutHC.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEchoPktOutHC.setDescription('This value represents the total number of BFD echo messages transmitted for this BFD session. The least significant 32 bits MUST equal to bfdSessPerfEchoPktOut, and MUST do so with the rules spelled out in RFC 2863.') bfd_sess_perf_echo_pkt_drop_hc = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 3, 1, 19), counter64()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessPerfEchoPktDropHC.setStatus('current') if mibBuilder.loadTexts: bfdSessPerfEchoPktDropHC.setDescription('This value represents the total number of BFD echo messages received for this BFD session yet dropped for being invalid. The least significant 32 bits MUST equal to bfdSessPerfEchoPktDrop, and MUST do so with the rules spelled out in RFC 2863.') bfd_sess_disc_map_table = mib_table((1, 3, 6, 1, 2, 1, 222, 1, 4)) if mibBuilder.loadTexts: bfdSessDiscMapTable.setStatus('current') if mibBuilder.loadTexts: bfdSessDiscMapTable.setDescription("The BFD Session Discriminator Mapping Table maps a local discriminator value to associated BFD session's bfdSessIndex found in the bfdSessionTable.") bfd_sess_disc_map_entry = mib_table_row((1, 3, 6, 1, 2, 1, 222, 1, 4, 1)).setIndexNames((0, 'BFD-STD-MIB', 'bfdSessDiscriminator')) if mibBuilder.loadTexts: bfdSessDiscMapEntry.setStatus('current') if mibBuilder.loadTexts: bfdSessDiscMapEntry.setDescription('The BFD Session Discriminator Mapping Entry specifies a mapping between a local discriminator and a BFD session.') bfd_sess_disc_map_index = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 4, 1, 1), bfd_sess_index_tc()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessDiscMapIndex.setStatus('current') if mibBuilder.loadTexts: bfdSessDiscMapIndex.setDescription('This object specifies a mapping between a local discriminator and a BFD Session in the BfdSessTable.') bfd_sess_ip_map_table = mib_table((1, 3, 6, 1, 2, 1, 222, 1, 5)) if mibBuilder.loadTexts: bfdSessIpMapTable.setStatus('current') if mibBuilder.loadTexts: bfdSessIpMapTable.setDescription('The BFD Session IP Mapping Table maps given bfdSessInterface, bfdSessSrcAddrType, bfdSessSrcAddr, bfdSessDstAddrType and bfdSessDstAddr to an associated BFD session found in the bfdSessionTable.') bfd_sess_ip_map_entry = mib_table_row((1, 3, 6, 1, 2, 1, 222, 1, 5, 1)).setIndexNames((0, 'BFD-STD-MIB', 'bfdSessInterface'), (0, 'BFD-STD-MIB', 'bfdSessSrcAddrType'), (0, 'BFD-STD-MIB', 'bfdSessSrcAddr'), (0, 'BFD-STD-MIB', 'bfdSessDstAddrType'), (0, 'BFD-STD-MIB', 'bfdSessDstAddr')) if mibBuilder.loadTexts: bfdSessIpMapEntry.setStatus('current') if mibBuilder.loadTexts: bfdSessIpMapEntry.setDescription('The BFD Session IP Map Entry contains a mapping from the IP information for a session, to the session in the bfdSessionTable.') bfd_sess_ip_map_index = mib_table_column((1, 3, 6, 1, 2, 1, 222, 1, 5, 1, 1), bfd_sess_index_tc()).setMaxAccess('readonly') if mibBuilder.loadTexts: bfdSessIpMapIndex.setStatus('current') if mibBuilder.loadTexts: bfdSessIpMapIndex.setDescription('This object specifies the BfdSessIndexTC referred to by the indexes of this row. In essence, a mapping is provided between these indexes and the BfdSessTable.') bfd_sess_up = notification_type((1, 3, 6, 1, 2, 1, 222, 0, 1)).setObjects(('BFD-STD-MIB', 'bfdSessDiag'), ('BFD-STD-MIB', 'bfdSessDiag')) if mibBuilder.loadTexts: bfdSessUp.setStatus('current') if mibBuilder.loadTexts: bfdSessUp.setDescription('This notification is generated when the bfdSessState object for one or more contiguous entries in bfdSessTable are about to enter the up(4) state from some other state. The included values of bfdSessDiag MUST both be set equal to this new state (i.e: up(4)). The two instances of bfdSessDiag in this notification indicate the range of indexes that are affected. Note that all the indexes of the two ends of the range can be derived from the instance identifiers of these two objects. For the cases where a contiguous range of sessions have transitioned into the up(4) state at roughly the same time, the device SHOULD issue a single notification for each range of contiguous indexes in an effort to minimize the emission of a large number of notifications. If a notification has to be issued for just a single bfdSessEntry, then the instance identifier (and values) of the two bfdSessDiag objects MUST be the identical.') bfd_sess_down = notification_type((1, 3, 6, 1, 2, 1, 222, 0, 2)).setObjects(('BFD-STD-MIB', 'bfdSessDiag'), ('BFD-STD-MIB', 'bfdSessDiag')) if mibBuilder.loadTexts: bfdSessDown.setStatus('current') if mibBuilder.loadTexts: bfdSessDown.setDescription('This notification is generated when the bfdSessState object for one or more contiguous entries in bfdSessTable are about to enter the down(2) or adminDown(1) states from some other state. The included values of bfdSessDiag MUST both be set equal to this new state (i.e: down(2) or adminDown(1)). The two instances of bfdSessDiag in this notification indicate the range of indexes that are affected. Note that all the indexes of the two ends of the range can be derived from the instance identifiers of these two objects. For cases where a contiguous range of sessions have transitioned into the down(2) or adminDown(1) states at roughly the same time, the device SHOULD issue a single notification for each range of contiguous indexes in an effort to minimize the emission of a large number of notifications. If a notification has to be issued for just a single bfdSessEntry, then the instance identifier (and values) of the two bfdSessDiag objects MUST be the identical.') bfd_groups = mib_identifier((1, 3, 6, 1, 2, 1, 222, 2, 1)) bfd_compliances = mib_identifier((1, 3, 6, 1, 2, 1, 222, 2, 2)) bfd_module_full_compliance = module_compliance((1, 3, 6, 1, 2, 1, 222, 2, 2, 1)).setObjects(('BFD-STD-MIB', 'bfdSessionGroup'), ('BFD-STD-MIB', 'bfdSessionReadOnlyGroup'), ('BFD-STD-MIB', 'bfdSessionPerfGroup'), ('BFD-STD-MIB', 'bfdNotificationGroup'), ('BFD-STD-MIB', 'bfdSessionPerfHCGroup')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): bfd_module_full_compliance = bfdModuleFullCompliance.setStatus('current') if mibBuilder.loadTexts: bfdModuleFullCompliance.setDescription('Compliance statement for agents that provide full support for the BFD-MIB module. Such devices can then be monitored and also be configured using this MIB module.') bfd_module_read_only_compliance = module_compliance((1, 3, 6, 1, 2, 1, 222, 2, 2, 2)).setObjects(('BFD-STD-MIB', 'bfdSessionGroup'), ('BFD-STD-MIB', 'bfdSessionReadOnlyGroup'), ('BFD-STD-MIB', 'bfdSessionPerfGroup'), ('BFD-STD-MIB', 'bfdNotificationGroup'), ('BFD-STD-MIB', 'bfdSessionPerfHCGroup')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): bfd_module_read_only_compliance = bfdModuleReadOnlyCompliance.setStatus('current') if mibBuilder.loadTexts: bfdModuleReadOnlyCompliance.setDescription('Compliance requirement for implementations that only provide read-only support for BFD-MIB. Such devices can then be monitored but cannot be configured using this MIB module.') bfd_session_group = object_group((1, 3, 6, 1, 2, 1, 222, 2, 1, 1)).setObjects(('BFD-STD-MIB', 'bfdAdminStatus'), ('BFD-STD-MIB', 'bfdOperStatus'), ('BFD-STD-MIB', 'bfdNotificationsEnable'), ('BFD-STD-MIB', 'bfdSessVersionNumber'), ('BFD-STD-MIB', 'bfdSessType'), ('BFD-STD-MIB', 'bfdSessIndexNext'), ('BFD-STD-MIB', 'bfdSessDiscriminator'), ('BFD-STD-MIB', 'bfdSessDestinationUdpPort'), ('BFD-STD-MIB', 'bfdSessSourceUdpPort'), ('BFD-STD-MIB', 'bfdSessEchoSourceUdpPort'), ('BFD-STD-MIB', 'bfdSessAdminStatus'), ('BFD-STD-MIB', 'bfdSessOperStatus'), ('BFD-STD-MIB', 'bfdSessOperMode'), ('BFD-STD-MIB', 'bfdSessDemandModeDesiredFlag'), ('BFD-STD-MIB', 'bfdSessControlPlaneIndepFlag'), ('BFD-STD-MIB', 'bfdSessMultipointFlag'), ('BFD-STD-MIB', 'bfdSessInterface'), ('BFD-STD-MIB', 'bfdSessSrcAddrType'), ('BFD-STD-MIB', 'bfdSessSrcAddr'), ('BFD-STD-MIB', 'bfdSessDstAddrType'), ('BFD-STD-MIB', 'bfdSessDstAddr'), ('BFD-STD-MIB', 'bfdSessGTSM'), ('BFD-STD-MIB', 'bfdSessGTSMTTL'), ('BFD-STD-MIB', 'bfdSessDesiredMinTxInterval'), ('BFD-STD-MIB', 'bfdSessReqMinRxInterval'), ('BFD-STD-MIB', 'bfdSessReqMinEchoRxInterval'), ('BFD-STD-MIB', 'bfdSessDetectMult'), ('BFD-STD-MIB', 'bfdSessAuthPresFlag'), ('BFD-STD-MIB', 'bfdSessAuthenticationType'), ('BFD-STD-MIB', 'bfdSessAuthenticationKeyID'), ('BFD-STD-MIB', 'bfdSessAuthenticationKey'), ('BFD-STD-MIB', 'bfdSessStorageType'), ('BFD-STD-MIB', 'bfdSessRowStatus')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): bfd_session_group = bfdSessionGroup.setStatus('current') if mibBuilder.loadTexts: bfdSessionGroup.setDescription('Collection of objects needed for BFD sessions.') bfd_session_read_only_group = object_group((1, 3, 6, 1, 2, 1, 222, 2, 1, 2)).setObjects(('BFD-STD-MIB', 'bfdSessRemoteDiscr'), ('BFD-STD-MIB', 'bfdSessState'), ('BFD-STD-MIB', 'bfdSessRemoteHeardFlag'), ('BFD-STD-MIB', 'bfdSessDiag'), ('BFD-STD-MIB', 'bfdSessNegotiatedInterval'), ('BFD-STD-MIB', 'bfdSessNegotiatedEchoInterval'), ('BFD-STD-MIB', 'bfdSessNegotiatedDetectMult'), ('BFD-STD-MIB', 'bfdSessDiscMapIndex'), ('BFD-STD-MIB', 'bfdSessIpMapIndex')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): bfd_session_read_only_group = bfdSessionReadOnlyGroup.setStatus('current') if mibBuilder.loadTexts: bfdSessionReadOnlyGroup.setDescription('Collection of read-only objects needed for BFD sessions.') bfd_session_perf_group = object_group((1, 3, 6, 1, 2, 1, 222, 2, 1, 3)).setObjects(('BFD-STD-MIB', 'bfdSessPerfCtrlPktIn'), ('BFD-STD-MIB', 'bfdSessPerfCtrlPktOut'), ('BFD-STD-MIB', 'bfdSessPerfCtrlPktDrop'), ('BFD-STD-MIB', 'bfdSessPerfCtrlPktDropLastTime'), ('BFD-STD-MIB', 'bfdSessPerfEchoPktIn'), ('BFD-STD-MIB', 'bfdSessPerfEchoPktOut'), ('BFD-STD-MIB', 'bfdSessPerfEchoPktDrop'), ('BFD-STD-MIB', 'bfdSessPerfEchoPktDropLastTime'), ('BFD-STD-MIB', 'bfdSessUpTime'), ('BFD-STD-MIB', 'bfdSessPerfLastSessDownTime'), ('BFD-STD-MIB', 'bfdSessPerfLastCommLostDiag'), ('BFD-STD-MIB', 'bfdSessPerfSessUpCount'), ('BFD-STD-MIB', 'bfdSessPerfDiscTime')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): bfd_session_perf_group = bfdSessionPerfGroup.setStatus('current') if mibBuilder.loadTexts: bfdSessionPerfGroup.setDescription('Collection of objects needed to monitor the performance of BFD sessions.') bfd_session_perf_hc_group = object_group((1, 3, 6, 1, 2, 1, 222, 2, 1, 4)).setObjects(('BFD-STD-MIB', 'bfdSessPerfCtrlPktInHC'), ('BFD-STD-MIB', 'bfdSessPerfCtrlPktOutHC'), ('BFD-STD-MIB', 'bfdSessPerfCtrlPktDropHC'), ('BFD-STD-MIB', 'bfdSessPerfEchoPktInHC'), ('BFD-STD-MIB', 'bfdSessPerfEchoPktOutHC'), ('BFD-STD-MIB', 'bfdSessPerfEchoPktDropHC')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): bfd_session_perf_hc_group = bfdSessionPerfHCGroup.setStatus('current') if mibBuilder.loadTexts: bfdSessionPerfHCGroup.setDescription('Collection of objects needed to monitor the performance of BFD sessions for which the values of bfdSessPerfPktIn, bfdSessPerfPktOut wrap around too quickly.') bfd_notification_group = notification_group((1, 3, 6, 1, 2, 1, 222, 2, 1, 5)).setObjects(('BFD-STD-MIB', 'bfdSessUp'), ('BFD-STD-MIB', 'bfdSessDown')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): bfd_notification_group = bfdNotificationGroup.setStatus('current') if mibBuilder.loadTexts: bfdNotificationGroup.setDescription('Set of notifications implemented in this module.') mibBuilder.exportSymbols('BFD-STD-MIB', bfdSessDstAddr=bfdSessDstAddr, bfdSessVersionNumber=bfdSessVersionNumber, bfdSessUp=bfdSessUp, bfdSessDiscMapIndex=bfdSessDiscMapIndex, bfdSessPerfLastSessDownTime=bfdSessPerfLastSessDownTime, bfdGroups=bfdGroups, PYSNMP_MODULE_ID=bfdMIB, bfdSessSourceUdpPort=bfdSessSourceUdpPort, bfdScalarObjects=bfdScalarObjects, bfdCompliances=bfdCompliances, bfdSessSrcAddr=bfdSessSrcAddr, bfdSessPerfCtrlPktDropHC=bfdSessPerfCtrlPktDropHC, bfdSessPerfCtrlPktIn=bfdSessPerfCtrlPktIn, bfdSessEchoSourceUdpPort=bfdSessEchoSourceUdpPort, bfdSessRemoteHeardFlag=bfdSessRemoteHeardFlag, bfdSessionGroup=bfdSessionGroup, bfdSessOperStatus=bfdSessOperStatus, bfdSessDestinationUdpPort=bfdSessDestinationUdpPort, bfdSessDetectMult=bfdSessDetectMult, bfdSessStorageType=bfdSessStorageType, bfdSessReqMinEchoRxInterval=bfdSessReqMinEchoRxInterval, bfdSessDiscriminator=bfdSessDiscriminator, bfdSessControlPlaneIndepFlag=bfdSessControlPlaneIndepFlag, bfdSessMultipointFlag=bfdSessMultipointFlag, bfdSessPerfEchoPktOutHC=bfdSessPerfEchoPktOutHC, bfdSessOperMode=bfdSessOperMode, bfdSessNegotiatedInterval=bfdSessNegotiatedInterval, bfdSessPerfEntry=bfdSessPerfEntry, bfdSessPerfSessUpCount=bfdSessPerfSessUpCount, bfdSessPerfCtrlPktOutHC=bfdSessPerfCtrlPktOutHC, bfdNotificationsEnable=bfdNotificationsEnable, bfdSessSrcAddrType=bfdSessSrcAddrType, bfdSessUpTime=bfdSessUpTime, bfdSessPerfEchoPktDropHC=bfdSessPerfEchoPktDropHC, bfdSessState=bfdSessState, bfdSessIpMapTable=bfdSessIpMapTable, bfdSessAuthenticationKeyID=bfdSessAuthenticationKeyID, bfdNotificationGroup=bfdNotificationGroup, bfdSessInterface=bfdSessInterface, bfdSessGTSMTTL=bfdSessGTSMTTL, bfdSessPerfLastCommLostDiag=bfdSessPerfLastCommLostDiag, bfdSessPerfEchoPktIn=bfdSessPerfEchoPktIn, bfdSessIndexNext=bfdSessIndexNext, bfdNotifications=bfdNotifications, bfdSessDstAddrType=bfdSessDstAddrType, bfdSessDiscMapEntry=bfdSessDiscMapEntry, bfdSessIpMapIndex=bfdSessIpMapIndex, bfdSessAuthPresFlag=bfdSessAuthPresFlag, bfdSessNegotiatedEchoInterval=bfdSessNegotiatedEchoInterval, bfdSessPerfCtrlPktOut=bfdSessPerfCtrlPktOut, bfdSessAuthenticationType=bfdSessAuthenticationType, bfdSessDiag=bfdSessDiag, bfdSessGTSM=bfdSessGTSM, bfdSessTable=bfdSessTable, bfdSessPerfCtrlPktDrop=bfdSessPerfCtrlPktDrop, bfdSessionPerfHCGroup=bfdSessionPerfHCGroup, bfdSessPerfTable=bfdSessPerfTable, bfdObjects=bfdObjects, bfdModuleFullCompliance=bfdModuleFullCompliance, bfdSessDesiredMinTxInterval=bfdSessDesiredMinTxInterval, bfdSessAuthenticationKey=bfdSessAuthenticationKey, bfdSessPerfCtrlPktInHC=bfdSessPerfCtrlPktInHC, bfdSessReqMinRxInterval=bfdSessReqMinRxInterval, bfdSessIpMapEntry=bfdSessIpMapEntry, bfdModuleReadOnlyCompliance=bfdModuleReadOnlyCompliance, bfdSessIndex=bfdSessIndex, bfdSessType=bfdSessType, bfdSessionPerfGroup=bfdSessionPerfGroup, bfdSessRemoteDiscr=bfdSessRemoteDiscr, bfdSessEntry=bfdSessEntry, bfdSessPerfDiscTime=bfdSessPerfDiscTime, bfdSessPerfEchoPktInHC=bfdSessPerfEchoPktInHC, bfdConformance=bfdConformance, bfdSessPerfCtrlPktDropLastTime=bfdSessPerfCtrlPktDropLastTime, bfdSessRowStatus=bfdSessRowStatus, bfdSessAdminStatus=bfdSessAdminStatus, bfdSessPerfEchoPktOut=bfdSessPerfEchoPktOut, bfdSessDown=bfdSessDown, bfdSessPerfEchoPktDropLastTime=bfdSessPerfEchoPktDropLastTime, bfdSessionReadOnlyGroup=bfdSessionReadOnlyGroup, bfdOperStatus=bfdOperStatus, bfdSessDiscMapTable=bfdSessDiscMapTable, bfdMIB=bfdMIB, bfdAdminStatus=bfdAdminStatus, bfdSessPerfEchoPktDrop=bfdSessPerfEchoPktDrop, bfdSessDemandModeDesiredFlag=bfdSessDemandModeDesiredFlag, bfdSessNegotiatedDetectMult=bfdSessNegotiatedDetectMult)
class Solution: def judgeCircle(self, moves: str) -> bool: x_axis = y_axis = 0 for move in moves: if move == "U": y_axis += 1 elif move == "D": y_axis -= 1 elif move == "R": x_axis += 1 elif move == "L": x_axis -= 1 return not x_axis and not y_axis
class Solution: def judge_circle(self, moves: str) -> bool: x_axis = y_axis = 0 for move in moves: if move == 'U': y_axis += 1 elif move == 'D': y_axis -= 1 elif move == 'R': x_axis += 1 elif move == 'L': x_axis -= 1 return not x_axis and (not y_axis)
with open("EX10.txt","r") as fp: words = 0 for data in fp: lines=data.split() for line in lines: words += 1 print("Total No.of Words:",words)
with open('EX10.txt', 'r') as fp: words = 0 for data in fp: lines = data.split() for line in lines: words += 1 print('Total No.of Words:', words)
__author__ = 'zoulida' class people(object): def __new__(cls, *args, **kargs): return super(people, cls).__new__(cls) def __init__(self, name): self.name = name def talk(self): print("hello,I am %s" % self.name) class student(people): def __new__(cls, *args, **kargs): if not hasattr(cls, "instance"): cls.instance = super(student, cls).__new__(cls, *args, **kargs) return cls.instance def __init__(self, name): if not hasattr(self, "init_fir"): self.init_fir = True super(student, self).__init__(name) a = student("Timo") print(a) b = student("kysa") c = student("Luyi") a.talk() b.talk() print(c)
__author__ = 'zoulida' class People(object): def __new__(cls, *args, **kargs): return super(people, cls).__new__(cls) def __init__(self, name): self.name = name def talk(self): print('hello,I am %s' % self.name) class Student(people): def __new__(cls, *args, **kargs): if not hasattr(cls, 'instance'): cls.instance = super(student, cls).__new__(cls, *args, **kargs) return cls.instance def __init__(self, name): if not hasattr(self, 'init_fir'): self.init_fir = True super(student, self).__init__(name) a = student('Timo') print(a) b = student('kysa') c = student('Luyi') a.talk() b.talk() print(c)
nombres=[] sueldo=[] totalsueldos=[] for x in range(3): nombres.append(input("Cual es tu nombre? ")) mes1=int(input("Cual fue tu sueldo de Junio? ")) mes2=int(input("Cual fue tu sueldo de Julio? ")) mes3=int(input("Cual fue tu sueldo de Agosto? ")) sueldo.append([mes1,mes2,mes3]) totalsueldos.append(mes1+mes2+mes3) print(nombres) print(sueldo) print(totalsueldos)
nombres = [] sueldo = [] totalsueldos = [] for x in range(3): nombres.append(input('Cual es tu nombre? ')) mes1 = int(input('Cual fue tu sueldo de Junio? ')) mes2 = int(input('Cual fue tu sueldo de Julio? ')) mes3 = int(input('Cual fue tu sueldo de Agosto? ')) sueldo.append([mes1, mes2, mes3]) totalsueldos.append(mes1 + mes2 + mes3) print(nombres) print(sueldo) print(totalsueldos)
# contains hyperparameters for our seq2seq model. you can add some more config = { 'batch_size': 200, 'max_vocab_size': 20000, 'max_seq_len': 26, # decided based on the sentence length distribution of amazon corpus 'embedding_dim': 100, # we had trained a 100-dim w2v vecs in tut 1 }
config = {'batch_size': 200, 'max_vocab_size': 20000, 'max_seq_len': 26, 'embedding_dim': 100}
class Solution: def isValid(self, s: str) -> bool: stack = [] other_half = {")": "(", "]": "[", "}": "{"} for char in s: if char in "{[(": stack.append(char) elif char in ")]}" and stack and stack[-1] == other_half[char]: stack.pop() else: return False return not stack if __name__ == "__main__": solver = Solution() print(solver.isValid("()[]{}")) print(solver.isValid("([)]"))
class Solution: def is_valid(self, s: str) -> bool: stack = [] other_half = {')': '(', ']': '[', '}': '{'} for char in s: if char in '{[(': stack.append(char) elif char in ')]}' and stack and (stack[-1] == other_half[char]): stack.pop() else: return False return not stack if __name__ == '__main__': solver = solution() print(solver.isValid('()[]{}')) print(solver.isValid('([)]'))
skills = [ { "id": "0001", "name": "Liver of Steel", "type": "Passive", "isPermable": False, "effects": {"maximumInebriety": "+5"}, }, {"id": "0002", "name": "Chronic Indigestion", "type": "Combat", "mpCost": 5}, { "id": "0003", "name": "The Smile of Mr. A.", "type": "Buff", "mpCost": 5, "isPermable": False, }, { "id": "0004", "name": "Arse Shoot", "type": "Buff", "mpCost": 5, "isPermable": False, }, { "id": "0005", "name": "Stomach of Steel", "type": "Passive", "isPermable": False, "effects": {"maximumFullness": "+5"}, }, { "id": "0006", "name": "Spleen of Steel", "type": "Passive", "isPermable": False, "effects": {"maximumSpleen": "+5"}, }, { "id": "0010", "name": "Powers of Observatiogn", "type": "Passive", "effects": {"itemDrop": "+10%"}, }, { "id": "0011", "name": "Gnefarious Pickpocketing", "type": "Passive", "effects": {"meatDrop": "+10%"}, }, {"id": "0012", "name": "Torso Awaregness", "type": "Passive"}, { "id": "0013", "name": "Gnomish Hardigness", "type": "Passive", "effects": {"maximumHP": "+5%"}, }, { "id": "0014", "name": "Cosmic Ugnderstanding", "type": "Passive", "effects": {"maximumMP": "+5%"}, }, {"id": "0015", "name": "CLEESH", "type": "Combat", "mpCost": 10}, { "id": "0019", "name": "Transcendent Olfaction", "type": "Combat", "mpCost": 40, "isAutomaticallyPermed": True, }, { "id": "0020", "name": "Really Expensive Jewelrycrafting", "type": "Passive", "isPermable": False, }, { "id": "0021", "name": "Lust", "type": "Passive", "isPermable": False, "effects": { "combatInitiative": "+50%", "spellDamage": "-5", "meleeDamage": "-5", }, }, { "id": "0022", "name": "Gluttony", "type": "Passive", "isPermable": False, "effects": {"strengthensFood": True, "statsPerFight": "-2"}, }, { "id": "0023", "name": "Greed", "type": "Passive", "isPermable": False, "effects": {"meatDrop": "+50%", "itemDrop": "-15%"}, }, { "id": "0024", "name": "Sloth", "type": "Passive", "isPermable": False, "effects": {"damageReduction": "+8", "combatInitiative": "-25%"}, }, { "id": "0025", "name": "Wrath", "type": "Passive", "isPermable": False, "effects": { "spellDamage": "+10", "meleeDamage": "+10", "damageReduction": "-4", }, }, { "id": "0026", "name": "Envy", "type": "Passive", "isPermable": False, "effects": {"itemDrop": "+30%", "meatDrop": "-25%"}, }, { "id": "0027", "name": "Pride", "type": "Passive", "isPermable": False, "effects": {"statsPerFight": "+4", "weakensFood": True}, }, {"id": "0028", "name": "Awesome Balls of Fire", "type": "Combat", "mpCost": 120}, {"id": "0029", "name": "Conjure Relaxing Campfire", "type": "Combat", "mpCost": 30}, {"id": "0030", "name": "Snowclone", "type": "Combat", "mpCost": 120}, {"id": "0031", "name": "Maximum Chill", "type": "Combat", "mpCost": 30}, {"id": "0032", "name": "Eggsplosion", "type": "Combat", "mpCost": 120}, {"id": "0033", "name": "Mudbath", "type": "Combat", "mpCost": 30}, {"id": "0036", "name": "Grease Lightning", "type": "Combat", "mpCost": 120}, {"id": "0037", "name": "Inappropriate Backrub", "type": "Combat", "mpCost": 30}, { "id": "0038", "name": "Natural Born Scrabbler", "type": "Passive", "effects": {"itemDrop": "+5%"}, }, { "id": "0039", "name": "Thrift and Grift", "type": "Passive", "effects": {"meatDrop": "+10%"}, }, { "id": "0040", "name": "Abs of Tin", "type": "Passive", "effects": {"maximumHP": "+10%"}, }, { "id": "0041", "name": "Marginally Insane", "type": "Passive", "effects": {"maximumMP": "+10%"}, }, {"id": "0042", "name": "Raise Backup Dancer", "type": "Combat", "mpCost": 120}, {"id": "0043", "name": "Creepy Lullaby", "type": "Combat", "mpCost": 30}, {"id": "0044", "name": "Rainbow Gravitation", "type": "Noncombat", "mpCost": 30}, {"id": "1000", "name": "Seal Clubbing Frenzy", "type": "Noncombat", "mpCost": 1}, {"id": "1003", "name": "Thrust-Smack", "type": "Combat", "mpCost": 3}, {"id": "1004", "name": "Lunge-Smack", "type": "Combat", "mpCost": 5}, {"id": "1005", "name": "Lunging Thrust-Smack", "type": "Combat", "mpCost": 8}, {"id": "1006", "name": "Super-Advanced Meatsmithing", "type": "Passive"}, {"id": "1007", "name": "Tongue of the Otter", "type": "Noncombat", "mpCost": 7}, {"id": "1008", "name": "Hide of the Otter", "type": "Passive"}, {"id": "1009", "name": "Claws of the Otter", "type": "Passive"}, {"id": "1010", "name": "Tongue of the Walrus", "type": "Noncombat", "mpCost": 10}, {"id": "1011", "name": "Hide of the Walrus", "type": "Passive"}, {"id": "1012", "name": "Claws of the Walrus", "type": "Passive"}, {"id": "1014", "name": "Eye of the Stoat", "type": "Passive"}, {"id": "1015", "name": "Rage of the Reindeer", "type": "Noncombat", "mpCost": 10}, {"id": "1016", "name": "Pulverize", "type": "Passive"}, {"id": "1017", "name": "Double-Fisted Skull Smashing", "type": "Passive"}, {"id": "1018", "name": "Northern Exposure", "type": "Passive"}, {"id": "1019", "name": "Musk of the Moose", "type": "Noncombat", "mpCost": 10}, { "id": "1020", "name": "Snarl of the Timberwolf", "type": "Noncombat", "mpCost": 10, }, { "id": "2000", "name": "Patience of the Tortoise", "type": "Noncombat", "mpCost": 1, }, {"id": "2003", "name": "Headbutt", "type": "Combat", "mpCost": 3}, {"id": "2004", "name": "Skin of the Leatherback", "type": "Passive"}, {"id": "2005", "name": "Shieldbutt", "type": "Combat", "mpCost": 5}, {"id": "2006", "name": "Armorcraftiness", "type": "Passive"}, {"id": "2007", "name": "Ghostly Shell", "type": "Buff", "mpCost": 6}, {"id": "2008", "name": "Reptilian Fortitude", "type": "Buff", "mpCost": 10}, {"id": "2009", "name": "Empathy of the Newt", "type": "Buff", "mpCost": 15}, {"id": "2010", "name": "Tenacity of the Snapper", "type": "Buff", "mpCost": 8}, {"id": "2011", "name": "Wisdom of the Elder Tortoises", "type": "Passive"}, {"id": "2012", "name": "Astral Shell", "type": "Buff", "mpCost": 10}, {"id": "2014", "name": "Amphibian Sympathy", "type": "Passive"}, {"id": "2015", "name": "Kneebutt", "type": "Combat", "mpCost": 4}, {"id": "2016", "name": "Cold-Blooded Fearlessness", "type": "Passive"}, {"id": "2020", "name": "Hero of the Half-Shell", "type": "Passive"}, {"id": "2021", "name": "Tao of the Terrapin", "type": "Passive"}, {"id": "2022", "name": "Spectral Snapper", "type": "Combat", "mpCost": 20}, {"id": "2103", "name": "Head + Knee Combo", "type": "Combat", "mpCost": 8}, {"id": "2105", "name": "Head + Shield Combo", "type": "Combat", "mpCost": 9}, {"id": "2106", "name": "Knee + Shield Combo", "type": "Combat", "mpCost": 10}, { "id": "2107", "name": "Head + Knee + Shield Combo", "type": "Combat", "mpCost": 13, }, {"id": "3000", "name": "Manicotti Meditation", "type": "Noncombat", "mpCost": 1}, {"id": "3003", "name": "Ravioli Shurikens", "type": "Combat", "mpCost": 4}, {"id": "3004", "name": "Entangling Noodles", "type": "Combat", "mpCost": 3}, {"id": "3005", "name": "Cannelloni Cannon", "type": "Combat", "mpCost": 7}, {"id": "3006", "name": "Pastamastery", "type": "Noncombat", "mpCost": 10}, {"id": "3007", "name": "Stuffed Mortar Shell", "type": "Combat", "mpCost": 19}, {"id": "3008", "name": "Weapon of the Pastalord", "type": "Combat", "mpCost": 35}, { "id": "3009", "name": "Lasagna Bandages", "type": "Combat / Noncombat", "mpCost": 6, }, {"id": "3010", "name": "Leash of Linguini", "type": "Noncombat", "mpCost": 12}, {"id": "3011", "name": "Spirit of Rigatoni", "type": "Passive"}, {"id": "3012", "name": "Cannelloni Cocoon", "type": "Noncombat", "mpCost": 20}, {"id": "3014", "name": "Spirit of Ravioli", "type": "Passive"}, {"id": "3015", "name": "Springy Fusilli", "type": "Noncombat", "mpCost": 10}, {"id": "3016", "name": "Tolerance of the Kitchen", "type": "Passive"}, {"id": "3017", "name": "Flavour of Magic", "type": "Noncombat", "mpCost": 10}, {"id": "3018", "name": "Transcendental Noodlecraft", "type": "Passive"}, {"id": "3019", "name": "Fearful Fettucini", "type": "Combat", "mpCost": 35}, {"id": "3020", "name": "Spaghetti Spear", "type": "Combat", "mpCost": 1}, {"id": "3101", "name": "Spirit of Cayenne", "type": "Noncombat", "mpCost": 10}, {"id": "3102", "name": "Spirit of Peppermint", "type": "Noncombat", "mpCost": 10}, {"id": "3103", "name": "Spirit of Garlic", "type": "Noncombat", "mpCost": 10}, {"id": "3104", "name": "Spirit of Wormwood", "type": "Noncombat", "mpCost": 10}, {"id": "3105", "name": "Spirit of Bacon Grease", "type": "Noncombat", "mpCost": 10}, {"id": "4000", "name": "Sauce Contemplation", "type": "Noncombat", "mpCost": 1}, {"id": "4003", "name": "Stream of Sauce", "type": "Combat", "mpCost": 3}, {"id": "4004", "name": "Expert Panhandling", "type": "Passive"}, {"id": "4005", "name": "Saucestorm", "type": "Combat", "mpCost": 12}, {"id": "4006", "name": "Advanced Saucecrafting", "type": "Noncombat", "mpCost": 10}, {"id": "4007", "name": "Elemental Saucesphere", "type": "Buff", "mpCost": 10}, {"id": "4008", "name": "Jalapeno Saucesphere", "type": "Buff", "mpCost": 5}, {"id": "4009", "name": "Wave of Sauce", "type": "Combat", "mpCost": 23}, {"id": "4010", "name": "Intrinsic Spiciness", "type": "Passive"}, {"id": "4011", "name": "Jabanero Saucesphere", "type": "Buff", "mpCost": 10}, {"id": "4012", "name": "Saucegeyser", "type": "Combat", "mpCost": 40}, {"id": "4014", "name": "Saucy Salve", "type": "Combat", "mpCost": 4}, {"id": "4015", "name": "Impetuous Sauciness", "type": "Passive"}, {"id": "4016", "name": "Diminished Gag Reflex", "type": "Passive"}, {"id": "4017", "name": "Immaculate Seasoning", "type": "Passive"}, {"id": "4018", "name": "The Way of Sauce", "type": "Passive"}, {"id": "4019", "name": "Scarysauce", "type": "Buff", "mpCost": 10}, {"id": "4020", "name": "Salsaball", "type": "Combat", "mpCost": 1}, {"id": "5000", "name": "Disco Aerobics", "type": "Noncombat", "mpCost": 1}, {"id": "5003", "name": "Disco Eye-Poke", "type": "Combat", "mpCost": 3}, {"id": "5004", "name": "Nimble Fingers", "type": "Passive"}, {"id": "5005", "name": "Disco Dance of Doom", "type": "Combat", "mpCost": 5}, {"id": "5006", "name": "Mad Looting Skillz", "type": "Passive"}, {"id": "5007", "name": "Disco Nap", "type": "Noncombat", "mpCost": 8}, { "id": "5008", "name": "Disco Dance II: Electric Boogaloo", "type": "Combat", "mpCost": 7, }, {"id": "5009", "name": "Disco Fever", "type": "Passive"}, { "id": "5010", "name": "Overdeveloped Sense of Self Preservation", "type": "Passive", }, {"id": "5011", "name": "Disco Power Nap", "type": "Noncombat", "mpCost": 12}, {"id": "5012", "name": "Disco Face Stab", "type": "Combat", "mpCost": 10}, { "id": "5014", "name": "Advanced Cocktailcrafting", "type": "Noncombat", "mpCost": 10, }, {"id": "5015", "name": "Ambidextrous Funkslinging", "type": "Passive"}, {"id": "5016", "name": "Heart of Polyester", "type": "Passive"}, {"id": "5017", "name": "Smooth Movement", "type": "Noncombat", "mpCost": 10}, {"id": "5018", "name": "Superhuman Cocktailcrafting", "type": "Passive"}, {"id": "5019", "name": "Tango of Terror", "type": "Combat", "mpCost": 8}, {"id": "6000", "name": "Moxie of the Mariachi", "type": "Noncombat", "mpCost": 1}, { "id": "6003", "name": "Aloysius' Antiphon of Aptitude", "type": "Buff", "mpCost": 40, }, {"id": "6004", "name": "The Moxious Madrigal", "type": "Buff", "mpCost": 2}, { "id": "6005", "name": "Cletus's Canticle of Celerity", "type": "Buff", "mpCost": 4, }, {"id": "6006", "name": "The Polka of Plenty", "type": "Buff", "mpCost": 7}, { "id": "6007", "name": "The Magical Mojomuscular Melody", "type": "Buff", "mpCost": 3, }, { "id": "6008", "name": "The Power Ballad of the Arrowsmith", "type": "Buff", "mpCost": 5, }, { "id": "6009", "name": "Brawnee's Anthem of Absorption", "type": "Buff", "mpCost": 13, }, {"id": "6010", "name": "Fat Leon's Phat Loot Lyric", "type": "Buff", "mpCost": 11}, {"id": "6011", "name": "The Psalm of Pointiness", "type": "Buff", "mpCost": 15}, { "id": "6012", "name": "Jackasses' Symphony of Destruction", "type": "Buff", "mpCost": 9, }, { "id": "6013", "name": "Stevedave's Shanty of Superiority", "type": "Buff", "mpCost": 30, }, {"id": "6014", "name": "The Ode to Booze", "type": "Buff", "mpCost": 50}, {"id": "6015", "name": "The Sonata of Sneakiness", "type": "Buff", "mpCost": 20}, { "id": "6016", "name": "Carlweather's Cantata of Confrontation", "type": "Buff", "mpCost": 20, }, {"id": "6017", "name": "Ur-Kel's Aria of Annoyance", "type": "Buff", "mpCost": 30}, {"id": "6018", "name": "Dirge of Dreadfulness", "type": "Buff", "mpCost": 9}, { "id": "6020", "name": "The Ballad of Richie Thingfinder", "type": "Buff", "mpCost": 50, }, { "id": "6021", "name": "Benetton's Medley of Diversity", "type": "Buff", "mpCost": 50, }, {"id": "6022", "name": "Elron's Explosive Etude", "type": "Buff", "mpCost": 50}, {"id": "6023", "name": "Chorale of Companionship", "type": "Buff", "mpCost": 50}, {"id": "6024", "name": "Prelude of Precision", "type": "Buff", "mpCost": 50}, { "id": "7001", "name": "Give In To Your Vampiric Urges", "type": "Combat", "mpCost": 0, }, {"id": "7002", "name": "Shake Hands", "type": "Combat", "mpCost": 0}, {"id": "7003", "name": "Hot Breath", "type": "Combat", "mpCost": 5}, {"id": "7004", "name": "Cold Breath", "type": "Combat", "mpCost": 5}, {"id": "7005", "name": "Spooky Breath", "type": "Combat", "mpCost": 5}, {"id": "7006", "name": "Stinky Breath", "type": "Combat", "mpCost": 5}, {"id": "7007", "name": "Sleazy Breath", "type": "Combat", "mpCost": 5}, {"id": "7008", "name": "Moxious Maneuver", "type": "Combat"}, {"id": "7009", "name": "Magic Missile", "type": "Combat", "mpCost": 2}, {"id": "7010", "name": "Fire Red Bottle-Rocket", "type": "Combat", "mpCost": 5}, {"id": "7011", "name": "Fire Blue Bottle-Rocket", "type": "Combat", "mpCost": 5}, {"id": "7012", "name": "Fire Orange Bottle-Rocket", "type": "Combat", "mpCost": 5}, {"id": "7013", "name": "Fire Purple Bottle-Rocket", "type": "Combat", "mpCost": 5}, {"id": "7014", "name": "Fire Black Bottle-Rocket", "type": "Combat", "mpCost": 5}, {"id": "7015", "name": "Creepy Grin", "type": "Combat", "mpCost": 30}, {"id": "7016", "name": "Start Trash Fire", "type": "Combat", "mpCost": 100}, { "id": "7017", "name": "Overload Discarded Refrigerator", "type": "Combat", "mpCost": 100, }, {"id": "7018", "name": "Trashquake", "type": "Combat", "mpCost": 100}, {"id": "7019", "name": "Zombo's Visage", "type": "Combat", "mpCost": 100}, {"id": "7020", "name": "Hypnotize Hobo", "type": "Combat", "mpCost": 100}, {"id": "7021", "name": "Ask Richard for a Bandage", "type": "Combat"}, {"id": "7022", "name": "Ask Richard for a Grenade", "type": "Combat"}, {"id": "7023", "name": "Ask Richard to Rough the Hobo Up a Bit", "type": "Combat"}, {"id": "7024", "name": "Summon Mayfly Swarm", "type": "Combat", "mpCost": 0}, {"id": "7025", "name": "Get a You-Eye View", "type": "Combat", "mpCost": 30}, {"id": "7038", "name": "Vicious Talon Slash", "type": "Combat", "mpCost": 5}, { "id": "7039", "name": "All-You-Can-Beat Wing Buffet", "type": "Combat", "mpCost": 10, }, {"id": "7040", "name": "Tunnel Upwards", "type": "Combat", "mpCost": 0}, {"id": "7041", "name": "Tunnel Downwards", "type": "Combat", "mpCost": 0}, {"id": "7042", "name": "Rise From Your Ashes", "type": "Combat", "mpCost": 20}, {"id": "7043", "name": "Antarctic Flap", "type": "Combat", "mpCost": 10}, {"id": "7044", "name": "The Statue Treatment", "type": "Combat", "mpCost": 20}, {"id": "7045", "name": "Feast on Carrion", "type": "Combat", "mpCost": 20}, { "id": "7046", "name": 'Give Your Opponent "The Bird"', "type": "Combat", "mpCost": 20, }, {"id": "7047", "name": "Ask the hobo for a drink", "type": "Combat", "mpCost": 0}, { "id": "7048", "name": "Ask the hobo for something to eat", "type": "Combat", "mpCost": 0, }, { "id": "7049", "name": "Ask the hobo for some violence", "type": "Combat", "mpCost": 0, }, { "id": "7050", "name": "Ask the hobo to tell you a joke", "type": "Combat", "mpCost": 0, }, { "id": "7051", "name": "Ask the hobo to dance for you", "type": "Combat", "mpCost": 0, }, {"id": "7052", "name": "Summon hobo underling", "type": "Combat", "mpCost": 0}, {"id": "7053", "name": "Rouse Sapling", "type": "Combat", "mpCost": 15}, {"id": "7054", "name": "Spray Sap", "type": "Combat", "mpCost": 15}, {"id": "7055", "name": "Put Down Roots", "type": "Combat", "mpCost": 15}, {"id": "7056", "name": "Fire off a Roman Candle", "type": "Combat", "mpCost": 10}, {"id": "7061", "name": "Spring Raindrop Attack", "type": "Combat", "mpCost": 0}, {"id": "7062", "name": "Summer Siesta", "type": "Combat", "mpCost": 10}, {"id": "7063", "name": "Falling Leaf Whirlwind", "type": "Combat", "mpCost": 10}, {"id": "7064", "name": "Winter's Bite Technique", "type": "Combat", "mpCost": 10}, {"id": "7065", "name": "The 17 Cuts", "type": "Combat", "mpCost": 10}, { "id": "8000", "name": "Summon Snowcones", "type": "Mystical Bookshelf", "mpCost": 5, }, {"id": "8100", "name": "Summon Candy Heart", "type": "Mystical Bookshelf"}, {"id": "8101", "name": "Summon Party Favor", "type": "Mystical Bookshelf"}, { "id": "8200", "name": "Summon Hilarious Objects", "type": "Mystical Bookshelf", "mpCost": 5, }, { "id": "8201", "name": 'Summon "Tasteful" Gifts', "type": "Mystical Bookshelf", "mpCost": 5, }, ]
skills = [{'id': '0001', 'name': 'Liver of Steel', 'type': 'Passive', 'isPermable': False, 'effects': {'maximumInebriety': '+5'}}, {'id': '0002', 'name': 'Chronic Indigestion', 'type': 'Combat', 'mpCost': 5}, {'id': '0003', 'name': 'The Smile of Mr. A.', 'type': 'Buff', 'mpCost': 5, 'isPermable': False}, {'id': '0004', 'name': 'Arse Shoot', 'type': 'Buff', 'mpCost': 5, 'isPermable': False}, {'id': '0005', 'name': 'Stomach of Steel', 'type': 'Passive', 'isPermable': False, 'effects': {'maximumFullness': '+5'}}, {'id': '0006', 'name': 'Spleen of Steel', 'type': 'Passive', 'isPermable': False, 'effects': {'maximumSpleen': '+5'}}, {'id': '0010', 'name': 'Powers of Observatiogn', 'type': 'Passive', 'effects': {'itemDrop': '+10%'}}, {'id': '0011', 'name': 'Gnefarious Pickpocketing', 'type': 'Passive', 'effects': {'meatDrop': '+10%'}}, {'id': '0012', 'name': 'Torso Awaregness', 'type': 'Passive'}, {'id': '0013', 'name': 'Gnomish Hardigness', 'type': 'Passive', 'effects': {'maximumHP': '+5%'}}, {'id': '0014', 'name': 'Cosmic Ugnderstanding', 'type': 'Passive', 'effects': {'maximumMP': '+5%'}}, {'id': '0015', 'name': 'CLEESH', 'type': 'Combat', 'mpCost': 10}, {'id': '0019', 'name': 'Transcendent Olfaction', 'type': 'Combat', 'mpCost': 40, 'isAutomaticallyPermed': True}, {'id': '0020', 'name': 'Really Expensive Jewelrycrafting', 'type': 'Passive', 'isPermable': False}, {'id': '0021', 'name': 'Lust', 'type': 'Passive', 'isPermable': False, 'effects': {'combatInitiative': '+50%', 'spellDamage': '-5', 'meleeDamage': '-5'}}, {'id': '0022', 'name': 'Gluttony', 'type': 'Passive', 'isPermable': False, 'effects': {'strengthensFood': True, 'statsPerFight': '-2'}}, {'id': '0023', 'name': 'Greed', 'type': 'Passive', 'isPermable': False, 'effects': {'meatDrop': '+50%', 'itemDrop': '-15%'}}, {'id': '0024', 'name': 'Sloth', 'type': 'Passive', 'isPermable': False, 'effects': {'damageReduction': '+8', 'combatInitiative': '-25%'}}, {'id': '0025', 'name': 'Wrath', 'type': 'Passive', 'isPermable': False, 'effects': {'spellDamage': '+10', 'meleeDamage': '+10', 'damageReduction': '-4'}}, {'id': '0026', 'name': 'Envy', 'type': 'Passive', 'isPermable': False, 'effects': {'itemDrop': '+30%', 'meatDrop': '-25%'}}, {'id': '0027', 'name': 'Pride', 'type': 'Passive', 'isPermable': False, 'effects': {'statsPerFight': '+4', 'weakensFood': True}}, {'id': '0028', 'name': 'Awesome Balls of Fire', 'type': 'Combat', 'mpCost': 120}, {'id': '0029', 'name': 'Conjure Relaxing Campfire', 'type': 'Combat', 'mpCost': 30}, {'id': '0030', 'name': 'Snowclone', 'type': 'Combat', 'mpCost': 120}, {'id': '0031', 'name': 'Maximum Chill', 'type': 'Combat', 'mpCost': 30}, {'id': '0032', 'name': 'Eggsplosion', 'type': 'Combat', 'mpCost': 120}, {'id': '0033', 'name': 'Mudbath', 'type': 'Combat', 'mpCost': 30}, {'id': '0036', 'name': 'Grease Lightning', 'type': 'Combat', 'mpCost': 120}, {'id': '0037', 'name': 'Inappropriate Backrub', 'type': 'Combat', 'mpCost': 30}, {'id': '0038', 'name': 'Natural Born Scrabbler', 'type': 'Passive', 'effects': {'itemDrop': '+5%'}}, {'id': '0039', 'name': 'Thrift and Grift', 'type': 'Passive', 'effects': {'meatDrop': '+10%'}}, {'id': '0040', 'name': 'Abs of Tin', 'type': 'Passive', 'effects': {'maximumHP': '+10%'}}, {'id': '0041', 'name': 'Marginally Insane', 'type': 'Passive', 'effects': {'maximumMP': '+10%'}}, {'id': '0042', 'name': 'Raise Backup Dancer', 'type': 'Combat', 'mpCost': 120}, {'id': '0043', 'name': 'Creepy Lullaby', 'type': 'Combat', 'mpCost': 30}, {'id': '0044', 'name': 'Rainbow Gravitation', 'type': 'Noncombat', 'mpCost': 30}, {'id': '1000', 'name': 'Seal Clubbing Frenzy', 'type': 'Noncombat', 'mpCost': 1}, {'id': '1003', 'name': 'Thrust-Smack', 'type': 'Combat', 'mpCost': 3}, {'id': '1004', 'name': 'Lunge-Smack', 'type': 'Combat', 'mpCost': 5}, {'id': '1005', 'name': 'Lunging Thrust-Smack', 'type': 'Combat', 'mpCost': 8}, {'id': '1006', 'name': 'Super-Advanced Meatsmithing', 'type': 'Passive'}, {'id': '1007', 'name': 'Tongue of the Otter', 'type': 'Noncombat', 'mpCost': 7}, {'id': '1008', 'name': 'Hide of the Otter', 'type': 'Passive'}, {'id': '1009', 'name': 'Claws of the Otter', 'type': 'Passive'}, {'id': '1010', 'name': 'Tongue of the Walrus', 'type': 'Noncombat', 'mpCost': 10}, {'id': '1011', 'name': 'Hide of the Walrus', 'type': 'Passive'}, {'id': '1012', 'name': 'Claws of the Walrus', 'type': 'Passive'}, {'id': '1014', 'name': 'Eye of the Stoat', 'type': 'Passive'}, {'id': '1015', 'name': 'Rage of the Reindeer', 'type': 'Noncombat', 'mpCost': 10}, {'id': '1016', 'name': 'Pulverize', 'type': 'Passive'}, {'id': '1017', 'name': 'Double-Fisted Skull Smashing', 'type': 'Passive'}, {'id': '1018', 'name': 'Northern Exposure', 'type': 'Passive'}, {'id': '1019', 'name': 'Musk of the Moose', 'type': 'Noncombat', 'mpCost': 10}, {'id': '1020', 'name': 'Snarl of the Timberwolf', 'type': 'Noncombat', 'mpCost': 10}, {'id': '2000', 'name': 'Patience of the Tortoise', 'type': 'Noncombat', 'mpCost': 1}, {'id': '2003', 'name': 'Headbutt', 'type': 'Combat', 'mpCost': 3}, {'id': '2004', 'name': 'Skin of the Leatherback', 'type': 'Passive'}, {'id': '2005', 'name': 'Shieldbutt', 'type': 'Combat', 'mpCost': 5}, {'id': '2006', 'name': 'Armorcraftiness', 'type': 'Passive'}, {'id': '2007', 'name': 'Ghostly Shell', 'type': 'Buff', 'mpCost': 6}, {'id': '2008', 'name': 'Reptilian Fortitude', 'type': 'Buff', 'mpCost': 10}, {'id': '2009', 'name': 'Empathy of the Newt', 'type': 'Buff', 'mpCost': 15}, {'id': '2010', 'name': 'Tenacity of the Snapper', 'type': 'Buff', 'mpCost': 8}, {'id': '2011', 'name': 'Wisdom of the Elder Tortoises', 'type': 'Passive'}, {'id': '2012', 'name': 'Astral Shell', 'type': 'Buff', 'mpCost': 10}, {'id': '2014', 'name': 'Amphibian Sympathy', 'type': 'Passive'}, {'id': '2015', 'name': 'Kneebutt', 'type': 'Combat', 'mpCost': 4}, {'id': '2016', 'name': 'Cold-Blooded Fearlessness', 'type': 'Passive'}, {'id': '2020', 'name': 'Hero of the Half-Shell', 'type': 'Passive'}, {'id': '2021', 'name': 'Tao of the Terrapin', 'type': 'Passive'}, {'id': '2022', 'name': 'Spectral Snapper', 'type': 'Combat', 'mpCost': 20}, {'id': '2103', 'name': 'Head + Knee Combo', 'type': 'Combat', 'mpCost': 8}, {'id': '2105', 'name': 'Head + Shield Combo', 'type': 'Combat', 'mpCost': 9}, {'id': '2106', 'name': 'Knee + Shield Combo', 'type': 'Combat', 'mpCost': 10}, {'id': '2107', 'name': 'Head + Knee + Shield Combo', 'type': 'Combat', 'mpCost': 13}, {'id': '3000', 'name': 'Manicotti Meditation', 'type': 'Noncombat', 'mpCost': 1}, {'id': '3003', 'name': 'Ravioli Shurikens', 'type': 'Combat', 'mpCost': 4}, {'id': '3004', 'name': 'Entangling Noodles', 'type': 'Combat', 'mpCost': 3}, {'id': '3005', 'name': 'Cannelloni Cannon', 'type': 'Combat', 'mpCost': 7}, {'id': '3006', 'name': 'Pastamastery', 'type': 'Noncombat', 'mpCost': 10}, {'id': '3007', 'name': 'Stuffed Mortar Shell', 'type': 'Combat', 'mpCost': 19}, {'id': '3008', 'name': 'Weapon of the Pastalord', 'type': 'Combat', 'mpCost': 35}, {'id': '3009', 'name': 'Lasagna Bandages', 'type': 'Combat / Noncombat', 'mpCost': 6}, {'id': '3010', 'name': 'Leash of Linguini', 'type': 'Noncombat', 'mpCost': 12}, {'id': '3011', 'name': 'Spirit of Rigatoni', 'type': 'Passive'}, {'id': '3012', 'name': 'Cannelloni Cocoon', 'type': 'Noncombat', 'mpCost': 20}, {'id': '3014', 'name': 'Spirit of Ravioli', 'type': 'Passive'}, {'id': '3015', 'name': 'Springy Fusilli', 'type': 'Noncombat', 'mpCost': 10}, {'id': '3016', 'name': 'Tolerance of the Kitchen', 'type': 'Passive'}, {'id': '3017', 'name': 'Flavour of Magic', 'type': 'Noncombat', 'mpCost': 10}, {'id': '3018', 'name': 'Transcendental Noodlecraft', 'type': 'Passive'}, {'id': '3019', 'name': 'Fearful Fettucini', 'type': 'Combat', 'mpCost': 35}, {'id': '3020', 'name': 'Spaghetti Spear', 'type': 'Combat', 'mpCost': 1}, {'id': '3101', 'name': 'Spirit of Cayenne', 'type': 'Noncombat', 'mpCost': 10}, {'id': '3102', 'name': 'Spirit of Peppermint', 'type': 'Noncombat', 'mpCost': 10}, {'id': '3103', 'name': 'Spirit of Garlic', 'type': 'Noncombat', 'mpCost': 10}, {'id': '3104', 'name': 'Spirit of Wormwood', 'type': 'Noncombat', 'mpCost': 10}, {'id': '3105', 'name': 'Spirit of Bacon Grease', 'type': 'Noncombat', 'mpCost': 10}, {'id': '4000', 'name': 'Sauce Contemplation', 'type': 'Noncombat', 'mpCost': 1}, {'id': '4003', 'name': 'Stream of Sauce', 'type': 'Combat', 'mpCost': 3}, {'id': '4004', 'name': 'Expert Panhandling', 'type': 'Passive'}, {'id': '4005', 'name': 'Saucestorm', 'type': 'Combat', 'mpCost': 12}, {'id': '4006', 'name': 'Advanced Saucecrafting', 'type': 'Noncombat', 'mpCost': 10}, {'id': '4007', 'name': 'Elemental Saucesphere', 'type': 'Buff', 'mpCost': 10}, {'id': '4008', 'name': 'Jalapeno Saucesphere', 'type': 'Buff', 'mpCost': 5}, {'id': '4009', 'name': 'Wave of Sauce', 'type': 'Combat', 'mpCost': 23}, {'id': '4010', 'name': 'Intrinsic Spiciness', 'type': 'Passive'}, {'id': '4011', 'name': 'Jabanero Saucesphere', 'type': 'Buff', 'mpCost': 10}, {'id': '4012', 'name': 'Saucegeyser', 'type': 'Combat', 'mpCost': 40}, {'id': '4014', 'name': 'Saucy Salve', 'type': 'Combat', 'mpCost': 4}, {'id': '4015', 'name': 'Impetuous Sauciness', 'type': 'Passive'}, {'id': '4016', 'name': 'Diminished Gag Reflex', 'type': 'Passive'}, {'id': '4017', 'name': 'Immaculate Seasoning', 'type': 'Passive'}, {'id': '4018', 'name': 'The Way of Sauce', 'type': 'Passive'}, {'id': '4019', 'name': 'Scarysauce', 'type': 'Buff', 'mpCost': 10}, {'id': '4020', 'name': 'Salsaball', 'type': 'Combat', 'mpCost': 1}, {'id': '5000', 'name': 'Disco Aerobics', 'type': 'Noncombat', 'mpCost': 1}, {'id': '5003', 'name': 'Disco Eye-Poke', 'type': 'Combat', 'mpCost': 3}, {'id': '5004', 'name': 'Nimble Fingers', 'type': 'Passive'}, {'id': '5005', 'name': 'Disco Dance of Doom', 'type': 'Combat', 'mpCost': 5}, {'id': '5006', 'name': 'Mad Looting Skillz', 'type': 'Passive'}, {'id': '5007', 'name': 'Disco Nap', 'type': 'Noncombat', 'mpCost': 8}, {'id': '5008', 'name': 'Disco Dance II: Electric Boogaloo', 'type': 'Combat', 'mpCost': 7}, {'id': '5009', 'name': 'Disco Fever', 'type': 'Passive'}, {'id': '5010', 'name': 'Overdeveloped Sense of Self Preservation', 'type': 'Passive'}, {'id': '5011', 'name': 'Disco Power Nap', 'type': 'Noncombat', 'mpCost': 12}, {'id': '5012', 'name': 'Disco Face Stab', 'type': 'Combat', 'mpCost': 10}, {'id': '5014', 'name': 'Advanced Cocktailcrafting', 'type': 'Noncombat', 'mpCost': 10}, {'id': '5015', 'name': 'Ambidextrous Funkslinging', 'type': 'Passive'}, {'id': '5016', 'name': 'Heart of Polyester', 'type': 'Passive'}, {'id': '5017', 'name': 'Smooth Movement', 'type': 'Noncombat', 'mpCost': 10}, {'id': '5018', 'name': 'Superhuman Cocktailcrafting', 'type': 'Passive'}, {'id': '5019', 'name': 'Tango of Terror', 'type': 'Combat', 'mpCost': 8}, {'id': '6000', 'name': 'Moxie of the Mariachi', 'type': 'Noncombat', 'mpCost': 1}, {'id': '6003', 'name': "Aloysius' Antiphon of Aptitude", 'type': 'Buff', 'mpCost': 40}, {'id': '6004', 'name': 'The Moxious Madrigal', 'type': 'Buff', 'mpCost': 2}, {'id': '6005', 'name': "Cletus's Canticle of Celerity", 'type': 'Buff', 'mpCost': 4}, {'id': '6006', 'name': 'The Polka of Plenty', 'type': 'Buff', 'mpCost': 7}, {'id': '6007', 'name': 'The Magical Mojomuscular Melody', 'type': 'Buff', 'mpCost': 3}, {'id': '6008', 'name': 'The Power Ballad of the Arrowsmith', 'type': 'Buff', 'mpCost': 5}, {'id': '6009', 'name': "Brawnee's Anthem of Absorption", 'type': 'Buff', 'mpCost': 13}, {'id': '6010', 'name': "Fat Leon's Phat Loot Lyric", 'type': 'Buff', 'mpCost': 11}, {'id': '6011', 'name': 'The Psalm of Pointiness', 'type': 'Buff', 'mpCost': 15}, {'id': '6012', 'name': "Jackasses' Symphony of Destruction", 'type': 'Buff', 'mpCost': 9}, {'id': '6013', 'name': "Stevedave's Shanty of Superiority", 'type': 'Buff', 'mpCost': 30}, {'id': '6014', 'name': 'The Ode to Booze', 'type': 'Buff', 'mpCost': 50}, {'id': '6015', 'name': 'The Sonata of Sneakiness', 'type': 'Buff', 'mpCost': 20}, {'id': '6016', 'name': "Carlweather's Cantata of Confrontation", 'type': 'Buff', 'mpCost': 20}, {'id': '6017', 'name': "Ur-Kel's Aria of Annoyance", 'type': 'Buff', 'mpCost': 30}, {'id': '6018', 'name': 'Dirge of Dreadfulness', 'type': 'Buff', 'mpCost': 9}, {'id': '6020', 'name': 'The Ballad of Richie Thingfinder', 'type': 'Buff', 'mpCost': 50}, {'id': '6021', 'name': "Benetton's Medley of Diversity", 'type': 'Buff', 'mpCost': 50}, {'id': '6022', 'name': "Elron's Explosive Etude", 'type': 'Buff', 'mpCost': 50}, {'id': '6023', 'name': 'Chorale of Companionship', 'type': 'Buff', 'mpCost': 50}, {'id': '6024', 'name': 'Prelude of Precision', 'type': 'Buff', 'mpCost': 50}, {'id': '7001', 'name': 'Give In To Your Vampiric Urges', 'type': 'Combat', 'mpCost': 0}, {'id': '7002', 'name': 'Shake Hands', 'type': 'Combat', 'mpCost': 0}, {'id': '7003', 'name': 'Hot Breath', 'type': 'Combat', 'mpCost': 5}, {'id': '7004', 'name': 'Cold Breath', 'type': 'Combat', 'mpCost': 5}, {'id': '7005', 'name': 'Spooky Breath', 'type': 'Combat', 'mpCost': 5}, {'id': '7006', 'name': 'Stinky Breath', 'type': 'Combat', 'mpCost': 5}, {'id': '7007', 'name': 'Sleazy Breath', 'type': 'Combat', 'mpCost': 5}, {'id': '7008', 'name': 'Moxious Maneuver', 'type': 'Combat'}, {'id': '7009', 'name': 'Magic Missile', 'type': 'Combat', 'mpCost': 2}, {'id': '7010', 'name': 'Fire Red Bottle-Rocket', 'type': 'Combat', 'mpCost': 5}, {'id': '7011', 'name': 'Fire Blue Bottle-Rocket', 'type': 'Combat', 'mpCost': 5}, {'id': '7012', 'name': 'Fire Orange Bottle-Rocket', 'type': 'Combat', 'mpCost': 5}, {'id': '7013', 'name': 'Fire Purple Bottle-Rocket', 'type': 'Combat', 'mpCost': 5}, {'id': '7014', 'name': 'Fire Black Bottle-Rocket', 'type': 'Combat', 'mpCost': 5}, {'id': '7015', 'name': 'Creepy Grin', 'type': 'Combat', 'mpCost': 30}, {'id': '7016', 'name': 'Start Trash Fire', 'type': 'Combat', 'mpCost': 100}, {'id': '7017', 'name': 'Overload Discarded Refrigerator', 'type': 'Combat', 'mpCost': 100}, {'id': '7018', 'name': 'Trashquake', 'type': 'Combat', 'mpCost': 100}, {'id': '7019', 'name': "Zombo's Visage", 'type': 'Combat', 'mpCost': 100}, {'id': '7020', 'name': 'Hypnotize Hobo', 'type': 'Combat', 'mpCost': 100}, {'id': '7021', 'name': 'Ask Richard for a Bandage', 'type': 'Combat'}, {'id': '7022', 'name': 'Ask Richard for a Grenade', 'type': 'Combat'}, {'id': '7023', 'name': 'Ask Richard to Rough the Hobo Up a Bit', 'type': 'Combat'}, {'id': '7024', 'name': 'Summon Mayfly Swarm', 'type': 'Combat', 'mpCost': 0}, {'id': '7025', 'name': 'Get a You-Eye View', 'type': 'Combat', 'mpCost': 30}, {'id': '7038', 'name': 'Vicious Talon Slash', 'type': 'Combat', 'mpCost': 5}, {'id': '7039', 'name': 'All-You-Can-Beat Wing Buffet', 'type': 'Combat', 'mpCost': 10}, {'id': '7040', 'name': 'Tunnel Upwards', 'type': 'Combat', 'mpCost': 0}, {'id': '7041', 'name': 'Tunnel Downwards', 'type': 'Combat', 'mpCost': 0}, {'id': '7042', 'name': 'Rise From Your Ashes', 'type': 'Combat', 'mpCost': 20}, {'id': '7043', 'name': 'Antarctic Flap', 'type': 'Combat', 'mpCost': 10}, {'id': '7044', 'name': 'The Statue Treatment', 'type': 'Combat', 'mpCost': 20}, {'id': '7045', 'name': 'Feast on Carrion', 'type': 'Combat', 'mpCost': 20}, {'id': '7046', 'name': 'Give Your Opponent "The Bird"', 'type': 'Combat', 'mpCost': 20}, {'id': '7047', 'name': 'Ask the hobo for a drink', 'type': 'Combat', 'mpCost': 0}, {'id': '7048', 'name': 'Ask the hobo for something to eat', 'type': 'Combat', 'mpCost': 0}, {'id': '7049', 'name': 'Ask the hobo for some violence', 'type': 'Combat', 'mpCost': 0}, {'id': '7050', 'name': 'Ask the hobo to tell you a joke', 'type': 'Combat', 'mpCost': 0}, {'id': '7051', 'name': 'Ask the hobo to dance for you', 'type': 'Combat', 'mpCost': 0}, {'id': '7052', 'name': 'Summon hobo underling', 'type': 'Combat', 'mpCost': 0}, {'id': '7053', 'name': 'Rouse Sapling', 'type': 'Combat', 'mpCost': 15}, {'id': '7054', 'name': 'Spray Sap', 'type': 'Combat', 'mpCost': 15}, {'id': '7055', 'name': 'Put Down Roots', 'type': 'Combat', 'mpCost': 15}, {'id': '7056', 'name': 'Fire off a Roman Candle', 'type': 'Combat', 'mpCost': 10}, {'id': '7061', 'name': 'Spring Raindrop Attack', 'type': 'Combat', 'mpCost': 0}, {'id': '7062', 'name': 'Summer Siesta', 'type': 'Combat', 'mpCost': 10}, {'id': '7063', 'name': 'Falling Leaf Whirlwind', 'type': 'Combat', 'mpCost': 10}, {'id': '7064', 'name': "Winter's Bite Technique", 'type': 'Combat', 'mpCost': 10}, {'id': '7065', 'name': 'The 17 Cuts', 'type': 'Combat', 'mpCost': 10}, {'id': '8000', 'name': 'Summon Snowcones', 'type': 'Mystical Bookshelf', 'mpCost': 5}, {'id': '8100', 'name': 'Summon Candy Heart', 'type': 'Mystical Bookshelf'}, {'id': '8101', 'name': 'Summon Party Favor', 'type': 'Mystical Bookshelf'}, {'id': '8200', 'name': 'Summon Hilarious Objects', 'type': 'Mystical Bookshelf', 'mpCost': 5}, {'id': '8201', 'name': 'Summon "Tasteful" Gifts', 'type': 'Mystical Bookshelf', 'mpCost': 5}]
load("@bazel_gazelle//:deps.bzl", "go_repository") def go_repositories(): go_repository( name = "co_honnef_go_tools", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "honnef.co/go/tools", sum = "h1:MNh1AVMyVX23VUHE2O27jm6lNj3vjO5DexS4A1xvnzk=", version = "v0.2.2", ) go_repository( name = "com_github_alecthomas_template", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/alecthomas/template", sum = "h1:JYp7IbQjafoB+tBA3gMyHYHrpOtNuDiK/uB5uXxq5wM=", version = "v0.0.0-20190718012654-fb15b899a751", ) go_repository( name = "com_github_alecthomas_units", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/alecthomas/units", sum = "h1:UQZhZ2O0vMHr2cI+DC1Mbh0TJxzA3RcLoMsFw+aXw7E=", version = "v0.0.0-20190924025748-f65c72e2690d", ) go_repository( name = "com_github_andreasbriese_bbloom", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/AndreasBriese/bbloom", sum = "h1:cTp8I5+VIoKjsnZuH8vjyaysT/ses3EvZeaV/1UkF2M=", version = "v0.0.0-20190825152654-46b345b51c96", ) go_repository( name = "com_github_antihax_optional", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/antihax/optional", sum = "h1:xK2lYat7ZLaVVcIuj82J8kIro4V6kDe0AUDFboUCwcg=", version = "v1.0.0", ) go_repository( name = "com_github_armon_consul_api", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/armon/consul-api", sum = "h1:G1bPvciwNyF7IUmKXNt9Ak3m6u9DE1rF+RmtIkBpVdA=", version = "v0.0.0-20180202201655-eb2c6b5be1b6", ) go_repository( name = "com_github_aws_aws_sdk_go_v2", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/aws-sdk-go-v2", sum = "h1:1XIXAfxsEmbhbj5ry3D3vX+6ZcUYvIqSm4CWWEuGZCA=", version = "v1.13.0", ) go_repository( name = "com_github_aws_aws_sdk_go_v2_aws_protocol_eventstream", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/aws-sdk-go-v2/aws/protocol/eventstream", sum = "h1:scBthy70MB3m4LCMFaBcmYCyR2XWOz6MxSfdSu/+fQo=", version = "v1.2.0", ) go_repository( name = "com_github_aws_aws_sdk_go_v2_config", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/aws-sdk-go-v2/config", sum = "h1:yLv8bfNoT4r+UvUKQKqRtdnvuWGMK5a82l4ru9Jvnuo=", version = "v1.13.1", ) go_repository( name = "com_github_aws_aws_sdk_go_v2_credentials", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/aws-sdk-go-v2/credentials", sum = "h1:8Ow0WcyDesGNL0No11jcgb1JAtE+WtubqXjgxau+S0o=", version = "v1.8.0", ) go_repository( name = "com_github_aws_aws_sdk_go_v2_feature_ec2_imds", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/aws-sdk-go-v2/feature/ec2/imds", sum = "h1:NITDuUZO34mqtOwFWZiXo7yAHj7kf+XPE+EiKuCBNUI=", version = "v1.10.0", ) go_repository( name = "com_github_aws_aws_sdk_go_v2_feature_s3_manager", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/aws-sdk-go-v2/feature/s3/manager", sum = "h1:oUCLhAKNaXyTqdJyw+KEjDVVBs1V5mCy8YDLMi08LL8=", version = "v1.9.1", ) go_repository( name = "com_github_aws_aws_sdk_go_v2_internal_configsources", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/aws-sdk-go-v2/internal/configsources", sum = "h1:CRiQJ4E2RhfDdqbie1ZYDo8QtIo75Mk7oTdJSfwJTMQ=", version = "v1.1.4", ) go_repository( name = "com_github_aws_aws_sdk_go_v2_internal_endpoints_v2", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/aws-sdk-go-v2/internal/endpoints/v2", sum = "h1:3ADoioDMOtF4uiK59vCpplpCwugEU+v4ZFD29jDL3RQ=", version = "v2.2.0", ) go_repository( name = "com_github_aws_aws_sdk_go_v2_internal_ini", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/aws-sdk-go-v2/internal/ini", sum = "h1:ixotxbfTCFpqbuwFv/RcZwyzhkxPSYDYEMcj4niB5Uk=", version = "v1.3.5", ) go_repository( name = "com_github_aws_aws_sdk_go_v2_service_internal_accept_encoding", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/aws-sdk-go-v2/service/internal/accept-encoding", sum = "h1:F1diQIOkNn8jcez4173r+PLPdkWK7chy74r3fKpDrLI=", version = "v1.7.0", ) go_repository( name = "com_github_aws_aws_sdk_go_v2_service_internal_presigned_url", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/aws-sdk-go-v2/service/internal/presigned-url", sum = "h1:4QAOB3KrvI1ApJK14sliGr3Ie2pjyvNypn/lfzDHfUw=", version = "v1.7.0", ) go_repository( name = "com_github_aws_aws_sdk_go_v2_service_internal_s3shared", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/aws-sdk-go-v2/service/internal/s3shared", sum = "h1:XAe+PDnaBELHr25qaJKfB415V4CKFWE8H+prUreql8k=", version = "v1.11.0", ) go_repository( name = "com_github_aws_aws_sdk_go_v2_service_s3", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/aws-sdk-go-v2/service/s3", sum = "h1:zAU2P99CLTz8kUGl+IptU2ycAXuMaLAvgIv+UH4U8pY=", version = "v1.24.1", ) go_repository( name = "com_github_aws_aws_sdk_go_v2_service_sso", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/aws-sdk-go-v2/service/sso", sum = "h1:1qLJeQGBmNQW3mBNzK2CFmrQNmoXWrscPqsrAaU1aTA=", version = "v1.9.0", ) go_repository( name = "com_github_aws_aws_sdk_go_v2_service_sts", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/aws-sdk-go-v2/service/sts", sum = "h1:ksiDXhvNYg0D2/UFkLejsaz3LqpW5yjNQ8Nx9Sn2c0E=", version = "v1.14.0", ) go_repository( name = "com_github_aws_smithy_go", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/aws/smithy-go", sum = "h1:gsoZQMNHnX+PaghNw4ynPsyGP7aUCqx5sY2dlPQsZ0w=", version = "v1.10.0", ) go_repository( name = "com_github_benbjohnson_clock", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/benbjohnson/clock", sum = "h1:Q92kusRqC1XV2MjkWETPvjJVqKetz1OzxZB7mHJLju8=", version = "v1.1.0", ) go_repository( name = "com_github_beorn7_perks", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/beorn7/perks", sum = "h1:VlbKKnNfV8bJzeqoa4cOKqO6bYr3WgKZxO8Z16+hsOM=", version = "v1.0.1", ) go_repository( name = "com_github_bkaradzic_go_lz4", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/bkaradzic/go-lz4", sum = "h1:RXc4wYsyz985CkXXeX04y4VnZFGG8Rd43pRaHsOXAKk=", version = "v1.0.0", ) go_repository( name = "com_github_burntsushi_toml", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/BurntSushi/toml", sum = "h1:dtDWrepsVPfW9H/4y7dDgFc2MBUSeJhlaDtK13CxFlU=", version = "v1.0.0", ) go_repository( name = "com_github_burntsushi_xgb", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/BurntSushi/xgb", sum = "h1:1BDTz0u9nC3//pOCMdNH+CiXJVYJh5UQNCOBG7jbELc=", version = "v0.0.0-20160522181843-27f122750802", ) go_repository( name = "com_github_census_instrumentation_opencensus_proto", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/census-instrumentation/opencensus-proto", sum = "h1:glEXhBS5PSLLv4IXzLA5yPRVX4bilULVyxxbrfOtDAk=", version = "v0.2.1", ) go_repository( name = "com_github_cespare_xxhash", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/cespare/xxhash", sum = "h1:a6HrQnmkObjyL+Gs60czilIUGqrzKutQD6XZog3p+ko=", version = "v1.1.0", ) go_repository( name = "com_github_cespare_xxhash_v2", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/cespare/xxhash/v2", sum = "h1:YRXhKfTDauu4ajMg1TPgFO5jnlC2HCbmLXMcTG5cbYE=", version = "v2.1.2", ) go_repository( name = "com_github_chzyer_logex", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/chzyer/logex", sum = "h1:Swpa1K6QvQznwJRcfTfQJmTE72DqScAa40E+fbHEXEE=", version = "v1.1.10", ) go_repository( name = "com_github_chzyer_readline", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/chzyer/readline", sum = "h1:fY5BOSpyZCqRo5OhCuC+XN+r/bBCmeuuJtjz+bCNIf8=", version = "v0.0.0-20180603132655-2972be24d48e", ) go_repository( name = "com_github_chzyer_test", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/chzyer/test", sum = "h1:q763qf9huN11kDQavWsoZXJNW3xEE4JJyHa5Q25/sd8=", version = "v0.0.0-20180213035817-a1ea475d72b1", ) go_repository( name = "com_github_clickhouse_clickhouse_go", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/ClickHouse/clickhouse-go", sum = "h1:cKjXeYLNWVJIx2J1K6H2CqyRmfwVJVY1OV1coaaFcI0=", version = "v1.5.4", ) go_repository( name = "com_github_client9_misspell", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/client9/misspell", sum = "h1:ta993UF76GwbvJcIo3Y68y/M3WxlpEHPWIGDkJYwzJI=", version = "v0.3.4", ) go_repository( name = "com_github_cloudflare_golz4", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/cloudflare/golz4", sum = "h1:F1EaeKL/ta07PY/k9Os/UFtwERei2/XzGemhpGnBKNg=", version = "v0.0.0-20150217214814-ef862a3cdc58", ) go_repository( name = "com_github_cncf_udpa_go", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/cncf/udpa/go", sum = "h1:hzAQntlaYRkVSFEfj9OTWlVV1H155FMD8BTKktLv0QI=", version = "v0.0.0-20210930031921-04548b0d99d4", ) go_repository( name = "com_github_cncf_xds_go", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/cncf/xds/go", sum = "h1:zH8ljVhhq7yC0MIeUL/IviMtY8hx2mK8cN9wEYb8ggw=", version = "v0.0.0-20211011173535-cb28da3451f1", ) go_repository( name = "com_github_coreos_etcd", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/coreos/etcd", sum = "h1:jFneRYjIvLMLhDLCzuTuU4rSJUjRplcJQ7pD7MnhC04=", version = "v3.3.10+incompatible", ) go_repository( name = "com_github_coreos_go_etcd", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/coreos/go-etcd", sum = "h1:bXhRBIXoTm9BYHS3gE0TtQuyNZyeEMux2sDi4oo5YOo=", version = "v2.0.0+incompatible", ) go_repository( name = "com_github_coreos_go_semver", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/coreos/go-semver", sum = "h1:3Jm3tLmsgAYcjC+4Up7hJrFBPr+n7rAqYeSw/SZazuY=", version = "v0.2.0", ) go_repository( name = "com_github_cpuguy83_go_md2man", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/cpuguy83/go-md2man", sum = "h1:BSKMNlYxDvnunlTymqtgONjNnaRV1sTpcovwwjF22jk=", version = "v1.0.10", ) go_repository( name = "com_github_creack_pty", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/creack/pty", sum = "h1:uDmaGzcdjhF4i/plgjmEsriH11Y0o7RKapEf/LDaM3w=", version = "v1.1.9", ) go_repository( name = "com_github_davecgh_go_spew", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/davecgh/go-spew", sum = "h1:vj9j/u1bqnvCEfJOwUhtlOARqs3+rkHYY13jYWTU97c=", version = "v1.1.1", ) go_repository( name = "com_github_dgraph_io_badger", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/dgraph-io/badger", sum = "h1:mNw0qs90GVgGGWylh0umH5iag1j6n/PeJtNvL6KY/x8=", version = "v1.6.2", ) go_repository( name = "com_github_dgraph_io_ristretto", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/dgraph-io/ristretto", sum = "h1:a5WaUrDa0qm0YrAAS1tUykT5El3kt62KNZZeMxQn3po=", version = "v0.0.2", ) go_repository( name = "com_github_dgryski_go_farm", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/dgryski/go-farm", sum = "h1:fAjc9m62+UWV/WAFKLNi6ZS0675eEUC9y3AlwSbQu1Y=", version = "v0.0.0-20200201041132-a6ae2369ad13", ) go_repository( name = "com_github_dustin_go_humanize", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/dustin/go-humanize", sum = "h1:VSnTsYCnlFHaM2/igO1h6X3HA71jcobQuxemgkq4zYo=", version = "v1.0.0", ) go_repository( name = "com_github_envoyproxy_go_control_plane", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/envoyproxy/go-control-plane", sum = "h1:fP+fF0up6oPY49OrjPrhIJ8yQfdIM85NXMLkMg1EXVs=", version = "v0.9.10-0.20210907150352-cf90f659a021", ) go_repository( name = "com_github_envoyproxy_protoc_gen_validate", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/envoyproxy/protoc-gen-validate", sum = "h1:EQciDnbrYxy13PgWoY8AqoxGiPrpgBZ1R8UNe3ddc+A=", version = "v0.1.0", ) go_repository( name = "com_github_fsnotify_fsnotify", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/fsnotify/fsnotify", sum = "h1:IXs+QLmnXW2CcXuY+8Mzv/fWEsPGWxqefPtCP5CnV9I=", version = "v1.4.7", ) go_repository( name = "com_github_ghodss_yaml", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/ghodss/yaml", sum = "h1:wQHKEahhL6wmXdzwWG11gIVCkOv05bNOh+Rxn0yngAk=", version = "v1.0.0", ) go_repository( name = "com_github_go_gl_glfw", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/go-gl/glfw", sum = "h1:QbL/5oDUmRBzO9/Z7Seo6zf912W/a6Sr4Eu0G/3Jho0=", version = "v0.0.0-20190409004039-e6da0acd62b1", ) go_repository( name = "com_github_go_gl_glfw_v3_3_glfw", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/go-gl/glfw/v3.3/glfw", sum = "h1:WtGNWLvXpe6ZudgnXrq0barxBImvnnJoMEhXAzcbM0I=", version = "v0.0.0-20200222043503-6f7a984d4dc4", ) go_repository( name = "com_github_go_kit_kit", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/go-kit/kit", sum = "h1:wDJmvq38kDhkVxi50ni9ykkdUr1PKgqKOoi01fa0Mdk=", version = "v0.9.0", ) go_repository( name = "com_github_go_kit_log", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/go-kit/log", sum = "h1:DGJh0Sm43HbOeYDNnVZFl8BvcYVvjD5bqYJvp0REbwQ=", version = "v0.1.0", ) go_repository( name = "com_github_go_logfmt_logfmt", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/go-logfmt/logfmt", sum = "h1:TrB8swr/68K7m9CcGut2g3UOihhbcbiMAYiuTXdEih4=", version = "v0.5.0", ) go_repository( name = "com_github_go_sql_driver_mysql", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/go-sql-driver/mysql", sum = "h1:7LxgVwFb2hIQtMm87NdgAVfXjnt4OePseqT1tKx+opk=", version = "v1.4.0", ) go_repository( name = "com_github_go_stack_stack", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/go-stack/stack", sum = "h1:5SgMzNM5HxrEjV0ww2lTmX6E2Izsfxas4+YHWRs3Lsk=", version = "v1.8.0", ) go_repository( name = "com_github_gogo_protobuf", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/gogo/protobuf", sum = "h1:72R+M5VuhED/KujmZVcIquuo8mBgX4oVda//DQb3PXo=", version = "v1.1.1", ) go_repository( name = "com_github_golang_glog", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/golang/glog", sum = "h1:VKtxabqXZkF25pY9ekfRL6a582T4P37/31XEstQ5p58=", version = "v0.0.0-20160126235308-23def4e6c14b", ) go_repository( name = "com_github_golang_groupcache", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/golang/groupcache", sum = "h1:oI5xCqsCo564l8iNU+DwB5epxmsaqB+rhGL0m5jtYqE=", version = "v0.0.0-20210331224755-41bb18bfe9da", ) go_repository( name = "com_github_golang_mock", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/golang/mock", sum = "h1:ErTB+efbowRARo13NNdxyJji2egdxLGQhRaY+DUumQc=", version = "v1.6.0", ) go_repository( name = "com_github_golang_protobuf", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/golang/protobuf", sum = "h1:ROPKBNFfQgOUMifHyP+KYbvpjbdoFNs+aK7DXlji0Tw=", version = "v1.5.2", ) go_repository( name = "com_github_golang_snappy", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/golang/snappy", sum = "h1:fHPg5GQYlCeLIPB9BZqMVR5nR9A+IM5zcgeTdjMYmLA=", version = "v0.0.3", ) go_repository( name = "com_github_google_btree", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/google/btree", sum = "h1:0udJVsspx3VBr5FwtLhQQtuAsVc79tTq0ocGIPAU6qo=", version = "v1.0.0", ) go_repository( name = "com_github_google_go_cmp", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/google/go-cmp", sum = "h1:81/ik6ipDQS2aGcBfIN5dHDB36BwrStyeAQquSYCV4o=", version = "v0.5.7", ) go_repository( name = "com_github_google_gofuzz", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/google/gofuzz", sum = "h1:A8PeW59pxE9IoFRqBp37U+mSNaQoZ46F1f0f863XSXw=", version = "v1.0.0", ) go_repository( name = "com_github_google_martian", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/google/martian", sum = "h1:/CP5g8u/VJHijgedC/Legn3BAbAaWPgecwXBIDzw5no=", version = "v2.1.0+incompatible", ) go_repository( name = "com_github_google_martian_v3", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/google/martian/v3", sum = "h1:d8MncMlErDFTwQGBK1xhv026j9kqhvw1Qv9IbWT1VLQ=", version = "v3.2.1", ) go_repository( name = "com_github_google_pprof", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/google/pprof", sum = "h1:K6RDEckDVWvDI9JAJYCmNdQXq6neHJOYx3V6jnqNEec=", version = "v0.0.0-20210720184732-4bb14d4b1be1", ) go_repository( name = "com_github_google_renameio", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/google/renameio", sum = "h1:GOZbcHa3HfsPKPlmyPyN2KEohoMXOhdMbHrvbpl2QaA=", version = "v0.1.0", ) go_repository( name = "com_github_google_uuid", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/google/uuid", sum = "h1:EVhdT+1Kseyi1/pUmXKaFxYsDNy9RQYkMWRH68J/W7Y=", version = "v1.1.2", ) go_repository( name = "com_github_googleapis_gax_go_v2", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/googleapis/gax-go/v2", sum = "h1:dp3bWCh+PPO1zjRRiCSczJav13sBvG4UhNyVTa1KqdU=", version = "v2.1.1", ) go_repository( name = "com_github_grpc_ecosystem_grpc_gateway", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/grpc-ecosystem/grpc-gateway", sum = "h1:gmcG1KaJ57LophUzW0Hy8NmPhnMZb4M0+kPpLofRdBo=", version = "v1.16.0", ) go_repository( name = "com_github_hashicorp_golang_lru", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/hashicorp/golang-lru", sum = "h1:0hERBMJE1eitiLkihrMvRVBYAkpHzc/J3QdDN+dAcgU=", version = "v0.5.1", ) go_repository( name = "com_github_hashicorp_hcl", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/hashicorp/hcl", sum = "h1:0Anlzjpi4vEasTeNFn2mLJgTSwt0+6sfsiTG8qcWGx4=", version = "v1.0.0", ) go_repository( name = "com_github_ianlancetaylor_demangle", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/ianlancetaylor/demangle", sum = "h1:mV02weKRL81bEnm8A0HT1/CAelMQDBuQIfLw8n+d6xI=", version = "v0.0.0-20200824232613-28f6c0f3b639", ) go_repository( name = "com_github_inconshreveable_mousetrap", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/inconshreveable/mousetrap", sum = "h1:Z8tu5sraLXCXIcARxBp/8cbvlwVa7Z1NHg9XEKhtSvM=", version = "v1.0.0", ) go_repository( name = "com_github_jmespath_go_jmespath", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/jmespath/go-jmespath", sum = "h1:BEgLn5cpjn8UN1mAw4NjwDrS35OdebyEtFe+9YPoQUg=", version = "v0.4.0", ) go_repository( name = "com_github_jmespath_go_jmespath_internal_testify", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/jmespath/go-jmespath/internal/testify", sum = "h1:shLQSRRSCCPj3f2gpwzGwWFoC7ycTf1rcQZHOlsJ6N8=", version = "v1.5.1", ) go_repository( name = "com_github_jmoiron_sqlx", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/jmoiron/sqlx", sum = "h1:41Ip0zITnmWNR/vHV+S4m+VoUivnWY5E4OJfLZjCJMA=", version = "v1.2.0", ) go_repository( name = "com_github_jpillora_backoff", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/jpillora/backoff", sum = "h1:uvFg412JmmHBHw7iwprIxkPMI+sGQ4kzOWsMeHnm2EA=", version = "v1.0.0", ) go_repository( name = "com_github_json_iterator_go", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/json-iterator/go", sum = "h1:PV8peI4a0ysnczrg+LtxykD8LfKY9ML6u2jnxaEnrnM=", version = "v1.1.12", ) go_repository( name = "com_github_jstemmer_go_junit_report", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/jstemmer/go-junit-report", sum = "h1:6QPYqodiu3GuPL+7mfx+NwDdp2eTkp9IfEUpgAwUN0o=", version = "v0.9.1", ) go_repository( name = "com_github_julienschmidt_httprouter", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/julienschmidt/httprouter", sum = "h1:U0609e9tgbseu3rBINet9P48AI/D3oJs4dN7jwJOQ1U=", version = "v1.3.0", ) go_repository( name = "com_github_kisielk_gotool", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/kisielk/gotool", sum = "h1:AV2c/EiW3KqPNT9ZKl07ehoAGi4C5/01Cfbblndcapg=", version = "v1.0.0", ) go_repository( name = "com_github_konsorten_go_windows_terminal_sequences", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/konsorten/go-windows-terminal-sequences", sum = "h1:CE8S1cTafDpPvMhIxNJKvHsGVBgn1xWYf1NbHQhywc8=", version = "v1.0.3", ) go_repository( name = "com_github_kr_logfmt", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/kr/logfmt", sum = "h1:T+h1c/A9Gawja4Y9mFVWj2vyii2bbUNDw3kt9VxK2EY=", version = "v0.0.0-20140226030751-b84e30acd515", ) go_repository( name = "com_github_kr_pretty", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/kr/pretty", sum = "h1:WgNl7dwNpEZ6jJ9k1snq4pZsg7DOEN8hP9Xw0Tsjwk0=", version = "v0.3.0", ) go_repository( name = "com_github_kr_pty", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/kr/pty", sum = "h1:VkoXIwSboBpnk99O/KFauAEILuNHv5DVFKZMBN/gUgw=", version = "v1.1.1", ) go_repository( name = "com_github_kr_text", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/kr/text", sum = "h1:5Nx0Ya0ZqY2ygV366QzturHI13Jq95ApcVaJBhpS+AY=", version = "v0.2.0", ) go_repository( name = "com_github_lib_pq", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/lib/pq", sum = "h1:X5PMW56eZitiTeO7tKzZxFCSpbFZJtkMMooicw2us9A=", version = "v1.0.0", ) go_repository( name = "com_github_magiconair_properties", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/magiconair/properties", sum = "h1:LLgXmsheXeRoUOBOjtwPQCWIYqM/LU1ayDtDePerRcY=", version = "v1.8.0", ) go_repository( name = "com_github_mattn_go_sqlite3", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/mattn/go-sqlite3", sum = "h1:pDRiWfl+++eC2FEFRy6jXmQlvp4Yh3z1MJKg4UeYM/4=", version = "v1.9.0", ) go_repository( name = "com_github_matttproud_golang_protobuf_extensions", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/matttproud/golang_protobuf_extensions", sum = "h1:4hp9jkHxhMHkqkrB3Ix0jegS5sx/RkqARlsWZ6pIwiU=", version = "v1.0.1", ) go_repository( name = "com_github_mitchellh_go_homedir", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/mitchellh/go-homedir", sum = "h1:lukF9ziXFxDFPkA1vsr5zpc1XuPDn/wFntq5mG+4E0Y=", version = "v1.1.0", ) go_repository( name = "com_github_mitchellh_mapstructure", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/mitchellh/mapstructure", sum = "h1:fmNYVwqnSfB9mZU6OS2O6GsXM+wcskZDuKQzvN1EDeE=", version = "v1.1.2", ) go_repository( name = "com_github_modern_go_concurrent", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/modern-go/concurrent", sum = "h1:TRLaZ9cD/w8PVh93nsPXa1VrQ6jlwL5oN8l14QlcNfg=", version = "v0.0.0-20180306012644-bacd9c7ef1dd", ) go_repository( name = "com_github_modern_go_reflect2", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/modern-go/reflect2", sum = "h1:xBagoLtFs94CBntxluKeaWgTMpvLxC4ur3nMaC9Gz0M=", version = "v1.0.2", ) go_repository( name = "com_github_mwitkow_go_conntrack", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/mwitkow/go-conntrack", sum = "h1:KUppIJq7/+SVif2QVs3tOP0zanoHgBEVAwHxUSIzRqU=", version = "v0.0.0-20190716064945-2f068394615f", ) go_repository( name = "com_github_oneofone_xxhash", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/OneOfOne/xxhash", sum = "h1:KMrpdQIwFcEqXDklaen+P1axHaj9BSKzvpUUfnHldSE=", version = "v1.2.2", ) go_repository( name = "com_github_pelletier_go_toml", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/pelletier/go-toml", sum = "h1:T5zMGML61Wp+FlcbWjRDT7yAxhJNAiPPLOFECq181zc=", version = "v1.2.0", ) go_repository( name = "com_github_pierrec_lz4", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/pierrec/lz4", sum = "h1:9UY3+iC23yxF0UfGaYrGplQ+79Rg+h/q9FV9ix19jjM=", version = "v2.6.1+incompatible", ) go_repository( name = "com_github_pkg_errors", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/pkg/errors", sum = "h1:FEBLx1zS214owpjy7qsBeixbURkuhQAwrK5UwLGTwt4=", version = "v0.9.1", ) go_repository( name = "com_github_pmezard_go_difflib", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/pmezard/go-difflib", sum = "h1:4DBwDE0NGyQoBHbLQYPwSUPoCMWR5BEzIk/f1lZbAQM=", version = "v1.0.0", ) go_repository( name = "com_github_prometheus_client_golang", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/prometheus/client_golang", sum = "h1:ZiaPsmm9uiBeaSMRznKsCDNtPCS0T3JVDGF+06gjBzk=", version = "v1.12.1", ) go_repository( name = "com_github_prometheus_client_model", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/prometheus/client_model", sum = "h1:uq5h0d+GuxiXLJLNABMgp2qUWDPiLvgCzz2dUR+/W/M=", version = "v0.2.0", ) go_repository( name = "com_github_prometheus_common", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/prometheus/common", sum = "h1:hWIdL3N2HoUx3B8j3YN9mWor0qhY/NlEKZEaXxuIRh4=", version = "v0.32.1", ) go_repository( name = "com_github_prometheus_procfs", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/prometheus/procfs", sum = "h1:4jVXhlkAyzOScmCkXBTOLRLTz8EeU+eyjrwB/EPq0VU=", version = "v0.7.3", ) go_repository( name = "com_github_rogpeppe_fastuuid", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/rogpeppe/fastuuid", sum = "h1:Ppwyp6VYCF1nvBTXL3trRso7mXMlRrw9ooo375wvi2s=", version = "v1.2.0", ) go_repository( name = "com_github_rogpeppe_go_internal", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/rogpeppe/go-internal", sum = "h1:/FiVV8dS/e+YqF2JvO3yXRFbBLTIuSDkuC7aBOAvL+k=", version = "v1.6.1", ) go_repository( name = "com_github_rs_xid", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/rs/xid", sum = "h1:6NjYksEUlhurdVehpc7S7dk6DAmcKv8V9gG0FsVN2U4=", version = "v1.3.0", ) go_repository( name = "com_github_russross_blackfriday", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/russross/blackfriday", sum = "h1:HyvC0ARfnZBqnXwABFeSZHpKvJHJJfPz81GNueLj0oo=", version = "v1.5.2", ) go_repository( name = "com_github_sirupsen_logrus", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/sirupsen/logrus", sum = "h1:UBcNElsrwanuuMsnGSlYmtmgbb23qDR5dG+6X6Oo89I=", version = "v1.6.0", ) go_repository( name = "com_github_spaolacci_murmur3", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/spaolacci/murmur3", sum = "h1:7c1g84S4BPRrfL5Xrdp6fOJ206sU9y293DDHaoy0bLI=", version = "v1.1.0", ) go_repository( name = "com_github_spf13_afero", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/spf13/afero", sum = "h1:m8/z1t7/fwjysjQRYbP0RD+bUIF/8tJwPdEZsI83ACI=", version = "v1.1.2", ) go_repository( name = "com_github_spf13_cast", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/spf13/cast", sum = "h1:oget//CVOEoFewqQxwr0Ej5yjygnqGkvggSE/gB35Q8=", version = "v1.3.0", ) go_repository( name = "com_github_spf13_cobra", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/spf13/cobra", sum = "h1:f0B+LkLX6DtmRH1isoNA9VTtNUK9K8xYd28JNNfOv/s=", version = "v0.0.5", ) go_repository( name = "com_github_spf13_jwalterweatherman", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/spf13/jwalterweatherman", sum = "h1:XHEdyB+EcvlqZamSM4ZOMGlc93t6AcsBEu9Gc1vn7yk=", version = "v1.0.0", ) go_repository( name = "com_github_spf13_pflag", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/spf13/pflag", sum = "h1:zPAT6CGy6wXeQ7NtTnaTerfKOsV6V6F8agHXFiazDkg=", version = "v1.0.3", ) go_repository( name = "com_github_spf13_viper", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/spf13/viper", sum = "h1:VUFqw5KcqRf7i70GOzW7N+Q7+gxVBkSSqiXB12+JQ4M=", version = "v1.3.2", ) go_repository( name = "com_github_stretchr_objx", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/stretchr/objx", sum = "h1:2vfRuCMp5sSVIDSqO8oNnWJq7mPa6KVP3iPIwFBuy8A=", version = "v0.1.1", ) go_repository( name = "com_github_stretchr_testify", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/stretchr/testify", sum = "h1:nwc3DEeHmmLAfoZucVR881uASk0Mfjw8xYJ99tb5CcY=", version = "v1.7.0", ) go_repository( name = "com_github_ugorji_go_codec", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/ugorji/go/codec", sum = "h1:3SVOIvH7Ae1KRYyQWRjXWJEA9sS/c/pjvH++55Gr648=", version = "v0.0.0-20181204163529-d75b2dcb6bc8", ) go_repository( name = "com_github_xordataexchange_crypt", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/xordataexchange/crypt", sum = "h1:ESFSdwYZvkeru3RtdrYueztKhOBCSAAzS4Gf+k0tEow=", version = "v0.0.3-0.20170626215501-b2862e3d0a77", ) go_repository( name = "com_github_yuin_goldmark", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "github.com/yuin/goldmark", sum = "h1:/vn0k+RBvwlxEmP5E7SZMqNxPhfMVFEJiykr15/0XKM=", version = "v1.4.1", ) go_repository( name = "com_google_cloud_go", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "cloud.google.com/go", sum = "h1:t9Iw5QH5v4XtlEQaCtUY7x6sCABps8sW0acw7e2WQ6Y=", version = "v0.100.2", ) go_repository( name = "com_google_cloud_go_bigquery", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "cloud.google.com/go/bigquery", sum = "h1:PQcPefKFdaIzjQFbiyOgAqyx8q5djaE7x9Sqe712DPA=", version = "v1.8.0", ) go_repository( name = "com_google_cloud_go_compute", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "cloud.google.com/go/compute", sum = "h1:EKki8sSdvDU0OO9mAXGwPXOTOgPz2l08R0/IutDH11I=", version = "v1.2.0", ) go_repository( name = "com_google_cloud_go_datastore", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "cloud.google.com/go/datastore", sum = "h1:/May9ojXjRkPBNVrq+oWLqmWCkr4OU5uRY29bu0mRyQ=", version = "v1.1.0", ) go_repository( name = "com_google_cloud_go_iam", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "cloud.google.com/go/iam", sum = "h1:4CapQyNFjiksks1/x7jsvsygFPhihslYk5GptIrlX68=", version = "v0.1.1", ) go_repository( name = "com_google_cloud_go_pubsub", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "cloud.google.com/go/pubsub", sum = "h1:ukjixP1wl0LpnZ6LWtZJ0mX5tBmjp1f8Sqer8Z2OMUU=", version = "v1.3.1", ) go_repository( name = "com_google_cloud_go_storage", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "cloud.google.com/go/storage", sum = "h1:Ljj+ZXVEhCr/1+4ZhvtteN1ND7UUsNTlduGclLh8GO0=", version = "v1.15.0", ) go_repository( name = "com_shuralyov_dmitri_gpu_mtl", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "dmitri.shuralyov.com/gpu/mtl", sum = "h1:VpgP7xuJadIUuKccphEpTJnWhS2jkQyMt6Y7pJCD7fY=", version = "v0.0.0-20190408044501-666a987793e9", ) go_repository( name = "in_gopkg_alecthomas_kingpin_v2", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "gopkg.in/alecthomas/kingpin.v2", sum = "h1:jMFz6MfLP0/4fUyZle81rXUoxOBFi19VUFKVDOQfozc=", version = "v2.2.6", ) go_repository( name = "in_gopkg_check_v1", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "gopkg.in/check.v1", sum = "h1:Hei/4ADfdWqJk1ZMxUNpqntNwaWcugrBjAiHlqqRiVk=", version = "v1.0.0-20201130134442-10cb98267c6c", ) go_repository( name = "in_gopkg_errgo_v2", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "gopkg.in/errgo.v2", sum = "h1:0vLT13EuvQ0hNvakwLuFZ/jYrLp5F3kcWHXdRggjCE8=", version = "v2.1.0", ) go_repository( name = "in_gopkg_yaml_v2", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "gopkg.in/yaml.v2", sum = "h1:D8xgwECY7CYvx+Y2n4sBz93Jn9JRvxdiyyo8CTfuKaY=", version = "v2.4.0", ) go_repository( name = "in_gopkg_yaml_v3", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "gopkg.in/yaml.v3", sum = "h1:h8qDotaEPuJATrMmW04NCwg7v22aHH28wwpauUhK9Oo=", version = "v3.0.0-20210107192922-496545a6307b", ) go_repository( name = "io_opencensus_go", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "go.opencensus.io", sum = "h1:gqCw0LfLxScz8irSi8exQc7fyQ0fKQU/qnC/X8+V/1M=", version = "v0.23.0", ) go_repository( name = "io_opentelemetry_go_proto_otlp", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "go.opentelemetry.io/proto/otlp", sum = "h1:rwOQPCuKAKmwGKq2aVNnYIibI6wnV7EvzgfTCzcdGg8=", version = "v0.7.0", ) go_repository( name = "io_rsc_binaryregexp", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "rsc.io/binaryregexp", sum = "h1:HfqmD5MEmC0zvwBuF187nq9mdnXjXsSivRiXN7SmRkE=", version = "v0.2.0", ) go_repository( name = "io_rsc_quote_v3", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "rsc.io/quote/v3", sum = "h1:9JKUTTIUgS6kzR9mK1YuGKv6Nl+DijDNIc0ghT58FaY=", version = "v3.1.0", ) go_repository( name = "io_rsc_sampler", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "rsc.io/sampler", sum = "h1:7uVkIFmeBqHfdjD+gZwtXXI+RODJ2Wc4O7MPEh/QiW4=", version = "v1.3.0", ) go_repository( name = "org_golang_google_api", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "google.golang.org/api", sum = "h1:9eJiHhwJKIYX6sX2fUZxQLi7pDRA/MYu8c12q6WbJik=", version = "v0.68.0", ) go_repository( name = "org_golang_google_appengine", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "google.golang.org/appengine", sum = "h1:FZR1q0exgwxzPzp/aF+VccGrSfxfPpkBqjIIEq3ru6c=", version = "v1.6.7", ) go_repository( name = "org_golang_google_genproto", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "google.golang.org/genproto", sum = "h1:2X+CNIheCutWRyKRte8szGxrE5ggtV4U+NKAbh/oLhg=", version = "v0.0.0-20220211171837-173942840c17", ) go_repository( name = "org_golang_google_grpc", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "google.golang.org/grpc", sum = "h1:weqSxi/TMs1SqFRMHCtBgXRs8k3X39QIDEZ0pRcttUg=", version = "v1.44.0", ) go_repository( name = "org_golang_google_grpc_cmd_protoc_gen_go_grpc", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "google.golang.org/grpc/cmd/protoc-gen-go-grpc", sum = "h1:M1YKkFIboKNieVO5DLUEVzQfGwJD30Nv2jfUgzb5UcE=", version = "v1.1.0", ) go_repository( name = "org_golang_google_protobuf", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "google.golang.org/protobuf", sum = "h1:SnqbnDw1V7RiZcXPx5MEeqPv2s79L9i7BJUlG/+RurQ=", version = "v1.27.1", ) go_repository( name = "org_golang_x_crypto", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "golang.org/x/crypto", sum = "h1:psW17arqaxU48Z5kZ0CQnkZWQJsqcURM6tKiBApRjXI=", version = "v0.0.0-20200622213623-75b288015ac9", ) go_repository( name = "org_golang_x_exp", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "golang.org/x/exp", sum = "h1:QE6XYQK6naiK1EPAe1g/ILLxN5RBoH5xkJk3CqlMI/Y=", version = "v0.0.0-20200224162631-6cc2880d07d6", ) go_repository( name = "org_golang_x_image", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "golang.org/x/image", sum = "h1:+qEpEAPhDZ1o0x3tHzZTQDArnOixOzGD9HUJfcg0mb4=", version = "v0.0.0-20190802002840-cff245a6509b", ) go_repository( name = "org_golang_x_lint", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "golang.org/x/lint", sum = "h1:VLliZ0d+/avPrXXH+OakdXhpJuEoBZuwh1m2j7U6Iug=", version = "v0.0.0-20210508222113-6edffad5e616", ) go_repository( name = "org_golang_x_mobile", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "golang.org/x/mobile", sum = "h1:4+4C/Iv2U4fMZBiMCc98MG1In4gJY5YRhtpDNeDeHWs=", version = "v0.0.0-20190719004257-d2bd2a29d028", ) go_repository( name = "org_golang_x_mod", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "golang.org/x/mod", sum = "h1:OJxoQ/rynoF0dcCdI7cLPktw/hR2cueqYfjm43oqK38=", version = "v0.5.1", ) go_repository( name = "org_golang_x_net", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "golang.org/x/net", sum = "h1:O7DYs+zxREGLKzKoMQrtrEacpb0ZVXA5rIwylE2Xchk=", version = "v0.0.0-20220127200216-cd36cc0744dd", ) go_repository( name = "org_golang_x_oauth2", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "golang.org/x/oauth2", sum = "h1:RerP+noqYHUQ8CMRcPlC2nvTa4dcBIjegkuWdcUDuqg=", version = "v0.0.0-20211104180415-d3ed0bb246c8", ) go_repository( name = "org_golang_x_sync", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "golang.org/x/sync", sum = "h1:5KslGYwFpkhGh+Q16bwMP3cOontH8FOep7tGV86Y7SQ=", version = "v0.0.0-20210220032951-036812b2e83c", ) go_repository( name = "org_golang_x_sys", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "golang.org/x/sys", sum = "h1:rm+CHSpPEEW2IsXUib1ThaHIjuBVZjxNgSKmBLFfD4c=", version = "v0.0.0-20220209214540-3681064d5158", ) go_repository( name = "org_golang_x_term", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "golang.org/x/term", sum = "h1:JGgROgKl9N8DuW20oFS5gxc+lE67/N3FcwmBPMe7ArY=", version = "v0.0.0-20210927222741-03fcf44c2211", ) go_repository( name = "org_golang_x_text", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "golang.org/x/text", sum = "h1:olpwvP2KacW1ZWvsR7uQhoyTYvKAupfQrRGBFM352Gk=", version = "v0.3.7", ) go_repository( name = "org_golang_x_time", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "golang.org/x/time", sum = "h1:/5xXl8Y5W96D+TtHSlonuFqGHIWVuyCkGJLwGh9JJFs=", version = "v0.0.0-20191024005414-555d28b269f0", ) go_repository( name = "org_golang_x_tools", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "golang.org/x/tools", sum = "h1:j9KsMiaP1c3B0OTQGth0/k+miLGTgLsAFUCrF2vLcF8=", version = "v0.1.9", ) go_repository( name = "org_golang_x_xerrors", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "golang.org/x/xerrors", sum = "h1:go1bK/D/BFZV2I8cIQd1NKEZ+0owSTG1fDTci4IqFcE=", version = "v0.0.0-20200804184101-5ec99f83aff1", ) go_repository( name = "org_uber_go_atomic", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "go.uber.org/atomic", sum = "h1:ECmE8Bn/WFTYwEW/bpKD3M8VtR/zQVbavAoalC1PYyE=", version = "v1.9.0", ) go_repository( name = "org_uber_go_goleak", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "go.uber.org/goleak", sum = "h1:wy28qYRKZgnJTxGxvye5/wgWr1EKjmUDGYox5mGlRlI=", version = "v1.1.11", ) go_repository( name = "org_uber_go_multierr", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "go.uber.org/multierr", sum = "h1:zaiO/rmgFjbmCXdSYJWQcdvOCsthmdaHfr3Gm2Kx4Ec=", version = "v1.7.0", ) go_repository( name = "org_uber_go_zap", build_extra_args = ["-exclude=**/testdata", "-exclude=go/packages/packagestest"], importpath = "go.uber.org/zap", sum = "h1:WefMeulhovoZ2sYXz7st6K0sLj7bBhpiFaud4r4zST8=", version = "v1.21.0", )
load('@bazel_gazelle//:deps.bzl', 'go_repository') def go_repositories(): go_repository(name='co_honnef_go_tools', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='honnef.co/go/tools', sum='h1:MNh1AVMyVX23VUHE2O27jm6lNj3vjO5DexS4A1xvnzk=', version='v0.2.2') go_repository(name='com_github_alecthomas_template', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/alecthomas/template', sum='h1:JYp7IbQjafoB+tBA3gMyHYHrpOtNuDiK/uB5uXxq5wM=', version='v0.0.0-20190718012654-fb15b899a751') go_repository(name='com_github_alecthomas_units', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/alecthomas/units', sum='h1:UQZhZ2O0vMHr2cI+DC1Mbh0TJxzA3RcLoMsFw+aXw7E=', version='v0.0.0-20190924025748-f65c72e2690d') go_repository(name='com_github_andreasbriese_bbloom', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/AndreasBriese/bbloom', sum='h1:cTp8I5+VIoKjsnZuH8vjyaysT/ses3EvZeaV/1UkF2M=', version='v0.0.0-20190825152654-46b345b51c96') go_repository(name='com_github_antihax_optional', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/antihax/optional', sum='h1:xK2lYat7ZLaVVcIuj82J8kIro4V6kDe0AUDFboUCwcg=', version='v1.0.0') go_repository(name='com_github_armon_consul_api', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/armon/consul-api', sum='h1:G1bPvciwNyF7IUmKXNt9Ak3m6u9DE1rF+RmtIkBpVdA=', version='v0.0.0-20180202201655-eb2c6b5be1b6') go_repository(name='com_github_aws_aws_sdk_go_v2', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/aws-sdk-go-v2', sum='h1:1XIXAfxsEmbhbj5ry3D3vX+6ZcUYvIqSm4CWWEuGZCA=', version='v1.13.0') go_repository(name='com_github_aws_aws_sdk_go_v2_aws_protocol_eventstream', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/aws-sdk-go-v2/aws/protocol/eventstream', sum='h1:scBthy70MB3m4LCMFaBcmYCyR2XWOz6MxSfdSu/+fQo=', version='v1.2.0') go_repository(name='com_github_aws_aws_sdk_go_v2_config', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/aws-sdk-go-v2/config', sum='h1:yLv8bfNoT4r+UvUKQKqRtdnvuWGMK5a82l4ru9Jvnuo=', version='v1.13.1') go_repository(name='com_github_aws_aws_sdk_go_v2_credentials', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/aws-sdk-go-v2/credentials', sum='h1:8Ow0WcyDesGNL0No11jcgb1JAtE+WtubqXjgxau+S0o=', version='v1.8.0') go_repository(name='com_github_aws_aws_sdk_go_v2_feature_ec2_imds', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/aws-sdk-go-v2/feature/ec2/imds', sum='h1:NITDuUZO34mqtOwFWZiXo7yAHj7kf+XPE+EiKuCBNUI=', version='v1.10.0') go_repository(name='com_github_aws_aws_sdk_go_v2_feature_s3_manager', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/aws-sdk-go-v2/feature/s3/manager', sum='h1:oUCLhAKNaXyTqdJyw+KEjDVVBs1V5mCy8YDLMi08LL8=', version='v1.9.1') go_repository(name='com_github_aws_aws_sdk_go_v2_internal_configsources', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/aws-sdk-go-v2/internal/configsources', sum='h1:CRiQJ4E2RhfDdqbie1ZYDo8QtIo75Mk7oTdJSfwJTMQ=', version='v1.1.4') go_repository(name='com_github_aws_aws_sdk_go_v2_internal_endpoints_v2', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/aws-sdk-go-v2/internal/endpoints/v2', sum='h1:3ADoioDMOtF4uiK59vCpplpCwugEU+v4ZFD29jDL3RQ=', version='v2.2.0') go_repository(name='com_github_aws_aws_sdk_go_v2_internal_ini', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/aws-sdk-go-v2/internal/ini', sum='h1:ixotxbfTCFpqbuwFv/RcZwyzhkxPSYDYEMcj4niB5Uk=', version='v1.3.5') go_repository(name='com_github_aws_aws_sdk_go_v2_service_internal_accept_encoding', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/aws-sdk-go-v2/service/internal/accept-encoding', sum='h1:F1diQIOkNn8jcez4173r+PLPdkWK7chy74r3fKpDrLI=', version='v1.7.0') go_repository(name='com_github_aws_aws_sdk_go_v2_service_internal_presigned_url', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/aws-sdk-go-v2/service/internal/presigned-url', sum='h1:4QAOB3KrvI1ApJK14sliGr3Ie2pjyvNypn/lfzDHfUw=', version='v1.7.0') go_repository(name='com_github_aws_aws_sdk_go_v2_service_internal_s3shared', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/aws-sdk-go-v2/service/internal/s3shared', sum='h1:XAe+PDnaBELHr25qaJKfB415V4CKFWE8H+prUreql8k=', version='v1.11.0') go_repository(name='com_github_aws_aws_sdk_go_v2_service_s3', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/aws-sdk-go-v2/service/s3', sum='h1:zAU2P99CLTz8kUGl+IptU2ycAXuMaLAvgIv+UH4U8pY=', version='v1.24.1') go_repository(name='com_github_aws_aws_sdk_go_v2_service_sso', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/aws-sdk-go-v2/service/sso', sum='h1:1qLJeQGBmNQW3mBNzK2CFmrQNmoXWrscPqsrAaU1aTA=', version='v1.9.0') go_repository(name='com_github_aws_aws_sdk_go_v2_service_sts', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/aws-sdk-go-v2/service/sts', sum='h1:ksiDXhvNYg0D2/UFkLejsaz3LqpW5yjNQ8Nx9Sn2c0E=', version='v1.14.0') go_repository(name='com_github_aws_smithy_go', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/aws/smithy-go', sum='h1:gsoZQMNHnX+PaghNw4ynPsyGP7aUCqx5sY2dlPQsZ0w=', version='v1.10.0') go_repository(name='com_github_benbjohnson_clock', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/benbjohnson/clock', sum='h1:Q92kusRqC1XV2MjkWETPvjJVqKetz1OzxZB7mHJLju8=', version='v1.1.0') go_repository(name='com_github_beorn7_perks', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/beorn7/perks', sum='h1:VlbKKnNfV8bJzeqoa4cOKqO6bYr3WgKZxO8Z16+hsOM=', version='v1.0.1') go_repository(name='com_github_bkaradzic_go_lz4', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/bkaradzic/go-lz4', sum='h1:RXc4wYsyz985CkXXeX04y4VnZFGG8Rd43pRaHsOXAKk=', version='v1.0.0') go_repository(name='com_github_burntsushi_toml', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/BurntSushi/toml', sum='h1:dtDWrepsVPfW9H/4y7dDgFc2MBUSeJhlaDtK13CxFlU=', version='v1.0.0') go_repository(name='com_github_burntsushi_xgb', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/BurntSushi/xgb', sum='h1:1BDTz0u9nC3//pOCMdNH+CiXJVYJh5UQNCOBG7jbELc=', version='v0.0.0-20160522181843-27f122750802') go_repository(name='com_github_census_instrumentation_opencensus_proto', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/census-instrumentation/opencensus-proto', sum='h1:glEXhBS5PSLLv4IXzLA5yPRVX4bilULVyxxbrfOtDAk=', version='v0.2.1') go_repository(name='com_github_cespare_xxhash', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/cespare/xxhash', sum='h1:a6HrQnmkObjyL+Gs60czilIUGqrzKutQD6XZog3p+ko=', version='v1.1.0') go_repository(name='com_github_cespare_xxhash_v2', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/cespare/xxhash/v2', sum='h1:YRXhKfTDauu4ajMg1TPgFO5jnlC2HCbmLXMcTG5cbYE=', version='v2.1.2') go_repository(name='com_github_chzyer_logex', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/chzyer/logex', sum='h1:Swpa1K6QvQznwJRcfTfQJmTE72DqScAa40E+fbHEXEE=', version='v1.1.10') go_repository(name='com_github_chzyer_readline', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/chzyer/readline', sum='h1:fY5BOSpyZCqRo5OhCuC+XN+r/bBCmeuuJtjz+bCNIf8=', version='v0.0.0-20180603132655-2972be24d48e') go_repository(name='com_github_chzyer_test', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/chzyer/test', sum='h1:q763qf9huN11kDQavWsoZXJNW3xEE4JJyHa5Q25/sd8=', version='v0.0.0-20180213035817-a1ea475d72b1') go_repository(name='com_github_clickhouse_clickhouse_go', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/ClickHouse/clickhouse-go', sum='h1:cKjXeYLNWVJIx2J1K6H2CqyRmfwVJVY1OV1coaaFcI0=', version='v1.5.4') go_repository(name='com_github_client9_misspell', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/client9/misspell', sum='h1:ta993UF76GwbvJcIo3Y68y/M3WxlpEHPWIGDkJYwzJI=', version='v0.3.4') go_repository(name='com_github_cloudflare_golz4', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/cloudflare/golz4', sum='h1:F1EaeKL/ta07PY/k9Os/UFtwERei2/XzGemhpGnBKNg=', version='v0.0.0-20150217214814-ef862a3cdc58') go_repository(name='com_github_cncf_udpa_go', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/cncf/udpa/go', sum='h1:hzAQntlaYRkVSFEfj9OTWlVV1H155FMD8BTKktLv0QI=', version='v0.0.0-20210930031921-04548b0d99d4') go_repository(name='com_github_cncf_xds_go', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/cncf/xds/go', sum='h1:zH8ljVhhq7yC0MIeUL/IviMtY8hx2mK8cN9wEYb8ggw=', version='v0.0.0-20211011173535-cb28da3451f1') go_repository(name='com_github_coreos_etcd', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/coreos/etcd', sum='h1:jFneRYjIvLMLhDLCzuTuU4rSJUjRplcJQ7pD7MnhC04=', version='v3.3.10+incompatible') go_repository(name='com_github_coreos_go_etcd', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/coreos/go-etcd', sum='h1:bXhRBIXoTm9BYHS3gE0TtQuyNZyeEMux2sDi4oo5YOo=', version='v2.0.0+incompatible') go_repository(name='com_github_coreos_go_semver', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/coreos/go-semver', sum='h1:3Jm3tLmsgAYcjC+4Up7hJrFBPr+n7rAqYeSw/SZazuY=', version='v0.2.0') go_repository(name='com_github_cpuguy83_go_md2man', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/cpuguy83/go-md2man', sum='h1:BSKMNlYxDvnunlTymqtgONjNnaRV1sTpcovwwjF22jk=', version='v1.0.10') go_repository(name='com_github_creack_pty', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/creack/pty', sum='h1:uDmaGzcdjhF4i/plgjmEsriH11Y0o7RKapEf/LDaM3w=', version='v1.1.9') go_repository(name='com_github_davecgh_go_spew', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/davecgh/go-spew', sum='h1:vj9j/u1bqnvCEfJOwUhtlOARqs3+rkHYY13jYWTU97c=', version='v1.1.1') go_repository(name='com_github_dgraph_io_badger', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/dgraph-io/badger', sum='h1:mNw0qs90GVgGGWylh0umH5iag1j6n/PeJtNvL6KY/x8=', version='v1.6.2') go_repository(name='com_github_dgraph_io_ristretto', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/dgraph-io/ristretto', sum='h1:a5WaUrDa0qm0YrAAS1tUykT5El3kt62KNZZeMxQn3po=', version='v0.0.2') go_repository(name='com_github_dgryski_go_farm', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/dgryski/go-farm', sum='h1:fAjc9m62+UWV/WAFKLNi6ZS0675eEUC9y3AlwSbQu1Y=', version='v0.0.0-20200201041132-a6ae2369ad13') go_repository(name='com_github_dustin_go_humanize', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/dustin/go-humanize', sum='h1:VSnTsYCnlFHaM2/igO1h6X3HA71jcobQuxemgkq4zYo=', version='v1.0.0') go_repository(name='com_github_envoyproxy_go_control_plane', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/envoyproxy/go-control-plane', sum='h1:fP+fF0up6oPY49OrjPrhIJ8yQfdIM85NXMLkMg1EXVs=', version='v0.9.10-0.20210907150352-cf90f659a021') go_repository(name='com_github_envoyproxy_protoc_gen_validate', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/envoyproxy/protoc-gen-validate', sum='h1:EQciDnbrYxy13PgWoY8AqoxGiPrpgBZ1R8UNe3ddc+A=', version='v0.1.0') go_repository(name='com_github_fsnotify_fsnotify', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/fsnotify/fsnotify', sum='h1:IXs+QLmnXW2CcXuY+8Mzv/fWEsPGWxqefPtCP5CnV9I=', version='v1.4.7') go_repository(name='com_github_ghodss_yaml', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/ghodss/yaml', sum='h1:wQHKEahhL6wmXdzwWG11gIVCkOv05bNOh+Rxn0yngAk=', version='v1.0.0') go_repository(name='com_github_go_gl_glfw', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/go-gl/glfw', sum='h1:QbL/5oDUmRBzO9/Z7Seo6zf912W/a6Sr4Eu0G/3Jho0=', version='v0.0.0-20190409004039-e6da0acd62b1') go_repository(name='com_github_go_gl_glfw_v3_3_glfw', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/go-gl/glfw/v3.3/glfw', sum='h1:WtGNWLvXpe6ZudgnXrq0barxBImvnnJoMEhXAzcbM0I=', version='v0.0.0-20200222043503-6f7a984d4dc4') go_repository(name='com_github_go_kit_kit', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/go-kit/kit', sum='h1:wDJmvq38kDhkVxi50ni9ykkdUr1PKgqKOoi01fa0Mdk=', version='v0.9.0') go_repository(name='com_github_go_kit_log', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/go-kit/log', sum='h1:DGJh0Sm43HbOeYDNnVZFl8BvcYVvjD5bqYJvp0REbwQ=', version='v0.1.0') go_repository(name='com_github_go_logfmt_logfmt', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/go-logfmt/logfmt', sum='h1:TrB8swr/68K7m9CcGut2g3UOihhbcbiMAYiuTXdEih4=', version='v0.5.0') go_repository(name='com_github_go_sql_driver_mysql', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/go-sql-driver/mysql', sum='h1:7LxgVwFb2hIQtMm87NdgAVfXjnt4OePseqT1tKx+opk=', version='v1.4.0') go_repository(name='com_github_go_stack_stack', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/go-stack/stack', sum='h1:5SgMzNM5HxrEjV0ww2lTmX6E2Izsfxas4+YHWRs3Lsk=', version='v1.8.0') go_repository(name='com_github_gogo_protobuf', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/gogo/protobuf', sum='h1:72R+M5VuhED/KujmZVcIquuo8mBgX4oVda//DQb3PXo=', version='v1.1.1') go_repository(name='com_github_golang_glog', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/golang/glog', sum='h1:VKtxabqXZkF25pY9ekfRL6a582T4P37/31XEstQ5p58=', version='v0.0.0-20160126235308-23def4e6c14b') go_repository(name='com_github_golang_groupcache', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/golang/groupcache', sum='h1:oI5xCqsCo564l8iNU+DwB5epxmsaqB+rhGL0m5jtYqE=', version='v0.0.0-20210331224755-41bb18bfe9da') go_repository(name='com_github_golang_mock', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/golang/mock', sum='h1:ErTB+efbowRARo13NNdxyJji2egdxLGQhRaY+DUumQc=', version='v1.6.0') go_repository(name='com_github_golang_protobuf', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/golang/protobuf', sum='h1:ROPKBNFfQgOUMifHyP+KYbvpjbdoFNs+aK7DXlji0Tw=', version='v1.5.2') go_repository(name='com_github_golang_snappy', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/golang/snappy', sum='h1:fHPg5GQYlCeLIPB9BZqMVR5nR9A+IM5zcgeTdjMYmLA=', version='v0.0.3') go_repository(name='com_github_google_btree', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/google/btree', sum='h1:0udJVsspx3VBr5FwtLhQQtuAsVc79tTq0ocGIPAU6qo=', version='v1.0.0') go_repository(name='com_github_google_go_cmp', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/google/go-cmp', sum='h1:81/ik6ipDQS2aGcBfIN5dHDB36BwrStyeAQquSYCV4o=', version='v0.5.7') go_repository(name='com_github_google_gofuzz', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/google/gofuzz', sum='h1:A8PeW59pxE9IoFRqBp37U+mSNaQoZ46F1f0f863XSXw=', version='v1.0.0') go_repository(name='com_github_google_martian', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/google/martian', sum='h1:/CP5g8u/VJHijgedC/Legn3BAbAaWPgecwXBIDzw5no=', version='v2.1.0+incompatible') go_repository(name='com_github_google_martian_v3', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/google/martian/v3', sum='h1:d8MncMlErDFTwQGBK1xhv026j9kqhvw1Qv9IbWT1VLQ=', version='v3.2.1') go_repository(name='com_github_google_pprof', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/google/pprof', sum='h1:K6RDEckDVWvDI9JAJYCmNdQXq6neHJOYx3V6jnqNEec=', version='v0.0.0-20210720184732-4bb14d4b1be1') go_repository(name='com_github_google_renameio', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/google/renameio', sum='h1:GOZbcHa3HfsPKPlmyPyN2KEohoMXOhdMbHrvbpl2QaA=', version='v0.1.0') go_repository(name='com_github_google_uuid', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/google/uuid', sum='h1:EVhdT+1Kseyi1/pUmXKaFxYsDNy9RQYkMWRH68J/W7Y=', version='v1.1.2') go_repository(name='com_github_googleapis_gax_go_v2', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/googleapis/gax-go/v2', sum='h1:dp3bWCh+PPO1zjRRiCSczJav13sBvG4UhNyVTa1KqdU=', version='v2.1.1') go_repository(name='com_github_grpc_ecosystem_grpc_gateway', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/grpc-ecosystem/grpc-gateway', sum='h1:gmcG1KaJ57LophUzW0Hy8NmPhnMZb4M0+kPpLofRdBo=', version='v1.16.0') go_repository(name='com_github_hashicorp_golang_lru', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/hashicorp/golang-lru', sum='h1:0hERBMJE1eitiLkihrMvRVBYAkpHzc/J3QdDN+dAcgU=', version='v0.5.1') go_repository(name='com_github_hashicorp_hcl', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/hashicorp/hcl', sum='h1:0Anlzjpi4vEasTeNFn2mLJgTSwt0+6sfsiTG8qcWGx4=', version='v1.0.0') go_repository(name='com_github_ianlancetaylor_demangle', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/ianlancetaylor/demangle', sum='h1:mV02weKRL81bEnm8A0HT1/CAelMQDBuQIfLw8n+d6xI=', version='v0.0.0-20200824232613-28f6c0f3b639') go_repository(name='com_github_inconshreveable_mousetrap', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/inconshreveable/mousetrap', sum='h1:Z8tu5sraLXCXIcARxBp/8cbvlwVa7Z1NHg9XEKhtSvM=', version='v1.0.0') go_repository(name='com_github_jmespath_go_jmespath', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/jmespath/go-jmespath', sum='h1:BEgLn5cpjn8UN1mAw4NjwDrS35OdebyEtFe+9YPoQUg=', version='v0.4.0') go_repository(name='com_github_jmespath_go_jmespath_internal_testify', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/jmespath/go-jmespath/internal/testify', sum='h1:shLQSRRSCCPj3f2gpwzGwWFoC7ycTf1rcQZHOlsJ6N8=', version='v1.5.1') go_repository(name='com_github_jmoiron_sqlx', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/jmoiron/sqlx', sum='h1:41Ip0zITnmWNR/vHV+S4m+VoUivnWY5E4OJfLZjCJMA=', version='v1.2.0') go_repository(name='com_github_jpillora_backoff', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/jpillora/backoff', sum='h1:uvFg412JmmHBHw7iwprIxkPMI+sGQ4kzOWsMeHnm2EA=', version='v1.0.0') go_repository(name='com_github_json_iterator_go', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/json-iterator/go', sum='h1:PV8peI4a0ysnczrg+LtxykD8LfKY9ML6u2jnxaEnrnM=', version='v1.1.12') go_repository(name='com_github_jstemmer_go_junit_report', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/jstemmer/go-junit-report', sum='h1:6QPYqodiu3GuPL+7mfx+NwDdp2eTkp9IfEUpgAwUN0o=', version='v0.9.1') go_repository(name='com_github_julienschmidt_httprouter', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/julienschmidt/httprouter', sum='h1:U0609e9tgbseu3rBINet9P48AI/D3oJs4dN7jwJOQ1U=', version='v1.3.0') go_repository(name='com_github_kisielk_gotool', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/kisielk/gotool', sum='h1:AV2c/EiW3KqPNT9ZKl07ehoAGi4C5/01Cfbblndcapg=', version='v1.0.0') go_repository(name='com_github_konsorten_go_windows_terminal_sequences', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/konsorten/go-windows-terminal-sequences', sum='h1:CE8S1cTafDpPvMhIxNJKvHsGVBgn1xWYf1NbHQhywc8=', version='v1.0.3') go_repository(name='com_github_kr_logfmt', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/kr/logfmt', sum='h1:T+h1c/A9Gawja4Y9mFVWj2vyii2bbUNDw3kt9VxK2EY=', version='v0.0.0-20140226030751-b84e30acd515') go_repository(name='com_github_kr_pretty', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/kr/pretty', sum='h1:WgNl7dwNpEZ6jJ9k1snq4pZsg7DOEN8hP9Xw0Tsjwk0=', version='v0.3.0') go_repository(name='com_github_kr_pty', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/kr/pty', sum='h1:VkoXIwSboBpnk99O/KFauAEILuNHv5DVFKZMBN/gUgw=', version='v1.1.1') go_repository(name='com_github_kr_text', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/kr/text', sum='h1:5Nx0Ya0ZqY2ygV366QzturHI13Jq95ApcVaJBhpS+AY=', version='v0.2.0') go_repository(name='com_github_lib_pq', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/lib/pq', sum='h1:X5PMW56eZitiTeO7tKzZxFCSpbFZJtkMMooicw2us9A=', version='v1.0.0') go_repository(name='com_github_magiconair_properties', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/magiconair/properties', sum='h1:LLgXmsheXeRoUOBOjtwPQCWIYqM/LU1ayDtDePerRcY=', version='v1.8.0') go_repository(name='com_github_mattn_go_sqlite3', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/mattn/go-sqlite3', sum='h1:pDRiWfl+++eC2FEFRy6jXmQlvp4Yh3z1MJKg4UeYM/4=', version='v1.9.0') go_repository(name='com_github_matttproud_golang_protobuf_extensions', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/matttproud/golang_protobuf_extensions', sum='h1:4hp9jkHxhMHkqkrB3Ix0jegS5sx/RkqARlsWZ6pIwiU=', version='v1.0.1') go_repository(name='com_github_mitchellh_go_homedir', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/mitchellh/go-homedir', sum='h1:lukF9ziXFxDFPkA1vsr5zpc1XuPDn/wFntq5mG+4E0Y=', version='v1.1.0') go_repository(name='com_github_mitchellh_mapstructure', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/mitchellh/mapstructure', sum='h1:fmNYVwqnSfB9mZU6OS2O6GsXM+wcskZDuKQzvN1EDeE=', version='v1.1.2') go_repository(name='com_github_modern_go_concurrent', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/modern-go/concurrent', sum='h1:TRLaZ9cD/w8PVh93nsPXa1VrQ6jlwL5oN8l14QlcNfg=', version='v0.0.0-20180306012644-bacd9c7ef1dd') go_repository(name='com_github_modern_go_reflect2', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/modern-go/reflect2', sum='h1:xBagoLtFs94CBntxluKeaWgTMpvLxC4ur3nMaC9Gz0M=', version='v1.0.2') go_repository(name='com_github_mwitkow_go_conntrack', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/mwitkow/go-conntrack', sum='h1:KUppIJq7/+SVif2QVs3tOP0zanoHgBEVAwHxUSIzRqU=', version='v0.0.0-20190716064945-2f068394615f') go_repository(name='com_github_oneofone_xxhash', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/OneOfOne/xxhash', sum='h1:KMrpdQIwFcEqXDklaen+P1axHaj9BSKzvpUUfnHldSE=', version='v1.2.2') go_repository(name='com_github_pelletier_go_toml', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/pelletier/go-toml', sum='h1:T5zMGML61Wp+FlcbWjRDT7yAxhJNAiPPLOFECq181zc=', version='v1.2.0') go_repository(name='com_github_pierrec_lz4', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/pierrec/lz4', sum='h1:9UY3+iC23yxF0UfGaYrGplQ+79Rg+h/q9FV9ix19jjM=', version='v2.6.1+incompatible') go_repository(name='com_github_pkg_errors', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/pkg/errors', sum='h1:FEBLx1zS214owpjy7qsBeixbURkuhQAwrK5UwLGTwt4=', version='v0.9.1') go_repository(name='com_github_pmezard_go_difflib', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/pmezard/go-difflib', sum='h1:4DBwDE0NGyQoBHbLQYPwSUPoCMWR5BEzIk/f1lZbAQM=', version='v1.0.0') go_repository(name='com_github_prometheus_client_golang', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/prometheus/client_golang', sum='h1:ZiaPsmm9uiBeaSMRznKsCDNtPCS0T3JVDGF+06gjBzk=', version='v1.12.1') go_repository(name='com_github_prometheus_client_model', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/prometheus/client_model', sum='h1:uq5h0d+GuxiXLJLNABMgp2qUWDPiLvgCzz2dUR+/W/M=', version='v0.2.0') go_repository(name='com_github_prometheus_common', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/prometheus/common', sum='h1:hWIdL3N2HoUx3B8j3YN9mWor0qhY/NlEKZEaXxuIRh4=', version='v0.32.1') go_repository(name='com_github_prometheus_procfs', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/prometheus/procfs', sum='h1:4jVXhlkAyzOScmCkXBTOLRLTz8EeU+eyjrwB/EPq0VU=', version='v0.7.3') go_repository(name='com_github_rogpeppe_fastuuid', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/rogpeppe/fastuuid', sum='h1:Ppwyp6VYCF1nvBTXL3trRso7mXMlRrw9ooo375wvi2s=', version='v1.2.0') go_repository(name='com_github_rogpeppe_go_internal', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/rogpeppe/go-internal', sum='h1:/FiVV8dS/e+YqF2JvO3yXRFbBLTIuSDkuC7aBOAvL+k=', version='v1.6.1') go_repository(name='com_github_rs_xid', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/rs/xid', sum='h1:6NjYksEUlhurdVehpc7S7dk6DAmcKv8V9gG0FsVN2U4=', version='v1.3.0') go_repository(name='com_github_russross_blackfriday', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/russross/blackfriday', sum='h1:HyvC0ARfnZBqnXwABFeSZHpKvJHJJfPz81GNueLj0oo=', version='v1.5.2') go_repository(name='com_github_sirupsen_logrus', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/sirupsen/logrus', sum='h1:UBcNElsrwanuuMsnGSlYmtmgbb23qDR5dG+6X6Oo89I=', version='v1.6.0') go_repository(name='com_github_spaolacci_murmur3', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/spaolacci/murmur3', sum='h1:7c1g84S4BPRrfL5Xrdp6fOJ206sU9y293DDHaoy0bLI=', version='v1.1.0') go_repository(name='com_github_spf13_afero', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/spf13/afero', sum='h1:m8/z1t7/fwjysjQRYbP0RD+bUIF/8tJwPdEZsI83ACI=', version='v1.1.2') go_repository(name='com_github_spf13_cast', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/spf13/cast', sum='h1:oget//CVOEoFewqQxwr0Ej5yjygnqGkvggSE/gB35Q8=', version='v1.3.0') go_repository(name='com_github_spf13_cobra', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/spf13/cobra', sum='h1:f0B+LkLX6DtmRH1isoNA9VTtNUK9K8xYd28JNNfOv/s=', version='v0.0.5') go_repository(name='com_github_spf13_jwalterweatherman', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/spf13/jwalterweatherman', sum='h1:XHEdyB+EcvlqZamSM4ZOMGlc93t6AcsBEu9Gc1vn7yk=', version='v1.0.0') go_repository(name='com_github_spf13_pflag', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/spf13/pflag', sum='h1:zPAT6CGy6wXeQ7NtTnaTerfKOsV6V6F8agHXFiazDkg=', version='v1.0.3') go_repository(name='com_github_spf13_viper', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/spf13/viper', sum='h1:VUFqw5KcqRf7i70GOzW7N+Q7+gxVBkSSqiXB12+JQ4M=', version='v1.3.2') go_repository(name='com_github_stretchr_objx', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/stretchr/objx', sum='h1:2vfRuCMp5sSVIDSqO8oNnWJq7mPa6KVP3iPIwFBuy8A=', version='v0.1.1') go_repository(name='com_github_stretchr_testify', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/stretchr/testify', sum='h1:nwc3DEeHmmLAfoZucVR881uASk0Mfjw8xYJ99tb5CcY=', version='v1.7.0') go_repository(name='com_github_ugorji_go_codec', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/ugorji/go/codec', sum='h1:3SVOIvH7Ae1KRYyQWRjXWJEA9sS/c/pjvH++55Gr648=', version='v0.0.0-20181204163529-d75b2dcb6bc8') go_repository(name='com_github_xordataexchange_crypt', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/xordataexchange/crypt', sum='h1:ESFSdwYZvkeru3RtdrYueztKhOBCSAAzS4Gf+k0tEow=', version='v0.0.3-0.20170626215501-b2862e3d0a77') go_repository(name='com_github_yuin_goldmark', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='github.com/yuin/goldmark', sum='h1:/vn0k+RBvwlxEmP5E7SZMqNxPhfMVFEJiykr15/0XKM=', version='v1.4.1') go_repository(name='com_google_cloud_go', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='cloud.google.com/go', sum='h1:t9Iw5QH5v4XtlEQaCtUY7x6sCABps8sW0acw7e2WQ6Y=', version='v0.100.2') go_repository(name='com_google_cloud_go_bigquery', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='cloud.google.com/go/bigquery', sum='h1:PQcPefKFdaIzjQFbiyOgAqyx8q5djaE7x9Sqe712DPA=', version='v1.8.0') go_repository(name='com_google_cloud_go_compute', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='cloud.google.com/go/compute', sum='h1:EKki8sSdvDU0OO9mAXGwPXOTOgPz2l08R0/IutDH11I=', version='v1.2.0') go_repository(name='com_google_cloud_go_datastore', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='cloud.google.com/go/datastore', sum='h1:/May9ojXjRkPBNVrq+oWLqmWCkr4OU5uRY29bu0mRyQ=', version='v1.1.0') go_repository(name='com_google_cloud_go_iam', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='cloud.google.com/go/iam', sum='h1:4CapQyNFjiksks1/x7jsvsygFPhihslYk5GptIrlX68=', version='v0.1.1') go_repository(name='com_google_cloud_go_pubsub', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='cloud.google.com/go/pubsub', sum='h1:ukjixP1wl0LpnZ6LWtZJ0mX5tBmjp1f8Sqer8Z2OMUU=', version='v1.3.1') go_repository(name='com_google_cloud_go_storage', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='cloud.google.com/go/storage', sum='h1:Ljj+ZXVEhCr/1+4ZhvtteN1ND7UUsNTlduGclLh8GO0=', version='v1.15.0') go_repository(name='com_shuralyov_dmitri_gpu_mtl', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='dmitri.shuralyov.com/gpu/mtl', sum='h1:VpgP7xuJadIUuKccphEpTJnWhS2jkQyMt6Y7pJCD7fY=', version='v0.0.0-20190408044501-666a987793e9') go_repository(name='in_gopkg_alecthomas_kingpin_v2', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='gopkg.in/alecthomas/kingpin.v2', sum='h1:jMFz6MfLP0/4fUyZle81rXUoxOBFi19VUFKVDOQfozc=', version='v2.2.6') go_repository(name='in_gopkg_check_v1', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='gopkg.in/check.v1', sum='h1:Hei/4ADfdWqJk1ZMxUNpqntNwaWcugrBjAiHlqqRiVk=', version='v1.0.0-20201130134442-10cb98267c6c') go_repository(name='in_gopkg_errgo_v2', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='gopkg.in/errgo.v2', sum='h1:0vLT13EuvQ0hNvakwLuFZ/jYrLp5F3kcWHXdRggjCE8=', version='v2.1.0') go_repository(name='in_gopkg_yaml_v2', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='gopkg.in/yaml.v2', sum='h1:D8xgwECY7CYvx+Y2n4sBz93Jn9JRvxdiyyo8CTfuKaY=', version='v2.4.0') go_repository(name='in_gopkg_yaml_v3', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='gopkg.in/yaml.v3', sum='h1:h8qDotaEPuJATrMmW04NCwg7v22aHH28wwpauUhK9Oo=', version='v3.0.0-20210107192922-496545a6307b') go_repository(name='io_opencensus_go', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='go.opencensus.io', sum='h1:gqCw0LfLxScz8irSi8exQc7fyQ0fKQU/qnC/X8+V/1M=', version='v0.23.0') go_repository(name='io_opentelemetry_go_proto_otlp', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='go.opentelemetry.io/proto/otlp', sum='h1:rwOQPCuKAKmwGKq2aVNnYIibI6wnV7EvzgfTCzcdGg8=', version='v0.7.0') go_repository(name='io_rsc_binaryregexp', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='rsc.io/binaryregexp', sum='h1:HfqmD5MEmC0zvwBuF187nq9mdnXjXsSivRiXN7SmRkE=', version='v0.2.0') go_repository(name='io_rsc_quote_v3', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='rsc.io/quote/v3', sum='h1:9JKUTTIUgS6kzR9mK1YuGKv6Nl+DijDNIc0ghT58FaY=', version='v3.1.0') go_repository(name='io_rsc_sampler', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='rsc.io/sampler', sum='h1:7uVkIFmeBqHfdjD+gZwtXXI+RODJ2Wc4O7MPEh/QiW4=', version='v1.3.0') go_repository(name='org_golang_google_api', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='google.golang.org/api', sum='h1:9eJiHhwJKIYX6sX2fUZxQLi7pDRA/MYu8c12q6WbJik=', version='v0.68.0') go_repository(name='org_golang_google_appengine', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='google.golang.org/appengine', sum='h1:FZR1q0exgwxzPzp/aF+VccGrSfxfPpkBqjIIEq3ru6c=', version='v1.6.7') go_repository(name='org_golang_google_genproto', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='google.golang.org/genproto', sum='h1:2X+CNIheCutWRyKRte8szGxrE5ggtV4U+NKAbh/oLhg=', version='v0.0.0-20220211171837-173942840c17') go_repository(name='org_golang_google_grpc', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='google.golang.org/grpc', sum='h1:weqSxi/TMs1SqFRMHCtBgXRs8k3X39QIDEZ0pRcttUg=', version='v1.44.0') go_repository(name='org_golang_google_grpc_cmd_protoc_gen_go_grpc', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='google.golang.org/grpc/cmd/protoc-gen-go-grpc', sum='h1:M1YKkFIboKNieVO5DLUEVzQfGwJD30Nv2jfUgzb5UcE=', version='v1.1.0') go_repository(name='org_golang_google_protobuf', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='google.golang.org/protobuf', sum='h1:SnqbnDw1V7RiZcXPx5MEeqPv2s79L9i7BJUlG/+RurQ=', version='v1.27.1') go_repository(name='org_golang_x_crypto', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='golang.org/x/crypto', sum='h1:psW17arqaxU48Z5kZ0CQnkZWQJsqcURM6tKiBApRjXI=', version='v0.0.0-20200622213623-75b288015ac9') go_repository(name='org_golang_x_exp', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='golang.org/x/exp', sum='h1:QE6XYQK6naiK1EPAe1g/ILLxN5RBoH5xkJk3CqlMI/Y=', version='v0.0.0-20200224162631-6cc2880d07d6') go_repository(name='org_golang_x_image', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='golang.org/x/image', sum='h1:+qEpEAPhDZ1o0x3tHzZTQDArnOixOzGD9HUJfcg0mb4=', version='v0.0.0-20190802002840-cff245a6509b') go_repository(name='org_golang_x_lint', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='golang.org/x/lint', sum='h1:VLliZ0d+/avPrXXH+OakdXhpJuEoBZuwh1m2j7U6Iug=', version='v0.0.0-20210508222113-6edffad5e616') go_repository(name='org_golang_x_mobile', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='golang.org/x/mobile', sum='h1:4+4C/Iv2U4fMZBiMCc98MG1In4gJY5YRhtpDNeDeHWs=', version='v0.0.0-20190719004257-d2bd2a29d028') go_repository(name='org_golang_x_mod', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='golang.org/x/mod', sum='h1:OJxoQ/rynoF0dcCdI7cLPktw/hR2cueqYfjm43oqK38=', version='v0.5.1') go_repository(name='org_golang_x_net', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='golang.org/x/net', sum='h1:O7DYs+zxREGLKzKoMQrtrEacpb0ZVXA5rIwylE2Xchk=', version='v0.0.0-20220127200216-cd36cc0744dd') go_repository(name='org_golang_x_oauth2', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='golang.org/x/oauth2', sum='h1:RerP+noqYHUQ8CMRcPlC2nvTa4dcBIjegkuWdcUDuqg=', version='v0.0.0-20211104180415-d3ed0bb246c8') go_repository(name='org_golang_x_sync', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='golang.org/x/sync', sum='h1:5KslGYwFpkhGh+Q16bwMP3cOontH8FOep7tGV86Y7SQ=', version='v0.0.0-20210220032951-036812b2e83c') go_repository(name='org_golang_x_sys', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='golang.org/x/sys', sum='h1:rm+CHSpPEEW2IsXUib1ThaHIjuBVZjxNgSKmBLFfD4c=', version='v0.0.0-20220209214540-3681064d5158') go_repository(name='org_golang_x_term', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='golang.org/x/term', sum='h1:JGgROgKl9N8DuW20oFS5gxc+lE67/N3FcwmBPMe7ArY=', version='v0.0.0-20210927222741-03fcf44c2211') go_repository(name='org_golang_x_text', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='golang.org/x/text', sum='h1:olpwvP2KacW1ZWvsR7uQhoyTYvKAupfQrRGBFM352Gk=', version='v0.3.7') go_repository(name='org_golang_x_time', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='golang.org/x/time', sum='h1:/5xXl8Y5W96D+TtHSlonuFqGHIWVuyCkGJLwGh9JJFs=', version='v0.0.0-20191024005414-555d28b269f0') go_repository(name='org_golang_x_tools', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='golang.org/x/tools', sum='h1:j9KsMiaP1c3B0OTQGth0/k+miLGTgLsAFUCrF2vLcF8=', version='v0.1.9') go_repository(name='org_golang_x_xerrors', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='golang.org/x/xerrors', sum='h1:go1bK/D/BFZV2I8cIQd1NKEZ+0owSTG1fDTci4IqFcE=', version='v0.0.0-20200804184101-5ec99f83aff1') go_repository(name='org_uber_go_atomic', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='go.uber.org/atomic', sum='h1:ECmE8Bn/WFTYwEW/bpKD3M8VtR/zQVbavAoalC1PYyE=', version='v1.9.0') go_repository(name='org_uber_go_goleak', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='go.uber.org/goleak', sum='h1:wy28qYRKZgnJTxGxvye5/wgWr1EKjmUDGYox5mGlRlI=', version='v1.1.11') go_repository(name='org_uber_go_multierr', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='go.uber.org/multierr', sum='h1:zaiO/rmgFjbmCXdSYJWQcdvOCsthmdaHfr3Gm2Kx4Ec=', version='v1.7.0') go_repository(name='org_uber_go_zap', build_extra_args=['-exclude=**/testdata', '-exclude=go/packages/packagestest'], importpath='go.uber.org/zap', sum='h1:WefMeulhovoZ2sYXz7st6K0sLj7bBhpiFaud4r4zST8=', version='v1.21.0')
def main(shot_name): # load air shot behind Microbone to Getter NP-10H info('extracting {}'.format(shot_name)) #for testing just sleep a few seconds #sleep(5) # this action blocks until completed extract_pipette(shot_name) #isolate microbone close(description='Microbone to Turbo') close('C') #delay to ensure valve is closed and air shot not factionated sleep(2) #expand air shot to microbone #info('equilibrate with microbone') #open(description='Microbone to Getter NP-10H') #close('M') sleep(3) #isolate microbone ? #close(description='Microbone to Getter NP-10H')
def main(shot_name): info('extracting {}'.format(shot_name)) extract_pipette(shot_name) close(description='Microbone to Turbo') close('C') sleep(2) sleep(3)
# Enquete: Utilize o codigo em favorite_language.py # Crie uma lista de pessoas que devam participar da enquete sobre linguagem favorita. Inclua alguns nomes que ja' estejam no dicionario e outros que nao estao. # Percorra a lista de pessoas que devem participar da enquete. Se elas ja tiverem respondido `a enquete, mostre uma mensagem agradecendo-lhe por responder. Se ainda nao participaram da enquete, apresente uma mensagem convidando-as a responder. favorite_languages = { 'jen': 'python', 'sarah': 'c', 'edward': 'ruby', 'phil': 'python', 'chefe': 'javascript', 'edgar': 'php' } list_name = ['edgar', 'marcia','jen', 'augusto', 'retirante', 'sarah', 'chefe', 'madalena', 'joao', 'goza-montinho'] for key in list_name: if key in favorite_languages: print(f"Muito obrigado por sua resposta, {key}.") print("=="*20) elif key not in favorite_languages: print(f"{key}, por favor, responda a questao.") print("=="*20)
favorite_languages = {'jen': 'python', 'sarah': 'c', 'edward': 'ruby', 'phil': 'python', 'chefe': 'javascript', 'edgar': 'php'} list_name = ['edgar', 'marcia', 'jen', 'augusto', 'retirante', 'sarah', 'chefe', 'madalena', 'joao', 'goza-montinho'] for key in list_name: if key in favorite_languages: print(f'Muito obrigado por sua resposta, {key}.') print('==' * 20) elif key not in favorite_languages: print(f'{key}, por favor, responda a questao.') print('==' * 20)
def reverse_filter( s ): return s[ ::-1 ] def string_trim_upper( value ): return value.strip().upper() def string_trim_lower( value ): return value.strip().lower() def datetimeformat( value, format='%H:%M / %d-%m-%Y' ): return value.strftime( format )
def reverse_filter(s): return s[::-1] def string_trim_upper(value): return value.strip().upper() def string_trim_lower(value): return value.strip().lower() def datetimeformat(value, format='%H:%M / %d-%m-%Y'): return value.strftime(format)
load("@bazel_tools//tools/build_defs/repo:http.bzl", "http_archive") def bazel_sonarqube_repositories( sonar_scanner_cli_version = "4.5.0.2216", sonar_scanner_cli_sha256 = "a271a933d14da6e8705d58996d30afd0b4afc93c0bfe957eb377bed808c4fa89"): http_archive( name = "org_sonarsource_scanner_cli_sonar_scanner_cli", build_file = "@bazel_sonarqube//:BUILD.sonar_scanner", sha256 = sonar_scanner_cli_sha256, strip_prefix = "sonar-scanner-" + sonar_scanner_cli_version, urls = [ "https://repo1.maven.org/maven2/org/sonarsource/scanner/cli/sonar-scanner-cli/%s/sonar-scanner-cli-%s.zip" % (sonar_scanner_cli_version, sonar_scanner_cli_version), "https://jcenter.bintray.com/org/sonarsource/scanner/cli/sonar-scanner-cli/%s/sonar-scanner-cli-%s.zip" % (sonar_scanner_cli_version, sonar_scanner_cli_version), ], )
load('@bazel_tools//tools/build_defs/repo:http.bzl', 'http_archive') def bazel_sonarqube_repositories(sonar_scanner_cli_version='4.5.0.2216', sonar_scanner_cli_sha256='a271a933d14da6e8705d58996d30afd0b4afc93c0bfe957eb377bed808c4fa89'): http_archive(name='org_sonarsource_scanner_cli_sonar_scanner_cli', build_file='@bazel_sonarqube//:BUILD.sonar_scanner', sha256=sonar_scanner_cli_sha256, strip_prefix='sonar-scanner-' + sonar_scanner_cli_version, urls=['https://repo1.maven.org/maven2/org/sonarsource/scanner/cli/sonar-scanner-cli/%s/sonar-scanner-cli-%s.zip' % (sonar_scanner_cli_version, sonar_scanner_cli_version), 'https://jcenter.bintray.com/org/sonarsource/scanner/cli/sonar-scanner-cli/%s/sonar-scanner-cli-%s.zip' % (sonar_scanner_cli_version, sonar_scanner_cli_version)])
rawInstructions = [line.rstrip() for line in open("day12_input.txt")] instructions=[] for line in rawInstructions: instructions.append([line[0], int(line[1:])]) orientations = [[0,1], [1,0], [0,-1], [-1,0]] position = [0, 0, 1] def makeMove1(position, instruction): x = position[0] y = position[1] orientation = position[2] if instruction[0] == "L": orientation = int((position[2] - instruction[1] / 90) % 4) if instruction[0] == "R": orientation = int((position[2] + instruction[1] / 90) % 4) if instruction[0] == "F": x += instruction[1] * orientations[orientation][0] y += instruction[1] * orientations[orientation][1] if instruction[0] == "N": y += instruction[1] if instruction[0] == "E": x += instruction[1] if instruction[0] == "S": y -= instruction[1] if instruction[0] == "W": x -= instruction[1] return([x,y, orientation]) for line in instructions: print(line) position = makeMove1(position, line) position2 = [0,0,1,10,1] ccw_rotate = {1: lambda x, y: (-y, x), 2: lambda x, y: (-x, -y), 3: lambda x, y: (y, -x)} cw_rotate = {1: lambda x, y: (y, -x), 2: lambda x, y: (-x, -y), 3: lambda x, y: (-y, x)} def makeMove2(position, instruction): x = position2[0] y = position2[1] orientation = position2[2] neworientation = orientation x1 = position2[3] y1 = position2[4] if instruction[0] == "L": x1, y1 = ccw_rotate.get(int(instruction[1] / 90))(x1,y1) if instruction[0] == "R": x1, y1 = cw_rotate.get(int(instruction[1] / 90))(x1,y1) if instruction[0] == "F": x += instruction[1] * x1 y += instruction[1] * y1 if instruction[0] == "N": y1 += instruction[1] if instruction[0] == "E": x1 += instruction[1] if instruction[0] == "S": y1 -= instruction[1] if instruction[0] == "W": x1 -= instruction[1] return([x,y, neworientation, x1, y1]) for line in instructions: print(line) position2 = makeMove2(position2, line) print("Manhattan position 1 is: "+ str(abs(position[0])+abs(position[1]))) print("Manhattan position 2 is: "+ str(abs(position2[0])+abs(position2[1])))
raw_instructions = [line.rstrip() for line in open('day12_input.txt')] instructions = [] for line in rawInstructions: instructions.append([line[0], int(line[1:])]) orientations = [[0, 1], [1, 0], [0, -1], [-1, 0]] position = [0, 0, 1] def make_move1(position, instruction): x = position[0] y = position[1] orientation = position[2] if instruction[0] == 'L': orientation = int((position[2] - instruction[1] / 90) % 4) if instruction[0] == 'R': orientation = int((position[2] + instruction[1] / 90) % 4) if instruction[0] == 'F': x += instruction[1] * orientations[orientation][0] y += instruction[1] * orientations[orientation][1] if instruction[0] == 'N': y += instruction[1] if instruction[0] == 'E': x += instruction[1] if instruction[0] == 'S': y -= instruction[1] if instruction[0] == 'W': x -= instruction[1] return [x, y, orientation] for line in instructions: print(line) position = make_move1(position, line) position2 = [0, 0, 1, 10, 1] ccw_rotate = {1: lambda x, y: (-y, x), 2: lambda x, y: (-x, -y), 3: lambda x, y: (y, -x)} cw_rotate = {1: lambda x, y: (y, -x), 2: lambda x, y: (-x, -y), 3: lambda x, y: (-y, x)} def make_move2(position, instruction): x = position2[0] y = position2[1] orientation = position2[2] neworientation = orientation x1 = position2[3] y1 = position2[4] if instruction[0] == 'L': (x1, y1) = ccw_rotate.get(int(instruction[1] / 90))(x1, y1) if instruction[0] == 'R': (x1, y1) = cw_rotate.get(int(instruction[1] / 90))(x1, y1) if instruction[0] == 'F': x += instruction[1] * x1 y += instruction[1] * y1 if instruction[0] == 'N': y1 += instruction[1] if instruction[0] == 'E': x1 += instruction[1] if instruction[0] == 'S': y1 -= instruction[1] if instruction[0] == 'W': x1 -= instruction[1] return [x, y, neworientation, x1, y1] for line in instructions: print(line) position2 = make_move2(position2, line) print('Manhattan position 1 is: ' + str(abs(position[0]) + abs(position[1]))) print('Manhattan position 2 is: ' + str(abs(position2[0]) + abs(position2[1])))
class DebugHeaders(object): # List of headers we want to display header_filter = ( 'CONTENT_TYPE', 'HTTP_ACCEPT', 'HTTP_ACCEPT_CHARSET', 'HTTP_ACCEPT_ENCODING', 'HTTP_ACCEPT_LANGUAGE', 'HTTP_CACHE_CONTROL', 'HTTP_CONNECTION', 'HTTP_HOST', 'HTTP_KEEP_ALIVE', 'HTTP_REFERER', 'HTTP_USER_AGENT', 'QUERY_STRING', 'REMOTE_ADDR', 'REMOTE_HOST', 'REQUEST_METHOD', 'SCRIPT_NAME', 'SERVER_NAME', 'SERVER_PORT', 'SERVER_PROTOCOL', 'SERVER_SOFTWARE', ) def available_headers(self, request): return dict( [(k, v) for k, v in request.META.items() if k in self.header_filter] )
class Debugheaders(object): header_filter = ('CONTENT_TYPE', 'HTTP_ACCEPT', 'HTTP_ACCEPT_CHARSET', 'HTTP_ACCEPT_ENCODING', 'HTTP_ACCEPT_LANGUAGE', 'HTTP_CACHE_CONTROL', 'HTTP_CONNECTION', 'HTTP_HOST', 'HTTP_KEEP_ALIVE', 'HTTP_REFERER', 'HTTP_USER_AGENT', 'QUERY_STRING', 'REMOTE_ADDR', 'REMOTE_HOST', 'REQUEST_METHOD', 'SCRIPT_NAME', 'SERVER_NAME', 'SERVER_PORT', 'SERVER_PROTOCOL', 'SERVER_SOFTWARE') def available_headers(self, request): return dict([(k, v) for (k, v) in request.META.items() if k in self.header_filter])
class Solution: def plusOne(self, digits: 'List[int]') -> 'List[int]': fl = 1 for i in range(len(digits)-1,-1,-1): if digits[i] == 9 and fl == 1: fl = 1 digits[i] = 0 else: digits[i] += 1 fl = 0 break if (fl): digits.insert(0,1) return digits
class Solution: def plus_one(self, digits: 'List[int]') -> 'List[int]': fl = 1 for i in range(len(digits) - 1, -1, -1): if digits[i] == 9 and fl == 1: fl = 1 digits[i] = 0 else: digits[i] += 1 fl = 0 break if fl: digits.insert(0, 1) return digits
dictionary = { "CSS": "101", "Python": ["101", "201", "301"] } print(dictionary.get("CSS", None)) print(dictionary.get("HTML", None))
dictionary = {'CSS': '101', 'Python': ['101', '201', '301']} print(dictionary.get('CSS', None)) print(dictionary.get('HTML', None))
# edit the following parameters which control the benchmark mincpus = 16 maxcpus = 128 nsteps_cpus = 6 multigpu = (1,2,3,) multithread = (1,2,4,8) multithread = (8,) multithread_gpu = (42,) if (maxcpus < max(multigpu)): raise ValueError('increase the number of processors') systems = ['interface','lj'] runconfig = ['cpu-opt', 'cpu-omp','cpu-kokkos','cpu-kokkos-omp','cuda-kokkos','cuda-gpu', 'cuda-kokkos-omp', 'cuda-gpu-omp', 'cpu-bare'] excludeSystems = ['interface'] excludeSystemCompilerPairs = [] # this are fixed parameters singlethread =(1,) zerogpu = (0,) threads = { 'cpu-bare' : singlethread, 'cpu-opt' : singlethread, 'cpu-omp' : multithread, 'cpu-kokkos' : singlethread, 'cpu-kokkos-omp' : multithread, 'cuda-gpu' : singlethread, 'cuda-kokkos' : singlethread, 'cuda-gpu-omp' : multithread_gpu, 'cuda-kokkos-omp' : multithread_gpu, } gpus = { 'cpu-bare' : zerogpu, 'cpu-opt' : zerogpu, 'cpu-omp' : zerogpu, 'cpu-kokkos' : zerogpu, 'cpu-kokkos-omp' : zerogpu, 'cuda-gpu' : multigpu, 'cuda-kokkos' : multigpu, 'cuda-gpu-omp' : multigpu, 'cuda-kokkos-omp' : multigpu, } # list of available versions, toolchan descriptoirs and modules compilations = { '29Sep2021': { 'foss-2020b-cuda-kokkos' :'GCC/10.2.0 CUDA/11.1.1 OpenMPI/4.0.5 LAMMPS/29Sep2021-CUDA-11.1.1-kokkos-omp', 'foss-2020b-cuda-kokkos-omp' :'GCC/10.2.0 CUDA/11.1.1 OpenMPI/4.0.5 LAMMPS/29Sep2021-CUDA-11.1.1-kokkos-omp', 'foss-2020b-cuda-gpu' :'GCC/10.2.0 CUDA/11.1.1 OpenMPI/4.0.5 LAMMPS/29Sep2021-CUDA-11.1.1-gpu', 'foss-2021b-cuda-kokkos' :'GCC/11.2.0 OpenMPI/4.1.1 LAMMPS/29Sep2021-CUDA-11.4.1-kokkos-omp', 'foss-2021b-cuda-kokkos-omp' :'GCC/11.2.0 OpenMPI/4.1.1 LAMMPS/29Sep2021-CUDA-11.4.1-kokkos-omp', 'foss-2021b-cuda-gpu' :'GCC/11.2.0 OpenMPI/4.1.1 LAMMPS/29Sep2021-CUDA-11.4.1-gpu', 'foss-2020b-kokkos' :'GCC/10.2.0 OpenMPI/4.0.5 LAMMPS/29Sep2021-kokkos', 'foss-2021b-kokkos' :'GCC/11.2.0 OpenMPI/4.1.1 LAMMPS/29Sep2021-kokkos', 'iomkl-2019b-kokkos' :'iccifort/2019.5.281 OpenMPI/3.1.4 LAMMPS/29Sep2021-kokkos', 'foss-2020b-kokkos-omp' :'GCC/10.2.0 OpenMPI/4.0.5 LAMMPS/29Sep2021-kokkos-omp', 'foss-2021b-kokkos-omp' :'GCC/11.2.0 OpenMPI/4.1.1 LAMMPS/29Sep2021-kokkos-omp', 'iomkl-2019b-kokkos-omp' :'iccifort/2019.5.281 OpenMPI/3.1.4 LAMMPS/29Sep2021-kokkos-omp' }, '3Mar2020': { 'foss-2020a-kokkos' :'GCC/9.3.0 OpenMPI/4.0.3 LAMMPS/3Mar2020-Python-3.8.2-kokkos', 'foss-2020a-kokkos-omp' :'GCC/9.3.0 OpenMPI/4.0.3 LAMMPS/3Mar2020-Python-3.8.2-kokkos-omp', } }
mincpus = 16 maxcpus = 128 nsteps_cpus = 6 multigpu = (1, 2, 3) multithread = (1, 2, 4, 8) multithread = (8,) multithread_gpu = (42,) if maxcpus < max(multigpu): raise value_error('increase the number of processors') systems = ['interface', 'lj'] runconfig = ['cpu-opt', 'cpu-omp', 'cpu-kokkos', 'cpu-kokkos-omp', 'cuda-kokkos', 'cuda-gpu', 'cuda-kokkos-omp', 'cuda-gpu-omp', 'cpu-bare'] exclude_systems = ['interface'] exclude_system_compiler_pairs = [] singlethread = (1,) zerogpu = (0,) threads = {'cpu-bare': singlethread, 'cpu-opt': singlethread, 'cpu-omp': multithread, 'cpu-kokkos': singlethread, 'cpu-kokkos-omp': multithread, 'cuda-gpu': singlethread, 'cuda-kokkos': singlethread, 'cuda-gpu-omp': multithread_gpu, 'cuda-kokkos-omp': multithread_gpu} gpus = {'cpu-bare': zerogpu, 'cpu-opt': zerogpu, 'cpu-omp': zerogpu, 'cpu-kokkos': zerogpu, 'cpu-kokkos-omp': zerogpu, 'cuda-gpu': multigpu, 'cuda-kokkos': multigpu, 'cuda-gpu-omp': multigpu, 'cuda-kokkos-omp': multigpu} compilations = {'29Sep2021': {'foss-2020b-cuda-kokkos': 'GCC/10.2.0 CUDA/11.1.1 OpenMPI/4.0.5 LAMMPS/29Sep2021-CUDA-11.1.1-kokkos-omp', 'foss-2020b-cuda-kokkos-omp': 'GCC/10.2.0 CUDA/11.1.1 OpenMPI/4.0.5 LAMMPS/29Sep2021-CUDA-11.1.1-kokkos-omp', 'foss-2020b-cuda-gpu': 'GCC/10.2.0 CUDA/11.1.1 OpenMPI/4.0.5 LAMMPS/29Sep2021-CUDA-11.1.1-gpu', 'foss-2021b-cuda-kokkos': 'GCC/11.2.0 OpenMPI/4.1.1 LAMMPS/29Sep2021-CUDA-11.4.1-kokkos-omp', 'foss-2021b-cuda-kokkos-omp': 'GCC/11.2.0 OpenMPI/4.1.1 LAMMPS/29Sep2021-CUDA-11.4.1-kokkos-omp', 'foss-2021b-cuda-gpu': 'GCC/11.2.0 OpenMPI/4.1.1 LAMMPS/29Sep2021-CUDA-11.4.1-gpu', 'foss-2020b-kokkos': 'GCC/10.2.0 OpenMPI/4.0.5 LAMMPS/29Sep2021-kokkos', 'foss-2021b-kokkos': 'GCC/11.2.0 OpenMPI/4.1.1 LAMMPS/29Sep2021-kokkos', 'iomkl-2019b-kokkos': 'iccifort/2019.5.281 OpenMPI/3.1.4 LAMMPS/29Sep2021-kokkos', 'foss-2020b-kokkos-omp': 'GCC/10.2.0 OpenMPI/4.0.5 LAMMPS/29Sep2021-kokkos-omp', 'foss-2021b-kokkos-omp': 'GCC/11.2.0 OpenMPI/4.1.1 LAMMPS/29Sep2021-kokkos-omp', 'iomkl-2019b-kokkos-omp': 'iccifort/2019.5.281 OpenMPI/3.1.4 LAMMPS/29Sep2021-kokkos-omp'}, '3Mar2020': {'foss-2020a-kokkos': 'GCC/9.3.0 OpenMPI/4.0.3 LAMMPS/3Mar2020-Python-3.8.2-kokkos', 'foss-2020a-kokkos-omp': 'GCC/9.3.0 OpenMPI/4.0.3 LAMMPS/3Mar2020-Python-3.8.2-kokkos-omp'}}
values = { frozenset(("hardQuotaSize=1", "id=1", "hardQuotaUnit=TB")): { "status_code": "200", "text": { "responseData": {}, "responseHeader": { "now": 1492551097041, "requestId": "WPaFuAoQgF4AADVcf4kAAAAz", "status": "ok", }, "responseStatus": "ok", }, }, frozenset(("hardQuotaSize=1", "id=2", "hardQuotaUnit=TB")): { "status_code": "400", "text": { "responseData": {}, "responseHeader": { "now": 1492551097041, "requestId": "WPaFuAoQgF4AADVcf4kAAAAz", "status": "ok", }, "responseStatus": "ok", }, }, }
values = {frozenset(('hardQuotaSize=1', 'id=1', 'hardQuotaUnit=TB')): {'status_code': '200', 'text': {'responseData': {}, 'responseHeader': {'now': 1492551097041, 'requestId': 'WPaFuAoQgF4AADVcf4kAAAAz', 'status': 'ok'}, 'responseStatus': 'ok'}}, frozenset(('hardQuotaSize=1', 'id=2', 'hardQuotaUnit=TB')): {'status_code': '400', 'text': {'responseData': {}, 'responseHeader': {'now': 1492551097041, 'requestId': 'WPaFuAoQgF4AADVcf4kAAAAz', 'status': 'ok'}, 'responseStatus': 'ok'}}}
input_file = __file__.split("/") input_file[-1] = "input.txt" with open("/".join(input_file)) as f: actions = [entry.strip().split() for entry in f] curr_aim = curr_depth = curr_horiz = 0 for direction, num in actions: if direction in {"up", "down"}: aim_change = int(num) if direction == "down" else int(num) * -1 curr_aim += aim_change else: curr_horiz += int(num) curr_depth += (curr_aim) * int(num) print(f"Part one: {curr_aim * curr_horiz}") print(f"Part two: {curr_depth * curr_horiz}")
input_file = __file__.split('/') input_file[-1] = 'input.txt' with open('/'.join(input_file)) as f: actions = [entry.strip().split() for entry in f] curr_aim = curr_depth = curr_horiz = 0 for (direction, num) in actions: if direction in {'up', 'down'}: aim_change = int(num) if direction == 'down' else int(num) * -1 curr_aim += aim_change else: curr_horiz += int(num) curr_depth += curr_aim * int(num) print(f'Part one: {curr_aim * curr_horiz}') print(f'Part two: {curr_depth * curr_horiz}')
# # PySNMP MIB module Juniper-PPPOE-MIB (http://snmplabs.com/pysmi) # ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/Juniper-PPPOE-MIB # Produced by pysmi-0.3.4 at Mon Apr 29 19:53:05 2019 # On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4 # Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15) # Integer, OctetString, ObjectIdentifier = mibBuilder.importSymbols("ASN1", "Integer", "OctetString", "ObjectIdentifier") NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues") ConstraintsUnion, SingleValueConstraint, ConstraintsIntersection, ValueRangeConstraint, ValueSizeConstraint = mibBuilder.importSymbols("ASN1-REFINEMENT", "ConstraintsUnion", "SingleValueConstraint", "ConstraintsIntersection", "ValueRangeConstraint", "ValueSizeConstraint") InterfaceIndexOrZero, InterfaceIndex = mibBuilder.importSymbols("IF-MIB", "InterfaceIndexOrZero", "InterfaceIndex") juniMibs, = mibBuilder.importSymbols("Juniper-MIBs", "juniMibs") JuniNextIfIndex, JuniEnable = mibBuilder.importSymbols("Juniper-TC", "JuniNextIfIndex", "JuniEnable") ModuleCompliance, ObjectGroup, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "ObjectGroup", "NotificationGroup") ModuleIdentity, MibScalar, MibTable, MibTableRow, MibTableColumn, Counter32, TimeTicks, Gauge32, IpAddress, iso, MibIdentifier, Bits, NotificationType, Counter64, Integer32, ObjectIdentity, Unsigned32 = mibBuilder.importSymbols("SNMPv2-SMI", "ModuleIdentity", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "Counter32", "TimeTicks", "Gauge32", "IpAddress", "iso", "MibIdentifier", "Bits", "NotificationType", "Counter64", "Integer32", "ObjectIdentity", "Unsigned32") MacAddress, TextualConvention, DisplayString, RowStatus, TruthValue = mibBuilder.importSymbols("SNMPv2-TC", "MacAddress", "TextualConvention", "DisplayString", "RowStatus", "TruthValue") juniPPPoEMIB = ModuleIdentity((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18)) juniPPPoEMIB.setRevisions(('2008-11-27 10:23', '2008-06-18 09:42', '2005-08-03 20:58', '2005-05-18 12:01', '2004-06-09 20:58', '2003-03-10 18:30', '2002-10-02 20:12', '2002-10-01 18:27', '2002-08-16 21:46', '2001-06-19 14:27', '2001-03-21 15:00', '2001-02-12 00:00', '2000-10-25 00:00', '1999-05-13 00:00',)) if mibBuilder.loadTexts: juniPPPoEMIB.setLastUpdated('200811271023Z') if mibBuilder.loadTexts: juniPPPoEMIB.setOrganization('Juniper Networks, Inc.') class JuniPPPoEServiceNameAction(TextualConvention, Integer32): status = 'current' subtypeSpec = Integer32.subtypeSpec + ConstraintsUnion(SingleValueConstraint(0, 1)) namedValues = NamedValues(("drop", 0), ("terminate", 1)) juniPPPoEObjects = MibIdentifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1)) juniPPPoEIfLayer = MibIdentifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1)) juniPPPoESubIfLayer = MibIdentifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2)) juniPPPoEGlobal = MibIdentifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 3)) juniPPPoEProfile = MibIdentifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 4)) juniPPPoESummary = MibIdentifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5)) juniPPPoEServices = MibIdentifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6)) juniPPPoENextIfIndex = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 1), JuniNextIfIndex()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoENextIfIndex.setStatus('current') juniPPPoEIfTable = MibTable((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2), ) if mibBuilder.loadTexts: juniPPPoEIfTable.setStatus('current') juniPPPoEIfEntry = MibTableRow((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1), ).setIndexNames((0, "Juniper-PPPOE-MIB", "juniPPPoEIfIfIndex")) if mibBuilder.loadTexts: juniPPPoEIfEntry.setStatus('current') juniPPPoEIfIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 1), InterfaceIndex()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfIfIndex.setStatus('current') juniPPPoEIfMaxNumSessions = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 2), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 65335))).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEIfMaxNumSessions.setStatus('current') juniPPPoEIfRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 3), RowStatus()).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEIfRowStatus.setStatus('current') juniPPPoEIfLowerIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 4), InterfaceIndexOrZero()).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEIfLowerIfIndex.setStatus('current') juniPPPoEIfAcName = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 5), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 64))).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEIfAcName.setStatus('current') juniPPPoEIfDupProtect = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 6), JuniEnable().clone('disable')).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEIfDupProtect.setStatus('current') juniPPPoEIfPADIFlag = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 7), JuniEnable().clone('disable')).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEIfPADIFlag.setStatus('current') juniPPPoEIfAutoconfig = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 8), JuniEnable().clone('disable')).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEIfAutoconfig.setStatus('current') juniPPPoEIfServiceNameTable = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 9), Unsigned32()).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEIfServiceNameTable.setStatus('current') juniPPPoEIfPadrRemoteCircuitIdCapture = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 10), JuniEnable().clone('disable')).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEIfPadrRemoteCircuitIdCapture.setStatus('current') juniPPPoEIfMtu = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 11), Integer32().subtype(subtypeSpec=ConstraintsUnion(ValueRangeConstraint(1, 1), ValueRangeConstraint(2, 2), ValueRangeConstraint(66, 65535), )).clone(1494)).setMaxAccess("readwrite") if mibBuilder.loadTexts: juniPPPoEIfMtu.setStatus('current') juniPPPoEIfLockoutMin = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 12), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 86400))).setMaxAccess("readwrite") if mibBuilder.loadTexts: juniPPPoEIfLockoutMin.setStatus('current') juniPPPoEIfLockoutMax = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 13), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 86400))).setMaxAccess("readwrite") if mibBuilder.loadTexts: juniPPPoEIfLockoutMax.setStatus('current') juniPPPoEMaxSessionVsa = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 14), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1, 2))).clone(namedValues=NamedValues(("override", 1), ("ignore", 2))).clone('ignore')).setMaxAccess("readwrite") if mibBuilder.loadTexts: juniPPPoEMaxSessionVsa.setStatus('current') juniPPPoEIfStatsTable = MibTable((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3), ) if mibBuilder.loadTexts: juniPPPoEIfStatsTable.setStatus('current') juniPPPoEIfStatsEntry = MibTableRow((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1), ).setIndexNames((0, "Juniper-PPPOE-MIB", "juniPPPoEIfIfIndex")) if mibBuilder.loadTexts: juniPPPoEIfStatsEntry.setStatus('current') juniPPPoEIfStatsRxPADI = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 1), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsRxPADI.setStatus('current') juniPPPoEIfStatsTxPADO = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 2), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsTxPADO.setStatus('current') juniPPPoEIfStatsRxPADR = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 3), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsRxPADR.setStatus('current') juniPPPoEIfStatsTxPADS = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 4), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsTxPADS.setStatus('current') juniPPPoEIfStatsRxPADT = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 5), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsRxPADT.setStatus('current') juniPPPoEIfStatsTxPADT = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 6), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsTxPADT.setStatus('current') juniPPPoEIfStatsRxInvVersion = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 7), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvVersion.setStatus('current') juniPPPoEIfStatsRxInvCode = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 8), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvCode.setStatus('current') juniPPPoEIfStatsRxInvTags = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 9), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvTags.setStatus('current') juniPPPoEIfStatsRxInvSession = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 10), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvSession.setStatus('obsolete') juniPPPoEIfStatsRxInvTypes = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 11), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvTypes.setStatus('current') juniPPPoEIfStatsRxInvPackets = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 12), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvPackets.setStatus('current') juniPPPoEIfStatsRxInsufficientResources = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 13), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsRxInsufficientResources.setStatus('current') juniPPPoEIfStatsTxPADM = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 14), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsTxPADM.setStatus('current') juniPPPoEIfStatsTxPADN = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 15), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsTxPADN.setStatus('current') juniPPPoEIfStatsRxInvTagLength = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 16), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvTagLength.setStatus('current') juniPPPoEIfStatsRxInvLength = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 17), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvLength.setStatus('current') juniPPPoEIfStatsRxInvPadISession = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 18), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvPadISession.setStatus('current') juniPPPoEIfStatsRxInvPadRSession = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 19), Counter32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvPadRSession.setStatus('current') juniPPPoEIfLockoutTable = MibTable((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 4), ) if mibBuilder.loadTexts: juniPPPoEIfLockoutTable.setStatus('current') juniPPPoEIfLockoutEntry = MibTableRow((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 4, 1), ).setIndexNames((0, "Juniper-PPPOE-MIB", "juniPPPoEIfIfIndex"), (0, "Juniper-PPPOE-MIB", "juniPPPoEIfLockoutClientAddress")) if mibBuilder.loadTexts: juniPPPoEIfLockoutEntry.setStatus('current') juniPPPoEIfLockoutClientAddress = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 4, 1, 1), MacAddress()) if mibBuilder.loadTexts: juniPPPoEIfLockoutClientAddress.setStatus('current') juniPPPoEIfLockoutTime = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 4, 1, 2), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 86400))).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfLockoutTime.setStatus('current') juniPPPoEIfLockoutElapsedTime = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 4, 1, 3), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 86400))).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfLockoutElapsedTime.setStatus('current') juniPPPoEIfLockoutNextTime = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 4, 1, 4), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 86400))).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEIfLockoutNextTime.setStatus('current') juniPPPoESubIfNextIfIndex = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 1), JuniNextIfIndex()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoESubIfNextIfIndex.setStatus('current') juniPPPoESubIfTable = MibTable((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2), ) if mibBuilder.loadTexts: juniPPPoESubIfTable.setStatus('current') juniPPPoESubIfEntry = MibTableRow((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1), ).setIndexNames((0, "Juniper-PPPOE-MIB", "juniPPPoESubIfIndex")) if mibBuilder.loadTexts: juniPPPoESubIfEntry.setStatus('current') juniPPPoESubIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1, 1), InterfaceIndex()) if mibBuilder.loadTexts: juniPPPoESubIfIndex.setStatus('current') juniPPPoESubIfRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1, 2), RowStatus()).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoESubIfRowStatus.setStatus('current') juniPPPoESubIfLowerIfIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1, 3), InterfaceIndexOrZero()).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoESubIfLowerIfIndex.setStatus('current') juniPPPoESubIfId = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1, 4), Integer32().subtype(subtypeSpec=ValueRangeConstraint(-1, 2147483647)).clone(-1)).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoESubIfId.setStatus('current') juniPPPoESubIfSessionId = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1, 5), Integer32().subtype(subtypeSpec=ValueRangeConstraint(0, 65535))).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoESubIfSessionId.setStatus('current') juniPPPoESubIfMotm = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1, 6), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 127))).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoESubIfMotm.setStatus('current') juniPPPoESubIfUrl = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1, 7), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 127))).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoESubIfUrl.setStatus('current') juniPPPoEGlobalMotm = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 3, 1), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 127))).setMaxAccess("readwrite") if mibBuilder.loadTexts: juniPPPoEGlobalMotm.setStatus('current') juniPPPoEServiceNameTableNextIndex = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 1), Unsigned32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEServiceNameTableNextIndex.setStatus('current') juniPPPoEServiceNameTableTable = MibTable((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 2), ) if mibBuilder.loadTexts: juniPPPoEServiceNameTableTable.setStatus('current') juniPPPoEServiceNameTableEntry = MibTableRow((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 2, 1), ).setIndexNames((0, "Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableIndex")) if mibBuilder.loadTexts: juniPPPoEServiceNameTableEntry.setStatus('current') juniPPPoEServiceNameTableIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 2, 1, 1), Unsigned32()) if mibBuilder.loadTexts: juniPPPoEServiceNameTableIndex.setStatus('current') juniPPPoEServiceNameTableName = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 2, 1, 2), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 31))).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEServiceNameTableName.setStatus('current') juniPPPoEServiceNameTableEmptyAction = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 2, 1, 3), JuniPPPoEServiceNameAction()).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEServiceNameTableEmptyAction.setStatus('current') juniPPPoEServiceNameTableRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 2, 1, 4), RowStatus()).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEServiceNameTableRowStatus.setStatus('current') juniPPPoEServiceNameTableUnknownAction = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 2, 1, 5), JuniPPPoEServiceNameAction()).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEServiceNameTableUnknownAction.setStatus('current') juniPPPoEServiceNameTable = MibTable((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 3), ) if mibBuilder.loadTexts: juniPPPoEServiceNameTable.setStatus('current') juniPPPoEServiceNameEntry = MibTableRow((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 3, 1), ).setIndexNames((0, "Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableIndex"), (0, "Juniper-PPPOE-MIB", "juniPPPoEServiceName")) if mibBuilder.loadTexts: juniPPPoEServiceNameEntry.setStatus('current') juniPPPoEServiceName = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 3, 1, 1), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 31))) if mibBuilder.loadTexts: juniPPPoEServiceName.setStatus('current') juniPPPoEServiceNameAction = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 3, 1, 2), JuniPPPoEServiceNameAction()).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEServiceNameAction.setStatus('current') juniPPPoEServiceNameRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 3, 1, 3), RowStatus()).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEServiceNameRowStatus.setStatus('current') juniPPPoEProfileTable = MibTable((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 4, 1), ) if mibBuilder.loadTexts: juniPPPoEProfileTable.setStatus('deprecated') juniPPPoEProfileEntry = MibTableRow((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 4, 1, 1), ).setIndexNames((0, "Juniper-PPPOE-MIB", "juniPPPoEProfileIndex")) if mibBuilder.loadTexts: juniPPPoEProfileEntry.setStatus('deprecated') juniPPPoEProfileIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 4, 1, 1, 1), Unsigned32()) if mibBuilder.loadTexts: juniPPPoEProfileIndex.setStatus('deprecated') juniPPPoEProfileRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 4, 1, 1, 2), RowStatus()).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEProfileRowStatus.setStatus('deprecated') juniPPPoEProfileMotm = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 4, 1, 1, 3), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 127))).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEProfileMotm.setStatus('deprecated') juniPPPoEProfileUrl = MibTableColumn((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 4, 1, 1, 4), DisplayString().subtype(subtypeSpec=ValueSizeConstraint(0, 127))).setMaxAccess("readcreate") if mibBuilder.loadTexts: juniPPPoEProfileUrl.setStatus('deprecated') juniPPPoEMajorInterfaceCount = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 1), Integer32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoEMajorInterfaceCount.setStatus('current') juniPPPoESummaryMajorIfAdminUp = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 2), Integer32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoESummaryMajorIfAdminUp.setStatus('current') juniPPPoESummaryMajorIfAdminDown = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 3), Integer32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoESummaryMajorIfAdminDown.setStatus('current') juniPPPoESummaryMajorIfOperUp = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 4), Integer32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoESummaryMajorIfOperUp.setStatus('current') juniPPPoESummaryMajorIfOperDown = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 5), Integer32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoESummaryMajorIfOperDown.setStatus('current') juniPPPoESummaryMajorIfLowerLayerDown = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 6), Integer32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoESummaryMajorIfLowerLayerDown.setStatus('current') juniPPPoESummaryMajorIfNotPresent = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 7), Integer32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoESummaryMajorIfNotPresent.setStatus('current') juniPPPoESummarySubInterfaceCount = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 8), Integer32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoESummarySubInterfaceCount.setStatus('current') juniPPPoESummarySubIfAdminUp = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 9), Integer32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoESummarySubIfAdminUp.setStatus('current') juniPPPoESummarySubIfAdminDown = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 10), Integer32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoESummarySubIfAdminDown.setStatus('current') juniPPPoESummarySubIfOperUp = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 11), Integer32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoESummarySubIfOperUp.setStatus('current') juniPPPoESummarySubIfOperDown = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 12), Integer32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoESummarySubIfOperDown.setStatus('current') juniPPPoESummarySubIfLowerLayerDown = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 13), Integer32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoESummarySubIfLowerLayerDown.setStatus('current') juniPPPoESummarySubIfNotPresent = MibScalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 14), Integer32()).setMaxAccess("readonly") if mibBuilder.loadTexts: juniPPPoESummarySubIfNotPresent.setStatus('current') juniPPPoEConformance = MibIdentifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4)) juniPPPoECompliances = MibIdentifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5)) juniPPPoEGroups = MibIdentifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4)) juniPPPoECompliance = ModuleCompliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 1)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEGroup"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoECompliance = juniPPPoECompliance.setStatus('obsolete') juniPPPoECompliance2 = ModuleCompliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 2)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEGroup2"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfGroup2"), ("Juniper-PPPOE-MIB", "juniPPPoEProfileGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoECompliance2 = juniPPPoECompliance2.setStatus('obsolete') juniPPPoECompliance3 = ModuleCompliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 3)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEGroup2"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfGroup2"), ("Juniper-PPPOE-MIB", "juniPPPoEProfileGroup"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoECompliance3 = juniPPPoECompliance3.setStatus('obsolete') juniPPPoECompliance4 = ModuleCompliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 4)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEGroup2"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfGroup2"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoECompliance4 = juniPPPoECompliance4.setStatus('obsolete') juniPPPoECompliance5 = ModuleCompliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 5)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEGroup3"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfGroup2"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoECompliance5 = juniPPPoECompliance5.setStatus('obsolete') juniPPPoECompliance6 = ModuleCompliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 6)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEGroup4"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfGroup2"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoECompliance6 = juniPPPoECompliance6.setStatus('obsolete') juniPPPoECompliance7 = ModuleCompliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 7)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEGroup5"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfGroup2"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoECompliance7 = juniPPPoECompliance7.setStatus('obsolete') juniPPPoECompliance8 = ModuleCompliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 8)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEGroup6"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfGroup2"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryGroup"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoECompliance8 = juniPPPoECompliance8.setStatus('obsolete') juniPPPoECompliance9 = ModuleCompliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 9)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEGroup7"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfGroup2"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryGroup"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoECompliance9 = juniPPPoECompliance9.setStatus('obsolete') juniPPPoECompliance10 = ModuleCompliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 10)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEGroup8"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfGroup2"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryGroup"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoECompliance10 = juniPPPoECompliance10.setStatus('obsolete') juniPPPoECompliance11 = ModuleCompliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 11)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEGroup9"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfGroup2"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryGroup"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableGroup"), ("Juniper-PPPOE-MIB", "juniPPPoELockoutTableGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoECompliance11 = juniPPPoECompliance11.setStatus('obsolete') juniPPPoECompliance12 = ModuleCompliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 12)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEGroup10"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfGroup2"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryGroup"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableGroup"), ("Juniper-PPPOE-MIB", "juniPPPoELockoutTableGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoECompliance12 = juniPPPoECompliance12.setStatus('obsolete') juniPPPoECompliance13 = ModuleCompliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 13)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEGroup10"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfGroup2"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryGroup"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableGroup1"), ("Juniper-PPPOE-MIB", "juniPPPoELockoutTableGroup")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoECompliance13 = juniPPPoECompliance13.setStatus('current') juniPPPoEGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 1)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoENextIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfMaxNumSessions"), ("Juniper-PPPOE-MIB", "juniPPPoEIfRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLowerIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADI"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADO"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADR"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADS"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvVersion"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvCode"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTags"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvSession"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTypes"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPackets"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInsufficientResources")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoEGroup = juniPPPoEGroup.setStatus('obsolete') juniPPPoESubIfGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 2)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoESubIfNextIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfLowerIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfId"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfSessionId")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoESubIfGroup = juniPPPoESubIfGroup.setStatus('obsolete') juniPPPoEProfileGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 3)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEProfileRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoEProfileUrl"), ("Juniper-PPPOE-MIB", "juniPPPoEProfileMotm")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoEProfileGroup = juniPPPoEProfileGroup.setStatus('deprecated') juniPPPoEGroup2 = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 4)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoENextIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfMaxNumSessions"), ("Juniper-PPPOE-MIB", "juniPPPoEIfRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLowerIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADI"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADO"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADR"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADS"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvVersion"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvCode"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTags"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvSession"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTypes"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPackets"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInsufficientResources"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADM"), ("Juniper-PPPOE-MIB", "juniPPPoEGlobalMotm")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoEGroup2 = juniPPPoEGroup2.setStatus('obsolete') juniPPPoESubIfGroup2 = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 5)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoESubIfNextIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfLowerIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfId"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfSessionId"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfUrl"), ("Juniper-PPPOE-MIB", "juniPPPoESubIfMotm")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoESubIfGroup2 = juniPPPoESubIfGroup2.setStatus('current') juniPPPoESummaryGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 6)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEMajorInterfaceCount"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryMajorIfAdminUp"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryMajorIfAdminDown"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryMajorIfOperUp"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryMajorIfOperDown"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryMajorIfNotPresent"), ("Juniper-PPPOE-MIB", "juniPPPoESummaryMajorIfLowerLayerDown"), ("Juniper-PPPOE-MIB", "juniPPPoESummarySubInterfaceCount"), ("Juniper-PPPOE-MIB", "juniPPPoESummarySubIfAdminUp"), ("Juniper-PPPOE-MIB", "juniPPPoESummarySubIfAdminDown"), ("Juniper-PPPOE-MIB", "juniPPPoESummarySubIfOperUp"), ("Juniper-PPPOE-MIB", "juniPPPoESummarySubIfOperDown"), ("Juniper-PPPOE-MIB", "juniPPPoESummarySubIfNotPresent"), ("Juniper-PPPOE-MIB", "juniPPPoESummarySubIfLowerLayerDown")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoESummaryGroup = juniPPPoESummaryGroup.setStatus('current') juniPPPoEGroup3 = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 7)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoENextIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfMaxNumSessions"), ("Juniper-PPPOE-MIB", "juniPPPoEIfRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLowerIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfAcName"), ("Juniper-PPPOE-MIB", "juniPPPoEIfDupProtect"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADI"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADO"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADR"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADS"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvVersion"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvCode"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTags"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvSession"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTypes"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPackets"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInsufficientResources"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADM"), ("Juniper-PPPOE-MIB", "juniPPPoEGlobalMotm")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoEGroup3 = juniPPPoEGroup3.setStatus('obsolete') juniPPPoEGroup4 = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 8)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoENextIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfMaxNumSessions"), ("Juniper-PPPOE-MIB", "juniPPPoEIfRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLowerIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfAcName"), ("Juniper-PPPOE-MIB", "juniPPPoEIfDupProtect"), ("Juniper-PPPOE-MIB", "juniPPPoEIfPADIFlag"), ("Juniper-PPPOE-MIB", "juniPPPoEIfAutoconfig"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADI"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADO"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADR"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADS"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvVersion"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvCode"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTags"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvSession"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTypes"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPackets"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInsufficientResources"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADM"), ("Juniper-PPPOE-MIB", "juniPPPoEGlobalMotm")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoEGroup4 = juniPPPoEGroup4.setStatus('obsolete') juniPPPoEGroup5 = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 9)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoENextIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfMaxNumSessions"), ("Juniper-PPPOE-MIB", "juniPPPoEIfRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLowerIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfAcName"), ("Juniper-PPPOE-MIB", "juniPPPoEIfDupProtect"), ("Juniper-PPPOE-MIB", "juniPPPoEIfPADIFlag"), ("Juniper-PPPOE-MIB", "juniPPPoEIfAutoconfig"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADI"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADO"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADR"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADS"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvVersion"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvCode"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTags"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvSession"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTypes"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPackets"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInsufficientResources"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADM"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADN"), ("Juniper-PPPOE-MIB", "juniPPPoEGlobalMotm")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoEGroup5 = juniPPPoEGroup5.setStatus('obsolete') juniPPPoEGroup6 = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 10)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoENextIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfMaxNumSessions"), ("Juniper-PPPOE-MIB", "juniPPPoEIfRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLowerIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfAcName"), ("Juniper-PPPOE-MIB", "juniPPPoEIfDupProtect"), ("Juniper-PPPOE-MIB", "juniPPPoEIfPADIFlag"), ("Juniper-PPPOE-MIB", "juniPPPoEIfAutoconfig"), ("Juniper-PPPOE-MIB", "juniPPPoEIfServiceNameTable"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADI"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADO"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADR"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADS"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvVersion"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvCode"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTags"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTagLength"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvLength"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTypes"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPackets"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInsufficientResources"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADM"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADN"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPadISession"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPadRSession"), ("Juniper-PPPOE-MIB", "juniPPPoEGlobalMotm")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoEGroup6 = juniPPPoEGroup6.setStatus('obsolete') juniPPPoEServiceNameTableGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 11)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableNextIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableName"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableEmptyAction"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameAction"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameRowStatus")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoEServiceNameTableGroup = juniPPPoEServiceNameTableGroup.setStatus('obsolete') juniPPPoEGroup7 = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 12)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoENextIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfMaxNumSessions"), ("Juniper-PPPOE-MIB", "juniPPPoEIfRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLowerIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfAcName"), ("Juniper-PPPOE-MIB", "juniPPPoEIfDupProtect"), ("Juniper-PPPOE-MIB", "juniPPPoEIfPADIFlag"), ("Juniper-PPPOE-MIB", "juniPPPoEIfAutoconfig"), ("Juniper-PPPOE-MIB", "juniPPPoEIfServiceNameTable"), ("Juniper-PPPOE-MIB", "juniPPPoEIfPadrRemoteCircuitIdCapture"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADI"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADO"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADR"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADS"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvVersion"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvCode"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTags"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTagLength"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvLength"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTypes"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPackets"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInsufficientResources"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADM"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADN"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPadISession"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPadRSession"), ("Juniper-PPPOE-MIB", "juniPPPoEGlobalMotm")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoEGroup7 = juniPPPoEGroup7.setStatus('obsolete') juniPPPoEGroup8 = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 13)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoENextIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfMaxNumSessions"), ("Juniper-PPPOE-MIB", "juniPPPoEIfRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLowerIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfAcName"), ("Juniper-PPPOE-MIB", "juniPPPoEIfDupProtect"), ("Juniper-PPPOE-MIB", "juniPPPoEIfPADIFlag"), ("Juniper-PPPOE-MIB", "juniPPPoEIfAutoconfig"), ("Juniper-PPPOE-MIB", "juniPPPoEIfServiceNameTable"), ("Juniper-PPPOE-MIB", "juniPPPoEIfPadrRemoteCircuitIdCapture"), ("Juniper-PPPOE-MIB", "juniPPPoEIfMtu"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADI"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADO"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADR"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADS"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvVersion"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvCode"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTags"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTagLength"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvLength"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTypes"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPackets"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInsufficientResources"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADM"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADN"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPadISession"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPadRSession"), ("Juniper-PPPOE-MIB", "juniPPPoEGlobalMotm")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoEGroup8 = juniPPPoEGroup8.setStatus('current') juniPPPoELockoutTableGroup = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 14)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEIfLockoutTime"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLockoutElapsedTime"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLockoutNextTime")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoELockoutTableGroup = juniPPPoELockoutTableGroup.setStatus('current') juniPPPoEGroup9 = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 15)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoENextIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfMaxNumSessions"), ("Juniper-PPPOE-MIB", "juniPPPoEIfRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLowerIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfAcName"), ("Juniper-PPPOE-MIB", "juniPPPoEIfDupProtect"), ("Juniper-PPPOE-MIB", "juniPPPoEIfPADIFlag"), ("Juniper-PPPOE-MIB", "juniPPPoEIfAutoconfig"), ("Juniper-PPPOE-MIB", "juniPPPoEIfServiceNameTable"), ("Juniper-PPPOE-MIB", "juniPPPoEIfPadrRemoteCircuitIdCapture"), ("Juniper-PPPOE-MIB", "juniPPPoEIfMtu"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLockoutMin"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLockoutMax"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADI"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADO"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADR"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADS"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvVersion"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvCode"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTags"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTagLength"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvLength"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTypes"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPackets"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInsufficientResources"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADM"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADN"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPadISession"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPadRSession"), ("Juniper-PPPOE-MIB", "juniPPPoEGlobalMotm")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoEGroup9 = juniPPPoEGroup9.setStatus('obsolete') juniPPPoEGroup10 = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 16)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoENextIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfMaxNumSessions"), ("Juniper-PPPOE-MIB", "juniPPPoEIfRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLowerIfIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEIfAcName"), ("Juniper-PPPOE-MIB", "juniPPPoEIfDupProtect"), ("Juniper-PPPOE-MIB", "juniPPPoEIfPADIFlag"), ("Juniper-PPPOE-MIB", "juniPPPoEIfAutoconfig"), ("Juniper-PPPOE-MIB", "juniPPPoEIfServiceNameTable"), ("Juniper-PPPOE-MIB", "juniPPPoEIfPadrRemoteCircuitIdCapture"), ("Juniper-PPPOE-MIB", "juniPPPoEIfMtu"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLockoutMin"), ("Juniper-PPPOE-MIB", "juniPPPoEIfLockoutMax"), ("Juniper-PPPOE-MIB", "juniPPPoEMaxSessionVsa"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADI"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADO"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADR"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADS"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADT"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvVersion"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvCode"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTags"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTagLength"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvLength"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvTypes"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPackets"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInsufficientResources"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADM"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsTxPADN"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPadISession"), ("Juniper-PPPOE-MIB", "juniPPPoEIfStatsRxInvPadRSession"), ("Juniper-PPPOE-MIB", "juniPPPoEGlobalMotm")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoEGroup10 = juniPPPoEGroup10.setStatus('current') juniPPPoEServiceNameTableGroup1 = ObjectGroup((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 17)).setObjects(("Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableNextIndex"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableName"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableEmptyAction"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameAction"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameRowStatus"), ("Juniper-PPPOE-MIB", "juniPPPoEServiceNameTableUnknownAction")) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juniPPPoEServiceNameTableGroup1 = juniPPPoEServiceNameTableGroup1.setStatus('current') mibBuilder.exportSymbols("Juniper-PPPOE-MIB", juniPPPoESummaryMajorIfAdminDown=juniPPPoESummaryMajorIfAdminDown, juniPPPoESubIfUrl=juniPPPoESubIfUrl, juniPPPoEIfStatsTxPADT=juniPPPoEIfStatsTxPADT, juniPPPoESubIfSessionId=juniPPPoESubIfSessionId, juniPPPoEIfLowerIfIndex=juniPPPoEIfLowerIfIndex, juniPPPoESummaryMajorIfOperDown=juniPPPoESummaryMajorIfOperDown, juniPPPoEServiceNameTableIndex=juniPPPoEServiceNameTableIndex, juniPPPoECompliance4=juniPPPoECompliance4, juniPPPoEIfStatsTxPADM=juniPPPoEIfStatsTxPADM, juniPPPoEIfLockoutElapsedTime=juniPPPoEIfLockoutElapsedTime, juniPPPoESubIfMotm=juniPPPoESubIfMotm, juniPPPoEIfStatsTxPADO=juniPPPoEIfStatsTxPADO, juniPPPoESummarySubIfLowerLayerDown=juniPPPoESummarySubIfLowerLayerDown, juniPPPoEIfStatsRxInvPadRSession=juniPPPoEIfStatsRxInvPadRSession, juniPPPoEIfAutoconfig=juniPPPoEIfAutoconfig, juniPPPoECompliance8=juniPPPoECompliance8, juniPPPoEIfPADIFlag=juniPPPoEIfPADIFlag, juniPPPoESummarySubInterfaceCount=juniPPPoESummarySubInterfaceCount, juniPPPoEIfStatsRxInvCode=juniPPPoEIfStatsRxInvCode, juniPPPoENextIfIndex=juniPPPoENextIfIndex, juniPPPoEObjects=juniPPPoEObjects, juniPPPoEIfStatsTable=juniPPPoEIfStatsTable, juniPPPoECompliance3=juniPPPoECompliance3, juniPPPoEServices=juniPPPoEServices, juniPPPoEIfLockoutTable=juniPPPoEIfLockoutTable, JuniPPPoEServiceNameAction=JuniPPPoEServiceNameAction, juniPPPoEMIB=juniPPPoEMIB, juniPPPoEServiceNameEntry=juniPPPoEServiceNameEntry, juniPPPoESubIfEntry=juniPPPoESubIfEntry, juniPPPoESubIfTable=juniPPPoESubIfTable, juniPPPoEGroup3=juniPPPoEGroup3, juniPPPoEGlobal=juniPPPoEGlobal, juniPPPoEGroup8=juniPPPoEGroup8, juniPPPoEServiceNameAction=juniPPPoEServiceNameAction, juniPPPoEServiceNameTableEmptyAction=juniPPPoEServiceNameTableEmptyAction, juniPPPoEServiceNameTableUnknownAction=juniPPPoEServiceNameTableUnknownAction, juniPPPoEIfIfIndex=juniPPPoEIfIfIndex, juniPPPoEProfileGroup=juniPPPoEProfileGroup, juniPPPoELockoutTableGroup=juniPPPoELockoutTableGroup, juniPPPoECompliance11=juniPPPoECompliance11, juniPPPoEIfMaxNumSessions=juniPPPoEIfMaxNumSessions, juniPPPoECompliance12=juniPPPoECompliance12, juniPPPoEIfStatsRxInvLength=juniPPPoEIfStatsRxInvLength, juniPPPoEServiceNameTable=juniPPPoEServiceNameTable, juniPPPoEGroup5=juniPPPoEGroup5, juniPPPoEIfLockoutMax=juniPPPoEIfLockoutMax, juniPPPoEServiceNameTableGroup1=juniPPPoEServiceNameTableGroup1, juniPPPoEGroup9=juniPPPoEGroup9, juniPPPoEProfileEntry=juniPPPoEProfileEntry, juniPPPoEIfStatsRxInvPadISession=juniPPPoEIfStatsRxInvPadISession, juniPPPoEProfileIndex=juniPPPoEProfileIndex, juniPPPoEServiceNameTableGroup=juniPPPoEServiceNameTableGroup, juniPPPoESummaryGroup=juniPPPoESummaryGroup, juniPPPoEIfLayer=juniPPPoEIfLayer, juniPPPoEIfStatsRxInsufficientResources=juniPPPoEIfStatsRxInsufficientResources, juniPPPoEIfStatsRxPADR=juniPPPoEIfStatsRxPADR, juniPPPoEIfDupProtect=juniPPPoEIfDupProtect, juniPPPoEIfStatsRxInvVersion=juniPPPoEIfStatsRxInvVersion, juniPPPoEProfile=juniPPPoEProfile, juniPPPoEIfStatsTxPADN=juniPPPoEIfStatsTxPADN, juniPPPoESummarySubIfAdminUp=juniPPPoESummarySubIfAdminUp, juniPPPoEIfTable=juniPPPoEIfTable, juniPPPoESummary=juniPPPoESummary, juniPPPoESubIfLayer=juniPPPoESubIfLayer, juniPPPoEIfLockoutTime=juniPPPoEIfLockoutTime, juniPPPoEIfLockoutClientAddress=juniPPPoEIfLockoutClientAddress, juniPPPoEGroup10=juniPPPoEGroup10, juniPPPoEProfileTable=juniPPPoEProfileTable, juniPPPoEIfLockoutNextTime=juniPPPoEIfLockoutNextTime, juniPPPoEProfileUrl=juniPPPoEProfileUrl, juniPPPoESubIfRowStatus=juniPPPoESubIfRowStatus, juniPPPoESubIfGroup=juniPPPoESubIfGroup, juniPPPoESummaryMajorIfAdminUp=juniPPPoESummaryMajorIfAdminUp, juniPPPoEGroup2=juniPPPoEGroup2, juniPPPoEServiceNameTableEntry=juniPPPoEServiceNameTableEntry, juniPPPoEGroup6=juniPPPoEGroup6, juniPPPoECompliance9=juniPPPoECompliance9, juniPPPoESubIfGroup2=juniPPPoESubIfGroup2, juniPPPoEIfServiceNameTable=juniPPPoEIfServiceNameTable, juniPPPoESubIfLowerIfIndex=juniPPPoESubIfLowerIfIndex, juniPPPoEIfStatsEntry=juniPPPoEIfStatsEntry, juniPPPoEIfStatsRxInvTags=juniPPPoEIfStatsRxInvTags, juniPPPoEServiceName=juniPPPoEServiceName, juniPPPoEMaxSessionVsa=juniPPPoEMaxSessionVsa, juniPPPoEProfileMotm=juniPPPoEProfileMotm, juniPPPoEGlobalMotm=juniPPPoEGlobalMotm, juniPPPoESubIfNextIfIndex=juniPPPoESubIfNextIfIndex, juniPPPoECompliance5=juniPPPoECompliance5, juniPPPoEServiceNameRowStatus=juniPPPoEServiceNameRowStatus, juniPPPoEIfStatsRxPADI=juniPPPoEIfStatsRxPADI, juniPPPoEGroup7=juniPPPoEGroup7, juniPPPoECompliance2=juniPPPoECompliance2, juniPPPoESubIfIndex=juniPPPoESubIfIndex, juniPPPoEServiceNameTableRowStatus=juniPPPoEServiceNameTableRowStatus, juniPPPoEIfStatsRxInvPackets=juniPPPoEIfStatsRxInvPackets, juniPPPoESummaryMajorIfOperUp=juniPPPoESummaryMajorIfOperUp, juniPPPoESummarySubIfAdminDown=juniPPPoESummarySubIfAdminDown, juniPPPoEIfAcName=juniPPPoEIfAcName, juniPPPoEGroups=juniPPPoEGroups, PYSNMP_MODULE_ID=juniPPPoEMIB, juniPPPoEIfEntry=juniPPPoEIfEntry, juniPPPoESummarySubIfOperUp=juniPPPoESummarySubIfOperUp, juniPPPoECompliances=juniPPPoECompliances, juniPPPoEIfMtu=juniPPPoEIfMtu, juniPPPoEServiceNameTableName=juniPPPoEServiceNameTableName, juniPPPoESummaryMajorIfLowerLayerDown=juniPPPoESummaryMajorIfLowerLayerDown, juniPPPoEServiceNameTableTable=juniPPPoEServiceNameTableTable, juniPPPoEIfLockoutMin=juniPPPoEIfLockoutMin, juniPPPoEConformance=juniPPPoEConformance, juniPPPoEProfileRowStatus=juniPPPoEProfileRowStatus, juniPPPoEServiceNameTableNextIndex=juniPPPoEServiceNameTableNextIndex, juniPPPoESubIfId=juniPPPoESubIfId, juniPPPoEGroup4=juniPPPoEGroup4, juniPPPoESummarySubIfNotPresent=juniPPPoESummarySubIfNotPresent, juniPPPoECompliance6=juniPPPoECompliance6, juniPPPoECompliance13=juniPPPoECompliance13, juniPPPoEIfStatsRxInvTagLength=juniPPPoEIfStatsRxInvTagLength, juniPPPoEIfStatsTxPADS=juniPPPoEIfStatsTxPADS, juniPPPoESummaryMajorIfNotPresent=juniPPPoESummaryMajorIfNotPresent, juniPPPoECompliance7=juniPPPoECompliance7, juniPPPoEIfPadrRemoteCircuitIdCapture=juniPPPoEIfPadrRemoteCircuitIdCapture, juniPPPoEIfStatsRxInvSession=juniPPPoEIfStatsRxInvSession, juniPPPoECompliance10=juniPPPoECompliance10, juniPPPoEMajorInterfaceCount=juniPPPoEMajorInterfaceCount, juniPPPoEIfStatsRxInvTypes=juniPPPoEIfStatsRxInvTypes, juniPPPoESummarySubIfOperDown=juniPPPoESummarySubIfOperDown, juniPPPoEIfRowStatus=juniPPPoEIfRowStatus, juniPPPoEIfLockoutEntry=juniPPPoEIfLockoutEntry, juniPPPoEIfStatsRxPADT=juniPPPoEIfStatsRxPADT, juniPPPoECompliance=juniPPPoECompliance, juniPPPoEGroup=juniPPPoEGroup)
(integer, octet_string, object_identifier) = mibBuilder.importSymbols('ASN1', 'Integer', 'OctetString', 'ObjectIdentifier') (named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues') (constraints_union, single_value_constraint, constraints_intersection, value_range_constraint, value_size_constraint) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ConstraintsUnion', 'SingleValueConstraint', 'ConstraintsIntersection', 'ValueRangeConstraint', 'ValueSizeConstraint') (interface_index_or_zero, interface_index) = mibBuilder.importSymbols('IF-MIB', 'InterfaceIndexOrZero', 'InterfaceIndex') (juni_mibs,) = mibBuilder.importSymbols('Juniper-MIBs', 'juniMibs') (juni_next_if_index, juni_enable) = mibBuilder.importSymbols('Juniper-TC', 'JuniNextIfIndex', 'JuniEnable') (module_compliance, object_group, notification_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'ObjectGroup', 'NotificationGroup') (module_identity, mib_scalar, mib_table, mib_table_row, mib_table_column, counter32, time_ticks, gauge32, ip_address, iso, mib_identifier, bits, notification_type, counter64, integer32, object_identity, unsigned32) = mibBuilder.importSymbols('SNMPv2-SMI', 'ModuleIdentity', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'Counter32', 'TimeTicks', 'Gauge32', 'IpAddress', 'iso', 'MibIdentifier', 'Bits', 'NotificationType', 'Counter64', 'Integer32', 'ObjectIdentity', 'Unsigned32') (mac_address, textual_convention, display_string, row_status, truth_value) = mibBuilder.importSymbols('SNMPv2-TC', 'MacAddress', 'TextualConvention', 'DisplayString', 'RowStatus', 'TruthValue') juni_pp_po_emib = module_identity((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18)) juniPPPoEMIB.setRevisions(('2008-11-27 10:23', '2008-06-18 09:42', '2005-08-03 20:58', '2005-05-18 12:01', '2004-06-09 20:58', '2003-03-10 18:30', '2002-10-02 20:12', '2002-10-01 18:27', '2002-08-16 21:46', '2001-06-19 14:27', '2001-03-21 15:00', '2001-02-12 00:00', '2000-10-25 00:00', '1999-05-13 00:00')) if mibBuilder.loadTexts: juniPPPoEMIB.setLastUpdated('200811271023Z') if mibBuilder.loadTexts: juniPPPoEMIB.setOrganization('Juniper Networks, Inc.') class Junipppoeservicenameaction(TextualConvention, Integer32): status = 'current' subtype_spec = Integer32.subtypeSpec + constraints_union(single_value_constraint(0, 1)) named_values = named_values(('drop', 0), ('terminate', 1)) juni_pp_po_e_objects = mib_identifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1)) juni_pp_po_e_if_layer = mib_identifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1)) juni_pp_po_e_sub_if_layer = mib_identifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2)) juni_pp_po_e_global = mib_identifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 3)) juni_pp_po_e_profile = mib_identifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 4)) juni_pp_po_e_summary = mib_identifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5)) juni_pp_po_e_services = mib_identifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6)) juni_pp_po_e_next_if_index = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 1), juni_next_if_index()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoENextIfIndex.setStatus('current') juni_pp_po_e_if_table = mib_table((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2)) if mibBuilder.loadTexts: juniPPPoEIfTable.setStatus('current') juni_pp_po_e_if_entry = mib_table_row((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1)).setIndexNames((0, 'Juniper-PPPOE-MIB', 'juniPPPoEIfIfIndex')) if mibBuilder.loadTexts: juniPPPoEIfEntry.setStatus('current') juni_pp_po_e_if_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 1), interface_index()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfIfIndex.setStatus('current') juni_pp_po_e_if_max_num_sessions = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 2), integer32().subtype(subtypeSpec=value_range_constraint(0, 65335))).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEIfMaxNumSessions.setStatus('current') juni_pp_po_e_if_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 3), row_status()).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEIfRowStatus.setStatus('current') juni_pp_po_e_if_lower_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 4), interface_index_or_zero()).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEIfLowerIfIndex.setStatus('current') juni_pp_po_e_if_ac_name = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 5), display_string().subtype(subtypeSpec=value_size_constraint(0, 64))).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEIfAcName.setStatus('current') juni_pp_po_e_if_dup_protect = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 6), juni_enable().clone('disable')).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEIfDupProtect.setStatus('current') juni_pp_po_e_if_padi_flag = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 7), juni_enable().clone('disable')).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEIfPADIFlag.setStatus('current') juni_pp_po_e_if_autoconfig = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 8), juni_enable().clone('disable')).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEIfAutoconfig.setStatus('current') juni_pp_po_e_if_service_name_table = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 9), unsigned32()).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEIfServiceNameTable.setStatus('current') juni_pp_po_e_if_padr_remote_circuit_id_capture = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 10), juni_enable().clone('disable')).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEIfPadrRemoteCircuitIdCapture.setStatus('current') juni_pp_po_e_if_mtu = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 11), integer32().subtype(subtypeSpec=constraints_union(value_range_constraint(1, 1), value_range_constraint(2, 2), value_range_constraint(66, 65535))).clone(1494)).setMaxAccess('readwrite') if mibBuilder.loadTexts: juniPPPoEIfMtu.setStatus('current') juni_pp_po_e_if_lockout_min = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 12), integer32().subtype(subtypeSpec=value_range_constraint(0, 86400))).setMaxAccess('readwrite') if mibBuilder.loadTexts: juniPPPoEIfLockoutMin.setStatus('current') juni_pp_po_e_if_lockout_max = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 13), integer32().subtype(subtypeSpec=value_range_constraint(0, 86400))).setMaxAccess('readwrite') if mibBuilder.loadTexts: juniPPPoEIfLockoutMax.setStatus('current') juni_pp_po_e_max_session_vsa = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 2, 1, 14), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1, 2))).clone(namedValues=named_values(('override', 1), ('ignore', 2))).clone('ignore')).setMaxAccess('readwrite') if mibBuilder.loadTexts: juniPPPoEMaxSessionVsa.setStatus('current') juni_pp_po_e_if_stats_table = mib_table((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3)) if mibBuilder.loadTexts: juniPPPoEIfStatsTable.setStatus('current') juni_pp_po_e_if_stats_entry = mib_table_row((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1)).setIndexNames((0, 'Juniper-PPPOE-MIB', 'juniPPPoEIfIfIndex')) if mibBuilder.loadTexts: juniPPPoEIfStatsEntry.setStatus('current') juni_pp_po_e_if_stats_rx_padi = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 1), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsRxPADI.setStatus('current') juni_pp_po_e_if_stats_tx_pado = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 2), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsTxPADO.setStatus('current') juni_pp_po_e_if_stats_rx_padr = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 3), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsRxPADR.setStatus('current') juni_pp_po_e_if_stats_tx_pads = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 4), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsTxPADS.setStatus('current') juni_pp_po_e_if_stats_rx_padt = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 5), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsRxPADT.setStatus('current') juni_pp_po_e_if_stats_tx_padt = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 6), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsTxPADT.setStatus('current') juni_pp_po_e_if_stats_rx_inv_version = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 7), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvVersion.setStatus('current') juni_pp_po_e_if_stats_rx_inv_code = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 8), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvCode.setStatus('current') juni_pp_po_e_if_stats_rx_inv_tags = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 9), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvTags.setStatus('current') juni_pp_po_e_if_stats_rx_inv_session = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 10), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvSession.setStatus('obsolete') juni_pp_po_e_if_stats_rx_inv_types = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 11), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvTypes.setStatus('current') juni_pp_po_e_if_stats_rx_inv_packets = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 12), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvPackets.setStatus('current') juni_pp_po_e_if_stats_rx_insufficient_resources = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 13), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsRxInsufficientResources.setStatus('current') juni_pp_po_e_if_stats_tx_padm = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 14), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsTxPADM.setStatus('current') juni_pp_po_e_if_stats_tx_padn = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 15), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsTxPADN.setStatus('current') juni_pp_po_e_if_stats_rx_inv_tag_length = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 16), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvTagLength.setStatus('current') juni_pp_po_e_if_stats_rx_inv_length = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 17), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvLength.setStatus('current') juni_pp_po_e_if_stats_rx_inv_pad_i_session = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 18), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvPadISession.setStatus('current') juni_pp_po_e_if_stats_rx_inv_pad_r_session = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 3, 1, 19), counter32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfStatsRxInvPadRSession.setStatus('current') juni_pp_po_e_if_lockout_table = mib_table((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 4)) if mibBuilder.loadTexts: juniPPPoEIfLockoutTable.setStatus('current') juni_pp_po_e_if_lockout_entry = mib_table_row((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 4, 1)).setIndexNames((0, 'Juniper-PPPOE-MIB', 'juniPPPoEIfIfIndex'), (0, 'Juniper-PPPOE-MIB', 'juniPPPoEIfLockoutClientAddress')) if mibBuilder.loadTexts: juniPPPoEIfLockoutEntry.setStatus('current') juni_pp_po_e_if_lockout_client_address = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 4, 1, 1), mac_address()) if mibBuilder.loadTexts: juniPPPoEIfLockoutClientAddress.setStatus('current') juni_pp_po_e_if_lockout_time = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 4, 1, 2), integer32().subtype(subtypeSpec=value_range_constraint(0, 86400))).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfLockoutTime.setStatus('current') juni_pp_po_e_if_lockout_elapsed_time = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 4, 1, 3), integer32().subtype(subtypeSpec=value_range_constraint(0, 86400))).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfLockoutElapsedTime.setStatus('current') juni_pp_po_e_if_lockout_next_time = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 1, 4, 1, 4), integer32().subtype(subtypeSpec=value_range_constraint(0, 86400))).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEIfLockoutNextTime.setStatus('current') juni_pp_po_e_sub_if_next_if_index = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 1), juni_next_if_index()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoESubIfNextIfIndex.setStatus('current') juni_pp_po_e_sub_if_table = mib_table((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2)) if mibBuilder.loadTexts: juniPPPoESubIfTable.setStatus('current') juni_pp_po_e_sub_if_entry = mib_table_row((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1)).setIndexNames((0, 'Juniper-PPPOE-MIB', 'juniPPPoESubIfIndex')) if mibBuilder.loadTexts: juniPPPoESubIfEntry.setStatus('current') juni_pp_po_e_sub_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1, 1), interface_index()) if mibBuilder.loadTexts: juniPPPoESubIfIndex.setStatus('current') juni_pp_po_e_sub_if_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1, 2), row_status()).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoESubIfRowStatus.setStatus('current') juni_pp_po_e_sub_if_lower_if_index = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1, 3), interface_index_or_zero()).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoESubIfLowerIfIndex.setStatus('current') juni_pp_po_e_sub_if_id = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1, 4), integer32().subtype(subtypeSpec=value_range_constraint(-1, 2147483647)).clone(-1)).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoESubIfId.setStatus('current') juni_pp_po_e_sub_if_session_id = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1, 5), integer32().subtype(subtypeSpec=value_range_constraint(0, 65535))).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoESubIfSessionId.setStatus('current') juni_pp_po_e_sub_if_motm = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1, 6), display_string().subtype(subtypeSpec=value_size_constraint(0, 127))).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoESubIfMotm.setStatus('current') juni_pp_po_e_sub_if_url = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 2, 2, 1, 7), display_string().subtype(subtypeSpec=value_size_constraint(0, 127))).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoESubIfUrl.setStatus('current') juni_pp_po_e_global_motm = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 3, 1), display_string().subtype(subtypeSpec=value_size_constraint(0, 127))).setMaxAccess('readwrite') if mibBuilder.loadTexts: juniPPPoEGlobalMotm.setStatus('current') juni_pp_po_e_service_name_table_next_index = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 1), unsigned32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEServiceNameTableNextIndex.setStatus('current') juni_pp_po_e_service_name_table_table = mib_table((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 2)) if mibBuilder.loadTexts: juniPPPoEServiceNameTableTable.setStatus('current') juni_pp_po_e_service_name_table_entry = mib_table_row((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 2, 1)).setIndexNames((0, 'Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableIndex')) if mibBuilder.loadTexts: juniPPPoEServiceNameTableEntry.setStatus('current') juni_pp_po_e_service_name_table_index = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 2, 1, 1), unsigned32()) if mibBuilder.loadTexts: juniPPPoEServiceNameTableIndex.setStatus('current') juni_pp_po_e_service_name_table_name = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 2, 1, 2), display_string().subtype(subtypeSpec=value_size_constraint(0, 31))).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEServiceNameTableName.setStatus('current') juni_pp_po_e_service_name_table_empty_action = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 2, 1, 3), juni_pp_po_e_service_name_action()).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEServiceNameTableEmptyAction.setStatus('current') juni_pp_po_e_service_name_table_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 2, 1, 4), row_status()).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEServiceNameTableRowStatus.setStatus('current') juni_pp_po_e_service_name_table_unknown_action = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 2, 1, 5), juni_pp_po_e_service_name_action()).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEServiceNameTableUnknownAction.setStatus('current') juni_pp_po_e_service_name_table = mib_table((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 3)) if mibBuilder.loadTexts: juniPPPoEServiceNameTable.setStatus('current') juni_pp_po_e_service_name_entry = mib_table_row((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 3, 1)).setIndexNames((0, 'Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableIndex'), (0, 'Juniper-PPPOE-MIB', 'juniPPPoEServiceName')) if mibBuilder.loadTexts: juniPPPoEServiceNameEntry.setStatus('current') juni_pp_po_e_service_name = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 3, 1, 1), display_string().subtype(subtypeSpec=value_size_constraint(0, 31))) if mibBuilder.loadTexts: juniPPPoEServiceName.setStatus('current') juni_pp_po_e_service_name_action = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 3, 1, 2), juni_pp_po_e_service_name_action()).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEServiceNameAction.setStatus('current') juni_pp_po_e_service_name_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 6, 3, 1, 3), row_status()).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEServiceNameRowStatus.setStatus('current') juni_pp_po_e_profile_table = mib_table((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 4, 1)) if mibBuilder.loadTexts: juniPPPoEProfileTable.setStatus('deprecated') juni_pp_po_e_profile_entry = mib_table_row((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 4, 1, 1)).setIndexNames((0, 'Juniper-PPPOE-MIB', 'juniPPPoEProfileIndex')) if mibBuilder.loadTexts: juniPPPoEProfileEntry.setStatus('deprecated') juni_pp_po_e_profile_index = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 4, 1, 1, 1), unsigned32()) if mibBuilder.loadTexts: juniPPPoEProfileIndex.setStatus('deprecated') juni_pp_po_e_profile_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 4, 1, 1, 2), row_status()).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEProfileRowStatus.setStatus('deprecated') juni_pp_po_e_profile_motm = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 4, 1, 1, 3), display_string().subtype(subtypeSpec=value_size_constraint(0, 127))).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEProfileMotm.setStatus('deprecated') juni_pp_po_e_profile_url = mib_table_column((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 4, 1, 1, 4), display_string().subtype(subtypeSpec=value_size_constraint(0, 127))).setMaxAccess('readcreate') if mibBuilder.loadTexts: juniPPPoEProfileUrl.setStatus('deprecated') juni_pp_po_e_major_interface_count = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 1), integer32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoEMajorInterfaceCount.setStatus('current') juni_pp_po_e_summary_major_if_admin_up = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 2), integer32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoESummaryMajorIfAdminUp.setStatus('current') juni_pp_po_e_summary_major_if_admin_down = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 3), integer32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoESummaryMajorIfAdminDown.setStatus('current') juni_pp_po_e_summary_major_if_oper_up = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 4), integer32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoESummaryMajorIfOperUp.setStatus('current') juni_pp_po_e_summary_major_if_oper_down = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 5), integer32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoESummaryMajorIfOperDown.setStatus('current') juni_pp_po_e_summary_major_if_lower_layer_down = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 6), integer32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoESummaryMajorIfLowerLayerDown.setStatus('current') juni_pp_po_e_summary_major_if_not_present = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 7), integer32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoESummaryMajorIfNotPresent.setStatus('current') juni_pp_po_e_summary_sub_interface_count = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 8), integer32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoESummarySubInterfaceCount.setStatus('current') juni_pp_po_e_summary_sub_if_admin_up = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 9), integer32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoESummarySubIfAdminUp.setStatus('current') juni_pp_po_e_summary_sub_if_admin_down = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 10), integer32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoESummarySubIfAdminDown.setStatus('current') juni_pp_po_e_summary_sub_if_oper_up = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 11), integer32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoESummarySubIfOperUp.setStatus('current') juni_pp_po_e_summary_sub_if_oper_down = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 12), integer32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoESummarySubIfOperDown.setStatus('current') juni_pp_po_e_summary_sub_if_lower_layer_down = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 13), integer32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoESummarySubIfLowerLayerDown.setStatus('current') juni_pp_po_e_summary_sub_if_not_present = mib_scalar((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 1, 5, 14), integer32()).setMaxAccess('readonly') if mibBuilder.loadTexts: juniPPPoESummarySubIfNotPresent.setStatus('current') juni_pp_po_e_conformance = mib_identifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4)) juni_pp_po_e_compliances = mib_identifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5)) juni_pp_po_e_groups = mib_identifier((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4)) juni_pp_po_e_compliance = module_compliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 1)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEGroup'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfGroup')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_compliance = juniPPPoECompliance.setStatus('obsolete') juni_pp_po_e_compliance2 = module_compliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 2)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEGroup2'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfGroup2'), ('Juniper-PPPOE-MIB', 'juniPPPoEProfileGroup')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_compliance2 = juniPPPoECompliance2.setStatus('obsolete') juni_pp_po_e_compliance3 = module_compliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 3)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEGroup2'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfGroup2'), ('Juniper-PPPOE-MIB', 'juniPPPoEProfileGroup'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryGroup')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_compliance3 = juniPPPoECompliance3.setStatus('obsolete') juni_pp_po_e_compliance4 = module_compliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 4)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEGroup2'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfGroup2'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryGroup')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_compliance4 = juniPPPoECompliance4.setStatus('obsolete') juni_pp_po_e_compliance5 = module_compliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 5)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEGroup3'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfGroup2'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryGroup')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_compliance5 = juniPPPoECompliance5.setStatus('obsolete') juni_pp_po_e_compliance6 = module_compliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 6)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEGroup4'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfGroup2'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryGroup')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_compliance6 = juniPPPoECompliance6.setStatus('obsolete') juni_pp_po_e_compliance7 = module_compliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 7)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEGroup5'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfGroup2'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryGroup')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_compliance7 = juniPPPoECompliance7.setStatus('obsolete') juni_pp_po_e_compliance8 = module_compliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 8)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEGroup6'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfGroup2'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryGroup'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableGroup')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_compliance8 = juniPPPoECompliance8.setStatus('obsolete') juni_pp_po_e_compliance9 = module_compliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 9)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEGroup7'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfGroup2'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryGroup'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableGroup')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_compliance9 = juniPPPoECompliance9.setStatus('obsolete') juni_pp_po_e_compliance10 = module_compliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 10)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEGroup8'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfGroup2'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryGroup'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableGroup')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_compliance10 = juniPPPoECompliance10.setStatus('obsolete') juni_pp_po_e_compliance11 = module_compliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 11)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEGroup9'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfGroup2'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryGroup'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableGroup'), ('Juniper-PPPOE-MIB', 'juniPPPoELockoutTableGroup')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_compliance11 = juniPPPoECompliance11.setStatus('obsolete') juni_pp_po_e_compliance12 = module_compliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 12)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEGroup10'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfGroup2'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryGroup'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableGroup'), ('Juniper-PPPOE-MIB', 'juniPPPoELockoutTableGroup')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_compliance12 = juniPPPoECompliance12.setStatus('obsolete') juni_pp_po_e_compliance13 = module_compliance((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 5, 13)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEGroup10'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfGroup2'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryGroup'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableGroup1'), ('Juniper-PPPOE-MIB', 'juniPPPoELockoutTableGroup')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_compliance13 = juniPPPoECompliance13.setStatus('current') juni_pp_po_e_group = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 1)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoENextIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfMaxNumSessions'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLowerIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADI'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADO'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADR'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADS'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvVersion'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvCode'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTags'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvSession'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTypes'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPackets'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInsufficientResources')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_group = juniPPPoEGroup.setStatus('obsolete') juni_pp_po_e_sub_if_group = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 2)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoESubIfNextIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfLowerIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfId'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfSessionId')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_sub_if_group = juniPPPoESubIfGroup.setStatus('obsolete') juni_pp_po_e_profile_group = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 3)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEProfileRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoEProfileUrl'), ('Juniper-PPPOE-MIB', 'juniPPPoEProfileMotm')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_profile_group = juniPPPoEProfileGroup.setStatus('deprecated') juni_pp_po_e_group2 = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 4)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoENextIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfMaxNumSessions'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLowerIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADI'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADO'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADR'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADS'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvVersion'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvCode'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTags'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvSession'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTypes'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPackets'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInsufficientResources'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADM'), ('Juniper-PPPOE-MIB', 'juniPPPoEGlobalMotm')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_group2 = juniPPPoEGroup2.setStatus('obsolete') juni_pp_po_e_sub_if_group2 = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 5)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoESubIfNextIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfLowerIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfId'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfSessionId'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfUrl'), ('Juniper-PPPOE-MIB', 'juniPPPoESubIfMotm')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_sub_if_group2 = juniPPPoESubIfGroup2.setStatus('current') juni_pp_po_e_summary_group = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 6)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEMajorInterfaceCount'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryMajorIfAdminUp'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryMajorIfAdminDown'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryMajorIfOperUp'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryMajorIfOperDown'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryMajorIfNotPresent'), ('Juniper-PPPOE-MIB', 'juniPPPoESummaryMajorIfLowerLayerDown'), ('Juniper-PPPOE-MIB', 'juniPPPoESummarySubInterfaceCount'), ('Juniper-PPPOE-MIB', 'juniPPPoESummarySubIfAdminUp'), ('Juniper-PPPOE-MIB', 'juniPPPoESummarySubIfAdminDown'), ('Juniper-PPPOE-MIB', 'juniPPPoESummarySubIfOperUp'), ('Juniper-PPPOE-MIB', 'juniPPPoESummarySubIfOperDown'), ('Juniper-PPPOE-MIB', 'juniPPPoESummarySubIfNotPresent'), ('Juniper-PPPOE-MIB', 'juniPPPoESummarySubIfLowerLayerDown')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_summary_group = juniPPPoESummaryGroup.setStatus('current') juni_pp_po_e_group3 = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 7)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoENextIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfMaxNumSessions'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLowerIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfAcName'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfDupProtect'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADI'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADO'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADR'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADS'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvVersion'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvCode'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTags'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvSession'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTypes'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPackets'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInsufficientResources'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADM'), ('Juniper-PPPOE-MIB', 'juniPPPoEGlobalMotm')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_group3 = juniPPPoEGroup3.setStatus('obsolete') juni_pp_po_e_group4 = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 8)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoENextIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfMaxNumSessions'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLowerIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfAcName'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfDupProtect'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfPADIFlag'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfAutoconfig'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADI'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADO'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADR'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADS'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvVersion'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvCode'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTags'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvSession'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTypes'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPackets'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInsufficientResources'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADM'), ('Juniper-PPPOE-MIB', 'juniPPPoEGlobalMotm')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_group4 = juniPPPoEGroup4.setStatus('obsolete') juni_pp_po_e_group5 = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 9)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoENextIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfMaxNumSessions'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLowerIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfAcName'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfDupProtect'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfPADIFlag'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfAutoconfig'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADI'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADO'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADR'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADS'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvVersion'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvCode'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTags'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvSession'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTypes'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPackets'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInsufficientResources'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADM'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADN'), ('Juniper-PPPOE-MIB', 'juniPPPoEGlobalMotm')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_group5 = juniPPPoEGroup5.setStatus('obsolete') juni_pp_po_e_group6 = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 10)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoENextIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfMaxNumSessions'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLowerIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfAcName'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfDupProtect'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfPADIFlag'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfAutoconfig'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfServiceNameTable'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADI'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADO'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADR'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADS'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvVersion'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvCode'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTags'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTagLength'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvLength'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTypes'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPackets'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInsufficientResources'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADM'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADN'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPadISession'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPadRSession'), ('Juniper-PPPOE-MIB', 'juniPPPoEGlobalMotm')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_group6 = juniPPPoEGroup6.setStatus('obsolete') juni_pp_po_e_service_name_table_group = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 11)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableNextIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableName'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableEmptyAction'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameAction'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameRowStatus')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_service_name_table_group = juniPPPoEServiceNameTableGroup.setStatus('obsolete') juni_pp_po_e_group7 = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 12)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoENextIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfMaxNumSessions'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLowerIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfAcName'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfDupProtect'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfPADIFlag'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfAutoconfig'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfServiceNameTable'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfPadrRemoteCircuitIdCapture'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADI'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADO'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADR'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADS'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvVersion'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvCode'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTags'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTagLength'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvLength'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTypes'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPackets'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInsufficientResources'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADM'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADN'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPadISession'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPadRSession'), ('Juniper-PPPOE-MIB', 'juniPPPoEGlobalMotm')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_group7 = juniPPPoEGroup7.setStatus('obsolete') juni_pp_po_e_group8 = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 13)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoENextIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfMaxNumSessions'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLowerIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfAcName'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfDupProtect'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfPADIFlag'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfAutoconfig'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfServiceNameTable'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfPadrRemoteCircuitIdCapture'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfMtu'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADI'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADO'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADR'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADS'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvVersion'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvCode'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTags'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTagLength'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvLength'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTypes'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPackets'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInsufficientResources'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADM'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADN'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPadISession'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPadRSession'), ('Juniper-PPPOE-MIB', 'juniPPPoEGlobalMotm')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_group8 = juniPPPoEGroup8.setStatus('current') juni_pp_po_e_lockout_table_group = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 14)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEIfLockoutTime'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLockoutElapsedTime'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLockoutNextTime')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_lockout_table_group = juniPPPoELockoutTableGroup.setStatus('current') juni_pp_po_e_group9 = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 15)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoENextIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfMaxNumSessions'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLowerIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfAcName'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfDupProtect'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfPADIFlag'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfAutoconfig'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfServiceNameTable'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfPadrRemoteCircuitIdCapture'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfMtu'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLockoutMin'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLockoutMax'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADI'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADO'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADR'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADS'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvVersion'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvCode'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTags'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTagLength'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvLength'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTypes'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPackets'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInsufficientResources'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADM'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADN'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPadISession'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPadRSession'), ('Juniper-PPPOE-MIB', 'juniPPPoEGlobalMotm')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_group9 = juniPPPoEGroup9.setStatus('obsolete') juni_pp_po_e_group10 = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 16)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoENextIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfMaxNumSessions'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLowerIfIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfAcName'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfDupProtect'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfPADIFlag'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfAutoconfig'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfServiceNameTable'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfPadrRemoteCircuitIdCapture'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfMtu'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLockoutMin'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfLockoutMax'), ('Juniper-PPPOE-MIB', 'juniPPPoEMaxSessionVsa'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADI'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADO'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADR'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADS'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADT'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvVersion'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvCode'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTags'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTagLength'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvLength'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvTypes'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPackets'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInsufficientResources'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADM'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsTxPADN'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPadISession'), ('Juniper-PPPOE-MIB', 'juniPPPoEIfStatsRxInvPadRSession'), ('Juniper-PPPOE-MIB', 'juniPPPoEGlobalMotm')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_group10 = juniPPPoEGroup10.setStatus('current') juni_pp_po_e_service_name_table_group1 = object_group((1, 3, 6, 1, 4, 1, 4874, 2, 2, 18, 4, 4, 17)).setObjects(('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableNextIndex'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableName'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableEmptyAction'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameAction'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameRowStatus'), ('Juniper-PPPOE-MIB', 'juniPPPoEServiceNameTableUnknownAction')) if getattr(mibBuilder, 'version', (0, 0, 0)) > (4, 4, 0): juni_pp_po_e_service_name_table_group1 = juniPPPoEServiceNameTableGroup1.setStatus('current') mibBuilder.exportSymbols('Juniper-PPPOE-MIB', juniPPPoESummaryMajorIfAdminDown=juniPPPoESummaryMajorIfAdminDown, juniPPPoESubIfUrl=juniPPPoESubIfUrl, juniPPPoEIfStatsTxPADT=juniPPPoEIfStatsTxPADT, juniPPPoESubIfSessionId=juniPPPoESubIfSessionId, juniPPPoEIfLowerIfIndex=juniPPPoEIfLowerIfIndex, juniPPPoESummaryMajorIfOperDown=juniPPPoESummaryMajorIfOperDown, juniPPPoEServiceNameTableIndex=juniPPPoEServiceNameTableIndex, juniPPPoECompliance4=juniPPPoECompliance4, juniPPPoEIfStatsTxPADM=juniPPPoEIfStatsTxPADM, juniPPPoEIfLockoutElapsedTime=juniPPPoEIfLockoutElapsedTime, juniPPPoESubIfMotm=juniPPPoESubIfMotm, juniPPPoEIfStatsTxPADO=juniPPPoEIfStatsTxPADO, juniPPPoESummarySubIfLowerLayerDown=juniPPPoESummarySubIfLowerLayerDown, juniPPPoEIfStatsRxInvPadRSession=juniPPPoEIfStatsRxInvPadRSession, juniPPPoEIfAutoconfig=juniPPPoEIfAutoconfig, juniPPPoECompliance8=juniPPPoECompliance8, juniPPPoEIfPADIFlag=juniPPPoEIfPADIFlag, juniPPPoESummarySubInterfaceCount=juniPPPoESummarySubInterfaceCount, juniPPPoEIfStatsRxInvCode=juniPPPoEIfStatsRxInvCode, juniPPPoENextIfIndex=juniPPPoENextIfIndex, juniPPPoEObjects=juniPPPoEObjects, juniPPPoEIfStatsTable=juniPPPoEIfStatsTable, juniPPPoECompliance3=juniPPPoECompliance3, juniPPPoEServices=juniPPPoEServices, juniPPPoEIfLockoutTable=juniPPPoEIfLockoutTable, JuniPPPoEServiceNameAction=JuniPPPoEServiceNameAction, juniPPPoEMIB=juniPPPoEMIB, juniPPPoEServiceNameEntry=juniPPPoEServiceNameEntry, juniPPPoESubIfEntry=juniPPPoESubIfEntry, juniPPPoESubIfTable=juniPPPoESubIfTable, juniPPPoEGroup3=juniPPPoEGroup3, juniPPPoEGlobal=juniPPPoEGlobal, juniPPPoEGroup8=juniPPPoEGroup8, juniPPPoEServiceNameAction=juniPPPoEServiceNameAction, juniPPPoEServiceNameTableEmptyAction=juniPPPoEServiceNameTableEmptyAction, juniPPPoEServiceNameTableUnknownAction=juniPPPoEServiceNameTableUnknownAction, juniPPPoEIfIfIndex=juniPPPoEIfIfIndex, juniPPPoEProfileGroup=juniPPPoEProfileGroup, juniPPPoELockoutTableGroup=juniPPPoELockoutTableGroup, juniPPPoECompliance11=juniPPPoECompliance11, juniPPPoEIfMaxNumSessions=juniPPPoEIfMaxNumSessions, juniPPPoECompliance12=juniPPPoECompliance12, juniPPPoEIfStatsRxInvLength=juniPPPoEIfStatsRxInvLength, juniPPPoEServiceNameTable=juniPPPoEServiceNameTable, juniPPPoEGroup5=juniPPPoEGroup5, juniPPPoEIfLockoutMax=juniPPPoEIfLockoutMax, juniPPPoEServiceNameTableGroup1=juniPPPoEServiceNameTableGroup1, juniPPPoEGroup9=juniPPPoEGroup9, juniPPPoEProfileEntry=juniPPPoEProfileEntry, juniPPPoEIfStatsRxInvPadISession=juniPPPoEIfStatsRxInvPadISession, juniPPPoEProfileIndex=juniPPPoEProfileIndex, juniPPPoEServiceNameTableGroup=juniPPPoEServiceNameTableGroup, juniPPPoESummaryGroup=juniPPPoESummaryGroup, juniPPPoEIfLayer=juniPPPoEIfLayer, juniPPPoEIfStatsRxInsufficientResources=juniPPPoEIfStatsRxInsufficientResources, juniPPPoEIfStatsRxPADR=juniPPPoEIfStatsRxPADR, juniPPPoEIfDupProtect=juniPPPoEIfDupProtect, juniPPPoEIfStatsRxInvVersion=juniPPPoEIfStatsRxInvVersion, juniPPPoEProfile=juniPPPoEProfile, juniPPPoEIfStatsTxPADN=juniPPPoEIfStatsTxPADN, juniPPPoESummarySubIfAdminUp=juniPPPoESummarySubIfAdminUp, juniPPPoEIfTable=juniPPPoEIfTable, juniPPPoESummary=juniPPPoESummary, juniPPPoESubIfLayer=juniPPPoESubIfLayer, juniPPPoEIfLockoutTime=juniPPPoEIfLockoutTime, juniPPPoEIfLockoutClientAddress=juniPPPoEIfLockoutClientAddress, juniPPPoEGroup10=juniPPPoEGroup10, juniPPPoEProfileTable=juniPPPoEProfileTable, juniPPPoEIfLockoutNextTime=juniPPPoEIfLockoutNextTime, juniPPPoEProfileUrl=juniPPPoEProfileUrl, juniPPPoESubIfRowStatus=juniPPPoESubIfRowStatus, juniPPPoESubIfGroup=juniPPPoESubIfGroup, juniPPPoESummaryMajorIfAdminUp=juniPPPoESummaryMajorIfAdminUp, juniPPPoEGroup2=juniPPPoEGroup2, juniPPPoEServiceNameTableEntry=juniPPPoEServiceNameTableEntry, juniPPPoEGroup6=juniPPPoEGroup6, juniPPPoECompliance9=juniPPPoECompliance9, juniPPPoESubIfGroup2=juniPPPoESubIfGroup2, juniPPPoEIfServiceNameTable=juniPPPoEIfServiceNameTable, juniPPPoESubIfLowerIfIndex=juniPPPoESubIfLowerIfIndex, juniPPPoEIfStatsEntry=juniPPPoEIfStatsEntry, juniPPPoEIfStatsRxInvTags=juniPPPoEIfStatsRxInvTags, juniPPPoEServiceName=juniPPPoEServiceName, juniPPPoEMaxSessionVsa=juniPPPoEMaxSessionVsa, juniPPPoEProfileMotm=juniPPPoEProfileMotm, juniPPPoEGlobalMotm=juniPPPoEGlobalMotm, juniPPPoESubIfNextIfIndex=juniPPPoESubIfNextIfIndex, juniPPPoECompliance5=juniPPPoECompliance5, juniPPPoEServiceNameRowStatus=juniPPPoEServiceNameRowStatus, juniPPPoEIfStatsRxPADI=juniPPPoEIfStatsRxPADI, juniPPPoEGroup7=juniPPPoEGroup7, juniPPPoECompliance2=juniPPPoECompliance2, juniPPPoESubIfIndex=juniPPPoESubIfIndex, juniPPPoEServiceNameTableRowStatus=juniPPPoEServiceNameTableRowStatus, juniPPPoEIfStatsRxInvPackets=juniPPPoEIfStatsRxInvPackets, juniPPPoESummaryMajorIfOperUp=juniPPPoESummaryMajorIfOperUp, juniPPPoESummarySubIfAdminDown=juniPPPoESummarySubIfAdminDown, juniPPPoEIfAcName=juniPPPoEIfAcName, juniPPPoEGroups=juniPPPoEGroups, PYSNMP_MODULE_ID=juniPPPoEMIB, juniPPPoEIfEntry=juniPPPoEIfEntry, juniPPPoESummarySubIfOperUp=juniPPPoESummarySubIfOperUp, juniPPPoECompliances=juniPPPoECompliances, juniPPPoEIfMtu=juniPPPoEIfMtu, juniPPPoEServiceNameTableName=juniPPPoEServiceNameTableName, juniPPPoESummaryMajorIfLowerLayerDown=juniPPPoESummaryMajorIfLowerLayerDown, juniPPPoEServiceNameTableTable=juniPPPoEServiceNameTableTable, juniPPPoEIfLockoutMin=juniPPPoEIfLockoutMin, juniPPPoEConformance=juniPPPoEConformance, juniPPPoEProfileRowStatus=juniPPPoEProfileRowStatus, juniPPPoEServiceNameTableNextIndex=juniPPPoEServiceNameTableNextIndex, juniPPPoESubIfId=juniPPPoESubIfId, juniPPPoEGroup4=juniPPPoEGroup4, juniPPPoESummarySubIfNotPresent=juniPPPoESummarySubIfNotPresent, juniPPPoECompliance6=juniPPPoECompliance6, juniPPPoECompliance13=juniPPPoECompliance13, juniPPPoEIfStatsRxInvTagLength=juniPPPoEIfStatsRxInvTagLength, juniPPPoEIfStatsTxPADS=juniPPPoEIfStatsTxPADS, juniPPPoESummaryMajorIfNotPresent=juniPPPoESummaryMajorIfNotPresent, juniPPPoECompliance7=juniPPPoECompliance7, juniPPPoEIfPadrRemoteCircuitIdCapture=juniPPPoEIfPadrRemoteCircuitIdCapture, juniPPPoEIfStatsRxInvSession=juniPPPoEIfStatsRxInvSession, juniPPPoECompliance10=juniPPPoECompliance10, juniPPPoEMajorInterfaceCount=juniPPPoEMajorInterfaceCount, juniPPPoEIfStatsRxInvTypes=juniPPPoEIfStatsRxInvTypes, juniPPPoESummarySubIfOperDown=juniPPPoESummarySubIfOperDown, juniPPPoEIfRowStatus=juniPPPoEIfRowStatus, juniPPPoEIfLockoutEntry=juniPPPoEIfLockoutEntry, juniPPPoEIfStatsRxPADT=juniPPPoEIfStatsRxPADT, juniPPPoECompliance=juniPPPoECompliance, juniPPPoEGroup=juniPPPoEGroup)
n=int(input()) s=[str(input()) for a in range(n)] for i in range(n): c=0 for j in range(len(s[i])): if s[i][j] == "W": for k in range(max(0,j-2),min(len(s[i]),j+2)): if s[i][k]=="B": c+=1 break print(c)
n = int(input()) s = [str(input()) for a in range(n)] for i in range(n): c = 0 for j in range(len(s[i])): if s[i][j] == 'W': for k in range(max(0, j - 2), min(len(s[i]), j + 2)): if s[i][k] == 'B': c += 1 break print(c)
t = int(input()) for _ in range(t): n = int(input()) l1 = set(list(map(int,input().split()))) l2 = set(list(map(int,input().split()))) if l1==l2: print(1) else: print(0)
t = int(input()) for _ in range(t): n = int(input()) l1 = set(list(map(int, input().split()))) l2 = set(list(map(int, input().split()))) if l1 == l2: print(1) else: print(0)
#/* *** ODSATag: Sequential *** */ # Return the position of an element in a list. # If the element is not found, return -1. def sequentialSearch(elements, e): for i in range(len(elements)): # For each element if elements[i] == e: # if we found it return i # return this position return -1 # Otherwise, return -1 #/* *** ODSAendTag: Sequential *** */ if __name__ == '__main__': arr = [2, 3, 4, 5, 7, 10] print(arr) for key in [4, 6, 10]: pos = sequentialSearch(arr, key) print(f"Search for {key} --> position {pos}")
def sequential_search(elements, e): for i in range(len(elements)): if elements[i] == e: return i return -1 if __name__ == '__main__': arr = [2, 3, 4, 5, 7, 10] print(arr) for key in [4, 6, 10]: pos = sequential_search(arr, key) print(f'Search for {key} --> position {pos}')
############################################################################## # 01: Is Unique? ############################################################################## def caseAndSpaceTreat(inputString, caseSensitive=True, spaces=True): ''' Returns a lowercase string if case insensitive, and removes spaces if necessary ''' # String pre-treatment if caseSensitive == False: inputString = inputString.lower() if spaces == False: inputString = inputString.replace(" ", "") return inputString def isUnique_Set(inputString, caseSensitive=True, spaces=True): ''' Returns true, if all the characters in the input string are unique. This function uses an additional structure (set) to store the unique characters already used. ''' inputString = caseAndSpaceTreat(inputString,caseSensitive,spaces) lettersSet = {inputString[0]} allUnique = True for i in range(1, len(inputString)): letter = inputString[i] if(letter not in lettersSet): lettersSet.add(letter) else: allUnique = False break return(allUnique) def isUnique_NoStructs(inputString, caseSensitive=True, spaces=True): ''' Returns true, if all the characters in the input string are unique. This function does not use any additional structures. It goes through the string element by element, checking for matches. ''' inputString = caseAndSpaceTreat(inputString,caseSensitive,spaces) allUnique = True for i in range(0, len(inputString)): for j in range(i + 1, len(inputString)): if inputString[i] == inputString[j]: allUnique = False break if (allUnique is False): break return(allUnique) ############################################################################## # Test and Debug ############################################################################## if __name__ == '__main__': inputString = "aAbcdez xy" case = True spaces = False uniqueA = isUnique_Set(inputString, caseSensitive=case, spaces=spaces) uniqueB = isUnique_NoStructs(inputString, caseSensitive=case, spaces=spaces) print( "Sets: " + str(uniqueA) + "\n" + "NoStruct: " + str(uniqueB) + "\n" + "\n" "Match: " + str(uniqueA == uniqueB) )
def case_and_space_treat(inputString, caseSensitive=True, spaces=True): """ Returns a lowercase string if case insensitive, and removes spaces if necessary """ if caseSensitive == False: input_string = inputString.lower() if spaces == False: input_string = inputString.replace(' ', '') return inputString def is_unique__set(inputString, caseSensitive=True, spaces=True): """ Returns true, if all the characters in the input string are unique. This function uses an additional structure (set) to store the unique characters already used. """ input_string = case_and_space_treat(inputString, caseSensitive, spaces) letters_set = {inputString[0]} all_unique = True for i in range(1, len(inputString)): letter = inputString[i] if letter not in lettersSet: lettersSet.add(letter) else: all_unique = False break return allUnique def is_unique__no_structs(inputString, caseSensitive=True, spaces=True): """ Returns true, if all the characters in the input string are unique. This function does not use any additional structures. It goes through the string element by element, checking for matches. """ input_string = case_and_space_treat(inputString, caseSensitive, spaces) all_unique = True for i in range(0, len(inputString)): for j in range(i + 1, len(inputString)): if inputString[i] == inputString[j]: all_unique = False break if allUnique is False: break return allUnique if __name__ == '__main__': input_string = 'aAbcdez xy' case = True spaces = False unique_a = is_unique__set(inputString, caseSensitive=case, spaces=spaces) unique_b = is_unique__no_structs(inputString, caseSensitive=case, spaces=spaces) print('Sets: ' + str(uniqueA) + '\n' + 'NoStruct: ' + str(uniqueB) + '\n' + '\nMatch: ' + str(uniqueA == uniqueB))
d = 3255 f = d // 15-17 z = d // (f*5) d = d % (z+1) print("d = ", d)
d = 3255 f = d // 15 - 17 z = d // (f * 5) d = d % (z + 1) print('d = ', d)
message = "o" def scope(): global message message = "p" scope() print(message)
message = 'o' def scope(): global message message = 'p' scope() print(message)
# This file is part of the faebryk project # SPDX-License-Identifier: MIT class lazy: def __init__(self, expr): self.expr = expr def __str__(self): return str(self.expr()) def __repr__(self): return repr(self.expr()) def kw2dict(**kw): return dict(kw) class hashable_dict: def __init__(self, obj: dict): self.obj = obj def __hash__(self): return hash(sum(map(hash, self.obj.items()))) def __repr__(self): return "{}({})".format(type(self), repr(self.obj)) def __eq__(self, other): return hash(self) == hash(other)
class Lazy: def __init__(self, expr): self.expr = expr def __str__(self): return str(self.expr()) def __repr__(self): return repr(self.expr()) def kw2dict(**kw): return dict(kw) class Hashable_Dict: def __init__(self, obj: dict): self.obj = obj def __hash__(self): return hash(sum(map(hash, self.obj.items()))) def __repr__(self): return '{}({})'.format(type(self), repr(self.obj)) def __eq__(self, other): return hash(self) == hash(other)
def Sum_Divisors(x): s = 0 for i in range(1,(x // 2) + 1): if x % i == 0: s += i return s def Amicable(x,y): if x!=y: if Sum_Divisors(x) == y and Sum_Divisors(y) == x : return True return False def Sum_Amicable(): l=[] for i in range(284,10000): if Amicable(i,Sum_Divisors(i)): if i not in l: l.append(i) if Sum_Divisors(i) not in l: l.append(Sum_Divisors(i)) print(sum(l)) Sum_Amicable()
def sum__divisors(x): s = 0 for i in range(1, x // 2 + 1): if x % i == 0: s += i return s def amicable(x, y): if x != y: if sum__divisors(x) == y and sum__divisors(y) == x: return True return False def sum__amicable(): l = [] for i in range(284, 10000): if amicable(i, sum__divisors(i)): if i not in l: l.append(i) if sum__divisors(i) not in l: l.append(sum__divisors(i)) print(sum(l)) sum__amicable()
def is_odd(n): '''Return True if the number is odd and False otherwise.''' if n % 2 != 0: odd = True else: odd = False return odd def main(): '''Define main function.''' # Prompt the user for a number number = float(input('Please enter a number: ')) # Determine whether the number is even print(is_odd(number)) # Call main function main()
def is_odd(n): """Return True if the number is odd and False otherwise.""" if n % 2 != 0: odd = True else: odd = False return odd def main(): """Define main function.""" number = float(input('Please enter a number: ')) print(is_odd(number)) main()
def ans(x): if len(x) == 2 or len(x) == 10: return False return True
def ans(x): if len(x) == 2 or len(x) == 10: return False return True
# Autogenerated config.py # Documentation: # qute://help/configuring.html # qute://help/settings.html # Uncomment this to still load settings configured via autoconfig.yml config.load_autoconfig() config.source('colors_qutebrowser.py')
config.load_autoconfig() config.source('colors_qutebrowser.py')
L, R = map(int, input().split()) L -= 1 R -= 1 S = input() print(S[:L] + ''.join(reversed(S[L:R+1])) + S[R+1:len(S)])
(l, r) = map(int, input().split()) l -= 1 r -= 1 s = input() print(S[:L] + ''.join(reversed(S[L:R + 1])) + S[R + 1:len(S)])
# https://codeforces.com/problemset/problem/339/A s = [x for x in input().split("+")] if len(s) == 1: print(s[0]) else: s.sort() print("+".join(s))
s = [x for x in input().split('+')] if len(s) == 1: print(s[0]) else: s.sort() print('+'.join(s))
GIT_BRANCH_MASTER = "master" GIT_BRANCH_MAIN = "main" GITHUB_PUBLIC_DOMAIN_NAME = "github.com" KNOWN_DEFAULT_BRANCHES = (GIT_BRANCH_MASTER, GIT_BRANCH_MAIN)
git_branch_master = 'master' git_branch_main = 'main' github_public_domain_name = 'github.com' known_default_branches = (GIT_BRANCH_MASTER, GIT_BRANCH_MAIN)
# # PySNMP MIB module AC-V5-MIB (http://snmplabs.com/pysmi) # ASN.1 source file:///Users/davwang4/Dev/mibs.snmplabs.com/asn1/AC-V5-MIB # Produced by pysmi-0.3.4 at Mon Apr 29 16:54:49 2019 # On host DAVWANG4-M-1475 platform Darwin version 18.5.0 by user davwang4 # Using Python version 3.7.3 (default, Mar 27 2019, 09:23:15) # ObjectIdentifier, Integer, OctetString = mibBuilder.importSymbols("ASN1", "ObjectIdentifier", "Integer", "OctetString") NamedValues, = mibBuilder.importSymbols("ASN1-ENUMERATION", "NamedValues") ValueRangeConstraint, ConstraintsUnion, SingleValueConstraint, ValueSizeConstraint, ConstraintsIntersection = mibBuilder.importSymbols("ASN1-REFINEMENT", "ValueRangeConstraint", "ConstraintsUnion", "SingleValueConstraint", "ValueSizeConstraint", "ConstraintsIntersection") acProducts, acRegistrations, audioCodes, acGeneric, acBoardMibs = mibBuilder.importSymbols("AUDIOCODES-TYPES-MIB", "acProducts", "acRegistrations", "audioCodes", "acGeneric", "acBoardMibs") InetAddressType, InetAddress = mibBuilder.importSymbols("INET-ADDRESS-MIB", "InetAddressType", "InetAddress") SnmpAdminString, = mibBuilder.importSymbols("SNMP-FRAMEWORK-MIB", "SnmpAdminString") ModuleCompliance, ObjectGroup, NotificationGroup = mibBuilder.importSymbols("SNMPv2-CONF", "ModuleCompliance", "ObjectGroup", "NotificationGroup") IpAddress, TimeTicks, Bits, MibScalar, MibTable, MibTableRow, MibTableColumn, ObjectIdentity, ModuleIdentity, enterprises, MibIdentifier, Unsigned32, Counter32, NotificationType, iso, Counter64, Gauge32, Integer32 = mibBuilder.importSymbols("SNMPv2-SMI", "IpAddress", "TimeTicks", "Bits", "MibScalar", "MibTable", "MibTableRow", "MibTableColumn", "ObjectIdentity", "ModuleIdentity", "enterprises", "MibIdentifier", "Unsigned32", "Counter32", "NotificationType", "iso", "Counter64", "Gauge32", "Integer32") DisplayString, RowStatus, TextualConvention, TAddress, DateAndTime = mibBuilder.importSymbols("SNMPv2-TC", "DisplayString", "RowStatus", "TextualConvention", "TAddress", "DateAndTime") acV5 = ModuleIdentity((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13)) if mibBuilder.loadTexts: acV5.setLastUpdated('200911251109Z') if mibBuilder.loadTexts: acV5.setOrganization('AudioCodes Ltd') acV5Configuration = MibIdentifier((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1)) acv5Interfce = MibIdentifier((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1)) acV5InterfceTable = MibTable((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1), ) if mibBuilder.loadTexts: acV5InterfceTable.setStatus('current') acV5InterfceEntry = MibTableRow((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1), ).setIndexNames((0, "AC-V5-MIB", "acV5InterfceIndex")) if mibBuilder.loadTexts: acV5InterfceEntry.setStatus('current') acV5InterfceIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 30))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceIndex.setStatus('current') acV5InterfceRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 2), RowStatus()).setMaxAccess("readcreate") if mibBuilder.loadTexts: acV5InterfceRowStatus.setStatus('current') acV5InterfceAction = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 3), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("offline", 0), ("protectionSwitchOver", 1), ("inService", 2)))).setMaxAccess("readcreate") if mibBuilder.loadTexts: acV5InterfceAction.setStatus('current') acV5InterfceActionResult = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("succeeded", 0), ("inProgress", 1), ("failed", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceActionResult.setStatus('current') acV5InterfceOperationalState = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 5), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("offline", 0), ("busy", 1), ("inService", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceOperationalState.setStatus('current') acV5InterfceAdminState = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 6), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 2))).clone(namedValues=NamedValues(("offline", 0), ("inService", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceAdminState.setStatus('current') acV5InterfceActiveSignalingLink = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 7), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(-1, 0, 1))).clone(namedValues=NamedValues(("notConfigured", -1), ("primary", 0), ("secondary", 1)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceActiveSignalingLink.setStatus('current') acV5InterfceIdNotEqual = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 8), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("cleared", 0), ("raised", 1), ("unknown", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceIdNotEqual.setStatus('current') acV5InterfceVariantNotEqual = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 9), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("cleared", 0), ("raised", 1), ("unknown", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceVariantNotEqual.setStatus('current') acV5InterfceIDCheckTimeOutError = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 10), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("cleared", 0), ("raised", 1), ("unknown", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceIDCheckTimeOutError.setStatus('current') acV5InterfceL2StartupFailed = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 11), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("cleared", 0), ("raised", 1), ("unknown", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceL2StartupFailed.setStatus('current') acV5InterfceRestartFailed = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 12), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("cleared", 0), ("raised", 1), ("unknown", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceRestartFailed.setStatus('current') acV5InterfceControlProtocolDataLinkError = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 13), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("cleared", 0), ("raised", 1), ("unknown", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceControlProtocolDataLinkError.setStatus('current') acV5InterfceLinkControlProtocolDataLinkError = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 14), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("cleared", 0), ("raised", 1), ("unknown", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceLinkControlProtocolDataLinkError.setStatus('current') acV5InterfceBCCProtocolDataLinkError = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 15), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("cleared", 0), ("raised", 1), ("unknown", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceBCCProtocolDataLinkError.setStatus('current') acV5InterfcePSTNProtocolDataLinkError = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 16), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("cleared", 0), ("raised", 1), ("unknown", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfcePSTNProtocolDataLinkError.setStatus('current') acV5InterfceProtectionDL1Error = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 17), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("cleared", 0), ("raised", 1), ("unknown", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceProtectionDL1Error.setStatus('current') acV5InterfceProtectionDL2Error = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 18), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("cleared", 0), ("raised", 1), ("unknown", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceProtectionDL2Error.setStatus('current') acV5InterfceType = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 19), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(1))).clone(namedValues=NamedValues(("v52", 1)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceType.setStatus('current') acV5InterfceProtocolSide = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 20), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1))).clone(namedValues=NamedValues(("an-Side", 0), ("le-Side", 1)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5InterfceProtocolSide.setStatus('current') acV5InterfceId = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 21), Integer32().subtype(subtypeSpec=ValueRangeConstraint(-1, 16777215))).setMaxAccess("readcreate") if mibBuilder.loadTexts: acV5InterfceId.setStatus('current') acV5InterfceVariantId = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 22), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 127))).setMaxAccess("readcreate") if mibBuilder.loadTexts: acV5InterfceVariantId.setStatus('current') acV5InterfceLogicalCchannelId = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 23), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 65535))).setMaxAccess("readcreate") if mibBuilder.loadTexts: acV5InterfceLogicalCchannelId.setStatus('current') acV5InterfceTraceLevel = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 24), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 20, 21, 22, 23))).clone(namedValues=NamedValues(("noTrace", 0), ("full-Trace-No-Duplication", 20), ("full-Trace-With-Duplication", 21), ("layer3-Up-Trace-No-Duplication", 22), ("layer3-Up-Trace-With-Duplication", 23)))).setMaxAccess("readcreate") if mibBuilder.loadTexts: acV5InterfceTraceLevel.setStatus('current') acV5InterfceNumberOfPortsInCard = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 25), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 65533))).setMaxAccess("readcreate") if mibBuilder.loadTexts: acV5InterfceNumberOfPortsInCard.setStatus('current') acV5InterfceEnableRegisterRecallConfiguration = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 26), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1))).clone(namedValues=NamedValues(("disable", 0), ("enable", 1)))).setMaxAccess("readcreate") if mibBuilder.loadTexts: acV5InterfceEnableRegisterRecallConfiguration.setStatus('current') acV5InterfceRegisterRecallDurationType = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 27), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 65535))).setMaxAccess("readcreate") if mibBuilder.loadTexts: acV5InterfceRegisterRecallDurationType.setStatus('current') acV5Link = MibIdentifier((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2)) acV5LinkTable = MibTable((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1), ) if mibBuilder.loadTexts: acV5LinkTable.setStatus('current') acV5LinkEntry = MibTableRow((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1), ).setIndexNames((0, "AC-V5-MIB", "acV5LinkIndex")) if mibBuilder.loadTexts: acV5LinkEntry.setStatus('current') acV5LinkIndex = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 1), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 62))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5LinkIndex.setStatus('current') acV5LinkRowStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 2), RowStatus()).setMaxAccess("readcreate") if mibBuilder.loadTexts: acV5LinkRowStatus.setStatus('current') acV5LinkAction = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 3), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("unBlock", 0), ("block", 1), ("linkIdCheck", 2)))).setMaxAccess("readcreate") if mibBuilder.loadTexts: acV5LinkAction.setStatus('current') acV5LinkActionResult = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 4), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("succeeded", 0), ("inProgress", 1), ("failed", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5LinkActionResult.setStatus('current') acV5LinkIdCheckStatus = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 5), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("succes", 0), ("failure", 1), ("testRejected", 2)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5LinkIdCheckStatus.setStatus('current') acV5LinkOperationalState = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 6), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2, 3))).clone(namedValues=NamedValues(("operational", 0), ("blocked", 1), ("failed", 2), ("blockedAndFailed", 3)))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5LinkOperationalState.setStatus('current') acV5LinkInterfaceIndx = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 7), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 30))).setMaxAccess("readcreate") if mibBuilder.loadTexts: acV5LinkInterfaceIndx.setStatus('current') acV5LinkId = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 8), Integer32().subtype(subtypeSpec=ValueRangeConstraint(-1, 16777215))).setMaxAccess("readcreate") if mibBuilder.loadTexts: acV5LinkId.setStatus('current') acV5LinkType = MibTableColumn((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 9), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2))).clone(namedValues=NamedValues(("normal", 0), ("primary", 1), ("secondary", 2)))).setMaxAccess("readcreate") if mibBuilder.loadTexts: acV5LinkType.setStatus('current') acV5Action = MibIdentifier((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 3)) acV5PortAction = MibIdentifier((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 3, 1)) acV5PortActionType = MibScalar((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 3, 1, 1), Integer32().subtype(subtypeSpec=ConstraintsUnion(SingleValueConstraint(0, 1, 2, 10))).clone(namedValues=NamedValues(("none", 0), ("removeAllPorts", 1), ("removeIFPorts", 2), ("actionDone", 10)))).setMaxAccess("readwrite") if mibBuilder.loadTexts: acV5PortActionType.setStatus('current') acV5PortActionID = MibScalar((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 3, 1, 2), Unsigned32().subtype(subtypeSpec=ValueRangeConstraint(0, 4294967295))).setMaxAccess("readwrite") if mibBuilder.loadTexts: acV5PortActionID.setStatus('current') acV5PortActionParams = MibScalar((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 3, 1, 3), SnmpAdminString().subtype(subtypeSpec=ValueSizeConstraint(0, 200))).setMaxAccess("readwrite") if mibBuilder.loadTexts: acV5PortActionParams.setStatus('current') acV5PortActionResult = MibScalar((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 3, 1, 4), SnmpAdminString().subtype(subtypeSpec=ValueSizeConstraint(0, 200))).setMaxAccess("readonly") if mibBuilder.loadTexts: acV5PortActionResult.setStatus('current') mibBuilder.exportSymbols("AC-V5-MIB", acV5LinkOperationalState=acV5LinkOperationalState, acV5InterfcePSTNProtocolDataLinkError=acV5InterfcePSTNProtocolDataLinkError, acV5PortActionType=acV5PortActionType, acV5InterfceLinkControlProtocolDataLinkError=acV5InterfceLinkControlProtocolDataLinkError, acV5InterfceEnableRegisterRecallConfiguration=acV5InterfceEnableRegisterRecallConfiguration, acV5InterfceTraceLevel=acV5InterfceTraceLevel, acV5InterfceRegisterRecallDurationType=acV5InterfceRegisterRecallDurationType, acV5InterfceOperationalState=acV5InterfceOperationalState, acV5InterfceAdminState=acV5InterfceAdminState, acV5LinkInterfaceIndx=acV5LinkInterfaceIndx, acV5InterfceRowStatus=acV5InterfceRowStatus, acV5InterfceEntry=acV5InterfceEntry, acV5InterfceProtectionDL1Error=acV5InterfceProtectionDL1Error, acV5InterfceId=acV5InterfceId, acv5Interfce=acv5Interfce, acV5LinkTable=acV5LinkTable, acV5LinkRowStatus=acV5LinkRowStatus, acV5PortAction=acV5PortAction, acV5InterfceIndex=acV5InterfceIndex, acV5Configuration=acV5Configuration, acV5LinkAction=acV5LinkAction, acV5InterfceControlProtocolDataLinkError=acV5InterfceControlProtocolDataLinkError, acV5InterfceActiveSignalingLink=acV5InterfceActiveSignalingLink, acV5PortActionResult=acV5PortActionResult, acV5InterfceL2StartupFailed=acV5InterfceL2StartupFailed, acV5LinkIdCheckStatus=acV5LinkIdCheckStatus, acV5InterfceBCCProtocolDataLinkError=acV5InterfceBCCProtocolDataLinkError, acV5InterfceVariantId=acV5InterfceVariantId, acV5Action=acV5Action, acV5InterfceVariantNotEqual=acV5InterfceVariantNotEqual, acV5InterfceNumberOfPortsInCard=acV5InterfceNumberOfPortsInCard, PYSNMP_MODULE_ID=acV5, acV5PortActionID=acV5PortActionID, acV5InterfceProtocolSide=acV5InterfceProtocolSide, acV5LinkIndex=acV5LinkIndex, acV5LinkType=acV5LinkType, acV5LinkActionResult=acV5LinkActionResult, acV5InterfceIdNotEqual=acV5InterfceIdNotEqual, acV5InterfceLogicalCchannelId=acV5InterfceLogicalCchannelId, acV5InterfceTable=acV5InterfceTable, acV5PortActionParams=acV5PortActionParams, acV5InterfceIDCheckTimeOutError=acV5InterfceIDCheckTimeOutError, acV5InterfceType=acV5InterfceType, acV5InterfceProtectionDL2Error=acV5InterfceProtectionDL2Error, acV5InterfceActionResult=acV5InterfceActionResult, acV5LinkEntry=acV5LinkEntry, acV5InterfceRestartFailed=acV5InterfceRestartFailed, acV5=acV5, acV5InterfceAction=acV5InterfceAction, acV5Link=acV5Link, acV5LinkId=acV5LinkId)
(object_identifier, integer, octet_string) = mibBuilder.importSymbols('ASN1', 'ObjectIdentifier', 'Integer', 'OctetString') (named_values,) = mibBuilder.importSymbols('ASN1-ENUMERATION', 'NamedValues') (value_range_constraint, constraints_union, single_value_constraint, value_size_constraint, constraints_intersection) = mibBuilder.importSymbols('ASN1-REFINEMENT', 'ValueRangeConstraint', 'ConstraintsUnion', 'SingleValueConstraint', 'ValueSizeConstraint', 'ConstraintsIntersection') (ac_products, ac_registrations, audio_codes, ac_generic, ac_board_mibs) = mibBuilder.importSymbols('AUDIOCODES-TYPES-MIB', 'acProducts', 'acRegistrations', 'audioCodes', 'acGeneric', 'acBoardMibs') (inet_address_type, inet_address) = mibBuilder.importSymbols('INET-ADDRESS-MIB', 'InetAddressType', 'InetAddress') (snmp_admin_string,) = mibBuilder.importSymbols('SNMP-FRAMEWORK-MIB', 'SnmpAdminString') (module_compliance, object_group, notification_group) = mibBuilder.importSymbols('SNMPv2-CONF', 'ModuleCompliance', 'ObjectGroup', 'NotificationGroup') (ip_address, time_ticks, bits, mib_scalar, mib_table, mib_table_row, mib_table_column, object_identity, module_identity, enterprises, mib_identifier, unsigned32, counter32, notification_type, iso, counter64, gauge32, integer32) = mibBuilder.importSymbols('SNMPv2-SMI', 'IpAddress', 'TimeTicks', 'Bits', 'MibScalar', 'MibTable', 'MibTableRow', 'MibTableColumn', 'ObjectIdentity', 'ModuleIdentity', 'enterprises', 'MibIdentifier', 'Unsigned32', 'Counter32', 'NotificationType', 'iso', 'Counter64', 'Gauge32', 'Integer32') (display_string, row_status, textual_convention, t_address, date_and_time) = mibBuilder.importSymbols('SNMPv2-TC', 'DisplayString', 'RowStatus', 'TextualConvention', 'TAddress', 'DateAndTime') ac_v5 = module_identity((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13)) if mibBuilder.loadTexts: acV5.setLastUpdated('200911251109Z') if mibBuilder.loadTexts: acV5.setOrganization('AudioCodes Ltd') ac_v5_configuration = mib_identifier((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1)) acv5_interfce = mib_identifier((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1)) ac_v5_interfce_table = mib_table((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1)) if mibBuilder.loadTexts: acV5InterfceTable.setStatus('current') ac_v5_interfce_entry = mib_table_row((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1)).setIndexNames((0, 'AC-V5-MIB', 'acV5InterfceIndex')) if mibBuilder.loadTexts: acV5InterfceEntry.setStatus('current') ac_v5_interfce_index = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 1), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 30))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceIndex.setStatus('current') ac_v5_interfce_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 2), row_status()).setMaxAccess('readcreate') if mibBuilder.loadTexts: acV5InterfceRowStatus.setStatus('current') ac_v5_interfce_action = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 3), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('offline', 0), ('protectionSwitchOver', 1), ('inService', 2)))).setMaxAccess('readcreate') if mibBuilder.loadTexts: acV5InterfceAction.setStatus('current') ac_v5_interfce_action_result = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 4), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('succeeded', 0), ('inProgress', 1), ('failed', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceActionResult.setStatus('current') ac_v5_interfce_operational_state = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 5), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('offline', 0), ('busy', 1), ('inService', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceOperationalState.setStatus('current') ac_v5_interfce_admin_state = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 6), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 2))).clone(namedValues=named_values(('offline', 0), ('inService', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceAdminState.setStatus('current') ac_v5_interfce_active_signaling_link = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 7), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(-1, 0, 1))).clone(namedValues=named_values(('notConfigured', -1), ('primary', 0), ('secondary', 1)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceActiveSignalingLink.setStatus('current') ac_v5_interfce_id_not_equal = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 8), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('cleared', 0), ('raised', 1), ('unknown', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceIdNotEqual.setStatus('current') ac_v5_interfce_variant_not_equal = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 9), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('cleared', 0), ('raised', 1), ('unknown', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceVariantNotEqual.setStatus('current') ac_v5_interfce_id_check_time_out_error = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 10), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('cleared', 0), ('raised', 1), ('unknown', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceIDCheckTimeOutError.setStatus('current') ac_v5_interfce_l2_startup_failed = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 11), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('cleared', 0), ('raised', 1), ('unknown', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceL2StartupFailed.setStatus('current') ac_v5_interfce_restart_failed = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 12), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('cleared', 0), ('raised', 1), ('unknown', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceRestartFailed.setStatus('current') ac_v5_interfce_control_protocol_data_link_error = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 13), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('cleared', 0), ('raised', 1), ('unknown', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceControlProtocolDataLinkError.setStatus('current') ac_v5_interfce_link_control_protocol_data_link_error = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 14), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('cleared', 0), ('raised', 1), ('unknown', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceLinkControlProtocolDataLinkError.setStatus('current') ac_v5_interfce_bcc_protocol_data_link_error = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 15), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('cleared', 0), ('raised', 1), ('unknown', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceBCCProtocolDataLinkError.setStatus('current') ac_v5_interfce_pstn_protocol_data_link_error = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 16), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('cleared', 0), ('raised', 1), ('unknown', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfcePSTNProtocolDataLinkError.setStatus('current') ac_v5_interfce_protection_dl1_error = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 17), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('cleared', 0), ('raised', 1), ('unknown', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceProtectionDL1Error.setStatus('current') ac_v5_interfce_protection_dl2_error = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 18), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('cleared', 0), ('raised', 1), ('unknown', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceProtectionDL2Error.setStatus('current') ac_v5_interfce_type = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 19), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(1))).clone(namedValues=named_values(('v52', 1)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceType.setStatus('current') ac_v5_interfce_protocol_side = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 20), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1))).clone(namedValues=named_values(('an-Side', 0), ('le-Side', 1)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5InterfceProtocolSide.setStatus('current') ac_v5_interfce_id = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 21), integer32().subtype(subtypeSpec=value_range_constraint(-1, 16777215))).setMaxAccess('readcreate') if mibBuilder.loadTexts: acV5InterfceId.setStatus('current') ac_v5_interfce_variant_id = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 22), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 127))).setMaxAccess('readcreate') if mibBuilder.loadTexts: acV5InterfceVariantId.setStatus('current') ac_v5_interfce_logical_cchannel_id = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 23), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 65535))).setMaxAccess('readcreate') if mibBuilder.loadTexts: acV5InterfceLogicalCchannelId.setStatus('current') ac_v5_interfce_trace_level = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 24), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 20, 21, 22, 23))).clone(namedValues=named_values(('noTrace', 0), ('full-Trace-No-Duplication', 20), ('full-Trace-With-Duplication', 21), ('layer3-Up-Trace-No-Duplication', 22), ('layer3-Up-Trace-With-Duplication', 23)))).setMaxAccess('readcreate') if mibBuilder.loadTexts: acV5InterfceTraceLevel.setStatus('current') ac_v5_interfce_number_of_ports_in_card = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 25), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 65533))).setMaxAccess('readcreate') if mibBuilder.loadTexts: acV5InterfceNumberOfPortsInCard.setStatus('current') ac_v5_interfce_enable_register_recall_configuration = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 26), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1))).clone(namedValues=named_values(('disable', 0), ('enable', 1)))).setMaxAccess('readcreate') if mibBuilder.loadTexts: acV5InterfceEnableRegisterRecallConfiguration.setStatus('current') ac_v5_interfce_register_recall_duration_type = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 1, 1, 1, 27), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 65535))).setMaxAccess('readcreate') if mibBuilder.loadTexts: acV5InterfceRegisterRecallDurationType.setStatus('current') ac_v5_link = mib_identifier((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2)) ac_v5_link_table = mib_table((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1)) if mibBuilder.loadTexts: acV5LinkTable.setStatus('current') ac_v5_link_entry = mib_table_row((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1)).setIndexNames((0, 'AC-V5-MIB', 'acV5LinkIndex')) if mibBuilder.loadTexts: acV5LinkEntry.setStatus('current') ac_v5_link_index = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 1), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 62))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5LinkIndex.setStatus('current') ac_v5_link_row_status = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 2), row_status()).setMaxAccess('readcreate') if mibBuilder.loadTexts: acV5LinkRowStatus.setStatus('current') ac_v5_link_action = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 3), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('unBlock', 0), ('block', 1), ('linkIdCheck', 2)))).setMaxAccess('readcreate') if mibBuilder.loadTexts: acV5LinkAction.setStatus('current') ac_v5_link_action_result = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 4), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('succeeded', 0), ('inProgress', 1), ('failed', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5LinkActionResult.setStatus('current') ac_v5_link_id_check_status = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 5), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('succes', 0), ('failure', 1), ('testRejected', 2)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5LinkIdCheckStatus.setStatus('current') ac_v5_link_operational_state = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 6), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2, 3))).clone(namedValues=named_values(('operational', 0), ('blocked', 1), ('failed', 2), ('blockedAndFailed', 3)))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5LinkOperationalState.setStatus('current') ac_v5_link_interface_indx = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 7), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 30))).setMaxAccess('readcreate') if mibBuilder.loadTexts: acV5LinkInterfaceIndx.setStatus('current') ac_v5_link_id = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 8), integer32().subtype(subtypeSpec=value_range_constraint(-1, 16777215))).setMaxAccess('readcreate') if mibBuilder.loadTexts: acV5LinkId.setStatus('current') ac_v5_link_type = mib_table_column((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 1, 2, 1, 1, 9), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2))).clone(namedValues=named_values(('normal', 0), ('primary', 1), ('secondary', 2)))).setMaxAccess('readcreate') if mibBuilder.loadTexts: acV5LinkType.setStatus('current') ac_v5_action = mib_identifier((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 3)) ac_v5_port_action = mib_identifier((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 3, 1)) ac_v5_port_action_type = mib_scalar((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 3, 1, 1), integer32().subtype(subtypeSpec=constraints_union(single_value_constraint(0, 1, 2, 10))).clone(namedValues=named_values(('none', 0), ('removeAllPorts', 1), ('removeIFPorts', 2), ('actionDone', 10)))).setMaxAccess('readwrite') if mibBuilder.loadTexts: acV5PortActionType.setStatus('current') ac_v5_port_action_id = mib_scalar((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 3, 1, 2), unsigned32().subtype(subtypeSpec=value_range_constraint(0, 4294967295))).setMaxAccess('readwrite') if mibBuilder.loadTexts: acV5PortActionID.setStatus('current') ac_v5_port_action_params = mib_scalar((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 3, 1, 3), snmp_admin_string().subtype(subtypeSpec=value_size_constraint(0, 200))).setMaxAccess('readwrite') if mibBuilder.loadTexts: acV5PortActionParams.setStatus('current') ac_v5_port_action_result = mib_scalar((1, 3, 6, 1, 4, 1, 5003, 9, 10, 13, 3, 1, 4), snmp_admin_string().subtype(subtypeSpec=value_size_constraint(0, 200))).setMaxAccess('readonly') if mibBuilder.loadTexts: acV5PortActionResult.setStatus('current') mibBuilder.exportSymbols('AC-V5-MIB', acV5LinkOperationalState=acV5LinkOperationalState, acV5InterfcePSTNProtocolDataLinkError=acV5InterfcePSTNProtocolDataLinkError, acV5PortActionType=acV5PortActionType, acV5InterfceLinkControlProtocolDataLinkError=acV5InterfceLinkControlProtocolDataLinkError, acV5InterfceEnableRegisterRecallConfiguration=acV5InterfceEnableRegisterRecallConfiguration, acV5InterfceTraceLevel=acV5InterfceTraceLevel, acV5InterfceRegisterRecallDurationType=acV5InterfceRegisterRecallDurationType, acV5InterfceOperationalState=acV5InterfceOperationalState, acV5InterfceAdminState=acV5InterfceAdminState, acV5LinkInterfaceIndx=acV5LinkInterfaceIndx, acV5InterfceRowStatus=acV5InterfceRowStatus, acV5InterfceEntry=acV5InterfceEntry, acV5InterfceProtectionDL1Error=acV5InterfceProtectionDL1Error, acV5InterfceId=acV5InterfceId, acv5Interfce=acv5Interfce, acV5LinkTable=acV5LinkTable, acV5LinkRowStatus=acV5LinkRowStatus, acV5PortAction=acV5PortAction, acV5InterfceIndex=acV5InterfceIndex, acV5Configuration=acV5Configuration, acV5LinkAction=acV5LinkAction, acV5InterfceControlProtocolDataLinkError=acV5InterfceControlProtocolDataLinkError, acV5InterfceActiveSignalingLink=acV5InterfceActiveSignalingLink, acV5PortActionResult=acV5PortActionResult, acV5InterfceL2StartupFailed=acV5InterfceL2StartupFailed, acV5LinkIdCheckStatus=acV5LinkIdCheckStatus, acV5InterfceBCCProtocolDataLinkError=acV5InterfceBCCProtocolDataLinkError, acV5InterfceVariantId=acV5InterfceVariantId, acV5Action=acV5Action, acV5InterfceVariantNotEqual=acV5InterfceVariantNotEqual, acV5InterfceNumberOfPortsInCard=acV5InterfceNumberOfPortsInCard, PYSNMP_MODULE_ID=acV5, acV5PortActionID=acV5PortActionID, acV5InterfceProtocolSide=acV5InterfceProtocolSide, acV5LinkIndex=acV5LinkIndex, acV5LinkType=acV5LinkType, acV5LinkActionResult=acV5LinkActionResult, acV5InterfceIdNotEqual=acV5InterfceIdNotEqual, acV5InterfceLogicalCchannelId=acV5InterfceLogicalCchannelId, acV5InterfceTable=acV5InterfceTable, acV5PortActionParams=acV5PortActionParams, acV5InterfceIDCheckTimeOutError=acV5InterfceIDCheckTimeOutError, acV5InterfceType=acV5InterfceType, acV5InterfceProtectionDL2Error=acV5InterfceProtectionDL2Error, acV5InterfceActionResult=acV5InterfceActionResult, acV5LinkEntry=acV5LinkEntry, acV5InterfceRestartFailed=acV5InterfceRestartFailed, acV5=acV5, acV5InterfceAction=acV5InterfceAction, acV5Link=acV5Link, acV5LinkId=acV5LinkId)
# Name:COLLIN FRANCE # Date:JULY 11 17 # proj02: sum # Write a program that prompts the user to enter numbers, one per line, # ending with a line containing 0, and keep a running sum of the numbers. # Only print out the sum after all the numbers are entered # (at least in your final version). Each time you read in a number, # you can immediately use it for your sum, # and then be done with the number just entered. #Example: # Enter a number to sum, or 0 to indicate you are finished: 4 # Enter a number to sum, or 0 to indicate you are finished: 5 # Enter a number to sum, or 0 to indicate you are finished: 2 # Enter a number to sum, or 0 to indicate you are finished: 10 # Enter a number to sum, or 0 to indicate you are finished: 0 #The sum of your numbers iS:2 # True/False loop: end ewhen usr type in a 0 # loop control variable=True # n1=raw_input ("enter a number") # sum=0 # while loop control variable is True: # if user types in 0 # loop control is False # else raw_input ("enter a number") # sum=sum +user input loop_control = True collin=0 while loop_control == True: Number=raw_input("any number to a start equation. Enter a zero to show you are finished") if (Number) == "0": loop_control = False collin = int(Number) + collin print (collin),'is the sum'
loop_control = True collin = 0 while loop_control == True: number = raw_input('any number to a start equation. Enter a zero to show you are finished') if Number == '0': loop_control = False collin = int(Number) + collin (print(collin), 'is the sum')
#cons(a,b) constructs a pair, and car(pair) returns the first and cdr(pair) returns the last element of the pair. #For example , car(cons(3,4)) returns 3, and cdr(cons(3,4)) returns 4. #Given this implementation of cons: '''def cons(a,b): def pair(f): return f(a,b) return pair() ''' #Implement car and cdr
"""def cons(a,b): def pair(f): return f(a,b) return pair() """
def rotateImage(a): w = len(a) h = w img = [0] * h for col in range(h): img_row = [0] * w for row in range(w): img_row[h - row - 1] = a[row][col] img[col] = img_row return img
def rotate_image(a): w = len(a) h = w img = [0] * h for col in range(h): img_row = [0] * w for row in range(w): img_row[h - row - 1] = a[row][col] img[col] = img_row return img
def ajuda(msg): help(msg) n=str(input('Digite um comando para ver a ajuda: ')) ajuda(n)
def ajuda(msg): help(msg) n = str(input('Digite um comando para ver a ajuda: ')) ajuda(n)
def tower_of_hanoi(num_of_disks, mv_from, mv_to, tmp_bar): if num_of_disks == 1: print(f'Move disk 1 from {mv_from} to {mv_to}') return tower_of_hanoi(num_of_disks - 1, mv_from, tmp_bar, mv_to) print(f'Move disk {num_of_disks} from {mv_from} to {mv_to}') tower_of_hanoi(num_of_disks - 1, tmp_bar, mv_to, mv_from) tower_of_hanoi(1, 'A', 'C', 'B')
def tower_of_hanoi(num_of_disks, mv_from, mv_to, tmp_bar): if num_of_disks == 1: print(f'Move disk 1 from {mv_from} to {mv_to}') return tower_of_hanoi(num_of_disks - 1, mv_from, tmp_bar, mv_to) print(f'Move disk {num_of_disks} from {mv_from} to {mv_to}') tower_of_hanoi(num_of_disks - 1, tmp_bar, mv_to, mv_from) tower_of_hanoi(1, 'A', 'C', 'B')
# https://www.codewars.com/kata/5a2d70a6f28b821ab4000004/ ''' Instructions : This kata is part of the collection Mary's Puzzle Books. Zero Terminated Sum Mary has another puzzle book, and it's up to you to help her out! This book is filled with zero-terminated substrings, and you have to find the substring with the largest sum of its digits. For example, one puzzle looks like this: "72102450111111090" Here, there are 4 different substrings: 721, 245, 111111, and 9. The sums of their digits are 10, 11, 6, and 9 respectively. Therefore, the substring with the largest sum of its digits is 245, and its sum is 11. Write a function largest_sum which takes a string and returns the maximum of the sums of the substrings. In the example above, your function should return 11. Notes: A substring can have length 0. For example, 123004560 has three substrings, and the middle one has length 0. All inputs will be valid strings of digits, and the last digit will always be 0. ''' def largest_sum(s): arr = [] s = s.split('0') for i in s: sum = 0 for j in i: sum += int(j) arr.append(sum) return max(arr)
""" Instructions : This kata is part of the collection Mary's Puzzle Books. Zero Terminated Sum Mary has another puzzle book, and it's up to you to help her out! This book is filled with zero-terminated substrings, and you have to find the substring with the largest sum of its digits. For example, one puzzle looks like this: "72102450111111090" Here, there are 4 different substrings: 721, 245, 111111, and 9. The sums of their digits are 10, 11, 6, and 9 respectively. Therefore, the substring with the largest sum of its digits is 245, and its sum is 11. Write a function largest_sum which takes a string and returns the maximum of the sums of the substrings. In the example above, your function should return 11. Notes: A substring can have length 0. For example, 123004560 has three substrings, and the middle one has length 0. All inputs will be valid strings of digits, and the last digit will always be 0. """ def largest_sum(s): arr = [] s = s.split('0') for i in s: sum = 0 for j in i: sum += int(j) arr.append(sum) return max(arr)
class PPO: def get_specs(env=None): specs = { "type": "ppo_agent", "states_preprocessing": { "type":"flatten" }, "subsampling_fraction": 0.1, "optimization_steps": 50, "entropy_regularization": 0.01, "gae_lambda": None, "likelihood_ratio_clipping": 0.2, "actions_exploration":{ "type": "epsilon_decay", "initial_epsilon": 1.0, "final_epsilon": 0.1, "timesteps": 10000 }, "update_mode": { "unit": "episodes", "batch_size": 32, "frequency": 32 }, "memory": { "type": "latest", "include_next_states": False, "capacity": 50000 }, "step_optimizer": { "type": "adam", "learning_rate": 1e-3 }, "discount": 0.99, "saver": { "directory": None, "seconds": 600 }, "summarizer": { "directory": None, "time": 50, "labels": [] } } return specs
class Ppo: def get_specs(env=None): specs = {'type': 'ppo_agent', 'states_preprocessing': {'type': 'flatten'}, 'subsampling_fraction': 0.1, 'optimization_steps': 50, 'entropy_regularization': 0.01, 'gae_lambda': None, 'likelihood_ratio_clipping': 0.2, 'actions_exploration': {'type': 'epsilon_decay', 'initial_epsilon': 1.0, 'final_epsilon': 0.1, 'timesteps': 10000}, 'update_mode': {'unit': 'episodes', 'batch_size': 32, 'frequency': 32}, 'memory': {'type': 'latest', 'include_next_states': False, 'capacity': 50000}, 'step_optimizer': {'type': 'adam', 'learning_rate': 0.001}, 'discount': 0.99, 'saver': {'directory': None, 'seconds': 600}, 'summarizer': {'directory': None, 'time': 50, 'labels': []}} return specs
class Solution: # This will technically work, but it's slow as all get-out. # Worst case would be O(n^2) as you have to traverse your # entire list of n numbers k times, which if k is 1 less # than the length of nums, is effectively n. def rotate(self, nums, k): start = end = len(nums) if k >= start: k = k % start if k == 0: return x = 1 while k > 0: k -= 1 for i in range(1, end): # print(nums) temp = nums[-i] nums[-i] = nums[(-i-1) % end] nums[(-i-1) % end] = temp
class Solution: def rotate(self, nums, k): start = end = len(nums) if k >= start: k = k % start if k == 0: return x = 1 while k > 0: k -= 1 for i in range(1, end): temp = nums[-i] nums[-i] = nums[(-i - 1) % end] nums[(-i - 1) % end] = temp
ACCESS_DENIED = "access_denied" INVALID_CLIENT = "invalid_client" INVALID_GRANT = "invalid_grant" INVALID_REQUEST = "invalid_request" INVALID_SCOPE = "invalid_scope" INVALID_STATE = "invalid_state" INVALID_RESPONSE = "invalid_response" SERVER_ERROR = "server_error" TEMPORARILY_UNAVAILABLE = "temporarily_unavailable" UNAUTHORIZED_CLIENT = "unauthorized_client" UNSUPPORTED_GRANT_TYPE = "unsupported_grant_type" UNSUPPORTED_RESPONSE_TYPE = "unsupported_response_type" DESCRIPTIONS: dict[str, str] = { INVALID_REQUEST: ( "The request is missing a required parameter, includes an invalid " "parameter value, includes a parameter more than once, or is " "otherwise malformed." ), INVALID_CLIENT: ( "Client authentication failed (e.g., unknown client, no client " "authentication included, or unsupported authentication method)." ), INVALID_GRANT: ( "The provided authorization grant or refresh token is invalid, " "expired or revoked." ), UNAUTHORIZED_CLIENT: ("The client is not authorized to perform this action."), ACCESS_DENIED: ("The resource owner or authorization server denied the request."), UNSUPPORTED_RESPONSE_TYPE: ( "The authorization server does not support obtaining an authorization " "code using this method." ), UNSUPPORTED_GRANT_TYPE: ( "The authorization grant type is not supported by the authorization " "server." ), INVALID_SCOPE: ("The requested scope is invalid, unknown, or malformed."), SERVER_ERROR: ( "The server encountered an unexpected condition that prevented it " "from fulfilling the request." ), TEMPORARILY_UNAVAILABLE: ( "The server is currently unable to handle the request due to a " "temporary overloading or maintenance of the server." ), }
access_denied = 'access_denied' invalid_client = 'invalid_client' invalid_grant = 'invalid_grant' invalid_request = 'invalid_request' invalid_scope = 'invalid_scope' invalid_state = 'invalid_state' invalid_response = 'invalid_response' server_error = 'server_error' temporarily_unavailable = 'temporarily_unavailable' unauthorized_client = 'unauthorized_client' unsupported_grant_type = 'unsupported_grant_type' unsupported_response_type = 'unsupported_response_type' descriptions: dict[str, str] = {INVALID_REQUEST: 'The request is missing a required parameter, includes an invalid parameter value, includes a parameter more than once, or is otherwise malformed.', INVALID_CLIENT: 'Client authentication failed (e.g., unknown client, no client authentication included, or unsupported authentication method).', INVALID_GRANT: 'The provided authorization grant or refresh token is invalid, expired or revoked.', UNAUTHORIZED_CLIENT: 'The client is not authorized to perform this action.', ACCESS_DENIED: 'The resource owner or authorization server denied the request.', UNSUPPORTED_RESPONSE_TYPE: 'The authorization server does not support obtaining an authorization code using this method.', UNSUPPORTED_GRANT_TYPE: 'The authorization grant type is not supported by the authorization server.', INVALID_SCOPE: 'The requested scope is invalid, unknown, or malformed.', SERVER_ERROR: 'The server encountered an unexpected condition that prevented it from fulfilling the request.', TEMPORARILY_UNAVAILABLE: 'The server is currently unable to handle the request due to a temporary overloading or maintenance of the server.'}
def sum(n): return n * (n + 1) // 2 print(sum(46341))
def sum(n): return n * (n + 1) // 2 print(sum(46341))
pessoas = {'nome':'Gilson', 'Idade':55, 'Sexo': 'M'} print(pessoas) print(pessoas['nome']) print(pessoas['Idade']) print(f'{pessoas["nome"]}') print(pessoas.keys()) print(pessoas.values()) print(pessoas.items()) for k in pessoas.values(): print(k) for k ,v in pessoas.items(): print(f'{k} = {v}') brasil = [] estado1 = {'UF':'Rio de Janeiro', 'SIGLA' : 'RJ'} estado2 = {'UF':'PERNAMBUCO', 'SIGLA':'PE'} brasil.append(estado1) brasil.append(estado2) print(brasil) print(estado2) estado3 = dict() brasil1 = list() for c in range(0, 3): estado3['UF'] = str(input('Estado: ')) estado3['SIGLA'] = str(input('SIGLA: ')) brasil1.append(estado3.copy()) print(brasil1)
pessoas = {'nome': 'Gilson', 'Idade': 55, 'Sexo': 'M'} print(pessoas) print(pessoas['nome']) print(pessoas['Idade']) print(f"{pessoas['nome']}") print(pessoas.keys()) print(pessoas.values()) print(pessoas.items()) for k in pessoas.values(): print(k) for (k, v) in pessoas.items(): print(f'{k} = {v}') brasil = [] estado1 = {'UF': 'Rio de Janeiro', 'SIGLA': 'RJ'} estado2 = {'UF': 'PERNAMBUCO', 'SIGLA': 'PE'} brasil.append(estado1) brasil.append(estado2) print(brasil) print(estado2) estado3 = dict() brasil1 = list() for c in range(0, 3): estado3['UF'] = str(input('Estado: ')) estado3['SIGLA'] = str(input('SIGLA: ')) brasil1.append(estado3.copy()) print(brasil1)
# simple inheritance # base class class student: def __init__(self, name, age): self.name = name self.age = age def getdata(self): self.name = input('enter name') self.age = input('enter age') def putdata(self): print(self.name, self.age) # Derived class or sub class class scienceStudent(student): def science(self): print('this is a science method') obstudent = scienceStudent("amar", "12") obstudent.getdata() # Accessible obstudent.putdata() # Accessible obstudent.science() # Multiple inheritance # class c(a,b) where a,b are base class # Multilevel inheritance # class b(a): a-base class, b-derived class # class c(b): b-base class, c-derived class
class Student: def __init__(self, name, age): self.name = name self.age = age def getdata(self): self.name = input('enter name') self.age = input('enter age') def putdata(self): print(self.name, self.age) class Sciencestudent(student): def science(self): print('this is a science method') obstudent = science_student('amar', '12') obstudent.getdata() obstudent.putdata() obstudent.science()
#!/user/bin/env python '''rWork.py: This filter returns True if the r_work value for this structure is within the specified range ''' __author__ = "Mars (Shih-Cheng) Huang" __maintainer__ = "Mars (Shih-Cheng) Huang" __email__ = "marshuang80@gmail.com" __version__ = "0.2.0" __status__ = "Done" class RWork(object): '''This filter returns True if the rWork value for this structure is within the specified range. Attributes ---------- min_Rwork : float The lower bound r_work value max_Rwork : float The upper bound r_work value ''' def __init__(self, minRwork, maxRwork): self.min_Rwork = minRwork self.max_Rwork = maxRwork def __call__(self, t): if t[1].r_work == None: return False return t[1].r_work >= self.min_Rwork and t[1].r_work <= self.max_Rwork
"""rWork.py: This filter returns True if the r_work value for this structure is within the specified range """ __author__ = 'Mars (Shih-Cheng) Huang' __maintainer__ = 'Mars (Shih-Cheng) Huang' __email__ = 'marshuang80@gmail.com' __version__ = '0.2.0' __status__ = 'Done' class Rwork(object): """This filter returns True if the rWork value for this structure is within the specified range. Attributes ---------- min_Rwork : float The lower bound r_work value max_Rwork : float The upper bound r_work value """ def __init__(self, minRwork, maxRwork): self.min_Rwork = minRwork self.max_Rwork = maxRwork def __call__(self, t): if t[1].r_work == None: return False return t[1].r_work >= self.min_Rwork and t[1].r_work <= self.max_Rwork
#%% # nums = [-1,2,1,-4] # target = 1 # nums = [0, 1, 2] # target = 0 nums = [1, 1, 1, 0] target = 100 nums = [0, 2, 1, -3, -5] target = 1 def threeSumClosest(nums: list, target: int)->int: nums.sort() ptrLow = 0 ptrHigh = len(nums) - 1 bestEstimate = 10e10 #remember that we are dealing with three numbers while ptrHigh - ptrLow - 1 >= 0: for ind in range(ptrLow+1, ptrHigh): currentValue = nums[ptrLow] + nums[ind] + nums[ptrHigh] print(nums[ptrLow]) print(nums[ind]) print(nums[ptrHigh]) print('-'*10) if abs(target - bestEstimate) > abs(target - currentValue): bestEstimate = currentValue if target - currentValue == 0: return currentValue if bestEstimate < target: ptrLow += 1 else: ptrHigh -= 1 return bestEstimate threeSumClosest(nums, target) # %%
nums = [1, 1, 1, 0] target = 100 nums = [0, 2, 1, -3, -5] target = 1 def three_sum_closest(nums: list, target: int) -> int: nums.sort() ptr_low = 0 ptr_high = len(nums) - 1 best_estimate = 100000000000.0 while ptrHigh - ptrLow - 1 >= 0: for ind in range(ptrLow + 1, ptrHigh): current_value = nums[ptrLow] + nums[ind] + nums[ptrHigh] print(nums[ptrLow]) print(nums[ind]) print(nums[ptrHigh]) print('-' * 10) if abs(target - bestEstimate) > abs(target - currentValue): best_estimate = currentValue if target - currentValue == 0: return currentValue if bestEstimate < target: ptr_low += 1 else: ptr_high -= 1 return bestEstimate three_sum_closest(nums, target)
# md5 : 696999570c6da88ed87e96e1014f4fd0 # sha1 : bbf782f04e4b5dafbfe1afef6b08ab08a1777852 # sha256 : 8d6c894aeb73da24ba8c8af002f7299211c23a616cccf18443c6f38b43c33b3e ord_names = { 102: b'ChooseColorA', 103: b'ChooseColorW', 104: b'ChooseFontA', 105: b'ChooseFontW', 106: b'CommDlgExtendedError', 107: b'DllCanUnloadNow', 108: b'DllGetClassObject', 109: b'FindTextA', 110: b'FindTextW', 111: b'GetFileTitleA', 112: b'GetFileTitleW', 113: b'GetOpenFileNameA', 114: b'GetOpenFileNameW', 115: b'GetSaveFileNameA', 116: b'GetSaveFileNameW', 117: b'LoadAlterBitmap', 118: b'PageSetupDlgA', 119: b'PageSetupDlgW', 120: b'PrintDlgA', 121: b'PrintDlgExA', 122: b'PrintDlgExW', 123: b'PrintDlgW', 124: b'ReplaceTextA', 125: b'ReplaceTextW', 126: b'Ssync_ANSI_UNICODE_Struct_For_WOW', 127: b'WantArrows', 128: b'dwLBSubclass', 129: b'dwOKSubclass', }
ord_names = {102: b'ChooseColorA', 103: b'ChooseColorW', 104: b'ChooseFontA', 105: b'ChooseFontW', 106: b'CommDlgExtendedError', 107: b'DllCanUnloadNow', 108: b'DllGetClassObject', 109: b'FindTextA', 110: b'FindTextW', 111: b'GetFileTitleA', 112: b'GetFileTitleW', 113: b'GetOpenFileNameA', 114: b'GetOpenFileNameW', 115: b'GetSaveFileNameA', 116: b'GetSaveFileNameW', 117: b'LoadAlterBitmap', 118: b'PageSetupDlgA', 119: b'PageSetupDlgW', 120: b'PrintDlgA', 121: b'PrintDlgExA', 122: b'PrintDlgExW', 123: b'PrintDlgW', 124: b'ReplaceTextA', 125: b'ReplaceTextW', 126: b'Ssync_ANSI_UNICODE_Struct_For_WOW', 127: b'WantArrows', 128: b'dwLBSubclass', 129: b'dwOKSubclass'}
first = int(input()) i = 0 list = [] outputval = 0 if(first>0 and first<11): while(i<first): i+=1 f, s = map(int, input().split()) list.append(int(s/f)) if (min(list)<0): print(0) else: print(min(list))
first = int(input()) i = 0 list = [] outputval = 0 if first > 0 and first < 11: while i < first: i += 1 (f, s) = map(int, input().split()) list.append(int(s / f)) if min(list) < 0: print(0) else: print(min(list))
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. class TableProperties(object): COMMIT_NUM_RETRIES = "commit.retry.num-retries" COMMIT_NUM_RETRIES_DEFAULT = 4 COMMIT_MIN_RETRY_WAIT_MS = "commit.retry.min-wait-ms" COMMIT_MIN_RETRY_WAIT_MS_DEFAULT = 100 COMMIT_MAX_RETRY_WAIT_MS = "commit.retry.max-wait-ms" COMMIT_MAX_RETRY_WAIT_MS_DEFAULT = 60000 COMMIT_TOTAL_RETRY_TIME_MS = "commit.retry.total-timeout-ms" COMMIT_TOTAL_RETRY_TIME_MS_DEFAULT = 1800000 MANIFEST_TARGET_SIZE_BYTES = "commit.manifest.target-size-bytes" MANIFEST_TARGET_SIZE_BYTES_DEFAULT = 8388608 MANIFEST_MIN_MERGE_COUNT = "commit.manifest.min-count-to-merge" MANIFEST_MIN_MERGE_COUNT_DEFAULT = 100 DEFAULT_FILE_FORMAT = "write.format.default" DEFAULT_FILE_FORMAT_DEFAULT = "parquet" PARQUET_ROW_GROUP_SIZE_BYTES = "write.parquet.row-group-size-bytes" PARQUET_ROW_GROUP_SIZE_BYTES_DEFAULT = "134217728" PARQUET_PAGE_SIZE_BYTES = "write.parquet.page-size-bytes" PARQUET_PAGE_SIZE_BYTES_DEFAULT = "1048576" PARQUET_DICT_SIZE_BYTES = "write.parquet.dict-size-bytes" PARQUET_DICT_SIZE_BYTES_DEFAULT = "2097152" PARQUET_COMPRESSION = "write.parquet.compression-codec" PARQUET_COMPRESSION_DEFAULT = "gzip" AVRO_COMPRESSION = "write.avro.compression-codec" AVRO_COMPRESSION_DEFAULT = "gzip" SPLIT_SIZE = "read.split.target-size" SPLIT_SIZE_DEFAULT = 134217728 SPLIT_LOOKBACK = "read.split.planning-lookback" SPLIT_LOOKBACK_DEFAULT = 10 SPLIT_OPEN_FILE_COST = "read.split.open-file-cost" SPLIT_OPEN_FILE_COST_DEFAULT = 4 * 1024 * 1024 OBJECT_STORE_ENABLED = "write.object-storage.enabled" OBJECT_STORE_ENABLED_DEFAULT = False OBJECT_STORE_PATH = "write.object-storage.path" WRITE_LOCATION_PROVIDER_IMPL = "write.location-provider.impl" WRITE_NEW_DATA_LOCATION = "write.folder-storage.path" WRITE_METADATA_LOCATION = "write.metadata.path" MANIFEST_LISTS_ENABLED = "write.manifest-lists.enabled" MANIFEST_LISTS_ENABLED_DEFAULT = True
class Tableproperties(object): commit_num_retries = 'commit.retry.num-retries' commit_num_retries_default = 4 commit_min_retry_wait_ms = 'commit.retry.min-wait-ms' commit_min_retry_wait_ms_default = 100 commit_max_retry_wait_ms = 'commit.retry.max-wait-ms' commit_max_retry_wait_ms_default = 60000 commit_total_retry_time_ms = 'commit.retry.total-timeout-ms' commit_total_retry_time_ms_default = 1800000 manifest_target_size_bytes = 'commit.manifest.target-size-bytes' manifest_target_size_bytes_default = 8388608 manifest_min_merge_count = 'commit.manifest.min-count-to-merge' manifest_min_merge_count_default = 100 default_file_format = 'write.format.default' default_file_format_default = 'parquet' parquet_row_group_size_bytes = 'write.parquet.row-group-size-bytes' parquet_row_group_size_bytes_default = '134217728' parquet_page_size_bytes = 'write.parquet.page-size-bytes' parquet_page_size_bytes_default = '1048576' parquet_dict_size_bytes = 'write.parquet.dict-size-bytes' parquet_dict_size_bytes_default = '2097152' parquet_compression = 'write.parquet.compression-codec' parquet_compression_default = 'gzip' avro_compression = 'write.avro.compression-codec' avro_compression_default = 'gzip' split_size = 'read.split.target-size' split_size_default = 134217728 split_lookback = 'read.split.planning-lookback' split_lookback_default = 10 split_open_file_cost = 'read.split.open-file-cost' split_open_file_cost_default = 4 * 1024 * 1024 object_store_enabled = 'write.object-storage.enabled' object_store_enabled_default = False object_store_path = 'write.object-storage.path' write_location_provider_impl = 'write.location-provider.impl' write_new_data_location = 'write.folder-storage.path' write_metadata_location = 'write.metadata.path' manifest_lists_enabled = 'write.manifest-lists.enabled' manifest_lists_enabled_default = True
#!/usr/bin/env python # encoding: utf-8 ''' #-------------------------------------------------------------------# # CONFIDENTIAL --- CUSTOM STUDIOS # #-------------------------------------------------------------------# # # # @Project Name : t5p-mcdtb # # # # @File Name : __init__.py.py # # # # @Programmer : Jeffrey # # # # @Start Date : 2021/4/18 20:24 # # # # @Last Update : 2021/4/18 20:24 # # # #-------------------------------------------------------------------# # Classes: # # # #-------------------------------------------------------------------# '''
""" #-------------------------------------------------------------------# # CONFIDENTIAL --- CUSTOM STUDIOS # #-------------------------------------------------------------------# # # # @Project Name : t5p-mcdtb # # # # @File Name : __init__.py.py # # # # @Programmer : Jeffrey # # # # @Start Date : 2021/4/18 20:24 # # # # @Last Update : 2021/4/18 20:24 # # # #-------------------------------------------------------------------# # Classes: # # # #-------------------------------------------------------------------# """
class Solution: # O(n^2) time | O(1) space - where n is the length of the input array def maxDistance(self, colors: List[int]) -> int: maxDist = 0 for i in range(len(colors)): for j in range(i, len(colors)): if colors[i] != colors[j]: maxDist = max(maxDist, j - i) return maxDist
class Solution: def max_distance(self, colors: List[int]) -> int: max_dist = 0 for i in range(len(colors)): for j in range(i, len(colors)): if colors[i] != colors[j]: max_dist = max(maxDist, j - i) return maxDist
''' @File : init.py @Author : Zehong Ma @Version : 1.0 @Contact : zehongma@qq.com @Desc : None '''
""" @File : init.py @Author : Zehong Ma @Version : 1.0 @Contact : zehongma@qq.com @Desc : None """
# https://www.codechef.com/LTIME98C/problems/REDALERT for T in range(int(input())): n,d,h=map(int,input().split()) l,check=list(map(int,input().split())),0 for i in l: if(i==0): if(check<d): check=0 else: check-=d continue check+=i if(check>h): print("YES") break else: print("NO")
for t in range(int(input())): (n, d, h) = map(int, input().split()) (l, check) = (list(map(int, input().split())), 0) for i in l: if i == 0: if check < d: check = 0 else: check -= d continue check += i if check > h: print('YES') break else: print('NO')
# print("Hello") # print("Hello") i = 0 while i < 5: print("Hello No.", i) i += 1 print("Always happens once loop is finished") print("i is now", i) i = 10 while i > 0: print("Going down the floor:", i) # i could do more stuff i -= 2 print("Whew we are done with this i:", i) i = 20 while True: print("i is",i) if i > 28: break i += 2 while True: res = input("Enter number or q to quit ") if res == "q": print("No more calculations today") break elif res == "a": # TODO check if if the input is text print("I can't cube a letter a") continue # means we are not going to try to convert "a" to float num = float(res) print(f"My calculator says cube of {num} is {num**3}") print("All done whew!")
i = 0 while i < 5: print('Hello No.', i) i += 1 print('Always happens once loop is finished') print('i is now', i) i = 10 while i > 0: print('Going down the floor:', i) i -= 2 print('Whew we are done with this i:', i) i = 20 while True: print('i is', i) if i > 28: break i += 2 while True: res = input('Enter number or q to quit ') if res == 'q': print('No more calculations today') break elif res == 'a': print("I can't cube a letter a") continue num = float(res) print(f'My calculator says cube of {num} is {num ** 3}') print('All done whew!')
# -*- coding: utf-8 -*- class RpcSetPassword: def __init__(self, hashed_password): self.hashed_password = hashed_password def out_rpc_set_password(self, pack): pack.add_value("HashedPassword", self.hashed_password)
class Rpcsetpassword: def __init__(self, hashed_password): self.hashed_password = hashed_password def out_rpc_set_password(self, pack): pack.add_value('HashedPassword', self.hashed_password)
class LinkedList: class _Node: def __init__(self, e=None, node_next=None): self.e = e self.next = node_next def __str__(self): return str(self.e) def __repr__(self): return self.__str__() def __init__(self): self._dummy_head = self._Node() self._size = 0 def get_size(self): return self._size def is_empty(self): return self._size == 0 def add_first(self, e): self.add(0, e) def add_last(self, e): self.add(self._size, e) def add(self, index, e): if index < 0 or index > self._size: raise ValueError('Add failed. Illegal index.') prev = self._dummy_head for i in range(index): prev = prev.next node = self._Node(e) node.next = prev.next prev.next = node self._size += 1 def getter(self, index): if index < 0 or index >= self._size: raise ValueError('Get failed. Illegal index.') curr = self._dummy_head.next for i in range(index): curr = curr.next return curr.e def get_first(self): return self.getter(0) def get_last(self): return self.getter(self._size - 1) def setter(self, index): if index < 0 or index >= self._size: raise ValueError('Set failed. Illegal index.') curr = self._dummy_head.next for i in range(index): curr = curr.next curr.e = e def contains(self, e): curr = self._dummy_head.next while curr: if curr.e == e: return True curr = curr.next return False def remove(self, index): if index < 0 or index >= self._size: raise ValueError('Remove failed. Illegal index.') prev = self._dummy_head for i in range(index): prev = prev.next ret = prev.next prev.next = ret.next ret.next = None self._size -= 1 return ret.e def remove_first(self): return self.remove(0) def remove_last(self): return self.remove(self._size - 1) def __str__(self): curr = self._dummy_head.next data = [] while curr: data.append(str(curr.e)) curr = curr.next return '<chapter_03_LinkedList.linkedlist.LinkedList>: (Head) ' + \ ' -> '.join(data) + ' (Tail)' def __repr__(self): return self.__str__() if __name__ == '__main__': linkedlist = LinkedList() print(linkedlist.get_size()) linkedlist.add_first(1) linkedlist.add_first(2) linkedlist.add_first(4) linkedlist.add_first(5) print(linkedlist.get_size()) print(linkedlist) print(linkedlist.getter(3)) print(linkedlist.get_first()) print(linkedlist.get_last()) print(linkedlist) linkedlist.remove(2) linkedlist.remove_first() linkedlist.remove_last() print(linkedlist)
class Linkedlist: class _Node: def __init__(self, e=None, node_next=None): self.e = e self.next = node_next def __str__(self): return str(self.e) def __repr__(self): return self.__str__() def __init__(self): self._dummy_head = self._Node() self._size = 0 def get_size(self): return self._size def is_empty(self): return self._size == 0 def add_first(self, e): self.add(0, e) def add_last(self, e): self.add(self._size, e) def add(self, index, e): if index < 0 or index > self._size: raise value_error('Add failed. Illegal index.') prev = self._dummy_head for i in range(index): prev = prev.next node = self._Node(e) node.next = prev.next prev.next = node self._size += 1 def getter(self, index): if index < 0 or index >= self._size: raise value_error('Get failed. Illegal index.') curr = self._dummy_head.next for i in range(index): curr = curr.next return curr.e def get_first(self): return self.getter(0) def get_last(self): return self.getter(self._size - 1) def setter(self, index): if index < 0 or index >= self._size: raise value_error('Set failed. Illegal index.') curr = self._dummy_head.next for i in range(index): curr = curr.next curr.e = e def contains(self, e): curr = self._dummy_head.next while curr: if curr.e == e: return True curr = curr.next return False def remove(self, index): if index < 0 or index >= self._size: raise value_error('Remove failed. Illegal index.') prev = self._dummy_head for i in range(index): prev = prev.next ret = prev.next prev.next = ret.next ret.next = None self._size -= 1 return ret.e def remove_first(self): return self.remove(0) def remove_last(self): return self.remove(self._size - 1) def __str__(self): curr = self._dummy_head.next data = [] while curr: data.append(str(curr.e)) curr = curr.next return '<chapter_03_LinkedList.linkedlist.LinkedList>: (Head) ' + ' -> '.join(data) + ' (Tail)' def __repr__(self): return self.__str__() if __name__ == '__main__': linkedlist = linked_list() print(linkedlist.get_size()) linkedlist.add_first(1) linkedlist.add_first(2) linkedlist.add_first(4) linkedlist.add_first(5) print(linkedlist.get_size()) print(linkedlist) print(linkedlist.getter(3)) print(linkedlist.get_first()) print(linkedlist.get_last()) print(linkedlist) linkedlist.remove(2) linkedlist.remove_first() linkedlist.remove_last() print(linkedlist)
#================================================================ # Runge-Kutta 4th Order Function for Spring Damping # # Author: Bayu R. J. (remove this lol) # Version: 1.0 *initial release # Level: Beginner # Python : IDLE 3.6.3 (use 'new file' to make a whole script) #================================================================ # Compatibility # # *Function can be seperate independently #---------------------------------------------------------------- # Known Bugs # # *None #----------------------------------------------------------------- def dy(u): dy = u return dy def du(x, u): k = 2 # spring constant c = 460 # damping coefficient m = 450 # mass du = (-c*u - k*x) / m; return du; #initial value y = 0.01 u = 0 r = 0 # number of steps N = 10 # initial y a = y # final y b = 1 #step size h = (b-a)/N xpoints = [y] for i in range(99999): r += h if (r < b): xpoints.append(r) i += 1 ypoints = [] upoints = [] #print(xpoints) buat debugging #Runge-Kutta 4th Order for x in xpoints: ypoints.append(y) upoints.append(u) k1 = dy(u) m1 = du(y, u); k2 = dy(u + m1*h) m2 = du(y + k1*h / 2, u + m1*h / 2) k3 = dy(u + m2*h / 2) m3 = du(y + k2*h / 2, u + m2*h / 2) k4 = dy(u + m3*h) m4 = du(y + k3*h, u + m3*h) y += (k1 + 2*k2 + 2*k3 + k4)/6 u += (m1 + 2*m2 + 2*m3 + m4)/6 print (y)
def dy(u): dy = u return dy def du(x, u): k = 2 c = 460 m = 450 du = (-c * u - k * x) / m return du y = 0.01 u = 0 r = 0 n = 10 a = y b = 1 h = (b - a) / N xpoints = [y] for i in range(99999): r += h if r < b: xpoints.append(r) i += 1 ypoints = [] upoints = [] for x in xpoints: ypoints.append(y) upoints.append(u) k1 = dy(u) m1 = du(y, u) k2 = dy(u + m1 * h) m2 = du(y + k1 * h / 2, u + m1 * h / 2) k3 = dy(u + m2 * h / 2) m3 = du(y + k2 * h / 2, u + m2 * h / 2) k4 = dy(u + m3 * h) m4 = du(y + k3 * h, u + m3 * h) y += (k1 + 2 * k2 + 2 * k3 + k4) / 6 u += (m1 + 2 * m2 + 2 * m3 + m4) / 6 print(y)
n = 9 while n>=1: if(n>1): print(str(n) + " bottles of beer on the wall, " + str(n) + " bottles of beer.") n-=1 print("take one down and pass it around, " + str(n) + " bottles of beer on the wall.\n\n") else: print(str(n) + " bottles of beer on the wall, " + str(n) + " bottle of beer.") n-=1 print("take one down and pass it around, there are no bottles of beer on the wall.\n\n") pass
n = 9 while n >= 1: if n > 1: print(str(n) + ' bottles of beer on the wall, ' + str(n) + ' bottles of beer.') n -= 1 print('take one down and pass it around, ' + str(n) + ' bottles of beer on the wall.\n\n') else: print(str(n) + ' bottles of beer on the wall, ' + str(n) + ' bottle of beer.') n -= 1 print('take one down and pass it around, there are no bottles of beer on the wall.\n\n') pass
dy_import_module_symbols("testdatalimit_helper") # Send 10MB of data through with a high limit of 3MB. Which means as soon as it sends # 3MB, the shim should block until the time limit (in this case 20 seconds) is up. UPLOAD_LIMIT = 1024 * 1024 * 3 # 3MB DOWNLOAD_LIMIT = 1024 * 1024 * 3 # 3MB TIME_LIMIT = 10 DATA_TO_SEND = "HelloWorld" * 1024 * 1024 launch_test()
dy_import_module_symbols('testdatalimit_helper') upload_limit = 1024 * 1024 * 3 download_limit = 1024 * 1024 * 3 time_limit = 10 data_to_send = 'HelloWorld' * 1024 * 1024 launch_test()
class Hand: def __init__(self, stay=False): self.stay = stay self.cards = [] def drawCard(self, deck): self.cards.append(deck.dealCard()) def displayHand(self): return f"{[f'{card.num}{card.face},' for card in self.cards]}" # Corner case to be resolved: # --> Ace Ace Jack will fail (e.g. 11 + 1 + 10 = 22) def calculateScore(self): values = { 'Ace': 1, 2:2, 3:3, 4:4, 5:5, 6:6, 7:7, 8:8, 9:9, 10:10, 'Jack': 10, 'Queen': 10, 'King': 10 } aces = [] total = 0 for card in self.cards: if card.num == 'Ace': aces.append(card) else: total += values[card.num] for ace in aces: if total <= 10: total += 11 else: total += 1 return total
class Hand: def __init__(self, stay=False): self.stay = stay self.cards = [] def draw_card(self, deck): self.cards.append(deck.dealCard()) def display_hand(self): return f"{[f'{card.num}{card.face},' for card in self.cards]}" def calculate_score(self): values = {'Ace': 1, 2: 2, 3: 3, 4: 4, 5: 5, 6: 6, 7: 7, 8: 8, 9: 9, 10: 10, 'Jack': 10, 'Queen': 10, 'King': 10} aces = [] total = 0 for card in self.cards: if card.num == 'Ace': aces.append(card) else: total += values[card.num] for ace in aces: if total <= 10: total += 11 else: total += 1 return total
class Fee(object): def __init__(self, currency, fastest, slowest): self.currency = currency self.fastest = fastest self.slowest = slowest def __str__(self): return "Fees for %s [Fastest %s] [Slowest %s]" % (self.currency, self.fastest, self.slowest) def __repr__(self): return "Fees for %s [Fastest %s] [Slowest %s]" % (self.currency, self.fastest, self.slowest) def __eq__(self, other): return self.currency == other.currency
class Fee(object): def __init__(self, currency, fastest, slowest): self.currency = currency self.fastest = fastest self.slowest = slowest def __str__(self): return 'Fees for %s [Fastest %s] [Slowest %s]' % (self.currency, self.fastest, self.slowest) def __repr__(self): return 'Fees for %s [Fastest %s] [Slowest %s]' % (self.currency, self.fastest, self.slowest) def __eq__(self, other): return self.currency == other.currency
f = open("input.txt",'r') L = [] for item in f: L.append(item.strip()) # Construct arrays of possible keys: creden = ["ecl","eyr","hcl","byr","iyr","pid","hgt"] creden_plus = ["ecl","eyr","hcl","byr","iyr","pid","hgt","cid"] creden.sort() creden_plus.sort() # stores all passports passports = [] # stores key-value pairs (in string form): passport = [] for item in L: # if empty line, append passport, and reinitialize passport variable: if item == "": passports.append(passport) passport = [] # otherwise, loop through current line and append # key value pairs to passport items = item.split(" ") for att in items: if att != "": passport.append(att) # grab the last passport passports.append(passport) print(passports) count = 0 # loop through passports: for passport in passports: keys = [] # extract out the keys: for att in passport: keys.append(att.split(":")[0]) # sort them keys.sort() # see if keys are valid: if keys == creden or keys == creden_plus: count += 1 print(count)
f = open('input.txt', 'r') l = [] for item in f: L.append(item.strip()) creden = ['ecl', 'eyr', 'hcl', 'byr', 'iyr', 'pid', 'hgt'] creden_plus = ['ecl', 'eyr', 'hcl', 'byr', 'iyr', 'pid', 'hgt', 'cid'] creden.sort() creden_plus.sort() passports = [] passport = [] for item in L: if item == '': passports.append(passport) passport = [] items = item.split(' ') for att in items: if att != '': passport.append(att) passports.append(passport) print(passports) count = 0 for passport in passports: keys = [] for att in passport: keys.append(att.split(':')[0]) keys.sort() if keys == creden or keys == creden_plus: count += 1 print(count)
# Auxiliary def goodness(x,y): xx = x-np.average(x) yy = y-np.average(y) A = np.sqrt(np.inner(xx,xx)) B = np.sqrt(np.inner(yy,yy)) return np.inner(xx/A,yy/B) def argminrnd(items, target): # Returns the argmin item. if there are many, returns one at random. # items and target must be the same length candidates = np.where(target == target.min())[0] return items[random.choice(candidates)] def argmaxrnd(items, target): return argminrnd(items, -target) def gen_values(size, a=1, b=100, normalize=False, sort=False, \ desc=False, power=False, alpha = 2): # useful function to generate discrete linear and potential (power) distributions. # Generates values for various initializations. if not power: x = np.array(list(map(lambda x: random.randint(a,b),range(size)))) else: x = np.exp(alpha*np.array(list(map(lambda x: random.expovariate(1),range(size))))) if normalize: # Ensure x adds up to 1 x = x/x.sum() if sort: x = np.sort(x) # Note: defaults to quicksort, worstcase O(n**2). # check https://numpy.org/doc/stable/reference/generated/numpy.sort.html if desc: x = x[::-1] return x # p = gen_values(M, normalize=True, sort=True, desc=True, power=True, alpha = 0.75) # Miscellaneous # colored text and background def print_red(text): print("\033[91m {}\033[00m" .format(text)) def print_green(text): print("\033[92m {}\033[00m" .format(text)) def print_yellow(text): print("\033[93m {}\033[00m" .format(text)) def print_purple(text): print("\033[94m {}\033[00m" .format(text)) def print_cyan(text): print("\033[96m {}\033[00m" .format(text)) def print_gray(text): print("\033[97m {}\033[00m" .format(text))
def goodness(x, y): xx = x - np.average(x) yy = y - np.average(y) a = np.sqrt(np.inner(xx, xx)) b = np.sqrt(np.inner(yy, yy)) return np.inner(xx / A, yy / B) def argminrnd(items, target): candidates = np.where(target == target.min())[0] return items[random.choice(candidates)] def argmaxrnd(items, target): return argminrnd(items, -target) def gen_values(size, a=1, b=100, normalize=False, sort=False, desc=False, power=False, alpha=2): if not power: x = np.array(list(map(lambda x: random.randint(a, b), range(size)))) else: x = np.exp(alpha * np.array(list(map(lambda x: random.expovariate(1), range(size))))) if normalize: x = x / x.sum() if sort: x = np.sort(x) if desc: x = x[::-1] return x def print_red(text): print('\x1b[91m {}\x1b[00m'.format(text)) def print_green(text): print('\x1b[92m {}\x1b[00m'.format(text)) def print_yellow(text): print('\x1b[93m {}\x1b[00m'.format(text)) def print_purple(text): print('\x1b[94m {}\x1b[00m'.format(text)) def print_cyan(text): print('\x1b[96m {}\x1b[00m'.format(text)) def print_gray(text): print('\x1b[97m {}\x1b[00m'.format(text))
zahlen = [] with open('AdventOfCode_01_1_Input.txt') as f: for zeile in f: zahlen.append(int(zeile)) print(sum(zahlen))
zahlen = [] with open('AdventOfCode_01_1_Input.txt') as f: for zeile in f: zahlen.append(int(zeile)) print(sum(zahlen))
if __name__ == '__main__': a = 2,4 b = 1, c = b d = c # a, b = c, d print(c) print(d) a, b = b, a print(a, b) # Sets contains non duplicate items
if __name__ == '__main__': a = (2, 4) b = (1,) c = b d = c print(c) print(d) (a, b) = (b, a) print(a, b)
class BitDecoder: def encode(self, morse_msg, morse_format, timing): if isinstance(morse_msg, int): morse_msg = bin(morse_msg)[2:] symbol_gap = '0' * timing.intra_char char_gap = '0' * timing.inter_char word_gap = '0' * timing.inter_word words = morse_msg.split(morse_format.inter_word) encoded_word = [] for w in words: encoded_char = [] for morse_char in w.split(morse_format.inter_char): encoded_symbol = [] if morse_format.intra_char: morse_char = morse_char.split(morse_format.intra_char) if not morse_char: raise ValueError(f'Invalid morse word: "{w}"') for symbol in morse_char: encoded_symbol.append( self.encode_symbol(symbol, morse_format, timing)) encoded_char.append(symbol_gap.join(encoded_symbol)) encoded_word.append(char_gap.join(encoded_char)) return word_gap.join(encoded_word) def encode_symbol(self, symbol, morse_format, timing): if symbol not in (morse_format.dot, morse_format.dash): raise ValueError(f'Invalid morse simbol: "{symbol}"') duration = timing.dot if symbol == morse_format.dot else timing.dash return '1' * duration def decode(self, bit_msg, morse_format): pass
class Bitdecoder: def encode(self, morse_msg, morse_format, timing): if isinstance(morse_msg, int): morse_msg = bin(morse_msg)[2:] symbol_gap = '0' * timing.intra_char char_gap = '0' * timing.inter_char word_gap = '0' * timing.inter_word words = morse_msg.split(morse_format.inter_word) encoded_word = [] for w in words: encoded_char = [] for morse_char in w.split(morse_format.inter_char): encoded_symbol = [] if morse_format.intra_char: morse_char = morse_char.split(morse_format.intra_char) if not morse_char: raise value_error(f'Invalid morse word: "{w}"') for symbol in morse_char: encoded_symbol.append(self.encode_symbol(symbol, morse_format, timing)) encoded_char.append(symbol_gap.join(encoded_symbol)) encoded_word.append(char_gap.join(encoded_char)) return word_gap.join(encoded_word) def encode_symbol(self, symbol, morse_format, timing): if symbol not in (morse_format.dot, morse_format.dash): raise value_error(f'Invalid morse simbol: "{symbol}"') duration = timing.dot if symbol == morse_format.dot else timing.dash return '1' * duration def decode(self, bit_msg, morse_format): pass
class Dog: def __init__(self, name, age): self.name = name self.age = age # print(name) # below method will return us the attribute value of the object # getter def get_name(self): return self.name def get_age(self): return self.age # setter # set the different age def set_age(self, age): self.age = age d = Dog("tyson", 12) d.set_age(25) # d2 = Dog("Delta", 14) # d3 = Dog("Charlie", 10) print(d.get_age()) # print(d.get_name()) # print(d2.get_name()) # print(d.name) # print(d2.name) # print(d3.name)
class Dog: def __init__(self, name, age): self.name = name self.age = age def get_name(self): return self.name def get_age(self): return self.age def set_age(self, age): self.age = age d = dog('tyson', 12) d.set_age(25) print(d.get_age())
#!/usr/bin/env python3 ############################################################################################ # # # Program purpose: Computes the sum and average of n integer numbers (input from the # # user). Stop processing input at input 0. # # Program Author : Happi Yvan <ivensteinpoker@gmail.com> # # Creation Date : January 28, 2019 # # # ############################################################################################ def do_suming(input_mess: str) -> dict: user_data, cont, main_sum = '', True, 0 count = 0 while cont: try: user_data = int(input(input_mess)) if user_data == 0: cont = False else: main_sum += user_data count += 1 except ValueError as ve: print(f'[ERROR]: {ve}') return dict(main_sum=main_sum, count=count) def do_computation(): data_info = do_suming(input_mess='Enter an integer [0 to quit]: ') main_sum = data_info['main_sum'] average = data_info['main_sum'] / data_info['count'] print('-' * 30) print(f' Sum is: {main_sum}') print(f'Average: {average}') if __name__ == "__main__": do_computation()
def do_suming(input_mess: str) -> dict: (user_data, cont, main_sum) = ('', True, 0) count = 0 while cont: try: user_data = int(input(input_mess)) if user_data == 0: cont = False else: main_sum += user_data count += 1 except ValueError as ve: print(f'[ERROR]: {ve}') return dict(main_sum=main_sum, count=count) def do_computation(): data_info = do_suming(input_mess='Enter an integer [0 to quit]: ') main_sum = data_info['main_sum'] average = data_info['main_sum'] / data_info['count'] print('-' * 30) print(f' Sum is: {main_sum}') print(f'Average: {average}') if __name__ == '__main__': do_computation()
library_list = [ 'esoctiostan', 'esohststan', 'esookestan', 'esowdstan', 'esoxshooter', 'ing_oke', 'ing_sto', 'ing_og', 'ing_mas', 'ing_fg', 'irafblackbody', 'irafbstdscal', 'irafctiocal', 'irafctionewcal', 'irafiidscal', 'irafirscal', 'irafoke1990', 'irafredcal', 'irafspec16cal', 'irafspec50cal', 'irafspechayescal' ] # https://www.eso.org/sci/observing/tools/standards/spectra/hamuystandards.html esoctiostan = [ 'cd32d9927', 'cd_34d241', 'eg21', 'eg274', 'feige110', 'feige56', 'hilt600', 'hr1544', 'hr3454', 'hr4468', 'hr4963', 'hr5501', 'hr718', 'hr7596', 'hr7950', 'hr8634', 'hr9087', 'ltt1020', 'ltt1788', 'ltt2415', 'ltt3218', 'ltt3864', 'ltt4364', 'ltt4816', 'ltt6248', 'ltt7379', 'ltt745', 'ltt7987', 'ltt9239', 'ltt9491' ] # https://www.eso.org/sci/observing/tools/standards/spectra/hststandards.html esohststan = [ 'agk81d266', 'bd28d4211', 'bd33d2642', 'bd75d325', 'bpm16274', 'feige110', 'feige34', 'g191b2b', 'g93_48', 'gd108', 'gd50', 'grw70d5824', 'hd49798', 'hd60753', 'hd93521', 'hr153', 'hr1996', 'hr4554', 'hr5191', 'hr7001', 'hz2', 'hz21', 'hz4', 'hz44', 'lb227', 'lds749b', 'ngc7293' ] # https://www.eso.org/sci/observing/tools/standards/spectra/okestandards_rev.html esookestan = [ 'bd25d4655', 'bd28d4211', 'bd33d2642', 'bd75d325', 'feige110', 'feige34', 'feige66', 'feige67', 'g138_31', 'g158_100', 'g191b2b', 'g193_74', 'g24_9', 'g60_54', 'gd108', 'gd248', 'gd50', 'grw70d5824', 'hd93521', 'hz21', 'hz4', 'hz44', 'ltt9491', 'ngc7293', 'sa95_42' ] # https://www.eso.org/sci/observing/tools/standards/spectra/wdstandards.html esowdstan = [ 'agk_81d266_005', 'alpha_lyr_004', 'bd_25d4655_002', 'bd_28d4211_005', 'bd_33d2642_004', 'bd_75d325_005', 'feige110_005', 'feige34_005', 'feige66_002', 'feige67_002', 'g93_48_004', 'gd108_005', 'gd50_004', 'gd71', 'grw_70d5824_005', 'hd93521_005', 'hz21_005', 'hz2_005', 'hz44_005', 'hz4_004', 'lb227_004', 'lds749b_005', 'ltt9491_002', 'ngc7293_005' ] # https://www.eso.org/sci/observing/tools/standards/spectra/Xshooterspec.html esoxshooter = ['EG274', 'Feige110', 'GD153', 'GD71', 'LTT3218', 'LTT7987'] # http://www.ing.iac.es/Astronomy/observing/manuals/html_manuals/tech_notes/tn065-100/workflux.html ing_oke = [ 'bd254', 'bd28', 'bd33', 'bd75', 'erib', 'f110', 'f24', 'f34', 'f66', 'f67', 'g138', 'g158', 'g191new', 'g191old', 'g193', 'g24', 'g47', 'g60', 'g99', 'gd108', 'gd140', 'gd190', 'gd248', 'gd50', 'grw705new', 'grw705old', 'grw708', 'grw73', 'hd935', 'he3', 'hz14', 'hz2', 'hz21', 'hz29', 'hz43', 'hz44new', 'hz44old', 'hz4new', 'hz4old', 'hz7', 'l1363', 'l1512', 'l745', 'l870', 'l930', 'l970', 'lb1240', 'lb227', 'lds235', 'lds749', 'ltt', 'ngc', 'r627', 'r640', 'sa29', 'sa95', 't573', 'w1346', 'w485' ] ing_sto = [ 'bd08', 'bd253', 'bd28', 'bd33', 'bd40', 'f110', 'f15', 'f25', 'f34', 'f56', 'f92', 'f98', 'h102', 'h600', 'hz15', 'k27' ] ing_og = ['bd17', 'bd26', 'hd194', 'hd849'] ing_mas = [ 'bd28', 'cyg', 'eg81', 'f110', 'f34', 'f66', 'f67', 'g191', 'gd140', 'h600', 'hd192', 'hd217', 'hz14', 'hz44', 'pg0205', 'pg0216', 'pg0310', 'pg0823', 'pg0846', 'pg0934', 'pg0939', 'pg1121', 'pg1545', 'pg1708', 'w1346' ] ing_fg = ['g138', 'g158', 'g24', 'gd248'] # The following iraf standards refer to: # https://github.com/iraf-community/iraf/tree/master/noao/lib/onedstds irafblackbody = ['U', 'B', 'V', 'R', 'I', 'J', 'H', 'K', 'L', 'Lprime', 'M'] irafbstdscal = [ 'hr718', 'hr3454', 'hr3982', 'hr4468', 'hr4534', 'hr5191', 'hr5511', 'hr7001', 'hr7596', 'hr7950', 'hr8634', 'hr9087', 'hr15318', 'hr74280', 'hr100889', 'hr188350', 'hr198001', 'hr214923', 'hr224926' ] irafctiocal = [ 'bd8', 'bd25', 'bd73632', 'cd32', 'eg11', 'eg21', 'eg26', 'eg31', 'eg54', 'eg63', 'eg76', 'eg79', 'eg99', 'eg139', 'eg149', 'eg158', 'eg248', 'eg274', 'f15', 'f25', 'f56', 'f98', 'f110', 'feige15', 'feige25', 'feige56', 'feige98', 'feige110', 'g2631', 'g9937', 'g16350', 'h600', 'hz2', 'hz4', 'hz15', 'kopf27', 'l377', 'l1020', 'l1788', 'l2415', 'l2511', 'l3218', 'l3864', 'l4364', 'l4816', 'l6248', 'l7379', 'l7987', 'l8702', 'l9239', 'l9491', 'l74546', 'l93080', 'l97030', 'lds235', 'lds749', 'ltt4099', 'ltt8702', 'rose627', 'w1346', 'w485a', 'wolf1346', 'wolf485a' ] irafctionewcal = [ 'cd32', 'eg21', 'eg274', 'f56', 'f110', 'h600', 'l377', 'l745', 'l1020', 'l1788', 'l2415', 'l2511', 'l3218', 'l3864', 'l4364', 'l4816', 'l6248', 'l7379', 'l7987', 'l9239', 'l9491', 'cd32blue', 'eg21blue', 'eg274blue', 'f56blue', 'f110blue', 'h600blue', 'l377blue', 'l1020blue', 'l1788blue', 'l2415blue', 'l2511blue', 'l3218blue', 'l3864blue', 'l4364blue', 'l4816blue', 'l6248blue', 'l7379blue', 'l7987blue', 'l9239blue', 'l9491blue', 'cd32red', 'eg21red', 'eg274red', 'f56red', 'f110red', 'h600red', 'l377red', 'l745red', 'l1020red', 'l1788red', 'l2415red', 'l2511red', 'l3218red', 'l3864red', 'l4364red', 'l4816red', 'l6248red', 'l7379red', 'l7987red', 'l9239red', 'l9491red' ] irafiidscal = [ '40erib', 'amcvn', 'bd7781', 'bd73632', 'bd82015', 'bd253941', 'bd284211', 'bd332642', 'bd404032', 'eg11', 'eg20', 'eg26', 'eg28', 'eg29', 'eg31', 'eg33', 'eg39', 'eg42', 'eg50', 'eg54', 'eg63', 'eg67', 'eg71', 'eg76', 'eg77', 'eg79', 'eg91', 'eg98', 'eg99', 'eg102', 'eg119', 'eg129', 'eg139', 'eg144', 'eg145', 'eg148', 'eg149', 'eg158', 'eg162', 'eg182', 'eg184', 'eg193', 'eg247', 'eg248', 'feige15', 'feige24', 'feige25', 'feige34', 'feige56', 'feige92', 'feige98', 'feige110', 'g88', 'g2610', 'g2631', 'g4718', 'g9937', 'g12627', 'g14563', 'g16350', 'g191b2b', 'gd128', 'gd140', 'gd190', 'gh7112', 'grw705824', 'grw708247', 'grw738031', 'he3', 'hz2', 'hz4', 'hz7', 'hz14', 'hz15', 'hz29', 'hz43', 'hz44', 'kopff27', 'hiltner102', 'hiltner600', 'l8702', 'l13633', 'l14094', 'l74546a', 'l93080', 'l97030', 'l140349', 'l151234b', 'lft1655', 'lb227', 'lb1240', 'lds235b', 'lds749b', 'lp414101', 'ltt4099', 'ltt8702', 'ltt13002', 'ltt16294', 'ross627', 'ross640', 'sa29130', 'sao131065', 'ton573', 'wolf1346', 'wolf485a' ] irafirscal = [ 'bd082015', 'bd174708', 'bd253941', 'bd262606', 'bd284211', 'bd332642', 'bd404032', 'eg50', 'eg71', 'eg139', 'eg158', 'eg247', 'feige15', 'feige25', 'feige34', 'feige56', 'feige92', 'feige98', 'feige110', 'g191b2b', 'hd2857', 'hd17520', 'hd19445', 'hd60778', 'hd74721', 'hd84937', 'hd86986', 'hd109995', 'hd117880', 'hd161817', 'hd192281', 'hd217086', 'he3', 'hiltner102', 'hiltner600', 'hr7001', 'hz44', 'kopff27', 'wolf1346' ] irafoke1990 = [ 'bd75325', 'bd284211', 'feige34', 'feige67', 'feige110', 'g249', 'g13831', 'g191b2b', 'g19374', 'gd108', 'gd248', 'hz21', 'ltt9491', 'eg71', 'eg158', 'eg247' ] irafredcal = [ '40erib', 'amcvn', 'bd7781', 'bd73632', 'bd174708', 'bd262606', 'eg20', 'eg33', 'eg50', 'eg54', 'eg63', 'eg67', 'eg76', 'eg79', 'eg91', 'eg98', 'eg99', 'eg102', 'eg119', 'eg129', 'eg139', 'eg144', 'eg145', 'eg148', 'eg149', 'eg158', 'eg162', 'eg182', 'eg184', 'eg193', 'eg247', 'eg248', 'feige24', 'g2610', 'g2631', 'g4718', 'g9937', 'g12627', 'g14563', 'g16350', 'g191b2b', 'gd140', 'gd190', 'grw705824', 'grw708247', 'grw738031', 'hd19445', 'hd84937', 'he3', 'hz29', 'hz43', 'hz44', 'l13633', 'l14094', 'l151234b', 'l74546a', 'l93080', 'l97030', 'lds235b', 'lds749b', 'lft1655', 'ltt4099', 'ltt8702', 'ltt16294', 'ross627', 'ross640', 'sa29130', 'sao131065', 'wolf1346', 'wolf485a' ] irafspec16cal = [ 'hd15318', 'hd30739', 'hd74280', 'hd100889', 'hd114330', 'hd129956', 'hd188350', 'hd198001', 'hd214923', 'hd224926', 'hr718', 'hr1544', 'hr3454', 'hr4468', 'hr4963', 'hr5501', 'hr7596', 'hr7950', 'hr8634', 'hr9087', 'hd15318blue', 'hd30739blue', 'hd74280blue', 'hd100889blue', 'hd114330blue', 'hd129956blue', 'hd188350blue', 'hd198001blue', 'hd214923blue', 'hd224926blue', 'hr718blue', 'hr1544blue', 'hr3454blue', 'hr4468blue', 'hr4963blue', 'hr5501blue', 'hr7596blue', 'hr7950blue', 'hr8634blue', 'hr9087blue', 'hd15318red', 'hd30739red', 'hd74280red', 'hd100889red', 'hd114330red', 'hd129956red', 'hd188350red', 'hd198001red', 'hd214923red', 'hd224926red', 'hr718red', 'hr1544red', 'hr3454red', 'hr4468red', 'hr4963red', 'hr5501red', 'hr7596red', 'hr7950red', 'hr8634red', 'hr9087red' ] irafspec50cal = [ 'bd284211', 'cygob2no9', 'eg20', 'eg42', 'eg71', 'eg81', 'eg139', 'eg158', 'eg247', 'feige34', 'feige66', 'feige67', 'feige110', 'g191b2b', 'gd140', 'hd192281', 'hd217086', 'hilt600', 'hz14', 'hz44', 'pg0205134', 'pg0216032', 'pg0310149', 'pg0823546', 'pg0846249', 'pg0934554', 'pg0939262', 'pg1121145', 'pg1545035', 'pg1708602', 'wolf1346' ] irafspechayescal = [ 'bd284211', 'cygob2no9', 'eg42', 'eg71', 'eg81', 'eg139', 'eg158', 'eg247', 'feige34', 'feige66', 'feige67', 'feige110', 'g191b2b', 'gd140', 'hd192281', 'hd217086', 'hilt600', 'hz14', 'hz44', 'pg0205134', 'pg0216032', 'pg0310149', 'pg0823546', 'pg0846249', 'pg0934554', 'pg0939262', 'pg1121145', 'pg1545035', 'pg1708602', 'wolf1346' ]
library_list = ['esoctiostan', 'esohststan', 'esookestan', 'esowdstan', 'esoxshooter', 'ing_oke', 'ing_sto', 'ing_og', 'ing_mas', 'ing_fg', 'irafblackbody', 'irafbstdscal', 'irafctiocal', 'irafctionewcal', 'irafiidscal', 'irafirscal', 'irafoke1990', 'irafredcal', 'irafspec16cal', 'irafspec50cal', 'irafspechayescal'] esoctiostan = ['cd32d9927', 'cd_34d241', 'eg21', 'eg274', 'feige110', 'feige56', 'hilt600', 'hr1544', 'hr3454', 'hr4468', 'hr4963', 'hr5501', 'hr718', 'hr7596', 'hr7950', 'hr8634', 'hr9087', 'ltt1020', 'ltt1788', 'ltt2415', 'ltt3218', 'ltt3864', 'ltt4364', 'ltt4816', 'ltt6248', 'ltt7379', 'ltt745', 'ltt7987', 'ltt9239', 'ltt9491'] esohststan = ['agk81d266', 'bd28d4211', 'bd33d2642', 'bd75d325', 'bpm16274', 'feige110', 'feige34', 'g191b2b', 'g93_48', 'gd108', 'gd50', 'grw70d5824', 'hd49798', 'hd60753', 'hd93521', 'hr153', 'hr1996', 'hr4554', 'hr5191', 'hr7001', 'hz2', 'hz21', 'hz4', 'hz44', 'lb227', 'lds749b', 'ngc7293'] esookestan = ['bd25d4655', 'bd28d4211', 'bd33d2642', 'bd75d325', 'feige110', 'feige34', 'feige66', 'feige67', 'g138_31', 'g158_100', 'g191b2b', 'g193_74', 'g24_9', 'g60_54', 'gd108', 'gd248', 'gd50', 'grw70d5824', 'hd93521', 'hz21', 'hz4', 'hz44', 'ltt9491', 'ngc7293', 'sa95_42'] esowdstan = ['agk_81d266_005', 'alpha_lyr_004', 'bd_25d4655_002', 'bd_28d4211_005', 'bd_33d2642_004', 'bd_75d325_005', 'feige110_005', 'feige34_005', 'feige66_002', 'feige67_002', 'g93_48_004', 'gd108_005', 'gd50_004', 'gd71', 'grw_70d5824_005', 'hd93521_005', 'hz21_005', 'hz2_005', 'hz44_005', 'hz4_004', 'lb227_004', 'lds749b_005', 'ltt9491_002', 'ngc7293_005'] esoxshooter = ['EG274', 'Feige110', 'GD153', 'GD71', 'LTT3218', 'LTT7987'] ing_oke = ['bd254', 'bd28', 'bd33', 'bd75', 'erib', 'f110', 'f24', 'f34', 'f66', 'f67', 'g138', 'g158', 'g191new', 'g191old', 'g193', 'g24', 'g47', 'g60', 'g99', 'gd108', 'gd140', 'gd190', 'gd248', 'gd50', 'grw705new', 'grw705old', 'grw708', 'grw73', 'hd935', 'he3', 'hz14', 'hz2', 'hz21', 'hz29', 'hz43', 'hz44new', 'hz44old', 'hz4new', 'hz4old', 'hz7', 'l1363', 'l1512', 'l745', 'l870', 'l930', 'l970', 'lb1240', 'lb227', 'lds235', 'lds749', 'ltt', 'ngc', 'r627', 'r640', 'sa29', 'sa95', 't573', 'w1346', 'w485'] ing_sto = ['bd08', 'bd253', 'bd28', 'bd33', 'bd40', 'f110', 'f15', 'f25', 'f34', 'f56', 'f92', 'f98', 'h102', 'h600', 'hz15', 'k27'] ing_og = ['bd17', 'bd26', 'hd194', 'hd849'] ing_mas = ['bd28', 'cyg', 'eg81', 'f110', 'f34', 'f66', 'f67', 'g191', 'gd140', 'h600', 'hd192', 'hd217', 'hz14', 'hz44', 'pg0205', 'pg0216', 'pg0310', 'pg0823', 'pg0846', 'pg0934', 'pg0939', 'pg1121', 'pg1545', 'pg1708', 'w1346'] ing_fg = ['g138', 'g158', 'g24', 'gd248'] irafblackbody = ['U', 'B', 'V', 'R', 'I', 'J', 'H', 'K', 'L', 'Lprime', 'M'] irafbstdscal = ['hr718', 'hr3454', 'hr3982', 'hr4468', 'hr4534', 'hr5191', 'hr5511', 'hr7001', 'hr7596', 'hr7950', 'hr8634', 'hr9087', 'hr15318', 'hr74280', 'hr100889', 'hr188350', 'hr198001', 'hr214923', 'hr224926'] irafctiocal = ['bd8', 'bd25', 'bd73632', 'cd32', 'eg11', 'eg21', 'eg26', 'eg31', 'eg54', 'eg63', 'eg76', 'eg79', 'eg99', 'eg139', 'eg149', 'eg158', 'eg248', 'eg274', 'f15', 'f25', 'f56', 'f98', 'f110', 'feige15', 'feige25', 'feige56', 'feige98', 'feige110', 'g2631', 'g9937', 'g16350', 'h600', 'hz2', 'hz4', 'hz15', 'kopf27', 'l377', 'l1020', 'l1788', 'l2415', 'l2511', 'l3218', 'l3864', 'l4364', 'l4816', 'l6248', 'l7379', 'l7987', 'l8702', 'l9239', 'l9491', 'l74546', 'l93080', 'l97030', 'lds235', 'lds749', 'ltt4099', 'ltt8702', 'rose627', 'w1346', 'w485a', 'wolf1346', 'wolf485a'] irafctionewcal = ['cd32', 'eg21', 'eg274', 'f56', 'f110', 'h600', 'l377', 'l745', 'l1020', 'l1788', 'l2415', 'l2511', 'l3218', 'l3864', 'l4364', 'l4816', 'l6248', 'l7379', 'l7987', 'l9239', 'l9491', 'cd32blue', 'eg21blue', 'eg274blue', 'f56blue', 'f110blue', 'h600blue', 'l377blue', 'l1020blue', 'l1788blue', 'l2415blue', 'l2511blue', 'l3218blue', 'l3864blue', 'l4364blue', 'l4816blue', 'l6248blue', 'l7379blue', 'l7987blue', 'l9239blue', 'l9491blue', 'cd32red', 'eg21red', 'eg274red', 'f56red', 'f110red', 'h600red', 'l377red', 'l745red', 'l1020red', 'l1788red', 'l2415red', 'l2511red', 'l3218red', 'l3864red', 'l4364red', 'l4816red', 'l6248red', 'l7379red', 'l7987red', 'l9239red', 'l9491red'] irafiidscal = ['40erib', 'amcvn', 'bd7781', 'bd73632', 'bd82015', 'bd253941', 'bd284211', 'bd332642', 'bd404032', 'eg11', 'eg20', 'eg26', 'eg28', 'eg29', 'eg31', 'eg33', 'eg39', 'eg42', 'eg50', 'eg54', 'eg63', 'eg67', 'eg71', 'eg76', 'eg77', 'eg79', 'eg91', 'eg98', 'eg99', 'eg102', 'eg119', 'eg129', 'eg139', 'eg144', 'eg145', 'eg148', 'eg149', 'eg158', 'eg162', 'eg182', 'eg184', 'eg193', 'eg247', 'eg248', 'feige15', 'feige24', 'feige25', 'feige34', 'feige56', 'feige92', 'feige98', 'feige110', 'g88', 'g2610', 'g2631', 'g4718', 'g9937', 'g12627', 'g14563', 'g16350', 'g191b2b', 'gd128', 'gd140', 'gd190', 'gh7112', 'grw705824', 'grw708247', 'grw738031', 'he3', 'hz2', 'hz4', 'hz7', 'hz14', 'hz15', 'hz29', 'hz43', 'hz44', 'kopff27', 'hiltner102', 'hiltner600', 'l8702', 'l13633', 'l14094', 'l74546a', 'l93080', 'l97030', 'l140349', 'l151234b', 'lft1655', 'lb227', 'lb1240', 'lds235b', 'lds749b', 'lp414101', 'ltt4099', 'ltt8702', 'ltt13002', 'ltt16294', 'ross627', 'ross640', 'sa29130', 'sao131065', 'ton573', 'wolf1346', 'wolf485a'] irafirscal = ['bd082015', 'bd174708', 'bd253941', 'bd262606', 'bd284211', 'bd332642', 'bd404032', 'eg50', 'eg71', 'eg139', 'eg158', 'eg247', 'feige15', 'feige25', 'feige34', 'feige56', 'feige92', 'feige98', 'feige110', 'g191b2b', 'hd2857', 'hd17520', 'hd19445', 'hd60778', 'hd74721', 'hd84937', 'hd86986', 'hd109995', 'hd117880', 'hd161817', 'hd192281', 'hd217086', 'he3', 'hiltner102', 'hiltner600', 'hr7001', 'hz44', 'kopff27', 'wolf1346'] irafoke1990 = ['bd75325', 'bd284211', 'feige34', 'feige67', 'feige110', 'g249', 'g13831', 'g191b2b', 'g19374', 'gd108', 'gd248', 'hz21', 'ltt9491', 'eg71', 'eg158', 'eg247'] irafredcal = ['40erib', 'amcvn', 'bd7781', 'bd73632', 'bd174708', 'bd262606', 'eg20', 'eg33', 'eg50', 'eg54', 'eg63', 'eg67', 'eg76', 'eg79', 'eg91', 'eg98', 'eg99', 'eg102', 'eg119', 'eg129', 'eg139', 'eg144', 'eg145', 'eg148', 'eg149', 'eg158', 'eg162', 'eg182', 'eg184', 'eg193', 'eg247', 'eg248', 'feige24', 'g2610', 'g2631', 'g4718', 'g9937', 'g12627', 'g14563', 'g16350', 'g191b2b', 'gd140', 'gd190', 'grw705824', 'grw708247', 'grw738031', 'hd19445', 'hd84937', 'he3', 'hz29', 'hz43', 'hz44', 'l13633', 'l14094', 'l151234b', 'l74546a', 'l93080', 'l97030', 'lds235b', 'lds749b', 'lft1655', 'ltt4099', 'ltt8702', 'ltt16294', 'ross627', 'ross640', 'sa29130', 'sao131065', 'wolf1346', 'wolf485a'] irafspec16cal = ['hd15318', 'hd30739', 'hd74280', 'hd100889', 'hd114330', 'hd129956', 'hd188350', 'hd198001', 'hd214923', 'hd224926', 'hr718', 'hr1544', 'hr3454', 'hr4468', 'hr4963', 'hr5501', 'hr7596', 'hr7950', 'hr8634', 'hr9087', 'hd15318blue', 'hd30739blue', 'hd74280blue', 'hd100889blue', 'hd114330blue', 'hd129956blue', 'hd188350blue', 'hd198001blue', 'hd214923blue', 'hd224926blue', 'hr718blue', 'hr1544blue', 'hr3454blue', 'hr4468blue', 'hr4963blue', 'hr5501blue', 'hr7596blue', 'hr7950blue', 'hr8634blue', 'hr9087blue', 'hd15318red', 'hd30739red', 'hd74280red', 'hd100889red', 'hd114330red', 'hd129956red', 'hd188350red', 'hd198001red', 'hd214923red', 'hd224926red', 'hr718red', 'hr1544red', 'hr3454red', 'hr4468red', 'hr4963red', 'hr5501red', 'hr7596red', 'hr7950red', 'hr8634red', 'hr9087red'] irafspec50cal = ['bd284211', 'cygob2no9', 'eg20', 'eg42', 'eg71', 'eg81', 'eg139', 'eg158', 'eg247', 'feige34', 'feige66', 'feige67', 'feige110', 'g191b2b', 'gd140', 'hd192281', 'hd217086', 'hilt600', 'hz14', 'hz44', 'pg0205134', 'pg0216032', 'pg0310149', 'pg0823546', 'pg0846249', 'pg0934554', 'pg0939262', 'pg1121145', 'pg1545035', 'pg1708602', 'wolf1346'] irafspechayescal = ['bd284211', 'cygob2no9', 'eg42', 'eg71', 'eg81', 'eg139', 'eg158', 'eg247', 'feige34', 'feige66', 'feige67', 'feige110', 'g191b2b', 'gd140', 'hd192281', 'hd217086', 'hilt600', 'hz14', 'hz44', 'pg0205134', 'pg0216032', 'pg0310149', 'pg0823546', 'pg0846249', 'pg0934554', 'pg0939262', 'pg1121145', 'pg1545035', 'pg1708602', 'wolf1346']
class CharacterComponent: def __init__(self, name): self.name=name def equip(self): pass class CharacterConcreteComponent(CharacterComponent): def equip(self): return f'{self.name} equipment:' class Decorator(CharacterComponent): _character: CharacterComponent def __init__(self, _character:CharacterComponent): self._character=_character def equip(self): return self._character.equip() class ArmorConcreteDecorator(Decorator): def equip(self): return f'{self._character.equip()}\nArmor: Yes' class SwordConcreteDecorator(Decorator): def equip(self): return f'{self._character.equip()}\nSword: Yes' class RingConcreteDecorator(Decorator): def equip(self): return f'{self._character.equip()}\nRing: Yes' class NecklaceConcreteDecorator(Decorator): def equip(self): return f'{self._character.equip()}\nNecklace: Yes'
class Charactercomponent: def __init__(self, name): self.name = name def equip(self): pass class Characterconcretecomponent(CharacterComponent): def equip(self): return f'{self.name} equipment:' class Decorator(CharacterComponent): _character: CharacterComponent def __init__(self, _character: CharacterComponent): self._character = _character def equip(self): return self._character.equip() class Armorconcretedecorator(Decorator): def equip(self): return f'{self._character.equip()}\nArmor: Yes' class Swordconcretedecorator(Decorator): def equip(self): return f'{self._character.equip()}\nSword: Yes' class Ringconcretedecorator(Decorator): def equip(self): return f'{self._character.equip()}\nRing: Yes' class Necklaceconcretedecorator(Decorator): def equip(self): return f'{self._character.equip()}\nNecklace: Yes'
# Code on Python 3.7.4 # Working @ Dec, 2020 # david-boo.github.io # Define sequences. Then put two strings together to produce the list of pairs that we wish to compare, and a filter returns just those pairs for which seq1 != seq2 # Taking the length of the filtered list gives us the Hamming distance seq1='AAAGAAAACGCCAACCCCCCCCCGTGCTGCAGTCTTGATTGCTGTATGAGAGATCCGGCCCTGTACGCGGTCCCCGTAGGACACTCACAGACGTCCACAGTTCTAGAAGAAGCGCTTATTCGTATTCGTCGACCTGTCCCCTGCTCCGTCCAGCGGTTAGAGTCCTACATGTACGTTGGAAGAGCACTCCCGACCGGTGCGGTTAGTACATCTTTTGTGATTTCCGAGTTCCGTGAAGGGGAGACCGATATGTACGCTCAGCATATGTCGATGCTGCAACGTGCATAAGGACGTAGACGGATACGCACAGTGATGTAAGCTTTGGACCTTGGGCCTCTACGACCTACACACGAACAGTAGTTCACACCCCTGCGCTACCGAGCATGCACTAGCGGCAGTCTTTCTCCTCCGAACGCGCCAAAGAAAATTGAATAGCTATCACCGTGCATGGGCGTGATGTGGAGTCAACATTCAGTTTGGAAAGTTCTTGCATATGTGGTCATGTACTGAGTTGTCTTCCAAGACTGCGAAATTTTCGATGCAGCGGCAACAACCGTACGTTACGCACAACTAGTAGTGGAGTTCTTGACCTTTTCGGGCAGAGTCATGCCCACCTAGCATCGCTTAAAGTCCGTAAGAAGCTATCATGGACCCACGCACGCGGGGCTTGTGAGCTAATATATCCCTGCGGGAGAAACCGAAACGGGGTAGATGGAGCGGAGCCATAGGGACACGCGGCGGCTGTTAGACACTGATGGAGCAGTTGACGGCATTTCCTACGCTAACTATCAGGGAGGGGCCCAGTACAAATCACTTCTTTAGCTATAGTTACGTGCGGACATTAGCTTTTAGTAGCTCATGGCGAATGATTTAACTAAATACCGCCACTATTGCGGGGGTACTGTTTCCCCGTTTCACAAATTTACGCGTTACCTCCCCCTTCTTAGTAGCG' seq2='CAGTATAATAACAACCCCCTACCTAGCGGCATTCAGGGACTCGTCACAACTGATACGCCACTGATCGCGAAAGAACTGGCCAACTAAGCTAGGTGCATTCTATTATCAGAATTCAATTTTCGTATTCGAGGCACGTTCGACAGAACTCGACACTGGTCCGAGTTCCGCTTATAGATTTAACATCAGGCTCTCAAGAACGCGGCTAGAATCTCCTGCGGTGACTCCAAGGTCCATCAAGGTGGGAGTAGCGTCACCGCTCCTGATCCATCAATGACATAACAGGCCGTAGAGCGGTATCAGATGTGCTGAGTACCGTAATCATTGAGGGTTTGGGATGAAGAACGAAAGCAGGGCCTCTGGCTCACATACACTCCCTACCCAGTATGCGCTGACTGGCGTCGTTATGGTAGTAACCCGCAGAGTTCTAGTGAAAGGGGTCGTTCAGGCAAATACCGCGAGTGGGATAAATTGTCGCGCTGAGAAGGAATCGAATATGTCCTAACACACGCTGTCTTTCGATATGACGACGCCTTTCTAGATTCCTAGTCAACAGATGCACCCTAAGTACGACGAGAATAGTACAGCTCGACTTCCTCCGGGTGAGTCTTGCCCGAGAAGGCGAGCGCACAACAGATGGGTTGGTATATGCTGGGCCGACGCTGGGGACGCTGGCGGAGAGATTCGTGACTAGGAGGAGGCCAGACAAGGTTCGGGTAGGGGAGGATTAGATATCCGTGGGTATCGGTAAACCTGTGTAGGGGTGTCAATTGCGGTTCTGAGGTATACACTGAGACAAGGGCCAAACACTGATGACGACTGTAGCTGGACATACATAGCGGCACTAGTTAGAAGCAGCTGCCTTTCCACGACCAAAGTAGCCTATGTTCTCACTGGGGGGCTCCCGACTTAGGCCATCCCAACCGTGCGCCACTCGTTATATTCATAAGAGGGC' print(sum(map(lambda x, y: 0 if x == y else 1, seq1, seq2)))
seq1 = 'AAAGAAAACGCCAACCCCCCCCCGTGCTGCAGTCTTGATTGCTGTATGAGAGATCCGGCCCTGTACGCGGTCCCCGTAGGACACTCACAGACGTCCACAGTTCTAGAAGAAGCGCTTATTCGTATTCGTCGACCTGTCCCCTGCTCCGTCCAGCGGTTAGAGTCCTACATGTACGTTGGAAGAGCACTCCCGACCGGTGCGGTTAGTACATCTTTTGTGATTTCCGAGTTCCGTGAAGGGGAGACCGATATGTACGCTCAGCATATGTCGATGCTGCAACGTGCATAAGGACGTAGACGGATACGCACAGTGATGTAAGCTTTGGACCTTGGGCCTCTACGACCTACACACGAACAGTAGTTCACACCCCTGCGCTACCGAGCATGCACTAGCGGCAGTCTTTCTCCTCCGAACGCGCCAAAGAAAATTGAATAGCTATCACCGTGCATGGGCGTGATGTGGAGTCAACATTCAGTTTGGAAAGTTCTTGCATATGTGGTCATGTACTGAGTTGTCTTCCAAGACTGCGAAATTTTCGATGCAGCGGCAACAACCGTACGTTACGCACAACTAGTAGTGGAGTTCTTGACCTTTTCGGGCAGAGTCATGCCCACCTAGCATCGCTTAAAGTCCGTAAGAAGCTATCATGGACCCACGCACGCGGGGCTTGTGAGCTAATATATCCCTGCGGGAGAAACCGAAACGGGGTAGATGGAGCGGAGCCATAGGGACACGCGGCGGCTGTTAGACACTGATGGAGCAGTTGACGGCATTTCCTACGCTAACTATCAGGGAGGGGCCCAGTACAAATCACTTCTTTAGCTATAGTTACGTGCGGACATTAGCTTTTAGTAGCTCATGGCGAATGATTTAACTAAATACCGCCACTATTGCGGGGGTACTGTTTCCCCGTTTCACAAATTTACGCGTTACCTCCCCCTTCTTAGTAGCG' seq2 = 'CAGTATAATAACAACCCCCTACCTAGCGGCATTCAGGGACTCGTCACAACTGATACGCCACTGATCGCGAAAGAACTGGCCAACTAAGCTAGGTGCATTCTATTATCAGAATTCAATTTTCGTATTCGAGGCACGTTCGACAGAACTCGACACTGGTCCGAGTTCCGCTTATAGATTTAACATCAGGCTCTCAAGAACGCGGCTAGAATCTCCTGCGGTGACTCCAAGGTCCATCAAGGTGGGAGTAGCGTCACCGCTCCTGATCCATCAATGACATAACAGGCCGTAGAGCGGTATCAGATGTGCTGAGTACCGTAATCATTGAGGGTTTGGGATGAAGAACGAAAGCAGGGCCTCTGGCTCACATACACTCCCTACCCAGTATGCGCTGACTGGCGTCGTTATGGTAGTAACCCGCAGAGTTCTAGTGAAAGGGGTCGTTCAGGCAAATACCGCGAGTGGGATAAATTGTCGCGCTGAGAAGGAATCGAATATGTCCTAACACACGCTGTCTTTCGATATGACGACGCCTTTCTAGATTCCTAGTCAACAGATGCACCCTAAGTACGACGAGAATAGTACAGCTCGACTTCCTCCGGGTGAGTCTTGCCCGAGAAGGCGAGCGCACAACAGATGGGTTGGTATATGCTGGGCCGACGCTGGGGACGCTGGCGGAGAGATTCGTGACTAGGAGGAGGCCAGACAAGGTTCGGGTAGGGGAGGATTAGATATCCGTGGGTATCGGTAAACCTGTGTAGGGGTGTCAATTGCGGTTCTGAGGTATACACTGAGACAAGGGCCAAACACTGATGACGACTGTAGCTGGACATACATAGCGGCACTAGTTAGAAGCAGCTGCCTTTCCACGACCAAAGTAGCCTATGTTCTCACTGGGGGGCTCCCGACTTAGGCCATCCCAACCGTGCGCCACTCGTTATATTCATAAGAGGGC' print(sum(map(lambda x, y: 0 if x == y else 1, seq1, seq2)))
class Solution: def canFormArray(self, arr: List[int], pieces: List[List[int]]) -> bool: x={} f=[] z=[] for i in pieces: x[i[0]]=i l=0 while l<len(arr): if arr[l] in x: f.append(x[arr[l]]) print(f) else: return False print(len(x[arr[l]])) l=l+len(x[arr[l]]) for i in f: for x in i: z.append(x) if z==arr: return True return False
class Solution: def can_form_array(self, arr: List[int], pieces: List[List[int]]) -> bool: x = {} f = [] z = [] for i in pieces: x[i[0]] = i l = 0 while l < len(arr): if arr[l] in x: f.append(x[arr[l]]) print(f) else: return False print(len(x[arr[l]])) l = l + len(x[arr[l]]) for i in f: for x in i: z.append(x) if z == arr: return True return False