_id
stringlengths
64
64
repository
stringlengths
6
84
name
stringlengths
4
110
content
stringlengths
0
248k
license
null
download_url
stringlengths
89
454
language
stringclasses
7 values
comments
stringlengths
0
74.6k
code
stringlengths
0
248k
2eee94a6e94c8cae548ba217181e5a7a93a1a17bee1792fda5036e1c116bb5cb
diagrams/diagrams-lib
Names.hs
{-# LANGUAGE ConstraintKinds #-} # LANGUAGE FlexibleContexts # {-# LANGUAGE MonoLocalBinds #-} # OPTIONS_GHC -fno - warn - unused - imports # for Data . Semigroup ----------------------------------------------------------------------------- -- | -- Module : Diagrams.Names Copyright : ( c ) 2013 diagrams - lib team ( see LICENSE ) -- License : BSD-style (see LICENSE) -- Maintainer : -- -- Names can be given to subdiagrams, and subdiagrams can later be -- queried by name. This module exports types for representing names -- and subdiagrams, and various functions for working with them. -- ----------------------------------------------------------------------------- module Diagrams.Names ( -- * Names AName, Name, IsName(..), (.>) , Qualifiable(..) -- * Subdiagrams , Subdiagram, mkSubdiagram, subPoint, getSub, rawSub, location -- * Subdiagram maps , SubMap, fromNames, rememberAs, lookupSub -- * Naming things , named, nameSub, namePoint, localize -- * Querying by name , names , lookupName , withName, withNameAll, withNames ) where import Data.Semigroup import Diagrams.Core (OrderedField, Point) import Diagrams.Core.Names import Diagrams.Core.Types import Linear.Metric -- | Attach an atomic name to a diagram. named :: (IsName nm, Metric v, OrderedField n, Semigroup m) => nm -> QDiagram b v n m -> QDiagram b v n m named = nameSub mkSubdiagram -- | Attach an atomic name to a certain point (which may be computed -- from the given diagram), treated as a subdiagram with no content -- and a point envelope. namePoint :: (IsName nm , Metric v, OrderedField n, Semigroup m) => (QDiagram b v n m -> Point v n) -> nm -> QDiagram b v n m -> QDiagram b v n m namePoint p = nameSub (subPoint . p)
null
https://raw.githubusercontent.com/diagrams/diagrams-lib/6f66ce6bd5aed81d8a1330c143ea012724dbac3c/src/Diagrams/Names.hs
haskell
# LANGUAGE ConstraintKinds # # LANGUAGE MonoLocalBinds # --------------------------------------------------------------------------- | Module : Diagrams.Names License : BSD-style (see LICENSE) Maintainer : Names can be given to subdiagrams, and subdiagrams can later be queried by name. This module exports types for representing names and subdiagrams, and various functions for working with them. --------------------------------------------------------------------------- * Names * Subdiagrams * Subdiagram maps * Naming things * Querying by name | Attach an atomic name to a diagram. | Attach an atomic name to a certain point (which may be computed from the given diagram), treated as a subdiagram with no content and a point envelope.
# LANGUAGE FlexibleContexts # # OPTIONS_GHC -fno - warn - unused - imports # for Data . Semigroup Copyright : ( c ) 2013 diagrams - lib team ( see LICENSE ) module Diagrams.Names AName, Name, IsName(..), (.>) , Qualifiable(..) , Subdiagram, mkSubdiagram, subPoint, getSub, rawSub, location , SubMap, fromNames, rememberAs, lookupSub , named, nameSub, namePoint, localize , names , lookupName , withName, withNameAll, withNames ) where import Data.Semigroup import Diagrams.Core (OrderedField, Point) import Diagrams.Core.Names import Diagrams.Core.Types import Linear.Metric named :: (IsName nm, Metric v, OrderedField n, Semigroup m) => nm -> QDiagram b v n m -> QDiagram b v n m named = nameSub mkSubdiagram namePoint :: (IsName nm , Metric v, OrderedField n, Semigroup m) => (QDiagram b v n m -> Point v n) -> nm -> QDiagram b v n m -> QDiagram b v n m namePoint p = nameSub (subPoint . p)
5ed5ecd394a3611e291dc7ccbcd42b1ce49eed0356889b59542fcd42f9050b40
uwplse/PUMPKIN-PATCH
abstractionconfig.mli
open Environ open Evd open Constr open Abstracters open Candidates open Proofdiff open Cutlemma open Stateutils (* --- Configuring Abstraction --- *) Caller configuration for abstraction type abstraction_config = { env : env; args_base : types list; args_goal : types list; cs : candidates; f_base : types; f_goal : types; strategies : abstraction_strategy list; } (* --- Defaults --- *) (* * Given an environment, a difference in goal types, and a list of candidates, * configure the default configuration for abstraction of arguments *) val configure_args : env -> types proof_diff -> candidates -> evar_map -> abstraction_config state * Given an environment , a list of differences between fixpoint cases , * and a list of candidates , configure function abstraction . * * This produces one configuration for each difference . * Given an environment, a list of differences between fixpoint cases, * and a list of candidates, configure function abstraction. * * This produces one configuration for each difference. *) val configure_fixpoint_cases : env -> types list -> candidates -> evar_map -> (abstraction_config list) state (* --- Cut Lemmas --- *) (* * These configuration functions are for when you cut search by a certain lemma, * so the type of the candidate may not be formatted well enough to infer how * to abstract it, but the supplied cut lemma type may be. * In those cases, we go with the cut lemma, though improvements * to search and abstraction should make this obsolete. *) (* * Given an environment, a lemma to cut by, and a list of candidates, * configure argument abstraction. *) val configure_cut_args : env -> cut_lemma -> candidates -> evar_map -> abstraction_config state (* --- Goals --- *) (* * These configuration functions are for the top-level abstract * command, which takes a goal type. We use the goal type * to infer the arguments, but we use the candidate itself * to infer which function to abstract. For now, this will fail * if the function is not obvious from the candidate. *) (* * Give an environment, a goal type, and a candidate, configure abstraction. * * Automatically infer which kind of abstraction to try from the goal type. *) val configure_from_goal : env -> types -> types -> evar_map -> abstraction_config state
null
https://raw.githubusercontent.com/uwplse/PUMPKIN-PATCH/73fd77ba49388fdc72702a252a8fa8f071a8e1ea/plugin/src/core/components/abstraction/abstractionconfig.mli
ocaml
--- Configuring Abstraction --- --- Defaults --- * Given an environment, a difference in goal types, and a list of candidates, * configure the default configuration for abstraction of arguments --- Cut Lemmas --- * These configuration functions are for when you cut search by a certain lemma, * so the type of the candidate may not be formatted well enough to infer how * to abstract it, but the supplied cut lemma type may be. * In those cases, we go with the cut lemma, though improvements * to search and abstraction should make this obsolete. * Given an environment, a lemma to cut by, and a list of candidates, * configure argument abstraction. --- Goals --- * These configuration functions are for the top-level abstract * command, which takes a goal type. We use the goal type * to infer the arguments, but we use the candidate itself * to infer which function to abstract. For now, this will fail * if the function is not obvious from the candidate. * Give an environment, a goal type, and a candidate, configure abstraction. * * Automatically infer which kind of abstraction to try from the goal type.
open Environ open Evd open Constr open Abstracters open Candidates open Proofdiff open Cutlemma open Stateutils Caller configuration for abstraction type abstraction_config = { env : env; args_base : types list; args_goal : types list; cs : candidates; f_base : types; f_goal : types; strategies : abstraction_strategy list; } val configure_args : env -> types proof_diff -> candidates -> evar_map -> abstraction_config state * Given an environment , a list of differences between fixpoint cases , * and a list of candidates , configure function abstraction . * * This produces one configuration for each difference . * Given an environment, a list of differences between fixpoint cases, * and a list of candidates, configure function abstraction. * * This produces one configuration for each difference. *) val configure_fixpoint_cases : env -> types list -> candidates -> evar_map -> (abstraction_config list) state val configure_cut_args : env -> cut_lemma -> candidates -> evar_map -> abstraction_config state val configure_from_goal : env -> types -> types -> evar_map -> abstraction_config state
1b70d5bcaa89b568b808229aecb267fd1e5d4ee0825c821dd14148c5c7e25d2f
ngless-toolkit/ngless
Tests.hs
Copyright 2013 - 2021 NGLess Authors - License : MIT - License: MIT -} # LANGUAGE TemplateHaskell , QuasiQuotes # -- | Unit tests are their own programme. -- Unit tests written in have less overhead than full integration tests -- in the tests/ directory, but are not always as convenient. module Main where import Test.Tasty import Test.Tasty.TH import Test.Tasty.HUnit import Text.Parsec (parse) import Text.Parsec.Combinator (eof) import System.Directory (removeDirectoryRecursive) import qualified Data.Vector.Storable as VS import qualified Data.ByteString.Char8 as B import qualified Data.Conduit as C import Data.Conduit ((.|)) import Control.Monad.State.Strict (execState, modify') import Data.Convertible (convert) import Data.Conduit.Algorithms.Async (conduitPossiblyCompressedFile) import Language import Interpret import Tokens import FileManagement import NGLess import NGLess.NGLEnvironment (setupTestEnvironment) import Interpretation.Unique import Data.Sam import Data.FastQ import Utils.Conduit import Utils.Samtools (samBamConduit) import Utils.Here import qualified Data.GFF as GFF import Tests.Utils import Tests.Count (tgroup_Count) import Tests.FastQ (tgroup_FastQ) import Tests.IntGroups (tgroup_IntGroups) import Tests.Language (tgroup_Language) import Tests.LoadFQDirectory (tgroup_LoadFQDirectory) import Tests.NGLessAPI (tgroup_NGLessAPI) import Tests.Parse (tgroup_Parse) import Tests.Samples (tgroup_Samples) import Tests.Select (tgroup_Select) import Tests.Types (tgroup_Types) import Tests.Validation (tgroup_Validation) import Tests.Vector (tgroup_Vector) import Tests.Write (tgroup_Write) test_FastQ = [tgroup_FastQ] test_Validation = [tgroup_Validation] test_Count = [tgroup_Count] test_Parse = [tgroup_Parse] test_Types = [tgroup_Types] test_NGLessAPI = [tgroup_NGLessAPI] test_Vector = [tgroup_Vector] test_IntGroups = [tgroup_IntGroups] test_Samples = [tgroup_Samples] test_Select = [tgroup_Select] test_Language = [tgroup_Language] test_LoadFqDir = [tgroup_LoadFQDirectory] test_Write = [tgroup_Write] -- The main test driver sets up the config options then uses the automatically -- generated function main = do setupTestEnvironment $(defaultMainGenerator) removeDirectoryRecursive "testing_directory_tmp" -- Test Tokens module tokenize' fn t = map snd <$> (tokenize fn t) case_tok_cr = TNewLine @=? (case parse (Tokens.eol <* eof) "test" "\r\n" of { Right t -> t; Left _ -> error "Parse failed"; }) case_tok_single_line_comment = tokenize' "test" with_comment @?= Right expected where with_comment = "a=0# comment\nb=1\n" expected = [TWord "a",TOperator '=',TExpr (ConstInt 0),TNewLine,TWord "b",TOperator '=',TExpr (ConstInt 1),TNewLine] case_tok_single_line_comment_cstyle = tokenize' "test" with_comment @?= Right expected where with_comment = "a=0// comment\nb=1\n" expected = [TWord "a",TOperator '=',TExpr (ConstInt 0),TNewLine,TWord "b",TOperator '=',TExpr (ConstInt 1),TNewLine] case_tok_multi_line_comment = tokenize' "test" with_comment @?= Right expected where with_comment = "a=0/* This\n\nwith\nlines*/\nb=1\n" expected = [TWord "a",TOperator '=',TExpr (ConstInt 0),TIndent 0,TNewLine,TWord "b",TOperator '=',TExpr (ConstInt 1),TNewLine] case_tok_word_ = tokenize' "test" "word_with_underscore" @?= Right expected where expected = [TWord "word_with_underscore"] -- Test Types case_indent_comment = isOk "ParseFailed" $ parsetest indent_comment case_indent_space = isOk "ParseFailed" $ parsetest indent_space indent_comment = "ngless '0.0'\n\ \reads = fastq('input1.fq')\n\ \reads = preprocess(reads) using |read|:\n\ \ read = read[5:]\n\ \ # comment \n" indent_space = "ngless '0.0'\n\ \reads = fastq('input1.fq')\n\ \reads = preprocess(reads) using |read|:\n\ \ read = read[5:]\n\ \ \n" -- Type Validate pre process operations sr i s q = NGOShortRead (ShortRead i s $ VS.generate (B.length q) (convert . B.index q)) case_pre_process_indexation_1 = _evalIndex' (sr "@IRIS" "AGTACCAA" "aa`aaaaa") [Just (NGOInteger 5), Nothing] @?= (sr "@IRIS" "CAA" "aaa") case_pre_process_indexation_2 = _evalIndex' (sr "@IRIS" "AGTACCAA" "aa`aaaaa") [Nothing, Just (NGOInteger 3)] @?= (sr "@IRIS" "AGT" "aa`") case_pre_process_indexation_3 = _evalIndex' (sr "@IRIS" "AGTACCAA" "aa`aaaaa") [Just (NGOInteger 2), Just (NGOInteger 5)] @?= (sr "@IRIS" "TAC" "`aa") _evalIndex' a b = case _evalIndex a b of Right v -> v Left err -> error (show err) case_pre_process_length_1 = _evalUnary UOpLen (sr "@IRIS" "AGTACCAA" "aa`aaaaa") @?= Right (NGOInteger 8) case_bop_gte_1 = evalBinary BOpGTE (NGOInteger 10) (NGOInteger 10) @?= Right (NGOBool True) case_bop_gte_2 = evalBinary BOpGTE (NGOInteger 11) (NGOInteger 10) @?= Right (NGOBool True) case_bop_gte_3 = evalBinary BOpGTE (NGOInteger 10) (NGOInteger 11) @?= Right (NGOBool False) case_bop_gt_1 = evalBinary BOpGT (NGOInteger 10) (NGOInteger 10) @?= Right (NGOBool False) case_bop_gt_2 = evalBinary BOpGT (NGOInteger 11) (NGOInteger 10) @?= Right (NGOBool True) case_bop_gt_3 = evalBinary BOpGT (NGOInteger 10) (NGOInteger 11) @?= Right (NGOBool False) case_bop_lt_1 = evalBinary BOpLT (NGOInteger 10) (NGOInteger 10) @?= Right (NGOBool False) case_bop_lt_2 = evalBinary BOpLT (NGOInteger 11) (NGOInteger 10) @?= Right (NGOBool False) case_bop_lt_3 = evalBinary BOpLT (NGOInteger 10) (NGOInteger 11) @?= Right (NGOBool True) case_bop_lte_1 = evalBinary BOpLTE (NGOInteger 10) (NGOInteger 10) @?= Right (NGOBool True) case_bop_lte_2 = evalBinary BOpLTE (NGOInteger 11) (NGOInteger 10) @?= Right (NGOBool False) case_bop_lte_3 = evalBinary BOpLTE (NGOInteger 10) (NGOInteger 11) @?= Right (NGOBool True) case_bop_eq_1 = evalBinary BOpEQ (NGOInteger 10) (NGOInteger 10) @?= Right (NGOBool True) case_bop_eq_2 = evalBinary BOpEQ (NGOInteger 10) (NGOInteger 0) @?= Right (NGOBool False) case_bop_neq_1 = evalBinary BOpNEQ (NGOInteger 0) (NGOInteger 10) @?= Right (NGOBool True) case_bop_neq_2 = evalBinary BOpNEQ (NGOInteger 10) (NGOInteger 10) @?= Right (NGOBool False) case_bop_add_1 = evalBinary BOpAdd (NGOInteger 0) (NGOInteger 10) @?= Right (NGOInteger 10) case_bop_add_2 = evalBinary BOpAdd (NGOInteger 10) (NGOInteger 0) @?= Right (NGOInteger 10) case_bop_add_3 = evalBinary BOpAdd (NGOInteger 10) (NGOInteger 10) @?= Right (NGOInteger 20) case_bop_mul_1 = evalBinary BOpMul (NGOInteger 0) (NGOInteger 10) @?= Right (NGOInteger 0) case_bop_mul_2 = evalBinary BOpMul (NGOInteger 10) (NGOInteger 0) @?= Right (NGOInteger 0) case_bop_mul_3 = evalBinary BOpMul (NGOInteger 10) (NGOInteger 10) @?= Right (NGOInteger 100) case_bop_add_path_1 = evalBinary BOpPathAppend (NGOString "dir") (NGOString "file") @?= Right (NGOString "dir/file") case_bop_add_path_2 = evalBinary BOpPathAppend (NGOString "dir/subdir") (NGOString "file") @?= Right (NGOString "dir/subdir/file") case_bop_add_path_3 = evalBinary BOpPathAppend (NGOString "dir/subdir/") (NGOString "file") @?= Right (NGOString "dir/subdir/file") case_bop_add_path_4 = evalBinary BOpPathAppend (NGOString "../dir/subdir/") (NGOString "file") @?= Right (NGOString "../dir/subdir/file") case_bop_add_path_5 = evalBinary BOpPathAppend (NGOString "/abs/dir/subdir/") (NGOString "file") @?= Right (NGOString "/abs/dir/subdir/file") case_uop_minus_1 = _evalUnary UOpMinus (NGOInteger 10) @?= Right (NGOInteger (-10)) case_uop_minus_2 = _evalUnary UOpMinus (NGOInteger (-10)) @?= Right (NGOInteger 10) -- case_template_id = takeBaseNameNoExtensions "a/B/c/d/xpto_1.fq" @?= takeBaseNameNoExtensions "a/B/c/d/xpto_1.fq" case_template = takeBaseNameNoExtensions "a/B/c/d/xpto_1.fq" @?= "xpto_1" samStats :: FilePath -> NGLessIO (Int, Int, Int) samStats fname = C.runConduit (samBamConduit fname .| linesVC 1024 .| samStatsC) >>= runNGLess case_sam20 = do sam <- testNGLessIO $ asTempFile sam20 "sam" >>= samStats sam @?= (5,0,0) where sam20 = [here| @SQ SN:I LN:230218 @PG ID:bwa PN:bwa VN:0.7.7-r441 CL:/home/luispedro/.local/share/ngless/bin/ngless-0.0.0-bwa mem -t 1 /home/luispedro/.local/share/ngless/data/sacCer3/Sequence/BWAIndex/reference.fa.gz /tmp/preprocessed_sample20.fq1804289383846930886.gz IRIS:7:1:17:394#0 4 * 0 0 * * 0 0 GTCAGGACAAGAAAGACAANTCCAATTNACATT aaabaa`]baaaaa_aab]D^^`b`aYDW]aba AS:i:0 XS:i:0 IRIS:7:1:17:800#0 4 * 0 0 * * 0 0 GGAAACACTACTTAGGCTTATAAGATCNGGTTGCGG ababbaaabaaaaa`]`ba`]`aaaaYD\\_a``XT AS:i:0 XS:i:0 IRIS:7:1:17:1757#0 4 * 0 0 * * 0 0 TTTTCTCGACGATTTCCACTCCTGGTCNAC aaaaaa``aaa`aaaa_^a```]][Z[DY^ AS:i:0 XS:i:0 IRIS:7:1:17:1479#0 4 * 0 0 * * 0 0 CATATTGTAGGGTGGATCTCGAAAGATATGAAAGAT abaaaaa`a```^aaaaa`_]aaa`aaa__a_X]`` AS:i:0 XS:i:0 IRIS:7:1:17:150#0 4 * 0 0 * * 0 0 TGATGTACTATGCATATGAACTTGTATGCAAAGTGG abaabaa`aaaaaaa^ba_]]aaa^aaaaa_^][aa AS:i:0 XS:i:0 |] Parse GFF lines case_trim_attrs_1 = GFF._trimString " x = 10" @?= "x = 10" case_trim_attrs_2 = GFF._trimString " x = 10 " @?= "x = 10" case_trim_attrs_3 = GFF._trimString "x = 10 " @?= "x = 10" case_trim_attrs_4 = GFF._trimString "x = 10" @?= "x = 10" case_trim_attrs_5 = GFF._trimString " X " @?= "X" case_parse_gff_line = GFF.readGffLine gff_line @?= Right gff_structure where gff_line = "chrI\tunknown\texon\t4124\t4358\t.\t-\t.\tgene_id \"Y74C9A.3\"; transcript_id \"NM_058260\"; gene_name \"Y74C9A.3\"; p_id \"P23728\"; tss_id \"TSS14501\";" gff_structure = GFF.GffLine "chrI" "unknown" "exon" 4124 4358 Nothing GFF.GffNegStrand (-1) attrsExpected attrsExpected = [("gene_id","Y74C9A.3"), ("transcript_id" ,"NM_058260"), ("gene_name", "Y74C9A.3"), ("p_id", "P23728"), ("tss_id", "TSS14501")] -- _parseGffAttributes case_parse_gff_atributes_normal_1 = GFF._parseGffAttributes "ID=chrI;dbxref=NCBI:NC_001133;Name=chrI" @?= [("ID","chrI"),("dbxref","NCBI:NC_001133"),("Name","chrI")] case_parse_gff_atributes_normal_2 = GFF._parseGffAttributes "gene_id=chrI;dbxref=NCBI:NC_001133;Name=chrI" @?= [("gene_id","chrI"),("dbxref","NCBI:NC_001133"),("Name","chrI")] case_parse_gff_atributes_trail_del = GFF._parseGffAttributes "gene_id=chrI;dbxref=NCBI:NC_001133;Name=chrI;" @?= [("gene_id","chrI"),("dbxref","NCBI:NC_001133"),("Name","chrI")] case_parse_gff_atributes_trail_del_space = GFF._parseGffAttributes "gene_id=chrI;dbxref=NCBI:NC_001133;Name=chrI; " @?= [("gene_id","chrI"),("dbxref","NCBI:NC_001133"),("Name","chrI")] case_calc_sam_stats = testNGLessIO (samStats "test_samples/sample.sam.gz") >>= \r -> r @?= (2772,1310,1299) --- Unique.hs File " test_samples / data_set_repeated.fq " has 216 reads in which 54 are unique . countC = loop (0 :: Int) where loop !n = C.await >>= maybe (return n) (const (loop $ n+1)) make_unique_test n = let enc = SolexaEncoding in do nuniq <- testNGLessIO $ do newfp <- performUnique "test_samples/data_set_repeated.fq" enc n C.runConduit $ conduitPossiblyCompressedFile newfp .| linesC .| fqDecodeC "testing" enc .| countC let n' = min n 4 nuniq @?= (n' * 54) case_unique_1 = make_unique_test 1 case_unique_2 = make_unique_test 2 case_unique_3 = make_unique_test 3 case_unique_4 = make_unique_test 4 case_unique_5 = make_unique_test 5 case_recursiveAnalyze = execState (recursiveAnalyse countFcalls expr) 0 @?= (1 :: Int) where countFcalls (FunctionCall _ _ _ _) = modify' (+1) countFcalls _ = return () expr = Assignment (Variable "varname") (FunctionCall (FuncName "count") (Lookup Nothing (Variable "mapped")) [(Variable "features", ListExpression [ConstStr "seqname"]) ,(Variable "multiple", ConstSymbol "all1")] Nothing) case_expand_path = do expandPath' "/nothing1/file.txt" [] @?= ["/nothing1/file.txt"] expandPath' "/nothing2/file.txt" [undefined] @?= ["/nothing2/file.txt"] expandPath' "/nothing3/file.txt" ["/home/luispedro/my-directory"] @?= ["/nothing3/file.txt"] expandPath' "<>/nothing4/file.txt" ["/home/luispedro/my-directory1"] @?= ["/home/luispedro/my-directory1/nothing4/file.txt"] expandPath' "<>/nothing4/file.txt" ["refs=/home/luispedro/my-directory1"] @?= [] expandPath' "<>/nothing/file.txt" ["/home/luispedro/my-directory" ,"/home/alternative/your-directory"] @?= ["/home/luispedro/my-directory/nothing/file.txt" ,"/home/alternative/your-directory/nothing/file.txt"] expandPath' "<refs>/nothing/file.txt" ["/home/luispedro/my-directory" ,"/home/alternative/your-directory"] @?= ["/home/luispedro/my-directory/nothing/file.txt" ,"/home/alternative/your-directory/nothing/file.txt"] expandPath' "<refs>/nothing/file.txt" ["refs=/home/luispedro/my-directory" ,"/home/alternative/your-directory"] @?= ["/home/luispedro/my-directory/nothing/file.txt" ,"/home/alternative/your-directory/nothing/file.txt"] expandPath' "<refs>/nothing/file.txt" ["refs=/home/luispedro/my-directory" ,"nope=/home/alternative/your-directory"] @?= ["/home/luispedro/my-directory/nothing/file.txt"] expandPath' "<refs>/nothing/file.txt" ["other=/home/luispedro/my-directory" ,"nope=/home/alternative/your-directory"] @?= [] expandPath' "<refs>/nothing/file.txt" [] @?= []
null
https://raw.githubusercontent.com/ngless-toolkit/ngless/c69baf7e00e807a82ec1b1276763f74f4a5411b2/Tests-Src/Tests.hs
haskell
| Unit tests are their own programme. in the tests/ directory, but are not always as convenient. The main test driver sets up the config options then uses the automatically generated function Test Tokens module Test Types Type Validate pre process operations _parseGffAttributes - Unique.hs
Copyright 2013 - 2021 NGLess Authors - License : MIT - License: MIT -} # LANGUAGE TemplateHaskell , QuasiQuotes # Unit tests written in have less overhead than full integration tests module Main where import Test.Tasty import Test.Tasty.TH import Test.Tasty.HUnit import Text.Parsec (parse) import Text.Parsec.Combinator (eof) import System.Directory (removeDirectoryRecursive) import qualified Data.Vector.Storable as VS import qualified Data.ByteString.Char8 as B import qualified Data.Conduit as C import Data.Conduit ((.|)) import Control.Monad.State.Strict (execState, modify') import Data.Convertible (convert) import Data.Conduit.Algorithms.Async (conduitPossiblyCompressedFile) import Language import Interpret import Tokens import FileManagement import NGLess import NGLess.NGLEnvironment (setupTestEnvironment) import Interpretation.Unique import Data.Sam import Data.FastQ import Utils.Conduit import Utils.Samtools (samBamConduit) import Utils.Here import qualified Data.GFF as GFF import Tests.Utils import Tests.Count (tgroup_Count) import Tests.FastQ (tgroup_FastQ) import Tests.IntGroups (tgroup_IntGroups) import Tests.Language (tgroup_Language) import Tests.LoadFQDirectory (tgroup_LoadFQDirectory) import Tests.NGLessAPI (tgroup_NGLessAPI) import Tests.Parse (tgroup_Parse) import Tests.Samples (tgroup_Samples) import Tests.Select (tgroup_Select) import Tests.Types (tgroup_Types) import Tests.Validation (tgroup_Validation) import Tests.Vector (tgroup_Vector) import Tests.Write (tgroup_Write) test_FastQ = [tgroup_FastQ] test_Validation = [tgroup_Validation] test_Count = [tgroup_Count] test_Parse = [tgroup_Parse] test_Types = [tgroup_Types] test_NGLessAPI = [tgroup_NGLessAPI] test_Vector = [tgroup_Vector] test_IntGroups = [tgroup_IntGroups] test_Samples = [tgroup_Samples] test_Select = [tgroup_Select] test_Language = [tgroup_Language] test_LoadFqDir = [tgroup_LoadFQDirectory] test_Write = [tgroup_Write] main = do setupTestEnvironment $(defaultMainGenerator) removeDirectoryRecursive "testing_directory_tmp" tokenize' fn t = map snd <$> (tokenize fn t) case_tok_cr = TNewLine @=? (case parse (Tokens.eol <* eof) "test" "\r\n" of { Right t -> t; Left _ -> error "Parse failed"; }) case_tok_single_line_comment = tokenize' "test" with_comment @?= Right expected where with_comment = "a=0# comment\nb=1\n" expected = [TWord "a",TOperator '=',TExpr (ConstInt 0),TNewLine,TWord "b",TOperator '=',TExpr (ConstInt 1),TNewLine] case_tok_single_line_comment_cstyle = tokenize' "test" with_comment @?= Right expected where with_comment = "a=0// comment\nb=1\n" expected = [TWord "a",TOperator '=',TExpr (ConstInt 0),TNewLine,TWord "b",TOperator '=',TExpr (ConstInt 1),TNewLine] case_tok_multi_line_comment = tokenize' "test" with_comment @?= Right expected where with_comment = "a=0/* This\n\nwith\nlines*/\nb=1\n" expected = [TWord "a",TOperator '=',TExpr (ConstInt 0),TIndent 0,TNewLine,TWord "b",TOperator '=',TExpr (ConstInt 1),TNewLine] case_tok_word_ = tokenize' "test" "word_with_underscore" @?= Right expected where expected = [TWord "word_with_underscore"] case_indent_comment = isOk "ParseFailed" $ parsetest indent_comment case_indent_space = isOk "ParseFailed" $ parsetest indent_space indent_comment = "ngless '0.0'\n\ \reads = fastq('input1.fq')\n\ \reads = preprocess(reads) using |read|:\n\ \ read = read[5:]\n\ \ # comment \n" indent_space = "ngless '0.0'\n\ \reads = fastq('input1.fq')\n\ \reads = preprocess(reads) using |read|:\n\ \ read = read[5:]\n\ \ \n" sr i s q = NGOShortRead (ShortRead i s $ VS.generate (B.length q) (convert . B.index q)) case_pre_process_indexation_1 = _evalIndex' (sr "@IRIS" "AGTACCAA" "aa`aaaaa") [Just (NGOInteger 5), Nothing] @?= (sr "@IRIS" "CAA" "aaa") case_pre_process_indexation_2 = _evalIndex' (sr "@IRIS" "AGTACCAA" "aa`aaaaa") [Nothing, Just (NGOInteger 3)] @?= (sr "@IRIS" "AGT" "aa`") case_pre_process_indexation_3 = _evalIndex' (sr "@IRIS" "AGTACCAA" "aa`aaaaa") [Just (NGOInteger 2), Just (NGOInteger 5)] @?= (sr "@IRIS" "TAC" "`aa") _evalIndex' a b = case _evalIndex a b of Right v -> v Left err -> error (show err) case_pre_process_length_1 = _evalUnary UOpLen (sr "@IRIS" "AGTACCAA" "aa`aaaaa") @?= Right (NGOInteger 8) case_bop_gte_1 = evalBinary BOpGTE (NGOInteger 10) (NGOInteger 10) @?= Right (NGOBool True) case_bop_gte_2 = evalBinary BOpGTE (NGOInteger 11) (NGOInteger 10) @?= Right (NGOBool True) case_bop_gte_3 = evalBinary BOpGTE (NGOInteger 10) (NGOInteger 11) @?= Right (NGOBool False) case_bop_gt_1 = evalBinary BOpGT (NGOInteger 10) (NGOInteger 10) @?= Right (NGOBool False) case_bop_gt_2 = evalBinary BOpGT (NGOInteger 11) (NGOInteger 10) @?= Right (NGOBool True) case_bop_gt_3 = evalBinary BOpGT (NGOInteger 10) (NGOInteger 11) @?= Right (NGOBool False) case_bop_lt_1 = evalBinary BOpLT (NGOInteger 10) (NGOInteger 10) @?= Right (NGOBool False) case_bop_lt_2 = evalBinary BOpLT (NGOInteger 11) (NGOInteger 10) @?= Right (NGOBool False) case_bop_lt_3 = evalBinary BOpLT (NGOInteger 10) (NGOInteger 11) @?= Right (NGOBool True) case_bop_lte_1 = evalBinary BOpLTE (NGOInteger 10) (NGOInteger 10) @?= Right (NGOBool True) case_bop_lte_2 = evalBinary BOpLTE (NGOInteger 11) (NGOInteger 10) @?= Right (NGOBool False) case_bop_lte_3 = evalBinary BOpLTE (NGOInteger 10) (NGOInteger 11) @?= Right (NGOBool True) case_bop_eq_1 = evalBinary BOpEQ (NGOInteger 10) (NGOInteger 10) @?= Right (NGOBool True) case_bop_eq_2 = evalBinary BOpEQ (NGOInteger 10) (NGOInteger 0) @?= Right (NGOBool False) case_bop_neq_1 = evalBinary BOpNEQ (NGOInteger 0) (NGOInteger 10) @?= Right (NGOBool True) case_bop_neq_2 = evalBinary BOpNEQ (NGOInteger 10) (NGOInteger 10) @?= Right (NGOBool False) case_bop_add_1 = evalBinary BOpAdd (NGOInteger 0) (NGOInteger 10) @?= Right (NGOInteger 10) case_bop_add_2 = evalBinary BOpAdd (NGOInteger 10) (NGOInteger 0) @?= Right (NGOInteger 10) case_bop_add_3 = evalBinary BOpAdd (NGOInteger 10) (NGOInteger 10) @?= Right (NGOInteger 20) case_bop_mul_1 = evalBinary BOpMul (NGOInteger 0) (NGOInteger 10) @?= Right (NGOInteger 0) case_bop_mul_2 = evalBinary BOpMul (NGOInteger 10) (NGOInteger 0) @?= Right (NGOInteger 0) case_bop_mul_3 = evalBinary BOpMul (NGOInteger 10) (NGOInteger 10) @?= Right (NGOInteger 100) case_bop_add_path_1 = evalBinary BOpPathAppend (NGOString "dir") (NGOString "file") @?= Right (NGOString "dir/file") case_bop_add_path_2 = evalBinary BOpPathAppend (NGOString "dir/subdir") (NGOString "file") @?= Right (NGOString "dir/subdir/file") case_bop_add_path_3 = evalBinary BOpPathAppend (NGOString "dir/subdir/") (NGOString "file") @?= Right (NGOString "dir/subdir/file") case_bop_add_path_4 = evalBinary BOpPathAppend (NGOString "../dir/subdir/") (NGOString "file") @?= Right (NGOString "../dir/subdir/file") case_bop_add_path_5 = evalBinary BOpPathAppend (NGOString "/abs/dir/subdir/") (NGOString "file") @?= Right (NGOString "/abs/dir/subdir/file") case_uop_minus_1 = _evalUnary UOpMinus (NGOInteger 10) @?= Right (NGOInteger (-10)) case_uop_minus_2 = _evalUnary UOpMinus (NGOInteger (-10)) @?= Right (NGOInteger 10) case_template_id = takeBaseNameNoExtensions "a/B/c/d/xpto_1.fq" @?= takeBaseNameNoExtensions "a/B/c/d/xpto_1.fq" case_template = takeBaseNameNoExtensions "a/B/c/d/xpto_1.fq" @?= "xpto_1" samStats :: FilePath -> NGLessIO (Int, Int, Int) samStats fname = C.runConduit (samBamConduit fname .| linesVC 1024 .| samStatsC) >>= runNGLess case_sam20 = do sam <- testNGLessIO $ asTempFile sam20 "sam" >>= samStats sam @?= (5,0,0) where sam20 = [here| @SQ SN:I LN:230218 @PG ID:bwa PN:bwa VN:0.7.7-r441 CL:/home/luispedro/.local/share/ngless/bin/ngless-0.0.0-bwa mem -t 1 /home/luispedro/.local/share/ngless/data/sacCer3/Sequence/BWAIndex/reference.fa.gz /tmp/preprocessed_sample20.fq1804289383846930886.gz IRIS:7:1:17:394#0 4 * 0 0 * * 0 0 GTCAGGACAAGAAAGACAANTCCAATTNACATT aaabaa`]baaaaa_aab]D^^`b`aYDW]aba AS:i:0 XS:i:0 IRIS:7:1:17:800#0 4 * 0 0 * * 0 0 GGAAACACTACTTAGGCTTATAAGATCNGGTTGCGG ababbaaabaaaaa`]`ba`]`aaaaYD\\_a``XT AS:i:0 XS:i:0 IRIS:7:1:17:1757#0 4 * 0 0 * * 0 0 TTTTCTCGACGATTTCCACTCCTGGTCNAC aaaaaa``aaa`aaaa_^a```]][Z[DY^ AS:i:0 XS:i:0 IRIS:7:1:17:1479#0 4 * 0 0 * * 0 0 CATATTGTAGGGTGGATCTCGAAAGATATGAAAGAT abaaaaa`a```^aaaaa`_]aaa`aaa__a_X]`` AS:i:0 XS:i:0 IRIS:7:1:17:150#0 4 * 0 0 * * 0 0 TGATGTACTATGCATATGAACTTGTATGCAAAGTGG abaabaa`aaaaaaa^ba_]]aaa^aaaaa_^][aa AS:i:0 XS:i:0 |] Parse GFF lines case_trim_attrs_1 = GFF._trimString " x = 10" @?= "x = 10" case_trim_attrs_2 = GFF._trimString " x = 10 " @?= "x = 10" case_trim_attrs_3 = GFF._trimString "x = 10 " @?= "x = 10" case_trim_attrs_4 = GFF._trimString "x = 10" @?= "x = 10" case_trim_attrs_5 = GFF._trimString " X " @?= "X" case_parse_gff_line = GFF.readGffLine gff_line @?= Right gff_structure where gff_line = "chrI\tunknown\texon\t4124\t4358\t.\t-\t.\tgene_id \"Y74C9A.3\"; transcript_id \"NM_058260\"; gene_name \"Y74C9A.3\"; p_id \"P23728\"; tss_id \"TSS14501\";" gff_structure = GFF.GffLine "chrI" "unknown" "exon" 4124 4358 Nothing GFF.GffNegStrand (-1) attrsExpected attrsExpected = [("gene_id","Y74C9A.3"), ("transcript_id" ,"NM_058260"), ("gene_name", "Y74C9A.3"), ("p_id", "P23728"), ("tss_id", "TSS14501")] case_parse_gff_atributes_normal_1 = GFF._parseGffAttributes "ID=chrI;dbxref=NCBI:NC_001133;Name=chrI" @?= [("ID","chrI"),("dbxref","NCBI:NC_001133"),("Name","chrI")] case_parse_gff_atributes_normal_2 = GFF._parseGffAttributes "gene_id=chrI;dbxref=NCBI:NC_001133;Name=chrI" @?= [("gene_id","chrI"),("dbxref","NCBI:NC_001133"),("Name","chrI")] case_parse_gff_atributes_trail_del = GFF._parseGffAttributes "gene_id=chrI;dbxref=NCBI:NC_001133;Name=chrI;" @?= [("gene_id","chrI"),("dbxref","NCBI:NC_001133"),("Name","chrI")] case_parse_gff_atributes_trail_del_space = GFF._parseGffAttributes "gene_id=chrI;dbxref=NCBI:NC_001133;Name=chrI; " @?= [("gene_id","chrI"),("dbxref","NCBI:NC_001133"),("Name","chrI")] case_calc_sam_stats = testNGLessIO (samStats "test_samples/sample.sam.gz") >>= \r -> r @?= (2772,1310,1299) File " test_samples / data_set_repeated.fq " has 216 reads in which 54 are unique . countC = loop (0 :: Int) where loop !n = C.await >>= maybe (return n) (const (loop $ n+1)) make_unique_test n = let enc = SolexaEncoding in do nuniq <- testNGLessIO $ do newfp <- performUnique "test_samples/data_set_repeated.fq" enc n C.runConduit $ conduitPossiblyCompressedFile newfp .| linesC .| fqDecodeC "testing" enc .| countC let n' = min n 4 nuniq @?= (n' * 54) case_unique_1 = make_unique_test 1 case_unique_2 = make_unique_test 2 case_unique_3 = make_unique_test 3 case_unique_4 = make_unique_test 4 case_unique_5 = make_unique_test 5 case_recursiveAnalyze = execState (recursiveAnalyse countFcalls expr) 0 @?= (1 :: Int) where countFcalls (FunctionCall _ _ _ _) = modify' (+1) countFcalls _ = return () expr = Assignment (Variable "varname") (FunctionCall (FuncName "count") (Lookup Nothing (Variable "mapped")) [(Variable "features", ListExpression [ConstStr "seqname"]) ,(Variable "multiple", ConstSymbol "all1")] Nothing) case_expand_path = do expandPath' "/nothing1/file.txt" [] @?= ["/nothing1/file.txt"] expandPath' "/nothing2/file.txt" [undefined] @?= ["/nothing2/file.txt"] expandPath' "/nothing3/file.txt" ["/home/luispedro/my-directory"] @?= ["/nothing3/file.txt"] expandPath' "<>/nothing4/file.txt" ["/home/luispedro/my-directory1"] @?= ["/home/luispedro/my-directory1/nothing4/file.txt"] expandPath' "<>/nothing4/file.txt" ["refs=/home/luispedro/my-directory1"] @?= [] expandPath' "<>/nothing/file.txt" ["/home/luispedro/my-directory" ,"/home/alternative/your-directory"] @?= ["/home/luispedro/my-directory/nothing/file.txt" ,"/home/alternative/your-directory/nothing/file.txt"] expandPath' "<refs>/nothing/file.txt" ["/home/luispedro/my-directory" ,"/home/alternative/your-directory"] @?= ["/home/luispedro/my-directory/nothing/file.txt" ,"/home/alternative/your-directory/nothing/file.txt"] expandPath' "<refs>/nothing/file.txt" ["refs=/home/luispedro/my-directory" ,"/home/alternative/your-directory"] @?= ["/home/luispedro/my-directory/nothing/file.txt" ,"/home/alternative/your-directory/nothing/file.txt"] expandPath' "<refs>/nothing/file.txt" ["refs=/home/luispedro/my-directory" ,"nope=/home/alternative/your-directory"] @?= ["/home/luispedro/my-directory/nothing/file.txt"] expandPath' "<refs>/nothing/file.txt" ["other=/home/luispedro/my-directory" ,"nope=/home/alternative/your-directory"] @?= [] expandPath' "<refs>/nothing/file.txt" [] @?= []
1d1b9df1b8abbc094af201d530ad5a5a574fd6c893dbd475b29dfd59a98b2329
geophf/1HaskellADay
Exercise.hs
module Y2020.M08.D31.Exercise where - " Yesterday , " * ... * where " yesterday " is " our last working day where we , the workers , get weekends off"-yesterday . ... " yesterday " we discovered that is is , because they all wrote the word : " the . " Yay ! Everything is related to everything , and we can all go home , now . Good to know , but also not helpful . So , there are many common or connective words that do n't relate to the topic * * but then , if you 're writing a research paper on the English use of the definite article " the " and the Polish avoidance of the definite article when speaking in English , then " the " is very much the topic , and what are you going to do about that , huh ? Nothing ? Is that your answer ? and those are know as STOPWORDS , and , unix systems also have in /usr / share / dict/ a set of words called connectives . And guess what the very first word is in connectives . Just . guess . So ! Today 's problem . Yesterday * ... - "Yesterday,"* ... * where "yesterday" is "our last working day where we, the workers, get weekends off"-yesterday. ... "yesterday" we discovered that Charles Dickens is Charles Darwin is Charlie Kaufman, because they all wrote the word: "the." Yay! Everything is related to everything, and we can all go home, now. Good to know, but also not helpful. So, there are many common or connective words that don't relate to the topic* * but then, if you're writing a research paper on the English use of the definite article "the" and the Polish avoidance of the definite article when speaking in English, then "the" is very much the topic, and what are you going to do about that, huh? Nothing? Is that your answer? and those are know as STOPWORDS, and, unix systems also have in /usr/share/dict/ a set of words called connectives. And guess what the very first word is in connectives. Just. guess. So! Today's Haskell problem. Yesterday* ... --} import Y2020.M08.D28.Exercise - ... we created a word - frequency analysis of the cleaned - text of " A Christmas Carol . " And we learned " the " is the most - frequent word . TODAY , * ... * Today , : actually today , unlike ' yesterday 's ' meaning varies ... let us compute what the most - frequent word is , having removed the STOPWORDS . - ... we created a word-frequency analysis of the cleaned-text of Charles Dickens' "A Christmas Carol." And we learned "the" is the most-frequent word. TODAY,* ... *Today, n.: actually today, unlike 'yesterday's' meaning varies ... let us compute what the most-frequent word is, having removed the STOPWORDS. --} import Data.List (sortOn) import Data.Map (Map) import qualified Data.Map as Map import Data.Ord import Data.Set (Set) import Y2020.M08.D25.Exercise (workingDir, gutenbergTop100Index) stopwords :: FilePath stopwords = "/usr/share/dict/connectives" loadStopwords :: FilePath -> IO (Set String) loadStopwords connectives = undefined - > > > take 5 . Set.toList < $ > loadStopwords stopwords [ " a","about","after","against","all " ] - >>> take 5 . Set.toList <$> loadStopwords stopwords ["a","about","after","against","all"] --} removeStopwords :: Set String -> Map String Int -> Map String Int removeStopwords stoppers wordfreqs = undefined - What is most - frequent word in " A Christmas Carol , " having removed all ? > > > let conns = loadStopwords stopwords > > > let weirdos = Set.fromList " ! \"#$%'()*,-./0123456789:;?@[]\182\187\191 " > > > let bookus = study ( workingDir + + gutenbergTop100Index ) > > > let bookwords = cleanDoc weirdos < $ > bookus > > > let wordus = wordFreq < $ > bookwords > > > length < $ > wordus 4852 > > > let keywords = removeStopwords < $ > conns < * > wordus > > > length < $ > keywords 4702 > > > take 5 . sortOn ( Down . snd ) . Map.toList < $ > keywords [ ( " scrooge",314),("upon",120),("ghost",93),("christmas",92),("project",87 ) ] Okay , NOW we 're talking ! - What is Charles Dickens most-frequent word in "A Christmas Carol," having removed all stopwords? >>> let conns = loadStopwords stopwords >>> let weirdos = Set.fromList "!\"#$%'()*,-./0123456789:;?@[]\182\187\191" >>> let bookus = study (workingDir ++ gutenbergTop100Index) >>> let bookwords = cleanDoc weirdos <$> bookus >>> let wordus = wordFreq <$> bookwords >>> length <$> wordus 4852 >>> let keywords = removeStopwords <$> conns <*> wordus >>> length <$> keywords 4702 >>> take 5 . sortOn (Down . snd) . Map.toList <$> keywords [("scrooge",314),("upon",120),("ghost",93),("christmas",92),("project",87)] Okay, NOW we're talking! --}
null
https://raw.githubusercontent.com/geophf/1HaskellADay/514792071226cd1e2ba7640af942667b85601006/exercises/HAD/Y2020/M08/D31/Exercise.hs
haskell
} } } }
module Y2020.M08.D31.Exercise where - " Yesterday , " * ... * where " yesterday " is " our last working day where we , the workers , get weekends off"-yesterday . ... " yesterday " we discovered that is is , because they all wrote the word : " the . " Yay ! Everything is related to everything , and we can all go home , now . Good to know , but also not helpful . So , there are many common or connective words that do n't relate to the topic * * but then , if you 're writing a research paper on the English use of the definite article " the " and the Polish avoidance of the definite article when speaking in English , then " the " is very much the topic , and what are you going to do about that , huh ? Nothing ? Is that your answer ? and those are know as STOPWORDS , and , unix systems also have in /usr / share / dict/ a set of words called connectives . And guess what the very first word is in connectives . Just . guess . So ! Today 's problem . Yesterday * ... - "Yesterday,"* ... * where "yesterday" is "our last working day where we, the workers, get weekends off"-yesterday. ... "yesterday" we discovered that Charles Dickens is Charles Darwin is Charlie Kaufman, because they all wrote the word: "the." Yay! Everything is related to everything, and we can all go home, now. Good to know, but also not helpful. So, there are many common or connective words that don't relate to the topic* * but then, if you're writing a research paper on the English use of the definite article "the" and the Polish avoidance of the definite article when speaking in English, then "the" is very much the topic, and what are you going to do about that, huh? Nothing? Is that your answer? and those are know as STOPWORDS, and, unix systems also have in /usr/share/dict/ a set of words called connectives. And guess what the very first word is in connectives. Just. guess. So! Today's Haskell problem. Yesterday* ... import Y2020.M08.D28.Exercise - ... we created a word - frequency analysis of the cleaned - text of " A Christmas Carol . " And we learned " the " is the most - frequent word . TODAY , * ... * Today , : actually today , unlike ' yesterday 's ' meaning varies ... let us compute what the most - frequent word is , having removed the STOPWORDS . - ... we created a word-frequency analysis of the cleaned-text of Charles Dickens' "A Christmas Carol." And we learned "the" is the most-frequent word. TODAY,* ... *Today, n.: actually today, unlike 'yesterday's' meaning varies ... let us compute what the most-frequent word is, having removed the STOPWORDS. import Data.List (sortOn) import Data.Map (Map) import qualified Data.Map as Map import Data.Ord import Data.Set (Set) import Y2020.M08.D25.Exercise (workingDir, gutenbergTop100Index) stopwords :: FilePath stopwords = "/usr/share/dict/connectives" loadStopwords :: FilePath -> IO (Set String) loadStopwords connectives = undefined - > > > take 5 . Set.toList < $ > loadStopwords stopwords [ " a","about","after","against","all " ] - >>> take 5 . Set.toList <$> loadStopwords stopwords ["a","about","after","against","all"] removeStopwords :: Set String -> Map String Int -> Map String Int removeStopwords stoppers wordfreqs = undefined - What is most - frequent word in " A Christmas Carol , " having removed all ? > > > let conns = loadStopwords stopwords > > > let weirdos = Set.fromList " ! \"#$%'()*,-./0123456789:;?@[]\182\187\191 " > > > let bookus = study ( workingDir + + gutenbergTop100Index ) > > > let bookwords = cleanDoc weirdos < $ > bookus > > > let wordus = wordFreq < $ > bookwords > > > length < $ > wordus 4852 > > > let keywords = removeStopwords < $ > conns < * > wordus > > > length < $ > keywords 4702 > > > take 5 . sortOn ( Down . snd ) . Map.toList < $ > keywords [ ( " scrooge",314),("upon",120),("ghost",93),("christmas",92),("project",87 ) ] Okay , NOW we 're talking ! - What is Charles Dickens most-frequent word in "A Christmas Carol," having removed all stopwords? >>> let conns = loadStopwords stopwords >>> let weirdos = Set.fromList "!\"#$%'()*,-./0123456789:;?@[]\182\187\191" >>> let bookus = study (workingDir ++ gutenbergTop100Index) >>> let bookwords = cleanDoc weirdos <$> bookus >>> let wordus = wordFreq <$> bookwords >>> length <$> wordus 4852 >>> let keywords = removeStopwords <$> conns <*> wordus >>> length <$> keywords 4702 >>> take 5 . sortOn (Down . snd) . Map.toList <$> keywords [("scrooge",314),("upon",120),("ghost",93),("christmas",92),("project",87)] Okay, NOW we're talking!
e517e034894d596e36469432185c8afce2885922cd3003c3a1bf3c8d9c4e87f0
facebook/infer
timer.ml
* Copyright ( c ) Facebook , Inc. and its affiliates . * * This source code is licensed under the MIT license found in the * LICENSE file in the root directory of this source tree . * Copyright (c) Facebook, Inc. and its affiliates. * * This source code is licensed under the MIT license found in the * LICENSE file in the root directory of this source tree. *) (** Timers for runtime statistics *) open! NS0 type t = { mutable ustart: float ; mutable sstart: float ; mutable uaggregate: float ; mutable saggregate: float ; mutable count: int ; mutable max: float ; mutable threshold: float ; name: string } let enabled = ref false let start t = if !enabled then ( let {Unix.tms_utime; tms_stime} = Unix.times () in t.ustart <- tms_utime ; t.sstart <- tms_stime ) let stop_ t = let {Unix.tms_utime; tms_stime} = Unix.times () in let ud = tms_utime -. t.ustart in let sd = tms_stime -. t.sstart in t.uaggregate <- t.uaggregate +. ud ; t.saggregate <- t.saggregate +. sd ; let usd = ud +. sd in if Float.(t.max < usd) then t.max <- usd ; t.count <- t.count + 1 ; (tms_utime, tms_stime) let stop t = if !enabled then stop_ t |> ignore let stop_report t report = if !enabled then let tms_utime, tms_stime = stop_ t in let elapsed = tms_utime +. tms_stime -. (t.ustart +. t.sstart) in if Float.(elapsed > t.threshold) then ( t.threshold <- elapsed ; report ~name:t.name ~elapsed:(elapsed *. 1000.) ~aggregate:((t.uaggregate +. t.saggregate) *. 1000.) ~count:t.count ) let create ?at_exit:printf name = let t = { ustart= 0. ; uaggregate= 0. ; sstart= 0. ; saggregate= 0. ; count= 0 ; max= 0. ; threshold= 0. ; name } in Option.iter printf ~f:(fun report -> at_exit (fun () -> if !enabled then report ~name:t.name ~elapsed:(t.max *. 1000.) ~aggregate:((t.uaggregate +. t.saggregate) *. 1000.) ~count:t.count ) ) ; t
null
https://raw.githubusercontent.com/facebook/infer/b3a229f872003fe020455807668bc7a8edd22d5c/sledge/nonstdlib/timer.ml
ocaml
* Timers for runtime statistics
* Copyright ( c ) Facebook , Inc. and its affiliates . * * This source code is licensed under the MIT license found in the * LICENSE file in the root directory of this source tree . * Copyright (c) Facebook, Inc. and its affiliates. * * This source code is licensed under the MIT license found in the * LICENSE file in the root directory of this source tree. *) open! NS0 type t = { mutable ustart: float ; mutable sstart: float ; mutable uaggregate: float ; mutable saggregate: float ; mutable count: int ; mutable max: float ; mutable threshold: float ; name: string } let enabled = ref false let start t = if !enabled then ( let {Unix.tms_utime; tms_stime} = Unix.times () in t.ustart <- tms_utime ; t.sstart <- tms_stime ) let stop_ t = let {Unix.tms_utime; tms_stime} = Unix.times () in let ud = tms_utime -. t.ustart in let sd = tms_stime -. t.sstart in t.uaggregate <- t.uaggregate +. ud ; t.saggregate <- t.saggregate +. sd ; let usd = ud +. sd in if Float.(t.max < usd) then t.max <- usd ; t.count <- t.count + 1 ; (tms_utime, tms_stime) let stop t = if !enabled then stop_ t |> ignore let stop_report t report = if !enabled then let tms_utime, tms_stime = stop_ t in let elapsed = tms_utime +. tms_stime -. (t.ustart +. t.sstart) in if Float.(elapsed > t.threshold) then ( t.threshold <- elapsed ; report ~name:t.name ~elapsed:(elapsed *. 1000.) ~aggregate:((t.uaggregate +. t.saggregate) *. 1000.) ~count:t.count ) let create ?at_exit:printf name = let t = { ustart= 0. ; uaggregate= 0. ; sstart= 0. ; saggregate= 0. ; count= 0 ; max= 0. ; threshold= 0. ; name } in Option.iter printf ~f:(fun report -> at_exit (fun () -> if !enabled then report ~name:t.name ~elapsed:(t.max *. 1000.) ~aggregate:((t.uaggregate +. t.saggregate) *. 1000.) ~count:t.count ) ) ; t
0da7f207c1413ccf1434010a485ae8dbcce7dae1feab7a5f0d4ae8de23a833c1
mmontone/fmt
package.lisp
(defpackage fmt-test (:use :cl :fmt :fiveam) (:export #:run-tests))
null
https://raw.githubusercontent.com/mmontone/fmt/ecb0443fe595638e46c06a5dfea9a3e8c353d7df/t/package.lisp
lisp
(defpackage fmt-test (:use :cl :fmt :fiveam) (:export #:run-tests))
d178dea71726772477be0a29e1b35e34c94c98ebf689e35079fafa93bfc0d346
blockapps/eth-pruner
ExtendedWord.hs
# LANGUAGE FlexibleInstances # {-# LANGUAGE TypeSynonymInstances #-} {-# OPTIONS -fno-warn-orphans #-} module Prune.ExtendedWord ( Word64, Word160, word64ToBytes, bytesToWord64, word160ToBytes, bytesToWord160, ) where import Data.Binary import Data.Bits import Data.DoubleWord (Word160) word64ToBytes :: Word64 -> [Word8] word64ToBytes word = map (fromIntegral . (word `shiftR`)) [64-8, 64-16..0] bytesToWord64 :: [Word8] -> Word64 bytesToWord64 bytes | length bytes == 8 = sum $ map (\(shiftBits, byte) -> fromIntegral byte `shiftL` shiftBits) $ zip [64-8,64-16..0] bytes bytesToWord64 _ = error "bytesToWord64 was called with the wrong number of bytes" word160ToBytes :: Word160 -> [Word8] word160ToBytes word = map (fromIntegral . (word `shiftR`)) [160-8, 160-16..0] bytesToWord160 :: [Word8] -> Word160 bytesToWord160 bytes | length bytes == 20 = sum $ map (\(shiftBits, byte) -> fromIntegral byte `shiftL` shiftBits) $ zip [160-8,160-16..0] bytes bytesToWord160 _ = error "bytesToWord160 was called with the wrong number of bytes"
null
https://raw.githubusercontent.com/blockapps/eth-pruner/513fcc884c93974a29b380ca80669dc0aebec125/src/Prune/ExtendedWord.hs
haskell
# LANGUAGE TypeSynonymInstances # # OPTIONS -fno-warn-orphans #
# LANGUAGE FlexibleInstances # module Prune.ExtendedWord ( Word64, Word160, word64ToBytes, bytesToWord64, word160ToBytes, bytesToWord160, ) where import Data.Binary import Data.Bits import Data.DoubleWord (Word160) word64ToBytes :: Word64 -> [Word8] word64ToBytes word = map (fromIntegral . (word `shiftR`)) [64-8, 64-16..0] bytesToWord64 :: [Word8] -> Word64 bytesToWord64 bytes | length bytes == 8 = sum $ map (\(shiftBits, byte) -> fromIntegral byte `shiftL` shiftBits) $ zip [64-8,64-16..0] bytes bytesToWord64 _ = error "bytesToWord64 was called with the wrong number of bytes" word160ToBytes :: Word160 -> [Word8] word160ToBytes word = map (fromIntegral . (word `shiftR`)) [160-8, 160-16..0] bytesToWord160 :: [Word8] -> Word160 bytesToWord160 bytes | length bytes == 20 = sum $ map (\(shiftBits, byte) -> fromIntegral byte `shiftL` shiftBits) $ zip [160-8,160-16..0] bytes bytesToWord160 _ = error "bytesToWord160 was called with the wrong number of bytes"
024fd069d1d21f40f57771dace6f4dde307dc8de7104aa4fcd7c912cbd7b7501
hgoes/smtlib2
Nat.hs
module Language.SMTLib2.Internals.Type.Nat where import Data.Typeable import Data.Constraint import Data.GADT.Compare import Data.GADT.Show import Language.Haskell.TH -- | Natural numbers on the type-level. data Nat = Z | S Nat deriving Typeable | A concrete representation of the ' ' type . data Natural (n::Nat) where Zero :: Natural Z Succ :: Natural n -> Natural (S n) type family (+) (n :: Nat) (m :: Nat) :: Nat where (+) Z n = n (+) (S n) m = S ((+) n m) type family (-) (n :: Nat) (m :: Nat) :: Nat where (-) n Z = n (-) (S n) (S m) = n - m type family (<=) (n :: Nat) (m :: Nat) :: Bool where (<=) Z m = True (<=) (S n) Z = False (<=) (S n) (S m) = (<=) n m naturalToInteger :: Natural n -> Integer naturalToInteger = conv 0 where conv :: Integer -> Natural m -> Integer conv n Zero = n conv n (Succ x) = conv (n+1) x naturalAdd :: Natural n -> Natural m -> Natural (n + m) naturalAdd Zero n = n naturalAdd (Succ x) y = Succ (naturalAdd x y) naturalSub :: Natural (n + m) -> Natural n -> Natural m naturalSub n Zero = n naturalSub (Succ sum) (Succ n) = naturalSub sum n naturalSub' :: Natural n -> Natural m -> (forall diff. ((m + diff) ~ n) => Natural diff -> a) -> a naturalSub' n Zero f = f n naturalSub' (Succ sum) (Succ n) f = naturalSub' sum n f naturalLEQ :: Natural n -> Natural m -> Maybe (Dict ((n <= m) ~ True)) naturalLEQ Zero _ = Just Dict naturalLEQ (Succ n) (Succ m) = case naturalLEQ n m of Just Dict -> Just Dict Nothing -> Nothing naturalLEQ _ _ = Nothing instance Show (Natural n) where showsPrec p = showsPrec p . naturalToInteger instance Eq (Natural n) where (==) _ _ = True instance Ord (Natural n) where compare _ _ = EQ -- | Get a static representation for a dynamically created natural number. -- -- Example: -- -- >>> reifyNat (S (S Z)) show " 2 " reifyNat :: Nat -> (forall n. Natural n -> r) -> r reifyNat Z f = f Zero reifyNat (S n) f = reifyNat n $ \n' -> f (Succ n') -- | A template haskell function to create nicer looking numbers. -- -- Example: -- > > > : t $ ( nat 5 ) $ ( nat 5 ) : : Natural ( 'S ( 'S ( 'S ( 'S ( 'S ' Z ) ) ) ) ) nat :: (Num a,Ord a) => a -> ExpQ nat n | n < 0 = error $ "nat: Can only use numbers >= 0." | otherwise = nat' n where nat' 0 = [| Zero |] nat' n = [| Succ $(nat' (n-1)) |] -- | A template haskell function to create nicer looking number types. -- -- Example: -- > > > $ ( nat 5 ) : : Natural $ ( natT 5 ) 5 natT :: (Num a,Ord a) => a -> TypeQ natT n | n < 0 = error $ "natT: Can only use numbers >= 0." | otherwise = natT' n where natT' 0 = [t| Z |] natT' n = [t| S $(natT' (n-1)) |] instance Eq Nat where (==) Z Z = True (==) (S x) (S y) = x == y (==) _ _ = False instance Ord Nat where compare Z Z = EQ compare Z _ = LT compare _ Z = GT compare (S x) (S y) = compare x y instance Num Nat where (+) Z n = n (+) (S n) m = S (n + m) (-) n Z = n (-) (S n) (S m) = n - m (-) _ _ = error $ "Cannot produce negative natural numbers." (*) Z n = Z (*) (S n) m = m+(n*m) negate _ = error $ "Cannot produce negative natural numbers." abs = id signum Z = Z signum (S _) = S Z fromInteger x | x<0 = error $ "Cannot produce negative natural numbers." | otherwise = f x where f 0 = Z f n = S (f (n-1)) instance Enum Nat where succ = S pred (S n) = n pred Z = error $ "Cannot produce negative natural numbers." toEnum 0 = Z toEnum n = S (toEnum (n-1)) fromEnum Z = 0 fromEnum (S n) = (fromEnum n)+1 instance Real Nat where toRational Z = 0 toRational (S n) = (toRational n)+1 instance Integral Nat where quotRem x y = let (q,r) = quotRem (toInteger x) (toInteger y) in (fromInteger q,fromInteger r) toInteger = f 0 where f n Z = n f n (S m) = f (n+1) m type N0 = Z type N1 = S N0 type N2 = S N1 type N3 = S N2 type N4 = S N3 type N5 = S N4 type N6 = S N5 type N7 = S N6 type N8 = S N7 type N9 = S N8 type N10 = S N9 type N11 = S N10 type N12 = S N11 type N13 = S N12 type N14 = S N13 type N15 = S N14 type N16 = S N15 type N17 = S N16 type N18 = S N17 type N19 = S N18 type N20 = S N19 type N21 = S N20 type N22 = S N21 type N23 = S N22 type N24 = S N23 type N25 = S N24 type N26 = S N25 type N27 = S N26 type N28 = S N27 type N29 = S N28 type N30 = S N29 type N31 = S N30 type N32 = S N31 type N33 = S N32 type N34 = S N33 type N35 = S N34 type N36 = S N35 type N37 = S N36 type N38 = S N37 type N39 = S N38 type N40 = S N39 type N41 = S N40 type N42 = S N41 type N43 = S N42 type N44 = S N43 type N45 = S N44 type N46 = S N45 type N47 = S N46 type N48 = S N47 type N49 = S N48 type N50 = S N49 type N51 = S N50 type N52 = S N51 type N53 = S N52 type N54 = S N53 type N55 = S N54 type N56 = S N55 type N57 = S N56 type N58 = S N57 type N59 = S N58 type N60 = S N59 type N61 = S N60 type N62 = S N61 type N63 = S N62 type N64 = S N63 instance GEq Natural where geq Zero Zero = Just Refl geq (Succ x) (Succ y) = do Refl <- geq x y return Refl geq _ _ = Nothing instance GCompare Natural where gcompare Zero Zero = GEQ gcompare Zero _ = GLT gcompare _ Zero = GGT gcompare (Succ x) (Succ y) = case gcompare x y of GEQ -> GEQ GLT -> GLT GGT -> GGT instance GShow Natural where gshowsPrec = showsPrec class IsNatural n where getNatural :: Natural n instance IsNatural Z where getNatural = Zero instance IsNatural n => IsNatural (S n) where getNatural = Succ getNatural deriveIsNatural :: Natural n -> Dict (IsNatural n) deriveIsNatural Zero = Dict deriveIsNatural (Succ n) = case deriveIsNatural n of Dict -> Dict
null
https://raw.githubusercontent.com/hgoes/smtlib2/c35747f2a5a9ec88dc7b1db41a5aab6e98c0458d/Language/SMTLib2/Internals/Type/Nat.hs
haskell
| Natural numbers on the type-level. | Get a static representation for a dynamically created natural number. Example: >>> reifyNat (S (S Z)) show | A template haskell function to create nicer looking numbers. Example: | A template haskell function to create nicer looking number types. Example:
module Language.SMTLib2.Internals.Type.Nat where import Data.Typeable import Data.Constraint import Data.GADT.Compare import Data.GADT.Show import Language.Haskell.TH data Nat = Z | S Nat deriving Typeable | A concrete representation of the ' ' type . data Natural (n::Nat) where Zero :: Natural Z Succ :: Natural n -> Natural (S n) type family (+) (n :: Nat) (m :: Nat) :: Nat where (+) Z n = n (+) (S n) m = S ((+) n m) type family (-) (n :: Nat) (m :: Nat) :: Nat where (-) n Z = n (-) (S n) (S m) = n - m type family (<=) (n :: Nat) (m :: Nat) :: Bool where (<=) Z m = True (<=) (S n) Z = False (<=) (S n) (S m) = (<=) n m naturalToInteger :: Natural n -> Integer naturalToInteger = conv 0 where conv :: Integer -> Natural m -> Integer conv n Zero = n conv n (Succ x) = conv (n+1) x naturalAdd :: Natural n -> Natural m -> Natural (n + m) naturalAdd Zero n = n naturalAdd (Succ x) y = Succ (naturalAdd x y) naturalSub :: Natural (n + m) -> Natural n -> Natural m naturalSub n Zero = n naturalSub (Succ sum) (Succ n) = naturalSub sum n naturalSub' :: Natural n -> Natural m -> (forall diff. ((m + diff) ~ n) => Natural diff -> a) -> a naturalSub' n Zero f = f n naturalSub' (Succ sum) (Succ n) f = naturalSub' sum n f naturalLEQ :: Natural n -> Natural m -> Maybe (Dict ((n <= m) ~ True)) naturalLEQ Zero _ = Just Dict naturalLEQ (Succ n) (Succ m) = case naturalLEQ n m of Just Dict -> Just Dict Nothing -> Nothing naturalLEQ _ _ = Nothing instance Show (Natural n) where showsPrec p = showsPrec p . naturalToInteger instance Eq (Natural n) where (==) _ _ = True instance Ord (Natural n) where compare _ _ = EQ " 2 " reifyNat :: Nat -> (forall n. Natural n -> r) -> r reifyNat Z f = f Zero reifyNat (S n) f = reifyNat n $ \n' -> f (Succ n') > > > : t $ ( nat 5 ) $ ( nat 5 ) : : Natural ( 'S ( 'S ( 'S ( 'S ( 'S ' Z ) ) ) ) ) nat :: (Num a,Ord a) => a -> ExpQ nat n | n < 0 = error $ "nat: Can only use numbers >= 0." | otherwise = nat' n where nat' 0 = [| Zero |] nat' n = [| Succ $(nat' (n-1)) |] > > > $ ( nat 5 ) : : Natural $ ( natT 5 ) 5 natT :: (Num a,Ord a) => a -> TypeQ natT n | n < 0 = error $ "natT: Can only use numbers >= 0." | otherwise = natT' n where natT' 0 = [t| Z |] natT' n = [t| S $(natT' (n-1)) |] instance Eq Nat where (==) Z Z = True (==) (S x) (S y) = x == y (==) _ _ = False instance Ord Nat where compare Z Z = EQ compare Z _ = LT compare _ Z = GT compare (S x) (S y) = compare x y instance Num Nat where (+) Z n = n (+) (S n) m = S (n + m) (-) n Z = n (-) (S n) (S m) = n - m (-) _ _ = error $ "Cannot produce negative natural numbers." (*) Z n = Z (*) (S n) m = m+(n*m) negate _ = error $ "Cannot produce negative natural numbers." abs = id signum Z = Z signum (S _) = S Z fromInteger x | x<0 = error $ "Cannot produce negative natural numbers." | otherwise = f x where f 0 = Z f n = S (f (n-1)) instance Enum Nat where succ = S pred (S n) = n pred Z = error $ "Cannot produce negative natural numbers." toEnum 0 = Z toEnum n = S (toEnum (n-1)) fromEnum Z = 0 fromEnum (S n) = (fromEnum n)+1 instance Real Nat where toRational Z = 0 toRational (S n) = (toRational n)+1 instance Integral Nat where quotRem x y = let (q,r) = quotRem (toInteger x) (toInteger y) in (fromInteger q,fromInteger r) toInteger = f 0 where f n Z = n f n (S m) = f (n+1) m type N0 = Z type N1 = S N0 type N2 = S N1 type N3 = S N2 type N4 = S N3 type N5 = S N4 type N6 = S N5 type N7 = S N6 type N8 = S N7 type N9 = S N8 type N10 = S N9 type N11 = S N10 type N12 = S N11 type N13 = S N12 type N14 = S N13 type N15 = S N14 type N16 = S N15 type N17 = S N16 type N18 = S N17 type N19 = S N18 type N20 = S N19 type N21 = S N20 type N22 = S N21 type N23 = S N22 type N24 = S N23 type N25 = S N24 type N26 = S N25 type N27 = S N26 type N28 = S N27 type N29 = S N28 type N30 = S N29 type N31 = S N30 type N32 = S N31 type N33 = S N32 type N34 = S N33 type N35 = S N34 type N36 = S N35 type N37 = S N36 type N38 = S N37 type N39 = S N38 type N40 = S N39 type N41 = S N40 type N42 = S N41 type N43 = S N42 type N44 = S N43 type N45 = S N44 type N46 = S N45 type N47 = S N46 type N48 = S N47 type N49 = S N48 type N50 = S N49 type N51 = S N50 type N52 = S N51 type N53 = S N52 type N54 = S N53 type N55 = S N54 type N56 = S N55 type N57 = S N56 type N58 = S N57 type N59 = S N58 type N60 = S N59 type N61 = S N60 type N62 = S N61 type N63 = S N62 type N64 = S N63 instance GEq Natural where geq Zero Zero = Just Refl geq (Succ x) (Succ y) = do Refl <- geq x y return Refl geq _ _ = Nothing instance GCompare Natural where gcompare Zero Zero = GEQ gcompare Zero _ = GLT gcompare _ Zero = GGT gcompare (Succ x) (Succ y) = case gcompare x y of GEQ -> GEQ GLT -> GLT GGT -> GGT instance GShow Natural where gshowsPrec = showsPrec class IsNatural n where getNatural :: Natural n instance IsNatural Z where getNatural = Zero instance IsNatural n => IsNatural (S n) where getNatural = Succ getNatural deriveIsNatural :: Natural n -> Dict (IsNatural n) deriveIsNatural Zero = Dict deriveIsNatural (Succ n) = case deriveIsNatural n of Dict -> Dict
901d22b5924d19e89e4818dc2c1860c9bc18b5a677625b4c1203c9bfe0dc6965
ejlilley/AbstractMusic
Scales.hs
# LANGUAGE GADTs , MultiParamTypeClasses # MultiParamTypeClasses #-} module Scales where import Music (Scale(..), AbstractPitch1(..), AbstractInt1(..), AbstractPitch2(..), AbstractInt2(..), Interval(..), Pitch(..), Transpose(..), faInt, faPitch, Name(..), Number(..), Quality(..), Accidental(..), Ficta(..)) import Shortcuts import Util (rotate, rotateN) data GenericScale where GenericScale :: Scale s p i => s -> GenericScale todo : represent / enforce scale length(s ) with type - level . todo : make the basic scale type a list of * intervals * ( not pitches ) . e.g. = [ M2 , M2 , m2 , M2 , M2 , M2 , m2 ] etc . ficToAcc Raise = sharpen ficToAcc Neutral = id ficToAcc Lower = flatten completeScale s i = let c = if i >= 0 then scale s ++ map (transpose (AbstractInt2 Perf (Compound Unison))) c else map (transpose (AbstractInt2 Perf (Negative (Compound Unison)))) (reverse (scale s)) ++ map (transpose (AbstractInt2 Perf (Negative (Compound Unison)))) c in if i >= 0 then c else (head (scale s)) : c infiniteScale s = completeScale s 1 scaleDegree s (AbstractPitch1 deg fic) = let i = fromEnum deg index = abs i note = (completeScale s i) !! index in (ficToAcc fic) note Ionian | Hypoionian | Aeolian | Hypoaeolian | Dorian | Phrygian | Lydian | Mixolydian | Hypodorian | Hypophrygian | Hypolydian | Hypomixolydian | Locrian | Hypolocrian transposeScale orig base new = let offset = interval base new in map (transpose offset) orig Diatonic : basicIonian = map (\n -> AbstractPitch2 n Na) [C .. ] data Ionian = Ionian AbstractPitch2 deriving Show type Major = Ionian instance Scale Ionian AbstractPitch1 AbstractInt1 where tonic (Ionian t) = t scale s = take 7 $ transposeScale basicIonian (AbstractPitch2 C Na) (tonic s) applyScale = scaleDegree data Dorian = Dorian AbstractPitch2 deriving Show instance Scale Dorian AbstractPitch1 AbstractInt1 where tonic (Dorian t) = t scale s = take 7 $ transposeScale (rotate basicIonian) (AbstractPitch2 D Na) (tonic s) applyScale = scaleDegree data Phrygian = Phrygian AbstractPitch2 deriving Show instance Scale Phrygian AbstractPitch1 AbstractInt1 where tonic (Phrygian t) = t scale s = take 7 $ transposeScale ((rotateN 2) basicIonian) (AbstractPitch2 E Na) (tonic s) applyScale = scaleDegree data Lydian = Lydian AbstractPitch2 deriving Show instance Scale Lydian AbstractPitch1 AbstractInt1 where tonic (Lydian t) = t scale s = take 7 $ transposeScale ((rotateN 3) basicIonian) (AbstractPitch2 F Na) (tonic s) applyScale = scaleDegree data Mixolydian = Mixolydian AbstractPitch2 deriving Show instance Scale Mixolydian AbstractPitch1 AbstractInt1 where tonic (Mixolydian t) = t scale s = take 7 $ transposeScale ((rotateN 4) basicIonian) (AbstractPitch2 G Na) (tonic s) applyScale = scaleDegree data Aeolian = Aeolian AbstractPitch2 deriving Show type Minor = Aeolian instance Scale Aeolian AbstractPitch1 AbstractInt1 where tonic (Aeolian t) = t scale s = take 7 $ transposeScale ((rotateN 5) basicIonian) (AbstractPitch2 A Na) (tonic s) applyScale = scaleDegree data Locrian = Locrian AbstractPitch2 deriving Show instance Scale Locrian AbstractPitch1 AbstractInt1 where tonic (Locrian t) = t scale s = take 7 $ transposeScale ((rotateN 6) basicIonian) (AbstractPitch2 B Na) (tonic s) applyScale = scaleDegree -- Melodic minor scales: basicMelodicMinor = [AbstractPitch2 C Na, AbstractPitch2 D Na, AbstractPitch2 E flat, AbstractPitch2 F Na, AbstractPitch2 G Na, AbstractPitch2 (Up A) Na, AbstractPitch2 (Up B) Na] ++ map (transpose (AbstractInt2 Perf (Compound Unison))) basicMelodicMinor data MelodicMinor = MelodicMinor AbstractPitch2 deriving Show instance Scale MelodicMinor AbstractPitch1 AbstractInt1 where tonic (MelodicMinor t) = t scale s = take 7 $ transposeScale basicMelodicMinor (AbstractPitch2 C Na) (tonic s) applyScale = scaleDegree Harmonic major scales : basicHarmonicMajor = [AbstractPitch2 C Na, AbstractPitch2 D Na, AbstractPitch2 E Na, AbstractPitch2 F Na, AbstractPitch2 G Na, AbstractPitch2 (Up A) flat, AbstractPitch2 (Up B) Na] ++ map (transpose (AbstractInt2 Perf (Compound Unison))) basicHarmonicMajor Harmonic minor scales : basicHarmonicMinor = [AbstractPitch2 C Na, AbstractPitch2 D Na, AbstractPitch2 E flat, AbstractPitch2 F Na, AbstractPitch2 G Na, AbstractPitch2 (Up A) flat, AbstractPitch2 (Up B) Na] ++ map (transpose (AbstractInt2 Perf (Compound Unison))) basicHarmonicMinor data AlteredPhrygian = AlteredPhrygian AbstractPitch2 deriving Show instance Scale AlteredPhrygian AbstractPitch1 AbstractInt1 where tonic (AlteredPhrygian t) = t scale s = take 7 $ transposeScale (rotateN 4 basicHarmonicMinor) (AbstractPitch2 G Na) (tonic s) applyScale = scaleDegree data HarmonicMinor = HarmonicMinor AbstractPitch2 deriving Show instance Scale HarmonicMinor AbstractPitch1 AbstractInt1 where tonic (HarmonicMinor t) = t scale s = take 7 $ transposeScale basicHarmonicMinor (AbstractPitch2 C Na) (tonic s) applyScale = scaleDegree -- Double harmonic scales: basicDoubleHarmonic = [AbstractPitch2 C Na, AbstractPitch2 D flat, AbstractPitch2 E Na, AbstractPitch2 F Na, AbstractPitch2 G Na, AbstractPitch2 (Up A) flat, AbstractPitch2 (Up B) Na] ++ map (transpose (AbstractInt2 Perf (Compound Unison))) basicDoubleHarmonic major :: AbstractPitch2 -> Major major n = Ionian n minor :: AbstractPitch2 -> Minor minor n = Aeolian (n .-^ octave) harmonicminor :: AbstractPitch2 -> HarmonicMinor harmonicminor n = HarmonicMinor n melodicminor :: AbstractPitch2 -> MelodicMinor melodicminor n = MelodicMinor n chromaticScale p@(AbstractPitch2 n a) | (n == B) || (n == E) || (a == sharp) = p:(chromaticScale (AbstractPitch2 (succ n) Na)) | otherwise = p:(chromaticScale (AbstractPitch2 n sharp)) -- Modal: modeII = [ ( D , ) , ( E , Na ) , ( F , ) , ( G , ) , ( A , Na ) , ( B , Na ) , ( C , Na ) ] -- modeIII -- modeIV -- modeV -- modeVI -- modeVII -- modeVIII 's scales : mode1 = [ 2,2,2,2,2 ] mode2 = [ 1,2 , 1,2 , 1,2 , 1,2 ] mode3 = [ 2,1,1 , 2,1,1 , 2,1,1 ] mode4 = [ 1,1,3,1 , 1,1,3,1 ] = [ 1,4,1 , 1,4,1 ] = [ 2,2,1,1 , 2,2,1,1 ] mode7 = [ 1,1,1,2,1 , 1,1,1,2,1 ] -- (measured in semitones) hexachord :: AbstractPitch2 -> [AbstractPitch2] hexachord p = [p, p .+^ _M2, p .+^ _M3, p .+^ _P4, p .+^ _P5, p .+^ _M6] : data HexachordPrima = HexachordPrima deriving Show instance Scale HexachordPrima AbstractPitch1 AbstractInt1 where tonic HexachordPrima = g .-^ (3 *^ _P8) scale s = hexachord (tonic s) applyScale = scaleDegree data HexachordSecunda = HexachordSecunda deriving Show instance Scale HexachordSecunda AbstractPitch1 AbstractInt1 where tonic s = c .-^ (2 *^ _P8) scale s = hexachord (tonic s) applyScale = scaleDegree data HexachordTertia = HexachordTertia deriving Show instance Scale HexachordTertia AbstractPitch1 AbstractInt1 where tonic s = f .-^ (2 *^ _P8) scale s = hexachord (tonic s) applyScale = scaleDegree data HexachordQuarta = HexachordQuarta deriving Show instance Scale HexachordQuarta AbstractPitch1 AbstractInt1 where tonic s = g .-^ (2 *^ _P8) scale s = hexachord (tonic s) applyScale = scaleDegree data HexachordQuinta = HexachordQuinta deriving Show instance Scale HexachordQuinta AbstractPitch1 AbstractInt1 where tonic s = c .-^ _P8 scale s = hexachord (tonic s) applyScale = scaleDegree data HexachordSexta = HexachordSexta deriving Show instance Scale HexachordSexta AbstractPitch1 AbstractInt1 where tonic s = f .-^ _P8 scale s = hexachord (tonic s) applyScale = scaleDegree data HexachordSeptima = HexachordSeptima deriving Show instance Scale HexachordSeptima AbstractPitch1 AbstractInt1 where tonic s = g .-^ _P8 scale s = hexachord (tonic s) applyScale = scaleDegree
null
https://raw.githubusercontent.com/ejlilley/AbstractMusic/815ab33ee204dd3ebf29076bde330bfdf6938677/Scales.hs
haskell
Melodic minor scales: Double harmonic scales: Modal: modeIII modeIV modeV modeVI modeVII modeVIII (measured in semitones)
# LANGUAGE GADTs , MultiParamTypeClasses # MultiParamTypeClasses #-} module Scales where import Music (Scale(..), AbstractPitch1(..), AbstractInt1(..), AbstractPitch2(..), AbstractInt2(..), Interval(..), Pitch(..), Transpose(..), faInt, faPitch, Name(..), Number(..), Quality(..), Accidental(..), Ficta(..)) import Shortcuts import Util (rotate, rotateN) data GenericScale where GenericScale :: Scale s p i => s -> GenericScale todo : represent / enforce scale length(s ) with type - level . todo : make the basic scale type a list of * intervals * ( not pitches ) . e.g. = [ M2 , M2 , m2 , M2 , M2 , M2 , m2 ] etc . ficToAcc Raise = sharpen ficToAcc Neutral = id ficToAcc Lower = flatten completeScale s i = let c = if i >= 0 then scale s ++ map (transpose (AbstractInt2 Perf (Compound Unison))) c else map (transpose (AbstractInt2 Perf (Negative (Compound Unison)))) (reverse (scale s)) ++ map (transpose (AbstractInt2 Perf (Negative (Compound Unison)))) c in if i >= 0 then c else (head (scale s)) : c infiniteScale s = completeScale s 1 scaleDegree s (AbstractPitch1 deg fic) = let i = fromEnum deg index = abs i note = (completeScale s i) !! index in (ficToAcc fic) note Ionian | Hypoionian | Aeolian | Hypoaeolian | Dorian | Phrygian | Lydian | Mixolydian | Hypodorian | Hypophrygian | Hypolydian | Hypomixolydian | Locrian | Hypolocrian transposeScale orig base new = let offset = interval base new in map (transpose offset) orig Diatonic : basicIonian = map (\n -> AbstractPitch2 n Na) [C .. ] data Ionian = Ionian AbstractPitch2 deriving Show type Major = Ionian instance Scale Ionian AbstractPitch1 AbstractInt1 where tonic (Ionian t) = t scale s = take 7 $ transposeScale basicIonian (AbstractPitch2 C Na) (tonic s) applyScale = scaleDegree data Dorian = Dorian AbstractPitch2 deriving Show instance Scale Dorian AbstractPitch1 AbstractInt1 where tonic (Dorian t) = t scale s = take 7 $ transposeScale (rotate basicIonian) (AbstractPitch2 D Na) (tonic s) applyScale = scaleDegree data Phrygian = Phrygian AbstractPitch2 deriving Show instance Scale Phrygian AbstractPitch1 AbstractInt1 where tonic (Phrygian t) = t scale s = take 7 $ transposeScale ((rotateN 2) basicIonian) (AbstractPitch2 E Na) (tonic s) applyScale = scaleDegree data Lydian = Lydian AbstractPitch2 deriving Show instance Scale Lydian AbstractPitch1 AbstractInt1 where tonic (Lydian t) = t scale s = take 7 $ transposeScale ((rotateN 3) basicIonian) (AbstractPitch2 F Na) (tonic s) applyScale = scaleDegree data Mixolydian = Mixolydian AbstractPitch2 deriving Show instance Scale Mixolydian AbstractPitch1 AbstractInt1 where tonic (Mixolydian t) = t scale s = take 7 $ transposeScale ((rotateN 4) basicIonian) (AbstractPitch2 G Na) (tonic s) applyScale = scaleDegree data Aeolian = Aeolian AbstractPitch2 deriving Show type Minor = Aeolian instance Scale Aeolian AbstractPitch1 AbstractInt1 where tonic (Aeolian t) = t scale s = take 7 $ transposeScale ((rotateN 5) basicIonian) (AbstractPitch2 A Na) (tonic s) applyScale = scaleDegree data Locrian = Locrian AbstractPitch2 deriving Show instance Scale Locrian AbstractPitch1 AbstractInt1 where tonic (Locrian t) = t scale s = take 7 $ transposeScale ((rotateN 6) basicIonian) (AbstractPitch2 B Na) (tonic s) applyScale = scaleDegree basicMelodicMinor = [AbstractPitch2 C Na, AbstractPitch2 D Na, AbstractPitch2 E flat, AbstractPitch2 F Na, AbstractPitch2 G Na, AbstractPitch2 (Up A) Na, AbstractPitch2 (Up B) Na] ++ map (transpose (AbstractInt2 Perf (Compound Unison))) basicMelodicMinor data MelodicMinor = MelodicMinor AbstractPitch2 deriving Show instance Scale MelodicMinor AbstractPitch1 AbstractInt1 where tonic (MelodicMinor t) = t scale s = take 7 $ transposeScale basicMelodicMinor (AbstractPitch2 C Na) (tonic s) applyScale = scaleDegree Harmonic major scales : basicHarmonicMajor = [AbstractPitch2 C Na, AbstractPitch2 D Na, AbstractPitch2 E Na, AbstractPitch2 F Na, AbstractPitch2 G Na, AbstractPitch2 (Up A) flat, AbstractPitch2 (Up B) Na] ++ map (transpose (AbstractInt2 Perf (Compound Unison))) basicHarmonicMajor Harmonic minor scales : basicHarmonicMinor = [AbstractPitch2 C Na, AbstractPitch2 D Na, AbstractPitch2 E flat, AbstractPitch2 F Na, AbstractPitch2 G Na, AbstractPitch2 (Up A) flat, AbstractPitch2 (Up B) Na] ++ map (transpose (AbstractInt2 Perf (Compound Unison))) basicHarmonicMinor data AlteredPhrygian = AlteredPhrygian AbstractPitch2 deriving Show instance Scale AlteredPhrygian AbstractPitch1 AbstractInt1 where tonic (AlteredPhrygian t) = t scale s = take 7 $ transposeScale (rotateN 4 basicHarmonicMinor) (AbstractPitch2 G Na) (tonic s) applyScale = scaleDegree data HarmonicMinor = HarmonicMinor AbstractPitch2 deriving Show instance Scale HarmonicMinor AbstractPitch1 AbstractInt1 where tonic (HarmonicMinor t) = t scale s = take 7 $ transposeScale basicHarmonicMinor (AbstractPitch2 C Na) (tonic s) applyScale = scaleDegree basicDoubleHarmonic = [AbstractPitch2 C Na, AbstractPitch2 D flat, AbstractPitch2 E Na, AbstractPitch2 F Na, AbstractPitch2 G Na, AbstractPitch2 (Up A) flat, AbstractPitch2 (Up B) Na] ++ map (transpose (AbstractInt2 Perf (Compound Unison))) basicDoubleHarmonic major :: AbstractPitch2 -> Major major n = Ionian n minor :: AbstractPitch2 -> Minor minor n = Aeolian (n .-^ octave) harmonicminor :: AbstractPitch2 -> HarmonicMinor harmonicminor n = HarmonicMinor n melodicminor :: AbstractPitch2 -> MelodicMinor melodicminor n = MelodicMinor n chromaticScale p@(AbstractPitch2 n a) | (n == B) || (n == E) || (a == sharp) = p:(chromaticScale (AbstractPitch2 (succ n) Na)) | otherwise = p:(chromaticScale (AbstractPitch2 n sharp)) modeII = [ ( D , ) , ( E , Na ) , ( F , ) , ( G , ) , ( A , Na ) , ( B , Na ) , ( C , Na ) ] 's scales : mode1 = [ 2,2,2,2,2 ] mode2 = [ 1,2 , 1,2 , 1,2 , 1,2 ] mode3 = [ 2,1,1 , 2,1,1 , 2,1,1 ] mode4 = [ 1,1,3,1 , 1,1,3,1 ] = [ 1,4,1 , 1,4,1 ] = [ 2,2,1,1 , 2,2,1,1 ] mode7 = [ 1,1,1,2,1 , 1,1,1,2,1 ] hexachord :: AbstractPitch2 -> [AbstractPitch2] hexachord p = [p, p .+^ _M2, p .+^ _M3, p .+^ _P4, p .+^ _P5, p .+^ _M6] : data HexachordPrima = HexachordPrima deriving Show instance Scale HexachordPrima AbstractPitch1 AbstractInt1 where tonic HexachordPrima = g .-^ (3 *^ _P8) scale s = hexachord (tonic s) applyScale = scaleDegree data HexachordSecunda = HexachordSecunda deriving Show instance Scale HexachordSecunda AbstractPitch1 AbstractInt1 where tonic s = c .-^ (2 *^ _P8) scale s = hexachord (tonic s) applyScale = scaleDegree data HexachordTertia = HexachordTertia deriving Show instance Scale HexachordTertia AbstractPitch1 AbstractInt1 where tonic s = f .-^ (2 *^ _P8) scale s = hexachord (tonic s) applyScale = scaleDegree data HexachordQuarta = HexachordQuarta deriving Show instance Scale HexachordQuarta AbstractPitch1 AbstractInt1 where tonic s = g .-^ (2 *^ _P8) scale s = hexachord (tonic s) applyScale = scaleDegree data HexachordQuinta = HexachordQuinta deriving Show instance Scale HexachordQuinta AbstractPitch1 AbstractInt1 where tonic s = c .-^ _P8 scale s = hexachord (tonic s) applyScale = scaleDegree data HexachordSexta = HexachordSexta deriving Show instance Scale HexachordSexta AbstractPitch1 AbstractInt1 where tonic s = f .-^ _P8 scale s = hexachord (tonic s) applyScale = scaleDegree data HexachordSeptima = HexachordSeptima deriving Show instance Scale HexachordSeptima AbstractPitch1 AbstractInt1 where tonic s = g .-^ _P8 scale s = hexachord (tonic s) applyScale = scaleDegree
4334c917df03600fe4bc5b69fa6d4753eecd9212c198584a1338f1cdf69c8635
wireapp/wire-server
LoginCodeTimeout_user.hs
-- This file is part of the Wire Server implementation. -- Copyright ( C ) 2022 Wire Swiss GmbH < > -- -- This program is free software: you can redistribute it and/or modify it under the terms of the GNU Affero General Public License as published by the Free Software Foundation , either version 3 of the License , or ( at your option ) any -- later version. -- -- This program is distributed in the hope that it will be useful, but WITHOUT -- ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS -- FOR A PARTICULAR PURPOSE. See the GNU Affero General Public License for more -- details. -- You should have received a copy of the GNU Affero General Public License along -- with this program. If not, see </>. module Test.Wire.API.Golden.Generated.LoginCodeTimeout_user where import Data.Code (Timeout (Timeout)) import Data.Time (secondsToNominalDiffTime) import Wire.API.User.Auth (LoginCodeTimeout (..)) testObject_LoginCodeTimeout_user_1 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_1 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-25.000000000000))} testObject_LoginCodeTimeout_user_2 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_2 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 20.000000000000)} testObject_LoginCodeTimeout_user_3 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_3 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 3.000000000000)} testObject_LoginCodeTimeout_user_4 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_4 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-15.000000000000))} testObject_LoginCodeTimeout_user_5 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_5 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-24.000000000000))} testObject_LoginCodeTimeout_user_6 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_6 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-14.000000000000))} testObject_LoginCodeTimeout_user_7 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_7 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-27.000000000000))} testObject_LoginCodeTimeout_user_8 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_8 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 12.000000000000)} testObject_LoginCodeTimeout_user_9 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_9 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 21.000000000000)} testObject_LoginCodeTimeout_user_10 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_10 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-3.000000000000))} testObject_LoginCodeTimeout_user_11 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_11 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-1.000000000000))} testObject_LoginCodeTimeout_user_12 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_12 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-2.000000000000))} testObject_LoginCodeTimeout_user_13 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_13 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-30.000000000000))} testObject_LoginCodeTimeout_user_14 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_14 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-24.000000000000))} testObject_LoginCodeTimeout_user_15 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_15 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 6.000000000000)} testObject_LoginCodeTimeout_user_16 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_16 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 23.000000000000)} testObject_LoginCodeTimeout_user_17 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_17 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 29.000000000000)} testObject_LoginCodeTimeout_user_18 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_18 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 22.000000000000)} testObject_LoginCodeTimeout_user_19 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_19 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 7.000000000000)} testObject_LoginCodeTimeout_user_20 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_20 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-5.000000000000))}
null
https://raw.githubusercontent.com/wireapp/wire-server/c428355b7683b7b7722ea544eba314fc843ad8fa/libs/wire-api/test/golden/Test/Wire/API/Golden/Generated/LoginCodeTimeout_user.hs
haskell
This file is part of the Wire Server implementation. This program is free software: you can redistribute it and/or modify it under later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU Affero General Public License for more details. with this program. If not, see </>.
Copyright ( C ) 2022 Wire Swiss GmbH < > the terms of the GNU Affero General Public License as published by the Free Software Foundation , either version 3 of the License , or ( at your option ) any You should have received a copy of the GNU Affero General Public License along module Test.Wire.API.Golden.Generated.LoginCodeTimeout_user where import Data.Code (Timeout (Timeout)) import Data.Time (secondsToNominalDiffTime) import Wire.API.User.Auth (LoginCodeTimeout (..)) testObject_LoginCodeTimeout_user_1 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_1 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-25.000000000000))} testObject_LoginCodeTimeout_user_2 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_2 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 20.000000000000)} testObject_LoginCodeTimeout_user_3 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_3 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 3.000000000000)} testObject_LoginCodeTimeout_user_4 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_4 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-15.000000000000))} testObject_LoginCodeTimeout_user_5 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_5 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-24.000000000000))} testObject_LoginCodeTimeout_user_6 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_6 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-14.000000000000))} testObject_LoginCodeTimeout_user_7 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_7 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-27.000000000000))} testObject_LoginCodeTimeout_user_8 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_8 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 12.000000000000)} testObject_LoginCodeTimeout_user_9 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_9 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 21.000000000000)} testObject_LoginCodeTimeout_user_10 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_10 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-3.000000000000))} testObject_LoginCodeTimeout_user_11 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_11 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-1.000000000000))} testObject_LoginCodeTimeout_user_12 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_12 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-2.000000000000))} testObject_LoginCodeTimeout_user_13 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_13 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-30.000000000000))} testObject_LoginCodeTimeout_user_14 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_14 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-24.000000000000))} testObject_LoginCodeTimeout_user_15 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_15 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 6.000000000000)} testObject_LoginCodeTimeout_user_16 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_16 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 23.000000000000)} testObject_LoginCodeTimeout_user_17 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_17 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 29.000000000000)} testObject_LoginCodeTimeout_user_18 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_18 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 22.000000000000)} testObject_LoginCodeTimeout_user_19 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_19 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime 7.000000000000)} testObject_LoginCodeTimeout_user_20 :: LoginCodeTimeout testObject_LoginCodeTimeout_user_20 = LoginCodeTimeout {fromLoginCodeTimeout = Timeout (secondsToNominalDiffTime (-5.000000000000))}
fda824638f00f901fff07c3d841fe20e3d74f88bcb96a5618e0e8f8a7399cbe3
pixlsus/registry.gimp.org_static
imageFormula.scm
Berengar W. Lehr ( ) Medical Physics Group , Department of Diagnostic and Interventional Radiology Jena University Hospital , 07743 Jena , Thueringen , Germany ; ; This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation ; either version 2 of the License , or ; (at your option) any later version. ; ; This program is distributed in the hope that it will be useful, ; but WITHOUT ANY WARRANTY; without even the implied warranty of ; MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the ; GNU General Public License for more details. ; ; If you use this script and/or like it the author would be happy to ; receive a postcard from you: ; You should have received a copy of the GNU General Public License ; along with this program; if not, write to the Free Software Foundation , Inc. , 675 Mass Ave , Cambridge , , USA . (define (script-fu-formula formula filename size TextColor) (let* ( (sizeName (cond ((= size 0) "normalsize") ((= size 1) "LARGE") ((= size 2) "Huge") )) (url (string-append "" sizeName "%5C!" formula ".gif")) (image (car (file-uri-load FALSE url url))) (drawable (car (gimp-image-get-active-layer image))) (width (car (gimp-image-width image))) (height (car (gimp-image-height image))) (background (car (gimp-layer-new image width height RGBA-IMAGE "Background" 100 NORMAL-MODE))) (AntiTextColor (list (- 255 (car TextColor)) (- 255 (cadr TextColor)) (- 255 (caddr TextColor)))) (gradientName (car (gimp-gradient-new "NeuerFarbverlauf"))) (activegradient (car (gimp-context-get-gradient))) (filename (string-append filename ".png")) ) (gimp-image-convert-rgb image) (gimp-image-add-layer image background 1) (gimp-edit-fill background WHITE-FILL) (set! drawable (car (gimp-image-merge-visible-layers image EXPAND-AS-NECESSARY))) (gimp-gradient-segment-set-left-color gradientName 0 TextColor 100) (gimp-gradient-segment-set-right-color gradientName 0 AntiTextColor 100) (gimp-context-set-gradient gradientName) (plug-in-gradmap TRUE image drawable) (gimp-context-set-gradient activegradient) (plug-in-colortoalpha TRUE image drawable AntiTextColor) (file-png-save-defaults TRUE image drawable filename filename) ) ) Register the function with GIMP : (script-fu-register "script-fu-formula" _"_Image Formula..." _"Return an formula" "Berengar W. Lehr" "2010, Berengar W. Lehr / MPG@IDIR, UH Jena, Germany." "22th April 2010" "" SF-STRING "Formular" "E=mc^2" SF-STRING "Filename" "<Filename>.png" SF-ADJUSTMENT "Size (0-Normal|1-Large|2-Huge)" '(1 0 2 1 1 1 1) SF-COLOR "Textcolor" '(0 0 0) ) (script-fu-menu-register "script-fu-formula" "<Image>/Script-Fu/")
null
https://raw.githubusercontent.com/pixlsus/registry.gimp.org_static/ffcde7400f402728373ff6579947c6ffe87d1a5e/registry.gimp.org/files/imageFormula.scm
scheme
This program is free software; you can redistribute it and/or modify either version 2 of the License , or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. If you use this script and/or like it the author would be happy to receive a postcard from you: along with this program; if not, write to the Free Software
Berengar W. Lehr ( ) Medical Physics Group , Department of Diagnostic and Interventional Radiology Jena University Hospital , 07743 Jena , Thueringen , Germany it under the terms of the GNU General Public License as published by You should have received a copy of the GNU General Public License Foundation , Inc. , 675 Mass Ave , Cambridge , , USA . (define (script-fu-formula formula filename size TextColor) (let* ( (sizeName (cond ((= size 0) "normalsize") ((= size 1) "LARGE") ((= size 2) "Huge") )) (url (string-append "" sizeName "%5C!" formula ".gif")) (image (car (file-uri-load FALSE url url))) (drawable (car (gimp-image-get-active-layer image))) (width (car (gimp-image-width image))) (height (car (gimp-image-height image))) (background (car (gimp-layer-new image width height RGBA-IMAGE "Background" 100 NORMAL-MODE))) (AntiTextColor (list (- 255 (car TextColor)) (- 255 (cadr TextColor)) (- 255 (caddr TextColor)))) (gradientName (car (gimp-gradient-new "NeuerFarbverlauf"))) (activegradient (car (gimp-context-get-gradient))) (filename (string-append filename ".png")) ) (gimp-image-convert-rgb image) (gimp-image-add-layer image background 1) (gimp-edit-fill background WHITE-FILL) (set! drawable (car (gimp-image-merge-visible-layers image EXPAND-AS-NECESSARY))) (gimp-gradient-segment-set-left-color gradientName 0 TextColor 100) (gimp-gradient-segment-set-right-color gradientName 0 AntiTextColor 100) (gimp-context-set-gradient gradientName) (plug-in-gradmap TRUE image drawable) (gimp-context-set-gradient activegradient) (plug-in-colortoalpha TRUE image drawable AntiTextColor) (file-png-save-defaults TRUE image drawable filename filename) ) ) Register the function with GIMP : (script-fu-register "script-fu-formula" _"_Image Formula..." _"Return an formula" "Berengar W. Lehr" "2010, Berengar W. Lehr / MPG@IDIR, UH Jena, Germany." "22th April 2010" "" SF-STRING "Formular" "E=mc^2" SF-STRING "Filename" "<Filename>.png" SF-ADJUSTMENT "Size (0-Normal|1-Large|2-Huge)" '(1 0 2 1 1 1 1) SF-COLOR "Textcolor" '(0 0 0) ) (script-fu-menu-register "script-fu-formula" "<Image>/Script-Fu/")
ca6fbc55dbc633d43fd86357cc03670aed906c971bb96557a02605f13a8006ee
tarides/dune-release
test_uri_helpers.ml
let uri = let open Dune_release.Uri_helpers in Alcotest.testable pp_uri equal_uri let test_parse = let make_test ~input ~expected = let name = Printf.sprintf "parse: %s" input in let test_fun () = let actual = Dune_release.Uri_helpers.parse input in Alcotest.(check (option uri)) name expected actual in (name, `Quick, test_fun) in [ make_test ~input:"scheme" ~expected: (Some { scheme = Some "scheme"; domain = [ "com"; "domain" ]; path = [ "some"; "path" ]; }); make_test ~input:"noscheme.com/some/path" ~expected: (Some { scheme = None; domain = [ "com"; "noscheme" ]; path = [ "some"; "path" ]; }); make_test ~input:"nopath.com" ~expected: (Some { scheme = None; domain = [ "com"; "nopath" ]; path = [] }); make_test ~input:":some/path" ~expected: (Some { scheme = None; domain = [ "com"; "git@github" ]; path = [ "some"; "path" ]; }); ] let suite = ("Uri_helpers", test_parse)
null
https://raw.githubusercontent.com/tarides/dune-release/6bfed0f299b82c0931c78d4e216fd0efedff0673/tests/lib/test_uri_helpers.ml
ocaml
let uri = let open Dune_release.Uri_helpers in Alcotest.testable pp_uri equal_uri let test_parse = let make_test ~input ~expected = let name = Printf.sprintf "parse: %s" input in let test_fun () = let actual = Dune_release.Uri_helpers.parse input in Alcotest.(check (option uri)) name expected actual in (name, `Quick, test_fun) in [ make_test ~input:"scheme" ~expected: (Some { scheme = Some "scheme"; domain = [ "com"; "domain" ]; path = [ "some"; "path" ]; }); make_test ~input:"noscheme.com/some/path" ~expected: (Some { scheme = None; domain = [ "com"; "noscheme" ]; path = [ "some"; "path" ]; }); make_test ~input:"nopath.com" ~expected: (Some { scheme = None; domain = [ "com"; "nopath" ]; path = [] }); make_test ~input:":some/path" ~expected: (Some { scheme = None; domain = [ "com"; "git@github" ]; path = [ "some"; "path" ]; }); ] let suite = ("Uri_helpers", test_parse)
0952b667f624c1223a23eda7bfcab19a5432f56ca9e41606159e78b7ed3fb00f
coccinelle/coccinelle
bytes.mli
external length : bytes -> int = "%bytes_length" external get : bytes -> int -> char = "%bytes_safe_get" external set : bytes -> int -> char -> unit = "%bytes_safe_set" external create : int -> bytes = "caml_create_bytes" val make : int -> char -> bytes val init : int -> (int -> char) -> bytes val empty : bytes val copy : bytes -> bytes val of_string : string -> bytes val to_string : bytes -> string val sub : bytes -> int -> int -> bytes val sub_string : bytes -> int -> int -> string val extend : bytes -> int -> int -> bytes val fill : bytes -> int -> int -> char -> unit val blit : bytes -> int -> bytes -> int -> int -> unit val blit_string : string -> int -> bytes -> int -> int -> unit val concat : bytes -> bytes list -> bytes val cat : bytes -> bytes -> bytes val iter : (char -> unit) -> bytes -> unit val iteri : (int -> char -> unit) -> bytes -> unit val map : (char -> char) -> bytes -> bytes val mapi : (int -> char -> char) -> bytes -> bytes val fold_left : ('a -> char -> 'a) -> 'a -> bytes -> 'a val fold_right : (char -> 'a -> 'a) -> bytes -> 'a -> 'a val for_all : (char -> bool) -> bytes -> bool val exists : (char -> bool) -> bytes -> bool val trim : bytes -> bytes val escaped : bytes -> bytes val index : bytes -> char -> int val index_opt : bytes -> char -> int option val rindex : bytes -> char -> int val rindex_opt : bytes -> char -> int option val index_from : bytes -> int -> char -> int val index_from_opt : bytes -> int -> char -> int option val rindex_from : bytes -> int -> char -> int val rindex_from_opt : bytes -> int -> char -> int option val contains : bytes -> char -> bool val contains_from : bytes -> int -> char -> bool val rcontains_from : bytes -> int -> char -> bool val uppercase : bytes -> bytes val lowercase : bytes -> bytes val capitalize : bytes -> bytes val uncapitalize : bytes -> bytes val uppercase_ascii : bytes -> bytes val lowercase_ascii : bytes -> bytes val capitalize_ascii : bytes -> bytes val uncapitalize_ascii : bytes -> bytes type t = bytes val compare : t -> t -> int val equal : t -> t -> bool val starts_with : prefix:bytes -> bytes -> bool val ends_with : suffix:bytes -> bytes -> bool val unsafe_to_string : bytes -> string val unsafe_of_string : string -> bytes val split_on_char : char -> bytes -> bytes list val to_seq : t -> char Seq.t val to_seqi : t -> (int * char) Seq.t val of_seq : char Seq.t -> t val get_utf_8_uchar : t -> int -> Uchar.utf_decode val set_utf_8_uchar : t -> int -> Uchar.t -> int val is_valid_utf_8 : t -> bool val get_utf_16be_uchar : t -> int -> Uchar.utf_decode val set_utf_16be_uchar : t -> int -> Uchar.t -> int val is_valid_utf_16be : t -> bool val get_utf_16le_uchar : t -> int -> Uchar.utf_decode val set_utf_16le_uchar : t -> int -> Uchar.t -> int val is_valid_utf_16le : t -> bool val get_uint8 : bytes -> int -> int val get_int8 : bytes -> int -> int val get_uint16_ne : bytes -> int -> int val get_uint16_be : bytes -> int -> int val get_uint16_le : bytes -> int -> int val get_int16_ne : bytes -> int -> int val get_int16_be : bytes -> int -> int val get_int16_le : bytes -> int -> int val get_int32_ne : bytes -> int -> int32 val get_int32_be : bytes -> int -> int32 val get_int32_le : bytes -> int -> int32 val get_int64_ne : bytes -> int -> int64 val get_int64_be : bytes -> int -> int64 val get_int64_le : bytes -> int -> int64 val set_uint8 : bytes -> int -> int -> unit val set_int8 : bytes -> int -> int -> unit val set_uint16_ne : bytes -> int -> int -> unit val set_uint16_be : bytes -> int -> int -> unit val set_uint16_le : bytes -> int -> int -> unit val set_int16_ne : bytes -> int -> int -> unit val set_int16_be : bytes -> int -> int -> unit val set_int16_le : bytes -> int -> int -> unit val set_int32_ne : bytes -> int -> int32 -> unit val set_int32_be : bytes -> int -> int32 -> unit val set_int32_le : bytes -> int -> int32 -> unit val set_int64_ne : bytes -> int -> int64 -> unit val set_int64_be : bytes -> int -> int64 -> unit val set_int64_le : bytes -> int -> int64 -> unit external unsafe_get : bytes -> int -> char = "%bytes_unsafe_get" external unsafe_set : bytes -> int -> char -> unit = "%bytes_unsafe_set" external unsafe_blit : bytes -> int -> bytes -> int -> int -> unit = "caml_blit_bytes"[@@noalloc ] external unsafe_blit_string : string -> int -> bytes -> int -> int -> unit = "caml_blit_string"[@@noalloc ] external unsafe_fill : bytes -> int -> int -> char -> unit = "caml_fill_bytes"[@@noalloc ]
null
https://raw.githubusercontent.com/coccinelle/coccinelle/5448bb2bd03491ffec356bf7bd6ddcdbf4d36bc9/bundles/stdcompat/stdcompat-current/interfaces/4.14/bytes.mli
ocaml
external length : bytes -> int = "%bytes_length" external get : bytes -> int -> char = "%bytes_safe_get" external set : bytes -> int -> char -> unit = "%bytes_safe_set" external create : int -> bytes = "caml_create_bytes" val make : int -> char -> bytes val init : int -> (int -> char) -> bytes val empty : bytes val copy : bytes -> bytes val of_string : string -> bytes val to_string : bytes -> string val sub : bytes -> int -> int -> bytes val sub_string : bytes -> int -> int -> string val extend : bytes -> int -> int -> bytes val fill : bytes -> int -> int -> char -> unit val blit : bytes -> int -> bytes -> int -> int -> unit val blit_string : string -> int -> bytes -> int -> int -> unit val concat : bytes -> bytes list -> bytes val cat : bytes -> bytes -> bytes val iter : (char -> unit) -> bytes -> unit val iteri : (int -> char -> unit) -> bytes -> unit val map : (char -> char) -> bytes -> bytes val mapi : (int -> char -> char) -> bytes -> bytes val fold_left : ('a -> char -> 'a) -> 'a -> bytes -> 'a val fold_right : (char -> 'a -> 'a) -> bytes -> 'a -> 'a val for_all : (char -> bool) -> bytes -> bool val exists : (char -> bool) -> bytes -> bool val trim : bytes -> bytes val escaped : bytes -> bytes val index : bytes -> char -> int val index_opt : bytes -> char -> int option val rindex : bytes -> char -> int val rindex_opt : bytes -> char -> int option val index_from : bytes -> int -> char -> int val index_from_opt : bytes -> int -> char -> int option val rindex_from : bytes -> int -> char -> int val rindex_from_opt : bytes -> int -> char -> int option val contains : bytes -> char -> bool val contains_from : bytes -> int -> char -> bool val rcontains_from : bytes -> int -> char -> bool val uppercase : bytes -> bytes val lowercase : bytes -> bytes val capitalize : bytes -> bytes val uncapitalize : bytes -> bytes val uppercase_ascii : bytes -> bytes val lowercase_ascii : bytes -> bytes val capitalize_ascii : bytes -> bytes val uncapitalize_ascii : bytes -> bytes type t = bytes val compare : t -> t -> int val equal : t -> t -> bool val starts_with : prefix:bytes -> bytes -> bool val ends_with : suffix:bytes -> bytes -> bool val unsafe_to_string : bytes -> string val unsafe_of_string : string -> bytes val split_on_char : char -> bytes -> bytes list val to_seq : t -> char Seq.t val to_seqi : t -> (int * char) Seq.t val of_seq : char Seq.t -> t val get_utf_8_uchar : t -> int -> Uchar.utf_decode val set_utf_8_uchar : t -> int -> Uchar.t -> int val is_valid_utf_8 : t -> bool val get_utf_16be_uchar : t -> int -> Uchar.utf_decode val set_utf_16be_uchar : t -> int -> Uchar.t -> int val is_valid_utf_16be : t -> bool val get_utf_16le_uchar : t -> int -> Uchar.utf_decode val set_utf_16le_uchar : t -> int -> Uchar.t -> int val is_valid_utf_16le : t -> bool val get_uint8 : bytes -> int -> int val get_int8 : bytes -> int -> int val get_uint16_ne : bytes -> int -> int val get_uint16_be : bytes -> int -> int val get_uint16_le : bytes -> int -> int val get_int16_ne : bytes -> int -> int val get_int16_be : bytes -> int -> int val get_int16_le : bytes -> int -> int val get_int32_ne : bytes -> int -> int32 val get_int32_be : bytes -> int -> int32 val get_int32_le : bytes -> int -> int32 val get_int64_ne : bytes -> int -> int64 val get_int64_be : bytes -> int -> int64 val get_int64_le : bytes -> int -> int64 val set_uint8 : bytes -> int -> int -> unit val set_int8 : bytes -> int -> int -> unit val set_uint16_ne : bytes -> int -> int -> unit val set_uint16_be : bytes -> int -> int -> unit val set_uint16_le : bytes -> int -> int -> unit val set_int16_ne : bytes -> int -> int -> unit val set_int16_be : bytes -> int -> int -> unit val set_int16_le : bytes -> int -> int -> unit val set_int32_ne : bytes -> int -> int32 -> unit val set_int32_be : bytes -> int -> int32 -> unit val set_int32_le : bytes -> int -> int32 -> unit val set_int64_ne : bytes -> int -> int64 -> unit val set_int64_be : bytes -> int -> int64 -> unit val set_int64_le : bytes -> int -> int64 -> unit external unsafe_get : bytes -> int -> char = "%bytes_unsafe_get" external unsafe_set : bytes -> int -> char -> unit = "%bytes_unsafe_set" external unsafe_blit : bytes -> int -> bytes -> int -> int -> unit = "caml_blit_bytes"[@@noalloc ] external unsafe_blit_string : string -> int -> bytes -> int -> int -> unit = "caml_blit_string"[@@noalloc ] external unsafe_fill : bytes -> int -> int -> char -> unit = "caml_fill_bytes"[@@noalloc ]
e630d785c7eb19022fd29d985fd6ec87464723b761e4880cf0910396dde054f5
mzp/coq-for-ipad
taquin.ml
(***********************************************************************) (* *) MLTk , Tcl / Tk interface of Objective Caml (* *) , , and projet Cristal , INRIA Rocquencourt , Kyoto University RIMS (* *) Copyright 2002 Institut National de Recherche en Informatique et en Automatique and Kyoto University . All rights reserved . This file is distributed under the terms of the GNU Library General Public License , with the special exception on linking (* described in file LICENSE found in the Objective Caml source tree. *) (* *) (***********************************************************************) $ I d : taquin.ml 9547 2010 - 01 - 22 12:48:24Z doligez $ open Tk;; let découpe_image img nx ny = let l = Imagephoto.width img and h = Imagephoto.height img in let tx = l / nx and ty = h / ny in let pièces = ref [] in for x = 0 to nx - 1 do for y = 0 to ny - 1 do let pièce = Imagephoto.create ~width:tx ~height:ty () in Imagephoto.copy ~src:img ~src_area:(x * tx, y * ty, (x + 1) * tx, (y + 1) * ty) pièce; pièces := pièce :: !pièces done done; (tx, ty, List.tl !pièces);; let remplir_taquin c nx ny tx ty pièces = let trou_x = ref (nx - 1) and trou_y = ref (ny - 1) in let trou = Canvas.create_rectangle ~x1:(!trou_x * tx) ~y1:(!trou_y * ty) ~x2:tx ~y2:ty c in let taquin = Array.make_matrix nx ny trou in let p = ref pièces in for x = 0 to nx - 1 do for y = 0 to ny - 1 do match !p with | [] -> () | pièce :: reste -> taquin.(x).(y) <- Canvas.create_image ~x:(x * tx) ~y:(y * ty) ~image:pièce ~anchor:`Nw ~tags:["pièce"] c; p := reste done done; let déplacer x y = let pièce = taquin.(x).(y) in Canvas.coords_set c pièce ~xys:[!trou_x * tx, !trou_y * ty]; Canvas.coords_set c trou ~xys:[x * tx, y * ty; tx, ty]; taquin.(!trou_x).(!trou_y) <- pièce; taquin.(x).(y) <- trou; trou_x := x; trou_y := y in let jouer ei = let x = ei.ev_MouseX / tx and y = ei.ev_MouseY / ty in if x = !trou_x && (y = !trou_y - 1 || y = !trou_y + 1) || y = !trou_y && (x = !trou_x - 1 || x = !trou_x + 1) then déplacer x y in Canvas.bind ~events:[`ButtonPress] ~fields:[`MouseX; `MouseY] ~action:jouer c (`Tag "pièce");; let rec permutation = function | [] -> [] | l -> let n = Random.int (List.length l) in let (élément, reste) = partage l n in élément :: permutation reste and partage l n = match l with | [] -> failwith "partage" | tête :: reste -> if n = 0 then (tête, reste) else let (élément, reste') = partage reste (n - 1) in (élément, tête :: reste');; let create_filled_text parent lines = let lnum = List.length lines and lwidth = List.fold_right (fun line max -> let l = String.length line in if l > max then l else max) lines 1 in let txtw = Text.create ~width:lwidth ~height:lnum parent in List.iter (fun line -> Text.insert ~index:(`End, []) ~text:line txtw; Text.insert ~index:(`End, []) ~text:"\n" txtw) lines; txtw;; let give_help parent lines () = let help_window = Toplevel.create parent in Wm.title_set help_window "Help"; let help_frame = Frame.create help_window in let help_txtw = create_filled_text help_frame lines in let quit_help () = destroy help_window in let ok_button = Button.create ~text:"Ok" ~command:quit_help help_frame in pack ~side:`Bottom [help_txtw]; pack ~side:`Bottom [ok_button ]; pack [help_frame];; let taquin nom_fichier nx ny = let fp = openTk () in Wm.title_set fp "Taquin"; let img = Imagephoto.create ~file:nom_fichier () in let c = Canvas.create ~background:`Black ~width:(Imagephoto.width img) ~height:(Imagephoto.height img) fp in let (tx, ty, pièces) = découpe_image img nx ny in remplir_taquin c nx ny tx ty (permutation pièces); pack [c]; let quit = Button.create ~text:"Quit" ~command:closeTk fp in let help_lines = ["Pour jouer, cliquer sur une des pièces"; "entourant le trou"; ""; "To play, click on a part around the hole"] in let help = Button.create ~text:"Help" ~command:(give_help fp help_lines) fp in pack ~side:`Left ~fill:`X [quit] ; pack ~side:`Left ~fill:`X [help] ; mainLoop ();; if !Sys.interactive then () else begin taquin "Lambda2.back.gif" 4 4; exit 0 end;;
null
https://raw.githubusercontent.com/mzp/coq-for-ipad/4fb3711723e2581a170ffd734e936f210086396e/src/ocaml-3.12.0/otherlibs/labltk/examples_labltk/taquin.ml
ocaml
********************************************************************* described in file LICENSE found in the Objective Caml source tree. *********************************************************************
MLTk , Tcl / Tk interface of Objective Caml , , and projet Cristal , INRIA Rocquencourt , Kyoto University RIMS Copyright 2002 Institut National de Recherche en Informatique et en Automatique and Kyoto University . All rights reserved . This file is distributed under the terms of the GNU Library General Public License , with the special exception on linking $ I d : taquin.ml 9547 2010 - 01 - 22 12:48:24Z doligez $ open Tk;; let découpe_image img nx ny = let l = Imagephoto.width img and h = Imagephoto.height img in let tx = l / nx and ty = h / ny in let pièces = ref [] in for x = 0 to nx - 1 do for y = 0 to ny - 1 do let pièce = Imagephoto.create ~width:tx ~height:ty () in Imagephoto.copy ~src:img ~src_area:(x * tx, y * ty, (x + 1) * tx, (y + 1) * ty) pièce; pièces := pièce :: !pièces done done; (tx, ty, List.tl !pièces);; let remplir_taquin c nx ny tx ty pièces = let trou_x = ref (nx - 1) and trou_y = ref (ny - 1) in let trou = Canvas.create_rectangle ~x1:(!trou_x * tx) ~y1:(!trou_y * ty) ~x2:tx ~y2:ty c in let taquin = Array.make_matrix nx ny trou in let p = ref pièces in for x = 0 to nx - 1 do for y = 0 to ny - 1 do match !p with | [] -> () | pièce :: reste -> taquin.(x).(y) <- Canvas.create_image ~x:(x * tx) ~y:(y * ty) ~image:pièce ~anchor:`Nw ~tags:["pièce"] c; p := reste done done; let déplacer x y = let pièce = taquin.(x).(y) in Canvas.coords_set c pièce ~xys:[!trou_x * tx, !trou_y * ty]; Canvas.coords_set c trou ~xys:[x * tx, y * ty; tx, ty]; taquin.(!trou_x).(!trou_y) <- pièce; taquin.(x).(y) <- trou; trou_x := x; trou_y := y in let jouer ei = let x = ei.ev_MouseX / tx and y = ei.ev_MouseY / ty in if x = !trou_x && (y = !trou_y - 1 || y = !trou_y + 1) || y = !trou_y && (x = !trou_x - 1 || x = !trou_x + 1) then déplacer x y in Canvas.bind ~events:[`ButtonPress] ~fields:[`MouseX; `MouseY] ~action:jouer c (`Tag "pièce");; let rec permutation = function | [] -> [] | l -> let n = Random.int (List.length l) in let (élément, reste) = partage l n in élément :: permutation reste and partage l n = match l with | [] -> failwith "partage" | tête :: reste -> if n = 0 then (tête, reste) else let (élément, reste') = partage reste (n - 1) in (élément, tête :: reste');; let create_filled_text parent lines = let lnum = List.length lines and lwidth = List.fold_right (fun line max -> let l = String.length line in if l > max then l else max) lines 1 in let txtw = Text.create ~width:lwidth ~height:lnum parent in List.iter (fun line -> Text.insert ~index:(`End, []) ~text:line txtw; Text.insert ~index:(`End, []) ~text:"\n" txtw) lines; txtw;; let give_help parent lines () = let help_window = Toplevel.create parent in Wm.title_set help_window "Help"; let help_frame = Frame.create help_window in let help_txtw = create_filled_text help_frame lines in let quit_help () = destroy help_window in let ok_button = Button.create ~text:"Ok" ~command:quit_help help_frame in pack ~side:`Bottom [help_txtw]; pack ~side:`Bottom [ok_button ]; pack [help_frame];; let taquin nom_fichier nx ny = let fp = openTk () in Wm.title_set fp "Taquin"; let img = Imagephoto.create ~file:nom_fichier () in let c = Canvas.create ~background:`Black ~width:(Imagephoto.width img) ~height:(Imagephoto.height img) fp in let (tx, ty, pièces) = découpe_image img nx ny in remplir_taquin c nx ny tx ty (permutation pièces); pack [c]; let quit = Button.create ~text:"Quit" ~command:closeTk fp in let help_lines = ["Pour jouer, cliquer sur une des pièces"; "entourant le trou"; ""; "To play, click on a part around the hole"] in let help = Button.create ~text:"Help" ~command:(give_help fp help_lines) fp in pack ~side:`Left ~fill:`X [quit] ; pack ~side:`Left ~fill:`X [help] ; mainLoop ();; if !Sys.interactive then () else begin taquin "Lambda2.back.gif" 4 4; exit 0 end;;
17f7a9f22550e67fd48befc1b8e85f48a2d14089123d09a9e5c38e061751251f
may-liu/qtalk
http_add_muc_user.erl
%% Feel free to use, reuse and abuse the code in this file. -module(http_add_muc_user). -export([init/3]). -export([handle/2]). -export([terminate/3]). -include("logger.hrl"). -include("http_req.hrl"). -include("ejb_http_server.hrl"). init(_Transport, Req, []) -> {ok, Req, undefined}. handle(Req, State) -> {Method, _} = cowboy_req:method(Req), case Method of <<"GET">> -> {Host,_} = cowboy_req:host(Req), {ok, Req1} = get_echo(Method,Host,Req), {ok, Req1, State}; <<"POST">> -> HasBody = cowboy_req:has_body(Req), {ok, Req1} = post_echo(Method, HasBody, Req), {ok, Req1, State}; _ -> {ok,Req1} = echo(undefined, Req), {ok, Req1, State} end. get_echo(<<"GET">>,_,Req) -> cowboy_req:reply(200, [ {<<"content-type">>, <<"text/json; charset=utf-8">>} ], <<"No GET method">>, Req). post_echo(<<"POST">>, true, Req) -> {ok, Body, _} = cowboy_req:body(Req), Ret = case iplimit_util:check_muc_ip_limit(Req,Body) of true -> http_create_muc(Body); _ -> http_utils:gen_result(false, <<"3">>, <<"">>,<<"ip is limited">>) end, cowboy_req:reply(200, [ {<<"content-type">>, <<"text/json; charset=utf-8">>}], Ret, Req); post_echo(<<"POST">>, false, Req) -> cowboy_req:reply(400, [], <<"Missing Post body.">>, Req); post_echo(_, _, Req) -> cowboy_req:reply(405, Req). echo(undefined, Req) -> cowboy_req:reply(400, [], <<"Missing parameter.">>, Req); echo(Echo, Req) -> cowboy_req:reply(200, [ {<<"content-type">>, <<"text/json; charset=utf-8">>} ], Echo, Req). terminate(_Reason, _Req, _State) -> ok. http_create_muc(Body) -> Url1 = case catch ets:lookup(ejabberd_config,<<"http_server">>) of [Http_server] when is_record(Http_server,ejabberd_config) -> Http_server#ejabberd_config.val; _ -> ":10050/" end, Url = Url1 ++ "add_muc_user", Header = [], Type = "application/json", HTTPOptions = [], Options = [], case http_client:http_post(Url,Header,Type,Body,HTTPOptions,Options) of {ok, {_Status,_Headers, Rslt}} -> Rslt; _ -> http_utils:gen_result(false, <<"1">>, <<"">>,<<"create_muc failed">>) end.
null
https://raw.githubusercontent.com/may-liu/qtalk/f5431e5a7123975e9656e7ab239e674ce33713cd/qtalk_opensource/scripts/ejb_http_server/src/http_add_muc_user.erl
erlang
Feel free to use, reuse and abuse the code in this file.
-module(http_add_muc_user). -export([init/3]). -export([handle/2]). -export([terminate/3]). -include("logger.hrl"). -include("http_req.hrl"). -include("ejb_http_server.hrl"). init(_Transport, Req, []) -> {ok, Req, undefined}. handle(Req, State) -> {Method, _} = cowboy_req:method(Req), case Method of <<"GET">> -> {Host,_} = cowboy_req:host(Req), {ok, Req1} = get_echo(Method,Host,Req), {ok, Req1, State}; <<"POST">> -> HasBody = cowboy_req:has_body(Req), {ok, Req1} = post_echo(Method, HasBody, Req), {ok, Req1, State}; _ -> {ok,Req1} = echo(undefined, Req), {ok, Req1, State} end. get_echo(<<"GET">>,_,Req) -> cowboy_req:reply(200, [ {<<"content-type">>, <<"text/json; charset=utf-8">>} ], <<"No GET method">>, Req). post_echo(<<"POST">>, true, Req) -> {ok, Body, _} = cowboy_req:body(Req), Ret = case iplimit_util:check_muc_ip_limit(Req,Body) of true -> http_create_muc(Body); _ -> http_utils:gen_result(false, <<"3">>, <<"">>,<<"ip is limited">>) end, cowboy_req:reply(200, [ {<<"content-type">>, <<"text/json; charset=utf-8">>}], Ret, Req); post_echo(<<"POST">>, false, Req) -> cowboy_req:reply(400, [], <<"Missing Post body.">>, Req); post_echo(_, _, Req) -> cowboy_req:reply(405, Req). echo(undefined, Req) -> cowboy_req:reply(400, [], <<"Missing parameter.">>, Req); echo(Echo, Req) -> cowboy_req:reply(200, [ {<<"content-type">>, <<"text/json; charset=utf-8">>} ], Echo, Req). terminate(_Reason, _Req, _State) -> ok. http_create_muc(Body) -> Url1 = case catch ets:lookup(ejabberd_config,<<"http_server">>) of [Http_server] when is_record(Http_server,ejabberd_config) -> Http_server#ejabberd_config.val; _ -> ":10050/" end, Url = Url1 ++ "add_muc_user", Header = [], Type = "application/json", HTTPOptions = [], Options = [], case http_client:http_post(Url,Header,Type,Body,HTTPOptions,Options) of {ok, {_Status,_Headers, Rslt}} -> Rslt; _ -> http_utils:gen_result(false, <<"1">>, <<"">>,<<"create_muc failed">>) end.
3f253c683e34125c1c01239715773c31690e607e11f5ef9db88b8ed1a8e069a6
UU-ComputerScience/uhc
t2.hs
module Main where ids :: [forall a . a -> a] ids = [] h1 = (\x -> x) : ids h2 :: [forall a . a -> a] h2 = (\x -> x) : ids h3 = id ids main = return ()
null
https://raw.githubusercontent.com/UU-ComputerScience/uhc/f2b94a90d26e2093d84044b3832a9a3e3c36b129/EHC/test/lucilia/t2.hs
haskell
module Main where ids :: [forall a . a -> a] ids = [] h1 = (\x -> x) : ids h2 :: [forall a . a -> a] h2 = (\x -> x) : ids h3 = id ids main = return ()
ba562e507cb8250be5ea19e5f2afb70206ff093ef0269979bbf722592e74dc99
realworldocaml/book
action.mli
(** Actions defined in dune files. All constructors correspond to actions the user may write in dune files. Eventually, these are all desugared into [Action.t], which are actions executed by the build system. *) open Stdune open Dune_sexp module Action_plugin : sig val syntax : Syntax.t end module Diff : sig module Mode : sig type t = | Binary (** no diffing, just raw comparison *) | Text (** diffing after newline normalization *) end type ('path, 'target) t = { optional : bool ; mode : Mode.t ; file1 : 'path ; file2 : 'target } val map : ('p, 't) t -> path:('p -> 'x) -> target:('t -> 'y) -> ('x, 'y) t val decode : 'path Decoder.t -> 'target Decoder.t -> optional:bool -> ('path, 'target) t Decoder.t val decode_binary : 'path Decoder.t -> 'target Decoder.t -> ('path, 'target) t Decoder.t end module Outputs : sig type t = | Stdout | Stderr | Outputs (** Both Stdout and Stderr *) val to_string : t -> string end module Inputs : sig type t = Stdin val to_string : t -> string end module File_perm : sig * File mode , for when creating files . We only allow what takes into account when commands . account when memoizing commands. *) type t = | Normal | Executable val suffix : t -> string val to_unix_perm : t -> int end type t = | Run of String_with_vars.t * String_with_vars.t list | With_accepted_exit_codes of int Predicate_lang.t * t | Dynamic_run of String_with_vars.t * String_with_vars.t list | Chdir of String_with_vars.t * t | Setenv of String_with_vars.t * String_with_vars.t * t It 's not possible to use a build String_with_vars.t here since jbuild supports redirecting to /dev / null . In [ dune ] files this is replaced with % { null } supports redirecting to /dev/null. In [dune] files this is replaced with %{null} *) | Redirect_out of Outputs.t * String_with_vars.t * File_perm.t * t | Redirect_in of Inputs.t * String_with_vars.t * t | Ignore of Outputs.t * t | Progn of t list | Echo of String_with_vars.t list | Cat of String_with_vars.t list | Copy of String_with_vars.t * String_with_vars.t | Symlink of String_with_vars.t * String_with_vars.t | Copy_and_add_line_directive of String_with_vars.t * String_with_vars.t | System of String_with_vars.t | Bash of String_with_vars.t | Write_file of String_with_vars.t * File_perm.t * String_with_vars.t | Mkdir of String_with_vars.t | Diff of (String_with_vars.t, String_with_vars.t) Diff.t | No_infer of t | Pipe of Outputs.t * t list | Cram of String_with_vars.t include Conv.S with type t := t (** Raises User_error on invalid action. *) val validate : loc:Loc.t -> t -> unit val compare_no_locs : t -> t -> Ordering.t val to_dyn : t -> Dyn.t val remove_locs : t -> t val equal : t -> t -> bool val chdir : String_with_vars.t -> t -> t val run : String_with_vars.t -> String_with_vars.t list -> t
null
https://raw.githubusercontent.com/realworldocaml/book/d822fd065f19dbb6324bf83e0143bc73fd77dbf9/duniverse/dune_/src/dune_lang/action.mli
ocaml
* Actions defined in dune files. All constructors correspond to actions the user may write in dune files. Eventually, these are all desugared into [Action.t], which are actions executed by the build system. * no diffing, just raw comparison * diffing after newline normalization * Both Stdout and Stderr * Raises User_error on invalid action.
open Stdune open Dune_sexp module Action_plugin : sig val syntax : Syntax.t end module Diff : sig module Mode : sig type t = end type ('path, 'target) t = { optional : bool ; mode : Mode.t ; file1 : 'path ; file2 : 'target } val map : ('p, 't) t -> path:('p -> 'x) -> target:('t -> 'y) -> ('x, 'y) t val decode : 'path Decoder.t -> 'target Decoder.t -> optional:bool -> ('path, 'target) t Decoder.t val decode_binary : 'path Decoder.t -> 'target Decoder.t -> ('path, 'target) t Decoder.t end module Outputs : sig type t = | Stdout | Stderr val to_string : t -> string end module Inputs : sig type t = Stdin val to_string : t -> string end module File_perm : sig * File mode , for when creating files . We only allow what takes into account when commands . account when memoizing commands. *) type t = | Normal | Executable val suffix : t -> string val to_unix_perm : t -> int end type t = | Run of String_with_vars.t * String_with_vars.t list | With_accepted_exit_codes of int Predicate_lang.t * t | Dynamic_run of String_with_vars.t * String_with_vars.t list | Chdir of String_with_vars.t * t | Setenv of String_with_vars.t * String_with_vars.t * t It 's not possible to use a build String_with_vars.t here since jbuild supports redirecting to /dev / null . In [ dune ] files this is replaced with % { null } supports redirecting to /dev/null. In [dune] files this is replaced with %{null} *) | Redirect_out of Outputs.t * String_with_vars.t * File_perm.t * t | Redirect_in of Inputs.t * String_with_vars.t * t | Ignore of Outputs.t * t | Progn of t list | Echo of String_with_vars.t list | Cat of String_with_vars.t list | Copy of String_with_vars.t * String_with_vars.t | Symlink of String_with_vars.t * String_with_vars.t | Copy_and_add_line_directive of String_with_vars.t * String_with_vars.t | System of String_with_vars.t | Bash of String_with_vars.t | Write_file of String_with_vars.t * File_perm.t * String_with_vars.t | Mkdir of String_with_vars.t | Diff of (String_with_vars.t, String_with_vars.t) Diff.t | No_infer of t | Pipe of Outputs.t * t list | Cram of String_with_vars.t include Conv.S with type t := t val validate : loc:Loc.t -> t -> unit val compare_no_locs : t -> t -> Ordering.t val to_dyn : t -> Dyn.t val remove_locs : t -> t val equal : t -> t -> bool val chdir : String_with_vars.t -> t -> t val run : String_with_vars.t -> String_with_vars.t list -> t
cb4b92e7e21f947917d25fb0065d59e8c9f7b24260e6ae462137ff83fe338848
LeventErkok/hArduino
Setup.hs
----------------------------------------------------------------------------- -- | -- Module : Main Copyright : ( c ) -- License : BSD3 -- Maintainer : -- Stability : experimental -- Setup module for the hArduino library ----------------------------------------------------------------------------- # OPTIONS_GHC -Wall # module Main(main) where import Distribution.Simple main :: IO () main = defaultMain
null
https://raw.githubusercontent.com/LeventErkok/hArduino/ee04988ad9ef3d4384d7ce7a8670518ce8b0a34c/Setup.hs
haskell
--------------------------------------------------------------------------- | Module : Main License : BSD3 Maintainer : Stability : experimental ---------------------------------------------------------------------------
Copyright : ( c ) Setup module for the hArduino library # OPTIONS_GHC -Wall # module Main(main) where import Distribution.Simple main :: IO () main = defaultMain
5c32ae59b4d739747294968ce2f44fc0ea4b221d69658a7909f07f9af30b3e8c
clojurewerkz/cassaforte
types.clj
(ns clojurewerkz.cassaforte.query.types (:import [com.datastax.driver.core TupleType DataType ProtocolVersion CodecRegistry])) ;; ;; Types ;; (def primitive-types {:ascii (DataType/ascii) :bigint (DataType/bigint) :blob (DataType/blob) :boolean (DataType/cboolean) :counter (DataType/counter) :decimal (DataType/decimal) :double (DataType/cdouble) :float (DataType/cfloat) :inet (DataType/inet) :int (DataType/cint) :text (DataType/text) :timestamp (DataType/timestamp) :uuid (DataType/uuid) :varchar (DataType/varchar) :varint (DataType/varint) :timeuuid (DataType/timeuuid)}) (defn resolve-primitive-type [type-or-name] (if (keyword? type-or-name) (if-let [res (get primitive-types type-or-name)] res (throw (IllegalArgumentException. (str "Column name " (name type-or-name) " was not found, pick one of (" (clojure.string/join "," (keys primitive-types)) ")")))) type-or-name)) (defn list-type [primitive-type] (DataType/list (get primitive-types primitive-type))) (defn set-type [primitive-type] (DataType/set (get primitive-types primitive-type))) (defn map-type [key-type value-type] (DataType/map (get primitive-types key-type) (get primitive-types value-type))) FIXME should be using cluster instance and cluster.metadata.newTupleType instead (defn tuple-of [^ProtocolVersion protocol-version types values] (.newValue (TupleType/of protocol-version CodecRegistry/DEFAULT_INSTANCE (into-array (map #(get primitive-types %) types))) (object-array values)))
null
https://raw.githubusercontent.com/clojurewerkz/cassaforte/bd0b3ff44c5d7f993798270032aa41be0e8209c2/src/clojure/clojurewerkz/cassaforte/query/types.clj
clojure
Types
(ns clojurewerkz.cassaforte.query.types (:import [com.datastax.driver.core TupleType DataType ProtocolVersion CodecRegistry])) (def primitive-types {:ascii (DataType/ascii) :bigint (DataType/bigint) :blob (DataType/blob) :boolean (DataType/cboolean) :counter (DataType/counter) :decimal (DataType/decimal) :double (DataType/cdouble) :float (DataType/cfloat) :inet (DataType/inet) :int (DataType/cint) :text (DataType/text) :timestamp (DataType/timestamp) :uuid (DataType/uuid) :varchar (DataType/varchar) :varint (DataType/varint) :timeuuid (DataType/timeuuid)}) (defn resolve-primitive-type [type-or-name] (if (keyword? type-or-name) (if-let [res (get primitive-types type-or-name)] res (throw (IllegalArgumentException. (str "Column name " (name type-or-name) " was not found, pick one of (" (clojure.string/join "," (keys primitive-types)) ")")))) type-or-name)) (defn list-type [primitive-type] (DataType/list (get primitive-types primitive-type))) (defn set-type [primitive-type] (DataType/set (get primitive-types primitive-type))) (defn map-type [key-type value-type] (DataType/map (get primitive-types key-type) (get primitive-types value-type))) FIXME should be using cluster instance and cluster.metadata.newTupleType instead (defn tuple-of [^ProtocolVersion protocol-version types values] (.newValue (TupleType/of protocol-version CodecRegistry/DEFAULT_INSTANCE (into-array (map #(get primitive-types %) types))) (object-array values)))
2b94c1a341d091155e96a107de8037ddaf0406739da641c51356d3854a6fdee8
clj-easy/graal-config
core.clj
(ns example.core (:require [io.pedestal.log :as log]) (:gen-class)) (defn -main [& _args] (log/error :in 'my-fn :message "this is a message") (log/error :hello "world") (log/info :hello "world"))
null
https://raw.githubusercontent.com/clj-easy/graal-config/2462e9f730c7a283796694c4e7786093c1192016/config/org.slf4j/slf4j-simple/example/src/example/core.clj
clojure
(ns example.core (:require [io.pedestal.log :as log]) (:gen-class)) (defn -main [& _args] (log/error :in 'my-fn :message "this is a message") (log/error :hello "world") (log/info :hello "world"))
5c04821fd8b06bfce5c4b2d561a71289d7fb65553994fd4af8ea47a6998807ee
iamaleksey/common_lib
common_lib.erl
Copyright ( C ) 2009 , %%% All rights reserved. %%% %%% Redistribution and use in source and binary forms, with or without %%% modification, are permitted provided that the following conditions are met: %%% %%% o Redistributions of source code must retain the above copyright notice, %%% this list of conditions and the following disclaimer. %%% %%% o Redistributions in binary form must reproduce the above copyright notice, %%% this list of conditions and the following disclaimer in the documentation %%% and/or other materials provided with the distribution. %%% %%% o Neither the name of ERLANG TRAINING AND CONSULTING nor the names of its %%% contributors may be used to endorse or promote products derived from this %%% software without specific prior written permission. %%% THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS " AS IS " %%% AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED . IN NO EVENT SHALL THE COPYRIGHT HOLDER OR LIABLE FOR ANY DIRECT , INDIRECT , INCIDENTAL , SPECIAL , EXEMPLARY , OR %%% CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF %%% SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION ) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY , WHETHER IN %%% CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) %%% ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE %%% POSSIBILITY OF SUCH DAMAGE. -module(common_lib). -behaviour(application). START / STOP EXPORTS -export([start/2, stop/1]). %%%----------------------------------------------------------------------------- START / STOP EXPORTS %%%----------------------------------------------------------------------------- start(_Type, _StartArgs) -> cl_queue_tab:new(), common_lib_sup:start_link(). stop(_St) -> ok.
null
https://raw.githubusercontent.com/iamaleksey/common_lib/250d965d5accaad8aa1e2c7bbf4ac691aa94ca93/src/common_lib.erl
erlang
All rights reserved. Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: o Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. o Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. o Neither the name of ERLANG TRAINING AND CONSULTING nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission. AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. ----------------------------------------------------------------------------- -----------------------------------------------------------------------------
Copyright ( C ) 2009 , THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS " AS IS " IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED . IN NO EVENT SHALL THE COPYRIGHT HOLDER OR LIABLE FOR ANY DIRECT , INDIRECT , INCIDENTAL , SPECIAL , EXEMPLARY , OR INTERRUPTION ) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY , WHETHER IN -module(common_lib). -behaviour(application). START / STOP EXPORTS -export([start/2, stop/1]). START / STOP EXPORTS start(_Type, _StartArgs) -> cl_queue_tab:new(), common_lib_sup:start_link(). stop(_St) -> ok.
d157a63149042db3468419f7247874769da42f5532356333a6d91d0b3b5fa8b7
qfpl/reflex-tutorial
Solution.hs
# LANGUAGE CPP # {-# LANGUAGE OverloadedStrings #-} module Ex03.Solution ( attachEx03 ) where import Language.Javascript.JSaddle (JSM) import qualified Data.Map as Map import Reflex import Util.Attach #ifndef ghcjs_HOST_OS import Util.Run #endif import Ex03.Common import Ex03.Run ex03 :: Reflex t => Inputs t -> Outputs t ex03 (Inputs bMoney bSelected eBuy eRefund) = let -- We put our products in a list: products = [carrot, celery, cucumber] -- We write a helper function to get from a `Product` to a `Map Text (Behavior t Product)` productSingleton p = Map.singleton (pName p) (pure p) -- We use this helper to turn our products into a `Map` and then combine the `Map`s, using `foldMap`: mbProduct = foldMap productSingleton products -- We have a `Map` of `Behavior`s that we want to turn into a `Behavior` of `Map`s, -- so we use `sequence`: bmProduct = sequence mbProduct -- We use `(<@)` here to run `Map.lookup` with the values of `bSelected` and `bmProduct` at the times that ` eBuy ` fires : emProduct = Map.lookup <$> bSelected <*> bmProduct <@ eBuy Finally , we use ` fmapMaybe i d ` to filter out the ` Nothing ` values and removing the ` Just ` constructor : eProduct = fmapMaybe id emProduct checkNotEnoughMoney money p = money < pCost p eError = NotEnoughMoney <$ ffilter id (checkNotEnoughMoney <$> bMoney <@> eProduct) eSale = difference eProduct eError eVend = pName <$> eSale eSpend = pCost <$> eSale eChange = bMoney <@ eRefund in Outputs eVend eSpend eChange eError attachEx03 :: JSM () attachEx03 = attachId_ "ex03" $ host ex03 #ifndef ghcjs_HOST_OS go :: IO () go = run $ host ex03 #endif
null
https://raw.githubusercontent.com/qfpl/reflex-tutorial/07c1e6fab387cbeedd031630ba6a5cd946cc612e/code/exercises/src/Ex03/Solution.hs
haskell
# LANGUAGE OverloadedStrings # We put our products in a list: We write a helper function to get from a `Product` to a `Map Text (Behavior t Product)` We use this helper to turn our products into a `Map` and then combine the `Map`s, using `foldMap`: We have a `Map` of `Behavior`s that we want to turn into a `Behavior` of `Map`s, so we use `sequence`: We use `(<@)` here to run `Map.lookup` with the values of `bSelected` and `bmProduct` at
# LANGUAGE CPP # module Ex03.Solution ( attachEx03 ) where import Language.Javascript.JSaddle (JSM) import qualified Data.Map as Map import Reflex import Util.Attach #ifndef ghcjs_HOST_OS import Util.Run #endif import Ex03.Common import Ex03.Run ex03 :: Reflex t => Inputs t -> Outputs t ex03 (Inputs bMoney bSelected eBuy eRefund) = let products = [carrot, celery, cucumber] productSingleton p = Map.singleton (pName p) (pure p) mbProduct = foldMap productSingleton products bmProduct = sequence mbProduct the times that ` eBuy ` fires : emProduct = Map.lookup <$> bSelected <*> bmProduct <@ eBuy Finally , we use ` fmapMaybe i d ` to filter out the ` Nothing ` values and removing the ` Just ` constructor : eProduct = fmapMaybe id emProduct checkNotEnoughMoney money p = money < pCost p eError = NotEnoughMoney <$ ffilter id (checkNotEnoughMoney <$> bMoney <@> eProduct) eSale = difference eProduct eError eVend = pName <$> eSale eSpend = pCost <$> eSale eChange = bMoney <@ eRefund in Outputs eVend eSpend eChange eError attachEx03 :: JSM () attachEx03 = attachId_ "ex03" $ host ex03 #ifndef ghcjs_HOST_OS go :: IO () go = run $ host ex03 #endif
b5317b17fb56d4c77afae99c39be3e05c7f45a2656a782c49961b6b4516cd4b8
input-output-hk/cardano-ledger
Utxos.hs
# LANGUAGE DataKinds # # LANGUAGE FlexibleContexts # # LANGUAGE MultiParamTypeClasses # # LANGUAGE TypeFamilies # # LANGUAGE UndecidableInstances # # OPTIONS_GHC -Wno - orphans # module Cardano.Ledger.Conway.Rules.Utxos (ConwayUTXOS) where import Cardano.Ledger.Alonzo.Rules ( AlonzoUtxoEvent (..), AlonzoUtxoPredFailure (..), AlonzoUtxosEvent, AlonzoUtxosPredFailure, ) import Cardano.Ledger.Alonzo.Scripts (AlonzoScript) import Cardano.Ledger.Alonzo.Tx (AlonzoTx (..)) import Cardano.Ledger.Babbage.Rules (BabbageUTXO, BabbageUtxoPredFailure (..)) import Cardano.Ledger.BaseTypes (ShelleyBase) import Cardano.Ledger.Conway.Core import Cardano.Ledger.Conway.Era (ConwayUTXOS) import Cardano.Ledger.Shelley.LedgerState (PPUPPredFailure, UTxOState (..)) import Cardano.Ledger.Shelley.Rules (UtxoEnv (..)) import Control.State.Transition.Extended (Embed (..), STS (..)) instance ( EraTxOut era , EraGovernance era , Script era ~ AlonzoScript era , Eq (PPUPPredFailure era) , Show (PPUPPredFailure era) ) => STS (ConwayUTXOS era) where type BaseM (ConwayUTXOS era) = ShelleyBase type Environment (ConwayUTXOS era) = UtxoEnv era type State (ConwayUTXOS era) = UTxOState era type Signal (ConwayUTXOS era) = AlonzoTx era type PredicateFailure (ConwayUTXOS era) = AlonzoUtxosPredFailure era type Event (ConwayUTXOS era) = AlonzoUtxosEvent era transitionRules = [] instance ( EraTxOut era , EraGovernance era , PredicateFailure (EraRule "UTXOS" era) ~ AlonzoUtxosPredFailure era , Event (EraRule "UTXOS" era) ~ AlonzoUtxosEvent era , Eq (PPUPPredFailure era) , Show (PPUPPredFailure era) , Script era ~ AlonzoScript era ) => Embed (ConwayUTXOS era) (BabbageUTXO era) where wrapFailed = AlonzoInBabbageUtxoPredFailure . UtxosFailure wrapEvent = UtxosEvent
null
https://raw.githubusercontent.com/input-output-hk/cardano-ledger/ac405a977557a7c58ce1cf69d3c2a0bf148cf19f/eras/conway/impl/src/Cardano/Ledger/Conway/Rules/Utxos.hs
haskell
# LANGUAGE DataKinds # # LANGUAGE FlexibleContexts # # LANGUAGE MultiParamTypeClasses # # LANGUAGE TypeFamilies # # LANGUAGE UndecidableInstances # # OPTIONS_GHC -Wno - orphans # module Cardano.Ledger.Conway.Rules.Utxos (ConwayUTXOS) where import Cardano.Ledger.Alonzo.Rules ( AlonzoUtxoEvent (..), AlonzoUtxoPredFailure (..), AlonzoUtxosEvent, AlonzoUtxosPredFailure, ) import Cardano.Ledger.Alonzo.Scripts (AlonzoScript) import Cardano.Ledger.Alonzo.Tx (AlonzoTx (..)) import Cardano.Ledger.Babbage.Rules (BabbageUTXO, BabbageUtxoPredFailure (..)) import Cardano.Ledger.BaseTypes (ShelleyBase) import Cardano.Ledger.Conway.Core import Cardano.Ledger.Conway.Era (ConwayUTXOS) import Cardano.Ledger.Shelley.LedgerState (PPUPPredFailure, UTxOState (..)) import Cardano.Ledger.Shelley.Rules (UtxoEnv (..)) import Control.State.Transition.Extended (Embed (..), STS (..)) instance ( EraTxOut era , EraGovernance era , Script era ~ AlonzoScript era , Eq (PPUPPredFailure era) , Show (PPUPPredFailure era) ) => STS (ConwayUTXOS era) where type BaseM (ConwayUTXOS era) = ShelleyBase type Environment (ConwayUTXOS era) = UtxoEnv era type State (ConwayUTXOS era) = UTxOState era type Signal (ConwayUTXOS era) = AlonzoTx era type PredicateFailure (ConwayUTXOS era) = AlonzoUtxosPredFailure era type Event (ConwayUTXOS era) = AlonzoUtxosEvent era transitionRules = [] instance ( EraTxOut era , EraGovernance era , PredicateFailure (EraRule "UTXOS" era) ~ AlonzoUtxosPredFailure era , Event (EraRule "UTXOS" era) ~ AlonzoUtxosEvent era , Eq (PPUPPredFailure era) , Show (PPUPPredFailure era) , Script era ~ AlonzoScript era ) => Embed (ConwayUTXOS era) (BabbageUTXO era) where wrapFailed = AlonzoInBabbageUtxoPredFailure . UtxosFailure wrapEvent = UtxosEvent
13b08cd1ae231341aa0785e37a2a7c55845bb975dbcff3fc896a44495239347c
xvw/muhokama
env.mli
(** Provide the [Env] through HTTP request. *) val set : Lib_common.Env.t -> Dream.middleware val get : Dream.request -> (Lib_common.Env.t -> 'a) -> 'a
null
https://raw.githubusercontent.com/xvw/muhokama/c6f4dbe0459d9dc5f9fb9921a05a3bba93a06ce7/lib/service/env.mli
ocaml
* Provide the [Env] through HTTP request.
val set : Lib_common.Env.t -> Dream.middleware val get : Dream.request -> (Lib_common.Env.t -> 'a) -> 'a
edb771153958ea88bc302010e45190da828039b571e9f06848d77b10b19dc1c1
jacquev6/JsOfOCairo
draw_in_browser.ml
Copyright 2017 < > module Drawings = Drawings.Make(JsOfOCairo) let () = Js_of_ocaml.Js.export "draw" (fun canvas -> Drawings.draw (JsOfOCairo.create canvas) )
null
https://raw.githubusercontent.com/jacquev6/JsOfOCairo/a00a31000b1a7cabe6ac74e48e86b52ec4699cff/demo/draw_in_browser.ml
ocaml
Copyright 2017 < > module Drawings = Drawings.Make(JsOfOCairo) let () = Js_of_ocaml.Js.export "draw" (fun canvas -> Drawings.draw (JsOfOCairo.create canvas) )
614ba85d34f7ae256dbf9c40f4e994e5967a1774889f6394f5df48ccc19e556c
Andromedans/andromeda
substitution.ml
module MetaMap = Map.Make(struct type t = Mlty.meta let compare = compare end) type t = Mlty.ty MetaMap.t let lookup m s = try Some (MetaMap.find m s) with Not_found -> None let domain s = MetaMap.fold (fun m _ ms -> Mlty.MetaSet.add m ms) s Mlty.MetaSet.empty let apply (s : t) t = if MetaMap.is_empty s then t else begin let rec app = function | Mlty.Exn | Mlty.Judgement | Mlty.Boundary | Mlty.Derivation | Mlty.String | Mlty.Param _ as t -> t | Mlty.Meta m as orig -> begin match lookup m s with | Some t -> app t | None -> orig end | Mlty.Prod ts -> let ts = List.map app ts in Mlty.Prod ts | Mlty.Arrow (t1, t2) -> let t1 = app t1 and t2 = app t2 in Mlty.Arrow (t1, t2) | Mlty.Handler (t1, t2) -> let t1 = app t1 and t2 = app t2 in Mlty.Handler (t1, t2) | Mlty.Apply (pth, ts) -> let ts = List.map app ts in Mlty.Apply (pth, ts) | Mlty.Ref t -> let t = app t in Mlty.Ref t in app t end let empty : t = MetaMap.empty let from_lists ms ts = List.fold_left2 (fun s m t -> MetaMap.add m t s) empty ms ts let add m t s = let t = apply s t in if Mlty.occurs m t then None else Some (MetaMap.add m t s) let partition = MetaMap.partition
null
https://raw.githubusercontent.com/Andromedans/andromeda/a5c678450e6c6d4a7cd5eee1196bde558541b994/src/typing/substitution.ml
ocaml
module MetaMap = Map.Make(struct type t = Mlty.meta let compare = compare end) type t = Mlty.ty MetaMap.t let lookup m s = try Some (MetaMap.find m s) with Not_found -> None let domain s = MetaMap.fold (fun m _ ms -> Mlty.MetaSet.add m ms) s Mlty.MetaSet.empty let apply (s : t) t = if MetaMap.is_empty s then t else begin let rec app = function | Mlty.Exn | Mlty.Judgement | Mlty.Boundary | Mlty.Derivation | Mlty.String | Mlty.Param _ as t -> t | Mlty.Meta m as orig -> begin match lookup m s with | Some t -> app t | None -> orig end | Mlty.Prod ts -> let ts = List.map app ts in Mlty.Prod ts | Mlty.Arrow (t1, t2) -> let t1 = app t1 and t2 = app t2 in Mlty.Arrow (t1, t2) | Mlty.Handler (t1, t2) -> let t1 = app t1 and t2 = app t2 in Mlty.Handler (t1, t2) | Mlty.Apply (pth, ts) -> let ts = List.map app ts in Mlty.Apply (pth, ts) | Mlty.Ref t -> let t = app t in Mlty.Ref t in app t end let empty : t = MetaMap.empty let from_lists ms ts = List.fold_left2 (fun s m t -> MetaMap.add m t s) empty ms ts let add m t s = let t = apply s t in if Mlty.occurs m t then None else Some (MetaMap.add m t s) let partition = MetaMap.partition
e3d908eb870e8abc3099f901278592ee19e78085ada2066cf1b0ee3969c3e5a7
serokell/servant-util
Postgres.hs
module Servant.Util.Beam.Postgres ( module M ) where import Servant.Util.Beam.Postgres.Filtering as M import Servant.Util.Beam.Postgres.Pagination as M import Servant.Util.Beam.Postgres.Sorting as M
null
https://raw.githubusercontent.com/serokell/servant-util/21ce12e9bdbf37e06498e2387429a30d4a4ba992/servant-util-beam-pg/src/Servant/Util/Beam/Postgres.hs
haskell
module Servant.Util.Beam.Postgres ( module M ) where import Servant.Util.Beam.Postgres.Filtering as M import Servant.Util.Beam.Postgres.Pagination as M import Servant.Util.Beam.Postgres.Sorting as M
2bdbf7556bab5e8c21b3f2302e2018d51eb00203b4531f6adebf05bd18bc500f
takuto-h/yuzu
typeInfo.ml
type t = | Variant of ((Names.ctor_name * (TypeExpr.t) option * TypeExpr.t)) list | Record of ((bool * Names.val_name * TypeExpr.t * TypeExpr.t)) list
null
https://raw.githubusercontent.com/takuto-h/yuzu/e6bef0964d87c1ced65280083505448f56e5cf29/typeInfo.ml
ocaml
type t = | Variant of ((Names.ctor_name * (TypeExpr.t) option * TypeExpr.t)) list | Record of ((bool * Names.val_name * TypeExpr.t * TypeExpr.t)) list
a11b795b611fa38211667a48c5fb6c0aa79d0060515f2d0fee7f08b7194eeccd
ekmett/rope
Branded.hs
# LANGUAGE TypeOperators , Rank2Types , EmptyDataDecls , MultiParamTypeClasses , FunctionalDependencies , FlexibleContexts , FlexibleInstances , UndecidableInstances , IncoherentInstances , OverlappingInstances # MultiParamTypeClasses, FunctionalDependencies, FlexibleContexts, FlexibleInstances, UndecidableInstances, IncoherentInstances, OverlappingInstances #-} module Data.Rope.Branded ( Branded(..) , Unsafe , UBR , null -- :: (s `Branded` Rope) a -> Bool -- * Unpacking Ropes , head -- :: Unpackable t => (s `Branded` Rope) a -> t , last -- :: Unpackable t => (s `Branded` Rope) a -> t , unpack -- :: Unpackable t => (s `Branded` Rope) a -> [t] -- * MonadWriter , runBranded , execBranded -- MonadWriter terminology for 'context' ) where import Prelude hiding (null, head, last, take, drop, span, break, splitAt, takeWhile, dropWhile) import Control.Applicative hiding (empty) import Control.Monad.Writer.Class import Data.Rope.Branded.Comonad import Data.Monoid import Data.FingerTree (Measured(..)) import Data.Foldable (Foldable) import qualified Data.Foldable import Data.Traversable (Traversable(traverse)) import qualified Data.Rope.Internal as Rope import Data.Rope.Internal (Rope(..),Unpackable) type UBR a = (Unsafe `Branded` Rope) a data Unsafe data Branded brand t a = Branded { context :: !t, extractBranded :: a } null :: Branded s Rope a -> Bool null = Rope.null . context # INLINE null # head :: Unpackable t => Branded s Rope a -> t head = Rope.head . context # INLINE head # last :: Unpackable t => Branded s Rope a -> t last = Rope.last . context # INLINE last # unpack :: Unpackable t => Branded s Rope a -> [t] unpack (Branded s _) = Rope.unpack s # INLINE unpack # instance Measured v t => Measured v (Branded s t a) where measure = measure . context instance Functor (Branded s t) where fmap f (Branded s a) = Branded s (f a) instance Comonad (Branded s t) where extract = extractBranded extend f a@(Branded s _) = Branded s (f a) duplicate a@(Branded s _) = Branded s a instance Foldable (Branded s t) where foldr f z (Branded _ a) = f a z foldr1 _ (Branded _ a) = a foldl f z (Branded _ a) = f z a foldl1 _ (Branded _ a) = a foldMap f (Branded _ a) = f a instance Traversable (Branded s t) where traverse f (Branded s a) = Branded s <$> f a instance Monoid t => Applicative (Branded Unsafe t) where pure = Branded mempty Branded s f <*> Branded s' a = Branded (s `mappend` s') (f a) instance Monoid t => Monad (Branded Unsafe t) where return = Branded mempty Branded s a >>= f = Branded (s `mappend` s') b where Branded s' b = f a instance (Monoid t, Monoid m) => Monoid (Branded Unsafe t m) where mempty = Branded mempty mempty Branded r t `mappend` Branded s u = Branded (r `mappend` s) (t `mappend` u) -- > sample :: Branded Unsafe Rope () -- > sample = do pack "Hello" -- > pack ' ' > pack " World " -- > instance Monoid t => MonadWriter t (Branded Unsafe t) where tell t = Branded t () listen (Branded t a) = Branded t (a, t) pass (Branded t (a,f)) = Branded (f t) a runBranded :: Branded s t a -> (a, t) runBranded (Branded t a) = (a, t) # INLINE runBranded # execBranded :: Branded s t a -> t execBranded (Branded t _) = t # INLINE execBranded #
null
https://raw.githubusercontent.com/ekmett/rope/418b895e4895f566d726ca17688c428bcc95aa25/Data/Rope/Branded.hs
haskell
:: (s `Branded` Rope) a -> Bool * Unpacking Ropes :: Unpackable t => (s `Branded` Rope) a -> t :: Unpackable t => (s `Branded` Rope) a -> t :: Unpackable t => (s `Branded` Rope) a -> [t] * MonadWriter MonadWriter terminology for 'context' > sample :: Branded Unsafe Rope () > sample = do pack "Hello" > pack ' ' >
# LANGUAGE TypeOperators , Rank2Types , EmptyDataDecls , MultiParamTypeClasses , FunctionalDependencies , FlexibleContexts , FlexibleInstances , UndecidableInstances , IncoherentInstances , OverlappingInstances # MultiParamTypeClasses, FunctionalDependencies, FlexibleContexts, FlexibleInstances, UndecidableInstances, IncoherentInstances, OverlappingInstances #-} module Data.Rope.Branded ( Branded(..) , Unsafe , UBR , runBranded ) where import Prelude hiding (null, head, last, take, drop, span, break, splitAt, takeWhile, dropWhile) import Control.Applicative hiding (empty) import Control.Monad.Writer.Class import Data.Rope.Branded.Comonad import Data.Monoid import Data.FingerTree (Measured(..)) import Data.Foldable (Foldable) import qualified Data.Foldable import Data.Traversable (Traversable(traverse)) import qualified Data.Rope.Internal as Rope import Data.Rope.Internal (Rope(..),Unpackable) type UBR a = (Unsafe `Branded` Rope) a data Unsafe data Branded brand t a = Branded { context :: !t, extractBranded :: a } null :: Branded s Rope a -> Bool null = Rope.null . context # INLINE null # head :: Unpackable t => Branded s Rope a -> t head = Rope.head . context # INLINE head # last :: Unpackable t => Branded s Rope a -> t last = Rope.last . context # INLINE last # unpack :: Unpackable t => Branded s Rope a -> [t] unpack (Branded s _) = Rope.unpack s # INLINE unpack # instance Measured v t => Measured v (Branded s t a) where measure = measure . context instance Functor (Branded s t) where fmap f (Branded s a) = Branded s (f a) instance Comonad (Branded s t) where extract = extractBranded extend f a@(Branded s _) = Branded s (f a) duplicate a@(Branded s _) = Branded s a instance Foldable (Branded s t) where foldr f z (Branded _ a) = f a z foldr1 _ (Branded _ a) = a foldl f z (Branded _ a) = f z a foldl1 _ (Branded _ a) = a foldMap f (Branded _ a) = f a instance Traversable (Branded s t) where traverse f (Branded s a) = Branded s <$> f a instance Monoid t => Applicative (Branded Unsafe t) where pure = Branded mempty Branded s f <*> Branded s' a = Branded (s `mappend` s') (f a) instance Monoid t => Monad (Branded Unsafe t) where return = Branded mempty Branded s a >>= f = Branded (s `mappend` s') b where Branded s' b = f a instance (Monoid t, Monoid m) => Monoid (Branded Unsafe t m) where mempty = Branded mempty mempty Branded r t `mappend` Branded s u = Branded (r `mappend` s) (t `mappend` u) > pack " World " instance Monoid t => MonadWriter t (Branded Unsafe t) where tell t = Branded t () listen (Branded t a) = Branded t (a, t) pass (Branded t (a,f)) = Branded (f t) a runBranded :: Branded s t a -> (a, t) runBranded (Branded t a) = (a, t) # INLINE runBranded # execBranded :: Branded s t a -> t execBranded (Branded t _) = t # INLINE execBranded #
68ac82da956c64301e44939fdeb784435ecb6c135ed5e80de9515e190af07594
yokolet/clementine
tagged_literals.clj
(ns cljs.tagged-literals (:require [clojure.instant :as inst])) (defn read-queue [form] (assert (vector? form) "Queue literal expects a vector for its elements.") (list 'cljs.core/into 'cljs.core.PersistentQueue/EMPTY form)) (defn read-uuid [form] (assert (string? form) "UUID literal expects a string as its representation.") (try (let [uuid (java.util.UUID/fromString form)] (list (symbol "UUID.") form)) (catch Throwable e (throw (RuntimeException. (.getMessage e)))))) (defn read-inst [form] (assert (string? form) "Instance literal expects a string for its timestamp.") (try (let [^java.util.Date d (inst/read-instant-date form)] (list (symbol "js/Date.") (.getTime d))) (catch Throwable e (throw (RuntimeException. (.getMessage e)))))) (def ^:dynamic *cljs-data-readers* {'queue read-queue 'uuid read-uuid 'inst read-inst})
null
https://raw.githubusercontent.com/yokolet/clementine/b26c2318625e49606b5cc3b95cc9e1f5085ac309/ext/clojure-clojurescript-bef56a7/src/clj/cljs/tagged_literals.clj
clojure
(ns cljs.tagged-literals (:require [clojure.instant :as inst])) (defn read-queue [form] (assert (vector? form) "Queue literal expects a vector for its elements.") (list 'cljs.core/into 'cljs.core.PersistentQueue/EMPTY form)) (defn read-uuid [form] (assert (string? form) "UUID literal expects a string as its representation.") (try (let [uuid (java.util.UUID/fromString form)] (list (symbol "UUID.") form)) (catch Throwable e (throw (RuntimeException. (.getMessage e)))))) (defn read-inst [form] (assert (string? form) "Instance literal expects a string for its timestamp.") (try (let [^java.util.Date d (inst/read-instant-date form)] (list (symbol "js/Date.") (.getTime d))) (catch Throwable e (throw (RuntimeException. (.getMessage e)))))) (def ^:dynamic *cljs-data-readers* {'queue read-queue 'uuid read-uuid 'inst read-inst})
bcacf7656377ebae3a72c46691639cc13babb89d1cd0f8158d7e7f9140ce7abc
programaker-project/Programaker-Core
automate_rest_api_programs_root.erl
%%% @doc %%% REST endpoint to manage knowledge collections. %%% @end -module(automate_rest_api_programs_root). -export([init/2]). -export([ allowed_methods/2 , options/2 , is_authorized/2 , content_types_provided/2 , content_types_accepted/2 , resource_exists/2 ]). -export([ accept_json_create_program/2 , to_json/2 ]). -include("./records.hrl"). -define(UTILS, automate_rest_api_utils). -define(FORMATTING, automate_rest_api_utils_formatting). -define(PROGRAMS, automate_rest_api_utils_programs). -record(create_program_seq, { username :: binary() }). -spec init(_,_) -> {'cowboy_rest',_,_}. init(Req, _Opts) -> UserId = cowboy_req:binding(user_id, Req), {cowboy_rest, Req , #create_program_seq{ username=UserId }}. resource_exists(Req, State) -> case cowboy_req:method(Req) of <<"POST">> -> { false, Req, State }; _ -> { true, Req, State} end. %% CORS options(Req, State) -> Req1 = automate_rest_api_cors:set_headers(Req), {ok, Req1, State}. %% Authentication -spec allowed_methods(cowboy_req:req(),_) -> {[binary()], cowboy_req:req(),_}. allowed_methods(Req, State) -> {[<<"GET">>, <<"POST">>, <<"OPTIONS">>], Req, State}. is_authorized(Req, State) -> Req1 = automate_rest_api_cors:set_headers(Req), case cowboy_req:method(Req1) of %% Don't do authentication if it's just asking for options <<"OPTIONS">> -> { true, Req1, State }; Method -> case cowboy_req:header(<<"authorization">>, Req, undefined) of undefined -> { {false, <<"Authorization header not found">>} , Req1, State }; X -> Scope = case Method of <<"GET">> -> list_programs; <<"POST">> -> create_programs end, #create_program_seq{username=Username} = State, case automate_rest_api_backend:is_valid_token(X, Scope) of {true, Username} -> { true, Req1, State }; {true, _} -> %% Non matching username { { false, <<"Unauthorized to create a program here">>}, Req1, State }; false -> { { false, <<"Authorization not correct">>}, Req1, State } end end end. %% POST handler content_types_accepted(Req, State) -> {[{{<<"application">>, <<"json">>, []}, accept_json_create_program}], Req, State}. -spec accept_json_create_program(cowboy_req:req(), #create_program_seq{}) -> {{'true', binary()},cowboy_req:req(), #create_program_seq{}}. accept_json_create_program(Req, State) -> #create_program_seq{username=Username} = State, {ok, Body, _} = ?UTILS:read_body(Req), {Type, Name} = ?PROGRAMS:get_metadata_from_body(Body), case automate_rest_api_backend:create_program(Username, Name, Type) of { ok, {ProgramId, ProgramName, ProgramUrl, ProgramType} } -> Output = jiffy:encode(#{ <<"id">> => ProgramId , <<"name">> => ProgramName , <<"link">> => ProgramUrl , <<"type">> => ProgramType }), Res1 = cowboy_req:set_resp_body(Output, Req), Res2 = cowboy_req:delete_resp_header(<<"content-type">>, Res1), Res3 = cowboy_req:set_resp_header(<<"content-type">>, <<"application/json">>, Res2), { {true, ProgramUrl }, Res3, State } end. %% GET handler content_types_provided(Req, State) -> {[{{<<"application">>, <<"json">>, []}, to_json}], Req, State}. -spec to_json(cowboy_req:req(), #create_program_seq{}) -> {binary(),cowboy_req:req(), #create_program_seq{}}. to_json(Req, State) -> #create_program_seq{username=Username} = State, case automate_rest_api_backend:lists_programs_from_username(Username) of { ok, Programs } -> Output = jiffy:encode(encode_program_list(Programs)), Res1 = cowboy_req:delete_resp_header(<<"content-type">>, Req), Res2 = cowboy_req:set_resp_header(<<"content-type">>, <<"application/json">>, Res1), { Output, Res2, State } end. encode_program_list(Programs) -> lists:map(fun(Program=#program_metadata{id=Id}) -> ProgramBridges = try ?UTILS:get_bridges_on_program_id(Id) of Bridges -> Bridges catch ErrNS:Error:StackTrace -> automate_logging:log_platform(error, ErrNS, Error, StackTrace), [] end, ?FORMATTING:program_listing_to_json(Program, ProgramBridges) end, Programs).
null
https://raw.githubusercontent.com/programaker-project/Programaker-Core/ef10fc6d2a228b2096b121170c421f5c29f9f270/backend/apps/automate_rest_api/src/automate_rest_api_programs_root.erl
erlang
@doc REST endpoint to manage knowledge collections. @end CORS Authentication Don't do authentication if it's just asking for options Non matching username POST handler GET handler
-module(automate_rest_api_programs_root). -export([init/2]). -export([ allowed_methods/2 , options/2 , is_authorized/2 , content_types_provided/2 , content_types_accepted/2 , resource_exists/2 ]). -export([ accept_json_create_program/2 , to_json/2 ]). -include("./records.hrl"). -define(UTILS, automate_rest_api_utils). -define(FORMATTING, automate_rest_api_utils_formatting). -define(PROGRAMS, automate_rest_api_utils_programs). -record(create_program_seq, { username :: binary() }). -spec init(_,_) -> {'cowboy_rest',_,_}. init(Req, _Opts) -> UserId = cowboy_req:binding(user_id, Req), {cowboy_rest, Req , #create_program_seq{ username=UserId }}. resource_exists(Req, State) -> case cowboy_req:method(Req) of <<"POST">> -> { false, Req, State }; _ -> { true, Req, State} end. options(Req, State) -> Req1 = automate_rest_api_cors:set_headers(Req), {ok, Req1, State}. -spec allowed_methods(cowboy_req:req(),_) -> {[binary()], cowboy_req:req(),_}. allowed_methods(Req, State) -> {[<<"GET">>, <<"POST">>, <<"OPTIONS">>], Req, State}. is_authorized(Req, State) -> Req1 = automate_rest_api_cors:set_headers(Req), case cowboy_req:method(Req1) of <<"OPTIONS">> -> { true, Req1, State }; Method -> case cowboy_req:header(<<"authorization">>, Req, undefined) of undefined -> { {false, <<"Authorization header not found">>} , Req1, State }; X -> Scope = case Method of <<"GET">> -> list_programs; <<"POST">> -> create_programs end, #create_program_seq{username=Username} = State, case automate_rest_api_backend:is_valid_token(X, Scope) of {true, Username} -> { true, Req1, State }; { { false, <<"Unauthorized to create a program here">>}, Req1, State }; false -> { { false, <<"Authorization not correct">>}, Req1, State } end end end. content_types_accepted(Req, State) -> {[{{<<"application">>, <<"json">>, []}, accept_json_create_program}], Req, State}. -spec accept_json_create_program(cowboy_req:req(), #create_program_seq{}) -> {{'true', binary()},cowboy_req:req(), #create_program_seq{}}. accept_json_create_program(Req, State) -> #create_program_seq{username=Username} = State, {ok, Body, _} = ?UTILS:read_body(Req), {Type, Name} = ?PROGRAMS:get_metadata_from_body(Body), case automate_rest_api_backend:create_program(Username, Name, Type) of { ok, {ProgramId, ProgramName, ProgramUrl, ProgramType} } -> Output = jiffy:encode(#{ <<"id">> => ProgramId , <<"name">> => ProgramName , <<"link">> => ProgramUrl , <<"type">> => ProgramType }), Res1 = cowboy_req:set_resp_body(Output, Req), Res2 = cowboy_req:delete_resp_header(<<"content-type">>, Res1), Res3 = cowboy_req:set_resp_header(<<"content-type">>, <<"application/json">>, Res2), { {true, ProgramUrl }, Res3, State } end. content_types_provided(Req, State) -> {[{{<<"application">>, <<"json">>, []}, to_json}], Req, State}. -spec to_json(cowboy_req:req(), #create_program_seq{}) -> {binary(),cowboy_req:req(), #create_program_seq{}}. to_json(Req, State) -> #create_program_seq{username=Username} = State, case automate_rest_api_backend:lists_programs_from_username(Username) of { ok, Programs } -> Output = jiffy:encode(encode_program_list(Programs)), Res1 = cowboy_req:delete_resp_header(<<"content-type">>, Req), Res2 = cowboy_req:set_resp_header(<<"content-type">>, <<"application/json">>, Res1), { Output, Res2, State } end. encode_program_list(Programs) -> lists:map(fun(Program=#program_metadata{id=Id}) -> ProgramBridges = try ?UTILS:get_bridges_on_program_id(Id) of Bridges -> Bridges catch ErrNS:Error:StackTrace -> automate_logging:log_platform(error, ErrNS, Error, StackTrace), [] end, ?FORMATTING:program_listing_to_json(Program, ProgramBridges) end, Programs).
3e91bd156ee353ae6dcae09638eebdc353745581e96bd946f077acdcb57ed946
tqtezos/stablecoin
Metadata.hs
SPDX - FileCopyrightText : 2021 Oxhead Alpha SPDX - License - Identifier : MIT | This module contains the TZIP-16 metadata and off - chain - views for the -- @stablecoin.tz@ contract. module Lorentz.Contracts.Stablecoin.Metadata ( MetadataUri(..) , ParsedMetadataUri(..) , metadataJSON , metadataMap , parseMetadataUri ) where import Data.Aeson qualified as J import Data.ByteString.Lazy qualified as BSL import Data.Version (showVersion) import Fmt (pretty) import Text.Megaparsec qualified as P import Text.Megaparsec.Char (string') import Lorentz as L import Lorentz.Contracts.Spec.FA2Interface qualified as FA2 import Lorentz.Contracts.Spec.TZIP16Interface (Error(..), License(..), Metadata(..), MetadataMap, Source(..), ViewImplementation(..)) import Lorentz.Contracts.Spec.TZIP16Interface qualified as TZ import Morley.Metadata (ViewCode(..), compileViewCodeTH, mkMichelsonStorageView, unsafeCompileViewCode) import Morley.Micheline (ToExpression(toExpression)) import Morley.Tezos.Address (ContractAddress, formatAddress, parseKindedAddress) import Lorentz.Contracts.Stablecoin.Types import Paths_stablecoin (version) import Stablecoin.Util (ligoVersion) jfield :: MText jfield = [mt|metadataJSON|] metadataMap :: J.ToJSON metadata => MetadataUri metadata -> MetadataMap metadataMap mdata = mkBigMap $ One might reasonable expect that the URI would be stored as packed strings , but the TZIP-16 spec is explicit about that not being the case . -- -- > Unless otherwise-specified, the encoding of the values must be the direct stream -- > of bytes of the data being stored. (...) > There is no implicit conversion to 's binary format ( PACK ) nor -- > quoting mechanism. -- -- See: </-/blob/eb1da57684599a266334a73babd7ba82dbbbce66/proposals/tzip-16/tzip-16.md#contract-storage> -- So , instead , we encode it as UTF-8 byte sequences . case mdata of CurrentContract md includeUri -> if includeUri then [ (mempty, TZ.encodeURI $ TZ.tezosStorageUri (TZ.ContractHost Nothing) jfield) , (jfield, BSL.toStrict (J.encode md)) ] else [ (jfield, BSL.toStrict (J.encode md)) ] RemoteContract addr -> [ (mempty, TZ.encodeURI $ TZ.tezosStorageUri (TZ.ContractHost (Just $ formatAddress addr)) jfield) ] Raw uri -> [ (mempty, encodeUtf8 uri) ] Result after parsing the metadata uri from a TZIP-16 metadata bigmap . data ParsedMetadataUri = InCurrentContractUnderKey Text | InRemoteContractUnderKey ContractAddress Text | RawUri Text deriving stock (Eq, Show) parseMetadataUri :: Text -> Either Text ParsedMetadataUri parseMetadataUri t = first (fromString . P.errorBundlePretty) $ P.parse metadataUriParser "" t metadataUriParser :: P.Parsec Void Text ParsedMetadataUri metadataUriParser = (P.try remoteContractUriParser) <|> (P.try currentContractUriParser) <|> rawUriParser remoteContractUriParser :: P.Parsec Void Text ParsedMetadataUri remoteContractUriParser = do _ <- string' (TZ.tezosStorageScheme <> "://") addr <- P.manyTill P.anySingle (string' "/") key <- P.many P.anySingle case parseKindedAddress (toText addr) of Right paddr -> pure $ InRemoteContractUnderKey paddr (toText key) Left err -> fail $ pretty err rawUriParser :: P.Parsec Void Text ParsedMetadataUri rawUriParser = (RawUri . toText) <$> (P.many (P.satisfy (const True))) currentContractUriParser :: P.Parsec Void Text ParsedMetadataUri currentContractUriParser = do _ <- string' (TZ.tezosStorageScheme <> ":") key_ <- P.many P.anySingle pure $ InCurrentContractUnderKey (toText key_) data MetadataUri metadata ^ Metadata and a flag to denote if URI should be included | RemoteContract ContractAddress | Raw Text | Make the TZIP-16 metadata . We accept a @Maybe@ @FA2.TokenMetadata@ -- as argument here so that we can use this function to create the metadata of the -- FA1.2 Variant as well. metadataJSON :: Maybe FA2.TokenMetadata -> Maybe Text -> Metadata (ToT Storage) metadataJSON mtmd mbDescription = TZ.name "stablecoin" <> TZ.description (fromMaybe defaultDescription mbDescription) <> TZ.version (toText $ showVersion version) <> TZ.license (License { lName = "MIT", lDetails = Nothing }) <> TZ.authors [ TZ.author "Serokell" "/" , TZ.author "TQ Tezos" "/" , TZ.author "Oxhead Alpha" "/" ] <> TZ.homepage "/" <> TZ.source Source { sLocation = Just $ "" <> toText (showVersion version) <> "/ligo/stablecoin" , sTools = [ "ligo " <> $ligoVersion ] } <> TZ.interfaces [ TZ.Interface "TZIP-012", TZ.Interface "TZIP-017" ] <> TZ.errors [ mkError [mt|FA2_TOKEN_UNDEFINED|] [mt|All `token_id`s must be 0|] , mkError [mt|FA2_INSUFFICIENT_BALANCE|] [mt|Cannot debit from a wallet because of insufficient amount of tokens|] , mkError [mt|FA2_NOT_OPERATOR|] [mt|You're neither the owner or a permitted operator of one or more wallets from which tokens will be transferred|] , mkError [mt|XTZ_RECEIVED|] [mt|Contract received a non-zero amount of tokens|] , mkError [mt|NOT_CONTRACT_OWNER|] [mt|Operation can only be performed by the contract's owner|] , mkError [mt|NOT_PENDING_OWNER|] [mt|Operation can only be performed by the current contract's pending owner|] , mkError [mt|NO_PENDING_OWNER_SET|] [mt|There's no pending transfer of ownership|] , mkError [mt|NOT_PAUSER|] [mt|Operation can only be performed by the contract's pauser|] , mkError [mt|NOT_MASTER_MINTER|] [mt|Operation can only be performed by the contract's master minter|] , mkError [mt|NOT_MINTER|] [mt|Operation can only be performed by registered minters|] , mkError [mt|CONTRACT_PAUSED|] [mt|Operation cannot be performed while the contract is paused|] , mkError [mt|CONTRACT_NOT_PAUSED|] [mt|Operation cannot be performed while the contract is not paused|] , mkError [mt|NOT_TOKEN_OWNER|] [mt|You cannot configure another user's operators|] , mkError [mt|CURRENT_ALLOWANCE_REQUIRED|] [mt|The given address is already a minter, you must specify its current minting allowance|] , mkError [mt|ALLOWANCE_MISMATCH|] [mt|The given current minting allowance does not match the minter's actual current minting allowance|] , mkError [mt|ADDR_NOT_MINTER|] [mt|This address is not a registered minter|] , mkError [mt|ALLOWANCE_EXCEEDED|] [mt|The amount of tokens to be minted exceeds your current minting allowance|] , mkError [mt|BAD_TRANSFERLIST|] [mt|The given address is a not a smart contract complying with the transferlist interface|] , mkError [mt|MINTER_LIMIT_REACHED|] [mt|Cannot add new minter because the number of minters is already at the limit|] , mkError [mt|MISSIGNED|] [mt|This permit's signature is invalid|] , mkError [mt|EXPIRED_PERMIT|] [mt|A permit was found, but it has already expired|] , mkError [mt|NOT_PERMIT_ISSUER|] [mt|You're not the issuer of the given permit|] , mkError [mt|DUP_PERMIT|] [mt|The given permit already exists|] , mkError [mt|EXPIRY_TOO_BIG|] [mt|The `set_expiry` entrypoint was called with an expiry value that is too big|] , mkError [mt|NEGATIVE_TOTAL_SUPPLY|] [mt|The total_supply value was found to be less than zero after an operation. This indicates a bug in the contract.|] ] <> TZ.views mkViews where defaultDescription :: Text defaultDescription = "Tezos Stablecoin project implements an FA2-compatible token smart contract.\ \ It draws inspiration from popular permissioned asset contracts like CENTRE Fiat Token and other similar contracts.\ \ The contract is implemented in the LIGO language." mkViews :: [TZ.View (ToT Storage)] mkViews = case mtmd of Nothing -> [ getDefaultExpiryView , getCounterView ] Just tmd -> [ getDefaultExpiryView , getCounterView , getBalanceView , getTotalSupplyView , getAllTokensView , isOperatorView , mkTokenMetadataView tmd ] mkError :: MText -> MText -> Error mkError err expansion = TZ.EStatic $ TZ.StaticError { seError = toExpression (toVal err) , seExpansion = toExpression (toVal expansion) , seLanguages = ["en"] } type BalanceViewParam = (Address, Natural) getBalanceView :: TZ.View (ToT Storage) getBalanceView = TZ.View { vName = "get_balance" , vDescription = Just "Access the balance of an address" , vPure = Just True , vImplementations = one $ VIMichelsonStorageView $ mkMichelsonStorageView @Storage @Natural Nothing [] $ $$(compileViewCodeTH $ WithParam @BalanceViewParam $ L.dip (L.toField #sLedger) # L.car # L.get # If there is no ledger entry , return zero . ) } getTotalSupplyView :: TZ.View (ToT Storage) getTotalSupplyView = TZ.View { vName = "total_supply" , vDescription = Just "Get the total no of tokens available." , vPure = Just True , vImplementations = one $ VIMichelsonStorageView $ mkMichelsonStorageView @Storage @Natural Nothing [] $ $$(compileViewCodeTH $ WithParam @Natural $ L.int # L.assertEq0 [mt|Unknown TOKEN ID|] # L.toField #sTotalSupply ) } getAllTokensView :: TZ.View (ToT Storage) getAllTokensView = TZ.View { vName = "all_tokens" , vDescription = Just "Get list of token ids supported." , vPure = Just True , vImplementations = one $ VIMichelsonStorageView $ mkMichelsonStorageView @Storage Nothing [] $ $$(compileViewCodeTH $ WithoutParam $ L.drop # L.nil # L.push (0 :: Natural) # L.cons ) } isOperatorView :: TZ.View (ToT Storage) isOperatorView = TZ.View { vName = "is_operator" , vDescription = Just "Check if the given address is an operator" , vPure = Just True , vImplementations = one $ VIMichelsonStorageView $ mkMichelsonStorageView @Storage @Bool Nothing [] $ $$(compileViewCodeTH $ WithParam @FA2.OperatorParam $ L.dip (L.toField #sOperators) # L.getField #opTokenId # forcedCoerce_ @FA2.TokenId @Natural # L.int # L.assertEq0 [mt|Unknown TOKEN ID|] # L.getField #opOwner # L.dip (L.toField #opOperator) # L.pair # L.get # L.ifSome (L.drop # L.push True) (L.push False) ) } mkTokenMetadataView :: FA2.TokenMetadata -> TZ.View (ToT Storage) mkTokenMetadataView md = let vc = unsafeCompileViewCode $ WithParam @Natural $ L.dip L.drop # L.int # L.assertEq0 [mt|Unknown TOKEN ID|] # L.push (0 :: Natural, md) in TZ.View { vName = "token_metadata" , vDescription = Just "Get token metadata for the token id" , vPure = Just True , vImplementations = one $ VIMichelsonStorageView $ mkMichelsonStorageView @Storage @(Natural, FA2.TokenMetadata) Nothing [] vc } getDefaultExpiryView :: TZ.View (ToT Storage) getDefaultExpiryView = TZ.View { vName = "GetDefaultExpiry" , vDescription = Just "Access the contract's default expiry in seconds" , vPure = Just True , vImplementations = one $ VIMichelsonStorageView $ mkMichelsonStorageView @Storage @Natural Nothing [] $ $$(compileViewCodeTH $ WithoutParam $ L.toField #sDefaultExpiry ) } getCounterView :: TZ.View (ToT Storage) getCounterView = TZ.View { vName = "GetCounter" , vDescription = Just "Access the current permit counter" , vPure = Just True , vImplementations = one $ VIMichelsonStorageView $ mkMichelsonStorageView @Storage @Natural Nothing [] $ $$(compileViewCodeTH $ WithoutParam $ L.toField #sPermitCounter ) }
null
https://raw.githubusercontent.com/tqtezos/stablecoin/48012781d6c2d46d4cb8f0508a8ca1576481a561/haskell/src/Lorentz/Contracts/Stablecoin/Metadata.hs
haskell
@stablecoin.tz@ contract. > Unless otherwise-specified, the encoding of the values must be the direct stream > of bytes of the data being stored. (...) > quoting mechanism. See: </-/blob/eb1da57684599a266334a73babd7ba82dbbbce66/proposals/tzip-16/tzip-16.md#contract-storage> as argument here so that we can use this function to create the metadata of the FA1.2 Variant as well.
SPDX - FileCopyrightText : 2021 Oxhead Alpha SPDX - License - Identifier : MIT | This module contains the TZIP-16 metadata and off - chain - views for the module Lorentz.Contracts.Stablecoin.Metadata ( MetadataUri(..) , ParsedMetadataUri(..) , metadataJSON , metadataMap , parseMetadataUri ) where import Data.Aeson qualified as J import Data.ByteString.Lazy qualified as BSL import Data.Version (showVersion) import Fmt (pretty) import Text.Megaparsec qualified as P import Text.Megaparsec.Char (string') import Lorentz as L import Lorentz.Contracts.Spec.FA2Interface qualified as FA2 import Lorentz.Contracts.Spec.TZIP16Interface (Error(..), License(..), Metadata(..), MetadataMap, Source(..), ViewImplementation(..)) import Lorentz.Contracts.Spec.TZIP16Interface qualified as TZ import Morley.Metadata (ViewCode(..), compileViewCodeTH, mkMichelsonStorageView, unsafeCompileViewCode) import Morley.Micheline (ToExpression(toExpression)) import Morley.Tezos.Address (ContractAddress, formatAddress, parseKindedAddress) import Lorentz.Contracts.Stablecoin.Types import Paths_stablecoin (version) import Stablecoin.Util (ligoVersion) jfield :: MText jfield = [mt|metadataJSON|] metadataMap :: J.ToJSON metadata => MetadataUri metadata -> MetadataMap metadataMap mdata = mkBigMap $ One might reasonable expect that the URI would be stored as packed strings , but the TZIP-16 spec is explicit about that not being the case . > There is no implicit conversion to 's binary format ( PACK ) nor So , instead , we encode it as UTF-8 byte sequences . case mdata of CurrentContract md includeUri -> if includeUri then [ (mempty, TZ.encodeURI $ TZ.tezosStorageUri (TZ.ContractHost Nothing) jfield) , (jfield, BSL.toStrict (J.encode md)) ] else [ (jfield, BSL.toStrict (J.encode md)) ] RemoteContract addr -> [ (mempty, TZ.encodeURI $ TZ.tezosStorageUri (TZ.ContractHost (Just $ formatAddress addr)) jfield) ] Raw uri -> [ (mempty, encodeUtf8 uri) ] Result after parsing the metadata uri from a TZIP-16 metadata bigmap . data ParsedMetadataUri = InCurrentContractUnderKey Text | InRemoteContractUnderKey ContractAddress Text | RawUri Text deriving stock (Eq, Show) parseMetadataUri :: Text -> Either Text ParsedMetadataUri parseMetadataUri t = first (fromString . P.errorBundlePretty) $ P.parse metadataUriParser "" t metadataUriParser :: P.Parsec Void Text ParsedMetadataUri metadataUriParser = (P.try remoteContractUriParser) <|> (P.try currentContractUriParser) <|> rawUriParser remoteContractUriParser :: P.Parsec Void Text ParsedMetadataUri remoteContractUriParser = do _ <- string' (TZ.tezosStorageScheme <> "://") addr <- P.manyTill P.anySingle (string' "/") key <- P.many P.anySingle case parseKindedAddress (toText addr) of Right paddr -> pure $ InRemoteContractUnderKey paddr (toText key) Left err -> fail $ pretty err rawUriParser :: P.Parsec Void Text ParsedMetadataUri rawUriParser = (RawUri . toText) <$> (P.many (P.satisfy (const True))) currentContractUriParser :: P.Parsec Void Text ParsedMetadataUri currentContractUriParser = do _ <- string' (TZ.tezosStorageScheme <> ":") key_ <- P.many P.anySingle pure $ InCurrentContractUnderKey (toText key_) data MetadataUri metadata ^ Metadata and a flag to denote if URI should be included | RemoteContract ContractAddress | Raw Text | Make the TZIP-16 metadata . We accept a @Maybe@ @FA2.TokenMetadata@ metadataJSON :: Maybe FA2.TokenMetadata -> Maybe Text -> Metadata (ToT Storage) metadataJSON mtmd mbDescription = TZ.name "stablecoin" <> TZ.description (fromMaybe defaultDescription mbDescription) <> TZ.version (toText $ showVersion version) <> TZ.license (License { lName = "MIT", lDetails = Nothing }) <> TZ.authors [ TZ.author "Serokell" "/" , TZ.author "TQ Tezos" "/" , TZ.author "Oxhead Alpha" "/" ] <> TZ.homepage "/" <> TZ.source Source { sLocation = Just $ "" <> toText (showVersion version) <> "/ligo/stablecoin" , sTools = [ "ligo " <> $ligoVersion ] } <> TZ.interfaces [ TZ.Interface "TZIP-012", TZ.Interface "TZIP-017" ] <> TZ.errors [ mkError [mt|FA2_TOKEN_UNDEFINED|] [mt|All `token_id`s must be 0|] , mkError [mt|FA2_INSUFFICIENT_BALANCE|] [mt|Cannot debit from a wallet because of insufficient amount of tokens|] , mkError [mt|FA2_NOT_OPERATOR|] [mt|You're neither the owner or a permitted operator of one or more wallets from which tokens will be transferred|] , mkError [mt|XTZ_RECEIVED|] [mt|Contract received a non-zero amount of tokens|] , mkError [mt|NOT_CONTRACT_OWNER|] [mt|Operation can only be performed by the contract's owner|] , mkError [mt|NOT_PENDING_OWNER|] [mt|Operation can only be performed by the current contract's pending owner|] , mkError [mt|NO_PENDING_OWNER_SET|] [mt|There's no pending transfer of ownership|] , mkError [mt|NOT_PAUSER|] [mt|Operation can only be performed by the contract's pauser|] , mkError [mt|NOT_MASTER_MINTER|] [mt|Operation can only be performed by the contract's master minter|] , mkError [mt|NOT_MINTER|] [mt|Operation can only be performed by registered minters|] , mkError [mt|CONTRACT_PAUSED|] [mt|Operation cannot be performed while the contract is paused|] , mkError [mt|CONTRACT_NOT_PAUSED|] [mt|Operation cannot be performed while the contract is not paused|] , mkError [mt|NOT_TOKEN_OWNER|] [mt|You cannot configure another user's operators|] , mkError [mt|CURRENT_ALLOWANCE_REQUIRED|] [mt|The given address is already a minter, you must specify its current minting allowance|] , mkError [mt|ALLOWANCE_MISMATCH|] [mt|The given current minting allowance does not match the minter's actual current minting allowance|] , mkError [mt|ADDR_NOT_MINTER|] [mt|This address is not a registered minter|] , mkError [mt|ALLOWANCE_EXCEEDED|] [mt|The amount of tokens to be minted exceeds your current minting allowance|] , mkError [mt|BAD_TRANSFERLIST|] [mt|The given address is a not a smart contract complying with the transferlist interface|] , mkError [mt|MINTER_LIMIT_REACHED|] [mt|Cannot add new minter because the number of minters is already at the limit|] , mkError [mt|MISSIGNED|] [mt|This permit's signature is invalid|] , mkError [mt|EXPIRED_PERMIT|] [mt|A permit was found, but it has already expired|] , mkError [mt|NOT_PERMIT_ISSUER|] [mt|You're not the issuer of the given permit|] , mkError [mt|DUP_PERMIT|] [mt|The given permit already exists|] , mkError [mt|EXPIRY_TOO_BIG|] [mt|The `set_expiry` entrypoint was called with an expiry value that is too big|] , mkError [mt|NEGATIVE_TOTAL_SUPPLY|] [mt|The total_supply value was found to be less than zero after an operation. This indicates a bug in the contract.|] ] <> TZ.views mkViews where defaultDescription :: Text defaultDescription = "Tezos Stablecoin project implements an FA2-compatible token smart contract.\ \ It draws inspiration from popular permissioned asset contracts like CENTRE Fiat Token and other similar contracts.\ \ The contract is implemented in the LIGO language." mkViews :: [TZ.View (ToT Storage)] mkViews = case mtmd of Nothing -> [ getDefaultExpiryView , getCounterView ] Just tmd -> [ getDefaultExpiryView , getCounterView , getBalanceView , getTotalSupplyView , getAllTokensView , isOperatorView , mkTokenMetadataView tmd ] mkError :: MText -> MText -> Error mkError err expansion = TZ.EStatic $ TZ.StaticError { seError = toExpression (toVal err) , seExpansion = toExpression (toVal expansion) , seLanguages = ["en"] } type BalanceViewParam = (Address, Natural) getBalanceView :: TZ.View (ToT Storage) getBalanceView = TZ.View { vName = "get_balance" , vDescription = Just "Access the balance of an address" , vPure = Just True , vImplementations = one $ VIMichelsonStorageView $ mkMichelsonStorageView @Storage @Natural Nothing [] $ $$(compileViewCodeTH $ WithParam @BalanceViewParam $ L.dip (L.toField #sLedger) # L.car # L.get # If there is no ledger entry , return zero . ) } getTotalSupplyView :: TZ.View (ToT Storage) getTotalSupplyView = TZ.View { vName = "total_supply" , vDescription = Just "Get the total no of tokens available." , vPure = Just True , vImplementations = one $ VIMichelsonStorageView $ mkMichelsonStorageView @Storage @Natural Nothing [] $ $$(compileViewCodeTH $ WithParam @Natural $ L.int # L.assertEq0 [mt|Unknown TOKEN ID|] # L.toField #sTotalSupply ) } getAllTokensView :: TZ.View (ToT Storage) getAllTokensView = TZ.View { vName = "all_tokens" , vDescription = Just "Get list of token ids supported." , vPure = Just True , vImplementations = one $ VIMichelsonStorageView $ mkMichelsonStorageView @Storage Nothing [] $ $$(compileViewCodeTH $ WithoutParam $ L.drop # L.nil # L.push (0 :: Natural) # L.cons ) } isOperatorView :: TZ.View (ToT Storage) isOperatorView = TZ.View { vName = "is_operator" , vDescription = Just "Check if the given address is an operator" , vPure = Just True , vImplementations = one $ VIMichelsonStorageView $ mkMichelsonStorageView @Storage @Bool Nothing [] $ $$(compileViewCodeTH $ WithParam @FA2.OperatorParam $ L.dip (L.toField #sOperators) # L.getField #opTokenId # forcedCoerce_ @FA2.TokenId @Natural # L.int # L.assertEq0 [mt|Unknown TOKEN ID|] # L.getField #opOwner # L.dip (L.toField #opOperator) # L.pair # L.get # L.ifSome (L.drop # L.push True) (L.push False) ) } mkTokenMetadataView :: FA2.TokenMetadata -> TZ.View (ToT Storage) mkTokenMetadataView md = let vc = unsafeCompileViewCode $ WithParam @Natural $ L.dip L.drop # L.int # L.assertEq0 [mt|Unknown TOKEN ID|] # L.push (0 :: Natural, md) in TZ.View { vName = "token_metadata" , vDescription = Just "Get token metadata for the token id" , vPure = Just True , vImplementations = one $ VIMichelsonStorageView $ mkMichelsonStorageView @Storage @(Natural, FA2.TokenMetadata) Nothing [] vc } getDefaultExpiryView :: TZ.View (ToT Storage) getDefaultExpiryView = TZ.View { vName = "GetDefaultExpiry" , vDescription = Just "Access the contract's default expiry in seconds" , vPure = Just True , vImplementations = one $ VIMichelsonStorageView $ mkMichelsonStorageView @Storage @Natural Nothing [] $ $$(compileViewCodeTH $ WithoutParam $ L.toField #sDefaultExpiry ) } getCounterView :: TZ.View (ToT Storage) getCounterView = TZ.View { vName = "GetCounter" , vDescription = Just "Access the current permit counter" , vPure = Just True , vImplementations = one $ VIMichelsonStorageView $ mkMichelsonStorageView @Storage @Natural Nothing [] $ $$(compileViewCodeTH $ WithoutParam $ L.toField #sPermitCounter ) }
c60778b40b33f7fb79d2a9709dce55e351e071f4a3aa3b5f42e5de6f1b83ea90
jordanthayer/ocaml-search
queue_set.ml
* A queue that does n't allow for duplicates . @author eaburns @since 2010 - 02 - 15 @author eaburns @since 2010-02-15 *) type 'a t = { q : 'a Queue.t; on_q : ('a, bool) Hashtbl.t; } let create ?(hash_size=100) () = (** [create ?hash_size=100 ()] creates a new queue. *) { q = Queue.create (); on_q = Hashtbl.create hash_size } let push q elm = (** [push q elm] pushes an element onto the queue if it is not there already. *) if not (Hashtbl.mem q.on_q elm) then Queue.push elm q.q let push_all q elms = List.iter (push q) elms (** [push_all q elms] pushes a list of elements onto the queue. *) let of_list elms = (** [of_list elms] creates a queue populated with the given list of elements. *) let q = create () in push_all q elms; q let take q = (** [take q] takes an element off of the front of the queue. *) let elm = Queue.take q.q in Hashtbl.remove q.on_q elm; elm let on_q q elm = Hashtbl.mem q.on_q elm * [ on_q q elm ] tests if the given element is on the queue . let is_empty q = Queue.is_empty q.q (** [is_empty q] tests if the queue is empty. *)
null
https://raw.githubusercontent.com/jordanthayer/ocaml-search/57cfc85417aa97ee5d8fbcdb84c333aae148175f/structs/queue_set.ml
ocaml
* [create ?hash_size=100 ()] creates a new queue. * [push q elm] pushes an element onto the queue if it is not there already. * [push_all q elms] pushes a list of elements onto the queue. * [of_list elms] creates a queue populated with the given list of elements. * [take q] takes an element off of the front of the queue. * [is_empty q] tests if the queue is empty.
* A queue that does n't allow for duplicates . @author eaburns @since 2010 - 02 - 15 @author eaburns @since 2010-02-15 *) type 'a t = { q : 'a Queue.t; on_q : ('a, bool) Hashtbl.t; } let create ?(hash_size=100) () = { q = Queue.create (); on_q = Hashtbl.create hash_size } let push q elm = if not (Hashtbl.mem q.on_q elm) then Queue.push elm q.q let push_all q elms = List.iter (push q) elms let of_list elms = let q = create () in push_all q elms; q let take q = let elm = Queue.take q.q in Hashtbl.remove q.on_q elm; elm let on_q q elm = Hashtbl.mem q.on_q elm * [ on_q q elm ] tests if the given element is on the queue . let is_empty q = Queue.is_empty q.q
3ccb0b985ee27a52df95f9801794cc172356640307b52798d2780d6b8813ab6c
clojurewerkz/statistiker
distribution_test.clj
(ns clojurewerkz.statistiker.distribution-test (:import [org.apache.commons.math3.distribution EnumeratedRealDistribution]) (:require [clojure.test :refer :all]))
null
https://raw.githubusercontent.com/clojurewerkz/statistiker/f056f68c975cf3d6e0f1c8212aef9114d4eb657c/test/clj/clojurewerkz/statistiker/distribution_test.clj
clojure
(ns clojurewerkz.statistiker.distribution-test (:import [org.apache.commons.math3.distribution EnumeratedRealDistribution]) (:require [clojure.test :refer :all]))
0d4bb2ad27ce99030d7a9afad627d1b6a36740235b0804912d3403bc883e9f45
jtanguy/hmacaroons
Internal.hs
{-# LANGUAGE OverloadedStrings #-} | Module : Crypto . Macaroon . Internal Copyright : ( c ) 2015 License : BSD3 Maintainer : Stability : experimental Portability : portable Internal representation of a macaroon Module : Crypto.Macaroon.Internal Copyright : (c) 2015 Julien Tanguy License : BSD3 Maintainer : Stability : experimental Portability : portable Internal representation of a macaroon -} module Crypto.Macaroon.Internal where import Control.DeepSeq import Crypto.Hash import Data.Byteable import qualified Data.ByteString as BS import qualified Data.ByteString.Char8 as B8 import Data.Hex import Data.List |Type alias for Macaroons secret keys type Secret = BS.ByteString |Type alias for Macaroons and Caveat and identifiers type Key = BS.ByteString |Type alias for Macaroons and Caveat locations type Location = BS.ByteString |Type alias for Macaroons signatures type Sig = BS.ByteString -- | Main structure of a macaroon data Macaroon = MkMacaroon { location :: Location -- ^ Target location , identifier :: Key ^ Macaroon Identifier , caveats :: [Caveat] -- ^ List of caveats , signature :: Sig ^ Macaroon HMAC signature } | Constant - time instance instance Eq Macaroon where (MkMacaroon l1 i1 c1 s1) == (MkMacaroon l2 i2 c2 s2) = (l1 `constEqBytes` l2) &&! (i1 `constEqBytes` i2) &&! (c1 == c2) &&! (s1 `constEqBytes` s2) -- | show instance conforming to the @inspect@ "specification" instance Show Macaroon where We use intercalate because unlines would add a trailing newline show (MkMacaroon l i c s) = intercalate "\n" [ "location " ++ B8.unpack l , "identifier " ++ B8.unpack i , intercalate "\n" (map show c) , "signature " ++ B8.unpack (hex s) ] -- | NFData instance for use in the benchmark instance NFData Macaroon where rnf (MkMacaroon loc ident cavs sig) = rnf loc `seq` rnf ident `seq` rnf cavs `seq` rnf sig -- | Caveat structure data Caveat = MkCaveat { cid :: Key -- ^ Caveat identifier , vid :: Key -- ^ Caveat verification key identifier , cl :: Location -- ^ Caveat target location } | Constant - time instance instance Eq Caveat where (MkCaveat c1 v1 l1) == (MkCaveat c2 v2 l2) = (c1 `constEqBytes` c2) &&! (v1 `constEqBytes` v2) &&! (l1 `constEqBytes` l2) -- | show instance conforming to the @inspect@ "specification" instance Show Caveat where show (MkCaveat c v l) | v == BS.empty = "cid " ++ B8.unpack c | otherwise = unlines [ "cid " ++ B8.unpack c , "vid " ++ B8.unpack v , "cl " ++ B8.unpack l ] -- | NFData instance for use in the benchmark instance NFData Caveat where rnf (MkCaveat cid vid cl) = rnf cid `seq` rnf vid `seq` rnf cl | Primitive to add a First or Third party caveat to a macaroon -- For internal use only addCaveat :: Location -> Key -> Key -> Macaroon -> Macaroon addCaveat loc cid vid m = m { caveats = cavs ++ [cav'], signature = sig} where cavs = caveats m cav' = MkCaveat cid vid loc sig = toBytes (hmac (signature m) (BS.append vid cid) :: HMAC SHA256) -- | Utility non-short circuiting '&&' function. (&&!) :: Bool -> Bool -> Bool True &&! True = True True &&! False = False False &&! True = False False &&! False = False
null
https://raw.githubusercontent.com/jtanguy/hmacaroons/6fbca87836a4baef171c5ffc774387766c709fbf/src/Crypto/Macaroon/Internal.hs
haskell
# LANGUAGE OverloadedStrings # | Main structure of a macaroon ^ Target location ^ List of caveats | show instance conforming to the @inspect@ "specification" | NFData instance for use in the benchmark | Caveat structure ^ Caveat identifier ^ Caveat verification key identifier ^ Caveat target location | show instance conforming to the @inspect@ "specification" | NFData instance for use in the benchmark For internal use only | Utility non-short circuiting '&&' function.
| Module : Crypto . Macaroon . Internal Copyright : ( c ) 2015 License : BSD3 Maintainer : Stability : experimental Portability : portable Internal representation of a macaroon Module : Crypto.Macaroon.Internal Copyright : (c) 2015 Julien Tanguy License : BSD3 Maintainer : Stability : experimental Portability : portable Internal representation of a macaroon -} module Crypto.Macaroon.Internal where import Control.DeepSeq import Crypto.Hash import Data.Byteable import qualified Data.ByteString as BS import qualified Data.ByteString.Char8 as B8 import Data.Hex import Data.List |Type alias for Macaroons secret keys type Secret = BS.ByteString |Type alias for Macaroons and Caveat and identifiers type Key = BS.ByteString |Type alias for Macaroons and Caveat locations type Location = BS.ByteString |Type alias for Macaroons signatures type Sig = BS.ByteString data Macaroon = MkMacaroon { location :: Location , identifier :: Key ^ Macaroon Identifier , caveats :: [Caveat] , signature :: Sig ^ Macaroon HMAC signature } | Constant - time instance instance Eq Macaroon where (MkMacaroon l1 i1 c1 s1) == (MkMacaroon l2 i2 c2 s2) = (l1 `constEqBytes` l2) &&! (i1 `constEqBytes` i2) &&! (c1 == c2) &&! (s1 `constEqBytes` s2) instance Show Macaroon where We use intercalate because unlines would add a trailing newline show (MkMacaroon l i c s) = intercalate "\n" [ "location " ++ B8.unpack l , "identifier " ++ B8.unpack i , intercalate "\n" (map show c) , "signature " ++ B8.unpack (hex s) ] instance NFData Macaroon where rnf (MkMacaroon loc ident cavs sig) = rnf loc `seq` rnf ident `seq` rnf cavs `seq` rnf sig data Caveat = MkCaveat { cid :: Key , vid :: Key , cl :: Location } | Constant - time instance instance Eq Caveat where (MkCaveat c1 v1 l1) == (MkCaveat c2 v2 l2) = (c1 `constEqBytes` c2) &&! (v1 `constEqBytes` v2) &&! (l1 `constEqBytes` l2) instance Show Caveat where show (MkCaveat c v l) | v == BS.empty = "cid " ++ B8.unpack c | otherwise = unlines [ "cid " ++ B8.unpack c , "vid " ++ B8.unpack v , "cl " ++ B8.unpack l ] instance NFData Caveat where rnf (MkCaveat cid vid cl) = rnf cid `seq` rnf vid `seq` rnf cl | Primitive to add a First or Third party caveat to a macaroon addCaveat :: Location -> Key -> Key -> Macaroon -> Macaroon addCaveat loc cid vid m = m { caveats = cavs ++ [cav'], signature = sig} where cavs = caveats m cav' = MkCaveat cid vid loc sig = toBytes (hmac (signature m) (BS.append vid cid) :: HMAC SHA256) (&&!) :: Bool -> Bool -> Bool True &&! True = True True &&! False = False False &&! True = False False &&! False = False
c7623163614ecdf92dc787eac0547274dbb396cb98a7f26de785b6e0ab6fbdda
spawnfest/eep49ers
z.erl
-module(z).
null
https://raw.githubusercontent.com/spawnfest/eep49ers/d1020fd625a0bbda8ab01caf0e1738eb1cf74886/lib/tools/test/cover_SUITE_data/compile_beam/z.erl
erlang
-module(z).
941b7697a6c36a58bb0b3a613ae9a214170540f4cf571ff34db636715b83dbc4
themetaschemer/malt
test-D-extend.rkt
(module+ test (require rackunit) (define r0-td 3.0) (define r1-td (tensor 3.0 4.0 5.0)) (define r2-td (tensor (tensor 3.0 4.0 5.0) (tensor 7.0 8.0 9.0))) (define test-shape (list 2 2 3)) (check-equal? (tmap (λ (x) (+ x 1)) r1-td) (tensor 4.0 5.0 6.0)) (check-true (rank> r2-td r1-td)) (check-false (rank> r1-td r2-td)) (check-true (of-ranks? 1 r1-td 2 r2-td)) (check-false (of-ranks? 2 r1-td 2 r2-td)) (check-true (of-rank? 2 r2-td)) (check-false (of-rank? 1 r2-td)) (check-equal? (desc-u (λ (t e) (+! t e)) (tensor 0 1 2 3) (tensor 4 5 6 7)) (tensor (tensor 4 5 6 7) (tensor 5 6 7 8) (tensor 6 7 8 9) (tensor 7 8 9 10))) (check-equal? (desc-t (λ (e u) (+! e u)) (tensor 4 5 6 7) (tensor 0 1 2 3)) (tensor (tensor 4 5 6 7) (tensor 5 6 7 8) (tensor 6 7 8 9) (tensor 7 8 9 10))) (check-equal? (+! (tensor 1 2 3 4) 2) (tensor 3 4 5 6)) (let-values (((gt gu) (fill-gu-acc-gt (make-vector 3 0.0) (λ (i) (values (+ i 1.0) (+ i 2.0))) 2 0.0))) (check-equal? gu (tensor 2.0 3.0 4.0)) (check-equal? gt 6.0)) (let-values (((gt gu) (build-gu-acc-gt 3 (λ (i) (values (+ i 1.0) (+ i 2.0)))))) (check-equal? gu (tensor 2.0 3.0 4.0)) (check-equal? gt 6.0)) (let-values (((gt gu) (fill-gt-acc-gu (make-vector 3 0.0) (λ (i) (values (+ i 2.0) (+ i 1.0))) 2 0.0))) (check-equal? gt (tensor 2.0 3.0 4.0)) (check-equal? gu 6.0)) (let-values (((gt gu) (build-gt-acc-gu 3 (λ (i) (values (+ i 2.0) (+ i 1.0)))))) (check-equal? gt (tensor 2.0 3.0 4.0)) (check-equal? gu 6.0)) (let-values (((gt gu) (fill-gt-gu (make-vector 3 0.0) (make-vector 3 0.0) (λ (i) (values (+ i 2.0) (+ i 1.0))) 2))) (check-equal? gt (tensor 2.0 3.0 4.0)) (check-equal? gu (tensor 1.0 2.0 3.0))) (let-values (((gt gu) (build-gt-gu 3 (λ (i) (values (+ i 2.0) (+ i 1.0)))))) (check-equal? gt (tensor 2.0 3.0 4.0)) (check-equal? gu (tensor 1.0 2.0 3.0))) (let-values (((gt gu) (desc-u-∇ (λ (t ui zi) (values (* zi ui) (* zi t))) 6.0 (tensor 2.0 3.0 4.0) (tensor 1.0 1.0 1.0)))) (check-equal? gt 9.0) (check-equal? gu (tensor 6.0 6.0 6.0))) (let-values (((gt gu) (desc-t-∇ (λ (ti u zi) (values (* zi u) (* zi ti))) (tensor 2.0 3.0 4.0) 6.0 (tensor 1.0 1.0 1.0)))) (check-equal? gt (tensor 6.0 6.0 6.0)) (check-equal? gu 9.0)) (let-values (((gt gu) (tmap2 (λ (ti ui zi) (values (* zi ui) (* zi ti))) (tensor 2.0 3.0 4.0) (tensor 1.0 2.0 3.0) (tensor 1.0 1.0 1.0)))) (check-equal? gt (tensor 1.0 2.0 3.0)) (check-equal? gu (tensor 2.0 3.0 4.0))) (define *∇ (ext2-∇ (λ (a b z) (values (* z b) (* z a))) 0 0)) (let-values (((gt gu) (*∇ (tensor 2.0 3.0 4.0) (tensor 1.0 2.0 3.0) (tensor 1.0 1.0 1.0)))) (check-equal? gt (tensor 1.0 2.0 3.0)) (check-equal? gu (tensor 2.0 3.0 4.0))) (define sum-1-∇ (λ (t z) (tmap (λ (ti) z) t))) (define sum-∇ (ext1-∇ sum-1-∇ 1)) (let ((gt (sum-∇ (tensor 2.0 3.0 4.0) 1.0))) (check-equal? gt (tensor 1.0 1.0 1.0))) (let ((gt (sum-∇ (tensor (tensor 2.0 3.0 4.0) (tensor 2.0 3.0 4.0)) (tensor 2.0 1.0)))) (check-equal? gt (tensor (tensor 2.0 2.0 2.0) (tensor 1.0 1.0 1.0)))) )
null
https://raw.githubusercontent.com/themetaschemer/malt/78a04063a5a343f5cf4332e84da0e914cdb4d347/nested-tensors/tensors/test/test-D-extend.rkt
racket
(module+ test (require rackunit) (define r0-td 3.0) (define r1-td (tensor 3.0 4.0 5.0)) (define r2-td (tensor (tensor 3.0 4.0 5.0) (tensor 7.0 8.0 9.0))) (define test-shape (list 2 2 3)) (check-equal? (tmap (λ (x) (+ x 1)) r1-td) (tensor 4.0 5.0 6.0)) (check-true (rank> r2-td r1-td)) (check-false (rank> r1-td r2-td)) (check-true (of-ranks? 1 r1-td 2 r2-td)) (check-false (of-ranks? 2 r1-td 2 r2-td)) (check-true (of-rank? 2 r2-td)) (check-false (of-rank? 1 r2-td)) (check-equal? (desc-u (λ (t e) (+! t e)) (tensor 0 1 2 3) (tensor 4 5 6 7)) (tensor (tensor 4 5 6 7) (tensor 5 6 7 8) (tensor 6 7 8 9) (tensor 7 8 9 10))) (check-equal? (desc-t (λ (e u) (+! e u)) (tensor 4 5 6 7) (tensor 0 1 2 3)) (tensor (tensor 4 5 6 7) (tensor 5 6 7 8) (tensor 6 7 8 9) (tensor 7 8 9 10))) (check-equal? (+! (tensor 1 2 3 4) 2) (tensor 3 4 5 6)) (let-values (((gt gu) (fill-gu-acc-gt (make-vector 3 0.0) (λ (i) (values (+ i 1.0) (+ i 2.0))) 2 0.0))) (check-equal? gu (tensor 2.0 3.0 4.0)) (check-equal? gt 6.0)) (let-values (((gt gu) (build-gu-acc-gt 3 (λ (i) (values (+ i 1.0) (+ i 2.0)))))) (check-equal? gu (tensor 2.0 3.0 4.0)) (check-equal? gt 6.0)) (let-values (((gt gu) (fill-gt-acc-gu (make-vector 3 0.0) (λ (i) (values (+ i 2.0) (+ i 1.0))) 2 0.0))) (check-equal? gt (tensor 2.0 3.0 4.0)) (check-equal? gu 6.0)) (let-values (((gt gu) (build-gt-acc-gu 3 (λ (i) (values (+ i 2.0) (+ i 1.0)))))) (check-equal? gt (tensor 2.0 3.0 4.0)) (check-equal? gu 6.0)) (let-values (((gt gu) (fill-gt-gu (make-vector 3 0.0) (make-vector 3 0.0) (λ (i) (values (+ i 2.0) (+ i 1.0))) 2))) (check-equal? gt (tensor 2.0 3.0 4.0)) (check-equal? gu (tensor 1.0 2.0 3.0))) (let-values (((gt gu) (build-gt-gu 3 (λ (i) (values (+ i 2.0) (+ i 1.0)))))) (check-equal? gt (tensor 2.0 3.0 4.0)) (check-equal? gu (tensor 1.0 2.0 3.0))) (let-values (((gt gu) (desc-u-∇ (λ (t ui zi) (values (* zi ui) (* zi t))) 6.0 (tensor 2.0 3.0 4.0) (tensor 1.0 1.0 1.0)))) (check-equal? gt 9.0) (check-equal? gu (tensor 6.0 6.0 6.0))) (let-values (((gt gu) (desc-t-∇ (λ (ti u zi) (values (* zi u) (* zi ti))) (tensor 2.0 3.0 4.0) 6.0 (tensor 1.0 1.0 1.0)))) (check-equal? gt (tensor 6.0 6.0 6.0)) (check-equal? gu 9.0)) (let-values (((gt gu) (tmap2 (λ (ti ui zi) (values (* zi ui) (* zi ti))) (tensor 2.0 3.0 4.0) (tensor 1.0 2.0 3.0) (tensor 1.0 1.0 1.0)))) (check-equal? gt (tensor 1.0 2.0 3.0)) (check-equal? gu (tensor 2.0 3.0 4.0))) (define *∇ (ext2-∇ (λ (a b z) (values (* z b) (* z a))) 0 0)) (let-values (((gt gu) (*∇ (tensor 2.0 3.0 4.0) (tensor 1.0 2.0 3.0) (tensor 1.0 1.0 1.0)))) (check-equal? gt (tensor 1.0 2.0 3.0)) (check-equal? gu (tensor 2.0 3.0 4.0))) (define sum-1-∇ (λ (t z) (tmap (λ (ti) z) t))) (define sum-∇ (ext1-∇ sum-1-∇ 1)) (let ((gt (sum-∇ (tensor 2.0 3.0 4.0) 1.0))) (check-equal? gt (tensor 1.0 1.0 1.0))) (let ((gt (sum-∇ (tensor (tensor 2.0 3.0 4.0) (tensor 2.0 3.0 4.0)) (tensor 2.0 1.0)))) (check-equal? gt (tensor (tensor 2.0 2.0 2.0) (tensor 1.0 1.0 1.0)))) )
e2f8eab211e1a6224014c5d93f70c18b95aea3cc53662de67dfd39f4f505a78e
foretspaisibles/cl-kaputt
package.lisp
package.lisp — A Testsuite for the Kaputt Test Framework ( -kaputt ) This file is part of Kaputt . ;;;; Copyright © 2019–2021 ;;;; All rights reserved. This software is governed by the CeCILL - B license under French law and ;;;; abiding by the rules of distribution of free software. You can use, modify and/ or redistribute the software under the terms of the CeCILL - B license as circulated by CEA , CNRS and INRIA at the following URL ;;;; "-B_V1-en.txt" (defpackage #:kaputt/testsuite (:use #:common-lisp #:kaputt) (:import-from #:alexandria #:with-unique-names) (:export #:run-all-tests #:run-all-tests-batch) (:documentation "A testsuite for the Kaputt Test Framewok.")) End of file ` package.lisp '
null
https://raw.githubusercontent.com/foretspaisibles/cl-kaputt/94ff2a96ced6576e3995b445b78ab2a4bf09c57f/testsuite/package.lisp
lisp
All rights reserved. abiding by the rules of distribution of free software. You can use, "-B_V1-en.txt"
package.lisp — A Testsuite for the Kaputt Test Framework ( -kaputt ) This file is part of Kaputt . Copyright © 2019–2021 This software is governed by the CeCILL - B license under French law and modify and/ or redistribute the software under the terms of the CeCILL - B license as circulated by CEA , CNRS and INRIA at the following URL (defpackage #:kaputt/testsuite (:use #:common-lisp #:kaputt) (:import-from #:alexandria #:with-unique-names) (:export #:run-all-tests #:run-all-tests-batch) (:documentation "A testsuite for the Kaputt Test Framewok.")) End of file ` package.lisp '
0ab94e5af00ff101f55075615168f9e11765a704f938ab19a629db61ddf851de
bvaugon/ocapic
lazies.ml
(*************************************************************************) (* *) (* OCaPIC *) (* *) (* *) This file is distributed under the terms of the CeCILL license . (* See file ../../LICENSE-en. *) (* *) (*************************************************************************) let sleep () = Sys.sleep 4000;; Display.write_string "a";; sleep ();; let x = lazy ( Display.write_string "Hello"; sleep (); 42 );; Gc.run ();; Display.write_string "b";; sleep ();; let n = Lazy.force x;; Gc.run ();; sleep ();; Display.write_string "c";; sleep ();; Display.write_int n;; sleep ();; let n = Lazy.force x;; sleep ();; Display.write_string "d";; sleep ();; Display.write_int n;; sleep ();; Display.write_string "e";;
null
https://raw.githubusercontent.com/bvaugon/ocapic/a14cd9ec3f5022aeb5fe2264d595d7e8f1ddf58a/tests/lazies/lazies.ml
ocaml
*********************************************************************** OCaPIC See file ../../LICENSE-en. ***********************************************************************
This file is distributed under the terms of the CeCILL license . let sleep () = Sys.sleep 4000;; Display.write_string "a";; sleep ();; let x = lazy ( Display.write_string "Hello"; sleep (); 42 );; Gc.run ();; Display.write_string "b";; sleep ();; let n = Lazy.force x;; Gc.run ();; sleep ();; Display.write_string "c";; sleep ();; Display.write_int n;; sleep ();; let n = Lazy.force x;; sleep ();; Display.write_string "d";; sleep ();; Display.write_int n;; sleep ();; Display.write_string "e";;
99076db6d811049d85539b8ba9de254ce5f2d8d0b00596828345691c9ac8a7b8
deepfire/holotype
ghc-repro-16095-2.hs
# LANGUAGE AllowAmbiguousTypes # # LANGUAGE DataKinds # {-# LANGUAGE GADTs #-} # LANGUAGE KindSignatures # # LANGUAGE ScopedTypeVariables # # LANGUAGE TypeApplications # # LANGUAGE TypeOperators # module Repro where import Generics.SOP recover :: forall a xs. (Code a ~ '[xs], HasDatatypeInfo a) => a recover = case datatypeInfo (Proxy @a) :: DatatypeInfo '[xs] of Newtype _ _ _ -> let sop :: NP [] xs = (undefined :: forall c xs . All c xs => NP [] xs) in undefined
null
https://raw.githubusercontent.com/deepfire/holotype/d33052f588b74616560b81616ffc4a0142f8a617/doc/ghc-repro-16095-2.hs
haskell
# LANGUAGE GADTs #
# LANGUAGE AllowAmbiguousTypes # # LANGUAGE DataKinds # # LANGUAGE KindSignatures # # LANGUAGE ScopedTypeVariables # # LANGUAGE TypeApplications # # LANGUAGE TypeOperators # module Repro where import Generics.SOP recover :: forall a xs. (Code a ~ '[xs], HasDatatypeInfo a) => a recover = case datatypeInfo (Proxy @a) :: DatatypeInfo '[xs] of Newtype _ _ _ -> let sop :: NP [] xs = (undefined :: forall c xs . All c xs => NP [] xs) in undefined
0bee15e1dc847d6a798ccc0deb1d9a8d1d2a6aa1a6e57ec7fa94db8f6ec5f6b3
bn-d/ppx_pyformat
utils.ml
open Ppx_pyformat.Types let format_spec = String_format { fill = None } let make_field ?index ?conversion ?(format_spec = format_spec) arg = Field (make_replacement_field ~arg ?index ?conversion ~format_spec ()) let make_string = make_string_format_of_format_spec let make_int = make_int_format_of_format_spec let make_float = make_float_format_of_format_spec let test str expected _ = Ppx_pyformat.Utils.parse str |> OUnit2.assert_equal ~printer:Printer_utils.string_of_elements expected let test_exc str exc _ = let f _ = Ppx_pyformat.Utils.parse str in OUnit2.assert_raises exc f
null
https://raw.githubusercontent.com/bn-d/ppx_pyformat/bcb0031cf9fbce12d54d0e8d927ecf41ff3cab97/test/parser/utils.ml
ocaml
open Ppx_pyformat.Types let format_spec = String_format { fill = None } let make_field ?index ?conversion ?(format_spec = format_spec) arg = Field (make_replacement_field ~arg ?index ?conversion ~format_spec ()) let make_string = make_string_format_of_format_spec let make_int = make_int_format_of_format_spec let make_float = make_float_format_of_format_spec let test str expected _ = Ppx_pyformat.Utils.parse str |> OUnit2.assert_equal ~printer:Printer_utils.string_of_elements expected let test_exc str exc _ = let f _ = Ppx_pyformat.Utils.parse str in OUnit2.assert_raises exc f
c4f8e65bcae28f56fbc7ac3396f9eedb859e2164072897b39dbfb9aede530c58
c-cube/funarith
Rat.mli
* { 1 Interface for Rationals } * This abstracts over a type and operation for rationals . A possible implementation for arbitrary precision numbers is Zarith , with module { ! Q } A possible implementation for arbitrary precision numbers is Zarith, with module {!Q} *) module type S = Rat_intf.S
null
https://raw.githubusercontent.com/c-cube/funarith/1c86ac45e9608efaa761e3f14455402730885339/src/Rat.mli
ocaml
* { 1 Interface for Rationals } * This abstracts over a type and operation for rationals . A possible implementation for arbitrary precision numbers is Zarith , with module { ! Q } A possible implementation for arbitrary precision numbers is Zarith, with module {!Q} *) module type S = Rat_intf.S
5f09c90a296fbb537e634ec62a50a338e537d1dab7d70a31be5dffa0eb69f2a2
input-output-hk/cardano-wallet
WalletState.hs
# LANGUAGE DeriveGeneric # # LANGUAGE NamedFieldPuns # # LANGUAGE OverloadedLabels # # LANGUAGE StandaloneDeriving # # LANGUAGE TypeFamilies # -- | Copyright : © 2022 IOHK -- License: Apache-2.0 -- -- Pure data type which represents the entire wallet state, -- including all checkpoints. -- -- FIXME during ADP-1043: Actually include everything, e.g. TxHistory , Pending transactions , … module Cardano.Wallet.DB.WalletState ( -- * Wallet state WalletState (..) , fromGenesis , getLatest , findNearestPoint * WalletCheckpoint ( internal use mostly ) , WalletCheckpoint (..) , toWallet , fromWallet , getBlockHeight , getSlot * Delta types , DeltaWalletState1 (..) , DeltaWalletState -- * Multiple wallets , DeltaMap (..) , ErrNoSuchWallet (..) , adjustNoSuchWallet ) where import Prelude import Cardano.Wallet.Address.Book ( AddressBookIso (..), Discoveries, Prologue ) import Cardano.Wallet.Checkpoints ( Checkpoints ) import Cardano.Wallet.DB.Errors ( ErrNoSuchWallet (..) ) import Cardano.Wallet.DB.Store.Submissions.Layer ( emptyTxSubmissions ) import Cardano.Wallet.DB.Store.Submissions.Operations ( DeltaTxSubmissions, TxSubmissions ) import Cardano.Wallet.Primitive.Types ( BlockHeader, WalletId ) import Cardano.Wallet.Primitive.Types.UTxO ( UTxO ) import Data.Delta ( Delta (..) ) import Data.DeltaMap ( DeltaMap (..) ) import Data.Generics.Internal.VL ( withIso ) import Data.Generics.Internal.VL.Lens ( over, view, (^.) ) import Data.Map.Strict ( Map ) import Data.Word ( Word32 ) import Fmt ( Buildable (..), pretty ) import GHC.Generics ( Generic ) import qualified Cardano.Wallet.Checkpoints as CPS import qualified Cardano.Wallet.Primitive.Model as W import qualified Cardano.Wallet.Primitive.Types as W import qualified Data.Map.Strict as Map {------------------------------------------------------------------------------- Wallet Checkpoint -------------------------------------------------------------------------------} -- | Data stored in a single checkpoint. -- Only includes the 'UTxO' and the 'Discoveries', but not the 'Prologue'. data WalletCheckpoint s = WalletCheckpoint { currentTip :: !BlockHeader , utxo :: !UTxO , discoveries :: !(Discoveries s) } deriving (Generic) deriving instance AddressBookIso s => Eq (WalletCheckpoint s) -- | Helper function: Get the block height of a wallet checkpoint. getBlockHeight :: WalletCheckpoint s -> Word32 getBlockHeight (WalletCheckpoint currentTip _ _) = currentTip ^. (#blockHeight . #getQuantity) -- | Helper function: Get the 'Slot' of a wallet checkpoint. getSlot :: WalletCheckpoint s -> W.Slot getSlot (WalletCheckpoint currentTip _ _) = W.toSlot . W.chainPointFromBlockHeader $ currentTip | Convert a stored ' WalletCheckpoint ' to the legacy ' W.Wallet ' state . toWallet :: AddressBookIso s => Prologue s -> WalletCheckpoint s -> W.Wallet s toWallet pro (WalletCheckpoint pt utxo dis) = W.unsafeInitWallet utxo pt $ withIso addressIso $ \_ from -> from (pro,dis) | Convert a legacy ' W.Wallet ' state to a ' Prologue ' and a ' WalletCheckpoint ' fromWallet :: AddressBookIso s => W.Wallet s -> (Prologue s, WalletCheckpoint s) fromWallet w = (pro, WalletCheckpoint (W.currentTip w) (W.utxo w) dis) where (pro, dis) = withIso addressIso $ \to _ -> to (w ^. #getState) {------------------------------------------------------------------------------- Wallet State -------------------------------------------------------------------------------} -- | Wallet state. Currently includes: -- -- * Prologue of the address discovery state -- * Checkpoints of UTxO and of discoveries of the address discovery state. -- FIXME during ADP-1043 : Include also TxHistory , pending transactions , … , -- everything. data WalletState s = WalletState { prologue :: !(Prologue s) , checkpoints :: !(Checkpoints (WalletCheckpoint s)) , submissions :: !TxSubmissions } deriving (Generic) deriving instance AddressBookIso s => Eq (WalletState s) -- | Create a wallet from the genesis block. fromGenesis :: AddressBookIso s => W.Wallet s -> Maybe (WalletState s) fromGenesis cp | W.isGenesisBlockHeader header = Just $ WalletState { prologue , checkpoints = CPS.fromGenesis checkpoint , submissions = emptyTxSubmissions } | otherwise = Nothing where header = cp ^. #currentTip (prologue, checkpoint) = fromWallet cp -- | Get the wallet checkpoint with the largest slot number getLatest :: AddressBookIso s => WalletState s -> W.Wallet s getLatest w = toWallet (w ^. #prologue) . snd $ CPS.getLatest (w ^. #checkpoints) | Find the nearest ' ' that is either at the given point or before . findNearestPoint :: WalletState s -> W.Slot -> Maybe W.Slot findNearestPoint = CPS.findNearestPoint . view #checkpoints {------------------------------------------------------------------------------- Delta type for the wallet state -------------------------------------------------------------------------------} type DeltaWalletState s = [DeltaWalletState1 s] data DeltaWalletState1 s = ReplacePrologue (Prologue s) -- ^ Replace the prologue of the address discovery state | UpdateCheckpoints (CPS.DeltasCheckpoints (WalletCheckpoint s)) -- ^ Update the wallet checkpoints. | UpdateSubmissions [DeltaTxSubmissions] instance Delta (DeltaWalletState1 s) where type Base (DeltaWalletState1 s) = WalletState s apply (ReplacePrologue p) = over #prologue $ const p apply (UpdateCheckpoints d) = over #checkpoints $ apply d apply (UpdateSubmissions d) = over #submissions $ apply d instance Buildable (DeltaWalletState1 s) where build (ReplacePrologue _) = "ReplacePrologue …" build (UpdateCheckpoints d) = "UpdateCheckpoints (" <> build d <> ")" build (UpdateSubmissions d) = "UpdateSubmissions (" <> build d <> ")" instance Show (DeltaWalletState1 s) where show = pretty {------------------------------------------------------------------------------- Multiple wallets. -------------------------------------------------------------------------------} | Adjust a specific wallet if it exists or return ' ErrNoSuchWallet ' . adjustNoSuchWallet :: WalletId -> (ErrNoSuchWallet -> e) -> (w -> Either e (dw, b)) -> (Map WalletId w -> (Maybe (DeltaMap WalletId dw), Either e b)) adjustNoSuchWallet wid err update wallets = case Map.lookup wid wallets of Nothing -> (Nothing, Left $ err $ ErrNoSuchWallet wid) Just wal -> case update wal of Left e -> (Nothing, Left e) Right (dw, b) -> (Just $ Adjust wid dw, Right b)
null
https://raw.githubusercontent.com/input-output-hk/cardano-wallet/ce8843fa0cc82a3b19863e2263abfdc332c4c63a/lib/wallet/src/Cardano/Wallet/DB/WalletState.hs
haskell
| License: Apache-2.0 Pure data type which represents the entire wallet state, including all checkpoints. FIXME during ADP-1043: Actually include everything, * Wallet state * Multiple wallets ------------------------------------------------------------------------------ Wallet Checkpoint ------------------------------------------------------------------------------ | Data stored in a single checkpoint. Only includes the 'UTxO' and the 'Discoveries', but not the 'Prologue'. | Helper function: Get the block height of a wallet checkpoint. | Helper function: Get the 'Slot' of a wallet checkpoint. ------------------------------------------------------------------------------ Wallet State ------------------------------------------------------------------------------ | Wallet state. Currently includes: * Prologue of the address discovery state * Checkpoints of UTxO and of discoveries of the address discovery state. everything. | Create a wallet from the genesis block. | Get the wallet checkpoint with the largest slot number ------------------------------------------------------------------------------ Delta type for the wallet state ------------------------------------------------------------------------------ ^ Replace the prologue of the address discovery state ^ Update the wallet checkpoints. ------------------------------------------------------------------------------ Multiple wallets. ------------------------------------------------------------------------------
# LANGUAGE DeriveGeneric # # LANGUAGE NamedFieldPuns # # LANGUAGE OverloadedLabels # # LANGUAGE StandaloneDeriving # # LANGUAGE TypeFamilies # Copyright : © 2022 IOHK e.g. TxHistory , Pending transactions , … module Cardano.Wallet.DB.WalletState WalletState (..) , fromGenesis , getLatest , findNearestPoint * WalletCheckpoint ( internal use mostly ) , WalletCheckpoint (..) , toWallet , fromWallet , getBlockHeight , getSlot * Delta types , DeltaWalletState1 (..) , DeltaWalletState , DeltaMap (..) , ErrNoSuchWallet (..) , adjustNoSuchWallet ) where import Prelude import Cardano.Wallet.Address.Book ( AddressBookIso (..), Discoveries, Prologue ) import Cardano.Wallet.Checkpoints ( Checkpoints ) import Cardano.Wallet.DB.Errors ( ErrNoSuchWallet (..) ) import Cardano.Wallet.DB.Store.Submissions.Layer ( emptyTxSubmissions ) import Cardano.Wallet.DB.Store.Submissions.Operations ( DeltaTxSubmissions, TxSubmissions ) import Cardano.Wallet.Primitive.Types ( BlockHeader, WalletId ) import Cardano.Wallet.Primitive.Types.UTxO ( UTxO ) import Data.Delta ( Delta (..) ) import Data.DeltaMap ( DeltaMap (..) ) import Data.Generics.Internal.VL ( withIso ) import Data.Generics.Internal.VL.Lens ( over, view, (^.) ) import Data.Map.Strict ( Map ) import Data.Word ( Word32 ) import Fmt ( Buildable (..), pretty ) import GHC.Generics ( Generic ) import qualified Cardano.Wallet.Checkpoints as CPS import qualified Cardano.Wallet.Primitive.Model as W import qualified Cardano.Wallet.Primitive.Types as W import qualified Data.Map.Strict as Map data WalletCheckpoint s = WalletCheckpoint { currentTip :: !BlockHeader , utxo :: !UTxO , discoveries :: !(Discoveries s) } deriving (Generic) deriving instance AddressBookIso s => Eq (WalletCheckpoint s) getBlockHeight :: WalletCheckpoint s -> Word32 getBlockHeight (WalletCheckpoint currentTip _ _) = currentTip ^. (#blockHeight . #getQuantity) getSlot :: WalletCheckpoint s -> W.Slot getSlot (WalletCheckpoint currentTip _ _) = W.toSlot . W.chainPointFromBlockHeader $ currentTip | Convert a stored ' WalletCheckpoint ' to the legacy ' W.Wallet ' state . toWallet :: AddressBookIso s => Prologue s -> WalletCheckpoint s -> W.Wallet s toWallet pro (WalletCheckpoint pt utxo dis) = W.unsafeInitWallet utxo pt $ withIso addressIso $ \_ from -> from (pro,dis) | Convert a legacy ' W.Wallet ' state to a ' Prologue ' and a ' WalletCheckpoint ' fromWallet :: AddressBookIso s => W.Wallet s -> (Prologue s, WalletCheckpoint s) fromWallet w = (pro, WalletCheckpoint (W.currentTip w) (W.utxo w) dis) where (pro, dis) = withIso addressIso $ \to _ -> to (w ^. #getState) FIXME during ADP-1043 : Include also TxHistory , pending transactions , … , data WalletState s = WalletState { prologue :: !(Prologue s) , checkpoints :: !(Checkpoints (WalletCheckpoint s)) , submissions :: !TxSubmissions } deriving (Generic) deriving instance AddressBookIso s => Eq (WalletState s) fromGenesis :: AddressBookIso s => W.Wallet s -> Maybe (WalletState s) fromGenesis cp | W.isGenesisBlockHeader header = Just $ WalletState { prologue , checkpoints = CPS.fromGenesis checkpoint , submissions = emptyTxSubmissions } | otherwise = Nothing where header = cp ^. #currentTip (prologue, checkpoint) = fromWallet cp getLatest :: AddressBookIso s => WalletState s -> W.Wallet s getLatest w = toWallet (w ^. #prologue) . snd $ CPS.getLatest (w ^. #checkpoints) | Find the nearest ' ' that is either at the given point or before . findNearestPoint :: WalletState s -> W.Slot -> Maybe W.Slot findNearestPoint = CPS.findNearestPoint . view #checkpoints type DeltaWalletState s = [DeltaWalletState1 s] data DeltaWalletState1 s = ReplacePrologue (Prologue s) | UpdateCheckpoints (CPS.DeltasCheckpoints (WalletCheckpoint s)) | UpdateSubmissions [DeltaTxSubmissions] instance Delta (DeltaWalletState1 s) where type Base (DeltaWalletState1 s) = WalletState s apply (ReplacePrologue p) = over #prologue $ const p apply (UpdateCheckpoints d) = over #checkpoints $ apply d apply (UpdateSubmissions d) = over #submissions $ apply d instance Buildable (DeltaWalletState1 s) where build (ReplacePrologue _) = "ReplacePrologue …" build (UpdateCheckpoints d) = "UpdateCheckpoints (" <> build d <> ")" build (UpdateSubmissions d) = "UpdateSubmissions (" <> build d <> ")" instance Show (DeltaWalletState1 s) where show = pretty | Adjust a specific wallet if it exists or return ' ErrNoSuchWallet ' . adjustNoSuchWallet :: WalletId -> (ErrNoSuchWallet -> e) -> (w -> Either e (dw, b)) -> (Map WalletId w -> (Maybe (DeltaMap WalletId dw), Either e b)) adjustNoSuchWallet wid err update wallets = case Map.lookup wid wallets of Nothing -> (Nothing, Left $ err $ ErrNoSuchWallet wid) Just wal -> case update wal of Left e -> (Nothing, Left e) Right (dw, b) -> (Just $ Adjust wid dw, Right b)
51a2475952511c7139894b91c67d82196a2e09a5f5dcc12e7f0100065fe3b952
janestreet/vcaml
vcaml.mli
module Unshadow_buffer := Buffer module Unshadow_command := Command open Core open Async module Api_version = Nvim_internal.Api_version module Buffer = Unshadow_buffer module Channel_info = Channel_info module Client_info = Client_info module Color = Color module Command = Unshadow_command module Error_type = Nvim_internal.Error_type module Highlighted_text = Highlighted_text module Keymap = Keymap module Mark = Mark module Mode = Mode module Namespace = Namespace module Nvim = Nvim module Position = Position module Tabpage = Tabpage module Type = Nvim_internal.Phantom module Ui = Ui module Vcaml_error = Vcaml_error module Window = Window * API version for which this library is built ( not the same as the Neovim version ) . val api_version : Api_version.t * [ Msgpack.pp ] with support for extensions . val pp : Formatter.t -> Msgpack.t -> unit module Nvim_version : sig include Semantic_version.S val vcaml : t end module Client : sig type 'state t = 'state Client.t * [ on_error ] is invoked when VCaml fails to parse a response from Neovim and when sends us an asynchronous error event to inform us that it encountered a problem with a message we sent . Neovim sends us an asynchronous error event to inform us that it encountered a problem with a message we sent. *) val create : on_error:[ `Raise | `Call of Vcaml_error.t -> unit ] -> [ `not_connected ] t * A value of type [ Connection_type.t ] describes the type of connection to use , along with the information necessary to connect to Neovim . With a [ Unix ] connection , the plugin communicates with Neovim over the unix domain socket it uses to serve RPC requests . [ Unix ` Child ] should be used if the plugin is launched from within Neovim ; if it is launched independently a path to the socket will need to be provided . With a [ Stdio ] connection , the plugin communicates with Neovim using its own stdin and stdout ( which means stdout can not be used for logging ) . This connection type should only be used if the plugin is launched from Neovim with [ jobstart ] with [ rpc:1 ] in [ opts ] . [ Stdio ] connections are useful for synchronous , " one - shot " plugins where you want to synchronously start the process , communicate with Neovim , and shut down . To make this work , after starting the plugin , issue an [ rpcrequest ] , which will cause Neovim to block . The plugin should register the requested RPC before connecting to Neovim to ensure the RPC is defined at the time Neovim 's request is handled . After handling the request , the plugin should shut down . If you tried to do this with a [ Unix ] connection then after the process is launched you would need to create a new channel but Neovim ca n't do that while in the middle of processing whatever logic it 's currently executing that launched the process . To achieve synchronicity in this way you 'd need a continuation - after launching the process you 'd need to yield to the event loop so the channel could be established , and then the plugin would need to invoke a callback in Neovim to continue . The [ Embed ] connection is the inverse of the [ Stdio ] connection - instead of the OCaml app being launched by Neovim , Neovim is launched by the OCaml app . Just as in a [ Stdio ] connection the app 's stdin and stdout are used for RPC communication , here Neovim 's stdin and stdout are used to communicate with the embedding process . [ Embed ] is most useful for testing and for graphical applications that want to embed Neovim for editing text . When [ Embed ] is used the [ --embed ] flag must be passed in [ args ] . with the information necessary to connect to Neovim. With a [Unix] connection, the plugin communicates with Neovim over the unix domain socket it uses to serve RPC requests. [Unix `Child] should be used if the plugin is launched from within Neovim; if it is launched independently a path to the socket will need to be provided. With a [Stdio] connection, the plugin communicates with Neovim using its own stdin and stdout (which means stdout cannot be used for logging). This connection type should only be used if the plugin is launched from Neovim with [jobstart] with [rpc:1] in [opts]. [Stdio] connections are useful for synchronous, "one-shot" plugins where you want to synchronously start the process, communicate with Neovim, and shut down. To make this work, after starting the plugin, issue an [rpcrequest], which will cause Neovim to block. The plugin should register the requested RPC before connecting to Neovim to ensure the RPC is defined at the time Neovim's request is handled. After handling the request, the plugin should shut down. If you tried to do this with a [Unix] connection then after the process is launched you would need to create a new channel but Neovim can't do that while in the middle of processing whatever logic it's currently executing that launched the process. To achieve synchronicity in this way you'd need a continuation - after launching the process you'd need to yield to the event loop so the channel could be established, and then the plugin would need to invoke a callback in Neovim to continue. The [Embed] connection is the inverse of the [Stdio] connection - instead of the OCaml app being launched by Neovim, Neovim is launched by the OCaml app. Just as in a [Stdio] connection the app's stdin and stdout are used for RPC communication, here Neovim's stdin and stdout are used to communicate with the embedding process. [Embed] is most useful for testing and for graphical applications that want to embed Neovim for editing text. When [Embed] is used the [--embed] flag must be passed in [args]. *) module Connection_type : sig type _ t = | Unix : [ `Child | `Socket of string ] -> [ `connected ] Client.t t | Stdio : [ `connected ] Client.t t | Embed : { prog : string ; args : string list ; working_dir : string ; env : Core_unix.env } -> ([ `connected ] Client.t * Async.Process.t) t end * Attach to Neovim over an RPC channel . Once [ attach ] is called Neovim can start sending RPC requests and notifications , so handlers should be registered in advance with [ register_request_async ] and [ register_request_blocking ] as needed . Registering more handlers after attaching is allowed . Calling [ attach ] twice will raise . sending RPC requests and notifications, so handlers should be registered in advance with [register_request_async] and [register_request_blocking] as needed. Registering more handlers after attaching is allowed. Calling [attach] twice will raise. *) val attach : ?close_reader_and_writer_on_disconnect:(* Default: [true] *) bool -> [ `not_connected ] t -> 'a Connection_type.t -> time_source:Time_source.t -> 'a Deferred.Or_error.t (** Close the client and release the underlying file descriptors. Can be called safely multiple times. *) val close : [ `connected ] t -> unit Deferred.t * Returns Neovim 's i d for the channel over which Neovim and the client communicate . This can be useful when you want to set an autocmd or key mapping that issues an [ rcprequest ] or [ rpcnotify ] when triggered , since these functions requre the channel i d as an argument . This can be useful when you want to set an autocmd or key mapping that issues an [rcprequest] or [rpcnotify] when triggered, since these functions requre the channel id as an argument. *) val channel : [ `connected ] t -> int end * A [ ' a Api_call.t ] is a thunked call to neovim returning a - encoded [ ' a ] . No RPC traffic is generated until an [ Api_call.t ] is invoked via [ run ] or [ run_join ] . [ Api_call.t ] 's can be manipulated with an applicative - like interface . A good mental model is that invoking a [ ' a Api_call.t ] should cause exactly one RPC message to be sent to the neovim client , and that any operations within will not be interrupted . Calls with side effects will occur in the order written , so { [ let%map _ a = a and _ b = b in ( ) ] } will cause Neovim to first run [ a ] and then [ b ] . This is important for applications that rely on manipulating neovim 's internal state . In particular , the atomicity guarantee prevents races with other pending operations , including user input . You can run an [ Api_call.t ] with [ run ] or [ run_join ] . traffic is generated until an [Api_call.t] is invoked via [run] or [run_join]. [Api_call.t]'s can be manipulated with an applicative-like interface. A good mental model is that invoking a ['a Api_call.t] should cause exactly one RPC message to be sent to the neovim client, and that any operations within will not be interrupted. Calls with side effects will occur in the order written, so {[ let%map _a = a and _b = b in () ]} will cause Neovim to first run [a] and then [b]. This is important for applications that rely on manipulating neovim's internal state. In particular, the atomicity guarantee prevents races with other pending operations, including user input. You can run an [Api_call.t] with [run] or [run_join]. *) module Api_call : sig include Applicative.S with type 'a t = 'a Api_call.t include Applicative.Let_syntax with type 'a t := 'a Api_call.t module Or_error = Api_call.Or_error end val run : Source_code_position.t -> [ `connected ] Client.t -> 'a Api_call.t -> 'a Deferred.Or_error.t val run_join : Source_code_position.t -> [ `connected ] Client.t -> 'a Api_call.Or_error.t -> 'a Deferred.Or_error.t module Defun : sig * A [ Defun . Vim.t ] value is a reified value corresponding to the type of a function . It is used by [ wrap_viml_function ] to produce a regular ocaml function of the correct type . Important notes about [ Nil ] : 1 . If you are wrapping a function that takes no arguments , just use [ return T ] . Do not use [ Nil @- > return T ] . 2 . If you are wrapping a native ( non - API ) Vimscript function that does not have an explicit return statement , its implicit return is [ Integer 0 ] , not [ Nil ] . is used by [wrap_viml_function] to produce a regular ocaml function of the correct type. Important notes about [Nil]: 1. If you are wrapping a function that takes no arguments, just use [return T]. Do not use [Nil @-> return T]. 2. If you are wrapping a native (non-API) Vimscript function that does not have an explicit return statement, its implicit return is [Integer 0], not [Nil]. *) module Vim : sig type ('f, 'leftmost_input, 'out) t (** Wraps a [Type.t] to be used as the rightmost (return) type of this function. *) val return : 'a Type.t -> ('a Api_call.Or_error.t, unit, 'a) t * Add an extra argument to an existing function arity . Using this operator , function types will look extremely closely to how the underlying OCaml type will end up . For example , a Vim function with ( OCaml ) type [ int - > string - > int - > buffer ] would use the arity [ Integer @- > String @- > Integer @- > return Buffer ] . Using this operator, function types will look extremely closely to how the underlying OCaml type will end up. For example, a Vim function with (OCaml) type [int -> string -> int -> buffer] would use the arity [Integer @-> String @-> Integer @-> return Buffer]. *) val ( @-> ) : 'a Type.t -> ('b, _, 'output) t -> ('a -> 'b, 'a, 'output) t end * [ Defun . Ocaml ] is analogous to [ Defun . Vim ] , except used to specify OCaml - defined functions callable from neovim . See [ register_request_blocking ] and [ register_request_async ] below for usage . functions callable from neovim. See [register_request_blocking] and [register_request_async] below for usage. *) module Ocaml : sig module Sync : sig type ('f, 'leftmost_input) t val return : 'a Type.t -> ('a Deferred.Or_error.t, unit) t val ( @-> ) : 'a Type.t -> ('b, _) t -> ('a -> 'b, 'a) t module Expert : sig * Supports the rare case of interoperating with a Vimscript function that takes a callback that takes a variable number of arguments . a callback that takes a variable number of arguments. *) val varargs : args_type:'a Type.t -> return_type:'b Type.t -> ('a list -> 'b Deferred.Or_error.t, 'a list) t end end module Async : sig type 'f t val unit : unit Deferred.Or_error.t t val ( @-> ) : 'a Type.t -> 'b t -> ('a -> 'b) t module Expert : sig val varargs : 'a Type.t -> ('a list -> unit Deferred.Or_error.t) t end end end end * Given the name of a function available in Vimscript ( VimL ) along with its arity ( see [ Defun . Vim ] ) , return a regularly - typed OCaml function that calls said function . This is intended for client authors to delegate work back to Neovim , possibly to call an existing Vimscript function . Before reaching for this function , please check the functions available in [ Nvim ] , [ Buffer ] , [ Window ] and [ Tabpage ] to see that the functionality you intend to wrap is n't directly exposed in the API . [Defun.Vim]), return a regularly-typed OCaml function that calls said function. This is intended for client authors to delegate work back to Neovim, possibly to call an existing Vimscript function. Before reaching for this function, please check the functions available in [Nvim], [Buffer], [Window] and [Tabpage] to see that the functionality you intend to wrap isn't directly exposed in the API. *) val wrap_viml_function : type_:('fn, 'leftmost, 'out) Defun.Vim.t -> function_name:string -> 'fn * [ register_request_blocking ] and [ register_request_async ] register functions that can be called from Neovim via [ rpcrequest ] and [ rpcnotify ] respectively . This is achieved by adding a listener to the Neovim msgpack_rpc bus . A blocking request will block Neovim from processing user input or communication over other channels until a response is returned . Neovim will continue to process calls sent over the same channel while a blocking request is in flight , which means nested calls are supported . When the user presses Ctrl - C to interrupt a blocking call , [ keyboard_interrupted ] will be determined . Use that to run any necessary cleanup . If you call back into Neovim during the blocking RPC , consider whether a keyboard interrupt should prevent those calls from being run . An async request will enqueue logic on Neovim 's event loop instead of blocking . Importantly , the state of the editor may have changed between the time the async request was made and the time Neovim process any of its logic . be called from Neovim via [rpcrequest] and [rpcnotify] respectively. This is achieved by adding a listener to the Neovim msgpack_rpc bus. A blocking request will block Neovim from processing user input or communication over other channels until a response is returned. Neovim will continue to process calls sent over the same channel while a blocking request is in flight, which means nested calls are supported. When the user presses Ctrl-C to interrupt a blocking call, [keyboard_interrupted] will be determined. Use that to run any necessary cleanup. If you call back into Neovim during the blocking RPC, consider whether a keyboard interrupt should prevent those calls from being run. An async request will enqueue logic on Neovim's event loop instead of blocking. Importantly, the state of the editor may have changed between the time the async request was made and the time Neovim process any of its logic. *) val register_request_blocking : _ Client.t -> name:string -> type_:('fn, 'leftmost) Defun.Ocaml.Sync.t -> f:(keyboard_interrupted:unit Deferred.t -> client:[ `connected ] Client.t -> 'fn) -> unit val register_request_async : _ Client.t -> name:string -> type_:'fn Defun.Ocaml.Async.t -> f:(client:[ `connected ] Client.t -> 'fn) -> unit module Expert : sig module Notifier = Notifier end (* These functions are exported solely for the vcaml_plugin library's use. Clients should not call them. *) module Private : sig val register_request_blocking : _ Client.t -> name:string -> type_:('fn, 'leftmost) Defun.Ocaml.Sync.t -> f:(keyboard_interrupted:unit Deferred.t -> client:[ `connected ] Client.t -> 'fn) -> wrap_f:((unit -> Msgpack.t Deferred.Or_error.t) -> Msgpack.t Deferred.Or_error.t) -> unit val register_request_async : _ Client.t -> name:string -> type_:'fn Defun.Ocaml.Async.t -> f:(client:[ `connected ] Client.t -> 'fn) -> wrap_f:((unit -> unit Deferred.Or_error.t) -> unit Deferred.Or_error.t) -> unit end
null
https://raw.githubusercontent.com/janestreet/vcaml/b02fc56c48746fa18a6bc9a0f8fb85776db76977/src/vcaml.mli
ocaml
Default: [true] * Close the client and release the underlying file descriptors. Can be called safely multiple times. * Wraps a [Type.t] to be used as the rightmost (return) type of this function. These functions are exported solely for the vcaml_plugin library's use. Clients should not call them.
module Unshadow_buffer := Buffer module Unshadow_command := Command open Core open Async module Api_version = Nvim_internal.Api_version module Buffer = Unshadow_buffer module Channel_info = Channel_info module Client_info = Client_info module Color = Color module Command = Unshadow_command module Error_type = Nvim_internal.Error_type module Highlighted_text = Highlighted_text module Keymap = Keymap module Mark = Mark module Mode = Mode module Namespace = Namespace module Nvim = Nvim module Position = Position module Tabpage = Tabpage module Type = Nvim_internal.Phantom module Ui = Ui module Vcaml_error = Vcaml_error module Window = Window * API version for which this library is built ( not the same as the Neovim version ) . val api_version : Api_version.t * [ Msgpack.pp ] with support for extensions . val pp : Formatter.t -> Msgpack.t -> unit module Nvim_version : sig include Semantic_version.S val vcaml : t end module Client : sig type 'state t = 'state Client.t * [ on_error ] is invoked when VCaml fails to parse a response from Neovim and when sends us an asynchronous error event to inform us that it encountered a problem with a message we sent . Neovim sends us an asynchronous error event to inform us that it encountered a problem with a message we sent. *) val create : on_error:[ `Raise | `Call of Vcaml_error.t -> unit ] -> [ `not_connected ] t * A value of type [ Connection_type.t ] describes the type of connection to use , along with the information necessary to connect to Neovim . With a [ Unix ] connection , the plugin communicates with Neovim over the unix domain socket it uses to serve RPC requests . [ Unix ` Child ] should be used if the plugin is launched from within Neovim ; if it is launched independently a path to the socket will need to be provided . With a [ Stdio ] connection , the plugin communicates with Neovim using its own stdin and stdout ( which means stdout can not be used for logging ) . This connection type should only be used if the plugin is launched from Neovim with [ jobstart ] with [ rpc:1 ] in [ opts ] . [ Stdio ] connections are useful for synchronous , " one - shot " plugins where you want to synchronously start the process , communicate with Neovim , and shut down . To make this work , after starting the plugin , issue an [ rpcrequest ] , which will cause Neovim to block . The plugin should register the requested RPC before connecting to Neovim to ensure the RPC is defined at the time Neovim 's request is handled . After handling the request , the plugin should shut down . If you tried to do this with a [ Unix ] connection then after the process is launched you would need to create a new channel but Neovim ca n't do that while in the middle of processing whatever logic it 's currently executing that launched the process . To achieve synchronicity in this way you 'd need a continuation - after launching the process you 'd need to yield to the event loop so the channel could be established , and then the plugin would need to invoke a callback in Neovim to continue . The [ Embed ] connection is the inverse of the [ Stdio ] connection - instead of the OCaml app being launched by Neovim , Neovim is launched by the OCaml app . Just as in a [ Stdio ] connection the app 's stdin and stdout are used for RPC communication , here Neovim 's stdin and stdout are used to communicate with the embedding process . [ Embed ] is most useful for testing and for graphical applications that want to embed Neovim for editing text . When [ Embed ] is used the [ --embed ] flag must be passed in [ args ] . with the information necessary to connect to Neovim. With a [Unix] connection, the plugin communicates with Neovim over the unix domain socket it uses to serve RPC requests. [Unix `Child] should be used if the plugin is launched from within Neovim; if it is launched independently a path to the socket will need to be provided. With a [Stdio] connection, the plugin communicates with Neovim using its own stdin and stdout (which means stdout cannot be used for logging). This connection type should only be used if the plugin is launched from Neovim with [jobstart] with [rpc:1] in [opts]. [Stdio] connections are useful for synchronous, "one-shot" plugins where you want to synchronously start the process, communicate with Neovim, and shut down. To make this work, after starting the plugin, issue an [rpcrequest], which will cause Neovim to block. The plugin should register the requested RPC before connecting to Neovim to ensure the RPC is defined at the time Neovim's request is handled. After handling the request, the plugin should shut down. If you tried to do this with a [Unix] connection then after the process is launched you would need to create a new channel but Neovim can't do that while in the middle of processing whatever logic it's currently executing that launched the process. To achieve synchronicity in this way you'd need a continuation - after launching the process you'd need to yield to the event loop so the channel could be established, and then the plugin would need to invoke a callback in Neovim to continue. The [Embed] connection is the inverse of the [Stdio] connection - instead of the OCaml app being launched by Neovim, Neovim is launched by the OCaml app. Just as in a [Stdio] connection the app's stdin and stdout are used for RPC communication, here Neovim's stdin and stdout are used to communicate with the embedding process. [Embed] is most useful for testing and for graphical applications that want to embed Neovim for editing text. When [Embed] is used the [--embed] flag must be passed in [args]. *) module Connection_type : sig type _ t = | Unix : [ `Child | `Socket of string ] -> [ `connected ] Client.t t | Stdio : [ `connected ] Client.t t | Embed : { prog : string ; args : string list ; working_dir : string ; env : Core_unix.env } -> ([ `connected ] Client.t * Async.Process.t) t end * Attach to Neovim over an RPC channel . Once [ attach ] is called Neovim can start sending RPC requests and notifications , so handlers should be registered in advance with [ register_request_async ] and [ register_request_blocking ] as needed . Registering more handlers after attaching is allowed . Calling [ attach ] twice will raise . sending RPC requests and notifications, so handlers should be registered in advance with [register_request_async] and [register_request_blocking] as needed. Registering more handlers after attaching is allowed. Calling [attach] twice will raise. *) val attach -> [ `not_connected ] t -> 'a Connection_type.t -> time_source:Time_source.t -> 'a Deferred.Or_error.t val close : [ `connected ] t -> unit Deferred.t * Returns Neovim 's i d for the channel over which Neovim and the client communicate . This can be useful when you want to set an autocmd or key mapping that issues an [ rcprequest ] or [ rpcnotify ] when triggered , since these functions requre the channel i d as an argument . This can be useful when you want to set an autocmd or key mapping that issues an [rcprequest] or [rpcnotify] when triggered, since these functions requre the channel id as an argument. *) val channel : [ `connected ] t -> int end * A [ ' a Api_call.t ] is a thunked call to neovim returning a - encoded [ ' a ] . No RPC traffic is generated until an [ Api_call.t ] is invoked via [ run ] or [ run_join ] . [ Api_call.t ] 's can be manipulated with an applicative - like interface . A good mental model is that invoking a [ ' a Api_call.t ] should cause exactly one RPC message to be sent to the neovim client , and that any operations within will not be interrupted . Calls with side effects will occur in the order written , so { [ let%map _ a = a and _ b = b in ( ) ] } will cause Neovim to first run [ a ] and then [ b ] . This is important for applications that rely on manipulating neovim 's internal state . In particular , the atomicity guarantee prevents races with other pending operations , including user input . You can run an [ Api_call.t ] with [ run ] or [ run_join ] . traffic is generated until an [Api_call.t] is invoked via [run] or [run_join]. [Api_call.t]'s can be manipulated with an applicative-like interface. A good mental model is that invoking a ['a Api_call.t] should cause exactly one RPC message to be sent to the neovim client, and that any operations within will not be interrupted. Calls with side effects will occur in the order written, so {[ let%map _a = a and _b = b in () ]} will cause Neovim to first run [a] and then [b]. This is important for applications that rely on manipulating neovim's internal state. In particular, the atomicity guarantee prevents races with other pending operations, including user input. You can run an [Api_call.t] with [run] or [run_join]. *) module Api_call : sig include Applicative.S with type 'a t = 'a Api_call.t include Applicative.Let_syntax with type 'a t := 'a Api_call.t module Or_error = Api_call.Or_error end val run : Source_code_position.t -> [ `connected ] Client.t -> 'a Api_call.t -> 'a Deferred.Or_error.t val run_join : Source_code_position.t -> [ `connected ] Client.t -> 'a Api_call.Or_error.t -> 'a Deferred.Or_error.t module Defun : sig * A [ Defun . Vim.t ] value is a reified value corresponding to the type of a function . It is used by [ wrap_viml_function ] to produce a regular ocaml function of the correct type . Important notes about [ Nil ] : 1 . If you are wrapping a function that takes no arguments , just use [ return T ] . Do not use [ Nil @- > return T ] . 2 . If you are wrapping a native ( non - API ) Vimscript function that does not have an explicit return statement , its implicit return is [ Integer 0 ] , not [ Nil ] . is used by [wrap_viml_function] to produce a regular ocaml function of the correct type. Important notes about [Nil]: 1. If you are wrapping a function that takes no arguments, just use [return T]. Do not use [Nil @-> return T]. 2. If you are wrapping a native (non-API) Vimscript function that does not have an explicit return statement, its implicit return is [Integer 0], not [Nil]. *) module Vim : sig type ('f, 'leftmost_input, 'out) t val return : 'a Type.t -> ('a Api_call.Or_error.t, unit, 'a) t * Add an extra argument to an existing function arity . Using this operator , function types will look extremely closely to how the underlying OCaml type will end up . For example , a Vim function with ( OCaml ) type [ int - > string - > int - > buffer ] would use the arity [ Integer @- > String @- > Integer @- > return Buffer ] . Using this operator, function types will look extremely closely to how the underlying OCaml type will end up. For example, a Vim function with (OCaml) type [int -> string -> int -> buffer] would use the arity [Integer @-> String @-> Integer @-> return Buffer]. *) val ( @-> ) : 'a Type.t -> ('b, _, 'output) t -> ('a -> 'b, 'a, 'output) t end * [ Defun . Ocaml ] is analogous to [ Defun . Vim ] , except used to specify OCaml - defined functions callable from neovim . See [ register_request_blocking ] and [ register_request_async ] below for usage . functions callable from neovim. See [register_request_blocking] and [register_request_async] below for usage. *) module Ocaml : sig module Sync : sig type ('f, 'leftmost_input) t val return : 'a Type.t -> ('a Deferred.Or_error.t, unit) t val ( @-> ) : 'a Type.t -> ('b, _) t -> ('a -> 'b, 'a) t module Expert : sig * Supports the rare case of interoperating with a Vimscript function that takes a callback that takes a variable number of arguments . a callback that takes a variable number of arguments. *) val varargs : args_type:'a Type.t -> return_type:'b Type.t -> ('a list -> 'b Deferred.Or_error.t, 'a list) t end end module Async : sig type 'f t val unit : unit Deferred.Or_error.t t val ( @-> ) : 'a Type.t -> 'b t -> ('a -> 'b) t module Expert : sig val varargs : 'a Type.t -> ('a list -> unit Deferred.Or_error.t) t end end end end * Given the name of a function available in Vimscript ( VimL ) along with its arity ( see [ Defun . Vim ] ) , return a regularly - typed OCaml function that calls said function . This is intended for client authors to delegate work back to Neovim , possibly to call an existing Vimscript function . Before reaching for this function , please check the functions available in [ Nvim ] , [ Buffer ] , [ Window ] and [ Tabpage ] to see that the functionality you intend to wrap is n't directly exposed in the API . [Defun.Vim]), return a regularly-typed OCaml function that calls said function. This is intended for client authors to delegate work back to Neovim, possibly to call an existing Vimscript function. Before reaching for this function, please check the functions available in [Nvim], [Buffer], [Window] and [Tabpage] to see that the functionality you intend to wrap isn't directly exposed in the API. *) val wrap_viml_function : type_:('fn, 'leftmost, 'out) Defun.Vim.t -> function_name:string -> 'fn * [ register_request_blocking ] and [ register_request_async ] register functions that can be called from Neovim via [ rpcrequest ] and [ rpcnotify ] respectively . This is achieved by adding a listener to the Neovim msgpack_rpc bus . A blocking request will block Neovim from processing user input or communication over other channels until a response is returned . Neovim will continue to process calls sent over the same channel while a blocking request is in flight , which means nested calls are supported . When the user presses Ctrl - C to interrupt a blocking call , [ keyboard_interrupted ] will be determined . Use that to run any necessary cleanup . If you call back into Neovim during the blocking RPC , consider whether a keyboard interrupt should prevent those calls from being run . An async request will enqueue logic on Neovim 's event loop instead of blocking . Importantly , the state of the editor may have changed between the time the async request was made and the time Neovim process any of its logic . be called from Neovim via [rpcrequest] and [rpcnotify] respectively. This is achieved by adding a listener to the Neovim msgpack_rpc bus. A blocking request will block Neovim from processing user input or communication over other channels until a response is returned. Neovim will continue to process calls sent over the same channel while a blocking request is in flight, which means nested calls are supported. When the user presses Ctrl-C to interrupt a blocking call, [keyboard_interrupted] will be determined. Use that to run any necessary cleanup. If you call back into Neovim during the blocking RPC, consider whether a keyboard interrupt should prevent those calls from being run. An async request will enqueue logic on Neovim's event loop instead of blocking. Importantly, the state of the editor may have changed between the time the async request was made and the time Neovim process any of its logic. *) val register_request_blocking : _ Client.t -> name:string -> type_:('fn, 'leftmost) Defun.Ocaml.Sync.t -> f:(keyboard_interrupted:unit Deferred.t -> client:[ `connected ] Client.t -> 'fn) -> unit val register_request_async : _ Client.t -> name:string -> type_:'fn Defun.Ocaml.Async.t -> f:(client:[ `connected ] Client.t -> 'fn) -> unit module Expert : sig module Notifier = Notifier end module Private : sig val register_request_blocking : _ Client.t -> name:string -> type_:('fn, 'leftmost) Defun.Ocaml.Sync.t -> f:(keyboard_interrupted:unit Deferred.t -> client:[ `connected ] Client.t -> 'fn) -> wrap_f:((unit -> Msgpack.t Deferred.Or_error.t) -> Msgpack.t Deferred.Or_error.t) -> unit val register_request_async : _ Client.t -> name:string -> type_:'fn Defun.Ocaml.Async.t -> f:(client:[ `connected ] Client.t -> 'fn) -> wrap_f:((unit -> unit Deferred.Or_error.t) -> unit Deferred.Or_error.t) -> unit end
77279677c720d7471fa1748beb7091a17863ff034d928d540b636882e2cf0eda
softwarelanguageslab/maf
fjt-seq.scm
Adapted from Savina benchmarks ( " Fork Join ( throughput ) " benchmark , coming from JGF ) (letrec ((N 10) (A 3) (perform-computation (lambda (theta) (let ((sint (+ 1 theta))) (* sint sint)))) (throughput-actor (actor "throughput" (processed) (message () (perform-computation 37.2) (if (= (+ processed 1) N) (terminate) (become throughput-actor (+ processed 1)))))) (actors (vector (create throughput-actor 0) (create throughput-actor 0) (create throughput-actor 0))) (vector-foreach (lambda (f v) (letrec ((loop (lambda (i) (if (< i (vector-length v)) (begin (f (vector-ref v i)) (loop (+ i 1))) 'done)))) (loop 0)))) (loop (lambda (n) (if (= n N) 'done (begin (vector-foreach (lambda (a) (send a message)) actors) (loop (+ n 1))))))) (loop 0))
null
https://raw.githubusercontent.com/softwarelanguageslab/maf/be58e02c63d25cab5b48fdf7b737b68b882e9dca/test/concurrentScheme/actors/contracts/savina/fjt-seq.scm
scheme
Adapted from Savina benchmarks ( " Fork Join ( throughput ) " benchmark , coming from JGF ) (letrec ((N 10) (A 3) (perform-computation (lambda (theta) (let ((sint (+ 1 theta))) (* sint sint)))) (throughput-actor (actor "throughput" (processed) (message () (perform-computation 37.2) (if (= (+ processed 1) N) (terminate) (become throughput-actor (+ processed 1)))))) (actors (vector (create throughput-actor 0) (create throughput-actor 0) (create throughput-actor 0))) (vector-foreach (lambda (f v) (letrec ((loop (lambda (i) (if (< i (vector-length v)) (begin (f (vector-ref v i)) (loop (+ i 1))) 'done)))) (loop 0)))) (loop (lambda (n) (if (= n N) 'done (begin (vector-foreach (lambda (a) (send a message)) actors) (loop (+ n 1))))))) (loop 0))
e30f60e71558cf501e974fc4f3fddb5648dcc68d3e69574d9d133fbcc23f548f
slipstream/SlipStreamServer
module_component.cljc
(ns com.sixsq.slipstream.ssclj.resources.spec.module-component (:require [clojure.spec.alpha :as s] [com.sixsq.slipstream.ssclj.resources.spec.common :as c] [com.sixsq.slipstream.ssclj.resources.spec.core :as cimi-core] [com.sixsq.slipstream.ssclj.resources.spec.module :as module] [com.sixsq.slipstream.ssclj.util.spec :as su])) (s/def ::commit ::cimi-core/nonblank-string) (s/def ::author ::cimi-core/nonblank-string) (s/def ::parentModule ::module/link) (s/def ::cpu nat-int?) (s/def ::ram nat-int?) (s/def ::disk nat-int?) (s/def ::volatileDisk nat-int?) (s/def ::networkType #{"public" "private"}) (s/def ::ports (s/coll-of ::cimi-core/nonblank-string :min-count 1 :kind vector?)) (s/def ::mounts (s/coll-of ::cimi-core/nonblank-string :min-count 1 :kind vector?)) ;; parameter keywords are used in components and application parameter mappings (def ^:const parameter-name-regex #"^[a-zA-Z0-9]+([-_\.:][a-zA-Z0-9]*)*$") (s/def ::parameter (s/and string? #(re-matches parameter-name-regex %))) (s/def ::description ::cimi-core/nonblank-string) (s/def ::value ::cimi-core/nonblank-string) (s/def ::parameter-map (su/only-keys :req-un [::parameter] :opt-un [::description ::value])) (s/def ::parameters (s/coll-of ::parameter-map :min-count 1 :kind vector?)) (s/def ::inputParameters ::parameters) (s/def ::outputParameters ::parameters) (s/def ::target ::cimi-core/nonblank-string) (s/def ::package-list (s/coll-of ::cimi-core/nonblank-string :min-count 1 :kind vector?)) (s/def ::preinstall ::target) (s/def ::packages ::package-list) (s/def ::postinstall ::target) (s/def ::deployment ::target) (s/def ::reporting ::target) (s/def ::onVmAdd ::target) (s/def ::onVmRemove ::target) (s/def ::prescale ::target) (s/def ::postscale ::target) (s/def ::targets (su/only-keys :opt-un [::preinstall ::packages ::postinstall ::deployment ::reporting ::onVmAdd ::onVmRemove ::prescale ::postscale])) (def module-component-keys-spec (su/merge-keys-specs [c/common-attrs {:req-un [::parentModule ::networkType ::outputParameters ::author] :opt-un [::inputParameters ::cpu ::ram ::disk ::volatileDisk ::ports ::mounts ::targets ::commit]}])) (s/def ::module-component (su/only-keys-maps module-component-keys-spec))
null
https://raw.githubusercontent.com/slipstream/SlipStreamServer/3ee5c516877699746c61c48fc72779fe3d4e4652/cimi-resources/src/com/sixsq/slipstream/ssclj/resources/spec/module_component.cljc
clojure
parameter keywords are used in components and application parameter mappings
(ns com.sixsq.slipstream.ssclj.resources.spec.module-component (:require [clojure.spec.alpha :as s] [com.sixsq.slipstream.ssclj.resources.spec.common :as c] [com.sixsq.slipstream.ssclj.resources.spec.core :as cimi-core] [com.sixsq.slipstream.ssclj.resources.spec.module :as module] [com.sixsq.slipstream.ssclj.util.spec :as su])) (s/def ::commit ::cimi-core/nonblank-string) (s/def ::author ::cimi-core/nonblank-string) (s/def ::parentModule ::module/link) (s/def ::cpu nat-int?) (s/def ::ram nat-int?) (s/def ::disk nat-int?) (s/def ::volatileDisk nat-int?) (s/def ::networkType #{"public" "private"}) (s/def ::ports (s/coll-of ::cimi-core/nonblank-string :min-count 1 :kind vector?)) (s/def ::mounts (s/coll-of ::cimi-core/nonblank-string :min-count 1 :kind vector?)) (def ^:const parameter-name-regex #"^[a-zA-Z0-9]+([-_\.:][a-zA-Z0-9]*)*$") (s/def ::parameter (s/and string? #(re-matches parameter-name-regex %))) (s/def ::description ::cimi-core/nonblank-string) (s/def ::value ::cimi-core/nonblank-string) (s/def ::parameter-map (su/only-keys :req-un [::parameter] :opt-un [::description ::value])) (s/def ::parameters (s/coll-of ::parameter-map :min-count 1 :kind vector?)) (s/def ::inputParameters ::parameters) (s/def ::outputParameters ::parameters) (s/def ::target ::cimi-core/nonblank-string) (s/def ::package-list (s/coll-of ::cimi-core/nonblank-string :min-count 1 :kind vector?)) (s/def ::preinstall ::target) (s/def ::packages ::package-list) (s/def ::postinstall ::target) (s/def ::deployment ::target) (s/def ::reporting ::target) (s/def ::onVmAdd ::target) (s/def ::onVmRemove ::target) (s/def ::prescale ::target) (s/def ::postscale ::target) (s/def ::targets (su/only-keys :opt-un [::preinstall ::packages ::postinstall ::deployment ::reporting ::onVmAdd ::onVmRemove ::prescale ::postscale])) (def module-component-keys-spec (su/merge-keys-specs [c/common-attrs {:req-un [::parentModule ::networkType ::outputParameters ::author] :opt-un [::inputParameters ::cpu ::ram ::disk ::volatileDisk ::ports ::mounts ::targets ::commit]}])) (s/def ::module-component (su/only-keys-maps module-component-keys-spec))
e15035599a6380b10a4827530ae252656ef43797cb32c43c2bcc29f5c112a1b4
ijvcms/chuanqi_dev
map_20003.erl
-module(map_20003). -export([ range/0, data/0 ]). range() -> {48, 32}. data() -> { {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,0,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,0,0,0,0,1,1,1,1,0,0,0,0,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,0,0,0,0,0,0,0,0,0,0,0,2,0,0,0,0,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,0,0,0,0,0,0,0,0,0,0,0,0,2,2,0,0,0,0,0,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,0,1,1,0,0,0,0,0,0,0,0,0,0,0,0,1,2,0,0,0,0,1,1,0,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1,1,1,1,1,1}, {1,1,1,1,0,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1,1,1,1}, {1,1,1,1,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1,1}, {1,1,1,1,2,0,0,0,0,2,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1}, {1,1,1,1,2,2,0,0,0,2,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1}, {1,1,1,1,1,1,2,2,0,2,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1}, {1,1,1,1,1,1,1,1,2,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,2,2,0,0,0,0,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,2,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,0,0,0,0,0,0,0,0,2,2,0,0,0,0,2,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,2,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,2,0,2,2,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,0,0,0,0,0,2,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,0,0,0,2,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,2,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,2,2,0,0,1,2,0,0,2,0,0,0,0,0,0,2,2,2,2,2,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,2,2,0,0,2,2,2,2,2,0,0,2,2,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,2,2,2,2,2,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1} }.
null
https://raw.githubusercontent.com/ijvcms/chuanqi_dev/7742184bded15f25be761c4f2d78834249d78097/server/trunk/server/src/map_data/map_20003.erl
erlang
-module(map_20003). -export([ range/0, data/0 ]). range() -> {48, 32}. data() -> { {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,0,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,0,0,0,0,1,1,1,1,0,0,0,0,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,0,0,0,0,0,0,0,0,0,0,0,2,0,0,0,0,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,0,0,0,0,0,0,0,0,0,0,0,0,2,2,0,0,0,0,0,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,0,1,1,0,0,0,0,0,0,0,0,0,0,0,0,1,2,0,0,0,0,1,1,0,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1,1,1,1,1,1}, {1,1,1,1,0,0,0,0,0,0,0,0,0,0,0,0,0,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1,1,1,1}, {1,1,1,1,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1,1}, {1,1,1,1,2,0,0,0,0,2,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1}, {1,1,1,1,2,2,0,0,0,2,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1}, {1,1,1,1,1,1,2,2,0,2,1,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1}, {1,1,1,1,1,1,1,1,2,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,2,2,0,0,0,0,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,2,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,0,0,0,0,0,0,0,0,2,2,0,0,0,0,2,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,2,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,2,0,2,2,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,0,0,0,0,0,2,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,0,0,0,2,2,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,2,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,2,2,0,0,1,2,0,0,2,0,0,0,0,0,0,2,2,2,2,2,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,2,2,0,0,2,2,2,2,2,0,0,2,2,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,2,2,2,2,2,2,2,2,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1}, {1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1} }.
4f92ee014a9c4c558f20b5ed1564e9f0eedf43a4338b108267b0273e6ccecaaf
clojure/core.async
ex-async.clj
(require '[clojure.core.async :as async :refer [<!! >!! timeout chan alt!!]]) (defn fake-search [kind] (fn [c query] (future (<!! (timeout (rand-int 100))) (>!! c [kind query])))) (def web1 (fake-search :web1)) (def web2 (fake-search :web2)) (def image1 (fake-search :image1)) (def image2 (fake-search :image2)) (def video1 (fake-search :video1)) (def video2 (fake-search :video2)) (defn fastest [query & replicas] (let [c (chan)] (doseq [replica replicas] (replica c query)) c)) (defn google [query] (let [c (chan) t (timeout 80)] (future (>!! c (<!! (fastest query web1 web2)))) (future (>!! c (<!! (fastest query image1 image2)))) (future (>!! c (<!! (fastest query video1 video2)))) (loop [i 0 ret []] (if (= i 3) ret (recur (inc i) (conj ret (alt!! [c t] ([v] v)))))))) (google "clojure")
null
https://raw.githubusercontent.com/clojure/core.async/edc3e16c034106f06e861ffbf91ba0ea87107208/examples/ex-async.clj
clojure
(require '[clojure.core.async :as async :refer [<!! >!! timeout chan alt!!]]) (defn fake-search [kind] (fn [c query] (future (<!! (timeout (rand-int 100))) (>!! c [kind query])))) (def web1 (fake-search :web1)) (def web2 (fake-search :web2)) (def image1 (fake-search :image1)) (def image2 (fake-search :image2)) (def video1 (fake-search :video1)) (def video2 (fake-search :video2)) (defn fastest [query & replicas] (let [c (chan)] (doseq [replica replicas] (replica c query)) c)) (defn google [query] (let [c (chan) t (timeout 80)] (future (>!! c (<!! (fastest query web1 web2)))) (future (>!! c (<!! (fastest query image1 image2)))) (future (>!! c (<!! (fastest query video1 video2)))) (loop [i 0 ret []] (if (= i 3) ret (recur (inc i) (conj ret (alt!! [c t] ([v] v)))))))) (google "clojure")
e357ca830a1da35f5a85da475df29f12b9b60d650073e5983a7a2d8c16c57008
OCamlPro/freeton_ocaml_sdk
ton_abi.mli
(**************************************************************************) (* *) Copyright ( c ) 2021 OCamlPro SAS (* *) (* All rights reserved. *) (* This file is distributed under the terms of the GNU Lesser General *) Public License version 2.1 , with the special exception on linking (* described in the LICENSE.md file in the root directory. *) (* *) (* *) (**************************************************************************) val read : string -> Ton_types.AbiContract.t val write : string -> Ton_types.AbiContract.t -> unit
null
https://raw.githubusercontent.com/OCamlPro/freeton_ocaml_sdk/42a0d95252ed19c647fa86e9728af15d557fc5e3/src/freeton_base_lib/ton_abi.mli
ocaml
************************************************************************ All rights reserved. This file is distributed under the terms of the GNU Lesser General described in the LICENSE.md file in the root directory. ************************************************************************
Copyright ( c ) 2021 OCamlPro SAS Public License version 2.1 , with the special exception on linking val read : string -> Ton_types.AbiContract.t val write : string -> Ton_types.AbiContract.t -> unit
af371d15686741e68c314c0f5f0e8ccffb378ce7ad85b9a51ecd2eb6578285e7
ghcjs/ghcjs-boot
Types.hs
# LANGUAGE MagicHash , NoImplicitPrelude , TypeFamilies , UnboxedTuples , RoleAnnotations # RoleAnnotations #-} ----------------------------------------------------------------------------- -- | -- Module : GHC.Types Copyright : ( c ) The University of Glasgow 2009 License : see libraries / ghc - prim / LICENSE -- -- Maintainer : -- Stability : internal Portability : non - portable ( GHC Extensions ) -- GHC type definitions . -- Use GHC.Exts from the base package instead of importing this -- module directly. -- ----------------------------------------------------------------------------- module GHC.Types ( Bool(..), Char(..), Int(..), Word(..), Float(..), Double(..), Ordering(..), IO(..), isTrue#, SPEC(..), Coercible, ) where import GHC.Prim infixr 5 : data [] a = [] | a : [a] # CTYPE " HsBool " # | The character type ' ' is an enumeration whose values represent ( or equivalently ISO\/IEC 10646 ) characters ( see < / > for details ) . This set extends the ISO 8859 - 1 ( Latin-1 ) character set ( the first 256 characters ) , which is itself an extension of the ASCII character set ( the first 128 characters ) . A character literal in has type ' ' . To convert a ' ' to or from the corresponding ' Int ' value defined by Unicode , use ' Prelude.toEnum ' and ' Prelude.fromEnum ' from the ' Prelude . ' class respectively ( or equivalently ' ord ' and ' chr ' ) . Unicode (or equivalently ISO\/IEC 10646) characters (see </> for details). This set extends the ISO 8859-1 (Latin-1) character set (the first 256 characters), which is itself an extension of the ASCII character set (the first 128 characters). A character literal in Haskell has type 'Char'. To convert a 'Char' to or from the corresponding 'Int' value defined by Unicode, use 'Prelude.toEnum' and 'Prelude.fromEnum' from the 'Prelude.Enum' class respectively (or equivalently 'ord' and 'chr'). -} data {-# CTYPE "HsChar" #-} Char = C# Char# | A fixed - precision integer type with at least the range @[-2 ^ 29 .. 2 ^ 29 - 1]@. -- The exact range for a given implementation can be determined by using ' Prelude.minBound ' and ' Prelude.maxBound ' from the ' Prelude . Bounded ' class . # CTYPE " HsInt " # -- |A 'Word' is an unsigned integral type, with the same size as 'Int'. # CTYPE " HsWord " # -- | Single-precision floating point numbers. -- It is desirable that this type be at least equal in range and precision to the IEEE single - precision type . data {-# CTYPE "HsFloat" #-} Float = F# Float# -- | Double-precision floating point numbers. -- It is desirable that this type be at least equal in range and precision to the IEEE double - precision type . # CTYPE " " # data Ordering = LT | EQ | GT | A value of type @'IO ' a@ is a computation which , when performed , does some I\/O before returning a value of type There is really only one way to \"perform\ " an I\/O action : bind it to @Main.main@ in your program . When your program is run , the I\/O will be performed . It is n't possible to perform I\/O from an arbitrary function , unless that function is itself in the ' IO ' monad and called at some point , directly or indirectly , from ' IO ' is a monad , so ' IO ' actions can be combined using either the do - notation or the ' > > ' and ' > > = ' operations from the ' Monad ' class . A value of type @'IO' a@ is a computation which, when performed, does some I\/O before returning a value of type @a@. There is really only one way to \"perform\" an I\/O action: bind it to @Main.main@ in your program. When your program is run, the I\/O will be performed. It isn't possible to perform I\/O from an arbitrary function, unless that function is itself in the 'IO' monad and called at some point, directly or indirectly, from @Main.main@. 'IO' is a monad, so 'IO' actions can be combined using either the do-notation or the '>>' and '>>=' operations from the 'Monad' class. -} newtype IO a = IO (State# RealWorld -> (# State# RealWorld, a #)) type role IO representational The above role annotation is redundant but is included because this role is significant in the normalisation of FFI types . Specifically , if this role were to become nominal ( which would be very strange , indeed ! ) , changes elsewhere in GHC would be necessary . See [ FFI type roles ] in TcForeign . The above role annotation is redundant but is included because this role is significant in the normalisation of FFI types. Specifically, if this role were to become nominal (which would be very strange, indeed!), changes elsewhere in GHC would be necessary. See [FFI type roles] in TcForeign. -} Note [ Kind - changing of ( ~ ) and Coercible ] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ( ~ ) and Coercible are tricky to define . To the user , they must appear as constraints , but we can not define them as such in Haskell . But we also can not just define them only in GHC.Prim ( like ( - > ) ) , because we need a real module for them , e.g. to compile the constructor 's info table . Furthermore the type of MkCoercible can not be written in Haskell ( no syntax for ~#R ) . So we define them as regular data types in GHC.Types , and do magic in TysWiredIn , inside GHC , to change the kind and type . Note [Kind-changing of (~) and Coercible] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ (~) and Coercible are tricky to define. To the user, they must appear as constraints, but we cannot define them as such in Haskell. But we also cannot just define them only in GHC.Prim (like (->)), because we need a real module for them, e.g. to compile the constructor's info table. Furthermore the type of MkCoercible cannot be written in Haskell (no syntax for ~#R). So we define them as regular data types in GHC.Types, and do magic in TysWiredIn, inside GHC, to change the kind and type. -} -- | A data constructor used to box up all unlifted equalities -- The type constructor is special in that GHC pretends that it -- has kind (? -> ? -> Fact) rather than (* -> * -> *) data (~) a b = Eq# ((~#) a b) | This two - parameter class has instances for types @a@ and if -- the compiler can infer that they have the same representation. This class -- does not have regular instances; instead they are created on-the-fly during -- type-checking. Trying to manually declare an instance of @Coercible@ -- is an error. -- Nevertheless one can pretend that the following three kinds of instances exist . First , as a trivial base - case : -- -- @instance a a@ -- -- Furthermore, for every type constructor there is -- an instance that allows to coerce under the type constructor. For example , let @D@ be a prototypical type constructor ( @data@ or @newtype@ ) with three type arguments , which have roles @nominal@ , -- @representational@ resp. @phantom@. Then there is an instance of -- the form -- @instance Coercible b b\ ' = > Coercible ( D a b c ) ( D a b\ ' c\')@ -- -- Note that the @nominal@ type arguments are equal, the -- @representational@ type arguments can differ, but need to have a -- @Coercible@ instance themself, and the @phantom@ type arguments can be -- changed arbitrarily. -- The third kind of instance exists for every @newtype NT = MkNT T@ and comes in two variants , namely -- @instance Coercible a T = > Coercible a NT@ -- -- @instance Coercible T b => Coercible NT b@ -- -- This instance is only usable if the constructor @MkNT@ is in scope. -- -- If, as a library author of a type constructor like @Set a@, you -- want to prevent a user of your module to write -- @coerce :: Set T -> Set NT@, you need to set the role of @Set@\ 's type parameter to @nominal@ , -- by writing -- -- @type role Set nominal@ -- -- For more details about this feature, please refer to -- </~eir/papers/2014/coercible/coercible.pdf Safe Coercions> by , , and . -- -- @since 4.7.0.0 data Coercible a b = MkCoercible ((~#) a b) -- It's really ~R# (representational equality), not ~#, but * we do n't yet have syntax for ~R # , -- * the compiled code is the same either way -- * TysWiredIn has the truthful types -- Also see Note [Kind-changing of (~) and Coercible] | for ' tagToEnum # ' . Returns True if its parameter is 1 # and False -- if it is 0#. # INLINE isTrue # # isTrue# :: Int# -> Bool -- See Note [Optimizing isTrue#] isTrue# x = tagToEnum# x -- Note [Optimizing isTrue#] -- ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -- -- Current definition of isTrue# is a temporary workaround. We would like to -- have functions isTrue# and isFalse# defined like this: -- -- isTrue# :: Int# -> Bool -- isTrue# 1# = True -- isTrue# _ = False -- -- isFalse# :: Int# -> Bool isFalse # 0 # = True -- isFalse# _ = False -- -- These functions would allow us to safely check if a tag can represent True -- or False. Using isTrue# and isFalse# as defined above will not introduce -- additional case into the code. When we scrutinize return value of isTrue# -- or isFalse#, either explicitly in a case expression or implicitly in a guard, -- the result will always be a single case expression (given that optimizations -- are turned on). This results from case-of-case transformation. Consider this code ( this is both valid and ): -- -- case isTrue# (a ># b) of -- True -> e1 -- False -> e2 -- -- Inlining isTrue# gives: -- -- case (case (a ># b) of { 1# -> True; _ -> False } ) of -- True -> e1 -- False -> e2 -- -- Case-of-case transforms that to: -- -- case (a ># b) of -- 1# -> case True of -- True -> e1 -- False -> e2 -- _ -> case False of -- True -> e1 -- False -> e2 -- -- Which is then simplified by case-of-known-constructor: -- -- case (a ># b) of -- 1# -> e1 -- _ -> e2 -- While we get good Core here , the code generator will generate very bad Cmm -- if e1 or e2 do allocation. It will push heap checks into case alternatives which results in about 2.5 % increase in code size . Until this is improved we -- just make isTrue# an alias to tagToEnum#. This is a temporary solution (if you 're reading this in 2023 then things went wrong ) . See # 8326 . -- | ' SPEC ' is used by GHC in the @SpecConstr@ pass in order to inform -- the compiler when to be particularly aggressive. In particular, it tells GHC to specialize regardless of size or the number of -- specializations. However, not all loops fall into this category. -- -- Libraries can specify this by using 'SPEC' data type to inform which -- loops should be aggressively specialized. data SPEC = SPEC | SPEC2
null
https://raw.githubusercontent.com/ghcjs/ghcjs-boot/8c549931da27ba9e607f77195208ec156c840c8a/boot/ghc-prim/GHC/Types.hs
haskell
--------------------------------------------------------------------------- | Module : GHC.Types Maintainer : Stability : internal Use GHC.Exts from the base package instead of importing this module directly. --------------------------------------------------------------------------- # CTYPE "HsChar" # The exact range for a given implementation can be determined by using |A 'Word' is an unsigned integral type, with the same size as 'Int'. | Single-precision floating point numbers. It is desirable that this type be at least equal in range and precision # CTYPE "HsFloat" # | Double-precision floating point numbers. It is desirable that this type be at least equal in range and precision | A data constructor used to box up all unlifted equalities has kind (? -> ? -> Fact) rather than (* -> * -> *) the compiler can infer that they have the same representation. This class does not have regular instances; instead they are created on-the-fly during type-checking. Trying to manually declare an instance of @Coercible@ is an error. @instance a a@ Furthermore, for every type constructor there is an instance that allows to coerce under the type constructor. For @representational@ resp. @phantom@. Then there is an instance of the form Note that the @nominal@ type arguments are equal, the @representational@ type arguments can differ, but need to have a @Coercible@ instance themself, and the @phantom@ type arguments can be changed arbitrarily. @instance Coercible T b => Coercible NT b@ This instance is only usable if the constructor @MkNT@ is in scope. If, as a library author of a type constructor like @Set a@, you want to prevent a user of your module to write @coerce :: Set T -> Set NT@, by writing @type role Set nominal@ For more details about this feature, please refer to </~eir/papers/2014/coercible/coercible.pdf Safe Coercions> @since 4.7.0.0 It's really ~R# (representational equality), not ~#, * the compiled code is the same either way * TysWiredIn has the truthful types Also see Note [Kind-changing of (~) and Coercible] if it is 0#. See Note [Optimizing isTrue#] Note [Optimizing isTrue#] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Current definition of isTrue# is a temporary workaround. We would like to have functions isTrue# and isFalse# defined like this: isTrue# :: Int# -> Bool isTrue# 1# = True isTrue# _ = False isFalse# :: Int# -> Bool isFalse# _ = False These functions would allow us to safely check if a tag can represent True or False. Using isTrue# and isFalse# as defined above will not introduce additional case into the code. When we scrutinize return value of isTrue# or isFalse#, either explicitly in a case expression or implicitly in a guard, the result will always be a single case expression (given that optimizations are turned on). This results from case-of-case transformation. Consider this case isTrue# (a ># b) of True -> e1 False -> e2 Inlining isTrue# gives: case (case (a ># b) of { 1# -> True; _ -> False } ) of True -> e1 False -> e2 Case-of-case transforms that to: case (a ># b) of 1# -> case True of True -> e1 False -> e2 _ -> case False of True -> e1 False -> e2 Which is then simplified by case-of-known-constructor: case (a ># b) of 1# -> e1 _ -> e2 if e1 or e2 do allocation. It will push heap checks into case alternatives just make isTrue# an alias to tagToEnum#. This is a temporary solution (if the compiler when to be particularly aggressive. In particular, it specializations. However, not all loops fall into this category. Libraries can specify this by using 'SPEC' data type to inform which loops should be aggressively specialized.
# LANGUAGE MagicHash , NoImplicitPrelude , TypeFamilies , UnboxedTuples , RoleAnnotations # RoleAnnotations #-} Copyright : ( c ) The University of Glasgow 2009 License : see libraries / ghc - prim / LICENSE Portability : non - portable ( GHC Extensions ) GHC type definitions . module GHC.Types ( Bool(..), Char(..), Int(..), Word(..), Float(..), Double(..), Ordering(..), IO(..), isTrue#, SPEC(..), Coercible, ) where import GHC.Prim infixr 5 : data [] a = [] | a : [a] # CTYPE " HsBool " # | The character type ' ' is an enumeration whose values represent ( or equivalently ISO\/IEC 10646 ) characters ( see < / > for details ) . This set extends the ISO 8859 - 1 ( Latin-1 ) character set ( the first 256 characters ) , which is itself an extension of the ASCII character set ( the first 128 characters ) . A character literal in has type ' ' . To convert a ' ' to or from the corresponding ' Int ' value defined by Unicode , use ' Prelude.toEnum ' and ' Prelude.fromEnum ' from the ' Prelude . ' class respectively ( or equivalently ' ord ' and ' chr ' ) . Unicode (or equivalently ISO\/IEC 10646) characters (see </> for details). This set extends the ISO 8859-1 (Latin-1) character set (the first 256 characters), which is itself an extension of the ASCII character set (the first 128 characters). A character literal in Haskell has type 'Char'. To convert a 'Char' to or from the corresponding 'Int' value defined by Unicode, use 'Prelude.toEnum' and 'Prelude.fromEnum' from the 'Prelude.Enum' class respectively (or equivalently 'ord' and 'chr'). -} | A fixed - precision integer type with at least the range @[-2 ^ 29 .. 2 ^ 29 - 1]@. ' Prelude.minBound ' and ' Prelude.maxBound ' from the ' Prelude . Bounded ' class . # CTYPE " HsInt " # # CTYPE " HsWord " # to the IEEE single - precision type . to the IEEE double - precision type . # CTYPE " " # data Ordering = LT | EQ | GT | A value of type @'IO ' a@ is a computation which , when performed , does some I\/O before returning a value of type There is really only one way to \"perform\ " an I\/O action : bind it to @Main.main@ in your program . When your program is run , the I\/O will be performed . It is n't possible to perform I\/O from an arbitrary function , unless that function is itself in the ' IO ' monad and called at some point , directly or indirectly , from ' IO ' is a monad , so ' IO ' actions can be combined using either the do - notation or the ' > > ' and ' > > = ' operations from the ' Monad ' class . A value of type @'IO' a@ is a computation which, when performed, does some I\/O before returning a value of type @a@. There is really only one way to \"perform\" an I\/O action: bind it to @Main.main@ in your program. When your program is run, the I\/O will be performed. It isn't possible to perform I\/O from an arbitrary function, unless that function is itself in the 'IO' monad and called at some point, directly or indirectly, from @Main.main@. 'IO' is a monad, so 'IO' actions can be combined using either the do-notation or the '>>' and '>>=' operations from the 'Monad' class. -} newtype IO a = IO (State# RealWorld -> (# State# RealWorld, a #)) type role IO representational The above role annotation is redundant but is included because this role is significant in the normalisation of FFI types . Specifically , if this role were to become nominal ( which would be very strange , indeed ! ) , changes elsewhere in GHC would be necessary . See [ FFI type roles ] in TcForeign . The above role annotation is redundant but is included because this role is significant in the normalisation of FFI types. Specifically, if this role were to become nominal (which would be very strange, indeed!), changes elsewhere in GHC would be necessary. See [FFI type roles] in TcForeign. -} Note [ Kind - changing of ( ~ ) and Coercible ] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ( ~ ) and Coercible are tricky to define . To the user , they must appear as constraints , but we can not define them as such in Haskell . But we also can not just define them only in GHC.Prim ( like ( - > ) ) , because we need a real module for them , e.g. to compile the constructor 's info table . Furthermore the type of MkCoercible can not be written in Haskell ( no syntax for ~#R ) . So we define them as regular data types in GHC.Types , and do magic in TysWiredIn , inside GHC , to change the kind and type . Note [Kind-changing of (~) and Coercible] ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ (~) and Coercible are tricky to define. To the user, they must appear as constraints, but we cannot define them as such in Haskell. But we also cannot just define them only in GHC.Prim (like (->)), because we need a real module for them, e.g. to compile the constructor's info table. Furthermore the type of MkCoercible cannot be written in Haskell (no syntax for ~#R). So we define them as regular data types in GHC.Types, and do magic in TysWiredIn, inside GHC, to change the kind and type. -} The type constructor is special in that GHC pretends that it data (~) a b = Eq# ((~#) a b) | This two - parameter class has instances for types @a@ and if Nevertheless one can pretend that the following three kinds of instances exist . First , as a trivial base - case : example , let @D@ be a prototypical type constructor ( @data@ or @newtype@ ) with three type arguments , which have roles @nominal@ , @instance Coercible b b\ ' = > Coercible ( D a b c ) ( D a b\ ' c\')@ The third kind of instance exists for every @newtype NT = MkNT T@ and comes in two variants , namely @instance Coercible a T = > Coercible a NT@ you need to set the role of @Set@\ 's type parameter to @nominal@ , by , , and . data Coercible a b = MkCoercible ((~#) a b) but * we do n't yet have syntax for ~R # , | for ' tagToEnum # ' . Returns True if its parameter is 1 # and False # INLINE isTrue # # isTrue# x = tagToEnum# x isFalse # 0 # = True code ( this is both valid and ): While we get good Core here , the code generator will generate very bad Cmm which results in about 2.5 % increase in code size . Until this is improved we you 're reading this in 2023 then things went wrong ) . See # 8326 . | ' SPEC ' is used by GHC in the @SpecConstr@ pass in order to inform tells GHC to specialize regardless of size or the number of data SPEC = SPEC | SPEC2
6166e6daf54e8bc9614b0d83acd98bf04e0ca98b463a73b9d7ce297cd92a446c
sionescu/iolib
buffer.lisp
;;;; -*- Mode: Lisp; indent-tabs-mode: nil -*- ;;; ;;; --- Foreign memory buffers. ;;; (in-package :iolib/streams) ;;;; Foreign Buffers (defconstant +bytes-per-iobuf+ (* 4 1024)) ;;; FIXME: make this right ;;; probably not all SIMPLE-ARRAYs are admissible ;;; on all implementations (deftype compatible-lisp-array () '(simple-array * (*))) (defun allocate-iobuf (&optional (size +bytes-per-iobuf+)) (let ((b (%make-iobuf))) (setf (iobuf-data b) (foreign-alloc :uint8 :count size) (iobuf-size b) size) (values b))) (defun free-iobuf (iobuf) (unless (null-pointer-p (iobuf-data iobuf)) (foreign-free (iobuf-data iobuf))) (setf (iobuf-data iobuf) (null-pointer)) (values iobuf)) (defun iobuf-length (iobuf) (- (iobuf-end iobuf) (iobuf-start iobuf))) (defun iobuf-start-pointer (iobuf) (inc-pointer (iobuf-data iobuf) (iobuf-start iobuf))) (defun iobuf-end-pointer (iobuf) (inc-pointer (iobuf-data iobuf) (iobuf-end iobuf))) (defun iobuf-empty-p (iobuf) (= (iobuf-end iobuf) (iobuf-start iobuf))) (defun iobuf-full-p (iobuf) (= (iobuf-end iobuf) (iobuf-size iobuf))) (defun iobuf-end-space-length (iobuf) (- (iobuf-size iobuf) (iobuf-end iobuf))) (defun iobuf-reset (iobuf) (setf (iobuf-start iobuf) 0 (iobuf-end iobuf) 0)) (defun iobuf-peek (iobuf &optional (offset 0)) (bref iobuf (+ (iobuf-start iobuf) offset))) (defun iobuf-copy-data-to-start (iobuf) (declare (type iobuf iobuf)) (isys:memmove (iobuf-data iobuf) (inc-pointer (iobuf-data iobuf) (iobuf-start iobuf)) (iobuf-length iobuf)) (setf (iobuf-end iobuf) (iobuf-length iobuf)) (setf (iobuf-start iobuf) 0)) (defun iobuf-can-fit-slice-p (iobuf start end) (<= (- end start) (iobuf-end-space-length iobuf))) (defun iobuf-append-slice (iobuf array start end) (let ((slice-length (- end start))) (iobuf-copy-from-lisp-array array start iobuf (iobuf-end iobuf) slice-length) (incf (iobuf-end iobuf) slice-length))) BREF , ( SETF BREF ) and BUFFER - COPY * DO NOT * check boundaries ;;; that must be done by their callers (defun bref (iobuf index) (declare (type iobuf iobuf) (type buffer-index index)) (debug-only (assert (not (minusp index)))) (mem-aref (iobuf-data iobuf) :uint8 index)) (defun (setf bref) (octet iobuf index) (declare (type (unsigned-byte 8) octet) (type iobuf iobuf) (type buffer-index index)) (debug-only (assert (>= index 0)) (assert (< index (iobuf-size iobuf)))) (setf (mem-aref (iobuf-data iobuf) :uint8 index) octet)) (defun iobuf-copy-from-lisp-array (src soff dst doff length) (declare (type compatible-lisp-array src) (type iobuf dst) (type buffer-index soff doff length)) (debug-only (assert (>= doff 0)) (assert (>= soff 0)) (assert (<= (+ doff length) (iobuf-size dst)))) (let ((dst-ptr (iobuf-data dst))) (with-pointer-to-vector-data (src-ptr src) (isys:memcpy (inc-pointer dst-ptr doff) (inc-pointer src-ptr soff) length)))) (defun iobuf-copy-into-lisp-array (src soff dst doff length) (declare (type iobuf src) (type compatible-lisp-array dst) (type buffer-index soff doff length)) (debug-only (assert (>= doff 0)) (assert (>= soff 0)) (assert (<= (+ doff length) (length dst)))) (let ((src-ptr (iobuf-data src))) (with-pointer-to-vector-data (dst-ptr dst) (isys:memcpy (inc-pointer dst-ptr doff) (inc-pointer src-ptr soff) length)))) (defun iobuf-pop-octet (iobuf) (declare (type iobuf iobuf)) (debug-only (assert (> (iobuf-length iobuf) 0))) (let ((start (iobuf-start iobuf))) (prog1 (bref iobuf start) (incf (iobuf-start iobuf))))) (defun iobuf-push-octet (iobuf octet) (declare (type iobuf iobuf) (type (unsigned-byte 8) octet)) (debug-only (assert (not (iobuf-full-p iobuf)))) (let ((end (iobuf-end iobuf))) (prog1 (setf (bref iobuf end) octet) (incf (iobuf-end iobuf)))))
null
https://raw.githubusercontent.com/sionescu/iolib/dac715c81db55704db623d8b2cfc399ebcf6175f/src/streams/gray/buffer.lisp
lisp
-*- Mode: Lisp; indent-tabs-mode: nil -*- --- Foreign memory buffers. Foreign Buffers FIXME: make this right probably not all SIMPLE-ARRAYs are admissible on all implementations that must be done by their callers
(in-package :iolib/streams) (defconstant +bytes-per-iobuf+ (* 4 1024)) (deftype compatible-lisp-array () '(simple-array * (*))) (defun allocate-iobuf (&optional (size +bytes-per-iobuf+)) (let ((b (%make-iobuf))) (setf (iobuf-data b) (foreign-alloc :uint8 :count size) (iobuf-size b) size) (values b))) (defun free-iobuf (iobuf) (unless (null-pointer-p (iobuf-data iobuf)) (foreign-free (iobuf-data iobuf))) (setf (iobuf-data iobuf) (null-pointer)) (values iobuf)) (defun iobuf-length (iobuf) (- (iobuf-end iobuf) (iobuf-start iobuf))) (defun iobuf-start-pointer (iobuf) (inc-pointer (iobuf-data iobuf) (iobuf-start iobuf))) (defun iobuf-end-pointer (iobuf) (inc-pointer (iobuf-data iobuf) (iobuf-end iobuf))) (defun iobuf-empty-p (iobuf) (= (iobuf-end iobuf) (iobuf-start iobuf))) (defun iobuf-full-p (iobuf) (= (iobuf-end iobuf) (iobuf-size iobuf))) (defun iobuf-end-space-length (iobuf) (- (iobuf-size iobuf) (iobuf-end iobuf))) (defun iobuf-reset (iobuf) (setf (iobuf-start iobuf) 0 (iobuf-end iobuf) 0)) (defun iobuf-peek (iobuf &optional (offset 0)) (bref iobuf (+ (iobuf-start iobuf) offset))) (defun iobuf-copy-data-to-start (iobuf) (declare (type iobuf iobuf)) (isys:memmove (iobuf-data iobuf) (inc-pointer (iobuf-data iobuf) (iobuf-start iobuf)) (iobuf-length iobuf)) (setf (iobuf-end iobuf) (iobuf-length iobuf)) (setf (iobuf-start iobuf) 0)) (defun iobuf-can-fit-slice-p (iobuf start end) (<= (- end start) (iobuf-end-space-length iobuf))) (defun iobuf-append-slice (iobuf array start end) (let ((slice-length (- end start))) (iobuf-copy-from-lisp-array array start iobuf (iobuf-end iobuf) slice-length) (incf (iobuf-end iobuf) slice-length))) BREF , ( SETF BREF ) and BUFFER - COPY * DO NOT * check boundaries (defun bref (iobuf index) (declare (type iobuf iobuf) (type buffer-index index)) (debug-only (assert (not (minusp index)))) (mem-aref (iobuf-data iobuf) :uint8 index)) (defun (setf bref) (octet iobuf index) (declare (type (unsigned-byte 8) octet) (type iobuf iobuf) (type buffer-index index)) (debug-only (assert (>= index 0)) (assert (< index (iobuf-size iobuf)))) (setf (mem-aref (iobuf-data iobuf) :uint8 index) octet)) (defun iobuf-copy-from-lisp-array (src soff dst doff length) (declare (type compatible-lisp-array src) (type iobuf dst) (type buffer-index soff doff length)) (debug-only (assert (>= doff 0)) (assert (>= soff 0)) (assert (<= (+ doff length) (iobuf-size dst)))) (let ((dst-ptr (iobuf-data dst))) (with-pointer-to-vector-data (src-ptr src) (isys:memcpy (inc-pointer dst-ptr doff) (inc-pointer src-ptr soff) length)))) (defun iobuf-copy-into-lisp-array (src soff dst doff length) (declare (type iobuf src) (type compatible-lisp-array dst) (type buffer-index soff doff length)) (debug-only (assert (>= doff 0)) (assert (>= soff 0)) (assert (<= (+ doff length) (length dst)))) (let ((src-ptr (iobuf-data src))) (with-pointer-to-vector-data (dst-ptr dst) (isys:memcpy (inc-pointer dst-ptr doff) (inc-pointer src-ptr soff) length)))) (defun iobuf-pop-octet (iobuf) (declare (type iobuf iobuf)) (debug-only (assert (> (iobuf-length iobuf) 0))) (let ((start (iobuf-start iobuf))) (prog1 (bref iobuf start) (incf (iobuf-start iobuf))))) (defun iobuf-push-octet (iobuf octet) (declare (type iobuf iobuf) (type (unsigned-byte 8) octet)) (debug-only (assert (not (iobuf-full-p iobuf)))) (let ((end (iobuf-end iobuf))) (prog1 (setf (bref iobuf end) octet) (incf (iobuf-end iobuf)))))
7ea0b5c807b5dc701f555319c3a90e8778f5fd897f3720c6901d9e9dd1c3473b
tkych/lisp-dojo
003.lisp
Last modified : 2013 - 10 - 15 18:58:20 tkych (define-practice :id 003 :name my-last :level 0 :problem " MY-LAST list => cons/null Make function MY-LAST. It returns the last cons of a `list'. If `list' is (), returns (). Examples: (my-last '()) => NIL (my-last '(a b c d)) => (D) (my-last '(a b (c d))) => ((C D)) " :hint nil :solutions " * (defun my-last (lst) (if (endp (rest lst)) lst (my-last (rest lst))))" :reference " * #last" :test-env nil :test ((<=>? (my-last '()) (last '())) (<=>? (my-last '(a b c d)) (last '(a b c d))) (<=>? (my-last '(a b (c d))) (last '(a b (c d))))) )
null
https://raw.githubusercontent.com/tkych/lisp-dojo/ba83d025bc03101eec43ec6be44585d7b076caf6/practices/003.lisp
lisp
Last modified : 2013 - 10 - 15 18:58:20 tkych (define-practice :id 003 :name my-last :level 0 :problem " MY-LAST list => cons/null Make function MY-LAST. It returns the last cons of a `list'. If `list' is (), returns (). Examples: (my-last '()) => NIL (my-last '(a b c d)) => (D) (my-last '(a b (c d))) => ((C D)) " :hint nil :solutions " * (defun my-last (lst) (if (endp (rest lst)) lst (my-last (rest lst))))" :reference " * #last" :test-env nil :test ((<=>? (my-last '()) (last '())) (<=>? (my-last '(a b c d)) (last '(a b c d))) (<=>? (my-last '(a b (c d))) (last '(a b (c d))))) )
42bce414c88dd7b08e779e082b37b52964193fb07d84bcc68c200526e9af91fc
glguy/advent
16.hs
# Language QuasiQuotes , BlockArguments , LambdaCase # | Module : Main Description : Day 16 solution Copyright : ( c ) , 2021 License : ISC Maintainer : < > We 're given facts about a bunch of different /Sues/ and asked to check which one matches what we know about the one true /Sue/. Module : Main Description : Day 16 solution Copyright : (c) Eric Mertens, 2021 License : ISC Maintainer : <> We're given facts about a bunch of different /Sues/ and asked to check which one matches what we know about the one true /Sue/. -} module Main where import Advent.Format (format) main :: IO () main = do input <- [format|2015 16 (Sue %d: (%s: %d)&(, )%n)*|] print [i | (i, props) <- input, matchesClues1 props] print [i | (i, props) <- input, matchesClues2 props] -- | Predicate for properties that match exactly. matchesClues1 :: [(String,Int)] -> Bool matchesClues1 = matcher (const (==)) -- | Predicate like 'matchesClues1' but with special cases for -- /cats/, /trees/, /pomeranians/, and /goldfish/. matchesClues2 :: [(String,Int)] -> Bool matchesClues2 = matcher \case "cats" -> (<) "trees" -> (<) "pomeranians" -> (>) "goldfish" -> (>) _ -> (==) -- | Match a list of properties against the known hints. matcher :: (String -> Int -> Int -> Bool) {- ^ comparison selector -} -> [(String,Int)] {- ^ list of properties -} -> Bool {- ^ properties match clues -} matcher match = all \(prop, memory) -> match prop (clues prop) memory -- | Returns the given hint value for each property. clues :: String -> Int clues "children" = 3 clues "cats" = 7 clues "samoyeds" = 2 clues "pomeranians" = 3 clues "akitas" = 0 clues "vizslas" = 0 clues "goldfish" = 5 clues "trees" = 3 clues "cars" = 2 clues "perfumes" = 1
null
https://raw.githubusercontent.com/glguy/advent/7ab9f9e47208fd5720e36bac33fee2b78d4ec50b/solutions/src/2015/16.hs
haskell
| Predicate for properties that match exactly. | Predicate like 'matchesClues1' but with special cases for /cats/, /trees/, /pomeranians/, and /goldfish/. | Match a list of properties against the known hints. ^ comparison selector ^ list of properties ^ properties match clues | Returns the given hint value for each property.
# Language QuasiQuotes , BlockArguments , LambdaCase # | Module : Main Description : Day 16 solution Copyright : ( c ) , 2021 License : ISC Maintainer : < > We 're given facts about a bunch of different /Sues/ and asked to check which one matches what we know about the one true /Sue/. Module : Main Description : Day 16 solution Copyright : (c) Eric Mertens, 2021 License : ISC Maintainer : <> We're given facts about a bunch of different /Sues/ and asked to check which one matches what we know about the one true /Sue/. -} module Main where import Advent.Format (format) main :: IO () main = do input <- [format|2015 16 (Sue %d: (%s: %d)&(, )%n)*|] print [i | (i, props) <- input, matchesClues1 props] print [i | (i, props) <- input, matchesClues2 props] matchesClues1 :: [(String,Int)] -> Bool matchesClues1 = matcher (const (==)) matchesClues2 :: [(String,Int)] -> Bool matchesClues2 = matcher \case "cats" -> (<) "trees" -> (<) "pomeranians" -> (>) "goldfish" -> (>) _ -> (==) matcher :: matcher match = all \(prop, memory) -> match prop (clues prop) memory clues :: String -> Int clues "children" = 3 clues "cats" = 7 clues "samoyeds" = 2 clues "pomeranians" = 3 clues "akitas" = 0 clues "vizslas" = 0 clues "goldfish" = 5 clues "trees" = 3 clues "cars" = 2 clues "perfumes" = 1
a046c7fc99575fc486be2a0693067edf71f5657c55d545365139174c233463b8
yellowbean/Hastructure
Util.hs
{-# LANGUAGE OverloadedStrings #-} # LANGUAGE ScopedTypeVariables # module Util (mulBR,mulBIR,mulBI,mulBInt,mulBInteger,lastN,yearCountFraction,genSerialDates ,getValByDate,getValByDates,projDatesByPattern ,genSerialDatesTill,genSerialDatesTill2,subDates,getTsDates,sliceDates,SliceType(..) ,calcInt,calcIntRate,calcIntRateCurve ,multiplyTs,zipTs,getTsVals,divideBI,mulIR, daysInterval ,replace,paddingDefault, capWith, pv2, splitByDate, rangeBy ) where import qualified Data.Time as T import Data.List import Data.Fixed import Data.Ratio ((%)) import Data.Ix import Data.Maybe import qualified Data.Map as M import Lib import Types import Text.Printf import Control.Exception import Debug.Trace debug = flip trace mulBR :: Balance -> Rate -> Centi mulBR b r = fromRational $ toRational b * r mulBIR :: Balance -> IRate -> Centi mulBIR b r = fromRational $ (toRational b) * (toRational r) mulIR :: Int -> Rational -> Rational mulIR i r = (toRational i) * r mulBInt :: Balance -> Int -> Rational mulBInt b i = (toRational b) * (toRational i) mulBInteger :: Balance -> Integer -> Rational mulBInteger b i = mulBInt b (fromInteger i) mulBI :: Balance -> IRate -> Amount mulBI bal r = fromRational $ (toRational bal) * (toRational r) divideBI :: Balance -> Int -> Balance divideBI b i = fromRational $ (toRational b) / (toRational i) zipLeftover :: [a] -> [a] -> [a] zipLeftover [] [] = [] zipLeftover xs [] = xs zipLeftover [] ys = ys zipLeftover (x:xs) (y:ys) = zipLeftover xs ys lastN :: Int -> [a] -> [a] lastN n xs = zipLeftover (drop n xs) xs -- -count-conventions yearCountFraction :: DayCount -> Date -> Date -> Rational --TODO -16-field-22f.htm yearCountFraction dc sd ed = case dc of DC_ACT_ACT -> if sameYear then _diffDays % daysOfYear syear else (sDaysTillYearEnd % (daysOfYear syear)) + (eDaysAfterYearBeg % (daysOfYear eyear)) + (pred _diffYears) ` debug ` ( " < > " + + show sDaysTillYearEnd++"<>"++show(daysOfYear syear ) + + " < > " + + show ( daysOfYear eyear)++"<>"++ show eyear ) DC_ACT_365F -> _diffDays % 365 -- `debug` ("DIFF Days"++show(_diffDays)) DC_ACT_360 -> _diffDays % 360 DC_ACT_365A -> if has_leap_day then _diffDays % 366 else _diffDays % 365 DC_ACT_365L -> if T.isLeapYear eyear then _diffDays % 366 else _diffDays % 365 DC_NL_365 -> if has_leap_day then (pred _diffDays) % 365 else _diffDays % 365 DC_30E_360 -> let _sday = f31to30 sday _eday = f31to30 eday num = toRational (_eday - _sday) + 30*_gapMonth + 360*_diffYears in ` debug ` ( " NUM->"++show num++"E S month"++show emonth++show ) DC_30Ep_360 -> let _sday = f31to30 sday (_eyear,_emonth,_eday) = T.toGregorian $ if eday==31 then T.addDays 1 ed else ed __gapMonth = (toInteger $ _emonth - smonth) % 1 __diffYears = (toInteger $ _eyear - syear) % 1 num = toRational (_eday - _sday) + 30*__gapMonth + 360*__diffYears in num / 360 DC_30_360_ISDA -> let _sday = f31to30 sday _eday = if _sday>=30 && eday==31 then 30 else eday num = toRational (_eday - _sday) + 30*_gapMonth + 360*_diffYears in num / 360 30/360 Bond basis , this was call 30E/360 ISDA by kalotay DC_30_360_German -> let _sday = if sday==31 || (endOfFeb syear smonth sday) then ` debug ` ( " German eof start if > > " + + show ( endOfFeb sday)++show syear + + show smonth++show sday ) else sday ` debug ` ( " German eof start else " + + show ( endOfFeb sday)++show syear + + show smonth++show sday ) _eday = if eday==31 || (endOfFeb eyear emonth eday) then 30 else eday ` debug ` ( " German eof end " + + show ( endOfFeb eyear emonth eday)++show eyear++show emonth++show eday ) num = toRational (_eday - _sday) + 30*_gapMonth + 360*_diffYears -- `debug` ("German"++show(_sday)++"<>"++show _eday) in num / 360 DC_30_360_US -> let _sday = if (endOfFeb syear smonth sday) || sday==31 then 30 else sday _eday = if (eday==31 && sday >= 30)||(endOfFeb eyear emonth eday) && (endOfFeb syear smonth sday) then 30 else eday num = toRational (_eday - _sday) + 30*_gapMonth + 360*_diffYears in num / 360 -- -16-field-22f.htm where daysOfYear y = if T.isLeapYear y then 366 else 365 f31to30 d = if d==31 then 30 else d endOfFeb y m d = if T.isLeapYear y then (m==2) && d == 29 else (m==2) && d == 28 sameYear = syear == eyear has_leap_day = case (sameYear,sLeap,eLeap) of (True,False,False) -> False (True,True,_) -> inRange (sd,ed) (T.fromGregorian syear 2 29) _ -> let _leapDays = [ T.fromGregorian _y 2 29 | _y <- range (syear,eyear) , (T.isLeapYear _y) ] in any (inRange (sd,ed)) _leapDays _diffYears = (eyear - syear) % 1 -- Ratio Integer _gapDay = (toInteger (eday - sday)) % 1 _gapMonth = (toInteger (emonth - smonth)) % 1 sDaysTillYearEnd = succ $ T.diffDays (T.fromGregorian syear 12 31) sd eDaysAfterYearBeg = T.diffDays ed (T.fromGregorian eyear 1 1) _diffDays = toInteger $ T.diffDays ed sd sLeap = T.isLeapYear syear eLeap = T.isLeapYear eyear (syear,smonth,sday) = T.toGregorian sd (eyear,emonth,eday) = T.toGregorian ed genSerialDates :: DatePattern -> Date -> Int -> Dates genSerialDates dp sd num = take num $ filter (>= sd) $ case dp of MonthEnd -> [T.fromGregorian yearRange (fst __md) (snd __md) | yearRange <- [_y..(_y+yrs)] ,__md <- monthEnds yearRange ] where yrs = fromIntegral $ div num 12 + 1 QuarterEnd -> [T.fromGregorian yearRange __m __d | yearRange <- [_y..(_y+yrs)] ,(__m,__d) <- quarterEnds] where yrs = fromIntegral $ div num 4 + 1 YearEnd -> [T.fromGregorian yearRange 12 31 | yearRange <- [_y..(_y+(toInteger num))]] YearFirst -> [T.fromGregorian yearRange 1 1 | yearRange <- [_y..(_y+(toInteger num))]] MonthFirst -> [T.fromGregorian yearRange monthRange 1 | yearRange <- [_y..(_y+yrs)] , monthRange <- [1..12]] where yrs = fromIntegral $ div num 12 + 1 QuarterFirst -> [T.fromGregorian yearRange __m 1 | yearRange <- [_y..(_y+yrs)] ,__m <- [3,6,9,12]] where yrs = fromIntegral $ div num 4 + 1 MonthDayOfYear m d -> [T.fromGregorian yearRange m d | yearRange <- [_y..(_y+(toInteger num))]] DayOfMonth d -> [T.fromGregorian yearRange monthRange d | yearRange <- [_y..(_y+yrs)] , monthRange <- [1..12]] where yrs = fromIntegral $ div num 12 + 1 where quarterEnds = [(3,31),(6,30),(9,30),(12,31)] monthEnds y = if T.isLeapYear y then [(1,31),(2,29),(3,31),(4,30),(5,31),(6,30),(7,31),(8,31),(9,30),(10,31),(11,30),(12,31)] else [(1,31),(2,28),(3,31),(4,30),(5,31),(6,30),(7,31),(8,31),(9,30),(10,31),(11,30),(12,31)] (_y,_m,_d) = T.toGregorian sd yearBegin = T.fromGregorian _y 1 1 genSerialDatesTill:: Date -> DatePattern -> Date -> Dates genSerialDatesTill sd ptn ed = filter (< ed) $ genSerialDates ptn sd (fromInteger (succ num)) --`debug` ("Num"++show num) where (sy,sm,sday) = T.toGregorian sd (ey,em,eday) = T.toGregorian ed T.CalendarDiffDays cdM cdD = T.diffGregorianDurationRollOver ed sd num = case ptn of MonthEnd -> cdM QuarterEnd -> div cdM 3 YearEnd -> div cdM 12 MonthFirst -> cdM QuarterFirst-> div cdM 3 YearFirst-> div cdM 12 T.MonthOfYear DayOfMonth _d -> cdM -- T.DayOfMonth -- T.DayOfWeek genSerialDatesTill2 :: RangeType -> Date -> DatePattern -> Date -> Dates genSerialDatesTill2 rt sd dp ed = case rt of II -> sd:_r ++ [ed] EI -> _r ++ [ed] IE -> if (head _r)==sd then _r else sd:_r EE -> _r where _r = genSerialDatesTill sd dp ed tsPointVal :: TsPoint a -> a tsPointVal (TsPoint d v) = v getValByDate :: Ts -> CutoffType -> Date -> Rational getValByDate (LeftBalanceCurve dps) ct d = case find (\(TsPoint _d _) -> (cmpFun ct) _d d) (reverse dps) of Just (TsPoint _d v) -> toRational v Nothing -> 0 where cmpFun Inc = (<=) cmpFun Exc = (<) getValByDate (BalanceCurve dps) Exc d = case find (\(TsPoint _d _) -> d > _d) (reverse dps) of Just (TsPoint _d v) -> toRational v Nothing -> 0 getValByDate (BalanceCurve dps) Inc d = case find (\(TsPoint _d _) -> d >= _d) (reverse dps) of Just (TsPoint _d v) -> toRational v Nothing -> 0 getValByDate (FloatCurve dps) Exc d = case find (\(TsPoint _d _) -> d > _d) (reverse dps) of Just (TsPoint _d v) -> toRational v -- `debug` ("Getting rate "++show(_d)++show(v)) Nothing -> 0 -- `debug` ("Getting 0 ") getValByDate (IRateCurve dps) Exc d = case find (\(TsPoint _d _) -> d > _d) (reverse dps) of Just (TsPoint _d v) -> toRational v -- `debug` ("Getting rate "++show(_d)++show(v)) Nothing -> 0 -- `debug` ("Getting 0 ") getValByDate (ThresholdCurve dps) Inc d = case find (\(TsPoint _d _) -> d <= _d) dps of Just (TsPoint _d v) -> toRational v -- `debug` ("Getting rate "++show(_d)++show(v)) ` debug ` ( " Not found in " ) getValByDate (ThresholdCurve dps) Exc d = case find (\(TsPoint _d _) -> d < _d) dps of Just (TsPoint _d v) -> toRational v -- `debug` ("Getting rate "++show(_d)++show(v)) ` debug ` ( " Not found in " ) getValByDate (FactorCurveClosed dps ed) Exc d = case find (\(TsPoint _d _) -> d > _d) (reverse dps) of Just found@(TsPoint _found_d _found_v) -> if d >= ed then 1.0 else _found_v Nothing -> 1.0 getValByDate (PricingCurve dps) _ d = case (d>=lday,d<=fday) of (True,_) -> tsPointVal $ last dps (_,True) -> tsPointVal $ head dps _ -> let rindex = fromMaybe 0 $findIndex (\(TsPoint _dl _) -> ( _dl > d )) dps rdp@(TsPoint _dr _rv) = dps!!rindex ldp@(TsPoint _dl _lv) = dps!!(pred rindex) leftDistance = toRational $ daysBetween _dl d -- `debug` ("LEFT"++show leftDistance) distance = toRational $ daysBetween _dl _dr -- `debug` ("DIST"++show distance) vdistance = _rv - _lv -- ("DIST") in toRational $ _lv + (vdistance * leftDistance) / distance -- `debug` ("D "++ show _lv++">>"++ show vdistance++">>"++ show leftDistance++">>"++ show distance) where fday = getDate $ head dps lday = getDate $ last dps getValByDates :: Ts -> CutoffType -> [Date] -> [Rational] -- getValByDates rc ds = map (getValByDate rc) ds getValByDates rc ct = map (getValByDate rc ct) getTsVals :: Ts -> [Rational] getTsVals (FloatCurve ts) = [ v | (TsPoint d v) <- ts ] getTsDates :: Ts -> [Date] getTsDates (IRateCurve tps) = map getDate tps getTsDates (FloatCurve tps) = map getDate tps getTsDates (PricingCurve tps) = map getDate tps getTsDates (BalanceCurve tps) = map getDate tps subDates :: RangeType -> Date -> Date -> [Date] -> [Date] subDates rt sd ed ds = case rt of II -> filter (\x -> x >= sd && x <= ed ) ds EI -> filter (\x -> x > sd && x <= ed ) ds IE -> filter (\x -> x >= sd && x < ed ) ds EE -> filter (\x -> x > sd && x < ed ) ds data SliceType = SliceAfter Date | SliceOnAfter Date | SliceAfterKeepPrevious Date | SliceOnAfterKeepPrevious Date sliceDates :: SliceType -> [Date] -> [Date] sliceDates st ds = case st of SliceAfter d -> filter (> d) ds SliceOnAfter d -> filter (>= d) ds SliceAfterKeepPrevious d -> case findIndex (> d) ds of Just idx -> snd $ splitAt (pred idx) ds Nothing -> [] SliceOnAfterKeepPrevious d -> case findIndex (>= d) ds of Just idx -> snd $ splitAt (pred idx) ds Nothing -> [] calcIntRate :: Date -> Date -> IRate -> DayCount -> IRate calcIntRate start_date end_date int_rate day_count = let yf = yearCountFraction day_count start_date end_date in int_rate * (fromRational yf) calcIntRateCurve :: DayCount -> IRate -> [Date] -> [IRate] calcIntRateCurve dc r ds = [ calcIntRate sd ed r dc | (sd,ed) <- zip (init ds) (tail ds) ] calcInt :: Balance -> Date -> Date -> IRate -> DayCount -> Amount calcInt bal start_date end_date int_rate day_count = let yfactor = yearCountFraction day_count start_date end_date in mulBR bal (yfactor * (toRational int_rate)) zipTs :: [Date] -> [Rational] -> Ts zipTs ds rs = FloatCurve [ TsPoint d r | (d,r) <- (zip ds rs) ] multiplyTs :: CutoffType -> Ts -> Ts -> Ts multiplyTs ct (FloatCurve ts1) ts2 = FloatCurve [(TsPoint d (v * (getValByDate ts2 ct d))) | (TsPoint d v) <- ts1 ] TODO to be replace by generateDateSeries projDatesByPattern dp sd ed = let (T.CalendarDiffDays cdm cdd) = T.diffGregorianDurationClip ed sd num = case dp of MonthEnd -> cdm + 1 QuarterEnd -> (div cdm 3) + 1 -- `debug` ("cdm"++show cdm) YearEnd -> (div cdm 12) + 1 MonthFirst -> cdm + 1 QuarterFirst -> (div cdm 3) + 1 YearFirst -> (div cdm 12) + 1 MonthDayOfYear _ _ -> (div cdm 12) + 1 DayOfMonth _ -> cdm + 1 in genSerialDates dp sd (fromInteger num) replace :: [a] -> Int -> a -> [a] replace xs i e = case splitAt i xs of (before, _:after) -> before ++ e: after _ -> xs paddingDefault :: a -> [a] -> Int -> [a] paddingDefault x xs s | (length xs) > s = take s xs | otherwise = xs++(replicate (s - (length xs)) x) capWith :: Ord a => [a] -> a -> [a] capWith xs cap = [ if x > cap then cap else x | x <- xs ] pv2 :: IRate -> Date -> Date -> Amount -> Amount pv2 discount_rate today d amt = mulBI amt $ 1/denominator -- `debug` ("days between->"++show d ++show today++">>>"++show distance ) where denominator = (1+discount_rate) ^^ (fromInteger (div distance 365)) distance = daysBetween today d daysInterval :: [Date] -> [Integer] daysInterval ds = zipWith daysBetween (init ds) (tail ds) splitByDate :: TimeSeries a => [a] -> Date -> SplitType -> ([a],[a]) splitByDate xs d st = case st of EqToLeft -> span (\x -> (getDate x) <= d) xs EqToRight -> span (\x -> (getDate x) < d) xs EqToLeftKeepOne -> case findIndex (\x -> (getDate x) >= d ) xs of Just idx -> splitAt (pred idx) xs -- `debug` ("split with "++show (pred idx)++">>"++show (length xs)) Nothing -> (xs,[]) EqToRightKeepOne - > case findIndex ( \x - > ( getDate x ) > = d ) xs of Just idx - > splitAt ( pred idx ) xs -- ` debug ` ( " split with " + + show ( pred idx)++">>"++show ( length xs ) ) -- Nothing -> (xs,[]) -- EqToLeftKeepOnes -> case findIndices ( \x - > ( getDate x ) < = d ) xs of -- [] -> (xs,[]) -- inds -> rangeBy :: TimeSeries a => [a] -> Date -> Date -> RangeType -> [a] rangeBy xs sd ed rt = case rt of II -> filter (\x -> (getDate x >= sd) && (getDate x <= ed)) xs -- `debug` ("in rangeBy II") IE -> filter (\x -> (getDate x >= sd) && (getDate x < ed)) xs EI -> filter (\x -> (getDate x > sd) && (getDate x <= ed)) xs EE -> filter (\x -> (getDate x > sd) && (getDate x < ed)) xs debugLine :: Show a => [a] -> String debugLine xs = ""
null
https://raw.githubusercontent.com/yellowbean/Hastructure/ff1eb0c223b418c18ab6328012701864a6edc651/src/Util.hs
haskell
# LANGUAGE OverloadedStrings # -count-conventions TODO -16-field-22f.htm `debug` ("DIFF Days"++show(_diffDays)) `debug` ("German"++show(_sday)++"<>"++show _eday) -16-field-22f.htm Ratio Integer `debug` ("Num"++show num) T.DayOfMonth T.DayOfWeek `debug` ("Getting rate "++show(_d)++show(v)) `debug` ("Getting 0 ") `debug` ("Getting rate "++show(_d)++show(v)) `debug` ("Getting 0 ") `debug` ("Getting rate "++show(_d)++show(v)) `debug` ("Getting rate "++show(_d)++show(v)) `debug` ("LEFT"++show leftDistance) `debug` ("DIST"++show distance) ("DIST") `debug` ("D "++ show _lv++">>"++ show vdistance++">>"++ show leftDistance++">>"++ show distance) getValByDates rc ds = map (getValByDate rc) ds `debug` ("cdm"++show cdm) `debug` ("days between->"++show d ++show today++">>>"++show distance ) `debug` ("split with "++show (pred idx)++">>"++show (length xs)) ` debug ` ( " split with " + + show ( pred idx)++">>"++show ( length xs ) ) Nothing -> (xs,[]) EqToLeftKeepOnes -> [] -> (xs,[]) inds -> `debug` ("in rangeBy II")
# LANGUAGE ScopedTypeVariables # module Util (mulBR,mulBIR,mulBI,mulBInt,mulBInteger,lastN,yearCountFraction,genSerialDates ,getValByDate,getValByDates,projDatesByPattern ,genSerialDatesTill,genSerialDatesTill2,subDates,getTsDates,sliceDates,SliceType(..) ,calcInt,calcIntRate,calcIntRateCurve ,multiplyTs,zipTs,getTsVals,divideBI,mulIR, daysInterval ,replace,paddingDefault, capWith, pv2, splitByDate, rangeBy ) where import qualified Data.Time as T import Data.List import Data.Fixed import Data.Ratio ((%)) import Data.Ix import Data.Maybe import qualified Data.Map as M import Lib import Types import Text.Printf import Control.Exception import Debug.Trace debug = flip trace mulBR :: Balance -> Rate -> Centi mulBR b r = fromRational $ toRational b * r mulBIR :: Balance -> IRate -> Centi mulBIR b r = fromRational $ (toRational b) * (toRational r) mulIR :: Int -> Rational -> Rational mulIR i r = (toRational i) * r mulBInt :: Balance -> Int -> Rational mulBInt b i = (toRational b) * (toRational i) mulBInteger :: Balance -> Integer -> Rational mulBInteger b i = mulBInt b (fromInteger i) mulBI :: Balance -> IRate -> Amount mulBI bal r = fromRational $ (toRational bal) * (toRational r) divideBI :: Balance -> Int -> Balance divideBI b i = fromRational $ (toRational b) / (toRational i) zipLeftover :: [a] -> [a] -> [a] zipLeftover [] [] = [] zipLeftover xs [] = xs zipLeftover [] ys = ys zipLeftover (x:xs) (y:ys) = zipLeftover xs ys lastN :: Int -> [a] -> [a] lastN n xs = zipLeftover (drop n xs) xs yearCountFraction dc sd ed = case dc of DC_ACT_ACT -> if sameYear then _diffDays % daysOfYear syear else (sDaysTillYearEnd % (daysOfYear syear)) + (eDaysAfterYearBeg % (daysOfYear eyear)) + (pred _diffYears) ` debug ` ( " < > " + + show sDaysTillYearEnd++"<>"++show(daysOfYear syear ) + + " < > " + + show ( daysOfYear eyear)++"<>"++ show eyear ) DC_ACT_360 -> _diffDays % 360 DC_ACT_365A -> if has_leap_day then _diffDays % 366 else _diffDays % 365 DC_ACT_365L -> if T.isLeapYear eyear then _diffDays % 366 else _diffDays % 365 DC_NL_365 -> if has_leap_day then (pred _diffDays) % 365 else _diffDays % 365 DC_30E_360 -> let _sday = f31to30 sday _eday = f31to30 eday num = toRational (_eday - _sday) + 30*_gapMonth + 360*_diffYears in ` debug ` ( " NUM->"++show num++"E S month"++show emonth++show ) DC_30Ep_360 -> let _sday = f31to30 sday (_eyear,_emonth,_eday) = T.toGregorian $ if eday==31 then T.addDays 1 ed else ed __gapMonth = (toInteger $ _emonth - smonth) % 1 __diffYears = (toInteger $ _eyear - syear) % 1 num = toRational (_eday - _sday) + 30*__gapMonth + 360*__diffYears in num / 360 DC_30_360_ISDA -> let _sday = f31to30 sday _eday = if _sday>=30 && eday==31 then 30 else eday num = toRational (_eday - _sday) + 30*_gapMonth + 360*_diffYears in num / 360 30/360 Bond basis , this was call 30E/360 ISDA by kalotay DC_30_360_German -> let _sday = if sday==31 || (endOfFeb syear smonth sday) then ` debug ` ( " German eof start if > > " + + show ( endOfFeb sday)++show syear + + show smonth++show sday ) else sday ` debug ` ( " German eof start else " + + show ( endOfFeb sday)++show syear + + show smonth++show sday ) _eday = if eday==31 || (endOfFeb eyear emonth eday) then 30 else eday ` debug ` ( " German eof end " + + show ( endOfFeb eyear emonth eday)++show eyear++show emonth++show eday ) in num / 360 DC_30_360_US -> let _sday = if (endOfFeb syear smonth sday) || sday==31 then 30 else sday _eday = if (eday==31 && sday >= 30)||(endOfFeb eyear emonth eday) && (endOfFeb syear smonth sday) then 30 else eday num = toRational (_eday - _sday) + 30*_gapMonth + 360*_diffYears in num / 360 where daysOfYear y = if T.isLeapYear y then 366 else 365 f31to30 d = if d==31 then 30 else d endOfFeb y m d = if T.isLeapYear y then (m==2) && d == 29 else (m==2) && d == 28 sameYear = syear == eyear has_leap_day = case (sameYear,sLeap,eLeap) of (True,False,False) -> False (True,True,_) -> inRange (sd,ed) (T.fromGregorian syear 2 29) _ -> let _leapDays = [ T.fromGregorian _y 2 29 | _y <- range (syear,eyear) , (T.isLeapYear _y) ] in any (inRange (sd,ed)) _leapDays _gapDay = (toInteger (eday - sday)) % 1 _gapMonth = (toInteger (emonth - smonth)) % 1 sDaysTillYearEnd = succ $ T.diffDays (T.fromGregorian syear 12 31) sd eDaysAfterYearBeg = T.diffDays ed (T.fromGregorian eyear 1 1) _diffDays = toInteger $ T.diffDays ed sd sLeap = T.isLeapYear syear eLeap = T.isLeapYear eyear (syear,smonth,sday) = T.toGregorian sd (eyear,emonth,eday) = T.toGregorian ed genSerialDates :: DatePattern -> Date -> Int -> Dates genSerialDates dp sd num = take num $ filter (>= sd) $ case dp of MonthEnd -> [T.fromGregorian yearRange (fst __md) (snd __md) | yearRange <- [_y..(_y+yrs)] ,__md <- monthEnds yearRange ] where yrs = fromIntegral $ div num 12 + 1 QuarterEnd -> [T.fromGregorian yearRange __m __d | yearRange <- [_y..(_y+yrs)] ,(__m,__d) <- quarterEnds] where yrs = fromIntegral $ div num 4 + 1 YearEnd -> [T.fromGregorian yearRange 12 31 | yearRange <- [_y..(_y+(toInteger num))]] YearFirst -> [T.fromGregorian yearRange 1 1 | yearRange <- [_y..(_y+(toInteger num))]] MonthFirst -> [T.fromGregorian yearRange monthRange 1 | yearRange <- [_y..(_y+yrs)] , monthRange <- [1..12]] where yrs = fromIntegral $ div num 12 + 1 QuarterFirst -> [T.fromGregorian yearRange __m 1 | yearRange <- [_y..(_y+yrs)] ,__m <- [3,6,9,12]] where yrs = fromIntegral $ div num 4 + 1 MonthDayOfYear m d -> [T.fromGregorian yearRange m d | yearRange <- [_y..(_y+(toInteger num))]] DayOfMonth d -> [T.fromGregorian yearRange monthRange d | yearRange <- [_y..(_y+yrs)] , monthRange <- [1..12]] where yrs = fromIntegral $ div num 12 + 1 where quarterEnds = [(3,31),(6,30),(9,30),(12,31)] monthEnds y = if T.isLeapYear y then [(1,31),(2,29),(3,31),(4,30),(5,31),(6,30),(7,31),(8,31),(9,30),(10,31),(11,30),(12,31)] else [(1,31),(2,28),(3,31),(4,30),(5,31),(6,30),(7,31),(8,31),(9,30),(10,31),(11,30),(12,31)] (_y,_m,_d) = T.toGregorian sd yearBegin = T.fromGregorian _y 1 1 genSerialDatesTill:: Date -> DatePattern -> Date -> Dates genSerialDatesTill sd ptn ed where (sy,sm,sday) = T.toGregorian sd (ey,em,eday) = T.toGregorian ed T.CalendarDiffDays cdM cdD = T.diffGregorianDurationRollOver ed sd num = case ptn of MonthEnd -> cdM QuarterEnd -> div cdM 3 YearEnd -> div cdM 12 MonthFirst -> cdM QuarterFirst-> div cdM 3 YearFirst-> div cdM 12 T.MonthOfYear genSerialDatesTill2 :: RangeType -> Date -> DatePattern -> Date -> Dates genSerialDatesTill2 rt sd dp ed = case rt of II -> sd:_r ++ [ed] EI -> _r ++ [ed] IE -> if (head _r)==sd then _r else sd:_r EE -> _r where _r = genSerialDatesTill sd dp ed tsPointVal :: TsPoint a -> a tsPointVal (TsPoint d v) = v getValByDate :: Ts -> CutoffType -> Date -> Rational getValByDate (LeftBalanceCurve dps) ct d = case find (\(TsPoint _d _) -> (cmpFun ct) _d d) (reverse dps) of Just (TsPoint _d v) -> toRational v Nothing -> 0 where cmpFun Inc = (<=) cmpFun Exc = (<) getValByDate (BalanceCurve dps) Exc d = case find (\(TsPoint _d _) -> d > _d) (reverse dps) of Just (TsPoint _d v) -> toRational v Nothing -> 0 getValByDate (BalanceCurve dps) Inc d = case find (\(TsPoint _d _) -> d >= _d) (reverse dps) of Just (TsPoint _d v) -> toRational v Nothing -> 0 getValByDate (FloatCurve dps) Exc d = case find (\(TsPoint _d _) -> d > _d) (reverse dps) of getValByDate (IRateCurve dps) Exc d = case find (\(TsPoint _d _) -> d > _d) (reverse dps) of getValByDate (ThresholdCurve dps) Inc d = case find (\(TsPoint _d _) -> d <= _d) dps of ` debug ` ( " Not found in " ) getValByDate (ThresholdCurve dps) Exc d = case find (\(TsPoint _d _) -> d < _d) dps of ` debug ` ( " Not found in " ) getValByDate (FactorCurveClosed dps ed) Exc d = case find (\(TsPoint _d _) -> d > _d) (reverse dps) of Just found@(TsPoint _found_d _found_v) -> if d >= ed then 1.0 else _found_v Nothing -> 1.0 getValByDate (PricingCurve dps) _ d = case (d>=lday,d<=fday) of (True,_) -> tsPointVal $ last dps (_,True) -> tsPointVal $ head dps _ -> let rindex = fromMaybe 0 $findIndex (\(TsPoint _dl _) -> ( _dl > d )) dps rdp@(TsPoint _dr _rv) = dps!!rindex ldp@(TsPoint _dl _lv) = dps!!(pred rindex) in toRational $ _lv + (vdistance * leftDistance) / distance where fday = getDate $ head dps lday = getDate $ last dps getValByDates :: Ts -> CutoffType -> [Date] -> [Rational] getValByDates rc ct = map (getValByDate rc ct) getTsVals :: Ts -> [Rational] getTsVals (FloatCurve ts) = [ v | (TsPoint d v) <- ts ] getTsDates :: Ts -> [Date] getTsDates (IRateCurve tps) = map getDate tps getTsDates (FloatCurve tps) = map getDate tps getTsDates (PricingCurve tps) = map getDate tps getTsDates (BalanceCurve tps) = map getDate tps subDates :: RangeType -> Date -> Date -> [Date] -> [Date] subDates rt sd ed ds = case rt of II -> filter (\x -> x >= sd && x <= ed ) ds EI -> filter (\x -> x > sd && x <= ed ) ds IE -> filter (\x -> x >= sd && x < ed ) ds EE -> filter (\x -> x > sd && x < ed ) ds data SliceType = SliceAfter Date | SliceOnAfter Date | SliceAfterKeepPrevious Date | SliceOnAfterKeepPrevious Date sliceDates :: SliceType -> [Date] -> [Date] sliceDates st ds = case st of SliceAfter d -> filter (> d) ds SliceOnAfter d -> filter (>= d) ds SliceAfterKeepPrevious d -> case findIndex (> d) ds of Just idx -> snd $ splitAt (pred idx) ds Nothing -> [] SliceOnAfterKeepPrevious d -> case findIndex (>= d) ds of Just idx -> snd $ splitAt (pred idx) ds Nothing -> [] calcIntRate :: Date -> Date -> IRate -> DayCount -> IRate calcIntRate start_date end_date int_rate day_count = let yf = yearCountFraction day_count start_date end_date in int_rate * (fromRational yf) calcIntRateCurve :: DayCount -> IRate -> [Date] -> [IRate] calcIntRateCurve dc r ds = [ calcIntRate sd ed r dc | (sd,ed) <- zip (init ds) (tail ds) ] calcInt :: Balance -> Date -> Date -> IRate -> DayCount -> Amount calcInt bal start_date end_date int_rate day_count = let yfactor = yearCountFraction day_count start_date end_date in mulBR bal (yfactor * (toRational int_rate)) zipTs :: [Date] -> [Rational] -> Ts zipTs ds rs = FloatCurve [ TsPoint d r | (d,r) <- (zip ds rs) ] multiplyTs :: CutoffType -> Ts -> Ts -> Ts multiplyTs ct (FloatCurve ts1) ts2 = FloatCurve [(TsPoint d (v * (getValByDate ts2 ct d))) | (TsPoint d v) <- ts1 ] TODO to be replace by generateDateSeries projDatesByPattern dp sd ed = let (T.CalendarDiffDays cdm cdd) = T.diffGregorianDurationClip ed sd num = case dp of MonthEnd -> cdm + 1 YearEnd -> (div cdm 12) + 1 MonthFirst -> cdm + 1 QuarterFirst -> (div cdm 3) + 1 YearFirst -> (div cdm 12) + 1 MonthDayOfYear _ _ -> (div cdm 12) + 1 DayOfMonth _ -> cdm + 1 in genSerialDates dp sd (fromInteger num) replace :: [a] -> Int -> a -> [a] replace xs i e = case splitAt i xs of (before, _:after) -> before ++ e: after _ -> xs paddingDefault :: a -> [a] -> Int -> [a] paddingDefault x xs s | (length xs) > s = take s xs | otherwise = xs++(replicate (s - (length xs)) x) capWith :: Ord a => [a] -> a -> [a] capWith xs cap = [ if x > cap then cap else x | x <- xs ] pv2 :: IRate -> Date -> Date -> Amount -> Amount pv2 discount_rate today d amt = where denominator = (1+discount_rate) ^^ (fromInteger (div distance 365)) distance = daysBetween today d daysInterval :: [Date] -> [Integer] daysInterval ds = zipWith daysBetween (init ds) (tail ds) splitByDate :: TimeSeries a => [a] -> Date -> SplitType -> ([a],[a]) splitByDate xs d st = case st of EqToLeft -> span (\x -> (getDate x) <= d) xs EqToRight -> span (\x -> (getDate x) < d) xs EqToLeftKeepOne -> case findIndex (\x -> (getDate x) >= d ) xs of Nothing -> (xs,[]) EqToRightKeepOne - > case findIndex ( \x - > ( getDate x ) > = d ) xs of case findIndices ( \x - > ( getDate x ) < = d ) xs of rangeBy :: TimeSeries a => [a] -> Date -> Date -> RangeType -> [a] rangeBy xs sd ed rt = case rt of IE -> filter (\x -> (getDate x >= sd) && (getDate x < ed)) xs EI -> filter (\x -> (getDate x > sd) && (getDate x <= ed)) xs EE -> filter (\x -> (getDate x > sd) && (getDate x < ed)) xs debugLine :: Show a => [a] -> String debugLine xs = ""
a920c3f7b78d5c279e7fb172e79450183e3d5184395db5cbf8faa3f4442e26a3
diffusionkinetics/open
TestPlotly.hs
{-# LANGUAGE OverloadedStrings #-} import Lucid import Lucid.Html5 import Graphics.Plotly import Graphics.Plotly.Lucid import Lens.Micro import qualified Data.Text.Lazy as T import qualified Data.Text.Lazy.IO as T main = T.writeFile "test.html" $ renderText $ doctypehtml_ $ do head_ $ do meta_ [charset_ "utf-8"] plotlyCDN body_ $ toHtml $ plotly "myDiv" [myTrace] myTrace = scatter & x ?~ [1,2,3,4] & y ?~ [500,3000,700,200]
null
https://raw.githubusercontent.com/diffusionkinetics/open/673d9a4a099abd9035ccc21e37d8e614a45a1901/plotlyhs/TestPlotly.hs
haskell
# LANGUAGE OverloadedStrings #
import Lucid import Lucid.Html5 import Graphics.Plotly import Graphics.Plotly.Lucid import Lens.Micro import qualified Data.Text.Lazy as T import qualified Data.Text.Lazy.IO as T main = T.writeFile "test.html" $ renderText $ doctypehtml_ $ do head_ $ do meta_ [charset_ "utf-8"] plotlyCDN body_ $ toHtml $ plotly "myDiv" [myTrace] myTrace = scatter & x ?~ [1,2,3,4] & y ?~ [500,3000,700,200]
b2ed567a044ed0a57371e0f06e7dde6964ba592e265306fdd8a3f0d80a8b340d
siraben/zkeme80
interrupt.scm
(define interrupt-asm `((label sys-interrupt) (di) ,@(push* '(af bc de hl ix iy)) (exx) ((ex af afs)) ,@(push* '(af bc de hl)) (jp usb-interrupt) (label interrupt-resume) (in a (4)) (bit 0 a) (jr nz int-handle-on) (bit 1 a) (jr nz int-handle-timer1) (bit 2 a) (jr nz int-handle-timer2) (bit 4 a) (jr nz int-handle-link) (jr sys-interrupt-done) (label int-handle-on) (in a (3)) (res 0 a) (out (3) a) (set 0 a) (out (3) a) (jr sys-interrupt-done) (label int-handle-timer1) (in a (3)) (res 1 a) (out (3) a) (set 1 a) (out (3) a) (jr sys-interrupt-done) (label int-handle-timer2) (in a (3)) (res 2 a) (out (3) a) (set 2 a) (out (3) a) (jr sys-interrupt-done) (label int-handle-link) (in a (3)) (res 4 a) (out (3) a) (set 4 a) (out (3) a) (label sys-interrupt-done) ,@(pop* '(hl de bc af)) (exx) ((ex af afs)) ,@(pop* '(iy ix hl de bc af)) (ei) (ret) (label usb-interrupt) (in a (#x55)) (bit 0 a) (jr z usb-unknown-event) (bit 2 a) (jr z usb-line-event) (bit 4 a) (jr z usb-protocol-event) (jp interrupt-resume) (label usb-unknown-event) (jp interrupt-resume) (label usb-line-event) (in a (#x56)) (xor #xff) (out (#x57) a) (jp interrupt-resume) (label usb-protocol-event) ,@(map (lambda (x) `(in a (,x))) '(#x82 #x83 #x84 #x85 #x86)) (jp interrupt-resume) ))
null
https://raw.githubusercontent.com/siraben/zkeme80/ab49d496cac6797e6e3264ee027f96040eaf0492/src/interrupt.scm
scheme
(define interrupt-asm `((label sys-interrupt) (di) ,@(push* '(af bc de hl ix iy)) (exx) ((ex af afs)) ,@(push* '(af bc de hl)) (jp usb-interrupt) (label interrupt-resume) (in a (4)) (bit 0 a) (jr nz int-handle-on) (bit 1 a) (jr nz int-handle-timer1) (bit 2 a) (jr nz int-handle-timer2) (bit 4 a) (jr nz int-handle-link) (jr sys-interrupt-done) (label int-handle-on) (in a (3)) (res 0 a) (out (3) a) (set 0 a) (out (3) a) (jr sys-interrupt-done) (label int-handle-timer1) (in a (3)) (res 1 a) (out (3) a) (set 1 a) (out (3) a) (jr sys-interrupt-done) (label int-handle-timer2) (in a (3)) (res 2 a) (out (3) a) (set 2 a) (out (3) a) (jr sys-interrupt-done) (label int-handle-link) (in a (3)) (res 4 a) (out (3) a) (set 4 a) (out (3) a) (label sys-interrupt-done) ,@(pop* '(hl de bc af)) (exx) ((ex af afs)) ,@(pop* '(iy ix hl de bc af)) (ei) (ret) (label usb-interrupt) (in a (#x55)) (bit 0 a) (jr z usb-unknown-event) (bit 2 a) (jr z usb-line-event) (bit 4 a) (jr z usb-protocol-event) (jp interrupt-resume) (label usb-unknown-event) (jp interrupt-resume) (label usb-line-event) (in a (#x56)) (xor #xff) (out (#x57) a) (jp interrupt-resume) (label usb-protocol-event) ,@(map (lambda (x) `(in a (,x))) '(#x82 #x83 #x84 #x85 #x86)) (jp interrupt-resume) ))
f911167c9183315dcf0214ddedf797377d1551917c5942ea00408d8f6421faee
hoelzl/Clicc
read.lisp
;;;----------------------------------------------------------------------------- Copyright ( C ) 1993 Christian - Albrechts - Universitaet zu Kiel , Germany ;;;----------------------------------------------------------------------------- Projekt : APPLY - A Practicable And Portable Lisp Implementation ;;; ------------------------------------------------------ Funktion : Laufzeitsystem ;;; - Backquote-Reader + Simplifier - Readtables , ;;; - READ ;;; - READ-PRESERVING-WHITESPACE ;;; - READ-DELIMITED-LIST ;;; - READ-LINE ( - READ - CHAR , UNREAD - CHAR -- > file.lisp ) ;;; - PEEK-CHAR ;;; - READ-FROM-STRING - PARSE - INTEGER ;;; $ Revision : 1.14 $ ;;; $Log: read.lisp,v $ ;;; Revision 1.14 1994/06/03 09:51:05 hk Schreibfehler ;;; ;;; Revision 1.13 1994/06/02 14:10:19 hk Print - Funktion f"ur readtable - Struktur . ;;; Revision 1.12 1994/05/31 12:05:06 hk Bessere warning ;;; ;;; Revision 1.11 1994/02/17 16:16:35 hk " Uberfl"ussigen Test in struct - reader gestrichen , aufger"aumt , . ;;; ;;; Revision 1.10 1994/01/11 16:11:47 hk in bq - attach - append bei ` ( ..... . const ) behoben . ;;; ;;; Revision 1.9 1993/11/29 12:26:40 uho In ' read - token ' wird des look - ahead - Zeichens das Ende . ;;; Revision 1.8 1993/11/10 16:09:27 hk In read - from - string den zu T korrigiert . ;;; Revision 1.7 1993/07/14 13:50:42 hk Neue Reader fuer # b , # o , # x und # nR , vector - reader ;;; Revision 1.6 1993/06/16 15:20:38 hk Copyright eingefuegt . ;;; Revision 1.5 1993/05/07 08:55:22 hk ;;; readtable exportiert. ;;; ;;; Revision 1.4 1993/04/22 10:48:21 hk ;;; (in-package "RUNTIME") -> (in-package "LISP"), Definitionen exportiert , defvar , defconstant , clicc / lib / . rt::set - xxx in ( setf xxx ) umgeschrieben . Definitionen und Anwendungen von / aus Package Runtime mit rt : . declaim fun - spec und declaim top - level - form gestrichen . ;;; Revision 1.3 1993/02/16 14:34:20 hk ;;; clicc::declaim -> declaim, clicc::fun-spec (etc.) -> lisp::fun-spec (etc.) $ Revision : 1.14 $ eingefuegt ;;; ;;; Revision 1.2 1993/01/11 15:04:27 hk ;;; structure -> struct ;;; Revision 1.1 1992/03/24 17:12:55 hk ;;; Initial revision ;;;----------------------------------------------------------------------------- (in-package "LISP") (export '(*read-base* *read-suppress* *features* readtable readtablep copy-readtable set-syntax-from-char set-macro-character get-macro-character make-dispatch-macro-character set-dispatch-macro-character get-dispatch-macro-character read read-preserving-whitespace read-delimited-list read-line peek-char read-from-string parse-integer)) ;;------------------------------------------------------------------------------ (defparameter *comma* (make-symbol "COMMA")) (defparameter *comma-atsign* (make-symbol "COMMA-ATSIGN")) (defparameter *comma-dot* (make-symbol "COMMA-DOT")) (defparameter *bq-list* (make-symbol "BQ-LIST")) (defparameter *bq-append* (make-symbol "BQ-APPEND")) (defparameter *bq-list** (make-symbol "BQ-LIST*")) (defparameter *bq-nconc* (make-symbol "BQ-NCONC")) (defparameter *bq-clobberable* (make-symbol "BQ-CLOBBERABLE")) (defparameter *bq-quote* (make-symbol "BQ-QUOTE")) (defparameter *bq-quote-nil* (list *bq-quote* nil)) (defparameter *bq-vector* (make-symbol "VECTOR")) (defparameter *bq-level* 0) (defparameter *read-base* 10) (defparameter *read-suppress* nil) (defparameter *features* nil) (defparameter *token* (make-array 80 :element-type 'character :fill-pointer 0 :adjustable t)) (defparameter *uninterned* nil) (defparameter *preserve-whitespace* nil) (defparameter *dot-flag* nil) (defparameter *parenthesis-open* nil) (defparameter *standard-readtable* (make-standard-readtable)) erst nach obiger Zeile ;;------------------------------------------------------------------------------ Backquote ... ;;------------------------------------------------------------------------------ angelehnt an " Backquote , Appendix C in CLtL , 2nd . " erweitert um Backquote in Vektoren . ;;------------------------------------------------------------------------------ ;;------------------------------------------------------------------------------ (defun backquote-reader (stream char) (declare (ignore char)) (incf *bq-level*) (prog1 (bq-completely-process (bq-read stream)) (decf *bq-level*))) ;;------------------------------------------------------------------------------ (defun comma-reader (stream char) (declare (ignore char)) (when (<= *bq-level* 0) (error "A comma appeared outside of a backquote")) (decf *bq-level*) (prog1 (cons (case (peek-char nil stream t nil t) (#\@ (read-char stream t nil t) *comma-atsign*) (#\. (read-char stream t nil t) *comma-dot*) (otherwise *comma*)) (bq-read stream)) (incf *bq-level*))) ;;------------------------------------------------------------------------------ (defun bq-completely-process (x) (bq-remove-tokens (bq-simplify (bq-process x)))) ;;------------------------------------------------------------------------------ (defun bq-process (x) (cond ;; `basic --> (QUOTE basic) ;;------------------------- ((atom x) (list *bq-quote* x)) ;; `#(x1 x2 x3 ... xn) --> (apply #'vector `(x1 x2 x3 ... xn)) ;;------------------------------------------------------------ ((eq (car x) *bq-vector*) (let ((list (bq-completely-process (cdr x)))) (if (eq 'QUOTE (car list)) (list *bq-quote* (apply #'vector (cadr list))) (list 'APPLY `#'VECTOR list)))) ;; `,form --> form ;;---------------- ((eq (car x) *comma*) (cdr x)) ` , @form -- > ERROR ;;------------------ ((eq (car x) *comma-atsign*) (error ",@~S after `" (cdr x))) ` , .form -- > ERROR ;;------------------ ((eq (car x) *comma-dot*) (error ",.~S after `" (cdr x))) ;; `(x1 x2 x3 ... xn . atom) --> ;;------------------------------ (t (do ((p x (cdr p)) (q '() (cons (bracket (car p)) q))) ((atom p) ;; --> (append [x1] [x2 [x3] ... [xn] (quote atom)) ;;------------------------------------------------- (cons *bq-append* (nreconc q (list (list *bq-quote* p))))) ;; `(x1 ... xn . ,form) --> (append [x1] ... [xn] form) ;;----------------------------------------------------- (when (eq (car p) *comma*) (return (cons *bq-append* (nreconc q (list (cdr p)))))) ` ( x1 ... xn . , @form ) -- > ERROR ;;-------------------------------- (when (eq (car p) *comma-atsign*) (error "Dotted ,@~s" (cdr p))) ` ( x1 ... xn . , .form ) -- > ERROR ;;-------------------------------- (when (eq (car p) *comma-dot*) (error "Dotted ,@~s" (cdr p))))))) ;;------------------------------------------------------------------------------ (defun bracket (x) (cond ((atom x) (list *bq-list* (bq-process x))) ((eq (car x) *comma*) (list *bq-list* (cdr x))) ((eq (car x) *comma-atsign*) (cdr x)) ((eq (car x) *comma-dot*) (list *bq-clobberable* (cdr x))) (t (list *bq-list* (bq-process x))))) ;;------------------------------------------------------------------------------ (defun maptree (fn x) (if (atom x) (funcall fn x) (let ((a (funcall fn (car x))) (d (maptree fn (cdr x)))) (if (and (eql a (car x)) (eql d (cdr x))) x (cons a d))))) ;;------------------------------------------------------------------------------ (defun bq-splicing-frob (x) (and (consp x) (or (eq (car x) *comma-atsign*) (eq (car x) *comma-dot*)))) ;;------------------------------------------------------------------------------ (defun bq-frob (x) (and (consp x) (or (eq (car x) *comma*) (eq (car x) *comma-atsign*) (eq (car x) *comma-dot*)))) ;;------------------------------------------------------------------------------ (defun bq-simplify (x) (if (atom x) x (let ((x (if (eq (car x) *bq-quote*) x (maptree #'bq-simplify x)))) (if (not (eq (car x) *bq-append*)) x (bq-simplify-args x))))) ;;------------------------------------------------------------------------------ (defun bq-simplify-args (x) (do ((args (reverse (cdr x)) (cdr args)) (result nil (cond ((atom (car args)) (bq-attach-append *bq-append* (car args) result)) ((and (eq (caar args) *bq-list*) (notany #'bq-splicing-frob (cdar args))) (bq-attach-conses (cdar args) result)) ((and (eq (caar args) *bq-list**) (notany #'bq-splicing-frob (cdar args))) (bq-attach-conses (reverse (cdr (reverse (cdar args)))) (bq-attach-append *bq-append* (car (last (car args))) result))) ((and (eq (caar args) *bq-quote*) (consp (cadar args)) (not (bq-frob (cadar args))) (null (cddar args))) (bq-attach-conses (list (list *bq-quote* (caadar args))) result)) ((eq (caar args) *bq-clobberable*) (bq-attach-append *bq-nconc* (cadar args) result)) (t (bq-attach-append *bq-append* (car args) result))))) ((null args) result))) ;;------------------------------------------------------------------------------ (defun null-or-quoted (x) (or (null x) (and (consp x) (eq (car x) *bq-quote*)))) ;;------------------------------------------------------------------------------ (defun bq-attach-append (op item result) (cond ((or (null result) (equal result *bq-quote-nil*)) (if (bq-splicing-frob item) (list op item) item)) ((and (null-or-quoted item) (null-or-quoted result)) (list *bq-quote* (append (cadr item) (cadr result)))) ((and (consp result) (eq (car result) op)) (list* (car result) item (cdr result))) (t (list op item result)))) ;;------------------------------------------------------------------------------ (defun bq-attach-conses (items result) (cond ((and (every #'null-or-quoted items) (null-or-quoted result)) (list *bq-quote* (append (mapcar #'cadr items) (cadr result)))) ((or (null result) (equal result *bq-quote-nil*)) (cons *bq-list* items)) ((and (consp result) (or (eq (car result) *bq-list*) (eq (car result) *bq-list**))) (cons (car result) (append items (cdr result)))) (t (cons *bq-list** (append items (list result)))))) ;;------------------------------------------------------------------------------ (defun bq-remove-tokens (x) (cond ((atom x) (cond ((eq x *bq-list*) 'list) ((eq x *bq-append*) 'append) ((eq x *bq-nconc*) 'nconc) ((eq x *bq-list**) 'list*) ((eq x *bq-quote*) 'quote) (T x))) ((eq (car x) *bq-clobberable*) (bq-remove-tokens (cadr x))) ((and (eq (car x) *bq-list**) (consp (cddr x)) (null (cdddr x))) (cons 'cons (maptree #'bq-remove-tokens (cdr x)))) (T (maptree #'bq-remove-tokens x)))) ;;------------------------------------------------------------------------------ (defstruct (readtable (:copier nil) (:predicate readtablep) (:print-function (lambda (readtable stream depth) (declare (ignore readtable depth)) (write-string "#<readtable>" stream)))) fuer jedes Standard - Character ein Eintrag : NIL (= ILLEGAL ) , WHITESPACE , CONSTITUENT , SINGLE - ESCAPE , MULTI - ESCAPE , ;; (function . non-terminating-p) ;;------------------------------- (syntax (make-array char-code-limit :initial-element nil)) eine Association - List , die fuer jedes Dispatch - Character ;; das Dispatch-Array angiebt. ;;---------------------------- (dispatch nil)) ;;------------------------------------------------------------------------------ (defmacro get-fun (syntax) `(car ,syntax)) (defmacro terminating-p (syntax) `(null (cdr ,syntax))) (defmacro get-syntax (c) `(aref (readtable-syntax *readtable*) (char-code ,c)) ) ;;------------------------------------------------------------------------------ (defun copy-readtable (&optional (from *readtable*) (to nil)) (when (null from) (setq from *standard-readtable*)) (when (null to) (setq to (make-readtable))) (let ((syntax-from (readtable-syntax from)) (syntax-to (readtable-syntax to))) (dotimes (i char-code-limit) (setf (aref syntax-to i) (aref syntax-from i))) (setf (readtable-dispatch to) nil) (dolist (pair (readtable-dispatch from)) (when (car pair) (copy-dispatch-macro-character pair from to)))) to) ;;------------------------------------------------------------------------------ (defun set-syntax-from-char (to-char from-char &optional (to-readtable *readtable*) (from-readtable *standard-readtable*) &aux pair) (setf (aref (readtable-syntax to-readtable) (char-code to-char)) (aref (readtable-syntax from-readtable) (char-code from-char))) evtl . , wenn dispatch - character ueberschrieben ;;--------------------------------------------------------------------- (setq pair (assoc to-char (readtable-dispatch to-readtable))) (when pair (setf (car pair) nil) (setf (cdr pair) nil)) wenn dispatch - character , Kopie der Dispatch - Funktion erzeugen , die sich genauso wie die alte verhaelt . ;;-------------------------------------------------------------------- (setq pair (assoc from-char (readtable-dispatch from-readtable))) (when pair (copy-dispatch-macro-character pair from-readtable to-readtable)) t) ;;------------------------------------------------------------------------------ (defun copy-dispatch-macro-character (pair from to) (let ((c (car pair)) (dispatch-from (cdr pair)) dispatch-to) (make-dispatch-macro-character c (cdr (aref (readtable-syntax from) (char-code c))) to) (setq dispatch-to (cdr (assoc c (readtable-dispatch to)))) (dotimes (i char-code-limit) (setf (aref dispatch-to i) (aref dispatch-from i))))) ;;----------------------------------------------------------------------------- (defun set-macro-character (char function &optional non-terminating-p (readtable *readtable*)) (setf (aref (readtable-syntax readtable) (char-code char)) (cons function non-terminating-p)) evtl . , wenn dispatch - character ueberschrieben ;;--------------------------------------------------------------------- (let ((pair (assoc char (readtable-dispatch readtable)))) (when pair (setf (car pair) nil) (setf (cdr pair) nil))) t) ;;------------------------------------------------------------------------------ (defun get-macro-character (char &optional (readtable *readtable*)) (let ((entry (aref (readtable-syntax readtable) (char-code char)))) (if entry (values (car entry) (cdr entry)) nil))) ;;------------------------------------------------------------------------------ (defun make-dispatch-macro-character (char &optional non-terminating-p (readtable *readtable*)) (let ((dispatch-array (make-array char-code-limit :initial-element nil))) (setf (aref (readtable-syntax readtable) (char-code char)) (cons Dispatch - Reader ;;---------------- #'(lambda (stream char) (let* ((i nil) (c (read-char stream t nil t)) (d (digit-char-p c)) fun) (when d (setq i d) (loop (setq c (read-char stream t nil t)) (setq d (digit-char-p c)) (when (null d) (when *read-suppress* (setq i nil)) (return)) (setq i (+ d (* 10 i))))) (setq fun (aref dispatch-array (char-code (char-upcase c)))) (unless fun (error "no ~S dispatch function defined for subchar ~S ~ (with arg ~S)" char c i)) (funcall fun stream c i))) non-terminating-p)) (let ((pair (assoc char (readtable-dispatch readtable)))) (cond ;; altes dispatch-array ueberschreiben ;;------------------------------------ (pair (setf (cdr pair) dispatch-array)) Eintrag neu ;;-------------------- (T (push (cons char dispatch-array) (readtable-dispatch readtable)))))) t) ;;------------------------------------------------------------------------------ (defun set-dispatch-macro-character (disp-char sub-char function &optional (readtable *readtable*)) (let ((dispatch-array (cdr (assoc disp-char (readtable-dispatch readtable))))) (unless dispatch-array (error "~S is not a dispatch macro character" disp-char)) (setf (aref dispatch-array (char-code (char-upcase sub-char))) function)) t) ;;------------------------------------------------------------------------------ (defun get-dispatch-macro-character (disp-char sub-char &optional (readtable *readtable*)) (let ((dispatch-array (cdr (assoc disp-char (readtable-dispatch readtable))))) (unless dispatch-array (error "~S is not a dispatch macro character" disp-char)) (aref dispatch-array (char-code (char-upcase sub-char))))) ;;------------------------------------------------------------------------------ (defun read-token (stream c) (let ((multiple-escape nil) syntax (escape nil) (colon nil) colon-pos) (loop (setq syntax (get-syntax c)) (cond ((not multiple-escape) (case syntax (WHITESPACE Changed by ;; (when *preserve-whitespace* (unread-char c stream)) (unread-char c stream) (return)) (SINGLE-ESCAPE (setq c (read-char stream nil nil)) (unless c (error "unexpected End of File after single escape")) (setq escape t) (vector-push-extend c *token*)) (MULTIPLE-ESCAPE (setq escape t multiple-escape t)) ((nil) (error "illegal Character")) (t (when (and (consp syntax) (terminating-p syntax)) (unread-char c stream) (return)) (when (eql #\: c) (case colon ((nil) (setq colon 1) (setq colon-pos (fill-pointer *token*))) (1 (setq colon 2) (unless (eql colon-pos (1- (fill-pointer *token*))) (setq colon 3))) (t (setq colon 3)))) (vector-push-extend (char-upcase c) *token*)))) (T (case syntax (SINGLE-ESCAPE (setq c (read-char stream nil nil)) (unless c (error "unexpected End of File after single escape")) (vector-push-extend c *token*)) (MULTIPLE-ESCAPE (setq multiple-escape nil)) ((NIL) (error "illegal character")) (t (vector-push-extend c *token*))))) (setq c (read-char stream nil nil)) (unless c (when multiple-escape (error "unexpected End of File after multiple escape")) (return))) ;end of loop ;; nicht analysieren, wenn *READ-SUPPRESS* (when *read-suppress* (return-from read-token nil)) * token * als Zahl oder Symbol interpretieren ;;--------------------------------------------- (let ((i 0) (len (fill-pointer *token*)) (sign 1) (num1 0) (num2 0.0) (base *read-base*) c) (flet ( liest eine ;; (abhaengig von *read-base*). ;; Resultat: NIL , wenn 0 Ziffern gelesen wurden INTEGER , die durch die Ziffernfolge repraesentiert ;; wird, sonst. ;;--------------------------------------------------- (read-digits (&aux x d) (cond ((eql i len) nil) (T (setq x (digit-char-p (aref *token* i) base)) (cond ((null x) nil) (T (incf i) (loop (when (eql i len) (return x)) (setq d (digit-char-p (aref *token* i) base)) (when (null d) (return x)) (incf i) (setq x (+ (* base x) d)))))))) (read-sign () (if (eql i len) 1 (case (aref *token* i) (#\- (incf i) -1) (#\+ (incf i) 1) (t 1)))) (read-float2 (d &aux x) (loop (when (eql i len) (return)) (setq c (aref *token* i)) (setq x (digit-char-p c)) (when (null x) (return)) (incf i) (setq num2 (+ num2 (/ x d))) (setq d (* d 10.0))) num2)) ;;--------------- (tagbody (when (or escape colon) (go SYMBOL)) Wenn letztes Zeichen = # \. , ;;------------------------------------------------- (when (eql #\. (aref *token* (1- len))) (setq base 10)) (setq sign (read-sign)) (setq num1 (read-digits)) (when (null num1) (go FLOAT-DOT)) (when (eql i len) Integer ;;-------- (return-from read-token (* sign num1))) (setq c (aref *token* i)) (incf i) (cond ((eql #\. c) ;;---------------- (when (eql i len) (return-from read-token (* sign num1))) ;; evtl. Floating-Point ;;--------------------- (unless (eql base 10) (setq base 10) (setq i 0) (setq sign (read-sign)) (setq num1 (read-digits)) (incf i)) (setq num2 (read-float2 10.0)) (go FLOAT2)) ((eql #\/ c) (go RATIO2)) (T (go FLOAT-EXPT))) FLOAT-DOT (setq num1 0) (when (eql i len) (go SYMBOL)) (setq c (aref *token* i)) (incf i) (unless (eql #\. c) (go SYMBOL)) ;; nur ein Punkt ;;-------------- (when (eql i len) (go SYMBOL)) (setq c (aref *token* i)) (incf i) (setq num2 (digit-char-p c)) (when (null num2) (go SYMBOL)) (setq num2 (/ num2 10.0)) (setq num2 (read-float2 100.0)) FLOAT2 (when (eql i len) (return-from read-token (* sign (+ num1 num2)))) (setq c (aref *token* i)) (incf i) FLOAT-EXPT (unless (member (char-downcase c) '(#\e #\s #\f #\d #\l)) (go SYMBOL)) (when (eql i len) (go SYMBOL)) (setq base 10) (let ((e-sign (read-sign)) (expt (read-digits))) (when (or (null expt) (< i len)) (go Symbol)) (return-from read-token (* sign (+ num1 num2) (expt 10 (* e-sign expt))))) RATIO2 (setq num2 (read-digits)) (when (or (null num2) (< i len)) (go SYMBOL)) (let ((result (/ num1 num2))) (warn "ratio ~a/~a has been read as ~s" num1 num2 result) (return-from read-token result)) SYMBOL (cond kein Package angegeben ;;----------------------- ((null colon) (unless escape Pruefen ob der ' Dot ' einer Dotted - List vorliegt ;;------------------------------------------------ (when (and (eql len 1) (eql (aref *token* 0) #\.) *dot-flag*) (setq *dot-flag* nil) (return-from read-token nil)) ;; Pruefen ob das Symbol vollstaendig aus Dots besteht ;;---------------------------------------------------- (do ((i 0 (1+ i))) ((>= i len) (error "illegal token ~S" *token*)) (unless (eql #\. (aref *token* i)) (return)))) (return-from read-token (if *uninterned* (make-symbol *token*) (values (intern *token*))))) (*uninterned* (error "token may not contain colons")) KEYWORD ;;-------- ((eql colon-pos 0) (unless (eql colon 1) (error "illegal token ~S" *token*)) (return-from read-token (values (intern (subseq *token* 1) *keyword-package*)))) ;; Package ist angegeben ;;---------------------- (T (let* ((package-name (subseq *token* 0 colon-pos)) (package (find-package package-name)) (symbol-name (subseq *token* (+ colon-pos colon)))) (unless package (error "illegal package-name ~S" package-name)) (case colon (2 (return-from read-token (values (intern symbol-name package)))) (1 (multiple-value-bind (symbol where) (find-symbol symbol-name package) (unless (eql :external where) (error "can't find the external symbol ~S in ~S" symbol-name package)) (return-from read-token symbol))) (T (error "illegal Token ~S" *token*))))))))))) ;;------------------------------------------------------------------------------ ;; ignore-token stream liest ein token ;;------------------------------------------------------------------------------ (defun ignore-token (stream) (let ((c (read-char stream t nil t))) (read-token stream c) nil)) ;;------------------------------------------------------------------------------ die schliessende Klammer wird mittels ( read ) und nicht mit ( peek - char ) eingelesen , weil evtl . hinter dem letzten Element der Liste noch ;;------------------------------------------------------------------------------ (defun cons-reader (stream char) (declare (ignore char)) (let ((*dot-flag* t) (*parenthesis-open* #\)) list last-cons x) (setq x (bq-read stream)) (when (null *parenthesis-open*) (return-from cons-reader nil)) (when (null *dot-flag*) (error "Nothing appears before the dot in a list")) (setq list (setq last-cons (cons x nil))) (loop (setq x (bq-read stream)) (when (null *parenthesis-open*) (return list)) (cond kein Dot gelesen ;;----------------- (*dot-flag* (setq last-cons (setf (cdr last-cons) (cons x nil)))) Dot gelesen , Sonderbehandlung ;;------------------------------ (T (setf (cdr last-cons) (bq-read stream)) (when (null *parenthesis-open*) (error "Nothing appears after the dot in a list")) (bq-read stream) (unless (null *parenthesis-open*) (error "More than one object found after dot in a list")) (return list)))))) ;;------------------------------------------------------------------------------ (defun right-parenthesis-reader (stream char) (declare (ignore stream)) (cond ((eql char *parenthesis-open*) (setq *parenthesis-open* nil) nil) (T (warn "Ignoring an unmatched ~a" char) (values)))) ;;------------------------------------------------------------------------------ (defun quote-reader (stream char) (declare (ignore char)) (list 'QUOTE (bq-read stream))) ;;------------------------------------------------------------------------------ (defun semicolon-reader (stream char) (declare (ignore char)) (read-line stream nil nil nil) (values)) ;;------------------------------------------------------------------------------ (defun string-reader (stream char &aux c) (setf (fill-pointer *token*) 0) (loop (setq c (read-char stream t nil t)) (cond ((eql (get-syntax c) 'SINGLE-ESCAPE) (setq c (read-char stream t nil t)) (vector-push-extend c *token*)) ((eql char c) (return (copy-seq *token*))) (T (vector-push-extend c *token*))))) ;;------------------------------------------------------------------------------ (defun char-reader (stream char font) (declare (ignore char)) (let ((c (read-char stream t nil t)) (c2 (peek-char nil stream nil nil t))) ( 353 ): In the single - character case , ;; the character must be followed by a non-constituent character ;;-------------------------------------------------------------- (when (and c2 (eql 'CONSTITUENT (get-syntax c2))) ;; multiple-character case ;;------------------------ (setf (fill-pointer *token*) 0) (let ((*read-suppress* t)) (read-token stream c)) (unless *read-suppress* (setq c (name-char *token*)) (when (null c) (error "illegal character name ~s" *token*)))) (cond (*read-suppress* nil) (t (when (and font (> font 0)) (warn "font ~s of ~s will be ignored" font c)) c)))) ;;------------------------------------------------------------------------------ (defun function-reader (stream char i) (when i (extra-argument char)) (list 'function (bq-read stream))) ;;------------------------------------------------------------------------------ (defun vector-reader (stream char len) (let ((list (cons-reader stream char))) (cond (*read-suppress* nil) ((zerop *bq-level*) (if len (let ((listlen (length list))) (when (> listlen len) (error "Vector longer than specified length: #~S~S" len list)) (fill (replace (make-array len) list) (car (last list)) :start listlen)) (apply #'vector list))) (len (error "#~s( syntax is not allowed in backquoted expressions" len)) (t (cons *bq-vector* list))))) ;;------------------------------------------------------------------------------ (defun binary-reader (stream char i) (when i (extra-argument char)) (radix-reader stream char 2)) ;;------------------------------------------------------------------------------ (defun octal-reader (stream char i) (when i (extra-argument char)) (radix-reader stream char 8)) ;;------------------------------------------------------------------------------ (defun hex-reader (stream char i) (when i (extra-argument char)) (radix-reader stream char 16)) ;;------------------------------------------------------------------------------ (defun radix-reader (stream char radix) (cond (*read-suppress* (ignore-token stream)) ((not radix) (error "Radix missing in #R.")) ((not (<= 2 radix 36)) (error "Illegal radix for #R: ~D." radix)) (t (let ((res (let ((*read-base* radix)) (read stream t nil t)))) (unless (typep res 'integer #|rational|#) (error "#~A (base ~D) value is not a rational: ~S." char radix res)) res)))) ;;------------------------------------------------------------------------------ (defun uninterned-reader (stream char i) (when i (extra-argument char)) (let* ((*uninterned* T) (value (read stream t nil t))) (cond (*read-suppress* nil) ((symbolp value) value) (T (error "illegal value (~S) followed #:" value))))) ;;------------------------------------------------------------------------------ (defun array-reader (stream char n) (cond (*read-suppress* (read stream t nil t) nil) ((null n) (error "Rank argument must be supplied to #~a" char)) (t (let ((list (read stream t nil t))) (labels ((calc-dim (rank list) (cond ((eql 0 rank) ()) (T (cons (length list) (calc-dim (1- rank) (car list))))))) (make-array (calc-dim n list) :initial-contents list)))))) ;;------------------------------------------------------------------------------ (defun struct-reader (stream char i) (when i (extra-argument char)) (let ((list (read stream t nil t))) (cond (*read-suppress* nil) ((atom list) (error "illegal value (~s) followed #S" list)) (T (let ((constructor (rt:struct-constructor (car list))) (key-value-list (cdr list))) (unless constructor (error "~a is not a structure" (car list))) (do ((result ())) ((endp key-value-list) (apply constructor (nreverse result))) (push (intern (string (car key-value-list)) *keyword-package*) result) (pop key-value-list) (when (endp key-value-list) (error "unexpected end in #S~s" key-value-list)) (push (car key-value-list) result) (pop key-value-list))))))) ;;------------------------------------------------------------------------------ (defun feature-plus-reader (stream char i) (declare (ignore char)) (when i (extra-argument #\+)) (let ((feature (let ((*package* *keyword-package*)) (read stream t nil t)))) (if (eval-feature feature) (bq-read stream) (let ((*read-suppress* t)) (bq-read stream) (values))))) ;;------------------------------------------------------------------------------ (defun feature-minus-reader (stream char i) (declare (ignore char)) (when i (extra-argument #\-)) (let ((feature (let ((*package* *keyword-package*)) (read stream t nil t)))) (if (eval-feature feature) (let ((*read-suppress* t)) (bq-read stream) (values)) (bq-read stream)))) ;;------------------------------------------------------------------------------ (defun eval-feature (feature) (if (atom feature) (member feature *features*) (case (first feature) (not (not (eval-feature (second feature)))) (and (dolist (feature (cdr feature)) (unless (eval-feature feature) (return-from eval-feature nil))) T) (or (dolist (feature (cdr feature)) (when (eval-feature feature) (return-from eval-feature t))) nil) (T (error "illegal feature expression ~s" feature))))) ;;------------------------------------------------------------------------------ (defun comment-block-reader (stream char i) (declare (ignore char)) (when i (extra-argument #\|)) (let ((c (read-char stream t nil t)) (level 0)) (loop (cond ((eql #\| c) (setq c (read-char stream t nil t)) (when (eql #\# c) (when (eql 0 level) (return (values))) (decf level) (setq c (read-char stream t nil t)))) ((eql #\# c) (setq c (read-char stream t nil t)) (when (eql #\| c) (incf level) (setq c (read-char stream t nil t)))) (T (setq c (read-char stream t nil t))))))) ;;------------------------------------------------------------------------------ (defun extra-argument (c) (error "extra argument for #~S" c)) ;;------------------------------------------------------------------------------ (defun bq-read (stream) (internal-read stream t nil t)) ;;------------------------------------------------------------------------------ (defun internal-read (stream eof-error-p eof-value recursive-p) (prog1 (loop (let ((c (read-char stream nil nil)) syntax) (when (null c) (when (or eof-error-p recursive-p) (error "unexpected End of File")) (return-from internal-read eof-value)) (setq syntax (get-syntax c)) (case syntax (WHITESPACE) ;ignorieren ((CONSTITUENT SINGLE-ESCAPE MULTIPLE-ESCAPE) (return (progn (setf (fill-pointer *token*) 0) (read-token stream c)))) ((nil) (error "illegal Character")) ( Non- ) Terminating - Macro ;;------------------------- (T (multiple-value-call #'(lambda (&optional (v nil supplied)) (when supplied (return v))) (funcall (get-fun syntax) stream c)))))) (when (and (not recursive-p) (not *preserve-whitespace*)) (let ((c (read-char stream nil nil))) (cond EOF ( Annahme : stream ) ;; --------------------------------------------------------------- ((null c)) auf Top - Level ;; ------------------------------------- ((eql (get-syntax c) 'WHITESPACE)) Syntaktisch relevante ;; ------------------------------------------------------ (t (unread-char c stream))))))) ;;------------------------------------------------------------------------------ (defun read (&optional (stream *standard-input*) (eof-error-p t) (eof-value nil) (recursive-p nil)) (case stream ((nil) (setq stream *standard-input*)) ((t) (setq stream *terminal-io*))) (let ((*bq-level* 0)) (if recursive-p (internal-read stream eof-error-p eof-value recursive-p) (let ((*preserve-whitespace* nil)) (internal-read stream eof-error-p eof-value recursive-p))))) ;;------------------------------------------------------------------------------ (defun read-preserving-whitespace (&optional (stream *standard-input*) (eof-error-p t) (eof-value nil) (recursive-p nil)) (case stream ((nil) (setq stream *standard-input*)) ((t) (setq stream *terminal-io*))) (let ((*bq-level* 0)) (if recursive-p (internal-read stream eof-error-p eof-value recursive-p) (let ((*preserve-whitespace* t)) (internal-read stream eof-error-p eof-value recursive-p))))) ;;------------------------------------------------------------------------------ (defun read-delimited-list (char &optional stream recursive-p) (case stream ((nil) (setq stream *standard-input*)) ((T) (setq stream *terminal-io*))) (labels ((read-rest () (if (eql char (peek-char t stream t nil t)) (progn (read-char stream) nil) (cons (read stream t nil t) (read-rest))))) (read-rest))) ;;------------------------------------------------------------------------------ 2 Werte : 1 . string , 2 . ( member nil t ) , T = = eof ;;------------------------------------------------------------------------------ (defun read-line (&optional stream (eof-error-p t) eof-value recursive-p) (case stream ((nil) (setq stream *standard-input*)) ((T) (setq stream *terminal-io*))) (let ((c (read-char stream nil nil))) (cond ((null c) (when eof-error-p (error "unexpected end of file")) (values eof-value t)) (T (setf (fill-pointer *token*) 0) (loop (when (eql #\Newline c) (return (values (copy-seq *token*) nil))) (vector-push-extend c *token*) (setq c (read-char stream nil nil)) (when (null c) (return (values (copy-seq *token*) t)))))))) ;;------------------------------------------------------------------------------ (defun peek-char (&optional peek-type stream (eof-error-p t) eof-value recursive-p) (case stream ((nil) (setq stream *standard-input*)) ((T) (setq stream *terminal-io*))) (let ((c (read-char stream nil nil recursive-p))) (cond ((eq t peek-type) (loop (when (null c) (return)) (unless (eql 'WHITESPACE (get-syntax c)) (return)) (setq c (read-char stream nil nil recursive-p)))) ((characterp peek-type) (loop (when (null c) (return)) (unless (eql peek-type c) (return)) (setq c (read-char stream nil nil recursive-p))))) (when (null c) (when eof-error-p (error "unexpected end of file")) eof-value) (prog1 c (unread-char c stream)))) ;;------------------------------------------------------------------------------ (defun read-from-string (string &optional (eof-error-p t) eof-value &key (start 0) (end (length string)) ((:preserve-whitespace *preserve-whitespace*)) &aux index (*bq-level* 0)) (with-input-from-string (stream string :index index :start start :end end) (values (internal-read stream eof-error-p eof-value nil) index))) ;;------------------------------------------------------------------------------ (defun parse-integer (string &key (start 0) (end (length string)) (radix 10) (junk-allowed nil)) (prog (c x d sign) pruefen ob fuehrende WHITESPACE ;;-------------------------------- (loop (when (>= start end) (go NO-INTEGER)) (setq c (char string start)) (unless (eq 'WHITESPACE (get-syntax c)) (return))) ;; pruefen ob Vorzeichen ;;---------------------- (setq sign (case c (#\- (incf start) -1) (#\+ (incf start) 1) (t 1))) mindestens 1 Ziffer ;;-------------------------- (when (>= start end) (go NO-INTEGER)) (setq x (digit-char-p (char start start) radix)) (cond ((null x) (go NO-INTEGER)) (T (incf start) (loop (when (eql start end) (return)) (setq d (digit-char-p (char string start) radix)) (when (null d) (return)) (incf start) (setq x (+ (* radix x) d))))) ;; Integer gefunden ;;----------------- (cond (junk-allowed (return (values x start))) pruefen , ob nur WHITESPACE folgt ;;--------------------------------- (T (loop (when (>= start end) (return)) (setq c (char string start)) (unless (eq 'WHITESPACE (get-syntax c)) (go ERROR))) (return (values x start)))) NO-INTEGER (when junk-allowed (return (values nil start))) ERROR (error "illegal integer ~S" string))) ;;------------------------------------------------------------------------------ (defun make-standard-readtable () (let* ((rtab (make-readtable)) (syntax (readtable-syntax rtab))) (dolist (whitespace-char '(#\tab #\newline #\page #\return #\space)) (setf (aref syntax (char-code whitespace-char)) 'WHITESPACE)) (setf (aref syntax (char-code #\backspace)) 'CONSTITUENT) (do ((i (char-code #\!) (1+ i))) ((>= i (char-code #\rubout))) (setf (aref syntax i) 'CONSTITUENT)) (setf (aref syntax (char-code #\\)) 'SINGLE-ESCAPE) (setf (aref syntax (char-code #\|)) 'MULTIPLE-ESCAPE) (make-dispatch-macro-character #\# T rtab) (set-dispatch-macro-character #\# #\\ #'char-reader rtab) (set-dispatch-macro-character #\# #\' #'function-reader rtab) (set-dispatch-macro-character #\# #\( #'vector-reader rtab) (set-dispatch-macro-character #\# #\: #'uninterned-reader rtab) (set-dispatch-macro-character #\# #\B #'binary-reader rtab) (set-dispatch-macro-character #\# #\O #'octal-reader rtab) (set-dispatch-macro-character #\# #\X #'hex-reader rtab) (set-dispatch-macro-character #\# #\R #'radix-reader rtab) (set-dispatch-macro-character #\# #\A #'array-reader rtab) (set-dispatch-macro-character #\# #\S #'struct-reader rtab) (set-dispatch-macro-character #\# #\+ #'feature-plus-reader rtab) (set-dispatch-macro-character #\# #\- #'feature-minus-reader rtab) (set-dispatch-macro-character #\# #\| #'comment-block-reader rtab) (set-macro-character #\' #'quote-reader NIL rtab) (set-macro-character #\( #'cons-reader NIL rtab) (set-macro-character #\) #'right-parenthesis-reader NIL rtab) (set-macro-character #\, #'comma-reader NIL rtab) # ' semicolon - reader NIL rtab ) (set-macro-character #\" #'string-reader NIL rtab) (set-macro-character #\` #'backquote-reader NIL rtab) rtab))
null
https://raw.githubusercontent.com/hoelzl/Clicc/cea01db35301144967dc74fd2f96dd58aa52d6ea/src/runtime/lisp/read.lisp
lisp
----------------------------------------------------------------------------- ----------------------------------------------------------------------------- ------------------------------------------------------ - Backquote-Reader + Simplifier - READ - READ-PRESERVING-WHITESPACE - READ-DELIMITED-LIST - READ-LINE - PEEK-CHAR - READ-FROM-STRING $Log: read.lisp,v $ Revision 1.14 1994/06/03 09:51:05 hk Revision 1.13 1994/06/02 14:10:19 hk Revision 1.11 1994/02/17 16:16:35 hk Revision 1.10 1994/01/11 16:11:47 hk Revision 1.9 1993/11/29 12:26:40 uho readtable exportiert. Revision 1.4 1993/04/22 10:48:21 hk (in-package "RUNTIME") -> (in-package "LISP"), clicc::declaim -> declaim, clicc::fun-spec (etc.) -> lisp::fun-spec (etc.) Revision 1.2 1993/01/11 15:04:27 hk structure -> struct Initial revision ----------------------------------------------------------------------------- ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ `basic --> (QUOTE basic) ------------------------- `#(x1 x2 x3 ... xn) --> (apply #'vector `(x1 x2 x3 ... xn)) ------------------------------------------------------------ `,form --> form ---------------- ------------------ ------------------ `(x1 x2 x3 ... xn . atom) --> ------------------------------ --> (append [x1] [x2 [x3] ... [xn] (quote atom)) ------------------------------------------------- `(x1 ... xn . ,form) --> (append [x1] ... [xn] form) ----------------------------------------------------- -------------------------------- -------------------------------- ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ (function . non-terminating-p) ------------------------------- das Dispatch-Array angiebt. ---------------------------- ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ --------------------------------------------------------------------- -------------------------------------------------------------------- ------------------------------------------------------------------------------ ----------------------------------------------------------------------------- --------------------------------------------------------------------- ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ---------------- altes dispatch-array ueberschreiben ------------------------------------ -------------------- ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ (when *preserve-whitespace* (unread-char c stream)) end of loop nicht analysieren, wenn *READ-SUPPRESS* --------------------------------------------- (abhaengig von *read-base*). Resultat: wird, sonst. --------------------------------------------------- --------------- ------------------------------------------------- -------- ---------------- evtl. Floating-Point --------------------- nur ein Punkt -------------- ----------------------- ------------------------------------------------ Pruefen ob das Symbol vollstaendig aus Dots besteht ---------------------------------------------------- -------- Package ist angegeben ---------------------- ------------------------------------------------------------------------------ ignore-token stream ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ----------------- ------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ the character must be followed by a non-constituent character -------------------------------------------------------------- multiple-character case ------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ rational ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ignorieren ------------------------- --------------------------------------------------------------- ------------------------------------- ------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ ------------------------------------------------------------------------------ -------------------------------- pruefen ob Vorzeichen ---------------------- -------------------------- Integer gefunden ----------------- --------------------------------- ------------------------------------------------------------------------------
Copyright ( C ) 1993 Christian - Albrechts - Universitaet zu Kiel , Germany Projekt : APPLY - A Practicable And Portable Lisp Implementation Funktion : Laufzeitsystem - Readtables , ( - READ - CHAR , UNREAD - CHAR -- > file.lisp ) - PARSE - INTEGER $ Revision : 1.14 $ Schreibfehler Print - Funktion f"ur readtable - Struktur . Revision 1.12 1994/05/31 12:05:06 hk Bessere warning " Uberfl"ussigen Test in struct - reader gestrichen , aufger"aumt , . in bq - attach - append bei ` ( ..... . const ) behoben . In ' read - token ' wird des look - ahead - Zeichens das Ende . Revision 1.8 1993/11/10 16:09:27 hk In read - from - string den zu T korrigiert . Revision 1.7 1993/07/14 13:50:42 hk Neue Reader fuer # b , # o , # x und # nR , vector - reader Revision 1.6 1993/06/16 15:20:38 hk Copyright eingefuegt . Revision 1.5 1993/05/07 08:55:22 hk Definitionen exportiert , defvar , defconstant , clicc / lib / . rt::set - xxx in ( setf xxx ) umgeschrieben . Definitionen und Anwendungen von / aus Package Runtime mit rt : . declaim fun - spec und declaim top - level - form gestrichen . Revision 1.3 1993/02/16 14:34:20 hk $ Revision : 1.14 $ eingefuegt Revision 1.1 1992/03/24 17:12:55 hk (in-package "LISP") (export '(*read-base* *read-suppress* *features* readtable readtablep copy-readtable set-syntax-from-char set-macro-character get-macro-character make-dispatch-macro-character set-dispatch-macro-character get-dispatch-macro-character read read-preserving-whitespace read-delimited-list read-line peek-char read-from-string parse-integer)) (defparameter *comma* (make-symbol "COMMA")) (defparameter *comma-atsign* (make-symbol "COMMA-ATSIGN")) (defparameter *comma-dot* (make-symbol "COMMA-DOT")) (defparameter *bq-list* (make-symbol "BQ-LIST")) (defparameter *bq-append* (make-symbol "BQ-APPEND")) (defparameter *bq-list** (make-symbol "BQ-LIST*")) (defparameter *bq-nconc* (make-symbol "BQ-NCONC")) (defparameter *bq-clobberable* (make-symbol "BQ-CLOBBERABLE")) (defparameter *bq-quote* (make-symbol "BQ-QUOTE")) (defparameter *bq-quote-nil* (list *bq-quote* nil)) (defparameter *bq-vector* (make-symbol "VECTOR")) (defparameter *bq-level* 0) (defparameter *read-base* 10) (defparameter *read-suppress* nil) (defparameter *features* nil) (defparameter *token* (make-array 80 :element-type 'character :fill-pointer 0 :adjustable t)) (defparameter *uninterned* nil) (defparameter *preserve-whitespace* nil) (defparameter *dot-flag* nil) (defparameter *parenthesis-open* nil) (defparameter *standard-readtable* (make-standard-readtable)) erst nach obiger Zeile Backquote ... angelehnt an " Backquote , Appendix C in CLtL , 2nd . " erweitert um Backquote in Vektoren . (defun backquote-reader (stream char) (declare (ignore char)) (incf *bq-level*) (prog1 (bq-completely-process (bq-read stream)) (decf *bq-level*))) (defun comma-reader (stream char) (declare (ignore char)) (when (<= *bq-level* 0) (error "A comma appeared outside of a backquote")) (decf *bq-level*) (prog1 (cons (case (peek-char nil stream t nil t) (#\@ (read-char stream t nil t) *comma-atsign*) (#\. (read-char stream t nil t) *comma-dot*) (otherwise *comma*)) (bq-read stream)) (incf *bq-level*))) (defun bq-completely-process (x) (bq-remove-tokens (bq-simplify (bq-process x)))) (defun bq-process (x) (cond ((atom x) (list *bq-quote* x)) ((eq (car x) *bq-vector*) (let ((list (bq-completely-process (cdr x)))) (if (eq 'QUOTE (car list)) (list *bq-quote* (apply #'vector (cadr list))) (list 'APPLY `#'VECTOR list)))) ((eq (car x) *comma*) (cdr x)) ` , @form -- > ERROR ((eq (car x) *comma-atsign*) (error ",@~S after `" (cdr x))) ` , .form -- > ERROR ((eq (car x) *comma-dot*) (error ",.~S after `" (cdr x))) (t (do ((p x (cdr p)) (q '() (cons (bracket (car p)) q))) ((atom p) (cons *bq-append* (nreconc q (list (list *bq-quote* p))))) (when (eq (car p) *comma*) (return (cons *bq-append* (nreconc q (list (cdr p)))))) ` ( x1 ... xn . , @form ) -- > ERROR (when (eq (car p) *comma-atsign*) (error "Dotted ,@~s" (cdr p))) ` ( x1 ... xn . , .form ) -- > ERROR (when (eq (car p) *comma-dot*) (error "Dotted ,@~s" (cdr p))))))) (defun bracket (x) (cond ((atom x) (list *bq-list* (bq-process x))) ((eq (car x) *comma*) (list *bq-list* (cdr x))) ((eq (car x) *comma-atsign*) (cdr x)) ((eq (car x) *comma-dot*) (list *bq-clobberable* (cdr x))) (t (list *bq-list* (bq-process x))))) (defun maptree (fn x) (if (atom x) (funcall fn x) (let ((a (funcall fn (car x))) (d (maptree fn (cdr x)))) (if (and (eql a (car x)) (eql d (cdr x))) x (cons a d))))) (defun bq-splicing-frob (x) (and (consp x) (or (eq (car x) *comma-atsign*) (eq (car x) *comma-dot*)))) (defun bq-frob (x) (and (consp x) (or (eq (car x) *comma*) (eq (car x) *comma-atsign*) (eq (car x) *comma-dot*)))) (defun bq-simplify (x) (if (atom x) x (let ((x (if (eq (car x) *bq-quote*) x (maptree #'bq-simplify x)))) (if (not (eq (car x) *bq-append*)) x (bq-simplify-args x))))) (defun bq-simplify-args (x) (do ((args (reverse (cdr x)) (cdr args)) (result nil (cond ((atom (car args)) (bq-attach-append *bq-append* (car args) result)) ((and (eq (caar args) *bq-list*) (notany #'bq-splicing-frob (cdar args))) (bq-attach-conses (cdar args) result)) ((and (eq (caar args) *bq-list**) (notany #'bq-splicing-frob (cdar args))) (bq-attach-conses (reverse (cdr (reverse (cdar args)))) (bq-attach-append *bq-append* (car (last (car args))) result))) ((and (eq (caar args) *bq-quote*) (consp (cadar args)) (not (bq-frob (cadar args))) (null (cddar args))) (bq-attach-conses (list (list *bq-quote* (caadar args))) result)) ((eq (caar args) *bq-clobberable*) (bq-attach-append *bq-nconc* (cadar args) result)) (t (bq-attach-append *bq-append* (car args) result))))) ((null args) result))) (defun null-or-quoted (x) (or (null x) (and (consp x) (eq (car x) *bq-quote*)))) (defun bq-attach-append (op item result) (cond ((or (null result) (equal result *bq-quote-nil*)) (if (bq-splicing-frob item) (list op item) item)) ((and (null-or-quoted item) (null-or-quoted result)) (list *bq-quote* (append (cadr item) (cadr result)))) ((and (consp result) (eq (car result) op)) (list* (car result) item (cdr result))) (t (list op item result)))) (defun bq-attach-conses (items result) (cond ((and (every #'null-or-quoted items) (null-or-quoted result)) (list *bq-quote* (append (mapcar #'cadr items) (cadr result)))) ((or (null result) (equal result *bq-quote-nil*)) (cons *bq-list* items)) ((and (consp result) (or (eq (car result) *bq-list*) (eq (car result) *bq-list**))) (cons (car result) (append items (cdr result)))) (t (cons *bq-list** (append items (list result)))))) (defun bq-remove-tokens (x) (cond ((atom x) (cond ((eq x *bq-list*) 'list) ((eq x *bq-append*) 'append) ((eq x *bq-nconc*) 'nconc) ((eq x *bq-list**) 'list*) ((eq x *bq-quote*) 'quote) (T x))) ((eq (car x) *bq-clobberable*) (bq-remove-tokens (cadr x))) ((and (eq (car x) *bq-list**) (consp (cddr x)) (null (cdddr x))) (cons 'cons (maptree #'bq-remove-tokens (cdr x)))) (T (maptree #'bq-remove-tokens x)))) (defstruct (readtable (:copier nil) (:predicate readtablep) (:print-function (lambda (readtable stream depth) (declare (ignore readtable depth)) (write-string "#<readtable>" stream)))) fuer jedes Standard - Character ein Eintrag : NIL (= ILLEGAL ) , WHITESPACE , CONSTITUENT , SINGLE - ESCAPE , MULTI - ESCAPE , (syntax (make-array char-code-limit :initial-element nil)) eine Association - List , die fuer jedes Dispatch - Character (dispatch nil)) (defmacro get-fun (syntax) `(car ,syntax)) (defmacro terminating-p (syntax) `(null (cdr ,syntax))) (defmacro get-syntax (c) `(aref (readtable-syntax *readtable*) (char-code ,c)) ) (defun copy-readtable (&optional (from *readtable*) (to nil)) (when (null from) (setq from *standard-readtable*)) (when (null to) (setq to (make-readtable))) (let ((syntax-from (readtable-syntax from)) (syntax-to (readtable-syntax to))) (dotimes (i char-code-limit) (setf (aref syntax-to i) (aref syntax-from i))) (setf (readtable-dispatch to) nil) (dolist (pair (readtable-dispatch from)) (when (car pair) (copy-dispatch-macro-character pair from to)))) to) (defun set-syntax-from-char (to-char from-char &optional (to-readtable *readtable*) (from-readtable *standard-readtable*) &aux pair) (setf (aref (readtable-syntax to-readtable) (char-code to-char)) (aref (readtable-syntax from-readtable) (char-code from-char))) evtl . , wenn dispatch - character ueberschrieben (setq pair (assoc to-char (readtable-dispatch to-readtable))) (when pair (setf (car pair) nil) (setf (cdr pair) nil)) wenn dispatch - character , Kopie der Dispatch - Funktion erzeugen , die sich genauso wie die alte verhaelt . (setq pair (assoc from-char (readtable-dispatch from-readtable))) (when pair (copy-dispatch-macro-character pair from-readtable to-readtable)) t) (defun copy-dispatch-macro-character (pair from to) (let ((c (car pair)) (dispatch-from (cdr pair)) dispatch-to) (make-dispatch-macro-character c (cdr (aref (readtable-syntax from) (char-code c))) to) (setq dispatch-to (cdr (assoc c (readtable-dispatch to)))) (dotimes (i char-code-limit) (setf (aref dispatch-to i) (aref dispatch-from i))))) (defun set-macro-character (char function &optional non-terminating-p (readtable *readtable*)) (setf (aref (readtable-syntax readtable) (char-code char)) (cons function non-terminating-p)) evtl . , wenn dispatch - character ueberschrieben (let ((pair (assoc char (readtable-dispatch readtable)))) (when pair (setf (car pair) nil) (setf (cdr pair) nil))) t) (defun get-macro-character (char &optional (readtable *readtable*)) (let ((entry (aref (readtable-syntax readtable) (char-code char)))) (if entry (values (car entry) (cdr entry)) nil))) (defun make-dispatch-macro-character (char &optional non-terminating-p (readtable *readtable*)) (let ((dispatch-array (make-array char-code-limit :initial-element nil))) (setf (aref (readtable-syntax readtable) (char-code char)) (cons Dispatch - Reader #'(lambda (stream char) (let* ((i nil) (c (read-char stream t nil t)) (d (digit-char-p c)) fun) (when d (setq i d) (loop (setq c (read-char stream t nil t)) (setq d (digit-char-p c)) (when (null d) (when *read-suppress* (setq i nil)) (return)) (setq i (+ d (* 10 i))))) (setq fun (aref dispatch-array (char-code (char-upcase c)))) (unless fun (error "no ~S dispatch function defined for subchar ~S ~ (with arg ~S)" char c i)) (funcall fun stream c i))) non-terminating-p)) (let ((pair (assoc char (readtable-dispatch readtable)))) (cond (pair (setf (cdr pair) dispatch-array)) Eintrag neu (T (push (cons char dispatch-array) (readtable-dispatch readtable)))))) t) (defun set-dispatch-macro-character (disp-char sub-char function &optional (readtable *readtable*)) (let ((dispatch-array (cdr (assoc disp-char (readtable-dispatch readtable))))) (unless dispatch-array (error "~S is not a dispatch macro character" disp-char)) (setf (aref dispatch-array (char-code (char-upcase sub-char))) function)) t) (defun get-dispatch-macro-character (disp-char sub-char &optional (readtable *readtable*)) (let ((dispatch-array (cdr (assoc disp-char (readtable-dispatch readtable))))) (unless dispatch-array (error "~S is not a dispatch macro character" disp-char)) (aref dispatch-array (char-code (char-upcase sub-char))))) (defun read-token (stream c) (let ((multiple-escape nil) syntax (escape nil) (colon nil) colon-pos) (loop (setq syntax (get-syntax c)) (cond ((not multiple-escape) (case syntax (WHITESPACE Changed by (unread-char c stream) (return)) (SINGLE-ESCAPE (setq c (read-char stream nil nil)) (unless c (error "unexpected End of File after single escape")) (setq escape t) (vector-push-extend c *token*)) (MULTIPLE-ESCAPE (setq escape t multiple-escape t)) ((nil) (error "illegal Character")) (t (when (and (consp syntax) (terminating-p syntax)) (unread-char c stream) (return)) (when (eql #\: c) (case colon ((nil) (setq colon 1) (setq colon-pos (fill-pointer *token*))) (1 (setq colon 2) (unless (eql colon-pos (1- (fill-pointer *token*))) (setq colon 3))) (t (setq colon 3)))) (vector-push-extend (char-upcase c) *token*)))) (T (case syntax (SINGLE-ESCAPE (setq c (read-char stream nil nil)) (unless c (error "unexpected End of File after single escape")) (vector-push-extend c *token*)) (MULTIPLE-ESCAPE (setq multiple-escape nil)) ((NIL) (error "illegal character")) (t (vector-push-extend c *token*))))) (setq c (read-char stream nil nil)) (unless c (when multiple-escape (error "unexpected End of File after multiple escape")) (when *read-suppress* (return-from read-token nil)) * token * als Zahl oder Symbol interpretieren (let ((i 0) (len (fill-pointer *token*)) (sign 1) (num1 0) (num2 0.0) (base *read-base*) c) (flet ( liest eine NIL , wenn 0 Ziffern gelesen wurden INTEGER , die durch die Ziffernfolge repraesentiert (read-digits (&aux x d) (cond ((eql i len) nil) (T (setq x (digit-char-p (aref *token* i) base)) (cond ((null x) nil) (T (incf i) (loop (when (eql i len) (return x)) (setq d (digit-char-p (aref *token* i) base)) (when (null d) (return x)) (incf i) (setq x (+ (* base x) d)))))))) (read-sign () (if (eql i len) 1 (case (aref *token* i) (#\- (incf i) -1) (#\+ (incf i) 1) (t 1)))) (read-float2 (d &aux x) (loop (when (eql i len) (return)) (setq c (aref *token* i)) (setq x (digit-char-p c)) (when (null x) (return)) (incf i) (setq num2 (+ num2 (/ x d))) (setq d (* d 10.0))) num2)) (tagbody (when (or escape colon) (go SYMBOL)) Wenn letztes Zeichen = # \. , (when (eql #\. (aref *token* (1- len))) (setq base 10)) (setq sign (read-sign)) (setq num1 (read-digits)) (when (null num1) (go FLOAT-DOT)) (when (eql i len) Integer (return-from read-token (* sign num1))) (setq c (aref *token* i)) (incf i) (cond ((eql #\. c) (when (eql i len) (return-from read-token (* sign num1))) (unless (eql base 10) (setq base 10) (setq i 0) (setq sign (read-sign)) (setq num1 (read-digits)) (incf i)) (setq num2 (read-float2 10.0)) (go FLOAT2)) ((eql #\/ c) (go RATIO2)) (T (go FLOAT-EXPT))) FLOAT-DOT (setq num1 0) (when (eql i len) (go SYMBOL)) (setq c (aref *token* i)) (incf i) (unless (eql #\. c) (go SYMBOL)) (when (eql i len) (go SYMBOL)) (setq c (aref *token* i)) (incf i) (setq num2 (digit-char-p c)) (when (null num2) (go SYMBOL)) (setq num2 (/ num2 10.0)) (setq num2 (read-float2 100.0)) FLOAT2 (when (eql i len) (return-from read-token (* sign (+ num1 num2)))) (setq c (aref *token* i)) (incf i) FLOAT-EXPT (unless (member (char-downcase c) '(#\e #\s #\f #\d #\l)) (go SYMBOL)) (when (eql i len) (go SYMBOL)) (setq base 10) (let ((e-sign (read-sign)) (expt (read-digits))) (when (or (null expt) (< i len)) (go Symbol)) (return-from read-token (* sign (+ num1 num2) (expt 10 (* e-sign expt))))) RATIO2 (setq num2 (read-digits)) (when (or (null num2) (< i len)) (go SYMBOL)) (let ((result (/ num1 num2))) (warn "ratio ~a/~a has been read as ~s" num1 num2 result) (return-from read-token result)) SYMBOL (cond kein Package angegeben ((null colon) (unless escape Pruefen ob der ' Dot ' einer Dotted - List vorliegt (when (and (eql len 1) (eql (aref *token* 0) #\.) *dot-flag*) (setq *dot-flag* nil) (return-from read-token nil)) (do ((i 0 (1+ i))) ((>= i len) (error "illegal token ~S" *token*)) (unless (eql #\. (aref *token* i)) (return)))) (return-from read-token (if *uninterned* (make-symbol *token*) (values (intern *token*))))) (*uninterned* (error "token may not contain colons")) KEYWORD ((eql colon-pos 0) (unless (eql colon 1) (error "illegal token ~S" *token*)) (return-from read-token (values (intern (subseq *token* 1) *keyword-package*)))) (T (let* ((package-name (subseq *token* 0 colon-pos)) (package (find-package package-name)) (symbol-name (subseq *token* (+ colon-pos colon)))) (unless package (error "illegal package-name ~S" package-name)) (case colon (2 (return-from read-token (values (intern symbol-name package)))) (1 (multiple-value-bind (symbol where) (find-symbol symbol-name package) (unless (eql :external where) (error "can't find the external symbol ~S in ~S" symbol-name package)) (return-from read-token symbol))) (T (error "illegal Token ~S" *token*))))))))))) liest ein token (defun ignore-token (stream) (let ((c (read-char stream t nil t))) (read-token stream c) nil)) die schliessende Klammer wird mittels ( read ) und nicht mit ( peek - char ) eingelesen , weil evtl . hinter dem letzten Element der Liste noch (defun cons-reader (stream char) (declare (ignore char)) (let ((*dot-flag* t) (*parenthesis-open* #\)) list last-cons x) (setq x (bq-read stream)) (when (null *parenthesis-open*) (return-from cons-reader nil)) (when (null *dot-flag*) (error "Nothing appears before the dot in a list")) (setq list (setq last-cons (cons x nil))) (loop (setq x (bq-read stream)) (when (null *parenthesis-open*) (return list)) (cond kein Dot gelesen (*dot-flag* (setq last-cons (setf (cdr last-cons) (cons x nil)))) Dot gelesen , Sonderbehandlung (T (setf (cdr last-cons) (bq-read stream)) (when (null *parenthesis-open*) (error "Nothing appears after the dot in a list")) (bq-read stream) (unless (null *parenthesis-open*) (error "More than one object found after dot in a list")) (return list)))))) (defun right-parenthesis-reader (stream char) (declare (ignore stream)) (cond ((eql char *parenthesis-open*) (setq *parenthesis-open* nil) nil) (T (warn "Ignoring an unmatched ~a" char) (values)))) (defun quote-reader (stream char) (declare (ignore char)) (list 'QUOTE (bq-read stream))) (defun semicolon-reader (stream char) (declare (ignore char)) (read-line stream nil nil nil) (values)) (defun string-reader (stream char &aux c) (setf (fill-pointer *token*) 0) (loop (setq c (read-char stream t nil t)) (cond ((eql (get-syntax c) 'SINGLE-ESCAPE) (setq c (read-char stream t nil t)) (vector-push-extend c *token*)) ((eql char c) (return (copy-seq *token*))) (T (vector-push-extend c *token*))))) (defun char-reader (stream char font) (declare (ignore char)) (let ((c (read-char stream t nil t)) (c2 (peek-char nil stream nil nil t))) ( 353 ): In the single - character case , (when (and c2 (eql 'CONSTITUENT (get-syntax c2))) (setf (fill-pointer *token*) 0) (let ((*read-suppress* t)) (read-token stream c)) (unless *read-suppress* (setq c (name-char *token*)) (when (null c) (error "illegal character name ~s" *token*)))) (cond (*read-suppress* nil) (t (when (and font (> font 0)) (warn "font ~s of ~s will be ignored" font c)) c)))) (defun function-reader (stream char i) (when i (extra-argument char)) (list 'function (bq-read stream))) (defun vector-reader (stream char len) (let ((list (cons-reader stream char))) (cond (*read-suppress* nil) ((zerop *bq-level*) (if len (let ((listlen (length list))) (when (> listlen len) (error "Vector longer than specified length: #~S~S" len list)) (fill (replace (make-array len) list) (car (last list)) :start listlen)) (apply #'vector list))) (len (error "#~s( syntax is not allowed in backquoted expressions" len)) (t (cons *bq-vector* list))))) (defun binary-reader (stream char i) (when i (extra-argument char)) (radix-reader stream char 2)) (defun octal-reader (stream char i) (when i (extra-argument char)) (radix-reader stream char 8)) (defun hex-reader (stream char i) (when i (extra-argument char)) (radix-reader stream char 16)) (defun radix-reader (stream char radix) (cond (*read-suppress* (ignore-token stream)) ((not radix) (error "Radix missing in #R.")) ((not (<= 2 radix 36)) (error "Illegal radix for #R: ~D." radix)) (t (let ((res (let ((*read-base* radix)) (read stream t nil t)))) (error "#~A (base ~D) value is not a rational: ~S." char radix res)) res)))) (defun uninterned-reader (stream char i) (when i (extra-argument char)) (let* ((*uninterned* T) (value (read stream t nil t))) (cond (*read-suppress* nil) ((symbolp value) value) (T (error "illegal value (~S) followed #:" value))))) (defun array-reader (stream char n) (cond (*read-suppress* (read stream t nil t) nil) ((null n) (error "Rank argument must be supplied to #~a" char)) (t (let ((list (read stream t nil t))) (labels ((calc-dim (rank list) (cond ((eql 0 rank) ()) (T (cons (length list) (calc-dim (1- rank) (car list))))))) (make-array (calc-dim n list) :initial-contents list)))))) (defun struct-reader (stream char i) (when i (extra-argument char)) (let ((list (read stream t nil t))) (cond (*read-suppress* nil) ((atom list) (error "illegal value (~s) followed #S" list)) (T (let ((constructor (rt:struct-constructor (car list))) (key-value-list (cdr list))) (unless constructor (error "~a is not a structure" (car list))) (do ((result ())) ((endp key-value-list) (apply constructor (nreverse result))) (push (intern (string (car key-value-list)) *keyword-package*) result) (pop key-value-list) (when (endp key-value-list) (error "unexpected end in #S~s" key-value-list)) (push (car key-value-list) result) (pop key-value-list))))))) (defun feature-plus-reader (stream char i) (declare (ignore char)) (when i (extra-argument #\+)) (let ((feature (let ((*package* *keyword-package*)) (read stream t nil t)))) (if (eval-feature feature) (bq-read stream) (let ((*read-suppress* t)) (bq-read stream) (values))))) (defun feature-minus-reader (stream char i) (declare (ignore char)) (when i (extra-argument #\-)) (let ((feature (let ((*package* *keyword-package*)) (read stream t nil t)))) (if (eval-feature feature) (let ((*read-suppress* t)) (bq-read stream) (values)) (bq-read stream)))) (defun eval-feature (feature) (if (atom feature) (member feature *features*) (case (first feature) (not (not (eval-feature (second feature)))) (and (dolist (feature (cdr feature)) (unless (eval-feature feature) (return-from eval-feature nil))) T) (or (dolist (feature (cdr feature)) (when (eval-feature feature) (return-from eval-feature t))) nil) (T (error "illegal feature expression ~s" feature))))) (defun comment-block-reader (stream char i) (declare (ignore char)) (when i (extra-argument #\|)) (let ((c (read-char stream t nil t)) (level 0)) (loop (cond ((eql #\| c) (setq c (read-char stream t nil t)) (when (eql #\# c) (when (eql 0 level) (return (values))) (decf level) (setq c (read-char stream t nil t)))) ((eql #\# c) (setq c (read-char stream t nil t)) (when (eql #\| c) (incf level) (setq c (read-char stream t nil t)))) (T (setq c (read-char stream t nil t))))))) (defun extra-argument (c) (error "extra argument for #~S" c)) (defun bq-read (stream) (internal-read stream t nil t)) (defun internal-read (stream eof-error-p eof-value recursive-p) (prog1 (loop (let ((c (read-char stream nil nil)) syntax) (when (null c) (when (or eof-error-p recursive-p) (error "unexpected End of File")) (return-from internal-read eof-value)) (setq syntax (get-syntax c)) (case syntax ((CONSTITUENT SINGLE-ESCAPE MULTIPLE-ESCAPE) (return (progn (setf (fill-pointer *token*) 0) (read-token stream c)))) ((nil) (error "illegal Character")) ( Non- ) Terminating - Macro (T (multiple-value-call #'(lambda (&optional (v nil supplied)) (when supplied (return v))) (funcall (get-fun syntax) stream c)))))) (when (and (not recursive-p) (not *preserve-whitespace*)) (let ((c (read-char stream nil nil))) (cond EOF ( Annahme : stream ) ((null c)) auf Top - Level ((eql (get-syntax c) 'WHITESPACE)) Syntaktisch relevante (t (unread-char c stream))))))) (defun read (&optional (stream *standard-input*) (eof-error-p t) (eof-value nil) (recursive-p nil)) (case stream ((nil) (setq stream *standard-input*)) ((t) (setq stream *terminal-io*))) (let ((*bq-level* 0)) (if recursive-p (internal-read stream eof-error-p eof-value recursive-p) (let ((*preserve-whitespace* nil)) (internal-read stream eof-error-p eof-value recursive-p))))) (defun read-preserving-whitespace (&optional (stream *standard-input*) (eof-error-p t) (eof-value nil) (recursive-p nil)) (case stream ((nil) (setq stream *standard-input*)) ((t) (setq stream *terminal-io*))) (let ((*bq-level* 0)) (if recursive-p (internal-read stream eof-error-p eof-value recursive-p) (let ((*preserve-whitespace* t)) (internal-read stream eof-error-p eof-value recursive-p))))) (defun read-delimited-list (char &optional stream recursive-p) (case stream ((nil) (setq stream *standard-input*)) ((T) (setq stream *terminal-io*))) (labels ((read-rest () (if (eql char (peek-char t stream t nil t)) (progn (read-char stream) nil) (cons (read stream t nil t) (read-rest))))) (read-rest))) 2 Werte : 1 . string , 2 . ( member nil t ) , T = = eof (defun read-line (&optional stream (eof-error-p t) eof-value recursive-p) (case stream ((nil) (setq stream *standard-input*)) ((T) (setq stream *terminal-io*))) (let ((c (read-char stream nil nil))) (cond ((null c) (when eof-error-p (error "unexpected end of file")) (values eof-value t)) (T (setf (fill-pointer *token*) 0) (loop (when (eql #\Newline c) (return (values (copy-seq *token*) nil))) (vector-push-extend c *token*) (setq c (read-char stream nil nil)) (when (null c) (return (values (copy-seq *token*) t)))))))) (defun peek-char (&optional peek-type stream (eof-error-p t) eof-value recursive-p) (case stream ((nil) (setq stream *standard-input*)) ((T) (setq stream *terminal-io*))) (let ((c (read-char stream nil nil recursive-p))) (cond ((eq t peek-type) (loop (when (null c) (return)) (unless (eql 'WHITESPACE (get-syntax c)) (return)) (setq c (read-char stream nil nil recursive-p)))) ((characterp peek-type) (loop (when (null c) (return)) (unless (eql peek-type c) (return)) (setq c (read-char stream nil nil recursive-p))))) (when (null c) (when eof-error-p (error "unexpected end of file")) eof-value) (prog1 c (unread-char c stream)))) (defun read-from-string (string &optional (eof-error-p t) eof-value &key (start 0) (end (length string)) ((:preserve-whitespace *preserve-whitespace*)) &aux index (*bq-level* 0)) (with-input-from-string (stream string :index index :start start :end end) (values (internal-read stream eof-error-p eof-value nil) index))) (defun parse-integer (string &key (start 0) (end (length string)) (radix 10) (junk-allowed nil)) (prog (c x d sign) pruefen ob fuehrende WHITESPACE (loop (when (>= start end) (go NO-INTEGER)) (setq c (char string start)) (unless (eq 'WHITESPACE (get-syntax c)) (return))) (setq sign (case c (#\- (incf start) -1) (#\+ (incf start) 1) (t 1))) mindestens 1 Ziffer (when (>= start end) (go NO-INTEGER)) (setq x (digit-char-p (char start start) radix)) (cond ((null x) (go NO-INTEGER)) (T (incf start) (loop (when (eql start end) (return)) (setq d (digit-char-p (char string start) radix)) (when (null d) (return)) (incf start) (setq x (+ (* radix x) d))))) (cond (junk-allowed (return (values x start))) pruefen , ob nur WHITESPACE folgt (T (loop (when (>= start end) (return)) (setq c (char string start)) (unless (eq 'WHITESPACE (get-syntax c)) (go ERROR))) (return (values x start)))) NO-INTEGER (when junk-allowed (return (values nil start))) ERROR (error "illegal integer ~S" string))) (defun make-standard-readtable () (let* ((rtab (make-readtable)) (syntax (readtable-syntax rtab))) (dolist (whitespace-char '(#\tab #\newline #\page #\return #\space)) (setf (aref syntax (char-code whitespace-char)) 'WHITESPACE)) (setf (aref syntax (char-code #\backspace)) 'CONSTITUENT) (do ((i (char-code #\!) (1+ i))) ((>= i (char-code #\rubout))) (setf (aref syntax i) 'CONSTITUENT)) (setf (aref syntax (char-code #\\)) 'SINGLE-ESCAPE) (setf (aref syntax (char-code #\|)) 'MULTIPLE-ESCAPE) (make-dispatch-macro-character #\# T rtab) (set-dispatch-macro-character #\# #\\ #'char-reader rtab) (set-dispatch-macro-character #\# #\' #'function-reader rtab) (set-dispatch-macro-character #\# #\( #'vector-reader rtab) (set-dispatch-macro-character #\# #\: #'uninterned-reader rtab) (set-dispatch-macro-character #\# #\B #'binary-reader rtab) (set-dispatch-macro-character #\# #\O #'octal-reader rtab) (set-dispatch-macro-character #\# #\X #'hex-reader rtab) (set-dispatch-macro-character #\# #\R #'radix-reader rtab) (set-dispatch-macro-character #\# #\A #'array-reader rtab) (set-dispatch-macro-character #\# #\S #'struct-reader rtab) (set-dispatch-macro-character #\# #\+ #'feature-plus-reader rtab) (set-dispatch-macro-character #\# #\- #'feature-minus-reader rtab) (set-dispatch-macro-character #\# #\| #'comment-block-reader rtab) (set-macro-character #\' #'quote-reader NIL rtab) (set-macro-character #\( #'cons-reader NIL rtab) (set-macro-character #\) #'right-parenthesis-reader NIL rtab) (set-macro-character #\, #'comma-reader NIL rtab) # ' semicolon - reader NIL rtab ) (set-macro-character #\" #'string-reader NIL rtab) (set-macro-character #\` #'backquote-reader NIL rtab) rtab))
3b7373c471208622a7f376793e32630fe3e79122e56617925f7ce22a3f5cb293
dalong0514/ITstudy
0101Utils-DumpObjectV1-2.lisp
Dump Object - Lists the ActiveX properties & methods of a supplied VLA - Object or VLA - Object equivalent of a supplied ename , handle , or DXF data list ;; obj - [vla/ent/lst/str] VLA-Object, Entity Name, DXF List, or Handle (defun c:dump nil (LM:dump (car (entsel)))) (defun c:dumpn nil (LM:dump (car (nentsel)))) (defun LM:dump ( arg ) (cond ( (= 'vla-object (type arg)) (vlax-dump-object arg t) ) ( (= 'ename (type arg)) (LM:dump (vlax-ename->vla-object arg)) ) ( (= 'list (type arg)) (LM:dump (cdr (assoc -1 arg))) ) ( (= 'str (type arg)) (LM:dump (handent arg)) ) ) (princ) ) (vl-load-com) (princ)
null
https://raw.githubusercontent.com/dalong0514/ITstudy/8a7f1708d11856a78016795268da67b6a7521115/004%E7%BC%96%E7%A8%8B%E8%AF%AD%E8%A8%80/07AutoLisp/04LeeMac-Library/0101Utils-DumpObjectV1-2.lisp
lisp
obj - [vla/ent/lst/str] VLA-Object, Entity Name, DXF List, or Handle
Dump Object - Lists the ActiveX properties & methods of a supplied VLA - Object or VLA - Object equivalent of a supplied ename , handle , or DXF data list (defun c:dump nil (LM:dump (car (entsel)))) (defun c:dumpn nil (LM:dump (car (nentsel)))) (defun LM:dump ( arg ) (cond ( (= 'vla-object (type arg)) (vlax-dump-object arg t) ) ( (= 'ename (type arg)) (LM:dump (vlax-ename->vla-object arg)) ) ( (= 'list (type arg)) (LM:dump (cdr (assoc -1 arg))) ) ( (= 'str (type arg)) (LM:dump (handent arg)) ) ) (princ) ) (vl-load-com) (princ)
f861ebde6a4576846e6553f31480aa0eb2e161427b412c331049ed9f2a2e0c47
jakemcc/sicp-study
ex4_13.clj
Exercise 4.13 Functionality has been added to environment.clj , environment_test.clj , ; section4.clj and section4_test.clj ; I decided to only have the variable become unbound in the current scope ( whatever the first frame of the environment is ) . This seems to make ; the most sense to me. Being able to traverse all the frames to remove ; a binding seems like the wrong thing. Especially when you consider that ; a variable could be bound at different frames.
null
https://raw.githubusercontent.com/jakemcc/sicp-study/3b9e3d6c8cc30ad92b0d9bbcbbbfe36a8413f89d/clojure/section4.1/src/ex4_13.clj
clojure
section4.clj and section4_test.clj I decided to only have the variable become unbound in the current the most sense to me. Being able to traverse all the frames to remove a binding seems like the wrong thing. Especially when you consider that a variable could be bound at different frames.
Exercise 4.13 Functionality has been added to environment.clj , environment_test.clj , scope ( whatever the first frame of the environment is ) . This seems to make
8dfed27ed46bfdec984c175d23b2d079a605ff84be05e313610eba810497fd8b
lilactown/dom
dom.clj
(ns town.lilac.dom "Macros for creating DOM expressions. See `$` for usage. Additional macros like `div`, `input`, `button` allow quick & easy creation of specific tags. The code emitted by `$` and friends is side effecting. You do not need to keep the value returned by `$` or any of the specific DOM macros. \"incremental-dom\" keeps track of the elements created and diffs the result against the DOM nodes on the page during `patch`. Calling `$` and friends outside of a `patch` call is a runtime error." (:refer-clojure :exclude [map meta time])) (def void-tags #{"area" "base" "br" "col" "embed" "hr" "img" "input" "link" "meta" "param" "source" "track" "wbr"}) (defmacro $ "Core macro for creating DOM expressions. Emits code that uses Google's \"incremental-dom\" library to create, diff and patch the DOM nodes on the page. `tag` (string) is the HTML tag you want to open. Optionally, a map of attributes may be passed in the second position to configure the resulting DOM node. For non-void tags, any other type and/or any additional arguments are emitted between the open and close tag calls. E.g. ($ \"div\" ($ \"input\")) will place the input inside of the div. Void tags (i.e. tags that do not close, for instance \"input\") do not emit any of its args." [tag & args] (let [[attrs children] (if (map? (first args)) [(first args) (rest args)] [nil args]) [key attrs] (if-let [key (:key attrs)] [key (dissoc attrs :key)] [nil attrs]) attrs (cond (contains? attrs :&) `(merge ~(dissoc attrs :&) ~(:& attrs)) (contains? attrs '&) `(merge ~(dissoc attrs '&) ~('& attrs)) :else attrs)] (if (contains? void-tags tag) `(void ~tag ~key ~attrs) `(do (open ~tag ~key ~attrs) ~@children (close ~tag))))) (declare input textarea option select a abbr address area article aside audio b base bdi bdo big blockquote body br button canvas caption cite code col colgroup data datalist dd del details dfn dialog div dl dt em embed fieldset figcaption figure footer form h1 h2 h3 h4 h5 h6 head header hr html i iframe img ins kbd keygen label legend li link main map mark menu menuitem meta meter nav noscript object ol optgroup output p param picture pre progress q rp rt ruby s samp script section small source span strong style sub summary sup table tbody td tfoot th thead time title tr track u ul var video wbr circle clipPath ellipse g line mask path pattern polyline rect svg defs linearGradient polygon radialGradient stop tspan) (def tags '[input textarea option select a abbr address area article aside audio b base bdi bdo big blockquote body br button canvas caption cite code col colgroup data datalist dd del details dfn dialog div dl dt em embed fieldset figcaption figure footer form h1 h2 h3 h4 h5 h6 head header hr html i iframe img ins kbd keygen label legend li link main map mark menu menuitem meta meter nav noscript object ol optgroup output p param picture pre progress q rp rt ruby s samp script section small source span strong style sub summary sup table tbody td tfoot th thead time title tr track u ul var video wbr]) (defn gen-tag [tag] `(defmacro ~tag [& args#] `($ ~(str '~tag) ~@args#))) (defmacro gen-tags [] `(do ~@(for [tag tags] (gen-tag tag)))) (gen-tags) (defmacro buffer [& body] `(binding [*buffer* (cljs.core/array)] ~@body (flush!))) (defmacro try [& body] (let [catch (last body) body (drop-last body)] `(try (buffer ~@body) ~catch))) ;; async runtime (defmacro async [& body] (let [fallback (last body) body (drop-last body) fn-sym (gensym "async-fn")] (when (not= 'fallback (first fallback)) (throw (ex-info "async expr requires (fallback ,,,) as last expression in body" {:body body}))) `((fn ~fn-sym [] (let [buffer# (cljs.core/array) parent# (get-current-element)] (try (buffer ~@body) (catch js/Promise e# (let [fallback-id# (gensym "fallback") TODO assert that fallback is a single element cmt1# (html-comment (str fallback-id#)) el# (do ~@(rest fallback)) cmt2# (html-comment (str "/" fallback-id#))] (.then e# (fn [result#] (patch-range cmt1# cmt2# ~fn-sym)))))))))))
null
https://raw.githubusercontent.com/lilactown/dom/eed9f4db8777bc9f32a300523404654d5496cc16/src/town/lilac/dom.clj
clojure
async runtime
(ns town.lilac.dom "Macros for creating DOM expressions. See `$` for usage. Additional macros like `div`, `input`, `button` allow quick & easy creation of specific tags. The code emitted by `$` and friends is side effecting. You do not need to keep the value returned by `$` or any of the specific DOM macros. \"incremental-dom\" keeps track of the elements created and diffs the result against the DOM nodes on the page during `patch`. Calling `$` and friends outside of a `patch` call is a runtime error." (:refer-clojure :exclude [map meta time])) (def void-tags #{"area" "base" "br" "col" "embed" "hr" "img" "input" "link" "meta" "param" "source" "track" "wbr"}) (defmacro $ "Core macro for creating DOM expressions. Emits code that uses Google's \"incremental-dom\" library to create, diff and patch the DOM nodes on the page. `tag` (string) is the HTML tag you want to open. Optionally, a map of attributes may be passed in the second position to configure the resulting DOM node. For non-void tags, any other type and/or any additional arguments are emitted between the open and close tag calls. E.g. ($ \"div\" ($ \"input\")) will place the input inside of the div. Void tags (i.e. tags that do not close, for instance \"input\") do not emit any of its args." [tag & args] (let [[attrs children] (if (map? (first args)) [(first args) (rest args)] [nil args]) [key attrs] (if-let [key (:key attrs)] [key (dissoc attrs :key)] [nil attrs]) attrs (cond (contains? attrs :&) `(merge ~(dissoc attrs :&) ~(:& attrs)) (contains? attrs '&) `(merge ~(dissoc attrs '&) ~('& attrs)) :else attrs)] (if (contains? void-tags tag) `(void ~tag ~key ~attrs) `(do (open ~tag ~key ~attrs) ~@children (close ~tag))))) (declare input textarea option select a abbr address area article aside audio b base bdi bdo big blockquote body br button canvas caption cite code col colgroup data datalist dd del details dfn dialog div dl dt em embed fieldset figcaption figure footer form h1 h2 h3 h4 h5 h6 head header hr html i iframe img ins kbd keygen label legend li link main map mark menu menuitem meta meter nav noscript object ol optgroup output p param picture pre progress q rp rt ruby s samp script section small source span strong style sub summary sup table tbody td tfoot th thead time title tr track u ul var video wbr circle clipPath ellipse g line mask path pattern polyline rect svg defs linearGradient polygon radialGradient stop tspan) (def tags '[input textarea option select a abbr address area article aside audio b base bdi bdo big blockquote body br button canvas caption cite code col colgroup data datalist dd del details dfn dialog div dl dt em embed fieldset figcaption figure footer form h1 h2 h3 h4 h5 h6 head header hr html i iframe img ins kbd keygen label legend li link main map mark menu menuitem meta meter nav noscript object ol optgroup output p param picture pre progress q rp rt ruby s samp script section small source span strong style sub summary sup table tbody td tfoot th thead time title tr track u ul var video wbr]) (defn gen-tag [tag] `(defmacro ~tag [& args#] `($ ~(str '~tag) ~@args#))) (defmacro gen-tags [] `(do ~@(for [tag tags] (gen-tag tag)))) (gen-tags) (defmacro buffer [& body] `(binding [*buffer* (cljs.core/array)] ~@body (flush!))) (defmacro try [& body] (let [catch (last body) body (drop-last body)] `(try (buffer ~@body) ~catch))) (defmacro async [& body] (let [fallback (last body) body (drop-last body) fn-sym (gensym "async-fn")] (when (not= 'fallback (first fallback)) (throw (ex-info "async expr requires (fallback ,,,) as last expression in body" {:body body}))) `((fn ~fn-sym [] (let [buffer# (cljs.core/array) parent# (get-current-element)] (try (buffer ~@body) (catch js/Promise e# (let [fallback-id# (gensym "fallback") TODO assert that fallback is a single element cmt1# (html-comment (str fallback-id#)) el# (do ~@(rest fallback)) cmt2# (html-comment (str "/" fallback-id#))] (.then e# (fn [result#] (patch-range cmt1# cmt2# ~fn-sym)))))))))))
50b1c9625b3183a5c5d4f730f515ed27ece5f79f3fc099ddaa5a35efe5cbdb10
acieroid/scala-am
car-counter.scm
(define foldr (lambda (f base lst) (define foldr-aux (lambda (lst) (if (null? lst) base (f (car lst) (foldr-aux (cdr lst)))))) (foldr-aux lst))) (define result '()) (define display2 (lambda (i) (set! result (cons i result)))) (define newline2 (lambda () (set! result (cons 'newline result)))) (define error2 (lambda (e) (set! result (cons (list 'error e) result)))) (define (maak-buffer) (let ((inhoud '())) (define (newValue value) (set! inhoud (append inhoud (list value)))) (define (returnSum) (foldr + 0 inhoud)) (define (flush) (set! inhoud '())) (define (value pos) (list-ref inhoud pos)) (define (dispatch msg) (cond ((eq? msg 'newValue) newValue) ((eq? msg 'return) inhoud) ((eq? msg 'returnSum) (returnSum)) ((eq? msg 'flush) (flush)) ((eq? msg 'value) value) ((eq? msg 'size) (length inhoud)) (else (error "wrong message")))) dispatch)) (define buffer (maak-buffer)) ((buffer 'newValue) 3) ((buffer 'newValue) 9) (define res1 (and (= (buffer 'returnSum) 12) (equal? (buffer 'return) '(3 9)) (begin (buffer 'flush)) (null? (buffer 'return)))) (define (make-counter) (let ((state 0)) (define (increment) (set! state (+ state 1))) (define (read) state) (define (reset) (set! state 0)) (define (dispatch msg) (cond ((eq? msg 'increment) (increment)) ((eq? msg 'read) (read)) ((eq? msg 'reset) (reset)) (else (error "wrong message")))) dispatch)) (define (maak-verkeersteller) (let ((voorbijgereden (make-counter)) (buffer (maak-buffer))) (define (newCar) (voorbijgereden 'increment)) (define (newHour) ((buffer 'newValue) (voorbijgereden 'read)) (voorbijgereden 'reset)) (define (newDay) (define (loop start end) (cond ((= start end) (newline)) (else (display2 "Tussen ") (display2 start) (display2 " en ") (display2 (+ start 1)) (display2 " uur : ") (display2 ((buffer 'value) start)) (display2 " auto's") (newline2) (loop (+ start 1) end)))) (if (= (buffer 'size) 24) (begin (loop 0 24) (buffer 'flush) (voorbijgereden 'reset)) (error2 "no 24 hours have passed"))) (define (dispatch msg) (cond ((eq? msg 'newCar) (newCar)) ((eq? msg 'newHour) (newHour)) ((eq? msg 'newDay) (newDay)) (else (error2 "wrong message")))) dispatch)) (define verkeersteller (maak-verkeersteller)) (verkeersteller 'newCar) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newCar) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newDay) (verkeersteller 'newHour) (verkeersteller 'newDay) (equal? result '(newline newline " auto's" 1 " uur : " 24 " en " 23 "Tussen " newline " auto's" 1 " uur : " 23 " en " 22 "Tussen " newline " auto's" 2 " uur : " 22 " en " 21 "Tussen " newline " auto's" 0 " uur : " 21 " en " 20 "Tussen " newline " auto's" 1 " uur : " 20 " en " 19 "Tussen " newline " auto's" 0 " uur : " 19 " en " 18 "Tussen " newline " auto's" 1 " uur : " 18 " en " 17 "Tussen " newline " auto's" 0 " uur : " 17 " en " 16 "Tussen " newline " auto's" 1 " uur : " 16 " en " 15 "Tussen " newline " auto's" 1 " uur : " 15 " en " 14 "Tussen " newline " auto's" 0 " uur : " 14 " en " 13 "Tussen " newline " auto's" 0 " uur : " 13 " en " 12 "Tussen " newline " auto's" 0 " uur : " 12 " en " 11 "Tussen " newline " auto's" 1 " uur : " 11 " en " 10 "Tussen " newline " auto's" 2 " uur : " 10 " en " 9 "Tussen " newline " auto's" 2 " uur : " 9 " en " 8 "Tussen " newline " auto's" 0 " uur : " 8 " en " 7 "Tussen " newline " auto's" 0 " uur : " 7 " en " 6 "Tussen " newline " auto's" 1 " uur : " 6 " en " 5 "Tussen " newline " auto's" 0 " uur : " 5 " en " 4 "Tussen " newline " auto's" 0 " uur : " 4 " en " 3 "Tussen " newline " auto's" 3 " uur : " 3 " en " 2 "Tussen " newline " auto's" 0 " uur : " 2 " en " 1 "Tussen " newline " auto's" 2 " uur : " 1 " en " 0 "Tussen " (error2 "no 24 hours have passed")))
null
https://raw.githubusercontent.com/acieroid/scala-am/13ef3befbfc664b77f31f56847c30d60f4ee7dfe/test/R5RS/scp1/car-counter.scm
scheme
(define foldr (lambda (f base lst) (define foldr-aux (lambda (lst) (if (null? lst) base (f (car lst) (foldr-aux (cdr lst)))))) (foldr-aux lst))) (define result '()) (define display2 (lambda (i) (set! result (cons i result)))) (define newline2 (lambda () (set! result (cons 'newline result)))) (define error2 (lambda (e) (set! result (cons (list 'error e) result)))) (define (maak-buffer) (let ((inhoud '())) (define (newValue value) (set! inhoud (append inhoud (list value)))) (define (returnSum) (foldr + 0 inhoud)) (define (flush) (set! inhoud '())) (define (value pos) (list-ref inhoud pos)) (define (dispatch msg) (cond ((eq? msg 'newValue) newValue) ((eq? msg 'return) inhoud) ((eq? msg 'returnSum) (returnSum)) ((eq? msg 'flush) (flush)) ((eq? msg 'value) value) ((eq? msg 'size) (length inhoud)) (else (error "wrong message")))) dispatch)) (define buffer (maak-buffer)) ((buffer 'newValue) 3) ((buffer 'newValue) 9) (define res1 (and (= (buffer 'returnSum) 12) (equal? (buffer 'return) '(3 9)) (begin (buffer 'flush)) (null? (buffer 'return)))) (define (make-counter) (let ((state 0)) (define (increment) (set! state (+ state 1))) (define (read) state) (define (reset) (set! state 0)) (define (dispatch msg) (cond ((eq? msg 'increment) (increment)) ((eq? msg 'read) (read)) ((eq? msg 'reset) (reset)) (else (error "wrong message")))) dispatch)) (define (maak-verkeersteller) (let ((voorbijgereden (make-counter)) (buffer (maak-buffer))) (define (newCar) (voorbijgereden 'increment)) (define (newHour) ((buffer 'newValue) (voorbijgereden 'read)) (voorbijgereden 'reset)) (define (newDay) (define (loop start end) (cond ((= start end) (newline)) (else (display2 "Tussen ") (display2 start) (display2 " en ") (display2 (+ start 1)) (display2 " uur : ") (display2 ((buffer 'value) start)) (display2 " auto's") (newline2) (loop (+ start 1) end)))) (if (= (buffer 'size) 24) (begin (loop 0 24) (buffer 'flush) (voorbijgereden 'reset)) (error2 "no 24 hours have passed"))) (define (dispatch msg) (cond ((eq? msg 'newCar) (newCar)) ((eq? msg 'newHour) (newHour)) ((eq? msg 'newDay) (newDay)) (else (error2 "wrong message")))) dispatch)) (define verkeersteller (maak-verkeersteller)) (verkeersteller 'newCar) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newCar) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newHour) (verkeersteller 'newCar) (verkeersteller 'newDay) (verkeersteller 'newHour) (verkeersteller 'newDay) (equal? result '(newline newline " auto's" 1 " uur : " 24 " en " 23 "Tussen " newline " auto's" 1 " uur : " 23 " en " 22 "Tussen " newline " auto's" 2 " uur : " 22 " en " 21 "Tussen " newline " auto's" 0 " uur : " 21 " en " 20 "Tussen " newline " auto's" 1 " uur : " 20 " en " 19 "Tussen " newline " auto's" 0 " uur : " 19 " en " 18 "Tussen " newline " auto's" 1 " uur : " 18 " en " 17 "Tussen " newline " auto's" 0 " uur : " 17 " en " 16 "Tussen " newline " auto's" 1 " uur : " 16 " en " 15 "Tussen " newline " auto's" 1 " uur : " 15 " en " 14 "Tussen " newline " auto's" 0 " uur : " 14 " en " 13 "Tussen " newline " auto's" 0 " uur : " 13 " en " 12 "Tussen " newline " auto's" 0 " uur : " 12 " en " 11 "Tussen " newline " auto's" 1 " uur : " 11 " en " 10 "Tussen " newline " auto's" 2 " uur : " 10 " en " 9 "Tussen " newline " auto's" 2 " uur : " 9 " en " 8 "Tussen " newline " auto's" 0 " uur : " 8 " en " 7 "Tussen " newline " auto's" 0 " uur : " 7 " en " 6 "Tussen " newline " auto's" 1 " uur : " 6 " en " 5 "Tussen " newline " auto's" 0 " uur : " 5 " en " 4 "Tussen " newline " auto's" 0 " uur : " 4 " en " 3 "Tussen " newline " auto's" 3 " uur : " 3 " en " 2 "Tussen " newline " auto's" 0 " uur : " 2 " en " 1 "Tussen " newline " auto's" 2 " uur : " 1 " en " 0 "Tussen " (error2 "no 24 hours have passed")))
576bd9c3f6be6baeb4ec19dd38f75c37987c7c778c19f13832e46848edd790f3
Eventuria/demonstration-gsd
Streaming.hs
{-# LANGUAGE OverloadedStrings #-} # LANGUAGE TypeFamilies # # LANGUAGE DuplicateRecordFields # # LANGUAGE MultiParamTypeClasses # # LANGUAGE FlexibleInstances # # LANGUAGE FlexibleContexts # # LANGUAGE NamedFieldPuns # module Eventuria.Libraries.PersistedStreamEngine.Instances.EventStore.Read.Streaming ( streamFromRangeInclusive, streamFromOffsetInclusive, streamAll, streamAllInfinitely) where import GHC.Natural import Control.Monad.IO.Class (MonadIO(liftIO)) import Control.Concurrent.Async (waitCatch) import Control.Exception import Data.Maybe import Data.Aeson import Streamly import qualified Streamly.Prelude as S import qualified Database.EventStore as EventStore import Eventuria.Commons.Logger.Core import qualified Eventuria.Libraries.PersistedStreamEngine.Instances.EventStore.Read.Subscribing as EventStore.Subscribing import Eventuria.Libraries.PersistedStreamEngine.Interface.PersistedItem import Eventuria.Libraries.PersistedStreamEngine.Interface.Offset import Eventuria.Libraries.PersistedStreamEngine.Instances.EventStore.EventStoreStream import Eventuria.Libraries.PersistedStreamEngine.Instances.EventStore.Client.Dependencies import Eventuria.Libraries.PersistedStreamEngine.Interface.Streamable streamFromRangeInclusive :: Streamable stream monad item => EventStoreStream item -> Offset -> Offset -> stream monad (Either SomeException (Persisted item)) streamFromRangeInclusive eventStoreStream @ EventStoreStream { clientDependencies = Dependencies { logger, credentials, connection }, streamName = streamName } fromOffset toOffset = do liftIO $ logInfo logger $ "streaming [" ++ (show fromOffset) ++ "..] > " ++ show streamName let batchSize = 100 commandFetched <- liftIO $ catch (EventStore.readEventsForward connection streamName (EventStore.eventNumber $ naturalFromInteger fromOffset) (fromInteger batchSize) EventStore.NoResolveLink (Just credentials) >>= waitCatch ) (\e @ SomeException {} -> do liftIO $ logInfo logger $ "[stream.from.offset] exception raised " ++ show e return $ Left e) case commandFetched of Right (EventStore.ReadSuccess slices) -> do case (filterBelowInclusive (getPersistedItemsFromSlices slices) toOffset) of persistedItems | (length persistedItems) == fromInteger batchSize -> (Right <$> S.fromList persistedItems) <> (streamFromOffsetInclusive eventStoreStream $ fromOffset + batchSize) persistedItems -> Right <$> S.fromList persistedItems Right (EventStore.ReadNoStream) -> do liftIO $ logInfo logger $ "> " ++ show streamName ++ " is not found." S.fromList [] Right (EventStore.ReadStreamDeleted e) -> return $ Left readStreamDeletedException Right (EventStore.ReadNotModified )-> return $ Left readNotModifiedException Right (EventStore.ReadError e) -> return $ Left readErrorException Right (EventStore.ReadAccessDenied e) -> return $ Left readAccessDeniedException Left (exception) -> do liftIO $ logInfo logger $ "[stream.from.offset] exception propagated " ++ show exception return $ Left exception where filterBelowInclusive :: [Persisted item] -> Offset -> [Persisted item] filterBelowInclusive items toOffset = filter (\PersistedItem {offset} -> offset <= toOffset ) items getPersistedItemsFromSlices :: FromJSON item => EventStore.Slice t -> [Persisted item] getPersistedItemsFromSlices slices = recordedEventToPersistedItem <$> EventStore.resolvedEventOriginal <$> EventStore.sliceEvents slices streamFromOffsetInclusive :: Streamable stream monad item => EventStoreStream item -> Offset -> stream monad (Either SomeException (Persisted item)) streamFromOffsetInclusive eventStoreStream @ EventStoreStream { clientDependencies = Dependencies { logger, credentials, connection }, streamName = streamName } fromOffset = do liftIO $ logInfo logger $ "streaming [" ++ (show fromOffset) ++ "..] > " ++ show streamName let batchSize = 100 commandFetched <- liftIO $ catch (EventStore.readEventsForward connection streamName (EventStore.eventNumber $ naturalFromInteger fromOffset) (fromInteger batchSize) EventStore.NoResolveLink (Just credentials) >>= waitCatch ) (\e @ SomeException {} -> do liftIO $ logInfo logger $ "[stream.from.offset] exception raised " ++ show e return $ Left e) case commandFetched of Right (EventStore.ReadSuccess slices) -> do case (getPersistedItemsFromSlices slices) of persistedItems | (length persistedItems) == fromInteger batchSize -> (Right <$> S.fromList persistedItems) <> (streamFromOffsetInclusive eventStoreStream $ fromOffset + batchSize) persistedItems -> Right <$> S.fromList persistedItems Right (EventStore.ReadNoStream) -> do liftIO $ logInfo logger $ "> " ++ show streamName ++ " is not found." S.fromList [] Right (EventStore.ReadStreamDeleted e) -> return $ Left readStreamDeletedException Right (EventStore.ReadNotModified )-> return $ Left readNotModifiedException Right (EventStore.ReadError e) -> return $ Left readErrorException Right (EventStore.ReadAccessDenied e) -> return $ Left readAccessDeniedException Left (exception) -> do liftIO $ logInfo logger $ "[stream.from.offset] exception propagated " ++ show exception return $ Left exception where getPersistedItemsFromSlices :: FromJSON item => EventStore.Slice t -> [Persisted item] getPersistedItemsFromSlices slices = recordedEventToPersistedItem <$> EventStore.resolvedEventOriginal <$> EventStore.sliceEvents slices streamAll :: Streamable stream monad item => EventStoreStream item -> stream monad (Either SomeException (Persisted item)) streamAll eventStoreStream = streamFromOffsetInclusive eventStoreStream 0 streamAllInfinitely :: Streamable stream monad item => EventStoreStream item -> stream monad (Either SomeException (Persisted item)) streamAllInfinitely eventStoreStream = (EventStore.Subscribing.subscribe eventStoreStream) `parallel` (streamAll eventStoreStream) recordedEventToPersistedItem :: FromJSON item => EventStore.RecordedEvent -> Persisted item recordedEventToPersistedItem recordedEvent = PersistedItem { offset = toInteger $ EventStore.recordedEventNumber recordedEvent, item = fromJust $ EventStore.recordedEventDataAsJson recordedEvent } data EvenStoreExceptionReason = ReadStreamDeleted | ReadNotModified | ReadError | ReadAccessDenied deriving Show instance Exception EvenStoreExceptionReason readStreamDeletedException,readNotModifiedException,readErrorException,readAccessDeniedException :: SomeException readStreamDeletedException = toException ReadStreamDeleted readNotModifiedException = toException ReadNotModified readErrorException = toException ReadError readAccessDeniedException = toException ReadAccessDenied
null
https://raw.githubusercontent.com/Eventuria/demonstration-gsd/5c7692b310086bc172d3fd4e1eaf09ae51ea468f/src/Eventuria/Libraries/PersistedStreamEngine/Instances/EventStore/Read/Streaming.hs
haskell
# LANGUAGE OverloadedStrings #
# LANGUAGE TypeFamilies # # LANGUAGE DuplicateRecordFields # # LANGUAGE MultiParamTypeClasses # # LANGUAGE FlexibleInstances # # LANGUAGE FlexibleContexts # # LANGUAGE NamedFieldPuns # module Eventuria.Libraries.PersistedStreamEngine.Instances.EventStore.Read.Streaming ( streamFromRangeInclusive, streamFromOffsetInclusive, streamAll, streamAllInfinitely) where import GHC.Natural import Control.Monad.IO.Class (MonadIO(liftIO)) import Control.Concurrent.Async (waitCatch) import Control.Exception import Data.Maybe import Data.Aeson import Streamly import qualified Streamly.Prelude as S import qualified Database.EventStore as EventStore import Eventuria.Commons.Logger.Core import qualified Eventuria.Libraries.PersistedStreamEngine.Instances.EventStore.Read.Subscribing as EventStore.Subscribing import Eventuria.Libraries.PersistedStreamEngine.Interface.PersistedItem import Eventuria.Libraries.PersistedStreamEngine.Interface.Offset import Eventuria.Libraries.PersistedStreamEngine.Instances.EventStore.EventStoreStream import Eventuria.Libraries.PersistedStreamEngine.Instances.EventStore.Client.Dependencies import Eventuria.Libraries.PersistedStreamEngine.Interface.Streamable streamFromRangeInclusive :: Streamable stream monad item => EventStoreStream item -> Offset -> Offset -> stream monad (Either SomeException (Persisted item)) streamFromRangeInclusive eventStoreStream @ EventStoreStream { clientDependencies = Dependencies { logger, credentials, connection }, streamName = streamName } fromOffset toOffset = do liftIO $ logInfo logger $ "streaming [" ++ (show fromOffset) ++ "..] > " ++ show streamName let batchSize = 100 commandFetched <- liftIO $ catch (EventStore.readEventsForward connection streamName (EventStore.eventNumber $ naturalFromInteger fromOffset) (fromInteger batchSize) EventStore.NoResolveLink (Just credentials) >>= waitCatch ) (\e @ SomeException {} -> do liftIO $ logInfo logger $ "[stream.from.offset] exception raised " ++ show e return $ Left e) case commandFetched of Right (EventStore.ReadSuccess slices) -> do case (filterBelowInclusive (getPersistedItemsFromSlices slices) toOffset) of persistedItems | (length persistedItems) == fromInteger batchSize -> (Right <$> S.fromList persistedItems) <> (streamFromOffsetInclusive eventStoreStream $ fromOffset + batchSize) persistedItems -> Right <$> S.fromList persistedItems Right (EventStore.ReadNoStream) -> do liftIO $ logInfo logger $ "> " ++ show streamName ++ " is not found." S.fromList [] Right (EventStore.ReadStreamDeleted e) -> return $ Left readStreamDeletedException Right (EventStore.ReadNotModified )-> return $ Left readNotModifiedException Right (EventStore.ReadError e) -> return $ Left readErrorException Right (EventStore.ReadAccessDenied e) -> return $ Left readAccessDeniedException Left (exception) -> do liftIO $ logInfo logger $ "[stream.from.offset] exception propagated " ++ show exception return $ Left exception where filterBelowInclusive :: [Persisted item] -> Offset -> [Persisted item] filterBelowInclusive items toOffset = filter (\PersistedItem {offset} -> offset <= toOffset ) items getPersistedItemsFromSlices :: FromJSON item => EventStore.Slice t -> [Persisted item] getPersistedItemsFromSlices slices = recordedEventToPersistedItem <$> EventStore.resolvedEventOriginal <$> EventStore.sliceEvents slices streamFromOffsetInclusive :: Streamable stream monad item => EventStoreStream item -> Offset -> stream monad (Either SomeException (Persisted item)) streamFromOffsetInclusive eventStoreStream @ EventStoreStream { clientDependencies = Dependencies { logger, credentials, connection }, streamName = streamName } fromOffset = do liftIO $ logInfo logger $ "streaming [" ++ (show fromOffset) ++ "..] > " ++ show streamName let batchSize = 100 commandFetched <- liftIO $ catch (EventStore.readEventsForward connection streamName (EventStore.eventNumber $ naturalFromInteger fromOffset) (fromInteger batchSize) EventStore.NoResolveLink (Just credentials) >>= waitCatch ) (\e @ SomeException {} -> do liftIO $ logInfo logger $ "[stream.from.offset] exception raised " ++ show e return $ Left e) case commandFetched of Right (EventStore.ReadSuccess slices) -> do case (getPersistedItemsFromSlices slices) of persistedItems | (length persistedItems) == fromInteger batchSize -> (Right <$> S.fromList persistedItems) <> (streamFromOffsetInclusive eventStoreStream $ fromOffset + batchSize) persistedItems -> Right <$> S.fromList persistedItems Right (EventStore.ReadNoStream) -> do liftIO $ logInfo logger $ "> " ++ show streamName ++ " is not found." S.fromList [] Right (EventStore.ReadStreamDeleted e) -> return $ Left readStreamDeletedException Right (EventStore.ReadNotModified )-> return $ Left readNotModifiedException Right (EventStore.ReadError e) -> return $ Left readErrorException Right (EventStore.ReadAccessDenied e) -> return $ Left readAccessDeniedException Left (exception) -> do liftIO $ logInfo logger $ "[stream.from.offset] exception propagated " ++ show exception return $ Left exception where getPersistedItemsFromSlices :: FromJSON item => EventStore.Slice t -> [Persisted item] getPersistedItemsFromSlices slices = recordedEventToPersistedItem <$> EventStore.resolvedEventOriginal <$> EventStore.sliceEvents slices streamAll :: Streamable stream monad item => EventStoreStream item -> stream monad (Either SomeException (Persisted item)) streamAll eventStoreStream = streamFromOffsetInclusive eventStoreStream 0 streamAllInfinitely :: Streamable stream monad item => EventStoreStream item -> stream monad (Either SomeException (Persisted item)) streamAllInfinitely eventStoreStream = (EventStore.Subscribing.subscribe eventStoreStream) `parallel` (streamAll eventStoreStream) recordedEventToPersistedItem :: FromJSON item => EventStore.RecordedEvent -> Persisted item recordedEventToPersistedItem recordedEvent = PersistedItem { offset = toInteger $ EventStore.recordedEventNumber recordedEvent, item = fromJust $ EventStore.recordedEventDataAsJson recordedEvent } data EvenStoreExceptionReason = ReadStreamDeleted | ReadNotModified | ReadError | ReadAccessDenied deriving Show instance Exception EvenStoreExceptionReason readStreamDeletedException,readNotModifiedException,readErrorException,readAccessDeniedException :: SomeException readStreamDeletedException = toException ReadStreamDeleted readNotModifiedException = toException ReadNotModified readErrorException = toException ReadError readAccessDeniedException = toException ReadAccessDenied
1c5ab6a9289d810665e7d466888f1c0dbf708efdeb91517a2186c6c84ef8591e
Zilliqa/scilla
Config.ml
This file is part of scilla . Copyright ( c ) 2018 - present Zilliqa Research Pvt . Ltd. scilla is free software : you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation , either version 3 of the License , or ( at your option ) any later version . scilla is distributed in the hope that it will be useful , but WITHOUT ANY WARRANTY ; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE . See the GNU General Public License for more details . You should have received a copy of the GNU General Public License along with scilla . If not , see < / > . This file is part of scilla. Copyright (c) 2018 - present Zilliqa Research Pvt. Ltd. scilla is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. scilla is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with scilla. If not, see </>. *) open Core type json_replacement = { vname : string; value : string } [@@deriving yojson] type replacement = { filename : string; line : int; col : int; replacee : string; (** Identifier that should be replaced. *) replacement : string; } [@@deriving yojson] type config = { json_replacements : json_replacement list; replacements : replacement list; } [@@deriving yojson] let from_file filename = try Yojson.Safe.from_file filename |> config_of_yojson with | Sys_error err -> Error err | Yojson.Json_error err -> Error (Printf.sprintf "%s is broken:\n%s" filename err) | _ -> Error (Printf.sprintf "%s is broken" filename)
null
https://raw.githubusercontent.com/Zilliqa/scilla/eec5d1c686f3a000de14707d0fe5245f0c430e0b/src/merge/Config.ml
ocaml
* Identifier that should be replaced.
This file is part of scilla . Copyright ( c ) 2018 - present Zilliqa Research Pvt . Ltd. scilla is free software : you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation , either version 3 of the License , or ( at your option ) any later version . scilla is distributed in the hope that it will be useful , but WITHOUT ANY WARRANTY ; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE . See the GNU General Public License for more details . You should have received a copy of the GNU General Public License along with scilla . If not , see < / > . This file is part of scilla. Copyright (c) 2018 - present Zilliqa Research Pvt. Ltd. scilla is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. scilla is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with scilla. If not, see </>. *) open Core type json_replacement = { vname : string; value : string } [@@deriving yojson] type replacement = { filename : string; line : int; col : int; replacement : string; } [@@deriving yojson] type config = { json_replacements : json_replacement list; replacements : replacement list; } [@@deriving yojson] let from_file filename = try Yojson.Safe.from_file filename |> config_of_yojson with | Sys_error err -> Error err | Yojson.Json_error err -> Error (Printf.sprintf "%s is broken:\n%s" filename err) | _ -> Error (Printf.sprintf "%s is broken" filename)
8900c1548a2ae695bd98eacb3c7e2e57d8c831b147d18c9494649f0e31a40eb1
typelead/intellij-eta
IElementType.hs
module FFI.Com.IntelliJ.Psi.Tree.IElementType where import P # CLASS " com.intellij.psi.tree . IElementType " # IElementType = IElementType (Object# IElementType) deriving Class foreign import java unsafe getIndex :: IElementType -> Short instance Ord IElementType where x <= y = getIndex x <= getIndex y instance Eq IElementType where x == y = getIndex x == getIndex y data {-# CLASS "com.intellij.psi.tree.IElementType[]" #-} IElementTypeArray = IElementTypeArray (Object# IElementTypeArray) deriving Class instance JArray IElementType IElementTypeArray instance Show IElementType where show = fromJString . toStringJava
null
https://raw.githubusercontent.com/typelead/intellij-eta/ee66d621aa0bfdf56d7d287279a9a54e89802cf9/plugin/src/main/eta/FFI/Com/IntelliJ/Psi/Tree/IElementType.hs
haskell
# CLASS "com.intellij.psi.tree.IElementType[]" #
module FFI.Com.IntelliJ.Psi.Tree.IElementType where import P # CLASS " com.intellij.psi.tree . IElementType " # IElementType = IElementType (Object# IElementType) deriving Class foreign import java unsafe getIndex :: IElementType -> Short instance Ord IElementType where x <= y = getIndex x <= getIndex y instance Eq IElementType where x == y = getIndex x == getIndex y IElementTypeArray = IElementTypeArray (Object# IElementTypeArray) deriving Class instance JArray IElementType IElementTypeArray instance Show IElementType where show = fromJString . toStringJava
0c365ab00845a9f9abd782814a91e9423a1c25e9ca5e9681b0044851403a17d0
serioga/webapp-clojure-2020
component.cljc
(ns app.rum.impl.component) #?(:clj (set! *warn-on-reflection* true) :cljs (set! *warn-on-infer* true)) •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• (defmulti create-component "Component constructor by ID keyword." :app.rum/component-id) (defmethod create-component :default [data] (println "Calling default `create-component` for" data)) ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••
null
https://raw.githubusercontent.com/serioga/webapp-clojure-2020/91a7170a1be287bbfa5b9279d697208f7f806f9b/src/app/rum/impl/component.cljc
clojure
(ns app.rum.impl.component) #?(:clj (set! *warn-on-reflection* true) :cljs (set! *warn-on-infer* true)) •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• (defmulti create-component "Component constructor by ID keyword." :app.rum/component-id) (defmethod create-component :default [data] (println "Calling default `create-component` for" data)) ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••
ec9e699c0e3de284d6d1874efd8fffd7e61fcdab8563e9e56b071de70cf11244
tanakh/ICFP2011
Y2CAtkQbMadan.hs
# LANGUAGE CPP # {-# OPTIONS -Wall #-} import Control.Applicative import qualified Control.Exception.Control as E import Control.Monad import Control.Monad.State import Data.Maybe import Data.List import Data.Vector ((!)) import qualified Data.Vector as V import LTG getFirstWorthEnemy :: Int -> LTG (Maybe Int) getFirstWorthEnemy dmg = do alives <- filterM (\ix -> do al <- isAlive False ix vt <- getVital False ix return (al && vt >= dmg)) [0..255] return $ listToMaybe alives getAnySlot :: LTG (Maybe Int) getAnySlot = do aliveidents <- filterM (\ix -> do al <- isAlive True ix fn <- getField True ix return (al && fn == VFun "I")) [0..255] return $ listToMaybe aliveidents ensureZombieDead :: Int -> LTG () ensureZombieDead target = do zombieReady <- isDead False target if zombieReady then do return () oops ! They revived 255 ! vit <- getVital False target aliveslot <- getAnySlot case (vit, aliveslot) of (1, Just slot) -> do -- dec num slot (255 - target) Dec $> slot ensureZombieDead target (1, Nothing) -> do return () (x, _) -> do killTarget target zombieLoop :: Int -> Int -> Int -> Int -> LTG () zombieLoop f4 f1 dmg target = do elms <- getFirstWorthEnemy dmg case elms of Nothing -> return () Just n -> do num f4 n copyTo f1 0 ensureZombieDead target f1 $< I zombieLoop f4 f1 dmg target ofN :: Int -> Value ofN x = VInt x ofC :: Card -> Value ofC x = VFun (cardName x) infixl 1 $| ($|) :: Value -> Value -> Value x $| y = VApp x y lazyApplyIntermediate :: Value -> Value -> Value lazyApplyIntermediate f g = -- S (K f) (K g) (ofC S) $| (ofC K $| f) $| (ofC K $| g) makeFieldsUnlessConstructed :: [(Int, Value)] -> LTG() -> LTG() makeFieldsUnlessConstructed pairs procedure = do ffs <- mapM (\(f, v) -> do k <- getField True f return (k == v)) pairs if and ffs then do lprint $ "Reusing " ++ show (map fst pairs) return () else do procedure makeFieldUnlessConstructed :: Int -> Value -> LTG() -> LTG() makeFieldUnlessConstructed f lval procedure = do makeFieldsUnlessConstructed [(f, lval)] procedure kyokoAnAn :: Int -> Int -> Int -> Int -> Int -> Int -> LTG () kyokoAnAn f1 f2 f4 f8 target dmg = do -- f1, f2: temp -- f4 -- target: zombie target -- reuse field 0 to speed up ff0 <- getField True 0 if ff0 == VInt dmg then do copyTo f8 0 else do num f8 dmg makeFieldsUnlessConstructed -- I know it's ugly [(0, (VApp (VApp (VFun "S") (VApp (VFun "K") (VApp (VFun "zombie") (VInt (255 - target))))) (VApp (VFun "K") (VApp (VApp (VFun "S") (VApp (VFun "K") (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VFun "help")) (VFun "I"))) (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "copy"))) (VApp (VFun "K") (VInt 2))))) (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "copy"))) (VApp (VFun "K") (VInt 3)))) (VFun "succ"))))) (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "copy"))) (VApp (VFun "K") (VInt 4))))))), (f2, VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VFun "help")) (VFun "I"))) (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "copy"))) (VApp (VFun "K") (VInt 2))))) (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "copy"))) (VApp (VFun "K") (VInt 3)))) (VFun "succ")))] $ do -- v[f4] <- S (S Help I) (lazyApply Copy f8) -- S (S Help I) makeFieldUnlessConstructed f2 (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VFun "help")) (VFun "I"))) (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "copy"))) (VApp (VFun "K") (VInt 2))))) (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "copy"))) (VApp (VFun "K") (VInt 3)))) (VFun "succ"))) $ do -- v[f2] <- (lazyApply Copy f8) num : clear f2 f2 $< Copy num 0 f8 lazyApply f2 0 0 $< Put -- v[f2] <- S (S Help I) v[f8]; loop body = S ( \x - > Help x x ) ( lazyApply Copy f8 ) -- num: kill f4 copyTo 0 f2 clear f2 f2 $< S f2 $< Help f2 $< I S $> f2 apply0 f2 -- S (S Help I) (S (K copy) (K 8)) v[f4 ] < - S ( lazyApply Copy f2 ) Succ ; loop next -- num: gen f2 clear f4 f4 $< Copy num 0 f2 lazyApply f4 0 0 $< Put S $> f4 f4 $< Succ -- v[f2] <- S f2 f4 -- num: kill f4 S $> f2 copyTo 0 f4 apply0 f2 -- v[f1] <- S (K v[f2]) (lazyApply Copy f4); zombie -- v[0] = v[f4] = (lazyApply Copy f4) clear f4 f4 $< Copy num 0 f4 lazyApply f4 0 0 $< Put copyTo 0 f4 -- use f2 but no help copyTo f1 f2 K $> f1 S $> f1 apply0 f1 num f4 (255-target) Zombie $> f4 lazyApply f4 f1 copyTo 0 f4 zombieLoop f4 f1 dmg target sittingDuck :: LTG() sittingDuck = do I $> 0 sittingDuck get 3 * 2^n or 2^n smaller than x getEasyInt :: Int -> Int getEasyInt x | (x <= 3) = x getEasyInt x = max (head $ filter (\y -> y * 2 > x) twos) (head $ filter (\y -> y * 2 > x) threep) where twos = map (2^) [(0::Int)..] threep = 1 : map (\n -> 3*(2^n)) [(0::Int)..] #ifdef KAMIJO Iize , omae wo , ! ! speedo :: Int -> Double speedo x | x == 0 = 0 | odd x = 1 + speedo (x-1) | even x = 1 + speedo (div x 2) getMaxEnemy :: LTG Int getMaxEnemy = do oppAlives <- filterM (isAlive False) [0..255] vitals <- mapM (getVital False) oppAlives let targets = zip oppAlives vitals umami (i, v) = (fromIntegral v * 2 ** (0-speedo i) , v) return $ snd $ maximum $ map umami targets #else debugTag::String debugTag = "kyoko" getMaxEnemy :: LTG Int getMaxEnemy = do oppAlives <- filterM (isAlive False) [0..255] vitals <- mapM (getVital False) oppAlives return $ maximum vitals #endif checkTarget :: Int -> LTG () checkTarget target = do isTargetAlive <- isAlive False target when isTargetAlive $ lerror "Not dead" killTarget :: Int -> LTG() killTarget target = do zombifySlotVital <- getVital False target let zombifySlotV = getEasyInt zombifySlotVital alives <- filterM (\x -> do v <- getVital True x return $ v > zombifySlotV) [1..255] -- dmg > 2 -> attack is issued -- Create wall between the cut, to control damage, if possible case length alives of n | n < 2 -> lerror "there are no vital" n | zombifySlotV > 1 && n >= 5 -> attack2 (alives !! 1) (alives !! 4) (255 - target) zombifySlotV _ | zombifySlotV > 1 -> attack2 (alives !! 0) (alives !! 1) (255 - target) zombifySlotV _ -> return () when (zombifySlotV > 1) $ checkTarget target chooseTarget :: LTG Int chooseTarget = do vs <- forM [255,254..240] $ \i -> do vit <- getVital False i return (vit, -i) return $ negate $ snd $ minimum vs kyoukoMain :: LTG() kyoukoMain = do target <- chooseTarget dmg <- getEasyInt <$> getMaxEnemy isTargetAlive <- isAlive False target when isTargetAlive $ killTarget target kyokoAnAn 1 3 4 2 target dmg mamisanMain :: LTG() mamisanMain = do let weapon = VApp (VApp (VFun "S") (VFun "dec")) (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "get"))) (VApp (VFun "K") (VInt 1)))) (VFun "succ")) f <- getField True 1 if (f/=weapon) then prepareMagicalBullet 1 2 else do alives <- fmap V.fromList $ mapM (isAlive True) [0..255] vitals <- fmap V.fromList $ mapM (getVital True) [0..255] let range i = [i .. min 255 (i+124)] deaths i = sum [if alives ! j && vitals ! j == 1 then 1 else 0 | j<-range i] damages i = sum [if alives ! j && vitals ! j >= 1 then 1 else 0 | j<-range i] withScore i = ((deaths i, damages i,- speedo i), i) target = snd $ maximum $ map withScore [0..255] summonMami 1 2 target keepAlive :: Int -> LTG () keepAlive ix = do d <- isDead True ix when d $ do _ <- revive ix keepAlive ix ignExc :: LTG a -> LTG () ignExc m = do mb <- E.try m case mb of Left (LTGError _) -> return () Right _ -> return () yose :: LTG () yose = do forever $ ignExc $ do keepAlive 0 num 0 0 forM_ [(0::Int)..255] $ \_ -> do keepAlive 0 keepAlive 1 copyTo 1 0 Dec $> 1 Succ $> 0 waruagaki :: LTG () waruagaki = do keepAlive 0 keepAlive 1 keepAlive 2 num 0 1 Inc $> 0 num 0 2 Inc $> 0 speedo :: Int -> Int speedo x | x == 0 = 0 | odd x = 1 + speedo (x-1) | even x = 1 + speedo (div x 2) main :: IO () main = runLTG $ do let range = 10 let necks = take (range) $ map snd $ sort $[(speedo i, i) | i<-[0..255]] forever $ do ds <- filterM (isDead True) necks enemyVs <- mapM (getVital False) [0..255] let mainPuellaMagi = if (maximum enemyVs <= 2) then mamisanMain else kyoukoMain if null ds then do turn <- getTurnCnt if turn >= 100000 - 1536 then do lprint "yose mode" yose else do lprint "normal mode" mb <- E.try mainPuellaMagi case mb of Left (LTGError e) -> do case e of "there are no vital" -> do lprint "waruagaki mode" waruagaki _ -> do lprint e return () Right _ -> do return () return () else do rankedTgt <- mapM rankDeads ds let reviveTgt = snd $ head $ sort rankedTgt lprint $ "Revive mode: " ++ show (sort rankedTgt) ignExc $ revive reviveTgt lprint "Revive done" return () rankDeads :: Int -> LTG (Int, Int) rankDeads i | i == 0 = return (0, i) | True = do fa <- isAlive True (i-1) return (if fa then 1 else 0, i) futureApply 1 2 18 3
null
https://raw.githubusercontent.com/tanakh/ICFP2011/db0d670cdbe12e9cef4242d6ab202a98c254412e/ai/Y2CAtkQbMadan.hs
haskell
# OPTIONS -Wall # dec S (K f) (K g) f1, f2: temp f4 target: zombie target reuse field 0 to speed up I know it's ugly v[f4] <- S (S Help I) (lazyApply Copy f8) S (S Help I) v[f2] <- (lazyApply Copy f8) v[f2] <- S (S Help I) v[f8]; loop body num: kill f4 S (S Help I) (S (K copy) (K 8)) num: gen f2 v[f2] <- S f2 f4 num: kill f4 v[f1] <- S (K v[f2]) (lazyApply Copy f4); zombie v[0] = v[f4] = (lazyApply Copy f4) use f2 but no help dmg > 2 -> attack is issued Create wall between the cut, to control damage, if possible
# LANGUAGE CPP # import Control.Applicative import qualified Control.Exception.Control as E import Control.Monad import Control.Monad.State import Data.Maybe import Data.List import Data.Vector ((!)) import qualified Data.Vector as V import LTG getFirstWorthEnemy :: Int -> LTG (Maybe Int) getFirstWorthEnemy dmg = do alives <- filterM (\ix -> do al <- isAlive False ix vt <- getVital False ix return (al && vt >= dmg)) [0..255] return $ listToMaybe alives getAnySlot :: LTG (Maybe Int) getAnySlot = do aliveidents <- filterM (\ix -> do al <- isAlive True ix fn <- getField True ix return (al && fn == VFun "I")) [0..255] return $ listToMaybe aliveidents ensureZombieDead :: Int -> LTG () ensureZombieDead target = do zombieReady <- isDead False target if zombieReady then do return () oops ! They revived 255 ! vit <- getVital False target aliveslot <- getAnySlot case (vit, aliveslot) of (1, Just slot) -> do num slot (255 - target) Dec $> slot ensureZombieDead target (1, Nothing) -> do return () (x, _) -> do killTarget target zombieLoop :: Int -> Int -> Int -> Int -> LTG () zombieLoop f4 f1 dmg target = do elms <- getFirstWorthEnemy dmg case elms of Nothing -> return () Just n -> do num f4 n copyTo f1 0 ensureZombieDead target f1 $< I zombieLoop f4 f1 dmg target ofN :: Int -> Value ofN x = VInt x ofC :: Card -> Value ofC x = VFun (cardName x) infixl 1 $| ($|) :: Value -> Value -> Value x $| y = VApp x y lazyApplyIntermediate :: Value -> Value -> Value lazyApplyIntermediate f g = (ofC S) $| (ofC K $| f) $| (ofC K $| g) makeFieldsUnlessConstructed :: [(Int, Value)] -> LTG() -> LTG() makeFieldsUnlessConstructed pairs procedure = do ffs <- mapM (\(f, v) -> do k <- getField True f return (k == v)) pairs if and ffs then do lprint $ "Reusing " ++ show (map fst pairs) return () else do procedure makeFieldUnlessConstructed :: Int -> Value -> LTG() -> LTG() makeFieldUnlessConstructed f lval procedure = do makeFieldsUnlessConstructed [(f, lval)] procedure kyokoAnAn :: Int -> Int -> Int -> Int -> Int -> Int -> LTG () kyokoAnAn f1 f2 f4 f8 target dmg = do ff0 <- getField True 0 if ff0 == VInt dmg then do copyTo f8 0 else do num f8 dmg makeFieldsUnlessConstructed [(0, (VApp (VApp (VFun "S") (VApp (VFun "K") (VApp (VFun "zombie") (VInt (255 - target))))) (VApp (VFun "K") (VApp (VApp (VFun "S") (VApp (VFun "K") (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VFun "help")) (VFun "I"))) (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "copy"))) (VApp (VFun "K") (VInt 2))))) (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "copy"))) (VApp (VFun "K") (VInt 3)))) (VFun "succ"))))) (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "copy"))) (VApp (VFun "K") (VInt 4))))))), (f2, VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VFun "help")) (VFun "I"))) (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "copy"))) (VApp (VFun "K") (VInt 2))))) (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "copy"))) (VApp (VFun "K") (VInt 3)))) (VFun "succ")))] $ do makeFieldUnlessConstructed f2 (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VFun "help")) (VFun "I"))) (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "copy"))) (VApp (VFun "K") (VInt 2))))) (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "copy"))) (VApp (VFun "K") (VInt 3)))) (VFun "succ"))) $ do num : clear f2 f2 $< Copy num 0 f8 lazyApply f2 0 0 $< Put = S ( \x - > Help x x ) ( lazyApply Copy f8 ) copyTo 0 f2 clear f2 f2 $< S f2 $< Help f2 $< I S $> f2 v[f4 ] < - S ( lazyApply Copy f2 ) Succ ; loop next clear f4 f4 $< Copy num 0 f2 lazyApply f4 0 0 $< Put S $> f4 f4 $< Succ S $> f2 copyTo 0 f4 apply0 f2 clear f4 f4 $< Copy num 0 f4 lazyApply f4 0 0 $< Put copyTo 0 f4 copyTo f1 f2 K $> f1 S $> f1 apply0 f1 num f4 (255-target) Zombie $> f4 lazyApply f4 f1 copyTo 0 f4 zombieLoop f4 f1 dmg target sittingDuck :: LTG() sittingDuck = do I $> 0 sittingDuck get 3 * 2^n or 2^n smaller than x getEasyInt :: Int -> Int getEasyInt x | (x <= 3) = x getEasyInt x = max (head $ filter (\y -> y * 2 > x) twos) (head $ filter (\y -> y * 2 > x) threep) where twos = map (2^) [(0::Int)..] threep = 1 : map (\n -> 3*(2^n)) [(0::Int)..] #ifdef KAMIJO Iize , omae wo , ! ! speedo :: Int -> Double speedo x | x == 0 = 0 | odd x = 1 + speedo (x-1) | even x = 1 + speedo (div x 2) getMaxEnemy :: LTG Int getMaxEnemy = do oppAlives <- filterM (isAlive False) [0..255] vitals <- mapM (getVital False) oppAlives let targets = zip oppAlives vitals umami (i, v) = (fromIntegral v * 2 ** (0-speedo i) , v) return $ snd $ maximum $ map umami targets #else debugTag::String debugTag = "kyoko" getMaxEnemy :: LTG Int getMaxEnemy = do oppAlives <- filterM (isAlive False) [0..255] vitals <- mapM (getVital False) oppAlives return $ maximum vitals #endif checkTarget :: Int -> LTG () checkTarget target = do isTargetAlive <- isAlive False target when isTargetAlive $ lerror "Not dead" killTarget :: Int -> LTG() killTarget target = do zombifySlotVital <- getVital False target let zombifySlotV = getEasyInt zombifySlotVital alives <- filterM (\x -> do v <- getVital True x return $ v > zombifySlotV) [1..255] case length alives of n | n < 2 -> lerror "there are no vital" n | zombifySlotV > 1 && n >= 5 -> attack2 (alives !! 1) (alives !! 4) (255 - target) zombifySlotV _ | zombifySlotV > 1 -> attack2 (alives !! 0) (alives !! 1) (255 - target) zombifySlotV _ -> return () when (zombifySlotV > 1) $ checkTarget target chooseTarget :: LTG Int chooseTarget = do vs <- forM [255,254..240] $ \i -> do vit <- getVital False i return (vit, -i) return $ negate $ snd $ minimum vs kyoukoMain :: LTG() kyoukoMain = do target <- chooseTarget dmg <- getEasyInt <$> getMaxEnemy isTargetAlive <- isAlive False target when isTargetAlive $ killTarget target kyokoAnAn 1 3 4 2 target dmg mamisanMain :: LTG() mamisanMain = do let weapon = VApp (VApp (VFun "S") (VFun "dec")) (VApp (VApp (VFun "S") (VApp (VApp (VFun "S") (VApp (VFun "K") (VFun "get"))) (VApp (VFun "K") (VInt 1)))) (VFun "succ")) f <- getField True 1 if (f/=weapon) then prepareMagicalBullet 1 2 else do alives <- fmap V.fromList $ mapM (isAlive True) [0..255] vitals <- fmap V.fromList $ mapM (getVital True) [0..255] let range i = [i .. min 255 (i+124)] deaths i = sum [if alives ! j && vitals ! j == 1 then 1 else 0 | j<-range i] damages i = sum [if alives ! j && vitals ! j >= 1 then 1 else 0 | j<-range i] withScore i = ((deaths i, damages i,- speedo i), i) target = snd $ maximum $ map withScore [0..255] summonMami 1 2 target keepAlive :: Int -> LTG () keepAlive ix = do d <- isDead True ix when d $ do _ <- revive ix keepAlive ix ignExc :: LTG a -> LTG () ignExc m = do mb <- E.try m case mb of Left (LTGError _) -> return () Right _ -> return () yose :: LTG () yose = do forever $ ignExc $ do keepAlive 0 num 0 0 forM_ [(0::Int)..255] $ \_ -> do keepAlive 0 keepAlive 1 copyTo 1 0 Dec $> 1 Succ $> 0 waruagaki :: LTG () waruagaki = do keepAlive 0 keepAlive 1 keepAlive 2 num 0 1 Inc $> 0 num 0 2 Inc $> 0 speedo :: Int -> Int speedo x | x == 0 = 0 | odd x = 1 + speedo (x-1) | even x = 1 + speedo (div x 2) main :: IO () main = runLTG $ do let range = 10 let necks = take (range) $ map snd $ sort $[(speedo i, i) | i<-[0..255]] forever $ do ds <- filterM (isDead True) necks enemyVs <- mapM (getVital False) [0..255] let mainPuellaMagi = if (maximum enemyVs <= 2) then mamisanMain else kyoukoMain if null ds then do turn <- getTurnCnt if turn >= 100000 - 1536 then do lprint "yose mode" yose else do lprint "normal mode" mb <- E.try mainPuellaMagi case mb of Left (LTGError e) -> do case e of "there are no vital" -> do lprint "waruagaki mode" waruagaki _ -> do lprint e return () Right _ -> do return () return () else do rankedTgt <- mapM rankDeads ds let reviveTgt = snd $ head $ sort rankedTgt lprint $ "Revive mode: " ++ show (sort rankedTgt) ignExc $ revive reviveTgt lprint "Revive done" return () rankDeads :: Int -> LTG (Int, Int) rankDeads i | i == 0 = return (0, i) | True = do fa <- isAlive True (i-1) return (if fa then 1 else 0, i) futureApply 1 2 18 3
ee683717327469cd0f779b62ca7e3c5d687b43eedc8968f8a8e82178b5df5638
timbertson/passe
lock.mli
type lock type proof exception Stale_lock val create : unit -> lock val is_empty : lock -> bool val use : ?proof:proof -> lock -> (proof -> 'a Lwt.t) -> 'a Lwt.t module Map (Ord: OrderedType.S) ( ) : sig val acquire : Ord.t -> ?proof:proof -> (proof -> 'a Lwt.t) -> 'a Lwt.t end
null
https://raw.githubusercontent.com/timbertson/passe/467a79ea0cd7b08a97b52be3bd1307a3bdf55799/src/server/lock.mli
ocaml
type lock type proof exception Stale_lock val create : unit -> lock val is_empty : lock -> bool val use : ?proof:proof -> lock -> (proof -> 'a Lwt.t) -> 'a Lwt.t module Map (Ord: OrderedType.S) ( ) : sig val acquire : Ord.t -> ?proof:proof -> (proof -> 'a Lwt.t) -> 'a Lwt.t end
2068fda2bce652566dc4d4ac35907cdd9d9b59c1fcecdb9d46b997665dbc22d5
cloudant-labs/dreyfus
dreyfus_blacklist_await_test.erl
Licensed under the Apache License , Version 2.0 ( the " License " ) ; you may not % use this file except in compliance with the License. You may obtain a copy of % the License at % % -2.0 % % Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an " AS IS " BASIS , WITHOUT % WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the % License for the specific language governing permissions and limitations under % the License. -module(dreyfus_blacklist_await_test). -include_lib("couch/include/couch_db.hrl"). -include_lib("dreyfus/include/dreyfus.hrl"). -include_lib("eunit/include/eunit.hrl"). -define(DDOC_ID, <<"_design/black_list_doc">>). -define(INDEX_NAME, <<"my_index">>). -define(DBNAME, <<"mydb">>). -define(TIMEOUT, 1000). start() -> test_util:start_couch([dreyfus]). stop(_) -> test_util:stop_couch([dreyfus]). setup() -> ok = meck:new(couch_log), ok = meck:expect(couch_log, notice, fun(_Fmt, _Args) -> ?debugFmt(_Fmt, _Args) end). teardown(_) -> ok = meck:unload(couch_log). dreyfus_blacklist_await_test_() -> { "dreyfus black_list_doc await tests", { setup, fun start/0, fun stop/1, { foreach, fun setup/0, fun teardown/1, [ fun do_not_await_1/0 ] } } }. do_not_await_1() -> ok = meck:new(dreyfus_index, [passthrough]), Denied = lists:flatten([?b2l(?DBNAME), ".", "black_list_doc", ".", "my_index"]), config:set("dreyfus_blacklist", Denied, "true"), dreyfus_test_util:wait_config_change(Denied, "true"), Index = #index{dbname=?DBNAME, name=?INDEX_NAME, ddoc_id=?DDOC_ID}, State = create_state(?DBNAME, Index, nil, nil, []), Msg = "Index Blocked from Updating - db: ~p, ddocid: ~p name: ~p", Return = wait_log_message(Msg, fun() -> {noreply, NewState} = dreyfus_index:handle_call({await, 1}, self(), State) end), ?assertEqual(Return, ok). wait_log_message(Fmt, Fun) -> ok = meck:reset(couch_log), Fun(), ok = meck:wait(couch_log, '_', [Fmt, '_'], 5000). create_state(DbName, Index, UPid, IPid, WList) -> {state, DbName, Index, UPid, IPid, WList}.
null
https://raw.githubusercontent.com/cloudant-labs/dreyfus/243d451a1f8c941bdfbeceb983419cba8e540c0b/test/dreyfus_blacklist_await_test.erl
erlang
use this file except in compliance with the License. You may obtain a copy of the License at -2.0 Unless required by applicable law or agreed to in writing, software WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License.
Licensed under the Apache License , Version 2.0 ( the " License " ) ; you may not distributed under the License is distributed on an " AS IS " BASIS , WITHOUT -module(dreyfus_blacklist_await_test). -include_lib("couch/include/couch_db.hrl"). -include_lib("dreyfus/include/dreyfus.hrl"). -include_lib("eunit/include/eunit.hrl"). -define(DDOC_ID, <<"_design/black_list_doc">>). -define(INDEX_NAME, <<"my_index">>). -define(DBNAME, <<"mydb">>). -define(TIMEOUT, 1000). start() -> test_util:start_couch([dreyfus]). stop(_) -> test_util:stop_couch([dreyfus]). setup() -> ok = meck:new(couch_log), ok = meck:expect(couch_log, notice, fun(_Fmt, _Args) -> ?debugFmt(_Fmt, _Args) end). teardown(_) -> ok = meck:unload(couch_log). dreyfus_blacklist_await_test_() -> { "dreyfus black_list_doc await tests", { setup, fun start/0, fun stop/1, { foreach, fun setup/0, fun teardown/1, [ fun do_not_await_1/0 ] } } }. do_not_await_1() -> ok = meck:new(dreyfus_index, [passthrough]), Denied = lists:flatten([?b2l(?DBNAME), ".", "black_list_doc", ".", "my_index"]), config:set("dreyfus_blacklist", Denied, "true"), dreyfus_test_util:wait_config_change(Denied, "true"), Index = #index{dbname=?DBNAME, name=?INDEX_NAME, ddoc_id=?DDOC_ID}, State = create_state(?DBNAME, Index, nil, nil, []), Msg = "Index Blocked from Updating - db: ~p, ddocid: ~p name: ~p", Return = wait_log_message(Msg, fun() -> {noreply, NewState} = dreyfus_index:handle_call({await, 1}, self(), State) end), ?assertEqual(Return, ok). wait_log_message(Fmt, Fun) -> ok = meck:reset(couch_log), Fun(), ok = meck:wait(couch_log, '_', [Fmt, '_'], 5000). create_state(DbName, Index, UPid, IPid, WList) -> {state, DbName, Index, UPid, IPid, WList}.
4e4b5ada1bbb4f3fbf623ed7dc1cc3602dd34ab1fd1a4e08a667860807c37ad4
pink-gorilla/goldly
bindings_static.cljc
(ns goldly.sci.bindings-static (:require [clojure.walk :as walk])) #_(def bindings-static {'println println}) (def ns-static {'walk {'postwalk walk/postwalk 'prewalk walk/prewalk 'keywordize-keys walk/keywordize-keys 'walk walk/walk 'postwalk-replace walk/postwalk-replace 'prewalk-replace walk/prewalk-replace 'stringify-keys walk/stringify-keys}})
null
https://raw.githubusercontent.com/pink-gorilla/goldly/c65f789671cedfc5f115191a2a4b51d787492ae5/goldly/src/goldly/sci/bindings_static.cljc
clojure
(ns goldly.sci.bindings-static (:require [clojure.walk :as walk])) #_(def bindings-static {'println println}) (def ns-static {'walk {'postwalk walk/postwalk 'prewalk walk/prewalk 'keywordize-keys walk/keywordize-keys 'walk walk/walk 'postwalk-replace walk/postwalk-replace 'prewalk-replace walk/prewalk-replace 'stringify-keys walk/stringify-keys}})
8f17bda76e1c959cd61c0be921a2e4f0749b581dc242b6ed83e6d47f9f5eea37
macchiato-framework/macchiato-core
params.cljs
(ns macchiato.test.middleware.params (:require [cljs.nodejs :as node] [macchiato.middleware.params :refer [wrap-params]] [macchiato.test.mock.request :refer [header request]] [macchiato.test.mock.util :refer [mock-handler raw-response ok-response]] [cljs.test :refer-macros [is are deftest testing use-fixtures]])) (defn wrapped-echo [req] ((mock-handler wrap-params (fn [req res rais] (res req))) req)) (deftest wrap-params-query-params-only (let [req {:query-string "foo=bar&biz=bat%25"} resp (wrapped-echo req)] (is (= {"foo" "bar" "biz" "bat%"} (:query-params resp))) (is (empty? (:form-params resp))) (is (= {"foo" "bar" "biz" "bat%"} (:params resp))))) (def readable (.-Readable (node/require "stream"))) (defn str->stream [s] (doto (doto (readable.)) (.push s) (.push nil))) (deftest wrap-params-query-and-form-params (let [req {:query-string "foo=bar" :headers {"content-type" "application/x-www-form-urlencoded"} :body "biz=bat%25"} resp (wrapped-echo req)] (is (= {"foo" "bar"} (:query-params resp))) (is (= {"biz" "bat%"} (:form-params resp))) (is (= {"foo" "bar" "biz" "bat%"} (:params resp))))) (deftest wrap-params-not-form-encoded (let [req {:headers {"content-type" "application/json"} :body "{foo: \"bar\"}"} resp (wrapped-echo req)] (is (empty? (:form-params resp))) (is (empty? (:params resp))))) (deftest wrap-params-always-assocs-maps (let [req {:query-string "" :headers {"content-type" "application/x-www-form-urlencoded"} :body ""} resp (wrapped-echo req)] (is (= {} (:query-params resp))) (is (= {} (:form-params resp))) (is (= {} (:params resp)))))
null
https://raw.githubusercontent.com/macchiato-framework/macchiato-core/14eac3dbc561927ee61b6127f30ef0b0269b2af6/test/macchiato/test/middleware/params.cljs
clojure
(ns macchiato.test.middleware.params (:require [cljs.nodejs :as node] [macchiato.middleware.params :refer [wrap-params]] [macchiato.test.mock.request :refer [header request]] [macchiato.test.mock.util :refer [mock-handler raw-response ok-response]] [cljs.test :refer-macros [is are deftest testing use-fixtures]])) (defn wrapped-echo [req] ((mock-handler wrap-params (fn [req res rais] (res req))) req)) (deftest wrap-params-query-params-only (let [req {:query-string "foo=bar&biz=bat%25"} resp (wrapped-echo req)] (is (= {"foo" "bar" "biz" "bat%"} (:query-params resp))) (is (empty? (:form-params resp))) (is (= {"foo" "bar" "biz" "bat%"} (:params resp))))) (def readable (.-Readable (node/require "stream"))) (defn str->stream [s] (doto (doto (readable.)) (.push s) (.push nil))) (deftest wrap-params-query-and-form-params (let [req {:query-string "foo=bar" :headers {"content-type" "application/x-www-form-urlencoded"} :body "biz=bat%25"} resp (wrapped-echo req)] (is (= {"foo" "bar"} (:query-params resp))) (is (= {"biz" "bat%"} (:form-params resp))) (is (= {"foo" "bar" "biz" "bat%"} (:params resp))))) (deftest wrap-params-not-form-encoded (let [req {:headers {"content-type" "application/json"} :body "{foo: \"bar\"}"} resp (wrapped-echo req)] (is (empty? (:form-params resp))) (is (empty? (:params resp))))) (deftest wrap-params-always-assocs-maps (let [req {:query-string "" :headers {"content-type" "application/x-www-form-urlencoded"} :body ""} resp (wrapped-echo req)] (is (= {} (:query-params resp))) (is (= {} (:form-params resp))) (is (= {} (:params resp)))))
bc91a72faba9ee660fea5b1320a5d221faa2457d62a7e5ce0e54d4a874316a5d
finnsson/hs2graphviz
Main.hs
module Main where import Hs2Dot.Src import System.Environment (getArgs) import System.IO (FilePath) import Control.Monad (filterM) import System.Directory (doesFileExist) main :: IO () main = do args <- getArgs files <- filterM doesFileExist args code <- files2dot (conf args) files putStr $ if null files then manual else code where conf args = if any (=="--high") args then ConfigHigh else if any (=="--low") args then ConfigLow else ConfigNormal manual :: String manual = "usage: hs2dot [files.hs]*\n" ++ "\n" ++ "The files must be Haskell source code that haskell-src-exts can parse.\n" ++ "Some restrictions apply to the source files that can be parsed!\n" -- Architecture: -- Main -- All IO -- Hs2Dot.Src -- Primary convertion-flow. -- Every 1-1-relation between functions and boxes and lines in the dot-file. Hs2Dot . SrcHelper Helper - functions for Language . Haskell . Exts - datatypes -- Hs2Dot.Dot -- Functions to create dot-code. Hs2Dot . DotHelper -- Helper-functions to create dot-code. Makes use of Hs2Dot.Dot -- Hs2Dot.Helper Generic helper - methods not relying on any specific API ( Language . . nor Dot )
null
https://raw.githubusercontent.com/finnsson/hs2graphviz/64969b6552c8408c5079e29c999c8fa968e7a08d/src/Main.hs
haskell
Architecture: Main All IO Hs2Dot.Src Primary convertion-flow. Every 1-1-relation between functions and boxes and lines in the dot-file. Hs2Dot.Dot Functions to create dot-code. Helper-functions to create dot-code. Makes use of Hs2Dot.Dot Hs2Dot.Helper
module Main where import Hs2Dot.Src import System.Environment (getArgs) import System.IO (FilePath) import Control.Monad (filterM) import System.Directory (doesFileExist) main :: IO () main = do args <- getArgs files <- filterM doesFileExist args code <- files2dot (conf args) files putStr $ if null files then manual else code where conf args = if any (=="--high") args then ConfigHigh else if any (=="--low") args then ConfigLow else ConfigNormal manual :: String manual = "usage: hs2dot [files.hs]*\n" ++ "\n" ++ "The files must be Haskell source code that haskell-src-exts can parse.\n" ++ "Some restrictions apply to the source files that can be parsed!\n" Hs2Dot . SrcHelper Helper - functions for Language . Haskell . Exts - datatypes Hs2Dot . DotHelper Generic helper - methods not relying on any specific API ( Language . . nor Dot )
47b185cdb319ebb4f5a2b5758bb86fc1efba96fc62c09c554d26762b871979cf
protz/mezzo
Exports.mli
(*****************************************************************************) (* Mezzo, a programming language based on permissions *) Copyright ( C ) 2011 , 2012 and (* *) (* This program is free software: you can redistribute it and/or modify *) it under the terms of the GNU General Public License as published by the Free Software Foundation , either version 3 of the License , or (* (at your option) any later version. *) (* *) (* This program is distributed in the hope that it will be useful, *) (* but WITHOUT ANY WARRANTY; without even the implied warranty of *) (* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the *) (* GNU General Public License for more details. *) (* *) You should have received a copy of the GNU General Public License (* along with this program. If not, see </>. *) (* *) (*****************************************************************************) (** Handling the names exported by interfaces and implementations. *) * From a very high - level perspective , the type - checker needs to maintain a map * from names to [ TypeCore.var]s . * - We need to map _ qualified _ names to [ var]s ( What is the [ var ] that stands * for " int::int " ? ) , and * - we need to map _ unqualified _ names to [ var]s ( This implementation * contains " val x " . Which [ var ] is " x " ? ) * * Qualified names are added to this map when importing an interface . * Unqualified names are added when type - checking an implementation . * * What does this have to do with kind - check ? Well , kind - check expects an * environment where all required interfaces have been _ imported _ . This means * that if there is an occurrence of module " m " in implementation " impl " , then * kind - checking expects " m::x " to be available in the environment . Opening a * module is managed internally by [ KindCheck ] and [ TransSurface ] . * * Rather than using a separate , high - level environment , which we would inject * into the kind - checking environment , we cheat and reuse kind - checking * environments as high - level environments . The invariant is that a high - level * environment only contains [ NonLocal ] bindings , either qualified or * unqualified . * from names to [TypeCore.var]s. * - We need to map _qualified_ names to [var]s (What is the [var] that stands * for "int::int"?), and * - we need to map _unqualified_ names to [var]s (This implementation * contains "val x". Which [var] is "x"?) * * Qualified names are added to this map when importing an interface. * Unqualified names are added when type-checking an implementation. * * What does this have to do with kind-check? Well, kind-check expects an * environment where all required interfaces have been _imported_. This means * that if there is an occurrence of module "m" in implementation "impl", then * kind-checking expects "m::x" to be available in the environment. Opening a * module is managed internally by [KindCheck] and [TransSurface]. * * Rather than using a separate, high-level environment, which we would inject * into the kind-checking environment, we cheat and reuse kind-checking * environments as high-level environments. The invariant is that a high-level * environment only contains [NonLocal] bindings, either qualified or * unqualified. *) type value_exports = (Variable.name * TypeCore.var) list type datacon_exports = (TypeCore.var * Datacon.name * SurfaceSyntax.datacon_info) list (** Record exported values in an implementation. This creates non-local, * unqualified bindings. One can reach these bindings using * [find_unqualified_var], for instance when printing a signature, or in the * test-suite, when poking at a specific variable. *) val bind_implementation_values: TypeCore.env -> value_exports -> TypeCore.env (** Record exported types and data constructors in an implementation. *) val bind_implementation_types: TypeCore.env -> TypeCore.data_type_group -> TypeCore.var list -> datacon_exports -> TypeCore.env (** Record exported values from an interface. This creates non-local, qualified * bindings. One can reach these bindings using [find_qualified_var] at any * time. Such bindings will be used by the kind-checking, translation and * type-checking phases. *) val bind_interface_value: TypeCore.env -> Module.name -> Variable.name -> TypeCore.var -> TypeCore.env (** Record exported types and data constructors from an interface. *) val bind_interface_types: TypeCore.env -> Module.name -> TypeCore.data_type_group -> TypeCore.var list -> datacon_exports -> TypeCore.env * [ find_qualified_var env mname x ] finds name [ x ] as exported by module * [ ] . Use this to reach values exported by _ interfaces _ which the current * program depends on . * [mname]. Use this to reach values exported by _interfaces_ which the current * program depends on. *) val find_qualified_var: TypeCore.env -> Module.name -> Variable.name -> TypeCore.var (** [find_unqualified_var env x] finds the name [x] as exported by the current * module. Use it after type-checking an _implementation_. *) val find_unqualified_var: TypeCore.env -> Variable.name -> TypeCore.var
null
https://raw.githubusercontent.com/protz/mezzo/4e9d917558bd96067437116341b7a6ea02ab9c39/typing/Exports.mli
ocaml
*************************************************************************** Mezzo, a programming language based on permissions This program is free software: you can redistribute it and/or modify (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. along with this program. If not, see </>. *************************************************************************** * Handling the names exported by interfaces and implementations. * Record exported values in an implementation. This creates non-local, * unqualified bindings. One can reach these bindings using * [find_unqualified_var], for instance when printing a signature, or in the * test-suite, when poking at a specific variable. * Record exported types and data constructors in an implementation. * Record exported values from an interface. This creates non-local, qualified * bindings. One can reach these bindings using [find_qualified_var] at any * time. Such bindings will be used by the kind-checking, translation and * type-checking phases. * Record exported types and data constructors from an interface. * [find_unqualified_var env x] finds the name [x] as exported by the current * module. Use it after type-checking an _implementation_.
Copyright ( C ) 2011 , 2012 and it under the terms of the GNU General Public License as published by the Free Software Foundation , either version 3 of the License , or You should have received a copy of the GNU General Public License * From a very high - level perspective , the type - checker needs to maintain a map * from names to [ TypeCore.var]s . * - We need to map _ qualified _ names to [ var]s ( What is the [ var ] that stands * for " int::int " ? ) , and * - we need to map _ unqualified _ names to [ var]s ( This implementation * contains " val x " . Which [ var ] is " x " ? ) * * Qualified names are added to this map when importing an interface . * Unqualified names are added when type - checking an implementation . * * What does this have to do with kind - check ? Well , kind - check expects an * environment where all required interfaces have been _ imported _ . This means * that if there is an occurrence of module " m " in implementation " impl " , then * kind - checking expects " m::x " to be available in the environment . Opening a * module is managed internally by [ KindCheck ] and [ TransSurface ] . * * Rather than using a separate , high - level environment , which we would inject * into the kind - checking environment , we cheat and reuse kind - checking * environments as high - level environments . The invariant is that a high - level * environment only contains [ NonLocal ] bindings , either qualified or * unqualified . * from names to [TypeCore.var]s. * - We need to map _qualified_ names to [var]s (What is the [var] that stands * for "int::int"?), and * - we need to map _unqualified_ names to [var]s (This implementation * contains "val x". Which [var] is "x"?) * * Qualified names are added to this map when importing an interface. * Unqualified names are added when type-checking an implementation. * * What does this have to do with kind-check? Well, kind-check expects an * environment where all required interfaces have been _imported_. This means * that if there is an occurrence of module "m" in implementation "impl", then * kind-checking expects "m::x" to be available in the environment. Opening a * module is managed internally by [KindCheck] and [TransSurface]. * * Rather than using a separate, high-level environment, which we would inject * into the kind-checking environment, we cheat and reuse kind-checking * environments as high-level environments. The invariant is that a high-level * environment only contains [NonLocal] bindings, either qualified or * unqualified. *) type value_exports = (Variable.name * TypeCore.var) list type datacon_exports = (TypeCore.var * Datacon.name * SurfaceSyntax.datacon_info) list val bind_implementation_values: TypeCore.env -> value_exports -> TypeCore.env val bind_implementation_types: TypeCore.env -> TypeCore.data_type_group -> TypeCore.var list -> datacon_exports -> TypeCore.env val bind_interface_value: TypeCore.env -> Module.name -> Variable.name -> TypeCore.var -> TypeCore.env val bind_interface_types: TypeCore.env -> Module.name -> TypeCore.data_type_group -> TypeCore.var list -> datacon_exports -> TypeCore.env * [ find_qualified_var env mname x ] finds name [ x ] as exported by module * [ ] . Use this to reach values exported by _ interfaces _ which the current * program depends on . * [mname]. Use this to reach values exported by _interfaces_ which the current * program depends on. *) val find_qualified_var: TypeCore.env -> Module.name -> Variable.name -> TypeCore.var val find_unqualified_var: TypeCore.env -> Variable.name -> TypeCore.var
6314950e9b31a74c0904e3338d22a3b9b1450d9ba45f2a28f4255c9167f4d363
bollu/cellularAutomata
GameOfLife.hs
# LANGUAGE TypeFamilies # # LANGUAGE FlexibleContexts # # LANGUAGE TemplateHaskell # module GameOfLife where import Cellular import Control.Comonad import Diagrams.Prelude import Diagrams.Backend.Cairo.CmdLine import Diagrams.TwoD.Layout.Grid import Control.Monad import Data.Active import qualified Data.Vector as V import Data.MonoTraversable import DeriveMonoComonadTH data Cell = On | Off deriving(Eq) newtype GameOfLife = GameOfLife (Univ Cell) $(deriveMonoInstances ''GameOfLife) instance CA GameOfLife where stepCell = GameOfLife.stepCell renderCA = GameOfLife.renderCA liveNeighbourCount :: GameOfLife -> Int liveNeighbourCount (GameOfLife grid) = V.sum $ fmap (\c -> if c == On then 1 else 0) (getUnivNeighbours grid) stepCell :: GameOfLife -> Cell stepCell gol = cell' where cell' = if numNeighbours > 3 then Off else if numNeighbours < 2 then Off else if cell == Off && numNeighbours == 3 then On else cell cell = oextract gol numNeighbours = liveNeighbourCount gol renderCA :: CADiagramBackend b => GameOfLife -> QDiagram b V2 (N b) Any renderCA (GameOfLife univ) = univToDiagram cellToDiagram univ cellToDiagram :: CADiagramBackend b => Cell -> QDiagram b V2 (N b) Any cellToDiagram On = square 1 # fc cyan cellToDiagram Off = square 1 # fc white
null
https://raw.githubusercontent.com/bollu/cellularAutomata/1c77ff5d6d59678a845bde7e1747d45d0ca0989f/app/GameOfLife.hs
haskell
# LANGUAGE TypeFamilies # # LANGUAGE FlexibleContexts # # LANGUAGE TemplateHaskell # module GameOfLife where import Cellular import Control.Comonad import Diagrams.Prelude import Diagrams.Backend.Cairo.CmdLine import Diagrams.TwoD.Layout.Grid import Control.Monad import Data.Active import qualified Data.Vector as V import Data.MonoTraversable import DeriveMonoComonadTH data Cell = On | Off deriving(Eq) newtype GameOfLife = GameOfLife (Univ Cell) $(deriveMonoInstances ''GameOfLife) instance CA GameOfLife where stepCell = GameOfLife.stepCell renderCA = GameOfLife.renderCA liveNeighbourCount :: GameOfLife -> Int liveNeighbourCount (GameOfLife grid) = V.sum $ fmap (\c -> if c == On then 1 else 0) (getUnivNeighbours grid) stepCell :: GameOfLife -> Cell stepCell gol = cell' where cell' = if numNeighbours > 3 then Off else if numNeighbours < 2 then Off else if cell == Off && numNeighbours == 3 then On else cell cell = oextract gol numNeighbours = liveNeighbourCount gol renderCA :: CADiagramBackend b => GameOfLife -> QDiagram b V2 (N b) Any renderCA (GameOfLife univ) = univToDiagram cellToDiagram univ cellToDiagram :: CADiagramBackend b => Cell -> QDiagram b V2 (N b) Any cellToDiagram On = square 1 # fc cyan cellToDiagram Off = square 1 # fc white
81ccd12e5b2b6b9c3cb64f3ced3ce2a36dda5c4a6ee1a91913e28500e3a91a70
oofp/Beseder
IORefStateProv.hs
{-# LANGUAGE DataKinds #-} {-# LANGUAGE FlexibleContexts #-} # LANGUAGE FlexibleInstances # # LANGUAGE InstanceSigs # # LANGUAGE MultiParamTypeClasses # # LANGUAGE OverloadedStrings # # LANGUAGE PartialTypeSignatures # # LANGUAGE TypeApplications # # LANGUAGE TypeFamilies # {-# LANGUAGE TypeSynonymInstances #-} # LANGUAGE UndecidableInstances # {-# LANGUAGE ScopedTypeVariables #-} module Beseder.Resources.State.Impl.IORefStateProv ( ioRefStateRes ) where import Protolude import GHC.Show (Show (..)) import Data.IORef import Data.Coerce import Beseder.Resources.State.MonoStateProv newtype IORefState s = IORefState s deriving Show ioRefStateRes :: s -> IORefStateRes s ioRefStateRes = coerce type IORefStateRes s = StateRes IORefState s instance MonadIO m => MonoStateProv IORefState s m where data MonoStateData IORefState s m = IORefData (IORef s) createState (StateRes (IORefState s)) = liftIO (IORefData <$> newIORef s) setState (SetState s) st@(IORefData ioRef) = liftIO $ writeIORef ioRef s >> return st modifyState (ModifyState f) st@(IORefData ioRef) = liftIO $ modifyIORef ioRef f >> return st clearState _ = return () getDataState (IORefData ioRef) = liftIO $ readIORef ioRef
null
https://raw.githubusercontent.com/oofp/Beseder/a0f5c5e3138938b6fa18811d646535ee6df1a4f4/src/Beseder/Resources/State/Impl/IORefStateProv.hs
haskell
# LANGUAGE DataKinds # # LANGUAGE FlexibleContexts # # LANGUAGE TypeSynonymInstances # # LANGUAGE ScopedTypeVariables #
# LANGUAGE FlexibleInstances # # LANGUAGE InstanceSigs # # LANGUAGE MultiParamTypeClasses # # LANGUAGE OverloadedStrings # # LANGUAGE PartialTypeSignatures # # LANGUAGE TypeApplications # # LANGUAGE TypeFamilies # # LANGUAGE UndecidableInstances # module Beseder.Resources.State.Impl.IORefStateProv ( ioRefStateRes ) where import Protolude import GHC.Show (Show (..)) import Data.IORef import Data.Coerce import Beseder.Resources.State.MonoStateProv newtype IORefState s = IORefState s deriving Show ioRefStateRes :: s -> IORefStateRes s ioRefStateRes = coerce type IORefStateRes s = StateRes IORefState s instance MonadIO m => MonoStateProv IORefState s m where data MonoStateData IORefState s m = IORefData (IORef s) createState (StateRes (IORefState s)) = liftIO (IORefData <$> newIORef s) setState (SetState s) st@(IORefData ioRef) = liftIO $ writeIORef ioRef s >> return st modifyState (ModifyState f) st@(IORefData ioRef) = liftIO $ modifyIORef ioRef f >> return st clearState _ = return () getDataState (IORefData ioRef) = liftIO $ readIORef ioRef
a44c2a9486327056857c24a835c79bc43cc14b1d84984ff8d5bdf2d6464647c3
openmusic-project/OMChroma
init-chroma.lisp
(in-package :cr) (defvar *cr-root* (ensure-directories-exist (merge-pathnames "Documents/Chroma/" (user-homedir-pathname))) ) (defparameter *cr-out-dir* (ensure-directories-exist (merge-pathnames "cr-out/" *cr-root*))) (defparameter *cr-csfun-dir* (ensure-directories-exist (merge-pathnames "cr-fun/" *cr-root*))) (defparameter *cr-wt-dir* (ensure-directories-exist (merge-pathnames "cr-wt/" *cr-root*))) (defparameter *cr-models-dir* (ensure-directories-exist (merge-pathnames "cr-models/" *cr-root*))) (defparameter *cr-userfun-dir* (ensure-directories-exist (merge-pathnames "cr-userfun/" *cr-root*))) (defparameter *cr-tmp-dir* (ensure-directories-exist (merge-pathnames "cr-tmp/" *cr-root*))) (defun get-cr-path (dir &key name type subdirs) (let ((root (case dir (:out *cr-out-dir*) (:csfun *cr-csfun-dir*) (:wt *cr-wt-dir*) (:models *cr-models-dir*) (:userfun *cr-userfun-dir*) (:tmp *cr-tmp-dir*) (t nil)))) (when root (make-pathname :directory (append (pathname-directory root) subdirs) :name name :type type)))) ;;; Definition of helper-functions with implementation-dependent or external dependencies: (defun choose-file-dialog (&optional (message "Select a file...")) #+lispworks (capi::prompt-for-file message) #-lispworks (error "Sorry I can not prompt for file...") ) (defun cr-beep (&optional text) #+lispworks (capi::beep-pane nil) #-lispworks (print "BIP") (when text (print text)) ) (defun sound-file-get-info (filename) #+libsndfile (audio-io::om-get-sound-info (namestring filename)) #-libsndfile (error "Sorry I can not read sound info..."))
null
https://raw.githubusercontent.com/openmusic-project/OMChroma/5ded34f22b59a1a93ea7b87e182c9dbdfa95e047/sources/chroma/init-chroma.lisp
lisp
Definition of helper-functions with implementation-dependent or external dependencies:
(in-package :cr) (defvar *cr-root* (ensure-directories-exist (merge-pathnames "Documents/Chroma/" (user-homedir-pathname))) ) (defparameter *cr-out-dir* (ensure-directories-exist (merge-pathnames "cr-out/" *cr-root*))) (defparameter *cr-csfun-dir* (ensure-directories-exist (merge-pathnames "cr-fun/" *cr-root*))) (defparameter *cr-wt-dir* (ensure-directories-exist (merge-pathnames "cr-wt/" *cr-root*))) (defparameter *cr-models-dir* (ensure-directories-exist (merge-pathnames "cr-models/" *cr-root*))) (defparameter *cr-userfun-dir* (ensure-directories-exist (merge-pathnames "cr-userfun/" *cr-root*))) (defparameter *cr-tmp-dir* (ensure-directories-exist (merge-pathnames "cr-tmp/" *cr-root*))) (defun get-cr-path (dir &key name type subdirs) (let ((root (case dir (:out *cr-out-dir*) (:csfun *cr-csfun-dir*) (:wt *cr-wt-dir*) (:models *cr-models-dir*) (:userfun *cr-userfun-dir*) (:tmp *cr-tmp-dir*) (t nil)))) (when root (make-pathname :directory (append (pathname-directory root) subdirs) :name name :type type)))) (defun choose-file-dialog (&optional (message "Select a file...")) #+lispworks (capi::prompt-for-file message) #-lispworks (error "Sorry I can not prompt for file...") ) (defun cr-beep (&optional text) #+lispworks (capi::beep-pane nil) #-lispworks (print "BIP") (when text (print text)) ) (defun sound-file-get-info (filename) #+libsndfile (audio-io::om-get-sound-info (namestring filename)) #-libsndfile (error "Sorry I can not read sound info..."))
f288f960c4522b48468fd06d118099f3ed881605a13505f0a672ba1711b93c98
zero-one-group/geni-performance-benchmark
script.clj
(ns geni.script (:require [zero-one.geni.core :as g])) (comment (time (-> (g/read-parquet! "/data/performance-benchmark-data") ;(-> (g/read-parquet! "/data/performance-benchmark-data/part-00000-0cf99dad-6d07-4025-a5e9-f425bb9532b9-c000.snappy.parquet") (g/with-column :sales (g/* :price :quantity)) (g/group-by :member-id) (g/agg {:total-spend (g/sum :sales) :avg-basket-size (g/mean :sales) :avg-price (g/mean :price) :n-transactions (g/count "*") :n-visits (g/count-distinct :date) :n-brands (g/count-distinct :brand-id) :n-styles (g/count-distinct :style-id)}) (g/write-parquet! "target/geni-matrix.parquet" {:mode "overwrite"}))) (g/shape (g/read-parquet! "target/geni-matrix.parquet")) true) Elapsed time : 7684.372175 msecs = > 7.7 secs Elapsed time : 39247.311383 msecs = > 39 secs
null
https://raw.githubusercontent.com/zero-one-group/geni-performance-benchmark/ea3d92c69d78335e3e4d5f9d6772cb3e9c10b6b7/geni/src/geni/script.clj
clojure
(-> (g/read-parquet! "/data/performance-benchmark-data/part-00000-0cf99dad-6d07-4025-a5e9-f425bb9532b9-c000.snappy.parquet")
(ns geni.script (:require [zero-one.geni.core :as g])) (comment (time (-> (g/read-parquet! "/data/performance-benchmark-data") (g/with-column :sales (g/* :price :quantity)) (g/group-by :member-id) (g/agg {:total-spend (g/sum :sales) :avg-basket-size (g/mean :sales) :avg-price (g/mean :price) :n-transactions (g/count "*") :n-visits (g/count-distinct :date) :n-brands (g/count-distinct :brand-id) :n-styles (g/count-distinct :style-id)}) (g/write-parquet! "target/geni-matrix.parquet" {:mode "overwrite"}))) (g/shape (g/read-parquet! "target/geni-matrix.parquet")) true) Elapsed time : 7684.372175 msecs = > 7.7 secs Elapsed time : 39247.311383 msecs = > 39 secs
d8b3624c9907f0585ed650c9671724ca8c59536a8bd283d3a38602cacc98ab95
Peaker/git-mediate
Opts.hs
# LANGUAGE LambdaCase # -- | Option parser module Opts ( Options(..) , getOpts ) where import Control.Applicative (Alternative(..)) import qualified Options.Applicative as O import PPDiff (ColorEnable(..)) import System.Exit (exitSuccess) import Version (versionString) data Options = Options { shouldUseEditor :: Bool , shouldDumpDiffs :: Bool , shouldDumpDiff2 :: Bool , shouldUseColor :: Maybe ColorEnable , shouldSetConflictStyle :: Bool , untabify :: Maybe Int , mergeSpecificFile :: Maybe FilePath , diffsContext :: Int } data CmdArgs = CmdVersion | CmdOptions Options parser :: O.Parser CmdArgs parser = O.flag' CmdVersion (O.long "version" <> O.help "Print the version and quit") <|> CmdOptions <$> ( Options <$> O.switch ( O.long "editor" <> O.short 'e' <> O.help "Execute $EDITOR for each conflicted file that remains conflicted" ) <*> O.switch ( O.long "diff" <> O.short 'd' <> O.help "Dump the left/right diffs from base in each conflict remaining" ) <*> O.switch ( O.long "diff2" <> O.short '2' <> O.help "Dump the diff between left and right in each conflict remaining" ) <*> ( O.flag' (Just EnableColor) (O.long "color" <> O.short 'c' <> O.help "Enable color") <|> O.flag' (Just DisableColor) (O.long "no-color" <> O.short 'C' <> O.help "Disable color") <|> pure Nothing ) <*> O.switch ( O.long "style" <> O.short 's' <> O.help "Configure git's global merge.conflictstyle to diff3 if needed" ) <*> O.optional ( O.option O.auto ( O.long "untabify" <> O.metavar "TABSIZE" <> O.help "Convert tabs to the spaces at the tab stops for the given tab size" ) ) <*> O.optional ( O.strOption ( O.long "merge-file" <> O.short 'f' <> O.help "Merge a specific file") ) <*> O.option O.auto (O.long "context" <> O.short 'U' <> O.metavar "LINECOUNT" <> O.showDefault <> O.value 3 <> O.help "Number of context lines around dumped diffs" ) ) opts :: O.ParserInfo CmdArgs opts = O.info (O.helper <*> parser) $ O.fullDesc <> O.progDesc "Resolve any git conflicts that have become trivial by editing operations.\n\ \Go to -mediate for example use." <> O.header "git-mediate - Become a conflicts hero" getOpts :: IO Options getOpts = O.execParser opts >>= \case CmdVersion -> do putStrLn $ "git-mediate version " ++ versionString exitSuccess CmdOptions o -> pure o
null
https://raw.githubusercontent.com/Peaker/git-mediate/06a70285f16e8548e6b19bad393913450493adbf/src/Opts.hs
haskell
| Option parser
# LANGUAGE LambdaCase # module Opts ( Options(..) , getOpts ) where import Control.Applicative (Alternative(..)) import qualified Options.Applicative as O import PPDiff (ColorEnable(..)) import System.Exit (exitSuccess) import Version (versionString) data Options = Options { shouldUseEditor :: Bool , shouldDumpDiffs :: Bool , shouldDumpDiff2 :: Bool , shouldUseColor :: Maybe ColorEnable , shouldSetConflictStyle :: Bool , untabify :: Maybe Int , mergeSpecificFile :: Maybe FilePath , diffsContext :: Int } data CmdArgs = CmdVersion | CmdOptions Options parser :: O.Parser CmdArgs parser = O.flag' CmdVersion (O.long "version" <> O.help "Print the version and quit") <|> CmdOptions <$> ( Options <$> O.switch ( O.long "editor" <> O.short 'e' <> O.help "Execute $EDITOR for each conflicted file that remains conflicted" ) <*> O.switch ( O.long "diff" <> O.short 'd' <> O.help "Dump the left/right diffs from base in each conflict remaining" ) <*> O.switch ( O.long "diff2" <> O.short '2' <> O.help "Dump the diff between left and right in each conflict remaining" ) <*> ( O.flag' (Just EnableColor) (O.long "color" <> O.short 'c' <> O.help "Enable color") <|> O.flag' (Just DisableColor) (O.long "no-color" <> O.short 'C' <> O.help "Disable color") <|> pure Nothing ) <*> O.switch ( O.long "style" <> O.short 's' <> O.help "Configure git's global merge.conflictstyle to diff3 if needed" ) <*> O.optional ( O.option O.auto ( O.long "untabify" <> O.metavar "TABSIZE" <> O.help "Convert tabs to the spaces at the tab stops for the given tab size" ) ) <*> O.optional ( O.strOption ( O.long "merge-file" <> O.short 'f' <> O.help "Merge a specific file") ) <*> O.option O.auto (O.long "context" <> O.short 'U' <> O.metavar "LINECOUNT" <> O.showDefault <> O.value 3 <> O.help "Number of context lines around dumped diffs" ) ) opts :: O.ParserInfo CmdArgs opts = O.info (O.helper <*> parser) $ O.fullDesc <> O.progDesc "Resolve any git conflicts that have become trivial by editing operations.\n\ \Go to -mediate for example use." <> O.header "git-mediate - Become a conflicts hero" getOpts :: IO Options getOpts = O.execParser opts >>= \case CmdVersion -> do putStrLn $ "git-mediate version " ++ versionString exitSuccess CmdOptions o -> pure o
e17bd8dc1afe818c1626efa73e67f2e02c6ef962743dc384df1fd3c428b37ac9
metabase/toucan
hydrate.clj
(ns toucan.hydrate "Functions for deserializing and hydrating fields in objects fetched from the DB." (:require [toucan [db :as db] [models :as models]])) Counts Destructuring & Restructuring ;;; ================================================================================================================== # # # # * DISCLAIMER * ;; This I wrote this code at 4 AM nearly 2 years ago and do n't remember exactly what it is supposed to accomplish , ;; or why. It generates a sort of path that records the wacky ways in which objects in a collection are nested, ;; and how they fit into sequences; it then returns a flattened sequence of desired objects for easy modification. ;; Afterwards the modified objects can be put in place of the originals by passing in the sequence of modified objects ;; and the path. ;; ;; Nonetheless, it still works (somehow) and is well-tested. But it's definitely overengineered and crying out to be ;; replaced with a simpler implementation (`clojure.walk` would probably work here). PRs welcome! ;; # # # # Original Overview ;; ;; At a high level, these functions let you aggressively flatten a sequence of maps by a key ;; so you can apply some function across it, and then unflatten that sequence. ;; ;; +-------------------------------------------------------------------------+ ;; | +--> (map merge) --> new seq ;; seq -+--> counts-of ------------------------------------+ | ;; | +--> counts-unflatten -+ ;; +--> counts-flatten -> (modify the flattened seq) -+ ;; 1 . Get a value that can be used to unflatten a sequence later with ` counts - of ` . 2 . Flatten the sequence with ` counts - flatten ` 3 . Modify the flattened sequence as needed 4 . Unflatten the sequence by calling ` counts - unflatten ` with the modified sequence and value from step 1 5 . ` map merge ` the original sequence and the unflattened sequence . ;; ;; For your convenience `counts-apply` combines these steps for you. (defn- counts-of "Return a sequence of counts / keywords that can be used to unflatten COLL later. (counts-of [{:a [{:b 1} {:b 2}], :c 2} {:a {:b 3}, :c 4}] :a) -> [2 :atom] For each `x` in COLL, return: * `(count (k x))` if `(k x)` is sequential * `:atom` if `(k x)` is otherwise non-nil * `:nil` if `x` has key `k` but the value is nil * `nil` if `x` is nil." [coll k] (map (fn [x] (cond (sequential? (k x)) (count (k x)) (k x) :atom (contains? x k) :nil :else nil)) coll)) (defn- counts-flatten "Flatten COLL by K. (counts-flatten [{:a [{:b 1} {:b 2}], :c 2} {:a {:b 3}, :c 4}] :a) -> [{:b 1} {:b 2} {:b 3}]" [coll k] {:pre [(sequential? coll) (keyword? k)]} (->> coll (map k) (mapcat (fn [x] (if (sequential? x) x [x]))))) (defn- counts-unflatten "Unflatten COLL by K using COUNTS from `counts-of`. (counts-unflatten [{:b 2} {:b 4} {:b 6}] :a [2 :atom]) -> [{:a [{:b 2} {:b 4}]} {:a {:b 6}}]" ([coll k counts] (counts-unflatten [] coll k counts)) ([acc coll k [count & more]] (let [[unflattend coll] (condp = count nil [nil (rest coll)] :atom [(first coll) (rest coll)] :nil [:nil (rest coll)] (split-at count coll)) acc (conj acc unflattend)] (if-not (seq more) (map (fn [x] (when x {k (when-not (= x :nil) x)})) acc) (recur acc coll k more))))) (defn- counts-apply "Apply F to values of COLL flattened by K, then return unflattened/updated results. (counts-apply [{:a [{:b 1} {:b 2}], :c 2} {:a {:b 3}, :c 4}] :a #(update-in % [:b] (partial * 2))) -> [{:a [{:b 2} {:b 4}], :c 2} {:a {:b 3}, :c 4}]" [coll k f] (let [counts (counts-of coll k) new-vals (-> coll (counts-flatten k) f (counts-unflatten k counts))] (map merge coll new-vals))) ;;; Util Fns ;;; ================================================================================================================== (defn- valid-hydration-form? "Is this a valid argument to `hydrate`?" [k] (or (keyword? k) (and (sequential? k) (keyword? (first k)) (every? valid-hydration-form? (rest k))))) (defn- kw-append "Append to a keyword. (kw-append :user \"_id\") -> :user_id" [k suffix] (keyword (str (name k) suffix))) (defn- lookup-functions-with-metadata-key "Return a map of hydration keywords to functions that should be used to hydrate them, e.g. {:fields #'my-project.models.table/fields :tables #'my-project.models.database/tables ...} These functions are ones that are marked METADATA-KEY, e.g. `^:hydrate` or `^:batched-hydrate`." [metadata-key] (loop [m {}, [[k f] & more] (for [ns (all-ns) [symb varr] (ns-interns ns) :let [hydration-key (metadata-key (meta varr))] :when hydration-key] [(if (true? hydration-key) (keyword (name symb)) hydration-key) varr])] (cond (not k) m (m k) (throw (Exception. (format "Duplicate `^%s` functions for key '%s': %s and %s." metadata-key k (m k) f))) :else (recur (assoc m k f) more)))) ;;; Automagic Batched Hydration (via :model-keys) ;;; ================================================================================================================== (defn- require-model-namespaces-and-find-hydration-fns "Return map of `hydration-key` -> model e.g. `:user -> User`. This is built pulling the `hydration-keys` set from all of our entities." [] (into {} (for [ns (all-ns) [_ varr] (ns-publics ns) :let [model (var-get varr)] :when (models/model? model) :let [hydration-keys (models/hydration-keys model)] k hydration-keys] {k model}))) (def ^:private automagic-batched-hydration-key->model* (atom nil)) (defn- automagic-batched-hydration-key->model "Get a map of hydration keys to corresponding models." [] (or @automagic-batched-hydration-key->model* (reset! automagic-batched-hydration-key->model* (require-model-namespaces-and-find-hydration-fns)))) (defn- can-automagically-batched-hydrate? "Can we do a batched hydration of RESULTS with key K?" [results k] (let [k-id-u (kw-append k "_id") k-id-d (kw-append k "-id") contains-k-id? (fn [obj] (or (contains? obj k-id-u) (contains? obj k-id-d)))] (and (contains? (automagic-batched-hydration-key->model) k) (every? contains-k-id? results)))) (defn- automagically-batched-hydrate "Hydrate keyword DEST-KEY across all RESULTS by aggregating corresponding source keys (`DEST-KEY_id`), doing a single `db/select`, and mapping corresponding objects to DEST-KEY." [results dest-key] {:pre [(keyword? dest-key)]} (let [model ((automagic-batched-hydration-key->model) dest-key) source-keys #{(kw-append dest-key "_id") (kw-append dest-key "-id")} ids (set (for [result results :when (not (get result dest-key)) :let [k (some result source-keys)] :when k] k)) primary-key (models/primary-key model) objs (if (seq ids) (into {} (for [item (db/select model, primary-key [:in ids])] {(primary-key item) item})) (constantly nil))] (for [result results :let [source-id (some result source-keys)]] (if (get result dest-key) result (assoc result dest-key (objs source-id)))))) Function - Based Batched Hydration ( fns marked ^:batched - hydrate ) ;;; ================================================================================================================== (def ^:private hydration-key->batched-f* (atom nil)) (defn- hydration-key->batched-f "Map of keys to functions marked `^:batched-hydrate` for them." [] (or @hydration-key->batched-f* (reset! hydration-key->batched-f* (lookup-functions-with-metadata-key :batched-hydrate)))) (defn- can-fn-based-batched-hydrate? [_ k] (contains? (hydration-key->batched-f) k)) (defn- fn-based-batched-hydrate [results k] {:pre [(keyword? k)]} (((hydration-key->batched-f) k) results)) Function - Based Simple Hydration ( fns marked ^:hydrate ) ;;; ================================================================================================================== (def ^:private hydration-key->f* (atom nil)) (defn- hydration-key->f "Fetch a map of keys to functions marked `^:hydrate` for them." [] (or @hydration-key->f* (reset! hydration-key->f* (lookup-functions-with-metadata-key :hydrate)))) (defn- simple-hydrate "Hydrate keyword K in results by calling corresponding functions when applicable." [results k] {:pre [(keyword? k)]} (for [result results] ;; don't try to hydrate if they key is already present. If we find a matching fn, hydrate with it (when result (or (when-not (k result) (when-let [f ((hydration-key->f) k)] (assoc result k (f result)))) result)))) ;;; Resetting Hydration keys (for REPL usage) ;;; ================================================================================================================== (defn flush-hydration-key-caches! "Clear out the cached hydration keys. Useful when doing interactive development and defining new hydration functions." [] (reset! automagic-batched-hydration-key->model* nil) (reset! hydration-key->batched-f* nil) (reset! hydration-key->f* nil)) ;;; Primary Hydration Fns ;;; ================================================================================================================== (declare hydrate) (defn- hydrate-vector "Hydrate a nested hydration form (vector) by recursively calling `hydrate`." [results [k & more :as vect]] (assert (> (count vect) 1) (format (str "Replace '%s' with '%s'. Vectors are for nested hydration. " "There's no need to use one when you only have a single key.") vect (first vect))) (let [results (hydrate results k)] (if-not (seq more) results (counts-apply results k #(apply hydrate % more))))) (defn- hydrate-kw "Hydrate a single keyword." [results k] (cond (can-automagically-batched-hydrate? results k) (automagically-batched-hydrate results k) (can-fn-based-batched-hydrate? results k) (fn-based-batched-hydrate results k) :else (simple-hydrate results k))) (defn- hydrate-1 "Hydrate a single hydration form." [results k] (if (keyword? k) (hydrate-kw results k) (hydrate-vector results k))) (defn- hydrate-many "Hydrate many hydration forms across a *sequence* of RESULTS by recursively calling `hydrate-1`." [results k & more] (let [results (hydrate-1 results k)] (if-not (seq more) results (recur results (first more) (rest more))))) ;;; Public Interface ;;; ================================================================================================================== ;; hydrate <-------------+ | | ;; hydrate-many | ;; | (for each form) | ;; hydrate-1 | (recursively) | | ;; keyword? --+-- vector? | ;; | | | ;; hydrate-kw hydrate-vector ----+ ;; | ;; can-automagically-batched-hydrate? ;; | ;; true ------------+----------------- false ;; | | ;; automagically-batched-hydrate can-fn-based-batched-hydrate? ;; | ;; true -------------+------------- false ;; | | ;; fn-based-batched-hydrate simple-hydrate (defn hydrate "Hydrate a single object or sequence of objects. #### Automagic Batched Hydration (via hydration-keys) `hydrate` attempts to do a *batched hydration* where possible. If the key being hydrated is defined as one of some model's `hydration-keys`, `hydrate` will do a batched `db/select` if a corresponding key ending with `_id` is found in the objects being batch hydrated. (hydrate [{:user_id 100}, {:user_id 101}] :user) Since `:user` is a hydration key for `User`, a single `db/select` will used to fetch `Users`: (db/select User :id [:in #{100 101}]) The corresponding `Users` are then added under the key `:user`. #### Function-Based Batched Hydration (via functions marked ^:batched-hydrate) If the key can't be hydrated auto-magically with the appropriate `:hydration-keys`, `hydrate` will look for a function tagged with `:batched-hydrate` in its metadata, and use that instead. If a matching function is found, it is called with a collection of objects, e.g. (defn with-fields \"Efficiently add `Fields` to a collection of TABLES.\" {:batched-hydrate :fields} [tables] ...) (let [tables (get-some-tables)] (hydrate tables :fields)) ; uses with-fields By default, the function will be used to hydrate keys that match its name; as in the example above, you can specify a different key to hydrate for in the metadata instead. #### Simple Hydration (via functions marked ^:hydrate) If the key is *not* eligible for batched hydration, `hydrate` will look for a function or method tagged with `:hydrate` in its metadata, and use that instead; if a matching function is found, it is called on the object being hydrated and the result is `assoc`ed: (defn ^:hydrate dashboard [{:keys [dashboard_id]}] (Dashboard dashboard_id)) (let [dc (DashboardCard ...)] roughly equivalent to ( assoc dc : dashboard ( dashboard dc ) ) As with `:batched-hydrate` functions, by default, the function will be used to hydrate keys that match its name; you can specify a different key to hydrate instead as the metadata value of `:hydrate`: (defn ^{:hydrate :pk_field} pk-field-id [obj] ...) ; hydrate :pk_field with pk-field-id Keep in mind that you can only define a single function/method to hydrate each key; move functions into the `IModel` interface as needed. #### Hydrating Multiple Keys You can hydrate several keys at one time: (hydrate {...} :a :b) -> {:a 1, :b 2} #### Nested Hydration You can do recursive hydration by listing keys inside a vector: (hydrate {...} [:a :b]) -> {:a {:b 1}} The first key in a vector will be hydrated normally, and any subsequent keys will be hydrated *inside* the corresponding values for that key. (hydrate {...} [:a [:b :c] :e]) -> {:a {:b {:c 1} :e 2}}" [results k & ks] {:pre [(valid-hydration-form? k) (every? valid-hydration-form? ks)]} (when results (if (sequential? results) (if (empty? results) results (apply hydrate-many results k ks)) (first (apply hydrate-many [results] k ks)))))
null
https://raw.githubusercontent.com/metabase/toucan/29a921750f3051dce350255cfbd33512428bc3f8/src/toucan/hydrate.clj
clojure
================================================================================================================== or why. It generates a sort of path that records the wacky ways in which objects in a collection are nested, and how they fit into sequences; it then returns a flattened sequence of desired objects for easy modification. Afterwards the modified objects can be put in place of the originals by passing in the sequence of modified objects and the path. Nonetheless, it still works (somehow) and is well-tested. But it's definitely overengineered and crying out to be replaced with a simpler implementation (`clojure.walk` would probably work here). PRs welcome! At a high level, these functions let you aggressively flatten a sequence of maps by a key so you can apply some function across it, and then unflatten that sequence. +-------------------------------------------------------------------------+ | +--> (map merge) --> new seq seq -+--> counts-of ------------------------------------+ | | +--> counts-unflatten -+ +--> counts-flatten -> (modify the flattened seq) -+ For your convenience `counts-apply` combines these steps for you. Util Fns ================================================================================================================== Automagic Batched Hydration (via :model-keys) ================================================================================================================== ================================================================================================================== ================================================================================================================== don't try to hydrate if they key is already present. If we find a matching fn, hydrate with it Resetting Hydration keys (for REPL usage) ================================================================================================================== Primary Hydration Fns ================================================================================================================== Public Interface ================================================================================================================== hydrate <-------------+ hydrate-many | | (for each form) | hydrate-1 | (recursively) keyword? --+-- vector? | | | | hydrate-kw hydrate-vector ----+ | can-automagically-batched-hydrate? | true ------------+----------------- false | | automagically-batched-hydrate can-fn-based-batched-hydrate? | true -------------+------------- false | | fn-based-batched-hydrate simple-hydrate uses with-fields as in the example above, if a matching function you can specify a different key to hydrate instead as the metadata value of `:hydrate`: hydrate :pk_field with pk-field-id move functions into the
(ns toucan.hydrate "Functions for deserializing and hydrating fields in objects fetched from the DB." (:require [toucan [db :as db] [models :as models]])) Counts Destructuring & Restructuring # # # # * DISCLAIMER * This I wrote this code at 4 AM nearly 2 years ago and do n't remember exactly what it is supposed to accomplish , # # # # Original Overview 1 . Get a value that can be used to unflatten a sequence later with ` counts - of ` . 2 . Flatten the sequence with ` counts - flatten ` 3 . Modify the flattened sequence as needed 4 . Unflatten the sequence by calling ` counts - unflatten ` with the modified sequence and value from step 1 5 . ` map merge ` the original sequence and the unflattened sequence . (defn- counts-of "Return a sequence of counts / keywords that can be used to unflatten COLL later. (counts-of [{:a [{:b 1} {:b 2}], :c 2} {:a {:b 3}, :c 4}] :a) -> [2 :atom] For each `x` in COLL, return: * `(count (k x))` if `(k x)` is sequential * `:atom` if `(k x)` is otherwise non-nil * `:nil` if `x` has key `k` but the value is nil * `nil` if `x` is nil." [coll k] (map (fn [x] (cond (sequential? (k x)) (count (k x)) (k x) :atom (contains? x k) :nil :else nil)) coll)) (defn- counts-flatten "Flatten COLL by K. (counts-flatten [{:a [{:b 1} {:b 2}], :c 2} {:a {:b 3}, :c 4}] :a) -> [{:b 1} {:b 2} {:b 3}]" [coll k] {:pre [(sequential? coll) (keyword? k)]} (->> coll (map k) (mapcat (fn [x] (if (sequential? x) x [x]))))) (defn- counts-unflatten "Unflatten COLL by K using COUNTS from `counts-of`. (counts-unflatten [{:b 2} {:b 4} {:b 6}] :a [2 :atom]) -> [{:a [{:b 2} {:b 4}]} {:a {:b 6}}]" ([coll k counts] (counts-unflatten [] coll k counts)) ([acc coll k [count & more]] (let [[unflattend coll] (condp = count nil [nil (rest coll)] :atom [(first coll) (rest coll)] :nil [:nil (rest coll)] (split-at count coll)) acc (conj acc unflattend)] (if-not (seq more) (map (fn [x] (when x {k (when-not (= x :nil) x)})) acc) (recur acc coll k more))))) (defn- counts-apply "Apply F to values of COLL flattened by K, then return unflattened/updated results. (counts-apply [{:a [{:b 1} {:b 2}], :c 2} {:a {:b 3}, :c 4}] :a #(update-in % [:b] (partial * 2))) -> [{:a [{:b 2} {:b 4}], :c 2} {:a {:b 3}, :c 4}]" [coll k f] (let [counts (counts-of coll k) new-vals (-> coll (counts-flatten k) f (counts-unflatten k counts))] (map merge coll new-vals))) (defn- valid-hydration-form? "Is this a valid argument to `hydrate`?" [k] (or (keyword? k) (and (sequential? k) (keyword? (first k)) (every? valid-hydration-form? (rest k))))) (defn- kw-append "Append to a keyword. (kw-append :user \"_id\") -> :user_id" [k suffix] (keyword (str (name k) suffix))) (defn- lookup-functions-with-metadata-key "Return a map of hydration keywords to functions that should be used to hydrate them, e.g. {:fields #'my-project.models.table/fields :tables #'my-project.models.database/tables ...} These functions are ones that are marked METADATA-KEY, e.g. `^:hydrate` or `^:batched-hydrate`." [metadata-key] (loop [m {}, [[k f] & more] (for [ns (all-ns) [symb varr] (ns-interns ns) :let [hydration-key (metadata-key (meta varr))] :when hydration-key] [(if (true? hydration-key) (keyword (name symb)) hydration-key) varr])] (cond (not k) m (m k) (throw (Exception. (format "Duplicate `^%s` functions for key '%s': %s and %s." metadata-key k (m k) f))) :else (recur (assoc m k f) more)))) (defn- require-model-namespaces-and-find-hydration-fns "Return map of `hydration-key` -> model e.g. `:user -> User`. This is built pulling the `hydration-keys` set from all of our entities." [] (into {} (for [ns (all-ns) [_ varr] (ns-publics ns) :let [model (var-get varr)] :when (models/model? model) :let [hydration-keys (models/hydration-keys model)] k hydration-keys] {k model}))) (def ^:private automagic-batched-hydration-key->model* (atom nil)) (defn- automagic-batched-hydration-key->model "Get a map of hydration keys to corresponding models." [] (or @automagic-batched-hydration-key->model* (reset! automagic-batched-hydration-key->model* (require-model-namespaces-and-find-hydration-fns)))) (defn- can-automagically-batched-hydrate? "Can we do a batched hydration of RESULTS with key K?" [results k] (let [k-id-u (kw-append k "_id") k-id-d (kw-append k "-id") contains-k-id? (fn [obj] (or (contains? obj k-id-u) (contains? obj k-id-d)))] (and (contains? (automagic-batched-hydration-key->model) k) (every? contains-k-id? results)))) (defn- automagically-batched-hydrate "Hydrate keyword DEST-KEY across all RESULTS by aggregating corresponding source keys (`DEST-KEY_id`), doing a single `db/select`, and mapping corresponding objects to DEST-KEY." [results dest-key] {:pre [(keyword? dest-key)]} (let [model ((automagic-batched-hydration-key->model) dest-key) source-keys #{(kw-append dest-key "_id") (kw-append dest-key "-id")} ids (set (for [result results :when (not (get result dest-key)) :let [k (some result source-keys)] :when k] k)) primary-key (models/primary-key model) objs (if (seq ids) (into {} (for [item (db/select model, primary-key [:in ids])] {(primary-key item) item})) (constantly nil))] (for [result results :let [source-id (some result source-keys)]] (if (get result dest-key) result (assoc result dest-key (objs source-id)))))) Function - Based Batched Hydration ( fns marked ^:batched - hydrate ) (def ^:private hydration-key->batched-f* (atom nil)) (defn- hydration-key->batched-f "Map of keys to functions marked `^:batched-hydrate` for them." [] (or @hydration-key->batched-f* (reset! hydration-key->batched-f* (lookup-functions-with-metadata-key :batched-hydrate)))) (defn- can-fn-based-batched-hydrate? [_ k] (contains? (hydration-key->batched-f) k)) (defn- fn-based-batched-hydrate [results k] {:pre [(keyword? k)]} (((hydration-key->batched-f) k) results)) Function - Based Simple Hydration ( fns marked ^:hydrate ) (def ^:private hydration-key->f* (atom nil)) (defn- hydration-key->f "Fetch a map of keys to functions marked `^:hydrate` for them." [] (or @hydration-key->f* (reset! hydration-key->f* (lookup-functions-with-metadata-key :hydrate)))) (defn- simple-hydrate "Hydrate keyword K in results by calling corresponding functions when applicable." [results k] {:pre [(keyword? k)]} (for [result results] (when result (or (when-not (k result) (when-let [f ((hydration-key->f) k)] (assoc result k (f result)))) result)))) (defn flush-hydration-key-caches! "Clear out the cached hydration keys. Useful when doing interactive development and defining new hydration functions." [] (reset! automagic-batched-hydration-key->model* nil) (reset! hydration-key->batched-f* nil) (reset! hydration-key->f* nil)) (declare hydrate) (defn- hydrate-vector "Hydrate a nested hydration form (vector) by recursively calling `hydrate`." [results [k & more :as vect]] (assert (> (count vect) 1) (format (str "Replace '%s' with '%s'. Vectors are for nested hydration. " "There's no need to use one when you only have a single key.") vect (first vect))) (let [results (hydrate results k)] (if-not (seq more) results (counts-apply results k #(apply hydrate % more))))) (defn- hydrate-kw "Hydrate a single keyword." [results k] (cond (can-automagically-batched-hydrate? results k) (automagically-batched-hydrate results k) (can-fn-based-batched-hydrate? results k) (fn-based-batched-hydrate results k) :else (simple-hydrate results k))) (defn- hydrate-1 "Hydrate a single hydration form." [results k] (if (keyword? k) (hydrate-kw results k) (hydrate-vector results k))) (defn- hydrate-many "Hydrate many hydration forms across a *sequence* of RESULTS by recursively calling `hydrate-1`." [results k & more] (let [results (hydrate-1 results k)] (if-not (seq more) results (recur results (first more) (rest more))))) | | | | (defn hydrate "Hydrate a single object or sequence of objects. #### Automagic Batched Hydration (via hydration-keys) `hydrate` attempts to do a *batched hydration* where possible. If the key being hydrated is defined as one of some model's `hydration-keys`, `hydrate` will do a batched `db/select` if a corresponding key ending with `_id` is found in the objects being batch hydrated. (hydrate [{:user_id 100}, {:user_id 101}] :user) Since `:user` is a hydration key for `User`, a single `db/select` will used to fetch `Users`: (db/select User :id [:in #{100 101}]) The corresponding `Users` are then added under the key `:user`. #### Function-Based Batched Hydration (via functions marked ^:batched-hydrate) If the key can't be hydrated auto-magically with the appropriate `:hydration-keys`, `hydrate` will look for a function tagged with `:batched-hydrate` in its metadata, and use that instead. If a matching function is found, it is called with a collection of objects, e.g. (defn with-fields \"Efficiently add `Fields` to a collection of TABLES.\" {:batched-hydrate :fields} [tables] ...) (let [tables (get-some-tables)] you can specify a different key to hydrate for in the metadata instead. #### Simple Hydration (via functions marked ^:hydrate) If the key is *not* eligible for batched hydration, `hydrate` will look for a function or method is found, it is called on the object being hydrated and the result is `assoc`ed: (defn ^:hydrate dashboard [{:keys [dashboard_id]}] (Dashboard dashboard_id)) (let [dc (DashboardCard ...)] roughly equivalent to ( assoc dc : dashboard ( dashboard dc ) ) As with `:batched-hydrate` functions, by default, the function will be used to hydrate keys that `IModel` interface as needed. #### Hydrating Multiple Keys You can hydrate several keys at one time: (hydrate {...} :a :b) -> {:a 1, :b 2} #### Nested Hydration You can do recursive hydration by listing keys inside a vector: (hydrate {...} [:a :b]) -> {:a {:b 1}} The first key in a vector will be hydrated normally, and any subsequent keys will be hydrated *inside* the corresponding values for that key. (hydrate {...} [:a [:b :c] :e]) -> {:a {:b {:c 1} :e 2}}" [results k & ks] {:pre [(valid-hydration-form? k) (every? valid-hydration-form? ks)]} (when results (if (sequential? results) (if (empty? results) results (apply hydrate-many results k ks)) (first (apply hydrate-many [results] k ks)))))
83eb64181406b5657fb6565f14cd3215dc23165b10e71587d6c5e1e82192ab51
GaloisInc/ivory
Struct.hs
# OPTIONS_GHC -fno - warn - orphans # # LANGUAGE ScopedTypeVariables # # LANGUAGE KindSignatures # # LANGUAGE DataKinds # # LANGUAGE FlexibleContexts # # LANGUAGE TypeFamilies # # LANGUAGE CPP # module Ivory.Language.Struct where import Ivory.Language.Area import Ivory.Language.Proxy import Ivory.Language.Ref import Ivory.Language.Type(IvoryExpr(..), IvoryVar(..)) import qualified Ivory.Language.Syntax as I import GHC.TypeLits(Symbol) -- Structs --------------------------------------------------------------------- instance (IvoryStruct sym, ASymbol sym) => IvoryArea ('Struct sym) where ivoryArea _ = I.TyStruct (fromTypeSym (aSymbol :: SymbolType sym)) newtype StructDef (sym :: Symbol) = StructDef { getStructDef :: I.Struct } type family StructName (a :: Area *) :: Symbol type instance StructName ('Struct sym) = sym class (IvoryArea ('Struct sym), ASymbol sym) => IvoryStruct (sym :: Symbol) where structDef :: StructDef sym -- | Struct field labels. newtype Label (sym :: Symbol) (field :: Area *) = Label { getLabel :: String } instance Eq (Label (sym :: Symbol) (field :: Area *)) where l0 == l1 = getLabel l0 == getLabel l1 -- | Label indexing in a structure. (~>) :: forall ref s sym field. ( IvoryStruct sym, IvoryRef ref , IvoryExpr (ref s ('Struct sym)), IvoryExpr (ref s field) ) => ref s ('Struct sym) -> Label sym field -> ref s field s ~> l = wrapExpr (I.ExpLabel ty (unwrapExpr s) (getLabel l)) where ty = ivoryArea (Proxy :: Proxy ('Struct sym))
null
https://raw.githubusercontent.com/GaloisInc/ivory/53a0795b4fbeb0b7da0f6cdaccdde18849a78cd6/ivory/src/Ivory/Language/Struct.hs
haskell
Structs --------------------------------------------------------------------- | Struct field labels. | Label indexing in a structure.
# OPTIONS_GHC -fno - warn - orphans # # LANGUAGE ScopedTypeVariables # # LANGUAGE KindSignatures # # LANGUAGE DataKinds # # LANGUAGE FlexibleContexts # # LANGUAGE TypeFamilies # # LANGUAGE CPP # module Ivory.Language.Struct where import Ivory.Language.Area import Ivory.Language.Proxy import Ivory.Language.Ref import Ivory.Language.Type(IvoryExpr(..), IvoryVar(..)) import qualified Ivory.Language.Syntax as I import GHC.TypeLits(Symbol) instance (IvoryStruct sym, ASymbol sym) => IvoryArea ('Struct sym) where ivoryArea _ = I.TyStruct (fromTypeSym (aSymbol :: SymbolType sym)) newtype StructDef (sym :: Symbol) = StructDef { getStructDef :: I.Struct } type family StructName (a :: Area *) :: Symbol type instance StructName ('Struct sym) = sym class (IvoryArea ('Struct sym), ASymbol sym) => IvoryStruct (sym :: Symbol) where structDef :: StructDef sym newtype Label (sym :: Symbol) (field :: Area *) = Label { getLabel :: String } instance Eq (Label (sym :: Symbol) (field :: Area *)) where l0 == l1 = getLabel l0 == getLabel l1 (~>) :: forall ref s sym field. ( IvoryStruct sym, IvoryRef ref , IvoryExpr (ref s ('Struct sym)), IvoryExpr (ref s field) ) => ref s ('Struct sym) -> Label sym field -> ref s field s ~> l = wrapExpr (I.ExpLabel ty (unwrapExpr s) (getLabel l)) where ty = ivoryArea (Proxy :: Proxy ('Struct sym))
b40c946aec47c88c8e7274621497e011c62c452832c53d56507161441dec6151
mvoidex/hsdev
Lisp.hs
module Data.Lisp ( Lisp(..), lisp, encodeLisp, decodeLisp ) where import Prelude hiding (String, Bool) import qualified Prelude as P (String, Bool) import Data.Aeson (ToJSON(..), FromJSON(..), (.=)) import qualified Data.Aeson as A import Data.Aeson.Types (parseMaybe, parseEither) import Data.ByteString.Lazy (ByteString) import Data.Char (isAlpha, isDigit) import Data.Either (partitionEithers) import qualified Data.HashMap.Strict as HM import Data.List (unfoldr) import Data.Scientific import Data.String (fromString) import qualified Data.Text as T (unpack) import qualified Data.Text.Lazy as LT (pack, unpack) import qualified Data.Text.Lazy.Encoding as LT (encodeUtf8, decodeUtf8) import qualified Text.ParserCombinators.ReadP as R import Text.Read (readMaybe) import qualified Data.Vector as V data Lisp = Null | Bool P.Bool | Symbol P.String | String P.String | Number Scientific | List [Lisp] deriving (Eq) readable :: Read a => Int -> R.ReadP a readable = R.readS_to_P . readsPrec lisp :: Int -> R.ReadP Lisp lisp n = R.choice [ do s <- symbol return $ case s of "null" -> Null "true" -> Bool True "false" -> Bool False _ -> Symbol s, fmap String string, fmap Number number, fmap List list] where symbol :: R.ReadP P.String symbol = concat <$> sequence [ R.option [] (pure <$> R.char ':'), pure <$> R.satisfy isAlpha, R.munch (\ch -> isAlpha ch || isDigit ch || ch == '-')] string :: R.ReadP P.String string = (R.<++ R.pfail) $ do ('\"':_) <- R.look readable n number :: R.ReadP Scientific number = do s <- R.munch1 (\ch -> isDigit ch || ch `elem` ['e', 'E', '.', '+', '-']) maybe R.pfail return $ readMaybe s list :: R.ReadP [Lisp] list = R.between (R.char '(') (R.char ')') $ R.sepBy (lisp n) R.skipSpaces instance Read Lisp where readsPrec = R.readP_to_S . lisp instance Show Lisp where show Null = "null" show (Bool b) | b = "true" | otherwise = "false" show (Symbol s) = s show (String s) = show s show (Number n) = either show show (floatingOrInteger n :: Either Double Integer) show (List vs) = "(" ++ unwords (map show vs) ++ ")" instance ToJSON Lisp where toJSON Null = toJSON A.Null toJSON (Bool b) = toJSON b toJSON (Symbol s) = toJSON s toJSON (String s) = toJSON s toJSON (Number n) = toJSON n toJSON (List vs) | null keywords = toJSON $ map toJSON vals | null vals = keywordsObject | otherwise = toJSON $ map toJSON vals ++ [keywordsObject] where (vals, keywords) = partitionEithers $ unfoldr cutKeyword vs keywordsObject = A.object [fromString (dropColon k) .= v | (k, v) <- keywords] dropColon :: P.String -> P.String dropColon (':' : s) = s dropColon s = s cutKeyword :: [Lisp] -> Maybe (Either Lisp (P.String, Lisp), [Lisp]) cutKeyword [] = Nothing cutKeyword (Symbol s : []) = Just (Right (s, Null), []) cutKeyword (Symbol s : Symbol h : hs) = Just (Right (s, Null), Symbol h : hs) cutKeyword (Symbol s : h : hs) = Just (Right (s, h), hs) cutKeyword (h : hs) = Just (Left h, hs) instance FromJSON Lisp where parseJSON A.Null = return Null parseJSON (A.Bool b) = return $ Bool b parseJSON (A.String s) = return $ String $ T.unpack s parseJSON (A.Number n) = return $ Number n parseJSON (A.Array vs) = fmap List $ mapM parseJSON $ V.toList vs parseJSON (A.Object obj) = fmap (List . concat) $ mapM (\(k, v) -> sequence [pure $ Symbol (':' : T.unpack k), parseJSON v]) $ HM.toList obj decodeLisp :: FromJSON a => ByteString -> Either P.String a decodeLisp str = do sexp <- maybe (Left "Not a s-exp") Right . readMaybe . LT.unpack . LT.decodeUtf8 $ str parseEither parseJSON $ toJSON (sexp :: Lisp) encodeLisp :: ToJSON a => a -> ByteString encodeLisp r = LT.encodeUtf8 . LT.pack $ maybe "(:error \"can't convert to s-exp\")" (show :: Lisp -> P.String) (parseMaybe parseJSON (toJSON r))
null
https://raw.githubusercontent.com/mvoidex/hsdev/016646080a6859e4d9b4a1935fc1d732e388db1a/src/Data/Lisp.hs
haskell
module Data.Lisp ( Lisp(..), lisp, encodeLisp, decodeLisp ) where import Prelude hiding (String, Bool) import qualified Prelude as P (String, Bool) import Data.Aeson (ToJSON(..), FromJSON(..), (.=)) import qualified Data.Aeson as A import Data.Aeson.Types (parseMaybe, parseEither) import Data.ByteString.Lazy (ByteString) import Data.Char (isAlpha, isDigit) import Data.Either (partitionEithers) import qualified Data.HashMap.Strict as HM import Data.List (unfoldr) import Data.Scientific import Data.String (fromString) import qualified Data.Text as T (unpack) import qualified Data.Text.Lazy as LT (pack, unpack) import qualified Data.Text.Lazy.Encoding as LT (encodeUtf8, decodeUtf8) import qualified Text.ParserCombinators.ReadP as R import Text.Read (readMaybe) import qualified Data.Vector as V data Lisp = Null | Bool P.Bool | Symbol P.String | String P.String | Number Scientific | List [Lisp] deriving (Eq) readable :: Read a => Int -> R.ReadP a readable = R.readS_to_P . readsPrec lisp :: Int -> R.ReadP Lisp lisp n = R.choice [ do s <- symbol return $ case s of "null" -> Null "true" -> Bool True "false" -> Bool False _ -> Symbol s, fmap String string, fmap Number number, fmap List list] where symbol :: R.ReadP P.String symbol = concat <$> sequence [ R.option [] (pure <$> R.char ':'), pure <$> R.satisfy isAlpha, R.munch (\ch -> isAlpha ch || isDigit ch || ch == '-')] string :: R.ReadP P.String string = (R.<++ R.pfail) $ do ('\"':_) <- R.look readable n number :: R.ReadP Scientific number = do s <- R.munch1 (\ch -> isDigit ch || ch `elem` ['e', 'E', '.', '+', '-']) maybe R.pfail return $ readMaybe s list :: R.ReadP [Lisp] list = R.between (R.char '(') (R.char ')') $ R.sepBy (lisp n) R.skipSpaces instance Read Lisp where readsPrec = R.readP_to_S . lisp instance Show Lisp where show Null = "null" show (Bool b) | b = "true" | otherwise = "false" show (Symbol s) = s show (String s) = show s show (Number n) = either show show (floatingOrInteger n :: Either Double Integer) show (List vs) = "(" ++ unwords (map show vs) ++ ")" instance ToJSON Lisp where toJSON Null = toJSON A.Null toJSON (Bool b) = toJSON b toJSON (Symbol s) = toJSON s toJSON (String s) = toJSON s toJSON (Number n) = toJSON n toJSON (List vs) | null keywords = toJSON $ map toJSON vals | null vals = keywordsObject | otherwise = toJSON $ map toJSON vals ++ [keywordsObject] where (vals, keywords) = partitionEithers $ unfoldr cutKeyword vs keywordsObject = A.object [fromString (dropColon k) .= v | (k, v) <- keywords] dropColon :: P.String -> P.String dropColon (':' : s) = s dropColon s = s cutKeyword :: [Lisp] -> Maybe (Either Lisp (P.String, Lisp), [Lisp]) cutKeyword [] = Nothing cutKeyword (Symbol s : []) = Just (Right (s, Null), []) cutKeyword (Symbol s : Symbol h : hs) = Just (Right (s, Null), Symbol h : hs) cutKeyword (Symbol s : h : hs) = Just (Right (s, h), hs) cutKeyword (h : hs) = Just (Left h, hs) instance FromJSON Lisp where parseJSON A.Null = return Null parseJSON (A.Bool b) = return $ Bool b parseJSON (A.String s) = return $ String $ T.unpack s parseJSON (A.Number n) = return $ Number n parseJSON (A.Array vs) = fmap List $ mapM parseJSON $ V.toList vs parseJSON (A.Object obj) = fmap (List . concat) $ mapM (\(k, v) -> sequence [pure $ Symbol (':' : T.unpack k), parseJSON v]) $ HM.toList obj decodeLisp :: FromJSON a => ByteString -> Either P.String a decodeLisp str = do sexp <- maybe (Left "Not a s-exp") Right . readMaybe . LT.unpack . LT.decodeUtf8 $ str parseEither parseJSON $ toJSON (sexp :: Lisp) encodeLisp :: ToJSON a => a -> ByteString encodeLisp r = LT.encodeUtf8 . LT.pack $ maybe "(:error \"can't convert to s-exp\")" (show :: Lisp -> P.String) (parseMaybe parseJSON (toJSON r))
15bd10e9b8f065095e57f45b75dabc4dc7e574ac75ef39167e5adc7529c0f46a
adam-james-v/scripts
scripter.clj
(ns scripter.core (:require [babashka.classpath :refer [add-classpath]] [clojure.string :as st] [clojure.java.shell :refer [sh]])) (defn split-fname [fname] (let [sf (st/split fname #"\.")] [(apply str (drop-last sf)) (last sf)])) (defn split-folders [name] (let [sf (st/split name #"/")] (vec sf))) (defn move [f] (let [[name ext] (split-fname f) sname (split-folders name) xfname (if (= (first sname) "src") (apply str (conj (rest sname) "build/")) (apply str (interpose "/" sname))) fout (str xfname "." ext)] (println fout) (sh "chmod" "+x" fout))) (defn main [] (let [f (first *command-line-args*)] (println (str "Moving script: " f)) (move f) #_(println (get-deps f)))) (main)
null
https://raw.githubusercontent.com/adam-james-v/scripts/d91dc28b6e4946233fe675cc306af3343cc11204/scripter.clj
clojure
(ns scripter.core (:require [babashka.classpath :refer [add-classpath]] [clojure.string :as st] [clojure.java.shell :refer [sh]])) (defn split-fname [fname] (let [sf (st/split fname #"\.")] [(apply str (drop-last sf)) (last sf)])) (defn split-folders [name] (let [sf (st/split name #"/")] (vec sf))) (defn move [f] (let [[name ext] (split-fname f) sname (split-folders name) xfname (if (= (first sname) "src") (apply str (conj (rest sname) "build/")) (apply str (interpose "/" sname))) fout (str xfname "." ext)] (println fout) (sh "chmod" "+x" fout))) (defn main [] (let [f (first *command-line-args*)] (println (str "Moving script: " f)) (move f) #_(println (get-deps f)))) (main)
515f245e8e90a9a4447ff3fa94edd6a723835bc4f2694c0100a42211f1d426f5
well-typed/large-records
R070.hs
#if PROFILE_CORESIZE {-# OPTIONS_GHC -ddump-to-file -ddump-ds-preopt -ddump-ds -ddump-simpl #-} #endif #if PROFILE_TIMING {-# OPTIONS_GHC -ddump-to-file -ddump-timings #-} #endif {-# OPTIONS_GHC -fplugin=Data.Record.Anon.Plugin #-} module Experiment.ConstructNoTypeLet.Sized.R070 where import Data.Record.Anon.Simple (Record) import Bench.Types import Common.RowOfSize.Row070 record :: Word -> Record ExampleRow record x = ANON { -- 00 .. 09 t00 = MkT x , t01 = MkT x , t02 = MkT x , t03 = MkT x , t04 = MkT x , t05 = MkT x , t06 = MkT x , t07 = MkT x , t08 = MkT x , t09 = MkT x 10 .. 19 , t10 = MkT x , t11 = MkT x , t12 = MkT x , t13 = MkT x , t14 = MkT x , t15 = MkT x , t16 = MkT x , t17 = MkT x , t18 = MkT x , t19 = MkT x 20 .. 29 , t20 = MkT x , t21 = MkT x , t22 = MkT x , t23 = MkT x , t24 = MkT x , t25 = MkT x , t26 = MkT x , t27 = MkT x , t28 = MkT x , t29 = MkT x 30 .. 39 , t30 = MkT x , t31 = MkT x , t32 = MkT x , t33 = MkT x , t34 = MkT x , t35 = MkT x , t36 = MkT x , t37 = MkT x , t38 = MkT x , t39 = MkT x 40 .. 49 , t40 = MkT x , t41 = MkT x , t42 = MkT x , t43 = MkT x , t44 = MkT x , t45 = MkT x , t46 = MkT x , t47 = MkT x , t48 = MkT x , t49 = MkT x 50 .. 59 , t50 = MkT x , t51 = MkT x , t52 = MkT x , t53 = MkT x , t54 = MkT x , t55 = MkT x , t56 = MkT x , t57 = MkT x , t58 = MkT x , t59 = MkT x 60 .. 69 , t60 = MkT x , t61 = MkT x , t62 = MkT x , t63 = MkT x , t64 = MkT x , t65 = MkT x , t66 = MkT x , t67 = MkT x , t68 = MkT x , t69 = MkT x }
null
https://raw.githubusercontent.com/well-typed/large-records/78d0966e4871847e2c17a0aa821bacf38bdf96bc/large-records-benchmarks/bench/large-anon/Experiment/ConstructNoTypeLet/Sized/R070.hs
haskell
# OPTIONS_GHC -ddump-to-file -ddump-ds-preopt -ddump-ds -ddump-simpl # # OPTIONS_GHC -ddump-to-file -ddump-timings # # OPTIONS_GHC -fplugin=Data.Record.Anon.Plugin # 00 .. 09
#if PROFILE_CORESIZE #endif #if PROFILE_TIMING #endif module Experiment.ConstructNoTypeLet.Sized.R070 where import Data.Record.Anon.Simple (Record) import Bench.Types import Common.RowOfSize.Row070 record :: Word -> Record ExampleRow record x = ANON { t00 = MkT x , t01 = MkT x , t02 = MkT x , t03 = MkT x , t04 = MkT x , t05 = MkT x , t06 = MkT x , t07 = MkT x , t08 = MkT x , t09 = MkT x 10 .. 19 , t10 = MkT x , t11 = MkT x , t12 = MkT x , t13 = MkT x , t14 = MkT x , t15 = MkT x , t16 = MkT x , t17 = MkT x , t18 = MkT x , t19 = MkT x 20 .. 29 , t20 = MkT x , t21 = MkT x , t22 = MkT x , t23 = MkT x , t24 = MkT x , t25 = MkT x , t26 = MkT x , t27 = MkT x , t28 = MkT x , t29 = MkT x 30 .. 39 , t30 = MkT x , t31 = MkT x , t32 = MkT x , t33 = MkT x , t34 = MkT x , t35 = MkT x , t36 = MkT x , t37 = MkT x , t38 = MkT x , t39 = MkT x 40 .. 49 , t40 = MkT x , t41 = MkT x , t42 = MkT x , t43 = MkT x , t44 = MkT x , t45 = MkT x , t46 = MkT x , t47 = MkT x , t48 = MkT x , t49 = MkT x 50 .. 59 , t50 = MkT x , t51 = MkT x , t52 = MkT x , t53 = MkT x , t54 = MkT x , t55 = MkT x , t56 = MkT x , t57 = MkT x , t58 = MkT x , t59 = MkT x 60 .. 69 , t60 = MkT x , t61 = MkT x , t62 = MkT x , t63 = MkT x , t64 = MkT x , t65 = MkT x , t66 = MkT x , t67 = MkT x , t68 = MkT x , t69 = MkT x }
efd4111f8be070a5d90b0c392d8b2c389b3ff5979452f68909990076ca6c7cec
runtimeverification/haskell-backend
OnePathClaim.hs
| Copyright : ( c ) Runtime Verification , 2020 - 2021 License : BSD-3 - Clause Copyright : (c) Runtime Verification, 2020-2021 License : BSD-3-Clause -} module Kore.Reachability.OnePathClaim ( OnePathClaim (..), onePathRuleToTerm, mkOnePathClaim, Rule (..), ) where import Control.Monad ((>=>)) import Data.Generics.Wrapped ( _Unwrapped, ) import GHC.Generics qualified as GHC import Generics.SOP qualified as SOP import Kore.Attribute.Axiom qualified as Attribute import Kore.Debug import Kore.Internal.Alias ( Alias (aliasConstructor), ) import Kore.Internal.OrPattern ( OrPattern, ) import Kore.Internal.Pattern ( Pattern, ) import Kore.Internal.Pattern qualified as Pattern import Kore.Internal.Predicate qualified as Predicate import Kore.Internal.TermLike ( ElementVariable, TermLike, VariableName, getId, weakExistsFinally, ) import Kore.Internal.TermLike qualified as TermLike import Kore.Reachability.Claim import Kore.Rewrite.AxiomPattern import Kore.Rewrite.ClaimPattern as ClaimPattern import Kore.Rewrite.RewritingVariable ( RewritingVariableName, mkRuleVariable, ) import Kore.Rewrite.Transition ( TransitionT, ) import Kore.Rewrite.UnifyingRule ( UnifyingRule (..), ) import Kore.Simplify.Simplify ( Simplifier, ) import Kore.Syntax.Sentence qualified as Syntax import Kore.TopBottom ( TopBottom (..), ) import Kore.Unparser ( Unparse (..), ) import Prelude.Kore -- | One-Path-Claim claim pattern. newtype OnePathClaim = OnePathClaim {getOnePathClaim :: ClaimPattern} deriving stock (Eq, Ord, Show) deriving stock (GHC.Generic) deriving anyclass (NFData) deriving anyclass (SOP.Generic, SOP.HasDatatypeInfo) deriving anyclass (Debug, Diff) {- | Converts a 'OnePathClaim' into its term representation. This is intended to be used only in unparsing situations, as some of the variable information related to the rewriting algorithm is lost. -} onePathRuleToTerm :: OnePathClaim -> TermLike VariableName onePathRuleToTerm (OnePathClaim claimPattern') = claimPatternToTerm TermLike.WEF claimPattern' mkOnePathClaim :: Pattern RewritingVariableName -> OrPattern RewritingVariableName -> [ElementVariable RewritingVariableName] -> OnePathClaim mkOnePathClaim left right existentials = OnePathClaim (mkClaimPattern left right existentials) instance Unparse OnePathClaim where unparse claimPattern' = unparse $ onePathRuleToTerm claimPattern' unparse2 claimPattern' = unparse2 $ onePathRuleToTerm claimPattern' instance TopBottom OnePathClaim where isTop _ = False isBottom _ = False instance From OnePathClaim Attribute.SourceLocation where from = Attribute.sourceLocation . attributes . getOnePathClaim instance From OnePathClaim Attribute.Label where from = Attribute.label . attributes . getOnePathClaim instance From OnePathClaim Attribute.RuleIndex where from = Attribute.identifier . attributes . getOnePathClaim instance From OnePathClaim Attribute.Trusted where from = Attribute.trusted . attributes . getOnePathClaim instance From OnePathClaim Attribute.UniqueId where from = Attribute.uniqueId . attributes . getOnePathClaim instance UnifyingRule OnePathClaim where type UnifyingRuleVariable OnePathClaim = RewritingVariableName matchingPattern (OnePathClaim claim) = matchingPattern claim precondition (OnePathClaim claim) = precondition claim refreshRule stale (OnePathClaim claim) = OnePathClaim <$> refreshRule stale claim NOTE : Non - deterministic semantics The current implementation of one - path verification assumes that the proof claim is deterministic , that is : the proof claim would not be discharged during at a non - confluent state in the execution of a non - deterministic semantics . ( Often this means that the definition is simply deterministic . ) As a result , given the non - deterministic definition > module ABC > import DOMAINS > syntax S : : = " a " | " b " | " c " > rule [ ab ] : a = > b > rule [ ac ] : a = > c > endmodule this claim would be provable , > rule a = > b [ claim ] but this claim would * * not * * be provable , > rule a = > c [ claim ] because the algorithm would first apply semantic rule [ ab ] , which prevents rule [ ac ] from being used . We decided to assume that the definition is deterministic because one - path verification is mainly used only for deterministic semantics and the assumption simplifies the implementation . However , this assumption is not an essential feature of the algorithm . You should not rely on this assumption elsewhere . This decision is subject to change without notice . The current implementation of one-path verification assumes that the proof claim is deterministic, that is: the proof claim would not be discharged during at a non-confluent state in the execution of a non-deterministic semantics. (Often this means that the definition is simply deterministic.) As a result, given the non-deterministic definition > module ABC > import DOMAINS > syntax S ::= "a" | "b" | "c" > rule [ab]: a => b > rule [ac]: a => c > endmodule this claim would be provable, > rule a => b [claim] but this claim would **not** be provable, > rule a => c [claim] because the algorithm would first apply semantic rule [ab], which prevents rule [ac] from being used. We decided to assume that the definition is deterministic because one-path verification is mainly used only for deterministic semantics and the assumption simplifies the implementation. However, this assumption is not an essential feature of the algorithm. You should not rely on this assumption elsewhere. This decision is subject to change without notice. -} instance Claim OnePathClaim where newtype Rule OnePathClaim = OnePathRewriteRule {unRuleOnePath :: RewriteRule RewritingVariableName} deriving stock (Eq, Ord, Show) deriving stock (GHC.Generic) deriving anyclass (NFData) deriving anyclass (SOP.Generic, SOP.HasDatatypeInfo) deriving anyclass (Debug, Diff) deriving newtype (Unparse) simplify = simplify' _Unwrapped checkImplication = checkImplication' _Unwrapped applyClaims claims = deriveSeqClaim _Unwrapped OnePathClaim claims applyAxioms axioms = deriveSeqAxiomOnePath (concat axioms) instance From (Rule OnePathClaim) Attribute.PriorityAttributes where from = from @(RewriteRule _) . unRuleOnePath instance From OnePathClaim (AxiomPattern VariableName) where from = AxiomPattern . onePathRuleToTerm instance From OnePathClaim (AxiomPattern RewritingVariableName) where from = AxiomPattern . TermLike.mapVariables (pure mkRuleVariable) . onePathRuleToTerm instance ClaimExtractor OnePathClaim where extractClaim (attributes, sentence) = case termLike of TermLike.Implies_ _ (TermLike.And_ _ requires lhs) (TermLike.ApplyAlias_ alias [rhs]) | aliasId == weakExistsFinally -> do let rhs' = TermLike.mapVariables (pure mkRuleVariable) rhs attributes' = Attribute.mapAxiomVariables (pure mkRuleVariable) attributes (right', existentials') = ClaimPattern.termToExistentials rhs' pure $ OnePathClaim $ ClaimPattern.refreshExistentials ClaimPattern { ClaimPattern.left = Pattern.fromTermAndPredicate lhs (Predicate.wrapPredicate requires) & Pattern.mapVariables (pure mkRuleVariable) , ClaimPattern.right = parseRightHandSide right' , ClaimPattern.existentials = existentials' , ClaimPattern.attributes = attributes' } where aliasId = (getId . aliasConstructor) alias _ -> Nothing where termLike = (Syntax.sentenceAxiomPattern . Syntax.getSentenceClaim) sentence deriveSeqAxiomOnePath :: [Rule OnePathClaim] -> OnePathClaim -> TransitionT (AppliedRule OnePathClaim) Simplifier (ApplyResult OnePathClaim) deriveSeqAxiomOnePath rules = deriveSeq' _Unwrapped OnePathRewriteRule rewrites >=> simplifyRemainder where rewrites = unRuleOnePath <$> rules simplifyRemainder applied = case applied of ApplyRemainder claim -> ApplyRemainder <$> simplify claim _ -> return applied
null
https://raw.githubusercontent.com/runtimeverification/haskell-backend/4b04a36a24bc9188401230e7937b577ea83484af/kore/src/Kore/Reachability/OnePathClaim.hs
haskell
| One-Path-Claim claim pattern. | Converts a 'OnePathClaim' into its term representation. This is intended to be used only in unparsing situations, as some of the variable information related to the rewriting algorithm is lost.
| Copyright : ( c ) Runtime Verification , 2020 - 2021 License : BSD-3 - Clause Copyright : (c) Runtime Verification, 2020-2021 License : BSD-3-Clause -} module Kore.Reachability.OnePathClaim ( OnePathClaim (..), onePathRuleToTerm, mkOnePathClaim, Rule (..), ) where import Control.Monad ((>=>)) import Data.Generics.Wrapped ( _Unwrapped, ) import GHC.Generics qualified as GHC import Generics.SOP qualified as SOP import Kore.Attribute.Axiom qualified as Attribute import Kore.Debug import Kore.Internal.Alias ( Alias (aliasConstructor), ) import Kore.Internal.OrPattern ( OrPattern, ) import Kore.Internal.Pattern ( Pattern, ) import Kore.Internal.Pattern qualified as Pattern import Kore.Internal.Predicate qualified as Predicate import Kore.Internal.TermLike ( ElementVariable, TermLike, VariableName, getId, weakExistsFinally, ) import Kore.Internal.TermLike qualified as TermLike import Kore.Reachability.Claim import Kore.Rewrite.AxiomPattern import Kore.Rewrite.ClaimPattern as ClaimPattern import Kore.Rewrite.RewritingVariable ( RewritingVariableName, mkRuleVariable, ) import Kore.Rewrite.Transition ( TransitionT, ) import Kore.Rewrite.UnifyingRule ( UnifyingRule (..), ) import Kore.Simplify.Simplify ( Simplifier, ) import Kore.Syntax.Sentence qualified as Syntax import Kore.TopBottom ( TopBottom (..), ) import Kore.Unparser ( Unparse (..), ) import Prelude.Kore newtype OnePathClaim = OnePathClaim {getOnePathClaim :: ClaimPattern} deriving stock (Eq, Ord, Show) deriving stock (GHC.Generic) deriving anyclass (NFData) deriving anyclass (SOP.Generic, SOP.HasDatatypeInfo) deriving anyclass (Debug, Diff) onePathRuleToTerm :: OnePathClaim -> TermLike VariableName onePathRuleToTerm (OnePathClaim claimPattern') = claimPatternToTerm TermLike.WEF claimPattern' mkOnePathClaim :: Pattern RewritingVariableName -> OrPattern RewritingVariableName -> [ElementVariable RewritingVariableName] -> OnePathClaim mkOnePathClaim left right existentials = OnePathClaim (mkClaimPattern left right existentials) instance Unparse OnePathClaim where unparse claimPattern' = unparse $ onePathRuleToTerm claimPattern' unparse2 claimPattern' = unparse2 $ onePathRuleToTerm claimPattern' instance TopBottom OnePathClaim where isTop _ = False isBottom _ = False instance From OnePathClaim Attribute.SourceLocation where from = Attribute.sourceLocation . attributes . getOnePathClaim instance From OnePathClaim Attribute.Label where from = Attribute.label . attributes . getOnePathClaim instance From OnePathClaim Attribute.RuleIndex where from = Attribute.identifier . attributes . getOnePathClaim instance From OnePathClaim Attribute.Trusted where from = Attribute.trusted . attributes . getOnePathClaim instance From OnePathClaim Attribute.UniqueId where from = Attribute.uniqueId . attributes . getOnePathClaim instance UnifyingRule OnePathClaim where type UnifyingRuleVariable OnePathClaim = RewritingVariableName matchingPattern (OnePathClaim claim) = matchingPattern claim precondition (OnePathClaim claim) = precondition claim refreshRule stale (OnePathClaim claim) = OnePathClaim <$> refreshRule stale claim NOTE : Non - deterministic semantics The current implementation of one - path verification assumes that the proof claim is deterministic , that is : the proof claim would not be discharged during at a non - confluent state in the execution of a non - deterministic semantics . ( Often this means that the definition is simply deterministic . ) As a result , given the non - deterministic definition > module ABC > import DOMAINS > syntax S : : = " a " | " b " | " c " > rule [ ab ] : a = > b > rule [ ac ] : a = > c > endmodule this claim would be provable , > rule a = > b [ claim ] but this claim would * * not * * be provable , > rule a = > c [ claim ] because the algorithm would first apply semantic rule [ ab ] , which prevents rule [ ac ] from being used . We decided to assume that the definition is deterministic because one - path verification is mainly used only for deterministic semantics and the assumption simplifies the implementation . However , this assumption is not an essential feature of the algorithm . You should not rely on this assumption elsewhere . This decision is subject to change without notice . The current implementation of one-path verification assumes that the proof claim is deterministic, that is: the proof claim would not be discharged during at a non-confluent state in the execution of a non-deterministic semantics. (Often this means that the definition is simply deterministic.) As a result, given the non-deterministic definition > module ABC > import DOMAINS > syntax S ::= "a" | "b" | "c" > rule [ab]: a => b > rule [ac]: a => c > endmodule this claim would be provable, > rule a => b [claim] but this claim would **not** be provable, > rule a => c [claim] because the algorithm would first apply semantic rule [ab], which prevents rule [ac] from being used. We decided to assume that the definition is deterministic because one-path verification is mainly used only for deterministic semantics and the assumption simplifies the implementation. However, this assumption is not an essential feature of the algorithm. You should not rely on this assumption elsewhere. This decision is subject to change without notice. -} instance Claim OnePathClaim where newtype Rule OnePathClaim = OnePathRewriteRule {unRuleOnePath :: RewriteRule RewritingVariableName} deriving stock (Eq, Ord, Show) deriving stock (GHC.Generic) deriving anyclass (NFData) deriving anyclass (SOP.Generic, SOP.HasDatatypeInfo) deriving anyclass (Debug, Diff) deriving newtype (Unparse) simplify = simplify' _Unwrapped checkImplication = checkImplication' _Unwrapped applyClaims claims = deriveSeqClaim _Unwrapped OnePathClaim claims applyAxioms axioms = deriveSeqAxiomOnePath (concat axioms) instance From (Rule OnePathClaim) Attribute.PriorityAttributes where from = from @(RewriteRule _) . unRuleOnePath instance From OnePathClaim (AxiomPattern VariableName) where from = AxiomPattern . onePathRuleToTerm instance From OnePathClaim (AxiomPattern RewritingVariableName) where from = AxiomPattern . TermLike.mapVariables (pure mkRuleVariable) . onePathRuleToTerm instance ClaimExtractor OnePathClaim where extractClaim (attributes, sentence) = case termLike of TermLike.Implies_ _ (TermLike.And_ _ requires lhs) (TermLike.ApplyAlias_ alias [rhs]) | aliasId == weakExistsFinally -> do let rhs' = TermLike.mapVariables (pure mkRuleVariable) rhs attributes' = Attribute.mapAxiomVariables (pure mkRuleVariable) attributes (right', existentials') = ClaimPattern.termToExistentials rhs' pure $ OnePathClaim $ ClaimPattern.refreshExistentials ClaimPattern { ClaimPattern.left = Pattern.fromTermAndPredicate lhs (Predicate.wrapPredicate requires) & Pattern.mapVariables (pure mkRuleVariable) , ClaimPattern.right = parseRightHandSide right' , ClaimPattern.existentials = existentials' , ClaimPattern.attributes = attributes' } where aliasId = (getId . aliasConstructor) alias _ -> Nothing where termLike = (Syntax.sentenceAxiomPattern . Syntax.getSentenceClaim) sentence deriveSeqAxiomOnePath :: [Rule OnePathClaim] -> OnePathClaim -> TransitionT (AppliedRule OnePathClaim) Simplifier (ApplyResult OnePathClaim) deriveSeqAxiomOnePath rules = deriveSeq' _Unwrapped OnePathRewriteRule rewrites >=> simplifyRemainder where rewrites = unRuleOnePath <$> rules simplifyRemainder applied = case applied of ApplyRemainder claim -> ApplyRemainder <$> simplify claim _ -> return applied
ba3f3eb7ea764b4542cfbebf45efb54213b26f742cd26e2357b8e41e5b1f8a11
vehicle-lang/vehicle
Check.hs
module Vehicle.Check ( CheckOptions (..), check, ) where import Control.Exception (IOException, catch) import Control.Monad.Trans (MonadIO (liftIO)) import Data.List.NonEmpty (NonEmpty (..)) import Vehicle.Prelude import Vehicle.Resource import Vehicle.Verify.ProofCache (ProofCache (..), readProofCache) import Vehicle.Verify.Specification.Status (isVerified) -------------------------------------------------------------------------------- -- Checking newtype CheckOptions = CheckOptions { proofCache :: FilePath } deriving (Eq, Show) check :: LoggingSettings -> CheckOptions -> IO () check loggingSettings checkOptions = runImmediateLogger loggingSettings $ do -- If the user has specificied no logging target for check mode then -- default to command-line. status <- checkStatus checkOptions programOutput $ pretty status checkStatus :: CheckOptions -> ImmediateLoggerT IO CheckResult checkStatus CheckOptions {..} = do ProofCache {..} <- liftIO $ readProofCache proofCache (missingNetworks, alteredNetworks) <- checkResourceIntegrity resourceSummaries return $ case (missingNetworks, alteredNetworks, isVerified status) of (x : xs, _, _) -> MissingResources (x :| xs) ([], x : xs, _) -> AlteredResources (x :| xs) ([], [], False) -> Unverified ([], [], True) -> Verified getResourceStatus :: ResourceSummary -> IO ResourceStatus getResourceStatus ResourceSummary {..} = do let getResourceHash = hashResource resType value maybeNewHash <- catch @IOException (Just <$> getResourceHash) (const $ return Nothing) return $ case maybeNewHash of Nothing -> Missing Just newHash | fileHash /= newHash -> Altered | otherwise -> Unchanged checkResourceIntegrity :: (MonadLogger m, MonadIO m) => [ResourceSummary] -> m ([ResourceSummary], [ResourceSummary]) checkResourceIntegrity = \case [] -> return ([], []) (r : rs) -> do (missing, altered) <- checkResourceIntegrity rs resourceStatus <- liftIO (getResourceStatus r) return $ case resourceStatus of Unchanged -> (missing, altered) Altered -> (missing, r : altered) Missing -> (r : missing, altered) data ResourceStatus = Unchanged | Altered | Missing data CheckResult = Verified | Unverified | MissingResources (NonEmpty ResourceSummary) | AlteredResources (NonEmpty ResourceSummary) instance Pretty CheckResult where pretty Verified = "Status: verified" pretty Unverified = "Status: unverified" pretty (MissingResources missingNetworks) = "Status: unknown" <> line <> line <> "The following cannot not be found:" <> line <> line <> indent 2 (vsep (fmap prettyResource missingNetworks)) <> line <> line <> "To fix this problem, either move the missing files back to" <+> "the" <+> locations <+> "above or use Vehicle to reverify the" <+> "specification with the new" <+> locations <> "." where locations = "location" <> if length missingNetworks == 1 then "" else "s" pretty (AlteredResources alteredNetworks) = "Status: unknown" <> line <> line <> "The following have been altered since verification was" <+> "last run:" <> line <> line <> indent 2 (vsep (fmap prettyResource alteredNetworks)) <> line <> line <> "To fix this problem, use Vehicle to reverify the specification." prettyResource :: ResourceSummary -> Doc ann prettyResource ResourceSummary {..} = pretty resType <+> pretty name <+> parens (pretty value)
null
https://raw.githubusercontent.com/vehicle-lang/vehicle/ca99b8da9e5aabde2c94b758bb4141fbe53ebed5/vehicle/src/Vehicle/Check.hs
haskell
------------------------------------------------------------------------------ Checking If the user has specificied no logging target for check mode then default to command-line.
module Vehicle.Check ( CheckOptions (..), check, ) where import Control.Exception (IOException, catch) import Control.Monad.Trans (MonadIO (liftIO)) import Data.List.NonEmpty (NonEmpty (..)) import Vehicle.Prelude import Vehicle.Resource import Vehicle.Verify.ProofCache (ProofCache (..), readProofCache) import Vehicle.Verify.Specification.Status (isVerified) newtype CheckOptions = CheckOptions { proofCache :: FilePath } deriving (Eq, Show) check :: LoggingSettings -> CheckOptions -> IO () check loggingSettings checkOptions = runImmediateLogger loggingSettings $ do status <- checkStatus checkOptions programOutput $ pretty status checkStatus :: CheckOptions -> ImmediateLoggerT IO CheckResult checkStatus CheckOptions {..} = do ProofCache {..} <- liftIO $ readProofCache proofCache (missingNetworks, alteredNetworks) <- checkResourceIntegrity resourceSummaries return $ case (missingNetworks, alteredNetworks, isVerified status) of (x : xs, _, _) -> MissingResources (x :| xs) ([], x : xs, _) -> AlteredResources (x :| xs) ([], [], False) -> Unverified ([], [], True) -> Verified getResourceStatus :: ResourceSummary -> IO ResourceStatus getResourceStatus ResourceSummary {..} = do let getResourceHash = hashResource resType value maybeNewHash <- catch @IOException (Just <$> getResourceHash) (const $ return Nothing) return $ case maybeNewHash of Nothing -> Missing Just newHash | fileHash /= newHash -> Altered | otherwise -> Unchanged checkResourceIntegrity :: (MonadLogger m, MonadIO m) => [ResourceSummary] -> m ([ResourceSummary], [ResourceSummary]) checkResourceIntegrity = \case [] -> return ([], []) (r : rs) -> do (missing, altered) <- checkResourceIntegrity rs resourceStatus <- liftIO (getResourceStatus r) return $ case resourceStatus of Unchanged -> (missing, altered) Altered -> (missing, r : altered) Missing -> (r : missing, altered) data ResourceStatus = Unchanged | Altered | Missing data CheckResult = Verified | Unverified | MissingResources (NonEmpty ResourceSummary) | AlteredResources (NonEmpty ResourceSummary) instance Pretty CheckResult where pretty Verified = "Status: verified" pretty Unverified = "Status: unverified" pretty (MissingResources missingNetworks) = "Status: unknown" <> line <> line <> "The following cannot not be found:" <> line <> line <> indent 2 (vsep (fmap prettyResource missingNetworks)) <> line <> line <> "To fix this problem, either move the missing files back to" <+> "the" <+> locations <+> "above or use Vehicle to reverify the" <+> "specification with the new" <+> locations <> "." where locations = "location" <> if length missingNetworks == 1 then "" else "s" pretty (AlteredResources alteredNetworks) = "Status: unknown" <> line <> line <> "The following have been altered since verification was" <+> "last run:" <> line <> line <> indent 2 (vsep (fmap prettyResource alteredNetworks)) <> line <> line <> "To fix this problem, use Vehicle to reverify the specification." prettyResource :: ResourceSummary -> Doc ann prettyResource ResourceSummary {..} = pretty resType <+> pretty name <+> parens (pretty value)
4567a0e2567771853f883bafe6ccf7ac262b2732b3fa2aa34acc385828f69c8a
input-output-hk/plutus-apps
Common.hs
{-# LANGUAGE ConstraintKinds #-} {-# LANGUAGE DeriveAnyClass #-} # LANGUAGE DerivingStrategies # # LANGUAGE ExplicitNamespaces # # LANGUAGE FlexibleContexts # # LANGUAGE LambdaCase # {-# LANGUAGE OverloadedStrings #-} module Control.Monad.Freer.Extras.Beam.Common where import Cardano.BM.Data.Tracer (ToObject (..)) import Control.Exception (Exception) import Data.Aeson (FromJSON, ToJSON) import Data.Text (Text) import Database.Beam (Beamable, QBaseScope) import Database.Beam.Backend (BeamSqlBackendCanSerialize) import Database.Beam.Query.Internal (QNested) import Database.Beam.Schema.Tables (FieldsFulfillConstraint) import GHC.Generics (Generic) import Prettyprinter (Pretty (..), colon, (<+>)) type BeamableDb db table = (Beamable table, FieldsFulfillConstraint (BeamSqlBackendCanSerialize db) table) type BeamThreadingArg = QNested (QNested QBaseScope) newtype BeamError = SqlError Text deriving stock (Eq, Show, Generic) deriving anyclass (FromJSON, ToJSON, ToObject) instance Exception BeamError instance Pretty BeamError where pretty = \case SqlError s -> "SqlError (via Beam)" <> colon <+> pretty s newtype BeamLog = SqlLog String deriving stock (Eq, Show, Generic) deriving anyclass (FromJSON, ToJSON, ToObject) instance Pretty BeamLog where pretty = \case SqlLog s -> "SqlLog" <> colon <+> pretty s
null
https://raw.githubusercontent.com/input-output-hk/plutus-apps/b7f0e250a32387c8320ddd7fb19a21057b466a27/freer-extras/src/Control/Monad/Freer/Extras/Beam/Common.hs
haskell
# LANGUAGE ConstraintKinds # # LANGUAGE DeriveAnyClass # # LANGUAGE OverloadedStrings #
# LANGUAGE DerivingStrategies # # LANGUAGE ExplicitNamespaces # # LANGUAGE FlexibleContexts # # LANGUAGE LambdaCase # module Control.Monad.Freer.Extras.Beam.Common where import Cardano.BM.Data.Tracer (ToObject (..)) import Control.Exception (Exception) import Data.Aeson (FromJSON, ToJSON) import Data.Text (Text) import Database.Beam (Beamable, QBaseScope) import Database.Beam.Backend (BeamSqlBackendCanSerialize) import Database.Beam.Query.Internal (QNested) import Database.Beam.Schema.Tables (FieldsFulfillConstraint) import GHC.Generics (Generic) import Prettyprinter (Pretty (..), colon, (<+>)) type BeamableDb db table = (Beamable table, FieldsFulfillConstraint (BeamSqlBackendCanSerialize db) table) type BeamThreadingArg = QNested (QNested QBaseScope) newtype BeamError = SqlError Text deriving stock (Eq, Show, Generic) deriving anyclass (FromJSON, ToJSON, ToObject) instance Exception BeamError instance Pretty BeamError where pretty = \case SqlError s -> "SqlError (via Beam)" <> colon <+> pretty s newtype BeamLog = SqlLog String deriving stock (Eq, Show, Generic) deriving anyclass (FromJSON, ToJSON, ToObject) instance Pretty BeamLog where pretty = \case SqlLog s -> "SqlLog" <> colon <+> pretty s
e763abbbbd7801fc77d19a7f284245fe1b912506b89012960c3cfed2aa126835
commercialhaskell/stack
Main.hs
import StackTest main :: IO () main = do stackCleanFull stack ["build", "acme-dont-copy"] stack ["test"]
null
https://raw.githubusercontent.com/commercialhaskell/stack/255cd830627870cdef34b5e54d670ef07882523e/test/integration/tests/4783-doctest-deps/Main.hs
haskell
import StackTest main :: IO () main = do stackCleanFull stack ["build", "acme-dont-copy"] stack ["test"]
e2ccc1bb671ea7018241001a7d6915c86588f8e8c59c810377ef17a8658417f8
ogaml/ogaml
drawMode.mli
(** GL draw modes enum *) type t = | TriangleStrip | TriangleFan | Triangles | Lines
null
https://raw.githubusercontent.com/ogaml/ogaml/5e74597521abf7ba2833a9247e55780eabfbab78/src/graphics/vertex/drawMode.mli
ocaml
* GL draw modes enum
type t = | TriangleStrip | TriangleFan | Triangles | Lines
971128d97b6daf6d261c385080c9829539b914f93d7bc02f3b607c7856d929d0
wilbowma/cur
ML-rewrite-2.rkt
#lang cur (require (rename-in (except-in cur/stdlib/equality == refl) [ML-= ==] [ML-refl refl]) cur/stdlib/sugar cur/stdlib/nat cur/ntac/base cur/ntac/standard cur/ntac/ML-rewrite "rackunit-ntac.rkt") ;; tests rewrite ;;plus-0-n raw term (define plus-0-n-term (λ [n : Nat] (refl Nat n))) (:: plus-0-n-term (forall [n : Nat] (== Nat (plus 0 n) n))) (define-theorem plus-0-n (forall [n : Nat] (== Nat (plus 0 n) n)) by-intro simpl reflexivity) ;; mult-0-plus ;; - uses rewrite ;; raw term (:: (λ [n : Nat] ((λ [H : (== Nat (plus 0 n) n)] (new-elim H (λ [n0 : Nat] [n : Nat] (λ [H : (== Nat n0 n)] (Π [m : Nat] (== Nat (mult n0 m) (mult n0 m))))) (λ [n0 : Nat] (λ [m : Nat] (refl Nat (mult n0 m)))))) (plus-0-n-term n))) (∀ [n : Nat] [m : Nat] (== Nat (mult (plus 0 n) m) (mult n m)))) ;; raw term, directly (:: (λ [n : Nat] (new-elim (plus-0-n-term n) (λ [n0 : Nat] [n : Nat] (λ [H : (== Nat n0 n)] (Π [m : Nat] (== Nat (mult n m) (mult n m))))) (λ [n : Nat] (λ [m : Nat] (refl Nat (mult n m)))))) (∀ [n : Nat] [m : Nat] (== Nat (mult (plus 0 n) m) (mult n m)))) (define-theorem mult-0-plus (∀ [n : Nat] [m : Nat] (== Nat (mult (plus 0 n) m) (mult n m))) (by-intro n) by-intro (by-rewrite plus-0-n n) reflexivity)
null
https://raw.githubusercontent.com/wilbowma/cur/e039c98941b3d272c6e462387df22846e10b0128/cur-test/cur/tests/ntac/ML-rewrite-2.rkt
racket
tests rewrite plus-0-n raw term mult-0-plus - uses rewrite raw term raw term, directly
#lang cur (require (rename-in (except-in cur/stdlib/equality == refl) [ML-= ==] [ML-refl refl]) cur/stdlib/sugar cur/stdlib/nat cur/ntac/base cur/ntac/standard cur/ntac/ML-rewrite "rackunit-ntac.rkt") (define plus-0-n-term (λ [n : Nat] (refl Nat n))) (:: plus-0-n-term (forall [n : Nat] (== Nat (plus 0 n) n))) (define-theorem plus-0-n (forall [n : Nat] (== Nat (plus 0 n) n)) by-intro simpl reflexivity) (:: (λ [n : Nat] ((λ [H : (== Nat (plus 0 n) n)] (new-elim H (λ [n0 : Nat] [n : Nat] (λ [H : (== Nat n0 n)] (Π [m : Nat] (== Nat (mult n0 m) (mult n0 m))))) (λ [n0 : Nat] (λ [m : Nat] (refl Nat (mult n0 m)))))) (plus-0-n-term n))) (∀ [n : Nat] [m : Nat] (== Nat (mult (plus 0 n) m) (mult n m)))) (:: (λ [n : Nat] (new-elim (plus-0-n-term n) (λ [n0 : Nat] [n : Nat] (λ [H : (== Nat n0 n)] (Π [m : Nat] (== Nat (mult n m) (mult n m))))) (λ [n : Nat] (λ [m : Nat] (refl Nat (mult n m)))))) (∀ [n : Nat] [m : Nat] (== Nat (mult (plus 0 n) m) (mult n m)))) (define-theorem mult-0-plus (∀ [n : Nat] [m : Nat] (== Nat (mult (plus 0 n) m) (mult n m))) (by-intro n) by-intro (by-rewrite plus-0-n n) reflexivity)
845e17bed67db59b6ed122087568d7d922be5fc3aa4625f2c12989b378e2eb7e
lesguillemets/sicp-haskell
1.12.hs
module OneTwelve where Write a procedure that computes elements of 's triangle by means -- of a recursive process. -- Not sure what the expected input is.. pascalAt :: Int -> Int -> Int pascalAt row column | column == 0 || column == row = 1 | column < 0 || row < column = 0 | otherwise = pascalAt (row-1) column + pascalAt (row-1) (column-1) -- | Let's check, anyway. > > > pascalAt 0 0 1 -- >>> pascalAt 2 1 2 > > > map ( pascalAt 3 ) [ 0 .. 3 ] -- [1,3,3,1] > > > map ( pascalAt 4 ) [ 0 .. 4 ] -- [1,4,6,4,1]
null
https://raw.githubusercontent.com/lesguillemets/sicp-haskell/df524a1e28c45fb16a56f539cad8babc881d0431/exercise/chap01/sect2/1.12.hs
haskell
of a recursive process. Not sure what the expected input is.. | Let's check, anyway. >>> pascalAt 2 1 [1,3,3,1] [1,4,6,4,1]
module OneTwelve where Write a procedure that computes elements of 's triangle by means pascalAt :: Int -> Int -> Int pascalAt row column | column == 0 || column == row = 1 | column < 0 || row < column = 0 | otherwise = pascalAt (row-1) column + pascalAt (row-1) (column-1) > > > pascalAt 0 0 1 2 > > > map ( pascalAt 3 ) [ 0 .. 3 ] > > > map ( pascalAt 4 ) [ 0 .. 4 ]
5fa4b8a1a9216c3eac0173e2369f250cb6a71c0e1844f6dbaeb30453ed44ad7f
emqx/emqx
emqx_persistent_session_SUITE.erl
%%-------------------------------------------------------------------- Copyright ( c ) 2021 - 2023 EMQ Technologies Co. , Ltd. All Rights Reserved . %% Licensed under the Apache License , Version 2.0 ( the " License " ) ; %% you may not use this file except in compliance with the License. %% You may obtain a copy of the License at %% %% -2.0 %% %% Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an " AS IS " BASIS , %% WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. %% See the License for the specific language governing permissions and %% limitations under the License. %%-------------------------------------------------------------------- -module(emqx_persistent_session_SUITE). -include_lib("stdlib/include/assert.hrl"). -include_lib("common_test/include/ct.hrl"). -include_lib("snabbkaffe/include/snabbkaffe.hrl"). -include_lib("../include/emqx.hrl"). -include("../src/persistent_session/emqx_persistent_session.hrl"). -compile(export_all). -compile(nowarn_export_all). %%-------------------------------------------------------------------- SUITE boilerplate %%-------------------------------------------------------------------- all() -> [ {group, persistent_store_enabled}, {group, persistent_store_disabled} ]. A persistent session can be resumed in two ways : 1 . The old connection process is still alive , and the session is taken %% over by the new connection. 2 . The old session process has died ( e.g. , because of node down ) . %% The new process resumes the session from the stored state, and finds %% any subscribed messages from the persistent message store. %% %% We want to test both ways, both with the db backend enabled and disabled. %% %% In addition, we test both tcp and quic connections. groups() -> TCs = emqx_common_test_helpers:all(?MODULE), SnabbkaffeTCs = [TC || TC <- TCs, is_snabbkaffe_tc(TC)], GCTests = [TC || TC <- TCs, is_gc_tc(TC)], OtherTCs = (TCs -- SnabbkaffeTCs) -- GCTests, [ {persistent_store_enabled, [ {group, ram_tables}, {group, disc_tables} ]}, {persistent_store_disabled, [{group, no_kill_connection_process}]}, {ram_tables, [], [ {group, no_kill_connection_process}, {group, kill_connection_process}, {group, snabbkaffe}, {group, gc_tests} ]}, {disc_tables, [], [ {group, no_kill_connection_process}, {group, kill_connection_process}, {group, snabbkaffe}, {group, gc_tests} ]}, {no_kill_connection_process, [], [{group, tcp}, {group, quic}, {group, ws}]}, {kill_connection_process, [], [{group, tcp}, {group, quic}, {group, ws}]}, {snabbkaffe, [], [ {group, tcp_snabbkaffe}, {group, quic_snabbkaffe}, {group, ws_snabbkaffe} ]}, {tcp, [], OtherTCs}, {quic, [], OtherTCs}, {ws, [], OtherTCs}, {tcp_snabbkaffe, [], SnabbkaffeTCs}, {quic_snabbkaffe, [], SnabbkaffeTCs}, {ws_snabbkaffe, [], SnabbkaffeTCs}, {gc_tests, [], GCTests} ]. is_snabbkaffe_tc(TC) -> re:run(atom_to_list(TC), "^t_snabbkaffe_") /= nomatch. is_gc_tc(TC) -> re:run(atom_to_list(TC), "^t_gc_") /= nomatch. init_per_group(persistent_store_enabled, Config) -> [{persistent_store_enabled, true} | Config]; init_per_group(Group, Config) when Group =:= ram_tables; Group =:= disc_tables -> %% Start Apps Reply = case Group =:= ram_tables of true -> ram; false -> disc end, emqx_common_test_helpers:boot_modules(all), meck:new(emqx_config, [non_strict, passthrough, no_history, no_link]), meck:expect(emqx_config, get, fun (?on_disc_key) -> Reply =:= disc; (?is_enabled_key) -> true; (Other) -> meck:passthrough([Other]) end), emqx_common_test_helpers:start_apps([], fun set_special_confs/1), ?assertEqual(true, emqx_persistent_session:is_store_enabled()), Config; init_per_group(persistent_store_disabled, Config) -> %% Start Apps emqx_common_test_helpers:boot_modules(all), meck:new(emqx_config, [non_strict, passthrough, no_history, no_link]), meck:expect(emqx_config, get, fun (?is_enabled_key) -> false; (Other) -> meck:passthrough([Other]) end), emqx_common_test_helpers:start_apps([], fun set_special_confs/1), ?assertEqual(false, emqx_persistent_session:is_store_enabled()), [{persistent_store_enabled, false} | Config]; init_per_group(Group, Config) when Group == ws; Group == ws_snabbkaffe -> [ {ssl, false}, {host, "localhost"}, {enable_websocket, true}, {port, 8083}, {conn_fun, ws_connect} | Config ]; init_per_group(Group, Config) when Group == tcp; Group == tcp_snabbkaffe -> [{port, 1883}, {conn_fun, connect} | Config]; init_per_group(Group, Config) when Group == quic; Group == quic_snabbkaffe -> UdpPort = 1883, emqx_common_test_helpers:ensure_quic_listener(?MODULE, UdpPort), [{port, UdpPort}, {conn_fun, quic_connect} | Config]; init_per_group(no_kill_connection_process, Config) -> [{kill_connection_process, false} | Config]; init_per_group(kill_connection_process, Config) -> [{kill_connection_process, true} | Config]; init_per_group(snabbkaffe, Config) -> [{kill_connection_process, true} | Config]; init_per_group(gc_tests, Config) -> %% We need to make sure the system does not interfere with this test group. lists:foreach( fun(ClientId) -> maybe_kill_connection_process(ClientId, [{kill_connection_process, true}]) end, emqx_cm:all_client_ids() ), emqx_common_test_helpers:stop_apps([]), SessionMsgEts = gc_tests_session_store, MsgEts = gc_tests_msg_store, Pid = spawn(fun() -> ets:new(SessionMsgEts, [named_table, public, ordered_set]), ets:new(MsgEts, [named_table, public, ordered_set, {keypos, 2}]), receive stop -> ok end end), meck:new(mnesia, [non_strict, passthrough, no_history, no_link]), meck:expect(mnesia, dirty_first, fun (?SESS_MSG_TAB) -> ets:first(SessionMsgEts); (?MSG_TAB) -> ets:first(MsgEts); (X) -> meck:passthrough([X]) end), meck:expect(mnesia, dirty_next, fun (?SESS_MSG_TAB, X) -> ets:next(SessionMsgEts, X); (?MSG_TAB, X) -> ets:next(MsgEts, X); (Tab, X) -> meck:passthrough([Tab, X]) end), meck:expect(mnesia, dirty_delete, fun (?MSG_TAB, X) -> ets:delete(MsgEts, X); (Tab, X) -> meck:passthrough([Tab, X]) end), [{store_owner, Pid}, {session_msg_store, SessionMsgEts}, {msg_store, MsgEts} | Config]. init_per_suite(Config) -> Config. set_special_confs(_) -> ok. end_per_suite(_Config) -> emqx_common_test_helpers:ensure_mnesia_stopped(), ok. end_per_group(gc_tests, Config) -> meck:unload(mnesia), ?config(store_owner, Config) ! stop, ok; end_per_group(Group, _Config) when Group =:= ram_tables; Group =:= disc_tables -> meck:unload(emqx_config), emqx_common_test_helpers:stop_apps([]); end_per_group(persistent_store_disabled, _Config) -> meck:unload(emqx_config), emqx_common_test_helpers:stop_apps([]); end_per_group(_Group, _Config) -> ok. init_per_testcase(TestCase, Config) -> Config1 = preconfig_per_testcase(TestCase, Config), case is_gc_tc(TestCase) of true -> ets:delete_all_objects(?config(msg_store, Config)), ets:delete_all_objects(?config(session_msg_store, Config)); false -> skip end, case erlang:function_exported(?MODULE, TestCase, 2) of true -> ?MODULE:TestCase(init, Config1); _ -> Config1 end. end_per_testcase(TestCase, Config) -> case is_snabbkaffe_tc(TestCase) of true -> snabbkaffe:stop(); false -> skip end, case erlang:function_exported(?MODULE, TestCase, 2) of true -> ?MODULE:TestCase('end', Config); false -> ok end, Config. preconfig_per_testcase(TestCase, Config) -> {BaseName, Config1} = case ?config(tc_group_properties, Config) of [] -> %% We are running a single testcase { atom_to_binary(TestCase), init_per_group(tcp, init_per_group(kill_connection_process, Config)) }; [_ | _] = Props -> Path = lists:reverse(?config(tc_group_path, Config) ++ Props), Pre0 = [atom_to_list(N) || {name, N} <- lists:flatten(Path)], Pre1 = lists:join("_", Pre0 ++ [atom_to_binary(TestCase)]), {iolist_to_binary(Pre1), Config} end, [ {topic, iolist_to_binary([BaseName, "/foo"])}, {stopic, iolist_to_binary([BaseName, "/+"])}, {stopic_alt, iolist_to_binary([BaseName, "/foo"])}, {client_id, BaseName} | Config1 ]. %%-------------------------------------------------------------------- %% Helpers %%-------------------------------------------------------------------- client_info(Key, Client) -> maps:get(Key, maps:from_list(emqtt:info(Client)), undefined). receive_messages(Count) -> receive_messages(Count, []). receive_messages(0, Msgs) -> Msgs; receive_messages(Count, Msgs) -> receive {publish, Msg} -> receive_messages(Count - 1, [Msg | Msgs]); _Other -> receive_messages(Count, Msgs) after 5000 -> Msgs end. maybe_kill_connection_process(ClientId, Config) -> case ?config(kill_connection_process, Config) of true -> case emqx_cm:lookup_channels(ClientId) of [] -> ok; [ConnectionPid] -> ?assert(is_pid(ConnectionPid)), Ref = monitor(process, ConnectionPid), ConnectionPid ! die_if_test, receive {'DOWN', Ref, process, ConnectionPid, normal} -> ok after 3000 -> error(process_did_not_die) end, wait_for_cm_unregister(ClientId) end; false -> ok end. wait_for_cm_unregister(ClientId) -> wait_for_cm_unregister(ClientId, 100). wait_for_cm_unregister(_ClientId, 0) -> error(cm_did_not_unregister); wait_for_cm_unregister(ClientId, N) -> case emqx_cm:lookup_channels(ClientId) of [] -> ok; [_] -> timer:sleep(100), wait_for_cm_unregister(ClientId, N - 1) end. snabbkaffe_sync_publish(Topic, Payloads) -> Fun = fun(Client, Payload) -> ?check_trace( begin ?wait_async_action( {ok, _} = emqtt:publish(Client, Topic, Payload, 2), #{?snk_kind := ps_persist_msg, payload := Payload} ) end, fun(_, _Trace) -> ok end ) end, do_publish(Payloads, Fun, true). publish(Topic, Payloads) -> publish(Topic, Payloads, false). publish(Topic, Payloads, WaitForUnregister) -> Fun = fun(Client, Payload) -> {ok, _} = emqtt:publish(Client, Topic, Payload, 2) end, do_publish(Payloads, Fun, WaitForUnregister). do_publish(Payloads = [_ | _], PublishFun, WaitForUnregister) -> %% Publish from another process to avoid connection confusion. {Pid, Ref} = spawn_monitor( fun() -> %% For convenience, always publish using tcp. %% The publish path is not what we are testing. ClientID = <<"ps_SUITE_publisher">>, {ok, Client} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientID}, {port, 1883} ]), {ok, _} = emqtt:connect(Client), lists:foreach(fun(Payload) -> PublishFun(Client, Payload) end, Payloads), ok = emqtt:disconnect(Client), %% Snabbkaffe sometimes fails unless all processes are gone. case WaitForUnregister of false -> ok; true -> case emqx_cm:lookup_channels(ClientID) of [] -> ok; [ConnectionPid] -> ?assert(is_pid(ConnectionPid)), Ref1 = monitor(process, ConnectionPid), receive {'DOWN', Ref1, process, ConnectionPid, _} -> ok after 3000 -> error(process_did_not_die) end, wait_for_cm_unregister(ClientID) end end end ), receive {'DOWN', Ref, process, Pid, normal} -> ok; {'DOWN', Ref, process, Pid, What} -> error({failed_publish, What}) end; do_publish(Payload, PublishFun, WaitForUnregister) -> do_publish([Payload], PublishFun, WaitForUnregister). %%-------------------------------------------------------------------- %% Test Cases %%-------------------------------------------------------------------- %% [MQTT-3.1.2-23] t_connect_session_expiry_interval(Config) -> ConnFun = ?config(conn_fun, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), Payload = <<"test message">>, ClientId = ?config(client_id, Config), {ok, Client1} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic, qos2), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), publish(Topic, Payload), {ok, Client2} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, false} | Config ]), {ok, _} = emqtt:ConnFun(Client2), [Msg | _] = receive_messages(1), ?assertEqual({ok, iolist_to_binary(Topic)}, maps:find(topic, Msg)), ?assertEqual({ok, iolist_to_binary(Payload)}, maps:find(payload, Msg)), ?assertEqual({ok, 2}, maps:find(qos, Msg)), ok = emqtt:disconnect(Client2). t_without_client_id(Config) -> %% Emqtt client dies process_flag(trap_exit, true), ConnFun = ?config(conn_fun, Config), {ok, Client0} = emqtt:start_link([ {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, false} | Config ]), {error, {client_identifier_not_valid, _}} = emqtt:ConnFun(Client0), ok. t_assigned_clientid_persistent_session(Config) -> ConnFun = ?config(conn_fun, Config), {ok, Client1} = emqtt:start_link([ {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, true} | Config ]), {ok, _} = emqtt:ConnFun(Client1), AssignedClientId = client_info(clientid, Client1), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(AssignedClientId, Config), {ok, Client2} = emqtt:start_link([ {clientid, AssignedClientId}, {proto_ver, v5}, {clean_start, false} | Config ]), {ok, _} = emqtt:ConnFun(Client2), ?assertEqual(1, client_info(session_present, Client2)), ok = emqtt:disconnect(Client2). t_cancel_on_disconnect(Config) -> %% Open a persistent session, but cancel the persistence when %% shutting down the connection. ConnFun = ?config(conn_fun, Config), ClientId = ?config(client_id, Config), {ok, Client1} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, true} | Config ]), {ok, _} = emqtt:ConnFun(Client1), ok = emqtt:disconnect(Client1, 0, #{'Session-Expiry-Interval' => 0}), wait_for_cm_unregister(ClientId), {ok, Client2} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {clean_start, false}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ]), {ok, _} = emqtt:ConnFun(Client2), ?assertEqual(0, client_info(session_present, Client2)), ok = emqtt:disconnect(Client2). t_persist_on_disconnect(Config) -> %% Open a non-persistent session, but add the persistence when %% shutting down the connection. This is a protocol error, and %% should not convert the session into a persistent session. ConnFun = ?config(conn_fun, Config), ClientId = ?config(client_id, Config), {ok, Client1} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 0}}, {clean_start, true} | Config ]), {ok, _} = emqtt:ConnFun(Client1), %% Strangely enough, the disconnect is reported as successful by emqtt. ok = emqtt:disconnect(Client1, 0, #{'Session-Expiry-Interval' => 30}), wait_for_cm_unregister(ClientId), {ok, Client2} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {clean_start, false}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ]), {ok, _} = emqtt:ConnFun(Client2), %% The session should not be known, since it wasn't persisted because of the %% changed expiry interval in the disconnect call. ?assertEqual(0, client_info(session_present, Client2)), ok = emqtt:disconnect(Client2). wait_for_pending(SId) -> wait_for_pending(SId, 100). wait_for_pending(_SId, 0) -> error(exhausted_wait_for_pending); wait_for_pending(SId, N) -> case emqx_persistent_session:pending(SId) of [] -> timer:sleep(1), wait_for_pending(SId, N - 1); [_ | _] = Pending -> Pending end. t_process_dies_session_expires(Config) -> %% Emulate an error in the connect process, %% or that the node of the process goes down. %% A persistent session should eventually expire. ConnFun = ?config(conn_fun, Config), ClientId = ?config(client_id, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), Payload = <<"test">>, {ok, Client1} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 1}}, {clean_start, true} | Config ]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic, qos2), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), ok = publish(Topic, [Payload]), SessionId = case ?config(persistent_store_enabled, Config) of false -> undefined; true -> %% The session should not be marked as expired. {Tag, Session} = emqx_persistent_session:lookup(ClientId), ?assertEqual(persistent, Tag), SId = emqx_session:info(id, Session), case ?config(kill_connection_process, Config) of true -> %% The session should have a pending message ?assertMatch([_], wait_for_pending(SId)); false -> skip end, SId end, timer:sleep(1100), %% The session should now be marked as expired. case (?config(kill_connection_process, Config) andalso ?config(persistent_store_enabled, Config)) of true -> ?assertMatch({expired, _}, emqx_persistent_session:lookup(ClientId)); false -> skip end, {ok, Client2} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, false} | Config ]), {ok, _} = emqtt:ConnFun(Client2), ?assertEqual(0, client_info(session_present, Client2)), case (?config(kill_connection_process, Config) andalso ?config(persistent_store_enabled, Config)) of true -> The session should be a fresh one {persistent, NewSession} = emqx_persistent_session:lookup(ClientId), ?assertNotEqual(SessionId, emqx_session:info(id, NewSession)), %% The old session should now either %% be marked as abandoned or already be garbage collected. ?assertMatch([], emqx_persistent_session:pending(SessionId)); false -> skip end, %% We should not receive the pending message ?assertEqual([], receive_messages(1)), emqtt:disconnect(Client2). t_publish_while_client_is_gone(Config) -> %% A persistent session should receive messages in its %% subscription even if the process owning the session dies. ConnFun = ?config(conn_fun, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), Payload1 = <<"hello1">>, Payload2 = <<"hello2">>, ClientId = ?config(client_id, Config), {ok, Client1} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, true} | Config ]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic, qos2), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), ok = publish(Topic, [Payload1, Payload2]), {ok, Client2} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, false} | Config ]), {ok, _} = emqtt:ConnFun(Client2), Msgs = receive_messages(2), ?assertMatch([_, _], Msgs), [Msg2, Msg1] = Msgs, ?assertEqual({ok, iolist_to_binary(Payload1)}, maps:find(payload, Msg1)), ?assertEqual({ok, 2}, maps:find(qos, Msg1)), ?assertEqual({ok, iolist_to_binary(Payload2)}, maps:find(payload, Msg2)), ?assertEqual({ok, 2}, maps:find(qos, Msg2)), ok = emqtt:disconnect(Client2). t_clean_start_drops_subscriptions(Config) -> 1 . A persistent session is started and disconnected . 2 . While disconnected , a message is published and persisted . 3 . When connecting again , the clean start flag is set , the subscription is renewed , %% then we disconnect again. 4 . Finally , a new connection is made with clean start set to false . %% The original message should not be delivered. ConnFun = ?config(conn_fun, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), Payload1 = <<"hello1">>, Payload2 = <<"hello2">>, Payload3 = <<"hello3">>, ClientId = ?config(client_id, Config), 1 . {ok, Client1} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, true} | Config ]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic, qos2), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), 2 . ok = publish(Topic, Payload1), 3 . {ok, Client2} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, true} | Config ]), {ok, _} = emqtt:ConnFun(Client2), ?assertEqual(0, client_info(session_present, Client2)), {ok, _, [2]} = emqtt:subscribe(Client2, STopic, qos2), ok = publish(Topic, Payload2), [Msg1] = receive_messages(1), ?assertEqual({ok, iolist_to_binary(Payload2)}, maps:find(payload, Msg1)), ok = emqtt:disconnect(Client2), maybe_kill_connection_process(ClientId, Config), 4 . {ok, Client3} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, false} | Config ]), {ok, _} = emqtt:ConnFun(Client3), ok = publish(Topic, Payload3), [Msg2] = receive_messages(1), ?assertEqual({ok, iolist_to_binary(Payload3)}, maps:find(payload, Msg2)), ok = emqtt:disconnect(Client3). t_unsubscribe(Config) -> ConnFun = ?config(conn_fun, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), ClientId = ?config(client_id, Config), {ok, Client} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ]), {ok, _} = emqtt:ConnFun(Client), {ok, _, [2]} = emqtt:subscribe(Client, STopic, qos2), case emqx_persistent_session:is_store_enabled() of true -> {persistent, Session} = emqx_persistent_session:lookup(ClientId), SessionID = emqx_session:info(id, Session), SessionIDs = [SId || #route{dest = SId} <- emqx_session_router:match_routes(Topic)], ?assert(lists:member(SessionID, SessionIDs)), ?assertMatch([_], [Sub || {ST, _} = Sub <- emqtt:subscriptions(Client), ST =:= STopic]), {ok, _, _} = emqtt:unsubscribe(Client, STopic), ?assertMatch([], [Sub || {ST, _} = Sub <- emqtt:subscriptions(Client), ST =:= STopic]), SessionIDs2 = [SId || #route{dest = SId} <- emqx_session_router:match_routes(Topic)], ?assert(not lists:member(SessionID, SessionIDs2)); false -> ?assertMatch([_], [Sub || {ST, _} = Sub <- emqtt:subscriptions(Client), ST =:= STopic]), {ok, _, _} = emqtt:unsubscribe(Client, STopic), ?assertMatch([], [Sub || {ST, _} = Sub <- emqtt:subscriptions(Client), ST =:= STopic]) end, ok = emqtt:disconnect(Client). t_multiple_subscription_matches(Config) -> ConnFun = ?config(conn_fun, Config), Topic = ?config(topic, Config), STopic1 = ?config(stopic, Config), STopic2 = ?config(stopic_alt, Config), Payload = <<"test message">>, ClientId = ?config(client_id, Config), {ok, Client1} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic1, qos2), {ok, _, [2]} = emqtt:subscribe(Client1, STopic2, qos2), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), publish(Topic, Payload), {ok, Client2} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, false} | Config ]), {ok, _} = emqtt:ConnFun(Client2), We will receive the same message twice because it matches two subscriptions . [Msg1, Msg2] = receive_messages(2), ?assertEqual({ok, iolist_to_binary(Topic)}, maps:find(topic, Msg1)), ?assertEqual({ok, iolist_to_binary(Payload)}, maps:find(payload, Msg1)), ?assertEqual({ok, iolist_to_binary(Topic)}, maps:find(topic, Msg2)), ?assertEqual({ok, iolist_to_binary(Payload)}, maps:find(payload, Msg2)), ?assertEqual({ok, 2}, maps:find(qos, Msg1)), ?assertEqual({ok, 2}, maps:find(qos, Msg2)), ok = emqtt:disconnect(Client2). t_lost_messages_because_of_gc(init, Config) -> case (emqx_persistent_session:is_store_enabled() andalso ?config(kill_connection_process, Config)) of true -> Retain = 1000, OldRetain = emqx_config:get(?msg_retain, Retain), emqx_config:put(?msg_retain, Retain), [{retain, Retain}, {old_retain, OldRetain} | Config]; false -> {skip, only_relevant_with_store_and_kill_process} end; t_lost_messages_because_of_gc('end', Config) -> OldRetain = ?config(old_retain, Config), emqx_config:put(?msg_retain, OldRetain), ok. t_lost_messages_because_of_gc(Config) -> ConnFun = ?config(conn_fun, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), ClientId = ?config(client_id, Config), Retain = ?config(retain, Config), Payload1 = <<"hello1">>, Payload2 = <<"hello2">>, {ok, Client1} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic, qos2), emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), publish(Topic, Payload1), timer:sleep(2 * Retain), publish(Topic, Payload2), emqx_persistent_session_gc:message_gc_worker(), {ok, Client2} = emqtt:start_link([ {clientid, ClientId}, {clean_start, false}, {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ]), {ok, _} = emqtt:ConnFun(Client2), Msgs = receive_messages(2), ?assertMatch([_], Msgs), ?assertEqual({ok, iolist_to_binary(Payload2)}, maps:find(payload, hd(Msgs))), emqtt:disconnect(Client2), ok. %%-------------------------------------------------------------------- Snabbkaffe helpers %%-------------------------------------------------------------------- check_snabbkaffe_vanilla(Trace) -> ResumeTrace = [ T || #{?snk_kind := K} = T <- Trace, re:run(to_list(K), "^ps_") /= nomatch ], ?assertMatch([_ | _], ResumeTrace), [_Sid] = lists:usort(?projection(sid, ResumeTrace)), Check internal flow of the resuming ?assert( ?strict_causality( #{?snk_kind := ps_resuming}, #{?snk_kind := ps_initial_pendings}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_initial_pendings}, #{?snk_kind := ps_persist_pendings}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_persist_pendings}, #{?snk_kind := ps_notify_writers}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_notify_writers}, #{?snk_kind := ps_node_markers}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_node_markers}, #{?snk_kind := ps_resume_session}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_resume_session}, #{?snk_kind := ps_marker_pendings}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_marker_pendings}, #{?snk_kind := ps_marker_pendings_msgs}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_marker_pendings_msgs}, #{?snk_kind := ps_resume_end}, ResumeTrace ) ), Check flow between worker and ?assert( ?strict_causality( #{?snk_kind := ps_notify_writers}, #{?snk_kind := ps_worker_started}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_marker_pendings}, #{?snk_kind := ps_worker_resume_end}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_worker_resume_end}, #{?snk_kind := ps_worker_shutdown}, ResumeTrace ) ), [Markers] = ?projection(markers, ?of_kind(ps_node_markers, Trace)), ?assertMatch([_], Markers). to_list(L) when is_list(L) -> L; to_list(A) when is_atom(A) -> atom_to_list(A); to_list(B) when is_binary(B) -> binary_to_list(B). %%-------------------------------------------------------------------- Snabbkaffe tests %%-------------------------------------------------------------------- t_snabbkaffe_vanilla_stages(Config) -> %% Test that all stages of session resume works ok in the simplest case ConnFun = ?config(conn_fun, Config), ClientId = ?config(client_id, Config), EmqttOpts = [ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ], {ok, Client1} = emqtt:start_link([{clean_start, true} | EmqttOpts]), {ok, _} = emqtt:ConnFun(Client1), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), ?check_trace( begin {ok, Client2} = emqtt:start_link([{clean_start, false} | EmqttOpts]), {ok, _} = emqtt:ConnFun(Client2), ok = emqtt:disconnect(Client2) end, fun(ok, Trace) -> check_snabbkaffe_vanilla(Trace) end ), ok. t_snabbkaffe_pending_messages(Config) -> %% Make sure there are pending messages are fetched during the init stage. ConnFun = ?config(conn_fun, Config), ClientId = ?config(client_id, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), Payloads = [<<"test", (integer_to_binary(X))/binary>> || X <- [1, 2, 3, 4, 5]], EmqttOpts = [ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ], {ok, Client1} = emqtt:start_link([{clean_start, true} | EmqttOpts]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic, qos2), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), ?check_trace( begin snabbkaffe_sync_publish(Topic, Payloads), {ok, Client2} = emqtt:start_link([{clean_start, false} | EmqttOpts]), {ok, _} = emqtt:ConnFun(Client2), Msgs = receive_messages(length(Payloads)), ReceivedPayloads = [P || #{payload := P} <- Msgs], ?assertEqual(lists:sort(ReceivedPayloads), lists:sort(Payloads)), ok = emqtt:disconnect(Client2) end, fun(ok, Trace) -> check_snabbkaffe_vanilla(Trace), %% Check that all messages was delivered from the DB [Delivers1] = ?projection(msgs, ?of_kind(ps_persist_pendings_msgs, Trace)), [Delivers2] = ?projection(msgs, ?of_kind(ps_marker_pendings_msgs, Trace)), Delivers = Delivers1 ++ Delivers2, ?assertEqual(length(Payloads), length(Delivers)), %% Check for no duplicates ?assertEqual(lists:usort(Delivers), lists:sort(Delivers)) end ), ok. t_snabbkaffe_buffered_messages(Config) -> %% Make sure to buffer messages during startup. ConnFun = ?config(conn_fun, Config), ClientId = ?config(client_id, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), Payloads1 = [<<"test", (integer_to_binary(X))/binary>> || X <- [1, 2, 3]], Payloads2 = [<<"test", (integer_to_binary(X))/binary>> || X <- [4, 5, 6]], EmqttOpts = [ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ], {ok, Client1} = emqtt:start_link([{clean_start, true} | EmqttOpts]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic, qos2), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), publish(Topic, Payloads1), ?check_trace( begin Make the resume init phase wait until the first message is delivered . ?force_ordering( #{?snk_kind := ps_worker_deliver}, #{?snk_kind := ps_resume_end} ), Parent = self(), spawn_link(fun() -> ?block_until(#{?snk_kind := ps_marker_pendings_msgs}, infinity, 5000), publish(Topic, Payloads2, true), Parent ! publish_done, ok end), {ok, Client2} = emqtt:start_link([{clean_start, false} | EmqttOpts]), {ok, _} = emqtt:ConnFun(Client2), receive publish_done -> ok after 10000 -> error(too_long_to_publish) end, Msgs = receive_messages(length(Payloads1) + length(Payloads2) + 1), ReceivedPayloads = [P || #{payload := P} <- Msgs], ?assertEqual( lists:sort(Payloads1 ++ Payloads2), lists:sort(ReceivedPayloads) ), ok = emqtt:disconnect(Client2) end, fun(ok, Trace) -> check_snabbkaffe_vanilla(Trace), %% Check that some messages was buffered in the writer process [Msgs] = ?projection(msgs, ?of_kind(ps_writer_pendings, Trace)), ?assertMatch( X when 0 < X andalso X =< length(Payloads2), length(Msgs) ) end ), ok. %%-------------------------------------------------------------------- GC tests %%-------------------------------------------------------------------- -define(MARKER, 3). -define(DELIVERED, 2). -define(UNDELIVERED, 1). -define(ABANDONED, 0). msg_id() -> emqx_guid:gen(). delivered_msg(MsgId, SessionID, STopic) -> {SessionID, MsgId, STopic, ?DELIVERED}. undelivered_msg(MsgId, SessionID, STopic) -> {SessionID, MsgId, STopic, ?UNDELIVERED}. marker_msg(MarkerID, SessionID) -> {SessionID, MarkerID, <<>>, ?MARKER}. guid(MicrosecondsAgo) -> Make a fake GUID and set a timestamp . <<TS:64, Tail:64>> = emqx_guid:gen(), <<(TS - MicrosecondsAgo):64, Tail:64>>. abandoned_session_msg(SessionID) -> abandoned_session_msg(SessionID, 0). abandoned_session_msg(SessionID, MicrosecondsAgo) -> TS = erlang:system_time(microsecond), {SessionID, <<>>, <<(TS - MicrosecondsAgo):64>>, ?ABANDONED}. fresh_gc_delete_fun() -> Ets = ets:new(gc_collect, [ordered_set]), fun (delete, Key) -> ets:insert(Ets, {Key}), ok; (collect, <<>>) -> List = ets:match(Ets, {'$1'}), ets:delete(Ets), lists:append(List); (_, _Key) -> ok end. fresh_gc_callbacks_fun() -> Ets = ets:new(gc_collect, [ordered_set]), fun (collect, <<>>) -> List = ets:match(Ets, {'$1'}), ets:delete(Ets), lists:append(List); (Tag, Key) -> ets:insert(Ets, {{Key, Tag}}), ok end. get_gc_delete_messages() -> Fun = fresh_gc_delete_fun(), emqx_persistent_session:gc_session_messages(Fun), Fun(collect, <<>>). get_gc_callbacks() -> Fun = fresh_gc_callbacks_fun(), emqx_persistent_session:gc_session_messages(Fun), Fun(collect, <<>>). t_gc_all_delivered(Config) -> Store = ?config(session_msg_store, Config), STopic = ?config(stopic, Config), SessionId = emqx_guid:gen(), MsgIds = [msg_id() || _ <- lists:seq(1, 5)], Delivered = [delivered_msg(X, SessionId, STopic) || X <- MsgIds], Undelivered = [undelivered_msg(X, SessionId, STopic) || X <- MsgIds], SortedContent = lists:usort(Delivered ++ Undelivered), ets:insert(Store, [{X, <<>>} || X <- SortedContent]), GCMessages = get_gc_delete_messages(), ?assertEqual(SortedContent, GCMessages), ok. t_gc_some_undelivered(Config) -> Store = ?config(session_msg_store, Config), STopic = ?config(stopic, Config), SessionId = emqx_guid:gen(), MsgIds = [msg_id() || _ <- lists:seq(1, 10)], Delivered = [delivered_msg(X, SessionId, STopic) || X <- MsgIds], {Delivered1, _Delivered2} = split(Delivered), Undelivered = [undelivered_msg(X, SessionId, STopic) || X <- MsgIds], {Undelivered1, Undelivered2} = split(Undelivered), Content = Delivered1 ++ Undelivered1 ++ Undelivered2, ets:insert(Store, [{X, <<>>} || X <- Content]), Expected = lists:usort(Delivered1 ++ Undelivered1), GCMessages = get_gc_delete_messages(), ?assertEqual(Expected, GCMessages), ok. t_gc_with_markers(Config) -> Store = ?config(session_msg_store, Config), STopic = ?config(stopic, Config), SessionId = emqx_guid:gen(), MsgIds1 = [msg_id() || _ <- lists:seq(1, 10)], MarkerId = msg_id(), MsgIds = [msg_id() || _ <- lists:seq(1, 4)] ++ MsgIds1, Delivered = [delivered_msg(X, SessionId, STopic) || X <- MsgIds], {Delivered1, _Delivered2} = split(Delivered), Undelivered = [undelivered_msg(X, SessionId, STopic) || X <- MsgIds], {Undelivered1, Undelivered2} = split(Undelivered), Markers = [marker_msg(MarkerId, SessionId)], Content = Delivered1 ++ Undelivered1 ++ Undelivered2 ++ Markers, ets:insert(Store, [{X, <<>>} || X <- Content]), Expected = lists:usort(Delivered1 ++ Undelivered1), GCMessages = get_gc_delete_messages(), ?assertEqual(Expected, GCMessages), ok. t_gc_abandoned_some_undelivered(Config) -> Store = ?config(session_msg_store, Config), STopic = ?config(stopic, Config), SessionId = emqx_guid:gen(), MsgIds = [msg_id() || _ <- lists:seq(1, 10)], Delivered = [delivered_msg(X, SessionId, STopic) || X <- MsgIds], {Delivered1, _Delivered2} = split(Delivered), Undelivered = [undelivered_msg(X, SessionId, STopic) || X <- MsgIds], {Undelivered1, Undelivered2} = split(Undelivered), Abandoned = abandoned_session_msg(SessionId), Content = Delivered1 ++ Undelivered1 ++ Undelivered2 ++ [Abandoned], ets:insert(Store, [{X, <<>>} || X <- Content]), Expected = lists:usort(Delivered1 ++ Undelivered1 ++ Undelivered2), GCMessages = get_gc_delete_messages(), ?assertEqual(Expected, GCMessages), ok. t_gc_abandoned_only_called_on_empty_session(Config) -> Store = ?config(session_msg_store, Config), STopic = ?config(stopic, Config), SessionId = emqx_guid:gen(), MsgIds = [msg_id() || _ <- lists:seq(1, 10)], Delivered = [delivered_msg(X, SessionId, STopic) || X <- MsgIds], Undelivered = [undelivered_msg(X, SessionId, STopic) || X <- MsgIds], Abandoned = abandoned_session_msg(SessionId), Content = Delivered ++ Undelivered ++ [Abandoned], ets:insert(Store, [{X, <<>>} || X <- Content]), GCMessages = get_gc_callbacks(), %% Since we had messages to delete, we don't expect to get the %% callback on the abandoned session ?assertEqual([], [X || {X, abandoned} <- GCMessages]), %% But if we have only the abandoned session marker for this %% session, it should be called. ets:delete_all_objects(Store), UndeliveredOtherSession = undelivered_msg(msg_id(), emqx_guid:gen(), <<"topic">>), ets:insert(Store, [{X, <<>>} || X <- [Abandoned, UndeliveredOtherSession]]), GCMessages2 = get_gc_callbacks(), ?assertEqual([Abandoned], [X || {X, abandoned} <- GCMessages2]), ok. t_gc_session_gc_worker(init, Config) -> meck:new(emqx_persistent_session, [passthrough, no_link]), Config; t_gc_session_gc_worker('end', _Config) -> meck:unload(emqx_persistent_session), ok. t_gc_session_gc_worker(Config) -> STopic = ?config(stopic, Config), SessionID = emqx_guid:gen(), MsgDeleted = delivered_msg(msg_id(), SessionID, STopic), MarkerNotDeleted = marker_msg(msg_id(), SessionID), MarkerDeleted = marker_msg(guid(120 * 1000 * 1000), SessionID), AbandonedNotDeleted = abandoned_session_msg(SessionID), AbandonedDeleted = abandoned_session_msg(SessionID, 500 * 1000 * 1000), meck:expect(emqx_persistent_session, delete_session_message, fun(_Key) -> ok end), emqx_persistent_session_gc:session_gc_worker(delete, MsgDeleted), emqx_persistent_session_gc:session_gc_worker(marker, MarkerNotDeleted), emqx_persistent_session_gc:session_gc_worker(marker, MarkerDeleted), emqx_persistent_session_gc:session_gc_worker(abandoned, AbandonedDeleted), emqx_persistent_session_gc:session_gc_worker(abandoned, AbandonedNotDeleted), History = meck:history(emqx_persistent_session, self()), DeleteCalls = [ Key || {_Pid, {_, delete_session_message, [Key]}, _Result} <- History ], ?assertEqual( lists:sort([MsgDeleted, AbandonedDeleted, MarkerDeleted]), lists:sort(DeleteCalls) ), ok. t_gc_message_gc(Config) -> Topic = ?config(topic, Config), ClientID = ?config(client_id, Config), Store = ?config(msg_store, Config), NewMsgs = [ emqx_message:make(ClientID, Topic, integer_to_binary(P)) || P <- lists:seq(6, 10) ], Retain = 60 * 1000, emqx_config:put(?msg_retain, Retain), Msgs1 = [ emqx_message:make(ClientID, Topic, integer_to_binary(P)) || P <- lists:seq(1, 5) ], OldMsgs = [M#message{id = guid(Retain * 1000)} || M <- Msgs1], ets:insert(Store, NewMsgs ++ OldMsgs), ?assertEqual(lists:sort(OldMsgs ++ NewMsgs), ets:tab2list(Store)), ok = emqx_persistent_session_gc:message_gc_worker(), ?assertEqual(lists:sort(NewMsgs), ets:tab2list(Store)), ok. split(List) -> split(List, [], []). split([], L1, L2) -> {L1, L2}; split([H], L1, L2) -> {[H | L1], L2}; split([H1, H2 | Left], L1, L2) -> split(Left, [H1 | L1], [H2 | L2]).
null
https://raw.githubusercontent.com/emqx/emqx/dbc10c2eed3df314586c7b9ac6292083204f1f68/apps/emqx/test/emqx_persistent_session_SUITE.erl
erlang
-------------------------------------------------------------------- you may not use this file except in compliance with the License. You may obtain a copy of the License at -2.0 Unless required by applicable law or agreed to in writing, software WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. -------------------------------------------------------------------- -------------------------------------------------------------------- -------------------------------------------------------------------- over by the new connection. The new process resumes the session from the stored state, and finds any subscribed messages from the persistent message store. We want to test both ways, both with the db backend enabled and disabled. In addition, we test both tcp and quic connections. Start Apps Start Apps We need to make sure the system does not interfere with this test group. We are running a single testcase -------------------------------------------------------------------- Helpers -------------------------------------------------------------------- Publish from another process to avoid connection confusion. For convenience, always publish using tcp. The publish path is not what we are testing. Snabbkaffe sometimes fails unless all processes are gone. -------------------------------------------------------------------- Test Cases -------------------------------------------------------------------- [MQTT-3.1.2-23] Emqtt client dies Open a persistent session, but cancel the persistence when shutting down the connection. Open a non-persistent session, but add the persistence when shutting down the connection. This is a protocol error, and should not convert the session into a persistent session. Strangely enough, the disconnect is reported as successful by emqtt. The session should not be known, since it wasn't persisted because of the changed expiry interval in the disconnect call. Emulate an error in the connect process, or that the node of the process goes down. A persistent session should eventually expire. The session should not be marked as expired. The session should have a pending message The session should now be marked as expired. The old session should now either be marked as abandoned or already be garbage collected. We should not receive the pending message A persistent session should receive messages in its subscription even if the process owning the session dies. then we disconnect again. The original message should not be delivered. -------------------------------------------------------------------- -------------------------------------------------------------------- -------------------------------------------------------------------- -------------------------------------------------------------------- Test that all stages of session resume works ok in the simplest case Make sure there are pending messages are fetched during the init stage. Check that all messages was delivered from the DB Check for no duplicates Make sure to buffer messages during startup. Check that some messages was buffered in the writer process -------------------------------------------------------------------- -------------------------------------------------------------------- Since we had messages to delete, we don't expect to get the callback on the abandoned session But if we have only the abandoned session marker for this session, it should be called.
Copyright ( c ) 2021 - 2023 EMQ Technologies Co. , Ltd. All Rights Reserved . Licensed under the Apache License , Version 2.0 ( the " License " ) ; distributed under the License is distributed on an " AS IS " BASIS , -module(emqx_persistent_session_SUITE). -include_lib("stdlib/include/assert.hrl"). -include_lib("common_test/include/ct.hrl"). -include_lib("snabbkaffe/include/snabbkaffe.hrl"). -include_lib("../include/emqx.hrl"). -include("../src/persistent_session/emqx_persistent_session.hrl"). -compile(export_all). -compile(nowarn_export_all). SUITE boilerplate all() -> [ {group, persistent_store_enabled}, {group, persistent_store_disabled} ]. A persistent session can be resumed in two ways : 1 . The old connection process is still alive , and the session is taken 2 . The old session process has died ( e.g. , because of node down ) . groups() -> TCs = emqx_common_test_helpers:all(?MODULE), SnabbkaffeTCs = [TC || TC <- TCs, is_snabbkaffe_tc(TC)], GCTests = [TC || TC <- TCs, is_gc_tc(TC)], OtherTCs = (TCs -- SnabbkaffeTCs) -- GCTests, [ {persistent_store_enabled, [ {group, ram_tables}, {group, disc_tables} ]}, {persistent_store_disabled, [{group, no_kill_connection_process}]}, {ram_tables, [], [ {group, no_kill_connection_process}, {group, kill_connection_process}, {group, snabbkaffe}, {group, gc_tests} ]}, {disc_tables, [], [ {group, no_kill_connection_process}, {group, kill_connection_process}, {group, snabbkaffe}, {group, gc_tests} ]}, {no_kill_connection_process, [], [{group, tcp}, {group, quic}, {group, ws}]}, {kill_connection_process, [], [{group, tcp}, {group, quic}, {group, ws}]}, {snabbkaffe, [], [ {group, tcp_snabbkaffe}, {group, quic_snabbkaffe}, {group, ws_snabbkaffe} ]}, {tcp, [], OtherTCs}, {quic, [], OtherTCs}, {ws, [], OtherTCs}, {tcp_snabbkaffe, [], SnabbkaffeTCs}, {quic_snabbkaffe, [], SnabbkaffeTCs}, {ws_snabbkaffe, [], SnabbkaffeTCs}, {gc_tests, [], GCTests} ]. is_snabbkaffe_tc(TC) -> re:run(atom_to_list(TC), "^t_snabbkaffe_") /= nomatch. is_gc_tc(TC) -> re:run(atom_to_list(TC), "^t_gc_") /= nomatch. init_per_group(persistent_store_enabled, Config) -> [{persistent_store_enabled, true} | Config]; init_per_group(Group, Config) when Group =:= ram_tables; Group =:= disc_tables -> Reply = case Group =:= ram_tables of true -> ram; false -> disc end, emqx_common_test_helpers:boot_modules(all), meck:new(emqx_config, [non_strict, passthrough, no_history, no_link]), meck:expect(emqx_config, get, fun (?on_disc_key) -> Reply =:= disc; (?is_enabled_key) -> true; (Other) -> meck:passthrough([Other]) end), emqx_common_test_helpers:start_apps([], fun set_special_confs/1), ?assertEqual(true, emqx_persistent_session:is_store_enabled()), Config; init_per_group(persistent_store_disabled, Config) -> emqx_common_test_helpers:boot_modules(all), meck:new(emqx_config, [non_strict, passthrough, no_history, no_link]), meck:expect(emqx_config, get, fun (?is_enabled_key) -> false; (Other) -> meck:passthrough([Other]) end), emqx_common_test_helpers:start_apps([], fun set_special_confs/1), ?assertEqual(false, emqx_persistent_session:is_store_enabled()), [{persistent_store_enabled, false} | Config]; init_per_group(Group, Config) when Group == ws; Group == ws_snabbkaffe -> [ {ssl, false}, {host, "localhost"}, {enable_websocket, true}, {port, 8083}, {conn_fun, ws_connect} | Config ]; init_per_group(Group, Config) when Group == tcp; Group == tcp_snabbkaffe -> [{port, 1883}, {conn_fun, connect} | Config]; init_per_group(Group, Config) when Group == quic; Group == quic_snabbkaffe -> UdpPort = 1883, emqx_common_test_helpers:ensure_quic_listener(?MODULE, UdpPort), [{port, UdpPort}, {conn_fun, quic_connect} | Config]; init_per_group(no_kill_connection_process, Config) -> [{kill_connection_process, false} | Config]; init_per_group(kill_connection_process, Config) -> [{kill_connection_process, true} | Config]; init_per_group(snabbkaffe, Config) -> [{kill_connection_process, true} | Config]; init_per_group(gc_tests, Config) -> lists:foreach( fun(ClientId) -> maybe_kill_connection_process(ClientId, [{kill_connection_process, true}]) end, emqx_cm:all_client_ids() ), emqx_common_test_helpers:stop_apps([]), SessionMsgEts = gc_tests_session_store, MsgEts = gc_tests_msg_store, Pid = spawn(fun() -> ets:new(SessionMsgEts, [named_table, public, ordered_set]), ets:new(MsgEts, [named_table, public, ordered_set, {keypos, 2}]), receive stop -> ok end end), meck:new(mnesia, [non_strict, passthrough, no_history, no_link]), meck:expect(mnesia, dirty_first, fun (?SESS_MSG_TAB) -> ets:first(SessionMsgEts); (?MSG_TAB) -> ets:first(MsgEts); (X) -> meck:passthrough([X]) end), meck:expect(mnesia, dirty_next, fun (?SESS_MSG_TAB, X) -> ets:next(SessionMsgEts, X); (?MSG_TAB, X) -> ets:next(MsgEts, X); (Tab, X) -> meck:passthrough([Tab, X]) end), meck:expect(mnesia, dirty_delete, fun (?MSG_TAB, X) -> ets:delete(MsgEts, X); (Tab, X) -> meck:passthrough([Tab, X]) end), [{store_owner, Pid}, {session_msg_store, SessionMsgEts}, {msg_store, MsgEts} | Config]. init_per_suite(Config) -> Config. set_special_confs(_) -> ok. end_per_suite(_Config) -> emqx_common_test_helpers:ensure_mnesia_stopped(), ok. end_per_group(gc_tests, Config) -> meck:unload(mnesia), ?config(store_owner, Config) ! stop, ok; end_per_group(Group, _Config) when Group =:= ram_tables; Group =:= disc_tables -> meck:unload(emqx_config), emqx_common_test_helpers:stop_apps([]); end_per_group(persistent_store_disabled, _Config) -> meck:unload(emqx_config), emqx_common_test_helpers:stop_apps([]); end_per_group(_Group, _Config) -> ok. init_per_testcase(TestCase, Config) -> Config1 = preconfig_per_testcase(TestCase, Config), case is_gc_tc(TestCase) of true -> ets:delete_all_objects(?config(msg_store, Config)), ets:delete_all_objects(?config(session_msg_store, Config)); false -> skip end, case erlang:function_exported(?MODULE, TestCase, 2) of true -> ?MODULE:TestCase(init, Config1); _ -> Config1 end. end_per_testcase(TestCase, Config) -> case is_snabbkaffe_tc(TestCase) of true -> snabbkaffe:stop(); false -> skip end, case erlang:function_exported(?MODULE, TestCase, 2) of true -> ?MODULE:TestCase('end', Config); false -> ok end, Config. preconfig_per_testcase(TestCase, Config) -> {BaseName, Config1} = case ?config(tc_group_properties, Config) of [] -> { atom_to_binary(TestCase), init_per_group(tcp, init_per_group(kill_connection_process, Config)) }; [_ | _] = Props -> Path = lists:reverse(?config(tc_group_path, Config) ++ Props), Pre0 = [atom_to_list(N) || {name, N} <- lists:flatten(Path)], Pre1 = lists:join("_", Pre0 ++ [atom_to_binary(TestCase)]), {iolist_to_binary(Pre1), Config} end, [ {topic, iolist_to_binary([BaseName, "/foo"])}, {stopic, iolist_to_binary([BaseName, "/+"])}, {stopic_alt, iolist_to_binary([BaseName, "/foo"])}, {client_id, BaseName} | Config1 ]. client_info(Key, Client) -> maps:get(Key, maps:from_list(emqtt:info(Client)), undefined). receive_messages(Count) -> receive_messages(Count, []). receive_messages(0, Msgs) -> Msgs; receive_messages(Count, Msgs) -> receive {publish, Msg} -> receive_messages(Count - 1, [Msg | Msgs]); _Other -> receive_messages(Count, Msgs) after 5000 -> Msgs end. maybe_kill_connection_process(ClientId, Config) -> case ?config(kill_connection_process, Config) of true -> case emqx_cm:lookup_channels(ClientId) of [] -> ok; [ConnectionPid] -> ?assert(is_pid(ConnectionPid)), Ref = monitor(process, ConnectionPid), ConnectionPid ! die_if_test, receive {'DOWN', Ref, process, ConnectionPid, normal} -> ok after 3000 -> error(process_did_not_die) end, wait_for_cm_unregister(ClientId) end; false -> ok end. wait_for_cm_unregister(ClientId) -> wait_for_cm_unregister(ClientId, 100). wait_for_cm_unregister(_ClientId, 0) -> error(cm_did_not_unregister); wait_for_cm_unregister(ClientId, N) -> case emqx_cm:lookup_channels(ClientId) of [] -> ok; [_] -> timer:sleep(100), wait_for_cm_unregister(ClientId, N - 1) end. snabbkaffe_sync_publish(Topic, Payloads) -> Fun = fun(Client, Payload) -> ?check_trace( begin ?wait_async_action( {ok, _} = emqtt:publish(Client, Topic, Payload, 2), #{?snk_kind := ps_persist_msg, payload := Payload} ) end, fun(_, _Trace) -> ok end ) end, do_publish(Payloads, Fun, true). publish(Topic, Payloads) -> publish(Topic, Payloads, false). publish(Topic, Payloads, WaitForUnregister) -> Fun = fun(Client, Payload) -> {ok, _} = emqtt:publish(Client, Topic, Payload, 2) end, do_publish(Payloads, Fun, WaitForUnregister). do_publish(Payloads = [_ | _], PublishFun, WaitForUnregister) -> {Pid, Ref} = spawn_monitor( fun() -> ClientID = <<"ps_SUITE_publisher">>, {ok, Client} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientID}, {port, 1883} ]), {ok, _} = emqtt:connect(Client), lists:foreach(fun(Payload) -> PublishFun(Client, Payload) end, Payloads), ok = emqtt:disconnect(Client), case WaitForUnregister of false -> ok; true -> case emqx_cm:lookup_channels(ClientID) of [] -> ok; [ConnectionPid] -> ?assert(is_pid(ConnectionPid)), Ref1 = monitor(process, ConnectionPid), receive {'DOWN', Ref1, process, ConnectionPid, _} -> ok after 3000 -> error(process_did_not_die) end, wait_for_cm_unregister(ClientID) end end end ), receive {'DOWN', Ref, process, Pid, normal} -> ok; {'DOWN', Ref, process, Pid, What} -> error({failed_publish, What}) end; do_publish(Payload, PublishFun, WaitForUnregister) -> do_publish([Payload], PublishFun, WaitForUnregister). t_connect_session_expiry_interval(Config) -> ConnFun = ?config(conn_fun, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), Payload = <<"test message">>, ClientId = ?config(client_id, Config), {ok, Client1} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic, qos2), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), publish(Topic, Payload), {ok, Client2} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, false} | Config ]), {ok, _} = emqtt:ConnFun(Client2), [Msg | _] = receive_messages(1), ?assertEqual({ok, iolist_to_binary(Topic)}, maps:find(topic, Msg)), ?assertEqual({ok, iolist_to_binary(Payload)}, maps:find(payload, Msg)), ?assertEqual({ok, 2}, maps:find(qos, Msg)), ok = emqtt:disconnect(Client2). t_without_client_id(Config) -> process_flag(trap_exit, true), ConnFun = ?config(conn_fun, Config), {ok, Client0} = emqtt:start_link([ {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, false} | Config ]), {error, {client_identifier_not_valid, _}} = emqtt:ConnFun(Client0), ok. t_assigned_clientid_persistent_session(Config) -> ConnFun = ?config(conn_fun, Config), {ok, Client1} = emqtt:start_link([ {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, true} | Config ]), {ok, _} = emqtt:ConnFun(Client1), AssignedClientId = client_info(clientid, Client1), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(AssignedClientId, Config), {ok, Client2} = emqtt:start_link([ {clientid, AssignedClientId}, {proto_ver, v5}, {clean_start, false} | Config ]), {ok, _} = emqtt:ConnFun(Client2), ?assertEqual(1, client_info(session_present, Client2)), ok = emqtt:disconnect(Client2). t_cancel_on_disconnect(Config) -> ConnFun = ?config(conn_fun, Config), ClientId = ?config(client_id, Config), {ok, Client1} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, true} | Config ]), {ok, _} = emqtt:ConnFun(Client1), ok = emqtt:disconnect(Client1, 0, #{'Session-Expiry-Interval' => 0}), wait_for_cm_unregister(ClientId), {ok, Client2} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {clean_start, false}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ]), {ok, _} = emqtt:ConnFun(Client2), ?assertEqual(0, client_info(session_present, Client2)), ok = emqtt:disconnect(Client2). t_persist_on_disconnect(Config) -> ConnFun = ?config(conn_fun, Config), ClientId = ?config(client_id, Config), {ok, Client1} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 0}}, {clean_start, true} | Config ]), {ok, _} = emqtt:ConnFun(Client1), ok = emqtt:disconnect(Client1, 0, #{'Session-Expiry-Interval' => 30}), wait_for_cm_unregister(ClientId), {ok, Client2} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {clean_start, false}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ]), {ok, _} = emqtt:ConnFun(Client2), ?assertEqual(0, client_info(session_present, Client2)), ok = emqtt:disconnect(Client2). wait_for_pending(SId) -> wait_for_pending(SId, 100). wait_for_pending(_SId, 0) -> error(exhausted_wait_for_pending); wait_for_pending(SId, N) -> case emqx_persistent_session:pending(SId) of [] -> timer:sleep(1), wait_for_pending(SId, N - 1); [_ | _] = Pending -> Pending end. t_process_dies_session_expires(Config) -> ConnFun = ?config(conn_fun, Config), ClientId = ?config(client_id, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), Payload = <<"test">>, {ok, Client1} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 1}}, {clean_start, true} | Config ]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic, qos2), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), ok = publish(Topic, [Payload]), SessionId = case ?config(persistent_store_enabled, Config) of false -> undefined; true -> {Tag, Session} = emqx_persistent_session:lookup(ClientId), ?assertEqual(persistent, Tag), SId = emqx_session:info(id, Session), case ?config(kill_connection_process, Config) of true -> ?assertMatch([_], wait_for_pending(SId)); false -> skip end, SId end, timer:sleep(1100), case (?config(kill_connection_process, Config) andalso ?config(persistent_store_enabled, Config)) of true -> ?assertMatch({expired, _}, emqx_persistent_session:lookup(ClientId)); false -> skip end, {ok, Client2} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, false} | Config ]), {ok, _} = emqtt:ConnFun(Client2), ?assertEqual(0, client_info(session_present, Client2)), case (?config(kill_connection_process, Config) andalso ?config(persistent_store_enabled, Config)) of true -> The session should be a fresh one {persistent, NewSession} = emqx_persistent_session:lookup(ClientId), ?assertNotEqual(SessionId, emqx_session:info(id, NewSession)), ?assertMatch([], emqx_persistent_session:pending(SessionId)); false -> skip end, ?assertEqual([], receive_messages(1)), emqtt:disconnect(Client2). t_publish_while_client_is_gone(Config) -> ConnFun = ?config(conn_fun, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), Payload1 = <<"hello1">>, Payload2 = <<"hello2">>, ClientId = ?config(client_id, Config), {ok, Client1} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, true} | Config ]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic, qos2), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), ok = publish(Topic, [Payload1, Payload2]), {ok, Client2} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, false} | Config ]), {ok, _} = emqtt:ConnFun(Client2), Msgs = receive_messages(2), ?assertMatch([_, _], Msgs), [Msg2, Msg1] = Msgs, ?assertEqual({ok, iolist_to_binary(Payload1)}, maps:find(payload, Msg1)), ?assertEqual({ok, 2}, maps:find(qos, Msg1)), ?assertEqual({ok, iolist_to_binary(Payload2)}, maps:find(payload, Msg2)), ?assertEqual({ok, 2}, maps:find(qos, Msg2)), ok = emqtt:disconnect(Client2). t_clean_start_drops_subscriptions(Config) -> 1 . A persistent session is started and disconnected . 2 . While disconnected , a message is published and persisted . 3 . When connecting again , the clean start flag is set , the subscription is renewed , 4 . Finally , a new connection is made with clean start set to false . ConnFun = ?config(conn_fun, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), Payload1 = <<"hello1">>, Payload2 = <<"hello2">>, Payload3 = <<"hello3">>, ClientId = ?config(client_id, Config), 1 . {ok, Client1} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, true} | Config ]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic, qos2), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), 2 . ok = publish(Topic, Payload1), 3 . {ok, Client2} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, true} | Config ]), {ok, _} = emqtt:ConnFun(Client2), ?assertEqual(0, client_info(session_present, Client2)), {ok, _, [2]} = emqtt:subscribe(Client2, STopic, qos2), ok = publish(Topic, Payload2), [Msg1] = receive_messages(1), ?assertEqual({ok, iolist_to_binary(Payload2)}, maps:find(payload, Msg1)), ok = emqtt:disconnect(Client2), maybe_kill_connection_process(ClientId, Config), 4 . {ok, Client3} = emqtt:start_link([ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, false} | Config ]), {ok, _} = emqtt:ConnFun(Client3), ok = publish(Topic, Payload3), [Msg2] = receive_messages(1), ?assertEqual({ok, iolist_to_binary(Payload3)}, maps:find(payload, Msg2)), ok = emqtt:disconnect(Client3). t_unsubscribe(Config) -> ConnFun = ?config(conn_fun, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), ClientId = ?config(client_id, Config), {ok, Client} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ]), {ok, _} = emqtt:ConnFun(Client), {ok, _, [2]} = emqtt:subscribe(Client, STopic, qos2), case emqx_persistent_session:is_store_enabled() of true -> {persistent, Session} = emqx_persistent_session:lookup(ClientId), SessionID = emqx_session:info(id, Session), SessionIDs = [SId || #route{dest = SId} <- emqx_session_router:match_routes(Topic)], ?assert(lists:member(SessionID, SessionIDs)), ?assertMatch([_], [Sub || {ST, _} = Sub <- emqtt:subscriptions(Client), ST =:= STopic]), {ok, _, _} = emqtt:unsubscribe(Client, STopic), ?assertMatch([], [Sub || {ST, _} = Sub <- emqtt:subscriptions(Client), ST =:= STopic]), SessionIDs2 = [SId || #route{dest = SId} <- emqx_session_router:match_routes(Topic)], ?assert(not lists:member(SessionID, SessionIDs2)); false -> ?assertMatch([_], [Sub || {ST, _} = Sub <- emqtt:subscriptions(Client), ST =:= STopic]), {ok, _, _} = emqtt:unsubscribe(Client, STopic), ?assertMatch([], [Sub || {ST, _} = Sub <- emqtt:subscriptions(Client), ST =:= STopic]) end, ok = emqtt:disconnect(Client). t_multiple_subscription_matches(Config) -> ConnFun = ?config(conn_fun, Config), Topic = ?config(topic, Config), STopic1 = ?config(stopic, Config), STopic2 = ?config(stopic_alt, Config), Payload = <<"test message">>, ClientId = ?config(client_id, Config), {ok, Client1} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic1, qos2), {ok, _, [2]} = emqtt:subscribe(Client1, STopic2, qos2), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), publish(Topic, Payload), {ok, Client2} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}}, {clean_start, false} | Config ]), {ok, _} = emqtt:ConnFun(Client2), We will receive the same message twice because it matches two subscriptions . [Msg1, Msg2] = receive_messages(2), ?assertEqual({ok, iolist_to_binary(Topic)}, maps:find(topic, Msg1)), ?assertEqual({ok, iolist_to_binary(Payload)}, maps:find(payload, Msg1)), ?assertEqual({ok, iolist_to_binary(Topic)}, maps:find(topic, Msg2)), ?assertEqual({ok, iolist_to_binary(Payload)}, maps:find(payload, Msg2)), ?assertEqual({ok, 2}, maps:find(qos, Msg1)), ?assertEqual({ok, 2}, maps:find(qos, Msg2)), ok = emqtt:disconnect(Client2). t_lost_messages_because_of_gc(init, Config) -> case (emqx_persistent_session:is_store_enabled() andalso ?config(kill_connection_process, Config)) of true -> Retain = 1000, OldRetain = emqx_config:get(?msg_retain, Retain), emqx_config:put(?msg_retain, Retain), [{retain, Retain}, {old_retain, OldRetain} | Config]; false -> {skip, only_relevant_with_store_and_kill_process} end; t_lost_messages_because_of_gc('end', Config) -> OldRetain = ?config(old_retain, Config), emqx_config:put(?msg_retain, OldRetain), ok. t_lost_messages_because_of_gc(Config) -> ConnFun = ?config(conn_fun, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), ClientId = ?config(client_id, Config), Retain = ?config(retain, Config), Payload1 = <<"hello1">>, Payload2 = <<"hello2">>, {ok, Client1} = emqtt:start_link([ {clientid, ClientId}, {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic, qos2), emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), publish(Topic, Payload1), timer:sleep(2 * Retain), publish(Topic, Payload2), emqx_persistent_session_gc:message_gc_worker(), {ok, Client2} = emqtt:start_link([ {clientid, ClientId}, {clean_start, false}, {proto_ver, v5}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ]), {ok, _} = emqtt:ConnFun(Client2), Msgs = receive_messages(2), ?assertMatch([_], Msgs), ?assertEqual({ok, iolist_to_binary(Payload2)}, maps:find(payload, hd(Msgs))), emqtt:disconnect(Client2), ok. Snabbkaffe helpers check_snabbkaffe_vanilla(Trace) -> ResumeTrace = [ T || #{?snk_kind := K} = T <- Trace, re:run(to_list(K), "^ps_") /= nomatch ], ?assertMatch([_ | _], ResumeTrace), [_Sid] = lists:usort(?projection(sid, ResumeTrace)), Check internal flow of the resuming ?assert( ?strict_causality( #{?snk_kind := ps_resuming}, #{?snk_kind := ps_initial_pendings}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_initial_pendings}, #{?snk_kind := ps_persist_pendings}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_persist_pendings}, #{?snk_kind := ps_notify_writers}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_notify_writers}, #{?snk_kind := ps_node_markers}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_node_markers}, #{?snk_kind := ps_resume_session}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_resume_session}, #{?snk_kind := ps_marker_pendings}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_marker_pendings}, #{?snk_kind := ps_marker_pendings_msgs}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_marker_pendings_msgs}, #{?snk_kind := ps_resume_end}, ResumeTrace ) ), Check flow between worker and ?assert( ?strict_causality( #{?snk_kind := ps_notify_writers}, #{?snk_kind := ps_worker_started}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_marker_pendings}, #{?snk_kind := ps_worker_resume_end}, ResumeTrace ) ), ?assert( ?strict_causality( #{?snk_kind := ps_worker_resume_end}, #{?snk_kind := ps_worker_shutdown}, ResumeTrace ) ), [Markers] = ?projection(markers, ?of_kind(ps_node_markers, Trace)), ?assertMatch([_], Markers). to_list(L) when is_list(L) -> L; to_list(A) when is_atom(A) -> atom_to_list(A); to_list(B) when is_binary(B) -> binary_to_list(B). Snabbkaffe tests t_snabbkaffe_vanilla_stages(Config) -> ConnFun = ?config(conn_fun, Config), ClientId = ?config(client_id, Config), EmqttOpts = [ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ], {ok, Client1} = emqtt:start_link([{clean_start, true} | EmqttOpts]), {ok, _} = emqtt:ConnFun(Client1), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), ?check_trace( begin {ok, Client2} = emqtt:start_link([{clean_start, false} | EmqttOpts]), {ok, _} = emqtt:ConnFun(Client2), ok = emqtt:disconnect(Client2) end, fun(ok, Trace) -> check_snabbkaffe_vanilla(Trace) end ), ok. t_snabbkaffe_pending_messages(Config) -> ConnFun = ?config(conn_fun, Config), ClientId = ?config(client_id, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), Payloads = [<<"test", (integer_to_binary(X))/binary>> || X <- [1, 2, 3, 4, 5]], EmqttOpts = [ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ], {ok, Client1} = emqtt:start_link([{clean_start, true} | EmqttOpts]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic, qos2), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), ?check_trace( begin snabbkaffe_sync_publish(Topic, Payloads), {ok, Client2} = emqtt:start_link([{clean_start, false} | EmqttOpts]), {ok, _} = emqtt:ConnFun(Client2), Msgs = receive_messages(length(Payloads)), ReceivedPayloads = [P || #{payload := P} <- Msgs], ?assertEqual(lists:sort(ReceivedPayloads), lists:sort(Payloads)), ok = emqtt:disconnect(Client2) end, fun(ok, Trace) -> check_snabbkaffe_vanilla(Trace), [Delivers1] = ?projection(msgs, ?of_kind(ps_persist_pendings_msgs, Trace)), [Delivers2] = ?projection(msgs, ?of_kind(ps_marker_pendings_msgs, Trace)), Delivers = Delivers1 ++ Delivers2, ?assertEqual(length(Payloads), length(Delivers)), ?assertEqual(lists:usort(Delivers), lists:sort(Delivers)) end ), ok. t_snabbkaffe_buffered_messages(Config) -> ConnFun = ?config(conn_fun, Config), ClientId = ?config(client_id, Config), Topic = ?config(topic, Config), STopic = ?config(stopic, Config), Payloads1 = [<<"test", (integer_to_binary(X))/binary>> || X <- [1, 2, 3]], Payloads2 = [<<"test", (integer_to_binary(X))/binary>> || X <- [4, 5, 6]], EmqttOpts = [ {proto_ver, v5}, {clientid, ClientId}, {properties, #{'Session-Expiry-Interval' => 30}} | Config ], {ok, Client1} = emqtt:start_link([{clean_start, true} | EmqttOpts]), {ok, _} = emqtt:ConnFun(Client1), {ok, _, [2]} = emqtt:subscribe(Client1, STopic, qos2), ok = emqtt:disconnect(Client1), maybe_kill_connection_process(ClientId, Config), publish(Topic, Payloads1), ?check_trace( begin Make the resume init phase wait until the first message is delivered . ?force_ordering( #{?snk_kind := ps_worker_deliver}, #{?snk_kind := ps_resume_end} ), Parent = self(), spawn_link(fun() -> ?block_until(#{?snk_kind := ps_marker_pendings_msgs}, infinity, 5000), publish(Topic, Payloads2, true), Parent ! publish_done, ok end), {ok, Client2} = emqtt:start_link([{clean_start, false} | EmqttOpts]), {ok, _} = emqtt:ConnFun(Client2), receive publish_done -> ok after 10000 -> error(too_long_to_publish) end, Msgs = receive_messages(length(Payloads1) + length(Payloads2) + 1), ReceivedPayloads = [P || #{payload := P} <- Msgs], ?assertEqual( lists:sort(Payloads1 ++ Payloads2), lists:sort(ReceivedPayloads) ), ok = emqtt:disconnect(Client2) end, fun(ok, Trace) -> check_snabbkaffe_vanilla(Trace), [Msgs] = ?projection(msgs, ?of_kind(ps_writer_pendings, Trace)), ?assertMatch( X when 0 < X andalso X =< length(Payloads2), length(Msgs) ) end ), ok. GC tests -define(MARKER, 3). -define(DELIVERED, 2). -define(UNDELIVERED, 1). -define(ABANDONED, 0). msg_id() -> emqx_guid:gen(). delivered_msg(MsgId, SessionID, STopic) -> {SessionID, MsgId, STopic, ?DELIVERED}. undelivered_msg(MsgId, SessionID, STopic) -> {SessionID, MsgId, STopic, ?UNDELIVERED}. marker_msg(MarkerID, SessionID) -> {SessionID, MarkerID, <<>>, ?MARKER}. guid(MicrosecondsAgo) -> Make a fake GUID and set a timestamp . <<TS:64, Tail:64>> = emqx_guid:gen(), <<(TS - MicrosecondsAgo):64, Tail:64>>. abandoned_session_msg(SessionID) -> abandoned_session_msg(SessionID, 0). abandoned_session_msg(SessionID, MicrosecondsAgo) -> TS = erlang:system_time(microsecond), {SessionID, <<>>, <<(TS - MicrosecondsAgo):64>>, ?ABANDONED}. fresh_gc_delete_fun() -> Ets = ets:new(gc_collect, [ordered_set]), fun (delete, Key) -> ets:insert(Ets, {Key}), ok; (collect, <<>>) -> List = ets:match(Ets, {'$1'}), ets:delete(Ets), lists:append(List); (_, _Key) -> ok end. fresh_gc_callbacks_fun() -> Ets = ets:new(gc_collect, [ordered_set]), fun (collect, <<>>) -> List = ets:match(Ets, {'$1'}), ets:delete(Ets), lists:append(List); (Tag, Key) -> ets:insert(Ets, {{Key, Tag}}), ok end. get_gc_delete_messages() -> Fun = fresh_gc_delete_fun(), emqx_persistent_session:gc_session_messages(Fun), Fun(collect, <<>>). get_gc_callbacks() -> Fun = fresh_gc_callbacks_fun(), emqx_persistent_session:gc_session_messages(Fun), Fun(collect, <<>>). t_gc_all_delivered(Config) -> Store = ?config(session_msg_store, Config), STopic = ?config(stopic, Config), SessionId = emqx_guid:gen(), MsgIds = [msg_id() || _ <- lists:seq(1, 5)], Delivered = [delivered_msg(X, SessionId, STopic) || X <- MsgIds], Undelivered = [undelivered_msg(X, SessionId, STopic) || X <- MsgIds], SortedContent = lists:usort(Delivered ++ Undelivered), ets:insert(Store, [{X, <<>>} || X <- SortedContent]), GCMessages = get_gc_delete_messages(), ?assertEqual(SortedContent, GCMessages), ok. t_gc_some_undelivered(Config) -> Store = ?config(session_msg_store, Config), STopic = ?config(stopic, Config), SessionId = emqx_guid:gen(), MsgIds = [msg_id() || _ <- lists:seq(1, 10)], Delivered = [delivered_msg(X, SessionId, STopic) || X <- MsgIds], {Delivered1, _Delivered2} = split(Delivered), Undelivered = [undelivered_msg(X, SessionId, STopic) || X <- MsgIds], {Undelivered1, Undelivered2} = split(Undelivered), Content = Delivered1 ++ Undelivered1 ++ Undelivered2, ets:insert(Store, [{X, <<>>} || X <- Content]), Expected = lists:usort(Delivered1 ++ Undelivered1), GCMessages = get_gc_delete_messages(), ?assertEqual(Expected, GCMessages), ok. t_gc_with_markers(Config) -> Store = ?config(session_msg_store, Config), STopic = ?config(stopic, Config), SessionId = emqx_guid:gen(), MsgIds1 = [msg_id() || _ <- lists:seq(1, 10)], MarkerId = msg_id(), MsgIds = [msg_id() || _ <- lists:seq(1, 4)] ++ MsgIds1, Delivered = [delivered_msg(X, SessionId, STopic) || X <- MsgIds], {Delivered1, _Delivered2} = split(Delivered), Undelivered = [undelivered_msg(X, SessionId, STopic) || X <- MsgIds], {Undelivered1, Undelivered2} = split(Undelivered), Markers = [marker_msg(MarkerId, SessionId)], Content = Delivered1 ++ Undelivered1 ++ Undelivered2 ++ Markers, ets:insert(Store, [{X, <<>>} || X <- Content]), Expected = lists:usort(Delivered1 ++ Undelivered1), GCMessages = get_gc_delete_messages(), ?assertEqual(Expected, GCMessages), ok. t_gc_abandoned_some_undelivered(Config) -> Store = ?config(session_msg_store, Config), STopic = ?config(stopic, Config), SessionId = emqx_guid:gen(), MsgIds = [msg_id() || _ <- lists:seq(1, 10)], Delivered = [delivered_msg(X, SessionId, STopic) || X <- MsgIds], {Delivered1, _Delivered2} = split(Delivered), Undelivered = [undelivered_msg(X, SessionId, STopic) || X <- MsgIds], {Undelivered1, Undelivered2} = split(Undelivered), Abandoned = abandoned_session_msg(SessionId), Content = Delivered1 ++ Undelivered1 ++ Undelivered2 ++ [Abandoned], ets:insert(Store, [{X, <<>>} || X <- Content]), Expected = lists:usort(Delivered1 ++ Undelivered1 ++ Undelivered2), GCMessages = get_gc_delete_messages(), ?assertEqual(Expected, GCMessages), ok. t_gc_abandoned_only_called_on_empty_session(Config) -> Store = ?config(session_msg_store, Config), STopic = ?config(stopic, Config), SessionId = emqx_guid:gen(), MsgIds = [msg_id() || _ <- lists:seq(1, 10)], Delivered = [delivered_msg(X, SessionId, STopic) || X <- MsgIds], Undelivered = [undelivered_msg(X, SessionId, STopic) || X <- MsgIds], Abandoned = abandoned_session_msg(SessionId), Content = Delivered ++ Undelivered ++ [Abandoned], ets:insert(Store, [{X, <<>>} || X <- Content]), GCMessages = get_gc_callbacks(), ?assertEqual([], [X || {X, abandoned} <- GCMessages]), ets:delete_all_objects(Store), UndeliveredOtherSession = undelivered_msg(msg_id(), emqx_guid:gen(), <<"topic">>), ets:insert(Store, [{X, <<>>} || X <- [Abandoned, UndeliveredOtherSession]]), GCMessages2 = get_gc_callbacks(), ?assertEqual([Abandoned], [X || {X, abandoned} <- GCMessages2]), ok. t_gc_session_gc_worker(init, Config) -> meck:new(emqx_persistent_session, [passthrough, no_link]), Config; t_gc_session_gc_worker('end', _Config) -> meck:unload(emqx_persistent_session), ok. t_gc_session_gc_worker(Config) -> STopic = ?config(stopic, Config), SessionID = emqx_guid:gen(), MsgDeleted = delivered_msg(msg_id(), SessionID, STopic), MarkerNotDeleted = marker_msg(msg_id(), SessionID), MarkerDeleted = marker_msg(guid(120 * 1000 * 1000), SessionID), AbandonedNotDeleted = abandoned_session_msg(SessionID), AbandonedDeleted = abandoned_session_msg(SessionID, 500 * 1000 * 1000), meck:expect(emqx_persistent_session, delete_session_message, fun(_Key) -> ok end), emqx_persistent_session_gc:session_gc_worker(delete, MsgDeleted), emqx_persistent_session_gc:session_gc_worker(marker, MarkerNotDeleted), emqx_persistent_session_gc:session_gc_worker(marker, MarkerDeleted), emqx_persistent_session_gc:session_gc_worker(abandoned, AbandonedDeleted), emqx_persistent_session_gc:session_gc_worker(abandoned, AbandonedNotDeleted), History = meck:history(emqx_persistent_session, self()), DeleteCalls = [ Key || {_Pid, {_, delete_session_message, [Key]}, _Result} <- History ], ?assertEqual( lists:sort([MsgDeleted, AbandonedDeleted, MarkerDeleted]), lists:sort(DeleteCalls) ), ok. t_gc_message_gc(Config) -> Topic = ?config(topic, Config), ClientID = ?config(client_id, Config), Store = ?config(msg_store, Config), NewMsgs = [ emqx_message:make(ClientID, Topic, integer_to_binary(P)) || P <- lists:seq(6, 10) ], Retain = 60 * 1000, emqx_config:put(?msg_retain, Retain), Msgs1 = [ emqx_message:make(ClientID, Topic, integer_to_binary(P)) || P <- lists:seq(1, 5) ], OldMsgs = [M#message{id = guid(Retain * 1000)} || M <- Msgs1], ets:insert(Store, NewMsgs ++ OldMsgs), ?assertEqual(lists:sort(OldMsgs ++ NewMsgs), ets:tab2list(Store)), ok = emqx_persistent_session_gc:message_gc_worker(), ?assertEqual(lists:sort(NewMsgs), ets:tab2list(Store)), ok. split(List) -> split(List, [], []). split([], L1, L2) -> {L1, L2}; split([H], L1, L2) -> {[H | L1], L2}; split([H1, H2 | Left], L1, L2) -> split(Left, [H1 | L1], [H2 | L2]).
118306fa4ac7ea77927680a1dc3cc45178215b1d2555263bcc6b152cf9d24f5b
gsakkas/rite
20060308-17:49:12-350bb6231959f879ee62f44461de9e70.seminal.ml
exception Unimplemented let char2str c = String.make 1 c let rec getStr str count = if count = -1 then "" else (char2str (String.get str count)) ^ (getStr str (count-1)) let reverse str = let count = (String.length str)-1 in getStr str count let rec map_helper f str index = if index = String.length str then [] else (f (String.get str index))::(map_helper f str (index+1)) let map f str = map_helper f str 0 let test_fold_left acc b = "f(" ^ acc ^ ", " ^ (char2str b) ^ ")" let rec fold_left_helper f acc str index = if index = (String.length str) then acc else fold_left_helper f (f acc (String.get str index)) str (index+1) let fold_left f init str = fold_left_helper test_fold_left init str 0 let test_fold_right b acc = "g(" ^ (char2str b) ^ ", " ^ acc ^ ")" let rec fold_right_helper f str acc index = if index = -1 then acc else fold_right_helper f str (f (String.get str index) acc) (index-1) let fold_right f str init = fold_right_helper f str init ((String.length str)-1) let rec char_list_to_string charList = match charList with [] -> "" | hd::tl -> (char2str hd) ^ (char_list_to_string tl) let uppercase s = let lst = map (fun c -> (Char.uppercase c)) s in char_list_to_string lst let lowercase s = let lst = map (fun c -> (Char.lowercase c)) s in char_list_to_string lst type caseTester = Tester of bool * string let test_title a acc = if (Char.compare a ' ') = 0 then match acc with Tester (is_space, str) ->Tester( true, str^(char2str a)) else match acc with Tester(is_space, str) -> if (is_space) then Tester( false, str^(char2str (uppercase a))) else Tester(false; str^(char2str (lowercase a))) let titlecase s = fold_left (fun a acc ->test_title) Tester(false; "") s let histogram s = raise Unimplemented let charConvert char = Char.code char let rec printRec lst = match lst with [] -> "" | hd::tl -> string_of_int hd ^ " " ^ (printRec tl) let _ = let arg1 = Sys.argv.(1) in let ret = reverse arg1 in let _ = print_endline ret in let lst = map charConvert arg1 in let _=print_endline (printRec lst) in let foldLeftString = fold_left test_fold_left "null" arg1 in let _ = print_endline foldLeftString in let foldRightString = fold_right test_fold_right arg1 "null" in let _ = print_endline foldRightString in let _ = print_endline (uppercase arg1) in let _ = print_endline (lowercase arg1) in print_endline (titlecase arg1)
null
https://raw.githubusercontent.com/gsakkas/rite/958a0ad2460e15734447bc07bd181f5d35956d3b/features/data/seminal/20060308-17%3A49%3A12-350bb6231959f879ee62f44461de9e70.seminal.ml
ocaml
exception Unimplemented let char2str c = String.make 1 c let rec getStr str count = if count = -1 then "" else (char2str (String.get str count)) ^ (getStr str (count-1)) let reverse str = let count = (String.length str)-1 in getStr str count let rec map_helper f str index = if index = String.length str then [] else (f (String.get str index))::(map_helper f str (index+1)) let map f str = map_helper f str 0 let test_fold_left acc b = "f(" ^ acc ^ ", " ^ (char2str b) ^ ")" let rec fold_left_helper f acc str index = if index = (String.length str) then acc else fold_left_helper f (f acc (String.get str index)) str (index+1) let fold_left f init str = fold_left_helper test_fold_left init str 0 let test_fold_right b acc = "g(" ^ (char2str b) ^ ", " ^ acc ^ ")" let rec fold_right_helper f str acc index = if index = -1 then acc else fold_right_helper f str (f (String.get str index) acc) (index-1) let fold_right f str init = fold_right_helper f str init ((String.length str)-1) let rec char_list_to_string charList = match charList with [] -> "" | hd::tl -> (char2str hd) ^ (char_list_to_string tl) let uppercase s = let lst = map (fun c -> (Char.uppercase c)) s in char_list_to_string lst let lowercase s = let lst = map (fun c -> (Char.lowercase c)) s in char_list_to_string lst type caseTester = Tester of bool * string let test_title a acc = if (Char.compare a ' ') = 0 then match acc with Tester (is_space, str) ->Tester( true, str^(char2str a)) else match acc with Tester(is_space, str) -> if (is_space) then Tester( false, str^(char2str (uppercase a))) else Tester(false; str^(char2str (lowercase a))) let titlecase s = fold_left (fun a acc ->test_title) Tester(false; "") s let histogram s = raise Unimplemented let charConvert char = Char.code char let rec printRec lst = match lst with [] -> "" | hd::tl -> string_of_int hd ^ " " ^ (printRec tl) let _ = let arg1 = Sys.argv.(1) in let ret = reverse arg1 in let _ = print_endline ret in let lst = map charConvert arg1 in let _=print_endline (printRec lst) in let foldLeftString = fold_left test_fold_left "null" arg1 in let _ = print_endline foldLeftString in let foldRightString = fold_right test_fold_right arg1 "null" in let _ = print_endline foldRightString in let _ = print_endline (uppercase arg1) in let _ = print_endline (lowercase arg1) in print_endline (titlecase arg1)
3e675e445623369f89026f464172e5af01f46a252c7946b68401aeee9cc3ebe3
racket/drracket
pict-snip.rkt
#lang racket/base (require racket/snip racket/class racket/match racket/draw file/convertible racket/format wxme (prefix-in r: racket/base)) (module+ test (require rackunit)) (provide pict-snip% snip-class reader) (define convertible<%> (interface* () ([prop:convertible (lambda (v r d) (send v convert r d))]) convert)) ;; this snip is created on the user's space, but its callbacks are invoked on 's . (define pict-snip% (class* snip% (convertible<%>) (init-field w h d a recorded-datum) (define/override (get-extent dc x y [wb #f] [hb #f] [descent #f] [space #f] [lspace #f] [rspace #f]) (set-box/f lspace 0) (set-box/f rspace 0) (set-box/f wb w) (set-box/f hb h) (set-box/f descent d) (set-box/f space a)) (define proc #f) (define/override (draw dc x y left top right bottom dx dy draw-caret) (unless proc (set! proc (with-handlers ((exn:fail? mk-error-drawer)) (recorded-datum->procedure recorded-datum)))) (define-values (ox oy) (send dc get-origin)) (send dc set-origin (+ ox x) (+ oy y)) (proc dc) (send dc set-origin ox oy)) (define/override (copy) (new pict-snip% [w w] [h h] [d d] [a a] [recorded-datum recorded-datum])) (define/override (write f) (write-version-1-of-snip w h d a recorded-datum f)) (define/override (find-scroll-step y) (inexact->exact (floor (/ y 12)))) (define/override (get-num-scroll-steps) (add1 (find-scroll-step h))) (define/override (get-scroll-step-offset y) (inexact->exact (floor (* y 12)))) (super-new) (inherit set-snipclass) (set-snipclass snip-class) (define/public (convert r d) (case r [(png-bytes) (define bm (make-bitmap (inexact->exact (ceiling w)) (inexact->exact (ceiling h)))) (define dc (send bm make-dc)) (draw dc 0 0 0 0 w h 0 0 #f) (define b (open-output-bytes)) (send bm save-file b 'png) (get-output-bytes b)] [(pdf-bytes) (define b (open-output-bytes)) (define dc (new pdf-dc% [interactive #f] [width w] [height h] [output b])) (send dc start-doc "pict") (send dc start-page) (draw dc 0 0 0 0 w h 0 0 #f) (send dc end-page) (send dc end-doc) (get-output-bytes b)] [else d])))) (define (set-box/f b v) (when (box? b) (set-box! b v))) (define ((mk-error-drawer exn) dc) (define clr (send dc get-text-foreground)) (send dc set-text-foreground "red") (send dc draw-text (exn-message exn) 0 0 'grapheme) (send dc set-text-foreground clr)) (define snip-class (new (class snip-class% (inherit reading-version set-version) (define/override (read f) (define version (reading-version f)) (case version [(0) (parse-version-0-pict-snip-from-bytes (send f get-unterminated-bytes))] [(1) (parse-version-1-pict-snip (λ () (send f get-unterminated-bytes)) (λ () (send f get-exact)))])) (super-new) (set-version 1)))) (send snip-class set-classname (format "~s" (list '(lib "pict-snip.rkt" "drracket" "private") '(lib "pict-snip.rkt" "drracket" "private")))) (send (get-the-snip-class-list) add snip-class) (define reader (new (class* object% (snip-reader<%>) (define/public (read-header version stream) (void)) (define/public (read-snip text-only? version stream) (if text-only? #"#<pict-snip>" (or (case version [(0) (parse-version-0-pict-snip-from-bytes (send stream read-raw-bytes 'pict-snip))] [(1) (parse-version-1-pict-snip (λ () (send stream read-raw-bytes "drracket's pict-snip%")) (λ () (send stream read-integer "drracket's pict-snip%")))]) (error 'pict-snip.rkt "could not read pict-snip from stream")))) (super-new)))) ;; parse-pict-snip-from-bytes : bytes -> (or/c (is-a?/c pict-snip%) #f) (define (parse-version-0-pict-snip-from-bytes bytes) (let/ec escape (define prt (open-input-bytes bytes)) (define sexp (with-handlers ([exn:fail:read? (λ (x) (escape #f))]) (read prt))) (match sexp [`(,(? real? w) ,(? real? h) ,(? real? d) ,(? real? a) ,recorded-datum) (new pict-snip% [w w] [h h] [d d] [a a] [recorded-datum recorded-datum])] [else #f]))) (define (parse-version-1-pict-snip get-some-bytes get-a-number) (define prefix (bytes->string/utf-8 (get-some-bytes))) (define w (get-a-number)) (define h (get-a-number)) (define d (get-a-number)) (define a (get-a-number)) (define byteses (for/list ([_ (in-range (get-a-number))]) (get-some-bytes))) (define rewriten-datum (read (open-input-bytes (get-some-bytes)))) (define recorded-datum (let loop ([datum rewriten-datum]) (cond [(pair? datum) (cons (loop (car datum)) (loop (cdr datum)))] [(equal? datum prefix) (begin0 (car byteses) (set! byteses (cdr byteses)))] [else datum]))) (new pict-snip% [w w] [h h] [d d] [a a] [recorded-datum recorded-datum])) (define (write-version-1-of-snip w h d a recorded-datum f) (define unique-string (get-unique-string recorded-datum)) (define unique-bytes (string->bytes/utf-8 unique-string)) (send f put unique-bytes) (send f put w) (send f put h) (send f put d) (send f put a) (define-values (rewritten-datum byteses) (rewrite-recorded-datum recorded-datum unique-string)) (send f put (length byteses)) (for ([bytes (in-list byteses)]) (send f put bytes)) (define bp (open-output-bytes)) (write rewritten-datum bp) (send f put (get-output-bytes bp))) (define (rewrite-recorded-datum recorded-datum unique-string) (define byteses '()) (define rewriten-datum (let loop ([recorded-datum recorded-datum]) (match recorded-datum [(cons a b) (cons (loop a) (loop b))] [(? bytes?) (set! byteses (cons recorded-datum byteses)) unique-string] [else recorded-datum]))) (values rewriten-datum byteses)) (define (get-unique-string recorded-datum) (define prefix 0) (let loop ([recorded-datum recorded-datum]) (cond [(pair? recorded-datum) (loop (car recorded-datum)) (loop (cdr recorded-datum))] [(string? recorded-datum) (define m (regexp-match #rx"^bmpref([0-9]+):" recorded-datum)) (when m (define n (string->number (list-ref m 1))) (set! prefix (max (+ n 1) prefix)))])) (~a "bmpref" prefix ":")) (module+ test (check-equal? (get-unique-string '(((1) 2))) "bmpref0:") (check-equal? (get-unique-string '((("bmpref4:") "bmpref1:"))) "bmpref5:"))
null
https://raw.githubusercontent.com/racket/drracket/d2760acb76ef77046e7de788d26156f77330ab03/drracket/drracket/private/pict-snip.rkt
racket
this snip is created on the user's space, parse-pict-snip-from-bytes : bytes -> (or/c (is-a?/c pict-snip%) #f)
#lang racket/base (require racket/snip racket/class racket/match racket/draw file/convertible racket/format wxme (prefix-in r: racket/base)) (module+ test (require rackunit)) (provide pict-snip% snip-class reader) (define convertible<%> (interface* () ([prop:convertible (lambda (v r d) (send v convert r d))]) convert)) but its callbacks are invoked on 's . (define pict-snip% (class* snip% (convertible<%>) (init-field w h d a recorded-datum) (define/override (get-extent dc x y [wb #f] [hb #f] [descent #f] [space #f] [lspace #f] [rspace #f]) (set-box/f lspace 0) (set-box/f rspace 0) (set-box/f wb w) (set-box/f hb h) (set-box/f descent d) (set-box/f space a)) (define proc #f) (define/override (draw dc x y left top right bottom dx dy draw-caret) (unless proc (set! proc (with-handlers ((exn:fail? mk-error-drawer)) (recorded-datum->procedure recorded-datum)))) (define-values (ox oy) (send dc get-origin)) (send dc set-origin (+ ox x) (+ oy y)) (proc dc) (send dc set-origin ox oy)) (define/override (copy) (new pict-snip% [w w] [h h] [d d] [a a] [recorded-datum recorded-datum])) (define/override (write f) (write-version-1-of-snip w h d a recorded-datum f)) (define/override (find-scroll-step y) (inexact->exact (floor (/ y 12)))) (define/override (get-num-scroll-steps) (add1 (find-scroll-step h))) (define/override (get-scroll-step-offset y) (inexact->exact (floor (* y 12)))) (super-new) (inherit set-snipclass) (set-snipclass snip-class) (define/public (convert r d) (case r [(png-bytes) (define bm (make-bitmap (inexact->exact (ceiling w)) (inexact->exact (ceiling h)))) (define dc (send bm make-dc)) (draw dc 0 0 0 0 w h 0 0 #f) (define b (open-output-bytes)) (send bm save-file b 'png) (get-output-bytes b)] [(pdf-bytes) (define b (open-output-bytes)) (define dc (new pdf-dc% [interactive #f] [width w] [height h] [output b])) (send dc start-doc "pict") (send dc start-page) (draw dc 0 0 0 0 w h 0 0 #f) (send dc end-page) (send dc end-doc) (get-output-bytes b)] [else d])))) (define (set-box/f b v) (when (box? b) (set-box! b v))) (define ((mk-error-drawer exn) dc) (define clr (send dc get-text-foreground)) (send dc set-text-foreground "red") (send dc draw-text (exn-message exn) 0 0 'grapheme) (send dc set-text-foreground clr)) (define snip-class (new (class snip-class% (inherit reading-version set-version) (define/override (read f) (define version (reading-version f)) (case version [(0) (parse-version-0-pict-snip-from-bytes (send f get-unterminated-bytes))] [(1) (parse-version-1-pict-snip (λ () (send f get-unterminated-bytes)) (λ () (send f get-exact)))])) (super-new) (set-version 1)))) (send snip-class set-classname (format "~s" (list '(lib "pict-snip.rkt" "drracket" "private") '(lib "pict-snip.rkt" "drracket" "private")))) (send (get-the-snip-class-list) add snip-class) (define reader (new (class* object% (snip-reader<%>) (define/public (read-header version stream) (void)) (define/public (read-snip text-only? version stream) (if text-only? #"#<pict-snip>" (or (case version [(0) (parse-version-0-pict-snip-from-bytes (send stream read-raw-bytes 'pict-snip))] [(1) (parse-version-1-pict-snip (λ () (send stream read-raw-bytes "drracket's pict-snip%")) (λ () (send stream read-integer "drracket's pict-snip%")))]) (error 'pict-snip.rkt "could not read pict-snip from stream")))) (super-new)))) (define (parse-version-0-pict-snip-from-bytes bytes) (let/ec escape (define prt (open-input-bytes bytes)) (define sexp (with-handlers ([exn:fail:read? (λ (x) (escape #f))]) (read prt))) (match sexp [`(,(? real? w) ,(? real? h) ,(? real? d) ,(? real? a) ,recorded-datum) (new pict-snip% [w w] [h h] [d d] [a a] [recorded-datum recorded-datum])] [else #f]))) (define (parse-version-1-pict-snip get-some-bytes get-a-number) (define prefix (bytes->string/utf-8 (get-some-bytes))) (define w (get-a-number)) (define h (get-a-number)) (define d (get-a-number)) (define a (get-a-number)) (define byteses (for/list ([_ (in-range (get-a-number))]) (get-some-bytes))) (define rewriten-datum (read (open-input-bytes (get-some-bytes)))) (define recorded-datum (let loop ([datum rewriten-datum]) (cond [(pair? datum) (cons (loop (car datum)) (loop (cdr datum)))] [(equal? datum prefix) (begin0 (car byteses) (set! byteses (cdr byteses)))] [else datum]))) (new pict-snip% [w w] [h h] [d d] [a a] [recorded-datum recorded-datum])) (define (write-version-1-of-snip w h d a recorded-datum f) (define unique-string (get-unique-string recorded-datum)) (define unique-bytes (string->bytes/utf-8 unique-string)) (send f put unique-bytes) (send f put w) (send f put h) (send f put d) (send f put a) (define-values (rewritten-datum byteses) (rewrite-recorded-datum recorded-datum unique-string)) (send f put (length byteses)) (for ([bytes (in-list byteses)]) (send f put bytes)) (define bp (open-output-bytes)) (write rewritten-datum bp) (send f put (get-output-bytes bp))) (define (rewrite-recorded-datum recorded-datum unique-string) (define byteses '()) (define rewriten-datum (let loop ([recorded-datum recorded-datum]) (match recorded-datum [(cons a b) (cons (loop a) (loop b))] [(? bytes?) (set! byteses (cons recorded-datum byteses)) unique-string] [else recorded-datum]))) (values rewriten-datum byteses)) (define (get-unique-string recorded-datum) (define prefix 0) (let loop ([recorded-datum recorded-datum]) (cond [(pair? recorded-datum) (loop (car recorded-datum)) (loop (cdr recorded-datum))] [(string? recorded-datum) (define m (regexp-match #rx"^bmpref([0-9]+):" recorded-datum)) (when m (define n (string->number (list-ref m 1))) (set! prefix (max (+ n 1) prefix)))])) (~a "bmpref" prefix ":")) (module+ test (check-equal? (get-unique-string '(((1) 2))) "bmpref0:") (check-equal? (get-unique-string '((("bmpref4:") "bmpref1:"))) "bmpref5:"))
f1f2454428ab978c588acc535ede372bad6e13621e5b57b306ac45e944ee25a5
couchbase/couchdb
couch_os_process.erl
Licensed under the Apache License , Version 2.0 ( the " License " ) ; you may not % use this file except in compliance with the License. You may obtain a copy of % the License at % % -2.0 % % Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an " AS IS " BASIS , WITHOUT % WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the % License for the specific language governing permissions and limitations under % the License. -module(couch_os_process). -behaviour(gen_server). -export([start_link/1, start_link/2, start_link/3, stop/1]). -export([set_timeout/2, prompt/2, prompt_many/2]). -export([send/2, writeline/2, readline/1, writejson/2, readjson/1]). -export([init/1, terminate/2, handle_call/3, handle_cast/2, handle_info/2, code_change/3]). -include("couch_db.hrl"). -define(PORT_OPTIONS, [stream, {line, 4096}, binary, exit_status, hide]). -record(os_proc, {command, port, writer, reader, timeout=5000 }). start_link(Command) -> start_link(Command, []). start_link(Command, Options) -> start_link(Command, Options, ?PORT_OPTIONS). start_link(Command, Options, PortOptions) -> gen_server:start_link(couch_os_process, [Command, Options, PortOptions], []). stop(Pid) -> gen_server:cast(Pid, stop). % Read/Write API set_timeout(Pid, TimeOut) when is_integer(TimeOut) -> ok = gen_server:call(Pid, {set_timeout, TimeOut}, infinity). % Used by couch_db_update_notifier.erl send(Pid, Data) -> gen_server:cast(Pid, {send, Data}). prompt(Pid, Data) -> case gen_server:call(Pid, {prompt, Data}, infinity) of {ok, Result} -> Result; Error -> ?LOG_ERROR("OS Process Error ~p :: ~p",[Pid, Error]), throw(Error) end. prompt_many(Pid, DataList) -> OsProc = gen_server:call(Pid, get_os_proc, infinity), true = port_connect(OsProc#os_proc.port, self()), try send_many(OsProc, DataList), receive_many(length(DataList), OsProc, []) after Can throw badarg error , when OsProc Pid is dead or port was closed % by the readline function on error/timeout. (catch port_connect(OsProc#os_proc.port, Pid)), unlink(OsProc#os_proc.port), drop_port_messages(OsProc#os_proc.port) end. send_many(_OsProc, []) -> ok; send_many(#os_proc{writer = Writer} = OsProc, [Data | Rest]) -> Writer(OsProc, Data), send_many(OsProc, Rest). receive_many(0, _OsProc, Acc) -> {ok, lists:reverse(Acc)}; receive_many(N, #os_proc{reader = Reader} = OsProc, Acc) -> Line = Reader(OsProc), receive_many(N - 1, OsProc, [Line | Acc]). drop_port_messages(Port) -> receive {Port, _} -> drop_port_messages(Port) after 0 -> ok end. % Utility functions for reading and writing % in custom functions writeline(OsProc, Data) when is_record(OsProc, os_proc) -> port_command(OsProc#os_proc.port, [Data, $\n]). readline(#os_proc{} = OsProc) -> readline(OsProc, []). readline(#os_proc{port = Port} = OsProc, Acc) -> receive {Port, {data, {noeol, Data}}} -> readline(OsProc, [Data|Acc]); {Port, {data, {eol, Data}}} -> lists:reverse(Acc, Data); {Port, Err} -> catch port_close(Port), throw({os_process_error, Err}) after OsProc#os_proc.timeout -> catch port_close(Port), throw({os_process_error, "OS process timed out."}) end. % Standard JSON functions writejson(OsProc, Data) when is_record(OsProc, os_proc) -> JsonData = ?JSON_ENCODE(Data), ?LOG_DEBUG("OS Process ~p Input :: ~s", [OsProc#os_proc.port, ?LOG_USERDATA(JsonData)]), true = writeline(OsProc, JsonData). readjson(OsProc) when is_record(OsProc, os_proc) -> Line = iolist_to_binary(readline(OsProc)), ?LOG_DEBUG("OS Process ~p Output :: ~s", [OsProc#os_proc.port, ?LOG_USERDATA(Line)]), try % Don't actually parse the whole JSON. Just try to see if it's % a command or a doc map/reduce/filter/show/list/update output. % If it's a command then parse the whole JSON and execute the % command, otherwise return the raw JSON line to the caller. pick_command(Line) catch throw:abort -> {json, Line}; throw:{cmd, _Cmd} -> case ?JSON_DECODE(Line) of [<<"log">>, Msg] when is_binary(Msg) -> % we got a message to log. Log it and continue ?LOG_INFO("OS Process ~p Log :: ~s", [OsProc#os_proc.port, ?LOG_USERDATA(Msg)]), readjson(OsProc); [<<"error">>, Id, Reason] -> throw({error, {couch_util:to_existing_atom(Id),Reason}}); [<<"fatal">>, Id, Reason] -> ?LOG_INFO("OS Process ~p Fatal Error :: ~s ~p", [OsProc#os_proc.port, Id, Reason]), throw({couch_util:to_existing_atom(Id),Reason}); _Result -> {json, Line} end end. pick_command(Line) -> json_stream_parse:events(Line, fun pick_command0/1). pick_command0(array_start) -> fun pick_command1/1; pick_command0(_) -> throw(abort). pick_command1(<<"log">> = Cmd) -> throw({cmd, Cmd}); pick_command1(<<"error">> = Cmd) -> throw({cmd, Cmd}); pick_command1(<<"fatal">> = Cmd) -> throw({cmd, Cmd}); pick_command1(_) -> throw(abort). % gen_server API init([Command, Options, PortOptions]) -> PrivDir = couch_util:priv_dir(), Spawnkiller = filename:join(PrivDir, "couchspawnkillable"), CompleteCmd = "\"" ++ Spawnkiller ++ "\" " ++ Command, BaseProc = #os_proc{ command=Command, port=open_port({spawn, CompleteCmd}, PortOptions), writer=fun writejson/2, reader=fun readjson/1 }, KillCmd = readline(BaseProc), Pid = self(), ?LOG_DEBUG("OS Process Start :: ~p", [BaseProc#os_proc.port]), spawn(fun() -> % this ensure the real os process is killed when this process dies. erlang:monitor(process, Pid), receive _ -> ok end, os:cmd(?b2l(iolist_to_binary(KillCmd))) end), OsProc = lists:foldl(fun(Opt, Proc) -> case Opt of {writer, Writer} when is_function(Writer) -> Proc#os_proc{writer=Writer}; {reader, Reader} when is_function(Reader) -> Proc#os_proc{reader=Reader}; {timeout, TimeOut} when is_integer(TimeOut) -> Proc#os_proc{timeout=TimeOut} end end, BaseProc, Options), {ok, OsProc}. terminate(_Reason, #os_proc{port=Port}) -> catch port_close(Port), ok. handle_call(get_os_proc, _From, OsProc) -> {reply, OsProc, OsProc}; handle_call({set_timeout, TimeOut}, _From, OsProc) -> {reply, ok, OsProc#os_proc{timeout=TimeOut}}; handle_call({prompt, Data}, _From, OsProc) -> #os_proc{writer=Writer, reader=Reader} = OsProc, try Writer(OsProc, Data), {reply, {ok, Reader(OsProc)}, OsProc} catch throw:{error, OsError} -> {reply, OsError, OsProc}; throw:OtherError -> {stop, normal, OtherError, OsProc} end. handle_cast({send, Data}, #os_proc{writer=Writer}=OsProc) -> try Writer(OsProc, Data), {noreply, OsProc} catch throw:OsError -> ?LOG_ERROR("Failed sending data: ~p -> ~p", [?LOG_USERDATA(Data), OsError]), {stop, normal, OsProc} end; handle_cast(stop, OsProc) -> {stop, normal, OsProc}; handle_cast(Msg, OsProc) -> ?LOG_DEBUG("OS Proc: Unknown cast: ~p", [Msg]), {noreply, OsProc}. handle_info({Port, {exit_status, 0}}, #os_proc{port=Port}=OsProc) -> ?LOG_INFO("OS Process terminated normally", []), {stop, normal, OsProc}; handle_info({Port, {exit_status, Status}}, #os_proc{port=Port}=OsProc) -> ?LOG_ERROR("OS Process died with status: ~p", [Status]), {stop, {exit_status, Status}, OsProc}. code_change(_OldVsn, State, _Extra) -> {ok, State}.
null
https://raw.githubusercontent.com/couchbase/couchdb/8a75fd2faa89f95158de1776354ceccf3e762753/src/couchdb/couch_os_process.erl
erlang
use this file except in compliance with the License. You may obtain a copy of the License at -2.0 Unless required by applicable law or agreed to in writing, software WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. Read/Write API Used by couch_db_update_notifier.erl by the readline function on error/timeout. Utility functions for reading and writing in custom functions Standard JSON functions Don't actually parse the whole JSON. Just try to see if it's a command or a doc map/reduce/filter/show/list/update output. If it's a command then parse the whole JSON and execute the command, otherwise return the raw JSON line to the caller. we got a message to log. Log it and continue gen_server API this ensure the real os process is killed when this process dies.
Licensed under the Apache License , Version 2.0 ( the " License " ) ; you may not distributed under the License is distributed on an " AS IS " BASIS , WITHOUT -module(couch_os_process). -behaviour(gen_server). -export([start_link/1, start_link/2, start_link/3, stop/1]). -export([set_timeout/2, prompt/2, prompt_many/2]). -export([send/2, writeline/2, readline/1, writejson/2, readjson/1]). -export([init/1, terminate/2, handle_call/3, handle_cast/2, handle_info/2, code_change/3]). -include("couch_db.hrl"). -define(PORT_OPTIONS, [stream, {line, 4096}, binary, exit_status, hide]). -record(os_proc, {command, port, writer, reader, timeout=5000 }). start_link(Command) -> start_link(Command, []). start_link(Command, Options) -> start_link(Command, Options, ?PORT_OPTIONS). start_link(Command, Options, PortOptions) -> gen_server:start_link(couch_os_process, [Command, Options, PortOptions], []). stop(Pid) -> gen_server:cast(Pid, stop). set_timeout(Pid, TimeOut) when is_integer(TimeOut) -> ok = gen_server:call(Pid, {set_timeout, TimeOut}, infinity). send(Pid, Data) -> gen_server:cast(Pid, {send, Data}). prompt(Pid, Data) -> case gen_server:call(Pid, {prompt, Data}, infinity) of {ok, Result} -> Result; Error -> ?LOG_ERROR("OS Process Error ~p :: ~p",[Pid, Error]), throw(Error) end. prompt_many(Pid, DataList) -> OsProc = gen_server:call(Pid, get_os_proc, infinity), true = port_connect(OsProc#os_proc.port, self()), try send_many(OsProc, DataList), receive_many(length(DataList), OsProc, []) after Can throw badarg error , when OsProc Pid is dead or port was closed (catch port_connect(OsProc#os_proc.port, Pid)), unlink(OsProc#os_proc.port), drop_port_messages(OsProc#os_proc.port) end. send_many(_OsProc, []) -> ok; send_many(#os_proc{writer = Writer} = OsProc, [Data | Rest]) -> Writer(OsProc, Data), send_many(OsProc, Rest). receive_many(0, _OsProc, Acc) -> {ok, lists:reverse(Acc)}; receive_many(N, #os_proc{reader = Reader} = OsProc, Acc) -> Line = Reader(OsProc), receive_many(N - 1, OsProc, [Line | Acc]). drop_port_messages(Port) -> receive {Port, _} -> drop_port_messages(Port) after 0 -> ok end. writeline(OsProc, Data) when is_record(OsProc, os_proc) -> port_command(OsProc#os_proc.port, [Data, $\n]). readline(#os_proc{} = OsProc) -> readline(OsProc, []). readline(#os_proc{port = Port} = OsProc, Acc) -> receive {Port, {data, {noeol, Data}}} -> readline(OsProc, [Data|Acc]); {Port, {data, {eol, Data}}} -> lists:reverse(Acc, Data); {Port, Err} -> catch port_close(Port), throw({os_process_error, Err}) after OsProc#os_proc.timeout -> catch port_close(Port), throw({os_process_error, "OS process timed out."}) end. writejson(OsProc, Data) when is_record(OsProc, os_proc) -> JsonData = ?JSON_ENCODE(Data), ?LOG_DEBUG("OS Process ~p Input :: ~s", [OsProc#os_proc.port, ?LOG_USERDATA(JsonData)]), true = writeline(OsProc, JsonData). readjson(OsProc) when is_record(OsProc, os_proc) -> Line = iolist_to_binary(readline(OsProc)), ?LOG_DEBUG("OS Process ~p Output :: ~s", [OsProc#os_proc.port, ?LOG_USERDATA(Line)]), try pick_command(Line) catch throw:abort -> {json, Line}; throw:{cmd, _Cmd} -> case ?JSON_DECODE(Line) of [<<"log">>, Msg] when is_binary(Msg) -> ?LOG_INFO("OS Process ~p Log :: ~s", [OsProc#os_proc.port, ?LOG_USERDATA(Msg)]), readjson(OsProc); [<<"error">>, Id, Reason] -> throw({error, {couch_util:to_existing_atom(Id),Reason}}); [<<"fatal">>, Id, Reason] -> ?LOG_INFO("OS Process ~p Fatal Error :: ~s ~p", [OsProc#os_proc.port, Id, Reason]), throw({couch_util:to_existing_atom(Id),Reason}); _Result -> {json, Line} end end. pick_command(Line) -> json_stream_parse:events(Line, fun pick_command0/1). pick_command0(array_start) -> fun pick_command1/1; pick_command0(_) -> throw(abort). pick_command1(<<"log">> = Cmd) -> throw({cmd, Cmd}); pick_command1(<<"error">> = Cmd) -> throw({cmd, Cmd}); pick_command1(<<"fatal">> = Cmd) -> throw({cmd, Cmd}); pick_command1(_) -> throw(abort). init([Command, Options, PortOptions]) -> PrivDir = couch_util:priv_dir(), Spawnkiller = filename:join(PrivDir, "couchspawnkillable"), CompleteCmd = "\"" ++ Spawnkiller ++ "\" " ++ Command, BaseProc = #os_proc{ command=Command, port=open_port({spawn, CompleteCmd}, PortOptions), writer=fun writejson/2, reader=fun readjson/1 }, KillCmd = readline(BaseProc), Pid = self(), ?LOG_DEBUG("OS Process Start :: ~p", [BaseProc#os_proc.port]), spawn(fun() -> erlang:monitor(process, Pid), receive _ -> ok end, os:cmd(?b2l(iolist_to_binary(KillCmd))) end), OsProc = lists:foldl(fun(Opt, Proc) -> case Opt of {writer, Writer} when is_function(Writer) -> Proc#os_proc{writer=Writer}; {reader, Reader} when is_function(Reader) -> Proc#os_proc{reader=Reader}; {timeout, TimeOut} when is_integer(TimeOut) -> Proc#os_proc{timeout=TimeOut} end end, BaseProc, Options), {ok, OsProc}. terminate(_Reason, #os_proc{port=Port}) -> catch port_close(Port), ok. handle_call(get_os_proc, _From, OsProc) -> {reply, OsProc, OsProc}; handle_call({set_timeout, TimeOut}, _From, OsProc) -> {reply, ok, OsProc#os_proc{timeout=TimeOut}}; handle_call({prompt, Data}, _From, OsProc) -> #os_proc{writer=Writer, reader=Reader} = OsProc, try Writer(OsProc, Data), {reply, {ok, Reader(OsProc)}, OsProc} catch throw:{error, OsError} -> {reply, OsError, OsProc}; throw:OtherError -> {stop, normal, OtherError, OsProc} end. handle_cast({send, Data}, #os_proc{writer=Writer}=OsProc) -> try Writer(OsProc, Data), {noreply, OsProc} catch throw:OsError -> ?LOG_ERROR("Failed sending data: ~p -> ~p", [?LOG_USERDATA(Data), OsError]), {stop, normal, OsProc} end; handle_cast(stop, OsProc) -> {stop, normal, OsProc}; handle_cast(Msg, OsProc) -> ?LOG_DEBUG("OS Proc: Unknown cast: ~p", [Msg]), {noreply, OsProc}. handle_info({Port, {exit_status, 0}}, #os_proc{port=Port}=OsProc) -> ?LOG_INFO("OS Process terminated normally", []), {stop, normal, OsProc}; handle_info({Port, {exit_status, Status}}, #os_proc{port=Port}=OsProc) -> ?LOG_ERROR("OS Process died with status: ~p", [Status]), {stop, {exit_status, Status}, OsProc}. code_change(_OldVsn, State, _Extra) -> {ok, State}.
b491d966aaa96d8895b8dc996d95e5fc9c34c1faa445c31edde740cc2d2b33a4
np/ling
Session.hs
# LANGUAGE LambdaCase # # LANGUAGE ViewPatterns # module Ling.Session (module Ling.Session ,module Ling.Session.Core) where import Ling.Session.Core import Ling.Defs import Ling.Norm import Ling.Prelude hiding (subst1) import Ling.Scoped import Prelude hiding (log) sessionStep :: Term -> Endom Session sessionStep tm (IO _ (Arg x mty) s) = mkLet__ $ subst1 (x, Ann mty tm) s sessionStep _ s = error $ "sessionStep: no steps " ++ show s -- Should be length preserving extractDuals :: Dual a => [Maybe a] -> [a] extractDuals = \case [Just s0, Nothing] -> [s0, dual s0] [Nothing, Just s1] -> [dual s1, s1] from the two cases above the general rule -- so far is that all sessions should be annotated mas -> mas ^? below _Just ?| error "Missing type signature in `new` (extractDuals)" extractSession :: [Maybe a] -> a extractSession l = l ^? each . _Just ?| error "Missing type signature in `new` (extractSession)" -- See flatRSession in Ling.Reduce unsafeFlatRSession :: RSession -> [Session] unsafeFlatRSession (s `Repl` r) = replicate (r ^? litR . integral ?| error ("unsafeFlatRSession " ++ show r)) s See flatSessions in . Reduce unsafeFlatSessions :: Sessions -> [Session] unsafeFlatSessions = concatMap unsafeFlatRSession . view _Sessions projSessions :: Integer -> Sessions -> Session projSessions _ (Sessions []) = error "projSessions: out of bound" projSessions n (Sessions (Repl s r:ss)) | Just i <- r ^? litR = if n < i then s else projSessions (n - i) (Sessions ss) | otherwise = error "projSessions/Repl: only integer literals are supported" replRSession :: RFactor -> Endom RSession replRSession r (Repl s t) = Repl s (r <> t) mkCaseRSession :: (Scoped Term -> Term) -> Rel (Scoped Term) -> MkCase' (Scoped RSession) mkCaseRSession f rel u = repl . bimap h h . unzip . fmap unrepl where repl (s, r) = pure $ (s ^. from tSession) `Repl` (r ^. from rterm) unrepl (con, rs) = ((con, view (rsession . tSession) <$> rs), (con, view (rfactor . rterm) <$> rs)) h = mkCaseBy f rel u mkCaseSessions :: (Scoped Term -> Term) -> Rel (Scoped Term) -> MkCase' (Scoped Sessions) mkCaseSessions f rel u brs = Sessions . pure <$> mkCaseRSession f rel u (brs & branches . scoped %~ unSingleton) where unSingleton (Sessions [x]) = x unSingleton _ = error "mkCaseSessions" -- -}
null
https://raw.githubusercontent.com/np/ling/ca942db83ac927420d1ae5e24b4da164394ddbbe/Ling/Session.hs
haskell
Should be length preserving so far is that all sessions should be annotated See flatRSession in Ling.Reduce -}
# LANGUAGE LambdaCase # # LANGUAGE ViewPatterns # module Ling.Session (module Ling.Session ,module Ling.Session.Core) where import Ling.Session.Core import Ling.Defs import Ling.Norm import Ling.Prelude hiding (subst1) import Ling.Scoped import Prelude hiding (log) sessionStep :: Term -> Endom Session sessionStep tm (IO _ (Arg x mty) s) = mkLet__ $ subst1 (x, Ann mty tm) s sessionStep _ s = error $ "sessionStep: no steps " ++ show s extractDuals :: Dual a => [Maybe a] -> [a] extractDuals = \case [Just s0, Nothing] -> [s0, dual s0] [Nothing, Just s1] -> [dual s1, s1] from the two cases above the general rule mas -> mas ^? below _Just ?| error "Missing type signature in `new` (extractDuals)" extractSession :: [Maybe a] -> a extractSession l = l ^? each . _Just ?| error "Missing type signature in `new` (extractSession)" unsafeFlatRSession :: RSession -> [Session] unsafeFlatRSession (s `Repl` r) = replicate (r ^? litR . integral ?| error ("unsafeFlatRSession " ++ show r)) s See flatSessions in . Reduce unsafeFlatSessions :: Sessions -> [Session] unsafeFlatSessions = concatMap unsafeFlatRSession . view _Sessions projSessions :: Integer -> Sessions -> Session projSessions _ (Sessions []) = error "projSessions: out of bound" projSessions n (Sessions (Repl s r:ss)) | Just i <- r ^? litR = if n < i then s else projSessions (n - i) (Sessions ss) | otherwise = error "projSessions/Repl: only integer literals are supported" replRSession :: RFactor -> Endom RSession replRSession r (Repl s t) = Repl s (r <> t) mkCaseRSession :: (Scoped Term -> Term) -> Rel (Scoped Term) -> MkCase' (Scoped RSession) mkCaseRSession f rel u = repl . bimap h h . unzip . fmap unrepl where repl (s, r) = pure $ (s ^. from tSession) `Repl` (r ^. from rterm) unrepl (con, rs) = ((con, view (rsession . tSession) <$> rs), (con, view (rfactor . rterm) <$> rs)) h = mkCaseBy f rel u mkCaseSessions :: (Scoped Term -> Term) -> Rel (Scoped Term) -> MkCase' (Scoped Sessions) mkCaseSessions f rel u brs = Sessions . pure <$> mkCaseRSession f rel u (brs & branches . scoped %~ unSingleton) where unSingleton (Sessions [x]) = x unSingleton _ = error "mkCaseSessions"
71ffa4a96042abe894cb073fe475bc414f0c6b3c1ca4c3343815082087547b84
LexiFi/menhir
unionFind.ml
(******************************************************************************) (* *) (* *) , Paris , PPS , Université Paris Diderot (* *) . All rights reserved . This file is distributed under the terms of the GNU General Public License version 2 , as described in the (* file LICENSE. *) (* *) (******************************************************************************) * This module implements a simple and efficient union / find algorithm . See , ` ` Efficiency of a Good But Not Linear Set Union Algorithm '' , JACM 22(2 ) , 1975 . See Robert E. Tarjan, ``Efficiency of a Good But Not Linear Set Union Algorithm'', JACM 22(2), 1975. *) * The abstraction defined by this module is a set of points , partitioned into equivalence classes . With each equivalence class , a piece of information , of abstract type [ ' a ] , is associated ; we call it a descriptor . A point is implemented as a cell , whose ( mutable ) contents consist of a single link to either information about the equivalence class , or another point . Thus , points form a graph , which must be acyclic , and whose connected components are the equivalence classes . In every equivalence class , exactly one point has no outgoing edge , and carries information about the class instead . It is the class 's representative element . Information about a class consists of an integer weight ( the number of elements in the class ) and of the class 's descriptor . partitioned into equivalence classes. With each equivalence class, a piece of information, of abstract type ['a], is associated; we call it a descriptor. A point is implemented as a cell, whose (mutable) contents consist of a single link to either information about the equivalence class, or another point. Thus, points form a graph, which must be acyclic, and whose connected components are the equivalence classes. In every equivalence class, exactly one point has no outgoing edge, and carries information about the class instead. It is the class's representative element. Information about a class consists of an integer weight (the number of elements in the class) and of the class's descriptor. *) type 'a point = { mutable link: 'a link } and 'a link = | Info of 'a info | Link of 'a point and 'a info = { mutable weight: int; mutable descriptor: 'a } (** [fresh desc] creates a fresh point and returns it. It forms an equivalence class of its own, whose descriptor is [desc]. *) let fresh desc = { link = Info { weight = 1; descriptor = desc } } (** [repr point] returns the representative element of [point]'s equivalence class. It is found by starting at [point] and following the links. For efficiency, the function performs path compression at the same time. *) let rec repr point = match point.link with | Link point' -> let point'' = repr point' in if point'' != point' then (* [point''] is [point']'s representative element. Because we just invoked [repr point'], [point'.link] must be [Link point'']. We write this value into [point.link], thus performing path compression. Note that this function never performs memory allocation. *) point.link <- point'.link; point'' | Info _ -> point (** [get point] returns the descriptor associated with [point]'s equivalence class. *) let rec get point = By not calling [ repr ] immediately , we optimize the common cases where the path starting at [ point ] has length 0 or 1 , at the expense of the general case . where the path starting at [point] has length 0 or 1, at the expense of the general case. *) match point.link with | Info info | Link { link = Info info } -> info.descriptor | Link { link = Link _ } -> get (repr point) let rec set point v = match point.link with | Info info | Link { link = Info info } -> info.descriptor <- v | Link { link = Link _ } -> set (repr point) v * [ union point1 point2 ] merges the equivalence classes associated with [ point1 ] and [ point2 ] into a single class whose descriptor is that originally associated with [ point2 ] . It does nothing if [ point1 ] and [ point2 ] already are in the same class . The weights are used to determine whether [ point1 ] should be made to point to [ point2 ] , or vice - versa . By making the representative of the smaller class point to that of the larger class , we guarantee that paths remain of logarithmic length ( not accounting for path compression , which makes them yet smaller ) . with [point1] and [point2] into a single class whose descriptor is that originally associated with [point2]. It does nothing if [point1] and [point2] already are in the same class. The weights are used to determine whether [point1] should be made to point to [point2], or vice-versa. By making the representative of the smaller class point to that of the larger class, we guarantee that paths remain of logarithmic length (not accounting for path compression, which makes them yet smaller). *) let union point1 point2 = let point1 = repr point1 and point2 = repr point2 in if point1 != point2 then match point1.link, point2.link with | Info info1, Info info2 -> let weight1 = info1.weight and weight2 = info2.weight in if weight1 >= weight2 then begin point2.link <- Link point1; info1.weight <- weight1 + weight2; info1.descriptor <- info2.descriptor end else begin point1.link <- Link point2; info2.weight <- weight1 + weight2 end | _, _ -> assert false (* [repr] guarantees that [link] matches [Info _]. *) * [ equivalent point1 point2 ] tells whether [ point1 ] and [ point2 ] belong to the same equivalence class . belong to the same equivalence class. *) let equivalent point1 point2 = repr point1 == repr point2
null
https://raw.githubusercontent.com/LexiFi/menhir/794e64e7997d4d3f91d36dd49aaecc942ea858b7/src/unionFind.ml
ocaml
**************************************************************************** file LICENSE. **************************************************************************** * [fresh desc] creates a fresh point and returns it. It forms an equivalence class of its own, whose descriptor is [desc]. * [repr point] returns the representative element of [point]'s equivalence class. It is found by starting at [point] and following the links. For efficiency, the function performs path compression at the same time. [point''] is [point']'s representative element. Because we just invoked [repr point'], [point'.link] must be [Link point'']. We write this value into [point.link], thus performing path compression. Note that this function never performs memory allocation. * [get point] returns the descriptor associated with [point]'s equivalence class. [repr] guarantees that [link] matches [Info _].
, Paris , PPS , Université Paris Diderot . All rights reserved . This file is distributed under the terms of the GNU General Public License version 2 , as described in the * This module implements a simple and efficient union / find algorithm . See , ` ` Efficiency of a Good But Not Linear Set Union Algorithm '' , JACM 22(2 ) , 1975 . See Robert E. Tarjan, ``Efficiency of a Good But Not Linear Set Union Algorithm'', JACM 22(2), 1975. *) * The abstraction defined by this module is a set of points , partitioned into equivalence classes . With each equivalence class , a piece of information , of abstract type [ ' a ] , is associated ; we call it a descriptor . A point is implemented as a cell , whose ( mutable ) contents consist of a single link to either information about the equivalence class , or another point . Thus , points form a graph , which must be acyclic , and whose connected components are the equivalence classes . In every equivalence class , exactly one point has no outgoing edge , and carries information about the class instead . It is the class 's representative element . Information about a class consists of an integer weight ( the number of elements in the class ) and of the class 's descriptor . partitioned into equivalence classes. With each equivalence class, a piece of information, of abstract type ['a], is associated; we call it a descriptor. A point is implemented as a cell, whose (mutable) contents consist of a single link to either information about the equivalence class, or another point. Thus, points form a graph, which must be acyclic, and whose connected components are the equivalence classes. In every equivalence class, exactly one point has no outgoing edge, and carries information about the class instead. It is the class's representative element. Information about a class consists of an integer weight (the number of elements in the class) and of the class's descriptor. *) type 'a point = { mutable link: 'a link } and 'a link = | Info of 'a info | Link of 'a point and 'a info = { mutable weight: int; mutable descriptor: 'a } let fresh desc = { link = Info { weight = 1; descriptor = desc } } let rec repr point = match point.link with | Link point' -> let point'' = repr point' in if point'' != point' then point.link <- point'.link; point'' | Info _ -> point let rec get point = By not calling [ repr ] immediately , we optimize the common cases where the path starting at [ point ] has length 0 or 1 , at the expense of the general case . where the path starting at [point] has length 0 or 1, at the expense of the general case. *) match point.link with | Info info | Link { link = Info info } -> info.descriptor | Link { link = Link _ } -> get (repr point) let rec set point v = match point.link with | Info info | Link { link = Info info } -> info.descriptor <- v | Link { link = Link _ } -> set (repr point) v * [ union point1 point2 ] merges the equivalence classes associated with [ point1 ] and [ point2 ] into a single class whose descriptor is that originally associated with [ point2 ] . It does nothing if [ point1 ] and [ point2 ] already are in the same class . The weights are used to determine whether [ point1 ] should be made to point to [ point2 ] , or vice - versa . By making the representative of the smaller class point to that of the larger class , we guarantee that paths remain of logarithmic length ( not accounting for path compression , which makes them yet smaller ) . with [point1] and [point2] into a single class whose descriptor is that originally associated with [point2]. It does nothing if [point1] and [point2] already are in the same class. The weights are used to determine whether [point1] should be made to point to [point2], or vice-versa. By making the representative of the smaller class point to that of the larger class, we guarantee that paths remain of logarithmic length (not accounting for path compression, which makes them yet smaller). *) let union point1 point2 = let point1 = repr point1 and point2 = repr point2 in if point1 != point2 then match point1.link, point2.link with | Info info1, Info info2 -> let weight1 = info1.weight and weight2 = info2.weight in if weight1 >= weight2 then begin point2.link <- Link point1; info1.weight <- weight1 + weight2; info1.descriptor <- info2.descriptor end else begin point1.link <- Link point2; info2.weight <- weight1 + weight2 end | _, _ -> * [ equivalent point1 point2 ] tells whether [ point1 ] and [ point2 ] belong to the same equivalence class . belong to the same equivalence class. *) let equivalent point1 point2 = repr point1 == repr point2
04dc7f1d917e7f0dbb2acc24431da26cc816aa863d18eb118da6ddfd7af0b591
inhabitedtype/ocaml-aws
getAccessKeyInfo.mli
open Types type input = GetAccessKeyInfoRequest.t type output = GetAccessKeyInfoResponse.t type error = Errors_internal.t include Aws.Call with type input := input and type output := output and type error := error
null
https://raw.githubusercontent.com/inhabitedtype/ocaml-aws/b6d5554c5d201202b5de8d0b0253871f7b66dab6/libraries/sts/lib/getAccessKeyInfo.mli
ocaml
open Types type input = GetAccessKeyInfoRequest.t type output = GetAccessKeyInfoResponse.t type error = Errors_internal.t include Aws.Call with type input := input and type output := output and type error := error
ac60b0389c16cdc7b9ef60347587c6da7a57051eea51fc1257d2cc383d5b9304
clojure-interop/java-jdk
HTMLEditorKit$InsertHTMLTextAction.clj
(ns javax.swing.text.html.HTMLEditorKit$InsertHTMLTextAction "InsertHTMLTextAction can be used to insert an arbitrary string of HTML into an existing HTML document. At least two HTML.Tags need to be supplied. The first Tag, parentTag, identifies the parent in the document to add the elements to. The second tag, addTag, identifies the first tag that should be added to the document as seen in the HTML string. One important thing to remember, is that the parser is going to generate all the appropriate tags, even if they aren't in the HTML string passed in. For example, lets say you wanted to create an action to insert a table into the body. The parentTag would be HTML.Tag.BODY, addTag would be HTML.Tag.TABLE, and the string could be something like <table><tr><td></td></tr></table>. There is also an option to supply an alternate parentTag and addTag. These will be checked for if there is no parentTag at offset." (:refer-clojure :only [require comment defn ->]) (:import [javax.swing.text.html HTMLEditorKit$InsertHTMLTextAction])) (defn ->insert-html-text-action "Constructor. name - `java.lang.String` html - `java.lang.String` parent-tag - `javax.swing.text.html.HTML$Tag` add-tag - `javax.swing.text.html.HTML$Tag` alternate-parent-tag - `javax.swing.text.html.HTML$Tag` alternate-add-tag - `javax.swing.text.html.HTML$Tag`" (^HTMLEditorKit$InsertHTMLTextAction [^java.lang.String name ^java.lang.String html ^javax.swing.text.html.HTML$Tag parent-tag ^javax.swing.text.html.HTML$Tag add-tag ^javax.swing.text.html.HTML$Tag alternate-parent-tag ^javax.swing.text.html.HTML$Tag alternate-add-tag] (new HTMLEditorKit$InsertHTMLTextAction name html parent-tag add-tag alternate-parent-tag alternate-add-tag)) (^HTMLEditorKit$InsertHTMLTextAction [^java.lang.String name ^java.lang.String html ^javax.swing.text.html.HTML$Tag parent-tag ^javax.swing.text.html.HTML$Tag add-tag] (new HTMLEditorKit$InsertHTMLTextAction name html parent-tag add-tag))) (defn action-performed "Inserts the HTML into the document. ae - the event - `java.awt.event.ActionEvent`" ([^HTMLEditorKit$InsertHTMLTextAction this ^java.awt.event.ActionEvent ae] (-> this (.actionPerformed ae))))
null
https://raw.githubusercontent.com/clojure-interop/java-jdk/8d7a223e0f9a0965eb0332fad595cf7649d9d96e/javax.swing/src/javax/swing/text/html/HTMLEditorKit%24InsertHTMLTextAction.clj
clojure
(ns javax.swing.text.html.HTMLEditorKit$InsertHTMLTextAction "InsertHTMLTextAction can be used to insert an arbitrary string of HTML into an existing HTML document. At least two HTML.Tags need to be supplied. The first Tag, parentTag, identifies the parent in the document to add the elements to. The second tag, addTag, identifies the first tag that should be added to the document as seen in the HTML string. One important thing to remember, is that the parser is going to generate all the appropriate tags, even if they aren't in the HTML string passed in. For example, lets say you wanted to create an action to insert a table into the body. The parentTag would be HTML.Tag.BODY, addTag would be HTML.Tag.TABLE, and the string could be something like <table><tr><td></td></tr></table>. There is also an option to supply an alternate parentTag and addTag. These will be checked for if there is no parentTag at offset." (:refer-clojure :only [require comment defn ->]) (:import [javax.swing.text.html HTMLEditorKit$InsertHTMLTextAction])) (defn ->insert-html-text-action "Constructor. name - `java.lang.String` html - `java.lang.String` parent-tag - `javax.swing.text.html.HTML$Tag` add-tag - `javax.swing.text.html.HTML$Tag` alternate-parent-tag - `javax.swing.text.html.HTML$Tag` alternate-add-tag - `javax.swing.text.html.HTML$Tag`" (^HTMLEditorKit$InsertHTMLTextAction [^java.lang.String name ^java.lang.String html ^javax.swing.text.html.HTML$Tag parent-tag ^javax.swing.text.html.HTML$Tag add-tag ^javax.swing.text.html.HTML$Tag alternate-parent-tag ^javax.swing.text.html.HTML$Tag alternate-add-tag] (new HTMLEditorKit$InsertHTMLTextAction name html parent-tag add-tag alternate-parent-tag alternate-add-tag)) (^HTMLEditorKit$InsertHTMLTextAction [^java.lang.String name ^java.lang.String html ^javax.swing.text.html.HTML$Tag parent-tag ^javax.swing.text.html.HTML$Tag add-tag] (new HTMLEditorKit$InsertHTMLTextAction name html parent-tag add-tag))) (defn action-performed "Inserts the HTML into the document. ae - the event - `java.awt.event.ActionEvent`" ([^HTMLEditorKit$InsertHTMLTextAction this ^java.awt.event.ActionEvent ae] (-> this (.actionPerformed ae))))
82487bd76956b040e408f53e6e3bf1c3caa6157b51d13d3962e0cff5f411f0ca
quil-lang/magicl
shape.lisp
;;;; shapes.lisp ;;;; Author : (in-package #:magicl) ;;; Shapes ;; Predicates (declaim (inline valid-shape-p)) (defun valid-shape-p (shape) (and (typep shape 'list) (plusp (length shape)) (cl:every (lambda (x) (typep x 'alexandria:positive-fixnum)) shape))) (declaim (inline square-shape-p)) (defun square-shape-p (shape) (and (valid-shape-p shape) (apply #'cl:= shape))) (declaim (inline valid-index-p)) (defun valid-index-p (index &optional shape) (declare (notinline valid-index-p)) (if (null shape) (and (typep index 'list) (plusp (length index)) (cl:every (lambda (x) (typep x 'alexandria:non-negative-fixnum)) index)) (and (valid-index-p index) (cl:= (length index) (length shape)) (cl:every #'< index shape)))) (declaim (inline valid-matrix-index-p)) (defun valid-matrix-index-p (index &optional nrows ncols) (if (or (null nrows) (null ncols)) (and (typep index 'list) (cl:= 2 (length index)) (cl:every (lambda (x) (typep x 'alexandria:non-negative-fixnum)) index)) (and (typep index 'list) (cl:= 2 (length index)) (cl:every (lambda (x) (typep x 'alexandria:non-negative-fixnum)) index) (< (first index) nrows) (< (second index) ncols)))) ;; Types (deftype shape (&optional order) (declare (ignore order)) `(satisfies valid-shape-p)) (deftype index () `(satisfies valid-index-p)) ;; Assertions (defmacro assert-square-shape (&rest shapes) `(progn ,@(loop :for shape in shapes :collect `(assert (square-shape-p ,shape) () "The value of ~a is ~a, which is not a square SHAPE" ,(symbol-name shape) ,shape)))) (defun fixnum-to-shape (num &optional (order 2)) (make-list order :initial-element num))
null
https://raw.githubusercontent.com/quil-lang/magicl/45eae6e60329e8312496d25f1abfbf15274f4c89/src/high-level/shape.lisp
lisp
shapes.lisp Shapes Predicates Types Assertions
Author : (in-package #:magicl) (declaim (inline valid-shape-p)) (defun valid-shape-p (shape) (and (typep shape 'list) (plusp (length shape)) (cl:every (lambda (x) (typep x 'alexandria:positive-fixnum)) shape))) (declaim (inline square-shape-p)) (defun square-shape-p (shape) (and (valid-shape-p shape) (apply #'cl:= shape))) (declaim (inline valid-index-p)) (defun valid-index-p (index &optional shape) (declare (notinline valid-index-p)) (if (null shape) (and (typep index 'list) (plusp (length index)) (cl:every (lambda (x) (typep x 'alexandria:non-negative-fixnum)) index)) (and (valid-index-p index) (cl:= (length index) (length shape)) (cl:every #'< index shape)))) (declaim (inline valid-matrix-index-p)) (defun valid-matrix-index-p (index &optional nrows ncols) (if (or (null nrows) (null ncols)) (and (typep index 'list) (cl:= 2 (length index)) (cl:every (lambda (x) (typep x 'alexandria:non-negative-fixnum)) index)) (and (typep index 'list) (cl:= 2 (length index)) (cl:every (lambda (x) (typep x 'alexandria:non-negative-fixnum)) index) (< (first index) nrows) (< (second index) ncols)))) (deftype shape (&optional order) (declare (ignore order)) `(satisfies valid-shape-p)) (deftype index () `(satisfies valid-index-p)) (defmacro assert-square-shape (&rest shapes) `(progn ,@(loop :for shape in shapes :collect `(assert (square-shape-p ,shape) () "The value of ~a is ~a, which is not a square SHAPE" ,(symbol-name shape) ,shape)))) (defun fixnum-to-shape (num &optional (order 2)) (make-list order :initial-element num))
9d36e09f1e63ae2cab66edafcbfc2f38ccdb2ed9b61fd9feab92e1641a9f71b5
noinia/hgeometry
SlowSeq.hs
module Data.SlowSeq where import Control.Lens (bimap) import qualified Data . FingerTree as FT -- import Data.FingerTree hiding (null, viewl, viewr) import Data.FingerTree(ViewL(..),ViewR(..)) import qualified Data.Foldable as F import Data.Maybe import qualified Data.Sequence as S import qualified Data.Sequence.Util as SU -------------------------------------------------------------------------------- data Key a = NoKey | Key { getKey :: a } deriving (Show,Eq,Ord) instance Semigroup (Key a) where k <> NoKey = k _ <> k = k instance Monoid (Key a) where mempty = NoKey k `mappend` k' = k <> k' liftCmp :: (a -> a -> Ordering) -> Key a -> Key a -> Ordering liftCmp _ NoKey NoKey = EQ liftCmp _ NoKey (Key _) = LT liftCmp _ (Key _) NoKey = GT liftCmp cmp (Key x) (Key y) = x `cmp` y newtype Elem a = Elem { getElem : : a } deriving ( Eq , Ord , , Foldable , Functor ) -- instance Show a => Show (Elem a) where show ( ) = " Elem " < > show x newtype OrdSeq a = OrdSeq { _asSeq :: S.Seq a } deriving (Show,Eq) instance Semigroup (OrdSeq a) where (OrdSeq s) <> (OrdSeq t) = OrdSeq $ s `mappend` t instance Monoid (OrdSeq a) where mempty = OrdSeq mempty mappend = (<>) instance Foldable OrdSeq where foldMap f = foldMap f . _asSeq null = null . _asSeq length = length . _asSeq minimum = fromJust . lookupMin maximum = fromJust . lookupMax -- instance Measured (Key a) (Elem a) where measure ( ) = Key x type Compare a = a -> a -> Ordering -- | Insert into a monotone OrdSeq. -- -- pre: the comparator maintains monotonicity -- -- \(O(\log^2 n)\) insertBy :: Compare a -> a -> OrdSeq a -> OrdSeq a insertBy cmp x (OrdSeq s) = OrdSeq $ l `mappend` (x S.<| r) where (l,r) = split (\v -> cmp v x `elem` [EQ, GT]) s -- | Insert into a sorted OrdSeq -- -- \(O(\log^2 n)\) insert :: Ord a => a -> OrdSeq a -> OrdSeq a insert = insertBy compare deleteAllBy :: Compare a -> a -> OrdSeq a -> OrdSeq a deleteAllBy cmp x s = l <> r where (l,_,r) = splitBy cmp x s ( l , m ) = split ( \v - > liftCmp v ( Key x ) ` elem ` [ EQ , GT ] ) s ( _ , r ) = split ( \v - > liftCmp v ( Key x ) = = GT ) m -- | \(O(\log^2 n)\) splitBy :: Compare a -> a -> OrdSeq a -> (OrdSeq a, OrdSeq a, OrdSeq a) splitBy cmp x (OrdSeq s) = (OrdSeq l, OrdSeq m', OrdSeq r) where (l, m) = split (\v -> cmp v x `elem` [EQ,GT]) s (m',r) = split (\v -> cmp v x == GT) m HLINT ignore splitOn -- | Given a monotonic function f that maps a to b, split the sequence s -- depending on the b values. I.e. the result (l,m,r) is such that * all ( < x ) . fmap f $ l * all (= = x ) . fmap f $ m * all ( > x ) . fmap f $ r -- > > > splitOn i d 3 $ fromAscList ' [ 1 .. 5 ] ( OrdSeq { _ = fromList [ Elem 1,Elem 2]},OrdSeq { _ = fromList [ Elem 3]},OrdSeq { _ = fromList [ Elem 4,Elem 5 ] } ) > > > splitOn fst 2 $ fromAscList ' [ ( 0,"-"),(1,"A"),(2,"B"),(2,"C"),(3,"D"),(4,"E " ) ] ( OrdSeq { _ = fromList [ ( 0,"-"),Elem ( 1,"A")]},OrdSeq { _ = fromList [ ( 2,"B"),Elem ( 2,"C")]},OrdSeq { _ = fromList [ ( 3,"D"),Elem ( 4,"E " ) ] } ) -- -- \(O(\log^2 n)\) splitOn :: Ord b => (a -> b) -> b -> OrdSeq a -> (OrdSeq a, OrdSeq a, OrdSeq a) splitOn f x (OrdSeq s) = (OrdSeq l, OrdSeq m', OrdSeq r) where (l, m) = split (\v -> compare (f v) x `elem` [EQ,GT]) s (m',r) = split (\v -> compare (f v) x == GT) m | Given a monotonic predicate p , splits the sequence s into two sequences -- (as,bs) such that all (not p) as and all p bs -- -- \(O(\log^2 n)\) splitMonotonic :: (a -> Bool) -> OrdSeq a -> (OrdSeq a, OrdSeq a) splitMonotonic p = bimap OrdSeq OrdSeq . split p . _asSeq -- monotonic split for Sequences -- -- \(O(\log^2 n)\) split :: (a -> Bool) -> S.Seq a -> (S.Seq a, S.Seq a) split = SU.splitMonotone Deletes all elements from the -- -- \(O(\log^2 n)\) deleteAll :: Ord a => a -> OrdSeq a -> OrdSeq a deleteAll = deleteAllBy compare -- | inserts all eleements in order -- \(O(n\log n)\) fromListBy :: Compare a -> [a] -> OrdSeq a fromListBy cmp = foldr (insertBy cmp) mempty -- | inserts all eleements in order -- \(O(n\log n)\) fromListByOrd :: Ord a => [a] -> OrdSeq a fromListByOrd = fromListBy compare -- | O(n) fromAscList' :: [a] -> OrdSeq a fromAscList' = OrdSeq . S.fromList -- | \(O(\log^2 n)\) lookupBy :: Compare a -> a -> OrdSeq a -> Maybe a lookupBy cmp x s = let (_,m,_) = splitBy cmp x s in listToMaybe . F.toList $ m memberBy :: Compare a -> a -> OrdSeq a -> Bool memberBy cmp x = isJust . lookupBy cmp x -- | Fmap, assumes the order does not change -- \(O(n)\) mapMonotonic :: (a -> b) -> OrdSeq a -> OrdSeq b mapMonotonic f = fromAscList' . map f . F.toList | Gets the first element from the sequence -- \(O(1)\) viewl :: OrdSeq a -> ViewL OrdSeq a viewl = f . S.viewl . _asSeq where f S.EmptyL = EmptyL f (x S.:< s) = x :< OrdSeq s -- Last element -- \(O(1)\) viewr :: OrdSeq a -> ViewR OrdSeq a viewr = f . S.viewr . _asSeq where f S.EmptyR = EmptyR f (s S.:> x) = OrdSeq s :> x -- \(O(1)\) minView :: OrdSeq a -> Maybe (a, OrdSeq a) minView s = case viewl s of EmptyL -> Nothing (x :< t) -> Just (x,t) -- \(O(1)\) lookupMin :: OrdSeq a -> Maybe a lookupMin = fmap fst . minView -- \(O(1)\) maxView :: OrdSeq a -> Maybe (a, OrdSeq a) maxView s = case viewr s of EmptyR -> Nothing (t :> x) -> Just (x,t) -- \(O(1)\) lookupMax :: OrdSeq a -> Maybe a lookupMax = fmap fst . maxView
null
https://raw.githubusercontent.com/noinia/hgeometry/a6abecb1ce4a7fd96b25cc1a5c65cd4257ecde7a/hgeometry-old/remove-by-2021-06-01/src/Data/SlowSeq.hs
haskell
import Data.FingerTree hiding (null, viewl, viewr) ------------------------------------------------------------------------------ instance Show a => Show (Elem a) where instance Measured (Key a) (Elem a) where | Insert into a monotone OrdSeq. pre: the comparator maintains monotonicity \(O(\log^2 n)\) | Insert into a sorted OrdSeq \(O(\log^2 n)\) | \(O(\log^2 n)\) | Given a monotonic function f that maps a to b, split the sequence s depending on the b values. I.e. the result (l,m,r) is such that \(O(\log^2 n)\) (as,bs) such that all (not p) as and all p bs \(O(\log^2 n)\) monotonic split for Sequences \(O(\log^2 n)\) \(O(\log^2 n)\) | inserts all eleements in order \(O(n\log n)\) | inserts all eleements in order \(O(n\log n)\) | O(n) | \(O(\log^2 n)\) | Fmap, assumes the order does not change \(O(n)\) \(O(1)\) Last element \(O(1)\) \(O(1)\) \(O(1)\) \(O(1)\) \(O(1)\)
module Data.SlowSeq where import Control.Lens (bimap) import qualified Data . FingerTree as FT import Data.FingerTree(ViewL(..),ViewR(..)) import qualified Data.Foldable as F import Data.Maybe import qualified Data.Sequence as S import qualified Data.Sequence.Util as SU data Key a = NoKey | Key { getKey :: a } deriving (Show,Eq,Ord) instance Semigroup (Key a) where k <> NoKey = k _ <> k = k instance Monoid (Key a) where mempty = NoKey k `mappend` k' = k <> k' liftCmp :: (a -> a -> Ordering) -> Key a -> Key a -> Ordering liftCmp _ NoKey NoKey = EQ liftCmp _ NoKey (Key _) = LT liftCmp _ (Key _) NoKey = GT liftCmp cmp (Key x) (Key y) = x `cmp` y newtype Elem a = Elem { getElem : : a } deriving ( Eq , Ord , , Foldable , Functor ) show ( ) = " Elem " < > show x newtype OrdSeq a = OrdSeq { _asSeq :: S.Seq a } deriving (Show,Eq) instance Semigroup (OrdSeq a) where (OrdSeq s) <> (OrdSeq t) = OrdSeq $ s `mappend` t instance Monoid (OrdSeq a) where mempty = OrdSeq mempty mappend = (<>) instance Foldable OrdSeq where foldMap f = foldMap f . _asSeq null = null . _asSeq length = length . _asSeq minimum = fromJust . lookupMin maximum = fromJust . lookupMax measure ( ) = Key x type Compare a = a -> a -> Ordering insertBy :: Compare a -> a -> OrdSeq a -> OrdSeq a insertBy cmp x (OrdSeq s) = OrdSeq $ l `mappend` (x S.<| r) where (l,r) = split (\v -> cmp v x `elem` [EQ, GT]) s insert :: Ord a => a -> OrdSeq a -> OrdSeq a insert = insertBy compare deleteAllBy :: Compare a -> a -> OrdSeq a -> OrdSeq a deleteAllBy cmp x s = l <> r where (l,_,r) = splitBy cmp x s ( l , m ) = split ( \v - > liftCmp v ( Key x ) ` elem ` [ EQ , GT ] ) s ( _ , r ) = split ( \v - > liftCmp v ( Key x ) = = GT ) m splitBy :: Compare a -> a -> OrdSeq a -> (OrdSeq a, OrdSeq a, OrdSeq a) splitBy cmp x (OrdSeq s) = (OrdSeq l, OrdSeq m', OrdSeq r) where (l, m) = split (\v -> cmp v x `elem` [EQ,GT]) s (m',r) = split (\v -> cmp v x == GT) m HLINT ignore splitOn * all ( < x ) . fmap f $ l * all (= = x ) . fmap f $ m * all ( > x ) . fmap f $ r > > > splitOn i d 3 $ fromAscList ' [ 1 .. 5 ] ( OrdSeq { _ = fromList [ Elem 1,Elem 2]},OrdSeq { _ = fromList [ Elem 3]},OrdSeq { _ = fromList [ Elem 4,Elem 5 ] } ) > > > splitOn fst 2 $ fromAscList ' [ ( 0,"-"),(1,"A"),(2,"B"),(2,"C"),(3,"D"),(4,"E " ) ] ( OrdSeq { _ = fromList [ ( 0,"-"),Elem ( 1,"A")]},OrdSeq { _ = fromList [ ( 2,"B"),Elem ( 2,"C")]},OrdSeq { _ = fromList [ ( 3,"D"),Elem ( 4,"E " ) ] } ) splitOn :: Ord b => (a -> b) -> b -> OrdSeq a -> (OrdSeq a, OrdSeq a, OrdSeq a) splitOn f x (OrdSeq s) = (OrdSeq l, OrdSeq m', OrdSeq r) where (l, m) = split (\v -> compare (f v) x `elem` [EQ,GT]) s (m',r) = split (\v -> compare (f v) x == GT) m | Given a monotonic predicate p , splits the sequence s into two sequences splitMonotonic :: (a -> Bool) -> OrdSeq a -> (OrdSeq a, OrdSeq a) splitMonotonic p = bimap OrdSeq OrdSeq . split p . _asSeq split :: (a -> Bool) -> S.Seq a -> (S.Seq a, S.Seq a) split = SU.splitMonotone Deletes all elements from the deleteAll :: Ord a => a -> OrdSeq a -> OrdSeq a deleteAll = deleteAllBy compare fromListBy :: Compare a -> [a] -> OrdSeq a fromListBy cmp = foldr (insertBy cmp) mempty fromListByOrd :: Ord a => [a] -> OrdSeq a fromListByOrd = fromListBy compare fromAscList' :: [a] -> OrdSeq a fromAscList' = OrdSeq . S.fromList lookupBy :: Compare a -> a -> OrdSeq a -> Maybe a lookupBy cmp x s = let (_,m,_) = splitBy cmp x s in listToMaybe . F.toList $ m memberBy :: Compare a -> a -> OrdSeq a -> Bool memberBy cmp x = isJust . lookupBy cmp x mapMonotonic :: (a -> b) -> OrdSeq a -> OrdSeq b mapMonotonic f = fromAscList' . map f . F.toList | Gets the first element from the sequence viewl :: OrdSeq a -> ViewL OrdSeq a viewl = f . S.viewl . _asSeq where f S.EmptyL = EmptyL f (x S.:< s) = x :< OrdSeq s viewr :: OrdSeq a -> ViewR OrdSeq a viewr = f . S.viewr . _asSeq where f S.EmptyR = EmptyR f (s S.:> x) = OrdSeq s :> x minView :: OrdSeq a -> Maybe (a, OrdSeq a) minView s = case viewl s of EmptyL -> Nothing (x :< t) -> Just (x,t) lookupMin :: OrdSeq a -> Maybe a lookupMin = fmap fst . minView maxView :: OrdSeq a -> Maybe (a, OrdSeq a) maxView s = case viewr s of EmptyR -> Nothing (t :> x) -> Just (x,t) lookupMax :: OrdSeq a -> Maybe a lookupMax = fmap fst . maxView
e02af7dddbe35e0c3c8357b94767d863dba30370553e2ed43de0d60d4f5099ae
maximedenes/native-coq
fourier.ml
(************************************************************************) v * The Coq Proof Assistant / The Coq Development Team < O _ _ _ , , * INRIA - CNRS - LIX - LRI - PPS - Copyright 1999 - 2010 \VV/ * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * (* // * This file is distributed under the terms of the *) (* * GNU Lesser General Public License Version 2.1 *) (************************************************************************) (* Méthode d'élimination de Fourier *) Référence : Auteur(s ) : Fourier , Titre(s ) : Oeuvres de Fourier [ Document électronique ] . second . Mémoires publiés dans divers recueils / publ . par les soins de M. Gaston Darboux , ... Publication : Numérisation BnF de l'édition de Paris : , 1890 Pages : 326 - 327 / Auteur(s) : Fourier, Jean-Baptiste-Joseph Titre(s) : Oeuvres de Fourier [Document électronique]. Tome second. Mémoires publiés dans divers recueils / publ. par les soins de M. Gaston Darboux,... Publication : Numérisation BnF de l'édition de Paris : Gauthier-Villars, 1890 Pages: 326-327 / *) Un peu de calcul sur les rationnels ... Les opérations rendent des , i.e. le numérateur et le dénominateur sont premiers entre eux . Les opérations rendent des rationnels normalisés, i.e. le numérateur et le dénominateur sont premiers entre eux. *) type rational = {num:int; den:int} ;; let print_rational x = print_int x.num; print_string "/"; print_int x.den ;; let rec pgcd x y = if y = 0 then x else pgcd y (x mod y);; let r0 = {num=0;den=1};; let r1 = {num=1;den=1};; let rnorm x = let x = (if x.den<0 then {num=(-x.num);den=(-x.den)} else x) in if x.num=0 then r0 else (let d=pgcd x.num x.den in let d= (if d<0 then -d else d) in {num=(x.num)/d;den=(x.den)/d});; let rop x = rnorm {num=(-x.num);den=x.den};; let rplus x y = rnorm {num=x.num*y.den + y.num*x.den;den=x.den*y.den};; let rminus x y = rnorm {num=x.num*y.den - y.num*x.den;den=x.den*y.den};; let rmult x y = rnorm {num=x.num*y.num;den=x.den*y.den};; let rinv x = rnorm {num=x.den;den=x.num};; let rdiv x y = rnorm {num=x.num*y.den;den=x.den*y.num};; let rinf x y = x.num*y.den < y.num*x.den;; let rinfeq x y = x.num*y.den <= y.num*x.den;; { coef;hist;strict } , où coef=[c1 ; ... ; cn ; d ] , représente l'inéquation c1x1+ ... +cnxn < d si strict = true , < = sinon , hist donnant les coefficients ( positifs ) d'une . c1x1+...+cnxn < d si strict=true, <= sinon, hist donnant les coefficients (positifs) d'une combinaison linéaire qui permet d'obtenir l'inéquation à partir de celles du départ. *) type ineq = {coef:rational list; hist:rational list; strict:bool};; let pop x l = l:=x::(!l);; sépare la liste d'inéquations s selon que leur premier coefficient est ou positif . négatif, nul ou positif. *) let partitionne s = let lpos=ref [] in let lneg=ref [] in let lnul=ref [] in List.iter (fun ie -> match ie.coef with [] -> raise (Failure "empty ineq") |(c::r) -> if rinf c r0 then pop ie lneg else if rinf r0 c then pop ie lpos else pop ie lnul) s; [!lneg;!lnul;!lpos] ;; initialise les histoires d'une liste d'inéquations données par leurs listes de coefficients et leurs strictitudes ( ! ): ( add_hist [ ( equation 1 , s1); ... ;(équation n , sn ) ] ) = [ { équation 1 , [ 1;0; ... ] , s1 } ; { équation 2 , [ 0;1; ... ] , s2 } ; ... { équation n , [ 0;0; ... ;1 ] , sn } ] (add_hist [(equation 1, s1);...;(équation n, sn)]) = [{équation 1, [1;0;...;0], s1}; {équation 2, [0;1;...;0], s2}; ... {équation n, [0;0;...;1], sn}] *) let add_hist le = let n = List.length le in let i=ref 0 in List.map (fun (ie,s) -> let h =ref [] in for k=1 to (n-(!i)-1) do pop r0 h; done; pop r1 h; for k=1 to !i do pop r0 h; done; i:=!i+1; {coef=ie;hist=(!h);strict=s}) le ;; (* additionne deux inéquations *) let ie_add ie1 ie2 = {coef=List.map2 rplus ie1.coef ie2.coef; hist=List.map2 rplus ie1.hist ie2.hist; strict=ie1.strict || ie2.strict} ;; (* multiplication d'une inéquation par un rationnel (positif) *) let ie_emult a ie = {coef=List.map (fun x -> rmult a x) ie.coef; hist=List.map (fun x -> rmult a x) ie.hist; strict= ie.strict} ;; on enlève le premier coefficient let ie_tl ie = {coef=List.tl ie.coef;hist=ie.hist;strict=ie.strict} ;; le premier coefficient : " tête " de l'inéquation let hd_coef ie = List.hd ie.coef ;; calcule toutes les combinaisons entre inéquations de tête négative et inéquations de tête positive premier coefficient . *) let deduce_add lneg lpos = let res=ref [] in List.iter (fun i1 -> List.iter (fun i2 -> let a = rop (hd_coef i1) in let b = hd_coef i2 in pop (ie_tl (ie_add (ie_emult b i1) (ie_emult a i2))) res) lpos) lneg; !res ;; (* élimination de la première variable à partir d'une liste d'inéquations: opération qu'on itère dans l'algorithme de Fourier. *) let deduce1 s = match (partitionne s) with [lneg;lnul;lpos] -> let lnew = deduce_add lneg lpos in (List.map ie_tl lnul)@lnew |_->assert false ;; algorithme de Fourier : on élimine successivement toutes les variables . *) let deduce lie = let n = List.length (fst (List.hd lie)) in let lie=ref (add_hist lie) in for i=1 to n-1 do lie:= deduce1 !lie; done; !lie ;; donne [ ] si le système a des solutions , sinon donne [ c , s , lc ] où lc est la des inéquations de départ qui donne 0 < c si s = true ou 0 < = c sinon cette inéquation étant . sinon donne [c,s,lc] où lc est la combinaison linéaire des inéquations de départ qui donne 0 < c si s=true ou 0 <= c sinon cette inéquation étant absurde. *) let unsolvable lie = let lr = deduce lie in let res = ref [] in (try (List.iter (fun e -> match e with {coef=[c];hist=lc;strict=s} -> if (rinf c r0 && (not s)) || (rinfeq c r0 && s) then (res := [c,s,lc]; raise (Failure "contradiction found")) |_->assert false) lr) with _ -> ()); !res ;; Exemples : let test1=[[r1;r1;r0],true;[rop r1;r1;r1],false;[r0;rop r1;rop r1],false ] ; ; deduce ; ; unsolvable ; ; let test2= [ [ r1;r1;r0;r0;r0],false ; [ r0;r1;r1;r0;r0],false ; [ r0;r0;r1;r1;r0],false ; [ r0;r0;r0;r1;r1],false ; [ r1;r0;r0;r0;r1],false ; [ rop r1;rop r1;r0;r0;r0],false ; [ r0;rop r1;rop r1;r0;r0],false ; [ r0;r0;rop r1;rop r1;r0],false ; [ r0;r0;r0;rop r1;rop r1],false ; [ rop r1;r0;r0;r0;rop r1],false ] ; ; deduce test2 ; ; unsolvable test2 ; ; let test1=[[r1;r1;r0],true;[rop r1;r1;r1],false;[r0;rop r1;rop r1],false];; deduce test1;; unsolvable test1;; let test2=[ [r1;r1;r0;r0;r0],false; [r0;r1;r1;r0;r0],false; [r0;r0;r1;r1;r0],false; [r0;r0;r0;r1;r1],false; [r1;r0;r0;r0;r1],false; [rop r1;rop r1;r0;r0;r0],false; [r0;rop r1;rop r1;r0;r0],false; [r0;r0;rop r1;rop r1;r0],false; [r0;r0;r0;rop r1;rop r1],false; [rop r1;r0;r0;r0;rop r1],false ];; deduce test2;; unsolvable test2;; *)
null
https://raw.githubusercontent.com/maximedenes/native-coq/3623a4d9fe95c165f02f7119c0e6564a83a9f4c9/plugins/fourier/fourier.ml
ocaml
********************************************************************** // * This file is distributed under the terms of the * GNU Lesser General Public License Version 2.1 ********************************************************************** Méthode d'élimination de Fourier additionne deux inéquations multiplication d'une inéquation par un rationnel (positif) élimination de la première variable à partir d'une liste d'inéquations: opération qu'on itère dans l'algorithme de Fourier.
v * The Coq Proof Assistant / The Coq Development Team < O _ _ _ , , * INRIA - CNRS - LIX - LRI - PPS - Copyright 1999 - 2010 \VV/ * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Référence : Auteur(s ) : Fourier , Titre(s ) : Oeuvres de Fourier [ Document électronique ] . second . Mémoires publiés dans divers recueils / publ . par les soins de M. Gaston Darboux , ... Publication : Numérisation BnF de l'édition de Paris : , 1890 Pages : 326 - 327 / Auteur(s) : Fourier, Jean-Baptiste-Joseph Titre(s) : Oeuvres de Fourier [Document électronique]. Tome second. Mémoires publiés dans divers recueils / publ. par les soins de M. Gaston Darboux,... Publication : Numérisation BnF de l'édition de Paris : Gauthier-Villars, 1890 Pages: 326-327 / *) Un peu de calcul sur les rationnels ... Les opérations rendent des , i.e. le numérateur et le dénominateur sont premiers entre eux . Les opérations rendent des rationnels normalisés, i.e. le numérateur et le dénominateur sont premiers entre eux. *) type rational = {num:int; den:int} ;; let print_rational x = print_int x.num; print_string "/"; print_int x.den ;; let rec pgcd x y = if y = 0 then x else pgcd y (x mod y);; let r0 = {num=0;den=1};; let r1 = {num=1;den=1};; let rnorm x = let x = (if x.den<0 then {num=(-x.num);den=(-x.den)} else x) in if x.num=0 then r0 else (let d=pgcd x.num x.den in let d= (if d<0 then -d else d) in {num=(x.num)/d;den=(x.den)/d});; let rop x = rnorm {num=(-x.num);den=x.den};; let rplus x y = rnorm {num=x.num*y.den + y.num*x.den;den=x.den*y.den};; let rminus x y = rnorm {num=x.num*y.den - y.num*x.den;den=x.den*y.den};; let rmult x y = rnorm {num=x.num*y.num;den=x.den*y.den};; let rinv x = rnorm {num=x.den;den=x.num};; let rdiv x y = rnorm {num=x.num*y.den;den=x.den*y.num};; let rinf x y = x.num*y.den < y.num*x.den;; let rinfeq x y = x.num*y.den <= y.num*x.den;; { coef;hist;strict } , où coef=[c1 ; ... ; cn ; d ] , représente l'inéquation c1x1+ ... +cnxn < d si strict = true , < = sinon , hist donnant les coefficients ( positifs ) d'une . c1x1+...+cnxn < d si strict=true, <= sinon, hist donnant les coefficients (positifs) d'une combinaison linéaire qui permet d'obtenir l'inéquation à partir de celles du départ. *) type ineq = {coef:rational list; hist:rational list; strict:bool};; let pop x l = l:=x::(!l);; sépare la liste d'inéquations s selon que leur premier coefficient est ou positif . négatif, nul ou positif. *) let partitionne s = let lpos=ref [] in let lneg=ref [] in let lnul=ref [] in List.iter (fun ie -> match ie.coef with [] -> raise (Failure "empty ineq") |(c::r) -> if rinf c r0 then pop ie lneg else if rinf r0 c then pop ie lpos else pop ie lnul) s; [!lneg;!lnul;!lpos] ;; initialise les histoires d'une liste d'inéquations données par leurs listes de coefficients et leurs strictitudes ( ! ): ( add_hist [ ( equation 1 , s1); ... ;(équation n , sn ) ] ) = [ { équation 1 , [ 1;0; ... ] , s1 } ; { équation 2 , [ 0;1; ... ] , s2 } ; ... { équation n , [ 0;0; ... ;1 ] , sn } ] (add_hist [(equation 1, s1);...;(équation n, sn)]) = [{équation 1, [1;0;...;0], s1}; {équation 2, [0;1;...;0], s2}; ... {équation n, [0;0;...;1], sn}] *) let add_hist le = let n = List.length le in let i=ref 0 in List.map (fun (ie,s) -> let h =ref [] in for k=1 to (n-(!i)-1) do pop r0 h; done; pop r1 h; for k=1 to !i do pop r0 h; done; i:=!i+1; {coef=ie;hist=(!h);strict=s}) le ;; let ie_add ie1 ie2 = {coef=List.map2 rplus ie1.coef ie2.coef; hist=List.map2 rplus ie1.hist ie2.hist; strict=ie1.strict || ie2.strict} ;; let ie_emult a ie = {coef=List.map (fun x -> rmult a x) ie.coef; hist=List.map (fun x -> rmult a x) ie.hist; strict= ie.strict} ;; on enlève le premier coefficient let ie_tl ie = {coef=List.tl ie.coef;hist=ie.hist;strict=ie.strict} ;; le premier coefficient : " tête " de l'inéquation let hd_coef ie = List.hd ie.coef ;; calcule toutes les combinaisons entre inéquations de tête négative et inéquations de tête positive premier coefficient . *) let deduce_add lneg lpos = let res=ref [] in List.iter (fun i1 -> List.iter (fun i2 -> let a = rop (hd_coef i1) in let b = hd_coef i2 in pop (ie_tl (ie_add (ie_emult b i1) (ie_emult a i2))) res) lpos) lneg; !res ;; let deduce1 s = match (partitionne s) with [lneg;lnul;lpos] -> let lnew = deduce_add lneg lpos in (List.map ie_tl lnul)@lnew |_->assert false ;; algorithme de Fourier : on élimine successivement toutes les variables . *) let deduce lie = let n = List.length (fst (List.hd lie)) in let lie=ref (add_hist lie) in for i=1 to n-1 do lie:= deduce1 !lie; done; !lie ;; donne [ ] si le système a des solutions , sinon donne [ c , s , lc ] où lc est la des inéquations de départ qui donne 0 < c si s = true ou 0 < = c sinon cette inéquation étant . sinon donne [c,s,lc] où lc est la combinaison linéaire des inéquations de départ qui donne 0 < c si s=true ou 0 <= c sinon cette inéquation étant absurde. *) let unsolvable lie = let lr = deduce lie in let res = ref [] in (try (List.iter (fun e -> match e with {coef=[c];hist=lc;strict=s} -> if (rinf c r0 && (not s)) || (rinfeq c r0 && s) then (res := [c,s,lc]; raise (Failure "contradiction found")) |_->assert false) lr) with _ -> ()); !res ;; Exemples : let test1=[[r1;r1;r0],true;[rop r1;r1;r1],false;[r0;rop r1;rop r1],false ] ; ; deduce ; ; unsolvable ; ; let test2= [ [ r1;r1;r0;r0;r0],false ; [ r0;r1;r1;r0;r0],false ; [ r0;r0;r1;r1;r0],false ; [ r0;r0;r0;r1;r1],false ; [ r1;r0;r0;r0;r1],false ; [ rop r1;rop r1;r0;r0;r0],false ; [ r0;rop r1;rop r1;r0;r0],false ; [ r0;r0;rop r1;rop r1;r0],false ; [ r0;r0;r0;rop r1;rop r1],false ; [ rop r1;r0;r0;r0;rop r1],false ] ; ; deduce test2 ; ; unsolvable test2 ; ; let test1=[[r1;r1;r0],true;[rop r1;r1;r1],false;[r0;rop r1;rop r1],false];; deduce test1;; unsolvable test1;; let test2=[ [r1;r1;r0;r0;r0],false; [r0;r1;r1;r0;r0],false; [r0;r0;r1;r1;r0],false; [r0;r0;r0;r1;r1],false; [r1;r0;r0;r0;r1],false; [rop r1;rop r1;r0;r0;r0],false; [r0;rop r1;rop r1;r0;r0],false; [r0;r0;rop r1;rop r1;r0],false; [r0;r0;r0;rop r1;rop r1],false; [rop r1;r0;r0;r0;rop r1],false ];; deduce test2;; unsolvable test2;; *)