content
stringlengths
7
1.05M
fixed_cases
stringlengths
1
1.28M
combs = set() for a in xrange(2,101): for b in xrange(2,101): combs.add(a**b) print(len(combs)) # 9183
combs = set() for a in xrange(2, 101): for b in xrange(2, 101): combs.add(a ** b) print(len(combs))
# ------------------------------ # 417. Pacific Atlantic Water Flow # # Description: # Given an m x n matrix of non-negative integers representing the height of each unit cell in a # continent, the "Pacific ocean" touches the left and top edges of the matrix and the "Atlantic # ocean" touches the right and bottom ed...
class Solution: def pacific_atlantic(self, matrix: List[List[int]]) -> List[List[int]]: if not matrix or not matrix[0]: return res = [] n = len(matrix) m = len(matrix[0]) pacific = [[False for _ in range(m)] for _ in range(n)] atlantic = [[False for _ in ...
class McostGrid(): default_value = 1 def __init__(self): self.grid = [] self.terrain_types = [] self.unit_types = [] @property def row_headers(self): return self.terrain_types @property def column_headers(self): return self.unit_types def set(self,...
class Mcostgrid: default_value = 1 def __init__(self): self.grid = [] self.terrain_types = [] self.unit_types = [] @property def row_headers(self): return self.terrain_types @property def column_headers(self): return self.unit_types def set(self, c...
def sort(arr, exp1): n = len(arr) output = [0] * (n) count = [0] * (10) for i in range(0, n): index = (arr[i]/exp1) count[int((index)%10)] += 1 for i in range(1,10): count[i] += count[i-1] i = n-1 while i>=0: index = (arr[i]/exp1) output[ count[ int((index)%10) ] - 1] = arr[i] count[...
def sort(arr, exp1): n = len(arr) output = [0] * n count = [0] * 10 for i in range(0, n): index = arr[i] / exp1 count[int(index % 10)] += 1 for i in range(1, 10): count[i] += count[i - 1] i = n - 1 while i >= 0: index = arr[i] / exp1 output[count[int(i...
''' import flask as f # give name to flask mode]ule as f print(f.__version__) # see version import sys print(sys.path) import f33var print(f33var.n) '''
""" import flask as f # give name to flask mode]ule as f print(f.__version__) # see version import sys print(sys.path) import f33var print(f33var.n) """
# Remove Duplicates from Sorted List # https://www.interviewbit.com/problems/remove-duplicates-from-sorted-list/ # # Given a sorted linked list, delete all duplicates such that each element appear only once. # # For example, # Given 1->1->2, return 1->2. # Given 1->1->2->3->3, return 1->2->3. # # # # # # # # # # # # # ...
class Solution: def delete_duplicates(self, A): if A is None or A.next is None: return A (prev, tmp) = (A, A.next) while tmp: if prev.val == tmp.val: prev.next = tmp.next tmp = prev.next else: prev = tmp ...
if __name__ == "__main__": with open("12_04_01.txt", "r") as f: rng = f.readline().split("-") pwds = [] for pwd in range(int(rng[0]), int(rng[1])): lpwd = [char for char in str(pwd)] for num in lpwd: num = int(num) flag = 1 ...
if __name__ == '__main__': with open('12_04_01.txt', 'r') as f: rng = f.readline().split('-') pwds = [] for pwd in range(int(rng[0]), int(rng[1])): lpwd = [char for char in str(pwd)] for num in lpwd: num = int(num) flag = 1 for ...
""" OpenID utils some copied from http://github.com/openid/python-openid/examples/djopenid ben@adida.net """
""" OpenID utils some copied from http://github.com/openid/python-openid/examples/djopenid ben@adida.net """
''' Joe Walter difficulty: 5% run time: 0:00 answer: 9110846700 *** 048 Self Powers Find the last ten digits of the series, 1^1 + 2^2 + 3^3 + ... + 1000^1000. ''' def solve(n, num_digits = 10): mod = 10**num_digits sum = 0 for k in range(1, n+1): sum += pow(k, k, mod) return sum % mod assert solve(10...
""" Joe Walter difficulty: 5% run time: 0:00 answer: 9110846700 *** 048 Self Powers Find the last ten digits of the series, 1^1 + 2^2 + 3^3 + ... + 1000^1000. """ def solve(n, num_digits=10): mod = 10 ** num_digits sum = 0 for k in range(1, n + 1): sum += pow(k, k, mod) return sum % ...
# Number of occurrences of 2 as a digit in numbers from 0 to n # Count the number of 2s as digit in all numbers from 0 to n. # Examples : # Input : 22 # Output : 6 # Explanation: Total 2s that appear as digit # from 0 to 22 are (2, 12, 20, # 21, 22); # Input : 100 # Output : 20 # Explanat...
def occurance_of_twos(n): num = 0 two_count = 0 while num <= n: two_count += list(str(num)).count('2') num += 1 return twoCount print(occurance_of_twos(22)) print(occurance_of_twos(100))
""" All configuration is here. """ ## globals: FIXME: load from conf MAPBOX_ACCESS_TOKEN = "pk.eyJ1IjoiamFja3AiLCJhIjoidGpzN0lXVSJ9.7YK6eRwUNFwd3ODZff6JvA" N_BINS = 10 SCALE = 100 # _palette = sns.light_palette((5, 90, 55), N_BINS, input="husl") # DEFAULT_COLORSCALE = _palette.as_hex() DEFAULT_COLORSCALE = [ '#e8f6f8...
""" All configuration is here. """ mapbox_access_token = 'pk.eyJ1IjoiamFja3AiLCJhIjoidGpzN0lXVSJ9.7YK6eRwUNFwd3ODZff6JvA' n_bins = 10 scale = 100 default_colorscale = ['#e8f6f8', '#fce5e7', '#f9cdd2', '#f7b4bb', '#f49ca6', '#f1848f', '#ef6c7a', '#ec5363', '#e93b4e', '#e72338'] default_opacity = 0.8 value_to_mapbox_styl...
#!/usr/bin/python3 """ Given two strings s1, s2, find the lowest ASCII sum of deleted characters to make two strings equal. Example 1: Input: s1 = "sea", s2 = "eat" Output: 231 Explanation: Deleting "s" from "sea" adds the ASCII value of "s" (115) to the sum. Deleting "t" from "eat" adds 116 to the sum. At the end, bo...
""" Given two strings s1, s2, find the lowest ASCII sum of deleted characters to make two strings equal. Example 1: Input: s1 = "sea", s2 = "eat" Output: 231 Explanation: Deleting "s" from "sea" adds the ASCII value of "s" (115) to the sum. Deleting "t" from "eat" adds 116 to the sum. At the end, both strings are equa...
emojis = [{"id": 1, "emoji": "emoji1", "active": "y", "type": "Free", "type_num": 1}, {"id": 2, "emoji": "emoji2", "active": "y", "type": "Free", "type_num": 1}, {"id": 3, "emoji": "emoji3", "active": "y", "type": "Free", "type_num": 1}, {"id": 4, "emoji": "emoji4", "active": "y", "typ...
emojis = [{'id': 1, 'emoji': 'emoji1', 'active': 'y', 'type': 'Free', 'type_num': 1}, {'id': 2, 'emoji': 'emoji2', 'active': 'y', 'type': 'Free', 'type_num': 1}, {'id': 3, 'emoji': 'emoji3', 'active': 'y', 'type': 'Free', 'type_num': 1}, {'id': 4, 'emoji': 'emoji4', 'active': 'y', 'type': 'Free', 'type_num': 1}, {'id':...
#----------------------------------------------------------------------------- # Runtime: 56ms # Memory Usage: # Link: #----------------------------------------------------------------------------- class Solution: def permuteUnique(self, nums: [int]) -> [[int]]: if len(nums) == 1: return [ nu...
class Solution: def permute_unique(self, nums: [int]) -> [[int]]: if len(nums) == 1: return [nums] nums.sort() visited = [False] * len(nums) result = [] temp_result = [] def dfs(temp_result: [int]): if len(nums) == len(temp_result): ...
#1. Create a greeting for your program. #2. Ask the user for the city that they grew up in. #3. Ask the user for the name of a pet. #4. Combine the name of their city and pet and show them their band name. #5. Make sure the input cursor shows on a new line, see the example at: # https://band-name-generator-end.ap...
print('Welcome to Band Name Generator') city = input("What's name of the city you grew up in?\n") pet = input("What is the name of your pet?(Let's have a pet's name if not a pet otherwise)\n") print('Seems like ' + pet + ' ' + city + ' will be a good band name for you')
""" This script takes a sequence and reverses it, such that it can be inserted back into the genome as an artificial reversal of a sequence. """ seq = """TTATGTGTTTTGGGGGCGATCGTGAGGCAAAGAAAACCCGGCGCTGAGGCCGGGTTATTCTTGTTCTCTG GTCAAATTATATAGTTGGAAAACAAGGATGCATATATGAATGAACGATGCAGAGGCAATGCCGATGGCGA TAGTGGGTATCATGTAGCCGCTT...
""" This script takes a sequence and reverses it, such that it can be inserted back into the genome as an artificial reversal of a sequence. """ seq = 'TTATGTGTTTTGGGGGCGATCGTGAGGCAAAGAAAACCCGGCGCTGAGGCCGGGTTATTCTTGTTCTCTG\nGTCAAATTATATAGTTGGAAAACAAGGATGCATATATGAATGAACGATGCAGAGGCAATGCCGATGGCGA\nTAGTGGGTATCATGTAGCCGCTTA...
mysql = { 'host': 'localhost', 'user': 'student', 'password': 'student', 'database': 'BeerDB' }
mysql = {'host': 'localhost', 'user': 'student', 'password': 'student', 'database': 'BeerDB'}
# Adesh Gautam def merge(arr, l, m, r): L = arr[:m] R = arr[m:] n1 = len(L) n2 = len(R) i, j, k = 0, 0, 0 while i < n1 and j < n2 : if L[i] <= R[j]: arr[k] = L[i] i += 1 else: arr[k] = R[j] j += 1 k += 1 whi...
def merge(arr, l, m, r): l = arr[:m] r = arr[m:] n1 = len(L) n2 = len(R) (i, j, k) = (0, 0, 0) while i < n1 and j < n2: if L[i] <= R[j]: arr[k] = L[i] i += 1 else: arr[k] = R[j] j += 1 k += 1 while i < n1: arr[k]...
# python is a General Purpose High level Programming Language # Dictionaries ''' Dictionaries are unordered changeable (muteable) indexed collections in Python Dictionaries are Declared with {} and key value pairs ''' thisDict = { 'Name':'Shinji Ikari', 'Father':'Gendo Ikari', 'Mother':'Yui Ikari', ...
""" Dictionaries are unordered changeable (muteable) indexed collections in Python Dictionaries are Declared with {} and key value pairs """ this_dict = {'Name': 'Shinji Ikari', 'Father': 'Gendo Ikari', 'Mother': 'Yui Ikari', 'Guardian': 'Misato Kasturagi'} print(thisDict) thisDict['Father'] = 'Ikari Gendo' print(...
#!/usr/bin/env python # encoding: utf-8 FILE = 'File' ASSIGNMENT = 'Assignment' DOWNLOAD_URL_EXTENSION = "?forcedownload=1"
file = 'File' assignment = 'Assignment' download_url_extension = '?forcedownload=1'
class Solution(object): def numTilings(self, N): H = [[0, 0] for _ in xrange(N+1)] H[0][0] = 1 H[1][0] = 1 for i in xrange(2, N+1): H[i][0] = (H[i-1][0] + H[i-2][0] + H[i-1][1]*2) % 1000000007 H[i][1] = (H[i-2][0] + H[i-1][1]) % 1000000007 ...
class Solution(object): def num_tilings(self, N): h = [[0, 0] for _ in xrange(N + 1)] H[0][0] = 1 H[1][0] = 1 for i in xrange(2, N + 1): H[i][0] = (H[i - 1][0] + H[i - 2][0] + H[i - 1][1] * 2) % 1000000007 H[i][1] = (H[i - 2][0] + H[i - 1][1]) % 1000000007 ...
#dic.py stu = {"203-2012-045":"John", "203-2012-037":"Peter"} stu["202-2011-121"] = "Susan" print(stu["202-2011-121"]) del stu["202-2011-121"] for key in stu: print(key+" : "+str(stu[key])) for value in stu.values(): print(value) for item in stu.items(): print(item) print("203-2012-037" in stu) print(tuple(stu.ke...
stu = {'203-2012-045': 'John', '203-2012-037': 'Peter'} stu['202-2011-121'] = 'Susan' print(stu['202-2011-121']) del stu['202-2011-121'] for key in stu: print(key + ' : ' + str(stu[key])) for value in stu.values(): print(value) for item in stu.items(): print(item) print('203-2012-037' in stu) print(tuple(st...
class AttrDict(object): def __init__(self, initializer=None): self._data=dict() self._initializer = initializer self._is_initialized = False if initializer is not None else True def _initialize(self): if self._initializer: self._initializer(self) def get(self, ...
class Attrdict(object): def __init__(self, initializer=None): self._data = dict() self._initializer = initializer self._is_initialized = False if initializer is not None else True def _initialize(self): if self._initializer: self._initializer(self) def get(self...
# integers print(format(10, '+')) print(format(15, 'b')) print(format(15, 'x')) print(format(15, 'X')) # float print(format(.2, '%')) print(format(10.5, 'e')) print(format(10.5, 'e')) print(format(10.5345678, 'f')) print(format(10.5, 'F')) class Data: id = 0 def __init__(self, i): self.id = i ...
print(format(10, '+')) print(format(15, 'b')) print(format(15, 'x')) print(format(15, 'X')) print(format(0.2, '%')) print(format(10.5, 'e')) print(format(10.5, 'e')) print(format(10.5345678, 'f')) print(format(10.5, 'F')) class Data: id = 0 def __init__(self, i): self.id = i def __format__(self, ...
class Man: def __init__(self, name): self.name = name def hello(self): print(self.name) m = Man("Ken") m.hello()
class Man: def __init__(self, name): self.name = name def hello(self): print(self.name) m = man('Ken') m.hello()
@frappe.whitelist(allow_guest=True) def holdOrder(data): try: doc = data if isinstance(doc, string_types): doc = json.loads(doc) if doc.get('hold_Id'): cart = frappe.get_doc('Shopping Cart', doc.get('hold_Id')) else: cart = frappe.new_doc('Shopping Cart') cart.cart_type = 'Pos Cart' car...
@frappe.whitelist(allow_guest=True) def hold_order(data): try: doc = data if isinstance(doc, string_types): doc = json.loads(doc) if doc.get('hold_Id'): cart = frappe.get_doc('Shopping Cart', doc.get('hold_Id')) else: cart = frappe.new_doc('Shoppin...
class Solution: def minAbsoluteSumDiff(self, nums1: List[int], nums2: List[int]) -> int: v = [i for i in nums1] v.sort() gap = float('-inf') for ind, (i, j) in enumerate(zip(nums1, nums2)): k = bisect.bisect_right(v, j) if k < len(nums1): gap =...
class Solution: def min_absolute_sum_diff(self, nums1: List[int], nums2: List[int]) -> int: v = [i for i in nums1] v.sort() gap = float('-inf') for (ind, (i, j)) in enumerate(zip(nums1, nums2)): k = bisect.bisect_right(v, j) if k < len(nums1): ...
# Discord OAuth connection token environment variable DISCORD_OAUTH_TOKEN = "TOKEN" # Prefix used for the Bot commands COMMAND_PREFIX = "p!ka " # Logging configuration file environment variable LOGGING_CONFIG_JSON = "LOGGING_CONFIG_JSON" class SqliteDB: """SQLite database tables""" # Database environment va...
discord_oauth_token = 'TOKEN' command_prefix = 'p!ka ' logging_config_json = 'LOGGING_CONFIG_JSON' class Sqlitedb: """SQLite database tables""" database_config_path_env_var = 'DATABASE_CONFIG_PATH' database_storage_path = 'SQLITE_DATA_PATH' database_name = 'pokemon.db' user_table = 'users' poke...
""" https://www.codewars.com/kata/563b662a59afc2b5120000c6 Given p0: initial population, percent: the amount of growth each year (%) aug: the number of new inhabitants per year that come to live in the town p: the target population Return the number of years it will take to reach the target population. Examples: nb_...
""" https://www.codewars.com/kata/563b662a59afc2b5120000c6 Given p0: initial population, percent: the amount of growth each year (%) aug: the number of new inhabitants per year that come to live in the town p: the target population Return the number of years it will take to reach the target population. Examples: nb_...
def look(): for i in range (1,101): if i%3==0: print("Fizz") elif i%5==0: print("Buzz") elif i%3==0 and i//5==0: print("FizzBuzz") else: print(i) look()
def look(): for i in range(1, 101): if i % 3 == 0: print('Fizz') elif i % 5 == 0: print('Buzz') elif i % 3 == 0 and i // 5 == 0: print('FizzBuzz') else: print(i) look()
#!/usr/bin/env python3 N = 53 eps = 1.0 for i in range(N): eps = eps /2 onepeps = 1.0 + eps print('eps = ', eps, ' , one + eps = ', onepeps)
n = 53 eps = 1.0 for i in range(N): eps = eps / 2 onepeps = 1.0 + eps print('eps = ', eps, ' , one + eps = ', onepeps)
{'stack': {'backgrounds': [{'components': [{'label': 'Make Visible', 'name': 'Command4', 'position': (480, 16), 'size': (89, 25), 'type': 'VBBut...
{'stack': {'backgrounds': [{'components': [{'label': 'Make Visible', 'name': 'Command4', 'position': (480, 16), 'size': (89, 25), 'type': 'VBButton'}, {'label': 'Move ', 'name': 'Command5', 'position': (576, 16), 'size': (89, 25), 'type': 'VBButton'}, {'label': 'Size ', 'name': 'Command6', 'position': (672, 16), 'size'...
class ReduceNumberToZero: @classmethod def number_of_steps(cls, num: int) -> int: """ @name 1342. Number of Steps to Reduce a Number to Zero @ref Leetcode, 1342. https://leetcode.com/problems/number-of-steps-to-reduce-a-number-to-zero/ @brief Given an integ...
class Reducenumbertozero: @classmethod def number_of_steps(cls, num: int) -> int: """ @name 1342. Number of Steps to Reduce a Number to Zero @ref Leetcode, 1342. https://leetcode.com/problems/number-of-steps-to-reduce-a-number-to-zero/ @brief Given an integer n...
def messages_sent(message_container, start_date, end_date, message_type=None): """ Return number of messages sent between start and end date contained by message container (chat/member). """ messages_sent = 0 for message in message_container.messages: if (start_date <= message.timestamp....
def messages_sent(message_container, start_date, end_date, message_type=None): """ Return number of messages sent between start and end date contained by message container (chat/member). """ messages_sent = 0 for message in message_container.messages: if start_date <= message.timestamp.d...
def bit_add(bit, i, x): i += 1 n = len(bit) while i <= n: bit[i - 1] += x i += i & -i def bit_sum(bit, i): result = 0 i += 1 while i > 0: result += bit[i - 1] i -= i & -i return result def bit_query(bit, start, stop): if start == 0: return bit_...
def bit_add(bit, i, x): i += 1 n = len(bit) while i <= n: bit[i - 1] += x i += i & -i def bit_sum(bit, i): result = 0 i += 1 while i > 0: result += bit[i - 1] i -= i & -i return result def bit_query(bit, start, stop): if start == 0: return bit_su...
#!phthon 2 ip = raw_input("please type ip :") # print "{:<12} {:<12} {:<12} {:<12}".format(*ip.split('.')) ip_addr = ip.split(".") ip_addr[3]='0' print (ip_addr[0],ip_addr[1],ip_addr[2],ip_addr[3]) print (bin(int(ip_addr[0])),bin(int(ip_addr[1])),bin(int(ip_addr[2])),bin(int(ip_addr[3])))
ip = raw_input('please type ip :') ip_addr = ip.split('.') ip_addr[3] = '0' print(ip_addr[0], ip_addr[1], ip_addr[2], ip_addr[3]) print(bin(int(ip_addr[0])), bin(int(ip_addr[1])), bin(int(ip_addr[2])), bin(int(ip_addr[3])))
#!/usr/bin/env python # vim: ai ts=4 sts=4 et sw=4 class Connection(object): """The connection object pairs a backend with an individual identity (phone number, nickname, email, etc) so application authors need not concern themselves with backends.""" def __init__(self, backend, identit...
class Connection(object): """The connection object pairs a backend with an individual identity (phone number, nickname, email, etc) so application authors need not concern themselves with backends.""" def __init__(self, backend, identity): self.backend = backend self.ide...
#!/usr/bin/env python # coding: utf-8 # In[ ]: # Assignment 1 Day8 def getInput(calculate_arg_fun): def Fibonacci(n): if n<=0: print("Incorrect input") # First Fibonacci number is 0 elif n==1: return 0 # Second Fibonacci number is 1 elif n==2: ...
def get_input(calculate_arg_fun): def fibonacci(n): if n <= 0: print('Incorrect input') elif n == 1: return 0 elif n == 2: return 1 else: return fibonacci(n - 1) + fibonacci(n - 2) return calculate_arg_fun(a) return Fibonac...
# encoding: utf-8 """Constants for pynetgear.""" # --------------------- # DEFAULTS # --------------------- DEFAULT_HOST = "routerlogin.net" DEFAULT_USER = "admin" DEFAULT_PORT = 5000 ALL_PORTS = [(5555, True), (443, True), (5000, False), (80, False)] BLOCK = "Block" ALLOW = "Allow" UNKNOWN_DEVICE_DECODED = "<unknow...
"""Constants for pynetgear.""" default_host = 'routerlogin.net' default_user = 'admin' default_port = 5000 all_ports = [(5555, True), (443, True), (5000, False), (80, False)] block = 'Block' allow = 'Allow' unknown_device_decoded = '<unknown>' unknown_device_encoded = '&lt;unknown&gt;' session_id = 'A7D88AE69687E58D9A0...
class Solution: def angleClock(self, hour: int, minutes: int) -> float: if(hour == 12): hour = 0 angle_h = hour * 30.0 + minutes / 2.0 angle_m = minutes * 6.0 ans = abs(angle_h - angle_m) return ans if 360.0 - ans > ans else 360.0 - ans
class Solution: def angle_clock(self, hour: int, minutes: int) -> float: if hour == 12: hour = 0 angle_h = hour * 30.0 + minutes / 2.0 angle_m = minutes * 6.0 ans = abs(angle_h - angle_m) return ans if 360.0 - ans > ans else 360.0 - ans
graph = [ [], [2, 6], [1], [4, 5, 6], [3], [3], [1, 3] ] def dfs1(v, visited, graph): stack = [v] while stack: node = stack.pop() visited[node] = True print(node) for nd in graph[node]: if not visited[nd]: stack.append(nd)...
graph = [[], [2, 6], [1], [4, 5, 6], [3], [3], [1, 3]] def dfs1(v, visited, graph): stack = [v] while stack: node = stack.pop() visited[node] = True print(node) for nd in graph[node]: if not visited[nd]: stack.append(nd) def dfs2(v, visited, graph): ...
class Calculator: def __init__(self, a: int, b: int) -> None: self.a = a self.b = b def suma(self) -> int: return self.a+self.b def resta(self) -> int: return self.a-self.b def multi(self) -> int: return self.a*self.b def divi(self) -> int:...
class Calculator: def __init__(self, a: int, b: int) -> None: self.a = a self.b = b def suma(self) -> int: return self.a + self.b def resta(self) -> int: return self.a - self.b def multi(self) -> int: return self.a * self.b def divi(self) -> int: ...
#Linear Search def linear_search(arr, target): for i in range(len(arr)): if arr[i] == target: return i return -1 n = int(input("Enter number: ")) arr = list(map(int, input().split())) target = int(input("Enter target: ")) print(linear_search(arr, target))
def linear_search(arr, target): for i in range(len(arr)): if arr[i] == target: return i return -1 n = int(input('Enter number: ')) arr = list(map(int, input().split())) target = int(input('Enter target: ')) print(linear_search(arr, target))
# FLAKE8: NOQA c = get_config() c.TerminalIPythonApp.display_banner = True c.InteractiveShellApp.log_level = 20 c.InteractiveShellApp.extensions = [ # 'myextension' ] c.InteractiveShellApp.exec_lines = [ # '%load_ext pyflyby', # 'import json', # 'import requests', # 'import pandas as pd', ] c.Inte...
c = get_config() c.TerminalIPythonApp.display_banner = True c.InteractiveShellApp.log_level = 20 c.InteractiveShellApp.extensions = [] c.InteractiveShellApp.exec_lines = [] c.InteractiveShellApp.exec_files = [] c.InteractiveShell.autoindent = True c.InteractiveShell.colors = 'LightBG' c.InteractiveShell.confirm_exit = ...
# Selection structure # conditional operators: if, else,elif name = "Pedro" if name: print("The variable is not empty") number1 = 20 number2 = 30 if number1 != number2: print("Number 1 is lower than number 2") else: print("Number 2 is bigger than number 1") color = "blue" if color == "green": pr...
name = 'Pedro' if name: print('The variable is not empty') number1 = 20 number2 = 30 if number1 != number2: print('Number 1 is lower than number 2') else: print('Number 2 is bigger than number 1') color = 'blue' if color == 'green': print('Go ahead') elif color == 'red': print('Stop') elif color == ...
class TestModel_E2E_CNN: def test_basic(self): pass # TODO
class Testmodel_E2E_Cnn: def test_basic(self): pass
# -*- coding: utf-8 -*- def execute_rule(**kwargs): sql = kwargs.get("sql") bind_num = kwargs.get("or_num") if sql.count(" or ") > bind_num: return True return False
def execute_rule(**kwargs): sql = kwargs.get('sql') bind_num = kwargs.get('or_num') if sql.count(' or ') > bind_num: return True return False
def gen_mp4(src='pipe:0', dest='pipe:1'): return [ 'ffmpeg', '-y', '-i', src, '-crf', '25', '-preset', 'faster', '-f', 'mp4', '-movflags', 'frag_keyframe+empty_moov', dest ] def gen_mp3(src='pipe:0', dest='pipe:1', empty=False): cmd = [ ...
def gen_mp4(src='pipe:0', dest='pipe:1'): return ['ffmpeg', '-y', '-i', src, '-crf', '25', '-preset', 'faster', '-f', 'mp4', '-movflags', 'frag_keyframe+empty_moov', dest] def gen_mp3(src='pipe:0', dest='pipe:1', empty=False): cmd = ['ffmpeg', '-y', '-i', src, '-codec:a', 'libmp3lame', '-qscale:a', '2', dest] ...
pink = 0xDEADBF yellow = 0xFDDF86 blue = 0x6F90F5 red = 0xe74c3c dark_red = 0x992d22 green = 0x1fb600 gold = 0xd4af3a
pink = 14593471 yellow = 16637830 blue = 7311605 red = 15158332 dark_red = 10038562 green = 2078208 gold = 13938490
# -*- coding: utf-8 -*- """ Unit test package for execution_trace. """
""" Unit test package for execution_trace. """
# Use this file to maintain resume data # ====================================================== # ============= NAME AND CONTACT ======================= contact_info = { 'name':'Some Guy', 'street':'123 Fake St', 'city': 'Springfield', 'state':'OR', 'zip': '99700', 'phone':'555-555-5555', 'email':'som...
contact_info = {'name': 'Some Guy', 'street': '123 Fake St', 'city': 'Springfield', 'state': 'OR', 'zip': '99700', 'phone': '555-555-5555', 'email': 'someguy@somewebsite.example.com', 'title': 'All Around Great Guy'} links = [{'url': 'http://www.google.com', 'label': 'Link'}] about = 'Some Guy has over 20 years of expe...
class Enum(object): class __metaclass__(type): def __getitem__(self, key): return "Constants.{0}".format([item for item in self.__dict__ if key == self.__dict__[item]][0]) def get_name(self, key): return "Constants.{0}".format([item for item in self.__dict__ if key == self.__...
class Enum(object): class __Metaclass__(type): def __getitem__(self, key): return 'Constants.{0}'.format([item for item in self.__dict__ if key == self.__dict__[item]][0]) def get_name(self, key): return 'Constants.{0}'.format([item for item in self.__dict__ if key == self...
#create dictionary1 = {1:"a", 2:"b", 3:"c"} #access print(dictionary1[1]) #updating dictionary1[1]="hello" print(dictionary1) #delete del dictionary1[1] dictionary1.clear() # to clear it but keep the variable print(dictionary1.keys()) print(dictionary1.values())
dictionary1 = {1: 'a', 2: 'b', 3: 'c'} print(dictionary1[1]) dictionary1[1] = 'hello' print(dictionary1) del dictionary1[1] dictionary1.clear() print(dictionary1.keys()) print(dictionary1.values())
# Adapted, with minor modifications, from stackoverflow: # https://stackoverflow.com/questions/6752374/cube-root-modulo-p-how-do-i-do-this # did not test fully, but it works for the NTTRU parameters we're using def tonelli3(a,p,many=False): def solution(p,root): g=p-2 while pow(g,(p-1)//3,p)==1: ...
def tonelli3(a, p, many=False): def solution(p, root): g = p - 2 while pow(g, (p - 1) // 3, p) == 1: g -= 1 g = pow(g, (p - 1) // 3, p) return sorted([root % p, root * g % p, root * g ** 2 % p]) a = a % p if p in [2, 3] or a == 0: return a if p % 3 ==...
"""Descriptor utilities. Utilities to support special Python descriptors [1,2], in particular the use of a useful pattern for properties we call 'one time properties'. These are object attributes which are declared as properties, but become regular attributes once they've been read the first time. They can thus be e...
"""Descriptor utilities. Utilities to support special Python descriptors [1,2], in particular the use of a useful pattern for properties we call 'one time properties'. These are object attributes which are declared as properties, but become regular attributes once they've been read the first time. They can thus be e...
def common_end(L1: list, L2: list)-> bool: """Returns True if they have the same first element or the same last element or if the first and last elements of both lists are the same. Otherwise, the function returns False . Example: common_end(test_list1,test_list2) Faluse ...
def common_end(L1: list, L2: list) -> bool: """Returns True if they have the same first element or the same last element or if the first and last elements of both lists are the same. Otherwise, the function returns False . Example: common_end(test_list1,test_list2) Faluse ""...
def localSant(numOfSiblings, numOfSweets) -> str: try: if numOfSweets == 0: return 'no sweets left' if numOfSweets % numOfSiblings == 0: return 'give away' else: return 'eat them yourself' except ZeroDivisionError: return 'eat them yourself' if __name__ == '__main__': print(...
def local_sant(numOfSiblings, numOfSweets) -> str: try: if numOfSweets == 0: return 'no sweets left' if numOfSweets % numOfSiblings == 0: return 'give away' else: return 'eat them yourself' except ZeroDivisionError: return 'eat them yourself' i...
def part1(s): i = 0 while i < len(s) - 1: react = abs(ord(s[i]) - ord(s[i+1])) == 32 if react: if i == len(s) - 1: s = s[:i] else: s = s[:i] + s[i+2:] i = max(0, i-1) else: i += 1 return len(s) def ...
def part1(s): i = 0 while i < len(s) - 1: react = abs(ord(s[i]) - ord(s[i + 1])) == 32 if react: if i == len(s) - 1: s = s[:i] else: s = s[:i] + s[i + 2:] i = max(0, i - 1) else: i += 1 return len(s) ...
# -------------------------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for license information. # --------------------------------------------------------------------...
class Commandtree(object): """ a command tree """ def __init__(self, data, children=None): self.data = data if not children: self.children = [] else: self.children = children def get_child(self, child_name, kids): """ returns the object with the name...
#!/usr/bin/env python3 # -*- coding: utf-8 -*- """ Created on Sun Sep 30 17:05:23 2018 @author: user """
""" Created on Sun Sep 30 17:05:23 2018 @author: user """
'''Common constants.''' NUCLIOTIDES = ('A', 'C', 'G', 'T') # vcf data columns CHROM = 'CHROM' POS = 'POS' ID = 'ID' REF = 'REF' ALT = 'ALT' QUAL = 'QUAL' FILTER = 'FILTER' INFO = 'INFO' FORMAT = 'FORMAT' MANDATORY_FIELDS = (CHROM, POS, ID, REF, ALT, QUAL, FILTER) # Info-section keys NUMBER = 'Number' TYPE = 'Type' ...
"""Common constants.""" nucliotides = ('A', 'C', 'G', 'T') chrom = 'CHROM' pos = 'POS' id = 'ID' ref = 'REF' alt = 'ALT' qual = 'QUAL' filter = 'FILTER' info = 'INFO' format = 'FORMAT' mandatory_fields = (CHROM, POS, ID, REF, ALT, QUAL, FILTER) number = 'Number' type = 'Type' description = 'Description' mandatory_field...
# Link: https://leetcode.com/problems/clone-graph/ # Definition for a undirected graph node # class UndirectedGraphNode: # def __init__(self, x): # self.label = x # self.neighbors = [] class Solution: # @param node, a undirected graph node # @return a undirected graph node def cloneGrap...
class Solution: def clone_graph(self, node): if not node: return None q = [] m = {} head = undirected_graph_node(node.label) q.append(node) m[node] = head while len(q): curr = q.pop() for neighbor in curr.neighbors: ...
load("@bazel_skylib//lib:unittest.bzl", "asserts", "unittest") load(":dot_case.bzl", "dot_case") def _dot_case_test_impl(ctx): env = unittest.begin(ctx) tt = [ ["", ""], ["test", "test"], ["test string", "test.string"], ["Test String", "test.string"], ["dot.case", "dot.c...
load('@bazel_skylib//lib:unittest.bzl', 'asserts', 'unittest') load(':dot_case.bzl', 'dot_case') def _dot_case_test_impl(ctx): env = unittest.begin(ctx) tt = [['', ''], ['test', 'test'], ['test string', 'test.string'], ['Test String', 'test.string'], ['dot.case', 'dot.case'], ['path/case', 'path.case'], ['Test...
load("@bazel_tools//tools/build_defs/repo:git.bzl", "git_repository", "new_git_repository") _BBCP_BUILD = """ package(default_visibility = ["//visibility:public"]) # TODO(sustrik): make this hermetic genrule( name = "bbcp_binary", srcs = glob(["**"]), outs = ["bbcp"], cmd = "pushd $$(dirname $(locatio...
load('@bazel_tools//tools/build_defs/repo:git.bzl', 'git_repository', 'new_git_repository') _bbcp_build = '\npackage(default_visibility = ["//visibility:public"])\n\n# TODO(sustrik): make this hermetic\ngenrule(\n name = "bbcp_binary",\n srcs = glob(["**"]),\n outs = ["bbcp"],\n cmd = "pushd $$(dirname $(lo...
def findDecision(obj): #obj[0]: Passanger, obj[1]: Time, obj[2]: Coupon, obj[3]: Gender, obj[4]: Age, obj[5]: Education, obj[6]: Occupation, obj[7]: Bar, obj[8]: Coffeehouse, obj[9]: Restaurant20to50, obj[10]: Direction_same, obj[11]: Distance # {"feature": "Bar", "instances": 34, "metric_value": 0.9975, "depth": 1} ...
def find_decision(obj): if obj[7] <= 2.0: if obj[2] > 1: if obj[11] <= 2: if obj[5] <= 3: if obj[4] > 0: if obj[10] <= 0: if obj[8] <= 2.0: if obj[9] <= 1.0: ...
def bin_to_oct(binary): decimal = int(binary, 2) return oct(decimal) def oct_to_bin(octal): decimal = int(octal, 8) return bin(decimal) if __name__ == "__main__": print(bin_to_oct("111")) print(oct_to_bin("7"))
def bin_to_oct(binary): decimal = int(binary, 2) return oct(decimal) def oct_to_bin(octal): decimal = int(octal, 8) return bin(decimal) if __name__ == '__main__': print(bin_to_oct('111')) print(oct_to_bin('7'))
''' Function for insertion sort Time Complexity : O(N) Space Complexity : O(N) Auxilary Space : O(1) ''' def insertionSort(ar): for i in range(1,len(ar)): j = i - 1 elem = ar[i] while(j >= 0 and ar[j] > elem): ar[j + 1] = ar[j] j -= 1 a...
""" Function for insertion sort Time Complexity : O(N) Space Complexity : O(N) Auxilary Space : O(1) """ def insertion_sort(ar): for i in range(1, len(ar)): j = i - 1 elem = ar[i] while j >= 0 and ar[j] > elem: ar[j + 1] = ar[j] j -= 1 ar[j + ...
assert 1 < 2 assert 1 < 2 < 3 assert 5 == 5 == 5 assert (5 == 5) == True assert 5 == 5 != 4 == 4 > 3 > 2 < 3 <= 3 != 0 == 0 assert not 1 > 2 assert not 5 == 5 == True assert not 5 == 5 != 5 == 5 assert not 1 < 2 < 3 > 4 assert not 1 < 2 > 3 < 4 assert not 1 > 2 < 3 < 4
assert 1 < 2 assert 1 < 2 < 3 assert 5 == 5 == 5 assert (5 == 5) == True assert 5 == 5 != 4 == 4 > 3 > 2 < 3 <= 3 != 0 == 0 assert not 1 > 2 assert not 5 == 5 == True assert not 5 == 5 != 5 == 5 assert not 1 < 2 < 3 > 4 assert not 1 < 2 > 3 < 4 assert not 1 > 2 < 3 < 4
def find_salary_threshold(target_payroll, current_salaries): # custom algorithm, not from the book # first i take avg salary based on payroll and total number of current_salaries in current_salaries list # residue is the remainder left after comparing salary with avg_target for any salary that's more than avg_tar...
def find_salary_threshold(target_payroll, current_salaries): avg_target = target_payroll // len(current_salaries) residue = 0 i = 0 while i < len(current_salaries): if current_salaries[i] < avg_target: residue += avg_target - current_salaries[i] i += 1 else: ...
# This file is part of Scapy # See http://www.secdev.org/projects/scapy for more information # Copyright (C) Tabea Spahn <tabea.spahn@e-mundo.de> # This program is published under a GPLv2 license # scapy.contrib.status = skip """ Package of contrib automotive xcp specific modules that have to be loaded explicitly. ""...
""" Package of contrib automotive xcp specific modules that have to be loaded explicitly. """
#----------------------------------------------------------------------------- # # Copyright (c) 2005 by Enthought, Inc. # All rights reserved. # #----------------------------------------------------------------------------- """ Two-dimensionsal plotting application toolkit. Part of the Chaco project of the Entho...
""" Two-dimensionsal plotting application toolkit. Part of the Chaco project of the Enthought Tool Suite. """
class OrderedMap(dict): def __init__(self,*args,**kwargs): super().__init__(*args, **kwargs) def __iter__(self): return iter(sorted(super().__iter__())) class OrderedSet(set): def __init__(self,lst=[]): super().__init__(lst) def __iter__(self): ...
class Orderedmap(dict): def __init__(self, *args, **kwargs): super().__init__(*args, **kwargs) def __iter__(self): return iter(sorted(super().__iter__())) class Orderedset(set): def __init__(self, lst=[]): super().__init__(lst) def __iter__(self): return iter(sorted(...
class Solution: def luckyNumbers(self, mat): def solve(i, m): for row in mat: if row[i] > m: return False return True ans = [] for row in mat: idx, mn = [], 10 ** 6 for i, ele in enumerate(row): if ele < mn: ...
class Solution: def lucky_numbers(self, mat): def solve(i, m): for row in mat: if row[i] > m: return False return True ans = [] for row in mat: (idx, mn) = ([], 10 ** 6) for (i, ele) in enumerate(row): ...
__author__ = 'marble_xu' DEBUG = False DEBUG_START_X = 110 DEBUG_START_Y = 534 SCREEN_HEIGHT = 600 SCREEN_WIDTH = 800 SCREEN_SIZE = (SCREEN_WIDTH, SCREEN_HEIGHT) ORIGINAL_CAPTION = 'Super Mario Bros.' # COLORS # R G B GRAY = (100, 100, 100) NAVYBLUE = ( 60, 60, 100) WHITE = ...
__author__ = 'marble_xu' debug = False debug_start_x = 110 debug_start_y = 534 screen_height = 600 screen_width = 800 screen_size = (SCREEN_WIDTH, SCREEN_HEIGHT) original_caption = 'Super Mario Bros.' gray = (100, 100, 100) navyblue = (60, 60, 100) white = (255, 255, 255) red = (255, 0, 0) green = (0, 255, 0) forest_gr...
def mergesort(array): if len(array) <= 1: return array if len(array) % 2 == 0: midpoint = (len(array) // 2) else: midpoint = (len(array)+1) // 2 left = mergesort(array[:midpoint]) right = mergesort(array[midpoint:]) # Merge our two halves and return return merge(le...
def mergesort(array): if len(array) <= 1: return array if len(array) % 2 == 0: midpoint = len(array) // 2 else: midpoint = (len(array) + 1) // 2 left = mergesort(array[:midpoint]) right = mergesort(array[midpoint:]) return merge(left, right) def merge(left, right): m...
# Find the set of all integers a, b, c, d that satisfy the following conditions: # 0 <= a^3 + b^3 + c^3 + d^3 <= N # a^3 + b^3 = c^ + d3 # 0 <= a, b, c, d <= N def find_satisfy_sets(N): a = 0 d = dict() m = N // 2 while pow(a, 3) <= m: for b in range(a): t = pow(a, 3) + pow(b, 3) ...
def find_satisfy_sets(N): a = 0 d = dict() m = N // 2 while pow(a, 3) <= m: for b in range(a): t = pow(a, 3) + pow(b, 3) if t > m: break if t in d: for cd in d[t]: print(a, b, cd[0], cd[1]) d[...
expected_output = { "slot": { "P6": { "sensor": { "Temp: FC PWM1": {"state": "Fan Speed 45%", "reading": "25 Celsius"} } }, "P7": { "sensor": { "Temp: FC PWM1": {"state": "Fan Speed 45%", "reading": "25 Celsius"} ...
expected_output = {'slot': {'P6': {'sensor': {'Temp: FC PWM1': {'state': 'Fan Speed 45%', 'reading': '25 Celsius'}}}, 'P7': {'sensor': {'Temp: FC PWM1': {'state': 'Fan Speed 45%', 'reading': '25 Celsius'}}}}}
def square_dict(num): return {n: n * n for n in range(1, int(num) + 1)} # py.test exercise_10_27_16.py --cov=exercise_10_27_16.py --cov-report=html def test_square_dict(): assert square_dict(3) == {1: 1, 2: 4, 3: 9} assert square_dict(0) == {} assert square_dict(-1) == {} if __name__ == '__main__': ...
def square_dict(num): return {n: n * n for n in range(1, int(num) + 1)} def test_square_dict(): assert square_dict(3) == {1: 1, 2: 4, 3: 9} assert square_dict(0) == {} assert square_dict(-1) == {} if __name__ == '__main__': print(square_dict(input('Number: ')))
n: int; i: int; somaPares: int; contPares: int mediaPares: float n = int(input("Quantos elementos vai ter o vetor? ")) vet: [int] = [0 for x in range(n)] for i in range(0, n): vet[i] = int(input("Digite um numero: ")) somaPares = 0 contPares = 0 for i in range(0, n): if vet[i] % 2 == 0: somaPares =...
n: int i: int soma_pares: int cont_pares: int media_pares: float n = int(input('Quantos elementos vai ter o vetor? ')) vet: [int] = [0 for x in range(n)] for i in range(0, n): vet[i] = int(input('Digite um numero: ')) soma_pares = 0 cont_pares = 0 for i in range(0, n): if vet[i] % 2 == 0: soma_pares = s...
# create simple dictionary person_one = { 'name': 'tazri', 'age' : 17 } # direct method person_two = person_one; print("person_one : ",person_one); print("person_two : ",person_two); # changing value in person two and see what happen person_two['name'] = 'focasa'; print("\n\nAfter change name in person two ...
person_one = {'name': 'tazri', 'age': 17} person_two = person_one print('person_one : ', person_one) print('person_two : ', person_two) person_two['name'] = 'focasa' print('\n\nAfter change name in person two : ') print('person_one : ', person_one) person_one['name'] = 'tazri' copy_person = person_one.copy() copy_perso...
"""Create symlink to specific submodule path.""" def _submodule_repository(repository_ctx): # Remove the need to try and get a path to 'WORKSPACE.bazel' # once we start using a bazel version that includes the following commit: # https://github.com/bazelbuild/bazel/commit/8edf6abec40c848a5df93647f948e31f324...
"""Create symlink to specific submodule path.""" def _submodule_repository(repository_ctx): workspace_root = repository_ctx.path(label('//:WORKSPACE.bazel')).dirname for segment in repository_ctx.attr.path.split('/'): workspace_root = workspace_root.get_child(segment) repository_ctx.symlink(workspa...
vHora = float(input("informe o valor da sua hora")) qtdHoras = int(input("informe a quantidade de horas trabalhadas por sua pessoa")) salario = vHora*qtdHoras print(salario) ir = salario*0.11 print(ir) inss = salario*0.08 print(inss) sindicato = salario*0.05 print(sindicato) sLiquido = salario-ir-inss-sindicato print(s...
v_hora = float(input('informe o valor da sua hora')) qtd_horas = int(input('informe a quantidade de horas trabalhadas por sua pessoa')) salario = vHora * qtdHoras print(salario) ir = salario * 0.11 print(ir) inss = salario * 0.08 print(inss) sindicato = salario * 0.05 print(sindicato) s_liquido = salario - ir - inss - ...
BASE_ATTR_TMPL = '_attr_{name}' BASE_ATTR_GET_TMPL = '_attr__get_{name}' BASE_ATTR_SET_TMPL = '_attr__set_{name}' def mixin(cls): return cls
base_attr_tmpl = '_attr_{name}' base_attr_get_tmpl = '_attr__get_{name}' base_attr_set_tmpl = '_attr__set_{name}' def mixin(cls): return cls
def findDecision(obj): #obj[0]: Driving_to, obj[1]: Passanger, obj[2]: Weather, obj[3]: Temperature, obj[4]: Time, obj[5]: Coupon, obj[6]: Coupon_validity, obj[7]: Gender, obj[8]: Age, obj[9]: Maritalstatus, obj[10]: Children, obj[11]: Education, obj[12]: Occupation, obj[13]: Income, obj[14]: Bar, obj[15]: Coffeehouse,...
def find_decision(obj): if obj[5] > 1: if obj[15] > 0.0: if obj[18] > 0.0: if obj[12] <= 7: if obj[8] <= 6: if obj[14] > 0.0: if obj[19] <= 0: if obj[17] > 2.0: ...
def support_map_vectorized1(linked,num_indirect_equal_direct=3): # columns # 'team_j', 'team_i_name', 'team_i_score', 'team_i_H_A_N', # 'team_j_i_score', 'team_j_i_H_A_N', 'game_i_j', 'team_k_name', # 'team_k_score', 'team_k_H_A_N', 'team_j_k_score', 'team_j_k_H_A_N', # 'game_k_j' linked["direc...
def support_map_vectorized1(linked, num_indirect_equal_direct=3): linked['direct'] = linked['team_i_name'] == linked['team_k_name'] for_index1 = linked[['team_i_name', 'team_k_name']].copy() for_index1.loc[linked['direct']] = linked.loc[linked['direct'], ['team_i_name', 'team_j_name']] for_index1.column...
# Algorith of Attraction # @author unobatbayar # Basic information used: Physical, Status, Character, Chemistry # Let's just give points for each trait, however, minus points if not her preference points = 0 # will give points depending on traits below questions = ["He has a symmetrical face:", "He has ...
points = 0 questions = ['He has a symmetrical face:', 'He has a good smell:', 'He is handsome:', 'He is well dressed or looking good:', 'He has clear skin, bright eyes, fit body:', 'He is powerful (financial, physical, Informational or etc):', 'He is ambitious, motivated:', 'He has a great job or holds a reputable posi...
#!/usr/bin/env python """ This file defines custom exceptions for bayesloop. """ class ConfigurationError(Exception): """ Raised if some part of the configuration of a study instance is not consistent, e.g. non-existent parameter names are set to be optimized or the shape of a custom prior distribution do...
""" This file defines custom exceptions for bayesloop. """ class Configurationerror(Exception): """ Raised if some part of the configuration of a study instance is not consistent, e.g. non-existent parameter names are set to be optimized or the shape of a custom prior distribution does not fit the grid siz...
class Solution: def maxDiff(self, num: int) -> int: num = str(num) d = [int(c) for c in num] d = list(set(d)) res = [] for x in d: for y in range(0, 10): p = str(num) p = p.replace(str(x), str(y)) if p[0] != '0' and ...
class Solution: def max_diff(self, num: int) -> int: num = str(num) d = [int(c) for c in num] d = list(set(d)) res = [] for x in d: for y in range(0, 10): p = str(num) p = p.replace(str(x), str(y)) if p[0] != '0' an...
# Exercise 006: Double, Triple, Square Root """Create an algorithm that reads a number and displays its double, triple and square root.""" # First, we ask the user for an input num = float(input("Enter a number: ")) # So we multiply by two and by three to get double and triple double_num = num * 2 triple_num = num *...
"""Create an algorithm that reads a number and displays its double, triple and square root.""" num = float(input('Enter a number: ')) double_num = num * 2 triple_num = num * 3 sqrt_num = num ** 0.5 print(f"Given the value {num}, it's double is {double_num}") print(f"It's triple is {triple_num} and the square root is {s...
""" Linear Motion. Changing a variable to create a moving line. When the line moves off the edge of the window, the variable is set to 0, which places the line back at the bottom of the screen. """ a = None def setup(): size(640, 360) stroke(255) a = height / 2 def draw(): background(51) line(...
""" Linear Motion. Changing a variable to create a moving line. When the line moves off the edge of the window, the variable is set to 0, which places the line back at the bottom of the screen. """ a = None def setup(): size(640, 360) stroke(255) a = height / 2 def draw(): background(51) line(0, ...
""" 'W0104': ('Statement seems to have no effect', 'Used when a statement doesn\'t have (or at least seems to) \ any effect.'), 'W0105': ('String statement has no effect', 'Used when a string is used as a statement (which of course \ has no effect). This i...
""" 'W0104': ('Statement seems to have no effect', 'Used when a statement doesn't have (or at least seems to) any effect.'), 'W0105': ('String statement has no effect', 'Used when a string is used as a statement (which of course has no effect). This is a p...
class Solution: def gameOfLife(self, board: List[List[int]]) -> None: """Math. Running time: O(k) where k is the area of the board. """ def count(i, j, m, n): s = 0 for i in range(max(0, r-1), min(r+2, len(board))): for j in range(max(0, c-1),...
class Solution: def game_of_life(self, board: List[List[int]]) -> None: """Math. Running time: O(k) where k is the area of the board. """ def count(i, j, m, n): s = 0 for i in range(max(0, r - 1), min(r + 2, len(board))): for j in range(max(...
phonebook = {} phonebook["John"] = 938477566 phonebook["Jack"] = 938377264 phonebook["Jill"] = 947662781 print(phonebook) phonebook = { "John" : 938477566, "Jack" : 938377264, "Jill" : 947662781 } print(phonebook) phonebook = {"John" : 938477566,"Jack" : 938377264,"Jill" : 947662781} for name, number in p...
phonebook = {} phonebook['John'] = 938477566 phonebook['Jack'] = 938377264 phonebook['Jill'] = 947662781 print(phonebook) phonebook = {'John': 938477566, 'Jack': 938377264, 'Jill': 947662781} print(phonebook) phonebook = {'John': 938477566, 'Jack': 938377264, 'Jill': 947662781} for (name, number) in phonebook.items(): ...
INTRAHEALTH_DOMAINS = ('ipm-senegal', 'testing-ipm-senegal', 'ct-apr') OPERATEUR_XMLNSES = ( 'http://openrosa.org/formdesigner/7330597b92db84b1a33c7596bb7b1813502879be', 'http://openrosa.org/formdesigner/EF8B5DB8-4FB2-4CFB-B0A2-CDD26ADDAE3D' ) COMMANDE_XMLNSES = ( 'http://openrosa.org/formdesigner/9ED6673...
intrahealth_domains = ('ipm-senegal', 'testing-ipm-senegal', 'ct-apr') operateur_xmlnses = ('http://openrosa.org/formdesigner/7330597b92db84b1a33c7596bb7b1813502879be', 'http://openrosa.org/formdesigner/EF8B5DB8-4FB2-4CFB-B0A2-CDD26ADDAE3D') commande_xmlnses = ('http://openrosa.org/formdesigner/9ED66735-752D-4C69-B9C8-...
# This method computes the name (and IDs) of the features by recursion def addNames(curName, curd, targetd, lasti, curID,options,names,ids,N): if curd<targetd: for i in range(lasti,N): addNames(curName + (' * ' if len(curName)>0 else '') + options[i], curd + 1, targetd, i + 1, curID + [i], optio...
def add_names(curName, curd, targetd, lasti, curID, options, names, ids, N): if curd < targetd: for i in range(lasti, N): add_names(curName + (' * ' if len(curName) > 0 else '') + options[i], curd + 1, targetd, i + 1, curID + [i], options, names, ids, N) elif curd == targetd: names.a...
""" Queries of lock queries """ def gql_locks(fragment): """ Return the GraphQL locks query """ return f''' query($where: LockWhere!, $first: PageSize!, $skip: Int!) {{ data: locks(where: $where, first: $first, skip: $skip) {{ {fragment} }} }} ''' GQL_LOCKS_COUNT = ''' query($where: LockWher...
""" Queries of lock queries """ def gql_locks(fragment): """ Return the GraphQL locks query """ return f'\nquery($where: LockWhere!, $first: PageSize!, $skip: Int!) {{\n data: locks(where: $where, first: $first, skip: $skip) {{\n {fragment}\n }}\n}}\n' gql_locks_count = '\nquery($where: LockWhere!...
class Full(Exception): pass class Empty(Exception): pass class Queue(object): def __init__(self, maxSize = 0): self._list = [] self._maxQueued = maxSize def push(self, i): if self._maxQueued and len(self._list) >= self._maxQueued: raise Full else: ...
class Full(Exception): pass class Empty(Exception): pass class Queue(object): def __init__(self, maxSize=0): self._list = [] self._maxQueued = maxSize def push(self, i): if self._maxQueued and len(self._list) >= self._maxQueued: raise Full else: ...
def validate_coordinates(row, col): return 0 <= row < matrix_size and 0 <= col < matrix_size matrix_size = int(input()) matrix = [[int(num) for num in input().split()] for _ in range(matrix_size)] line = input() while not line == "END": command, row, col, value = line.split() row = int(row) col = int...
def validate_coordinates(row, col): return 0 <= row < matrix_size and 0 <= col < matrix_size matrix_size = int(input()) matrix = [[int(num) for num in input().split()] for _ in range(matrix_size)] line = input() while not line == 'END': (command, row, col, value) = line.split() row = int(row) col = int(...
def animated_player_mgt(game_mgr): def fn_get_action(board): # fn_display(board_pieces) valid_moves = game_mgr.fn_get_valid_moves(board, 1) if valid_moves is None: return None for i in range(len(valid_moves)): if valid_moves[i]: print("[", int...
def animated_player_mgt(game_mgr): def fn_get_action(board): valid_moves = game_mgr.fn_get_valid_moves(board, 1) if valid_moves is None: return None for i in range(len(valid_moves)): if valid_moves[i]: print('[', int(i / game_mgr.fn_get_board_size()),...
class Solution: def titleToNumber(self, columnTitle: str) -> int: ans = 0 for i in range(len(columnTitle)): temp = pow(26,len(columnTitle)-1-i)*(ord(columnTitle[i])-ord('A')+1) ans+=temp return ans
class Solution: def title_to_number(self, columnTitle: str) -> int: ans = 0 for i in range(len(columnTitle)): temp = pow(26, len(columnTitle) - 1 - i) * (ord(columnTitle[i]) - ord('A') + 1) ans += temp return ans