modelId stringlengths 4 111 | lastModified stringlengths 24 24 | tags list | pipeline_tag stringlengths 5 30 ⌀ | author stringlengths 2 34 ⌀ | config null | securityStatus null | id stringlengths 4 111 | likes int64 0 9.53k | downloads int64 2 73.6M | library_name stringlengths 2 84 ⌀ | created timestamp[us] | card stringlengths 101 901k | card_len int64 101 901k | embeddings list |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
timm/beit_large_patch16_224.in22k_ft_in22k_in1k | 2023-05-08T23:26:01.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"dataset:imagenet-22k",
"arxiv:2106.08254",
"arxiv:2010.11929",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/beit_large_patch16_224.in22k_ft_in22k_in1k | 0 | 931 | timm | 2022-12-23T02:28:05 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
- imagenet-22k
---
# Model card for beit_large_patch16_224.in22k_ft_in22k_in1k
A BEiT image classification model. Trained on ImageNet-22k with self-supervised masked image modelling (MIM) using a DALL-E dVAE as visual tokenizer. Fine-tuned on ImageNet-22k and then ImageNet-1k.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 304.4
- GMACs: 61.6
- Activations (M): 63.5
- Image size: 224 x 224
- **Papers:**
- BEiT: BERT Pre-Training of Image Transformers: https://arxiv.org/abs/2106.08254
- An Image is Worth 16x16 Words: Transformers for Image Recognition at Scale: https://arxiv.org/abs/2010.11929v2
- **Dataset:** ImageNet-1k
- **Pretrain Dataset:** ImageNet-22k
- **Original:** https://github.com/microsoft/unilm/tree/master/beit
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('beit_large_patch16_224.in22k_ft_in22k_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'beit_large_patch16_224.in22k_ft_in22k_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 197, 1024) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@article{bao2021beit,
title={Beit: Bert pre-training of image transformers},
author={Bao, Hangbo and Dong, Li and Piao, Songhao and Wei, Furu},
journal={arXiv preprint arXiv:2106.08254},
year={2021}
}
```
```bibtex
@article{dosovitskiy2020vit,
title={An Image is Worth 16x16 Words: Transformers for Image Recognition at Scale},
author={Dosovitskiy, Alexey and Beyer, Lucas and Kolesnikov, Alexander and Weissenborn, Dirk and Zhai, Xiaohua and Unterthiner, Thomas and Dehghani, Mostafa and Minderer, Matthias and Heigold, Georg and Gelly, Sylvain and Uszkoreit, Jakob and Houlsby, Neil},
journal={ICLR},
year={2021}
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
| 3,739 | [
[
-0.043670654296875,
-0.026397705078125,
0.001392364501953125,
0.0128021240234375,
-0.03155517578125,
-0.0186004638671875,
-0.018768310546875,
-0.039337158203125,
0.01837158203125,
0.027496337890625,
-0.04266357421875,
-0.048553466796875,
-0.056549072265625,
... |
proximasanfinetuning/fantassified_icons_v2 | 2023-06-08T19:26:22.000Z | [
"diffusers",
"text-to-image",
"stable-diffusion",
"finetune",
"icons",
"art",
"en",
"license:other",
"endpoints_compatible",
"has_space",
"diffusers:StableDiffusionPipeline",
"region:us"
] | text-to-image | proximasanfinetuning | null | null | proximasanfinetuning/fantassified_icons_v2 | 36 | 931 | diffusers | 2023-05-10T22:35:57 | ---
license: other
tags:
- text-to-image
- stable-diffusion
- finetune
- icons
- art
language:
- en
---
## new and shiny 。・:*:・゚’☆
[<img src="https://huggingface.co/proximasanfinetuning/fantassified_icons_v2/resolve/main/animatedicons.gif">](https://huggingface.co/proximasanfinetuning/fantassified_icons_v2/blob/main/animatedicons.gif)
# about
- updated version of [v1](https://huggingface.co/proxima/fantassified_icons), made with a dataset consisting of mostly the old version's dataset, but it's a lot better because I learned a few things since the dreambooth days
- generates icons inspired by fantasy games with mostly plain backgrounds
- no trigger words
- either my local hires fix isn't working well or potions look weird when hires is turned on, will have to test that another time (probably needs low denoising strength)
- i don't recommend this for people and faces as these were of 0% concern while training, the focus was on items, but you do you
- examples are [made with this VAE](https://huggingface.co/stabilityai/sd-vae-ft-mse-original/blob/main/vae-ft-mse-840000-ema-pruned.ckpt) at 20 steps, 512x512, CFG 7, Euler a (try DPM ++2M for a look that is a bit sharper)
---
## examples
[<img src="https://huggingface.co/proximasanfinetuning/fantassified_icons_v2/resolve/main/examples/1-3.png">](https://huggingface.co/proximasanfinetuning/fantassified_icons_v2/blob/main/examples/1-3.png)
[<img src="https://huggingface.co/proximasanfinetuning/fantassified_icons_v2/resolve/main/examples/4-6.png">](https://huggingface.co/proximasanfinetuning/fantassified_icons_v2/blob/main/examples/4-6.png)
[<img src="https://huggingface.co/proximasanfinetuning/fantassified_icons_v2/resolve/main/examples/7-9.png">](https://huggingface.co/proximasanfinetuning/fantassified_icons_v2/blob/main/examples/7-9.png)
---
if you enjoy this consider buying me a coffee (ノ◕ヮ◕)ノ*:・゚✧
<a href='https://ko-fi.com/S6S6FUYKY' target='_blank'><img height='36' style='border:0px;height:36px;' src='https://storage.ko-fi.com/cdn/kofi3.png?v=3' border='0' alt='Buy Me a Coffee at ko-fi.com' /></a>
----
## Use with diffusers
How to use it with [diffusers](https://github.com/huggingface/diffusers)
```python
import torch
from diffusers import StableDiffusionPipeline, DDIMScheduler
scheduler = DDIMScheduler.from_pretrained("proximasanfinetuning/fantassified_icons_v2", subfolder="scheduler")
pipe = StableDiffusionPipeline.from_pretrained("proximasanfinetuning/fantassified_icons_v2", scheduler=scheduler).to("cuda")
prompt = "A lemon themed high quality hamburger"
images = pipe(prompt, num_images_per_prompt=6, num_inference_steps=25).images
images[0]
```
---
# license
This model is licensed under a modified CreativeML OpenRAIL-M license.
* Utilizing and hosting the Fantassified Icons 1.0 model and its derivatives on platforms that earn, will earn, or plan to earn revenue or donations requires prior authorization. **To request permission, please email proximasan@protonmail.com.**
* You are permitted to host the model card and files on both commercial and non-commercial websites, apps, etc. as long as you properly credit the model by stating its full name and providing a link to the model card (https://huggingface.co/proximasanfinetuning/fantassified_icons_v2), without performing any actual inference or finetuning.
* The Fantassified Icons 1.0 model and its derivatives can be hosted on non-commercial websites, apps, etc. as long as no revenue or donations are received. Proper credit must be given by stating the full model name and including a link to the model card (https://huggingface.co/proximasanfinetuning/fantassified_icons_v2).
* **The outputs of the model or its derivatives can be used for commercial purposes as long as the usage is limited to teams of 10 or fewer individuals.**
* You can't use the model to deliberately produce nor share illegal or harmful outputs or content
* The authors claims no rights on the outputs you generate, you are free to use them and are accountable for their use which must not go against the provisions set in the license
* You may re-distribute the weights. If you do, please be aware you have to include the same use restrictions as the ones in the license and share a copy of the modified CreativeML OpenRAIL-M to all your users (please read the license entirely and carefully) Please read the full license here: https://huggingface.co/proximasanfinetuning/fantassified_icons_v2/blob/main/license.txt | 4,472 | [
[
-0.046783447265625,
-0.0264129638671875,
0.00609588623046875,
0.0304718017578125,
-0.020751953125,
-0.01451873779296875,
-0.0009026527404785156,
-0.04541015625,
0.06561279296875,
0.0308837890625,
-0.06732177734375,
-0.0284271240234375,
-0.037841796875,
0.010... |
Helsinki-NLP/opus-mt-st-en | 2023-08-16T12:04:36.000Z | [
"transformers",
"pytorch",
"tf",
"marian",
"text2text-generation",
"translation",
"st",
"en",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | translation | Helsinki-NLP | null | null | Helsinki-NLP/opus-mt-st-en | 0 | 930 | transformers | 2022-03-02T23:29:04 | ---
tags:
- translation
license: apache-2.0
---
### opus-mt-st-en
* source languages: st
* target languages: en
* OPUS readme: [st-en](https://github.com/Helsinki-NLP/OPUS-MT-train/blob/master/models/st-en/README.md)
* dataset: opus
* model: transformer-align
* pre-processing: normalization + SentencePiece
* download original weights: [opus-2020-01-16.zip](https://object.pouta.csc.fi/OPUS-MT-models/st-en/opus-2020-01-16.zip)
* test set translations: [opus-2020-01-16.test.txt](https://object.pouta.csc.fi/OPUS-MT-models/st-en/opus-2020-01-16.test.txt)
* test set scores: [opus-2020-01-16.eval.txt](https://object.pouta.csc.fi/OPUS-MT-models/st-en/opus-2020-01-16.eval.txt)
## Benchmarks
| testset | BLEU | chr-F |
|-----------------------|-------|-------|
| JW300.st.en | 45.7 | 0.609 |
| 816 | [
[
-0.0157012939453125,
-0.034027099609375,
0.0214080810546875,
0.0298309326171875,
-0.03472900390625,
-0.0250244140625,
-0.03753662109375,
-0.0106353759765625,
0.002227783203125,
0.0343017578125,
-0.05120849609375,
-0.0426025390625,
-0.0465087890625,
0.0165557... |
timm/convnext_large.fb_in1k | 2023-03-31T22:06:28.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"arxiv:2201.03545",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/convnext_large.fb_in1k | 0 | 930 | timm | 2022-12-13T07:08:36 | ---
tags:
- image-classification
- timm
library_tag: timm
license: apache-2.0
datasets:
- imagenet-1k
---
# Model card for convnext_large.fb_in1k
A ConvNeXt image classification model. Pretrained on ImageNet-1k by paper authors.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 197.8
- GMACs: 34.4
- Activations (M): 43.1
- Image size: train = 224 x 224, test = 288 x 288
- **Papers:**
- A ConvNet for the 2020s: https://arxiv.org/abs/2201.03545
- **Original:** https://github.com/facebookresearch/ConvNeXt
- **Dataset:** ImageNet-1k
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('convnext_large.fb_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'convnext_large.fb_in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 192, 56, 56])
# torch.Size([1, 384, 28, 28])
# torch.Size([1, 768, 14, 14])
# torch.Size([1, 1536, 7, 7])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'convnext_large.fb_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 1536, 7, 7) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
All timing numbers from eager model PyTorch 1.13 on RTX 3090 w/ AMP.
| model |top1 |top5 |img_size|param_count|gmacs |macts |samples_per_sec|batch_size|
|------------------------------------------------------------------------------------------------------------------------------|------|------|--------|-----------|------|------|---------------|----------|
| [convnextv2_huge.fcmae_ft_in22k_in1k_512](https://huggingface.co/timm/convnextv2_huge.fcmae_ft_in22k_in1k_512) |88.848|98.742|512 |660.29 |600.81|413.07|28.58 |48 |
| [convnextv2_huge.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_huge.fcmae_ft_in22k_in1k_384) |88.668|98.738|384 |660.29 |337.96|232.35|50.56 |64 |
| [convnext_xxlarge.clip_laion2b_soup_ft_in1k](https://huggingface.co/timm/convnext_xxlarge.clip_laion2b_soup_ft_in1k) |88.612|98.704|256 |846.47 |198.09|124.45|122.45 |256 |
| [convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_384](https://huggingface.co/timm/convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_384) |88.312|98.578|384 |200.13 |101.11|126.74|196.84 |256 |
| [convnextv2_large.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_large.fcmae_ft_in22k_in1k_384) |88.196|98.532|384 |197.96 |101.1 |126.74|128.94 |128 |
| [convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_320](https://huggingface.co/timm/convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_320) |87.968|98.47 |320 |200.13 |70.21 |88.02 |283.42 |256 |
| [convnext_xlarge.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_xlarge.fb_in22k_ft_in1k_384) |87.75 |98.556|384 |350.2 |179.2 |168.99|124.85 |192 |
| [convnextv2_base.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_base.fcmae_ft_in22k_in1k_384) |87.646|98.422|384 |88.72 |45.21 |84.49 |209.51 |256 |
| [convnext_large.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_large.fb_in22k_ft_in1k_384) |87.476|98.382|384 |197.77 |101.1 |126.74|194.66 |256 |
| [convnext_large_mlp.clip_laion2b_augreg_ft_in1k](https://huggingface.co/timm/convnext_large_mlp.clip_laion2b_augreg_ft_in1k) |87.344|98.218|256 |200.13 |44.94 |56.33 |438.08 |256 |
| [convnextv2_large.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_large.fcmae_ft_in22k_in1k) |87.26 |98.248|224 |197.96 |34.4 |43.13 |376.84 |256 |
| [convnext_base.clip_laion2b_augreg_ft_in12k_in1k_384](https://huggingface.co/timm/convnext_base.clip_laion2b_augreg_ft_in12k_in1k_384) |87.138|98.212|384 |88.59 |45.21 |84.49 |365.47 |256 |
| [convnext_xlarge.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_xlarge.fb_in22k_ft_in1k) |87.002|98.208|224 |350.2 |60.98 |57.5 |368.01 |256 |
| [convnext_base.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_base.fb_in22k_ft_in1k_384) |86.796|98.264|384 |88.59 |45.21 |84.49 |366.54 |256 |
| [convnextv2_base.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_base.fcmae_ft_in22k_in1k) |86.74 |98.022|224 |88.72 |15.38 |28.75 |624.23 |256 |
| [convnext_large.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_large.fb_in22k_ft_in1k) |86.636|98.028|224 |197.77 |34.4 |43.13 |581.43 |256 |
| [convnext_base.clip_laiona_augreg_ft_in1k_384](https://huggingface.co/timm/convnext_base.clip_laiona_augreg_ft_in1k_384) |86.504|97.97 |384 |88.59 |45.21 |84.49 |368.14 |256 |
| [convnext_base.clip_laion2b_augreg_ft_in12k_in1k](https://huggingface.co/timm/convnext_base.clip_laion2b_augreg_ft_in12k_in1k) |86.344|97.97 |256 |88.59 |20.09 |37.55 |816.14 |256 |
| [convnextv2_huge.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_huge.fcmae_ft_in1k) |86.256|97.75 |224 |660.29 |115.0 |79.07 |154.72 |256 |
| [convnext_small.in12k_ft_in1k_384](https://huggingface.co/timm/convnext_small.in12k_ft_in1k_384) |86.182|97.92 |384 |50.22 |25.58 |63.37 |516.19 |256 |
| [convnext_base.clip_laion2b_augreg_ft_in1k](https://huggingface.co/timm/convnext_base.clip_laion2b_augreg_ft_in1k) |86.154|97.68 |256 |88.59 |20.09 |37.55 |819.86 |256 |
| [convnext_base.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_base.fb_in22k_ft_in1k) |85.822|97.866|224 |88.59 |15.38 |28.75 |1037.66 |256 |
| [convnext_small.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_small.fb_in22k_ft_in1k_384) |85.778|97.886|384 |50.22 |25.58 |63.37 |518.95 |256 |
| [convnextv2_large.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_large.fcmae_ft_in1k) |85.742|97.584|224 |197.96 |34.4 |43.13 |375.23 |256 |
| [convnext_small.in12k_ft_in1k](https://huggingface.co/timm/convnext_small.in12k_ft_in1k) |85.174|97.506|224 |50.22 |8.71 |21.56 |1474.31 |256 |
| [convnext_tiny.in12k_ft_in1k_384](https://huggingface.co/timm/convnext_tiny.in12k_ft_in1k_384) |85.118|97.608|384 |28.59 |13.14 |39.48 |856.76 |256 |
| [convnextv2_tiny.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_tiny.fcmae_ft_in22k_in1k_384) |85.112|97.63 |384 |28.64 |13.14 |39.48 |491.32 |256 |
| [convnextv2_base.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_base.fcmae_ft_in1k) |84.874|97.09 |224 |88.72 |15.38 |28.75 |625.33 |256 |
| [convnext_small.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_small.fb_in22k_ft_in1k) |84.562|97.394|224 |50.22 |8.71 |21.56 |1478.29 |256 |
| [convnext_large.fb_in1k](https://huggingface.co/timm/convnext_large.fb_in1k) |84.282|96.892|224 |197.77 |34.4 |43.13 |584.28 |256 |
| [convnext_tiny.in12k_ft_in1k](https://huggingface.co/timm/convnext_tiny.in12k_ft_in1k) |84.186|97.124|224 |28.59 |4.47 |13.44 |2433.7 |256 |
| [convnext_tiny.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_tiny.fb_in22k_ft_in1k_384) |84.084|97.14 |384 |28.59 |13.14 |39.48 |862.95 |256 |
| [convnextv2_tiny.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_tiny.fcmae_ft_in22k_in1k) |83.894|96.964|224 |28.64 |4.47 |13.44 |1452.72 |256 |
| [convnext_base.fb_in1k](https://huggingface.co/timm/convnext_base.fb_in1k) |83.82 |96.746|224 |88.59 |15.38 |28.75 |1054.0 |256 |
| [convnextv2_nano.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_nano.fcmae_ft_in22k_in1k_384) |83.37 |96.742|384 |15.62 |7.22 |24.61 |801.72 |256 |
| [convnext_small.fb_in1k](https://huggingface.co/timm/convnext_small.fb_in1k) |83.142|96.434|224 |50.22 |8.71 |21.56 |1464.0 |256 |
| [convnextv2_tiny.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_tiny.fcmae_ft_in1k) |82.92 |96.284|224 |28.64 |4.47 |13.44 |1425.62 |256 |
| [convnext_tiny.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_tiny.fb_in22k_ft_in1k) |82.898|96.616|224 |28.59 |4.47 |13.44 |2480.88 |256 |
| [convnext_nano.in12k_ft_in1k](https://huggingface.co/timm/convnext_nano.in12k_ft_in1k) |82.282|96.344|224 |15.59 |2.46 |8.37 |3926.52 |256 |
| [convnext_tiny_hnf.a2h_in1k](https://huggingface.co/timm/convnext_tiny_hnf.a2h_in1k) |82.216|95.852|224 |28.59 |4.47 |13.44 |2529.75 |256 |
| [convnext_tiny.fb_in1k](https://huggingface.co/timm/convnext_tiny.fb_in1k) |82.066|95.854|224 |28.59 |4.47 |13.44 |2346.26 |256 |
| [convnextv2_nano.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_nano.fcmae_ft_in22k_in1k) |82.03 |96.166|224 |15.62 |2.46 |8.37 |2300.18 |256 |
| [convnextv2_nano.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_nano.fcmae_ft_in1k) |81.83 |95.738|224 |15.62 |2.46 |8.37 |2321.48 |256 |
| [convnext_nano_ols.d1h_in1k](https://huggingface.co/timm/convnext_nano_ols.d1h_in1k) |80.866|95.246|224 |15.65 |2.65 |9.38 |3523.85 |256 |
| [convnext_nano.d1h_in1k](https://huggingface.co/timm/convnext_nano.d1h_in1k) |80.768|95.334|224 |15.59 |2.46 |8.37 |3915.58 |256 |
| [convnextv2_pico.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_pico.fcmae_ft_in1k) |80.304|95.072|224 |9.07 |1.37 |6.1 |3274.57 |256 |
| [convnext_pico.d1_in1k](https://huggingface.co/timm/convnext_pico.d1_in1k) |79.526|94.558|224 |9.05 |1.37 |6.1 |5686.88 |256 |
| [convnext_pico_ols.d1_in1k](https://huggingface.co/timm/convnext_pico_ols.d1_in1k) |79.522|94.692|224 |9.06 |1.43 |6.5 |5422.46 |256 |
| [convnextv2_femto.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_femto.fcmae_ft_in1k) |78.488|93.98 |224 |5.23 |0.79 |4.57 |4264.2 |256 |
| [convnext_femto_ols.d1_in1k](https://huggingface.co/timm/convnext_femto_ols.d1_in1k) |77.86 |93.83 |224 |5.23 |0.82 |4.87 |6910.6 |256 |
| [convnext_femto.d1_in1k](https://huggingface.co/timm/convnext_femto.d1_in1k) |77.454|93.68 |224 |5.22 |0.79 |4.57 |7189.92 |256 |
| [convnextv2_atto.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_atto.fcmae_ft_in1k) |76.664|93.044|224 |3.71 |0.55 |3.81 |4728.91 |256 |
| [convnext_atto_ols.a2_in1k](https://huggingface.co/timm/convnext_atto_ols.a2_in1k) |75.88 |92.846|224 |3.7 |0.58 |4.11 |7963.16 |256 |
| [convnext_atto.d2_in1k](https://huggingface.co/timm/convnext_atto.d2_in1k) |75.664|92.9 |224 |3.7 |0.55 |3.81 |8439.22 |256 |
## Citation
```bibtex
@article{liu2022convnet,
author = {Zhuang Liu and Hanzi Mao and Chao-Yuan Wu and Christoph Feichtenhofer and Trevor Darrell and Saining Xie},
title = {A ConvNet for the 2020s},
journal = {Proceedings of the IEEE/CVF Conference on Computer Vision and Pattern Recognition (CVPR)},
year = {2022},
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
| 15,624 | [
[
-0.0670166015625,
-0.033233642578125,
-0.003299713134765625,
0.03839111328125,
-0.0322265625,
-0.01544952392578125,
-0.01273345947265625,
-0.034698486328125,
0.0662841796875,
0.017425537109375,
-0.044097900390625,
-0.04248046875,
-0.05078125,
-0.002906799316... |
seeklhy/codes-1b | 2023-09-04T12:36:59.000Z | [
"transformers",
"pytorch",
"gpt_bigcode",
"text-generation",
"SQL generation",
"Text-to-SQL",
"text2sql",
"sql",
"code",
"license:apache-2.0",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] | text-generation | seeklhy | null | null | seeklhy/codes-1b | 0 | 930 | transformers | 2023-08-27T09:11:37 | ---
language:
- sql
- code
tags:
- SQL generation
- Text-to-SQL
- text2sql
license: "apache-2.0"
---
# CodeS-1B
CodeS is a series of Code LLMs specifically optimized for SQL generation.
The CodeS encompasses 1B, 3B, 7B, and 15B scales. CodeS-1B, 3B, and 7B are incrementally pre-trained on the top of StarCoderBase-1B, 3B, and 7B and support the max length of 8,192. Meanwhile, CodeS-15B, derived from StarCoder-15B, accommodates sequences of up to 6,144 tokens.
We have demonstrated that CodeS achieves new state-of-the-art performance on two challenging Text-to-SQL benchmarks: Spider and Bird.
For more details about how to use CodeS, please refer to our GitHub page: https://github.com/RUCKBReasoning/codes.
(This is the repository of CodeS-1B.)
| 758 | [
[
-0.044403076171875,
-0.04010009765625,
0.0121917724609375,
0.055908203125,
-0.037994384765625,
0.0171661376953125,
0.0013408660888671875,
-0.0218963623046875,
0.019073486328125,
0.052001953125,
-0.05548095703125,
-0.026336669921875,
-0.028076171875,
0.045196... |
Helsinki-NLP/opus-mt-ru-es | 2023-08-16T12:03:24.000Z | [
"transformers",
"pytorch",
"tf",
"marian",
"text2text-generation",
"translation",
"ru",
"es",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | translation | Helsinki-NLP | null | null | Helsinki-NLP/opus-mt-ru-es | 2 | 929 | transformers | 2022-03-02T23:29:04 | ---
tags:
- translation
license: apache-2.0
---
### opus-mt-ru-es
* source languages: ru
* target languages: es
* OPUS readme: [ru-es](https://github.com/Helsinki-NLP/OPUS-MT-train/blob/master/models/ru-es/README.md)
* dataset: opus
* model: transformer-align
* pre-processing: normalization + SentencePiece
* download original weights: [opus-2020-01-21.zip](https://object.pouta.csc.fi/OPUS-MT-models/ru-es/opus-2020-01-21.zip)
* test set translations: [opus-2020-01-21.test.txt](https://object.pouta.csc.fi/OPUS-MT-models/ru-es/opus-2020-01-21.test.txt)
* test set scores: [opus-2020-01-21.eval.txt](https://object.pouta.csc.fi/OPUS-MT-models/ru-es/opus-2020-01-21.eval.txt)
## Benchmarks
| testset | BLEU | chr-F |
|-----------------------|-------|-------|
| newstest2012.ru.es | 26.1 | 0.527 |
| newstest2013.ru.es | 28.2 | 0.538 |
| Tatoeba.ru.es | 49.4 | 0.675 |
| 898 | [
[
-0.016815185546875,
-0.0299224853515625,
0.0211639404296875,
0.026092529296875,
-0.0257720947265625,
-0.0240936279296875,
-0.0316162109375,
-0.00830841064453125,
0.0043792724609375,
0.024322509765625,
-0.056884765625,
-0.040069580078125,
-0.04339599609375,
0... |
Yntec/Reanimate | 2023-11-05T16:23:36.000Z | [
"diffusers",
"Anime",
"Art",
"Illustration",
"Cartoon",
"XpucT",
"s6yx",
"stable-diffusion",
"stable-diffusion-diffusers",
"text-to-image",
"license:other",
"endpoints_compatible",
"diffusers:StableDiffusionPipeline",
"region:us",
"has_space"
] | text-to-image | Yntec | null | null | Yntec/Reanimate | 0 | 929 | diffusers | 2023-11-05T15:11:52 | ---
license: other
library_name: diffusers
pipeline_tag: text-to-image
tags:
- Anime
- Art
- Illustration
- Cartoon
- XpucT
- s6yx
- stable-diffusion
- stable-diffusion-diffusers
- text-to-image
- diffusers
---
# Reanimate
A mix of ReVAnimated by s6yx and Deliberate by XpucT to bring my favorite things from those models together! The zVAE is baked in.
Comparison

(Click for larger)
Sample and prompt:

masterpiece,best quality, retro artstyle, a cute little witch's prophecy comes true, logo, 1980s /style/, cover
# Recipe:
- SuperMerger Weight sum Train Difference Use MBW 1,0,0,0,0,0,0,0,0,1,0,0,1,0,1,1,1,1,1,1,1,0,1,1,0,1
Model A:
Deliberate
Model B:
ReVAnimated
Output Model:
Reanimate
- Bake zVAE
Output Model:
ReanimateVAE | 1,005 | [
[
-0.021759033203125,
-0.009429931640625,
0.0230712890625,
0.00627899169921875,
-0.0231781005859375,
0.0009036064147949219,
0.0267333984375,
-0.0122833251953125,
0.0723876953125,
0.0672607421875,
-0.08843994140625,
-0.019866943359375,
-0.01465606689453125,
-0.... |
lvwerra/pegasus-samsum | 2021-10-25T14:57:33.000Z | [
"transformers",
"pytorch",
"tensorboard",
"pegasus",
"text2text-generation",
"generated_from_trainer",
"dataset:samsum",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | text2text-generation | lvwerra | null | null | lvwerra/pegasus-samsum | 2 | 928 | transformers | 2022-03-02T23:29:05 | ---
tags:
- generated_from_trainer
datasets:
- samsum
model-index:
- name: pegasus-samsum
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# pegasus-samsum
This model is a fine-tuned version of [google/pegasus-cnn_dailymail](https://huggingface.co/google/pegasus-cnn_dailymail) on the samsum dataset.
It achieves the following results on the evaluation set:
- Loss: 1.4177
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 5e-05
- train_batch_size: 1
- eval_batch_size: 1
- seed: 42
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: linear
- lr_scheduler_warmup_steps: 500
- num_epochs: 0.4
### Training results
| Training Loss | Epoch | Step | Validation Loss |
|:-------------:|:-----:|:----:|:---------------:|
| 1.6092 | 0.03 | 500 | 1.6488 |
| 1.9715 | 0.07 | 1000 | 1.5444 |
| 1.8325 | 0.1 | 1500 | 1.5093 |
| 1.876 | 0.14 | 2000 | 1.4890 |
| 1.3081 | 0.17 | 2500 | 1.4737 |
| 1.7769 | 0.2 | 3000 | 1.4496 |
| 1.6276 | 0.24 | 3500 | 1.4430 |
| 1.6624 | 0.27 | 4000 | 1.4288 |
| 1.9202 | 0.31 | 4500 | 1.4235 |
| 1.4404 | 0.34 | 5000 | 1.4189 |
| 1.8016 | 0.37 | 5500 | 1.4177 |
### Framework versions
- Transformers 4.12.0.dev0
- Pytorch 1.9.1+cu102
- Datasets 1.12.1
- Tokenizers 0.10.3
| 1,819 | [
[
-0.035980224609375,
-0.031494140625,
0.0019330978393554688,
0.0029010772705078125,
-0.03216552734375,
-0.036773681640625,
-0.005615234375,
-0.01361083984375,
0.026641845703125,
0.0280609130859375,
-0.0625,
-0.048309326171875,
-0.06121826171875,
-0.0147552490... |
IDEA-CCNL/Randeng-Pegasus-523M-Summary-Chinese-V1 | 2023-04-06T06:14:02.000Z | [
"transformers",
"pytorch",
"pegasus",
"text2text-generation",
"summarization",
"chinese",
"zh",
"arxiv:1912.08777",
"arxiv:2209.02970",
"autotrain_compatible",
"region:us"
] | summarization | IDEA-CCNL | null | null | IDEA-CCNL/Randeng-Pegasus-523M-Summary-Chinese-V1 | 4 | 928 | transformers | 2023-01-13T09:21:54 | ---
language: zh
tags:
- summarization
- chinese
inference: False
---
# Randeng-Pegasus-523M-Summary-Chinese-V1
- Github: [Fengshenbang-LM](https://github.com/IDEA-CCNL/Fengshenbang-LM/blob/main/fengshen/examples/summary/randeng_pegasus_523M_summary.sh)
- Docs: [Fengshenbang-Docs](https://fengshenbang-doc.readthedocs.io/zh/latest/docs/%E7%87%83%E7%81%AF%E7%B3%BB%E5%88%97/Randeng-Pegasus-238M-Summary-Chinese.html)
## 简介 Brief Introduction
善于处理摘要任务,在数个中文摘要数据集上微调后的,中文版的PAGASUS-large。
Good at solving text summarization tasks, after fine-tuning on multiple Chinese text summarization datasets, Chinese PAGASUS-large.
## 模型分类 Model Taxonomy
| 需求 Demand | 任务 Task | 系列 Series | 模型 Model | 参数 Parameter | 额外 Extra |
| :----: | :----: | :----: | :----: | :----: | :----: |
| 通用 General | 自然语言转换 NLT | 燃灯 Randeng | PEFASUS | 523M | 文本摘要任务-中文 Summary-Chinese |
## 模型信息 Model Information
参考论文:[PEGASUS: Pre-training with Extracted Gap-sentences for Abstractive Summarization](https://arxiv.org/pdf/1912.08777.pdf)
基于[Randeng-Pegasus-523M-Chinese](https://huggingface.co/IDEA-CCNL/Randeng-Pegasus-523M-Chinese),我们在收集的7个中文领域的文本摘要数据集(约4M个样本),使用实体过滤后数据集(约1.8M)重新微调,在不损伤下游指标的情况下提升了摘要对原文的忠实度,得到了summary-v1版本。这7个数据集为:education, new2016zh, nlpcc, shence, sohu, thucnews和weibo。
Based on [Randeng-Pegasus-523M-Chinese](https://huggingface.co/IDEA-CCNL/Randeng-Pegasus-523M-Chinese), we fine-tuned a text summarization version (summary-v1) on a filted dataset(1.8M), which we use entitys to filter these 7 Chinese text summarization datasets, with totaling around 4M samples. We can improve the faithfulness of summaries without damage to the downstream task, eg. Rouge-L on lcsts. The datasets include: education, new2016zh, nlpcc, shence, sohu, thucnews and weibo.
### 下游效果 Performance
| datasets | rouge-1 | rouge-2 | rouge-L |
| ---- | ---- | ---- | ---- |
| LCSTS | 46.94 | 33.92 | 43.51 |
## 使用 Usage
```python
from transformers import PegasusForConditionalGeneration
# Need to download tokenizers_pegasus.py and other Python script from Fengshenbang-LM github repo in advance,
# or you can download tokenizers_pegasus.py and data_utils.py in https://huggingface.co/IDEA-CCNL/Randeng_Pegasus_523M/tree/main
# Strongly recommend you git clone the Fengshenbang-LM repo:
# 1. git clone https://github.com/IDEA-CCNL/Fengshenbang-LM
# 2. cd Fengshenbang-LM/fengshen/examples/pegasus/
# and then you will see the tokenizers_pegasus.py and data_utils.py which are needed by pegasus model
from tokenizers_pegasus import PegasusTokenizer
model = PegasusForConditionalGeneration.from_pretrained("IDEA-CCNL/Randeng-Pegasus-523M-Summary-Chinese-V1")
tokenizer = PegasusTokenizer.from_pretrained("IDEA-CCNL/Randeng-Pegasus-523M-Summary-Chinese-V1")
text = "在北京冬奥会自由式滑雪女子坡面障碍技巧决赛中,中国选手谷爱凌夺得银牌。祝贺谷爱凌!今天上午,自由式滑雪女子坡面障碍技巧决赛举行。决赛分三轮进行,取选手最佳成绩排名决出奖牌。第一跳,中国选手谷爱凌获得69.90分。在12位选手中排名第三。完成动作后,谷爱凌又扮了个鬼脸,甚是可爱。第二轮中,谷爱凌在道具区第三个障碍处失误,落地时摔倒。获得16.98分。网友:摔倒了也没关系,继续加油!在第二跳失误摔倒的情况下,谷爱凌顶住压力,第三跳稳稳发挥,流畅落地!获得86.23分!此轮比赛,共12位选手参赛,谷爱凌第10位出场。网友:看比赛时我比谷爱凌紧张,加油!"
inputs = tokenizer(text, max_length=1024, return_tensors="pt")
# Generate Summary
summary_ids = model.generate(inputs["input_ids"])
tokenizer.batch_decode(summary_ids, skip_special_tokens=True, clean_up_tokenization_spaces=False)[0]
# model Output: 自由式滑雪女子坡面障碍技巧决赛谷爱凌摘银
```
## 引用 Citation
如果您在您的工作中使用了我们的模型,可以引用我们的[论文](https://arxiv.org/abs/2209.02970):
If you are using the resource for your work, please cite the our [paper](https://arxiv.org/abs/2209.02970):
```text
@article{fengshenbang,
author = {Jiaxing Zhang and Ruyi Gan and Junjie Wang and Yuxiang Zhang and Lin Zhang and Ping Yang and Xinyu Gao and Ziwei Wu and Xiaoqun Dong and Junqing He and Jianheng Zhuo and Qi Yang and Yongfeng Huang and Xiayu Li and Yanghan Wu and Junyu Lu and Xinyu Zhu and Weifeng Chen and Ting Han and Kunhao Pan and Rui Wang and Hao Wang and Xiaojun Wu and Zhongshen Zeng and Chongpei Chen},
title = {Fengshenbang 1.0: Being the Foundation of Chinese Cognitive Intelligence},
journal = {CoRR},
volume = {abs/2209.02970},
year = {2022}
}
```
也可以引用我们的[网站](https://github.com/IDEA-CCNL/Fengshenbang-LM/):
You can also cite our [website](https://github.com/IDEA-CCNL/Fengshenbang-LM/):
```text
@misc{Fengshenbang-LM,
title={Fengshenbang-LM},
author={IDEA-CCNL},
year={2021},
howpublished={\url{https://github.com/IDEA-CCNL/Fengshenbang-LM}},
}
``` | 4,443 | [
[
-0.034759521484375,
-0.040618896484375,
0.01222991943359375,
0.029388427734375,
-0.042724609375,
-0.02984619140625,
-0.023651123046875,
-0.0310516357421875,
0.03680419921875,
0.02069091796875,
-0.041717529296875,
-0.045806884765625,
-0.039459228515625,
0.010... |
526christian/526mix-v1.5 | 2023-08-09T19:18:04.000Z | [
"diffusers",
"stable-diffusion",
"text-to-image",
"en",
"license:creativeml-openrail-m",
"endpoints_compatible",
"diffusers:StableDiffusionPipeline",
"region:us"
] | text-to-image | 526christian | null | null | 526christian/526mix-v1.5 | 1 | 928 | diffusers | 2023-08-02T20:47:05 | ---
language:
- en
tags:
- stable-diffusion
- text-to-image
license: creativeml-openrail-m
inference: true
---
High saturation is much less frequently an issue in this version at 7 CFG than the last. But if it happens again, it helps to pull back to 6.
`<neg-sketch-2>` negative embedding highly recommended for realism and 3D style images (among others). It can be found here: https://huggingface.co/JPPhoto/neg-sketch-2
When prompting for paintings, I suggest using "framed, borders, photo" as your negative prompt to get fullscreen images and cut out any weird 3D-like people.
When prompting for illustrations, I like to use "photo" or "realistic" as my negative prompt.
When prompting for realism, I normally use a negative prompt of `<neg-sketch-2>` at 1.1 weight and "(anime, render, pixar, illustration, sketch)" at 1.2 weight.
[Garbage-bin concepts LoRA](https://civitai.com/models/95391?modelVersionId=101827) recommended for any intense silliness.
[Example images hosted on Civitai](https://civitai.com/models/15022?modelVersionId=132011) were generated in InvokeAI's Nodes using latent upscaling from close to ~512x resolution up a few hundred pixels each side at 0.55-0.65 strength w/ DDIM. This was followed up with an ESRGAN model upscale, then converting the image to latents and using ControlNet Tile in a latent to latent stage at 0.2-0.4 strength w/ DDIM. | 1,379 | [
[
-0.058441162109375,
-0.05084228515625,
0.0357666015625,
0.0447998046875,
-0.037841796875,
-0.0049896240234375,
0.0071563720703125,
-0.045013427734375,
0.03350830078125,
0.052825927734375,
-0.0240631103515625,
-0.03076171875,
-0.031341552734375,
-0.0085830688... |
classla/wav2vec2-xls-r-parlaspeech-hr | 2023-06-23T06:29:11.000Z | [
"transformers",
"pytorch",
"safetensors",
"wav2vec2",
"automatic-speech-recognition",
"audio",
"parlaspeech",
"hr",
"dataset:parlaspeech-hr",
"endpoints_compatible",
"region:us"
] | automatic-speech-recognition | classla | null | null | classla/wav2vec2-xls-r-parlaspeech-hr | 2 | 925 | transformers | 2022-03-02T23:29:05 | ---
language: hr
datasets:
- parlaspeech-hr
tags:
- audio
- automatic-speech-recognition
- parlaspeech
widget:
- example_title: example 1
src: https://huggingface.co/classla/wav2vec2-xls-r-parlaspeech-hr/raw/main/1800.m4a
- example_title: example 2
src: https://huggingface.co/classla/wav2vec2-xls-r-parlaspeech-hr/raw/main/00020578b.flac.wav
---
# wav2vec2-xls-r-parlaspeech-hr
This model for Croatian ASR is based on the [facebook/wav2vec2-xls-r-300m model](https://huggingface.co/facebook/wav2vec2-xls-r-300m) and was fine-tuned with 300 hours of recordings and transcripts from the ASR Croatian parliament dataset [ParlaSpeech-HR v1.0](http://hdl.handle.net/11356/1494).
If you use this model, please cite the following paper:
Nikola Ljubešić, Danijel Koržinek, Peter Rupnik, Ivo-Pavao Jazbec. ParlaSpeech-HR -- a freely available ASR dataset for Croatian bootstrapped from the ParlaMint corpus. http://www.lrec-conf.org/proceedings/lrec2022/workshops/ParlaCLARINIII/pdf/2022.parlaclariniii-1.16.pdf
## Metrics
Evaluation is performed on the dev and test portions of the [ParlaSpeech-HR v1.0](http://hdl.handle.net/11356/1494) dataset.
|split|CER|WER|
|---|---|---|
|dev|0.0335|0.1046|
|test|0.0234|0.0761|
There are multiple models available, and in terms of CER and WER, the best-performing model is [wav2vec2-large-slavic-parlaspeech-hr-lm](https://huggingface.co/classla/wav2vec2-large-slavic-parlaspeech-hr-lm).
## Usage in `transformers`
```python
from transformers import Wav2Vec2Processor, Wav2Vec2ForCTC
import soundfile as sf
import torch
import os
device = torch.device("cuda:0" if torch.cuda.is_available() else "cpu")
# load model and tokenizer
processor = Wav2Vec2Processor.from_pretrained(
"classla/wav2vec2-xls-r-parlaspeech-hr")
model = Wav2Vec2ForCTC.from_pretrained("classla/wav2vec2-xls-r-parlaspeech-hr")
# download the example wav files:
os.system("wget https://huggingface.co/classla/wav2vec2-xls-r-parlaspeech-hr/raw/main/00020570a.flac.wav")
# read the wav file
speech, sample_rate = sf.read("00020570a.flac.wav")
input_values = processor(speech, sampling_rate=sample_rate, return_tensors="pt").input_values.to(device)
# remove the raw wav file
os.system("rm 00020570a.flac.wav")
# retrieve logits
logits = model.to(device)(input_values).logits
# take argmax and decode
predicted_ids = torch.argmax(logits, dim=-1)
transcription = processor.decode(predicted_ids[0]).lower()
# transcription: 'veliki broj poslovnih subjekata posluje sa minusom velik dio'
```
## Training hyperparameters
In fine-tuning, the following arguments were used:
| arg | value |
|-------------------------------|-------|
| `per_device_train_batch_size` | 16 |
| `gradient_accumulation_steps` | 4 |
| `num_train_epochs` | 8 |
| `learning_rate` | 3e-4 |
| `warmup_steps` | 500 | | 2,893 | [
[
-0.02618408203125,
-0.050567626953125,
0.0088348388671875,
0.031829833984375,
-0.011749267578125,
-0.009735107421875,
-0.03515625,
-0.032440185546875,
-0.002197265625,
0.022216796875,
-0.045745849609375,
-0.03857421875,
-0.042327880859375,
-0.003982543945312... |
timm/tf_efficientnet_b4.aa_in1k | 2023-04-27T21:19:11.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"arxiv:1905.11946",
"arxiv:1805.09501",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/tf_efficientnet_b4.aa_in1k | 0 | 925 | timm | 2022-12-13T00:03:05 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
---
# Model card for tf_efficientnet_b4.aa_in1k
A EfficientNet image classification model. Trained on ImageNet-1k with auto-augment in Tensorflow by paper authors, ported to PyTorch by Ross Wightman.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 19.3
- GMACs: 4.5
- Activations (M): 49.5
- Image size: 380 x 380
- **Papers:**
- EfficientNet: Rethinking Model Scaling for Convolutional Neural Networks: https://arxiv.org/abs/1905.11946
- AutoAugment: Learning Augmentation Policies from Data: https://arxiv.org/abs/1805.09501
- **Dataset:** ImageNet-1k
- **Original:** https://github.com/tensorflow/tpu/tree/master/models/official/efficientnet
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('tf_efficientnet_b4.aa_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'tf_efficientnet_b4.aa_in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 24, 190, 190])
# torch.Size([1, 32, 95, 95])
# torch.Size([1, 56, 48, 48])
# torch.Size([1, 160, 24, 24])
# torch.Size([1, 448, 12, 12])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'tf_efficientnet_b4.aa_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 1792, 12, 12) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@inproceedings{tan2019efficientnet,
title={Efficientnet: Rethinking model scaling for convolutional neural networks},
author={Tan, Mingxing and Le, Quoc},
booktitle={International conference on machine learning},
pages={6105--6114},
year={2019},
organization={PMLR}
}
```
```bibtex
@inproceedings{47890,
title = {AutoAugment: Learning Augmentation Policies from Data},
author = {Ekin Dogus Cubuk and Barret Zoph and Dandelion Mane and Vijay Vasudevan and Quoc V. Le},
year = {2019},
URL = {https://arxiv.org/pdf/1805.09501.pdf}
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
| 4,494 | [
[
-0.0296173095703125,
-0.041656494140625,
-0.009124755859375,
0.007129669189453125,
-0.01505279541015625,
-0.0306396484375,
-0.0221099853515625,
-0.031494140625,
0.01357269287109375,
0.0243988037109375,
-0.0293121337890625,
-0.043701171875,
-0.056243896484375,
... |
timm/convnext_base.clip_laion2b_augreg_ft_in1k | 2023-03-31T21:55:41.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"dataset:laion-2b",
"arxiv:2210.08402",
"arxiv:2201.03545",
"arxiv:2103.00020",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/convnext_base.clip_laion2b_augreg_ft_in1k | 0 | 925 | timm | 2023-02-03T18:32:07 | ---
tags:
- image-classification
- timm
library_tag: timm
license: apache-2.0
datasets:
- imagenet-1k
- laion-2b
---
# Model card for convnext_base.clip_laion2b_augreg_ft_in1k
A ConvNeXt image classification model. CLIP image tower weights pretrained in [OpenCLIP](https://github.com/mlfoundations/open_clip) on LAION and fine-tuned on ImageNet-1k in `timm` by Ross Wightman.
Please see related OpenCLIP model cards for more details on pretrain:
* https://huggingface.co/laion/CLIP-convnext_xxlarge-laion2B-s34B-b82K-augreg-soup
* https://huggingface.co/laion/CLIP-convnext_large_d.laion2B-s26B-b102K-augreg
* https://huggingface.co/laion/CLIP-convnext_base_w-laion2B-s13B-b82K-augreg
* https://huggingface.co/laion/CLIP-convnext_base_w_320-laion_aesthetic-s13B-b82K
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 88.6
- GMACs: 20.1
- Activations (M): 37.6
- Image size: 256 x 256
- **Papers:**
- LAION-5B: An open large-scale dataset for training next generation image-text models: https://arxiv.org/abs/2210.08402
- A ConvNet for the 2020s: https://arxiv.org/abs/2201.03545
- Learning Transferable Visual Models From Natural Language Supervision: https://arxiv.org/abs/2103.00020
- **Original:** https://github.com/mlfoundations/open_clip
- **Pretrain Dataset:** LAION-2B
- **Dataset:** ImageNet-1k
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('convnext_base.clip_laion2b_augreg_ft_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'convnext_base.clip_laion2b_augreg_ft_in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 128, 64, 64])
# torch.Size([1, 256, 32, 32])
# torch.Size([1, 512, 16, 16])
# torch.Size([1, 1024, 8, 8])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'convnext_base.clip_laion2b_augreg_ft_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 1024, 8, 8) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
All timing numbers from eager model PyTorch 1.13 on RTX 3090 w/ AMP.
| model |top1 |top5 |img_size|param_count|gmacs |macts |samples_per_sec|batch_size|
|------------------------------------------------------------------------------------------------------------------------------|------|------|--------|-----------|------|------|---------------|----------|
| [convnextv2_huge.fcmae_ft_in22k_in1k_512](https://huggingface.co/timm/convnextv2_huge.fcmae_ft_in22k_in1k_512) |88.848|98.742|512 |660.29 |600.81|413.07|28.58 |48 |
| [convnextv2_huge.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_huge.fcmae_ft_in22k_in1k_384) |88.668|98.738|384 |660.29 |337.96|232.35|50.56 |64 |
| [convnext_xxlarge.clip_laion2b_soup_ft_in1k](https://huggingface.co/timm/convnext_xxlarge.clip_laion2b_soup_ft_in1k) |88.612|98.704|256 |846.47 |198.09|124.45|122.45 |256 |
| [convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_384](https://huggingface.co/timm/convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_384) |88.312|98.578|384 |200.13 |101.11|126.74|196.84 |256 |
| [convnextv2_large.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_large.fcmae_ft_in22k_in1k_384) |88.196|98.532|384 |197.96 |101.1 |126.74|128.94 |128 |
| [convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_320](https://huggingface.co/timm/convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_320) |87.968|98.47 |320 |200.13 |70.21 |88.02 |283.42 |256 |
| [convnext_xlarge.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_xlarge.fb_in22k_ft_in1k_384) |87.75 |98.556|384 |350.2 |179.2 |168.99|124.85 |192 |
| [convnextv2_base.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_base.fcmae_ft_in22k_in1k_384) |87.646|98.422|384 |88.72 |45.21 |84.49 |209.51 |256 |
| [convnext_large.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_large.fb_in22k_ft_in1k_384) |87.476|98.382|384 |197.77 |101.1 |126.74|194.66 |256 |
| [convnext_large_mlp.clip_laion2b_augreg_ft_in1k](https://huggingface.co/timm/convnext_large_mlp.clip_laion2b_augreg_ft_in1k) |87.344|98.218|256 |200.13 |44.94 |56.33 |438.08 |256 |
| [convnextv2_large.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_large.fcmae_ft_in22k_in1k) |87.26 |98.248|224 |197.96 |34.4 |43.13 |376.84 |256 |
| [convnext_base.clip_laion2b_augreg_ft_in12k_in1k_384](https://huggingface.co/timm/convnext_base.clip_laion2b_augreg_ft_in12k_in1k_384) |87.138|98.212|384 |88.59 |45.21 |84.49 |365.47 |256 |
| [convnext_xlarge.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_xlarge.fb_in22k_ft_in1k) |87.002|98.208|224 |350.2 |60.98 |57.5 |368.01 |256 |
| [convnext_base.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_base.fb_in22k_ft_in1k_384) |86.796|98.264|384 |88.59 |45.21 |84.49 |366.54 |256 |
| [convnextv2_base.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_base.fcmae_ft_in22k_in1k) |86.74 |98.022|224 |88.72 |15.38 |28.75 |624.23 |256 |
| [convnext_large.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_large.fb_in22k_ft_in1k) |86.636|98.028|224 |197.77 |34.4 |43.13 |581.43 |256 |
| [convnext_base.clip_laiona_augreg_ft_in1k_384](https://huggingface.co/timm/convnext_base.clip_laiona_augreg_ft_in1k_384) |86.504|97.97 |384 |88.59 |45.21 |84.49 |368.14 |256 |
| [convnext_base.clip_laion2b_augreg_ft_in12k_in1k](https://huggingface.co/timm/convnext_base.clip_laion2b_augreg_ft_in12k_in1k) |86.344|97.97 |256 |88.59 |20.09 |37.55 |816.14 |256 |
| [convnextv2_huge.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_huge.fcmae_ft_in1k) |86.256|97.75 |224 |660.29 |115.0 |79.07 |154.72 |256 |
| [convnext_small.in12k_ft_in1k_384](https://huggingface.co/timm/convnext_small.in12k_ft_in1k_384) |86.182|97.92 |384 |50.22 |25.58 |63.37 |516.19 |256 |
| [convnext_base.clip_laion2b_augreg_ft_in1k](https://huggingface.co/timm/convnext_base.clip_laion2b_augreg_ft_in1k) |86.154|97.68 |256 |88.59 |20.09 |37.55 |819.86 |256 |
| [convnext_base.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_base.fb_in22k_ft_in1k) |85.822|97.866|224 |88.59 |15.38 |28.75 |1037.66 |256 |
| [convnext_small.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_small.fb_in22k_ft_in1k_384) |85.778|97.886|384 |50.22 |25.58 |63.37 |518.95 |256 |
| [convnextv2_large.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_large.fcmae_ft_in1k) |85.742|97.584|224 |197.96 |34.4 |43.13 |375.23 |256 |
| [convnext_small.in12k_ft_in1k](https://huggingface.co/timm/convnext_small.in12k_ft_in1k) |85.174|97.506|224 |50.22 |8.71 |21.56 |1474.31 |256 |
| [convnext_tiny.in12k_ft_in1k_384](https://huggingface.co/timm/convnext_tiny.in12k_ft_in1k_384) |85.118|97.608|384 |28.59 |13.14 |39.48 |856.76 |256 |
| [convnextv2_tiny.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_tiny.fcmae_ft_in22k_in1k_384) |85.112|97.63 |384 |28.64 |13.14 |39.48 |491.32 |256 |
| [convnextv2_base.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_base.fcmae_ft_in1k) |84.874|97.09 |224 |88.72 |15.38 |28.75 |625.33 |256 |
| [convnext_small.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_small.fb_in22k_ft_in1k) |84.562|97.394|224 |50.22 |8.71 |21.56 |1478.29 |256 |
| [convnext_large.fb_in1k](https://huggingface.co/timm/convnext_large.fb_in1k) |84.282|96.892|224 |197.77 |34.4 |43.13 |584.28 |256 |
| [convnext_tiny.in12k_ft_in1k](https://huggingface.co/timm/convnext_tiny.in12k_ft_in1k) |84.186|97.124|224 |28.59 |4.47 |13.44 |2433.7 |256 |
| [convnext_tiny.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_tiny.fb_in22k_ft_in1k_384) |84.084|97.14 |384 |28.59 |13.14 |39.48 |862.95 |256 |
| [convnextv2_tiny.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_tiny.fcmae_ft_in22k_in1k) |83.894|96.964|224 |28.64 |4.47 |13.44 |1452.72 |256 |
| [convnext_base.fb_in1k](https://huggingface.co/timm/convnext_base.fb_in1k) |83.82 |96.746|224 |88.59 |15.38 |28.75 |1054.0 |256 |
| [convnextv2_nano.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_nano.fcmae_ft_in22k_in1k_384) |83.37 |96.742|384 |15.62 |7.22 |24.61 |801.72 |256 |
| [convnext_small.fb_in1k](https://huggingface.co/timm/convnext_small.fb_in1k) |83.142|96.434|224 |50.22 |8.71 |21.56 |1464.0 |256 |
| [convnextv2_tiny.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_tiny.fcmae_ft_in1k) |82.92 |96.284|224 |28.64 |4.47 |13.44 |1425.62 |256 |
| [convnext_tiny.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_tiny.fb_in22k_ft_in1k) |82.898|96.616|224 |28.59 |4.47 |13.44 |2480.88 |256 |
| [convnext_nano.in12k_ft_in1k](https://huggingface.co/timm/convnext_nano.in12k_ft_in1k) |82.282|96.344|224 |15.59 |2.46 |8.37 |3926.52 |256 |
| [convnext_tiny_hnf.a2h_in1k](https://huggingface.co/timm/convnext_tiny_hnf.a2h_in1k) |82.216|95.852|224 |28.59 |4.47 |13.44 |2529.75 |256 |
| [convnext_tiny.fb_in1k](https://huggingface.co/timm/convnext_tiny.fb_in1k) |82.066|95.854|224 |28.59 |4.47 |13.44 |2346.26 |256 |
| [convnextv2_nano.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_nano.fcmae_ft_in22k_in1k) |82.03 |96.166|224 |15.62 |2.46 |8.37 |2300.18 |256 |
| [convnextv2_nano.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_nano.fcmae_ft_in1k) |81.83 |95.738|224 |15.62 |2.46 |8.37 |2321.48 |256 |
| [convnext_nano_ols.d1h_in1k](https://huggingface.co/timm/convnext_nano_ols.d1h_in1k) |80.866|95.246|224 |15.65 |2.65 |9.38 |3523.85 |256 |
| [convnext_nano.d1h_in1k](https://huggingface.co/timm/convnext_nano.d1h_in1k) |80.768|95.334|224 |15.59 |2.46 |8.37 |3915.58 |256 |
| [convnextv2_pico.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_pico.fcmae_ft_in1k) |80.304|95.072|224 |9.07 |1.37 |6.1 |3274.57 |256 |
| [convnext_pico.d1_in1k](https://huggingface.co/timm/convnext_pico.d1_in1k) |79.526|94.558|224 |9.05 |1.37 |6.1 |5686.88 |256 |
| [convnext_pico_ols.d1_in1k](https://huggingface.co/timm/convnext_pico_ols.d1_in1k) |79.522|94.692|224 |9.06 |1.43 |6.5 |5422.46 |256 |
| [convnextv2_femto.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_femto.fcmae_ft_in1k) |78.488|93.98 |224 |5.23 |0.79 |4.57 |4264.2 |256 |
| [convnext_femto_ols.d1_in1k](https://huggingface.co/timm/convnext_femto_ols.d1_in1k) |77.86 |93.83 |224 |5.23 |0.82 |4.87 |6910.6 |256 |
| [convnext_femto.d1_in1k](https://huggingface.co/timm/convnext_femto.d1_in1k) |77.454|93.68 |224 |5.22 |0.79 |4.57 |7189.92 |256 |
| [convnextv2_atto.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_atto.fcmae_ft_in1k) |76.664|93.044|224 |3.71 |0.55 |3.81 |4728.91 |256 |
| [convnext_atto_ols.a2_in1k](https://huggingface.co/timm/convnext_atto_ols.a2_in1k) |75.88 |92.846|224 |3.7 |0.58 |4.11 |7963.16 |256 |
| [convnext_atto.d2_in1k](https://huggingface.co/timm/convnext_atto.d2_in1k) |75.664|92.9 |224 |3.7 |0.55 |3.81 |8439.22 |256 |
## Citation
```bibtex
@software{ilharco_gabriel_2021_5143773,
author = {Ilharco, Gabriel and
Wortsman, Mitchell and
Wightman, Ross and
Gordon, Cade and
Carlini, Nicholas and
Taori, Rohan and
Dave, Achal and
Shankar, Vaishaal and
Namkoong, Hongseok and
Miller, John and
Hajishirzi, Hannaneh and
Farhadi, Ali and
Schmidt, Ludwig},
title = {OpenCLIP},
month = jul,
year = 2021,
note = {If you use this software, please cite it as below.},
publisher = {Zenodo},
version = {0.1},
doi = {10.5281/zenodo.5143773},
url = {https://doi.org/10.5281/zenodo.5143773}
}
```
```bibtex
@inproceedings{schuhmann2022laionb,
title={{LAION}-5B: An open large-scale dataset for training next generation image-text models},
author={Christoph Schuhmann and
Romain Beaumont and
Richard Vencu and
Cade W Gordon and
Ross Wightman and
Mehdi Cherti and
Theo Coombes and
Aarush Katta and
Clayton Mullis and
Mitchell Wortsman and
Patrick Schramowski and
Srivatsa R Kundurthy and
Katherine Crowson and
Ludwig Schmidt and
Robert Kaczmarczyk and
Jenia Jitsev},
booktitle={Thirty-sixth Conference on Neural Information Processing Systems Datasets and Benchmarks Track},
year={2022},
url={https://openreview.net/forum?id=M3Y74vmsMcY}
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
```bibtex
@inproceedings{Radford2021LearningTV,
title={Learning Transferable Visual Models From Natural Language Supervision},
author={Alec Radford and Jong Wook Kim and Chris Hallacy and A. Ramesh and Gabriel Goh and Sandhini Agarwal and Girish Sastry and Amanda Askell and Pamela Mishkin and Jack Clark and Gretchen Krueger and Ilya Sutskever},
booktitle={ICML},
year={2021}
}
```
```bibtex
@article{liu2022convnet,
author = {Zhuang Liu and Hanzi Mao and Chao-Yuan Wu and Christoph Feichtenhofer and Trevor Darrell and Saining Xie},
title = {A ConvNet for the 2020s},
journal = {Proceedings of the IEEE/CVF Conference on Computer Vision and Pattern Recognition (CVPR)},
year = {2022},
}
```
| 18,496 | [
[
-0.06103515625,
-0.03668212890625,
-0.002227783203125,
0.035430908203125,
-0.031524658203125,
-0.0178985595703125,
-0.013916015625,
-0.033966064453125,
0.058319091796875,
0.0204620361328125,
-0.04345703125,
-0.044158935546875,
-0.0538330078125,
-0.0032157897... |
Unbabel/xlm-roberta-comet-small | 2021-07-10T17:32:40.000Z | [
"transformers",
"pytorch",
"xlm-roberta",
"feature-extraction",
"arxiv:2012.15828",
"endpoints_compatible",
"region:us"
] | feature-extraction | Unbabel | null | null | Unbabel/xlm-roberta-comet-small | 1 | 924 | transformers | 2022-03-02T23:29:05 | # Model
mMiniLM-L12xH384 XLM-R model proposed in [MiniLMv2: Multi-Head Self-Attention Relation Distillation for Compressing Pretrained Transformers](https://arxiv.org/abs/2012.15828) that we fine-tune using the direct assessment annotations collected in the Workshop on Statistical Machine Translation (WMT) 2015 to 2020.
This model is much more light weight than the traditional XLM-RoBERTa base and large.
| 412 | [
[
-0.0423583984375,
-0.01141357421875,
0.039947509765625,
0.00411224365234375,
-0.0163116455078125,
-0.0160675048828125,
-0.007843017578125,
-0.02001953125,
0.0024623870849609375,
0.041229248046875,
-0.08294677734375,
0.007236480712890625,
-0.0616455078125,
0.... |
timm/maxvit_base_tf_384.in21k_ft_in1k | 2023-05-10T23:57:09.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"dataset:imagenet-21k",
"arxiv:2204.01697",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/maxvit_base_tf_384.in21k_ft_in1k | 0 | 924 | timm | 2022-12-02T21:49:04 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
- imagenet-21k
---
# Model card for maxvit_base_tf_384.in21k_ft_in1k
An official MaxViT image classification model. Pretrained in tensorflow on ImageNet-21k (21843 Google specific instance of ImageNet-22k) and fine-tuned on ImageNet-1k by paper authors.
Ported from official Tensorflow implementation (https://github.com/google-research/maxvit) to PyTorch by Ross Wightman.
### Model Variants in [maxxvit.py](https://github.com/huggingface/pytorch-image-models/blob/main/timm/models/maxxvit.py)
MaxxViT covers a number of related model architectures that share a common structure including:
- CoAtNet - Combining MBConv (depthwise-separable) convolutional blocks in early stages with self-attention transformer blocks in later stages.
- MaxViT - Uniform blocks across all stages, each containing a MBConv (depthwise-separable) convolution block followed by two self-attention blocks with different partitioning schemes (window followed by grid).
- CoAtNeXt - A timm specific arch that uses ConvNeXt blocks in place of MBConv blocks in CoAtNet. All normalization layers are LayerNorm (no BatchNorm).
- MaxxViT - A timm specific arch that uses ConvNeXt blocks in place of MBConv blocks in MaxViT. All normalization layers are LayerNorm (no BatchNorm).
- MaxxViT-V2 - A MaxxViT variation that removes the window block attention leaving only ConvNeXt blocks and grid attention w/ more width to compensate.
Aside from the major variants listed above, there are more subtle changes from model to model. Any model name with the string `rw` are `timm` specific configs w/ modelling adjustments made to favour PyTorch eager use. These were created while training initial reproductions of the models so there are variations.
All models with the string `tf` are models exactly matching Tensorflow based models by the original paper authors with weights ported to PyTorch. This covers a number of MaxViT models. The official CoAtNet models were never released.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 119.7
- GMACs: 73.8
- Activations (M): 332.9
- Image size: 384 x 384
- **Papers:**
- MaxViT: Multi-Axis Vision Transformer: https://arxiv.org/abs/2204.01697
- **Dataset:** ImageNet-1k
- **Pretrain Dataset:** ImageNet-21k
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('maxvit_base_tf_384.in21k_ft_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'maxvit_base_tf_384.in21k_ft_in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 64, 192, 192])
# torch.Size([1, 96, 96, 96])
# torch.Size([1, 192, 48, 48])
# torch.Size([1, 384, 24, 24])
# torch.Size([1, 768, 12, 12])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'maxvit_base_tf_384.in21k_ft_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 768, 12, 12) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
### By Top-1
|model |top1 |top5 |samples / sec |Params (M) |GMAC |Act (M)|
|------------------------------------------------------------------------------------------------------------------------|----:|----:|--------------:|--------------:|-----:|------:|
|[maxvit_xlarge_tf_512.in21k_ft_in1k](https://huggingface.co/timm/maxvit_xlarge_tf_512.in21k_ft_in1k) |88.53|98.64| 21.76| 475.77|534.14|1413.22|
|[maxvit_xlarge_tf_384.in21k_ft_in1k](https://huggingface.co/timm/maxvit_xlarge_tf_384.in21k_ft_in1k) |88.32|98.54| 42.53| 475.32|292.78| 668.76|
|[maxvit_base_tf_512.in21k_ft_in1k](https://huggingface.co/timm/maxvit_base_tf_512.in21k_ft_in1k) |88.20|98.53| 50.87| 119.88|138.02| 703.99|
|[maxvit_large_tf_512.in21k_ft_in1k](https://huggingface.co/timm/maxvit_large_tf_512.in21k_ft_in1k) |88.04|98.40| 36.42| 212.33|244.75| 942.15|
|[maxvit_large_tf_384.in21k_ft_in1k](https://huggingface.co/timm/maxvit_large_tf_384.in21k_ft_in1k) |87.98|98.56| 71.75| 212.03|132.55| 445.84|
|[maxvit_base_tf_384.in21k_ft_in1k](https://huggingface.co/timm/maxvit_base_tf_384.in21k_ft_in1k) |87.92|98.54| 104.71| 119.65| 73.80| 332.90|
|[maxvit_rmlp_base_rw_384.sw_in12k_ft_in1k](https://huggingface.co/timm/maxvit_rmlp_base_rw_384.sw_in12k_ft_in1k) |87.81|98.37| 106.55| 116.14| 70.97| 318.95|
|[maxxvitv2_rmlp_base_rw_384.sw_in12k_ft_in1k](https://huggingface.co/timm/maxxvitv2_rmlp_base_rw_384.sw_in12k_ft_in1k) |87.47|98.37| 149.49| 116.09| 72.98| 213.74|
|[coatnet_rmlp_2_rw_384.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_rmlp_2_rw_384.sw_in12k_ft_in1k) |87.39|98.31| 160.80| 73.88| 47.69| 209.43|
|[maxvit_rmlp_base_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/maxvit_rmlp_base_rw_224.sw_in12k_ft_in1k) |86.89|98.02| 375.86| 116.14| 23.15| 92.64|
|[maxxvitv2_rmlp_base_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/maxxvitv2_rmlp_base_rw_224.sw_in12k_ft_in1k) |86.64|98.02| 501.03| 116.09| 24.20| 62.77|
|[maxvit_base_tf_512.in1k](https://huggingface.co/timm/maxvit_base_tf_512.in1k) |86.60|97.92| 50.75| 119.88|138.02| 703.99|
|[coatnet_2_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_2_rw_224.sw_in12k_ft_in1k) |86.57|97.89| 631.88| 73.87| 15.09| 49.22|
|[maxvit_large_tf_512.in1k](https://huggingface.co/timm/maxvit_large_tf_512.in1k) |86.52|97.88| 36.04| 212.33|244.75| 942.15|
|[coatnet_rmlp_2_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_rmlp_2_rw_224.sw_in12k_ft_in1k) |86.49|97.90| 620.58| 73.88| 15.18| 54.78|
|[maxvit_base_tf_384.in1k](https://huggingface.co/timm/maxvit_base_tf_384.in1k) |86.29|97.80| 101.09| 119.65| 73.80| 332.90|
|[maxvit_large_tf_384.in1k](https://huggingface.co/timm/maxvit_large_tf_384.in1k) |86.23|97.69| 70.56| 212.03|132.55| 445.84|
|[maxvit_small_tf_512.in1k](https://huggingface.co/timm/maxvit_small_tf_512.in1k) |86.10|97.76| 88.63| 69.13| 67.26| 383.77|
|[maxvit_tiny_tf_512.in1k](https://huggingface.co/timm/maxvit_tiny_tf_512.in1k) |85.67|97.58| 144.25| 31.05| 33.49| 257.59|
|[maxvit_small_tf_384.in1k](https://huggingface.co/timm/maxvit_small_tf_384.in1k) |85.54|97.46| 188.35| 69.02| 35.87| 183.65|
|[maxvit_tiny_tf_384.in1k](https://huggingface.co/timm/maxvit_tiny_tf_384.in1k) |85.11|97.38| 293.46| 30.98| 17.53| 123.42|
|[maxvit_large_tf_224.in1k](https://huggingface.co/timm/maxvit_large_tf_224.in1k) |84.93|96.97| 247.71| 211.79| 43.68| 127.35|
|[coatnet_rmlp_1_rw2_224.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_rmlp_1_rw2_224.sw_in12k_ft_in1k) |84.90|96.96| 1025.45| 41.72| 8.11| 40.13|
|[maxvit_base_tf_224.in1k](https://huggingface.co/timm/maxvit_base_tf_224.in1k) |84.85|96.99| 358.25| 119.47| 24.04| 95.01|
|[maxxvit_rmlp_small_rw_256.sw_in1k](https://huggingface.co/timm/maxxvit_rmlp_small_rw_256.sw_in1k) |84.63|97.06| 575.53| 66.01| 14.67| 58.38|
|[coatnet_rmlp_2_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_rmlp_2_rw_224.sw_in1k) |84.61|96.74| 625.81| 73.88| 15.18| 54.78|
|[maxvit_rmlp_small_rw_224.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_small_rw_224.sw_in1k) |84.49|96.76| 693.82| 64.90| 10.75| 49.30|
|[maxvit_small_tf_224.in1k](https://huggingface.co/timm/maxvit_small_tf_224.in1k) |84.43|96.83| 647.96| 68.93| 11.66| 53.17|
|[maxvit_rmlp_tiny_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_tiny_rw_256.sw_in1k) |84.23|96.78| 807.21| 29.15| 6.77| 46.92|
|[coatnet_1_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_1_rw_224.sw_in1k) |83.62|96.38| 989.59| 41.72| 8.04| 34.60|
|[maxvit_tiny_rw_224.sw_in1k](https://huggingface.co/timm/maxvit_tiny_rw_224.sw_in1k) |83.50|96.50| 1100.53| 29.06| 5.11| 33.11|
|[maxvit_tiny_tf_224.in1k](https://huggingface.co/timm/maxvit_tiny_tf_224.in1k) |83.41|96.59| 1004.94| 30.92| 5.60| 35.78|
|[coatnet_rmlp_1_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_rmlp_1_rw_224.sw_in1k) |83.36|96.45| 1093.03| 41.69| 7.85| 35.47|
|[maxxvitv2_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxxvitv2_nano_rw_256.sw_in1k) |83.11|96.33| 1276.88| 23.70| 6.26| 23.05|
|[maxxvit_rmlp_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxxvit_rmlp_nano_rw_256.sw_in1k) |83.03|96.34| 1341.24| 16.78| 4.37| 26.05|
|[maxvit_rmlp_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_nano_rw_256.sw_in1k) |82.96|96.26| 1283.24| 15.50| 4.47| 31.92|
|[maxvit_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_nano_rw_256.sw_in1k) |82.93|96.23| 1218.17| 15.45| 4.46| 30.28|
|[coatnet_bn_0_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_bn_0_rw_224.sw_in1k) |82.39|96.19| 1600.14| 27.44| 4.67| 22.04|
|[coatnet_0_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_0_rw_224.sw_in1k) |82.39|95.84| 1831.21| 27.44| 4.43| 18.73|
|[coatnet_rmlp_nano_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_rmlp_nano_rw_224.sw_in1k) |82.05|95.87| 2109.09| 15.15| 2.62| 20.34|
|[coatnext_nano_rw_224.sw_in1k](https://huggingface.co/timm/coatnext_nano_rw_224.sw_in1k) |81.95|95.92| 2525.52| 14.70| 2.47| 12.80|
|[coatnet_nano_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_nano_rw_224.sw_in1k) |81.70|95.64| 2344.52| 15.14| 2.41| 15.41|
|[maxvit_rmlp_pico_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_pico_rw_256.sw_in1k) |80.53|95.21| 1594.71| 7.52| 1.85| 24.86|
### By Throughput (samples / sec)
|model |top1 |top5 |samples / sec |Params (M) |GMAC |Act (M)|
|------------------------------------------------------------------------------------------------------------------------|----:|----:|--------------:|--------------:|-----:|------:|
|[coatnext_nano_rw_224.sw_in1k](https://huggingface.co/timm/coatnext_nano_rw_224.sw_in1k) |81.95|95.92| 2525.52| 14.70| 2.47| 12.80|
|[coatnet_nano_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_nano_rw_224.sw_in1k) |81.70|95.64| 2344.52| 15.14| 2.41| 15.41|
|[coatnet_rmlp_nano_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_rmlp_nano_rw_224.sw_in1k) |82.05|95.87| 2109.09| 15.15| 2.62| 20.34|
|[coatnet_0_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_0_rw_224.sw_in1k) |82.39|95.84| 1831.21| 27.44| 4.43| 18.73|
|[coatnet_bn_0_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_bn_0_rw_224.sw_in1k) |82.39|96.19| 1600.14| 27.44| 4.67| 22.04|
|[maxvit_rmlp_pico_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_pico_rw_256.sw_in1k) |80.53|95.21| 1594.71| 7.52| 1.85| 24.86|
|[maxxvit_rmlp_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxxvit_rmlp_nano_rw_256.sw_in1k) |83.03|96.34| 1341.24| 16.78| 4.37| 26.05|
|[maxvit_rmlp_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_nano_rw_256.sw_in1k) |82.96|96.26| 1283.24| 15.50| 4.47| 31.92|
|[maxxvitv2_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxxvitv2_nano_rw_256.sw_in1k) |83.11|96.33| 1276.88| 23.70| 6.26| 23.05|
|[maxvit_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_nano_rw_256.sw_in1k) |82.93|96.23| 1218.17| 15.45| 4.46| 30.28|
|[maxvit_tiny_rw_224.sw_in1k](https://huggingface.co/timm/maxvit_tiny_rw_224.sw_in1k) |83.50|96.50| 1100.53| 29.06| 5.11| 33.11|
|[coatnet_rmlp_1_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_rmlp_1_rw_224.sw_in1k) |83.36|96.45| 1093.03| 41.69| 7.85| 35.47|
|[coatnet_rmlp_1_rw2_224.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_rmlp_1_rw2_224.sw_in12k_ft_in1k) |84.90|96.96| 1025.45| 41.72| 8.11| 40.13|
|[maxvit_tiny_tf_224.in1k](https://huggingface.co/timm/maxvit_tiny_tf_224.in1k) |83.41|96.59| 1004.94| 30.92| 5.60| 35.78|
|[coatnet_1_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_1_rw_224.sw_in1k) |83.62|96.38| 989.59| 41.72| 8.04| 34.60|
|[maxvit_rmlp_tiny_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_tiny_rw_256.sw_in1k) |84.23|96.78| 807.21| 29.15| 6.77| 46.92|
|[maxvit_rmlp_small_rw_224.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_small_rw_224.sw_in1k) |84.49|96.76| 693.82| 64.90| 10.75| 49.30|
|[maxvit_small_tf_224.in1k](https://huggingface.co/timm/maxvit_small_tf_224.in1k) |84.43|96.83| 647.96| 68.93| 11.66| 53.17|
|[coatnet_2_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_2_rw_224.sw_in12k_ft_in1k) |86.57|97.89| 631.88| 73.87| 15.09| 49.22|
|[coatnet_rmlp_2_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_rmlp_2_rw_224.sw_in1k) |84.61|96.74| 625.81| 73.88| 15.18| 54.78|
|[coatnet_rmlp_2_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_rmlp_2_rw_224.sw_in12k_ft_in1k) |86.49|97.90| 620.58| 73.88| 15.18| 54.78|
|[maxxvit_rmlp_small_rw_256.sw_in1k](https://huggingface.co/timm/maxxvit_rmlp_small_rw_256.sw_in1k) |84.63|97.06| 575.53| 66.01| 14.67| 58.38|
|[maxxvitv2_rmlp_base_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/maxxvitv2_rmlp_base_rw_224.sw_in12k_ft_in1k) |86.64|98.02| 501.03| 116.09| 24.20| 62.77|
|[maxvit_rmlp_base_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/maxvit_rmlp_base_rw_224.sw_in12k_ft_in1k) |86.89|98.02| 375.86| 116.14| 23.15| 92.64|
|[maxvit_base_tf_224.in1k](https://huggingface.co/timm/maxvit_base_tf_224.in1k) |84.85|96.99| 358.25| 119.47| 24.04| 95.01|
|[maxvit_tiny_tf_384.in1k](https://huggingface.co/timm/maxvit_tiny_tf_384.in1k) |85.11|97.38| 293.46| 30.98| 17.53| 123.42|
|[maxvit_large_tf_224.in1k](https://huggingface.co/timm/maxvit_large_tf_224.in1k) |84.93|96.97| 247.71| 211.79| 43.68| 127.35|
|[maxvit_small_tf_384.in1k](https://huggingface.co/timm/maxvit_small_tf_384.in1k) |85.54|97.46| 188.35| 69.02| 35.87| 183.65|
|[coatnet_rmlp_2_rw_384.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_rmlp_2_rw_384.sw_in12k_ft_in1k) |87.39|98.31| 160.80| 73.88| 47.69| 209.43|
|[maxxvitv2_rmlp_base_rw_384.sw_in12k_ft_in1k](https://huggingface.co/timm/maxxvitv2_rmlp_base_rw_384.sw_in12k_ft_in1k) |87.47|98.37| 149.49| 116.09| 72.98| 213.74|
|[maxvit_tiny_tf_512.in1k](https://huggingface.co/timm/maxvit_tiny_tf_512.in1k) |85.67|97.58| 144.25| 31.05| 33.49| 257.59|
|[maxvit_rmlp_base_rw_384.sw_in12k_ft_in1k](https://huggingface.co/timm/maxvit_rmlp_base_rw_384.sw_in12k_ft_in1k) |87.81|98.37| 106.55| 116.14| 70.97| 318.95|
|[maxvit_base_tf_384.in21k_ft_in1k](https://huggingface.co/timm/maxvit_base_tf_384.in21k_ft_in1k) |87.92|98.54| 104.71| 119.65| 73.80| 332.90|
|[maxvit_base_tf_384.in1k](https://huggingface.co/timm/maxvit_base_tf_384.in1k) |86.29|97.80| 101.09| 119.65| 73.80| 332.90|
|[maxvit_small_tf_512.in1k](https://huggingface.co/timm/maxvit_small_tf_512.in1k) |86.10|97.76| 88.63| 69.13| 67.26| 383.77|
|[maxvit_large_tf_384.in21k_ft_in1k](https://huggingface.co/timm/maxvit_large_tf_384.in21k_ft_in1k) |87.98|98.56| 71.75| 212.03|132.55| 445.84|
|[maxvit_large_tf_384.in1k](https://huggingface.co/timm/maxvit_large_tf_384.in1k) |86.23|97.69| 70.56| 212.03|132.55| 445.84|
|[maxvit_base_tf_512.in21k_ft_in1k](https://huggingface.co/timm/maxvit_base_tf_512.in21k_ft_in1k) |88.20|98.53| 50.87| 119.88|138.02| 703.99|
|[maxvit_base_tf_512.in1k](https://huggingface.co/timm/maxvit_base_tf_512.in1k) |86.60|97.92| 50.75| 119.88|138.02| 703.99|
|[maxvit_xlarge_tf_384.in21k_ft_in1k](https://huggingface.co/timm/maxvit_xlarge_tf_384.in21k_ft_in1k) |88.32|98.54| 42.53| 475.32|292.78| 668.76|
|[maxvit_large_tf_512.in21k_ft_in1k](https://huggingface.co/timm/maxvit_large_tf_512.in21k_ft_in1k) |88.04|98.40| 36.42| 212.33|244.75| 942.15|
|[maxvit_large_tf_512.in1k](https://huggingface.co/timm/maxvit_large_tf_512.in1k) |86.52|97.88| 36.04| 212.33|244.75| 942.15|
|[maxvit_xlarge_tf_512.in21k_ft_in1k](https://huggingface.co/timm/maxvit_xlarge_tf_512.in21k_ft_in1k) |88.53|98.64| 21.76| 475.77|534.14|1413.22|
## Citation
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
```bibtex
@article{tu2022maxvit,
title={MaxViT: Multi-Axis Vision Transformer},
author={Tu, Zhengzhong and Talebi, Hossein and Zhang, Han and Yang, Feng and Milanfar, Peyman and Bovik, Alan and Li, Yinxiao},
journal={ECCV},
year={2022},
}
```
```bibtex
@article{dai2021coatnet,
title={CoAtNet: Marrying Convolution and Attention for All Data Sizes},
author={Dai, Zihang and Liu, Hanxiao and Le, Quoc V and Tan, Mingxing},
journal={arXiv preprint arXiv:2106.04803},
year={2021}
}
```
| 22,282 | [
[
-0.052581787109375,
-0.031524658203125,
0.00007623434066772461,
0.031463623046875,
-0.0251617431640625,
-0.0172882080078125,
-0.01084136962890625,
-0.0241241455078125,
0.05279541015625,
0.0164794921875,
-0.042449951171875,
-0.046417236328125,
-0.047393798828125,... |
badmonk/rkmijo | 2023-07-15T11:11:45.000Z | [
"diffusers",
"text-to-image",
"stable-diffusion",
"license:creativeml-openrail-m",
"endpoints_compatible",
"has_space",
"diffusers:StableDiffusionPipeline",
"region:us"
] | text-to-image | badmonk | null | null | badmonk/rkmijo | 1 | 924 | diffusers | 2023-07-13T19:39:40 | ---
license: creativeml-openrail-m
tags:
- text-to-image
- stable-diffusion
---
# Model Card for RKMIJO
## Model Description
- **Developed by:** BADMONK
- **Model type:** Dreambooth Model + Extracted LoRA
- **Language(s) (NLP):** EN
- **License:** Creativeml-Openrail-M
- **Parent Model:** majicMIX sombre
# How to Get Started with the Model
Use the code below to get started with the model.
### RKMIJO ### | 427 | [
[
-0.0220794677734375,
-0.02734375,
0.0095367431640625,
0.0202484130859375,
-0.07220458984375,
-0.00672149658203125,
0.0238800048828125,
-0.040863037109375,
0.045562744140625,
0.06597900390625,
-0.06475830078125,
-0.057220458984375,
-0.05706787109375,
-0.01988... |
MBZUAI/LaMini-Flan-T5-77M | 2023-04-28T12:08:06.000Z | [
"transformers",
"pytorch",
"t5",
"text2text-generation",
"generated_from_trainer",
"instruction fine-tuning",
"en",
"arxiv:2304.14402",
"license:cc-by-nc-4.0",
"autotrain_compatible",
"endpoints_compatible",
"has_space",
"text-generation-inference",
"region:us"
] | text2text-generation | MBZUAI | null | null | MBZUAI/LaMini-Flan-T5-77M | 11 | 923 | transformers | 2023-04-10T08:20:26 | ---
license: cc-by-nc-4.0
tags:
- generated_from_trainer
- instruction fine-tuning
model-index:
- name: flan-t5-small-distil-v2
results: []
language:
- en
pipeline_tag: text2text-generation
widget:
- text: >-
how can I become more healthy?
example_title: example
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
<p align="center" width="100%">
<a><img src="https://raw.githubusercontent.com/mbzuai-nlp/lamini-lm/main/images/lamini.png" alt="Title" style="width: 100%; min-width: 300px; display: block; margin: auto;"></a>
</p>
# LaMini-Flan-T5-77M
[]()
This model is one of our LaMini-LM model series in paper "[LaMini-LM: A Diverse Herd of Distilled Models from Large-Scale Instructions](https://github.com/mbzuai-nlp/lamini-lm)". This model is a fine-tuned version of [google/flan-t5-small](https://huggingface.co/google/flan-t5-small) on [LaMini-instruction dataset](https://huggingface.co/datasets/MBZUAI/LaMini-instruction) that contains 2.58M samples for instruction fine-tuning. For more information about our dataset, please refer to our [project repository](https://github.com/mbzuai-nlp/lamini-lm/).
You can view other models of LaMini-LM series as follows. Models with ✩ are those with the best overall performance given their size/architecture, hence we recommend using them. More details can be seen in our paper.
<table>
<thead>
<tr>
<th>Base model</th>
<th colspan="4">LaMini-LM series (#parameters)</th>
</tr>
</thead>
<tbody>
<tr>
<td>T5</td>
<td><a href="https://huggingface.co/MBZUAI/lamini-t5-61m" target="_blank" rel="noopener noreferrer">LaMini-T5-61M</a></td>
<td><a href="https://huggingface.co/MBZUAI/lamini-t5-223m" target="_blank" rel="noopener noreferrer">LaMini-T5-223M</a></td>
<td><a href="https://huggingface.co/MBZUAI/lamini-t5-738m" target="_blank" rel="noopener noreferrer">LaMini-T5-738M</a></td>
<td></td>
</tr>
<tr>
<td>Flan-T5</td>
<td><a href="https://huggingface.co/MBZUAI/lamini-flan-t5-77m" target="_blank" rel="noopener noreferrer">LaMini-Flan-T5-77M</a>✩</td>
<td><a href="https://huggingface.co/MBZUAI/lamini-flan-t5-248m" target="_blank" rel="noopener noreferrer">LaMini-Flan-T5-248M</a>✩</td>
<td><a href="https://huggingface.co/MBZUAI/lamini-flan-t5-783m" target="_blank" rel="noopener noreferrer">LaMini-Flan-T5-783M</a>✩</td>
<td></td>
</tr>
<tr>
<td>Cerebras-GPT</td>
<td><a href="https://huggingface.co/MBZUAI/lamini-cerebras-111m" target="_blank" rel="noopener noreferrer">LaMini-Cerebras-111M</a></td>
<td><a href="https://huggingface.co/MBZUAI/lamini-cerebras-256m" target="_blank" rel="noopener noreferrer">LaMini-Cerebras-256M</a></td>
<td><a href="https://huggingface.co/MBZUAI/lamini-cerebras-590m" target="_blank" rel="noopener noreferrer">LaMini-Cerebras-590M</a></td>
<td><a href="https://huggingface.co/MBZUAI/lamini-cerebras-1.3b" target="_blank" rel="noopener noreferrer">LaMini-Cerebras-1.3B</a></td>
</tr>
<tr>
<td>GPT-2</td>
<td><a href="https://huggingface.co/MBZUAI/lamini-gpt-124m" target="_blank" rel="noopener noreferrer">LaMini-GPT-124M</a>✩</td>
<td><a href="https://huggingface.co/MBZUAI/lamini-gpt-774m" target="_blank" rel="noopener noreferrer">LaMini-GPT-774M</a>✩</td>
<td><a href="https://huggingface.co/MBZUAI/lamini-gpt-1.5b" target="_blank" rel="noopener noreferrer">LaMini-GPT-1.5B</a>✩</td>
<td></td>
</tr>
<tr>
<td>GPT-Neo</td>
<td><a href="https://huggingface.co/MBZUAI/lamini-neo-125m" target="_blank" rel="noopener noreferrer">LaMini-Neo-125M</a></td>
<td><a href="https://huggingface.co/MBZUAI/lamini-neo-1.3b" target="_blank" rel="noopener noreferrer">LaMini-Neo-1.3B</a></td>
<td></td>
<td></td>
</tr>
<tr>
<td>GPT-J</td>
<td colspan="4">coming soon</td>
</tr>
<tr>
<td>LLaMA</td>
<td colspan="4">coming soon</td>
</tr>
</tbody>
</table>
## Use
### Intended use
We recommend using the model to response to human instructions written in natural language.
We now show you how to load and use our model using HuggingFace `pipeline()`.
```python
# pip install -q transformers
from transformers import pipeline
checkpoint = "{model_name}"
model = pipeline('text2text-generation', model = checkpoint)
input_prompt = 'Please let me know your thoughts on the given place and why you think it deserves to be visited: \n"Barcelona, Spain"'
generated_text = model(input_prompt, max_length=512, do_sample=True)[0]['generated_text']
print("Response", generated_text)
```
## Training Procedure
<p align="center" width="100%">
<a><img src="https://raw.githubusercontent.com/mbzuai-nlp/lamini-lm/main/images/lamini-pipeline.drawio.png" alt="Title" style="width: 100%; min-width: 250px; display: block; margin: auto;"></a>
</p>
We initialize with [google/flan-t5-small](https://huggingface.co/google/flan-t5-small) and fine-tune it on our [LaMini-instruction dataset](https://huggingface.co/datasets/MBZUAI/LaMini-instruction). Its total number of parameters is 77M.
### Training Hyperparameters
The following hyperparameters were used during training:
- learning_rate: 0.0005
- train_batch_size: 128
- eval_batch_size: 64
- seed: 42
- gradient_accumulation_steps: 4
- total_train_batch_size: 512
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: linear
- num_epochs: 5
## Evaluation
We conducted two sets of evaluations: automatic evaluation on downstream NLP tasks and human evaluation on user-oriented instructions. For more detail, please refer to our [paper]().
## Limitations
More information needed
# Citation
```bibtex
@article{lamini-lm,
author = {Minghao Wu and
Abdul Waheed and
Chiyu Zhang and
Muhammad Abdul-Mageed and
Alham Fikri Aji
},
title = {LaMini-LM: A Diverse Herd of Distilled Models from Large-Scale Instructions},
journal = {CoRR},
volume = {abs/2304.14402},
year = {2023},
url = {https://arxiv.org/abs/2304.14402},
eprinttype = {arXiv},
eprint = {2304.14402}
}
``` | 6,414 | [
[
-0.0494384765625,
-0.052093505859375,
0.01335906982421875,
0.017608642578125,
-0.017303466796875,
-0.03125,
-0.0101470947265625,
-0.04913330078125,
0.0222625732421875,
0.020050048828125,
-0.06060791015625,
-0.0316162109375,
-0.03955078125,
0.0043106079101562... |
timm/cait_m48_448.fb_dist_in1k | 2023-04-13T01:45:43.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"arxiv:2103.17239",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/cait_m48_448.fb_dist_in1k | 0 | 923 | timm | 2023-04-13T01:40:54 | ---
tags:
- image-classification
- timm
library_tag: timm
license: apache-2.0
datasets:
- imagenet-1k
---
# Model card for cait_m48_448.fb_dist_in1k
A CaiT (Class-Attention in Image Transformers) image classification model. Pretrained on ImageNet-1k with distillation by paper authors.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 356.5
- GMACs: 329.4
- Activations (M): 1708.2
- Image size: 448 x 448
- **Papers:**
- Going deeper with Image Transformers: https://arxiv.org/abs/2103.17239
- **Dataset:** ImageNet-1k
- **Original:** https://github.com/facebookresearch/deit
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('cait_m48_448.fb_dist_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'cait_m48_448.fb_dist_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 785, 768) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Citation
```bibtex
@InProceedings{Touvron_2021_ICCV,
author = {Touvron, Hugo and Cord, Matthieu and Sablayrolles, Alexandre and Synnaeve, Gabriel and J'egou, Herv'e},
title = {Going Deeper With Image Transformers},
booktitle = {Proceedings of the IEEE/CVF International Conference on Computer Vision (ICCV)},
month = {October},
year = {2021},
pages = {32-42}
}
```
| 2,739 | [
[
-0.039703369140625,
-0.02685546875,
0.001979827880859375,
0.0208587646484375,
-0.030914306640625,
-0.02337646484375,
-0.01003265380859375,
-0.019744873046875,
0.01568603515625,
0.0234222412109375,
-0.046051025390625,
-0.04443359375,
-0.058013916015625,
-0.00... |
timm/twins_svt_base.in1k | 2023-04-23T23:23:56.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"arxiv:2104.13840",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/twins_svt_base.in1k | 0 | 923 | timm | 2023-04-23T23:23:09 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
---
# Model card for twins_svt_base.in1k
A Twins-SVT image classification model. Trained on ImageNet-1k by paper authors.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 56.1
- GMACs: 8.6
- Activations (M): 26.3
- Image size: 224 x 224
- **Papers:**
- Twins: Revisiting the Design of Spatial Attention in Vision Transformers: https://arxiv.org/abs/2104.13840
- **Dataset:** ImageNet-1k
- **Original:** https://github.com/Meituan-AutoML/Twins
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('twins_svt_base.in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'twins_svt_base.in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 49, 768) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@inproceedings{chu2021Twins,
title={Twins: Revisiting the Design of Spatial Attention in Vision Transformers},
author={Xiangxiang Chu and Zhi Tian and Yuqing Wang and Bo Zhang and Haibing Ren and Xiaolin Wei and Huaxia Xia and Chunhua Shen},
booktitle={NeurIPS 2021},
url={https://openreview.net/forum?id=5kTlVBkzSRx},
year={2021}
}
```
| 2,833 | [
[
-0.038818359375,
-0.0295257568359375,
0.003704071044921875,
0.0254058837890625,
-0.0130157470703125,
-0.0284881591796875,
-0.00565338134765625,
-0.02862548828125,
0.0207977294921875,
0.03314208984375,
-0.0478515625,
-0.039276123046875,
-0.04974365234375,
-0.... |
timm/convnext_xlarge.fb_in22k_ft_in1k | 2023-03-31T22:46:38.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"dataset:imagenet-22k",
"arxiv:2201.03545",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/convnext_xlarge.fb_in22k_ft_in1k | 0 | 922 | timm | 2022-12-13T07:17:29 | ---
tags:
- image-classification
- timm
library_tag: timm
license: apache-2.0
datasets:
- imagenet-1k
- imagenet-22k
---
# Model card for convnext_xlarge.fb_in22k_ft_in1k
A ConvNeXt image classification model. Pretrained on ImageNet-22k and fine-tuned on ImageNet-1k by paper authors.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 350.2
- GMACs: 61.0
- Activations (M): 57.5
- Image size: train = 224 x 224, test = 288 x 288
- **Papers:**
- A ConvNet for the 2020s: https://arxiv.org/abs/2201.03545
- **Original:** https://github.com/facebookresearch/ConvNeXt
- **Dataset:** ImageNet-1k
- **Pretrain Dataset:** ImageNet-22k
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('convnext_xlarge.fb_in22k_ft_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'convnext_xlarge.fb_in22k_ft_in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 256, 56, 56])
# torch.Size([1, 512, 28, 28])
# torch.Size([1, 1024, 14, 14])
# torch.Size([1, 2048, 7, 7])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'convnext_xlarge.fb_in22k_ft_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 2048, 7, 7) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
All timing numbers from eager model PyTorch 1.13 on RTX 3090 w/ AMP.
| model |top1 |top5 |img_size|param_count|gmacs |macts |samples_per_sec|batch_size|
|------------------------------------------------------------------------------------------------------------------------------|------|------|--------|-----------|------|------|---------------|----------|
| [convnextv2_huge.fcmae_ft_in22k_in1k_512](https://huggingface.co/timm/convnextv2_huge.fcmae_ft_in22k_in1k_512) |88.848|98.742|512 |660.29 |600.81|413.07|28.58 |48 |
| [convnextv2_huge.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_huge.fcmae_ft_in22k_in1k_384) |88.668|98.738|384 |660.29 |337.96|232.35|50.56 |64 |
| [convnext_xxlarge.clip_laion2b_soup_ft_in1k](https://huggingface.co/timm/convnext_xxlarge.clip_laion2b_soup_ft_in1k) |88.612|98.704|256 |846.47 |198.09|124.45|122.45 |256 |
| [convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_384](https://huggingface.co/timm/convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_384) |88.312|98.578|384 |200.13 |101.11|126.74|196.84 |256 |
| [convnextv2_large.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_large.fcmae_ft_in22k_in1k_384) |88.196|98.532|384 |197.96 |101.1 |126.74|128.94 |128 |
| [convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_320](https://huggingface.co/timm/convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_320) |87.968|98.47 |320 |200.13 |70.21 |88.02 |283.42 |256 |
| [convnext_xlarge.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_xlarge.fb_in22k_ft_in1k_384) |87.75 |98.556|384 |350.2 |179.2 |168.99|124.85 |192 |
| [convnextv2_base.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_base.fcmae_ft_in22k_in1k_384) |87.646|98.422|384 |88.72 |45.21 |84.49 |209.51 |256 |
| [convnext_large.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_large.fb_in22k_ft_in1k_384) |87.476|98.382|384 |197.77 |101.1 |126.74|194.66 |256 |
| [convnext_large_mlp.clip_laion2b_augreg_ft_in1k](https://huggingface.co/timm/convnext_large_mlp.clip_laion2b_augreg_ft_in1k) |87.344|98.218|256 |200.13 |44.94 |56.33 |438.08 |256 |
| [convnextv2_large.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_large.fcmae_ft_in22k_in1k) |87.26 |98.248|224 |197.96 |34.4 |43.13 |376.84 |256 |
| [convnext_base.clip_laion2b_augreg_ft_in12k_in1k_384](https://huggingface.co/timm/convnext_base.clip_laion2b_augreg_ft_in12k_in1k_384) |87.138|98.212|384 |88.59 |45.21 |84.49 |365.47 |256 |
| [convnext_xlarge.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_xlarge.fb_in22k_ft_in1k) |87.002|98.208|224 |350.2 |60.98 |57.5 |368.01 |256 |
| [convnext_base.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_base.fb_in22k_ft_in1k_384) |86.796|98.264|384 |88.59 |45.21 |84.49 |366.54 |256 |
| [convnextv2_base.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_base.fcmae_ft_in22k_in1k) |86.74 |98.022|224 |88.72 |15.38 |28.75 |624.23 |256 |
| [convnext_large.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_large.fb_in22k_ft_in1k) |86.636|98.028|224 |197.77 |34.4 |43.13 |581.43 |256 |
| [convnext_base.clip_laiona_augreg_ft_in1k_384](https://huggingface.co/timm/convnext_base.clip_laiona_augreg_ft_in1k_384) |86.504|97.97 |384 |88.59 |45.21 |84.49 |368.14 |256 |
| [convnext_base.clip_laion2b_augreg_ft_in12k_in1k](https://huggingface.co/timm/convnext_base.clip_laion2b_augreg_ft_in12k_in1k) |86.344|97.97 |256 |88.59 |20.09 |37.55 |816.14 |256 |
| [convnextv2_huge.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_huge.fcmae_ft_in1k) |86.256|97.75 |224 |660.29 |115.0 |79.07 |154.72 |256 |
| [convnext_small.in12k_ft_in1k_384](https://huggingface.co/timm/convnext_small.in12k_ft_in1k_384) |86.182|97.92 |384 |50.22 |25.58 |63.37 |516.19 |256 |
| [convnext_base.clip_laion2b_augreg_ft_in1k](https://huggingface.co/timm/convnext_base.clip_laion2b_augreg_ft_in1k) |86.154|97.68 |256 |88.59 |20.09 |37.55 |819.86 |256 |
| [convnext_base.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_base.fb_in22k_ft_in1k) |85.822|97.866|224 |88.59 |15.38 |28.75 |1037.66 |256 |
| [convnext_small.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_small.fb_in22k_ft_in1k_384) |85.778|97.886|384 |50.22 |25.58 |63.37 |518.95 |256 |
| [convnextv2_large.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_large.fcmae_ft_in1k) |85.742|97.584|224 |197.96 |34.4 |43.13 |375.23 |256 |
| [convnext_small.in12k_ft_in1k](https://huggingface.co/timm/convnext_small.in12k_ft_in1k) |85.174|97.506|224 |50.22 |8.71 |21.56 |1474.31 |256 |
| [convnext_tiny.in12k_ft_in1k_384](https://huggingface.co/timm/convnext_tiny.in12k_ft_in1k_384) |85.118|97.608|384 |28.59 |13.14 |39.48 |856.76 |256 |
| [convnextv2_tiny.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_tiny.fcmae_ft_in22k_in1k_384) |85.112|97.63 |384 |28.64 |13.14 |39.48 |491.32 |256 |
| [convnextv2_base.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_base.fcmae_ft_in1k) |84.874|97.09 |224 |88.72 |15.38 |28.75 |625.33 |256 |
| [convnext_small.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_small.fb_in22k_ft_in1k) |84.562|97.394|224 |50.22 |8.71 |21.56 |1478.29 |256 |
| [convnext_large.fb_in1k](https://huggingface.co/timm/convnext_large.fb_in1k) |84.282|96.892|224 |197.77 |34.4 |43.13 |584.28 |256 |
| [convnext_tiny.in12k_ft_in1k](https://huggingface.co/timm/convnext_tiny.in12k_ft_in1k) |84.186|97.124|224 |28.59 |4.47 |13.44 |2433.7 |256 |
| [convnext_tiny.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_tiny.fb_in22k_ft_in1k_384) |84.084|97.14 |384 |28.59 |13.14 |39.48 |862.95 |256 |
| [convnextv2_tiny.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_tiny.fcmae_ft_in22k_in1k) |83.894|96.964|224 |28.64 |4.47 |13.44 |1452.72 |256 |
| [convnext_base.fb_in1k](https://huggingface.co/timm/convnext_base.fb_in1k) |83.82 |96.746|224 |88.59 |15.38 |28.75 |1054.0 |256 |
| [convnextv2_nano.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_nano.fcmae_ft_in22k_in1k_384) |83.37 |96.742|384 |15.62 |7.22 |24.61 |801.72 |256 |
| [convnext_small.fb_in1k](https://huggingface.co/timm/convnext_small.fb_in1k) |83.142|96.434|224 |50.22 |8.71 |21.56 |1464.0 |256 |
| [convnextv2_tiny.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_tiny.fcmae_ft_in1k) |82.92 |96.284|224 |28.64 |4.47 |13.44 |1425.62 |256 |
| [convnext_tiny.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_tiny.fb_in22k_ft_in1k) |82.898|96.616|224 |28.59 |4.47 |13.44 |2480.88 |256 |
| [convnext_nano.in12k_ft_in1k](https://huggingface.co/timm/convnext_nano.in12k_ft_in1k) |82.282|96.344|224 |15.59 |2.46 |8.37 |3926.52 |256 |
| [convnext_tiny_hnf.a2h_in1k](https://huggingface.co/timm/convnext_tiny_hnf.a2h_in1k) |82.216|95.852|224 |28.59 |4.47 |13.44 |2529.75 |256 |
| [convnext_tiny.fb_in1k](https://huggingface.co/timm/convnext_tiny.fb_in1k) |82.066|95.854|224 |28.59 |4.47 |13.44 |2346.26 |256 |
| [convnextv2_nano.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_nano.fcmae_ft_in22k_in1k) |82.03 |96.166|224 |15.62 |2.46 |8.37 |2300.18 |256 |
| [convnextv2_nano.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_nano.fcmae_ft_in1k) |81.83 |95.738|224 |15.62 |2.46 |8.37 |2321.48 |256 |
| [convnext_nano_ols.d1h_in1k](https://huggingface.co/timm/convnext_nano_ols.d1h_in1k) |80.866|95.246|224 |15.65 |2.65 |9.38 |3523.85 |256 |
| [convnext_nano.d1h_in1k](https://huggingface.co/timm/convnext_nano.d1h_in1k) |80.768|95.334|224 |15.59 |2.46 |8.37 |3915.58 |256 |
| [convnextv2_pico.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_pico.fcmae_ft_in1k) |80.304|95.072|224 |9.07 |1.37 |6.1 |3274.57 |256 |
| [convnext_pico.d1_in1k](https://huggingface.co/timm/convnext_pico.d1_in1k) |79.526|94.558|224 |9.05 |1.37 |6.1 |5686.88 |256 |
| [convnext_pico_ols.d1_in1k](https://huggingface.co/timm/convnext_pico_ols.d1_in1k) |79.522|94.692|224 |9.06 |1.43 |6.5 |5422.46 |256 |
| [convnextv2_femto.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_femto.fcmae_ft_in1k) |78.488|93.98 |224 |5.23 |0.79 |4.57 |4264.2 |256 |
| [convnext_femto_ols.d1_in1k](https://huggingface.co/timm/convnext_femto_ols.d1_in1k) |77.86 |93.83 |224 |5.23 |0.82 |4.87 |6910.6 |256 |
| [convnext_femto.d1_in1k](https://huggingface.co/timm/convnext_femto.d1_in1k) |77.454|93.68 |224 |5.22 |0.79 |4.57 |7189.92 |256 |
| [convnextv2_atto.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_atto.fcmae_ft_in1k) |76.664|93.044|224 |3.71 |0.55 |3.81 |4728.91 |256 |
| [convnext_atto_ols.a2_in1k](https://huggingface.co/timm/convnext_atto_ols.a2_in1k) |75.88 |92.846|224 |3.7 |0.58 |4.11 |7963.16 |256 |
| [convnext_atto.d2_in1k](https://huggingface.co/timm/convnext_atto.d2_in1k) |75.664|92.9 |224 |3.7 |0.55 |3.81 |8439.22 |256 |
## Citation
```bibtex
@article{liu2022convnet,
author = {Zhuang Liu and Hanzi Mao and Chao-Yuan Wu and Christoph Feichtenhofer and Trevor Darrell and Saining Xie},
title = {A ConvNet for the 2020s},
journal = {Proceedings of the IEEE/CVF Conference on Computer Vision and Pattern Recognition (CVPR)},
year = {2022},
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
| 15,748 | [
[
-0.06756591796875,
-0.0323486328125,
-0.003658294677734375,
0.037994384765625,
-0.031890869140625,
-0.015716552734375,
-0.012969970703125,
-0.035369873046875,
0.06427001953125,
0.017303466796875,
-0.04473876953125,
-0.0418701171875,
-0.050628662109375,
-0.00... |
InstaDeepAI/nucleotide-transformer-v2-500m-multi-species | 2023-10-11T12:28:32.000Z | [
"transformers",
"pytorch",
"fill-mask",
"DNA",
"biology",
"genomics",
"custom_code",
"dataset:InstaDeepAI/multi_species_genome",
"dataset:InstaDeepAI/nucleotide_transformer_downstream_tasks",
"license:cc-by-nc-sa-4.0",
"autotrain_compatible",
"endpoints_compatible",
"has_space",
"region:us... | fill-mask | InstaDeepAI | null | null | InstaDeepAI/nucleotide-transformer-v2-500m-multi-species | 1 | 922 | transformers | 2023-07-27T09:04:55 | ---
license: cc-by-nc-sa-4.0
widget:
- text: ACCTGA<mask>TTCTGAGTC
tags:
- DNA
- biology
- genomics
datasets:
- InstaDeepAI/multi_species_genome
- InstaDeepAI/nucleotide_transformer_downstream_tasks
---
# nucleotide-transformer-v2-500m-multi-species
The Nucleotide Transformers are a collection of foundational language models that were pre-trained on DNA sequences from whole-genomes. Compared to other approaches, our models do not only integrate information from single reference genomes, but leverage DNA sequences from over 3,200 diverse human genomes, as well as 850 genomes from a wide range of species, including model and non-model organisms. Through robust and extensive evaluation, we show that these large models provide extremely accurate molecular phenotype prediction compared to existing methods
Part of this collection is the **nucleotide-transformer-v2-500m-multi-species**, a 500m parameters transformer pre-trained on a collection of 850 genomes from a wide range of species, including model and non-model organisms.
**Developed by:** InstaDeep, NVIDIA and TUM
### Model Sources
<!-- Provide the basic links for the model. -->
- **Repository:** [Nucleotide Transformer](https://github.com/instadeepai/nucleotide-transformer)
- **Paper:** [The Nucleotide Transformer: Building and Evaluating Robust Foundation Models for Human Genomics](https://www.biorxiv.org/content/10.1101/2023.01.11.523679v1)
### How to use
<!-- Need to adapt this section to our model. Need to figure out how to load the models from huggingface and do inference on them -->
Until its next release, the `transformers` library needs to be installed from source with the following command in order to use the models:
```bash
pip install --upgrade git+https://github.com/huggingface/transformers.git
```
A small snippet of code is given here in order to retrieve both logits and embeddings from a dummy DNA sequence.
```python
from transformers import AutoTokenizer, AutoModelForMaskedLM
import torch
# Import the tokenizer and the model
tokenizer = AutoTokenizer.from_pretrained("InstaDeepAI/nucleotide-transformer-v2-500m-multi-species", trust_remote_code=True)
model = AutoModelForMaskedLM.from_pretrained("InstaDeepAI/nucleotide-transformer-v2-500m-multi-species", trust_remote_code=True)
# Choose the length to which the input sequences are padded. By default, the
# model max length is chosen, but feel free to decrease it as the time taken to
# obtain the embeddings increases significantly with it.
max_length = tokenizer.model_max_length
# Create a dummy dna sequence and tokenize it
sequences = ["ATTCCGATTCCGATTCCG", "ATTTCTCTCTCTCTCTGAGATCGATCGATCGAT"]
tokens_ids = tokenizer.batch_encode_plus(sequences, return_tensors="pt", padding="max_length", max_length = max_length)["input_ids"]
# Compute the embeddings
attention_mask = tokens_ids != tokenizer.pad_token_id
torch_outs = model(
tokens_ids,
attention_mask=attention_mask,
encoder_attention_mask=attention_mask,
output_hidden_states=True
)
# Compute sequences embeddings
embeddings = torch_outs['hidden_states'][-1].detach().numpy()
print(f"Embeddings shape: {embeddings.shape}")
print(f"Embeddings per token: {embeddings}")
# Add embed dimension axis
attention_mask = torch.unsqueeze(attention_mask, dim=-1)
# Compute mean embeddings per sequence
mean_sequence_embeddings = torch.sum(attention_mask*embeddings, axis=-2)/torch.sum(attention_mask, axis=1)
print(f"Mean sequence embeddings: {mean_sequence_embeddings}")
```
## Training data
The **nucleotide-transformer-v2-500m-multi-species** model was pretrained on a total of 850 genomes downloaded from [NCBI](https://www.ncbi.nlm.nih.gov/). Plants and viruses are not included in these genomes, as their regulatory elements differ from those of interest in the paper's tasks. Some heavily studied model organisms were picked to be included in the collection of genomes, which represents a total of 174B nucleotides, i.e roughly 29B tokens. The data has been released as a HuggingFace dataset [here](https://huggingface.co/datasets/InstaDeepAI/multi_species_genomes).
## Training procedure
### Preprocessing
The DNA sequences are tokenized using the Nucleotide Transformer Tokenizer, which tokenizes sequences as 6-mers tokenizer when possible, otherwise tokenizing each nucleotide separately as described in the [Tokenization](https://github.com/instadeepai/nucleotide-transformer#tokenization-abc) section of the associated repository. This tokenizer has a vocabulary size of 4105. The inputs of the model are then of the form:
```
<CLS> <ACGTGT> <ACGTGC> <ACGGAC> <GACTAG> <TCAGCA>
```
The tokenized sequence have a maximum length of 1,000.
The masking procedure used is the standard one for Bert-style training:
- 15% of the tokens are masked.
- In 80% of the cases, the masked tokens are replaced by `[MASK]`.
- In 10% of the cases, the masked tokens are replaced by a random token (different) from the one they replace.
- In the 10% remaining cases, the masked tokens are left as is.
### Pretraining
The model was trained with 8 A100 80GB on 900B tokens, with an effective batch size of 1M tokens. The sequence length used was 1000 tokens. The Adam optimizer [38] was used with a learning rate schedule, and standard values for exponential decay rates and epsilon constants, β1 = 0.9, β2 = 0.999 and ε=1e-8. During a first warmup period, the learning rate was increased linearly between 5e-5 and 1e-4 over 16k steps before decreasing following a square root decay until the end of training.
### Architecture
The model belongs to the second generation of nucleotide transformers, with the changes in architecture consisting the use of rotary positional embeddings instead of learned ones, as well as the introduction of Gated Linear Units.
### BibTeX entry and citation info
```bibtex
@article{dalla2023nucleotide,
title={The Nucleotide Transformer: Building and Evaluating Robust Foundation Models for Human Genomics},
author={Dalla-Torre, Hugo and Gonzalez, Liam and Mendoza Revilla, Javier and Lopez Carranza, Nicolas and Henryk Grywaczewski, Adam and Oteri, Francesco and Dallago, Christian and Trop, Evan and Sirelkhatim, Hassan and Richard, Guillaume and others},
journal={bioRxiv},
pages={2023--01},
year={2023},
publisher={Cold Spring Harbor Laboratory}
}
``` | 6,342 | [
[
-0.044891357421875,
-0.04193115234375,
0.006885528564453125,
-0.0032196044921875,
-0.0302886962890625,
0.004062652587890625,
-0.00665283203125,
-0.012664794921875,
0.03448486328125,
0.0162811279296875,
-0.033843994140625,
-0.025909423828125,
-0.05859375,
0.0... |
timm/vit_huge_patch14_clip_336.laion2b_ft_in12k_in1k | 2023-05-06T00:09:27.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"dataset:laion-2b",
"dataset:imagenet-12k",
"arxiv:2212.07143",
"arxiv:2210.08402",
"arxiv:2010.11929",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/vit_huge_patch14_clip_336.laion2b_ft_in12k_in1k | 0 | 921 | timm | 2022-11-02T18:58:38 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
- laion-2b
- imagenet-12k
---
# Model card for vit_huge_patch14_clip_336.laion2b_ft_in12k_in1k
A Vision Transformer (ViT) image classification model. Pretrained on LAION-2B image-text pairs using OpenCLIP. Fine-tuned on ImageNet-12k and then ImageNet-1k in `timm`. See recipes in [Reproducible scaling laws](https://arxiv.org/abs/2212.07143).
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 632.5
- GMACs: 363.7
- Activations (M): 213.4
- Image size: 336 x 336
- **Papers:**
- OpenCLIP: https://github.com/mlfoundations/open_clip
- Reproducible scaling laws for contrastive language-image learning: https://arxiv.org/abs/2212.07143
- LAION-5B: An open large-scale dataset for training next generation image-text models: https://arxiv.org/abs/2210.08402
- An Image is Worth 16x16 Words: Transformers for Image Recognition at Scale: https://arxiv.org/abs/2010.11929v2
- **Dataset:** ImageNet-1k
- **Pretrain Dataset:**
- LAION-2B
- ImageNet-12k
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('vit_huge_patch14_clip_336.laion2b_ft_in12k_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'vit_huge_patch14_clip_336.laion2b_ft_in12k_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 577, 1280) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@software{ilharco_gabriel_2021_5143773,
author = {Ilharco, Gabriel and
Wortsman, Mitchell and
Wightman, Ross and
Gordon, Cade and
Carlini, Nicholas and
Taori, Rohan and
Dave, Achal and
Shankar, Vaishaal and
Namkoong, Hongseok and
Miller, John and
Hajishirzi, Hannaneh and
Farhadi, Ali and
Schmidt, Ludwig},
title = {OpenCLIP},
month = jul,
year = 2021,
note = {If you use this software, please cite it as below.},
publisher = {Zenodo},
version = {0.1},
doi = {10.5281/zenodo.5143773},
url = {https://doi.org/10.5281/zenodo.5143773}
}
```
```bibtex
@article{cherti2022reproducible,
title={Reproducible scaling laws for contrastive language-image learning},
author={Cherti, Mehdi and Beaumont, Romain and Wightman, Ross and Wortsman, Mitchell and Ilharco, Gabriel and Gordon, Cade and Schuhmann, Christoph and Schmidt, Ludwig and Jitsev, Jenia},
journal={arXiv preprint arXiv:2212.07143},
year={2022}
}
```
```bibtex
@inproceedings{schuhmann2022laionb,
title={{LAION}-5B: An open large-scale dataset for training next generation image-text models},
author={Christoph Schuhmann and
Romain Beaumont and
Richard Vencu and
Cade W Gordon and
Ross Wightman and
Mehdi Cherti and
Theo Coombes and
Aarush Katta and
Clayton Mullis and
Mitchell Wortsman and
Patrick Schramowski and
Srivatsa R Kundurthy and
Katherine Crowson and
Ludwig Schmidt and
Robert Kaczmarczyk and
Jenia Jitsev},
booktitle={Thirty-sixth Conference on Neural Information Processing Systems Datasets and Benchmarks Track},
year={2022},
url={https://openreview.net/forum?id=M3Y74vmsMcY}
}
```
```bibtex
@article{dosovitskiy2020vit,
title={An Image is Worth 16x16 Words: Transformers for Image Recognition at Scale},
author={Dosovitskiy, Alexey and Beyer, Lucas and Kolesnikov, Alexander and Weissenborn, Dirk and Zhai, Xiaohua and Unterthiner, Thomas and Dehghani, Mostafa and Minderer, Matthias and Heigold, Georg and Gelly, Sylvain and Uszkoreit, Jakob and Houlsby, Neil},
journal={ICLR},
year={2021}
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
| 5,766 | [
[
-0.030303955078125,
-0.0281982421875,
0.009857177734375,
0.0121917724609375,
-0.0256805419921875,
-0.0333251953125,
-0.0338134765625,
-0.03155517578125,
0.0107879638671875,
0.0273590087890625,
-0.0301666259765625,
-0.042510986328125,
-0.051300048828125,
-0.0... |
artificialguybr/StoryBookRedmond-V2 | 2023-10-07T19:18:27.000Z | [
"diffusers",
"text-to-image",
"stable-diffusion",
"lora",
"license:creativeml-openrail-m",
"has_space",
"region:us"
] | text-to-image | artificialguybr | null | null | artificialguybr/StoryBookRedmond-V2 | 3 | 921 | diffusers | 2023-10-07T19:15:31 | ---
license: creativeml-openrail-m
tags:
- text-to-image
- stable-diffusion
- lora
- diffusers
base_model: stabilityai/stable-diffusion-xl-base-1.0
instance_prompt: KidsRedmAF, Kids Book
widget:
- text: KidsRedmAF, Kids Book
---
# StoryBook.Redmond V2

StoryBook.Redmond V2 is here!
Test all my lora here: https://huggingface.co/spaces/artificialguybr/artificialguybr-demo-lora
Introducing StorybookRedmond, the ultimate LORA for creating stunning children books images!
I'm grateful for the GPU time from Redmond.AI that allowed me to make this LORA! If you need GPU, then you need the great services from Redmond.AI.
It is based on SD XL 1.0 and fine-tuned on a large dataset.
The LORA has a high capacity to generate Storybook images.
You can use detailed, minimalist, colorful, black and white as tag to control the results.
The tag for the model:KidsRedmAF, Kids Book
LORA is not perfect and sometimes needs more than one gen to create good images.
I really hope you like the LORA and use it.
If you like the model and think it's worth it, you can make a donation to my Patreon or Ko-fi.
Follow me in my twitter to know before all about new models:
https://twitter.com/artificialguybr/ | 1,235 | [
[
-0.0294189453125,
-0.0616455078125,
-0.0021114349365234375,
0.0184478759765625,
-0.031890869140625,
0.00621795654296875,
0.02069091796875,
-0.06964111328125,
0.04315185546875,
0.03570556640625,
-0.049835205078125,
-0.033538818359375,
-0.0192108154296875,
-0.... |
Palak/microsoft_deberta-large_squad | 2021-12-24T18:12:42.000Z | [
"transformers",
"pytorch",
"deberta",
"question-answering",
"generated_from_trainer",
"dataset:squad",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | question-answering | Palak | null | null | Palak/microsoft_deberta-large_squad | 0 | 920 | transformers | 2022-03-02T23:29:04 | ---
tags:
- generated_from_trainer
datasets:
- squad
model-index:
- name: microsoft-deberta-large
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# microsoft-deberta-large
This model is a fine-tuned version of [microsoft_deberta-large](https://huggingface.co/microsoft/deberta-large) on the **squadV1** dataset.
- "eval_exact_match": 87.89025543992432
- "eval_f1": 93.8755152147345
- "eval_samples": 10788
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 3e-05
- train_batch_size: 12
- eval_batch_size: 32
- seed: 42
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: linear
- num_epochs: 3
### Framework versions
- Transformers 4.14.1
- Pytorch 1.9.0
- Datasets 1.16.1
- Tokenizers 0.10.3
| 1,123 | [
[
-0.0271759033203125,
-0.046600341796875,
0.01404571533203125,
0.03173828125,
-0.027008056640625,
-0.005855560302734375,
-0.00162506103515625,
-0.0206298828125,
0.0113067626953125,
0.017303466796875,
-0.06304931640625,
-0.038299560546875,
-0.04864501953125,
-... |
facebook/convnext-large-384 | 2023-09-04T21:22:21.000Z | [
"transformers",
"pytorch",
"tf",
"safetensors",
"convnext",
"image-classification",
"vision",
"dataset:imagenet-1k",
"arxiv:2201.03545",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | image-classification | facebook | null | null | facebook/convnext-large-384 | 0 | 920 | transformers | 2022-03-02T23:29:05 | ---
license: apache-2.0
tags:
- vision
- image-classification
datasets:
- imagenet-1k
widget:
- src: https://huggingface.co/datasets/mishig/sample_images/resolve/main/tiger.jpg
example_title: Tiger
- src: https://huggingface.co/datasets/mishig/sample_images/resolve/main/teapot.jpg
example_title: Teapot
- src: https://huggingface.co/datasets/mishig/sample_images/resolve/main/palace.jpg
example_title: Palace
---
# ConvNeXT (large-sized model)
ConvNeXT model trained on ImageNet-1k at resolution 384x384. It was introduced in the paper [A ConvNet for the 2020s](https://arxiv.org/abs/2201.03545) by Liu et al. and first released in [this repository](https://github.com/facebookresearch/ConvNeXt).
Disclaimer: The team releasing ConvNeXT did not write a model card for this model so this model card has been written by the Hugging Face team.
## Model description
ConvNeXT is a pure convolutional model (ConvNet), inspired by the design of Vision Transformers, that claims to outperform them. The authors started from a ResNet and "modernized" its design by taking the Swin Transformer as inspiration.

## Intended uses & limitations
You can use the raw model for image classification. See the [model hub](https://huggingface.co/models?search=convnext) to look for
fine-tuned versions on a task that interests you.
### How to use
Here is how to use this model to classify an image of the COCO 2017 dataset into one of the 1,000 ImageNet classes:
```python
from transformers import ConvNextFeatureExtractor, ConvNextForImageClassification
import torch
from datasets import load_dataset
dataset = load_dataset("huggingface/cats-image")
image = dataset["test"]["image"][0]
feature_extractor = ConvNextFeatureExtractor.from_pretrained("facebook/convnext-large-384")
model = ConvNextForImageClassification.from_pretrained("facebook/convnext-large-384")
inputs = feature_extractor(image, return_tensors="pt")
with torch.no_grad():
logits = model(**inputs).logits
# model predicts one of the 1000 ImageNet classes
predicted_label = logits.argmax(-1).item()
print(model.config.id2label[predicted_label]),
```
For more code examples, we refer to the [documentation](https://huggingface.co/docs/transformers/master/en/model_doc/convnext).
### BibTeX entry and citation info
```bibtex
@article{DBLP:journals/corr/abs-2201-03545,
author = {Zhuang Liu and
Hanzi Mao and
Chao{-}Yuan Wu and
Christoph Feichtenhofer and
Trevor Darrell and
Saining Xie},
title = {A ConvNet for the 2020s},
journal = {CoRR},
volume = {abs/2201.03545},
year = {2022},
url = {https://arxiv.org/abs/2201.03545},
eprinttype = {arXiv},
eprint = {2201.03545},
timestamp = {Thu, 20 Jan 2022 14:21:35 +0100},
biburl = {https://dblp.org/rec/journals/corr/abs-2201-03545.bib},
bibsource = {dblp computer science bibliography, https://dblp.org}
}
``` | 3,079 | [
[
-0.051910400390625,
-0.037353515625,
-0.010162353515625,
0.011138916015625,
-0.0229644775390625,
-0.0225677490234375,
-0.01073455810546875,
-0.057342529296875,
0.033721923828125,
0.034423828125,
-0.041900634765625,
-0.021636962890625,
-0.03826904296875,
-0.0... |
h2oai/h2ogpt-4096-llama2-13b | 2023-08-24T18:34:43.000Z | [
"transformers",
"pytorch",
"safetensors",
"llama",
"text-generation",
"facebook",
"meta",
"llama-2",
"h2ogpt",
"en",
"license:llama2",
"has_space",
"text-generation-inference",
"region:us"
] | text-generation | h2oai | null | null | h2oai/h2ogpt-4096-llama2-13b | 5 | 919 | transformers | 2023-08-09T17:36:58 | ---
inference: false
language:
- en
license: llama2
model_type: llama
pipeline_tag: text-generation
tags:
- facebook
- meta
- pytorch
- llama
- llama-2
- h2ogpt
---
h2oGPT clone of [Meta's Llama 2 13B](https://huggingface.co/meta-llama/Llama-2-13b-hf).
This model can be fine-tuned with [H2O.ai](https://h2o.ai/) open-source software:
- h2oGPT https://github.com/h2oai/h2ogpt/
- H2O LLM Studio https://h2o.ai/platform/ai-cloud/make/llm-studio/
Try our live [h2oGPT demo](https://gpt.h2o.ai) with side-by-side LLM comparisons and private document chat!
## Model Architecture
```
LlamaForCausalLM(
(model): LlamaModel(
(embed_tokens): Embedding(32000, 5120, padding_idx=0)
(layers): ModuleList(
(0-39): 40 x LlamaDecoderLayer(
(self_attn): LlamaAttention(
(q_proj): Linear(in_features=5120, out_features=5120, bias=False)
(k_proj): Linear(in_features=5120, out_features=5120, bias=False)
(v_proj): Linear(in_features=5120, out_features=5120, bias=False)
(o_proj): Linear(in_features=5120, out_features=5120, bias=False)
(rotary_emb): LlamaRotaryEmbedding()
)
(mlp): LlamaMLP(
(gate_proj): Linear(in_features=5120, out_features=13824, bias=False)
(up_proj): Linear(in_features=5120, out_features=13824, bias=False)
(down_proj): Linear(in_features=13824, out_features=5120, bias=False)
(act_fn): SiLUActivation()
)
(input_layernorm): LlamaRMSNorm()
(post_attention_layernorm): LlamaRMSNorm()
)
)
(norm): LlamaRMSNorm()
)
(lm_head): Linear(in_features=5120, out_features=32000, bias=False)
)
``` | 1,668 | [
[
-0.028289794921875,
-0.052642822265625,
0.044189453125,
0.035919189453125,
-0.0261688232421875,
0.009490966796875,
0.004917144775390625,
-0.0341796875,
0.029296875,
0.0240325927734375,
-0.04815673828125,
-0.0430908203125,
-0.04180908203125,
-0.01736450195312... |
eugenesiow/edsr | 2021-09-13T03:46:42.000Z | [
"transformers",
"EDSR",
"super-image",
"image-super-resolution",
"dataset:eugenesiow/Div2k",
"dataset:eugenesiow/Set5",
"dataset:eugenesiow/Set14",
"dataset:eugenesiow/BSD100",
"dataset:eugenesiow/Urban100",
"arxiv:1707.02921",
"arxiv:2104.07566",
"license:apache-2.0",
"endpoints_compatible"... | null | eugenesiow | null | null | eugenesiow/edsr | 3 | 917 | transformers | 2022-03-02T23:29:05 | ---
license: apache-2.0
tags:
- super-image
- image-super-resolution
datasets:
- eugenesiow/Div2k
- eugenesiow/Set5
- eugenesiow/Set14
- eugenesiow/BSD100
- eugenesiow/Urban100
metrics:
- pnsr
- ssim
---
# Enhanced Deep Residual Networks for Single Image Super-Resolution (EDSR)
EDSR model pre-trained on DIV2K (800 images training, augmented to 4000 images, 100 images validation) for 2x, 3x and 4x image super resolution. It was introduced in the paper [Enhanced Deep Residual Networks for Single Image Super-Resolution](https://arxiv.org/abs/1707.02921) by Lim et al. (2017) and first released in [this repository](https://github.com/sanghyun-son/EDSR-PyTorch).
The goal of image super resolution is to restore a high resolution (HR) image from a single low resolution (LR) image. The image below shows the ground truth (HR), the bicubic upscaling x2 and EDSR upscaling x2.

## Model description
EDSR is a model that uses both deeper and wider architecture (32 ResBlocks and 256 channels) to improve performance. It uses both global and local skip connections, and up-scaling is done at the end of the network. It doesn't use batch normalization layers (input and output have similar distributions, normalizing intermediate features may not be desirable) instead it uses constant scaling layers to ensure stable training. An L1 loss function (absolute error) is used instead of L2 (MSE), the authors showed better performance empirically and it requires less computation.
This is a base model (~5mb vs ~100mb) that includes just 16 ResBlocks and 64 channels.
## Intended uses & limitations
You can use the pre-trained models for upscaling your images 2x, 3x and 4x. You can also use the trainer to train a model on your own dataset.
### How to use
The model can be used with the [super_image](https://github.com/eugenesiow/super-image) library:
```bash
pip install super-image
```
Here is how to use a pre-trained model to upscale your image:
```python
from super_image import EdsrModel, ImageLoader
from PIL import Image
import requests
url = 'https://paperswithcode.com/media/datasets/Set5-0000002728-07a9793f_zA3bDjj.jpg'
image = Image.open(requests.get(url, stream=True).raw)
model = EdsrModel.from_pretrained('eugenesiow/edsr', scale=2) # scale 2, 3 and 4 models available
inputs = ImageLoader.load_image(image)
preds = model(inputs)
ImageLoader.save_image(preds, './scaled_2x.png') # save the output 2x scaled image to `./scaled_2x.png`
ImageLoader.save_compare(inputs, preds, './scaled_2x_compare.png') # save an output comparing the super-image with a bicubic scaling
```
[](https://colab.research.google.com/github/eugenesiow/super-image-notebooks/blob/master/notebooks/Upscale_Images_with_Pretrained_super_image_Models.ipynb "Open in Colab")
## Training data
The models for 2x, 3x and 4x image super resolution were pretrained on [DIV2K](https://huggingface.co/datasets/eugenesiow/Div2k), a dataset of 800 high-quality (2K resolution) images for training, augmented to 4000 images and uses a dev set of 100 validation images (images numbered 801 to 900).
## Training procedure
### Preprocessing
We follow the pre-processing and training method of [Wang et al.](https://arxiv.org/abs/2104.07566).
Low Resolution (LR) images are created by using bicubic interpolation as the resizing method to reduce the size of the High Resolution (HR) images by x2, x3 and x4 times.
During training, RGB patches with size of 64×64 from the LR input are used together with their corresponding HR patches.
Data augmentation is applied to the training set in the pre-processing stage where five images are created from the four corners and center of the original image.
We need the huggingface [datasets](https://huggingface.co/datasets?filter=task_ids:other-other-image-super-resolution) library to download the data:
```bash
pip install datasets
```
The following code gets the data and preprocesses/augments the data.
```python
from datasets import load_dataset
from super_image.data import EvalDataset, TrainDataset, augment_five_crop
augmented_dataset = load_dataset('eugenesiow/Div2k', 'bicubic_x4', split='train')\
.map(augment_five_crop, batched=True, desc="Augmenting Dataset") # download and augment the data with the five_crop method
train_dataset = TrainDataset(augmented_dataset) # prepare the train dataset for loading PyTorch DataLoader
eval_dataset = EvalDataset(load_dataset('eugenesiow/Div2k', 'bicubic_x4', split='validation')) # prepare the eval dataset for the PyTorch DataLoader
```
### Pretraining
The model was trained on GPU. The training code is provided below:
```python
from super_image import Trainer, TrainingArguments, EdsrModel, EdsrConfig
training_args = TrainingArguments(
output_dir='./results', # output directory
num_train_epochs=1000, # total number of training epochs
)
config = EdsrConfig(
scale=4, # train a model to upscale 4x
)
model = EdsrModel(config)
trainer = Trainer(
model=model, # the instantiated model to be trained
args=training_args, # training arguments, defined above
train_dataset=train_dataset, # training dataset
eval_dataset=eval_dataset # evaluation dataset
)
trainer.train()
```
[](https://colab.research.google.com/github/eugenesiow/super-image-notebooks/blob/master/notebooks/Train_super_image_Models.ipynb "Open in Colab")
## Evaluation results
The evaluation metrics include [PSNR](https://en.wikipedia.org/wiki/Peak_signal-to-noise_ratio#Quality_estimation_with_PSNR) and [SSIM](https://en.wikipedia.org/wiki/Structural_similarity#Algorithm).
Evaluation datasets include:
- Set5 - [Bevilacqua et al. (2012)](https://huggingface.co/datasets/eugenesiow/Set5)
- Set14 - [Zeyde et al. (2010)](https://huggingface.co/datasets/eugenesiow/Set14)
- BSD100 - [Martin et al. (2001)](https://huggingface.co/datasets/eugenesiow/BSD100)
- Urban100 - [Huang et al. (2015)](https://huggingface.co/datasets/eugenesiow/Urban100)
The results columns below are represented below as `PSNR/SSIM`. They are compared against a Bicubic baseline.
|Dataset |Scale |Bicubic |edsr |
|--- |--- |--- |--- |
|Set5 |2x |33.64/0.9292 |**38.19/0.9612** |
|Set5 |3x |30.39/0.8678 |**35.31/0.9421** |
|Set5 |4x |28.42/0.8101 |**32.5/0.8986** |
|Set14 |2x |30.22/0.8683 |**33.99/0.9215** |
|Set14 |3x |27.53/0.7737 |**31.18/0.862** |
|Set14 |4x |25.99/0.7023 |**28.92/0.7899** |
|BSD100 |2x |29.55/0.8425 |**33.89/0.9266** |
|BSD100 |3x |27.20/0.7382 |**29.77/0.8224** |
|BSD100 |4x |25.96/0.6672 |**28.62/0.7689** |
|Urban100 |2x |26.66/0.8408 |**32.68/0.9331** |
|Urban100 |3x | |**29.75/0.8825** |
|Urban100 |4x |23.14/0.6573 |**26.53/0.7995** |

You can find a notebook to easily run evaluation on pretrained models below:
[](https://colab.research.google.com/github/eugenesiow/super-image-notebooks/blob/master/notebooks/Evaluate_Pretrained_super_image_Models.ipynb "Open in Colab")
## BibTeX entry and citation info
```bibtex
@InProceedings{Lim_2017_CVPR_Workshops,
author = {Lim, Bee and Son, Sanghyun and Kim, Heewon and Nah, Seungjun and Lee, Kyoung Mu},
title = {Enhanced Deep Residual Networks for Single Image Super-Resolution},
booktitle = {The IEEE Conference on Computer Vision and Pattern Recognition (CVPR) Workshops},
month = {July},
year = {2017}
}
``` | 8,501 | [
[
-0.04901123046875,
-0.03289794921875,
0.004611968994140625,
0.0034942626953125,
-0.021026611328125,
-0.0019779205322265625,
-0.004756927490234375,
-0.031829833984375,
0.0141143798828125,
0.0084381103515625,
-0.03271484375,
-0.019439697265625,
-0.040283203125,
... |
facebook/dinov2-large-imagenet1k-1-layer | 2023-09-15T16:37:58.000Z | [
"transformers",
"pytorch",
"safetensors",
"dinov2",
"image-classification",
"dino",
"vision",
"dataset:imagenet-1k",
"arxiv:2304.07193",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | image-classification | facebook | null | null | facebook/dinov2-large-imagenet1k-1-layer | 0 | 917 | transformers | 2023-09-14T20:04:10 | ---
license: apache-2.0
tags:
- dino
- vision
datasets:
- imagenet-1k
---
# Vision Transformer (large-sized model) trained using DINOv2
Vision Transformer (ViT) model trained using the DINOv2 method. It was introduced in the paper [DINOv2: Learning Robust Visual Features without Supervision](https://arxiv.org/abs/2304.07193) by Oquab et al. and first released in [this repository](https://github.com/facebookresearch/dinov2).
Disclaimer: The team releasing DINOv2 did not write a model card for this model so this model card has been written by the Hugging Face team.
## Model description
The Vision Transformer (ViT) is a transformer encoder model (BERT-like) pretrained on a large collection of images in a self-supervised fashion.
Images are presented to the model as a sequence of fixed-size patches, which are linearly embedded. One also adds a [CLS] token to the beginning of a sequence to use it for classification tasks. One also adds absolute position embeddings before feeding the sequence to the layers of the Transformer encoder.
Note that this model does not include any fine-tuned heads.
By pre-training the model, it learns an inner representation of images that can then be used to extract features useful for downstream tasks: if you have a dataset of labeled images for instance, you can train a standard classifier by placing a linear layer on top of the pre-trained encoder. One typically places a linear layer on top of the [CLS] token, as the last hidden state of this token can be seen as a representation of an entire image.
## Intended uses & limitations
You can use the model for classifying an image among one of the [1000 ImageNet labels](https://huggingface.co/datasets/huggingface/label-files/blob/main/imagenet-1k-id2label.json). See the [model hub](https://huggingface.co/models?search=facebook/dinov2) to look for
other fine-tuned versions on a task that interests you.
### How to use
Here is how to use this model:
```python
from transformers import AutoImageProcessor, AutoModelForImageClassification
from PIL import Image
import requests
url = 'http://images.cocodataset.org/val2017/000000039769.jpg'
image = Image.open(requests.get(url, stream=True).raw)
processor = AutoImageProcessor.from_pretrained('facebook/dinov2-large-imagenet1k-1-layer')
model = AutoModelForImageClassification.from_pretrained('facebook/dinov2-large-imagenet1k-1-layer')
inputs = processor(images=image, return_tensors="pt")
outputs = model(**inputs)
logits = outputs.logits
predicted_class_idx = logits.argmax(-1).item()
print("Predicted class:", model.config.id2label[predicted_class_idx])
```
### BibTeX entry and citation info
```bibtex
misc{oquab2023dinov2,
title={DINOv2: Learning Robust Visual Features without Supervision},
author={Maxime Oquab and Timothée Darcet and Théo Moutakanni and Huy Vo and Marc Szafraniec and Vasil Khalidov and Pierre Fernandez and Daniel Haziza and Francisco Massa and Alaaeldin El-Nouby and Mahmoud Assran and Nicolas Ballas and Wojciech Galuba and Russell Howes and Po-Yao Huang and Shang-Wen Li and Ishan Misra and Michael Rabbat and Vasu Sharma and Gabriel Synnaeve and Hu Xu and Hervé Jegou and Julien Mairal and Patrick Labatut and Armand Joulin and Piotr Bojanowski},
year={2023},
eprint={2304.07193},
archivePrefix={arXiv},
primaryClass={cs.CV}
}
``` | 3,367 | [
[
-0.043304443359375,
-0.028717041015625,
-0.0011577606201171875,
-0.007335662841796875,
-0.0294952392578125,
-0.00817108154296875,
0.00838470458984375,
-0.034881591796875,
0.02264404296875,
0.0355224609375,
-0.03106689453125,
-0.0160675048828125,
-0.0567932128906... |
Helsinki-NLP/opus-mt-mt-en | 2023-08-16T12:01:19.000Z | [
"transformers",
"pytorch",
"tf",
"jax",
"marian",
"text2text-generation",
"translation",
"mt",
"en",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | translation | Helsinki-NLP | null | null | Helsinki-NLP/opus-mt-mt-en | 0 | 916 | transformers | 2022-03-02T23:29:04 | ---
tags:
- translation
license: apache-2.0
---
### opus-mt-mt-en
* source languages: mt
* target languages: en
* OPUS readme: [mt-en](https://github.com/Helsinki-NLP/OPUS-MT-train/blob/master/models/mt-en/README.md)
* dataset: opus
* model: transformer-align
* pre-processing: normalization + SentencePiece
* download original weights: [opus-2020-01-16.zip](https://object.pouta.csc.fi/OPUS-MT-models/mt-en/opus-2020-01-16.zip)
* test set translations: [opus-2020-01-16.test.txt](https://object.pouta.csc.fi/OPUS-MT-models/mt-en/opus-2020-01-16.test.txt)
* test set scores: [opus-2020-01-16.eval.txt](https://object.pouta.csc.fi/OPUS-MT-models/mt-en/opus-2020-01-16.eval.txt)
## Benchmarks
| testset | BLEU | chr-F |
|-----------------------|-------|-------|
| JW300.mt.en | 49.0 | 0.655 |
| Tatoeba.mt.en | 53.3 | 0.685 |
| 851 | [
[
-0.0196990966796875,
-0.029815673828125,
0.0218963623046875,
0.0285797119140625,
-0.0308380126953125,
-0.0255889892578125,
-0.03204345703125,
-0.005733489990234375,
0.004024505615234375,
0.035125732421875,
-0.051513671875,
-0.043670654296875,
-0.046478271484375,... |
Helsinki-NLP/opus-mt-tc-big-en-fr | 2023-10-10T10:25:37.000Z | [
"transformers",
"pytorch",
"tf",
"safetensors",
"marian",
"text2text-generation",
"translation",
"opus-mt-tc",
"en",
"fr",
"license:cc-by-4.0",
"model-index",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | translation | Helsinki-NLP | null | null | Helsinki-NLP/opus-mt-tc-big-en-fr | 2 | 916 | transformers | 2022-04-13T14:07:14 | ---
language:
- en
- fr
tags:
- translation
- opus-mt-tc
license: cc-by-4.0
model-index:
- name: opus-mt-tc-big-en-fr
results:
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: flores101-devtest
type: flores_101
args: eng fra devtest
metrics:
- name: BLEU
type: bleu
value: 52.2
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: multi30k_test_2016_flickr
type: multi30k-2016_flickr
args: eng-fra
metrics:
- name: BLEU
type: bleu
value: 52.4
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: multi30k_test_2017_flickr
type: multi30k-2017_flickr
args: eng-fra
metrics:
- name: BLEU
type: bleu
value: 52.8
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: multi30k_test_2017_mscoco
type: multi30k-2017_mscoco
args: eng-fra
metrics:
- name: BLEU
type: bleu
value: 54.7
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: multi30k_test_2018_flickr
type: multi30k-2018_flickr
args: eng-fra
metrics:
- name: BLEU
type: bleu
value: 43.7
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: news-test2008
type: news-test2008
args: eng-fra
metrics:
- name: BLEU
type: bleu
value: 27.6
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: newsdiscussdev2015
type: newsdiscussdev2015
args: eng-fra
metrics:
- name: BLEU
type: bleu
value: 33.4
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: newsdiscusstest2015
type: newsdiscusstest2015
args: eng-fra
metrics:
- name: BLEU
type: bleu
value: 40.3
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: tatoeba-test-v2021-08-07
type: tatoeba_mt
args: eng-fra
metrics:
- name: BLEU
type: bleu
value: 53.2
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: tico19-test
type: tico19-test
args: eng-fra
metrics:
- name: BLEU
type: bleu
value: 40.6
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: newstest2009
type: wmt-2009-news
args: eng-fra
metrics:
- name: BLEU
type: bleu
value: 30.0
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: newstest2010
type: wmt-2010-news
args: eng-fra
metrics:
- name: BLEU
type: bleu
value: 33.5
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: newstest2011
type: wmt-2011-news
args: eng-fra
metrics:
- name: BLEU
type: bleu
value: 35.0
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: newstest2012
type: wmt-2012-news
args: eng-fra
metrics:
- name: BLEU
type: bleu
value: 32.8
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: newstest2013
type: wmt-2013-news
args: eng-fra
metrics:
- name: BLEU
type: bleu
value: 34.6
- task:
name: Translation eng-fra
type: translation
args: eng-fra
dataset:
name: newstest2014
type: wmt-2014-news
args: eng-fra
metrics:
- name: BLEU
type: bleu
value: 41.9
---
# opus-mt-tc-big-en-fr
Neural machine translation model for translating from English (en) to French (fr).
This model is part of the [OPUS-MT project](https://github.com/Helsinki-NLP/Opus-MT), an effort to make neural machine translation models widely available and accessible for many languages in the world. All models are originally trained using the amazing framework of [Marian NMT](https://marian-nmt.github.io/), an efficient NMT implementation written in pure C++. The models have been converted to pyTorch using the transformers library by huggingface. Training data is taken from [OPUS](https://opus.nlpl.eu/) and training pipelines use the procedures of [OPUS-MT-train](https://github.com/Helsinki-NLP/Opus-MT-train).
* Publications: [OPUS-MT – Building open translation services for the World](https://aclanthology.org/2020.eamt-1.61/) and [The Tatoeba Translation Challenge – Realistic Data Sets for Low Resource and Multilingual MT](https://aclanthology.org/2020.wmt-1.139/) (Please, cite if you use this model.)
```
@inproceedings{tiedemann-thottingal-2020-opus,
title = "{OPUS}-{MT} {--} Building open translation services for the World",
author = {Tiedemann, J{\"o}rg and Thottingal, Santhosh},
booktitle = "Proceedings of the 22nd Annual Conference of the European Association for Machine Translation",
month = nov,
year = "2020",
address = "Lisboa, Portugal",
publisher = "European Association for Machine Translation",
url = "https://aclanthology.org/2020.eamt-1.61",
pages = "479--480",
}
@inproceedings{tiedemann-2020-tatoeba,
title = "The Tatoeba Translation Challenge {--} Realistic Data Sets for Low Resource and Multilingual {MT}",
author = {Tiedemann, J{\"o}rg},
booktitle = "Proceedings of the Fifth Conference on Machine Translation",
month = nov,
year = "2020",
address = "Online",
publisher = "Association for Computational Linguistics",
url = "https://aclanthology.org/2020.wmt-1.139",
pages = "1174--1182",
}
```
## Model info
* Release: 2022-03-09
* source language(s): eng
* target language(s): fra
* model: transformer-big
* data: opusTCv20210807+bt ([source](https://github.com/Helsinki-NLP/Tatoeba-Challenge))
* tokenization: SentencePiece (spm32k,spm32k)
* original model: [opusTCv20210807+bt_transformer-big_2022-03-09.zip](https://object.pouta.csc.fi/Tatoeba-MT-models/eng-fra/opusTCv20210807+bt_transformer-big_2022-03-09.zip)
* more information released models: [OPUS-MT eng-fra README](https://github.com/Helsinki-NLP/Tatoeba-Challenge/tree/master/models/eng-fra/README.md)
## Usage
A short example code:
```python
from transformers import MarianMTModel, MarianTokenizer
src_text = [
"The Portuguese teacher is very demanding.",
"When was your last hearing test?"
]
model_name = "pytorch-models/opus-mt-tc-big-en-fr"
tokenizer = MarianTokenizer.from_pretrained(model_name)
model = MarianMTModel.from_pretrained(model_name)
translated = model.generate(**tokenizer(src_text, return_tensors="pt", padding=True))
for t in translated:
print( tokenizer.decode(t, skip_special_tokens=True) )
# expected output:
# Le professeur de portugais est très exigeant.
# Quand a eu lieu votre dernier test auditif ?
```
You can also use OPUS-MT models with the transformers pipelines, for example:
```python
from transformers import pipeline
pipe = pipeline("translation", model="Helsinki-NLP/opus-mt-tc-big-en-fr")
print(pipe("The Portuguese teacher is very demanding."))
# expected output: Le professeur de portugais est très exigeant.
```
## Benchmarks
* test set translations: [opusTCv20210807+bt_transformer-big_2022-03-09.test.txt](https://object.pouta.csc.fi/Tatoeba-MT-models/eng-fra/opusTCv20210807+bt_transformer-big_2022-03-09.test.txt)
* test set scores: [opusTCv20210807+bt_transformer-big_2022-03-09.eval.txt](https://object.pouta.csc.fi/Tatoeba-MT-models/eng-fra/opusTCv20210807+bt_transformer-big_2022-03-09.eval.txt)
* benchmark results: [benchmark_results.txt](benchmark_results.txt)
* benchmark output: [benchmark_translations.zip](benchmark_translations.zip)
| langpair | testset | chr-F | BLEU | #sent | #words |
|----------|---------|-------|-------|-------|--------|
| eng-fra | tatoeba-test-v2021-08-07 | 0.69621 | 53.2 | 12681 | 106378 |
| eng-fra | flores101-devtest | 0.72494 | 52.2 | 1012 | 28343 |
| eng-fra | multi30k_test_2016_flickr | 0.72361 | 52.4 | 1000 | 13505 |
| eng-fra | multi30k_test_2017_flickr | 0.72826 | 52.8 | 1000 | 12118 |
| eng-fra | multi30k_test_2017_mscoco | 0.73547 | 54.7 | 461 | 5484 |
| eng-fra | multi30k_test_2018_flickr | 0.66723 | 43.7 | 1071 | 15867 |
| eng-fra | newsdiscussdev2015 | 0.60471 | 33.4 | 1500 | 27940 |
| eng-fra | newsdiscusstest2015 | 0.64915 | 40.3 | 1500 | 27975 |
| eng-fra | newssyscomb2009 | 0.58903 | 30.7 | 502 | 12331 |
| eng-fra | news-test2008 | 0.55516 | 27.6 | 2051 | 52685 |
| eng-fra | newstest2009 | 0.57907 | 30.0 | 2525 | 69263 |
| eng-fra | newstest2010 | 0.60156 | 33.5 | 2489 | 66022 |
| eng-fra | newstest2011 | 0.61632 | 35.0 | 3003 | 80626 |
| eng-fra | newstest2012 | 0.59736 | 32.8 | 3003 | 78011 |
| eng-fra | newstest2013 | 0.59700 | 34.6 | 3000 | 70037 |
| eng-fra | newstest2014 | 0.66686 | 41.9 | 3003 | 77306 |
| eng-fra | tico19-test | 0.63022 | 40.6 | 2100 | 64661 |
## Acknowledgements
The work is supported by the [European Language Grid](https://www.european-language-grid.eu/) as [pilot project 2866](https://live.european-language-grid.eu/catalogue/#/resource/projects/2866), by the [FoTran project](https://www.helsinki.fi/en/researchgroups/natural-language-understanding-with-cross-lingual-grounding), funded by the European Research Council (ERC) under the European Union’s Horizon 2020 research and innovation programme (grant agreement No 771113), and the [MeMAD project](https://memad.eu/), funded by the European Union’s Horizon 2020 Research and Innovation Programme under grant agreement No 780069. We are also grateful for the generous computational resources and IT infrastructure provided by [CSC -- IT Center for Science](https://www.csc.fi/), Finland.
## Model conversion info
* transformers version: 4.16.2
* OPUS-MT git hash: 3405783
* port time: Wed Apr 13 17:07:05 EEST 2022
* port machine: LM0-400-22516.local
| 10,302 | [
[
-0.035980224609375,
-0.0462646484375,
0.01425933837890625,
0.023223876953125,
-0.0287322998046875,
-0.0165863037109375,
-0.035675048828125,
-0.0236968994140625,
0.018218994140625,
0.0174560546875,
-0.03485107421875,
-0.04852294921875,
-0.048492431640625,
0.0... |
deepseek-ai/deepseek-coder-33b-base | 2023-11-05T10:29:33.000Z | [
"transformers",
"pytorch",
"llama",
"text-generation",
"license:other",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] | text-generation | deepseek-ai | null | null | deepseek-ai/deepseek-coder-33b-base | 20 | 916 | transformers | 2023-10-28T08:14:27 | ---
license: other
license_name: deepseek-license
license_link: LICENSE
---
<p align="center">
<img width="1000px" alt="DeepSeek Coder" src="https://github.com/deepseek-ai/DeepSeek-Coder/blob/main/pictures/logo.png?raw=true">
</p>
<p align="center"><a href="https://www.deepseek.com/">[🏠Homepage]</a> | <a href="https://coder.deepseek.com/">[🤖 Chat with DeepSeek Coder]</a> | <a href="https://discord.gg/Tc7c45Zzu5">[Discord]</a> | <a href="https://github.com/guoday/assert/blob/main/QR.png?raw=true">[Wechat(微信)]</a> </p>
<hr>
### 1. Introduction of Deepseek Coder
Deepseek Coder is composed of a series of code language models, each trained from scratch on 2T tokens, with a composition of 87% code and 13% natural language in both English and Chinese. We provide various sizes of the code model, ranging from 1B to 33B versions. Each model is pre-trained on project-level code corpus by employing a window size of 16K and a extra fill-in-the-blank task, to support project-level code completion and infilling. For coding capabilities, Deepseek Coder achieves state-of-the-art performance among open-source code models on multiple programming languages and various benchmarks.
- **Massive Training Data**: Trained from scratch on 2T tokens, including 87% code and 13% linguistic data in both English and Chinese languages.
- **Highly Flexible & Scalable**: Offered in model sizes of 1.3B, 5.7B, 6.7B, and 33B, enabling users to choose the setup most suitable for their requirements.
- **Superior Model Performance**: State-of-the-art performance among publicly available code models on HumanEval, MultiPL-E, MBPP, DS-1000, and APPS benchmarks.
- **Advanced Code Completion Capabilities**: A window size of 16K and a fill-in-the-blank task, supporting project-level code completion and infilling tasks.
### 2. Model Summary
deepseek-coder-33b-base is a 33B parameter model with Grouped-Query Attention trained on 2 trillion tokens.
- **Home Page:** [DeepSeek](https://deepseek.com/)
- **Repository:** [deepseek-ai/deepseek-coder](https://github.com/deepseek-ai/deepseek-coder)
- **Chat With DeepSeek Coder:** [DeepSeek-Coder](https://coder.deepseek.com/)
### 3. How to Use
Here give some examples of how to use our model.
#### 1)Code Completion
```python
from transformers import AutoTokenizer, AutoModelForCausalLM
import torch
tokenizer = AutoTokenizer.from_pretrained("deepseek-ai/deepseek-coder-33b-base", trust_remote_code=True)
model = AutoModelForCausalLM.from_pretrained("deepseek-ai/deepseek-coder-33b-base", trust_remote_code=True).cuda()
input_text = "#write a quick sort algorithm"
inputs = tokenizer(input_text, return_tensors="pt").cuda()
outputs = model.generate(**inputs, max_length=128)
print(tokenizer.decode(outputs[0], skip_special_tokens=True))
```
#### 2)Code Insertion
```python
from transformers import AutoTokenizer, AutoModelForCausalLM
import torch
tokenizer = AutoTokenizer.from_pretrained("deepseek-ai/deepseek-coder-33b-base", trust_remote_code=True)
model = AutoModelForCausalLM.from_pretrained("deepseek-ai/deepseek-coder-33b-base", trust_remote_code=True).cuda()
input_text = """<|fim▁begin|>def quick_sort(arr):
if len(arr) <= 1:
return arr
pivot = arr[0]
left = []
right = []
<|fim▁hole|>
if arr[i] < pivot:
left.append(arr[i])
else:
right.append(arr[i])
return quick_sort(left) + [pivot] + quick_sort(right)<|fim▁end|>"""
inputs = tokenizer(input_text, return_tensors="pt").cuda()
outputs = model.generate(**inputs, max_length=128)
print(tokenizer.decode(outputs[0], skip_special_tokens=True)[len(input_text):])
```
#### 3)Repository Level Code Completion
```python
from transformers import AutoTokenizer, AutoModelForCausalLM
tokenizer = AutoTokenizer.from_pretrained("deepseek-ai/deepseek-coder-33b-base", trust_remote_code=True)
model = AutoModelForCausalLM.from_pretrained("deepseek-ai/deepseek-coder-33b-base", trust_remote_code=True).cuda()
input_text = """#utils.py
import torch
from sklearn import datasets
from sklearn.model_selection import train_test_split
from sklearn.preprocessing import StandardScaler
from sklearn.metrics import accuracy_score
def load_data():
iris = datasets.load_iris()
X = iris.data
y = iris.target
# Standardize the data
scaler = StandardScaler()
X = scaler.fit_transform(X)
X_train, X_test, y_train, y_test = train_test_split(X, y, test_size=0.3, random_state=42)
# Convert numpy data to PyTorch tensors
X_train = torch.tensor(X_train, dtype=torch.float32)
X_test = torch.tensor(X_test, dtype=torch.float32)
y_train = torch.tensor(y_train, dtype=torch.int64)
y_test = torch.tensor(y_test, dtype=torch.int64)
return X_train, X_test, y_train, y_test
def evaluate_predictions(y_test, y_pred):
return accuracy_score(y_test, y_pred)
#model.py
import torch
import torch.nn as nn
import torch.optim as optim
from torch.utils.data import DataLoader, TensorDataset
class IrisClassifier(nn.Module):
def __init__(self):
super(IrisClassifier, self).__init__()
self.fc = nn.Sequential(
nn.Linear(4, 16),
nn.ReLU(),
nn.Linear(16, 3)
)
def forward(self, x):
return self.fc(x)
def train_model(self, X_train, y_train, epochs, lr, batch_size):
criterion = nn.CrossEntropyLoss()
optimizer = optim.Adam(self.parameters(), lr=lr)
# Create DataLoader for batches
dataset = TensorDataset(X_train, y_train)
dataloader = DataLoader(dataset, batch_size=batch_size, shuffle=True)
for epoch in range(epochs):
for batch_X, batch_y in dataloader:
optimizer.zero_grad()
outputs = self(batch_X)
loss = criterion(outputs, batch_y)
loss.backward()
optimizer.step()
def predict(self, X_test):
with torch.no_grad():
outputs = self(X_test)
_, predicted = outputs.max(1)
return predicted.numpy()
#main.py
from utils import load_data, evaluate_predictions
from model import IrisClassifier as Classifier
def main():
# Model training and evaluation
"""
inputs = tokenizer(input_text, return_tensors="pt").to(model.device)
outputs = model.generate(**inputs, max_new_tokens=140)
print(tokenizer.decode(outputs[0]))
```
### 4. License
This code repository is licensed under the MIT License. The use of DeepSeek Coder models is subject to the Model License. DeepSeek Coder supports commercial use.
See the [LICENSE-MODEL](https://github.com/deepseek-ai/deepseek-coder/blob/main/LICENSE-MODEL) for more details.
### 5. Contact
If you have any questions, please raise an issue or contact us at [agi_code@deepseek.com](mailto:agi_code@deepseek.com).
| 6,833 | [
[
-0.0266265869140625,
-0.032440185546875,
0.015045166015625,
0.0177764892578125,
-0.016510009765625,
-0.005084991455078125,
-0.01255035400390625,
-0.03387451171875,
-0.00119781494140625,
0.00447845458984375,
-0.037261962890625,
-0.041351318359375,
-0.049774169921... |
facebook/vit-msn-small | 2022-09-30T13:20:37.000Z | [
"transformers",
"pytorch",
"vit_msn",
"feature-extraction",
"vision",
"dataset:imagenet-1k",
"arxiv:2204.07141",
"license:apache-2.0",
"endpoints_compatible",
"has_space",
"region:us"
] | feature-extraction | facebook | null | null | facebook/vit-msn-small | 1 | 915 | transformers | 2022-09-09T06:08:20 | ---
license: apache-2.0
tags:
- vision
datasets:
- imagenet-1k
---
# Vision Transformer (small-sized model) pre-trained with MSN
Vision Transformer (ViT) model pre-trained using the MSN method. It was introduced in the paper [Masked Siamese Networks for Label-Efficient Learning](https://arxiv.org/abs/2204.07141) by Mahmoud Assran, Mathilde Caron, Ishan Misra, Piotr Bojanowski, Florian Bordes, Pascal Vincent, Armand Joulin, Michael Rabbat, Nicolas Ballas and first released in [this repository](https://github.com/facebookresearch/msn).
Disclaimer: The team releasing MSN did not write a model card for this model so this model card has been written by the Hugging Face team.
## Model description
The Vision Transformer (ViT) is a transformer encoder model (BERT-like). Images are presented to the model as a sequence of fixed-size patches.
MSN presents a joint-embedding architecture to match the prototypes of masked patches with that of the unmasked patches. With this setup, their method yields excellent performance in the low-shot and extreme low-shot regimes.
By pre-training the model, it learns an inner representation of images that can then be used to extract features useful for downstream tasks: if you have a dataset of labeled images for instance, you can train a standard classifier by placing a linear layer on top of the pre-trained encoder.
## Intended uses & limitations
You can use the raw model for downstream tasks like image classification. See the [model hub](https://huggingface.co/models?filter=vit_msn) to look for different versions of MSN pre-trained models that interest you. The model is particularly beneficial when you have a few labeled samples in your training set.
### How to use
Here is how to use this backbone encoder:
```python
from transformers import AutoFeatureExtractor, ViTMSNModel
import torch
from PIL import Image
import requests
url = "http://images.cocodataset.org/val2017/000000039769.jpg"
image = Image.open(requests.get(url, stream=True).raw)
feature_extractor = AutoFeatureExtractor.from_pretrained("facebook/vit-msn-small")
model = ViTMSNModel.from_pretrained("facebook/vit-msn-small")
inputs = feature_extractor(images=image, return_tensors="pt")
with torch.no_grad():
outputs = model(**inputs)
last_hidden_states = outputs.last_hidden_state
```
For fine-tuning on image classification use the `ViTMSNForImageClassification` class:
```python
from transformers import AutoFeatureExtractor, ViTMSNForImageClassification
import torch
from PIL import Image
import requests
url = "http://images.cocodataset.org/val2017/000000039769.jpg"
image = Image.open(requests.get(url, stream=True).raw)
feature_extractor = AutoFeatureExtractor.from_pretrained("facebook/vit-msn-small")
model = ViTMSNForImageClassification.from_pretrained("facebook/vit-msn-small")
...
```
### Citation
```bibtex
@article{assran2022masked,
title={Masked Siamese Networks for Label-Efficient Learning},
author={Assran, Mahmoud, and Caron, Mathilde, and Misra, Ishan, and Bojanowski, Piotr, and Bordes, Florian and Vincent, Pascal, and Joulin, Armand, and Rabbat, Michael, and Ballas, Nicolas},
journal={arXiv preprint arXiv:2204.07141},
year={2022}
}
``` | 3,216 | [
[
-0.0438232421875,
-0.0208892822265625,
-0.01448822021484375,
0.00530242919921875,
-0.0272979736328125,
-0.0079498291015625,
-0.006591796875,
-0.029541015625,
0.037445068359375,
0.028533935546875,
-0.04083251953125,
-0.0212554931640625,
-0.055419921875,
-0.00... |
malteos/bloom-1b5-clp-german | 2023-09-11T11:43:05.000Z | [
"transformers",
"pytorch",
"safetensors",
"bloom",
"text-generation",
"de",
"dataset:oscar",
"arxiv:2301.09626",
"license:bigscience-bloom-rail-1.0",
"endpoints_compatible",
"has_space",
"text-generation-inference",
"region:us"
] | text-generation | malteos | null | null | malteos/bloom-1b5-clp-german | 7 | 915 | transformers | 2022-10-18T10:01:57 | ---
license: bigscience-bloom-rail-1.0
language: de
pipeline_tag: text-generation
widget:
- text: >-
In einer schockierenden Entdeckung fanden Wissenschaftler eine Herde
Einhörner, die in
example_title: Einhörner ...
- text: >-
Definiere folgende Wörter
Wort: Einhorn
Definition: Das Einhorn ist ein Fabelwesen von Pferde- oder Ziegengestalt
mit einem geraden Horn auf der Stirnmitte.
Wort: Regierungschef
Definition: Der Regierungschef ist der Leiter der Regierung eines Staates
(z. B. National- oder Gliedstaat).
Wort: Waffendrill
Definition:
example_title: Definiere ...
datasets:
- oscar
---
The multilingual [bloom-1b7](https://huggingface.co/bigscience/bloom-1b7) model adapted to the German language using the [CLP-Transfer](https://arxiv.org/abs/2301.09626) method.
- Tokenizer from https://huggingface.co/malteos/gpt2-xl-wechsel-german
- Trained on the German subset of OSCAR https://huggingface.co/datasets/oscar
## See also
- [malteos/bloom-6b4-clp-german](https://huggingface.co/malteos/bloom-6b4-clp-german)
- [malteos/bloom-6b4-clp-german-oasst-v0.1](https://huggingface.co/malteos/bloom-6b4-clp-german-oasst-v0.1)
| 1,192 | [
[
-0.03460693359375,
-0.0269775390625,
0.034637451171875,
0.028900146484375,
0.0006160736083984375,
0.0024566650390625,
-0.0257110595703125,
-0.05316162109375,
0.0201416015625,
0.01152801513671875,
-0.04901123046875,
-0.029083251953125,
-0.054290771484375,
0.0... |
timm/mixnet_s.ft_in1k | 2023-04-27T21:13:49.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"arxiv:1907.09595",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/mixnet_s.ft_in1k | 0 | 915 | timm | 2022-12-12T23:59:47 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
---
# Model card for mixnet_s.ft_in1k
A MixNet image classification model. Fine-tuned on ImageNet-1k from original Tensorflow "SAME" padding weights for use in PyTorch.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 4.1
- GMACs: 0.3
- Activations (M): 6.3
- Image size: 224 x 224
- **Papers:**
- MixConv: Mixed Depthwise Convolutional Kernels: https://arxiv.org/abs/1907.09595
- **Dataset:** ImageNet-1k
- **Original:** https://github.com/huggingface/pytorch-image-models
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('mixnet_s.ft_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'mixnet_s.ft_in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 16, 112, 112])
# torch.Size([1, 24, 56, 56])
# torch.Size([1, 40, 28, 28])
# torch.Size([1, 120, 14, 14])
# torch.Size([1, 200, 7, 7])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'mixnet_s.ft_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 1536, 7, 7) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
```bibtex
@misc{tan2019mixconv,
title={MixConv: Mixed Depthwise Convolutional Kernels},
author={Mingxing Tan and Quoc V. Le},
year={2019},
eprint={1907.09595},
archivePrefix={arXiv},
primaryClass={cs.CV}
}
```
| 3,919 | [
[
-0.045440673828125,
-0.041015625,
-0.006343841552734375,
0.0163421630859375,
-0.02783203125,
-0.0230865478515625,
-0.0122528076171875,
-0.032684326171875,
0.03131103515625,
0.0256195068359375,
-0.03497314453125,
-0.05126953125,
-0.0546875,
-0.014472961425781... |
bert-base-german-dbmdz-cased | 2022-07-18T20:03:25.000Z | [
"transformers",
"pytorch",
"jax",
"bert",
"fill-mask",
"de",
"license:mit",
"autotrain_compatible",
"endpoints_compatible",
"has_space",
"region:us"
] | fill-mask | null | null | null | bert-base-german-dbmdz-cased | 0 | 914 | transformers | 2022-03-02T23:29:04 | ---
language: de
license: mit
---
This model is the same as [dbmdz/bert-base-german-cased](https://huggingface.co/dbmdz/bert-base-german-cased). See the [dbmdz/bert-base-german-cased model card](https://huggingface.co/dbmdz/bert-base-german-cased) for details on the model. | 274 | [
[
-0.029083251953125,
-0.0667724609375,
0.0184326171875,
0.0254364013671875,
-0.0234375,
-0.002048492431640625,
0.01256561279296875,
-0.019866943359375,
0.054901123046875,
0.052978515625,
-0.08319091796875,
-0.046661376953125,
-0.01161956787109375,
-0.02407836... |
TryStar/CloneDiffusion | 2023-05-10T19:28:23.000Z | [
"diffusers",
"stable-diffusion",
"text-to-image",
"license:creativeml-openrail-m",
"endpoints_compatible",
"has_space",
"diffusers:StableDiffusionPipeline",
"region:us"
] | text-to-image | TryStar | null | null | TryStar/CloneDiffusion | 61 | 914 | diffusers | 2022-11-21T19:40:36 | ---
license: creativeml-openrail-m
tags:
- stable-diffusion
- text-to-image
---
This is the fine-tuned Stable Diffusion model trained on screenshots from The Clone wars TV series. Use the tokens "Clonewars style" in your prompts for the effect.
**If you enjoy my work, please consider supporting me:**
[](https://ko-fi.com/trystar)
## Gradio
We support a [Gradio](https://github.com/gradio-app/gradio) Web UI run CloneDiffusion:
[](https://huggingface.co/spaces/akhaliq/CloneDiffusion)
**Star Wars Characters**

**How to use?**
Use prompt "clonewars style" before your full prompt.
I recommend Steps: 50, Sampler: Euler a and CFG scale: 7
This model was trained using the diffusers based dreambooth training by [TheLastBen](https://colab.research.google.com/github/TheLastBen/fast-stable-diffusion/blob/main/fast-DreamBooth.ipynb)
created by TryStar | 1,275 | [
[
-0.040313720703125,
-0.06494140625,
0.037017822265625,
-0.0142364501953125,
-0.035980224609375,
0.015045166015625,
-0.0010290145874023438,
0.0078125,
0.051177978515625,
0.047882080078125,
-0.041015625,
-0.023895263671875,
-0.0562744140625,
-0.014419555664062... |
timm/beit_large_patch16_384.in22k_ft_in22k_in1k | 2023-05-08T23:29:18.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"dataset:imagenet-22k",
"arxiv:2106.08254",
"arxiv:2010.11929",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/beit_large_patch16_384.in22k_ft_in22k_in1k | 0 | 914 | timm | 2022-12-23T02:30:12 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
- imagenet-22k
---
# Model card for beit_large_patch16_384.in22k_ft_in22k_in1k
A BEiT image classification model. Trained on ImageNet-22k with self-supervised masked image modelling (MIM) using a DALL-E dVAE as visual tokenizer. Fine-tuned on ImageNet-22k and then ImageNet-1k.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 305.0
- GMACs: 191.2
- Activations (M): 270.2
- Image size: 384 x 384
- **Papers:**
- BEiT: BERT Pre-Training of Image Transformers: https://arxiv.org/abs/2106.08254
- An Image is Worth 16x16 Words: Transformers for Image Recognition at Scale: https://arxiv.org/abs/2010.11929v2
- **Dataset:** ImageNet-1k
- **Pretrain Dataset:** ImageNet-22k
- **Original:** https://github.com/microsoft/unilm/tree/master/beit
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('beit_large_patch16_384.in22k_ft_in22k_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'beit_large_patch16_384.in22k_ft_in22k_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 577, 1024) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@article{bao2021beit,
title={Beit: Bert pre-training of image transformers},
author={Bao, Hangbo and Dong, Li and Piao, Songhao and Wei, Furu},
journal={arXiv preprint arXiv:2106.08254},
year={2021}
}
```
```bibtex
@article{dosovitskiy2020vit,
title={An Image is Worth 16x16 Words: Transformers for Image Recognition at Scale},
author={Dosovitskiy, Alexey and Beyer, Lucas and Kolesnikov, Alexander and Weissenborn, Dirk and Zhai, Xiaohua and Unterthiner, Thomas and Dehghani, Mostafa and Minderer, Matthias and Heigold, Georg and Gelly, Sylvain and Uszkoreit, Jakob and Houlsby, Neil},
journal={ICLR},
year={2021}
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
| 3,741 | [
[
-0.0439453125,
-0.0260009765625,
0.00128936767578125,
0.0124053955078125,
-0.031494140625,
-0.018646240234375,
-0.0186920166015625,
-0.039337158203125,
0.018218994140625,
0.027740478515625,
-0.0423583984375,
-0.048492431640625,
-0.05657958984375,
-0.00399398... |
cvssp/audioldm2-music | 2023-08-29T14:41:17.000Z | [
"diffusers",
"arxiv:2308.05734",
"license:cc-by-nc-nd-4.0",
"diffusers:AudioLDM2Pipeline",
"region:us"
] | null | cvssp | null | null | cvssp/audioldm2-music | 2 | 914 | diffusers | 2023-08-21T11:00:44 | ---
license: cc-by-nc-nd-4.0
---
# AudioLDM 2 Music
AudioLDM 2 is a latent text-to-audio diffusion model capable of generating realistic audio samples given any text input.
It is available in the 🧨 Diffusers library from v0.21.0 onwards.
# Model Details
AudioLDM 2 was proposed in the paper [AudioLDM 2: Learning Holistic Audio Generation with Self-supervised Pretraining](https://arxiv.org/abs/2308.05734) by Haohe Liu et al.
AudioLDM takes a text prompt as input and predicts the corresponding audio. It can generate text-conditional sound effects,
human speech and music.
# Checkpoint Details
This is the original, **music** version of the AudioLDM 2 model, also referred to as **audioldm2-music-665k**.
There are three official AudioLDM 2 checkpoints. Two of these checkpoints are applicable to the general task of text-to-audio
generation. The third checkpoint is trained exclusively on text-to-music generation. All checkpoints share the same
model size for the text encoders and VAE. They differ in the size and depth of the UNet. See table below for details on
the three official checkpoints:
| Checkpoint | Task | UNet Model Size | Total Model Size | Training Data / h |
|-----------------------------------------------------------------|---------------|-----------------|------------------|-------------------|
| [audioldm2](https://huggingface.co/cvssp/audioldm2) | Text-to-audio | 350M | 1.1B | 1150k |
| [audioldm2-large](https://huggingface.co/cvssp/audioldm2-large) | Text-to-audio | 750M | 1.5B | 1150k |
| [audioldm2-music](https://huggingface.co/cvssp/audioldm2-music) | Text-to-music | 350M | 1.1B | 665k |
## Model Sources
- [**Original Repository**](https://github.com/haoheliu/audioldm2)
- [**🧨 Diffusers Pipeline**](https://huggingface.co/docs/diffusers/api/pipelines/audioldm2)
- [**Paper**](https://arxiv.org/abs/2308.05734)
- [**Demo**](https://huggingface.co/spaces/haoheliu/audioldm2-text2audio-text2music)
# Usage
First, install the required packages:
```
pip install --upgrade diffusers transformers accelerate
```
## Text-to-Audio
For text-to-audio generation, the [AudioLDM2Pipeline](https://huggingface.co/docs/diffusers/api/pipelines/audioldm2) can be
used to load pre-trained weights and generate text-conditional audio outputs:
```python
from diffusers import AudioLDM2Pipeline
import torch
repo_id = "cvssp/audioldm2-music"
pipe = AudioLDM2Pipeline.from_pretrained(repo_id, torch_dtype=torch.float16)
pipe = pipe.to("cuda")
prompt = "Techno music with a strong, upbeat tempo and high melodic riffs"
audio = pipe(prompt, num_inference_steps=200, audio_length_in_s=10.0).audios[0]
```
The resulting audio output can be saved as a .wav file:
```python
import scipy
scipy.io.wavfile.write("techno.wav", rate=16000, data=audio)
```
Or displayed in a Jupyter Notebook / Google Colab:
```python
from IPython.display import Audio
Audio(audio, rate=16000)
```
## Tips
Prompts:
* Descriptive prompt inputs work best: you can use adjectives to describe the sound (e.g. "high quality" or "clear") and make the prompt context specific (e.g., "water stream in a forest" instead of "stream").
* It's best to use general terms like 'cat' or 'dog' instead of specific names or abstract objects that the model may not be familiar with.
Inference:
* The _quality_ of the predicted audio sample can be controlled by the `num_inference_steps` argument: higher steps give higher quality audio at the expense of slower inference.
* The _length_ of the predicted audio sample can be controlled by varying the `audio_length_in_s` argument.
When evaluating generated waveforms:
* The quality of the generated waveforms can vary significantly based on the seed. Try generating with different seeds until you find a satisfactory generation
* Multiple waveforms can be generated in one go: set `num_waveforms_per_prompt` to a value greater than 1. Automatic scoring will be performed between the generated waveforms and prompt text, and the audios ranked from best to worst accordingly.
The following example demonstrates how to construct a good audio generation using the aforementioned tips:
```python
import scipy
import torch
from diffusers import AudioLDM2Pipeline
# load the pipeline
repo_id = "cvssp/audioldm2-music"
pipe = AudioLDM2Pipeline.from_pretrained(repo_id, torch_dtype=torch.float16)
pipe = pipe.to("cuda")
# define the prompts
prompt = "Techno music with a strong, upbeat tempo and high melodic riffs"
negative_prompt = "Low quality."
# set the seed
generator = torch.Generator("cuda").manual_seed(0)
# run the generation
audio = pipe(
prompt,
negative_prompt=negative_prompt,
num_inference_steps=200,
audio_length_in_s=10.0,
num_waveforms_per_prompt=3,
).audios
# save the best audio sample (index 0) as a .wav file
scipy.io.wavfile.write("techno.wav", rate=16000, data=audio[0])
```
# Citation
**BibTeX:**
```
@article{liu2023audioldm2,
title={"AudioLDM 2: Learning Holistic Audio Generation with Self-supervised Pretraining"},
author={Haohe Liu and Qiao Tian and Yi Yuan and Xubo Liu and Xinhao Mei and Qiuqiang Kong and Yuping Wang and Wenwu Wang and Yuxuan Wang and Mark D. Plumbley},
journal={arXiv preprint arXiv:2308.05734},
year={2023}
}
```
| 5,429 | [
[
-0.035919189453125,
-0.06494140625,
0.039703369140625,
0.0167236328125,
-0.0055389404296875,
-0.0034332275390625,
-0.0159759521484375,
-0.026519775390625,
-0.001667022705078125,
0.034027099609375,
-0.061553955078125,
-0.04986572265625,
-0.03546142578125,
-0.... |
TheBloke/Nous-Hermes-Llama2-70B-GPTQ | 2023-09-27T12:46:00.000Z | [
"transformers",
"safetensors",
"llama",
"text-generation",
"llama-2",
"self-instruct",
"distillation",
"synthetic instruction",
"en",
"license:mit",
"text-generation-inference",
"region:us"
] | text-generation | TheBloke | null | null | TheBloke/Nous-Hermes-Llama2-70B-GPTQ | 6 | 914 | transformers | 2023-08-24T08:35:24 | ---
language:
- en
license:
- mit
tags:
- llama-2
- self-instruct
- distillation
- synthetic instruction
model_name: Nous Hermes Llama2 70B
base_model: NousResearch/Nous-Hermes-Llama2-70b
inference: false
model_creator: NousResearch
model_type: llama
prompt_template: '### Instruction:
{prompt}
### Response:
'
quantized_by: TheBloke
---
<!-- header start -->
<!-- 200823 -->
<div style="width: auto; margin-left: auto; margin-right: auto">
<img src="https://i.imgur.com/EBdldam.jpg" alt="TheBlokeAI" style="width: 100%; min-width: 400px; display: block; margin: auto;">
</div>
<div style="display: flex; justify-content: space-between; width: 100%;">
<div style="display: flex; flex-direction: column; align-items: flex-start;">
<p style="margin-top: 0.5em; margin-bottom: 0em;"><a href="https://discord.gg/theblokeai">Chat & support: TheBloke's Discord server</a></p>
</div>
<div style="display: flex; flex-direction: column; align-items: flex-end;">
<p style="margin-top: 0.5em; margin-bottom: 0em;"><a href="https://www.patreon.com/TheBlokeAI">Want to contribute? TheBloke's Patreon page</a></p>
</div>
</div>
<div style="text-align:center; margin-top: 0em; margin-bottom: 0em"><p style="margin-top: 0.25em; margin-bottom: 0em;">TheBloke's LLM work is generously supported by a grant from <a href="https://a16z.com">andreessen horowitz (a16z)</a></p></div>
<hr style="margin-top: 1.0em; margin-bottom: 1.0em;">
<!-- header end -->
# Nous Hermes Llama2 70B - GPTQ
- Model creator: [NousResearch](https://huggingface.co/NousResearch)
- Original model: [Nous Hermes Llama2 70B](https://huggingface.co/NousResearch/Nous-Hermes-Llama2-70b)
<!-- description start -->
## Description
This repo contains GPTQ model files for [NousResearch's Nous Hermes Llama2 70B](https://huggingface.co/NousResearch/Nous-Hermes-Llama2-70b).
Multiple GPTQ parameter permutations are provided; see Provided Files below for details of the options provided, their parameters, and the software used to create them.
<!-- description end -->
<!-- repositories-available start -->
## Repositories available
* [AWQ model(s) for GPU inference.](https://huggingface.co/TheBloke/Nous-Hermes-Llama2-70B-AWQ)
* [GPTQ models for GPU inference, with multiple quantisation parameter options.](https://huggingface.co/TheBloke/Nous-Hermes-Llama2-70B-GPTQ)
* [2, 3, 4, 5, 6 and 8-bit GGUF models for CPU+GPU inference](https://huggingface.co/TheBloke/Nous-Hermes-Llama2-70B-GGUF)
* [NousResearch's original unquantised fp16 model in pytorch format, for GPU inference and for further conversions](https://huggingface.co/NousResearch/Nous-Hermes-Llama2-70b)
<!-- repositories-available end -->
<!-- prompt-template start -->
## Prompt template: Alpaca-InstructOnly
```
### Instruction:
{prompt}
### Response:
```
<!-- prompt-template end -->
<!-- licensing start -->
## Licensing
The creator of the source model has listed its license as `['mit']`, and this quantization has therefore used that same license.
As this model is based on Llama 2, it is also subject to the Meta Llama 2 license terms, and the license files for that are additionally included. It should therefore be considered as being claimed to be licensed under both licenses. I contacted Hugging Face for clarification on dual licensing but they do not yet have an official position. Should this change, or should Meta provide any feedback on this situation, I will update this section accordingly.
In the meantime, any questions regarding licensing, and in particular how these two licenses might interact, should be directed to the original model repository: [NousResearch's Nous Hermes Llama2 70B](https://huggingface.co/NousResearch/Nous-Hermes-Llama2-70b).
<!-- licensing end -->
<!-- README_GPTQ.md-provided-files start -->
## Provided files and GPTQ parameters
Multiple quantisation parameters are provided, to allow you to choose the best one for your hardware and requirements.
Each separate quant is in a different branch. See below for instructions on fetching from different branches.
All recent GPTQ files are made with AutoGPTQ, and all files in non-main branches are made with AutoGPTQ. Files in the `main` branch which were uploaded before August 2023 were made with GPTQ-for-LLaMa.
<details>
<summary>Explanation of GPTQ parameters</summary>
- Bits: The bit size of the quantised model.
- GS: GPTQ group size. Higher numbers use less VRAM, but have lower quantisation accuracy. "None" is the lowest possible value.
- Act Order: True or False. Also known as `desc_act`. True results in better quantisation accuracy. Some GPTQ clients have had issues with models that use Act Order plus Group Size, but this is generally resolved now.
- Damp %: A GPTQ parameter that affects how samples are processed for quantisation. 0.01 is default, but 0.1 results in slightly better accuracy.
- GPTQ dataset: The dataset used for quantisation. Using a dataset more appropriate to the model's training can improve quantisation accuracy. Note that the GPTQ dataset is not the same as the dataset used to train the model - please refer to the original model repo for details of the training dataset(s).
- Sequence Length: The length of the dataset sequences used for quantisation. Ideally this is the same as the model sequence length. For some very long sequence models (16+K), a lower sequence length may have to be used. Note that a lower sequence length does not limit the sequence length of the quantised model. It only impacts the quantisation accuracy on longer inference sequences.
- ExLlama Compatibility: Whether this file can be loaded with ExLlama, which currently only supports Llama models in 4-bit.
</details>
| Branch | Bits | GS | Act Order | Damp % | GPTQ Dataset | Seq Len | Size | ExLlama | Desc |
| ------ | ---- | -- | --------- | ------ | ------------ | ------- | ---- | ------- | ---- |
| [main](https://huggingface.co/TheBloke/Nous-Hermes-Llama2-70B-GPTQ/tree/main) | 4 | None | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 4096 | 35.33 GB | Yes | 4-bit, with Act Order. No group size, to lower VRAM requirements. |
| [gptq-4bit-32g-actorder_True](https://huggingface.co/TheBloke/Nous-Hermes-Llama2-70B-GPTQ/tree/gptq-4bit-32g-actorder_True) | 4 | 32 | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 4096 | 40.66 GB | Yes | 4-bit, with Act Order and group size 32g. Gives highest possible inference quality, with maximum VRAM usage. |
| [gptq-4bit-64g-actorder_True](https://huggingface.co/TheBloke/Nous-Hermes-Llama2-70B-GPTQ/tree/gptq-4bit-64g-actorder_True) | 4 | 64 | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 4096 | 37.99 GB | Yes | 4-bit, with Act Order and group size 64g. Uses less VRAM than 32g, but with slightly lower accuracy. |
| [gptq-4bit-128g-actorder_True](https://huggingface.co/TheBloke/Nous-Hermes-Llama2-70B-GPTQ/tree/gptq-4bit-128g-actorder_True) | 4 | 128 | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 4096 | 36.65 GB | Yes | 4-bit, with Act Order and group size 128g. Uses even less VRAM than 64g, but with slightly lower accuracy. |
| [gptq-3bit--1g-actorder_True](https://huggingface.co/TheBloke/Nous-Hermes-Llama2-70B-GPTQ/tree/gptq-3bit--1g-actorder_True) | 3 | None | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 4096 | 26.78 GB | No | 3-bit, with Act Order and no group size. Lowest possible VRAM requirements. May be lower quality than 3-bit 128g. |
| [gptq-3bit-128g-actorder_True](https://huggingface.co/TheBloke/Nous-Hermes-Llama2-70B-GPTQ/tree/gptq-3bit-128g-actorder_True) | 3 | 128 | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 4096 | 28.03 GB | No | 3-bit, with group size 128g and act-order. Higher quality than 128g-False. |
<!-- README_GPTQ.md-provided-files end -->
<!-- README_GPTQ.md-download-from-branches start -->
## How to download from branches
- In text-generation-webui, you can add `:branch` to the end of the download name, eg `TheBloke/Nous-Hermes-Llama2-70B-GPTQ:main`
- With Git, you can clone a branch with:
```
git clone --single-branch --branch main https://huggingface.co/TheBloke/Nous-Hermes-Llama2-70B-GPTQ
```
- In Python Transformers code, the branch is the `revision` parameter; see below.
<!-- README_GPTQ.md-download-from-branches end -->
<!-- README_GPTQ.md-text-generation-webui start -->
## How to easily download and use this model in [text-generation-webui](https://github.com/oobabooga/text-generation-webui).
Please make sure you're using the latest version of [text-generation-webui](https://github.com/oobabooga/text-generation-webui).
It is strongly recommended to use the text-generation-webui one-click-installers unless you're sure you know how to make a manual install.
1. Click the **Model tab**.
2. Under **Download custom model or LoRA**, enter `TheBloke/Nous-Hermes-Llama2-70B-GPTQ`.
- To download from a specific branch, enter for example `TheBloke/Nous-Hermes-Llama2-70B-GPTQ:main`
- see Provided Files above for the list of branches for each option.
3. Click **Download**.
4. The model will start downloading. Once it's finished it will say "Done".
5. In the top left, click the refresh icon next to **Model**.
6. In the **Model** dropdown, choose the model you just downloaded: `Nous-Hermes-Llama2-70B-GPTQ`
7. The model will automatically load, and is now ready for use!
8. If you want any custom settings, set them and then click **Save settings for this model** followed by **Reload the Model** in the top right.
* Note that you do not need to and should not set manual GPTQ parameters any more. These are set automatically from the file `quantize_config.json`.
9. Once you're ready, click the **Text Generation tab** and enter a prompt to get started!
<!-- README_GPTQ.md-text-generation-webui end -->
<!-- README_GPTQ.md-use-from-python start -->
## How to use this GPTQ model from Python code
### Install the necessary packages
Requires: Transformers 4.32.0 or later, Optimum 1.12.0 or later, and AutoGPTQ 0.4.2 or later.
```shell
pip3 install transformers>=4.32.0 optimum>=1.12.0
pip3 install auto-gptq --extra-index-url https://huggingface.github.io/autogptq-index/whl/cu118/ # Use cu117 if on CUDA 11.7
```
If you have problems installing AutoGPTQ using the pre-built wheels, install it from source instead:
```shell
pip3 uninstall -y auto-gptq
git clone https://github.com/PanQiWei/AutoGPTQ
cd AutoGPTQ
pip3 install .
```
### For CodeLlama models only: you must use Transformers 4.33.0 or later.
If 4.33.0 is not yet released when you read this, you will need to install Transformers from source:
```shell
pip3 uninstall -y transformers
pip3 install git+https://github.com/huggingface/transformers.git
```
### You can then use the following code
```python
from transformers import AutoModelForCausalLM, AutoTokenizer, pipeline
model_name_or_path = "TheBloke/Nous-Hermes-Llama2-70B-GPTQ"
# To use a different branch, change revision
# For example: revision="main"
model = AutoModelForCausalLM.from_pretrained(model_name_or_path,
device_map="auto",
trust_remote_code=False,
revision="main")
tokenizer = AutoTokenizer.from_pretrained(model_name_or_path, use_fast=True)
prompt = "Tell me about AI"
prompt_template=f'''### Instruction:
{prompt}
### Response:
'''
print("\n\n*** Generate:")
input_ids = tokenizer(prompt_template, return_tensors='pt').input_ids.cuda()
output = model.generate(inputs=input_ids, temperature=0.7, do_sample=True, top_p=0.95, top_k=40, max_new_tokens=512)
print(tokenizer.decode(output[0]))
# Inference can also be done using transformers' pipeline
print("*** Pipeline:")
pipe = pipeline(
"text-generation",
model=model,
tokenizer=tokenizer,
max_new_tokens=512,
do_sample=True,
temperature=0.7,
top_p=0.95,
top_k=40,
repetition_penalty=1.1
)
print(pipe(prompt_template)[0]['generated_text'])
```
<!-- README_GPTQ.md-use-from-python end -->
<!-- README_GPTQ.md-compatibility start -->
## Compatibility
The files provided are tested to work with AutoGPTQ, both via Transformers and using AutoGPTQ directly. They should also work with [Occ4m's GPTQ-for-LLaMa fork](https://github.com/0cc4m/KoboldAI).
[ExLlama](https://github.com/turboderp/exllama) is compatible with Llama models in 4-bit. Please see the Provided Files table above for per-file compatibility.
[Huggingface Text Generation Inference (TGI)](https://github.com/huggingface/text-generation-inference) is compatible with all GPTQ models.
<!-- README_GPTQ.md-compatibility end -->
<!-- footer start -->
<!-- 200823 -->
## Discord
For further support, and discussions on these models and AI in general, join us at:
[TheBloke AI's Discord server](https://discord.gg/theblokeai)
## Thanks, and how to contribute
Thanks to the [chirper.ai](https://chirper.ai) team!
Thanks to Clay from [gpus.llm-utils.org](llm-utils)!
I've had a lot of people ask if they can contribute. I enjoy providing models and helping people, and would love to be able to spend even more time doing it, as well as expanding into new projects like fine tuning/training.
If you're able and willing to contribute it will be most gratefully received and will help me to keep providing more models, and to start work on new AI projects.
Donaters will get priority support on any and all AI/LLM/model questions and requests, access to a private Discord room, plus other benefits.
* Patreon: https://patreon.com/TheBlokeAI
* Ko-Fi: https://ko-fi.com/TheBlokeAI
**Special thanks to**: Aemon Algiz.
**Patreon special mentions**: Alicia Loh, Stephen Murray, K, Ajan Kanaga, RoA, Magnesian, Deo Leter, Olakabola, Eugene Pentland, zynix, Deep Realms, Raymond Fosdick, Elijah Stavena, Iucharbius, Erik Bjäreholt, Luis Javier Navarrete Lozano, Nicholas, theTransient, John Detwiler, alfie_i, knownsqashed, Mano Prime, Willem Michiel, Enrico Ros, LangChain4j, OG, Michael Dempsey, Pierre Kircher, Pedro Madruga, James Bentley, Thomas Belote, Luke @flexchar, Leonard Tan, Johann-Peter Hartmann, Illia Dulskyi, Fen Risland, Chadd, S_X, Jeff Scroggin, Ken Nordquist, Sean Connelly, Artur Olbinski, Swaroop Kallakuri, Jack West, Ai Maven, David Ziegler, Russ Johnson, transmissions 11, John Villwock, Alps Aficionado, Clay Pascal, Viktor Bowallius, Subspace Studios, Rainer Wilmers, Trenton Dambrowitz, vamX, Michael Levine, 준교 김, Brandon Frisco, Kalila, Trailburnt, Randy H, Talal Aujan, Nathan Dryer, Vadim, 阿明, ReadyPlayerEmma, Tiffany J. Kim, George Stoitzev, Spencer Kim, Jerry Meng, Gabriel Tamborski, Cory Kujawski, Jeffrey Morgan, Spiking Neurons AB, Edmond Seymore, Alexandros Triantafyllidis, Lone Striker, Cap'n Zoog, Nikolai Manek, danny, ya boyyy, Derek Yates, usrbinkat, Mandus, TL, Nathan LeClaire, subjectnull, Imad Khwaja, webtim, Raven Klaugh, Asp the Wyvern, Gabriel Puliatti, Caitlyn Gatomon, Joseph William Delisle, Jonathan Leane, Luke Pendergrass, SuperWojo, Sebastain Graf, Will Dee, Fred von Graf, Andrey, Dan Guido, Daniel P. Andersen, Nitin Borwankar, Elle, Vitor Caleffi, biorpg, jjj, NimbleBox.ai, Pieter, Matthew Berman, terasurfer, Michael Davis, Alex, Stanislav Ovsiannikov
Thank you to all my generous patrons and donaters!
And thank you again to a16z for their generous grant.
<!-- footer end -->
# Original model card: NousResearch's Nous Hermes Llama2 70B
# Model Card: Nous-Hermes-Llama2-70b
Compute provided by PygmalionAI, thank you! Follow PygmalionAI on Twitter @pygmalion_ai.
## Model Description
Nous-Hermes-Llama2-70b is a state-of-the-art language model fine-tuned on over 300,000 instructions. This model was fine-tuned by Nous Research, with Teknium and Emozilla leading the fine tuning process and dataset curation, Pygmalion sponsoring the compute, and several other contributors.
This Hermes model uses the exact same dataset as Hermes on Llama-1. This is to ensure consistency between the old Hermes and new, for anyone who wanted to keep Hermes as similar to the old one, just more capable.
This model stands out for its long responses, lower hallucination rate, and absence of OpenAI censorship mechanisms in the synthetic training data. The fine-tuning process was performed with a 4096 sequence length on an 8x H100 80GB machine.
## Model Training
The model was trained almost entirely on synthetic GPT-4 outputs. Curating high quality GPT-4 datasets enables incredibly high quality in knowledge, task completion, and style.
This includes data from diverse sources such as GPTeacher, the general, roleplay v1&2, code instruct datasets, Nous Instruct & PDACTL (unpublished), and several others, detailed further below
## Collaborators
The model fine-tuning and the datasets were a collaboration of efforts and resources between Teknium, Karan4D, Emozilla, Huemin Art, and Pygmalion AI.
Special mention goes to @winglian for assisting in some of the training issues.
Huge shoutout and acknowledgement is deserved for all the dataset creators who generously share their datasets openly.
Among the contributors of datasets:
- GPTeacher was made available by Teknium
- Wizard LM by nlpxucan
- Nous Research Instruct Dataset was provided by Karan4D and HueminArt.
- GPT4-LLM and Unnatural Instructions were provided by Microsoft
- Airoboros dataset by jondurbin
- Camel-AI's domain expert datasets are from Camel-AI
- CodeAlpaca dataset by Sahil 2801.
If anyone was left out, please open a thread in the community tab.
## Prompt Format
The model follows the Alpaca prompt format:
```
### Instruction:
<prompt>
### Response:
<leave a newline blank for model to respond>
```
or
```
### Instruction:
<prompt>
### Input:
<additional context>
### Response:
<leave a newline blank for model to respond>
```
## Benchmarks:
GPT4All Suite:
```
hf-causal-experimental (pretrained=/home/data/axolotl/Nous-Hermes-Llama2-70b,dtype=float16,use_accelerate=True), limit: None, provide_description: False, num_fewshot: 0, batch_size: None
| Task |Version| Metric |Value | |Stderr|
|-------------|------:|--------|-----:|---|-----:|
|arc_challenge| 0|acc |0.5734|± |0.0145|
| | |acc_norm|0.6015|± |0.0143|
|arc_easy | 0|acc |0.8422|± |0.0075|
| | |acc_norm|0.8253|± |0.0078|
|boolq | 1|acc |0.8422|± |0.0064|
|hellaswag | 0|acc |0.6519|± |0.0048|
| | |acc_norm|0.8363|± |0.0037|
|openbookqa | 0|acc |0.3880|± |0.0218|
| | |acc_norm|0.5000|± |0.0224|
|piqa | 0|acc |0.8313|± |0.0087|
| | |acc_norm|0.8351|± |0.0087|
|winogrande | 0|acc |0.7751|± |0.0117|
```
BigBench Suite:
```
hf-causal-experimental (pretrained=/home/data/axolotl/Nous-Hermes-Llama2-70b,dtype=float16,use_accelerate=True), limit: None, provide_description: False, num_fewshot: 0, batch_size: None
| Task |Version| Metric |Value | |Stderr|
|------------------------------------------------|------:|---------------------|-----:|---|-----:|
|bigbench_causal_judgement | 0|multiple_choice_grade|0.6579|± |0.0345|
|bigbench_date_understanding | 0|multiple_choice_grade|0.7344|± |0.0230|
|bigbench_disambiguation_qa | 0|multiple_choice_grade|0.3023|± |0.0286|
|bigbench_geometric_shapes | 0|multiple_choice_grade|0.2340|± |0.0224|
| | |exact_str_match |0.0000|± |0.0000|
|bigbench_logical_deduction_five_objects | 0|multiple_choice_grade|0.2760|± |0.0200|
|bigbench_logical_deduction_seven_objects | 0|multiple_choice_grade|0.1871|± |0.0148|
|bigbench_logical_deduction_three_objects | 0|multiple_choice_grade|0.4467|± |0.0288|
|bigbench_movie_recommendation | 0|multiple_choice_grade|0.3240|± |0.0210|
|bigbench_navigate | 0|multiple_choice_grade|0.5000|± |0.0158|
|bigbench_reasoning_about_colored_objects | 0|multiple_choice_grade|0.6605|± |0.0106|
|bigbench_ruin_names | 0|multiple_choice_grade|0.4598|± |0.0236|
|bigbench_salient_translation_error_detection | 0|multiple_choice_grade|0.2585|± |0.0139|
|bigbench_snarks | 0|multiple_choice_grade|0.6630|± |0.0352|
|bigbench_sports_understanding | 0|multiple_choice_grade|0.7394|± |0.0140|
|bigbench_temporal_sequences | 0|multiple_choice_grade|0.4440|± |0.0157|
|bigbench_tracking_shuffled_objects_five_objects | 0|multiple_choice_grade|0.2168|± |0.0117|
|bigbench_tracking_shuffled_objects_seven_objects| 0|multiple_choice_grade|0.1531|± |0.0086|
|bigbench_tracking_shuffled_objects_three_objects| 0|multiple_choice_grade|0.4467|± |0.0288|
```
AGIEval:
```
hf-causal-experimental (pretrained=/home/data/axolotl/Nous-Hermes-Llama2-70b,dtype=float16,use_accelerate=True), limit: None, provide_description: False, num_fewshot: 0, batch_size: None
| Task |Version| Metric |Value | |Stderr|
|------------------------------|------:|--------|-----:|---|-----:|
|agieval_aqua_rat | 0|acc |0.2480|± |0.0272|
| | |acc_norm|0.2362|± |0.0267|
|agieval_logiqa_en | 0|acc |0.3917|± |0.0191|
| | |acc_norm|0.3932|± |0.0192|
|agieval_lsat_ar | 0|acc |0.2217|± |0.0275|
| | |acc_norm|0.2000|± |0.0264|
|agieval_lsat_lr | 0|acc |0.5765|± |0.0219|
| | |acc_norm|0.4922|± |0.0222|
|agieval_lsat_rc | 0|acc |0.6914|± |0.0282|
| | |acc_norm|0.6022|± |0.0299|
|agieval_sat_en | 0|acc |0.8641|± |0.0239|
| | |acc_norm|0.8204|± |0.0268|
|agieval_sat_en_without_passage| 0|acc |0.5291|± |0.0349|
| | |acc_norm|0.4709|± |0.0349|
|agieval_sat_math | 0|acc |0.4136|± |0.0333|
| | |acc_norm|0.3455|± |0.0321|
```
## Resources for Applied Use Cases:
Check out LM Studio for a nice chatgpt style interface here: https://lmstudio.ai/
For an example of a back and forth chatbot using huggingface transformers and discord, check out: https://github.com/teknium1/alpaca-discord
For an example of a roleplaying discord chatbot, check out this: https://github.com/teknium1/alpaca-roleplay-discordbot
## Future Plans
We plan to continue to iterate on both more high quality data, and new data filtering techniques to eliminate lower quality data going forward.
## Model Usage
The model is available for download on Hugging Face. It is suitable for a wide range of language tasks, from generating creative text to understanding and following complex instructions.
[<img src="https://raw.githubusercontent.com/OpenAccess-AI-Collective/axolotl/main/image/axolotl-badge-web.png" alt="Built with Axolotl" width="200" height="32"/>](https://github.com/OpenAccess-AI-Collective/axolotl)
## Training procedure
The following `bitsandbytes` quantization config was used during training:
- quant_method: bitsandbytes
- load_in_8bit: False
- load_in_4bit: True
- llm_int8_threshold: 6.0
- llm_int8_skip_modules: None
- llm_int8_enable_fp32_cpu_offload: False
- llm_int8_has_fp16_weight: False
- bnb_4bit_quant_type: nf4
- bnb_4bit_use_double_quant: True
- bnb_4bit_compute_dtype: bfloat16
The following `bitsandbytes` quantization config was used during training:
- quant_method: bitsandbytes
- load_in_8bit: False
- load_in_4bit: True
- llm_int8_threshold: 6.0
- llm_int8_skip_modules: None
- llm_int8_enable_fp32_cpu_offload: False
- llm_int8_has_fp16_weight: False
- bnb_4bit_quant_type: nf4
- bnb_4bit_use_double_quant: True
- bnb_4bit_compute_dtype: bfloat16
### Framework versions
- PEFT 0.5.0.dev0
- PEFT 0.5.0.dev0
| 24,530 | [
[
-0.0421142578125,
-0.05059814453125,
0.01399993896484375,
0.018035888671875,
-0.02996826171875,
-0.0063018798828125,
0.00980377197265625,
-0.05133056640625,
0.02520751953125,
0.03179931640625,
-0.05157470703125,
-0.038360595703125,
-0.027679443359375,
-0.006... |
deepseek-ai/deepseek-coder-33b-instruct | 2023-11-05T16:22:50.000Z | [
"transformers",
"pytorch",
"llama",
"text-generation",
"license:other",
"endpoints_compatible",
"has_space",
"text-generation-inference",
"region:us"
] | text-generation | deepseek-ai | null | null | deepseek-ai/deepseek-coder-33b-instruct | 56 | 914 | transformers | 2023-11-01T05:46:34 | ---
license: other
license_name: deepseek
license_link: LICENSE
---
<p align="center">
<img width="1000px" alt="DeepSeek Coder" src="https://github.com/deepseek-ai/DeepSeek-Coder/blob/main/pictures/logo.png?raw=true">
</p>
<p align="center"><a href="https://www.deepseek.com/">[🏠Homepage]</a> | <a href="https://coder.deepseek.com/">[🤖 Chat with DeepSeek Coder]</a> | <a href="https://discord.gg/Tc7c45Zzu5">[Discord]</a> | <a href="https://github.com/guoday/assert/blob/main/QR.png?raw=true">[Wechat(微信)]</a> </p>
<hr>
### 1. Introduction of Deepseek Coder
Deepseek Coder is composed of a series of code language models, each trained from scratch on 2T tokens, with a composition of 87% code and 13% natural language in both English and Chinese. We provide various sizes of the code model, ranging from 1B to 33B versions. Each model is pre-trained on project-level code corpus by employing a window size of 16K and a extra fill-in-the-blank task, to support project-level code completion and infilling. For coding capabilities, Deepseek Coder achieves state-of-the-art performance among open-source code models on multiple programming languages and various benchmarks.
- **Massive Training Data**: Trained from scratch on 2T tokens, including 87% code and 13% linguistic data in both English and Chinese languages.
- **Highly Flexible & Scalable**: Offered in model sizes of 1.3B, 5.7B, 6.7B, and 33B, enabling users to choose the setup most suitable for their requirements.
- **Superior Model Performance**: State-of-the-art performance among publicly available code models on HumanEval, MultiPL-E, MBPP, DS-1000, and APPS benchmarks.
- **Advanced Code Completion Capabilities**: A window size of 16K and a fill-in-the-blank task, supporting project-level code completion and infilling tasks.
### 2. Model Summary
deepseek-coder-33b-instruct is a 33B parameter model initialized from deepseek-coder-33b-base and fine-tuned on 2B tokens of instruction data.
- **Home Page:** [DeepSeek](https://deepseek.com/)
- **Repository:** [deepseek-ai/deepseek-coder](https://github.com/deepseek-ai/deepseek-coder)
- **Chat With DeepSeek Coder:** [DeepSeek-Coder](https://coder.deepseek.com/)
### 3. How to Use
Here give some examples of how to use our model.
#### Chat Model Inference
```python
from transformers import AutoTokenizer, AutoModelForCausalLM
tokenizer = AutoTokenizer.from_pretrained("deepseek-ai/deepseek-coder-33b-instruct", trust_remote_code=True)
model = AutoModelForCausalLM.from_pretrained("deepseek-ai/deepseek-coder-33b-instruct", trust_remote_code=True).cuda()
messages=[
{ 'role': 'user', 'content': "write a quick sort algorithm in python."}
]
inputs = tokenizer.apply_chat_template(messages, return_tensors="pt").to(model.device)
# 32021 is the id of <|EOT|> token
outputs = model.generate(inputs, max_new_tokens=512, do_sample=False, top_k=50, top_p=0.95, num_return_sequences=1, eos_token_id=32021)
print(tokenizer.decode(outputs[0][len(inputs[0]):], skip_special_tokens=True))
```
### 4. License
This code repository is licensed under the MIT License. The use of DeepSeek Coder models is subject to the Model License. DeepSeek Coder supports commercial use.
See the [LICENSE-MODEL](https://github.com/deepseek-ai/deepseek-coder/blob/main/LICENSE-MODEL) for more details.
### 5. Contact
If you have any questions, please raise an issue or contact us at [agi_code@deepseek.com](mailto:agi_code@deepseek.com).
| 3,468 | [
[
-0.0226898193359375,
-0.04730224609375,
0.01325225830078125,
0.0260162353515625,
-0.0216522216796875,
0.010009765625,
-0.016143798828125,
-0.044677734375,
-0.0037097930908203125,
0.0106048583984375,
-0.036468505859375,
-0.042510986328125,
-0.0489501953125,
-... |
UBC-NLP/MARBERTv2 | 2022-03-30T21:52:31.000Z | [
"transformers",
"pytorch",
"tf",
"bert",
"fill-mask",
"Arabic BERT",
"MSA",
"Twitter",
"Masked Langauge Model",
"ar",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | fill-mask | UBC-NLP | null | null | UBC-NLP/MARBERTv2 | 6 | 913 | transformers | 2022-03-02T23:29:05 | ---
language:
- ar
tags:
- Arabic BERT
- MSA
- Twitter
- Masked Langauge Model
widget:
- text: "اللغة العربية هي لغة [MASK]."
---
<img src="https://raw.githubusercontent.com/UBC-NLP/marbert/main/ARBERT_MARBERT.jpg" alt="drawing" width="30%" height="30%" align="right"/>
**MARBERTv2** is one of three models described in our **ACL 2021 paper** **["ARBERT & MARBERT: Deep Bidirectional Transformers for Arabic"](https://aclanthology.org/2021.acl-long.551.pdf)**.
We find that results with ARBERT and MARBERT on QA are not competitive, a clear discrepancy from what we have observed thus far on other tasksWe hypothesize this is because the two models are pre-trained with a sequence length of only 128, which does not allow them to sufficiently capture both a question and its likely answer within the same sequence window during the pre-training.
To rectify this, we further pre-train the stronger model, MARBERT, on the same MSA data as ARBERT in addition to AraNews dataset but with a bigger sequence length of 512 tokens for 40 epochs. We call this
further pre-trained model **MARBERTv2**, noting it has **29B tokens**. MARBERTv2 acquires best performance on all but one test set, where XLM-RLarge marginally outperforms us (only in F1).
For more information, please visit our own GitHub [repo](https://github.com/UBC-NLP/marbert).
# BibTex
If you use our models (ARBERT, MARBERT, or MARBERTv2) for your scientific publication, or if you find the resources in this repository useful, please cite our paper as follows (to be updated):
```bibtex
@inproceedings{abdul-mageed-etal-2021-arbert,
title = "{ARBERT} {\&} {MARBERT}: Deep Bidirectional Transformers for {A}rabic",
author = "Abdul-Mageed, Muhammad and
Elmadany, AbdelRahim and
Nagoudi, El Moatez Billah",
booktitle = "Proceedings of the 59th Annual Meeting of the Association for Computational Linguistics and the 11th International Joint Conference on Natural Language Processing (Volume 1: Long Papers)",
month = aug,
year = "2021",
address = "Online",
publisher = "Association for Computational Linguistics",
url = "https://aclanthology.org/2021.acl-long.551",
doi = "10.18653/v1/2021.acl-long.551",
pages = "7088--7105",
abstract = "Pre-trained language models (LMs) are currently integral to many natural language processing systems. Although multilingual LMs were also introduced to serve many languages, these have limitations such as being costly at inference time and the size and diversity of non-English data involved in their pre-training. We remedy these issues for a collection of diverse Arabic varieties by introducing two powerful deep bidirectional transformer-based models, ARBERT and MARBERT. To evaluate our models, we also introduce ARLUE, a new benchmark for multi-dialectal Arabic language understanding evaluation. ARLUE is built using 42 datasets targeting six different task clusters, allowing us to offer a series of standardized experiments under rich conditions. When fine-tuned on ARLUE, our models collectively achieve new state-of-the-art results across the majority of tasks (37 out of 48 classification tasks, on the 42 datasets). Our best model acquires the highest ARLUE score (77.40) across all six task clusters, outperforming all other models including XLM-R Large ( 3.4x larger size). Our models are publicly available at https://github.com/UBC-NLP/marbert and ARLUE will be released through the same repository.",
}
```
## Acknowledgments
We gratefully acknowledge support from the Natural Sciences and Engineering Research Council of Canada, the Social Sciences and Humanities Research Council of Canada, Canadian Foundation for Innovation, [ComputeCanada](www.computecanada.ca) and [UBC ARC-Sockeye](https://doi.org/10.14288/SOCKEYE). We also thank the [Google TensorFlow Research Cloud (TFRC)](https://www.tensorflow.org/tfrc) program for providing us with free TPU access.
| 4,023 | [
[
-0.044586181640625,
-0.033538818359375,
0.0260162353515625,
0.0157470703125,
-0.01220703125,
-0.0023097991943359375,
-0.023223876953125,
-0.0343017578125,
-0.00685882568359375,
0.0396728515625,
-0.0294647216796875,
-0.051727294921875,
-0.0679931640625,
0.005... |
timm/tf_efficientnet_lite3.in1k | 2023-04-27T21:38:29.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"arxiv:1905.11946",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/tf_efficientnet_lite3.in1k | 0 | 913 | timm | 2022-12-13T00:13:52 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
---
# Model card for tf_efficientnet_lite3.in1k
A EfficientNet-Lite image classification model. Trained on ImageNet-1k in Tensorflow by paper authors, ported to PyTorch by Ross Wightman.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 8.2
- GMACs: 1.7
- Activations (M): 21.8
- Image size: 300 x 300
- **Papers:**
- EfficientNet: Rethinking Model Scaling for Convolutional Neural Networks: https://arxiv.org/abs/1905.11946
- **Dataset:** ImageNet-1k
- **Original:** https://github.com/tensorflow/tpu/tree/master/models/official/efficientnet
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('tf_efficientnet_lite3.in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'tf_efficientnet_lite3.in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 24, 150, 150])
# torch.Size([1, 32, 75, 75])
# torch.Size([1, 48, 38, 38])
# torch.Size([1, 136, 19, 19])
# torch.Size([1, 384, 10, 10])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'tf_efficientnet_lite3.in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 1280, 10, 10) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@inproceedings{tan2019efficientnet,
title={Efficientnet: Rethinking model scaling for convolutional neural networks},
author={Tan, Mingxing and Le, Quoc},
booktitle={International conference on machine learning},
pages={6105--6114},
year={2019},
organization={PMLR}
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
| 4,092 | [
[
-0.026641845703125,
-0.039093017578125,
-0.0012178421020507812,
0.0074615478515625,
-0.0197601318359375,
-0.0338134765625,
-0.025634765625,
-0.0280609130859375,
0.01418304443359375,
0.026763916015625,
-0.0247650146484375,
-0.047882080078125,
-0.052642822265625,
... |
osanseviero/BigGAN-deep-128 | 2022-02-21T13:55:46.000Z | [
"generic",
"pytorch",
"text-to-image",
"has_space",
"region:us"
] | text-to-image | osanseviero | null | null | osanseviero/BigGAN-deep-128 | 14 | 912 | generic | 2022-03-02T23:29:05 | ---
tags:
- text-to-image
library_name: generic
---
# Image generation using pretrained BigGAN
## Warning: This only works for ImageNet inputs.
List of possible inputs: https://gist.github.com/yrevar/942d3a0ac09ec9e5eb3a
GitHub repository: https://github.com/huggingface/pytorch-pretrained-BigGAN
| 309 | [
[
-0.038238525390625,
-0.0384521484375,
0.04022216796875,
0.025482177734375,
-0.042572021484375,
-0.020477294921875,
-0.017913818359375,
-0.01300811767578125,
0.0350341796875,
0.0283050537109375,
-0.0595703125,
-0.0406494140625,
-0.0645751953125,
-0.0072860717... |
line-corporation/japanese-large-lm-1.7b | 2023-08-17T01:06:37.000Z | [
"transformers",
"pytorch",
"safetensors",
"gpt2",
"text-generation",
"ja",
"dataset:wikipedia",
"dataset:mc4",
"dataset:cc100",
"dataset:oscar",
"license:apache-2.0",
"endpoints_compatible",
"has_space",
"text-generation-inference",
"region:us"
] | text-generation | line-corporation | null | null | line-corporation/japanese-large-lm-1.7b | 23 | 911 | transformers | 2023-07-21T00:46:33 | ---
license: apache-2.0
datasets:
- wikipedia
- mc4
- cc100
- oscar
language:
- ja
---
# japanese-large-lm-1.7b
This repository provides a 1.7B parameters Japanese language model, trained by [LINE Corporation](https://linecorp.com/ja/).
[Tech Blog](https://engineering.linecorp.com/ja/blog/3.6-billion-parameter-japanese-language-model) explains details.
## How to use
```
import torch
from transformers import AutoModelForCausalLM, AutoTokenizer, pipeline, set_seed
model = AutoModelForCausalLM.from_pretrained("line-corporation/japanese-large-lm-1.7b", torch_dtype=torch.float16)
tokenizer = AutoTokenizer.from_pretrained("line-corporation/japanese-large-lm-1.7b", use_fast=False)
generator = pipeline("text-generation", model=model, tokenizer=tokenizer, device=0)
set_seed(101)
text = generator(
"おはようございます、今日の天気は",
max_length=30,
do_sample=True,
pad_token_id=tokenizer.pad_token_id,
num_return_sequences=5,
)
for t in text:
print(t)
# [{'generated_text': 'おはようございます、今日の天気は雨模様ですね。梅雨のこの時期の ジメジメ、ムシムシはたまらないですねえ~。 皆さんもお'},
# {'generated_text': 'おはようございます、今日の天気は快晴。 そして、朝8時15分には、 8月9日現在の、 月島・勝どき・'},
# {'generated_text': 'おはようございます、今日の天気は曇りです。 朝起きたら雪がチラついていました。 日中も雪が舞い散るような天気です。 朝から寒いですね。'},
# {'generated_text': 'おはようございます、今日の天気は雨です。昨日、天気が悪く洗濯物を干しにベランダに出た時に雨に降られ、風邪が悪化しそうです。今日洗濯'},
# {'generated_text': 'おはようございます、今日の天気は晴天ですが涼しい1日です、気温は午後になり 若干下がる予報です。 6月も10日を'}]
```
## Model architecture
| Model | Vocab size | Architecture | Position type | Layers | Hidden dim | Attention heads |
| :---: | :--------: | :----------- | :-----------: | :----: | :--------: | :-------------: |
| 1.7B | 51200 | GPT2 | Absolute | 24 | 2304 | 24 |
| 3.6B | 51200 | GPTNeoX | RoPE | 30 | 3072 | 32 |
## Training Corpus
Our training corpus consists of the Japanese portions of publicly available corpus such as C4, CC-100, and Oscar.
We also incorporated the Web texts crawled by in-house system.
The total size of our training corpus is about 650 GB.
The trained model achieves 8.57 perplexity on the internal validation sets of Japanese C4.
## Tokenization
We use a sentencepiece tokenizer with a unigram language model and byte-fallback.
We **do not** apply pre-tokenization with Japanese tokenizer.
Thus, a user may directly feed raw sentences into the tokenizer.
## License
[Apache License, Version 2.0](https://www.apache.org/licenses/LICENSE-2.0) | 2,435 | [
[
-0.033416748046875,
-0.056671142578125,
0.02520751953125,
0.0259246826171875,
-0.05120849609375,
-0.012786865234375,
-0.02325439453125,
-0.019378662109375,
0.01482391357421875,
0.040985107421875,
-0.050689697265625,
-0.056396484375,
-0.03582763671875,
0.0115... |
timm/efficientnet_el_pruned.in1k | 2023-04-27T21:11:59.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"arxiv:2003.02838",
"arxiv:1905.11946",
"arxiv:2002.08258",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/efficientnet_el_pruned.in1k | 0 | 910 | timm | 2022-12-12T23:57:50 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
---
# Model card for efficientnet_el_pruned.in1k
A EfficientNet-EdgeTPU image classification model. Knapsack pruned from existing weights.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 10.6
- GMACs: 8.0
- Activations (M): 30.7
- Image size: 300 x 300
- **Papers:**
- Accelerator-aware Neural Network Design using AutoML: https://arxiv.org/abs/2003.02838
- EfficientNet: Rethinking Model Scaling for Convolutional Neural Networks: https://arxiv.org/abs/1905.11946
- Knapsack Pruning with Inner Distillation: https://arxiv.org/abs/2002.08258
- **Dataset:** ImageNet-1k
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('efficientnet_el_pruned.in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'efficientnet_el_pruned.in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 32, 150, 150])
# torch.Size([1, 40, 75, 75])
# torch.Size([1, 56, 38, 38])
# torch.Size([1, 176, 19, 19])
# torch.Size([1, 232, 10, 10])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'efficientnet_el_pruned.in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 1536, 10, 10) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@article{gupta2020accelerator,
title={Accelerator-aware neural network design using automl},
author={Gupta, Suyog and Akin, Berkin},
journal={arXiv preprint arXiv:2003.02838},
year={2020}
}
```
```bibtex
@inproceedings{tan2019efficientnet,
title={Efficientnet: Rethinking model scaling for convolutional neural networks},
author={Tan, Mingxing and Le, Quoc},
booktitle={International conference on machine learning},
pages={6105--6114},
year={2019},
organization={PMLR}
}
```
```bibtex
@article{aflalo2020knapsack,
title={Knapsack pruning with inner distillation},
author={Aflalo, Yonathan and Noy, Asaf and Lin, Ming and Friedman, Itamar and Zelnik, Lihi},
journal={arXiv preprint arXiv:2002.08258},
year={2020}
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
| 4,590 | [
[
-0.035797119140625,
-0.040924072265625,
-0.0018243789672851562,
0.0099029541015625,
-0.02294921875,
-0.033172607421875,
-0.0236968994140625,
-0.026611328125,
0.00992584228515625,
0.0198211669921875,
-0.031036376953125,
-0.037200927734375,
-0.057220458984375,
... |
timm/convnext_xxlarge.clip_laion2b_soup_ft_in1k | 2023-03-31T23:03:06.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"dataset:laion-2b",
"arxiv:2210.08402",
"arxiv:2201.03545",
"arxiv:2103.00020",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/convnext_xxlarge.clip_laion2b_soup_ft_in1k | 1 | 910 | timm | 2023-03-31T22:51:41 | ---
tags:
- image-classification
- timm
library_tag: timm
license: apache-2.0
datasets:
- imagenet-1k
- laion-2b
---
# Model card for convnext_xxlarge.clip_laion2b_soup_ft_in1k
A ConvNeXt image classification model. CLIP image tower weights pretrained in [OpenCLIP](https://github.com/mlfoundations/open_clip) on LAION and fine-tuned on ImageNet-1k in `timm` by Ross Wightman.
Please see related OpenCLIP model cards for more details on pretrain:
* https://huggingface.co/laion/CLIP-convnext_xxlarge-laion2B-s34B-b82K-augreg-soup
* https://huggingface.co/laion/CLIP-convnext_large_d.laion2B-s26B-b102K-augreg
* https://huggingface.co/laion/CLIP-convnext_base_w-laion2B-s13B-b82K-augreg
* https://huggingface.co/laion/CLIP-convnext_base_w_320-laion_aesthetic-s13B-b82K
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 846.5
- GMACs: 198.1
- Activations (M): 124.5
- Image size: 256 x 256
- **Papers:**
- LAION-5B: An open large-scale dataset for training next generation image-text models: https://arxiv.org/abs/2210.08402
- A ConvNet for the 2020s: https://arxiv.org/abs/2201.03545
- Learning Transferable Visual Models From Natural Language Supervision: https://arxiv.org/abs/2103.00020
- **Original:** https://github.com/mlfoundations/open_clip
- **Pretrain Dataset:** LAION-2B
- **Dataset:** ImageNet-1k
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('convnext_xxlarge.clip_laion2b_soup_ft_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'convnext_xxlarge.clip_laion2b_soup_ft_in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 384, 64, 64])
# torch.Size([1, 768, 32, 32])
# torch.Size([1, 1536, 16, 16])
# torch.Size([1, 3072, 8, 8])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'convnext_xxlarge.clip_laion2b_soup_ft_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 3072, 8, 8) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
All timing numbers from eager model PyTorch 1.13 on RTX 3090 w/ AMP.
| model |top1 |top5 |img_size|param_count|gmacs |macts |samples_per_sec|batch_size|
|------------------------------------------------------------------------------------------------------------------------------|------|------|--------|-----------|------|------|---------------|----------|
| [convnextv2_huge.fcmae_ft_in22k_in1k_512](https://huggingface.co/timm/convnextv2_huge.fcmae_ft_in22k_in1k_512) |88.848|98.742|512 |660.29 |600.81|413.07|28.58 |48 |
| [convnextv2_huge.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_huge.fcmae_ft_in22k_in1k_384) |88.668|98.738|384 |660.29 |337.96|232.35|50.56 |64 |
| [convnext_xxlarge.clip_laion2b_soup_ft_in1k](https://huggingface.co/timm/convnext_xxlarge.clip_laion2b_soup_ft_in1k) |88.612|98.704|256 |846.47 |198.09|124.45|122.45 |256 |
| [convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_384](https://huggingface.co/timm/convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_384) |88.312|98.578|384 |200.13 |101.11|126.74|196.84 |256 |
| [convnextv2_large.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_large.fcmae_ft_in22k_in1k_384) |88.196|98.532|384 |197.96 |101.1 |126.74|128.94 |128 |
| [convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_320](https://huggingface.co/timm/convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_320) |87.968|98.47 |320 |200.13 |70.21 |88.02 |283.42 |256 |
| [convnext_xlarge.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_xlarge.fb_in22k_ft_in1k_384) |87.75 |98.556|384 |350.2 |179.2 |168.99|124.85 |192 |
| [convnextv2_base.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_base.fcmae_ft_in22k_in1k_384) |87.646|98.422|384 |88.72 |45.21 |84.49 |209.51 |256 |
| [convnext_large.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_large.fb_in22k_ft_in1k_384) |87.476|98.382|384 |197.77 |101.1 |126.74|194.66 |256 |
| [convnext_large_mlp.clip_laion2b_augreg_ft_in1k](https://huggingface.co/timm/convnext_large_mlp.clip_laion2b_augreg_ft_in1k) |87.344|98.218|256 |200.13 |44.94 |56.33 |438.08 |256 |
| [convnextv2_large.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_large.fcmae_ft_in22k_in1k) |87.26 |98.248|224 |197.96 |34.4 |43.13 |376.84 |256 |
| [convnext_base.clip_laion2b_augreg_ft_in12k_in1k_384](https://huggingface.co/timm/convnext_base.clip_laion2b_augreg_ft_in12k_in1k_384) |87.138|98.212|384 |88.59 |45.21 |84.49 |365.47 |256 |
| [convnext_xlarge.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_xlarge.fb_in22k_ft_in1k) |87.002|98.208|224 |350.2 |60.98 |57.5 |368.01 |256 |
| [convnext_base.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_base.fb_in22k_ft_in1k_384) |86.796|98.264|384 |88.59 |45.21 |84.49 |366.54 |256 |
| [convnextv2_base.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_base.fcmae_ft_in22k_in1k) |86.74 |98.022|224 |88.72 |15.38 |28.75 |624.23 |256 |
| [convnext_large.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_large.fb_in22k_ft_in1k) |86.636|98.028|224 |197.77 |34.4 |43.13 |581.43 |256 |
| [convnext_base.clip_laiona_augreg_ft_in1k_384](https://huggingface.co/timm/convnext_base.clip_laiona_augreg_ft_in1k_384) |86.504|97.97 |384 |88.59 |45.21 |84.49 |368.14 |256 |
| [convnext_base.clip_laion2b_augreg_ft_in12k_in1k](https://huggingface.co/timm/convnext_base.clip_laion2b_augreg_ft_in12k_in1k) |86.344|97.97 |256 |88.59 |20.09 |37.55 |816.14 |256 |
| [convnextv2_huge.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_huge.fcmae_ft_in1k) |86.256|97.75 |224 |660.29 |115.0 |79.07 |154.72 |256 |
| [convnext_small.in12k_ft_in1k_384](https://huggingface.co/timm/convnext_small.in12k_ft_in1k_384) |86.182|97.92 |384 |50.22 |25.58 |63.37 |516.19 |256 |
| [convnext_base.clip_laion2b_augreg_ft_in1k](https://huggingface.co/timm/convnext_base.clip_laion2b_augreg_ft_in1k) |86.154|97.68 |256 |88.59 |20.09 |37.55 |819.86 |256 |
| [convnext_base.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_base.fb_in22k_ft_in1k) |85.822|97.866|224 |88.59 |15.38 |28.75 |1037.66 |256 |
| [convnext_small.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_small.fb_in22k_ft_in1k_384) |85.778|97.886|384 |50.22 |25.58 |63.37 |518.95 |256 |
| [convnextv2_large.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_large.fcmae_ft_in1k) |85.742|97.584|224 |197.96 |34.4 |43.13 |375.23 |256 |
| [convnext_small.in12k_ft_in1k](https://huggingface.co/timm/convnext_small.in12k_ft_in1k) |85.174|97.506|224 |50.22 |8.71 |21.56 |1474.31 |256 |
| [convnext_tiny.in12k_ft_in1k_384](https://huggingface.co/timm/convnext_tiny.in12k_ft_in1k_384) |85.118|97.608|384 |28.59 |13.14 |39.48 |856.76 |256 |
| [convnextv2_tiny.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_tiny.fcmae_ft_in22k_in1k_384) |85.112|97.63 |384 |28.64 |13.14 |39.48 |491.32 |256 |
| [convnextv2_base.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_base.fcmae_ft_in1k) |84.874|97.09 |224 |88.72 |15.38 |28.75 |625.33 |256 |
| [convnext_small.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_small.fb_in22k_ft_in1k) |84.562|97.394|224 |50.22 |8.71 |21.56 |1478.29 |256 |
| [convnext_large.fb_in1k](https://huggingface.co/timm/convnext_large.fb_in1k) |84.282|96.892|224 |197.77 |34.4 |43.13 |584.28 |256 |
| [convnext_tiny.in12k_ft_in1k](https://huggingface.co/timm/convnext_tiny.in12k_ft_in1k) |84.186|97.124|224 |28.59 |4.47 |13.44 |2433.7 |256 |
| [convnext_tiny.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_tiny.fb_in22k_ft_in1k_384) |84.084|97.14 |384 |28.59 |13.14 |39.48 |862.95 |256 |
| [convnextv2_tiny.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_tiny.fcmae_ft_in22k_in1k) |83.894|96.964|224 |28.64 |4.47 |13.44 |1452.72 |256 |
| [convnext_base.fb_in1k](https://huggingface.co/timm/convnext_base.fb_in1k) |83.82 |96.746|224 |88.59 |15.38 |28.75 |1054.0 |256 |
| [convnextv2_nano.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_nano.fcmae_ft_in22k_in1k_384) |83.37 |96.742|384 |15.62 |7.22 |24.61 |801.72 |256 |
| [convnext_small.fb_in1k](https://huggingface.co/timm/convnext_small.fb_in1k) |83.142|96.434|224 |50.22 |8.71 |21.56 |1464.0 |256 |
| [convnextv2_tiny.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_tiny.fcmae_ft_in1k) |82.92 |96.284|224 |28.64 |4.47 |13.44 |1425.62 |256 |
| [convnext_tiny.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_tiny.fb_in22k_ft_in1k) |82.898|96.616|224 |28.59 |4.47 |13.44 |2480.88 |256 |
| [convnext_nano.in12k_ft_in1k](https://huggingface.co/timm/convnext_nano.in12k_ft_in1k) |82.282|96.344|224 |15.59 |2.46 |8.37 |3926.52 |256 |
| [convnext_tiny_hnf.a2h_in1k](https://huggingface.co/timm/convnext_tiny_hnf.a2h_in1k) |82.216|95.852|224 |28.59 |4.47 |13.44 |2529.75 |256 |
| [convnext_tiny.fb_in1k](https://huggingface.co/timm/convnext_tiny.fb_in1k) |82.066|95.854|224 |28.59 |4.47 |13.44 |2346.26 |256 |
| [convnextv2_nano.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_nano.fcmae_ft_in22k_in1k) |82.03 |96.166|224 |15.62 |2.46 |8.37 |2300.18 |256 |
| [convnextv2_nano.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_nano.fcmae_ft_in1k) |81.83 |95.738|224 |15.62 |2.46 |8.37 |2321.48 |256 |
| [convnext_nano_ols.d1h_in1k](https://huggingface.co/timm/convnext_nano_ols.d1h_in1k) |80.866|95.246|224 |15.65 |2.65 |9.38 |3523.85 |256 |
| [convnext_nano.d1h_in1k](https://huggingface.co/timm/convnext_nano.d1h_in1k) |80.768|95.334|224 |15.59 |2.46 |8.37 |3915.58 |256 |
| [convnextv2_pico.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_pico.fcmae_ft_in1k) |80.304|95.072|224 |9.07 |1.37 |6.1 |3274.57 |256 |
| [convnext_pico.d1_in1k](https://huggingface.co/timm/convnext_pico.d1_in1k) |79.526|94.558|224 |9.05 |1.37 |6.1 |5686.88 |256 |
| [convnext_pico_ols.d1_in1k](https://huggingface.co/timm/convnext_pico_ols.d1_in1k) |79.522|94.692|224 |9.06 |1.43 |6.5 |5422.46 |256 |
| [convnextv2_femto.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_femto.fcmae_ft_in1k) |78.488|93.98 |224 |5.23 |0.79 |4.57 |4264.2 |256 |
| [convnext_femto_ols.d1_in1k](https://huggingface.co/timm/convnext_femto_ols.d1_in1k) |77.86 |93.83 |224 |5.23 |0.82 |4.87 |6910.6 |256 |
| [convnext_femto.d1_in1k](https://huggingface.co/timm/convnext_femto.d1_in1k) |77.454|93.68 |224 |5.22 |0.79 |4.57 |7189.92 |256 |
| [convnextv2_atto.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_atto.fcmae_ft_in1k) |76.664|93.044|224 |3.71 |0.55 |3.81 |4728.91 |256 |
| [convnext_atto_ols.a2_in1k](https://huggingface.co/timm/convnext_atto_ols.a2_in1k) |75.88 |92.846|224 |3.7 |0.58 |4.11 |7963.16 |256 |
| [convnext_atto.d2_in1k](https://huggingface.co/timm/convnext_atto.d2_in1k) |75.664|92.9 |224 |3.7 |0.55 |3.81 |8439.22 |256 |
## Citation
```bibtex
@software{ilharco_gabriel_2021_5143773,
author = {Ilharco, Gabriel and
Wortsman, Mitchell and
Wightman, Ross and
Gordon, Cade and
Carlini, Nicholas and
Taori, Rohan and
Dave, Achal and
Shankar, Vaishaal and
Namkoong, Hongseok and
Miller, John and
Hajishirzi, Hannaneh and
Farhadi, Ali and
Schmidt, Ludwig},
title = {OpenCLIP},
month = jul,
year = 2021,
note = {If you use this software, please cite it as below.},
publisher = {Zenodo},
version = {0.1},
doi = {10.5281/zenodo.5143773},
url = {https://doi.org/10.5281/zenodo.5143773}
}
```
```bibtex
@inproceedings{schuhmann2022laionb,
title={{LAION}-5B: An open large-scale dataset for training next generation image-text models},
author={Christoph Schuhmann and
Romain Beaumont and
Richard Vencu and
Cade W Gordon and
Ross Wightman and
Mehdi Cherti and
Theo Coombes and
Aarush Katta and
Clayton Mullis and
Mitchell Wortsman and
Patrick Schramowski and
Srivatsa R Kundurthy and
Katherine Crowson and
Ludwig Schmidt and
Robert Kaczmarczyk and
Jenia Jitsev},
booktitle={Thirty-sixth Conference on Neural Information Processing Systems Datasets and Benchmarks Track},
year={2022},
url={https://openreview.net/forum?id=M3Y74vmsMcY}
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
```bibtex
@inproceedings{Radford2021LearningTV,
title={Learning Transferable Visual Models From Natural Language Supervision},
author={Alec Radford and Jong Wook Kim and Chris Hallacy and A. Ramesh and Gabriel Goh and Sandhini Agarwal and Girish Sastry and Amanda Askell and Pamela Mishkin and Jack Clark and Gretchen Krueger and Ilya Sutskever},
booktitle={ICML},
year={2021}
}
```
```bibtex
@article{liu2022convnet,
author = {Zhuang Liu and Hanzi Mao and Chao-Yuan Wu and Christoph Feichtenhofer and Trevor Darrell and Saining Xie},
title = {A ConvNet for the 2020s},
journal = {Proceedings of the IEEE/CVF Conference on Computer Vision and Pattern Recognition (CVPR)},
year = {2022},
}
```
| 18,504 | [
[
-0.058319091796875,
-0.035430908203125,
-0.0018663406372070312,
0.036712646484375,
-0.03021240234375,
-0.0182647705078125,
-0.01390838623046875,
-0.032928466796875,
0.057403564453125,
0.0176849365234375,
-0.04132080078125,
-0.043853759765625,
-0.054168701171875,... |
TheBloke/wizardLM-7B-GPTQ | 2023-08-21T13:07:17.000Z | [
"transformers",
"safetensors",
"llama",
"text-generation",
"license:other",
"has_space",
"text-generation-inference",
"region:us"
] | text-generation | TheBloke | null | null | TheBloke/wizardLM-7B-GPTQ | 104 | 910 | transformers | 2023-04-26T08:12:20 | ---
inference: false
license: other
model_type: llama
---
<!-- header start -->
<!-- 200823 -->
<div style="width: auto; margin-left: auto; margin-right: auto">
<img src="https://i.imgur.com/EBdldam.jpg" alt="TheBlokeAI" style="width: 100%; min-width: 400px; display: block; margin: auto;">
</div>
<div style="display: flex; justify-content: space-between; width: 100%;">
<div style="display: flex; flex-direction: column; align-items: flex-start;">
<p style="margin-top: 0.5em; margin-bottom: 0em;"><a href="https://discord.gg/theblokeai">Chat & support: TheBloke's Discord server</a></p>
</div>
<div style="display: flex; flex-direction: column; align-items: flex-end;">
<p style="margin-top: 0.5em; margin-bottom: 0em;"><a href="https://www.patreon.com/TheBlokeAI">Want to contribute? TheBloke's Patreon page</a></p>
</div>
</div>
<div style="text-align:center; margin-top: 0em; margin-bottom: 0em"><p style="margin-top: 0.25em; margin-bottom: 0em;">TheBloke's LLM work is generously supported by a grant from <a href="https://a16z.com">andreessen horowitz (a16z)</a></p></div>
<hr style="margin-top: 1.0em; margin-bottom: 1.0em;">
<!-- header end -->
# WizardLM's WizardLM-7B 4bit GPTQ
These files are GPTQ model files for [WizardLM's WizardLM-7B 4bit](https://huggingface.co/WizardLM/WizardLM-7B-V1.0).
Multiple GPTQ parameter permutations are provided; see Provided Files below for details of the options provided, their parameters, and the software used to create them.
These models were quantised using hardware kindly provided by [Latitude.sh](https://www.latitude.sh/accelerate).
## Repositories available
* [GPTQ models for GPU inference, with multiple quantisation parameter options.](https://huggingface.co/TheBloke/wizardLM-7B-GPTQ)
* [2, 3, 4, 5, 6 and 8-bit GGML models for CPU+GPU inference](https://huggingface.co/TheBloke/wizardLM-7B-GGML)
* [Unquantised fp16 model in pytorch format, for GPU inference and for further conversions](https://huggingface.co/TheBloke/wizardLM-7B-HF)
## Prompt template: WizardLM
```
{prompt}
### Response:
```
## Provided files
Multiple quantisation parameters are provided, to allow you to choose the best one for your hardware and requirements.
Each separate quant is in a different branch. See below for instructions on fetching from different branches.
| Branch | Bits | Group Size | Act Order (desc_act) | File Size | ExLlama Compatible? | Made With | Description |
| ------ | ---- | ---------- | -------------------- | --------- | ------------------- | --------- | ----------- |
| main | 4 | 128 | False | 4.52 GB | True | GPTQ-for-LLaMa | Most compatible option. Good inference speed in AutoGPTQ and GPTQ-for-LLaMa. Lower inference quality than other options. |
| gptq-4bit-32g-actorder_True | 4 | 32 | True | 4.28 GB | True | AutoGPTQ | 4-bit, with Act Order and group size. 32g gives highest possible inference quality, with maximum VRAM usage. Poor AutoGPTQ CUDA speed. |
| gptq-4bit-64g-actorder_True | 4 | 64 | True | 4.02 GB | True | AutoGPTQ | 4-bit, with Act Order and group size. 64g uses less VRAM than 32g, but with slightly lower accuracy. Poor AutoGPTQ CUDA speed. |
| gptq-4bit-128g-actorder_True | 4 | 128 | True | 3.90 GB | True | AutoGPTQ | 4-bit, with Act Order and group size. 128g uses even less VRAM, but with slightly lower accuracy. Poor AutoGPTQ CUDA speed. |
| gptq-8bit--1g-actorder_True | 8 | None | True | 7.01 GB | False | AutoGPTQ | 8-bit, with Act Order. No group size, to lower VRAM requirements and to improve AutoGPTQ speed. |
| gptq-8bit-128g-actorder_False | 8 | 128 | False | 7.16 GB | False | AutoGPTQ | 8-bit, with group size 128g for higher inference quality and without Act Order to improve AutoGPTQ speed. |
| gptq-8bit-128g-actorder_True | 8 | 128 | True | 7.16 GB | False | AutoGPTQ | 8-bit, with group size 128g for higher inference quality and with Act Order for even higher accuracy. Poor AutoGPTQ CUDA speed. |
| gptq-8bit-64g-actorder_True | 8 | 64 | True | 7.31 GB | False | AutoGPTQ | 8-bit, with group size 64g and Act Order for maximum inference quality. Poor AutoGPTQ CUDA speed. |
## How to download from branches
- In text-generation-webui, you can add `:branch` to the end of the download name, eg `TheBloke/wizardLM-7B-GPTQ:gptq-4bit-32g-actorder_True`
- With Git, you can clone a branch with:
```
git clone --branch gptq-4bit-32g-actorder_True https://huggingface.co/TheBloke/wizardLM-7B-GPTQ`
```
- In Python Transformers code, the branch is the `revision` parameter; see below.
## How to easily download and use this model in [text-generation-webui](https://github.com/oobabooga/text-generation-webui).
Please make sure you're using the latest version of [text-generation-webui](https://github.com/oobabooga/text-generation-webui).
It is strongly recommended to use the text-generation-webui one-click-installers unless you know how to make a manual install.
1. Click the **Model tab**.
2. Under **Download custom model or LoRA**, enter `TheBloke/wizardLM-7B-GPTQ`.
- To download from a specific branch, enter for example `TheBloke/wizardLM-7B-GPTQ:gptq-4bit-32g-actorder_True`
- see Provided Files above for the list of branches for each option.
3. Click **Download**.
4. The model will start downloading. Once it's finished it will say "Done"
5. In the top left, click the refresh icon next to **Model**.
6. In the **Model** dropdown, choose the model you just downloaded: `wizardLM-7B-GPTQ`
7. The model will automatically load, and is now ready for use!
8. If you want any custom settings, set them and then click **Save settings for this model** followed by **Reload the Model** in the top right.
* Note that you do not need to set GPTQ parameters any more. These are set automatically from the file `quantize_config.json`.
9. Once you're ready, click the **Text Generation tab** and enter a prompt to get started!
## How to use this GPTQ model from Python code
First make sure you have [AutoGPTQ](https://github.com/PanQiWei/AutoGPTQ) installed:
`GITHUB_ACTIONS=true pip install auto-gptq`
Then try the following example code:
```python
from transformers import AutoTokenizer, pipeline, logging
from auto_gptq import AutoGPTQForCausalLM, BaseQuantizeConfig
model_name_or_path = "TheBloke/wizardLM-7B-GPTQ"
model_basename = "wizardLM-7B-GPTQ-4bit-128g.no-act.order"
use_triton = False
tokenizer = AutoTokenizer.from_pretrained(model_name_or_path, use_fast=True)
model = AutoGPTQForCausalLM.from_quantized(model_name_or_path,
model_basename=model_basename
use_safetensors=True,
trust_remote_code=True,
device="cuda:0",
use_triton=use_triton,
quantize_config=None)
"""
To download from a specific branch, use the revision parameter, as in this example:
model = AutoGPTQForCausalLM.from_quantized(model_name_or_path,
revision="gptq-4bit-32g-actorder_True",
model_basename=model_basename,
use_safetensors=True,
trust_remote_code=True,
device="cuda:0",
quantize_config=None)
"""
prompt = "Tell me about AI"
prompt_template=f'''{prompt}
### Response:
'''
print("\n\n*** Generate:")
input_ids = tokenizer(prompt_template, return_tensors='pt').input_ids.cuda()
output = model.generate(inputs=input_ids, temperature=0.7, max_new_tokens=512)
print(tokenizer.decode(output[0]))
# Inference can also be done using transformers' pipeline
# Prevent printing spurious transformers error when using pipeline with AutoGPTQ
logging.set_verbosity(logging.CRITICAL)
print("*** Pipeline:")
pipe = pipeline(
"text-generation",
model=model,
tokenizer=tokenizer,
max_new_tokens=512,
temperature=0.7,
top_p=0.95,
repetition_penalty=1.15
)
print(pipe(prompt_template)[0]['generated_text'])
```
## Compatibility
The files provided will work with AutoGPTQ (CUDA and Triton modes), GPTQ-for-LLaMa (only CUDA has been tested), and Occ4m's GPTQ-for-LLaMa fork.
ExLlama works with Llama models in 4-bit. Please see the Provided Files table above for per-file compatibility.
<!-- footer start -->
<!-- 200823 -->
## Discord
For further support, and discussions on these models and AI in general, join us at:
[TheBloke AI's Discord server](https://discord.gg/theblokeai)
## Thanks, and how to contribute.
Thanks to the [chirper.ai](https://chirper.ai) team!
I've had a lot of people ask if they can contribute. I enjoy providing models and helping people, and would love to be able to spend even more time doing it, as well as expanding into new projects like fine tuning/training.
If you're able and willing to contribute it will be most gratefully received and will help me to keep providing more models, and to start work on new AI projects.
Donaters will get priority support on any and all AI/LLM/model questions and requests, access to a private Discord room, plus other benefits.
* Patreon: https://patreon.com/TheBlokeAI
* Ko-Fi: https://ko-fi.com/TheBlokeAI
**Special thanks to**: Aemon Algiz.
**Patreon special mentions**: Sam, theTransient, Jonathan Leane, Steven Wood, webtim, Johann-Peter Hartmann, Geoffrey Montalvo, Gabriel Tamborski, Willem Michiel, John Villwock, Derek Yates, Mesiah Bishop, Eugene Pentland, Pieter, Chadd, Stephen Murray, Daniel P. Andersen, terasurfer, Brandon Frisco, Thomas Belote, Sid, Nathan LeClaire, Magnesian, Alps Aficionado, Stanislav Ovsiannikov, Alex, Joseph William Delisle, Nikolai Manek, Michael Davis, Junyu Yang, K, J, Spencer Kim, Stefan Sabev, Olusegun Samson, transmissions 11, Michael Levine, Cory Kujawski, Rainer Wilmers, zynix, Kalila, Luke @flexchar, Ajan Kanaga, Mandus, vamX, Ai Maven, Mano Prime, Matthew Berman, subjectnull, Vitor Caleffi, Clay Pascal, biorpg, alfie_i, 阿明, Jeffrey Morgan, ya boyyy, Raymond Fosdick, knownsqashed, Olakabola, Leonard Tan, ReadyPlayerEmma, Enrico Ros, Dave, Talal Aujan, Illia Dulskyi, Sean Connelly, senxiiz, Artur Olbinski, Elle, Raven Klaugh, Fen Risland, Deep Realms, Imad Khwaja, Fred von Graf, Will Dee, usrbinkat, SuperWojo, Alexandros Triantafyllidis, Swaroop Kallakuri, Dan Guido, John Detwiler, Pedro Madruga, Iucharbius, Viktor Bowallius, Asp the Wyvern, Edmond Seymore, Trenton Dambrowitz, Space Cruiser, Spiking Neurons AB, Pyrater, LangChain4j, Tony Hughes, Kacper Wikieł, Rishabh Srivastava, David Ziegler, Luke Pendergrass, Andrey, Gabriel Puliatti, Lone Striker, Sebastain Graf, Pierre Kircher, Randy H, NimbleBox.ai, Vadim, danny, Deo Leter
Thank you to all my generous patrons and donaters!
And thank you again to a16z for their generous grant.
<!-- footer end -->
# Original model card: WizardLM's WizardLM-7B 4bit
The WizardLM delta weights.
| 10,667 | [
[
-0.0389404296875,
-0.0682373046875,
0.0129241943359375,
0.0145111083984375,
-0.01824951171875,
-0.0088958740234375,
0.0096282958984375,
-0.0223388671875,
0.002773284912109375,
0.0257568359375,
-0.038177490234375,
-0.031707763671875,
-0.0261688232421875,
0.00... |
mmaaz60/LLaVA-7B-Lightening-v1-1 | 2023-06-07T21:45:12.000Z | [
"transformers",
"pytorch",
"llava",
"text-generation",
"license:cc-by-4.0",
"endpoints_compatible",
"region:us"
] | text-generation | mmaaz60 | null | null | mmaaz60/LLaVA-7B-Lightening-v1-1 | 2 | 910 | transformers | 2023-06-07T12:52:16 | ---
license: cc-by-4.0
---
This model is obtained by applying LLaVA-7B-Lightening-v1-1 delta from [liuhaotian/LLaVA-Lightning-7B-delta-v1-1](liuhaotian/LLaVA-Lightning-7B-delta-v1-1) to LLaMA-7B model. | 201 | [
[
-0.00812530517578125,
-0.04547119140625,
0.038787841796875,
0.036224365234375,
-0.04840087890625,
0.0028514862060546875,
0.06268310546875,
-0.028045654296875,
0.043792724609375,
0.0721435546875,
-0.0545654296875,
-0.0017910003662109375,
-0.0147247314453125,
... |
timm/efficientvit_m0.r224_in1k | 2023-08-18T23:21:27.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"arxiv:2305.07027",
"license:mit",
"region:us"
] | image-classification | timm | null | null | timm/efficientvit_m0.r224_in1k | 0 | 909 | timm | 2023-08-18T23:21:24 | ---
tags:
- image-classification
- timm
library_name: timm
license: mit
datasets:
- imagenet-1k
---
# Model card for efficientvit_m0.r224_in1k
An EfficientViT (MSRA) image classification model. Trained on ImageNet-1k by paper authors.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 2.3
- GMACs: 0.1
- Activations (M): 0.9
- Image size: 224 x 224
- **Papers:**
- EfficientViT: Memory Efficient Vision Transformer with Cascaded Group Attention: https://arxiv.org/abs/2305.07027
- **Dataset:** ImageNet-1k
- **Original:** https://github.com/microsoft/Cream/tree/main/EfficientViT
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('efficientvit_m0.r224_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'efficientvit_m0.r224_in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 64, 14, 14])
# torch.Size([1, 128, 7, 7])
# torch.Size([1, 192, 4, 4])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'efficientvit_m0.r224_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 192, 4, 4) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@InProceedings{liu2023efficientvit,
title = {EfficientViT: Memory Efficient Vision Transformer with Cascaded Group Attention},
author = {Liu, Xinyu and Peng, Houwen and Zheng, Ningxin and Yang, Yuqing and Hu, Han and Yuan, Yixuan},
booktitle = {Proceedings of the IEEE/CVF Conference on Computer Vision and Pattern Recognition (CVPR)},
year = {2023},
}
```
| 3,763 | [
[
-0.031036376953125,
-0.040618896484375,
0.0002446174621582031,
0.012908935546875,
-0.02252197265625,
-0.032928466796875,
-0.0198974609375,
-0.01837158203125,
0.0106048583984375,
0.0228118896484375,
-0.034698486328125,
-0.045379638671875,
-0.04833984375,
-0.0... |
nghuyong/ernie-3.0-nano-zh | 2022-09-10T09:02:42.000Z | [
"transformers",
"pytorch",
"ernie",
"feature-extraction",
"zh",
"arxiv:2107.02137",
"endpoints_compatible",
"has_space",
"region:us"
] | feature-extraction | nghuyong | null | null | nghuyong/ernie-3.0-nano-zh | 21 | 906 | transformers | 2022-08-22T09:39:34 | ---
language: zh
---
# ERNIE-3.0-nano-zh
## Introduction
ERNIE 3.0: Large-scale Knowledge Enhanced Pre-training for Language Understanding and Generation
More detail: https://arxiv.org/abs/2107.02137
## Released Model Info
This released pytorch model is converted from the officially released PaddlePaddle ERNIE model and
a series of experiments have been conducted to check the accuracy of the conversion.
- Official PaddlePaddle ERNIE repo:https://paddlenlp.readthedocs.io/zh/latest/model_zoo/transformers/ERNIE/contents.html
- Pytorch Conversion repo: https://github.com/nghuyong/ERNIE-Pytorch
## How to use
```Python
from transformers import BertTokenizer, ErnieModel
tokenizer = BertTokenizer.from_pretrained("nghuyong/ernie-3.0-nano-zh")
model = ErnieModel.from_pretrained("nghuyong/ernie-3.0-nano-zh")
```
## Citation
```bibtex
@article{sun2021ernie,
title={Ernie 3.0: Large-scale knowledge enhanced pre-training for language understanding and generation},
author={Sun, Yu and Wang, Shuohuan and Feng, Shikun and Ding, Siyu and Pang, Chao and Shang, Junyuan and Liu, Jiaxiang and Chen, Xuyi and Zhao, Yanbin and Lu, Yuxiang and others},
journal={arXiv preprint arXiv:2107.02137},
year={2021}
}
```
| 1,225 | [
[
-0.0299835205078125,
-0.04852294921875,
0.01021575927734375,
0.0186614990234375,
-0.024658203125,
-0.031585693359375,
-0.0435791015625,
-0.0222930908203125,
0.007190704345703125,
0.0225830078125,
-0.034454345703125,
-0.0265655517578125,
-0.04608154296875,
-0... |
DiamondYin/Wall-E-01-robot-heywhale | 2023-01-15T16:58:31.000Z | [
"diffusers",
"pytorch",
"stable-diffusion",
"text-to-image",
"diffusion-models-class",
"dreambooth-hackathon",
"wildcard",
"license:creativeml-openrail-m",
"endpoints_compatible",
"diffusers:StableDiffusionPipeline",
"region:us"
] | text-to-image | DiamondYin | null | null | DiamondYin/Wall-E-01-robot-heywhale | 3 | 906 | diffusers | 2023-01-15T15:24:01 | ---
license: creativeml-openrail-m
tags:
- pytorch
- diffusers
- stable-diffusion
- text-to-image
- diffusion-models-class
- dreambooth-hackathon
- wildcard
widget:
- text: In space, there is a spaceship docked here, and Wall-E-01 walks in the spaceship,8K
resolution, 16:9
---
# DreamBooth model for the Wall-E-01 concept trained by DiamondYin.
This is a Stable Diffusion model fine-tuned on the Wall-E-01 concept with DreamBooth. It can be used by modifying the `instance_prompt`: **a photo of Wall-E-01 robot**
This model was created as part of the DreamBooth Hackathon 🔥. Visit the [organisation page](https://huggingface.co/dreambooth-hackathon) for instructions on how to take part!
## Description
This is a Stable Diffusion model fine-tuned on `robot` images for the wildcard theme,
for the Hugging Face DreamBooth Hackathon, from the HF CN Community, corporated with the HeyWhale.
The production cost of WALL-E is $180 million. It tells about a lonely robot designed to clean up the polluted earth. The unique feature of this film is that there is almost no dialogue in the first 40 minutes or so. On the contrary, the audience enters a world of robots; How it thinks, how it works, how it speaks (or doesn't speak). Pixar's classic film was a success. The film has a global box office of more than 520 million US dollars, won a number of Oscar nominations, and ranked first on Time magazine's list of the best films of the decade.
Now we can easily create Wally's pictures and present the script's pictures with the help of the Stable Diffusion model. We can write a series of stories for WALL-E, but we don't have to bear such expensive costs. This is the advantage of the Stable Diffusion model
机器总动员这部电影(WALL-E)的生产成本为1.8亿美元。它讲述了一个孤独的机器人被设计来清理被污染的地球。这部电影的独特之处在于,前40分钟左右几乎没有对话,相反,观众进入了一个机器人的世界;它如何思考,如何工作,如何说话(或不说话)。皮克斯的经典电影获得了成功。
该片全球票房超过5.2亿美元,获得多项奥斯卡提名,并在《时代》杂志十年最佳影片排行榜上排名第一。现在,我们可以通过Stable Diffusion model轻松创建WALL-E的图片并呈现脚本的图片。我们可以为WALL-E写一系列故事,但我们不必承担如此昂贵的成本。这是稳定扩散模型的优点
下面是相关实例,大家可以体验。
调用时请注意主体的名称是:Wall-E-01 robot
When calling, please note that the name of the subject is: Wall-E-01 robot
Prompt: Wall-E-01 robot on the moon 8K resolution, 16:9,Cyberpunk


Prompt: Wall-E-01 robot, the background is an old bridge and a pond, mist and swirly clouds in the background, fantastic landscape, hyperrealism, no blur, 4k resolution, ultra detailed, style of Anton Fadeev, Ivan Shishkin, John Berkey

Prompt: illustration of a Wall-E robot sitting on top of the deck of a battle ship traveling through the open sea

Prompt: Wall-E-01 robot cartoon image with rainbow background



Prompt:"Wall-E, a small robot with a binocular-shaped head, sitting in the cockpit of a large spaceship, surrounded by high-tech controls and screens displaying various information about the ship's status and location, with a focus on Wall-E's expression and the intricate details of the ship's controls. The image should be in high resolution and have a realistic, futuristic aesthetic."



## Usage
```python
from diffusers import StableDiffusionPipeline
pipeline = StableDiffusionPipeline.from_pretrained('DiamondYin/Wall-E-01-robot-heywhale')
image = pipeline().images[0]
image
```
| 4,253 | [
[
-0.0487060546875,
-0.06488037109375,
0.046112060546875,
0.00881195068359375,
0.0035953521728515625,
0.006114959716796875,
0.021148681640625,
-0.032073974609375,
0.05108642578125,
0.036041259765625,
-0.03778076171875,
-0.0266265869140625,
-0.040252685546875,
... |
timm/twins_pcpvt_large.in1k | 2023-04-23T23:22:46.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"arxiv:2104.13840",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/twins_pcpvt_large.in1k | 0 | 905 | timm | 2023-04-23T23:21:47 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
---
# Model card for twins_pcpvt_large.in1k
A Twins-PCPVT image classification model. Trained on ImageNet-1k by paper authors.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 61.0
- GMACs: 9.8
- Activations (M): 35.8
- Image size: 224 x 224
- **Papers:**
- Twins: Revisiting the Design of Spatial Attention in Vision Transformers: https://arxiv.org/abs/2104.13840
- **Dataset:** ImageNet-1k
- **Original:** https://github.com/Meituan-AutoML/Twins
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('twins_pcpvt_large.in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'twins_pcpvt_large.in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 49, 512) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@inproceedings{chu2021Twins,
title={Twins: Revisiting the Design of Spatial Attention in Vision Transformers},
author={Xiangxiang Chu and Zhi Tian and Yuqing Wang and Bo Zhang and Haibing Ren and Xiaolin Wei and Huaxia Xia and Chunhua Shen},
booktitle={NeurIPS 2021},
url={https://openreview.net/forum?id=5kTlVBkzSRx},
year={2021}
}
```
| 2,844 | [
[
-0.0399169921875,
-0.033660888671875,
0.00545501708984375,
0.028839111328125,
-0.00992584228515625,
-0.031097412109375,
-0.01020050048828125,
-0.0274505615234375,
0.0183868408203125,
0.032318115234375,
-0.044097900390625,
-0.03619384765625,
-0.04974365234375,
... |
s-nlp/ruT5-base-detox | 2023-09-08T08:57:14.000Z | [
"transformers",
"pytorch",
"safetensors",
"t5",
"text2text-generation",
"text-generation-inference",
"ru",
"dataset:s-nlp/ru_paradetox",
"license:openrail++",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | text2text-generation | s-nlp | null | null | s-nlp/ruT5-base-detox | 5 | 904 | transformers | 2022-03-02T23:29:05 | ---
license: openrail++
language:
- ru
tags:
- text-generation-inference
datasets:
- s-nlp/ru_paradetox
---
This is the detoxification baseline model trained on the [train](https://github.com/skoltech-nlp/russe_detox_2022/blob/main/data/input/train.tsv) part of "RUSSE 2022: Russian Text Detoxification Based on Parallel Corpora" competition. The source sentences are Russian toxic messages from Odnoklassniki, Pikabu, and Twitter platforms. The base model is [ruT5](https://huggingface.co/sberbank-ai/ruT5-base) provided from Sber.
**How to use**
```python
from transformers import T5ForConditionalGeneration, AutoTokenizer
base_model_name = 'sberbank-ai/ruT5-base'
model_name = 'SkolkovoInstitute/ruT5-base-detox'
tokenizer = AutoTokenizer.from_pretrained(base_model_name)
model = T5ForConditionalGeneration.from_pretrained(model_name)
``` | 844 | [
[
0.00249481201171875,
-0.01140594482421875,
0.030426025390625,
-0.00247955322265625,
-0.0228424072265625,
0.00015664100646972656,
0.00627899169921875,
-0.0004830360412597656,
-0.029510498046875,
0.018768310546875,
-0.03900146484375,
-0.043212890625,
-0.0533447265... |
lincoln/mbart-mlsum-automatic-summarization | 2021-09-07T08:21:55.000Z | [
"transformers",
"pytorch",
"tf",
"mbart",
"text2text-generation",
"summarization",
"bart",
"fr",
"dataset:MLSUM",
"arxiv:2004.14900",
"license:mit",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | summarization | lincoln | null | null | lincoln/mbart-mlsum-automatic-summarization | 4 | 904 | transformers | 2022-03-02T23:29:05 | ---
language:
- fr
license: mit
datasets:
- MLSUM
pipeline_tag: "summarization"
widget:
- text: « La veille de l’ouverture, je vais faire venir un coach pour les salariés qui reprendront le travail. Cela va me coûter 300 euros, mais après des mois d’oisiveté obligatoire, la reprise n’est pas simple. Certains sont au chômage partiel depuis mars 2020 », raconte Alain Fontaine, propriétaire du restaurant Le Mesturet, dans le quartier de la Bourse, à Paris. Cette date d’ouverture, désormais, il la connaît. Emmanuel Macron a, en effet, donné le feu vert pour un premier accueil des clients en terrasse, mercredi 19 mai. M. Fontaine imagine même faire venir un orchestre ce jour-là pour fêter l’événement. Il lui reste toutefois à construire sa terrasse. Il pensait que les ouvriers passeraient samedi 1er mai pour l’installer, mais, finalement, le rendez-vous a été décalé. Pour l’instant, le tas de bois est entreposé dans la salle de restaurant qui n’a plus accueilli de convives depuis le 29 octobre 2020, quand le couperet de la fermeture administrative est tombé.M. Fontaine, président de l’Association française des maîtres restaurateurs, ne manquera pas de concurrents prêts à profiter de ce premier temps de réouverture des bars et restaurants. Même si le couvre-feu limite le service à 21 heures. D’autant que la Mairie de Paris vient d’annoncer le renouvellement des terrasses éphémères installées en 2020 et leur gratuité jusqu’à la fin de l’été.
tags:
- summarization
- mbart
- bart
---
# Résumé automatique d'article de presses
Ce modèles est basé sur le modèle [`facebook/mbart-large-50`](https://huggingface.co/facebook/mbart-large-50) et été fine-tuné en utilisant des articles de presse issus de la base de données MLSUM. L'hypothèse à été faite que les chapeaux des articles faisaient de bon résumés de référence.
## Entrainement
Nous avons testé deux architecture de modèles (T5 et BART) avec des textes en entrée de 512 ou 1024 tokens. Finallement c'est le modèle BART avec 512 tokens qui à été retenu.
Il a été entrainé sur 2 epochs (~700K articles) sur une Tesla V100 (32 heures d'entrainement).
## Résultats

Nous avons comparé notre modèle (`mbart-large-512-full` sur le graphique) à deux références:
* MBERT qui correspond aux performances du modèle entrainé par l'équipe à l'origine de la base d'articles MLSUM
* Barthez qui est un autre modèle basé sur des articles de presses issus de la base de données OrangeSum
On voit que le score de novelty (cf papier MLSUM) de notre modèle n'est pas encore comparable à ces deux références et encore moins à une production humaine néanmoins les résumés générés sont dans l'ensemble de bonne qualité.
## Utilisation
```python
from transformers import AutoModelForSeq2SeqLM, AutoTokenizer
from transformers import SummarizationPipeline
model_name = 'lincoln/mbart-mlsum-automatic-summarization'
loaded_tokenizer = AutoTokenizer.from_pretrained(model_name)
loaded_model = AutoModelForSeq2SeqLM.from_pretrained(model_name)
nlp = SummarizationPipeline(model=loaded_model, tokenizer=loaded_tokenizer)
nlp("""
« La veille de l’ouverture, je vais faire venir un coach pour les salariés qui reprendront le travail.
Cela va me coûter 300 euros, mais après des mois d’oisiveté obligatoire, la reprise n’est pas simple.
Certains sont au chômage partiel depuis mars 2020 », raconte Alain Fontaine, propriétaire du restaurant Le Mesturet,
dans le quartier de la Bourse, à Paris. Cette date d’ouverture, désormais, il la connaît. Emmanuel Macron a, en effet,
donné le feu vert pour un premier accueil des clients en terrasse, mercredi 19 mai. M. Fontaine imagine même faire venir un orchestre ce jour-là pour fêter l’événement.
Il lui reste toutefois à construire sa terrasse. Il pensait que les ouvriers passeraient samedi 1er mai pour l’installer, mais, finalement, le rendez-vous a été décalé.
Pour l’instant, le tas de bois est entreposé dans la salle de restaurant qui n’a plus accueilli de convives depuis le 29 octobre 2020,
quand le couperet de la fermeture administrative est tombé.M. Fontaine, président de l’Association française des maîtres restaurateurs,
ne manquera pas de concurrents prêts à profiter de ce premier temps de réouverture des bars et restaurants. Même si le couvre-feu limite le service à 21 heures.
D’autant que la Mairie de Paris vient d’annoncer le renouvellement des terrasses éphémères installées en 2020 et leur gratuité jusqu’à la fin de l’été.
""")
```
## Citation
```bibtex
@article{scialom2020mlsum,
title={MLSUM: The Multilingual Summarization Corpus},
author={Thomas Scialom and Paul-Alexis Dray and Sylvain Lamprier and Benjamin Piwowarski and Jacopo Staiano},
year={2020},
eprint={2004.14900},
archivePrefix={arXiv},
primaryClass={cs.CL}
}
``` | 4,856 | [
[
-0.042083740234375,
-0.033966064453125,
0.0255584716796875,
0.03656005859375,
0.002666473388671875,
-0.005153656005859375,
-0.00870513916015625,
-0.03277587890625,
0.045440673828125,
0.0210113525390625,
-0.0263519287109375,
-0.029144287109375,
-0.03631591796875,... |
neulab/codebert-javascript | 2023-02-27T20:56:02.000Z | [
"transformers",
"pytorch",
"roberta",
"fill-mask",
"arxiv:2302.05527",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | fill-mask | neulab | null | null | neulab/codebert-javascript | 7 | 904 | transformers | 2022-09-23T15:19:35 | This is a `microsoft/codebert-base-mlm` model, trained for 1,000,000 steps (with `batch_size=32`) on **JavaScript** code from the `codeparrot/github-code-clean` dataset, on the masked-language-modeling task.
It is intended to be used in CodeBERTScore: [https://github.com/neulab/code-bert-score](https://github.com/neulab/code-bert-score), but can be used for any other model or task.
For more information, see: [https://github.com/neulab/code-bert-score](https://github.com/neulab/code-bert-score)
## Citation
If you use this model for research, please cite:
```
@article{zhou2023codebertscore,
url = {https://arxiv.org/abs/2302.05527},
author = {Zhou, Shuyan and Alon, Uri and Agarwal, Sumit and Neubig, Graham},
title = {CodeBERTScore: Evaluating Code Generation with Pretrained Models of Code},
publisher = {arXiv},
year = {2023},
}
``` | 857 | [
[
-0.008026123046875,
-0.039886474609375,
-0.006954193115234375,
0.031646728515625,
-0.0005316734313964844,
-0.0016765594482421875,
-0.01287078857421875,
-0.0123443603515625,
0.0069427490234375,
0.04827880859375,
-0.04638671875,
-0.0574951171875,
-0.02827453613281... |
usman7071/my-car-model | 2023-10-18T06:43:23.000Z | [
"diffusers",
"NxtWave-GenAI-Webinar",
"text-to-image",
"stable-diffusion",
"license:creativeml-openrail-m",
"endpoints_compatible",
"diffusers:StableDiffusionPipeline",
"region:us",
"has_space"
] | text-to-image | usman7071 | null | null | usman7071/my-car-model | 0 | 904 | diffusers | 2023-10-18T06:37:52 | ---
license: creativeml-openrail-m
tags:
- NxtWave-GenAI-Webinar
- text-to-image
- stable-diffusion
---
### my-car-model Dreambooth model trained by usman7071 following the "Build your own Gen AI model" session by NxtWave.
Project Submission Code: GoX19932gAS
Sample pictures of this concept:
.jpg)
.jpg)
| 496 | [
[
-0.0574951171875,
-0.0185394287109375,
0.0350341796875,
-0.004421234130859375,
-0.01476287841796875,
0.0389404296875,
0.030975341796875,
-0.031402587890625,
0.033233642578125,
0.0218505859375,
-0.05218505859375,
-0.020721435546875,
-0.0128173828125,
-0.01345... |
wukevin/tcr-bert | 2021-11-22T08:32:15.000Z | [
"transformers",
"pytorch",
"bert",
"text-classification",
"endpoints_compatible",
"region:us"
] | text-classification | wukevin | null | null | wukevin/tcr-bert | 4 | 903 | transformers | 2022-03-02T23:29:05 | # TCR transformer model
See our full [codebase](https://github.com/wukevin/tcr-bert) and our [preprint](https://www.biorxiv.org/content/10.1101/2021.11.18.469186v1) for more information.
This model is on:
- Masked language modeling (masked amino acid or MAA modeling)
- Classification across antigen labels from PIRD
If you are looking for a model trained only on MAA, please see our [other model](https://huggingface.co/wukevin/tcr-bert-mlm-only).
Example inputs:
* `C A S S P V T G G I Y G Y T F` (binds to NLVPMVATV CMV antigen)
* `C A T S G R A G V E Q F F` (binds to GILGFVFTL flu antigen) | 600 | [
[
-0.01502227783203125,
-0.048980712890625,
0.0180511474609375,
-0.021728515625,
-0.006103515625,
0.0166168212890625,
0.0125274658203125,
-0.01438140869140625,
0.018157958984375,
0.02532958984375,
-0.045257568359375,
-0.0278778076171875,
-0.053070068359375,
0.... |
dcferreira/detoxify-optimized | 2023-05-19T17:35:13.000Z | [
"transformers",
"onnx",
"xlm-roberta",
"text-classification",
"license:apache-2.0",
"endpoints_compatible",
"region:us"
] | text-classification | dcferreira | null | null | dcferreira/detoxify-optimized | 1 | 903 | transformers | 2023-05-19T11:27:06 | ---
license: apache-2.0
---
This repo has an optimized version of [Detoxify](https://github.com/unitaryai/detoxify/), which needs less disk space and less memory at the cost of just a little bit of accuracy.
This is an experiment for me to learn how to use [🤗 Optimum](https://huggingface.co/docs/optimum/index).
# Usage
Loading the model requires the [🤗 Optimum](https://huggingface.co/docs/optimum/index) library installed.
```python
from optimum.onnxruntime import ORTModelForSequenceClassification
from optimum.pipelines import pipeline as opt_pipeline
from transformers import AutoTokenizer
tokenizer = AutoTokenizer.from_pretrained("dcferreira/detoxify-optimized")
model = ORTModelForSequenceClassification.from_pretrained("dcferreira/detoxify-optimized")
pipe = opt_pipeline(
model=model,
task="text-classification",
function_to_apply="sigmoid",
accelerator="ort",
tokenizer=tokenizer,
top_k=None, # return scores for all the labels, model was trained as multilabel
)
print(pipe(['example text','exemple de texte','texto de ejemplo','testo di esempio','texto de exemplo','örnek metin','пример текста']))
```
# Performance
The table below compares some statistics on running the original model, vs the original model with the [onnxruntime](https://onnxruntime.ai/), vs optimizing the model with onnxruntime.
| model | Accuracy (%) | Samples p/ second (CPU) | Samples p/ second (GPU) | GPU VRAM | Disk Space |
|----------------|----------|-------------------------|-------------------------|----------|------------|
| original | 92.1083 | 16 | 250 | 3GB | 1.1GB |
| ort | 92.1067 | 19 | 340 | 4GB | 1.1GB |
| optimized (O4) | 92.1031 | 14 | 650 | 2GB | 540MB |
For details on how these numbers were reached, check out `evaluate.py` in this repo.
| 1,971 | [
[
-0.032135009765625,
-0.0263824462890625,
0.0328369140625,
-0.01194000244140625,
-0.01538848876953125,
-0.007793426513671875,
-0.005832672119140625,
-0.0209197998046875,
0.004878997802734375,
0.032958984375,
-0.035064697265625,
-0.033477783203125,
-0.037170410156... |
budecosystem/genz-13b-v2-4bit | 2023-07-26T17:05:28.000Z | [
"transformers",
"llama",
"text-generation",
"en",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] | text-generation | budecosystem | null | null | budecosystem/genz-13b-v2-4bit | 0 | 903 | transformers | 2023-07-26T15:47:21 | ---
language:
- en
library_name: transformers
pipeline_tag: text-generation
---
# GenZ 13B v2 4bit
The instruction finetuned model with 4K input length. The model is finetuned on top of pretrained LLaMa2
## Inference
```python
from transformers import LlamaForCausalLM, LlamaTokenizer
from auto_gptq import AutoGPTQForCausalLM, BaseQuantizeConfig
base_model = 'budecosystem/genz-13b-v2-4bit'
tokenizer = LlamaTokenizer.from_pretrained(base_model)
model = AutoGPTQForCausalLM.from_quantized(model_name_or_path=base_model,
model_basename="gptq_model-4bit-128g",
use_safetensors=True,
trust_remote_code=True)
prompt = """A chat between a curious user and an artificial intelligence assistant. The assistant gives helpful, detailed, and polite answers to the user's questions.
USER: who are you? ASSISTANT: """
inputs = tokenizer(prompt, return_tensors="pt")
sample = model.generate(**inputs, max_length=128)
print(tokenizer.decode(sample[0]))
```
Use following prompt template
```
A chat between a curious user and an artificial intelligence assistant. The assistant gives helpful, detailed, and polite answers to the user's questions. USER: Hi, how are you? ASSISTANT:
```
## Finetuning
```bash
python finetune.py
--model_name meta-llama/Llama-2-13b
--data_path dataset.json
--output_dir output
--trust_remote_code
--prompt_column instruction
--response_column output
```
Check the GitHub for the code -> [GenZ](https://github.com/BudEcosystem/GenZ) | 1,504 | [
[
-0.033905029296875,
-0.06610107421875,
0.035400390625,
0.0237884521484375,
-0.035064697265625,
0.01096343994140625,
-0.002063751220703125,
-0.0132598876953125,
-0.01198577880859375,
0.024627685546875,
-0.061676025390625,
-0.038116455078125,
-0.04290771484375,
... |
samrawal/bert-large-uncased_med-ner | 2022-05-28T15:56:42.000Z | [
"transformers",
"pytorch",
"jax",
"bert",
"token-classification",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | token-classification | samrawal | null | null | samrawal/bert-large-uncased_med-ner | 7 | 902 | transformers | 2022-03-02T23:29:05 | A Named Entity Recognition model for medication entities (`medication name`, `dosage`, `duration`, `frequency`, `reason`).
The model has been trained on the i2b2 (now n2c2) dataset for the 2009 - Medication task. Please visit the n2c2 site to request access to the dataset. | 274 | [
[
-0.0035533905029296875,
-0.0296173095703125,
0.046295166015625,
0.0202178955078125,
-0.0037631988525390625,
-0.0145111083984375,
0.00222015380859375,
-0.040863037109375,
0.0263671875,
0.053131103515625,
-0.057037353515625,
-0.024658203125,
-0.0596923828125,
... |
timm/tf_mixnet_m.in1k | 2023-04-27T21:50:09.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"arxiv:1907.09595",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/tf_mixnet_m.in1k | 0 | 902 | timm | 2022-12-13T00:21:43 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
---
# Model card for tf_mixnet_m.in1k
A MixNet image classification model. Trained on ImageNet-1k in Tensorflow by paper authors, ported to PyTorch by Ross Wightman.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 5.0
- GMACs: 0.4
- Activations (M): 8.2
- Image size: 224 x 224
- **Papers:**
- MixConv: Mixed Depthwise Convolutional Kernels: https://arxiv.org/abs/1907.09595
- **Dataset:** ImageNet-1k
- **Original:** https://github.com/tensorflow/tpu/tree/master/models/official/efficientnet
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('tf_mixnet_m.in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'tf_mixnet_m.in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 24, 112, 112])
# torch.Size([1, 32, 56, 56])
# torch.Size([1, 40, 28, 28])
# torch.Size([1, 120, 14, 14])
# torch.Size([1, 200, 7, 7])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'tf_mixnet_m.in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 1536, 7, 7) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@misc{tan2019mixconv,
title={MixConv: Mixed Depthwise Convolutional Kernels},
author={Mingxing Tan and Quoc V. Le},
year={2019},
eprint={1907.09595},
archivePrefix={arXiv},
primaryClass={cs.CV}
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
| 3,939 | [
[
-0.039337158203125,
-0.039154052734375,
-0.00257110595703125,
0.01313018798828125,
-0.029754638671875,
-0.0217742919921875,
-0.014495849609375,
-0.031524658203125,
0.024566650390625,
0.0269622802734375,
-0.03302001953125,
-0.057952880859375,
-0.05511474609375,
... |
quantumaikr/KoreanLM-3B | 2023-09-02T12:55:53.000Z | [
"transformers",
"pytorch",
"safetensors",
"llama",
"text-generation",
"korean",
"foundation",
"ko",
"en",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] | text-generation | quantumaikr | null | null | quantumaikr/KoreanLM-3B | 0 | 901 | transformers | 2023-08-21T09:02:18 | ---
language:
- ko
- en
pipeline_tag: text-generation
tags:
- llama
- korean
- foundation
---
<p align="center" width="100%">
<img src="https://i.imgur.com/snFDU0P.png" alt="KoreanLM icon" style="width: 500px; display: block; margin: auto; border-radius: 10%;">
</p>
# KoreanLM: 한국어 언어모델 프로젝트
KoreanLM은 한국어 언어모델을 개발하기 위한 오픈소스 프로젝트입니다. 현재 대부분의 언어모델들은 영어에 초점을 맞추고 있어, 한국어에 대한 학습이 상대적으로 부족하고 토큰화 과정에서 비효율적인 경우가 있습니다. 이러한 문제를 해결하고 한국어에 최적화된 언어모델을 제공하기 위해 KoreanLM 프로젝트를 시작하게 되었습니다.
## 프로젝트 목표
1. 한국어에 특화된 언어모델 개발: 한국어의 문법, 어휘, 문화적 특성을 반영하여 한국어를 더 정확하게 이해하고 생성할 수 있는 언어모델을 개발합니다.
2. 효율적인 토큰화 방식 도입: 한국어 텍스트의 토큰화 과정에서 효율적이고 정확한 분석이 가능한 새로운 토큰화 방식을 도입하여 언어모델의 성능을 향상시킵니다.
3. 거대 언어모델의 사용성 개선: 현재 거대한 사이즈의 언어모델들은 기업이 자사의 데이터를 파인튜닝하기 어려운 문제가 있습니다. 이를 해결하기 위해 한국어 언어모델의 크기를 조절하여 사용성을 개선하고, 자연어 처리 작업에 더 쉽게 적용할 수 있도록 합니다.
## 사용 방법
다음은 transformers 라이브러리를 통해 모델과 토크나이저를 로딩하는 예제입니다.
```python
import transformers
model = transformers.AutoModelForCausalLM.from_pretrained("quantumaikr/KoreanLM-3B")
tokenizer = transformers.AutoTokenizer.from_pretrained("quantumaikr/KoreanLM-3B")
```
## 기술 문의
hi@quantumai.kr
www.quantumai.kr | 1,129 | [
[
-0.030059814453125,
-0.0352783203125,
0.0171966552734375,
0.025177001953125,
-0.034759521484375,
0.0229644775390625,
0.0254364013671875,
-0.0185546875,
0.031036376953125,
0.022613525390625,
-0.0248260498046875,
-0.0307464599609375,
-0.039459228515625,
0.0112... |
SargeZT/controlnet-sd-xl-1.0-depth-16bit-zoe | 2023-08-14T19:09:42.000Z | [
"diffusers",
"stable-diffusion-xl",
"stable-diffusion-xl-diffusers",
"text-to-image",
"controlnet",
"license:creativeml-openrail-m",
"has_space",
"diffusers:ControlNetModel",
"region:us"
] | text-to-image | SargeZT | null | null | SargeZT/controlnet-sd-xl-1.0-depth-16bit-zoe | 16 | 900 | diffusers | 2023-08-13T19:14:13 |
---
license: creativeml-openrail-m
base_model: stabilityai/stable-diffusion-xl-base-1.0
tags:
- stable-diffusion-xl
- stable-diffusion-xl-diffusers
- text-to-image
- diffusers
- controlnet
inference: true
---
# controlnet-SargeZT/controlnet-sd-xl-1.0-depth-16bit-zoe
These are controlnet weights trained on stabilityai/stable-diffusion-xl-base-1.0. Use Zoe's preprocessor, preferably NK, colorized to grayscale with default parameters in the ZoeDepth repo.
You can find some example images below.
Various prompts:





prompt: a black and white cat laying on top of a keyboard

prompt: a wooden bench sitting in the middle of a forest

prompt: a ripe banana sitting on top of a wooden table

prompt: a large jetliner sitting on top of an airport tarmac

prompt: two girls are playing soccer on a field

prompt: a laptop computer sitting on top of a desk

prompt: a man riding skis on top of a body of water

prompt: a small plane is flying through the air

## License
[SDXL 1.0 License](https://huggingface.co/stabilityai/stable-diffusion-xl-base-1.0/blob/main/LICENSE.md)
| 1,421 | [
[
-0.0249481201171875,
-0.01329803466796875,
0.0274200439453125,
0.027069091796875,
-0.0137481689453125,
0.00015938282012939453,
0.0087127685546875,
-0.0034580230712890625,
0.050567626953125,
0.035400390625,
-0.061981201171875,
-0.03387451171875,
-0.04736328125,
... |
TinyLlama/tinyLlama-intermediate-checkpoints | 2023-09-28T14:53:27.000Z | [
"transformers",
"llama",
"text-generation",
"en",
"dataset:cerebras/SlimPajama-627B",
"dataset:bigcode/starcoderdata",
"license:apache-2.0",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] | text-generation | TinyLlama | null | null | TinyLlama/tinyLlama-intermediate-checkpoints | 10 | 900 | transformers | 2023-09-28T14:27:51 | ---
license: apache-2.0
datasets:
- cerebras/SlimPajama-627B
- bigcode/starcoderdata
language:
- en
---
<div align="center">
# TinyLlama-1.1B
</div>
https://github.com/jzhang38/TinyLlama
The TinyLlama project aims to **pretrain** a **1.1B Llama model on 3 trillion tokens**. With some proper optimization, we can achieve this within a span of "just" 90 days using 16 A100-40G GPUs 🚀🚀. The training has started on 2023-09-01.
<div align="center">
<img src="./TinyLlama_logo.png" width="300"/>
</div>
We adopted exactly the same architecture and tokenizer as Llama 2. This means TinyLlama can be plugged and played in many open-source projects built upon Llama. Besides, TinyLlama is compact with only 1.1B parameters. This compactness allows it to cater to a multitude of applications demanding a restricted computation and memory footprint.
#### This Model
This is an intermediate checkpoint with 50K steps and 105B tokens.
#### Releases Schedule
We will be rolling out intermediate checkpoints following the below schedule. We also include some baseline models for comparison.
| Date | HF Checkpoint | Tokens | Step | HellaSwag Acc_norm |
|------------|-------------------------------------------------|--------|------|---------------------|
| Baseline | [StableLM-Alpha-3B](https://huggingface.co/stabilityai/stablelm-base-alpha-3b)| 800B | -- | 38.31 |
| Baseline | [Pythia-1B-intermediate-step-50k-105b](https://huggingface.co/EleutherAI/pythia-1b/tree/step50000) | 105B | 50k | 42.04 |
| Baseline | [Pythia-1B](https://huggingface.co/EleutherAI/pythia-1b) | 300B | 143k | 47.16 |
| 2023-09-04 | [TinyLlama-1.1B-intermediate-step-50k-105b](https://huggingface.co/PY007/TinyLlama-1.1B-step-50K-105b) | 105B | 50k | 43.50 |
| 2023-09-16 | -- | 500B | -- | -- |
| 2023-10-01 | -- | 1T | -- | -- |
| 2023-10-16 | -- | 1.5T | -- | -- |
| 2023-10-31 | -- | 2T | -- | -- |
| 2023-11-15 | -- | 2.5T | -- | -- |
| 2023-12-01 | -- | 3T | -- | -- |
#### How to use
You will need the transformers>=4.31
Do check the [TinyLlama](https://github.com/jzhang38/TinyLlama) github page for more information.
```
from transformers import AutoTokenizer
import transformers
import torch
model = "PY007/TinyLlama-1.1B-step-50K-105b"
tokenizer = AutoTokenizer.from_pretrained(model)
pipeline = transformers.pipeline(
"text-generation",
model=model,
torch_dtype=torch.float16,
device_map="auto",
)
sequences = pipeline(
'The TinyLlama project aims to pretrain a 1.1B Llama model on 3 trillion tokens. With some proper optimization, we can achieve this within a span of "just" 90 days using 16 A100-40G GPUs 🚀🚀. The training has started on 2023-09-01.',
do_sample=True,
top_k=10,
num_return_sequences=1,
repetition_penalty=1.5,
eos_token_id=tokenizer.eos_token_id,
max_length=500,
)
for seq in sequences:
print(f"Result: {seq['generated_text']}")
``` | 3,411 | [
[
-0.0281524658203125,
-0.04351806640625,
0.03173828125,
0.01617431640625,
-0.038177490234375,
-0.0035076141357421875,
-0.01090240478515625,
-0.034576416015625,
0.03607177734375,
0.005489349365234375,
-0.059814453125,
-0.0296478271484375,
-0.03607177734375,
-0... |
dblasko/blip-dalle3-img2prompt | 2023-10-15T08:45:12.000Z | [
"transformers",
"pytorch",
"blip",
"text2text-generation",
"art",
"image-to-text",
"image-captioning",
"en",
"dataset:laion/dalle-3-dataset",
"autotrain_compatible",
"endpoints_compatible",
"has_space",
"region:us"
] | text2text-generation | dblasko | null | null | dblasko/blip-dalle3-img2prompt | 16 | 900 | transformers | 2023-10-13T16:57:18 | ---
datasets:
- laion/dalle-3-dataset
language:
- en
tags:
- art
- image-to-text
- image-captioning
---
# DALL·E 3 Image prompt reverse-engineering
Pre-trained image-captioning model BLIP fine-tuned on a mixture of `laion/dalle-3-dataset` and semi-automatically gathered `(image, prompt)` data from DALLE·E 3.
It takes a generated image as an input and outputs a potential prompt to generate such an image, which can then be used as a base to generate similar images.
⚠️ Disclaimer: This model is **not intended for commercial use** as the data it was trained on includes images generated by DALLE·E 3. This is for educational purposes only.
### Usage:
Loading the model and preprocessor:
```python
from transformers import BlipForConditionalGeneration, AutoProcessor
model = BlipForConditionalGeneration.from_pretrained("dblasko/blip-dalle3-img2prompt").to(device)
processor = AutoProcessor.from_pretrained("dblasko/blip-dalle3-img2prompt")
```
Inference example on an image from `laion/dalle-3-dataset`:
```python
from datasets import load_dataset
dataset = load_dataset("laion/dalle-3-dataset", split=f'train[0%:1%]') # for fast download time in the toy example
example = dataset[img_index][0]
image = example["image"]
caption = example["caption"]
inputs = processor(images=image, return_tensors="pt").to(device)
pixel_values = inputs.pixel_values
generated_ids = model.generate(pixel_values=pixel_values, max_length=50)
generated_caption = processor.batch_decode(generated_ids, skip_special_tokens=True)[0]
print(f"Generated caption: {generated_caption}\nReal caption: {caption}")
``` | 1,600 | [
[
-0.01763916015625,
-0.035369873046875,
0.017303466796875,
0.032867431640625,
-0.031494140625,
-0.00809478759765625,
0.01508331298828125,
-0.0164337158203125,
-0.01129913330078125,
0.040985107421875,
-0.0526123046875,
-0.0170440673828125,
-0.03521728515625,
0... |
facebook/wav2vec2-large | 2022-08-26T21:31:10.000Z | [
"transformers",
"pytorch",
"wav2vec2",
"pretraining",
"speech",
"en",
"dataset:librispeech_asr",
"arxiv:2006.11477",
"license:apache-2.0",
"endpoints_compatible",
"has_space",
"region:us"
] | null | facebook | null | null | facebook/wav2vec2-large | 0 | 898 | transformers | 2022-03-02T23:29:05 | ---
language: en
datasets:
- librispeech_asr
tags:
- speech
license: apache-2.0
---
# Wav2Vec2-Large
[Facebook's Wav2Vec2](https://ai.facebook.com/blog/wav2vec-20-learning-the-structure-of-speech-from-raw-audio/)
The base model pretrained on 16kHz sampled speech audio. When using the model make sure that your speech input is also sampled at 16Khz. Note that this model should be fine-tuned on a downstream task, like Automatic Speech Recognition. Check out [this blog](https://huggingface.co/blog/fine-tune-wav2vec2-english) for more information.
[Paper](https://arxiv.org/abs/2006.11477)
Authors: Alexei Baevski, Henry Zhou, Abdelrahman Mohamed, Michael Auli
**Abstract**
We show for the first time that learning powerful representations from speech audio alone followed by fine-tuning on transcribed speech can outperform the best semi-supervised methods while being conceptually simpler. wav2vec 2.0 masks the speech input in the latent space and solves a contrastive task defined over a quantization of the latent representations which are jointly learned. Experiments using all labeled data of Librispeech achieve 1.8/3.3 WER on the clean/other test sets. When lowering the amount of labeled data to one hour, wav2vec 2.0 outperforms the previous state of the art on the 100 hour subset while using 100 times less labeled data. Using just ten minutes of labeled data and pre-training on 53k hours of unlabeled data still achieves 4.8/8.2 WER. This demonstrates the feasibility of speech recognition with limited amounts of labeled data.
The original model can be found under https://github.com/pytorch/fairseq/tree/master/examples/wav2vec#wav2vec-20.
# Usage
See [this notebook](https://colab.research.google.com/drive/1FjTsqbYKphl9kL-eILgUc-bl4zVThL8F?usp=sharing) for more information on how to fine-tune the model. | 1,833 | [
[
-0.01043701171875,
-0.03961181640625,
0.007747650146484375,
-0.0020694732666015625,
-0.0225067138671875,
-0.007534027099609375,
-0.0271148681640625,
-0.060455322265625,
-0.01983642578125,
0.01197052001953125,
-0.043182373046875,
-0.0298614501953125,
-0.049346923... |
nghuyong/ernie-health-zh | 2022-09-10T09:13:33.000Z | [
"transformers",
"pytorch",
"ernie",
"feature-extraction",
"zh",
"arxiv:2110.07244",
"endpoints_compatible",
"region:us"
] | feature-extraction | nghuyong | null | null | nghuyong/ernie-health-zh | 9 | 898 | transformers | 2022-05-31T08:43:33 | ---
language: zh
---
# ernie-health-zh
## Introduction
ERNIE-health is a Chinese biomedical language model pre-trained from in-domain text of de-identified online doctor-patient dialogues, electronic medical records, and textbooks.
More detail:
https://github.com/PaddlePaddle/PaddleNLP/blob/develop/model_zoo/ernie-health/
https://arxiv.org/pdf/2110.07244.pdf
## Released Model Info
|Model Name|Language|Model Structure|
|:---:|:---:|:---:|
|ernie-health-zh| Chinese |Layer:12, Hidden:768, Heads:12|
This released pytorch model is converted from the officially released PaddlePaddle ERNIE model and
a series of experiments have been conducted to check the accuracy of the conversion.
- Official PaddlePaddle ERNIE repo:https://github.com/PaddlePaddle/PaddleNLP/blob/develop/model_zoo/ernie-health/
- Pytorch Conversion repo: https://github.com/nghuyong/ERNIE-Pytorch
## How to use
```Python
from transformers import AutoTokenizer, AutoModel
tokenizer = AutoTokenizer.from_pretrained("nghuyong/ernie-health-zh")
model = AutoModel.from_pretrained("nghuyong/ernie-health-zh")
```
## Citation
```bibtex
@article{wang2021building,
title={Building Chinese Biomedical Language Models via Multi-Level Text Discrimination},
author={Wang, Quan and Dai, Songtai and Xu, Benfeng and Lyu, Yajuan and Zhu, Yong and Wu, Hua and Wang, Haifeng},
journal={arXiv preprint arXiv:2110.07244},
year={2021}
}
```
| 1,412 | [
[
0.0041961669921875,
-0.042816162109375,
0.0123291015625,
0.002490997314453125,
-0.0257415771484375,
-0.0243988037109375,
-0.0140838623046875,
-0.045989990234375,
0.025299072265625,
0.0184326171875,
-0.025238037109375,
-0.053985595703125,
-0.043121337890625,
... |
TheBloke/WizardCoder-Python-7B-V1.0-GPTQ | 2023-09-27T12:49:35.000Z | [
"transformers",
"safetensors",
"llama",
"text-generation",
"code",
"arxiv:2304.12244",
"arxiv:2306.08568",
"arxiv:2308.09583",
"arxiv:2303.08774",
"license:llama2",
"model-index",
"text-generation-inference",
"region:us"
] | text-generation | TheBloke | null | null | TheBloke/WizardCoder-Python-7B-V1.0-GPTQ | 6 | 898 | transformers | 2023-09-16T14:45:16 | ---
license: llama2
library_name: transformers
tags:
- code
metrics:
- code_eval
base_model: WizardLM/WizardCoder-Python-7b-V1.0
inference: false
model_creator: WizardLM
model_type: llama
prompt_template: 'Below is an instruction that describes a task. Write a response
that appropriately completes the request.
### Instruction:
{prompt}
### Response:
'
quantized_by: TheBloke
model-index:
- name: WizardCoder-Python-34B-V1.0
results:
- task:
type: text-generation
dataset:
name: HumanEval
type: openai_humaneval
metrics:
- type: pass@1
value: 0.555
name: pass@1
verified: false
---
<!-- header start -->
<!-- 200823 -->
<div style="width: auto; margin-left: auto; margin-right: auto">
<img src="https://i.imgur.com/EBdldam.jpg" alt="TheBlokeAI" style="width: 100%; min-width: 400px; display: block; margin: auto;">
</div>
<div style="display: flex; justify-content: space-between; width: 100%;">
<div style="display: flex; flex-direction: column; align-items: flex-start;">
<p style="margin-top: 0.5em; margin-bottom: 0em;"><a href="https://discord.gg/theblokeai">Chat & support: TheBloke's Discord server</a></p>
</div>
<div style="display: flex; flex-direction: column; align-items: flex-end;">
<p style="margin-top: 0.5em; margin-bottom: 0em;"><a href="https://www.patreon.com/TheBlokeAI">Want to contribute? TheBloke's Patreon page</a></p>
</div>
</div>
<div style="text-align:center; margin-top: 0em; margin-bottom: 0em"><p style="margin-top: 0.25em; margin-bottom: 0em;">TheBloke's LLM work is generously supported by a grant from <a href="https://a16z.com">andreessen horowitz (a16z)</a></p></div>
<hr style="margin-top: 1.0em; margin-bottom: 1.0em;">
<!-- header end -->
# WizardCoder Python 7B V1.0 - GPTQ
- Model creator: [WizardLM](https://huggingface.co/WizardLM)
- Original model: [WizardCoder Python 7B V1.0](https://huggingface.co/WizardLM/WizardCoder-Python-7b-V1.0)
<!-- description start -->
## Description
This repo contains GPTQ model files for [WizardLM's WizardCoder Python 7B V1.0](https://huggingface.co/WizardLM/WizardCoder-Python-7b-V1.0).
Multiple GPTQ parameter permutations are provided; see Provided Files below for details of the options provided, their parameters, and the software used to create them.
<!-- description end -->
<!-- repositories-available start -->
## Repositories available
* [AWQ model(s) for GPU inference.](https://huggingface.co/TheBloke/WizardCoder-Python-7B-V1.0-AWQ)
* [GPTQ models for GPU inference, with multiple quantisation parameter options.](https://huggingface.co/TheBloke/WizardCoder-Python-7B-V1.0-GPTQ)
* [2, 3, 4, 5, 6 and 8-bit GGUF models for CPU+GPU inference](https://huggingface.co/TheBloke/WizardCoder-Python-7B-V1.0-GGUF)
* [WizardLM's original unquantised fp16 model in pytorch format, for GPU inference and for further conversions](https://huggingface.co/WizardLM/WizardCoder-Python-7b-V1.0)
<!-- repositories-available end -->
<!-- prompt-template start -->
## Prompt template: Alpaca
```
Below is an instruction that describes a task. Write a response that appropriately completes the request.
### Instruction:
{prompt}
### Response:
```
<!-- prompt-template end -->
<!-- README_GPTQ.md-provided-files start -->
## Provided files and GPTQ parameters
Multiple quantisation parameters are provided, to allow you to choose the best one for your hardware and requirements.
Each separate quant is in a different branch. See below for instructions on fetching from different branches.
All recent GPTQ files are made with AutoGPTQ, and all files in non-main branches are made with AutoGPTQ. Files in the `main` branch which were uploaded before August 2023 were made with GPTQ-for-LLaMa.
<details>
<summary>Explanation of GPTQ parameters</summary>
- Bits: The bit size of the quantised model.
- GS: GPTQ group size. Higher numbers use less VRAM, but have lower quantisation accuracy. "None" is the lowest possible value.
- Act Order: True or False. Also known as `desc_act`. True results in better quantisation accuracy. Some GPTQ clients have had issues with models that use Act Order plus Group Size, but this is generally resolved now.
- Damp %: A GPTQ parameter that affects how samples are processed for quantisation. 0.01 is default, but 0.1 results in slightly better accuracy.
- GPTQ dataset: The dataset used for quantisation. Using a dataset more appropriate to the model's training can improve quantisation accuracy. Note that the GPTQ dataset is not the same as the dataset used to train the model - please refer to the original model repo for details of the training dataset(s).
- Sequence Length: The length of the dataset sequences used for quantisation. Ideally this is the same as the model sequence length. For some very long sequence models (16+K), a lower sequence length may have to be used. Note that a lower sequence length does not limit the sequence length of the quantised model. It only impacts the quantisation accuracy on longer inference sequences.
- ExLlama Compatibility: Whether this file can be loaded with ExLlama, which currently only supports Llama models in 4-bit.
</details>
| Branch | Bits | GS | Act Order | Damp % | GPTQ Dataset | Seq Len | Size | ExLlama | Desc |
| ------ | ---- | -- | --------- | ------ | ------------ | ------- | ---- | ------- | ---- |
| [main](https://huggingface.co/TheBloke/WizardCoder-Python-7B-V1.0-GPTQ/tree/main) | 4 | 128 | Yes | 0.1 | [Evol Instruct Code](https://huggingface.co/datasets/nickrosh/Evol-Instruct-Code-80k-v1) | 8192 | 3.90 GB | Yes | 4-bit, with Act Order and group size 128g. Uses even less VRAM than 64g, but with slightly lower accuracy. |
| [gptq-4bit-32g-actorder_True](https://huggingface.co/TheBloke/WizardCoder-Python-7B-V1.0-GPTQ/tree/gptq-4bit-32g-actorder_True) | 4 | 32 | Yes | 0.1 | [Evol Instruct Code](https://huggingface.co/datasets/nickrosh/Evol-Instruct-Code-80k-v1) | 8192 | 4.28 GB | Yes | 4-bit, with Act Order and group size 32g. Gives highest possible inference quality, with maximum VRAM usage. |
| [gptq-8bit--1g-actorder_True](https://huggingface.co/TheBloke/WizardCoder-Python-7B-V1.0-GPTQ/tree/gptq-8bit--1g-actorder_True) | 8 | None | Yes | 0.1 | [Evol Instruct Code](https://huggingface.co/datasets/nickrosh/Evol-Instruct-Code-80k-v1) | 8192 | 7.01 GB | No | 8-bit, with Act Order. No group size, to lower VRAM requirements. |
| [gptq-8bit-128g-actorder_True](https://huggingface.co/TheBloke/WizardCoder-Python-7B-V1.0-GPTQ/tree/gptq-8bit-128g-actorder_True) | 8 | 128 | Yes | 0.1 | [Evol Instruct Code](https://huggingface.co/datasets/nickrosh/Evol-Instruct-Code-80k-v1) | 8192 | 7.16 GB | No | 8-bit, with group size 128g for higher inference quality and with Act Order for even higher accuracy. |
<!-- README_GPTQ.md-provided-files end -->
<!-- README_GPTQ.md-download-from-branches start -->
## How to download from branches
- In text-generation-webui, you can add `:branch` to the end of the download name, eg `TheBloke/WizardCoder-Python-7B-V1.0-GPTQ:main`
- With Git, you can clone a branch with:
```
git clone --single-branch --branch main https://huggingface.co/TheBloke/WizardCoder-Python-7B-V1.0-GPTQ
```
- In Python Transformers code, the branch is the `revision` parameter; see below.
<!-- README_GPTQ.md-download-from-branches end -->
<!-- README_GPTQ.md-text-generation-webui start -->
## How to easily download and use this model in [text-generation-webui](https://github.com/oobabooga/text-generation-webui).
Please make sure you're using the latest version of [text-generation-webui](https://github.com/oobabooga/text-generation-webui).
It is strongly recommended to use the text-generation-webui one-click-installers unless you're sure you know how to make a manual install.
1. Click the **Model tab**.
2. Under **Download custom model or LoRA**, enter `TheBloke/WizardCoder-Python-7B-V1.0-GPTQ`.
- To download from a specific branch, enter for example `TheBloke/WizardCoder-Python-7B-V1.0-GPTQ:main`
- see Provided Files above for the list of branches for each option.
3. Click **Download**.
4. The model will start downloading. Once it's finished it will say "Done".
5. In the top left, click the refresh icon next to **Model**.
6. In the **Model** dropdown, choose the model you just downloaded: `WizardCoder-Python-7B-V1.0-GPTQ`
7. The model will automatically load, and is now ready for use!
8. If you want any custom settings, set them and then click **Save settings for this model** followed by **Reload the Model** in the top right.
* Note that you do not need to and should not set manual GPTQ parameters any more. These are set automatically from the file `quantize_config.json`.
9. Once you're ready, click the **Text Generation tab** and enter a prompt to get started!
<!-- README_GPTQ.md-text-generation-webui end -->
<!-- README_GPTQ.md-use-from-python start -->
## How to use this GPTQ model from Python code
### Install the necessary packages
Requires: Transformers 4.32.0 or later, Optimum 1.12.0 or later, and AutoGPTQ 0.4.2 or later.
```shell
pip3 install transformers>=4.32.0 optimum>=1.12.0
pip3 install auto-gptq --extra-index-url https://huggingface.github.io/autogptq-index/whl/cu118/ # Use cu117 if on CUDA 11.7
```
If you have problems installing AutoGPTQ using the pre-built wheels, install it from source instead:
```shell
pip3 uninstall -y auto-gptq
git clone https://github.com/PanQiWei/AutoGPTQ
cd AutoGPTQ
pip3 install .
```
### For CodeLlama models only: you must use Transformers 4.33.0 or later.
If 4.33.0 is not yet released when you read this, you will need to install Transformers from source:
```shell
pip3 uninstall -y transformers
pip3 install git+https://github.com/huggingface/transformers.git
```
### You can then use the following code
```python
from transformers import AutoModelForCausalLM, AutoTokenizer, pipeline
model_name_or_path = "TheBloke/WizardCoder-Python-7B-V1.0-GPTQ"
# To use a different branch, change revision
# For example: revision="main"
model = AutoModelForCausalLM.from_pretrained(model_name_or_path,
device_map="auto",
trust_remote_code=False,
revision="main")
tokenizer = AutoTokenizer.from_pretrained(model_name_or_path, use_fast=True)
prompt = "Tell me about AI"
prompt_template=f'''Below is an instruction that describes a task. Write a response that appropriately completes the request.
### Instruction:
{prompt}
### Response:
'''
print("\n\n*** Generate:")
input_ids = tokenizer(prompt_template, return_tensors='pt').input_ids.cuda()
output = model.generate(inputs=input_ids, temperature=0.7, do_sample=True, top_p=0.95, top_k=40, max_new_tokens=512)
print(tokenizer.decode(output[0]))
# Inference can also be done using transformers' pipeline
print("*** Pipeline:")
pipe = pipeline(
"text-generation",
model=model,
tokenizer=tokenizer,
max_new_tokens=512,
do_sample=True,
temperature=0.7,
top_p=0.95,
top_k=40,
repetition_penalty=1.1
)
print(pipe(prompt_template)[0]['generated_text'])
```
<!-- README_GPTQ.md-use-from-python end -->
<!-- README_GPTQ.md-compatibility start -->
## Compatibility
The files provided are tested to work with AutoGPTQ, both via Transformers and using AutoGPTQ directly. They should also work with [Occ4m's GPTQ-for-LLaMa fork](https://github.com/0cc4m/KoboldAI).
[ExLlama](https://github.com/turboderp/exllama) is compatible with Llama models in 4-bit. Please see the Provided Files table above for per-file compatibility.
[Huggingface Text Generation Inference (TGI)](https://github.com/huggingface/text-generation-inference) is compatible with all GPTQ models.
<!-- README_GPTQ.md-compatibility end -->
<!-- footer start -->
<!-- 200823 -->
## Discord
For further support, and discussions on these models and AI in general, join us at:
[TheBloke AI's Discord server](https://discord.gg/theblokeai)
## Thanks, and how to contribute
Thanks to the [chirper.ai](https://chirper.ai) team!
Thanks to Clay from [gpus.llm-utils.org](llm-utils)!
I've had a lot of people ask if they can contribute. I enjoy providing models and helping people, and would love to be able to spend even more time doing it, as well as expanding into new projects like fine tuning/training.
If you're able and willing to contribute it will be most gratefully received and will help me to keep providing more models, and to start work on new AI projects.
Donaters will get priority support on any and all AI/LLM/model questions and requests, access to a private Discord room, plus other benefits.
* Patreon: https://patreon.com/TheBlokeAI
* Ko-Fi: https://ko-fi.com/TheBlokeAI
**Special thanks to**: Aemon Algiz.
**Patreon special mentions**: Alicia Loh, Stephen Murray, K, Ajan Kanaga, RoA, Magnesian, Deo Leter, Olakabola, Eugene Pentland, zynix, Deep Realms, Raymond Fosdick, Elijah Stavena, Iucharbius, Erik Bjäreholt, Luis Javier Navarrete Lozano, Nicholas, theTransient, John Detwiler, alfie_i, knownsqashed, Mano Prime, Willem Michiel, Enrico Ros, LangChain4j, OG, Michael Dempsey, Pierre Kircher, Pedro Madruga, James Bentley, Thomas Belote, Luke @flexchar, Leonard Tan, Johann-Peter Hartmann, Illia Dulskyi, Fen Risland, Chadd, S_X, Jeff Scroggin, Ken Nordquist, Sean Connelly, Artur Olbinski, Swaroop Kallakuri, Jack West, Ai Maven, David Ziegler, Russ Johnson, transmissions 11, John Villwock, Alps Aficionado, Clay Pascal, Viktor Bowallius, Subspace Studios, Rainer Wilmers, Trenton Dambrowitz, vamX, Michael Levine, 준교 김, Brandon Frisco, Kalila, Trailburnt, Randy H, Talal Aujan, Nathan Dryer, Vadim, 阿明, ReadyPlayerEmma, Tiffany J. Kim, George Stoitzev, Spencer Kim, Jerry Meng, Gabriel Tamborski, Cory Kujawski, Jeffrey Morgan, Spiking Neurons AB, Edmond Seymore, Alexandros Triantafyllidis, Lone Striker, Cap'n Zoog, Nikolai Manek, danny, ya boyyy, Derek Yates, usrbinkat, Mandus, TL, Nathan LeClaire, subjectnull, Imad Khwaja, webtim, Raven Klaugh, Asp the Wyvern, Gabriel Puliatti, Caitlyn Gatomon, Joseph William Delisle, Jonathan Leane, Luke Pendergrass, SuperWojo, Sebastain Graf, Will Dee, Fred von Graf, Andrey, Dan Guido, Daniel P. Andersen, Nitin Borwankar, Elle, Vitor Caleffi, biorpg, jjj, NimbleBox.ai, Pieter, Matthew Berman, terasurfer, Michael Davis, Alex, Stanislav Ovsiannikov
Thank you to all my generous patrons and donaters!
And thank you again to a16z for their generous grant.
<!-- footer end -->
# Original model card: WizardLM's WizardCoder Python 7B V1.0
<p align="center">
🤗 <a href="https://huggingface.co/WizardLM" target="_blank">HF Repo</a> •🐱 <a href="https://github.com/nlpxucan/WizardLM" target="_blank">Github Repo</a> • 🐦 <a href="https://twitter.com/WizardLM_AI" target="_blank">Twitter</a> • 📃 <a href="https://arxiv.org/abs/2304.12244" target="_blank">[WizardLM]</a> • 📃 <a href="https://arxiv.org/abs/2306.08568" target="_blank">[WizardCoder]</a> • 📃 <a href="https://arxiv.org/abs/2308.09583" target="_blank">[WizardMath]</a> <br>
</p>
<p align="center">
👋 Join our <a href="https://discord.gg/VZjjHtWrKs" target="_blank">Discord</a>
</p>
## News
- 🔥🔥🔥[2023/08/26] We released **WizardCoder-Python-34B-V1.0** , which achieves the **73.2 pass@1** and surpasses **GPT4 (2023/03/15)**, **ChatGPT-3.5**, and **Claude2** on the [HumanEval Benchmarks](https://github.com/openai/human-eval).
- [2023/06/16] We released **WizardCoder-15B-V1.0** , which achieves the **57.3 pass@1** and surpasses **Claude-Plus (+6.8)**, **Bard (+15.3)** and **InstructCodeT5+ (+22.3)** on the [HumanEval Benchmarks](https://github.com/openai/human-eval).
❗Note: There are two HumanEval results of GPT4 and ChatGPT-3.5. The 67.0 and 48.1 are reported by the official GPT4 Report (2023/03/15) of [OpenAI](https://arxiv.org/abs/2303.08774). The 82.0 and 72.5 are tested by ourselves with the latest API (2023/08/26).
| Model | Checkpoint | Paper | HumanEval | MBPP | Demo | License |
| ----- |------| ---- |------|-------| ----- | ----- |
| WizardCoder-Python-34B-V1.0 | 🤗 <a href="https://huggingface.co/WizardLM/WizardCoder-Python-34B-V1.0" target="_blank">HF Link</a> | 📃 <a href="https://arxiv.org/abs/2306.08568" target="_blank">[WizardCoder]</a> | 73.2 | 61.2 | [Demo](http://47.103.63.15:50085/) | <a href="https://ai.meta.com/resources/models-and-libraries/llama-downloads/" target="_blank">Llama2</a> |
| WizardCoder-15B-V1.0 | 🤗 <a href="https://huggingface.co/WizardLM/WizardCoder-15B-V1.0" target="_blank">HF Link</a> | 📃 <a href="https://arxiv.org/abs/2306.08568" target="_blank">[WizardCoder]</a> | 59.8 |50.6 | -- | <a href="https://huggingface.co/spaces/bigcode/bigcode-model-license-agreement" target="_blank">OpenRAIL-M</a> |
| WizardCoder-Python-13B-V1.0 | 🤗 <a href="https://huggingface.co/WizardLM/WizardCoder-Python-13B-V1.0" target="_blank">HF Link</a> | 📃 <a href="https://arxiv.org/abs/2306.08568" target="_blank">[WizardCoder]</a> | 64.0 | 55.6 | -- | <a href="https://ai.meta.com/resources/models-and-libraries/llama-downloads/" target="_blank">Llama2</a> |
| WizardCoder-Python-7B-V1.0 | 🤗 <a href="https://huggingface.co/WizardLM/WizardCoder-Python-7B-V1.0" target="_blank">HF Link</a> | 📃 <a href="https://arxiv.org/abs/2306.08568" target="_blank">[WizardCoder]</a> | 55.5 | 51.6 | [Demo](http://47.103.63.15:50088/) | <a href="https://ai.meta.com/resources/models-and-libraries/llama-downloads/" target="_blank">Llama2</a> |
| WizardCoder-3B-V1.0 | 🤗 <a href="https://huggingface.co/WizardLM/WizardCoder-3B-V1.0" target="_blank">HF Link</a> | 📃 <a href="https://arxiv.org/abs/2306.08568" target="_blank">[WizardCoder]</a> | 34.8 |37.4 | -- | <a href="https://huggingface.co/spaces/bigcode/bigcode-model-license-agreement" target="_blank">OpenRAIL-M</a> |
| WizardCoder-1B-V1.0 | 🤗 <a href="https://huggingface.co/WizardLM/WizardCoder-1B-V1.0" target="_blank">HF Link</a> | 📃 <a href="https://arxiv.org/abs/2306.08568" target="_blank">[WizardCoder]</a> | 23.8 |28.6 | -- | <a href="https://huggingface.co/spaces/bigcode/bigcode-model-license-agreement" target="_blank">OpenRAIL-M</a> |
- Our **WizardMath-70B-V1.0** model slightly outperforms some closed-source LLMs on the GSM8K, including **ChatGPT 3.5**, **Claude Instant 1** and **PaLM 2 540B**.
- Our **WizardMath-70B-V1.0** model achieves **81.6 pass@1** on the [GSM8k Benchmarks](https://github.com/openai/grade-school-math), which is **24.8** points higher than the SOTA open-source LLM, and achieves **22.7 pass@1** on the [MATH Benchmarks](https://github.com/hendrycks/math), which is **9.2** points higher than the SOTA open-source LLM.
<font size=4>
| Model | Checkpoint | Paper | GSM8k | MATH |Online Demo| License|
| ----- |------| ---- |------|-------| ----- | ----- |
| WizardMath-70B-V1.0 | 🤗 <a href="https://huggingface.co/WizardLM/WizardMath-70B-V1.0" target="_blank">HF Link</a> | 📃 <a href="https://arxiv.org/abs/2308.09583" target="_blank">[WizardMath]</a>| **81.6** | **22.7** |[Demo](http://47.103.63.15:50083/)| <a href="https://ai.meta.com/resources/models-and-libraries/llama-downloads/" target="_blank">Llama 2 </a> |
| WizardMath-13B-V1.0 | 🤗 <a href="https://huggingface.co/WizardLM/WizardMath-13B-V1.0" target="_blank">HF Link</a> | 📃 <a href="https://arxiv.org/abs/2308.09583" target="_blank">[WizardMath]</a>| **63.9** | **14.0** |[Demo](http://47.103.63.15:50082/)| <a href="https://ai.meta.com/resources/models-and-libraries/llama-downloads/" target="_blank">Llama 2 </a> |
| WizardMath-7B-V1.0 | 🤗 <a href="https://huggingface.co/WizardLM/WizardMath-7B-V1.0" target="_blank">HF Link</a> | 📃 <a href="https://arxiv.org/abs/2308.09583" target="_blank">[WizardMath]</a>| **54.9** | **10.7** | [Demo ](http://47.103.63.15:50080/)| <a href="https://ai.meta.com/resources/models-and-libraries/llama-downloads/" target="_blank">Llama 2 </a>|
</font>
- [08/09/2023] We released **WizardLM-70B-V1.0** model. Here is [Full Model Weight](https://huggingface.co/WizardLM/WizardLM-70B-V1.0).
<font size=4>
| <sup>Model</sup> | <sup>Checkpoint</sup> | <sup>Paper</sup> |<sup>MT-Bench</sup> | <sup>AlpacaEval</sup> | <sup>GSM8k</sup> | <sup>HumanEval</sup> | <sup>License</sup>|
| ----- |------| ---- |------|-------| ----- | ----- | ----- |
| <sup>**WizardLM-70B-V1.0**</sup> | <sup>🤗 <a href="https://huggingface.co/WizardLM/WizardLM-70B-V1.0" target="_blank">HF Link</a> </sup>|<sup>📃**Coming Soon**</sup>| <sup>**7.78**</sup> | <sup>**92.91%**</sup> |<sup>**77.6%**</sup> | <sup> **50.6**</sup>|<sup> <a href="https://ai.meta.com/resources/models-and-libraries/llama-downloads/" target="_blank">Llama 2 License </a></sup> |
| <sup>WizardLM-13B-V1.2</sup> | <sup>🤗 <a href="https://huggingface.co/WizardLM/WizardLM-13B-V1.2" target="_blank">HF Link</a> </sup>| | <sup>7.06</sup> | <sup>89.17%</sup> |<sup>55.3%</sup> | <sup>36.6 </sup>|<sup> <a href="https://ai.meta.com/resources/models-and-libraries/llama-downloads/" target="_blank">Llama 2 License </a></sup> |
| <sup>WizardLM-13B-V1.1</sup> |<sup> 🤗 <a href="https://huggingface.co/WizardLM/WizardLM-13B-V1.1" target="_blank">HF Link</a> </sup> | | <sup>6.76</sup> |<sup>86.32%</sup> | | <sup>25.0 </sup>| <sup>Non-commercial</sup>|
| <sup>WizardLM-30B-V1.0</sup> | <sup>🤗 <a href="https://huggingface.co/WizardLM/WizardLM-30B-V1.0" target="_blank">HF Link</a></sup> | | <sup>7.01</sup> | | | <sup>37.8 </sup>| <sup>Non-commercial</sup> |
| <sup>WizardLM-13B-V1.0</sup> | <sup>🤗 <a href="https://huggingface.co/WizardLM/WizardLM-13B-V1.0" target="_blank">HF Link</a> </sup> | | <sup>6.35</sup> | <sup>75.31%</sup> | | <sup> 24.0 </sup> | <sup>Non-commercial</sup>|
| <sup>WizardLM-7B-V1.0 </sup>| <sup>🤗 <a href="https://huggingface.co/WizardLM/WizardLM-7B-V1.0" target="_blank">HF Link</a> </sup> |<sup> 📃 <a href="https://arxiv.org/abs/2304.12244" target="_blank">[WizardLM]</a> </sup>| | | |<sup>19.1 </sup>|<sup> Non-commercial</sup>|
</font>
## Comparing WizardCoder-Python-34B-V1.0 with Other LLMs.
🔥 The following figure shows that our **WizardCoder-Python-34B-V1.0 attains the second position in this benchmark**, surpassing GPT4 (2023/03/15, 73.2 vs. 67.0), ChatGPT-3.5 (73.2 vs. 72.5) and Claude2 (73.2 vs. 71.2).
<p align="center" width="100%">
<a ><img src="https://raw.githubusercontent.com/nlpxucan/WizardLM/main/WizardCoder/imgs/compare_sota.png" alt="WizardCoder" style="width: 96%; min-width: 300px; display: block; margin: auto;"></a>
</p>
## Prompt Format
```
"Below is an instruction that describes a task. Write a response that appropriately completes the request.\n\n### Instruction:\n{instruction}\n\n### Response:"
```
## Inference Demo Script
We provide the inference demo code [here](https://github.com/nlpxucan/WizardLM/tree/main/demo).
## Citation
Please cite the repo if you use the data, method or code in this repo.
```
@article{luo2023wizardcoder,
title={WizardCoder: Empowering Code Large Language Models with Evol-Instruct},
author={Luo, Ziyang and Xu, Can and Zhao, Pu and Sun, Qingfeng and Geng, Xiubo and Hu, Wenxiang and Tao, Chongyang and Ma, Jing and Lin, Qingwei and Jiang, Daxin},
journal={arXiv preprint arXiv:2306.08568},
year={2023}
}
```
| 23,426 | [
[
-0.03741455078125,
-0.055267333984375,
-0.00518798828125,
0.01160430908203125,
-0.0108184814453125,
-0.0184783935546875,
0.00608062744140625,
-0.0196075439453125,
0.0026397705078125,
0.034210205078125,
-0.0347900390625,
-0.034637451171875,
-0.03466796875,
0.... |
TheBloke/zephyr-7B-alpha-GGUF | 2023-10-14T07:12:10.000Z | [
"transformers",
"mistral",
"generated_from_trainer",
"en",
"dataset:stingning/ultrachat",
"dataset:openbmb/UltraFeedback",
"arxiv:2305.18290",
"license:mit",
"has_space",
"text-generation-inference",
"region:us"
] | null | TheBloke | null | null | TheBloke/zephyr-7B-alpha-GGUF | 124 | 898 | transformers | 2023-10-11T03:26:12 | ---
base_model: HuggingFaceH4/zephyr-7b-alpha
datasets:
- stingning/ultrachat
- openbmb/UltraFeedback
inference: false
language:
- en
license: mit
model-index:
- name: zephyr-7b-alpha
results: []
model_creator: Hugging Face H4
model_name: Zephyr 7B Alpha
model_type: mistral
prompt_template: '<|system|>
</s>
<|user|>
{prompt}</s>
<|assistant|>
'
quantized_by: TheBloke
tags:
- generated_from_trainer
---
<!-- header start -->
<!-- 200823 -->
<div style="width: auto; margin-left: auto; margin-right: auto">
<img src="https://i.imgur.com/EBdldam.jpg" alt="TheBlokeAI" style="width: 100%; min-width: 400px; display: block; margin: auto;">
</div>
<div style="display: flex; justify-content: space-between; width: 100%;">
<div style="display: flex; flex-direction: column; align-items: flex-start;">
<p style="margin-top: 0.5em; margin-bottom: 0em;"><a href="https://discord.gg/theblokeai">Chat & support: TheBloke's Discord server</a></p>
</div>
<div style="display: flex; flex-direction: column; align-items: flex-end;">
<p style="margin-top: 0.5em; margin-bottom: 0em;"><a href="https://www.patreon.com/TheBlokeAI">Want to contribute? TheBloke's Patreon page</a></p>
</div>
</div>
<div style="text-align:center; margin-top: 0em; margin-bottom: 0em"><p style="margin-top: 0.25em; margin-bottom: 0em;">TheBloke's LLM work is generously supported by a grant from <a href="https://a16z.com">andreessen horowitz (a16z)</a></p></div>
<hr style="margin-top: 1.0em; margin-bottom: 1.0em;">
<!-- header end -->
# Zephyr 7B Alpha - GGUF
- Model creator: [Hugging Face H4](https://huggingface.co/HuggingFaceH4)
- Original model: [Zephyr 7B Alpha](https://huggingface.co/HuggingFaceH4/zephyr-7b-alpha)
<!-- description start -->
## Description
This repo contains GGUF format model files for [Hugging Face H4's Zephyr 7B Alpha](https://huggingface.co/HuggingFaceH4/zephyr-7b-alpha).
<!-- description end -->
<!-- README_GGUF.md-about-gguf start -->
### About GGUF
GGUF is a new format introduced by the llama.cpp team on August 21st 2023. It is a replacement for GGML, which is no longer supported by llama.cpp.
Here is an incomplate list of clients and libraries that are known to support GGUF:
* [llama.cpp](https://github.com/ggerganov/llama.cpp). The source project for GGUF. Offers a CLI and a server option.
* [text-generation-webui](https://github.com/oobabooga/text-generation-webui), the most widely used web UI, with many features and powerful extensions. Supports GPU acceleration.
* [KoboldCpp](https://github.com/LostRuins/koboldcpp), a fully featured web UI, with GPU accel across all platforms and GPU architectures. Especially good for story telling.
* [LM Studio](https://lmstudio.ai/), an easy-to-use and powerful local GUI for Windows and macOS (Silicon), with GPU acceleration.
* [LoLLMS Web UI](https://github.com/ParisNeo/lollms-webui), a great web UI with many interesting and unique features, including a full model library for easy model selection.
* [Faraday.dev](https://faraday.dev/), an attractive and easy to use character-based chat GUI for Windows and macOS (both Silicon and Intel), with GPU acceleration.
* [ctransformers](https://github.com/marella/ctransformers), a Python library with GPU accel, LangChain support, and OpenAI-compatible AI server.
* [llama-cpp-python](https://github.com/abetlen/llama-cpp-python), a Python library with GPU accel, LangChain support, and OpenAI-compatible API server.
* [candle](https://github.com/huggingface/candle), a Rust ML framework with a focus on performance, including GPU support, and ease of use.
<!-- README_GGUF.md-about-gguf end -->
<!-- repositories-available start -->
## Repositories available
* [AWQ model(s) for GPU inference.](https://huggingface.co/TheBloke/zephyr-7B-alpha-AWQ)
* [GPTQ models for GPU inference, with multiple quantisation parameter options.](https://huggingface.co/TheBloke/zephyr-7B-alpha-GPTQ)
* [2, 3, 4, 5, 6 and 8-bit GGUF models for CPU+GPU inference](https://huggingface.co/TheBloke/zephyr-7B-alpha-GGUF)
* [Hugging Face H4's original unquantised fp16 model in pytorch format, for GPU inference and for further conversions](https://huggingface.co/HuggingFaceH4/zephyr-7b-alpha)
<!-- repositories-available end -->
<!-- prompt-template start -->
## Prompt template: Zephyr
```
<|system|>
</s>
<|user|>
{prompt}</s>
<|assistant|>
```
<!-- prompt-template end -->
<!-- compatibility_gguf start -->
## Compatibility
These quantised GGUFv2 files are compatible with llama.cpp from August 27th onwards, as of commit [d0cee0d](https://github.com/ggerganov/llama.cpp/commit/d0cee0d36d5be95a0d9088b674dbb27354107221)
They are also compatible with many third party UIs and libraries - please see the list at the top of this README.
## Explanation of quantisation methods
<details>
<summary>Click to see details</summary>
The new methods available are:
* GGML_TYPE_Q2_K - "type-1" 2-bit quantization in super-blocks containing 16 blocks, each block having 16 weight. Block scales and mins are quantized with 4 bits. This ends up effectively using 2.5625 bits per weight (bpw)
* GGML_TYPE_Q3_K - "type-0" 3-bit quantization in super-blocks containing 16 blocks, each block having 16 weights. Scales are quantized with 6 bits. This end up using 3.4375 bpw.
* GGML_TYPE_Q4_K - "type-1" 4-bit quantization in super-blocks containing 8 blocks, each block having 32 weights. Scales and mins are quantized with 6 bits. This ends up using 4.5 bpw.
* GGML_TYPE_Q5_K - "type-1" 5-bit quantization. Same super-block structure as GGML_TYPE_Q4_K resulting in 5.5 bpw
* GGML_TYPE_Q6_K - "type-0" 6-bit quantization. Super-blocks with 16 blocks, each block having 16 weights. Scales are quantized with 8 bits. This ends up using 6.5625 bpw
Refer to the Provided Files table below to see what files use which methods, and how.
</details>
<!-- compatibility_gguf end -->
<!-- README_GGUF.md-provided-files start -->
## Provided files
| Name | Quant method | Bits | Size | Max RAM required | Use case |
| ---- | ---- | ---- | ---- | ---- | ----- |
| [zephyr-7b-alpha.Q2_K.gguf](https://huggingface.co/TheBloke/zephyr-7B-alpha-GGUF/blob/main/zephyr-7b-alpha.Q2_K.gguf) | Q2_K | 2 | 3.08 GB| 5.58 GB | smallest, significant quality loss - not recommended for most purposes |
| [zephyr-7b-alpha.Q3_K_S.gguf](https://huggingface.co/TheBloke/zephyr-7B-alpha-GGUF/blob/main/zephyr-7b-alpha.Q3_K_S.gguf) | Q3_K_S | 3 | 3.16 GB| 5.66 GB | very small, high quality loss |
| [zephyr-7b-alpha.Q3_K_M.gguf](https://huggingface.co/TheBloke/zephyr-7B-alpha-GGUF/blob/main/zephyr-7b-alpha.Q3_K_M.gguf) | Q3_K_M | 3 | 3.52 GB| 6.02 GB | very small, high quality loss |
| [zephyr-7b-alpha.Q3_K_L.gguf](https://huggingface.co/TheBloke/zephyr-7B-alpha-GGUF/blob/main/zephyr-7b-alpha.Q3_K_L.gguf) | Q3_K_L | 3 | 3.82 GB| 6.32 GB | small, substantial quality loss |
| [zephyr-7b-alpha.Q4_0.gguf](https://huggingface.co/TheBloke/zephyr-7B-alpha-GGUF/blob/main/zephyr-7b-alpha.Q4_0.gguf) | Q4_0 | 4 | 4.11 GB| 6.61 GB | legacy; small, very high quality loss - prefer using Q3_K_M |
| [zephyr-7b-alpha.Q4_K_S.gguf](https://huggingface.co/TheBloke/zephyr-7B-alpha-GGUF/blob/main/zephyr-7b-alpha.Q4_K_S.gguf) | Q4_K_S | 4 | 4.14 GB| 6.64 GB | small, greater quality loss |
| [zephyr-7b-alpha.Q4_K_M.gguf](https://huggingface.co/TheBloke/zephyr-7B-alpha-GGUF/blob/main/zephyr-7b-alpha.Q4_K_M.gguf) | Q4_K_M | 4 | 4.37 GB| 6.87 GB | medium, balanced quality - recommended |
| [zephyr-7b-alpha.Q5_0.gguf](https://huggingface.co/TheBloke/zephyr-7B-alpha-GGUF/blob/main/zephyr-7b-alpha.Q5_0.gguf) | Q5_0 | 5 | 5.00 GB| 7.50 GB | legacy; medium, balanced quality - prefer using Q4_K_M |
| [zephyr-7b-alpha.Q5_K_S.gguf](https://huggingface.co/TheBloke/zephyr-7B-alpha-GGUF/blob/main/zephyr-7b-alpha.Q5_K_S.gguf) | Q5_K_S | 5 | 5.00 GB| 7.50 GB | large, low quality loss - recommended |
| [zephyr-7b-alpha.Q5_K_M.gguf](https://huggingface.co/TheBloke/zephyr-7B-alpha-GGUF/blob/main/zephyr-7b-alpha.Q5_K_M.gguf) | Q5_K_M | 5 | 5.13 GB| 7.63 GB | large, very low quality loss - recommended |
| [zephyr-7b-alpha.Q6_K.gguf](https://huggingface.co/TheBloke/zephyr-7B-alpha-GGUF/blob/main/zephyr-7b-alpha.Q6_K.gguf) | Q6_K | 6 | 5.94 GB| 8.44 GB | very large, extremely low quality loss |
| [zephyr-7b-alpha.Q8_0.gguf](https://huggingface.co/TheBloke/zephyr-7B-alpha-GGUF/blob/main/zephyr-7b-alpha.Q8_0.gguf) | Q8_0 | 8 | 7.70 GB| 10.20 GB | very large, extremely low quality loss - not recommended |
**Note**: the above RAM figures assume no GPU offloading. If layers are offloaded to the GPU, this will reduce RAM usage and use VRAM instead.
<!-- README_GGUF.md-provided-files end -->
<!-- README_GGUF.md-how-to-download start -->
## How to download GGUF files
**Note for manual downloaders:** You almost never want to clone the entire repo! Multiple different quantisation formats are provided, and most users only want to pick and download a single file.
The following clients/libraries will automatically download models for you, providing a list of available models to choose from:
- LM Studio
- LoLLMS Web UI
- Faraday.dev
### In `text-generation-webui`
Under Download Model, you can enter the model repo: TheBloke/zephyr-7B-alpha-GGUF and below it, a specific filename to download, such as: zephyr-7b-alpha.Q4_K_M.gguf.
Then click Download.
### On the command line, including multiple files at once
I recommend using the `huggingface-hub` Python library:
```shell
pip3 install huggingface-hub
```
Then you can download any individual model file to the current directory, at high speed, with a command like this:
```shell
huggingface-cli download TheBloke/zephyr-7B-alpha-GGUF zephyr-7b-alpha.Q4_K_M.gguf --local-dir . --local-dir-use-symlinks False
```
<details>
<summary>More advanced huggingface-cli download usage</summary>
You can also download multiple files at once with a pattern:
```shell
huggingface-cli download TheBloke/zephyr-7B-alpha-GGUF --local-dir . --local-dir-use-symlinks False --include='*Q4_K*gguf'
```
For more documentation on downloading with `huggingface-cli`, please see: [HF -> Hub Python Library -> Download files -> Download from the CLI](https://huggingface.co/docs/huggingface_hub/guides/download#download-from-the-cli).
To accelerate downloads on fast connections (1Gbit/s or higher), install `hf_transfer`:
```shell
pip3 install hf_transfer
```
And set environment variable `HF_HUB_ENABLE_HF_TRANSFER` to `1`:
```shell
HF_HUB_ENABLE_HF_TRANSFER=1 huggingface-cli download TheBloke/zephyr-7B-alpha-GGUF zephyr-7b-alpha.Q4_K_M.gguf --local-dir . --local-dir-use-symlinks False
```
Windows Command Line users: You can set the environment variable by running `set HF_HUB_ENABLE_HF_TRANSFER=1` before the download command.
</details>
<!-- README_GGUF.md-how-to-download end -->
<!-- README_GGUF.md-how-to-run start -->
## Example `llama.cpp` command
Make sure you are using `llama.cpp` from commit [d0cee0d](https://github.com/ggerganov/llama.cpp/commit/d0cee0d36d5be95a0d9088b674dbb27354107221) or later.
```shell
./main -ngl 32 -m zephyr-7b-alpha.Q4_K_M.gguf --color -c 2048 --temp 0.7 --repeat_penalty 1.1 -n -1 -p "<|system|>\n</s>\n<|user|>\n{prompt}</s>\n<|assistant|>"
```
Change `-ngl 32` to the number of layers to offload to GPU. Remove it if you don't have GPU acceleration.
Change `-c 2048` to the desired sequence length. For extended sequence models - eg 8K, 16K, 32K - the necessary RoPE scaling parameters are read from the GGUF file and set by llama.cpp automatically.
If you want to have a chat-style conversation, replace the `-p <PROMPT>` argument with `-i -ins`
For other parameters and how to use them, please refer to [the llama.cpp documentation](https://github.com/ggerganov/llama.cpp/blob/master/examples/main/README.md)
## How to run in `text-generation-webui`
Further instructions here: [text-generation-webui/docs/llama.cpp.md](https://github.com/oobabooga/text-generation-webui/blob/main/docs/llama.cpp.md).
## How to run from Python code
You can use GGUF models from Python using the [llama-cpp-python](https://github.com/abetlen/llama-cpp-python) or [ctransformers](https://github.com/marella/ctransformers) libraries.
### How to load this model in Python code, using ctransformers
#### First install the package
Run one of the following commands, according to your system:
```shell
# Base ctransformers with no GPU acceleration
pip install ctransformers
# Or with CUDA GPU acceleration
pip install ctransformers[cuda]
# Or with AMD ROCm GPU acceleration (Linux only)
CT_HIPBLAS=1 pip install ctransformers --no-binary ctransformers
# Or with Metal GPU acceleration for macOS systems only
CT_METAL=1 pip install ctransformers --no-binary ctransformers
```
#### Simple ctransformers example code
```python
from ctransformers import AutoModelForCausalLM
# Set gpu_layers to the number of layers to offload to GPU. Set to 0 if no GPU acceleration is available on your system.
llm = AutoModelForCausalLM.from_pretrained("TheBloke/zephyr-7B-alpha-GGUF", model_file="zephyr-7b-alpha.Q4_K_M.gguf", model_type="mistral", gpu_layers=50)
print(llm("AI is going to"))
```
## How to use with LangChain
Here are guides on using llama-cpp-python and ctransformers with LangChain:
* [LangChain + llama-cpp-python](https://python.langchain.com/docs/integrations/llms/llamacpp)
* [LangChain + ctransformers](https://python.langchain.com/docs/integrations/providers/ctransformers)
<!-- README_GGUF.md-how-to-run end -->
<!-- footer start -->
<!-- 200823 -->
## Discord
For further support, and discussions on these models and AI in general, join us at:
[TheBloke AI's Discord server](https://discord.gg/theblokeai)
## Thanks, and how to contribute
Thanks to the [chirper.ai](https://chirper.ai) team!
Thanks to Clay from [gpus.llm-utils.org](llm-utils)!
I've had a lot of people ask if they can contribute. I enjoy providing models and helping people, and would love to be able to spend even more time doing it, as well as expanding into new projects like fine tuning/training.
If you're able and willing to contribute it will be most gratefully received and will help me to keep providing more models, and to start work on new AI projects.
Donaters will get priority support on any and all AI/LLM/model questions and requests, access to a private Discord room, plus other benefits.
* Patreon: https://patreon.com/TheBlokeAI
* Ko-Fi: https://ko-fi.com/TheBlokeAI
**Special thanks to**: Aemon Algiz.
**Patreon special mentions**: Pierre Kircher, Stanislav Ovsiannikov, Michael Levine, Eugene Pentland, Andrey, 준교 김, Randy H, Fred von Graf, Artur Olbinski, Caitlyn Gatomon, terasurfer, Jeff Scroggin, James Bentley, Vadim, Gabriel Puliatti, Harry Royden McLaughlin, Sean Connelly, Dan Guido, Edmond Seymore, Alicia Loh, subjectnull, AzureBlack, Manuel Alberto Morcote, Thomas Belote, Lone Striker, Chris Smitley, Vitor Caleffi, Johann-Peter Hartmann, Clay Pascal, biorpg, Brandon Frisco, sidney chen, transmissions 11, Pedro Madruga, jinyuan sun, Ajan Kanaga, Emad Mostaque, Trenton Dambrowitz, Jonathan Leane, Iucharbius, usrbinkat, vamX, George Stoitzev, Luke Pendergrass, theTransient, Olakabola, Swaroop Kallakuri, Cap'n Zoog, Brandon Phillips, Michael Dempsey, Nikolai Manek, danny, Matthew Berman, Gabriel Tamborski, alfie_i, Raymond Fosdick, Tom X Nguyen, Raven Klaugh, LangChain4j, Magnesian, Illia Dulskyi, David Ziegler, Mano Prime, Luis Javier Navarrete Lozano, Erik Bjäreholt, 阿明, Nathan Dryer, Alex, Rainer Wilmers, zynix, TL, Joseph William Delisle, John Villwock, Nathan LeClaire, Willem Michiel, Joguhyik, GodLy, OG, Alps Aficionado, Jeffrey Morgan, ReadyPlayerEmma, Tiffany J. Kim, Sebastain Graf, Spencer Kim, Michael Davis, webtim, Talal Aujan, knownsqashed, John Detwiler, Imad Khwaja, Deo Leter, Jerry Meng, Elijah Stavena, Rooh Singh, Pieter, SuperWojo, Alexandros Triantafyllidis, Stephen Murray, Ai Maven, ya boyyy, Enrico Ros, Ken Nordquist, Deep Realms, Nicholas, Spiking Neurons AB, Elle, Will Dee, Jack West, RoA, Luke @flexchar, Viktor Bowallius, Derek Yates, Subspace Studios, jjj, Toran Billups, Asp the Wyvern, Fen Risland, Ilya, NimbleBox.ai, Chadd, Nitin Borwankar, Emre, Mandus, Leonard Tan, Kalila, K, Trailburnt, S_X, Cory Kujawski
Thank you to all my generous patrons and donaters!
And thank you again to a16z for their generous grant.
<!-- footer end -->
<!-- original-model-card start -->
# Original model card: Hugging Face H4's Zephyr 7B Alpha
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
<img src="https://huggingface.co/HuggingFaceH4/zephyr-7b-alpha/resolve/main/thumbnail.png" alt="Zephyr Logo" width="800" style="margin-left:'auto' margin-right:'auto' display:'block'"/>
# Model Card for Zephyr 7B Alpha
Zephyr is a series of language models that are trained to act as helpful assistants. Zephyr-7B-α is the first model in the series, and is a fine-tuned version of [mistralai/Mistral-7B-v0.1](https://huggingface.co/mistralai/Mistral-7B-v0.1) that was trained on on a mix of publicly available, synthetic datasets using [Direct Preference Optimization (DPO)](https://arxiv.org/abs/2305.18290). We found that removing the in-built alignment of these datasets boosted performance on [MT Bench](https://huggingface.co/spaces/lmsys/mt-bench) and made the model more helpful. However, this means that model is likely to generate problematic text when prompted to do so and should only be used for educational and research purposes.
## Model description
- **Model type:** A 7B parameter GPT-like model fine-tuned on a mix of publicly available, synthetic datasets.
- **Language(s) (NLP):** Primarily English
- **License:** MIT
- **Finetuned from model:** [mistralai/Mistral-7B-v0.1](https://huggingface.co/mistralai/Mistral-7B-v0.1)
### Model Sources
<!-- Provide the basic links for the model. -->
- **Repository:** https://github.com/huggingface/alignment-handbook
- **Demo:** https://huggingface.co/spaces/HuggingFaceH4/zephyr-chat
## Intended uses & limitations
The model was initially fine-tuned on a variant of the [`UltraChat`](https://huggingface.co/datasets/stingning/ultrachat) dataset, which contains a diverse range of synthetic dialogues generated by ChatGPT. We then further aligned the model with [🤗 TRL's](https://github.com/huggingface/trl) `DPOTrainer` on the [openbmb/UltraFeedback](https://huggingface.co/datasets/openbmb/UltraFeedback) dataset, which contain 64k prompts and model completions that are ranked by GPT-4. As a result, the model can be used for chat and you can check out our [demo](https://huggingface.co/spaces/HuggingFaceH4/zephyr-chat) to test its capabilities.
Here's how you can run the model using the `pipeline()` function from 🤗 Transformers:
```python
import torch
from transformers import pipeline
pipe = pipeline("text-generation", model="HuggingFaceH4/zephyr-7b-alpha", torch_dtype=torch.bfloat16, device_map="auto")
# We use the tokenizer's chat template to format each message - see https://huggingface.co/docs/transformers/main/en/chat_templating
messages = [
{
"role": "system",
"content": "You are a friendly chatbot who always responds in the style of a pirate",
},
{"role": "user", "content": "How many helicopters can a human eat in one sitting?"},
]
prompt = pipe.tokenizer.apply_chat_template(messages, tokenize=False, add_generation_prompt=True)
outputs = pipe(prompt, max_new_tokens=256, do_sample=True, temperature=0.7, top_k=50, top_p=0.95)
print(outputs[0]["generated_text"])
# <|system|>
# You are a friendly chatbot who always responds in the style of a pirate.</s>
# <|user|>
# How many helicopters can a human eat in one sitting?</s>
# <|assistant|>
# Ah, me hearty matey! But yer question be a puzzler! A human cannot eat a helicopter in one sitting, as helicopters are not edible. They be made of metal, plastic, and other materials, not food!
```
## Bias, Risks, and Limitations
<!-- This section is meant to convey both technical and sociotechnical limitations. -->
Zephyr-7B-α has not been aligned to human preferences with techniques like RLHF or deployed with in-the-loop filtering of responses like ChatGPT, so the model can produce problematic outputs (especially when prompted to do so).
It is also unknown what the size and composition of the corpus was used to train the base model (`mistralai/Mistral-7B-v0.1`), however it is likely to have included a mix of Web data and technical sources like books and code. See the [Falcon 180B model card](https://huggingface.co/tiiuae/falcon-180B#training-data) for an example of this.
## Training and evaluation data
Zephyr 7B Alpha achieves the following results on the evaluation set:
- Loss: 0.4605
- Rewards/chosen: -0.5053
- Rewards/rejected: -1.8752
- Rewards/accuracies: 0.7812
- Rewards/margins: 1.3699
- Logps/rejected: -327.4286
- Logps/chosen: -297.1040
- Logits/rejected: -2.7153
- Logits/chosen: -2.7447
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 5e-07
- train_batch_size: 2
- eval_batch_size: 4
- seed: 42
- distributed_type: multi-GPU
- num_devices: 16
- total_train_batch_size: 32
- total_eval_batch_size: 64
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: linear
- lr_scheduler_warmup_ratio: 0.1
- num_epochs: 1
### Training results
| Training Loss | Epoch | Step | Validation Loss | Rewards/chosen | Rewards/rejected | Rewards/accuracies | Rewards/margins | Logps/rejected | Logps/chosen | Logits/rejected | Logits/chosen |
|:-------------:|:-----:|:----:|:---------------:|:--------------:|:----------------:|:------------------:|:---------------:|:--------------:|:------------:|:---------------:|:-------------:|
| 0.5602 | 0.05 | 100 | 0.5589 | -0.3359 | -0.8168 | 0.7188 | 0.4809 | -306.2607 | -293.7161 | -2.6554 | -2.6797 |
| 0.4852 | 0.1 | 200 | 0.5136 | -0.5310 | -1.4994 | 0.8125 | 0.9684 | -319.9124 | -297.6181 | -2.5762 | -2.5957 |
| 0.5212 | 0.15 | 300 | 0.5168 | -0.1686 | -1.1760 | 0.7812 | 1.0074 | -313.4444 | -290.3699 | -2.6865 | -2.7125 |
| 0.5496 | 0.21 | 400 | 0.4835 | -0.1617 | -1.7170 | 0.8281 | 1.5552 | -324.2635 | -290.2326 | -2.7947 | -2.8218 |
| 0.5209 | 0.26 | 500 | 0.5054 | -0.4778 | -1.6604 | 0.7344 | 1.1826 | -323.1325 | -296.5546 | -2.8388 | -2.8667 |
| 0.4617 | 0.31 | 600 | 0.4910 | -0.3738 | -1.5180 | 0.7656 | 1.1442 | -320.2848 | -294.4741 | -2.8234 | -2.8521 |
| 0.4452 | 0.36 | 700 | 0.4838 | -0.4591 | -1.6576 | 0.7031 | 1.1986 | -323.0770 | -296.1796 | -2.7401 | -2.7653 |
| 0.4674 | 0.41 | 800 | 0.5077 | -0.5692 | -1.8659 | 0.7656 | 1.2967 | -327.2416 | -298.3818 | -2.6740 | -2.6945 |
| 0.4656 | 0.46 | 900 | 0.4927 | -0.5279 | -1.6614 | 0.7656 | 1.1335 | -323.1518 | -297.5553 | -2.7817 | -2.8015 |
| 0.4102 | 0.52 | 1000 | 0.4772 | -0.5767 | -2.0667 | 0.7656 | 1.4900 | -331.2578 | -298.5311 | -2.7160 | -2.7455 |
| 0.4663 | 0.57 | 1100 | 0.4740 | -0.8038 | -2.1018 | 0.7656 | 1.2980 | -331.9604 | -303.0741 | -2.6994 | -2.7257 |
| 0.4737 | 0.62 | 1200 | 0.4716 | -0.3783 | -1.7015 | 0.7969 | 1.3232 | -323.9545 | -294.5634 | -2.6842 | -2.7135 |
| 0.4259 | 0.67 | 1300 | 0.4866 | -0.6239 | -1.9703 | 0.7812 | 1.3464 | -329.3312 | -299.4761 | -2.7046 | -2.7356 |
| 0.4935 | 0.72 | 1400 | 0.4747 | -0.5626 | -1.7600 | 0.7812 | 1.1974 | -325.1243 | -298.2491 | -2.7153 | -2.7444 |
| 0.4211 | 0.77 | 1500 | 0.4645 | -0.6099 | -1.9993 | 0.7656 | 1.3894 | -329.9109 | -299.1959 | -2.6944 | -2.7236 |
| 0.4931 | 0.83 | 1600 | 0.4684 | -0.6798 | -2.1082 | 0.7656 | 1.4285 | -332.0890 | -300.5934 | -2.7006 | -2.7305 |
| 0.5029 | 0.88 | 1700 | 0.4595 | -0.5063 | -1.8951 | 0.7812 | 1.3889 | -327.8267 | -297.1233 | -2.7108 | -2.7403 |
| 0.4965 | 0.93 | 1800 | 0.4613 | -0.5561 | -1.9079 | 0.7812 | 1.3518 | -328.0831 | -298.1203 | -2.7226 | -2.7523 |
| 0.4337 | 0.98 | 1900 | 0.4608 | -0.5066 | -1.8718 | 0.7656 | 1.3652 | -327.3599 | -297.1296 | -2.7175 | -2.7469 |
### Framework versions
- Transformers 4.34.0
- Pytorch 2.0.1+cu118
- Datasets 2.12.0
- Tokenizers 0.14.0
<!-- original-model-card end -->
| 25,721 | [
[
-0.03741455078125,
-0.039154052734375,
0.020477294921875,
0.02197265625,
-0.0165557861328125,
-0.0104217529296875,
0.003681182861328125,
-0.0506591796875,
0.03912353515625,
0.00690460205078125,
-0.054229736328125,
-0.034637451171875,
-0.02764892578125,
-0.00... |
Revanthraja/Fashion | 2023-10-22T09:10:29.000Z | [
"diffusers",
"tensorboard",
"text-to-image",
"license:creativeml-openrail-m",
"endpoints_compatible",
"diffusers:StableDiffusionPipeline",
"region:us",
"has_space"
] | text-to-image | Revanthraja | null | null | Revanthraja/Fashion | 1 | 898 | diffusers | 2023-10-22T07:13:51 | ---
license: creativeml-openrail-m
tags:
- text-to-image
---
### dress_style_v1 Dreambooth model trained by Revanthraja M with [Hugging Face Dreambooth Training Space](https://huggingface.co/spaces/multimodalart/dreambooth-training) with the v1-5 base model
You run your new concept via `diffusers` [Colab Notebook for Inference](https://colab.research.google.com/github/huggingface/notebooks/blob/main/diffusers/sd_dreambooth_inference.ipynb). Don't forget to use the concept prompts!
| 489 | [
[
-0.0372314453125,
-0.0455322265625,
0.020172119140625,
0.036651611328125,
-0.027923583984375,
0.01739501953125,
0.03033447265625,
-0.024749755859375,
0.048187255859375,
0.03033447265625,
-0.06475830078125,
-0.0209503173828125,
-0.025665283203125,
-0.02311706... |
UCSC-VLAA/ViT-H-14-CLIPA-336-datacomp1B | 2023-10-17T06:25:50.000Z | [
"open_clip",
"clip",
"zero-shot-image-classification",
"dataset:mlfoundations/datacomp_1b",
"arxiv:2306.15658",
"arxiv:2305.07017",
"license:apache-2.0",
"region:us"
] | zero-shot-image-classification | UCSC-VLAA | null | null | UCSC-VLAA/ViT-H-14-CLIPA-336-datacomp1B | 1 | 897 | open_clip | 2023-10-17T06:14:09 | ---
tags:
- clip
library_name: open_clip
pipeline_tag: zero-shot-image-classification
license: apache-2.0
datasets:
- mlfoundations/datacomp_1b
---
# Model card for ViT-H-14-CLIPA-336-datacomp1B
A CLIPA-v2 model...
## Model Details
- **Model Type:** Contrastive Image-Text, Zero-Shot Image Classification.
- **Original:** https://github.com/UCSC-VLAA/CLIPA
- **Dataset:** mlfoundations/datacomp_1b
- **Papers:**
- CLIPA-v2: Scaling CLIP Training with 81.1% Zero-shot ImageNet Accuracy within a $10,000 Budget; An Extra $4,000 Unlocks 81.8% Accuracy: https://arxiv.org/abs/2306.15658
- An Inverse Scaling Law for CLIP Training: https://arxiv.org/abs/2305.07017
## Model Usage
### With OpenCLIP
```
import torch
import torch.nn.functional as F
from urllib.request import urlopen
from PIL import Image
from open_clip import create_model_from_pretrained, get_tokenizer
model, preprocess = create_model_from_pretrained('hf-hub:ViT-H-14-CLIPA-336')
tokenizer = get_tokenizer('hf-hub:ViT-H-14-CLIPA-336')
image = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
image = preprocess(image).unsqueeze(0)
text = tokenizer(["a diagram", "a dog", "a cat", "a beignet"], context_length=model.context_length)
with torch.no_grad(), torch.cuda.amp.autocast():
image_features = model.encode_image(image)
text_features = model.encode_text(text)
image_features = F.normalize(image_features, dim=-1)
text_features = F.normalize(text_features, dim=-1)
text_probs = (100.0 * image_features @ text_features.T).softmax(dim=-1)
print("Label probs:", text_probs) # prints: [[0., 0., 0., 1.0]]
```
## Citation
```bibtex
@article{li2023clipav2,
title={CLIPA-v2: Scaling CLIP Training with 81.1% Zero-shot ImageNet Accuracy within a $10,000 Budget; An Extra $4,000 Unlocks 81.8% Accuracy},
author={Xianhang Li and Zeyu Wang and Cihang Xie},
journal={arXiv preprint arXiv:2306.15658},
year={2023},
}
```
```bibtex
@inproceedings{li2023clipa,
title={An Inverse Scaling Law for CLIP Training},
author={Xianhang Li and Zeyu Wang and Cihang Xie},
booktitle={NeurIPS},
year={2023},
}
```
| 2,222 | [
[
-0.026031494140625,
-0.0322265625,
0.00717926025390625,
0.01837158203125,
-0.0293731689453125,
-0.021484375,
0.0010957717895507812,
-0.0284423828125,
0.0379638671875,
0.01220703125,
-0.03985595703125,
-0.032470703125,
-0.048004150390625,
-0.0149078369140625,... |
google/switch-base-128 | 2023-01-24T17:20:02.000Z | [
"transformers",
"pytorch",
"switch_transformers",
"text2text-generation",
"en",
"dataset:c4",
"arxiv:2101.03961",
"arxiv:1910.09700",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"has_space",
"region:us"
] | text2text-generation | google | null | null | google/switch-base-128 | 3 | 896 | transformers | 2022-11-04T07:59:22 | ---
language:
- en
tags:
- text2text-generation
widget:
- text: "The <extra_id_0> walks in <extra_id_1> park"
example_title: "Masked Language Modeling"
datasets:
- c4
license: apache-2.0
---
# Model Card for Switch Transformers Base - 128 experts

# Table of Contents
0. [TL;DR](#TL;DR)
1. [Model Details](#model-details)
2. [Usage](#usage)
3. [Uses](#uses)
4. [Bias, Risks, and Limitations](#bias-risks-and-limitations)
5. [Training Details](#training-details)
6. [Evaluation](#evaluation)
7. [Environmental Impact](#environmental-impact)
8. [Citation](#citation)
9. [Model Card Authors](#model-card-authors)
# TL;DR
Switch Transformers is a Mixture of Experts (MoE) model trained on Masked Language Modeling (MLM) task. The model architecture is similar to the classic T5, but with the Feed Forward layers replaced by the Sparse MLP layers containing "experts" MLP. According to the [original paper](https://arxiv.org/pdf/2101.03961.pdf) the model enables faster training (scaling properties) while being better than T5 on fine-tuned tasks.
As mentioned in the first few lines of the abstract :
> we advance the current scale of language models by pre-training up to trillion parameter models on the “Colossal Clean Crawled Corpus”, and achieve a 4x speedup over the T5-XXL model.
**Disclaimer**: Content from **this** model card has been written by the Hugging Face team, and parts of it were copy pasted from the [original paper](https://arxiv.org/pdf/2101.03961.pdf).
# Model Details
## Model Description
- **Model type:** Language model
- **Language(s) (NLP):** English
- **License:** Apache 2.0
- **Related Models:** [All Switch Transformers Checkpoints](https://huggingface.co/models?search=switch)
- **Original Checkpoints:** [All Original Switch Transformers Checkpoints](https://github.com/google-research/t5x/blob/main/docs/models.md#mixture-of-experts-moe-checkpoints)
- **Resources for more information:**
- [Research paper](https://arxiv.org/pdf/2101.03961.pdf)
- [GitHub Repo](https://github.com/google-research/t5x)
- [Hugging Face Switch Transformers Docs (Similar to T5) ](https://huggingface.co/docs/transformers/model_doc/switch_transformers)
# Usage
Note that these checkpoints has been trained on Masked-Language Modeling (MLM) task. Therefore the checkpoints are not "ready-to-use" for downstream tasks. You may want to check `FLAN-T5` for running fine-tuned weights or fine-tune your own MoE following [this notebook](https://colab.research.google.com/drive/1aGGVHZmtKmcNBbAwa9hbu58DDpIuB5O4?usp=sharing)
Find below some example scripts on how to use the model in `transformers`:
## Using the Pytorch model
### Running the model on a CPU
<details>
<summary> Click to expand </summary>
```python
from transformers import AutoTokenizer, SwitchTransformersForConditionalGeneration
tokenizer = AutoTokenizer.from_pretrained("google/switch-base-128")
model = SwitchTransformersForConditionalGeneration.from_pretrained("google/switch-base-128")
input_text = "A <extra_id_0> walks into a bar a orders a <extra_id_1> with <extra_id_2> pinch of <extra_id_3>."
input_ids = tokenizer(input_text, return_tensors="pt").input_ids
outputs = model.generate(input_ids)
print(tokenizer.decode(outputs[0]))
>>> <pad> <extra_id_0> man<extra_id_1> beer<extra_id_2> a<extra_id_3> salt<extra_id_4>.</s>
```
</details>
### Running the model on a GPU
<details>
<summary> Click to expand </summary>
```python
# pip install accelerate
from transformers import AutoTokenizer, SwitchTransformersForConditionalGeneration
tokenizer = AutoTokenizer.from_pretrained("google/switch-base-128")
model = SwitchTransformersForConditionalGeneration.from_pretrained("google/switch-base-128", device_map="auto")
input_text = "A <extra_id_0> walks into a bar a orders a <extra_id_1> with <extra_id_2> pinch of <extra_id_3>."
input_ids = tokenizer(input_text, return_tensors="pt").input_ids.to(0)
outputs = model.generate(input_ids)
print(tokenizer.decode(outputs[0]))
>>> <pad> <extra_id_0> man<extra_id_1> beer<extra_id_2> a<extra_id_3> salt<extra_id_4>.</s>
```
</details>
### Running the model on a GPU using different precisions
#### FP16
<details>
<summary> Click to expand </summary>
```python
# pip install accelerate
from transformers import AutoTokenizer, SwitchTransformersForConditionalGeneration
tokenizer = AutoTokenizer.from_pretrained("google/switch-base-128")
model = SwitchTransformersForConditionalGeneration.from_pretrained("google/switch-base-128", device_map="auto", torch_dtype=torch.float16)
input_text = "A <extra_id_0> walks into a bar a orders a <extra_id_1> with <extra_id_2> pinch of <extra_id_3>."
input_ids = tokenizer(input_text, return_tensors="pt").input_ids.to(0)
outputs = model.generate(input_ids)
print(tokenizer.decode(outputs[0]))
>>> <pad> <extra_id_0> man<extra_id_1> beer<extra_id_2> a<extra_id_3> salt<extra_id_4>.</s>
```
</details>
#### INT8
<details>
<summary> Click to expand </summary>
```python
# pip install bitsandbytes accelerate
from transformers import AutoTokenizer, SwitchTransformersForConditionalGeneration
tokenizer = AutoTokenizer.from_pretrained("google/switch-base-128")
model = SwitchTransformersForConditionalGeneration.from_pretrained("google/switch-base-128", device_map="auto")
input_text = "A <extra_id_0> walks into a bar a orders a <extra_id_1> with <extra_id_2> pinch of <extra_id_3>."
input_ids = tokenizer(input_text, return_tensors="pt").input_ids.to(0)
outputs = model.generate(input_ids)
print(tokenizer.decode(outputs[0]))
>>> <pad> <extra_id_0> man<extra_id_1> beer<extra_id_2> a<extra_id_3> salt<extra_id_4>.</s>
```
</details>
# Uses
## Direct Use and Downstream Use
See the [research paper](https://arxiv.org/pdf/2101.03961.pdf) for further details.
## Out-of-Scope Use
More information needed.
# Bias, Risks, and Limitations
More information needed.
## Ethical considerations and risks
More information needed.
## Known Limitations
More information needed.
## Sensitive Use:
More information needed.
# Training Details
## Training Data
The model was trained on a Masked Language Modeling task, on Colossal Clean Crawled Corpus (C4) dataset, following the same procedure as `T5`.
## Training Procedure
According to the model card from the [original paper](https://arxiv.org/pdf/2101.03961.pdf) the model has been trained on TPU v3 or TPU v4 pods, using [`t5x`](https://github.com/google-research/t5x) codebase together with [`jax`](https://github.com/google/jax).
# Evaluation
## Testing Data, Factors & Metrics
The authors evaluated the model on various tasks and compared the results against T5. See the table below for some quantitative evaluation:

For full details, please check the [research paper](https://arxiv.org/pdf/2101.03961.pdf).
## Results
For full results for Switch Transformers, see the [research paper](https://arxiv.org/pdf/2101.03961.pdf), Table 5.
# Environmental Impact
Carbon emissions can be estimated using the [Machine Learning Impact calculator](https://mlco2.github.io/impact#compute) presented in [Lacoste et al. (2019)](https://arxiv.org/abs/1910.09700).
- **Hardware Type:** Google Cloud TPU Pods - TPU v3 or TPU v4 | Number of chips ≥ 4.
- **Hours used:** More information needed
- **Cloud Provider:** GCP
- **Compute Region:** More information needed
- **Carbon Emitted:** More information needed
# Citation
**BibTeX:**
```bibtex
@misc{https://doi.org/10.48550/arxiv.2101.03961,
doi = {10.48550/ARXIV.2101.03961},
url = {https://arxiv.org/abs/2101.03961},
author = {Fedus, William and Zoph, Barret and Shazeer, Noam},
keywords = {Machine Learning (cs.LG), Artificial Intelligence (cs.AI), FOS: Computer and information sciences, FOS: Computer and information sciences},
title = {Switch Transformers: Scaling to Trillion Parameter Models with Simple and Efficient Sparsity},
publisher = {arXiv},
year = {2021},
copyright = {arXiv.org perpetual, non-exclusive license}
}
``` | 8,220 | [
[
-0.035797119140625,
-0.03173828125,
0.0146026611328125,
0.0148773193359375,
-0.0069732666015625,
0.0038928985595703125,
-0.010894775390625,
-0.0303955078125,
-0.00272369384765625,
0.0277252197265625,
-0.04376220703125,
-0.02288818359375,
-0.05828857421875,
0... |
timm/convnext_base.clip_laiona_augreg_ft_in1k_384 | 2023-03-31T22:00:40.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"dataset:laion-aesthetic",
"arxiv:2210.08402",
"arxiv:2201.03545",
"arxiv:2103.00020",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/convnext_base.clip_laiona_augreg_ft_in1k_384 | 0 | 894 | timm | 2023-02-03T18:33:02 | ---
tags:
- image-classification
- timm
library_tag: timm
license: apache-2.0
datasets:
- imagenet-1k
- laion-aesthetic
---
# Model card for convnext_base.clip_laiona_augreg_ft_in1k_384
A ConvNeXt image classification model. CLIP image tower weights pretrained in [OpenCLIP](https://github.com/mlfoundations/open_clip) on LAION and fine-tuned on ImageNet-1k in `timm` by Ross Wightman.
Please see related OpenCLIP model cards for more details on pretrain:
* https://huggingface.co/laion/CLIP-convnext_xxlarge-laion2B-s34B-b82K-augreg-soup
* https://huggingface.co/laion/CLIP-convnext_large_d.laion2B-s26B-b102K-augreg
* https://huggingface.co/laion/CLIP-convnext_base_w-laion2B-s13B-b82K-augreg
* https://huggingface.co/laion/CLIP-convnext_base_w_320-laion_aesthetic-s13B-b82K
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 88.6
- GMACs: 45.2
- Activations (M): 84.5
- Image size: 384 x 384
- **Papers:**
- LAION-5B: An open large-scale dataset for training next generation image-text models: https://arxiv.org/abs/2210.08402
- A ConvNet for the 2020s: https://arxiv.org/abs/2201.03545
- Learning Transferable Visual Models From Natural Language Supervision: https://arxiv.org/abs/2103.00020
- **Original:** https://github.com/mlfoundations/open_clip
- **Pretrain Dataset:** LAION-Aesthetic
- **Dataset:** ImageNet-1k
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('convnext_base.clip_laiona_augreg_ft_in1k_384', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'convnext_base.clip_laiona_augreg_ft_in1k_384',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 128, 96, 96])
# torch.Size([1, 256, 48, 48])
# torch.Size([1, 512, 24, 24])
# torch.Size([1, 1024, 12, 12])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'convnext_base.clip_laiona_augreg_ft_in1k_384',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 1024, 12, 12) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
All timing numbers from eager model PyTorch 1.13 on RTX 3090 w/ AMP.
| model |top1 |top5 |img_size|param_count|gmacs |macts |samples_per_sec|batch_size|
|------------------------------------------------------------------------------------------------------------------------------|------|------|--------|-----------|------|------|---------------|----------|
| [convnextv2_huge.fcmae_ft_in22k_in1k_512](https://huggingface.co/timm/convnextv2_huge.fcmae_ft_in22k_in1k_512) |88.848|98.742|512 |660.29 |600.81|413.07|28.58 |48 |
| [convnextv2_huge.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_huge.fcmae_ft_in22k_in1k_384) |88.668|98.738|384 |660.29 |337.96|232.35|50.56 |64 |
| [convnext_xxlarge.clip_laion2b_soup_ft_in1k](https://huggingface.co/timm/convnext_xxlarge.clip_laion2b_soup_ft_in1k) |88.612|98.704|256 |846.47 |198.09|124.45|122.45 |256 |
| [convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_384](https://huggingface.co/timm/convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_384) |88.312|98.578|384 |200.13 |101.11|126.74|196.84 |256 |
| [convnextv2_large.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_large.fcmae_ft_in22k_in1k_384) |88.196|98.532|384 |197.96 |101.1 |126.74|128.94 |128 |
| [convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_320](https://huggingface.co/timm/convnext_large_mlp.clip_laion2b_soup_ft_in12k_in1k_320) |87.968|98.47 |320 |200.13 |70.21 |88.02 |283.42 |256 |
| [convnext_xlarge.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_xlarge.fb_in22k_ft_in1k_384) |87.75 |98.556|384 |350.2 |179.2 |168.99|124.85 |192 |
| [convnextv2_base.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_base.fcmae_ft_in22k_in1k_384) |87.646|98.422|384 |88.72 |45.21 |84.49 |209.51 |256 |
| [convnext_large.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_large.fb_in22k_ft_in1k_384) |87.476|98.382|384 |197.77 |101.1 |126.74|194.66 |256 |
| [convnext_large_mlp.clip_laion2b_augreg_ft_in1k](https://huggingface.co/timm/convnext_large_mlp.clip_laion2b_augreg_ft_in1k) |87.344|98.218|256 |200.13 |44.94 |56.33 |438.08 |256 |
| [convnextv2_large.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_large.fcmae_ft_in22k_in1k) |87.26 |98.248|224 |197.96 |34.4 |43.13 |376.84 |256 |
| [convnext_base.clip_laion2b_augreg_ft_in12k_in1k_384](https://huggingface.co/timm/convnext_base.clip_laion2b_augreg_ft_in12k_in1k_384) |87.138|98.212|384 |88.59 |45.21 |84.49 |365.47 |256 |
| [convnext_xlarge.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_xlarge.fb_in22k_ft_in1k) |87.002|98.208|224 |350.2 |60.98 |57.5 |368.01 |256 |
| [convnext_base.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_base.fb_in22k_ft_in1k_384) |86.796|98.264|384 |88.59 |45.21 |84.49 |366.54 |256 |
| [convnextv2_base.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_base.fcmae_ft_in22k_in1k) |86.74 |98.022|224 |88.72 |15.38 |28.75 |624.23 |256 |
| [convnext_large.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_large.fb_in22k_ft_in1k) |86.636|98.028|224 |197.77 |34.4 |43.13 |581.43 |256 |
| [convnext_base.clip_laiona_augreg_ft_in1k_384](https://huggingface.co/timm/convnext_base.clip_laiona_augreg_ft_in1k_384) |86.504|97.97 |384 |88.59 |45.21 |84.49 |368.14 |256 |
| [convnext_base.clip_laion2b_augreg_ft_in12k_in1k](https://huggingface.co/timm/convnext_base.clip_laion2b_augreg_ft_in12k_in1k) |86.344|97.97 |256 |88.59 |20.09 |37.55 |816.14 |256 |
| [convnextv2_huge.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_huge.fcmae_ft_in1k) |86.256|97.75 |224 |660.29 |115.0 |79.07 |154.72 |256 |
| [convnext_small.in12k_ft_in1k_384](https://huggingface.co/timm/convnext_small.in12k_ft_in1k_384) |86.182|97.92 |384 |50.22 |25.58 |63.37 |516.19 |256 |
| [convnext_base.clip_laion2b_augreg_ft_in1k](https://huggingface.co/timm/convnext_base.clip_laion2b_augreg_ft_in1k) |86.154|97.68 |256 |88.59 |20.09 |37.55 |819.86 |256 |
| [convnext_base.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_base.fb_in22k_ft_in1k) |85.822|97.866|224 |88.59 |15.38 |28.75 |1037.66 |256 |
| [convnext_small.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_small.fb_in22k_ft_in1k_384) |85.778|97.886|384 |50.22 |25.58 |63.37 |518.95 |256 |
| [convnextv2_large.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_large.fcmae_ft_in1k) |85.742|97.584|224 |197.96 |34.4 |43.13 |375.23 |256 |
| [convnext_small.in12k_ft_in1k](https://huggingface.co/timm/convnext_small.in12k_ft_in1k) |85.174|97.506|224 |50.22 |8.71 |21.56 |1474.31 |256 |
| [convnext_tiny.in12k_ft_in1k_384](https://huggingface.co/timm/convnext_tiny.in12k_ft_in1k_384) |85.118|97.608|384 |28.59 |13.14 |39.48 |856.76 |256 |
| [convnextv2_tiny.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_tiny.fcmae_ft_in22k_in1k_384) |85.112|97.63 |384 |28.64 |13.14 |39.48 |491.32 |256 |
| [convnextv2_base.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_base.fcmae_ft_in1k) |84.874|97.09 |224 |88.72 |15.38 |28.75 |625.33 |256 |
| [convnext_small.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_small.fb_in22k_ft_in1k) |84.562|97.394|224 |50.22 |8.71 |21.56 |1478.29 |256 |
| [convnext_large.fb_in1k](https://huggingface.co/timm/convnext_large.fb_in1k) |84.282|96.892|224 |197.77 |34.4 |43.13 |584.28 |256 |
| [convnext_tiny.in12k_ft_in1k](https://huggingface.co/timm/convnext_tiny.in12k_ft_in1k) |84.186|97.124|224 |28.59 |4.47 |13.44 |2433.7 |256 |
| [convnext_tiny.fb_in22k_ft_in1k_384](https://huggingface.co/timm/convnext_tiny.fb_in22k_ft_in1k_384) |84.084|97.14 |384 |28.59 |13.14 |39.48 |862.95 |256 |
| [convnextv2_tiny.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_tiny.fcmae_ft_in22k_in1k) |83.894|96.964|224 |28.64 |4.47 |13.44 |1452.72 |256 |
| [convnext_base.fb_in1k](https://huggingface.co/timm/convnext_base.fb_in1k) |83.82 |96.746|224 |88.59 |15.38 |28.75 |1054.0 |256 |
| [convnextv2_nano.fcmae_ft_in22k_in1k_384](https://huggingface.co/timm/convnextv2_nano.fcmae_ft_in22k_in1k_384) |83.37 |96.742|384 |15.62 |7.22 |24.61 |801.72 |256 |
| [convnext_small.fb_in1k](https://huggingface.co/timm/convnext_small.fb_in1k) |83.142|96.434|224 |50.22 |8.71 |21.56 |1464.0 |256 |
| [convnextv2_tiny.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_tiny.fcmae_ft_in1k) |82.92 |96.284|224 |28.64 |4.47 |13.44 |1425.62 |256 |
| [convnext_tiny.fb_in22k_ft_in1k](https://huggingface.co/timm/convnext_tiny.fb_in22k_ft_in1k) |82.898|96.616|224 |28.59 |4.47 |13.44 |2480.88 |256 |
| [convnext_nano.in12k_ft_in1k](https://huggingface.co/timm/convnext_nano.in12k_ft_in1k) |82.282|96.344|224 |15.59 |2.46 |8.37 |3926.52 |256 |
| [convnext_tiny_hnf.a2h_in1k](https://huggingface.co/timm/convnext_tiny_hnf.a2h_in1k) |82.216|95.852|224 |28.59 |4.47 |13.44 |2529.75 |256 |
| [convnext_tiny.fb_in1k](https://huggingface.co/timm/convnext_tiny.fb_in1k) |82.066|95.854|224 |28.59 |4.47 |13.44 |2346.26 |256 |
| [convnextv2_nano.fcmae_ft_in22k_in1k](https://huggingface.co/timm/convnextv2_nano.fcmae_ft_in22k_in1k) |82.03 |96.166|224 |15.62 |2.46 |8.37 |2300.18 |256 |
| [convnextv2_nano.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_nano.fcmae_ft_in1k) |81.83 |95.738|224 |15.62 |2.46 |8.37 |2321.48 |256 |
| [convnext_nano_ols.d1h_in1k](https://huggingface.co/timm/convnext_nano_ols.d1h_in1k) |80.866|95.246|224 |15.65 |2.65 |9.38 |3523.85 |256 |
| [convnext_nano.d1h_in1k](https://huggingface.co/timm/convnext_nano.d1h_in1k) |80.768|95.334|224 |15.59 |2.46 |8.37 |3915.58 |256 |
| [convnextv2_pico.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_pico.fcmae_ft_in1k) |80.304|95.072|224 |9.07 |1.37 |6.1 |3274.57 |256 |
| [convnext_pico.d1_in1k](https://huggingface.co/timm/convnext_pico.d1_in1k) |79.526|94.558|224 |9.05 |1.37 |6.1 |5686.88 |256 |
| [convnext_pico_ols.d1_in1k](https://huggingface.co/timm/convnext_pico_ols.d1_in1k) |79.522|94.692|224 |9.06 |1.43 |6.5 |5422.46 |256 |
| [convnextv2_femto.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_femto.fcmae_ft_in1k) |78.488|93.98 |224 |5.23 |0.79 |4.57 |4264.2 |256 |
| [convnext_femto_ols.d1_in1k](https://huggingface.co/timm/convnext_femto_ols.d1_in1k) |77.86 |93.83 |224 |5.23 |0.82 |4.87 |6910.6 |256 |
| [convnext_femto.d1_in1k](https://huggingface.co/timm/convnext_femto.d1_in1k) |77.454|93.68 |224 |5.22 |0.79 |4.57 |7189.92 |256 |
| [convnextv2_atto.fcmae_ft_in1k](https://huggingface.co/timm/convnextv2_atto.fcmae_ft_in1k) |76.664|93.044|224 |3.71 |0.55 |3.81 |4728.91 |256 |
| [convnext_atto_ols.a2_in1k](https://huggingface.co/timm/convnext_atto_ols.a2_in1k) |75.88 |92.846|224 |3.7 |0.58 |4.11 |7963.16 |256 |
| [convnext_atto.d2_in1k](https://huggingface.co/timm/convnext_atto.d2_in1k) |75.664|92.9 |224 |3.7 |0.55 |3.81 |8439.22 |256 |
## Citation
```bibtex
@software{ilharco_gabriel_2021_5143773,
author = {Ilharco, Gabriel and
Wortsman, Mitchell and
Wightman, Ross and
Gordon, Cade and
Carlini, Nicholas and
Taori, Rohan and
Dave, Achal and
Shankar, Vaishaal and
Namkoong, Hongseok and
Miller, John and
Hajishirzi, Hannaneh and
Farhadi, Ali and
Schmidt, Ludwig},
title = {OpenCLIP},
month = jul,
year = 2021,
note = {If you use this software, please cite it as below.},
publisher = {Zenodo},
version = {0.1},
doi = {10.5281/zenodo.5143773},
url = {https://doi.org/10.5281/zenodo.5143773}
}
```
```bibtex
@inproceedings{schuhmann2022laionb,
title={{LAION}-5B: An open large-scale dataset for training next generation image-text models},
author={Christoph Schuhmann and
Romain Beaumont and
Richard Vencu and
Cade W Gordon and
Ross Wightman and
Mehdi Cherti and
Theo Coombes and
Aarush Katta and
Clayton Mullis and
Mitchell Wortsman and
Patrick Schramowski and
Srivatsa R Kundurthy and
Katherine Crowson and
Ludwig Schmidt and
Robert Kaczmarczyk and
Jenia Jitsev},
booktitle={Thirty-sixth Conference on Neural Information Processing Systems Datasets and Benchmarks Track},
year={2022},
url={https://openreview.net/forum?id=M3Y74vmsMcY}
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
```bibtex
@inproceedings{Radford2021LearningTV,
title={Learning Transferable Visual Models From Natural Language Supervision},
author={Alec Radford and Jong Wook Kim and Chris Hallacy and A. Ramesh and Gabriel Goh and Sandhini Agarwal and Girish Sastry and Amanda Askell and Pamela Mishkin and Jack Clark and Gretchen Krueger and Ilya Sutskever},
booktitle={ICML},
year={2021}
}
```
```bibtex
@article{liu2022convnet,
author = {Zhuang Liu and Hanzi Mao and Chao-Yuan Wu and Christoph Feichtenhofer and Trevor Darrell and Saining Xie},
title = {A ConvNet for the 2020s},
journal = {Proceedings of the IEEE/CVF Conference on Computer Vision and Pattern Recognition (CVPR)},
year = {2022},
}
```
| 18,526 | [
[
-0.060821533203125,
-0.03607177734375,
-0.00214385986328125,
0.03460693359375,
-0.030792236328125,
-0.017578125,
-0.014801025390625,
-0.033843994140625,
0.05828857421875,
0.020294189453125,
-0.043426513671875,
-0.045379638671875,
-0.05322265625,
-0.002414703... |
openai/shap-e-img2img | 2023-07-20T16:02:43.000Z | [
"diffusers",
"image-to-image",
"text-to-3d",
"shap-e",
"arxiv:2305.02463",
"license:mit",
"has_space",
"diffusers:ShapEImg2ImgPipeline",
"region:us"
] | image-to-image | openai | null | null | openai/shap-e-img2img | 16 | 894 | diffusers | 2023-07-04T13:25:57 | ---
license: mit
tags:
- image-to-image
- text-to-3d
- diffusers
- shap-e
---
# Shap-E
Shap-E introduces a diffusion process that can generate a 3D image from a text prompt. It was introduced in [Shap-E: Generating Conditional 3D Implicit Functions](https://arxiv.org/abs/2305.02463) by Heewoo Jun and Alex Nichol from OpenAI.
Original repository of Shap-E can be found here: https://github.com/openai/shap-e.
_The authors of Shap-E didn't author this model card. They provide a separate model card [here](https://github.com/openai/shap-e/blob/main/model-card.md)._
## Introduction
The abstract of the Shap-E paper:
*We present Shap-E, a conditional generative model for 3D assets. Unlike recent work on 3D generative models which produce a single output representation, Shap-E directly generates the parameters of implicit functions that can be rendered as both textured meshes and neural radiance fields. We train Shap-E in two stages: first, we train an encoder that deterministically maps 3D assets into the parameters of an implicit function; second, we train a conditional diffusion model on outputs of the encoder. When trained on a large dataset of paired 3D and text data, our resulting models are capable of generating complex and diverse 3D assets in a matter of seconds. When compared to Point-E, an explicit generative model over point clouds, Shap-E converges faster and reaches comparable or better sample quality despite modeling a higher-dimensional, multi-representation output space. We release model weights, inference code, and samples at [this https URL](https://github.com/openai/shap-e).*
## Released checkpoints
The authors released the following checkpoints:
* [openai/shap-e](https://hf.co/openai/shap-e): produces a 3D image from a text input prompt
* [openai/shap-e-img2img](https://hf.co/openai/shap-e-img2img): samples a 3D image from synthetic 2D image
## Usage examples in 🧨 diffusers
First make sure you have installed all the dependencies:
```bash
pip install transformers accelerate -q
pip install git+https://github.com/huggingface/diffusers@@shap-ee
```
Once the dependencies are installed, use the code below:
```python
import torch
from diffusers import ShapEImg2ImgPipeline
from diffusers.utils import export_to_gif, load_image
ckpt_id = "openai/shap-e-img2img"
pipe = ShapEImg2ImgPipeline.from_pretrained(repo).to("cuda")
img_url = "https://hf.co/datasets/diffusers/docs-images/resolve/main/shap-e/corgi.png"
image = load_image(img_url)
generator = torch.Generator(device="cuda").manual_seed(0)
batch_size = 4
guidance_scale = 3.0
images = pipe(
image,
num_images_per_prompt=batch_size,
generator=generator,
guidance_scale=guidance_scale,
num_inference_steps=64,
size=256,
output_type="pil"
).images
gif_path = export_to_gif(images, "corgi_sampled_3d.gif")
```
## Results
<table>
<tbody>
<tr>
<td align="center">
<img src="https://huggingface.co/datasets/diffusers/docs-images/resolve/main/shap-e/corgi.png" alt="Reference corgi image in 2D">
</td>
<td align="center">
<img src="https://huggingface.co/datasets/diffusers/docs-images/resolve/main/shap-e/corgi_sampled_3d.gif" alt="Sampled image in 3D (one)">
</td align="center">
<td align="center">
<img src="https://huggingface.co/datasets/diffusers/docs-images/resolve/main/shap-e/corgi_sampled_3d_two.gif" alt="Sampled image in 3D (two)">
</td>
</tr>
<tr>
<td align="center">Reference corgi image in 2D</td>
<td align="center">Sampled image in 3D (one)</td>
<td align="center">Sampled image in 3D (two)</td>
</tr>
</tr>
</tbody>
<table>
## Training details
Refer to the [original paper](https://arxiv.org/abs/2305.02463).
## Known limitations and potential biases
Refer to the [original model card](https://github.com/openai/shap-e/blob/main/model-card.md).
## Citation
```bibtex
@misc{jun2023shape,
title={Shap-E: Generating Conditional 3D Implicit Functions},
author={Heewoo Jun and Alex Nichol},
year={2023},
eprint={2305.02463},
archivePrefix={arXiv},
primaryClass={cs.CV}
}
``` | 4,295 | [
[
-0.050994873046875,
-0.06402587890625,
0.033447265625,
0.0199127197265625,
-0.00823974609375,
-0.037628173828125,
0.0081787109375,
-0.044464111328125,
0.0153961181640625,
0.0128021240234375,
-0.039764404296875,
-0.029205322265625,
-0.038421630859375,
-0.0019... |
slymnyldrm/dreambooth_usecase_weights | 2023-09-26T22:38:30.000Z | [
"diffusers",
"tensorboard",
"stable-diffusion",
"stable-diffusion-diffusers",
"text-to-image",
"dreambooth",
"license:creativeml-openrail-m",
"endpoints_compatible",
"has_space",
"diffusers:StableDiffusionPipeline",
"region:us"
] | text-to-image | slymnyldrm | null | null | slymnyldrm/dreambooth_usecase_weights | 0 | 894 | diffusers | 2023-09-26T20:30:22 |
---
license: creativeml-openrail-m
base_model: runwayml/stable-diffusion-v1-5
instance_prompt: photo of suleyman_person person
tags:
- stable-diffusion
- stable-diffusion-diffusers
- text-to-image
- diffusers
- dreambooth
inference: true
---
# DreamBooth - slymnyldrm/dreambooth_usecase_weights
This is a dreambooth model derived from runwayml/stable-diffusion-v1-5. The weights were trained on photo of suleyman_person person using [DreamBooth](https://dreambooth.github.io/).
You can find some example images in the following.
DreamBooth for the text encoder was enabled: True.
| 591 | [
[
0.005046844482421875,
-0.0175323486328125,
0.03619384765625,
-0.0019397735595703125,
-0.01885986328125,
0.022308349609375,
0.02386474609375,
-0.008819580078125,
0.044891357421875,
0.037445068359375,
-0.038421630859375,
-0.0276641845703125,
-0.047698974609375,
... |
TheBloke/Xwin-LM-13B-v0.2-GPTQ | 2023-10-15T01:34:45.000Z | [
"transformers",
"safetensors",
"llama",
"text-generation",
"license:llama2",
"text-generation-inference",
"region:us"
] | text-generation | TheBloke | null | null | TheBloke/Xwin-LM-13B-v0.2-GPTQ | 5 | 894 | transformers | 2023-10-15T00:54:13 | ---
base_model: Xwin-LM/Xwin-LM-13B-V0.2
inference: false
license: llama2
model_creator: Xwin-LM
model_name: Xwin LM 13B v0.2
model_type: llama
prompt_template: 'A chat between a curious user and an artificial intelligence assistant.
The assistant gives helpful, detailed, and polite answers to the user''s questions.
USER: {prompt} ASSISTANT:
'
quantized_by: TheBloke
---
<!-- header start -->
<!-- 200823 -->
<div style="width: auto; margin-left: auto; margin-right: auto">
<img src="https://i.imgur.com/EBdldam.jpg" alt="TheBlokeAI" style="width: 100%; min-width: 400px; display: block; margin: auto;">
</div>
<div style="display: flex; justify-content: space-between; width: 100%;">
<div style="display: flex; flex-direction: column; align-items: flex-start;">
<p style="margin-top: 0.5em; margin-bottom: 0em;"><a href="https://discord.gg/theblokeai">Chat & support: TheBloke's Discord server</a></p>
</div>
<div style="display: flex; flex-direction: column; align-items: flex-end;">
<p style="margin-top: 0.5em; margin-bottom: 0em;"><a href="https://www.patreon.com/TheBlokeAI">Want to contribute? TheBloke's Patreon page</a></p>
</div>
</div>
<div style="text-align:center; margin-top: 0em; margin-bottom: 0em"><p style="margin-top: 0.25em; margin-bottom: 0em;">TheBloke's LLM work is generously supported by a grant from <a href="https://a16z.com">andreessen horowitz (a16z)</a></p></div>
<hr style="margin-top: 1.0em; margin-bottom: 1.0em;">
<!-- header end -->
# Xwin LM 13B v0.2 - GPTQ
- Model creator: [Xwin-LM](https://huggingface.co/Xwin-LM)
- Original model: [Xwin LM 13B v0.2](https://huggingface.co/Xwin-LM/Xwin-LM-13B-V0.2)
<!-- description start -->
## Description
This repo contains GPTQ model files for [Xwin-LM's Xwin LM 13B v0.2](https://huggingface.co/Xwin-LM/Xwin-LM-13B-V0.2).
Multiple GPTQ parameter permutations are provided; see Provided Files below for details of the options provided, their parameters, and the software used to create them.
<!-- description end -->
<!-- repositories-available start -->
## Repositories available
* [AWQ model(s) for GPU inference.](https://huggingface.co/TheBloke/Xwin-LM-13B-v0.2-AWQ)
* [GPTQ models for GPU inference, with multiple quantisation parameter options.](https://huggingface.co/TheBloke/Xwin-LM-13B-v0.2-GPTQ)
* [2, 3, 4, 5, 6 and 8-bit GGUF models for CPU+GPU inference](https://huggingface.co/TheBloke/Xwin-LM-13B-v0.2-GGUF)
* [Xwin-LM's original unquantised fp16 model in pytorch format, for GPU inference and for further conversions](https://huggingface.co/Xwin-LM/Xwin-LM-13B-V0.2)
<!-- repositories-available end -->
<!-- prompt-template start -->
## Prompt template: Vicuna
```
A chat between a curious user and an artificial intelligence assistant. The assistant gives helpful, detailed, and polite answers to the user's questions. USER: {prompt} ASSISTANT:
```
<!-- prompt-template end -->
<!-- README_GPTQ.md-provided-files start -->
## Provided files, and GPTQ parameters
Multiple quantisation parameters are provided, to allow you to choose the best one for your hardware and requirements.
Each separate quant is in a different branch. See below for instructions on fetching from different branches.
Most GPTQ files are made with AutoGPTQ. Mistral models are currently made with Transformers.
<details>
<summary>Explanation of GPTQ parameters</summary>
- Bits: The bit size of the quantised model.
- GS: GPTQ group size. Higher numbers use less VRAM, but have lower quantisation accuracy. "None" is the lowest possible value.
- Act Order: True or False. Also known as `desc_act`. True results in better quantisation accuracy. Some GPTQ clients have had issues with models that use Act Order plus Group Size, but this is generally resolved now.
- Damp %: A GPTQ parameter that affects how samples are processed for quantisation. 0.01 is default, but 0.1 results in slightly better accuracy.
- GPTQ dataset: The calibration dataset used during quantisation. Using a dataset more appropriate to the model's training can improve quantisation accuracy. Note that the GPTQ calibration dataset is not the same as the dataset used to train the model - please refer to the original model repo for details of the training dataset(s).
- Sequence Length: The length of the dataset sequences used for quantisation. Ideally this is the same as the model sequence length. For some very long sequence models (16+K), a lower sequence length may have to be used. Note that a lower sequence length does not limit the sequence length of the quantised model. It only impacts the quantisation accuracy on longer inference sequences.
- ExLlama Compatibility: Whether this file can be loaded with ExLlama, which currently only supports Llama models in 4-bit.
</details>
| Branch | Bits | GS | Act Order | Damp % | GPTQ Dataset | Seq Len | Size | ExLlama | Desc |
| ------ | ---- | -- | --------- | ------ | ------------ | ------- | ---- | ------- | ---- |
| [main](https://huggingface.co/TheBloke/Xwin-LM-13B-v0.2-GPTQ/tree/main) | 4 | 128 | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 4096 | 7.26 GB | Yes | 4-bit, with Act Order and group size 128g. Uses even less VRAM than 64g, but with slightly lower accuracy. |
| [gptq-4bit-32g-actorder_True](https://huggingface.co/TheBloke/Xwin-LM-13B-v0.2-GPTQ/tree/gptq-4bit-32g-actorder_True) | 4 | 32 | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 4096 | 8.00 GB | Yes | 4-bit, with Act Order and group size 32g. Gives highest possible inference quality, with maximum VRAM usage. |
| [gptq-8bit--1g-actorder_True](https://huggingface.co/TheBloke/Xwin-LM-13B-v0.2-GPTQ/tree/gptq-8bit--1g-actorder_True) | 8 | None | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 4096 | 13.36 GB | No | 8-bit, with Act Order. No group size, to lower VRAM requirements. |
| [gptq-8bit-128g-actorder_True](https://huggingface.co/TheBloke/Xwin-LM-13B-v0.2-GPTQ/tree/gptq-8bit-128g-actorder_True) | 8 | 128 | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 4096 | 13.65 GB | No | 8-bit, with group size 128g for higher inference quality and with Act Order for even higher accuracy. |
| [gptq-8bit-32g-actorder_True](https://huggingface.co/TheBloke/Xwin-LM-13B-v0.2-GPTQ/tree/gptq-8bit-32g-actorder_True) | 8 | 32 | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 4096 | 14.55 GB | No | 8-bit, with group size 32g and Act Order for maximum inference quality. |
| [gptq-4bit-64g-actorder_True](https://huggingface.co/TheBloke/Xwin-LM-13B-v0.2-GPTQ/tree/gptq-4bit-64g-actorder_True) | 4 | 64 | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 4096 | 7.51 GB | Yes | 4-bit, with Act Order and group size 64g. Uses less VRAM than 32g, but with slightly lower accuracy. |
<!-- README_GPTQ.md-provided-files end -->
<!-- README_GPTQ.md-download-from-branches start -->
## How to download, including from branches
### In text-generation-webui
To download from the `main` branch, enter `TheBloke/Xwin-LM-13B-v0.2-GPTQ` in the "Download model" box.
To download from another branch, add `:branchname` to the end of the download name, eg `TheBloke/Xwin-LM-13B-v0.2-GPTQ:gptq-4bit-32g-actorder_True`
### From the command line
I recommend using the `huggingface-hub` Python library:
```shell
pip3 install huggingface-hub
```
To download the `main` branch to a folder called `Xwin-LM-13B-v0.2-GPTQ`:
```shell
mkdir Xwin-LM-13B-v0.2-GPTQ
huggingface-cli download TheBloke/Xwin-LM-13B-v0.2-GPTQ --local-dir Xwin-LM-13B-v0.2-GPTQ --local-dir-use-symlinks False
```
To download from a different branch, add the `--revision` parameter:
```shell
mkdir Xwin-LM-13B-v0.2-GPTQ
huggingface-cli download TheBloke/Xwin-LM-13B-v0.2-GPTQ --revision gptq-4bit-32g-actorder_True --local-dir Xwin-LM-13B-v0.2-GPTQ --local-dir-use-symlinks False
```
<details>
<summary>More advanced huggingface-cli download usage</summary>
If you remove the `--local-dir-use-symlinks False` parameter, the files will instead be stored in the central Huggingface cache directory (default location on Linux is: `~/.cache/huggingface`), and symlinks will be added to the specified `--local-dir`, pointing to their real location in the cache. This allows for interrupted downloads to be resumed, and allows you to quickly clone the repo to multiple places on disk without triggering a download again. The downside, and the reason why I don't list that as the default option, is that the files are then hidden away in a cache folder and it's harder to know where your disk space is being used, and to clear it up if/when you want to remove a download model.
The cache location can be changed with the `HF_HOME` environment variable, and/or the `--cache-dir` parameter to `huggingface-cli`.
For more documentation on downloading with `huggingface-cli`, please see: [HF -> Hub Python Library -> Download files -> Download from the CLI](https://huggingface.co/docs/huggingface_hub/guides/download#download-from-the-cli).
To accelerate downloads on fast connections (1Gbit/s or higher), install `hf_transfer`:
```shell
pip3 install hf_transfer
```
And set environment variable `HF_HUB_ENABLE_HF_TRANSFER` to `1`:
```shell
mkdir Xwin-LM-13B-v0.2-GPTQ
HF_HUB_ENABLE_HF_TRANSFER=1 huggingface-cli download TheBloke/Xwin-LM-13B-v0.2-GPTQ --local-dir Xwin-LM-13B-v0.2-GPTQ --local-dir-use-symlinks False
```
Windows Command Line users: You can set the environment variable by running `set HF_HUB_ENABLE_HF_TRANSFER=1` before the download command.
</details>
### With `git` (**not** recommended)
To clone a specific branch with `git`, use a command like this:
```shell
git clone --single-branch --branch gptq-4bit-32g-actorder_True https://huggingface.co/TheBloke/Xwin-LM-13B-v0.2-GPTQ
```
Note that using Git with HF repos is strongly discouraged. It will be much slower than using `huggingface-hub`, and will use twice as much disk space as it has to store the model files twice (it stores every byte both in the intended target folder, and again in the `.git` folder as a blob.)
<!-- README_GPTQ.md-download-from-branches end -->
<!-- README_GPTQ.md-text-generation-webui start -->
## How to easily download and use this model in [text-generation-webui](https://github.com/oobabooga/text-generation-webui).
Please make sure you're using the latest version of [text-generation-webui](https://github.com/oobabooga/text-generation-webui).
It is strongly recommended to use the text-generation-webui one-click-installers unless you're sure you know how to make a manual install.
1. Click the **Model tab**.
2. Under **Download custom model or LoRA**, enter `TheBloke/Xwin-LM-13B-v0.2-GPTQ`.
- To download from a specific branch, enter for example `TheBloke/Xwin-LM-13B-v0.2-GPTQ:gptq-4bit-32g-actorder_True`
- see Provided Files above for the list of branches for each option.
3. Click **Download**.
4. The model will start downloading. Once it's finished it will say "Done".
5. In the top left, click the refresh icon next to **Model**.
6. In the **Model** dropdown, choose the model you just downloaded: `Xwin-LM-13B-v0.2-GPTQ`
7. The model will automatically load, and is now ready for use!
8. If you want any custom settings, set them and then click **Save settings for this model** followed by **Reload the Model** in the top right.
* Note that you do not need to and should not set manual GPTQ parameters any more. These are set automatically from the file `quantize_config.json`.
9. Once you're ready, click the **Text Generation tab** and enter a prompt to get started!
<!-- README_GPTQ.md-text-generation-webui end -->
<!-- README_GPTQ.md-use-from-tgi start -->
## Serving this model from Text Generation Inference (TGI)
It's recommended to use TGI version 1.1.0 or later. The official Docker container is: `ghcr.io/huggingface/text-generation-inference:1.1.0`
Example Docker parameters:
```shell
--model-id TheBloke/Xwin-LM-13B-v0.2-GPTQ --port 3000 --quantize awq --max-input-length 3696 --max-total-tokens 4096 --max-batch-prefill-tokens 4096
```
Example Python code for interfacing with TGI (requires huggingface-hub 0.17.0 or later):
```shell
pip3 install huggingface-hub
```
```python
from huggingface_hub import InferenceClient
endpoint_url = "https://your-endpoint-url-here"
prompt = "Tell me about AI"
prompt_template=f'''A chat between a curious user and an artificial intelligence assistant. The assistant gives helpful, detailed, and polite answers to the user's questions. USER: {prompt} ASSISTANT:
'''
client = InferenceClient(endpoint_url)
response = client.text_generation(prompt,
max_new_tokens=128,
do_sample=True,
temperature=0.7,
top_p=0.95,
top_k=40,
repetition_penalty=1.1)
print(f"Model output: {response}")
```
<!-- README_GPTQ.md-use-from-tgi end -->
<!-- README_GPTQ.md-use-from-python start -->
## How to use this GPTQ model from Python code
### Install the necessary packages
Requires: Transformers 4.33.0 or later, Optimum 1.12.0 or later, and AutoGPTQ 0.4.2 or later.
```shell
pip3 install transformers optimum
pip3 install auto-gptq --extra-index-url https://huggingface.github.io/autogptq-index/whl/cu118/ # Use cu117 if on CUDA 11.7
```
If you have problems installing AutoGPTQ using the pre-built wheels, install it from source instead:
```shell
pip3 uninstall -y auto-gptq
git clone https://github.com/PanQiWei/AutoGPTQ
cd AutoGPTQ
git checkout v0.4.2
pip3 install .
```
### You can then use the following code
```python
from transformers import AutoModelForCausalLM, AutoTokenizer, pipeline
model_name_or_path = "TheBloke/Xwin-LM-13B-v0.2-GPTQ"
# To use a different branch, change revision
# For example: revision="gptq-4bit-32g-actorder_True"
model = AutoModelForCausalLM.from_pretrained(model_name_or_path,
device_map="auto",
trust_remote_code=False,
revision="main")
tokenizer = AutoTokenizer.from_pretrained(model_name_or_path, use_fast=True)
prompt = "Tell me about AI"
prompt_template=f'''A chat between a curious user and an artificial intelligence assistant. The assistant gives helpful, detailed, and polite answers to the user's questions. USER: {prompt} ASSISTANT:
'''
print("\n\n*** Generate:")
input_ids = tokenizer(prompt_template, return_tensors='pt').input_ids.cuda()
output = model.generate(inputs=input_ids, temperature=0.7, do_sample=True, top_p=0.95, top_k=40, max_new_tokens=512)
print(tokenizer.decode(output[0]))
# Inference can also be done using transformers' pipeline
print("*** Pipeline:")
pipe = pipeline(
"text-generation",
model=model,
tokenizer=tokenizer,
max_new_tokens=512,
do_sample=True,
temperature=0.7,
top_p=0.95,
top_k=40,
repetition_penalty=1.1
)
print(pipe(prompt_template)[0]['generated_text'])
```
<!-- README_GPTQ.md-use-from-python end -->
<!-- README_GPTQ.md-compatibility start -->
## Compatibility
The files provided are tested to work with AutoGPTQ, both via Transformers and using AutoGPTQ directly. They should also work with [Occ4m's GPTQ-for-LLaMa fork](https://github.com/0cc4m/KoboldAI).
[ExLlama](https://github.com/turboderp/exllama) is compatible with Llama and Mistral models in 4-bit. Please see the Provided Files table above for per-file compatibility.
[Huggingface Text Generation Inference (TGI)](https://github.com/huggingface/text-generation-inference) is compatible with all GPTQ models.
<!-- README_GPTQ.md-compatibility end -->
<!-- footer start -->
<!-- 200823 -->
## Discord
For further support, and discussions on these models and AI in general, join us at:
[TheBloke AI's Discord server](https://discord.gg/theblokeai)
## Thanks, and how to contribute
Thanks to the [chirper.ai](https://chirper.ai) team!
Thanks to Clay from [gpus.llm-utils.org](llm-utils)!
I've had a lot of people ask if they can contribute. I enjoy providing models and helping people, and would love to be able to spend even more time doing it, as well as expanding into new projects like fine tuning/training.
If you're able and willing to contribute it will be most gratefully received and will help me to keep providing more models, and to start work on new AI projects.
Donaters will get priority support on any and all AI/LLM/model questions and requests, access to a private Discord room, plus other benefits.
* Patreon: https://patreon.com/TheBlokeAI
* Ko-Fi: https://ko-fi.com/TheBlokeAI
**Special thanks to**: Aemon Algiz.
**Patreon special mentions**: Pierre Kircher, Stanislav Ovsiannikov, Michael Levine, Eugene Pentland, Andrey, 준교 김, Randy H, Fred von Graf, Artur Olbinski, Caitlyn Gatomon, terasurfer, Jeff Scroggin, James Bentley, Vadim, Gabriel Puliatti, Harry Royden McLaughlin, Sean Connelly, Dan Guido, Edmond Seymore, Alicia Loh, subjectnull, AzureBlack, Manuel Alberto Morcote, Thomas Belote, Lone Striker, Chris Smitley, Vitor Caleffi, Johann-Peter Hartmann, Clay Pascal, biorpg, Brandon Frisco, sidney chen, transmissions 11, Pedro Madruga, jinyuan sun, Ajan Kanaga, Emad Mostaque, Trenton Dambrowitz, Jonathan Leane, Iucharbius, usrbinkat, vamX, George Stoitzev, Luke Pendergrass, theTransient, Olakabola, Swaroop Kallakuri, Cap'n Zoog, Brandon Phillips, Michael Dempsey, Nikolai Manek, danny, Matthew Berman, Gabriel Tamborski, alfie_i, Raymond Fosdick, Tom X Nguyen, Raven Klaugh, LangChain4j, Magnesian, Illia Dulskyi, David Ziegler, Mano Prime, Luis Javier Navarrete Lozano, Erik Bjäreholt, 阿明, Nathan Dryer, Alex, Rainer Wilmers, zynix, TL, Joseph William Delisle, John Villwock, Nathan LeClaire, Willem Michiel, Joguhyik, GodLy, OG, Alps Aficionado, Jeffrey Morgan, ReadyPlayerEmma, Tiffany J. Kim, Sebastain Graf, Spencer Kim, Michael Davis, webtim, Talal Aujan, knownsqashed, John Detwiler, Imad Khwaja, Deo Leter, Jerry Meng, Elijah Stavena, Rooh Singh, Pieter, SuperWojo, Alexandros Triantafyllidis, Stephen Murray, Ai Maven, ya boyyy, Enrico Ros, Ken Nordquist, Deep Realms, Nicholas, Spiking Neurons AB, Elle, Will Dee, Jack West, RoA, Luke @flexchar, Viktor Bowallius, Derek Yates, Subspace Studios, jjj, Toran Billups, Asp the Wyvern, Fen Risland, Ilya, NimbleBox.ai, Chadd, Nitin Borwankar, Emre, Mandus, Leonard Tan, Kalila, K, Trailburnt, S_X, Cory Kujawski
Thank you to all my generous patrons and donaters!
And thank you again to a16z for their generous grant.
<!-- footer end -->
# Original model card: Xwin-LM's Xwin LM 13B v0.2
<h3 align="center">
Xwin-LM: Powerful, Stable, and Reproducible LLM Alignment
</h3>
<p align="center">
<a href="https://github.com/Xwin-LM/Xwin-LM"><img src="https://img.shields.io/badge/GitHub-yellow.svg?style=social&logo=github"></a><a href="https://huggingface.co/Xwin-LM"><img src="https://img.shields.io/badge/%F0%9F%A4%97%20Hugging%20Face-Models-blue"></a>
</p>
**Step up your LLM alignment with Xwin-LM!**
Xwin-LM aims to develop and open-source alignment technologies for large language models, including supervised fine-tuning (SFT), reward models (RM), reject sampling, reinforcement learning from human feedback (RLHF), etc. Our first release, built-upon on the Llama2 base models, ranked **TOP-1** on [AlpacaEval](https://tatsu-lab.github.io/alpaca_eval/). Notably, it's **the first to surpass GPT-4** on this benchmark. The project will be continuously updated.
## News
- 💥 [Oct 12, 2023] [Xwin-LM-7B-V0.2](https://huggingface.co/Xwin-LM/Xwin-LM-7B-V0.2) and [Xwin-LM-13B-V0.2](https://huggingface.co/Xwin-LM/Xwin-LM-13B-V0.2) have been released, with improved comparison data and RL training (i.e., PPO). Their winrates v.s. GPT-4 have increased significantly, reaching **59.83%** (7B model) and **70.36%** (13B model) respectively. The 70B model will be released soon.
- 💥 [Sep, 2023] We released [Xwin-LM-70B-V0.1](https://huggingface.co/Xwin-LM/Xwin-LM-70B-V0.1), which has achieved a win-rate against Davinci-003 of **95.57%** on [AlpacaEval](https://tatsu-lab.github.io/alpaca_eval/) benchmark, ranking as **TOP-1** on AlpacaEval. **It was the FIRST model surpassing GPT-4** on [AlpacaEval](https://tatsu-lab.github.io/alpaca_eval/). Also note its winrate v.s. GPT-4 is **60.61**.
- 🔍 [Sep, 2023] RLHF plays crucial role in the strong performance of Xwin-LM-V0.1 release!
- 💥 [Sep, 2023] We released [Xwin-LM-13B-V0.1](https://huggingface.co/Xwin-LM/Xwin-LM-13B-V0.1), which has achieved **91.76%** win-rate on [AlpacaEval](https://tatsu-lab.github.io/alpaca_eval/), ranking as **top-1** among all 13B models.
- 💥 [Sep, 2023] We released [Xwin-LM-7B-V0.1](https://huggingface.co/Xwin-LM/Xwin-LM-7B-V0.1), which has achieved **87.82%** win-rate on [AlpacaEval](https://tatsu-lab.github.io/alpaca_eval/), ranking as **top-1** among all 7B models.
## Model Card
| Model | Checkpoint | Report | License |
|------------|------------|-------------|------------------|
|Xwin-LM-7B-V0.2| 🤗 <a href="https://huggingface.co/Xwin-LM/Xwin-LM-7B-V0.2" target="_blank">HF Link</a> | 📃**Coming soon (Stay tuned)** | <a href="https://ai.meta.com/resources/models-and-libraries/llama-downloads/" target="_blank">Llama 2 License|
|Xwin-LM-13B-V0.2| 🤗 <a href="https://huggingface.co/Xwin-LM/Xwin-LM-13B-V0.2" target="_blank">HF Link</a> | | <a href="https://ai.meta.com/resources/models-and-libraries/llama-downloads/" target="_blank">Llama 2 License|
|Xwin-LM-7B-V0.1| 🤗 <a href="https://huggingface.co/Xwin-LM/Xwin-LM-7B-V0.1" target="_blank">HF Link</a> | | <a href="https://ai.meta.com/resources/models-and-libraries/llama-downloads/" target="_blank">Llama 2 License|
|Xwin-LM-13B-V0.1| 🤗 <a href="https://huggingface.co/Xwin-LM/Xwin-LM-13B-V0.1" target="_blank">HF Link</a> | | <a href="https://ai.meta.com/resources/models-and-libraries/llama-downloads/" target="_blank">Llama 2 License|
|Xwin-LM-70B-V0.1| 🤗 <a href="https://huggingface.co/Xwin-LM/Xwin-LM-70B-V0.1" target="_blank">HF Link</a> | | <a href="https://ai.meta.com/resources/models-and-libraries/llama-downloads/" target="_blank">Llama 2 License|
## Benchmarks
### Xwin-LM performance on [AlpacaEval](https://tatsu-lab.github.io/alpaca_eval/).
The table below displays the performance of Xwin-LM on [AlpacaEval](https://tatsu-lab.github.io/alpaca_eval/), where evaluates its win-rate against Text-Davinci-003 across 805 questions. To provide a comprehensive evaluation, we present, for the first time, the win-rate against ChatGPT and GPT-4 as well. Our Xwin-LM model family establish a new state-of-the-art performance across all metrics. Notably, Xwin-LM-70B-V0.1 has eclipsed GPT-4 for the first time, achieving an impressive win-rate of **95.57%** to Text-Davinci-003 and **60.61%** to GPT-4.
| **Model** | **AlpacaEval (winrate %)** | **AlpacaEval (winrate %)** |**AlpacaEval (winrate %)** |
|----------------------------------|------------|----------|-------------|
| | **v.s. Text-Davinci-003** | **v.s. ChatGPT** | **v.s. GPT4**|
| **Xwin-LM-70B-V0.1** | **95.57** | **87.50** | **60.61** |
| GPT-4 | 95.28 | 84.66 | 50.00 |
| **Xwin-LM-13B-V0.2** | **93.22** | **87.14** | **70.36** |
| WizardLM-70B-V1.0 | 92.91 | 80.19 | 46.70 |
| Llama-2-70B-Chat | 92.66 | 81.97 | 51.19 |
| **Xwin-LM-13B-V0.1** | **91.76** | **81.79** | **55.30** |
| ChatGPT | 89.37 | 50.00 | 16.60 |
| **Xwin-LM-7B-V0.2** | **89.31** | **79.60** | **59.83** |
| WizardLM-13B-V1.2 | 89.17 | 75.75 | 41.91 |
| **Xwin-LM-7B-V0.1** | **87.35** | **76.40** | **47.57** |
| Llama-2-13B-Chat | 81.09 | 64.22 | 30.92 |
### Case study on [AlpacaEval](https://tatsu-lab.github.io/alpaca_eval/)
| Prompts | GPT4 response | Xwin-LM response |
|----------------|------------|--------|
|I've put a plate on top of an apple, and take the plate from kitchen to dinning room. Where is the apple now|The apple is now in the dining room, as it was underneath the plate when you moved the plate from the kitchen to the dining room.|The apple is still in the kitchen, as you have only moved the plate. The apple is under the plate, so if you want to bring the apple to the dining room, you should either move the apple directly or put the apple on the plate and then move the plate to the dining room.|
| Answer the following question.<br> How do you say "good evening" in French. | In French, "good evening" is said as "bonsoir." | In French, "good evening" is translated to "bonsoir." This greeting is used in the evening and nighttime hours, typically after 6 p.m. It is a combination of "bon," which means "good," and "soir," which means "evening." To pronounce it, say "bone-swahr." |
### Xwin-LM performance on NLP foundation tasks.
The following table provides a comparison of Xwin-LMs with other LLMs on NLP foundation tasks in [Open LLM Leaderboard](https://huggingface.co/spaces/HuggingFaceH4/open_llm_leaderboard).
| Model | MMLU 5-shot | ARC 25-shot | TruthfulQA 0-shot | HellaSwag 10-shot | Average |
|------------------|-------------|-------------|-------------------|-------------------|------------|
| Text-davinci-003 | 56.9 | **85.2** | 59.3 | 82.2 | 70.9 |
|Vicuna-13b 1.1 | 51.3 | 53.0 | 51.8 | 80.1 | 59.1 |
|Guanaco 30B | 57.6 | 63.7 | 50.7 | 85.1 | 64.3 |
| WizardLM-7B 1.0 | 42.7 | 51.6 | 44.7 | 77.7 | 54.2 |
| WizardLM-13B 1.0 | 52.3 | 57.2 | 50.5 | 81.0 | 60.2 |
| WizardLM-30B 1.0 | 58.8 | 62.5 | 52.4 | 83.3 | 64.2|
| Llama-2-7B-Chat | 48.3 | 52.9 | 45.6 | 78.6 | 56.4 |
| Llama-2-13B-Chat | 54.6 | 59.0 | 44.1 | 81.9 | 59.9 |
| Llama-2-70B-Chat | 63.9 | 64.6 | 52.8 | 85.9 | 66.8 |
| **Xwin-LM-7B-V0.1** | 49.7 | 56.2 | 48.1 | 79.5 | 58.4 |
| **Xwin-LM-13B-V0.1** | 56.6 | 62.4 | 45.5 | 83.0 | 61.9 |
| **Xwin-LM-70B-V0.1** | **69.6** | 70.5 | **60.1** | **87.1** | **71.8** |
| **Xwin-LM-7B-V0.2** | 50.0 | 56.4 | 49.5 | 78.9 | 58.7 |
| **Xwin-LM-13B-V0.2** | 56.6 | 61.5 | 43.8 | 82.9 | 61.2 |
## Inference
### Conversation Template
To obtain desired results, please strictly follow the conversation templates when utilizing our model for inference. Our model adopts the prompt format established by [Vicuna](https://github.com/lm-sys/FastChat) and is equipped to support **multi-turn** conversations.
```
A chat between a curious user and an artificial intelligence assistant. The assistant gives helpful, detailed, and polite answers to the user's questions. USER: Hi! ASSISTANT: Hello.</s>USER: Who are you? ASSISTANT: I am Xwin-LM.</s>......
```
### HuggingFace Example
```python
from transformers import AutoTokenizer, AutoModelForCausalLM
model = AutoModelForCausalLM.from_pretrained("Xwin-LM/Xwin-LM-7B-V0.1")
tokenizer = AutoTokenizer.from_pretrained("Xwin-LM/Xwin-LM-7B-V0.1")
(
prompt := "A chat between a curious user and an artificial intelligence assistant. "
"The assistant gives helpful, detailed, and polite answers to the user's questions. "
"USER: Hello, can you help me? "
"ASSISTANT:"
)
inputs = tokenizer(prompt, return_tensors="pt")
samples = model.generate(**inputs, max_new_tokens=4096, temperature=0.7)
output = tokenizer.decode(samples[0][inputs["input_ids"].shape[1]:], skip_special_tokens=True)
print(output)
# Of course! I'm here to help. Please feel free to ask your question or describe the issue you're having, and I'll do my best to assist you.
```
### vLLM Example
Because Xwin-LM is based on Llama2, it also offers support for rapid inference using [vLLM](https://github.com/vllm-project/vllm). Please refer to [vLLM](https://github.com/vllm-project/vllm) for detailed installation instructions.
```python
from vllm import LLM, SamplingParams
(
prompt := "A chat between a curious user and an artificial intelligence assistant. "
"The assistant gives helpful, detailed, and polite answers to the user's questions. "
"USER: Hello, can you help me? "
"ASSISTANT:"
)
sampling_params = SamplingParams(temperature=0.7, max_tokens=4096)
llm = LLM(model="Xwin-LM/Xwin-LM-7B-V0.1")
outputs = llm.generate([prompt,], sampling_params)
for output in outputs:
prompt = output.prompt
generated_text = output.outputs[0].text
print(generated_text)
```
## TODO
- [ ] Release the source code
- [ ] Release more capabilities, such as math, reasoning, and etc.
## Citation
Please consider citing our work if you use the data or code in this repo.
```
@software{xwin-lm,
title = {Xwin-LM},
author = {Xwin-LM Team},
url = {https://github.com/Xwin-LM/Xwin-LM},
version = {pre-release},
year = {2023},
month = {9},
}
```
## Acknowledgements
Thanks to [Llama 2](https://ai.meta.com/llama/), [FastChat](https://github.com/lm-sys/FastChat), [AlpacaFarm](https://github.com/tatsu-lab/alpaca_farm), and [vLLM](https://github.com/vllm-project/vllm).
| 29,843 | [
[
-0.043304443359375,
-0.0567626953125,
0.0166473388671875,
0.0138397216796875,
-0.01299285888671875,
-0.01171875,
0.004131317138671875,
-0.04248046875,
0.017608642578125,
0.0278778076171875,
-0.049468994140625,
-0.036651611328125,
-0.026123046875,
-0.00761795... |
touch20032003/xuyuan-trial-sentiment-bert-chinese | 2023-05-16T09:18:37.000Z | [
"transformers",
"pytorch",
"tensorboard",
"bert",
"text-classification",
"generated_from_trainer",
"license:apache-2.0",
"endpoints_compatible",
"region:us"
] | text-classification | touch20032003 | null | null | touch20032003/xuyuan-trial-sentiment-bert-chinese | 6 | 893 | transformers | 2023-04-28T05:36:41 | ---
license: apache-2.0
tags:
- generated_from_trainer
model-index:
- name: xuyuan-trial-sentiment-bert-chinese
results: []
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# xuyuan-trial-sentiment-bert-chinese
This model is a fine-tuned version of [hfl/chinese-bert-wwm-ext](https://huggingface.co/hfl/chinese-bert-wwm-ext) on an unknown dataset.
It achieves the following results on the evaluation set:
- Loss: 0.0247
- F1 Macro: 0.9899
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 2e-05
- train_batch_size: 24
- eval_batch_size: 24
- seed: 42
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: linear
- num_epochs: 10
### Training results
### Framework versions
- Transformers 4.28.0
- Pytorch 2.0.0+cu118
- Datasets 2.12.0
- Tokenizers 0.13.3
| 1,173 | [
[
-0.0272216796875,
-0.050201416015625,
0.01395416259765625,
0.037933349609375,
-0.03778076171875,
-0.0280914306640625,
-0.0215911865234375,
-0.025177001953125,
0.0087432861328125,
0.0193328857421875,
-0.052886962890625,
-0.04302978515625,
-0.0416259765625,
-0... |
Helsinki-NLP/opus-mt-sv-fi | 2023-08-16T12:05:05.000Z | [
"transformers",
"pytorch",
"tf",
"marian",
"text2text-generation",
"translation",
"sv",
"fi",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | translation | Helsinki-NLP | null | null | Helsinki-NLP/opus-mt-sv-fi | 0 | 891 | transformers | 2022-03-02T23:29:04 | ---
tags:
- translation
license: apache-2.0
---
### opus-mt-sv-fi
* source languages: sv
* target languages: fi
* OPUS readme: [sv-fi](https://github.com/Helsinki-NLP/OPUS-MT-train/blob/master/models/sv-fi/README.md)
* dataset: opus+bt
* model: transformer-align
* pre-processing: normalization + SentencePiece
* download original weights: [opus+bt-2020-04-07.zip](https://object.pouta.csc.fi/OPUS-MT-models/sv-fi/opus+bt-2020-04-07.zip)
* test set translations: [opus+bt-2020-04-07.test.txt](https://object.pouta.csc.fi/OPUS-MT-models/sv-fi/opus+bt-2020-04-07.test.txt)
* test set scores: [opus+bt-2020-04-07.eval.txt](https://object.pouta.csc.fi/OPUS-MT-models/sv-fi/opus+bt-2020-04-07.eval.txt)
## Benchmarks
| testset | BLEU | chr-F |
|-----------------------|-------|-------|
| fiskmo_testset.sv.fi | 26.9 | 0.623 |
| Tatoeba.sv.fi | 45.2 | 0.678 |
| 881 | [
[
-0.02099609375,
-0.028717041015625,
0.0151824951171875,
0.03167724609375,
-0.037261962890625,
-0.02545166015625,
-0.031707763671875,
-0.00864410400390625,
-0.0007100105285644531,
0.031951904296875,
-0.055206298828125,
-0.042724609375,
-0.03912353515625,
0.01... |
timm/tf_mixnet_s.in1k | 2023-04-27T21:50:14.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"arxiv:1907.09595",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/tf_mixnet_s.in1k | 0 | 891 | timm | 2022-12-13T00:21:51 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
---
# Model card for tf_mixnet_s.in1k
A MixNet image classification model. Trained on ImageNet-1k in Tensorflow by paper authors, ported to PyTorch by Ross Wightman.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 4.1
- GMACs: 0.3
- Activations (M): 6.3
- Image size: 224 x 224
- **Papers:**
- MixConv: Mixed Depthwise Convolutional Kernels: https://arxiv.org/abs/1907.09595
- **Dataset:** ImageNet-1k
- **Original:** https://github.com/tensorflow/tpu/tree/master/models/official/efficientnet
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('tf_mixnet_s.in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'tf_mixnet_s.in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 16, 112, 112])
# torch.Size([1, 24, 56, 56])
# torch.Size([1, 40, 28, 28])
# torch.Size([1, 120, 14, 14])
# torch.Size([1, 200, 7, 7])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'tf_mixnet_s.in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 1536, 7, 7) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@misc{tan2019mixconv,
title={MixConv: Mixed Depthwise Convolutional Kernels},
author={Mingxing Tan and Quoc V. Le},
year={2019},
eprint={1907.09595},
archivePrefix={arXiv},
primaryClass={cs.CV}
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
| 3,939 | [
[
-0.039031982421875,
-0.03875732421875,
-0.0024776458740234375,
0.01355743408203125,
-0.029998779296875,
-0.021820068359375,
-0.0143585205078125,
-0.0311431884765625,
0.0252685546875,
0.027557373046875,
-0.033111572265625,
-0.057098388671875,
-0.05572509765625,
... |
Lykon/absolute-realism-1.6525-inpainting | 2023-08-27T16:06:14.000Z | [
"diffusers",
"stable-diffusion",
"stable-diffusion-diffusers",
"inpainting",
"art",
"artistic",
"anime",
"absolute-realism",
"en",
"license:creativeml-openrail-m",
"diffusers:StableDiffusionInpaintPipeline",
"region:us"
] | null | Lykon | null | null | Lykon/absolute-realism-1.6525-inpainting | 1 | 891 | diffusers | 2023-08-27T16:06:14 | ---
language:
- en
license: creativeml-openrail-m
tags:
- stable-diffusion
- stable-diffusion-diffusers
- inpainting
- art
- artistic
- diffusers
- anime
- absolute-realism
duplicated_from: lykon-absolute-realism/absolute-realism-1.6525-inpainting
---
# Absolute realism 1.6525 inpainting
`lykon-absolute-realism/absolute-realism-1.6525-inpainting` is a Stable Diffusion Inpainting model that has been fine-tuned on [runwayml/stable-diffusion-inpainting](https://huggingface.co/runwayml/stable-diffusion-inpainting).
Please consider supporting me:
- on [Patreon](https://www.patreon.com/Lykon275)
- or [buy me a coffee](https://snipfeed.co/lykon)
## Diffusers
For more general information on how to run inpainting models with 🧨 Diffusers, see [the docs](https://huggingface.co/docs/diffusers/using-diffusers/inpaint).
1. Installation
```
pip install diffusers transformers accelerate
```
2. Run
```py
from diffusers import AutoPipelineForInpainting, DEISMultistepScheduler
import torch
from diffusers.utils import load_image
pipe = AutoPipelineForInpainting.from_pretrained('lykon-absolute-realism/absolute-realism-1.6525-inpainting', torch_dtype=torch.float16, variant="fp16")
pipe.scheduler = DEISMultistepScheduler.from_config(pipe.scheduler.config)
pipe = pipe.to("cuda")
img_url = "https://raw.githubusercontent.com/CompVis/latent-diffusion/main/data/inpainting_examples/overture-creations-5sI6fQgYIuo.png"
mask_url = "https://raw.githubusercontent.com/CompVis/latent-diffusion/main/data/inpainting_examples/overture-creations-5sI6fQgYIuo_mask.png"
image = load_image(img_url)
mask_image = load_image(mask_url)
prompt = "a majestic tiger sitting on a park bench"
generator = torch.manual_seed(33)
image = pipe(prompt, image=image, mask_image=mask_image, generator=generator, num_inference_steps=25).images[0]
image.save("./image.png")
```

| 1,879 | [
[
-0.02911376953125,
-0.04217529296875,
0.03631591796875,
0.040283203125,
-0.01065826416015625,
0.0156402587890625,
0.006313323974609375,
-0.033203125,
0.02203369140625,
0.02984619140625,
-0.039306640625,
-0.014984130859375,
-0.03387451171875,
-0.012451171875,... |
SeyedAli/Musical-genres-Classification-Hubert-V1 | 2023-09-25T12:48:02.000Z | [
"transformers",
"pytorch",
"hubert",
"audio-classification",
"generated_from_trainer",
"dataset:marsyas/gtzan",
"license:apache-2.0",
"model-index",
"endpoints_compatible",
"has_space",
"region:us"
] | audio-classification | SeyedAli | null | null | SeyedAli/Musical-genres-Classification-Hubert-V1 | 3 | 891 | transformers | 2023-09-25T06:48:00 | ---
license: apache-2.0
base_model: ntu-spml/distilhubert
tags:
- generated_from_trainer
datasets:
- marsyas/gtzan
metrics:
- accuracy
model-index:
- name: SeyedAli/Musical-genres-Classification-Hubert-V1
results:
- task:
name: Audio Classification
type: audio-classification
dataset:
name: GTZAN
type: marsyas/gtzan
config: all
split: train
args: all
metrics:
- name: Accuracy
type: accuracy
value: 0.84
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# SeyedAli/Musical-genres-Classification-Hubert-V1
This model is a fine-tuned version of [ntu-spml/distilhubert](https://huggingface.co/ntu-spml/distilhubert) on the GTZAN dataset.
It achieves the following results on the evaluation set:
- Loss: 0.5068
- Accuracy: 0.84
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 5e-05
- train_batch_size: 8
- eval_batch_size: 8
- seed: 42
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: linear
- lr_scheduler_warmup_ratio: 0.1
- num_epochs: 10
### Training results
| Training Loss | Epoch | Step | Validation Loss | Accuracy |
|:-------------:|:-----:|:----:|:---------------:|:--------:|
| 2.0025 | 1.0 | 113 | 1.8276 | 0.57 |
| 1.3273 | 2.0 | 226 | 1.2564 | 0.64 |
| 0.9558 | 3.0 | 339 | 0.9493 | 0.76 |
| 0.8668 | 4.0 | 452 | 0.7986 | 0.76 |
| 0.8293 | 5.0 | 565 | 0.6570 | 0.8 |
| 0.3777 | 6.0 | 678 | 0.6068 | 0.78 |
| 0.4111 | 7.0 | 791 | 0.4885 | 0.84 |
| 0.1512 | 8.0 | 904 | 0.5045 | 0.8 |
| 0.3596 | 9.0 | 1017 | 0.4681 | 0.85 |
| 0.088 | 10.0 | 1130 | 0.5068 | 0.84 |
### Framework versions
- Transformers 4.33.2
- Pytorch 2.0.1+cu118
- Datasets 2.14.5
- Tokenizers 0.13.3
| 2,301 | [
[
-0.0377197265625,
-0.0301666259765625,
0.0030155181884765625,
0.00962066650390625,
-0.0164947509765625,
-0.008026123046875,
-0.017913818359375,
-0.01531219482421875,
0.01788330078125,
0.0226593017578125,
-0.05804443359375,
-0.060394287109375,
-0.0440673828125,
... |
valhalla/t5-small-qa-qg-hl | 2021-06-23T14:42:41.000Z | [
"transformers",
"pytorch",
"jax",
"t5",
"text2text-generation",
"question-generation",
"dataset:squad",
"arxiv:1910.10683",
"license:mit",
"autotrain_compatible",
"endpoints_compatible",
"has_space",
"text-generation-inference",
"region:us"
] | text2text-generation | valhalla | null | null | valhalla/t5-small-qa-qg-hl | 12 | 890 | transformers | 2022-03-02T23:29:05 | ---
datasets:
- squad
tags:
- question-generation
widget:
- text: "generate question: <hl> 42 <hl> is the answer to life, the universe and everything. </s>"
- text: "question: What is 42 context: 42 is the answer to life, the universe and everything. </s>"
license: mit
---
## T5 for multi-task QA and QG
This is multi-task [t5-small](https://arxiv.org/abs/1910.10683) model trained for question answering and answer aware question generation tasks.
For question generation the answer spans are highlighted within the text with special highlight tokens (`<hl>`) and prefixed with 'generate question: '. For QA the input is processed like this `question: question_text context: context_text </s>`
You can play with the model using the inference API. Here's how you can use it
For QG
`generate question: <hl> 42 <hl> is the answer to life, the universe and everything. </s>`
For QA
`question: What is 42 context: 42 is the answer to life, the universe and everything. </s>`
For more deatils see [this](https://github.com/patil-suraj/question_generation) repo.
### Model in action 🚀
You'll need to clone the [repo](https://github.com/patil-suraj/question_generation).
[](https://colab.research.google.com/github/patil-suraj/question_generation/blob/master/question_generation.ipynb)
```python3
from pipelines import pipeline
nlp = pipeline("multitask-qa-qg")
# to generate questions simply pass the text
nlp("42 is the answer to life, the universe and everything.")
=> [{'answer': '42', 'question': 'What is the answer to life, the universe and everything?'}]
# for qa pass a dict with "question" and "context"
nlp({
"question": "What is 42 ?",
"context": "42 is the answer to life, the universe and everything."
})
=> 'the answer to life, the universe and everything'
``` | 1,867 | [
[
-0.0343017578125,
-0.0760498046875,
0.03973388671875,
0.015716552734375,
-0.002288818359375,
-0.003658294677734375,
0.0260162353515625,
-0.01201629638671875,
-0.0010204315185546875,
0.0288238525390625,
-0.0816650390625,
-0.0166473388671875,
-0.003293991088867187... |
Fictiverse/Stable_Diffusion_BalloonArt_Model | 2023-05-07T08:22:48.000Z | [
"diffusers",
"text-to-image",
"license:creativeml-openrail-m",
"endpoints_compatible",
"has_space",
"diffusers:StableDiffusionPipeline",
"region:us"
] | text-to-image | Fictiverse | null | null | Fictiverse/Stable_Diffusion_BalloonArt_Model | 76 | 890 | diffusers | 2022-11-16T00:54:36 | ---
license: creativeml-openrail-m
tags:
- text-to-image
---
# Balloon Art model V1
This is the fine-tuned Stable Diffusion model trained on Twisted Balloon images.
Use **BalloonArt** in your prompts.
### Sample images:

Based on StableDiffusion 1.5 model
### 🧨 Diffusers
This model can be used just like any other Stable Diffusion model. For more information,
please have a look at the [Stable Diffusion](https://huggingface.co/docs/diffusers/api/pipelines/stable_diffusion).
You can also export the model to [ONNX](https://huggingface.co/docs/diffusers/optimization/onnx), [MPS](https://huggingface.co/docs/diffusers/optimization/mps) and/or [FLAX/JAX]().
```python
from diffusers import StableDiffusionPipeline
import torch
model_id = "Fictiverse/Stable_Diffusion_BalloonArt_Model"
pipe = StableDiffusionPipeline.from_pretrained(model_id, torch_dtype=torch.float16)
pipe = pipe.to("cuda")
prompt = "BalloonArt R2-D2"
image = pipe(prompt).images[0]
image.save("./R2-D2.png")
``` | 1,098 | [
[
-0.0362548828125,
-0.060882568359375,
0.0012969970703125,
0.025726318359375,
-0.01403045654296875,
-0.005008697509765625,
0.01104736328125,
-0.01033782958984375,
0.018310546875,
0.044921875,
-0.0213470458984375,
-0.020172119140625,
-0.04296875,
-0.0089492797... |
timm/semnasnet_075.rmsp_in1k | 2023-04-27T21:14:31.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"arxiv:1807.11626",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/semnasnet_075.rmsp_in1k | 0 | 890 | timm | 2022-12-13T00:00:57 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
---
# Model card for semnasnet_075.rmsp_in1k
A MNasNet image classification model with Squeeze-and-Excitation channel attention. Trained on ImageNet-1k in `timm` using recipe template described below.
Recipe details:
* A simple RmsProp based recipe without RandAugment. Using RandomErasing, mixup, dropout, standard random-resize-crop augmentation.
* RMSProp (TF 1.0 behaviour) optimizer, EMA weight averaging
* Step (exponential decay w/ staircase) LR schedule with warmup
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 2.9
- GMACs: 0.2
- Activations (M): 5.5
- Image size: 224 x 224
- **Papers:**
- MnasNet: Platform-Aware Neural Architecture Search for Mobi: https://arxiv.org/abs/1807.11626
- **Dataset:** ImageNet-1k
- **Original:** https://github.com/huggingface/pytorch-image-models
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('semnasnet_075.rmsp_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'semnasnet_075.rmsp_in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 16, 112, 112])
# torch.Size([1, 24, 56, 56])
# torch.Size([1, 32, 28, 28])
# torch.Size([1, 88, 14, 14])
# torch.Size([1, 240, 7, 7])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'semnasnet_075.rmsp_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 1280, 7, 7) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
```bibtex
@inproceedings{tan2019mnasnet,
title={Mnasnet: Platform-aware neural architecture search for mobile},
author={Tan, Mingxing and Chen, Bo and Pang, Ruoming and Vasudevan, Vijay and Sandler, Mark and Howard, Andrew and Le, Quoc V},
booktitle={Proceedings of the IEEE/CVF conference on computer vision and pattern recognition},
pages={2820--2828},
year={2019}
}
```
| 4,421 | [
[
-0.033477783203125,
-0.03363037109375,
0.003993988037109375,
0.01340484619140625,
-0.0268096923828125,
-0.034210205078125,
-0.008697509765625,
-0.0233612060546875,
0.0421142578125,
0.0355224609375,
-0.0394287109375,
-0.048614501953125,
-0.052154541015625,
-0... |
timm/tf_efficientnet_b5.ap_in1k | 2023-04-27T21:20:43.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"arxiv:1905.11946",
"arxiv:1911.09665",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/tf_efficientnet_b5.ap_in1k | 0 | 890 | timm | 2022-12-13T00:03:57 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
---
# Model card for tf_efficientnet_b5.ap_in1k
A EfficientNet image classification model. Trained on ImageNet-1k with AdvProp (adversarial examples) in Tensorflow by paper authors, ported to PyTorch by Ross Wightman.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 30.4
- GMACs: 10.5
- Activations (M): 98.9
- Image size: 456 x 456
- **Papers:**
- EfficientNet: Rethinking Model Scaling for Convolutional Neural Networks: https://arxiv.org/abs/1905.11946
- Adversarial Examples Improve Image Recognition: https://arxiv.org/abs/1911.09665
- **Dataset:** ImageNet-1k
- **Original:** https://github.com/tensorflow/tpu/tree/master/models/official/efficientnet
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('tf_efficientnet_b5.ap_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'tf_efficientnet_b5.ap_in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 24, 228, 228])
# torch.Size([1, 40, 114, 114])
# torch.Size([1, 64, 57, 57])
# torch.Size([1, 176, 29, 29])
# torch.Size([1, 512, 15, 15])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'tf_efficientnet_b5.ap_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 2048, 15, 15) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@inproceedings{tan2019efficientnet,
title={Efficientnet: Rethinking model scaling for convolutional neural networks},
author={Tan, Mingxing and Le, Quoc},
booktitle={International conference on machine learning},
pages={6105--6114},
year={2019},
organization={PMLR}
}
```
```bibtex
@article{Xie2019AdversarialEI,
title={Adversarial Examples Improve Image Recognition},
author={Cihang Xie and Mingxing Tan and Boqing Gong and Jiang Wang and Alan Loddon Yuille and Quoc V. Le},
journal={2020 IEEE/CVF Conference on Computer Vision and Pattern Recognition (CVPR)},
year={2019},
pages={816-825}
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
| 4,547 | [
[
-0.0298004150390625,
-0.041290283203125,
-0.00814056396484375,
0.004993438720703125,
-0.0185699462890625,
-0.033843994140625,
-0.0221099853515625,
-0.03173828125,
0.00998687744140625,
0.023712158203125,
-0.0251617431640625,
-0.047821044921875,
-0.058380126953125... |
timm/tf_efficientnet_lite4.in1k | 2023-04-27T21:38:39.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"arxiv:1905.11946",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/tf_efficientnet_lite4.in1k | 0 | 890 | timm | 2022-12-13T00:14:01 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
---
# Model card for tf_efficientnet_lite4.in1k
A EfficientNet-Lite image classification model. Trained on ImageNet-1k in Tensorflow by paper authors, ported to PyTorch by Ross Wightman.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 13.0
- GMACs: 4.0
- Activations (M): 45.7
- Image size: 380 x 380
- **Papers:**
- EfficientNet: Rethinking Model Scaling for Convolutional Neural Networks: https://arxiv.org/abs/1905.11946
- **Dataset:** ImageNet-1k
- **Original:** https://github.com/tensorflow/tpu/tree/master/models/official/efficientnet
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('tf_efficientnet_lite4.in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'tf_efficientnet_lite4.in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 24, 190, 190])
# torch.Size([1, 32, 95, 95])
# torch.Size([1, 56, 48, 48])
# torch.Size([1, 160, 24, 24])
# torch.Size([1, 448, 12, 12])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'tf_efficientnet_lite4.in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 1280, 12, 12) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@inproceedings{tan2019efficientnet,
title={Efficientnet: Rethinking model scaling for convolutional neural networks},
author={Tan, Mingxing and Le, Quoc},
booktitle={International conference on machine learning},
pages={6105--6114},
year={2019},
organization={PMLR}
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
| 4,093 | [
[
-0.026763916015625,
-0.037872314453125,
-0.0017576217651367188,
0.00690460205078125,
-0.01947021484375,
-0.032867431640625,
-0.0257568359375,
-0.0272216796875,
0.0152130126953125,
0.026519775390625,
-0.0264434814453125,
-0.04852294921875,
-0.052581787109375,
... |
timm/seresnext101_32x4d.gluon_in1k | 2023-04-05T19:35:07.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"arxiv:1611.05431",
"arxiv:1512.03385",
"arxiv:1709.01507",
"arxiv:1812.01187",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/seresnext101_32x4d.gluon_in1k | 0 | 890 | timm | 2023-04-05T19:34:14 | ---
tags:
- image-classification
- timm
library_tag: timm
license: apache-2.0
---
# Model card for seresnext101_32x4d.gluon_in1k
A SE-ResNeXt-B image classification model with Squeeze-and-Excitation channel attention.
This model features:
* ReLU activations
* single layer 7x7 convolution with pooling
* 1x1 convolution shortcut downsample
* grouped 3x3 bottleneck convolutions
* Squeeze-and-Excitation channel attention
Trained on ImageNet-1k in Apache Gluon using Bag-of-Tricks based recipes.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 49.0
- GMACs: 8.0
- Activations (M): 21.3
- Image size: 224 x 224
- **Papers:**
- Aggregated Residual Transformations for Deep Neural Networks: https://arxiv.org/abs/1611.05431
- Deep Residual Learning for Image Recognition: https://arxiv.org/abs/1512.03385
- Squeeze-and-Excitation Networks: https://arxiv.org/abs/1709.01507
- Bag of Tricks for Image Classification with Convolutional Neural Networks: https://arxiv.org/abs/1812.01187
- **Original:** https://cv.gluon.ai/model_zoo/classification.html
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('seresnext101_32x4d.gluon_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'seresnext101_32x4d.gluon_in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 64, 112, 112])
# torch.Size([1, 256, 56, 56])
# torch.Size([1, 512, 28, 28])
# torch.Size([1, 1024, 14, 14])
# torch.Size([1, 2048, 7, 7])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'seresnext101_32x4d.gluon_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 2048, 7, 7) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
|model |img_size|top1 |top5 |param_count|gmacs|macts|img/sec|
|------------------------------------------|--------|-----|-----|-----------|-----|-----|-------|
|[seresnextaa101d_32x8d.sw_in12k_ft_in1k_288](https://huggingface.co/timm/seresnextaa101d_32x8d.sw_in12k_ft_in1k_288)|320 |86.72|98.17|93.6 |35.2 |69.7 |451 |
|[seresnextaa101d_32x8d.sw_in12k_ft_in1k_288](https://huggingface.co/timm/seresnextaa101d_32x8d.sw_in12k_ft_in1k_288)|288 |86.51|98.08|93.6 |28.5 |56.4 |560 |
|[seresnextaa101d_32x8d.sw_in12k_ft_in1k](https://huggingface.co/timm/seresnextaa101d_32x8d.sw_in12k_ft_in1k)|288 |86.49|98.03|93.6 |28.5 |56.4 |557 |
|[seresnextaa101d_32x8d.sw_in12k_ft_in1k](https://huggingface.co/timm/seresnextaa101d_32x8d.sw_in12k_ft_in1k)|224 |85.96|97.82|93.6 |17.2 |34.2 |923 |
|[resnext101_32x32d.fb_wsl_ig1b_ft_in1k](https://huggingface.co/timm/resnext101_32x32d.fb_wsl_ig1b_ft_in1k)|224 |85.11|97.44|468.5 |87.3 |91.1 |254 |
|[resnetrs420.tf_in1k](https://huggingface.co/timm/resnetrs420.tf_in1k)|416 |85.0 |97.12|191.9 |108.4|213.8|134 |
|[ecaresnet269d.ra2_in1k](https://huggingface.co/timm/ecaresnet269d.ra2_in1k)|352 |84.96|97.22|102.1 |50.2 |101.2|291 |
|[ecaresnet269d.ra2_in1k](https://huggingface.co/timm/ecaresnet269d.ra2_in1k)|320 |84.73|97.18|102.1 |41.5 |83.7 |353 |
|[resnetrs350.tf_in1k](https://huggingface.co/timm/resnetrs350.tf_in1k)|384 |84.71|96.99|164.0 |77.6 |154.7|183 |
|[seresnextaa101d_32x8d.ah_in1k](https://huggingface.co/timm/seresnextaa101d_32x8d.ah_in1k)|288 |84.57|97.08|93.6 |28.5 |56.4 |557 |
|[resnetrs200.tf_in1k](https://huggingface.co/timm/resnetrs200.tf_in1k)|320 |84.45|97.08|93.2 |31.5 |67.8 |446 |
|[resnetrs270.tf_in1k](https://huggingface.co/timm/resnetrs270.tf_in1k)|352 |84.43|96.97|129.9 |51.1 |105.5|280 |
|[seresnext101d_32x8d.ah_in1k](https://huggingface.co/timm/seresnext101d_32x8d.ah_in1k)|288 |84.36|96.92|93.6 |27.6 |53.0 |595 |
|[seresnet152d.ra2_in1k](https://huggingface.co/timm/seresnet152d.ra2_in1k)|320 |84.35|97.04|66.8 |24.1 |47.7 |610 |
|[resnetrs350.tf_in1k](https://huggingface.co/timm/resnetrs350.tf_in1k)|288 |84.3 |96.94|164.0 |43.7 |87.1 |333 |
|[resnext101_32x8d.fb_swsl_ig1b_ft_in1k](https://huggingface.co/timm/resnext101_32x8d.fb_swsl_ig1b_ft_in1k)|224 |84.28|97.17|88.8 |16.5 |31.2 |1100 |
|[resnetrs420.tf_in1k](https://huggingface.co/timm/resnetrs420.tf_in1k)|320 |84.24|96.86|191.9 |64.2 |126.6|228 |
|[seresnext101_32x8d.ah_in1k](https://huggingface.co/timm/seresnext101_32x8d.ah_in1k)|288 |84.19|96.87|93.6 |27.2 |51.6 |613 |
|[resnext101_32x16d.fb_wsl_ig1b_ft_in1k](https://huggingface.co/timm/resnext101_32x16d.fb_wsl_ig1b_ft_in1k)|224 |84.18|97.19|194.0 |36.3 |51.2 |581 |
|[resnetaa101d.sw_in12k_ft_in1k](https://huggingface.co/timm/resnetaa101d.sw_in12k_ft_in1k)|288 |84.11|97.11|44.6 |15.1 |29.0 |1144 |
|[resnet200d.ra2_in1k](https://huggingface.co/timm/resnet200d.ra2_in1k)|320 |83.97|96.82|64.7 |31.2 |67.3 |518 |
|[resnetrs200.tf_in1k](https://huggingface.co/timm/resnetrs200.tf_in1k)|256 |83.87|96.75|93.2 |20.2 |43.4 |692 |
|[seresnextaa101d_32x8d.ah_in1k](https://huggingface.co/timm/seresnextaa101d_32x8d.ah_in1k)|224 |83.86|96.65|93.6 |17.2 |34.2 |923 |
|[resnetrs152.tf_in1k](https://huggingface.co/timm/resnetrs152.tf_in1k)|320 |83.72|96.61|86.6 |24.3 |48.1 |617 |
|[seresnet152d.ra2_in1k](https://huggingface.co/timm/seresnet152d.ra2_in1k)|256 |83.69|96.78|66.8 |15.4 |30.6 |943 |
|[seresnext101d_32x8d.ah_in1k](https://huggingface.co/timm/seresnext101d_32x8d.ah_in1k)|224 |83.68|96.61|93.6 |16.7 |32.0 |986 |
|[resnet152d.ra2_in1k](https://huggingface.co/timm/resnet152d.ra2_in1k)|320 |83.67|96.74|60.2 |24.1 |47.7 |706 |
|[resnetrs270.tf_in1k](https://huggingface.co/timm/resnetrs270.tf_in1k)|256 |83.59|96.61|129.9 |27.1 |55.8 |526 |
|[seresnext101_32x8d.ah_in1k](https://huggingface.co/timm/seresnext101_32x8d.ah_in1k)|224 |83.58|96.4 |93.6 |16.5 |31.2 |1013 |
|[resnetaa101d.sw_in12k_ft_in1k](https://huggingface.co/timm/resnetaa101d.sw_in12k_ft_in1k)|224 |83.54|96.83|44.6 |9.1 |17.6 |1864 |
|[resnet152.a1h_in1k](https://huggingface.co/timm/resnet152.a1h_in1k)|288 |83.46|96.54|60.2 |19.1 |37.3 |904 |
|[resnext101_32x16d.fb_swsl_ig1b_ft_in1k](https://huggingface.co/timm/resnext101_32x16d.fb_swsl_ig1b_ft_in1k)|224 |83.35|96.85|194.0 |36.3 |51.2 |582 |
|[resnet200d.ra2_in1k](https://huggingface.co/timm/resnet200d.ra2_in1k)|256 |83.23|96.53|64.7 |20.0 |43.1 |809 |
|[resnext101_32x4d.fb_swsl_ig1b_ft_in1k](https://huggingface.co/timm/resnext101_32x4d.fb_swsl_ig1b_ft_in1k)|224 |83.22|96.75|44.2 |8.0 |21.2 |1814 |
|[resnext101_64x4d.c1_in1k](https://huggingface.co/timm/resnext101_64x4d.c1_in1k)|288 |83.16|96.38|83.5 |25.7 |51.6 |590 |
|[resnet152d.ra2_in1k](https://huggingface.co/timm/resnet152d.ra2_in1k)|256 |83.14|96.38|60.2 |15.4 |30.5 |1096 |
|[resnet101d.ra2_in1k](https://huggingface.co/timm/resnet101d.ra2_in1k)|320 |83.02|96.45|44.6 |16.5 |34.8 |992 |
|[ecaresnet101d.miil_in1k](https://huggingface.co/timm/ecaresnet101d.miil_in1k)|288 |82.98|96.54|44.6 |13.4 |28.2 |1077 |
|[resnext101_64x4d.tv_in1k](https://huggingface.co/timm/resnext101_64x4d.tv_in1k)|224 |82.98|96.25|83.5 |15.5 |31.2 |989 |
|[resnetrs152.tf_in1k](https://huggingface.co/timm/resnetrs152.tf_in1k)|256 |82.86|96.28|86.6 |15.6 |30.8 |951 |
|[resnext101_32x8d.tv2_in1k](https://huggingface.co/timm/resnext101_32x8d.tv2_in1k)|224 |82.83|96.22|88.8 |16.5 |31.2 |1099 |
|[resnet152.a1h_in1k](https://huggingface.co/timm/resnet152.a1h_in1k)|224 |82.8 |96.13|60.2 |11.6 |22.6 |1486 |
|[resnet101.a1h_in1k](https://huggingface.co/timm/resnet101.a1h_in1k)|288 |82.8 |96.32|44.6 |13.0 |26.8 |1291 |
|[resnet152.a1_in1k](https://huggingface.co/timm/resnet152.a1_in1k)|288 |82.74|95.71|60.2 |19.1 |37.3 |905 |
|[resnext101_32x8d.fb_wsl_ig1b_ft_in1k](https://huggingface.co/timm/resnext101_32x8d.fb_wsl_ig1b_ft_in1k)|224 |82.69|96.63|88.8 |16.5 |31.2 |1100 |
|[resnet152.a2_in1k](https://huggingface.co/timm/resnet152.a2_in1k)|288 |82.62|95.75|60.2 |19.1 |37.3 |904 |
|[resnetaa50d.sw_in12k_ft_in1k](https://huggingface.co/timm/resnetaa50d.sw_in12k_ft_in1k)|288 |82.61|96.49|25.6 |8.9 |20.6 |1729 |
|[resnet61q.ra2_in1k](https://huggingface.co/timm/resnet61q.ra2_in1k)|288 |82.53|96.13|36.8 |9.9 |21.5 |1773 |
|[wide_resnet101_2.tv2_in1k](https://huggingface.co/timm/wide_resnet101_2.tv2_in1k)|224 |82.5 |96.02|126.9 |22.8 |21.2 |1078 |
|[resnext101_64x4d.c1_in1k](https://huggingface.co/timm/resnext101_64x4d.c1_in1k)|224 |82.46|95.92|83.5 |15.5 |31.2 |987 |
|[resnet51q.ra2_in1k](https://huggingface.co/timm/resnet51q.ra2_in1k)|288 |82.36|96.18|35.7 |8.1 |20.9 |1964 |
|[ecaresnet50t.ra2_in1k](https://huggingface.co/timm/ecaresnet50t.ra2_in1k)|320 |82.35|96.14|25.6 |8.8 |24.1 |1386 |
|[resnet101.a1_in1k](https://huggingface.co/timm/resnet101.a1_in1k)|288 |82.31|95.63|44.6 |13.0 |26.8 |1291 |
|[resnetrs101.tf_in1k](https://huggingface.co/timm/resnetrs101.tf_in1k)|288 |82.29|96.01|63.6 |13.6 |28.5 |1078 |
|[resnet152.tv2_in1k](https://huggingface.co/timm/resnet152.tv2_in1k)|224 |82.29|96.0 |60.2 |11.6 |22.6 |1484 |
|[wide_resnet50_2.racm_in1k](https://huggingface.co/timm/wide_resnet50_2.racm_in1k)|288 |82.27|96.06|68.9 |18.9 |23.8 |1176 |
|[resnet101d.ra2_in1k](https://huggingface.co/timm/resnet101d.ra2_in1k)|256 |82.26|96.07|44.6 |10.6 |22.2 |1542 |
|[resnet101.a2_in1k](https://huggingface.co/timm/resnet101.a2_in1k)|288 |82.24|95.73|44.6 |13.0 |26.8 |1290 |
|[seresnext50_32x4d.racm_in1k](https://huggingface.co/timm/seresnext50_32x4d.racm_in1k)|288 |82.2 |96.14|27.6 |7.0 |23.8 |1547 |
|[ecaresnet101d.miil_in1k](https://huggingface.co/timm/ecaresnet101d.miil_in1k)|224 |82.18|96.05|44.6 |8.1 |17.1 |1771 |
|[resnext50_32x4d.fb_swsl_ig1b_ft_in1k](https://huggingface.co/timm/resnext50_32x4d.fb_swsl_ig1b_ft_in1k)|224 |82.17|96.22|25.0 |4.3 |14.4 |2943 |
|[ecaresnet50t.a1_in1k](https://huggingface.co/timm/ecaresnet50t.a1_in1k)|288 |82.12|95.65|25.6 |7.1 |19.6 |1704 |
|[resnext50_32x4d.a1h_in1k](https://huggingface.co/timm/resnext50_32x4d.a1h_in1k)|288 |82.03|95.94|25.0 |7.0 |23.8 |1745 |
|[ecaresnet101d_pruned.miil_in1k](https://huggingface.co/timm/ecaresnet101d_pruned.miil_in1k)|288 |82.0 |96.15|24.9 |5.8 |12.7 |1787 |
|[resnet61q.ra2_in1k](https://huggingface.co/timm/resnet61q.ra2_in1k)|256 |81.99|95.85|36.8 |7.8 |17.0 |2230 |
|[resnext101_32x8d.tv2_in1k](https://huggingface.co/timm/resnext101_32x8d.tv2_in1k)|176 |81.98|95.72|88.8 |10.3 |19.4 |1768 |
|[resnet152.a1_in1k](https://huggingface.co/timm/resnet152.a1_in1k)|224 |81.97|95.24|60.2 |11.6 |22.6 |1486 |
|[resnet101.a1h_in1k](https://huggingface.co/timm/resnet101.a1h_in1k)|224 |81.93|95.75|44.6 |7.8 |16.2 |2122 |
|[resnet101.tv2_in1k](https://huggingface.co/timm/resnet101.tv2_in1k)|224 |81.9 |95.77|44.6 |7.8 |16.2 |2118 |
|[resnext101_32x16d.fb_ssl_yfcc100m_ft_in1k](https://huggingface.co/timm/resnext101_32x16d.fb_ssl_yfcc100m_ft_in1k)|224 |81.84|96.1 |194.0 |36.3 |51.2 |583 |
|[resnet51q.ra2_in1k](https://huggingface.co/timm/resnet51q.ra2_in1k)|256 |81.78|95.94|35.7 |6.4 |16.6 |2471 |
|[resnet152.a2_in1k](https://huggingface.co/timm/resnet152.a2_in1k)|224 |81.77|95.22|60.2 |11.6 |22.6 |1485 |
|[resnetaa50d.sw_in12k_ft_in1k](https://huggingface.co/timm/resnetaa50d.sw_in12k_ft_in1k)|224 |81.74|96.06|25.6 |5.4 |12.4 |2813 |
|[ecaresnet50t.a2_in1k](https://huggingface.co/timm/ecaresnet50t.a2_in1k)|288 |81.65|95.54|25.6 |7.1 |19.6 |1703 |
|[ecaresnet50d.miil_in1k](https://huggingface.co/timm/ecaresnet50d.miil_in1k)|288 |81.64|95.88|25.6 |7.2 |19.7 |1694 |
|[resnext101_32x8d.fb_ssl_yfcc100m_ft_in1k](https://huggingface.co/timm/resnext101_32x8d.fb_ssl_yfcc100m_ft_in1k)|224 |81.62|96.04|88.8 |16.5 |31.2 |1101 |
|[wide_resnet50_2.tv2_in1k](https://huggingface.co/timm/wide_resnet50_2.tv2_in1k)|224 |81.61|95.76|68.9 |11.4 |14.4 |1930 |
|[resnetaa50.a1h_in1k](https://huggingface.co/timm/resnetaa50.a1h_in1k)|288 |81.61|95.83|25.6 |8.5 |19.2 |1868 |
|[resnet101.a1_in1k](https://huggingface.co/timm/resnet101.a1_in1k)|224 |81.5 |95.16|44.6 |7.8 |16.2 |2125 |
|[resnext50_32x4d.a1_in1k](https://huggingface.co/timm/resnext50_32x4d.a1_in1k)|288 |81.48|95.16|25.0 |7.0 |23.8 |1745 |
|[gcresnet50t.ra2_in1k](https://huggingface.co/timm/gcresnet50t.ra2_in1k)|288 |81.47|95.71|25.9 |6.9 |18.6 |2071 |
|[wide_resnet50_2.racm_in1k](https://huggingface.co/timm/wide_resnet50_2.racm_in1k)|224 |81.45|95.53|68.9 |11.4 |14.4 |1929 |
|[resnet50d.a1_in1k](https://huggingface.co/timm/resnet50d.a1_in1k)|288 |81.44|95.22|25.6 |7.2 |19.7 |1908 |
|[ecaresnet50t.ra2_in1k](https://huggingface.co/timm/ecaresnet50t.ra2_in1k)|256 |81.44|95.67|25.6 |5.6 |15.4 |2168 |
|[ecaresnetlight.miil_in1k](https://huggingface.co/timm/ecaresnetlight.miil_in1k)|288 |81.4 |95.82|30.2 |6.8 |13.9 |2132 |
|[resnet50d.ra2_in1k](https://huggingface.co/timm/resnet50d.ra2_in1k)|288 |81.37|95.74|25.6 |7.2 |19.7 |1910 |
|[resnet101.a2_in1k](https://huggingface.co/timm/resnet101.a2_in1k)|224 |81.32|95.19|44.6 |7.8 |16.2 |2125 |
|[seresnet50.ra2_in1k](https://huggingface.co/timm/seresnet50.ra2_in1k)|288 |81.3 |95.65|28.1 |6.8 |18.4 |1803 |
|[resnext50_32x4d.a2_in1k](https://huggingface.co/timm/resnext50_32x4d.a2_in1k)|288 |81.3 |95.11|25.0 |7.0 |23.8 |1746 |
|[seresnext50_32x4d.racm_in1k](https://huggingface.co/timm/seresnext50_32x4d.racm_in1k)|224 |81.27|95.62|27.6 |4.3 |14.4 |2591 |
|[ecaresnet50t.a1_in1k](https://huggingface.co/timm/ecaresnet50t.a1_in1k)|224 |81.26|95.16|25.6 |4.3 |11.8 |2823 |
|[gcresnext50ts.ch_in1k](https://huggingface.co/timm/gcresnext50ts.ch_in1k)|288 |81.23|95.54|15.7 |4.8 |19.6 |2117 |
|[senet154.gluon_in1k](https://huggingface.co/timm/senet154.gluon_in1k)|224 |81.23|95.35|115.1 |20.8 |38.7 |545 |
|[resnet50.a1_in1k](https://huggingface.co/timm/resnet50.a1_in1k)|288 |81.22|95.11|25.6 |6.8 |18.4 |2089 |
|[resnet50_gn.a1h_in1k](https://huggingface.co/timm/resnet50_gn.a1h_in1k)|288 |81.22|95.63|25.6 |6.8 |18.4 |676 |
|[resnet50d.a2_in1k](https://huggingface.co/timm/resnet50d.a2_in1k)|288 |81.18|95.09|25.6 |7.2 |19.7 |1908 |
|[resnet50.fb_swsl_ig1b_ft_in1k](https://huggingface.co/timm/resnet50.fb_swsl_ig1b_ft_in1k)|224 |81.18|95.98|25.6 |4.1 |11.1 |3455 |
|[resnext50_32x4d.tv2_in1k](https://huggingface.co/timm/resnext50_32x4d.tv2_in1k)|224 |81.17|95.34|25.0 |4.3 |14.4 |2933 |
|[resnext50_32x4d.a1h_in1k](https://huggingface.co/timm/resnext50_32x4d.a1h_in1k)|224 |81.1 |95.33|25.0 |4.3 |14.4 |2934 |
|[seresnet50.a2_in1k](https://huggingface.co/timm/seresnet50.a2_in1k)|288 |81.1 |95.23|28.1 |6.8 |18.4 |1801 |
|[seresnet50.a1_in1k](https://huggingface.co/timm/seresnet50.a1_in1k)|288 |81.1 |95.12|28.1 |6.8 |18.4 |1799 |
|[resnet152s.gluon_in1k](https://huggingface.co/timm/resnet152s.gluon_in1k)|224 |81.02|95.41|60.3 |12.9 |25.0 |1347 |
|[resnet50.d_in1k](https://huggingface.co/timm/resnet50.d_in1k)|288 |80.97|95.44|25.6 |6.8 |18.4 |2085 |
|[gcresnet50t.ra2_in1k](https://huggingface.co/timm/gcresnet50t.ra2_in1k)|256 |80.94|95.45|25.9 |5.4 |14.7 |2571 |
|[resnext101_32x4d.fb_ssl_yfcc100m_ft_in1k](https://huggingface.co/timm/resnext101_32x4d.fb_ssl_yfcc100m_ft_in1k)|224 |80.93|95.73|44.2 |8.0 |21.2 |1814 |
|[resnet50.c1_in1k](https://huggingface.co/timm/resnet50.c1_in1k)|288 |80.91|95.55|25.6 |6.8 |18.4 |2084 |
|[seresnext101_32x4d.gluon_in1k](https://huggingface.co/timm/seresnext101_32x4d.gluon_in1k)|224 |80.9 |95.31|49.0 |8.0 |21.3 |1585 |
|[seresnext101_64x4d.gluon_in1k](https://huggingface.co/timm/seresnext101_64x4d.gluon_in1k)|224 |80.9 |95.3 |88.2 |15.5 |31.2 |918 |
|[resnet50.c2_in1k](https://huggingface.co/timm/resnet50.c2_in1k)|288 |80.86|95.52|25.6 |6.8 |18.4 |2085 |
|[resnet50.tv2_in1k](https://huggingface.co/timm/resnet50.tv2_in1k)|224 |80.85|95.43|25.6 |4.1 |11.1 |3450 |
|[ecaresnet50t.a2_in1k](https://huggingface.co/timm/ecaresnet50t.a2_in1k)|224 |80.84|95.02|25.6 |4.3 |11.8 |2821 |
|[ecaresnet101d_pruned.miil_in1k](https://huggingface.co/timm/ecaresnet101d_pruned.miil_in1k)|224 |80.79|95.62|24.9 |3.5 |7.7 |2961 |
|[seresnet33ts.ra2_in1k](https://huggingface.co/timm/seresnet33ts.ra2_in1k)|288 |80.79|95.36|19.8 |6.0 |14.8 |2506 |
|[ecaresnet50d_pruned.miil_in1k](https://huggingface.co/timm/ecaresnet50d_pruned.miil_in1k)|288 |80.79|95.58|19.9 |4.2 |10.6 |2349 |
|[resnet50.a2_in1k](https://huggingface.co/timm/resnet50.a2_in1k)|288 |80.78|94.99|25.6 |6.8 |18.4 |2088 |
|[resnet50.b1k_in1k](https://huggingface.co/timm/resnet50.b1k_in1k)|288 |80.71|95.43|25.6 |6.8 |18.4 |2087 |
|[resnext50_32x4d.ra_in1k](https://huggingface.co/timm/resnext50_32x4d.ra_in1k)|288 |80.7 |95.39|25.0 |7.0 |23.8 |1749 |
|[resnetrs101.tf_in1k](https://huggingface.co/timm/resnetrs101.tf_in1k)|192 |80.69|95.24|63.6 |6.0 |12.7 |2270 |
|[resnet50d.a1_in1k](https://huggingface.co/timm/resnet50d.a1_in1k)|224 |80.68|94.71|25.6 |4.4 |11.9 |3162 |
|[eca_resnet33ts.ra2_in1k](https://huggingface.co/timm/eca_resnet33ts.ra2_in1k)|288 |80.68|95.36|19.7 |6.0 |14.8 |2637 |
|[resnet50.a1h_in1k](https://huggingface.co/timm/resnet50.a1h_in1k)|224 |80.67|95.3 |25.6 |4.1 |11.1 |3452 |
|[resnext50d_32x4d.bt_in1k](https://huggingface.co/timm/resnext50d_32x4d.bt_in1k)|288 |80.67|95.42|25.0 |7.4 |25.1 |1626 |
|[resnetaa50.a1h_in1k](https://huggingface.co/timm/resnetaa50.a1h_in1k)|224 |80.63|95.21|25.6 |5.2 |11.6 |3034 |
|[ecaresnet50d.miil_in1k](https://huggingface.co/timm/ecaresnet50d.miil_in1k)|224 |80.61|95.32|25.6 |4.4 |11.9 |2813 |
|[resnext101_64x4d.gluon_in1k](https://huggingface.co/timm/resnext101_64x4d.gluon_in1k)|224 |80.61|94.99|83.5 |15.5 |31.2 |989 |
|[gcresnet33ts.ra2_in1k](https://huggingface.co/timm/gcresnet33ts.ra2_in1k)|288 |80.6 |95.31|19.9 |6.0 |14.8 |2578 |
|[gcresnext50ts.ch_in1k](https://huggingface.co/timm/gcresnext50ts.ch_in1k)|256 |80.57|95.17|15.7 |3.8 |15.5 |2710 |
|[resnet152.a3_in1k](https://huggingface.co/timm/resnet152.a3_in1k)|224 |80.56|95.0 |60.2 |11.6 |22.6 |1483 |
|[resnet50d.ra2_in1k](https://huggingface.co/timm/resnet50d.ra2_in1k)|224 |80.53|95.16|25.6 |4.4 |11.9 |3164 |
|[resnext50_32x4d.a1_in1k](https://huggingface.co/timm/resnext50_32x4d.a1_in1k)|224 |80.53|94.46|25.0 |4.3 |14.4 |2930 |
|[wide_resnet101_2.tv2_in1k](https://huggingface.co/timm/wide_resnet101_2.tv2_in1k)|176 |80.48|94.98|126.9 |14.3 |13.2 |1719 |
|[resnet152d.gluon_in1k](https://huggingface.co/timm/resnet152d.gluon_in1k)|224 |80.47|95.2 |60.2 |11.8 |23.4 |1428 |
|[resnet50.b2k_in1k](https://huggingface.co/timm/resnet50.b2k_in1k)|288 |80.45|95.32|25.6 |6.8 |18.4 |2086 |
|[ecaresnetlight.miil_in1k](https://huggingface.co/timm/ecaresnetlight.miil_in1k)|224 |80.45|95.24|30.2 |4.1 |8.4 |3530 |
|[resnext50_32x4d.a2_in1k](https://huggingface.co/timm/resnext50_32x4d.a2_in1k)|224 |80.45|94.63|25.0 |4.3 |14.4 |2936 |
|[wide_resnet50_2.tv2_in1k](https://huggingface.co/timm/wide_resnet50_2.tv2_in1k)|176 |80.43|95.09|68.9 |7.3 |9.0 |3015 |
|[resnet101d.gluon_in1k](https://huggingface.co/timm/resnet101d.gluon_in1k)|224 |80.42|95.01|44.6 |8.1 |17.0 |2007 |
|[resnet50.a1_in1k](https://huggingface.co/timm/resnet50.a1_in1k)|224 |80.38|94.6 |25.6 |4.1 |11.1 |3461 |
|[seresnet33ts.ra2_in1k](https://huggingface.co/timm/seresnet33ts.ra2_in1k)|256 |80.36|95.1 |19.8 |4.8 |11.7 |3267 |
|[resnext101_32x4d.gluon_in1k](https://huggingface.co/timm/resnext101_32x4d.gluon_in1k)|224 |80.34|94.93|44.2 |8.0 |21.2 |1814 |
|[resnext50_32x4d.fb_ssl_yfcc100m_ft_in1k](https://huggingface.co/timm/resnext50_32x4d.fb_ssl_yfcc100m_ft_in1k)|224 |80.32|95.4 |25.0 |4.3 |14.4 |2941 |
|[resnet101s.gluon_in1k](https://huggingface.co/timm/resnet101s.gluon_in1k)|224 |80.28|95.16|44.7 |9.2 |18.6 |1851 |
|[seresnet50.ra2_in1k](https://huggingface.co/timm/seresnet50.ra2_in1k)|224 |80.26|95.08|28.1 |4.1 |11.1 |2972 |
|[resnetblur50.bt_in1k](https://huggingface.co/timm/resnetblur50.bt_in1k)|288 |80.24|95.24|25.6 |8.5 |19.9 |1523 |
|[resnet50d.a2_in1k](https://huggingface.co/timm/resnet50d.a2_in1k)|224 |80.22|94.63|25.6 |4.4 |11.9 |3162 |
|[resnet152.tv2_in1k](https://huggingface.co/timm/resnet152.tv2_in1k)|176 |80.2 |94.64|60.2 |7.2 |14.0 |2346 |
|[seresnet50.a2_in1k](https://huggingface.co/timm/seresnet50.a2_in1k)|224 |80.08|94.74|28.1 |4.1 |11.1 |2969 |
|[eca_resnet33ts.ra2_in1k](https://huggingface.co/timm/eca_resnet33ts.ra2_in1k)|256 |80.08|94.97|19.7 |4.8 |11.7 |3284 |
|[gcresnet33ts.ra2_in1k](https://huggingface.co/timm/gcresnet33ts.ra2_in1k)|256 |80.06|94.99|19.9 |4.8 |11.7 |3216 |
|[resnet50_gn.a1h_in1k](https://huggingface.co/timm/resnet50_gn.a1h_in1k)|224 |80.06|94.95|25.6 |4.1 |11.1 |1109 |
|[seresnet50.a1_in1k](https://huggingface.co/timm/seresnet50.a1_in1k)|224 |80.02|94.71|28.1 |4.1 |11.1 |2962 |
|[resnet50.ram_in1k](https://huggingface.co/timm/resnet50.ram_in1k)|288 |79.97|95.05|25.6 |6.8 |18.4 |2086 |
|[resnet152c.gluon_in1k](https://huggingface.co/timm/resnet152c.gluon_in1k)|224 |79.92|94.84|60.2 |11.8 |23.4 |1455 |
|[seresnext50_32x4d.gluon_in1k](https://huggingface.co/timm/seresnext50_32x4d.gluon_in1k)|224 |79.91|94.82|27.6 |4.3 |14.4 |2591 |
|[resnet50.d_in1k](https://huggingface.co/timm/resnet50.d_in1k)|224 |79.91|94.67|25.6 |4.1 |11.1 |3456 |
|[resnet101.tv2_in1k](https://huggingface.co/timm/resnet101.tv2_in1k)|176 |79.9 |94.6 |44.6 |4.9 |10.1 |3341 |
|[resnetrs50.tf_in1k](https://huggingface.co/timm/resnetrs50.tf_in1k)|224 |79.89|94.97|35.7 |4.5 |12.1 |2774 |
|[resnet50.c2_in1k](https://huggingface.co/timm/resnet50.c2_in1k)|224 |79.88|94.87|25.6 |4.1 |11.1 |3455 |
|[ecaresnet26t.ra2_in1k](https://huggingface.co/timm/ecaresnet26t.ra2_in1k)|320 |79.86|95.07|16.0 |5.2 |16.4 |2168 |
|[resnet50.a2_in1k](https://huggingface.co/timm/resnet50.a2_in1k)|224 |79.85|94.56|25.6 |4.1 |11.1 |3460 |
|[resnet50.ra_in1k](https://huggingface.co/timm/resnet50.ra_in1k)|288 |79.83|94.97|25.6 |6.8 |18.4 |2087 |
|[resnet101.a3_in1k](https://huggingface.co/timm/resnet101.a3_in1k)|224 |79.82|94.62|44.6 |7.8 |16.2 |2114 |
|[resnext50_32x4d.ra_in1k](https://huggingface.co/timm/resnext50_32x4d.ra_in1k)|224 |79.76|94.6 |25.0 |4.3 |14.4 |2943 |
|[resnet50.c1_in1k](https://huggingface.co/timm/resnet50.c1_in1k)|224 |79.74|94.95|25.6 |4.1 |11.1 |3455 |
|[ecaresnet50d_pruned.miil_in1k](https://huggingface.co/timm/ecaresnet50d_pruned.miil_in1k)|224 |79.74|94.87|19.9 |2.5 |6.4 |3929 |
|[resnet33ts.ra2_in1k](https://huggingface.co/timm/resnet33ts.ra2_in1k)|288 |79.71|94.83|19.7 |6.0 |14.8 |2710 |
|[resnet152.gluon_in1k](https://huggingface.co/timm/resnet152.gluon_in1k)|224 |79.68|94.74|60.2 |11.6 |22.6 |1486 |
|[resnext50d_32x4d.bt_in1k](https://huggingface.co/timm/resnext50d_32x4d.bt_in1k)|224 |79.67|94.87|25.0 |4.5 |15.2 |2729 |
|[resnet50.bt_in1k](https://huggingface.co/timm/resnet50.bt_in1k)|288 |79.63|94.91|25.6 |6.8 |18.4 |2086 |
|[ecaresnet50t.a3_in1k](https://huggingface.co/timm/ecaresnet50t.a3_in1k)|224 |79.56|94.72|25.6 |4.3 |11.8 |2805 |
|[resnet101c.gluon_in1k](https://huggingface.co/timm/resnet101c.gluon_in1k)|224 |79.53|94.58|44.6 |8.1 |17.0 |2062 |
|[resnet50.b1k_in1k](https://huggingface.co/timm/resnet50.b1k_in1k)|224 |79.52|94.61|25.6 |4.1 |11.1 |3459 |
|[resnet50.tv2_in1k](https://huggingface.co/timm/resnet50.tv2_in1k)|176 |79.42|94.64|25.6 |2.6 |6.9 |5397 |
|[resnet32ts.ra2_in1k](https://huggingface.co/timm/resnet32ts.ra2_in1k)|288 |79.4 |94.66|18.0 |5.9 |14.6 |2752 |
|[resnet50.b2k_in1k](https://huggingface.co/timm/resnet50.b2k_in1k)|224 |79.38|94.57|25.6 |4.1 |11.1 |3459 |
|[resnext50_32x4d.tv2_in1k](https://huggingface.co/timm/resnext50_32x4d.tv2_in1k)|176 |79.37|94.3 |25.0 |2.7 |9.0 |4577 |
|[resnext50_32x4d.gluon_in1k](https://huggingface.co/timm/resnext50_32x4d.gluon_in1k)|224 |79.36|94.43|25.0 |4.3 |14.4 |2942 |
|[resnext101_32x8d.tv_in1k](https://huggingface.co/timm/resnext101_32x8d.tv_in1k)|224 |79.31|94.52|88.8 |16.5 |31.2 |1100 |
|[resnet101.gluon_in1k](https://huggingface.co/timm/resnet101.gluon_in1k)|224 |79.31|94.53|44.6 |7.8 |16.2 |2125 |
|[resnetblur50.bt_in1k](https://huggingface.co/timm/resnetblur50.bt_in1k)|224 |79.31|94.63|25.6 |5.2 |12.0 |2524 |
|[resnet50.a1h_in1k](https://huggingface.co/timm/resnet50.a1h_in1k)|176 |79.27|94.49|25.6 |2.6 |6.9 |5404 |
|[resnext50_32x4d.a3_in1k](https://huggingface.co/timm/resnext50_32x4d.a3_in1k)|224 |79.25|94.31|25.0 |4.3 |14.4 |2931 |
|[resnet50.fb_ssl_yfcc100m_ft_in1k](https://huggingface.co/timm/resnet50.fb_ssl_yfcc100m_ft_in1k)|224 |79.22|94.84|25.6 |4.1 |11.1 |3451 |
|[resnet33ts.ra2_in1k](https://huggingface.co/timm/resnet33ts.ra2_in1k)|256 |79.21|94.56|19.7 |4.8 |11.7 |3392 |
|[resnet50d.gluon_in1k](https://huggingface.co/timm/resnet50d.gluon_in1k)|224 |79.07|94.48|25.6 |4.4 |11.9 |3162 |
|[resnet50.ram_in1k](https://huggingface.co/timm/resnet50.ram_in1k)|224 |79.03|94.38|25.6 |4.1 |11.1 |3453 |
|[resnet50.am_in1k](https://huggingface.co/timm/resnet50.am_in1k)|224 |79.01|94.39|25.6 |4.1 |11.1 |3461 |
|[resnet32ts.ra2_in1k](https://huggingface.co/timm/resnet32ts.ra2_in1k)|256 |79.01|94.37|18.0 |4.6 |11.6 |3440 |
|[ecaresnet26t.ra2_in1k](https://huggingface.co/timm/ecaresnet26t.ra2_in1k)|256 |78.9 |94.54|16.0 |3.4 |10.5 |3421 |
|[resnet152.a3_in1k](https://huggingface.co/timm/resnet152.a3_in1k)|160 |78.89|94.11|60.2 |5.9 |11.5 |2745 |
|[wide_resnet101_2.tv_in1k](https://huggingface.co/timm/wide_resnet101_2.tv_in1k)|224 |78.84|94.28|126.9 |22.8 |21.2 |1079 |
|[seresnext26d_32x4d.bt_in1k](https://huggingface.co/timm/seresnext26d_32x4d.bt_in1k)|288 |78.83|94.24|16.8 |4.5 |16.8 |2251 |
|[resnet50.ra_in1k](https://huggingface.co/timm/resnet50.ra_in1k)|224 |78.81|94.32|25.6 |4.1 |11.1 |3454 |
|[seresnext26t_32x4d.bt_in1k](https://huggingface.co/timm/seresnext26t_32x4d.bt_in1k)|288 |78.74|94.33|16.8 |4.5 |16.7 |2264 |
|[resnet50s.gluon_in1k](https://huggingface.co/timm/resnet50s.gluon_in1k)|224 |78.72|94.23|25.7 |5.5 |13.5 |2796 |
|[resnet50d.a3_in1k](https://huggingface.co/timm/resnet50d.a3_in1k)|224 |78.71|94.24|25.6 |4.4 |11.9 |3154 |
|[wide_resnet50_2.tv_in1k](https://huggingface.co/timm/wide_resnet50_2.tv_in1k)|224 |78.47|94.09|68.9 |11.4 |14.4 |1934 |
|[resnet50.bt_in1k](https://huggingface.co/timm/resnet50.bt_in1k)|224 |78.46|94.27|25.6 |4.1 |11.1 |3454 |
|[resnet34d.ra2_in1k](https://huggingface.co/timm/resnet34d.ra2_in1k)|288 |78.43|94.35|21.8 |6.5 |7.5 |3291 |
|[gcresnext26ts.ch_in1k](https://huggingface.co/timm/gcresnext26ts.ch_in1k)|288 |78.42|94.04|10.5 |3.1 |13.3 |3226 |
|[resnet26t.ra2_in1k](https://huggingface.co/timm/resnet26t.ra2_in1k)|320 |78.33|94.13|16.0 |5.2 |16.4 |2391 |
|[resnet152.tv_in1k](https://huggingface.co/timm/resnet152.tv_in1k)|224 |78.32|94.04|60.2 |11.6 |22.6 |1487 |
|[seresnext26ts.ch_in1k](https://huggingface.co/timm/seresnext26ts.ch_in1k)|288 |78.28|94.1 |10.4 |3.1 |13.3 |3062 |
|[bat_resnext26ts.ch_in1k](https://huggingface.co/timm/bat_resnext26ts.ch_in1k)|256 |78.25|94.1 |10.7 |2.5 |12.5 |3393 |
|[resnet50.a3_in1k](https://huggingface.co/timm/resnet50.a3_in1k)|224 |78.06|93.78|25.6 |4.1 |11.1 |3450 |
|[resnet50c.gluon_in1k](https://huggingface.co/timm/resnet50c.gluon_in1k)|224 |78.0 |93.99|25.6 |4.4 |11.9 |3286 |
|[eca_resnext26ts.ch_in1k](https://huggingface.co/timm/eca_resnext26ts.ch_in1k)|288 |78.0 |93.91|10.3 |3.1 |13.3 |3297 |
|[seresnext26t_32x4d.bt_in1k](https://huggingface.co/timm/seresnext26t_32x4d.bt_in1k)|224 |77.98|93.75|16.8 |2.7 |10.1 |3841 |
|[resnet34.a1_in1k](https://huggingface.co/timm/resnet34.a1_in1k)|288 |77.92|93.77|21.8 |6.1 |6.2 |3609 |
|[resnet101.a3_in1k](https://huggingface.co/timm/resnet101.a3_in1k)|160 |77.88|93.71|44.6 |4.0 |8.3 |3926 |
|[resnet26t.ra2_in1k](https://huggingface.co/timm/resnet26t.ra2_in1k)|256 |77.87|93.84|16.0 |3.4 |10.5 |3772 |
|[seresnext26ts.ch_in1k](https://huggingface.co/timm/seresnext26ts.ch_in1k)|256 |77.86|93.79|10.4 |2.4 |10.5 |4263 |
|[resnetrs50.tf_in1k](https://huggingface.co/timm/resnetrs50.tf_in1k)|160 |77.82|93.81|35.7 |2.3 |6.2 |5238 |
|[gcresnext26ts.ch_in1k](https://huggingface.co/timm/gcresnext26ts.ch_in1k)|256 |77.81|93.82|10.5 |2.4 |10.5 |4183 |
|[ecaresnet50t.a3_in1k](https://huggingface.co/timm/ecaresnet50t.a3_in1k)|160 |77.79|93.6 |25.6 |2.2 |6.0 |5329 |
|[resnext50_32x4d.a3_in1k](https://huggingface.co/timm/resnext50_32x4d.a3_in1k)|160 |77.73|93.32|25.0 |2.2 |7.4 |5576 |
|[resnext50_32x4d.tv_in1k](https://huggingface.co/timm/resnext50_32x4d.tv_in1k)|224 |77.61|93.7 |25.0 |4.3 |14.4 |2944 |
|[seresnext26d_32x4d.bt_in1k](https://huggingface.co/timm/seresnext26d_32x4d.bt_in1k)|224 |77.59|93.61|16.8 |2.7 |10.2 |3807 |
|[resnet50.gluon_in1k](https://huggingface.co/timm/resnet50.gluon_in1k)|224 |77.58|93.72|25.6 |4.1 |11.1 |3455 |
|[eca_resnext26ts.ch_in1k](https://huggingface.co/timm/eca_resnext26ts.ch_in1k)|256 |77.44|93.56|10.3 |2.4 |10.5 |4284 |
|[resnet26d.bt_in1k](https://huggingface.co/timm/resnet26d.bt_in1k)|288 |77.41|93.63|16.0 |4.3 |13.5 |2907 |
|[resnet101.tv_in1k](https://huggingface.co/timm/resnet101.tv_in1k)|224 |77.38|93.54|44.6 |7.8 |16.2 |2125 |
|[resnet50d.a3_in1k](https://huggingface.co/timm/resnet50d.a3_in1k)|160 |77.22|93.27|25.6 |2.2 |6.1 |5982 |
|[resnext26ts.ra2_in1k](https://huggingface.co/timm/resnext26ts.ra2_in1k)|288 |77.17|93.47|10.3 |3.1 |13.3 |3392 |
|[resnet34.a2_in1k](https://huggingface.co/timm/resnet34.a2_in1k)|288 |77.15|93.27|21.8 |6.1 |6.2 |3615 |
|[resnet34d.ra2_in1k](https://huggingface.co/timm/resnet34d.ra2_in1k)|224 |77.1 |93.37|21.8 |3.9 |4.5 |5436 |
|[seresnet50.a3_in1k](https://huggingface.co/timm/seresnet50.a3_in1k)|224 |77.02|93.07|28.1 |4.1 |11.1 |2952 |
|[resnext26ts.ra2_in1k](https://huggingface.co/timm/resnext26ts.ra2_in1k)|256 |76.78|93.13|10.3 |2.4 |10.5 |4410 |
|[resnet26d.bt_in1k](https://huggingface.co/timm/resnet26d.bt_in1k)|224 |76.7 |93.17|16.0 |2.6 |8.2 |4859 |
|[resnet34.bt_in1k](https://huggingface.co/timm/resnet34.bt_in1k)|288 |76.5 |93.35|21.8 |6.1 |6.2 |3617 |
|[resnet34.a1_in1k](https://huggingface.co/timm/resnet34.a1_in1k)|224 |76.42|92.87|21.8 |3.7 |3.7 |5984 |
|[resnet26.bt_in1k](https://huggingface.co/timm/resnet26.bt_in1k)|288 |76.35|93.18|16.0 |3.9 |12.2 |3331 |
|[resnet50.tv_in1k](https://huggingface.co/timm/resnet50.tv_in1k)|224 |76.13|92.86|25.6 |4.1 |11.1 |3457 |
|[resnet50.a3_in1k](https://huggingface.co/timm/resnet50.a3_in1k)|160 |75.96|92.5 |25.6 |2.1 |5.7 |6490 |
|[resnet34.a2_in1k](https://huggingface.co/timm/resnet34.a2_in1k)|224 |75.52|92.44|21.8 |3.7 |3.7 |5991 |
|[resnet26.bt_in1k](https://huggingface.co/timm/resnet26.bt_in1k)|224 |75.3 |92.58|16.0 |2.4 |7.4 |5583 |
|[resnet34.bt_in1k](https://huggingface.co/timm/resnet34.bt_in1k)|224 |75.16|92.18|21.8 |3.7 |3.7 |5994 |
|[seresnet50.a3_in1k](https://huggingface.co/timm/seresnet50.a3_in1k)|160 |75.1 |92.08|28.1 |2.1 |5.7 |5513 |
|[resnet34.gluon_in1k](https://huggingface.co/timm/resnet34.gluon_in1k)|224 |74.57|91.98|21.8 |3.7 |3.7 |5984 |
|[resnet18d.ra2_in1k](https://huggingface.co/timm/resnet18d.ra2_in1k)|288 |73.81|91.83|11.7 |3.4 |5.4 |5196 |
|[resnet34.tv_in1k](https://huggingface.co/timm/resnet34.tv_in1k)|224 |73.32|91.42|21.8 |3.7 |3.7 |5979 |
|[resnet18.fb_swsl_ig1b_ft_in1k](https://huggingface.co/timm/resnet18.fb_swsl_ig1b_ft_in1k)|224 |73.28|91.73|11.7 |1.8 |2.5 |10213 |
|[resnet18.a1_in1k](https://huggingface.co/timm/resnet18.a1_in1k)|288 |73.16|91.03|11.7 |3.0 |4.1 |6050 |
|[resnet34.a3_in1k](https://huggingface.co/timm/resnet34.a3_in1k)|224 |72.98|91.11|21.8 |3.7 |3.7 |5967 |
|[resnet18.fb_ssl_yfcc100m_ft_in1k](https://huggingface.co/timm/resnet18.fb_ssl_yfcc100m_ft_in1k)|224 |72.6 |91.42|11.7 |1.8 |2.5 |10213 |
|[resnet18.a2_in1k](https://huggingface.co/timm/resnet18.a2_in1k)|288 |72.37|90.59|11.7 |3.0 |4.1 |6051 |
|[resnet14t.c3_in1k](https://huggingface.co/timm/resnet14t.c3_in1k)|224 |72.26|90.31|10.1 |1.7 |5.8 |7026 |
|[resnet18d.ra2_in1k](https://huggingface.co/timm/resnet18d.ra2_in1k)|224 |72.26|90.68|11.7 |2.1 |3.3 |8707 |
|[resnet18.a1_in1k](https://huggingface.co/timm/resnet18.a1_in1k)|224 |71.49|90.07|11.7 |1.8 |2.5 |10187 |
|[resnet14t.c3_in1k](https://huggingface.co/timm/resnet14t.c3_in1k)|176 |71.31|89.69|10.1 |1.1 |3.6 |10970 |
|[resnet18.gluon_in1k](https://huggingface.co/timm/resnet18.gluon_in1k)|224 |70.84|89.76|11.7 |1.8 |2.5 |10210 |
|[resnet18.a2_in1k](https://huggingface.co/timm/resnet18.a2_in1k)|224 |70.64|89.47|11.7 |1.8 |2.5 |10194 |
|[resnet34.a3_in1k](https://huggingface.co/timm/resnet34.a3_in1k)|160 |70.56|89.52|21.8 |1.9 |1.9 |10737 |
|[resnet18.tv_in1k](https://huggingface.co/timm/resnet18.tv_in1k)|224 |69.76|89.07|11.7 |1.8 |2.5 |10205 |
|[resnet10t.c3_in1k](https://huggingface.co/timm/resnet10t.c3_in1k)|224 |68.34|88.03|5.4 |1.1 |2.4 |13079 |
|[resnet18.a3_in1k](https://huggingface.co/timm/resnet18.a3_in1k)|224 |68.25|88.17|11.7 |1.8 |2.5 |10167 |
|[resnet10t.c3_in1k](https://huggingface.co/timm/resnet10t.c3_in1k)|176 |66.71|86.96|5.4 |0.7 |1.5 |20327 |
|[resnet18.a3_in1k](https://huggingface.co/timm/resnet18.a3_in1k)|160 |65.66|86.26|11.7 |0.9 |1.3 |18229 |
## Citation
```bibtex
@article{Xie2016,
title={Aggregated Residual Transformations for Deep Neural Networks},
author={Saining Xie and Ross Girshick and Piotr Dollár and Zhuowen Tu and Kaiming He},
journal={arXiv preprint arXiv:1611.05431},
year={2016}
}
```
```bibtex
@article{He2015,
author = {Kaiming He and Xiangyu Zhang and Shaoqing Ren and Jian Sun},
title = {Deep Residual Learning for Image Recognition},
journal = {arXiv preprint arXiv:1512.03385},
year = {2015}
}
```
```bibtex
@inproceedings{hu2018senet,
title={Squeeze-and-Excitation Networks},
author={Jie Hu and Li Shen and Gang Sun},
journal={IEEE Conference on Computer Vision and Pattern Recognition},
year={2018}
}
```
```bibtex
@article{He2018BagOT,
title={Bag of Tricks for Image Classification with Convolutional Neural Networks},
author={Tong He and Zhi Zhang and Hang Zhang and Zhongyue Zhang and Junyuan Xie and Mu Li},
journal={2019 IEEE/CVF Conference on Computer Vision and Pattern Recognition (CVPR)},
year={2018},
pages={558-567}
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
| 39,180 | [
[
-0.064453125,
-0.019561767578125,
0.00481414794921875,
0.0277862548828125,
-0.03192138671875,
-0.009246826171875,
-0.00982666015625,
-0.034423828125,
0.0836181640625,
0.018218994140625,
-0.0460205078125,
-0.038299560546875,
-0.048004150390625,
-0.00244903564... |
smp111/terrain_recognition | 2023-10-17T18:36:19.000Z | [
"transformers",
"pytorch",
"tensorboard",
"vit",
"image-classification",
"huggingpics",
"model-index",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | image-classification | smp111 | null | null | smp111/terrain_recognition | 0 | 890 | transformers | 2023-10-17T18:36:13 | ---
tags:
- image-classification
- pytorch
- huggingpics
metrics:
- accuracy
model-index:
- name: terrain_recognition
results:
- task:
name: Image Classification
type: image-classification
metrics:
- name: Accuracy
type: accuracy
value: 0.8777777552604675
---
# terrain_recognition
Autogenerated by HuggingPics🤗🖼️
Create your own image classifier for **anything** by running [the demo on Google Colab](https://colab.research.google.com/github/nateraw/huggingpics/blob/main/HuggingPics.ipynb).
Report any issues with the demo at the [github repo](https://github.com/nateraw/huggingpics).
## Example Images
#### grassy

#### marshy

#### rocky

#### sandy
 | 821 | [
[
-0.05419921875,
-0.0526123046875,
0.030487060546875,
0.04315185546875,
-0.031982421875,
0.01329803466796875,
0.019744873046875,
-0.0252838134765625,
0.0299224853515625,
0.0237884521484375,
-0.03448486328125,
-0.07080078125,
-0.053558349609375,
-0.01100921630... |
WillHeld/roberta-base-rte | 2022-09-18T01:30:13.000Z | [
"transformers",
"pytorch",
"roberta",
"text-classification",
"generated_from_trainer",
"en",
"dataset:glue",
"license:mit",
"model-index",
"endpoints_compatible",
"region:us"
] | text-classification | WillHeld | null | null | WillHeld/roberta-base-rte | 0 | 889 | transformers | 2022-09-18T01:22:21 | ---
language:
- en
license: mit
tags:
- generated_from_trainer
datasets:
- glue
metrics:
- accuracy
model-index:
- name: roberta-base-rte
results:
- task:
name: Text Classification
type: text-classification
dataset:
name: GLUE RTE
type: glue
args: rte
metrics:
- name: Accuracy
type: accuracy
value: 0.7581227436823105
---
<!-- This model card has been generated automatically according to the information the Trainer had access to. You
should probably proofread and complete it, then remove this comment. -->
# roberta-base-rte
This model is a fine-tuned version of [roberta-base](https://huggingface.co/roberta-base) on the GLUE RTE dataset.
It achieves the following results on the evaluation set:
- Loss: 0.7660
- Accuracy: 0.7581
## Model description
More information needed
## Intended uses & limitations
More information needed
## Training and evaluation data
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 2e-05
- train_batch_size: 16
- eval_batch_size: 8
- seed: 42
- optimizer: Adam with betas=(0.9,0.999) and epsilon=1e-08
- lr_scheduler_type: linear
- lr_scheduler_warmup_ratio: 0.06
- num_epochs: 10.0
### Training results
| Training Loss | Epoch | Step | Validation Loss | Accuracy |
|:-------------:|:-----:|:----:|:---------------:|:--------:|
| 0.551 | 3.21 | 500 | 0.7660 | 0.7581 |
| 0.1665 | 6.41 | 1000 | 1.5218 | 0.7690 |
| 0.0463 | 9.62 | 1500 | 1.6747 | 0.7653 |
### Framework versions
- Transformers 4.21.3
- Pytorch 1.7.1
- Datasets 1.18.3
- Tokenizers 0.11.6
| 1,722 | [
[
-0.0220947265625,
-0.055938720703125,
0.01250457763671875,
0.0114288330078125,
-0.0222320556640625,
-0.03790283203125,
-0.021209716796875,
-0.01551055908203125,
0.0094757080078125,
0.0279083251953125,
-0.048583984375,
-0.049285888671875,
-0.061798095703125,
... |
timm/maxvit_rmlp_base_rw_384.sw_in12k_ft_in1k | 2023-05-11T00:18:46.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"dataset:imagenet-12k",
"arxiv:2204.01697",
"arxiv:2111.09883",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/maxvit_rmlp_base_rw_384.sw_in12k_ft_in1k | 0 | 889 | timm | 2023-01-20T21:33:19 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
- imagenet-12k
---
# Model card for maxvit_rmlp_base_rw_384.sw_in12k_ft_in1k
A timm specific MaxViT (w/ a MLP Log-CPB (continuous log-coordinate relative position bias motivated by Swin-V2) image classification model. Pretrained in `timm` on ImageNet-12k (a 11821 class subset of full ImageNet-22k) and fine-tuned on ImageNet-1k by Ross Wightman.
ImageNet-12k pretraining and ImageNet-1k fine-tuning performed on 8x GPU [Lambda Labs](https://lambdalabs.com/) cloud instances..
### Model Variants in [maxxvit.py](https://github.com/huggingface/pytorch-image-models/blob/main/timm/models/maxxvit.py)
MaxxViT covers a number of related model architectures that share a common structure including:
- CoAtNet - Combining MBConv (depthwise-separable) convolutional blocks in early stages with self-attention transformer blocks in later stages.
- MaxViT - Uniform blocks across all stages, each containing a MBConv (depthwise-separable) convolution block followed by two self-attention blocks with different partitioning schemes (window followed by grid).
- CoAtNeXt - A timm specific arch that uses ConvNeXt blocks in place of MBConv blocks in CoAtNet. All normalization layers are LayerNorm (no BatchNorm).
- MaxxViT - A timm specific arch that uses ConvNeXt blocks in place of MBConv blocks in MaxViT. All normalization layers are LayerNorm (no BatchNorm).
- MaxxViT-V2 - A MaxxViT variation that removes the window block attention leaving only ConvNeXt blocks and grid attention w/ more width to compensate.
Aside from the major variants listed above, there are more subtle changes from model to model. Any model name with the string `rw` are `timm` specific configs w/ modelling adjustments made to favour PyTorch eager use. These were created while training initial reproductions of the models so there are variations.
All models with the string `tf` are models exactly matching Tensorflow based models by the original paper authors with weights ported to PyTorch. This covers a number of MaxViT models. The official CoAtNet models were never released.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 116.1
- GMACs: 71.0
- Activations (M): 318.9
- Image size: 384 x 384
- **Papers:**
- MaxViT: Multi-Axis Vision Transformer: https://arxiv.org/abs/2204.01697
- Swin Transformer V2: Scaling Up Capacity and Resolution: https://arxiv.org/abs/2111.09883
- **Dataset:** ImageNet-1k
- **Pretrain Dataset:** ImageNet-12k
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('maxvit_rmlp_base_rw_384.sw_in12k_ft_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'maxvit_rmlp_base_rw_384.sw_in12k_ft_in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 64, 192, 192])
# torch.Size([1, 96, 96, 96])
# torch.Size([1, 192, 48, 48])
# torch.Size([1, 384, 24, 24])
# torch.Size([1, 768, 12, 12])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'maxvit_rmlp_base_rw_384.sw_in12k_ft_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 768, 12, 12) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
### By Top-1
|model |top1 |top5 |samples / sec |Params (M) |GMAC |Act (M)|
|------------------------------------------------------------------------------------------------------------------------|----:|----:|--------------:|--------------:|-----:|------:|
|[maxvit_xlarge_tf_512.in21k_ft_in1k](https://huggingface.co/timm/maxvit_xlarge_tf_512.in21k_ft_in1k) |88.53|98.64| 21.76| 475.77|534.14|1413.22|
|[maxvit_xlarge_tf_384.in21k_ft_in1k](https://huggingface.co/timm/maxvit_xlarge_tf_384.in21k_ft_in1k) |88.32|98.54| 42.53| 475.32|292.78| 668.76|
|[maxvit_base_tf_512.in21k_ft_in1k](https://huggingface.co/timm/maxvit_base_tf_512.in21k_ft_in1k) |88.20|98.53| 50.87| 119.88|138.02| 703.99|
|[maxvit_large_tf_512.in21k_ft_in1k](https://huggingface.co/timm/maxvit_large_tf_512.in21k_ft_in1k) |88.04|98.40| 36.42| 212.33|244.75| 942.15|
|[maxvit_large_tf_384.in21k_ft_in1k](https://huggingface.co/timm/maxvit_large_tf_384.in21k_ft_in1k) |87.98|98.56| 71.75| 212.03|132.55| 445.84|
|[maxvit_base_tf_384.in21k_ft_in1k](https://huggingface.co/timm/maxvit_base_tf_384.in21k_ft_in1k) |87.92|98.54| 104.71| 119.65| 73.80| 332.90|
|[maxvit_rmlp_base_rw_384.sw_in12k_ft_in1k](https://huggingface.co/timm/maxvit_rmlp_base_rw_384.sw_in12k_ft_in1k) |87.81|98.37| 106.55| 116.14| 70.97| 318.95|
|[maxxvitv2_rmlp_base_rw_384.sw_in12k_ft_in1k](https://huggingface.co/timm/maxxvitv2_rmlp_base_rw_384.sw_in12k_ft_in1k) |87.47|98.37| 149.49| 116.09| 72.98| 213.74|
|[coatnet_rmlp_2_rw_384.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_rmlp_2_rw_384.sw_in12k_ft_in1k) |87.39|98.31| 160.80| 73.88| 47.69| 209.43|
|[maxvit_rmlp_base_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/maxvit_rmlp_base_rw_224.sw_in12k_ft_in1k) |86.89|98.02| 375.86| 116.14| 23.15| 92.64|
|[maxxvitv2_rmlp_base_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/maxxvitv2_rmlp_base_rw_224.sw_in12k_ft_in1k) |86.64|98.02| 501.03| 116.09| 24.20| 62.77|
|[maxvit_base_tf_512.in1k](https://huggingface.co/timm/maxvit_base_tf_512.in1k) |86.60|97.92| 50.75| 119.88|138.02| 703.99|
|[coatnet_2_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_2_rw_224.sw_in12k_ft_in1k) |86.57|97.89| 631.88| 73.87| 15.09| 49.22|
|[maxvit_large_tf_512.in1k](https://huggingface.co/timm/maxvit_large_tf_512.in1k) |86.52|97.88| 36.04| 212.33|244.75| 942.15|
|[coatnet_rmlp_2_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_rmlp_2_rw_224.sw_in12k_ft_in1k) |86.49|97.90| 620.58| 73.88| 15.18| 54.78|
|[maxvit_base_tf_384.in1k](https://huggingface.co/timm/maxvit_base_tf_384.in1k) |86.29|97.80| 101.09| 119.65| 73.80| 332.90|
|[maxvit_large_tf_384.in1k](https://huggingface.co/timm/maxvit_large_tf_384.in1k) |86.23|97.69| 70.56| 212.03|132.55| 445.84|
|[maxvit_small_tf_512.in1k](https://huggingface.co/timm/maxvit_small_tf_512.in1k) |86.10|97.76| 88.63| 69.13| 67.26| 383.77|
|[maxvit_tiny_tf_512.in1k](https://huggingface.co/timm/maxvit_tiny_tf_512.in1k) |85.67|97.58| 144.25| 31.05| 33.49| 257.59|
|[maxvit_small_tf_384.in1k](https://huggingface.co/timm/maxvit_small_tf_384.in1k) |85.54|97.46| 188.35| 69.02| 35.87| 183.65|
|[maxvit_tiny_tf_384.in1k](https://huggingface.co/timm/maxvit_tiny_tf_384.in1k) |85.11|97.38| 293.46| 30.98| 17.53| 123.42|
|[maxvit_large_tf_224.in1k](https://huggingface.co/timm/maxvit_large_tf_224.in1k) |84.93|96.97| 247.71| 211.79| 43.68| 127.35|
|[coatnet_rmlp_1_rw2_224.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_rmlp_1_rw2_224.sw_in12k_ft_in1k) |84.90|96.96| 1025.45| 41.72| 8.11| 40.13|
|[maxvit_base_tf_224.in1k](https://huggingface.co/timm/maxvit_base_tf_224.in1k) |84.85|96.99| 358.25| 119.47| 24.04| 95.01|
|[maxxvit_rmlp_small_rw_256.sw_in1k](https://huggingface.co/timm/maxxvit_rmlp_small_rw_256.sw_in1k) |84.63|97.06| 575.53| 66.01| 14.67| 58.38|
|[coatnet_rmlp_2_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_rmlp_2_rw_224.sw_in1k) |84.61|96.74| 625.81| 73.88| 15.18| 54.78|
|[maxvit_rmlp_small_rw_224.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_small_rw_224.sw_in1k) |84.49|96.76| 693.82| 64.90| 10.75| 49.30|
|[maxvit_small_tf_224.in1k](https://huggingface.co/timm/maxvit_small_tf_224.in1k) |84.43|96.83| 647.96| 68.93| 11.66| 53.17|
|[maxvit_rmlp_tiny_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_tiny_rw_256.sw_in1k) |84.23|96.78| 807.21| 29.15| 6.77| 46.92|
|[coatnet_1_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_1_rw_224.sw_in1k) |83.62|96.38| 989.59| 41.72| 8.04| 34.60|
|[maxvit_tiny_rw_224.sw_in1k](https://huggingface.co/timm/maxvit_tiny_rw_224.sw_in1k) |83.50|96.50| 1100.53| 29.06| 5.11| 33.11|
|[maxvit_tiny_tf_224.in1k](https://huggingface.co/timm/maxvit_tiny_tf_224.in1k) |83.41|96.59| 1004.94| 30.92| 5.60| 35.78|
|[coatnet_rmlp_1_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_rmlp_1_rw_224.sw_in1k) |83.36|96.45| 1093.03| 41.69| 7.85| 35.47|
|[maxxvitv2_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxxvitv2_nano_rw_256.sw_in1k) |83.11|96.33| 1276.88| 23.70| 6.26| 23.05|
|[maxxvit_rmlp_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxxvit_rmlp_nano_rw_256.sw_in1k) |83.03|96.34| 1341.24| 16.78| 4.37| 26.05|
|[maxvit_rmlp_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_nano_rw_256.sw_in1k) |82.96|96.26| 1283.24| 15.50| 4.47| 31.92|
|[maxvit_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_nano_rw_256.sw_in1k) |82.93|96.23| 1218.17| 15.45| 4.46| 30.28|
|[coatnet_bn_0_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_bn_0_rw_224.sw_in1k) |82.39|96.19| 1600.14| 27.44| 4.67| 22.04|
|[coatnet_0_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_0_rw_224.sw_in1k) |82.39|95.84| 1831.21| 27.44| 4.43| 18.73|
|[coatnet_rmlp_nano_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_rmlp_nano_rw_224.sw_in1k) |82.05|95.87| 2109.09| 15.15| 2.62| 20.34|
|[coatnext_nano_rw_224.sw_in1k](https://huggingface.co/timm/coatnext_nano_rw_224.sw_in1k) |81.95|95.92| 2525.52| 14.70| 2.47| 12.80|
|[coatnet_nano_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_nano_rw_224.sw_in1k) |81.70|95.64| 2344.52| 15.14| 2.41| 15.41|
|[maxvit_rmlp_pico_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_pico_rw_256.sw_in1k) |80.53|95.21| 1594.71| 7.52| 1.85| 24.86|
### By Throughput (samples / sec)
|model |top1 |top5 |samples / sec |Params (M) |GMAC |Act (M)|
|------------------------------------------------------------------------------------------------------------------------|----:|----:|--------------:|--------------:|-----:|------:|
|[coatnext_nano_rw_224.sw_in1k](https://huggingface.co/timm/coatnext_nano_rw_224.sw_in1k) |81.95|95.92| 2525.52| 14.70| 2.47| 12.80|
|[coatnet_nano_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_nano_rw_224.sw_in1k) |81.70|95.64| 2344.52| 15.14| 2.41| 15.41|
|[coatnet_rmlp_nano_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_rmlp_nano_rw_224.sw_in1k) |82.05|95.87| 2109.09| 15.15| 2.62| 20.34|
|[coatnet_0_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_0_rw_224.sw_in1k) |82.39|95.84| 1831.21| 27.44| 4.43| 18.73|
|[coatnet_bn_0_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_bn_0_rw_224.sw_in1k) |82.39|96.19| 1600.14| 27.44| 4.67| 22.04|
|[maxvit_rmlp_pico_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_pico_rw_256.sw_in1k) |80.53|95.21| 1594.71| 7.52| 1.85| 24.86|
|[maxxvit_rmlp_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxxvit_rmlp_nano_rw_256.sw_in1k) |83.03|96.34| 1341.24| 16.78| 4.37| 26.05|
|[maxvit_rmlp_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_nano_rw_256.sw_in1k) |82.96|96.26| 1283.24| 15.50| 4.47| 31.92|
|[maxxvitv2_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxxvitv2_nano_rw_256.sw_in1k) |83.11|96.33| 1276.88| 23.70| 6.26| 23.05|
|[maxvit_nano_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_nano_rw_256.sw_in1k) |82.93|96.23| 1218.17| 15.45| 4.46| 30.28|
|[maxvit_tiny_rw_224.sw_in1k](https://huggingface.co/timm/maxvit_tiny_rw_224.sw_in1k) |83.50|96.50| 1100.53| 29.06| 5.11| 33.11|
|[coatnet_rmlp_1_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_rmlp_1_rw_224.sw_in1k) |83.36|96.45| 1093.03| 41.69| 7.85| 35.47|
|[coatnet_rmlp_1_rw2_224.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_rmlp_1_rw2_224.sw_in12k_ft_in1k) |84.90|96.96| 1025.45| 41.72| 8.11| 40.13|
|[maxvit_tiny_tf_224.in1k](https://huggingface.co/timm/maxvit_tiny_tf_224.in1k) |83.41|96.59| 1004.94| 30.92| 5.60| 35.78|
|[coatnet_1_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_1_rw_224.sw_in1k) |83.62|96.38| 989.59| 41.72| 8.04| 34.60|
|[maxvit_rmlp_tiny_rw_256.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_tiny_rw_256.sw_in1k) |84.23|96.78| 807.21| 29.15| 6.77| 46.92|
|[maxvit_rmlp_small_rw_224.sw_in1k](https://huggingface.co/timm/maxvit_rmlp_small_rw_224.sw_in1k) |84.49|96.76| 693.82| 64.90| 10.75| 49.30|
|[maxvit_small_tf_224.in1k](https://huggingface.co/timm/maxvit_small_tf_224.in1k) |84.43|96.83| 647.96| 68.93| 11.66| 53.17|
|[coatnet_2_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_2_rw_224.sw_in12k_ft_in1k) |86.57|97.89| 631.88| 73.87| 15.09| 49.22|
|[coatnet_rmlp_2_rw_224.sw_in1k](https://huggingface.co/timm/coatnet_rmlp_2_rw_224.sw_in1k) |84.61|96.74| 625.81| 73.88| 15.18| 54.78|
|[coatnet_rmlp_2_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_rmlp_2_rw_224.sw_in12k_ft_in1k) |86.49|97.90| 620.58| 73.88| 15.18| 54.78|
|[maxxvit_rmlp_small_rw_256.sw_in1k](https://huggingface.co/timm/maxxvit_rmlp_small_rw_256.sw_in1k) |84.63|97.06| 575.53| 66.01| 14.67| 58.38|
|[maxxvitv2_rmlp_base_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/maxxvitv2_rmlp_base_rw_224.sw_in12k_ft_in1k) |86.64|98.02| 501.03| 116.09| 24.20| 62.77|
|[maxvit_rmlp_base_rw_224.sw_in12k_ft_in1k](https://huggingface.co/timm/maxvit_rmlp_base_rw_224.sw_in12k_ft_in1k) |86.89|98.02| 375.86| 116.14| 23.15| 92.64|
|[maxvit_base_tf_224.in1k](https://huggingface.co/timm/maxvit_base_tf_224.in1k) |84.85|96.99| 358.25| 119.47| 24.04| 95.01|
|[maxvit_tiny_tf_384.in1k](https://huggingface.co/timm/maxvit_tiny_tf_384.in1k) |85.11|97.38| 293.46| 30.98| 17.53| 123.42|
|[maxvit_large_tf_224.in1k](https://huggingface.co/timm/maxvit_large_tf_224.in1k) |84.93|96.97| 247.71| 211.79| 43.68| 127.35|
|[maxvit_small_tf_384.in1k](https://huggingface.co/timm/maxvit_small_tf_384.in1k) |85.54|97.46| 188.35| 69.02| 35.87| 183.65|
|[coatnet_rmlp_2_rw_384.sw_in12k_ft_in1k](https://huggingface.co/timm/coatnet_rmlp_2_rw_384.sw_in12k_ft_in1k) |87.39|98.31| 160.80| 73.88| 47.69| 209.43|
|[maxxvitv2_rmlp_base_rw_384.sw_in12k_ft_in1k](https://huggingface.co/timm/maxxvitv2_rmlp_base_rw_384.sw_in12k_ft_in1k) |87.47|98.37| 149.49| 116.09| 72.98| 213.74|
|[maxvit_tiny_tf_512.in1k](https://huggingface.co/timm/maxvit_tiny_tf_512.in1k) |85.67|97.58| 144.25| 31.05| 33.49| 257.59|
|[maxvit_rmlp_base_rw_384.sw_in12k_ft_in1k](https://huggingface.co/timm/maxvit_rmlp_base_rw_384.sw_in12k_ft_in1k) |87.81|98.37| 106.55| 116.14| 70.97| 318.95|
|[maxvit_base_tf_384.in21k_ft_in1k](https://huggingface.co/timm/maxvit_base_tf_384.in21k_ft_in1k) |87.92|98.54| 104.71| 119.65| 73.80| 332.90|
|[maxvit_base_tf_384.in1k](https://huggingface.co/timm/maxvit_base_tf_384.in1k) |86.29|97.80| 101.09| 119.65| 73.80| 332.90|
|[maxvit_small_tf_512.in1k](https://huggingface.co/timm/maxvit_small_tf_512.in1k) |86.10|97.76| 88.63| 69.13| 67.26| 383.77|
|[maxvit_large_tf_384.in21k_ft_in1k](https://huggingface.co/timm/maxvit_large_tf_384.in21k_ft_in1k) |87.98|98.56| 71.75| 212.03|132.55| 445.84|
|[maxvit_large_tf_384.in1k](https://huggingface.co/timm/maxvit_large_tf_384.in1k) |86.23|97.69| 70.56| 212.03|132.55| 445.84|
|[maxvit_base_tf_512.in21k_ft_in1k](https://huggingface.co/timm/maxvit_base_tf_512.in21k_ft_in1k) |88.20|98.53| 50.87| 119.88|138.02| 703.99|
|[maxvit_base_tf_512.in1k](https://huggingface.co/timm/maxvit_base_tf_512.in1k) |86.60|97.92| 50.75| 119.88|138.02| 703.99|
|[maxvit_xlarge_tf_384.in21k_ft_in1k](https://huggingface.co/timm/maxvit_xlarge_tf_384.in21k_ft_in1k) |88.32|98.54| 42.53| 475.32|292.78| 668.76|
|[maxvit_large_tf_512.in21k_ft_in1k](https://huggingface.co/timm/maxvit_large_tf_512.in21k_ft_in1k) |88.04|98.40| 36.42| 212.33|244.75| 942.15|
|[maxvit_large_tf_512.in1k](https://huggingface.co/timm/maxvit_large_tf_512.in1k) |86.52|97.88| 36.04| 212.33|244.75| 942.15|
|[maxvit_xlarge_tf_512.in21k_ft_in1k](https://huggingface.co/timm/maxvit_xlarge_tf_512.in21k_ft_in1k) |88.53|98.64| 21.76| 475.77|534.14|1413.22|
## Citation
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
```bibtex
@article{tu2022maxvit,
title={MaxViT: Multi-Axis Vision Transformer},
author={Tu, Zhengzhong and Talebi, Hossein and Zhang, Han and Yang, Feng and Milanfar, Peyman and Bovik, Alan and Li, Yinxiao},
journal={ECCV},
year={2022},
}
```
```bibtex
@article{dai2021coatnet,
title={CoAtNet: Marrying Convolution and Attention for All Data Sizes},
author={Dai, Zihang and Liu, Hanxiao and Le, Quoc V and Tan, Mingxing},
journal={arXiv preprint arXiv:2106.04803},
year={2021}
}
```
| 22,503 | [
[
-0.052978515625,
-0.03302001953125,
0.001544952392578125,
0.0292816162109375,
-0.0244293212890625,
-0.020263671875,
-0.01160430908203125,
-0.0241546630859375,
0.049957275390625,
0.0172882080078125,
-0.04376220703125,
-0.0472412109375,
-0.047821044921875,
-0.... |
Helsinki-NLP/opus-mt-fi-sv | 2023-08-16T11:35:32.000Z | [
"transformers",
"pytorch",
"tf",
"marian",
"text2text-generation",
"translation",
"fi",
"sv",
"license:apache-2.0",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | translation | Helsinki-NLP | null | null | Helsinki-NLP/opus-mt-fi-sv | 0 | 886 | transformers | 2022-03-02T23:29:04 | ---
tags:
- translation
license: apache-2.0
---
### opus-mt-fi-sv
* source languages: fi
* target languages: sv
* OPUS readme: [fi-sv](https://github.com/Helsinki-NLP/OPUS-MT-train/blob/master/models/fi-sv/README.md)
* dataset: opus+bt
* model: transformer-align
* pre-processing: normalization + SentencePiece
* download original weights: [opus+bt-2020-04-11.zip](https://object.pouta.csc.fi/OPUS-MT-models/fi-sv/opus+bt-2020-04-11.zip)
* test set translations: [opus+bt-2020-04-11.test.txt](https://object.pouta.csc.fi/OPUS-MT-models/fi-sv/opus+bt-2020-04-11.test.txt)
* test set scores: [opus+bt-2020-04-11.eval.txt](https://object.pouta.csc.fi/OPUS-MT-models/fi-sv/opus+bt-2020-04-11.eval.txt)
## Benchmarks
| testset | BLEU | chr-F |
|-----------------------|-------|-------|
| fiskmo_testset.fi.sv | 27.4 | 0.605 |
| Tatoeba.fi.sv | 54.7 | 0.709 |
| 881 | [
[
-0.021514892578125,
-0.033355712890625,
0.0144500732421875,
0.030517578125,
-0.035552978515625,
-0.024871826171875,
-0.0318603515625,
-0.0086822509765625,
-0.00038743019104003906,
0.03228759765625,
-0.0537109375,
-0.042572021484375,
-0.038543701171875,
0.017... |
SriramSridhar78/sriram-car-classifier | 2023-03-21T12:14:20.000Z | [
"transformers",
"pytorch",
"tensorboard",
"safetensors",
"vit",
"image-classification",
"huggingpics",
"model-index",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | image-classification | SriramSridhar78 | null | null | SriramSridhar78/sriram-car-classifier | 4 | 886 | transformers | 2022-03-02T23:29:05 | ---
tags:
- image-classification
- pytorch
- huggingpics
metrics:
- accuracy
model-index:
- name: sriram-car-classifier
results:
- task:
name: Image Classification
type: image-classification
metrics:
- name: Accuracy
type: accuracy
value: 0.8271908164024353
---
# sriram-car-classifier
Autogenerated by HuggingPics🤗🖼️
Create your own image classifier for **anything** by running [the demo on Google Colab](https://colab.research.google.com/github/nateraw/huggingpics/blob/main/HuggingPics.ipynb).
Report any issues with the demo at the [github repo](https://github.com/nateraw/huggingpics).
## Example Images
#### AM_General_Hummer_SUV_2000

#### Acura_Integra_Type_R_2001

#### Acura_RL_Sedan_2012

#### Acura_TL_Sedan_2012

#### Acura_TL_Type-S_2008

#### Acura_TSX_Sedan_2012

#### Acura_ZDX_Hatchback_2012

#### Aston_Martin_V8_Vantage_Convertible_2012

#### Aston_Martin_V8_Vantage_Coupe_2012

#### Aston_Martin_Virage_Convertible_2012

#### Aston_Martin_Virage_Coupe_2012

#### Audi_100_Sedan_1994

#### Audi_100_Wagon_1994

#### Audi_A5_Coupe_2012

#### Audi_R8_Coupe_2012

#### Audi_RS_4_Convertible_2008

#### Audi_S4_Sedan_2007

#### Audi_S4_Sedan_2012

#### Audi_S5_Convertible_2012

#### Audi_S5_Coupe_2012

#### Audi_S6_Sedan_2011

#### Audi_TTS_Coupe_2012

#### Audi_TT_Hatchback_2011

#### Audi_TT_RS_Coupe_2012

#### Audi_V8_Sedan_1994

#### BMW_1_Series_Convertible_2012

#### BMW_1_Series_Coupe_2012

#### BMW_3_Series_Sedan_2012

#### BMW_3_Series_Wagon_2012

#### BMW_6_Series_Convertible_2007

#### BMW_ActiveHybrid_5_Sedan_2012

#### BMW_M3_Coupe_2012

#### BMW_M5_Sedan_2010

#### BMW_M6_Convertible_2010

#### BMW_X3_SUV_2012

#### BMW_X5_SUV_2007

#### BMW_X6_SUV_2012

#### BMW_Z4_Convertible_2012

#### Bentley_Arnage_Sedan_2009

#### Bentley_Continental_Flying_Spur_Sedan_2007

#### Bentley_Continental_GT_Coupe_2007

#### Bentley_Continental_GT_Coupe_2012

#### Bentley_Continental_Supersports_Conv._Convertible_2012

#### Bentley_Mulsanne_Sedan_2011

#### Bugatti_Veyron_16.4_Convertible_2009

#### Bugatti_Veyron_16.4_Coupe_2009

#### Buick_Enclave_SUV_2012

#### Buick_Rainier_SUV_2007

#### Buick_Regal_GS_2012

#### Buick_Verano_Sedan_2012

#### Cadillac_CTS-V_Sedan_2012

#### Cadillac_Escalade_EXT_Crew_Cab_2007

#### Cadillac_SRX_SUV_2012

#### Chevrolet_Avalanche_Crew_Cab_2012

#### Chevrolet_Camaro_Convertible_2012

#### Chevrolet_Cobalt_SS_2010

#### Chevrolet_Corvette_Convertible_2012

#### Chevrolet_Corvette_Ron_Fellows_Edition_Z06_2007

#### Chevrolet_Corvette_ZR1_2012

#### Chevrolet_Express_Cargo_Van_2007

#### Chevrolet_Express_Van_2007

#### Chevrolet_HHR_SS_2010

#### Chevrolet_Impala_Sedan_2007

#### Chevrolet_Malibu_Hybrid_Sedan_2010

#### Chevrolet_Malibu_Sedan_2007

#### Chevrolet_Monte_Carlo_Coupe_2007

#### Chevrolet_Silverado_1500_Classic_Extended_Cab_2007

#### Chevrolet_Silverado_1500_Extended_Cab_2012

#### Chevrolet_Silverado_1500_Hybrid_Crew_Cab_2012

#### Chevrolet_Silverado_1500_Regular_Cab_2012

#### Chevrolet_Silverado_2500HD_Regular_Cab_2012

#### Chevrolet_Sonic_Sedan_2012

#### Chevrolet_Tahoe_Hybrid_SUV_2012

#### Chevrolet_TrailBlazer_SS_2009

#### Chevrolet_Traverse_SUV_2012

#### Chrysler_300_SRT-8_2010

#### Chrysler_Aspen_SUV_2009

#### Chrysler_Crossfire_Convertible_2008

#### Chrysler_PT_Cruiser_Convertible_2008

#### Chrysler_Sebring_Convertible_2010

#### Chrysler_Town_and_Country_Minivan_2012

#### Daewoo_Nubira_Wagon_2002

#### Dodge_Caliber_Wagon_2007

#### Dodge_Caliber_Wagon_2012

#### Dodge_Caravan_Minivan_1997

#### Dodge_Challenger_SRT8_2011

#### Dodge_Charger_SRT-8_2009

#### Dodge_Charger_Sedan_2012

#### Dodge_Dakota_Club_Cab_2007

#### Dodge_Dakota_Crew_Cab_2010

#### Dodge_Durango_SUV_2007

#### Dodge_Durango_SUV_2012

#### Dodge_Journey_SUV_2012

#### Dodge_Magnum_Wagon_2008

#### Dodge_Ram_Pickup_3500_Crew_Cab_2010

#### Dodge_Ram_Pickup_3500_Quad_Cab_2009

#### Dodge_Sprinter_Cargo_Van_2009

#### Eagle_Talon_Hatchback_1998

#### FIAT_500_Abarth_2012

#### FIAT_500_Convertible_2012

#### Ferrari_458_Italia_Convertible_2012

#### Ferrari_458_Italia_Coupe_2012

#### Ferrari_California_Convertible_2012

#### Ferrari_FF_Coupe_2012

#### Fisker_Karma_Sedan_2012

#### Ford_E-Series_Wagon_Van_2012

#### Ford_Edge_SUV_2012

#### Ford_Expedition_EL_SUV_2009

#### Ford_F-150_Regular_Cab_2007

#### Ford_F-150_Regular_Cab_2012

#### Ford_F-450_Super_Duty_Crew_Cab_2012

#### Ford_Fiesta_Sedan_2012

#### Ford_Focus_Sedan_2007

#### Ford_Freestar_Minivan_2007

#### Ford_GT_Coupe_2006

#### Ford_Mustang_Convertible_2007

#### Ford_Ranger_SuperCab_2011

#### GMC_Acadia_SUV_2012

#### GMC_Canyon_Extended_Cab_2012

#### GMC_Savana_Van_2012

#### GMC_Terrain_SUV_2012

#### GMC_Yukon_Hybrid_SUV_2012

#### Geo_Metro_Convertible_1993

#### HUMMER_H2_SUT_Crew_Cab_2009

#### HUMMER_H3T_Crew_Cab_2010

#### Honda_Accord_Coupe_2012

#### Honda_Accord_Sedan_2012

#### Honda_Odyssey_Minivan_2007

#### Honda_Odyssey_Minivan_2012

#### Hyundai_Accent_Sedan_2012

#### Hyundai_Azera_Sedan_2012

#### Hyundai_Elantra_Sedan_2007

#### Hyundai_Elantra_Touring_Hatchback_2012

#### Hyundai_Genesis_Sedan_2012

#### Hyundai_Santa_Fe_SUV_2012

#### Hyundai_Sonata_Hybrid_Sedan_2012

#### Hyundai_Sonata_Sedan_2012

#### Hyundai_Tucson_SUV_2012

#### Hyundai_Veloster_Hatchback_2012

#### Hyundai_Veracruz_SUV_2012

#### Infiniti_G_Coupe_IPL_2012

#### Infiniti_QX56_SUV_2011

#### Isuzu_Ascender_SUV_2008

#### Jaguar_XK_XKR_2012

#### Jeep_Compass_SUV_2012

#### Jeep_Grand_Cherokee_SUV_2012

#### Jeep_Liberty_SUV_2012

#### Jeep_Patriot_SUV_2012

#### Jeep_Wrangler_SUV_2012

#### Lamborghini_Aventador_Coupe_2012

#### Lamborghini_Diablo_Coupe_2001

#### Lamborghini_Gallardo_LP_570-4_Superleggera_2012

#### Lamborghini_Reventon_Coupe_2008

#### Land_Rover_LR2_SUV_2012

#### Land_Rover_Range_Rover_SUV_2012

#### Lincoln_Town_Car_Sedan_2011

#### MINI_Cooper_Roadster_Convertible_2012

#### Maybach_Landaulet_Convertible_2012

#### Mazda_Tribute_SUV_2011

#### McLaren_MP4-12C_Coupe_2012

#### Mercedes-Benz_300-Class_Convertible_1993

#### Mercedes-Benz_C-Class_Sedan_2012

#### Mercedes-Benz_E-Class_Sedan_2012

#### Mercedes-Benz_S-Class_Sedan_2012

#### Mercedes-Benz_SL-Class_Coupe_2009

#### Mercedes-Benz_Sprinter_Van_2012

#### Mitsubishi_Lancer_Sedan_2012

#### Nissan_240SX_Coupe_1998

#### Nissan_Juke_Hatchback_2012

#### Nissan_Leaf_Hatchback_2012

#### Nissan_NV_Passenger_Van_2012

#### Plymouth_Neon_Coupe_1999

#### Porsche_Panamera_Sedan_2012

#### Ram_C_V_Cargo_Van_Minivan_2012

#### Rolls-Royce_Ghost_Sedan_2012

#### Rolls-Royce_Phantom_Drophead_Coupe_Convertible_2012

#### Rolls-Royce_Phantom_Sedan_2012

#### Scion_xD_Hatchback_2012

#### Spyker_C8_Convertible_2009

#### Spyker_C8_Coupe_2009

#### Suzuki_Aerio_Sedan_2007

#### Suzuki_Kizashi_Sedan_2012

#### Suzuki_SX4_Hatchback_2012

#### Suzuki_SX4_Sedan_2012

#### Tesla_Model_S_Sedan_2012

#### Toyota_4Runner_SUV_2012

#### Toyota_Camry_Sedan_2012

#### Toyota_Corolla_Sedan_2012

#### Toyota_Sequoia_SUV_2012

#### Volkswagen_Beetle_Hatchback_2012

#### Volkswagen_Golf_Hatchback_1991

#### Volkswagen_Golf_Hatchback_2012

#### Volvo_240_Sedan_1993

#### Volvo_C30_Hatchback_2012

#### Volvo_XC90_SUV_2007

#### smart_fortwo_Convertible_2012
 | 21,333 | [
[
-0.07476806640625,
-0.0058746337890625,
0.0268096923828125,
0.0174560546875,
-0.038177490234375,
0.029327392578125,
0.0165252685546875,
-0.034576416015625,
0.0065765380859375,
-0.00983428955078125,
-0.028076171875,
-0.0231475830078125,
-0.01316070556640625,
... |
microsoft/unispeech-sat-base-100h-libri-ft | 2021-11-04T15:26:40.000Z | [
"transformers",
"pytorch",
"unispeech-sat",
"automatic-speech-recognition",
"audio",
"en",
"dataset:librispeech_asr",
"arxiv:2110.05752",
"license:apache-2.0",
"endpoints_compatible",
"region:us"
] | automatic-speech-recognition | microsoft | null | null | microsoft/unispeech-sat-base-100h-libri-ft | 3 | 886 | transformers | 2022-03-02T23:29:05 | ---
language: en
datasets:
- librispeech_asr
tags:
- audio
- automatic-speech-recognition
license: apache-2.0
widget:
- example_title: Librispeech sample 1
src: https://cdn-media.huggingface.co/speech_samples/sample1.flac
- example_title: Librispeech sample 2
src: https://cdn-media.huggingface.co/speech_samples/sample2.flac
---
# UniSpeech-SAT-Base-Finetuned-100h-Libri
[Microsoft's UniSpeech](https://www.microsoft.com/en-us/research/publication/unispeech-unified-speech-representation-learning-with-labeled-and-unlabeled-data/)
A [unispeech-sat-base model]( ) that was fine-tuned on 100h hours of Librispeech on 16kHz sampled speech audio. When using the model
make sure that your speech input is also sampled at 16Khz.
The model was fine-tuned on:
- 100 hours of [LibriSpeech](https://huggingface.co/datasets/librispeech_asr)
[Paper: UNISPEECH-SAT: UNIVERSAL SPEECH REPRESENTATION LEARNING WITH SPEAKER
AWARE PRE-TRAINING](https://arxiv.org/abs/2110.05752)
Authors: Sanyuan Chen, Yu Wu, Chengyi Wang, Zhengyang Chen, Zhuo Chen, Shujie Liu, Jian Wu, Yao Qian, Furu Wei, Jinyu Li, Xiangzhan Yu
**Abstract**
*Self-supervised learning (SSL) is a long-standing goal for speech processing, since it utilizes large-scale unlabeled data and avoids extensive human labeling. Recent years witness great successes in applying self-supervised learning in speech recognition, while limited exploration was attempted in applying SSL for modeling speaker characteristics. In this paper, we aim to improve the existing SSL framework for speaker representation learning. Two methods are introduced for enhancing the unsupervised speaker information extraction. First, we apply the multi-task learning to the current SSL framework, where we integrate the utterance-wise contrastive loss with the SSL objective function. Second, for better speaker discrimination, we propose an utterance mixing strategy for data augmentation, where additional overlapped utterances are created unsupervisely and incorporate during training. We integrate the proposed methods into the HuBERT framework. Experiment results on SUPERB benchmark show that the proposed system achieves state-of-the-art performance in universal representation learning, especially for speaker identification oriented tasks. An ablation study is performed verifying the efficacy of each proposed method. Finally, we scale up training dataset to 94 thousand hours public audio data and achieve further performance improvement in all SUPERB tasks..*
The original model can be found under https://github.com/microsoft/UniSpeech/tree/main/UniSpeech-SAT.
# Usage
To transcribe audio files the model can be used as a standalone acoustic model as follows:
```python
from transformers import Wav2Vec2Processor, UniSpeechSatForCTC
from datasets import load_dataset
import torch
# load model and tokenizer
processor = Wav2Vec2Processor.from_pretrained("microsoft/unispeech-sat-base-100h-libri-ft")
model = UniSpeechSatForCTC.from_pretrained("microsoft/unispeech-sat-base-100h-libri-ft")
# load dummy dataset
ds = load_dataset("patrickvonplaten/librispeech_asr_dummy", "clean", split="validation")
# tokenize
input_values = processor(ds[0]["audio"]["array"], return_tensors="pt", padding="longest").input_values # Batch size 1
# retrieve logits
logits = model(input_values).logits
# take argmax and decode
predicted_ids = torch.argmax(logits, dim=-1)
transcription = processor.batch_decode(predicted_ids)
```
# Contribution
The model was contributed by [cywang](https://huggingface.co/cywang) and [patrickvonplaten](https://huggingface.co/patrickvonplaten).
# License
The official license can be found [here](https://github.com/microsoft/UniSpeech/blob/main/LICENSE)
 | 3,859 | [
[
-0.021636962890625,
-0.0357666015625,
0.01183319091796875,
0.0180816650390625,
-0.027587890625,
0.0010175704956054688,
-0.0286102294921875,
-0.036407470703125,
-0.0002409219741821289,
0.03851318359375,
-0.029998779296875,
-0.033447265625,
-0.02911376953125,
... |
Jinouga/haruno-sakura-boruto-v4 | 2023-07-20T11:43:54.000Z | [
"diffusers",
"text-to-image",
"stable-diffusion",
"license:creativeml-openrail-m",
"endpoints_compatible",
"has_space",
"diffusers:StableDiffusionPipeline",
"region:us"
] | text-to-image | Jinouga | null | null | Jinouga/haruno-sakura-boruto-v4 | 1 | 886 | diffusers | 2023-06-20T17:44:33 | ---
license: creativeml-openrail-m
tags:
- text-to-image
- stable-diffusion
---
### haruno-sakura[Boruto]V4 Dreambooth model trained by Jinouga with [TheLastBen's fast-DreamBooth](https://colab.research.google.com/github/TheLastBen/fast-stable-diffusion/blob/main/fast-DreamBooth.ipynb) notebook
Test the concept via A1111 Colab [fast-Colab-A1111](https://colab.research.google.com/github/TheLastBen/fast-stable-diffusion/blob/main/fast_stable_diffusion_AUTOMATIC1111.ipynb)
Sample pictures of this concept:
| 512 | [
[
-0.0240936279296875,
-0.048187255859375,
0.035552978515625,
0.031463623046875,
-0.0245819091796875,
0.0286407470703125,
0.0196990966796875,
-0.0201416015625,
0.04962158203125,
0.0166473388671875,
-0.018157958984375,
-0.01056671142578125,
-0.0288848876953125,
... |
maywell/Synatra-7B-v0.3-base | 2023-10-29T11:17:06.000Z | [
"transformers",
"pytorch",
"mistral",
"text-generation",
"ko",
"license:cc-by-nc-4.0",
"endpoints_compatible",
"text-generation-inference",
"region:us"
] | text-generation | maywell | null | null | maywell/Synatra-7B-v0.3-base | 4 | 886 | transformers | 2023-10-28T00:56:03 | ---
language:
- ko
library_name: transformers
pipeline_tag: text-generation
license: cc-by-nc-4.0
---
# **Synatra-7B-v0.3-base🐧**

## Support Me
시나트라는 개인 프로젝트로, 1인의 자원으로 개발되고 있습니다. 모델이 마음에 드셨다면 약간의 연구비 지원은 어떨까요?
[<img src="https://cdn.buymeacoffee.com/buttons/default-orange.png" alt="Buy me a Coffee" width="217" height="50">](https://www.buymeacoffee.com/mwell)
Wanna be a sponser? Contact me on Telegram **AlzarTakkarsen**
# **License**
This model is strictly [*non-commercial*](https://creativecommons.org/licenses/by-nc/4.0/) (**cc-by-nc-4.0**) use only.
The "Model" is completely free (ie. base model, derivates, merges/mixes) to use for non-commercial purposes as long as the the included **cc-by-nc-4.0** license in any parent repository, and the non-commercial use statute remains, regardless of other models' licences.
The licence can be changed after new model released. If you are to use this model for commercial purpose, Contact me.
# **Model Details**
**Base Model**
[mistralai/Mistral-7B-Instruct-v0.1](https://huggingface.co/mistralai/Mistral-7B-Instruct-v0.1)
**Trained On**
A6000 48GB * 8
**Instruction format**
It follows [ChatML](https://github.com/openai/openai-python/blob/main/chatml.md) format and **Alpaca(No-Input)** format.
**TODO**
- ~~``RP 기반 튜닝 모델 제작``~~ ✅
- ~~``데이터셋 정제``~~ ✅
- 언어 이해능력 개선
- ~~``상식 보완``~~ ✅
- 토크나이저 변경
# **Model Benchmark**
## Ko-LLM-Leaderboard
On Benchmarking...
# **Implementation Code**
Since, chat_template already contains insturction format above.
You can use the code below.
```python
from transformers import AutoModelForCausalLM, AutoTokenizer
device = "cuda" # the device to load the model onto
model = AutoModelForCausalLM.from_pretrained("maywell/Synatra-7B-v0.3-base")
tokenizer = AutoTokenizer.from_pretrained("maywell/Synatra-7B-v0.3-base")
messages = [
{"role": "user", "content": "바나나는 원래 하얀색이야?"},
]
encodeds = tokenizer.apply_chat_template(messages, return_tensors="pt")
model_inputs = encodeds.to(device)
model.to(device)
generated_ids = model.generate(model_inputs, max_new_tokens=1000, do_sample=True)
decoded = tokenizer.batch_decode(generated_ids)
print(decoded[0])
``` | 2,224 | [
[
-0.021881103515625,
-0.05743408203125,
0.0034656524658203125,
0.037261962890625,
-0.03955078125,
-0.0325927734375,
-0.0134735107421875,
-0.031219482421875,
0.031768798828125,
0.02362060546875,
-0.037200927734375,
-0.04083251953125,
-0.053741455078125,
-0.004... |
w11wo/wav2vec2-xls-r-300m-korean | 2023-05-16T04:58:04.000Z | [
"transformers",
"pytorch",
"tensorboard",
"safetensors",
"wav2vec2",
"automatic-speech-recognition",
"generated_from_trainer",
"hf-asr-leaderboard",
"robust-speech-event",
"ko",
"dataset:kresnik/zeroth_korean",
"arxiv:2111.09296",
"license:apache-2.0",
"model-index",
"endpoints_compatibl... | automatic-speech-recognition | w11wo | null | null | w11wo/wav2vec2-xls-r-300m-korean | 6 | 885 | transformers | 2022-03-02T23:29:05 | ---
language: ko
license: apache-2.0
tags:
- automatic-speech-recognition
- generated_from_trainer
- hf-asr-leaderboard
- robust-speech-event
datasets:
- kresnik/zeroth_korean
model-index:
- name: Wav2Vec2 XLS-R 300M Korean
results:
- task:
name: Automatic Speech Recognition
type: automatic-speech-recognition
dataset:
name: Zeroth Korean
type: kresnik/zeroth_korean
args: clean
metrics:
- name: Test WER
type: wer
value: 29.54
- name: Test CER
type: cer
value: 9.53
- task:
name: Automatic Speech Recognition
type: automatic-speech-recognition
dataset:
name: Robust Speech Event - Dev Data
type: speech-recognition-community-v2/dev_data
args: ko
metrics:
- name: Test WER
type: wer
value: 76.26
- name: Test CER
type: cer
value: 38.67
- task:
name: Automatic Speech Recognition
type: automatic-speech-recognition
dataset:
name: Robust Speech Event - Test Data
type: speech-recognition-community-v2/eval_data
args: ko
metrics:
- name: Test WER
type: wer
value: 73.18
---
# Wav2Vec2 XLS-R 300M Korean
Wav2Vec2 XLS-R 300M Korean is an automatic speech recognition model based on the [XLS-R](https://arxiv.org/abs/2111.09296) architecture. This model is a fine-tuned version of [Wav2Vec2-XLS-R-300M](https://huggingface.co/facebook/wav2vec2-xls-r-300m) on the [Zeroth Korean](https://huggingface.co/datasets/kresnik/zeroth_korean) dataset.
This model was trained using HuggingFace's PyTorch framework and is part of the [Robust Speech Challenge Event](https://discuss.huggingface.co/t/open-to-the-community-robust-speech-recognition-challenge/13614) organized by HuggingFace. All training was done on a Tesla V100, sponsored by OVH.
All necessary scripts used for training could be found in the [Files and versions](https://huggingface.co/w11wo/wav2vec2-xls-r-300m-korean/tree/main) tab, as well as the [Training metrics](https://huggingface.co/w11wo/wav2vec2-xls-r-300m-korean/tensorboard) logged via Tensorboard.
## Model
| Model | #params | Arch. | Training/Validation data (text) |
| ---------------------------- | ------- | ----- | ------------------------------- |
| `wav2vec2-xls-r-300m-korean` | 300M | XLS-R | `Zeroth Korean` Dataset |
## Evaluation Results
The model achieves the following results on evaluation:
| Dataset | Loss | WER | CER |
| -------------------------------- | ------ | ------ | ------ |
| `Zeroth Korean` | 0.2089 | 29.54% | 9.53% |
| `Robust Speech Event - Dev Data` | N/A | 76.26% | 38.67% |
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- `learning_rate`: 7.5e-05
- `train_batch_size`: 8
- `eval_batch_size`: 8
- `seed`: 42
- `gradient_accumulation_steps`: 4
- `total_train_batch_size`: 32
- `optimizer`: Adam with `betas=(0.9, 0.999)` and `epsilon=1e-08`
- `lr_scheduler_type`: linear
- `lr_scheduler_warmup_steps`: 2000
- `num_epochs`: 50.0
- `mixed_precision_training`: Native AMP
### Training results
| Training Loss | Epoch | Step | Validation Loss | Wer | Cer |
| :-----------: | :---: | :---: | :-------------: | :----: | :----: |
| 19.7138 | 0.72 | 500 | 19.6427 | 1.0 | 1.0 |
| 4.8039 | 1.44 | 1000 | 4.7842 | 1.0 | 1.0 |
| 4.5619 | 2.16 | 1500 | 4.5608 | 0.9992 | 0.9598 |
| 4.254 | 2.88 | 2000 | 4.2729 | 0.9955 | 0.9063 |
| 4.1905 | 3.6 | 2500 | 4.2257 | 0.9903 | 0.8758 |
| 4.0683 | 4.32 | 3000 | 3.9294 | 0.9937 | 0.7911 |
| 3.486 | 5.04 | 3500 | 2.7045 | 1.0012 | 0.5934 |
| 2.946 | 5.75 | 4000 | 1.9691 | 0.9425 | 0.4634 |
| 2.634 | 6.47 | 4500 | 1.5212 | 0.8807 | 0.3850 |
| 2.4066 | 7.19 | 5000 | 1.2551 | 0.8177 | 0.3601 |
| 2.2651 | 7.91 | 5500 | 1.0423 | 0.7650 | 0.3039 |
| 2.1828 | 8.63 | 6000 | 0.9599 | 0.7273 | 0.3106 |
| 2.1023 | 9.35 | 6500 | 0.9482 | 0.7161 | 0.3063 |
| 2.0536 | 10.07 | 7000 | 0.8242 | 0.6767 | 0.2860 |
| 1.9803 | 10.79 | 7500 | 0.7643 | 0.6563 | 0.2637 |
| 1.9468 | 11.51 | 8000 | 0.7319 | 0.6441 | 0.2505 |
| 1.9178 | 12.23 | 8500 | 0.6937 | 0.6320 | 0.2489 |
| 1.8515 | 12.95 | 9000 | 0.6443 | 0.6053 | 0.2196 |
| 1.8083 | 13.67 | 9500 | 0.6286 | 0.6122 | 0.2148 |
| 1.819 | 14.39 | 10000 | 0.6015 | 0.5986 | 0.2074 |
| 1.7684 | 15.11 | 10500 | 0.5682 | 0.5741 | 0.1982 |
| 1.7195 | 15.83 | 11000 | 0.5385 | 0.5592 | 0.2007 |
| 1.7044 | 16.55 | 11500 | 0.5362 | 0.5524 | 0.2097 |
| 1.6879 | 17.27 | 12000 | 0.5119 | 0.5489 | 0.2083 |
| 1.656 | 17.98 | 12500 | 0.4990 | 0.5362 | 0.1968 |
| 1.6122 | 18.7 | 13000 | 0.4561 | 0.5092 | 0.1900 |
| 1.5919 | 19.42 | 13500 | 0.4778 | 0.5225 | 0.1975 |
| 1.5896 | 20.14 | 14000 | 0.4563 | 0.5098 | 0.1859 |
| 1.5589 | 20.86 | 14500 | 0.4362 | 0.4940 | 0.1725 |
| 1.5353 | 21.58 | 15000 | 0.4140 | 0.4826 | 0.1580 |
| 1.5441 | 22.3 | 15500 | 0.4031 | 0.4742 | 0.1550 |
| 1.5116 | 23.02 | 16000 | 0.3916 | 0.4748 | 0.1545 |
| 1.4731 | 23.74 | 16500 | 0.3841 | 0.4810 | 0.1542 |
| 1.4647 | 24.46 | 17000 | 0.3752 | 0.4524 | 0.1475 |
| 1.4328 | 25.18 | 17500 | 0.3587 | 0.4476 | 0.1461 |
| 1.4129 | 25.9 | 18000 | 0.3429 | 0.4242 | 0.1366 |
| 1.4062 | 26.62 | 18500 | 0.3450 | 0.4251 | 0.1355 |
| 1.3928 | 27.34 | 19000 | 0.3297 | 0.4145 | 0.1322 |
| 1.3906 | 28.06 | 19500 | 0.3210 | 0.4185 | 0.1336 |
| 1.358 | 28.78 | 20000 | 0.3131 | 0.3970 | 0.1275 |
| 1.3445 | 29.5 | 20500 | 0.3069 | 0.3920 | 0.1276 |
| 1.3159 | 30.22 | 21000 | 0.3035 | 0.3961 | 0.1255 |
| 1.3044 | 30.93 | 21500 | 0.2952 | 0.3854 | 0.1242 |
| 1.3034 | 31.65 | 22000 | 0.2966 | 0.3772 | 0.1227 |
| 1.2963 | 32.37 | 22500 | 0.2844 | 0.3706 | 0.1208 |
| 1.2765 | 33.09 | 23000 | 0.2841 | 0.3567 | 0.1173 |
| 1.2438 | 33.81 | 23500 | 0.2734 | 0.3552 | 0.1137 |
| 1.2487 | 34.53 | 24000 | 0.2703 | 0.3502 | 0.1118 |
| 1.2249 | 35.25 | 24500 | 0.2650 | 0.3484 | 0.1142 |
| 1.2229 | 35.97 | 25000 | 0.2584 | 0.3374 | 0.1097 |
| 1.2374 | 36.69 | 25500 | 0.2568 | 0.3337 | 0.1095 |
| 1.2153 | 37.41 | 26000 | 0.2494 | 0.3327 | 0.1071 |
| 1.1925 | 38.13 | 26500 | 0.2518 | 0.3366 | 0.1077 |
| 1.1908 | 38.85 | 27000 | 0.2437 | 0.3272 | 0.1057 |
| 1.1858 | 39.57 | 27500 | 0.2396 | 0.3265 | 0.1044 |
| 1.1808 | 40.29 | 28000 | 0.2373 | 0.3156 | 0.1028 |
| 1.1842 | 41.01 | 28500 | 0.2356 | 0.3152 | 0.1026 |
| 1.1668 | 41.73 | 29000 | 0.2319 | 0.3188 | 0.1025 |
| 1.1448 | 42.45 | 29500 | 0.2293 | 0.3099 | 0.0995 |
| 1.1327 | 43.17 | 30000 | 0.2265 | 0.3047 | 0.0979 |
| 1.1307 | 43.88 | 30500 | 0.2222 | 0.3078 | 0.0989 |
| 1.1419 | 44.6 | 31000 | 0.2215 | 0.3038 | 0.0981 |
| 1.1231 | 45.32 | 31500 | 0.2193 | 0.3013 | 0.0972 |
| 1.139 | 46.04 | 32000 | 0.2162 | 0.3007 | 0.0968 |
| 1.1114 | 46.76 | 32500 | 0.2122 | 0.2982 | 0.0960 |
| 1.111 | 47.48 | 33000 | 0.2125 | 0.2946 | 0.0948 |
| 1.0982 | 48.2 | 33500 | 0.2099 | 0.2957 | 0.0953 |
| 1.109 | 48.92 | 34000 | 0.2092 | 0.2955 | 0.0955 |
| 1.0905 | 49.64 | 34500 | 0.2088 | 0.2954 | 0.0953 |
## Disclaimer
Do consider the biases which came from pre-training datasets that may be carried over into the results of this model.
## Authors
Wav2Vec2 XLS-R 300M Korean was trained and evaluated by [Wilson Wongso](https://w11wo.github.io/). All computation and development are done on OVH Cloud.
## Framework versions
- Transformers 4.17.0.dev0
- Pytorch 1.10.2+cu102
- Datasets 1.18.2.dev0
- Tokenizers 0.10.3
| 8,592 | [
[
-0.0472412109375,
-0.037811279296875,
0.0203857421875,
0.00927734375,
0.0035457611083984375,
0.002452850341796875,
-0.004543304443359375,
-0.00835418701171875,
0.037139892578125,
0.0237579345703125,
-0.037445068359375,
-0.04705810546875,
-0.045867919921875,
... |
timm/tf_efficientnet_b2.aa_in1k | 2023-04-27T21:17:51.000Z | [
"timm",
"pytorch",
"safetensors",
"image-classification",
"dataset:imagenet-1k",
"arxiv:1905.11946",
"arxiv:1805.09501",
"license:apache-2.0",
"region:us"
] | image-classification | timm | null | null | timm/tf_efficientnet_b2.aa_in1k | 0 | 885 | timm | 2022-12-13T00:02:08 | ---
tags:
- image-classification
- timm
library_name: timm
license: apache-2.0
datasets:
- imagenet-1k
---
# Model card for tf_efficientnet_b2.aa_in1k
A EfficientNet image classification model. Trained on ImageNet-1k with auto-augment in Tensorflow by paper authors, ported to PyTorch by Ross Wightman.
## Model Details
- **Model Type:** Image classification / feature backbone
- **Model Stats:**
- Params (M): 9.1
- GMACs: 1.0
- Activations (M): 13.8
- Image size: 260 x 260
- **Papers:**
- EfficientNet: Rethinking Model Scaling for Convolutional Neural Networks: https://arxiv.org/abs/1905.11946
- AutoAugment: Learning Augmentation Policies from Data: https://arxiv.org/abs/1805.09501
- **Dataset:** ImageNet-1k
- **Original:** https://github.com/tensorflow/tpu/tree/master/models/official/efficientnet
## Model Usage
### Image Classification
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model('tf_efficientnet_b2.aa_in1k', pretrained=True)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
top5_probabilities, top5_class_indices = torch.topk(output.softmax(dim=1) * 100, k=5)
```
### Feature Map Extraction
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'tf_efficientnet_b2.aa_in1k',
pretrained=True,
features_only=True,
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # unsqueeze single image into batch of 1
for o in output:
# print shape of each feature map in output
# e.g.:
# torch.Size([1, 16, 130, 130])
# torch.Size([1, 24, 65, 65])
# torch.Size([1, 48, 33, 33])
# torch.Size([1, 120, 17, 17])
# torch.Size([1, 352, 9, 9])
print(o.shape)
```
### Image Embeddings
```python
from urllib.request import urlopen
from PIL import Image
import timm
img = Image.open(urlopen(
'https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/beignets-task-guide.png'
))
model = timm.create_model(
'tf_efficientnet_b2.aa_in1k',
pretrained=True,
num_classes=0, # remove classifier nn.Linear
)
model = model.eval()
# get model specific transforms (normalization, resize)
data_config = timm.data.resolve_model_data_config(model)
transforms = timm.data.create_transform(**data_config, is_training=False)
output = model(transforms(img).unsqueeze(0)) # output is (batch_size, num_features) shaped tensor
# or equivalently (without needing to set num_classes=0)
output = model.forward_features(transforms(img).unsqueeze(0))
# output is unpooled, a (1, 1408, 9, 9) shaped tensor
output = model.forward_head(output, pre_logits=True)
# output is a (1, num_features) shaped tensor
```
## Model Comparison
Explore the dataset and runtime metrics of this model in timm [model results](https://github.com/huggingface/pytorch-image-models/tree/main/results).
## Citation
```bibtex
@inproceedings{tan2019efficientnet,
title={Efficientnet: Rethinking model scaling for convolutional neural networks},
author={Tan, Mingxing and Le, Quoc},
booktitle={International conference on machine learning},
pages={6105--6114},
year={2019},
organization={PMLR}
}
```
```bibtex
@inproceedings{47890,
title = {AutoAugment: Learning Augmentation Policies from Data},
author = {Ekin Dogus Cubuk and Barret Zoph and Dandelion Mane and Vijay Vasudevan and Quoc V. Le},
year = {2019},
URL = {https://arxiv.org/pdf/1805.09501.pdf}
}
```
```bibtex
@misc{rw2019timm,
author = {Ross Wightman},
title = {PyTorch Image Models},
year = {2019},
publisher = {GitHub},
journal = {GitHub repository},
doi = {10.5281/zenodo.4414861},
howpublished = {\url{https://github.com/huggingface/pytorch-image-models}}
}
```
| 4,489 | [
[
-0.0291748046875,
-0.042388916015625,
-0.00969696044921875,
0.00710296630859375,
-0.0151519775390625,
-0.02996826171875,
-0.0225677490234375,
-0.03216552734375,
0.0131683349609375,
0.024444580078125,
-0.028778076171875,
-0.04248046875,
-0.056549072265625,
-0... |
4bit/Llama-2-7b-chat-hf | 2023-07-19T03:07:36.000Z | [
"transformers",
"safetensors",
"llama",
"text-generation",
"facebook",
"meta",
"pytorch",
"llama-2",
"en",
"has_space",
"text-generation-inference",
"region:us"
] | text-generation | 4bit | null | null | 4bit/Llama-2-7b-chat-hf | 8 | 884 | transformers | 2023-07-19T03:00:23 | ---
extra_gated_heading: Access Llama 2 on Hugging Face
extra_gated_description: >-
This is a form to enable access to Llama 2 on Hugging Face after you have been
granted access from Meta. Please visit the [Meta website](https://ai.meta.com/resources/models-and-libraries/llama-downloads) and accept our
license terms and acceptable use policy before submitting this form. Requests
will be processed in 1-2 days.
extra_gated_prompt: "**Your Hugging Face account email address MUST match the email you provide on the Meta website, or your request will not be approved.**"
extra_gated_button_content: Submit
extra_gated_fields:
I agree to share my name, email address and username with Meta and confirm that I have already been granted download access on the Meta website: checkbox
language:
- en
pipeline_tag: text-generation
inference: false
tags:
- facebook
- meta
- pytorch
- llama
- llama-2
---
# **Llama 2**
Llama 2 is a collection of pretrained and fine-tuned generative text models ranging in scale from 7 billion to 70 billion parameters. This is the repository for the 7B fine-tuned model, optimized for dialogue use cases and converted for the Hugging Face Transformers format. Links to other models can be found in the index at the bottom.
## Model Details
*Note: Use of this model is governed by the Meta license. In order to download the model weights and tokenizer, please visit the [website](https://ai.meta.com/resources/models-and-libraries/llama-downloads/) and accept our License before requesting access here.*
Meta developed and publicly released the Llama 2 family of large language models (LLMs), a collection of pretrained and fine-tuned generative text models ranging in scale from 7 billion to 70 billion parameters. Our fine-tuned LLMs, called Llama-2-Chat, are optimized for dialogue use cases. Llama-2-Chat models outperform open-source chat models on most benchmarks we tested, and in our human evaluations for helpfulness and safety, are on par with some popular closed-source models like ChatGPT and PaLM.
**Model Developers** Meta
**Variations** Llama 2 comes in a range of parameter sizes — 7B, 13B, and 70B — as well as pretrained and fine-tuned variations.
**Input** Models input text only.
**Output** Models generate text only.
**Model Architecture** Llama 2 is an auto-regressive language model that uses an optimized transformer architecture. The tuned versions use supervised fine-tuning (SFT) and reinforcement learning with human feedback (RLHF) to align to human preferences for helpfulness and safety.
||Training Data|Params|Content Length|GQA|Tokens|LR|
|---|---|---|---|---|---|---|
|Llama 2|*A new mix of publicly available online data*|7B|4k|✗|2.0T|3.0 x 10<sup>-4</sup>|
|Llama 2|*A new mix of publicly available online data*|13B|4k|✗|2.0T|3.0 x 10<sup>-4</sup>|
|Llama 2|*A new mix of publicly available online data*|70B|4k|✔|2.0T|1.5 x 10<sup>-4</sup>|
*Llama 2 family of models.* Token counts refer to pretraining data only. All models are trained with a global batch-size of 4M tokens. Bigger models - 70B -- use Grouped-Query Attention (GQA) for improved inference scalability.
**Model Dates** Llama 2 was trained between January 2023 and July 2023.
**Status** This is a static model trained on an offline dataset. Future versions of the tuned models will be released as we improve model safety with community feedback.
**License** A custom commercial license is available at: [https://ai.meta.com/resources/models-and-libraries/llama-downloads/](https://ai.meta.com/resources/models-and-libraries/llama-downloads/)
## Intended Use
**Intended Use Cases** Llama 2 is intended for commercial and research use in English. Tuned models are intended for assistant-like chat, whereas pretrained models can be adapted for a variety of natural language generation tasks.
To get the expected features and performance for the chat versions, a specific formatting needs to be followed, including the `INST` and `<<SYS>>` tags, `BOS` and `EOS` tokens, and the whitespaces and breaklines in between (we recommend calling `strip()` on inputs to avoid double-spaces). See our reference code in github for details: [`chat_completion`](https://github.com/facebookresearch/llama/blob/main/llama/generation.py#L212).
**Out-of-scope Uses** Use in any manner that violates applicable laws or regulations (including trade compliance laws).Use in languages other than English. Use in any other way that is prohibited by the Acceptable Use Policy and Licensing Agreement for Llama 2.
## Hardware and Software
**Training Factors** We used custom training libraries, Meta's Research Super Cluster, and production clusters for pretraining. Fine-tuning, annotation, and evaluation were also performed on third-party cloud compute.
**Carbon Footprint** Pretraining utilized a cumulative 3.3M GPU hours of computation on hardware of type A100-80GB (TDP of 350-400W). Estimated total emissions were 539 tCO2eq, 100% of which were offset by Meta’s sustainability program.
||Time (GPU hours)|Power Consumption (W)|Carbon Emitted(tCO<sub>2</sub>eq)|
|---|---|---|---|
|Llama 2 7B|184320|400|31.22|
|Llama 2 13B|368640|400|62.44|
|Llama 2 70B|1720320|400|291.42|
|Total|3311616||539.00|
**CO<sub>2</sub> emissions during pretraining.** Time: total GPU time required for training each model. Power Consumption: peak power capacity per GPU device for the GPUs used adjusted for power usage efficiency. 100% of the emissions are directly offset by Meta's sustainability program, and because we are openly releasing these models, the pretraining costs do not need to be incurred by others.
## Training Data
**Overview** Llama 2 was pretrained on 2 trillion tokens of data from publicly available sources. The fine-tuning data includes publicly available instruction datasets, as well as over one million new human-annotated examples. Neither the pretraining nor the fine-tuning datasets include Meta user data.
**Data Freshness** The pretraining data has a cutoff of September 2022, but some tuning data is more recent, up to July 2023.
## Evaluation Results
In this section, we report the results for the Llama 1 and Llama 2 models on standard academic benchmarks.For all the evaluations, we use our internal evaluations library.
|Model|Size|Code|Commonsense Reasoning|World Knowledge|Reading Comprehension|Math|MMLU|BBH|AGI Eval|
|---|---|---|---|---|---|---|---|---|---|
|Llama 1|7B|14.1|60.8|46.2|58.5|6.95|35.1|30.3|23.9|
|Llama 1|13B|18.9|66.1|52.6|62.3|10.9|46.9|37.0|33.9|
|Llama 1|33B|26.0|70.0|58.4|67.6|21.4|57.8|39.8|41.7|
|Llama 1|65B|30.7|70.7|60.5|68.6|30.8|63.4|43.5|47.6|
|Llama 2|7B|16.8|63.9|48.9|61.3|14.6|45.3|32.6|29.3|
|Llama 2|13B|24.5|66.9|55.4|65.8|28.7|54.8|39.4|39.1|
|Llama 2|70B|**37.5**|**71.9**|**63.6**|**69.4**|**35.2**|**68.9**|**51.2**|**54.2**|
**Overall performance on grouped academic benchmarks.** *Code:* We report the average pass@1 scores of our models on HumanEval and MBPP. *Commonsense Reasoning:* We report the average of PIQA, SIQA, HellaSwag, WinoGrande, ARC easy and challenge, OpenBookQA, and CommonsenseQA. We report 7-shot results for CommonSenseQA and 0-shot results for all other benchmarks. *World Knowledge:* We evaluate the 5-shot performance on NaturalQuestions and TriviaQA and report the average. *Reading Comprehension:* For reading comprehension, we report the 0-shot average on SQuAD, QuAC, and BoolQ. *MATH:* We report the average of the GSM8K (8 shot) and MATH (4 shot) benchmarks at top 1.
|||TruthfulQA|Toxigen|
|---|---|---|---|
|Llama 1|7B|27.42|23.00|
|Llama 1|13B|41.74|23.08|
|Llama 1|33B|44.19|22.57|
|Llama 1|65B|48.71|21.77|
|Llama 2|7B|33.29|**21.25**|
|Llama 2|13B|41.86|26.10|
|Llama 2|70B|**50.18**|24.60|
**Evaluation of pretrained LLMs on automatic safety benchmarks.** For TruthfulQA, we present the percentage of generations that are both truthful and informative (the higher the better). For ToxiGen, we present the percentage of toxic generations (the smaller the better).
|||TruthfulQA|Toxigen|
|---|---|---|---|
|Llama-2-Chat|7B|57.04|**0.00**|
|Llama-2-Chat|13B|62.18|**0.00**|
|Llama-2-Chat|70B|**64.14**|0.01|
**Evaluation of fine-tuned LLMs on different safety datasets.** Same metric definitions as above.
## Ethical Considerations and Limitations
Llama 2 is a new technology that carries risks with use. Testing conducted to date has been in English, and has not covered, nor could it cover all scenarios. For these reasons, as with all LLMs, Llama 2’s potential outputs cannot be predicted in advance, and the model may in some instances produce inaccurate, biased or other objectionable responses to user prompts. Therefore, before deploying any applications of Llama 2, developers should perform safety testing and tuning tailored to their specific applications of the model.
Please see the Responsible Use Guide available at [https://ai.meta.com/llama/responsible-use-guide/](https://ai.meta.com/llama/responsible-use-guide)
## Reporting Issues
Please report any software “bug,” or other problems with the models through one of the following means:
- Reporting issues with the model: [github.com/facebookresearch/llama](http://github.com/facebookresearch/llama)
- Reporting problematic content generated by the model: [developers.facebook.com/llama_output_feedback](http://developers.facebook.com/llama_output_feedback)
- Reporting bugs and security concerns: [facebook.com/whitehat/info](http://facebook.com/whitehat/info)
## Llama Model Index
|Model|Llama2|Llama2-hf|Llama2-chat|Llama2-chat-hf|
|---|---|---|---|---|
|7B| [Link](https://huggingface.co/llamaste/Llama-2-7b) | [Link](https://huggingface.co/llamaste/Llama-2-7b-hf) | [Link](https://huggingface.co/llamaste/Llama-2-7b-chat) | [Link](https://huggingface.co/llamaste/Llama-2-7b-chat-hf)|
|13B| [Link](https://huggingface.co/llamaste/Llama-2-13b) | [Link](https://huggingface.co/llamaste/Llama-2-13b-hf) | [Link](https://huggingface.co/llamaste/Llama-2-13b-chat) | [Link](https://huggingface.co/llamaste/Llama-2-13b-hf)|
|70B| [Link](https://huggingface.co/llamaste/Llama-2-70b) | [Link](https://huggingface.co/llamaste/Llama-2-70b-hf) | [Link](https://huggingface.co/llamaste/Llama-2-70b-chat) | [Link](https://huggingface.co/llamaste/Llama-2-70b-hf)|
| 10,294 | [
[
-0.0165863037109375,
-0.052734375,
0.028106689453125,
0.01451873779296875,
-0.0285186767578125,
0.01702880859375,
-0.0033168792724609375,
-0.056182861328125,
0.004383087158203125,
0.0236358642578125,
-0.052581787109375,
-0.0430908203125,
-0.050140380859375,
... |
TheBloke/airoboros-mistral2.2-7B-GPTQ | 2023-10-04T19:15:20.000Z | [
"transformers",
"safetensors",
"mistral",
"text-generation",
"llama-2",
"instruct",
"finetune",
"alpaca",
"gpt4",
"synthetic data",
"distillation",
"en",
"dataset:jondurbin/airoboros-2.2.1",
"license:mit",
"text-generation-inference",
"region:us"
] | text-generation | TheBloke | null | null | TheBloke/airoboros-mistral2.2-7B-GPTQ | 4 | 884 | transformers | 2023-10-03T21:52:41 | ---
base_model: teknium/airoboros-mistral2.2-7b
datasets:
- jondurbin/airoboros-2.2.1
inference: false
language:
- en
license: mit
model-index:
- name: airoboros2.2-mistral-7b
results: []
model_creator: Teknium
model_name: Airoboros Mistral2.2 7B
model_type: mistral
prompt_template: 'USER: {prompt}
ASSISTANT:
'
quantized_by: TheBloke
tags:
- llama-2
- instruct
- finetune
- alpaca
- gpt4
- synthetic data
- distillation
---
<!-- header start -->
<!-- 200823 -->
<div style="width: auto; margin-left: auto; margin-right: auto">
<img src="https://i.imgur.com/EBdldam.jpg" alt="TheBlokeAI" style="width: 100%; min-width: 400px; display: block; margin: auto;">
</div>
<div style="display: flex; justify-content: space-between; width: 100%;">
<div style="display: flex; flex-direction: column; align-items: flex-start;">
<p style="margin-top: 0.5em; margin-bottom: 0em;"><a href="https://discord.gg/theblokeai">Chat & support: TheBloke's Discord server</a></p>
</div>
<div style="display: flex; flex-direction: column; align-items: flex-end;">
<p style="margin-top: 0.5em; margin-bottom: 0em;"><a href="https://www.patreon.com/TheBlokeAI">Want to contribute? TheBloke's Patreon page</a></p>
</div>
</div>
<div style="text-align:center; margin-top: 0em; margin-bottom: 0em"><p style="margin-top: 0.25em; margin-bottom: 0em;">TheBloke's LLM work is generously supported by a grant from <a href="https://a16z.com">andreessen horowitz (a16z)</a></p></div>
<hr style="margin-top: 1.0em; margin-bottom: 1.0em;">
<!-- header end -->
# Airoboros Mistral2.2 7B - GPTQ
- Model creator: [Teknium](https://huggingface.co/teknium)
- Original model: [Airoboros Mistral2.2 7B](https://huggingface.co/teknium/airoboros-mistral2.2-7b)
<!-- description start -->
## Description
This repo contains GPTQ model files for [Teknium's Airoboros Mistral2.2 7B](https://huggingface.co/teknium/airoboros-mistral2.2-7b).
Multiple GPTQ parameter permutations are provided; see Provided Files below for details of the options provided, their parameters, and the software used to create them.
<!-- description end -->
<!-- repositories-available start -->
## Repositories available
* [AWQ model(s) for GPU inference.](https://huggingface.co/TheBloke/airoboros-mistral2.2-7B-AWQ)
* [GPTQ models for GPU inference, with multiple quantisation parameter options.](https://huggingface.co/TheBloke/airoboros-mistral2.2-7B-GPTQ)
* [2, 3, 4, 5, 6 and 8-bit GGUF models for CPU+GPU inference](https://huggingface.co/TheBloke/airoboros-mistral2.2-7B-GGUF)
* [Teknium's original unquantised fp16 model in pytorch format, for GPU inference and for further conversions](https://huggingface.co/teknium/airoboros-mistral2.2-7b)
<!-- repositories-available end -->
<!-- prompt-template start -->
## Prompt template: User-Assistant
```
USER: {prompt}
ASSISTANT:
```
<!-- prompt-template end -->
<!-- README_GPTQ.md-provided-files start -->
## Provided files, and GPTQ parameters
Multiple quantisation parameters are provided, to allow you to choose the best one for your hardware and requirements.
Each separate quant is in a different branch. See below for instructions on fetching from different branches.
Most GPTQ files are made with AutoGPTQ. Mistral models are currently made with Transformers.
<details>
<summary>Explanation of GPTQ parameters</summary>
- Bits: The bit size of the quantised model.
- GS: GPTQ group size. Higher numbers use less VRAM, but have lower quantisation accuracy. "None" is the lowest possible value.
- Act Order: True or False. Also known as `desc_act`. True results in better quantisation accuracy. Some GPTQ clients have had issues with models that use Act Order plus Group Size, but this is generally resolved now.
- Damp %: A GPTQ parameter that affects how samples are processed for quantisation. 0.01 is default, but 0.1 results in slightly better accuracy.
- GPTQ dataset: The calibration dataset used during quantisation. Using a dataset more appropriate to the model's training can improve quantisation accuracy. Note that the GPTQ calibration dataset is not the same as the dataset used to train the model - please refer to the original model repo for details of the training dataset(s).
- Sequence Length: The length of the dataset sequences used for quantisation. Ideally this is the same as the model sequence length. For some very long sequence models (16+K), a lower sequence length may have to be used. Note that a lower sequence length does not limit the sequence length of the quantised model. It only impacts the quantisation accuracy on longer inference sequences.
- ExLlama Compatibility: Whether this file can be loaded with ExLlama, which currently only supports Llama models in 4-bit.
</details>
| Branch | Bits | GS | Act Order | Damp % | GPTQ Dataset | Seq Len | Size | ExLlama | Desc |
| ------ | ---- | -- | --------- | ------ | ------------ | ------- | ---- | ------- | ---- |
| [main](https://huggingface.co/TheBloke/airoboros-mistral2.2-7B-GPTQ/tree/main) | 4 | 128 | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 32768 | 4.16 GB | Yes | 4-bit, with Act Order and group size 128g. Uses even less VRAM than 64g, but with slightly lower accuracy. |
| [gptq-4bit-32g-actorder_True](https://huggingface.co/TheBloke/airoboros-mistral2.2-7B-GPTQ/tree/gptq-4bit-32g-actorder_True) | 4 | 32 | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 32768 | 4.57 GB | Yes | 4-bit, with Act Order and group size 32g. Gives highest possible inference quality, with maximum VRAM usage. |
| [gptq-8bit--1g-actorder_True](https://huggingface.co/TheBloke/airoboros-mistral2.2-7B-GPTQ/tree/gptq-8bit--1g-actorder_True) | 8 | None | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 32768 | 7.52 GB | No | 8-bit, with Act Order. No group size, to lower VRAM requirements. |
| [gptq-8bit-128g-actorder_True](https://huggingface.co/TheBloke/airoboros-mistral2.2-7B-GPTQ/tree/gptq-8bit-128g-actorder_True) | 8 | 128 | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 32768 | 7.68 GB | No | 8-bit, with group size 128g for higher inference quality and with Act Order for even higher accuracy. |
| [gptq-8bit-32g-actorder_True](https://huggingface.co/TheBloke/airoboros-mistral2.2-7B-GPTQ/tree/gptq-8bit-32g-actorder_True) | 8 | 32 | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 32768 | 8.17 GB | No | 8-bit, with group size 32g and Act Order for maximum inference quality. |
| [gptq-4bit-64g-actorder_True](https://huggingface.co/TheBloke/airoboros-mistral2.2-7B-GPTQ/tree/gptq-4bit-64g-actorder_True) | 4 | 64 | Yes | 0.1 | [wikitext](https://huggingface.co/datasets/wikitext/viewer/wikitext-2-v1/test) | 32768 | 4.29 GB | Yes | 4-bit, with Act Order and group size 64g. Uses less VRAM than 32g, but with slightly lower accuracy. |
<!-- README_GPTQ.md-provided-files end -->
<!-- README_GPTQ.md-download-from-branches start -->
## How to download, including from branches
### In text-generation-webui
To download from the `main` branch, enter `TheBloke/airoboros-mistral2.2-7B-GPTQ` in the "Download model" box.
To download from another branch, add `:branchname` to the end of the download name, eg `TheBloke/airoboros-mistral2.2-7B-GPTQ:gptq-4bit-32g-actorder_True`
### From the command line
I recommend using the `huggingface-hub` Python library:
```shell
pip3 install huggingface-hub
```
To download the `main` branch to a folder called `airoboros-mistral2.2-7B-GPTQ`:
```shell
mkdir airoboros-mistral2.2-7B-GPTQ
huggingface-cli download TheBloke/airoboros-mistral2.2-7B-GPTQ --local-dir airoboros-mistral2.2-7B-GPTQ --local-dir-use-symlinks False
```
To download from a different branch, add the `--revision` parameter:
```shell
mkdir airoboros-mistral2.2-7B-GPTQ
huggingface-cli download TheBloke/airoboros-mistral2.2-7B-GPTQ --revision gptq-4bit-32g-actorder_True --local-dir airoboros-mistral2.2-7B-GPTQ --local-dir-use-symlinks False
```
<details>
<summary>More advanced huggingface-cli download usage</summary>
If you remove the `--local-dir-use-symlinks False` parameter, the files will instead be stored in the central Huggingface cache directory (default location on Linux is: `~/.cache/huggingface`), and symlinks will be added to the specified `--local-dir`, pointing to their real location in the cache. This allows for interrupted downloads to be resumed, and allows you to quickly clone the repo to multiple places on disk without triggering a download again. The downside, and the reason why I don't list that as the default option, is that the files are then hidden away in a cache folder and it's harder to know where your disk space is being used, and to clear it up if/when you want to remove a download model.
The cache location can be changed with the `HF_HOME` environment variable, and/or the `--cache-dir` parameter to `huggingface-cli`.
For more documentation on downloading with `huggingface-cli`, please see: [HF -> Hub Python Library -> Download files -> Download from the CLI](https://huggingface.co/docs/huggingface_hub/guides/download#download-from-the-cli).
To accelerate downloads on fast connections (1Gbit/s or higher), install `hf_transfer`:
```shell
pip3 install hf_transfer
```
And set environment variable `HF_HUB_ENABLE_HF_TRANSFER` to `1`:
```shell
mkdir airoboros-mistral2.2-7B-GPTQ
HF_HUB_ENABLE_HF_TRANSFER=1 huggingface-cli download TheBloke/airoboros-mistral2.2-7B-GPTQ --local-dir airoboros-mistral2.2-7B-GPTQ --local-dir-use-symlinks False
```
Windows Command Line users: You can set the environment variable by running `set HF_HUB_ENABLE_HF_TRANSFER=1` before the download command.
</details>
### With `git` (**not** recommended)
To clone a specific branch with `git`, use a command like this:
```shell
git clone --single-branch --branch gptq-4bit-32g-actorder_True https://huggingface.co/TheBloke/airoboros-mistral2.2-7B-GPTQ
```
Note that using Git with HF repos is strongly discouraged. It will be much slower than using `huggingface-hub`, and will use twice as much disk space as it has to store the model files twice (it stores every byte both in the intended target folder, and again in the `.git` folder as a blob.)
<!-- README_GPTQ.md-download-from-branches end -->
<!-- README_GPTQ.md-text-generation-webui start -->
## How to easily download and use this model in [text-generation-webui](https://github.com/oobabooga/text-generation-webui).
Please make sure you're using the latest version of [text-generation-webui](https://github.com/oobabooga/text-generation-webui).
It is strongly recommended to use the text-generation-webui one-click-installers unless you're sure you know how to make a manual install.
1. Click the **Model tab**.
2. Under **Download custom model or LoRA**, enter `TheBloke/airoboros-mistral2.2-7B-GPTQ`.
- To download from a specific branch, enter for example `TheBloke/airoboros-mistral2.2-7B-GPTQ:gptq-4bit-32g-actorder_True`
- see Provided Files above for the list of branches for each option.
3. Click **Download**.
4. The model will start downloading. Once it's finished it will say "Done".
5. In the top left, click the refresh icon next to **Model**.
6. In the **Model** dropdown, choose the model you just downloaded: `airoboros-mistral2.2-7B-GPTQ`
7. The model will automatically load, and is now ready for use!
8. If you want any custom settings, set them and then click **Save settings for this model** followed by **Reload the Model** in the top right.
* Note that you do not need to and should not set manual GPTQ parameters any more. These are set automatically from the file `quantize_config.json`.
9. Once you're ready, click the **Text Generation tab** and enter a prompt to get started!
<!-- README_GPTQ.md-text-generation-webui end -->
<!-- README_GPTQ.md-use-from-tgi start -->
## Serving this model from Text Generation Inference (TGI)
It's recommended to use TGI version 1.1.0 or later. The official Docker container is: `ghcr.io/huggingface/text-generation-inference:1.1.0`
Example Docker parameters:
```shell
--model-id TheBloke/airoboros-mistral2.2-7B-GPTQ --port 3000 --quantize awq --max-input-length 3696 --max-total-tokens 4096 --max-batch-prefill-tokens 4096
```
Example Python code for interfacing with TGI (requires huggingface-hub 0.17.0 or later):
```shell
pip3 install huggingface-hub
```
```python
from huggingface_hub import InferenceClient
endpoint_url = "https://your-endpoint-url-here"
prompt = "Tell me about AI"
prompt_template=f'''USER: {prompt}
ASSISTANT:
'''
client = InferenceClient(endpoint_url)
response = client.text_generation(prompt,
max_new_tokens=128,
do_sample=True,
temperature=0.7,
top_p=0.95,
top_k=40,
repetition_penalty=1.1)
print(f"Model output: {response}")
```
<!-- README_GPTQ.md-use-from-tgi end -->
<!-- README_GPTQ.md-use-from-python start -->
## How to use this GPTQ model from Python code
### Install the necessary packages
Requires: Transformers 4.33.0 or later, Optimum 1.12.0 or later, and AutoGPTQ 0.4.2 or later.
```shell
pip3 install transformers optimum
pip3 install auto-gptq --extra-index-url https://huggingface.github.io/autogptq-index/whl/cu118/ # Use cu117 if on CUDA 11.7
```
If you have problems installing AutoGPTQ using the pre-built wheels, install it from source instead:
```shell
pip3 uninstall -y auto-gptq
git clone https://github.com/PanQiWei/AutoGPTQ
cd AutoGPTQ
git checkout v0.4.2
pip3 install .
```
### You can then use the following code
```python
from transformers import AutoModelForCausalLM, AutoTokenizer, pipeline
model_name_or_path = "TheBloke/airoboros-mistral2.2-7B-GPTQ"
# To use a different branch, change revision
# For example: revision="gptq-4bit-32g-actorder_True"
model = AutoModelForCausalLM.from_pretrained(model_name_or_path,
device_map="auto",
trust_remote_code=False,
revision="main")
tokenizer = AutoTokenizer.from_pretrained(model_name_or_path, use_fast=True)
prompt = "Tell me about AI"
prompt_template=f'''USER: {prompt}
ASSISTANT:
'''
print("\n\n*** Generate:")
input_ids = tokenizer(prompt_template, return_tensors='pt').input_ids.cuda()
output = model.generate(inputs=input_ids, temperature=0.7, do_sample=True, top_p=0.95, top_k=40, max_new_tokens=512)
print(tokenizer.decode(output[0]))
# Inference can also be done using transformers' pipeline
print("*** Pipeline:")
pipe = pipeline(
"text-generation",
model=model,
tokenizer=tokenizer,
max_new_tokens=512,
do_sample=True,
temperature=0.7,
top_p=0.95,
top_k=40,
repetition_penalty=1.1
)
print(pipe(prompt_template)[0]['generated_text'])
```
<!-- README_GPTQ.md-use-from-python end -->
<!-- README_GPTQ.md-compatibility start -->
## Compatibility
The files provided are tested to work with AutoGPTQ, both via Transformers and using AutoGPTQ directly. They should also work with [Occ4m's GPTQ-for-LLaMa fork](https://github.com/0cc4m/KoboldAI).
[ExLlama](https://github.com/turboderp/exllama) is compatible with Llama and Mistral models in 4-bit. Please see the Provided Files table above for per-file compatibility.
[Huggingface Text Generation Inference (TGI)](https://github.com/huggingface/text-generation-inference) is compatible with all GPTQ models.
<!-- README_GPTQ.md-compatibility end -->
<!-- footer start -->
<!-- 200823 -->
## Discord
For further support, and discussions on these models and AI in general, join us at:
[TheBloke AI's Discord server](https://discord.gg/theblokeai)
## Thanks, and how to contribute
Thanks to the [chirper.ai](https://chirper.ai) team!
Thanks to Clay from [gpus.llm-utils.org](llm-utils)!
I've had a lot of people ask if they can contribute. I enjoy providing models and helping people, and would love to be able to spend even more time doing it, as well as expanding into new projects like fine tuning/training.
If you're able and willing to contribute it will be most gratefully received and will help me to keep providing more models, and to start work on new AI projects.
Donaters will get priority support on any and all AI/LLM/model questions and requests, access to a private Discord room, plus other benefits.
* Patreon: https://patreon.com/TheBlokeAI
* Ko-Fi: https://ko-fi.com/TheBlokeAI
**Special thanks to**: Aemon Algiz.
**Patreon special mentions**: Pierre Kircher, Stanislav Ovsiannikov, Michael Levine, Eugene Pentland, Andrey, 준교 김, Randy H, Fred von Graf, Artur Olbinski, Caitlyn Gatomon, terasurfer, Jeff Scroggin, James Bentley, Vadim, Gabriel Puliatti, Harry Royden McLaughlin, Sean Connelly, Dan Guido, Edmond Seymore, Alicia Loh, subjectnull, AzureBlack, Manuel Alberto Morcote, Thomas Belote, Lone Striker, Chris Smitley, Vitor Caleffi, Johann-Peter Hartmann, Clay Pascal, biorpg, Brandon Frisco, sidney chen, transmissions 11, Pedro Madruga, jinyuan sun, Ajan Kanaga, Emad Mostaque, Trenton Dambrowitz, Jonathan Leane, Iucharbius, usrbinkat, vamX, George Stoitzev, Luke Pendergrass, theTransient, Olakabola, Swaroop Kallakuri, Cap'n Zoog, Brandon Phillips, Michael Dempsey, Nikolai Manek, danny, Matthew Berman, Gabriel Tamborski, alfie_i, Raymond Fosdick, Tom X Nguyen, Raven Klaugh, LangChain4j, Magnesian, Illia Dulskyi, David Ziegler, Mano Prime, Luis Javier Navarrete Lozano, Erik Bjäreholt, 阿明, Nathan Dryer, Alex, Rainer Wilmers, zynix, TL, Joseph William Delisle, John Villwock, Nathan LeClaire, Willem Michiel, Joguhyik, GodLy, OG, Alps Aficionado, Jeffrey Morgan, ReadyPlayerEmma, Tiffany J. Kim, Sebastain Graf, Spencer Kim, Michael Davis, webtim, Talal Aujan, knownsqashed, John Detwiler, Imad Khwaja, Deo Leter, Jerry Meng, Elijah Stavena, Rooh Singh, Pieter, SuperWojo, Alexandros Triantafyllidis, Stephen Murray, Ai Maven, ya boyyy, Enrico Ros, Ken Nordquist, Deep Realms, Nicholas, Spiking Neurons AB, Elle, Will Dee, Jack West, RoA, Luke @flexchar, Viktor Bowallius, Derek Yates, Subspace Studios, jjj, Toran Billups, Asp the Wyvern, Fen Risland, Ilya, NimbleBox.ai, Chadd, Nitin Borwankar, Emre, Mandus, Leonard Tan, Kalila, K, Trailburnt, S_X, Cory Kujawski
Thank you to all my generous patrons and donaters!
And thank you again to a16z for their generous grant.
<!-- footer end -->
# Original model card: Teknium's Airoboros Mistral2.2 7B
Mistral trained with the airoboros dataset!

Actual dataset is airoboros 2.2, but it seems to have been replaced on hf with 2.2.1.
Prompt Format:
```
USER: <prompt>
ASSISTANT:
```
TruthfulQA:
```
hf-causal-experimental (pretrained=/home/teknium/dakota/lm-evaluation-harness/airoboros2.2-mistral/,dtype=float16), limit: None, provide_description: False, num_fewshot: 0, batch_size: 8
| Task |Version|Metric|Value | |Stderr|
|-------------|------:|------|-----:|---|-----:|
|truthfulqa_mc| 1|mc1 |0.3562|± |0.0168|
| | |mc2 |0.5217|± |0.0156|
```
Wandb training charts: https://wandb.ai/teknium1/airoboros-mistral-7b/runs/airoboros-mistral-1?workspace=user-teknium1
More info to come
| 19,579 | [
[
-0.037811279296875,
-0.05377197265625,
0.0083160400390625,
0.0127716064453125,
-0.0175933837890625,
-0.0146331787109375,
0.003871917724609375,
-0.032501220703125,
0.019439697265625,
0.021453857421875,
-0.0430908203125,
-0.034698486328125,
-0.028594970703125,
... |
Kwan0/layoutlmv3-base-finetune-DocLayNet-100k | 2023-10-14T13:46:16.000Z | [
"transformers",
"pytorch",
"layoutlmv3",
"token-classification",
"generated_from_trainer",
"dataset:pierreguillou/DocLayNet-large",
"model-index",
"autotrain_compatible",
"endpoints_compatible",
"region:us"
] | token-classification | Kwan0 | null | null | Kwan0/layoutlmv3-base-finetune-DocLayNet-100k | 1 | 884 | transformers | 2023-10-05T03:24:24 | ---
tags:
- generated_from_trainer
datasets:
- pierreguillou/DocLayNet-large
metrics:
- precision
- recall
- f1
- accuracy
base_model: microsoft/layoutlmv3-base
model-index:
- name: layoutlmv3-finetuned-doclaynet
results:
- task:
type: token-classification
name: Token Classification
dataset:
name: pierreguillou/DocLayNet-large
type: pierreguillou/DocLayNet-large
args: doclaynet
metrics:
- type: precision
value: 0.847
name: Precision
- type: recall
value: 0.893
name: Recall
- type: f1
value: 0.870
name: F1
- type: accuracy
value: 0.957
name: Accuracy
---
# layoutlmv3-finetuned-funsd
This model is a fine-tuned version of [microsoft/layoutlmv3-base](https://huggingface.co/microsoft/layoutlmv3-base) on the pierreguillou/DocLayNet-large using bounding boxes and
categories for lines (not for for paragraphs).
It achieves the following results on the evaluation set:
- Loss: 0.33888205885887146,
- Precision: 0.8478835766832817,
- Recall: 0.8934488524091807,
- F1: 0.8700700634847538,
- Accuracy: 0.9574140990541197
The script for training can be found here: https://github.com/huggingface/transformers/tree/main/examples/research_projects/layoutlmv3
More information needed
## Training procedure
### Training hyperparameters
The following hyperparameters were used during training:
- learning_rate: 1e-05
- train_batch_size: 2
- eval_batch_size: 2
- training_steps: 100000
### Framework versions
- Transformers 4.33.3
- Pytorch 1.11.0+cu115
- Datasets 2.14.5
- Tokenizers 0.13.3
| 1,600 | [
[
-0.033172607421875,
-0.045440673828125,
0.027557373046875,
0.027557373046875,
-0.015716552734375,
-0.023956298828125,
0.01068115234375,
0.0104217529296875,
0.015289306640625,
0.0440673828125,
-0.05657958984375,
-0.0506591796875,
-0.0198516845703125,
-0.02778... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.