text
stringlengths
14
162k
timestamp
timestamp[s]
url
stringlengths
14
1.98k
Ngati Mutunga invites you all - to celebrate the achievments of one of our national treasures Te Rangihiroa - Sir Peter Buck and to celebrtae our people today. This weekend on 22 November- Saturday starting at 9:30 am with Mihi Whakatau - at Urenui Marae, Main North Road, Urenui, North Taranaki. Once again the theme is leadership, focussing on our Youth. " Youth developemnt is community development". Guest speaker is Marcus Akuhata- Brown.
2019-04-23T14:46:31
http://www.taranakivista.co.nz/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=52&cntnt01returnid=67
(Sharecast News) - Global Ports Holding cut its losses in the first half of the year and expect to report a profit in 2019 as the cruise port operator reported a 14% increase in revenues to $56.6m, a 7.5% increase at constant currencies thanks to strong cruise sales. Boosted by currency movements, the London-listed, Turkish-owned group posted record segmental adjusted operating profit up 25.2% to $40.3m in the six months to 30 June, with consolidated EBITDA rising 20.4% to $36.1m, in line with management expectations. Cruise EBITDA rose 45% and commercial EBITDA 16%. Loss for the period of $3.6m was cut from a $6.7m loss a year before. A $16.0m amortisation expense was taken in relation to port operation rights, up from $14.8m last time, but the change in underlying profit was driven by the higher operating profit, the higher income from equity accounted investees, partly offset by higher tax charge. An interim dividend of $17.5m (22p/share) was declared, in line with last year, and house broker Shore Capital said that assuming a similar final payment would equate to a dividend yield of 9%. Global Ports Holding, which is 65.63% owned by Istanbul-listed Global Investment Holdings, is the world's largest cruise port operator. It is not to be confused with Global Ports, the leading container terminal operator serving Russian cargo flows. Cruise revenues and profits were boosted as passenger numbers grew 6.2% to 1.6m in the period, driven by a strong performance at Barcelona and Malaga cruise ports and growth in ancillary services revenues. The equity accounted associate ports Venice, Lisbon and Singapore also rose strongly. An agreement was signed to operate Havana cruise port - the group's first in the Americas - and a partnership agreement was signed with Dreamlines, a fast-growing online travel agency for cruises. In commercial, general & bulk cargo volumes were down 1.6% and TEU throughput up 0.6%. TEU stands for Twenty-Foot Equivalent Unit which can be used to measure a ship's cargo carrying capacity. Port Adria's performance continues to improve after completion of investment program, with operating profits at Port Akdeniz supported by weak Turkish lira. Chief executive Emre Sayin said: "Trading since the period end at both our cruise and commercial ports has continued to perform in line with our expectations. Despite significant volatility in Turkish lira during this period, business has not been affected because we are a global business with over 95% of revenues in hard currency. "We look forward to welcoming a record number of passengers to our cruise ports in 2018 and expect to deliver full year results towards the upper end of expectations." Global Ports, which floated in London in May last year at 740p but fell below 400p this March, was up 5% on Friday at 515p. Real estate investor Dukemount Capital saw losses widen in its last financial year, however, the firm now considers itself to be working with "the right parties on the right properties". Dukemount's losses widened 60% to £285,968 as a result of costs associated to the acquisition of its first property and the firm's flotation on the London Stock Exchange back in March 2017. Dukemount, which floated with the aim of helping to "satisfy the large and increasing demand for long dated high yield investments from some of the world's largest financial institutions", has yet to record any revenue and admitted that its full-year growth had not been as rapid as hoped. "The group has explored numerous opportunities during the year and whilst progress has not been as fast moving as we would have liked we do consider that we are now working with the right parties on the right properties and look forward to moving ahead with our first two projects and using this model as a blueprint for future developments," said chairman Geoffrey Dart. Dukemount held cash and equivalents of £148,391 on 30 April.
2019-04-19T22:49:15
http://finance.digitallook.com/news/27890354/Results_round-up.html?username=&ac=
The owls and the possums know me by heart. and assorted bits of cat food, laced with white, organic tortilla chips. cutting through two-years of resignation. here's to anyone s-t-u-c-k between zero and one. Lately, I can't help but notice all of the energy being directed at what's wrong with the world. A dog being choked by its owner, a political conspiracy, another death--unspeakable things darken my news feeds. It leaves me breathless. It leaves me groping in midnight for the tiniest spark, which, depending on the day, may light the way, or burn down the whole effing building with everyone in it. Unknowingly, I've been a part of THIS. I've been a part of the world that roots for no possibility. I didn't do it intentionally. I did it because I got caught up....in the strain of the moment...in the feeling that THIS is not right...in the belief that THIS--whatever THIS is--MUST be acknowledged. Otherwise, my life, my pain, or my experience somehow will not matter. THIS has also made me irresponsible. For nearly two years, I've felt THIS so deeply, that the thought of NOT feeling THIS and NOT discussing THIS has become unfathomable. "How can I express me, without expressing THIS?" I've questioned....day after day after day. "You can, if you choose to." My heart finally answered. Other things have happened, but I choose to focus on THIS. As I write this, I am surrounded by magazines...FAT, juicy, stylish magazines with cover shots of fresh oranges, skinny waists, and famous celebrities. Break Your Bad Habits! --one screams. Start the New Year Bright!--beckons my favorite. They're all different, but hopelessly the same: tuned in to my desperate need to improve, conquer, elevate, and perform. Each January, I plunge into the abyss...usually driven by something ridiculous, worthy, or unreachable. One year, I was determined to wear size 3 Ann Taylor Loft jeans. Another, I vowed to write every day. Another, I took on making a certain amount of money during a certain period of time. Last year, I launched operation "Get healthy and document it." 1. To let you know I was going to be quiet for a while. 2. To declare 2012 the year of "Being" not "Doing." 3. To create some semblance of a normal life...away from message boards, computers, and 24/7 Lyme Disease. Tired of discussing tests, doctors, and medications. Tired of trying to make the best of, or shed light on, an exhausting situation. Tired of sharing more with strangers on the internet than with my friends or husband. Partly, as Shauna puts it, for survival. for the me that's quietly bubbling up to the surface. I miss generating some-thing and no-thing. For a while, this blog filled that space. It's not easy--folding life into pain. Despite deep discomfort, or perhaps because of it, I ache to create, express, and contribute. How to do that when my body runs like a Ford Pinto being held together by duct tape? (or, as ok as I can be...Ford Pinto and all). If you've ever seen the musical Rent, you know the Seasons of Love song. With just a few simple words, it captures the struggle we all have: to experience joy and pain and treasure it all equally. This past year has been like that. 365 days of inches, miles, laughter, and strife. So many nights, I thought I was going to die. So many blessings...created from misery. There are no words to describe what it's like to cry out, night after night, drowning in the dark. Or, how much you appreciate an "ordinary day," once it's escaped you. I can't express it now, but I hope these 365 (or so) posts somehow did. I'm grateful for that AND for you. The skin above my l eft eyebrow is flaking. Pieces of me fall off in chunks, from my matted hair, over my swollen eyelids, into the lines above my cheekbones. "I look so old," I can't help but notice. Gone are my bright eyes of wonder. In their place, a sagging, droopy stare that appears more 80 than 41. It is just the beginning of torment. My left arm hangs at my side, unable to withstand the pull of gravity. "I. just. need. to. hold. it," I think, tugging at it incessantly. My right arm carries it, like a sling. It now holds the weight of two. I hope it can endure without breaking. "You're not getting well," they tease. "It's been over a year." "You can turn this around." Invisible to the naked eye, stands a coach and a patient. Each with something to say. Each determined to drown out the other. Each valid in their points of view, even when the view is less than empowering. In the middle, is me. The real me with a big "M"...listening, waiting, hoping, praying. Day 335: Novel Idea. I'm Going To Try It. If you know me, you know one of my greatest dreams is to finish a book. I say finish, because I've started several of them. Three or four chapters in, I always get stuck stop. "It's the wrong topic," I think. "I should write when I have something more interesting to say." "Not sure I have the energy for this." "I'm not as good as so and so..." Still, November is National Novel Writing Month. And, it would be great to accomplish something that isn't related to sickness, showering, or spider four-suit solitaire. So, I just gave myself a deadline and signed up for thirty days and nights of literary abandon. (Ie: I committed to writing a 50,000 word (approximately 175 page) novel by 11:59:59, November 30). PS Want to join me? Don't be intimidated. It's about quantity not quality. The goal is to silence your inner critic and write, write, write. Through the outpouring, hopefully, something magical will happen. Lately, I've received several emails, messages, and texts. "Where've you been?" "Are you ok?" "Miss you." I feel the same way...missing, somehow disconnected. I can't really say where the time's gone. I'm not out doing the Hustle. I haven't been napping (except this afternoon). I'm not spending my usual time in the sauna, sorting meds, dry brushing, blogging, juicing, on Facebook. I am behind...on everything (phone calls, dishes, art journals...you name it). I guess, realistically, you could say, I've been at the doctors. On average, I have 4-6 appointments a week. With travel, that takes between 12-15 hours. Add on labs, colonics, lymphatic stuff, massage, crazy foot baths...another 5+ hours...gone. It all feels very consuming. When I get home, I usually just stare into space. Too tired to cook, I eat out often. When I can muster up some extra oompha, I go to a movie, have Angel wheel me around Disney, get some fresh air, or visit with friends. Yesterday, in between sips of tea at Starbucks (a rare outing), I caught up with two friends. One just opened a bakery (you should totally visit it). Another just had a baby. "Are you working?" one asked. "Are you better yet?" the other said. In between, I'm daydreaming...about taking a class, singing lessons, working, improv, exercise. It's too soon for those things. Instead, I'm settling for Solitaire. Still, it's a good sign I'm thinking about them. Hard to believe it's already October. Fall afternoon + unread magazines + decaf hibiscus, papaya, mango tea = joy. Altered Today: Time for ME...away from beds, living room chairs, and (for a little while) illness. Stop thinking you can’t make a difference. Stop thinking you have to perfect to be __________, be successful, or be happy. You are so incredibly precious . And there is only one you that can be the difference you are for the world. You get to say how it goes. Day 310: Eat It. I Dare You. Thai hot is not the same as Indian hot. Thai hot will have you sipping water, smiling, reading a book at an outdoor cafe. Indian hot will have you staring at your plate, unable to take another bite, calculating the steps to the door, bathroom, and car. I've been enjoying the curries--red, green, yellow. I'm even getting used to the lamb...which is fortunate since I've eaten it 7 days in a row. But what I am really loving??? The rice. I've never eaten much rice. It makes me feel grounded, balanced, healthy. It's a weird thing about grains. My Naturopath encourages me to eat them. My lyme research says not to. My Acupuncturist's Associate (aka Chinese Nutritionist) says they are absolutely necessary. The Eat Right for Your Type Diet says they're beneficial (especially the rice part). So I guess that means I'm now doing some kind of Chin-Naturo-Lyme-Eat Right diet: allowing grains but only certain ones, embracing the no-sugar law, reintroducing some low-sugar fruits, ignoring dairy (except for greek yogurt), avoiding gluten, being selective with my meat choices. On the surface, it appears to be helping: I've lost 10 pounds; I'm eating more regularly; I feel more stable. We're all so different (and change so much). I think figuring out what works best for you is truly one of the toughest parts of the battle. Altered Today: Respect...for hot foods, Indian cuisine, and my dietary choices. PS To find what the Eat Right for Your Type Diet recommends for your blood type, go here. For a Candida Diet food list, go here. To read about my other dietary experiments, go here and here and here.
2019-04-20T06:22:08
https://tagudin.typepad.com/alter_everything/finding-myself/
Where is LabVIEW Used? Who uses LabVIEW? What companies use it? LabVIEW is used most by companies that manufacture hardware of some sort, specifically in the groups responsible for testing that the product was designed correctly and that the product works before leaving the factory. It’s also used in research (i.e. government labs and universities) that use LabVIEW to facilitate their experiments. LabVIEW is used for other purposes as well (see What is LabVIEW used for). If you really just want to know what LabVIEW is, see our article What is LabVIEW? – A developer’s perspective. LabVIEW is generally used by engineers that are involved in testing the products that they design and manufacture (either in product design validation or in manufacturing test). At Viewpoint, we utilize LabVIEW a LOT for a variety of customers. If you just got some LabVIEW dropped in your lap and you want some help with it, check out our LabVIEW experience and reach out to us for a LabVIEW consultation if you’d like help.
2019-04-25T18:49:06
https://www.viewpointusa.com/labview/where-is-labview-used-who-uses-it-companies-that-use-it/
The Netatmo Weather Station is perhaps one of the most progressive weather stations that have been designed purposely for home use. Not many advanced weather instruments are made for home use like this one in particular and it has proved to be a device in its own class, a true testament of masterclass ingenuity and innovation. When this weather station was created, the engineers wanted to create something completely different. Owing to the increasing cases of pollution in the recent past, there was a need to create a device that would detect the rate of pollution indoors where pollution is known to be prevalent as a result of human beings breathing out carbon dioxide. It for this reason therefore that this weather station was created to help curb the situation. It comes with an indoor unit for that purpose and an exterior unit for your weather updates. This Weather Station is designed to have a carbon dioxide detector which gets to measure the degree of pollution levels and gets to notify you of the conditions that are prevailing inside your home so that you can allow fresh air conditions in your house in the event that it is required and ensure that there is room for a conducive environment for living; for you and your entire family at large. It also gets to notify you of the noise rate in your house just in case the decibel levels exceed the recommended point. The outdoor module on the other hand provides information on the current weather conditions outside your home so that you can be able to know how to plan your day, travel and even the dress code you would decide upon. The weather station can be linked together with a smartphone which allows you to make analysis of the readings that have been recorded in the past. The analysis made can help you come up with trends which will prove useful when it comes to making weather forecasting and predictions for specific locations. It comes with its own special app which allows you to view graphical presentations of the data recorded. Just like other weather instruments, this station also comes with a fair share of pros and cons. It comes in a small size which looks classy and definitely comes with a touch of glamour. They do not take too much space unlike other personal stations which usually occupy a lot of space. The two modules are sleek complement each other and they are by all means very suitable for your home and office. Easy Use: The Netatmo weather station is quite easy and simple to use, with a user-friendly interface. The module can be manually activated and deactivated whenever you desire. You can use it in various ways. To start collecting information, all you need to do is tap the top cover of the device. The weather station will be activated immediately and start sending data to the server. This weather station is very easy to install. Very few logistics are needed for the installation. The indoor module is usually mounted anywhere you find suitable in your house or office. The outdoor module on the other hand can be mounted at the backyard or just outside your window. No elevation is needed and so it should be easy during the installation. The weather station is also one strong one and a robust. It is basically designed to last very long and is bound to give you great service when you use it. It is durable and you need not worry of any damages that can occur to it. The major short coming of this device is that you it cannot be mounted at a place where there is direct sunlight. This is because it lacks the protective shields and thus, your readings can be inaccurate. Furthermore, the weather station only gets to measure a couple of weather variables such as temperature, humidity and barometric pressure. So other variables are left out and you get to miss out on important updates. The device is quite expensive being a personal weather stations compared to other ones with better features. The device should be a good deal for home use and should offer great service.
2019-04-19T22:53:35
http://bestweatherstation2017.com/2017/02/02/netatmo-weather-station-ultimate/
Friday morning we awoke to another chilly, cloudy day in what I had thought would be warm, sunny Greece. Today we were going to wander through Athens. Our first stop was the Central Market to see the meat and fish vendors. We were not disappointed with the spectacle. It was just as reported: loud, busy, hectic. I took a lot of video, trying to capture it. We saw lots of fresh meat being cut specifically to customers' orders and different types of seafood, many we did not recognize. Across the street we found the fruit and vegetable market. Here were the olives I had heard so much about. I was looking for olives similar to what I buy at our local supermarket. Finding some that looked close, I was invited to taste one before buying. I bought a 1/2 kilo and we munched olives as we continued to walk about the city. Our next stop was the Greek agora (marketplace). We used our Acropolis ticket for entrance. This site was pretty neat because of the restored stoa, the shop area. Plus the temple on top of the hill was still in great shape and wasn't covered with scaffolding, cranes or crowds. Then through the flea market which had very few shops geared towards tourists. It was here I checked prices against the store I found in the Plaka. But most of the stores were selling shoes, pants, jackets, etc. We did stop at a bakery and bought something that looked like pizza with feta cheese, tomato and olives which we shared and was delicious. And then we shared a chocolate filled donut. Refreshed with our blood sugar level on the rise, we headed towards the Tower of the Winds and the Roman agora. Because of construction the entrance wasn't where we expected it to be and it would have meant going out of our way to enter. It was getting late and we were tired, so we didn't make it into this site. Does Amtrak Auto Train Have Internet Service?
2019-04-20T20:40:12
http://www.travelsnippetsandmore.com/2010/11/athens-central-market-greek-agora-flea.html
Volcanoes have erupted in the south Armagh area and the remains of volcanic necks can be found in the hills around Forkhill. The often calm, tranquil waters of Cam Lough stretch for just over two kilometers in a north-west to south-east direction. This narrow, elongate lough provides rich waters for the fisherman and marks a break in the lines of hills that surround Slieve Gullion, the Ring of Gullion. Infact, Cam Lough marks the point where the Ring of Gullion is broken, or offset. On the western side, the ring of hills intersects Cam Lough at its northern end at Sturgan Mountain. However, on its eastern side, the ring of hills intersects the lough halfway down its eastern shore. The Ring of Gullion was once a continuous, unbroken ring of hills made up from rocks that were once molten and which were intruded into, and erupted out of volcanoes, that followed a circular fracture, or fault, that existed here around 60 million years ago. A younger fault then developed here, running in a north-west to south-east direction and the rocks on either side were displaced. Geologists have estimated that the total movement along this Cam Lough Fault was up to 2km. This movement didn’t happen in one go but resulted from a series of much shorter movements (a few metres at a time) that occurred over a much longer period of time (probably over several million years). Each time movement occurred on this fault, it would have been felt by animals living here at the time as an earthquake. Thankfully, it is a very long time since the Cam Lough Fault moved and earthquakes in south Armagh are a feature only of our distant geological past! The lough follows, very precisely, the line of the Cam Lough Fault, running for about 2.5km in the same north-west to south-east direction as the fault. The lough owes its existence here to the action of ice. Starting around 2.5 million years ago the global climate began to oscillate between periods of warmer climate and periods of extreme cold. During these cold periods, great sheets of ice would periodically cover large parts of Ireland as the world plunged into an Ice Age. As the ice advanced over the countryside it would erode deep into the underlying rock. Any weakness in this rock would be exploited by the ice which would erode deeper the area of weakness. The Cam Lough Fault has created such a weakness in the rock of south Armagh and it has been over deepened by the erosive action of ice allowing the waters of the present lough to infill the hollow that the ice has excavated.
2019-04-23T05:07:26
https://www.ringofgullion.org/geology/camlough-lake/
An accountant shared a story with his peers of a client who called recently to say “This year I really want to do whatever we can to slash my tax bill and pay the minimum”. The accountant replied “What do you think we’ve been doing when we work on your taxes all these years?” Obviously there was a disconnect in communication and expectations. The client was really saying that he wants more aggressive and sophisticated tax shelter strategies. The accountant was really saying that he was already at the limit of traditional tax planning within his comfort zone. Never before in our lifetime has the drive and opportunity to avoid paying income taxes been so great. I’m jumping ahead a bit on the ‘opportunity’ part by projecting the tax changes that we expect will be implemented in 2017. It seems like these tax changes will come just in time to help those affluent taxpayers, especially business owners, who wish to use them in combination with other legal tools to reduce or eliminate federal income taxes. Our new president has raised awareness and expectations that anyone who works hard enough at avoiding income taxes has the right and the ability to do so. He has also raised awareness that a private charitable foundation can be used to further the goal of avoiding income taxes. Yet he makes it clear that tax savings do not come easy; this is the result of time-consuming and expensive financial planning. The planning should be done well in advance of earning the income that you will shelter. Your bookkeeping and tax filings must be squeaky clean. The best way to ruin tax planning efforts is to lack the backup documentation to support these strategies. Never be fooled into thinking that tax shelters mean disregarding the many complexities of tax law compliance. Tax planning is expensive. We know the adage “It taxes money to make money”. The same idea applies here: it takes money to save money on taxes. Don’t believe tax shelter advertisements that sound too good to be true. Offshore accounts and similar advertised strategies fall into this category. Use experienced help. Recognize that most accountants and attorneys do not specialize in tax shelter planning. Larger firms have individuals who specialize in this area of practice. Look for professional credentials like LLM or MT in compensation planning. Use professionally drafted documents. I maintain a library of tax planning resources but the actual documents should be prepared or reviewed by an attorney. Monitor tax compliance over time. Don’t put your tax planning documents in a drawer and forget about them; this would be a recipe for disaster. In many successful businesses, I see a combination of these strategies being used together for maximum benefit. The best first step is to schedule a review of your current tax situation and past years’ tax filings and then begin to plan ahead for lower taxes next year.
2019-04-21T15:24:14
http://tonynovak.com/avoid-income-taxes/
Handmade in Thiers by one of France's oldest cutlers, Andre Verdier Laguiole cutlery brings sophistication to the table. Laguiole by Andre Verdier cutlery are masterfully crafted from stainless steel and finished with stainless steel bolsters and five-rivet handles. Full-tang construction ensures expert balance and superior durability, while modern materials make them maintenance-free. A fusion of elegance and state-of-the-art technology, Andre Verdier Laguiole sets arrive in a velvet-lined box along with a certificate of authenticity.
2019-04-18T20:19:04
https://www.kitchenstorysg.com/andre-verdier.html
Imagine an island seven degrees south of the equator, blessed with rich volcanic soil, where broad coastal plains rise to the hills and a chain of mystical 3,000-metre peaks. An island roughly the size of Greece, of sprawling cities, endless rice fields, and raw, otherworldly landscapes where you might find boiling lakes and plumes of steam billowing from the earth. This island is known as Java, and it is a food-lover’s paradise. The population of Java, a staggering 145 million at the last count, is largely divided between three ethnic groups: the Javanese, Sundanese and Madurese, each with their own ways of cooking. This post concentrates on the cuisine of Central Java and Yogyakarta, for that is where Bama and I spent three weeks at the start of our recent Spice Odyssey. What is the character of Javanese food? I would describe it as the buttery taste of candlenut, the earthy notes of turmeric, nutmeg, cumin and coriander seed; the fragrance of lemongrass, kaffir lime leaf, lemon basil, ginger and galangal, blended with the sharp tang of garlic and shallot; the fiery jolt of bird’s eye chillies; and the creaminess of coconut milk. There is also one particular trait that sets it apart from Indonesia’s other regional cuisines. While the Sundanese like to eat fresh leaves, the Javanese penchant for sweetness is expressed in the liberal use of palm sugar and kecap manis, a syrupy soy sauce reminiscent of treacle. Apart from the popularity of soy sauce, I spot a few other Chinese influences. In the highlands of Dieng – accompanied by fellow travel bloggers Bart and Badai – Bama and I sample mie ongklok, a specialty of nearby Wonosobo. It consists of noodles, cabbage and chopped chives in a thick, starchy sauce, served with beef sate. The noodles are boiled with the help of a woven bamboo basket called ongklok, hence the name. For dinner near the ancient Buddhist temple of Borobudur, we try kupat tahu – a bowl of rice dumplings, fried tofu and bean sprouts in peanut sauce. In Yogyakarta, or Jogja for short, the four of us visit the restaurant of Bale Raos for a taste of royal cuisine. The two standouts are favourites of the current dynasty’s seventh sultan: urip-urip gulung, grilled catfish rolls in turmeric gravy; and sanggar, thick slices of spiced beef slathered in coconut milk before grilling. After dinner, we wait an hour in line for bungkus (takeout) at Gudeg Pawon, a warung converted from a typical Javanese house. Jogja’s signature dish of gudeg – stewed young jackfruit – will be tomorrow’s pre-dawn breakfast. The heat of the kitchen fills the air, and I can feel the beads of sweat forming on my face and arms. The line moves at a snail’s pace, past a vat of jackfruit stew simmering away on a simple firewood stove. When it is finally our turn to be served, the attendants heap gudeg, chicken and boiled egg on a portion of rice, deftly wrapping the whole ensemble in banana leaf and brown paper. In Solo – formally known as Surakarta – Bama and I return each night to the street stalls at Galabo to sample the local delicacies. We bite into succulent sate buntel, mutton satay covered in fat and drizzled in kecap manis, and admire the resourcefulness of the “poor man’s dish” called tengkleng, a delicious heap of goat ribs and offal in soup. I find a worthy addition to my list of favourite Indonesian dishes in tongseng, a curry-like mutton stew with vegetables and the distinctive touch of kecap manis. We also try nasi liwet tempong, rice cooked in coconut milk and chicken broth, topped with egg, sliced vegetables and chicken thigh; and order a side of cabuk rambak – rice dumplings (ketupat), peanut sauce and a spicy-sweet mystery paste. Iya, saya kangen masakan khas Jawa! Awesomeee.. As usual, I like the way you describe it, James! Makasih, Wien! I can’t wait till my next trip to Indonesia. Terima kasih kembali James. When will you come back to Indonesia? Hopefully sometime this year, Wien. I was thinking of coming again after Imlek but that doesn’t look very likely now. We’ll see! Gosh, I’m glad I’m still in Semarang when this post comes. 🙂 Come again to Java, James. My mother says there are still many dishes you haven’t tried. With your mom’s incredible cooking, I’m jealous that you’re in Semarang. 🙂 I wish I could fit in another trip after Chinese New Year… I am missing Javanese food so much! It doesn’t help that so few of my favourite dishes are available in Hong Kong. I am missing Indonesian food so much and can’t wait till I come home next month. Hope you enjoyed all those foods.. Sorry about that, Nurul. 🙂 I think masakan khas Jawa is my favourite food in the world – I love sweet things and complex flavours so it’s perfect for me. I’am absolutely sure about that, since Sego Gandul, Iwak Pe, and Mangut are some of my favourite Javanese dishes as well. They remind me to my childhood-live in Semarang and Kudus. Agree with you, Jateng has the best food! Jadi mau ke Indonesia, Imlek ini James? I am sure about that too. Your article about Banda makes me want to visit it soon. Your spectacular photos and descriptions have all our mouths watering! The spice blends are especially intriguing to me – I would love to taste those. I learned so much about spices in Java. The best part was watching Bama’s mother cook, and then tasting her dishes afterwards! That experience has made a huge impact on my own cooking – just today I made fried rice with turmeric, nutmeg, pepper, garlic and shallot. My mouth is watering. I loved the food in Java and hopefully I’ll get back one of these days. Your feature shot of the satay is particularly tantalizing. That shot is one of my favourite food pictures from Indonesia – I think the familiarity of satay made it an easy choice for the feature image. Guess I am pretty lucky to live just 4 hours away by plane… I’d love to go back sometime this year. I could hop on a plane right now the effect of your pictures makes my mouth water … oh all that spiceyness; what a treat! I feel the same way! We have some good restaurants here but they are often expensive and lack the dishes I miss the most. It’s strange how Indonesian food can remain so underrated while Thai and Vietnamese are so popular around the world. The first time I had Indonesian food was a few months ago when I was in Amsterdam! I’m sure there must be at least one in the DC metro area, so I’ll have to find it. That would be really interesting – and a great way to combat the extreme winter weather these days! The way you described the foods and flavors had my mouth watering! Being a vegetarian, though, I wonder if I would find a lot of Indonesian/Javanese dishes to try? By the way, I was just reading that jackfruit is the new darling here in the U.S.; lots of chefs are using it these days. I just had some for the first time in Nicaragua! Actually yes, although vegetarianism isn’t very common in Java, there are plenty of fabulous vegetarian dishes. Gado-gado and pecel are perhaps the most famous; both consist of mixed vegetables in peanut sauce. You can also have stewed young jackfruit without the sides of chicken and egg. One of my favourites is lontong sayur, which is coconut milk and vegetables with rice steamed in banana leaf. You’ll also find lots of tofu and a local soybean product called tempe. I especially love tempe when it’s fried in sweetened soy sauce. I didn’t know that jackfruit was catching on in the U.S. – I’ve always associated it with dessert! It is perfect in a shake or with ice cream. OK – so I certainly won’t starve to death over there! Yum! All looks so delicious but I’m a bit wary of so many chillies! Funny thing is, that dish with all the chillies wasn’t nearly as spicy as I imagined! It was largely because they were cooked whole instead of being ground into the sauce. If that had happened I’m sure my taste buds would be completely overwhelmed. Completely salivating!! Love how you described the character of the cuisine. I seriously miss tahu… cannot get anything even close to the way it is prepared in Java here in India. Actually, I don’t recall having tahu at all (or any other soy products) during our month in India. But Keralan food really reminded me and Bama of Indonesian… it must have been the similar spice blends and their love of coconut milk! I get the association between some Kerela cuisine and Indo too. But you can see now why I miss tahu?? I’m glad I waited until I was full to read this or I’d have stopped halfway to go eat. That mangut looks pretty awesome – and spicy. Was it as fiery as it looks? That nasi kuding with all the sides looks like a personal buffet. The mangut was spicy, but not overwhelming at all. I think the creaminess of the coconut milk balanced out the chillies. I loved the nasi kuning – so much effort was put into cooking it and I felt it was way more special than a run of the mill birthday cake! It really was! I definitely miss all the spices and flavours. You’re welcome. 🙂 I love Indonesia and Jateng. Cool, I had a really great time there. Solo has so much culture and history. What an amazing variety, and yet, I am not familiar with a single one of these dishes! I even had to Google candlenut! The Mangut looks particularly delicious. Strange how the South East Asian culinary scene has been dominated by Thai and to some extent Vietnamese cuisine. We much preferred Lao and Burmese. And from your mouthwatering account, I think Indonesian could easily best them all. Bama and I felt that the food on India’s west coast had strong similarities with Indonesian, so I am sure you and Ravi will enjoy it as much as I do. The lack of exposure compared to Thai and Vietnamese might have something to do with Thailand’s long-standing appeal as a tourist destination and the spread of a large diaspora (Vietnam). That said, Indonesian food seems to be very popular in the Netherlands where roughly 1.8 million people are of Indonesian descent. It will be interesting to go on a Dutch-Indonesian food tour when I get to Amsterdam! James your food photography is incredible. I think I shall come over for some lessons! I enjoyed seeing the dishes very much however moreso your eloquent description of the delicious dishes. Bama’s Mom sounds like quite the extraordinary and generous cook! Thank you so much, Sue! It takes a lot of practice, the right kind of light (natural is the best) and the advice of someone with more experience – in my case, Bama. His mom is really a superb chef. I learned so much watching her cook and she even gave me the recipe to one of her signature dishes! Thank you so much, Randall! 🙂 May you live to the fullest this Year of the Fire Monkey – here’s to another 12 months of new adventures and happy memories. 🙂 祝你身壯力健, 心想事成! Thank you James, your celebration of Javanese food is so heartfelt ! Lapar ! Ah, I don’t have the answer for that one. 🙂 I guess it was partially down to perfect timing – we were travelling around Idul Fitri and Bama’s family decided to welcome me into their home for the festive season. Wow I love your photos and the descriptions of regional food which are so descriptive that I am feeling hungry reading your beautiful post. How lucky you are to have home made food made for you. What a wonderful treat! I love hr photo of Bama’s mother cooking chills and the finished product. Thanks Peta! There is really nothing like home-cooked food. It was such a privilege to be invited to the family home by Bama’s parents. I learned so much about Javanese cooking from his mother. Say what that’s a perfect coincidence! I have never heard of Java and this post is so informative! I love learning about new cultures’ foods and man, do these ever look delicious. Thanks for sharing!! You’re welcome! Javanese food isn’t well known outside Indonesia but I hope that begins to change in the next few years – it deserves so much more recognition! It certainly looks like it needs more recognition! Some amazing stuff there!!! So intersted with your review about Javanese Food. Indonesian food is very unique you also can try Pempek (cake fish originaly from Palembang, South Sumatera), Gudeg (Jogja Traditional Food), Tekwan, Celimpungan, Model, Laksan, Bakmie, Martabak and also others traditional food. The most many delicious food is from Palembang. Thank you for commenting, Putri. Gudeg is one of my favorite Indonesian dishes – now that I live in Jakarta I have it fairly often these days. Back in early 2015 my best friend and I went on a short trip to Palembang; trying different kinds of pempek (like kapal selam) was a highlight, and I also recommend the local specialty mie celor.
2019-04-21T06:38:33
https://notesplusultra.com/2016/01/28/food-from-the-heart-of-java/
OK, so this might sound a bit weird, but ever since I was little I've been close to the dead. Instead of making real friends, I would talk and play games with thin air. To list all the weird stuff that's happened to me would take too long, but this is one of the most resent. About a year ago, I was staying with my grams house (which is normal for me because I stay with her once a week) and I was watching TV with her when I just burst into tears. I don't know why, but I just couldn't stop. Finally she calmed me down I went to bed. Then the freaky stuff started. First I could hear footsteps in the hall and in the attic, which I know for a fact used to be a nursery to three young children. The house was her grandmothers, so its pretty old, and with age comes history. Then I heard a small child's voice that asked me to give them a hug. I freaked out and got my mum to come and get me. The next week I went back and it was worse. I saw two children, a pretty little girl with dark brown hair. With her was a smaller boy who looked similar but with blond hair. They didn't scare me this time and I just smiled at them. I've seen the girl, who's name I learned was Amalie and that she died of the measles, twice since then, but now I just wave at her. The boys name was Dante and I've seen him once, but he's more shy than his sister. I still call to them when I get sad, but mainly I just hear them talking and playing. Being dead hasn't got them down!
2019-04-19T10:56:25
http://www.gods-and-monsters.com/harley.html
The topics covered in Embedded Design Training include latest and best real-time examples that are aimed to help students in getting the right job so after the completion of Training. The topics covered in Internet of Things Training include latest and best real-time examples that are aimed to help students in getting the right job so after the completion of Training. The topics covered in Data Science Training include latest and best real-time examples that are aimed to help students in getting the right job so after the completion of Training. Platform to discuss your queries. TekSpot Solutions is a leading Software Training Institute and provides Job Guarantee Program in Bangalore Class Room and Online Training services. Managed and Lead by IT Professionals with more than a decade experience in leading MNC companies. We are most popular for our training approach that enable students to gain real-time exposure on cutting-edge technologies. The students will be trained on technologies required to work on the project; post which, project guidance shall be provided based on the guidelines of our partners. Throughout these year we have done amazing work with 150 students.. If you have questions, don’t hesitate to get in touch with us. Please provide the details requested below, so we can answer your question as quickly and efficiently as possible. 3rd Floor, Chourasia-Shreyas Complex, 3rd Main, Ashwath Nagar, Marathahalli, Bangalore- 560038. Land mark - Beside City Union Bank.
2019-04-22T16:22:46
http://www.tekspotsolutions.com/
Individually crafted by Michael Schunke and Josie Gluck, each limited production hand-blown glass design makes a contemporary statement while preserving traditional techniques and hand-made excellence. This page is an archive of our design portfolio. To purchase our current designs, please visit our Shop Designs section. Designs currently available to order in our shop. Please visit our shop section to view details and purchasing information. Please contact us for availability and purchasing information. Please click on an image to contact us for additional information. These designs may be available by special order, and go as far back as Michael's Nine Iron Studios, since 1994.
2019-04-20T16:46:04
https://www.vetrovero.com/design-archives.html
1965. 246 pages. White pictorial dust jacket over cloth boards. Inscription to front endpaper. Good clean pages with bright copy and firm binding. Light tanning to endpapers and page edges. Boards are mildly rub worn, with some light shelf wear to spine, edges and corners, corners are bumped. Slight crushing to spine ends. Sunning to spine and edges. Light wear to dust jacket with tears, nicks and creases to spine, edge and corners. With some tanning to spine and edges. Sticker to front.
2019-04-20T22:56:14
https://www.worldofrarebooks.com/hawks-of-noon-by-john-c-champion.html
anybody still using the forum? just curious as to how many people actually come use the forum.. I've been using it but not as much as when I was brand new. Unfortunately, nobody else seems to be using it. It's a good place to teach people who are new to the game how to play because this was the first place I came to even before I talked to any veteran players. How long so you hold a grudge or forgive and forget? Why Ban Stable Leaders During USL Final?
2019-04-24T14:17:55
http://support.wrestlerunstoppable.com/support/discussions/topics/314102/page/last
Sherry Black funeral today at 11 a.m. The funeral for slain bookseller Sherry Black will take place Monday in Sandy at 11 a.m. She and her husband, Earl Black, ran B&W Billiards and Books from a building next to their home at 3466 S. 700 East. Earl Black makes custom knives and pool tables; Sherry Black sold used and rare books. Black is the mother-in-law to Greg Miller, CEO of the Larry H. Miller Group, which owns the Utah Jazz. The 64-year-old was stabbed to death at her home on Nov. 30. Her funeral will take place at the Sandy Utah Crescent Stake Center, 1700 E. 10945 South, at 11 a.m. She will be interred at Wasatch Lawn Memorial Park.
2019-04-21T12:16:41
https://archive.sltrib.com/article.php?id=50816992&itype=CMSID
Bike Accident – Equip the kids with a properly fitted bike helmet, elbow pads, and kneepads. The helmet will protect your child’s head in case there is a collision, and the knee and elbow pads will minimize road rash and added pain in the event of a sliding accident. Make sure your child is also riding a bike that is appropriate for his size. Take your kids’ bikes to a reputable bike shop at the beginning of summer for a proper fitting to ensure the tires are inflated, brakes are in good working condition, and the chain is tight. Dress your kids in reflective clothing to make sure drivers see them. If your kids ride their bikes around dusk, be sure to equip their bikes with reflectors and lights. Instruct them to always ride with at least one hand on the handlebars to be in full control of where the bike is headed. Quiz them on traffic laws and hand signals before you let them ride in traffic. Make sure they are aware of their surroundings before making a turn and be on the lookout for cars pulling out of driveways into traffic. Sunburn – The sun is most powerful between 10am and 4pm, so try to avoid having the kids play in direct sunlight during those hours. Look for shady areas to keep them occupied and apply ample amounts of waterproof sunscreen with an SPF of 50+ to prevent sunburn. If your child has fair skin, include a hat for the warmest part of the day. Reapply sunscreen as needed, especially if the kids are playing in the pool. Take breaks playing in and out of the sun, and have plenty of water on hand to keep them hydrated. Playground – Never let the kids play unattended, as they often think they are invincible with superpowers and exempt from falling. Spot them when climbing on the jungle gym or on the rock wall, as kids are more cautious when parents are supervising nearby. Choose a play area that has shock-absorbing material like mulch, pea gravel, or rubber to minimize the impact of falls. Be mindful of kids in different age groups and, if possible, separate toddlers from school age kids to minimize accidents. Be aware of your surroundings and avoid playing on broken equipment or near debris that could cause a fall. Sports Injury – Kids love sports and competing, but being overzealous on the field can cause accidents. Using fair play tactics to call “mine” will help avoid colliding with a teammate on the field. Following established rules and wearing protective gear will also reduce sport-related injuries. Make sure kids take the time to warm up and cool down after engaging in sport activities. Stray Pets – Stray animals can carry diseases like rabies, so even though they may look fine, it can be dangerous to let kids play with stray animals they come into contact with. When kids see an animal they don’t know, they should avoid eye contact and move cautiously. Parents should also position themselves between the animal and their child to prevent bites. Poison Ivy / Poison Oak / Poison Sumac – Allergic reactions to the natural oils in these plants can cause high levels of discomfort. Be aware of what these leaves look like in nature and avoid contact with them. Dress in long pants and shirts with long sleeves when out hiking. Also stay on well-groomed trails and avoid wandering off the beaten path. If you do come into contact with urushiol, the oil from the plants, use Tecnu Original or Tecnu Extreme cleanser within the first 8 hours to relieve symptoms and clean infected clothing like boots and gloves. Wash infected clothing several times in hot water before wearing again to avoid re-infecting your skin. Bug Bites – Outdoor play in the summer presents its own set of challenges, especially if you live in a humid climate. Mosquito, tick, and chigger bites can be annoying and cause other health issues if not treated property. Use an insect repellent that contains at least 20% DEET and cover legs and arms when possible to minimize skin surface area for the insects to bite. Apply sunscreen first, then apply insect repellent and make sure to reapply every few hours. Avoid playing in wooded and brushy areas with high grasses and leaves. When hiking, make sure to stay on the trail to minimize risk. Taking the time to prepare your kids for safe play this summer will prevent accidents and injuries. Make summer safe by planning activities for the entire family to participate in. Be smart and set boundaries to keep everyone safe and maximize summertime fun. Previous articleThere Are So Many Different Parenting Styles, and One Thing That Makes Me So Mad About All of Them (Except Mine)!!
2019-04-25T16:49:32
https://momsmagazine.com/tips-to-avoid-common-outdoor-playtime-accidents/
Very nice 5 bedroom/ 5 bath villa with tennis court and pool, sea views. Attractive 2 bedroom/2 bath apartment with air conditioning, in a villa overlooking the Aegean outside Athens [25 miles]. Additional bedroom/bathroom available on request. Sea views. Walking distance to beach. Very nice 2-3 bedroom/2 bath duplex penthouses with air conditioning, high speed internet access. Walking distance to all major sights. Athens: Nice air-conditioned 3 bedroom/2 bath apartment 15 minutes from the city center. Athens Coast, Greece: modern, comfortable 1-2 bedroom, 1 bath apartments and studios are situated by the beach in Varkiza,near Vougliameni on the Attica coast, about 15-16 miles from Athens. beaches; easy access to city center.
2019-04-24T02:20:38
http://www.villasintl.com/Europe/Greece/Athens/
Shea Stringer and Joshua Reaves, RBC Branch Managers/Small Business Development Leaders, aroused the interest and shared valuable tips with the attendees of the GCBN 3rd Quarter Seminar on Saturday, October 23rd. Within the wealth of information shared, the presenters tagged teamed, revealing strategies to optimize cash flow, the importance of knowing and understanding your credit score, excellent tips on “how to” grow your business and a directory of small business resources. The GCBN always challenges us to find ways to use Christian principles in our business activity. When asked to write this article, I began to think of some of the most important principles that should guide us in business. What first came to mind was Matthew 7:12 “Do unto others as you would have others do unto you”. Proverbs 22:7 says, “The rich rules over the poor, and the borrower becomes the lender’s slave.” It doesn’t take a rocket scientist to see what is going on in the world today. We are living in an unstable economy. One in four mortgages are now underwater. That means the homeowner OWES more than their home is worth!!! And if you have a mortgage on the home you “own”, do you think the home is really yours? Ant Hill is a Christian based company; based on the principles of the biblical scripture: Proverbs 6:6-8. Our live presentations with bigger-than-life ants are aimed to encourage positive development in families and kids of all ages.
2019-04-26T12:36:41
http://www.gcbnetwork.com/blog/
Homes have been without power today after a car crashed into a telegraph pole. Police were called to Chapel Lane in New Longton, near Penwortham, at 8.45am after getting reports of a Toyota GT86 crashing into a telegraph pole. Lancashire Police's Force Incident Manager Dave Britton said: "It's a car that went into a telegraph pole. "We're now waiting for the pole to either be removed or made safe by engineers." Some 162 homes were reported to be without power at 9.11am with a hope of being fixed by 11.18am. 83 homes remained without power going into the afternoon, with Electricity North West restoring power to all properties by 3.30pm. Chapel Lane was closed and no injuries were reported from the crash.
2019-04-19T10:40:36
https://www.lep.co.uk/news/traffic-and-travel/this-is-why-power-has-been-out-for-homes-in-the-preston-and-south-ribble-area-1-9586237
Motto: Never underestimate your enemy... he's always worse than you could ever imagine. Leads with courage and cunning. Fearless in battle frontline. Can outwit even the smartest Decepticon with the sheer skill of his battle strategies. As vehicle, his central forward facing turbine elevates to fend off the attack from high flyers. As robot, armed with a powerful hand held turbo defender.
2019-04-18T14:43:00
http://www2.unicron.com/1992-transformers/340-1992-g1/1804-boss-turbomaster.html
HIOWWT is the only conservation charity committed to improving conditions for all wildlife in Hampshire and the Isle of Wight. They manage over 46 nature reserves as part of a vision to create ‘Living Landscapes’ for the future. The VCT identified an opportunity to partly meet its objective of disseminating conservation information to schools, other educational institutions and members of conservation bodies through sponsorship of the Hampshire & Isle of Wight Wildlife Trust’s Wildlife Watch Groups – their junior branch and the UK’s leading club for young environmentalists. The VCT committed £20,000 over a 5 year period which helped fund new activity boxes for each group, regular newsletters, vital training for group volunteers and new materials which helped encourage more local children to get involved.
2019-04-24T12:51:41
http://www.vitacress-conservation.org/hiowwt/
Preparation: A B. bronchiseptica aroA mutant was constructed by allelic exchange. Introduction of the Km-R cassette into the aroA gene of this strain was confirmed by PCR using aroA-specific primers (aroAfw 5′GGCGTGCAAAGCGGGGCGGACTGGCTGGAG3′ and aroArv 5′ATAATCGGGGAAAGTCTTGCTGACGCAGCC3′) and by Southern blotting and DNA:DNA hybridization using an aroA-specific probe generated by PCR (Stevenson and Roberts, 2002). Description: This aroA/trpE mutant is from Bordetella bronchiseptica (McArthur et al., 2003). Preparation: An isogenic mutant of RB50 containing an in-frame deletion of the adenylate cyclase toxin gene (cyaA), was constructed with an in-frame deletion of the ATPase (bscN) gene required for type III secretion (Mann et al., 2007). Persistence: Wild type B. bronchiseptica could still be detected in lungs up to 56 days post-infection. In contrast, the numbers of BBC18 did not increase following inoculation, but decreased rapidly, and were cleared from the lungs completely by day 6.The nasal cavity samples showed the same trend and were also clear of bacteria after 6 days. The behaviour of the mutant and the wild type strain was mirrored in outbred NIH-S mice. Thus the B. bronchiseptica aroA mutant is highly attenuated (Stevenson and Roberts, 2002). Efficacy: Immunization with GVB120 (B. bronchiseptica aroA mutant expressing FrgC), by either regime, had a major effect on colonization of the lungs, trachea and nasal cavity by wild type B. bronchiseptica BBC17. The effect of immunization on the subsequent colonization with BBC17 was more pronounced in the lower than the upper respiratory tract (Stevenson and Roberts, 2002). Description: High titers of anti-B. bronchiseptica IgA were detected in serum samples from immunized, but not naive, mice prior to challenge (Stevenson and Roberts, 2002). Description: High titers of anti-B. bronchiseptica IgG were detected in serum samples from immunized, but not naive, mice prior to challenge (Stevenson and Roberts, 2002). Description: High titers of anti-B. bronchiseptica IgM were detected in serum samples from immunized, but not naive, mice prior to challenge (Stevenson and Roberts, 2002). Persistence: An aroA/trpE mutant is attenuated in mice (McArthur et al., 2003). Efficacy: An aroA/trpE mutant induces significant protection from challenge with wild type B. bronchiseptica (McArthur et al., 2003). Persistence: TLR4def and TNF-α−/− mice were intranasally inoculated with 103, 104, or 105 CFU of RB50 or 105 CFU of AVS in a 50-μl inoculum and observed them for signs of severe disease. WT mice given similar doses of RB50 are able to control the disease and to clear bacteria from the lower respiratory tract (Mann et al., 2007). Efficacy: The nasal cavities of vaccinated TLR4def mice and TNF-α−/− mice contained 10,000-fold fewer CFU than those of control mice. The tracheae and lungs of vaccinated TLR4def mice and TNF-α−/− mice contained <20 CFU, while the same organs of control mice contained approximately 106 and 108 CFU, respectively. These results indicate that low-dose intranasal vaccination with AVS protects susceptible mice from severe infection by a variety of B. bronchiseptica strains (Mann et al., 2007). Description: AVS induces significantly increased IFN-gamma production in mouse splenocytes as compared to naive mice. This increase occurred 28 days after vaccination and after stimulation with heat-killed RB50 (Mann et al., 2007). Description: AVS induces decreased IL-10 production in mouse splenocytes as compared to inoculation with wild type strain. This decrease occurred 28 days after vaccination and after stimulation with heat-killed RB50. However, IL-10 was significantly upregulated in splenocytes compared to naive mice (Mann et al., 2007). Stevenson and Roberts, 2002: Stevenson A, Roberts M. Use of a rationally attenuated Bordetella bronchiseptica as a live mucosal vaccine and vector for heterologous antigens. Vaccine. 2002; 20(17-18); 2325-2335. [PubMed: 12009288]. McArthur et al., 2003: McArthur JD, West NP, Cole JN, Jungnitz H, Guzmán CA, Chin J, Lehrbach PR, Djordjevic SP, Walker MJ. An aromatic amino acid auxotrophic mutant of Bordetella bronchiseptica is attenuated and immunogenic in a mouse model of infection. FEMS microbiology letters. 2003; 221(1); 7-16. [PubMed: 12694904]. Mann et al., 2007: Mann P, Goebel E, Barbarich J, Pilione M, Kennett M, Harvill E. Use of a genetically defined double mutant strain of Bordetella bronchiseptica lacking adenylate cyclase and type III secretion as a live vaccine. Infection and immunity. 2007; 75(7); 3665-3672. [PubMed: 17452472].
2019-04-25T03:52:29
http://www.violinet.org/vaxquery/vaccine_comparison.php?displayOption=y,y&c_host_id=3&c_vaccine_id%5B%5D=3122&c_vaccine_id%5B%5D=3123&c_vaccine_id%5B%5D=3268
Melissa Lundquist is an assistant professor at the University of St. Catherine/University of St. Thomas School of Social Work. Melissa began working with families facing cancer in the early 1990’s while in graduate school at Fordham University in New York City. After returning to Minnesota, she worked at the Angel Foundation co-directing the Facing Cancer Together program until joining the School of Social Work faculty in 2015. Melissa is familiar with the profound physical, emotional, financial, and legal challenges families must navigate when living with cancer and is honored to be part of team at Cancer Legal Care.
2019-04-18T18:46:08
https://www.cancerlegalcare.org/who-we-are/board-of-directors.html/title/melissa-lundquist-phd-msw-lgsw
Pragmatic Investment Plan - Quarter 4/2016 - Motion, not progress. 2015 is long over and it’s time for a little belated reflection over its last three months. Of those I enjoyed (the beta version of) Rails, Angular, Postgres, and Bootstrap the most. I was also lucky enough to get a sneak peak at The Art of Monitoring and it’s coming together wonderfully. It feels like a very important book and I think it’ll be much loved when finished. I continued to track the number of books I read and keep a rough page count. Through 2015, counting only books that I actually finished, I read 54 books totalling about 14,633 pages. This is a lot less than the last few years and probably reflected the smaller amount of time I spent commuting. I also set myself some small goals in regards to my main two websites, UnixDaemon and The Puppet Cookbook. Both had been left to languish while I was busy at work and had barely enough time spent on them to migrate over to a new VPS (but still on Bytemark). UnixDaemon is now built using the Hugo Static Engine but to be honest it’s not been much fun to use. Although Blosxom managed to last me over a decade I’d be surprised if hugo lasts a year. Due to a long story of woe I lost the code to build the Puppet cookbook site a few years ago so it’d been left to rot. I had some spare time just before Christmas so I threw some quick ruby and HTML together and after redoing all the recipes in markdown I got it deploying again. Since then I’ve added basic syntax highlighting and made the solutions more compatible with modern puppet. The work’s not finished but at least I can update it and the presented code won’t scream in pain under puppet-lint. It looks like I’ll be doing more puppet focused work this year so I’m hoping for a few more strikes of inspiration in terms of what else to cover. In terms of technical events I limited myself to a single conference in Q4 and attended DockerCon Europe 2015 in Barcelona. The city was lovely, the weather was great, and the conference was very well organised. It’d been a while since I last looked at Docker and it was great to see how production ready it now is. 2015 was also the year of cutting away obligations. I stopping being involved in a number of technical events in an attempt to regain my evenings and helped migrate away a number of websites I hosted for other user groups/projects in an attempt to simplify my own infrastructure. Once I got over the feeling of guilt about doing it the handing over was a lot easier than I’d expected. If anything I wish I’d done it a few years ago. The year ended with a large change for me. I left an amazing role at Mozilla and took a job back in London. I enjoyed my time, and the people, at Moz but after nearly 3 years of pure remote working I was starting to become a little insular and hermitesque. I’m hoping that working in an office with other technical people physically present will be a good thing. Even if commuting again feels like a massive step back. If you’re considering applying for a role at Mozilla I can heartily recommend it. It has some amazing people and offers a lot of freedom to do good, solid, technical work. With hindsight 2015 was a decent if not groundbreaking year. In a way it’s reassuring to know this one could easily be much better. So here’s to that.
2019-04-19T12:46:42
https://www.unixdaemon.net/career/pip-2015-q4/
Next was Couma, holding a large vial filled with a red liquid. "I can heal you”, said COUMA,. "YES", pleaded the people, as they threw coins. But Couma actually seemed to cause some to hemorrhage. At this point many were beginning to be angry at these ARMS. “Arms, arms, arms” they would mutter to themselves.
2019-04-25T12:31:47
http://www.cathydslaght.com/cathyslaghtchatcom/fast-byte-and-the-seven-wharves-six-more-arms
Personalized Home Care Services aspires to be the leading provider of home care in Redford, Michigan. We offer compassionate in-home care for seniors, disabled persons, and recovering patients. Let us help you gain peace of mind. Request a FREE care visit today!
2019-04-22T04:45:07
http://www.myphcs.com/home-care-redford/
With clever use of space and a well thought out layout plus on-board comfort, this is a boat that switches from water sports to cruising to light fishing with ease so that you can truly enjoy all the freedom of being on the water. She offers unique styling and comfort and provides the best practical features such as storage and class-leading safety characteristics. Active 675 Open has easy access in and out of the water thanks to a large swimming platform. Generous and comfortable seating up front quickly folds over to connect with the seating in front of the cockpit to create a sun pad for a little sun worship. It is equipped with a 200HP Mercury Verado, outboard engine that provides a smooth, dry and confident ride with outstanding fuel economy. Take her to the water with the confidence. Length 6,75m-Width 2,55m-Engine Mercury VERADO 200HP, turbocharged fourstroke-Max. Speed 42MPH-Fuel Tank 135l-Fresh water tank 45l-Persons max.8-Year built 2014.
2019-04-22T20:46:58
http://www.rentaboat-split.com/quicksilver-675-activ-open/
Jussie Smollett has officially been charged with federal disorderly conduct for filing a false police report for his alleged attack on January 29th. Chicago police spokesman, Anthony Guglielmi, tweeted on Wednesday afternoon (February 20th) that the Empire star is being charged with a Class 4 felony, and that detectives presented evidence before a Cook County grand jury. If Smollett is charged, he can face one to three years in prison. Fox is denying reports that Jussie Smollett’s role on Empire is being cut amid a reported investigation into whether he staged his own attack. Smollett and his attorneys, meanwhile, have agreed to sit down with police in a bid to stave off a grand jury, TMZ reports. Meanwhile, late in the day Wednesday, CBS2 posted video that allegedly shows Ola and Abel Osundairo buying ski masks, gloves, red hats and other gear reportedly used in the staged attack. Police sources tell CBS that the pair bought the items at Smollett’s direction. Since the January 29th attack that landed him in the hospital, the narrative around Smollett’s role in it has evolved. Smollett has maintained that he was assaulted by two men shouting “homophobic” and “racist slurs,” while police sources have repeatedly told news organizations that they are looking into whether he colluded with two Ola and Abel (who were arrested and later released) in the attack. His siblings have also stood by him. Smollett's brother, Jocqui, posted an Instagram photo that read, "This is the media, an irresponsible media. It will make the criminal look like he's the victim and make the victim look like he's the criminal. If you aren't careful, the media will have you hating the people who are being oppressed and loving the people who are doing the oppressing." His sister Jurnee Smollett-Bell then reposted the image. Later, Jocqui posted another image that read, "I have a feeling even if we had video of Jussie Smollett being attacked… y'all would still discredit him. Because it's easier to believe what aligns with your contempt for survivors of hate crimes, sexual abuse, etc who happen to be LGBTQ+, disabled or women."
2019-04-22T07:05:39
https://www.lecomradio.com/entertainment/jussie-smollett-officially-charged-for-filing-false-police-report/
Hardwater Kiting is New England's #1 choice for snowkites. We use the gear we sell. Our offerings are based on our first hand experience with what works best here in Northern New England as well as other snow kiting locations. Hardwater Kiting also offers anything that the above brands produce. If there is something that you want that you don't see listed here, please contact us. Special orders are not a problem.
2019-04-25T16:59:23
https://www.hardwaterkiter.com/snowkites.html
While resources-related projects will always be the engine of the sector, the rising number of residential, hotel, retail, transportation and office developments are becoming increasingly important, as the country’s hosting of APEC in 2018 and the expanding middle class continue to shift Papua New Guinea’s construction priorities. Although a downturn in the commodity cycle, the end of construction on the PNG LNG project and long-standing ambiguities over land rights have constrained development in the real estate sector, changes are afoot that could lead to significant improvements. About half a dozen major housing projects are now under way, and homes at reasonable prices are fast becoming available. A culture of home ownership is taking hold, driven by rising prosperity and aspiration. This chapter contains interviews with Matthew Lewis, Managing Director, Hornibrook NGI; and Graham Boddington, General Manager, Northbuild Construction.
2019-04-22T21:27:11
https://oxfordbusinessgroup.com/papua-new-guinea-2018/construction-real-estate
Inside all of us is an urge to break away from the doldrums of monotonous everyday life. No matter how hard we work to suppress that urge, sometimes we can't fight it. Sometimes we have to feed that urge to unplug, clip in, and create our own adventure. What's holding you back? Call out sick on Friday, load up the frame packs, and get lost on the ride in that search for the perfect spot to tie up your hammock. You may find yourself rattling over dusty two track straight through the night. You may find a dirt road that you've always wanted to ride down, but you never had the time, or energy, or equipment to make it worthwhile. This is your chance to break free!Find your own adventure on the all new Marquette Carbon Adventure bike. Full SRAM Drivetrain - Combining a mix of the most dependable drivetrain components SRAM has to offer you'll be ready to tackle the unknown with ease. The Marquette Carbon Adventure utilizes the latest SRAM 1x11 technology from both the mountain and road side to deliver the optimum in gear range, precision, and durability. Recon Silver RL Suspension Fork - The Recon is the new standard for value and performance. The blend of a Rockshox Reeba’s crown and stanchions with matched with a bomb proof steel upper tubing create a killer combination between strength and performance. With shorter tubing the recon delivers weight savings which come in handy on those 500+ mile rides. When I saw this bike in September at the Framed Bikes Booth out at the Minnesota State Fair I was skeptical at how they could be selling this setup for such a low price. They explained how they operate and run a lean ship and their direct to consumer channel cuts out the middleman passing the savings to the consumer. I went to the House showroom and actually rented one for a day and was hooked. They even applied the rental price to the cost of the bike! I was looking at buying a Salsa Cutthroat after reviewing the geometry they are nearly identical and the build is nearly identical as well except the Cutthroat is $1,500.00 more…Plain and simple this bike rips and I could not be happier with the quality and the service I received from The-House, You guys rock! Picked this bike up from The House at their show room in St. Paul this summer and I feel bad for my other bikes as they have not seen any action since. I have been riding more places than I ever was before on my road bike and seem to actually seek out dirt roads and paths that I would have sneered at in the past with my road bike. Geometry is awesome for long rides and handles even some light single track riding like a champ! Planning to buy a set of 27.5+ Wheels and seeing how this thing rides with some chubbies on it! Will update my review when I do. Thanks FRAMED!
2019-04-21T00:11:27
https://www.the-house.com/qfrmcri29r17yb17zz-framed-bikes.html
Gene Blevins/ReutersA tornado in Kansas last week. A new poll suggests the public feels that global warming is real. Sunday will be the 42nd annual Earth Day celebration. Here are 10 ideas for commemorating the day, observed each year on April 22, or exploring issues related to the environment in the classroom or home on any day of the year. When was the first Earth Day (PDF), and what major themes did it address? Are these themes still relevant today? How has Earth Day changed since 1970? In the past five or 10 years? Since the year in which you were born? How had public attitudes and environmental concerns changed by the time Earth Day hit 20 and “shed its humble roots”? How has going global shifted its focus? And how has “green” turned into big business 40 years later? After searching for Earth Day coverage over the years in the Times archives, students make posters intended to aesthetically and thematically represent Earth Day celebrations from various years. Alternatively, they investigate who coordinated the first Earth Day and what personal experiences shaped his attitude about preserving the environment. They then reflect on what factors have influenced how they consider the environment and make posters representing what Earth Day means to them. What do you know about Earth Day and the environment? Students test their knowledge with our student crosswords about Earth Day or global warming. Or, students create quizzes intended to test others’ knowledge of major environmental events since 1940. Another way to do the quiz is to list the events on the board and have students try to put them in chronological order. To follow up, ask students how they might get to know the natural features of the place where they live, like rivers, lakes, woodlands, fields, rock formations or even mountains. Can they identify the common plant and animal species that live in the community? Have them annotate a map of the neighborhood around your school with these features and note the species you would expect to find there. If possible, take your class on a sense of place field trip, using tools like Environment Canada’s Urban BioKit or Nature BioKit as guides for students to complete as you walk around your school’s neighborhood or to a nearby park. After their exploration, students read the Scientist at Work blog post “Biodiversity, and Green Slugs, in Action,” noting the number of species the author lists in her column. Using this column as inspiration, they then write a similar essay on their experience of the sense of place walk. A growing number of scientists and conservationists suggest that the best way to preserve and protect the Earth is to focus less on restoring degraded lands to a former, “pristine” condition and more on preserving what we can while accepting that people are a part of Earth’s ecosystems. After reading the Op-Ed “Hope in the Age of Man,” students discuss its main ideas: what is the “Anthropocene,” and why do some environmentalists see it as a “disaster”? What do the authors have to say about it? Do students agree with the authors’ assertion that “We can accept the reality of humanity’s reshaping of the environment without giving up in despair”? Alternatively, use our lesson “Will It Happen Again? Examining Mass Extinctions on Earth” to explore the perspective some scientists hold that humans are responsible for a major extinction on Earth. What actions can you take to provide shelter for wildlife in your community? As a class or as a school community, consider following the National Wildlife Federation’s guidelines for building a Schoolyard Habitat. Students might encourage their families to use native plants in their own gardens at home. Or, taking a page from City Room’s Hawk Cam project, they monitor a local family of birds or other species and blog about their observations and provide tips for how local people can help animal and plant life thrive. Students assess risks in their regions like rising sea levels and flooding as well as extreme weather and how public opinion about the connections between climate change and these risks help shape politics. Students can also use the Times Topics pages on global warming and climate change to brush up on the latest news and provide their classmates with regular updates. You might also take a look at Andrew C. Revkin’s Dot Earth blog posts “What’s A Science Teacher to Do?” and “Climate in Classrooms” or the editorial “Pseudoscience and Tennessee’s Classrooms.” Why is climate change – and the teaching of it in school – hotly debated? Where do you stand? What is your school or district’s policy? Use our lesson “How Green Is My School? Conducting an Energy Audit” to determine the school’s use of energy. Next, students read up on green building projects like the energy- and carbon-neutral headquarters of Seattle’s Bullitt Foundation, which is headed up by Denis Hayes, coordinator of the first Earth Day observation, and net-zero energy buildings. They identify some commercial buildings that meet this standard or have achieved other aspects of high performance buildings. They then brainstorm and propose ways to make their homes or schools achieve a net-zero energy balance. Students explore the concept of geoengineering, or developing technological solutions to climate change caused by human activity. Are geoengineering approaches more feasible than those meant to limit the emission of greenhouse gases? Should we pursue some of these methods, like deflecting sunlight away from earth? What are some potential pitfalls to geoengineering? How might simpler solutions, like installing cool roofs, help mitigate atmospheric warming? How environmentally friendly are so-called “green” products? Hold a classroom debate. How is the environment represented in entertainment and culture? What messages do these aspects of popular culture send? What celebrities are associated with environmentalism, and what impact does their activism have? Students choose a specific film, television show, magazine feature or other aspect of culture that features nature or the environment to assess and analyze for its messages and effectiveness at fostering awareness. Because my family moves around alot it made me think of all the Earth Day celebrations that my schools have done, sometimes we did a green up day and others we had a picnic outside in a local deer park. My mom told me a little about Earth day when she was younger. It was really interesting to learn. However a long ago it was… I vividly remember each student getting a packet of lima bean seeds. It was our MISSION to successfully grow the plant throughout the rest of the year. This was when I visually learned about how plants literally learn towards sunlight.
2019-04-19T21:22:08
https://learning.blogs.nytimes.com/2012/04/18/earth-day-and-all-days-10-ways-to-learn-about-the-environment/
Please purchase a gift certificate for the bridal couple using the secured Paypal link below. Thank you in advance for truly making it the honeymoon of their dreams! Please note in comment section the couples name, wedding date, and message. Please email sandra@springchicken.com to confirm receipt. If you have a Paypal account you can also send money through the personal tab for friends and family to David@springchicken.com Please note couples name and message. Do you love a great love story? Andrea and Evan have only just begun but have a wonderful start to lifelong love story. You can add to their fairytale romance, by giving a romantic honeymoon gift . This will go toward a candle light dinner for 2 on the beach, a relaxing couples massage in a beautiful garden spa, bottle of fine Champagne  , an adventurous excursion around the island , or any number of extras they can add to their honeymoon. Sharing their love and life together! See their Love story and details. Christina and Rigo's Wedding Page! Tony and Merritt met in high school through a mutual friend and began dating senior year. As it came time for college, they decided to give long distance a try as Merritt would go to swim for Penn State and Tony would be a cadet at Texas A&M. After four years, and many visits back and forth, Tony proposed to Merritt while visiting her in Happy Valley in June 2012. She said yes! The couple is very excited to begin their journey together soon after they both graduate in May. They will be getting married in Houston on May 18, 2013 and taking a honeymoon to the beautiful St. Maarten! They will then reside in College Station until Tony begins training as a Second Lieutenant in the US Army in Ft. Benning, Georgia in fall 2013. Jeffrey and Shayla met the summer of 2009 at Milam County Cowboy Church! Jeffrey proposed December 23, 2012 and their wedding date is June 29, 2013. Your presence at the wedding is a great gift to us already but instead of wedding gifts we are asking you to donate towards our honeymoon to the beautiful Bahamas! The deadline for the trip to be paid is May 16!! This would be very much appreciated! Hope to see everyone very soon!! Lesley and Brent will be sharing the beginning of their lives together on June 26th 2010 before their family and friends at the Riu Palace Riviera Maya. Please join them at this memorable event. Travel begins June 23, 2010 and returns June 28, 2010. We are so excited about the big day, While your attendance is gift enough, if you so choose, we are registered for honeymoon gift certificates. A gift of cash towards our honeymoon would really make our day. Never any Booking Fees PM us for more info. Book Now online: http://springchicken.com/reservationf... Or email: Sandra@springchicken.com Visit our Web Site: http://springchicken.com While visiting Vienna with Viking River Cruises, enjoy a leisurely stop at one of the city's famed coffeehouses.
2019-04-18T13:26:04
http://springchicken.com/weddingshoneymoons.html
Have you checked your bank account or received a notification that a withdrawal has been made from Nylah Skin With Benefits Box? Often customers of Nylah Skin With Benefits Box have no knowledge that they have been signed up for a subscription that automatically renews and takes money from your credit card. So what do you do now to get your money back? Often customers find that it can be extremely difficult having their money returned to their accounts once Nylah Skin With Benefits Box has taken them. In many cases, we typically manage to get customers their money back from Nylah Skin With Benefits Box within 3-4 days. We know the process and have dealt with Nylah Skin With Benefits Box before. If you want we can help get your money back for a fee of 5 EUR. You only pay once we actually manage to get your money back you have been charged from Nylah Skin With Benefits Box back into your account. That’s no cure, no pay!
2019-04-21T12:12:05
http://refund-helper.com/guide-get-a-refund-from-nylah-skin-with-benefits-box/
User-generated DJ mixes and remixes of songs are about to start appearing on TIDAL following a new deal with Dubset Media Holdings. Dubset’s MixBANK platform is said to determine all of the appropriate rights-holders within a DJ mix – even across myriad samples in a single track – while simultaneously clearing rights across relevant label and publishing parties. Last year, Dubset raised $4m in funding, while inking global deals to license the masters of Sony Music and independent labels (via Merlin) on major music services. Dubset has previously inked agreements with Spotify and Apple Music to distribute remix material on their platforms. Speaking about the TIDAL deal, Dubset CEO Stephen White said: “This is another important step in making the incredible content created by our DJ community available to fans all over the world. Lior Tibon of TIDAL said: “Sampling and mixtapes has long been a foundational part of the music ecosystem.
2019-04-26T12:00:38
https://www.musicbusinessworldwide.com/dubset-inks-deal-tidal-distribute-remixes-streaming-platform/
Flat roof specialist Byford Roofing tackled the job knowing the installation was complex and demanding, but also that the schedule was tight. Byford chose BMI Icopal’s Parabit Holt Melt Duo, which was applied to the concrete deck of the roof. Over that went a layer of inverted insulation and paving slabs, ready to receive the MUGA pitch finish. Andrew Byford, Director at Byford Roofing, commented: “I chose Parabit because it’s a system we know well – we are comfortable laying it and therefore it gave us confidence in achieving the target programme completion date. Not only is it suitable for a zero falls roof, it is also very robust. “Because of the limited storage space on site, we needed to get the hot melt laid as fast as we could so that we could use the roof area for storage of the other roofing materials. From an installation perspective, the most challenging aspect for Byford Roofing was guaranteeing it provided a completely flat surface for the application of the sports surfacing, meaning accuracy was ensured in installing the insulation layer and the paving slab ballast. To ensure the contractor met that requirement, Byford chose a paving support system that offered minimal build up with the most support. Andrew added: “After that it was all about making precise cuts, taking time to get it right and achieve that level finish. Most of the 800 square metre roof area was applied in an initial period of two-to-three weeks. Beyond that, Byford made return visits to the site to work with the sequencing of other works by the main contractor. One of the later tasks was waterproofing with BMI Icopal Elastoflex around the fence posts that had been installed into the waterproofed parapet wall, around the roof’s perimeter. Byford was pleased with the result, especially given the contract’s demanding nature, as Andrew concluded: “I was happy with the spec we put forward.
2019-04-23T02:57:37
https://www.buildingtalk.com/bmi-icopal-hot-melt-provides-great-result-for-sports-area/
We have hundreds of commercial, governmental and privately published material in many subject areas in the form of books, reports, periodicals, videos and sound recordings.The majority of the material is housed in a glass case in the Reference area of the library.Many are from World War II but the book also includes veterans from Korea, Afghanistan and World War I.Access to the veterans and their families was easier this time around, Snyder said, than it was for Volume I which included only 42 stories."It was nice gaining the confidence and trust of these veterans," said Snyder, who was a reservist with the navy and army for 40 years and a commander with sea cadets in the 1970s and army cadets in the mid-1990s."Veterans often talk to their peers and not their juniors.The Local History Collection consists of materials covering the Okanagan Valley from Osoyoos to Vernon.Visitors to the library have access to print and microfilm materials covering this topic.David Snyder's latest labour of love has been eight years in the making. Our membership with the Chamber facilitates face-to-face opportunities with many of our current and future partners within Penticton. It allows us to connect with businesses large and small, putting faces to names, and in turn forging stronger relationships within the community. Meet in a public area and don't tell them where you live. The effects of GM’s downsizing and recent buyout programs on the area economy and demographics are still unfolding, but recent unemployment is high and home sales are very slow. Be Naughty is an online dating site for singles people.
2019-04-25T12:21:33
http://afcraf.metod-portal.ru/profile?id=1661
I was born on April Fool’s Day. Which is quite the extraordinary day to enter this outrageously cruel and daringly beautiful world. When people aren’t asking you if your pure existence is just one epic joke, they are playing a trick on you. On my 6th birthday, someone brought a cake to my party. Which, at the time, I thought was the nicest thing you could bring a fool like myself. Except the cake had one trick candle on it. So after I made my wish, I blew and I blew and I blew the fire on top of the stubby little candles out until my face turned bright red and I started to cry. People started to laugh and shout, “April Fools! April Fools!”. As if at the age of 6, they were all part of this secret society. As if, they set up a private Facebook group that was called “How to play a trick on Jen the fool” or started a group text asking each other who would be the one to get the cake and who would be the one to bring the trick candle from the gag store across the street. I felt so alone in that moment. I wanted to find a way to disappear into the vanilla sheet cake from Publix that was slowly starting to sink around the areas where the trick candle was shimmering. I picked up the flaming candle, dunked it into a glass of ice water, and asked my parent’s If we could move to Timbuktu or Mars – as I’m sure they have a wonderful school system there. So this year, I had a plan. It would finally be my turn to fool all of you. On my birthday, I’d turn 26 all over again. I bet if I walked around for another 365 days and said “I’m 26!” when someone asked my my age, they wouldn’t question me or sit me down at a wobbly wood table underneath a fluorescent light and interrogate me about it. They’d accept it and even better than that, I’d start to believe it. I planned to do this not because year 26 was a total and complete disaster and I wanted to make up for it. I planned to do this for the simple and daunting fact that I do not want to get older. I guess when you’re 6, you want to be 7 so you can grow a little more and finally fit into clothes at the Limited Too. When you’re 15, you cross the days off the calendar and count down until you turn 16 and get to take your place behind the wheel. Of course, when you’re 20, you’re begging for the day to come when you can proudly show a bouncer your ID and have them not draw a humongous X across your hand in permanent marker. But after you turn 22 and 23 and 24 and 25 and 26, you suddenly want to count backward. Our age, I thought, never matched up perfectly with where we were in our lives. It was always a little bit off. What happens is, you hit a certain age and you realize this whole thing is not practice for something else. This is all we’ve got. And every single day and every single decision and every single conversation we have with a person is, in the end, all we have. That’s a lot of freaking pressure. Sometimes I find myself having a staring contest with my marshmallow colored pillow case at 3am, wondering If I should have said “I’m sorry” instead of “I never want to speak to you again.” Or If I should have accepted that job instead of selling all my belongings and packing a duffle bag of my precious books and the dollars in my savings account and roaming around this world like I’m trying to find something more long lasting than what’s inside a 10×10 cubicle. Sometimes I wonder if i’m doing it right. If I even know what right is. Should I be married by now? Should I breast feeding kid #1 and planning for kid #2? Should I have a savings account and a Roth IRA and a 401K that has more than 3 digits in it? Am I wasting too much time chasing a career and a lifestyle that’s as reliable as the 6 train on a Saturday afternoon? Last week, I found myself across from a friend celebrating her birthday with a plate of scrambled eggs and an overflowing glass of champagne and orange juice. She just turned 23 and I desperately wished I could close my eyes and go back to that age. At 23, I was living in LA. I didn’t have a resume or a full-time job or a stable place to live. But yet, Inside of the messy pile of nothing I had, I somehow had everything. I always wish I started earlier, did more, went on facebook less. Loved harder. Stopped caring about what people thought when I spoke out loud. Blurted out the stubborn words “Okay, I’m so so wrong. I can feel it. I can see it.” Instead of hanging up the phone. “Why are you going to do that?” My friend said to me when I told her my game plan of lying about my age. “Because, it’s a lot of pressure to grow up and turn another year older when you’re in your 20’s,” I said. Pressure to get married and settle down. To be someone who is so tangled up in their career that their job title gets a gold star on their LinkedIn profile. She glared at me, as If I was telling her stuff she was just a handful of years away from understanding yet at the same time, she understood it all. We finished our meal and wrapped our bodies up in oversized coats. She hugged me goodbye and asked that I reconsider this whole age thing. She asked to see me next week when all that would be different was the number assigned to my body. The official marking of how many days I’ve been on this planet. And if you think about that way, if you think about birthdays as just an overall count of how many days you’ve made it here, so far, it changes everything. To cling on to love and to look love in the eyes and say goodbye. To eat slices of pizza and to get fired from jobs. To move across the country and then move right back home again. To watch people and places and things dissolve into nothing but tiny memories that are sparked by other, newer, people and places and things. 27 years. That’s 9,855 days. That’s just the amount of time i’ve had so far to figure this whole thing out.
2019-04-23T23:02:14
http://thethingsilearnedfrom.com/lying-about-your-age/
Darcy Brisbin is a Senior Administrative Assistant in CBRE’s Brokerage Services department. She joined CBRE in March of 2013 and specializes in assisting Lew Horne with calendars and contact databases, scheduling meetings and appointments, performing administrative duties including research, editing, mass mailings, and other duties as necessary. Prior to joining CBRE, Darcy was a Transportation Coordinator at a logistics company in New York City. She received her degrees in International Politics and Literature from the University of California, Santa Barbara. Darcy is a valuable asset to the team, contributing expertise in Microsoft Suite, database management, complex contacts management, expense reporting, budget analysis, report creation, modification, and presentation, mobile platform technology, and Workplace analysis. Along with her valuable technical skill set, she is also hospitable, a create problem-solver, is able to comprehend the “bigger picture” of a project, and pays special attention to the intricacies of a given request.
2019-04-19T22:25:23
https://uat-www.cbre.com/people-and-offices/darcy-brisbin
Geeky Holiday Gift Guide, Black Friday, & Cyber Monday Sales 2017! Nerdy News: Star Wars Title Revealed, Terminator Reboot, Geek Politics & More! Geeky Holiday Gift Guide, Black Friday, & Cyber Monday Sales 2016!
2019-04-25T02:39:59
http://thenerdybird.com/tag/funko/
At the end of 2015, we published this blog post. Since some of these shows have already passed, we decided to update the list for the remainder of 2016. Here are a few more medical device and healthcare trade shows that you may want to consider exhibiting at this year. If you see a medical device or healthcare trade show that is coming up soon (90 days or less), make sure to read our guide on how to successfully plan and design for a trade show exhibit in 90 days. If you're a first time exhibitor, take advantage of our free trade show needs assessment. MD&M East has a great track record of connecting medical technology buyers and suppliers at the trade show. Exhibiting at MD&M East gives your company the opportunity to feature your products, provide service demonstrations, networking opportunities, and educate your target audience. Here are some quick facts for exhibitors interested in the show: There are over 46,000 buy & supplier meetings over 3 days, the average lead count per exhibitor is 60, and an 11:1 attendee to exhibitor ratio. FIME is the largest medical trade show exhibition in the Western Hemisphere, serving the entirety of the North, Central, and South American regions. The FIME show focuses on four specific medical industry sectors: technology, products & supplies, services, and equipment. The FIME show is ideal for exhibitors that want to strengthen their brand awareness in the industry, launch new products into the market, generate sales leads, keep up on industry trends, recruit new distribution, and so much more. According to the show website, over half the attendees are also in a management position or higher, which makes the show very desirable for marketing and sales teams. North American Spine Society (NASS) expo is the largest spine meeting and exhibition in the world. The NASS show allows exhibitors to connect with an extensive group of high-level, influential decision-makers attending the meeting. If your company wants the opportunity to share the last information, innovative techniques and best practices with renowned spine care professionals from around the globe, NASS is the ideal show for you. Here are some quick facts about the show: Almost 60% of attendees plan to make a purchase based on what they see at NASS, 83% of attendees spend over 2 hours in the technical exhibition, and 73% of attendees influence purchasing decisions. Since the NASS show is a global event, it truly allows exhibitors to tap into new international markets. Medtrade is considered the largest US expo and conference for the home medical equipment (HME) and durable medical equipment (DME) industry. Medtrade is the show to exhibit if your company falls into the home or durable medical equipment category. Thousands of attendees will be at the show to buy the products and services that are ideal for your customers. For over 35 years, attendees have come to the show in order to see the latest products and technology in the medical equipment space. Here are some quick facts about the show: 76% of attendees consider Medtrade events as "Must Attend", over 84% of the attendees have a role in the purchasing process, and over 33% of the attendees have an annual purchasing volume of $1 Million and up. RSNA is considered the world's premier radiology forum and event that brings in over 55,000 attendees annually to McCormik Place convention center. Here are a few quick facts about RSNA: 75% of attendees have a role in purchasing products seen at RSNA. 79% of attendees come to RSNA to see new products and developments, 98% of the exhibitors recommend the RSNA meeting to non-competing companies, and each attendee spends an average of 12.1 hours in the exhibit halls. With a new year about to start, most businesses are mapping out their calendars and budgeting for the trade shows they will be exhibiting at 2016. In an attempt to hone in on the “must-exhibit” shows, clients often ask us which are our favorites. To answer that question, you really need to take a closer look at each specific industry. With almost 25 years of experience under our belts at ExpoMarketing – and having designed and built more than 3,000 trade show booths, you’d be right to assume we’ve seen a lot of shows. Hundreds, in fact. So narrowing down a short list of favorites isn’t easy. For this particular entry, we’ll focus on the crowded field of medical device and healthcare industry events. Arranged chronologically below is a list of some of the top medical device trade shows and health industry trade shows – along with our insights on each – so you can decide which shows your company should attend in 2016. MD&M is one of the “big daddies” in the medical device show space with literally thousands of suppliers showcasing their latest and greatest technologies. But it’s not just the size that makes this show a “must do.” The great draw here is the consistent focus on innovation. In fact, the goal of MD&M is to inspire, educate and motivate health care professionals and industry engineers by throwing a spotlight on groundbreaking innovations that will make their work easier and more effective. That’s why the show has evolved into one of the busiest networking hubs for the industry. The emphasis on innovation and education also allows for great opportunities for interesting demo stations and custom trade show booths that are themselves innovative. Medtrade Spring is the second largest tradeshow in the U.S. focused exclusively on the home medical equipment market (its late-year counterpart Medtrade, taking place in Atlanta on October 31, is the largest). We really like Medtrade Spring because it brings the big show approach to a much-overlooked sector of the industry. The show is specifically designed to give today's health providers the highest quality educational, networking and advocacy opportunities and the largest selection of HME products in one place. Exhibitors love the enthusiastic crowd who are genuinely looking for the latest tools of the trade. “The EB Show,” as it has come to be known, is exciting because each year it unveils a collection of cutting edge, potentially game-changing biological science. The scientific “wow factor” has led the show to become a genuine international affair, drawing the top life science researchers and health professionals from around the world. EB has consistently represented over 65 countries in the fields of anatomy, physiology, biochemistry, molecular biology, pathology, nutrition, and pharmacology, among others. For exhibitors, it’s a chance to introduce your company’s innovations to nearly 10,000 domestic and international decision makers from numerous scientific and medical disciplines all under one roof. Plus, one of EB’s biggest annual draws, its incredible collection of 8,000 scientific posters, is displayed right in the exhibit hall, guaranteeing that the booths receive maximum traffic. More than 7,300 primary care physicians will descend upon the Anaheim Convention Center this year for Pri-Med West – the largest of the five regional Pri-Med shows. These motivated attendees are mostly doctors who are looking to gather information and learn about new products they have been too busy to investigate during office hours. The exhibit hall is heavily promoted, with three lengthy gaps between session programs during each day of the conference. Pri-Med organizers are happy to share that 90% of the event attendees spend time in the exhibit hall. So much more than a medical specialty show, the AUA’s annual events have become somewhat legendary for featuring one of the largest and liveliest collections of show floor exhibits in the medical world. For more than a century, the AUA has stood at the forefront in developing innovative, evidence-based quality education for urologists and urologic health care professionals worldwide. The AUA Annual Meeting is the largest gathering of urologists in the world, and is truly a must for businesses who have products or services designed for urologists, oncologists, technicians, PAs and nurses – all of whom will be attending in very large numbers (more than 18,000 are expected this year). Truly not like any other medical trade show, The Aesthetic Show feels like a Hollywood event – complete with a glitzy, high quality awards show that starts with a walk down a red carpet that runs right through the show floor. Keynote presentations by the leading innovators in plastic surgery, dermatology and other specialties pertaining to the aesthetics of the human form also take place in the middle of the show floor as well – drawing a huge crowd to the booths. Another specialty event that has really come on strong the last couple years, the Vision Expo is one of those shows that has taken its exhibit hall game up a few notches, largely thanks to the broad assortment of creative and interesting trade show booths. Plus, more optical professionals make their buying decisions at International Vision Expo than any other annual industry event in North America. The 2016 event will offer buyers a genuinely comprehensive view of the entire optical industry with over 500 exhibitors, specialty product pavilions and educational programs. Rounding out our chronological list of our favorite health industry trade shows is an event that isn’t technically a medical show at all. A remarkably diverse yet efficient show, the PACK Expo now shares the bill with the Pharma Expo, so exhibitors get a two-for-one experience. In 2016, PACK Expo International will be the world’s largest processing and packaging event. Along with Pharma Expo, PACK will bring together 50,000 attendees, 7000 international buyers from 130+ countries and more than 2,300 exhibiting companies. The show floor, spanning an incredible 1.2 million square feet, each year buzzes with machinery in action, interactive learning hubs and networking lounges. The show provides a networking bonanza on the show floor and an assortment of booths that push the boundaries of creativity. If you're thinking about exhibiting at the PACK Expo & Pharma Expo for the first time, be sure to read our blog post on 4 things to know before your first pharma tech trade show. Bookmark this page for more of our favorite shows from different industries!
2019-04-22T00:56:34
https://www.expomarketing.com/blog/top-7-medical-device-and-healthcare-trade-shows-for-2016/
Learn how to create and apply security policies, which can include encryption, permission settings, and more. In Adobe Acrobat 8, it's simple to apply one of the two preconfigured security policies, to create a new one with customized terms or to access and apply one from a policy server. Security policies include encryption, permission settings, and information about who can open the PDFs or change security settings. You can create three types of security policies: password security (to password-protect documents), certificate security (to encrypt documents for a list of recipients) and Adobe LiveCycle Policy Server policies. Creating policies for password and certificate security lets you reuse the same security settings for a set of PDFs without having to change security settings for each. The policies for password and certificate security are stored on the local computer. Click the Secure button in the Tasks toolbar and choose Manage Security Policies > Refresh Security Policies to ensure that you have access to the most up-to-date server policies. Then, click the Secure button in the Tasks toolbar and choose a policy. Click OK to any warnings about changing the security for the document. In the Secure menu, you can identify organizational policies by the Enterprise Policy icon, and user policies by the Personal Policy icon. Choose Advanced > Security > Manage Security Policies. Select a policy, and then click Apply To Document. Click Secure on the toolbar and choose Manage Security Policies. Click New, and select the type of security you want. Click Next, and follow the on-screen instructions to set up the policy and choose the desired security settings. Choose Advanced > Security > Manage Security Policies. * If you want to specify passwords and restrictions whenever you apply this policy to a document, deselect Save Passwords With The Policy. * If you want to save passwords and restriction settings with the policy, select Save Passwords With The Policy. Specify a compatibility setting and password options. If you selected Save Passwords With The Policy, specify the password and restrictions. Click Next. Review the policy details, and then click Finish. If you want to specify recipients whenever you apply this policy to a document, select Ask For Recipients When Applying This Policy, and click Next. If Ask For Recipients When Applying This Policy is not selected, specify recipients by selecting the digital IDs you want to use to encrypt the document (including your own digital ID), and click Next. When you create a user policy using the Adobe LiveCycle Policy Server, you're redirected to the Adobe LiveCycle Policy Server web page. Select Use The Adobe LiveCycle Policy Server, and click Next. On the Adobe LiveCycle Policy Server web page, click Policies, and then click New. When you're done, click Save at the top of the page. The original file, which isn't protected and which has its original filename. The protected file, which automatically includes "(secured)" in the filename. The security envelope, which automatically includes "Envelope" in the filename. For example, [original file name]Envelope.pdf.
2019-04-20T05:49:48
https://acrobatusers.com/tutorials/apply-a-security-policy-to-a-pdf-with-acrobat-8
A timepiece of shining simplicity, the Gitte Steel Mesh Watch — the name Gitte means “radiant” in Danish—has a crystal framed by the briefest bezel. Set into the slightly oversized 38-mm stainless steel case is a minimalist dial with raised gleaming silver dots marking the hours and two-hand movement. The generous format repeats in the band, a 14-mm-wide steel-mesh bracelet with adjustable clasp closure.
2019-04-25T04:30:13
https://georgemossjewellers.com/product/skagen-ladies-gitte-steel-mesh-watch/
This site offers online access to your statements through this link. In addition, you can retrieve tax documents, manage your hard copy mail and see basic account information. Should you require our white glove set-up service, please call any member of our service team to help you through the process. We always have live support at your convenience for any of our online tools. This site offers our clients greater flexibility in reporting as well as the ability to link holdings across various platforms (accounts like 529 plans, annuities, etc.) This site, we believe, is more user friendly for looking at account balances. Please call any member of our service team to help walk you through the online set up.
2019-04-21T16:27:34
http://www.rpbwealth.com/Access-Your-Accounts.8.htm
Get Relief Pharma is a company created by pharmacists to empower pharmacists, customers, and our partners to work together for a better pharmacy services. Starting a New era to pharmacy field by supporting pharmacy staff and providing first class services and resources. Adapting the technology to serve the pharmacy community through job availability with full rates, also giving helping hand to pharmacy staff by providing them with most updated information, most useful links, and frequently used forms in one place. Easy, free and fast procedures to get the relief required-- just register, post your jobs and select from applied candidates. Ready pool of qualified pharmacists and pharmacy technicians. A 24/7 automated job board for pharmacists: full-time, part-time, relief jobs. Fully automated marketplace -- you choose your preferred location, hours, terms, etc. Useful links from daily visited websites by pharmacy staff. Commute and weather updates to support just-in-time, last-minute relief opportunities.
2019-04-20T05:00:40
http://getreliefpharma.ca/About.aspx
Some of the best Shoalhaven Bushwalks. The Shoalhaven region has some excellent bushwalks to choose from. The table below contains some of Shoalhavens best hikes. Map of Illawarra and Shoalhaven Bushwalks. The map below contains some of the best bushwalks in the Illawarra and Shoalhaven region. Where: Stanwell Station or South of Stanwell Village. Distance: 9km or 22km one way. Difficultly: Mermaid Pools medium, Tahmoor Gorge Hard. Shoalhaven bushwalks, trek, Shoalhaven hikes, best Shoalhaven bushwalks, tracks, trails, south coast bush walks.
2019-04-21T00:39:00
http://trailmaze.com/bush-walks/nsw-bushwalks/shoalhaven/
As a member of Arizona Grantmakers Forum you join a group of engaged, committed philanthropists working together to improve our community. We offer a variety of services to meet the needs of our members. Members receive monthly e-newsletters with highlights of current national and local philanthropy news, plus relevant resources for the work you do. AGF regularly partners with experts and local thought leaders to produce white papers, reports and other publications. The AGF website also houses a library of grantmaking resources for your review. Our member directory includes current, searchable contact information for over 85 Arizona grantmakers. This is a member benefit available to Arizona Grantmakers Forum members, to help them connect to other grantmakers and colleagues. Please log-in here to access it. Member discounts apply to the Stanford Social Innovation Review and The Foundation Review. For more information about these discounts please contact support@azgrantmakers.org. Members can post job openings for free to the Arizona Grantmakers Forum Jobs Web page. To submit an opening, please send the job description and closing date to support@azgrantmakers.org. AGF members are subscribed to our listserv – a group email list that enables members to communicate directly with the whole AGF membership. You can tap the collective knowledge of your grantmaking peers by submitting questions, sharing your grantmaking highlights, or notifying them of an upcoming event. AGF team is available to answer technical questions, direct you to resources and connect you with peers. Send your questions to support@azgrantmakers.org. AGF has access to the Foundation Center’s online directory of foundations and can provide members with information on national and local foundations funding in specific interest areas throughout Arizona. This information can be especially helpful when looking for partners to provide advice, matching dollars, etc. AGF extends a discount for an easy-to-use conferencing solution to our members. ReadyTalk offers its subscribers the following services: teleconferences, virtual meetings, and webinar functionality. Contact support@azgrantmakers.org to learn more. With the increased governmental scrutiny on the philanthropic and nonprofit sectors, many experts strongly recommend that foundations carry Directors & Officers Insurance to protect both trustees and the foundation. AGF offers a discounted Directors’ and Officer’s Liability Insurance coverage program to our members through a partnership with the Council on Foundations. For detailed information about this policy, click here. AGF is pleased to bring you a new discount offer on grantmaking software. Through special arrangements with Bromelkamp Company, we now offer our members 5% discounts on Akoya.net and Pearl grants management software for private/family, public/community or corporate foundations. These fully-integrated solutions allow you to manage contacts tracking/CRM, grants and scholarships, as well as fundraising and fund accounting (optional) in a single system. Designed in Microsoft Access and Microsoft Dynamics, Bromelkamp Company products are user-modifiable and customized to meet your foundation’s needs. Quovo provides endowments, foundations, and advisors with an elegant web dashboard that aggregates their investment accounts – across custodians, portfolios, and managers – and generates a suite of tracking and interactive analysis modules on top of the data. Learn more.
2019-04-21T14:21:20
http://arizonagrantmakersforum.org/join-us/member-benefits/
the class name is 'qc.engine.playerScript' but not 'playerScript'. I know how occurs but i don't know how to fix it. in publish the prefab throws an error. i had to place the prefab to the game heirarchy and unmake it prefab. The error dissapear, but it throws it again with other sprite with a script attached. Can you send the project to me? It's strange case, normally the preview works then publish should works with no different. Can you send your project with error reappearable to my colleague's mail weism@qcplay.com, so we can help you to check this issue. I was going to publish the soolution you gave me but i was too slow haha. exactly i was missing qc.engine. before the script name.
2019-04-21T16:13:53
http://ask.qiciengine.com/?/question/10
General Purpose buckets incorporate wedge floor design and are built with a shell tine construction to increase strength and rigidity. Designed for the Fusion Coupler system. Includes Bolt-On Cutting Edge.
2019-04-19T08:49:25
https://www.stowerscat.com/products/cat-machines-work-tools-and-attachments/non-current-cat-work-tools-and-attachments/buckets-loader/31m-4yd-18240384/
Handfinished openwork straw texture elephant Lamp. The trunk up posture is interpreted as the elephant spraying water. This movement is very active and relaxed while fun showing happiness. The trunk down posture is interpreted as the trunk absorbing the fortune of the earth i.e. gold and nutrients. This is the reason trunk down posture is believed to bring good fortune contrary to Western belief.
2019-04-21T22:31:03
http://www.sumngaibrass.com/lighting-accentlamps/24
MSyslog is a logging subsystem for UNIX operating systems. It replaces the traditional UNIX logging daemon, syslogd, with an improved version that provides capabilities for log centralization, preservation of log integrity, and storage on a myriad of popular database engines. MSyslog, which stands for Modular Syslog, has a very flexible architecture that allows the administrator to configure it to receive log data from several input sources such as TCP and UDP network connections, UNIX named pipes and plaintext files. Log data storage is available through multiple output options including plain text files, MySQL and PostgreSQL database engines. Log relaying can be performed over TCP sessions or the traditional UDP-based syslog protocol. MSyslog also supports filters that perform cryptographic integrity checks and filtering by regular expressions. MSyslog runs on a variety of UNIX and Linux operating systems. Quick start: Click the following link to obtain the latest stable release. Requirements: An implementation of the BSD syslog API (native to all modern UNIX operating systems). This software is provided under the BSD license. Whether you want to report a bug, send a patch or give some suggestions on this package, drop us a few lines at oss@coresecurity.com.
2019-04-18T10:25:54
https://www.coresecurity.com/corelabs-research/open-source-tools/msyslog
I think in my case , better late than never…. As part of my programme to change my lifestyle around, I needed to know how much money my family required to live? Seems a simple question. But one that I could not answer .Now I am not alone in this. Recent polls suggest that only 30% of North Americans actually have a budget. That means the vast majority of people have no idea what they spend their money on and my household definitely fell into this category. Now in order to change, you first have to establish where you are? I”m not a financial expert in any way and my aim here is not to become a financial expert.I am finding out what works for me and maybe it would work for you. Result? “We need more money!!”……So the cycle continued. How to break this cycle? I decided to basically record all of our spending habits over a three-month period. I felt this was a good period of time. Long enough to give me a reasonable level of understanding as to where the moola went? 1/ Food – simple enough . All groceries but not including take-out or restaurant meals. 2/ Household – Mortgage or Rent and all utility bills. 3/ Insurance- House/ Motor and personal. 4/ Motoring expenses. – Gas , repairs etc. 9/ Other – everything else, just write what it was when entering the amount . Now your budget may look different to this. For example, if you did”t own a vehicle , you are not going to have motoring expenses, however you may have public transport costs or taxi fares instead. Where”s your investments? you may ask. Quite simply at this stage, apart from some Mutual funds for my kids college education, there are no investments! It is very easy to get carried away and make your budget way too detailed and complicated. In my case, if I am going to carry it through, I have to make it simple to use and simple to understand. Otherwise, I would get “fed up” with it very quickly and not bother with it . Again, make it personal to you and/or your family. This is the one that worked for us . The point of this exercise was to clearly identify where our money was being spent and how much we actually spent. I did not want to change anything at this stage, however I did find that after recording our spending in the first few weeks, our spending habits started to change, as the shocking numbers sank in . After the three-month period was finished, the results were amazing. Spending money wisely on “needs” rather than “wants” in order to be able to work less and have more time to do things I love. Its worth while reminding yourself of why you are doing this? Like most things in life, if you don”t have a target or aim that is measurable , in time, you will wonder from your path and not get the results you were looking for. Again, this was my aim. Yours will be different . Maybe you want to save for a particular trip to the sun or a big box item? Instead of following the modern disease of putting everything on credit. It is worth noting, American”s credit and store card debt hit over a trillion dollars in March of 2018, according to figures released by the Federal Reserve. An average of over five thousand dollars per card holder.That”s a lot !!Just saying .Not to judge anyone. I don”t want to be like those reformed smokers who don”t shut up about giving up smoking.( used to have to listen to those “muppets” when I smoked). The important thing here is to be able to recognize your current situation. If you are happy with it the way it is, great! Bully for you and move on . For me, this was not the case and change is required. By recording our expenditure over the three-month period, the first and most important question was answered . 1/Do you earn more than you spend ? This has to be the starting point for everyone. You don”t have to be a genius ( luckily for me) to work out that if you spend more than you earn over a period of time then the likely outcome is going to be…….DEBT! . The debt you incur will then cost you money every month and so your expenditure increases etc etc etc. If you are like me you have no idea how much your debt is costing you each month? ( Bet you can”t give me an explanation for APR? ) Surprisingly, we were on the right side and our earnings were more than our spending, which begged the question….. 2/ Where are you spending your Money? The fact that we earned more than we spent was an encouraging start. However, the answers to where are money went? was, to put it bluntly, bloody scary. Small, regular amounts go un-noticed especially when you pay by debit or credit card, instead of physically handing over the cash. When you see it being spent over a three-month period, then multiply it up to what it is costing you over a whole year, it can be quite shocking. A good example of this. One of my sons is a competitive swimmer. After each early morning practice, we would get him breakfast from an extremely well-known fast food chain. Not expensive right? Well, when I did the calculations from my three months of records , it worked out to be over eighteen hundred dollars a year. For a lot of people that’s one whole pay check per year! Needles to say , my son now takes breakfast from home. He”s not happy about it , but it teaches him a valuable lesson and I”m happy because he is now having a healthy breakfast and we are saving money. Win, win. Finally, the exercise showed which debts cost us the most each month. This automatically gave us the order of which we should reduce our debt . Next stage. Anyone want to buy a TV ?
2019-04-21T09:15:50
https://limeyimmigrant.com/2018/12/08/setting-up-a-budget/
2020 Toyota Sienna Release Date, Redesign, Review – Sienna is grouped as being a household auto, and this new generation will be 2020 with considerable changes, particularly the body. The auto appearance very good with many engines to offer high performance and productive fuel economy. As being a new minivan, this vehicle can be quite a pleasure that you require. Currently, you might not wait around to view his introduction like a new Siena 2019. Even when there is an extreme transform, but right after the automobile arrives onto the marketplace, is fully identified by the conventional look and look is a lot more the latest than before, with a few upgrades both inside and outside. It can be predicted that the automobile can get this new system like a fantastic alter. It appears that the business is going to be impacted with all the comfort and ease to your cabin. Not surprisingly, the new design of Sienna include amplified connection, radio station and Wi-Fi smartphone using Bluetooth or USB 2. 0. One of the good news is how the vehicle may have a fresh the navigation system. As a family vehicle, we perceive the car with many leisure techniques. Apparently, the right spot for this latest version is increased to offer a higher-level of convenience for the family members in the identification of friendly vacations. These assets are to draw in far more buyers on the market and compromise their competitors. As being a household car, it deserves an excellent performance and reliability. The Japanese company is wholly convinced how the auto with the V6 power of 3.5 liters is perfect, that could generate energy over 266 hp and is paired with a computerized 6-rate gearbox. Also additional primary fuel injection. You can even get some assist systems, which include grip, electric powered steering, crisis braking system and steadiness manage. They assume much better Sienna. Sienna for your specific distribution day will not be yet recognized. Hopefully that they will get around the beginning of 2020 like a household automobile will find its budget modifications and offers an excellent fuel economy. The original price for this motor is all about $ 27,000 and, of course, is slightly beyond the current model and also other cars in the class. It is evident that it is well worth this budget.
2019-04-24T14:16:31
https://carswhistle.com/2019-toyota-sienna-release-date-redesign-review/
A Stockton musician is walking from Easingwold to Esquelbecq to lay tributes at the grave of a First World War soldier who was shot for cowardice and desertion, only to be pardoned 90 years later. Stockton-on-Tees is welcoming a new sporting event this summer but you don’t have to be a runner to get involved. Savings galore for customers with two legs and four! SHOPPERS, visitors and their furry friends alike can get their hands (or paws) on a free booklet packed with over £1,000 worth of money off vouchers thanks to Stockton BID. Fairfield Library will reopen to the public on Monday (February 26) after undergoing a refurbishment. New outdoor gym for Roseworth: Come and give it a try! Roseworth residents wishing to get physically active in 2018 can do so easily and free of charge after a new outdoor gym was officially opened by Councillor Jim Beall, the Council’s Cabinet Member for Adult Social Care and Health. British Cycling is delighted to announce that Stockton will host the 2018 HSBC UK National Circuit Championships on 13 July 2018. Young people interested in being an author, illustrator, librarian, book seller or publisher are being invited to a special event in Stockton Central Library. Protecting the areas and people most in need will remain Stockton-on-Tees Borough Council’s focus as it tackles ongoing reductions in Government funding. There's always something happening in Stockton-on-Tees, and 2018 is shaping up to be no different. More international students arrive in Stockton-on-Tees…and they’ve been getting to know their new home! A new intake of students at Durham University’s International Study Centre (ISC) in Stockton-on-Tees have been getting to know their new home. Stockton market is celebrating after being named the best large outdoor market in the country. A long-serving former Stockton-on-Tees councillor has been awarded posthumous Honorary Alderman status. Work to divert underground utilities services in preparation for the construction of a new leisure centre will get under way at All Saints Church of England Academy in Ingleby Barwick on Monday (February 5). Work to protect Leven Bank in Yarm is being brought forward following the recent spell of wintery weather.
2019-04-21T16:35:39
https://www.stockton.gov.uk/news/2018/february/
The security vendor Avast has received a $100m investment from private equity firm Summit Partners, in exchange for a minority stake in the company. Avast chief executive Vince Steckler described the $100m (£64m) deal on Monday as "a vote of confidence in our disruptive 'freemium' business model", which sees the vendor giving its product — including updates — for free to millions of non-corporate users. The company's current model is based around providing its antivirus program, which contains similar features to competitors' paid-for offerings, to home users for free. As with rival antivirus firm AVG, this is done in the hope that those customers will then upgrade to a paid-for premium version. Avast also provides a number of business-tailored products that attract an annual subscription fee in exchange for security features. The firm's freemium model has already netted the security specialist approximately 100 million registered subscribers, according to a statement from the company. "[This approach] is already upsetting the traditional antivirus market," said Steckler. "Instead of paying for advertising or installation on new computers, Avast continues to experience dramatic growth as fans of Avast recommend our products to their friends. Freemium is the wave of the future... We have no plans to change our approach and conform to the classic retail positioning model." As part of Monday's deal, Scott Collins, managing director of Summit Partners, will get a seat on Avast's board of directors. ZDNet UK asked Avast how big Summit Partners' minority stake was, but the company would not divulge this information.
2019-04-21T14:03:46
https://www.zdnet.com/article/freemium-antivirus-firm-avast-gets-funding-boost/
The Unibet Story - Moving up in limits! I proudly present to you guys, my new blog, since it is 2019 and I am planning some changes if it come's to poker. I have been thinking for quite some time now on how to start 2019, and in this first post I will present you guys the plan. If you guys (or girls) have any suggestions or improvements on the plan don't hesitate to post in this thread. Let's start off with how 2018 went. Pokerwise, it went great. I've made a profit of around 4k last year, but I never really worked on building a bankroll. I cashed out many times because I was/am planning on buying a new car, which has become a little bit easier moneywise now. The main theme of the beginning of 2019 will be building a bankroll. I will do this by playing mainly MTT's. Since Unibet also offers monthly missions to earn cash and tournament tickets and you also have to play cashgame's and sit en go's/hexapro's for these missions, I will also include these gametype's in my bankroll scheme. I will be starting with a bankroll of 200 euro's, and per gametype this will be the moving up/down-schedule. At the beginning of each session I will check this chart to see what I can play. I will update the chart after each session. I hope you guys had a fun time reading this first post, will keep you guys updated! Not a great start in the Deep Space, but hey, we got it in good! 16:00 - €5 Deep Space - 10,7k @ 300/600/70. 17:00 - €1 Singularity - 6,4k @ 125/250/30. 17:00 - €5 Shooting Star Bounty - busto, AJo < AQo. 16:00 - €5 Deep Space - busto, K9o < A2s (1 re-entry made). 17:00 - €1 Singularity - busto, 33 < K5s. 18:45 - €1 Falling Star Bounty - 4,8k @ 20/40/5. 18:45 - €1 Falling Star Bounty - 5,3k @ 100/200/25. 19:00 - €2 Singularity - busto, JJ < AQs. 19:45 - €5 Falling Star Bounty - 5,8k @20/40/5. 18:45 - €1 Falling Star Bounty - busto, 22 < AA. 19:45 - €5 Falling Star Bounty - 5,5k @ 100/200/25. 20:00 - €5 Black Hole - 12,4k @ 60/120/15. 20:00 - €1 Zenith - 11,8k @ 150/300/40. 19:45 - €5 Falling Star Bounty - busto, A9o < KK. 20:00 - €5 Black Hole - 12,7k @ 300/600/70 (1 re-entry made). 20:00 - €1 Zenith - busto, A8o < TT. 21:00 - €1 Singularity - 8,3k @ 100/200/30. 21:30 - €2 Galaxy - 6,9k @ 30/60/7 (1 rebuy made). This post has been edited 1 time(s), it was last edited by Angstzweet: 02.01.2019 21:55. 20:00 - €5 Black Hole - KTo < A8o (1 re-entry made). 21:00 - €1 Singularity - busto, 98s < A7o. 21:30 - €2 Galaxy - 20,9k @ 125/250/30 (1 rebuy & 1 add-on made). 22:00 - €2 Singularity - 3,1 @ 125/250/30. 22:30 - €2 Deep Crazy Moon - busto, 44 < AJs. 22:30 - €5 Shooting Star Bounty - 2,3 @ 20/40/5. 20:00 - €5 Black Hole - busto, KTo < A8o (1 re-entry made). 21:30 - €2 Galaxy - 20,4k @ 500/1000/125 (1 rebuy & 1 add-on made). 22:00 - €2 Singularity - busto, JTo < ATo. 22:30 - €5 Shooting Star Bounty - 4,9k @ 150/300/40. 23:00 - €2 Wormhole - busto, KJo < AJo. 23:00 - €1 Singularity - 16,5k @ 125/250/30. 21:30 - €2 Galaxy - busto, AJs < TT, 9th for €7.20 (1 rebuy & 1 add-on made). 22:30 - €5 Shooting Star Bounty - busto, TT < JJ. 23:00 - €1 Singularity - busto, AKs < JJ, 10th for €2.30. That was a rough evening. I was totally card dead, ran into almost everything and besides that I couldn't win my flips. Unfortunately that's also one of the things you need to deal with when you play poker. It can only go up from here (at least I hope ). Off to bed for now, some more games coming in tomorrow! Nice running updates. GL in the future. This post has been edited 2 time(s), it was last edited by Angstzweet: 03.01.2019 17:14. Didn't post a schedule, but I played some tourneys this afternoon. The bad run of yesterday evening keeps going on this afternoon. I get it in really good, but get outflopped, -turned or -rivered everytime. Gonna stop playing for now.
2019-04-24T22:17:51
https://www.pokerstrategy.com/forum/thread.php?threadid=470290&amp;goto=firstnew
Wind direction with time to shoot. UP and DOWN = Adjust Power, LEFT and RIGHT = Adjust Angle, A and D = Move Tank Left and Right, S = Abort Move, W = Fire. Or use your MOUSE to adjust everything. Hi I am from Australia, this time I am watching related article about <a href="**.marshallrobertsltd.co.uk/nfl/nfl.asp">NFL jerseys UK</a> at this, I am in fact happy and learning more from it. Thanks for sharing.
2019-04-18T18:17:40
https://www.goosiam.com/games/viewgame.asp?gid=%E0%B9%80%E0%B8%81%E0%B8%A1%E0%B8%AA%E0%B9%8CArtilleryLive&g=4044
GRAND CLOSEOUT - ONLY 2 NEW HOMES LEFT AT EAGLE POINTE - HUGE PRICE REDUCTIONS taken on these last two low-maintenance, single family, luxury condos in gated, active adult community. Brand new Waterford plan features 1st floor master & is loaded w/options & upgrades. Hardwood on lower level, eat-in kitchen w/GE stainless steel 5 burner gas range/appliance pkg., granite countertops, morning room, high-def home theater pkg., walk-in closets, oversized walk-in master shower, tons of storage, energy efficient E3 third party certified green home has spray foam insulation & Rinnai tankless water heater. The Bay Club at is the heart & hub of all social events. Enjoy resort style amenities including an indoor & outdoor swimming pool & hot tub, large fitness center, billiards room, library, 2 card rooms, ballroom, catering kitchen, locker rooms & more. Come see what all of Chesapeake is talking about. Voted #1 Active Adult Community many times! Call today to schedule your personal tour.
2019-04-23T17:50:52
https://www.austinjamesteam.com/homes/1035-Whitburn-Ter/Chesapeake/VA/23322/89835439/
Whether rail vehicles are made from steel, stainless steel or aluminium, the search for lower cost, robust designs is never ending. For the case of aluminium, complete trains are being assembled from hollow aluminium extrusions and prefabricated panels. Recent investigations into the crashworthiness of aluminium railcars have clearly demonstrated the benefits of using innovative joint designs and optimised procedures for metal inert gas (MIG) and friction stir welding (FSW). The initial cost factor remains a major consideration but, increasingly, ways of reducing through life cost are being adopted. Reducing the anticipated through life maintenance bill is crucial, whether the vehicles are being purchased outright or leased. Manufacturers will always fabricate designs which meet the standards of the times. In recent years more attention has been given to crashworthiness. Modern designs will certainly meet existing crashworthiness requirements and, as understanding of key issues grows, designs will increasingly reflect the next generation of standards. The rail sector, like all other industry sectors, is increasingly turning its attention to dismantling and recycling issues. For example, in vehicles designed from stainless steel, there is great benefit in avoiding a mixture of materials, so as to simplify the end of life dismantling and maximise the value of the scrap. Manufacturers must be alert to the fact that regulations covering the fabrication of rail vehicles across Europe are changing. The process of welding has always required a high level of skill and control to ensure that welds are fit for use. This recognises the fact that it can be difficult or expensive to check all welds once they are made, while at the same time a poor quality weld could have disastrous implications in terms of safety. European standards such as prEN 15085-2 on 'Railway applications - welding of railway vehicles and components' are therefore adopting an approach which is based on two standards already used in the German rail sector, DIN 6700 and DIN 18800. The new approach will require fabricators to demonstrate compliance with EN 719 and EN 729. Together, these standards cover requirements for the welders and the manufacturing facility. Compliance with these standards must be demonstrated by independent third party assessment. These changes are familiar to manufacturers which are already supplying into the German market. All other suppliers to the European market should now engage with an assessor organisation which has the necessary skills and has been accredited to do this work. Approaches to crashworthy design have rightly received considerable attention in recent years, particularly in Europe. The European Commission funded project SAFETRAIN contributed much in this area. The majority of work has focused on crumple zones at the end of railcars to absorb impact energy, and features such as anti-climb devices. The first two recommendations recognise that an inherent feature of all fusion welded joints in solution treated and artificially aged aluminium alloys is the considerable strength reduction in the weld region compared with parent material. Unless adequate consideration is given to this point at the design and build stage, fracture may occur during accidents in the vicinity of the weld, which could compromise the crashworthiness of the welded structure. There are, in principle, many aluminium alloys to choose from, but modern aluminium railcars are made from complex double-skinned extrusions. The need for high strength and excellent extrudability limits choice to those alloys which do soften on welding. This prompted work to explore the extent of softening, depending on the alloy used and manufacturing process adopted. In the EuroStir ® project TWI, Rail Safety and Standards Board (RSSB), Angel Trains and HSBC Rail (UK) conducted tests, to compare FSW and MIG welding. Static tests and dynamic tensile tests were conducted, to compare the properties of these welds. The work quantified the softening effects, confirming that both processes lead to a level of softening which should be taken into account at the design stage. Further insight was developed within the EC project ALJOIN, which studied the crashworthiness of joints in aluminium rail vehicles. Within this project Alcan, Bombardier Transportation, DanStir, NewRail (University of Newcastle) and TWI worked together to develop an understanding of the issues and develop new joint designs and welding procedures, to overcome any inherent joint weakness. This has enabled rolling stock manufacturers to develop new joint designs, suited to the specific fabrication process which will be used. Irrespective of the joining process used, it is important that the rail vehicles have an acceptable level of crashworthiness. The new designs have been subjected to extensive numerical and physical validations. Computer simulations predict that, with the new designs, overload fracture would occur in the parent material rather than along the weld line. The predictions have been verified by extensive full-scale component tests under high-speed impact at Bombardier's test facility in France ( Fig.1). The newly designed FSW and MIG joints meet the stringent requirements for rail vehicle safety. The railway vehicle industry continues to make increasing use of friction stir welding (FSW), a process invented and patented in 1991 at TWI in Cambridge (United Kingdom). The driver for its uptake is its combination of cost effectiveness and good weld performance. Another benefit is that the heat input during the process is low compared with MIG welding, so reducing the level of distortion. This stems from the fact that the process operates below the melting point of the material to be joined. A rotating tool, which consists of a profiled pin and a tool shoulder, is inserted at the joint line between two pieces of aluminium to be joined. The rotating tool moves along the joint and heats the metal, which flows plastically to create a weld. AMAG extrusion GmbH in Ranshofen (Austria) have built and commissioned a gantry type friction stir welding machine. During FSW the extrusions are clamped onto a sophisticated machine table to minimise distortion. So far, AMAG have produced more than 3000m of friction stir welds in structural panels ( Fig.2). They have welded floor panels and longitudinal girders for prototype aluminium trains of several train manufacturers. Bombardier Transportation in Derby (United Kingdom) became a member of the very first TWI Group Sponsored Project on friction stir welding. After a three year process review they introduced friction stir welding onto their Electrostar range of vehicles for the UK market. They fabricate an increasing number of car bodies from friction stir welded aluminium panels, which are joined together using MIG welding. The FSW process is used to prefabricate stiff longitudinal extrusions which constitute the carbody sidewalls. No fewer than 376 friction stir welded vehicles have been ordered by London Underground for the latest Victoria Line upgrade ( Fig.3). FSW is likely to be used on future contracts for over 2000 more new trains in the next decade. Hitachi (Japan) was amongst the first train manufacturers, to recognise the benefits of FSW. They use a double-skinned design for their vehicles which are constructed from hollow aluminium extrusions joined along their length by FSW. Hitachi comment positively on the low distortion and excellent mechanical properties of friction stir welds compared with MIG welds. Hitachi have delivered friction stir welded vehicles for both commuter and express use. They recently won a contract to supply the 29 train sets for the Channel Tunnel Rail Link (CTRL, Fig.4). Kawasaki Heavy Industries (Japan) have recently used friction stir spot welding to attach stringers to roof panels ( Fig.5). They developed a new aluminium car body shell, which is assembled by this method. KHI report a number of benefits for the joining technique, not least the fact that it improves the flatness and visual appearance of the skin panels because of the low heat input. Sapa in Finspong (Sweden) started production of FSW panels more than 10 years ago. They now have a production rate of approximately 1,000m of friction stir welds per day, i.e. a yearly production rate of more than 300,000m. The total length of friction stir welds made by Sapa up to date is probably more than two million metres. In addition to the production of large rolling stock panels ( Fig.6) they also produce smaller components, such as heat sinks for the high-power electronics of electric locomotives. Sapa supply all the major European train manufacturers (Alstom, Bombardier, CAF, Siemens, etc.) with aluminium extrusions and friction stir welded panels for a number of different projects. Steel, stainless steel and aluminium all find favour as materials for rail vehicles. Whatever the material of construction, crashworthiness considerations now play a more important part in design. The standards in Europe relating to fabrication are changing and manufacturers will need to be able to demonstrate that their welders, welding facilities and systems have been approved to the new standards. The use of friction stir welding for the fabrication of aluminium rolling stock continues to grow around the world. In Europe this is aided by specialised supply chain companies which provide sub-assemblies to the rail vehicle builders. The authors wish to thank the companies mentioned for permission to publish photographs and information on their products and manufacturing processes. Stephan Kallee gained his Diploma in Mechanical Engineering at the Technical University of Munich. After completing a course as a European Welding Engineer, he joined TWI in 1995, where he now focuses on land transport. John Davenport gained his first degree and PhD from the University of Cambridge. He worked in industrial R&Dmp;D and manufacturing industry before joining TWI in 2001 as Programme Manager covering rail and other industry sectors.
2019-04-20T08:33:47
https://www.twi-global.com/technical-knowledge/published-papers/trends-in-the-design-and-fabrication-of-rolling-stock-january-2007
Naenae pool+fitness is closed following an engineering report. See the media release on Council's website for more information and updates. We’re located on Everest Avenue in Naenae.
2019-04-19T00:51:55
http://www.huttcity.govt.nz/pools-fitness/naenae/contact/
Includes Industry‐first, All‐in‐one Portable SiriusXM® and ADS‐B Aviation Receiver. Garmin is pleased to announce GDL 52/51, a series of datalink receivers capable of receiving SiriusXM Aviation weather and audio for display and control on select portables and mobile devices and optionally available with an Automatic Dependent Surveillance- Broadcast (ADS-B) traffic and weather receiver. The flagship GDL 52 combines all of these functions into a single device, while GDL 51 specifically provides SiriusXM Aviation weather and audio entertainment. Both variants include a built-in backup battery and provide GPS position data and back-up attitude information to compatible portable devices. Wireless and hardwired compatibility is extended to include G3X TouchTM, aera® 660 and aera 795/796 aviation portables, as well as wireless connectivity with the Garmin PilotTM app, allowing customers access to a full-featured suite of weather products, ADS-B traffic and more using a single receiver. Providing an easy-to-use and completely portable aviation satellite link, the compact GDL 52 combines SiriusXM coverage — accessible from ground or air — with the subscription-free weather and traffic features of an ADS-B “In” datalink. Together, these 2 network link technologies bring a world of safety-enhancing features — plus access to more than 150 channels of digital-quality music, news, sports and other entertainment programming — directly to your cockpit. Better still, you can use our Connext® wireless connectivity to stream this information onto multiple Garmin aviation portables (including aera®660, aera 796 or aera 795 series) as well as iPad® tablets and mobile devices with the Garmin Pilot™ app. So you get more access — on more devices — without spending more money. Continuous SiriusXM satellite updates — accessible by ground and air — can help you make better, more timely flight decisions. The SiriusXM network’s powerful satellites deliver seamless coverage across the continental U.S. and its coastal regions as well as southern Canada. Choose from available SiriusXM Aviation weather packages that provide METAR data and animated NEXRAD imagery plus current reports on precipitation, lightning, winds aloft, echo tops, turbulence, freezing levels, TFRs. Alternatively, the GDL 52 portable receiver also provides subscription-free access in the U.S. to ADS-B Flight Information Service-Broadcast (FIS-B) weather information. With this, your compatible devices can display animated graphical weather plus METARs, TAFs, winds and temperatures aloft, PIREPs, NOTAMs and other features linked from ADS-B. And to help you maintain the most current weather picture, your GDL 52 receiver can queue the weather from ADS-B and/or SiriusXM while your display device is sleeping or turned off so it automatically updates when you turn the screen back on. By simply connecting a compatible Bluetooth®headset or audio panel to GDL 52, you can wirelessly listen to your choice of high-quality audio entertainment channels provided by SiriusXM. Volume adjustments and station selection may be accessed through your compatible Garmin aviation portable or mobile device app. If you prefer, a 3.5 mm stereo audio jack positioned on the side of your GDL 52 makes it easy to provide a hardwired audio out connection to an auxiliary device or audio panel in your aircraft. To further extend your traffic monitoring capability (on compatible displays), the GDL 52 receiver also allows access to our Target Trend relative motion tracking technology. This feature gives you a faster, more intuitive way to judge the direction and closure rate of intruding targets relative to your aircraft’s position. So, rather than a fixed “snapshot” of the traffic situation, Target Trend provides a more dynamic “velocity-based” display that shows which aircraft trajectories are most likely to converge with your own. For example, if traffic is ahead of you and traveling along the same track but at a slower rate, the motion vector would point opposite of its indicated direction of flight to show you are overtaking the traffic. The result — you’re able to make faster, better target avoidance decisions. For pilots who want the best in U.S. data link weather coverage plus an impressive array of traffic, navigation and audio entertainment options, the GDL 52 portable receiver is the ideal 1-box, dual-network solution. With its versatile connections and compact size, you can even enjoy benefits of SiriusXM audio outside the cockpit — anywhere you want to drive, pedal or walk within the SiriusXM coverage area. And by going with Garmin, your receiver will be backed by a comprehensive 1-year warranty — and by the industry’s No. 1-ranked product support team.
2019-04-25T14:28:39
http://skyeavionics.com/product/gdl-52-gdl-51/
Red Fox Outfitters has partnered with Yellow Dog Travel for destination fly fishing trips. Yellow Dog has over 185 fly fishing destinations in over 25 countries. When you book through Yellow Dog, there are no additional costs and you will never pay more than if you were to book directly with a lodge. Yellow Dog will also provide you with tons of pre-trip planning material so you will arrive prepared and ready to go! If your not sure where you want to go, Yellow Dog can match you with a trip specific to your needs based on location, price point, and lodge options! Interested in traveling for some fishing? The Red Fox and the Yellow Dog team can help you out with your travel and fishing needs! We can put you in touch with the appropriate program director at Yellow Dog and get your trip plans rolling! - Be sure to mention Red Fox sent you!
2019-04-19T01:15:44
https://www.redfoxoutfitters.com/fly-fishing-travel/
tattoo *Bolson / Tattoo Cronopios Collection * Nadja @ACCESS Event!! Hey I was looking for the jacket for this everywhere at the event and couldn’t find it. Could you tell me where it was at the event? Thank you in advance.
2019-04-24T16:34:31
https://igotdressed.com/2019/04/14/40448/
To claim the KANA Enterprise Knowledge Management profile please enter your @verint.com email address below. Buyers deserve to review accurate information about KANA Enterprise Knowledge Management. As an added benefit we award claimed profiles with additional points in the rankings as a thanks for showing transparency. Claiming your profile is as simple as clicking a link and receiving a confirmation email. Make sure potential buyers that wish to transact with KANA Enterprise Knowledge Management can visit your website. Sign up. Client reviews impact your position in the rankings and can increase buyer interest in KANA Enterprise Knowledge Management. Invite your clients to leave reviews. Invite potential buyers to learn more about KANA Enterprise Knowledge Management through a free one-on-one video interview. Schedule an interview. Give buyers a complete view of KANA Enterprise Knowledge Management and earn a boost in your profile score in the rankings. Login here to complete your profile.
2019-04-23T01:22:15
https://www.crowdreviews.com/kana-enterprise-knowledge-management/login
Just heard this out of Tallahassee where the controversial teacher merit pay bill could be on its way to Gov. Rick Scott to be signed into law. The Florida House will take up final debate on the measure Wednesday before its vote. If this bill passes, teachers’ pay could be tied to their students’ performance. Teachers would be held accountable for their students’ grades and Florida’s Comprehensive Assessment Test (FCAT) scores, but opponents say it’s not fair to teachers. Many are saying they would not mind a bonus attached to this but to base their pay on it will open a Pandora’s Box of issues. “Well, our teachers are in the classroom doing their job and they are focused on preparing their kids for the FCAT next week, and they’re not going to be in Tallahassee and they know that,” said Andy Ford, president of Florida Education Association.The Senate passed the bill (SB 736) last week. It’s less rigid than one former Gov. Charlie Crist vetoed after widespread protests by teachers, parents, students and many local school officials. The House is set to vote on the bill, which would go directly to the Scott, who has expressed strong support for the legislation.It’s designed to mirror Florida’s plan for a $700 million federal Race to the Top education grant that includes a move to merit pay. Republicans said the move is necessary and that it’s time teachers face the same job performance requirements of other workers in the private sector. The House speaker, Dean Cannon (R – Winter Park), scheduled 12 hours of debate on this bill, which will be split equally between Republicans and Democrats Wednesday. I am very interested in the outcome of this and I wonder how the teacher will react if this bill becomes law.
2019-04-19T05:25:19
https://barzakaylaw.com/2011/03/16/teachers-merit-pay-bill-to-be-law-soon/
It’s been a crazy busy year which is ending on a high! This month we teamed up with education communications expert Ezri Carlebach to work with the Cambridge School of Visual and Performing Arts to promote the appointment of award-winning British designer Holly Fulton as their new Head of Fashion. Holly has taken on the role, while continuing her own fashion label. The college wanted to find an active fashion designer to offer their students an unparalleled fashion education which they certainly have done with Holly heading up the Fashion Design BA (Hons) degree. We’ve had some great media attention from Vogue, Drapers, Harpers Bazaar, WWD and The Industry – with more news to follow in 2018!
2019-04-24T00:51:19
https://mlpr.co.uk/2017/holly-fulton-the-new-head-of-fashion-at-the-cambridge-school-of-visual-and-performing-arts/
Posted by Stephanie on August 30, 2012 in Chat Highlights and tagged inflatable sports tunnels. Join us Thursday as we discuss the most commonly asked questions regarding inflatable problem-solving & crisis management. Preliminary questions have been listed below, but, we encourage chat participants to ask any questions they may have about inflatables to #InflatableChat. Q1. Will I be able to set up my inflatable by myself? How can I successfully inflate my giant advertising balloon? Q2. Mayday! My inflatable has accumulated mildew – what should I do? Q3. My helium blimp has been punctured / torn, can it be saved? Q4. What should I do if my cold-air inflatable has a small tear? Q5. What should I do if my cold-air inflatable has a large tear? Q6. How often should I wash my inflatable? Q7. What are the best practices for washing a custom inflatable? Q8. Can I use my inflatable in the winter? Q9. How cold is too cold for a cold-air / helium inflatable? Are you new to twitter? Visit our Getting Started page for directions. Already have a twitter account? Follow @LandmarkBot for weekly #InflatableChat reminders. Posted by Caitlin Jean on August 22, 2012 in Chat Questions and tagged cold air inflatables, custom inflatables, helium blimps, inflatable mold, inflatable repair, inflatable repair kits, vinyl inflatable repair.
2019-04-20T22:24:02
https://inflatablechat.wordpress.com/
AUSTIN, Texas — Rick Potter knows campaign signs don‘t vote, but when an overwhelming amount of Beto O‘Rourke signs began sprouting up in his home county, he says he knew exactly what to do: call in the cavalry. For 18 years, Potter has been part of the Mighty Texas Strike Force, which typically deploys a few battalions of rock-ribbed conservatives from solid-red territory to a swing state where they can help tip a competitive race to the GOP. This year, the group is deploying at home, in the Lone Star State. “It marks the first time I‘ll stay in Texas to assist in keeping a Republican in office,” said the 62-year-old Travis County businessman. He has been part of a volunteer army of 1,500 to 2,000 conservatives from 15 different states who volunteer their time to go to battleground states on their own dime during presidential election cycles. Since then, the group has grown with members from other red states who go out in swing states to help out with voter and efforts to get out the vote. Today, Potter is the chairman. “We changed the name to the Mighty American Strike Force because of the variety of states involved,” he said. “But to date we have never deployed in midterm elections.” And the group never felt the need to hit the hustings in Texas. “We‘ve started our conference calls and are getting ready to go where we are needed,” he said. It says something that Potter feels his efforts are needed in his home state. O‘Rourke has outraised Sen. Ted Cruz by $8 million so far, according to The Texas Tribune, and the latest Real Clear Politics polling numbers show a tight race with O‘Rourke within the margin of error. Potter says maybe his geography makes an O‘Rourke victory feel like a real possibility: He lives in Travis County, a blue doughnut hole surrounded by Republican members of Congress all over the outskirts. In 2016, 350 volunteers including Potter were in Pennsylvania for two weeks, spread out in counties surrounding Pittsburgh, Philadelphia, Harrisburg and Scranton. In these areas, turnout increased just enough from Mitt Romney‘s numbers in 2012 to place candidate Donald Trump over Hillary Clinton by just over 40,000 votes — the first GOP win of Pennsylvania‘s electoral votes since 1988.
2019-04-20T18:39:24
https://hermannherald.com/sign-of-the-times-texas-gop-cavalry-may-need-to-stay-home-to-guard-ted-cruz/16781/
Checkout the Rhode Island Events Calendar and the events channel below. the 2018 Ida Lewis Distance Race will create quite the spectacle of sail when it starts at 12:30 p.m. on Friday (August 17) between Fort Adams and Rose Island. TEAM ONE ANNUAL TENT SALE!
2019-04-21T13:06:14
https://www.riyachting.com/channels/events
None has the right to be worshipped except Allaah, alone, having no partner. Sovereignty is His and all praise is for Him, and He has full power over everything. O Allaah no one can hold back what You give, and no one can give what You hold back, and no one’s riches can benefit them against You. Allaahumma ‘innee ‘a’oothu bika min jahdil-balaa’i, wa darakish-shaqaa’i,wa soo’il qadhaa’i, wa shamaatatil-‘a’ada.
2019-04-21T16:37:06
https://authentic-dua.com/category/group/sahih-bukhari-muslim/
In Middle Eastern culture from ancient times and continuing today, the right hand is the hand of favor. This is both symbolic and practical. Within this cultural practice, the left is the hand that performs all the unclean acts required for the body while the right hand remains clean and unsoiled. Offering someone your left hand would be highly offensive while offering the right hand shows favor and acceptance. I thank you that you have answered me and have become my salvation. The stone that the builders rejected has become the chief cornerstone. This is the Lord’s doing; it is marvelous in our eyes. The cornerstone, capstone provides foundation and support for an entire structure and is highly prized. From rejection by others to a chosen and favored role by Yahweh – the poet rejoices in this impossible possibility. The psalmist celebrates the happy reversal God has accomplished. Several New Testament theologians picked up on this cornerstone image as they pondered the meaning of the Christ event. For them, this saying prefigured the life and function of Jesus the Christ and succinctly described who he is. Mark used it first, in the context of a parable used to the indict the Pharisees over their rejection of Jesus as Messiah. Matthew and Luke followed Mark closely. Blessed is the one who comes in the name of the Lord. We bless you from the house of the Lord … Bind the festal procession with branches up to the horns of the altar. Christians from liturgical traditions recite this first line nearly every Sunday, and most Christians will read about this “festal procession with branches” and recollect Jesus’ Palm Sunday parade. Theologian Richard Hays reflects on ways the first century theologians re-read their own Scriptures to find within them “figures” or “pre-figures” of Christ. They began with the Christ Event and then read backwards through the Hebrew Scriptures to make sense on this never-before-imagined event. It’s not so much prediction, Hays notes, as it is a recognition of divine patterns in God’s interaction with humans and our human endeavor to understand this divine interaction. It’s not so much about how the original texts were produced as it is about how the texts are received in any subsequent age. Our psalmist rejoices in the surprising reversals of grace he and his people have experienced and he gives praise to the steadfast God for orchestrating his salvation. In our own day, through the events of our own lives, we too can recognize God’s persistent pattern of turning expectations on their heads and surprising us with grace and new life. As 21st century theologians, we too rejoice in the ever new surprise of resurrection. Disaster, despair and death may be our human pattern, but the Divine Pattern displayed by death’s reversal in the resurrection of Jesus Christ is a pattern that will never cease to amaze us. Richard Hays. Reading Backwards: Figural Christology and the Fourfold Gospel Witness (Waco: Baylor University Press) 2014. Previous Previous post: As You Read. Weeks 12 & 13. Esther and Jonah.
2019-04-20T00:25:17
http://livinginthestory.com/2019/03/psalm-118/
I was trying to solve the N-Queens(Only 1 solution) problem and I succeeded but my program could only calculate up to N = 47 in a good amount of time so I tried to implement least constraining value and most constraining variable and even though it got faster, it was still slow. What can I do to be able to calculate up to N = 1000? I can't post the whole code because it's too long but please note that isOk(board, x, y, n) is a function that tells if we put a queen on the x row and y column it threatens other queens or not. mid_rows is an array that includes the most middle rows to the side rows so like let's say n = 5, then it's [2,3,1,4,0] or when n = 6 it's [3,2,4,1,5,0]. sd_squares is a list that contains the side squares to middle squares. Like when n = 5 it's [0,4,1,3,2] or when n = 6 it's [0,5,1,4,2,3]. Browse other questions tagged python python-3.x time-limit-exceeded backtracking n-queens or ask your own question.
2019-04-25T16:57:12
https://codereview.stackexchange.com/questions/205089/using-most-constraining-variable-and-least-constraining-value-for-n-queens-chall
In an island of few true luxury properties, this little jewel may be Curaçao's most upscale resort (and its priciest), with pampering service to match. It's on the island's southern flank, right on the water, with a private manmade lagoon that's fed by the sea but calm and placid for swimming. The resort's three pool villas offer private pools and utter privacy (two have two bedrooms/two baths; the Villa Bunga Flamboyan has four bedrooms and three baths). If you want to be closer to the sea, the two oceanfront villas and three oceanview villas offer luxurious quarters in tropical gardens with three bedrooms each and private access to the infinity pool. All villas come with smartly outfitted, contemporary kitchens. Of the four suites, two one-bedroom units offer sea views and a shared Jacuzzi. The three standard hotel rooms are nestled in lush gardens; one, the Banyan Tree Loft, comes with a fully equipped kitchen and an extra double bed. All have balconies or terraces, and all are dressed to the teeth with luxury linens and Asian-inspired furnishings. You'll dine well in the resort's beachside restaurant, Baoase Culinary Beach Restaurant & Bar, open for breakfast, lunch, and dinner. The resort's 15 units will expand to 25 in May 2015 with the completion of 10 new luxury suites—each with outdoor showers, private pools, and access to a private beach—located in a secluded section of the resort.
2019-04-23T15:59:25
https://www.frommers.com/destinations/curacao/hotels/baoase-luxury-resort
3-way Switch for rear door light on Ascape. A minor irk that one had to open the door to turn the outside light on. Meant that you couldn’t ‘see’ who/what was out there before opening the door. Minor irk but an irk nevertheless. A tweak to a 3-way switch scheme is the solution. Hardware change to 2 x SPDT switches would do it. At least one switch has to be weatherproof to replace the switch on the light itself. I used a toggle switch on the light, replacing the sub-miniature, which was a bit cumbersome to operate anyways, due to the size and rubber seal. The inside switch is a rocker type. Toggle type just wouldn’t have looked right. Possible the hardest task of the whole thing was carving that hole for the rocker switch. The only hardware required: 2 SPDT switches of the 3-pin ON/ON variety. I sourced the switches from Amazon.ca. Connection is simple as per this diagram. The light is easily removed exposing the wiring on the inside. No new holes required as existing is big enough to feed the extra wires. Inside access is gained by removing the rear cupboard panel, 2 screws. There is ample room for the inside switch but a bit of a bear to cut the hole. An alternative is to use a switch that mounts trough a round hole. For me that was not an option. Too fussy I guess. Mounting the round toggle switch into the rectangular hole required a bit of MacGyver’ing. I used silicone to ‘glue’ it into place in addition to fabricating a rectangular washer and then coating the exterior with liquid electrical tape. Probably a bit of overdo but it should at least keep the water out.
2019-04-26T08:53:49
https://www.smallrvs.ca/?p=1258
You agree to not distribute any of the materials provided to you, including, but not limited to: course materials, module materials, spreadsheets, word documents and emails. Applicant shall at all times indemnify, defend and hold S&L harmless from all loss, liability, costs, damages and expenses that my occur or be claimed with respect to any person, or persons, resulting from the purchase, use, or application of this website, S&LMP, communications between S&L and Applicant, as well as any of the provided materials and resources given to Applicant by S&L. This Agreement represents the entire agreement between S&L and Applicant.
2019-04-25T18:26:39
http://saltandlightphoto.com/mentoring-program-terms/
Sarah hates storms so she stands by the sliding door and watches Jake from the inside. He's holding the golf club in his hands like a tall ice cream cone. It’s raining harder now and she sees streaks of white lightning beyond the foothills. Sarah keeps watching him but he doesn’t turn around to look at her. It seems as if he doesn’t even know she is there. Jason Martin, MFA in Writing and Poetics from the Kerouac School at Naropa University, is a currently out-of-work English teacher. Previously published in Cold Mountain Review, Patterson Literary Review, and Quilt. He can be contacted at jtbs47@gmail.com.
2019-04-24T16:03:04
http://www.thesquawkback.com/2016/05/jason.html
Former American Idol host Brian Dunkleman is now driving for Uber — and he's perfectly fine with that. After TMZ reported on Thursday (Jan. 3) that the former TV host is a driver for the ride-sharing company, Dunkleman had some choice words for those who look down on how his career has progressed. "I chose to stop doing standup comedy and started driving an Uber so I could be there for my son as much as he needed after our life as we knew it was destroyed. Print that," Dunkleman tweeted, referencing his divorce from and custody battle with his wife, Kalea Dunkleman. The couple has a son together, 5-year-old Jackson. TMZ learned Dunkleman's current occupation by obtaining financial documents he submitted as part of divorce proceedings. The paperwork notes that Dunkleman began driving for Uber in March of 2016 and works about 45 hours per week; it also notes his weekly pay, checking account balance and monthly expenses. "And I make over a grand on a good week motherf--kers," Dunkelman adds in a second tweet. In both tweets, he tagged TMZ and its founder, Harvey Levin. A native of New York State, Dunkleman co-hosted the first season of American Idol in 2002 with Ryan Seacrest, but elected to leave the gig after Season 1. He later admitted, People reports, that he believes he would have been fired had he not left of his own accord; still, Dunkleman added, he was "bitter" about his decision after seeing how successful the show became. Dunkleman made an appearance on American Idol during the show's Fox series finale in 2016 (the TV singing competition has since been revived on ABC). At the time, he said that he was "very glad" to have been asked back. What Are Country Music&apos;s American Idol Finalists Doing Now?
2019-04-26T15:37:40
https://tasteofcountry.com/brian-dunkleman-former-american-idol-host-driving-for-uber/
WASHINGTON--A new Scientific Statement issued by the Endocrine Society calls for more research aimed specifically at understanding the underlying mechanisms that make it difficult to maintain long-term weight loss. Despite decades of research and billions of dollars spent each year on treatment, understanding of the underlying causes of obesity remains limited. One in three American adults is affected by obesity, and it costs an estimated $147 billion a year to treat obesity and its consequences in the United States, according to the Centers for Disease Control and Prevention. Growing evidence suggests obesity is a disorder of the body's intricate energy balance systems. Once an individual loses weight, the body typically reduces the amount of energy expended at rest, during exercise and daily activities while increasing hunger. This combination of lower energy expenditure and hunger creates a "perfect metabolic storm" of conditions for weight gain. "Because of the body's energy balance adjustments, most individuals who successfully lose weight struggle to maintain weight loss over time," said Michael W. Schwartz, M.D., of the University of Washington in Seattle, Wash., and the chair of the task force that authored the Society's Scientific Statement. "To effectively treat obesity, we need to better understand the mechanisms that cause this phenomenon, and to devise interventions that specifically address them. Our therapeutic focus has traditionally been on achieving weight reduction. Most patients can do this; what they have the most trouble with is keeping the weight off." "Healthcare providers and patients need to view this tendency as the body's expected response to weight loss, rather than as a sign of a failed treatment regimen or noncompliance with treatment," Schwartz said. Interactions between genetics, developmental influences and the environment. Though a substantial portion of obesity risk is conveyed by genes, researchers have not yet been able to identify all of the relevant genes and to understand the nature of their interactions with developmental processes and the environment. The effect of endocrine-disrupting chemicals such as bisphenol A on obesity. The microbiome, or bacteria in the gut, and its interactions with the endocrine and digestive systems as well as the brain. The reasons behind the therapeutic success of bariatric surgery. The role that diet composition plays in the development of obesity. Biological markers and predictors for diabetes, heart disease and other conditions that often develop in conjunction with obesity. The effects of socioeconomic status on obesity risk. Brain imaging to better understand appetite and feeding behavior. Other authors of the statement include: Randy J. Seeley of the University of Michigan in Ann Arbor, Mich.; Lori M. Zeltser and Rudolph L. Leibel of Columbia University in New York, N.Y.; Adam Drewnowski of the University of Washington in Seattle, Wash.; and Eric Ravussin and Leanne M. Redman of Pennington Biomedical Research Center in Baton Rouge, La. The work was supported by grants from the National Institutes of Health, the National Institute of Diabetes and Digestive and Kidney Diseases-funded Nutrition Obesity Research Centers at the University of Washington, University of Michigan, the Pennington Biomedical Center, Columbia University, and the Russell Berrie Foundation. The statement, "Obesity Pathogenesis: An Endocrine Society Scientific Statement," was published online in the Society's journal Endocrine Reviews at https://academic.oup.com/edrv/article-lookup/doi/10.1210/er.2017-00111. The statement will be published in the August 2017 issue of Endocrine Reviews.
2019-04-20T03:34:39
https://www.eurekalert.org/pub_releases/2017-06/tes-esi062617.php
How do I adapt a Holset hy35 to a 3" exhaust? EGT temps-how high is too high? Wideband gauges: Innovate, AEM, or something else? bad O2 sensor or bad cat? Wrapping exhaust-good or bad? discuss! What's a good inexpensive 3 inch cat? Open'd exhaust. How much did you gain? is redusing my 3 inch exhaust to a 2.25 tip bad? Which EGT gauge has the screw in probe? A SV Q I hope not too stupid to answer? Stock T1 Garrett - DP question. Anyone ever used bolts to hold in exhaust manifold? Finally maybe an equal length header?! Any difference btween t1 and t2 exhaust manifolds? Anyone run a 3" exhaust system? Will my stock 2.25" swingvalve accept a 2.5" exhaust upgrade? 3 inch dowpipe- 2.5 inch SV? Quick Time Performance cut out? exhaust change. How much is it worth? Does it have to be this loud? Debating: 3" SV (internal) vs. external WG? Effect of rich condition on EGT? Home built 3" swing valve? Resonator power robbing effects-if any? Does location affect its ability? Cat I move the cat upward? What would you prefer in a header? My exhaust is finally done.. 2.5 downpipe in 2.25 swingvalve? Running no exhaust after DP? Good? Bad? Nothing? 3'' Exhaust on 2.5'' Swingvalve? 3 inch Exhaust, Weld or Clamps? best size pipe for a custom header/manifold? can u pass emission with 3" Good source for 4" mandrel bends? My external wastegate setup. pics. external gate pics and heatshield mock up. lots of pics. Making a 3 bolt flange to downpipe section. All this talk about external wastegates! Straight outa the exhaust housing? would a tbi header be a waste w/stock garret? I need a picture of this piece? G-body side exhaust + CO poisoning? Who makes a 2.5" cat back for the S/C? Anyone use a Racing Solutions exhaust Kit?? Running 2 mufflers to get rid of drone!!!!!! Exhaust gas simulation-tubular vs log header! aaaaalright. Motor building time. Need advice. To Thermal Coat Or Not? How is a 2.5" TM exhaust supposed to sound? Stock SRT tailpipes big enough? 8V Exhaust Manifold CAD ? Will 2.5" exhaust system from a P body bolt into a J body? How do cammed 4cyl sound? GLHT exhaust muffler location: Front or Rear? Full Tube SOHC Header $250. exhaust manifold to turbo gasket? 16v 3" Swingvalve and downpipe? Where do I have my machinist put the EGT bung? Cutting out Cat, Noise difference...? those who make stainless headers, come on in. im looking for good prices for parts. Any place to get turbine outlet flange. Stock looking or N-1/GT style muffler on 89 CSX VNT? EGT probe, one last time. Making a Stainless 3" downpipe and side exit exhaust. Factory passenger side exhaust tip? Pics of FWD Omni exhaust needed urgent please!
2019-04-18T14:20:51
http://www.turbo-mopar.com/forums/archive/index.php/f-18.html?s=d3cfc5b7335427419068e4d7d5cfbf65
Bruce Smith, Rochester Institute of Technology (RTI) professor of microelectronic engineering and also the director of the Center for Nanolithography Research in the Kate Gleason College of Engineering, has led a team of engineering students to develop a new process of Nanolithography that uses evanescent wave lithography (EWL) to produce the smallest ever semiconductor device geometry. Researchers from University of New South Wales, Australia, are working on developing a coating that may make cleaning bathrooms less of a chore. The lead researchers Professor Rose Amal and Professor Michael Brungs of the ARC Centre for Functional Nanomaterials, are hoping to apply a coating of tiny particles of titanium dioxide to keep the toilets clean. Currently the titanium dioxide is being used on outdoor items like self-cleaning windows. The Kama Sutra Virus / worm is going to be activated on Friday. It has been spreading around the world via email, but won’t begin destroying computer files until Friday, February 3rd. There are some things you can do. First you should back everything up. There are many backup programs available that automatically back your files up. This should be done frequently because even without the destructive force of a virus, hard drives can become corrupted and eventually completely fail. Intel announced today that it has reached a milestone in the development of the 45 nanometer (nm) logic technology. Intel believes they are the first to have a fully working SRAM (Static Random Access Memory) chip that uses the 45 nm technology. Scientists have been debating whether Pluto should be classified as a planet or just another rock in space orbiting the sun. Hopefully this question will be answered by NASA in 9 years. Today, the National Aeronautics and Space Administration launched the New Horizons spacecraft on top of a Lockheed-Martin Atlas V rocket from Cape Canaveral Air Force Station in Florida. The New Horizon craft will travel to Pluto and its moon Charon in an effort to shed light on the body’s surface properties, geology, interior makeup and atmospheres. The “flyby” studies will take place in 2015. Apple announced a new iPod Radio Remote at the Mac World Expo in San Francisco this past week. This new accessory for the iPod nano is a FM radio and a remote control. You can have your iPod in the backpack and use the remote to jump to any song in your playlist or you can listen to FM radio. Apple computer, for the first time today, showed off the new iMac at the Macworld Expo in San Francisco. The new iMac uses the Mac OS X operating system and is running on the new Intel Core Duo processor. There’s a cool new tool available to help you build links. It is called PRASE and in this article I will explain why it’s good at helping find sites. Further I’ll look at some of the other features to see if there are other uses for this tool, such as competitive intelligence gathering and deep linking opportunities. Really, this new tool offers so much more when you begin to look at what it can do. And that’s what I’m writing about today. Voice over Internet Protocol (VoIP) may be a great way to lower your phone bills. It is definitely something you should consider if you make long distance calls. This is what you need to know before you leave your regular phone service behind and begin the process of converting over to VOIP. There are three ways to place a call using VOIP services. ATA (analog telephone adapter) is the simplest and most common way users make VOIP calls. This method allows you to connect your standard phone to your computer. Your ATA adapter converts your phone signal to a digital signal that can be sent over the Internet. Pulse-Link Inc. from Carlsbad, California, will demonstrate its Gigabit-rate CWave Ultra Wideband (UWB) during the Consumer Electronics Show, January 5-8, in Las Vegas. F-Secure, a Finnish security firm is warning users not to install a leaked beta version of MSN Messenger version 8. It is a hoax that is a variation of the Virkel instant messaging virus. The virus uses MSN Messenger client to send the infection to the entire user’s contact list, then connects the user’s computer to a second “botnet” server which can be further used to install more unauthorized software on the machine, such as phishing, hijacking, or keylogger software. Reverse Dictionary - Ever asked yourself "What's the word for..." I just happened to stumble on a pretty interesting tool today. I was trying to find a word for “People that are behind the times” for my previous blog post. I did a couple of searches in Google without avail and eventually started scouring for a tool that did a reverse lookup on a word. A tool where I would give the definition, and it would give me some words that matched that definition. What I discovered was Onelook.com’s Reverse Dictionary. Reverse Dictionaries allow you to “Describe a concept” in order to find words that match that description. Reverse Dictionary - Ever asked yourself "What's the word for..." Quadruple Your Visitor Viewing Time! Field of Dreams By now you probably have read numerous articles about driving traffic to your web site by implementing some proven techniques, such as SEO (Search Engine Optimization), Keyword Marketing, Google AdSense, Pay Per Click, among others. But how many articles or techniques do you read on “How to keep visitors from leaving a website?” Chances are very few. The adage, “If You Build It, They Will Come” may work for the movie “Field of Dreams,” but not necessarily in the real Web World. Like in the movie, there has to be a raison d’etre — a reason to keep watching, a baited hook. If you remember, the film featured baseball greats of yesteryear that tapped into the consciousness of the fan, giving people something of value, a need fulfilled or just plain curiosity. They will watch the game/movie transfixed for hours. Quadruple Your Visitor Viewing Time! Microsoft will discontinue support for the Mac version of Internet Explorer. The support will end on December 31st and the program will be removed from the MS (Microsoft) website Mactopia for downloads on January 31st 2006. The initial announcement was made in June of 2003. Many Mac users use Safari or Firefox as a browser. This could be a problem because some websites have sections specifically designed for IE (Internet Explorer). I usually use Firefox but ran into a problem on a virtual tradeshow website. A marketing website (Marketworks) I use also requires IE for some of its applications. On December 15th, Amp'd quietly launched their multi-capable mobile wireless service which is marketed to a niche market. The hip new mobile company called Amp’d Mobile is more than just a cell phone, it is video broadcasts, music player, still and video camera, and also a cell phone too for the MTV fans and college students. The term used for this type of technology is call mobile virtual network operator (MVNO). Amp’d Mobile uses the Verizon Wireless for the cell phone services. The goal of Amp’d will be to market to a specific demographic group of people. Amp’d has endorsers that are pro surfers, skateboarders and snowboarders. Amp’d Mobile earlier this week announced that MTV is now a investor as well as a content provider. Mozilla Foundation has issued a security advisory for its new Firefox version 1.5 browser. This is what happens. The browser will hang when the history includes a real long page title / location (like 2.5 million characters for instance). The browser will hang when processing the long file. The only way to correct this is to clear the Firefox history file (history.dat). Researchers at PacketStorm security group has warned that the bug can result in hackers gaining control of a system, not just a denial of service (DoS) attack. The non-profit One Laptop per Child (OLPC) organization has announced that Quanta Computer Inc. of Taiwan was chosen to be the original design manufacturer (ODM) for the $100 laptop project. Yahoo! is planning on implementing a new VoIP (voice over Internet protocol) service to compete against Skype. Yahoo acquired Internet VoIP service Dialpad back in June. In September eBay acquired VoIP operator Skype explaining that this could help facilitate sales, specifically international sales. Buyers could actually converse with each other before bidding on an item. The service will be available in 180 countries and will integrate Yahoo e-mail and instant messenger service features. According to Networking Pipeline computer to computer calls will be free. I used Dialpad when it was free back in 2001 and was able to call any phone number in the US for free using my computer. Later Dialpad became a pay service. New Internet Explorer (IE) vulnerabilities have been exposed by Israeli hacker Matan Gillon. This new hole gives phishers a way to scan the hard drives of Google Desktop users, when the IE browser is used. Apparently there is a flaw in the way IE processes Web pages. Malicious Websites could steal sensitive information like credit card numbers or passwords from your hard drive when visiting sites where the pages are created with Cascading Style Sheets (CSS). These “style sheets” are a quick method some developers use to make the site look uniform with the same fonts and headers on each page (along with other functional appearances). Anyone buying a car should consider all of their options. Should they concern themselves with gas mileage or do they have a large family and need a large vehicle? If you have a long commute and drive solo or with a coworker to work, you should consider the hybrid option. eEye Digital Security has found a critical vulnerability in some versions of Apple Computers iTune. The newest version released just a few days ago has this vulnerability. The flaw could enable attackers to remotely take over a user’s computer. SEO and Search Engine Forums & Conferences :: are they really helpful? Working in the SEO/SEM industry can be very rewarding. Many times a problem can be solved simply with a little online research, and posts on a few forums. All to often, however, some people put too much stock in the posts they see, ultimately negatively impacting their SEO efforts. In this article I look at some of the positives and negatives of online SEM forums and attending SEM and SEO conferences. As part of my daily routine I visit a few of the search engine forums out there to see what people are talking about and what some have noticed. SEO and Search Engine Forums & Conferences :: are they really helpful? 1. Check your website statistics on a weekly basis. Are You Marketing Your Website? The history occurring in recent patent applications reveals more efficient production of Ethanol from Biomass using transgenomics. Ethanol production requires nearly complete hydrolysis. Most of the commercial applications for cellulase enzymes represent higher value markets than the fuel market. For this reason, enzymatic hydrolysis of biomass to ethanol remains non-competitive. A new news aggregator has been developed and is available for use in a beta version. The new website, Inform.com, appears to have more bells and whistles than other aggregators including Yahoo, Google News and Topix but with fewer news sources. Since the site is in beta more sources might be expected in the future, after all Google and others are continually adding new news sources. The Apple Computer Inc. iPod is one of the most popular devices of the new millennium. Madison Avenue’s favorite target audience with billions of dispensable income and no mortgage payments is the new generation born after 1985. Call the generation what you want, but they have made Apple very successful again by buying up the new iPod. I finally broke down and bought a couple pre-paid cell phones. This type of service is great for someone like me that does not use the cell phone much. It is also a great alternative for parents that worry about their kids running up a huge bill. Parents can give their children an allotted of minutes / money to make calls. After the allotment is used upthe parent can choose to recharge the phone either with a credit card or over the Internet. Google Inc. has introduced a completely new search engine devoted to blogs. The Google search already indexes blogs, but the links to them are sometimes buried among other webpages. The pages become outdated as the content changes so many surfers are taken to pages that have changed since the regular Google Search indexed it. Apple Computer unveiled its new iPod last week. The new Nano plays music, displays photos and is extremely small. Like computers, the size of the iPod is shrinking. The new Nano is about the size of a deck of cards, but a little thinner. Older iPods used a tiny hard drive to story songs. The new Nano uses solid state memory technology to not only increase the speed and reduce the size, but to extend the battery life as well. The Nano can last more than 14 hours on a single charge. Spamhaus made a claim that Internet giant Yahoo! hosts thousands of phishing websites. The press was given examples of some words including Bank, Paypal, and eBay. Here is how the fraud works. An email may prompt a user to click on a website called yourBank.com to updated your personal information. The email recipient may click on the link and become a victim of identity theft fraud after providing the private information. Recently Motorola won FCC approval for a new phone that features an Apple iTunes player. If the rumors are right, Apple will be announcing a new iPod phone in partnership with Motorola and Cingular Wireless. Most insiders have predicted this marriage between phone an iPod for years. A joint effort between the University of Texas and Australia’s Commonwealth Scientific and Industrial Research Organization has created industrial-ready material made of nanotubes. The scientists reported this in the Friday edition of the journal Science. A new security hole in Windows XP was reported on Wednesday by the French Security Incident Response Team (FrSIRT). A file called Msdds.dll (Microsoft DDS Library Shape Control file) is put into the hard drive when Visual Studio 2002 or certain Microsoft (MS) Office XP products are installed. The new security patch for the Apple Computer Tiger Operating System prevented 64-bit applications from running. A corrected patch can be found at Apples website. Some of the newer high-end applications have been compiled for 64 bit operation. Standard 32 bit programs continued to work. The new update, 2005-007 version 1.1, will replace the original patch issued on Monday. The original patch omitted the 64 bit version of LibSystem. The original patch was also updated to correct the flaw. Last Friday Microsoft warned there were vulnerabilities in their plug-and-play feature. There are three critical security flaws and one could potentially allow hackers to seize complete control of a computer. Since the announcement malware writers have been producing various worms to exploit the hole. They all are variants of the Zotob, as well as other bots (robot worms) and are spreading much faster than the original. Fireplaces and fireplace mantels are fast becoming a core feature in homes across the world as they add a real feature point to any formal or indeed casual living area. Funnily enough fireplaces have had a relatively short history, considering that fire itself has been around for hundreds of thousands of years. The Mountain View CA Mozilla Foundation announced Wednesday it will launch a for-profit subsidiary that will continue to develop the Firefox web browser and Thunderbird email client. The subsidiary, called Mozilla Corporation was necessary to eliminate legal and tax issues that might arise if the Mozilla foundation tried to make money from its desktop products. Why would anyone want a second mouse button? Apple believes the consumer wants it, so they have introduced the new Mighty Mouse. Actually, Apple went beyond the second button to install a “single upper shell” that features touch sensitive clicking. AMD (Advanced Micro Devices) introduced it’s new Athlon 64 X2 Dual Core Processor 3800+ on Monday. AMD has also cut prices of their earlier CPU models. The new model is rated at 2.0 GHz and includes 512K of L2 cache memory. Dual core is a way of splitting the processor so it can complete two tasks simultaneously at a faster speed. Half of the processor can be rendering images while the other is crunching numbers or coordinates for a game. The processor is quicker because it can multi-task, according to the company. A new planet has been spotted. Astronomers in California have officially identified 2003UB313 as the 10 planet orbiting our sun. They are calling the new planet Xena. PASADENA, CA - Back in April of this year, my family joined the 21st century when we purchased an iPod. We were in the Apple Store, which I started going to frequently after I purchased a Mini Mac to play with, and we noticed that our oldest son was really interested in an iPod. Since it was right after his birthday, we thought that an iPod Mini might be a good idea, and he was quite enthusiastic about it. Since I had just bought a Mini Mac recently, I was motivated to buy another Apple product (the Mini Mac is really cool, more on that another time). PASADENA, CA - In another article I mentioned that one of the reasons for the purchase of the iPod was that I would exercise more. Now that I own one, do I exercise more? The answer is … yes! One of my joys of owning an iPod is walking around the city I live in, Pasadena, and escaping from the moment through the magic of the music. With the tunes that I want to hear a few quick flicks of my fingers away, I wander the neighborhood slowly, window shopping, observing my fellow pedestrians, casting an indifferent eye at traffic, all while enjoying the serenity of the iPod experience. I’ve entered the local record shop (yes, it still exists and it does sell some records) listening to the new Gorillaz album Demon Days, and exited later immersed in the Overture from Tannhäuser. I have the freedom, which wasn’t possible before my iPod, to listen to any of the 5300 + songs on it, all of which I own legally, at any place and at any time! I have a confession to make. I’ve always wanted one, maybe even secretly desired one. Professional curiosity, the coolness factor, the desire to work with something different, I’m not sure what it was exactly, probably a bit of all of them all, but it wasn’t enough to overcome the cost of adopting a new platform. Rob Sullivan is a SEO Consultant and Writer for http://www.textlinkbrokers.com. Textlinkbrokers is the trusted leader in building long term rankings through safe and effective link building.
2019-04-24T02:00:06
http://www.bestsyndication.com/MAINpages/archives/science_tech/030606_science_archive.htm
Request Quote The Sud Est is a friendly and affordable Bed and Breakfast which is located in Sternatia, in Salento, Salento heart of Greece. Offers a friendly, but professional at the same time, it has three large bedrooms SUN, MOON and SEA with vaulted ceilings (building typical of the area), each room contains a double bed and a single bed, available to customers, there is also a large garden with patio and parking for both cars and motorcycles with possibility of garage. It is located in a central area of ??Sternatia a few steps from Piazza, ESF Station (South Eastern Railway) and the various business activities of the country. Sternatia is 16 km from Lecce and is one of 11 countries of Greece Salentina, with the highest percentage of speakers Griko.
2019-04-19T20:58:40
http://en.itholiday.com/str/7127-bed-and-breakfast-sud-est.htm
We collect information including your name, address, telephone number/s and email address. We only use your data when we contact you about our mobile coffee services. We use your contact information to contact you when you use our services. Therefore we do not share any information with third parties or partner companies. Currently our website themobilecoffeebean.com does not collect cookie data as a result of not having cookies installed.
2019-04-18T20:38:22
https://themobilecoffeebean.com/privacy-policy/
I really enjoyed this post, mrs f, the snippets of conversation, the photographs. I saw a PBS documentary recently: scientists found skeletal remains of what may be the ‘missing link.’ The question arose: What makes us human? Language? Using tools? Or is it our social selves: our ability to be polite, to help each other, to follow self-imposed rules, navigate busy NYC streets at the height of papal visits. . . Humanity is everywhere in the hustle of bustle of NYC streets and underground subway stations: often messy; sometimes ugly; always, a colorful jumble of sights and smells and sounds. On a wing and a prayer, by the grace of God or fate or luck, we’ll keep this jostle going. I wondered how you were weathering the papal visit! It was tempting to try and head south for it….but not tempting enough, clearly. This post made me sooooooo homesick. Although I must admit I had a bad case of taxi-arm in my 20-year NYC residency (mostly because I seemed to be running late so darned often), I also spent a great deal of subway time in observations just like the ones here in Fringeville today. I may also have been one of the few full-time residents of Manhattan who would actually stop to enjoy the street music (when I was NOT running late, that is). Truly, I miss it all – and your trip down memory lane (for me) is bittersweet.
2019-04-26T02:34:34
https://mrsfringe.com/2015/09/25/holy-papal-visit-batman-gothams-a-mess/
Gentle sweeping curves and exquisite detailing make this mini sofa and chair collection a must have addition to any living space. Features hand tufted buttons and neat pleats and the addition of a streamlined mid century leg adds a pop of modernity to this vintage classic. Fabric characteristics These fabrics have a softness and lustre created by a thick pile of threads on the surface. Through normal handling and wear of the furniture, crush marks and random shading of the fabric surface will occur. This is generally considered a desirable expression of the fabrics’ comfort and elegance. Avoid contact with hot surfaces. Frame Material Solid hardwood rails with high density particleboard panels glued and stapled. All hardwood comes from sustainable forests. Seat material Zigzag springs to seat, firm front edge. Filling characteristics All interiors will settle and compress with use, regular dressing is required to maintain the appearance of seats, backs and scatters. Cushions must be plumped regularly to retain their performance and appearance.
2019-04-24T15:53:23
https://www.arnotts.ie/shop-by-department/furniture/sofas/alexander-james/jean-sofa-plush-velvet-rose/JEANSOFAPLUSHROSE.html
of sugar cane harvesting equipment suited for both new and existing mechanised growers, and strives to provide dependable products, which achieve consistent results. In addition to this, Canetec also offers a diverse range of manufacturing and engineering services to a broad customer base including agriculture, waste and the mining industry, which aim to add value to operations by providing innovative solutions for each client. The company leverages the capabilities of other key companies as well, which allows them to focus on their core competencies to ensure products are delivered within the specified time limit and budget.
2019-04-26T05:55:27
http://canetec.com/about-us.html
The Ronaldo collection makes others envious with its clean and modern elements. Rolled and pleated arms are adorned with panels while the three over three cushions house two sets of accent arm pillows. The Possibilities living room sleeper is curved, yet sleekly lined for a classic look. The gently sculptured back and the rolled arms are inviting. Comfort is provided with the expansive seating environment. The Ramona sleeper will make your home a happy place. Features include cushions that are wrapped with contrasting welt, shaped arms and a waterfall skirt. The accent arm pillows are enrobed with contrasting welt and show off colors and multiple textures. The Sedgewick sleeper features three bordered seat cushions with knife edged back cushions. The welted detail gives this a super sleek and modern appeal. Available in Queen, Regular and Twin Sleepers. The Taylor sleeper is stylish and will freshen up your decor. Features high profile arms, wood legs, box seat cushions and coordinating arm pillows. The chic look of the Tilly sleeper is perfect for your home with two over two cushions and accent arm pillows. Features two over two cushion design and accent arm pillows. The clean lines of the the Troupe sleeper is contemporary and casual. Features three over three seat cushions, rolled arms, welted detail and block wood legs. The Klaussner Westbrook sleeper features curved arms with pleated details. The Zuma sleeper is a must have in any home.
2019-04-26T08:14:05
https://www.sofabedetc.com/sleepers.html?p=2
Do You Need a Book Reviewed, possibly included in Kim's Blog? What do you gain from mentoring writers and offering free publishing workshops? "I gain intense joy, inspiration, and soul-satisfying pleasure. As a woman whose passion for writing began at the age of thirteen, I have mastered the elements of storytelling and achieved success through self-publishing. To share this success and "how-to" knowledge with new writers or seasoned authors fulfills my life mission as an English teacher and as a writer who supports other writers with publishing their work." Check back as free materials are posted. ​All Books, News, Free Classes, Free Ebooks and Deals. No Spam. Get the latest updates and special offers. You'll also have a chance to enter exclusive giveaways. Avid readers become successful authors. The books below include those Kim recommends, including many of which she has reviewed and written literary reviews or academic essays. This website is updated regularly, so you can keep up with all that Kim does in the local area of North Idaho and Eastern Washington. For those out of the area, be sure to connect and plan to bookmark this website. Kim does spend much time on social media and online forums, and she does make public appearances. She reaches out to those wanting to connect and loves to hear from readers. If you'd like to send Kim a message directly, please use the form above. Kim speaks directly to readers through her books, classes and blog. Book release notifications are also sent out through Kim's newsletter.
2019-04-20T21:16:24
https://www.kimemorgan.com/i-read.html
In a somewhat bizarre occurrence, the referee in Brazil's Campeonato Série A Football League match between Santos and Corinthians lost the toss coin just moments before the scheduled kickoff. The two opposing team captains looked on in bewilderment as the embarrassed match official searched frantically in his pockets for the coin. He even went as far as to remove his shoes and socks with the hope that it would have been there. Unfortunately, he had no luck whatsoever in retrieving the lost coin. So with time going and the anxious spectators and players growing increasingly impatient over the footballing faux pas, the quick-thinking ref decided to use an alternative method to determine which team will attack which goal - request that the two team captains play Rock-Paper-Scissors. "Everything appeared to be set and in place for the match to kick off promptly at its scheduled time. I was under the impression that I had everything that I needed to officiate the game:- my whistle, my little notebook, my pen, my yellow and red cards and the all-important coin. I remember placing the coin in my front left pants pocket. The only conclusion I can draw for it getting lost is that I probably didn't put it in deep enough and it fell out as I took out my handkerchief which was in the same pocket, to wipe the sweat off my face because it was a very hot afternoon." "The teams and the referee assistants accompanied me out onto the field. I went to the centre circle with the two opposing captains for the coin toss and the flag exchange. I dug into my left pocket first because that is where I usually keep the coin but I didn't feel it. I then did the logical thing and checked the other pocket. Nothing. I then became frantic. I dug in the pockets again to see if I had dug deep enough. I even took off my shoes to see if it was there. No luck. I knew that the players and spectators were growing impatient. I had to think fast. Then suddenly and miraculous idea hit me - have the opposing team captains play Rock-Paper-Scissors to determine who will attack which goal. I told the captains what happened and the great suggestion. Initially they thought that it was a joke but I told them that I was very serious and they obliged." "The Corinthians captain won the RPS showdown when he did scissors and the Santos captain did paper." "Of course. I think that it is something that FIFA should consider in order to avoid similar embarrassing situations like what happened to me in the future. In fact, tomorrow I plan to write Mr. Infantino with that proposal to see if the FIFA Council can make it official." Who really wrote this - someone with chunks missing from there head?
2019-04-20T04:12:51
https://www.laughsend.com/spoof-news/world-news/football-referee-makes-44985.php
Modern Window Treatments For Living Room Implausible Treatment Ideas Com Home Interior 23 is one of pictures that are related with the picture before in the collection gallery. The exactly dimension of Modern Window Treatments For Living Room Implausible Treatment Ideas Com Home Interior 23 was 857x600 pixels. You can also look for some pictures that related to Modern Window Treatments For Living Room Implausible Treatment Ideas Com Home Interior 23 by scroll down to collection on below this picture. If you want to find the other picture or article about Modern Window Treatments For Living Room just push the next button or previous button; or if you are interested in similar pictures of Modern Window Treatments For Living Room Implausible Treatment Ideas Com Home Interior 23, you are free to browse through search feature that located on top this page or random post section at below of this post. We hope it can help you to get information of this picture.
2019-04-22T10:16:23
http://mogams.com/modern-window-treatments-for-living-room/modern-window-treatments-for-living-room-implausible-treatment-ideas-com-home-interior-23/
Steelspan's metal pegboard panels are a classy addition to any industrial workshop, home garage, shop display or commercial storeroom. The Metal Pegboard 1860 and 960 in both Aluminium Diamond Plate and stainless steel is designed to integrate with the Steelspan Storage System and may be secured at 25mm height increments to the back or sides of the End Frame. Metal Pegboard accessories including pegboard hooks or pegboard storage bins can be fitted to the pegboard on the sides of shelves, above the work bench top or as a full height pegboard display panel to store and display tools, small parts and components or retail items. Depending on the need the metal pegboard panel may also be secured directly to the wall. Steelspan has a custom cutting and bending service and thus can meet just about any design application with this product. Steelspan's Metal Pegboard Panels are proudly designed and made in Australia.
2019-04-22T06:06:45
https://steelspan.com.au/products/metal-pegboard/metal-pegboard-panels
One lot & one CUSTOM DESIGN COMPLETED HOME are still available on this originally 7-lot sub-division in Yardley, Lower Makefield Township, PA. The lots include both wooded and open variety and range from 2.5 – 8 acres. Properties feature entirely public utilities including water, sewer, and gas. This location provides convenient access to trains for Philadelphia, New York, and Princeton and is located just minutes from I-95 and Newtown, PA.
2019-04-23T16:05:21
https://www.mcginnconstruction.com/lower-makefield-lots
Located on the Gulf Coast of Thailand, Ko Samui is one of Thailand’s most popular wedding and honeymoon destinations. With glorious beaches, luxurious accommodation and superb food, it’s easy to see why Ko Samui is such a favourite for those seeking a romantic retreat. The majority of couples coming to Ko Samui opt for a ceremony on the beach with the stunning Gulf of Thailand as a backdrop, but there are alternative romantic settings on the island away from the sea shore.
2019-04-19T10:56:32
https://watdee.com/getting-married-in-ko-samui
Smoke Away is known as a natural stop smoking support program which helps people break the smoking habit with different solutions! Quit smoking with the help of Smoke Away kits and save money by using Smoke Away coupon code and other offers below! Save $20 OFF all orders today! Stop smoking naturally! Redeem this link and buy now! Shop at Smoke Away and enjoy 30-Day money-back guarantee! Buy now!
2019-04-21T08:57:25
https://livecoupons.net/stores/smoke-away-coupons/
Communities in Central America tell of families separated and the anguish of parents who have lost contact with their children, worrying about whether they are safe and alive. Neither the communities from which they flee nor their credit unions want this. In Guatemala, in the Western highlands of Quiché, Huehuetenango and Quetzaltenango, San Marcos and Totonicapán, we remember these communities 20 years ago, vibrant with colorful red yellow and blue weavings and textiles. Most of that is lost now to low cost Chinese competition. In the recent years, we have worked with Guatemalan credit unions and their association, MICOOPE, to finance small farmers which has helped provide higher income in rural households and provide an economic future for youth. Yet there is limited employment opportunity in agriculture and the communities are far from airports, ports or the capital city. Transport of fresh produce to market is risky because of landslides and strikes that block the roads. So the credit unions look also to finance small business to offer youth jobs or opportunities to start enterprises. We work with them to help them upgrade their ability to do business lending. Risk is high. There are very few businesses to offer jobs. Young people start businesses but are also highly mobile. The survival of new enterprises is only 7% nationally in Guatemala. So where to start? We build an alliance with the Ministry of Economics, the CUs and local businesses. The state helps the CU put a business training center in the credit union. The CU uses the training course graduation to screen borrowers. The private businesses offer a “micro-franchise” to set up chicken restaurants, bakeries or internet businesses. Credit unions finance the purchase of the micro-franchise license, purchase of the equipment and working capital. As they do everywhere, CUs help provide jobs and an economic future for their communities. Thank you for your support in helping them do that work.
2019-04-18T16:17:19
http://doglobalgood.org/field_engagements/supporter_updates?post=1684
1. Purchase 1 (one) - 4 (four) ounce or greater bottle of either Mechanic In A Bottle, Ethanol Shield, Diesel Mechanic In A Bottle or Engine Energy during valid manufacturer’s rebate offer through December 31, 2013 (receipt date must be during rebate period) and receive a rebate of up to $3.00 off the original purchase price but not to exceed the original purchase price. 2. Complete attached form in its entirety. By submitting this rebate form, you agree to the terms & conditions below.
2019-04-20T12:11:28
https://topequipment.net/news/2013/9/17/b3c-factory-rebate-program-has-been-extended-to-123113
Jamal Khashoggi is on the shortlist of Time Magazine's Person of the Year, the publication announced Monday. The Washington Post columnist who was killed at the hands of Saudi agents in Istanbul, was described by the magazine as a "prolific commentator and critic of Saudi Arabia’s Crown Prince Mohammed bin Salman," and is on the list alongside powerful world figures including U.S. President Donald Trump and Russian President Vladimir Putin. Khashoggi was last seen Oct. 2 when he entered the Saudi consulate in Istanbul to obtain papers he needed to marry his Turkish fiancee. He disappeared shortly after entering the diplomatic building as Saudi Arabia produced various, contradictory narratives to account for his whereabouts. Riyadh eventually admitted he died in the consulate shortly after he entered, blaming his death on rogue agents -- an explanation that has come under scrutiny as pressure builds in the U.S. Congress for bin Salman, Saudi Arabia's de facto ruler, to be held to account for Khashoggi's death. Khashoggi's body has yet to be returned to his family, amid reports it was brutally dismembered and possibly dissolved in acid. "Believed to have been murdered on the orders of the Crown Prince, his death prompted international outcry and scrutiny of the Saudi regime," Time said. In addition to Putin and Trump, Khashoggi is vying for the honor alongside families whom Trump separated at the U.S. border in a bid to halt future illegal immigration; the director of this year's acclaimed Black Panther movie, Ryan Coogler; Special Counsel Robert Mueller, and Christine Blasey Ford, who brought sexual assault allegations against Trump's second pick for the U.S. Supreme Court.
2019-04-21T12:09:15
https://www.aa.com.tr/en/jamal-khashoggi/khashoggi-on-time-person-of-the-year-shortlist/1334924
Sometimes skip-to-next-keyframe engages when we don't need it to; when if we just kept decoding a bit more, we'd be able to play all or at least more frames. We tend to engage skip-to-next-keyframe more eagerly when switching streams, or exiting buffering. I'm not referring to what to do when the CPU/decoder is too slow to decode a video... There's not a lot we can do to win in that situation. For fragmented files (only) Have MP4Reader ignore the aSkipToNextKeyframe flag and instead only skip if the current playback position is behind the next keyframe. This means we'll only drop frames that we can't actually play. Since this requires knowledge of where the next keyframe is, it's not generalizable to other Readers, like the WebM and Ogg Readers, until their demuxers are changed to allow that to be exported. So this change only has affect for the MP4Reader while using the MoofParser. A gtest. We can't land this until bug 1118593 is fixed, as MP4Demuxer::GetNextKeyframeTime() only works if we're using the MoofParser's SampleIterator, and we don't do that for CENC encrypted content since that fails on some files. Will follow up with the gtest patch once edwin lands bug 1118597 (I meant bug 1118597 instead of bug 1118593 in comment 2). ni? cpearce so I don't forget to land the test. ni? rillian so we don't forget to uplift. Requesting approval for this patch only. [User impact if declined]: Video playback stalls on slower systems. [Describe test coverage new/current, TBPL]: green on inbound. [Risks and why]: This affects non-MSE mp4 playback. The main risk is that the new heuristic will play a sequence of still frames when it would have previously played smooth video. Attachment #8551533 - Flags: approval-mozilla-beta? Attachment #8551533 - Flags: approval-mozilla-aurora? > bug 1118597 instead of bug 1118593 in comment 2). > ni? cpearce so I don't forget to land the test. Backed out for checktest failures.
2019-04-19T20:02:49
https://bugzilla.mozilla.org/show_bug.cgi?id=1123498
We had another attempt at fixing the fire this morning, and had more success than the first time (although still smoking out the cabin). But the biggest adventure was the loo. Since we’re in the middle of nowhere, the toilets are literally outhouses, and other members of the tour had freaked everyone out the night before by telling us a story about a girl who’d gone to an outhouse in Africa during the night, only to have the floor cave in and get trapped neck deep in waste and insects all night. Not helped by the fact that the floors had cracks in them – one toilet with a rather thick crack was avoided by the majority because of it. However, 2 of our group got up early to walk up the mountain for sunrise. When they left, I looked out the door and just stared at what I could see. That sunrise made coming to the camp totally worth it. Breakfast was included these 2 nights, so for the first time in weeks we had a hot meal in the morning. There was fried egg, sausage and some other kind of flat meat I didn’t recognise, along with tea, bread and rolls (getting used to drinking tea without milk now). Another Vodkatrain group had arrived that morning too, so the place had gotten a little more active. We’d also come across another dog, a male black beast we nicknamed ‘Big Daddy’. The tour had promised Mongolian winter games, but surprise surprise, there wasn’t enough snow – so the sledges were back in storage (we’ve really had no luck with the winter part of this tour, really annoying since that was the biggest draw of this trip – and even more annoying since the other cheaper tour DID get to go dog sledding a mere DAY after we left). Instead, since we’d meant to do it yesterday but run out of time, we spent the early morning doing archery. The Mongolian bow has less attachments than a western bow. You have to guess where the arrow goes rather than having any ledge to set the arrow. You also don’t really aim as we were trained to fire the bow up in the air rather than at any form of target. Made even harder by the fact that the sun was in our eyes due to the time of day. Afterwards, we played a form of charades where we just had to come up with a word for the other team to guess. Sadly our team lost (I just couldn’t get my team to understand ‘condo’ while the other team (the couple and the marrieds, managed to steamroll through ‘platypus’, ‘telephone pole’ and ‘ladybug’ – though did get scuppered with ‘instant mash’ and ‘elderberry’. As the losers, we were the four in charge of cutting up the meat during our Mongolian Cooking Class where we’d be making dumplings. Worked out pretty well since the two veggies were in the team making the dough. The ingredients for making dumplings was pretty simple – dough is just flour and water, folded together and pounded into a solid, while the meat was a lot harder. You have to slice the meat into thin strips then dice it into small pieces. The guy in our group was the best by far for our team, while I just could not get a handle on it at all. The meat is too floppy and I have no wrist strength. You then chop up an onion and some garlic, and you’ve got your filling (the veggies got soy meat instead). Once the fillings are ready, you take chunk of dough and roll it into a thin tube, then cut it into small sausage roll sized cunks. Then hold it by your left hand, roll the pin towards said hand, and swing the dough around until you’ve gone round the whole edge and left a slightly thicker piece in the middle. This is where you pile on the filling before you take one edge, and press it into the opposite side until you’ve gone round completely. Sadly the closing part was the one aspect I could not master. I was great at rolling, and pretty good at calculating how much to put in, but closing them just did not work work out. I can just about close a gyoza, but those were the shape we were using for the veggie dumplings, so couldn’t use it for the meat. So mine ended up looking like sacks rather than dumplings, and Vogy had a good giggle at my attempts before they were taken to be steamed for 20 minutes. This was where my biggest peeve of the Ger Camp happened. I accepted that the lack of snow is not something we can help – its been an abnormally warm winter for the Northern Hemisphere and Vodkatrain warns you in advance the extra activities are weather permitting. However, while the Mongolian Cooking Class is included in the Ruski Huski – lunch is not. Meaning that although we prepared the dumplings, we had to pay to eat them. Wasn’t much admittedly, but it seemed rather cheap to make us pay for something we’d already pre-paid to make. Dumplings were still very good though. And once we’d eaten, we set off to go visit the nomadic woman we’d brought chocolates for. She lived about 15 minutes away in her own Ger in the park. Sadly I never quite caught her name, but she’s lived in this Ger for about 20 years, and used to teach Mongolian literature at college. She raised 8 children and nowadays, spends her time milking her cows, making dairy products and sewing traditional dress for herself. Her Ger was beautiful, and much more like how I expected. All the furniture has a beautiful pattern, and there’s a tiny kitchen and a TV in the corners. Gers are interesting things in that they are completely portable. It usually takes a day to move one – and for building it, you first put in a floor, the door, wall supports and middle posts, and the central roof circle. Then you put in the larger pieces of furniture, and then the 80 or so roof supports. Then its the fabric on the wall and roof, and the waterproofing outside. When you want to move, you have to register where you want to go at the government office, who will register the land to you. People normally have 2 places – one for the summer and one for the winter, and move between them depending on the weather and what their herd needs. We also got to try some of the dairy products that Mongolians spend the summer making. This included a type of doughnutty bread that was pretty nice, cheese that was very bland (like solid sour cream), curds (which were very hard and very strong) and some weird fudge-like substance that tasted like cheese and cream and was avoided by most of us as a whole. She was very interested in us as well, and asked about our families and jobs, and where we came from. I really wish I’d thought to bring something Scottish with me to give her. Also spotted the other Vodkatrain group performing our next activity. Horse Riding. Yes, again. Although considering these were Mongolian horses, it was pretty clear this was going to be a little bit different from the last time. For one thing they were smaller (some of the guys looked plain ridiculous on the backs until the stirrups were adjusted), and felt a lot sturdier. We also had to wear extra footwear for protection. And we got a very firm warning as to how tempermental these horses could be when 2 minutes into our trek one bucked its local rider off and dragged him 20 foot down the road. That said, it was a lot more fun than the previous horse riding. I felt more comfortable on the smaller horse, although I was pretty certain it was following my directions even less than the previous one had. It only ever seemed to follow through on actions if the locals were around nearby. But did get to trot for a good chunk of the time on flat ground. I wasn’t having dinner on the grounds that I was still full from the dumplings, but afterwards Vogy showed both us and the other group a video of other places in Mongolia we hadn’t seen, including the Ghobi Desert and a lake to flows into Lake Baikal. Definitely going to have to come back here at some point to see that lake and trek the desert. And this night our group had success with the fire, so we had a warm night for once! Although despite this, we ended up in the other groups ger for some time for a mini party. They also snuck in Big Daddy, who was clearly reluctant to go in (don’t think he’s meant to get in the gers) but also wouldn’t leave once he was in. This entry was posted in Diary, Vodkatrain and tagged Ger Camp, Mongolia, Ruski Huski, Terelj National Park, trans-siberian express, Vodkatrain. Bookmark the permalink.
2019-04-20T07:15:32
https://thelogpose.wordpress.com/2013/11/20/19th-november-ruski-huski-tour-day-12-ger-camp/
Following the spring visit of my stocks I put on sale this rare dial "VOLTAIRE" accompanied by his needles. - This dial manufactured under license YEMA France was reserved in 1969 to the international market and especially the United States. It’s in fact a Superman dial reserved for export as Yema practiced it with its under brand "LE JOUR". It's a dial with date in perfect condition, New Old Stock (NOS) never used, whose gray brushed color varies from" mouse gray" to "anthracite gray "depending on the light! The tritium indexes are beautiful with a superb green water color without lack. Suitable for Yema powered by an ETA 2782/2783. - The needles are a little less flamboyant and require, for the Minute needle (Arrowhead), a partial tritium filling , work who can easily be done by any good vintage watchmaker, to be perfect. Same destination: Superman with ETA 2782/2783. Note the presence of the searched ad rare second hand type "LOLIPOP". My asking price of 450 € include: Dial, Needles and shipping everywhere in the world. Opportunity to sell separately dial and needles but priority will be given to a sale of the lot. Paypal is ok but only “ Between Friends" or bank wire. Spare parts are located in France.
2019-04-18T23:20:50
http://chronocentric.com/forums/chronotrader/index.cgi?md=read;id=88275