_id stringlengths 64 64 | repository stringlengths 6 84 | name stringlengths 4 110 | content stringlengths 0 248k | license null | download_url stringlengths 89 454 | language stringclasses 7
values | comments stringlengths 0 74.6k | code stringlengths 0 248k |
|---|---|---|---|---|---|---|---|---|
010ac73c3b4c7c15e14921033335ec8ea8d3ed0ad3c80ae9783d7648e9d721a8 | Clozure/ccl | x86-error-signal.lisp | ;;;
Copyright 2005 - 2009 Clozure Associates
;;;
Licensed under the Apache License , Version 2.0 ( the " License " ) ;
;;; you may not use this file except in compliance with the License.
;;; You may obtain a copy of the License at
;;;
;;; -2.0
;;;
;;; Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an " AS IS " BASIS ,
;;; WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
;;; See the License for the specific language governing permissions and
;;; limitations under the License.
(in-package "CCL")
#+x8664-target
(defun xp-argument-count (xp)
(ldb (byte (- 16 x8664::fixnumshift) 0)
(encoded-gpr-lisp xp x8664::nargs.q)))
#+x8632-target
(defun xp-argument-count (xp)
(encoded-gpr-lisp xp target::nargs))
#+x8664-target
(defun xp-argument-list (xp)
(let ((nargs (xp-argument-count xp))
(arg-x (encoded-gpr-lisp xp x8664::arg_x))
(arg-y (encoded-gpr-lisp xp x8664::arg_y))
(arg-z (encoded-gpr-lisp xp x8664::arg_z)))
(cond ((eql nargs 0) nil)
((eql nargs 1) (list arg-z))
((eql nargs 2) (list arg-y arg-z))
(t
(let ((args (list arg-x arg-y arg-z)))
(if (eql nargs 3)
args
(let ((sp (%inc-ptr (encoded-gpr-macptr xp x8664::rsp)
(+ x8664::node-size x8664::xcf.size))))
(dotimes (i (- nargs 3))
(push (%get-object sp (* i x8664::node-size)) args))
args)))))))
#+x8632-target
(defun xp-argument-list (xp)
(let ((nargs (xp-argument-count xp))
(arg-y (encoded-gpr-lisp xp x8632::arg_y))
(arg-z (encoded-gpr-lisp xp x8632::arg_z)))
(cond ((eql nargs 0) nil)
((eql nargs 1) (list arg-z))
(t
(let ((args (list arg-y arg-z)))
(if (eql nargs 2)
args
(let ((sp (%inc-ptr (encoded-gpr-macptr xp x8632::ebp)
(+ x8632::node-size x8632::xcf.size))))
(dotimes (i (- nargs 2))
(push (%get-object sp (* i x8632::node-size)) args))
args)))))))
Making this be continuable is hard , because of the xcf on the
;;; stack and the way that the kernel saves/restores rsp and rbp
;;; before calling out. If we get around those problems, then
;;; we have to also deal with the fact that the return address
;;; is on the stack. Easiest to make the kernel deal with that,
;;; and just set %fn to the function that returns the values
;;; returned by the (newly defined) function and %arg_z to
;;; that list of values.
(defun handle-udf-call (xp frame-ptr)
(let* ((args (xp-argument-list xp))
(values (multiple-value-list
(%kernel-restart-internal
$xudfcall
(list (maybe-setf-name (encoded-gpr-lisp xp target::fname)) args)
frame-ptr)))
(f #'(lambda (values) (apply #'values values))))
(setf (encoded-gpr-lisp xp target::arg_z) values
(encoded-gpr-lisp xp target::fn) f)))
#+x8664-target
(defcallback %xerr-disp (:address xp :address xcf :int)
(with-error-reentry-detection
(let* ((frame-ptr (macptr->fixnum xcf))
(fn (%get-object xcf x8664::xcf.nominal-function))
(op0 (%get-xcf-byte xcf 0))
(op1 (%get-xcf-byte xcf 1))
(op2 (%get-xcf-byte xcf 2)))
(declare (type (unsigned-byte 8) op0 op1 op2))
(let* ((skip 2))
(if (and (= op0 #xcd)
(>= op1 #x70))
(cond ((< op1 #x90)
(setq skip (%check-anchored-uuo xcf 3))
(setq *error-reentry-count* 0)
(setf (encoded-gpr-lisp xp (ldb (byte 4 0) op1))
(%slot-unbound-trap
(encoded-gpr-lisp xp (ldb (byte 4 4) op2))
(encoded-gpr-lisp xp (ldb (byte 4 0) op2))
frame-ptr)))
((= op1 #x90)
(setq skip (%check-anchored-uuo xcf 3))
(setf (encoded-gpr-lisp xp (ldb (byte 4 4) op2))
(%kernel-restart-internal $xvunbnd
(list
(encoded-gpr-lisp
xp
(ldb (byte 4 0) op2)))
frame-ptr)))
((< op1 #xa0)
(setq skip (%check-anchored-uuo xcf 2))
;; #x9x, x>0 - register X is a symbol. It's unbound,
but we do n't have enough info to offer USE - VALUE ,
STORE - VALUE , or CONTINUE restarts .
(%error (make-condition 'unbound-variable
:name
(encoded-gpr-lisp
xp
(ldb (byte 4 0) op1)))
()
frame-ptr))
((< op1 #xb0)
(setq skip (%check-anchored-uuo xcf 2))
(%err-disp-internal $xfunbnd
(list (encoded-gpr-lisp
xp
(ldb (byte 4 0) op1)))
frame-ptr))
((< op1 #xc0)
(setq skip (%check-anchored-uuo xcf 3))
(%err-disp-internal
#.(car (rassoc 'type-error *kernel-simple-error-classes*))
(list (encoded-gpr-lisp
xp
(ldb (byte 4 0) op1))
(logandc2 op2 arch::error-type-error))
frame-ptr))
((= op1 #xc0)
(setq skip (%check-anchored-uuo xcf 2))
(%error 'too-few-arguments
(list :nargs (xp-argument-count xp)
:fn fn)
frame-ptr))
((= op1 #xc1)
(setq skip (%check-anchored-uuo xcf 2))
(%error 'too-many-arguments
(list :nargs (xp-argument-count xp)
:fn fn)
frame-ptr))
((= op1 #xc2)
(setq skip (%check-anchored-uuo xcf 2))
(let* ((flags (xp-flags-register xp))
(nargs (xp-argument-count xp))
(carry-bit (logbitp x86::x86-carry-flag-bit flags)))
(if carry-bit
(%error 'too-few-arguments
(list :nargs nargs
:fn fn)
frame-ptr)
(%error 'too-many-arguments
(list :nargs nargs
:fn fn)
frame-ptr))))
((= op1 #xc3) ;array rank
(setq skip (%check-anchored-uuo xcf 3))
(%err-disp-internal $XNDIMS
(list (encoded-gpr-lisp xp (ldb (byte 4 4) op2))
(encoded-gpr-lisp xp (ldb (byte 4 0) op2)))
frame-ptr))
((= op1 #xc6)
(setq skip (%check-anchored-uuo xcf 2))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp xp x8664::temp0)
:expected-type '(or symbol function)
:format-control
"~S is not of type ~S, and can't be FUNCALLed or APPLYed")
nil frame-ptr))
((= op1 #xc7)
(handle-udf-call xp frame-ptr)
(setq skip 0))
((or (= op1 #xc8) (= op1 #xcb))
(setq skip (%check-anchored-uuo xcf 3))
(%error (%rsc-string $xarroob)
(list (encoded-gpr-lisp xp (ldb (byte 4 4) op2))
(encoded-gpr-lisp xp (ldb (byte 4 0) op2)))
frame-ptr))
((= op1 #xc9)
(setq skip (%check-anchored-uuo xcf 2))
(%err-disp-internal $xnotfun
(list (encoded-gpr-lisp xp x8664::temp0))
frame-ptr))
;; #xca = uuo-error-debug-trap
((= op1 #xcc)
;; external entry point or foreign variable
(setq skip (%check-anchored-uuo xcf 3))
(let* ((eep-or-fv (encoded-gpr-lisp xp (ldb (byte 4 4) op2))))
(etypecase eep-or-fv
(external-entry-point
(resolve-eep eep-or-fv)
(setf (encoded-gpr-lisp xp (ldb (byte 4 0) op2))
(eep.address eep-or-fv)))
(foreign-variable
(resolve-foreign-variable eep-or-fv)
(setf (encoded-gpr-lisp xp (ldb (byte 4 0) op2))
(fv.addr eep-or-fv))))))
((< op1 #xe0)
(setq skip (%check-anchored-uuo xcf 3))
(if (= op2 x8664::subtag-catch-frame)
(%error (make-condition 'cant-throw-error
:tag (encoded-gpr-lisp
xp
(ldb (byte 4 0) op1)))
nil frame-ptr)
(let* ((typename
(cond ((= op2 x8664::tag-fixnum) 'fixnum)
((= op2 x8664::tag-single-float) 'single-float)
((= op2 x8664::subtag-character) 'character)
((= op2 x8664::fulltag-cons) 'cons)
((= op2 x8664::tag-misc) 'uvector)
((= op2 x8664::fulltag-symbol) 'symbol)
((= op2 x8664::fulltag-function) 'function)
(t (let* ((class (logand op2 x8664::fulltagmask))
(high4 (ash op2 (- x8664::ntagbits))))
(cond ((= class x8664::fulltag-nodeheader-0)
(svref *nodeheader-0-types* high4))
((= class x8664::fulltag-nodeheader-1)
(svref *nodeheader-1-types* high4))
((= class x8664::fulltag-immheader-0)
(svref *immheader-0-types* high4))
((= class x8664::fulltag-immheader-1)
(svref *immheader-1-types* high4))
((= class x8664::fulltag-immheader-2)
(svref *immheader-2-types* high4))
(t (list 'bogus op2))))))))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp
xp
(ldb (byte 4 0) op1))
:expected-type typename)
nil
frame-ptr))))
((< op1 #xf0)
(setq skip (%check-anchored-uuo xcf 2))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp
xp
(ldb (byte 4 0) op1))
:expected-type 'list)
nil
frame-ptr))
(t
(setq skip (%check-anchored-uuo xcf 2))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp
xp
(ldb (byte 4 0) op1))
:expected-type 'fixnum)
nil
frame-ptr)))
(%error "Unknown trap: #x~x~%xp=~s"
(list (list op0 op1 op2) xp)
frame-ptr))
skip))))
;;; lots of duplicated code here
#+x8632-target
(defcallback %xerr-disp (:address xp :address xcf :int)
(with-error-reentry-detection
(let* ((frame-ptr (macptr->fixnum xcf))
(fn (%get-object xcf x8632::xcf.nominal-function))
(op0 (%get-xcf-byte xcf 0))
(op1 (%get-xcf-byte xcf 1))
(op2 (%get-xcf-byte xcf 2)))
(declare (type (unsigned-byte 8) op0 op1 op2))
(let* ((skip 2))
(if (and (= op0 #xcd)
(>= op1 #x70))
(cond ((< op1 #x90)
(setq skip (%check-anchored-uuo xcf 3))
(setq *error-reentry-count* 0)
(setf (encoded-gpr-lisp xp (ldb (byte 3 0) op1))
(%slot-unbound-trap
(encoded-gpr-lisp xp (ldb (byte 4 4) op2))
(encoded-gpr-lisp xp (ldb (byte 4 0) op2))
frame-ptr)))
((= op1 #x90)
(setq skip (%check-anchored-uuo xcf 3))
(setf (encoded-gpr-lisp
xp
(ldb (byte 3 0) op2))
(%kernel-restart-internal $xvunbnd
(list
(encoded-gpr-lisp
xp
(ldb (byte 3 0) op2)))
frame-ptr)))
((< op1 #xa0)
(setq skip (%check-anchored-uuo xcf 2))
;; #x9x, x>- - register X is a symbol. It's unbound,
but we do n't have enough info to offer USE - VALUE ,
STORE - VALUE , or CONTINUE restart
(%error (make-condition 'unbound-variable
:name
(encoded-gpr-lisp
xp
(ldb (byte 3 0) op1)))
()
frame-ptr))
((< op1 #xb0)
(setq skip (%check-anchored-uuo xcf 2))
(%err-disp-internal $xfunbnd
(list (encoded-gpr-lisp
xp
(ldb (byte 3 0) op1)))
frame-ptr))
((< op1 #xc0)
(setq skip (%check-anchored-uuo xcf 3))
(%err-disp-internal
#.(car (rassoc 'type-error *kernel-simple-error-classes*))
(list (encoded-gpr-lisp
xp
(ldb (byte 3 0) op1))
(logandc2 op2 arch::error-type-error))
frame-ptr))
((= op1 #xc0)
(setq skip (%check-anchored-uuo xcf 2))
(%error 'too-few-arguments
(list :nargs (xp-argument-count xp)
:fn fn)
frame-ptr))
((= op1 #xc1)
(setq skip (%check-anchored-uuo xcf 2))
(%error 'too-many-arguments
(list :nargs (xp-argument-count xp)
:fn fn)
frame-ptr))
((= op1 #xc2)
(setq skip (%check-anchored-uuo xcf 2))
(let* ((flags (xp-flags-register xp))
(nargs (xp-argument-count xp))
(carry-bit (logbitp x86::x86-carry-flag-bit flags)))
(if carry-bit
(%error 'too-few-arguments
(list :nargs nargs
:fn fn)
frame-ptr)
(%error 'too-many-arguments
(list :nargs nargs
:fn fn)
frame-ptr))))
((= op1 #xc3) ;array rank
(setq skip (%check-anchored-uuo xcf 3))
(%err-disp-internal $XNDIMS
(list (encoded-gpr-lisp xp (ldb (byte 4 4) op2))
(encoded-gpr-lisp xp (ldb (byte 4 0) op2)))
frame-ptr))
((= op1 #xc6)
(setq skip (%check-anchored-uuo xcf 2))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp xp x8632::temp0)
:expected-type '(or symbol function)
:format-control
"~S is not of type ~S, and can't be FUNCALLed or APPLYed")
nil frame-ptr))
((= op1 #xc7)
(handle-udf-call xp frame-ptr)
(setq skip 0))
((or (= op1 #xc8) (= op1 #xcb))
(setq skip (%check-anchored-uuo xcf 3))
(%error (%rsc-string $xarroob)
(list (encoded-gpr-lisp xp (ldb (byte 4 4) op2))
(encoded-gpr-lisp xp (ldb (byte 4 0) op2)))
frame-ptr))
((= op1 #xc9)
(setq skip (%check-anchored-uuo xcf 2))
(%err-disp-internal $xnotfun
(list (encoded-gpr-lisp xp x8632::temp0))
frame-ptr))
;; #xca = uuo-error-debug-trap
((= op1 #xcc)
;; external entry point or foreign variable
(setq skip (%check-anchored-uuo xcf 3))
(let* ((eep-or-fv (encoded-gpr-lisp xp (ldb (byte 4 4) op2))))
(etypecase eep-or-fv
(external-entry-point
(resolve-eep eep-or-fv)
(setf (encoded-gpr-lisp xp (ldb (byte 4 0) op2))
(eep.address eep-or-fv)))
(foreign-variable
(resolve-foreign-variable eep-or-fv)
(setf (encoded-gpr-lisp xp (ldb (byte 4 0) op2))
(fv.addr eep-or-fv))))))
((< op1 #xe0)
(setq skip (%check-anchored-uuo xcf 3))
(if (= op2 x8632::subtag-catch-frame)
(%error (make-condition 'cant-throw-error
:tag (encoded-gpr-lisp
xp
(ldb (byte 3 0) op1)))
nil frame-ptr)
(let* ((typename
(cond ((= op2 x8632::tag-fixnum) 'fixnum)
((= op2 x8632::subtag-character) 'character)
((= op2 x8632::fulltag-cons) 'cons)
((= op2 x8632::tag-misc) 'uvector)
(t (let* ((class (logand op2 x8632::fulltagmask))
(high5 (ash op2 (- x8632::ntagbits))))
(cond ((= class x8632::fulltag-nodeheader)
(svref *nodeheader-types* high5))
((= class x8632::fulltag-immheader)
(svref *immheader-types* high5))
(t (list 'bogus op2))))))))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp
xp
(ldb (byte 3 0) op1))
:expected-type typename)
nil
frame-ptr))))
((< op1 #xf0)
(setq skip (%check-anchored-uuo xcf 2))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp
xp
(ldb (byte 3 0) op1))
:expected-type 'list)
nil
frame-ptr))
(t
(setq skip (%check-anchored-uuo xcf 2))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp
xp
(ldb (byte 3 0) op1))
:expected-type 'fixnum)
nil
frame-ptr)))
(%error "Unknown trap: #x~x~%xp=~s"
(list (list op0 op1 op2) xp)
frame-ptr))
skip))))
| null | https://raw.githubusercontent.com/Clozure/ccl/6c1a9458f7a5437b73ec227e989aa5b825f32fd3/level-1/x86-error-signal.lisp | lisp |
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
-2.0
Unless required by applicable law or agreed to in writing, software
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
stack and the way that the kernel saves/restores rsp and rbp
before calling out. If we get around those problems, then
we have to also deal with the fact that the return address
is on the stack. Easiest to make the kernel deal with that,
and just set %fn to the function that returns the values
returned by the (newly defined) function and %arg_z to
that list of values.
#x9x, x>0 - register X is a symbol. It's unbound,
array rank
#xca = uuo-error-debug-trap
external entry point or foreign variable
lots of duplicated code here
#x9x, x>- - register X is a symbol. It's unbound,
array rank
#xca = uuo-error-debug-trap
external entry point or foreign variable | Copyright 2005 - 2009 Clozure Associates
distributed under the License is distributed on an " AS IS " BASIS ,
(in-package "CCL")
#+x8664-target
(defun xp-argument-count (xp)
(ldb (byte (- 16 x8664::fixnumshift) 0)
(encoded-gpr-lisp xp x8664::nargs.q)))
#+x8632-target
(defun xp-argument-count (xp)
(encoded-gpr-lisp xp target::nargs))
#+x8664-target
(defun xp-argument-list (xp)
(let ((nargs (xp-argument-count xp))
(arg-x (encoded-gpr-lisp xp x8664::arg_x))
(arg-y (encoded-gpr-lisp xp x8664::arg_y))
(arg-z (encoded-gpr-lisp xp x8664::arg_z)))
(cond ((eql nargs 0) nil)
((eql nargs 1) (list arg-z))
((eql nargs 2) (list arg-y arg-z))
(t
(let ((args (list arg-x arg-y arg-z)))
(if (eql nargs 3)
args
(let ((sp (%inc-ptr (encoded-gpr-macptr xp x8664::rsp)
(+ x8664::node-size x8664::xcf.size))))
(dotimes (i (- nargs 3))
(push (%get-object sp (* i x8664::node-size)) args))
args)))))))
#+x8632-target
(defun xp-argument-list (xp)
(let ((nargs (xp-argument-count xp))
(arg-y (encoded-gpr-lisp xp x8632::arg_y))
(arg-z (encoded-gpr-lisp xp x8632::arg_z)))
(cond ((eql nargs 0) nil)
((eql nargs 1) (list arg-z))
(t
(let ((args (list arg-y arg-z)))
(if (eql nargs 2)
args
(let ((sp (%inc-ptr (encoded-gpr-macptr xp x8632::ebp)
(+ x8632::node-size x8632::xcf.size))))
(dotimes (i (- nargs 2))
(push (%get-object sp (* i x8632::node-size)) args))
args)))))))
Making this be continuable is hard , because of the xcf on the
(defun handle-udf-call (xp frame-ptr)
(let* ((args (xp-argument-list xp))
(values (multiple-value-list
(%kernel-restart-internal
$xudfcall
(list (maybe-setf-name (encoded-gpr-lisp xp target::fname)) args)
frame-ptr)))
(f #'(lambda (values) (apply #'values values))))
(setf (encoded-gpr-lisp xp target::arg_z) values
(encoded-gpr-lisp xp target::fn) f)))
#+x8664-target
(defcallback %xerr-disp (:address xp :address xcf :int)
(with-error-reentry-detection
(let* ((frame-ptr (macptr->fixnum xcf))
(fn (%get-object xcf x8664::xcf.nominal-function))
(op0 (%get-xcf-byte xcf 0))
(op1 (%get-xcf-byte xcf 1))
(op2 (%get-xcf-byte xcf 2)))
(declare (type (unsigned-byte 8) op0 op1 op2))
(let* ((skip 2))
(if (and (= op0 #xcd)
(>= op1 #x70))
(cond ((< op1 #x90)
(setq skip (%check-anchored-uuo xcf 3))
(setq *error-reentry-count* 0)
(setf (encoded-gpr-lisp xp (ldb (byte 4 0) op1))
(%slot-unbound-trap
(encoded-gpr-lisp xp (ldb (byte 4 4) op2))
(encoded-gpr-lisp xp (ldb (byte 4 0) op2))
frame-ptr)))
((= op1 #x90)
(setq skip (%check-anchored-uuo xcf 3))
(setf (encoded-gpr-lisp xp (ldb (byte 4 4) op2))
(%kernel-restart-internal $xvunbnd
(list
(encoded-gpr-lisp
xp
(ldb (byte 4 0) op2)))
frame-ptr)))
((< op1 #xa0)
(setq skip (%check-anchored-uuo xcf 2))
but we do n't have enough info to offer USE - VALUE ,
STORE - VALUE , or CONTINUE restarts .
(%error (make-condition 'unbound-variable
:name
(encoded-gpr-lisp
xp
(ldb (byte 4 0) op1)))
()
frame-ptr))
((< op1 #xb0)
(setq skip (%check-anchored-uuo xcf 2))
(%err-disp-internal $xfunbnd
(list (encoded-gpr-lisp
xp
(ldb (byte 4 0) op1)))
frame-ptr))
((< op1 #xc0)
(setq skip (%check-anchored-uuo xcf 3))
(%err-disp-internal
#.(car (rassoc 'type-error *kernel-simple-error-classes*))
(list (encoded-gpr-lisp
xp
(ldb (byte 4 0) op1))
(logandc2 op2 arch::error-type-error))
frame-ptr))
((= op1 #xc0)
(setq skip (%check-anchored-uuo xcf 2))
(%error 'too-few-arguments
(list :nargs (xp-argument-count xp)
:fn fn)
frame-ptr))
((= op1 #xc1)
(setq skip (%check-anchored-uuo xcf 2))
(%error 'too-many-arguments
(list :nargs (xp-argument-count xp)
:fn fn)
frame-ptr))
((= op1 #xc2)
(setq skip (%check-anchored-uuo xcf 2))
(let* ((flags (xp-flags-register xp))
(nargs (xp-argument-count xp))
(carry-bit (logbitp x86::x86-carry-flag-bit flags)))
(if carry-bit
(%error 'too-few-arguments
(list :nargs nargs
:fn fn)
frame-ptr)
(%error 'too-many-arguments
(list :nargs nargs
:fn fn)
frame-ptr))))
(setq skip (%check-anchored-uuo xcf 3))
(%err-disp-internal $XNDIMS
(list (encoded-gpr-lisp xp (ldb (byte 4 4) op2))
(encoded-gpr-lisp xp (ldb (byte 4 0) op2)))
frame-ptr))
((= op1 #xc6)
(setq skip (%check-anchored-uuo xcf 2))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp xp x8664::temp0)
:expected-type '(or symbol function)
:format-control
"~S is not of type ~S, and can't be FUNCALLed or APPLYed")
nil frame-ptr))
((= op1 #xc7)
(handle-udf-call xp frame-ptr)
(setq skip 0))
((or (= op1 #xc8) (= op1 #xcb))
(setq skip (%check-anchored-uuo xcf 3))
(%error (%rsc-string $xarroob)
(list (encoded-gpr-lisp xp (ldb (byte 4 4) op2))
(encoded-gpr-lisp xp (ldb (byte 4 0) op2)))
frame-ptr))
((= op1 #xc9)
(setq skip (%check-anchored-uuo xcf 2))
(%err-disp-internal $xnotfun
(list (encoded-gpr-lisp xp x8664::temp0))
frame-ptr))
((= op1 #xcc)
(setq skip (%check-anchored-uuo xcf 3))
(let* ((eep-or-fv (encoded-gpr-lisp xp (ldb (byte 4 4) op2))))
(etypecase eep-or-fv
(external-entry-point
(resolve-eep eep-or-fv)
(setf (encoded-gpr-lisp xp (ldb (byte 4 0) op2))
(eep.address eep-or-fv)))
(foreign-variable
(resolve-foreign-variable eep-or-fv)
(setf (encoded-gpr-lisp xp (ldb (byte 4 0) op2))
(fv.addr eep-or-fv))))))
((< op1 #xe0)
(setq skip (%check-anchored-uuo xcf 3))
(if (= op2 x8664::subtag-catch-frame)
(%error (make-condition 'cant-throw-error
:tag (encoded-gpr-lisp
xp
(ldb (byte 4 0) op1)))
nil frame-ptr)
(let* ((typename
(cond ((= op2 x8664::tag-fixnum) 'fixnum)
((= op2 x8664::tag-single-float) 'single-float)
((= op2 x8664::subtag-character) 'character)
((= op2 x8664::fulltag-cons) 'cons)
((= op2 x8664::tag-misc) 'uvector)
((= op2 x8664::fulltag-symbol) 'symbol)
((= op2 x8664::fulltag-function) 'function)
(t (let* ((class (logand op2 x8664::fulltagmask))
(high4 (ash op2 (- x8664::ntagbits))))
(cond ((= class x8664::fulltag-nodeheader-0)
(svref *nodeheader-0-types* high4))
((= class x8664::fulltag-nodeheader-1)
(svref *nodeheader-1-types* high4))
((= class x8664::fulltag-immheader-0)
(svref *immheader-0-types* high4))
((= class x8664::fulltag-immheader-1)
(svref *immheader-1-types* high4))
((= class x8664::fulltag-immheader-2)
(svref *immheader-2-types* high4))
(t (list 'bogus op2))))))))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp
xp
(ldb (byte 4 0) op1))
:expected-type typename)
nil
frame-ptr))))
((< op1 #xf0)
(setq skip (%check-anchored-uuo xcf 2))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp
xp
(ldb (byte 4 0) op1))
:expected-type 'list)
nil
frame-ptr))
(t
(setq skip (%check-anchored-uuo xcf 2))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp
xp
(ldb (byte 4 0) op1))
:expected-type 'fixnum)
nil
frame-ptr)))
(%error "Unknown trap: #x~x~%xp=~s"
(list (list op0 op1 op2) xp)
frame-ptr))
skip))))
#+x8632-target
(defcallback %xerr-disp (:address xp :address xcf :int)
(with-error-reentry-detection
(let* ((frame-ptr (macptr->fixnum xcf))
(fn (%get-object xcf x8632::xcf.nominal-function))
(op0 (%get-xcf-byte xcf 0))
(op1 (%get-xcf-byte xcf 1))
(op2 (%get-xcf-byte xcf 2)))
(declare (type (unsigned-byte 8) op0 op1 op2))
(let* ((skip 2))
(if (and (= op0 #xcd)
(>= op1 #x70))
(cond ((< op1 #x90)
(setq skip (%check-anchored-uuo xcf 3))
(setq *error-reentry-count* 0)
(setf (encoded-gpr-lisp xp (ldb (byte 3 0) op1))
(%slot-unbound-trap
(encoded-gpr-lisp xp (ldb (byte 4 4) op2))
(encoded-gpr-lisp xp (ldb (byte 4 0) op2))
frame-ptr)))
((= op1 #x90)
(setq skip (%check-anchored-uuo xcf 3))
(setf (encoded-gpr-lisp
xp
(ldb (byte 3 0) op2))
(%kernel-restart-internal $xvunbnd
(list
(encoded-gpr-lisp
xp
(ldb (byte 3 0) op2)))
frame-ptr)))
((< op1 #xa0)
(setq skip (%check-anchored-uuo xcf 2))
but we do n't have enough info to offer USE - VALUE ,
STORE - VALUE , or CONTINUE restart
(%error (make-condition 'unbound-variable
:name
(encoded-gpr-lisp
xp
(ldb (byte 3 0) op1)))
()
frame-ptr))
((< op1 #xb0)
(setq skip (%check-anchored-uuo xcf 2))
(%err-disp-internal $xfunbnd
(list (encoded-gpr-lisp
xp
(ldb (byte 3 0) op1)))
frame-ptr))
((< op1 #xc0)
(setq skip (%check-anchored-uuo xcf 3))
(%err-disp-internal
#.(car (rassoc 'type-error *kernel-simple-error-classes*))
(list (encoded-gpr-lisp
xp
(ldb (byte 3 0) op1))
(logandc2 op2 arch::error-type-error))
frame-ptr))
((= op1 #xc0)
(setq skip (%check-anchored-uuo xcf 2))
(%error 'too-few-arguments
(list :nargs (xp-argument-count xp)
:fn fn)
frame-ptr))
((= op1 #xc1)
(setq skip (%check-anchored-uuo xcf 2))
(%error 'too-many-arguments
(list :nargs (xp-argument-count xp)
:fn fn)
frame-ptr))
((= op1 #xc2)
(setq skip (%check-anchored-uuo xcf 2))
(let* ((flags (xp-flags-register xp))
(nargs (xp-argument-count xp))
(carry-bit (logbitp x86::x86-carry-flag-bit flags)))
(if carry-bit
(%error 'too-few-arguments
(list :nargs nargs
:fn fn)
frame-ptr)
(%error 'too-many-arguments
(list :nargs nargs
:fn fn)
frame-ptr))))
(setq skip (%check-anchored-uuo xcf 3))
(%err-disp-internal $XNDIMS
(list (encoded-gpr-lisp xp (ldb (byte 4 4) op2))
(encoded-gpr-lisp xp (ldb (byte 4 0) op2)))
frame-ptr))
((= op1 #xc6)
(setq skip (%check-anchored-uuo xcf 2))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp xp x8632::temp0)
:expected-type '(or symbol function)
:format-control
"~S is not of type ~S, and can't be FUNCALLed or APPLYed")
nil frame-ptr))
((= op1 #xc7)
(handle-udf-call xp frame-ptr)
(setq skip 0))
((or (= op1 #xc8) (= op1 #xcb))
(setq skip (%check-anchored-uuo xcf 3))
(%error (%rsc-string $xarroob)
(list (encoded-gpr-lisp xp (ldb (byte 4 4) op2))
(encoded-gpr-lisp xp (ldb (byte 4 0) op2)))
frame-ptr))
((= op1 #xc9)
(setq skip (%check-anchored-uuo xcf 2))
(%err-disp-internal $xnotfun
(list (encoded-gpr-lisp xp x8632::temp0))
frame-ptr))
((= op1 #xcc)
(setq skip (%check-anchored-uuo xcf 3))
(let* ((eep-or-fv (encoded-gpr-lisp xp (ldb (byte 4 4) op2))))
(etypecase eep-or-fv
(external-entry-point
(resolve-eep eep-or-fv)
(setf (encoded-gpr-lisp xp (ldb (byte 4 0) op2))
(eep.address eep-or-fv)))
(foreign-variable
(resolve-foreign-variable eep-or-fv)
(setf (encoded-gpr-lisp xp (ldb (byte 4 0) op2))
(fv.addr eep-or-fv))))))
((< op1 #xe0)
(setq skip (%check-anchored-uuo xcf 3))
(if (= op2 x8632::subtag-catch-frame)
(%error (make-condition 'cant-throw-error
:tag (encoded-gpr-lisp
xp
(ldb (byte 3 0) op1)))
nil frame-ptr)
(let* ((typename
(cond ((= op2 x8632::tag-fixnum) 'fixnum)
((= op2 x8632::subtag-character) 'character)
((= op2 x8632::fulltag-cons) 'cons)
((= op2 x8632::tag-misc) 'uvector)
(t (let* ((class (logand op2 x8632::fulltagmask))
(high5 (ash op2 (- x8632::ntagbits))))
(cond ((= class x8632::fulltag-nodeheader)
(svref *nodeheader-types* high5))
((= class x8632::fulltag-immheader)
(svref *immheader-types* high5))
(t (list 'bogus op2))))))))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp
xp
(ldb (byte 3 0) op1))
:expected-type typename)
nil
frame-ptr))))
((< op1 #xf0)
(setq skip (%check-anchored-uuo xcf 2))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp
xp
(ldb (byte 3 0) op1))
:expected-type 'list)
nil
frame-ptr))
(t
(setq skip (%check-anchored-uuo xcf 2))
(%error (make-condition 'type-error
:datum (encoded-gpr-lisp
xp
(ldb (byte 3 0) op1))
:expected-type 'fixnum)
nil
frame-ptr)))
(%error "Unknown trap: #x~x~%xp=~s"
(list (list op0 op1 op2) xp)
frame-ptr))
skip))))
|
851b6cd87e11298dd12685e34ec3bbcf8cfb37f2667c6c902e81f07bab5dd249 | hbr/albatross | list.mli | * A thin wrapper around [ . List ] which avoids throwing exceptions and
with some additional monadic functions .
with some additional monadic functions.
*)
open Module_types
* { 1 List Monad }
(** A list of values of type ['a]. *)
type 'a t = 'a list
(** [return a] makes a singleton list with the element [a]. *)
val return: 'a -> 'a t
(** [l >>= f] applies the function [f] to all elements of the list [l] and
concatenates all lists. *)
val (>>=): 'a t -> ('a -> 'b t) -> 'b t
* [ f > = > g ] composes the two monadic functions [ f ] and [ g ] .
val (>=>): ('a -> 'b t) -> ('b -> 'c t) -> ('a -> 'c t)
(** [flst <*> lst] is equivalent to [flst >>= fun f -> map f lst] i.e. it maps
all functions contained in [flst] over the list [lst] and then concatenates
the results. *)
val (<*>): ('a -> 'b) t -> 'a t -> 'b t
* [ join ] is the same as { ! : concat } .
val join: 'a list list -> 'a list
(** {1 Modified list functions}*)
(** [find p l] finds an element [e] in the list [l] which satisfies [p e]. *)
val find: ('a -> bool) ->'a t -> 'a option
val split_head_tail: 'a t -> 'a * 'a t
(** Split the list in its head and tail parts. Requires that the list is not
empty. *)
val head_strict: 'a t -> 'a
(** Get the head of the list. Requires that the list is not empty. *)
val tail_strict: 'a t -> 'a t
(** Get the tail of the list. Requires that the list is not empty. *)
val nth_strict: int -> 'a t -> 'a
(** [ith_strict n list] returns the [n]th element of the list. Precondition:
[list] has at least [n + 1] elements. *)
val nth: int -> 'a t -> 'a option
(** [ith_strict n list] returns the [n]th element of the list if the list is
long enough. Otherwise [None] is returned. *)
* { 1 List functions from }
(** [append a b] prepends the lists [a] in front of the list [b]. Synonym [a @
b]. *)
val append: 'a list -> 'a list -> 'a list
(** [concat ll] concatenates all lists contained in the list of lists [ll]. *)
val concat: 'a list list -> 'a list
(** Transform a list of pairs into a pair of lists. *)
val split: ('a * 'b) list -> 'a list * 'b list
(** [rev a] reverses the list [a]. *)
val rev: 'a list -> 'a list
(** [rev_append a b] prepends the lists [rev a] in front of the list [b]. *)
val rev_append: 'a list -> 'a list -> 'a list
val length: 'a t -> int
val filter: ('a -> bool) -> 'a t -> 'a t
val fold_left: ('a -> 'b -> 'a) -> 'a -> 'b list -> 'a
val fold_right: ('a -> 'b -> 'b) -> 'a list -> 'b -> 'b
val iter: ('a -> unit) -> 'a list -> unit
val map : ('a -> 'b) -> 'a list -> 'b list
val mapi : (int -> 'a -> 'b) -> 'a list -> 'b list
val rev_map : ('a -> 'b) -> 'a list -> 'b list
val for_all : ('a -> bool) -> 'a list -> bool
val exists : ('a -> bool) -> 'a list -> bool
* { 1 Additional list functions }
(** [map_and_filter f list] maps the list with [f] and removes the element for
which [f e = None].*)
val map_and_filter: ('a -> 'b option) -> 'a list -> 'b list
val split_at: ('a -> bool) -> 'a t -> 'a t * 'a t
* [ split_at p lst ] scans the list until it finds the first element
satisfying [ p ] and returns the prefix and the remainder starting at the
encountered element .
satisfying [p] and returns the prefix and the remainder starting at the
encountered element. *)
val transpose: 'a list list -> 'a list list
*
[ transpose list_of_rows ] returns the list of columns .
Preconditions :
- The list of rows must not be empty .
- All rows in the list of rows must not be empty and have the same length .
Example :
{ [
transpose [ [ 1 ; 2 ; 3 ] ; [ 4 ; 5 ; 6 ] ]
=
[ [ 1 ; 4 ] ; [ 2 ; 5 ] ; [ 3 ; 6 ] ]
] }
[transpose list_of_rows] returns the list of columns.
Preconditions:
- The list of rows must not be empty.
- All rows in the list of rows must not be empty and have the same length.
Example:
{[
transpose [ [1; 2; 3]; [4; 5; 6] ]
=
[ [1; 4]; [2; 5]; [3; 6] ]
]}
*)
* { 1 Monadic list functions }
(** Monadic list functions *)
module Monadic (M: MONAD):
sig
(** [fold_left f lst start] leftfolds the function [f] over the list [lst]
starting with the value [start]. Continuation of the fold is determined
by the bind operator [>>=] of the monad [M]. E.g. if the monad [M] is
[Option] the folding stops as soon as [f e acc] returns the value [None].
{[
fold_left f [a b c ...] s =
M.(f a s >>= fun acc ->
f b acc >>= fun acc ->
f c acc >>= fun acc ->
...)
]}
*)
val fold_left: ('a -> 'b -> 'b M.t) -> 'a t -> 'b -> 'b M.t
(** The same as [fold_left] just right folding.
{[
fold_right f [... x y z] s =
fold_left f (rev [... x y z]) s =
M.(f z s >>= fun acc ->
f y acc >>= fun acc ->
f x acc >>= fun acc ->
...)
]}*)
val fold_right: ('a -> 'b -> 'b M.t) -> 'a t -> 'b -> 'b M.t
* The same as [ fold_left ] except that the folding function receives the
position of the first argument in the list as an additional argument .
position of the first argument in the list as an additional argument. *)
val foldi_left: (int -> 'a -> 'b -> 'b M.t) -> 'a t -> 'b -> 'b M.t
end
| null | https://raw.githubusercontent.com/hbr/albatross/8f28ef97951f92f30dc69cf94c0bbe20d64fba21/ocaml/fmlib/basic/list.mli | ocaml | * A list of values of type ['a].
* [return a] makes a singleton list with the element [a].
* [l >>= f] applies the function [f] to all elements of the list [l] and
concatenates all lists.
* [flst <*> lst] is equivalent to [flst >>= fun f -> map f lst] i.e. it maps
all functions contained in [flst] over the list [lst] and then concatenates
the results.
* {1 Modified list functions}
* [find p l] finds an element [e] in the list [l] which satisfies [p e].
* Split the list in its head and tail parts. Requires that the list is not
empty.
* Get the head of the list. Requires that the list is not empty.
* Get the tail of the list. Requires that the list is not empty.
* [ith_strict n list] returns the [n]th element of the list. Precondition:
[list] has at least [n + 1] elements.
* [ith_strict n list] returns the [n]th element of the list if the list is
long enough. Otherwise [None] is returned.
* [append a b] prepends the lists [a] in front of the list [b]. Synonym [a @
b].
* [concat ll] concatenates all lists contained in the list of lists [ll].
* Transform a list of pairs into a pair of lists.
* [rev a] reverses the list [a].
* [rev_append a b] prepends the lists [rev a] in front of the list [b].
* [map_and_filter f list] maps the list with [f] and removes the element for
which [f e = None].
* Monadic list functions
* [fold_left f lst start] leftfolds the function [f] over the list [lst]
starting with the value [start]. Continuation of the fold is determined
by the bind operator [>>=] of the monad [M]. E.g. if the monad [M] is
[Option] the folding stops as soon as [f e acc] returns the value [None].
{[
fold_left f [a b c ...] s =
M.(f a s >>= fun acc ->
f b acc >>= fun acc ->
f c acc >>= fun acc ->
...)
]}
* The same as [fold_left] just right folding.
{[
fold_right f [... x y z] s =
fold_left f (rev [... x y z]) s =
M.(f z s >>= fun acc ->
f y acc >>= fun acc ->
f x acc >>= fun acc ->
...)
]} | * A thin wrapper around [ . List ] which avoids throwing exceptions and
with some additional monadic functions .
with some additional monadic functions.
*)
open Module_types
* { 1 List Monad }
type 'a t = 'a list
val return: 'a -> 'a t
val (>>=): 'a t -> ('a -> 'b t) -> 'b t
* [ f > = > g ] composes the two monadic functions [ f ] and [ g ] .
val (>=>): ('a -> 'b t) -> ('b -> 'c t) -> ('a -> 'c t)
val (<*>): ('a -> 'b) t -> 'a t -> 'b t
* [ join ] is the same as { ! : concat } .
val join: 'a list list -> 'a list
val find: ('a -> bool) ->'a t -> 'a option
val split_head_tail: 'a t -> 'a * 'a t
val head_strict: 'a t -> 'a
val tail_strict: 'a t -> 'a t
val nth_strict: int -> 'a t -> 'a
val nth: int -> 'a t -> 'a option
* { 1 List functions from }
val append: 'a list -> 'a list -> 'a list
val concat: 'a list list -> 'a list
val split: ('a * 'b) list -> 'a list * 'b list
val rev: 'a list -> 'a list
val rev_append: 'a list -> 'a list -> 'a list
val length: 'a t -> int
val filter: ('a -> bool) -> 'a t -> 'a t
val fold_left: ('a -> 'b -> 'a) -> 'a -> 'b list -> 'a
val fold_right: ('a -> 'b -> 'b) -> 'a list -> 'b -> 'b
val iter: ('a -> unit) -> 'a list -> unit
val map : ('a -> 'b) -> 'a list -> 'b list
val mapi : (int -> 'a -> 'b) -> 'a list -> 'b list
val rev_map : ('a -> 'b) -> 'a list -> 'b list
val for_all : ('a -> bool) -> 'a list -> bool
val exists : ('a -> bool) -> 'a list -> bool
* { 1 Additional list functions }
val map_and_filter: ('a -> 'b option) -> 'a list -> 'b list
val split_at: ('a -> bool) -> 'a t -> 'a t * 'a t
* [ split_at p lst ] scans the list until it finds the first element
satisfying [ p ] and returns the prefix and the remainder starting at the
encountered element .
satisfying [p] and returns the prefix and the remainder starting at the
encountered element. *)
val transpose: 'a list list -> 'a list list
*
[ transpose list_of_rows ] returns the list of columns .
Preconditions :
- The list of rows must not be empty .
- All rows in the list of rows must not be empty and have the same length .
Example :
{ [
transpose [ [ 1 ; 2 ; 3 ] ; [ 4 ; 5 ; 6 ] ]
=
[ [ 1 ; 4 ] ; [ 2 ; 5 ] ; [ 3 ; 6 ] ]
] }
[transpose list_of_rows] returns the list of columns.
Preconditions:
- The list of rows must not be empty.
- All rows in the list of rows must not be empty and have the same length.
Example:
{[
transpose [ [1; 2; 3]; [4; 5; 6] ]
=
[ [1; 4]; [2; 5]; [3; 6] ]
]}
*)
* { 1 Monadic list functions }
module Monadic (M: MONAD):
sig
val fold_left: ('a -> 'b -> 'b M.t) -> 'a t -> 'b -> 'b M.t
val fold_right: ('a -> 'b -> 'b M.t) -> 'a t -> 'b -> 'b M.t
* The same as [ fold_left ] except that the folding function receives the
position of the first argument in the list as an additional argument .
position of the first argument in the list as an additional argument. *)
val foldi_left: (int -> 'a -> 'b -> 'b M.t) -> 'a t -> 'b -> 'b M.t
end
|
165b16b5a912b40f40c8781330632d8077c83bb112e4878fb31894bd057ffb65 | facebook/flow | lintSettings.ml |
* Copyright ( c ) Meta Platforms , Inc. and affiliates .
*
* This source code is licensed under the MIT license found in the
* LICENSE file in the root directory of this source tree .
* Copyright (c) Meta Platforms, Inc. and affiliates.
*
* This source code is licensed under the MIT license found in the
* LICENSE file in the root directory of this source tree.
*)
open Lints
open Severity
let ( >>= ) = Base.Result.( >>= )
type 'a t = {
(* The default value associated with a lint if the lint kind isn't found in the map *)
default_value: 'a;
Values for that have been explicitly set
The Loc.t is for settings defined in comments , and is used to find unused lint
* suppressions . The Loc.t is set to None for settings coming from the flowconfig or .
* suppressions. The Loc.t is set to None for settings coming from the flowconfig or --lints.*)
explicit_values: ('a * Loc.t option) LintMap.t;
}
type warning = int * string
type error = int * string
let default_explicit_values = LintMap.singleton Lints.UntypedTypeImport (Severity.Err, None)
let ignored_by_all =
[Lints.ImplicitInexactObject; Lints.AmbiguousObjectType; Lints.UninitializedInstanceProperty]
let config_default kind =
LintMap.find_opt kind default_explicit_values |> Base.Option.value ~default:(Severity.Off, None)
let of_default default_value =
let explicit_values = LintMap.of_function ignored_by_all config_default in
{ default_value; explicit_values }
let set_value key value settings =
let new_map = LintMap.add key value settings.explicit_values in
{ settings with explicit_values = new_map }
let set_all entries settings =
List.fold_left (fun settings (key, value) -> set_value key value settings) settings entries
let get_default settings = settings.default_value
let get_value lint_kind settings =
LintMap.find_opt lint_kind settings.explicit_values
|> Base.Option.value_map ~f:fst ~default:settings.default_value
let get_loc lint_kind settings =
LintMap.find_opt lint_kind settings.explicit_values |> Base.Option.value_map ~f:snd ~default:None
let is_explicit lint_kind settings = LintMap.mem lint_kind settings.explicit_values
(* Iterate over all lint kinds with an explicit value *)
let iter f settings = LintMap.iter f settings.explicit_values
Fold over all lint kinds with an explicit value
let fold f settings acc = LintMap.fold f settings.explicit_values acc
(* Map over all lint kinds with an explicit value *)
let map f settings =
let new_explicit = LintMap.map f settings.explicit_values in
{ settings with explicit_values = new_explicit }
(* SEVERITY-SPECIFIC FUNCTIONS *)
let empty_severities = { default_value = Off; explicit_values = LintMap.empty }
let default_severities = { empty_severities with explicit_values = default_explicit_values }
let is_enabled lint_kind settings =
match get_value lint_kind settings with
| Err
| Warn ->
true
| Off -> false
type parse_result =
| AllSetting of severity t
| EntryList of lint_kind list * (severity * Loc.t option)
Takes a base LintSettings and a list of labeled lines and returns the corresponding
* severity LintSettings.t from applying the new lines on top of the base settings if
* successful . Otherwise , returns an error message along with the label of the
* line it failed on .
* severity LintSettings.t from applying the new lines on top of the base settings if
* successful. Otherwise, returns an error message along with the label of the
* line it failed on. *)
let of_lines base_settings =
let parse_value label value =
match severity_of_string value with
| Some severity -> Ok severity
| None -> Error (label, "Invalid setting encountered. Valid settings are error, warn, and off.")
in
let eq_regex = Str.regexp "=" in
let all_regex = Str.regexp "all" in
let parse_line (loc, (label, line)) =
match Str.split_delim eq_regex line with
| [left; right] ->
let left = left |> String.trim in
let right = right |> String.trim in
parse_value label right >>= fun value ->
begin
match left with
| "all" -> Ok (AllSetting (of_default value))
| _ -> begin
match kinds_of_string left with
| Some kinds -> Ok (EntryList (kinds, (value, Some loc)))
| None -> Error (label, Printf.sprintf "Invalid lint rule \"%s\" encountered." left)
end
end
| _ ->
Error (label, "Malformed lint rule. Properly formed rules contain a single '=' character.")
in
let add_value keys value settings =
let (new_settings, all_redundant) =
List.fold_left
(fun (settings, all_redundant) key ->
let v = get_value key settings in
let all_redundant = all_redundant && v = fst value && v <> fst (config_default key) in
let settings = set_value key value settings in
(settings, all_redundant))
(settings, true)
keys
in
if all_redundant then
Error "Redundant argument. This argument doesn't change any lint settings."
else
Ok new_settings
in
let rec loop (acc : Severity.severity t) (warnings : warning list) = function
| [] -> Ok (acc, Base.List.rev warnings)
| line :: lines ->
(match parse_line line with
| Ok (EntryList (keys, value)) ->
(match add_value keys value acc with
| Ok acc -> loop acc warnings lines
| Error msg ->
let warning = (line |> snd |> fst, msg) in
loop acc (warning :: warnings) lines)
| Ok (AllSetting value) ->
if acc == base_settings then
loop value warnings lines
else
Error
( line |> snd |> fst,
"\"all\" is only allowed as the first setting. Settings are order-sensitive."
)
| Error line_err -> loop acc (line_err :: warnings) lines)
in
let loc_of_line line =
Loc.(
let start = { line; column = 0 } in
let _end = { line = line + 1; column = 0 } in
{ source = None; start; _end }
)
in
fun lint_lines ->
let locate_fun ((label, _) as item) = (loc_of_line label, item) in
(* Artificially locate the lines to detect unused lines *)
let located_lines = Base.List.map ~f:locate_fun lint_lines in
loop base_settings [] located_lines >>= fun (settings, warnings) ->
let used_locs =
fold
(fun _kind (_enabled, loc) acc ->
Base.Option.value_map loc ~f:(fun loc -> Loc_collections.LocSet.add loc acc) ~default:acc)
settings
Loc_collections.LocSet.empty
in
let used_locs =
Base.List.fold
~f:(fun acc (line, _warning) -> Loc_collections.LocSet.add (loc_of_line line) acc)
~init:used_locs
warnings
in
let first_unused =
List.fold_left
(fun acc (art_loc, (label, line)) ->
match acc with
| Some _ -> acc
| None ->
if
Loc_collections.LocSet.mem art_loc used_locs
|| Str.string_match all_regex (String.trim line) 0
then
None
else
Some label)
None
located_lines
in
let warnings =
match first_unused with
| Some label ->
let warning =
( label,
"Redundant argument. " ^ "The values set by this argument are completely overwritten."
)
in
warning :: warnings
| None -> warnings
in
(* Remove the artificial locations before returning the result *)
let settings = map (fun (enabled, _loc) -> (enabled, None)) settings in
Ok (settings, warnings)
let to_string settings =
let acc = Buffer.create 20 in
Buffer.add_string acc (Printf.sprintf "all=%s" (settings |> get_default |> string_of_severity));
iter
(fun kind (severity, _) ->
Buffer.add_string
acc
(Printf.sprintf ", %s=%s" (string_of_kind kind) (string_of_severity severity)))
settings;
Buffer.contents acc
type lint_parse_error =
| Invalid_setting
| Malformed_argument
| Naked_comment
| Nonexistent_rule
| Overwritten_argument
| Redundant_argument
| null | https://raw.githubusercontent.com/facebook/flow/51c84b797c57d0807a5b6dbbb4a10733913e9ec3/src/common/lints/lintSettings.ml | ocaml | The default value associated with a lint if the lint kind isn't found in the map
Iterate over all lint kinds with an explicit value
Map over all lint kinds with an explicit value
SEVERITY-SPECIFIC FUNCTIONS
Artificially locate the lines to detect unused lines
Remove the artificial locations before returning the result |
* Copyright ( c ) Meta Platforms , Inc. and affiliates .
*
* This source code is licensed under the MIT license found in the
* LICENSE file in the root directory of this source tree .
* Copyright (c) Meta Platforms, Inc. and affiliates.
*
* This source code is licensed under the MIT license found in the
* LICENSE file in the root directory of this source tree.
*)
open Lints
open Severity
let ( >>= ) = Base.Result.( >>= )
type 'a t = {
default_value: 'a;
Values for that have been explicitly set
The Loc.t is for settings defined in comments , and is used to find unused lint
* suppressions . The Loc.t is set to None for settings coming from the flowconfig or .
* suppressions. The Loc.t is set to None for settings coming from the flowconfig or --lints.*)
explicit_values: ('a * Loc.t option) LintMap.t;
}
type warning = int * string
type error = int * string
let default_explicit_values = LintMap.singleton Lints.UntypedTypeImport (Severity.Err, None)
let ignored_by_all =
[Lints.ImplicitInexactObject; Lints.AmbiguousObjectType; Lints.UninitializedInstanceProperty]
let config_default kind =
LintMap.find_opt kind default_explicit_values |> Base.Option.value ~default:(Severity.Off, None)
let of_default default_value =
let explicit_values = LintMap.of_function ignored_by_all config_default in
{ default_value; explicit_values }
let set_value key value settings =
let new_map = LintMap.add key value settings.explicit_values in
{ settings with explicit_values = new_map }
let set_all entries settings =
List.fold_left (fun settings (key, value) -> set_value key value settings) settings entries
let get_default settings = settings.default_value
let get_value lint_kind settings =
LintMap.find_opt lint_kind settings.explicit_values
|> Base.Option.value_map ~f:fst ~default:settings.default_value
let get_loc lint_kind settings =
LintMap.find_opt lint_kind settings.explicit_values |> Base.Option.value_map ~f:snd ~default:None
let is_explicit lint_kind settings = LintMap.mem lint_kind settings.explicit_values
let iter f settings = LintMap.iter f settings.explicit_values
Fold over all lint kinds with an explicit value
let fold f settings acc = LintMap.fold f settings.explicit_values acc
let map f settings =
let new_explicit = LintMap.map f settings.explicit_values in
{ settings with explicit_values = new_explicit }
let empty_severities = { default_value = Off; explicit_values = LintMap.empty }
let default_severities = { empty_severities with explicit_values = default_explicit_values }
let is_enabled lint_kind settings =
match get_value lint_kind settings with
| Err
| Warn ->
true
| Off -> false
type parse_result =
| AllSetting of severity t
| EntryList of lint_kind list * (severity * Loc.t option)
Takes a base LintSettings and a list of labeled lines and returns the corresponding
* severity LintSettings.t from applying the new lines on top of the base settings if
* successful . Otherwise , returns an error message along with the label of the
* line it failed on .
* severity LintSettings.t from applying the new lines on top of the base settings if
* successful. Otherwise, returns an error message along with the label of the
* line it failed on. *)
let of_lines base_settings =
let parse_value label value =
match severity_of_string value with
| Some severity -> Ok severity
| None -> Error (label, "Invalid setting encountered. Valid settings are error, warn, and off.")
in
let eq_regex = Str.regexp "=" in
let all_regex = Str.regexp "all" in
let parse_line (loc, (label, line)) =
match Str.split_delim eq_regex line with
| [left; right] ->
let left = left |> String.trim in
let right = right |> String.trim in
parse_value label right >>= fun value ->
begin
match left with
| "all" -> Ok (AllSetting (of_default value))
| _ -> begin
match kinds_of_string left with
| Some kinds -> Ok (EntryList (kinds, (value, Some loc)))
| None -> Error (label, Printf.sprintf "Invalid lint rule \"%s\" encountered." left)
end
end
| _ ->
Error (label, "Malformed lint rule. Properly formed rules contain a single '=' character.")
in
let add_value keys value settings =
let (new_settings, all_redundant) =
List.fold_left
(fun (settings, all_redundant) key ->
let v = get_value key settings in
let all_redundant = all_redundant && v = fst value && v <> fst (config_default key) in
let settings = set_value key value settings in
(settings, all_redundant))
(settings, true)
keys
in
if all_redundant then
Error "Redundant argument. This argument doesn't change any lint settings."
else
Ok new_settings
in
let rec loop (acc : Severity.severity t) (warnings : warning list) = function
| [] -> Ok (acc, Base.List.rev warnings)
| line :: lines ->
(match parse_line line with
| Ok (EntryList (keys, value)) ->
(match add_value keys value acc with
| Ok acc -> loop acc warnings lines
| Error msg ->
let warning = (line |> snd |> fst, msg) in
loop acc (warning :: warnings) lines)
| Ok (AllSetting value) ->
if acc == base_settings then
loop value warnings lines
else
Error
( line |> snd |> fst,
"\"all\" is only allowed as the first setting. Settings are order-sensitive."
)
| Error line_err -> loop acc (line_err :: warnings) lines)
in
let loc_of_line line =
Loc.(
let start = { line; column = 0 } in
let _end = { line = line + 1; column = 0 } in
{ source = None; start; _end }
)
in
fun lint_lines ->
let locate_fun ((label, _) as item) = (loc_of_line label, item) in
let located_lines = Base.List.map ~f:locate_fun lint_lines in
loop base_settings [] located_lines >>= fun (settings, warnings) ->
let used_locs =
fold
(fun _kind (_enabled, loc) acc ->
Base.Option.value_map loc ~f:(fun loc -> Loc_collections.LocSet.add loc acc) ~default:acc)
settings
Loc_collections.LocSet.empty
in
let used_locs =
Base.List.fold
~f:(fun acc (line, _warning) -> Loc_collections.LocSet.add (loc_of_line line) acc)
~init:used_locs
warnings
in
let first_unused =
List.fold_left
(fun acc (art_loc, (label, line)) ->
match acc with
| Some _ -> acc
| None ->
if
Loc_collections.LocSet.mem art_loc used_locs
|| Str.string_match all_regex (String.trim line) 0
then
None
else
Some label)
None
located_lines
in
let warnings =
match first_unused with
| Some label ->
let warning =
( label,
"Redundant argument. " ^ "The values set by this argument are completely overwritten."
)
in
warning :: warnings
| None -> warnings
in
let settings = map (fun (enabled, _loc) -> (enabled, None)) settings in
Ok (settings, warnings)
let to_string settings =
let acc = Buffer.create 20 in
Buffer.add_string acc (Printf.sprintf "all=%s" (settings |> get_default |> string_of_severity));
iter
(fun kind (severity, _) ->
Buffer.add_string
acc
(Printf.sprintf ", %s=%s" (string_of_kind kind) (string_of_severity severity)))
settings;
Buffer.contents acc
type lint_parse_error =
| Invalid_setting
| Malformed_argument
| Naked_comment
| Nonexistent_rule
| Overwritten_argument
| Redundant_argument
|
f7931fc6b0c8bcff39f1997e15e3fe2fb83c4e30fbda8118cc02f2d141ab8997 | 2600hz/kazoo | kazoo_endpoint_maintenance.erl | %%%-----------------------------------------------------------------------------
( C ) 2010 - 2020 , 2600Hz
%%% @doc
This Source Code Form is subject to the terms of the Mozilla Public
License , v. 2.0 . If a copy of the MPL was not distributed with this
file , You can obtain one at /.
%%%
%%% @end
%%%-----------------------------------------------------------------------------
-module(kazoo_endpoint_maintenance).
-export([flush/0]).
-include("kazoo_endpoint.hrl").
-spec flush() -> 'ok'.
flush() ->
kz_cache:flush_local(?CACHE_NAME).
| null | https://raw.githubusercontent.com/2600hz/kazoo/24519b9af9792caa67f7c09bbb9d27e2418f7ad6/core/kazoo_endpoint/src/kazoo_endpoint_maintenance.erl | erlang | -----------------------------------------------------------------------------
@doc
@end
----------------------------------------------------------------------------- | ( C ) 2010 - 2020 , 2600Hz
This Source Code Form is subject to the terms of the Mozilla Public
License , v. 2.0 . If a copy of the MPL was not distributed with this
file , You can obtain one at /.
-module(kazoo_endpoint_maintenance).
-export([flush/0]).
-include("kazoo_endpoint.hrl").
-spec flush() -> 'ok'.
flush() ->
kz_cache:flush_local(?CACHE_NAME).
|
a3fae72dc11d420e81c6fa6964f4adf7d1e76756cd8d0f4c468e3eb4c4d8d907 | GaloisInc/cryptol | Unlit.hs | -- |
Module : Cryptol . .
Copyright : ( c ) 2013 - 2016 Galois , Inc.
-- License : BSD3
-- Maintainer :
-- Stability : provisional
-- Portability : portable
--
-- Convert a literate source file into an ordinary source file.
{-# LANGUAGE OverloadedStrings, Safe, PatternGuards #-}
module Cryptol.Parser.Unlit
( unLit, PreProc(..), guessPreProc, knownExts
) where
import Data.Text(Text)
import qualified Data.Text as Text
import Data.Char(isSpace)
import System.FilePath(takeExtension)
import Cryptol.Utils.Panic
data PreProc = None | Markdown | LaTeX | RST
knownExts :: [String]
knownExts =
[ "cry"
, "tex"
, "markdown"
, "md"
, "rst"
]
guessPreProc :: FilePath -> PreProc
guessPreProc file = case takeExtension file of
".tex" -> LaTeX
".markdown" -> Markdown
".md" -> Markdown
".rst" -> RST
_ -> None
unLit :: PreProc -> Text -> Text
unLit None = id
unLit proc = Text.unlines . concatMap toCryptol . preProc proc . Text.lines
preProc :: PreProc -> [Text] -> [Block]
preProc p =
case p of
None -> return . Code
Markdown -> markdown
LaTeX -> latex
RST -> rst
data Block = Code [Text] | Comment [Text]
toCryptol :: Block -> [Text]
toCryptol (Code xs) = xs
toCryptol (Comment ls) =
case ls of
[] -> []
[l] -> [ "/* " `Text.append` l `Text.append` " */" ]
l1 : rest -> let (more, l) = splitLast rest
in "/* " `Text.append` l1 : more ++ [ l `Text.append` " */" ]
where
splitLast [] = panic "Cryptol.Parser.Unlit.toCryptol" [ "splitLast []" ]
splitLast [x] = ([], x)
splitLast (x : xs) = let (ys,y) = splitLast xs
in (x:ys,y)
mk :: ([Text] -> Block) -> [Text] -> [Block]
mk _ [] = []
mk c ls = [ c (reverse ls) ]
-- | The preprocessor for `markdown`
markdown :: [Text] -> [Block]
markdown = blanks []
where
comment current [] = mk Comment current
comment current (l : ls)
| Just op <- isOpenFence l = mk Comment (l : current) ++ fenced op [] ls
| isBlank l = blanks (l : current) ls
| otherwise = comment (l : current) ls
blanks current [] = mk Comment current
blanks current (l : ls)
| Just op <- isOpenFence l = mk Comment (l : current) ++ fenced op [] ls
| isCodeLine l = mk Comment current ++ code [l] ls
| isBlank l = blanks (l : current) ls
| otherwise = comment (l : current) ls
code current [] = mk Code current
code current (l : ls)
| isCodeLine l = code (l : current) ls
| otherwise = mk Code current ++ comment [] (l : ls)
fenced op current [] = mk op current -- XXX should this be an error?
fenced op current (l : ls)
| isCloseFence l = mk op current ++ comment [l] ls
| otherwise = fenced op (l : current) ls
isOpenFence l
| "```" `Text.isPrefixOf` l' =
Just $ case Text.dropWhile isSpace (Text.drop 3 l') of
l'' | "cryptol" `Text.isPrefixOf` l'' -> Code
| isBlank l'' -> Code
| otherwise -> Comment
| otherwise = Nothing
where
l' = Text.dropWhile isSpace l
isCloseFence l = "```" `Text.isPrefixOf` Text.dropWhile isSpace l
isBlank l = Text.all isSpace l
isCodeLine l = "\t" `Text.isPrefixOf` l || " " `Text.isPrefixOf` l
-- | The preprocessor for `latex`
latex :: [Text] -> [Block]
latex = comment []
where
comment current [] = mk Comment current
comment current (l : ls)
| isBeginCode l = mk Comment (l : current) ++ code [] ls
| otherwise = comment (l : current) ls
code current [] = mk Code current
code current (l : ls)
| isEndCode l = mk Code current ++ comment [l] ls
| otherwise = code (l : current) ls
isBeginCode l = "\\begin{code}" `Text.isPrefixOf` l
isEndCode l = "\\end{code}" `Text.isPrefixOf` l
rst :: [Text] -> [Block]
rst = comment []
where
isBeginCode l = case filter (not . Text.null) (Text.split isSpace l) of
["..", dir, "cryptol"] -> dir == "code-block::" ||
dir == "sourcecode::"
_ -> False
isEmpty = Text.all isSpace
isCode l = case Text.uncons l of
Just (c, _) -> isSpace c
Nothing -> True
comment acc ls =
case ls of
[] -> mk Comment acc
l : ls1 | isBeginCode l -> codeOptions (l : acc) ls1
| otherwise -> comment (l : acc) ls1
codeOptions acc ls =
case ls of
[] -> mk Comment acc
l : ls1 | isEmpty l -> mk Comment (l : acc) ++ code [] ls1
| otherwise -> codeOptions (l : acc) ls1
code acc ls =
case ls of
[] -> mk Code acc
l : ls1 | isCode l -> code (l : acc) ls1
| otherwise -> mk Code acc ++ comment [] ls
| null | https://raw.githubusercontent.com/GaloisInc/cryptol/fd05e16022acd13e4659f0c65194e2480cc088a3/src/Cryptol/Parser/Unlit.hs | haskell | |
License : BSD3
Maintainer :
Stability : provisional
Portability : portable
Convert a literate source file into an ordinary source file.
# LANGUAGE OverloadedStrings, Safe, PatternGuards #
| The preprocessor for `markdown`
XXX should this be an error?
| The preprocessor for `latex` | Module : Cryptol . .
Copyright : ( c ) 2013 - 2016 Galois , Inc.
module Cryptol.Parser.Unlit
( unLit, PreProc(..), guessPreProc, knownExts
) where
import Data.Text(Text)
import qualified Data.Text as Text
import Data.Char(isSpace)
import System.FilePath(takeExtension)
import Cryptol.Utils.Panic
data PreProc = None | Markdown | LaTeX | RST
knownExts :: [String]
knownExts =
[ "cry"
, "tex"
, "markdown"
, "md"
, "rst"
]
guessPreProc :: FilePath -> PreProc
guessPreProc file = case takeExtension file of
".tex" -> LaTeX
".markdown" -> Markdown
".md" -> Markdown
".rst" -> RST
_ -> None
unLit :: PreProc -> Text -> Text
unLit None = id
unLit proc = Text.unlines . concatMap toCryptol . preProc proc . Text.lines
preProc :: PreProc -> [Text] -> [Block]
preProc p =
case p of
None -> return . Code
Markdown -> markdown
LaTeX -> latex
RST -> rst
data Block = Code [Text] | Comment [Text]
toCryptol :: Block -> [Text]
toCryptol (Code xs) = xs
toCryptol (Comment ls) =
case ls of
[] -> []
[l] -> [ "/* " `Text.append` l `Text.append` " */" ]
l1 : rest -> let (more, l) = splitLast rest
in "/* " `Text.append` l1 : more ++ [ l `Text.append` " */" ]
where
splitLast [] = panic "Cryptol.Parser.Unlit.toCryptol" [ "splitLast []" ]
splitLast [x] = ([], x)
splitLast (x : xs) = let (ys,y) = splitLast xs
in (x:ys,y)
mk :: ([Text] -> Block) -> [Text] -> [Block]
mk _ [] = []
mk c ls = [ c (reverse ls) ]
markdown :: [Text] -> [Block]
markdown = blanks []
where
comment current [] = mk Comment current
comment current (l : ls)
| Just op <- isOpenFence l = mk Comment (l : current) ++ fenced op [] ls
| isBlank l = blanks (l : current) ls
| otherwise = comment (l : current) ls
blanks current [] = mk Comment current
blanks current (l : ls)
| Just op <- isOpenFence l = mk Comment (l : current) ++ fenced op [] ls
| isCodeLine l = mk Comment current ++ code [l] ls
| isBlank l = blanks (l : current) ls
| otherwise = comment (l : current) ls
code current [] = mk Code current
code current (l : ls)
| isCodeLine l = code (l : current) ls
| otherwise = mk Code current ++ comment [] (l : ls)
fenced op current (l : ls)
| isCloseFence l = mk op current ++ comment [l] ls
| otherwise = fenced op (l : current) ls
isOpenFence l
| "```" `Text.isPrefixOf` l' =
Just $ case Text.dropWhile isSpace (Text.drop 3 l') of
l'' | "cryptol" `Text.isPrefixOf` l'' -> Code
| isBlank l'' -> Code
| otherwise -> Comment
| otherwise = Nothing
where
l' = Text.dropWhile isSpace l
isCloseFence l = "```" `Text.isPrefixOf` Text.dropWhile isSpace l
isBlank l = Text.all isSpace l
isCodeLine l = "\t" `Text.isPrefixOf` l || " " `Text.isPrefixOf` l
latex :: [Text] -> [Block]
latex = comment []
where
comment current [] = mk Comment current
comment current (l : ls)
| isBeginCode l = mk Comment (l : current) ++ code [] ls
| otherwise = comment (l : current) ls
code current [] = mk Code current
code current (l : ls)
| isEndCode l = mk Code current ++ comment [l] ls
| otherwise = code (l : current) ls
isBeginCode l = "\\begin{code}" `Text.isPrefixOf` l
isEndCode l = "\\end{code}" `Text.isPrefixOf` l
rst :: [Text] -> [Block]
rst = comment []
where
isBeginCode l = case filter (not . Text.null) (Text.split isSpace l) of
["..", dir, "cryptol"] -> dir == "code-block::" ||
dir == "sourcecode::"
_ -> False
isEmpty = Text.all isSpace
isCode l = case Text.uncons l of
Just (c, _) -> isSpace c
Nothing -> True
comment acc ls =
case ls of
[] -> mk Comment acc
l : ls1 | isBeginCode l -> codeOptions (l : acc) ls1
| otherwise -> comment (l : acc) ls1
codeOptions acc ls =
case ls of
[] -> mk Comment acc
l : ls1 | isEmpty l -> mk Comment (l : acc) ++ code [] ls1
| otherwise -> codeOptions (l : acc) ls1
code acc ls =
case ls of
[] -> mk Code acc
l : ls1 | isCode l -> code (l : acc) ls1
| otherwise -> mk Code acc ++ comment [] ls
|
9c82ccfd3baa064520a6218b1c49a89674d6d739b01fb40372b4ad0a240f33af | jtdaugherty/vty | Debug.hs | Copyright 2009 - 2010
module Graphics.Vty.Debug
( MockWindow(..)
, regionForWindow
, allSpansHaveWidth
, spanOpsAffectedColumns
, spanOpsAffectedRows
)
where
import Graphics.Vty.Attributes
import Graphics.Vty.Image (DisplayRegion)
import Graphics.Vty.Span
import qualified Data.Vector as Vector
rowOpsAffectedColumns :: DisplayOps -> [Int]
rowOpsAffectedColumns ops
= Vector.toList $ Vector.map spanOpsAffectedColumns ops
allSpansHaveWidth :: DisplayOps -> Int -> Bool
allSpansHaveWidth ops expected
= all (== expected) $ Vector.toList $ Vector.map spanOpsAffectedColumns ops
spanOpsAffectedRows :: DisplayOps -> Int
spanOpsAffectedRows ops
= toEnum $ length (filter (not . null . Vector.toList) (Vector.toList ops))
type SpanConstructLog = [SpanConstructEvent]
data SpanConstructEvent = SpanSetAttr Attr
isSetAttr :: Attr -> SpanConstructEvent -> Bool
isSetAttr expectedAttr (SpanSetAttr inAttr)
| inAttr == expectedAttr = True
isSetAttr _attr _event = False
data MockWindow = MockWindow Int Int
deriving (Show, Eq)
regionForWindow :: MockWindow -> DisplayRegion
regionForWindow (MockWindow w h) = (w,h)
| null | https://raw.githubusercontent.com/jtdaugherty/vty/2f8c92b8af5cd82d0746d6cf90bb32f97e564fd2/src/Graphics/Vty/Debug.hs | haskell | Copyright 2009 - 2010
module Graphics.Vty.Debug
( MockWindow(..)
, regionForWindow
, allSpansHaveWidth
, spanOpsAffectedColumns
, spanOpsAffectedRows
)
where
import Graphics.Vty.Attributes
import Graphics.Vty.Image (DisplayRegion)
import Graphics.Vty.Span
import qualified Data.Vector as Vector
rowOpsAffectedColumns :: DisplayOps -> [Int]
rowOpsAffectedColumns ops
= Vector.toList $ Vector.map spanOpsAffectedColumns ops
allSpansHaveWidth :: DisplayOps -> Int -> Bool
allSpansHaveWidth ops expected
= all (== expected) $ Vector.toList $ Vector.map spanOpsAffectedColumns ops
spanOpsAffectedRows :: DisplayOps -> Int
spanOpsAffectedRows ops
= toEnum $ length (filter (not . null . Vector.toList) (Vector.toList ops))
type SpanConstructLog = [SpanConstructEvent]
data SpanConstructEvent = SpanSetAttr Attr
isSetAttr :: Attr -> SpanConstructEvent -> Bool
isSetAttr expectedAttr (SpanSetAttr inAttr)
| inAttr == expectedAttr = True
isSetAttr _attr _event = False
data MockWindow = MockWindow Int Int
deriving (Show, Eq)
regionForWindow :: MockWindow -> DisplayRegion
regionForWindow (MockWindow w h) = (w,h)
| |
4a9fdb2e6f6ada804d5a8fbb29d0809ebd4281664a031c080409eb2bb72f39c8 | samaaron/arnold | grumbles.clj | (ns arnold.grumbles
(:use [overtone.live]))
Inspired by an example in an early chapter of the SuperCollider book
(definst grumble [speed 6 freq-mul 1]
(let [snd (mix (map #(* (sin-osc (* % freq-mul 100))
(max 0 (+ (lf-noise1:kr speed)
(line:kr 1 -1 30 :action FREE))))
[1 (/ 2 3) (/ 3 2) 2]))]
(pan2 snd (sin-osc:kr 50))))
(grumble :freq-mul 1)
(ctl grumble :speed 3000)
(volume (/ 127 127))
| null | https://raw.githubusercontent.com/samaaron/arnold/e8daa3ba14dc0d654740750d6cf02ef42cd0fc2e/src/arnold/grumbles.clj | clojure | (ns arnold.grumbles
(:use [overtone.live]))
Inspired by an example in an early chapter of the SuperCollider book
(definst grumble [speed 6 freq-mul 1]
(let [snd (mix (map #(* (sin-osc (* % freq-mul 100))
(max 0 (+ (lf-noise1:kr speed)
(line:kr 1 -1 30 :action FREE))))
[1 (/ 2 3) (/ 3 2) 2]))]
(pan2 snd (sin-osc:kr 50))))
(grumble :freq-mul 1)
(ctl grumble :speed 3000)
(volume (/ 127 127))
| |
2df8c473bd8d4b38eb1c6d66f18bdeb20296613f7784ab07674023d68b84cfd3 | rowangithub/DOrder | mtype.mli | (***********************************************************************)
(* *)
(* Objective Caml *)
(* *)
, projet Cristal , INRIA Rocquencourt
(* *)
Copyright 1996 Institut National de Recherche en Informatique et
en Automatique . All rights reserved . This file is distributed
under the terms of the Q Public License version 1.0 .
(* *)
(***********************************************************************)
$ I d : mtype.mli 6196 2004 - 04 - 09 13:32:28Z xleroy $
(* Operations on module types *)
open Types
val scrape: Env.t -> module_type -> module_type
(* Expand toplevel module type abbreviations
till hitting a "hard" module type (signature, functor,
or abstract module type ident. *)
val freshen: module_type -> module_type
(* Return an alpha-equivalent copy of the given module type
where bound identifiers are fresh. *)
val strengthen: Env.t -> module_type -> Path.t -> module_type
(* Strengthen abstract type components relative to the
given path. *)
val nondep_supertype: Env.t -> Ident.t -> module_type -> module_type
(* Return the smallest supertype of the given type
in which the given ident does not appear.
Raise [Not_found] if no such type exists. *)
val no_code_needed: Env.t -> module_type -> bool
val no_code_needed_sig: Env.t -> signature -> bool
(* Determine whether a module needs no implementation code,
i.e. consists only of type definitions. *)
val enrich_modtype: Env.t -> Path.t -> module_type -> module_type
val enrich_typedecl: Env.t -> Path.t -> type_declaration -> type_declaration
val type_paths: Env.t -> Path.t -> module_type -> Path.t list
| null | https://raw.githubusercontent.com/rowangithub/DOrder/e0d5efeb8853d2a51cc4796d7db0f8be3185d7df/typing/mtype.mli | ocaml | *********************************************************************
Objective Caml
*********************************************************************
Operations on module types
Expand toplevel module type abbreviations
till hitting a "hard" module type (signature, functor,
or abstract module type ident.
Return an alpha-equivalent copy of the given module type
where bound identifiers are fresh.
Strengthen abstract type components relative to the
given path.
Return the smallest supertype of the given type
in which the given ident does not appear.
Raise [Not_found] if no such type exists.
Determine whether a module needs no implementation code,
i.e. consists only of type definitions. | , projet Cristal , INRIA Rocquencourt
Copyright 1996 Institut National de Recherche en Informatique et
en Automatique . All rights reserved . This file is distributed
under the terms of the Q Public License version 1.0 .
$ I d : mtype.mli 6196 2004 - 04 - 09 13:32:28Z xleroy $
open Types
val scrape: Env.t -> module_type -> module_type
val freshen: module_type -> module_type
val strengthen: Env.t -> module_type -> Path.t -> module_type
val nondep_supertype: Env.t -> Ident.t -> module_type -> module_type
val no_code_needed: Env.t -> module_type -> bool
val no_code_needed_sig: Env.t -> signature -> bool
val enrich_modtype: Env.t -> Path.t -> module_type -> module_type
val enrich_typedecl: Env.t -> Path.t -> type_declaration -> type_declaration
val type_paths: Env.t -> Path.t -> module_type -> Path.t list
|
be9502714e559bd7b77ab080081dfa5f25de2806ba78ae8c1e9a235d9e5538a7 | brendanhay/gogol | Types.hs | # LANGUAGE DataKinds #
# LANGUAGE DeriveGeneric #
# LANGUAGE DerivingStrategies #
# LANGUAGE DuplicateRecordFields #
# LANGUAGE FlexibleInstances #
# LANGUAGE GeneralizedNewtypeDeriving #
# LANGUAGE LambdaCase #
{-# LANGUAGE OverloadedStrings #-}
# LANGUAGE PatternSynonyms #
# LANGUAGE RecordWildCards #
{-# LANGUAGE StrictData #-}
# LANGUAGE TypeFamilies #
# LANGUAGE TypeOperators #
# LANGUAGE NoImplicitPrelude #
# OPTIONS_GHC -fno - warn - duplicate - exports #
# OPTIONS_GHC -fno - warn - name - shadowing #
# OPTIONS_GHC -fno - warn - unused - binds #
# OPTIONS_GHC -fno - warn - unused - imports #
# OPTIONS_GHC -fno - warn - unused - matches #
-- |
Module : . Translate . Types
Copyright : ( c ) 2015 - 2022
License : Mozilla Public License , v. 2.0 .
Maintainer : < brendan.g.hay+ >
-- Stability : auto-generated
Portability : non - portable ( GHC extensions )
module Gogol.Translate.Types
( -- * Configuration
translateService,
* OAuth
CloudPlatform'FullControl,
CloudTranslation'FullControl,
-- * Types
-- ** Xgafv
Xgafv (..),
* * BatchDocumentInputConfig
BatchDocumentInputConfig (..),
newBatchDocumentInputConfig,
-- ** BatchDocumentOutputConfig
BatchDocumentOutputConfig (..),
newBatchDocumentOutputConfig,
-- ** BatchTranslateDocumentRequest
BatchTranslateDocumentRequest (..),
newBatchTranslateDocumentRequest,
-- ** BatchTranslateDocumentRequest_FormatConversions
BatchTranslateDocumentRequest_FormatConversions (..),
newBatchTranslateDocumentRequest_FormatConversions,
-- ** BatchTranslateDocumentRequest_Glossaries
BatchTranslateDocumentRequest_Glossaries (..),
newBatchTranslateDocumentRequest_Glossaries,
* *
BatchTranslateDocumentRequest_Models (..),
newBatchTranslateDocumentRequest_Models,
-- ** BatchTranslateTextRequest
BatchTranslateTextRequest (..),
newBatchTranslateTextRequest,
-- ** BatchTranslateTextRequest_Glossaries
BatchTranslateTextRequest_Glossaries (..),
newBatchTranslateTextRequest_Glossaries,
-- ** BatchTranslateTextRequest_Labels
BatchTranslateTextRequest_Labels (..),
newBatchTranslateTextRequest_Labels,
* * BatchTranslateTextRequest_Models
BatchTranslateTextRequest_Models (..),
newBatchTranslateTextRequest_Models,
-- ** CancelOperationRequest
CancelOperationRequest (..),
newCancelOperationRequest,
-- ** DetectLanguageRequest
DetectLanguageRequest (..),
newDetectLanguageRequest,
-- ** DetectLanguageRequest_Labels
DetectLanguageRequest_Labels (..),
newDetectLanguageRequest_Labels,
-- ** DetectLanguageResponse
DetectLanguageResponse (..),
newDetectLanguageResponse,
-- ** DetectedLanguage
DetectedLanguage (..),
newDetectedLanguage,
-- ** DocumentInputConfig
DocumentInputConfig (..),
newDocumentInputConfig,
-- ** DocumentOutputConfig
DocumentOutputConfig (..),
newDocumentOutputConfig,
-- ** DocumentTranslation
DocumentTranslation (..),
newDocumentTranslation,
-- ** Empty
Empty (..),
newEmpty,
-- ** GcsDestination
GcsDestination (..),
newGcsDestination,
* *
GcsSource (..),
newGcsSource,
-- ** Glossary
Glossary (..),
newGlossary,
-- ** GlossaryInputConfig
GlossaryInputConfig (..),
newGlossaryInputConfig,
-- ** InputConfig
InputConfig (..),
newInputConfig,
-- ** LanguageCodePair
LanguageCodePair (..),
newLanguageCodePair,
-- ** LanguageCodesSet
LanguageCodesSet (..),
newLanguageCodesSet,
-- ** ListGlossariesResponse
ListGlossariesResponse (..),
newListGlossariesResponse,
* * ListLocationsResponse
ListLocationsResponse (..),
newListLocationsResponse,
-- ** ListOperationsResponse
ListOperationsResponse (..),
newListOperationsResponse,
-- ** Location
Location (..),
newLocation,
-- ** Location_Labels
Location_Labels (..),
newLocation_Labels,
-- ** Location_Metadata
Location_Metadata (..),
newLocation_Metadata,
-- ** Operation
Operation (..),
newOperation,
-- ** Operation_Metadata
Operation_Metadata (..),
newOperation_Metadata,
-- ** Operation_Response
Operation_Response (..),
newOperation_Response,
-- ** OutputConfig
OutputConfig (..),
newOutputConfig,
-- ** Status
Status (..),
newStatus,
-- ** Status_DetailsItem
Status_DetailsItem (..),
newStatus_DetailsItem,
-- ** SupportedLanguage
SupportedLanguage (..),
newSupportedLanguage,
* * SupportedLanguages
SupportedLanguages (..),
newSupportedLanguages,
* * TranslateDocumentRequest
TranslateDocumentRequest (..),
newTranslateDocumentRequest,
* * TranslateDocumentRequest_Labels
TranslateDocumentRequest_Labels (..),
newTranslateDocumentRequest_Labels,
* *
TranslateDocumentResponse (..),
newTranslateDocumentResponse,
-- ** TranslateTextGlossaryConfig
TranslateTextGlossaryConfig (..),
newTranslateTextGlossaryConfig,
-- ** TranslateTextRequest
TranslateTextRequest (..),
newTranslateTextRequest,
-- ** TranslateTextRequest_Labels
TranslateTextRequest_Labels (..),
newTranslateTextRequest_Labels,
-- ** TranslateTextResponse
TranslateTextResponse (..),
newTranslateTextResponse,
-- ** Translation
Translation (..),
newTranslation,
-- ** WaitOperationRequest
WaitOperationRequest (..),
newWaitOperationRequest,
)
where
import qualified Gogol.Prelude as Core
import Gogol.Translate.Internal.Product
import Gogol.Translate.Internal.Sum
-- | Default request referring to version @v3@ of the Cloud Translation API. This contains the host and root path used as a starting point for constructing service requests.
translateService :: Core.ServiceConfig
translateService =
Core.defaultService
(Core.ServiceId "translate:v3")
"translation.googleapis.com"
| See , edit , configure , and delete your Google Cloud data and see the email address for your Google Account .
type CloudPlatform'FullControl = "-platform"
| Translate text from one language to another using Google Translate
type CloudTranslation'FullControl = "-translation"
| null | https://raw.githubusercontent.com/brendanhay/gogol/fffd4d98a1996d0ffd4cf64545c5e8af9c976cda/lib/services/gogol-translate/gen/Gogol/Translate/Types.hs | haskell | # LANGUAGE OverloadedStrings #
# LANGUAGE StrictData #
|
Stability : auto-generated
* Configuration
* Types
** Xgafv
** BatchDocumentOutputConfig
** BatchTranslateDocumentRequest
** BatchTranslateDocumentRequest_FormatConversions
** BatchTranslateDocumentRequest_Glossaries
** BatchTranslateTextRequest
** BatchTranslateTextRequest_Glossaries
** BatchTranslateTextRequest_Labels
** CancelOperationRequest
** DetectLanguageRequest
** DetectLanguageRequest_Labels
** DetectLanguageResponse
** DetectedLanguage
** DocumentInputConfig
** DocumentOutputConfig
** DocumentTranslation
** Empty
** GcsDestination
** Glossary
** GlossaryInputConfig
** InputConfig
** LanguageCodePair
** LanguageCodesSet
** ListGlossariesResponse
** ListOperationsResponse
** Location
** Location_Labels
** Location_Metadata
** Operation
** Operation_Metadata
** Operation_Response
** OutputConfig
** Status
** Status_DetailsItem
** SupportedLanguage
** TranslateTextGlossaryConfig
** TranslateTextRequest
** TranslateTextRequest_Labels
** TranslateTextResponse
** Translation
** WaitOperationRequest
| Default request referring to version @v3@ of the Cloud Translation API. This contains the host and root path used as a starting point for constructing service requests. | # LANGUAGE DataKinds #
# LANGUAGE DeriveGeneric #
# LANGUAGE DerivingStrategies #
# LANGUAGE DuplicateRecordFields #
# LANGUAGE FlexibleInstances #
# LANGUAGE GeneralizedNewtypeDeriving #
# LANGUAGE LambdaCase #
# LANGUAGE PatternSynonyms #
# LANGUAGE RecordWildCards #
# LANGUAGE TypeFamilies #
# LANGUAGE TypeOperators #
# LANGUAGE NoImplicitPrelude #
# OPTIONS_GHC -fno - warn - duplicate - exports #
# OPTIONS_GHC -fno - warn - name - shadowing #
# OPTIONS_GHC -fno - warn - unused - binds #
# OPTIONS_GHC -fno - warn - unused - imports #
# OPTIONS_GHC -fno - warn - unused - matches #
Module : . Translate . Types
Copyright : ( c ) 2015 - 2022
License : Mozilla Public License , v. 2.0 .
Maintainer : < brendan.g.hay+ >
Portability : non - portable ( GHC extensions )
module Gogol.Translate.Types
translateService,
* OAuth
CloudPlatform'FullControl,
CloudTranslation'FullControl,
Xgafv (..),
* * BatchDocumentInputConfig
BatchDocumentInputConfig (..),
newBatchDocumentInputConfig,
BatchDocumentOutputConfig (..),
newBatchDocumentOutputConfig,
BatchTranslateDocumentRequest (..),
newBatchTranslateDocumentRequest,
BatchTranslateDocumentRequest_FormatConversions (..),
newBatchTranslateDocumentRequest_FormatConversions,
BatchTranslateDocumentRequest_Glossaries (..),
newBatchTranslateDocumentRequest_Glossaries,
* *
BatchTranslateDocumentRequest_Models (..),
newBatchTranslateDocumentRequest_Models,
BatchTranslateTextRequest (..),
newBatchTranslateTextRequest,
BatchTranslateTextRequest_Glossaries (..),
newBatchTranslateTextRequest_Glossaries,
BatchTranslateTextRequest_Labels (..),
newBatchTranslateTextRequest_Labels,
* * BatchTranslateTextRequest_Models
BatchTranslateTextRequest_Models (..),
newBatchTranslateTextRequest_Models,
CancelOperationRequest (..),
newCancelOperationRequest,
DetectLanguageRequest (..),
newDetectLanguageRequest,
DetectLanguageRequest_Labels (..),
newDetectLanguageRequest_Labels,
DetectLanguageResponse (..),
newDetectLanguageResponse,
DetectedLanguage (..),
newDetectedLanguage,
DocumentInputConfig (..),
newDocumentInputConfig,
DocumentOutputConfig (..),
newDocumentOutputConfig,
DocumentTranslation (..),
newDocumentTranslation,
Empty (..),
newEmpty,
GcsDestination (..),
newGcsDestination,
* *
GcsSource (..),
newGcsSource,
Glossary (..),
newGlossary,
GlossaryInputConfig (..),
newGlossaryInputConfig,
InputConfig (..),
newInputConfig,
LanguageCodePair (..),
newLanguageCodePair,
LanguageCodesSet (..),
newLanguageCodesSet,
ListGlossariesResponse (..),
newListGlossariesResponse,
* * ListLocationsResponse
ListLocationsResponse (..),
newListLocationsResponse,
ListOperationsResponse (..),
newListOperationsResponse,
Location (..),
newLocation,
Location_Labels (..),
newLocation_Labels,
Location_Metadata (..),
newLocation_Metadata,
Operation (..),
newOperation,
Operation_Metadata (..),
newOperation_Metadata,
Operation_Response (..),
newOperation_Response,
OutputConfig (..),
newOutputConfig,
Status (..),
newStatus,
Status_DetailsItem (..),
newStatus_DetailsItem,
SupportedLanguage (..),
newSupportedLanguage,
* * SupportedLanguages
SupportedLanguages (..),
newSupportedLanguages,
* * TranslateDocumentRequest
TranslateDocumentRequest (..),
newTranslateDocumentRequest,
* * TranslateDocumentRequest_Labels
TranslateDocumentRequest_Labels (..),
newTranslateDocumentRequest_Labels,
* *
TranslateDocumentResponse (..),
newTranslateDocumentResponse,
TranslateTextGlossaryConfig (..),
newTranslateTextGlossaryConfig,
TranslateTextRequest (..),
newTranslateTextRequest,
TranslateTextRequest_Labels (..),
newTranslateTextRequest_Labels,
TranslateTextResponse (..),
newTranslateTextResponse,
Translation (..),
newTranslation,
WaitOperationRequest (..),
newWaitOperationRequest,
)
where
import qualified Gogol.Prelude as Core
import Gogol.Translate.Internal.Product
import Gogol.Translate.Internal.Sum
translateService :: Core.ServiceConfig
translateService =
Core.defaultService
(Core.ServiceId "translate:v3")
"translation.googleapis.com"
| See , edit , configure , and delete your Google Cloud data and see the email address for your Google Account .
type CloudPlatform'FullControl = "-platform"
| Translate text from one language to another using Google Translate
type CloudTranslation'FullControl = "-translation"
|
550378a5ab81106d83330035ddf20783099f9a88de39132bbaa3ab593e60aeee | fp-works/2019-winter-Haskell-school | Exercise02Spec.hs | module CIS194.Homework05.Exercise02Spec where
import CIS194.Homework05.Exercise02
import Test.Tasty.Hspec
spec_evalStr :: Spec
spec_evalStr =
it "evaluates the value correctly" $ do
evalStr "(2+3)*4" `shouldBe` Just 20
evalStr "2+3*4" `shouldBe` Just 14
evalStr "2+3*" `shouldBe` Nothing
evalStr "" `shouldBe` Nothing
evalStr " " `shouldBe` Nothing
| null | https://raw.githubusercontent.com/fp-works/2019-winter-Haskell-school/823b67f019b9e7bc0d3be36711c0cc7da4eba7d2/cis194/week5/daniel-deng/test/Exercise02Spec.hs | haskell | module CIS194.Homework05.Exercise02Spec where
import CIS194.Homework05.Exercise02
import Test.Tasty.Hspec
spec_evalStr :: Spec
spec_evalStr =
it "evaluates the value correctly" $ do
evalStr "(2+3)*4" `shouldBe` Just 20
evalStr "2+3*4" `shouldBe` Just 14
evalStr "2+3*" `shouldBe` Nothing
evalStr "" `shouldBe` Nothing
evalStr " " `shouldBe` Nothing
| |
781e108fe8a9080bea34b5200cbb3df6a11d481adb8a65ddb6f957499affd22a | OCamlPro/directories | directories.mli | module Base_dirs () : sig
val home_dir : string option
val cache_dir : string option
val config_dir : string option
val data_dir : string option
val data_local_dir : string option
val preference_dir : string option
val runtime_dir : string option
val state_dir : string option
val executable_dir : string option
end
module User_dirs () : sig
val home_dir : string option
val audio_dir : string option
val desktop_dir : string option
val document_dir : string option
val download_dir : string option
val font_dir : string option
val picture_dir : string option
val public_dir : string option
val template_dir : string option
val video_dir : string option
end
module Project_dirs (App_id : sig
val qualifier : string
val organization : string
val application : string
end) : sig
val cache_dir : string option
val config_dir : string option
val data_dir : string option
val data_local_dir : string option
val preference_dir : string option
val runtime_dir : string option
val state_dir : string option
end
| null | https://raw.githubusercontent.com/OCamlPro/directories/1cf7211f918fa909e5f77c0dfbb059c74071e99b/src/directories.mli | ocaml | module Base_dirs () : sig
val home_dir : string option
val cache_dir : string option
val config_dir : string option
val data_dir : string option
val data_local_dir : string option
val preference_dir : string option
val runtime_dir : string option
val state_dir : string option
val executable_dir : string option
end
module User_dirs () : sig
val home_dir : string option
val audio_dir : string option
val desktop_dir : string option
val document_dir : string option
val download_dir : string option
val font_dir : string option
val picture_dir : string option
val public_dir : string option
val template_dir : string option
val video_dir : string option
end
module Project_dirs (App_id : sig
val qualifier : string
val organization : string
val application : string
end) : sig
val cache_dir : string option
val config_dir : string option
val data_dir : string option
val data_local_dir : string option
val preference_dir : string option
val runtime_dir : string option
val state_dir : string option
end
| |
577dbb0b7fdf1c1e5721aa454b40c897362e50e20fc91376f78790fc097a34a3 | denisidoro/rosebud | core.clj | (ns fundo.logic.core
(:require [clj-time.format :as time.format]
[quark.beta.math.point :as point]
[quark.beta.time :as time]))
(def ^:private formatter (time.format/formatter "yyyyMMdd"))
(defn ^:private fundo-entry->point
[{:keys [c d p q]}]
(point/new
(time/date-str->millis (str d) formatter)
c))
(defn as-bucket
[cnpj body]
{:bucket/id (keyword "fundo" (str cnpj))
:bucket/path [:fundo cnpj]
:history/gross (map fundo-entry->point body)})
| null | https://raw.githubusercontent.com/denisidoro/rosebud/90385528d9a75a0e17803df487a4f6cfb87e981c/server/src/fundo/logic/core.clj | clojure | (ns fundo.logic.core
(:require [clj-time.format :as time.format]
[quark.beta.math.point :as point]
[quark.beta.time :as time]))
(def ^:private formatter (time.format/formatter "yyyyMMdd"))
(defn ^:private fundo-entry->point
[{:keys [c d p q]}]
(point/new
(time/date-str->millis (str d) formatter)
c))
(defn as-bucket
[cnpj body]
{:bucket/id (keyword "fundo" (str cnpj))
:bucket/path [:fundo cnpj]
:history/gross (map fundo-entry->point body)})
| |
10792c6d1604ad5439b5c83e7516a895d2c7ed4cbcce7872347f44495c0f56f4 | dalaing/little-languages | Value.hs | module Components.Term.Nat.Eval.Value (
nv
, valueInput
) where
import Data.Foldable (asum)
import Control.Lens (preview, review)
import Control.Monad.Reader (ReaderT(..))
import Common.Recursion (Step(..))
import Common.Term.Eval.Value (ValueInput(..))
import Components.Term.Nat.Data
valueTmZero :: WithNatTerm ty tm
=> tm
-> Maybe tm
valueTmZero =
fmap (review _TmZero) .
preview _TmZero
valueTmSucc :: WithNatTerm ty tm
=> tm
-> Maybe tm
valueTmSucc tm = do
n <- preview _TmSucc tm
-- this is the strict version
n' <- nv n
return $ review _TmSucc n'
nv :: WithNatTerm ty tm
=> tm
-> Maybe tm
nv tm =
asum .
map ($ tm) $
[ valueTmZero
, valueTmSucc
]
valueInput :: WithNatTerm ty tm
=> ValueInput tm
valueInput =
ValueInput [SBase $ ReaderT nv]
| null | https://raw.githubusercontent.com/dalaing/little-languages/9f089f646a5344b8f7178700455a36a755d29b1f/code/old/multityped/nb-modular/src/Components/Term/Nat/Eval/Value.hs | haskell | this is the strict version | module Components.Term.Nat.Eval.Value (
nv
, valueInput
) where
import Data.Foldable (asum)
import Control.Lens (preview, review)
import Control.Monad.Reader (ReaderT(..))
import Common.Recursion (Step(..))
import Common.Term.Eval.Value (ValueInput(..))
import Components.Term.Nat.Data
valueTmZero :: WithNatTerm ty tm
=> tm
-> Maybe tm
valueTmZero =
fmap (review _TmZero) .
preview _TmZero
valueTmSucc :: WithNatTerm ty tm
=> tm
-> Maybe tm
valueTmSucc tm = do
n <- preview _TmSucc tm
n' <- nv n
return $ review _TmSucc n'
nv :: WithNatTerm ty tm
=> tm
-> Maybe tm
nv tm =
asum .
map ($ tm) $
[ valueTmZero
, valueTmSucc
]
valueInput :: WithNatTerm ty tm
=> ValueInput tm
valueInput =
ValueInput [SBase $ ReaderT nv]
|
52fced23b09c95c9ed64194b2572afdbca1ef5fec235745c05dcb7e001c1cc16 | practicalli/clojure-through-code | 01_basics.clj | namespaces are similar to packages in Java , in that they are a grouping of data and behaviour
namespaces allow you to structure your Clojure code into logical groupings
namesaces help you use functions defined in one namespace in a different namespace
;; using the (use) function in clojure.
(ns clojure-through-code.01-basics
(:require [clojure.string]))
;; (:require 'clojure.repl)
;; (:require [clojure.repl] :refer :all)
;;;;;;;;;;;;;;;;;;;;;;;
Clojure Syntax
Clojure uses a prefix notation and ( ) [ ] : { } # @ ! special characters
;; no need for lots of ; , and other silly things...
All behaviour in Clojure is defined in a List , with the first elemtent being a function
;; and the remaining elements being arguments to that function.
;;;;;;;;;;;;;;;;;;;;;;;;;;
;; What is my environment
Clojure has built in symbols , which start and end with *
;; Symbols can be evaluated outside of a list structure,
;; functions (the behaviour of your application) and their
;; arguments are contained within a list structure ()
;; The full clojure version
can be used to check you are running a particular version , major or minor of Clojure core
*clojure-version*
The version info for Clojure core , as a map containing : major : minor
;; :incremental and :qualifier keys. Feature releases may increment
;; :minor and/or :major, bugfix releases will increment :incremental.
Possible values of : qualifier include " GA " , " SNAPSHOT " , " RC - x " " BETA - x "
The directory where the Clojure compiler will create the .class files for the current project
;; This directory must be in the classpath for 'compile' to work.
*compile-path*
;; The path of the file being evaluated, as a String. In the REPL the value is not defined.
*file*
;; A clojure.lang.Namespace object representing the current namespace
*ns*
;; most recent repl values
*1
*2
*3
;;;;;;;;;;;;;;;;;;;;;;;;;
Using Java Interoperability
java.lang is part of the Clojure runtime environment , so when ever you run a REPL you can call any methods without having to import them or include any dependencies
From java.lang . System getProperty ( ) as documented at :
;;
(System/getProperty "java.version")
(System/getProperty "java.vm.name")
Java properties can be obtained by calling
from java.lang . As System.getProperty is called as a function
;; in clojure it needs to be wrapped in a list structure.
Make the result prettier using the Clojure str function
(str "Current Java version: " (System/getProperty "java.version"))
;; We can also get the version of the project
(System/getProperty "clojure-through-code.version")
Chaining a few Clojure functions together , to read from
the Leiningen project file
;; Getting the version number of the project
Information can be read from the Clojure project.clj file using the slurp function
(slurp "project.clj")
= > " ( defproject clojure - through - code \"20.1.5 - SNAPSHOT\"\n : description \"Learning Clojure by evaluating code on the fly\"\n : url \"\"\n : license { : name \"Eclipse Public License\"\n : url \" / legal / epl - v10.html\"}\n : dependencies [ [ org.clojure/clojure \"1.6.0\"]])\n\n "
;; The value returned by slurp is a bit messy, so we can tidy it up with read-string
(read-string (slurp "project.clj"))
= > ( defproject clojure - through - code " 20.1.5 - SNAPSHOT " : description " Learning Clojure by evaluating code on the fly " : url " " : license { : name " Eclipse Public License " , : url " -v10.html " } : dependencies [ [ org.clojure/clojure " 1.6.0 " ] ] )
;; rather than have all the information from the file, we just want to get the project version
;; Using the nth function we can select which element we actually want
(nth (read-string (slurp "project.clj")) 2)
= > " 20.1.5 - SNAPSHOT "
;; The above code is classic Lisp, you read it from the inside out, so in this case you
;; start with (slurp ...) and what it returns is used as the argument to read-string...
;; Get the contents of the project.clj file using `slurp`
;; Read the text of that file using read-string
Select just the third string using nth 2 ( using an index starting at 0 )
;; You can format the code differently, but in this case its not much easier to read
(nth
(read-string
(slurp "project.clj"))
2)
;; the same behaviour as above can be written using the threading macro
;; which can make code easier to read by reading sequentially down the list of functions.
(->
"./project.clj"
slurp
read-string
(nth 2))
;; Using the threading macro, the result of every function is passed onto the next function
;; in the list. This can be seen very clearly usng ,,, to denote where the value is passed
;; to the next function
(->
"./project.clj"
slurp ,,,
read-string ,,,
(nth ,,, 2))
;; Remember, commas in clojure are ignored
;; To make this really simple lets create a contrived example of the threading macro.
;; Here we use the str function to join strings together. Each individual string call
joins its own strings together , then passes them as a single string as the first argument to the next function
(->
(str "This" " " "is" " ")
(str "the" " " "treading" " " "macro" " ")
(str "in" " " "action."))
;; Using the ->> threading macro, the result of a function is passed as the last parameter
;; of the next function call. So in another simple series of str function calls,
;; our text comes out backwards.
(->>
(str "This" " ")
(str "is" " ")
(str "backwards" " "))
;; Threading macro is very useful for passing a collection through a number of functions,
;; each function manipulating that collection in a specific way before passing it on to the next.
(-> [2 5 4 1 3 6]
(reverse)
(rest)
(sort)
(last))
;; add all project information to a map
(->> "project.clj"
slurp
read-string
(drop 2)
(cons :version)
(apply hash-map)
(def project))
;; Threading macros and println statements
If you use a print or println function in a threading macro , then part of the value will be lost , as those functions return a value of nil .
(-> "message"
(str " " "in a bottle")
println
(str ", The Police"))
;; => ", The Police"
The initial part of the message before the println funciton is called has been dropped because println returned nil . Therefore nil was the value passed as the first argument to tne next function , rather than " message in a bottle " .
;; Using the doto function with println we can pass the value on as the return value and pass the value to be printed in the console.
(doto "message in a bottle" println)
;; => "message in a bottle"
;; So putting this doto function in our threading macro now works
(-> "Message"
(str " " "in a bottle")
(doto println)
(str " - " "The Police"))
;; => "Message in a bottle - The Police"
;; defining functions
(def fred "I am free")
(def five 5)
(def five 6)
(def five [1 2 3 4 5 6 7 8])
five
(reduce + five)
(reduce + [1 2 3 4 5 6 7 8])
= > 36
;; defn is a macro that builds on def
(defn my-function [] (str "I wish I was fred"))
;; defining a function with def
(def my-function
(fn [args] (str "behaviour")))
;; anonymous function
(fn [args] (str "behaviour"))
;; anonymous function syntax sugar
;; An anonymous function is defined with the #() syntax where % is a placeholder for the arguments.
(#(* % %) 6) ;; square a number (fn [num] (* num num))
add three ( fn [ num ] ( + num 3 ) )
add 3 arguments ( fn [ arg1 arg2 arg3 ] ( + arg1 arg2 arg3 4 5 ) )
;;
;;;;;;;;;;;;;;;;;;;;;;;
;; Working with strings
You could use the Java - like function ` println ` to output strings .
(println "Hello, whats different with me? What value do I return")
However , something different happens when you evaluate this expression . This is refered to as a side - effect because when you call this function it returns nil . The actual text is output to the REPL or console .
In Clojure , you are more likely to use the ` str ` function when working with strings .
(str "Hello, I am returned as a value of this expression")
;; join strings together with the function str
(str "Hello" ", " "HackTheTower UK")
using println in LightTable shows the results in console window , as its a side affect
;; using srt you see the results of the evaluation inline with the code,
; as the result of a definition or an expression.
;; Avoid code that creates side-effects where possible to keep your software less complex.
;; using the fast feedback of the REPL usually works beter than println statements in debuging
;;;;;;;;;;;;;;;;;;;;;;;;
Simple math to show you the basic structure of Clojure
; Math is straightforward
(+ 3 (/ 4 2) (* 3 5))
(+ 1 1 2489 459 2.7)
(->
(+ 12 144 20 (* 3 (Math/sqrt 4)))
(/ 7)
(+ (* 5 11))
(= (+ 0.0 (* 9 9))))
(Math/sqrt 4)
= > 1
= > 2
(/ 1 2)
(type (/ 22 7.0))
(/ 5000 20000)
(type (Integer. "2"))
The above is the same as the Java statement Integer myInt = new Integer("2 " )
(/ (* 22/7 3) 3)
;; Ratios delay the need to drop into decimal numbers. Once you create a decimal number then everything it touches had a greater potential to becoming a decimal
Clojure uses Prefix notation , so math operations on many arguments is easy .
(+ 1 2 3 4 5)
(+ 1 2 (* 3 4) (- 5 6 -7))
(+)
(*)
(* 2)
(+ 4)
Variadic functions
(+ 1 2 3)
(< 1 2 3)
(< 1 3 8 4)
( remaining 22 7 )
(inc 3)
(dec 4)
(min 1 2 3 5 8 13)
(max 1 2 3 5 8 13)
(apply + [1 2 3])
(reduce + [1 2 3])
(apply / [1 2 3])
(/ 53)
(map + [1 2 3.0] [4.0 5 6])
(repeat 4 9)
; Equality is =
(= 1 1) ; => true
(= 2 1) ; => false
;; Equality is very useful when your data structures are immutable
; You need not for logic, too
(not true) ; => false
(identical? "foo" "bar")
(identical? "foo" "foo")
(= "foo" "bar")
(= "foo" "foo")
(identical? :foo :bar)
(identical? :foo :foo)
;; Keywords exist as identifiers and for very fast comparisons
(def my-map {:foo "a"})
(= "a" (:foo my-map))
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
Truethy experiments
;; some truthiness with math functions - looking at types
(+)
(class (+))
(*)
(true? +)
(false? +)
(true? *)
(false? *)
(true? 1)
(true? -1)
(true? true)
(true? (not false))
(- 2)
; (class (/)) ;; wrong number of arguments error
(= 4 (inc 2))
;; => false
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;; Conditionals
;; if something is true, do this, else do that
(if false
"hello"
(do (+ 3 4)
(str "goodbye")))
(if false "one" "two")
(if nil "uh" "oh")
(if false "Hello word" "Goodbye crule world")
;; cond - if condition true, do this, :otherwise do that
(cond
(zero? (- (* 4 2) 8))
(= 4 (inc 2))
(= 4 (/ 8 2))
(= "Hello World" (str "Hello " "World"))
:otherwise "None of the above.")
(cond
(= 7 (inc 2)) "(inc 2) is not 7, so this condition is false"
(= 16 (* 8 2)) "This is the first correct condition so its associated expression is returned"
(zero? (- (* 8 8) 64)) "This is true but not returned as a previous condition is true"
:otherwise "None of the above are true")
;; when true do the following
(when (> 8 2)
"Higher")
;; Predicates - take a value and return a boolean result (true | false)
(true? true)
(true? (not true))
(true? false)
(true? (not false))
(true? nil)
; Types
;;;;;;;;;;;;;
Clojure uses Java 's object types for booleans , strings and numbers .
; Use `class` to inspect them.
(class 1)
Integer literals are java.lang . Long by default
(class 1.1) ; Float literals are java.lang.Double
(class "")
; Strings always double-quoted, and are java.lang.String
(class false) ; Booleans are java.lang.Boolean
(class nil) ; The "null" value is called nil
(class (list 1 2 3 4))
(class true)
(class ())
(class (list 1 2 34 5))
(class (str 2 3 4 5))
(class (+ 22/7))
(class 5)
(class "fish")
(type [1 2 3])
(type {:a 1 :b 2})
(type (take 3 (range 10)))
(take 10 (range))
(type (Integer. "8080"))
(type "This is a string")
(type '(1 2 3 4))
(type 1)
(type "I am a string")
(type :i-am-a-keyword)
(type 22/7)
(type 'def)
(type 'defn)
(type '(1 2 3 4))
(type [1 2 3 4])
(type {:a 1 :b 2})
(type #{1 2 3 4})
;; Ratios
To help maintain the precision of numbers , Clojure has a type called Ratio
;; So when you are dividing numbers you can keep the as a fraction using whole numbers
;; rather than constrain the result to a approximate
(/ 2)
A classic example is dividing 22 by 7 which is approximately the value of Pi
(/ 22 7)
(class (/ 22 7))
If you want to force Clojure to evaluate this then you can specify one of the
;; numbers with a decimal point
(class (/ 22 7.0))
(/ 14 4)
7/2
(* (/ 22 7) 7)
(type 7.0)
;; Is something a thing
(instance? String "hello")
(instance? Double 3.14)
(instance? Number 3.14)
(instance? java.util.Date #inst "2015-01-01")
;; Lets try and break clojure with Math
;; (/ 22 0)
ArithmeticException Divide by zero clojure.lang.Numbers.divide ( Numbers.java:156 )
java.lang . * packages are included in all Clojure projects , so you can call the
;; Java Math functions easily
(Math/sqrt 4)
(Math/sqrt 13)
(Math/PI)
(.toUpperCase "bla")
;;(new yourObjectName)
;; (. youObjectName)
Lets have some maths fun and see how Clojure deals with this
(Math/sqrt -1)
So Clojure , well Java really as its the Java Math class methods , deals with interesting
;; mathematical concepts like the square-root of minus one.
So what does NaN mean . Well by consulting Stack Overflow , a NaN is produced if a floating point operation would produce an undefinable result . Other examples include dividing 0.0 by 0.0 is arithmetically undefined .
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
Clojure projects
Install Leiningen build tool from leingingen.org
Create a new project with new project - name
Run the repl using repl
;; Look at the project configuration file project.clj
The project is defined as Clojure code using defproject macro , keywords , maps & vectors
;; In the source code src/project-name/core.clj is some sample code in a specific namespace
Namespaces are similar to packages in Java
;; A namespace is a way to organise your clojure code (data structure and function definitions)
;; The namespace represents the underlying directory and filename which contain specific data structure and function definitions
(namespace 'clojure-through-code.01-basics/my-map)
(name 'clojure-through-code.01-basics/my-map)
;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;
;; Documentation in Clojure & LightTable
Clojure functions have Documentation
- in LightTable you can right - click on a function name and select " show docs "
;; documentation is shown inline
;; Lets look at the documentation for map
(class [])
(map? [1 2 3 4])
;;;;;;;;;;;;;;;;;;;;;;;;
LightTable Settings
The configuration in LightTable uses a Clojure syntax
;; which is easy enough to understand even if you dont know
;; clojure. Essentially the configurations are a
datastructure , a map with Clojure keywords to make it
;; simple to pull out the relevant settings
;; Set up keyboard shortcuts or look at the default shortcuts
;; Settings: User keymap
;; Settings: Default keymap
General configuration settings for LightTable - eg , , themes , editor settings
;; Settings: User behaviors
;; (doto) ;; Chain functions together
;; ->
;;; cool stuff
;; user> (as-> 0 n)
0
;; user> (as-> 0 n (inc n) (inc n))
2
user > ( def x [ [ 1 2 3 ] [ 4 5 6 ] ] )
;; #'user/x
;; user> x
;; [[1 2 3] [4 5 6]]
;; user> (ffirst x)
1
user > ( first x )
;; [1 2 3]
;; user> (assoc nil :a)
ArityException Wrong number of args ( 2 ) passed to : core / assoc clojure.lang . AFn.throwArity ( AFn.java:429 )
user > ( assoc nil : a 1 )
{ : a 1 }
user > ( filter identity @)RuntimeException Unmatched delimiter : ) clojure.lang . Util.runtimeException ( Util.java:221 )
;; user> (filter identity '(1 2 3 nil))
;; (1 2 3)
;; user> (identity nil)
;; nil
;; user> (true? nil)
;; false
Paredit
;; Alt-up - get rid of parent
(def a "I have a name")
;; (def :a "What about keywords")
;; => keywords cannot be used as names, as keywords point to themselves
(class :a)
(get {"a" "ay"} "a")
(get-in {"a" {"aa" "You found me"}} ["a" "aa"])
(let [reason "sick"]
(cond
(= reason "sick") "I ache all over and am seeing green elephant-shaped spots"
(= reason "train") "That darn Southern Rail on strike again"
(= reason "pet") "My pet ate my homework"))
(let [greeting :fr]
(case greeting
:fr "bonjour monde clojure"
:en "hello clojure world"
:it "ciao mondo clojure"
:es "hola mundo clojure"))
(let [language :fr
message (case language
:fr "bonjour monde clojure"
:en "hello clojure world"
:it "ciao mondo clojure"
:es "hola mundo clojure")
upper-case? true]
(if upper-case?
(clojure.string/upper-case message)
message))
(let [reason "sick"]
(cond
(= reason "sick") "I ache all over and am seeing green elephant-shaped spots"
(= reason "train") "That darn Southern Rail on strike again"
(= reason "pet") "My pet ate my homework"))
(def my-details ["John" "Stevenson" "37" "Clojure" "London" "North Yorkshire" 12])
(first my-details)
(second my-details)
(rest my-details)
(nth ["John" "Stevenson" "37" "Clojure" "London" "North Yorkshire" 12] 2)
(nth my-details 0)
(first my-details)
(first "John")
(str (nth "John" 0))
["string" ["fish" "rabit"]]
{:key ["value1" "value2"]}
{:bicycle ["wheels" "frame" "handlbars"]}
{:meal ["starter" "main course" "desert"]}
{:meal
["starter" ["soup" "bread rolls"]
"main course" ["fish" "chips" "mushy peas"]
"desert" ["cheese" "wine"]]}
{:meal
{"starter" ["soup" "bread rolls"]
"main course" ["fish" "chips" "mushy peas"]
"desert" ["cheese" "wine"]}}
{:meal
{:starter ["soup" "bread rolls"]
:main-course ["fish" "chips" "mushy peas"]
:desert ["cheese" "wine"]}}
{:meal
{:ingredience []
:recipe []}}
| null | https://raw.githubusercontent.com/practicalli/clojure-through-code/e65842363c328fb251c88a0c6a377ed2a42d152a/src/clojure_through_code/01_basics.clj | clojure | using the (use) function in clojure.
(:require 'clojure.repl)
(:require [clojure.repl] :refer :all)
no need for lots of ; , and other silly things...
and the remaining elements being arguments to that function.
What is my environment
Symbols can be evaluated outside of a list structure,
functions (the behaviour of your application) and their
arguments are contained within a list structure ()
The full clojure version
:incremental and :qualifier keys. Feature releases may increment
:minor and/or :major, bugfix releases will increment :incremental.
This directory must be in the classpath for 'compile' to work.
The path of the file being evaluated, as a String. In the REPL the value is not defined.
A clojure.lang.Namespace object representing the current namespace
most recent repl values
in clojure it needs to be wrapped in a list structure.
We can also get the version of the project
Getting the version number of the project
The value returned by slurp is a bit messy, so we can tidy it up with read-string
rather than have all the information from the file, we just want to get the project version
Using the nth function we can select which element we actually want
The above code is classic Lisp, you read it from the inside out, so in this case you
start with (slurp ...) and what it returns is used as the argument to read-string...
Get the contents of the project.clj file using `slurp`
Read the text of that file using read-string
You can format the code differently, but in this case its not much easier to read
the same behaviour as above can be written using the threading macro
which can make code easier to read by reading sequentially down the list of functions.
Using the threading macro, the result of every function is passed onto the next function
in the list. This can be seen very clearly usng ,,, to denote where the value is passed
to the next function
Remember, commas in clojure are ignored
To make this really simple lets create a contrived example of the threading macro.
Here we use the str function to join strings together. Each individual string call
Using the ->> threading macro, the result of a function is passed as the last parameter
of the next function call. So in another simple series of str function calls,
our text comes out backwards.
Threading macro is very useful for passing a collection through a number of functions,
each function manipulating that collection in a specific way before passing it on to the next.
add all project information to a map
Threading macros and println statements
=> ", The Police"
Using the doto function with println we can pass the value on as the return value and pass the value to be printed in the console.
=> "message in a bottle"
So putting this doto function in our threading macro now works
=> "Message in a bottle - The Police"
defining functions
defn is a macro that builds on def
defining a function with def
anonymous function
anonymous function syntax sugar
An anonymous function is defined with the #() syntax where % is a placeholder for the arguments.
square a number (fn [num] (* num num))
Working with strings
join strings together with the function str
using srt you see the results of the evaluation inline with the code,
as the result of a definition or an expression.
Avoid code that creates side-effects where possible to keep your software less complex.
using the fast feedback of the REPL usually works beter than println statements in debuging
Math is straightforward
Ratios delay the need to drop into decimal numbers. Once you create a decimal number then everything it touches had a greater potential to becoming a decimal
Equality is =
=> true
=> false
Equality is very useful when your data structures are immutable
You need not for logic, too
=> false
Keywords exist as identifiers and for very fast comparisons
some truthiness with math functions - looking at types
(class (/)) ;; wrong number of arguments error
=> false
Conditionals
if something is true, do this, else do that
cond - if condition true, do this, :otherwise do that
when true do the following
Predicates - take a value and return a boolean result (true | false)
Types
Use `class` to inspect them.
Float literals are java.lang.Double
Strings always double-quoted, and are java.lang.String
Booleans are java.lang.Boolean
The "null" value is called nil
Ratios
So when you are dividing numbers you can keep the as a fraction using whole numbers
rather than constrain the result to a approximate
numbers with a decimal point
Is something a thing
Lets try and break clojure with Math
(/ 22 0)
Java Math functions easily
(new yourObjectName)
(. youObjectName)
mathematical concepts like the square-root of minus one.
Look at the project configuration file project.clj
In the source code src/project-name/core.clj is some sample code in a specific namespace
A namespace is a way to organise your clojure code (data structure and function definitions)
The namespace represents the underlying directory and filename which contain specific data structure and function definitions
Documentation in Clojure & LightTable
documentation is shown inline
Lets look at the documentation for map
which is easy enough to understand even if you dont know
clojure. Essentially the configurations are a
simple to pull out the relevant settings
Set up keyboard shortcuts or look at the default shortcuts
Settings: User keymap
Settings: Default keymap
Settings: User behaviors
(doto) ;; Chain functions together
->
cool stuff
user> (as-> 0 n)
user> (as-> 0 n (inc n) (inc n))
#'user/x
user> x
[[1 2 3] [4 5 6]]
user> (ffirst x)
[1 2 3]
user> (assoc nil :a)
user> (filter identity '(1 2 3 nil))
(1 2 3)
user> (identity nil)
nil
user> (true? nil)
false
Alt-up - get rid of parent
(def :a "What about keywords")
=> keywords cannot be used as names, as keywords point to themselves | namespaces are similar to packages in Java , in that they are a grouping of data and behaviour
namespaces allow you to structure your Clojure code into logical groupings
namesaces help you use functions defined in one namespace in a different namespace
(ns clojure-through-code.01-basics
(:require [clojure.string]))
Clojure Syntax
Clojure uses a prefix notation and ( ) [ ] : { } # @ ! special characters
All behaviour in Clojure is defined in a List , with the first elemtent being a function
Clojure has built in symbols , which start and end with *
can be used to check you are running a particular version , major or minor of Clojure core
*clojure-version*
The version info for Clojure core , as a map containing : major : minor
Possible values of : qualifier include " GA " , " SNAPSHOT " , " RC - x " " BETA - x "
The directory where the Clojure compiler will create the .class files for the current project
*compile-path*
*file*
*ns*
*1
*2
*3
Using Java Interoperability
java.lang is part of the Clojure runtime environment , so when ever you run a REPL you can call any methods without having to import them or include any dependencies
From java.lang . System getProperty ( ) as documented at :
(System/getProperty "java.version")
(System/getProperty "java.vm.name")
Java properties can be obtained by calling
from java.lang . As System.getProperty is called as a function
Make the result prettier using the Clojure str function
(str "Current Java version: " (System/getProperty "java.version"))
(System/getProperty "clojure-through-code.version")
Chaining a few Clojure functions together , to read from
the Leiningen project file
Information can be read from the Clojure project.clj file using the slurp function
(slurp "project.clj")
= > " ( defproject clojure - through - code \"20.1.5 - SNAPSHOT\"\n : description \"Learning Clojure by evaluating code on the fly\"\n : url \"\"\n : license { : name \"Eclipse Public License\"\n : url \" / legal / epl - v10.html\"}\n : dependencies [ [ org.clojure/clojure \"1.6.0\"]])\n\n "
(read-string (slurp "project.clj"))
= > ( defproject clojure - through - code " 20.1.5 - SNAPSHOT " : description " Learning Clojure by evaluating code on the fly " : url " " : license { : name " Eclipse Public License " , : url " -v10.html " } : dependencies [ [ org.clojure/clojure " 1.6.0 " ] ] )
(nth (read-string (slurp "project.clj")) 2)
= > " 20.1.5 - SNAPSHOT "
Select just the third string using nth 2 ( using an index starting at 0 )
(nth
(read-string
(slurp "project.clj"))
2)
(->
"./project.clj"
slurp
read-string
(nth 2))
(->
"./project.clj"
slurp ,,,
read-string ,,,
(nth ,,, 2))
joins its own strings together , then passes them as a single string as the first argument to the next function
(->
(str "This" " " "is" " ")
(str "the" " " "treading" " " "macro" " ")
(str "in" " " "action."))
(->>
(str "This" " ")
(str "is" " ")
(str "backwards" " "))
(-> [2 5 4 1 3 6]
(reverse)
(rest)
(sort)
(last))
(->> "project.clj"
slurp
read-string
(drop 2)
(cons :version)
(apply hash-map)
(def project))
If you use a print or println function in a threading macro , then part of the value will be lost , as those functions return a value of nil .
(-> "message"
(str " " "in a bottle")
println
(str ", The Police"))
The initial part of the message before the println funciton is called has been dropped because println returned nil . Therefore nil was the value passed as the first argument to tne next function , rather than " message in a bottle " .
(doto "message in a bottle" println)
(-> "Message"
(str " " "in a bottle")
(doto println)
(str " - " "The Police"))
(def fred "I am free")
(def five 5)
(def five 6)
(def five [1 2 3 4 5 6 7 8])
five
(reduce + five)
(reduce + [1 2 3 4 5 6 7 8])
= > 36
(defn my-function [] (str "I wish I was fred"))
(def my-function
(fn [args] (str "behaviour")))
(fn [args] (str "behaviour"))
add three ( fn [ num ] ( + num 3 ) )
add 3 arguments ( fn [ arg1 arg2 arg3 ] ( + arg1 arg2 arg3 4 5 ) )
You could use the Java - like function ` println ` to output strings .
(println "Hello, whats different with me? What value do I return")
However , something different happens when you evaluate this expression . This is refered to as a side - effect because when you call this function it returns nil . The actual text is output to the REPL or console .
In Clojure , you are more likely to use the ` str ` function when working with strings .
(str "Hello, I am returned as a value of this expression")
(str "Hello" ", " "HackTheTower UK")
using println in LightTable shows the results in console window , as its a side affect
Simple math to show you the basic structure of Clojure
(+ 3 (/ 4 2) (* 3 5))
(+ 1 1 2489 459 2.7)
(->
(+ 12 144 20 (* 3 (Math/sqrt 4)))
(/ 7)
(+ (* 5 11))
(= (+ 0.0 (* 9 9))))
(Math/sqrt 4)
= > 1
= > 2
(/ 1 2)
(type (/ 22 7.0))
(/ 5000 20000)
(type (Integer. "2"))
The above is the same as the Java statement Integer myInt = new Integer("2 " )
(/ (* 22/7 3) 3)
Clojure uses Prefix notation , so math operations on many arguments is easy .
(+ 1 2 3 4 5)
(+ 1 2 (* 3 4) (- 5 6 -7))
(+)
(*)
(* 2)
(+ 4)
Variadic functions
(+ 1 2 3)
(< 1 2 3)
(< 1 3 8 4)
( remaining 22 7 )
(inc 3)
(dec 4)
(min 1 2 3 5 8 13)
(max 1 2 3 5 8 13)
(apply + [1 2 3])
(reduce + [1 2 3])
(apply / [1 2 3])
(/ 53)
(map + [1 2 3.0] [4.0 5 6])
(repeat 4 9)
(identical? "foo" "bar")
(identical? "foo" "foo")
(= "foo" "bar")
(= "foo" "foo")
(identical? :foo :bar)
(identical? :foo :foo)
(def my-map {:foo "a"})
(= "a" (:foo my-map))
Truethy experiments
(+)
(class (+))
(*)
(true? +)
(false? +)
(true? *)
(false? *)
(true? 1)
(true? -1)
(true? true)
(true? (not false))
(- 2)
(= 4 (inc 2))
(if false
"hello"
(do (+ 3 4)
(str "goodbye")))
(if false "one" "two")
(if nil "uh" "oh")
(if false "Hello word" "Goodbye crule world")
(cond
(zero? (- (* 4 2) 8))
(= 4 (inc 2))
(= 4 (/ 8 2))
(= "Hello World" (str "Hello " "World"))
:otherwise "None of the above.")
(cond
(= 7 (inc 2)) "(inc 2) is not 7, so this condition is false"
(= 16 (* 8 2)) "This is the first correct condition so its associated expression is returned"
(zero? (- (* 8 8) 64)) "This is true but not returned as a previous condition is true"
:otherwise "None of the above are true")
(when (> 8 2)
"Higher")
(true? true)
(true? (not true))
(true? false)
(true? (not false))
(true? nil)
Clojure uses Java 's object types for booleans , strings and numbers .
(class 1)
Integer literals are java.lang . Long by default
(class "")
(class (list 1 2 3 4))
(class true)
(class ())
(class (list 1 2 34 5))
(class (str 2 3 4 5))
(class (+ 22/7))
(class 5)
(class "fish")
(type [1 2 3])
(type {:a 1 :b 2})
(type (take 3 (range 10)))
(take 10 (range))
(type (Integer. "8080"))
(type "This is a string")
(type '(1 2 3 4))
(type 1)
(type "I am a string")
(type :i-am-a-keyword)
(type 22/7)
(type 'def)
(type 'defn)
(type '(1 2 3 4))
(type [1 2 3 4])
(type {:a 1 :b 2})
(type #{1 2 3 4})
To help maintain the precision of numbers , Clojure has a type called Ratio
(/ 2)
A classic example is dividing 22 by 7 which is approximately the value of Pi
(/ 22 7)
(class (/ 22 7))
If you want to force Clojure to evaluate this then you can specify one of the
(class (/ 22 7.0))
(/ 14 4)
7/2
(* (/ 22 7) 7)
(type 7.0)
(instance? String "hello")
(instance? Double 3.14)
(instance? Number 3.14)
(instance? java.util.Date #inst "2015-01-01")
ArithmeticException Divide by zero clojure.lang.Numbers.divide ( Numbers.java:156 )
java.lang . * packages are included in all Clojure projects , so you can call the
(Math/sqrt 4)
(Math/sqrt 13)
(Math/PI)
(.toUpperCase "bla")
Lets have some maths fun and see how Clojure deals with this
(Math/sqrt -1)
So Clojure , well Java really as its the Java Math class methods , deals with interesting
So what does NaN mean . Well by consulting Stack Overflow , a NaN is produced if a floating point operation would produce an undefinable result . Other examples include dividing 0.0 by 0.0 is arithmetically undefined .
Clojure projects
Install Leiningen build tool from leingingen.org
Create a new project with new project - name
Run the repl using repl
The project is defined as Clojure code using defproject macro , keywords , maps & vectors
Namespaces are similar to packages in Java
(namespace 'clojure-through-code.01-basics/my-map)
(name 'clojure-through-code.01-basics/my-map)
Clojure functions have Documentation
- in LightTable you can right - click on a function name and select " show docs "
(class [])
(map? [1 2 3 4])
LightTable Settings
The configuration in LightTable uses a Clojure syntax
datastructure , a map with Clojure keywords to make it
General configuration settings for LightTable - eg , , themes , editor settings
0
2
user > ( def x [ [ 1 2 3 ] [ 4 5 6 ] ] )
1
user > ( first x )
ArityException Wrong number of args ( 2 ) passed to : core / assoc clojure.lang . AFn.throwArity ( AFn.java:429 )
user > ( assoc nil : a 1 )
{ : a 1 }
user > ( filter identity @)RuntimeException Unmatched delimiter : ) clojure.lang . Util.runtimeException ( Util.java:221 )
Paredit
(def a "I have a name")
(class :a)
(get {"a" "ay"} "a")
(get-in {"a" {"aa" "You found me"}} ["a" "aa"])
(let [reason "sick"]
(cond
(= reason "sick") "I ache all over and am seeing green elephant-shaped spots"
(= reason "train") "That darn Southern Rail on strike again"
(= reason "pet") "My pet ate my homework"))
(let [greeting :fr]
(case greeting
:fr "bonjour monde clojure"
:en "hello clojure world"
:it "ciao mondo clojure"
:es "hola mundo clojure"))
(let [language :fr
message (case language
:fr "bonjour monde clojure"
:en "hello clojure world"
:it "ciao mondo clojure"
:es "hola mundo clojure")
upper-case? true]
(if upper-case?
(clojure.string/upper-case message)
message))
(let [reason "sick"]
(cond
(= reason "sick") "I ache all over and am seeing green elephant-shaped spots"
(= reason "train") "That darn Southern Rail on strike again"
(= reason "pet") "My pet ate my homework"))
(def my-details ["John" "Stevenson" "37" "Clojure" "London" "North Yorkshire" 12])
(first my-details)
(second my-details)
(rest my-details)
(nth ["John" "Stevenson" "37" "Clojure" "London" "North Yorkshire" 12] 2)
(nth my-details 0)
(first my-details)
(first "John")
(str (nth "John" 0))
["string" ["fish" "rabit"]]
{:key ["value1" "value2"]}
{:bicycle ["wheels" "frame" "handlbars"]}
{:meal ["starter" "main course" "desert"]}
{:meal
["starter" ["soup" "bread rolls"]
"main course" ["fish" "chips" "mushy peas"]
"desert" ["cheese" "wine"]]}
{:meal
{"starter" ["soup" "bread rolls"]
"main course" ["fish" "chips" "mushy peas"]
"desert" ["cheese" "wine"]}}
{:meal
{:starter ["soup" "bread rolls"]
:main-course ["fish" "chips" "mushy peas"]
:desert ["cheese" "wine"]}}
{:meal
{:ingredience []
:recipe []}}
|
e22cf5a4671acc80357915fac90aaf4f7d35a40f74aabbecf80fc95a09451d7c | txyyss/Project-Euler | Euler138.hs | -- Special isosceles triangles
module Euler138 where
-- Detailed analysis can be found in
-- -euler-138-special-isosceles-triangles/
result138 = sum $ map (abs . snd) $ tail $ take 13 $ iterate helper (0,1)
where helper (x,y) = (- 9 * x - 4 * y - 4, - 20 * x - 9 * y - 8)
| null | https://raw.githubusercontent.com/txyyss/Project-Euler/d2f41dad429013868445c1c9c1c270b951550ee9/Euler138.hs | haskell | Special isosceles triangles
Detailed analysis can be found in
-euler-138-special-isosceles-triangles/ |
module Euler138 where
result138 = sum $ map (abs . snd) $ tail $ take 13 $ iterate helper (0,1)
where helper (x,y) = (- 9 * x - 4 * y - 4, - 20 * x - 9 * y - 8)
|
e5a57475aa4138879435ee54983d0b819f6cf916590e35dd785c4b98ddf43cd4 | mtakuya/gauche-yahoo-jp | news-topicslog.scm | #!/usr/bin/env gosh
(use yahoo-jp)
(define appid "YOUR-APPID")
(define yahoo-obj (make-yahoo-jp appid))
(define res (yahoo:news-topicslog yahoo-obj
'((category "computer")
(startdate "20100301")
(results "5"))))
(for-each (lambda (lst)
(display (topicslog-topicname lst))
(newline)
(display (topicslog-url lst))
(newline))
res)
| null | https://raw.githubusercontent.com/mtakuya/gauche-yahoo-jp/3abdbf3b10d3db1923329e41b3a8d8cff5796413/example/news-topicslog.scm | scheme | #!/usr/bin/env gosh
(use yahoo-jp)
(define appid "YOUR-APPID")
(define yahoo-obj (make-yahoo-jp appid))
(define res (yahoo:news-topicslog yahoo-obj
'((category "computer")
(startdate "20100301")
(results "5"))))
(for-each (lambda (lst)
(display (topicslog-topicname lst))
(newline)
(display (topicslog-url lst))
(newline))
res)
| |
f03273f6b0091444699a9ccb96f5b133ab01a6d3fbe5c10210ecf73761a2bf61 | NorfairKing/sydtest | Webdriver.hs | # LANGUAGE DataKinds #
# LANGUAGE FlexibleContexts #
# LANGUAGE FlexibleInstances #
# LANGUAGE GeneralizedNewtypeDeriving #
# LANGUAGE NumericUnderscores #
{-# LANGUAGE OverloadedStrings #-}
# LANGUAGE RecordWildCards #
# LANGUAGE ScopedTypeVariables #
# LANGUAGE TypeFamilies #
# LANGUAGE UndecidableInstances #
-- Because of webdriver using dangerous constructors
# OPTIONS_GHC -fno - warn - incomplete - record - updates #
-- For the undefined trick
# OPTIONS_GHC -fno - warn - unused - pattern - binds #
module Test.Syd.Webdriver
( -- * Defining webdriver tests
WebdriverSpec,
webdriverSpec,
WebdriverTestM (..),
runWebdriverTestM,
WebdriverTestEnv (..),
webdriverTestEnvSetupFunc,
-- * Writing webdriver tests
openPath,
setWindowSize,
-- * Running a selenium server
SeleniumServerHandle (..),
seleniumServerSetupFunc,
)
where
import Control.Monad.Base
import Control.Monad.Reader
import Control.Monad.Trans.Control
import Data.Aeson as JSON
import GHC.Stack
import Network.HTTP.Client as HTTP
import Network.Socket
import Network.Socket.Free
import Network.Socket.Wait as Port
import Network.URI
import Path
import Path.IO
import System.Exit
import System.Process.Typed
import Test.Syd
import Test.Syd.Path
import Test.Syd.Process.Typed
import Test.Syd.Wai
import Test.WebDriver as WD hiding (setWindowSize)
import Test.WebDriver.Class (WebDriver (..))
import qualified Test.WebDriver.Commands.Internal as WD
import qualified Test.WebDriver.JSON as WD
import Test.WebDriver.Session (WDSessionState (..))
-- | Type synonym for webdriver tests
type WebdriverSpec app = TestDef '[SeleniumServerHandle, HTTP.Manager] (WebdriverTestEnv app)
-- | A monad for webdriver tests.
This instantiates the ' WebDriver ' class , as well as the ' IsTest ' class .
newtype WebdriverTestM app a = WebdriverTestM
{ unWebdriverTestM :: ReaderT (WebdriverTestEnv app) WD a
}
deriving
( Functor,
Applicative,
Monad,
MonadIO,
MonadReader (WebdriverTestEnv app),
We do n't want ' MonadBaseControl IO ' or ' MonadBase IO ' , but we have to
because webdriver uses them .
MonadBaseControl IO,
MonadBase IO
)
data WebdriverTestEnv app = WebdriverTestEnv
{ -- | The base url of the app we test, so that we can test external sites just like local ones.
webdriverTestEnvURI :: !URI,
-- | The webdriver configuration
webdriverTestEnvConfig :: !WDConfig,
-- | The app that we'll test.
--
You can put any piece of data here . In the case of yesod tests , we 'll put an @App@ here .
webdriverTestEnvApp :: !app
}
instance WDSessionState (WebdriverTestM app) where
getSession = WebdriverTestM getSession
putSession = WebdriverTestM . putSession
instance WebDriver (WebdriverTestM app) where
doCommand m p a = WebdriverTestM $ doCommand m p a
instance IsTest (WebdriverTestM app ()) where
type Arg1 (WebdriverTestM app ()) = ()
type Arg2 (WebdriverTestM app ()) = WebdriverTestEnv app
runTest wdTestFunc = runTest (\() wdte -> runWebdriverTestM wdte wdTestFunc)
instance IsTest (WebdriverTestM app (GoldenTest a)) where
type Arg1 (WebdriverTestM app (GoldenTest a)) = ()
type Arg2 (WebdriverTestM app (GoldenTest a)) = WebdriverTestEnv app
runTest wdTestFunc = runTest (\() wdte -> runWebdriverTestM wdte wdTestFunc)
-- | Run a webdriver test.
runWebdriverTestM :: WebdriverTestEnv app -> WebdriverTestM app a -> IO a
runWebdriverTestM env (WebdriverTestM func) = WD.runSession (webdriverTestEnvConfig env) $
WD.finallyClose $ do
setImplicitWait 10_000
setScriptTimeout 10_000
setPageLoadTimeout 10_000
runReaderT func env
| Open a page on the URI in the ' WebdriverTestEnv ' .
openPath :: String -> WebdriverTestM app ()
openPath p = do
uri <- asks webdriverTestEnvURI
let url = show uri <> p
openPage url
-- We have to override this because it returns something.
-- So we remove the 'noReturn'.
setWindowSize ::
(HasCallStack, WebDriver wd) =>
| ( Width , )
(Word, Word) ->
wd ()
setWindowSize (w, h) =
WD.ignoreReturn $
WD.doWinCommand methodPost currentWindow "/size" $
object ["width" .= w, "height" .= h]
webdriverSpec ::
(HTTP.Manager -> SetupFunc (URI, app)) ->
WebdriverSpec app ->
Spec
webdriverSpec appSetupFunc =
managerSpec
. modifyMaxSuccess (`div` 50)
. setupAroundWith' (\man () -> appSetupFunc man)
. setupAroundAll seleniumServerSetupFunc
. webdriverTestEnvSpec
webdriverTestEnvSpec ::
TestDef '[SeleniumServerHandle, HTTP.Manager] (WebdriverTestEnv app) ->
TestDef '[SeleniumServerHandle, HTTP.Manager] (URI, app)
webdriverTestEnvSpec = setupAroundWith' go2 . setupAroundWith' go1
where
go1 ::
SeleniumServerHandle ->
(SeleniumServerHandle -> SetupFunc (WebdriverTestEnv app)) ->
SetupFunc (WebdriverTestEnv app)
go1 ssh func = func ssh
go2 ::
HTTP.Manager ->
(URI, app) ->
SetupFunc (SeleniumServerHandle -> SetupFunc (WebdriverTestEnv app))
go2 man (uri, app) = pure $ \ssh -> webdriverTestEnvSetupFunc ssh man uri app
-- | Set up a 'WebdriverTestEnv' for your app by readying a webdriver session
webdriverTestEnvSetupFunc ::
SeleniumServerHandle ->
HTTP.Manager ->
URI ->
app ->
SetupFunc (WebdriverTestEnv app)
webdriverTestEnvSetupFunc SeleniumServerHandle {..} manager uri app = do
chromeExecutable <- liftIO $ do
chromeFile <- parseRelFile "chromium"
mExecutable <- findExecutable chromeFile
case mExecutable of
Nothing -> die "No chromium found on PATH."
Just executable -> pure executable
let browser =
chrome
{ chromeOptions =
[ -- We don't set the --user-data-dir because it makes the
-- chromedriver timeout for unknown reasons.
-- "--user-data-dir="
"--headless",
-- Bypass OS security model to run on nix as well
"--no-sandbox",
-- No need for a GPU in headless mode?
"--disable-gpu",
-- Overcome limited resource problem
"--disable-dev-shm-usage",
Normalise setup for screenshots
"--use-gl=angle",
"--use-angle=swiftshader",
"--window-size=1920,1080",
-- So that screenshots tests don't start failing when something new is added at the bottom of the page that isn't even on the screen
"--hide-scrollbars"
],
chromeBinary = Just $ fromAbsFile chromeExecutable
}
let caps =
WD.defaultCaps
{ browser = browser
}
let webdriverTestEnvConfig =
WD.defaultConfig
{ wdPort = (fromIntegral :: PortNumber -> Int) seleniumServerHandlePort,
wdHTTPManager = Just manager,
wdCapabilities = caps
}
let webdriverTestEnvURI = uri
webdriverTestEnvApp = app
pure WebdriverTestEnv {..}
data SeleniumServerHandle = SeleniumServerHandle
{ seleniumServerHandlePort :: PortNumber
}
-- | Run, and clean up, a selenium server
seleniumServerSetupFunc :: SetupFunc SeleniumServerHandle
seleniumServerSetupFunc = do
tempDir <- tempDirSetupFunc "selenium-server"
portInt <- liftIO getFreePort
let processConfig =
setStdout nullStream $
setStderr nullStream $
setWorkingDir (fromAbsDir tempDir) $
proc
"selenium-server"
[ "-port",
show portInt
]
_ <- typedProcessSetupFunc processConfig
liftIO $ Port.wait "127.0.0.1" portInt
let seleniumServerHandlePort = fromIntegral portInt
pure SeleniumServerHandle {..}
| null | https://raw.githubusercontent.com/NorfairKing/sydtest/74fc91867dca88c0d22faae1a0bfcd027d74e4b8/sydtest-webdriver/src/Test/Syd/Webdriver.hs | haskell | # LANGUAGE OverloadedStrings #
Because of webdriver using dangerous constructors
For the undefined trick
* Defining webdriver tests
* Writing webdriver tests
* Running a selenium server
| Type synonym for webdriver tests
| A monad for webdriver tests.
| The base url of the app we test, so that we can test external sites just like local ones.
| The webdriver configuration
| The app that we'll test.
| Run a webdriver test.
We have to override this because it returns something.
So we remove the 'noReturn'.
| Set up a 'WebdriverTestEnv' for your app by readying a webdriver session
We don't set the --user-data-dir because it makes the
chromedriver timeout for unknown reasons.
"--user-data-dir="
Bypass OS security model to run on nix as well
No need for a GPU in headless mode?
Overcome limited resource problem
So that screenshots tests don't start failing when something new is added at the bottom of the page that isn't even on the screen
| Run, and clean up, a selenium server | # LANGUAGE DataKinds #
# LANGUAGE FlexibleContexts #
# LANGUAGE FlexibleInstances #
# LANGUAGE GeneralizedNewtypeDeriving #
# LANGUAGE NumericUnderscores #
# LANGUAGE RecordWildCards #
# LANGUAGE ScopedTypeVariables #
# LANGUAGE TypeFamilies #
# LANGUAGE UndecidableInstances #
# OPTIONS_GHC -fno - warn - incomplete - record - updates #
# OPTIONS_GHC -fno - warn - unused - pattern - binds #
module Test.Syd.Webdriver
WebdriverSpec,
webdriverSpec,
WebdriverTestM (..),
runWebdriverTestM,
WebdriverTestEnv (..),
webdriverTestEnvSetupFunc,
openPath,
setWindowSize,
SeleniumServerHandle (..),
seleniumServerSetupFunc,
)
where
import Control.Monad.Base
import Control.Monad.Reader
import Control.Monad.Trans.Control
import Data.Aeson as JSON
import GHC.Stack
import Network.HTTP.Client as HTTP
import Network.Socket
import Network.Socket.Free
import Network.Socket.Wait as Port
import Network.URI
import Path
import Path.IO
import System.Exit
import System.Process.Typed
import Test.Syd
import Test.Syd.Path
import Test.Syd.Process.Typed
import Test.Syd.Wai
import Test.WebDriver as WD hiding (setWindowSize)
import Test.WebDriver.Class (WebDriver (..))
import qualified Test.WebDriver.Commands.Internal as WD
import qualified Test.WebDriver.JSON as WD
import Test.WebDriver.Session (WDSessionState (..))
type WebdriverSpec app = TestDef '[SeleniumServerHandle, HTTP.Manager] (WebdriverTestEnv app)
This instantiates the ' WebDriver ' class , as well as the ' IsTest ' class .
newtype WebdriverTestM app a = WebdriverTestM
{ unWebdriverTestM :: ReaderT (WebdriverTestEnv app) WD a
}
deriving
( Functor,
Applicative,
Monad,
MonadIO,
MonadReader (WebdriverTestEnv app),
We do n't want ' MonadBaseControl IO ' or ' MonadBase IO ' , but we have to
because webdriver uses them .
MonadBaseControl IO,
MonadBase IO
)
data WebdriverTestEnv app = WebdriverTestEnv
webdriverTestEnvURI :: !URI,
webdriverTestEnvConfig :: !WDConfig,
You can put any piece of data here . In the case of yesod tests , we 'll put an @App@ here .
webdriverTestEnvApp :: !app
}
instance WDSessionState (WebdriverTestM app) where
getSession = WebdriverTestM getSession
putSession = WebdriverTestM . putSession
instance WebDriver (WebdriverTestM app) where
doCommand m p a = WebdriverTestM $ doCommand m p a
instance IsTest (WebdriverTestM app ()) where
type Arg1 (WebdriverTestM app ()) = ()
type Arg2 (WebdriverTestM app ()) = WebdriverTestEnv app
runTest wdTestFunc = runTest (\() wdte -> runWebdriverTestM wdte wdTestFunc)
instance IsTest (WebdriverTestM app (GoldenTest a)) where
type Arg1 (WebdriverTestM app (GoldenTest a)) = ()
type Arg2 (WebdriverTestM app (GoldenTest a)) = WebdriverTestEnv app
runTest wdTestFunc = runTest (\() wdte -> runWebdriverTestM wdte wdTestFunc)
runWebdriverTestM :: WebdriverTestEnv app -> WebdriverTestM app a -> IO a
runWebdriverTestM env (WebdriverTestM func) = WD.runSession (webdriverTestEnvConfig env) $
WD.finallyClose $ do
setImplicitWait 10_000
setScriptTimeout 10_000
setPageLoadTimeout 10_000
runReaderT func env
| Open a page on the URI in the ' WebdriverTestEnv ' .
openPath :: String -> WebdriverTestM app ()
openPath p = do
uri <- asks webdriverTestEnvURI
let url = show uri <> p
openPage url
setWindowSize ::
(HasCallStack, WebDriver wd) =>
| ( Width , )
(Word, Word) ->
wd ()
setWindowSize (w, h) =
WD.ignoreReturn $
WD.doWinCommand methodPost currentWindow "/size" $
object ["width" .= w, "height" .= h]
webdriverSpec ::
(HTTP.Manager -> SetupFunc (URI, app)) ->
WebdriverSpec app ->
Spec
webdriverSpec appSetupFunc =
managerSpec
. modifyMaxSuccess (`div` 50)
. setupAroundWith' (\man () -> appSetupFunc man)
. setupAroundAll seleniumServerSetupFunc
. webdriverTestEnvSpec
webdriverTestEnvSpec ::
TestDef '[SeleniumServerHandle, HTTP.Manager] (WebdriverTestEnv app) ->
TestDef '[SeleniumServerHandle, HTTP.Manager] (URI, app)
webdriverTestEnvSpec = setupAroundWith' go2 . setupAroundWith' go1
where
go1 ::
SeleniumServerHandle ->
(SeleniumServerHandle -> SetupFunc (WebdriverTestEnv app)) ->
SetupFunc (WebdriverTestEnv app)
go1 ssh func = func ssh
go2 ::
HTTP.Manager ->
(URI, app) ->
SetupFunc (SeleniumServerHandle -> SetupFunc (WebdriverTestEnv app))
go2 man (uri, app) = pure $ \ssh -> webdriverTestEnvSetupFunc ssh man uri app
webdriverTestEnvSetupFunc ::
SeleniumServerHandle ->
HTTP.Manager ->
URI ->
app ->
SetupFunc (WebdriverTestEnv app)
webdriverTestEnvSetupFunc SeleniumServerHandle {..} manager uri app = do
chromeExecutable <- liftIO $ do
chromeFile <- parseRelFile "chromium"
mExecutable <- findExecutable chromeFile
case mExecutable of
Nothing -> die "No chromium found on PATH."
Just executable -> pure executable
let browser =
chrome
{ chromeOptions =
"--headless",
"--no-sandbox",
"--disable-gpu",
"--disable-dev-shm-usage",
Normalise setup for screenshots
"--use-gl=angle",
"--use-angle=swiftshader",
"--window-size=1920,1080",
"--hide-scrollbars"
],
chromeBinary = Just $ fromAbsFile chromeExecutable
}
let caps =
WD.defaultCaps
{ browser = browser
}
let webdriverTestEnvConfig =
WD.defaultConfig
{ wdPort = (fromIntegral :: PortNumber -> Int) seleniumServerHandlePort,
wdHTTPManager = Just manager,
wdCapabilities = caps
}
let webdriverTestEnvURI = uri
webdriverTestEnvApp = app
pure WebdriverTestEnv {..}
data SeleniumServerHandle = SeleniumServerHandle
{ seleniumServerHandlePort :: PortNumber
}
seleniumServerSetupFunc :: SetupFunc SeleniumServerHandle
seleniumServerSetupFunc = do
tempDir <- tempDirSetupFunc "selenium-server"
portInt <- liftIO getFreePort
let processConfig =
setStdout nullStream $
setStderr nullStream $
setWorkingDir (fromAbsDir tempDir) $
proc
"selenium-server"
[ "-port",
show portInt
]
_ <- typedProcessSetupFunc processConfig
liftIO $ Port.wait "127.0.0.1" portInt
let seleniumServerHandlePort = fromIntegral portInt
pure SeleniumServerHandle {..}
|
89453334e21bd8c4bd95bfdd858b3527260186ad52994c5d73ef486aad1abc58 | Opetushallitus/ataru | liitepyynto_information_request_handlers.cljs | (ns ataru.virkailija.application.attachments.liitepyynto-information-request-handlers
(:require [ataru.application-common.fx :refer [http]]
[cljs-time.core :as c]
[cljs-time.format :as f]
[re-frame.core :as re-frame]))
(def iso-formatter (f/formatter "yyyy-MM-dd'T'HH:mm:ss.SSSZZ"))
(def date-formatter (f/formatter "yyyy-MM-dd"))
(def time-formatter (f/formatter "HH:mm"))
(def datetime-formatter (f/formatter "yyyy-MM-dd HH:mm"))
(defn- get-deadline-visibility-state [db application-key liitepyynto-key]
(get-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :visibility-state] :hidden))
(defn- set-deadline-visibility-state [db application-key liitepyynto-key state]
(assoc-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :visibility-state] state))
(defn- set-deadline-date [db application-key liitepyynto-key value]
(assoc-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :date] value))
(defn- set-deadline-time [db application-key liitepyynto-key value]
(assoc-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :time] value))
(defn- get-deadline-last-modified [db application-key liitepyynto-key]
(get-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :last-modified] nil))
(defn- set-deadline-last-modified [db application-key liitepyynto-key last-modified]
(assoc-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :last-modified] last-modified))
(defn- set-deadline
[db application-key liitepyynto-key date-string time-string last-modified]
(-> db
(set-deadline-date application-key liitepyynto-key date-string)
(set-deadline-time application-key liitepyynto-key time-string)
(set-deadline-last-modified application-key liitepyynto-key last-modified)))
(re-frame/reg-event-db
:liitepyynto-information-request/set-deadline-visibility-state
(fn [db [_ application-key liitepyynto-key state]]
(set-deadline-visibility-state db application-key liitepyynto-key state)))
(re-frame/reg-event-fx
:liitepyynto-information-request/hide-deadline
(fn [{db :db} [_ application-key liitepyynto-key]]
(let [current-state (get-deadline-visibility-state db application-key liitepyynto-key)]
(when (or (= :visible current-state)
(= :appearing current-state))
{:db (set-deadline-visibility-state db application-key liitepyynto-key :disappearing)
:dispatch-later [{:ms 200
:dispatch [:liitepyynto-information-request/set-deadline-visibility-state
application-key
liitepyynto-key
:hidden]}]}))))
(re-frame/reg-event-fx
:liitepyynto-information-request/show-deadline
(fn [{db :db} [_ application-key liitepyynto-key]]
(let [current-state (get-deadline-visibility-state db application-key liitepyynto-key)]
(when (or (= :hidden current-state)
(= :disappearing current-state))
{:db (set-deadline-visibility-state db application-key liitepyynto-key :appearing)
:dispatch-later [{:ms 200
:dispatch [:liitepyynto-information-request/set-deadline-visibility-state
application-key
liitepyynto-key
:visible]}]}))))
(re-frame/reg-event-fx
:liitepyynto-information-request/set-deadline-toggle
(fn [{db :db} [_ application-key liitepyynto-key on?]]
{:dispatch [(cond on?
:liitepyynto-information-request/show-deadline
(some? (get-deadline-last-modified db application-key liitepyynto-key))
:liitepyynto-information-request/delete-deadline
:else
:liitepyynto-information-request/hide-deadline)
application-key
liitepyynto-key]}))
(re-frame/reg-event-db
:liitepyynto-information-request/set-deadline-date
(fn [db [_ application-key liitepyynto-key value]]
(set-deadline-date db application-key liitepyynto-key value)))
(re-frame/reg-event-db
:liitepyynto-information-request/set-deadline-time
(fn [db [_ application-key liitepyynto-key value]]
(set-deadline-time db application-key liitepyynto-key value)))
(re-frame/reg-event-db
:liitepyynto-information-request/hide-deadline-error
(fn [db [_ application-key liitepyynto-key]]
(assoc-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :error?] false)))
(re-frame/reg-event-fx
:liitepyynto-information-request/show-deadline-error
(fn [{db :db} [_ application-key liitepyynto-key]]
{:db (assoc-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :error?] true)
:dispatch-later [{:ms 5000
:dispatch [:liitepyynto-information-request/hide-deadline-error
application-key
liitepyynto-key]}]}))
(defn- parse-deadline [deadline]
(let [datetime (->> deadline
(f/parse iso-formatter)
c/to-default-time-zone)]
[(f/unparse date-formatter datetime)
(f/unparse time-formatter datetime)]))
(re-frame/reg-event-fx
:liitepyynto-information-request/set-deadlines
(fn [{db :db} [_ application-key response]]
(let [last-modified (get-in response [:headers "last-modified"])]
{:db (reduce (fn [db deadline]
(let [liitepyynto-key (keyword (:field-id deadline))
[date-string time-string] (parse-deadline (:deadline deadline))]
(set-deadline db application-key liitepyynto-key date-string time-string last-modified)))
db
(:body response))
:dispatch-n (map (fn [deadline]
[:liitepyynto-information-request/show-deadline
application-key
(keyword (:field-id deadline))])
(:body response))})))
(re-frame/reg-event-fx
:liitepyynto-information-request/set-deadline
(fn [{db :db} [_ application-key liitepyynto-key response]]
(let [last-modified (get-in response [:headers "last-modified"])
[date-string time-string] (parse-deadline (get-in response [:body :deadline]))]
{:db (set-deadline db application-key liitepyynto-key date-string time-string last-modified)
:dispatch [:liitepyynto-information-request/show-deadline
application-key
liitepyynto-key]})))
(re-frame/reg-event-fx
:liitepyynto-information-request/unset-deadline
(fn [{db :db} [_ application-key liitepyynto-key _]]
{:db (set-deadline db application-key liitepyynto-key "" "" nil)
:dispatch [:liitepyynto-information-request/hide-deadline
application-key
liitepyynto-key]}))
(re-frame/reg-event-db
:liitepyynto-information-request/ignore-error
(fn [db _] db))
(re-frame/reg-event-fx
:liitepyynto-information-request/re-fetch-and-show-error
(fn [_ [_ application-key liitepyynto-key _]]
{:liitepyynto-information-request/get-deadline
{:application-key application-key
:liitepyynto-key liitepyynto-key}
:dispatch [:liitepyynto-information-request/show-deadline-error
application-key
liitepyynto-key]}))
(re-frame/reg-event-fx
:liitepyynto-information-request/get-deadlines
(fn [_ [_ application-key]]
{:liitepyynto-information-request/get-deadlines
{:application-key application-key}}))
(re-frame/reg-event-fx
:liitepyynto-information-request/debounced-save-deadline
(fn [_ [_ application-key liitepyynto-key]]
{:dispatch-debounced
{:timeout 500
:id [:liitepyynto-information-request/save-deadline
application-key
liitepyynto-key]
:dispatch [:liitepyynto-information-request/save-deadline
application-key
liitepyynto-key]}}))
(re-frame/reg-event-fx
:liitepyynto-information-request/save-deadline
(fn [{db :db} [_ application-key liitepyynto-key]]
(let [date (get-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :date])
time (get-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :time])
last-modified (get-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :last-modified])]
(when-let [datetime (try
(->> (str date " " time)
(f/parse-local datetime-formatter)
c/to-utc-time-zone)
(catch js/Error e
nil))]
{:liitepyynto-information-request/save-deadline
{:application-key application-key
:liitepyynto-key liitepyynto-key
:deadline datetime
:last-modified last-modified}}))))
(re-frame/reg-event-fx
:liitepyynto-information-request/delete-deadline
(fn [{db :db} [_ application-key liitepyynto-key]]
(when-let [last-modified (get-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :last-modified])]
{:liitepyynto-information-request/delete-deadline
{:application-key application-key
:liitepyynto-key liitepyynto-key
:last-modified last-modified}})))
(re-frame/reg-fx
:liitepyynto-information-request/get-deadlines
(fn [{:keys [application-key]}]
(http (aget js/config "virkailija-caller-id")
{:method :get
:url (str "/lomake-editori/api/applications/" application-key
"/field-deadline")
:handler [:liitepyynto-information-request/set-deadlines
application-key]
:error-handler [:liitepyynto-information-request/ignore-error]})))
(re-frame/reg-fx
:liitepyynto-information-request/get-deadline
(fn [{:keys [application-key liitepyynto-key]}]
(http (aget js/config "virkailija-caller-id")
{:method :get
:url (str "/lomake-editori/api/applications/" application-key
"/field-deadline/" (name liitepyynto-key))
:handler [:liitepyynto-information-request/set-deadline
application-key
liitepyynto-key]
:error-handler [:liitepyynto-information-request/unset-deadline
application-key
liitepyynto-key]})))
(re-frame/reg-fx
:liitepyynto-information-request/save-deadline
(fn [{:keys [application-key liitepyynto-key deadline last-modified]}]
(http (aget js/config "virkailija-caller-id")
{:method :put
:url (str "/lomake-editori/api/applications/" application-key
"/field-deadline/" (name liitepyynto-key))
:post-data {:deadline (f/unparse iso-formatter deadline)}
:headers (if (some? last-modified)
{"If-Unmodified-Since" last-modified}
{"If-None-Match" "*"})
:handler [:liitepyynto-information-request/set-deadline
application-key
liitepyynto-key]
:error-handler [:liitepyynto-information-request/re-fetch-and-show-error
application-key
liitepyynto-key]})))
(re-frame/reg-fx
:liitepyynto-information-request/delete-deadline
(fn [{:keys [application-key liitepyynto-key last-modified]}]
(http (aget js/config "virkailija-caller-id")
{:method :delete
:url (str "/lomake-editori/api/applications/" application-key
"/field-deadline/" (name liitepyynto-key))
:headers {"If-Unmodified-Since" last-modified}
:handler [:liitepyynto-information-request/unset-deadline
application-key
liitepyynto-key]
:error-handler [:liitepyynto-information-request/re-fetch-and-show-error
application-key
liitepyynto-key]})))
| null | https://raw.githubusercontent.com/Opetushallitus/ataru/2d8ef1d3f972621e301a3818567d4e11219d2e82/src/cljs/ataru/virkailija/application/attachments/liitepyynto_information_request_handlers.cljs | clojure | (ns ataru.virkailija.application.attachments.liitepyynto-information-request-handlers
(:require [ataru.application-common.fx :refer [http]]
[cljs-time.core :as c]
[cljs-time.format :as f]
[re-frame.core :as re-frame]))
(def iso-formatter (f/formatter "yyyy-MM-dd'T'HH:mm:ss.SSSZZ"))
(def date-formatter (f/formatter "yyyy-MM-dd"))
(def time-formatter (f/formatter "HH:mm"))
(def datetime-formatter (f/formatter "yyyy-MM-dd HH:mm"))
(defn- get-deadline-visibility-state [db application-key liitepyynto-key]
(get-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :visibility-state] :hidden))
(defn- set-deadline-visibility-state [db application-key liitepyynto-key state]
(assoc-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :visibility-state] state))
(defn- set-deadline-date [db application-key liitepyynto-key value]
(assoc-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :date] value))
(defn- set-deadline-time [db application-key liitepyynto-key value]
(assoc-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :time] value))
(defn- get-deadline-last-modified [db application-key liitepyynto-key]
(get-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :last-modified] nil))
(defn- set-deadline-last-modified [db application-key liitepyynto-key last-modified]
(assoc-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :last-modified] last-modified))
(defn- set-deadline
[db application-key liitepyynto-key date-string time-string last-modified]
(-> db
(set-deadline-date application-key liitepyynto-key date-string)
(set-deadline-time application-key liitepyynto-key time-string)
(set-deadline-last-modified application-key liitepyynto-key last-modified)))
(re-frame/reg-event-db
:liitepyynto-information-request/set-deadline-visibility-state
(fn [db [_ application-key liitepyynto-key state]]
(set-deadline-visibility-state db application-key liitepyynto-key state)))
(re-frame/reg-event-fx
:liitepyynto-information-request/hide-deadline
(fn [{db :db} [_ application-key liitepyynto-key]]
(let [current-state (get-deadline-visibility-state db application-key liitepyynto-key)]
(when (or (= :visible current-state)
(= :appearing current-state))
{:db (set-deadline-visibility-state db application-key liitepyynto-key :disappearing)
:dispatch-later [{:ms 200
:dispatch [:liitepyynto-information-request/set-deadline-visibility-state
application-key
liitepyynto-key
:hidden]}]}))))
(re-frame/reg-event-fx
:liitepyynto-information-request/show-deadline
(fn [{db :db} [_ application-key liitepyynto-key]]
(let [current-state (get-deadline-visibility-state db application-key liitepyynto-key)]
(when (or (= :hidden current-state)
(= :disappearing current-state))
{:db (set-deadline-visibility-state db application-key liitepyynto-key :appearing)
:dispatch-later [{:ms 200
:dispatch [:liitepyynto-information-request/set-deadline-visibility-state
application-key
liitepyynto-key
:visible]}]}))))
(re-frame/reg-event-fx
:liitepyynto-information-request/set-deadline-toggle
(fn [{db :db} [_ application-key liitepyynto-key on?]]
{:dispatch [(cond on?
:liitepyynto-information-request/show-deadline
(some? (get-deadline-last-modified db application-key liitepyynto-key))
:liitepyynto-information-request/delete-deadline
:else
:liitepyynto-information-request/hide-deadline)
application-key
liitepyynto-key]}))
(re-frame/reg-event-db
:liitepyynto-information-request/set-deadline-date
(fn [db [_ application-key liitepyynto-key value]]
(set-deadline-date db application-key liitepyynto-key value)))
(re-frame/reg-event-db
:liitepyynto-information-request/set-deadline-time
(fn [db [_ application-key liitepyynto-key value]]
(set-deadline-time db application-key liitepyynto-key value)))
(re-frame/reg-event-db
:liitepyynto-information-request/hide-deadline-error
(fn [db [_ application-key liitepyynto-key]]
(assoc-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :error?] false)))
(re-frame/reg-event-fx
:liitepyynto-information-request/show-deadline-error
(fn [{db :db} [_ application-key liitepyynto-key]]
{:db (assoc-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :error?] true)
:dispatch-later [{:ms 5000
:dispatch [:liitepyynto-information-request/hide-deadline-error
application-key
liitepyynto-key]}]}))
(defn- parse-deadline [deadline]
(let [datetime (->> deadline
(f/parse iso-formatter)
c/to-default-time-zone)]
[(f/unparse date-formatter datetime)
(f/unparse time-formatter datetime)]))
(re-frame/reg-event-fx
:liitepyynto-information-request/set-deadlines
(fn [{db :db} [_ application-key response]]
(let [last-modified (get-in response [:headers "last-modified"])]
{:db (reduce (fn [db deadline]
(let [liitepyynto-key (keyword (:field-id deadline))
[date-string time-string] (parse-deadline (:deadline deadline))]
(set-deadline db application-key liitepyynto-key date-string time-string last-modified)))
db
(:body response))
:dispatch-n (map (fn [deadline]
[:liitepyynto-information-request/show-deadline
application-key
(keyword (:field-id deadline))])
(:body response))})))
(re-frame/reg-event-fx
:liitepyynto-information-request/set-deadline
(fn [{db :db} [_ application-key liitepyynto-key response]]
(let [last-modified (get-in response [:headers "last-modified"])
[date-string time-string] (parse-deadline (get-in response [:body :deadline]))]
{:db (set-deadline db application-key liitepyynto-key date-string time-string last-modified)
:dispatch [:liitepyynto-information-request/show-deadline
application-key
liitepyynto-key]})))
(re-frame/reg-event-fx
:liitepyynto-information-request/unset-deadline
(fn [{db :db} [_ application-key liitepyynto-key _]]
{:db (set-deadline db application-key liitepyynto-key "" "" nil)
:dispatch [:liitepyynto-information-request/hide-deadline
application-key
liitepyynto-key]}))
(re-frame/reg-event-db
:liitepyynto-information-request/ignore-error
(fn [db _] db))
(re-frame/reg-event-fx
:liitepyynto-information-request/re-fetch-and-show-error
(fn [_ [_ application-key liitepyynto-key _]]
{:liitepyynto-information-request/get-deadline
{:application-key application-key
:liitepyynto-key liitepyynto-key}
:dispatch [:liitepyynto-information-request/show-deadline-error
application-key
liitepyynto-key]}))
(re-frame/reg-event-fx
:liitepyynto-information-request/get-deadlines
(fn [_ [_ application-key]]
{:liitepyynto-information-request/get-deadlines
{:application-key application-key}}))
(re-frame/reg-event-fx
:liitepyynto-information-request/debounced-save-deadline
(fn [_ [_ application-key liitepyynto-key]]
{:dispatch-debounced
{:timeout 500
:id [:liitepyynto-information-request/save-deadline
application-key
liitepyynto-key]
:dispatch [:liitepyynto-information-request/save-deadline
application-key
liitepyynto-key]}}))
(re-frame/reg-event-fx
:liitepyynto-information-request/save-deadline
(fn [{db :db} [_ application-key liitepyynto-key]]
(let [date (get-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :date])
time (get-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :time])
last-modified (get-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :last-modified])]
(when-let [datetime (try
(->> (str date " " time)
(f/parse-local datetime-formatter)
c/to-utc-time-zone)
(catch js/Error e
nil))]
{:liitepyynto-information-request/save-deadline
{:application-key application-key
:liitepyynto-key liitepyynto-key
:deadline datetime
:last-modified last-modified}}))))
(re-frame/reg-event-fx
:liitepyynto-information-request/delete-deadline
(fn [{db :db} [_ application-key liitepyynto-key]]
(when-let [last-modified (get-in db [:liitepyynto-information-request application-key liitepyynto-key :deadline :last-modified])]
{:liitepyynto-information-request/delete-deadline
{:application-key application-key
:liitepyynto-key liitepyynto-key
:last-modified last-modified}})))
(re-frame/reg-fx
:liitepyynto-information-request/get-deadlines
(fn [{:keys [application-key]}]
(http (aget js/config "virkailija-caller-id")
{:method :get
:url (str "/lomake-editori/api/applications/" application-key
"/field-deadline")
:handler [:liitepyynto-information-request/set-deadlines
application-key]
:error-handler [:liitepyynto-information-request/ignore-error]})))
(re-frame/reg-fx
:liitepyynto-information-request/get-deadline
(fn [{:keys [application-key liitepyynto-key]}]
(http (aget js/config "virkailija-caller-id")
{:method :get
:url (str "/lomake-editori/api/applications/" application-key
"/field-deadline/" (name liitepyynto-key))
:handler [:liitepyynto-information-request/set-deadline
application-key
liitepyynto-key]
:error-handler [:liitepyynto-information-request/unset-deadline
application-key
liitepyynto-key]})))
(re-frame/reg-fx
:liitepyynto-information-request/save-deadline
(fn [{:keys [application-key liitepyynto-key deadline last-modified]}]
(http (aget js/config "virkailija-caller-id")
{:method :put
:url (str "/lomake-editori/api/applications/" application-key
"/field-deadline/" (name liitepyynto-key))
:post-data {:deadline (f/unparse iso-formatter deadline)}
:headers (if (some? last-modified)
{"If-Unmodified-Since" last-modified}
{"If-None-Match" "*"})
:handler [:liitepyynto-information-request/set-deadline
application-key
liitepyynto-key]
:error-handler [:liitepyynto-information-request/re-fetch-and-show-error
application-key
liitepyynto-key]})))
(re-frame/reg-fx
:liitepyynto-information-request/delete-deadline
(fn [{:keys [application-key liitepyynto-key last-modified]}]
(http (aget js/config "virkailija-caller-id")
{:method :delete
:url (str "/lomake-editori/api/applications/" application-key
"/field-deadline/" (name liitepyynto-key))
:headers {"If-Unmodified-Since" last-modified}
:handler [:liitepyynto-information-request/unset-deadline
application-key
liitepyynto-key]
:error-handler [:liitepyynto-information-request/re-fetch-and-show-error
application-key
liitepyynto-key]})))
| |
c1cefb528d6ba4ec1fe505700e5a06b7dca0e734457b072ef8d52d0e483a6c90 | jdreaver/eventful | Projection.hs | # LANGUAGE QuasiQuotes #
# LANGUAGE TemplateHaskell #
module Eventful.TH.Projection
( mkProjection
) where
import Data.Char (toLower)
import Language.Haskell.TH
import SumTypes.TH
import Eventful.Projection
-- | Creates a 'Projection' for a given type and a list of events. The user of
-- this function also needs to provide event handlers for each event. For
-- example:
--
-- @
data EventA = EventA
data EventB = EventB
--
data =
--
myStateDefault : :
myStateDefault = 0
--
mkProjection '' ' myStateDefault [ '' EventA , '' EventB ]
--
handleEventA : : - > EventA - >
handleEventA ( x ) EventA = ( x + 1 )
--
: : - > EventB - >
( x ) EventB = ( x - 1 )
-- @
--
-- This will produce the following:
--
-- @
data MyStateEvent = MyStateEventA ! EventA | MyStateEventB !
--
handleMyStateEvent : : - > MyStateEvent - >
handleMyStateEvent state ( MyStateEventA event ) = handleEventA state event
handleMyStateEvent state ( event ) = handleEventB state event
--
-- type MyStateProjection = Projection MyState MyStateEvent
--
-- myStateProjection :: MyStateProjection
myStateProjection = Projection myStateDefault handleMyStateEvent
-- @
mkProjection :: Name -> Name -> [Name] -> Q [Dec]
mkProjection stateName stateDefault events = do
-- Make event sum type
let eventTypeName = nameBase stateName ++ "Event"
sumTypeDecls <- constructSumType eventTypeName defaultSumTypeOptions events
-- Make function to handle events from sum type to handlers.
let handleFuncName = mkName $ "handle" ++ eventTypeName
handleFuncType <- [t| $(conT stateName) -> $(conT $ mkName eventTypeName) -> $(conT stateName) |]
handleFuncBodies <- mapM (handleFuncBody stateName) events
let
handleTypeDecls =
[ SigD handleFuncName handleFuncType
, FunD handleFuncName handleFuncBodies
]
-- Make the projection type
projectionType <- [t| Projection $(conT stateName) $(conT $ mkName eventTypeName) |]
let
projectionTypeName = mkName $ nameBase stateName ++ "Projection"
projectionTypeDecl = TySynD projectionTypeName [] projectionType
-- Make the projection
projectionFuncExpr <- [e| Projection $(varE stateDefault) $(varE handleFuncName) |]
let
projectionFuncName = mkName $ firstCharToLower (nameBase stateName) ++ "Projection"
projectionFuncClause = Clause [] (NormalB projectionFuncExpr) []
projectionDecls =
[ SigD projectionFuncName (ConT projectionTypeName)
, FunD projectionFuncName [projectionFuncClause]
]
return $ sumTypeDecls ++ handleTypeDecls ++ [projectionTypeDecl] ++ projectionDecls
handleFuncBody :: Name -> Name -> Q Clause
handleFuncBody stateName event = do
let
statePattern = VarP (mkName "state")
eventPattern = ConP (mkName $ nameBase stateName ++ nameBase event) [VarP (mkName "event")]
handleFuncName = mkName $ "handle" ++ nameBase event
constructor <- [e| $(varE handleFuncName) $(varE $ mkName "state") $(varE $ mkName "event") |]
return $ Clause [statePattern, eventPattern] (NormalB constructor) []
firstCharToLower :: String -> String
firstCharToLower [] = []
firstCharToLower (x:xs) = toLower x : xs
| null | https://raw.githubusercontent.com/jdreaver/eventful/3f0c604e5bb2dcf5bacf0a2e01edf6a5e9c5e22e/eventful-core/src/Eventful/TH/Projection.hs | haskell | | Creates a 'Projection' for a given type and a list of events. The user of
this function also needs to provide event handlers for each event. For
example:
@
@
This will produce the following:
@
type MyStateProjection = Projection MyState MyStateEvent
myStateProjection :: MyStateProjection
@
Make event sum type
Make function to handle events from sum type to handlers.
Make the projection type
Make the projection | # LANGUAGE QuasiQuotes #
# LANGUAGE TemplateHaskell #
module Eventful.TH.Projection
( mkProjection
) where
import Data.Char (toLower)
import Language.Haskell.TH
import SumTypes.TH
import Eventful.Projection
data EventA = EventA
data EventB = EventB
data =
myStateDefault : :
myStateDefault = 0
mkProjection '' ' myStateDefault [ '' EventA , '' EventB ]
handleEventA : : - > EventA - >
handleEventA ( x ) EventA = ( x + 1 )
: : - > EventB - >
( x ) EventB = ( x - 1 )
data MyStateEvent = MyStateEventA ! EventA | MyStateEventB !
handleMyStateEvent : : - > MyStateEvent - >
handleMyStateEvent state ( MyStateEventA event ) = handleEventA state event
handleMyStateEvent state ( event ) = handleEventB state event
myStateProjection = Projection myStateDefault handleMyStateEvent
mkProjection :: Name -> Name -> [Name] -> Q [Dec]
mkProjection stateName stateDefault events = do
let eventTypeName = nameBase stateName ++ "Event"
sumTypeDecls <- constructSumType eventTypeName defaultSumTypeOptions events
let handleFuncName = mkName $ "handle" ++ eventTypeName
handleFuncType <- [t| $(conT stateName) -> $(conT $ mkName eventTypeName) -> $(conT stateName) |]
handleFuncBodies <- mapM (handleFuncBody stateName) events
let
handleTypeDecls =
[ SigD handleFuncName handleFuncType
, FunD handleFuncName handleFuncBodies
]
projectionType <- [t| Projection $(conT stateName) $(conT $ mkName eventTypeName) |]
let
projectionTypeName = mkName $ nameBase stateName ++ "Projection"
projectionTypeDecl = TySynD projectionTypeName [] projectionType
projectionFuncExpr <- [e| Projection $(varE stateDefault) $(varE handleFuncName) |]
let
projectionFuncName = mkName $ firstCharToLower (nameBase stateName) ++ "Projection"
projectionFuncClause = Clause [] (NormalB projectionFuncExpr) []
projectionDecls =
[ SigD projectionFuncName (ConT projectionTypeName)
, FunD projectionFuncName [projectionFuncClause]
]
return $ sumTypeDecls ++ handleTypeDecls ++ [projectionTypeDecl] ++ projectionDecls
handleFuncBody :: Name -> Name -> Q Clause
handleFuncBody stateName event = do
let
statePattern = VarP (mkName "state")
eventPattern = ConP (mkName $ nameBase stateName ++ nameBase event) [VarP (mkName "event")]
handleFuncName = mkName $ "handle" ++ nameBase event
constructor <- [e| $(varE handleFuncName) $(varE $ mkName "state") $(varE $ mkName "event") |]
return $ Clause [statePattern, eventPattern] (NormalB constructor) []
firstCharToLower :: String -> String
firstCharToLower [] = []
firstCharToLower (x:xs) = toLower x : xs
|
ebb84146d112379eeeaa8d25872bf27e97292451e8a8e8191d804829943e5017 | LambdaScientist/CLaSH-by-example | TestSimpleDFlop.hs | # LANGUAGE NoImplicitPrelude #
# LANGUAGE RecordWildCards #
# LANGUAGE DeriveGeneric #
{-# LANGUAGE DeriveAnyClass #-}
module ClocksAndRegisters.TestSimpleDFlop where
import CLaSH.Prelude
import SAFE.TestingTools
import SAFE.CommonClash
import ClocksAndRegisters.Models.SimpleDFlop
import Text.PrettyPrint.HughesPJClass
import GHC.Generics (Generic)
import Control.DeepSeq
configurationList :: [Config]
configurationList = [configOne, configTwo, configThree, configFour]
where
startSt = St 0
inputOne = signal $ PIn 0 0
configOne = Config inputOne startSt
inputTwo = signal $ PIn 0 1
configTwo = Config inputTwo startSt
inputThree = signal $ PIn 1 0
configThree = Config inputThree startSt
startStOther = St 1
inputFour = signal $ PIn 1 1
configFour = Config inputFour startStOther
---TESTING
data Config = Config { input :: Signal PIn
, startSt :: St
}
instance NFData Config where
rnf a = seq a ()
instance Pretty Config where
pPrint Config{..} = text "Config:"
$ + $ text " input = " < + > pPrint input
$+$ text "startSt =" <+> pPrint startSt
instance Transition Config where
runOneTest = runOneTest'
setupTest :: Config -> Signal St
setupTest (Config pin st) = topEntity' st pin
setupAndRun :: [[TestResult]]
setupAndRun = runConfigList' False 5 setupTest configurationList
ppSetupAndRun :: Doc
ppSetupAndRun = pPrint setupAndRun
ppSetupAndRun2 :: String
ppSetupAndRun2 = show setupAndRun
| null | https://raw.githubusercontent.com/LambdaScientist/CLaSH-by-example/e783cd2f2408e67baf7f36c10398c27036a78ef3/ConvertedClashExamples/src/ClocksAndRegisters/TestSimpleDFlop.hs | haskell | # LANGUAGE DeriveAnyClass #
-TESTING | # LANGUAGE NoImplicitPrelude #
# LANGUAGE RecordWildCards #
# LANGUAGE DeriveGeneric #
module ClocksAndRegisters.TestSimpleDFlop where
import CLaSH.Prelude
import SAFE.TestingTools
import SAFE.CommonClash
import ClocksAndRegisters.Models.SimpleDFlop
import Text.PrettyPrint.HughesPJClass
import GHC.Generics (Generic)
import Control.DeepSeq
configurationList :: [Config]
configurationList = [configOne, configTwo, configThree, configFour]
where
startSt = St 0
inputOne = signal $ PIn 0 0
configOne = Config inputOne startSt
inputTwo = signal $ PIn 0 1
configTwo = Config inputTwo startSt
inputThree = signal $ PIn 1 0
configThree = Config inputThree startSt
startStOther = St 1
inputFour = signal $ PIn 1 1
configFour = Config inputFour startStOther
data Config = Config { input :: Signal PIn
, startSt :: St
}
instance NFData Config where
rnf a = seq a ()
instance Pretty Config where
pPrint Config{..} = text "Config:"
$ + $ text " input = " < + > pPrint input
$+$ text "startSt =" <+> pPrint startSt
instance Transition Config where
runOneTest = runOneTest'
setupTest :: Config -> Signal St
setupTest (Config pin st) = topEntity' st pin
setupAndRun :: [[TestResult]]
setupAndRun = runConfigList' False 5 setupTest configurationList
ppSetupAndRun :: Doc
ppSetupAndRun = pPrint setupAndRun
ppSetupAndRun2 :: String
ppSetupAndRun2 = show setupAndRun
|
64c42355d3225bc220b20aeffe4f876828f612b4ba19d6045bf6e1eba14d4acc | opennars/Narjure | set_functions.clj | (ns nal.deriver.set-functions
(:require [clojure.set :as set]))
;todo performance
(defn difference
"Set difference precondition operation application code"
[[op & set1] [_ & set2]]
(into [op] (sort-by hash (set/difference (set set1) (set set2)))))
(defn union [[op & set1] [_ & set2]]
"Set union precondition operation application code"
(into [op] (sort-by hash (set/union (set set1) (set set2)))))
(defn intersection [[op & set1] [_ & set2]]
"Set intersection precondition operation application code"
(into [op] (sort-by hash (set/intersection (set set1) (set set2)))))
(def f-map {:difference difference
:union union
:intersection intersection})
(defn not-empty-diff? [[_ & set1] [_ & set2]]
(not-empty (set/difference (set set1) (set set2))))
(defn not-empty-inter? [[_ & set1] [_ & set2]]
(not-empty (set/intersection (set set1) (set set2))))
| null | https://raw.githubusercontent.com/opennars/Narjure/cd5a72e6777fc47271d721fef8362aa2dad664ca/src/nal/deriver/set_functions.clj | clojure | todo performance | (ns nal.deriver.set-functions
(:require [clojure.set :as set]))
(defn difference
"Set difference precondition operation application code"
[[op & set1] [_ & set2]]
(into [op] (sort-by hash (set/difference (set set1) (set set2)))))
(defn union [[op & set1] [_ & set2]]
"Set union precondition operation application code"
(into [op] (sort-by hash (set/union (set set1) (set set2)))))
(defn intersection [[op & set1] [_ & set2]]
"Set intersection precondition operation application code"
(into [op] (sort-by hash (set/intersection (set set1) (set set2)))))
(def f-map {:difference difference
:union union
:intersection intersection})
(defn not-empty-diff? [[_ & set1] [_ & set2]]
(not-empty (set/difference (set set1) (set set2))))
(defn not-empty-inter? [[_ & set1] [_ & set2]]
(not-empty (set/intersection (set set1) (set set2))))
|
d052b6dd73994ee19910d5503ab04cead2005197323ce4a24e719bb117097ece | UBTECH-Walker/WalkerSimulationFor2020WAIC | HeadPanCommand.lisp | ; Auto-generated. Do not edit!
(cl:in-package ubt_core_msgs-msg)
;//! \htmlinclude HeadPanCommand.msg.html
(cl:defclass <HeadPanCommand> (roslisp-msg-protocol:ros-message)
((target
:reader target
:initarg :target
:type cl:float
:initform 0.0)
(speed_ratio
:reader speed_ratio
:initarg :speed_ratio
:type cl:float
:initform 0.0)
(enable_pan_request
:reader enable_pan_request
:initarg :enable_pan_request
:type cl:fixnum
:initform 0))
)
(cl:defclass HeadPanCommand (<HeadPanCommand>)
())
(cl:defmethod cl:initialize-instance :after ((m <HeadPanCommand>) cl:&rest args)
(cl:declare (cl:ignorable args))
(cl:unless (cl:typep m 'HeadPanCommand)
(roslisp-msg-protocol:msg-deprecation-warning "using old message class name ubt_core_msgs-msg:<HeadPanCommand> is deprecated: use ubt_core_msgs-msg:HeadPanCommand instead.")))
(cl:ensure-generic-function 'target-val :lambda-list '(m))
(cl:defmethod target-val ((m <HeadPanCommand>))
(roslisp-msg-protocol:msg-deprecation-warning "Using old-style slot reader ubt_core_msgs-msg:target-val is deprecated. Use ubt_core_msgs-msg:target instead.")
(target m))
(cl:ensure-generic-function 'speed_ratio-val :lambda-list '(m))
(cl:defmethod speed_ratio-val ((m <HeadPanCommand>))
(roslisp-msg-protocol:msg-deprecation-warning "Using old-style slot reader ubt_core_msgs-msg:speed_ratio-val is deprecated. Use ubt_core_msgs-msg:speed_ratio instead.")
(speed_ratio m))
(cl:ensure-generic-function 'enable_pan_request-val :lambda-list '(m))
(cl:defmethod enable_pan_request-val ((m <HeadPanCommand>))
(roslisp-msg-protocol:msg-deprecation-warning "Using old-style slot reader ubt_core_msgs-msg:enable_pan_request-val is deprecated. Use ubt_core_msgs-msg:enable_pan_request instead.")
(enable_pan_request m))
(cl:defmethod roslisp-msg-protocol:symbol-codes ((msg-type (cl:eql '<HeadPanCommand>)))
"Constants for message type '<HeadPanCommand>"
'((:MAX_SPEED_RATIO . 1.0)
(:MIN_SPEED_RATIO . 0.0)
(:REQUEST_PAN_DISABLE . 0)
(:REQUEST_PAN_ENABLE . 1)
(:REQUEST_PAN_VOID . 2))
)
(cl:defmethod roslisp-msg-protocol:symbol-codes ((msg-type (cl:eql 'HeadPanCommand)))
"Constants for message type 'HeadPanCommand"
'((:MAX_SPEED_RATIO . 1.0)
(:MIN_SPEED_RATIO . 0.0)
(:REQUEST_PAN_DISABLE . 0)
(:REQUEST_PAN_ENABLE . 1)
(:REQUEST_PAN_VOID . 2))
)
(cl:defmethod roslisp-msg-protocol:serialize ((msg <HeadPanCommand>) ostream)
"Serializes a message object of type '<HeadPanCommand>"
(cl:let ((bits (roslisp-utils:encode-single-float-bits (cl:slot-value msg 'target))))
(cl:write-byte (cl:ldb (cl:byte 8 0) bits) ostream)
(cl:write-byte (cl:ldb (cl:byte 8 8) bits) ostream)
(cl:write-byte (cl:ldb (cl:byte 8 16) bits) ostream)
(cl:write-byte (cl:ldb (cl:byte 8 24) bits) ostream))
(cl:let ((bits (roslisp-utils:encode-single-float-bits (cl:slot-value msg 'speed_ratio))))
(cl:write-byte (cl:ldb (cl:byte 8 0) bits) ostream)
(cl:write-byte (cl:ldb (cl:byte 8 8) bits) ostream)
(cl:write-byte (cl:ldb (cl:byte 8 16) bits) ostream)
(cl:write-byte (cl:ldb (cl:byte 8 24) bits) ostream))
(cl:write-byte (cl:ldb (cl:byte 8 0) (cl:slot-value msg 'enable_pan_request)) ostream)
)
(cl:defmethod roslisp-msg-protocol:deserialize ((msg <HeadPanCommand>) istream)
"Deserializes a message object of type '<HeadPanCommand>"
(cl:let ((bits 0))
(cl:setf (cl:ldb (cl:byte 8 0) bits) (cl:read-byte istream))
(cl:setf (cl:ldb (cl:byte 8 8) bits) (cl:read-byte istream))
(cl:setf (cl:ldb (cl:byte 8 16) bits) (cl:read-byte istream))
(cl:setf (cl:ldb (cl:byte 8 24) bits) (cl:read-byte istream))
(cl:setf (cl:slot-value msg 'target) (roslisp-utils:decode-single-float-bits bits)))
(cl:let ((bits 0))
(cl:setf (cl:ldb (cl:byte 8 0) bits) (cl:read-byte istream))
(cl:setf (cl:ldb (cl:byte 8 8) bits) (cl:read-byte istream))
(cl:setf (cl:ldb (cl:byte 8 16) bits) (cl:read-byte istream))
(cl:setf (cl:ldb (cl:byte 8 24) bits) (cl:read-byte istream))
(cl:setf (cl:slot-value msg 'speed_ratio) (roslisp-utils:decode-single-float-bits bits)))
(cl:setf (cl:ldb (cl:byte 8 0) (cl:slot-value msg 'enable_pan_request)) (cl:read-byte istream))
msg
)
(cl:defmethod roslisp-msg-protocol:ros-datatype ((msg (cl:eql '<HeadPanCommand>)))
"Returns string type for a message object of type '<HeadPanCommand>"
"ubt_core_msgs/HeadPanCommand")
(cl:defmethod roslisp-msg-protocol:ros-datatype ((msg (cl:eql 'HeadPanCommand)))
"Returns string type for a message object of type 'HeadPanCommand"
"ubt_core_msgs/HeadPanCommand")
(cl:defmethod roslisp-msg-protocol:md5sum ((type (cl:eql '<HeadPanCommand>)))
"Returns md5sum for a message object of type '<HeadPanCommand>"
"23b8a3f4b7ee9de7099d029e57660a8c")
(cl:defmethod roslisp-msg-protocol:md5sum ((type (cl:eql 'HeadPanCommand)))
"Returns md5sum for a message object of type 'HeadPanCommand"
"23b8a3f4b7ee9de7099d029e57660a8c")
(cl:defmethod roslisp-msg-protocol:message-definition ((type (cl:eql '<HeadPanCommand>)))
"Returns full string definition for message of type '<HeadPanCommand>"
(cl:format cl:nil "float32 target # radians for target, 0 str~%float32 speed_ratio # Percentage of max speed [0-1]~%#~% float32 MAX_SPEED_RATIO = 1.0~% float32 MIN_SPEED_RATIO = 0.0~%#~%uint8 enable_pan_request # override automatic pan enable/disable~%# enable_pan_request is tristate: 0 = disable pan; 1 = enable pan; 2 = don't change pan~% uint8 REQUEST_PAN_DISABLE = 0~% uint8 REQUEST_PAN_ENABLE = 1~% uint8 REQUEST_PAN_VOID = 2~%#~%~%~%"))
(cl:defmethod roslisp-msg-protocol:message-definition ((type (cl:eql 'HeadPanCommand)))
"Returns full string definition for message of type 'HeadPanCommand"
(cl:format cl:nil "float32 target # radians for target, 0 str~%float32 speed_ratio # Percentage of max speed [0-1]~%#~% float32 MAX_SPEED_RATIO = 1.0~% float32 MIN_SPEED_RATIO = 0.0~%#~%uint8 enable_pan_request # override automatic pan enable/disable~%# enable_pan_request is tristate: 0 = disable pan; 1 = enable pan; 2 = don't change pan~% uint8 REQUEST_PAN_DISABLE = 0~% uint8 REQUEST_PAN_ENABLE = 1~% uint8 REQUEST_PAN_VOID = 2~%#~%~%~%"))
(cl:defmethod roslisp-msg-protocol:serialization-length ((msg <HeadPanCommand>))
(cl:+ 0
4
4
1
))
(cl:defmethod roslisp-msg-protocol:ros-message-to-list ((msg <HeadPanCommand>))
"Converts a ROS message object to a list"
(cl:list 'HeadPanCommand
(cl:cons ':target (target msg))
(cl:cons ':speed_ratio (speed_ratio msg))
(cl:cons ':enable_pan_request (enable_pan_request msg))
))
| null | https://raw.githubusercontent.com/UBTECH-Walker/WalkerSimulationFor2020WAIC/7cdb21dabb8423994ba3f6021bc7934290d5faa9/walker_WAIC_18.04_v1.2_20200616/walker_install/share/common-lisp/ros/ubt_core_msgs/msg/HeadPanCommand.lisp | lisp | Auto-generated. Do not edit!
//! \htmlinclude HeadPanCommand.msg.html |
(cl:in-package ubt_core_msgs-msg)
(cl:defclass <HeadPanCommand> (roslisp-msg-protocol:ros-message)
((target
:reader target
:initarg :target
:type cl:float
:initform 0.0)
(speed_ratio
:reader speed_ratio
:initarg :speed_ratio
:type cl:float
:initform 0.0)
(enable_pan_request
:reader enable_pan_request
:initarg :enable_pan_request
:type cl:fixnum
:initform 0))
)
(cl:defclass HeadPanCommand (<HeadPanCommand>)
())
(cl:defmethod cl:initialize-instance :after ((m <HeadPanCommand>) cl:&rest args)
(cl:declare (cl:ignorable args))
(cl:unless (cl:typep m 'HeadPanCommand)
(roslisp-msg-protocol:msg-deprecation-warning "using old message class name ubt_core_msgs-msg:<HeadPanCommand> is deprecated: use ubt_core_msgs-msg:HeadPanCommand instead.")))
(cl:ensure-generic-function 'target-val :lambda-list '(m))
(cl:defmethod target-val ((m <HeadPanCommand>))
(roslisp-msg-protocol:msg-deprecation-warning "Using old-style slot reader ubt_core_msgs-msg:target-val is deprecated. Use ubt_core_msgs-msg:target instead.")
(target m))
(cl:ensure-generic-function 'speed_ratio-val :lambda-list '(m))
(cl:defmethod speed_ratio-val ((m <HeadPanCommand>))
(roslisp-msg-protocol:msg-deprecation-warning "Using old-style slot reader ubt_core_msgs-msg:speed_ratio-val is deprecated. Use ubt_core_msgs-msg:speed_ratio instead.")
(speed_ratio m))
(cl:ensure-generic-function 'enable_pan_request-val :lambda-list '(m))
(cl:defmethod enable_pan_request-val ((m <HeadPanCommand>))
(roslisp-msg-protocol:msg-deprecation-warning "Using old-style slot reader ubt_core_msgs-msg:enable_pan_request-val is deprecated. Use ubt_core_msgs-msg:enable_pan_request instead.")
(enable_pan_request m))
(cl:defmethod roslisp-msg-protocol:symbol-codes ((msg-type (cl:eql '<HeadPanCommand>)))
"Constants for message type '<HeadPanCommand>"
'((:MAX_SPEED_RATIO . 1.0)
(:MIN_SPEED_RATIO . 0.0)
(:REQUEST_PAN_DISABLE . 0)
(:REQUEST_PAN_ENABLE . 1)
(:REQUEST_PAN_VOID . 2))
)
(cl:defmethod roslisp-msg-protocol:symbol-codes ((msg-type (cl:eql 'HeadPanCommand)))
"Constants for message type 'HeadPanCommand"
'((:MAX_SPEED_RATIO . 1.0)
(:MIN_SPEED_RATIO . 0.0)
(:REQUEST_PAN_DISABLE . 0)
(:REQUEST_PAN_ENABLE . 1)
(:REQUEST_PAN_VOID . 2))
)
(cl:defmethod roslisp-msg-protocol:serialize ((msg <HeadPanCommand>) ostream)
"Serializes a message object of type '<HeadPanCommand>"
(cl:let ((bits (roslisp-utils:encode-single-float-bits (cl:slot-value msg 'target))))
(cl:write-byte (cl:ldb (cl:byte 8 0) bits) ostream)
(cl:write-byte (cl:ldb (cl:byte 8 8) bits) ostream)
(cl:write-byte (cl:ldb (cl:byte 8 16) bits) ostream)
(cl:write-byte (cl:ldb (cl:byte 8 24) bits) ostream))
(cl:let ((bits (roslisp-utils:encode-single-float-bits (cl:slot-value msg 'speed_ratio))))
(cl:write-byte (cl:ldb (cl:byte 8 0) bits) ostream)
(cl:write-byte (cl:ldb (cl:byte 8 8) bits) ostream)
(cl:write-byte (cl:ldb (cl:byte 8 16) bits) ostream)
(cl:write-byte (cl:ldb (cl:byte 8 24) bits) ostream))
(cl:write-byte (cl:ldb (cl:byte 8 0) (cl:slot-value msg 'enable_pan_request)) ostream)
)
(cl:defmethod roslisp-msg-protocol:deserialize ((msg <HeadPanCommand>) istream)
"Deserializes a message object of type '<HeadPanCommand>"
(cl:let ((bits 0))
(cl:setf (cl:ldb (cl:byte 8 0) bits) (cl:read-byte istream))
(cl:setf (cl:ldb (cl:byte 8 8) bits) (cl:read-byte istream))
(cl:setf (cl:ldb (cl:byte 8 16) bits) (cl:read-byte istream))
(cl:setf (cl:ldb (cl:byte 8 24) bits) (cl:read-byte istream))
(cl:setf (cl:slot-value msg 'target) (roslisp-utils:decode-single-float-bits bits)))
(cl:let ((bits 0))
(cl:setf (cl:ldb (cl:byte 8 0) bits) (cl:read-byte istream))
(cl:setf (cl:ldb (cl:byte 8 8) bits) (cl:read-byte istream))
(cl:setf (cl:ldb (cl:byte 8 16) bits) (cl:read-byte istream))
(cl:setf (cl:ldb (cl:byte 8 24) bits) (cl:read-byte istream))
(cl:setf (cl:slot-value msg 'speed_ratio) (roslisp-utils:decode-single-float-bits bits)))
(cl:setf (cl:ldb (cl:byte 8 0) (cl:slot-value msg 'enable_pan_request)) (cl:read-byte istream))
msg
)
(cl:defmethod roslisp-msg-protocol:ros-datatype ((msg (cl:eql '<HeadPanCommand>)))
"Returns string type for a message object of type '<HeadPanCommand>"
"ubt_core_msgs/HeadPanCommand")
(cl:defmethod roslisp-msg-protocol:ros-datatype ((msg (cl:eql 'HeadPanCommand)))
"Returns string type for a message object of type 'HeadPanCommand"
"ubt_core_msgs/HeadPanCommand")
(cl:defmethod roslisp-msg-protocol:md5sum ((type (cl:eql '<HeadPanCommand>)))
"Returns md5sum for a message object of type '<HeadPanCommand>"
"23b8a3f4b7ee9de7099d029e57660a8c")
(cl:defmethod roslisp-msg-protocol:md5sum ((type (cl:eql 'HeadPanCommand)))
"Returns md5sum for a message object of type 'HeadPanCommand"
"23b8a3f4b7ee9de7099d029e57660a8c")
(cl:defmethod roslisp-msg-protocol:message-definition ((type (cl:eql '<HeadPanCommand>)))
"Returns full string definition for message of type '<HeadPanCommand>"
(cl:format cl:nil "float32 target # radians for target, 0 str~%float32 speed_ratio # Percentage of max speed [0-1]~%#~% float32 MAX_SPEED_RATIO = 1.0~% float32 MIN_SPEED_RATIO = 0.0~%#~%uint8 enable_pan_request # override automatic pan enable/disable~%# enable_pan_request is tristate: 0 = disable pan; 1 = enable pan; 2 = don't change pan~% uint8 REQUEST_PAN_DISABLE = 0~% uint8 REQUEST_PAN_ENABLE = 1~% uint8 REQUEST_PAN_VOID = 2~%#~%~%~%"))
(cl:defmethod roslisp-msg-protocol:message-definition ((type (cl:eql 'HeadPanCommand)))
"Returns full string definition for message of type 'HeadPanCommand"
(cl:format cl:nil "float32 target # radians for target, 0 str~%float32 speed_ratio # Percentage of max speed [0-1]~%#~% float32 MAX_SPEED_RATIO = 1.0~% float32 MIN_SPEED_RATIO = 0.0~%#~%uint8 enable_pan_request # override automatic pan enable/disable~%# enable_pan_request is tristate: 0 = disable pan; 1 = enable pan; 2 = don't change pan~% uint8 REQUEST_PAN_DISABLE = 0~% uint8 REQUEST_PAN_ENABLE = 1~% uint8 REQUEST_PAN_VOID = 2~%#~%~%~%"))
(cl:defmethod roslisp-msg-protocol:serialization-length ((msg <HeadPanCommand>))
(cl:+ 0
4
4
1
))
(cl:defmethod roslisp-msg-protocol:ros-message-to-list ((msg <HeadPanCommand>))
"Converts a ROS message object to a list"
(cl:list 'HeadPanCommand
(cl:cons ':target (target msg))
(cl:cons ':speed_ratio (speed_ratio msg))
(cl:cons ':enable_pan_request (enable_pan_request msg))
))
|
41dbca589f225c6e4c7105fb3b59988735eaf2595da132b6836a91fae4f19143 | practicalli/four-clojure | project.clj | (defproject four-clojure "0.1.0-SNAPSHOT"
:description "Discussions on the solutions to the 4Clojure.com challenges"
:url "-clojure"
:license {:name "Creative Commons Attribution Share-Alike 4.0 International"
:url ""}
:dependencies [[org.clojure/clojure "1.9.0"]])
| null | https://raw.githubusercontent.com/practicalli/four-clojure/9812b63769a06f9b0bfd63e5ffce380b67e5468b/project.clj | clojure | (defproject four-clojure "0.1.0-SNAPSHOT"
:description "Discussions on the solutions to the 4Clojure.com challenges"
:url "-clojure"
:license {:name "Creative Commons Attribution Share-Alike 4.0 International"
:url ""}
:dependencies [[org.clojure/clojure "1.9.0"]])
| |
f74ce5df45a8c123f57723208f7be51af6933fb710798bd741baf87038cf96df | pink-gorilla/webly | files.clj | (ns modular.webserver.handler.files
(:require
; [taoensso.timbre :refer [debug info warn error]]
[bidi.bidi :as bidi :refer [url-decode]]
[clojure.java.io :as io]
[ring.util.response :refer [file-response resource-response]]
[ring.middleware.content-type :refer [wrap-content-type]]
[ring.middleware.not-modified :refer [wrap-not-modified]]))
(defrecord FilesMaybe [options]
bidi/Matched
(resolve-handler [this m]
(let [reminder (url-decode (:remainder m))
filename (str (:dir options) reminder)]
;(warn "file-maybe: " filename)
(when (.exists (io/file filename))
;(warn "file found: " filename)
(assoc (dissoc m :remainder)
:handler (->
(fn [req] (file-response reminder
{:root (:dir options)}))
(wrap-content-type options)
(wrap-not-modified))))))
(unresolve-handler [this m]
(when (= this (:handler m)) "")))
; copied from bidi.
; but bidi forgot to wrap not modified
;
(defrecord ResourcesMaybe [options]
bidi/Matched
(resolve-handler [this m]
(let [path (url-decode (:remainder m))]
(when (not-empty path)
(when-let [res (io/resource (str (:prefix options) path))]
;(warn "res: " path)
(assoc (dissoc m :remainder)
:handler (->
(fn [req] (resource-response (str (:prefix options) path)))
(wrap-content-type options)
(wrap-not-modified) ; awb99 hack
))))))
(unresolve-handler [this m]
(when (= this (:handler m)) ""))) | null | https://raw.githubusercontent.com/pink-gorilla/webly/d449a506e6101afc16d384300cdebb7425e3a7f3/webserver/src/modular/webserver/handler/files.clj | clojure | [taoensso.timbre :refer [debug info warn error]]
(warn "file-maybe: " filename)
(warn "file found: " filename)
copied from bidi.
but bidi forgot to wrap not modified
(warn "res: " path)
awb99 hack | (ns modular.webserver.handler.files
(:require
[bidi.bidi :as bidi :refer [url-decode]]
[clojure.java.io :as io]
[ring.util.response :refer [file-response resource-response]]
[ring.middleware.content-type :refer [wrap-content-type]]
[ring.middleware.not-modified :refer [wrap-not-modified]]))
(defrecord FilesMaybe [options]
bidi/Matched
(resolve-handler [this m]
(let [reminder (url-decode (:remainder m))
filename (str (:dir options) reminder)]
(when (.exists (io/file filename))
(assoc (dissoc m :remainder)
:handler (->
(fn [req] (file-response reminder
{:root (:dir options)}))
(wrap-content-type options)
(wrap-not-modified))))))
(unresolve-handler [this m]
(when (= this (:handler m)) "")))
(defrecord ResourcesMaybe [options]
bidi/Matched
(resolve-handler [this m]
(let [path (url-decode (:remainder m))]
(when (not-empty path)
(when-let [res (io/resource (str (:prefix options) path))]
(assoc (dissoc m :remainder)
:handler (->
(fn [req] (resource-response (str (:prefix options) path)))
(wrap-content-type options)
))))))
(unresolve-handler [this m]
(when (= this (:handler m)) ""))) |
0697f52c89f243a8197fc93491ef5a72824312739425cf50eaa5dee08b40c0a4 | yogthos/reagent-dnd | core.cljs | (ns react-dnd-test.core
(:require
[reagent.core :as r]
[reagent-dnd.core :as dnd])
(:require-macros
[reagent.ratom :refer [reaction]]))
(defonce state (r/atom {:knight-position [0 0]}))
(defn knight-at? [position]
(reaction (= (:knight-position @state) position)))
(defn can-move-knight? [position]
(reaction
(let [[kx ky] (:knight-position @state)
[tx ty] position
dx (Math/abs (- kx tx))
dy (Math/abs (- ky ty))]
(or
(and (= dx 2) (= dy 1))
(and (= dy 2) (= dx 1))))))
(defn knight-span [drag-state]
[:span {:style
{:cursor :move
:opacity (if (:dragging? @drag-state) 0.5 1)}}
"♘"])
(defn knight []
(let [drag-state (r/atom {})]
[dnd/drag-source
:type :knight
:state drag-state
:child [knight-span drag-state]]))
(defn square [& {:keys [black? piece drag-state]}]
[:div {:style {:position :relative
:width "32px"
:height "32px"
:background (if black? :white :black)
:color (if black? :black :white)
:font-size "32px"}}
piece
(when (:is-over? @drag-state)
[:div {:style {:width "32px"
:height "32px"
:position :absolute
:z-index "1"
:opacity "0.5"
:background-color :red}}])
(when (:can-drop? @drag-state)
[:div {:style {:width "32px"
:height "32px"
:position :absolute
:z-index "2"
:opacity "0.5"
:background-color :green}}])])
(defn move-knight-to [position]
(swap! state assoc :knight-position position))
(defn board-square [& {:keys [position]}]
(let [drag-state (r/atom {})
[x y] position
black? (odd? (+ x y))]
[:div {:style {:height "12.5%"
:width "12.5%"}}
[:div {:style {:position :relative :width "32px" :height "32px"}}
[dnd/drop-target
:types [:knight]
:state drag-state
:drop #(move-knight-to position)
:can-drop? (fn [] @(can-move-knight? position))
:child [square
:drag-state drag-state
:black? black?
:piece (when @(knight-at? position)
[knight])]]]]))
(defn position [i]
[(quot i 8) (rem i 8)])
(defn board []
[:div {:style {:width "256px"
:height "256px"
:display :flex
:flex-wrap :wrap}}
(for [i (range 64) :let [p (position i)]]
^{:key (str "square-" i)}
[board-square :position p])])
(def context (dnd/with-drag-drop-context dnd/html5-backend board))
(defn home []
[context])
| null | https://raw.githubusercontent.com/yogthos/reagent-dnd/9830e240b5f2e372c40a633432d0593288ec6682/env/dev/cljs/react_dnd_test/core.cljs | clojure | (ns react-dnd-test.core
(:require
[reagent.core :as r]
[reagent-dnd.core :as dnd])
(:require-macros
[reagent.ratom :refer [reaction]]))
(defonce state (r/atom {:knight-position [0 0]}))
(defn knight-at? [position]
(reaction (= (:knight-position @state) position)))
(defn can-move-knight? [position]
(reaction
(let [[kx ky] (:knight-position @state)
[tx ty] position
dx (Math/abs (- kx tx))
dy (Math/abs (- ky ty))]
(or
(and (= dx 2) (= dy 1))
(and (= dy 2) (= dx 1))))))
(defn knight-span [drag-state]
[:span {:style
{:cursor :move
:opacity (if (:dragging? @drag-state) 0.5 1)}}
"♘"])
(defn knight []
(let [drag-state (r/atom {})]
[dnd/drag-source
:type :knight
:state drag-state
:child [knight-span drag-state]]))
(defn square [& {:keys [black? piece drag-state]}]
[:div {:style {:position :relative
:width "32px"
:height "32px"
:background (if black? :white :black)
:color (if black? :black :white)
:font-size "32px"}}
piece
(when (:is-over? @drag-state)
[:div {:style {:width "32px"
:height "32px"
:position :absolute
:z-index "1"
:opacity "0.5"
:background-color :red}}])
(when (:can-drop? @drag-state)
[:div {:style {:width "32px"
:height "32px"
:position :absolute
:z-index "2"
:opacity "0.5"
:background-color :green}}])])
(defn move-knight-to [position]
(swap! state assoc :knight-position position))
(defn board-square [& {:keys [position]}]
(let [drag-state (r/atom {})
[x y] position
black? (odd? (+ x y))]
[:div {:style {:height "12.5%"
:width "12.5%"}}
[:div {:style {:position :relative :width "32px" :height "32px"}}
[dnd/drop-target
:types [:knight]
:state drag-state
:drop #(move-knight-to position)
:can-drop? (fn [] @(can-move-knight? position))
:child [square
:drag-state drag-state
:black? black?
:piece (when @(knight-at? position)
[knight])]]]]))
(defn position [i]
[(quot i 8) (rem i 8)])
(defn board []
[:div {:style {:width "256px"
:height "256px"
:display :flex
:flex-wrap :wrap}}
(for [i (range 64) :let [p (position i)]]
^{:key (str "square-" i)}
[board-square :position p])])
(def context (dnd/with-drag-drop-context dnd/html5-backend board))
(defn home []
[context])
| |
14408538c1293144f87f071f2349b7ffa5538dfe1f43a6daefa4550ff075ce96 | bmeurer/ocamljit2 | testsieve.ml | let sieve primes=
Event.sync (Event.send primes 0);
Event.sync (Event.send primes 1);
Event.sync (Event.send primes 2);
let integers = Event.new_channel () in
let rec enumerate n=
Event.sync (Event.send integers n);
enumerate (n + 2)
and filter inpout =
let n = Event.sync (Event.receive inpout)
On prepare le terrain pour l'appel recursif
and output = Event.new_channel () in
Celui qui etait en tete du crible est premier
Event.sync (Event.send primes n);
Thread.create filter output;
On elimine de la sortie ceux qui sont des multiples de n
while true do
let m = Event.sync (Event.receive inpout) in
print_int n ; print_string " : " ; print_int m ; print_newline ( ) ;
if (m mod n) = 0
then ()
else ((Event.sync (Event.send output m));())
done in
Thread.create filter integers;
Thread.create enumerate 3
let premiers = Event.new_channel ()
let main _ =
Thread.create sieve premiers;
while true do
for i = 1 to 100 do
let n = Event.sync (Event.receive premiers) in
print_int n; print_newline()
done;
exit 0
done
let _ =
try main ()
with _ -> exit 0;;
| null | https://raw.githubusercontent.com/bmeurer/ocamljit2/ef06db5c688c1160acc1de1f63c29473bcd0055c/testsuite/tests/lib-threads/testsieve.ml | ocaml | let sieve primes=
Event.sync (Event.send primes 0);
Event.sync (Event.send primes 1);
Event.sync (Event.send primes 2);
let integers = Event.new_channel () in
let rec enumerate n=
Event.sync (Event.send integers n);
enumerate (n + 2)
and filter inpout =
let n = Event.sync (Event.receive inpout)
On prepare le terrain pour l'appel recursif
and output = Event.new_channel () in
Celui qui etait en tete du crible est premier
Event.sync (Event.send primes n);
Thread.create filter output;
On elimine de la sortie ceux qui sont des multiples de n
while true do
let m = Event.sync (Event.receive inpout) in
print_int n ; print_string " : " ; print_int m ; print_newline ( ) ;
if (m mod n) = 0
then ()
else ((Event.sync (Event.send output m));())
done in
Thread.create filter integers;
Thread.create enumerate 3
let premiers = Event.new_channel ()
let main _ =
Thread.create sieve premiers;
while true do
for i = 1 to 100 do
let n = Event.sync (Event.receive premiers) in
print_int n; print_newline()
done;
exit 0
done
let _ =
try main ()
with _ -> exit 0;;
| |
d40d557adfb64acef47f285c7dca9be9b2abf7e95abc64e356a1ddb22b5e58a9 | deadtrickster/cl-events | package.lisp | (in-package :cl-user)
(defpackage :cl-events.test
(:use :cl
:alexandria
:iterate
:prove
:cl-events))
(in-package :cl-events.test)
| null | https://raw.githubusercontent.com/deadtrickster/cl-events/2fdec2dbdef8ba2144139b27a7350d4cedc011a1/t/package.lisp | lisp | (in-package :cl-user)
(defpackage :cl-events.test
(:use :cl
:alexandria
:iterate
:prove
:cl-events))
(in-package :cl-events.test)
| |
c866510a9c91716451948ac03822116e799f5ac33af07914e2828934c75e91fc | expipiplus1/vulkan | VK_KHR_portability_enumeration.hs | {-# language CPP #-}
-- | = Name
--
VK_KHR_portability_enumeration - instance extension
--
= = VK_KHR_portability_enumeration
--
-- [__Name String__]
-- @VK_KHR_portability_enumeration@
--
-- [__Extension Type__]
-- Instance extension
--
-- [__Registered Extension Number__]
395
--
-- [__Revision__]
1
--
-- [__Extension and Version Dependencies__]
--
- Requires support for Vulkan 1.0
--
-- [__Contact__]
--
-
< -Docs/issues/new?body=[VK_KHR_portability_enumeration ] @charles - lunarg%0A*Here describe the issue or question you have about the VK_KHR_portability_enumeration extension * >
--
-- == Other Extension Metadata
--
-- [__Last Modified Date__]
2021 - 06 - 02
--
-- [__IP Status__]
-- No known IP claims.
--
-- [__Interactions and External Dependencies__]
--
-- - Interacts with @VK_KHR_portability_subset@
--
-- [__Contributors__]
--
- , LunarG
--
- , LunarG
--
-- == Description
--
-- This extension allows applications to control whether devices that
expose the extension are included in the
-- results of physical device enumeration. Since devices which support the
@VK_KHR_portability_subset@ extension are not fully conformant Vulkan
implementations , the Vulkan loader does not report those devices unless
-- the application explicitly asks for them. This prevents applications
-- which may not be aware of non-conformant devices from accidentally using
-- them, as any device which supports the @VK_KHR_portability_subset@
-- extension mandates that the extension must be enabled if that device is
-- used.
--
-- This extension is implemented in the loader.
--
-- == New Enum Constants
--
-- - 'KHR_PORTABILITY_ENUMERATION_EXTENSION_NAME'
--
-- - 'KHR_PORTABILITY_ENUMERATION_SPEC_VERSION'
--
-- - Extending
' Vulkan . Core10.Enums . InstanceCreateFlagBits . InstanceCreateFlagBits ' :
--
- ' Vulkan . Core10.Enums . InstanceCreateFlagBits . INSTANCE_CREATE_ENUMERATE_PORTABILITY_BIT_KHR '
--
-- == Version History
--
- Revision 1 , 2021 - 06 - 02 ( )
--
-- - Initial version
--
-- == See Also
--
-- No cross-references are available
--
-- == Document Notes
--
-- For more information, see the
-- <-extensions/html/vkspec.html#VK_KHR_portability_enumeration Vulkan Specification>
--
-- This page is a generated document. Fixes and changes should be made to
-- the generator scripts, not directly.
module Vulkan.Extensions.VK_KHR_portability_enumeration ( KHR_PORTABILITY_ENUMERATION_SPEC_VERSION
, pattern KHR_PORTABILITY_ENUMERATION_SPEC_VERSION
, KHR_PORTABILITY_ENUMERATION_EXTENSION_NAME
, pattern KHR_PORTABILITY_ENUMERATION_EXTENSION_NAME
) where
import Data.String (IsString)
type KHR_PORTABILITY_ENUMERATION_SPEC_VERSION = 1
No documentation found for TopLevel " VK_KHR_PORTABILITY_ENUMERATION_SPEC_VERSION "
pattern KHR_PORTABILITY_ENUMERATION_SPEC_VERSION :: forall a . Integral a => a
pattern KHR_PORTABILITY_ENUMERATION_SPEC_VERSION = 1
type KHR_PORTABILITY_ENUMERATION_EXTENSION_NAME = "VK_KHR_portability_enumeration"
No documentation found for TopLevel " VK_KHR_PORTABILITY_ENUMERATION_EXTENSION_NAME "
pattern KHR_PORTABILITY_ENUMERATION_EXTENSION_NAME :: forall a . (Eq a, IsString a) => a
pattern KHR_PORTABILITY_ENUMERATION_EXTENSION_NAME = "VK_KHR_portability_enumeration"
| null | https://raw.githubusercontent.com/expipiplus1/vulkan/b1e33d1031779b4740c279c68879d05aee371659/src/Vulkan/Extensions/VK_KHR_portability_enumeration.hs | haskell | # language CPP #
| = Name
[__Name String__]
@VK_KHR_portability_enumeration@
[__Extension Type__]
Instance extension
[__Registered Extension Number__]
[__Revision__]
[__Extension and Version Dependencies__]
[__Contact__]
== Other Extension Metadata
[__Last Modified Date__]
[__IP Status__]
No known IP claims.
[__Interactions and External Dependencies__]
- Interacts with @VK_KHR_portability_subset@
[__Contributors__]
== Description
This extension allows applications to control whether devices that
results of physical device enumeration. Since devices which support the
the application explicitly asks for them. This prevents applications
which may not be aware of non-conformant devices from accidentally using
them, as any device which supports the @VK_KHR_portability_subset@
extension mandates that the extension must be enabled if that device is
used.
This extension is implemented in the loader.
== New Enum Constants
- 'KHR_PORTABILITY_ENUMERATION_EXTENSION_NAME'
- 'KHR_PORTABILITY_ENUMERATION_SPEC_VERSION'
- Extending
== Version History
- Initial version
== See Also
No cross-references are available
== Document Notes
For more information, see the
<-extensions/html/vkspec.html#VK_KHR_portability_enumeration Vulkan Specification>
This page is a generated document. Fixes and changes should be made to
the generator scripts, not directly. | VK_KHR_portability_enumeration - instance extension
= = VK_KHR_portability_enumeration
395
1
- Requires support for Vulkan 1.0
-
< -Docs/issues/new?body=[VK_KHR_portability_enumeration ] @charles - lunarg%0A*Here describe the issue or question you have about the VK_KHR_portability_enumeration extension * >
2021 - 06 - 02
- , LunarG
- , LunarG
expose the extension are included in the
@VK_KHR_portability_subset@ extension are not fully conformant Vulkan
implementations , the Vulkan loader does not report those devices unless
' Vulkan . Core10.Enums . InstanceCreateFlagBits . InstanceCreateFlagBits ' :
- ' Vulkan . Core10.Enums . InstanceCreateFlagBits . INSTANCE_CREATE_ENUMERATE_PORTABILITY_BIT_KHR '
- Revision 1 , 2021 - 06 - 02 ( )
module Vulkan.Extensions.VK_KHR_portability_enumeration ( KHR_PORTABILITY_ENUMERATION_SPEC_VERSION
, pattern KHR_PORTABILITY_ENUMERATION_SPEC_VERSION
, KHR_PORTABILITY_ENUMERATION_EXTENSION_NAME
, pattern KHR_PORTABILITY_ENUMERATION_EXTENSION_NAME
) where
import Data.String (IsString)
type KHR_PORTABILITY_ENUMERATION_SPEC_VERSION = 1
No documentation found for TopLevel " VK_KHR_PORTABILITY_ENUMERATION_SPEC_VERSION "
pattern KHR_PORTABILITY_ENUMERATION_SPEC_VERSION :: forall a . Integral a => a
pattern KHR_PORTABILITY_ENUMERATION_SPEC_VERSION = 1
type KHR_PORTABILITY_ENUMERATION_EXTENSION_NAME = "VK_KHR_portability_enumeration"
No documentation found for TopLevel " VK_KHR_PORTABILITY_ENUMERATION_EXTENSION_NAME "
pattern KHR_PORTABILITY_ENUMERATION_EXTENSION_NAME :: forall a . (Eq a, IsString a) => a
pattern KHR_PORTABILITY_ENUMERATION_EXTENSION_NAME = "VK_KHR_portability_enumeration"
|
a203c2ec4aa546de3204280a973690656702dd8e001fc340656ffb3a6bdecb3d | lambdamikel/DLMAPS | load-race.lisp | ;;;-*- Mode: Lisp; Package: COMMON-LISP-USER -*-
;;; This is the RACE Loader for ACL / LINUX Version
(in-package :cl-user)
(let ((excl::*redefinition-warnings* nil))
(let ((*enable-package-locked-errors* nil))
(defun excl::check-for-duplicate-definitions-in-file (fspec type when
&optional icsp)
(declare (ignore fspec type when icsp)))))
(let* ((load-pathname
(concatenate 'string
(directory-namestring
(translate-logical-pathname *load-pathname*))))
(example-directory
(format nil "~Aexamples/**/*.*" load-pathname))
(race-directory
(format nil "~A**/*.*" load-pathname)))
(setf (logical-pathname-translations "race")
`(("**;*.*" ,race-directory)
("examples;**;*.*" ,example-directory))))
(defun load-race ()
(load "race:race-1-1-0.fasl" :verbose t))
(load-race)
| null | https://raw.githubusercontent.com/lambdamikel/DLMAPS/7f8dbb9432069d41e6a7d9c13dc5b25602ad35dc/src/prover/dl-benchmark-suite/race-1-1/race-1-1-acl5-linux/load-race.lisp | lisp | -*- Mode: Lisp; Package: COMMON-LISP-USER -*-
This is the RACE Loader for ACL / LINUX Version |
(in-package :cl-user)
(let ((excl::*redefinition-warnings* nil))
(let ((*enable-package-locked-errors* nil))
(defun excl::check-for-duplicate-definitions-in-file (fspec type when
&optional icsp)
(declare (ignore fspec type when icsp)))))
(let* ((load-pathname
(concatenate 'string
(directory-namestring
(translate-logical-pathname *load-pathname*))))
(example-directory
(format nil "~Aexamples/**/*.*" load-pathname))
(race-directory
(format nil "~A**/*.*" load-pathname)))
(setf (logical-pathname-translations "race")
`(("**;*.*" ,race-directory)
("examples;**;*.*" ,example-directory))))
(defun load-race ()
(load "race:race-1-1-0.fasl" :verbose t))
(load-race)
|
ffacef1defb29aff8b9a6007a0c644198aa10c09c0134a905629098b12300715 | puppetlabs/trapperkeeper | bootstrap_test.clj | (ns puppetlabs.trapperkeeper.bootstrap-test
(:import (java.io StringReader))
(:require [clojure.test :refer :all]
[clojure.java.io :refer [file] :as io]
[slingshot.slingshot :refer [try+]]
[puppetlabs.kitchensink.core :refer [without-ns]]
[puppetlabs.kitchensink.classpath :refer [with-additional-classpath-entries]]
[puppetlabs.trapperkeeper.services :refer [service-map]]
[puppetlabs.trapperkeeper.app :refer [get-service]]
[puppetlabs.trapperkeeper.bootstrap :refer :all]
[puppetlabs.trapperkeeper.logging :refer [reset-logging]]
[puppetlabs.trapperkeeper.testutils.logging :refer [with-test-logging]]
[puppetlabs.trapperkeeper.testutils.bootstrap :refer [bootstrap-with-empty-config parse-and-bootstrap]]
[puppetlabs.trapperkeeper.examples.bootstrapping.test-services :refer [test-fn test-fn-two test-fn-three hello-world]]
[schema.test :as schema-test]
[me.raynes.fs :as fs]
[clojure.string :as string]))
(use-fixtures
:once
schema-test/validate-schemas
Without this , " test " and : only invocations may fail .
(fn [f] (reset-logging) (f)))
(deftest bootstrapping
(testing "Valid bootstrap configurations"
(let [bootstrap-config "./dev-resources/bootstrapping/cli/bootstrap.cfg"
app (parse-and-bootstrap bootstrap-config)]
(testing "Can load a service based on a valid bootstrap config string"
(let [test-svc (get-service app :TestService)
hello-world-svc (get-service app :HelloWorldService)]
(is (= (test-fn test-svc) :cli))
(is (= (hello-world hello-world-svc) "hello world"))))
(with-additional-classpath-entries ["./dev-resources/bootstrapping/classpath"]
(testing "Looks for bootstrap config on classpath (dev-resources)"
(with-test-logging
(let [app (bootstrap-with-empty-config)
test-svc (get-service app :TestService)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
#"Loading bootstrap config from classpath: 'file:/.*dev-resources/bootstrapping/classpath/bootstrap.cfg'"
:debug))
(is (= (test-fn test-svc) :classpath))
(is (= (hello-world hello-world-svc) "hello world")))))
(testing "Gives precedence to bootstrap config in cwd"
(let [cwd-config (io/file (System/getProperty "user.dir") "bootstrap.cfg")
test-config (io/file "./dev-resources/bootstrapping/cwd/bootstrap.cfg")]
;; This test used to set the user.dir property to the dev-resources dir above,
however in Java 11 it is illegal to set user.dir at runtime .
(is (not (.exists cwd-config))
"A bootstrap config file exists in the cwd, cannot reliably test cwd bootstrap loading!")
(try
(io/copy test-config cwd-config)
(with-test-logging
(let [app (bootstrap-with-empty-config)
test-svc (get-service app :TestService)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
#"Loading bootstrap config from current working directory: '.*/bootstrap.cfg'"
:debug))
(is (= (test-fn test-svc) :cwd))
(is (= (hello-world hello-world-svc) "hello world"))))
(finally (io/delete-file cwd-config)))))
(testing "Gives precedence to bootstrap config specified as CLI arg"
(with-test-logging
(let [bootstrap-path "./dev-resources/bootstrapping/cli/bootstrap.cfg"
app (bootstrap-with-empty-config ["--bootstrap-config" bootstrap-path])
test-svc (get-service app :TestService)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
(format "Loading bootstrap configs:\n%s" bootstrap-path)
:debug))
(is (= (test-fn test-svc) :cli))
(is (= (hello-world hello-world-svc) "hello world")))))))
(testing "Invalid bootstrap configurations"
(testing "Bootstrap config path specified on CLI does not exist"
(let [cfg-path "./dev-resources/bootstrapping/cli/non-existent-bootstrap.cfg"]
(is (thrown-with-msg?
IllegalArgumentException
#"Specified bootstrap config file does not exist: '.*non-existent-bootstrap.cfg'"
(bootstrap-with-empty-config ["--bootstrap-config" cfg-path])))))
(testing "No bootstrap config found"
(is (thrown-with-msg?
IllegalStateException
#"Unable to find bootstrap.cfg file via --bootstrap-config command line argument, current working directory, or on classpath"
(bootstrap-with-empty-config)))
(let [got-expected-exception (atom false)]
(try+
(bootstrap-with-empty-config ["--bootstrap-config" nil])
(catch map? m
(is (contains? m :kind))
(is (= :cli-error (without-ns (:kind m))))
(is (= :puppetlabs.kitchensink.core/cli-error (:kind m)))
(is (contains? m :msg))
(is (re-find
#"Missing required argument for.*--bootstrap-config"
(m :msg)))
(reset! got-expected-exception true)))
(is (true? @got-expected-exception))))
(testing "Bad line in bootstrap config file"
(let [bootstrap-config "./dev-resources/bootstrapping/cli/invalid_entry_bootstrap.cfg"]
(is (thrown-with-msg?
IllegalArgumentException
#"(?is)Invalid line in bootstrap.*This is not a legit line"
(parse-and-bootstrap bootstrap-config)))))
(testing "Invalid service graph"
(let [bootstrap-config "./dev-resources/bootstrapping/cli/invalid_service_graph_bootstrap.cfg"]
(is (thrown-with-msg?
IllegalArgumentException
#"Invalid service definition;"
(parse-and-bootstrap bootstrap-config)))))))
(testing "comments allowed in bootstrap config file"
(let [bootstrap-config "./dev-resources/bootstrapping/cli/bootstrap_with_comments.cfg"
service-maps (->> bootstrap-config
parse-bootstrap-config!
(map service-map))]
(is (= (count service-maps) 2))
(is (contains? (first service-maps) :HelloWorldService))
(is (contains? (second service-maps) :TestService)))))
(deftest empty-bootstrap
(testing "Empty bootstrap causes error"
(testing "single bootstrap file"
(let [bootstrap-config "./dev-resources/bootstrapping/cli/empty_bootstrap.cfg"]
(is (thrown-with-msg?
Exception
(re-pattern (str "No entries found in any supplied bootstrap file\\(s\\):\n"
"./dev-resources/bootstrapping/cli/empty_bootstrap.cfg"))
(parse-bootstrap-config! bootstrap-config)))))
(testing "multiple bootstrap files"
(let [bootstraps ["./dev-resources/bootstrapping/cli/split_bootstraps/empty/empty1.cfg"
"./dev-resources/bootstrapping/cli/split_bootstraps/empty/empty2.cfg"]]
(is (thrown-with-msg?
Exception
(re-pattern (str "No entries found in any supplied bootstrap file\\(s\\):\n"
(string/join "\n" bootstraps)))
(parse-bootstrap-configs! bootstraps)))))))
(deftest multiple-bootstrap-files
(testing "Multiple bootstrap files can be specified directly on the command line"
(with-test-logging
(let [bootstrap-one "./dev-resources/bootstrapping/cli/split_bootstraps/one/bootstrap_one.cfg"
bootstrap-two "./dev-resources/bootstrapping/cli/split_bootstraps/two/bootstrap_two.cfg"
bootstrap-path (format "%s,%s" bootstrap-one bootstrap-two)
app (bootstrap-with-empty-config ["--bootstrap-config" bootstrap-path])
test-svc (get-service app :TestService)
test-svc-two (get-service app :TestServiceTwo)
test-svc-three (get-service app :TestServiceThree)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
(format "Loading bootstrap configs:\n%s\n%s"
bootstrap-one
bootstrap-two)
:debug))
(is (= (test-fn test-svc) :cli))
(is (= (test-fn-two test-svc-two) :two))
(is (= (test-fn-three test-svc-three) :three))
(is (= (hello-world hello-world-svc) "hello world")))))
(testing "A path containing multiple .cfg files can be specified on the command line"
(with-test-logging
(let [bootstrap-path "./dev-resources/bootstrapping/cli/split_bootstraps/both/"
app (bootstrap-with-empty-config ["--bootstrap-config" bootstrap-path])
test-svc (get-service app :TestService)
test-svc-two (get-service app :TestServiceTwo)
test-svc-three (get-service app :TestServiceThree)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
; We can't know what order it will find the files on disk, so just
look for a partial match with the path we gave TK .
(re-pattern (format "Loading bootstrap configs:\n%s"
(fs/absolute bootstrap-path)))
:debug))
(is (= (test-fn test-svc) :cli))
(is (= (test-fn-two test-svc-two) :two))
(is (= (test-fn-three test-svc-three) :three))
(is (= (hello-world hello-world-svc) "hello world")))))
(testing "A path containing both a file and a folder can be specified on the command line"
(with-test-logging
(let [bootstrap-one-dir "./dev-resources/bootstrapping/cli/split_bootstraps/one/"
bootstrap-one "./dev-resources/bootstrapping/cli/split_bootstraps/one/bootstrap_one.cfg"
bootstrap-two "./dev-resources/bootstrapping/cli/split_bootstraps/two/bootstrap_two.cfg"
bootstrap-path (format "%s,%s" bootstrap-one-dir bootstrap-two)
app (bootstrap-with-empty-config ["--bootstrap-config" bootstrap-path])
test-svc (get-service app :TestService)
test-svc-two (get-service app :TestServiceTwo)
test-svc-three (get-service app :TestServiceThree)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
(format "Loading bootstrap configs:\n%s\n%s"
(fs/absolute bootstrap-one)
bootstrap-two)
:debug))
(is (= (test-fn test-svc) :cli))
(is (= (test-fn-two test-svc-two) :two))
(is (= (test-fn-three test-svc-three) :three))
(is (= (hello-world hello-world-svc) "hello world"))))))
(deftest bootstrap-path-with-spaces
(testing "Ensure that a bootstrap config can be loaded with a path that contains spaces"
(with-test-logging
(let [bootstrap-path "./dev-resources/bootstrapping/cli/path with spaces/bootstrap.cfg"
app (bootstrap-with-empty-config
["--bootstrap-config" bootstrap-path])
test-svc (get-service app :TestService)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
(format "Loading bootstrap configs:\n%s" bootstrap-path)
:debug))
(is (= (test-fn test-svc) :cli))
(is (= (hello-world hello-world-svc) "hello world")))))
(testing "Multiple bootstrap files can be specified with spaces in the names"
(with-test-logging
(let [bootstrap-one "./dev-resources/bootstrapping/cli/split_bootstraps/spaces/bootstrap with spaces one.cfg"
bootstrap-two "./dev-resources/bootstrapping/cli/split_bootstraps/spaces/bootstrap with spaces two.cfg"
bootstrap-path (format "%s,%s" bootstrap-one bootstrap-two)
app (bootstrap-with-empty-config ["--bootstrap-config" bootstrap-path])
test-svc (get-service app :TestService)
test-svc-two (get-service app :TestServiceTwo)
test-svc-three (get-service app :TestServiceThree)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
(format "Loading bootstrap configs:\n%s\n%s"
bootstrap-one
bootstrap-two)
:debug))
(is (= (test-fn test-svc) :cli))
(is (= (test-fn-two test-svc-two) :two))
(is (= (test-fn-three test-svc-three) :three))
(is (= (hello-world hello-world-svc) "hello world"))))))
(deftest duplicate-service-entries
(testing "duplicate bootstrap entries are allowed"
(let [bootstrap-path "./dev-resources/bootstrapping/cli/duplicate_entries.cfg"
app (bootstrap-with-empty-config
["--bootstrap-config" bootstrap-path])
hello-world-svc (get-service app :HelloWorldService)]
(is (= (hello-world hello-world-svc) "hello world")))))
(deftest duplicate-service-definitions
(testing "Duplicate service definitions causes error with filename and line numbers"
(let [bootstraps ["./dev-resources/bootstrapping/cli/duplicate_services/duplicates.cfg"]]
(is (thrown-with-msg?
IllegalArgumentException
(re-pattern (str "Duplicate implementations found for service protocol ':TestService':\n"
".*/duplicates.cfg:2\n"
"puppetlabs.trapperkeeper.examples.bootstrapping.test-services/cli-test-service\n"
".*/duplicates.cfg:3\n"
"puppetlabs.trapperkeeper.examples.bootstrapping.test-services/foo-test-service\n"
"Duplicate implementations.*\n"
".*/duplicates.cfg:5\n"
".*test-service-two\n"
".*/duplicates.cfg:6\n"
".*test-service-two-duplicate"))
(parse-bootstrap-configs! bootstraps))))
(testing "Duplicate service definitions between two files throws error"
(let [bootstraps ["./dev-resources/bootstrapping/cli/duplicate_services/split_one.cfg"
"./dev-resources/bootstrapping/cli/duplicate_services/split_two.cfg"]]
(is (thrown-with-msg?
IllegalArgumentException
(re-pattern (str "Duplicate implementations found for service protocol ':TestService':\n"
".*/split_one.cfg:2\n"
"puppetlabs.trapperkeeper.examples.bootstrapping.test-services/foo-test-service\n"
".*/split_two.cfg:2\n"
"puppetlabs.trapperkeeper.examples.bootstrapping.test-services/cli-test-service\n"
"Duplicate implementations.*\n"
".*/split_one.cfg:4\n"
".*test-service-two-duplicate\n"
".*/split_two.cfg:4\n"
".*test-service-two"))
(parse-bootstrap-configs! bootstraps)))))))
(deftest config-file-in-jar
(testing "Bootstrapping via a config file contained in a .jar as command line option"
(let [jar (file "./dev-resources/bootstrapping/jar/this-jar-contains-a-bootstrap-config-file.jar")
bootstrap-url (str "jar:file:///" (.getAbsolutePath jar) "!/bootstrap.cfg")]
;; just test that this bootstrap config file can be read successfully
;; (ie, this does not throw an exception)
(bootstrap-with-empty-config ["--bootstrap-config" bootstrap-url]))))
(deftest config-from-classpath-test
(testing "can locate bootstrap file on the classpath"
(let [bootstrap-file "./dev-resources/bootstrapping/classpath/bootstrap.cfg"
bootstrap-uri (str "file:" (.getCanonicalPath (file bootstrap-file)))]
(with-additional-classpath-entries
["./dev-resources/bootstrapping/classpath/"]
(let [found-bootstraps (config-from-classpath)]
(is (= 1 (count found-bootstraps)))
(is (= bootstrap-uri (first found-bootstraps)))))))
(testing "can locate bootstrap file contained in a .jar on the classpath"
(let [jar "./dev-resources/bootstrapping/jar/this-jar-contains-a-bootstrap-config-file.jar"
jar-uri (str "file:" (.getAbsolutePath (file jar)))
expected-resource-uri (format "jar:%s!/bootstrap.cfg" jar-uri)]
(with-additional-classpath-entries
["./dev-resources/bootstrapping/jar/this-jar-contains-a-bootstrap-config-file.jar"]
(let [found-bootstraps (config-from-classpath)]
(is (= 1 (count found-bootstraps)))
(is (= expected-resource-uri (first found-bootstraps))))))))
(deftest parse-bootstrap-config-test
(testing "Missing service namespace logs warning"
(with-test-logging
(let [bootstrap-config "./dev-resources/bootstrapping/cli/fake_namespace_bootstrap.cfg"]
(parse-bootstrap-config! bootstrap-config)
(is (logged?
(str "Unable to load service 'non-existent-service/test-service' from "
"./dev-resources/bootstrapping/cli/fake_namespace_bootstrap.cfg:3")
:warn)))))
(testing "Missing service definition logs warning"
(with-test-logging
(let [bootstrap-config "./dev-resources/bootstrapping/cli/missing_definition_bootstrap.cfg"]
(parse-bootstrap-config! bootstrap-config)
(is (logged?
(str "Unable to load service "
"'puppetlabs.trapperkeeper.examples.bootstrapping.test-services/non-existent-service' "
"from ./dev-resources/bootstrapping/cli/missing_definition_bootstrap.cfg:3")
:warn)))))
(testing "errors are thrown with line number and file"
; Load a bootstrap with a bad service graph to generate an error
(let [bootstrap "./dev-resources/bootstrapping/cli/invalid_service_graph_bootstrap.cfg"]
(is (thrown-with-msg?
IllegalArgumentException
(re-pattern (str "Problem loading service "
"'puppetlabs.trapperkeeper.examples.bootstrapping.test-services/invalid-service-graph-service' "
"from ./dev-resources/bootstrapping/cli/invalid_service_graph_bootstrap.cfg:1:\n"
"Invalid service definition"))
(parse-bootstrap-config! bootstrap))))))
(deftest get-annotated-bootstrap-entries-test
(testing "file with comments"
(let [bootstraps ["./dev-resources/bootstrapping/cli/bootstrap_with_comments.cfg"]]
(let [entries (get-annotated-bootstrap-entries bootstraps)]
(is (= [{:bootstrap-file "./dev-resources/bootstrapping/cli/bootstrap_with_comments.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/hello-world-service"
:line-number 2}
{:bootstrap-file "./dev-resources/bootstrapping/cli/bootstrap_with_comments.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/foo-test-service"
:line-number 5}]
entries)))))
(testing "multiple bootstrap files"
(let [bootstraps ["./dev-resources/bootstrapping/cli/split_bootstraps/both/bootstrap_one.cfg"
"./dev-resources/bootstrapping/cli/split_bootstraps/both/bootstrap_two.cfg"]]
(let [entries (get-annotated-bootstrap-entries bootstraps)]
(is (= [{:bootstrap-file "./dev-resources/bootstrapping/cli/split_bootstraps/both/bootstrap_one.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/cli-test-service"
:line-number 1}
{:bootstrap-file "./dev-resources/bootstrapping/cli/split_bootstraps/both/bootstrap_one.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/hello-world-service"
:line-number 2}
{:bootstrap-file "./dev-resources/bootstrapping/cli/split_bootstraps/both/bootstrap_two.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/test-service-two"
:line-number 1}
{:bootstrap-file "./dev-resources/bootstrapping/cli/split_bootstraps/both/bootstrap_two.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/test-service-three"
:line-number 2}]
entries))))))
(deftest find-duplicates-test
(testing "correct duplicates found"
(let [items [{:important-key :one
:other-key 2}
{:important-key :one
:other-key 3}
{:important-key :two
:other-key 4}
{:important-key :three
:other-key 5}]]
; List of key value pairs
(is (= {:one [{:important-key :one
:other-key 2}
{:important-key :one
:other-key 3}]}
(find-duplicates items :important-key))))))
(deftest check-duplicate-service-implementations!-test
(testing "no duplicate service implementations does not throw error"
(let [configs ["./dev-resources/bootstrapping/cli/bootstrap.cfg"]
bootstrap-entries (get-annotated-bootstrap-entries configs)
resolved-services (resolve-services! bootstrap-entries)]
(check-duplicate-service-implementations! resolved-services bootstrap-entries)))
(testing "duplicate service implementations throws error"
(let [configs ["./dev-resources/bootstrapping/cli/duplicate_services/duplicates.cfg"]
bootstrap-entries (get-annotated-bootstrap-entries configs)
resolved-services (resolve-services! bootstrap-entries)]
(is (thrown-with-msg?
IllegalArgumentException
#"Duplicate implementations found for service protocol ':TestService'"
(check-duplicate-service-implementations!
resolved-services
bootstrap-entries))))))
(deftest remove-duplicate-entries-test
(testing "single bootstrap with all duplicates"
(testing "only the first duplicate found is kept"
(let [configs ["./dev-resources/bootstrapping/cli/duplicate_entries.cfg"]
bootstrap-entries (get-annotated-bootstrap-entries configs)]
(is (= [{:bootstrap-file "./dev-resources/bootstrapping/cli/duplicate_entries.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/hello-world-service"
:line-number 1}]
(remove-duplicate-entries bootstrap-entries))))))
(testing "two copies of the same set of services"
(let [configs ["./dev-resources/bootstrapping/cli/bootstrap.cfg"
"./dev-resources/bootstrapping/cli/bootstrap.cfg"]
bootstrap-entries (get-annotated-bootstrap-entries configs)]
(is (= [{:bootstrap-file "./dev-resources/bootstrapping/cli/bootstrap.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/cli-test-service"
:line-number 1}
{:bootstrap-file "./dev-resources/bootstrapping/cli/bootstrap.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/hello-world-service"
:line-number 2}]
(remove-duplicate-entries bootstrap-entries))))))
(deftest read-config-test
(testing "basic config"
(let [config "./dev-resources/bootstrapping/cli/bootstrap.cfg"]
(is (= ["puppetlabs.trapperkeeper.examples.bootstrapping.test-services/cli-test-service"
"puppetlabs.trapperkeeper.examples.bootstrapping.test-services/hello-world-service"]
(read-config config)))))
(testing "jar uri"
(let [jar "./dev-resources/bootstrapping/jar/this-jar-contains-a-bootstrap-config-file.jar"
config (str "jar:file:///" (.getAbsolutePath (file jar)) "!/bootstrap.cfg")]
; The bootstrap in the jar contains an empty line at the end
(is (= ["puppetlabs.trapperkeeper.examples.bootstrapping.test-services/hello-world-service"
""]
(read-config config)))))
(testing "malformed uri is wrapped in our exception"
(let [config "\n"]
(is (thrown-with-msg?
IllegalArgumentException
#"Specified bootstrap config file does not exist"
(read-config config)))))
(testing "Non-absolute uri is wrapped in our exception"
TODO This path is currently interpreted as a URI because TK checks
if it 's a file , and if not , attemps to load as a URI
(let [config "./not-a-file"]
(is (thrown-with-msg?
IllegalArgumentException
#"Specified bootstrap config file does not exist"
(println (read-config config))))))
(testing "Non-existent file in URI is wrapped in our exception"
(let [config "file-a-file"]
(is (thrown-with-msg?
IllegalArgumentException
#"Specified bootstrap config file does not exist"
(read-config config))))))
| null | https://raw.githubusercontent.com/puppetlabs/trapperkeeper/3e5e7e286287d75e7fdf7eb1dabb2fa534091329/test/puppetlabs/trapperkeeper/bootstrap_test.clj | clojure | This test used to set the user.dir property to the dev-resources dir above,
We can't know what order it will find the files on disk, so just
just test that this bootstrap config file can be read successfully
(ie, this does not throw an exception)
Load a bootstrap with a bad service graph to generate an error
List of key value pairs
The bootstrap in the jar contains an empty line at the end | (ns puppetlabs.trapperkeeper.bootstrap-test
(:import (java.io StringReader))
(:require [clojure.test :refer :all]
[clojure.java.io :refer [file] :as io]
[slingshot.slingshot :refer [try+]]
[puppetlabs.kitchensink.core :refer [without-ns]]
[puppetlabs.kitchensink.classpath :refer [with-additional-classpath-entries]]
[puppetlabs.trapperkeeper.services :refer [service-map]]
[puppetlabs.trapperkeeper.app :refer [get-service]]
[puppetlabs.trapperkeeper.bootstrap :refer :all]
[puppetlabs.trapperkeeper.logging :refer [reset-logging]]
[puppetlabs.trapperkeeper.testutils.logging :refer [with-test-logging]]
[puppetlabs.trapperkeeper.testutils.bootstrap :refer [bootstrap-with-empty-config parse-and-bootstrap]]
[puppetlabs.trapperkeeper.examples.bootstrapping.test-services :refer [test-fn test-fn-two test-fn-three hello-world]]
[schema.test :as schema-test]
[me.raynes.fs :as fs]
[clojure.string :as string]))
(use-fixtures
:once
schema-test/validate-schemas
Without this , " test " and : only invocations may fail .
(fn [f] (reset-logging) (f)))
(deftest bootstrapping
(testing "Valid bootstrap configurations"
(let [bootstrap-config "./dev-resources/bootstrapping/cli/bootstrap.cfg"
app (parse-and-bootstrap bootstrap-config)]
(testing "Can load a service based on a valid bootstrap config string"
(let [test-svc (get-service app :TestService)
hello-world-svc (get-service app :HelloWorldService)]
(is (= (test-fn test-svc) :cli))
(is (= (hello-world hello-world-svc) "hello world"))))
(with-additional-classpath-entries ["./dev-resources/bootstrapping/classpath"]
(testing "Looks for bootstrap config on classpath (dev-resources)"
(with-test-logging
(let [app (bootstrap-with-empty-config)
test-svc (get-service app :TestService)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
#"Loading bootstrap config from classpath: 'file:/.*dev-resources/bootstrapping/classpath/bootstrap.cfg'"
:debug))
(is (= (test-fn test-svc) :classpath))
(is (= (hello-world hello-world-svc) "hello world")))))
(testing "Gives precedence to bootstrap config in cwd"
(let [cwd-config (io/file (System/getProperty "user.dir") "bootstrap.cfg")
test-config (io/file "./dev-resources/bootstrapping/cwd/bootstrap.cfg")]
however in Java 11 it is illegal to set user.dir at runtime .
(is (not (.exists cwd-config))
"A bootstrap config file exists in the cwd, cannot reliably test cwd bootstrap loading!")
(try
(io/copy test-config cwd-config)
(with-test-logging
(let [app (bootstrap-with-empty-config)
test-svc (get-service app :TestService)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
#"Loading bootstrap config from current working directory: '.*/bootstrap.cfg'"
:debug))
(is (= (test-fn test-svc) :cwd))
(is (= (hello-world hello-world-svc) "hello world"))))
(finally (io/delete-file cwd-config)))))
(testing "Gives precedence to bootstrap config specified as CLI arg"
(with-test-logging
(let [bootstrap-path "./dev-resources/bootstrapping/cli/bootstrap.cfg"
app (bootstrap-with-empty-config ["--bootstrap-config" bootstrap-path])
test-svc (get-service app :TestService)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
(format "Loading bootstrap configs:\n%s" bootstrap-path)
:debug))
(is (= (test-fn test-svc) :cli))
(is (= (hello-world hello-world-svc) "hello world")))))))
(testing "Invalid bootstrap configurations"
(testing "Bootstrap config path specified on CLI does not exist"
(let [cfg-path "./dev-resources/bootstrapping/cli/non-existent-bootstrap.cfg"]
(is (thrown-with-msg?
IllegalArgumentException
#"Specified bootstrap config file does not exist: '.*non-existent-bootstrap.cfg'"
(bootstrap-with-empty-config ["--bootstrap-config" cfg-path])))))
(testing "No bootstrap config found"
(is (thrown-with-msg?
IllegalStateException
#"Unable to find bootstrap.cfg file via --bootstrap-config command line argument, current working directory, or on classpath"
(bootstrap-with-empty-config)))
(let [got-expected-exception (atom false)]
(try+
(bootstrap-with-empty-config ["--bootstrap-config" nil])
(catch map? m
(is (contains? m :kind))
(is (= :cli-error (without-ns (:kind m))))
(is (= :puppetlabs.kitchensink.core/cli-error (:kind m)))
(is (contains? m :msg))
(is (re-find
#"Missing required argument for.*--bootstrap-config"
(m :msg)))
(reset! got-expected-exception true)))
(is (true? @got-expected-exception))))
(testing "Bad line in bootstrap config file"
(let [bootstrap-config "./dev-resources/bootstrapping/cli/invalid_entry_bootstrap.cfg"]
(is (thrown-with-msg?
IllegalArgumentException
#"(?is)Invalid line in bootstrap.*This is not a legit line"
(parse-and-bootstrap bootstrap-config)))))
(testing "Invalid service graph"
(let [bootstrap-config "./dev-resources/bootstrapping/cli/invalid_service_graph_bootstrap.cfg"]
(is (thrown-with-msg?
IllegalArgumentException
#"Invalid service definition;"
(parse-and-bootstrap bootstrap-config)))))))
(testing "comments allowed in bootstrap config file"
(let [bootstrap-config "./dev-resources/bootstrapping/cli/bootstrap_with_comments.cfg"
service-maps (->> bootstrap-config
parse-bootstrap-config!
(map service-map))]
(is (= (count service-maps) 2))
(is (contains? (first service-maps) :HelloWorldService))
(is (contains? (second service-maps) :TestService)))))
(deftest empty-bootstrap
(testing "Empty bootstrap causes error"
(testing "single bootstrap file"
(let [bootstrap-config "./dev-resources/bootstrapping/cli/empty_bootstrap.cfg"]
(is (thrown-with-msg?
Exception
(re-pattern (str "No entries found in any supplied bootstrap file\\(s\\):\n"
"./dev-resources/bootstrapping/cli/empty_bootstrap.cfg"))
(parse-bootstrap-config! bootstrap-config)))))
(testing "multiple bootstrap files"
(let [bootstraps ["./dev-resources/bootstrapping/cli/split_bootstraps/empty/empty1.cfg"
"./dev-resources/bootstrapping/cli/split_bootstraps/empty/empty2.cfg"]]
(is (thrown-with-msg?
Exception
(re-pattern (str "No entries found in any supplied bootstrap file\\(s\\):\n"
(string/join "\n" bootstraps)))
(parse-bootstrap-configs! bootstraps)))))))
(deftest multiple-bootstrap-files
(testing "Multiple bootstrap files can be specified directly on the command line"
(with-test-logging
(let [bootstrap-one "./dev-resources/bootstrapping/cli/split_bootstraps/one/bootstrap_one.cfg"
bootstrap-two "./dev-resources/bootstrapping/cli/split_bootstraps/two/bootstrap_two.cfg"
bootstrap-path (format "%s,%s" bootstrap-one bootstrap-two)
app (bootstrap-with-empty-config ["--bootstrap-config" bootstrap-path])
test-svc (get-service app :TestService)
test-svc-two (get-service app :TestServiceTwo)
test-svc-three (get-service app :TestServiceThree)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
(format "Loading bootstrap configs:\n%s\n%s"
bootstrap-one
bootstrap-two)
:debug))
(is (= (test-fn test-svc) :cli))
(is (= (test-fn-two test-svc-two) :two))
(is (= (test-fn-three test-svc-three) :three))
(is (= (hello-world hello-world-svc) "hello world")))))
(testing "A path containing multiple .cfg files can be specified on the command line"
(with-test-logging
(let [bootstrap-path "./dev-resources/bootstrapping/cli/split_bootstraps/both/"
app (bootstrap-with-empty-config ["--bootstrap-config" bootstrap-path])
test-svc (get-service app :TestService)
test-svc-two (get-service app :TestServiceTwo)
test-svc-three (get-service app :TestServiceThree)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
look for a partial match with the path we gave TK .
(re-pattern (format "Loading bootstrap configs:\n%s"
(fs/absolute bootstrap-path)))
:debug))
(is (= (test-fn test-svc) :cli))
(is (= (test-fn-two test-svc-two) :two))
(is (= (test-fn-three test-svc-three) :three))
(is (= (hello-world hello-world-svc) "hello world")))))
(testing "A path containing both a file and a folder can be specified on the command line"
(with-test-logging
(let [bootstrap-one-dir "./dev-resources/bootstrapping/cli/split_bootstraps/one/"
bootstrap-one "./dev-resources/bootstrapping/cli/split_bootstraps/one/bootstrap_one.cfg"
bootstrap-two "./dev-resources/bootstrapping/cli/split_bootstraps/two/bootstrap_two.cfg"
bootstrap-path (format "%s,%s" bootstrap-one-dir bootstrap-two)
app (bootstrap-with-empty-config ["--bootstrap-config" bootstrap-path])
test-svc (get-service app :TestService)
test-svc-two (get-service app :TestServiceTwo)
test-svc-three (get-service app :TestServiceThree)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
(format "Loading bootstrap configs:\n%s\n%s"
(fs/absolute bootstrap-one)
bootstrap-two)
:debug))
(is (= (test-fn test-svc) :cli))
(is (= (test-fn-two test-svc-two) :two))
(is (= (test-fn-three test-svc-three) :three))
(is (= (hello-world hello-world-svc) "hello world"))))))
(deftest bootstrap-path-with-spaces
(testing "Ensure that a bootstrap config can be loaded with a path that contains spaces"
(with-test-logging
(let [bootstrap-path "./dev-resources/bootstrapping/cli/path with spaces/bootstrap.cfg"
app (bootstrap-with-empty-config
["--bootstrap-config" bootstrap-path])
test-svc (get-service app :TestService)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
(format "Loading bootstrap configs:\n%s" bootstrap-path)
:debug))
(is (= (test-fn test-svc) :cli))
(is (= (hello-world hello-world-svc) "hello world")))))
(testing "Multiple bootstrap files can be specified with spaces in the names"
(with-test-logging
(let [bootstrap-one "./dev-resources/bootstrapping/cli/split_bootstraps/spaces/bootstrap with spaces one.cfg"
bootstrap-two "./dev-resources/bootstrapping/cli/split_bootstraps/spaces/bootstrap with spaces two.cfg"
bootstrap-path (format "%s,%s" bootstrap-one bootstrap-two)
app (bootstrap-with-empty-config ["--bootstrap-config" bootstrap-path])
test-svc (get-service app :TestService)
test-svc-two (get-service app :TestServiceTwo)
test-svc-three (get-service app :TestServiceThree)
hello-world-svc (get-service app :HelloWorldService)]
(is (logged?
(format "Loading bootstrap configs:\n%s\n%s"
bootstrap-one
bootstrap-two)
:debug))
(is (= (test-fn test-svc) :cli))
(is (= (test-fn-two test-svc-two) :two))
(is (= (test-fn-three test-svc-three) :three))
(is (= (hello-world hello-world-svc) "hello world"))))))
(deftest duplicate-service-entries
(testing "duplicate bootstrap entries are allowed"
(let [bootstrap-path "./dev-resources/bootstrapping/cli/duplicate_entries.cfg"
app (bootstrap-with-empty-config
["--bootstrap-config" bootstrap-path])
hello-world-svc (get-service app :HelloWorldService)]
(is (= (hello-world hello-world-svc) "hello world")))))
(deftest duplicate-service-definitions
(testing "Duplicate service definitions causes error with filename and line numbers"
(let [bootstraps ["./dev-resources/bootstrapping/cli/duplicate_services/duplicates.cfg"]]
(is (thrown-with-msg?
IllegalArgumentException
(re-pattern (str "Duplicate implementations found for service protocol ':TestService':\n"
".*/duplicates.cfg:2\n"
"puppetlabs.trapperkeeper.examples.bootstrapping.test-services/cli-test-service\n"
".*/duplicates.cfg:3\n"
"puppetlabs.trapperkeeper.examples.bootstrapping.test-services/foo-test-service\n"
"Duplicate implementations.*\n"
".*/duplicates.cfg:5\n"
".*test-service-two\n"
".*/duplicates.cfg:6\n"
".*test-service-two-duplicate"))
(parse-bootstrap-configs! bootstraps))))
(testing "Duplicate service definitions between two files throws error"
(let [bootstraps ["./dev-resources/bootstrapping/cli/duplicate_services/split_one.cfg"
"./dev-resources/bootstrapping/cli/duplicate_services/split_two.cfg"]]
(is (thrown-with-msg?
IllegalArgumentException
(re-pattern (str "Duplicate implementations found for service protocol ':TestService':\n"
".*/split_one.cfg:2\n"
"puppetlabs.trapperkeeper.examples.bootstrapping.test-services/foo-test-service\n"
".*/split_two.cfg:2\n"
"puppetlabs.trapperkeeper.examples.bootstrapping.test-services/cli-test-service\n"
"Duplicate implementations.*\n"
".*/split_one.cfg:4\n"
".*test-service-two-duplicate\n"
".*/split_two.cfg:4\n"
".*test-service-two"))
(parse-bootstrap-configs! bootstraps)))))))
(deftest config-file-in-jar
(testing "Bootstrapping via a config file contained in a .jar as command line option"
(let [jar (file "./dev-resources/bootstrapping/jar/this-jar-contains-a-bootstrap-config-file.jar")
bootstrap-url (str "jar:file:///" (.getAbsolutePath jar) "!/bootstrap.cfg")]
(bootstrap-with-empty-config ["--bootstrap-config" bootstrap-url]))))
(deftest config-from-classpath-test
(testing "can locate bootstrap file on the classpath"
(let [bootstrap-file "./dev-resources/bootstrapping/classpath/bootstrap.cfg"
bootstrap-uri (str "file:" (.getCanonicalPath (file bootstrap-file)))]
(with-additional-classpath-entries
["./dev-resources/bootstrapping/classpath/"]
(let [found-bootstraps (config-from-classpath)]
(is (= 1 (count found-bootstraps)))
(is (= bootstrap-uri (first found-bootstraps)))))))
(testing "can locate bootstrap file contained in a .jar on the classpath"
(let [jar "./dev-resources/bootstrapping/jar/this-jar-contains-a-bootstrap-config-file.jar"
jar-uri (str "file:" (.getAbsolutePath (file jar)))
expected-resource-uri (format "jar:%s!/bootstrap.cfg" jar-uri)]
(with-additional-classpath-entries
["./dev-resources/bootstrapping/jar/this-jar-contains-a-bootstrap-config-file.jar"]
(let [found-bootstraps (config-from-classpath)]
(is (= 1 (count found-bootstraps)))
(is (= expected-resource-uri (first found-bootstraps))))))))
(deftest parse-bootstrap-config-test
(testing "Missing service namespace logs warning"
(with-test-logging
(let [bootstrap-config "./dev-resources/bootstrapping/cli/fake_namespace_bootstrap.cfg"]
(parse-bootstrap-config! bootstrap-config)
(is (logged?
(str "Unable to load service 'non-existent-service/test-service' from "
"./dev-resources/bootstrapping/cli/fake_namespace_bootstrap.cfg:3")
:warn)))))
(testing "Missing service definition logs warning"
(with-test-logging
(let [bootstrap-config "./dev-resources/bootstrapping/cli/missing_definition_bootstrap.cfg"]
(parse-bootstrap-config! bootstrap-config)
(is (logged?
(str "Unable to load service "
"'puppetlabs.trapperkeeper.examples.bootstrapping.test-services/non-existent-service' "
"from ./dev-resources/bootstrapping/cli/missing_definition_bootstrap.cfg:3")
:warn)))))
(testing "errors are thrown with line number and file"
(let [bootstrap "./dev-resources/bootstrapping/cli/invalid_service_graph_bootstrap.cfg"]
(is (thrown-with-msg?
IllegalArgumentException
(re-pattern (str "Problem loading service "
"'puppetlabs.trapperkeeper.examples.bootstrapping.test-services/invalid-service-graph-service' "
"from ./dev-resources/bootstrapping/cli/invalid_service_graph_bootstrap.cfg:1:\n"
"Invalid service definition"))
(parse-bootstrap-config! bootstrap))))))
(deftest get-annotated-bootstrap-entries-test
(testing "file with comments"
(let [bootstraps ["./dev-resources/bootstrapping/cli/bootstrap_with_comments.cfg"]]
(let [entries (get-annotated-bootstrap-entries bootstraps)]
(is (= [{:bootstrap-file "./dev-resources/bootstrapping/cli/bootstrap_with_comments.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/hello-world-service"
:line-number 2}
{:bootstrap-file "./dev-resources/bootstrapping/cli/bootstrap_with_comments.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/foo-test-service"
:line-number 5}]
entries)))))
(testing "multiple bootstrap files"
(let [bootstraps ["./dev-resources/bootstrapping/cli/split_bootstraps/both/bootstrap_one.cfg"
"./dev-resources/bootstrapping/cli/split_bootstraps/both/bootstrap_two.cfg"]]
(let [entries (get-annotated-bootstrap-entries bootstraps)]
(is (= [{:bootstrap-file "./dev-resources/bootstrapping/cli/split_bootstraps/both/bootstrap_one.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/cli-test-service"
:line-number 1}
{:bootstrap-file "./dev-resources/bootstrapping/cli/split_bootstraps/both/bootstrap_one.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/hello-world-service"
:line-number 2}
{:bootstrap-file "./dev-resources/bootstrapping/cli/split_bootstraps/both/bootstrap_two.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/test-service-two"
:line-number 1}
{:bootstrap-file "./dev-resources/bootstrapping/cli/split_bootstraps/both/bootstrap_two.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/test-service-three"
:line-number 2}]
entries))))))
(deftest find-duplicates-test
(testing "correct duplicates found"
(let [items [{:important-key :one
:other-key 2}
{:important-key :one
:other-key 3}
{:important-key :two
:other-key 4}
{:important-key :three
:other-key 5}]]
(is (= {:one [{:important-key :one
:other-key 2}
{:important-key :one
:other-key 3}]}
(find-duplicates items :important-key))))))
(deftest check-duplicate-service-implementations!-test
(testing "no duplicate service implementations does not throw error"
(let [configs ["./dev-resources/bootstrapping/cli/bootstrap.cfg"]
bootstrap-entries (get-annotated-bootstrap-entries configs)
resolved-services (resolve-services! bootstrap-entries)]
(check-duplicate-service-implementations! resolved-services bootstrap-entries)))
(testing "duplicate service implementations throws error"
(let [configs ["./dev-resources/bootstrapping/cli/duplicate_services/duplicates.cfg"]
bootstrap-entries (get-annotated-bootstrap-entries configs)
resolved-services (resolve-services! bootstrap-entries)]
(is (thrown-with-msg?
IllegalArgumentException
#"Duplicate implementations found for service protocol ':TestService'"
(check-duplicate-service-implementations!
resolved-services
bootstrap-entries))))))
(deftest remove-duplicate-entries-test
(testing "single bootstrap with all duplicates"
(testing "only the first duplicate found is kept"
(let [configs ["./dev-resources/bootstrapping/cli/duplicate_entries.cfg"]
bootstrap-entries (get-annotated-bootstrap-entries configs)]
(is (= [{:bootstrap-file "./dev-resources/bootstrapping/cli/duplicate_entries.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/hello-world-service"
:line-number 1}]
(remove-duplicate-entries bootstrap-entries))))))
(testing "two copies of the same set of services"
(let [configs ["./dev-resources/bootstrapping/cli/bootstrap.cfg"
"./dev-resources/bootstrapping/cli/bootstrap.cfg"]
bootstrap-entries (get-annotated-bootstrap-entries configs)]
(is (= [{:bootstrap-file "./dev-resources/bootstrapping/cli/bootstrap.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/cli-test-service"
:line-number 1}
{:bootstrap-file "./dev-resources/bootstrapping/cli/bootstrap.cfg"
:entry "puppetlabs.trapperkeeper.examples.bootstrapping.test-services/hello-world-service"
:line-number 2}]
(remove-duplicate-entries bootstrap-entries))))))
(deftest read-config-test
(testing "basic config"
(let [config "./dev-resources/bootstrapping/cli/bootstrap.cfg"]
(is (= ["puppetlabs.trapperkeeper.examples.bootstrapping.test-services/cli-test-service"
"puppetlabs.trapperkeeper.examples.bootstrapping.test-services/hello-world-service"]
(read-config config)))))
(testing "jar uri"
(let [jar "./dev-resources/bootstrapping/jar/this-jar-contains-a-bootstrap-config-file.jar"
config (str "jar:file:///" (.getAbsolutePath (file jar)) "!/bootstrap.cfg")]
(is (= ["puppetlabs.trapperkeeper.examples.bootstrapping.test-services/hello-world-service"
""]
(read-config config)))))
(testing "malformed uri is wrapped in our exception"
(let [config "\n"]
(is (thrown-with-msg?
IllegalArgumentException
#"Specified bootstrap config file does not exist"
(read-config config)))))
(testing "Non-absolute uri is wrapped in our exception"
TODO This path is currently interpreted as a URI because TK checks
if it 's a file , and if not , attemps to load as a URI
(let [config "./not-a-file"]
(is (thrown-with-msg?
IllegalArgumentException
#"Specified bootstrap config file does not exist"
(println (read-config config))))))
(testing "Non-existent file in URI is wrapped in our exception"
(let [config "file-a-file"]
(is (thrown-with-msg?
IllegalArgumentException
#"Specified bootstrap config file does not exist"
(read-config config))))))
|
490f67b805d092f8eb8539f8461d6c8cd750cb4137767e800d85c76254088e24 | fpco/ide-backend | SrcDist.hs | -----------------------------------------------------------------------------
-- |
-- Module : Distribution.Simple.SrcDist
Copyright : 2004
--
-- Maintainer :
-- Portability : portable
--
-- This handles the @sdist@ command. The module exports an 'sdist' action but
-- also some of the phases that make it up so that other tools can use just the
-- bits they need. In particular the preparation of the tree of files to go
-- into the source tarball is separated from actually building the source
-- tarball.
--
The ' createArchive ' action uses the external @tar@ program and assumes that
it accepts the @-z@ flag . Neither of these assumptions are valid on Windows .
-- The 'sdist' action now also does some distribution QA checks.
Copyright ( c ) 2003 - 2004 ,
All rights reserved .
Redistribution and use in source and binary forms , with or without
modification , are permitted provided that the following conditions are
met :
* Redistributions of source code must retain the above copyright
notice , this list of conditions and the following disclaimer .
* Redistributions in binary form must reproduce the above
copyright notice , this list of conditions and the following
disclaimer in the documentation and/or other materials provided
with the distribution .
* Neither the name of nor the names of other
contributors may be used to endorse or promote products derived
from this software without specific prior written permission .
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
" AS IS " AND ANY EXPRESS OR IMPLIED WARRANTIES , INCLUDING , BUT NOT
LIMITED TO , THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
A PARTICULAR PURPOSE ARE DISCLAIMED . IN NO EVENT SHALL THE COPYRIGHT
OWNER OR ANY DIRECT , INDIRECT , INCIDENTAL ,
SPECIAL , EXEMPLARY , OR CONSEQUENTIAL DAMAGES ( INCLUDING , BUT NOT
LIMITED TO , PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES ; LOSS OF USE ,
DATA , OR PROFITS ; OR BUSINESS INTERRUPTION ) HOWEVER CAUSED AND ON ANY
THEORY OF LIABILITY , WHETHER IN CONTRACT , STRICT LIABILITY , OR TORT
( INCLUDING NEGLIGENCE OR OTHERWISE ) ARISING IN ANY WAY OUT OF THE USE
OF THIS SOFTWARE , EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE .
All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions are
met:
* Redistributions of source code must retain the above copyright
notice, this list of conditions and the following disclaimer.
* Redistributions in binary form must reproduce the above
copyright notice, this list of conditions and the following
disclaimer in the documentation and/or other materials provided
with the distribution.
* Neither the name of Isaac Jones nor the names of other
contributors may be used to endorse or promote products derived
from this software without specific prior written permission.
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
"AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT
OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL,
SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT
LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE,
DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY
THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
(INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. -}
-- NOTE: FIX: we don't have a great way of testing this module, since
-- we can't easily look inside a tarball once its created.
module Distribution.Simple.SrcDist (
-- * The top level action
sdist,
-- ** Parts of 'sdist'
printPackageProblems,
prepareTree,
createArchive,
-- ** Snaphots
prepareSnapshotTree,
snapshotPackage,
snapshotVersion,
dateToSnapshotNumber,
) where
import Distribution.PackageDescription
( PackageDescription(..), BuildInfo(..), Executable(..), Library(..)
, TestSuite(..), TestSuiteInterface(..), Benchmark(..)
, BenchmarkInterface(..) )
import Distribution.PackageDescription.Check
( PackageCheck(..), checkConfiguredPackage, checkPackageFiles )
import Distribution.Package
( PackageIdentifier(pkgVersion), Package(..), packageVersion )
import Distribution.ModuleName (ModuleName)
import qualified Distribution.ModuleName as ModuleName
import Distribution.Version
( Version(versionBranch) )
import Distribution.Simple.Utils
( createDirectoryIfMissingVerbose, withUTF8FileContents, writeUTF8File
, installOrdinaryFile, installOrdinaryFiles, setFileExecutable
, findFile, findFileWithExtension, matchFileGlob
, withTempDirectory, defaultPackageDesc
, die, warn, notice, setupMessage )
import Distribution.Simple.Setup (SDistFlags(..), fromFlag, flagToMaybe)
import Distribution.Simple.PreProcess (PPSuffixHandler, ppSuffixes, preprocessComponent)
import Distribution.Simple.LocalBuildInfo ( LocalBuildInfo(..), withComponentsLBI )
import Distribution.Simple.BuildPaths ( autogenModuleName )
import Distribution.Simple.Program ( defaultProgramConfiguration, requireProgram,
rawSystemProgram, tarProgram )
import Distribution.Text
( display )
import Control.Monad(when, unless)
import Data.Char (toLower)
import Data.List (partition, isPrefixOf)
import Data.Maybe (isNothing, catMaybes)
import System.Time (getClockTime, toCalendarTime, CalendarTime(..))
import System.Directory
( doesFileExist, Permissions(executable), getPermissions )
import Distribution.Verbosity (Verbosity)
import System.FilePath
( (</>), (<.>), takeDirectory, dropExtension, isAbsolute )
-- |Create a source distribution.
sdist :: PackageDescription -- ^information from the tarball
-> Maybe LocalBuildInfo -- ^Information from configure
-> SDistFlags -- ^verbosity & snapshot
-> (FilePath -> FilePath) -- ^build prefix (temp dir)
-> [PPSuffixHandler] -- ^ extra preprocessors (includes suffixes)
-> IO ()
sdist pkg mb_lbi flags mkTmpDir pps = do
-- do some QA
printPackageProblems verbosity pkg
when (isNothing mb_lbi) $
warn verbosity "Cannot run preprocessors. Run 'configure' command first."
date <- toCalendarTime =<< getClockTime
let pkg' | snapshot = snapshotPackage date pkg
| otherwise = pkg
case flagToMaybe (sDistDirectory flags) of
Just targetDir -> do
generateSourceDir targetDir pkg'
notice verbosity $ "Source directory created: " ++ targetDir
Nothing -> do
createDirectoryIfMissingVerbose verbosity True tmpTargetDir
withTempDirectory verbosity tmpTargetDir "sdist." $ \tmpDir -> do
let targetDir = tmpDir </> tarBallName pkg'
generateSourceDir targetDir pkg'
targzFile <- createArchive verbosity pkg' mb_lbi tmpDir targetPref
notice verbosity $ "Source tarball created: " ++ targzFile
where
generateSourceDir targetDir pkg' = do
setupMessage verbosity "Building source dist for" (packageId pkg')
prepareTree verbosity pkg' mb_lbi distPref targetDir pps
when snapshot $
overwriteSnapshotPackageDesc verbosity pkg' targetDir
verbosity = fromFlag (sDistVerbosity flags)
snapshot = fromFlag (sDistSnapshot flags)
distPref = fromFlag $ sDistDistPref flags
targetPref = distPref
tmpTargetDir = mkTmpDir distPref
|Prepare a directory tree of source files .
prepareTree :: Verbosity -- ^verbosity
-> PackageDescription -- ^info from the cabal file
-> Maybe LocalBuildInfo
^dist
-> FilePath -- ^source tree to populate
^extra preprocessors ( includes suffixes )
-> IO ()
prepareTree verbosity pkg_descr0 mb_lbi distPref targetDir pps = do
createDirectoryIfMissingVerbose verbosity True targetDir
-- maybe move the library files into place
withLib $ \Library { exposedModules = modules, libBuildInfo = libBi } ->
prepareDir verbosity pkg_descr distPref targetDir pps modules libBi
-- move the executables into place
withExe $ \Executable { modulePath = mainPath, buildInfo = exeBi } -> do
prepareDir verbosity pkg_descr distPref targetDir pps [] exeBi
srcMainFile <- do
ppFile <- findFileWithExtension (ppSuffixes pps) (hsSourceDirs exeBi) (dropExtension mainPath)
case ppFile of
Nothing -> findFile (hsSourceDirs exeBi) mainPath
Just pp -> return pp
copyFileTo verbosity targetDir srcMainFile
-- move the test suites into place
withTest $ \t -> do
let bi = testBuildInfo t
prep = prepareDir verbosity pkg_descr distPref targetDir pps
case testInterface t of
TestSuiteExeV10 _ mainPath -> do
prep [] bi
srcMainFile <- do
ppFile <- findFileWithExtension (ppSuffixes pps)
(hsSourceDirs bi)
(dropExtension mainPath)
case ppFile of
Nothing -> findFile (hsSourceDirs bi) mainPath
Just pp -> return pp
copyFileTo verbosity targetDir srcMainFile
TestSuiteLibV09 _ m -> do
prep [m] bi
TestSuiteUnsupported tp -> die $ "Unsupported test suite type: " ++ show tp
-- move the benchmarks into place
withBenchmark $ \bm -> do
let bi = benchmarkBuildInfo bm
prep = prepareDir verbosity pkg_descr distPref targetDir pps
case benchmarkInterface bm of
BenchmarkExeV10 _ mainPath -> do
prep [] bi
srcMainFile <- do
ppFile <- findFileWithExtension (ppSuffixes pps)
(hsSourceDirs bi)
(dropExtension mainPath)
case ppFile of
Nothing -> findFile (hsSourceDirs bi) mainPath
Just pp -> return pp
copyFileTo verbosity targetDir srcMainFile
BenchmarkUnsupported tp -> die $ "Unsupported benchmark type: " ++ show tp
flip mapM_ (dataFiles pkg_descr) $ \ filename -> do
files <- matchFileGlob (dataDir pkg_descr </> filename)
let dir = takeDirectory (dataDir pkg_descr </> filename)
createDirectoryIfMissingVerbose verbosity True (targetDir </> dir)
sequence_ [ installOrdinaryFile verbosity file (targetDir </> file)
| file <- files ]
when (not (null (licenseFile pkg_descr))) $
copyFileTo verbosity targetDir (licenseFile pkg_descr)
flip mapM_ (extraSrcFiles pkg_descr) $ \ fpath -> do
files <- matchFileGlob fpath
sequence_
[ do copyFileTo verbosity targetDir file
-- preserve executable bit on extra-src-files like ./configure
perms <- getPermissions file
when (executable perms) --only checks user x bit
(setFileExecutable (targetDir </> file))
| file <- files ]
-- copy the install-include files
withLib $ \ l -> do
let lbi = libBuildInfo l
relincdirs = "." : filter (not.isAbsolute) (includeDirs lbi)
incs <- mapM (findInc relincdirs) (installIncludes lbi)
flip mapM_ incs $ \(_,fpath) ->
copyFileTo verbosity targetDir fpath
-- if the package was configured then we can run platform independent
-- pre-processors and include those generated files
case mb_lbi of
Just lbi | not (null pps) -> do
let lbi' = lbi{ buildDir = targetDir </> buildDir lbi }
withComponentsLBI pkg_descr lbi' $ \c _ ->
preprocessComponent pkg_descr c lbi' True verbosity pps
_ -> return ()
-- setup isn't listed in the description file.
hsExists <- doesFileExist "Setup.hs"
lhsExists <- doesFileExist "Setup.lhs"
if hsExists then copyFileTo verbosity targetDir "Setup.hs"
else if lhsExists then copyFileTo verbosity targetDir "Setup.lhs"
else writeUTF8File (targetDir </> "Setup.hs") $ unlines [
"import Distribution.Simple",
"main = defaultMain"]
-- the description file itself
descFile <- defaultPackageDesc verbosity
installOrdinaryFile verbosity descFile (targetDir </> descFile)
where
pkg_descr = mapAllBuildInfo filterAutogenModule pkg_descr0
filterAutogenModule bi = bi {
otherModules = filter (/=autogenModule) (otherModules bi)
}
autogenModule = autogenModuleName pkg_descr0
findInc [] f = die ("can't find include file " ++ f)
findInc (d:ds) f = do
let path = (d </> f)
b <- doesFileExist path
if b then return (f,path) else findInc ds f
We have to deal with all libs and executables , so we have local
-- versions of these functions that ignore the 'buildable' attribute:
withLib action = maybe (return ()) action (library pkg_descr)
withExe action = mapM_ action (executables pkg_descr)
withTest action = mapM_ action (testSuites pkg_descr)
withBenchmark action = mapM_ action (benchmarks pkg_descr)
-- | Prepare a directory tree of source files for a snapshot version.
-- It is expected that the appropriate snapshot version has already been set
in the package description , eg using ' snapshotPackage ' or ' snapshotVersion ' .
--
prepareSnapshotTree :: Verbosity -- ^verbosity
-> PackageDescription -- ^info from the cabal file
-> Maybe LocalBuildInfo
^dist
-> FilePath -- ^source tree to populate
^extra preprocessors ( includes suffixes )
-> IO ()
prepareSnapshotTree verbosity pkg mb_lbi distPref targetDir pps = do
prepareTree verbosity pkg mb_lbi distPref targetDir pps
overwriteSnapshotPackageDesc verbosity pkg targetDir
overwriteSnapshotPackageDesc :: Verbosity -- ^verbosity
-> PackageDescription -- ^info from the cabal file
-> FilePath -- ^source tree
-> IO ()
overwriteSnapshotPackageDesc verbosity pkg targetDir = do
-- We could just writePackageDescription targetDescFile pkg_descr,
-- but that would lose comments and formatting.
descFile <- defaultPackageDesc verbosity
withUTF8FileContents descFile $
writeUTF8File (targetDir </> descFile)
. unlines . map (replaceVersion (packageVersion pkg)) . lines
where
replaceVersion :: Version -> String -> String
replaceVersion version line
| "version:" `isPrefixOf` map toLower line
= "version: " ++ display version
| otherwise = line
| Modifies a ' PackageDescription ' by appending a snapshot number
-- corresponding to the given date.
--
snapshotPackage :: CalendarTime -> PackageDescription -> PackageDescription
snapshotPackage date pkg =
pkg {
package = pkgid { pkgVersion = snapshotVersion date (pkgVersion pkgid) }
}
where pkgid = packageId pkg
-- | Modifies a 'Version' by appending a snapshot number corresponding
-- to the given date.
--
snapshotVersion :: CalendarTime -> Version -> Version
snapshotVersion date version = version {
versionBranch = versionBranch version
++ [dateToSnapshotNumber date]
}
-- | Given a date produce a corresponding integer representation.
-- For example given a date @18/03/2008@ produce the number @20080318@.
--
dateToSnapshotNumber :: CalendarTime -> Int
dateToSnapshotNumber date = year * 10000
+ month * 100
+ day
where
year = ctYear date
month = fromEnum (ctMonth date) + 1
day = ctDay date
-- |Create an archive from a tree of source files, and clean up the tree.
createArchive :: Verbosity -- ^verbosity
^info from cabal file
-> Maybe LocalBuildInfo -- ^info from configure
-> FilePath -- ^source tree to archive
-> FilePath -- ^name of archive to create
-> IO FilePath
createArchive verbosity pkg_descr mb_lbi tmpDir targetPref = do
let tarBallFilePath = targetPref </> tarBallName pkg_descr <.> "tar.gz"
(tarProg, _) <- requireProgram verbosity tarProgram
(maybe defaultProgramConfiguration withPrograms mb_lbi)
-- Hmm: I could well be skating on thinner ice here by using the -C option (=> GNU tar-specific?)
-- [The prev. solution used pipes and sub-command sequences to set up the paths correctly,
-- which is problematic in a Windows setting.]
rawSystemProgram verbosity tarProg
["-C", tmpDir, "-czf", tarBallFilePath, tarBallName pkg_descr]
return tarBallFilePath
-- |Move the sources into place based on buildInfo
prepareDir :: Verbosity -- ^verbosity
-> PackageDescription -- ^info from the cabal file
^dist
-> FilePath -- ^TargetPrefix
-> [PPSuffixHandler] -- ^ extra preprocessors (includes suffixes)
-> [ModuleName] -- ^Exposed modules
-> BuildInfo
-> IO ()
prepareDir verbosity _pkg _distPref inPref pps modules bi
= do let searchDirs = hsSourceDirs bi
sources <- sequence
[ let file = ModuleName.toFilePath module_
in findFileWithExtension suffixes searchDirs file
>>= maybe (notFound module_) return
| module_ <- modules ++ otherModules bi ]
bootFiles <- sequence
[ let file = ModuleName.toFilePath module_
fileExts = ["hs-boot", "lhs-boot"]
in findFileWithExtension fileExts (hsSourceDirs bi) file
| module_ <- modules ++ otherModules bi ]
let allSources = sources ++ catMaybes bootFiles ++ cSources bi
installOrdinaryFiles verbosity inPref (zip (repeat []) allSources)
where suffixes = ppSuffixes pps ++ ["hs", "lhs"]
notFound m = die $ "Error: Could not find module: " ++ display m
++ " with any suffix: " ++ show suffixes
copyFileTo :: Verbosity -> FilePath -> FilePath -> IO ()
copyFileTo verbosity dir file = do
let targetFile = dir </> file
createDirectoryIfMissingVerbose verbosity True (takeDirectory targetFile)
installOrdinaryFile verbosity file targetFile
printPackageProblems :: Verbosity -> PackageDescription -> IO ()
printPackageProblems verbosity pkg_descr = do
ioChecks <- checkPackageFiles pkg_descr "."
let pureChecks = checkConfiguredPackage pkg_descr
isDistError (PackageDistSuspicious _) = False
isDistError _ = True
(errors, warnings) = partition isDistError (pureChecks ++ ioChecks)
unless (null errors) $
notice verbosity $ "Distribution quality errors:\n"
++ unlines (map explanation errors)
unless (null warnings) $
notice verbosity $ "Distribution quality warnings:\n"
++ unlines (map explanation warnings)
unless (null errors) $
notice verbosity
"Note: the public hackage server would reject this package."
------------------------------------------------------------
-- | The name of the tarball without extension
--
tarBallName :: PackageDescription -> String
tarBallName = display . packageId
mapAllBuildInfo :: (BuildInfo -> BuildInfo)
-> (PackageDescription -> PackageDescription)
mapAllBuildInfo f pkg = pkg {
library = fmap mapLibBi (library pkg),
executables = fmap mapExeBi (executables pkg),
testSuites = fmap mapTestBi (testSuites pkg),
benchmarks = fmap mapBenchBi (benchmarks pkg)
}
where
mapLibBi lib = lib { libBuildInfo = f (libBuildInfo lib) }
mapExeBi exe = exe { buildInfo = f (buildInfo exe) }
mapTestBi t = t { testBuildInfo = f (testBuildInfo t) }
mapBenchBi bm = bm { benchmarkBuildInfo = f (benchmarkBuildInfo bm) }
| null | https://raw.githubusercontent.com/fpco/ide-backend/860636f2d0e872e9481569236bce690637e0016e/ide-backend/TestSuite/inputs/Cabal-1.14.0/Distribution/Simple/SrcDist.hs | haskell | ---------------------------------------------------------------------------
|
Module : Distribution.Simple.SrcDist
Maintainer :
Portability : portable
This handles the @sdist@ command. The module exports an 'sdist' action but
also some of the phases that make it up so that other tools can use just the
bits they need. In particular the preparation of the tree of files to go
into the source tarball is separated from actually building the source
tarball.
The 'sdist' action now also does some distribution QA checks.
NOTE: FIX: we don't have a great way of testing this module, since
we can't easily look inside a tarball once its created.
* The top level action
** Parts of 'sdist'
** Snaphots
|Create a source distribution.
^information from the tarball
^Information from configure
^verbosity & snapshot
^build prefix (temp dir)
^ extra preprocessors (includes suffixes)
do some QA
^verbosity
^info from the cabal file
^source tree to populate
maybe move the library files into place
move the executables into place
move the test suites into place
move the benchmarks into place
preserve executable bit on extra-src-files like ./configure
only checks user x bit
copy the install-include files
if the package was configured then we can run platform independent
pre-processors and include those generated files
setup isn't listed in the description file.
the description file itself
versions of these functions that ignore the 'buildable' attribute:
| Prepare a directory tree of source files for a snapshot version.
It is expected that the appropriate snapshot version has already been set
^verbosity
^info from the cabal file
^source tree to populate
^verbosity
^info from the cabal file
^source tree
We could just writePackageDescription targetDescFile pkg_descr,
but that would lose comments and formatting.
corresponding to the given date.
| Modifies a 'Version' by appending a snapshot number corresponding
to the given date.
| Given a date produce a corresponding integer representation.
For example given a date @18/03/2008@ produce the number @20080318@.
|Create an archive from a tree of source files, and clean up the tree.
^verbosity
^info from configure
^source tree to archive
^name of archive to create
Hmm: I could well be skating on thinner ice here by using the -C option (=> GNU tar-specific?)
[The prev. solution used pipes and sub-command sequences to set up the paths correctly,
which is problematic in a Windows setting.]
|Move the sources into place based on buildInfo
^verbosity
^info from the cabal file
^TargetPrefix
^ extra preprocessors (includes suffixes)
^Exposed modules
----------------------------------------------------------
| The name of the tarball without extension
| Copyright : 2004
The ' createArchive ' action uses the external @tar@ program and assumes that
it accepts the @-z@ flag . Neither of these assumptions are valid on Windows .
Copyright ( c ) 2003 - 2004 ,
All rights reserved .
Redistribution and use in source and binary forms , with or without
modification , are permitted provided that the following conditions are
met :
* Redistributions of source code must retain the above copyright
notice , this list of conditions and the following disclaimer .
* Redistributions in binary form must reproduce the above
copyright notice , this list of conditions and the following
disclaimer in the documentation and/or other materials provided
with the distribution .
* Neither the name of nor the names of other
contributors may be used to endorse or promote products derived
from this software without specific prior written permission .
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
" AS IS " AND ANY EXPRESS OR IMPLIED WARRANTIES , INCLUDING , BUT NOT
LIMITED TO , THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
A PARTICULAR PURPOSE ARE DISCLAIMED . IN NO EVENT SHALL THE COPYRIGHT
OWNER OR ANY DIRECT , INDIRECT , INCIDENTAL ,
SPECIAL , EXEMPLARY , OR CONSEQUENTIAL DAMAGES ( INCLUDING , BUT NOT
LIMITED TO , PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES ; LOSS OF USE ,
DATA , OR PROFITS ; OR BUSINESS INTERRUPTION ) HOWEVER CAUSED AND ON ANY
THEORY OF LIABILITY , WHETHER IN CONTRACT , STRICT LIABILITY , OR TORT
( INCLUDING NEGLIGENCE OR OTHERWISE ) ARISING IN ANY WAY OUT OF THE USE
OF THIS SOFTWARE , EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE .
All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions are
met:
* Redistributions of source code must retain the above copyright
notice, this list of conditions and the following disclaimer.
* Redistributions in binary form must reproduce the above
copyright notice, this list of conditions and the following
disclaimer in the documentation and/or other materials provided
with the distribution.
* Neither the name of Isaac Jones nor the names of other
contributors may be used to endorse or promote products derived
from this software without specific prior written permission.
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
"AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT
OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL,
SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT
LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE,
DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY
THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
(INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. -}
module Distribution.Simple.SrcDist (
sdist,
printPackageProblems,
prepareTree,
createArchive,
prepareSnapshotTree,
snapshotPackage,
snapshotVersion,
dateToSnapshotNumber,
) where
import Distribution.PackageDescription
( PackageDescription(..), BuildInfo(..), Executable(..), Library(..)
, TestSuite(..), TestSuiteInterface(..), Benchmark(..)
, BenchmarkInterface(..) )
import Distribution.PackageDescription.Check
( PackageCheck(..), checkConfiguredPackage, checkPackageFiles )
import Distribution.Package
( PackageIdentifier(pkgVersion), Package(..), packageVersion )
import Distribution.ModuleName (ModuleName)
import qualified Distribution.ModuleName as ModuleName
import Distribution.Version
( Version(versionBranch) )
import Distribution.Simple.Utils
( createDirectoryIfMissingVerbose, withUTF8FileContents, writeUTF8File
, installOrdinaryFile, installOrdinaryFiles, setFileExecutable
, findFile, findFileWithExtension, matchFileGlob
, withTempDirectory, defaultPackageDesc
, die, warn, notice, setupMessage )
import Distribution.Simple.Setup (SDistFlags(..), fromFlag, flagToMaybe)
import Distribution.Simple.PreProcess (PPSuffixHandler, ppSuffixes, preprocessComponent)
import Distribution.Simple.LocalBuildInfo ( LocalBuildInfo(..), withComponentsLBI )
import Distribution.Simple.BuildPaths ( autogenModuleName )
import Distribution.Simple.Program ( defaultProgramConfiguration, requireProgram,
rawSystemProgram, tarProgram )
import Distribution.Text
( display )
import Control.Monad(when, unless)
import Data.Char (toLower)
import Data.List (partition, isPrefixOf)
import Data.Maybe (isNothing, catMaybes)
import System.Time (getClockTime, toCalendarTime, CalendarTime(..))
import System.Directory
( doesFileExist, Permissions(executable), getPermissions )
import Distribution.Verbosity (Verbosity)
import System.FilePath
( (</>), (<.>), takeDirectory, dropExtension, isAbsolute )
-> IO ()
sdist pkg mb_lbi flags mkTmpDir pps = do
printPackageProblems verbosity pkg
when (isNothing mb_lbi) $
warn verbosity "Cannot run preprocessors. Run 'configure' command first."
date <- toCalendarTime =<< getClockTime
let pkg' | snapshot = snapshotPackage date pkg
| otherwise = pkg
case flagToMaybe (sDistDirectory flags) of
Just targetDir -> do
generateSourceDir targetDir pkg'
notice verbosity $ "Source directory created: " ++ targetDir
Nothing -> do
createDirectoryIfMissingVerbose verbosity True tmpTargetDir
withTempDirectory verbosity tmpTargetDir "sdist." $ \tmpDir -> do
let targetDir = tmpDir </> tarBallName pkg'
generateSourceDir targetDir pkg'
targzFile <- createArchive verbosity pkg' mb_lbi tmpDir targetPref
notice verbosity $ "Source tarball created: " ++ targzFile
where
generateSourceDir targetDir pkg' = do
setupMessage verbosity "Building source dist for" (packageId pkg')
prepareTree verbosity pkg' mb_lbi distPref targetDir pps
when snapshot $
overwriteSnapshotPackageDesc verbosity pkg' targetDir
verbosity = fromFlag (sDistVerbosity flags)
snapshot = fromFlag (sDistSnapshot flags)
distPref = fromFlag $ sDistDistPref flags
targetPref = distPref
tmpTargetDir = mkTmpDir distPref
|Prepare a directory tree of source files .
-> Maybe LocalBuildInfo
^dist
^extra preprocessors ( includes suffixes )
-> IO ()
prepareTree verbosity pkg_descr0 mb_lbi distPref targetDir pps = do
createDirectoryIfMissingVerbose verbosity True targetDir
withLib $ \Library { exposedModules = modules, libBuildInfo = libBi } ->
prepareDir verbosity pkg_descr distPref targetDir pps modules libBi
withExe $ \Executable { modulePath = mainPath, buildInfo = exeBi } -> do
prepareDir verbosity pkg_descr distPref targetDir pps [] exeBi
srcMainFile <- do
ppFile <- findFileWithExtension (ppSuffixes pps) (hsSourceDirs exeBi) (dropExtension mainPath)
case ppFile of
Nothing -> findFile (hsSourceDirs exeBi) mainPath
Just pp -> return pp
copyFileTo verbosity targetDir srcMainFile
withTest $ \t -> do
let bi = testBuildInfo t
prep = prepareDir verbosity pkg_descr distPref targetDir pps
case testInterface t of
TestSuiteExeV10 _ mainPath -> do
prep [] bi
srcMainFile <- do
ppFile <- findFileWithExtension (ppSuffixes pps)
(hsSourceDirs bi)
(dropExtension mainPath)
case ppFile of
Nothing -> findFile (hsSourceDirs bi) mainPath
Just pp -> return pp
copyFileTo verbosity targetDir srcMainFile
TestSuiteLibV09 _ m -> do
prep [m] bi
TestSuiteUnsupported tp -> die $ "Unsupported test suite type: " ++ show tp
withBenchmark $ \bm -> do
let bi = benchmarkBuildInfo bm
prep = prepareDir verbosity pkg_descr distPref targetDir pps
case benchmarkInterface bm of
BenchmarkExeV10 _ mainPath -> do
prep [] bi
srcMainFile <- do
ppFile <- findFileWithExtension (ppSuffixes pps)
(hsSourceDirs bi)
(dropExtension mainPath)
case ppFile of
Nothing -> findFile (hsSourceDirs bi) mainPath
Just pp -> return pp
copyFileTo verbosity targetDir srcMainFile
BenchmarkUnsupported tp -> die $ "Unsupported benchmark type: " ++ show tp
flip mapM_ (dataFiles pkg_descr) $ \ filename -> do
files <- matchFileGlob (dataDir pkg_descr </> filename)
let dir = takeDirectory (dataDir pkg_descr </> filename)
createDirectoryIfMissingVerbose verbosity True (targetDir </> dir)
sequence_ [ installOrdinaryFile verbosity file (targetDir </> file)
| file <- files ]
when (not (null (licenseFile pkg_descr))) $
copyFileTo verbosity targetDir (licenseFile pkg_descr)
flip mapM_ (extraSrcFiles pkg_descr) $ \ fpath -> do
files <- matchFileGlob fpath
sequence_
[ do copyFileTo verbosity targetDir file
perms <- getPermissions file
(setFileExecutable (targetDir </> file))
| file <- files ]
withLib $ \ l -> do
let lbi = libBuildInfo l
relincdirs = "." : filter (not.isAbsolute) (includeDirs lbi)
incs <- mapM (findInc relincdirs) (installIncludes lbi)
flip mapM_ incs $ \(_,fpath) ->
copyFileTo verbosity targetDir fpath
case mb_lbi of
Just lbi | not (null pps) -> do
let lbi' = lbi{ buildDir = targetDir </> buildDir lbi }
withComponentsLBI pkg_descr lbi' $ \c _ ->
preprocessComponent pkg_descr c lbi' True verbosity pps
_ -> return ()
hsExists <- doesFileExist "Setup.hs"
lhsExists <- doesFileExist "Setup.lhs"
if hsExists then copyFileTo verbosity targetDir "Setup.hs"
else if lhsExists then copyFileTo verbosity targetDir "Setup.lhs"
else writeUTF8File (targetDir </> "Setup.hs") $ unlines [
"import Distribution.Simple",
"main = defaultMain"]
descFile <- defaultPackageDesc verbosity
installOrdinaryFile verbosity descFile (targetDir </> descFile)
where
pkg_descr = mapAllBuildInfo filterAutogenModule pkg_descr0
filterAutogenModule bi = bi {
otherModules = filter (/=autogenModule) (otherModules bi)
}
autogenModule = autogenModuleName pkg_descr0
findInc [] f = die ("can't find include file " ++ f)
findInc (d:ds) f = do
let path = (d </> f)
b <- doesFileExist path
if b then return (f,path) else findInc ds f
We have to deal with all libs and executables , so we have local
withLib action = maybe (return ()) action (library pkg_descr)
withExe action = mapM_ action (executables pkg_descr)
withTest action = mapM_ action (testSuites pkg_descr)
withBenchmark action = mapM_ action (benchmarks pkg_descr)
in the package description , eg using ' snapshotPackage ' or ' snapshotVersion ' .
-> Maybe LocalBuildInfo
^dist
^extra preprocessors ( includes suffixes )
-> IO ()
prepareSnapshotTree verbosity pkg mb_lbi distPref targetDir pps = do
prepareTree verbosity pkg mb_lbi distPref targetDir pps
overwriteSnapshotPackageDesc verbosity pkg targetDir
-> IO ()
overwriteSnapshotPackageDesc verbosity pkg targetDir = do
descFile <- defaultPackageDesc verbosity
withUTF8FileContents descFile $
writeUTF8File (targetDir </> descFile)
. unlines . map (replaceVersion (packageVersion pkg)) . lines
where
replaceVersion :: Version -> String -> String
replaceVersion version line
| "version:" `isPrefixOf` map toLower line
= "version: " ++ display version
| otherwise = line
| Modifies a ' PackageDescription ' by appending a snapshot number
snapshotPackage :: CalendarTime -> PackageDescription -> PackageDescription
snapshotPackage date pkg =
pkg {
package = pkgid { pkgVersion = snapshotVersion date (pkgVersion pkgid) }
}
where pkgid = packageId pkg
snapshotVersion :: CalendarTime -> Version -> Version
snapshotVersion date version = version {
versionBranch = versionBranch version
++ [dateToSnapshotNumber date]
}
dateToSnapshotNumber :: CalendarTime -> Int
dateToSnapshotNumber date = year * 10000
+ month * 100
+ day
where
year = ctYear date
month = fromEnum (ctMonth date) + 1
day = ctDay date
^info from cabal file
-> IO FilePath
createArchive verbosity pkg_descr mb_lbi tmpDir targetPref = do
let tarBallFilePath = targetPref </> tarBallName pkg_descr <.> "tar.gz"
(tarProg, _) <- requireProgram verbosity tarProgram
(maybe defaultProgramConfiguration withPrograms mb_lbi)
rawSystemProgram verbosity tarProg
["-C", tmpDir, "-czf", tarBallFilePath, tarBallName pkg_descr]
return tarBallFilePath
^dist
-> BuildInfo
-> IO ()
prepareDir verbosity _pkg _distPref inPref pps modules bi
= do let searchDirs = hsSourceDirs bi
sources <- sequence
[ let file = ModuleName.toFilePath module_
in findFileWithExtension suffixes searchDirs file
>>= maybe (notFound module_) return
| module_ <- modules ++ otherModules bi ]
bootFiles <- sequence
[ let file = ModuleName.toFilePath module_
fileExts = ["hs-boot", "lhs-boot"]
in findFileWithExtension fileExts (hsSourceDirs bi) file
| module_ <- modules ++ otherModules bi ]
let allSources = sources ++ catMaybes bootFiles ++ cSources bi
installOrdinaryFiles verbosity inPref (zip (repeat []) allSources)
where suffixes = ppSuffixes pps ++ ["hs", "lhs"]
notFound m = die $ "Error: Could not find module: " ++ display m
++ " with any suffix: " ++ show suffixes
copyFileTo :: Verbosity -> FilePath -> FilePath -> IO ()
copyFileTo verbosity dir file = do
let targetFile = dir </> file
createDirectoryIfMissingVerbose verbosity True (takeDirectory targetFile)
installOrdinaryFile verbosity file targetFile
printPackageProblems :: Verbosity -> PackageDescription -> IO ()
printPackageProblems verbosity pkg_descr = do
ioChecks <- checkPackageFiles pkg_descr "."
let pureChecks = checkConfiguredPackage pkg_descr
isDistError (PackageDistSuspicious _) = False
isDistError _ = True
(errors, warnings) = partition isDistError (pureChecks ++ ioChecks)
unless (null errors) $
notice verbosity $ "Distribution quality errors:\n"
++ unlines (map explanation errors)
unless (null warnings) $
notice verbosity $ "Distribution quality warnings:\n"
++ unlines (map explanation warnings)
unless (null errors) $
notice verbosity
"Note: the public hackage server would reject this package."
tarBallName :: PackageDescription -> String
tarBallName = display . packageId
mapAllBuildInfo :: (BuildInfo -> BuildInfo)
-> (PackageDescription -> PackageDescription)
mapAllBuildInfo f pkg = pkg {
library = fmap mapLibBi (library pkg),
executables = fmap mapExeBi (executables pkg),
testSuites = fmap mapTestBi (testSuites pkg),
benchmarks = fmap mapBenchBi (benchmarks pkg)
}
where
mapLibBi lib = lib { libBuildInfo = f (libBuildInfo lib) }
mapExeBi exe = exe { buildInfo = f (buildInfo exe) }
mapTestBi t = t { testBuildInfo = f (testBuildInfo t) }
mapBenchBi bm = bm { benchmarkBuildInfo = f (benchmarkBuildInfo bm) }
|
92636a746e28884bc5e8c59990a56453cad6533344f7748789a5156355218480 | crategus/cl-cffi-gtk | gtk.assistant.lisp | ;;; ----------------------------------------------------------------------------
;;; gtk.assistant.lisp
;;;
;;; The documentation of this file is taken from the GTK 3 Reference Manual
Version 3.24 and modified to document the Lisp binding to the GTK library .
;;; See <>. The API documentation of the Lisp binding is
available from < -cffi-gtk/ > .
;;;
Copyright ( C ) 2009 - 2011
Copyright ( C ) 2011 - 2021
;;;
;;; This program is free software: you can redistribute it and/or modify
;;; it under the terms of the GNU Lesser General Public License for Lisp
as published by the Free Software Foundation , either version 3 of the
;;; License, or (at your option) any later version and with a preamble to
the GNU Lesser General Public License that clarifies the terms for use
;;; with Lisp programs and is referred as the LLGPL.
;;;
;;; This program is distributed in the hope that it will be useful,
;;; but WITHOUT ANY WARRANTY; without even the implied warranty of
;;; MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
GNU Lesser General Public License for more details .
;;;
You should have received a copy of the GNU Lesser General Public
License along with this program and the preamble to the Gnu Lesser
;;; General Public License. If not, see </>
;;; and <>.
;;; ----------------------------------------------------------------------------
;;;
GtkAssistant
;;;
;;; A widget used to guide users through multi-step operations
;;;
;;; Types and Values
;;;
;;; GtkAssistant
GtkAssistantPageType
;;;
;;; Functions
;;;
;;; gtk_assistant_new
;;; gtk_assistant_get_current_page
;;; gtk_assistant_set_current_page
;;; gtk_assistant_get_n_pages
;;; gtk_assistant_get_nth_page
;;; gtk_assistant_prepend_page
;;; gtk_assistant_append_page
;;; gtk_assistant_insert_page
;;; gtk_assistant_remove_page
;;;
;;; GtkAssistantPageFunc
;;; gtk_assistant_set_forward_page_func
;;;
;;; gtk_assistant_set_page_type
gtk_assistant_get_page_type
gtk_assistant_set_page_title
;;; gtk_assistant_get_page_title
;;; gtk_assistant_set_page_header_image deprecated
;;; gtk_assistant_get_page_header_image deprecated
;;; gtk_assistant_set_page_side_image deprecated
;;; gtk_assistant_get_page_side_image deprecated
;;; gtk_assistant_set_page_complete
;;; gtk_assistant_get_page_complete
;;; gtk_assistant_set_page_has_padding
;;; gtk_assistant_get_page_has_padding
;;; gtk_assistant_add_action_widget
;;; gtk_assistant_remove_action_widget
;;; gtk_assistant_update_buttons_state
;;; gtk_assistant_commit
;;; gtk_assistant_next_page
;;; gtk_assistant_previous_page
;;;
;;; Properties
;;;
;;; gint use-header-bar Read / Write / Construct Only
;;;
;;; Child Properties
;;;
gboolean complete Read / Write
;;; gboolean has-padding Read / Write
;;; GdkPixbuf* header-image Read / Write
GtkAssistantPageType page - type Read / Write
GdkPixbuf * sidebar - image Read / Write
;;; gchar* title Read / Write
;;;
;;; Style Properties
;;;
;;; gint content-padding Read
;;; gint header-padding Read
;;;
;;; Signals
;;;
;;; void apply Run Last
;;; void cancel Run Last
;;; void close Run Last
;;; void escape Action
;;; void prepare Run Last
;;;
;;; Object Hierarchy
;;;
;;; GObject
;;; ╰── GInitiallyUnowned
╰ ─ ─
╰ ─ ─ GtkContainer
╰ ─ ─
╰ ─ ─ GtkWindow
;;; ╰── GtkAssistant
;;;
;;; Implemented Interfaces
;;;
GtkAssistant implements AtkImplementorIface and GtkBuildable .
;;; ----------------------------------------------------------------------------
(in-package :gtk)
;;; ----------------------------------------------------------------------------
enum GtkAssistantPageType
;;; ----------------------------------------------------------------------------
(define-g-enum "GtkAssistantPageType" gtk-assistant-page-type
(:export t
:type-initializer "gtk_assistant_page_type_get_type")
(:content 0)
(:intro 1)
(:confirm 2)
(:summary 3)
(:progress 4)
(:custom 5))
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-page-type atdoc:*symbol-name-alias*)
"GEnum"
(gethash 'gtk-assistant-page-type atdoc:*external-symbols*)
"@version{*2021-12-3}
@begin{short}
An enumeration for determining the page role inside the
@class{gtk-assistant} widget. It is used to handle buttons sensitivity and
visibility.
@end{short}
Note that an assistant needs to end its page flow with a page of
@code{:confirm}, @code{:summary} or @code{:progress} type to be correct. The
Cancel button will only be shown if the page is not \"committed\". See the
@fun{gtk-assistant-commit} function for details.
@begin{pre}
(define-g-enum \"GtkAssistantPageType\" gtk-assistant-page-type
(:export t
:type-initializer \"gtk_assistant_page_type_get_type\")
(:content 0)
(:intro 1)
(:confirm 2)
(:summary 3)
(:progress 4)
(:custom 5))
@end{pre}
@begin[code]{table}
@entry[:content]{The page has regular contents. Both the Back and Forward
buttons will be shown.}
@entry[:intro]{The page contains an introduction to the assistant task.
Only the Forward button will be shown if there is a next page.}
@entry[:confirm]{The page lets the user confirm or deny the changes. The
Back and Apply buttons will be shown.}
@entry[:summary]{The page informs the user of the changes done. Only the
Close button will be shown.}
@entry[:progress]{Used for tasks that take a long time to complete, blocks
the assistant until the page is marked as complete. Only the Back button
will be shown.}
@entry[:custom]{Used for when other page types are not appropriate. No
buttons will be shown, and the application must add its own buttons
through the @fun{gtk-assistant-add-action-widget} function.}
@end{table}
@see-class{gtk-assistant}
@see-function{gtk-assistant-commit}
@see-function{gtk-assistant-add-action-widget}")
;;; ----------------------------------------------------------------------------
struct GtkAssistant
;;; ----------------------------------------------------------------------------
(define-g-object-class "GtkAssistant" gtk-assistant
(:superclass gtk-window
:export t
:interfaces ("AtkImplementorIface"
"GtkBuildable")
:type-initializer "gtk_assistant_get_type")
((use-header-bar
gtk-assistant-use-header-bar
"use-header-bar" "gint" t t)))
#+cl-cffi-gtk-documentation
(setf (documentation 'gtk-assistant 'type)
"@version{*2021-11-2}
@begin{short}
A @sym{gtk-assistant} widget is used to represent a generally complex
operation splitted in several steps, guiding the user through its pages and
controlling the page flow to collect the necessary data.
@end{short}
@image[assistant]{}
The design of the @sym{gtk-assistant} widget is that it controls what buttons
to show and to make sensitive, based on what it knows about the page sequence
and the type of each page, in addition to state information like the page
completion and committed status.
If you have a case that does not quite fit in an assistants way of handling
buttons, you can use the @code{:custom} page type of the
@symbol{gtk-assistant-page-type} enumeration and handle buttons yourself.
@begin[GtkAssistant as GtkBuildable]{dictionary}
The @sym{gtk-assistant} implementation of the @class{gtk-buildable}
interface exposes the action area as internal children with the
name @code{\"action_area\"}. To add pages to an assistant in a
@class{gtk-builder} object, simply add it as a @code{<child>} to the
@sym{gtk-assistant} widget and set its child properties as necessary.
@end{dictionary}
@begin[CSS nodes]{dictionary}
The @sym{gtk-assistant} implementation has a single CSS node with the name
@code{assistant}.
@end{dictionary}
@begin[Child Property Details]{dictionary}
@begin[code]{table}
@begin[complete]{entry}
The @code{complete} child property of type @code{:boolean}
(Read / Write) @br{}
Setting to @em{true} marks a page as complete, i.e. all the required
fields are filled out. GTK uses this information to control the
sensitivity of the navigation buttons. @br{}
Default value: @em{false} @br{}
@end{entry}
@begin[has-padding]{entry}
The @code{has-padding} child property of type @code{:boolean}
(Read / Write) @br{}
Whether the assistant adds padding around the page. Since 3.18 @br{}
Default value: @em{true}
@end{entry}
@begin[header-image]{entry}
The @code{header-image} child property of type @class{gdk-pixbuf}
(Read / Write) @br{}
The image used to be displayed in the page header. @br{}
@em{Warning:} The @code{header-image} child property has been deprecated
since version 3.2 and should not be used in newly written code. Since
GTK 3.2, a header is no longer shown. Add your header decoration to the
page content instead.
@end{entry}
@begin[page-type]{entry}
The @code{page-type} child property of type
@symbol{gtk-assistant-page-type} (Read / Write) @br{}
The type of the assistant page. @br{}
Default value: @code{:content}
@end{entry}
@begin[sidebar-image]{entry}
The @code{sidebar-image} child property of type @class{gdk-pixbuf}
(Read / Write) @br{}
The image used to be displayed in the sidebar. @br{}
@em{Warning:} The @code{sidebar-image} child property has been
deprecated since version 3.2 and should not be used in newly written
code. Since GTK 3.2, the sidebar image is no longer shown.
@end{entry}
@begin[title]{entry}
The @code{title} child property of type @code{:string} (Read / Write)
@br{}
The title of the page. @br{}
Default value: @code{nil}
@end{entry}
@end{table}
@end{dictionary}
@begin[Style Property Details]{dictionary}
@begin[code]{table}
@begin[content-padding]{entry}
The @code{content-padding} style property of type @code{:int} (Read)
@br{}
Number of pixels around the content pages. @br{}
@em{Warning:} The @code{content-padding} style property has been
deprecated since version 3.20 and should not be used in newly written
code. This style property is ignored. @br{}
Allowed values: >= 0 @br{}
Default value: 1
@end{entry}
@begin[header-padding]{entry}
The @code{header-padding} style property of type @code{:int} (Read)
@br{}
Number of pixels around the header. @br{}
@em{Warning:} The @code{content-padding} has been deprecated since
version 3.20 and should not be used in newly written code. This style
property is ignored. @br{}
Allowed values: >= 0 @br{}
Default value: 6
@end{entry}
@end{table}
@end{dictionary}
@begin[Signal Details]{dictionary}
@subheading{The \"apply\" signal}
@begin{pre}
lambda (assistant) :run-last
@end{pre}
The signal is emitted when the Apply button is clicked. The default
behavior of the assistant is to switch to the page after the current page,
unless the current page is the last one. A handler for the \"apply\"
signal should carry out the actions for which the wizard has collected
data. If the action takes a long time to complete, you might consider
putting a @code{:progress} page after the @code{:confirm} page and handle
this operation within the \"prepare\" signal of the progress page.
@begin[code]{table}
@entry[assistant]{The @sym{gtk-assistant} widget which received the
signal.}
@end{table}
@subheading{The \"cancel\" signal}
@begin{pre}
lambda (assistant) :run-last
@end{pre}
The signal is emitted when the Cancel button is clicked.
@begin[code]{table}
@entry[assistant]{The @sym{gtk-assistant} widget which received the
signal.}
@end{table}
@subheading{The \"close\" signal}
@begin{pre}
lambda (assistant) :run-last
@end{pre}
The signal is emitted either when the Close button of a summary page is
clicked, or when the Apply button in the last page in the flow is clicked,
which is the @code{:confirm} page.
@begin[code]{table}
@entry[assistant]{The @sym{gtk-assistant} widget which received the
signal.}
@end{table}
@subheading{The \"escape\" signal}
@begin{pre}
lambda (assistant) :action
@end{pre}
No documentation.
@begin[code]{table}
@entry[assistant]{The @sym{gtk-assistant} widget which received the
signal.}
@end{table}
@subheading{The \"prepare\" signal}
@begin{pre}
lambda (assistant page) :run-last
@end{pre}
The signal is emitted when a new page is set as the assistants current
page, before making the new page visible. A handler for this signal can
do any preparations which are necessary before showing the page.
@begin[code]{table}
@entry[assistant]{The @sym{gtk-assistant} widget which received the
signal.}
@entry[page]{The @class{gtk-widget} widget for the current page.}
@end{table}
@end{dictionary}
@see-slot{gtk-assistant-use-header-bar}")
;;; ----------------------------------------------------------------------------
;;; Property and Accessor Details
;;; ----------------------------------------------------------------------------
(eval-when (:compile-toplevel :load-toplevel :execute)
(register-object-type "GtkAssistant" 'gtk-assistant))
;;; --- gtk-assistant-use-header-bar -------------------------------------------
#+cl-cffi-gtk-documentation
(setf (documentation (atdoc:get-slot-from-name "use-header-bar"
'gtk-assistant) 't)
"The @code{use-header-bar} property of type @code{:int}
(Read / Write / Construct) @br{}
@em{True} if the assistant uses a header bar for action buttons instead of the
action area. For technical reasons, this property is declared as an integer
property, use the value 1 for @em{true} or -1 for @em{false}. @br{}
Allowed values: [-1, 1] @br{}
Default value: -1")
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-use-header-bar atdoc:*function-name-alias*)
"Accessor"
(documentation 'gtk-assistant-use-header-bar 'function)
"@version{2021-10-27}
@syntax[]{(gtk-assistant-use-header-bar object) => setting}
@syntax[]{(setf (gtk-assistant-use-header-bar object) setting)}
@argument[object]{a @class{gtk-assistant} widget}
@argument[setting]{@em{true} if the assistant uses a header bar}
@begin{short}
Accessor of the @slot[gtk-assistant]{use-header-bar} slot of the
@class{gtk-assistant} class.
@end{short}
@em{True} if the assistant uses a header bar for action buttons instead of the
action area. For technical reasons, this property is declared as an integer
property, use the value 1 for @em{true} or -1 for @em{false}.
@see-class{gtk-assistant}
@see-class{gtk-header-bar}")
;;; ----------------------------------------------------------------------------
;;; Accessors of the Child Properties
;;; ----------------------------------------------------------------------------
;;; --- gtk-assistant-child-complete -------------------------------------------
(define-child-property "GtkAssistant"
gtk-assistant-child-complete
"complete" "gboolean" t t t)
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-child-complete atdoc:*function-name-alias*)
"Accessor"
(documentation 'gtk-assistant-child-complete 'function)
"@version{2021-11-2}
@syntax[]{(gtk-assistant-child-complete container child) => complete}
@syntax[]{(setf (gtk-assistant-child-complete container child) complete)}
@argument[container]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} page of the assistant}
@argument[complete]{a boolean whether the page is complete}
@begin{short}
Accessor of the @code{complete} child property of the @class{gtk-assistant}
class.
@end{short}
Setting the @code{complete} child property to @em{true} marks a page as
complete, i.e. all the required fields are filled out. GTK uses this
information to control the sensitivity of the navigation buttons.
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-page-complete}")
;;; --- gtk-assistant-child-has-padding ----------------------------------------
#+gtk-3-18
(define-child-property "GtkAssistant"
gtk-assistant-child-has-padding
"has-padding" "gboolean" t t t)
#+(and gtk-3-18 cl-cffi-gtk-documentation)
(setf (gethash 'gtk-assistant-child-has-padding atdoc:*function-name-alias*)
"Accessor"
(documentation 'gtk-assistant-child-has-padding 'function)
"@version{2021-11-2}
@syntax[]{(gtk-assistant-child-has-padding container child) => setting}
@syntax[]{(setf (gtk-assistant-child-has-padding container child) setting)}
@argument[container]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} page of the assistant}
@argument[setting]{a boolean whether the assistant adds padding around the
page}
@begin{short}
Accessor of the @code{has-padding} child property of the
@class{gtk-assistant} class.
@end{short}
Whether the assistant adds padding around the page.
Since 3.18
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-page-has-padding}")
;;; --- gtk-assistant-child-header-image ---------------------------------------
;; not exported
(define-child-property "GtkAssistant"
gtk-assistant-child-header-image
"header-image" "GdkPixbuf" t t nil)
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-child-header-image atdoc:*function-name-alias*)
"Accessor"
(documentation 'gtk-assistant-child-header-image 'function)
"@version{2021-11-2}
@syntax[]{(gtk-assistant-child-header-image container child) => image}
@syntax[]{(setf (gtk-assistant-child-header-image container child) image)}
@argument[container]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} page of the assistant}
@argument[image]{a @class{gdk-pixbuf} image}
@begin{short}
Accessor of the @code{header-image} child property of the
@class{gtk-assistant} class.
@end{short}
The image used to be displayed in the page header.
@begin[Warning]{dictionary}
The @code{header-image} child property has been deprecated since version 3.2
and should not be used in newly written code. Since GTK 3.2, a header is no
longer shown. Add your header decoration to the page content instead.
@end{dictionary}
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-class{gdk-pixbuf}")
;;; --- gtk-assistant-child-page-type ------------------------------------------
(define-child-property "GtkAssistant"
gtk-assistant-child-page-type
"page-type" "GtkAssistantPageType" t t t)
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-child-page-type atdoc:*function-name-alias*)
"Accessor"
(documentation 'gtk-assistant-child-page-type 'function)
"@version{2021-11-2}
@syntax[]{(gtk-assistant-child-page-type container child) => ptype}
@syntax[]{(setf (gtk-assistant-child-page-type container child) ptype)}
@argument[container]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} page of the assistant}
@argument[ptype]{a value of the @symbol{gtk-assistant-page-type} enumeration}
@begin{short}
Accessor of the @code{page-type} child property of the @class{gtk-assistant}
class.
@end{short}
The page type determines the page behavior in the assistant.
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-symbol{gtk-assistant-page-type}
@see-function{gtk-assistant-child-page-type}")
;;; --- gtk-assistant-child-sidebar-image --------------------------------------
;; not exported
(define-child-property "GtkAssistant"
gtk-assistant-child-sidebar-image
"sidebar-image" "GdkPixbuf" t t nil)
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-child-sidebar-image atdoc:*function-name-alias*)
"Accessor"
(documentation 'gtk-assistant-child-sidebar-image 'function)
"@version{2021-10-26}
@syntax[]{(gtk-assistant-child-sidebar-image container child) => image}
@syntax[]{(setf (gtk-assistant-child-sidebar-image container child) image)}
@argument[container]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} page of the assistant}
@argument[image]{a @class{gdk-pixbuf} image}
@begin{short}
Accessor of the @code{sidebar-image} child property of the
@class{gtk-assistant} class.
@end{short}
The image used to be displayed in the sidebar.
@begin[Warning]{dictionary}
The @code{sidebar-image} child property has been deprecated since version
3.2 and should not be used in newly written code. Since GTK 3.2, the
sidebar image is no longer shown.
@end{dictionary}
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-class{gdk-pixbuf}")
;;; --- gtk-assistant-child-title ----------------------------------------------
(define-child-property "GtkAssistant"
gtk-assistant-child-title
"title" "gchararray" t t t)
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-child-title atdoc:*function-name-alias*)
"Accessor"
(documentation 'gtk-assistant-child-title 'function)
"@version{2021-11-2}
@syntax[]{(gtk-assistant-child-title container child) => title}
@syntax[]{(setf (gtk-assistant-child-title container child) title)}
@argument[container]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} page of the assistant}
@argument[title]{a string with the title of the page}
@begin{short}
Accessor of the @code{title} child property of the
@class{gtk-assistant} class.
@end{short}
The title of the page.
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-asssistant-page-title}")
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_new ()
;;; ----------------------------------------------------------------------------
(defun gtk-assistant-new ()
#+cl-cffi-gtk-documentation
"@version{2021-10-26}
@return{A @class{gtk-assistant} widget.}
@begin{short}
Creates a new assistant.
@end{short}
@see-class{gtk-assistant}"
(make-instance 'gtk-assistant))
(export 'gtk-assistant-new)
;;; ----------------------------------------------------------------------------
gtk_assistant_get_current_page ( )
;;; gtk_assistant_set_current_page () -> gtk-assistant-current-page
;;; ----------------------------------------------------------------------------
(defun (setf gtk-assistant-current-page) (index assistant)
(foreign-funcall "gtk_assistant_set_current_page"
(g-object gtk-assistant) assistant
:int index
:void)
index)
(defcfun ("gtk_assistant_get_current_page" gtk-assistant-current-page) :int
#+cl-cffi-gtk-documentation
"@version{*2021-11-1}
@syntax[]{(gtk-assistant-current-page assistant) => index}
@syntax[]{(setf (gtk-assistant-current-page assistant) index)}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[index]{an integer with the index of the page to switch to, starting
from 0, if negative, the last page will be used, if greater than the number
of pages in the assistant, nothing will be done}
@begin{short}
Accessor of the current page of the assistant.
@end{short}
The @sym{gtk-assistant-current-page} function returns the page number of the
current page in the assistant. The @sym{(setf gtk-assistant-current-page)}
function switches the page in the assistant to @arg{index}.
Note that this will only be necessary in custom buttons, as the assistant
flow can be set with the @fun{gtk-assistant-set-forward-page-func} function.
@see-class{gtk-assistant}
@see-function{gtk-assistant-set-forward-page-func}"
(assistant (g-object gtk-assistant)))
(export 'gtk-assistant-current-page)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_get_n_pages () -> gtk-assistant-n-pages
;;; ----------------------------------------------------------------------------
(defcfun ("gtk_assistant_get_n_pages" gtk-assistant-n-pages) :int
#+cl-cffi-gtk-documentation
"@version{*2021-11-1}
@argument[assistant]{a @class{gtk-assistant} widget}
@return{An integer with the number of pages in @arg{assistant}.}
@begin{short}
Returns the number of pages in the assistant.
@end{short}
@see-class{gtk-assistant}"
(assistant (g-object gtk-assistant)))
(export 'gtk-assistant-n-pages)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_get_nth_page () -> gtk-assistant-nth-page
;;; ----------------------------------------------------------------------------
(defcfun ("gtk_assistant_get_nth_page" gtk-assistant-nth-page)
(g-object gtk-widget)
#+cl-cffi-gtk-documentation
"@version{*2021-11-2}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[index]{an integer with the index of a page in @arg{assistant},
or -1 to get the last page}
@return{The @class{gtk-widget} child widget, or @code{nil} if the @arg{index}
argument is out of bounds.}
@begin{short}
Returns the child widget contained in the assistant with the given page
index.
@end{short}
@see-class{gtk-assistant}
@see-class{gtk-widget}"
(assistant (g-object gtk-assistant))
(index :int))
(export 'gtk-assistant-nth-page)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_prepend_page ()
;;; ----------------------------------------------------------------------------
(defcfun ("gtk_assistant_prepend_page" gtk-assistant-prepend-page) :int
#+cl-cffi-gtk-documentation
"@version{2021-10-26}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[page]{a @class{gtk-widget} page of the assistant}
@return{An integer with the index starting at 0 of the inserted page.}
@begin{short}
Prepends a page to the assistant.
@end{short}
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-append-page}
@see-function{gtk-assistant-insert-page}
@see-function{gtk-assistant-remove-page}"
(assistant (g-object gtk-assistant))
(page (g-object gtk-widget)))
(export 'gtk-assistant-prepend-page)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_append_page ()
;;; ----------------------------------------------------------------------------
(defcfun ("gtk_assistant_append_page" gtk-assistant-append-page) :int
#+cl-cffi-gtk-documentation
"@version{*2021-11-1}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[page]{a @class{gtk-widget} page of the assistant}
@return{An integer with the index starting at 0 of the inserted page.}
@begin{short}
Appends a page to the assistant.
@end{short}
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-prepend-page}
@see-function{gtk-assistant-insert-page}
@see-function{gtk-assistant-remove-page}"
(assistant (g-object gtk-assistant))
(page (g-object gtk-widget)))
(export 'gtk-assistant-append-page)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_insert_page ()
;;; ----------------------------------------------------------------------------
(defcfun ("gtk_assistant_insert_page" gtk-assistant-insert-page) :int
#+cl-cffi-gtk-documentation
"@version{2021-10-26}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[page]{a @class{gtk-widget} page of the assistant}
@argument[position]{an integer with the index starting at 0 at which to
insert @arg{page}, or -1 to append @arg{page} to the assistant}
@return{The index starting from 0 of the inserted page.}
@begin{short}
Inserts a page in the assistant at a given position.
@end{short}
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-append-page}
@see-function{gtk-assistant-prepend-page}
@see-function{gtk-assistant-remove-page}"
(assistant (g-object gtk-assistant))
(page (g-object gtk-widget))
(position :int))
(export 'gtk-assistant-insert-page)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_remove_page ()
;;; ----------------------------------------------------------------------------
(defcfun ("gtk_assistant_remove_page" gtk-assistant-remove-page) :void
#+cl-cffi-gtk-documentation
"@version{2021-11-1}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[index]{an integer with the index of a page in the assistant, or -1
to remove the last page}
@begin{short}
Removes the page with the given page index from the assistant.
@end{short}
@see-class{gtk-assistant}
@see-function{gtk-assistant-append-page}
@see-function{gtk-assistant-prepend-page}
@see-function{gtk-assistant-insert-page}"
(assistant (g-object gtk-assistant))
(index :int))
(export 'gtk-assistant-remove-page)
;;; ----------------------------------------------------------------------------
;;; GtkAssistantPageFunc ()
;;; ----------------------------------------------------------------------------
(define-cb-methods gtk-assistant-page-func :int ((current-page :int)))
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-page-func atdoc:*symbol-name-alias*)
"Callback"
(gethash 'gtk-assistant-page-func atdoc:*external-symbols*)
"@version{2021-10-26}
@begin{short}
A callback function used by the @fun{gtk-assistant-set-forward-page-func}
function to know which is the next page given a current one.
@end{short}
It is called both for computing the next page when the user presses the
Forward button and for handling the behavior of the Last button.
@begin{pre}
lambda (current)
@end{pre}
@begin[code]{table}
@entry[current]{An integer with the page number used to calculate the next
page.}
@entry[Returns]{An integer with the next page number.}
@end{table}
@see-class{gtk-assistant}
@see-function{gtk-assistant-set-forward-page-func}")
(export 'gtk-assistant-page-func)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_set_forward_page_func ()
;;; ----------------------------------------------------------------------------
(defcfun ("gtk_assistant_set_forward_page_func"
%gtk-assistant-set-forward-page-func) :void
(assistant (g-object gtk-assistant))
(func :pointer)
(data :pointer)
(destroy :pointer))
(defun gtk-assistant-set-forward-page-func (assistant func)
#+cl-cffi-gtk-documentation
"@version{2021-10-26}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[func]{a @symbol{gtk-assistant-page-func} page forwarding callback
function, or @code{nil} to use the default one}
@begin{short}
Sets the page forwarding function to be @arg{func}.
@end{short}
This function will be used to determine what will be the next page when the
user presses the Forward button. Setting @arg{func} to @code{nil} will make
the assistant to use the default forward function, which just goes to the next
visible page.
@see-class{gtk-assistant}
@see-symbol{gtk-assistant-page-func}"
(if func
(%gtk-assistant-set-forward-page-func
assistant
(callback gtk-assistant-page-func)
(create-fn-ref assistant func)
(callback gtk-assistant-page-func-destroy-notify))
(%gtk-assistant-set-forward-page-func assistant
(null-pointer)
(null-pointer)
(null-pointer))))
(export 'gtk-assistant-set-forward-page-func)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_set_page_type ()
gtk_assistant_get_page_type ( ) - > gtk - assistant - page - type
;;; ----------------------------------------------------------------------------
(defun (setf gtk-assistant-page-type) (ptype assistant page)
(setf (gtk-assistant-child-page-type assistant page) ptype))
(defun gtk-assistant-page-type (assistant page)
#+cl-cffi-gtk-documentation
"@version{*2021-11-2}
@syntax[]{(gtk-assistant-page-type assistant page) => ptype}
@syntax[]{(setf (gtk-assistant-page-type assistant page) ptype)}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[page]{a @class{gtk-widget} page of @arg{assistant}}
@argument[ptype]{a value of the @symbol{gtk-assistant-page-type} enumeration}
@begin{short}
Accessor of the page type of a page in the assistant.
@end{short}
The page type determines the page behavior in the assistant. The function is
implemented with the @fun{gtk-assistant-child-pack-type} function.
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-symbol{gtk-assistant-page-type}
@see-function{gtk-assistant-child-page-type}"
(gtk-assistant-child-page-type assistant page))
(export 'gtk-assistant-page-type)
;;; ----------------------------------------------------------------------------
gtk_assistant_set_page_title ( )
;;; gtk_assistant_get_page_title () -> gtk-assistant-page-title
;;; ----------------------------------------------------------------------------
(defun (setf gtk-assistant-page-title) (title assistant page)
(setf (gtk-assistant-child-title assistant page) title))
(defun gtk-assistant-page-title (assistant page)
#+cl-cffi-gtk-documentation
"@version{*2021-11-2}
@syntax[]{(gtk-assistant-page-title assistant page) => title}
@syntax[]{(setf (gtk-assistant-page-title assistant page) title)}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[page]{a @class{gtk-widget} page of @arg{assistant}}
@argument[title]{a string with the new title for @arg{page}}
@begin{short}
Accessor of the title for the page in the assistant.
@end{short}
The @sym{gtk-assistant-page-title} function gets the title for the page in the
assistant. The @sym{(setf gtk-assistant-page-title)} function sets a title.
The title is displayed in the header area of the assistant when the page is
the current page.
The function is implemented with the @fun{gtk-assistant-child-title} function.
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-child-title}"
(gtk-assistant-child-title assistant page))
(export 'gtk-assistant-page-title)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_set_page_header_image ()
;;;
;;; void gtk_assistant_set_page_header_image (GtkAssistant *assistant,
;;; GtkWidget *page,
;;; GdkPixbuf *pixbuf);
;;;
;;; Warning
;;;
gtk_assistant_set_page_header_image has been deprecated since version 3.2
and should not be used in newly written code . Since GTK 3.2 , a header is no
;;; longer shown; add your header decoration to the page content instead.
;;;
;;; Sets a header image for page.
;;;
;;; assistant :
a GtkAssistant
;;;
;;; page :
;;; a page of assistant
;;;
;;; pixbuf :
;;; the new header image page
;;;
Since 2.10
;;; ----------------------------------------------------------------------------
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_get_page_header_image ()
;;;
;;; GdkPixbuf * gtk_assistant_get_page_header_image (GtkAssistant *assistant,
;;; GtkWidget *page);
;;;
;;; Warning
;;;
gtk_assistant_get_page_header_image has been deprecated since version 3.2
and should not be used in newly written code . Since GTK 3.2 , a header is no
;;; longer shown; add your header decoration to the page content instead.
;;;
;;; Gets the header image for page.
;;;
;;; assistant :
a GtkAssistant
;;;
;;; page :
;;; a page of assistant
;;;
;;; Returns :
;;; the header image for page, or NULL if there's no header image for the
;;; page
;;;
Since 2.10
;;; ----------------------------------------------------------------------------
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_set_page_side_image ()
;;;
void gtk_assistant_set_page_side_image ( GtkAssistant * assistant ,
;;; GtkWidget *page,
;;; GdkPixbuf *pixbuf);
;;;
;;; Warning
;;;
gtk_assistant_set_page_side_image has been deprecated since version 3.2 and
should not be used in newly written code . Since GTK 3.2 , sidebar images are
;;; not shown anymore.
;;;
;;; Sets a side image for page.
;;;
;;; This image used to be displayed in the side area of the assistant when page
;;; is the current page.
;;;
;;; assistant :
a GtkAssistant
;;;
;;; page :
;;; a page of assistant
;;;
;;; pixbuf :
;;; the new side image page
;;;
Since 2.10
;;; ----------------------------------------------------------------------------
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_get_page_side_image ()
;;;
;;; GdkPixbuf * gtk_assistant_get_page_side_image (GtkAssistant *assistant,
;;; GtkWidget *page);
;;;
;;; Warning
;;;
gtk_assistant_get_page_side_image has been deprecated since version 3.2 and
should not be used in newly written code . Since GTK 3.2 , sidebar images are
;;; not shown anymore.
;;;
;;; Gets the side image for page.
;;;
;;; assistant :
a GtkAssistant
;;;
;;; page :
;;; a page of assistant
;;;
;;; Returns :
;;; the side image for page, or NULL if there's no side image for the page
;;;
Since 2.10
;;; ----------------------------------------------------------------------------
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_set_page_complete ()
;;; gtk_assistant_get_page_complete () -> gtk-assistant-page-complete
;;; ----------------------------------------------------------------------------
(defun (setf gtk-assistant-page-complete) (complete assistant page)
(setf (gtk-assistant-child-complete assistant page) complete))
(defun gtk-assistant-page-complete (assistant page)
#+cl-cffi-gtk-documentation
"@version{*2021-11-2}
@syntax[]{(gtk-assistant-page-complete assistant page) => complete}
@syntax[]{(setf (gtk-assistant-page-complete assistant page) complete)}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[page]{a @class{gtk-widget} page of @arg{assistant}}
@argument[complete]{a boolean with the completeness status of the page}
@begin{short}
Accessor of the completeness status of the page in the assistant.
@end{short}
The @sym{gtk-assistant-page-complete} function gets whether the page is
complete. The @sym{(setf gtk-assistant-page-complete)} function sets whether
the page contents are complete. This will make the assistant update the
buttons state to be able to continue the task.
The function is implemented with the @fun{gtk-assistant-child-complete}
function.
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-child-complete}"
(gtk-assistant-child-complete assistant page))
(export 'gtk-assistant-page-complete)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_set_page_has_padding ()
;;; gtk_assistant_get_page_has_padding () -> gtk-assistant-page-has-padding
;;; ----------------------------------------------------------------------------
(defun (setf gtk-assistant-page-has-padding) (setting assistant page)
(setf (gtk-assistant-child-has-padding assistant page) setting))
(defun gtk-assistant-page-has-padding (assistant page)
"@version{2021-11-2}
@syntax[]{(gtk-assistant-page-has-padding assistant page) => setting}
@syntax[]{(setf (gtk-assistant-page-has-padding assistant page) setting)}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[page]{a @class{gtk-widget} page of @arg{assistant}}
@argument[setting]{a boolean whether the page has padding}
@begin{short}
Accessor of the has padding status of the page in the assistant.
@end{short}
The @sym{gtk-assistant-page-has-padding} function gets whether the page has
padding. The @sym{(setf gtk-assistant-page-has-padding)} function sets whether
the assistant is adding padding around the page.
The function is implemented with the @fun{gtk-assistant-child-has-padding}
function.
Since 3.18
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-child-has-padding}"
(gtk-assistant-child-has-padding assistant page))
(export 'gtk-assistant-page-has-padding)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_add_action_widget ()
;;; ----------------------------------------------------------------------------
(defcfun ("gtk_assistant_add_action_widget" gtk-assistant-add-action-widget)
:void
#+cl-cffi-gtk-documentation
"@version{2021-11-2}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} child widget}
@begin{short}
Adds a child widget to the action area of the assistant.
@end{short}
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-remove-action-widget}"
(assistant (g-object gtk-assistant))
(child (g-object gtk-widget)))
(export 'gtk-assistant-add-action-widget)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_remove_action_widget ()
;;; ----------------------------------------------------------------------------
(defcfun ("gtk_assistant_remove_action_widget"
gtk-assistant-remove-action-widget)
:void
#+cl-cffi-gtk-documentation
"@version{2021-11-2}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} child widget}
@begin{short}
Removes a child widget from the action area of the assistant.
@end{short}
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-add-action-widget}"
(assistant (g-object gtk-assistant))
(child (g-object gtk-widget)))
(export 'gtk-assistant-remove-action-widget)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_update_buttons_state ()
;;; ----------------------------------------------------------------------------
(defcfun ("gtk_assistant_update_buttons_state"
gtk-assistant-update-buttons-state) :void
#+cl-cffi-gtk-documentation
"@version{2021-10-26}
@argument[assistant]{a @class{gtk-assistant} widget}
@begin{short}
Forces the assistant to recompute the buttons state.
@end{short}
GTK automatically takes care of this in most situations, e.g. when the user
goes to a different page, or when the visibility or completeness of a page
changes. One situation where it can be necessary to call this function is
when changing a value on the current page affects the future page flow of the
assistant.
@see-class{gtk-assistant}"
(assistant (g-object gtk-assistant)))
(export 'gtk-assistant-update-buttons-state)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_commit ()
;;; ----------------------------------------------------------------------------
(defcfun ("gtk_assistant_commit" gtk-assistant-commit) :void
#+cl-cffi-gtk-documentation
"@version{*2021-11-1}
@argument[assistant]{a @class{gtk-assistant} widget}
@begin{short}
Erases the visited page history so the Back button is not shown on the
current page, and removes the Cancel button from subsequent pages.
@end{short}
Use this when the information provided up to the current page is hereafter
deemed permanent and cannot be modified or undone. For example, showing a
progress page to track a long running, unreversible operation after the user
has clicked the Apply button on a confirmation page.
@see-class{gtk-assistant}"
(assistant (g-object gtk-assistant)))
(export 'gtk-assistant-commit)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_next_page ()
;;; ----------------------------------------------------------------------------
(defcfun ("gtk_assistant_next_page" gtk-assistant-next-page) :void
#+cl-cffi-gtk-documentation
"@version{2021-11-2}
@argument[assistant]{a @class{gtk-assistant} widget}
@begin{short}
Navigate to the next page.
@end{short}
It is a programming error to call this function when there is no next page.
This function is for use when creating pages with the @code{:custom} value of
the @symbol{gtk-assistant-page-type} enumeration.
@see-class{gtk-assistant}
@see-symbol{gtk-assistant-page-type}
@see-function{gtk-assistant-previous-page}"
(assistant (g-object gtk-assistant)))
(export 'gtk-assistant-next-page)
;;; ----------------------------------------------------------------------------
;;; gtk_assistant_previous_page ()
;;; ----------------------------------------------------------------------------
(defcfun ("gtk_assistant_previous_page" gtk-assistant-previous-page) :void
#+cl-cffi-gtk-documentation
"@version{2021-11-2}
@argument[assistant]{a @class{gtk-assistant} widget}
@begin{short}
Navigate to the previous visited page.
@end{short}
It is a programming error to call this function when no previous page is
available. This function is for use when creating pages with the
@code{:custom} value of the @symbol{gtk-assistant-page-type} enumeration.
@see-class{gtk-assistant}
@see-symbol{gtk-assistant-page-type}
@see-function{gtk-assistant-next-page}"
(assistant (g-object gtk-assistant)))
(export 'gtk-assistant-previous-page)
;;; --- End of file gtk.assistant.lisp -----------------------------------------
| null | https://raw.githubusercontent.com/crategus/cl-cffi-gtk/ba198f7d29cb06de1e8965e1b8a78522d5430516/gtk/gtk.assistant.lisp | lisp | ----------------------------------------------------------------------------
gtk.assistant.lisp
The documentation of this file is taken from the GTK 3 Reference Manual
See <>. The API documentation of the Lisp binding is
This program is free software: you can redistribute it and/or modify
it under the terms of the GNU Lesser General Public License for Lisp
License, or (at your option) any later version and with a preamble to
with Lisp programs and is referred as the LLGPL.
This program is distributed in the hope that it will be useful,
but WITHOUT ANY WARRANTY; without even the implied warranty of
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
General Public License. If not, see </>
and <>.
----------------------------------------------------------------------------
A widget used to guide users through multi-step operations
Types and Values
GtkAssistant
Functions
gtk_assistant_new
gtk_assistant_get_current_page
gtk_assistant_set_current_page
gtk_assistant_get_n_pages
gtk_assistant_get_nth_page
gtk_assistant_prepend_page
gtk_assistant_append_page
gtk_assistant_insert_page
gtk_assistant_remove_page
GtkAssistantPageFunc
gtk_assistant_set_forward_page_func
gtk_assistant_set_page_type
gtk_assistant_get_page_title
gtk_assistant_set_page_header_image deprecated
gtk_assistant_get_page_header_image deprecated
gtk_assistant_set_page_side_image deprecated
gtk_assistant_get_page_side_image deprecated
gtk_assistant_set_page_complete
gtk_assistant_get_page_complete
gtk_assistant_set_page_has_padding
gtk_assistant_get_page_has_padding
gtk_assistant_add_action_widget
gtk_assistant_remove_action_widget
gtk_assistant_update_buttons_state
gtk_assistant_commit
gtk_assistant_next_page
gtk_assistant_previous_page
Properties
gint use-header-bar Read / Write / Construct Only
Child Properties
gboolean has-padding Read / Write
GdkPixbuf* header-image Read / Write
gchar* title Read / Write
Style Properties
gint content-padding Read
gint header-padding Read
Signals
void apply Run Last
void cancel Run Last
void close Run Last
void escape Action
void prepare Run Last
Object Hierarchy
GObject
╰── GInitiallyUnowned
╰── GtkAssistant
Implemented Interfaces
----------------------------------------------------------------------------
----------------------------------------------------------------------------
----------------------------------------------------------------------------
----------------------------------------------------------------------------
----------------------------------------------------------------------------
----------------------------------------------------------------------------
Property and Accessor Details
----------------------------------------------------------------------------
--- gtk-assistant-use-header-bar -------------------------------------------
----------------------------------------------------------------------------
Accessors of the Child Properties
----------------------------------------------------------------------------
--- gtk-assistant-child-complete -------------------------------------------
--- gtk-assistant-child-has-padding ----------------------------------------
--- gtk-assistant-child-header-image ---------------------------------------
not exported
--- gtk-assistant-child-page-type ------------------------------------------
--- gtk-assistant-child-sidebar-image --------------------------------------
not exported
--- gtk-assistant-child-title ----------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_new ()
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_set_current_page () -> gtk-assistant-current-page
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_get_n_pages () -> gtk-assistant-n-pages
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_get_nth_page () -> gtk-assistant-nth-page
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_prepend_page ()
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_append_page ()
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_insert_page ()
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_remove_page ()
----------------------------------------------------------------------------
----------------------------------------------------------------------------
GtkAssistantPageFunc ()
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_set_forward_page_func ()
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_set_page_type ()
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_get_page_title () -> gtk-assistant-page-title
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_set_page_header_image ()
void gtk_assistant_set_page_header_image (GtkAssistant *assistant,
GtkWidget *page,
GdkPixbuf *pixbuf);
Warning
longer shown; add your header decoration to the page content instead.
Sets a header image for page.
assistant :
page :
a page of assistant
pixbuf :
the new header image page
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_get_page_header_image ()
GdkPixbuf * gtk_assistant_get_page_header_image (GtkAssistant *assistant,
GtkWidget *page);
Warning
longer shown; add your header decoration to the page content instead.
Gets the header image for page.
assistant :
page :
a page of assistant
Returns :
the header image for page, or NULL if there's no header image for the
page
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_set_page_side_image ()
GtkWidget *page,
GdkPixbuf *pixbuf);
Warning
not shown anymore.
Sets a side image for page.
This image used to be displayed in the side area of the assistant when page
is the current page.
assistant :
page :
a page of assistant
pixbuf :
the new side image page
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_get_page_side_image ()
GdkPixbuf * gtk_assistant_get_page_side_image (GtkAssistant *assistant,
GtkWidget *page);
Warning
not shown anymore.
Gets the side image for page.
assistant :
page :
a page of assistant
Returns :
the side image for page, or NULL if there's no side image for the page
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_set_page_complete ()
gtk_assistant_get_page_complete () -> gtk-assistant-page-complete
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_set_page_has_padding ()
gtk_assistant_get_page_has_padding () -> gtk-assistant-page-has-padding
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_add_action_widget ()
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_remove_action_widget ()
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_update_buttons_state ()
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_commit ()
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_next_page ()
----------------------------------------------------------------------------
----------------------------------------------------------------------------
gtk_assistant_previous_page ()
----------------------------------------------------------------------------
--- End of file gtk.assistant.lisp ----------------------------------------- | Version 3.24 and modified to document the Lisp binding to the GTK library .
available from < -cffi-gtk/ > .
Copyright ( C ) 2009 - 2011
Copyright ( C ) 2011 - 2021
as published by the Free Software Foundation , either version 3 of the
the GNU Lesser General Public License that clarifies the terms for use
GNU Lesser General Public License for more details .
You should have received a copy of the GNU Lesser General Public
License along with this program and the preamble to the Gnu Lesser
GtkAssistant
GtkAssistantPageType
gtk_assistant_get_page_type
gtk_assistant_set_page_title
gboolean complete Read / Write
GtkAssistantPageType page - type Read / Write
GdkPixbuf * sidebar - image Read / Write
╰ ─ ─
╰ ─ ─ GtkContainer
╰ ─ ─
╰ ─ ─ GtkWindow
GtkAssistant implements AtkImplementorIface and GtkBuildable .
(in-package :gtk)
enum GtkAssistantPageType
(define-g-enum "GtkAssistantPageType" gtk-assistant-page-type
(:export t
:type-initializer "gtk_assistant_page_type_get_type")
(:content 0)
(:intro 1)
(:confirm 2)
(:summary 3)
(:progress 4)
(:custom 5))
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-page-type atdoc:*symbol-name-alias*)
"GEnum"
(gethash 'gtk-assistant-page-type atdoc:*external-symbols*)
"@version{*2021-12-3}
@begin{short}
An enumeration for determining the page role inside the
@class{gtk-assistant} widget. It is used to handle buttons sensitivity and
visibility.
@end{short}
Note that an assistant needs to end its page flow with a page of
@code{:confirm}, @code{:summary} or @code{:progress} type to be correct. The
Cancel button will only be shown if the page is not \"committed\". See the
@fun{gtk-assistant-commit} function for details.
@begin{pre}
(define-g-enum \"GtkAssistantPageType\" gtk-assistant-page-type
(:export t
:type-initializer \"gtk_assistant_page_type_get_type\")
(:content 0)
(:intro 1)
(:confirm 2)
(:summary 3)
(:progress 4)
(:custom 5))
@end{pre}
@begin[code]{table}
@entry[:content]{The page has regular contents. Both the Back and Forward
buttons will be shown.}
@entry[:intro]{The page contains an introduction to the assistant task.
Only the Forward button will be shown if there is a next page.}
@entry[:confirm]{The page lets the user confirm or deny the changes. The
Back and Apply buttons will be shown.}
@entry[:summary]{The page informs the user of the changes done. Only the
Close button will be shown.}
@entry[:progress]{Used for tasks that take a long time to complete, blocks
the assistant until the page is marked as complete. Only the Back button
will be shown.}
@entry[:custom]{Used for when other page types are not appropriate. No
buttons will be shown, and the application must add its own buttons
through the @fun{gtk-assistant-add-action-widget} function.}
@end{table}
@see-class{gtk-assistant}
@see-function{gtk-assistant-commit}
@see-function{gtk-assistant-add-action-widget}")
struct GtkAssistant
(define-g-object-class "GtkAssistant" gtk-assistant
(:superclass gtk-window
:export t
:interfaces ("AtkImplementorIface"
"GtkBuildable")
:type-initializer "gtk_assistant_get_type")
((use-header-bar
gtk-assistant-use-header-bar
"use-header-bar" "gint" t t)))
#+cl-cffi-gtk-documentation
(setf (documentation 'gtk-assistant 'type)
"@version{*2021-11-2}
@begin{short}
A @sym{gtk-assistant} widget is used to represent a generally complex
operation splitted in several steps, guiding the user through its pages and
controlling the page flow to collect the necessary data.
@end{short}
@image[assistant]{}
The design of the @sym{gtk-assistant} widget is that it controls what buttons
to show and to make sensitive, based on what it knows about the page sequence
and the type of each page, in addition to state information like the page
completion and committed status.
If you have a case that does not quite fit in an assistants way of handling
buttons, you can use the @code{:custom} page type of the
@symbol{gtk-assistant-page-type} enumeration and handle buttons yourself.
@begin[GtkAssistant as GtkBuildable]{dictionary}
The @sym{gtk-assistant} implementation of the @class{gtk-buildable}
interface exposes the action area as internal children with the
name @code{\"action_area\"}. To add pages to an assistant in a
@class{gtk-builder} object, simply add it as a @code{<child>} to the
@sym{gtk-assistant} widget and set its child properties as necessary.
@end{dictionary}
@begin[CSS nodes]{dictionary}
The @sym{gtk-assistant} implementation has a single CSS node with the name
@code{assistant}.
@end{dictionary}
@begin[Child Property Details]{dictionary}
@begin[code]{table}
@begin[complete]{entry}
The @code{complete} child property of type @code{:boolean}
(Read / Write) @br{}
Setting to @em{true} marks a page as complete, i.e. all the required
fields are filled out. GTK uses this information to control the
sensitivity of the navigation buttons. @br{}
Default value: @em{false} @br{}
@end{entry}
@begin[has-padding]{entry}
The @code{has-padding} child property of type @code{:boolean}
(Read / Write) @br{}
Whether the assistant adds padding around the page. Since 3.18 @br{}
Default value: @em{true}
@end{entry}
@begin[header-image]{entry}
The @code{header-image} child property of type @class{gdk-pixbuf}
(Read / Write) @br{}
The image used to be displayed in the page header. @br{}
@em{Warning:} The @code{header-image} child property has been deprecated
since version 3.2 and should not be used in newly written code. Since
GTK 3.2, a header is no longer shown. Add your header decoration to the
page content instead.
@end{entry}
@begin[page-type]{entry}
The @code{page-type} child property of type
@symbol{gtk-assistant-page-type} (Read / Write) @br{}
The type of the assistant page. @br{}
Default value: @code{:content}
@end{entry}
@begin[sidebar-image]{entry}
The @code{sidebar-image} child property of type @class{gdk-pixbuf}
(Read / Write) @br{}
The image used to be displayed in the sidebar. @br{}
@em{Warning:} The @code{sidebar-image} child property has been
deprecated since version 3.2 and should not be used in newly written
code. Since GTK 3.2, the sidebar image is no longer shown.
@end{entry}
@begin[title]{entry}
The @code{title} child property of type @code{:string} (Read / Write)
@br{}
The title of the page. @br{}
Default value: @code{nil}
@end{entry}
@end{table}
@end{dictionary}
@begin[Style Property Details]{dictionary}
@begin[code]{table}
@begin[content-padding]{entry}
The @code{content-padding} style property of type @code{:int} (Read)
@br{}
Number of pixels around the content pages. @br{}
@em{Warning:} The @code{content-padding} style property has been
deprecated since version 3.20 and should not be used in newly written
code. This style property is ignored. @br{}
Allowed values: >= 0 @br{}
Default value: 1
@end{entry}
@begin[header-padding]{entry}
The @code{header-padding} style property of type @code{:int} (Read)
@br{}
Number of pixels around the header. @br{}
@em{Warning:} The @code{content-padding} has been deprecated since
version 3.20 and should not be used in newly written code. This style
property is ignored. @br{}
Allowed values: >= 0 @br{}
Default value: 6
@end{entry}
@end{table}
@end{dictionary}
@begin[Signal Details]{dictionary}
@subheading{The \"apply\" signal}
@begin{pre}
lambda (assistant) :run-last
@end{pre}
The signal is emitted when the Apply button is clicked. The default
behavior of the assistant is to switch to the page after the current page,
unless the current page is the last one. A handler for the \"apply\"
signal should carry out the actions for which the wizard has collected
data. If the action takes a long time to complete, you might consider
putting a @code{:progress} page after the @code{:confirm} page and handle
this operation within the \"prepare\" signal of the progress page.
@begin[code]{table}
@entry[assistant]{The @sym{gtk-assistant} widget which received the
signal.}
@end{table}
@subheading{The \"cancel\" signal}
@begin{pre}
lambda (assistant) :run-last
@end{pre}
The signal is emitted when the Cancel button is clicked.
@begin[code]{table}
@entry[assistant]{The @sym{gtk-assistant} widget which received the
signal.}
@end{table}
@subheading{The \"close\" signal}
@begin{pre}
lambda (assistant) :run-last
@end{pre}
The signal is emitted either when the Close button of a summary page is
clicked, or when the Apply button in the last page in the flow is clicked,
which is the @code{:confirm} page.
@begin[code]{table}
@entry[assistant]{The @sym{gtk-assistant} widget which received the
signal.}
@end{table}
@subheading{The \"escape\" signal}
@begin{pre}
lambda (assistant) :action
@end{pre}
No documentation.
@begin[code]{table}
@entry[assistant]{The @sym{gtk-assistant} widget which received the
signal.}
@end{table}
@subheading{The \"prepare\" signal}
@begin{pre}
lambda (assistant page) :run-last
@end{pre}
The signal is emitted when a new page is set as the assistants current
page, before making the new page visible. A handler for this signal can
do any preparations which are necessary before showing the page.
@begin[code]{table}
@entry[assistant]{The @sym{gtk-assistant} widget which received the
signal.}
@entry[page]{The @class{gtk-widget} widget for the current page.}
@end{table}
@end{dictionary}
@see-slot{gtk-assistant-use-header-bar}")
(eval-when (:compile-toplevel :load-toplevel :execute)
(register-object-type "GtkAssistant" 'gtk-assistant))
#+cl-cffi-gtk-documentation
(setf (documentation (atdoc:get-slot-from-name "use-header-bar"
'gtk-assistant) 't)
"The @code{use-header-bar} property of type @code{:int}
(Read / Write / Construct) @br{}
@em{True} if the assistant uses a header bar for action buttons instead of the
action area. For technical reasons, this property is declared as an integer
property, use the value 1 for @em{true} or -1 for @em{false}. @br{}
Allowed values: [-1, 1] @br{}
Default value: -1")
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-use-header-bar atdoc:*function-name-alias*)
"Accessor"
(documentation 'gtk-assistant-use-header-bar 'function)
"@version{2021-10-27}
@syntax[]{(gtk-assistant-use-header-bar object) => setting}
@syntax[]{(setf (gtk-assistant-use-header-bar object) setting)}
@argument[object]{a @class{gtk-assistant} widget}
@argument[setting]{@em{true} if the assistant uses a header bar}
@begin{short}
Accessor of the @slot[gtk-assistant]{use-header-bar} slot of the
@class{gtk-assistant} class.
@end{short}
@em{True} if the assistant uses a header bar for action buttons instead of the
action area. For technical reasons, this property is declared as an integer
property, use the value 1 for @em{true} or -1 for @em{false}.
@see-class{gtk-assistant}
@see-class{gtk-header-bar}")
(define-child-property "GtkAssistant"
gtk-assistant-child-complete
"complete" "gboolean" t t t)
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-child-complete atdoc:*function-name-alias*)
"Accessor"
(documentation 'gtk-assistant-child-complete 'function)
"@version{2021-11-2}
@syntax[]{(gtk-assistant-child-complete container child) => complete}
@syntax[]{(setf (gtk-assistant-child-complete container child) complete)}
@argument[container]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} page of the assistant}
@argument[complete]{a boolean whether the page is complete}
@begin{short}
Accessor of the @code{complete} child property of the @class{gtk-assistant}
class.
@end{short}
Setting the @code{complete} child property to @em{true} marks a page as
complete, i.e. all the required fields are filled out. GTK uses this
information to control the sensitivity of the navigation buttons.
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-page-complete}")
#+gtk-3-18
(define-child-property "GtkAssistant"
gtk-assistant-child-has-padding
"has-padding" "gboolean" t t t)
#+(and gtk-3-18 cl-cffi-gtk-documentation)
(setf (gethash 'gtk-assistant-child-has-padding atdoc:*function-name-alias*)
"Accessor"
(documentation 'gtk-assistant-child-has-padding 'function)
"@version{2021-11-2}
@syntax[]{(gtk-assistant-child-has-padding container child) => setting}
@syntax[]{(setf (gtk-assistant-child-has-padding container child) setting)}
@argument[container]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} page of the assistant}
@argument[setting]{a boolean whether the assistant adds padding around the
page}
@begin{short}
Accessor of the @code{has-padding} child property of the
@class{gtk-assistant} class.
@end{short}
Whether the assistant adds padding around the page.
Since 3.18
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-page-has-padding}")
(define-child-property "GtkAssistant"
gtk-assistant-child-header-image
"header-image" "GdkPixbuf" t t nil)
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-child-header-image atdoc:*function-name-alias*)
"Accessor"
(documentation 'gtk-assistant-child-header-image 'function)
"@version{2021-11-2}
@syntax[]{(gtk-assistant-child-header-image container child) => image}
@syntax[]{(setf (gtk-assistant-child-header-image container child) image)}
@argument[container]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} page of the assistant}
@argument[image]{a @class{gdk-pixbuf} image}
@begin{short}
Accessor of the @code{header-image} child property of the
@class{gtk-assistant} class.
@end{short}
The image used to be displayed in the page header.
@begin[Warning]{dictionary}
The @code{header-image} child property has been deprecated since version 3.2
and should not be used in newly written code. Since GTK 3.2, a header is no
longer shown. Add your header decoration to the page content instead.
@end{dictionary}
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-class{gdk-pixbuf}")
(define-child-property "GtkAssistant"
gtk-assistant-child-page-type
"page-type" "GtkAssistantPageType" t t t)
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-child-page-type atdoc:*function-name-alias*)
"Accessor"
(documentation 'gtk-assistant-child-page-type 'function)
"@version{2021-11-2}
@syntax[]{(gtk-assistant-child-page-type container child) => ptype}
@syntax[]{(setf (gtk-assistant-child-page-type container child) ptype)}
@argument[container]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} page of the assistant}
@argument[ptype]{a value of the @symbol{gtk-assistant-page-type} enumeration}
@begin{short}
Accessor of the @code{page-type} child property of the @class{gtk-assistant}
class.
@end{short}
The page type determines the page behavior in the assistant.
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-symbol{gtk-assistant-page-type}
@see-function{gtk-assistant-child-page-type}")
(define-child-property "GtkAssistant"
gtk-assistant-child-sidebar-image
"sidebar-image" "GdkPixbuf" t t nil)
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-child-sidebar-image atdoc:*function-name-alias*)
"Accessor"
(documentation 'gtk-assistant-child-sidebar-image 'function)
"@version{2021-10-26}
@syntax[]{(gtk-assistant-child-sidebar-image container child) => image}
@syntax[]{(setf (gtk-assistant-child-sidebar-image container child) image)}
@argument[container]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} page of the assistant}
@argument[image]{a @class{gdk-pixbuf} image}
@begin{short}
Accessor of the @code{sidebar-image} child property of the
@class{gtk-assistant} class.
@end{short}
The image used to be displayed in the sidebar.
@begin[Warning]{dictionary}
The @code{sidebar-image} child property has been deprecated since version
3.2 and should not be used in newly written code. Since GTK 3.2, the
sidebar image is no longer shown.
@end{dictionary}
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-class{gdk-pixbuf}")
(define-child-property "GtkAssistant"
gtk-assistant-child-title
"title" "gchararray" t t t)
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-child-title atdoc:*function-name-alias*)
"Accessor"
(documentation 'gtk-assistant-child-title 'function)
"@version{2021-11-2}
@syntax[]{(gtk-assistant-child-title container child) => title}
@syntax[]{(setf (gtk-assistant-child-title container child) title)}
@argument[container]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} page of the assistant}
@argument[title]{a string with the title of the page}
@begin{short}
Accessor of the @code{title} child property of the
@class{gtk-assistant} class.
@end{short}
The title of the page.
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-asssistant-page-title}")
(defun gtk-assistant-new ()
#+cl-cffi-gtk-documentation
"@version{2021-10-26}
@return{A @class{gtk-assistant} widget.}
@begin{short}
Creates a new assistant.
@end{short}
@see-class{gtk-assistant}"
(make-instance 'gtk-assistant))
(export 'gtk-assistant-new)
gtk_assistant_get_current_page ( )
(defun (setf gtk-assistant-current-page) (index assistant)
(foreign-funcall "gtk_assistant_set_current_page"
(g-object gtk-assistant) assistant
:int index
:void)
index)
(defcfun ("gtk_assistant_get_current_page" gtk-assistant-current-page) :int
#+cl-cffi-gtk-documentation
"@version{*2021-11-1}
@syntax[]{(gtk-assistant-current-page assistant) => index}
@syntax[]{(setf (gtk-assistant-current-page assistant) index)}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[index]{an integer with the index of the page to switch to, starting
from 0, if negative, the last page will be used, if greater than the number
of pages in the assistant, nothing will be done}
@begin{short}
Accessor of the current page of the assistant.
@end{short}
The @sym{gtk-assistant-current-page} function returns the page number of the
current page in the assistant. The @sym{(setf gtk-assistant-current-page)}
function switches the page in the assistant to @arg{index}.
Note that this will only be necessary in custom buttons, as the assistant
flow can be set with the @fun{gtk-assistant-set-forward-page-func} function.
@see-class{gtk-assistant}
@see-function{gtk-assistant-set-forward-page-func}"
(assistant (g-object gtk-assistant)))
(export 'gtk-assistant-current-page)
(defcfun ("gtk_assistant_get_n_pages" gtk-assistant-n-pages) :int
#+cl-cffi-gtk-documentation
"@version{*2021-11-1}
@argument[assistant]{a @class{gtk-assistant} widget}
@return{An integer with the number of pages in @arg{assistant}.}
@begin{short}
Returns the number of pages in the assistant.
@end{short}
@see-class{gtk-assistant}"
(assistant (g-object gtk-assistant)))
(export 'gtk-assistant-n-pages)
(defcfun ("gtk_assistant_get_nth_page" gtk-assistant-nth-page)
(g-object gtk-widget)
#+cl-cffi-gtk-documentation
"@version{*2021-11-2}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[index]{an integer with the index of a page in @arg{assistant},
or -1 to get the last page}
@return{The @class{gtk-widget} child widget, or @code{nil} if the @arg{index}
argument is out of bounds.}
@begin{short}
Returns the child widget contained in the assistant with the given page
index.
@end{short}
@see-class{gtk-assistant}
@see-class{gtk-widget}"
(assistant (g-object gtk-assistant))
(index :int))
(export 'gtk-assistant-nth-page)
(defcfun ("gtk_assistant_prepend_page" gtk-assistant-prepend-page) :int
#+cl-cffi-gtk-documentation
"@version{2021-10-26}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[page]{a @class{gtk-widget} page of the assistant}
@return{An integer with the index starting at 0 of the inserted page.}
@begin{short}
Prepends a page to the assistant.
@end{short}
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-append-page}
@see-function{gtk-assistant-insert-page}
@see-function{gtk-assistant-remove-page}"
(assistant (g-object gtk-assistant))
(page (g-object gtk-widget)))
(export 'gtk-assistant-prepend-page)
(defcfun ("gtk_assistant_append_page" gtk-assistant-append-page) :int
#+cl-cffi-gtk-documentation
"@version{*2021-11-1}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[page]{a @class{gtk-widget} page of the assistant}
@return{An integer with the index starting at 0 of the inserted page.}
@begin{short}
Appends a page to the assistant.
@end{short}
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-prepend-page}
@see-function{gtk-assistant-insert-page}
@see-function{gtk-assistant-remove-page}"
(assistant (g-object gtk-assistant))
(page (g-object gtk-widget)))
(export 'gtk-assistant-append-page)
(defcfun ("gtk_assistant_insert_page" gtk-assistant-insert-page) :int
#+cl-cffi-gtk-documentation
"@version{2021-10-26}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[page]{a @class{gtk-widget} page of the assistant}
@argument[position]{an integer with the index starting at 0 at which to
insert @arg{page}, or -1 to append @arg{page} to the assistant}
@return{The index starting from 0 of the inserted page.}
@begin{short}
Inserts a page in the assistant at a given position.
@end{short}
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-append-page}
@see-function{gtk-assistant-prepend-page}
@see-function{gtk-assistant-remove-page}"
(assistant (g-object gtk-assistant))
(page (g-object gtk-widget))
(position :int))
(export 'gtk-assistant-insert-page)
(defcfun ("gtk_assistant_remove_page" gtk-assistant-remove-page) :void
#+cl-cffi-gtk-documentation
"@version{2021-11-1}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[index]{an integer with the index of a page in the assistant, or -1
to remove the last page}
@begin{short}
Removes the page with the given page index from the assistant.
@end{short}
@see-class{gtk-assistant}
@see-function{gtk-assistant-append-page}
@see-function{gtk-assistant-prepend-page}
@see-function{gtk-assistant-insert-page}"
(assistant (g-object gtk-assistant))
(index :int))
(export 'gtk-assistant-remove-page)
(define-cb-methods gtk-assistant-page-func :int ((current-page :int)))
#+cl-cffi-gtk-documentation
(setf (gethash 'gtk-assistant-page-func atdoc:*symbol-name-alias*)
"Callback"
(gethash 'gtk-assistant-page-func atdoc:*external-symbols*)
"@version{2021-10-26}
@begin{short}
A callback function used by the @fun{gtk-assistant-set-forward-page-func}
function to know which is the next page given a current one.
@end{short}
It is called both for computing the next page when the user presses the
Forward button and for handling the behavior of the Last button.
@begin{pre}
lambda (current)
@end{pre}
@begin[code]{table}
@entry[current]{An integer with the page number used to calculate the next
page.}
@entry[Returns]{An integer with the next page number.}
@end{table}
@see-class{gtk-assistant}
@see-function{gtk-assistant-set-forward-page-func}")
(export 'gtk-assistant-page-func)
(defcfun ("gtk_assistant_set_forward_page_func"
%gtk-assistant-set-forward-page-func) :void
(assistant (g-object gtk-assistant))
(func :pointer)
(data :pointer)
(destroy :pointer))
(defun gtk-assistant-set-forward-page-func (assistant func)
#+cl-cffi-gtk-documentation
"@version{2021-10-26}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[func]{a @symbol{gtk-assistant-page-func} page forwarding callback
function, or @code{nil} to use the default one}
@begin{short}
Sets the page forwarding function to be @arg{func}.
@end{short}
This function will be used to determine what will be the next page when the
user presses the Forward button. Setting @arg{func} to @code{nil} will make
the assistant to use the default forward function, which just goes to the next
visible page.
@see-class{gtk-assistant}
@see-symbol{gtk-assistant-page-func}"
(if func
(%gtk-assistant-set-forward-page-func
assistant
(callback gtk-assistant-page-func)
(create-fn-ref assistant func)
(callback gtk-assistant-page-func-destroy-notify))
(%gtk-assistant-set-forward-page-func assistant
(null-pointer)
(null-pointer)
(null-pointer))))
(export 'gtk-assistant-set-forward-page-func)
gtk_assistant_get_page_type ( ) - > gtk - assistant - page - type
(defun (setf gtk-assistant-page-type) (ptype assistant page)
(setf (gtk-assistant-child-page-type assistant page) ptype))
(defun gtk-assistant-page-type (assistant page)
#+cl-cffi-gtk-documentation
"@version{*2021-11-2}
@syntax[]{(gtk-assistant-page-type assistant page) => ptype}
@syntax[]{(setf (gtk-assistant-page-type assistant page) ptype)}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[page]{a @class{gtk-widget} page of @arg{assistant}}
@argument[ptype]{a value of the @symbol{gtk-assistant-page-type} enumeration}
@begin{short}
Accessor of the page type of a page in the assistant.
@end{short}
The page type determines the page behavior in the assistant. The function is
implemented with the @fun{gtk-assistant-child-pack-type} function.
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-symbol{gtk-assistant-page-type}
@see-function{gtk-assistant-child-page-type}"
(gtk-assistant-child-page-type assistant page))
(export 'gtk-assistant-page-type)
gtk_assistant_set_page_title ( )
(defun (setf gtk-assistant-page-title) (title assistant page)
(setf (gtk-assistant-child-title assistant page) title))
(defun gtk-assistant-page-title (assistant page)
#+cl-cffi-gtk-documentation
"@version{*2021-11-2}
@syntax[]{(gtk-assistant-page-title assistant page) => title}
@syntax[]{(setf (gtk-assistant-page-title assistant page) title)}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[page]{a @class{gtk-widget} page of @arg{assistant}}
@argument[title]{a string with the new title for @arg{page}}
@begin{short}
Accessor of the title for the page in the assistant.
@end{short}
The @sym{gtk-assistant-page-title} function gets the title for the page in the
assistant. The @sym{(setf gtk-assistant-page-title)} function sets a title.
The title is displayed in the header area of the assistant when the page is
the current page.
The function is implemented with the @fun{gtk-assistant-child-title} function.
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-child-title}"
(gtk-assistant-child-title assistant page))
(export 'gtk-assistant-page-title)
gtk_assistant_set_page_header_image has been deprecated since version 3.2
and should not be used in newly written code . Since GTK 3.2 , a header is no
a GtkAssistant
Since 2.10
gtk_assistant_get_page_header_image has been deprecated since version 3.2
and should not be used in newly written code . Since GTK 3.2 , a header is no
a GtkAssistant
Since 2.10
void gtk_assistant_set_page_side_image ( GtkAssistant * assistant ,
gtk_assistant_set_page_side_image has been deprecated since version 3.2 and
should not be used in newly written code . Since GTK 3.2 , sidebar images are
a GtkAssistant
Since 2.10
gtk_assistant_get_page_side_image has been deprecated since version 3.2 and
should not be used in newly written code . Since GTK 3.2 , sidebar images are
a GtkAssistant
Since 2.10
(defun (setf gtk-assistant-page-complete) (complete assistant page)
(setf (gtk-assistant-child-complete assistant page) complete))
(defun gtk-assistant-page-complete (assistant page)
#+cl-cffi-gtk-documentation
"@version{*2021-11-2}
@syntax[]{(gtk-assistant-page-complete assistant page) => complete}
@syntax[]{(setf (gtk-assistant-page-complete assistant page) complete)}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[page]{a @class{gtk-widget} page of @arg{assistant}}
@argument[complete]{a boolean with the completeness status of the page}
@begin{short}
Accessor of the completeness status of the page in the assistant.
@end{short}
The @sym{gtk-assistant-page-complete} function gets whether the page is
complete. The @sym{(setf gtk-assistant-page-complete)} function sets whether
the page contents are complete. This will make the assistant update the
buttons state to be able to continue the task.
The function is implemented with the @fun{gtk-assistant-child-complete}
function.
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-child-complete}"
(gtk-assistant-child-complete assistant page))
(export 'gtk-assistant-page-complete)
(defun (setf gtk-assistant-page-has-padding) (setting assistant page)
(setf (gtk-assistant-child-has-padding assistant page) setting))
(defun gtk-assistant-page-has-padding (assistant page)
"@version{2021-11-2}
@syntax[]{(gtk-assistant-page-has-padding assistant page) => setting}
@syntax[]{(setf (gtk-assistant-page-has-padding assistant page) setting)}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[page]{a @class{gtk-widget} page of @arg{assistant}}
@argument[setting]{a boolean whether the page has padding}
@begin{short}
Accessor of the has padding status of the page in the assistant.
@end{short}
The @sym{gtk-assistant-page-has-padding} function gets whether the page has
padding. The @sym{(setf gtk-assistant-page-has-padding)} function sets whether
the assistant is adding padding around the page.
The function is implemented with the @fun{gtk-assistant-child-has-padding}
function.
Since 3.18
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-child-has-padding}"
(gtk-assistant-child-has-padding assistant page))
(export 'gtk-assistant-page-has-padding)
(defcfun ("gtk_assistant_add_action_widget" gtk-assistant-add-action-widget)
:void
#+cl-cffi-gtk-documentation
"@version{2021-11-2}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} child widget}
@begin{short}
Adds a child widget to the action area of the assistant.
@end{short}
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-remove-action-widget}"
(assistant (g-object gtk-assistant))
(child (g-object gtk-widget)))
(export 'gtk-assistant-add-action-widget)
(defcfun ("gtk_assistant_remove_action_widget"
gtk-assistant-remove-action-widget)
:void
#+cl-cffi-gtk-documentation
"@version{2021-11-2}
@argument[assistant]{a @class{gtk-assistant} widget}
@argument[child]{a @class{gtk-widget} child widget}
@begin{short}
Removes a child widget from the action area of the assistant.
@end{short}
@see-class{gtk-assistant}
@see-class{gtk-widget}
@see-function{gtk-assistant-add-action-widget}"
(assistant (g-object gtk-assistant))
(child (g-object gtk-widget)))
(export 'gtk-assistant-remove-action-widget)
(defcfun ("gtk_assistant_update_buttons_state"
gtk-assistant-update-buttons-state) :void
#+cl-cffi-gtk-documentation
"@version{2021-10-26}
@argument[assistant]{a @class{gtk-assistant} widget}
@begin{short}
Forces the assistant to recompute the buttons state.
@end{short}
GTK automatically takes care of this in most situations, e.g. when the user
goes to a different page, or when the visibility or completeness of a page
changes. One situation where it can be necessary to call this function is
when changing a value on the current page affects the future page flow of the
assistant.
@see-class{gtk-assistant}"
(assistant (g-object gtk-assistant)))
(export 'gtk-assistant-update-buttons-state)
(defcfun ("gtk_assistant_commit" gtk-assistant-commit) :void
#+cl-cffi-gtk-documentation
"@version{*2021-11-1}
@argument[assistant]{a @class{gtk-assistant} widget}
@begin{short}
Erases the visited page history so the Back button is not shown on the
current page, and removes the Cancel button from subsequent pages.
@end{short}
Use this when the information provided up to the current page is hereafter
deemed permanent and cannot be modified or undone. For example, showing a
progress page to track a long running, unreversible operation after the user
has clicked the Apply button on a confirmation page.
@see-class{gtk-assistant}"
(assistant (g-object gtk-assistant)))
(export 'gtk-assistant-commit)
(defcfun ("gtk_assistant_next_page" gtk-assistant-next-page) :void
#+cl-cffi-gtk-documentation
"@version{2021-11-2}
@argument[assistant]{a @class{gtk-assistant} widget}
@begin{short}
Navigate to the next page.
@end{short}
It is a programming error to call this function when there is no next page.
This function is for use when creating pages with the @code{:custom} value of
the @symbol{gtk-assistant-page-type} enumeration.
@see-class{gtk-assistant}
@see-symbol{gtk-assistant-page-type}
@see-function{gtk-assistant-previous-page}"
(assistant (g-object gtk-assistant)))
(export 'gtk-assistant-next-page)
(defcfun ("gtk_assistant_previous_page" gtk-assistant-previous-page) :void
#+cl-cffi-gtk-documentation
"@version{2021-11-2}
@argument[assistant]{a @class{gtk-assistant} widget}
@begin{short}
Navigate to the previous visited page.
@end{short}
It is a programming error to call this function when no previous page is
available. This function is for use when creating pages with the
@code{:custom} value of the @symbol{gtk-assistant-page-type} enumeration.
@see-class{gtk-assistant}
@see-symbol{gtk-assistant-page-type}
@see-function{gtk-assistant-next-page}"
(assistant (g-object gtk-assistant)))
(export 'gtk-assistant-previous-page)
|
c4b679b55652a8f146cfc7fcc19de7c496421c9572e375c76dfd6bde5f36ca65 | EFanZh/EOPL-Exercises | exercise-6.8-inlined.rkt | #lang eopl
Exercise 6.8 [ ★ ★ ★ ] Rewrite the interpreter of section 5.4 using a procedural and inlined representation . This is
challenging because we effectively have two observers , apply - cont and apply - handler . As a hint , consider modifying
the recipe on page 6.1 so that we add to each procedure two extra arguments , one representing the behavior of the
continuation under apply - cont and one representing its behavior under apply - handler .
;; Grammar.
(define the-lexical-spec
'([whitespace (whitespace) skip]
[comment ("%" (arbno (not #\newline))) skip]
[identifier (letter (arbno (or letter digit "_" "-" "?"))) symbol]
[number (digit (arbno digit)) number]
[number ("-" digit (arbno digit)) number]))
(define the-grammar
'([program (expression) a-program]
[expression (number) const-exp]
[expression ("-" "(" expression "," expression ")") diff-exp]
[expression ("if" expression "then" expression "else" expression) if-exp]
[expression (identifier) var-exp]
[expression ("proc" "(" identifier ")" expression) proc-exp]
[expression ("(" expression expression ")") call-exp]
[expression ("let" identifier "=" expression "in" expression) let-exp]
[expression ("letrec" identifier "(" identifier ")" "=" expression "in" expression) letrec-exp]
[expression ("list" "(" (separated-list number ",") ")") const-list-exp]
[expression (unary-op "(" expression ")") unop-exp]
[expression ("try" expression "catch" "(" identifier ")" expression) try-exp]
[expression ("raise" expression) raise-exp]
[unary-op ("null?") null?-unop]
[unary-op ("car") car-unop]
[unary-op ("cdr") cdr-unop]
[unary-op ("zero?") zero?-unop]))
(sllgen:make-define-datatypes the-lexical-spec the-grammar)
(define scan&parse (sllgen:make-string-parser the-lexical-spec the-grammar))
;; Data structures.
(define environment?
(list-of (lambda (p)
(and (pair? p)
(symbol? (car p))))))
(define empty-env
(lambda ()
'()))
(define extend-env
(lambda (sym val old-env)
(cons (list sym val) old-env)))
(define extend-env-rec
(lambda (p-name b-var p-body saved-env)
(cons (list p-name b-var p-body)
saved-env)))
(define apply-env
(lambda (env search-sym)
(if (null? env)
(eopl:error 'apply-env "No binding for ~s" search-sym)
(let* ([binding (car env)]
[id (list-ref binding 0)]
[expval-or-bvar (list-ref binding 1)])
(cond [(not (eqv? search-sym id)) (apply-env (cdr env) search-sym)]
[(not (symbol? expval-or-bvar)) expval-or-bvar]
[else (let ([bvar (cadr binding)]
[body (caddr binding)])
(proc-val (procedure bvar body env)))])))))
(define-datatype proc proc?
[procedure [bvar symbol?]
[body expression?]
[env environment?]])
(define-datatype expval expval?
[num-val [value number?]]
[bool-val [boolean boolean?]]
[proc-val [proc proc?]]
[list-val [lst (list-of expval?)]])
(define expval-extractor-error
(lambda (variant value)
(eopl:error 'expval-extractors "Looking for a ~s, found ~s" variant value)))
(define expval->num
(lambda (v)
(cases expval v
[num-val (num) num]
[else (expval-extractor-error 'num v)])))
(define expval->bool
(lambda (v)
(cases expval v
[bool-val (bool) bool]
[else (expval-extractor-error 'bool v)])))
(define expval->proc
(lambda (v)
(cases expval v
[proc-val (proc) proc]
[else (expval-extractor-error 'proc v)])))
(define expval->list
(lambda (v)
(cases expval v
[list-val (lst) lst]
[else (expval-extractor-error 'list v)])))
;; Interpreter.
(define apply-unop
(lambda (unop val)
(cases unary-op unop
[null?-unop () (bool-val (null? (expval->list val)))]
[car-unop () (car (expval->list val))]
[cdr-unop () (list-val (cdr (expval->list val)))]
[zero?-unop () (bool-val (zero? (expval->num val)))])))
(define apply-procedure
(lambda (proc1 arg cont handler)
(cases proc proc1
[procedure (var body saved-env) (value-of/k body (extend-env var arg saved-env) cont handler)])))
(define value-of/k
(lambda (exp env cont handler)
(cases expression exp
[const-exp (num) (cont (num-val num))]
[const-list-exp (nums) (cont (list-val (map num-val nums)))]
[var-exp (var) (cont (apply-env env var))]
[diff-exp (exp1 exp2) (value-of/k exp1
env
(lambda (val1)
(value-of/k exp2
env
(lambda (val)
(let ([n1 (expval->num val1)]
[n2 (expval->num val)])
(cont (num-val (- n1 n2)))))
handler))
handler)]
[unop-exp (unop exp1) (value-of/k exp1
env
(lambda (val)
(cont (apply-unop unop val)))
handler)]
[if-exp (exp1 exp2 exp3) (value-of/k exp1
env
(lambda (val)
(if (expval->bool val)
(value-of/k exp2 env cont handler)
(value-of/k exp3 env cont handler)))
handler)]
[proc-exp (var body) (cont (proc-val (procedure var body env)))]
[call-exp (rator rand) (value-of/k rator
env
(lambda (val1)
(value-of/k rand
env
(lambda (val)
(let ([proc (expval->proc val1)])
(apply-procedure proc val cont handler)))
handler))
handler)]
[let-exp (var exp1 body) (value-of/k (call-exp (proc-exp var body) exp1) env cont handler)]
[letrec-exp (p-name b-var p-body letrec-body) (value-of/k letrec-body
(extend-env-rec p-name b-var p-body env)
cont
handler)]
[try-exp (exp1 var handler-exp) (value-of/k exp1
env
cont
(lambda (val)
(value-of/k handler-exp
(extend-env var val env)
cont
handler)))]
[raise-exp (exp1) (value-of/k exp1
env
(lambda (val)
(handler val))
handler)])))
(define value-of-program
(lambda (pgm)
(cases program pgm
(a-program (body)
(value-of/k body
(empty-env)
(lambda (val)
val)
(lambda (val)
(eopl:error 'apply-handler "uncaught exception!")))))))
Interface .
(define run
(lambda (string)
(value-of-program (scan&parse string))))
(provide bool-val list-val num-val run)
| null | https://raw.githubusercontent.com/EFanZh/EOPL-Exercises/11667f1e84a1a3e300c2182630b56db3e3d9246a/solutions/exercise-6.8-inlined.rkt | racket | Grammar.
Data structures.
Interpreter. | #lang eopl
Exercise 6.8 [ ★ ★ ★ ] Rewrite the interpreter of section 5.4 using a procedural and inlined representation . This is
challenging because we effectively have two observers , apply - cont and apply - handler . As a hint , consider modifying
the recipe on page 6.1 so that we add to each procedure two extra arguments , one representing the behavior of the
continuation under apply - cont and one representing its behavior under apply - handler .
(define the-lexical-spec
'([whitespace (whitespace) skip]
[comment ("%" (arbno (not #\newline))) skip]
[identifier (letter (arbno (or letter digit "_" "-" "?"))) symbol]
[number (digit (arbno digit)) number]
[number ("-" digit (arbno digit)) number]))
(define the-grammar
'([program (expression) a-program]
[expression (number) const-exp]
[expression ("-" "(" expression "," expression ")") diff-exp]
[expression ("if" expression "then" expression "else" expression) if-exp]
[expression (identifier) var-exp]
[expression ("proc" "(" identifier ")" expression) proc-exp]
[expression ("(" expression expression ")") call-exp]
[expression ("let" identifier "=" expression "in" expression) let-exp]
[expression ("letrec" identifier "(" identifier ")" "=" expression "in" expression) letrec-exp]
[expression ("list" "(" (separated-list number ",") ")") const-list-exp]
[expression (unary-op "(" expression ")") unop-exp]
[expression ("try" expression "catch" "(" identifier ")" expression) try-exp]
[expression ("raise" expression) raise-exp]
[unary-op ("null?") null?-unop]
[unary-op ("car") car-unop]
[unary-op ("cdr") cdr-unop]
[unary-op ("zero?") zero?-unop]))
(sllgen:make-define-datatypes the-lexical-spec the-grammar)
(define scan&parse (sllgen:make-string-parser the-lexical-spec the-grammar))
(define environment?
(list-of (lambda (p)
(and (pair? p)
(symbol? (car p))))))
(define empty-env
(lambda ()
'()))
(define extend-env
(lambda (sym val old-env)
(cons (list sym val) old-env)))
(define extend-env-rec
(lambda (p-name b-var p-body saved-env)
(cons (list p-name b-var p-body)
saved-env)))
(define apply-env
(lambda (env search-sym)
(if (null? env)
(eopl:error 'apply-env "No binding for ~s" search-sym)
(let* ([binding (car env)]
[id (list-ref binding 0)]
[expval-or-bvar (list-ref binding 1)])
(cond [(not (eqv? search-sym id)) (apply-env (cdr env) search-sym)]
[(not (symbol? expval-or-bvar)) expval-or-bvar]
[else (let ([bvar (cadr binding)]
[body (caddr binding)])
(proc-val (procedure bvar body env)))])))))
(define-datatype proc proc?
[procedure [bvar symbol?]
[body expression?]
[env environment?]])
(define-datatype expval expval?
[num-val [value number?]]
[bool-val [boolean boolean?]]
[proc-val [proc proc?]]
[list-val [lst (list-of expval?)]])
(define expval-extractor-error
(lambda (variant value)
(eopl:error 'expval-extractors "Looking for a ~s, found ~s" variant value)))
(define expval->num
(lambda (v)
(cases expval v
[num-val (num) num]
[else (expval-extractor-error 'num v)])))
(define expval->bool
(lambda (v)
(cases expval v
[bool-val (bool) bool]
[else (expval-extractor-error 'bool v)])))
(define expval->proc
(lambda (v)
(cases expval v
[proc-val (proc) proc]
[else (expval-extractor-error 'proc v)])))
(define expval->list
(lambda (v)
(cases expval v
[list-val (lst) lst]
[else (expval-extractor-error 'list v)])))
(define apply-unop
(lambda (unop val)
(cases unary-op unop
[null?-unop () (bool-val (null? (expval->list val)))]
[car-unop () (car (expval->list val))]
[cdr-unop () (list-val (cdr (expval->list val)))]
[zero?-unop () (bool-val (zero? (expval->num val)))])))
(define apply-procedure
(lambda (proc1 arg cont handler)
(cases proc proc1
[procedure (var body saved-env) (value-of/k body (extend-env var arg saved-env) cont handler)])))
(define value-of/k
(lambda (exp env cont handler)
(cases expression exp
[const-exp (num) (cont (num-val num))]
[const-list-exp (nums) (cont (list-val (map num-val nums)))]
[var-exp (var) (cont (apply-env env var))]
[diff-exp (exp1 exp2) (value-of/k exp1
env
(lambda (val1)
(value-of/k exp2
env
(lambda (val)
(let ([n1 (expval->num val1)]
[n2 (expval->num val)])
(cont (num-val (- n1 n2)))))
handler))
handler)]
[unop-exp (unop exp1) (value-of/k exp1
env
(lambda (val)
(cont (apply-unop unop val)))
handler)]
[if-exp (exp1 exp2 exp3) (value-of/k exp1
env
(lambda (val)
(if (expval->bool val)
(value-of/k exp2 env cont handler)
(value-of/k exp3 env cont handler)))
handler)]
[proc-exp (var body) (cont (proc-val (procedure var body env)))]
[call-exp (rator rand) (value-of/k rator
env
(lambda (val1)
(value-of/k rand
env
(lambda (val)
(let ([proc (expval->proc val1)])
(apply-procedure proc val cont handler)))
handler))
handler)]
[let-exp (var exp1 body) (value-of/k (call-exp (proc-exp var body) exp1) env cont handler)]
[letrec-exp (p-name b-var p-body letrec-body) (value-of/k letrec-body
(extend-env-rec p-name b-var p-body env)
cont
handler)]
[try-exp (exp1 var handler-exp) (value-of/k exp1
env
cont
(lambda (val)
(value-of/k handler-exp
(extend-env var val env)
cont
handler)))]
[raise-exp (exp1) (value-of/k exp1
env
(lambda (val)
(handler val))
handler)])))
(define value-of-program
(lambda (pgm)
(cases program pgm
(a-program (body)
(value-of/k body
(empty-env)
(lambda (val)
val)
(lambda (val)
(eopl:error 'apply-handler "uncaught exception!")))))))
Interface .
(define run
(lambda (string)
(value-of-program (scan&parse string))))
(provide bool-val list-val num-val run)
|
8e5f601f65879c3252a1772c06d14502d9fea1e7b02a2e9c8da8b9aef1b5e848 | prg-titech/baccaml | opt_mem.mli | open MinCaml
open Asm
open Opt_lib
val remove_rw : int M.t -> string M'.t -> t -> t
val find_remove_candidate : int M.t -> (string * exp) M'.t -> exp M.t -> t -> exp M.t
val remove_unread_write : exp M.t -> t -> t
val const_fold_rw : t -> t
| null | https://raw.githubusercontent.com/prg-titech/baccaml/a3b95e996a995b5004ca897a4b6419edfee590aa/opt/opt_mem.mli | ocaml | open MinCaml
open Asm
open Opt_lib
val remove_rw : int M.t -> string M'.t -> t -> t
val find_remove_candidate : int M.t -> (string * exp) M'.t -> exp M.t -> t -> exp M.t
val remove_unread_write : exp M.t -> t -> t
val const_fold_rw : t -> t
| |
f25e5e6c506fc868e82fe7600eccdde02baa21661e90d4990733ded8048ad646 | clash-lang/clash-compiler | NameInstance.hs | module NameInstance where
import qualified Prelude as P
import Data.List (isInfixOf)
import System.Environment (getArgs)
import System.FilePath ((</>), takeDirectory)
import Clash.Prelude
topEntity :: Bool -> Bool -> (Bool,Bool)
topEntity = suffixName @"after" $ setName @"foo" $ prefixName @"before" f
f :: Bool -> Bool -> (Bool,Bool)
f x y = (y,x)
# NOINLINE f #
-- File content test
assertIn :: String -> String -> IO ()
assertIn needle haystack
| needle `isInfixOf` haystack = return ()
| otherwise = P.error $ P.concat [ "Expected:\n\n ", needle
, "\n\nIn:\n\n", haystack ]
mainSystemVerilog :: IO ()
mainSystemVerilog = do
[topDir] <- getArgs
content <- readFile (topDir </> show 'topEntity </> "topEntity.sv")
assertIn "before_foo_after" content
mainVerilog :: IO ()
mainVerilog = do
[topDir] <- getArgs
content <- readFile (topDir </> show 'topEntity </> "topEntity.v")
assertIn "before_foo_after" content
mainVHDL :: IO ()
mainVHDL = do
[topDir] <- getArgs
content <- readFile (topDir </> show 'topEntity </> "topEntity.vhdl")
assertIn "before_foo_after" content
| null | https://raw.githubusercontent.com/clash-lang/clash-compiler/8e461a910f2f37c900705a0847a9b533bce4d2ea/tests/shouldwork/Basic/NameInstance.hs | haskell | File content test | module NameInstance where
import qualified Prelude as P
import Data.List (isInfixOf)
import System.Environment (getArgs)
import System.FilePath ((</>), takeDirectory)
import Clash.Prelude
topEntity :: Bool -> Bool -> (Bool,Bool)
topEntity = suffixName @"after" $ setName @"foo" $ prefixName @"before" f
f :: Bool -> Bool -> (Bool,Bool)
f x y = (y,x)
# NOINLINE f #
assertIn :: String -> String -> IO ()
assertIn needle haystack
| needle `isInfixOf` haystack = return ()
| otherwise = P.error $ P.concat [ "Expected:\n\n ", needle
, "\n\nIn:\n\n", haystack ]
mainSystemVerilog :: IO ()
mainSystemVerilog = do
[topDir] <- getArgs
content <- readFile (topDir </> show 'topEntity </> "topEntity.sv")
assertIn "before_foo_after" content
mainVerilog :: IO ()
mainVerilog = do
[topDir] <- getArgs
content <- readFile (topDir </> show 'topEntity </> "topEntity.v")
assertIn "before_foo_after" content
mainVHDL :: IO ()
mainVHDL = do
[topDir] <- getArgs
content <- readFile (topDir </> show 'topEntity </> "topEntity.vhdl")
assertIn "before_foo_after" content
|
bdd048e14d2f2c007f1a5ffc983fbd06c11d86d473698b60451534346cd0eb35 | achirkin/vulkan | VK_AMD_buffer_marker.hs | # OPTIONS_GHC -fno - warn - orphans #
# OPTIONS_GHC -fno - warn - unused - imports #
# OPTIONS_HADDOCK not - home #
{-# LANGUAGE CPP #-}
{-# LANGUAGE DataKinds #-}
# LANGUAGE FlexibleInstances #
# LANGUAGE ForeignFunctionInterface #
{-# LANGUAGE MagicHash #-}
{-# LANGUAGE PatternSynonyms #-}
{-# LANGUAGE Strict #-}
{-# LANGUAGE TypeFamilies #-}
{-# LANGUAGE ViewPatterns #-}
module Graphics.Vulkan.Ext.VK_AMD_buffer_marker
* Vulkan extension : @VK_AMD_buffer_marker@
-- |
--
-- supported: @vulkan@
--
-- contact: @Daniel Rakos @drakos-amd@
--
author :
--
-- type: @device@
--
-- Extension number: @180@
VkCmdWriteBufferMarkerAMD, pattern VkCmdWriteBufferMarkerAMD,
HS_vkCmdWriteBufferMarkerAMD, PFN_vkCmdWriteBufferMarkerAMD,
module Graphics.Vulkan.Marshal, AHardwareBuffer(), ANativeWindow(),
CAMetalLayer(), VkBool32(..), VkDeviceAddress(..),
VkDeviceSize(..), VkFlags(..), VkSampleMask(..),
VkPipelineBindPoint(..), VkPipelineCacheHeaderVersion(..),
VkPipelineCreateBitmask(..),
VkPipelineCreationFeedbackBitmaskEXT(..),
VkPipelineExecutableStatisticFormatKHR(..),
VkPipelineStageBitmask(..), VkPipelineCacheCreateBitmask(..),
VkPipelineCacheCreateFlagBits(), VkPipelineCacheCreateFlags(),
VkPipelineCompilerControlBitmaskAMD(..),
VkPipelineCompilerControlFlagBitsAMD(),
VkPipelineCompilerControlFlagsAMD(), VkPipelineCreateFlagBits(),
VkPipelineCreateFlags(), VkPipelineCreationFeedbackFlagBitsEXT(),
VkPipelineCreationFeedbackFlagsEXT(),
VkPipelineShaderStageCreateBitmask(..),
VkPipelineShaderStageCreateFlagBits(),
VkPipelineShaderStageCreateFlags(), VkPipelineStageFlagBits(),
VkPipelineStageFlags(), VkAccelerationStructureKHR,
VkAccelerationStructureKHR_T(), VkAccelerationStructureNV,
VkAccelerationStructureNV_T(), VkBuffer, VkBufferView,
VkBufferView_T(), VkBuffer_T(), VkCommandBuffer,
VkCommandBuffer_T(), VkCommandPool, VkCommandPool_T(),
VkDebugReportCallbackEXT, VkDebugReportCallbackEXT_T(),
VkDebugUtilsMessengerEXT, VkDebugUtilsMessengerEXT_T(),
VkDeferredOperationKHR, VkDeferredOperationKHR_T(),
VkDescriptorPool, VkDescriptorPool_T(), VkDescriptorSet,
VkDescriptorSetLayout, VkDescriptorSetLayout_T(),
VkDescriptorSet_T(), VkDescriptorUpdateTemplate,
VkDescriptorUpdateTemplateKHR, VkDescriptorUpdateTemplateKHR_T(),
VkDescriptorUpdateTemplate_T(), VkDevice, VkDeviceMemory,
VkDeviceMemory_T(), VkDevice_T(), VkDisplayKHR, VkDisplayKHR_T(),
VkDisplayModeKHR, VkDisplayModeKHR_T(), VkEvent, VkEvent_T(),
VkFence, VkFence_T(), VkFramebuffer, VkFramebuffer_T(), VkImage,
VkImageView, VkImageView_T(), VkImage_T(),
VkIndirectCommandsLayoutNV, VkIndirectCommandsLayoutNV_T(),
VkInstance, VkInstance_T(), VkPerformanceConfigurationINTEL,
VkPerformanceConfigurationINTEL_T(), VkPhysicalDevice,
VkPhysicalDevice_T(), VkPipeline, VkPipelineCache,
VkPipelineCache_T(), VkPipelineLayout, VkPipelineLayout_T(),
VkPipeline_T(), VkPrivateDataSlotEXT, VkPrivateDataSlotEXT_T(),
VkQueryPool, VkQueryPool_T(), VkQueue, VkQueue_T(), VkRenderPass,
VkRenderPass_T(), VkSampler, VkSamplerYcbcrConversion,
VkSamplerYcbcrConversionKHR, VkSamplerYcbcrConversionKHR_T(),
VkSamplerYcbcrConversion_T(), VkSampler_T(), VkSemaphore,
VkSemaphore_T(), VkShaderModule, VkShaderModule_T(), VkSurfaceKHR,
VkSurfaceKHR_T(), VkSwapchainKHR, VkSwapchainKHR_T(),
VkValidationCacheEXT, VkValidationCacheEXT_T(),
VK_AMD_BUFFER_MARKER_SPEC_VERSION,
pattern VK_AMD_BUFFER_MARKER_SPEC_VERSION,
VK_AMD_BUFFER_MARKER_EXTENSION_NAME,
pattern VK_AMD_BUFFER_MARKER_EXTENSION_NAME)
where
import GHC.Ptr (Ptr (..))
import Graphics.Vulkan.Marshal
import Graphics.Vulkan.Marshal.Proc (VulkanProc (..))
import Graphics.Vulkan.Types.BaseTypes
import Graphics.Vulkan.Types.Enum.Pipeline
import Graphics.Vulkan.Types.Handles
pattern VkCmdWriteBufferMarkerAMD :: CString
pattern VkCmdWriteBufferMarkerAMD <-
(is_VkCmdWriteBufferMarkerAMD -> True)
where
VkCmdWriteBufferMarkerAMD = _VkCmdWriteBufferMarkerAMD
{-# INLINE _VkCmdWriteBufferMarkerAMD #-}
_VkCmdWriteBufferMarkerAMD :: CString
_VkCmdWriteBufferMarkerAMD = Ptr "vkCmdWriteBufferMarkerAMD\NUL"#
{-# INLINE is_VkCmdWriteBufferMarkerAMD #-}
is_VkCmdWriteBufferMarkerAMD :: CString -> Bool
is_VkCmdWriteBufferMarkerAMD
= (EQ ==) . cmpCStrings _VkCmdWriteBufferMarkerAMD
type VkCmdWriteBufferMarkerAMD = "vkCmdWriteBufferMarkerAMD"
-- | Queues: 'transfer', 'graphics', 'compute'.
--
Renderpass : @both@
--
-- Pipeline: @transfer@
--
> void vkCmdWriteBufferMarkerAMD
> ( VkCommandBuffer commandBuffer
-- > , VkPipelineStageFlagBits pipelineStage
> ,
-- > , VkDeviceSize dstOffset
> , uint32_t marker
-- > )
--
< -extensions/html/vkspec.html#vkCmdWriteBufferMarkerAMD vkCmdWriteBufferMarkerAMD registry at www.khronos.org >
type HS_vkCmdWriteBufferMarkerAMD =
^ commandBuffer
->
VkPipelineStageFlagBits -- ^ pipelineStage
->
VkBuffer -- ^ dstBuffer
^ dstOffset
-> Word32 -- ^ marker
-> IO ()
type PFN_vkCmdWriteBufferMarkerAMD =
FunPtr HS_vkCmdWriteBufferMarkerAMD
foreign import ccall unsafe "dynamic"
unwrapVkCmdWriteBufferMarkerAMDUnsafe ::
PFN_vkCmdWriteBufferMarkerAMD -> HS_vkCmdWriteBufferMarkerAMD
foreign import ccall safe "dynamic"
unwrapVkCmdWriteBufferMarkerAMDSafe ::
PFN_vkCmdWriteBufferMarkerAMD -> HS_vkCmdWriteBufferMarkerAMD
instance VulkanProc "vkCmdWriteBufferMarkerAMD" where
type VkProcType "vkCmdWriteBufferMarkerAMD" =
HS_vkCmdWriteBufferMarkerAMD
vkProcSymbol = _VkCmdWriteBufferMarkerAMD
# INLINE vkProcSymbol #
unwrapVkProcPtrUnsafe = unwrapVkCmdWriteBufferMarkerAMDUnsafe
# INLINE unwrapVkProcPtrUnsafe #
unwrapVkProcPtrSafe = unwrapVkCmdWriteBufferMarkerAMDSafe
# INLINE unwrapVkProcPtrSafe #
pattern VK_AMD_BUFFER_MARKER_SPEC_VERSION :: (Num a, Eq a) => a
pattern VK_AMD_BUFFER_MARKER_SPEC_VERSION = 1
type VK_AMD_BUFFER_MARKER_SPEC_VERSION = 1
pattern VK_AMD_BUFFER_MARKER_EXTENSION_NAME :: CString
pattern VK_AMD_BUFFER_MARKER_EXTENSION_NAME <-
(is_VK_AMD_BUFFER_MARKER_EXTENSION_NAME -> True)
where
VK_AMD_BUFFER_MARKER_EXTENSION_NAME
= _VK_AMD_BUFFER_MARKER_EXTENSION_NAME
# INLINE _ VK_AMD_BUFFER_MARKER_EXTENSION_NAME #
_VK_AMD_BUFFER_MARKER_EXTENSION_NAME :: CString
_VK_AMD_BUFFER_MARKER_EXTENSION_NAME
= Ptr "VK_AMD_buffer_marker\NUL"#
# INLINE is_VK_AMD_BUFFER_MARKER_EXTENSION_NAME #
is_VK_AMD_BUFFER_MARKER_EXTENSION_NAME :: CString -> Bool
is_VK_AMD_BUFFER_MARKER_EXTENSION_NAME
= (EQ ==) . cmpCStrings _VK_AMD_BUFFER_MARKER_EXTENSION_NAME
type VK_AMD_BUFFER_MARKER_EXTENSION_NAME = "VK_AMD_buffer_marker"
| null | https://raw.githubusercontent.com/achirkin/vulkan/b2e0568c71b5135010f4bba939cd8dcf7a05c361/vulkan-api/src-gen/Graphics/Vulkan/Ext/VK_AMD_buffer_marker.hs | haskell | # LANGUAGE CPP #
# LANGUAGE DataKinds #
# LANGUAGE MagicHash #
# LANGUAGE PatternSynonyms #
# LANGUAGE Strict #
# LANGUAGE TypeFamilies #
# LANGUAGE ViewPatterns #
|
supported: @vulkan@
contact: @Daniel Rakos @drakos-amd@
type: @device@
Extension number: @180@
# INLINE _VkCmdWriteBufferMarkerAMD #
# INLINE is_VkCmdWriteBufferMarkerAMD #
| Queues: 'transfer', 'graphics', 'compute'.
Pipeline: @transfer@
> , VkPipelineStageFlagBits pipelineStage
> , VkDeviceSize dstOffset
> )
^ pipelineStage
^ dstBuffer
^ marker | # OPTIONS_GHC -fno - warn - orphans #
# OPTIONS_GHC -fno - warn - unused - imports #
# OPTIONS_HADDOCK not - home #
# LANGUAGE FlexibleInstances #
# LANGUAGE ForeignFunctionInterface #
module Graphics.Vulkan.Ext.VK_AMD_buffer_marker
* Vulkan extension : @VK_AMD_buffer_marker@
author :
VkCmdWriteBufferMarkerAMD, pattern VkCmdWriteBufferMarkerAMD,
HS_vkCmdWriteBufferMarkerAMD, PFN_vkCmdWriteBufferMarkerAMD,
module Graphics.Vulkan.Marshal, AHardwareBuffer(), ANativeWindow(),
CAMetalLayer(), VkBool32(..), VkDeviceAddress(..),
VkDeviceSize(..), VkFlags(..), VkSampleMask(..),
VkPipelineBindPoint(..), VkPipelineCacheHeaderVersion(..),
VkPipelineCreateBitmask(..),
VkPipelineCreationFeedbackBitmaskEXT(..),
VkPipelineExecutableStatisticFormatKHR(..),
VkPipelineStageBitmask(..), VkPipelineCacheCreateBitmask(..),
VkPipelineCacheCreateFlagBits(), VkPipelineCacheCreateFlags(),
VkPipelineCompilerControlBitmaskAMD(..),
VkPipelineCompilerControlFlagBitsAMD(),
VkPipelineCompilerControlFlagsAMD(), VkPipelineCreateFlagBits(),
VkPipelineCreateFlags(), VkPipelineCreationFeedbackFlagBitsEXT(),
VkPipelineCreationFeedbackFlagsEXT(),
VkPipelineShaderStageCreateBitmask(..),
VkPipelineShaderStageCreateFlagBits(),
VkPipelineShaderStageCreateFlags(), VkPipelineStageFlagBits(),
VkPipelineStageFlags(), VkAccelerationStructureKHR,
VkAccelerationStructureKHR_T(), VkAccelerationStructureNV,
VkAccelerationStructureNV_T(), VkBuffer, VkBufferView,
VkBufferView_T(), VkBuffer_T(), VkCommandBuffer,
VkCommandBuffer_T(), VkCommandPool, VkCommandPool_T(),
VkDebugReportCallbackEXT, VkDebugReportCallbackEXT_T(),
VkDebugUtilsMessengerEXT, VkDebugUtilsMessengerEXT_T(),
VkDeferredOperationKHR, VkDeferredOperationKHR_T(),
VkDescriptorPool, VkDescriptorPool_T(), VkDescriptorSet,
VkDescriptorSetLayout, VkDescriptorSetLayout_T(),
VkDescriptorSet_T(), VkDescriptorUpdateTemplate,
VkDescriptorUpdateTemplateKHR, VkDescriptorUpdateTemplateKHR_T(),
VkDescriptorUpdateTemplate_T(), VkDevice, VkDeviceMemory,
VkDeviceMemory_T(), VkDevice_T(), VkDisplayKHR, VkDisplayKHR_T(),
VkDisplayModeKHR, VkDisplayModeKHR_T(), VkEvent, VkEvent_T(),
VkFence, VkFence_T(), VkFramebuffer, VkFramebuffer_T(), VkImage,
VkImageView, VkImageView_T(), VkImage_T(),
VkIndirectCommandsLayoutNV, VkIndirectCommandsLayoutNV_T(),
VkInstance, VkInstance_T(), VkPerformanceConfigurationINTEL,
VkPerformanceConfigurationINTEL_T(), VkPhysicalDevice,
VkPhysicalDevice_T(), VkPipeline, VkPipelineCache,
VkPipelineCache_T(), VkPipelineLayout, VkPipelineLayout_T(),
VkPipeline_T(), VkPrivateDataSlotEXT, VkPrivateDataSlotEXT_T(),
VkQueryPool, VkQueryPool_T(), VkQueue, VkQueue_T(), VkRenderPass,
VkRenderPass_T(), VkSampler, VkSamplerYcbcrConversion,
VkSamplerYcbcrConversionKHR, VkSamplerYcbcrConversionKHR_T(),
VkSamplerYcbcrConversion_T(), VkSampler_T(), VkSemaphore,
VkSemaphore_T(), VkShaderModule, VkShaderModule_T(), VkSurfaceKHR,
VkSurfaceKHR_T(), VkSwapchainKHR, VkSwapchainKHR_T(),
VkValidationCacheEXT, VkValidationCacheEXT_T(),
VK_AMD_BUFFER_MARKER_SPEC_VERSION,
pattern VK_AMD_BUFFER_MARKER_SPEC_VERSION,
VK_AMD_BUFFER_MARKER_EXTENSION_NAME,
pattern VK_AMD_BUFFER_MARKER_EXTENSION_NAME)
where
import GHC.Ptr (Ptr (..))
import Graphics.Vulkan.Marshal
import Graphics.Vulkan.Marshal.Proc (VulkanProc (..))
import Graphics.Vulkan.Types.BaseTypes
import Graphics.Vulkan.Types.Enum.Pipeline
import Graphics.Vulkan.Types.Handles
pattern VkCmdWriteBufferMarkerAMD :: CString
pattern VkCmdWriteBufferMarkerAMD <-
(is_VkCmdWriteBufferMarkerAMD -> True)
where
VkCmdWriteBufferMarkerAMD = _VkCmdWriteBufferMarkerAMD
_VkCmdWriteBufferMarkerAMD :: CString
_VkCmdWriteBufferMarkerAMD = Ptr "vkCmdWriteBufferMarkerAMD\NUL"#
is_VkCmdWriteBufferMarkerAMD :: CString -> Bool
is_VkCmdWriteBufferMarkerAMD
= (EQ ==) . cmpCStrings _VkCmdWriteBufferMarkerAMD
type VkCmdWriteBufferMarkerAMD = "vkCmdWriteBufferMarkerAMD"
Renderpass : @both@
> void vkCmdWriteBufferMarkerAMD
> ( VkCommandBuffer commandBuffer
> ,
> , uint32_t marker
< -extensions/html/vkspec.html#vkCmdWriteBufferMarkerAMD vkCmdWriteBufferMarkerAMD registry at www.khronos.org >
type HS_vkCmdWriteBufferMarkerAMD =
^ commandBuffer
->
->
^ dstOffset
-> IO ()
type PFN_vkCmdWriteBufferMarkerAMD =
FunPtr HS_vkCmdWriteBufferMarkerAMD
foreign import ccall unsafe "dynamic"
unwrapVkCmdWriteBufferMarkerAMDUnsafe ::
PFN_vkCmdWriteBufferMarkerAMD -> HS_vkCmdWriteBufferMarkerAMD
foreign import ccall safe "dynamic"
unwrapVkCmdWriteBufferMarkerAMDSafe ::
PFN_vkCmdWriteBufferMarkerAMD -> HS_vkCmdWriteBufferMarkerAMD
instance VulkanProc "vkCmdWriteBufferMarkerAMD" where
type VkProcType "vkCmdWriteBufferMarkerAMD" =
HS_vkCmdWriteBufferMarkerAMD
vkProcSymbol = _VkCmdWriteBufferMarkerAMD
# INLINE vkProcSymbol #
unwrapVkProcPtrUnsafe = unwrapVkCmdWriteBufferMarkerAMDUnsafe
# INLINE unwrapVkProcPtrUnsafe #
unwrapVkProcPtrSafe = unwrapVkCmdWriteBufferMarkerAMDSafe
# INLINE unwrapVkProcPtrSafe #
pattern VK_AMD_BUFFER_MARKER_SPEC_VERSION :: (Num a, Eq a) => a
pattern VK_AMD_BUFFER_MARKER_SPEC_VERSION = 1
type VK_AMD_BUFFER_MARKER_SPEC_VERSION = 1
pattern VK_AMD_BUFFER_MARKER_EXTENSION_NAME :: CString
pattern VK_AMD_BUFFER_MARKER_EXTENSION_NAME <-
(is_VK_AMD_BUFFER_MARKER_EXTENSION_NAME -> True)
where
VK_AMD_BUFFER_MARKER_EXTENSION_NAME
= _VK_AMD_BUFFER_MARKER_EXTENSION_NAME
# INLINE _ VK_AMD_BUFFER_MARKER_EXTENSION_NAME #
_VK_AMD_BUFFER_MARKER_EXTENSION_NAME :: CString
_VK_AMD_BUFFER_MARKER_EXTENSION_NAME
= Ptr "VK_AMD_buffer_marker\NUL"#
# INLINE is_VK_AMD_BUFFER_MARKER_EXTENSION_NAME #
is_VK_AMD_BUFFER_MARKER_EXTENSION_NAME :: CString -> Bool
is_VK_AMD_BUFFER_MARKER_EXTENSION_NAME
= (EQ ==) . cmpCStrings _VK_AMD_BUFFER_MARKER_EXTENSION_NAME
type VK_AMD_BUFFER_MARKER_EXTENSION_NAME = "VK_AMD_buffer_marker"
|
5052d39033037b3ba19cbc20347366cf1682ac9f152a1e123b6eec4d43abc54a | d-cent/mooncake | feed.clj | (ns mooncake.test.controller.feed
(:require [midje.sweet :refer :all]
[mooncake.controller.feed :as fc]
[mooncake.activity :as a]
[mooncake.test.test-helpers.enlive :as eh]
[mooncake.test.test-helpers.db :as dbh]
[mooncake.db.user :as user]
[mooncake.db.mongo :as mongo]
[mooncake.db.activity :as adb]
[mooncake.config :as config])
(:import (org.bson.types ObjectId)))
(def ten-oclock "2015-01-01T10:00:00.000Z")
(def eleven-oclock "2015-01-01T11:00:00.000Z")
(def twelve-oclock "2015-01-02T12:00:00.000Z")
(def next-day "2015-01-02T12:00:00.000Z")
(def previous-day "2014-12-31T12:00:00.000Z")
(def base-insert-time "564c8f57d4c6d9e63f34c6b")
(fact "feed handler displays activities retrieved from activity sources"
(let [store (dbh/create-in-memory-store)]
(mongo/store! store adb/activity-collection {:actor {:type "Person"
:name "JDog"}
:published ten-oclock
:activity-src "OpenAhjo"
:type "Activity"})
(mongo/store! store adb/activity-collection {:actor {:type "Person"
:name "KCat"}
:published twelve-oclock
:activity-src "objective8"
:type "Activity"})
(fc/feed store {:context
{:activity-sources {:OpenAhjo {:activity-types ["Activity"]}
:objective8 {:activity-types ["Activity"]}}}
:t (constantly "")}) => (every-checker
(eh/check-renders-page :.func--feed-page)
(contains {:body (contains "JDog")})
(contains {:body (contains "KCat")}))))
(fact "feed handler displays username of logged-in user"
(fc/feed (dbh/create-in-memory-store) {:t (constantly "")
:session {:username "Barry"}}) => (contains {:body (contains "Barry")}))
(def activity-src-1--enabled-type {:actor {:type "Person"
:name "Activity source 1: enabled type"}
:published ten-oclock
:activity-src "activity-src-1"
:type "Enabled"
:relInsertTime (ObjectId. (str base-insert-time 1))})
(def activity-src-1--previous-day {:actor {:type "Person"
:name "Activity source 1: previous day"}
:published previous-day
:activity-src "activity-src-1"
:type "Enabled"
:relInsertTime (ObjectId. (str base-insert-time 2))})
(def activity-src-1--disabled-type {:actor {:type "Person"
:name "Activity source 1: disabled type"}
:published eleven-oclock
:activity-src "activity-src-1"
:type "Disabled"
:relInsertTime (ObjectId. (str base-insert-time 3))})
(def activity-src-2--no-preference-type {:actor {:type "Person"
:name "Activity source 2: no preference expressed"}
:published twelve-oclock
:activity-src "activity-src-2"
:type "No-preference"
:relInsertTime (ObjectId. (str base-insert-time 4))})
(facts "about which activities feed handler displays"
(let [store (dbh/create-in-memory-store)
_ (mongo/store! store adb/activity-collection activity-src-1--enabled-type)
_ (mongo/store! store adb/activity-collection activity-src-1--disabled-type)
_ (mongo/store! store adb/activity-collection activity-src-2--no-preference-type)
_ (user/create-user! store ...user-id... ...username...)
_ (user/update-feed-settings! store ...username... {:activity-src-1 {:types [{:id "Enabled" :selected true}
{:id "Disabled" :selected false}]}})
request {:context {:activity-sources {:activity-src-1 {:activity-types ["Enabled" "Disabled"]}
:activity-src-2 {:activity-types ["No-preference"]}}}
:t (constantly "")
:session {:username ...username...}}
response (fc/feed store request)]
(fact "enabled activity types are shown"
(:body response) => (contains "Activity source 1: enabled type"))
(fact "disabled activity types are not shown"
(:body response) =not=> (contains "Activity source 1: disabled type"))
(fact "no-preference activity types are shown"
(:body response) => (contains "Activity source 2: no preference expressed"))
(fact "custom message is not shown when there are activities on the page"
(:body response) =not=> (contains "clj--empty-activity-item"))
(fact "custom message is shown if all activity types are disabled"
(user/update-feed-settings! store ...username... {:activity-src-1 {:types [{:id "Disabled" :selected false}]}})
(let [no-activities-request {:context {:activity-sources {:activity-src-1 {:activity-types ["Disabled"]}}}
:t (constantly "")
:session {:username ...username...}}
no-activities-response (fc/feed store no-activities-request)]
(:body no-activities-response) => (contains "clj--empty-activity-item")))))
(facts "about generating the activity query map"
(let [feed-settings {:activity-src-1 {:types [{:id "Enabled" :selected true}
{:id "Disabled" :selected false}]}
:activity-src-2 {:types [{:id "Disabled" :selected false}]}}
activity-sources {:activity-src-1 {:activity-types ["Enabled" "Disabled" "No-preference"]}
:activity-src-2 {:activity-types ["Disabled"]}
:activity-src-3 {:activity-types ["No-preference"]}}]
(fc/generate-feed-query feed-settings activity-sources) => (just [{:activity-src "activity-src-1"
:type ["Enabled" "No-preference"]}
{:activity-src "activity-src-3"
:type ["No-preference"]}] :in-any-order)))
(facts "about pagination"
(let [store (dbh/create-in-memory-store)
_ (user/create-user! store ...user-id... ...username...)
_ (dbh/create-dummy-activities store (+ 1 config/activities-per-page))
valid-page-number "2"
invalid-page-number "ABC"
too-tiny-of-a-page-number "0"
too-big-of-a-page-number "3"]
(fact "page number is passed in get request"
(let [request {:context {:activity-sources {:test-source {:activity-types ["Create"]}}}
:t (constantly "")
:session {:username ...username...}
:params {:page-number valid-page-number}}
response (fc/feed store request)]
(:body response) => (contains "TestData0")
(:body response) =not=> (contains (str "TestData" config/activities-per-page))))
(fact "empty page number params is passed in get request and defaults to 1"
(let [request {:context {:activity-sources {:test-source {:activity-types ["Create"]}}}
:t (constantly "")
:session {:username ...username...}
:params {}}
response (fc/feed store request)]
(:body response) =not=> (contains "TestData0")
(:body response) => (contains (str "TestData" config/activities-per-page))))
(fact "page number cannot be non-numbers"
(let [request {:context {:activity-sources {:test-source {:activity-types ["Create"]}}}
:t (constantly "")
:session {:username ...username...}
:params {:page-number invalid-page-number}}
response (fc/feed store request)]
(:status response) => nil))
(fact "page number cannot be too small"
(let [request {:context {:activity-sources {:test-source {:activity-types ["Create"]}}}
:t (constantly "")
:session {:username ...username...}
:params {:page-number too-tiny-of-a-page-number}}
response (fc/feed store request)]
(:status response) => nil))
(fact "page number cannot be too big"
(let [request {:context {:activity-sources {:test-source {:activity-types ["Create"]}}}
:t (constantly "")
:session {:username ...username...}
:params {:page-number too-big-of-a-page-number}}
response (fc/feed store request)]
(:status response) => nil))))
(defn request-with-timestamp [timestamp-params]
{:context {:activity-sources {:activity-src-1 {:activity-types ["Enabled" "Disabled"]}
:activity-src-2 {:activity-types ["No-preference"]}}}
:t (constantly "")
:session {:username ...username...}
:params timestamp-params})
(facts "about which activities are retrieved and updated"
(let [store (dbh/create-in-memory-store)
_ (mongo/store! store adb/activity-collection activity-src-1--enabled-type)
_ (mongo/store! store adb/activity-collection activity-src-1--previous-day)
_ (mongo/store! store adb/activity-collection activity-src-1--disabled-type)
_ (mongo/store! store adb/activity-collection activity-src-2--no-preference-type)
_ (user/create-user! store ...user-id... ...username...)
_ (user/update-feed-settings! store ...username... {:activity-src-1 {:types [{:id "Enabled" :selected true}
{:id "Disabled" :selected false}]}})
response-for-retrieving (fc/retrieve-activities-html store (request-with-timestamp {:timestamp-to next-day :insert-id (str base-insert-time 5)}))
response-for-updating (fc/retrieve-activities-html store (request-with-timestamp {:timestamp-from previous-day :insert-id (str base-insert-time 2)}))]
(facts "retrieving older activities"
(fact "enabled activity types are shown"
(:body response-for-retrieving) => (contains "Activity source 1: enabled type"))
(fact "disabled activity types are not shown"
(:body response-for-retrieving) =not=> (contains "Activity source 1: disabled type"))
(fact "no-preference activity types are shown"
(:body response-for-retrieving) => (contains "Activity source 2: no preference expressed")))
(facts "retrieving newer activities"
(fact "enabled activity types are shown"
(:body response-for-updating) => (contains "Activity source 1: enabled type"))
(fact "disabled activity types are not shown"
(:body response-for-updating) =not=> (contains "Activity source 1: disabled type"))
(fact "no-preference activity types are shown"
(:body response-for-updating) => (contains "Activity source 2: no preference expressed"))
(fact "activity with timestamp in query parameter is not shown"
(:body response-for-updating) =not=> (contains "Activity source 1: previous day")))
(facts "error handling"
(let [bad-timestamp "2015-01-0110:00:00.000Z"
bad-timestamp-response (fc/retrieve-activities-html store (request-with-timestamp {:timestamp-to bad-timestamp :insert-id (str base-insert-time 1)}))]
(fact "valid-timestamp? returns whether a timestamp is in the correct format"
(fc/valid-timestamp? next-day) => truthy
(fc/valid-timestamp? bad-timestamp) => falsey)
(fact "invalid format for timestamp returns Bad Request"
(:status bad-timestamp-response) => 400)))))
| null | https://raw.githubusercontent.com/d-cent/mooncake/eb16b7239e7580a73b98f7cdacb324ab4e301f9c/test/mooncake/test/controller/feed.clj | clojure | (ns mooncake.test.controller.feed
(:require [midje.sweet :refer :all]
[mooncake.controller.feed :as fc]
[mooncake.activity :as a]
[mooncake.test.test-helpers.enlive :as eh]
[mooncake.test.test-helpers.db :as dbh]
[mooncake.db.user :as user]
[mooncake.db.mongo :as mongo]
[mooncake.db.activity :as adb]
[mooncake.config :as config])
(:import (org.bson.types ObjectId)))
(def ten-oclock "2015-01-01T10:00:00.000Z")
(def eleven-oclock "2015-01-01T11:00:00.000Z")
(def twelve-oclock "2015-01-02T12:00:00.000Z")
(def next-day "2015-01-02T12:00:00.000Z")
(def previous-day "2014-12-31T12:00:00.000Z")
(def base-insert-time "564c8f57d4c6d9e63f34c6b")
(fact "feed handler displays activities retrieved from activity sources"
(let [store (dbh/create-in-memory-store)]
(mongo/store! store adb/activity-collection {:actor {:type "Person"
:name "JDog"}
:published ten-oclock
:activity-src "OpenAhjo"
:type "Activity"})
(mongo/store! store adb/activity-collection {:actor {:type "Person"
:name "KCat"}
:published twelve-oclock
:activity-src "objective8"
:type "Activity"})
(fc/feed store {:context
{:activity-sources {:OpenAhjo {:activity-types ["Activity"]}
:objective8 {:activity-types ["Activity"]}}}
:t (constantly "")}) => (every-checker
(eh/check-renders-page :.func--feed-page)
(contains {:body (contains "JDog")})
(contains {:body (contains "KCat")}))))
(fact "feed handler displays username of logged-in user"
(fc/feed (dbh/create-in-memory-store) {:t (constantly "")
:session {:username "Barry"}}) => (contains {:body (contains "Barry")}))
(def activity-src-1--enabled-type {:actor {:type "Person"
:name "Activity source 1: enabled type"}
:published ten-oclock
:activity-src "activity-src-1"
:type "Enabled"
:relInsertTime (ObjectId. (str base-insert-time 1))})
(def activity-src-1--previous-day {:actor {:type "Person"
:name "Activity source 1: previous day"}
:published previous-day
:activity-src "activity-src-1"
:type "Enabled"
:relInsertTime (ObjectId. (str base-insert-time 2))})
(def activity-src-1--disabled-type {:actor {:type "Person"
:name "Activity source 1: disabled type"}
:published eleven-oclock
:activity-src "activity-src-1"
:type "Disabled"
:relInsertTime (ObjectId. (str base-insert-time 3))})
(def activity-src-2--no-preference-type {:actor {:type "Person"
:name "Activity source 2: no preference expressed"}
:published twelve-oclock
:activity-src "activity-src-2"
:type "No-preference"
:relInsertTime (ObjectId. (str base-insert-time 4))})
(facts "about which activities feed handler displays"
(let [store (dbh/create-in-memory-store)
_ (mongo/store! store adb/activity-collection activity-src-1--enabled-type)
_ (mongo/store! store adb/activity-collection activity-src-1--disabled-type)
_ (mongo/store! store adb/activity-collection activity-src-2--no-preference-type)
_ (user/create-user! store ...user-id... ...username...)
_ (user/update-feed-settings! store ...username... {:activity-src-1 {:types [{:id "Enabled" :selected true}
{:id "Disabled" :selected false}]}})
request {:context {:activity-sources {:activity-src-1 {:activity-types ["Enabled" "Disabled"]}
:activity-src-2 {:activity-types ["No-preference"]}}}
:t (constantly "")
:session {:username ...username...}}
response (fc/feed store request)]
(fact "enabled activity types are shown"
(:body response) => (contains "Activity source 1: enabled type"))
(fact "disabled activity types are not shown"
(:body response) =not=> (contains "Activity source 1: disabled type"))
(fact "no-preference activity types are shown"
(:body response) => (contains "Activity source 2: no preference expressed"))
(fact "custom message is not shown when there are activities on the page"
(:body response) =not=> (contains "clj--empty-activity-item"))
(fact "custom message is shown if all activity types are disabled"
(user/update-feed-settings! store ...username... {:activity-src-1 {:types [{:id "Disabled" :selected false}]}})
(let [no-activities-request {:context {:activity-sources {:activity-src-1 {:activity-types ["Disabled"]}}}
:t (constantly "")
:session {:username ...username...}}
no-activities-response (fc/feed store no-activities-request)]
(:body no-activities-response) => (contains "clj--empty-activity-item")))))
(facts "about generating the activity query map"
(let [feed-settings {:activity-src-1 {:types [{:id "Enabled" :selected true}
{:id "Disabled" :selected false}]}
:activity-src-2 {:types [{:id "Disabled" :selected false}]}}
activity-sources {:activity-src-1 {:activity-types ["Enabled" "Disabled" "No-preference"]}
:activity-src-2 {:activity-types ["Disabled"]}
:activity-src-3 {:activity-types ["No-preference"]}}]
(fc/generate-feed-query feed-settings activity-sources) => (just [{:activity-src "activity-src-1"
:type ["Enabled" "No-preference"]}
{:activity-src "activity-src-3"
:type ["No-preference"]}] :in-any-order)))
(facts "about pagination"
(let [store (dbh/create-in-memory-store)
_ (user/create-user! store ...user-id... ...username...)
_ (dbh/create-dummy-activities store (+ 1 config/activities-per-page))
valid-page-number "2"
invalid-page-number "ABC"
too-tiny-of-a-page-number "0"
too-big-of-a-page-number "3"]
(fact "page number is passed in get request"
(let [request {:context {:activity-sources {:test-source {:activity-types ["Create"]}}}
:t (constantly "")
:session {:username ...username...}
:params {:page-number valid-page-number}}
response (fc/feed store request)]
(:body response) => (contains "TestData0")
(:body response) =not=> (contains (str "TestData" config/activities-per-page))))
(fact "empty page number params is passed in get request and defaults to 1"
(let [request {:context {:activity-sources {:test-source {:activity-types ["Create"]}}}
:t (constantly "")
:session {:username ...username...}
:params {}}
response (fc/feed store request)]
(:body response) =not=> (contains "TestData0")
(:body response) => (contains (str "TestData" config/activities-per-page))))
(fact "page number cannot be non-numbers"
(let [request {:context {:activity-sources {:test-source {:activity-types ["Create"]}}}
:t (constantly "")
:session {:username ...username...}
:params {:page-number invalid-page-number}}
response (fc/feed store request)]
(:status response) => nil))
(fact "page number cannot be too small"
(let [request {:context {:activity-sources {:test-source {:activity-types ["Create"]}}}
:t (constantly "")
:session {:username ...username...}
:params {:page-number too-tiny-of-a-page-number}}
response (fc/feed store request)]
(:status response) => nil))
(fact "page number cannot be too big"
(let [request {:context {:activity-sources {:test-source {:activity-types ["Create"]}}}
:t (constantly "")
:session {:username ...username...}
:params {:page-number too-big-of-a-page-number}}
response (fc/feed store request)]
(:status response) => nil))))
(defn request-with-timestamp [timestamp-params]
{:context {:activity-sources {:activity-src-1 {:activity-types ["Enabled" "Disabled"]}
:activity-src-2 {:activity-types ["No-preference"]}}}
:t (constantly "")
:session {:username ...username...}
:params timestamp-params})
(facts "about which activities are retrieved and updated"
(let [store (dbh/create-in-memory-store)
_ (mongo/store! store adb/activity-collection activity-src-1--enabled-type)
_ (mongo/store! store adb/activity-collection activity-src-1--previous-day)
_ (mongo/store! store adb/activity-collection activity-src-1--disabled-type)
_ (mongo/store! store adb/activity-collection activity-src-2--no-preference-type)
_ (user/create-user! store ...user-id... ...username...)
_ (user/update-feed-settings! store ...username... {:activity-src-1 {:types [{:id "Enabled" :selected true}
{:id "Disabled" :selected false}]}})
response-for-retrieving (fc/retrieve-activities-html store (request-with-timestamp {:timestamp-to next-day :insert-id (str base-insert-time 5)}))
response-for-updating (fc/retrieve-activities-html store (request-with-timestamp {:timestamp-from previous-day :insert-id (str base-insert-time 2)}))]
(facts "retrieving older activities"
(fact "enabled activity types are shown"
(:body response-for-retrieving) => (contains "Activity source 1: enabled type"))
(fact "disabled activity types are not shown"
(:body response-for-retrieving) =not=> (contains "Activity source 1: disabled type"))
(fact "no-preference activity types are shown"
(:body response-for-retrieving) => (contains "Activity source 2: no preference expressed")))
(facts "retrieving newer activities"
(fact "enabled activity types are shown"
(:body response-for-updating) => (contains "Activity source 1: enabled type"))
(fact "disabled activity types are not shown"
(:body response-for-updating) =not=> (contains "Activity source 1: disabled type"))
(fact "no-preference activity types are shown"
(:body response-for-updating) => (contains "Activity source 2: no preference expressed"))
(fact "activity with timestamp in query parameter is not shown"
(:body response-for-updating) =not=> (contains "Activity source 1: previous day")))
(facts "error handling"
(let [bad-timestamp "2015-01-0110:00:00.000Z"
bad-timestamp-response (fc/retrieve-activities-html store (request-with-timestamp {:timestamp-to bad-timestamp :insert-id (str base-insert-time 1)}))]
(fact "valid-timestamp? returns whether a timestamp is in the correct format"
(fc/valid-timestamp? next-day) => truthy
(fc/valid-timestamp? bad-timestamp) => falsey)
(fact "invalid format for timestamp returns Bad Request"
(:status bad-timestamp-response) => 400)))))
| |
5a9ca64508f2d7bd334ea9546529d39d5c8d6563b7a98873233a20c2320cac37 | spawngrid/htoad | htoad_htoad.erl | -module(htoad_htoad).
-include_lib("htoad/include/htoad.hrl").
-include_lib("htoad/include/toadie.hrl").
-include_lib("htoad/include/stdlib.hrl").
-rules([init]).
init(Engine, #init{}) ->
Engine1 = htoad:assert(Engine, #htoad{
version = vsn()
}),
lager:debug("Initialized htoad_htoad"),
Engine1.
%% private
vsn() ->
{ok, Vsn} = application:get_key(htoad, vsn),
Vsn.
| null | https://raw.githubusercontent.com/spawngrid/htoad/f0c7dfbd911b29fb0c406b7c26606f553af11194/apps/htoad/src/htoad_htoad.erl | erlang | private | -module(htoad_htoad).
-include_lib("htoad/include/htoad.hrl").
-include_lib("htoad/include/toadie.hrl").
-include_lib("htoad/include/stdlib.hrl").
-rules([init]).
init(Engine, #init{}) ->
Engine1 = htoad:assert(Engine, #htoad{
version = vsn()
}),
lager:debug("Initialized htoad_htoad"),
Engine1.
vsn() ->
{ok, Vsn} = application:get_key(htoad, vsn),
Vsn.
|
3a9a8cb2842d2bf8be671fa6e0ac221785809b63db1aeb8bdc4d59f51f214484 | djs55/vhd-tool | xenstore.ml |
* Copyright ( C ) Citrix Systems Inc.
*
* This program is free software ; you can redistribute it and/or modify
* it under the terms of the GNU Lesser General Public License as published
* by the Free Software Foundation ; version 2.1 only . with the special
* exception on linking described in file LICENSE .
*
* This program is distributed in the hope that it will be useful ,
* but WITHOUT ANY WARRANTY ; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE . See the
* GNU Lesser General Public License for more details .
* Copyright (C) Citrix Systems Inc.
*
* This program is free software; you can redistribute it and/or modify
* it under the terms of the GNU Lesser General Public License as published
* by the Free Software Foundation; version 2.1 only. with the special
* exception on linking described in file LICENSE.
*
* This program is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* GNU Lesser General Public License for more details.
*)
let error fmt = Printf.ksprintf (output_string stderr) fmt
module Client = Xs_client_unix.Client(Xs_transport_unix_client)
let make_client () =
try
Client.make ()
with e ->
error "Failed to connect to xenstore. The raw error was: %s" (Printexc.to_string e);
begin match e with
| Unix.Unix_error(Unix.EACCES, _, _) ->
error "Access to xenstore was denied.";
let euid = Unix.geteuid () in
if euid <> 0 then begin
error "My effective uid is %d." euid;
error "Typically xenstore can only be accessed by root (uid 0).";
error "Please switch to root (uid 0) and retry."
end
| Unix.Unix_error(Unix.ECONNREFUSED, _, _) ->
error "Access to xenstore was refused.";
error "This normally indicates that the service is not running.";
error "Please start the xenstore service and retry."
| _ -> ()
end;
raise e
let get_client =
let client = ref None in
fun () -> match !client with
| None ->
let c = make_client () in
client := Some c;
c
| Some c -> c
type domid = int
module Xs = struct
type domid = int
type xsh = {
(*
debug: string list -> string;
*)
directory : string -> string list;
read : string -> string;
(*
readv : string -> string list -> string list;
*)
write : string -> string -> unit;
writev : string -> (string * string) list -> unit;
mkdir : string -> unit;
rm : string -> unit;
getperms : string - > perms ;
: string - > string list - > perms - > unit ;
release : domid - > unit ;
resume : domid - > unit ;
getperms : string -> perms;
setpermsv : string -> string list -> perms -> unit;
release : domid -> unit;
resume : domid -> unit;
*)
setperms : string -> Xs_protocol.ACL.t -> unit;
getdomainpath : domid -> string;
watch : string -> string -> unit;
unwatch : string -> string -> unit;
introduce : domid -> nativeint -> int -> unit;
set_target : domid -> domid -> unit;
}
let ops h = {
read = Client.read h;
directory = Client.directory h;
write = Client.write h;
writev = (fun base_path -> List.iter (fun (k, v) -> Client.write h (base_path ^ "/" ^ k) v));
mkdir = Client.mkdir h;
rm = (fun path -> try Client.rm h path with Xs_protocol.Enoent _ -> ());
setperms = Client.setperms h;
getdomainpath = Client.getdomainpath h;
watch = Client.watch h;
unwatch = Client.unwatch h;
introduce = Client.introduce h;
set_target = Client.set_target h;
}
let with_xs f = Client.immediate (get_client ()) (fun h -> f (ops h))
let wait f = Client.wait (get_client ()) (fun h -> f (ops h))
let transaction _ f = Client.transaction (get_client ()) (fun h -> f (ops h))
end
module Xst = Xs
let with_xs = Xs.with_xs
| null | https://raw.githubusercontent.com/djs55/vhd-tool/ef051aae1b52888c6158a54bacdbaa2bf190679d/src/xenstore.ml | ocaml |
debug: string list -> string;
readv : string -> string list -> string list;
|
* Copyright ( C ) Citrix Systems Inc.
*
* This program is free software ; you can redistribute it and/or modify
* it under the terms of the GNU Lesser General Public License as published
* by the Free Software Foundation ; version 2.1 only . with the special
* exception on linking described in file LICENSE .
*
* This program is distributed in the hope that it will be useful ,
* but WITHOUT ANY WARRANTY ; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE . See the
* GNU Lesser General Public License for more details .
* Copyright (C) Citrix Systems Inc.
*
* This program is free software; you can redistribute it and/or modify
* it under the terms of the GNU Lesser General Public License as published
* by the Free Software Foundation; version 2.1 only. with the special
* exception on linking described in file LICENSE.
*
* This program is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
* GNU Lesser General Public License for more details.
*)
let error fmt = Printf.ksprintf (output_string stderr) fmt
module Client = Xs_client_unix.Client(Xs_transport_unix_client)
let make_client () =
try
Client.make ()
with e ->
error "Failed to connect to xenstore. The raw error was: %s" (Printexc.to_string e);
begin match e with
| Unix.Unix_error(Unix.EACCES, _, _) ->
error "Access to xenstore was denied.";
let euid = Unix.geteuid () in
if euid <> 0 then begin
error "My effective uid is %d." euid;
error "Typically xenstore can only be accessed by root (uid 0).";
error "Please switch to root (uid 0) and retry."
end
| Unix.Unix_error(Unix.ECONNREFUSED, _, _) ->
error "Access to xenstore was refused.";
error "This normally indicates that the service is not running.";
error "Please start the xenstore service and retry."
| _ -> ()
end;
raise e
let get_client =
let client = ref None in
fun () -> match !client with
| None ->
let c = make_client () in
client := Some c;
c
| Some c -> c
type domid = int
module Xs = struct
type domid = int
type xsh = {
directory : string -> string list;
read : string -> string;
write : string -> string -> unit;
writev : string -> (string * string) list -> unit;
mkdir : string -> unit;
rm : string -> unit;
getperms : string - > perms ;
: string - > string list - > perms - > unit ;
release : domid - > unit ;
resume : domid - > unit ;
getperms : string -> perms;
setpermsv : string -> string list -> perms -> unit;
release : domid -> unit;
resume : domid -> unit;
*)
setperms : string -> Xs_protocol.ACL.t -> unit;
getdomainpath : domid -> string;
watch : string -> string -> unit;
unwatch : string -> string -> unit;
introduce : domid -> nativeint -> int -> unit;
set_target : domid -> domid -> unit;
}
let ops h = {
read = Client.read h;
directory = Client.directory h;
write = Client.write h;
writev = (fun base_path -> List.iter (fun (k, v) -> Client.write h (base_path ^ "/" ^ k) v));
mkdir = Client.mkdir h;
rm = (fun path -> try Client.rm h path with Xs_protocol.Enoent _ -> ());
setperms = Client.setperms h;
getdomainpath = Client.getdomainpath h;
watch = Client.watch h;
unwatch = Client.unwatch h;
introduce = Client.introduce h;
set_target = Client.set_target h;
}
let with_xs f = Client.immediate (get_client ()) (fun h -> f (ops h))
let wait f = Client.wait (get_client ()) (fun h -> f (ops h))
let transaction _ f = Client.transaction (get_client ()) (fun h -> f (ops h))
end
module Xst = Xs
let with_xs = Xs.with_xs
|
0158e80cd6451aabd434157922a5d73f7c11e14da3ff12d8db4d7fe11d4bcd7d | erikd/vector-algorithms | Combinators.hs | {-# LANGUAGE Rank2Types, TypeOperators #-}
-- ---------------------------------------------------------------------------
-- |
-- Module : Data.Vector.Algorithms.Combinators
Copyright : ( c ) 2008 - 2010
Maintainer : < >
-- Stability : Experimental
-- Portability : Non-portable (rank-2 types)
--
-- The purpose of this module is to supply various combinators for commonly
-- used idioms for the algorithms in this package. Examples at the time of
-- this writing include running an algorithm keyed on some function of the
-- elements (but only computing said function once per element), and safely
-- applying the algorithms on mutable arrays to immutable arrays.
module Data.Vector.Algorithms.Combinators
(
-- , usingKeys
-- , usingIxKeys
) where
import Prelude hiding (length)
import Control.Monad.ST
import Data.Ord
import Data.Vector.Generic
import qualified Data.Vector.Generic.Mutable as M
import qualified Data.Vector.Generic.New as N
-- | Uses a function to compute a key for each element which the
-- algorithm should use in lieu of the actual element . For instance :
--
-- > usingKeys f arr
--
-- should produce the same results as :
--
-- > ( comparing f ) arr
--
-- the difference being that usingKeys computes each key only once
-- which can be more efficient for expensive key functions .
usingKeys : : ( UA e , UA k , Ord k )
= > ( forall e ' . ( UA e ' ) = > Comparison e ' - > MUArr e ' s - > ST s ( ) )
- > ( e - > k )
- > MUArr e s
- > ST s ( )
usingKeys algo f arr = usingIxKeys algo ( const f ) arr
{ - # INLINE usingKeys #
-- | Uses a function to compute a key for each element which the
-- algorithm should use in lieu of the actual element. For instance:
--
-- > usingKeys sortBy f arr
--
-- should produce the same results as:
--
-- > sortBy (comparing f) arr
--
-- the difference being that usingKeys computes each key only once
-- which can be more efficient for expensive key functions.
usingKeys :: (UA e, UA k, Ord k)
=> (forall e'. (UA e') => Comparison e' -> MUArr e' s -> ST s ())
-> (e -> k)
-> MUArr e s
-> ST s ()
usingKeys algo f arr = usingIxKeys algo (const f) arr
{-# INLINE usingKeys #-}
-- | As usingKeys, only the key function has access to the array index
-- at which each element is stored.
usingIxKeys :: (UA e, UA k, Ord k)
=> (forall e'. (UA e') => Comparison e' -> MUArr e' s -> ST s ())
-> (Int -> e -> k)
-> MUArr e s
-> ST s ()
usingIxKeys algo f arr = do
keys <- newMU (lengthMU arr)
fill len keys
algo (comparing fstS) (unsafeZipMU keys arr)
where
len = lengthMU arr
fill k keys
| k < 0 = return ()
| otherwise = readMU arr k >>= writeMU keys k . f k >> fill (k-1) keys
# INLINE usingIxKeys #
-}
| null | https://raw.githubusercontent.com/erikd/vector-algorithms/d25f05648ebf419a96755eeba7352df6b7f7dd3f/src/Data/Vector/Algorithms/Combinators.hs | haskell | # LANGUAGE Rank2Types, TypeOperators #
---------------------------------------------------------------------------
|
Module : Data.Vector.Algorithms.Combinators
Stability : Experimental
Portability : Non-portable (rank-2 types)
The purpose of this module is to supply various combinators for commonly
used idioms for the algorithms in this package. Examples at the time of
this writing include running an algorithm keyed on some function of the
elements (but only computing said function once per element), and safely
applying the algorithms on mutable arrays to immutable arrays.
, usingKeys
, usingIxKeys
| Uses a function to compute a key for each element which the
algorithm should use in lieu of the actual element . For instance :
> usingKeys f arr
should produce the same results as :
> ( comparing f ) arr
the difference being that usingKeys computes each key only once
which can be more efficient for expensive key functions .
| Uses a function to compute a key for each element which the
algorithm should use in lieu of the actual element. For instance:
> usingKeys sortBy f arr
should produce the same results as:
> sortBy (comparing f) arr
the difference being that usingKeys computes each key only once
which can be more efficient for expensive key functions.
# INLINE usingKeys #
| As usingKeys, only the key function has access to the array index
at which each element is stored. |
Copyright : ( c ) 2008 - 2010
Maintainer : < >
module Data.Vector.Algorithms.Combinators
(
) where
import Prelude hiding (length)
import Control.Monad.ST
import Data.Ord
import Data.Vector.Generic
import qualified Data.Vector.Generic.Mutable as M
import qualified Data.Vector.Generic.New as N
usingKeys : : ( UA e , UA k , Ord k )
= > ( forall e ' . ( UA e ' ) = > Comparison e ' - > MUArr e ' s - > ST s ( ) )
- > ( e - > k )
- > MUArr e s
- > ST s ( )
usingKeys algo f arr = usingIxKeys algo ( const f ) arr
{ - # INLINE usingKeys #
usingKeys :: (UA e, UA k, Ord k)
=> (forall e'. (UA e') => Comparison e' -> MUArr e' s -> ST s ())
-> (e -> k)
-> MUArr e s
-> ST s ()
usingKeys algo f arr = usingIxKeys algo (const f) arr
usingIxKeys :: (UA e, UA k, Ord k)
=> (forall e'. (UA e') => Comparison e' -> MUArr e' s -> ST s ())
-> (Int -> e -> k)
-> MUArr e s
-> ST s ()
usingIxKeys algo f arr = do
keys <- newMU (lengthMU arr)
fill len keys
algo (comparing fstS) (unsafeZipMU keys arr)
where
len = lengthMU arr
fill k keys
| k < 0 = return ()
| otherwise = readMU arr k >>= writeMU keys k . f k >> fill (k-1) keys
# INLINE usingIxKeys #
-}
|
f0c3f07ef8dc498d6937937cf7bb191f2f10ef539cb3525bb7b49ab280380f98 | nilenso/time-tracker | routes.clj | (ns time-tracker.clients.routes
(:require [time-tracker.clients.handlers :as handlers]
[time-tracker.web.middleware :refer [with-rest-middleware]]))
(defn routes []
{"" (with-rest-middleware
{:get handlers/list-all
:post handlers/create})
[:id "/"] (with-rest-middleware
{:put handlers/modify})})
| null | https://raw.githubusercontent.com/nilenso/time-tracker/054d0dc6d6b89a4ed234d8f0b0a260b6deeef9e3/src/clj/time_tracker/clients/routes.clj | clojure | (ns time-tracker.clients.routes
(:require [time-tracker.clients.handlers :as handlers]
[time-tracker.web.middleware :refer [with-rest-middleware]]))
(defn routes []
{"" (with-rest-middleware
{:get handlers/list-all
:post handlers/create})
[:id "/"] (with-rest-middleware
{:put handlers/modify})})
| |
a5898f309f398d7b46eec481231cb034de8997304a28627623034e78161d46f1 | magnusjonsson/opti | expr.ml | type unop =
| Unop_neg
| Unop_abs
type binop =
| Binop_add
| Binop_sub
| Binop_mul
| Binop_div
| Binop_min
| Binop_max
| Binop_le
| Binop_ge
| Binop_lt
| Binop_gt
type expr =
| Expr_const of float
| Expr_ref of string * string list
| Expr_unop of unop * expr
| Expr_binop of binop * expr * expr
| Expr_if of expr * expr * expr
if the two indices are equal , then first expr , else second expr
let map_subscripts_in_expr (f: string -> string) (e: expr)
=
let rec process e =
match e with
| Expr_const _ -> e
| Expr_ref(variable_name,subscripts) -> Expr_ref(variable_name, List.map f subscripts)
| Expr_unop(u, e1) -> Expr_unop(u, process e1)
| Expr_binop(b, e1, e2) -> Expr_binop(b, process e1, process e2)
| Expr_index_eq_ne(i1, i2, e1, e2) -> Expr_index_eq_ne(f i1, f i2, process e1, process e2)
| Expr_if(e1, e2, e3) -> Expr_if(process e1, process e2, process e3)
in
process e
| null | https://raw.githubusercontent.com/magnusjonsson/opti/dffb7b86b81c8059276b038313ddd88d2e9ff67e/lib/expr.ml | ocaml | type unop =
| Unop_neg
| Unop_abs
type binop =
| Binop_add
| Binop_sub
| Binop_mul
| Binop_div
| Binop_min
| Binop_max
| Binop_le
| Binop_ge
| Binop_lt
| Binop_gt
type expr =
| Expr_const of float
| Expr_ref of string * string list
| Expr_unop of unop * expr
| Expr_binop of binop * expr * expr
| Expr_if of expr * expr * expr
if the two indices are equal , then first expr , else second expr
let map_subscripts_in_expr (f: string -> string) (e: expr)
=
let rec process e =
match e with
| Expr_const _ -> e
| Expr_ref(variable_name,subscripts) -> Expr_ref(variable_name, List.map f subscripts)
| Expr_unop(u, e1) -> Expr_unop(u, process e1)
| Expr_binop(b, e1, e2) -> Expr_binop(b, process e1, process e2)
| Expr_index_eq_ne(i1, i2, e1, e2) -> Expr_index_eq_ne(f i1, f i2, process e1, process e2)
| Expr_if(e1, e2, e3) -> Expr_if(process e1, process e2, process e3)
in
process e
| |
88b339c6556ba7304bd0e88b7c5d4934bf36743b4ba8b2f26a10f4375fe0b798 | grapesmoker/cl-sfml | shape.lisp | (in-package :sfml)
SFML implements shapes in a really bizarre way . It asks for you
;; to pass it a callback which it can call upon initialization
;; to get the number of points, followed by a callback which can
;; get a specific point, followed by the actual data of the points.
;; So for now I'm not going to implement the interface to drawing
;; arbitrary shapes, which are likely of limited utility anyway.
;; Still create the top-level class for the shape hierarchy though.
;; Override the accessors for the scale, position, rotation, and origin
;; for semantic convenience.
(defclass shape (entity)
((pointer :initarg :pointer :initform nil :accessor shape-pointer)
(changed-slots :initform '() :accessor shape-changed-slots)
;; type should be one of :convex-shape, :rectangle, or :circle
(type :initarg :type :initform nil :accessor shape-type)
;; origin should store a vector
(origin :accessor shape-origin)
;; position should store a vector
(position :accessor shape-position)
(rotation :accessor shape-rotation)
(scale :accessor shape-scale)
(size :accessor shape-size)
(texture :accessor shape-texture)
(texture-rect :accessor shape-texture-rect)
(point-count :accessor shape-point-count)
;; bounding boxes are rect classes
(local-bbox :reader shape-local-bbox)
(global-bbox :reader shape-global-bbox)
;; this should store a color class
(fill-color :initarg :fill-color
:initform (make-color)
:accessor shape-fill-color)
(outline-color :initarg :outline-color
:initform (make-color)
:accessor shape-outline-color)
(outline-thickness :initarg :outline-thickness
:initform nil
:accessor shape-outline-thickness)))
| null | https://raw.githubusercontent.com/grapesmoker/cl-sfml/3e587b431bbdd23dde2d0031f979d859ac436bca/graphics/shape.lisp | lisp | to pass it a callback which it can call upon initialization
to get the number of points, followed by a callback which can
get a specific point, followed by the actual data of the points.
So for now I'm not going to implement the interface to drawing
arbitrary shapes, which are likely of limited utility anyway.
Still create the top-level class for the shape hierarchy though.
Override the accessors for the scale, position, rotation, and origin
for semantic convenience.
type should be one of :convex-shape, :rectangle, or :circle
origin should store a vector
position should store a vector
bounding boxes are rect classes
this should store a color class | (in-package :sfml)
SFML implements shapes in a really bizarre way . It asks for you
(defclass shape (entity)
((pointer :initarg :pointer :initform nil :accessor shape-pointer)
(changed-slots :initform '() :accessor shape-changed-slots)
(type :initarg :type :initform nil :accessor shape-type)
(origin :accessor shape-origin)
(position :accessor shape-position)
(rotation :accessor shape-rotation)
(scale :accessor shape-scale)
(size :accessor shape-size)
(texture :accessor shape-texture)
(texture-rect :accessor shape-texture-rect)
(point-count :accessor shape-point-count)
(local-bbox :reader shape-local-bbox)
(global-bbox :reader shape-global-bbox)
(fill-color :initarg :fill-color
:initform (make-color)
:accessor shape-fill-color)
(outline-color :initarg :outline-color
:initform (make-color)
:accessor shape-outline-color)
(outline-thickness :initarg :outline-thickness
:initform nil
:accessor shape-outline-thickness)))
|
b5cf97eacecebc4d7e8867b941cda7c82b6f32c73ec47c26e73840ee6fac3c9a | joshvera/effects | Resumable.hs | # LANGUAGE DataKinds , FlexibleContexts , GADTs , LambdaCase , KindSignatures , Rank2Types , TypeOperators #
module Control.Monad.Effect.Resumable
( Resumable(..)
, SomeExc(..)
, throwResumable
, runResumable
, runResumableWith
) where
import Control.DeepSeq
import Control.Monad.Effect.Internal
import Data.Functor.Classes
newtype Resumable exc (m :: * -> *) a = Resumable (exc a)
throwResumable :: (Member (Resumable exc) e, Effectful m) => exc v -> m e v
throwResumable = send . Resumable
runResumable :: (Effectful m, Effects e) => m (Resumable exc ': e) a -> m e (Either (SomeExc exc) a)
runResumable = raiseHandler go
where go (Return a) = pure (Right a)
go (Effect (Resumable e) _) = pure (Left (SomeExc e))
go (Other u k) = liftStatefulHandler (Right ()) (either (pure . Left) runResumable) u k
| Run a ' ' effect in an ' Effectful ' context , using a handler to resume computation .
runResumableWith :: (Effectful m, PureEffects effects) => (forall resume . exc resume -> m effects resume) -> m (Resumable exc ': effects) a -> m effects a
runResumableWith handler = interpret (\ (Resumable e) -> handler e)
data SomeExc exc where
SomeExc :: exc v -> SomeExc exc
instance Eq1 exc => Eq (SomeExc exc) where
SomeExc exc1 == SomeExc exc2 = liftEq (const (const True)) exc1 exc2
instance (Show1 exc) => Show (SomeExc exc) where
showsPrec num (SomeExc exc) = liftShowsPrec (const (const id)) (const id) num exc
instance NFData1 exc => NFData (SomeExc exc) where
rnf (SomeExc exc) = liftRnf (\a -> seq a ()) exc
instance PureEffect (Resumable exc)
instance Effect (Resumable exc) where
handleState c dist (Request (Resumable exc) k) = Request (Resumable exc) (dist . (<$ c) . k)
| null | https://raw.githubusercontent.com/joshvera/effects/b2693454131dc7c00d2cf45bea69c17b986f0ea5/src/Control/Monad/Effect/Resumable.hs | haskell | # LANGUAGE DataKinds , FlexibleContexts , GADTs , LambdaCase , KindSignatures , Rank2Types , TypeOperators #
module Control.Monad.Effect.Resumable
( Resumable(..)
, SomeExc(..)
, throwResumable
, runResumable
, runResumableWith
) where
import Control.DeepSeq
import Control.Monad.Effect.Internal
import Data.Functor.Classes
newtype Resumable exc (m :: * -> *) a = Resumable (exc a)
throwResumable :: (Member (Resumable exc) e, Effectful m) => exc v -> m e v
throwResumable = send . Resumable
runResumable :: (Effectful m, Effects e) => m (Resumable exc ': e) a -> m e (Either (SomeExc exc) a)
runResumable = raiseHandler go
where go (Return a) = pure (Right a)
go (Effect (Resumable e) _) = pure (Left (SomeExc e))
go (Other u k) = liftStatefulHandler (Right ()) (either (pure . Left) runResumable) u k
| Run a ' ' effect in an ' Effectful ' context , using a handler to resume computation .
runResumableWith :: (Effectful m, PureEffects effects) => (forall resume . exc resume -> m effects resume) -> m (Resumable exc ': effects) a -> m effects a
runResumableWith handler = interpret (\ (Resumable e) -> handler e)
data SomeExc exc where
SomeExc :: exc v -> SomeExc exc
instance Eq1 exc => Eq (SomeExc exc) where
SomeExc exc1 == SomeExc exc2 = liftEq (const (const True)) exc1 exc2
instance (Show1 exc) => Show (SomeExc exc) where
showsPrec num (SomeExc exc) = liftShowsPrec (const (const id)) (const id) num exc
instance NFData1 exc => NFData (SomeExc exc) where
rnf (SomeExc exc) = liftRnf (\a -> seq a ()) exc
instance PureEffect (Resumable exc)
instance Effect (Resumable exc) where
handleState c dist (Request (Resumable exc) k) = Request (Resumable exc) (dist . (<$ c) . k)
| |
b2b0df5147827026e934720ef05f06933accb195885fff1cda61007bb5c3fb22 | parapluu/Concuerror | system_instant_delivery.erl | -module(system_instant_delivery).
-compile(export_all).
-concuerror_options_forced([{instant_delivery, true}]).
%%------------------------------------------------------------------------------
scenarios() ->
[ test
].
%%------------------------------------------------------------------------------
%% This test checks that replies from io server can be instant.
test() ->
Fun =
fun() ->
User = erlang:group_leader(),
M = erlang:monitor(process, User),
P = self(),
Command = {put_chars, unicode, io_lib, format, ["Hello world!", []]},
Request = {io_request, P, M, Command},
User ! Request,
receive
{io_reply, M, ok} -> ok
after
0 ->
receive
{io_reply, M, ok} -> ok
end
end,
demonitor(M, [flush]),
spawn(fun() -> P ! ok end),
receive
ok -> ok
after
0 -> ok
end
end,
spawn(Fun),
exit(died_to_show_trace).
| null | https://raw.githubusercontent.com/parapluu/Concuerror/152a5ccee0b6e97d8c3329c2167166435329d261/tests/suites/basic_tests/src/system_instant_delivery.erl | erlang | ------------------------------------------------------------------------------
------------------------------------------------------------------------------
This test checks that replies from io server can be instant. | -module(system_instant_delivery).
-compile(export_all).
-concuerror_options_forced([{instant_delivery, true}]).
scenarios() ->
[ test
].
test() ->
Fun =
fun() ->
User = erlang:group_leader(),
M = erlang:monitor(process, User),
P = self(),
Command = {put_chars, unicode, io_lib, format, ["Hello world!", []]},
Request = {io_request, P, M, Command},
User ! Request,
receive
{io_reply, M, ok} -> ok
after
0 ->
receive
{io_reply, M, ok} -> ok
end
end,
demonitor(M, [flush]),
spawn(fun() -> P ! ok end),
receive
ok -> ok
after
0 -> ok
end
end,
spawn(Fun),
exit(died_to_show_trace).
|
1b299e1b4ea81ecb07f7df3e38058187bd3d7ff51ab6f24dc5a2790c0758075b | mvaldesdeleon/aoc18 | Day25.hs | # LANGUAGE TemplateHaskell #
module Day25
( day25
) where
import Control.Lens
import Data.List ((\\))
import qualified Data.Map.Strict as M
import Data.Maybe (fromMaybe)
import qualified Data.Set as S
import Paths_aoc18 (getDataFileName)
import Text.Parsec (Parsec, char, digit, many1, newline, option,
parse, sepBy1)
data Point = Point
{ _x :: Integer
, _y :: Integer
, _z :: Integer
, _t :: Integer
} deriving (Show, Eq, Ord)
makeLenses ''Point
distance :: Point -> Point -> Integer
distance pa pb =
abs (pb ^. x - pa ^. x) + abs (pb ^. y - pa ^. y) + abs (pb ^. z - pa ^. z) +
abs (pb ^. t - pa ^. t)
parsePoint :: Parsec String () Point
parsePoint =
Point <$> number <* char ',' <*> number <* char ',' <*> number <* char ',' <*>
number
where
number = read <$> ((:) <$> option ' ' (char '-') <*> many1 digit)
parseInput :: String -> [Point]
parseInput input =
case parse (parsePoint `sepBy1` newline) "" input of
Left e -> error $ show e
Right ps -> ps
loadInput :: IO String
loadInput = getDataFileName "inputs/day-25.txt" >>= readFile
type Graph = M.Map Point [Point]
constellations :: [Point] -> [[Point]]
constellations ps = buildConstellations [] (S.fromList ps)
where
graph = foldl addPoint M.empty ps
addPoint gr p = foldl (addNeighbor p) gr ps
addNeighbor p gr np =
if distance p np <= 3
then M.insertWith (++) p [np] gr
else gr
buildConstellations :: [[Point]] -> S.Set Point -> [[Point]]
buildConstellations cs s =
if S.null s
then cs
else let c = nextConstellation s
in buildConstellations
(c : cs)
(S.difference s (S.fromList c))
nextConstellation :: S.Set Point -> [Point]
nextConstellation s =
let p = S.findMin s
in bfs [] [p]
bfs :: [Point] -> [Point] -> [Point]
bfs rs st =
if null st
then rs
else let (s:ss) = st
in bfs (s : rs)
(ss ++ (fromMaybe [] (s `M.lookup` graph) \\ rs))
day25 :: IO ()
day25 = do
input <- parseInput <$> loadInput
print $ length . constellations $ input
| null | https://raw.githubusercontent.com/mvaldesdeleon/aoc18/1a6f6de7c482e5de264360e36f97a3c7487e2457/src/Day25.hs | haskell | # LANGUAGE TemplateHaskell #
module Day25
( day25
) where
import Control.Lens
import Data.List ((\\))
import qualified Data.Map.Strict as M
import Data.Maybe (fromMaybe)
import qualified Data.Set as S
import Paths_aoc18 (getDataFileName)
import Text.Parsec (Parsec, char, digit, many1, newline, option,
parse, sepBy1)
data Point = Point
{ _x :: Integer
, _y :: Integer
, _z :: Integer
, _t :: Integer
} deriving (Show, Eq, Ord)
makeLenses ''Point
distance :: Point -> Point -> Integer
distance pa pb =
abs (pb ^. x - pa ^. x) + abs (pb ^. y - pa ^. y) + abs (pb ^. z - pa ^. z) +
abs (pb ^. t - pa ^. t)
parsePoint :: Parsec String () Point
parsePoint =
Point <$> number <* char ',' <*> number <* char ',' <*> number <* char ',' <*>
number
where
number = read <$> ((:) <$> option ' ' (char '-') <*> many1 digit)
parseInput :: String -> [Point]
parseInput input =
case parse (parsePoint `sepBy1` newline) "" input of
Left e -> error $ show e
Right ps -> ps
loadInput :: IO String
loadInput = getDataFileName "inputs/day-25.txt" >>= readFile
type Graph = M.Map Point [Point]
constellations :: [Point] -> [[Point]]
constellations ps = buildConstellations [] (S.fromList ps)
where
graph = foldl addPoint M.empty ps
addPoint gr p = foldl (addNeighbor p) gr ps
addNeighbor p gr np =
if distance p np <= 3
then M.insertWith (++) p [np] gr
else gr
buildConstellations :: [[Point]] -> S.Set Point -> [[Point]]
buildConstellations cs s =
if S.null s
then cs
else let c = nextConstellation s
in buildConstellations
(c : cs)
(S.difference s (S.fromList c))
nextConstellation :: S.Set Point -> [Point]
nextConstellation s =
let p = S.findMin s
in bfs [] [p]
bfs :: [Point] -> [Point] -> [Point]
bfs rs st =
if null st
then rs
else let (s:ss) = st
in bfs (s : rs)
(ss ++ (fromMaybe [] (s `M.lookup` graph) \\ rs))
day25 :: IO ()
day25 = do
input <- parseInput <$> loadInput
print $ length . constellations $ input
| |
44539d6edf2192a1e41783a486f545a46f4726c2468fbd95cbdfd2df339b0bed | pavlobaron/ErlangOTPBookSamples | strict.erl | -module(strict).
-export([strict_eval/1, print/0]).
print() ->
io:format("I have been called, but what for?..").
strict_eval(X) ->
5.
| null | https://raw.githubusercontent.com/pavlobaron/ErlangOTPBookSamples/50094964ad814932760174914490e49618b2b8c2/sprache/strict.erl | erlang | -module(strict).
-export([strict_eval/1, print/0]).
print() ->
io:format("I have been called, but what for?..").
strict_eval(X) ->
5.
| |
87283845a6aa94d706bff027c20de7d717ed1a49a3883606573dc4a52e8e03df | swarmpit/swarmpit | outbound.clj | (ns swarmpit.docker.engine.mapper.outbound
"Map swarmpit domain to docker domain"
(:require [clojure.string :as str]
[swarmpit.docker.engine.mapper.inbound :as mi]
[swarmpit.utils :refer [name-value->map ->nano as-bytes]]))
(defn ->auth-config
"Pass registry or dockeruser entity"
[auth-entity]
(when (some? auth-entity)
{:username (:username auth-entity)
:password (:password auth-entity)
:serveraddress (:url auth-entity)}))
(defn ->service-mode
[service]
(if (= (:mode service) "global")
{:Global {}}
{:Replicated
{:Replicas (:replicas service)}}))
(defn ->service-ports
[service]
(->> (:ports service)
(filter #(and (some? (:containerPort %))
(some? (:hostPort %))
(> (:containerPort %) 0)
(> (:hostPort %) 0)))
(map (fn [p] {:Protocol (:protocol p)
:PublishMode (:mode p)
:PublishedPort (:hostPort p)
:TargetPort (:containerPort p)}))
(into [])))
(defn- ->service-networks
[service]
(->> (:networks service)
(map #(hash-map :Target (:networkName %)
:Aliases (:serviceAliases %)))
(into [])))
(defn ->service-hosts
[service]
(->> (:hosts service)
(filter #(not (and (str/blank? (:name %))
(str/blank? (:value %)))))
(map (fn [p] (str (:value p) " " (:name p))))
(into [])))
(defn ->service-variables
[service]
(->> (:variables service)
(filter #(not (and (str/blank? (:name %))
(str/blank? (:value %)))))
(map (fn [p] (str (:name p) "=" (:value p))))
(into [])))
(defn ->service-labels
[service]
(->> (:labels service)
(filter #(not (and (str/blank? (:name %))
(str/blank? (:value %)))))
(name-value->map)))
(defn ->service-container-labels
[service]
(->> (:containerLabels service)
(name-value->map)))
(defn ->service-log-options
[service]
(->> (get-in service [:logdriver :opts])
(filter #(not (and (str/blank? (:name %))
(str/blank? (:value %)))))
(name-value->map)))
(defn ->service-volume-options
[service-volume]
(when (some? service-volume)
{:Labels (:labels service-volume)
:DriverConfig {:Name (get-in service-volume [:driver :name])
:Options (name-value->map (get-in service-volume [:driver :options]))}}))
(defn ->service-mounts
[service]
(->> (:mounts service)
(map (fn [v] {:ReadOnly (:readOnly v)
:Source (:host v)
:Target (:containerPath v)
:Type (:type v)
:VolumeOptions (->service-volume-options (:volumeOptions v))}))
(into [])))
(defn- ->service-placement-contraints
[service]
(->> (get-in service [:deployment :placement])
(map (fn [p] (:rule p)))
(into [])))
(defn- ->secret-id
[secret-name secrets]
(->> secrets
(filter #(= secret-name (:secretName %)))
(first)
:id))
(defn ->secret-target
[secret]
(let [secret-target (:secretTarget secret)]
(if (str/blank? secret-target)
(:secretName secret)
secret-target)))
(defn ->service-secrets
[service secrets]
(->> (:secrets service)
(map (fn [s] {:SecretName (:secretName s)
:SecretID (->secret-id (:secretName s) secrets)
:File {:GID "0"
:Mode 292
:Name (->secret-target s)
:UID "0"}}))
(into [])))
(defn- ->config-id
[config-name configs]
(->> configs
(filter #(= config-name (:configName %)))
(first)
:id))
(defn ->config-target
[config]
(let [config-target (:configTarget config)]
(if (str/blank? config-target)
(:configName config)
config-target)))
(defn ->service-configs
[service configs]
(->> (:configs service)
(map (fn [c] {:ConfigName (:configName c)
:ConfigID (->config-id (:configName c) configs)
:File {:GID "0"
:Mode 292
:Name (->config-target c)
:UID "0"}}))
(into [])))
(defn ->service-resource
[service-resource]
(let [cpu (:cpu service-resource)
memory (:memory service-resource)]
{:NanoCPUs (when (some? cpu)
(-> cpu
(->nano)
(long)))
:MemoryBytes (when (some? memory)
(as-bytes memory))}))
(defn ->service-update-config
[service]
(let [update (get-in service [:deployment :update])]
{:Parallelism (:parallelism update)
:Delay (->nano (:delay update))
:Order (:order update)
:FailureAction (:failureAction update)}))
(defn ->service-rollback-config
[service]
(let [rollback (get-in service [:deployment :rollback])]
{:Parallelism (:parallelism rollback)
:Delay (->nano (:delay rollback))
:Order (:order rollback)
:FailureAction (:failureAction rollback)}))
(defn ->service-restart-policy
[service]
(let [policy (get-in service [:deployment :restartPolicy])]
{:Condition (:condition policy)
:Delay (->nano (:delay policy))
:Window (->nano (:window policy))
:MaxAttempts (:attempts policy)}))
(defn ->service-healthcheck
[service-healthcheck]
(when service-healthcheck
{:Test (:test service-healthcheck)
:Interval (->nano (:interval service-healthcheck))
:Timeout (->nano (:timeout service-healthcheck))
:Retries (:retries service-healthcheck)}))
(defn ->service-image
[service digest?]
(let [repository (get-in service [:repository :name])
tag (get-in service [:repository :tag])
digest (get-in service [:repository :imageDigest])]
(if digest?
(str repository ":" tag "@" digest)
(str repository ":" tag))))
(defn ->service-links
[service]
(->> (:links service)
(map #(hash-map (keyword (str mi/link-label (:name %))) (:value %)))
(into {})))
(defn ->service-metadata
[service image]
(let [autoredeploy (get-in service [:deployment :autoredeploy])
agent (:agent service)
stack (:stack service)
immutable (:immutable service)
links (:links service)]
(merge {}
(when (some? stack)
{:com.docker.stack.namespace stack
:com.docker.stack.image image})
(when (some? autoredeploy)
{mi/autoredeploy-label (str autoredeploy)})
(when (some? agent)
{mi/agent-label (str agent)})
(when (some? immutable)
{mi/immutable-label (str immutable)})
(when (not-empty links)
(->service-links service)))))
(defn ->service-container-metadata
[service]
(let [stack (:stack service)]
(merge {}
(when (some? stack)
{:com.docker.stack.namespace stack}))))
(defn ->service
[service]
{:Name (:serviceName service)
:Labels (merge
(->service-labels service)
(->service-metadata service (->service-image service false)))
:TaskTemplate {:ContainerSpec {:Image (->service-image service true)
:Labels (merge
(->service-container-labels service)
(->service-container-metadata service))
:Mounts (->service-mounts service)
:Secrets (:secrets service)
:Configs (:configs service)
:Args (:command service)
:TTY (:tty service)
:Healthcheck (->service-healthcheck (:healthcheck service))
:Env (->service-variables service)
:Hosts (->service-hosts service)}
:LogDriver {:Name (get-in service [:logdriver :name])
:Options (->service-log-options service)}
:Resources {:Limits (->service-resource (get-in service [:resources :limit]))
:Reservations (->service-resource (get-in service [:resources :reservation]))}
:RestartPolicy (->service-restart-policy service)
:Placement {:Constraints (->service-placement-contraints service)}
:ForceUpdate (get-in service [:deployment :forceUpdate])
:Networks (->service-networks service)}
:Mode (->service-mode service)
:UpdateConfig (->service-update-config service)
:RollbackConfig (->service-rollback-config service)
:EndpointSpec {:Ports (->service-ports service)}})
(defn ->network-ipam-config
[network]
(let [ipam (:ipam network)
gateway (:gateway ipam)
subnet (:subnet ipam)]
(if (not (str/blank? subnet))
{:Config [{:Subnet subnet
:Gateway gateway}]}
{:Config []})))
(defn ->network
[network]
{:Name (:networkName network)
:Driver (:driver network)
:Internal (:internal network)
:Options (name-value->map (:options network))
:Attachable (:attachable network)
:Ingress (:ingress network)
:EnableIPv6 (:enableIPv6 network)
:IPAM (merge {:Driver "default"}
(->network-ipam-config network))})
(defn ->volume
[volume]
{:Name (:volumeName volume)
:Driver (:driver volume)
:DriverOpts (name-value->map (:options volume))
:Labels (:labels volume)})
(defn ->secret
[secret]
{:Name (:secretName secret)
:Data (:data secret)})
(defn ->config
[config]
{:Name (:configName config)
:Data (:data config)})
(defn ->node
[node]
{:Availability (:availability node)
:Role (:role node)
:Labels (name-value->map (:labels node))})
| null | https://raw.githubusercontent.com/swarmpit/swarmpit/38ffbe08e717d8620bf433c99f2e85a9e5984c32/src/clj/swarmpit/docker/engine/mapper/outbound.clj | clojure | (ns swarmpit.docker.engine.mapper.outbound
"Map swarmpit domain to docker domain"
(:require [clojure.string :as str]
[swarmpit.docker.engine.mapper.inbound :as mi]
[swarmpit.utils :refer [name-value->map ->nano as-bytes]]))
(defn ->auth-config
"Pass registry or dockeruser entity"
[auth-entity]
(when (some? auth-entity)
{:username (:username auth-entity)
:password (:password auth-entity)
:serveraddress (:url auth-entity)}))
(defn ->service-mode
[service]
(if (= (:mode service) "global")
{:Global {}}
{:Replicated
{:Replicas (:replicas service)}}))
(defn ->service-ports
[service]
(->> (:ports service)
(filter #(and (some? (:containerPort %))
(some? (:hostPort %))
(> (:containerPort %) 0)
(> (:hostPort %) 0)))
(map (fn [p] {:Protocol (:protocol p)
:PublishMode (:mode p)
:PublishedPort (:hostPort p)
:TargetPort (:containerPort p)}))
(into [])))
(defn- ->service-networks
[service]
(->> (:networks service)
(map #(hash-map :Target (:networkName %)
:Aliases (:serviceAliases %)))
(into [])))
(defn ->service-hosts
[service]
(->> (:hosts service)
(filter #(not (and (str/blank? (:name %))
(str/blank? (:value %)))))
(map (fn [p] (str (:value p) " " (:name p))))
(into [])))
(defn ->service-variables
[service]
(->> (:variables service)
(filter #(not (and (str/blank? (:name %))
(str/blank? (:value %)))))
(map (fn [p] (str (:name p) "=" (:value p))))
(into [])))
(defn ->service-labels
[service]
(->> (:labels service)
(filter #(not (and (str/blank? (:name %))
(str/blank? (:value %)))))
(name-value->map)))
(defn ->service-container-labels
[service]
(->> (:containerLabels service)
(name-value->map)))
(defn ->service-log-options
[service]
(->> (get-in service [:logdriver :opts])
(filter #(not (and (str/blank? (:name %))
(str/blank? (:value %)))))
(name-value->map)))
(defn ->service-volume-options
[service-volume]
(when (some? service-volume)
{:Labels (:labels service-volume)
:DriverConfig {:Name (get-in service-volume [:driver :name])
:Options (name-value->map (get-in service-volume [:driver :options]))}}))
(defn ->service-mounts
[service]
(->> (:mounts service)
(map (fn [v] {:ReadOnly (:readOnly v)
:Source (:host v)
:Target (:containerPath v)
:Type (:type v)
:VolumeOptions (->service-volume-options (:volumeOptions v))}))
(into [])))
(defn- ->service-placement-contraints
[service]
(->> (get-in service [:deployment :placement])
(map (fn [p] (:rule p)))
(into [])))
(defn- ->secret-id
[secret-name secrets]
(->> secrets
(filter #(= secret-name (:secretName %)))
(first)
:id))
(defn ->secret-target
[secret]
(let [secret-target (:secretTarget secret)]
(if (str/blank? secret-target)
(:secretName secret)
secret-target)))
(defn ->service-secrets
[service secrets]
(->> (:secrets service)
(map (fn [s] {:SecretName (:secretName s)
:SecretID (->secret-id (:secretName s) secrets)
:File {:GID "0"
:Mode 292
:Name (->secret-target s)
:UID "0"}}))
(into [])))
(defn- ->config-id
[config-name configs]
(->> configs
(filter #(= config-name (:configName %)))
(first)
:id))
(defn ->config-target
[config]
(let [config-target (:configTarget config)]
(if (str/blank? config-target)
(:configName config)
config-target)))
(defn ->service-configs
[service configs]
(->> (:configs service)
(map (fn [c] {:ConfigName (:configName c)
:ConfigID (->config-id (:configName c) configs)
:File {:GID "0"
:Mode 292
:Name (->config-target c)
:UID "0"}}))
(into [])))
(defn ->service-resource
[service-resource]
(let [cpu (:cpu service-resource)
memory (:memory service-resource)]
{:NanoCPUs (when (some? cpu)
(-> cpu
(->nano)
(long)))
:MemoryBytes (when (some? memory)
(as-bytes memory))}))
(defn ->service-update-config
[service]
(let [update (get-in service [:deployment :update])]
{:Parallelism (:parallelism update)
:Delay (->nano (:delay update))
:Order (:order update)
:FailureAction (:failureAction update)}))
(defn ->service-rollback-config
[service]
(let [rollback (get-in service [:deployment :rollback])]
{:Parallelism (:parallelism rollback)
:Delay (->nano (:delay rollback))
:Order (:order rollback)
:FailureAction (:failureAction rollback)}))
(defn ->service-restart-policy
[service]
(let [policy (get-in service [:deployment :restartPolicy])]
{:Condition (:condition policy)
:Delay (->nano (:delay policy))
:Window (->nano (:window policy))
:MaxAttempts (:attempts policy)}))
(defn ->service-healthcheck
[service-healthcheck]
(when service-healthcheck
{:Test (:test service-healthcheck)
:Interval (->nano (:interval service-healthcheck))
:Timeout (->nano (:timeout service-healthcheck))
:Retries (:retries service-healthcheck)}))
(defn ->service-image
[service digest?]
(let [repository (get-in service [:repository :name])
tag (get-in service [:repository :tag])
digest (get-in service [:repository :imageDigest])]
(if digest?
(str repository ":" tag "@" digest)
(str repository ":" tag))))
(defn ->service-links
[service]
(->> (:links service)
(map #(hash-map (keyword (str mi/link-label (:name %))) (:value %)))
(into {})))
(defn ->service-metadata
[service image]
(let [autoredeploy (get-in service [:deployment :autoredeploy])
agent (:agent service)
stack (:stack service)
immutable (:immutable service)
links (:links service)]
(merge {}
(when (some? stack)
{:com.docker.stack.namespace stack
:com.docker.stack.image image})
(when (some? autoredeploy)
{mi/autoredeploy-label (str autoredeploy)})
(when (some? agent)
{mi/agent-label (str agent)})
(when (some? immutable)
{mi/immutable-label (str immutable)})
(when (not-empty links)
(->service-links service)))))
(defn ->service-container-metadata
[service]
(let [stack (:stack service)]
(merge {}
(when (some? stack)
{:com.docker.stack.namespace stack}))))
(defn ->service
[service]
{:Name (:serviceName service)
:Labels (merge
(->service-labels service)
(->service-metadata service (->service-image service false)))
:TaskTemplate {:ContainerSpec {:Image (->service-image service true)
:Labels (merge
(->service-container-labels service)
(->service-container-metadata service))
:Mounts (->service-mounts service)
:Secrets (:secrets service)
:Configs (:configs service)
:Args (:command service)
:TTY (:tty service)
:Healthcheck (->service-healthcheck (:healthcheck service))
:Env (->service-variables service)
:Hosts (->service-hosts service)}
:LogDriver {:Name (get-in service [:logdriver :name])
:Options (->service-log-options service)}
:Resources {:Limits (->service-resource (get-in service [:resources :limit]))
:Reservations (->service-resource (get-in service [:resources :reservation]))}
:RestartPolicy (->service-restart-policy service)
:Placement {:Constraints (->service-placement-contraints service)}
:ForceUpdate (get-in service [:deployment :forceUpdate])
:Networks (->service-networks service)}
:Mode (->service-mode service)
:UpdateConfig (->service-update-config service)
:RollbackConfig (->service-rollback-config service)
:EndpointSpec {:Ports (->service-ports service)}})
(defn ->network-ipam-config
[network]
(let [ipam (:ipam network)
gateway (:gateway ipam)
subnet (:subnet ipam)]
(if (not (str/blank? subnet))
{:Config [{:Subnet subnet
:Gateway gateway}]}
{:Config []})))
(defn ->network
[network]
{:Name (:networkName network)
:Driver (:driver network)
:Internal (:internal network)
:Options (name-value->map (:options network))
:Attachable (:attachable network)
:Ingress (:ingress network)
:EnableIPv6 (:enableIPv6 network)
:IPAM (merge {:Driver "default"}
(->network-ipam-config network))})
(defn ->volume
[volume]
{:Name (:volumeName volume)
:Driver (:driver volume)
:DriverOpts (name-value->map (:options volume))
:Labels (:labels volume)})
(defn ->secret
[secret]
{:Name (:secretName secret)
:Data (:data secret)})
(defn ->config
[config]
{:Name (:configName config)
:Data (:data config)})
(defn ->node
[node]
{:Availability (:availability node)
:Role (:role node)
:Labels (name-value->map (:labels node))})
| |
635e62b081aac3059ab58e2665dfa2ff68b9659c510fcd072363dd250cf67677 | cxphoe/SICP-solutions | 3.7.rkt | (define (make-account balance password)
(define (withdraw amount)
(if (>= balance amount)
(begin (set! balance (- balance amount))
balance)
"Insufficient funds"))
(define (deposit amount)
(set! balance (+ balance amount)))
(define (dispatch pw m)
(if (eq? pw password)
(cond ((eq? m 'withdraw) withdraw)
((eq? m 'deposit) deposit)
(else (error "Unknown request -- MAKE-ACCOUNT" m)))
(lambda (x) "Incorrect password")))
dispatch)
(define (make-joint acc pw new-pw)
(let ((withdraw (acc pw 'withdraw))
(deposit (acc pw 'deposit)))
(define (dispatch pw m)
(cond ((not (eq? pw new-pw)) (lambda (x)
"Incorrect Password"))
((eq? m 'withdraw) withdraw)
((eq? m 'deposit) deposit)
(else (error "Unknown request -- MAKE-JOINT" m))))
(if (not (number? (withdraw 0)))
(error "Incorrect password for jointed account" (list pw))
dispatch)))
(define peter-acc (make-account 100 'open-sesame))
(define paul-acc (make-joint peter-acc 'open-sesame 'rosebud))
((peter-acc 'open-sesame 'withdraw) 0)
((paul-acc 'open-seasame 'withdraw) 50)
((paul-acc 'rosebud 'withdraw) 50)
((peter-acc 'open-sesame 'withdraw) 0)
(define bob-acc (make-joint peter-acc 'openingsesame 'rosebud)) | null | https://raw.githubusercontent.com/cxphoe/SICP-solutions/d35bb688db0320f6efb3b3bde1a14ce21da319bd/Chapter%203-Modeling%20with%20Mutable%20Data/1.Assignment%20and%20Local%20state/3.7.rkt | racket | (define (make-account balance password)
(define (withdraw amount)
(if (>= balance amount)
(begin (set! balance (- balance amount))
balance)
"Insufficient funds"))
(define (deposit amount)
(set! balance (+ balance amount)))
(define (dispatch pw m)
(if (eq? pw password)
(cond ((eq? m 'withdraw) withdraw)
((eq? m 'deposit) deposit)
(else (error "Unknown request -- MAKE-ACCOUNT" m)))
(lambda (x) "Incorrect password")))
dispatch)
(define (make-joint acc pw new-pw)
(let ((withdraw (acc pw 'withdraw))
(deposit (acc pw 'deposit)))
(define (dispatch pw m)
(cond ((not (eq? pw new-pw)) (lambda (x)
"Incorrect Password"))
((eq? m 'withdraw) withdraw)
((eq? m 'deposit) deposit)
(else (error "Unknown request -- MAKE-JOINT" m))))
(if (not (number? (withdraw 0)))
(error "Incorrect password for jointed account" (list pw))
dispatch)))
(define peter-acc (make-account 100 'open-sesame))
(define paul-acc (make-joint peter-acc 'open-sesame 'rosebud))
((peter-acc 'open-sesame 'withdraw) 0)
((paul-acc 'open-seasame 'withdraw) 50)
((paul-acc 'rosebud 'withdraw) 50)
((peter-acc 'open-sesame 'withdraw) 0)
(define bob-acc (make-joint peter-acc 'openingsesame 'rosebud)) | |
63df0b843a76e28a8084d05b61ac4628c88d2256d47ee3d58c3fc9bd4880f279 | mxmxyz/tidal-guiot | Boot.hs | module Sound.Tidal.Guiot.Boot (module B) where
import Sound.Tidal.Guiot.Control as B
import Sound.Tidal.Guiot.Functions as B
import Sound.Tidal.Guiot.Rhythm as B
import Sound.Tidal.Guiot.Scales as B
import Sound.Tidal.Guiot.Utils as B
| null | https://raw.githubusercontent.com/mxmxyz/tidal-guiot/eccea30a5cbef37cf0c4b1978fe65b99cce71bf7/src/Sound/Tidal/Guiot/Boot.hs | haskell | module Sound.Tidal.Guiot.Boot (module B) where
import Sound.Tidal.Guiot.Control as B
import Sound.Tidal.Guiot.Functions as B
import Sound.Tidal.Guiot.Rhythm as B
import Sound.Tidal.Guiot.Scales as B
import Sound.Tidal.Guiot.Utils as B
| |
1e5b72d658a2b00361f9e6bea3af3d6cf663b4906b42b9159d53d19b205c06ee | nyampass/conceit | csv.clj | (ns conceit.commons.test.csv
(use conceit.commons.csv
conceit.commons.test
clojure.test))
(deftest* csv-value-test
(= "\"foo\"" (csv-value "foo"))
(= "\"abc\"" (csv-value :abc))
(= "\"HOGE\"" (csv-value 'HOGE))
(= "\"100\"" (csv-value 100))
(= "\"hello \"\"world\"\"!\"" (csv-value "hello \"world\"!"))
(= "\"foo, bar\"" (csv-value "foo, bar"))
(= "\"\"" (csv-value ""))
(= "\"\"" (csv-value nil)))
(deftest* csv-row-test
(= "\"foo\",\"bar\"" (csv-row [:foo :bar]))
(= "\"x\"" (csv-row ["x"]))
(= "\"a,b\",\"c\"\"d\",\"efg\",\"10\"" (csv-row ["a,b" "c\"d" "efg" 10]))
(= "\"x\",\"\"" (csv-row ["x" ""]))
(= "" (csv-row [])))
(deftest* csv-rows-test
(= "\"foo\",\"bar\"\r\n\"abc\",\"def\"\r\n" (csv-rows [[:foo :bar] ["abc" "def"]]))
(= "\"name\",\"age\",\"note\"\r\n\"John\",\"24\",\"foo\"\"bar\"\r\n\"James\",\"30\",\"aaa,bbb,ccc\"\r\n" (csv-rows [[:name :age :note] ["John" 24 "foo\"bar"] ["James" 30 "aaa,bbb,ccc"]]))
(= "\r\n\r\n" (csv-rows [[] []]))
(= "" (csv-rows [])))
(deftest* csv-row-by-map-test
(= "\"John\",\"24\",\"foo\"\"bar\"" (csv-row-by-map {:name "John" :age 24 :note "foo\"bar"} [:name :age :note]))
(= "\"a\"" (csv-row-by-map {:name :a :value 10} [:name]))
(= "" (csv-row-by-map {:name :foo} [])))
(deftest* csv-rows-by-maps-test
(= "\"John\",\"24\",\"foo\"\"bar\"\r\n\"James\",\"30\",\"aaa,bbb,ccc\"\r\n" (csv-rows-by-maps [{:name "John" :age 24 :note "foo\"bar"} {:name "James" :age 30 :note "aaa,bbb,ccc"}] [:name :age :note]))
(= "\"a\"\r\n\"b\"\r\n\"c\"\r\n" (csv-rows-by-maps [{:name :a :value 10} {:name :b :value 20} {:name :c :value 30}] [:name]))
(= "\r\n\r\n" (csv-rows-by-maps [{:name :foo} {:name :bar}] []))
(= "" (csv-rows-by-maps [] [:name :age])))
;; (run-tests)
| null | https://raw.githubusercontent.com/nyampass/conceit/2b8ba8cc3d732fe2f58d320e2aa4ecdd6f3f3be5/conceit-commons/test/conceit/commons/test/csv.clj | clojure | (run-tests) | (ns conceit.commons.test.csv
(use conceit.commons.csv
conceit.commons.test
clojure.test))
(deftest* csv-value-test
(= "\"foo\"" (csv-value "foo"))
(= "\"abc\"" (csv-value :abc))
(= "\"HOGE\"" (csv-value 'HOGE))
(= "\"100\"" (csv-value 100))
(= "\"hello \"\"world\"\"!\"" (csv-value "hello \"world\"!"))
(= "\"foo, bar\"" (csv-value "foo, bar"))
(= "\"\"" (csv-value ""))
(= "\"\"" (csv-value nil)))
(deftest* csv-row-test
(= "\"foo\",\"bar\"" (csv-row [:foo :bar]))
(= "\"x\"" (csv-row ["x"]))
(= "\"a,b\",\"c\"\"d\",\"efg\",\"10\"" (csv-row ["a,b" "c\"d" "efg" 10]))
(= "\"x\",\"\"" (csv-row ["x" ""]))
(= "" (csv-row [])))
(deftest* csv-rows-test
(= "\"foo\",\"bar\"\r\n\"abc\",\"def\"\r\n" (csv-rows [[:foo :bar] ["abc" "def"]]))
(= "\"name\",\"age\",\"note\"\r\n\"John\",\"24\",\"foo\"\"bar\"\r\n\"James\",\"30\",\"aaa,bbb,ccc\"\r\n" (csv-rows [[:name :age :note] ["John" 24 "foo\"bar"] ["James" 30 "aaa,bbb,ccc"]]))
(= "\r\n\r\n" (csv-rows [[] []]))
(= "" (csv-rows [])))
(deftest* csv-row-by-map-test
(= "\"John\",\"24\",\"foo\"\"bar\"" (csv-row-by-map {:name "John" :age 24 :note "foo\"bar"} [:name :age :note]))
(= "\"a\"" (csv-row-by-map {:name :a :value 10} [:name]))
(= "" (csv-row-by-map {:name :foo} [])))
(deftest* csv-rows-by-maps-test
(= "\"John\",\"24\",\"foo\"\"bar\"\r\n\"James\",\"30\",\"aaa,bbb,ccc\"\r\n" (csv-rows-by-maps [{:name "John" :age 24 :note "foo\"bar"} {:name "James" :age 30 :note "aaa,bbb,ccc"}] [:name :age :note]))
(= "\"a\"\r\n\"b\"\r\n\"c\"\r\n" (csv-rows-by-maps [{:name :a :value 10} {:name :b :value 20} {:name :c :value 30}] [:name]))
(= "\r\n\r\n" (csv-rows-by-maps [{:name :foo} {:name :bar}] []))
(= "" (csv-rows-by-maps [] [:name :age])))
|
510b9d99e52fe4b2e438e9d62ae495e4d4a7f7cf5fd69467031f74ddf62ea3c9 | nomnom-insights/nomnom.lockjaw | util.clj | (ns lockjaw.util
(:import
(java.util.zip
CRC32)))
(defn name-to-id
"Converts a string to an int"
[name]
(let [bytes (.getBytes ^String name "UTF-8")
crc (new CRC32)]
(.update ^CRC32 crc bytes)
(.getValue ^CRC32 crc)))
| null | https://raw.githubusercontent.com/nomnom-insights/nomnom.lockjaw/2adc9d39d1b565c639248101114beac2bc2faa94/src/lockjaw/util.clj | clojure | (ns lockjaw.util
(:import
(java.util.zip
CRC32)))
(defn name-to-id
"Converts a string to an int"
[name]
(let [bytes (.getBytes ^String name "UTF-8")
crc (new CRC32)]
(.update ^CRC32 crc bytes)
(.getValue ^CRC32 crc)))
| |
b02494ae8e877e031a72beced9119ebc6fd7ece272821623b84920cfdee1b856 | google/codeworld | prediction.hs |
Copyright 2020 The CodeWorld Authors . All rights reserved .
Licensed under the Apache License , Version 2.0 ( the " License " ) ;
you may not use this file except in compliance with the License .
You may obtain a copy of the License at
-2.0
Unless required by applicable law or agreed to in writing , software
distributed under the License is distributed on an " AS IS " BASIS ,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND , either express or implied .
See the License for the specific language governing permissions and
limitations under the License .
Copyright 2020 The CodeWorld Authors. All rights reserved.
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
-}
import CodeWorld.Prediction
import Data.Bifunctor
import qualified Data.IntMap as IM
import Data.List
import qualified Data.Map as M
import System.Exit
import Test.QuickCheck
import Common
type EventsDone = ([TimeStamp], IM.IntMap [TEvent])
type LogEntry = Either Double Event
type Log = [LogEntry]
type Check = (EventsDone, Either Double (Int, TEvent))
type CheckReport = (Check, Future Log, Future Log, Future Log)
-- Fake state and handle functions
step :: Double -> Log -> Log
step dt = (Left dt :)
handle :: Event -> Log -> Log
handle dt = (Right dt :)
-- Global constant
rate :: Double
rate = 1 / 4 -- decimal display
-- Generation of random schedules
-- The actual check:
-- Exhaustively search the order in which these events could happen
Memoize every initial segment
-- Ensure that all possible ways reach the same conclusion.
failedChecks :: EventSchedule -> [CheckReport]
failedChecks schedule = map mkReport $ filter (not . check) allChecks
where
allDone :: [EventsDone]
allDone = do
let (tss, em) = schedule
tss' <- inits tss
em' <- traverse inits em -- wow!
return (tss', em')
allChecks :: [Check]
allChecks = allDone >>= prevs
prevs :: EventsDone -> [Check]
prevs (tss, m) =
[((init tss, m), Left (last tss)) | not (null tss)] ++
[ ((tss, IM.adjust init i m), Right (i, last done))
| i <- IM.keys m
, let done = m IM.! i
, not (null done)
]
memo :: M.Map EventsDone (Future Log)
memo =
M.fromList [(eventsDone, recreate eventsDone) | eventsDone <- allDone]
recreate :: EventsDone -> Future Log
recreate m =
case prevs m of
[] -> initFuture [] (IM.size (snd m))
(c:_) -> checkActual c
check :: Check -> Bool
check c = checkActual c `eqFuture` checkExpected c
checkExpected :: Check -> Future Log
checkExpected (prev, Left t) = memo M.! first (++ [t]) prev
checkExpected (prev, Right (p, (t, e))) =
memo M.! second (IM.adjust (++ [(t, e)]) p) prev
checkActual :: Check -> Future Log
checkActual (prev, Left t) = currentTimePasses step rate t $ memo M.! prev
checkActual (prev, Right (p, (t, e))) =
addEvent step rate p t (handle <$> e) $ memo M.! prev
mkReport :: Check -> CheckReport
mkReport c = (c, memo M.! fst c, checkExpected c, checkActual c)
-- The quickcheck test, with reporting
testPrediction :: Property
testPrediction =
forAllSchedules $ \schedule ->
let failed = failedChecks schedule
in reportFailedCheck (head failed) `whenFail` null failed
reportFailedCheck :: CheckReport -> IO ()
reportFailedCheck (c, before, expected, actual) = do
putStrLn "Failed Check"
putStrLn "History:"
putStr $ showHistory (fst c)
putStrLn "Event:"
print (snd c)
putStrLn "Before:"
printInternalState showLog before
putStrLn "Expected:"
printInternalState showLog expected
putStrLn "Actual:"
printInternalState showLog actual
putStrLn ""
showHistory :: EventsDone -> String
showHistory (tss, m) =
unlines $
("Queried at: " ++ intercalate " " (map show tss)) : map go (IM.toList m)
where
go (p, tes) = "Player " ++ show p ++ ": " ++ intercalate " " (map ste tes)
ste (t, Nothing) = show t
ste (t, Just e) = show e ++ "@" ++ show t
showLog :: Log -> String
showLog l = intercalate " " (map sle (reverse l))
where
sle (Left x) = show x
sle (Right x) = "[" ++ show x ++ "]"
-- The main entry point.
Set the exit code to please .
main :: IO ()
main = do
res <- quickCheckWithResult args testPrediction
case res of
Success {} -> exitSuccess
_ -> exitFailure
where
args = stdArgs {maxSize = 30} -- more gets too large
| null | https://raw.githubusercontent.com/google/codeworld/77b0863075be12e3bc5f182a53fcc38b038c3e16/codeworld-prediction/tests/prediction.hs | haskell | Fake state and handle functions
Global constant
decimal display
Generation of random schedules
The actual check:
Exhaustively search the order in which these events could happen
Ensure that all possible ways reach the same conclusion.
wow!
The quickcheck test, with reporting
The main entry point.
more gets too large |
Copyright 2020 The CodeWorld Authors . All rights reserved .
Licensed under the Apache License , Version 2.0 ( the " License " ) ;
you may not use this file except in compliance with the License .
You may obtain a copy of the License at
-2.0
Unless required by applicable law or agreed to in writing , software
distributed under the License is distributed on an " AS IS " BASIS ,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND , either express or implied .
See the License for the specific language governing permissions and
limitations under the License .
Copyright 2020 The CodeWorld Authors. All rights reserved.
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
-}
import CodeWorld.Prediction
import Data.Bifunctor
import qualified Data.IntMap as IM
import Data.List
import qualified Data.Map as M
import System.Exit
import Test.QuickCheck
import Common
type EventsDone = ([TimeStamp], IM.IntMap [TEvent])
type LogEntry = Either Double Event
type Log = [LogEntry]
type Check = (EventsDone, Either Double (Int, TEvent))
type CheckReport = (Check, Future Log, Future Log, Future Log)
step :: Double -> Log -> Log
step dt = (Left dt :)
handle :: Event -> Log -> Log
handle dt = (Right dt :)
rate :: Double
Memoize every initial segment
failedChecks :: EventSchedule -> [CheckReport]
failedChecks schedule = map mkReport $ filter (not . check) allChecks
where
allDone :: [EventsDone]
allDone = do
let (tss, em) = schedule
tss' <- inits tss
return (tss', em')
allChecks :: [Check]
allChecks = allDone >>= prevs
prevs :: EventsDone -> [Check]
prevs (tss, m) =
[((init tss, m), Left (last tss)) | not (null tss)] ++
[ ((tss, IM.adjust init i m), Right (i, last done))
| i <- IM.keys m
, let done = m IM.! i
, not (null done)
]
memo :: M.Map EventsDone (Future Log)
memo =
M.fromList [(eventsDone, recreate eventsDone) | eventsDone <- allDone]
recreate :: EventsDone -> Future Log
recreate m =
case prevs m of
[] -> initFuture [] (IM.size (snd m))
(c:_) -> checkActual c
check :: Check -> Bool
check c = checkActual c `eqFuture` checkExpected c
checkExpected :: Check -> Future Log
checkExpected (prev, Left t) = memo M.! first (++ [t]) prev
checkExpected (prev, Right (p, (t, e))) =
memo M.! second (IM.adjust (++ [(t, e)]) p) prev
checkActual :: Check -> Future Log
checkActual (prev, Left t) = currentTimePasses step rate t $ memo M.! prev
checkActual (prev, Right (p, (t, e))) =
addEvent step rate p t (handle <$> e) $ memo M.! prev
mkReport :: Check -> CheckReport
mkReport c = (c, memo M.! fst c, checkExpected c, checkActual c)
testPrediction :: Property
testPrediction =
forAllSchedules $ \schedule ->
let failed = failedChecks schedule
in reportFailedCheck (head failed) `whenFail` null failed
reportFailedCheck :: CheckReport -> IO ()
reportFailedCheck (c, before, expected, actual) = do
putStrLn "Failed Check"
putStrLn "History:"
putStr $ showHistory (fst c)
putStrLn "Event:"
print (snd c)
putStrLn "Before:"
printInternalState showLog before
putStrLn "Expected:"
printInternalState showLog expected
putStrLn "Actual:"
printInternalState showLog actual
putStrLn ""
showHistory :: EventsDone -> String
showHistory (tss, m) =
unlines $
("Queried at: " ++ intercalate " " (map show tss)) : map go (IM.toList m)
where
go (p, tes) = "Player " ++ show p ++ ": " ++ intercalate " " (map ste tes)
ste (t, Nothing) = show t
ste (t, Just e) = show e ++ "@" ++ show t
showLog :: Log -> String
showLog l = intercalate " " (map sle (reverse l))
where
sle (Left x) = show x
sle (Right x) = "[" ++ show x ++ "]"
Set the exit code to please .
main :: IO ()
main = do
res <- quickCheckWithResult args testPrediction
case res of
Success {} -> exitSuccess
_ -> exitFailure
where
|
25e046ae1e923dd0b5dce88a4f61c366282151cc70b45d51ecb5d33168a3dcc7 | isovector/type-errors | Errors.hs | # LANGUAGE CPP #
------------------------------------------------------------------------------
-- | This module provides useful tools for writing better type-errors. For
-- a quickstart guide to the underlying 'GHC.TypeLits.TypeError' machinery,
check out excellent blog post
-- <-errors A story told by Type Errors>.
module Type.Errors
( -- * Generating Error Messages
ErrorMessage (..)
, PrettyPrintList
, ShowTypeQuoted
-- * Emitting Error Messages
, TypeError
, DelayError
, DelayErrorFcf
, NoError
, NoErrorFcf
-- * Observing Stuckness
, IfStuck
, WhenStuck
, UnlessStuck
-- * Running Magic Stuck Type Families
, te
-- * Observing Phantomness
, PHANTOM
, UnlessPhantom
-- * Performing Type Substitutions
, Subst
, VAR
, SubstVar
-- * Working With Fcfs
, Exp
, Eval
, Pure
) where
import Control.Applicative
import Data.Coerce
import Data.Generics
import Data.Kind
import Fcf
import GHC.TypeLits
import qualified Language.Haskell.TH as TH
import Language.Haskell.TH hiding (Type, Exp)
-- $setup
-- >>> :m +Data.Kind
-- >>> :m +Data.Proxy
> > > import ( Generic ( .. ) )
> > > : def ! ( \msg - > pure $ " let foo : : DelayError ( " + + msg + + " ) = > ( ) ; foo = ( ) ; in foo " )
> > > : def ! ( \msg - > pure $ " let foo : : ( " + + msg + + " ) = > ( ) ; foo = ( ) ; in foo " )
-- >>> :{
-- data HasNoRep = HasNoRep
-- :}
------------------------------------------------------------------------------
-- | Pretty print a list.
--
> > > : [ Bool ]
-- ...
... ' '
-- ...
--
> > > : [ 1 , 2 ]
-- ...
-- ... '1', and '2'
-- ...
--
> > > : [ " hello " , " world " , " cool " ]
-- ...
-- ... "hello", "world", and "cool"
-- ...
--
@since 0.1.0.0
type family PrettyPrintList (vs :: [k]) :: ErrorMessage where
PrettyPrintList '[] = 'Text ""
PrettyPrintList '[a] = ShowTypeQuoted a
PrettyPrintList '[a, b] = ShowTypeQuoted a ':<>: 'Text ", and " ':<>: ShowTypeQuoted b
PrettyPrintList (a ': vs) = ShowTypeQuoted a ':<>: 'Text ", " ':<>: PrettyPrintList vs
------------------------------------------------------------------------------
| Like ' ShowType ' , but quotes the type if necessary .
--
> > > :
-- ...
-- ... 'Int'
-- ...
--
-- >>> :show_error ShowTypeQuoted "symbols aren't quoted"
-- ...
-- ... "symbols aren't quoted"
-- ...
--
@since 0.1.0.0
#if __GLASGOW_HASKELL__ >= 902
type ShowTypeQuoted :: k -> ErrorMessage
#endif
type family ShowTypeQuoted (t :: k) :: ErrorMessage where
ShowTypeQuoted (t :: Symbol) = 'ShowType t
ShowTypeQuoted t = 'Text "'" ':<>: 'ShowType t ':<>: 'Text "'"
------------------------------------------------------------------------------
| Error messages produced via ' TypeError ' are often /too strict/ , and will
be emitted sooner than you 'd like . The solution is to use ' DelayError ' ,
-- which will switch the error messages to being consumed lazily.
--
-- >>> :{
-- foo :: TypeError ('Text "Too eager; prevents compilation") => ()
-- foo = ()
-- :}
-- ...
-- ... Too eager; prevents compilation
-- ...
--
-- >>> :{
foo : : DelayError ( ' Text " Lazy ; emitted on use " ) = > ( )
-- foo = ()
-- :}
--
-- >>> foo
-- ...
-- ... Lazy; emitted on use
-- ...
--
@since 0.1.0.0
type DelayError err = Eval (DelayErrorFcf err)
------------------------------------------------------------------------------
| Like ' DelayError ' , but implemented as a first - class family .
' DelayErrorFcf ' is useful when used as the last argument to ' ' and
-- 'UnlessStuck'.
--
@since 0.1.0.0
data DelayErrorFcf :: ErrorMessage -> Exp k
type instance Eval (DelayErrorFcf a) = TypeError a
------------------------------------------------------------------------------
-- | A helper definition that /doesn't/ emit a type error. This is
occassionally useful to leave as the residual constraint in ' ' when
-- you only want to observe if an expression /isn't/ stuck.
--
@since 0.1.0.0
type NoError = (() :: Constraint)
------------------------------------------------------------------------------
| Like ' NoError ' , but implemented as a first - class family . ' NoErrorFcf ' is
useful when used as the last argument to ' ' and ' UnlessStuck ' .
--
@since 0.1.0.0
type NoErrorFcf = Pure NoError
------------------------------------------------------------------------------
| @'IfStuck ' expr b c@ leaves @b@ in the residual constraints whenever
@expr@ is stuck , otherwise it ' Eval'uates @c@.
--
Often you want to leave a ' DelayError ' in @b@ in order to report an error
when @expr@ is stuck .
--
The @c@ parameter is a first - class family , which allows you to perform
arbitrarily - complicated type - level computations whenever @expr@ is n't stuck .
For example , you might want to produce a typeclass ' Constraint ' here .
Alternatively , you can nest calls to ' ' in order to do subsequent
-- processing.
--
This is a generalization of < / kcsongor > 's
-- machinery described in
< -stuck-families/ detecting the undetectable > .
--
@since 0.1.0.0
type family IfStuck (expr :: k) (b :: k1) (c :: Exp k1) :: k1 where
-- The type pattern @_ Foo@ is interpretered by the compiler as being of
-- any kind. This is great and exactly what we want here, except that things
like @forall s. Maybe s@ will get stuck on it .
--
So instead , we just propagate out 100 of these type variables and assume
that 100 type variables ought to be enough for anyone .
IfStuck (_ AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind) b c = b
IfStuck a b c = Eval c
data AnythingOfAnyKind
------------------------------------------------------------------------------
| Like ' ' , but specialized to the case when you do n't want to do
-- anything if @expr@ isn't stuck.
--
-- >>> :{
-- observe_no_rep
: :
-- (Rep t)
( DelayError ( ' Text " No Rep instance for " ' : < > : ShowTypeQuoted t ) )
-- => t
-- -> ()
-- observe_no_rep _ = ()
-- :}
--
-- >>> observe_no_rep HasNoRep
-- ...
-- ... No Rep instance for 'HasNoRep'
-- ...
--
-- >>> observe_no_rep True
-- ()
--
@since 0.1.0.0
type WhenStuck expr b = IfStuck expr b NoErrorFcf
------------------------------------------------------------------------------
| Like ' ' , but leaves no residual constraint when @expr@ is stuck .
-- This can be used to ensure an expression /isn't/ stuck before analyzing it
-- further.
--
See the example under ' UnlessPhantom ' for an example of this use - case .
--
@since 0.1.0.0
type UnlessStuck expr c = IfStuck expr NoError c
------------------------------------------------------------------------------
-- | This library provides tools for performing lexical substitutions over
types . For example , the function ' UnlessPhantom ' asks you to mark phantom
variables via ' PHANTOM ' .
--
-- Unfortunately, this substitution cannot reliably be performed via
-- type families, since it will too often get stuck. Instead we provide 'te',
-- which is capable of reasoning about types symbolically.
--
-- Any type which comes with the warning /"This type family is always stuck."/
-- __must__ be used in the context of 'te' and the magic @[t|@ quasiquoter. To
-- illustrate, the following is stuck:
--
-- >>> :{
-- foo :: SubstVar VAR Bool
-- foo = True
-- :}
-- ...
-- ... Couldn't match expected type ...SubstVar VAR Bool...
-- ... with actual type ...Bool...
-- ...
--
-- But running it via 'te' makes everything work:
--
-- >>> :{
foo : : $ ( te[t| SubstVar | ] )
-- foo = True
-- :}
--
-- If you don't want to think about when to use 'te', it's a no-op when used
-- with everyday types:
--
-- >>> :{
bar : : $ ( te[t| | ] )
-- bar = True
-- :}
--
@since 0.2.0.0
te :: Q TH.Type -> Q TH.Type
te = liftA $ everywhere $ mkT parseSubst
replaceWhen :: Data a => TH.Type -> TH.Type -> a -> a
replaceWhen a b = everywhere $ mkT $ \case
x | x == a -> b
x -> x
parseSubst :: TH.Type -> TH.Type
parseSubst (ConT phantom `AppT` expr `AppT` msg)
| phantom == ''UnlessPhantom =
ConT ''Coercible
`AppT` (replaceWhen (ConT ''PHANTOM) (ConT ''Stuck) expr)
`AppT` (replaceWhen (ConT ''PHANTOM)
(ConT ''DelayError `AppT` msg)
expr)
parseSubst (ConT subst `AppT` t `AppT` a `AppT` b)
| subst == ''Subst = replaceWhen a b t
parseSubst (ConT subst `AppT` t `AppT` b)
| subst == ''SubstVar = replaceWhen (ConT ''VAR) b t
parseSubst a = a
------------------------------------------------------------------------------
-- | __This type family is always stuck. It must be used in the context of 'te'.__
--
-- A meta-variable for marking which argument should be a phantom when working
with ' UnlessPhantom ' .
--
' PHANTOM ' is polykinded and can be used in several settings .
--
See ' UnlessPhantom ' for examples .
--
@since 0.1.0.0
type family PHANTOM :: k
------------------------------------------------------------------------------
-- | __This type family is always stuck. It must be used in the context of 'te'.__
--
@'UnlessPhantom ' expr err@ determines if the type described by @expr@
is phantom in the variables marked via ' PHANTOM ' . If it 's not , it produces
-- the error message @err@.
--
-- For example, consider the definition:
--
-- >>> :{
data Qux a b = Qux b
-- :}
--
-- which is phantom in @a@:
--
> > > : eval_error $ ( te[t| UnlessPhantom ( Qux PHANTOM Int ) ( ' Text " Ok " ) | ] )
-- ()
--
-- but not in @b@:
--
> > > : eval_error $ ( te[t| UnlessPhantom ( Qux Int PHANTOM ) ( ' Text " Bad ! " ) | ] )
-- ...
-- ... Bad!
-- ...
--
-- Unfortunately there is no known way to emit an error message if the variable
-- /is/ a phantom.
--
Often you 'll want to guard ' UnlessPhantom ' against ' ' , to ensure you
-- don't get errors when things are merely ambiguous. You can do this by
writing your own fcf whose implementation is ' UnlessPhantom ' :
--
-- >>> :{
data NotPhantomErrorFcf : : k - > Exp Constraint
-- type instance Eval (NotPhantomErrorFcf f) =
$ ( te[t| UnlessPhantom ( f PHANTOM )
-- ( ShowTypeQuoted f
-- ':<>: 'Text " is not phantom in its argument!")
-- |])
-- :}
--
-- >>> :{
-- observe_phantom
-- :: UnlessStuck
-- f
-- (NotPhantomErrorFcf f)
-- => f p
-- -> ()
-- observe_phantom _ = ()
-- :}
--
-- We then notice that using @observe_phantom@ against 'Data.Proxy.Proxy'
-- doesn't produce any errors, but against 'Maybe' does:
--
-- >>> observe_phantom Proxy
-- ()
--
-- >>> observe_phantom (Just 5)
-- ...
-- ... 'Maybe' is not phantom in its argument!
-- ...
--
Finally , we leave @observe_phantom@ unsaturated , and therefore is n't yet
known . Without guarding the ' UnlessPhantom ' behind ' UnlessStuck ' , this would
-- incorrectly produce the message "'f' is not phantom in its argument!"
--
-- >>> observe_phantom
-- ...
-- ... No instance for (Show (f0 p0 -> ()))
-- ...
--
@since 0.2.0.0
type family UnlessPhantom :: k -> ErrorMessage -> Constraint
------------------------------------------------------------------------------
-- | __This type family is always stuck. It must be used in the context of 'te'.__
--
@'Subst ' expr a b@ substitutes all instances of @a@ for @b@ in @expr@.
--
> > > : kind ! $ ( te[t| Subst ( Either Int Int ) Int Bool | ] )
-- ...
= Either
--
> > > : kind ! $ ( te[t| Subst ( Either Int Bool ) Int [ Char ] | ] )
-- ...
-- = Either [Char] Bool
--
> > > : kind ! $ ( te[t| Subst ( Either ) Either ( , ) | ] )
-- ...
-- = (Int, Bool)
--
@since 0.2.0.0
type family Subst :: k1 -> k1 -> k2 -> k2
------------------------------------------------------------------------------
-- | __This type family is always stuck. It must be used in the context of 'te'.__
--
-- 'VAR' is a meta-varaible which marks a substitution in 'SubstVar'. The
result of @'SubstVar ' expr val@ is @expr[val/'VAR']@.
--
-- 'VAR' is polykinded and can be used in several settings.
--
-- See 'SubstVar' for examples.
--
@since 0.2.0.0
type family VAR :: k
------------------------------------------------------------------------------
-- | __This type family is always stuck. It must be used in the context of 'te'.__
--
Like ' Subst ' , but uses the explicit meta - variable ' VAR ' to mark substitution
-- points.
--
> > > : kind ! $ ( te[t| SubstVar ( Either ) | ] )
-- ...
= Either
--
> > > : kind ! $ ( te[t| SubstVar ( Either ) [ ] | ] )
-- ...
-- = Either [Char] Bool
--
> > > : kind ! $ ( te[t| SubstVar ( VAR Int Bool ) ( , ) | ] )
-- ...
-- = (Int, Bool)
--
@since 0.2.0.0
type family SubstVar :: k1 -> k2 -> k2
| null | https://raw.githubusercontent.com/isovector/type-errors/81fd8e2e48f65b83a228cc1ba7db890fcc11cbd7/src/Type/Errors.hs | haskell | ----------------------------------------------------------------------------
| This module provides useful tools for writing better type-errors. For
a quickstart guide to the underlying 'GHC.TypeLits.TypeError' machinery,
<-errors A story told by Type Errors>.
* Generating Error Messages
* Emitting Error Messages
* Observing Stuckness
* Running Magic Stuck Type Families
* Observing Phantomness
* Performing Type Substitutions
* Working With Fcfs
$setup
>>> :m +Data.Kind
>>> :m +Data.Proxy
>>> :{
data HasNoRep = HasNoRep
:}
----------------------------------------------------------------------------
| Pretty print a list.
...
...
...
... '1', and '2'
...
...
... "hello", "world", and "cool"
...
----------------------------------------------------------------------------
...
... 'Int'
...
>>> :show_error ShowTypeQuoted "symbols aren't quoted"
...
... "symbols aren't quoted"
...
----------------------------------------------------------------------------
which will switch the error messages to being consumed lazily.
>>> :{
foo :: TypeError ('Text "Too eager; prevents compilation") => ()
foo = ()
:}
...
... Too eager; prevents compilation
...
>>> :{
foo = ()
:}
>>> foo
...
... Lazy; emitted on use
...
----------------------------------------------------------------------------
'UnlessStuck'.
----------------------------------------------------------------------------
| A helper definition that /doesn't/ emit a type error. This is
you only want to observe if an expression /isn't/ stuck.
----------------------------------------------------------------------------
----------------------------------------------------------------------------
processing.
machinery described in
The type pattern @_ Foo@ is interpretered by the compiler as being of
any kind. This is great and exactly what we want here, except that things
----------------------------------------------------------------------------
anything if @expr@ isn't stuck.
>>> :{
observe_no_rep
(Rep t)
=> t
-> ()
observe_no_rep _ = ()
:}
>>> observe_no_rep HasNoRep
...
... No Rep instance for 'HasNoRep'
...
>>> observe_no_rep True
()
----------------------------------------------------------------------------
This can be used to ensure an expression /isn't/ stuck before analyzing it
further.
----------------------------------------------------------------------------
| This library provides tools for performing lexical substitutions over
Unfortunately, this substitution cannot reliably be performed via
type families, since it will too often get stuck. Instead we provide 'te',
which is capable of reasoning about types symbolically.
Any type which comes with the warning /"This type family is always stuck."/
__must__ be used in the context of 'te' and the magic @[t|@ quasiquoter. To
illustrate, the following is stuck:
>>> :{
foo :: SubstVar VAR Bool
foo = True
:}
...
... Couldn't match expected type ...SubstVar VAR Bool...
... with actual type ...Bool...
...
But running it via 'te' makes everything work:
>>> :{
foo = True
:}
If you don't want to think about when to use 'te', it's a no-op when used
with everyday types:
>>> :{
bar = True
:}
----------------------------------------------------------------------------
| __This type family is always stuck. It must be used in the context of 'te'.__
A meta-variable for marking which argument should be a phantom when working
----------------------------------------------------------------------------
| __This type family is always stuck. It must be used in the context of 'te'.__
the error message @err@.
For example, consider the definition:
>>> :{
:}
which is phantom in @a@:
()
but not in @b@:
...
... Bad!
...
Unfortunately there is no known way to emit an error message if the variable
/is/ a phantom.
don't get errors when things are merely ambiguous. You can do this by
>>> :{
type instance Eval (NotPhantomErrorFcf f) =
( ShowTypeQuoted f
':<>: 'Text " is not phantom in its argument!")
|])
:}
>>> :{
observe_phantom
:: UnlessStuck
f
(NotPhantomErrorFcf f)
=> f p
-> ()
observe_phantom _ = ()
:}
We then notice that using @observe_phantom@ against 'Data.Proxy.Proxy'
doesn't produce any errors, but against 'Maybe' does:
>>> observe_phantom Proxy
()
>>> observe_phantom (Just 5)
...
... 'Maybe' is not phantom in its argument!
...
incorrectly produce the message "'f' is not phantom in its argument!"
>>> observe_phantom
...
... No instance for (Show (f0 p0 -> ()))
...
----------------------------------------------------------------------------
| __This type family is always stuck. It must be used in the context of 'te'.__
...
...
= Either [Char] Bool
...
= (Int, Bool)
----------------------------------------------------------------------------
| __This type family is always stuck. It must be used in the context of 'te'.__
'VAR' is a meta-varaible which marks a substitution in 'SubstVar'. The
'VAR' is polykinded and can be used in several settings.
See 'SubstVar' for examples.
----------------------------------------------------------------------------
| __This type family is always stuck. It must be used in the context of 'te'.__
points.
...
...
= Either [Char] Bool
...
= (Int, Bool)
| # LANGUAGE CPP #
check out excellent blog post
module Type.Errors
ErrorMessage (..)
, PrettyPrintList
, ShowTypeQuoted
, TypeError
, DelayError
, DelayErrorFcf
, NoError
, NoErrorFcf
, IfStuck
, WhenStuck
, UnlessStuck
, te
, PHANTOM
, UnlessPhantom
, Subst
, VAR
, SubstVar
, Exp
, Eval
, Pure
) where
import Control.Applicative
import Data.Coerce
import Data.Generics
import Data.Kind
import Fcf
import GHC.TypeLits
import qualified Language.Haskell.TH as TH
import Language.Haskell.TH hiding (Type, Exp)
> > > import ( Generic ( .. ) )
> > > : def ! ( \msg - > pure $ " let foo : : DelayError ( " + + msg + + " ) = > ( ) ; foo = ( ) ; in foo " )
> > > : def ! ( \msg - > pure $ " let foo : : ( " + + msg + + " ) = > ( ) ; foo = ( ) ; in foo " )
> > > : [ Bool ]
... ' '
> > > : [ 1 , 2 ]
> > > : [ " hello " , " world " , " cool " ]
@since 0.1.0.0
type family PrettyPrintList (vs :: [k]) :: ErrorMessage where
PrettyPrintList '[] = 'Text ""
PrettyPrintList '[a] = ShowTypeQuoted a
PrettyPrintList '[a, b] = ShowTypeQuoted a ':<>: 'Text ", and " ':<>: ShowTypeQuoted b
PrettyPrintList (a ': vs) = ShowTypeQuoted a ':<>: 'Text ", " ':<>: PrettyPrintList vs
| Like ' ShowType ' , but quotes the type if necessary .
> > > :
@since 0.1.0.0
#if __GLASGOW_HASKELL__ >= 902
type ShowTypeQuoted :: k -> ErrorMessage
#endif
type family ShowTypeQuoted (t :: k) :: ErrorMessage where
ShowTypeQuoted (t :: Symbol) = 'ShowType t
ShowTypeQuoted t = 'Text "'" ':<>: 'ShowType t ':<>: 'Text "'"
| Error messages produced via ' TypeError ' are often /too strict/ , and will
be emitted sooner than you 'd like . The solution is to use ' DelayError ' ,
foo : : DelayError ( ' Text " Lazy ; emitted on use " ) = > ( )
@since 0.1.0.0
type DelayError err = Eval (DelayErrorFcf err)
| Like ' DelayError ' , but implemented as a first - class family .
' DelayErrorFcf ' is useful when used as the last argument to ' ' and
@since 0.1.0.0
data DelayErrorFcf :: ErrorMessage -> Exp k
type instance Eval (DelayErrorFcf a) = TypeError a
occassionally useful to leave as the residual constraint in ' ' when
@since 0.1.0.0
type NoError = (() :: Constraint)
| Like ' NoError ' , but implemented as a first - class family . ' NoErrorFcf ' is
useful when used as the last argument to ' ' and ' UnlessStuck ' .
@since 0.1.0.0
type NoErrorFcf = Pure NoError
| @'IfStuck ' expr b c@ leaves @b@ in the residual constraints whenever
@expr@ is stuck , otherwise it ' Eval'uates @c@.
Often you want to leave a ' DelayError ' in @b@ in order to report an error
when @expr@ is stuck .
The @c@ parameter is a first - class family , which allows you to perform
arbitrarily - complicated type - level computations whenever @expr@ is n't stuck .
For example , you might want to produce a typeclass ' Constraint ' here .
Alternatively , you can nest calls to ' ' in order to do subsequent
This is a generalization of < / kcsongor > 's
< -stuck-families/ detecting the undetectable > .
@since 0.1.0.0
type family IfStuck (expr :: k) (b :: k1) (c :: Exp k1) :: k1 where
like @forall s. Maybe s@ will get stuck on it .
So instead , we just propagate out 100 of these type variables and assume
that 100 type variables ought to be enough for anyone .
IfStuck (_ AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind AnythingOfAnyKind AnythingOfAnyKind
AnythingOfAnyKind) b c = b
IfStuck a b c = Eval c
data AnythingOfAnyKind
| Like ' ' , but specialized to the case when you do n't want to do
: :
( DelayError ( ' Text " No Rep instance for " ' : < > : ShowTypeQuoted t ) )
@since 0.1.0.0
type WhenStuck expr b = IfStuck expr b NoErrorFcf
| Like ' ' , but leaves no residual constraint when @expr@ is stuck .
See the example under ' UnlessPhantom ' for an example of this use - case .
@since 0.1.0.0
type UnlessStuck expr c = IfStuck expr NoError c
types . For example , the function ' UnlessPhantom ' asks you to mark phantom
variables via ' PHANTOM ' .
foo : : $ ( te[t| SubstVar | ] )
bar : : $ ( te[t| | ] )
@since 0.2.0.0
te :: Q TH.Type -> Q TH.Type
te = liftA $ everywhere $ mkT parseSubst
replaceWhen :: Data a => TH.Type -> TH.Type -> a -> a
replaceWhen a b = everywhere $ mkT $ \case
x | x == a -> b
x -> x
parseSubst :: TH.Type -> TH.Type
parseSubst (ConT phantom `AppT` expr `AppT` msg)
| phantom == ''UnlessPhantom =
ConT ''Coercible
`AppT` (replaceWhen (ConT ''PHANTOM) (ConT ''Stuck) expr)
`AppT` (replaceWhen (ConT ''PHANTOM)
(ConT ''DelayError `AppT` msg)
expr)
parseSubst (ConT subst `AppT` t `AppT` a `AppT` b)
| subst == ''Subst = replaceWhen a b t
parseSubst (ConT subst `AppT` t `AppT` b)
| subst == ''SubstVar = replaceWhen (ConT ''VAR) b t
parseSubst a = a
with ' UnlessPhantom ' .
' PHANTOM ' is polykinded and can be used in several settings .
See ' UnlessPhantom ' for examples .
@since 0.1.0.0
type family PHANTOM :: k
@'UnlessPhantom ' expr err@ determines if the type described by @expr@
is phantom in the variables marked via ' PHANTOM ' . If it 's not , it produces
data Qux a b = Qux b
> > > : eval_error $ ( te[t| UnlessPhantom ( Qux PHANTOM Int ) ( ' Text " Ok " ) | ] )
> > > : eval_error $ ( te[t| UnlessPhantom ( Qux Int PHANTOM ) ( ' Text " Bad ! " ) | ] )
Often you 'll want to guard ' UnlessPhantom ' against ' ' , to ensure you
writing your own fcf whose implementation is ' UnlessPhantom ' :
data NotPhantomErrorFcf : : k - > Exp Constraint
$ ( te[t| UnlessPhantom ( f PHANTOM )
Finally , we leave @observe_phantom@ unsaturated , and therefore is n't yet
known . Without guarding the ' UnlessPhantom ' behind ' UnlessStuck ' , this would
@since 0.2.0.0
type family UnlessPhantom :: k -> ErrorMessage -> Constraint
@'Subst ' expr a b@ substitutes all instances of @a@ for @b@ in @expr@.
> > > : kind ! $ ( te[t| Subst ( Either Int Int ) Int Bool | ] )
= Either
> > > : kind ! $ ( te[t| Subst ( Either Int Bool ) Int [ Char ] | ] )
> > > : kind ! $ ( te[t| Subst ( Either ) Either ( , ) | ] )
@since 0.2.0.0
type family Subst :: k1 -> k1 -> k2 -> k2
result of @'SubstVar ' expr val@ is @expr[val/'VAR']@.
@since 0.2.0.0
type family VAR :: k
Like ' Subst ' , but uses the explicit meta - variable ' VAR ' to mark substitution
> > > : kind ! $ ( te[t| SubstVar ( Either ) | ] )
= Either
> > > : kind ! $ ( te[t| SubstVar ( Either ) [ ] | ] )
> > > : kind ! $ ( te[t| SubstVar ( VAR Int Bool ) ( , ) | ] )
@since 0.2.0.0
type family SubstVar :: k1 -> k2 -> k2
|
79c53baa6e8edafcbc96efff9ee12e9301c3e4e7d5334bbb821cdd9acef9b75e | freizl/dive-into-haskell | Sentence.hs | -- |
module Sentence where
type Subject = String
type Verb = String
type Object = String
data Sentence = Sentence Subject Verb Object
deriving (Eq, Show)
s1 = Sentence "dogs" "drool"
s2 = Sentence "Julie" "loves" "dogs"
| null | https://raw.githubusercontent.com/freizl/dive-into-haskell/b18a6bfe212db6c3a5d707b4a640170b8bcf9330/readings/haskell-book/06/Sentence.hs | haskell | | |
module Sentence where
type Subject = String
type Verb = String
type Object = String
data Sentence = Sentence Subject Verb Object
deriving (Eq, Show)
s1 = Sentence "dogs" "drool"
s2 = Sentence "Julie" "loves" "dogs"
|
3bfb15a3d60e78c309f0e9d5aacfe8918ca5fe908e61e7a742021600a485971f | ryanpbrewster/haskell | GC.hs | -- GC.hs
- Problem
-
- The GC - content of a DNA string is given by the percentage of symbols in the
- string that are ' C ' or ' G ' . For example , the GC - content of " AGCTATAG " is
- 37.5 % . Note that the reverse complement of any DNA string has the same
- GC - content .
-
- DNA strings must be labeled when they are consolidated into a database .
- A commonly used method of string labeling is called FASTA format . In this
- format , the string is introduced by a line that begins with ' > ' , followed by
- some labeling information . Subsequent lines contain the string itself ; the
- first line to begin with ' > ' indicates the label of the next string .
-
- In 's implementation , a string in FASTA format will be labeled by
- the ID " Rosalind_xxxx " , where " xxxx " denotes a four - digit code between 0000
- and 9999 .
-
- Given : At most 10 DNA strings in FASTA format ( of length at most 1 kbp each ) .
-
- Return : The ID of the string having the highest GC - content , followed by the
- GC - content of that string . allows for a default error of 0.001 in
- all decimal answers unless otherwise stated ; please see the note on absolute
- error below .
-
- Sample Dataset
-
- > Rosalind_6404
- CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
- TCCCACTAATAATTCTGAGG
- > Rosalind_5959
- CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT
- ATATCCATTTGTCAGCAGACACGC
- > Rosalind_0808
- CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC
- TGGGAACCTGCGGGCAGTAGGTGGAAT
-
- Sample Output
-
- Rosalind_0808
- 60.919540
- Problem
-
- The GC-content of a DNA string is given by the percentage of symbols in the
- string that are 'C' or 'G'. For example, the GC-content of "AGCTATAG" is
- 37.5%. Note that the reverse complement of any DNA string has the same
- GC-content.
-
- DNA strings must be labeled when they are consolidated into a database.
- A commonly used method of string labeling is called FASTA format. In this
- format, the string is introduced by a line that begins with '>', followed by
- some labeling information. Subsequent lines contain the string itself; the
- first line to begin with '>' indicates the label of the next string.
-
- In Rosalind's implementation, a string in FASTA format will be labeled by
- the ID "Rosalind_xxxx", where "xxxx" denotes a four-digit code between 0000
- and 9999.
-
- Given: At most 10 DNA strings in FASTA format (of length at most 1 kbp each).
-
- Return: The ID of the string having the highest GC-content, followed by the
- GC-content of that string. Rosalind allows for a default error of 0.001 in
- all decimal answers unless otherwise stated; please see the note on absolute
- error below.
-
- Sample Dataset
-
- >Rosalind_6404
- CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
- TCCCACTAATAATTCTGAGG
- >Rosalind_5959
- CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT
- ATATCCATTTGTCAGCAGACACGC
- >Rosalind_0808
- CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC
- TGGGAACCTGCGGGCAGTAGGTGGAAT
-
- Sample Output
-
- Rosalind_0808
- 60.919540
-}
import System.Environment (getArgs)
import Text.Printf
import Data.Ord (comparing)
import Data.List (maximumBy)
import Rosalind.Parsing (parseNucFASTAs)
import Rosalind.Structures
main = do
args <- getArgs
txt <- readFile (head args)
putStrLn $ solveProblem txt
solveProblem txt = let inps = parseNucFASTAs txt
ans = maximumBy (comparing (gcContent.getSequence)) inps
out = showAnswer ans
in out
showAnswer fsta@(FASTA id dna) = showID id ++ "\n" ++ printf "%.6f" (100 * gcContent dna)
gc :: Nucleotide -> Bool
gc (Nucleotide n) = n == 'G' || n == 'C'
gcContent :: BioSequence -> Double
gcContent ncl_seq =
let nucs = getNucs ncl_seq
gc_content = length $ filter gc nucs
total = length nucs
in (fromIntegral gc_content) / (fromIntegral total)
| null | https://raw.githubusercontent.com/ryanpbrewster/haskell/6edd0afe234008a48b4871032dedfd143ca6e412/Rosalind/GC.hs | haskell | GC.hs |
- Problem
-
- The GC - content of a DNA string is given by the percentage of symbols in the
- string that are ' C ' or ' G ' . For example , the GC - content of " AGCTATAG " is
- 37.5 % . Note that the reverse complement of any DNA string has the same
- GC - content .
-
- DNA strings must be labeled when they are consolidated into a database .
- A commonly used method of string labeling is called FASTA format . In this
- format , the string is introduced by a line that begins with ' > ' , followed by
- some labeling information . Subsequent lines contain the string itself ; the
- first line to begin with ' > ' indicates the label of the next string .
-
- In 's implementation , a string in FASTA format will be labeled by
- the ID " Rosalind_xxxx " , where " xxxx " denotes a four - digit code between 0000
- and 9999 .
-
- Given : At most 10 DNA strings in FASTA format ( of length at most 1 kbp each ) .
-
- Return : The ID of the string having the highest GC - content , followed by the
- GC - content of that string . allows for a default error of 0.001 in
- all decimal answers unless otherwise stated ; please see the note on absolute
- error below .
-
- Sample Dataset
-
- > Rosalind_6404
- CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
- TCCCACTAATAATTCTGAGG
- > Rosalind_5959
- CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT
- ATATCCATTTGTCAGCAGACACGC
- > Rosalind_0808
- CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC
- TGGGAACCTGCGGGCAGTAGGTGGAAT
-
- Sample Output
-
- Rosalind_0808
- 60.919540
- Problem
-
- The GC-content of a DNA string is given by the percentage of symbols in the
- string that are 'C' or 'G'. For example, the GC-content of "AGCTATAG" is
- 37.5%. Note that the reverse complement of any DNA string has the same
- GC-content.
-
- DNA strings must be labeled when they are consolidated into a database.
- A commonly used method of string labeling is called FASTA format. In this
- format, the string is introduced by a line that begins with '>', followed by
- some labeling information. Subsequent lines contain the string itself; the
- first line to begin with '>' indicates the label of the next string.
-
- In Rosalind's implementation, a string in FASTA format will be labeled by
- the ID "Rosalind_xxxx", where "xxxx" denotes a four-digit code between 0000
- and 9999.
-
- Given: At most 10 DNA strings in FASTA format (of length at most 1 kbp each).
-
- Return: The ID of the string having the highest GC-content, followed by the
- GC-content of that string. Rosalind allows for a default error of 0.001 in
- all decimal answers unless otherwise stated; please see the note on absolute
- error below.
-
- Sample Dataset
-
- >Rosalind_6404
- CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
- TCCCACTAATAATTCTGAGG
- >Rosalind_5959
- CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT
- ATATCCATTTGTCAGCAGACACGC
- >Rosalind_0808
- CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC
- TGGGAACCTGCGGGCAGTAGGTGGAAT
-
- Sample Output
-
- Rosalind_0808
- 60.919540
-}
import System.Environment (getArgs)
import Text.Printf
import Data.Ord (comparing)
import Data.List (maximumBy)
import Rosalind.Parsing (parseNucFASTAs)
import Rosalind.Structures
main = do
args <- getArgs
txt <- readFile (head args)
putStrLn $ solveProblem txt
solveProblem txt = let inps = parseNucFASTAs txt
ans = maximumBy (comparing (gcContent.getSequence)) inps
out = showAnswer ans
in out
showAnswer fsta@(FASTA id dna) = showID id ++ "\n" ++ printf "%.6f" (100 * gcContent dna)
gc :: Nucleotide -> Bool
gc (Nucleotide n) = n == 'G' || n == 'C'
gcContent :: BioSequence -> Double
gcContent ncl_seq =
let nucs = getNucs ncl_seq
gc_content = length $ filter gc nucs
total = length nucs
in (fromIntegral gc_content) / (fromIntegral total)
|
80137ced9d07ecab47caabee51642109f460655c3f467f8767512d687f4e6f83 | theodormoroianu/SecondYearCourses | HaskellChurch_20210415163944.hs | {-# LANGUAGE RankNTypes #-}
module HaskellChurch where
A boolean is any way to choose between two alternatives
newtype CBool = CBool {cIf :: forall t. t -> t -> t}
An instance to show as regular Booleans
instance Show CBool where
show b = "cBool " <> show (cIf b True False)
The boolean constant true always chooses the first alternative
cTrue :: CBool
cTrue = undefined
The boolean constant false always chooses the second alternative
cFalse :: CBool
cFalse = undefined
cBool :: Bool -> CBool
cBool True = cTrue
cBool False = cFalse
--The boolean negation switches the alternatives
cNot :: CBool -> CBool
cNot = undefined
--The boolean conjunction can be built as a conditional
(&&:) :: CBool -> CBool -> CBool
(&&:) = undefined
infixr 3 &&:
--The boolean disjunction can be built as a conditional
(||:) :: CBool -> CBool -> CBool
(||:) = undefined
infixr 2 ||:
-- a pair is a way to compute something based on the values
-- contained within the pair.
newtype CPair a b = CPair { cOn :: forall c . (a -> b -> c) -> c }
An instance to show CPairs as regular pairs .
instance (Show a, Show b) => Show (CPair a b) where
show p = "cPair " <> show (cOn p (,))
builds a pair out of two values as an object which , when given
--a function to be applied on the values, it will apply it on them.
cPair :: a -> b -> CPair a b
cPair = undefined
first projection uses the function selecting first component on a pair
cFst :: CPair a b -> a
cFst = undefined
second projection
cSnd :: CPair a b -> b
cSnd = undefined
-- A natural number is any way to iterate a function s a number of times
-- over an initial value z
newtype CNat = CNat { cFor :: forall t. (t -> t) -> t -> t }
-- An instance to show CNats as regular natural numbers
instance Show CNat where
show n = show $ cFor n (1 +) (0 :: Integer)
--0 will iterate the function s 0 times over z, producing z
c0 :: CNat
c0 = undefined
1 is the the function s iterated 1 times over z , that is , z
c1 :: CNat
c1 = undefined
--Successor n either
- applies s one more time in addition to what n does
-- - iterates s n times over (s z)
cS :: CNat -> CNat
cS = undefined
--Addition of m and n is done by iterating s n times over m
(+:) :: CNat -> CNat -> CNat
(+:) = undefined
infixl 6 +:
--Multiplication of m and n can be done by composing n and m
(*:) :: CNat -> CNat -> CNat
(*:) = \n m -> CNat $ cFor n . cFor m
infixl 7 *:
--Exponentiation of m and n can be done by applying n to m
(^:) :: CNat -> CNat -> CNat
(^:) = \m n -> CNat $ cFor n (cFor m)
infixr 8 ^:
--Testing whether a value is 0 can be done through iteration
-- using a function constantly false and an initial value true
cIs0 :: CNat -> CBool
cIs0 = \n -> cFor n (\_ -> cFalse) cTrue
Predecessor ( evaluating to 0 for 0 ) can be defined iterating
over pairs , starting from an initial value ( 0 , 0 )
cPred :: CNat -> CNat
cPred = undefined
substraction from m n ( evaluating to 0 if m < n ) is repeated application
-- of the predeccesor function
(-:) :: CNat -> CNat -> CNat
(-:) = \m n -> cFor n cPred m
Transform a value into a CNat ( should yield c0 for nums < = 0 )
cNat :: (Ord p, Num p) => p -> CNat
cNat n = undefined
We can define an instance Num CNat which will allow us to see any
integer constant as a CNat ( e.g. 12 : : CNat ) and also use regular
-- arithmetic
instance Num CNat where
(+) = (+:)
(*) = (*:)
(-) = (-:)
abs = id
signum n = cIf (cIs0 n) 0 1
fromInteger = cNat
-- m is less than (or equal to) n if when substracting n from m we get 0
(<=:) :: CNat -> CNat -> CBool
(<=:) = undefined
infix 4 <=:
(>=:) :: CNat -> CNat -> CBool
(>=:) = \m n -> n <=: m
infix 4 >=:
(<:) :: CNat -> CNat -> CBool
(<:) = \m n -> cNot (m >=: n)
infix 4 <:
(>:) :: CNat -> CNat -> CBool
(>:) = \m n -> n <: m
infix 4 >:
-- equality on naturals can be defined my means of comparisons
(==:) :: CNat -> CNat -> CBool
(==:) = undefined
--Fun with arithmetic and pairs
--Define factorial. You can iterate over a pair to contain the current index and so far factorial
cFactorial :: CNat -> CNat
cFactorial = undefined
Define Fibonacci . You can iterate over a pair to contain two consecutive numbers in the sequence
cFibonacci :: CNat -> CNat
cFibonacci = undefined
--Given m and n, compute q and r satisfying m = q * n + r. If n is not 0 then r should be less than n.
--hint repeated substraction, iterated for at most m times.
cDivMod :: CNat -> CNat -> CPair CNat CNat
cDivMod = undefined
-- a list is a way to aggregate a sequence of elements given an aggregation function and an initial value.
newtype CList a = CList { cFoldR :: forall b. (a -> b -> b) -> b -> b }
make CList an instance of Foldable
instance Foldable CList where
--An instance to show CLists as regular lists.
instance (Show a) => Show (CList a) where
show l = "cList " <> (show $ toList l)
-- The empty list is that which when aggregated it will always produce the initial value
cNil :: CList a
cNil = undefined
-- Adding an element to a list means that, when aggregating the list, the newly added
-- element will be aggregated with the result obtained by aggregating the remainder of the list
(.:) :: a -> CList a -> CList a
(.:) = undefined
we can obtain a CList from a regular list by folding the list
cList :: [a] -> CList a
cList = undefined
builds a CList of CNats corresponding to a list of Integers
cNatList :: [Integer] -> CList CNat
cNatList = undefined
-- sums the elements in the list
cSum :: CList CNat -> CNat
cSum = undefined
-- checks whether a list is nil (similar to cIs0)
cIsNil :: CList a -> CBool
cIsNil = \l -> cFoldR l (\_ _ -> cFalse) cTrue
-- gets the head of the list (or the default specified value if the list is empty)
cHead :: CList a -> a -> a
cHead = undefined
-- gets the head of the list (or the default specified value if the list is empty)
cTail :: CList a -> CList a
cTail = \l -> cFst $ cFoldR l (\x p -> (\t -> cPair t (x .: t)) (cSnd p)) (cPair cNil cNil)
cLength :: CList a -> CNat
cLength = \l -> cFoldR l (\_ n -> cS n) 0
fix :: Term
fix = lam "f" (lam "x" (v "f" $$ (v "x" $$ v "x")) $$ lam "x" (v "f" $$ (v "x" $$ v "x")))
divmod :: (Enum a, Num a, Ord b, Num b) => b -> b -> (a, b)
divmod m n = divmod' (0, 0)
where
divmod' (x, y)
| x' <= m = divmod' (x', succ y)
| otherwise = (y, m - x)
where x' = x + n
divmod' m n =
if n == 0 then (0, m)
else
Function.fix
(\f p ->
(\x' ->
if x' > 0 then f ((,) (succ (fst p)) x')
else if (<=) n (snd p) then ((,) (succ (fst p)) 0)
else p)
((-) (snd p) n))
(0, m)
churchDivMod' :: Term
churchDivMod' = lams ["m", "n"]
(churchIs0 $$ v "n"
$$ (churchPair $$ church0 $$ v "m")
$$ (fix
$$ lams ["f", "p"]
(lam "x"
(churchIs0 $$ v "x"
$$ (churchLte $$ v "n" $$ (churchSnd $$ v "p")
$$ (churchPair $$ (churchS $$ (churchFst $$ v "p")) $$ church0)
$$ v "p"
)
$$ (v "f" $$ (churchPair $$ (churchS $$ (churchFst $$ v "p")) $$ v "x"))
)
$$ (churchSub $$ (churchSnd $$ v "p") $$ v "n")
)
$$ (churchPair $$ church0 $$ v "m")
)
)
churchSudan :: Term
churchSudan = fix $$ lam "f" (lams ["n", "x", "y"]
(churchIs0 $$ v "n"
$$ (churchPlus $$ v "x" $$ v "y")
$$ (churchIs0 $$ v "y"
$$ v "x"
$$ (lam "fnpy"
(v "f" $$ (churchPred $$ v "n")
$$ v "fnpy"
$$ (churchPlus $$ v "fnpy" $$ v "y")
)
$$ (v "f" $$ v "n" $$ v "x" $$ (churchPred $$ v "y"))
)
)
))
churchAckermann :: Term
churchAckermann = fix $$ lam "A" (lams ["m", "n"]
(churchIs0 $$ v "m"
$$ (churchS $$ v "n")
$$ (churchIs0 $$ v "n"
$$ (v "A" $$ (churchPred $$ v "m") $$ church1)
$$ (v "A" $$ (churchPred $$ v "m")
$$ (v "A" $$ v "m" $$ (churchPred $$ v "n")))
)
)
)
| null | https://raw.githubusercontent.com/theodormoroianu/SecondYearCourses/5e359e6a7cf588a527d27209bf53b4ce6b8d5e83/FLP/Laboratoare/Lab%209/.history/HaskellChurch_20210415163944.hs | haskell | # LANGUAGE RankNTypes #
The boolean negation switches the alternatives
The boolean conjunction can be built as a conditional
The boolean disjunction can be built as a conditional
a pair is a way to compute something based on the values
contained within the pair.
a function to be applied on the values, it will apply it on them.
A natural number is any way to iterate a function s a number of times
over an initial value z
An instance to show CNats as regular natural numbers
0 will iterate the function s 0 times over z, producing z
Successor n either
- iterates s n times over (s z)
Addition of m and n is done by iterating s n times over m
Multiplication of m and n can be done by composing n and m
Exponentiation of m and n can be done by applying n to m
Testing whether a value is 0 can be done through iteration
using a function constantly false and an initial value true
of the predeccesor function
arithmetic
m is less than (or equal to) n if when substracting n from m we get 0
equality on naturals can be defined my means of comparisons
Fun with arithmetic and pairs
Define factorial. You can iterate over a pair to contain the current index and so far factorial
Given m and n, compute q and r satisfying m = q * n + r. If n is not 0 then r should be less than n.
hint repeated substraction, iterated for at most m times.
a list is a way to aggregate a sequence of elements given an aggregation function and an initial value.
An instance to show CLists as regular lists.
The empty list is that which when aggregated it will always produce the initial value
Adding an element to a list means that, when aggregating the list, the newly added
element will be aggregated with the result obtained by aggregating the remainder of the list
sums the elements in the list
checks whether a list is nil (similar to cIs0)
gets the head of the list (or the default specified value if the list is empty)
gets the head of the list (or the default specified value if the list is empty) | module HaskellChurch where
A boolean is any way to choose between two alternatives
newtype CBool = CBool {cIf :: forall t. t -> t -> t}
An instance to show as regular Booleans
instance Show CBool where
show b = "cBool " <> show (cIf b True False)
The boolean constant true always chooses the first alternative
cTrue :: CBool
cTrue = undefined
The boolean constant false always chooses the second alternative
cFalse :: CBool
cFalse = undefined
cBool :: Bool -> CBool
cBool True = cTrue
cBool False = cFalse
cNot :: CBool -> CBool
cNot = undefined
(&&:) :: CBool -> CBool -> CBool
(&&:) = undefined
infixr 3 &&:
(||:) :: CBool -> CBool -> CBool
(||:) = undefined
infixr 2 ||:
newtype CPair a b = CPair { cOn :: forall c . (a -> b -> c) -> c }
An instance to show CPairs as regular pairs .
instance (Show a, Show b) => Show (CPair a b) where
show p = "cPair " <> show (cOn p (,))
builds a pair out of two values as an object which , when given
cPair :: a -> b -> CPair a b
cPair = undefined
first projection uses the function selecting first component on a pair
cFst :: CPair a b -> a
cFst = undefined
second projection
cSnd :: CPair a b -> b
cSnd = undefined
newtype CNat = CNat { cFor :: forall t. (t -> t) -> t -> t }
instance Show CNat where
show n = show $ cFor n (1 +) (0 :: Integer)
c0 :: CNat
c0 = undefined
1 is the the function s iterated 1 times over z , that is , z
c1 :: CNat
c1 = undefined
- applies s one more time in addition to what n does
cS :: CNat -> CNat
cS = undefined
(+:) :: CNat -> CNat -> CNat
(+:) = undefined
infixl 6 +:
(*:) :: CNat -> CNat -> CNat
(*:) = \n m -> CNat $ cFor n . cFor m
infixl 7 *:
(^:) :: CNat -> CNat -> CNat
(^:) = \m n -> CNat $ cFor n (cFor m)
infixr 8 ^:
cIs0 :: CNat -> CBool
cIs0 = \n -> cFor n (\_ -> cFalse) cTrue
Predecessor ( evaluating to 0 for 0 ) can be defined iterating
over pairs , starting from an initial value ( 0 , 0 )
cPred :: CNat -> CNat
cPred = undefined
substraction from m n ( evaluating to 0 if m < n ) is repeated application
(-:) :: CNat -> CNat -> CNat
(-:) = \m n -> cFor n cPred m
Transform a value into a CNat ( should yield c0 for nums < = 0 )
cNat :: (Ord p, Num p) => p -> CNat
cNat n = undefined
We can define an instance Num CNat which will allow us to see any
integer constant as a CNat ( e.g. 12 : : CNat ) and also use regular
instance Num CNat where
(+) = (+:)
(*) = (*:)
(-) = (-:)
abs = id
signum n = cIf (cIs0 n) 0 1
fromInteger = cNat
(<=:) :: CNat -> CNat -> CBool
(<=:) = undefined
infix 4 <=:
(>=:) :: CNat -> CNat -> CBool
(>=:) = \m n -> n <=: m
infix 4 >=:
(<:) :: CNat -> CNat -> CBool
(<:) = \m n -> cNot (m >=: n)
infix 4 <:
(>:) :: CNat -> CNat -> CBool
(>:) = \m n -> n <: m
infix 4 >:
(==:) :: CNat -> CNat -> CBool
(==:) = undefined
cFactorial :: CNat -> CNat
cFactorial = undefined
Define Fibonacci . You can iterate over a pair to contain two consecutive numbers in the sequence
cFibonacci :: CNat -> CNat
cFibonacci = undefined
cDivMod :: CNat -> CNat -> CPair CNat CNat
cDivMod = undefined
newtype CList a = CList { cFoldR :: forall b. (a -> b -> b) -> b -> b }
make CList an instance of Foldable
instance Foldable CList where
instance (Show a) => Show (CList a) where
show l = "cList " <> (show $ toList l)
cNil :: CList a
cNil = undefined
(.:) :: a -> CList a -> CList a
(.:) = undefined
we can obtain a CList from a regular list by folding the list
cList :: [a] -> CList a
cList = undefined
builds a CList of CNats corresponding to a list of Integers
cNatList :: [Integer] -> CList CNat
cNatList = undefined
cSum :: CList CNat -> CNat
cSum = undefined
cIsNil :: CList a -> CBool
cIsNil = \l -> cFoldR l (\_ _ -> cFalse) cTrue
cHead :: CList a -> a -> a
cHead = undefined
cTail :: CList a -> CList a
cTail = \l -> cFst $ cFoldR l (\x p -> (\t -> cPair t (x .: t)) (cSnd p)) (cPair cNil cNil)
cLength :: CList a -> CNat
cLength = \l -> cFoldR l (\_ n -> cS n) 0
fix :: Term
fix = lam "f" (lam "x" (v "f" $$ (v "x" $$ v "x")) $$ lam "x" (v "f" $$ (v "x" $$ v "x")))
divmod :: (Enum a, Num a, Ord b, Num b) => b -> b -> (a, b)
divmod m n = divmod' (0, 0)
where
divmod' (x, y)
| x' <= m = divmod' (x', succ y)
| otherwise = (y, m - x)
where x' = x + n
divmod' m n =
if n == 0 then (0, m)
else
Function.fix
(\f p ->
(\x' ->
if x' > 0 then f ((,) (succ (fst p)) x')
else if (<=) n (snd p) then ((,) (succ (fst p)) 0)
else p)
((-) (snd p) n))
(0, m)
churchDivMod' :: Term
churchDivMod' = lams ["m", "n"]
(churchIs0 $$ v "n"
$$ (churchPair $$ church0 $$ v "m")
$$ (fix
$$ lams ["f", "p"]
(lam "x"
(churchIs0 $$ v "x"
$$ (churchLte $$ v "n" $$ (churchSnd $$ v "p")
$$ (churchPair $$ (churchS $$ (churchFst $$ v "p")) $$ church0)
$$ v "p"
)
$$ (v "f" $$ (churchPair $$ (churchS $$ (churchFst $$ v "p")) $$ v "x"))
)
$$ (churchSub $$ (churchSnd $$ v "p") $$ v "n")
)
$$ (churchPair $$ church0 $$ v "m")
)
)
churchSudan :: Term
churchSudan = fix $$ lam "f" (lams ["n", "x", "y"]
(churchIs0 $$ v "n"
$$ (churchPlus $$ v "x" $$ v "y")
$$ (churchIs0 $$ v "y"
$$ v "x"
$$ (lam "fnpy"
(v "f" $$ (churchPred $$ v "n")
$$ v "fnpy"
$$ (churchPlus $$ v "fnpy" $$ v "y")
)
$$ (v "f" $$ v "n" $$ v "x" $$ (churchPred $$ v "y"))
)
)
))
churchAckermann :: Term
churchAckermann = fix $$ lam "A" (lams ["m", "n"]
(churchIs0 $$ v "m"
$$ (churchS $$ v "n")
$$ (churchIs0 $$ v "n"
$$ (v "A" $$ (churchPred $$ v "m") $$ church1)
$$ (v "A" $$ (churchPred $$ v "m")
$$ (v "A" $$ v "m" $$ (churchPred $$ v "n")))
)
)
)
|
f2b6a033086b133b8834a9fd1143779fec282c7600a63af56b685252d8500c68 | siers/zn | TLS.hs | #file-fetch-url-hs-L27
-- stack -v runghc --package connection --package http-client --package http-client-tls --package tls --package data-default
{-# LANGUAGE OverloadedStrings #-}
# LANGUAGE ViewPatterns #
# OPTIONS_GHC -fno - warn - deprecations #
module Zn.TLS (mkHttpManager) where
import qualified Network.Connection as NC
import qualified Network.HTTP.Client as Http
import qualified Network.HTTP.Client.TLS as Http
import qualified Network.TLS as TLS
import qualified Network.TLS.Extra as TLS (ciphersuite_all)
import qualified System.X509 as TLS
import Data.Default
import Data.Maybe
import Network.HTTP.Client
import System.Environment
import Prelude
main :: IO ()
main = do
murl <- getArgs
case listToMaybe murl of
(fmap parseUrl -> Just (Just req)) -> do
mgr <- mkHttpManager True
res <- httpLbs req mgr
print (show (responseStatus res))
_ -> error "usage: fetch-url [URL] (must include http:// or https://"
-- | Create an HTTP 'Manager' for running a 'Test'
mkHttpManager :: Bool -- ^ validate ssl
-> IO Manager
mkHttpManager validateSsl = do
scs <- TLS.getSystemCertificateStore
let tlsSettings = NC.TLSSettings (cp scs)
mngrCfg = Http.mkManagerSettings tlsSettings Nothing
Http.newManager mngrCfg
where
cp scs = (TLS.defaultParamsClient "" "") {
TLS.clientSupported = def {
TLS.supportedCiphers = TLS.ciphersuite_all
, TLS.supportedHashSignatures = hashSignatures
, TLS.supportedVersions [ TLS10 , TLS11 , TLS12 ]
}
, TLS.clientShared = def {
TLS.sharedCAStore = scs
, TLS.sharedValidationCache = validationCache
}
}
hashSignatures =
[ (TLS.HashSHA512, TLS.SignatureRSA)
, (TLS.HashSHA384, TLS.SignatureRSA)
, (TLS.HashSHA256, TLS.SignatureRSA)
, (TLS.HashSHA224, TLS.SignatureRSA)
, (TLS.HashSHA1, TLS.SignatureRSA)
, (TLS.HashSHA1, TLS.SignatureDSS)
" bad SignatureECDSA for ecdhparams "
" bad SignatureECDSA for ecdhparams "
, (TLS.HashSHA256, TLS.SignatureECDSA)
, (TLS.HashSHA224, TLS.SignatureECDSA)
, (TLS.HashSHA1, TLS.SignatureECDSA)
]
validationCache =
if not validateSsl then
TLS.ValidationCache
(\_ _ _ -> return TLS.ValidationCachePass)
(\_ _ _ -> return ())
else
def
| null | https://raw.githubusercontent.com/siers/zn/b78692910fc5c4c725b3133cb91f5e1e3da94808/src/Zn/TLS.hs | haskell | stack -v runghc --package connection --package http-client --package http-client-tls --package tls --package data-default
# LANGUAGE OverloadedStrings #
| Create an HTTP 'Manager' for running a 'Test'
^ validate ssl | #file-fetch-url-hs-L27
# LANGUAGE ViewPatterns #
# OPTIONS_GHC -fno - warn - deprecations #
module Zn.TLS (mkHttpManager) where
import qualified Network.Connection as NC
import qualified Network.HTTP.Client as Http
import qualified Network.HTTP.Client.TLS as Http
import qualified Network.TLS as TLS
import qualified Network.TLS.Extra as TLS (ciphersuite_all)
import qualified System.X509 as TLS
import Data.Default
import Data.Maybe
import Network.HTTP.Client
import System.Environment
import Prelude
main :: IO ()
main = do
murl <- getArgs
case listToMaybe murl of
(fmap parseUrl -> Just (Just req)) -> do
mgr <- mkHttpManager True
res <- httpLbs req mgr
print (show (responseStatus res))
_ -> error "usage: fetch-url [URL] (must include http:// or https://"
-> IO Manager
mkHttpManager validateSsl = do
scs <- TLS.getSystemCertificateStore
let tlsSettings = NC.TLSSettings (cp scs)
mngrCfg = Http.mkManagerSettings tlsSettings Nothing
Http.newManager mngrCfg
where
cp scs = (TLS.defaultParamsClient "" "") {
TLS.clientSupported = def {
TLS.supportedCiphers = TLS.ciphersuite_all
, TLS.supportedHashSignatures = hashSignatures
, TLS.supportedVersions [ TLS10 , TLS11 , TLS12 ]
}
, TLS.clientShared = def {
TLS.sharedCAStore = scs
, TLS.sharedValidationCache = validationCache
}
}
hashSignatures =
[ (TLS.HashSHA512, TLS.SignatureRSA)
, (TLS.HashSHA384, TLS.SignatureRSA)
, (TLS.HashSHA256, TLS.SignatureRSA)
, (TLS.HashSHA224, TLS.SignatureRSA)
, (TLS.HashSHA1, TLS.SignatureRSA)
, (TLS.HashSHA1, TLS.SignatureDSS)
" bad SignatureECDSA for ecdhparams "
" bad SignatureECDSA for ecdhparams "
, (TLS.HashSHA256, TLS.SignatureECDSA)
, (TLS.HashSHA224, TLS.SignatureECDSA)
, (TLS.HashSHA1, TLS.SignatureECDSA)
]
validationCache =
if not validateSsl then
TLS.ValidationCache
(\_ _ _ -> return TLS.ValidationCachePass)
(\_ _ _ -> return ())
else
def
|
3f7010936ec07bc382bacd368a6be7e57edf8dfa7f4255315f28fbbd6815dd3a | GaloisInc/flexdis86 | Flexdis86.hs | |
Module : $ Header$
Copyright : ( c ) Galois , Inc , 2016
Maintainer :
Top - level module for .
Module : $Header$
Copyright : (c) Galois, Inc, 2016
Maintainer :
Top-level module for Flexdis.
-}
module Flexdis86
( module Flexdis86.InstructionSet
, module Flexdis86.Prefixes
, module Flexdis86.Register
, module Flexdis86.Relocation
, module Flexdis86.Segment
, module Flexdis86.Operand
*
, disassembleInstruction
, tryDisassemble
, disassembleBuffer
, D.DisassembledAddr(..)
, module Flexdis86.ByteReader
-- * Assembler
, mkInstruction
, A.assembleInstruction
, A.InstructionEncodingException(..)
) where
import Control.Monad ( MonadPlus )
import qualified Data.ByteString as B
import qualified Flexdis86.Assembler as A
import Flexdis86.ByteReader
import Flexdis86.DefaultParser
import qualified Flexdis86.Disassembler as D
import Flexdis86.InstructionSet
import Flexdis86.Operand
import Flexdis86.Prefixes
import Flexdis86.Register
import Flexdis86.Relocation
import Flexdis86.Segment
| Parse instruction using byte reader .
disassembleInstruction :: ByteReader m
=> m InstructionInstance
disassembleInstruction = D.disassembleInstruction defaultX64Disassembler
-- | Try disassemble returns the numbers of bytes read and an instruction instance.
tryDisassemble :: B.ByteString -> (Int, Maybe InstructionInstance)
tryDisassemble = D.tryDisassemble defaultX64Disassembler
disassembleBuffer :: B.ByteString
-- ^ Buffer to decompose
-> [D.DisassembledAddr]
disassembleBuffer = D.disassembleBuffer defaultX64Disassembler
| Create zero or more instruction instances from a string and arguments .
mkInstruction :: MonadPlus m
=> String
-- ^ Mnemonic
-> [Value]
-- ^ Arguments
-> m InstructionInstance
mkInstruction = A.mkInstruction defaultX64Assembler
| null | https://raw.githubusercontent.com/GaloisInc/flexdis86/9bd6fc6a9480d2ea0cd22d04fd5a5e4ae532504a/src/Flexdis86.hs | haskell | * Assembler
| Try disassemble returns the numbers of bytes read and an instruction instance.
^ Buffer to decompose
^ Mnemonic
^ Arguments | |
Module : $ Header$
Copyright : ( c ) Galois , Inc , 2016
Maintainer :
Top - level module for .
Module : $Header$
Copyright : (c) Galois, Inc, 2016
Maintainer :
Top-level module for Flexdis.
-}
module Flexdis86
( module Flexdis86.InstructionSet
, module Flexdis86.Prefixes
, module Flexdis86.Register
, module Flexdis86.Relocation
, module Flexdis86.Segment
, module Flexdis86.Operand
*
, disassembleInstruction
, tryDisassemble
, disassembleBuffer
, D.DisassembledAddr(..)
, module Flexdis86.ByteReader
, mkInstruction
, A.assembleInstruction
, A.InstructionEncodingException(..)
) where
import Control.Monad ( MonadPlus )
import qualified Data.ByteString as B
import qualified Flexdis86.Assembler as A
import Flexdis86.ByteReader
import Flexdis86.DefaultParser
import qualified Flexdis86.Disassembler as D
import Flexdis86.InstructionSet
import Flexdis86.Operand
import Flexdis86.Prefixes
import Flexdis86.Register
import Flexdis86.Relocation
import Flexdis86.Segment
| Parse instruction using byte reader .
disassembleInstruction :: ByteReader m
=> m InstructionInstance
disassembleInstruction = D.disassembleInstruction defaultX64Disassembler
tryDisassemble :: B.ByteString -> (Int, Maybe InstructionInstance)
tryDisassemble = D.tryDisassemble defaultX64Disassembler
disassembleBuffer :: B.ByteString
-> [D.DisassembledAddr]
disassembleBuffer = D.disassembleBuffer defaultX64Disassembler
| Create zero or more instruction instances from a string and arguments .
mkInstruction :: MonadPlus m
=> String
-> [Value]
-> m InstructionInstance
mkInstruction = A.mkInstruction defaultX64Assembler
|
5d9022d90ecf7e040abe2c73a33ae1de66a0cd7d7c01fb2c6349e938fafc9c72 | dancrossnyc/multics | e_interact_.lisp | ;;; ***********************************************************
;;; * *
* Copyright , ( C ) Honeywell Bull Inc. , 1988 *
;;; * *
* Copyright , ( C ) Honeywell Information Systems Inc. , 1982 *
;;; * *
* Copyright ( c ) 1978 by Massachusetts Institute of *
* Technology and Honeywell Information Systems , Inc. *
;;; * *
;;; ***********************************************************
;;;
;;;
;;; e_interact_
;;;
;;; All that of the basic editor which deals with being interactive
;;; commands, prefixes, etc., as opposed to being an editor.
;;; HISTORY COMMENTS:
1 ) change(84 - 01 - 30,Margolin ) , approve ( ) , audit ( ) , install ( ):
;;; pre-hcom history:
;;; Split off from e_ when he grew too gravid.
;;; BSG 8/4/78
;;; Modified 1978.11.27-29 to reorganize interrupt stuff, etc. by rsl.
Macro facility redone 2/11/79 by BSG .
Modified 06/20/79 by GMP for CTL prologue / epilogue handlers .
;;; Modified 08/21/79 by GMP for negative arguments.
Modified : August 1979 by GMP for new command invocation mechanism .
Modified : June 1981 by RMSoley for understanding of emacs _ call .
Modified : July 1981 RMSoley for pl1 argument parsing , and support
;;; of multiple emacs's, tasking.
Modified : March 1982 RMSoley for undo .
Modified : June 1982 B - get - top - level - char - innards nulls
;;; out previous-command after echo-negotiation. Also, last-input-char
;;; is maintained by get-a-char, not process-char, so it is
more correct . Added JSL 's new command executor stuff .
;;; Set up the &undo property on more commands.
Modified : 25 November 1983 to add " ^ [ " as a valid
;;; escape prefix in parse-key-description.
Modified : 19 January 1984 to comment out register - option
;;; forms, as they were moved to e_option_defaults_.
Modified : 19 January 1984 Barmar to reject esc-<number > in genset - key .
Modified : 30 January 1984 Barmar to fix kmacro - display - interpret to
properly interpret " ESC + NUM " and meta characters .
2 ) change(84 - 12 - 25,Margolin ) , approve(86 - 02 - 24,MCR7186 ) ,
;;; audit(86-08-12,Harvey), install(86-08-20,MR12.0-1136):
;;; to fix wrong-type-arg error
in multiplier command , change lambda into let , use defmacro .
3 ) change(84 - 12 - 26,Margolin ) , approve(86 - 02 - 24,MCR7186 ) ,
;;; audit(86-08-12,Harvey), install(86-08-20,MR12.0-1136):
;;; to fix bug in the rewrite of permanently-set.
4 ) change(84 - 12 - 30,Margolin ) , approve(86 - 02 - 24,MCR7186 ) ,
;;; audit(86-08-12,Harvey), install(86-08-20,MR12.0-1136):
;;; to remove top-level setq of
;;; suppress-remarks, as it has been set in e_option_defaults_; changed
;;; set-emacs-interrupt to grow the handler and handle arrays if
;;; necessary, changed extended-command to ignore null command lines,
;;; fixed some problems in key binding management, changed special
;;; declaration to defvar, moved %include's to before declarations.
5 ) change(88 - 01 - 07,Schroth ) , approve(88 - 02 - 29,MCR7851 ) ,
;;; audit(88-06-08,RBarstad), install(88-08-01,MR12.2-1071):
Implement 8 - bit extended ASCII I / O. Used ' new ' macros in various
;;; places to improve readibility.
6 ) change(88 - 01 - 07,Schroth ) , approve(88 - 02 - 29,MCR7852 ) ,
;;; audit(88-06-08,RBarstad), install(88-08-01,MR12.2-1071):
Added support for split - screen display : revert to one split on
;;; exit and restore screen splits when later restarted.
;;; END HISTORY COMMENTS
(declare (genprefix /!eia_))
(%include e-macros)
(%include backquote)
(%include defmacro)
(declare (macros nil))
(%include e-define-command)
(%include other_other)
(%include sharpsign)
(declare (*lexpr display-error display-com-error display-error-noabort
display-com-error-noabort minibuffer-print
minibuffer-print-noclear minibuffer-remark))
(declare (*expr DCTL-epilogue DCTL-prologue assert-minor-mode clear-the-screen
convert_status_code_ cur-hpos decimal-rep display-init
e_argument_parse_$get_one_path e_pl1_$init
e_argument_parse_$get_startup_info
e_argument_parse_$new_arguments e_lap_$rtrim e_lap_$trim
e_pl1_$assign_channel e_pl1_$dump_output_buffer
e_pl1_$echo_negotiate_get_char e_pl1_$get_char
e_pl1_$get_editing_chars e_pl1_$get_emacs_interrupt
e_pl1_$get_emacs_interrupt_array e_pl1_$real_have_chars
e_pl1_$set_break_char e_pl1_$set_emacs_tty_modes
e_pl1_$set_multics_tty_modes e_tasking_$destroy_me
e_pl1_$set_extended_ascii e_pl1_$get_output_conv_table
e_tasking_$get_tasking_flag e_tasking_$quit echo-buffer-clear
echo-buffer-clear-all echo-buffer-outprint echo-buffer-print
echo-buffer-rubout echo-buffer-utter editor-main-init
emacs$set_emacs_return_code empty-buffer-p end-local-displays
error_table_ exists-file find-file-subr full-redisplay
get-buffer-state go-to-or-create-buffer init-local-displays
intern-minibuf-response jetteur-des-gazongues
lisp-quit-function loadfile local-display-generator-nnl
map-over-emacs-buffers minibuf-response negate-minor-mode
nullstringp randomize-redisplay rdis-find-non-displayable
redisplay ring-tty-bell
set-autoload-lib set-lisp-rdis-meters user_info_$homedir
user_info_$whoami yesp))
(declare (array* (notype (key-bindings 256. 2))))
(declare (array* (notype (saved-command-history 50.))))
(array saved-command-history t 50.)
;;; The key binding arrays.
;;; These are created and initialized at dump time so that the
;;; user needn't wait through them at startup time.
(array key-bindings t 256. 2)
(fillarray 'key-bindings '(undefined-command))
(array alternate-key-bindings t 256. 2)
(fillarray 'alternate-key-bindings '(undefined-command))
(setq permanize-key-bindings t)
(defvar (
tty is a TELNET connection
*transparent-commands* ;never becomes previous-command
last-time-sample ;for command bell
command-bell ;option for command bell
command-bell-count ;also
meter-commands ;option for command metering
for complete - command , ESC - SPACE
tty-type ;Terminal type.
NowDumpingEmacs ;t at dump time
tasking-emacs ;t if we are running tasked.
tasking-restarted ;t if we've been restarted.
emacs-name ;called name of this incarnation:
emacs / new_emacs / emacs _
suppress utterances by
quit-on-break ;whether or not to quit on typed BREAK
;during emacs_ invocation.
documentation-dir ;for help command
history-next-index ;for command history
next-multics-argno
buffer-minor-modes ;used for checking macro hack
buffer-modified-flag
suppress-redisplay-flag ;controls whether redisplay is enabled
e-quit-transparency ;Allows quits not to screen-hack
terminal needs hacking on setting Emacs tty modes
DCTL-epilogue-availablep ;terminal needs hacking on setting Multics tty modes
delayed-interrupt ;interrupt went off in minibuffer
damaged-flag ;redisplay, do all the work!
in .
known-buflist ;list of known buffers
kparse-list ;used in key parsing.
numarg ;numeric argument to current function, or nil if none
undo ;whether or not to undo; like numarg
list of MCS escape ( \ ) , erase ( # ) , and kill ( @ ) characters
MCS-escape-character ;MCS escape character (\)
emacs-epilogue-action-list ;things to be done on exit
last-input-char ;current char, for self-inserts
last-command-triplet-1 ;current/last command being executed
last-command-triplet-mpfxk ;continuation of above, encoded.
current-buffer ;symbol name of current buffer
list-of-known-options ;for option mechanism, list thereof.
macrostack ;format is (macro restart count)
macro-collection-in-progress
last-macro-definition
pointer on current xec list
nobreak-functions ;functions that don't break echnego
as it says , assq list
permanize-key-bindings ;on at init time, until start-up over
previous-buffer ;buffer we came from
current-command ;command being executed
last command invoked in this Emacs
previous-argument-list ;argument list used to invoke last cmd
user-display-variable ;for user opinion on mode line
locechnego-ctr ;meters
locechnego-meter
next-interrupt-channel ;lowest unused entry in interrupt handler table
recursion-level ;records when interrupt handler may cause a redisplay
e-lisp-error-mode ;how to treat lisp errors
inhibit-default-start-up-execution
emacs-start-ups-need-running
NLCHARSTRING ;a newline as string object
TAB ;ascii TAB
ESC ;ascii escape
CRET ;carriage return symbol
CR ;that too
NL
Formfeed
VT ;Vertical Tab
put in mbuf by pi - handler
args:apply-arg
args:ns
args:paths
args:ll
args:pl
tasking-arg
terminal can do 8bit ASCII
177 normally or 377 if 8 - bit
))
(defvar (
split-mode-p ;on if split screens
))
(declare (*expr rdis-restore-screen-to-one-split
rdis-recreate-splits-on-screen))
(defun display-load-time-error n
(princ (apply 'catenate (listify n)))
(terpri)
(break load-time-error t))
(putprop 'display-error
'(lambda n (apply 'display-load-time-error (listify n))) 'expr)
(putprop 'minibuffer-print
'(lambda n (apply 'display-load-time-error (listify n))) 'expr)
Macros to test bits in left - half of a fixnum : ( tlnX value mask )
(defmacro tlnn (value mask) ;t if any bit is on
`(not (tlne ,value ,mask)))
(defmacro tlne (value mask) ;t if all bits are off
`(zerop (logand ,value (lsh ,mask 18.))))
;;;
;;;
;;; Character function binding generators.
;;;
(defmacro permanently-set (&body forms)
`(let ((permanize-key-bindings t))
.,forms))
(defcom set-perm-key
&arguments ((key &symbol &prompt "Key: ")
(function &symbol &prompt "Function: "))
&numeric-argument (&reject)
(permanently-set (set-key key function)))
(defcom-synonym set-permanent-key set-perm-key)
(defcom set-key
&arguments ((key &symbol &prompt "Key: ")
(function &symbol &prompt "Function: "))
&numeric-argument (&reject)
(let ((result (parse-key-description key)))
(genset-key (caddr result) (car result) (cadr result) function)))
;;;
;;; This is the setter of all keys.
;;;
(defvar permit-setting-esc-number nil)
(defun genset-key (prefix metap key function)
(or permit-setting-esc-number
(= metap 0)
(and (not (= key (CtoI "+")))
(not (= key (CtoI "-")))
(or (< key (CtoI "0"))
(> key (CtoI "9"))))
;; esc-<number>
(display-error "esc-<number> may not be bound."))
(and (or prefix (= metap 1)) (> key (1- (CtoI "a"))) (< key (1+ (CtoI "z")))
(setq key (- key 40)))
(cond (prefix
(or (not (symbolp (key-bindings prefix 0)))
(genset-key nil 0 prefix
(let ((x (fillarray (*array (gensym) t 256.) '(undefined-command))))
(store (x 7) 'ignore-prefix)
x))) ;make ^G punt prefix only
(setq metap (key-bindings prefix 0)) ; this is array.
(cond (permanize-key-bindings
(remove-local-key-binding 0 key prefix)) ;override
((arraycall t metap key) ;one there already
(update-perm-key-bindings 0 key prefix (arraycall t metap key))
(update-local-key-bindings 0 key prefix function)))
(store (arraycall t metap key) function))
(t (cond (permanize-key-bindings
(remove-local-key-binding metap key nil))
((key-bindings key metap)
(update-perm-key-bindings metap key nil (key-bindings key metap))
(update-local-key-bindings metap key nil function)))
(or NowDumpingEmacs
(cond ((memq (key-bindings key metap) nobreak-functions)
(e_pl1_$set_break_char key 1)))
(cond ((memq function nobreak-functions)
(e_pl1_$set_break_char key 0))))
(store (key-bindings key metap) function))))
(defun update-perm-key-bindings (metap key prefix function)
(let ((keyrep (key-total-printed-symbol metap key prefix)))
(or (and (not permanize-key-bindings) ;this redundant clause is a way out
(assq keyrep per-buffer-key-bindings)) ;dont overpush
(putprop keyrep function 'perm-key-function))))
(defun update-local-key-bindings (metap key prefix function)
(let ((keyrep (key-total-printed-symbol metap key prefix))
(listrep (key-fixnum-rep-encode metap key prefix)))
(let ((assq-answer (assq keyrep per-buffer-key-bindings)))
(cond (assq-answer (rplaca (cdr assq-answer) function))
(t (setq per-buffer-key-bindings
(cons (cons keyrep (cons function listrep))
per-buffer-key-bindings)))))))
(defun remove-local-key-binding (metap key prefix)
(let ((key-symbol (key-total-printed-symbol metap key prefix)))
(let ((assq-answer
(assq key-symbol per-buffer-key-bindings)))
(if assq-answer
(setq per-buffer-key-bindings
(delq assq-answer per-buffer-key-bindings))))))
(defun key-total-printed-symbol (metap key prefix)
(intern (make_atom (cond (prefix (catenate (printable prefix)(printable key)))
((= 0 metap)(printable key))
(t (catenate "esc-" (printable key)))))))
;;; Get printable name of a key
(defun get-key-name (key-list)
(apply 'key-total-printed-symbol key-list))
(defun key-fixnum-rep-encode (metap key prefix)
(list metap key prefix))
(defun reorganize-local-key-bindings (revert)
(let ((permanize-key-bindings t)
(saved-local-bindings (append per-buffer-key-bindings nil))) ;copy list
(unwind-protect
(progn (mapc '(lambda (x)
(prog (y)
(setq y (cond (revert (get (car x) 'perm-key-function))
(t (cadr x))))
-non - prefix first
(genset-key nil (car (cddr x)) (cadr (cddr x)) y))))
per-buffer-key-bindings)
(mapc '(lambda (x)
(prog (y)
(setq y (cond (revert (get (car x) 'perm-key-function))
(t (cadr x))))
(and (caddr (cddr x)) ; prefixed ones
(genset-key (caddr (cddr x)) 0 (cadr (cddr x)) y))))
per-buffer-key-bindings))
(setq per-buffer-key-bindings saved-local-bindings))))
(defun revert-local-key-bindings ()(reorganize-local-key-bindings t))
(defun instate-local-key-bindings ()(reorganize-local-key-bindings nil))
(defun printable (x)
(let ((y (cond ((numberp x) x)
(t (getcharn x 1)))))
8 - bit or META
((= y 33) "ESC")
((= y 15) "CR")
((= y 177) "\177")
((= y 40) "SPACE")
((< y 40) (catenate "^" (ascii (bit-set 100 y))))
((numberp x)(ascii x))
(t x))))
(defun printable-8-bit-char (ch-num)
the display rep of char that is either an 8 - bit ASCII or a meta char
(cond (DCTL-extended-ascii (printable-extended-ascii ch-num))
(t (printable-meta-char ch-num))))
(defun printable-extended-ascii (ch-num)
returns the display representation of an 8 - bit ASCII code
(let ((ch (ascii ch-num)))
(cond ((> (rdis-find-non-displayable ch 1 0) 0) ch) ;displayable
(t (catenate "ext-" (printable (bit-clear 200 ch-num))))))) ;not displayable
(defun printable-meta-char (ch-num)
;; returns the display rep of a meta-char
;; For R11/ITS telnet ^_l
(catenate "meta-" (printable (bit-clear 200 ch-num))))
(defun prinkeyrep-to-num (x) (cadr (parse-key-description x))) ;compatibility
;;; Swaps "alternate-key-bindings" (the emacs_ table) with "key-bindings,"
;;; the standard full-emacs table.
(defun swap-binding-tables ()
(do a 0 (1+ a) (= a 2)
(do b 0 (1+ b) (= b 256.)
(store (key-bindings b a)
(prog1 (alternate-key-bindings b a)
(store (alternate-key-bindings b a)
(key-bindings b a)))))))
;;;
;;; Full-hog key parser,
BSG 8/5/78 Saturday morning .
;;;
(defun parse-key-description (desc) ;returns (m k p)
(prog (prefix metap key)
(setq kparse-list (exploden desc)) ;char-by-char
(cond ((or (parse-key-match-list '(e s c a p e -))
(parse-key-match-list '(e s c -))
(parse-key-match-list '(m e t a -))
(parse-key-match-list '(m -))
(parse-key-match-list '(^ [ -))
(parse-key-match-list '(^ [)))
(setq metap 1))
(t (setq metap 0)
try for 1 frob .
(or kparse-list (return (list 0 prefix nil))) ;non-meta, non-prefix
(parse-key-match-list '(-)) ;rip out minus
(or kparse-list (kparse-error desc))
(or (< prefix (CtoI " "))
(kparse-error (catenate (printable prefix)
" may not be a prefix character.")))))
(setq key (parse-key-description-syllable desc))
(and (or (= 1 metap) prefix) (> key (1- (CtoI "a")))
(< key (1+ (CtoI "z")))(setq key (- key 40)))
(and kparse-list (kparse-error desc))
(return (list metap key prefix))))
(defun parse-key-description-syllable (desc)
(cond ((not kparse-list)(kparse-error desc))
control frob , = " ^ "
(setq kparse-list (cdr kparse-list))
(cond ((not kparse-list) 136) ;plain old hat
(t (parse-key-controllify))))
((or (parse-key-match-list '(c -))
(parse-key-match-list '(c t l -))
(parse-key-match-list '(c o n t r o l -)))
(parse-key-controllify))
added Dec 84 EDSchroth
(or (parse-key-match-list '(x -))
(parse-key-match-list '(e x t -))
(parse-key-match-list '(e x t e n d e d -))))
(parse-key-extendify desc)) ;make it an extended ASCII
((parse-key-match-list '(e s c)) 33)
((parse-key-match-list '(c r)) 15)
((parse-key-match-list '(\ /1 /7 /7)) 177)
((parse-key-match-list '(t a b)) 11)
((parse-key-match-list '(s p a c e)) 40)
((parse-key-match-list '(s p)) 40)
(t (prog1 (car kparse-list)
(setq kparse-list (cdr kparse-list))))))
(defun parse-key-controllify ()
(or kparse-list (kparse-error "Unspecified control character."))
(let ((kdesc (car kparse-list)))
(and (> kdesc (1- (CtoI "a")))
(< kdesc (1+ (CtoI "z")))
(setq kdesc (- kdesc 40)))
(or (and (< kdesc (1+ (CtoI "_")))
(> kdesc (1- (CtoI "@"))))
(kparse-error (catenate "^" (ascii kdesc) " is not ASCII.")))
(setq kparse-list (cdr kparse-list))
(- kdesc 100)))
Handles extended ascii key descriptions . Dec 84 EDSchroth
(defun parse-key-extendify (desc)
(or kparse-list (kparse-error "Unspecified extended character."))
make 8 - bit ASCII
(defun parse-key-match-list (matchee)
(do ((data kparse-list (cdr data))
(pattern matchee (cdr pattern))
(chara)(charb)(chardata))
((null pattern)(setq kparse-list data) t)
(or data (return nil)) ;nothing more
(setq chardata (car data))
(setq chara (getcharn (car pattern) 1))
(setq charb (cond ((and (< chara (1+ (CtoI "z")))
(> chara (1- (CtoI "a"))))
(- chara 40))
(t chara)))
(or (= chardata chara)(= chardata charb)(return nil))))
(defun kparse-error (desc)
(display-error "Invalid key description: " desc))
;;;
;;; Randomness
;;;
(setq NLCHARSTRING (ItoC 012) ESC (ascii 033))
(setq TAB (ascii 011) BACKSPACE (ascii 010) SPACE (ascii 040) CR (ascii 15)
CRET (ascii 015) NL (ascii 012) FF (ascii 14) VT (ascii 13))
;;;
;;;
Initialize the option mechanism first .
;;;
(setq list-of-known-options nil)
(defun require-symbol (putative-symbol)
(cond ((not (symbolp putative-symbol))
(display-error "This function requires a symbol."))))
(defun register-option (sym val)
(require-symbol sym)
(or (memq sym list-of-known-options)
(setq list-of-known-options
(sort (cons sym list-of-known-options) 'alphalessp)))
(remprop sym 'value-must-be-numeric)
(remprop sym 'value-ok-true-false)
(or (boundp sym)(set sym val)))
;;;(register-option 'eval:eval t) ; Unfortunately ;;; moved to e_option_defaults_
;;;(register-option 'eval:assume-atom nil) ;;; moved to e_option_defaults_
;;;(register-option 'eval:correct-errors nil) ;;; moved to e_option_defaults_
( register - option ' eval : prinlevel 3 ) ; ; ; moved to e_option_defaults _
( register - option ' eval : 6 ) ; ; ; moved to e_option_defaults _
;;;
;;; Listener
;;; and toplevels.
;;;
(defun listener-level () (start) (std-yggdrasil))
(defun start ()
11/3/80
(setq e-quit-transparency nil)
Lisp errors to minibuf
(and (eq emacs-name 'emacs_) (swap-binding-tables))
(get-editing-characters) ;read erase, kill, escape chars
(editor-main-init) ;init the guts of the editor.
(or (boundp 'next-multics-argno) (setq next-multics-argno 1))
(setq history-next-index 0)
(setq macro-collection-in-progress nil previous-command nil
last-macro-definition nil)
(setq emacs-epilogue-action-list nil)
(sstatus cleanup '((run-emacs-epilogue-actions)))
(*rset nil)
(e_pl1_$set_emacs_tty_modes)
(sstatus mulpi t)
(sstatus interrupt 16. 'emacs-quit-handler)
(sstatus mulquit 16.)
(init-echnego-bittab)
(setq errlist '((pi-handler))) ;CTRL/g escapes lossages
init rsl 's hack .
(display-init) ;initialize the redisplay
fix up for possible 8 - bit
And the PL / I redisplay .
(interrupt-init) ;And the interrupt scheme.
(setq permanize-key-bindings nil)
(reset-top-level-editor-state)
(setq emacs-start-ups-need-running t))
Initialize the 8 - bit printing character scan table at dump time
;;; This should be in e_redisplay_ but is done here as the per invocation
;;; stuff is done here.
(declare
7bit non - printing
8bit non - printing
(defvar 7bit-tabscan-table
(fillarray (*array '7bit-tabscan-table 'fixnum 128.) '(-1)))
(defvar 8bit-tabscan-table
(fillarray (*array '8bit-tabscan-table 'fixnum 128.) '(-1)))
040 ... 173 print nicely
((= i 31.))
(store (arraycall fixnum 7bit-tabscan-table i) 0)
(store (arraycall fixnum 8bit-tabscan-table i) 0))
nix 177
nix 177
;;; Takes care of per invocation set-up for extended ASCII
Dec 1984 EDSchroth
(defun init-extended-ascii-land ()
(setq char-input-mask 177)
the ctl knows about 8 - bit !
(setq char-input-mask 377)
(e_pl1_$set_extended_ascii 1)
add 8 - bit self - inserts based on TTT output conversion table
Also , define 8 - bit non - printing scan table
(let ((convtab (*array nil 'fixnum 64.)))
(e_pl1_$get_output_conv_table convtab)
do 8 - bit chars only
(next-byte-of (rot 777 -9.) (rot next-byte-of -9.))) ;successive bytes
stop after # o377
(or (bit-test next-byte-of (arraycall fixnum convtab (// i 4))) ;pick a byte
if zero
copy entries for 200 ... 377
((= i 64.)) ;to scan table
(store (arraycall fixnum 8bit-tabscan-table i)
(arraycall fixnum convtab i))))
(e_pl1_$set_emacs_tty_modes)))) ;fix-up modes
(defvar emacs-start-up-error-message)
(defun run-emacs-start-up-error (arg)
arg
(display-error-noabort emacs-start-up-error-message)
(throw () emacs-start-up-tag))
(defun run-emacs-start-up-actions ()
(setq inhibit-default-start-up-execution nil)
(or (eq emacs-name 'emacs_)
(run-user-start-up (catenate (e_lap_$trim (user_info_$homedir))
">start_up.emacs"))
(run-user-start-up (catenate (user-project-dir)
">start_up.emacs"))
(run-user-start-up ">site>start_up.emacs"))
(and (eq emacs-name 'emacs_) (go-to-or-create-buffer 'main))
(or inhibit-default-start-up-execution (default-emacs-start-up))
(cond ((eq current-buffer '|<start_up_emacs_buffer>|)
(go-to-or-create-buffer 'main)
(setq previous-buffer 'main))
((eq previous-buffer '|<start_up_emacs_buffer>|)
(setq previous-buffer current-buffer)))
(setq known-buflist (delq '|<start_up_emacs_buffer>| known-buflist)))
(defun user-project-dir ()
(catenate ">user_dir_dir>"
(e_lap_$trim (cadr (user_info_$whoami)))))
(defun run-user-start-up (filename)
(cond (args:ns 't)
((exists-file filename 4)
(setq emacs-start-up-error-message "Error in start_up.emacs")
(catch
(let ((e-lisp-error-mode 'run-emacs-start-up-error))
(loadfile filename))
emacs-start-up-tag) 't)
('else nil)))
Re - written by GMP , 9/4/78 .
Re - written by RMSoley , 21 July 1981
(defun default-emacs-start-up ()
(setq inhibit-default-start-up-execution t)
;; File-file the pathnames and macro files.
(do ((paths args:paths (1- paths)))
((zerop paths))
(let ((info (e_argument_parse_$get_one_path)))
(cond ((zerop (cadr info))
(setq emacs-start-up-error-message
(catenate "Can't load file " (car info)))
(catch
(let ((e-lisp-error-mode 'run-emacs-start-up-error))
(load (e_lap_$trim (car info))))
emacs-start-up-tag))
(t
(catch
(find-file-subr (e_lap_$trim (car info)))
pgazonga)))))
;; Do -apply arguments.
(cond ((> args:apply-arg -1)
(setq emacs-start-up-error-message "Can't do -apply.")
(catch
(let ((e-lisp-error-mode 'run-emacs-start-up-error))
(apply (make_atom (status arg args:apply-arg))
(multics-args-as-list (1+ args:apply-arg))))
emacs-start-up-tag)))
(and tasking-restarted (full-redisplay))
(setq tasking-restarted nil))
(defun multics-args-as-list (first-argno)
(do ((count first-argno (1+ count))
(l))
((not (status arg count)) (nreverse l))
(setq l (cons (status arg count) l))))
(setq pi-handler-minibuffer-print nil tasking-restarted nil)
(defun pi-handler ()
(e_pl1_$set_emacs_tty_modes)
(randomize-redisplay)
(and DCTL-prologue-availablep (DCTL-prologue))
(and split-mode-p (rdis-recreate-splits-on-screen))
(reset-top-level-editor-state)
(cond ((zerop (e_argument_parse_$new_arguments))
(full-redisplay))
(t (tasking-restart-internal)))
(cond (pi-handler-minibuffer-print
(minibuffer-print pi-handler-minibuffer-print)
(setq pi-handler-minibuffer-print nil)))
(std-yggdrasil))
(defun reset-top-level-editor-state ()
(or minibufferp (instate-local-key-bindings))
(setq suppress-redisplay-flag nil) ;restart redisplay if stopped
(cond ((memq 'Macro/ Learn buffer-minor-modes)
(negate-minor-mode 'Macro/ Learn)))
(setq damaged-flag t ;force redisplay to work on it
numarg nil
undo nil
macro-execution-in-progress nil
macro-collection-in-progress nil
macrostack nil)
(or minibufferp (setq recursion-level 0)))
Modified 28 June 1981 RMSoley to use set_break_sequence
Modified Dec 1984 EDSchroth for 8bit ASCII .
;;; Extended chars break echonego by default
(defun init-echnego-bittab ()
(do ((char 0 (1+ char))
(number 0)
(nlist ())
(count 0 (1+ count)))
((= char 256.)
(apply 'e_pl1_$set_break_sequence
(nreverse (cons number nlist))))
(and (not (zerop char))
(zerop (\ count 32.))
(setq nlist (cons number nlist)
count 0
number 0))
(setq number (lsh number 1))
(or (and (> char 31.) (< char 127.)
(memq (key-bindings char 0) nobreak-functions))
(setq number (1+ number)))))
(defcom debug-e
&numeric-argument (&reject)
(*rset t) (nouuo t) (sstatus uuolinks nil) ;et in saecula saeculorum amen
(setq e-lisp-error-mode 'lisp-break)
(sstatus mulpi 1) ;pi -> ^b interrupt
(sstatus interrupt 2 '(lambda (z)(pi-handler) z))) ;CTRL/a -> reenter
(defun get-editing-characters ()
(let ((editing-chars (e_pl1_$get_editing_chars)))
(setq MCS-editing-characters (mapcar 'CtoI editing-chars)
MCS-escape-character (car editing-chars))
(set-editing-key (car editing-chars) 'escape-char)
(set-editing-key (cadr editing-chars) 'rubout-char)
(set-editing-key (caddr editing-chars) 'kill-to-beginning-of-line)))
(defun set-editing-key (character function)
(cond ((eq (get-key-binding (parse-key-description character))
'self-insert)
(set-perm-key character function))))
;;;
;;; Following is all of Multics EMACS.
;;;
(defun std-yggdrasil () ;Root tree of universe
(do ()(nil)
ceci est jet'e
;seulement par ^G
(redisplay) ;gratuitous
(ring-tty-bell)
(reset-top-level-editor-state)))
(defun charlisten ()
(let ((recursion-level recursion-level))
(do nil (nil)
(or macro-execution-in-progress
emacs-start-ups-need-running
(redisplay))
(catch
(errset (let ((fail-act 'e-lisp-lossage-handler)
(pdl-overflow 'e-lisp-lossage-handler)
(wrng-type-arg 'e-lisp-lossage-handler)
(*rset-trap 'e-lisp-lossage-handler)
(unbnd-vrbl 'e-lisp-lossage-handler)
(undf-fnctn 'e-lisp-lossage-handler)
(unseen-go-tag 'e-lisp-lossage-handler)
(wrng-no-args 'e-lisp-lossage-handler)
(errset 'e-lisp-lossage-handler))
(cond
((eq emacs-start-ups-need-running t)
(setq emacs-start-ups-need-running nil)
(run-emacs-start-up-actions))
(emacs-start-ups-need-running
(funcall
(prog1 emacs-start-ups-need-running
(setq emacs-start-ups-need-running
nil)))))
(do ((numarg nil nil) (undo nil nil)) (nil)
(process-char (get-top-level-char))))
nil)
pgazonga)
(reset-top-level-editor-state))))
(defun e-lisp-lossage-handler (arg)
(setq arg (caddr (errframe nil)))
(cond (e-quit-transparency (errprint nil))
(t (minibuffer-print
(car arg) " " (maknam (explodec (cadr arg))))))
(cond ((eq e-lisp-error-mode 'lisp-break)
(let ((e-quit-transparency 'transparent))
(e_pl1_$set_multics_tty_modes)
(terpri)(terpri)
(princ
(catenate "Lisp error in buffer " current-buffer))
(terpri)
(setq arg (eval (list 'break (caddr arg) t)))
(e_pl1_$set_emacs_tty_modes)
(full-redisplay))
(cond (arg)(t (command-prompt-abort))))
((null e-lisp-error-mode)(command-quit))
(t (funcall e-lisp-error-mode arg))))
(defcom lisp-error-mode
&arguments ((mode &symbol &prompt "Mode: " ;&valid on off, when ready
&default off)) ;default to "normal"
&numeric-argument (&reject)
(cond ((memq mode '(nil reset off 0)) ;ick
(setq e-lisp-error-mode nil))
((memq mode '(t set on 1 lisp-break))
(setq e-lisp-error-mode 'lisp-break))
(t (display-error "Unknown lisp error mode: " mode))))
;;;
;;;
;;; Character readers
;;;
(declare (array* (notype (emacs-interrupt-handlers ?)(emacs-interrupt-handles ?))
(fixnum (emacs-interrupt-array ?))))
(defun get-top-level-char ()
(get-a-char 'toplevel-char 'get-top-level-char-innards))
(defun get-char ()
(get-a-char 'input-char 'e_pl1_$get_char))
(defun get-a-char (type get-char-function)
(let ((new-ch
(cond ((and macro-execution-in-progress (kmacro-get-one-cmd type)))
(t (do ((ch (funcall get-char-function) (funcall get-char-function)))
(nil)
(or (= 0 (emacs-interrupt-array 0)) (setq delayed-interrupt t))
(store (emacs-interrupt-array 0) 0)
(and (not minibufferp) delayed-interrupt (emacs-interrupt-processor))
(or (= ch -1)
(progn (store (saved-command-history history-next-index) ch)
(setq history-next-index
(cond ((= history-next-index 49.) 0)
(t (1+ history-next-index))))
(and macro-collection-in-progress
(kmacro-record-input ch type))
(return ch))))))))
last - input - char = char without META
new-ch))
;;;
Highly local specials for redisplay ( echo negotiation ) .
Goddamn backpanel wires to every board in the machine .
(defvar (X howmuchigot-sym rdis-upd-locecho-flg screenlinelen touchy-damaged-flag rdis-suppress-redisplay))
(defvar (rdis-multiwindowed-buflist rdis-inhibit-echnego))
(defvar (curlinel curstuff work-string curpointpos hard-enforce-fill-column fill-column))
(defun get-top-level-char-innards ()
(let ((ordi rdis-suppress-redisplay)
(chpos 0))
THIS NEXT STATEMENT IS PERHAPS THE MOST IMPORTANT IN MULTICS EMACS
;;; IT CAUSES REDISPLAY TO OCCUR WHEN THERE IS NO PENDING INPUT.
;;; ALMOST ALL REDISPLAY IN THE WORLD IS INVOKED RIGHT HERE.
(and (= 0 (e_pl1_$real_have_chars))(redisplay))
;;; Attempt PL/I (and poss. better) echo negotiation.
(cond ((and ;try super-opt
(eq curstuff work-string) ;line gotta be open
(= curpointpos (1- curlinel)) ;gotta be at eol
(not macro-collection-in-progress)
(not ordi) ;old rdis-suppr-rdis
(not suppress-redisplay-flag)
(not (and hard-enforce-fill-column
(not (< (setq chpos (cur-hpos)) fill-column))))
(not rdis-inhibit-echnego)
(prog2 (redisplay) ;update all parms
(not (and minibufferp (> X (- screenlinelen 10.)))))
(or (not (memq current-buffer rdis-multiwindowed-buflist))
minibufferp)) ;echnego ok minibuf even so
(setq locechnego-ctr (1+ locechnego-ctr))
(prog2 (set 'howmuchigot-sym 0)
(e_pl1_$echo_negotiate_get_char
work-string
'howmuchigot-sym
(cond (hard-enforce-fill-column
(min (- screenlinelen X)
(- fill-column chpos)))
(minibufferp
(- screenlinelen X 7))
(t (- screenlinelen X))))
(cond ((> howmuchigot-sym 0)
(store (saved-command-history history-next-index)
(substr work-string (1+ curpointpos) howmuchigot-sym))
(setq history-next-index
(cond ((= history-next-index 49.) 0)
(t (1+ history-next-index))))
(setq X (+ X howmuchigot-sym))
(setq locechnego-meter (+ locechnego-meter howmuchigot-sym))
(setq curpointpos (+ curpointpos howmuchigot-sym))
(setq curlinel (+ curlinel howmuchigot-sym))
(setq touchy-damaged-flag t)
(setq previous-command nil) ;since we never actually execute a command
(let ((rdis-upd-locecho-flg t))
(redisplay))))))
(t (e_pl1_$get_char)))))
;;;
;;;
interrupt handling integrated into e_interact _ 1978.11.21 by
;;;
;;;
;;; how it works:
;;;
There are two types of interrupt numbers , namely
;;; internal and external. Internal numbers are assigned
;;; sequentially from the variable next-interrupt-channel.
;;; Internal numbers are used to index into the array
;;; emacs-interrupt-handlers, and are returned by
;;; e_pl1_$get_emacs_interrupt. External numbers are
;;; assigned by e_pl1_$assign_channel, and are computed
;;; as 64*emacs_recursion_level + internal_number. It is
;;; these external numbers which must be passed to
;;; e_pl1_$set_emacs_interrupt, and therefore it is these
;;; which set-emacs-interrupt-handler returns.
;;;
(defun emacs-interrupt-processor ()
(setq delayed-interrupt nil)
(do ((int-info (e_pl1_$get_emacs_interrupt) (e_pl1_$get_emacs_interrupt)))
((< (car int-info) 0) (and (= recursion-level 0)
(not rdis-suppress-redisplay) ; don't destroy local display
(redisplay)))
(let ((intno (car int-info)))
(cond ((emacs-interrupt-handlers intno)
(funcall (emacs-interrupt-handlers intno)
intno
(emacs-interrupt-handles intno)
(cadr int-info)))))))
(defvar max-emacs-interrupt-channel 64.)
(defun set-emacs-interrupt-handler (handler handle) ; returns interrupt channel number
(setq next-interrupt-channel (1+ next-interrupt-channel))
(if (= next-interrupt-channel max-emacs-interrupt-channel) ;ran out of channels
(setq max-emacs-interrupt-channel (* 2 max-emacs-interrupt-channel))
(*rearray 'emacs-interrupt-handlers t max-emacs-interrupt-channel)
(*rearray 'emacs-interrupt-handles t max-emacs-interrupt-channel))
(store (emacs-interrupt-handlers next-interrupt-channel) handler)
(store (emacs-interrupt-handles next-interrupt-channel) handle)
(e_pl1_$assign_channel next-interrupt-channel))
(defun interrupt-init ()
(*array 'emacs-interrupt-array 'external (e_pl1_$get_emacs_interrupt_array) 2)
(*array 'emacs-interrupt-handlers t max-emacs-interrupt-channel)
(*array 'emacs-interrupt-handles t max-emacs-interrupt-channel)
(setq delayed-interrupt nil)
(setq next-interrupt-channel -1))
;;;
;;;
;;; Functions to print errors/messages in the minibuffer
;;;
(defvar (suppress-minibuffer))
;;;(register-option 'suppress-minibuffer nil) ;;; moved to e_option_defaults_
;;; Print an error message.
(defun display-error-noabort n
(or suppress-minibuffer
(echo-buffer-print (apply 'catenate (listify n)))))
;;; Print an error message and abort.
(defun display-error n
(or suppress-minibuffer
(apply 'display-error-noabort (listify n)))
(command-quit))
Print an error message : first argument is Multics error code .
(defun display-com-error-noabort n
(or suppress-minibuffer
(let ((prefix
(cond ((= 0 (arg 1)) "")
(t (catenate
(e_lap_$rtrim
(cadr (convert_status_code_ (arg 1))))
(cond ((> n 1) " ")
(t ""))))))
(message (cond ((> n 1)
(apply 'catenate (listify (- 1 n))))
(t ""))))
(echo-buffer-print (catenate prefix message)))))
Print an error message and abort : first argument is Multics error code .
(defun display-com-error n
(apply 'display-com-error-noabort (listify n))
(command-quit))
;;; Clear out the minibuffer.
(defun minibuffer-clear-all ()
(echo-buffer-clear-all))
;;; Print a message in the minibuffer.
(defun minibuffer-print n
(or macro-execution-in-progress suppress-minibuffer
(echo-buffer-print (apply 'catenate (listify n)))))
;;; Print a message in the minibuffer without clearing current contents.
(defun minibuffer-print-noclear n
(or macro-execution-in-progress suppress-minibuffer
(echo-buffer-outprint (apply 'catenate (listify n)))))
;;; Delete the last N characters from the minibuffer.
(defun minibuffer-rubout (n)
(or macro-execution-in-progress
(echo-buffer-rubout n)))
;;; Make a very transient remark.
(defun minibuffer-remark n
(or macro-execution-in-progress suppress-remarks suppress-minibuffer
(echo-buffer-utter (apply 'catenate (listify n)))))
(defun display-error-remark n
(or suppress-minibuffer
(echo-buffer-utter (apply 'catenate (listify n)))))
;;; Clear the last minibuffer statement.
(defun minibuffer-clear ()(echo-buffer-clear))
;;;
;;; Self-documentation primitives - see e_self_documentor_.
;;;
(defun get-cmd-symbol-3args (metap key prefix)
(cond ((and (= metap 1) prefix) nil)
((not prefix)
(cond ((subrp (key-bindings key metap)) nil)
(t (key-bindings key metap))))
(t (cond ((not (subrp (key-bindings prefix 0))) nil)
(t (arraycall t (key-bindings prefix 0) key))))))
;;; Get the function bound to a key
(defun get-key-binding (key-list)
(apply 'get-cmd-symbol-3args key-list))
;;; Read the name of key
(defun key-prompt (prompt)
(prog (ch1)
(minibuffer-print prompt)
(setq ch1 (get-char))
(return (cond ((= ch1 377)
(setq ch1 (get-char))
(cond ((= ch1 377)
(minibuffer-print-noclear "esc-" (printable 177))
'(1 177 nil))
(t (return (telnet-loser ch1)))))
((> ch1 char-input-mask)
(minibuffer-print-noclear "esc-")
(key-prompt-1 1 (bit-clear 200 ch1) nil))
(t (key-prompt-1 0 ch1 nil))))))
(defun key-prompt-1 (metap key prefix)
(prog (mf1)
(and (or prefix (= metap 1))
(< key (1+ (CtoI "z")))(> key (1- (CtoI "a")))
(setq key (- key 40)))
(setq mf1 (cond (prefix (arraycall t (key-bindings prefix 0) key))
(t (key-bindings key metap))))
(cond ((eq mf1 'escape)
(minibuffer-print-noclear "esc-")
(return (key-prompt-1 1 (get-char) nil)))
((not (symbolp mf1))
(minibuffer-print-noclear (printable key)
" (prefix char): ")
(return (key-prompt-1 0 (get-char) key)))
(t (minibuffer-print-noclear (printable key))
(return (list metap key prefix))))))
;;; Compatability
(defun key-prompt-3args ()
(key-prompt "?: "))
;;; Execute supplied function on all keys defined in current buffer
(defun map-over-emacs-commands (fun arg)
(do i 0 (1+ i) (= i 256.) ;i hated fortran as a child
(do j 0 (1+ j) (= j 2) ;and i hate it now as a programmer.
(let ((element (key-bindings i j)))
(cond ((not (symbolp element))
(do k 0 (1+ k)(= k 256.)
(or (not (arraycall t element k))
(eq (arraycall t element k) 'undefined-command)
(funcall fun (key-total-printed-symbol 0 k i)
(arraycall t element k) arg))))
((eq element 'undefined-command))
(element
(funcall fun (key-total-printed-symbol j i nil) element arg)))))))
;;;
;;;
ESC Processing and Numeric Argument Readers
;;;
;;; Command to quit to editor top level
(defcom command-quit
&numeric-argument (&ignore)
&undo &ignore
(ring-tty-bell)
(throw 'les-petites-gazongues pgazonga))
;;; Command to "ignore" a prefix character, by default on prefix-^G
(defcom ignore-prefix
&undo &ignore
&numeric-argument (&ignore)
(ring-tty-bell))
;;; Command to throw to top level or nearest yggdrasil (ldebug, multics mode
;;; are the only others beside top level)
(defcom command-prompt-abort
&numeric-argument (&ignore)
&undo &ignore
(throw nil gazongue-a-l/'yggdrasil))
Command bound to ESC key
(defcom escape
&undo-function &pass
&numeric-argument (&pass)
(and (eq minibufferp ESC) (jetteur-des-gazongues))
(escape-dont-exit-minibuf))
(defprop throw-to-toplevel jetteur-des-gazongues expr)
(defcom-synonym escape-dont-exit-minibuffer escape-dont-exit-minibuf)
;;; Set the undo switch.
(defcom undo-prefix
&numeric-argument &pass
&undo &pass
(setq undo (not undo))
(process-char (get-char)))
Command that does real work of ESC
(defcom escape-dont-exit-minibuf
&numeric-argument (&pass)
&undo &pass
(prog (nxcn numf negate)
a (setq nxcn (get-char))
(cond ((and (> nxcn (1- (CtoI "0"))) (< nxcn (1+ (CtoI "9")))) ;number
(or numarg (setq numarg 0))
(setq numarg (+ (- nxcn (CtoI "0")) (* 10. numarg)))
(setq numf t)
(go a))
((and (not numf) (= nxcn (CtoI "-"))) ;want negative argument
(setq negate t numf t) (go a))
((and (not numf) (= nxcn (CtoI "+"))) ;want positive argument
(setq numf t) (go a))
(t (and numf negate ;negative argument (default -1)
(setq numarg (- (or numarg 1))))
(cond (numf (process-char nxcn))
(t (execute-key 1 nxcn nil)))))))
Command to collect numeric argument or use powers of 4
(defcom multiplier
&undo &pass
&numeric-argument (&pass)
(prog (nxcn numf multf negate plus-given my-char)
(setq my-char last-input-char) ;character used to invoke this
a (setq nxcn (get-char))
(cond ((and (> nxcn (1- (CtoI "0"))) (< nxcn (1+ (CtoI "9")))) ;number
(or numf (setq numf 0))
(setq numf (+ (- nxcn (CtoI "0"))(* 10. numf)))
(go a))
((and (not numf) (= nxcn (CtoI "-"))) ;negative argument
(setq numf 0 negate t) (go a))
((and (not numf) (= nxcn (CtoI "+"))) ;positive argument
(setq numf 0 plus-given t) (go a))
((and (< nxcn 200) (eq (ascii nxcn) my-char)) ;NOTE- this code is buggy
(cond ((and (not numf) (not multf))
(setq multf 4))
((not numf) (setq multf (* multf 4)))
(numf (setq numf nil))
(t (setq multf nil numf nil)))
(go a))
(t (and (or negate plus-given) (= numf 0)
(setq numf 1)) ;default number if only + given
(and negate (setq numf (- numf))) ;negate number (with -1 as default)
(setq numarg (cond ((and numf multf) (* numf multf))
(numf)
(multf (* 4 multf))
(t 4)))
(process-char nxcn)))))
Read a " metazied " number ( from Network mostly )
(defcom read-meta-argument
&undo &pass
&numeric-argument (&ignore)
(prog (negate nxcn plus-given)
(setq nxcn (CtoI last-input-char)) ;get charater invoked by (without meta-bit)
(setq numarg 0)
(cond ((= nxcn (CtoI "+")) (setq plus-given t))
((= nxcn (CtoI "-")) (setq negate t))
(t ;assume a digit
(setq numarg (- nxcn (CtoI "0")))))
a (setq nxcn (get-char))
(cond ((and (> nxcn (1- (+ 200 (CtoI "0")))) (< nxcn (1+ (+ 200 (CtoI "9")))))
(setq numarg (+ (- nxcn (+ 200 (CtoI "0"))) (* 10. numarg)))
(go a))
(t ;have character to execute
(and (= numarg 0) (or negate plus-given)
(setq numarg 1)) ;a sign given, set default
(and negate (setq numarg (- numarg)))
(process-char nxcn)))))
;;;
;;;
;;; Character/Key/Command Execution
;;;
;;; Process a character: determine if it is a "meta" character and then
;;; execute the key corresponding to the character
(defun process-char (ch)
(or (fixp ch)
(setq ch (CtoI ch)))
(let ((recursion-level (1+ recursion-level)))
(cond ((and (not (zerop network-flag))
TELNET IAC
(setq ch (get-char))
(cond ((= ch 377)
(execute-key 1 177 nil))
(t (telnet-loser ch))))
((> ch char-input-mask) ;meta-foo
(setq ch (logand char-input-mask ch)) ;non-meta foo
(execute-key 1 ch nil))
(t (execute-key 0 ch nil)))))
Execute a " key " as an Emacs command : A " key " is the triplet consisting
;;; of a character, "meta"-bit, and prefix character used to determine the
;;; exact command to be executed.
(defun execute-key (metap ch prefix)
(let ((command)) ;the command to execute
(and (or (= metap 1) prefix)
(and (< ch (1+ (CtoI "z")))
(> ch (1- (CtoI "a")))
(setq ch (- ch 40))))
(cond ((not prefix) (setq command (key-bindings ch metap)))
(t (setq command (arraycall t (key-bindings prefix 0) ch))))
(cond ((symbolp command) ;normal command
(setq last-command-triplet-mpfxk (cond ((= metap 1) 'meta)
(t prefix))
last-command-triplet-1 ch)
(execute-command command (last-command-triplet) nil))
(t ;a prefix character
(execute-key 0 (get-char) ch)))))
(defvar (autoload-inform))
;;;(register-option 'autoload-inform nil) ;;; moved to e_option_defaults_
;;; Ensure that autoloads are done early in the execution phase.
(defun ensure-autoload (command)
(cond ((getl command '(editor-macro subr expr)))
((not (get command 'autoload)))
('else
(if autoload-inform
(minibuffer-print "Autoloading " command " ... "))
(protect (loadfile (get command 'autoload))
&success
(if autoload-inform
(minibuffer-print-noclear "done."))
&failure
(if autoload-inform
(minibuffer-print-noclear "failed."))))))
(setq last-time-sample nil)
Execute an Emacs command
(defun execute-command (command key argument-list)
(ensure-autoload command)
(setq current-command command)
(or last-time-sample (setq last-time-sample (time)))
(let ((last-time-sample 'dont-sample))
(cond ((get command 'editor-macro) ;keyboard macro
(or (null argument-list)
(display-error (ed-get-name command key)
" does not accept arguments."))
(push-editor-macro-level (get command 'editor-macro)
(editor-macro-arg-interp numarg))
(setq previous-command command
previous-argument-list nil))
((get command 'editor-command) ;new-style command
(execute-new-command command key argument-list))
(t ;old-style command
(or (null argument-list)
(display-error (ed-get-name command key)
" does not accept arguments."))
(execute-old-command command (last-command-triplet)))))
(and (or command-bell meter-commands) ;Avoid call if we can.
(command-timing last-time-sample))
(setq numarg nil undo nil last-time-sample nil))
;;; Handle command timing.
nil= > no bell . otherwise threshhold in seconds
;;;(register-option 'command-bell nil) ;;; moved to e_option_defaults_
;;; nil=> no bell. fixnum=>number of bells. otherwise function to call.
;;;(register-option 'command-bell-count nil) ;;; moved to e_option_defaults_
;;; nil=> no metering. t=> minibuffer metering. otherwise function.
;;;(register-option 'meter-commands nil) ;;; moved to e_option_defaults_
;;; Moved to e_option_defaults
( defprop command - bell t value - ok - anything )
( defprop command - bell - count t value - ok - anything )
;;;(defprop meter-commands t value-ok-anything)
(defun command-timing (sample)
(or (null sample) (not (floatp sample))
(let ((difference (-$ (time) sample)))
(and command-bell (> difference (float command-bell))
(cond ((fixp command-bell-count)
(do-times command-bell-count (ring-tty-bell)))
(command-bell-count
(funcall command-bell-count difference))))
(cond ((eq meter-commands 't)
(minibuffer-print (decimal-rep difference) "s"))
(meter-commands
(funcall meter-commands difference))))))
;;; Returns command name for error messages
(defun ed-get-name (command key)
(catenate command
(cond ((get command 'editor-macro) " (keyboard macro)")
(t ""))
(cond (key
(catenate " (" (get-key-name key) ")"))
(t ""))))
;;; Try to convert an argument to a fixnum and return nil if not valid
(defun ed-cv-fixnum-check (argument)
(let ((argument-list (exploden argument)))
(do ((digit (car argument-list) (car argument-list))
(negate)
(value))
((not digit)
(and negate (setq value (- value)))
value)
+ as first char
(setq value 0))
((and (= digit #/-) (not value))
(setq value 0 negate t))
((and (> digit (1- #/0)) (< digit (1+ #/9)))
(setq value (+ (- digit #/0) (* 10. (or value 0)))))
(t ;not valid in a number
(return nil)))
(setq argument-list (cdr argument-list)))))
;;;
(setq *transparent-commands* '(escape multiplier noop re-execute-command
extended-command))
Invoke a new - style Emacs command
JSL 's new version - June 1982
(defun execute-new-command (command key argument-list)
(do ((done)
(flags (get command 'editor-command))
(function command)
(ignore-rejected-numarg)
(prologue-info)
(result)
(times))
(done result)
;;
;; Check for synonym command.
;;
(and (symbolp flags)
(return (execute-command flags key argument-list)))
;;
;; Check for undo.
;;
(if undo
(and (tlnn flags 000500)
(setq undo nil))
(and (tlnn flags 000400)
(return (execute-command (get command 'ed-undo-function)
key argument-list)))
(and (tlne flags 000700)
(display-error (ed-get-name command key)
" does not accept the undo prefix.")))
;;
;; Here to process numeric arguments.
;;
(if numarg
;;
;; Check for &numeric-function.
;;
(if (tlnn flags 001000)
(setq function (get function 'ed-numeric-function))
(ensure-autoload function)
(or (and function (getl function '(subr lsubr fsubr
expr lexpr fexpr)))
(display-error (ed-get-name command key)
" does not accept a numeric argument."))
(setq flags (or (get function 'editor-command) 0)
ignore-rejected-numarg t))
;;
;; Check for &negative function.
;;
(if (and (< numarg 0) (tlnn flags 200000))
(setq function (get function 'ed-negative-function))
(ensure-autoload function)
(or (and function (getl function '(subr lsubr fsubr
expr lexpr fexpr)))
(display-error (ed-get-name command key) " does not "
"accept a negative numeric argument."))
(setq flags (or (get function 'editor-command) 0)
numarg (- numarg)
ignore-rejected-numarg t))
;;
;; Now process &repeat, &reject, &ignore and check bounds.
;;
(let ((numarg-type (logand flags (lsh 070000 18.)))
(numarg-range (and (tlnn flags 100000)
(get function 'ed-numeric-range))))
(setq times (ed-interpret-numarg command key numarg-type
numarg-range
ignore-rejected-numarg))))
;;
;; Simple case.
;;
(if (and (null argument-list)
(tlne flags 406040)) ; Has no special handling needed.
;;
;; Deal with numeric argument, if any.
;;
(cond (times (setq numarg nil))
(t (setq times 1)))
;;
;; Call the function, and return its result.
;;
(return
(cond ((eq (cadr function) 'subr)
(do ((i 1 (1+ i))
(f (caddr function))
(inv (or (memq command *transparent-commands*)
(memq command nobreak-functions))))
((> i times) result)
(setq result (subrcall t f))
(or inv
(setq previous-command command
previous-argument-list nil))))
(t (do ((i 1 (1+ i))
(inv (or (memq command *transparent-commands*)
(memq command nobreak-functions))))
((> i times) result)
(setq result (funcall function))
(or inv
(setq previous-command command
previous-argument-list nil)))))))
;;
;; Prepare for cleanup handler, in case specified.
;;
(unwind-protect
(progn
;;
;; Do prologue if specified.
;;
(and (tlnn flags 004000) ;has prologue code.
(setq prologue-info
(funcall (get function 'ed-prologue-function))))
;;
;; Process arguments.
;;
(and (or (tlnn flags 400000) ;wants arguments
(not (null argument-list)))
(setq argument-list
(ed-interpret-arguments command key function flags
argument-list)))
;;
;; Clear numarg for &repeat case.
;;
(cond (times (setq numarg nil))
(t (setq times 1)))
;;
;; Do the command as many times as necessary, calling the
;; prologue after each invocation, if there is one.
;;
(do ((epilogue (and (tlnn flags 002000)
(get function 'ed-epilogue-function)))
(i 1 (1+ i))
(inv (or (memq command *transparent-commands*)
(memq command nobreak-functions))))
((> i times))
(setq result (apply function argument-list))
(and epilogue
(setq result (funcall epilogue prologue-info
result (= i times))))
(or inv
(setq previous-command command
previous-argument-list argument-list)))
;;
;; We won't need cleanup handler anymore.
;;
(setq done (> times 0)))
;;
;; Here we check for cleanup handler.
;;
(and (not done) (setq done t)
(tlnn flags 000040)
(setq flags (get function 'ed-cleanup-function))
(funcall flags prologue-info)))))
;;; Interpret the numeric argument
JSL 's new version - June 1982
(defun ed-interpret-numarg (command key numarg-type numarg-range
ignore-rejected-numarg)
(and numarg-range ;a range is specified
(let ((lower (car numarg-range))
(upper (cdr numarg-range)))
(cond (lower ;lower bound specified
(setq lower (ed-get-encoded-value lower))
(and (< numarg lower) ;lose, lose
(display-error
(ed-get-name command key)
" does not accept a "
(cond ((= lower 0) ;a special case
"negative numeric argument.")
(t (catenate
"numeric argument < "
(decimal-rep lower)
"; you supplied "
(decimal-rep numarg) ".")))))))
(cond (upper ;upper bound specified
(setq upper (ed-get-encoded-value upper))
(and (> numarg upper) ;lose, lose
(display-error
(ed-get-name command key)
" does not accept a "
(cond ((= upper -1) ;a special case
"positive numeric argument.")
(t (catenate
"numeric argument > "
(decimal-rep upper)
"; you supplied "
(decimal-rep numarg) ".")))))))))
(cond ((zerop numarg-type) ; Pass numeric argument.
nil)
((= numarg-type (lsh 010000 18.)) ; Repeat numeric argument.
numarg)
((= numarg-type (lsh 020000 18.)) ; Ignore numeric argument.
(setq numarg nil))
;;
;; If we get here, numarg-type = (lsh 030000 18.) Reject.
;;
(ignore-rejected-numarg
(setq numarg nil))
(t (display-error (ed-get-name command key)
" does not accept a numeric argument."))))
;;; Interpret and complete the command's argument list
;;; Slightly modified by JSL summer '82
(defun ed-interpret-arguments (command key function flags argument-list)
(let ((nargs-given (length argument-list))
(nargs-wanted (logand flags 777777))
(args-template (get function 'ed-argument-list)))
(and (= nargs-wanted 0) ;no arguments allowed
(> nargs-given 0) ;but some were supplied
(display-error (ed-get-name command key)
" does not accept arguments."))
(do ((i 1 (1+ i)) ;go through the arguments
(args-wanted args-template (cdr args-wanted))
(args-given argument-list (cdr args-given))
(new-arguments))
((> i nargs-wanted) ;until all args processed
(nreverse new-arguments)) ;'twas built in reverse
(setq new-arguments (cons
(ed-interpret-single-arg
command key nargs-wanted nargs-given i
(car args-wanted)
(car args-given)
(= i nargs-wanted) (cdr args-given))
new-arguments)))))
;;; Interpretation of a single argument
(defun ed-interpret-single-arg (command key nargs-wanted nargs-given
arg-no arg-template arg-supplied
last-argp rest-of-args-supplied)
(let ((data-type ;data type of argument
(logand (car arg-template) (lsh 700000 18.)))
non - zero = > prompt if missing
(tlnn (car arg-template) 040000))
non - zero = > default value exists
(tlnn (car arg-template) 020000))
non - zero = > value is restricted
(tlnn (car arg-template) 010000))
(prompt-info (cadr arg-template))
(default-info (caddr arg-template))
(restriction-info (cadddr arg-template))
(show-error (cond ((tlnn (car arg-template) 040000)
;;can prompt for new value
'display-error-noabort)
(t 'display-error)))
(completion-list (eval (car (cddddr arg-template)))))
(do ((the-argument arg-supplied) ;start with what's given
(have-argument))
(have-argument the-argument) ;return constructed arg
(cond
((or (= data-type (lsh 300000 18.)) ;&rest-as-string
(= data-type (lsh 400000 18.))) ;&rest-as-list
(or last-argp
(display-error "Argument #" (decimal-rep arg-no)
" of " (ed-get-name command key)
" is a rest-of-arguments type, but "
"is not the last argument."))
(setq have-argument t ;this will succeed
the-argument (cond
((= data-type (lsh 300000 18.))
;;wants a string
(catenate
(or arg-supplied "")
(do ((args
rest-of-args-supplied
(cdr args))
(x "" (catenate
x " " (car args))))
((null args) x))))
(t ;wants a list
(append (and arg-supplied
(list arg-supplied))
rest-of-args-supplied)))))
((and last-argp rest-of-args-supplied)
(display-error (ed-get-name command key) " expects "
(decimal-rep nargs-wanted) " arguments;"
" you supplied " (decimal-rep nargs-given)
"."))
(the-argument
;;something here, check it for legality
(cond ((zerop data-type) ;string argument, no checking
(setq have-argument t))
((= data-type (lsh 100000 18.)) ;wants a symbol
(let ((x (ed-interpret-symbol-arg
command key arg-no the-argument
show-error have-restrictions
restriction-info)))
(setq the-argument (car x)
have-argument (cdr x))))
((= data-type (lsh 200000 18.))
;;wants an integer
(let ((x (ed-interpret-integer-arg
command key arg-no the-argument
show-error have-restrictions
restriction-info)))
(setq the-argument (car x)
have-argument (cdr x))))
(t ;unknown data type
(display-error "Argument #" (decimal-rep arg-no)
" of " (ed-get-name command key)
" has an unknown data type."))))
(t ;prompt or use default
(cond (have-prompt ;prompt for it
(setq the-argument (minibuf-response
(ed-get-encoded-value
(car prompt-info))
(cdr prompt-info)))
(and have-default ;if there's a default
(nullstringp the-argument) ;no value given
(setq the-argument (ed-get-encoded-value
default-info))))
(have-default ;have default value
(setq the-argument (ed-get-encoded-value
default-info)))
(t ;no prompt, no default
(display-error "Argument #" (decimal-rep arg-no)
" of " (ed-get-name command key)
" has no prompt or default value.")
)))))))
;;;
;;; Interpretation of an argument which should be a symbol
;;;
(defun ed-interpret-symbol-arg (command key arg-no the-argument show-error
have-restrictions restriction-info)
(let ((argument (intern (make_atom (e_lap_$trim the-argument))))
(have-argument nil)) ;not found yet
(cond (have-restrictions ;but it's value is limited
(let ((possible-values (ed-get-encoded-value
restriction-info)))
(cond ((memq the-argument possible-values)
(setq have-argument t))
(t ;not good
(funcall show-error
"Argument # " (decimal-rep arg-no)
" of " (ed-get-name command key)
" must be one of:"
(do ((values possible-values
(cdr possible-values))
(x "" (catenate x " "
(car values))))
((null values) x)))
(setq argument nil))))) ;force prompt
(t ;value not restricted, got it
(setq have-argument t)))
(cons argument have-argument)))
;;;
;;; Interpretation of an argument which should be an integer
;;;
(defun ed-interpret-integer-arg (command key arg-no the-argument show-error
have-restrictions restriction-info)
(let ((value (cond ((fixp the-argument) the-argument)
(t (ed-cv-fixnum-check the-argument))))
(have-argument)) ;none yet
(cond (value ;got something
(cond (have-restrictions ;but restricted
(let ((lower (car restriction-info))
(upper (cdr restriction-info)))
(cond (lower ;has lower bound
(setq lower (ed-get-encoded-value
lower))
(cond ((< value lower)
(cond ((= lower 0)
(funcall
show-error
"Argument #"
(decimal-rep arg-no)
" of "
(ed-get-name
command key)
" must not be "
"negative."))
(t
(funcall
show-error
"Argument #"
(decimal-rep arg-no)
" of "
(ed-get-name
command key)
" must be >= "
(decimal-rep lower)
"; you supplied "
(decimal-rep value)
".")))
(setq value nil)))))
;;force prompt
(cond (upper ;has upper bound
(setq upper (ed-get-encoded-value
upper))
(cond ((> value upper)
(cond ((= upper -1)
(funcall
show-error
"Argument #"
(decimal-rep arg-no)
" of "
(ed-get-name
command key)
" must not be "
"positive."))
(t (funcall
show-error
"Argument #"
(decimal-rep arg-no)
" of "
(ed-get-name
command key)
" must be <= "
(decimal-rep upper)
"; you supplied "
(decimal-rep value)
".")))
(setq value nil))))))
;force prompt
(and value ;passed the tests
(setq have-argument t)))
(t ;unrestricted, got it
(setq have-argument t))))
(t ;not a number
(funcall show-error
"Argument #" (decimal-rep arg-no) " of "
(ed-get-name command key)
" must be an integer, not " the-argument ".")
(setq have-argument nil))) ;force prompt
(cons value have-argument)))
;;;
;;; Evaluate an encoded value.
;;;
(defun ed-get-encoded-value (encoded-value)
(let ((type (car encoded-value))
(value (cadr encoded-value)))
(cond ((eq type 'quote) value) ;actual value is here
((eq type 'eval) (funcall value)) ;value from function
(t ;unknown
(display-error "Unknown value encoding: " type)))))
;;;
Execute an old style Emacs command
Slightly modified by JSL ( mostly format ) - June 1982
(defun execute-old-command (command key)
(let ((function command)
(numarg-repeat))
(setq numarg-repeat (get command 'argwants))
(and (< (or numarg 1) 0)
numarg-repeat
(setq numarg (- numarg)
function (or (get command 'negative-arg-function)
'bad-negative-argument)))
(or (eq (cadr function) 'subr)
(get function 'subr)
(get function 'expr)
(get function 'autoload)
(display-error "Undefined function " function " for "
command " (" (get-key-name key) ")"))
(setq numarg-repeat (cond (numarg-repeat (or numarg 1))
(t 1)))
(cond ((eq (cadr function) 'subr)
(do ((i 1 (1+ i))
(f (caddr function)))
((> i numarg-repeat))
(subrcall t f)
(setq previous-command command
previous-argument-list nil)))
(t (do ((i 1 (1+ i)))
((> i numarg-repeat))
(funcall function)
(setq previous-command command
previous-argument-list nil))))))
;;; Execute an actual command the specified number of times
;;; with the given arguments.
(defun execute-command-function (command function ntimes argument-list)
(cond ((and (eq (cadr function) 'subr) (< (length argument-list) 5))
(do ((i 1 (1+ i))
(f (caddr function))
(nargs (length argument-list)))
((> i ntimes))
(cond ((= nargs 0)
(subrcall t f))
((= nargs 1)
(subrcall t f (car argument-list)))
((= nargs 2)
(subrcall t f (car argument-list)
(cadr argument-list)))
((= nargs 3)
(subrcall t f (car argument-list)
(cadr argument-list) (caddr argument-list)))
((= nargs 4)
(subrcall t f (car argument-list)
(cadr argument-list) (caddr argument-list)
(car (cdddr argument-list)))))
(or (memq command '(escape multiplier noop
re-execute-command extended-command))
(setq previous-command command
previous-argument-list argument-list))))
(t (do i 1 (1+ i) (> i ntimes) (apply function argument-list)
(or (memq command '(escape multiplier noop
re-execute-command extended-command))
(setq previous-command command
previous-argument-list argument-list))))))
Emacs command to re - execute the last command
(defcom re-execute-command
&undo &pass
&numeric-argument (&pass)
(or previous-command
(display-error "No saved previous command"))
(execute-command previous-command nil previous-argument-list))
Emacs command invoked for an unbound key
(defcom undefined-command
&numeric-argument (&ignore)
&undo &ignore
(display-error "Unknown command: " (get-key-name (last-command-triplet))))
Emacs command invoked for a key whose command does n't accept negative arguments
(defcom bad-negative-argument
&undo &ignore
&numeric-argument (&ignore)
(display-error "Command rejected negative argument: " (get-key-name (last-command-triplet))))
;;; Function to return the last key typed by the user
(defun last-command-triplet ()
(cond ((eq last-command-triplet-mpfxk 'meta)
(list 1 last-command-triplet-1 nil))
(t (list 0 last-command-triplet-1 last-command-triplet-mpfxk))))
;;;
;;;
ESC - X Command
New version : 27 August 1979 by GMP
;;;
Invoke an Emacs command with arguments as read from mini - buffer
(defcom extended-command
&arguments ((command-line &prompt "Command: "
&completions Fundamental/.ext-commands))
&numeric-argument (&pass)
&undo &pass
(let ((command-list (parse-command-line command-line))) ;split into pieces
(if (not (null command-list))
(let ((command-name (car command-list))
(arguments (cdr command-list)))
(or (nullstringp command-name) ;if nothing there
(let ((command (intern (make_atom command-name))))
(ensure-autoload command)
(cond ((getl command '(editor-command editor-macro))
(execute-command command nil arguments))
(t (execute-old-extended-command command arguments)))))))))
Parse a line into tokens , obeying the Multics quoting convention
(defun parse-command-line (line)
(do ((input (exploden line))
(answer nil))
(nil)
(setq input
(do ((input1 input (cdr input1)))
((or (null input1)
(not (member (car input1) '(#^I #^J #/ ))))
input1)))
(cond ((null input)
(return (nreverse answer)))
(t
(setq answer
(cons
(do ((result ""))
((or (null input)
(member (car input) '(#^I #^J #/ )))
result)
(setq result
(catenate result
(cond
((= (car input) #/")
(do ((input1 (cdr input) (cdr input1))
(quoted t)
(piece ""))
((not quoted)
(setq input input1)
piece)
(cond
((null input1)
(display-error "Unbalanced quotes."))
((and (= (car input1) #/")
(equal (cadr input1) #/"))
(setq input1 (cdr input1)
piece (catenate piece """")))
((= (car input1) #/")
(setq quoted nil))
(t
(setq piece (catenate piece
(ItoC (car input1))))))))
(t
(do ((input1 (cdr input) (cdr input1))
(piece (ItoC (car input))
(catenate piece (ItoC (car input1)))))
((or (null input1)
(member (car input1) '(#^I #^J #/ #/")))
(setq input input1)
piece)))))))
answer))))))
;;; Invoke an old-style extended command (no prompting, etc.)
(defun execute-old-extended-command (command arguments)
(or (getl command '(expr subr lsubr autoload))
(display-error "Unknown command: " command))
(ensure-autoload command)
(let ((argsprop (args command))
(nargs (length arguments)))
(cond ((null argsprop) nil) ;unknown number wanted
((and (not (< nargs (or (car argsprop)
(cdr argsprop))))
(not (> nargs (cdr argsprop))))
nil) ;correct number supplied
(t
(display-error "Wrong number of arguments to extended command " command "."))))
(apply command ;execute command
(do ((args arguments (cdr args)) ;intern/convert all arguments
(new-arg-list nil
(cons (let ((argument (car args))
(value))
(setq value (ed-cv-fixnum-check argument))
(cond (value value)
(t (intern (make_atom argument)))))
new-arg-list)))
((null args) (nreverse new-arg-list)))))
;;;
;;;
;;; O boy hairy "macro" feature.
Appreciations to " EINE " E.L.E. ,
;;; The state of the art advances now with my cursor.
Redone pretty much wholesale 2/11/79 to allow " input chars " .
Have a good time in California , DLW , thanks for everything , -bsg .
;;; When a macro is being executed, this is called to supply input from the
;;; executing macro.
(defun kmacro-get-one-cmd (expected-type)
(let ((this (car macro-execution-in-progress))
(rest (cdr macro-execution-in-progress)))
(cond ((and (numberp this)(eq expected-type 'input-char))
(setq macro-execution-in-progress rest)
this)
((eq expected-type 'toplevel-char)
(cond ((eq this 'macend)
(execute-single-editor-enmacroed-command 'macend)
(cond (macro-execution-in-progress
(kmacro-get-one-cmd expected-type))
(t nil)))
((atom this)
(display-error "Keyboard macro lost synchrony."))
((eq (car this) 'toplevel-char)
(setq macro-execution-in-progress rest)
(cdr this))
(t nil)))
((eq expected-type 'input-char)
;;^U ^F, the ^F is like this in "articifially generated"
;;macros. char will get this, i.e., nothing at all,
;;and go to the tty for input
(setq macro-execution-in-progress rest) ;1/29/80 fix bsg
(cdr this)))))
;;; When a macro is being recorded, this is called to record a single input
character . Toplevelness is stored for ease in displaying definition .
( An idea by )
(defun kmacro-record-input (ch type)
(setq macro-collection-in-progress
(cons (cond ((eq type 'toplevel-char)
(cons 'toplevel-char ch))
(t ch))
macro-collection-in-progress)))
The commands to start and stop collecting macroes ( macros ? , macreaux ? )
(defcom begin-macro-collection
&numeric-argument (&reject)
(cond (macro-collection-in-progress
(display-error "Macro already in collection."))
aaah ,
(command-quit))
(t (assert-minor-mode 'Macro/ Learn)
(setq macro-collection-in-progress (list nil)))))
(defcom end-macro-collection
&numeric-argument (&pass)
(wrap-up-macro-definition)
(and numarg (execute-last-editor-macro)))
(defun editor-macro-arg-interp (arg)
(cond ((not arg) 1) ;once
((= arg 0) 'query)
((< arg 0) 'forever)
((> arg 9999.) 'forever)
(t arg)))
(defun push-editor-macro-level (mac ntimes)
(and (> (length macrostack) 20.)
(display-error "Too much macro recursion."))
(and macrostack (rplaca (cdr (car macrostack)) macro-execution-in-progress))
(setq macrostack (cons (list mac mac ntimes) macrostack))
(setq macro-execution-in-progress (cadr (car macrostack))))
(defun wrap-up-macro-definition ()
(or macro-collection-in-progress (display-error "No macro in progress."))
(negate-minor-mode 'Macro/ Learn)
(setq last-macro-definition
(cdr (nreverse (cons 'macend
(do ((l macro-collection-in-progress (cdr l)))
((null l)(display-error "Void macro."))
(and (not (atom (car l)))
(eq (caar l) 'toplevel-char)
(return (cdr l))))))))
(setq macro-collection-in-progress nil))
(defcom execute-last-editor-macro
&numeric-argument (&pass)
(or last-macro-definition (display-error "No macro to run."))
(push-editor-macro-level last-macro-definition (editor-macro-arg-interp numarg)))
(defun execute-single-editor-enmacroed-command (x)
(cond ((eq x nil)) ;empty in list
((eq x 'halt)
(setq macrostack (cdr macrostack))
(setq macro-execution-in-progress (cadar macrostack)))
((eq x 'repeat)
(setq macro-execution-in-progress (caar macrostack))
(rplaca (cdar macrostack) macro-execution-in-progress))
((eq x 'macend)
(let ((count (caddar macrostack)))
(cond ((eq count 'query)
(cond ((macro-query-get-answer)
(execute-single-editor-enmacroed-command 'repeat))
(t (execute-single-editor-enmacroed-command 'halt))))
((eq count 'forever)
(execute-single-editor-enmacroed-command 'repeat))
((< count 2)
(execute-single-editor-enmacroed-command 'halt))
(t (rplaca (cddar macrostack) (1- count))
(setq macro-execution-in-progress (caar macrostack))
(rplaca (cdar macrostack) macro-execution-in-progress)))))
(t (display-error "Internal macro format error: " x)))))))
;;;
;;;
Macro utilities
;;;
;;; Save a macro definition
(defcom save-macro
&prologue &eval (or last-macro-definition
(display-error "No macro defintion to store."))
&arguments ((macro-name &symbol
&default &eval
(let ((name (intern-minibuf-response "Macro name? " NL)))
(cond ((getl name '(editor-command expr subr autoload))
(display-error name " is not an acceptable name."))
(t name))))
(macro-key &symbol
&default &eval
(get-key-name (key-prompt "On what key? "))))
&numeric-argument (&reject)
(putprop macro-name last-macro-definition 'editor-macro)
(or (memq macro-key '(CR ^J)) ;don't want it anywhere
(set-key macro-key macro-name)))
(defcom show-last-or-current-macro
&numeric-argument (&pass)
(cond (macro-collection-in-progress (wrap-up-macro-definition)))
(show-editor-macro last-macro-definition))
(defcom show-macro
&arguments ((macro-name &symbol &prompt "Macro name: "))
&numeric-argument (&pass)
(cond ((get macro-name 'editor-macro)
(show-editor-macro (get macro-name 'editor-macro)))
(t (display-error macro-name " is not a defined macro."))))
(defun kmacro-display-interpret (x)
(prog (the-interpretation the-input fun prefix metap numbering stringing l2list whoops)
(setq the-input (nreverse (cdr (reverse x))))
tlc (cond ((null the-input)
(cond (stringing
(setq the-interpretation
(kmacro-stringing-util stringing the-interpretation))))
(return (nreverse the-interpretation))))
(setq x (car the-input) the-input (cdr the-input))
(cond ((not (atom x))(setq x (cdr x)))) ;ignore tlc, ok here.
(setq prefix nil)
(cond ((> x char-input-mask) (setq x (bit-clear 200 x) metap 1))
(t (setq metap 0)))
(setq fun (get-key-binding (list metap x nil)) whoops x)
(cond (numbering
(cond ((kmacro-numberp x)
(setq numbering (cons x numbering))
(go tlc))
(t (setq the-interpretation
(cons (cons (implode (nreverse numbering))
'Numeric/ argument) the-interpretation)
numbering nil)))))
ARRAYP
(setq prefix x))
((or (eq fun 'escape)
(eq fun 'escape-dont-exit-minibuf))
(and stringing (setq the-interpretation
(kmacro-stringing-util stringing the-interpretation)
stringing nil))
(cond ((and (eq fun 'escape)
the-input (not (atom (car the-input)))))
probbly was ESC ending minibuffer , next was tlc .
((and the-input (kmacro-number-or-plusminusp (car the-input)))
(setq numbering (list (kmacro-number-or-plusminusp (car the-input)))
the-input (cdr the-input))
(setq the-interpretation
(cons (cons (key-total-printed-symbol metap x prefix) fun)
the-interpretation))
(go tlc))
(t (setq metap 1)
(cond ((null the-input)
(setq x whoops prefix nil metap 0))
(t (setq x (cond ((numberp (car the-input))
(car the-input))
(t (cdar the-input)))
the-input (cdr the-input))
(and (> x (1- (CtoI "a")))
(< x (1+ (CtoI "z")))
(setq x (- x 40))))))))
((eq fun 'multiplier)
(and stringing (setq the-interpretation
(kmacro-stringing-util stringing the-interpretation)
stringing nil))
(setq the-interpretation
(cons (cons (key-total-printed-symbol metap x prefix)
fun)
the-interpretation))
(cond ((and the-input (kmacro-number-or-plusminusp (car the-input)))
(setq numbering (list (kmacro-number-or-plusminusp (car the-input)))
the-input (cdr the-input))))
(go tlc)))
(cond ((not (null prefix))
(cond ((null the-input)(setq x whoops prefix nil metap 0))
(t (setq x (cond ((numberp (car the-input))
(car the-input))
(t (cdar the-input)))
the-input (cdr the-input))
(and (> x (1- (CtoI "a")))(< x (1+ (CtoI "z")))
(setq x (- x 40)))))))
(setq fun (get-cmd-symbol-3args metap x prefix))
(cond ((memq fun '(self-insert overwrite-mode-self-insert))
(setq stringing (cons (ascii x) stringing)))
(t (cond (stringing
(setq the-interpretation
(kmacro-stringing-util
stringing the-interpretation)
stringing nil)))
(setq the-interpretation
(cons (cons (key-total-printed-symbol metap x prefix)
(get-cmd-symbol-3args metap x prefix))
the-interpretation))))
(setq l2list nil)
cl2c (cond ((or (null the-input)
collect lev 2 ch
(eq (caar the-input) 'toplevel-char)))
(cond (l2list
(setq the-interpretation
(cons (cons (apply 'catenate
(nreverse l2list))
'Input/ Characters)
the-interpretation))))
(go tlc))
(t (setq l2list (cons (ascii (car the-input)) l2list)
the-input (cdr the-input))
(go cl2c)))))
(defun kmacro-stringing-util (s int)
(map '(lambda (x)(cond ((eq (car x) '/")(rplaca x """""")))) s)
(cons (cons (catenate """" (apply 'catenate (nreverse s)) """")
'String)
int))
(defun kmacro-numberp (x)
(cond ((numberp x))
((not (atom x))(setq x (cdr x))))
(and (> x (1- (CtoI "0"))) (< x (1+ (CtoI "9"))) x))
(defun kmacro-number-or-plusminusp (x)
(cond ((numberp x))
((not (atom x)) (setq x (cdr x))))
(cond ((and (> x (1- (CtoI "0"))) (< x (1+ (CtoI "9")))) x)
((= x (CtoI "+")) '+)
((= x (CtoI "-")) '-)))
(defun show-editor-macro (x)
Figger out what it means .
(init-local-displays)
(cond (numarg (mapc 'show-editor-macro-2 x)) ;hairy kind
(t (local-display-generator-nnl
(do ((mac x (cdr mac))
(stuff nil (cons (caar mac) stuff)))
WARNING 511 limit
(mapcar '(lambda (y)(catenate " " y)) (nreverse stuff))))))))
(end-local-displays))
(defun show-editor-macro-2 (x)
(local-display-generator-nnl
(catenate (car x) TAB
(cond ((getl (setq x (cdr x))
'(expr subr autoload)) x)
((memq x '(String Input/ Characters Numeric/ argument)) x)
((get x 'editor-macro)
(catenate x " (keyboard macro)"))
(t "--????--")))))
(defcom macro-query
&numeric-argument (&reject)
(cond (macro-collection-in-progress
(display-error-noabort "Inserting query at this point."))
((not macro-execution-in-progress)
(display-error "macro query: no macro running."))
(t (cond ((not (macro-query-get-answer))
(setq macro-execution-in-progress (caar macrostack)))))))
(defun macro-query-get-answer ()
(let ((macro-execution-in-progress nil)
(macro-collection-in-progress nil))
(echo-buffer-print "ok? :")
(redisplay)
(do ((ans (get-char)(get-char)))
(nil)
(cond ((= ans 7)(command-quit))
((= ans 161)(command-quit))
((= ans 12))
((= ans 40)(return t))
((= ans 15)(return nil))
((= ans 131)(return t)) ;y
((= ans 156)(return nil)) ;n
(t (return nil))))))
;;;
;;;
;;; Quit handling and no-op department - done right BSG 3/28/79
Improvements for process preservation - BSG 3 December ' 79
(defun emacs-quit-handler (arg)
(setq arg arg)
(signalquit))
(defcom signalquit
&undo &ignore
&numeric-argument (&ignore)
(cond ((eq e-quit-transparency 'transparent)
This is to check flag safely even if NIL gets clobbered !
If this thing blows , you simply ca n't hit quit on Emacs .
(t (let ((oqt e-quit-transparency) ;So that we can quit cleanly
(e-quit-transparency 'transparent))
(randomize-redisplay) ;in case quit was caused by
(or oqt
(progn
(e_pl1_$set_emacs_tty_modes) ;tty reconnect
(clear-the-screen)
(and split-mode-p (rdis-restore-screen-to-one-split))))
(and DCTL-epilogue-availablep (DCTL-epilogue))
(e_pl1_$dump_output_buffer)
(e_pl1_$set_multics_tty_modes)
(terpri)
(cond ((and (eq emacs-name 'emacs_) quit-on-break)
(emacs$set_emacs_return_code
(error_table_ 'action_not_performed))
(or tasking-emacs (lisp-quit-function))))
(signalquit-hardcore-vt132-writearound)
(ioc z)
(e_pl1_$set_emacs_tty_modes)
(and DCTL-prologue-availablep (DCTL-prologue))
(and split-mode-p (rdis-recreate-splits-on-screen))
(or oqt (progn ;Redisplay suppressed
(full-redisplay)
(display-error-noabort
"Restarting from QUIT... ")
(redisplay)))))))
Writearound for the hardcore / vt132 bug that causes screen to not
;;; be cleared on ^Z^Z or BREAK. The problem looks like this:
;;;
( 1 ) Emacs sends characters to fix up screen .
( 2 ) Emacs does ( ioc z ) , causing signal _ quit .
( 3 ) default_error_handler _ does a resetwrite .
( 4 ) Hardcore has not yet sent the clearing characters ; they get eaten .
( 5 ) Screen stays screwed , though no longer in Emacs .
( 6 ) User gets confused .
;;;
The only solutions are : ( 1 ) Do write_status 's until all output is out ,
or ( 2 ) Just do a ( sleep ) of some interesting length . I chose the sleep
;;; option. If hardcore ever gets fixed, it would be nice to do a
;;; force_out operation to make sure the characters get out.
14 November 1981
(defun signalquit-hardcore-vt132-writearound ()
(and (eq tty-type 'vt132) (sleep 2)))
(defcom noop
&numeric-argument (&ignore)
&undo &ignore
)
;;; This hack hides the lisp "quit" function, rebinding "quit"
to " quit - the - editor " , a much nicer function from Emacs ' point of view .
(putprop 'lisp-quit-function (get 'quit 'subr) 'subr)
(remprop 'quit 'subr)
(defcom-synonym quit quit-the-editor)
Exit from EMACS
(defcom quit-force
&numeric-argument (&reject)
(clear-reset)
(set-lisp-rdis-meters)
(alarmclock 'time nil) (alarmclock 'runtime nil)
(cond ((zerop (e_tasking_$quit)) (tasking-restart))
(t (lisp-quit-function))))
(defun clear-reset ()
(clear-the-screen)
(and split-mode-p (rdis-restore-screen-to-one-split))
(and DCTL-epilogue-availablep (DCTL-epilogue))
(e_pl1_$dump_output_buffer)
(e_pl1_$set_multics_tty_modes))
Restart a tasking Emacs .
(defun tasking-restart () (tasking-restart-internal) (pi-handler))
(defun tasking-restart-internal ()
(e_pl1_$init)
(e_pl1_$set_emacs_tty_modes)
(randomize-redisplay)
(and DCTL-prologue-availablep (DCTL-prologue))
(let ((su-args (e_argument_parse_$get_startup_info)))
(setq args:apply-arg (caddr (cddddr su-args))
args:paths (caddr su-args))
(setq emacs-start-ups-need-running 'default-emacs-start-up)
(init-echnego-bittab))
(clear-the-screen)
(setq tasking-restarted t))
;;; Decide if it's okay to quit now.
(defun okay-to-quit? ()
(do ((buffers known-buflist (cdr buffers))
(found nil))
((null buffers)
(cond ((not found) t)
(t (init-local-displays)
(local-display-generator-nnl "Modified Buffers:")
(local-display-generator-nnl "")
(mapc 'local-display-buffer-info found)
(local-display-generator-nnl "-------------------------")
(yesp "Modified buffers exist. Quit?"))))
(and (not (get (car buffers) 'dont-notice-modified-buffer))
(not (empty-buffer-p (car buffers)))
(get-buffer-state (car buffers) 'buffer-modified-flag)
(setq found (cons (car buffers) found)))))
(defun local-display-buffer-info (buffer)
(let ((path (get-buffer-state buffer 'fpathname)))
(local-display-generator-nnl
(catenate
(cond ((eq current-buffer buffer) ">")
((eq previous-buffer buffer) "<")
(t " "))
(cond ((get-buffer-state buffer 'buffer-modified-flag) "*")
(t " "))
(cond (path
(catenate buffer
(substr " "
1 (max (- 25.
(stringlength buffer))
1))
path))
(t buffer))))))
Mark this Emacs as dead if tasking , then quit .
(defcom destroy-task
(and minibufferp
(display-error "No quitting while in the minibuffer."))
(cond ((not tasking-emacs)
(display-error "This is not a tasking Emacs."))
((not (okay-to-quit?)) (command-quit))
(t (e_tasking_$destroy_me)
(run-emacs-epilogue-actions)
(quit-force))))
Exit from EMACS if no buffers are modified or user says OK
(defcom quit-the-editor
&numeric-argument (&reject)
(and minibufferp
(display-error "No quitting while in the minibuffer."))
(cond (tasking-emacs (clear-reset) (e_tasking_$quit) (tasking-restart))
((okay-to-quit?)
(run-emacs-epilogue-actions)
(quit-force))
(t (command-quit))))
5/6/80
(do nil ((null emacs-epilogue-action-list))
(errset (apply (caar emacs-epilogue-action-list)
(cdar emacs-epilogue-action-list)))
(setq emacs-epilogue-action-list (cdr emacs-epilogue-action-list))))
(defun set-emacs-epilogue-handler (fnandargs dupflg)
(or (and dupflg (assq (car fnandargs) emacs-epilogue-action-list))
(setq emacs-epilogue-action-list (cons fnandargs emacs-epilogue-action-list))))
;;;
(defun telnet-loser (c)
(cond ((or (= c 363)(= c 364)) ;BREAK, IP
(signalquit))
IAC DO
(setq c (e_pl1_$get_char))
(cond ((not (= c 1)) ;DO ECHO
(display-error-noabort "Ignoring TELNET IAC DO " (implode (explodec c))))))
IAC DONT
(setq c (e_pl1_$get_char))
(cond ((not (= c 1)) ;DONT ECHO
(display-error-noabort "Ignoring TELNET IAC DONT " (implode (explodec c))))))
(t (display-error-noabort "Ignoring TELNET IAC " (implode (explodec c)) "(octal). Good luck."))))
(defun define-autoload-lib fexpr (x)
(mapc '(lambda (y)(set-autoload-lib y (car x)))(cdr x)))
;;;
;;;
HELP ! What did I type ? ! ? ! ? 2/11/79
;;;
(defcom help
&undo &ignore
&numeric-argument (&ignore)
(init-local-displays)
(local-display-generator-nnl
(catenate "Help segments on Emacs are found in " documentation-dir "."))
(mapc 'local-display-generator-nnl
'("See emacs.gi.info there for full information on everything."
"Type the escape key, the question mark key, and some key that"
"you want to know about to find out about it. Type a control underscore"
"at any time to get more help. Type control underscore"
"and a question mark for all help commands."
"Type two linefeeds to remove this display,"
"or any other display that ends with -- * * * * * * * --,"
"from your screen."))
(end-local-displays))
(defcom-synonym ? help)
(defcom help-on-tap
&numeric-argument (&ignore)
&undo &ignore
(minibuffer-print "HELP: (? for more info): ")
(do x (get-char)(get-char) nil
(and (> x (1- #/a))
(< x (1+ #/z))
(setq x (- x 40)))
(cond ((= x 12))
((= x #/H)(help))
((= x #/C)(execute-command 'describe-key nil nil))
((= x #/D)(execute-command 'describe nil nil))
((= x #/A)(execute-command 'apropos nil nil))
((= x #/L)(help-list-typin))
((= x #/?)(help-whats-on-tap))
((= x 7)(command-quit)) ;^G
(t (help-whats-on-tap)))
(or (= x 12)(return nil)))
(minibuffer-print ""))
(defun help-whats-on-tap ()
(init-local-displays)
(mapc 'local-display-generator-nnl
'("^_ H gives general help info."
"^_ ? gives this list of what ^_ can do."
"^_ A followed by a word and a CR looks for appropriate"
" matching commands. Type ^_ D apropos CR for more on this."
"^_ C prompts for a character (or key sequence) and tells what it does."
"^_ D followed by an extended command name and a CR tells"
" about the extended command."
"^_ L Lists the last 50 characters or commands typed."))
(local-display-generator-nnl
"Type two linefeeds to remove this display from your screen.")
(end-local-displays))
(defun help-list-typin ()
(do ((stop (cond ((= history-next-index 0) 50.)
(t history-next-index)))
(cur history-next-index (1+ cur))
(first t nil)
(nl)
(l))
((and (not first)(= cur stop))
(do c 0 (1+ c)(= c 50.)
(or l (return nil))
(setq nl (cons (car l) nl) l (cdr l)))
(init-local-displays)
(do ((line (catenate (printable (car nl)) " ")
(catenate line (cond (nl (printable (car nl)))
(t ""))
" ")))
((null nl)
(or (nullstringp line)(samepnamep line " ")
(local-display-generator-nnl line)))
(cond ((> (stringlength line)(- screenlinelen 6))
(local-display-generator-nnl line)
(setq line "")))
(setq nl (cdr nl))))
(and (= cur 50.)(setq cur 0))
(cond ((numberp (saved-command-history cur))
(setq l (cons (saved-command-history cur) l)))
((null (saved-command-history cur)))
Next case is combined chars from get - top - level - char - innards
(t (setq l (append (nreverse (explodec (saved-command-history cur)))
l)))))
(local-display-generator-nnl "Type two linefeeds to remove this display from the screen.")
(end-local-displays))
| null | https://raw.githubusercontent.com/dancrossnyc/multics/dc291689edf955c660e57236da694630e2217151/library_dir_dir/system_library_unbundled/source/bound_multics_emacs_.s.archive/e_interact_.lisp | lisp | ***********************************************************
* *
* *
* *
* *
***********************************************************
e_interact_
All that of the basic editor which deals with being interactive
commands, prefixes, etc., as opposed to being an editor.
HISTORY COMMENTS:
pre-hcom history:
Split off from e_ when he grew too gravid.
BSG 8/4/78
Modified 1978.11.27-29 to reorganize interrupt stuff, etc. by rsl.
Modified 08/21/79 by GMP for negative arguments.
of multiple emacs's, tasking.
out previous-command after echo-negotiation. Also, last-input-char
is maintained by get-a-char, not process-char, so it is
Set up the &undo property on more commands.
escape prefix in parse-key-description.
forms, as they were moved to e_option_defaults_.
audit(86-08-12,Harvey), install(86-08-20,MR12.0-1136):
to fix wrong-type-arg error
audit(86-08-12,Harvey), install(86-08-20,MR12.0-1136):
to fix bug in the rewrite of permanently-set.
audit(86-08-12,Harvey), install(86-08-20,MR12.0-1136):
to remove top-level setq of
suppress-remarks, as it has been set in e_option_defaults_; changed
set-emacs-interrupt to grow the handler and handle arrays if
necessary, changed extended-command to ignore null command lines,
fixed some problems in key binding management, changed special
declaration to defvar, moved %include's to before declarations.
audit(88-06-08,RBarstad), install(88-08-01,MR12.2-1071):
places to improve readibility.
audit(88-06-08,RBarstad), install(88-08-01,MR12.2-1071):
exit and restore screen splits when later restarted.
END HISTORY COMMENTS
The key binding arrays.
These are created and initialized at dump time so that the
user needn't wait through them at startup time.
never becomes previous-command
for command bell
option for command bell
also
option for command metering
Terminal type.
t at dump time
t if we are running tasked.
t if we've been restarted.
called name of this incarnation:
whether or not to quit on typed BREAK
during emacs_ invocation.
for help command
for command history
used for checking macro hack
controls whether redisplay is enabled
Allows quits not to screen-hack
terminal needs hacking on setting Multics tty modes
interrupt went off in minibuffer
redisplay, do all the work!
list of known buffers
used in key parsing.
numeric argument to current function, or nil if none
whether or not to undo; like numarg
MCS escape character (\)
things to be done on exit
current char, for self-inserts
current/last command being executed
continuation of above, encoded.
symbol name of current buffer
for option mechanism, list thereof.
format is (macro restart count)
functions that don't break echnego
on at init time, until start-up over
buffer we came from
command being executed
argument list used to invoke last cmd
for user opinion on mode line
meters
lowest unused entry in interrupt handler table
records when interrupt handler may cause a redisplay
how to treat lisp errors
a newline as string object
ascii TAB
ascii escape
carriage return symbol
that too
Vertical Tab
on if split screens
t if any bit is on
t if all bits are off
Character function binding generators.
This is the setter of all keys.
esc-<number>
make ^G punt prefix only
this is array.
override
one there already
this redundant clause is a way out
dont overpush
Get printable name of a key
copy list
prefixed ones
displayable
not displayable
returns the display rep of a meta-char
For R11/ITS telnet ^_l
compatibility
Swaps "alternate-key-bindings" (the emacs_ table) with "key-bindings,"
the standard full-emacs table.
Full-hog key parser,
returns (m k p)
char-by-char
non-meta, non-prefix
rip out minus
plain old hat
make it an extended ASCII
nothing more
Randomness
(register-option 'eval:eval t) ; Unfortunately ;;; moved to e_option_defaults_
(register-option 'eval:assume-atom nil) ;;; moved to e_option_defaults_
(register-option 'eval:correct-errors nil) ;;; moved to e_option_defaults_
; ; moved to e_option_defaults _
; ; moved to e_option_defaults _
Listener
and toplevels.
read erase, kill, escape chars
init the guts of the editor.
CTRL/g escapes lossages
initialize the redisplay
And the interrupt scheme.
This should be in e_redisplay_ but is done here as the per invocation
stuff is done here.
Takes care of per invocation set-up for extended ASCII
successive bytes
pick a byte
to scan table
fix-up modes
File-file the pathnames and macro files.
Do -apply arguments.
restart redisplay if stopped
force redisplay to work on it
Extended chars break echonego by default
et in saecula saeculorum amen
pi -> ^b interrupt
CTRL/a -> reenter
Following is all of Multics EMACS.
Root tree of universe
seulement par ^G
gratuitous
&valid on off, when ready
default to "normal"
ick
Character readers
IT CAUSES REDISPLAY TO OCCUR WHEN THERE IS NO PENDING INPUT.
ALMOST ALL REDISPLAY IN THE WORLD IS INVOKED RIGHT HERE.
Attempt PL/I (and poss. better) echo negotiation.
try super-opt
line gotta be open
gotta be at eol
old rdis-suppr-rdis
update all parms
echnego ok minibuf even so
since we never actually execute a command
how it works:
internal and external. Internal numbers are assigned
sequentially from the variable next-interrupt-channel.
Internal numbers are used to index into the array
emacs-interrupt-handlers, and are returned by
e_pl1_$get_emacs_interrupt. External numbers are
assigned by e_pl1_$assign_channel, and are computed
as 64*emacs_recursion_level + internal_number. It is
these external numbers which must be passed to
e_pl1_$set_emacs_interrupt, and therefore it is these
which set-emacs-interrupt-handler returns.
don't destroy local display
returns interrupt channel number
ran out of channels
Functions to print errors/messages in the minibuffer
(register-option 'suppress-minibuffer nil) ;;; moved to e_option_defaults_
Print an error message.
Print an error message and abort.
Clear out the minibuffer.
Print a message in the minibuffer.
Print a message in the minibuffer without clearing current contents.
Delete the last N characters from the minibuffer.
Make a very transient remark.
Clear the last minibuffer statement.
Self-documentation primitives - see e_self_documentor_.
Get the function bound to a key
Read the name of key
Compatability
Execute supplied function on all keys defined in current buffer
i hated fortran as a child
and i hate it now as a programmer.
Command to quit to editor top level
Command to "ignore" a prefix character, by default on prefix-^G
Command to throw to top level or nearest yggdrasil (ldebug, multics mode
are the only others beside top level)
Set the undo switch.
number
want negative argument
want positive argument
negative argument (default -1)
character used to invoke this
number
negative argument
positive argument
NOTE- this code is buggy
default number if only + given
negate number (with -1 as default)
get charater invoked by (without meta-bit)
assume a digit
have character to execute
a sign given, set default
Character/Key/Command Execution
Process a character: determine if it is a "meta" character and then
execute the key corresponding to the character
meta-foo
non-meta foo
of a character, "meta"-bit, and prefix character used to determine the
exact command to be executed.
the command to execute
normal command
a prefix character
(register-option 'autoload-inform nil) ;;; moved to e_option_defaults_
Ensure that autoloads are done early in the execution phase.
keyboard macro
new-style command
old-style command
Avoid call if we can.
Handle command timing.
(register-option 'command-bell nil) ;;; moved to e_option_defaults_
nil=> no bell. fixnum=>number of bells. otherwise function to call.
(register-option 'command-bell-count nil) ;;; moved to e_option_defaults_
nil=> no metering. t=> minibuffer metering. otherwise function.
(register-option 'meter-commands nil) ;;; moved to e_option_defaults_
Moved to e_option_defaults
(defprop meter-commands t value-ok-anything)
Returns command name for error messages
Try to convert an argument to a fixnum and return nil if not valid
not valid in a number
Check for synonym command.
Check for undo.
Here to process numeric arguments.
Check for &numeric-function.
Check for &negative function.
Now process &repeat, &reject, &ignore and check bounds.
Simple case.
Has no special handling needed.
Deal with numeric argument, if any.
Call the function, and return its result.
Prepare for cleanup handler, in case specified.
Do prologue if specified.
has prologue code.
Process arguments.
wants arguments
Clear numarg for &repeat case.
Do the command as many times as necessary, calling the
prologue after each invocation, if there is one.
We won't need cleanup handler anymore.
Here we check for cleanup handler.
Interpret the numeric argument
a range is specified
lower bound specified
lose, lose
a special case
upper bound specified
lose, lose
a special case
Pass numeric argument.
Repeat numeric argument.
Ignore numeric argument.
If we get here, numarg-type = (lsh 030000 18.) Reject.
Interpret and complete the command's argument list
Slightly modified by JSL summer '82
no arguments allowed
but some were supplied
go through the arguments
until all args processed
'twas built in reverse
Interpretation of a single argument
data type of argument
can prompt for new value
start with what's given
return constructed arg
&rest-as-string
&rest-as-list
this will succeed
wants a string
wants a list
something here, check it for legality
string argument, no checking
wants a symbol
wants an integer
unknown data type
prompt or use default
prompt for it
if there's a default
no value given
have default value
no prompt, no default
Interpretation of an argument which should be a symbol
not found yet
but it's value is limited
not good
force prompt
value not restricted, got it
Interpretation of an argument which should be an integer
none yet
got something
but restricted
has lower bound
force prompt
has upper bound
force prompt
passed the tests
unrestricted, got it
not a number
force prompt
Evaluate an encoded value.
actual value is here
value from function
unknown
Execute an actual command the specified number of times
with the given arguments.
Function to return the last key typed by the user
split into pieces
if nothing there
Invoke an old-style extended command (no prompting, etc.)
unknown number wanted
correct number supplied
execute command
intern/convert all arguments
O boy hairy "macro" feature.
The state of the art advances now with my cursor.
When a macro is being executed, this is called to supply input from the
executing macro.
^U ^F, the ^F is like this in "articifially generated"
macros. char will get this, i.e., nothing at all,
and go to the tty for input
1/29/80 fix bsg
When a macro is being recorded, this is called to record a single input
once
empty in list
Save a macro definition
don't want it anywhere
ignore tlc, ok here.
hairy kind
y
n
Quit handling and no-op department - done right BSG 3/28/79
So that we can quit cleanly
in case quit was caused by
tty reconnect
Redisplay suppressed
be cleared on ^Z^Z or BREAK. The problem looks like this:
they get eaten .
option. If hardcore ever gets fixed, it would be nice to do a
force_out operation to make sure the characters get out.
This hack hides the lisp "quit" function, rebinding "quit"
Decide if it's okay to quit now.
BREAK, IP
DO ECHO
DONT ECHO
^G | * Copyright , ( C ) Honeywell Bull Inc. , 1988 *
* Copyright , ( C ) Honeywell Information Systems Inc. , 1982 *
* Copyright ( c ) 1978 by Massachusetts Institute of *
* Technology and Honeywell Information Systems , Inc. *
1 ) change(84 - 01 - 30,Margolin ) , approve ( ) , audit ( ) , install ( ):
Macro facility redone 2/11/79 by BSG .
Modified 06/20/79 by GMP for CTL prologue / epilogue handlers .
Modified : August 1979 by GMP for new command invocation mechanism .
Modified : June 1981 by RMSoley for understanding of emacs _ call .
Modified : July 1981 RMSoley for pl1 argument parsing , and support
Modified : March 1982 RMSoley for undo .
Modified : June 1982 B - get - top - level - char - innards nulls
more correct . Added JSL 's new command executor stuff .
Modified : 25 November 1983 to add " ^ [ " as a valid
Modified : 19 January 1984 to comment out register - option
Modified : 19 January 1984 Barmar to reject esc-<number > in genset - key .
Modified : 30 January 1984 Barmar to fix kmacro - display - interpret to
properly interpret " ESC + NUM " and meta characters .
2 ) change(84 - 12 - 25,Margolin ) , approve(86 - 02 - 24,MCR7186 ) ,
in multiplier command , change lambda into let , use defmacro .
3 ) change(84 - 12 - 26,Margolin ) , approve(86 - 02 - 24,MCR7186 ) ,
4 ) change(84 - 12 - 30,Margolin ) , approve(86 - 02 - 24,MCR7186 ) ,
5 ) change(88 - 01 - 07,Schroth ) , approve(88 - 02 - 29,MCR7851 ) ,
Implement 8 - bit extended ASCII I / O. Used ' new ' macros in various
6 ) change(88 - 01 - 07,Schroth ) , approve(88 - 02 - 29,MCR7852 ) ,
Added support for split - screen display : revert to one split on
(declare (genprefix /!eia_))
(%include e-macros)
(%include backquote)
(%include defmacro)
(declare (macros nil))
(%include e-define-command)
(%include other_other)
(%include sharpsign)
(declare (*lexpr display-error display-com-error display-error-noabort
display-com-error-noabort minibuffer-print
minibuffer-print-noclear minibuffer-remark))
(declare (*expr DCTL-epilogue DCTL-prologue assert-minor-mode clear-the-screen
convert_status_code_ cur-hpos decimal-rep display-init
e_argument_parse_$get_one_path e_pl1_$init
e_argument_parse_$get_startup_info
e_argument_parse_$new_arguments e_lap_$rtrim e_lap_$trim
e_pl1_$assign_channel e_pl1_$dump_output_buffer
e_pl1_$echo_negotiate_get_char e_pl1_$get_char
e_pl1_$get_editing_chars e_pl1_$get_emacs_interrupt
e_pl1_$get_emacs_interrupt_array e_pl1_$real_have_chars
e_pl1_$set_break_char e_pl1_$set_emacs_tty_modes
e_pl1_$set_multics_tty_modes e_tasking_$destroy_me
e_pl1_$set_extended_ascii e_pl1_$get_output_conv_table
e_tasking_$get_tasking_flag e_tasking_$quit echo-buffer-clear
echo-buffer-clear-all echo-buffer-outprint echo-buffer-print
echo-buffer-rubout echo-buffer-utter editor-main-init
emacs$set_emacs_return_code empty-buffer-p end-local-displays
error_table_ exists-file find-file-subr full-redisplay
get-buffer-state go-to-or-create-buffer init-local-displays
intern-minibuf-response jetteur-des-gazongues
lisp-quit-function loadfile local-display-generator-nnl
map-over-emacs-buffers minibuf-response negate-minor-mode
nullstringp randomize-redisplay rdis-find-non-displayable
redisplay ring-tty-bell
set-autoload-lib set-lisp-rdis-meters user_info_$homedir
user_info_$whoami yesp))
(declare (array* (notype (key-bindings 256. 2))))
(declare (array* (notype (saved-command-history 50.))))
(array saved-command-history t 50.)
(array key-bindings t 256. 2)
(fillarray 'key-bindings '(undefined-command))
(array alternate-key-bindings t 256. 2)
(fillarray 'alternate-key-bindings '(undefined-command))
(setq permanize-key-bindings t)
(defvar (
tty is a TELNET connection
for complete - command , ESC - SPACE
emacs / new_emacs / emacs _
suppress utterances by
next-multics-argno
buffer-modified-flag
terminal needs hacking on setting Emacs tty modes
in .
list of MCS escape ( \ ) , erase ( # ) , and kill ( @ ) characters
macro-collection-in-progress
last-macro-definition
pointer on current xec list
as it says , assq list
last command invoked in this Emacs
locechnego-meter
inhibit-default-start-up-execution
emacs-start-ups-need-running
NL
Formfeed
put in mbuf by pi - handler
args:apply-arg
args:ns
args:paths
args:ll
args:pl
tasking-arg
terminal can do 8bit ASCII
177 normally or 377 if 8 - bit
))
(defvar (
))
(declare (*expr rdis-restore-screen-to-one-split
rdis-recreate-splits-on-screen))
(defun display-load-time-error n
(princ (apply 'catenate (listify n)))
(terpri)
(break load-time-error t))
(putprop 'display-error
'(lambda n (apply 'display-load-time-error (listify n))) 'expr)
(putprop 'minibuffer-print
'(lambda n (apply 'display-load-time-error (listify n))) 'expr)
Macros to test bits in left - half of a fixnum : ( tlnX value mask )
`(not (tlne ,value ,mask)))
`(zerop (logand ,value (lsh ,mask 18.))))
(defmacro permanently-set (&body forms)
`(let ((permanize-key-bindings t))
.,forms))
(defcom set-perm-key
&arguments ((key &symbol &prompt "Key: ")
(function &symbol &prompt "Function: "))
&numeric-argument (&reject)
(permanently-set (set-key key function)))
(defcom-synonym set-permanent-key set-perm-key)
(defcom set-key
&arguments ((key &symbol &prompt "Key: ")
(function &symbol &prompt "Function: "))
&numeric-argument (&reject)
(let ((result (parse-key-description key)))
(genset-key (caddr result) (car result) (cadr result) function)))
(defvar permit-setting-esc-number nil)
(defun genset-key (prefix metap key function)
(or permit-setting-esc-number
(= metap 0)
(and (not (= key (CtoI "+")))
(not (= key (CtoI "-")))
(or (< key (CtoI "0"))
(> key (CtoI "9"))))
(display-error "esc-<number> may not be bound."))
(and (or prefix (= metap 1)) (> key (1- (CtoI "a"))) (< key (1+ (CtoI "z")))
(setq key (- key 40)))
(cond (prefix
(or (not (symbolp (key-bindings prefix 0)))
(genset-key nil 0 prefix
(let ((x (fillarray (*array (gensym) t 256.) '(undefined-command))))
(store (x 7) 'ignore-prefix)
(cond (permanize-key-bindings
(update-perm-key-bindings 0 key prefix (arraycall t metap key))
(update-local-key-bindings 0 key prefix function)))
(store (arraycall t metap key) function))
(t (cond (permanize-key-bindings
(remove-local-key-binding metap key nil))
((key-bindings key metap)
(update-perm-key-bindings metap key nil (key-bindings key metap))
(update-local-key-bindings metap key nil function)))
(or NowDumpingEmacs
(cond ((memq (key-bindings key metap) nobreak-functions)
(e_pl1_$set_break_char key 1)))
(cond ((memq function nobreak-functions)
(e_pl1_$set_break_char key 0))))
(store (key-bindings key metap) function))))
(defun update-perm-key-bindings (metap key prefix function)
(let ((keyrep (key-total-printed-symbol metap key prefix)))
(putprop keyrep function 'perm-key-function))))
(defun update-local-key-bindings (metap key prefix function)
(let ((keyrep (key-total-printed-symbol metap key prefix))
(listrep (key-fixnum-rep-encode metap key prefix)))
(let ((assq-answer (assq keyrep per-buffer-key-bindings)))
(cond (assq-answer (rplaca (cdr assq-answer) function))
(t (setq per-buffer-key-bindings
(cons (cons keyrep (cons function listrep))
per-buffer-key-bindings)))))))
(defun remove-local-key-binding (metap key prefix)
(let ((key-symbol (key-total-printed-symbol metap key prefix)))
(let ((assq-answer
(assq key-symbol per-buffer-key-bindings)))
(if assq-answer
(setq per-buffer-key-bindings
(delq assq-answer per-buffer-key-bindings))))))
(defun key-total-printed-symbol (metap key prefix)
(intern (make_atom (cond (prefix (catenate (printable prefix)(printable key)))
((= 0 metap)(printable key))
(t (catenate "esc-" (printable key)))))))
(defun get-key-name (key-list)
(apply 'key-total-printed-symbol key-list))
(defun key-fixnum-rep-encode (metap key prefix)
(list metap key prefix))
(defun reorganize-local-key-bindings (revert)
(let ((permanize-key-bindings t)
(unwind-protect
(progn (mapc '(lambda (x)
(prog (y)
(setq y (cond (revert (get (car x) 'perm-key-function))
(t (cadr x))))
-non - prefix first
(genset-key nil (car (cddr x)) (cadr (cddr x)) y))))
per-buffer-key-bindings)
(mapc '(lambda (x)
(prog (y)
(setq y (cond (revert (get (car x) 'perm-key-function))
(t (cadr x))))
(genset-key (caddr (cddr x)) 0 (cadr (cddr x)) y))))
per-buffer-key-bindings))
(setq per-buffer-key-bindings saved-local-bindings))))
(defun revert-local-key-bindings ()(reorganize-local-key-bindings t))
(defun instate-local-key-bindings ()(reorganize-local-key-bindings nil))
(defun printable (x)
(let ((y (cond ((numberp x) x)
(t (getcharn x 1)))))
8 - bit or META
((= y 33) "ESC")
((= y 15) "CR")
((= y 177) "\177")
((= y 40) "SPACE")
((< y 40) (catenate "^" (ascii (bit-set 100 y))))
((numberp x)(ascii x))
(t x))))
(defun printable-8-bit-char (ch-num)
the display rep of char that is either an 8 - bit ASCII or a meta char
(cond (DCTL-extended-ascii (printable-extended-ascii ch-num))
(t (printable-meta-char ch-num))))
(defun printable-extended-ascii (ch-num)
returns the display representation of an 8 - bit ASCII code
(let ((ch (ascii ch-num)))
(defun printable-meta-char (ch-num)
(catenate "meta-" (printable (bit-clear 200 ch-num))))
(defun swap-binding-tables ()
(do a 0 (1+ a) (= a 2)
(do b 0 (1+ b) (= b 256.)
(store (key-bindings b a)
(prog1 (alternate-key-bindings b a)
(store (alternate-key-bindings b a)
(key-bindings b a)))))))
BSG 8/5/78 Saturday morning .
(prog (prefix metap key)
(cond ((or (parse-key-match-list '(e s c a p e -))
(parse-key-match-list '(e s c -))
(parse-key-match-list '(m e t a -))
(parse-key-match-list '(m -))
(parse-key-match-list '(^ [ -))
(parse-key-match-list '(^ [)))
(setq metap 1))
(t (setq metap 0)
try for 1 frob .
(or kparse-list (kparse-error desc))
(or (< prefix (CtoI " "))
(kparse-error (catenate (printable prefix)
" may not be a prefix character.")))))
(setq key (parse-key-description-syllable desc))
(and (or (= 1 metap) prefix) (> key (1- (CtoI "a")))
(< key (1+ (CtoI "z")))(setq key (- key 40)))
(and kparse-list (kparse-error desc))
(return (list metap key prefix))))
(defun parse-key-description-syllable (desc)
(cond ((not kparse-list)(kparse-error desc))
control frob , = " ^ "
(setq kparse-list (cdr kparse-list))
(t (parse-key-controllify))))
((or (parse-key-match-list '(c -))
(parse-key-match-list '(c t l -))
(parse-key-match-list '(c o n t r o l -)))
(parse-key-controllify))
added Dec 84 EDSchroth
(or (parse-key-match-list '(x -))
(parse-key-match-list '(e x t -))
(parse-key-match-list '(e x t e n d e d -))))
((parse-key-match-list '(e s c)) 33)
((parse-key-match-list '(c r)) 15)
((parse-key-match-list '(\ /1 /7 /7)) 177)
((parse-key-match-list '(t a b)) 11)
((parse-key-match-list '(s p a c e)) 40)
((parse-key-match-list '(s p)) 40)
(t (prog1 (car kparse-list)
(setq kparse-list (cdr kparse-list))))))
(defun parse-key-controllify ()
(or kparse-list (kparse-error "Unspecified control character."))
(let ((kdesc (car kparse-list)))
(and (> kdesc (1- (CtoI "a")))
(< kdesc (1+ (CtoI "z")))
(setq kdesc (- kdesc 40)))
(or (and (< kdesc (1+ (CtoI "_")))
(> kdesc (1- (CtoI "@"))))
(kparse-error (catenate "^" (ascii kdesc) " is not ASCII.")))
(setq kparse-list (cdr kparse-list))
(- kdesc 100)))
Handles extended ascii key descriptions . Dec 84 EDSchroth
(defun parse-key-extendify (desc)
(or kparse-list (kparse-error "Unspecified extended character."))
make 8 - bit ASCII
(defun parse-key-match-list (matchee)
(do ((data kparse-list (cdr data))
(pattern matchee (cdr pattern))
(chara)(charb)(chardata))
((null pattern)(setq kparse-list data) t)
(setq chardata (car data))
(setq chara (getcharn (car pattern) 1))
(setq charb (cond ((and (< chara (1+ (CtoI "z")))
(> chara (1- (CtoI "a"))))
(- chara 40))
(t chara)))
(or (= chardata chara)(= chardata charb)(return nil))))
(defun kparse-error (desc)
(display-error "Invalid key description: " desc))
(setq NLCHARSTRING (ItoC 012) ESC (ascii 033))
(setq TAB (ascii 011) BACKSPACE (ascii 010) SPACE (ascii 040) CR (ascii 15)
CRET (ascii 015) NL (ascii 012) FF (ascii 14) VT (ascii 13))
Initialize the option mechanism first .
(setq list-of-known-options nil)
(defun require-symbol (putative-symbol)
(cond ((not (symbolp putative-symbol))
(display-error "This function requires a symbol."))))
(defun register-option (sym val)
(require-symbol sym)
(or (memq sym list-of-known-options)
(setq list-of-known-options
(sort (cons sym list-of-known-options) 'alphalessp)))
(remprop sym 'value-must-be-numeric)
(remprop sym 'value-ok-true-false)
(or (boundp sym)(set sym val)))
(defun listener-level () (start) (std-yggdrasil))
(defun start ()
11/3/80
(setq e-quit-transparency nil)
Lisp errors to minibuf
(and (eq emacs-name 'emacs_) (swap-binding-tables))
(or (boundp 'next-multics-argno) (setq next-multics-argno 1))
(setq history-next-index 0)
(setq macro-collection-in-progress nil previous-command nil
last-macro-definition nil)
(setq emacs-epilogue-action-list nil)
(sstatus cleanup '((run-emacs-epilogue-actions)))
(*rset nil)
(e_pl1_$set_emacs_tty_modes)
(sstatus mulpi t)
(sstatus interrupt 16. 'emacs-quit-handler)
(sstatus mulquit 16.)
(init-echnego-bittab)
init rsl 's hack .
fix up for possible 8 - bit
And the PL / I redisplay .
(setq permanize-key-bindings nil)
(reset-top-level-editor-state)
(setq emacs-start-ups-need-running t))
Initialize the 8 - bit printing character scan table at dump time
(declare
7bit non - printing
8bit non - printing
(defvar 7bit-tabscan-table
(fillarray (*array '7bit-tabscan-table 'fixnum 128.) '(-1)))
(defvar 8bit-tabscan-table
(fillarray (*array '8bit-tabscan-table 'fixnum 128.) '(-1)))
040 ... 173 print nicely
((= i 31.))
(store (arraycall fixnum 7bit-tabscan-table i) 0)
(store (arraycall fixnum 8bit-tabscan-table i) 0))
nix 177
nix 177
Dec 1984 EDSchroth
(defun init-extended-ascii-land ()
(setq char-input-mask 177)
the ctl knows about 8 - bit !
(setq char-input-mask 377)
(e_pl1_$set_extended_ascii 1)
add 8 - bit self - inserts based on TTT output conversion table
Also , define 8 - bit non - printing scan table
(let ((convtab (*array nil 'fixnum 64.)))
(e_pl1_$get_output_conv_table convtab)
do 8 - bit chars only
stop after # o377
if zero
copy entries for 200 ... 377
(store (arraycall fixnum 8bit-tabscan-table i)
(arraycall fixnum convtab i))))
(defvar emacs-start-up-error-message)
(defun run-emacs-start-up-error (arg)
arg
(display-error-noabort emacs-start-up-error-message)
(throw () emacs-start-up-tag))
(defun run-emacs-start-up-actions ()
(setq inhibit-default-start-up-execution nil)
(or (eq emacs-name 'emacs_)
(run-user-start-up (catenate (e_lap_$trim (user_info_$homedir))
">start_up.emacs"))
(run-user-start-up (catenate (user-project-dir)
">start_up.emacs"))
(run-user-start-up ">site>start_up.emacs"))
(and (eq emacs-name 'emacs_) (go-to-or-create-buffer 'main))
(or inhibit-default-start-up-execution (default-emacs-start-up))
(cond ((eq current-buffer '|<start_up_emacs_buffer>|)
(go-to-or-create-buffer 'main)
(setq previous-buffer 'main))
((eq previous-buffer '|<start_up_emacs_buffer>|)
(setq previous-buffer current-buffer)))
(setq known-buflist (delq '|<start_up_emacs_buffer>| known-buflist)))
(defun user-project-dir ()
(catenate ">user_dir_dir>"
(e_lap_$trim (cadr (user_info_$whoami)))))
(defun run-user-start-up (filename)
(cond (args:ns 't)
((exists-file filename 4)
(setq emacs-start-up-error-message "Error in start_up.emacs")
(catch
(let ((e-lisp-error-mode 'run-emacs-start-up-error))
(loadfile filename))
emacs-start-up-tag) 't)
('else nil)))
Re - written by GMP , 9/4/78 .
Re - written by RMSoley , 21 July 1981
(defun default-emacs-start-up ()
(setq inhibit-default-start-up-execution t)
(do ((paths args:paths (1- paths)))
((zerop paths))
(let ((info (e_argument_parse_$get_one_path)))
(cond ((zerop (cadr info))
(setq emacs-start-up-error-message
(catenate "Can't load file " (car info)))
(catch
(let ((e-lisp-error-mode 'run-emacs-start-up-error))
(load (e_lap_$trim (car info))))
emacs-start-up-tag))
(t
(catch
(find-file-subr (e_lap_$trim (car info)))
pgazonga)))))
(cond ((> args:apply-arg -1)
(setq emacs-start-up-error-message "Can't do -apply.")
(catch
(let ((e-lisp-error-mode 'run-emacs-start-up-error))
(apply (make_atom (status arg args:apply-arg))
(multics-args-as-list (1+ args:apply-arg))))
emacs-start-up-tag)))
(and tasking-restarted (full-redisplay))
(setq tasking-restarted nil))
(defun multics-args-as-list (first-argno)
(do ((count first-argno (1+ count))
(l))
((not (status arg count)) (nreverse l))
(setq l (cons (status arg count) l))))
(setq pi-handler-minibuffer-print nil tasking-restarted nil)
(defun pi-handler ()
(e_pl1_$set_emacs_tty_modes)
(randomize-redisplay)
(and DCTL-prologue-availablep (DCTL-prologue))
(and split-mode-p (rdis-recreate-splits-on-screen))
(reset-top-level-editor-state)
(cond ((zerop (e_argument_parse_$new_arguments))
(full-redisplay))
(t (tasking-restart-internal)))
(cond (pi-handler-minibuffer-print
(minibuffer-print pi-handler-minibuffer-print)
(setq pi-handler-minibuffer-print nil)))
(std-yggdrasil))
(defun reset-top-level-editor-state ()
(or minibufferp (instate-local-key-bindings))
(cond ((memq 'Macro/ Learn buffer-minor-modes)
(negate-minor-mode 'Macro/ Learn)))
numarg nil
undo nil
macro-execution-in-progress nil
macro-collection-in-progress nil
macrostack nil)
(or minibufferp (setq recursion-level 0)))
Modified 28 June 1981 RMSoley to use set_break_sequence
Modified Dec 1984 EDSchroth for 8bit ASCII .
(defun init-echnego-bittab ()
(do ((char 0 (1+ char))
(number 0)
(nlist ())
(count 0 (1+ count)))
((= char 256.)
(apply 'e_pl1_$set_break_sequence
(nreverse (cons number nlist))))
(and (not (zerop char))
(zerop (\ count 32.))
(setq nlist (cons number nlist)
count 0
number 0))
(setq number (lsh number 1))
(or (and (> char 31.) (< char 127.)
(memq (key-bindings char 0) nobreak-functions))
(setq number (1+ number)))))
(defcom debug-e
&numeric-argument (&reject)
(setq e-lisp-error-mode 'lisp-break)
(defun get-editing-characters ()
(let ((editing-chars (e_pl1_$get_editing_chars)))
(setq MCS-editing-characters (mapcar 'CtoI editing-chars)
MCS-escape-character (car editing-chars))
(set-editing-key (car editing-chars) 'escape-char)
(set-editing-key (cadr editing-chars) 'rubout-char)
(set-editing-key (caddr editing-chars) 'kill-to-beginning-of-line)))
(defun set-editing-key (character function)
(cond ((eq (get-key-binding (parse-key-description character))
'self-insert)
(set-perm-key character function))))
(do ()(nil)
ceci est jet'e
(ring-tty-bell)
(reset-top-level-editor-state)))
(defun charlisten ()
(let ((recursion-level recursion-level))
(do nil (nil)
(or macro-execution-in-progress
emacs-start-ups-need-running
(redisplay))
(catch
(errset (let ((fail-act 'e-lisp-lossage-handler)
(pdl-overflow 'e-lisp-lossage-handler)
(wrng-type-arg 'e-lisp-lossage-handler)
(*rset-trap 'e-lisp-lossage-handler)
(unbnd-vrbl 'e-lisp-lossage-handler)
(undf-fnctn 'e-lisp-lossage-handler)
(unseen-go-tag 'e-lisp-lossage-handler)
(wrng-no-args 'e-lisp-lossage-handler)
(errset 'e-lisp-lossage-handler))
(cond
((eq emacs-start-ups-need-running t)
(setq emacs-start-ups-need-running nil)
(run-emacs-start-up-actions))
(emacs-start-ups-need-running
(funcall
(prog1 emacs-start-ups-need-running
(setq emacs-start-ups-need-running
nil)))))
(do ((numarg nil nil) (undo nil nil)) (nil)
(process-char (get-top-level-char))))
nil)
pgazonga)
(reset-top-level-editor-state))))
(defun e-lisp-lossage-handler (arg)
(setq arg (caddr (errframe nil)))
(cond (e-quit-transparency (errprint nil))
(t (minibuffer-print
(car arg) " " (maknam (explodec (cadr arg))))))
(cond ((eq e-lisp-error-mode 'lisp-break)
(let ((e-quit-transparency 'transparent))
(e_pl1_$set_multics_tty_modes)
(terpri)(terpri)
(princ
(catenate "Lisp error in buffer " current-buffer))
(terpri)
(setq arg (eval (list 'break (caddr arg) t)))
(e_pl1_$set_emacs_tty_modes)
(full-redisplay))
(cond (arg)(t (command-prompt-abort))))
((null e-lisp-error-mode)(command-quit))
(t (funcall e-lisp-error-mode arg))))
(defcom lisp-error-mode
&numeric-argument (&reject)
(setq e-lisp-error-mode nil))
((memq mode '(t set on 1 lisp-break))
(setq e-lisp-error-mode 'lisp-break))
(t (display-error "Unknown lisp error mode: " mode))))
(declare (array* (notype (emacs-interrupt-handlers ?)(emacs-interrupt-handles ?))
(fixnum (emacs-interrupt-array ?))))
(defun get-top-level-char ()
(get-a-char 'toplevel-char 'get-top-level-char-innards))
(defun get-char ()
(get-a-char 'input-char 'e_pl1_$get_char))
(defun get-a-char (type get-char-function)
(let ((new-ch
(cond ((and macro-execution-in-progress (kmacro-get-one-cmd type)))
(t (do ((ch (funcall get-char-function) (funcall get-char-function)))
(nil)
(or (= 0 (emacs-interrupt-array 0)) (setq delayed-interrupt t))
(store (emacs-interrupt-array 0) 0)
(and (not minibufferp) delayed-interrupt (emacs-interrupt-processor))
(or (= ch -1)
(progn (store (saved-command-history history-next-index) ch)
(setq history-next-index
(cond ((= history-next-index 49.) 0)
(t (1+ history-next-index))))
(and macro-collection-in-progress
(kmacro-record-input ch type))
(return ch))))))))
last - input - char = char without META
new-ch))
Highly local specials for redisplay ( echo negotiation ) .
Goddamn backpanel wires to every board in the machine .
(defvar (X howmuchigot-sym rdis-upd-locecho-flg screenlinelen touchy-damaged-flag rdis-suppress-redisplay))
(defvar (rdis-multiwindowed-buflist rdis-inhibit-echnego))
(defvar (curlinel curstuff work-string curpointpos hard-enforce-fill-column fill-column))
(defun get-top-level-char-innards ()
(let ((ordi rdis-suppress-redisplay)
(chpos 0))
THIS NEXT STATEMENT IS PERHAPS THE MOST IMPORTANT IN MULTICS EMACS
(and (= 0 (e_pl1_$real_have_chars))(redisplay))
(not macro-collection-in-progress)
(not suppress-redisplay-flag)
(not (and hard-enforce-fill-column
(not (< (setq chpos (cur-hpos)) fill-column))))
(not rdis-inhibit-echnego)
(not (and minibufferp (> X (- screenlinelen 10.)))))
(or (not (memq current-buffer rdis-multiwindowed-buflist))
(setq locechnego-ctr (1+ locechnego-ctr))
(prog2 (set 'howmuchigot-sym 0)
(e_pl1_$echo_negotiate_get_char
work-string
'howmuchigot-sym
(cond (hard-enforce-fill-column
(min (- screenlinelen X)
(- fill-column chpos)))
(minibufferp
(- screenlinelen X 7))
(t (- screenlinelen X))))
(cond ((> howmuchigot-sym 0)
(store (saved-command-history history-next-index)
(substr work-string (1+ curpointpos) howmuchigot-sym))
(setq history-next-index
(cond ((= history-next-index 49.) 0)
(t (1+ history-next-index))))
(setq X (+ X howmuchigot-sym))
(setq locechnego-meter (+ locechnego-meter howmuchigot-sym))
(setq curpointpos (+ curpointpos howmuchigot-sym))
(setq curlinel (+ curlinel howmuchigot-sym))
(setq touchy-damaged-flag t)
(let ((rdis-upd-locecho-flg t))
(redisplay))))))
(t (e_pl1_$get_char)))))
interrupt handling integrated into e_interact _ 1978.11.21 by
There are two types of interrupt numbers , namely
(defun emacs-interrupt-processor ()
(setq delayed-interrupt nil)
(do ((int-info (e_pl1_$get_emacs_interrupt) (e_pl1_$get_emacs_interrupt)))
((< (car int-info) 0) (and (= recursion-level 0)
(redisplay)))
(let ((intno (car int-info)))
(cond ((emacs-interrupt-handlers intno)
(funcall (emacs-interrupt-handlers intno)
intno
(emacs-interrupt-handles intno)
(cadr int-info)))))))
(defvar max-emacs-interrupt-channel 64.)
(setq next-interrupt-channel (1+ next-interrupt-channel))
(setq max-emacs-interrupt-channel (* 2 max-emacs-interrupt-channel))
(*rearray 'emacs-interrupt-handlers t max-emacs-interrupt-channel)
(*rearray 'emacs-interrupt-handles t max-emacs-interrupt-channel))
(store (emacs-interrupt-handlers next-interrupt-channel) handler)
(store (emacs-interrupt-handles next-interrupt-channel) handle)
(e_pl1_$assign_channel next-interrupt-channel))
(defun interrupt-init ()
(*array 'emacs-interrupt-array 'external (e_pl1_$get_emacs_interrupt_array) 2)
(*array 'emacs-interrupt-handlers t max-emacs-interrupt-channel)
(*array 'emacs-interrupt-handles t max-emacs-interrupt-channel)
(setq delayed-interrupt nil)
(setq next-interrupt-channel -1))
(defvar (suppress-minibuffer))
(defun display-error-noabort n
(or suppress-minibuffer
(echo-buffer-print (apply 'catenate (listify n)))))
(defun display-error n
(or suppress-minibuffer
(apply 'display-error-noabort (listify n)))
(command-quit))
Print an error message : first argument is Multics error code .
(defun display-com-error-noabort n
(or suppress-minibuffer
(let ((prefix
(cond ((= 0 (arg 1)) "")
(t (catenate
(e_lap_$rtrim
(cadr (convert_status_code_ (arg 1))))
(cond ((> n 1) " ")
(t ""))))))
(message (cond ((> n 1)
(apply 'catenate (listify (- 1 n))))
(t ""))))
(echo-buffer-print (catenate prefix message)))))
Print an error message and abort : first argument is Multics error code .
(defun display-com-error n
(apply 'display-com-error-noabort (listify n))
(command-quit))
(defun minibuffer-clear-all ()
(echo-buffer-clear-all))
(defun minibuffer-print n
(or macro-execution-in-progress suppress-minibuffer
(echo-buffer-print (apply 'catenate (listify n)))))
(defun minibuffer-print-noclear n
(or macro-execution-in-progress suppress-minibuffer
(echo-buffer-outprint (apply 'catenate (listify n)))))
(defun minibuffer-rubout (n)
(or macro-execution-in-progress
(echo-buffer-rubout n)))
(defun minibuffer-remark n
(or macro-execution-in-progress suppress-remarks suppress-minibuffer
(echo-buffer-utter (apply 'catenate (listify n)))))
(defun display-error-remark n
(or suppress-minibuffer
(echo-buffer-utter (apply 'catenate (listify n)))))
(defun minibuffer-clear ()(echo-buffer-clear))
(defun get-cmd-symbol-3args (metap key prefix)
(cond ((and (= metap 1) prefix) nil)
((not prefix)
(cond ((subrp (key-bindings key metap)) nil)
(t (key-bindings key metap))))
(t (cond ((not (subrp (key-bindings prefix 0))) nil)
(t (arraycall t (key-bindings prefix 0) key))))))
(defun get-key-binding (key-list)
(apply 'get-cmd-symbol-3args key-list))
(defun key-prompt (prompt)
(prog (ch1)
(minibuffer-print prompt)
(setq ch1 (get-char))
(return (cond ((= ch1 377)
(setq ch1 (get-char))
(cond ((= ch1 377)
(minibuffer-print-noclear "esc-" (printable 177))
'(1 177 nil))
(t (return (telnet-loser ch1)))))
((> ch1 char-input-mask)
(minibuffer-print-noclear "esc-")
(key-prompt-1 1 (bit-clear 200 ch1) nil))
(t (key-prompt-1 0 ch1 nil))))))
(defun key-prompt-1 (metap key prefix)
(prog (mf1)
(and (or prefix (= metap 1))
(< key (1+ (CtoI "z")))(> key (1- (CtoI "a")))
(setq key (- key 40)))
(setq mf1 (cond (prefix (arraycall t (key-bindings prefix 0) key))
(t (key-bindings key metap))))
(cond ((eq mf1 'escape)
(minibuffer-print-noclear "esc-")
(return (key-prompt-1 1 (get-char) nil)))
((not (symbolp mf1))
(minibuffer-print-noclear (printable key)
" (prefix char): ")
(return (key-prompt-1 0 (get-char) key)))
(t (minibuffer-print-noclear (printable key))
(return (list metap key prefix))))))
(defun key-prompt-3args ()
(key-prompt "?: "))
(defun map-over-emacs-commands (fun arg)
(let ((element (key-bindings i j)))
(cond ((not (symbolp element))
(do k 0 (1+ k)(= k 256.)
(or (not (arraycall t element k))
(eq (arraycall t element k) 'undefined-command)
(funcall fun (key-total-printed-symbol 0 k i)
(arraycall t element k) arg))))
((eq element 'undefined-command))
(element
(funcall fun (key-total-printed-symbol j i nil) element arg)))))))
ESC Processing and Numeric Argument Readers
(defcom command-quit
&numeric-argument (&ignore)
&undo &ignore
(ring-tty-bell)
(throw 'les-petites-gazongues pgazonga))
(defcom ignore-prefix
&undo &ignore
&numeric-argument (&ignore)
(ring-tty-bell))
(defcom command-prompt-abort
&numeric-argument (&ignore)
&undo &ignore
(throw nil gazongue-a-l/'yggdrasil))
Command bound to ESC key
(defcom escape
&undo-function &pass
&numeric-argument (&pass)
(and (eq minibufferp ESC) (jetteur-des-gazongues))
(escape-dont-exit-minibuf))
(defprop throw-to-toplevel jetteur-des-gazongues expr)
(defcom-synonym escape-dont-exit-minibuffer escape-dont-exit-minibuf)
(defcom undo-prefix
&numeric-argument &pass
&undo &pass
(setq undo (not undo))
(process-char (get-char)))
Command that does real work of ESC
(defcom escape-dont-exit-minibuf
&numeric-argument (&pass)
&undo &pass
(prog (nxcn numf negate)
a (setq nxcn (get-char))
(or numarg (setq numarg 0))
(setq numarg (+ (- nxcn (CtoI "0")) (* 10. numarg)))
(setq numf t)
(go a))
(setq negate t numf t) (go a))
(setq numf t) (go a))
(setq numarg (- (or numarg 1))))
(cond (numf (process-char nxcn))
(t (execute-key 1 nxcn nil)))))))
Command to collect numeric argument or use powers of 4
(defcom multiplier
&undo &pass
&numeric-argument (&pass)
(prog (nxcn numf multf negate plus-given my-char)
a (setq nxcn (get-char))
(or numf (setq numf 0))
(setq numf (+ (- nxcn (CtoI "0"))(* 10. numf)))
(go a))
(setq numf 0 negate t) (go a))
(setq numf 0 plus-given t) (go a))
(cond ((and (not numf) (not multf))
(setq multf 4))
((not numf) (setq multf (* multf 4)))
(numf (setq numf nil))
(t (setq multf nil numf nil)))
(go a))
(t (and (or negate plus-given) (= numf 0)
(setq numarg (cond ((and numf multf) (* numf multf))
(numf)
(multf (* 4 multf))
(t 4)))
(process-char nxcn)))))
Read a " metazied " number ( from Network mostly )
(defcom read-meta-argument
&undo &pass
&numeric-argument (&ignore)
(prog (negate nxcn plus-given)
(setq numarg 0)
(cond ((= nxcn (CtoI "+")) (setq plus-given t))
((= nxcn (CtoI "-")) (setq negate t))
(setq numarg (- nxcn (CtoI "0")))))
a (setq nxcn (get-char))
(cond ((and (> nxcn (1- (+ 200 (CtoI "0")))) (< nxcn (1+ (+ 200 (CtoI "9")))))
(setq numarg (+ (- nxcn (+ 200 (CtoI "0"))) (* 10. numarg)))
(go a))
(and (= numarg 0) (or negate plus-given)
(and negate (setq numarg (- numarg)))
(process-char nxcn)))))
(defun process-char (ch)
(or (fixp ch)
(setq ch (CtoI ch)))
(let ((recursion-level (1+ recursion-level)))
(cond ((and (not (zerop network-flag))
TELNET IAC
(setq ch (get-char))
(cond ((= ch 377)
(execute-key 1 177 nil))
(t (telnet-loser ch))))
(execute-key 1 ch nil))
(t (execute-key 0 ch nil)))))
Execute a " key " as an Emacs command : A " key " is the triplet consisting
(defun execute-key (metap ch prefix)
(and (or (= metap 1) prefix)
(and (< ch (1+ (CtoI "z")))
(> ch (1- (CtoI "a")))
(setq ch (- ch 40))))
(cond ((not prefix) (setq command (key-bindings ch metap)))
(t (setq command (arraycall t (key-bindings prefix 0) ch))))
(setq last-command-triplet-mpfxk (cond ((= metap 1) 'meta)
(t prefix))
last-command-triplet-1 ch)
(execute-command command (last-command-triplet) nil))
(execute-key 0 (get-char) ch)))))
(defvar (autoload-inform))
(defun ensure-autoload (command)
(cond ((getl command '(editor-macro subr expr)))
((not (get command 'autoload)))
('else
(if autoload-inform
(minibuffer-print "Autoloading " command " ... "))
(protect (loadfile (get command 'autoload))
&success
(if autoload-inform
(minibuffer-print-noclear "done."))
&failure
(if autoload-inform
(minibuffer-print-noclear "failed."))))))
(setq last-time-sample nil)
Execute an Emacs command
(defun execute-command (command key argument-list)
(ensure-autoload command)
(setq current-command command)
(or last-time-sample (setq last-time-sample (time)))
(let ((last-time-sample 'dont-sample))
(or (null argument-list)
(display-error (ed-get-name command key)
" does not accept arguments."))
(push-editor-macro-level (get command 'editor-macro)
(editor-macro-arg-interp numarg))
(setq previous-command command
previous-argument-list nil))
(execute-new-command command key argument-list))
(or (null argument-list)
(display-error (ed-get-name command key)
" does not accept arguments."))
(execute-old-command command (last-command-triplet)))))
(command-timing last-time-sample))
(setq numarg nil undo nil last-time-sample nil))
nil= > no bell . otherwise threshhold in seconds
( defprop command - bell t value - ok - anything )
( defprop command - bell - count t value - ok - anything )
(defun command-timing (sample)
(or (null sample) (not (floatp sample))
(let ((difference (-$ (time) sample)))
(and command-bell (> difference (float command-bell))
(cond ((fixp command-bell-count)
(do-times command-bell-count (ring-tty-bell)))
(command-bell-count
(funcall command-bell-count difference))))
(cond ((eq meter-commands 't)
(minibuffer-print (decimal-rep difference) "s"))
(meter-commands
(funcall meter-commands difference))))))
(defun ed-get-name (command key)
(catenate command
(cond ((get command 'editor-macro) " (keyboard macro)")
(t ""))
(cond (key
(catenate " (" (get-key-name key) ")"))
(t ""))))
(defun ed-cv-fixnum-check (argument)
(let ((argument-list (exploden argument)))
(do ((digit (car argument-list) (car argument-list))
(negate)
(value))
((not digit)
(and negate (setq value (- value)))
value)
+ as first char
(setq value 0))
((and (= digit #/-) (not value))
(setq value 0 negate t))
((and (> digit (1- #/0)) (< digit (1+ #/9)))
(setq value (+ (- digit #/0) (* 10. (or value 0)))))
(return nil)))
(setq argument-list (cdr argument-list)))))
(setq *transparent-commands* '(escape multiplier noop re-execute-command
extended-command))
Invoke a new - style Emacs command
JSL 's new version - June 1982
(defun execute-new-command (command key argument-list)
(do ((done)
(flags (get command 'editor-command))
(function command)
(ignore-rejected-numarg)
(prologue-info)
(result)
(times))
(done result)
(and (symbolp flags)
(return (execute-command flags key argument-list)))
(if undo
(and (tlnn flags 000500)
(setq undo nil))
(and (tlnn flags 000400)
(return (execute-command (get command 'ed-undo-function)
key argument-list)))
(and (tlne flags 000700)
(display-error (ed-get-name command key)
" does not accept the undo prefix.")))
(if numarg
(if (tlnn flags 001000)
(setq function (get function 'ed-numeric-function))
(ensure-autoload function)
(or (and function (getl function '(subr lsubr fsubr
expr lexpr fexpr)))
(display-error (ed-get-name command key)
" does not accept a numeric argument."))
(setq flags (or (get function 'editor-command) 0)
ignore-rejected-numarg t))
(if (and (< numarg 0) (tlnn flags 200000))
(setq function (get function 'ed-negative-function))
(ensure-autoload function)
(or (and function (getl function '(subr lsubr fsubr
expr lexpr fexpr)))
(display-error (ed-get-name command key) " does not "
"accept a negative numeric argument."))
(setq flags (or (get function 'editor-command) 0)
numarg (- numarg)
ignore-rejected-numarg t))
(let ((numarg-type (logand flags (lsh 070000 18.)))
(numarg-range (and (tlnn flags 100000)
(get function 'ed-numeric-range))))
(setq times (ed-interpret-numarg command key numarg-type
numarg-range
ignore-rejected-numarg))))
(if (and (null argument-list)
(cond (times (setq numarg nil))
(t (setq times 1)))
(return
(cond ((eq (cadr function) 'subr)
(do ((i 1 (1+ i))
(f (caddr function))
(inv (or (memq command *transparent-commands*)
(memq command nobreak-functions))))
((> i times) result)
(setq result (subrcall t f))
(or inv
(setq previous-command command
previous-argument-list nil))))
(t (do ((i 1 (1+ i))
(inv (or (memq command *transparent-commands*)
(memq command nobreak-functions))))
((> i times) result)
(setq result (funcall function))
(or inv
(setq previous-command command
previous-argument-list nil)))))))
(unwind-protect
(progn
(setq prologue-info
(funcall (get function 'ed-prologue-function))))
(not (null argument-list)))
(setq argument-list
(ed-interpret-arguments command key function flags
argument-list)))
(cond (times (setq numarg nil))
(t (setq times 1)))
(do ((epilogue (and (tlnn flags 002000)
(get function 'ed-epilogue-function)))
(i 1 (1+ i))
(inv (or (memq command *transparent-commands*)
(memq command nobreak-functions))))
((> i times))
(setq result (apply function argument-list))
(and epilogue
(setq result (funcall epilogue prologue-info
result (= i times))))
(or inv
(setq previous-command command
previous-argument-list argument-list)))
(setq done (> times 0)))
(and (not done) (setq done t)
(tlnn flags 000040)
(setq flags (get function 'ed-cleanup-function))
(funcall flags prologue-info)))))
JSL 's new version - June 1982
(defun ed-interpret-numarg (command key numarg-type numarg-range
ignore-rejected-numarg)
(let ((lower (car numarg-range))
(upper (cdr numarg-range)))
(setq lower (ed-get-encoded-value lower))
(display-error
(ed-get-name command key)
" does not accept a "
"negative numeric argument.")
(t (catenate
"numeric argument < "
(decimal-rep lower)
"; you supplied "
(decimal-rep numarg) ".")))))))
(setq upper (ed-get-encoded-value upper))
(display-error
(ed-get-name command key)
" does not accept a "
"positive numeric argument.")
(t (catenate
"numeric argument > "
(decimal-rep upper)
"; you supplied "
(decimal-rep numarg) ".")))))))))
nil)
numarg)
(setq numarg nil))
(ignore-rejected-numarg
(setq numarg nil))
(t (display-error (ed-get-name command key)
" does not accept a numeric argument."))))
(defun ed-interpret-arguments (command key function flags argument-list)
(let ((nargs-given (length argument-list))
(nargs-wanted (logand flags 777777))
(args-template (get function 'ed-argument-list)))
(display-error (ed-get-name command key)
" does not accept arguments."))
(args-wanted args-template (cdr args-wanted))
(args-given argument-list (cdr args-given))
(new-arguments))
(setq new-arguments (cons
(ed-interpret-single-arg
command key nargs-wanted nargs-given i
(car args-wanted)
(car args-given)
(= i nargs-wanted) (cdr args-given))
new-arguments)))))
(defun ed-interpret-single-arg (command key nargs-wanted nargs-given
arg-no arg-template arg-supplied
last-argp rest-of-args-supplied)
(logand (car arg-template) (lsh 700000 18.)))
non - zero = > prompt if missing
(tlnn (car arg-template) 040000))
non - zero = > default value exists
(tlnn (car arg-template) 020000))
non - zero = > value is restricted
(tlnn (car arg-template) 010000))
(prompt-info (cadr arg-template))
(default-info (caddr arg-template))
(restriction-info (cadddr arg-template))
(show-error (cond ((tlnn (car arg-template) 040000)
'display-error-noabort)
(t 'display-error)))
(completion-list (eval (car (cddddr arg-template)))))
(have-argument))
(cond
(or last-argp
(display-error "Argument #" (decimal-rep arg-no)
" of " (ed-get-name command key)
" is a rest-of-arguments type, but "
"is not the last argument."))
the-argument (cond
((= data-type (lsh 300000 18.))
(catenate
(or arg-supplied "")
(do ((args
rest-of-args-supplied
(cdr args))
(x "" (catenate
x " " (car args))))
((null args) x))))
(append (and arg-supplied
(list arg-supplied))
rest-of-args-supplied)))))
((and last-argp rest-of-args-supplied)
(display-error (ed-get-name command key) " expects "
(decimal-rep nargs-wanted) " arguments;"
" you supplied " (decimal-rep nargs-given)
"."))
(the-argument
(setq have-argument t))
(let ((x (ed-interpret-symbol-arg
command key arg-no the-argument
show-error have-restrictions
restriction-info)))
(setq the-argument (car x)
have-argument (cdr x))))
((= data-type (lsh 200000 18.))
(let ((x (ed-interpret-integer-arg
command key arg-no the-argument
show-error have-restrictions
restriction-info)))
(setq the-argument (car x)
have-argument (cdr x))))
(display-error "Argument #" (decimal-rep arg-no)
" of " (ed-get-name command key)
" has an unknown data type."))))
(setq the-argument (minibuf-response
(ed-get-encoded-value
(car prompt-info))
(cdr prompt-info)))
(setq the-argument (ed-get-encoded-value
default-info))))
(setq the-argument (ed-get-encoded-value
default-info)))
(display-error "Argument #" (decimal-rep arg-no)
" of " (ed-get-name command key)
" has no prompt or default value.")
)))))))
(defun ed-interpret-symbol-arg (command key arg-no the-argument show-error
have-restrictions restriction-info)
(let ((argument (intern (make_atom (e_lap_$trim the-argument))))
(let ((possible-values (ed-get-encoded-value
restriction-info)))
(cond ((memq the-argument possible-values)
(setq have-argument t))
(funcall show-error
"Argument # " (decimal-rep arg-no)
" of " (ed-get-name command key)
" must be one of:"
(do ((values possible-values
(cdr possible-values))
(x "" (catenate x " "
(car values))))
((null values) x)))
(setq have-argument t)))
(cons argument have-argument)))
(defun ed-interpret-integer-arg (command key arg-no the-argument show-error
have-restrictions restriction-info)
(let ((value (cond ((fixp the-argument) the-argument)
(t (ed-cv-fixnum-check the-argument))))
(let ((lower (car restriction-info))
(upper (cdr restriction-info)))
(setq lower (ed-get-encoded-value
lower))
(cond ((< value lower)
(cond ((= lower 0)
(funcall
show-error
"Argument #"
(decimal-rep arg-no)
" of "
(ed-get-name
command key)
" must not be "
"negative."))
(t
(funcall
show-error
"Argument #"
(decimal-rep arg-no)
" of "
(ed-get-name
command key)
" must be >= "
(decimal-rep lower)
"; you supplied "
(decimal-rep value)
".")))
(setq value nil)))))
(setq upper (ed-get-encoded-value
upper))
(cond ((> value upper)
(cond ((= upper -1)
(funcall
show-error
"Argument #"
(decimal-rep arg-no)
" of "
(ed-get-name
command key)
" must not be "
"positive."))
(t (funcall
show-error
"Argument #"
(decimal-rep arg-no)
" of "
(ed-get-name
command key)
" must be <= "
(decimal-rep upper)
"; you supplied "
(decimal-rep value)
".")))
(setq value nil))))))
(setq have-argument t)))
(setq have-argument t))))
(funcall show-error
"Argument #" (decimal-rep arg-no) " of "
(ed-get-name command key)
" must be an integer, not " the-argument ".")
(cons value have-argument)))
(defun ed-get-encoded-value (encoded-value)
(let ((type (car encoded-value))
(value (cadr encoded-value)))
(display-error "Unknown value encoding: " type)))))
Execute an old style Emacs command
Slightly modified by JSL ( mostly format ) - June 1982
(defun execute-old-command (command key)
(let ((function command)
(numarg-repeat))
(setq numarg-repeat (get command 'argwants))
(and (< (or numarg 1) 0)
numarg-repeat
(setq numarg (- numarg)
function (or (get command 'negative-arg-function)
'bad-negative-argument)))
(or (eq (cadr function) 'subr)
(get function 'subr)
(get function 'expr)
(get function 'autoload)
(display-error "Undefined function " function " for "
command " (" (get-key-name key) ")"))
(setq numarg-repeat (cond (numarg-repeat (or numarg 1))
(t 1)))
(cond ((eq (cadr function) 'subr)
(do ((i 1 (1+ i))
(f (caddr function)))
((> i numarg-repeat))
(subrcall t f)
(setq previous-command command
previous-argument-list nil)))
(t (do ((i 1 (1+ i)))
((> i numarg-repeat))
(funcall function)
(setq previous-command command
previous-argument-list nil))))))
(defun execute-command-function (command function ntimes argument-list)
(cond ((and (eq (cadr function) 'subr) (< (length argument-list) 5))
(do ((i 1 (1+ i))
(f (caddr function))
(nargs (length argument-list)))
((> i ntimes))
(cond ((= nargs 0)
(subrcall t f))
((= nargs 1)
(subrcall t f (car argument-list)))
((= nargs 2)
(subrcall t f (car argument-list)
(cadr argument-list)))
((= nargs 3)
(subrcall t f (car argument-list)
(cadr argument-list) (caddr argument-list)))
((= nargs 4)
(subrcall t f (car argument-list)
(cadr argument-list) (caddr argument-list)
(car (cdddr argument-list)))))
(or (memq command '(escape multiplier noop
re-execute-command extended-command))
(setq previous-command command
previous-argument-list argument-list))))
(t (do i 1 (1+ i) (> i ntimes) (apply function argument-list)
(or (memq command '(escape multiplier noop
re-execute-command extended-command))
(setq previous-command command
previous-argument-list argument-list))))))
Emacs command to re - execute the last command
(defcom re-execute-command
&undo &pass
&numeric-argument (&pass)
(or previous-command
(display-error "No saved previous command"))
(execute-command previous-command nil previous-argument-list))
Emacs command invoked for an unbound key
(defcom undefined-command
&numeric-argument (&ignore)
&undo &ignore
(display-error "Unknown command: " (get-key-name (last-command-triplet))))
Emacs command invoked for a key whose command does n't accept negative arguments
(defcom bad-negative-argument
&undo &ignore
&numeric-argument (&ignore)
(display-error "Command rejected negative argument: " (get-key-name (last-command-triplet))))
(defun last-command-triplet ()
(cond ((eq last-command-triplet-mpfxk 'meta)
(list 1 last-command-triplet-1 nil))
(t (list 0 last-command-triplet-1 last-command-triplet-mpfxk))))
ESC - X Command
New version : 27 August 1979 by GMP
Invoke an Emacs command with arguments as read from mini - buffer
(defcom extended-command
&arguments ((command-line &prompt "Command: "
&completions Fundamental/.ext-commands))
&numeric-argument (&pass)
&undo &pass
(if (not (null command-list))
(let ((command-name (car command-list))
(arguments (cdr command-list)))
(let ((command (intern (make_atom command-name))))
(ensure-autoload command)
(cond ((getl command '(editor-command editor-macro))
(execute-command command nil arguments))
(t (execute-old-extended-command command arguments)))))))))
Parse a line into tokens , obeying the Multics quoting convention
(defun parse-command-line (line)
(do ((input (exploden line))
(answer nil))
(nil)
(setq input
(do ((input1 input (cdr input1)))
((or (null input1)
(not (member (car input1) '(#^I #^J #/ ))))
input1)))
(cond ((null input)
(return (nreverse answer)))
(t
(setq answer
(cons
(do ((result ""))
((or (null input)
(member (car input) '(#^I #^J #/ )))
result)
(setq result
(catenate result
(cond
((= (car input) #/")
(do ((input1 (cdr input) (cdr input1))
(quoted t)
(piece ""))
((not quoted)
(setq input input1)
piece)
(cond
((null input1)
(display-error "Unbalanced quotes."))
((and (= (car input1) #/")
(equal (cadr input1) #/"))
(setq input1 (cdr input1)
piece (catenate piece """")))
((= (car input1) #/")
(setq quoted nil))
(t
(setq piece (catenate piece
(ItoC (car input1))))))))
(t
(do ((input1 (cdr input) (cdr input1))
(piece (ItoC (car input))
(catenate piece (ItoC (car input1)))))
((or (null input1)
(member (car input1) '(#^I #^J #/ #/")))
(setq input input1)
piece)))))))
answer))))))
(defun execute-old-extended-command (command arguments)
(or (getl command '(expr subr lsubr autoload))
(display-error "Unknown command: " command))
(ensure-autoload command)
(let ((argsprop (args command))
(nargs (length arguments)))
((and (not (< nargs (or (car argsprop)
(cdr argsprop))))
(not (> nargs (cdr argsprop))))
(t
(display-error "Wrong number of arguments to extended command " command "."))))
(new-arg-list nil
(cons (let ((argument (car args))
(value))
(setq value (ed-cv-fixnum-check argument))
(cond (value value)
(t (intern (make_atom argument)))))
new-arg-list)))
((null args) (nreverse new-arg-list)))))
Appreciations to " EINE " E.L.E. ,
Redone pretty much wholesale 2/11/79 to allow " input chars " .
Have a good time in California , DLW , thanks for everything , -bsg .
(defun kmacro-get-one-cmd (expected-type)
(let ((this (car macro-execution-in-progress))
(rest (cdr macro-execution-in-progress)))
(cond ((and (numberp this)(eq expected-type 'input-char))
(setq macro-execution-in-progress rest)
this)
((eq expected-type 'toplevel-char)
(cond ((eq this 'macend)
(execute-single-editor-enmacroed-command 'macend)
(cond (macro-execution-in-progress
(kmacro-get-one-cmd expected-type))
(t nil)))
((atom this)
(display-error "Keyboard macro lost synchrony."))
((eq (car this) 'toplevel-char)
(setq macro-execution-in-progress rest)
(cdr this))
(t nil)))
((eq expected-type 'input-char)
(cdr this)))))
character . Toplevelness is stored for ease in displaying definition .
( An idea by )
(defun kmacro-record-input (ch type)
(setq macro-collection-in-progress
(cons (cond ((eq type 'toplevel-char)
(cons 'toplevel-char ch))
(t ch))
macro-collection-in-progress)))
The commands to start and stop collecting macroes ( macros ? , macreaux ? )
(defcom begin-macro-collection
&numeric-argument (&reject)
(cond (macro-collection-in-progress
(display-error "Macro already in collection."))
aaah ,
(command-quit))
(t (assert-minor-mode 'Macro/ Learn)
(setq macro-collection-in-progress (list nil)))))
(defcom end-macro-collection
&numeric-argument (&pass)
(wrap-up-macro-definition)
(and numarg (execute-last-editor-macro)))
(defun editor-macro-arg-interp (arg)
((= arg 0) 'query)
((< arg 0) 'forever)
((> arg 9999.) 'forever)
(t arg)))
(defun push-editor-macro-level (mac ntimes)
(and (> (length macrostack) 20.)
(display-error "Too much macro recursion."))
(and macrostack (rplaca (cdr (car macrostack)) macro-execution-in-progress))
(setq macrostack (cons (list mac mac ntimes) macrostack))
(setq macro-execution-in-progress (cadr (car macrostack))))
(defun wrap-up-macro-definition ()
(or macro-collection-in-progress (display-error "No macro in progress."))
(negate-minor-mode 'Macro/ Learn)
(setq last-macro-definition
(cdr (nreverse (cons 'macend
(do ((l macro-collection-in-progress (cdr l)))
((null l)(display-error "Void macro."))
(and (not (atom (car l)))
(eq (caar l) 'toplevel-char)
(return (cdr l))))))))
(setq macro-collection-in-progress nil))
(defcom execute-last-editor-macro
&numeric-argument (&pass)
(or last-macro-definition (display-error "No macro to run."))
(push-editor-macro-level last-macro-definition (editor-macro-arg-interp numarg)))
(defun execute-single-editor-enmacroed-command (x)
((eq x 'halt)
(setq macrostack (cdr macrostack))
(setq macro-execution-in-progress (cadar macrostack)))
((eq x 'repeat)
(setq macro-execution-in-progress (caar macrostack))
(rplaca (cdar macrostack) macro-execution-in-progress))
((eq x 'macend)
(let ((count (caddar macrostack)))
(cond ((eq count 'query)
(cond ((macro-query-get-answer)
(execute-single-editor-enmacroed-command 'repeat))
(t (execute-single-editor-enmacroed-command 'halt))))
((eq count 'forever)
(execute-single-editor-enmacroed-command 'repeat))
((< count 2)
(execute-single-editor-enmacroed-command 'halt))
(t (rplaca (cddar macrostack) (1- count))
(setq macro-execution-in-progress (caar macrostack))
(rplaca (cdar macrostack) macro-execution-in-progress)))))
(t (display-error "Internal macro format error: " x)))))))
Macro utilities
(defcom save-macro
&prologue &eval (or last-macro-definition
(display-error "No macro defintion to store."))
&arguments ((macro-name &symbol
&default &eval
(let ((name (intern-minibuf-response "Macro name? " NL)))
(cond ((getl name '(editor-command expr subr autoload))
(display-error name " is not an acceptable name."))
(t name))))
(macro-key &symbol
&default &eval
(get-key-name (key-prompt "On what key? "))))
&numeric-argument (&reject)
(putprop macro-name last-macro-definition 'editor-macro)
(set-key macro-key macro-name)))
(defcom show-last-or-current-macro
&numeric-argument (&pass)
(cond (macro-collection-in-progress (wrap-up-macro-definition)))
(show-editor-macro last-macro-definition))
(defcom show-macro
&arguments ((macro-name &symbol &prompt "Macro name: "))
&numeric-argument (&pass)
(cond ((get macro-name 'editor-macro)
(show-editor-macro (get macro-name 'editor-macro)))
(t (display-error macro-name " is not a defined macro."))))
(defun kmacro-display-interpret (x)
(prog (the-interpretation the-input fun prefix metap numbering stringing l2list whoops)
(setq the-input (nreverse (cdr (reverse x))))
tlc (cond ((null the-input)
(cond (stringing
(setq the-interpretation
(kmacro-stringing-util stringing the-interpretation))))
(return (nreverse the-interpretation))))
(setq x (car the-input) the-input (cdr the-input))
(setq prefix nil)
(cond ((> x char-input-mask) (setq x (bit-clear 200 x) metap 1))
(t (setq metap 0)))
(setq fun (get-key-binding (list metap x nil)) whoops x)
(cond (numbering
(cond ((kmacro-numberp x)
(setq numbering (cons x numbering))
(go tlc))
(t (setq the-interpretation
(cons (cons (implode (nreverse numbering))
'Numeric/ argument) the-interpretation)
numbering nil)))))
ARRAYP
(setq prefix x))
((or (eq fun 'escape)
(eq fun 'escape-dont-exit-minibuf))
(and stringing (setq the-interpretation
(kmacro-stringing-util stringing the-interpretation)
stringing nil))
(cond ((and (eq fun 'escape)
the-input (not (atom (car the-input)))))
probbly was ESC ending minibuffer , next was tlc .
((and the-input (kmacro-number-or-plusminusp (car the-input)))
(setq numbering (list (kmacro-number-or-plusminusp (car the-input)))
the-input (cdr the-input))
(setq the-interpretation
(cons (cons (key-total-printed-symbol metap x prefix) fun)
the-interpretation))
(go tlc))
(t (setq metap 1)
(cond ((null the-input)
(setq x whoops prefix nil metap 0))
(t (setq x (cond ((numberp (car the-input))
(car the-input))
(t (cdar the-input)))
the-input (cdr the-input))
(and (> x (1- (CtoI "a")))
(< x (1+ (CtoI "z")))
(setq x (- x 40))))))))
((eq fun 'multiplier)
(and stringing (setq the-interpretation
(kmacro-stringing-util stringing the-interpretation)
stringing nil))
(setq the-interpretation
(cons (cons (key-total-printed-symbol metap x prefix)
fun)
the-interpretation))
(cond ((and the-input (kmacro-number-or-plusminusp (car the-input)))
(setq numbering (list (kmacro-number-or-plusminusp (car the-input)))
the-input (cdr the-input))))
(go tlc)))
(cond ((not (null prefix))
(cond ((null the-input)(setq x whoops prefix nil metap 0))
(t (setq x (cond ((numberp (car the-input))
(car the-input))
(t (cdar the-input)))
the-input (cdr the-input))
(and (> x (1- (CtoI "a")))(< x (1+ (CtoI "z")))
(setq x (- x 40)))))))
(setq fun (get-cmd-symbol-3args metap x prefix))
(cond ((memq fun '(self-insert overwrite-mode-self-insert))
(setq stringing (cons (ascii x) stringing)))
(t (cond (stringing
(setq the-interpretation
(kmacro-stringing-util
stringing the-interpretation)
stringing nil)))
(setq the-interpretation
(cons (cons (key-total-printed-symbol metap x prefix)
(get-cmd-symbol-3args metap x prefix))
the-interpretation))))
(setq l2list nil)
cl2c (cond ((or (null the-input)
collect lev 2 ch
(eq (caar the-input) 'toplevel-char)))
(cond (l2list
(setq the-interpretation
(cons (cons (apply 'catenate
(nreverse l2list))
'Input/ Characters)
the-interpretation))))
(go tlc))
(t (setq l2list (cons (ascii (car the-input)) l2list)
the-input (cdr the-input))
(go cl2c)))))
(defun kmacro-stringing-util (s int)
(map '(lambda (x)(cond ((eq (car x) '/")(rplaca x """""")))) s)
(cons (cons (catenate """" (apply 'catenate (nreverse s)) """")
'String)
int))
(defun kmacro-numberp (x)
(cond ((numberp x))
((not (atom x))(setq x (cdr x))))
(and (> x (1- (CtoI "0"))) (< x (1+ (CtoI "9"))) x))
(defun kmacro-number-or-plusminusp (x)
(cond ((numberp x))
((not (atom x)) (setq x (cdr x))))
(cond ((and (> x (1- (CtoI "0"))) (< x (1+ (CtoI "9")))) x)
((= x (CtoI "+")) '+)
((= x (CtoI "-")) '-)))
(defun show-editor-macro (x)
Figger out what it means .
(init-local-displays)
(t (local-display-generator-nnl
(do ((mac x (cdr mac))
(stuff nil (cons (caar mac) stuff)))
WARNING 511 limit
(mapcar '(lambda (y)(catenate " " y)) (nreverse stuff))))))))
(end-local-displays))
(defun show-editor-macro-2 (x)
(local-display-generator-nnl
(catenate (car x) TAB
(cond ((getl (setq x (cdr x))
'(expr subr autoload)) x)
((memq x '(String Input/ Characters Numeric/ argument)) x)
((get x 'editor-macro)
(catenate x " (keyboard macro)"))
(t "--????--")))))
(defcom macro-query
&numeric-argument (&reject)
(cond (macro-collection-in-progress
(display-error-noabort "Inserting query at this point."))
((not macro-execution-in-progress)
(display-error "macro query: no macro running."))
(t (cond ((not (macro-query-get-answer))
(setq macro-execution-in-progress (caar macrostack)))))))
(defun macro-query-get-answer ()
(let ((macro-execution-in-progress nil)
(macro-collection-in-progress nil))
(echo-buffer-print "ok? :")
(redisplay)
(do ((ans (get-char)(get-char)))
(nil)
(cond ((= ans 7)(command-quit))
((= ans 161)(command-quit))
((= ans 12))
((= ans 40)(return t))
((= ans 15)(return nil))
(t (return nil))))))
Improvements for process preservation - BSG 3 December ' 79
(defun emacs-quit-handler (arg)
(setq arg arg)
(signalquit))
(defcom signalquit
&undo &ignore
&numeric-argument (&ignore)
(cond ((eq e-quit-transparency 'transparent)
This is to check flag safely even if NIL gets clobbered !
If this thing blows , you simply ca n't hit quit on Emacs .
(e-quit-transparency 'transparent))
(or oqt
(progn
(clear-the-screen)
(and split-mode-p (rdis-restore-screen-to-one-split))))
(and DCTL-epilogue-availablep (DCTL-epilogue))
(e_pl1_$dump_output_buffer)
(e_pl1_$set_multics_tty_modes)
(terpri)
(cond ((and (eq emacs-name 'emacs_) quit-on-break)
(emacs$set_emacs_return_code
(error_table_ 'action_not_performed))
(or tasking-emacs (lisp-quit-function))))
(signalquit-hardcore-vt132-writearound)
(ioc z)
(e_pl1_$set_emacs_tty_modes)
(and DCTL-prologue-availablep (DCTL-prologue))
(and split-mode-p (rdis-recreate-splits-on-screen))
(full-redisplay)
(display-error-noabort
"Restarting from QUIT... ")
(redisplay)))))))
Writearound for the hardcore / vt132 bug that causes screen to not
( 1 ) Emacs sends characters to fix up screen .
( 2 ) Emacs does ( ioc z ) , causing signal _ quit .
( 3 ) default_error_handler _ does a resetwrite .
( 5 ) Screen stays screwed , though no longer in Emacs .
( 6 ) User gets confused .
The only solutions are : ( 1 ) Do write_status 's until all output is out ,
or ( 2 ) Just do a ( sleep ) of some interesting length . I chose the sleep
14 November 1981
(defun signalquit-hardcore-vt132-writearound ()
(and (eq tty-type 'vt132) (sleep 2)))
(defcom noop
&numeric-argument (&ignore)
&undo &ignore
)
to " quit - the - editor " , a much nicer function from Emacs ' point of view .
(putprop 'lisp-quit-function (get 'quit 'subr) 'subr)
(remprop 'quit 'subr)
(defcom-synonym quit quit-the-editor)
Exit from EMACS
(defcom quit-force
&numeric-argument (&reject)
(clear-reset)
(set-lisp-rdis-meters)
(alarmclock 'time nil) (alarmclock 'runtime nil)
(cond ((zerop (e_tasking_$quit)) (tasking-restart))
(t (lisp-quit-function))))
(defun clear-reset ()
(clear-the-screen)
(and split-mode-p (rdis-restore-screen-to-one-split))
(and DCTL-epilogue-availablep (DCTL-epilogue))
(e_pl1_$dump_output_buffer)
(e_pl1_$set_multics_tty_modes))
Restart a tasking Emacs .
(defun tasking-restart () (tasking-restart-internal) (pi-handler))
(defun tasking-restart-internal ()
(e_pl1_$init)
(e_pl1_$set_emacs_tty_modes)
(randomize-redisplay)
(and DCTL-prologue-availablep (DCTL-prologue))
(let ((su-args (e_argument_parse_$get_startup_info)))
(setq args:apply-arg (caddr (cddddr su-args))
args:paths (caddr su-args))
(setq emacs-start-ups-need-running 'default-emacs-start-up)
(init-echnego-bittab))
(clear-the-screen)
(setq tasking-restarted t))
(defun okay-to-quit? ()
(do ((buffers known-buflist (cdr buffers))
(found nil))
((null buffers)
(cond ((not found) t)
(t (init-local-displays)
(local-display-generator-nnl "Modified Buffers:")
(local-display-generator-nnl "")
(mapc 'local-display-buffer-info found)
(local-display-generator-nnl "-------------------------")
(yesp "Modified buffers exist. Quit?"))))
(and (not (get (car buffers) 'dont-notice-modified-buffer))
(not (empty-buffer-p (car buffers)))
(get-buffer-state (car buffers) 'buffer-modified-flag)
(setq found (cons (car buffers) found)))))
(defun local-display-buffer-info (buffer)
(let ((path (get-buffer-state buffer 'fpathname)))
(local-display-generator-nnl
(catenate
(cond ((eq current-buffer buffer) ">")
((eq previous-buffer buffer) "<")
(t " "))
(cond ((get-buffer-state buffer 'buffer-modified-flag) "*")
(t " "))
(cond (path
(catenate buffer
(substr " "
1 (max (- 25.
(stringlength buffer))
1))
path))
(t buffer))))))
Mark this Emacs as dead if tasking , then quit .
(defcom destroy-task
(and minibufferp
(display-error "No quitting while in the minibuffer."))
(cond ((not tasking-emacs)
(display-error "This is not a tasking Emacs."))
((not (okay-to-quit?)) (command-quit))
(t (e_tasking_$destroy_me)
(run-emacs-epilogue-actions)
(quit-force))))
Exit from EMACS if no buffers are modified or user says OK
(defcom quit-the-editor
&numeric-argument (&reject)
(and minibufferp
(display-error "No quitting while in the minibuffer."))
(cond (tasking-emacs (clear-reset) (e_tasking_$quit) (tasking-restart))
((okay-to-quit?)
(run-emacs-epilogue-actions)
(quit-force))
(t (command-quit))))
5/6/80
(do nil ((null emacs-epilogue-action-list))
(errset (apply (caar emacs-epilogue-action-list)
(cdar emacs-epilogue-action-list)))
(setq emacs-epilogue-action-list (cdr emacs-epilogue-action-list))))
(defun set-emacs-epilogue-handler (fnandargs dupflg)
(or (and dupflg (assq (car fnandargs) emacs-epilogue-action-list))
(setq emacs-epilogue-action-list (cons fnandargs emacs-epilogue-action-list))))
(defun telnet-loser (c)
(signalquit))
IAC DO
(setq c (e_pl1_$get_char))
(display-error-noabort "Ignoring TELNET IAC DO " (implode (explodec c))))))
IAC DONT
(setq c (e_pl1_$get_char))
(display-error-noabort "Ignoring TELNET IAC DONT " (implode (explodec c))))))
(t (display-error-noabort "Ignoring TELNET IAC " (implode (explodec c)) "(octal). Good luck."))))
(defun define-autoload-lib fexpr (x)
(mapc '(lambda (y)(set-autoload-lib y (car x)))(cdr x)))
HELP ! What did I type ? ! ? ! ? 2/11/79
(defcom help
&undo &ignore
&numeric-argument (&ignore)
(init-local-displays)
(local-display-generator-nnl
(catenate "Help segments on Emacs are found in " documentation-dir "."))
(mapc 'local-display-generator-nnl
'("See emacs.gi.info there for full information on everything."
"Type the escape key, the question mark key, and some key that"
"you want to know about to find out about it. Type a control underscore"
"at any time to get more help. Type control underscore"
"and a question mark for all help commands."
"Type two linefeeds to remove this display,"
"or any other display that ends with -- * * * * * * * --,"
"from your screen."))
(end-local-displays))
(defcom-synonym ? help)
(defcom help-on-tap
&numeric-argument (&ignore)
&undo &ignore
(minibuffer-print "HELP: (? for more info): ")
(do x (get-char)(get-char) nil
(and (> x (1- #/a))
(< x (1+ #/z))
(setq x (- x 40)))
(cond ((= x 12))
((= x #/H)(help))
((= x #/C)(execute-command 'describe-key nil nil))
((= x #/D)(execute-command 'describe nil nil))
((= x #/A)(execute-command 'apropos nil nil))
((= x #/L)(help-list-typin))
((= x #/?)(help-whats-on-tap))
(t (help-whats-on-tap)))
(or (= x 12)(return nil)))
(minibuffer-print ""))
(defun help-whats-on-tap ()
(init-local-displays)
(mapc 'local-display-generator-nnl
'("^_ H gives general help info."
"^_ ? gives this list of what ^_ can do."
"^_ A followed by a word and a CR looks for appropriate"
" matching commands. Type ^_ D apropos CR for more on this."
"^_ C prompts for a character (or key sequence) and tells what it does."
"^_ D followed by an extended command name and a CR tells"
" about the extended command."
"^_ L Lists the last 50 characters or commands typed."))
(local-display-generator-nnl
"Type two linefeeds to remove this display from your screen.")
(end-local-displays))
(defun help-list-typin ()
(do ((stop (cond ((= history-next-index 0) 50.)
(t history-next-index)))
(cur history-next-index (1+ cur))
(first t nil)
(nl)
(l))
((and (not first)(= cur stop))
(do c 0 (1+ c)(= c 50.)
(or l (return nil))
(setq nl (cons (car l) nl) l (cdr l)))
(init-local-displays)
(do ((line (catenate (printable (car nl)) " ")
(catenate line (cond (nl (printable (car nl)))
(t ""))
" ")))
((null nl)
(or (nullstringp line)(samepnamep line " ")
(local-display-generator-nnl line)))
(cond ((> (stringlength line)(- screenlinelen 6))
(local-display-generator-nnl line)
(setq line "")))
(setq nl (cdr nl))))
(and (= cur 50.)(setq cur 0))
(cond ((numberp (saved-command-history cur))
(setq l (cons (saved-command-history cur) l)))
((null (saved-command-history cur)))
Next case is combined chars from get - top - level - char - innards
(t (setq l (append (nreverse (explodec (saved-command-history cur)))
l)))))
(local-display-generator-nnl "Type two linefeeds to remove this display from the screen.")
(end-local-displays))
|
fd8db4ce33861c13c5e3e302f6d0f3ba287390f2a1fe16678c87c4b43b7fce91 | dbuenzli/remat | remat.ml | ---------------------------------------------------------------------------
Copyright 2012 . All rights reserved .
Distributed under the BSD3 license , see license at the end of the file .
% % NAME%% release % % ---------------------------------------------------------------------------
Copyright 2012 Daniel C. Bünzli. All rights reserved.
Distributed under the BSD3 license, see license at the end of the file.
%%NAME%% release %%VERSION%%
---------------------------------------------------------------------------*)
* Remat main program .
open Cmdliner
let cmds = [ Cmd_convert.cmd; Cmd_browser.cmd; Cmd_publish.cmd; Cmd_help.cmd ]
let main () = match Term.eval_choice Cmd_default.cmd cmds with
| `Ok ret -> exit ret
| `Error _ -> exit 1
| `Help | `Version -> exit 0
let () = main ()
---------------------------------------------------------------------------
Copyright 2012
All rights reserved .
Redistribution and use in source and binary forms , with or without
modification , are permitted provided that the following conditions
are met :
1 . Redistributions of source code must retain the above copyright
notice , this list of conditions and the following disclaimer .
2 . Redistributions in binary form must reproduce the above
copyright notice , this list of conditions and the following
disclaimer in the documentation and/or other materials provided
with the distribution .
3 . Neither the name of nor the names of
contributors may be used to endorse or promote products derived
from this software without specific prior written permission .
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
" AS IS " AND ANY EXPRESS OR IMPLIED WARRANTIES , INCLUDING , BUT NOT
LIMITED TO , THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
A PARTICULAR PURPOSE ARE DISCLAIMED . IN NO EVENT SHALL THE COPYRIGHT
OWNER OR FOR ANY DIRECT , INDIRECT , INCIDENTAL ,
SPECIAL , EXEMPLARY , OR CONSEQUENTIAL DAMAGES ( INCLUDING , BUT NOT
LIMITED TO , PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES ; LOSS OF USE ,
DATA , OR PROFITS ; OR BUSINESS INTERRUPTION ) HOWEVER CAUSED AND ON ANY
THEORY OF LIABILITY , WHETHER IN CONTRACT , STRICT LIABILITY , OR TORT
( INCLUDING NEGLIGENCE OR OTHERWISE ) ARISING IN ANY WAY OUT OF THE USE
OF THIS SOFTWARE , EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE .
---------------------------------------------------------------------------
Copyright 2012 Daniel C. Bünzli
All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
are met:
1. Redistributions of source code must retain the above copyright
notice, this list of conditions and the following disclaimer.
2. Redistributions in binary form must reproduce the above
copyright notice, this list of conditions and the following
disclaimer in the documentation and/or other materials provided
with the distribution.
3. Neither the name of Daniel C. Bünzli nor the names of
contributors may be used to endorse or promote products derived
from this software without specific prior written permission.
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
"AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT
OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL,
SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT
LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE,
DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY
THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
(INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
---------------------------------------------------------------------------*)
| null | https://raw.githubusercontent.com/dbuenzli/remat/28d572e77bbd1ad46bbfde87c0ba8bd0ab99ed28/src-remat/remat.ml | ocaml | ---------------------------------------------------------------------------
Copyright 2012 . All rights reserved .
Distributed under the BSD3 license , see license at the end of the file .
% % NAME%% release % % ---------------------------------------------------------------------------
Copyright 2012 Daniel C. Bünzli. All rights reserved.
Distributed under the BSD3 license, see license at the end of the file.
%%NAME%% release %%VERSION%%
---------------------------------------------------------------------------*)
* Remat main program .
open Cmdliner
let cmds = [ Cmd_convert.cmd; Cmd_browser.cmd; Cmd_publish.cmd; Cmd_help.cmd ]
let main () = match Term.eval_choice Cmd_default.cmd cmds with
| `Ok ret -> exit ret
| `Error _ -> exit 1
| `Help | `Version -> exit 0
let () = main ()
---------------------------------------------------------------------------
Copyright 2012
All rights reserved .
Redistribution and use in source and binary forms , with or without
modification , are permitted provided that the following conditions
are met :
1 . Redistributions of source code must retain the above copyright
notice , this list of conditions and the following disclaimer .
2 . Redistributions in binary form must reproduce the above
copyright notice , this list of conditions and the following
disclaimer in the documentation and/or other materials provided
with the distribution .
3 . Neither the name of nor the names of
contributors may be used to endorse or promote products derived
from this software without specific prior written permission .
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
" AS IS " AND ANY EXPRESS OR IMPLIED WARRANTIES , INCLUDING , BUT NOT
LIMITED TO , THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
A PARTICULAR PURPOSE ARE DISCLAIMED . IN NO EVENT SHALL THE COPYRIGHT
OWNER OR FOR ANY DIRECT , INDIRECT , INCIDENTAL ,
SPECIAL , EXEMPLARY , OR CONSEQUENTIAL DAMAGES ( INCLUDING , BUT NOT
LIMITED TO , PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES ; LOSS OF USE ,
DATA , OR PROFITS ; OR BUSINESS INTERRUPTION ) HOWEVER CAUSED AND ON ANY
THEORY OF LIABILITY , WHETHER IN CONTRACT , STRICT LIABILITY , OR TORT
( INCLUDING NEGLIGENCE OR OTHERWISE ) ARISING IN ANY WAY OUT OF THE USE
OF THIS SOFTWARE , EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE .
---------------------------------------------------------------------------
Copyright 2012 Daniel C. Bünzli
All rights reserved.
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
are met:
1. Redistributions of source code must retain the above copyright
notice, this list of conditions and the following disclaimer.
2. Redistributions in binary form must reproduce the above
copyright notice, this list of conditions and the following
disclaimer in the documentation and/or other materials provided
with the distribution.
3. Neither the name of Daniel C. Bünzli nor the names of
contributors may be used to endorse or promote products derived
from this software without specific prior written permission.
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
"AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT
OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL,
SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT
LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE,
DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY
THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
(INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
---------------------------------------------------------------------------*)
| |
dbfcb5455b01b168a539376a311e6a2722034f016b866a219481ddf20af31892 | rjnw/sham | arith-stx.rkt | #lang racket
(require syntax/parse)
(require sham/sam/transform)
(require "../ast/basic-math.rkt")
#;(define-ast math
(expr
[neg ('- e)]
[div ('/ n d)]
[add ('+ e ...)]
[sub ('- e1 e2 ...)]
[mul ('* e ...)])
#:with struct-helpers sexp-printer
#:format (#f - #f - -))
(define-transform (parse-math)
(rkt-syntax -> math-ast)
(mexpr (stx -> val)
[n:integer (make-num (syntax-e n))]
[('- e:mexpr e2:mexpr ...) (make-sub e e2)]
[('/ n:mexpr d:mexpr) (make-div n d)]
[('+ es:mexpr ...) (make-add es)]
[('* es:mexpr ...) (make-mul es)]))
(module+ test
(require rackunit)
)
| null | https://raw.githubusercontent.com/rjnw/sham/6e0524b1eb01bcda83ae7a5be6339da4257c6781/sham-sam/sham/sam/test/transform/arith-stx.rkt | racket | (define-ast math | #lang racket
(require syntax/parse)
(require sham/sam/transform)
(require "../ast/basic-math.rkt")
(expr
[neg ('- e)]
[div ('/ n d)]
[add ('+ e ...)]
[sub ('- e1 e2 ...)]
[mul ('* e ...)])
#:with struct-helpers sexp-printer
#:format (#f - #f - -))
(define-transform (parse-math)
(rkt-syntax -> math-ast)
(mexpr (stx -> val)
[n:integer (make-num (syntax-e n))]
[('- e:mexpr e2:mexpr ...) (make-sub e e2)]
[('/ n:mexpr d:mexpr) (make-div n d)]
[('+ es:mexpr ...) (make-add es)]
[('* es:mexpr ...) (make-mul es)]))
(module+ test
(require rackunit)
)
|
e1c1bc29f1b966a1eb079e3dddf7a118b0d444e89b7d19fb535320baca02c129 | scrintal/heroicons-reagent | archive_box.cljs | (ns com.scrintal.heroicons.outline.archive-box)
(defn render []
[:svg {:xmlns ""
:fill "none"
:viewBox "0 0 24 24"
:strokeWidth "1.5"
:stroke "currentColor"
:aria-hidden "true"}
[:path {:strokeLinecap "round"
:strokeLinejoin "round"
:d "M20.25 7.5l-.625 10.632a2.25 2.25 0 01-2.247 2.118H6.622a2.25 2.25 0 01-2.247-2.118L3.75 7.5M10 11.25h4M3.375 7.5h17.25c.621 0 1.125-.504 1.125-1.125v-1.5c0-.621-.504-1.125-1.125-1.125H3.375c-.621 0-1.125.504-1.125 1.125v1.5c0 .621.504 1.125 1.125 1.125z"}]]) | null | https://raw.githubusercontent.com/scrintal/heroicons-reagent/572f51d2466697ec4d38813663ee2588960365b6/src/com/scrintal/heroicons/outline/archive_box.cljs | clojure | (ns com.scrintal.heroicons.outline.archive-box)
(defn render []
[:svg {:xmlns ""
:fill "none"
:viewBox "0 0 24 24"
:strokeWidth "1.5"
:stroke "currentColor"
:aria-hidden "true"}
[:path {:strokeLinecap "round"
:strokeLinejoin "round"
:d "M20.25 7.5l-.625 10.632a2.25 2.25 0 01-2.247 2.118H6.622a2.25 2.25 0 01-2.247-2.118L3.75 7.5M10 11.25h4M3.375 7.5h17.25c.621 0 1.125-.504 1.125-1.125v-1.5c0-.621-.504-1.125-1.125-1.125H3.375c-.621 0-1.125.504-1.125 1.125v1.5c0 .621.504 1.125 1.125 1.125z"}]]) | |
45629757a3989becd0502f844da05972633455d5c0580769a7855ed0bf46416e | mdsebald/link_blox_app | lblx_sample_hold.erl | %%% @doc
BLOCKTYPE
%%% Sample and Hold input values
%%% DESCRIPTION
%%% Output values will equal corresponding input values as long as hold input is false
%%% When hold input value is true, outputs will be held at the last value
%%% regardless of the input values.
%%% LINKS
%%% @end
-module(lblx_sample_hold).
-author("Mark Sebald").
-include("../block_state.hrl").
%% ====================================================================
%% API functions
%% ====================================================================
-export([groups/0, version/0]).
-export([create/2, create/4, create/5, upgrade/1, initialize/1, execute/2, delete/1]).
groups() -> [control].
version() -> "0.1.0".
%% Merge the block type specific, Config, Input, and Output attributes
%% with the common Config, Input, and Output attributes, that all block types have
-spec default_configs(BlockName :: block_name(),
Description :: string()) -> config_attribs().
default_configs(BlockName, Description) ->
attrib_utils:merge_attribute_lists(
block_common:configs(BlockName, ?MODULE, version(), Description),
[
{num_of_values, {1}} %| int | 1 | 1..99 |
]).
-spec default_inputs() -> input_attribs().
default_inputs() ->
attrib_utils:merge_attribute_lists(
block_common:inputs(),
[
{hold, {false, {false}}}, %| bool | false | true, false |
{inputs, [{empty, {empty}}]} %| array of any | empty | N/A |
]).
-spec default_outputs() -> output_attribs().
default_outputs() ->
attrib_utils:merge_attribute_lists(
block_common:outputs(),
[
{outputs, [{null, []}]} %| array of any | null | N/A |
]).
%%
%% Create a set of block attributes for this block type.
Init attributes are used to override the default attribute values
%% and to add attributes to the lists of default attributes
%%
-spec create(BlockName :: block_name(),
Description :: string()) -> block_defn().
create(BlockName, Description) ->
create(BlockName, Description, [], [], []).
-spec create(BlockName :: block_name(),
Description :: string(),
InitConfig :: config_attribs(),
InitInputs :: input_attribs()) -> block_defn().
create(BlockName, Description, InitConfig, InitInputs) ->
create(BlockName, Description, InitConfig, InitInputs, []).
-spec create(BlockName :: block_name(),
Description :: string(),
InitConfig :: config_attribs(),
InitInputs :: input_attribs(),
InitOutputs :: output_attribs()) -> block_defn().
create(BlockName, Description, InitConfig, InitInputs, InitOutputs) ->
% Update Default Config, Input, Output, and Private attribute values
% with the initial values passed into this function.
%
% If any of the intial attributes do not already exist in the
% default attribute lists, merge_attribute_lists() will create them.
Config = attrib_utils:merge_attribute_lists(default_configs(BlockName, Description), InitConfig),
Inputs = attrib_utils:merge_attribute_lists(default_inputs(), InitInputs),
Outputs = attrib_utils:merge_attribute_lists(default_outputs(), InitOutputs),
% This is the block definition,
{Config, Inputs, Outputs}.
%%
%% Upgrade block attribute values, when block code and block data versions are different
%%
-spec upgrade(BlockDefn :: block_defn()) -> {ok, block_defn()} | {error, atom()}.
upgrade({Config, Inputs, Outputs}) ->
ModuleVer = version(),
{BlockName, BlockModule, ConfigVer} = config_utils:name_module_version(Config),
BlockType = type_utils:type_name(BlockModule),
case attrib_utils:set_value(Config, version, version()) of
{ok, UpdConfig} ->
m_logger:info(block_type_upgraded_from_ver_to,
[BlockName, BlockType, ConfigVer, ModuleVer]),
{ok, {UpdConfig, Inputs, Outputs}};
{error, Reason} ->
m_logger:error(err_upgrading_block_type_from_ver_to,
[Reason, BlockName, BlockType, ConfigVer, ModuleVer]),
{error, Reason}
end.
%%
Initialize block values
%% Perform any setup here as needed before starting execution
%%
-spec initialize(BlockState :: block_state()) -> block_state().
initialize({Config, Inputs, Outputs, Private}) ->
case config_utils:get_integer_range(Config, num_of_values, 1, 99) of
{ok, NumOfValues} ->
Create N inputs and outputs
BlockName = config_utils:name(Config),
Inputs1 = input_utils:resize_attribute_array_value(BlockName, Inputs,
inputs, NumOfValues, {empty, {empty}}),
Outputs1 = output_utils:resize_attribute_array_value(Outputs,
outputs, NumOfValues, {null, []}),
Value = null,
Status = initialed;
{error, Reason} ->
Inputs1 = Inputs,
Outputs1 = Outputs,
{Value, Status} = config_utils:log_error(Config, num_of_values, Reason)
end,
Outputs2 = output_utils:set_value_status(Outputs1, Value, Status),
% This is the block state
{Config, Inputs1, Outputs2, Private}.
%%
%% Execute the block specific functionality
%%
-spec execute(BlockState :: block_state(),
ExecMethod :: exec_method()) -> block_state().
execute({Config, Inputs, Outputs, Private}, disable) ->
Outputs1 = output_utils:update_all_outputs(Outputs, null, disabled),
{Config, Inputs, Outputs1, Private};
execute({Config, Inputs, Outputs, Private}, _ExecMethod) ->
case input_utils:get_boolean(Inputs, hold) of
{ok, true} ->
% Outputs are held at last value, don't update
Value = true, Status = normal,
Outputs1 = Outputs;
{ok, Value} -> % hold input value is false or null,
Status = normal,
% Pass input values through to outputs.
% Quantity of input and output values are the same
{ok, {inputs, InputVals}} = attrib_utils:get_attribute(Inputs, inputs),
OutputVals = lists:map(fun({InputVal, {_DefVal}}) -> InputVal end, InputVals),
Outputs1 = output_utils:set_array_values(Outputs, outputs, OutputVals);
{error, Reason} ->
{Value, Status} = input_utils:log_error(Config, hold, Reason),
{ok, NumOfValues} = config_utils:get_integer(Config, num_of_values),
% Set array of output values to null
NullVals = lists:duplicate(NumOfValues, null),
Outputs1 = output_utils:set_array_values(Outputs, outputs, NullVals)
end,
Outputs2 = output_utils:set_value_status(Outputs1, Value, Status),
% Return updated block state
{Config, Inputs, Outputs2, Private}.
%%
%% Delete the block
%%
-spec delete(BlockState :: block_state()) -> block_defn().
delete({Config, Inputs, Outputs, _Private}) ->
{Config, Inputs, Outputs}.
%% ====================================================================
Internal functions
%% ====================================================================
%% ====================================================================
%% Tests
%% ====================================================================
-ifdef(TEST).
-include_lib("eunit/include/eunit.hrl").
-include("block_io_test_gen.hrl").
test_sets() ->
[
% Test bad config values
{[{num_of_values, -1}],[{hold, "Bad Value"}], [{status, config_err}, {value, null}, {{outputs, 1}, null}]},
{[{num_of_values, 100}],[], [{status, config_err}, {value, null}, {{outputs, 1}, null}]},
% Test bad input values
{[{num_of_values, 1}], [], [{status, input_err}, {value, null}, {{outputs, 1}, null}]},
{[{hold, true}, {{inputs, 1}, "something"}], [{status, normal}, {value, true}, {{outputs, 1}, null}]},
{[{hold, false}], [{status, normal}, {value, false}, {{outputs, 1}, "something"}]},
{[{hold, false}, {{inputs, 1}, "something else"}], [{status, normal}, {value, false}, {{outputs, 1}, "something else"}]},
{[{num_of_values, 10}], [{hold, true}, {{inputs, 1}, 1},{{inputs, 5}, 5}, {{inputs, 10}, 10}],
[{status, normal}, {value, true}, {{outputs, 1}, "something else"}, {{outputs, 5}, null}, {{outputs, 10}, null}]},
{[{hold, false}], [{status, normal}, {value, false}, {{outputs, 1}, 1}, {{outputs, 5}, 5}, {{outputs, 10}, 10}]}
].
-endif.
| null | https://raw.githubusercontent.com/mdsebald/link_blox_app/64034fa5854759ad16625b93e3dde65a9c65f615/src/block_types/lblx_sample_hold.erl | erlang | @doc
Sample and Hold input values
DESCRIPTION
Output values will equal corresponding input values as long as hold input is false
When hold input value is true, outputs will be held at the last value
regardless of the input values.
LINKS
@end
====================================================================
API functions
====================================================================
Merge the block type specific, Config, Input, and Output attributes
with the common Config, Input, and Output attributes, that all block types have
| int | 1 | 1..99 |
| bool | false | true, false |
| array of any | empty | N/A |
| array of any | null | N/A |
Create a set of block attributes for this block type.
and to add attributes to the lists of default attributes
Update Default Config, Input, Output, and Private attribute values
with the initial values passed into this function.
If any of the intial attributes do not already exist in the
default attribute lists, merge_attribute_lists() will create them.
This is the block definition,
Upgrade block attribute values, when block code and block data versions are different
Perform any setup here as needed before starting execution
This is the block state
Execute the block specific functionality
Outputs are held at last value, don't update
hold input value is false or null,
Pass input values through to outputs.
Quantity of input and output values are the same
Set array of output values to null
Return updated block state
Delete the block
====================================================================
====================================================================
====================================================================
Tests
====================================================================
Test bad config values
Test bad input values | BLOCKTYPE
-module(lblx_sample_hold).
-author("Mark Sebald").
-include("../block_state.hrl").
-export([groups/0, version/0]).
-export([create/2, create/4, create/5, upgrade/1, initialize/1, execute/2, delete/1]).
groups() -> [control].
version() -> "0.1.0".
-spec default_configs(BlockName :: block_name(),
Description :: string()) -> config_attribs().
default_configs(BlockName, Description) ->
attrib_utils:merge_attribute_lists(
block_common:configs(BlockName, ?MODULE, version(), Description),
[
]).
-spec default_inputs() -> input_attribs().
default_inputs() ->
attrib_utils:merge_attribute_lists(
block_common:inputs(),
[
]).
-spec default_outputs() -> output_attribs().
default_outputs() ->
attrib_utils:merge_attribute_lists(
block_common:outputs(),
[
]).
Init attributes are used to override the default attribute values
-spec create(BlockName :: block_name(),
Description :: string()) -> block_defn().
create(BlockName, Description) ->
create(BlockName, Description, [], [], []).
-spec create(BlockName :: block_name(),
Description :: string(),
InitConfig :: config_attribs(),
InitInputs :: input_attribs()) -> block_defn().
create(BlockName, Description, InitConfig, InitInputs) ->
create(BlockName, Description, InitConfig, InitInputs, []).
-spec create(BlockName :: block_name(),
Description :: string(),
InitConfig :: config_attribs(),
InitInputs :: input_attribs(),
InitOutputs :: output_attribs()) -> block_defn().
create(BlockName, Description, InitConfig, InitInputs, InitOutputs) ->
Config = attrib_utils:merge_attribute_lists(default_configs(BlockName, Description), InitConfig),
Inputs = attrib_utils:merge_attribute_lists(default_inputs(), InitInputs),
Outputs = attrib_utils:merge_attribute_lists(default_outputs(), InitOutputs),
{Config, Inputs, Outputs}.
-spec upgrade(BlockDefn :: block_defn()) -> {ok, block_defn()} | {error, atom()}.
upgrade({Config, Inputs, Outputs}) ->
ModuleVer = version(),
{BlockName, BlockModule, ConfigVer} = config_utils:name_module_version(Config),
BlockType = type_utils:type_name(BlockModule),
case attrib_utils:set_value(Config, version, version()) of
{ok, UpdConfig} ->
m_logger:info(block_type_upgraded_from_ver_to,
[BlockName, BlockType, ConfigVer, ModuleVer]),
{ok, {UpdConfig, Inputs, Outputs}};
{error, Reason} ->
m_logger:error(err_upgrading_block_type_from_ver_to,
[Reason, BlockName, BlockType, ConfigVer, ModuleVer]),
{error, Reason}
end.
Initialize block values
-spec initialize(BlockState :: block_state()) -> block_state().
initialize({Config, Inputs, Outputs, Private}) ->
case config_utils:get_integer_range(Config, num_of_values, 1, 99) of
{ok, NumOfValues} ->
Create N inputs and outputs
BlockName = config_utils:name(Config),
Inputs1 = input_utils:resize_attribute_array_value(BlockName, Inputs,
inputs, NumOfValues, {empty, {empty}}),
Outputs1 = output_utils:resize_attribute_array_value(Outputs,
outputs, NumOfValues, {null, []}),
Value = null,
Status = initialed;
{error, Reason} ->
Inputs1 = Inputs,
Outputs1 = Outputs,
{Value, Status} = config_utils:log_error(Config, num_of_values, Reason)
end,
Outputs2 = output_utils:set_value_status(Outputs1, Value, Status),
{Config, Inputs1, Outputs2, Private}.
-spec execute(BlockState :: block_state(),
ExecMethod :: exec_method()) -> block_state().
execute({Config, Inputs, Outputs, Private}, disable) ->
Outputs1 = output_utils:update_all_outputs(Outputs, null, disabled),
{Config, Inputs, Outputs1, Private};
execute({Config, Inputs, Outputs, Private}, _ExecMethod) ->
case input_utils:get_boolean(Inputs, hold) of
{ok, true} ->
Value = true, Status = normal,
Outputs1 = Outputs;
Status = normal,
{ok, {inputs, InputVals}} = attrib_utils:get_attribute(Inputs, inputs),
OutputVals = lists:map(fun({InputVal, {_DefVal}}) -> InputVal end, InputVals),
Outputs1 = output_utils:set_array_values(Outputs, outputs, OutputVals);
{error, Reason} ->
{Value, Status} = input_utils:log_error(Config, hold, Reason),
{ok, NumOfValues} = config_utils:get_integer(Config, num_of_values),
NullVals = lists:duplicate(NumOfValues, null),
Outputs1 = output_utils:set_array_values(Outputs, outputs, NullVals)
end,
Outputs2 = output_utils:set_value_status(Outputs1, Value, Status),
{Config, Inputs, Outputs2, Private}.
-spec delete(BlockState :: block_state()) -> block_defn().
delete({Config, Inputs, Outputs, _Private}) ->
{Config, Inputs, Outputs}.
Internal functions
-ifdef(TEST).
-include_lib("eunit/include/eunit.hrl").
-include("block_io_test_gen.hrl").
test_sets() ->
[
{[{num_of_values, -1}],[{hold, "Bad Value"}], [{status, config_err}, {value, null}, {{outputs, 1}, null}]},
{[{num_of_values, 100}],[], [{status, config_err}, {value, null}, {{outputs, 1}, null}]},
{[{num_of_values, 1}], [], [{status, input_err}, {value, null}, {{outputs, 1}, null}]},
{[{hold, true}, {{inputs, 1}, "something"}], [{status, normal}, {value, true}, {{outputs, 1}, null}]},
{[{hold, false}], [{status, normal}, {value, false}, {{outputs, 1}, "something"}]},
{[{hold, false}, {{inputs, 1}, "something else"}], [{status, normal}, {value, false}, {{outputs, 1}, "something else"}]},
{[{num_of_values, 10}], [{hold, true}, {{inputs, 1}, 1},{{inputs, 5}, 5}, {{inputs, 10}, 10}],
[{status, normal}, {value, true}, {{outputs, 1}, "something else"}, {{outputs, 5}, null}, {{outputs, 10}, null}]},
{[{hold, false}], [{status, normal}, {value, false}, {{outputs, 1}, 1}, {{outputs, 5}, 5}, {{outputs, 10}, 10}]}
].
-endif.
|
a28eb8dedd600167acdcb323f6f2cc533092fe8c7c4ac59e48beae61e7f5eb01 | well-typed/large-records | R030.hs | {-# LANGUAGE RankNTypes #-}
#if PROFILE_CORESIZE
{-# OPTIONS_GHC -ddump-to-file -ddump-ds-preopt -ddump-ds -ddump-simpl #-}
#endif
#if PROFILE_TIMING
{-# OPTIONS_GHC -ddump-to-file -ddump-timings #-}
#endif
module Experiment.Applicative.Sized.R030 where
import Bench.Types
import Experiment.SimpleRecord.Sized.R030
zipRecordWith ::
Applicative f
=> (forall n. T n -> T n -> f (T n))
-> R -> R -> f R
zipRecordWith f r r' =
pure MkR
1 .. 10
<*> f (field1 r) (field1 r')
<*> f (field2 r) (field2 r')
<*> f (field3 r) (field3 r')
<*> f (field4 r) (field4 r')
<*> f (field5 r) (field5 r')
<*> f (field6 r) (field6 r')
<*> f (field7 r) (field7 r')
<*> f (field8 r) (field8 r')
<*> f (field9 r) (field9 r')
<*> f (field10 r) (field10 r')
11 .. 20
<*> f (field11 r) (field11 r')
<*> f (field12 r) (field12 r')
<*> f (field13 r) (field13 r')
<*> f (field14 r) (field14 r')
<*> f (field15 r) (field15 r')
<*> f (field16 r) (field16 r')
<*> f (field17 r) (field17 r')
<*> f (field18 r) (field18 r')
<*> f (field19 r) (field19 r')
<*> f (field20 r) (field20 r')
21 .. 30
<*> f (field21 r) (field21 r')
<*> f (field22 r) (field22 r')
<*> f (field23 r) (field23 r')
<*> f (field24 r) (field24 r')
<*> f (field25 r) (field25 r')
<*> f (field26 r) (field26 r')
<*> f (field27 r) (field27 r')
<*> f (field28 r) (field28 r')
<*> f (field29 r) (field29 r')
<*> f (field30 r) (field30 r')
| null | https://raw.githubusercontent.com/well-typed/large-records/c6c2b51af11e90f30822543d7ce4d1cb28cee294/large-records-benchmarks/bench/experiments/Experiment/Applicative/Sized/R030.hs | haskell | # LANGUAGE RankNTypes #
# OPTIONS_GHC -ddump-to-file -ddump-ds-preopt -ddump-ds -ddump-simpl #
# OPTIONS_GHC -ddump-to-file -ddump-timings # |
#if PROFILE_CORESIZE
#endif
#if PROFILE_TIMING
#endif
module Experiment.Applicative.Sized.R030 where
import Bench.Types
import Experiment.SimpleRecord.Sized.R030
zipRecordWith ::
Applicative f
=> (forall n. T n -> T n -> f (T n))
-> R -> R -> f R
zipRecordWith f r r' =
pure MkR
1 .. 10
<*> f (field1 r) (field1 r')
<*> f (field2 r) (field2 r')
<*> f (field3 r) (field3 r')
<*> f (field4 r) (field4 r')
<*> f (field5 r) (field5 r')
<*> f (field6 r) (field6 r')
<*> f (field7 r) (field7 r')
<*> f (field8 r) (field8 r')
<*> f (field9 r) (field9 r')
<*> f (field10 r) (field10 r')
11 .. 20
<*> f (field11 r) (field11 r')
<*> f (field12 r) (field12 r')
<*> f (field13 r) (field13 r')
<*> f (field14 r) (field14 r')
<*> f (field15 r) (field15 r')
<*> f (field16 r) (field16 r')
<*> f (field17 r) (field17 r')
<*> f (field18 r) (field18 r')
<*> f (field19 r) (field19 r')
<*> f (field20 r) (field20 r')
21 .. 30
<*> f (field21 r) (field21 r')
<*> f (field22 r) (field22 r')
<*> f (field23 r) (field23 r')
<*> f (field24 r) (field24 r')
<*> f (field25 r) (field25 r')
<*> f (field26 r) (field26 r')
<*> f (field27 r) (field27 r')
<*> f (field28 r) (field28 r')
<*> f (field29 r) (field29 r')
<*> f (field30 r) (field30 r')
|
d4878527f655d0c5a5e46992bee879085c91f5f5057c6fe04723a65530cdd1a1 | cffi/cffi | bindings.lisp | ;;;; -*- Mode: lisp; indent-tabs-mode: nil -*-
;;;
;;; libtest.lisp --- Setup CFFI bindings for libtest.
;;;
Copyright ( C ) 2005 - 2007 , loliveira(@)common - lisp.net >
;;;
;;; Permission is hereby granted, free of charge, to any person
;;; obtaining a copy of this software and associated documentation
files ( the " Software " ) , to deal in the Software without
;;; restriction, including without limitation the rights to use, copy,
;;; modify, merge, publish, distribute, sublicense, and/or sell copies
of the Software , and to permit persons to whom the Software is
;;; furnished to do so, subject to the following conditions:
;;;
;;; The above copyright notice and this permission notice shall be
included in all copies or substantial portions of the Software .
;;;
THE SOFTWARE IS PROVIDED " AS IS " , WITHOUT WARRANTY OF ANY KIND ,
;;; EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
;;; MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
;;; NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
;;; HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
;;; WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
;;; OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
;;; DEALINGS IN THE SOFTWARE.
;;;
(in-package #:cffi-tests)
(define-foreign-library (libtest :type :test)
(:darwin (:or "libtest.dylib" "libtest32.dylib"))
(:unix (:or "libtest.so" "libtest32.so"))
(:windows "libtest.dll")
(t (:default "libtest")))
(define-foreign-library (libtest2 :type :test)
(:darwin (:or "libtest2.dylib" "libtest2_32.dylib"))
(:unix (:or "libtest2.so" "libtest2_32.so"))
(t (:default "libtest2")))
(define-foreign-library (libfsbv :type :test)
(:darwin (:or "libfsbv.dylib" "libfsbv32.dylib"))
(:unix (:or "libfsbv.so" "libfsbv_32.so"))
(:windows "libfsbv.dll")
(t (:default "libfsbv")))
(define-foreign-library libc
(:windows "msvcrt.dll"))
(define-foreign-library libm
#+(and lispworks darwin) ; not sure why the full path is necessary
(:darwin "/usr/lib/libm.dylib")
(t (:default "libm")))
(defmacro deftest (name &rest body)
(destructuring-bind (name &key expected-to-fail)
(alexandria:ensure-list name)
(let ((result `(rtest:deftest ,name ,@body)))
(when expected-to-fail
(setf result `(progn
(when ,expected-to-fail
(pushnew ',name rtest::*expected-failures*))
,result)))
result)))
(defun call-within-new-thread (fn &rest args)
(let (result
error
(cv (bordeaux-threads:make-condition-variable))
(lock (bordeaux-threads:make-lock)))
(bordeaux-threads:with-lock-held (lock)
(bordeaux-threads:make-thread
(lambda ()
(multiple-value-setq (result error)
(ignore-errors (apply fn args)))
(bordeaux-threads:with-lock-held (lock)
(bordeaux-threads:condition-notify cv))))
(bordeaux-threads:condition-wait cv lock)
(values result error))))
As of OSX 10.6.6 , loading CoreFoundation on something other than
;;; the initial thread results in a crash.
(deftest load-core-foundation
(progn
#+bordeaux-threads
(call-within-new-thread 'load-foreign-library
'(:framework "CoreFoundation"))
t)
t)
;;; Return the directory containing the source when compiling or
;;; loading this file. We don't use *LOAD-TRUENAME* because the fasl
;;; file may be in a different directory than the source with certain
;;; ASDF extensions loaded.
(defun load-directory ()
(let ((here #.(or *compile-file-truename* *load-truename*)))
(make-pathname :name nil :type nil :version nil
:defaults here)))
(defun load-test-libraries ()
(let ((*foreign-library-directories* (list (load-directory))))
(load-foreign-library 'libtest)
(load-foreign-library 'libtest2)
(load-foreign-library 'libfsbv)
(load-foreign-library 'libc)
#+(or abcl lispworks) (load-foreign-library 'libm)))
#-(:and :ecl (:not :dffi))
(load-test-libraries)
#+(:and :ecl (:not :dffi))
(ffi:load-foreign-library
#.(make-pathname :name "libtest" :type "so"
:defaults (or *compile-file-truename* *load-truename*)))
;;; check libtest version
(defparameter *required-dll-version* "20120107")
(defcvar "dll_version" :string)
(unless (string= *dll-version* *required-dll-version*)
(error "version check failed: expected ~s but libtest reports ~s"
*required-dll-version*
*dll-version*))
;;; The maximum and minimum values for single and double precision C
;;; floating point values, which may be quite different from the
;;; corresponding Lisp versions.
(defcvar "float_max" :float)
(defcvar "float_min" :float)
(defcvar "double_max" :double)
(defcvar "double_min" :double)
(defun run-cffi-tests (&key (compiled nil))
(let ((regression-test::*compile-tests* compiled)
(*package* (find-package '#:cffi-tests)))
(format t "~&;;; running tests (~Acompiled)" (if compiled "" "un"))
(do-tests)
(set-difference (regression-test:pending-tests)
regression-test::*expected-failures*)))
(defun run-all-cffi-tests ()
(let ((unexpected-failures
(append (run-cffi-tests :compiled nil)
(run-cffi-tests :compiled t))))
(format t "~%~%Overall unexpected failures: ~{~% ~A~}~%" unexpected-failures)
unexpected-failures))
(defmacro expecting-error (&body body)
`(handler-case (progn ,@body :no-error)
(error () :error)))
| null | https://raw.githubusercontent.com/cffi/cffi/384d96bdf83959adf62249e0690acda4b7011ea6/tests/bindings.lisp | lisp | -*- Mode: lisp; indent-tabs-mode: nil -*-
libtest.lisp --- Setup CFFI bindings for libtest.
Permission is hereby granted, free of charge, to any person
obtaining a copy of this software and associated documentation
restriction, including without limitation the rights to use, copy,
modify, merge, publish, distribute, sublicense, and/or sell copies
furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER
DEALINGS IN THE SOFTWARE.
not sure why the full path is necessary
the initial thread results in a crash.
Return the directory containing the source when compiling or
loading this file. We don't use *LOAD-TRUENAME* because the fasl
file may be in a different directory than the source with certain
ASDF extensions loaded.
check libtest version
The maximum and minimum values for single and double precision C
floating point values, which may be quite different from the
corresponding Lisp versions. | Copyright ( C ) 2005 - 2007 , loliveira(@)common - lisp.net >
files ( the " Software " ) , to deal in the Software without
of the Software , and to permit persons to whom the Software is
included in all copies or substantial portions of the Software .
THE SOFTWARE IS PROVIDED " AS IS " , WITHOUT WARRANTY OF ANY KIND ,
(in-package #:cffi-tests)
(define-foreign-library (libtest :type :test)
(:darwin (:or "libtest.dylib" "libtest32.dylib"))
(:unix (:or "libtest.so" "libtest32.so"))
(:windows "libtest.dll")
(t (:default "libtest")))
(define-foreign-library (libtest2 :type :test)
(:darwin (:or "libtest2.dylib" "libtest2_32.dylib"))
(:unix (:or "libtest2.so" "libtest2_32.so"))
(t (:default "libtest2")))
(define-foreign-library (libfsbv :type :test)
(:darwin (:or "libfsbv.dylib" "libfsbv32.dylib"))
(:unix (:or "libfsbv.so" "libfsbv_32.so"))
(:windows "libfsbv.dll")
(t (:default "libfsbv")))
(define-foreign-library libc
(:windows "msvcrt.dll"))
(define-foreign-library libm
(:darwin "/usr/lib/libm.dylib")
(t (:default "libm")))
(defmacro deftest (name &rest body)
(destructuring-bind (name &key expected-to-fail)
(alexandria:ensure-list name)
(let ((result `(rtest:deftest ,name ,@body)))
(when expected-to-fail
(setf result `(progn
(when ,expected-to-fail
(pushnew ',name rtest::*expected-failures*))
,result)))
result)))
(defun call-within-new-thread (fn &rest args)
(let (result
error
(cv (bordeaux-threads:make-condition-variable))
(lock (bordeaux-threads:make-lock)))
(bordeaux-threads:with-lock-held (lock)
(bordeaux-threads:make-thread
(lambda ()
(multiple-value-setq (result error)
(ignore-errors (apply fn args)))
(bordeaux-threads:with-lock-held (lock)
(bordeaux-threads:condition-notify cv))))
(bordeaux-threads:condition-wait cv lock)
(values result error))))
As of OSX 10.6.6 , loading CoreFoundation on something other than
(deftest load-core-foundation
(progn
#+bordeaux-threads
(call-within-new-thread 'load-foreign-library
'(:framework "CoreFoundation"))
t)
t)
(defun load-directory ()
(let ((here #.(or *compile-file-truename* *load-truename*)))
(make-pathname :name nil :type nil :version nil
:defaults here)))
(defun load-test-libraries ()
(let ((*foreign-library-directories* (list (load-directory))))
(load-foreign-library 'libtest)
(load-foreign-library 'libtest2)
(load-foreign-library 'libfsbv)
(load-foreign-library 'libc)
#+(or abcl lispworks) (load-foreign-library 'libm)))
#-(:and :ecl (:not :dffi))
(load-test-libraries)
#+(:and :ecl (:not :dffi))
(ffi:load-foreign-library
#.(make-pathname :name "libtest" :type "so"
:defaults (or *compile-file-truename* *load-truename*)))
(defparameter *required-dll-version* "20120107")
(defcvar "dll_version" :string)
(unless (string= *dll-version* *required-dll-version*)
(error "version check failed: expected ~s but libtest reports ~s"
*required-dll-version*
*dll-version*))
(defcvar "float_max" :float)
(defcvar "float_min" :float)
(defcvar "double_max" :double)
(defcvar "double_min" :double)
(defun run-cffi-tests (&key (compiled nil))
(let ((regression-test::*compile-tests* compiled)
(*package* (find-package '#:cffi-tests)))
(format t "~&;;; running tests (~Acompiled)" (if compiled "" "un"))
(do-tests)
(set-difference (regression-test:pending-tests)
regression-test::*expected-failures*)))
(defun run-all-cffi-tests ()
(let ((unexpected-failures
(append (run-cffi-tests :compiled nil)
(run-cffi-tests :compiled t))))
(format t "~%~%Overall unexpected failures: ~{~% ~A~}~%" unexpected-failures)
unexpected-failures))
(defmacro expecting-error (&body body)
`(handler-case (progn ,@body :no-error)
(error () :error)))
|
838029224f14fd13a07735807e4da68b743d22df4414168653b14d3f5f609ef7 | jrm-code-project/LISP-Machine | storage.lisp | -*- Mode : LISP ; Package : SYSTEM - INTERNALS ; Cold - Load : T ; : CL ; Base:8 -*-
( c ) Copyright 1985 , Lisp Machine Incorporated ( LMI ) .
;;; This is a cold-load file. See also STORAGE-DEFS.
; forwarded to a-mem
(defvar-resettable %inhibit-read-only nil nil
"Bind this to T to do nasty horrible things behind the virtual memory system's back.")
(defvar *area-list* :unbound
"Call (CURRENT-AREA-LIST) for list of active areas.")
(defun %region-free-pointer (region)
(without-interrupts
(compiler::invalidate-cons-caches)
;(%p-contents-offset (%region-origin region-free-pointer) region)
(aref #'region-free-pointer region)
))
(defun set-%region-free-pointer (region value)
(without-interrupts
(compiler::invalidate-cons-caches)
;(%p-store-contents-offset value (%region-origin region-free-pointer) region)
(setf (aref #'region-free-pointer region) value)
))
( defsetf % region - free - pointer set-%region - free - pointer ) -- in storage - defs
;(defun %reset-temporary-area (area &optional inhibit-error)
; "Reclaim all storage associated with AREA. There must not be any references to storage
;in the area. References from unused storage are not permitted. References from active
;stack frames are not permitted. References from internal processor registers are not
;permitted. References from other stack groups, including inactive ones, are not permitted.
;In short, you shouldn't be using this. Use the garbage collector."
; (unless (or inhibit-error (area-temporary? area))
; (multiple-cerror () ()
( " The area ~S ( ~S ) was not created as temporary . " ( area - name area ) area )
; ("Don't reset this area" (return-from %reset-temporary-area nil))
; ("Make area temporary, and the reset it" (make-area-temporary area))))
; (without-interrupts
; ;; We can't just iterate over the region tables here (because %free-region modifies
; ;; them), so we build a list of the regions we want to free, then %free-region them.
; (mapc #'%free-region
; (loop for region = (%area-region-list area) then (%region-list-thread region)
; until (minusp region)
; collect region))))
(defun reset-temporary-area (area &optional inhibit) area inhibit
;; Let's put the fear of God into casual users of this thing.
; (multiple-cerror () ()
; ("RESET-TEMPORARY-AREA is obsolete and dangerous.")
; ("Don't reset this area." ())
( " Reset this area using SI::%RESET - TEMPORARY - AREA . " ( % reset - temporary - area area inhibit ) ) )
(ferror nil "RESET-TEMPORARY-AREA is no longer supported.")
)
(make-obsolete reset-temporary-area "is no longer supported.")
;(defun %reset-region-free-pointer (region new-fp)
; (unless inhibit-scheduling-flag
; (ferror "This function must be called with scheduling inhibited."))
; (let ((old-fp (%region-free-pointer region)))
; (when (< new-fp old-fp)
( setf ( % region - free - pointer region ) new - fp )
; ; Reset the structure - handles in the affected area . On the first page
; ; ( page - number new - fp ) , reset the first - header iff it needs to be lower .
; ;; For the following pages, just indicate no header and no initial qs.
; ;; Careful about the very last page -- if it's in the next region don't
; ;; touch it.
; (when (= old-fp (%region-length region)) (decf old-fp))
; (setq old-fp (%pointer-plus old-fp (%region-origin region)))
; (setq new-fp (%pointer-plus new-fp (%region-origin region)))
; ;; If this function ever needs to be fast, use %BLT here.
; (loop initially
; (when (> (page-first-header (page-number new-fp)) (page-index new-fp))
( setf ( page - first - header ( page - number new - fp ) ) ( page - index new - fp ) ) )
; for page from (1+ (page-number new-fp)) to (page-number old-fp)
do ( setf ( page - first - header page ) # o400 )
do ( setf ( page - initial - qs page ) 0 ) )
; (%gc-scav-reset region))))
;(make-obsolete %reset-region-free-pointer "use garbage collector")
;(defun %free-region (region)
" Removes all trace of REGION from the area , virtual memory , and GC tables . "
; (unless inhibit-scheduling-flag
; (ferror "This function must be called with scheduling inhibited."))
; (let ((area (%region-area region))
( area - region - list - base ( % region - origin sys : area - region - list ) )
( region - list - thread - base ( % region - origin sys : region - list - thread ) ) )
; ; This function needs to be pretty fast , to keep GC : RECLAIM - OLDSPACE from
; ;; consuming too much time without interrupts. Define some magic accessors
; ;; for the relevant region tables. (Note the local variables above.)
( macrolet ( ( % area - region - list ( area )
; `(%p-pointer (+ area-region-list-base ,area)))
; (%region-list-thread (region)
; `(%p-pointer (+ region-list-thread-base ,region))))
; ; If it 's the first region in the area , delete from the start of the thread .
; (if (eq region (%area-region-list area))
( setf ( % area - region - list area ) ( % region - list - thread region ) )
; ;; Otherwise search for the region and snap it out of the thread.
; (loop with this = (%area-region-list area)
; for next = (%region-list-thread this)
; until (eq next region)
; do (setq this next)
finally ( setf ( % region - list - thread this ) ( % region - list - thread next ) ) ) ) )
; (%gc-free-region region)))
(defun %deallocate-end-of-region (region)
"Return unused quantums in region to free pool."
(unless inhibit-scheduling-flag
(ferror "This function must be called with scheduling disabled."))
(let ((quantum-size %address-space-quantum-size)
(origin (%region-origin region))
(length (%region-length region))
(free-pointer (%region-free-pointer region)))
If less than one quantum long , or if there is less than one quantum of free space ,
;; don't do anything. It is illegal to have regions with no quantums.
(unless (or (<= length quantum-size)
(<= (- length free-pointer) quantum-size))
(loop with first-free-quantum = (ceiling free-pointer quantum-size)
with new-length = (* first-free-quantum quantum-size)
with origin-quantum = (truncate (si::%pointer-unsigned origin) quantum-size)
with array = #'address-space-map
initially (setf (%region-length region) new-length)
for quantum from first-free-quantum below (truncate length quantum-size)
do (setf (aref array (+ origin-quantum quantum)) 0)
finally (%deallocate-pages (%pointer-plus origin new-length)
(%pointer-plus origin length))))))
(defun %deallocate-pages (vma-start vma-bound)
"Remove the pages between START and BOUND from the maps and the page-hash-table."
(unless inhibit-scheduling-flag
(ferror "This function must be called with scheduling disabled."))
special variable .
;; Map gets Map Status: read/write unmodified, Map Access: no access.
with bits = #o300
Bit 30 in swap - status argument means disconnect virtual page from page frame .
;; It also makes the page unmodified in the other way, the details of which
I almost understood at one point , but no longer . - oh .
with swap-status = (%logdpb 1 (byte 1 #o30) %pht-swap-status-flushable)
for address = vma-start then (%pointer-plus address page)
until (= address vma-bound)
do (%change-page-status address swap-status bits)))
(defun %invalidate-region-mapping (region)
"Decache all information about REGION from the virtual memory maps."
(loop with page = page-size
with origin = (%region-origin region)
with bound = (%pointer-plus origin (%region-length region))
for address = origin then (%pointer-plus address page)
until (eq address bound)
do (%change-page-status address nil nil)))
(defun %invalidate-area-mapping (area)
"Decache all information about AREA from the virtual memory maps."
(for-every-region-in-area (region area)
(%invalidate-region-mapping region)))
;;; The following functions don't work at all.
(defun %make-region-not-read-only (region)
(let* ((old-region-bits (%region-bits region))
(old-access-status-meta (ldb %%region-map-bits old-region-bits))
(new-access-status-meta (%logdpb %pht-map-status-read-write-first
%%region-map-status-code
(%logdpb 3 %%region-map-access-code old-region-bits)))
(new-region-bits (%logdpb new-access-status-meta
%%region-map-bits
old-region-bits)))
(declare (ignore old-access-status-meta))
(setf (%region-bits region) new-region-bits)
(loop with page = page-size
with origin = (%region-origin region)
with bound = (%pointer-plus origin (%region-length region))
for address = origin then (%pointer-plus address page)
until (eq address bound)
do (%change-page-status address nil new-region-bits))))
(defun %make-region-read-only (region)
(let* ((old-region-bits (%region-bits region))
(old-access-status-meta (ldb %%region-map-bits old-region-bits))
(new-access-status-meta (%logdpb %pht-map-status-read-only
%%region-map-status-code
(%logdpb 2 %%region-map-access-code old-region-bits)))
(new-region-bits (%logdpb new-access-status-meta
%%region-map-bits
old-region-bits)))
(declare (ignore old-access-status-meta))
(setf (%region-bits region) new-region-bits)
(loop with page = page-size
with origin = (%region-origin region)
with bound = (%pointer-plus origin (%region-length region))
for address = origin then (%pointer-plus address page)
until (eq address bound)
do (%change-page-status address nil new-region-bits))))
;;;
(defun current-area-list ()
"Use this instead of the variable AREA-LIST. That can get clobbered if someone
reads in QCOM or something."
(if (not (boundp '*area-list*))
(setq *area-list* (g-l-p (symbol-function 'area-name))))
*area-list*
;(g-l-p (symbol-function 'area-name)) was the old thing. As areas get deallocated,
; can be completely wrong now.
)
(defun allocated-regions ()
(loop for region from 0 below sys:number-of-regions
counting ( (%region-type region) %region-space-free)))
(defun allocated-areas ()
(length (current-area-list)) ;(fill-pointer (symbol-function 'area-name))
)
( defvar area - temporary - flag - array : unbound
" Array index by area number containing 1 if area is temporary , else 0 . " )
(defun area-temporary-p (area) area
"Return T if the specified area is a temporary area."
( not ( zerop ( aref area - temporary - flag - array area ) ) )
nil
)
(defun area-temporary? (area) area
"Return T if the specified area is a temporary area."
( not ( zerop ( aref area - temporary - flag - array area ) ) )
nil
)
;(defun make-area-temporary (area)
; "Mark an area (specified by number) as temporary."
( setf ( aref area - temporary - flag - array area ) 1 ) )
(defvar *room* :unbound
"Areas to mention when ROOM is called with no arguments.")
(forward-value-cell '*room* 'room)
(defun make-area (&key name
(region-size #o40000)
(gc :dynamic)
(read-only ())
(volatility 3 volatilityp)
(room ())
(swap-recommendations 0)
&allow-other-keys)
"Create a new area, or modify an existing one. Returns the area number.
Takes keyword argument pairs as follows:
:NAME - Symbol which provides name of area. This symbol, which must be supplied, is
SET to the area number.
:REGION-SIZE - size for regions, between #o40000 and #o4000000 words.
:GC - :DYNAMIC - garbage-collector treats this area normally (the default);
:STATIC - garbage-collector ignores this area;
:FIXED - garbage-collector ignores this area, which may not be consed in.
:MOBY-CONSABLE - can be consed in. Moby regions are effectively STATIC for gc purposes.
:MOBY-FIXED - already allocated or consable on another machine. Not consable here.
:VOLATILITY - The volatility (number between 0 and 3) of newspace regions in this area.
:READ-ONLY - If T, the area may not be written or consed in.
:ROOM - if specified, push this area onto ROOM, so that (ROOM) will list it.
:SWAP-RECOMMENDATIONS - pages prefetched upon a page fault."
(declare (unspecial room))
; (unless (variable-boundp area-temporary-flag-array)
( setq area - temporary - flag - array ( make - array # o400 : element - type ' bit ) ) )
(check-type name (and symbol (not null)))
(check-type region-size (integer #o40000 #o4000000))
(check-type gc (member :static :dynamic :fixed :moby-consable :moby-fixed))
(check-type volatility (integer 0 3))
(check-type read-only (member t nil))
(check-type swap-recommendations (integer 0 31.))
(and volatilityp (neq gc ':dynamic)
(ferror "~S specified, but ~S is not ~S" :volatility :gc :dynamic))
(let ((bits (%logdpb (case gc
(:static %region-space-static)
;(:temporary %region-space-static)
(:dynamic %region-space-new)
(:fixed %region-space-fixed)
(:moby-consable %region-space-moby-new)
(:moby-fixed %region-space-moby-fixed))
%%region-space-type
;; I think you have to say "no scavenge" for the area so
;; new space regions don't get scavenged. when the microcode
;; allocates a copy region, it automatically turns this on.
;; This is the same behavior as the cold load builder. - Pace 17-Feb-86
(%logdpb (ecase gc
(:static 1)
(: temporary 1 )
(:dynamic 0)
(:fixed 1)
(:moby-consable 1)
(:moby-fixed 1))
%%region-scavenge-enable
(%logdpb swap-recommendations %%region-swapin-quantum
(%logdpb volatility %%region-volatility
(%logdpb 1 %%region-oldspace-meta-bit
(%logdpb 1 %%region-extra-pdl-meta-bit
(%logdpb 2 %%region-representation-type
(%logdpb (if read-only
%pht-map-status-read-only
%pht-map-status-read-write-first)
%%region-map-status-code
(%logdpb (if read-only 2 3)
%%region-map-access-code
0))))))))))
(number))
(without-interrupts
(gc:without-scavenging
(gc:without-flipping
(cond ((memq name (current-area-list))
(setq number (symbol-value name)))
(t
(setq number (aref #'system-communication-area %sys-com-free-area#-list))
(when (= number 0)
(ferror "Out of area numbers, cannot create ~S" name))
(setf (aref #'system-communication-area %sys-com-free-area#-list)
(%area-region-list number))
(setf (%area-region-list number)
(%logdpb 1 %%q-boxed-sign-bit number))
( setf ( array - leader # ' area - name 0 ) number )
;(vector-push name #'area-name)
(setf (aref #'area-name number) name)
(setf (symbol-value name) number)
(do ((p (current-area-list) (cdr p))
(last-p (value-cell-location '*area-list*) p))
((null p)
(rplacd last-p (list name)))
(cond ((not (< (symeval (car p)) number))
(return (rplacd last-p
(cons name (cdr last-p)))))))))
(setf (%area-region-size number) region-size)
(setf (%area-region-bits number) bits)
(when (and room (not (memq name *room*)))
(push name *room*))
; (when (eq gc ':temporary)
; (make-area-temporary number))
number)))))
(defun rename-area (old-area-name new-area-name &aux tem)
"Change the name of an area. This should not be done casually."
(check-type old-area-name (and symbol (not null)))
(check-type new-area-name (and symbol (not null)))
(let ((number (symbol-value old-area-name)))
(without-interrupts
(gc:without-scavenging
(gc:without-flipping
(cond ((null (setq tem (memq old-area-name (current-area-list))))
(ferror "~S is not an active area" old-area-name))
((not (eq old-area-name
(aref #'area-name number)))
(ferror "Area structure for ~s inconsistant" old-area-name)))
(setf (aref #'area-name number) new-area-name)
(rplaca tem new-area-name)
(makunbound old-area-name)
(setf (symbol-value new-area-name) number)
(cond ((setq tem (memq old-area-name *room*))
(rplaca tem new-area-name)))
number)))))
(defun delete-null-areas ()
(dolist (a-n (current-area-list))
(let ((area-number (symbol-value a-n))
(count 0))
(for-every-region-in-area (region area-number)
(incf count))
(if (zerop count)
(delete-area a-n)))))
(defun delete-area (a-n &aux tem)
"Delete an area name. Area must have 0 regions."
(check-type a-n (and symbol (not null)))
(let ((number (symbol-value a-n)))
(cond ((not (eq (%area-region-list number)
(%logdpb 1 %%q-boxed-sign-bit number)))
(ferror "Area to be deleted has regions.")))
(cond ((null (setq tem (memq a-n (current-area-list))))
(ferror "~S is not an active area" a-n))
((not (eq a-n
(aref #'area-name number)))
(ferror "Area structure for ~s inconsistant" a-n)))
(without-interrupts
(gc:without-scavenging
(gc:without-flipping
(setq *area-list* (delq a-n *area-list*))
(setf (%area-region-list number)
(aref #'system-communication-area %sys-com-free-area#-list))
(setf (aref #'system-communication-area %sys-com-free-area#-list)
number)
(setf (aref #'area-name number) nil)
(makunbound a-n)
(setq *room* (delq a-n *room*))
number)))))
;;; Structure-handles initialization. This is called right at the beginning
;;; of SI::QLD.
(defun setup-structure-handles-for-region (region)
(loop with origin = (%region-origin region)
with object = origin
with page = -1
until (= object (%pointer-plus origin (%region-free-pointer region)))
for boxed = (%structure-boxed-size object)
for total = (%structure-total-size object)
when ( (page-number object) page)
do (setf (page-first-header (page-number object)) (page-index object))
for boundary = (+ (page-index object) boxed)
when (> boundary #o400)
do (loop for p from (1+ (page-number object))
do (decf boundary #o400)
until (< boundary #o400)
do (setf (page-first-header p) #o400)
do (setf (page-initial-qs p) #o400)
finally (setf (page-initial-qs p) (page-index boundary)))
do (setq page (page-number object))
do (setq object (%pointer-plus object total))
finally
(when (= (page-first-header (page-number object)) #o400)
(setf (page-first-header (page-number object)) (page-index object)))))
(defun setup-structure-handles-for-area (area)
(for-every-region-in-area (region area)
(initialize-structure-handles-for-region region)
(unless (= (%region-representation-type region) %region-representation-type-unstructured)
(setup-structure-handles-for-region region))))
(defun initialize-structure-handles-for-region (region)
"Define every page in the region to contain #o400 unboxed words."
(loop with origin = (%region-origin region)
with bound = (%pointer-plus origin (%region-length region))
for page from (page-number origin) below (page-number bound)
do (setf (page-first-header page) #o400);No header on this page.
do (setf (page-initial-qs page) 0))) ;No initial Qs on this page.
(defvar *structure-handles-setup* nil)
(defun setup-structure-handles ()
(loop for symbolic-area in (current-area-list)
for area = (symbol-value symbolic-area)
do (setup-structure-handles-for-area area)
finally
(setf (%region-free-pointer virtual-page-data) (%region-length virtual-page-data)))
(setq *structure-handles-setup* t)
(enable-structure-handles-error-checks))
(defun enable-structure-handles-error-checks ()
(if *structure-handles-setup*
(%p-dpb 1 %%m-flags-check-structure-handles (locf si:%mode-flags))))
(add-initialization 'enable-structure-handles-error-checks
'(enable-structure-handles-error-checks)
:system)
;;; This is a moderately critical function for the gc process, and is currently crippled by
the ( aref # ' address - space - map ... ) . This function could be made about 4 times faster by
converting the address space map into a one - word - per - quantum table , which could be scanned
;;; quickly using the sort of address arithmetic used in gc::compute-storage-distribution.
(defun unallocated-space ()
"The amount of space not allocated to any region."
;; LOOP can't (declare (unspecial base))
(let ((base (truncate (%pointer-plus (%region-origin init-list-area)
(%region-length init-list-area))
%address-space-quantum-size))
(bound (truncate virtual-memory-size %address-space-quantum-size)))
(declare (unspecial base))
(* (loop for i from base below bound
count (zerop (aref #'address-space-map i)))
%address-space-quantum-size)))
(defun unused-space ()
"The amount of space allocated to regions but not yet used by them."
(with-quick-region-area-accessors
(loop with bound = sys:number-of-regions
with %%type = sys:%%region-space-type
for region from 0 below bound
when (memq (%logldb %%type (%region-bits region)) '#.(list %region-space-new
%region-space-copy
%region-space-static))
sum (- (%region-length region) (%region-free-pointer region)))))
To be conservative , " free space " , as far as the human or the GC are concerned ,
;;; is the amount of space in unallocated quantums. Unused space in regions may or
;;; may not be usable.
(deff free-space 'unallocated-space)
Crufty name has proliferated .
| null | https://raw.githubusercontent.com/jrm-code-project/LISP-Machine/0a448d27f40761fafabe5775ffc550637be537b2/lambda/sys/storage.lisp | lisp | Package : SYSTEM - INTERNALS ; Cold - Load : T ; : CL ; Base:8 -*-
This is a cold-load file. See also STORAGE-DEFS.
forwarded to a-mem
(%p-contents-offset (%region-origin region-free-pointer) region)
(%p-store-contents-offset value (%region-origin region-free-pointer) region)
(defun %reset-temporary-area (area &optional inhibit-error)
"Reclaim all storage associated with AREA. There must not be any references to storage
in the area. References from unused storage are not permitted. References from active
stack frames are not permitted. References from internal processor registers are not
permitted. References from other stack groups, including inactive ones, are not permitted.
In short, you shouldn't be using this. Use the garbage collector."
(unless (or inhibit-error (area-temporary? area))
(multiple-cerror () ()
("Don't reset this area" (return-from %reset-temporary-area nil))
("Make area temporary, and the reset it" (make-area-temporary area))))
(without-interrupts
;; We can't just iterate over the region tables here (because %free-region modifies
;; them), so we build a list of the regions we want to free, then %free-region them.
(mapc #'%free-region
(loop for region = (%area-region-list area) then (%region-list-thread region)
until (minusp region)
collect region))))
Let's put the fear of God into casual users of this thing.
(multiple-cerror () ()
("RESET-TEMPORARY-AREA is obsolete and dangerous.")
("Don't reset this area." ())
(defun %reset-region-free-pointer (region new-fp)
(unless inhibit-scheduling-flag
(ferror "This function must be called with scheduling inhibited."))
(let ((old-fp (%region-free-pointer region)))
(when (< new-fp old-fp)
; Reset the structure - handles in the affected area . On the first page
; ( page - number new - fp ) , reset the first - header iff it needs to be lower .
;; For the following pages, just indicate no header and no initial qs.
;; Careful about the very last page -- if it's in the next region don't
;; touch it.
(when (= old-fp (%region-length region)) (decf old-fp))
(setq old-fp (%pointer-plus old-fp (%region-origin region)))
(setq new-fp (%pointer-plus new-fp (%region-origin region)))
;; If this function ever needs to be fast, use %BLT here.
(loop initially
(when (> (page-first-header (page-number new-fp)) (page-index new-fp))
for page from (1+ (page-number new-fp)) to (page-number old-fp)
(%gc-scav-reset region))))
(make-obsolete %reset-region-free-pointer "use garbage collector")
(defun %free-region (region)
(unless inhibit-scheduling-flag
(ferror "This function must be called with scheduling inhibited."))
(let ((area (%region-area region))
; This function needs to be pretty fast , to keep GC : RECLAIM - OLDSPACE from
;; consuming too much time without interrupts. Define some magic accessors
;; for the relevant region tables. (Note the local variables above.)
`(%p-pointer (+ area-region-list-base ,area)))
(%region-list-thread (region)
`(%p-pointer (+ region-list-thread-base ,region))))
; If it 's the first region in the area , delete from the start of the thread .
(if (eq region (%area-region-list area))
;; Otherwise search for the region and snap it out of the thread.
(loop with this = (%area-region-list area)
for next = (%region-list-thread this)
until (eq next region)
do (setq this next)
(%gc-free-region region)))
don't do anything. It is illegal to have regions with no quantums.
Map gets Map Status: read/write unmodified, Map Access: no access.
It also makes the page unmodified in the other way, the details of which
The following functions don't work at all.
(g-l-p (symbol-function 'area-name)) was the old thing. As areas get deallocated,
can be completely wrong now.
(fill-pointer (symbol-function 'area-name))
(defun make-area-temporary (area)
"Mark an area (specified by number) as temporary."
(unless (variable-boundp area-temporary-flag-array)
(:temporary %region-space-static)
I think you have to say "no scavenge" for the area so
new space regions don't get scavenged. when the microcode
allocates a copy region, it automatically turns this on.
This is the same behavior as the cold load builder. - Pace 17-Feb-86
(vector-push name #'area-name)
(when (eq gc ':temporary)
(make-area-temporary number))
Structure-handles initialization. This is called right at the beginning
of SI::QLD.
No header on this page.
No initial Qs on this page.
This is a moderately critical function for the gc process, and is currently crippled by
quickly using the sort of address arithmetic used in gc::compute-storage-distribution.
LOOP can't (declare (unspecial base))
is the amount of space in unallocated quantums. Unused space in regions may or
may not be usable. |
( c ) Copyright 1985 , Lisp Machine Incorporated ( LMI ) .
(defvar-resettable %inhibit-read-only nil nil
"Bind this to T to do nasty horrible things behind the virtual memory system's back.")
(defvar *area-list* :unbound
"Call (CURRENT-AREA-LIST) for list of active areas.")
(defun %region-free-pointer (region)
(without-interrupts
(compiler::invalidate-cons-caches)
(aref #'region-free-pointer region)
))
(defun set-%region-free-pointer (region value)
(without-interrupts
(compiler::invalidate-cons-caches)
(setf (aref #'region-free-pointer region) value)
))
( defsetf % region - free - pointer set-%region - free - pointer ) -- in storage - defs
( " The area ~S ( ~S ) was not created as temporary . " ( area - name area ) area )
(defun reset-temporary-area (area &optional inhibit) area inhibit
( " Reset this area using SI::%RESET - TEMPORARY - AREA . " ( % reset - temporary - area area inhibit ) ) )
(ferror nil "RESET-TEMPORARY-AREA is no longer supported.")
)
(make-obsolete reset-temporary-area "is no longer supported.")
( setf ( % region - free - pointer region ) new - fp )
( setf ( page - first - header ( page - number new - fp ) ) ( page - index new - fp ) ) )
do ( setf ( page - first - header page ) # o400 )
do ( setf ( page - initial - qs page ) 0 ) )
" Removes all trace of REGION from the area , virtual memory , and GC tables . "
( area - region - list - base ( % region - origin sys : area - region - list ) )
( region - list - thread - base ( % region - origin sys : region - list - thread ) ) )
( macrolet ( ( % area - region - list ( area )
( setf ( % area - region - list area ) ( % region - list - thread region ) )
finally ( setf ( % region - list - thread this ) ( % region - list - thread next ) ) ) ) )
(defun %deallocate-end-of-region (region)
"Return unused quantums in region to free pool."
(unless inhibit-scheduling-flag
(ferror "This function must be called with scheduling disabled."))
(let ((quantum-size %address-space-quantum-size)
(origin (%region-origin region))
(length (%region-length region))
(free-pointer (%region-free-pointer region)))
If less than one quantum long , or if there is less than one quantum of free space ,
(unless (or (<= length quantum-size)
(<= (- length free-pointer) quantum-size))
(loop with first-free-quantum = (ceiling free-pointer quantum-size)
with new-length = (* first-free-quantum quantum-size)
with origin-quantum = (truncate (si::%pointer-unsigned origin) quantum-size)
with array = #'address-space-map
initially (setf (%region-length region) new-length)
for quantum from first-free-quantum below (truncate length quantum-size)
do (setf (aref array (+ origin-quantum quantum)) 0)
finally (%deallocate-pages (%pointer-plus origin new-length)
(%pointer-plus origin length))))))
(defun %deallocate-pages (vma-start vma-bound)
"Remove the pages between START and BOUND from the maps and the page-hash-table."
(unless inhibit-scheduling-flag
(ferror "This function must be called with scheduling disabled."))
special variable .
with bits = #o300
Bit 30 in swap - status argument means disconnect virtual page from page frame .
I almost understood at one point , but no longer . - oh .
with swap-status = (%logdpb 1 (byte 1 #o30) %pht-swap-status-flushable)
for address = vma-start then (%pointer-plus address page)
until (= address vma-bound)
do (%change-page-status address swap-status bits)))
(defun %invalidate-region-mapping (region)
"Decache all information about REGION from the virtual memory maps."
(loop with page = page-size
with origin = (%region-origin region)
with bound = (%pointer-plus origin (%region-length region))
for address = origin then (%pointer-plus address page)
until (eq address bound)
do (%change-page-status address nil nil)))
(defun %invalidate-area-mapping (area)
"Decache all information about AREA from the virtual memory maps."
(for-every-region-in-area (region area)
(%invalidate-region-mapping region)))
(defun %make-region-not-read-only (region)
(let* ((old-region-bits (%region-bits region))
(old-access-status-meta (ldb %%region-map-bits old-region-bits))
(new-access-status-meta (%logdpb %pht-map-status-read-write-first
%%region-map-status-code
(%logdpb 3 %%region-map-access-code old-region-bits)))
(new-region-bits (%logdpb new-access-status-meta
%%region-map-bits
old-region-bits)))
(declare (ignore old-access-status-meta))
(setf (%region-bits region) new-region-bits)
(loop with page = page-size
with origin = (%region-origin region)
with bound = (%pointer-plus origin (%region-length region))
for address = origin then (%pointer-plus address page)
until (eq address bound)
do (%change-page-status address nil new-region-bits))))
(defun %make-region-read-only (region)
(let* ((old-region-bits (%region-bits region))
(old-access-status-meta (ldb %%region-map-bits old-region-bits))
(new-access-status-meta (%logdpb %pht-map-status-read-only
%%region-map-status-code
(%logdpb 2 %%region-map-access-code old-region-bits)))
(new-region-bits (%logdpb new-access-status-meta
%%region-map-bits
old-region-bits)))
(declare (ignore old-access-status-meta))
(setf (%region-bits region) new-region-bits)
(loop with page = page-size
with origin = (%region-origin region)
with bound = (%pointer-plus origin (%region-length region))
for address = origin then (%pointer-plus address page)
until (eq address bound)
do (%change-page-status address nil new-region-bits))))
(defun current-area-list ()
"Use this instead of the variable AREA-LIST. That can get clobbered if someone
reads in QCOM or something."
(if (not (boundp '*area-list*))
(setq *area-list* (g-l-p (symbol-function 'area-name))))
*area-list*
)
(defun allocated-regions ()
(loop for region from 0 below sys:number-of-regions
counting ( (%region-type region) %region-space-free)))
(defun allocated-areas ()
)
( defvar area - temporary - flag - array : unbound
" Array index by area number containing 1 if area is temporary , else 0 . " )
(defun area-temporary-p (area) area
"Return T if the specified area is a temporary area."
( not ( zerop ( aref area - temporary - flag - array area ) ) )
nil
)
(defun area-temporary? (area) area
"Return T if the specified area is a temporary area."
( not ( zerop ( aref area - temporary - flag - array area ) ) )
nil
)
( setf ( aref area - temporary - flag - array area ) 1 ) )
(defvar *room* :unbound
"Areas to mention when ROOM is called with no arguments.")
(forward-value-cell '*room* 'room)
(defun make-area (&key name
(region-size #o40000)
(gc :dynamic)
(read-only ())
(volatility 3 volatilityp)
(room ())
(swap-recommendations 0)
&allow-other-keys)
"Create a new area, or modify an existing one. Returns the area number.
Takes keyword argument pairs as follows:
:NAME - Symbol which provides name of area. This symbol, which must be supplied, is
SET to the area number.
:REGION-SIZE - size for regions, between #o40000 and #o4000000 words.
:FIXED - garbage-collector ignores this area, which may not be consed in.
:MOBY-CONSABLE - can be consed in. Moby regions are effectively STATIC for gc purposes.
:MOBY-FIXED - already allocated or consable on another machine. Not consable here.
:VOLATILITY - The volatility (number between 0 and 3) of newspace regions in this area.
:READ-ONLY - If T, the area may not be written or consed in.
:ROOM - if specified, push this area onto ROOM, so that (ROOM) will list it.
:SWAP-RECOMMENDATIONS - pages prefetched upon a page fault."
(declare (unspecial room))
( setq area - temporary - flag - array ( make - array # o400 : element - type ' bit ) ) )
(check-type name (and symbol (not null)))
(check-type region-size (integer #o40000 #o4000000))
(check-type gc (member :static :dynamic :fixed :moby-consable :moby-fixed))
(check-type volatility (integer 0 3))
(check-type read-only (member t nil))
(check-type swap-recommendations (integer 0 31.))
(and volatilityp (neq gc ':dynamic)
(ferror "~S specified, but ~S is not ~S" :volatility :gc :dynamic))
(let ((bits (%logdpb (case gc
(:static %region-space-static)
(:dynamic %region-space-new)
(:fixed %region-space-fixed)
(:moby-consable %region-space-moby-new)
(:moby-fixed %region-space-moby-fixed))
%%region-space-type
(%logdpb (ecase gc
(:static 1)
(: temporary 1 )
(:dynamic 0)
(:fixed 1)
(:moby-consable 1)
(:moby-fixed 1))
%%region-scavenge-enable
(%logdpb swap-recommendations %%region-swapin-quantum
(%logdpb volatility %%region-volatility
(%logdpb 1 %%region-oldspace-meta-bit
(%logdpb 1 %%region-extra-pdl-meta-bit
(%logdpb 2 %%region-representation-type
(%logdpb (if read-only
%pht-map-status-read-only
%pht-map-status-read-write-first)
%%region-map-status-code
(%logdpb (if read-only 2 3)
%%region-map-access-code
0))))))))))
(number))
(without-interrupts
(gc:without-scavenging
(gc:without-flipping
(cond ((memq name (current-area-list))
(setq number (symbol-value name)))
(t
(setq number (aref #'system-communication-area %sys-com-free-area#-list))
(when (= number 0)
(ferror "Out of area numbers, cannot create ~S" name))
(setf (aref #'system-communication-area %sys-com-free-area#-list)
(%area-region-list number))
(setf (%area-region-list number)
(%logdpb 1 %%q-boxed-sign-bit number))
( setf ( array - leader # ' area - name 0 ) number )
(setf (aref #'area-name number) name)
(setf (symbol-value name) number)
(do ((p (current-area-list) (cdr p))
(last-p (value-cell-location '*area-list*) p))
((null p)
(rplacd last-p (list name)))
(cond ((not (< (symeval (car p)) number))
(return (rplacd last-p
(cons name (cdr last-p)))))))))
(setf (%area-region-size number) region-size)
(setf (%area-region-bits number) bits)
(when (and room (not (memq name *room*)))
(push name *room*))
number)))))
(defun rename-area (old-area-name new-area-name &aux tem)
"Change the name of an area. This should not be done casually."
(check-type old-area-name (and symbol (not null)))
(check-type new-area-name (and symbol (not null)))
(let ((number (symbol-value old-area-name)))
(without-interrupts
(gc:without-scavenging
(gc:without-flipping
(cond ((null (setq tem (memq old-area-name (current-area-list))))
(ferror "~S is not an active area" old-area-name))
((not (eq old-area-name
(aref #'area-name number)))
(ferror "Area structure for ~s inconsistant" old-area-name)))
(setf (aref #'area-name number) new-area-name)
(rplaca tem new-area-name)
(makunbound old-area-name)
(setf (symbol-value new-area-name) number)
(cond ((setq tem (memq old-area-name *room*))
(rplaca tem new-area-name)))
number)))))
(defun delete-null-areas ()
(dolist (a-n (current-area-list))
(let ((area-number (symbol-value a-n))
(count 0))
(for-every-region-in-area (region area-number)
(incf count))
(if (zerop count)
(delete-area a-n)))))
(defun delete-area (a-n &aux tem)
"Delete an area name. Area must have 0 regions."
(check-type a-n (and symbol (not null)))
(let ((number (symbol-value a-n)))
(cond ((not (eq (%area-region-list number)
(%logdpb 1 %%q-boxed-sign-bit number)))
(ferror "Area to be deleted has regions.")))
(cond ((null (setq tem (memq a-n (current-area-list))))
(ferror "~S is not an active area" a-n))
((not (eq a-n
(aref #'area-name number)))
(ferror "Area structure for ~s inconsistant" a-n)))
(without-interrupts
(gc:without-scavenging
(gc:without-flipping
(setq *area-list* (delq a-n *area-list*))
(setf (%area-region-list number)
(aref #'system-communication-area %sys-com-free-area#-list))
(setf (aref #'system-communication-area %sys-com-free-area#-list)
number)
(setf (aref #'area-name number) nil)
(makunbound a-n)
(setq *room* (delq a-n *room*))
number)))))
(defun setup-structure-handles-for-region (region)
(loop with origin = (%region-origin region)
with object = origin
with page = -1
until (= object (%pointer-plus origin (%region-free-pointer region)))
for boxed = (%structure-boxed-size object)
for total = (%structure-total-size object)
when ( (page-number object) page)
do (setf (page-first-header (page-number object)) (page-index object))
for boundary = (+ (page-index object) boxed)
when (> boundary #o400)
do (loop for p from (1+ (page-number object))
do (decf boundary #o400)
until (< boundary #o400)
do (setf (page-first-header p) #o400)
do (setf (page-initial-qs p) #o400)
finally (setf (page-initial-qs p) (page-index boundary)))
do (setq page (page-number object))
do (setq object (%pointer-plus object total))
finally
(when (= (page-first-header (page-number object)) #o400)
(setf (page-first-header (page-number object)) (page-index object)))))
(defun setup-structure-handles-for-area (area)
(for-every-region-in-area (region area)
(initialize-structure-handles-for-region region)
(unless (= (%region-representation-type region) %region-representation-type-unstructured)
(setup-structure-handles-for-region region))))
(defun initialize-structure-handles-for-region (region)
"Define every page in the region to contain #o400 unboxed words."
(loop with origin = (%region-origin region)
with bound = (%pointer-plus origin (%region-length region))
for page from (page-number origin) below (page-number bound)
(defvar *structure-handles-setup* nil)
(defun setup-structure-handles ()
(loop for symbolic-area in (current-area-list)
for area = (symbol-value symbolic-area)
do (setup-structure-handles-for-area area)
finally
(setf (%region-free-pointer virtual-page-data) (%region-length virtual-page-data)))
(setq *structure-handles-setup* t)
(enable-structure-handles-error-checks))
(defun enable-structure-handles-error-checks ()
(if *structure-handles-setup*
(%p-dpb 1 %%m-flags-check-structure-handles (locf si:%mode-flags))))
(add-initialization 'enable-structure-handles-error-checks
'(enable-structure-handles-error-checks)
:system)
the ( aref # ' address - space - map ... ) . This function could be made about 4 times faster by
converting the address space map into a one - word - per - quantum table , which could be scanned
(defun unallocated-space ()
"The amount of space not allocated to any region."
(let ((base (truncate (%pointer-plus (%region-origin init-list-area)
(%region-length init-list-area))
%address-space-quantum-size))
(bound (truncate virtual-memory-size %address-space-quantum-size)))
(declare (unspecial base))
(* (loop for i from base below bound
count (zerop (aref #'address-space-map i)))
%address-space-quantum-size)))
(defun unused-space ()
"The amount of space allocated to regions but not yet used by them."
(with-quick-region-area-accessors
(loop with bound = sys:number-of-regions
with %%type = sys:%%region-space-type
for region from 0 below bound
when (memq (%logldb %%type (%region-bits region)) '#.(list %region-space-new
%region-space-copy
%region-space-static))
sum (- (%region-length region) (%region-free-pointer region)))))
To be conservative , " free space " , as far as the human or the GC are concerned ,
(deff free-space 'unallocated-space)
Crufty name has proliferated .
|
66bb0ed077a54d6792776d7afa836b5372d4d6e5af927f97db44b9be20cca183 | flipstone/orville | RowValues.hs | # LANGUAGE GeneralizedNewtypeDeriving #
|
Module : Orville . PostgreSQL.Internal . Expr . Insert . RowValues
Copyright : Flipstone Technology Partners 2016 - 2021
License : MIT
Module : Orville.PostgreSQL.Internal.Expr.Insert.RowValues
Copyright : Flipstone Technology Partners 2016-2021
License : MIT
-}
module Orville.PostgreSQL.Internal.Expr.Insert.RowValues
( RowValues,
rowValues,
)
where
import qualified Orville.PostgreSQL.Internal.RawSql as RawSql
import Orville.PostgreSQL.Internal.SqlValue (SqlValue)
newtype RowValues
= RowValues RawSql.RawSql
deriving (RawSql.SqlExpression)
rowValues :: [SqlValue] -> RowValues
rowValues values =
RowValues $
mconcat
[ RawSql.leftParen
, RawSql.intercalate RawSql.comma (fmap RawSql.parameter values)
, RawSql.rightParen
]
| null | https://raw.githubusercontent.com/flipstone/orville/d68cc4a85bf84269e4883d232cf7bf91a626662b/orville-postgresql-libpq/src/Orville/PostgreSQL/Internal/Expr/Insert/RowValues.hs | haskell | # LANGUAGE GeneralizedNewtypeDeriving #
|
Module : Orville . PostgreSQL.Internal . Expr . Insert . RowValues
Copyright : Flipstone Technology Partners 2016 - 2021
License : MIT
Module : Orville.PostgreSQL.Internal.Expr.Insert.RowValues
Copyright : Flipstone Technology Partners 2016-2021
License : MIT
-}
module Orville.PostgreSQL.Internal.Expr.Insert.RowValues
( RowValues,
rowValues,
)
where
import qualified Orville.PostgreSQL.Internal.RawSql as RawSql
import Orville.PostgreSQL.Internal.SqlValue (SqlValue)
newtype RowValues
= RowValues RawSql.RawSql
deriving (RawSql.SqlExpression)
rowValues :: [SqlValue] -> RowValues
rowValues values =
RowValues $
mconcat
[ RawSql.leftParen
, RawSql.intercalate RawSql.comma (fmap RawSql.parameter values)
, RawSql.rightParen
]
| |
092dffca0b50acea69076c92a55c540584f975496a421c3e33e63f55d4f05bac | static-analysis-engineering/codehawk | bCHStructTables.mli | = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = =
CodeHawk Binary Analyzer
Author : ------------------------------------------------------------------------------
The MIT License ( MIT )
Copyright ( c ) 2022 Aarno Labs LLC
Permission is hereby granted , free of charge , to any person obtaining a copy
of this software and associated documentation files ( the " Software " ) , to deal
in the Software without restriction , including without limitation the rights
to use , copy , modify , merge , publish , distribute , sublicense , and/or sell
copies of the Software , and to permit persons to whom the Software is
furnished to do so , subject to the following conditions :
The above copyright notice and this permission notice shall be included in all
copies or substantial portions of the Software .
THE SOFTWARE IS PROVIDED " AS IS " , WITHOUT WARRANTY OF ANY KIND , EXPRESS OR
, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY ,
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT . IN NO EVENT SHALL THE
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM , DAMAGES OR OTHER
LIABILITY , WHETHER IN AN ACTION OF CONTRACT , TORT OR OTHERWISE , ARISING FROM ,
OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
SOFTWARE .
= = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = =
CodeHawk Binary Analyzer
Author: Henny Sipma
------------------------------------------------------------------------------
The MIT License (MIT)
Copyright (c) 2022 Aarno Labs LLC
Permission is hereby granted, free of charge, to any person obtaining a copy
of this software and associated documentation files (the "Software"), to deal
in the Software without restriction, including without limitation the rights
to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
copies of the Software, and to permit persons to whom the Software is
furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in all
copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
SOFTWARE.
============================================================================= *)
(* bchlib *)
open BCHLibTypes
val structtables: struct_tables_int
| null | https://raw.githubusercontent.com/static-analysis-engineering/codehawk/f3ca3a16d7f42e4e08ca3efe6dc66810548408c6/CodeHawk/CHB/bchlib/bCHStructTables.mli | ocaml | bchlib | = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = =
CodeHawk Binary Analyzer
Author : ------------------------------------------------------------------------------
The MIT License ( MIT )
Copyright ( c ) 2022 Aarno Labs LLC
Permission is hereby granted , free of charge , to any person obtaining a copy
of this software and associated documentation files ( the " Software " ) , to deal
in the Software without restriction , including without limitation the rights
to use , copy , modify , merge , publish , distribute , sublicense , and/or sell
copies of the Software , and to permit persons to whom the Software is
furnished to do so , subject to the following conditions :
The above copyright notice and this permission notice shall be included in all
copies or substantial portions of the Software .
THE SOFTWARE IS PROVIDED " AS IS " , WITHOUT WARRANTY OF ANY KIND , EXPRESS OR
, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY ,
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT . IN NO EVENT SHALL THE
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM , DAMAGES OR OTHER
LIABILITY , WHETHER IN AN ACTION OF CONTRACT , TORT OR OTHERWISE , ARISING FROM ,
OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
SOFTWARE .
= = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = =
CodeHawk Binary Analyzer
Author: Henny Sipma
------------------------------------------------------------------------------
The MIT License (MIT)
Copyright (c) 2022 Aarno Labs LLC
Permission is hereby granted, free of charge, to any person obtaining a copy
of this software and associated documentation files (the "Software"), to deal
in the Software without restriction, including without limitation the rights
to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
copies of the Software, and to permit persons to whom the Software is
furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in all
copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
SOFTWARE.
============================================================================= *)
open BCHLibTypes
val structtables: struct_tables_int
|
7ce2771bfbeef4ef8994d18ce53233b345fa05e9c82036798432792138559754 | rtoal/ple | another_mystery.hs | mystery (x, y) z =
(y / 2.0, z, [x, x, x])
| null | https://raw.githubusercontent.com/rtoal/ple/b24cab4de2beca6970833a09d05af6ef96ec3921/haskell/another_mystery.hs | haskell | mystery (x, y) z =
(y / 2.0, z, [x, x, x])
| |
4ce7da949ed1f4f7d67524c863bba37b67f247c2a3e82ef9fd5166cc17a81015 | aelve/guide | Error.hs | # LANGUAGE FlexibleInstances #
module Guide.Api.Error
(
ErrorResponse,
)
where
import Imports
import Data.Swagger
import GHC.TypeLits
import Servant
import Servant.Swagger
Taken from -servant/servant-swagger/issues/59
data ErrorResponse (code :: Nat) (description :: Symbol)
instance
( HasSwagger api
, KnownNat code
, KnownSymbol desc )
=> HasSwagger (ErrorResponse code desc :> api) where
toSwagger _ = toSwagger (Proxy :: Proxy api)
& setResponse (fromInteger code) (return responseSchema)
where
code = natVal (Proxy :: Proxy code)
desc = symbolVal (Proxy :: Proxy desc)
responseSchema = mempty
& description .~ toText desc
instance HasLink sub => HasLink (ErrorResponse code desc :> sub) where
type MkLink (ErrorResponse code desc :> sub) a = MkLink sub a
toLink f _ l = toLink f (Proxy :: Proxy sub) l
instance HasServer api ctx => HasServer (ErrorResponse code desc :> api) ctx where
type ServerT (ErrorResponse code desc :> api) m = ServerT api m
route _ = route (Proxy :: Proxy api)
hoistServerWithContext _ pc nt s = hoistServerWithContext (Proxy :: Proxy api) pc nt s
| null | https://raw.githubusercontent.com/aelve/guide/96a338d61976344d2405a16b11567e5464820a9e/back/src/Guide/Api/Error.hs | haskell | # LANGUAGE FlexibleInstances #
module Guide.Api.Error
(
ErrorResponse,
)
where
import Imports
import Data.Swagger
import GHC.TypeLits
import Servant
import Servant.Swagger
Taken from -servant/servant-swagger/issues/59
data ErrorResponse (code :: Nat) (description :: Symbol)
instance
( HasSwagger api
, KnownNat code
, KnownSymbol desc )
=> HasSwagger (ErrorResponse code desc :> api) where
toSwagger _ = toSwagger (Proxy :: Proxy api)
& setResponse (fromInteger code) (return responseSchema)
where
code = natVal (Proxy :: Proxy code)
desc = symbolVal (Proxy :: Proxy desc)
responseSchema = mempty
& description .~ toText desc
instance HasLink sub => HasLink (ErrorResponse code desc :> sub) where
type MkLink (ErrorResponse code desc :> sub) a = MkLink sub a
toLink f _ l = toLink f (Proxy :: Proxy sub) l
instance HasServer api ctx => HasServer (ErrorResponse code desc :> api) ctx where
type ServerT (ErrorResponse code desc :> api) m = ServerT api m
route _ = route (Proxy :: Proxy api)
hoistServerWithContext _ pc nt s = hoistServerWithContext (Proxy :: Proxy api) pc nt s
| |
2863e19688c7e255ace8375247765ea0515568e1662c3bf7525a5a51b1d750d0 | kowainik/membrain | Constructors.hs | |
Copyright : ( c ) 2018 - 2020 Kowainik
SPDX - License - Identifier : MPL-2.0
Maintainer : < >
This module implements smart constructors for creating values of type
' Memory ' .
Copyright: (c) 2018-2020 Kowainik
SPDX-License-Identifier: MPL-2.0
Maintainer: Kowainik <>
This module implements smart constructors for creating values of type
'Memory'.
-}
module Membrain.Constructors
( -- * Smart constructors
bit
, nibble
, byte
, kilobyte
, megabyte
, gigabyte
, terabyte
, petabyte
, exabyte
, zettabyte
, yottabyte
, kibibyte
, mebibyte
, gibibyte
, tebibyte
, pebibyte
, exbibyte
, zebibyte
, yobibyte
) where
import GHC.Natural (Natural)
import Membrain.Memory (Memory (..), memory)
import Membrain.Units (Bit, Byte, Exabyte, Exbibyte, Gibibyte, Gigabyte, Kibibyte, Kilobyte,
Mebibyte, Megabyte, Nibble, Pebibyte, Petabyte, Tebibyte, Terabyte, Yobibyte,
Yottabyte, Zebibyte, Zettabyte)
$ setup
> > > import
>>> import Membrain
-}
| Creates ' Memory ' in ' Bit 's from given ' Natural ' as the number of bits .
> > > showMemory $ bit 42
" 42b "
>>> showMemory $ bit 42
"42b"
-}
bit :: Natural -> Memory Bit
bit = Memory
# INLINE bit #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of nibbles .
> > > showMemory $ nibble 42
" 42n "
>>> showMemory $ nibble 42
"42n"
-}
nibble :: Natural -> Memory Nibble
nibble = memory
# INLINE nibble #
| Creates ' Memory ' in ' Byte 's from given ' Natural ' as the number of bytes .
> > > showMemory $ byte 42
" 42B "
>>> showMemory $ byte 42
"42B"
-}
byte :: Natural -> Memory Byte
byte = memory
# INLINE byte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of kilobytes .
> > > showMemory $ kilobyte 42
" 42kB "
>>> showMemory $ kilobyte 42
"42kB"
-}
kilobyte :: Natural -> Memory Kilobyte
kilobyte = memory
# INLINE kilobyte #
| Creates ' Memory ' in ' Megabyte 's from given ' Natural ' as the number of megabytes .
> > > showMemory $ megabyte 42
" 42 MB "
>>> showMemory $ megabyte 42
"42MB"
-}
megabyte :: Natural -> Memory Megabyte
megabyte = memory
# INLINE megabyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of gigabytes .
> > > showMemory $ gigabyte 42
" 42 GB "
>>> showMemory $ gigabyte 42
"42GB"
-}
gigabyte :: Natural -> Memory Gigabyte
gigabyte = memory
# INLINE gigabyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of terabytes .
> > > showMemory $ terabyte 42
" 42 TB "
>>> showMemory $ terabyte 42
"42TB"
-}
terabyte :: Natural -> Memory Terabyte
terabyte = memory
# INLINE terabyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of petabytes .
> > > showMemory $ petabyte 42
" 42PB "
>>> showMemory $ petabyte 42
"42PB"
-}
petabyte :: Natural -> Memory Petabyte
petabyte = memory
# INLINE petabyte #
| Creates ' Memory ' in ' Exabyte 's from given ' Natural ' as the number of exabytes .
> > > showMemory $ exabyte 42
" 42EB "
>>> showMemory $ exabyte 42
"42EB"
-}
exabyte :: Natural -> Memory Exabyte
exabyte = memory
# INLINE exabyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of zettabytes .
> > > showMemory $ zettabyte 42
" 42ZB "
>>> showMemory $ zettabyte 42
"42ZB"
-}
zettabyte :: Natural -> Memory Zettabyte
zettabyte = memory
# INLINE zettabyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of yottabytes .
> > > showMemory $ yottabyte 42
" 42YB "
>>> showMemory $ yottabyte 42
"42YB"
-}
yottabyte :: Natural -> Memory Yottabyte
yottabyte = memory
# INLINE yottabyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of kibibytes .
> > > showMemory $ kibibyte 42
" 42KiB "
>>> showMemory $ kibibyte 42
"42KiB"
-}
kibibyte :: Natural -> Memory Kibibyte
kibibyte = memory
# INLINE kibibyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of mebibytes .
> > > showMemory $ mebibyte 42
" 42MiB "
>>> showMemory $ mebibyte 42
"42MiB"
-}
mebibyte :: Natural -> Memory Mebibyte
mebibyte = memory
# INLINE mebibyte #
| Creates ' Memory ' in ' Gibibyte 's from given ' Natural ' as the number of gibibytes .
> > > showMemory $ gibibyte 42
" 42GiB "
>>> showMemory $ gibibyte 42
"42GiB"
-}
gibibyte :: Natural -> Memory Gibibyte
gibibyte = memory
# INLINE gibibyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of tebibytes .
> > > showMemory $ tebibyte 42
" 42TiB "
>>> showMemory $ tebibyte 42
"42TiB"
-}
tebibyte :: Natural -> Memory Tebibyte
tebibyte = memory
# INLINE tebibyte #
| Creates ' Memory ' in ' Pebibyte 's from given ' Natural ' as the number of pebibytes .
> > > showMemory $ pebibyte 42
" 42PiB "
>>> showMemory $ pebibyte 42
"42PiB"
-}
pebibyte :: Natural -> Memory Pebibyte
pebibyte = memory
# INLINE pebibyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of exbibytes .
> > > showMemory $ exbibyte 42
" 42EiB "
>>> showMemory $ exbibyte 42
"42EiB"
-}
exbibyte :: Natural -> Memory Exbibyte
exbibyte = memory
# INLINE exbibyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of zebibytes .
> > > showMemory $ zebibyte 42
" 42ZiB "
>>> showMemory $ zebibyte 42
"42ZiB"
-}
zebibyte :: Natural -> Memory Zebibyte
zebibyte = memory
# INLINE zebibyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of yobibytes .
> > > showMemory $ yobibyte 42
" 42YiB "
>>> showMemory $ yobibyte 42
"42YiB"
-}
yobibyte :: Natural -> Memory Yobibyte
yobibyte = memory
# INLINE yobibyte #
| null | https://raw.githubusercontent.com/kowainik/membrain/c7c3e9ad9b56fbe48677a7a7f5b2e2146cbd8bb1/src/Membrain/Constructors.hs | haskell | * Smart constructors | |
Copyright : ( c ) 2018 - 2020 Kowainik
SPDX - License - Identifier : MPL-2.0
Maintainer : < >
This module implements smart constructors for creating values of type
' Memory ' .
Copyright: (c) 2018-2020 Kowainik
SPDX-License-Identifier: MPL-2.0
Maintainer: Kowainik <>
This module implements smart constructors for creating values of type
'Memory'.
-}
module Membrain.Constructors
bit
, nibble
, byte
, kilobyte
, megabyte
, gigabyte
, terabyte
, petabyte
, exabyte
, zettabyte
, yottabyte
, kibibyte
, mebibyte
, gibibyte
, tebibyte
, pebibyte
, exbibyte
, zebibyte
, yobibyte
) where
import GHC.Natural (Natural)
import Membrain.Memory (Memory (..), memory)
import Membrain.Units (Bit, Byte, Exabyte, Exbibyte, Gibibyte, Gigabyte, Kibibyte, Kilobyte,
Mebibyte, Megabyte, Nibble, Pebibyte, Petabyte, Tebibyte, Terabyte, Yobibyte,
Yottabyte, Zebibyte, Zettabyte)
$ setup
> > > import
>>> import Membrain
-}
| Creates ' Memory ' in ' Bit 's from given ' Natural ' as the number of bits .
> > > showMemory $ bit 42
" 42b "
>>> showMemory $ bit 42
"42b"
-}
bit :: Natural -> Memory Bit
bit = Memory
# INLINE bit #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of nibbles .
> > > showMemory $ nibble 42
" 42n "
>>> showMemory $ nibble 42
"42n"
-}
nibble :: Natural -> Memory Nibble
nibble = memory
# INLINE nibble #
| Creates ' Memory ' in ' Byte 's from given ' Natural ' as the number of bytes .
> > > showMemory $ byte 42
" 42B "
>>> showMemory $ byte 42
"42B"
-}
byte :: Natural -> Memory Byte
byte = memory
# INLINE byte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of kilobytes .
> > > showMemory $ kilobyte 42
" 42kB "
>>> showMemory $ kilobyte 42
"42kB"
-}
kilobyte :: Natural -> Memory Kilobyte
kilobyte = memory
# INLINE kilobyte #
| Creates ' Memory ' in ' Megabyte 's from given ' Natural ' as the number of megabytes .
> > > showMemory $ megabyte 42
" 42 MB "
>>> showMemory $ megabyte 42
"42MB"
-}
megabyte :: Natural -> Memory Megabyte
megabyte = memory
# INLINE megabyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of gigabytes .
> > > showMemory $ gigabyte 42
" 42 GB "
>>> showMemory $ gigabyte 42
"42GB"
-}
gigabyte :: Natural -> Memory Gigabyte
gigabyte = memory
# INLINE gigabyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of terabytes .
> > > showMemory $ terabyte 42
" 42 TB "
>>> showMemory $ terabyte 42
"42TB"
-}
terabyte :: Natural -> Memory Terabyte
terabyte = memory
# INLINE terabyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of petabytes .
> > > showMemory $ petabyte 42
" 42PB "
>>> showMemory $ petabyte 42
"42PB"
-}
petabyte :: Natural -> Memory Petabyte
petabyte = memory
# INLINE petabyte #
| Creates ' Memory ' in ' Exabyte 's from given ' Natural ' as the number of exabytes .
> > > showMemory $ exabyte 42
" 42EB "
>>> showMemory $ exabyte 42
"42EB"
-}
exabyte :: Natural -> Memory Exabyte
exabyte = memory
# INLINE exabyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of zettabytes .
> > > showMemory $ zettabyte 42
" 42ZB "
>>> showMemory $ zettabyte 42
"42ZB"
-}
zettabyte :: Natural -> Memory Zettabyte
zettabyte = memory
# INLINE zettabyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of yottabytes .
> > > showMemory $ yottabyte 42
" 42YB "
>>> showMemory $ yottabyte 42
"42YB"
-}
yottabyte :: Natural -> Memory Yottabyte
yottabyte = memory
# INLINE yottabyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of kibibytes .
> > > showMemory $ kibibyte 42
" 42KiB "
>>> showMemory $ kibibyte 42
"42KiB"
-}
kibibyte :: Natural -> Memory Kibibyte
kibibyte = memory
# INLINE kibibyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of mebibytes .
> > > showMemory $ mebibyte 42
" 42MiB "
>>> showMemory $ mebibyte 42
"42MiB"
-}
mebibyte :: Natural -> Memory Mebibyte
mebibyte = memory
# INLINE mebibyte #
| Creates ' Memory ' in ' Gibibyte 's from given ' Natural ' as the number of gibibytes .
> > > showMemory $ gibibyte 42
" 42GiB "
>>> showMemory $ gibibyte 42
"42GiB"
-}
gibibyte :: Natural -> Memory Gibibyte
gibibyte = memory
# INLINE gibibyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of tebibytes .
> > > showMemory $ tebibyte 42
" 42TiB "
>>> showMemory $ tebibyte 42
"42TiB"
-}
tebibyte :: Natural -> Memory Tebibyte
tebibyte = memory
# INLINE tebibyte #
| Creates ' Memory ' in ' Pebibyte 's from given ' Natural ' as the number of pebibytes .
> > > showMemory $ pebibyte 42
" 42PiB "
>>> showMemory $ pebibyte 42
"42PiB"
-}
pebibyte :: Natural -> Memory Pebibyte
pebibyte = memory
# INLINE pebibyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of exbibytes .
> > > showMemory $ exbibyte 42
" 42EiB "
>>> showMemory $ exbibyte 42
"42EiB"
-}
exbibyte :: Natural -> Memory Exbibyte
exbibyte = memory
# INLINE exbibyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of zebibytes .
> > > showMemory $ zebibyte 42
" 42ZiB "
>>> showMemory $ zebibyte 42
"42ZiB"
-}
zebibyte :: Natural -> Memory Zebibyte
zebibyte = memory
# INLINE zebibyte #
| Creates ' Memory ' in ' 's from given ' Natural ' as the number of yobibytes .
> > > showMemory $ yobibyte 42
" 42YiB "
>>> showMemory $ yobibyte 42
"42YiB"
-}
yobibyte :: Natural -> Memory Yobibyte
yobibyte = memory
# INLINE yobibyte #
|
8e99d7781d3e79252b25b48e801807d3423414edabf69f0a95a31148c517424f | unisonweb/unison | Desugar.hs | module Unison.PatternMatchCoverage.Desugar
( desugarMatch,
)
where
import Data.List.NonEmpty (NonEmpty (..))
import qualified U.Core.ABT as ABT
import Unison.Pattern
import qualified Unison.Pattern as Pattern
import Unison.PatternMatchCoverage.Class
import Unison.PatternMatchCoverage.Fix
import Unison.PatternMatchCoverage.GrdTree
import Unison.PatternMatchCoverage.PmGrd
import qualified Unison.PatternMatchCoverage.PmLit as PmLit
import Unison.Term (MatchCase (..), Term', app, var)
import Unison.Type (Type)
import qualified Unison.Type as Type
| a match into a ' GrdTree '
desugarMatch ::
forall loc vt v m.
(Pmc vt v loc m) =>
-- | loc of match
loc ->
-- | scrutinee type
Type vt loc ->
-- | scrutinee variable
v ->
-- | match cases
[MatchCase loc (Term' vt v loc)] ->
m (GrdTree (PmGrd vt v loc) loc)
desugarMatch loc0 scrutineeType v0 cs0 =
traverse desugarClause cs0 >>= \case
[] -> pure $ Leaf loc0
x : xs -> pure $ Fork (x :| xs)
where
desugarClause :: MatchCase loc (Term' vt v loc) -> m (GrdTree (PmGrd vt v loc) loc)
desugarClause MatchCase {matchPattern, matchGuard} =
desugarPattern scrutineeType v0 matchPattern (finalK (Pattern.loc matchPattern) matchGuard) []
finalK :: loc -> Maybe (Term' vt v loc) -> [v] -> m (GrdTree (PmGrd vt v loc) loc)
finalK loc mterm vs = case mterm of
Nothing -> pure (Leaf loc)
Just grdExpr -> do
let ann = ABT.annotation grdExpr
expr = foldr (\a b -> app ann (var ann a) b) grdExpr vs
typ = Type.boolean ann
v <- fresh
pure (Grd (PmLet v expr typ) (Grd (PmLit v (PmLit.Boolean True)) (Leaf loc)))
desugarPattern ::
forall v vt loc m.
(Pmc vt v loc m) =>
Type vt loc ->
v ->
Pattern loc ->
([v] -> m (GrdTree (PmGrd vt v loc) loc)) ->
[v] ->
m (GrdTree (PmGrd vt v loc) loc)
desugarPattern typ v0 pat k vs = case pat of
Unbound _ -> k vs
Var _ -> k (v0 : vs)
Boolean _ x -> Grd (PmLit v0 $ PmLit.Boolean x) <$> k vs
Int _ x -> Grd (PmLit v0 $ PmLit.Int x) <$> k vs
Nat _ x -> Grd (PmLit v0 $ PmLit.Nat x) <$> k vs
Float _ x -> Grd (PmLit v0 $ PmLit.Float x) <$> k vs
Text _ x -> Grd (PmLit v0 $ PmLit.Text x) <$> k vs
Char _ x -> Grd (PmLit v0 $ PmLit.Char x) <$> k vs
Constructor _loc consRef pats -> do
contyps <- getConstructorVarTypes typ consRef
patvars <- assignFreshPatternVars pats
let c = PmCon v0 consRef convars
convars :: [(v, Type vt loc)]
convars = map (\(v, _, t) -> (v, t)) tpatvars
tpatvars = zipWith (\(v, p) t -> (v, p, t)) patvars contyps
rest <- foldr (\(v, pat, t) b -> desugarPattern t v pat b) k tpatvars vs
pure (Grd c rest)
As _ rest -> desugarPattern typ v0 rest k (v0 : vs)
EffectPure {} -> k vs
EffectBind {} -> k vs
SequenceLiteral {} -> handleSequence typ v0 pat k vs
SequenceOp {} -> handleSequence typ v0 pat k vs
handleSequence ::
forall v vt loc m.
(Pmc vt v loc m) =>
Type vt loc ->
v ->
Pattern loc ->
([v] -> m (GrdTree (PmGrd vt v loc) loc)) ->
[v] ->
m (GrdTree (PmGrd vt v loc) loc)
handleSequence typ v pat k vs = do
let listArg = case typ of
Type.App' _list arg -> arg
_ -> error "list type is not an application?"
listToGrdTree typ listArg v (normalizeList pat) k vs
listToGrdTree ::
forall v vt loc m.
(Pmc vt v loc m) =>
Type vt loc ->
Type vt loc ->
v ->
NormalizedList loc ->
([v] -> m (GrdTree (PmGrd vt v loc) loc)) ->
[v] ->
m (GrdTree (PmGrd vt v loc) loc)
listToGrdTree _listTyp elemTyp listVar nl0 k0 vs0 =
let (minLen, maxLen) = countMinListLen nl0
in Grd (PmListInterval listVar minLen maxLen) <$> go 0 0 nl0 k0 vs0
where
go consCount snocCount (Fix pat) k vs = case pat of
N'ConsF x xs -> do
element <- fresh
let grd = PmListHead listVar consCount element elemTyp
let !consCount' = consCount + 1
Grd grd <$> desugarPattern elemTyp element x (go consCount' snocCount xs k) vs
N'SnocF xs x -> do
element <- fresh
let grd = PmListTail listVar snocCount element elemTyp
let !snocCount' = snocCount + 1
Grd grd <$> go consCount snocCount' xs (desugarPattern elemTyp element x k) vs
N'NilF -> k vs
N'VarF _ -> k (listVar : vs)
N'UnboundF _ -> k vs
countMinListLen :: NormalizedList loc -> (Int, Int)
countMinListLen =
($ 0) . cata \case
N'ConsF _ b -> \acc -> b $! acc + 1
N'SnocF b _ -> \acc -> b $! acc + 1
N'NilF -> \ !n -> (n, n)
N'VarF _ -> \ !n -> (n, maxBound)
N'UnboundF _ -> \ !n -> (n, maxBound)
data NormalizedListF loc a
= N'ConsF (Pattern loc) a
| N'SnocF a (Pattern loc)
| N'NilF
| N'VarF loc
| N'UnboundF loc
deriving stock (Functor)
type NormalizedList loc = Fix (NormalizedListF loc)
pattern N'Cons :: Pattern loc -> Fix (NormalizedListF loc) -> Fix (NormalizedListF loc)
pattern N'Cons x xs = Fix (N'ConsF x xs)
pattern N'Snoc :: Fix (NormalizedListF loc) -> Pattern loc -> Fix (NormalizedListF loc)
pattern N'Snoc xs x = Fix (N'SnocF xs x)
pattern N'Nil :: Fix (NormalizedListF loc)
pattern N'Nil = Fix N'NilF
pattern N'Var :: loc -> Fix (NormalizedListF loc)
pattern N'Var x = Fix (N'VarF x)
pattern N'Unbound :: loc -> Fix (NormalizedListF loc)
pattern N'Unbound x = Fix (N'UnboundF x)
| strip out sequence literals and concats
normalizeList :: Pattern loc -> NormalizedList loc
normalizeList pat0 = case goCons pat0 of
Left f -> f N'Nil
Right x -> x
where
goCons :: Pattern loc -> Either (NormalizedList loc -> NormalizedList loc) (NormalizedList loc)
goCons = \case
SequenceLiteral _loc xs ->
Left \nil -> foldr N'Cons nil xs
SequenceOp _loc lhs op rhs -> case op of
Cons ->
case goCons rhs of
Left f -> Left (N'Cons lhs . f)
Right x -> Right (N'Cons lhs x)
Snoc ->
case goCons lhs of
Left f -> Left (f . N'Cons rhs)
Right x -> Right (N'Snoc x rhs)
Concat ->
case goCons lhs of
Left f -> case goCons rhs of
Left g -> Left (f . g)
Right x -> Right (f x)
Right x -> Right (goSnoc rhs x)
Var loc -> Right (N'Var loc)
Unbound loc -> Right (N'Unbound loc)
-- as-patterns are not handled properly here, which is fine while we
-- only have boolean guards, but this needs to be fixed if we
-- introduce pattern guards
As _loc pat -> goCons pat
_ -> error "goCons: unexpected pattern"
goSnoc :: Pattern loc -> NormalizedList loc -> NormalizedList loc
goSnoc pat nlp = case pat of
SequenceLiteral _loc xs ->
foldl N'Snoc nlp xs
SequenceOp _loc lhs op rhs -> case op of
Cons ->
goSnoc rhs (N'Snoc nlp lhs)
Snoc ->
N'Snoc (goSnoc rhs nlp) lhs
Concat ->
goSnoc rhs (goSnoc lhs nlp)
As _loc pat -> goSnoc pat nlp
_ -> error "goSnoc: unexpected pattern"
assignFreshPatternVars :: (Pmc vt v loc m) => [Pattern loc] -> m [(v, Pattern loc)]
assignFreshPatternVars pats = traverse (\p -> (,p) <$> fresh) pats
| null | https://raw.githubusercontent.com/unisonweb/unison/61b65bfe5b16df10d2ba9ba05afecfaffc016d0b/parser-typechecker/src/Unison/PatternMatchCoverage/Desugar.hs | haskell | | loc of match
| scrutinee type
| scrutinee variable
| match cases
as-patterns are not handled properly here, which is fine while we
only have boolean guards, but this needs to be fixed if we
introduce pattern guards | module Unison.PatternMatchCoverage.Desugar
( desugarMatch,
)
where
import Data.List.NonEmpty (NonEmpty (..))
import qualified U.Core.ABT as ABT
import Unison.Pattern
import qualified Unison.Pattern as Pattern
import Unison.PatternMatchCoverage.Class
import Unison.PatternMatchCoverage.Fix
import Unison.PatternMatchCoverage.GrdTree
import Unison.PatternMatchCoverage.PmGrd
import qualified Unison.PatternMatchCoverage.PmLit as PmLit
import Unison.Term (MatchCase (..), Term', app, var)
import Unison.Type (Type)
import qualified Unison.Type as Type
| a match into a ' GrdTree '
desugarMatch ::
forall loc vt v m.
(Pmc vt v loc m) =>
loc ->
Type vt loc ->
v ->
[MatchCase loc (Term' vt v loc)] ->
m (GrdTree (PmGrd vt v loc) loc)
desugarMatch loc0 scrutineeType v0 cs0 =
traverse desugarClause cs0 >>= \case
[] -> pure $ Leaf loc0
x : xs -> pure $ Fork (x :| xs)
where
desugarClause :: MatchCase loc (Term' vt v loc) -> m (GrdTree (PmGrd vt v loc) loc)
desugarClause MatchCase {matchPattern, matchGuard} =
desugarPattern scrutineeType v0 matchPattern (finalK (Pattern.loc matchPattern) matchGuard) []
finalK :: loc -> Maybe (Term' vt v loc) -> [v] -> m (GrdTree (PmGrd vt v loc) loc)
finalK loc mterm vs = case mterm of
Nothing -> pure (Leaf loc)
Just grdExpr -> do
let ann = ABT.annotation grdExpr
expr = foldr (\a b -> app ann (var ann a) b) grdExpr vs
typ = Type.boolean ann
v <- fresh
pure (Grd (PmLet v expr typ) (Grd (PmLit v (PmLit.Boolean True)) (Leaf loc)))
desugarPattern ::
forall v vt loc m.
(Pmc vt v loc m) =>
Type vt loc ->
v ->
Pattern loc ->
([v] -> m (GrdTree (PmGrd vt v loc) loc)) ->
[v] ->
m (GrdTree (PmGrd vt v loc) loc)
desugarPattern typ v0 pat k vs = case pat of
Unbound _ -> k vs
Var _ -> k (v0 : vs)
Boolean _ x -> Grd (PmLit v0 $ PmLit.Boolean x) <$> k vs
Int _ x -> Grd (PmLit v0 $ PmLit.Int x) <$> k vs
Nat _ x -> Grd (PmLit v0 $ PmLit.Nat x) <$> k vs
Float _ x -> Grd (PmLit v0 $ PmLit.Float x) <$> k vs
Text _ x -> Grd (PmLit v0 $ PmLit.Text x) <$> k vs
Char _ x -> Grd (PmLit v0 $ PmLit.Char x) <$> k vs
Constructor _loc consRef pats -> do
contyps <- getConstructorVarTypes typ consRef
patvars <- assignFreshPatternVars pats
let c = PmCon v0 consRef convars
convars :: [(v, Type vt loc)]
convars = map (\(v, _, t) -> (v, t)) tpatvars
tpatvars = zipWith (\(v, p) t -> (v, p, t)) patvars contyps
rest <- foldr (\(v, pat, t) b -> desugarPattern t v pat b) k tpatvars vs
pure (Grd c rest)
As _ rest -> desugarPattern typ v0 rest k (v0 : vs)
EffectPure {} -> k vs
EffectBind {} -> k vs
SequenceLiteral {} -> handleSequence typ v0 pat k vs
SequenceOp {} -> handleSequence typ v0 pat k vs
handleSequence ::
forall v vt loc m.
(Pmc vt v loc m) =>
Type vt loc ->
v ->
Pattern loc ->
([v] -> m (GrdTree (PmGrd vt v loc) loc)) ->
[v] ->
m (GrdTree (PmGrd vt v loc) loc)
handleSequence typ v pat k vs = do
let listArg = case typ of
Type.App' _list arg -> arg
_ -> error "list type is not an application?"
listToGrdTree typ listArg v (normalizeList pat) k vs
listToGrdTree ::
forall v vt loc m.
(Pmc vt v loc m) =>
Type vt loc ->
Type vt loc ->
v ->
NormalizedList loc ->
([v] -> m (GrdTree (PmGrd vt v loc) loc)) ->
[v] ->
m (GrdTree (PmGrd vt v loc) loc)
listToGrdTree _listTyp elemTyp listVar nl0 k0 vs0 =
let (minLen, maxLen) = countMinListLen nl0
in Grd (PmListInterval listVar minLen maxLen) <$> go 0 0 nl0 k0 vs0
where
go consCount snocCount (Fix pat) k vs = case pat of
N'ConsF x xs -> do
element <- fresh
let grd = PmListHead listVar consCount element elemTyp
let !consCount' = consCount + 1
Grd grd <$> desugarPattern elemTyp element x (go consCount' snocCount xs k) vs
N'SnocF xs x -> do
element <- fresh
let grd = PmListTail listVar snocCount element elemTyp
let !snocCount' = snocCount + 1
Grd grd <$> go consCount snocCount' xs (desugarPattern elemTyp element x k) vs
N'NilF -> k vs
N'VarF _ -> k (listVar : vs)
N'UnboundF _ -> k vs
countMinListLen :: NormalizedList loc -> (Int, Int)
countMinListLen =
($ 0) . cata \case
N'ConsF _ b -> \acc -> b $! acc + 1
N'SnocF b _ -> \acc -> b $! acc + 1
N'NilF -> \ !n -> (n, n)
N'VarF _ -> \ !n -> (n, maxBound)
N'UnboundF _ -> \ !n -> (n, maxBound)
data NormalizedListF loc a
= N'ConsF (Pattern loc) a
| N'SnocF a (Pattern loc)
| N'NilF
| N'VarF loc
| N'UnboundF loc
deriving stock (Functor)
type NormalizedList loc = Fix (NormalizedListF loc)
pattern N'Cons :: Pattern loc -> Fix (NormalizedListF loc) -> Fix (NormalizedListF loc)
pattern N'Cons x xs = Fix (N'ConsF x xs)
pattern N'Snoc :: Fix (NormalizedListF loc) -> Pattern loc -> Fix (NormalizedListF loc)
pattern N'Snoc xs x = Fix (N'SnocF xs x)
pattern N'Nil :: Fix (NormalizedListF loc)
pattern N'Nil = Fix N'NilF
pattern N'Var :: loc -> Fix (NormalizedListF loc)
pattern N'Var x = Fix (N'VarF x)
pattern N'Unbound :: loc -> Fix (NormalizedListF loc)
pattern N'Unbound x = Fix (N'UnboundF x)
| strip out sequence literals and concats
normalizeList :: Pattern loc -> NormalizedList loc
normalizeList pat0 = case goCons pat0 of
Left f -> f N'Nil
Right x -> x
where
goCons :: Pattern loc -> Either (NormalizedList loc -> NormalizedList loc) (NormalizedList loc)
goCons = \case
SequenceLiteral _loc xs ->
Left \nil -> foldr N'Cons nil xs
SequenceOp _loc lhs op rhs -> case op of
Cons ->
case goCons rhs of
Left f -> Left (N'Cons lhs . f)
Right x -> Right (N'Cons lhs x)
Snoc ->
case goCons lhs of
Left f -> Left (f . N'Cons rhs)
Right x -> Right (N'Snoc x rhs)
Concat ->
case goCons lhs of
Left f -> case goCons rhs of
Left g -> Left (f . g)
Right x -> Right (f x)
Right x -> Right (goSnoc rhs x)
Var loc -> Right (N'Var loc)
Unbound loc -> Right (N'Unbound loc)
As _loc pat -> goCons pat
_ -> error "goCons: unexpected pattern"
goSnoc :: Pattern loc -> NormalizedList loc -> NormalizedList loc
goSnoc pat nlp = case pat of
SequenceLiteral _loc xs ->
foldl N'Snoc nlp xs
SequenceOp _loc lhs op rhs -> case op of
Cons ->
goSnoc rhs (N'Snoc nlp lhs)
Snoc ->
N'Snoc (goSnoc rhs nlp) lhs
Concat ->
goSnoc rhs (goSnoc lhs nlp)
As _loc pat -> goSnoc pat nlp
_ -> error "goSnoc: unexpected pattern"
assignFreshPatternVars :: (Pmc vt v loc m) => [Pattern loc] -> m [(v, Pattern loc)]
assignFreshPatternVars pats = traverse (\p -> (,p) <$> fresh) pats
|
240b1d71c8e344b85ad43e6aeb20e3dcfa95237b13f83b6d89f93b5a2feda9a1 | plum-umd/fundamentals | zip.rkt | The first three lines of this file were inserted by . They record metadata
;; about the language level of this file in a form that our tools can easily process.
#reader(lib "htdp-intermediate-lambda-reader.ss" "lang")((modname zip) (read-case-sensitive #t) (teachpacks ()) (htdp-settings #(#t constructor repeating-decimal #f #t none #f () #f)))
;; Session ID: 887722
A ListofInt is one of :
;; - '()
- ( cons Integer ListofInt )
A ListofPairofInt is one of :
;; - '()
- ( cons PairofInt ListofPairofInt )
A PairofInt is a ( make - pair )
(define-struct pair (left right))
zip : ListofInt ListofInt - > ListofPairofInt
;; Zip together the given lists into a list of pairs
;; Stops zipping at end of the shortest list
(check-expect (zip (list 1 2 3) (list 4 5 6))
(list (make-pair 1 4)
(make-pair 2 5)
(make-pair 3 6)))
(check-expect (zip (list 1 2) (list 4 5 6))
(list (make-pair 1 4)
(make-pair 2 5)))
(check-expect (zip (list 1 2 3) (list 4 5))
(list (make-pair 1 4)
(make-pair 2 5)))
#;
(define (zip ls1 ls2)
(cond [(empty? ls1) '()]
[(cons? ls1)
(cond [(empty? ls2) '()]
[(cons? ls2)
(cons (make-pair (first ls1) (first ls2))
(zip (rest ls1) (rest ls2)))])]))
(define (zip ls1 ls2)
(cond [(empty? ls1) '()]
[(cons? ls1)
(zip-cons ls2 (first ls1) (rest ls1))]))
zip - cons : ListofInt Integer ListofInteger - > ListofPairofInteger
(define (zip-cons ls2 first-ls1 rest-ls1)
(cond [(empty? ls2) '()]
[(cons? ls2)
(cons (make-pair first-ls1 (first ls2))
(zip rest-ls1 (rest ls2)))]))
| null | https://raw.githubusercontent.com/plum-umd/fundamentals/eb01ac528d42855be53649991a17d19c025a97ad/2/www/lectures/4/zip.rkt | racket | about the language level of this file in a form that our tools can easily process.
Session ID: 887722
- '()
- '()
Zip together the given lists into a list of pairs
Stops zipping at end of the shortest list
| The first three lines of this file were inserted by . They record metadata
#reader(lib "htdp-intermediate-lambda-reader.ss" "lang")((modname zip) (read-case-sensitive #t) (teachpacks ()) (htdp-settings #(#t constructor repeating-decimal #f #t none #f () #f)))
A ListofInt is one of :
- ( cons Integer ListofInt )
A ListofPairofInt is one of :
- ( cons PairofInt ListofPairofInt )
A PairofInt is a ( make - pair )
(define-struct pair (left right))
zip : ListofInt ListofInt - > ListofPairofInt
(check-expect (zip (list 1 2 3) (list 4 5 6))
(list (make-pair 1 4)
(make-pair 2 5)
(make-pair 3 6)))
(check-expect (zip (list 1 2) (list 4 5 6))
(list (make-pair 1 4)
(make-pair 2 5)))
(check-expect (zip (list 1 2 3) (list 4 5))
(list (make-pair 1 4)
(make-pair 2 5)))
(define (zip ls1 ls2)
(cond [(empty? ls1) '()]
[(cons? ls1)
(cond [(empty? ls2) '()]
[(cons? ls2)
(cons (make-pair (first ls1) (first ls2))
(zip (rest ls1) (rest ls2)))])]))
(define (zip ls1 ls2)
(cond [(empty? ls1) '()]
[(cons? ls1)
(zip-cons ls2 (first ls1) (rest ls1))]))
zip - cons : ListofInt Integer ListofInteger - > ListofPairofInteger
(define (zip-cons ls2 first-ls1 rest-ls1)
(cond [(empty? ls2) '()]
[(cons? ls2)
(cons (make-pair first-ls1 (first ls2))
(zip rest-ls1 (rest ls2)))]))
|
dbac1e188be88f0adcb4b9284a5821536b224eaf5430e95b8800a7bd04cf6a6a | Paczesiowa/virthualenv | Skeletons.hs | # LANGUAGE TemplateHaskell #
module Skeletons where
import Data.FileEmbed (embedFile)
import Data.ByteString.Char8 (unpack)
import System.FilePath ((</>))
activateSkel :: String
activateSkel = unpack $(embedFile $ "skeletons" </> "activate")
cabalWrapperSkel :: String
cabalWrapperSkel = unpack $(embedFile $ "skeletons" </> "cabal")
cabalConfigSkel :: String
cabalConfigSkel = unpack $(embedFile $ "skeletons" </> "cabal_config")
| null | https://raw.githubusercontent.com/Paczesiowa/virthualenv/aab89dad9de7dac5268472eaa50c11eb40b02380/src/Skeletons.hs | haskell | # LANGUAGE TemplateHaskell #
module Skeletons where
import Data.FileEmbed (embedFile)
import Data.ByteString.Char8 (unpack)
import System.FilePath ((</>))
activateSkel :: String
activateSkel = unpack $(embedFile $ "skeletons" </> "activate")
cabalWrapperSkel :: String
cabalWrapperSkel = unpack $(embedFile $ "skeletons" </> "cabal")
cabalConfigSkel :: String
cabalConfigSkel = unpack $(embedFile $ "skeletons" </> "cabal_config")
| |
131f2ed5beb6e87d918e79fa89ab4c117c43b3bcb05c907a13a336a5d0996cb2 | pat227/ocaml-db-model | date_time_extended.mli | module Date_time_extended : sig
(*type t = Core.Time.t*)
include (module type of Core.Time)
val show : ?zoneoffset:int -> t -> Ppx_deriving_runtime.string
val to_string : ?zoneoffset:int -> t -> string
(*of_string internally supports parsing date time values without time zone
offsets since mysql does not display time zone offsets even if a time zone
offset was supplied when inserting the value.*)
val of_string : ?zoneoffset:int -> string -> t
val compare : t -> t -> Ppx_deriving_runtime.int
val equal : t -> t -> Ppx_deriving_runtime.bool
Type json changed to type t sometime after 4.06.0
val to_yojson : t -> Yojson.Safe.t
val of_yojson : Yojson.Safe.t -> t Ppx_deriving_yojson_runtime.error_or
Not useful unless have local hacked version of csvfields
MUST use these
val to_xml : t - > Csvfields.Xml.xml list
val of_xml : Csvfields.Xml.xml - > t
val xsd : Csvfields.Xml.xml list
MUST use these
val to_xml : t -> Csvfields.Xml.xml list
val of_xml : Csvfields.Xml.xml -> t
val xsd : Csvfields.Xml.xml list*)
end
| null | https://raw.githubusercontent.com/pat227/ocaml-db-model/d117aabcaee88a309ce3af3e11dec031edd3bed4/src/lib/date_time_extended.mli | ocaml | type t = Core.Time.t
of_string internally supports parsing date time values without time zone
offsets since mysql does not display time zone offsets even if a time zone
offset was supplied when inserting the value. | module Date_time_extended : sig
include (module type of Core.Time)
val show : ?zoneoffset:int -> t -> Ppx_deriving_runtime.string
val to_string : ?zoneoffset:int -> t -> string
val of_string : ?zoneoffset:int -> string -> t
val compare : t -> t -> Ppx_deriving_runtime.int
val equal : t -> t -> Ppx_deriving_runtime.bool
Type json changed to type t sometime after 4.06.0
val to_yojson : t -> Yojson.Safe.t
val of_yojson : Yojson.Safe.t -> t Ppx_deriving_yojson_runtime.error_or
Not useful unless have local hacked version of csvfields
MUST use these
val to_xml : t - > Csvfields.Xml.xml list
val of_xml : Csvfields.Xml.xml - > t
val xsd : Csvfields.Xml.xml list
MUST use these
val to_xml : t -> Csvfields.Xml.xml list
val of_xml : Csvfields.Xml.xml -> t
val xsd : Csvfields.Xml.xml list*)
end
|
8f347658d668d82da9ff8899ceb54a2420677b17540e0b20aad19959d35afce8 | herbie-fp/regraph | precompute.rkt | #lang racket
code extracted and simplified from v1.4 master April 25 2020
(require math/flonum math/base math/special-functions math/bigfloat racket/hash)
(provide eval-application)
(define (cbrt x) (expt x (/ 1 3)))
(define (exp2 x) (expt 2 x))
(define (log10 x) (log x 10))
(define (copysign x y) (if (>= y 0) (abs x) (- (abs x))))
(define (fdim x y) (max (- x y) 0))
(define (fma x y z) (bigfloat->flonum (bf+ (bf* (bf x) (bf y)) (bf z))))
(define (fmax x y) (cond ((nan? x) y) ((nan? y) x) (else (max x y))))
(define (fmin x y) (cond ((nan? x) y) ((nan? y) x) (else (min x y))))
(define (logb x) (floor (log (abs x) 2)))
(define real-fns
(list + - * / acos acosh asin asinh atan atanh cbrt copysign cos cosh erf erfc exp exp2
fdim floor fma fmax fmin log log10 logb remainder round sin sinh sqrt tan tanh))
(define (no-complex fun)
(λ xs
(define res (apply fun xs))
(if (real? res)
res
+nan.0)))
(define real-operations
(for/hash ([fn real-fns])
(values (object-name fn) (no-complex fn))))
(define (from-bigfloat bff)
(λ args (bigfloat->flonum (apply bff (map bf args)))))
(define (bffmod x mod)
(bf- x (bf* (bftruncate (bf/ x mod)) mod)))
(define from-bf-operations
(hash 'expm1 (from-bigfloat bfexpm1)
'fmod (from-bigfloat bffmod)
'hypot (from-bigfloat bfhypot)
'j0 (from-bigfloat bfbesj0)
'j1 (from-bigfloat bfbesj1)
'log1p (from-bigfloat bflog1p)
'log2 (from-bigfloat bflog2)
'y0 (from-bigfloat bfbesy0)
'y1 (from-bigfloat bfbesy1)))
(define complex-operations
(hash '+.c + '-.c - '*.c * '/.c / 'exp.c exp 'log.c log 'pow.c expt 'sqrt.c sqrt
'complex make-rectangular 're real-part 'im imag-part 'conj conjugate 'neg.c -))
(define ((comparator test) . args)
(for/and ([left args] [right (cdr args)])
(test left right)))
(define (if-fn test if-true if-false) (if test if-true if-false))
(define (and-fn . as) (andmap identity as))
(define (or-fn . as) (ormap identity as))
(define (!=-fn . args)
(not (check-duplicates args =)))
(define other-operations
(hash 'ceil ceiling
'atan2 (no-complex atan)
'fabs abs
'lgamma log-gamma
'pow (no-complex expt)
'rint round
'tgamma gamma
'trunc truncate
'== (comparator =)
'!= !=-fn
'< (comparator <)
'> (comparator >)
'<= (comparator <=)
'>= (comparator >=)
'if if-fn
'not not
'and and-fn
'or or-fn))
(define operations
(hash-union complex-operations real-operations from-bf-operations other-operations))
(define (val-to-type val)
(match val [#t 'TRUE] [#f 'FALSE] [(? real?) val]))
(define (exact-noncomplex-value? val)
(and (not (and (complex? val) (not (real? val))))
(exact? val)))
(define (eval-application op . args)
(if (and (not (null? args)) (andmap (conjoin number? exact?) args))
(with-handlers ([exn:fail:contract:divide-by-zero? (const #f)])
(define res (apply (hash-ref operations op) args))
(and (exact-noncomplex-value? res)
(val-to-type res)))
false))
| null | https://raw.githubusercontent.com/herbie-fp/regraph/1725355df2cd1ffef7e0c8f01cde848d0f3dcfbf/infra/precompute.rkt | racket | #lang racket
code extracted and simplified from v1.4 master April 25 2020
(require math/flonum math/base math/special-functions math/bigfloat racket/hash)
(provide eval-application)
(define (cbrt x) (expt x (/ 1 3)))
(define (exp2 x) (expt 2 x))
(define (log10 x) (log x 10))
(define (copysign x y) (if (>= y 0) (abs x) (- (abs x))))
(define (fdim x y) (max (- x y) 0))
(define (fma x y z) (bigfloat->flonum (bf+ (bf* (bf x) (bf y)) (bf z))))
(define (fmax x y) (cond ((nan? x) y) ((nan? y) x) (else (max x y))))
(define (fmin x y) (cond ((nan? x) y) ((nan? y) x) (else (min x y))))
(define (logb x) (floor (log (abs x) 2)))
(define real-fns
(list + - * / acos acosh asin asinh atan atanh cbrt copysign cos cosh erf erfc exp exp2
fdim floor fma fmax fmin log log10 logb remainder round sin sinh sqrt tan tanh))
(define (no-complex fun)
(λ xs
(define res (apply fun xs))
(if (real? res)
res
+nan.0)))
(define real-operations
(for/hash ([fn real-fns])
(values (object-name fn) (no-complex fn))))
(define (from-bigfloat bff)
(λ args (bigfloat->flonum (apply bff (map bf args)))))
(define (bffmod x mod)
(bf- x (bf* (bftruncate (bf/ x mod)) mod)))
(define from-bf-operations
(hash 'expm1 (from-bigfloat bfexpm1)
'fmod (from-bigfloat bffmod)
'hypot (from-bigfloat bfhypot)
'j0 (from-bigfloat bfbesj0)
'j1 (from-bigfloat bfbesj1)
'log1p (from-bigfloat bflog1p)
'log2 (from-bigfloat bflog2)
'y0 (from-bigfloat bfbesy0)
'y1 (from-bigfloat bfbesy1)))
(define complex-operations
(hash '+.c + '-.c - '*.c * '/.c / 'exp.c exp 'log.c log 'pow.c expt 'sqrt.c sqrt
'complex make-rectangular 're real-part 'im imag-part 'conj conjugate 'neg.c -))
(define ((comparator test) . args)
(for/and ([left args] [right (cdr args)])
(test left right)))
(define (if-fn test if-true if-false) (if test if-true if-false))
(define (and-fn . as) (andmap identity as))
(define (or-fn . as) (ormap identity as))
(define (!=-fn . args)
(not (check-duplicates args =)))
(define other-operations
(hash 'ceil ceiling
'atan2 (no-complex atan)
'fabs abs
'lgamma log-gamma
'pow (no-complex expt)
'rint round
'tgamma gamma
'trunc truncate
'== (comparator =)
'!= !=-fn
'< (comparator <)
'> (comparator >)
'<= (comparator <=)
'>= (comparator >=)
'if if-fn
'not not
'and and-fn
'or or-fn))
(define operations
(hash-union complex-operations real-operations from-bf-operations other-operations))
(define (val-to-type val)
(match val [#t 'TRUE] [#f 'FALSE] [(? real?) val]))
(define (exact-noncomplex-value? val)
(and (not (and (complex? val) (not (real? val))))
(exact? val)))
(define (eval-application op . args)
(if (and (not (null? args)) (andmap (conjoin number? exact?) args))
(with-handlers ([exn:fail:contract:divide-by-zero? (const #f)])
(define res (apply (hash-ref operations op) args))
(and (exact-noncomplex-value? res)
(val-to-type res)))
false))
| |
964991f73ff6fd1599ca16ad75ea46c9ccaffd3f7d24d33034fe74f0e8115944 | billstclair/trubanc-lisp | length.lisp | -*- Mode : LISP ; Syntax : COMMON - LISP ; Package : FLEXI - STREAMS ; Base : 10 -*-
$ Header : /usr / local / cvsrep / flexi - streams / length.lisp , v 1.6 2008/05/29 10:25:14 edi Exp $
Copyright ( c ) 2005 - 2008 , Dr. . All rights reserved .
;;; Redistribution and use in source and binary forms, with or without
;;; modification, are permitted provided that the following conditions
;;; are met:
;;; * Redistributions of source code must retain the above copyright
;;; notice, this list of conditions and the following disclaimer.
;;; * Redistributions in binary form must reproduce the above
;;; copyright notice, this list of conditions and the following
;;; disclaimer in the documentation and/or other materials
;;; provided with the distribution.
;;; THIS SOFTWARE IS PROVIDED BY THE AUTHOR 'AS IS' AND ANY EXPRESSED
;;; OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED
;;; WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
;;; ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY
DIRECT , INDIRECT , INCIDENTAL , SPECIAL , EXEMPLARY , OR CONSEQUENTIAL
;;; DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE
;;; GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
INTERRUPTION ) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY ,
;;; WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING
;;; NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS
;;; SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
(in-package :flexi-streams)
(defgeneric encoding-factor (format)
(:documentation "Given an external format FORMAT, returns a factor
which denotes the octets to characters ratio to expect when
encoding/decoding. If the returned value is an integer, the factor is
assumed to be exact. If it is a \(double) float, the factor is
supposed to be based on heuristics and usually not exact.
This factor is used in string.lisp.")
(declare #.*standard-optimize-settings*))
(defmethod encoding-factor ((format flexi-8-bit-format))
(declare #.*standard-optimize-settings*)
8 - bit encodings map octets to characters in an exact one - to - one
;; fashion
1)
(defmethod encoding-factor ((format flexi-utf-8-format))
(declare #.*standard-optimize-settings*)
UTF-8 characters can be anything from one to six octets , but we
assume that the " overhead " is only about 5 percent - this
;; estimate is obviously very much dependant on the content
1.05d0)
(defmethod encoding-factor ((format flexi-utf-16-format))
(declare #.*standard-optimize-settings*)
usually one character maps to two octets , but characters with
code points above # x10000 map to four octets - we assume that we
;; usually don't see these characters but of course have to return a
;; float
2.0d0)
(defmethod encoding-factor ((format flexi-utf-32-format))
(declare #.*standard-optimize-settings*)
UTF-32 always matches every character to four octets
4)
(defmethod encoding-factor ((format flexi-crlf-mixin))
(declare #.*standard-optimize-settings*)
;; if the sequence #\Return #\Linefeed is the line-end marker, this
;; obviously makes encodings potentially longer and definitely makes
;; the estimate unexact
(* 1.02d0 (call-next-method)))
(defgeneric check-end (format start end i)
(declare #.*fixnum-optimize-settings*)
(:documentation "Helper function used below to determine if we tried
to read past the end of the sequence.")
(:method (format start end i)
(declare #.*fixnum-optimize-settings*)
(declare (ignore start))
(declare (fixnum end i))
(when (> i end)
(signal-encoding-error format "This sequence can't be decoded ~
using ~A as it is too short. ~A octet~:P missing at then end."
(external-format-name format)
(- i end))))
(:method ((format flexi-utf-16-format) start end i)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end i))
(declare (ignore i))
;; don't warn twice
(when (evenp (- end start))
(call-next-method))))
(defgeneric compute-number-of-chars (format sequence start end)
(declare #.*standard-optimize-settings*)
(:documentation "Computes the exact number of characters required to
decode the sequence of octets in SEQUENCE from START to END using the
external format FORMAT."))
(defmethod compute-number-of-chars :around (format (list list) start end)
(declare #.*standard-optimize-settings*)
(call-next-method format (coerce list 'vector) start end))
(defmethod compute-number-of-chars ((format flexi-8-bit-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end))
(declare (ignore sequence))
(- end start))
(defmethod compute-number-of-chars ((format flexi-crlf-mixin) sequence start end)
this method only applies to the 8 - bit formats as all other
;; formats with CRLF line endings have their own specialized methods
;; below
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((i start)
(length (- end start)))
(declare (fixnum i length))
(loop
(when (>= i end)
(return))
(let ((position (search #.(vector +cr+ +lf+) sequence :start2 i :end2 end :test #'=)))
(unless position
(return))
(setq i (1+ position))
(decf length)))
length))
(defmethod compute-number-of-chars ((format flexi-utf-8-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(loop
(when (>= i end)
(return))
(let* ((octet (aref sequence i))
;; note that there are no validity checks here
(length (cond ((not (logbitp 7 octet)) 1)
((= #b11000000 (logand* octet #b11100000)) 2)
((= #b11100000 (logand* octet #b11110000)) 3)
(t 4))))
(declare (fixnum length) (type octet octet))
(incf sum)
(incf i length)))
(check-end format start end i)
sum))
(defmethod compute-number-of-chars ((format flexi-crlf-utf-8-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((sum 0)
(i start)
(last-octet 0))
(declare (fixnum i sum) (type octet last-octet))
(loop
(when (>= i end)
(return))
(let* ((octet (aref sequence i))
;; note that there are no validity checks here
(length (cond ((not (logbitp 7 octet)) 1)
((= #b11000000 (logand* octet #b11100000)) 2)
((= #b11100000 (logand* octet #b11110000)) 3)
(t 4))))
(declare (fixnum length) (type octet octet))
(unless (and (= octet +lf+) (= last-octet +cr+))
(incf sum))
(incf i length)
(setq last-octet octet)))
(check-end format start end i)
sum))
(defmethod compute-number-of-chars :before ((format flexi-utf-16-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(declare (ignore sequence))
(when (oddp (- end start))
(signal-encoding-error format "~A octet~:P cannot be decoded ~
using UTF-16 as ~:*~A is not even."
(- end start))))
(defmethod compute-number-of-chars ((format flexi-utf-16-le-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(decf end 2)
(loop
(when (> i end)
(return))
(let* ((high-octet (aref sequence (1+ i)))
(length (cond ((<= #xd8 high-octet #xdf) 4)
(t 2))))
(declare (fixnum length) (type octet high-octet))
(incf sum)
(incf i length)))
(check-end format start (+ end 2) i)
sum))
(defmethod compute-number-of-chars ((format flexi-utf-16-be-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(decf end 2)
(loop
(when (> i end)
(return))
(let* ((high-octet (aref sequence i))
(length (cond ((<= #xd8 high-octet #xdf) 4)
(t 2))))
(declare (fixnum length) (type octet high-octet))
(incf sum)
(incf i length)))
(check-end format start (+ end 2) i)
sum))
(defmethod compute-number-of-chars ((format flexi-crlf-utf-16-le-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((sum 0)
(i start)
(last-octet 0))
(declare (fixnum i sum) (type octet last-octet))
(decf end 2)
(loop
(when (> i end)
(return))
(let* ((high-octet (aref sequence (1+ i)))
(length (cond ((<= #xd8 high-octet #xdf) 4)
(t 2))))
(declare (fixnum length) (type octet high-octet))
(unless (and (zerop high-octet)
(= (the octet (aref sequence i)) +lf+)
(= last-octet +cr+))
(incf sum))
(setq last-octet (if (zerop high-octet)
(aref sequence i)
0))
(incf i length)))
(check-end format start (+ end 2) i)
sum))
(defmethod compute-number-of-chars ((format flexi-crlf-utf-16-be-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((sum 0)
(i start)
(last-octet 0))
(declare (fixnum i sum) (type octet last-octet))
(decf end 2)
(loop
(when (> i end)
(return))
(let* ((high-octet (aref sequence i))
(length (cond ((<= #xd8 high-octet #xdf) 4)
(t 2))))
(declare (fixnum length) (type octet high-octet))
(unless (and (zerop high-octet)
(= (the octet (aref sequence (1+ i))) +lf+)
(= last-octet +cr+))
(incf sum))
(setq last-octet (if (zerop high-octet)
(aref sequence (1+ i))
0))
(incf i length)))
(check-end format start (+ end 2) i)
sum))
(defmethod compute-number-of-chars :before ((format flexi-utf-32-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end))
(declare (ignore sequence))
(let ((length (- end start)))
(when (plusp (mod length 4))
(signal-encoding-error format "~A octet~:P cannot be decoded ~
using UTF-32 as ~:*~A is not a multiple-value of four."
length))))
(defmethod compute-number-of-chars ((format flexi-utf-32-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end))
(declare (ignore sequence))
(ceiling (- end start) 4))
(defmethod compute-number-of-chars ((format flexi-crlf-utf-32-le-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((i start)
(length (ceiling (- end start) 4)))
(decf end 8)
(loop
(when (> i end)
(return))
(cond ((loop for j of-type fixnum from i
for octet across #.(vector +cr+ 0 0 0 +lf+ 0 0 0)
always (= octet (aref sequence j)))
(decf length)
(incf i 8))
(t (incf i 4))))
length))
(defmethod compute-number-of-chars ((format flexi-crlf-utf-32-be-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((i start)
(length (ceiling (- end start) 4)))
(decf end 8)
(loop
(when (> i end)
(return))
(cond ((loop for j of-type fixnum from i
for octet across #.(vector 0 0 0 +cr+ 0 0 0 +lf+)
always (= octet (aref sequence j)))
(decf length)
(incf i 8))
(t (incf i 4))))
length))
(defgeneric compute-number-of-octets (format sequence start end)
(declare #.*standard-optimize-settings*)
(:documentation "Computes the exact number of octets required to
encode the sequence of characters in SEQUENCE from START to END using
the external format FORMAT."))
(defmethod compute-number-of-octets :around (format (list list) start end)
(declare #.*standard-optimize-settings*)
(call-next-method format (coerce list 'string*) start end))
(defmethod compute-number-of-octets ((format flexi-8-bit-format) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end))
(declare (ignore string))
(- end start))
(defmethod compute-number-of-octets ((format flexi-utf-8-format) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (string string))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(loop
(when (>= i end)
(return))
(let* ((char-code (char-code (char string i)))
(char-length (cond ((< char-code #x80) 1)
((< char-code #x800) 2)
((< char-code #x10000) 3)
(t 4))))
(declare (fixnum char-length) (type char-code-integer char-code))
(incf sum char-length)
(incf i)))
sum))
(defmethod compute-number-of-octets ((format flexi-crlf-utf-8-format) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (string string))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(loop
(when (>= i end)
(return))
(let* ((char-code (char-code (char string i)))
(char-length (cond ((= char-code #.(char-code #\Newline)) 2)
((< char-code #x80) 1)
((< char-code #x800) 2)
((< char-code #x10000) 3)
(t 4))))
(declare (fixnum char-length) (type char-code-integer char-code))
(incf sum char-length)
(incf i)))
sum))
(defmethod compute-number-of-octets ((format flexi-utf-16-format) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (string string))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(loop
(when (>= i end)
(return))
(let* ((char-code (char-code (char string i)))
(char-length (cond ((< char-code #x10000) 2)
(t 4))))
(declare (fixnum char-length) (type char-code-integer char-code))
(incf sum char-length)
(incf i)))
sum))
(defmethod compute-number-of-octets ((format flexi-crlf-utf-16-le-format) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (string string))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(loop
(when (>= i end)
(return))
(let* ((char-code (char-code (char string i)))
(char-length (cond ((= char-code #.(char-code #\Newline)) 4)
((< char-code #x10000) 2)
(t 4))))
(declare (fixnum char-length) (type char-code-integer char-code))
(incf sum char-length)
(incf i)))
sum))
(defmethod compute-number-of-octets ((format flexi-crlf-utf-16-be-format) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (string string))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(loop
(when (>= i end)
(return))
(let* ((char-code (char-code (char string i)))
(char-length (cond ((= char-code #.(char-code #\Newline)) 4)
((< char-code #x10000) 2)
(t 4))))
(declare (fixnum char-length) (type char-code-integer char-code))
(incf sum char-length)
(incf i)))
sum))
(defmethod compute-number-of-octets ((format flexi-utf-32-format) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end))
(declare (ignore string))
(* 4 (- end start)))
(defmethod compute-number-of-octets ((format flexi-crlf-mixin) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (string string))
(+ (call-next-method)
(* (case (external-format-name format)
(:utf-32 4)
(otherwise 1))
(count #\Newline string :start start :end end :test #'char=))))
(defgeneric character-length (format char)
(declare #.*fixnum-optimize-settings*)
(:documentation "Returns the number of octets needed to encode the
single character CHAR.")
(:method (format char)
(compute-number-of-octets format (string char) 0 1)))
(defmethod character-length :around ((format flexi-crlf-mixin) (char (eql #\Newline)))
(declare #.*fixnum-optimize-settings*)
(+ (call-next-method format +cr+)
(call-next-method format +lf+)))
(defmethod character-length ((format flexi-8-bit-format) char)
(declare #.*fixnum-optimize-settings*)
(declare (ignore char))
1)
(defmethod character-length ((format flexi-utf-32-format) char)
(declare #.*fixnum-optimize-settings*)
(declare (ignore char))
4) | null | https://raw.githubusercontent.com/billstclair/trubanc-lisp/5436d2eca5b1ed10bc47eec7080f6cb90f98ca65/systems/flexi-streams-1.0.7/length.lisp | lisp | Syntax : COMMON - LISP ; Package : FLEXI - STREAMS ; Base : 10 -*-
Redistribution and use in source and binary forms, with or without
modification, are permitted provided that the following conditions
are met:
* Redistributions of source code must retain the above copyright
notice, this list of conditions and the following disclaimer.
* Redistributions in binary form must reproduce the above
copyright notice, this list of conditions and the following
disclaimer in the documentation and/or other materials
provided with the distribution.
THIS SOFTWARE IS PROVIDED BY THE AUTHOR 'AS IS' AND ANY EXPRESSED
OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED
WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE
ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY
DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE
GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS
WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING
NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS
SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
fashion
estimate is obviously very much dependant on the content
usually don't see these characters but of course have to return a
float
if the sequence #\Return #\Linefeed is the line-end marker, this
obviously makes encodings potentially longer and definitely makes
the estimate unexact
don't warn twice
formats with CRLF line endings have their own specialized methods
below
note that there are no validity checks here
note that there are no validity checks here | $ Header : /usr / local / cvsrep / flexi - streams / length.lisp , v 1.6 2008/05/29 10:25:14 edi Exp $
Copyright ( c ) 2005 - 2008 , Dr. . All rights reserved .
DIRECT , INDIRECT , INCIDENTAL , SPECIAL , EXEMPLARY , OR CONSEQUENTIAL
INTERRUPTION ) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY ,
(in-package :flexi-streams)
(defgeneric encoding-factor (format)
(:documentation "Given an external format FORMAT, returns a factor
which denotes the octets to characters ratio to expect when
encoding/decoding. If the returned value is an integer, the factor is
assumed to be exact. If it is a \(double) float, the factor is
supposed to be based on heuristics and usually not exact.
This factor is used in string.lisp.")
(declare #.*standard-optimize-settings*))
(defmethod encoding-factor ((format flexi-8-bit-format))
(declare #.*standard-optimize-settings*)
8 - bit encodings map octets to characters in an exact one - to - one
1)
(defmethod encoding-factor ((format flexi-utf-8-format))
(declare #.*standard-optimize-settings*)
UTF-8 characters can be anything from one to six octets , but we
assume that the " overhead " is only about 5 percent - this
1.05d0)
(defmethod encoding-factor ((format flexi-utf-16-format))
(declare #.*standard-optimize-settings*)
usually one character maps to two octets , but characters with
code points above # x10000 map to four octets - we assume that we
2.0d0)
(defmethod encoding-factor ((format flexi-utf-32-format))
(declare #.*standard-optimize-settings*)
UTF-32 always matches every character to four octets
4)
(defmethod encoding-factor ((format flexi-crlf-mixin))
(declare #.*standard-optimize-settings*)
(* 1.02d0 (call-next-method)))
(defgeneric check-end (format start end i)
(declare #.*fixnum-optimize-settings*)
(:documentation "Helper function used below to determine if we tried
to read past the end of the sequence.")
(:method (format start end i)
(declare #.*fixnum-optimize-settings*)
(declare (ignore start))
(declare (fixnum end i))
(when (> i end)
(signal-encoding-error format "This sequence can't be decoded ~
using ~A as it is too short. ~A octet~:P missing at then end."
(external-format-name format)
(- i end))))
(:method ((format flexi-utf-16-format) start end i)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end i))
(declare (ignore i))
(when (evenp (- end start))
(call-next-method))))
(defgeneric compute-number-of-chars (format sequence start end)
(declare #.*standard-optimize-settings*)
(:documentation "Computes the exact number of characters required to
decode the sequence of octets in SEQUENCE from START to END using the
external format FORMAT."))
(defmethod compute-number-of-chars :around (format (list list) start end)
(declare #.*standard-optimize-settings*)
(call-next-method format (coerce list 'vector) start end))
(defmethod compute-number-of-chars ((format flexi-8-bit-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end))
(declare (ignore sequence))
(- end start))
(defmethod compute-number-of-chars ((format flexi-crlf-mixin) sequence start end)
this method only applies to the 8 - bit formats as all other
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((i start)
(length (- end start)))
(declare (fixnum i length))
(loop
(when (>= i end)
(return))
(let ((position (search #.(vector +cr+ +lf+) sequence :start2 i :end2 end :test #'=)))
(unless position
(return))
(setq i (1+ position))
(decf length)))
length))
(defmethod compute-number-of-chars ((format flexi-utf-8-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(loop
(when (>= i end)
(return))
(let* ((octet (aref sequence i))
(length (cond ((not (logbitp 7 octet)) 1)
((= #b11000000 (logand* octet #b11100000)) 2)
((= #b11100000 (logand* octet #b11110000)) 3)
(t 4))))
(declare (fixnum length) (type octet octet))
(incf sum)
(incf i length)))
(check-end format start end i)
sum))
(defmethod compute-number-of-chars ((format flexi-crlf-utf-8-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((sum 0)
(i start)
(last-octet 0))
(declare (fixnum i sum) (type octet last-octet))
(loop
(when (>= i end)
(return))
(let* ((octet (aref sequence i))
(length (cond ((not (logbitp 7 octet)) 1)
((= #b11000000 (logand* octet #b11100000)) 2)
((= #b11100000 (logand* octet #b11110000)) 3)
(t 4))))
(declare (fixnum length) (type octet octet))
(unless (and (= octet +lf+) (= last-octet +cr+))
(incf sum))
(incf i length)
(setq last-octet octet)))
(check-end format start end i)
sum))
(defmethod compute-number-of-chars :before ((format flexi-utf-16-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(declare (ignore sequence))
(when (oddp (- end start))
(signal-encoding-error format "~A octet~:P cannot be decoded ~
using UTF-16 as ~:*~A is not even."
(- end start))))
(defmethod compute-number-of-chars ((format flexi-utf-16-le-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(decf end 2)
(loop
(when (> i end)
(return))
(let* ((high-octet (aref sequence (1+ i)))
(length (cond ((<= #xd8 high-octet #xdf) 4)
(t 2))))
(declare (fixnum length) (type octet high-octet))
(incf sum)
(incf i length)))
(check-end format start (+ end 2) i)
sum))
(defmethod compute-number-of-chars ((format flexi-utf-16-be-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(decf end 2)
(loop
(when (> i end)
(return))
(let* ((high-octet (aref sequence i))
(length (cond ((<= #xd8 high-octet #xdf) 4)
(t 2))))
(declare (fixnum length) (type octet high-octet))
(incf sum)
(incf i length)))
(check-end format start (+ end 2) i)
sum))
(defmethod compute-number-of-chars ((format flexi-crlf-utf-16-le-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((sum 0)
(i start)
(last-octet 0))
(declare (fixnum i sum) (type octet last-octet))
(decf end 2)
(loop
(when (> i end)
(return))
(let* ((high-octet (aref sequence (1+ i)))
(length (cond ((<= #xd8 high-octet #xdf) 4)
(t 2))))
(declare (fixnum length) (type octet high-octet))
(unless (and (zerop high-octet)
(= (the octet (aref sequence i)) +lf+)
(= last-octet +cr+))
(incf sum))
(setq last-octet (if (zerop high-octet)
(aref sequence i)
0))
(incf i length)))
(check-end format start (+ end 2) i)
sum))
(defmethod compute-number-of-chars ((format flexi-crlf-utf-16-be-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((sum 0)
(i start)
(last-octet 0))
(declare (fixnum i sum) (type octet last-octet))
(decf end 2)
(loop
(when (> i end)
(return))
(let* ((high-octet (aref sequence i))
(length (cond ((<= #xd8 high-octet #xdf) 4)
(t 2))))
(declare (fixnum length) (type octet high-octet))
(unless (and (zerop high-octet)
(= (the octet (aref sequence (1+ i))) +lf+)
(= last-octet +cr+))
(incf sum))
(setq last-octet (if (zerop high-octet)
(aref sequence (1+ i))
0))
(incf i length)))
(check-end format start (+ end 2) i)
sum))
(defmethod compute-number-of-chars :before ((format flexi-utf-32-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end))
(declare (ignore sequence))
(let ((length (- end start)))
(when (plusp (mod length 4))
(signal-encoding-error format "~A octet~:P cannot be decoded ~
using UTF-32 as ~:*~A is not a multiple-value of four."
length))))
(defmethod compute-number-of-chars ((format flexi-utf-32-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end))
(declare (ignore sequence))
(ceiling (- end start) 4))
(defmethod compute-number-of-chars ((format flexi-crlf-utf-32-le-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((i start)
(length (ceiling (- end start) 4)))
(decf end 8)
(loop
(when (> i end)
(return))
(cond ((loop for j of-type fixnum from i
for octet across #.(vector +cr+ 0 0 0 +lf+ 0 0 0)
always (= octet (aref sequence j)))
(decf length)
(incf i 8))
(t (incf i 4))))
length))
(defmethod compute-number-of-chars ((format flexi-crlf-utf-32-be-format) sequence start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (vector sequence))
(let ((i start)
(length (ceiling (- end start) 4)))
(decf end 8)
(loop
(when (> i end)
(return))
(cond ((loop for j of-type fixnum from i
for octet across #.(vector 0 0 0 +cr+ 0 0 0 +lf+)
always (= octet (aref sequence j)))
(decf length)
(incf i 8))
(t (incf i 4))))
length))
(defgeneric compute-number-of-octets (format sequence start end)
(declare #.*standard-optimize-settings*)
(:documentation "Computes the exact number of octets required to
encode the sequence of characters in SEQUENCE from START to END using
the external format FORMAT."))
(defmethod compute-number-of-octets :around (format (list list) start end)
(declare #.*standard-optimize-settings*)
(call-next-method format (coerce list 'string*) start end))
(defmethod compute-number-of-octets ((format flexi-8-bit-format) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end))
(declare (ignore string))
(- end start))
(defmethod compute-number-of-octets ((format flexi-utf-8-format) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (string string))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(loop
(when (>= i end)
(return))
(let* ((char-code (char-code (char string i)))
(char-length (cond ((< char-code #x80) 1)
((< char-code #x800) 2)
((< char-code #x10000) 3)
(t 4))))
(declare (fixnum char-length) (type char-code-integer char-code))
(incf sum char-length)
(incf i)))
sum))
(defmethod compute-number-of-octets ((format flexi-crlf-utf-8-format) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (string string))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(loop
(when (>= i end)
(return))
(let* ((char-code (char-code (char string i)))
(char-length (cond ((= char-code #.(char-code #\Newline)) 2)
((< char-code #x80) 1)
((< char-code #x800) 2)
((< char-code #x10000) 3)
(t 4))))
(declare (fixnum char-length) (type char-code-integer char-code))
(incf sum char-length)
(incf i)))
sum))
(defmethod compute-number-of-octets ((format flexi-utf-16-format) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (string string))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(loop
(when (>= i end)
(return))
(let* ((char-code (char-code (char string i)))
(char-length (cond ((< char-code #x10000) 2)
(t 4))))
(declare (fixnum char-length) (type char-code-integer char-code))
(incf sum char-length)
(incf i)))
sum))
(defmethod compute-number-of-octets ((format flexi-crlf-utf-16-le-format) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (string string))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(loop
(when (>= i end)
(return))
(let* ((char-code (char-code (char string i)))
(char-length (cond ((= char-code #.(char-code #\Newline)) 4)
((< char-code #x10000) 2)
(t 4))))
(declare (fixnum char-length) (type char-code-integer char-code))
(incf sum char-length)
(incf i)))
sum))
(defmethod compute-number-of-octets ((format flexi-crlf-utf-16-be-format) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (string string))
(let ((sum 0)
(i start))
(declare (fixnum i sum))
(loop
(when (>= i end)
(return))
(let* ((char-code (char-code (char string i)))
(char-length (cond ((= char-code #.(char-code #\Newline)) 4)
((< char-code #x10000) 2)
(t 4))))
(declare (fixnum char-length) (type char-code-integer char-code))
(incf sum char-length)
(incf i)))
sum))
(defmethod compute-number-of-octets ((format flexi-utf-32-format) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end))
(declare (ignore string))
(* 4 (- end start)))
(defmethod compute-number-of-octets ((format flexi-crlf-mixin) string start end)
(declare #.*fixnum-optimize-settings*)
(declare (fixnum start end) (string string))
(+ (call-next-method)
(* (case (external-format-name format)
(:utf-32 4)
(otherwise 1))
(count #\Newline string :start start :end end :test #'char=))))
(defgeneric character-length (format char)
(declare #.*fixnum-optimize-settings*)
(:documentation "Returns the number of octets needed to encode the
single character CHAR.")
(:method (format char)
(compute-number-of-octets format (string char) 0 1)))
(defmethod character-length :around ((format flexi-crlf-mixin) (char (eql #\Newline)))
(declare #.*fixnum-optimize-settings*)
(+ (call-next-method format +cr+)
(call-next-method format +lf+)))
(defmethod character-length ((format flexi-8-bit-format) char)
(declare #.*fixnum-optimize-settings*)
(declare (ignore char))
1)
(defmethod character-length ((format flexi-utf-32-format) char)
(declare #.*fixnum-optimize-settings*)
(declare (ignore char))
4) |
8d5aca731ffd760f8b6e48d84cf85f8623963377e8f9df66e9864223935e7130 | clojure-interop/google-cloud-clients | core.clj | (ns com.google.cloud.vision.v1p3beta1.core
(:refer-clojure :only [require comment defn ->])
(:import ))
(require '[com.google.cloud.vision.v1p3beta1.ImageAnnotatorClient])
(require '[com.google.cloud.vision.v1p3beta1.ImageAnnotatorSettings$Builder])
(require '[com.google.cloud.vision.v1p3beta1.ImageAnnotatorSettings])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductSetsFixedSizeCollection])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductSetsPage])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductSetsPagedResponse])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductsFixedSizeCollection])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductsInProductSetFixedSizeCollection])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductsInProductSetPage])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductsInProductSetPagedResponse])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductsPage])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductsPagedResponse])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListReferenceImagesFixedSizeCollection])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListReferenceImagesPage])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListReferenceImagesPagedResponse])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchSettings$Builder])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchSettings])
| null | https://raw.githubusercontent.com/clojure-interop/google-cloud-clients/80852d0496057c22f9cdc86d6f9ffc0fa3cd7904/com.google.cloud.vision/src/com/google/cloud/vision/v1p3beta1/core.clj | clojure | (ns com.google.cloud.vision.v1p3beta1.core
(:refer-clojure :only [require comment defn ->])
(:import ))
(require '[com.google.cloud.vision.v1p3beta1.ImageAnnotatorClient])
(require '[com.google.cloud.vision.v1p3beta1.ImageAnnotatorSettings$Builder])
(require '[com.google.cloud.vision.v1p3beta1.ImageAnnotatorSettings])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductSetsFixedSizeCollection])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductSetsPage])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductSetsPagedResponse])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductsFixedSizeCollection])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductsInProductSetFixedSizeCollection])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductsInProductSetPage])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductsInProductSetPagedResponse])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductsPage])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListProductsPagedResponse])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListReferenceImagesFixedSizeCollection])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListReferenceImagesPage])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient$ListReferenceImagesPagedResponse])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchClient])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchSettings$Builder])
(require '[com.google.cloud.vision.v1p3beta1.ProductSearchSettings])
| |
83518376c5efd1a15355a5fb078b9037ade0ea067400d1a14a405dd68295a39f | appleshan/cl-http | translations.lisp | -*- Syntax : Ansi - Common - Lisp ; Base : 10 ; Mode : lisp ; Package : common - lisp - user -*-
;;;
Copyright , 1994 - 1995
;;; All rights reserved.
;;;
Tried to make MAC - TRANSLATIONS.LISP more portable - OBC
Copyright ( C ) 1995 , OBC for non MCL Genera ports .
;;;
;;;;;;-------------------------------------------------------------------
;;;
;;; LOGICAL PATHNAME HOST FOR HTTP
;;;
(defun http-pathname (&rest dirnames)
(merge-pathnames (make-pathname :directory (append '(:relative) dirnames))
*cl-http-directory*))
(defun rooted-pathname (&rest dirnames)
(make-pathname :directory (append '(:absolute) dirnames
'(:wild-inferiors))
:name :wild
:type :wild))
(defun wildify (wild-bit logical-subdirectory &rest dirnames)
(list (concatenate 'string logical-subdirectory
(and logical-subdirectory ";")
wild-bit ".*")
(let ((http-pathname (apply 'http-pathname dirnames)))
(namestring
(merge-pathnames (substitute #\/ #\; (format nil "~A.~~*~~" wild-bit))
http-pathname)))))
(setf (logical-pathname-translations "http")
`(,(wildify "*.*" "http")
,(wildify "**;*.*" "client" "client")
,(wildify "**;*.*" "docs" "docs")
,(wildify "**;*.*" "lispm" "lispm")
,(wildify "**;*.*" "logs" "log")
,(wildify "**;*.*" "mcl" "mcl")
,(wildify "**;*.*" "pw" "log" "pw")
,(wildify "**;*.*" "server" "server")
,(wildify "**;*.*" "sources" )
,(wildify "**;*.*" "standards" "standards")
,(wildify "**;*.*" "www" "www")
,(wildify "**;*.*" "cmucl" "cmucl")
("root;**;*.*.*" ,(rooted-pathname))
,(wildify "**;*.*" nil)))
| null | https://raw.githubusercontent.com/appleshan/cl-http/a7ec6bf51e260e9bb69d8e180a103daf49aa0ac2/scl/translations.lisp | lisp | Base : 10 ; Mode : lisp ; Package : common - lisp - user -*-
All rights reserved.
-------------------------------------------------------------------
LOGICAL PATHNAME HOST FOR HTTP
(format nil "~A.~~*~~" wild-bit)) | Copyright , 1994 - 1995
Tried to make MAC - TRANSLATIONS.LISP more portable - OBC
Copyright ( C ) 1995 , OBC for non MCL Genera ports .
(defun http-pathname (&rest dirnames)
(merge-pathnames (make-pathname :directory (append '(:relative) dirnames))
*cl-http-directory*))
(defun rooted-pathname (&rest dirnames)
(make-pathname :directory (append '(:absolute) dirnames
'(:wild-inferiors))
:name :wild
:type :wild))
(defun wildify (wild-bit logical-subdirectory &rest dirnames)
(list (concatenate 'string logical-subdirectory
(and logical-subdirectory ";")
wild-bit ".*")
(let ((http-pathname (apply 'http-pathname dirnames)))
(namestring
http-pathname)))))
(setf (logical-pathname-translations "http")
`(,(wildify "*.*" "http")
,(wildify "**;*.*" "client" "client")
,(wildify "**;*.*" "docs" "docs")
,(wildify "**;*.*" "lispm" "lispm")
,(wildify "**;*.*" "logs" "log")
,(wildify "**;*.*" "mcl" "mcl")
,(wildify "**;*.*" "pw" "log" "pw")
,(wildify "**;*.*" "server" "server")
,(wildify "**;*.*" "sources" )
,(wildify "**;*.*" "standards" "standards")
,(wildify "**;*.*" "www" "www")
,(wildify "**;*.*" "cmucl" "cmucl")
("root;**;*.*.*" ,(rooted-pathname))
,(wildify "**;*.*" nil)))
|
e205bf7b1229600201837bdce2d9bf67be61a9db8865db01b5e4b8a481331458 | takikawa/racket-ppa | semaphore.rkt | #lang racket/base
(require racket/unsafe/ops
"check.rkt"
"../common/queue.rkt"
"internal-error.rkt"
"host.rkt"
"atomic.rkt"
"parameter.rkt"
"waiter.rkt"
"evt.rkt"
"pre-poll.rkt"
"error.rkt")
(provide make-semaphore
semaphore?
semaphore-post
semaphore-post-all
semaphore-wait
semaphore-try-wait?
semaphore-peek-evt
semaphore-peek-evt?
semaphore-any-waiters?
semaphore-post/atomic
semaphore-wait/atomic
semaphore-post-all/atomic
unsafe-semaphore-post
unsafe-semaphore-wait)
(struct semaphore queue ([count #:mutable]) ; -1 => non-empty queue
#:authentic
#:property host:prop:unsafe-authentic-override #t ; allow evt chaperone
#:property
prop:evt
(poller (lambda (s poll-ctx)
(semaphore-wait/poll s s poll-ctx))))
(define count-field-pos 2) ; used with `unsafe-struct*-cas!`
(struct semaphore-peek-evt (sema)
#:property
prop:evt
(poller (lambda (sp poll-ctx)
(semaphore-wait/poll (semaphore-peek-evt-sema sp)
sp
poll-ctx
#:peek? #t
#:result sp))))
(struct semaphore-peek-select-waiter select-waiter ())
(define/who (make-semaphore [init 0])
(check who exact-nonnegative-integer? init)
(unless (fixnum? init)
(raise
(exn:fail (error-message->string
who
(string-append "starting value "
(number->string init)
" is too large"))
(current-continuation-marks))))
(semaphore #f #f init))
;; ----------------------------------------
(define/who (semaphore-post s)
(check who semaphore? s)
(unsafe-semaphore-post s))
(define (unsafe-semaphore-post s)
(define c (semaphore-count s))
(cond
[(and (c . >= . 0)
(not (current-future))
(unsafe-struct*-cas! s count-field-pos c (add1 c)))
(void)]
[else
(atomically
(semaphore-post/atomic s)
(void))]))
;; In atomic mode:
(define (semaphore-post/atomic s)
(assert-atomic-mode)
(let loop ()
(define w (queue-remove! s))
(cond
[(not w)
(set-semaphore-count! s (add1 (semaphore-count s)))]
[else
(waiter-resume! w s)
(when (queue-empty? s)
allow CAS again
(when (semaphore-peek-select-waiter? w)
;; Don't consume a post for a peek waiter
(loop))])))
;; In atomic mode
(define (semaphore-post-all/atomic s)
(assert-atomic-mode)
(set-semaphore-count! s +inf.0)
(queue-remove-all!
s
(lambda (w) (waiter-resume! w s))))
(define (semaphore-post-all s)
(atomically
(semaphore-post-all/atomic s)
(void)))
;; In atomic mode:
(define (semaphore-any-waiters? s)
(assert-atomic-mode)
(not (queue-empty? s)))
;; ----------------------------------------
(define/who (semaphore-try-wait? s)
(check who semaphore? s)
(atomically
(call-pre-poll-external-callbacks)
(define c (semaphore-count s))
(cond
[(positive? c)
(set-semaphore-count! s (sub1 c))
#t]
[else #f])))
(define/who (semaphore-wait s)
(check who semaphore? s)
(unsafe-semaphore-wait s))
(define (unsafe-semaphore-wait s)
(define c (semaphore-count s))
(cond
[(and (positive? c)
(not (current-future))
(unsafe-struct*-cas! s count-field-pos c (sub1 c)))
(void)]
[else
((atomically
(define c (semaphore-count s))
(cond
[(positive? c)
(set-semaphore-count! s (sub1 c))
void]
[else
(define w (current-thread/in-atomic))
(define n (queue-add! s w))
so CAS not tried for ` semaphore - post `
(waiter-suspend!
w
;; On break/kill/suspend:
(lambda ()
(queue-remove-node! s n)
(when (queue-empty? s)
allow CAS again
;; This callback is used if the thread receives a break
;; signal but doesn't escape (either because breaks are
;; disabled or the handler continues), or if the
;; interrupt was to suspend and the thread is resumed:
(lambda () (unsafe-semaphore-wait s))))])))]))
;; In atomic mode
(define (semaphore-wait/poll s self poll-ctx
#:peek? [peek? #f]
#:result [result s])
;; Similar to `semaphore-wait, but as called by `sync`,
;; so use a select waiter instead of the current thread
(assert-atomic-mode)
(define c (semaphore-count s))
(cond
[(positive? c)
(unless peek?
(set-semaphore-count! s (sub1 c)))
(values (list result) #f)]
[(poll-ctx-poll? poll-ctx)
(values #f self)]
[else
(define w (if peek?
(semaphore-peek-select-waiter (poll-ctx-select-proc poll-ctx))
(select-waiter (poll-ctx-select-proc poll-ctx))))
(define n (queue-add! s w))
so CAS not tried for ` semaphore - post `
;; Replace with `async-evt`, but the `sema-waiter` can select the
;; event through a callback. Pair the event with a nack callback
;; to get back out of line.
(values #f
(control-state-evt async-evt
(lambda (v) result)
(lambda ()
(assert-atomic-mode)
(queue-remove-node! s n)
(when (queue-empty? s)
allow CAS again
void
(lambda ()
;; Retry: decrement or requeue
(assert-atomic-mode)
(define c (semaphore-count s))
(cond
[(positive? c)
(unless peek?
(set-semaphore-count! s (sub1 c)))
(values result #t)]
[else
(set! n (queue-add! s w))
so CAS not tried for ` semaphore - post `
(values #f #f)]))))]))
;; Called only when it should immediately succeed:
(define (semaphore-wait/atomic s)
(define c (semaphore-count s))
(cond
[(positive? c)
(set-semaphore-count! s (sub1 c))]
[else
(internal-error "semaphore-wait/atomic: cannot decrement semaphore")]))
| null | https://raw.githubusercontent.com/takikawa/racket-ppa/caff086a1cd48208815cec2a22645a3091c11d4c/src/thread/semaphore.rkt | racket | -1 => non-empty queue
allow evt chaperone
used with `unsafe-struct*-cas!`
----------------------------------------
In atomic mode:
Don't consume a post for a peek waiter
In atomic mode
In atomic mode:
----------------------------------------
On break/kill/suspend:
This callback is used if the thread receives a break
signal but doesn't escape (either because breaks are
disabled or the handler continues), or if the
interrupt was to suspend and the thread is resumed:
In atomic mode
Similar to `semaphore-wait, but as called by `sync`,
so use a select waiter instead of the current thread
Replace with `async-evt`, but the `sema-waiter` can select the
event through a callback. Pair the event with a nack callback
to get back out of line.
Retry: decrement or requeue
Called only when it should immediately succeed: | #lang racket/base
(require racket/unsafe/ops
"check.rkt"
"../common/queue.rkt"
"internal-error.rkt"
"host.rkt"
"atomic.rkt"
"parameter.rkt"
"waiter.rkt"
"evt.rkt"
"pre-poll.rkt"
"error.rkt")
(provide make-semaphore
semaphore?
semaphore-post
semaphore-post-all
semaphore-wait
semaphore-try-wait?
semaphore-peek-evt
semaphore-peek-evt?
semaphore-any-waiters?
semaphore-post/atomic
semaphore-wait/atomic
semaphore-post-all/atomic
unsafe-semaphore-post
unsafe-semaphore-wait)
#:authentic
#:property
prop:evt
(poller (lambda (s poll-ctx)
(semaphore-wait/poll s s poll-ctx))))
(struct semaphore-peek-evt (sema)
#:property
prop:evt
(poller (lambda (sp poll-ctx)
(semaphore-wait/poll (semaphore-peek-evt-sema sp)
sp
poll-ctx
#:peek? #t
#:result sp))))
(struct semaphore-peek-select-waiter select-waiter ())
(define/who (make-semaphore [init 0])
(check who exact-nonnegative-integer? init)
(unless (fixnum? init)
(raise
(exn:fail (error-message->string
who
(string-append "starting value "
(number->string init)
" is too large"))
(current-continuation-marks))))
(semaphore #f #f init))
(define/who (semaphore-post s)
(check who semaphore? s)
(unsafe-semaphore-post s))
(define (unsafe-semaphore-post s)
(define c (semaphore-count s))
(cond
[(and (c . >= . 0)
(not (current-future))
(unsafe-struct*-cas! s count-field-pos c (add1 c)))
(void)]
[else
(atomically
(semaphore-post/atomic s)
(void))]))
(define (semaphore-post/atomic s)
(assert-atomic-mode)
(let loop ()
(define w (queue-remove! s))
(cond
[(not w)
(set-semaphore-count! s (add1 (semaphore-count s)))]
[else
(waiter-resume! w s)
(when (queue-empty? s)
allow CAS again
(when (semaphore-peek-select-waiter? w)
(loop))])))
(define (semaphore-post-all/atomic s)
(assert-atomic-mode)
(set-semaphore-count! s +inf.0)
(queue-remove-all!
s
(lambda (w) (waiter-resume! w s))))
(define (semaphore-post-all s)
(atomically
(semaphore-post-all/atomic s)
(void)))
(define (semaphore-any-waiters? s)
(assert-atomic-mode)
(not (queue-empty? s)))
(define/who (semaphore-try-wait? s)
(check who semaphore? s)
(atomically
(call-pre-poll-external-callbacks)
(define c (semaphore-count s))
(cond
[(positive? c)
(set-semaphore-count! s (sub1 c))
#t]
[else #f])))
(define/who (semaphore-wait s)
(check who semaphore? s)
(unsafe-semaphore-wait s))
(define (unsafe-semaphore-wait s)
(define c (semaphore-count s))
(cond
[(and (positive? c)
(not (current-future))
(unsafe-struct*-cas! s count-field-pos c (sub1 c)))
(void)]
[else
((atomically
(define c (semaphore-count s))
(cond
[(positive? c)
(set-semaphore-count! s (sub1 c))
void]
[else
(define w (current-thread/in-atomic))
(define n (queue-add! s w))
so CAS not tried for ` semaphore - post `
(waiter-suspend!
w
(lambda ()
(queue-remove-node! s n)
(when (queue-empty? s)
allow CAS again
(lambda () (unsafe-semaphore-wait s))))])))]))
(define (semaphore-wait/poll s self poll-ctx
#:peek? [peek? #f]
#:result [result s])
(assert-atomic-mode)
(define c (semaphore-count s))
(cond
[(positive? c)
(unless peek?
(set-semaphore-count! s (sub1 c)))
(values (list result) #f)]
[(poll-ctx-poll? poll-ctx)
(values #f self)]
[else
(define w (if peek?
(semaphore-peek-select-waiter (poll-ctx-select-proc poll-ctx))
(select-waiter (poll-ctx-select-proc poll-ctx))))
(define n (queue-add! s w))
so CAS not tried for ` semaphore - post `
(values #f
(control-state-evt async-evt
(lambda (v) result)
(lambda ()
(assert-atomic-mode)
(queue-remove-node! s n)
(when (queue-empty? s)
allow CAS again
void
(lambda ()
(assert-atomic-mode)
(define c (semaphore-count s))
(cond
[(positive? c)
(unless peek?
(set-semaphore-count! s (sub1 c)))
(values result #t)]
[else
(set! n (queue-add! s w))
so CAS not tried for ` semaphore - post `
(values #f #f)]))))]))
(define (semaphore-wait/atomic s)
(define c (semaphore-count s))
(cond
[(positive? c)
(set-semaphore-count! s (sub1 c))]
[else
(internal-error "semaphore-wait/atomic: cannot decrement semaphore")]))
|
0cf95eb45e69cad19559d56e556008cc29a54a61ba0f734e561de37dadbf1efe | solita/mnt-teet | admin_commands_test.clj | (ns ^:db teet.admin.admin-commands-test
(:require [clojure.test :refer :all]
teet.admin.admin-commands
[teet.util.datomic :as du]
[teet.test.utils :as tu]
[teet.user.user-db :as user-db]
[datomic.client.api :as d]))
(use-fixtures :each tu/with-environment (tu/with-db) tu/with-global-data)
(deftest create-user
(tu/give-admin-permission tu/mock-user-boss)
(testing "New user can be created"
(is (tu/local-command tu/mock-user-boss
:admin/create-user
{:user/person-id "EE44556677880"
:user/email ""})))
(testing "Proper permissions are required"
(is (thrown? Exception
(tu/local-command tu/mock-user-carla-consultant
:admin/create-user
{:user/person-id "EE44556677880"
:user/email ""}))))
(testing "Person id needs to be provided and valid (for some value of valid)"
(is (:body (tu/local-command tu/mock-user-boss
:admin/create-user
{:user/person-id "invalid"
:user/email ""}))
"Spec validation failed")
(is (:body (tu/local-command tu/mock-user-boss
:admin/create-user
{}))
"Spec validation failed"))
(testing "Creating another user with the same email fails"
(tu/is-thrown-with-data?
{:teet/error :email-address-already-in-use}
(tu/local-command tu/mock-user-boss
:admin/create-user
{:user/person-id "EE55667788990"
:user/email ""}))))
(deftest edit-user-checks-unique-email
(tu/give-admin-permission tu/mock-user-boss)
(doseq [u [{:user/person-id "EE11223344556" :user/email ""}
{:user/person-id "EE11223344557" :user/email ""}]]
(tu/local-command tu/mock-user-boss :admin/create-user u))
(tu/is-thrown-with-data?
{:teet/error :email-address-already-in-use}
(tu/local-command tu/mock-user-boss
:admin/edit-user
{:user/person-id "EE11223344557"
:user/email ""}))
(is (= "" (:user/email (d/pull (tu/db) [:user/email]
[:user/person-id "EE11223344557"])))
"email hasn't been changed")
(tu/local-command tu/mock-user-boss
:admin/edit-user
{:user/person-id "EE11223344557"
:user/email ""})
(is (= "" (:user/email (d/pull (tu/db) [:user/email]
[:user/person-id "EE11223344557"])))
"email has been changed"))
(deftest create-user-global-permissions
(tu/give-admin-permission tu/mock-user-boss)
(testing "New user can be granted a global role"
(tu/local-command tu/mock-user-boss
:admin/create-user
{:user/person-id "EE44556677880"
:user/global-role :admin
:user/email ""})
(let [new-user-permissions (-> (du/entity (tu/db) [:user/person-id "EE44556677880"])
:user/permissions)]
(is (= (count new-user-permissions) 1))
(is (= (-> new-user-permissions first :permission/role)
:admin))))
(testing "Existing user can be granted a global role"
(tu/local-command tu/mock-user-boss
:admin/create-user
{:user/person-id "EE55667788990"
:user/email ""})
(let [new-user-permissions (-> (du/entity (tu/db) [:user/person-id "EE55667788990"])
:user/permissions)]
(is (= (count new-user-permissions) 0)))
(tu/local-command tu/mock-user-boss
:admin/edit-user
{:user/person-id "EE55667788990"
:user/global-role :admin
:user/email ""})
(let [existing-user-permissions (-> (du/entity (tu/db) [:user/person-id "EE55667788990"])
:user/permissions)]
(is (= (count existing-user-permissions) 1))
(is (= (-> existing-user-permissions first :permission/role)
:admin)))
;; Can't add the same global role multiple times
(tu/local-command tu/mock-user-boss
:admin/create-user
{:user/person-id "EE55667788990"
:user/global-role :admin})
(let [existing-user-permissions (-> (du/entity (tu/db) [:user/person-id "EE55667788990"])
:user/permissions)]
(is (= (count existing-user-permissions) 1) "Will override the previous permission")
(is (= (-> existing-user-permissions first :permission/role)
:admin)))
;; Can add multiple global roles
(tu/local-command tu/mock-user-boss
:admin/edit-user
{:user/person-id "EE55667788990"
:user/email ""
:user/global-role :ta-consultant})
(let [existing-user-permissions (user-db/users-valid-global-permissions
(tu/db)
(:db/id (du/entity (tu/db) [:user/person-id "EE55667788990"])))
]
(is (= (count existing-user-permissions) 1) "Can't add multiple global roles")
(is (= (->> existing-user-permissions (map :permission/role) set)
#{:ta-consultant})
"The latest global role stays as the only valid role"))))
| null | https://raw.githubusercontent.com/solita/mnt-teet/0e6b16acbc13d22b1a42b8ef0b174a4c88c864ee/app/backend/test/teet/admin/admin_commands_test.clj | clojure | Can't add the same global role multiple times
Can add multiple global roles | (ns ^:db teet.admin.admin-commands-test
(:require [clojure.test :refer :all]
teet.admin.admin-commands
[teet.util.datomic :as du]
[teet.test.utils :as tu]
[teet.user.user-db :as user-db]
[datomic.client.api :as d]))
(use-fixtures :each tu/with-environment (tu/with-db) tu/with-global-data)
(deftest create-user
(tu/give-admin-permission tu/mock-user-boss)
(testing "New user can be created"
(is (tu/local-command tu/mock-user-boss
:admin/create-user
{:user/person-id "EE44556677880"
:user/email ""})))
(testing "Proper permissions are required"
(is (thrown? Exception
(tu/local-command tu/mock-user-carla-consultant
:admin/create-user
{:user/person-id "EE44556677880"
:user/email ""}))))
(testing "Person id needs to be provided and valid (for some value of valid)"
(is (:body (tu/local-command tu/mock-user-boss
:admin/create-user
{:user/person-id "invalid"
:user/email ""}))
"Spec validation failed")
(is (:body (tu/local-command tu/mock-user-boss
:admin/create-user
{}))
"Spec validation failed"))
(testing "Creating another user with the same email fails"
(tu/is-thrown-with-data?
{:teet/error :email-address-already-in-use}
(tu/local-command tu/mock-user-boss
:admin/create-user
{:user/person-id "EE55667788990"
:user/email ""}))))
(deftest edit-user-checks-unique-email
(tu/give-admin-permission tu/mock-user-boss)
(doseq [u [{:user/person-id "EE11223344556" :user/email ""}
{:user/person-id "EE11223344557" :user/email ""}]]
(tu/local-command tu/mock-user-boss :admin/create-user u))
(tu/is-thrown-with-data?
{:teet/error :email-address-already-in-use}
(tu/local-command tu/mock-user-boss
:admin/edit-user
{:user/person-id "EE11223344557"
:user/email ""}))
(is (= "" (:user/email (d/pull (tu/db) [:user/email]
[:user/person-id "EE11223344557"])))
"email hasn't been changed")
(tu/local-command tu/mock-user-boss
:admin/edit-user
{:user/person-id "EE11223344557"
:user/email ""})
(is (= "" (:user/email (d/pull (tu/db) [:user/email]
[:user/person-id "EE11223344557"])))
"email has been changed"))
(deftest create-user-global-permissions
(tu/give-admin-permission tu/mock-user-boss)
(testing "New user can be granted a global role"
(tu/local-command tu/mock-user-boss
:admin/create-user
{:user/person-id "EE44556677880"
:user/global-role :admin
:user/email ""})
(let [new-user-permissions (-> (du/entity (tu/db) [:user/person-id "EE44556677880"])
:user/permissions)]
(is (= (count new-user-permissions) 1))
(is (= (-> new-user-permissions first :permission/role)
:admin))))
(testing "Existing user can be granted a global role"
(tu/local-command tu/mock-user-boss
:admin/create-user
{:user/person-id "EE55667788990"
:user/email ""})
(let [new-user-permissions (-> (du/entity (tu/db) [:user/person-id "EE55667788990"])
:user/permissions)]
(is (= (count new-user-permissions) 0)))
(tu/local-command tu/mock-user-boss
:admin/edit-user
{:user/person-id "EE55667788990"
:user/global-role :admin
:user/email ""})
(let [existing-user-permissions (-> (du/entity (tu/db) [:user/person-id "EE55667788990"])
:user/permissions)]
(is (= (count existing-user-permissions) 1))
(is (= (-> existing-user-permissions first :permission/role)
:admin)))
(tu/local-command tu/mock-user-boss
:admin/create-user
{:user/person-id "EE55667788990"
:user/global-role :admin})
(let [existing-user-permissions (-> (du/entity (tu/db) [:user/person-id "EE55667788990"])
:user/permissions)]
(is (= (count existing-user-permissions) 1) "Will override the previous permission")
(is (= (-> existing-user-permissions first :permission/role)
:admin)))
(tu/local-command tu/mock-user-boss
:admin/edit-user
{:user/person-id "EE55667788990"
:user/email ""
:user/global-role :ta-consultant})
(let [existing-user-permissions (user-db/users-valid-global-permissions
(tu/db)
(:db/id (du/entity (tu/db) [:user/person-id "EE55667788990"])))
]
(is (= (count existing-user-permissions) 1) "Can't add multiple global roles")
(is (= (->> existing-user-permissions (map :permission/role) set)
#{:ta-consultant})
"The latest global role stays as the only valid role"))))
|
da48e6d0341ae8725fe7767462c14ed5336664bf97f1d3d3398894277410143d | bluelisp/hemlock | qt.lisp | ;;;; -*- Mode: Lisp; indent-tabs-mode: nil -*-
(in-package :hemlock.qt)
(pushnew :qt hi::*available-backends*)
(eval-when (:compile-toplevel :load-toplevel :execute)
(unless (named-readtables:find-readtable :hemlock.qt)
(named-readtables:defreadtable :hemlock.qt
(:merge :qt)
(:dispatch-macro-char #\# #\k 'hemlock-ext::parse-key-fun))))
(named-readtables:in-readtable :hemlock.qt)
(defun enable-syntax ()
(named-readtables:in-readtable :hemlock.qt)
nil)
(defvar *settings-organization* "Hemlock")
(defvar *settings-application* "Hemlock")
(defvar *font*)
(defvar *modeline-font*)
(defvar *tabs*)
(defvar *buffers-to-tabs*)
(defvar *main-stack*)
(defvar *main-hunk-widget*)
(defvar *executor*)
(defvar *notifier*)
(defun qsettings ()
(#_new QSettings
*settings-organization*
*settings-application*))
(defun save-window-geometry (window)
(with-object (sx (qsettings))
(#_setValue sx
"geometry"
(#_new QVariant (#_saveGeometry window)))))
(defcommand "Save Window Geometry" (p)
"Save current window's geometry in Qt settings." ""
(declare (ignore p))
(save-window-geometry
(#_window (qt-hunk-widget (window-hunk (current-window))))))
(defun restore-window-geometry (window)
(with-object (sx (qsettings))
(#_restoreGeometry window
(#_toByteArray (#_value sx "geometry")))))
(defcommand "Restore Window Geometry" (p)
"Restore the current window's geometry from Qt settings." ""
(declare (ignore p))
(restore-window-geometry
(#_window (qt-hunk-widget (window-hunk (current-window))))))
(defun save-font ()
(with-object (sx (qsettings))
(format t "setting font ~A~%" (#_toString *font*))
(#_setValue sx "main font" (#_toString *font*))))
(defun qvariant-string (x)
fixme : CommonQt now string QVariants automatically , so
;; (#_toString ...) fails on those pre-unmarshalled strings. But
sometimes we get a default QVariant , which CommonQt does n't unpack ,
;; and we need to call (#_toString) after all. This doesn't seem
;; ideal...
(if (stringp x)
x
(#_toString x)))
(defun restore-font ()
(with-object (sx (qsettings))
(let ((str (qvariant-string (#_value sx "main font"))))
(when (plusp (length str))
(setf *font*
(let ((font (#_new QFont)))
(#_fromString font str)
font))))))
(defcommand "Select Font" (p)
"Open a font dialog and change the current display font." ""
(declare (ignore p))
(let (font)
(unless (qt::with-&bool (arg nil)
(setf font (#_QFontDialog::getFont arg *font*)))
(editor-error "Font dialog cancelled"))
(setf *font* font)
(save-font)))
(defparameter *gutter* 10
"The gutter to place between between the matter in a hemlock pane and its
margin to improve legibility (sp?, damn i miss ispell).")
(defclass qt-device (device)
((cursor-hunk :initform nil
:documentation "The hunk that has the cursor."
:accessor device-cursor-hunk)
(cursor-item :initform nil
:accessor device-cursor-item)
#+nil (windows :initform nil)
(main-window :initform nil
:accessor device-main-window)))
(defun current-device ()
(device-hunk-device (window-hunk (current-window))))
(defclass qt-hunk (device-hunk)
((widget :initarg :widget
:reader qt-hunk-widget)
(native-widget-item :initform nil
:accessor hunk-native-widget-item)
(item :initarg :item
:accessor qt-hunk-item)
(item-group :initform nil
:accessor hunk-item-group)
(background-items :initform nil
:accessor hunk-background-items)
(want-background-p :initarg :want-background-p
:initform nil
:accessor qt-hunk-want-background-p)
(itab :initform (make-array 0 :adjustable t :initial-element nil))
(text-position :initarg :text-position
:accessor device-hunk-text-position)
(text-height :initarg :text-height
:accessor device-hunk-text-height)
(cw)
(ch)
(ts)))
(defun line-items (hunk i)
(with-slots (itab) hunk
(unless (< i (length itab))
(adjust-array itab (* 2 (max 1 i)) :initial-element nil))
(elt itab i)))
(defun (setf line-items) (newval hunk i)
(with-slots (itab) hunk
(unless (< i (length itab))
(adjust-array itab (* 2 (max 1 i))))
(setf (elt itab i) newval)))
(defvar *steal-focus-out* t)
(defclass hunk-widget ()
((hunk :accessor widget-hunk)
(centerize :initform nil
:initarg :centerize
:accessor centerize-widget-p)
(paint-margin :initform nil
:initarg :paint-margin
:accessor paint-widget-margin-p)
(background-pixmap :initform nil
:accessor hunk-widget-background-pixmap)
(background-pixmap-item :initform nil
:accessor hunk-widget-background-pixmap-item)
(white-item-1 :initform nil
:accessor hunk-widget-rect-pixmap-item)
(white-item-2 :initform nil
:accessor hunk-widget-rect-pixmap-item)
(height :initform 0
:accessor hunk-widget-height))
(:metaclass qt-class)
(:qt-superclass "QGraphicsView")
(:override ("resizeEvent" resize-event)
("keyPressEvent" key-press-event)
("focusOutEvent" focus-out-event)
("event" intercept-event)
("contextMenuEvent" context-menu-event)
#+nil ("mousePressEvent" mouse-press-event)
#+nil ("mouseMoveEvent" mouse-move-event)
#+nil ("mouseReleaseEvent" mouse-release-event)))
(defun focus-out-event (this event)
(declare (ignore event))
(when *steal-focus-out*
(let ((*steal-focus-out* nil))
(#_setFocus this))))
(defvar *interesting-event-received* nil
"Did Qt just receive an event that matters to Hemlock?
Anyone using :OVERRIDE or #_connect for code that might affect
Hemlock state is required to set this variable to true. See the
comment in DISPATCH-EVENTS for details.")
(defun intercept-event (instance event)
;;
;; Rather than have this separately in each hunk-widget method, do
;; it centrally here:
(setf *interesting-event-received* t)
;;
Qt consumes key events for its own purposes . Using this event
;; interceptor, we can steal them in time.
(let (casted)
(cond
((and (enum= (#_type event) (#_QEvent::KeyPress))
(setf casted (make-instance 'qobject
:class (qt:find-qclass "QKeyEvent")
:pointer (qt::qobject-pointer event)))
(eql (#_key casted) (primitive-value (#_Qt::Key_Tab))))
(key-press-event instance casted)
t)
(t
(call-next-qmethod)))))
(defmethod initialize-instance :after ((instance hunk-widget) &key)
(new instance)
(#_setFocusPolicy instance (#_Qt::StrongFocus))
(#_setScene instance (#_new QGraphicsScene instance))
(#_setHorizontalScrollBarPolicy instance (#_Qt::ScrollBarAlwaysOff))
(#_setVerticalScrollBarPolicy instance (#_Qt::ScrollBarAlwaysOff)))
(defmethod device-init ((device qt-device))
;; (redisplay-all)
)
(defmethod device-exit ((device qt-device)))
(defmacro with-timer (&body body)
`(call-with-timer (lambda () ,@body)))
(defun call-with-timer (fun)
(let ((a (get-internal-real-time)))
(multiple-value-prog1
(funcall fun)
(let ((b (get-internal-real-time)))
(format *trace-output*
" ~D"
(round(* (- b a) (/ 1000 internal-time-units-per-second))))
(force-output *trace-output*)))))
(defmethod device-smart-redisplay ((device qt-device) window)
(dumb-or-smart-redisplay device window nil))
(defmethod device-dumb-redisplay ((device qt-device) window)
(dumb-or-smart-redisplay device window t))
(defmethod device-after-redisplay ((device qt-device))
)
(defmethod device-clear ((device qt-device))
)
(defmethod device-note-read-wait ((device qt-device) on-off)
)
(defvar *processing-events-p* nil)
(defun exhaustively-dispatch-events-no-hang ()
;; Must dispatch all remaining events here (but not actually block).
;;
Redisplay can lead to events being posted , and Hemlock 's event loop
;; is built to alternate between INTERNAL-REDISPLAY and
;; DISPATCH-EVENTS, with the expectation that only meaningful events
;; like keyboard or socket interaction will make event dispatching
;; return. So if redisplay exited with a pending event,
;; editor-input-method would degenerate into a busy loop.
(assert (not *processing-events-p*))
(let ((ev (#_QAbstractEventDispatcher::instance))
(*processing-events-p* t))
(iter (while (#_processEvents ev (#_QEventLoop::AllEvents))))))
(defmethod device-force-output ((device qt-device))
(unless *processing-events-p*
(exhaustively-dispatch-events-no-hang)))
(defmethod device-finish-output ((device qt-device) window)
)
(defmethod device-put-cursor ((device qt-device) hunk x y)
(with-slots (cursor-item cursor-hunk) device
(when (and cursor-item (not (eq hunk cursor-hunk)))
(let ((*steal-focus-out* nil))
(#_removeItem (#_scene cursor-item) cursor-item))
(setf cursor-item nil))
(setf cursor-hunk hunk)
(with-slots (cw ch) hunk
(unless cursor-item
(setf cursor-item
(with-objects ((path (#_new QPainterPath))
(pen (#_new QPen (#_Qt::NoPen)))
(color (#_new QColor 0 180 180 64))
(brush (#_new QBrush color)))
(#_addRect path 0 0 cw ch)
(let* ((scene (#_scene (qt-hunk-widget hunk)))
(group (ensure-hunk-item-group scene hunk))
(item (#_new QGraphicsPathItem path group)))
(qt::cancel-finalization item)
(#_setPen item pen)
(#_setBrush item brush)
item))))
(#_setPos cursor-item
(* x cw)
(* y ch)))
(#_setZValue cursor-item 3)))
(defmethod device-show-mark ((device qt-device) window x y time)
)
Windows
(defmethod device-next-window ((device qt-device) window)
(device-hunk-window (device-hunk-next (window-hunk window))))
(defmethod device-previous-window ((device qt-device) window)
(device-hunk-window (device-hunk-previous (window-hunk window))))
(defvar *currently-selected-hunk* nil)
(defmethod device-delete-window ((device qt-device) window)
(let* ((hunk (window-hunk window))
(prev (device-hunk-previous hunk))
(next (device-hunk-next hunk))
(device (device-hunk-device hunk))
(group (hunk-item-group hunk)))
(when group
(when (eq hunk (device-cursor-hunk device))
(setf (device-cursor-item device) nil))
(setf (hunk-native-widget-item hunk) nil)
(with-slots (itab) hunk
(fill itab nil))
(#_delete group))
(setf (device-hunk-next prev) next)
(setf (device-hunk-previous next) prev)
(let ((buffer (window-buffer window)))
(setf (buffer-windows buffer) (delete window (buffer-windows buffer))))
(let ((new-lines (device-hunk-height hunk)))
(declare (fixnum new-lines))
(cond ((eq hunk (device-hunks (device-hunk-device next)))
(incf (device-hunk-height next) new-lines)
(incf (device-hunk-text-height next) new-lines)
(let ((w (device-hunk-window next)))
(hi::change-window-image-height w (+ new-lines (window-height w)))))
(t
(incf (device-hunk-height prev) new-lines)
(incf (device-hunk-position prev) new-lines)
(incf (device-hunk-text-height prev) new-lines)
(incf (device-hunk-text-position prev) new-lines)
(let ((w (device-hunk-window prev)))
(hi::change-window-image-height w (+ new-lines (window-height w)))))))
(when (eq hunk (device-hunks device))
(setf (device-hunks device) next)))
(setf *currently-selected-hunk* nil)
(setf hi::*screen-image-trashed* t))
(defmethod device-make-window ((device qt-device)
start modelinep window font-family
ask-user x y width height proportion)
(declare (ignore window font-family ask-user x y width height))
(let* ((old-window (current-window))
(victim (window-hunk old-window))
(text-height (device-hunk-text-height victim))
(availability (if modelinep (1- text-height) text-height)))
(when (> availability 1)
(let* ((new-lines (truncate (* availability proportion)))
(old-lines (- availability new-lines))
(pos (device-hunk-position victim))
(new-height (if modelinep (1+ new-lines) new-lines))
(new-text-pos (if modelinep (1- pos) pos))
(widget (qt-hunk-widget (window-hunk *current-window*)))
(new-hunk (make-instance 'qt-hunk
:position pos
:height new-height
:text-position new-text-pos
:text-height new-lines
:device device
:widget widget))
(new-window (internal-make-window :hunk new-hunk)))
(with-object (metrics (#_new QFontMetrics *font*))
(setf (slot-value new-hunk 'cw) (+ 0 (#_width metrics "m"))
(slot-value new-hunk 'ch) (+ 2 (#_height metrics))))
(setf (device-hunk-window new-hunk) new-window)
(let* ((old-text-pos-diff (- pos (device-hunk-text-position victim)))
(old-win-new-pos (- pos new-height)))
(declare (fixnum old-text-pos-diff old-win-new-pos))
(setf (device-hunk-height victim)
(- (device-hunk-height victim) new-height))
(setf (device-hunk-text-height victim) old-lines)
(setf (device-hunk-position victim) old-win-new-pos)
(setf (device-hunk-text-position victim)
(- old-win-new-pos old-text-pos-diff)))
(hi::setup-window-image start new-window new-lines
(window-width old-window))
(prepare-window-for-redisplay new-window)
(when modelinep
(setup-modeline-image (line-buffer (mark-line start)) new-window))
(hi::change-window-image-height old-window old-lines)
(shiftf (device-hunk-previous new-hunk)
(device-hunk-previous (device-hunk-next victim))
new-hunk)
(shiftf (device-hunk-next new-hunk) (device-hunk-next victim) new-hunk)
(setf *currently-selected-hunk* nil)
(setf hi::*screen-image-trashed* t)
new-window))))
(defmethod resize-event ((widget hunk-widget) resize-event)
(call-next-qmethod)
#+nil (#_setMaximumWidth *tabs* (#_width wrapper))
(update-full-screen-items widget)
(hi::enlarge-device (current-device)
(recompute-hunk-widget-height widget))
(hi::internal-redisplay))
(defvar *standard-column-width* 80)
(defun standard-width-in-pixels ()
(with-object (metrics (#_new QFontMetrics *font*))
(+ (* *standard-column-width* (#_width metrics "m"))
;; leave space for the gutter on the left side
;; (but not the right side, so that the column width is cut off cleanly)
*gutter*)))
(defun offset-on-each-side (widget)
(if (centerize-widget-p widget)
(let ((white-width (standard-width-in-pixels))
(full-width (#_width widget)))
(max 0.0d0 (/ (- full-width white-width) 2.0d0)))
0.0d0))
(defmethod device-beep ((device qt-device) stream)
)
(defclass qt-editor-input (editor-input)
())
(defvar *alt-is-meta* t)
(defvar *qt-initialized-p* nil)
(defmethod context-menu-event ((instance hunk-widget) event)
;; (call-next-qmethod)
(let ((menu (#_new QMenu)))
(add-menus menu)
(#_exec menu (#_globalPos event))))
(defmethod key-press-event ((instance hunk-widget) event)
;; (call-next-qmethod)
(hi::q-event *editor-input* (qevent-to-key-event event)))
(defun parse-modifiers (event)
(let ((mods (#_modifiers event)))
(logior (if (logtest mods
(qt::primitive-value (#_Qt::ControlModifier)))
(hemlock-ext:key-event-bits #k"control-a")
0)
(if (or (logtest mods
(qt::primitive-value (#_Qt::MetaModifier)))
(and *alt-is-meta*
(logtest mods
(qt::primitive-value (#_Qt::AltModifier)))))
(hemlock-ext:key-event-bits #k"meta-a")
0))))
(defun parse-key (event)
(let ((k (#_key event)))
(cond
((or (eql k (primitive-value (#_Qt::Key_Return)))
(eql k (primitive-value (#_Qt::Key_Enter))))
(hemlock-ext:key-event-keysym #k"Return"))
((eql k (primitive-value (#_Qt::Key_Tab)))
(hemlock-ext:key-event-keysym #k"tab"))
((eql k (primitive-value (#_Qt::Key_Escape)))
(hemlock-ext:key-event-keysym #k"Escape"))
((eql k (primitive-value (#_Qt::Key_Backspace)))
(hemlock-ext:key-event-keysym #k"Backspace"))
((eql k (primitive-value (#_Qt::Key_Delete)))
(hemlock-ext:key-event-keysym #k"delete"))
((eql k (primitive-value (#_Qt::Key_Space)))
(hemlock-ext:key-event-keysym #k"space"))
(t
nil))))
(defun qevent-to-key-event (event)
(let* ((text (map 'string
(lambda (c)
(if (< (char-code c) 32)
(code-char (+ 96 (char-code c)))
c))
(#_text event)))
(mask (parse-modifiers event))
(keysym (or (parse-key event)
(hemlock-ext::name-keysym text))))
(when keysym
(hemlock-ext:make-key-event keysym mask))))
(defmethod get-key-event
((stream qt-editor-input) &optional ignore-abort-attempts-p)
(hi::%editor-input-method stream ignore-abort-attempts-p))
(defun in-main-qthread-p ()
(and hi::*in-the-editor*
(typep (current-device) 'qt-device)))
(defmethod hi::dispatch-events-with-backend ((backend (eql :qt)))
;; The whole *INTERESTING-EVENT-RECEIVED* business is here to prevent
;; calling into INTERNAL-REDISPLAY too often (which is particularly
;; bad because even no-op redisplay is currently expensive enough to
;; be noticable, but would seem suboptimal in any case).
;;
;; #_processEvents as called here is already a blocking call, but
apparently has a timeout event somewhere that is set to two
;; seconds. As a result, the redisplay loop would call us to block,
only to enter INTERNAL - REDISPLAY again after 2s , even though no
;; events have been received that are relevant to redisplay.
;;
;; The workaround is to simply go back into Qt until a signal or
;; method has indicated that we did something which might have
affected Hemlock state .
;;
;; On my machine, this makes the difference between hemlock.qt always
showing up with 1 % CPU usage in top , and not showing up .
;;
;; Note that processEvents has flags to inhibit processing of certain
;; events, which end up matching our relevancy test (user input and
;; socket stuff), but they are only useful in the opposite situation
;; of not wanting to block, and briefly wanting to ignore those kinds
;; of events.
(assert (not *processing-events-p*))
(setf *interesting-event-received* nil)
(let ((*processing-events-p* t))
(iter (until *interesting-event-received*)
(#_processEvents (#_QAbstractEventDispatcher::instance)
(#_QEventLoop::WaitForMoreEvents)))))
(defmethod hi::dispatch-events-no-hang-with-backend ((backend (eql :qt)))
(assert (not *processing-events-p*))
(let ((*processing-events-p* t))
(#_processEvents (#_QAbstractEventDispatcher::instance)
(#_QEventLoop::AllEvents))))
(defmethod unget-key-event (key-event (stream qt-editor-input))
(hi::un-event key-event stream))
(defmethod clear-editor-input ((stream qt-editor-input))
;; hmm?
)
(defmethod listen-editor-input ((stream qt-editor-input))
(hi::input-event-next (hi::editor-input-head stream)))
(defun make-hemlock-widget ()
(let* ((vbox (#_new QVBoxLayout))
(tabs (#_new QTabBar))
(main (make-instance 'hunk-widget
:centerize t
:paint-margin t))
(font
(let ((font (#_new QFont)))
(#_fromString font *font-family*)
(#_setPointSize font *font-size*)
font))
(*font* font)
(font (progn (restore-font) *font*))
(*modeline-font*
(let ((font (#_new QFont)))
(#_fromString font *modeline-font-family*)
(#_setPointSize font (#_pointSize *font*))
font)))
(#_addWidget vbox tabs)
(#_hide tabs)
(let ((main-stack (#_new QStackedWidget)))
(setf *main-stack* main-stack)
(setf *main-hunk-widget* main)
(#_addWidget vbox main-stack)
(#_addWidget main-stack main))
(#_setFocusPolicy tabs (#_Qt::NoFocus))
(#_setSpacing vbox 0)
(#_setMargin vbox 0)
(let ((central-widget (#_new QWidget)))
(#_setLayout central-widget vbox)
(values main font *modeline-font* central-widget tabs))))
(defun add-buffer-tab-hook (buffer)
(when (in-main-qthread-p)
(#_addTab *tabs* (buffer-name buffer))))
(defun buffer-tab-index (buffer)
(dotimes (i (#_count *tabs*))
(when (equal (#_tabText *tabs* i) (buffer-name buffer))
(return i))))
(defun delete-buffer-tab-hook (buffer)
(when (in-main-qthread-p)
(let ((idx (buffer-tab-index buffer)))
(if idx
(#_removeTab *tabs* idx)
(warn "buffer tab missing")))))
(defun update-buffer-tab-hook (buffer new-name)
(when (in-main-qthread-p)
(let ((idx (buffer-tab-index buffer)))
(if idx
(#_setTabText *tabs* idx new-name)
(warn "buffer tab missing")))))
(defun set-buffer-tab-hook (buffer)
(when (in-main-qthread-p)
(let ((idx (buffer-tab-index buffer)))
(if idx
(#_setCurrentIndex *tabs* idx)
(warn "buffer tab missing")))))
(defun set-stack-widget-hook (buffer)
(when (in-main-qthread-p)
(#_setCurrentWidget *main-stack*
*main-hunk-widget*)))
(add-hook hemlock::make-buffer-hook 'add-buffer-tab-hook)
(add-hook hemlock::delete-buffer-hook 'delete-buffer-tab-hook)
(add-hook hemlock::buffer-name-hook 'update-buffer-tab-hook)
(add-hook hemlock::set-buffer-hook 'set-buffer-tab-hook)
(add-hook hemlock::set-buffer-hook 'set-stack-widget-hook)
(defun splitter-sizes (splitter)
(qt::qlist-to-list (#_sizes splitter)))
(defun (setf splitter-sizes) (newval splitter)
(#_setSizes splitter (qt::qlist-append (qt::make-qlist<int>) newval))
newval)
(defun resize-echo-area (nlines backgroundp)
(setf (device-hunk-height (window-hunk *echo-area-window*))
nlines)
(setf (device-hunk-text-height (window-hunk *echo-area-window*))
nlines)
(hi::change-window-image-height *echo-area-window* nlines)
(setf (qt-hunk-want-background-p (window-hunk *echo-area-window*))
backgroundp)
(redisplay-all)
#+nil
(let* ((widget (or widget
(qt-hunk-widget (window-hunk *echo-area-window*))))
(splitter (#_centralWidget (#_window widget)))
(new-height (with-object (metrics (#_new QFontMetrics *font*))
(+ (* 2 *gutter*)
(* nlines (#_height metrics))))))
(#_setMinimumHeight widget 1)
(destructuring-bind (top bottom)
(splitter-sizes splitter)
(let ((diff (- new-height bottom)))
(setf (splitter-sizes splitter)
(list (- top diff) new-height))))))
(defun minimize-echo-area ()
(resize-echo-area 1 nil))
(defun enlarge-echo-area ()
(resize-echo-area 5 t))
(defun set-window-hook (new-window)
(when (in-main-qthread-p)
(cond
((eq new-window *echo-area-window*)
(enlarge-echo-area))
((eq *current-window* *echo-area-window*)
(minimize-echo-area)))))
(add-hook hemlock::set-window-hook 'set-window-hook)
(defun signal-receiver (function)
(make-instance 'signal-receiver
:function (lambda (&rest args)
(setf *interesting-event-received* t)
(apply function args))))
(defun connect (source signal cont)
(let ((receiver (signal-receiver cont)))
(push receiver *do-not-gc-list*)
(#_QObject::connect source signal receiver (QSLOT "invoke()"))))
(defun connect/int (source signal cont)
(let ((receiver (signal-receiver cont)))
(push receiver *do-not-gc-list*)
(#_QObject::connect source signal receiver (QSLOT "invoke(int)"))))
(defun connect/string (source signal cont)
(let ((receiver (signal-receiver cont)))
(push receiver *do-not-gc-list*)
(#_QObject::connect source
signal
receiver
(QSLOT "invoke(const QString&)"))))
(defun connect/boolean (source signal cont)
(let ((receiver (signal-receiver cont)))
(push receiver *do-not-gc-list*)
(#_QObject::connect source
signal
receiver
(QSLOT "invoke(bool)"))))
(defclass signal-receiver ()
((function :initarg :function
:accessor signal-receiver-function))
(:metaclass qt-class)
(:qt-superclass "QObject")
(:slots ("invoke()" (lambda (this &rest args)
(apply (signal-receiver-function this)
args)))
("invoke(int)" (lambda (this &rest args)
(apply (signal-receiver-function this)
args)))
("invoke(const QString&)" (lambda (this &rest args)
(apply (signal-receiver-function this)
args)))
("invoke(bool)" (lambda (this &rest args)
(apply (signal-receiver-function this)
args)))))
(defmethod initialize-instance :after ((instance signal-receiver) &key)
(new instance))
(defclass command-action-receiver ()
((command :initarg :command
:accessor command-action-receiver-command))
(:metaclass qt-class)
(:qt-superclass "QWidget")
(:slots ("triggered()" (lambda (this)
(funcall (command-function
(command-action-receiver-command
this))
nil)
(hi::internal-redisplay)))))
(defmethod initialize-instance :after ((instance command-action-receiver) &key)
(new instance))
(defvar *do-not-gc-list*)
(defun add-command-action (menu command &optional suffix)
(let* ((receiver
(make-instance 'command-action-receiver
:command (getstring command hi::*command-names*)))
(action
(#_addAction
menu
(concatenate 'string command suffix)
receiver
(qslot "triggered()"))))
(push action *do-not-gc-list*)
(push receiver *do-not-gc-list*)))
#+(or)
(defun control-g-handler (&rest *)
(let ((widget *echo-hunk-widget*))
(cond
((#_hasFocus widget)
(hi::q-event *editor-input* #k"control-g"))
(t
(setf *steal-focus-out* t)
(#_setFocus *echo-hunk-widget*)
(clear-echo-area)
(message "Focus restored. Welcome back to Hemlock.")))))
(defun control-g-handler (&rest *)
(setf *steal-focus-out* t)
(#_setFocus *main-hunk-widget*)
(clear-echo-area)
(hi::q-event *editor-input* #k"control-g"))
(defvar *invoke-later-thunks*)
(defvar *invoke-later-timer*)
(defmethod hi::invoke-later ((backend (eql :qt)) fun)
(push fun *invoke-later-thunks*)
(#_setSingleShot *invoke-later-timer* t)
(#_start *invoke-later-timer*))
(defun process-invoke-later-thunks ()
(iter (while *invoke-later-thunks*)
(funcall (pop *invoke-later-thunks*))))
(defmethod hi::backend-init-raw-io ((backend (eql :qt)) display)
(declare (ignore display))
(setf hi::*editor-input* (make-instance 'qt-editor-input)))
(defun add-menus (parent)
(let ((menu (#_addMenu parent "File")))
(add-command-action menu "Find File")
(add-command-action menu "Save File")
(#_addSeparator menu)
(add-command-action menu "Write File")
(#_addSeparator menu)
(add-command-action menu "Save All Files and Exit"))
(let ((menu (#_addMenu parent "View")))
(add-command-action menu "Toggle Menu Bar")
(add-command-action menu "Toggle Tab Bar")
(add-command-action menu "Toggle Full Screen"))
(let ((menu (#_addMenu parent "Lisp")))
(add-command-action menu "Start Slave Thread")
(add-command-action menu "Start Slave Process")
(add-command-action menu "List Slaves"))
(let ((menu (#_addMenu parent "Buffer")))
(add-command-action menu "Bufed"))
(let ((menu (#_addMenu parent "Browser")))
(add-command-action menu "Browse")
(add-command-action menu "Browse Qt Class")
(add-command-action menu "CLHS")
(add-command-action menu "Google")
(#_addSeparator menu)
(add-command-action menu "Enter Foreign Widget")
(add-command-action menu "Leave Foreign Widget"))
(let ((menu (#_addMenu parent "Preferences")))
(add-command-action menu "Select Font")
(#_addSeparator menu)
(add-command-action menu "Save Window Geometry")
(add-command-action menu "Restore Window Geometry")))
(defmethod hi::%init-screen-manager ((backend-type (eql :qt)) (display t))
(declare (ignore display))
(let (main central-widget)
(setf (values main *font* *modeline-font* central-widget *tabs*)
(make-hemlock-widget))
(let* ((device (make-instance 'qt-device))
(window (#_new QMainWindow)))
(setf (device-name device) "Qt"
(device-bottom-window-base device) nil)
keep the QMainWindow from being GCed :
(setf (device-main-window device) window)
(#_setWindowTitle window "Hemlock")
(#_setCentralWidget window central-widget)
(add-menus (#_menuBar window))
(#_hide (#_menuBar window))
(setf hi::*real-editor-input* *editor-input*)
(set-up-qt-hunks device main)
(dolist (buffer hi::*buffer-list*)
(unless (eq buffer *echo-area-buffer*)
(add-buffer-tab-hook buffer)))
(connect/int *tabs*
(qsignal "currentChanged(int)")
(lambda (index)
(change-to-buffer (hemlock-ext::find-buffer (#_tabText *tabs* index)))))
(with-object (key (#_new QKeySequence "Ctrl+G"))
(connect (#_new QShortcut key (#_window *main-hunk-widget*))
(QSIGNAL "activated()")
'control-g-handler))
#+nil
(#_setMinimumHeight echo
(with-object (metrics (#_new QFontMetrics *font*))
(+ (* 2 *gutter*) (#_height metrics))))
(restore-window-geometry window)
(#_show window)
;; (minimize-echo-area echo)
;; undo the minimum set before, so that it's only a default
;; (fixme: it still overrides a saved geometry):
#+nil (#_setMinimumSize widget 0 0)
(setf *notifier* (make-instance 'qt-repl::repl-notifier))
(setf *executor* (make-instance 'qt-repl::repl-executer
:notifier *notifier*)))))
(defmethod hi::make-event-loop ((backend (eql :qt)))
'qt-event-loop)
(defmethod hi::invoke-with-existing-event-loop ((backend (eql :qt)) loop fun)
(assert (eq loop 'qt-event-loop))
(hi::invoke-with-new-event-loop backend fun))
(defmethod hi::invoke-with-new-event-loop ((backend (eql :qt)) fun &aux keep)
(unless *qt-initialized-p*
HACK ! Disable SBCL 's SIGCHLD handler . I do n't know what exactly
it is doing wrong , but if SBCL sets a signal handler for this , it
;; leads to segfaults whenever a process started by Qt exits.
;;
;; It doesn't matter what the handler would do; a no-op lambda
;; already has this effect.
;;
;; [Perhaps it's due to the way Qt tries to chain call our handler,
or perhaps we are interrupting FFI code , or is it an altstack thing ?
;; I have no idea.]
#+sbcl (sb-kernel::default-interrupt sb-unix:sigchld)
(format t "Loading shared libraries [")
(let ((first t))
(dolist (module '(:qtcore :qtgui :qtnetwork :qtsvg :qtwebkit))
(if first
(setf first nil)
(write-string ", "))
(format t "~A" (string-downcase module))
(force-output)
(ensure-smoke module)))
(format t "].~%Connecting to window system...")
(force-output)
(push (make-qapplication) keep)
(format t "done.~%")
(force-output)
(setf *qt-initialized-p* t))
;; When in a slave, we need to create a QEventLoop here, otherwise
we will later . Let 's just do it unconditionally :
(push (#_new QEventLoop) keep)
(let* ((*do-not-gc-list* '())
(*invoke-later-thunks* '())
(*invoke-later-timer* (#_new QTimer))
(*interesting-event-received* nil))
(connect *invoke-later-timer*
(QSIGNAL "timeout()")
#'process-invoke-later-thunks)
#-sbcl (funcall fun)
#+sbcl (sb-int:with-float-traps-masked
(:overflow :invalid :divide-by-zero)
(funcall fun))))
Keysym translations
(defun qt-character-keysym (gesture)
(cond
# # # hmm
(hemlock-ext:key-event-keysym #k"Return"))
# # # hmm
(hemlock-ext:key-event-keysym #k"Tab"))
((eql gesture #\Backspace)
(hemlock-ext:key-event-keysym #k"Backspace"))
((eql gesture #\Escape)
(hemlock-ext:key-event-keysym #k"Escape"))
((eql gesture #\rubout)
(hemlock-ext:key-event-keysym #k"delete"))
(t
(char-code gesture))))
;;;;
(defun effective-hunk-widget-width (widget)
(- (#_width widget) (offset-on-each-side widget)))
(defun probe-namestring (x)
(when (and x (probe-file x))
(etypecase x
(string x)
(pathname (namestring x)))))
(defun find-background-svg ()
(etypecase hemlock:*background-image*
((or string pathname)
(or (probe-namestring hemlock:*background-image*)
(progn
(format t "Specified background image not found: ~A~%"
hemlock:*background-image*)
nil)))
((eql :auto)
(or (probe-namestring (merge-pathnames ".hemlock/background.svg"
(user-homedir-pathname)))
(probe-namestring (merge-pathnames "background.svg"
(hi::installation-directory)))))
(null)))
(defun update-full-screen-items (widget)
(when t ;;(qt-hunk-want-background-p hunk)
(with-slots (background-pixmap background-pixmap-item)
widget
(setf background-pixmap
(let ((file (find-background-svg)))
(if file
(let ((pixmap (#_new QPixmap
(#_width widget)
(#_height widget))))
(with-objects
((renderer (#_new QSvgRenderer file))
(painter (#_new QPainter pixmap)))
(#_render renderer painter)
(#_end painter)
pixmap))
nil)))
(when background-pixmap-item
(#_removeItem (#_scene background-pixmap-item) background-pixmap-item)
(setf background-pixmap-item nil))
(when background-pixmap
(setf background-pixmap-item
(#_addPixmap (#_scene widget)
background-pixmap))
(#_setZValue background-pixmap-item -2)
#+nil (#_setBackgroundBrush
(#_scene widget)
(#_new QBrush background-pixmap)))))
(with-slots (white-item-1 white-item-2)
widget
(when white-item-1
(#_removeItem (#_scene white-item-1) white-item-1)
(setf white-item-1 nil))
(when white-item-2
(#_removeItem (#_scene white-item-2) white-item-2)
(setf white-item-2 nil))
(let ((offset (truncate (offset-on-each-side widget))))
(with-object (~)
(setf white-item-1
(#_addRect (#_scene widget)
(#_new QRectF
offset
0
(- (#_width widget) (* 2 offset))
(#_height widget))
(~ (#_new QPen (#_Qt::NoPen)))
(~ (#_new QBrush
(~ (#_new QBrush (~ (#_new QColor 255 255 255 210)))))))))
(with-object (~)
(setf white-item-2
(#_addRect (#_scene widget)
(~ (#_new QRectF
(- (#_width widget) offset)
0
offset
(#_height widget)))
(~ (#_new QPen (#_Qt::NoPen)))
(~ (#_new QBrush
(~ (#_new QBrush (~ (#_new QColor 255 255 255 180))))))))))
(#_setZValue white-item-1 -1)
(#_setZValue white-item-2 -1)))
(defun old-resize-junk ()
#+nil
(let ((window (device-hunk-window hunk)))
;;
;; Nuke all the lines in the window image.
(unless (eq (cdr (window-first-line window)) the-sentinel)
(shiftf (cdr (window-last-line window))
(window-spare-lines window)
(cdr (window-first-line window))
the-sentinel))
# # # ( setf ( bitmap - hunk - start hunk ) ( cdr ( window - first - line window ) ) )
;;
;; Add some new spare lines if needed. If width is greater,
;; reallocate the dis-line-chars.
(let* ((res (window-spare-lines window))
(new-width
(max 5 (floor (- (effective-hunk-widget-width (qt-hunk-widget hunk))
(* 2 *gutter*))
(slot-value hunk 'cw))))
(new-height
(max 2 (1- (floor (- (#_height (qt-hunk-widget hunk))
(* 2 *gutter*))
(slot-value hunk 'ch)))))
(width (length (the simple-string (dis-line-chars (car res))))))
(declare (list res))
(when (> new-width width)
(setq width new-width)
(dolist (dl res)
(setf (dis-line-chars dl) (make-string new-width))))
(setf (window-height window) new-height (window-width window) new-width)
(do ((i (- (* new-height 2) (length res)) (1- i)))
((minusp i))
(push (make-window-dis-line (make-string width)) res))
(setf (window-spare-lines window) res)
;;
Force modeline update .
(let ((ml-buffer (window-modeline-buffer window)))
(when ml-buffer
(let ((dl (window-modeline-dis-line window))
(chars (make-string new-width))
(len (min new-width (window-modeline-buffer-len window))))
(setf (dis-line-old-chars dl) nil)
(setf (dis-line-chars dl) chars)
(replace chars ml-buffer :end1 len :end2 len)
(setf (dis-line-length dl) len)
(setf (dis-line-flags dl) changed-bit)))))
;;
;; Prepare for redisplay.
(setf (window-tick window) (tick))
(update-window-image window)
(when (eq window *current-window*) (maybe-recenter-window window))
hunk))
(defmethod hi::device-enlarge-window ((device qt-device) window offset)
(let* ((hunk (window-hunk window))
(victim
(cond
((eq hunk (device-hunks (device-hunk-device hunk)))
we 're the first hunk
(let ((victim (device-hunk-next hunk)))
(when (eq hunk victim)
... the first and only hunk
(editor-error "Cannot enlarge only window"))
;; move the victim down
(incf (device-hunk-position hunk) offset)
(incf (device-hunk-text-position hunk) offset)
victim))
(t
we 're not first hunk , so there is a victim in front of us
;; move us up
(let ((victim (device-hunk-previous hunk)))
(decf (device-hunk-position victim) offset)
(decf (device-hunk-text-position victim) offset)
victim)))))
;; bump up our height
(incf (device-hunk-height hunk) offset)
(incf (device-hunk-text-height hunk) offset)
;; make the victim smaller
(decf (device-hunk-height victim) offset)
(decf (device-hunk-text-height victim) offset)
;; housekeeping
(let ((w (device-hunk-window victim)))
(hi::change-window-image-height w (- offset (window-height w))))
(let ((w (device-hunk-window hunk)))
(hi::change-window-image-height w (+ offset (window-height w))))
(setf hi::*screen-image-trashed* t)))
(defmethod hi::enlarge-device
((device qt-device) offset)
#+nil (hi::set-up-screen-image device)
(let ((first (device-hunks device)))
(incf (device-hunk-position first) offset)
(incf (device-hunk-text-position first) offset)
(incf (device-hunk-height first) offset)
(incf (device-hunk-text-height first) offset)
(let ((w (device-hunk-window first)))
(hi::change-window-image-height w (+ offset (window-height w))))
(do ((hunk (device-hunk-next first) (device-hunk-next hunk)))
((eq hunk first))
(incf (device-hunk-position hunk) offset)
(incf (device-hunk-text-position hunk) offset))
(let ((hunk (window-hunk *echo-area-window*)))
(incf (device-hunk-position hunk) offset)
(incf (device-hunk-text-position hunk) offset))
(setf hi::*screen-image-trashed* t)))
(defun recompute-hunk-widget-height (widget)
(let ((new (with-object (metrics (#_new QFontMetrics *font*))
(max 2 (floor (- (#_height widget)
(* 2 *gutter*))
(+ 2 (#_height metrics))))))
(old (hunk-widget-height widget)))
(setf (hunk-widget-height widget) new)
(- new old)))
(defun set-up-qt-hunks (device main-widget)
(progn ;;with-object (metrics (#_new QFontMetrics *font*))
(let* ((buffer *current-buffer*)
(start (buffer-start-mark buffer))
(first (cons dummy-line the-sentinel))
#+nil
(width (max 5 (floor (- (#_width (qt-hunk-widget hunk))
(* 2 *gutter*))
(+ 0 (#_width metrics "m")))))
(height (recompute-hunk-widget-height main-widget))
(echo-height #+nil (value hemlock::echo-area-height)
1)
(main-lines (- height echo-height 1)) ;-1 for echo modeline.
(main-text-lines (1- main-lines)) ;also main-modeline-pos
)
(declare (ignorable start first))
(setf (buffer-windows buffer) nil
(buffer-windows *echo-area-buffer*) nil)
(let* ((window (hi::internal-make-window))
(last-text-line (1- main-text-lines))
(hunk (make-instance 'qt-hunk
:position main-lines ;main-text-lines
:height main-lines
:text-position last-text-line
:text-height main-text-lines
:widget main-widget)))
(redraw-widget device window hunk buffer t)
(setf *current-window* window)
#+nil (push window (slot-value device 'windows))
(setf (device-hunk-previous hunk) hunk)
(setf (device-hunk-next hunk) hunk)
(setf (device-hunks device) hunk))
(let ((echo-window (hi::internal-make-window))
(echo-hunk (make-instance 'qt-hunk
:position (1- height)
:height echo-height
:text-position (- height 2)
:text-height echo-height
:widget main-widget)))
(redraw-widget device echo-window echo-hunk *echo-area-buffer* nil)
(setf *echo-area-window* echo-window)))))
(defvar *font-family*
"Fixed [Misc]"
#+nil "Courier New")
(defvar *modeline-font-family*
"Sans")
(defvar *font-size*
10)
(defun redraw-widget (device window hunk buffer modelinep)
(setf (slot-value (qt-hunk-widget hunk) 'hunk)
hunk)
(let* ((start (buffer-start-mark buffer))
(first (cons dummy-line the-sentinel))
(font *font*)
width height)
(with-object (metrics (#_new QFontMetrics font))
(setf
(slot-value hunk 'cw) (+ 0 (#_width metrics "m"))
(slot-value hunk 'ch) (+ 2 (#_height metrics))
width (max 5 (floor (- (#_width (qt-hunk-widget hunk))
(* 2 *gutter*))
(slot-value hunk 'cw)))
height (max 2 (floor (- (#_height (qt-hunk-widget hunk))
(* 2 *gutter*))
(slot-value hunk 'ch)))
(device-hunk-window hunk) window
;; (device-hunk-position hunk) 0
;; (device-hunk-height hunk) height
(device-hunk-next hunk) nil
(device-hunk-previous hunk) nil
(device-hunk-device hunk) device
(window-tick window) -1 ; The last time this window was updated.
(window-%buffer window) buffer ; buffer displayed in this window.
(window-height window) (device-hunk-height hunk) ; Height of window in lines.
(window-width window) width ; Width of the window in characters.
The charpos of the first char displayed .
(window-first-line window) first ; The head of the list of dis-lines.
(window-last-line window) the-sentinel ; The last dis-line displayed.
The first changed dis - line on last update .
(window-last-changed window) first ; The last changed dis-line.
(window-spare-lines window) nil ; The head of the list of unused dis-lines
(window-hunk window) hunk ; The device hunk that displays this window.
(window-display-start window) (copy-mark start :right-inserting) ; first character position displayed
(window-display-end window) (copy-mark start :right-inserting) ; last character displayed
(window-point window) (copy-mark (buffer-point buffer)) ; Where the cursor is in this window.
(window-modeline-dis-line window) nil ; Dis-line for modeline display.
(window-modeline-buffer window) nil ; Complete string of all modeline data.
(window-modeline-buffer-len window) nil ; Valid chars in modeline-buffer.
(window-display-recentering window) nil ;
)
(setup-dis-lines window width height)
(when modelinep
(setup-modeline-image buffer window))
(push window (buffer-windows buffer))
(push window *window-list*)
(hi::update-window-image window))))
(defun setup-dis-lines (window width height)
(do ((i (- height) (1+ i))
(res ()
(cons (make-window-dis-line (make-string width)) res)))
((= i height)
(setf (window-spare-lines window) res))))
;;;; Redisplay
(defvar *tick* 0)
;;; (defun dis-line-rect (hunk dl)
;;; (let* ((h (slot-value hunk 'ch))
;;; (w (slot-value hunk 'cw))
;;; (xo *gutter*)
;;; (yo *gutter*)
( ( dis - line - chars dl ) )
( start 0 ) ; ...
;;; (end (dis-line-length dl)) ;...
;;; (x1 (+ xo (* w start)))
;;; (y1 (+ 1 yo (* (dis-line-position dl) h)))
;;; (m (#_new QFontMetrics *font*))
( ww ( # _ width m ( subseq chrs start end ) ) )
;;; (hh (#_ascent m)))
( # _ new QRect x1 y1 ww ( * 2 hh ) ) ) )
#+(or)
(defun dis-line-rect (hunk dl)
(nth-line-rect hunk (dis-line-position dl)))
#+(or)
(defun nth-line-rect (hunk i)
(let* ((x *gutter*)
(y (+ *gutter* (* i (slot-value hunk 'ch))))
(w (- (#_width (qt-hunk-widget hunk))
(ceiling (offset-on-each-side (qt-hunk-widget hunk)))))
(h (slot-value hunk 'ch)))
(#_new QRect x y w h)))
#+(or)
(defun cursor-rect (hunk x y)
(with-slots (cw ch) hunk
(when (and x y cw ch)
(#_new QRect
(+ *gutter* (* x cw))
(+ *gutter* (* y ch))
(1+ cw) (1+ ch)))))
(defun clear-line-items (scene hunk position)
(declare (ignore scene))
(dolist (old-item (line-items hunk position))
(#_delete old-item))
(setf (line-items hunk position) nil))
(defun update-modeline-items (scene hunk dl)
(let* ((position (+ (dis-line-position dl)
;; fixme?
(device-hunk-text-height hunk)))
(h (slot-value hunk 'ch))
#+nil (w (slot-value hunk 'cw))
(widget (qt-hunk-widget hunk))
(offset (truncate (offset-on-each-side widget)))
(chrs (dis-line-chars dl))
(y (* position h)))
(unless (zerop (dis-line-flags dl))
(setf (hi::dis-line-tick dl) (incf *tick*)))
(clear-line-items scene hunk position)
(with-objects ((pen (#_new QPen (#_Qt::NoPen)))
(color (#_new QColor 255 255 255 210))
(oops (#_new QBrush color))
(brush (#_new QBrush oops))
(rect (#_new QRectF
(- (+ offset *gutter*))
y
(#_width widget)
h)))
(let ((item
(#_new QGraphicsRectItem
rect
(ensure-hunk-item-group scene hunk))))
(qt::cancel-finalization item)
(#_setPen item pen)
(#_setBrush item brush)
(#_setZValue item 0)
(push item (line-items hunk position))))
(let ((len (dis-line-length dl)))
(push (add-chunk-item scene
hunk
chrs
0
(+ 1 y)
0
len
0
*modeline-font*)
(line-items hunk position))))
(setf (dis-line-flags dl) unaltered-bits (dis-line-delta dl) 0))
(defun update-line-items (scene hunk dl)
(let* ((position (dis-line-position dl))
(h (slot-value hunk 'ch))
(w (slot-value hunk 'cw))
;; (widget (qt-hunk-widget hunk))
;; (offset (truncate (offset-on-each-side widget)))
(chrs (dis-line-chars dl))
(y (* position h)))
(unless (zerop (dis-line-flags dl))
(setf (hi::dis-line-tick dl) (incf *tick*)))
(clear-line-items scene hunk position)
;;
(handler-case
(let* ((no (hi::tag-line-number (hi::dis-line-tag dl)))
(str (princ-to-string no)))
(push (add-chunk-item scene hunk str
(- (+ (* w (length str)) (* 2 *gutter*)))
(+ 1 y)
0
(length str)
(if (zerop (mod no 5))
16
15))
(line-items hunk position)))
(error (c) (warn "~A" c)))
;; font changes
(let ((start 0)
(font 0)
(end (dis-line-length dl))
(changes (dis-line-font-changes dl)))
(iter
(cond ((null changes)
(push (add-chunk-item scene hunk chrs
(* w start)
(+ 1 y)
start
end
font)
(line-items hunk position))
(return))
(t
(push (add-chunk-item scene hunk chrs
(* w start)
(+ 1 y)
start
(font-change-x changes)
font)
(line-items hunk position))
(setf font (font-change-font changes)
start (font-change-x changes)
changes (font-change-next changes)))))))
(setf (dis-line-flags dl) unaltered-bits (dis-line-delta dl) 0))
(defun clear-all-line-items (scene hunk)
(with-slots (itab) hunk
(iter
(for i from 0)
(for items in-vector itab)
(dolist (old-item items)
(#_removeItem scene old-item))
(setf (elt itab i) nil))))
(defun reset-hunk-background (window hunk)
(declare (ignore window))
(let* ((widget (qt-hunk-widget hunk))
(scene (#_scene widget)))
(dolist (item (hunk-background-items hunk))
(#_delete item))
(setf (hunk-background-items hunk)
(when (qt-hunk-want-background-p hunk)
(let ((offset (offset-on-each-side widget)))
(with-objects
((pen1 (#_new QPen (#_Qt::SolidLine)))
(pen2 (#_new QPen (#_Qt::NoPen)))
(color1 (#_new QColor 255 255 255 210))
(color2 (#_new QColor 255 255 255 128))
(oops1 (#_new QBrush color1))
(oops2 (#_new QBrush color2))
(brush1 (#_new QBrush oops1))
(brush2 (#_new QBrush oops2))
(rect1 (#_new QRectF
(- (+ (* 2 *gutter*) (truncate offset 2)))
(- *gutter*)
(+ (- (#_width widget) offset)
(* 2 *gutter*))
(+ (* (slot-value hunk 'ch)
(device-hunk-height hunk))
(* 2 *gutter*))))
(rect2 (#_new QRectF rect1)))
(#_setColor pen1 (#_new QColor (#_Qt::black)))
(#_adjust rect2 -5 -5 5 5)
(let* ((group (ensure-hunk-item-group scene hunk))
(item1 (#_new QGraphicsRectItem rect1 group))
(item2 (#_new QGraphicsRectItem rect2 group)))
(qt::cancel-finalization item1)
(qt::cancel-finalization item2)
(#_setPen item1 pen1)
(#_setPen item2 pen2)
(#_setBrush item1 brush1)
(#_setBrush item2 brush2)
(#_setZValue item1 1)
(#_setZValue item2 1)
(#_setZValue group 3)
(list item1 item2))))))))
Smart is n't very smart , but still much better for " a single line changed "
;; kind of situations.
(defun dumb-or-smart-redisplay (device window dumb)
(declare (ignore device))
(let* ((widget (qt-hunk-widget (window-hunk window)))
(hunk (window-hunk window))
(first (window-first-line window))
(offset (truncate (offset-on-each-side widget)))
(scene (#_scene widget)))
(when dumb
(reset-hunk-background window hunk)
(clear-all-line-items scene hunk))
(let* ((native-widget (hi::buffer-widget (window-buffer window)))
(current-item (hunk-native-widget-item hunk))
(current-widget (and current-item
(#_widget current-item))))
(unless (eq native-widget current-widget)
(let ((group (ensure-hunk-item-group scene hunk)))
(when current-item
(setf (hunk-native-widget-item hunk) nil)
(#_setWidget current-item (qt::null-qobject "QWidget"))
(#_delete current-item))
(when native-widget
(let ((item (#_new QGraphicsProxyWidget)))
(#_setParent native-widget (qt::null-qobject "QWidget"))
(#_setWidget item native-widget)
(#_setParentItem item group)
(#_setPos item (- offset) 0)
(#_setZValue item 4)
;;; (#_setAcceptHoverEvents item t)
;;; (#_setEnabled native-widget t)
(#_setFocusPolicy native-widget (#_Qt::StrongFocus))
;;; (#_setFocusProxy widget native-widget)
(#_setGeometry native-widget
(- (+ offset))
0
(- (#_width widget)
(* 2 *gutter*))
(* (slot-value hunk 'ch)
(device-hunk-text-height hunk)))
#+nil (#_setTransform item
(#_scale (#_rotate (#_new QTransform) 10)
0.75 0.75)
nil)
(setf (hunk-native-widget-item hunk) item))))))
;; "empty" lines
(let ((pos (dis-line-position (car (window-last-line window))))
(old (window-old-lines window)))
(when (and pos old)
(iter:iter (iter:for i from (1+ pos) to old)
(clear-line-items scene hunk i)))
(setf (window-old-lines window) pos))
;; render "changed" lines
(do ((i 0 (1+ i))
(dl (cdr first) (cdr dl)))
((eq dl the-sentinel)
(setf (window-old-lines window) (1- i)))
(let ((dis-line (car dl)))
;; fixme. See comment in COMPUTE-LINE-IMAGE:
(hi::sync-dis-line-tag (hi::dis-line-line dis-line) dis-line)
(when (or dumb (plusp (dis-line-flags dis-line)))
(update-line-items scene hunk dis-line))))
;; modeline
(when (window-modeline-buffer window)
(update-modeline-fields (window-buffer window) window)
(let ((dl (window-modeline-dis-line window)))
(update-modeline-items scene hunk dl)
(setf (dis-line-flags dl) unaltered-bits))
(setf (dis-line-flags (window-modeline-dis-line window))
unaltered-bits)))
;; tell the redisplay algorithm that we did our job, otherwise it
;; retries forever:
(let* ((first (window-first-line window))
;; (hunk (window-hunk window))
#+nil (device (device-hunk-device hunk)))
(setf (window-first-changed window) the-sentinel
(window-last-changed window) first)))
(defun ensure-hunk-item-group (scene hunk)
(or (hunk-item-group hunk)
(setf (hunk-item-group hunk)
(let ((g (#_new QGraphicsItemGroup)))
(#_addItem scene g)
(qt::cancel-finalization g)
g))))
(defun add-chunk-item
(scene hunk string x y start end font-color &optional (font *font*))
(let* ((item
(#_new QGraphicsSimpleTextItem (ensure-hunk-item-group scene hunk)))
(widget (qt-hunk-widget hunk))
(offset (truncate (offset-on-each-side widget))))
(qt::cancel-finalization item)
( # _ setPos ( hunk - item - group hunk ) 50 50 )
(with-objects
((t2 (#_translate (#_new QTransform)
(+ offset *gutter*)
(+ *gutter*
(progn ;; with-object (metrics (#_new QFontMetrics *font*))
(* (slot-value hunk 'ch)
(- (device-hunk-position hunk)
(device-hunk-height hunk))))))))
(#_setTransform (hunk-item-group hunk) t2 nil))
(#_setText item (subseq string start end))
(#_setFont item font)
(let ((color
(elt #( ;fg bg
#x000000 #xffffff
1 = comments
2 = backquote
3 = unquote
4 = strings
5 = quote
6 = # +
7 = # -
#x000000 #xbebebe
#xff0000 #xbebebe
#x00aa00 #xbebebe
#xffff00 #xbebebe
#x0000ff #xbebebe
#xff00ff #xbebebe
#x00ffff #xbebebe
#xbebebe #x000000
#xffffff #x000000)
(* 2 (mod font-color 17)))))
(with-objects ((color (#_new QColor
(ldb (byte 8 16) color)
(ldb (byte 8 8) color)
(ldb (byte 8 0) color)))
(brush (#_new QBrush color)))
(#_setBrush item brush)))
(#_setPos item x y)
(#_setZValue item 2)
item))
(defun make-virtual-buffer (name widget &rest args)
(let ((buffer (apply #'make-buffer name args)))
(when buffer
(setf (buffer-writable buffer) nil)
(setf (hi::buffer-widget buffer) widget)
;; (#_addWidget *main-stack* widget)
buffer)))
;;
(defcommand "Enter Foreign Widget" (p)
"" ""
(declare (ignore p))
(let ((widget (hi::buffer-widget (current-buffer))))
(unless widget
(editor-error "Not a foreign widget."))
(setf *steal-focus-out* nil)
(#_setFocus widget)
(clear-echo-area)
(message "Focus set to foreign widget. Type C-g to go back.")))
(defcommand "Leave Foreign Widget" (p)
"Like control-g-handler, except for the C-g behaviour." ""
(declare (ignore p))
(let ((main *main-hunk-widget*))
(unless (#_hasFocus main)
(setf *steal-focus-out* t)
(#_setFocus main)
(clear-echo-area)
(message "Focus restored. Welcome back to Hemlock."))))
(defcommand "Disable Steal Focus" (p)
"" ""
(declare (ignore p))
(setf *steal-focus-out* nil)
(message "Focus stealing disabled"))
(defcommand "Enable Steal Focus" (p)
"" ""
(declare (ignore p))
(setf *steal-focus-out* t)
(#_setFocus *main-hunk-widget*))
#+nil
(defcommand "Abc" (p)
"" ""
(let ((w (qt-hunk-item (window-hunk (current-window)))))
(#_setZValue w 500)
(#_setTransform (let* ((old (qt::qobject-class w))
(old-ptr (qt::qobject-pointer w))
(new (qt::find-qclass "QGraphicsItem"))
(new-ptr (qt::%cast old-ptr
(qt::unbash old)
(qt::unbash new))))
(make-instance 'qt::qobject
:class new
:pointer new-ptr))
(#_translate (if p
(#_rotate (#_scale (#_new QTransform) 0.75 0.75) 45)
(#_new QTransform)) 200 0)
nil)))
(defcommand "Toggle Tab Bar" (p)
"" ""
(#_setVisible *tabs* (not (#_isVisible *tabs*))))
(defun main-window ()
(#_window (qt-hunk-widget (window-hunk (current-window)))))
(defcommand "Toggle Menu Bar" (p)
"" ""
(let ((menubar (#_menuBar (main-window))))
(#_setVisible menubar (not (#_isVisible menubar)))))
(defcommand "Toggle Full Screen" (p)
"" ""
(let ((win (main-window)))
(if (logtest (#_windowState win)
(primitive-value (#_Qt::WindowFullScreen)))
(#_showNormal win)
(#_showFullScreen win))))
#+nil
(defcommand "Def" (p)
"" ""
(let* ((widget (#_new QWebView))
(w (#_addWidget
(#_scene (qt-hunk-widget (window-hunk (current-window))))
widget)))
(push widget *do-not-gc-list*)
(push w *do-not-gc-list*)
(#_setUrl widget (#_new QUrl ""))
#+nil (#_setZValue w 500)
#+nil (let* ((new-class (qt::find-qclass "QGraphicsItem"))
(new-ptr (qt::%cast w new-class)))
(make-instance 'qt::qobject
:class new-class
:pointer new-ptr))
(#_setTransform w
#+nil (#_translate (#_new QTransform) 1 2)
(#_translate (if p
(#_rotate (#_scale (#_new QTransform) 0.75 0.75) 45)
(#_new QTransform))
400 0)
nil)))
| null | https://raw.githubusercontent.com/bluelisp/hemlock/47e16ba731a0cf4ffd7fb2110e17c764ae757170/src/qt.lisp | lisp | -*- Mode: Lisp; indent-tabs-mode: nil -*-
(#_toString ...) fails on those pre-unmarshalled strings. But
and we need to call (#_toString) after all. This doesn't seem
ideal...
Rather than have this separately in each hunk-widget method, do
it centrally here:
interceptor, we can steal them in time.
(redisplay-all)
Must dispatch all remaining events here (but not actually block).
is built to alternate between INTERNAL-REDISPLAY and
DISPATCH-EVENTS, with the expectation that only meaningful events
like keyboard or socket interaction will make event dispatching
return. So if redisplay exited with a pending event,
editor-input-method would degenerate into a busy loop.
leave space for the gutter on the left side
(but not the right side, so that the column width is cut off cleanly)
(call-next-qmethod)
(call-next-qmethod)
The whole *INTERESTING-EVENT-RECEIVED* business is here to prevent
calling into INTERNAL-REDISPLAY too often (which is particularly
bad because even no-op redisplay is currently expensive enough to
be noticable, but would seem suboptimal in any case).
#_processEvents as called here is already a blocking call, but
seconds. As a result, the redisplay loop would call us to block,
events have been received that are relevant to redisplay.
The workaround is to simply go back into Qt until a signal or
method has indicated that we did something which might have
On my machine, this makes the difference between hemlock.qt always
Note that processEvents has flags to inhibit processing of certain
events, which end up matching our relevancy test (user input and
socket stuff), but they are only useful in the opposite situation
of not wanting to block, and briefly wanting to ignore those kinds
of events.
hmm?
(minimize-echo-area echo)
undo the minimum set before, so that it's only a default
(fixme: it still overrides a saved geometry):
leads to segfaults whenever a process started by Qt exits.
It doesn't matter what the handler would do; a no-op lambda
already has this effect.
[Perhaps it's due to the way Qt tries to chain call our handler,
I have no idea.]
When in a slave, we need to create a QEventLoop here, otherwise
(qt-hunk-want-background-p hunk)
Nuke all the lines in the window image.
Add some new spare lines if needed. If width is greater,
reallocate the dis-line-chars.
Prepare for redisplay.
move the victim down
move us up
bump up our height
make the victim smaller
housekeeping
with-object (metrics (#_new QFontMetrics *font*))
-1 for echo modeline.
also main-modeline-pos
main-text-lines
(device-hunk-position hunk) 0
(device-hunk-height hunk) height
The last time this window was updated.
buffer displayed in this window.
Height of window in lines.
Width of the window in characters.
The head of the list of dis-lines.
The last dis-line displayed.
The last changed dis-line.
The head of the list of unused dis-lines
The device hunk that displays this window.
first character position displayed
last character displayed
Where the cursor is in this window.
Dis-line for modeline display.
Complete string of all modeline data.
Valid chars in modeline-buffer.
Redisplay
(defun dis-line-rect (hunk dl)
(let* ((h (slot-value hunk 'ch))
(w (slot-value hunk 'cw))
(xo *gutter*)
(yo *gutter*)
...
(end (dis-line-length dl)) ;...
(x1 (+ xo (* w start)))
(y1 (+ 1 yo (* (dis-line-position dl) h)))
(m (#_new QFontMetrics *font*))
(hh (#_ascent m)))
fixme?
(widget (qt-hunk-widget hunk))
(offset (truncate (offset-on-each-side widget)))
font changes
kind of situations.
(#_setAcceptHoverEvents item t)
(#_setEnabled native-widget t)
(#_setFocusProxy widget native-widget)
"empty" lines
render "changed" lines
fixme. See comment in COMPUTE-LINE-IMAGE:
modeline
tell the redisplay algorithm that we did our job, otherwise it
retries forever:
(hunk (window-hunk window))
with-object (metrics (#_new QFontMetrics *font*))
fg bg
(#_addWidget *main-stack* widget)
|
(in-package :hemlock.qt)
(pushnew :qt hi::*available-backends*)
(eval-when (:compile-toplevel :load-toplevel :execute)
(unless (named-readtables:find-readtable :hemlock.qt)
(named-readtables:defreadtable :hemlock.qt
(:merge :qt)
(:dispatch-macro-char #\# #\k 'hemlock-ext::parse-key-fun))))
(named-readtables:in-readtable :hemlock.qt)
(defun enable-syntax ()
(named-readtables:in-readtable :hemlock.qt)
nil)
(defvar *settings-organization* "Hemlock")
(defvar *settings-application* "Hemlock")
(defvar *font*)
(defvar *modeline-font*)
(defvar *tabs*)
(defvar *buffers-to-tabs*)
(defvar *main-stack*)
(defvar *main-hunk-widget*)
(defvar *executor*)
(defvar *notifier*)
(defun qsettings ()
(#_new QSettings
*settings-organization*
*settings-application*))
(defun save-window-geometry (window)
(with-object (sx (qsettings))
(#_setValue sx
"geometry"
(#_new QVariant (#_saveGeometry window)))))
(defcommand "Save Window Geometry" (p)
"Save current window's geometry in Qt settings." ""
(declare (ignore p))
(save-window-geometry
(#_window (qt-hunk-widget (window-hunk (current-window))))))
(defun restore-window-geometry (window)
(with-object (sx (qsettings))
(#_restoreGeometry window
(#_toByteArray (#_value sx "geometry")))))
(defcommand "Restore Window Geometry" (p)
"Restore the current window's geometry from Qt settings." ""
(declare (ignore p))
(restore-window-geometry
(#_window (qt-hunk-widget (window-hunk (current-window))))))
(defun save-font ()
(with-object (sx (qsettings))
(format t "setting font ~A~%" (#_toString *font*))
(#_setValue sx "main font" (#_toString *font*))))
(defun qvariant-string (x)
fixme : CommonQt now string QVariants automatically , so
sometimes we get a default QVariant , which CommonQt does n't unpack ,
(if (stringp x)
x
(#_toString x)))
(defun restore-font ()
(with-object (sx (qsettings))
(let ((str (qvariant-string (#_value sx "main font"))))
(when (plusp (length str))
(setf *font*
(let ((font (#_new QFont)))
(#_fromString font str)
font))))))
(defcommand "Select Font" (p)
"Open a font dialog and change the current display font." ""
(declare (ignore p))
(let (font)
(unless (qt::with-&bool (arg nil)
(setf font (#_QFontDialog::getFont arg *font*)))
(editor-error "Font dialog cancelled"))
(setf *font* font)
(save-font)))
(defparameter *gutter* 10
"The gutter to place between between the matter in a hemlock pane and its
margin to improve legibility (sp?, damn i miss ispell).")
(defclass qt-device (device)
((cursor-hunk :initform nil
:documentation "The hunk that has the cursor."
:accessor device-cursor-hunk)
(cursor-item :initform nil
:accessor device-cursor-item)
#+nil (windows :initform nil)
(main-window :initform nil
:accessor device-main-window)))
(defun current-device ()
(device-hunk-device (window-hunk (current-window))))
(defclass qt-hunk (device-hunk)
((widget :initarg :widget
:reader qt-hunk-widget)
(native-widget-item :initform nil
:accessor hunk-native-widget-item)
(item :initarg :item
:accessor qt-hunk-item)
(item-group :initform nil
:accessor hunk-item-group)
(background-items :initform nil
:accessor hunk-background-items)
(want-background-p :initarg :want-background-p
:initform nil
:accessor qt-hunk-want-background-p)
(itab :initform (make-array 0 :adjustable t :initial-element nil))
(text-position :initarg :text-position
:accessor device-hunk-text-position)
(text-height :initarg :text-height
:accessor device-hunk-text-height)
(cw)
(ch)
(ts)))
(defun line-items (hunk i)
(with-slots (itab) hunk
(unless (< i (length itab))
(adjust-array itab (* 2 (max 1 i)) :initial-element nil))
(elt itab i)))
(defun (setf line-items) (newval hunk i)
(with-slots (itab) hunk
(unless (< i (length itab))
(adjust-array itab (* 2 (max 1 i))))
(setf (elt itab i) newval)))
(defvar *steal-focus-out* t)
(defclass hunk-widget ()
((hunk :accessor widget-hunk)
(centerize :initform nil
:initarg :centerize
:accessor centerize-widget-p)
(paint-margin :initform nil
:initarg :paint-margin
:accessor paint-widget-margin-p)
(background-pixmap :initform nil
:accessor hunk-widget-background-pixmap)
(background-pixmap-item :initform nil
:accessor hunk-widget-background-pixmap-item)
(white-item-1 :initform nil
:accessor hunk-widget-rect-pixmap-item)
(white-item-2 :initform nil
:accessor hunk-widget-rect-pixmap-item)
(height :initform 0
:accessor hunk-widget-height))
(:metaclass qt-class)
(:qt-superclass "QGraphicsView")
(:override ("resizeEvent" resize-event)
("keyPressEvent" key-press-event)
("focusOutEvent" focus-out-event)
("event" intercept-event)
("contextMenuEvent" context-menu-event)
#+nil ("mousePressEvent" mouse-press-event)
#+nil ("mouseMoveEvent" mouse-move-event)
#+nil ("mouseReleaseEvent" mouse-release-event)))
(defun focus-out-event (this event)
(declare (ignore event))
(when *steal-focus-out*
(let ((*steal-focus-out* nil))
(#_setFocus this))))
(defvar *interesting-event-received* nil
"Did Qt just receive an event that matters to Hemlock?
Anyone using :OVERRIDE or #_connect for code that might affect
Hemlock state is required to set this variable to true. See the
comment in DISPATCH-EVENTS for details.")
(defun intercept-event (instance event)
(setf *interesting-event-received* t)
Qt consumes key events for its own purposes . Using this event
(let (casted)
(cond
((and (enum= (#_type event) (#_QEvent::KeyPress))
(setf casted (make-instance 'qobject
:class (qt:find-qclass "QKeyEvent")
:pointer (qt::qobject-pointer event)))
(eql (#_key casted) (primitive-value (#_Qt::Key_Tab))))
(key-press-event instance casted)
t)
(t
(call-next-qmethod)))))
(defmethod initialize-instance :after ((instance hunk-widget) &key)
(new instance)
(#_setFocusPolicy instance (#_Qt::StrongFocus))
(#_setScene instance (#_new QGraphicsScene instance))
(#_setHorizontalScrollBarPolicy instance (#_Qt::ScrollBarAlwaysOff))
(#_setVerticalScrollBarPolicy instance (#_Qt::ScrollBarAlwaysOff)))
(defmethod device-init ((device qt-device))
)
(defmethod device-exit ((device qt-device)))
(defmacro with-timer (&body body)
`(call-with-timer (lambda () ,@body)))
(defun call-with-timer (fun)
(let ((a (get-internal-real-time)))
(multiple-value-prog1
(funcall fun)
(let ((b (get-internal-real-time)))
(format *trace-output*
" ~D"
(round(* (- b a) (/ 1000 internal-time-units-per-second))))
(force-output *trace-output*)))))
(defmethod device-smart-redisplay ((device qt-device) window)
(dumb-or-smart-redisplay device window nil))
(defmethod device-dumb-redisplay ((device qt-device) window)
(dumb-or-smart-redisplay device window t))
(defmethod device-after-redisplay ((device qt-device))
)
(defmethod device-clear ((device qt-device))
)
(defmethod device-note-read-wait ((device qt-device) on-off)
)
(defvar *processing-events-p* nil)
(defun exhaustively-dispatch-events-no-hang ()
Redisplay can lead to events being posted , and Hemlock 's event loop
(assert (not *processing-events-p*))
(let ((ev (#_QAbstractEventDispatcher::instance))
(*processing-events-p* t))
(iter (while (#_processEvents ev (#_QEventLoop::AllEvents))))))
(defmethod device-force-output ((device qt-device))
(unless *processing-events-p*
(exhaustively-dispatch-events-no-hang)))
(defmethod device-finish-output ((device qt-device) window)
)
(defmethod device-put-cursor ((device qt-device) hunk x y)
(with-slots (cursor-item cursor-hunk) device
(when (and cursor-item (not (eq hunk cursor-hunk)))
(let ((*steal-focus-out* nil))
(#_removeItem (#_scene cursor-item) cursor-item))
(setf cursor-item nil))
(setf cursor-hunk hunk)
(with-slots (cw ch) hunk
(unless cursor-item
(setf cursor-item
(with-objects ((path (#_new QPainterPath))
(pen (#_new QPen (#_Qt::NoPen)))
(color (#_new QColor 0 180 180 64))
(brush (#_new QBrush color)))
(#_addRect path 0 0 cw ch)
(let* ((scene (#_scene (qt-hunk-widget hunk)))
(group (ensure-hunk-item-group scene hunk))
(item (#_new QGraphicsPathItem path group)))
(qt::cancel-finalization item)
(#_setPen item pen)
(#_setBrush item brush)
item))))
(#_setPos cursor-item
(* x cw)
(* y ch)))
(#_setZValue cursor-item 3)))
(defmethod device-show-mark ((device qt-device) window x y time)
)
Windows
(defmethod device-next-window ((device qt-device) window)
(device-hunk-window (device-hunk-next (window-hunk window))))
(defmethod device-previous-window ((device qt-device) window)
(device-hunk-window (device-hunk-previous (window-hunk window))))
(defvar *currently-selected-hunk* nil)
(defmethod device-delete-window ((device qt-device) window)
(let* ((hunk (window-hunk window))
(prev (device-hunk-previous hunk))
(next (device-hunk-next hunk))
(device (device-hunk-device hunk))
(group (hunk-item-group hunk)))
(when group
(when (eq hunk (device-cursor-hunk device))
(setf (device-cursor-item device) nil))
(setf (hunk-native-widget-item hunk) nil)
(with-slots (itab) hunk
(fill itab nil))
(#_delete group))
(setf (device-hunk-next prev) next)
(setf (device-hunk-previous next) prev)
(let ((buffer (window-buffer window)))
(setf (buffer-windows buffer) (delete window (buffer-windows buffer))))
(let ((new-lines (device-hunk-height hunk)))
(declare (fixnum new-lines))
(cond ((eq hunk (device-hunks (device-hunk-device next)))
(incf (device-hunk-height next) new-lines)
(incf (device-hunk-text-height next) new-lines)
(let ((w (device-hunk-window next)))
(hi::change-window-image-height w (+ new-lines (window-height w)))))
(t
(incf (device-hunk-height prev) new-lines)
(incf (device-hunk-position prev) new-lines)
(incf (device-hunk-text-height prev) new-lines)
(incf (device-hunk-text-position prev) new-lines)
(let ((w (device-hunk-window prev)))
(hi::change-window-image-height w (+ new-lines (window-height w)))))))
(when (eq hunk (device-hunks device))
(setf (device-hunks device) next)))
(setf *currently-selected-hunk* nil)
(setf hi::*screen-image-trashed* t))
(defmethod device-make-window ((device qt-device)
start modelinep window font-family
ask-user x y width height proportion)
(declare (ignore window font-family ask-user x y width height))
(let* ((old-window (current-window))
(victim (window-hunk old-window))
(text-height (device-hunk-text-height victim))
(availability (if modelinep (1- text-height) text-height)))
(when (> availability 1)
(let* ((new-lines (truncate (* availability proportion)))
(old-lines (- availability new-lines))
(pos (device-hunk-position victim))
(new-height (if modelinep (1+ new-lines) new-lines))
(new-text-pos (if modelinep (1- pos) pos))
(widget (qt-hunk-widget (window-hunk *current-window*)))
(new-hunk (make-instance 'qt-hunk
:position pos
:height new-height
:text-position new-text-pos
:text-height new-lines
:device device
:widget widget))
(new-window (internal-make-window :hunk new-hunk)))
(with-object (metrics (#_new QFontMetrics *font*))
(setf (slot-value new-hunk 'cw) (+ 0 (#_width metrics "m"))
(slot-value new-hunk 'ch) (+ 2 (#_height metrics))))
(setf (device-hunk-window new-hunk) new-window)
(let* ((old-text-pos-diff (- pos (device-hunk-text-position victim)))
(old-win-new-pos (- pos new-height)))
(declare (fixnum old-text-pos-diff old-win-new-pos))
(setf (device-hunk-height victim)
(- (device-hunk-height victim) new-height))
(setf (device-hunk-text-height victim) old-lines)
(setf (device-hunk-position victim) old-win-new-pos)
(setf (device-hunk-text-position victim)
(- old-win-new-pos old-text-pos-diff)))
(hi::setup-window-image start new-window new-lines
(window-width old-window))
(prepare-window-for-redisplay new-window)
(when modelinep
(setup-modeline-image (line-buffer (mark-line start)) new-window))
(hi::change-window-image-height old-window old-lines)
(shiftf (device-hunk-previous new-hunk)
(device-hunk-previous (device-hunk-next victim))
new-hunk)
(shiftf (device-hunk-next new-hunk) (device-hunk-next victim) new-hunk)
(setf *currently-selected-hunk* nil)
(setf hi::*screen-image-trashed* t)
new-window))))
(defmethod resize-event ((widget hunk-widget) resize-event)
(call-next-qmethod)
#+nil (#_setMaximumWidth *tabs* (#_width wrapper))
(update-full-screen-items widget)
(hi::enlarge-device (current-device)
(recompute-hunk-widget-height widget))
(hi::internal-redisplay))
(defvar *standard-column-width* 80)
(defun standard-width-in-pixels ()
(with-object (metrics (#_new QFontMetrics *font*))
(+ (* *standard-column-width* (#_width metrics "m"))
*gutter*)))
(defun offset-on-each-side (widget)
(if (centerize-widget-p widget)
(let ((white-width (standard-width-in-pixels))
(full-width (#_width widget)))
(max 0.0d0 (/ (- full-width white-width) 2.0d0)))
0.0d0))
(defmethod device-beep ((device qt-device) stream)
)
(defclass qt-editor-input (editor-input)
())
(defvar *alt-is-meta* t)
(defvar *qt-initialized-p* nil)
(defmethod context-menu-event ((instance hunk-widget) event)
(let ((menu (#_new QMenu)))
(add-menus menu)
(#_exec menu (#_globalPos event))))
(defmethod key-press-event ((instance hunk-widget) event)
(hi::q-event *editor-input* (qevent-to-key-event event)))
(defun parse-modifiers (event)
(let ((mods (#_modifiers event)))
(logior (if (logtest mods
(qt::primitive-value (#_Qt::ControlModifier)))
(hemlock-ext:key-event-bits #k"control-a")
0)
(if (or (logtest mods
(qt::primitive-value (#_Qt::MetaModifier)))
(and *alt-is-meta*
(logtest mods
(qt::primitive-value (#_Qt::AltModifier)))))
(hemlock-ext:key-event-bits #k"meta-a")
0))))
(defun parse-key (event)
(let ((k (#_key event)))
(cond
((or (eql k (primitive-value (#_Qt::Key_Return)))
(eql k (primitive-value (#_Qt::Key_Enter))))
(hemlock-ext:key-event-keysym #k"Return"))
((eql k (primitive-value (#_Qt::Key_Tab)))
(hemlock-ext:key-event-keysym #k"tab"))
((eql k (primitive-value (#_Qt::Key_Escape)))
(hemlock-ext:key-event-keysym #k"Escape"))
((eql k (primitive-value (#_Qt::Key_Backspace)))
(hemlock-ext:key-event-keysym #k"Backspace"))
((eql k (primitive-value (#_Qt::Key_Delete)))
(hemlock-ext:key-event-keysym #k"delete"))
((eql k (primitive-value (#_Qt::Key_Space)))
(hemlock-ext:key-event-keysym #k"space"))
(t
nil))))
(defun qevent-to-key-event (event)
(let* ((text (map 'string
(lambda (c)
(if (< (char-code c) 32)
(code-char (+ 96 (char-code c)))
c))
(#_text event)))
(mask (parse-modifiers event))
(keysym (or (parse-key event)
(hemlock-ext::name-keysym text))))
(when keysym
(hemlock-ext:make-key-event keysym mask))))
(defmethod get-key-event
((stream qt-editor-input) &optional ignore-abort-attempts-p)
(hi::%editor-input-method stream ignore-abort-attempts-p))
(defun in-main-qthread-p ()
(and hi::*in-the-editor*
(typep (current-device) 'qt-device)))
(defmethod hi::dispatch-events-with-backend ((backend (eql :qt)))
apparently has a timeout event somewhere that is set to two
only to enter INTERNAL - REDISPLAY again after 2s , even though no
affected Hemlock state .
showing up with 1 % CPU usage in top , and not showing up .
(assert (not *processing-events-p*))
(setf *interesting-event-received* nil)
(let ((*processing-events-p* t))
(iter (until *interesting-event-received*)
(#_processEvents (#_QAbstractEventDispatcher::instance)
(#_QEventLoop::WaitForMoreEvents)))))
(defmethod hi::dispatch-events-no-hang-with-backend ((backend (eql :qt)))
(assert (not *processing-events-p*))
(let ((*processing-events-p* t))
(#_processEvents (#_QAbstractEventDispatcher::instance)
(#_QEventLoop::AllEvents))))
(defmethod unget-key-event (key-event (stream qt-editor-input))
(hi::un-event key-event stream))
(defmethod clear-editor-input ((stream qt-editor-input))
)
(defmethod listen-editor-input ((stream qt-editor-input))
(hi::input-event-next (hi::editor-input-head stream)))
(defun make-hemlock-widget ()
(let* ((vbox (#_new QVBoxLayout))
(tabs (#_new QTabBar))
(main (make-instance 'hunk-widget
:centerize t
:paint-margin t))
(font
(let ((font (#_new QFont)))
(#_fromString font *font-family*)
(#_setPointSize font *font-size*)
font))
(*font* font)
(font (progn (restore-font) *font*))
(*modeline-font*
(let ((font (#_new QFont)))
(#_fromString font *modeline-font-family*)
(#_setPointSize font (#_pointSize *font*))
font)))
(#_addWidget vbox tabs)
(#_hide tabs)
(let ((main-stack (#_new QStackedWidget)))
(setf *main-stack* main-stack)
(setf *main-hunk-widget* main)
(#_addWidget vbox main-stack)
(#_addWidget main-stack main))
(#_setFocusPolicy tabs (#_Qt::NoFocus))
(#_setSpacing vbox 0)
(#_setMargin vbox 0)
(let ((central-widget (#_new QWidget)))
(#_setLayout central-widget vbox)
(values main font *modeline-font* central-widget tabs))))
(defun add-buffer-tab-hook (buffer)
(when (in-main-qthread-p)
(#_addTab *tabs* (buffer-name buffer))))
(defun buffer-tab-index (buffer)
(dotimes (i (#_count *tabs*))
(when (equal (#_tabText *tabs* i) (buffer-name buffer))
(return i))))
(defun delete-buffer-tab-hook (buffer)
(when (in-main-qthread-p)
(let ((idx (buffer-tab-index buffer)))
(if idx
(#_removeTab *tabs* idx)
(warn "buffer tab missing")))))
(defun update-buffer-tab-hook (buffer new-name)
(when (in-main-qthread-p)
(let ((idx (buffer-tab-index buffer)))
(if idx
(#_setTabText *tabs* idx new-name)
(warn "buffer tab missing")))))
(defun set-buffer-tab-hook (buffer)
(when (in-main-qthread-p)
(let ((idx (buffer-tab-index buffer)))
(if idx
(#_setCurrentIndex *tabs* idx)
(warn "buffer tab missing")))))
(defun set-stack-widget-hook (buffer)
(when (in-main-qthread-p)
(#_setCurrentWidget *main-stack*
*main-hunk-widget*)))
(add-hook hemlock::make-buffer-hook 'add-buffer-tab-hook)
(add-hook hemlock::delete-buffer-hook 'delete-buffer-tab-hook)
(add-hook hemlock::buffer-name-hook 'update-buffer-tab-hook)
(add-hook hemlock::set-buffer-hook 'set-buffer-tab-hook)
(add-hook hemlock::set-buffer-hook 'set-stack-widget-hook)
(defun splitter-sizes (splitter)
(qt::qlist-to-list (#_sizes splitter)))
(defun (setf splitter-sizes) (newval splitter)
(#_setSizes splitter (qt::qlist-append (qt::make-qlist<int>) newval))
newval)
(defun resize-echo-area (nlines backgroundp)
(setf (device-hunk-height (window-hunk *echo-area-window*))
nlines)
(setf (device-hunk-text-height (window-hunk *echo-area-window*))
nlines)
(hi::change-window-image-height *echo-area-window* nlines)
(setf (qt-hunk-want-background-p (window-hunk *echo-area-window*))
backgroundp)
(redisplay-all)
#+nil
(let* ((widget (or widget
(qt-hunk-widget (window-hunk *echo-area-window*))))
(splitter (#_centralWidget (#_window widget)))
(new-height (with-object (metrics (#_new QFontMetrics *font*))
(+ (* 2 *gutter*)
(* nlines (#_height metrics))))))
(#_setMinimumHeight widget 1)
(destructuring-bind (top bottom)
(splitter-sizes splitter)
(let ((diff (- new-height bottom)))
(setf (splitter-sizes splitter)
(list (- top diff) new-height))))))
(defun minimize-echo-area ()
(resize-echo-area 1 nil))
(defun enlarge-echo-area ()
(resize-echo-area 5 t))
(defun set-window-hook (new-window)
(when (in-main-qthread-p)
(cond
((eq new-window *echo-area-window*)
(enlarge-echo-area))
((eq *current-window* *echo-area-window*)
(minimize-echo-area)))))
(add-hook hemlock::set-window-hook 'set-window-hook)
(defun signal-receiver (function)
(make-instance 'signal-receiver
:function (lambda (&rest args)
(setf *interesting-event-received* t)
(apply function args))))
(defun connect (source signal cont)
(let ((receiver (signal-receiver cont)))
(push receiver *do-not-gc-list*)
(#_QObject::connect source signal receiver (QSLOT "invoke()"))))
(defun connect/int (source signal cont)
(let ((receiver (signal-receiver cont)))
(push receiver *do-not-gc-list*)
(#_QObject::connect source signal receiver (QSLOT "invoke(int)"))))
(defun connect/string (source signal cont)
(let ((receiver (signal-receiver cont)))
(push receiver *do-not-gc-list*)
(#_QObject::connect source
signal
receiver
(QSLOT "invoke(const QString&)"))))
(defun connect/boolean (source signal cont)
(let ((receiver (signal-receiver cont)))
(push receiver *do-not-gc-list*)
(#_QObject::connect source
signal
receiver
(QSLOT "invoke(bool)"))))
(defclass signal-receiver ()
((function :initarg :function
:accessor signal-receiver-function))
(:metaclass qt-class)
(:qt-superclass "QObject")
(:slots ("invoke()" (lambda (this &rest args)
(apply (signal-receiver-function this)
args)))
("invoke(int)" (lambda (this &rest args)
(apply (signal-receiver-function this)
args)))
("invoke(const QString&)" (lambda (this &rest args)
(apply (signal-receiver-function this)
args)))
("invoke(bool)" (lambda (this &rest args)
(apply (signal-receiver-function this)
args)))))
(defmethod initialize-instance :after ((instance signal-receiver) &key)
(new instance))
(defclass command-action-receiver ()
((command :initarg :command
:accessor command-action-receiver-command))
(:metaclass qt-class)
(:qt-superclass "QWidget")
(:slots ("triggered()" (lambda (this)
(funcall (command-function
(command-action-receiver-command
this))
nil)
(hi::internal-redisplay)))))
(defmethod initialize-instance :after ((instance command-action-receiver) &key)
(new instance))
(defvar *do-not-gc-list*)
(defun add-command-action (menu command &optional suffix)
(let* ((receiver
(make-instance 'command-action-receiver
:command (getstring command hi::*command-names*)))
(action
(#_addAction
menu
(concatenate 'string command suffix)
receiver
(qslot "triggered()"))))
(push action *do-not-gc-list*)
(push receiver *do-not-gc-list*)))
#+(or)
(defun control-g-handler (&rest *)
(let ((widget *echo-hunk-widget*))
(cond
((#_hasFocus widget)
(hi::q-event *editor-input* #k"control-g"))
(t
(setf *steal-focus-out* t)
(#_setFocus *echo-hunk-widget*)
(clear-echo-area)
(message "Focus restored. Welcome back to Hemlock.")))))
(defun control-g-handler (&rest *)
(setf *steal-focus-out* t)
(#_setFocus *main-hunk-widget*)
(clear-echo-area)
(hi::q-event *editor-input* #k"control-g"))
(defvar *invoke-later-thunks*)
(defvar *invoke-later-timer*)
(defmethod hi::invoke-later ((backend (eql :qt)) fun)
(push fun *invoke-later-thunks*)
(#_setSingleShot *invoke-later-timer* t)
(#_start *invoke-later-timer*))
(defun process-invoke-later-thunks ()
(iter (while *invoke-later-thunks*)
(funcall (pop *invoke-later-thunks*))))
(defmethod hi::backend-init-raw-io ((backend (eql :qt)) display)
(declare (ignore display))
(setf hi::*editor-input* (make-instance 'qt-editor-input)))
(defun add-menus (parent)
(let ((menu (#_addMenu parent "File")))
(add-command-action menu "Find File")
(add-command-action menu "Save File")
(#_addSeparator menu)
(add-command-action menu "Write File")
(#_addSeparator menu)
(add-command-action menu "Save All Files and Exit"))
(let ((menu (#_addMenu parent "View")))
(add-command-action menu "Toggle Menu Bar")
(add-command-action menu "Toggle Tab Bar")
(add-command-action menu "Toggle Full Screen"))
(let ((menu (#_addMenu parent "Lisp")))
(add-command-action menu "Start Slave Thread")
(add-command-action menu "Start Slave Process")
(add-command-action menu "List Slaves"))
(let ((menu (#_addMenu parent "Buffer")))
(add-command-action menu "Bufed"))
(let ((menu (#_addMenu parent "Browser")))
(add-command-action menu "Browse")
(add-command-action menu "Browse Qt Class")
(add-command-action menu "CLHS")
(add-command-action menu "Google")
(#_addSeparator menu)
(add-command-action menu "Enter Foreign Widget")
(add-command-action menu "Leave Foreign Widget"))
(let ((menu (#_addMenu parent "Preferences")))
(add-command-action menu "Select Font")
(#_addSeparator menu)
(add-command-action menu "Save Window Geometry")
(add-command-action menu "Restore Window Geometry")))
(defmethod hi::%init-screen-manager ((backend-type (eql :qt)) (display t))
(declare (ignore display))
(let (main central-widget)
(setf (values main *font* *modeline-font* central-widget *tabs*)
(make-hemlock-widget))
(let* ((device (make-instance 'qt-device))
(window (#_new QMainWindow)))
(setf (device-name device) "Qt"
(device-bottom-window-base device) nil)
keep the QMainWindow from being GCed :
(setf (device-main-window device) window)
(#_setWindowTitle window "Hemlock")
(#_setCentralWidget window central-widget)
(add-menus (#_menuBar window))
(#_hide (#_menuBar window))
(setf hi::*real-editor-input* *editor-input*)
(set-up-qt-hunks device main)
(dolist (buffer hi::*buffer-list*)
(unless (eq buffer *echo-area-buffer*)
(add-buffer-tab-hook buffer)))
(connect/int *tabs*
(qsignal "currentChanged(int)")
(lambda (index)
(change-to-buffer (hemlock-ext::find-buffer (#_tabText *tabs* index)))))
(with-object (key (#_new QKeySequence "Ctrl+G"))
(connect (#_new QShortcut key (#_window *main-hunk-widget*))
(QSIGNAL "activated()")
'control-g-handler))
#+nil
(#_setMinimumHeight echo
(with-object (metrics (#_new QFontMetrics *font*))
(+ (* 2 *gutter*) (#_height metrics))))
(restore-window-geometry window)
(#_show window)
#+nil (#_setMinimumSize widget 0 0)
(setf *notifier* (make-instance 'qt-repl::repl-notifier))
(setf *executor* (make-instance 'qt-repl::repl-executer
:notifier *notifier*)))))
(defmethod hi::make-event-loop ((backend (eql :qt)))
'qt-event-loop)
(defmethod hi::invoke-with-existing-event-loop ((backend (eql :qt)) loop fun)
(assert (eq loop 'qt-event-loop))
(hi::invoke-with-new-event-loop backend fun))
(defmethod hi::invoke-with-new-event-loop ((backend (eql :qt)) fun &aux keep)
(unless *qt-initialized-p*
HACK ! Disable SBCL 's SIGCHLD handler . I do n't know what exactly
it is doing wrong , but if SBCL sets a signal handler for this , it
or perhaps we are interrupting FFI code , or is it an altstack thing ?
#+sbcl (sb-kernel::default-interrupt sb-unix:sigchld)
(format t "Loading shared libraries [")
(let ((first t))
(dolist (module '(:qtcore :qtgui :qtnetwork :qtsvg :qtwebkit))
(if first
(setf first nil)
(write-string ", "))
(format t "~A" (string-downcase module))
(force-output)
(ensure-smoke module)))
(format t "].~%Connecting to window system...")
(force-output)
(push (make-qapplication) keep)
(format t "done.~%")
(force-output)
(setf *qt-initialized-p* t))
we will later . Let 's just do it unconditionally :
(push (#_new QEventLoop) keep)
(let* ((*do-not-gc-list* '())
(*invoke-later-thunks* '())
(*invoke-later-timer* (#_new QTimer))
(*interesting-event-received* nil))
(connect *invoke-later-timer*
(QSIGNAL "timeout()")
#'process-invoke-later-thunks)
#-sbcl (funcall fun)
#+sbcl (sb-int:with-float-traps-masked
(:overflow :invalid :divide-by-zero)
(funcall fun))))
Keysym translations
(defun qt-character-keysym (gesture)
(cond
# # # hmm
(hemlock-ext:key-event-keysym #k"Return"))
# # # hmm
(hemlock-ext:key-event-keysym #k"Tab"))
((eql gesture #\Backspace)
(hemlock-ext:key-event-keysym #k"Backspace"))
((eql gesture #\Escape)
(hemlock-ext:key-event-keysym #k"Escape"))
((eql gesture #\rubout)
(hemlock-ext:key-event-keysym #k"delete"))
(t
(char-code gesture))))
(defun effective-hunk-widget-width (widget)
(- (#_width widget) (offset-on-each-side widget)))
(defun probe-namestring (x)
(when (and x (probe-file x))
(etypecase x
(string x)
(pathname (namestring x)))))
(defun find-background-svg ()
(etypecase hemlock:*background-image*
((or string pathname)
(or (probe-namestring hemlock:*background-image*)
(progn
(format t "Specified background image not found: ~A~%"
hemlock:*background-image*)
nil)))
((eql :auto)
(or (probe-namestring (merge-pathnames ".hemlock/background.svg"
(user-homedir-pathname)))
(probe-namestring (merge-pathnames "background.svg"
(hi::installation-directory)))))
(null)))
(defun update-full-screen-items (widget)
(with-slots (background-pixmap background-pixmap-item)
widget
(setf background-pixmap
(let ((file (find-background-svg)))
(if file
(let ((pixmap (#_new QPixmap
(#_width widget)
(#_height widget))))
(with-objects
((renderer (#_new QSvgRenderer file))
(painter (#_new QPainter pixmap)))
(#_render renderer painter)
(#_end painter)
pixmap))
nil)))
(when background-pixmap-item
(#_removeItem (#_scene background-pixmap-item) background-pixmap-item)
(setf background-pixmap-item nil))
(when background-pixmap
(setf background-pixmap-item
(#_addPixmap (#_scene widget)
background-pixmap))
(#_setZValue background-pixmap-item -2)
#+nil (#_setBackgroundBrush
(#_scene widget)
(#_new QBrush background-pixmap)))))
(with-slots (white-item-1 white-item-2)
widget
(when white-item-1
(#_removeItem (#_scene white-item-1) white-item-1)
(setf white-item-1 nil))
(when white-item-2
(#_removeItem (#_scene white-item-2) white-item-2)
(setf white-item-2 nil))
(let ((offset (truncate (offset-on-each-side widget))))
(with-object (~)
(setf white-item-1
(#_addRect (#_scene widget)
(#_new QRectF
offset
0
(- (#_width widget) (* 2 offset))
(#_height widget))
(~ (#_new QPen (#_Qt::NoPen)))
(~ (#_new QBrush
(~ (#_new QBrush (~ (#_new QColor 255 255 255 210)))))))))
(with-object (~)
(setf white-item-2
(#_addRect (#_scene widget)
(~ (#_new QRectF
(- (#_width widget) offset)
0
offset
(#_height widget)))
(~ (#_new QPen (#_Qt::NoPen)))
(~ (#_new QBrush
(~ (#_new QBrush (~ (#_new QColor 255 255 255 180))))))))))
(#_setZValue white-item-1 -1)
(#_setZValue white-item-2 -1)))
(defun old-resize-junk ()
#+nil
(let ((window (device-hunk-window hunk)))
(unless (eq (cdr (window-first-line window)) the-sentinel)
(shiftf (cdr (window-last-line window))
(window-spare-lines window)
(cdr (window-first-line window))
the-sentinel))
# # # ( setf ( bitmap - hunk - start hunk ) ( cdr ( window - first - line window ) ) )
(let* ((res (window-spare-lines window))
(new-width
(max 5 (floor (- (effective-hunk-widget-width (qt-hunk-widget hunk))
(* 2 *gutter*))
(slot-value hunk 'cw))))
(new-height
(max 2 (1- (floor (- (#_height (qt-hunk-widget hunk))
(* 2 *gutter*))
(slot-value hunk 'ch)))))
(width (length (the simple-string (dis-line-chars (car res))))))
(declare (list res))
(when (> new-width width)
(setq width new-width)
(dolist (dl res)
(setf (dis-line-chars dl) (make-string new-width))))
(setf (window-height window) new-height (window-width window) new-width)
(do ((i (- (* new-height 2) (length res)) (1- i)))
((minusp i))
(push (make-window-dis-line (make-string width)) res))
(setf (window-spare-lines window) res)
Force modeline update .
(let ((ml-buffer (window-modeline-buffer window)))
(when ml-buffer
(let ((dl (window-modeline-dis-line window))
(chars (make-string new-width))
(len (min new-width (window-modeline-buffer-len window))))
(setf (dis-line-old-chars dl) nil)
(setf (dis-line-chars dl) chars)
(replace chars ml-buffer :end1 len :end2 len)
(setf (dis-line-length dl) len)
(setf (dis-line-flags dl) changed-bit)))))
(setf (window-tick window) (tick))
(update-window-image window)
(when (eq window *current-window*) (maybe-recenter-window window))
hunk))
(defmethod hi::device-enlarge-window ((device qt-device) window offset)
(let* ((hunk (window-hunk window))
(victim
(cond
((eq hunk (device-hunks (device-hunk-device hunk)))
we 're the first hunk
(let ((victim (device-hunk-next hunk)))
(when (eq hunk victim)
... the first and only hunk
(editor-error "Cannot enlarge only window"))
(incf (device-hunk-position hunk) offset)
(incf (device-hunk-text-position hunk) offset)
victim))
(t
we 're not first hunk , so there is a victim in front of us
(let ((victim (device-hunk-previous hunk)))
(decf (device-hunk-position victim) offset)
(decf (device-hunk-text-position victim) offset)
victim)))))
(incf (device-hunk-height hunk) offset)
(incf (device-hunk-text-height hunk) offset)
(decf (device-hunk-height victim) offset)
(decf (device-hunk-text-height victim) offset)
(let ((w (device-hunk-window victim)))
(hi::change-window-image-height w (- offset (window-height w))))
(let ((w (device-hunk-window hunk)))
(hi::change-window-image-height w (+ offset (window-height w))))
(setf hi::*screen-image-trashed* t)))
(defmethod hi::enlarge-device
((device qt-device) offset)
#+nil (hi::set-up-screen-image device)
(let ((first (device-hunks device)))
(incf (device-hunk-position first) offset)
(incf (device-hunk-text-position first) offset)
(incf (device-hunk-height first) offset)
(incf (device-hunk-text-height first) offset)
(let ((w (device-hunk-window first)))
(hi::change-window-image-height w (+ offset (window-height w))))
(do ((hunk (device-hunk-next first) (device-hunk-next hunk)))
((eq hunk first))
(incf (device-hunk-position hunk) offset)
(incf (device-hunk-text-position hunk) offset))
(let ((hunk (window-hunk *echo-area-window*)))
(incf (device-hunk-position hunk) offset)
(incf (device-hunk-text-position hunk) offset))
(setf hi::*screen-image-trashed* t)))
(defun recompute-hunk-widget-height (widget)
(let ((new (with-object (metrics (#_new QFontMetrics *font*))
(max 2 (floor (- (#_height widget)
(* 2 *gutter*))
(+ 2 (#_height metrics))))))
(old (hunk-widget-height widget)))
(setf (hunk-widget-height widget) new)
(- new old)))
(defun set-up-qt-hunks (device main-widget)
(let* ((buffer *current-buffer*)
(start (buffer-start-mark buffer))
(first (cons dummy-line the-sentinel))
#+nil
(width (max 5 (floor (- (#_width (qt-hunk-widget hunk))
(* 2 *gutter*))
(+ 0 (#_width metrics "m")))))
(height (recompute-hunk-widget-height main-widget))
(echo-height #+nil (value hemlock::echo-area-height)
1)
)
(declare (ignorable start first))
(setf (buffer-windows buffer) nil
(buffer-windows *echo-area-buffer*) nil)
(let* ((window (hi::internal-make-window))
(last-text-line (1- main-text-lines))
(hunk (make-instance 'qt-hunk
:height main-lines
:text-position last-text-line
:text-height main-text-lines
:widget main-widget)))
(redraw-widget device window hunk buffer t)
(setf *current-window* window)
#+nil (push window (slot-value device 'windows))
(setf (device-hunk-previous hunk) hunk)
(setf (device-hunk-next hunk) hunk)
(setf (device-hunks device) hunk))
(let ((echo-window (hi::internal-make-window))
(echo-hunk (make-instance 'qt-hunk
:position (1- height)
:height echo-height
:text-position (- height 2)
:text-height echo-height
:widget main-widget)))
(redraw-widget device echo-window echo-hunk *echo-area-buffer* nil)
(setf *echo-area-window* echo-window)))))
(defvar *font-family*
"Fixed [Misc]"
#+nil "Courier New")
(defvar *modeline-font-family*
"Sans")
(defvar *font-size*
10)
(defun redraw-widget (device window hunk buffer modelinep)
(setf (slot-value (qt-hunk-widget hunk) 'hunk)
hunk)
(let* ((start (buffer-start-mark buffer))
(first (cons dummy-line the-sentinel))
(font *font*)
width height)
(with-object (metrics (#_new QFontMetrics font))
(setf
(slot-value hunk 'cw) (+ 0 (#_width metrics "m"))
(slot-value hunk 'ch) (+ 2 (#_height metrics))
width (max 5 (floor (- (#_width (qt-hunk-widget hunk))
(* 2 *gutter*))
(slot-value hunk 'cw)))
height (max 2 (floor (- (#_height (qt-hunk-widget hunk))
(* 2 *gutter*))
(slot-value hunk 'ch)))
(device-hunk-window hunk) window
(device-hunk-next hunk) nil
(device-hunk-previous hunk) nil
(device-hunk-device hunk) device
The charpos of the first char displayed .
The first changed dis - line on last update .
)
(setup-dis-lines window width height)
(when modelinep
(setup-modeline-image buffer window))
(push window (buffer-windows buffer))
(push window *window-list*)
(hi::update-window-image window))))
(defun setup-dis-lines (window width height)
(do ((i (- height) (1+ i))
(res ()
(cons (make-window-dis-line (make-string width)) res)))
((= i height)
(setf (window-spare-lines window) res))))
(defvar *tick* 0)
( ( dis - line - chars dl ) )
( ww ( # _ width m ( subseq chrs start end ) ) )
( # _ new QRect x1 y1 ww ( * 2 hh ) ) ) )
#+(or)
(defun dis-line-rect (hunk dl)
(nth-line-rect hunk (dis-line-position dl)))
#+(or)
(defun nth-line-rect (hunk i)
(let* ((x *gutter*)
(y (+ *gutter* (* i (slot-value hunk 'ch))))
(w (- (#_width (qt-hunk-widget hunk))
(ceiling (offset-on-each-side (qt-hunk-widget hunk)))))
(h (slot-value hunk 'ch)))
(#_new QRect x y w h)))
#+(or)
(defun cursor-rect (hunk x y)
(with-slots (cw ch) hunk
(when (and x y cw ch)
(#_new QRect
(+ *gutter* (* x cw))
(+ *gutter* (* y ch))
(1+ cw) (1+ ch)))))
(defun clear-line-items (scene hunk position)
(declare (ignore scene))
(dolist (old-item (line-items hunk position))
(#_delete old-item))
(setf (line-items hunk position) nil))
(defun update-modeline-items (scene hunk dl)
(let* ((position (+ (dis-line-position dl)
(device-hunk-text-height hunk)))
(h (slot-value hunk 'ch))
#+nil (w (slot-value hunk 'cw))
(widget (qt-hunk-widget hunk))
(offset (truncate (offset-on-each-side widget)))
(chrs (dis-line-chars dl))
(y (* position h)))
(unless (zerop (dis-line-flags dl))
(setf (hi::dis-line-tick dl) (incf *tick*)))
(clear-line-items scene hunk position)
(with-objects ((pen (#_new QPen (#_Qt::NoPen)))
(color (#_new QColor 255 255 255 210))
(oops (#_new QBrush color))
(brush (#_new QBrush oops))
(rect (#_new QRectF
(- (+ offset *gutter*))
y
(#_width widget)
h)))
(let ((item
(#_new QGraphicsRectItem
rect
(ensure-hunk-item-group scene hunk))))
(qt::cancel-finalization item)
(#_setPen item pen)
(#_setBrush item brush)
(#_setZValue item 0)
(push item (line-items hunk position))))
(let ((len (dis-line-length dl)))
(push (add-chunk-item scene
hunk
chrs
0
(+ 1 y)
0
len
0
*modeline-font*)
(line-items hunk position))))
(setf (dis-line-flags dl) unaltered-bits (dis-line-delta dl) 0))
(defun update-line-items (scene hunk dl)
(let* ((position (dis-line-position dl))
(h (slot-value hunk 'ch))
(w (slot-value hunk 'cw))
(chrs (dis-line-chars dl))
(y (* position h)))
(unless (zerop (dis-line-flags dl))
(setf (hi::dis-line-tick dl) (incf *tick*)))
(clear-line-items scene hunk position)
(handler-case
(let* ((no (hi::tag-line-number (hi::dis-line-tag dl)))
(str (princ-to-string no)))
(push (add-chunk-item scene hunk str
(- (+ (* w (length str)) (* 2 *gutter*)))
(+ 1 y)
0
(length str)
(if (zerop (mod no 5))
16
15))
(line-items hunk position)))
(error (c) (warn "~A" c)))
(let ((start 0)
(font 0)
(end (dis-line-length dl))
(changes (dis-line-font-changes dl)))
(iter
(cond ((null changes)
(push (add-chunk-item scene hunk chrs
(* w start)
(+ 1 y)
start
end
font)
(line-items hunk position))
(return))
(t
(push (add-chunk-item scene hunk chrs
(* w start)
(+ 1 y)
start
(font-change-x changes)
font)
(line-items hunk position))
(setf font (font-change-font changes)
start (font-change-x changes)
changes (font-change-next changes)))))))
(setf (dis-line-flags dl) unaltered-bits (dis-line-delta dl) 0))
(defun clear-all-line-items (scene hunk)
(with-slots (itab) hunk
(iter
(for i from 0)
(for items in-vector itab)
(dolist (old-item items)
(#_removeItem scene old-item))
(setf (elt itab i) nil))))
(defun reset-hunk-background (window hunk)
(declare (ignore window))
(let* ((widget (qt-hunk-widget hunk))
(scene (#_scene widget)))
(dolist (item (hunk-background-items hunk))
(#_delete item))
(setf (hunk-background-items hunk)
(when (qt-hunk-want-background-p hunk)
(let ((offset (offset-on-each-side widget)))
(with-objects
((pen1 (#_new QPen (#_Qt::SolidLine)))
(pen2 (#_new QPen (#_Qt::NoPen)))
(color1 (#_new QColor 255 255 255 210))
(color2 (#_new QColor 255 255 255 128))
(oops1 (#_new QBrush color1))
(oops2 (#_new QBrush color2))
(brush1 (#_new QBrush oops1))
(brush2 (#_new QBrush oops2))
(rect1 (#_new QRectF
(- (+ (* 2 *gutter*) (truncate offset 2)))
(- *gutter*)
(+ (- (#_width widget) offset)
(* 2 *gutter*))
(+ (* (slot-value hunk 'ch)
(device-hunk-height hunk))
(* 2 *gutter*))))
(rect2 (#_new QRectF rect1)))
(#_setColor pen1 (#_new QColor (#_Qt::black)))
(#_adjust rect2 -5 -5 5 5)
(let* ((group (ensure-hunk-item-group scene hunk))
(item1 (#_new QGraphicsRectItem rect1 group))
(item2 (#_new QGraphicsRectItem rect2 group)))
(qt::cancel-finalization item1)
(qt::cancel-finalization item2)
(#_setPen item1 pen1)
(#_setPen item2 pen2)
(#_setBrush item1 brush1)
(#_setBrush item2 brush2)
(#_setZValue item1 1)
(#_setZValue item2 1)
(#_setZValue group 3)
(list item1 item2))))))))
Smart is n't very smart , but still much better for " a single line changed "
(defun dumb-or-smart-redisplay (device window dumb)
(declare (ignore device))
(let* ((widget (qt-hunk-widget (window-hunk window)))
(hunk (window-hunk window))
(first (window-first-line window))
(offset (truncate (offset-on-each-side widget)))
(scene (#_scene widget)))
(when dumb
(reset-hunk-background window hunk)
(clear-all-line-items scene hunk))
(let* ((native-widget (hi::buffer-widget (window-buffer window)))
(current-item (hunk-native-widget-item hunk))
(current-widget (and current-item
(#_widget current-item))))
(unless (eq native-widget current-widget)
(let ((group (ensure-hunk-item-group scene hunk)))
(when current-item
(setf (hunk-native-widget-item hunk) nil)
(#_setWidget current-item (qt::null-qobject "QWidget"))
(#_delete current-item))
(when native-widget
(let ((item (#_new QGraphicsProxyWidget)))
(#_setParent native-widget (qt::null-qobject "QWidget"))
(#_setWidget item native-widget)
(#_setParentItem item group)
(#_setPos item (- offset) 0)
(#_setZValue item 4)
(#_setFocusPolicy native-widget (#_Qt::StrongFocus))
(#_setGeometry native-widget
(- (+ offset))
0
(- (#_width widget)
(* 2 *gutter*))
(* (slot-value hunk 'ch)
(device-hunk-text-height hunk)))
#+nil (#_setTransform item
(#_scale (#_rotate (#_new QTransform) 10)
0.75 0.75)
nil)
(setf (hunk-native-widget-item hunk) item))))))
(let ((pos (dis-line-position (car (window-last-line window))))
(old (window-old-lines window)))
(when (and pos old)
(iter:iter (iter:for i from (1+ pos) to old)
(clear-line-items scene hunk i)))
(setf (window-old-lines window) pos))
(do ((i 0 (1+ i))
(dl (cdr first) (cdr dl)))
((eq dl the-sentinel)
(setf (window-old-lines window) (1- i)))
(let ((dis-line (car dl)))
(hi::sync-dis-line-tag (hi::dis-line-line dis-line) dis-line)
(when (or dumb (plusp (dis-line-flags dis-line)))
(update-line-items scene hunk dis-line))))
(when (window-modeline-buffer window)
(update-modeline-fields (window-buffer window) window)
(let ((dl (window-modeline-dis-line window)))
(update-modeline-items scene hunk dl)
(setf (dis-line-flags dl) unaltered-bits))
(setf (dis-line-flags (window-modeline-dis-line window))
unaltered-bits)))
(let* ((first (window-first-line window))
#+nil (device (device-hunk-device hunk)))
(setf (window-first-changed window) the-sentinel
(window-last-changed window) first)))
(defun ensure-hunk-item-group (scene hunk)
(or (hunk-item-group hunk)
(setf (hunk-item-group hunk)
(let ((g (#_new QGraphicsItemGroup)))
(#_addItem scene g)
(qt::cancel-finalization g)
g))))
(defun add-chunk-item
(scene hunk string x y start end font-color &optional (font *font*))
(let* ((item
(#_new QGraphicsSimpleTextItem (ensure-hunk-item-group scene hunk)))
(widget (qt-hunk-widget hunk))
(offset (truncate (offset-on-each-side widget))))
(qt::cancel-finalization item)
( # _ setPos ( hunk - item - group hunk ) 50 50 )
(with-objects
((t2 (#_translate (#_new QTransform)
(+ offset *gutter*)
(+ *gutter*
(* (slot-value hunk 'ch)
(- (device-hunk-position hunk)
(device-hunk-height hunk))))))))
(#_setTransform (hunk-item-group hunk) t2 nil))
(#_setText item (subseq string start end))
(#_setFont item font)
(let ((color
#x000000 #xffffff
1 = comments
2 = backquote
3 = unquote
4 = strings
5 = quote
6 = # +
7 = # -
#x000000 #xbebebe
#xff0000 #xbebebe
#x00aa00 #xbebebe
#xffff00 #xbebebe
#x0000ff #xbebebe
#xff00ff #xbebebe
#x00ffff #xbebebe
#xbebebe #x000000
#xffffff #x000000)
(* 2 (mod font-color 17)))))
(with-objects ((color (#_new QColor
(ldb (byte 8 16) color)
(ldb (byte 8 8) color)
(ldb (byte 8 0) color)))
(brush (#_new QBrush color)))
(#_setBrush item brush)))
(#_setPos item x y)
(#_setZValue item 2)
item))
(defun make-virtual-buffer (name widget &rest args)
(let ((buffer (apply #'make-buffer name args)))
(when buffer
(setf (buffer-writable buffer) nil)
(setf (hi::buffer-widget buffer) widget)
buffer)))
(defcommand "Enter Foreign Widget" (p)
"" ""
(declare (ignore p))
(let ((widget (hi::buffer-widget (current-buffer))))
(unless widget
(editor-error "Not a foreign widget."))
(setf *steal-focus-out* nil)
(#_setFocus widget)
(clear-echo-area)
(message "Focus set to foreign widget. Type C-g to go back.")))
(defcommand "Leave Foreign Widget" (p)
"Like control-g-handler, except for the C-g behaviour." ""
(declare (ignore p))
(let ((main *main-hunk-widget*))
(unless (#_hasFocus main)
(setf *steal-focus-out* t)
(#_setFocus main)
(clear-echo-area)
(message "Focus restored. Welcome back to Hemlock."))))
(defcommand "Disable Steal Focus" (p)
"" ""
(declare (ignore p))
(setf *steal-focus-out* nil)
(message "Focus stealing disabled"))
(defcommand "Enable Steal Focus" (p)
"" ""
(declare (ignore p))
(setf *steal-focus-out* t)
(#_setFocus *main-hunk-widget*))
#+nil
(defcommand "Abc" (p)
"" ""
(let ((w (qt-hunk-item (window-hunk (current-window)))))
(#_setZValue w 500)
(#_setTransform (let* ((old (qt::qobject-class w))
(old-ptr (qt::qobject-pointer w))
(new (qt::find-qclass "QGraphicsItem"))
(new-ptr (qt::%cast old-ptr
(qt::unbash old)
(qt::unbash new))))
(make-instance 'qt::qobject
:class new
:pointer new-ptr))
(#_translate (if p
(#_rotate (#_scale (#_new QTransform) 0.75 0.75) 45)
(#_new QTransform)) 200 0)
nil)))
(defcommand "Toggle Tab Bar" (p)
"" ""
(#_setVisible *tabs* (not (#_isVisible *tabs*))))
(defun main-window ()
(#_window (qt-hunk-widget (window-hunk (current-window)))))
(defcommand "Toggle Menu Bar" (p)
"" ""
(let ((menubar (#_menuBar (main-window))))
(#_setVisible menubar (not (#_isVisible menubar)))))
(defcommand "Toggle Full Screen" (p)
"" ""
(let ((win (main-window)))
(if (logtest (#_windowState win)
(primitive-value (#_Qt::WindowFullScreen)))
(#_showNormal win)
(#_showFullScreen win))))
#+nil
(defcommand "Def" (p)
"" ""
(let* ((widget (#_new QWebView))
(w (#_addWidget
(#_scene (qt-hunk-widget (window-hunk (current-window))))
widget)))
(push widget *do-not-gc-list*)
(push w *do-not-gc-list*)
(#_setUrl widget (#_new QUrl ""))
#+nil (#_setZValue w 500)
#+nil (let* ((new-class (qt::find-qclass "QGraphicsItem"))
(new-ptr (qt::%cast w new-class)))
(make-instance 'qt::qobject
:class new-class
:pointer new-ptr))
(#_setTransform w
#+nil (#_translate (#_new QTransform) 1 2)
(#_translate (if p
(#_rotate (#_scale (#_new QTransform) 0.75 0.75) 45)
(#_new QTransform))
400 0)
nil)))
|
9afba6151966eb15a1cbfd80c912a979bf83dcaa2bc9391e03b2333af4e2ac3b | tsloughter/kuberl | kuberl_v1beta1_supplemental_groups_strategy_options.erl | -module(kuberl_v1beta1_supplemental_groups_strategy_options).
-export([encode/1]).
-export_type([kuberl_v1beta1_supplemental_groups_strategy_options/0]).
-type kuberl_v1beta1_supplemental_groups_strategy_options() ::
#{ 'ranges' => list(),
'rule' => binary()
}.
encode(#{ 'ranges' := Ranges,
'rule' := Rule
}) ->
#{ 'ranges' => Ranges,
'rule' => Rule
}.
| null | https://raw.githubusercontent.com/tsloughter/kuberl/f02ae6680d6ea5db6e8b6c7acbee8c4f9df482e2/gen/kuberl_v1beta1_supplemental_groups_strategy_options.erl | erlang | -module(kuberl_v1beta1_supplemental_groups_strategy_options).
-export([encode/1]).
-export_type([kuberl_v1beta1_supplemental_groups_strategy_options/0]).
-type kuberl_v1beta1_supplemental_groups_strategy_options() ::
#{ 'ranges' => list(),
'rule' => binary()
}.
encode(#{ 'ranges' := Ranges,
'rule' := Rule
}) ->
#{ 'ranges' => Ranges,
'rule' => Rule
}.
| |
b8e98a3fd943cfbb44179a214096180d9ec3644b70f4422557dc685b9e76a361 | LambdaHack/LambdaHack | SessionUIUnitTests.hs | module SessionUIUnitTests (macroTests) where
import Prelude ()
import Game.LambdaHack.Core.Prelude
import qualified Data.Map.Strict as M
import Test.Tasty
import Test.Tasty.HUnit
import Test.Tasty.QuickCheck
import qualified Game.LambdaHack.Client.UI.Content.Input as IC
import qualified Game.LambdaHack.Client.UI.HumanCmd as HumanCmd
import qualified Game.LambdaHack.Client.UI.Key as K
import Game.LambdaHack.Client.UI.SessionUI
import qualified Client.UI.Content.Input as Content.Input
import SessionUIMock
Run @test -p " In - game " --quickcheck - verbose@ to verify that quickcheck
-- properties are not too often satisfied voidly.
macroTests :: TestTree
macroTests = testGroup "macroTests" $
let coinput = IC.makeData Nothing Content.Input.standardKeysAndMouse
stringToKeyMacro = KeyMacro . map (K.mkKM . (: []))
listToKeyMacro = KeyMacro . map K.mkKM
bindInput l input =
let ltriple = M.fromList $ map (\(k, ks) ->
(K.mkKM k, ([], "", HumanCmd.Macro $ map (: []) ks))) l
in input {IC.bcmdMap = M.union ltriple $ IC.bcmdMap input}
in [ testCase "Macro 1 from PR#192 description" $
fst <$> unwindMacros coinput (stringToKeyMacro "'j''j'")
@?= [ [ (Right "", "'j''j'", "") ]
, [ (Left "", "j''j'", "") ]
, [ (Left "j", "''j'", "j") ]
, [ (Right "j", "'j'", "j") ]
, [ (Left "", "j'", "j") ]
, [ (Left "j", "'", "j") ]
, [ (Right "j", "", "j") ]
]
, testCase "Macro 1 from Issue#189 description" $
snd (last (unwindMacros (bindInput [ ("a", "'bc'V")
, ("c", "'aaa'V") ] coinput)
(stringToKeyMacro "a")))
@?= "Macro looped"
, testCase "Macro 2 from Issue#189 description" $
snd (last (unwindMacros (bindInput [("a", "'x'")] coinput)
(stringToKeyMacro "'a'")))
@?= "x"
, testCase "Macro 3 from Issue#189 description" $
snd (last (unwindMacros coinput
(stringToKeyMacro "'x''x'")))
@?= "xx"
, testCase "Macro 4 from Issue#189 description" $
snd (last (unwindMacros coinput
(stringToKeyMacro "'x''x'V")))
@?= "xxx"
, testCase "Macro 5 from Issue#189 description" $
snd (last (unwindMacros coinput
(stringToKeyMacro "x'x'V")))
@?= "xxx"
, testCase "Macro test 10" $
snd (last (unwindMacros coinput
(stringToKeyMacro "x'y'V")))
@?= "xyy"
, testCase "Macro test 11" $
snd (last (unwindMacros coinput
(stringToKeyMacro "'x''y'V")))
@?= "xyy"
, testCase "Macro test 12" $
snd (last (unwindMacros coinput
(listToKeyMacro ["x", "C-V"])))
@?= "x"
, testCase "Macro test 13" $
snd (last (unwindMacros coinput
(listToKeyMacro ["'", "x", "'", "C-V"])))
@?= "xxxxxxxxxxxxxxxxxxxxxxxxxx"
, testCase "Macro test 14" $
snd (last (unwindMacros coinput
(listToKeyMacro ["'", "x", "'", "y", "C-V"])))
@?= "xyxxxxxxxxxxxxxxxxxxxxxxxxx"
, testCase "Macro test 15" $
snd (last (unwindMacros (bindInput [("a", "x")] coinput)
(stringToKeyMacro "'a'V")))
@?= "xx"
, testCase "Macro test 16" $
snd (last (unwindMacros (bindInput [("a", "'x'")] coinput)
(stringToKeyMacro "'a'V")))
@?= "xx"
, testCase "Macro test 17" $
snd (last (unwindMacros (bindInput [("a", "'x'V")] coinput)
(stringToKeyMacro "a")))
@?= "xx"
, testCase "Macro test 18" $
snd (last (unwindMacros (bindInput [("a", "'x'V")] coinput)
(stringToKeyMacro "'a'")))
@?= "xx"
, testCase "Macro test 19" $
snd (last (unwindMacros (bindInput [("a", "'x'V")] coinput)
(stringToKeyMacro "'a'V")))
@?= "xxxx"
, testCase "Macro test 20" $
snd (last (unwindMacros (bindInput [ ("a", "'bz'V")
, ("c", "'aaa'V") ] coinput)
(stringToKeyMacro "c")))
@?= "bzbzbzbzbzbzbzbzbzbzbzbz"
, testCase "RepeatLast test 10" $
snd (last (unwindMacros coinput
(stringToKeyMacro "x'y'v")))
@?= "xyy"
, testCase "RepeatLast test 11" $
snd (last (unwindMacros coinput
(stringToKeyMacro "'x'yv")))
@?= "xyy"
, testCase "RepeatLast test 12" $
snd (last (unwindMacros coinput
(listToKeyMacro ["v", "C-v"])))
@?= ""
, testCase "RepeatLast test 13" $
snd (last (unwindMacros coinput
(listToKeyMacro ["'", "x", "'", "C-v"])))
@?= "xxxxxxxxxxxxxxxxxxxxxxxxxx"
, testCase "RepeatLast test 14" $
snd (last (unwindMacros coinput
(listToKeyMacro ["'", "x", "'", "V", "C-v"])))
@?= "xxxxxxxxxxxxxxxxxxxxxxxxxxx"
, testCase "RepeatLast test 15" $
snd (last (unwindMacros (bindInput [("a", "x")] coinput)
(stringToKeyMacro "av")))
@?= "xx"
, testCase "RepeatLast test 16" $
snd (last (unwindMacros (bindInput [("a", "'x'")] coinput)
(stringToKeyMacro "'a'v")))
@?= "xx"
, testCase "RepeatLast test 17" $
snd (last (unwindMacros (bindInput [("a", "'x'v")] coinput)
(stringToKeyMacro "a")))
@?= "xx"
, testCase "RepeatLast test 18" $
snd (last (unwindMacros (bindInput [("a", "'x'v")] coinput)
(stringToKeyMacro "'a'")))
@?= "xx"
, testCase "RepeatLast test 19" $
snd (last (unwindMacros (bindInput [("a", "'x'v")] coinput)
(stringToKeyMacro "'a'v")))
@?= "xxxx"
, testCase "RepeatLast test 20" $
snd (last (unwindMacros (bindInput [ ("a", "'bz'v")
, ("c", "'aaa'v") ] coinput)
(stringToKeyMacro "c")))
@?= "bzzbzzbzzbzz"
, testCase "RepeatLast test 21" $
snd (last (unwindMacros (bindInput [("a", "'x'V")] coinput)
(stringToKeyMacro "'a'v")))
@?= "xxxx"
, testCase "RepeatLast test 22" $
snd (last (unwindMacros (bindInput [("a", "'xy'V")] coinput)
(stringToKeyMacro "'aa'v")))
@?= "xyxyxyxyxyxy"
, testCase "RepeatLast test 23" $
snd (last (unwindMacros (bindInput [("a", "'xy'v")] coinput)
(stringToKeyMacro "'aa'V")))
@?= "xyyxyyxyyxyy"
, testCase "RepeatLast test 24" $
snd (last (unwindMacros (bindInput [("a", "'xy'vv")] coinput)
(stringToKeyMacro "'aa'vv")))
@?= "xyyyxyyyxyyyxyyy"
, testCase "RepeatLast test 25" $
snd (last (unwindMacros (bindInput [("a", "'xyv'v")] coinput)
(stringToKeyMacro "'a'a'vv'")))
@?= "xyyyxyyyxyyyxyyy"
, testCase "RepeatLast test 26" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "'za'v")
, ("c", "'ab'v") ] coinput)
(stringToKeyMacro "'c'v")))
@?= "xyyzxyyxyyzxyyxyyxyyzxyyxyyzxyyxyy"
, testCase "RepeatLast test 27" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'V")
, ("b", "'za'v")
, ("c", "'ab'v") ] coinput)
(stringToKeyMacro "'c'v")))
@?= "xyxyzxyxyxyxyzxyxyxyxyxyxyzxyxyxyxyzxyxyxyxy"
, testCase "RepeatLast test 28" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "'za'V")
, ("c", "'ab'v") ] coinput)
(stringToKeyMacro "'c'v")))
@?= "xyyzxyyzxyyzxyyzxyyxyyzxyyzxyyzxyyzxyy"
, testCase "RepeatLast test 29" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "'za'V")
, ("c", "'ab'V") ] coinput)
(stringToKeyMacro "'c'v")))
@?= "xyyzxyyzxyyxyyzxyyzxyyxyyzxyyzxyyxyyzxyyzxyy"
, testCase "RepeatLast test 30" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "'za'V")
, ("c", "'ab'V") ] coinput)
(stringToKeyMacro "'c'V")))
@?= "xyyzxyyzxyyxyyzxyyzxyyxyyzxyyzxyyxyyzxyyzxyy"
, testCase "RepeatLast test 31" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "'za'v")
, ("c", "'ab'V") ] coinput)
(stringToKeyMacro "'c'V")))
@?= "xyyzxyyxyyxyyzxyyxyyxyyzxyyxyyxyyzxyyxyy"
, testCase "RepeatLast test 32" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "'za'v") ] coinput)
(stringToKeyMacro "'ab'vv")))
@?= "xyyzxyyxyyzxyyxyyzxyyxyy"
, testCase "RepeatLast test 33" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'V") ] coinput)
(stringToKeyMacro "a'za'vvv")))
@?= "xyxyzxyxyxyxyxyxyxyxy"
, testCase "RepeatLast test 34" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("c", "a'za'Vv") ] coinput)
(stringToKeyMacro "'c'v")))
@?= "xyyzxyyzxyyzxyyxyyzxyyzxyyzxyy"
, testCase "RepeatLast test 35" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "'za'V") ] coinput)
(stringToKeyMacro "'ab'Vv")))
@?= "xyyzxyyzxyyxyyzxyyzxyyxyyzxyyzxyy"
, testCase "RepeatLast test 36" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "za'za'") ] coinput)
(stringToKeyMacro "'ab'V'ab'V")))
@?= "xyyzxyyzxyyxyyzxyyzxyyxyyzxyyzxyyxyyzxyyzxyy"
, testCase "RepeatLast test 37" $
snd (last (unwindMacros (bindInput [ ("b", "z'xy'vv")
, ("c", "'xyvb'V") ] coinput)
(stringToKeyMacro "'c'V")))
@?= "xyyzxyyyxyyzxyyyxyyzxyyyxyyzxyyy"
, testCase "RepeatLast test 38" $
snd (last (unwindMacros coinput (stringToKeyMacro "'xv'V")))
@?= "xxxx"
, testCase "RepeatLast test 39" $
fst <$> unwindMacros coinput (stringToKeyMacro "'xv'V")
@?= [[(Right "", "'xv'V", "")],
[(Left "", "xv'V", "")],
[(Left "x", "v'V", "x")],
[(Left "x", "x'V", "x")],
[(Left "xx", "'V", "x")],
[(Right "xx", "V", "x")],
[(Right "", "xx", ""), (Right "xx", "", "V")],
[(Right "", "x", "x"), (Right "xx", "", "V")],
[(Right "xx", "", "V")]]
, testCase "RepeatLast test 40" $
snd (last (unwindMacros coinput (stringToKeyMacro "'xy'Vv")))
@?= "xyxyxy"
, testCase
"RepeatLast test 41; named macros not referentially transparent" $
snd (last (unwindMacros (bindInput [("a", "'xy'V")] coinput)
(stringToKeyMacro "av")))
@?= "xyxyxyxy" -- because @a@ repeated; good!
, testCase "RepeatLast test 42" $
snd (last (unwindMacros (bindInput [("a", "xy")] coinput)
(stringToKeyMacro "'a'Vv")))
because @V@ repeated ; good !
, testCase "RepeatLast test 43" $
snd (last (unwindMacros coinput (stringToKeyMacro "'xyV'V")))
@?= "xyxy"
, testCase "RepeatLast test 44" $
snd (last (unwindMacros coinput (stringToKeyMacro "'xyV'v")))
@?= "xyxy"
, testCase "RepeatLast test 45" $
snd (last (unwindMacros (bindInput [("a", "xyV")] coinput)
(stringToKeyMacro "'a'V")))
@?= "xyxy"
, testCase "RepeatLast test 46" $
snd (last (unwindMacros (bindInput [("a", "xyV")] coinput)
(stringToKeyMacro "'a'v")))
@?= "xyxy"
, testProperty "In-game macro and equivalent predefined macro agree" $
forAll (listOf (elements "`ABvV")) $
\macro ->
let bindings = bindInput [("a", macro)] coinput
inGameResult =
snd (last (unwindMacros coinput
(stringToKeyMacro macro)))
in inGameResult
=== snd (last (unwindMacros bindings
(stringToKeyMacro "a")))
.&&. inGameResult =/= "Macro looped" -- may not loop
, testProperty "In-game and predefined with limited minimal bindings" $
forAll (listOf (elements "````''''ABCABCABCABCvVvVvVa")) $ -- may loop
\macro ->
let bindings = bindInput [("a", macro)] coinput
in snd (last (unwindMacros bindings
(stringToKeyMacro macro)))
=== snd (last (unwindMacros bindings
(stringToKeyMacro "a")))
, testProperty "In-game and predefined with limited multiple bindings" $
forAll (listOf (elements "```ABCDvVabccc")) $
\macro ->
-- The macros may still loop due to mutual recursion,
-- even though direct recursion is ruled out by filtering.
let macroA = filter (/= 'a') macro
macroB = filter (/= 'b') $ take 5 $ reverse macro
bindings = bindInput [ ("a", macroA)
, ("b", macroB)
, ("c", "A'B''CD'") ]
coinput
in snd (last (unwindMacros bindings
(stringToKeyMacro macroA)))
=== snd (last (unwindMacros bindings
(stringToKeyMacro "a")))
]
| null | https://raw.githubusercontent.com/LambdaHack/LambdaHack/5b3773967479dd031eff440e7ca7132a6c795df2/test/SessionUIUnitTests.hs | haskell | quickcheck - verbose@ to verify that quickcheck
properties are not too often satisfied voidly.
because @a@ repeated; good!
may not loop
may loop
The macros may still loop due to mutual recursion,
even though direct recursion is ruled out by filtering. | module SessionUIUnitTests (macroTests) where
import Prelude ()
import Game.LambdaHack.Core.Prelude
import qualified Data.Map.Strict as M
import Test.Tasty
import Test.Tasty.HUnit
import Test.Tasty.QuickCheck
import qualified Game.LambdaHack.Client.UI.Content.Input as IC
import qualified Game.LambdaHack.Client.UI.HumanCmd as HumanCmd
import qualified Game.LambdaHack.Client.UI.Key as K
import Game.LambdaHack.Client.UI.SessionUI
import qualified Client.UI.Content.Input as Content.Input
import SessionUIMock
macroTests :: TestTree
macroTests = testGroup "macroTests" $
let coinput = IC.makeData Nothing Content.Input.standardKeysAndMouse
stringToKeyMacro = KeyMacro . map (K.mkKM . (: []))
listToKeyMacro = KeyMacro . map K.mkKM
bindInput l input =
let ltriple = M.fromList $ map (\(k, ks) ->
(K.mkKM k, ([], "", HumanCmd.Macro $ map (: []) ks))) l
in input {IC.bcmdMap = M.union ltriple $ IC.bcmdMap input}
in [ testCase "Macro 1 from PR#192 description" $
fst <$> unwindMacros coinput (stringToKeyMacro "'j''j'")
@?= [ [ (Right "", "'j''j'", "") ]
, [ (Left "", "j''j'", "") ]
, [ (Left "j", "''j'", "j") ]
, [ (Right "j", "'j'", "j") ]
, [ (Left "", "j'", "j") ]
, [ (Left "j", "'", "j") ]
, [ (Right "j", "", "j") ]
]
, testCase "Macro 1 from Issue#189 description" $
snd (last (unwindMacros (bindInput [ ("a", "'bc'V")
, ("c", "'aaa'V") ] coinput)
(stringToKeyMacro "a")))
@?= "Macro looped"
, testCase "Macro 2 from Issue#189 description" $
snd (last (unwindMacros (bindInput [("a", "'x'")] coinput)
(stringToKeyMacro "'a'")))
@?= "x"
, testCase "Macro 3 from Issue#189 description" $
snd (last (unwindMacros coinput
(stringToKeyMacro "'x''x'")))
@?= "xx"
, testCase "Macro 4 from Issue#189 description" $
snd (last (unwindMacros coinput
(stringToKeyMacro "'x''x'V")))
@?= "xxx"
, testCase "Macro 5 from Issue#189 description" $
snd (last (unwindMacros coinput
(stringToKeyMacro "x'x'V")))
@?= "xxx"
, testCase "Macro test 10" $
snd (last (unwindMacros coinput
(stringToKeyMacro "x'y'V")))
@?= "xyy"
, testCase "Macro test 11" $
snd (last (unwindMacros coinput
(stringToKeyMacro "'x''y'V")))
@?= "xyy"
, testCase "Macro test 12" $
snd (last (unwindMacros coinput
(listToKeyMacro ["x", "C-V"])))
@?= "x"
, testCase "Macro test 13" $
snd (last (unwindMacros coinput
(listToKeyMacro ["'", "x", "'", "C-V"])))
@?= "xxxxxxxxxxxxxxxxxxxxxxxxxx"
, testCase "Macro test 14" $
snd (last (unwindMacros coinput
(listToKeyMacro ["'", "x", "'", "y", "C-V"])))
@?= "xyxxxxxxxxxxxxxxxxxxxxxxxxx"
, testCase "Macro test 15" $
snd (last (unwindMacros (bindInput [("a", "x")] coinput)
(stringToKeyMacro "'a'V")))
@?= "xx"
, testCase "Macro test 16" $
snd (last (unwindMacros (bindInput [("a", "'x'")] coinput)
(stringToKeyMacro "'a'V")))
@?= "xx"
, testCase "Macro test 17" $
snd (last (unwindMacros (bindInput [("a", "'x'V")] coinput)
(stringToKeyMacro "a")))
@?= "xx"
, testCase "Macro test 18" $
snd (last (unwindMacros (bindInput [("a", "'x'V")] coinput)
(stringToKeyMacro "'a'")))
@?= "xx"
, testCase "Macro test 19" $
snd (last (unwindMacros (bindInput [("a", "'x'V")] coinput)
(stringToKeyMacro "'a'V")))
@?= "xxxx"
, testCase "Macro test 20" $
snd (last (unwindMacros (bindInput [ ("a", "'bz'V")
, ("c", "'aaa'V") ] coinput)
(stringToKeyMacro "c")))
@?= "bzbzbzbzbzbzbzbzbzbzbzbz"
, testCase "RepeatLast test 10" $
snd (last (unwindMacros coinput
(stringToKeyMacro "x'y'v")))
@?= "xyy"
, testCase "RepeatLast test 11" $
snd (last (unwindMacros coinput
(stringToKeyMacro "'x'yv")))
@?= "xyy"
, testCase "RepeatLast test 12" $
snd (last (unwindMacros coinput
(listToKeyMacro ["v", "C-v"])))
@?= ""
, testCase "RepeatLast test 13" $
snd (last (unwindMacros coinput
(listToKeyMacro ["'", "x", "'", "C-v"])))
@?= "xxxxxxxxxxxxxxxxxxxxxxxxxx"
, testCase "RepeatLast test 14" $
snd (last (unwindMacros coinput
(listToKeyMacro ["'", "x", "'", "V", "C-v"])))
@?= "xxxxxxxxxxxxxxxxxxxxxxxxxxx"
, testCase "RepeatLast test 15" $
snd (last (unwindMacros (bindInput [("a", "x")] coinput)
(stringToKeyMacro "av")))
@?= "xx"
, testCase "RepeatLast test 16" $
snd (last (unwindMacros (bindInput [("a", "'x'")] coinput)
(stringToKeyMacro "'a'v")))
@?= "xx"
, testCase "RepeatLast test 17" $
snd (last (unwindMacros (bindInput [("a", "'x'v")] coinput)
(stringToKeyMacro "a")))
@?= "xx"
, testCase "RepeatLast test 18" $
snd (last (unwindMacros (bindInput [("a", "'x'v")] coinput)
(stringToKeyMacro "'a'")))
@?= "xx"
, testCase "RepeatLast test 19" $
snd (last (unwindMacros (bindInput [("a", "'x'v")] coinput)
(stringToKeyMacro "'a'v")))
@?= "xxxx"
, testCase "RepeatLast test 20" $
snd (last (unwindMacros (bindInput [ ("a", "'bz'v")
, ("c", "'aaa'v") ] coinput)
(stringToKeyMacro "c")))
@?= "bzzbzzbzzbzz"
, testCase "RepeatLast test 21" $
snd (last (unwindMacros (bindInput [("a", "'x'V")] coinput)
(stringToKeyMacro "'a'v")))
@?= "xxxx"
, testCase "RepeatLast test 22" $
snd (last (unwindMacros (bindInput [("a", "'xy'V")] coinput)
(stringToKeyMacro "'aa'v")))
@?= "xyxyxyxyxyxy"
, testCase "RepeatLast test 23" $
snd (last (unwindMacros (bindInput [("a", "'xy'v")] coinput)
(stringToKeyMacro "'aa'V")))
@?= "xyyxyyxyyxyy"
, testCase "RepeatLast test 24" $
snd (last (unwindMacros (bindInput [("a", "'xy'vv")] coinput)
(stringToKeyMacro "'aa'vv")))
@?= "xyyyxyyyxyyyxyyy"
, testCase "RepeatLast test 25" $
snd (last (unwindMacros (bindInput [("a", "'xyv'v")] coinput)
(stringToKeyMacro "'a'a'vv'")))
@?= "xyyyxyyyxyyyxyyy"
, testCase "RepeatLast test 26" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "'za'v")
, ("c", "'ab'v") ] coinput)
(stringToKeyMacro "'c'v")))
@?= "xyyzxyyxyyzxyyxyyxyyzxyyxyyzxyyxyy"
, testCase "RepeatLast test 27" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'V")
, ("b", "'za'v")
, ("c", "'ab'v") ] coinput)
(stringToKeyMacro "'c'v")))
@?= "xyxyzxyxyxyxyzxyxyxyxyxyxyzxyxyxyxyzxyxyxyxy"
, testCase "RepeatLast test 28" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "'za'V")
, ("c", "'ab'v") ] coinput)
(stringToKeyMacro "'c'v")))
@?= "xyyzxyyzxyyzxyyzxyyxyyzxyyzxyyzxyyzxyy"
, testCase "RepeatLast test 29" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "'za'V")
, ("c", "'ab'V") ] coinput)
(stringToKeyMacro "'c'v")))
@?= "xyyzxyyzxyyxyyzxyyzxyyxyyzxyyzxyyxyyzxyyzxyy"
, testCase "RepeatLast test 30" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "'za'V")
, ("c", "'ab'V") ] coinput)
(stringToKeyMacro "'c'V")))
@?= "xyyzxyyzxyyxyyzxyyzxyyxyyzxyyzxyyxyyzxyyzxyy"
, testCase "RepeatLast test 31" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "'za'v")
, ("c", "'ab'V") ] coinput)
(stringToKeyMacro "'c'V")))
@?= "xyyzxyyxyyxyyzxyyxyyxyyzxyyxyyxyyzxyyxyy"
, testCase "RepeatLast test 32" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "'za'v") ] coinput)
(stringToKeyMacro "'ab'vv")))
@?= "xyyzxyyxyyzxyyxyyzxyyxyy"
, testCase "RepeatLast test 33" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'V") ] coinput)
(stringToKeyMacro "a'za'vvv")))
@?= "xyxyzxyxyxyxyxyxyxyxy"
, testCase "RepeatLast test 34" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("c", "a'za'Vv") ] coinput)
(stringToKeyMacro "'c'v")))
@?= "xyyzxyyzxyyzxyyxyyzxyyzxyyzxyy"
, testCase "RepeatLast test 35" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "'za'V") ] coinput)
(stringToKeyMacro "'ab'Vv")))
@?= "xyyzxyyzxyyxyyzxyyzxyyxyyzxyyzxyy"
, testCase "RepeatLast test 36" $
snd (last (unwindMacros (bindInput [ ("a", "'xy'v")
, ("b", "za'za'") ] coinput)
(stringToKeyMacro "'ab'V'ab'V")))
@?= "xyyzxyyzxyyxyyzxyyzxyyxyyzxyyzxyyxyyzxyyzxyy"
, testCase "RepeatLast test 37" $
snd (last (unwindMacros (bindInput [ ("b", "z'xy'vv")
, ("c", "'xyvb'V") ] coinput)
(stringToKeyMacro "'c'V")))
@?= "xyyzxyyyxyyzxyyyxyyzxyyyxyyzxyyy"
, testCase "RepeatLast test 38" $
snd (last (unwindMacros coinput (stringToKeyMacro "'xv'V")))
@?= "xxxx"
, testCase "RepeatLast test 39" $
fst <$> unwindMacros coinput (stringToKeyMacro "'xv'V")
@?= [[(Right "", "'xv'V", "")],
[(Left "", "xv'V", "")],
[(Left "x", "v'V", "x")],
[(Left "x", "x'V", "x")],
[(Left "xx", "'V", "x")],
[(Right "xx", "V", "x")],
[(Right "", "xx", ""), (Right "xx", "", "V")],
[(Right "", "x", "x"), (Right "xx", "", "V")],
[(Right "xx", "", "V")]]
, testCase "RepeatLast test 40" $
snd (last (unwindMacros coinput (stringToKeyMacro "'xy'Vv")))
@?= "xyxyxy"
, testCase
"RepeatLast test 41; named macros not referentially transparent" $
snd (last (unwindMacros (bindInput [("a", "'xy'V")] coinput)
(stringToKeyMacro "av")))
, testCase "RepeatLast test 42" $
snd (last (unwindMacros (bindInput [("a", "xy")] coinput)
(stringToKeyMacro "'a'Vv")))
because @V@ repeated ; good !
, testCase "RepeatLast test 43" $
snd (last (unwindMacros coinput (stringToKeyMacro "'xyV'V")))
@?= "xyxy"
, testCase "RepeatLast test 44" $
snd (last (unwindMacros coinput (stringToKeyMacro "'xyV'v")))
@?= "xyxy"
, testCase "RepeatLast test 45" $
snd (last (unwindMacros (bindInput [("a", "xyV")] coinput)
(stringToKeyMacro "'a'V")))
@?= "xyxy"
, testCase "RepeatLast test 46" $
snd (last (unwindMacros (bindInput [("a", "xyV")] coinput)
(stringToKeyMacro "'a'v")))
@?= "xyxy"
, testProperty "In-game macro and equivalent predefined macro agree" $
forAll (listOf (elements "`ABvV")) $
\macro ->
let bindings = bindInput [("a", macro)] coinput
inGameResult =
snd (last (unwindMacros coinput
(stringToKeyMacro macro)))
in inGameResult
=== snd (last (unwindMacros bindings
(stringToKeyMacro "a")))
, testProperty "In-game and predefined with limited minimal bindings" $
\macro ->
let bindings = bindInput [("a", macro)] coinput
in snd (last (unwindMacros bindings
(stringToKeyMacro macro)))
=== snd (last (unwindMacros bindings
(stringToKeyMacro "a")))
, testProperty "In-game and predefined with limited multiple bindings" $
forAll (listOf (elements "```ABCDvVabccc")) $
\macro ->
let macroA = filter (/= 'a') macro
macroB = filter (/= 'b') $ take 5 $ reverse macro
bindings = bindInput [ ("a", macroA)
, ("b", macroB)
, ("c", "A'B''CD'") ]
coinput
in snd (last (unwindMacros bindings
(stringToKeyMacro macroA)))
=== snd (last (unwindMacros bindings
(stringToKeyMacro "a")))
]
|
1a3b74d67962ad0bca5ea8c5a967a67a1046c21017b75d5a2e8f91608ff798c0 | wilbowma/cur | info.rkt | #lang info
(define collection 'multi)
(define deps '("cur-lib" "cur-doc" "cur-test"))
(define implies '("cur-lib" "cur-doc" "cur-test"))
(define pkg-desc "Dependent types with parenthesis and meta-programming.")
(define pkg-authors '(wilbowma))
| null | https://raw.githubusercontent.com/wilbowma/cur/e039c98941b3d272c6e462387df22846e10b0128/cur/info.rkt | racket | #lang info
(define collection 'multi)
(define deps '("cur-lib" "cur-doc" "cur-test"))
(define implies '("cur-lib" "cur-doc" "cur-test"))
(define pkg-desc "Dependent types with parenthesis and meta-programming.")
(define pkg-authors '(wilbowma))
| |
f9f80c4d9a2160bf9d9b3f6e21add70e1b4c90b1801700701ed2188990819860 | magnolia-lang/magnolia-lang | PPrint.hs | # LANGUAGE FlexibleInstances #
{-# LANGUAGE OverloadedStrings #-}
# LANGUAGE ScopedTypeVariables #
# OPTIONS_GHC -Wno - orphans #
module Magnolia.PPrint (pprint, pprintList, pshow, render) where
import Control.Monad (join)
import qualified Data.List.NonEmpty as NE
import qualified Data.Map as M
import qualified Data.Text.Lazy as T
import qualified Data.Text.Lazy.IO as TIO
import Prettyprinter
import Prettyprinter.Render.Text
import Data.Void (absurd)
import Backend
import Env
import Err
import Magnolia.Syntax
-- The below pprinting and error-handling related utils are directly inspired
from their equivalent in -research/dex-lang .
p :: Pretty a => a -> Doc ann
p = pretty
-- TODO: Text.Lazy -> Text.Strict (renderLazy -> renderStrict)
pprint :: Pretty a => a -> IO ()
pprint = printDoc . p
printDoc :: Doc ann -> IO ()
printDoc = TIO.putStrLn . render
render :: Doc ann -> T.Text
render = renderLazy . layoutPretty defaultLayoutOptions
pshow :: Pretty a => a -> T.Text
pshow = render . p
pprintList :: Pretty a => [a] -> IO ()
pprintList = printDoc . vsep . punctuate line . map p
instance Pretty Err where -- TODO: change error to have error types
pretty (Err errType src parentScopes txt) =
p src <> ":" <+> p errType <> (case parentScopes of
[] -> ""
ps -> " in " <> concatWith (surround dot) (map p ps)) <> ":" <+> p txt
instance Pretty SrcCtx where
pretty (SrcCtx msrcInfo) = case msrcInfo of
Nothing -> "<unknown location>"
Just ((filename, startLine, startColumn), _) ->
p filename <> ":" <> p startLine <> ":" <> p startColumn
instance Pretty ErrType where
pretty e = case e of
AmbiguousFunctionRefErr -> ambiguous "functions"
AmbiguousTopLevelRefErr -> ambiguous "top-level references"
AmbiguousProcedureRefErr -> ambiguous "procedures"
CompilerErr -> "Compiler bug!" <> line
<> "Please report this at github.com/magnolia-lang/magnolia-lang"
<> line
CyclicErr -> "Error: found cyclic dependency"
DeclContextErr -> "Declaration context error"
InvalidDeclErr -> "Declaration error"
MiscErr -> "Error"
ModeMismatchErr -> "Mode error"
NotImplementedErr -> "Not implemented"
ParseErr -> "Parse error"
TypeErr -> "Type error"
UnboundFunctionErr -> unbound "function"
UnboundTopLevelErr -> unbound "top-level reference"
UnboundNameErr -> unbound "name"
UnboundProcedureErr -> unbound "procedure"
UnboundTypeErr -> unbound "type"
UnboundVarErr -> unbound "variable"
where
ambiguous s = "Error: could not disambiguate between" <+> s
unbound s = "Error:" <+> s <+> "not in scope"
instance Pretty Name where
pretty (Name _ str) = p str
instance Pretty NameSpace where
pretty ns = (case ns of
NSDirectory -> "directory"
NSFunction -> "function"
NSGenerated -> "generated"
NSModule -> "module"
NSPackage -> "package"
NSProcedure -> "procedure"
NSRenaming -> "renaming"
NSSatisfaction -> "satisfaction"
NSType -> "type"
NSUnspecified -> "unspecified"
NSVariable -> "variable") <+> "namespace"
instance Pretty FullyQualifiedName where
pretty (FullyQualifiedName mscopeName targetName) =
maybe "" (\n -> p n <> ".") mscopeName <> p targetName
instance (Show (e p), Pretty (e p)) => Pretty (Ann p e) where
pretty = p . _elem
instance Pretty (MPackage' PhCheck) where
pretty (MPackage name decls deps) =
let importHeader = case deps of
[] -> ""
_ -> "imports" <+> align (vsep (punctuate comma (map p deps)))
in "package" <+> p name <+> importHeader <+> ";" <> "\n\n"
<> vsep (map p (join (M.elems decls)))
instance Pretty (MPackageDep' PhCheck) where
pretty (MPackageDep name) = p name
instance Pretty (MTopLevelDecl PhCheck) where
pretty decl = case decl of
MNamedRenamingDecl namedRenaming -> p namedRenaming
MModuleDecl modul -> p modul
MSatisfactionDecl satisfaction -> p satisfaction
instance Pretty (MNamedRenaming' PhCheck) where
pretty (MNamedRenaming name block) =
"renaming" <+> p name <+> "=" <+> p block
instance Pretty (MSatisfaction' PhCheck) where
TODO
instance Pretty (MModule' PhCheck) where
pretty (MModule moduleType name moduleExpr) =
p moduleType <+> p name <+> "=" <+> p moduleExpr
instance Pretty (MModuleExpr' PhCheck) where
pretty (MModuleDef decls deps renamingBlocks) =
lbrace <> line <>
indent 4 (vsep (map p deps <>
map ((<> semi) . p) (join (M.elems decls)))) <> line <>
rbrace <> align (vsep $ map p renamingBlocks)
pretty (MModuleRef v _) = absurd v
pretty (MModuleAsSignature v _) = absurd v
pretty (MModuleExternal backend fqn moduleExpr') =
"external" <+> p backend <+> p fqn <+> p moduleExpr'
instance Pretty (MModuleDep' PhCheck) where
pretty (MModuleDep mmoduleDepType mmoduleDepModuleExpr) =
p mmoduleDepType <+> p mmoduleDepModuleExpr
instance Pretty MModuleDepType where
pretty mmoduleDepType = case mmoduleDepType of
MModuleDepRequire -> "require"
MModuleDepUse -> "use"
instance Pretty (MRenamingBlock' PhCheck) where
pretty (MRenamingBlock renamingBlockTy renamings) =
let content = hsep (punctuate comma (map p renamings))
in case renamingBlockTy of
PartialRenamingBlock -> "[[" <> content <> "]]"
TotalRenamingBlock -> brackets content
instance Pretty (MRenaming' PhCheck) where
pretty renaming = case renaming of
InlineRenaming (src, tgt) -> p src <+> "=>" <+> p tgt
RefRenaming v -> absurd v
instance Pretty MModuleType where
pretty typ = case typ of
Signature -> "signature"
Concept -> "concept"
Implementation -> "implementation"
Program -> "program"
instance Pretty Backend where
pretty backend = case backend of
Cxx -> "C++"
JavaScript -> "JavaScript"
Python -> "Python"
instance Pretty (MDecl PhCheck) where
pretty decl = case decl of
MTypeDecl modifiers tdecl -> hsep (map p modifiers) <+> pretty tdecl
MCallableDecl modifiers cdecl -> hsep (map p modifiers) <+> pretty cdecl
instance Pretty MModifier where
pretty Require = "require"
instance Pretty (MTypeDecl' p) where
pretty (Type typ) = "type" <+> p typ
instance Pretty (MCallableDecl' PhCheck) where
pretty (Callable callableType name args ret mguard cbody) =
let pret = if callableType == Function then " : " <> p ret else ""
pbody = case cbody of EmptyBody -> ""
MagnoliaBody body -> " = " <> p body
ExternalBody () -> " = <external impl>;"
BuiltinBody -> " (builtin);"
pguard = case mguard of Nothing -> ""
Just guard -> " guard " <> p guard
in p callableType <+> p name <> prettyArgs <>
pret <> pguard <> pbody
where
prettyArgs :: Doc ann
prettyArgs = case callableType of
Procedure -> parens $ hsep $ punctuate comma (map p args)
_ -> parens $ hsep $ punctuate comma $
map (\(Ann _ a) -> p (nodeName a) <+> ":" <+> p (_varType a)) args
instance Pretty MCallableType where
pretty callableType = case callableType of
Axiom -> "axiom"
Function -> "function"
Predicate -> "predicate"
Procedure -> "procedure"
instance Pretty (MExpr' p) where
pretty e = pNoSemi e <> semi
where
pNoSemi :: MExpr' p -> Doc ann
pNoSemi expr = case expr of
MVar v -> p (nodeName v)
MCall name args mcast -> let parglist = map (pNoSemi . _elem) args in
p name <> parens (hsep (punctuate comma parglist)) <>
(case mcast of Nothing -> ""; Just cast -> " : " <> p cast)
MBlockExpr _ block ->
vsep [ nest 4 (vsep ( "{" : map p (NE.toList block)))
, "}"
]
MValue expr' -> "value" <+> p expr'
TODO : modes are for now ignore in MLet
MLet (Ann _ (Var _ name mcast)) mass ->
let pcast = case mcast of Nothing -> ""; Just cast -> " : " <> p cast
pass = case mass of Nothing -> ""
Just ass -> " = " <> pNoSemi (_elem ass)
in "var" <+> p name <> pcast <> pass
MIf cond etrue efalse -> align $ vsep [ "if" <+> p cond
, "then" <+> p etrue
, "else" <+> p efalse <+> "end"
]
MAssert aexpr -> "assert" <+> pNoSemi (_elem aexpr)
MSkip -> "skip"
instance Pretty (MaybeTypedVar' p) where
pretty (Var mode name mtyp) = case mtyp of
Nothing -> p mode <+> p name
Just typ -> p mode <+> p name <+> ":" <+> p typ
instance Pretty (TypedVar' p) where
pretty (Var mode name typ) = p mode <+> p name <+> ":" <+> p typ
instance Pretty MVarMode where
pretty mode = case mode of
MObs -> "obs"
MOut -> "out"
MUnk -> "unk"
MUpd -> "upd" | null | https://raw.githubusercontent.com/magnolia-lang/magnolia-lang/ff29126a72c9f7bec7d098c25e74606fef5464e5/src/lib/Magnolia/PPrint.hs | haskell | # LANGUAGE OverloadedStrings #
The below pprinting and error-handling related utils are directly inspired
TODO: Text.Lazy -> Text.Strict (renderLazy -> renderStrict)
TODO: change error to have error types | # LANGUAGE FlexibleInstances #
# LANGUAGE ScopedTypeVariables #
# OPTIONS_GHC -Wno - orphans #
module Magnolia.PPrint (pprint, pprintList, pshow, render) where
import Control.Monad (join)
import qualified Data.List.NonEmpty as NE
import qualified Data.Map as M
import qualified Data.Text.Lazy as T
import qualified Data.Text.Lazy.IO as TIO
import Prettyprinter
import Prettyprinter.Render.Text
import Data.Void (absurd)
import Backend
import Env
import Err
import Magnolia.Syntax
from their equivalent in -research/dex-lang .
p :: Pretty a => a -> Doc ann
p = pretty
pprint :: Pretty a => a -> IO ()
pprint = printDoc . p
printDoc :: Doc ann -> IO ()
printDoc = TIO.putStrLn . render
render :: Doc ann -> T.Text
render = renderLazy . layoutPretty defaultLayoutOptions
pshow :: Pretty a => a -> T.Text
pshow = render . p
pprintList :: Pretty a => [a] -> IO ()
pprintList = printDoc . vsep . punctuate line . map p
pretty (Err errType src parentScopes txt) =
p src <> ":" <+> p errType <> (case parentScopes of
[] -> ""
ps -> " in " <> concatWith (surround dot) (map p ps)) <> ":" <+> p txt
instance Pretty SrcCtx where
pretty (SrcCtx msrcInfo) = case msrcInfo of
Nothing -> "<unknown location>"
Just ((filename, startLine, startColumn), _) ->
p filename <> ":" <> p startLine <> ":" <> p startColumn
instance Pretty ErrType where
pretty e = case e of
AmbiguousFunctionRefErr -> ambiguous "functions"
AmbiguousTopLevelRefErr -> ambiguous "top-level references"
AmbiguousProcedureRefErr -> ambiguous "procedures"
CompilerErr -> "Compiler bug!" <> line
<> "Please report this at github.com/magnolia-lang/magnolia-lang"
<> line
CyclicErr -> "Error: found cyclic dependency"
DeclContextErr -> "Declaration context error"
InvalidDeclErr -> "Declaration error"
MiscErr -> "Error"
ModeMismatchErr -> "Mode error"
NotImplementedErr -> "Not implemented"
ParseErr -> "Parse error"
TypeErr -> "Type error"
UnboundFunctionErr -> unbound "function"
UnboundTopLevelErr -> unbound "top-level reference"
UnboundNameErr -> unbound "name"
UnboundProcedureErr -> unbound "procedure"
UnboundTypeErr -> unbound "type"
UnboundVarErr -> unbound "variable"
where
ambiguous s = "Error: could not disambiguate between" <+> s
unbound s = "Error:" <+> s <+> "not in scope"
instance Pretty Name where
pretty (Name _ str) = p str
instance Pretty NameSpace where
pretty ns = (case ns of
NSDirectory -> "directory"
NSFunction -> "function"
NSGenerated -> "generated"
NSModule -> "module"
NSPackage -> "package"
NSProcedure -> "procedure"
NSRenaming -> "renaming"
NSSatisfaction -> "satisfaction"
NSType -> "type"
NSUnspecified -> "unspecified"
NSVariable -> "variable") <+> "namespace"
instance Pretty FullyQualifiedName where
pretty (FullyQualifiedName mscopeName targetName) =
maybe "" (\n -> p n <> ".") mscopeName <> p targetName
instance (Show (e p), Pretty (e p)) => Pretty (Ann p e) where
pretty = p . _elem
instance Pretty (MPackage' PhCheck) where
pretty (MPackage name decls deps) =
let importHeader = case deps of
[] -> ""
_ -> "imports" <+> align (vsep (punctuate comma (map p deps)))
in "package" <+> p name <+> importHeader <+> ";" <> "\n\n"
<> vsep (map p (join (M.elems decls)))
instance Pretty (MPackageDep' PhCheck) where
pretty (MPackageDep name) = p name
instance Pretty (MTopLevelDecl PhCheck) where
pretty decl = case decl of
MNamedRenamingDecl namedRenaming -> p namedRenaming
MModuleDecl modul -> p modul
MSatisfactionDecl satisfaction -> p satisfaction
instance Pretty (MNamedRenaming' PhCheck) where
pretty (MNamedRenaming name block) =
"renaming" <+> p name <+> "=" <+> p block
instance Pretty (MSatisfaction' PhCheck) where
TODO
instance Pretty (MModule' PhCheck) where
pretty (MModule moduleType name moduleExpr) =
p moduleType <+> p name <+> "=" <+> p moduleExpr
instance Pretty (MModuleExpr' PhCheck) where
pretty (MModuleDef decls deps renamingBlocks) =
lbrace <> line <>
indent 4 (vsep (map p deps <>
map ((<> semi) . p) (join (M.elems decls)))) <> line <>
rbrace <> align (vsep $ map p renamingBlocks)
pretty (MModuleRef v _) = absurd v
pretty (MModuleAsSignature v _) = absurd v
pretty (MModuleExternal backend fqn moduleExpr') =
"external" <+> p backend <+> p fqn <+> p moduleExpr'
instance Pretty (MModuleDep' PhCheck) where
pretty (MModuleDep mmoduleDepType mmoduleDepModuleExpr) =
p mmoduleDepType <+> p mmoduleDepModuleExpr
instance Pretty MModuleDepType where
pretty mmoduleDepType = case mmoduleDepType of
MModuleDepRequire -> "require"
MModuleDepUse -> "use"
instance Pretty (MRenamingBlock' PhCheck) where
pretty (MRenamingBlock renamingBlockTy renamings) =
let content = hsep (punctuate comma (map p renamings))
in case renamingBlockTy of
PartialRenamingBlock -> "[[" <> content <> "]]"
TotalRenamingBlock -> brackets content
instance Pretty (MRenaming' PhCheck) where
pretty renaming = case renaming of
InlineRenaming (src, tgt) -> p src <+> "=>" <+> p tgt
RefRenaming v -> absurd v
instance Pretty MModuleType where
pretty typ = case typ of
Signature -> "signature"
Concept -> "concept"
Implementation -> "implementation"
Program -> "program"
instance Pretty Backend where
pretty backend = case backend of
Cxx -> "C++"
JavaScript -> "JavaScript"
Python -> "Python"
instance Pretty (MDecl PhCheck) where
pretty decl = case decl of
MTypeDecl modifiers tdecl -> hsep (map p modifiers) <+> pretty tdecl
MCallableDecl modifiers cdecl -> hsep (map p modifiers) <+> pretty cdecl
instance Pretty MModifier where
pretty Require = "require"
instance Pretty (MTypeDecl' p) where
pretty (Type typ) = "type" <+> p typ
instance Pretty (MCallableDecl' PhCheck) where
pretty (Callable callableType name args ret mguard cbody) =
let pret = if callableType == Function then " : " <> p ret else ""
pbody = case cbody of EmptyBody -> ""
MagnoliaBody body -> " = " <> p body
ExternalBody () -> " = <external impl>;"
BuiltinBody -> " (builtin);"
pguard = case mguard of Nothing -> ""
Just guard -> " guard " <> p guard
in p callableType <+> p name <> prettyArgs <>
pret <> pguard <> pbody
where
prettyArgs :: Doc ann
prettyArgs = case callableType of
Procedure -> parens $ hsep $ punctuate comma (map p args)
_ -> parens $ hsep $ punctuate comma $
map (\(Ann _ a) -> p (nodeName a) <+> ":" <+> p (_varType a)) args
instance Pretty MCallableType where
pretty callableType = case callableType of
Axiom -> "axiom"
Function -> "function"
Predicate -> "predicate"
Procedure -> "procedure"
instance Pretty (MExpr' p) where
pretty e = pNoSemi e <> semi
where
pNoSemi :: MExpr' p -> Doc ann
pNoSemi expr = case expr of
MVar v -> p (nodeName v)
MCall name args mcast -> let parglist = map (pNoSemi . _elem) args in
p name <> parens (hsep (punctuate comma parglist)) <>
(case mcast of Nothing -> ""; Just cast -> " : " <> p cast)
MBlockExpr _ block ->
vsep [ nest 4 (vsep ( "{" : map p (NE.toList block)))
, "}"
]
MValue expr' -> "value" <+> p expr'
TODO : modes are for now ignore in MLet
MLet (Ann _ (Var _ name mcast)) mass ->
let pcast = case mcast of Nothing -> ""; Just cast -> " : " <> p cast
pass = case mass of Nothing -> ""
Just ass -> " = " <> pNoSemi (_elem ass)
in "var" <+> p name <> pcast <> pass
MIf cond etrue efalse -> align $ vsep [ "if" <+> p cond
, "then" <+> p etrue
, "else" <+> p efalse <+> "end"
]
MAssert aexpr -> "assert" <+> pNoSemi (_elem aexpr)
MSkip -> "skip"
instance Pretty (MaybeTypedVar' p) where
pretty (Var mode name mtyp) = case mtyp of
Nothing -> p mode <+> p name
Just typ -> p mode <+> p name <+> ":" <+> p typ
instance Pretty (TypedVar' p) where
pretty (Var mode name typ) = p mode <+> p name <+> ":" <+> p typ
instance Pretty MVarMode where
pretty mode = case mode of
MObs -> "obs"
MOut -> "out"
MUnk -> "unk"
MUpd -> "upd" |
d8615b679641d2d2118fd4ba915f061839274d782d75fc107d095cae0b6edf2f | tsloughter/kuberl | kuberl_policy_v1beta1_allowed_flex_volume.erl | -module(kuberl_policy_v1beta1_allowed_flex_volume).
-export([encode/1]).
-export_type([kuberl_policy_v1beta1_allowed_flex_volume/0]).
-type kuberl_policy_v1beta1_allowed_flex_volume() ::
#{ 'driver' := binary()
}.
encode(#{ 'driver' := Driver
}) ->
#{ 'driver' => Driver
}.
| null | https://raw.githubusercontent.com/tsloughter/kuberl/f02ae6680d6ea5db6e8b6c7acbee8c4f9df482e2/gen/kuberl_policy_v1beta1_allowed_flex_volume.erl | erlang | -module(kuberl_policy_v1beta1_allowed_flex_volume).
-export([encode/1]).
-export_type([kuberl_policy_v1beta1_allowed_flex_volume/0]).
-type kuberl_policy_v1beta1_allowed_flex_volume() ::
#{ 'driver' := binary()
}.
encode(#{ 'driver' := Driver
}) ->
#{ 'driver' => Driver
}.
| |
479d8595150481c1443a7ed6af426a0e496978785d02c837c414592870d4662c | alexprut/earth-defender | monitor_mesh.erl | -module(monitor_mesh).
%% External exports
-export([start_monitor_mesh/0]).
%% Internal exports
-export([monitor_mesh/0]).
%%% ---------------------------------------------------
%%%
%%% Monitor all mesh nodes.
%%%
%%% ---------------------------------------------------
start_monitor_mesh() ->
spawn(?MODULE, monitor_mesh, []).
monitor_mesh() ->
net_kernel:monitor_nodes(true),
utils:log("Monitoring mesh nodes. ~n", []),
monitor_mesh_loop().
monitor_mesh_loop() ->
receive
{nodeup, Node} ->
utils:log("Node: ~p is up, detected at node: ~p~n", [Node, node()]),
monitor_mesh_loop();
{nodedown, Node} ->
utils:log("Node: ~p is down, detected at node: ~p~n", [Node, node()]),
case local_rooms_state:is_master() of
true ->
utils:log("Slave died, node: ~p~n", [Node]),
local_rooms_state:remove_slave(Node);
false ->
utils:log("Maybe a master died.~n", []),
{Master_name, _} = slave_handler:get_master_data(),
utils:log("Last master name: ~p~n", [Master_name]),
case Master_name == Node of
true ->
% Master died, election algorithm (Bully algorithm modified version)
utils:log("Master died, node: ~p~n", [Node]),
New_master = lists:max([node() | nodes()]),
case New_master == node() of
true ->
utils:log("I'm the new master, takeover.~n", []),
local_rooms_state ! master_takeover;
false ->
utils:log("The new master should be: ~p~n", [New_master]),
Master_service_url = rpc:call(New_master, utils, get_service_url, [], 2000),
case Master_service_url of
{badrpc, _} ->
utils:log("Badrpc at node: ~p~n", [Node]),
ok;
_ ->
utils:log("Temp master data, the next master node could be: ~p~n", [New_master]),
slave_handler:set_master_data({New_master, Master_service_url})
end
end;
false ->
% A slave died
utils:log("A slave died.~n", []),
ok
end
end,
monitor_mesh_loop();
stop ->
exit(kill, self())
end.
| null | https://raw.githubusercontent.com/alexprut/earth-defender/5d4d8f0832fc74882a701d6a0dedee23fd494648/server/src/monitor_mesh.erl | erlang | External exports
Internal exports
---------------------------------------------------
Monitor all mesh nodes.
---------------------------------------------------
Master died, election algorithm (Bully algorithm modified version)
A slave died | -module(monitor_mesh).
-export([start_monitor_mesh/0]).
-export([monitor_mesh/0]).
start_monitor_mesh() ->
spawn(?MODULE, monitor_mesh, []).
monitor_mesh() ->
net_kernel:monitor_nodes(true),
utils:log("Monitoring mesh nodes. ~n", []),
monitor_mesh_loop().
monitor_mesh_loop() ->
receive
{nodeup, Node} ->
utils:log("Node: ~p is up, detected at node: ~p~n", [Node, node()]),
monitor_mesh_loop();
{nodedown, Node} ->
utils:log("Node: ~p is down, detected at node: ~p~n", [Node, node()]),
case local_rooms_state:is_master() of
true ->
utils:log("Slave died, node: ~p~n", [Node]),
local_rooms_state:remove_slave(Node);
false ->
utils:log("Maybe a master died.~n", []),
{Master_name, _} = slave_handler:get_master_data(),
utils:log("Last master name: ~p~n", [Master_name]),
case Master_name == Node of
true ->
utils:log("Master died, node: ~p~n", [Node]),
New_master = lists:max([node() | nodes()]),
case New_master == node() of
true ->
utils:log("I'm the new master, takeover.~n", []),
local_rooms_state ! master_takeover;
false ->
utils:log("The new master should be: ~p~n", [New_master]),
Master_service_url = rpc:call(New_master, utils, get_service_url, [], 2000),
case Master_service_url of
{badrpc, _} ->
utils:log("Badrpc at node: ~p~n", [Node]),
ok;
_ ->
utils:log("Temp master data, the next master node could be: ~p~n", [New_master]),
slave_handler:set_master_data({New_master, Master_service_url})
end
end;
false ->
utils:log("A slave died.~n", []),
ok
end
end,
monitor_mesh_loop();
stop ->
exit(kill, self())
end.
|
253a734a1aa829ff1b4e49b43cbd207dea10d9b69a7836c2011181da63420c21 | icicle-lang/disorder.hs-ambiata | test.hs | import Control.Monad
import qualified Test.Disorder.Corpus
import System.Exit
import System.IO
main :: IO ()
main =
hSetBuffering stdout LineBuffering >> mapM id [
Test.Disorder.Corpus.tests
] >>= \rs -> when (not . all id $ rs) exitFailure
| null | https://raw.githubusercontent.com/icicle-lang/disorder.hs-ambiata/0068d9a0dd9aea45e772fb664cf4e7e71636dbe5/disorder-corpus/test/test.hs | haskell | import Control.Monad
import qualified Test.Disorder.Corpus
import System.Exit
import System.IO
main :: IO ()
main =
hSetBuffering stdout LineBuffering >> mapM id [
Test.Disorder.Corpus.tests
] >>= \rs -> when (not . all id $ rs) exitFailure
| |
f96f1e4180749812f370fa3ecf8d77bbe52fd21fd1480b179068355c17155be2 | emotiq/emotiq | lazy.lisp | ;; Lazy.lisp -- class for lazy evaluation and memoization of results
;;
DM / MCFA 10/01
DM / RAL 12/08 -- more efficient implementation
;; -----------------------------------------------------------
(in-package "LAZY")
(defclass lazy-form ()
((expr-fn :reader expr-fn :initarg :expr-fn)))
(defclass memoized-lazy-evaluation ()
((expr :reader force :initarg :forced)))
(defmacro lazy (expr)
`(make-instance 'lazy-form
:expr-fn (lambda () ,expr)))
(defmethod force (val)
val)
(defmethod force ((val lazy-form))
(let ((ans (funcall (expr-fn val))))
(change-class val 'memoized-lazy-evaluation
:forced ans)
ans))
| null | https://raw.githubusercontent.com/emotiq/emotiq/9af78023f670777895a3dac29a2bbe98e19b6249/src/useful-macros/old-code/lazy.lisp | lisp | Lazy.lisp -- class for lazy evaluation and memoization of results
-----------------------------------------------------------
| DM / MCFA 10/01
DM / RAL 12/08 -- more efficient implementation
(in-package "LAZY")
(defclass lazy-form ()
((expr-fn :reader expr-fn :initarg :expr-fn)))
(defclass memoized-lazy-evaluation ()
((expr :reader force :initarg :forced)))
(defmacro lazy (expr)
`(make-instance 'lazy-form
:expr-fn (lambda () ,expr)))
(defmethod force (val)
val)
(defmethod force ((val lazy-form))
(let ((ans (funcall (expr-fn val))))
(change-class val 'memoized-lazy-evaluation
:forced ans)
ans))
|
b544aad19c50bf366bf0f30f8916a6408eac56476e9488e1e7a1821caa018e9b | tweag/linear-base | Linear.hs | {-# LANGUAGE LinearTypes #-}
# LANGUAGE NoImplicitPrelude #
TODO : Disabled while we still support GHC 9.2 to enable
-- the import of the empty TypeEq module there.
# OPTIONS_GHC -Wno - dodgy - exports -Wno - unused - imports #
| This module provides a replacement for ' Prelude ' with
-- support for linear programming via linear versions of
-- standard data types, functions and type classes.
--
-- A simple example:
--
-- >>> :set -XLinearTypes
-- >>> :set -XNoImplicitPrelude
> > > import Prelude . Linear
-- >>> :{
-- boolToInt :: Bool %1-> Int
boolToInt False = 0
boolToInt True = 1
-- :}
--
-- >>> :{
-- makeInt :: Either Int Bool %1-> Int
-- makeInt = either id boolToInt
-- :}
--
-- This module is designed to be imported unqualifed.
module Prelude.Linear
( -- * Standard Types, Classes and Related Functions
-- ** Basic data types
module Data.Bool.Linear,
Prelude.Char,
module Data.Maybe.Linear,
module Data.Either.Linear,
module Prelude.Linear.Internal.TypeEq,
* Tuples
Prelude.fst,
Prelude.snd,
curry,
uncurry,
-- ** Basic type classes
module Data.Ord.Linear,
Prelude.Enum (..),
Prelude.Bounded (..),
-- ** Numbers
Prelude.Int,
Prelude.Integer,
Prelude.Float,
Prelude.Double,
Prelude.Rational,
Prelude.Word,
module Data.Num.Linear,
Prelude.Real (..),
Prelude.Integral (..),
Prelude.Floating (..),
Prelude.Fractional (..),
Prelude.RealFrac (..),
Prelude.RealFloat (..),
-- *** Numeric functions
Prelude.subtract,
Prelude.even,
Prelude.odd,
Prelude.gcd,
Prelude.lcm,
(Prelude.^),
(Prelude.^^),
Prelude.fromIntegral,
Prelude.realToFrac,
-- ** Monads and functors
(<*),
* * and monoids
module Data.Monoid.Linear,
-- ** Miscellaneous functions
id,
const,
(.),
flip,
($),
(&),
Prelude.until,
Prelude.error,
Prelude.errorWithoutStackTrace,
Prelude.undefined,
seq,
($!),
-- * List operations
module Data.List.Linear,
-- * Functions on strings
-- TODO: Implement a linear counterpart of this
module Data.String,
-- * Converting to and from String
Prelude.ShowS,
Prelude.Show (..),
Prelude.shows,
Prelude.showChar,
Prelude.showString,
Prelude.showParen,
Prelude.ReadS,
Prelude.Read (..),
Prelude.reads,
Prelude.readParen,
Prelude.read,
Prelude.lex,
-- * Basic input and output
Prelude.IO,
Prelude.putChar,
Prelude.putStr,
Prelude.putStrLn,
Prelude.print,
Prelude.getChar,
Prelude.getLine,
Prelude.getContents,
Prelude.interact,
-- ** Files
Prelude.FilePath,
Prelude.readFile,
Prelude.writeFile,
Prelude.appendFile,
Prelude.readIO,
Prelude.readLn,
* Using ' Ur ' values in linear code
-- $
Ur (..),
unur,
-- * Doing non-linear operations inside linear functions
-- $
Consumable (..),
Dupable (..),
Movable (..),
lseq,
dup,
dup3,
forget,
)
where
import Data.Bool.Linear
import Data.Either.Linear
import qualified Data.Functor.Linear as Data
import Data.List.Linear
import Data.Maybe.Linear
import Data.Monoid.Linear
import Data.Num.Linear
import Data.Ord.Linear
import Data.String
import Data.Tuple.Linear
import Data.Unrestricted.Linear
import Prelude.Linear.Internal
import Prelude.Linear.Internal.TypeEq
import qualified Prelude
-- | Replacement for the flip function with generalized multiplicities.
flip :: (a %p -> b %q -> c) %r -> b %q -> a %p -> c
flip f b a = f a b
-- | Linearly typed replacement for the standard '(Prelude.<*)' function.
(<*) :: (Data.Applicative f, Consumable b) => f a %1 -> f b %1 -> f a
fa <* fb = Data.fmap (flip lseq) fa Data.<*> fb
infixl 4 <* -- same fixity as base.<*
| null | https://raw.githubusercontent.com/tweag/linear-base/6869779b4f8a675125784063ddd2a89e49f61b38/src/Prelude/Linear.hs | haskell | # LANGUAGE LinearTypes #
the import of the empty TypeEq module there.
support for linear programming via linear versions of
standard data types, functions and type classes.
A simple example:
>>> :set -XLinearTypes
>>> :set -XNoImplicitPrelude
>>> :{
boolToInt :: Bool %1-> Int
:}
>>> :{
makeInt :: Either Int Bool %1-> Int
makeInt = either id boolToInt
:}
This module is designed to be imported unqualifed.
* Standard Types, Classes and Related Functions
** Basic data types
** Basic type classes
** Numbers
*** Numeric functions
** Monads and functors
** Miscellaneous functions
* List operations
* Functions on strings
TODO: Implement a linear counterpart of this
* Converting to and from String
* Basic input and output
** Files
$
* Doing non-linear operations inside linear functions
$
| Replacement for the flip function with generalized multiplicities.
| Linearly typed replacement for the standard '(Prelude.<*)' function.
same fixity as base.<* | # LANGUAGE NoImplicitPrelude #
TODO : Disabled while we still support GHC 9.2 to enable
# OPTIONS_GHC -Wno - dodgy - exports -Wno - unused - imports #
| This module provides a replacement for ' Prelude ' with
> > > import Prelude . Linear
boolToInt False = 0
boolToInt True = 1
module Prelude.Linear
module Data.Bool.Linear,
Prelude.Char,
module Data.Maybe.Linear,
module Data.Either.Linear,
module Prelude.Linear.Internal.TypeEq,
* Tuples
Prelude.fst,
Prelude.snd,
curry,
uncurry,
module Data.Ord.Linear,
Prelude.Enum (..),
Prelude.Bounded (..),
Prelude.Int,
Prelude.Integer,
Prelude.Float,
Prelude.Double,
Prelude.Rational,
Prelude.Word,
module Data.Num.Linear,
Prelude.Real (..),
Prelude.Integral (..),
Prelude.Floating (..),
Prelude.Fractional (..),
Prelude.RealFrac (..),
Prelude.RealFloat (..),
Prelude.subtract,
Prelude.even,
Prelude.odd,
Prelude.gcd,
Prelude.lcm,
(Prelude.^),
(Prelude.^^),
Prelude.fromIntegral,
Prelude.realToFrac,
(<*),
* * and monoids
module Data.Monoid.Linear,
id,
const,
(.),
flip,
($),
(&),
Prelude.until,
Prelude.error,
Prelude.errorWithoutStackTrace,
Prelude.undefined,
seq,
($!),
module Data.List.Linear,
module Data.String,
Prelude.ShowS,
Prelude.Show (..),
Prelude.shows,
Prelude.showChar,
Prelude.showString,
Prelude.showParen,
Prelude.ReadS,
Prelude.Read (..),
Prelude.reads,
Prelude.readParen,
Prelude.read,
Prelude.lex,
Prelude.IO,
Prelude.putChar,
Prelude.putStr,
Prelude.putStrLn,
Prelude.print,
Prelude.getChar,
Prelude.getLine,
Prelude.getContents,
Prelude.interact,
Prelude.FilePath,
Prelude.readFile,
Prelude.writeFile,
Prelude.appendFile,
Prelude.readIO,
Prelude.readLn,
* Using ' Ur ' values in linear code
Ur (..),
unur,
Consumable (..),
Dupable (..),
Movable (..),
lseq,
dup,
dup3,
forget,
)
where
import Data.Bool.Linear
import Data.Either.Linear
import qualified Data.Functor.Linear as Data
import Data.List.Linear
import Data.Maybe.Linear
import Data.Monoid.Linear
import Data.Num.Linear
import Data.Ord.Linear
import Data.String
import Data.Tuple.Linear
import Data.Unrestricted.Linear
import Prelude.Linear.Internal
import Prelude.Linear.Internal.TypeEq
import qualified Prelude
flip :: (a %p -> b %q -> c) %r -> b %q -> a %p -> c
flip f b a = f a b
(<*) :: (Data.Applicative f, Consumable b) => f a %1 -> f b %1 -> f a
fa <* fb = Data.fmap (flip lseq) fa Data.<*> fb
|
7517518169ba9f07f4f8690b05a9138b4131369e1c87ff61a19fdbbf1193afab | fission-codes/fission | Class.hs | | Database mutations for ' LoosePin 's
module Fission.Web.Server.LoosePin.Destroyer.Class (Destroyer (..)) where
import Database.Esqueleto.Legacy
import Network.IPFS.CID.Types as IPFS.CID
import Fission.Prelude
import Fission.Web.Server.Models
import Fission.Web.Server.MonadDB.Types
-- | Actions for destroying @LoosePin@s
class Monad m => Destroyer m where
-- | Destroy a specific @LoosePin@
destroy :: UserId -> CID -> m ()
-- | Destroy several @LoosePin@s by they primary keys
destroyMany :: UserId -> [LoosePinId] -> m ()
instance MonadIO m => Destroyer (Transaction m) where
destroyMany userId userCidIds =
delete $ from \pin ->
where_ $ pin ^. LoosePinId `in_` valList userCidIds
&&. pin ^. LoosePinOwnerId ==. val userId
destroy userId cid =
delete $ from \pin ->
where_ $ pin ^. LoosePinCid ==. val cid
&&. pin ^. LoosePinOwnerId ==. val userId
| null | https://raw.githubusercontent.com/fission-codes/fission/ae177407dccc20be67948a901956b99f40d37ac8/fission-web-server/library/Fission/Web/Server/LoosePin/Destroyer/Class.hs | haskell | | Actions for destroying @LoosePin@s
| Destroy a specific @LoosePin@
| Destroy several @LoosePin@s by they primary keys | | Database mutations for ' LoosePin 's
module Fission.Web.Server.LoosePin.Destroyer.Class (Destroyer (..)) where
import Database.Esqueleto.Legacy
import Network.IPFS.CID.Types as IPFS.CID
import Fission.Prelude
import Fission.Web.Server.Models
import Fission.Web.Server.MonadDB.Types
class Monad m => Destroyer m where
destroy :: UserId -> CID -> m ()
destroyMany :: UserId -> [LoosePinId] -> m ()
instance MonadIO m => Destroyer (Transaction m) where
destroyMany userId userCidIds =
delete $ from \pin ->
where_ $ pin ^. LoosePinId `in_` valList userCidIds
&&. pin ^. LoosePinOwnerId ==. val userId
destroy userId cid =
delete $ from \pin ->
where_ $ pin ^. LoosePinCid ==. val cid
&&. pin ^. LoosePinOwnerId ==. val userId
|
83d18938a2789506c17a3709e06dadabb1833b5297aa0e95fb0dab6c2823cdcf | zachsully/dl | FreeVars.hs | module DL.Utils.FreeVars where
import Data.Set
import DL.General.Variable
--------------------------------------------------------------------------------
Free Variable --
--------------------------------------------------------------------------------
class FV a where
fvs :: a -> Set Variable
| null | https://raw.githubusercontent.com/zachsully/dl/c99cdfa8a3b59b1977a34876f397c467518091b6/haskell/DL/Utils/FreeVars.hs | haskell | ------------------------------------------------------------------------------
------------------------------------------------------------------------------ | module DL.Utils.FreeVars where
import Data.Set
import DL.General.Variable
class FV a where
fvs :: a -> Set Variable
|
6ca57b6f953cc75ad90367759c436c5839a3d025aaa7dba27b512d50bd2e9310 | may-liu/qtalk | adhoc.erl | %%%----------------------------------------------------------------------
%%% File : adhoc.erl
Author : < >
Purpose : Provide helper functions for ad - hoc commands ( XEP-0050 )
Created : 31 Oct 2005 by < >
%%%
%%%
ejabberd , Copyright ( C ) 2002 - 2014 ProcessOne
%%%
%%% This program is free software; you can redistribute it and/or
modify it under the terms of the GNU General Public License as
published by the Free Software Foundation ; either version 2 of the
%%% License, or (at your option) any later version.
%%%
%%% This program is distributed in the hope that it will be useful,
%%% but WITHOUT ANY WARRANTY; without even the implied warranty of
%%% MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
%%% General Public License for more details.
%%%
You should have received a copy of the GNU General Public License along
with this program ; if not , write to the Free Software Foundation , Inc. ,
51 Franklin Street , Fifth Floor , Boston , USA .
%%%
%%%----------------------------------------------------------------------
-module(adhoc).
-author('').
-export([
parse_request/1,
produce_response/2,
produce_response/1
]).
-include("ejabberd.hrl").
-include("logger.hrl").
-include("jlib.hrl").
-include("adhoc.hrl").
Parse an ad - hoc request . Return either an adhoc_request record or
an { error , ErrorType } tuple .
%%
-spec(parse_request/1 ::
(
IQ :: iq_request())
-> adhoc_response()
%%
| {error, _}
).
parse_request(#iq{type = set, lang = Lang, sub_el = SubEl, xmlns = ?NS_COMMANDS}) ->
?DEBUG("entering parse_request...", []),
Node = xml:get_tag_attr_s(<<"node">>, SubEl),
SessionID = xml:get_tag_attr_s(<<"sessionid">>, SubEl),
Action = xml:get_tag_attr_s(<<"action">>, SubEl),
XData = find_xdata_el(SubEl),
#xmlel{children = AllEls} = SubEl,
Others = case XData of
false -> AllEls;
_ -> lists:delete(XData, AllEls)
end,
#adhoc_request{
lang = Lang,
node = Node,
sessionid = SessionID,
action = Action,
xdata = XData,
others = Others
};
parse_request(_) -> {error, ?ERR_BAD_REQUEST}.
Borrowed from mod_vcard.erl
find_xdata_el(#xmlel{children = SubEls}) ->
find_xdata_el1(SubEls).
find_xdata_el1([]) -> false;
find_xdata_el1([El | Els]) when is_record(El, xmlel) ->
case xml:get_tag_attr_s(<<"xmlns">>, El) of
?NS_XDATA -> El;
_ -> find_xdata_el1(Els)
end;
find_xdata_el1([_ | Els]) -> find_xdata_el1(Els).
%% Produce a <command/> node to use as response from an adhoc_response
%% record, filling in values for language, node and session id from
%% the request.
%%
-spec(produce_response/2 ::
(
Adhoc_Request :: adhoc_request(),
Adhoc_Response :: adhoc_response())
-> Xmlel::xmlel()
).
%% Produce a <command/> node to use as response from an adhoc_response
%% record.
produce_response(#adhoc_request{lang = Lang, node = Node, sessionid = SessionID},
Adhoc_Response) ->
produce_response(Adhoc_Response#adhoc_response{
lang = Lang, node = Node, sessionid = SessionID
}).
%%
-spec(produce_response/1 ::
(
Adhoc_Response::adhoc_response())
-> Xmlel::xmlel()
).
produce_response(
#adhoc_response{
lang = _ ,
node = Node,
sessionid = ProvidedSessionID,
status = Status,
defaultaction = DefaultAction,
actions = Actions,
notes = Notes,
elements = Elements
}) ->
SessionID = if is_binary(ProvidedSessionID),
ProvidedSessionID /= <<"">> -> ProvidedSessionID;
true -> jlib:now_to_utc_string(os:timestamp())
end,
case Actions of
[] ->
ActionsEls = [];
_ ->
case DefaultAction of
<<"">> -> ActionsElAttrs = [];
_ -> ActionsElAttrs = [{<<"execute">>, DefaultAction}]
end,
ActionsEls = [
#xmlel{
name = <<"actions">>,
attrs = ActionsElAttrs,
children = [
#xmlel{name = Action, attrs = [], children = []}
|| Action <- Actions]
}
]
end,
NotesEls = lists:map(fun({Type, Text}) ->
#xmlel{
name = <<"note">>,
attrs = [{<<"type">>, Type}],
children = [{xmlcdata, Text}]
}
end, Notes),
#xmlel{
name = <<"command">>,
attrs = [
{<<"xmlns">>, ?NS_COMMANDS},
{<<"sessionid">>, SessionID},
{<<"node">>, Node},
{<<"status">>, iolist_to_binary(atom_to_list(Status))}
],
children = ActionsEls ++ NotesEls ++ Elements
}.
| null | https://raw.githubusercontent.com/may-liu/qtalk/f5431e5a7123975e9656e7ab239e674ce33713cd/qtalk_opensource/src/adhoc.erl | erlang | ----------------------------------------------------------------------
File : adhoc.erl
This program is free software; you can redistribute it and/or
License, or (at your option) any later version.
This program is distributed in the hope that it will be useful,
but WITHOUT ANY WARRANTY; without even the implied warranty of
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
General Public License for more details.
----------------------------------------------------------------------
Produce a <command/> node to use as response from an adhoc_response
record, filling in values for language, node and session id from
the request.
Produce a <command/> node to use as response from an adhoc_response
record.
| Author : < >
Purpose : Provide helper functions for ad - hoc commands ( XEP-0050 )
Created : 31 Oct 2005 by < >
ejabberd , Copyright ( C ) 2002 - 2014 ProcessOne
modify it under the terms of the GNU General Public License as
published by the Free Software Foundation ; either version 2 of the
You should have received a copy of the GNU General Public License along
with this program ; if not , write to the Free Software Foundation , Inc. ,
51 Franklin Street , Fifth Floor , Boston , USA .
-module(adhoc).
-author('').
-export([
parse_request/1,
produce_response/2,
produce_response/1
]).
-include("ejabberd.hrl").
-include("logger.hrl").
-include("jlib.hrl").
-include("adhoc.hrl").
Parse an ad - hoc request . Return either an adhoc_request record or
an { error , ErrorType } tuple .
-spec(parse_request/1 ::
(
IQ :: iq_request())
-> adhoc_response()
| {error, _}
).
parse_request(#iq{type = set, lang = Lang, sub_el = SubEl, xmlns = ?NS_COMMANDS}) ->
?DEBUG("entering parse_request...", []),
Node = xml:get_tag_attr_s(<<"node">>, SubEl),
SessionID = xml:get_tag_attr_s(<<"sessionid">>, SubEl),
Action = xml:get_tag_attr_s(<<"action">>, SubEl),
XData = find_xdata_el(SubEl),
#xmlel{children = AllEls} = SubEl,
Others = case XData of
false -> AllEls;
_ -> lists:delete(XData, AllEls)
end,
#adhoc_request{
lang = Lang,
node = Node,
sessionid = SessionID,
action = Action,
xdata = XData,
others = Others
};
parse_request(_) -> {error, ?ERR_BAD_REQUEST}.
Borrowed from mod_vcard.erl
find_xdata_el(#xmlel{children = SubEls}) ->
find_xdata_el1(SubEls).
find_xdata_el1([]) -> false;
find_xdata_el1([El | Els]) when is_record(El, xmlel) ->
case xml:get_tag_attr_s(<<"xmlns">>, El) of
?NS_XDATA -> El;
_ -> find_xdata_el1(Els)
end;
find_xdata_el1([_ | Els]) -> find_xdata_el1(Els).
-spec(produce_response/2 ::
(
Adhoc_Request :: adhoc_request(),
Adhoc_Response :: adhoc_response())
-> Xmlel::xmlel()
).
produce_response(#adhoc_request{lang = Lang, node = Node, sessionid = SessionID},
Adhoc_Response) ->
produce_response(Adhoc_Response#adhoc_response{
lang = Lang, node = Node, sessionid = SessionID
}).
-spec(produce_response/1 ::
(
Adhoc_Response::adhoc_response())
-> Xmlel::xmlel()
).
produce_response(
#adhoc_response{
lang = _ ,
node = Node,
sessionid = ProvidedSessionID,
status = Status,
defaultaction = DefaultAction,
actions = Actions,
notes = Notes,
elements = Elements
}) ->
SessionID = if is_binary(ProvidedSessionID),
ProvidedSessionID /= <<"">> -> ProvidedSessionID;
true -> jlib:now_to_utc_string(os:timestamp())
end,
case Actions of
[] ->
ActionsEls = [];
_ ->
case DefaultAction of
<<"">> -> ActionsElAttrs = [];
_ -> ActionsElAttrs = [{<<"execute">>, DefaultAction}]
end,
ActionsEls = [
#xmlel{
name = <<"actions">>,
attrs = ActionsElAttrs,
children = [
#xmlel{name = Action, attrs = [], children = []}
|| Action <- Actions]
}
]
end,
NotesEls = lists:map(fun({Type, Text}) ->
#xmlel{
name = <<"note">>,
attrs = [{<<"type">>, Type}],
children = [{xmlcdata, Text}]
}
end, Notes),
#xmlel{
name = <<"command">>,
attrs = [
{<<"xmlns">>, ?NS_COMMANDS},
{<<"sessionid">>, SessionID},
{<<"node">>, Node},
{<<"status">>, iolist_to_binary(atom_to_list(Status))}
],
children = ActionsEls ++ NotesEls ++ Elements
}.
|
7e2b4647b3cb9f4a6548cf20402d6a2683461008638b671b06eab161f879b285 | mfp/obigstore | obs_data_model.mli |
* Copyright ( C ) 2011 - 2013 < >
*
* This library is free software ; you can redistribute it and/or
* modify it under the terms of the GNU Lesser General Public
* License as published by the Free Software Foundation ; either
* version 2.1 of the License , or ( at your option ) any later version ,
* with the special exception on linking described in file LICENSE .
*
* This library is distributed in the hope that it will be useful ,
* but WITHOUT ANY WARRANTY ; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE . See the GNU
* Lesser General Public License for more details .
*
* You should have received a copy of the GNU Lesser General Public
* License along with this library ; if not , write to the Free Software
* Foundation , Inc. , 59 Temple Place , Suite 330 , Boston , MA 02111 - 1307 USA
* Copyright (C) 2011-2013 Mauricio Fernandez <>
*
* This library is free software; you can redistribute it and/or
* modify it under the terms of the GNU Lesser General Public
* License as published by the Free Software Foundation; either
* version 2.1 of the License, or (at your option) any later version,
* with the special exception on linking described in file LICENSE.
*
* This library is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
* Lesser General Public License for more details.
*
* You should have received a copy of the GNU Lesser General Public
* License along with this library; if not, write to the Free Software
* Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
*)
* { 2 Type definitions }
* Exception raised when inserting an invalid BSON [ @column ] .
exception Invalid_BSON_column of string (** column name *)
(** Exception raised when a watched key/column has been modified while a write
* transaction is being performed. *)
exception Dirty_data
(** Exception raised by the {!lock} operation if a deadlock is detected. *)
exception Deadlock
(** Operation denied owning to insufficient permissions or invalid
* credentials. *)
exception Denied
type table = private string
val string_of_table : table -> string
val table_of_string : string -> table
type key = string
type 'data column = { name : column_name; data : 'data; timestamp : timestamp; }
and column_name = string
and timestamp = No_timestamp | Timestamp of Int64.t
type decoded_data =
Binary of string | BSON of Obs_bson.document | Malformed_BSON of string
type ('key, 'data) key_data = {
key : 'key;
last_column : string; (** Name of last column in the following list *)
columns : 'data column list;
}
type ('key, 'data) slice = 'key option * ('key, 'data) key_data list (** last_key * data *)
* Range representing elements between [ first ] ( inclusive if reverse is
* false , exclusive otherwise ) and [ up_to ]
* ( exclusive if reverse is false , inclusive otherwise ) . If [ first ] is not
* provided , the range starts with the first available element ( last , if
* [ reverse ] is [ true ] ) ; likewise , if [ up_to ] is not provided , the elements
* until the last ( first , if [ reverse is [ true ] ) one are selected .
*
* Summarizing :
*
* * if reverse is false , elements x such that [ first < = x < up_to ]
* * if reverse is true , elements x such that [ first > x > = up_to ]
*
* where a side of the inequality disappears if the corresponding value
* ( [ first ] or [ up_to ] ) is [ None ] .
*
* false, exclusive otherwise) and [up_to]
* (exclusive if reverse is false, inclusive otherwise). If [first] is not
* provided, the range starts with the first available element (last, if
* [reverse] is [true]); likewise, if [up_to] is not provided, the elements
* until the last (first, if [reverse is [true]) one are selected.
*
* Summarizing:
*
* * if reverse is false, elements x such that [first <= x < up_to]
* * if reverse is true, elements x such that [first > x >= up_to]
*
* where a side of the inequality disappears if the corresponding value
* ([first] or [up_to]) is [None].
* *)
type 'key range =
{
first : 'key option;
up_to : 'key option;
reverse : bool;
}
type 'key cont_or_discrete_range = [ `Continuous of 'key range | `Discrete of 'key list ]
type 'key key_range = [ 'key cont_or_discrete_range | `All]
type column_range = [ string key_range | `Union of string cont_or_discrete_range list ]
(** Predicate on the value of a colum *)
type column_val_rel =
| Any (** don't care about the value *)
| EQ of string | LT of string | GT of string
| GE of string | LE of string
| Between of string * bool * string * bool (** each bool indicating whether inclusive *)
type simple_row_predicate =
| Column_val of string * column_val_rel (** [name, predicate] *)
type row_predicate_and = Satisfy_all of simple_row_predicate list (* all of them *)
type row_predicate = Satisfy_any of row_predicate_and list (* any of them *)
type backup_format = int
type raw_dump_timestamp = Int64.t
type tx_id = Int64.t
type lock_kind = [`SHARED | `EXCLUSIVE]
type tx_info =
{
tx_id : tx_id;
started_at : float;
wanted_locks : (string * lock_kind) list;
held_locks : (string * lock_kind) list;
}
(** Specify transaction semantics. *)
type sync_mode =
[ `Sync (** Synchronous commit, with full fsync (unless disabled globally) *)
| `Async (** Asynchronous commit, without fsync. Durability not guaranteed
* in the event of system crashes. *)
| `Default (** In outermost transaction: use synchronous commit.
* In nested transactions: inherit parent mode
* (can still be modified by a child transaction).
*)
]
{ 2 Data model }
module type RAW_DUMP =
sig
type db
type raw_dump
(** Request that the current state of the DB be dumped. *)
val dump : db -> mode:[`Sync | `Async | `No_stream] -> raw_dump Lwt.t
(** Allow to release the resources associated to the dump (e.g., delete
* the actual data). Further operations on the dump will fail. *)
val release : raw_dump -> keep_files:bool -> unit Lwt.t
val timestamp : raw_dump -> raw_dump_timestamp Lwt.t
val localdir : raw_dump -> string Lwt.t
val list_files : raw_dump -> (string * Int64.t) list Lwt.t
val file_digest : raw_dump -> string -> string option Lwt.t
val open_file :
raw_dump -> ?offset:Int64.t -> string ->
Lwt_io.input_channel option Lwt.t
end
(** DB operations with opaque columns. *)
module type RAW_S =
sig
type db
type keyspace
val list_keyspaces : db -> string list Lwt.t
* Register the keyspace in the DB and return a new [ keyspace ] object .
* Different calls to [ register_keyspace name ] with the same [ name ]
* return different values ( allowing to perform transactions on them
* independently ) .
* Different calls to [register_keyspace name] with the same [name]
* return different values (allowing to perform transactions on them
* independently). *)
val register_keyspace : db -> string -> keyspace Lwt.t
(** Similar to [register_keyspace], but only returns [Some ks] if the
* keyspace exists in the DB. *)
val get_keyspace : db -> string -> keyspace option Lwt.t
val keyspace_name : keyspace -> string
val keyspace_id : keyspace -> int
(** List the tables that contained data at the time the outermost
* transaction began. *)
val list_tables : keyspace -> table list Lwt.t
(** @return approximate size on disk of the data for the given table. *)
val table_size_on_disk : keyspace -> table -> Int64.t Lwt.t
(** @return approximate size on disk of the data for the given key range in
* the specified table. *)
val key_range_size_on_disk :
keyspace -> ?first:string -> ?up_to:string -> table -> Int64.t Lwt.t
* { 3 Transactions }
* [ read_committed_transaction ks f ] runs [ f ] in a transaction .
* Within [ f ] , the effect of other transactions committed after its
* evaluation started will be visible .
*
* Note that nested transactions can be executed concurrenty
* ( with [ lwt x = read_committed_transaction f a and
* y = read_committed_transaction f b ] , [ Lwt.join ] or similar )
* but the server can choose to serialize their execution .
*
* Also note that " simple " operations such as { ! } are performed
* within an implicit transaction .
*
* This means that code like the following is dangerous :
* { [
* read_committed_transaction ks ( *
* Within [f], the effect of other transactions committed after its
* evaluation started will be visible.
*
* Note that nested transactions can be executed concurrenty
* (with [lwt x = read_committed_transaction f a and
* y = read_committed_transaction f b], [Lwt.join] or similar)
* but the server can choose to serialize their execution.
*
* Also note that "simple" operations such as {!put_columns} are performed
* within an implicit transaction.
*
* This means that code like the following is dangerous:
* {[
* read_committed_transaction ks (* TX1 *)
* (fun ks ->
* read_committed_transaction ks (* TX2 *)
* (fun ks2 ->
* put_columns ks tbl key cols (* TX3 *) >>
* put_columns ks2 tbl2 key2 cols2))
* ]}
* This code can hang if the server serializes concurrent, nested
* transaction, because [put_columns ks ...] starts an implicit
* transaction [TX3] whose execution will start only once the
* [TX2] transaction completes, but [TX2] will not finish until [TX3] is
* done.
*
* @param sync Specify sync mode. The final sync mode used on commit for
* the outermost transaction is the most restrictive amongst the ones
* specified by it and its descendents (e.g., if any uses [~sync:`Sync],
* this is the mode that will be used, regardless of what [sync] mode was
* used in the outermost transaction). Default value: [`Default] (refer to
* {!sync_mode}.
*)
val read_committed_transaction :
?sync:sync_mode -> keyspace -> (keyspace -> 'a Lwt.t) -> 'a Lwt.t
* [ repeatable_read_transaction ks f ] runs [ f ] in a transaction .
* Two read operations with the same parameters performed in [ f ] 's scope
* are guaranteed to return the same results ( unless [ f ] itself wrote
* data ) , regardless of whether other transactions have committed data or
* not .
*
* Refer to { ! read_committed_transaction } for information on concurrent
* execution of nested transactions .
*
* Two read operations with the same parameters performed in [f]'s scope
* are guaranteed to return the same results (unless [f] itself wrote
* data), regardless of whether other transactions have committed data or
* not.
*
* Refer to {!read_committed_transaction} for information on concurrent
* execution of nested transactions.
* *)
val repeatable_read_transaction :
?sync:sync_mode -> keyspace -> (keyspace -> 'a Lwt.t) -> 'a Lwt.t
* [ ks ] returns the ID of the current and outermost
* transaction ( useful for logging and reporting ) , or None if not inside a
* transaction .
* transaction (useful for logging and reporting), or None if not inside a
* transaction. *)
val transaction_id : keyspace -> (int * int) option Lwt.t
* [ lock ks ~shared l ] acquire locks with names given in [ l ] for the DB
* keyspace [ ks ] . Each DB keyspace defines a different
* lock namespace ; therefore different [ keyspace ] values for the same
* underlying DB keyspace share the same namespace .
* The locks will be released automatically when the outermost transaction
* is committed or aborted . [ lock ] is a NOP unless inside a transaction .
*
* @param shared indicates whether shared or exclusive locks are to be
* acquired
* keyspace [keyspace_name ks]. Each DB keyspace defines a different
* lock namespace; therefore different [keyspace] values for the same
* underlying DB keyspace share the same namespace.
* The locks will be released automatically when the outermost transaction
* is committed or aborted. [lock] is a NOP unless inside a transaction.
*
* @param shared indicates whether shared or exclusive locks are to be
* acquired *)
val lock : keyspace -> shared:bool -> string list -> unit Lwt.t
* [ watch_keys ks table keys ] will make write transactions raise
* [ Dirty_data ] if a column belonging to any of the given keys is modified
* ( added , updated or deleted ) after the call to [ watch_keys ] .
*
* It is used to perform optimistic concurrency control as follows :
* { [
* let attempt ( ) =
* begin fun ks - >
* watch_keys ks accounts [ account_key ] > >
* lwt n = get_column ks accounts account_key " balance " > |=
* fst > |= int_of_string
* in
* put_columns ks accounts account_key
* [ { name = " balance " ; data = string_of_int ( n + 1 ) ;
* timestamp = No_timestamp ; } ]
* end in
* let rec retry_if_needed ( ) =
* try_lwt attempt ( ) with Dirty_data - > retry_if_needed ( )
* in
* ( * perform transaction
* [Dirty_data] if a column belonging to any of the given keys is modified
* (added, updated or deleted) after the call to [watch_keys].
*
* It is used to perform optimistic concurrency control as follows:
* {[
* let attempt () =
* read_committed_transaction ks begin fun ks ->
* watch_keys ks accounts [account_key] >>
* lwt n = get_column ks accounts account_key "balance" >|=
* fst >|= int_of_string
* in
* put_columns ks accounts account_key
* [ { name = "balance"; data = string_of_int (n + 1);
* timestamp = No_timestamp; } ]
* end in
* let rec retry_if_needed () =
* try_lwt attempt () with Dirty_data -> retry_if_needed ()
* in
* (* perform transaction *)
* retry_if_needed ()
* ]}
* *)
val watch_keys : keyspace -> table -> string list -> unit Lwt.t
* [ watch_columns ks table l ] is similar to { ! watch_keys } , but instead of
* watching the whole keys , only the specified columns are considered , e.g.
* [ watch_keys ks table [ " key1 " , [ " col1 " , " col2 " ] ; " key2 " , [ " col2 " ] ] ] .
* watching the whole keys, only the specified columns are considered, e.g.
* [watch_keys ks table ["key1", ["col1", "col2"]; "key2", ["col2"]]]. *)
val watch_columns : keyspace -> table -> (string * string list) list -> unit Lwt.t
(** [watch_prefixes ks table prefixes] is similar to {!watch_keys}, but is
* given a prefix of the keys to watch; e.g., if you do
* [watch_prefixes ks tbl ["foo"; "bar"]], write transactions will abort
* with [Dirty_data] if any keys starting with [foo] or [bar] (inclusive)
* are modified by a concurrent transaction *)
val watch_prefixes : keyspace -> table -> string list -> unit Lwt.t
* { 3 Read operations }
(** Return up to [max_keys] keys (default: [max_int]) in the given range. *)
val get_keys :
keyspace -> table ->
?max_keys:int ->
string key_range -> string list Lwt.t
(** [exists_key ks table k] returns [true] if any column with the given
* [key] exists in the given [table] within the keyspace [ks]. *)
val exists_key : keyspace -> table -> string -> bool Lwt.t
(** [exist_keys ks table keys] returns a list of bools indicating whether
* each key in [keys] has got any column in the given [table] within the
* keyspace [ks]. *)
val exist_keys : keyspace -> table -> string list -> bool list Lwt.t
* Count the keys in the given range : [ count_keys tx table range ] is
* functionality equivalent to [ get_keys tx table range > |= ]
* but somewhat faster , by a constant factor , and more memory - efficient .
* functionality equivalent to [get_keys tx table range >|= List.length]
* but somewhat faster, by a constant factor, and more memory-efficient. *)
val count_keys : keyspace -> table -> string key_range -> Int64.t Lwt.t
* [ get_slice tx table ? max_keys ? max_columns ? decode_timestamp
* key_range ? predicate column_range ] returns a data slice corresponding
* to the keys included in the [ key_range ] which contain at least one of
* the columns specified in the [ column_range ] and satisfy the
* [ predicate ] .
*
* If the key range is [ ` Discrete l ] and the column range is a [ Column_range ]
* the columns will be returned :
* * in lexicographic order , if the column range is not reverse
* * in reverse lexicographic order , if the column range is reverse
*
* For the sake of efficiency , if the key range is [ ` Continuous _ ] , the
* columns are selected :
* * in lexicographic order , if the key range is not [ reverse ]
* * in reverse lexicographic order , if the key range is [ reverse ]
*
* @param max_keys return no more than [ max_keys ] keys
* @param return no more than [ max_columns ] columns per key
* @param decode_timestamp whether to decode the timestamp ( default : false )
*
* key_range ?predicate column_range] returns a data slice corresponding
* to the keys included in the [key_range] which contain at least one of
* the columns specified in the [column_range] and satisfy the
* [predicate].
*
* If the key range is [`Discrete l] and the column range is a [Column_range]
* the columns will be returned:
* * in lexicographic order, if the column range is not reverse
* * in reverse lexicographic order, if the column range is reverse
*
* For the sake of efficiency, if the key range is [`Continuous _], the
* columns are selected:
* * in lexicographic order, if the key range is not [reverse]
* * in reverse lexicographic order, if the key range is [reverse]
*
* @param max_keys return no more than [max_keys] keys
* @param max_columns return no more than [max_columns] columns per key
* @param decode_timestamp whether to decode the timestamp (default: false)
* *)
val get_slice :
keyspace -> table ->
?max_keys:int -> ?max_columns:int -> ?decode_timestamps:bool ->
string key_range -> ?predicate:row_predicate -> column_range ->
(string, string) slice Lwt.t
* [ get_slice_values tx table key_range [ " col1 " ; " col2 " ] ]
* returns [ Some last_key , l ] if at least a key was selected , where [ l ] is
* an associative list whose elements are pairs containing the key and a list
* of value options corresponding to the requested columns ( in the order they
* were given to [ get_slice_values ] ) . A key is selected if :
* * it is specified in a [ ` Discrete l ] range
* * it exists in the given [ ` Continuous r ] range
* returns [Some last_key, l] if at least a key was selected, where [l] is
* an associative list whose elements are pairs containing the key and a list
* of value options corresponding to the requested columns (in the order they
* were given to [get_slice_values]). A key is selected if:
* * it is specified in a [`Discrete l] range
* * it exists in the given [`Continuous r] range *)
val get_slice_values :
keyspace -> table ->
?max_keys:int ->
string key_range -> column_name list ->
(key option * (key * string option list) list) Lwt.t
* Similar to [ get_slice_values ] , but returning the data and the
* timestamp in since the beginning of the Unix epoch .
* timestamp in microsends since the beginning of the Unix epoch. *)
val get_slice_values_with_timestamps :
keyspace -> table ->
?max_keys:int ->
string key_range -> column_name list ->
(key option * (key * (string * Int64.t) option list) list) Lwt.t
(** @return [Some last_column_name, column_list] if any column exists for the
* selected key, [None] otherwise. *)
val get_columns :
keyspace -> table ->
?max_columns:int -> ?decode_timestamps:bool ->
key -> column_range ->
(column_name * (string column list)) option Lwt.t
(** [get_column_values tx table key columns] returns the data associated to
* the given [columns] (if existent). If [key] doesn't exist (that is, it has
* got no associated columns), all the values will be [None]. *)
val get_column_values :
keyspace -> table ->
key -> column_name list ->
string option list Lwt.t
val get_column :
keyspace -> table ->
key -> column_name -> (string * timestamp) option Lwt.t
* { 3 } Write operations
val put_columns :
keyspace -> table -> key -> string column list ->
unit Lwt.t
val put_multi_columns :
keyspace -> table -> (key * string column list) list -> unit Lwt.t
val delete_columns :
keyspace -> table -> key -> column_name list -> unit Lwt.t
val delete_key : keyspace -> table -> key -> unit Lwt.t
val delete_keys : keyspace -> table -> string key_range -> unit Lwt.t
* { 3 } Asynchronous notifications
* [ listen ] allows to receive notifications sent to the specified
* [ topic ] in the keyspace [ ks ] . Note that [ listen ] is not affected by
* surrounding transactions , i.e. , the subscription is performed even if
* the surrounding transaction is canceled .
* Note that subscriptions are per [ keyspace ] , not per keyspace name : it is
* possible to subscribe to different topics in two different [ keyspace ]
* objects which operate on the same DB keyspace .
*
* [topic] in the keyspace [ks]. Note that [listen] is not affected by
* surrounding transactions, i.e., the subscription is performed even if
* the surrounding transaction is canceled.
* Note that subscriptions are per [keyspace], not per keyspace name: it is
* possible to subscribe to different topics in two different [keyspace]
* objects which operate on the same DB keyspace.
* *)
val listen : keyspace -> string -> unit Lwt.t
* [ listen_prefix ks prefix ] allows to receive notifications sent to topics
* which are ( possibly improper ) suffixes of [ prefix ] in the keyspace [ ks ] .
* Note that [ listen_prefix ] is not affected by surrounding transactions ,
* i.e. , the subscription is performed even if the surrounding transaction
* is canceled .
*
* If a notification would match several regular topics and prefixes , only
* one notification is returned .
*
* Note that subscriptions are per [ keyspace ] , not per keyspace name : it is
* possible to subscribe to different topics in two different [ keyspace ]
* objects which operate on the same DB keyspace .
*
* which are (possibly improper) suffixes of [prefix] in the keyspace [ks].
* Note that [listen_prefix] is not affected by surrounding transactions,
* i.e., the subscription is performed even if the surrounding transaction
* is canceled.
*
* If a notification would match several regular topics and prefixes, only
* one notification is returned.
*
* Note that subscriptions are per [keyspace], not per keyspace name: it is
* possible to subscribe to different topics in two different [keyspace]
* objects which operate on the same DB keyspace.
* *)
val listen_prefix : keyspace -> string -> unit Lwt.t
(** [unlisten ks topìc] signals that further notifications sent to the [topic]
* in the keyspace [ks] will not be received. Notifications that were
* already queued in the server will not be discarded, however.
* Note that [unlisten] is not affected by surrounding transactions, i.e.,
* the unsubscription is performed even if the surrounding transaction is
* canceled. *)
val unlisten : keyspace -> string -> unit Lwt.t
(** [unlisten_prefix ks prefix] signals that further notifications sent to
* topics which are (possibly improper) suffixes of [prefix] are not to be
* received anymore. Notifications that were already queued in the server
* will not be discarded, however.
*
* Note that [unlisten_prefix] is not affected by surrounding transactions,
* i.e., the unsubscription is performed even if the surrounding
* transaction is canceled. *)
val unlisten_prefix : keyspace -> string -> unit Lwt.t
(** [notify ks topic] sends a notification associated to the given [topic]
* in keyspace [ks], which will be received by all the connections that
* performed [listen] on the same [ks]/[topic]. [notify] honors surrounding
* transactions, i.e., the notification will be actually performed only
* when/if the outermost surrounding transaction is committed, and no
* notification is sent if any of the surrounding transactions is aborted.
*
* Multiple notifications for the same topic within a transaction might be
* coalesced, and no assumption should be made about the order in which the
* notifications are reported to the listeners.
* *)
val notify : keyspace -> string -> unit Lwt.t
(** Return queued notifications, blocking if there is none yet.
* An empty list will be returned when there are no more queued
* notifications and the underlying connection is closed.
* *)
val await_notifications : keyspace -> string list Lwt.t
* { 3 Backup }
type backup_cursor
val dump :
keyspace ->
?format:backup_format ->
?only_tables:table list ->
?offset:backup_cursor -> unit ->
(string * backup_cursor option) option Lwt.t
(** [load tx data] returns [false] if the data is in an unknown format. *)
val load : keyspace -> string -> bool Lwt.t
module Raw_dump : RAW_DUMP with type db := db
(** {3 Administration} *)
(** Load statistics *)
val load_stats : keyspace -> Obs_load_stats.stats Lwt.t
(** [dump_info property] returns information about the state of the DB if
* [property] is understood by the DB implementation. *)
val get_property : db -> string -> string option Lwt.t
(** Trigger whole keyspace compaction. *)
val compact : keyspace -> unit Lwt.t
* [ compact_table ks table ? from_key ? to_key ( ) ] compacts the table between
* keys [ from_key ] and [ to_key ] ( inclusive , defaulting to the beginning / end
* of the table if not suppplied ) .
* keys [from_key] and [to_key] (inclusive, defaulting to the beginning/end
* of the table if not suppplied). *)
val compact_table :
keyspace -> table -> ?from_key:string -> ?to_key:string -> unit -> unit Lwt.t
(** List currently executing transactions. *)
val list_transactions : keyspace -> tx_info list Lwt.t
(** List keys of tables modified so far in the specified transaction. *)
val changed_tables : keyspace -> tx_id -> string list Lwt.t
end
* DB operations with BSON - encoded columns : columns whose name begins with
* ' @ ' are BSON - encoded . All the extra functions in { ! S } are similar to those
* in { ! RAW_S } but decode / encode properly such columns .
* '@' are BSON-encoded. All the extra functions in {!S} are similar to those
* in {!RAW_S} but decode/encode properly such columns. *)
module type S =
sig
include RAW_S
* { 3 Read operations }
* Similar to { ! get_slice } , but decodes the BSON - encoded records in columns
* whose name begins with [ @ ] .
* whose name begins with [@]. *)
val get_bson_slice :
keyspace -> table ->
?max_keys:int -> ?max_columns:int -> ?decode_timestamps:bool ->
string key_range -> ?predicate:row_predicate -> column_range ->
(string, decoded_data) slice Lwt.t
(** Refer to {!get_slice_values}. *)
val get_bson_slice_values :
keyspace -> table ->
?max_keys:int ->
string key_range -> column_name list ->
(key option * (key * decoded_data option list) list) Lwt.t
* Refer to { ! } .
val get_bson_slice_values_with_timestamps :
keyspace -> table ->
?max_keys:int ->
string key_range -> column_name list ->
(key option * (key * (decoded_data * Int64.t) option list) list) Lwt.t
(** Refer to {!get_columns}. *)
val get_bson_columns :
keyspace -> table ->
?max_columns:int -> ?decode_timestamps:bool ->
key -> column_range ->
(column_name * (decoded_data column list)) option Lwt.t
(** Refer to {!get_column_values}. *)
val get_bson_column_values :
keyspace -> table ->
key -> column_name list ->
decoded_data option list Lwt.t
(** Refer to {!get_column}. *)
val get_bson_column :
keyspace -> table ->
key -> column_name -> (decoded_data * timestamp) option Lwt.t
* { 3 Write operations }
* Refer to { ! } .
* @raise Invalid_BSON_column if the data for any is not [ BSON x ] .
* @raise Invalid_BSON_column if the data for any @column is not [BSON x]. *)
val put_bson_columns :
keyspace -> table -> key -> decoded_data column list ->
unit Lwt.t
* Refer to { ! } .
* @raise Invalid_BSON_column if the data for any is not [ BSON x ] .
* @raise Invalid_BSON_column if the data for any @column is not [BSON x]. *)
val put_multi_bson_columns :
keyspace -> table -> (key * decoded_data column list) list -> unit Lwt.t
end
module type BACKUP_SUPPORT =
sig
type backup_cursor
val string_of_cursor : backup_cursor -> string
val cursor_of_string : string -> backup_cursor option
end
| null | https://raw.githubusercontent.com/mfp/obigstore/1b078eeb21e11c8de986717150c7108a94778095/src/core/obs_data_model.mli | ocaml | * column name
* Exception raised when a watched key/column has been modified while a write
* transaction is being performed.
* Exception raised by the {!lock} operation if a deadlock is detected.
* Operation denied owning to insufficient permissions or invalid
* credentials.
* Name of last column in the following list
* last_key * data
* Predicate on the value of a colum
* don't care about the value
* each bool indicating whether inclusive
* [name, predicate]
all of them
any of them
* Specify transaction semantics.
* Synchronous commit, with full fsync (unless disabled globally)
* Asynchronous commit, without fsync. Durability not guaranteed
* in the event of system crashes.
* In outermost transaction: use synchronous commit.
* In nested transactions: inherit parent mode
* (can still be modified by a child transaction).
* Request that the current state of the DB be dumped.
* Allow to release the resources associated to the dump (e.g., delete
* the actual data). Further operations on the dump will fail.
* DB operations with opaque columns.
* Similar to [register_keyspace], but only returns [Some ks] if the
* keyspace exists in the DB.
* List the tables that contained data at the time the outermost
* transaction began.
* @return approximate size on disk of the data for the given table.
* @return approximate size on disk of the data for the given key range in
* the specified table.
TX1
TX2
TX3
perform transaction
* [watch_prefixes ks table prefixes] is similar to {!watch_keys}, but is
* given a prefix of the keys to watch; e.g., if you do
* [watch_prefixes ks tbl ["foo"; "bar"]], write transactions will abort
* with [Dirty_data] if any keys starting with [foo] or [bar] (inclusive)
* are modified by a concurrent transaction
* Return up to [max_keys] keys (default: [max_int]) in the given range.
* [exists_key ks table k] returns [true] if any column with the given
* [key] exists in the given [table] within the keyspace [ks].
* [exist_keys ks table keys] returns a list of bools indicating whether
* each key in [keys] has got any column in the given [table] within the
* keyspace [ks].
* @return [Some last_column_name, column_list] if any column exists for the
* selected key, [None] otherwise.
* [get_column_values tx table key columns] returns the data associated to
* the given [columns] (if existent). If [key] doesn't exist (that is, it has
* got no associated columns), all the values will be [None].
* [unlisten ks topìc] signals that further notifications sent to the [topic]
* in the keyspace [ks] will not be received. Notifications that were
* already queued in the server will not be discarded, however.
* Note that [unlisten] is not affected by surrounding transactions, i.e.,
* the unsubscription is performed even if the surrounding transaction is
* canceled.
* [unlisten_prefix ks prefix] signals that further notifications sent to
* topics which are (possibly improper) suffixes of [prefix] are not to be
* received anymore. Notifications that were already queued in the server
* will not be discarded, however.
*
* Note that [unlisten_prefix] is not affected by surrounding transactions,
* i.e., the unsubscription is performed even if the surrounding
* transaction is canceled.
* [notify ks topic] sends a notification associated to the given [topic]
* in keyspace [ks], which will be received by all the connections that
* performed [listen] on the same [ks]/[topic]. [notify] honors surrounding
* transactions, i.e., the notification will be actually performed only
* when/if the outermost surrounding transaction is committed, and no
* notification is sent if any of the surrounding transactions is aborted.
*
* Multiple notifications for the same topic within a transaction might be
* coalesced, and no assumption should be made about the order in which the
* notifications are reported to the listeners.
*
* Return queued notifications, blocking if there is none yet.
* An empty list will be returned when there are no more queued
* notifications and the underlying connection is closed.
*
* [load tx data] returns [false] if the data is in an unknown format.
* {3 Administration}
* Load statistics
* [dump_info property] returns information about the state of the DB if
* [property] is understood by the DB implementation.
* Trigger whole keyspace compaction.
* List currently executing transactions.
* List keys of tables modified so far in the specified transaction.
* Refer to {!get_slice_values}.
* Refer to {!get_columns}.
* Refer to {!get_column_values}.
* Refer to {!get_column}. |
* Copyright ( C ) 2011 - 2013 < >
*
* This library is free software ; you can redistribute it and/or
* modify it under the terms of the GNU Lesser General Public
* License as published by the Free Software Foundation ; either
* version 2.1 of the License , or ( at your option ) any later version ,
* with the special exception on linking described in file LICENSE .
*
* This library is distributed in the hope that it will be useful ,
* but WITHOUT ANY WARRANTY ; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE . See the GNU
* Lesser General Public License for more details .
*
* You should have received a copy of the GNU Lesser General Public
* License along with this library ; if not , write to the Free Software
* Foundation , Inc. , 59 Temple Place , Suite 330 , Boston , MA 02111 - 1307 USA
* Copyright (C) 2011-2013 Mauricio Fernandez <>
*
* This library is free software; you can redistribute it and/or
* modify it under the terms of the GNU Lesser General Public
* License as published by the Free Software Foundation; either
* version 2.1 of the License, or (at your option) any later version,
* with the special exception on linking described in file LICENSE.
*
* This library is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
* Lesser General Public License for more details.
*
* You should have received a copy of the GNU Lesser General Public
* License along with this library; if not, write to the Free Software
* Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA
*)
* { 2 Type definitions }
* Exception raised when inserting an invalid BSON [ @column ] .
exception Dirty_data
exception Deadlock
exception Denied
type table = private string
val string_of_table : table -> string
val table_of_string : string -> table
type key = string
type 'data column = { name : column_name; data : 'data; timestamp : timestamp; }
and column_name = string
and timestamp = No_timestamp | Timestamp of Int64.t
type decoded_data =
Binary of string | BSON of Obs_bson.document | Malformed_BSON of string
type ('key, 'data) key_data = {
key : 'key;
columns : 'data column list;
}
* Range representing elements between [ first ] ( inclusive if reverse is
* false , exclusive otherwise ) and [ up_to ]
* ( exclusive if reverse is false , inclusive otherwise ) . If [ first ] is not
* provided , the range starts with the first available element ( last , if
* [ reverse ] is [ true ] ) ; likewise , if [ up_to ] is not provided , the elements
* until the last ( first , if [ reverse is [ true ] ) one are selected .
*
* Summarizing :
*
* * if reverse is false , elements x such that [ first < = x < up_to ]
* * if reverse is true , elements x such that [ first > x > = up_to ]
*
* where a side of the inequality disappears if the corresponding value
* ( [ first ] or [ up_to ] ) is [ None ] .
*
* false, exclusive otherwise) and [up_to]
* (exclusive if reverse is false, inclusive otherwise). If [first] is not
* provided, the range starts with the first available element (last, if
* [reverse] is [true]); likewise, if [up_to] is not provided, the elements
* until the last (first, if [reverse is [true]) one are selected.
*
* Summarizing:
*
* * if reverse is false, elements x such that [first <= x < up_to]
* * if reverse is true, elements x such that [first > x >= up_to]
*
* where a side of the inequality disappears if the corresponding value
* ([first] or [up_to]) is [None].
* *)
type 'key range =
{
first : 'key option;
up_to : 'key option;
reverse : bool;
}
type 'key cont_or_discrete_range = [ `Continuous of 'key range | `Discrete of 'key list ]
type 'key key_range = [ 'key cont_or_discrete_range | `All]
type column_range = [ string key_range | `Union of string cont_or_discrete_range list ]
type column_val_rel =
| EQ of string | LT of string | GT of string
| GE of string | LE of string
type simple_row_predicate =
type backup_format = int
type raw_dump_timestamp = Int64.t
type tx_id = Int64.t
type lock_kind = [`SHARED | `EXCLUSIVE]
type tx_info =
{
tx_id : tx_id;
started_at : float;
wanted_locks : (string * lock_kind) list;
held_locks : (string * lock_kind) list;
}
type sync_mode =
]
{ 2 Data model }
module type RAW_DUMP =
sig
type db
type raw_dump
val dump : db -> mode:[`Sync | `Async | `No_stream] -> raw_dump Lwt.t
val release : raw_dump -> keep_files:bool -> unit Lwt.t
val timestamp : raw_dump -> raw_dump_timestamp Lwt.t
val localdir : raw_dump -> string Lwt.t
val list_files : raw_dump -> (string * Int64.t) list Lwt.t
val file_digest : raw_dump -> string -> string option Lwt.t
val open_file :
raw_dump -> ?offset:Int64.t -> string ->
Lwt_io.input_channel option Lwt.t
end
module type RAW_S =
sig
type db
type keyspace
val list_keyspaces : db -> string list Lwt.t
* Register the keyspace in the DB and return a new [ keyspace ] object .
* Different calls to [ register_keyspace name ] with the same [ name ]
* return different values ( allowing to perform transactions on them
* independently ) .
* Different calls to [register_keyspace name] with the same [name]
* return different values (allowing to perform transactions on them
* independently). *)
val register_keyspace : db -> string -> keyspace Lwt.t
val get_keyspace : db -> string -> keyspace option Lwt.t
val keyspace_name : keyspace -> string
val keyspace_id : keyspace -> int
val list_tables : keyspace -> table list Lwt.t
val table_size_on_disk : keyspace -> table -> Int64.t Lwt.t
val key_range_size_on_disk :
keyspace -> ?first:string -> ?up_to:string -> table -> Int64.t Lwt.t
* { 3 Transactions }
* [ read_committed_transaction ks f ] runs [ f ] in a transaction .
* Within [ f ] , the effect of other transactions committed after its
* evaluation started will be visible .
*
* Note that nested transactions can be executed concurrenty
* ( with [ lwt x = read_committed_transaction f a and
* y = read_committed_transaction f b ] , [ Lwt.join ] or similar )
* but the server can choose to serialize their execution .
*
* Also note that " simple " operations such as { ! } are performed
* within an implicit transaction .
*
* This means that code like the following is dangerous :
* { [
* read_committed_transaction ks ( *
* Within [f], the effect of other transactions committed after its
* evaluation started will be visible.
*
* Note that nested transactions can be executed concurrenty
* (with [lwt x = read_committed_transaction f a and
* y = read_committed_transaction f b], [Lwt.join] or similar)
* but the server can choose to serialize their execution.
*
* Also note that "simple" operations such as {!put_columns} are performed
* within an implicit transaction.
*
* This means that code like the following is dangerous:
* {[
* (fun ks ->
* (fun ks2 ->
* put_columns ks2 tbl2 key2 cols2))
* ]}
* This code can hang if the server serializes concurrent, nested
* transaction, because [put_columns ks ...] starts an implicit
* transaction [TX3] whose execution will start only once the
* [TX2] transaction completes, but [TX2] will not finish until [TX3] is
* done.
*
* @param sync Specify sync mode. The final sync mode used on commit for
* the outermost transaction is the most restrictive amongst the ones
* specified by it and its descendents (e.g., if any uses [~sync:`Sync],
* this is the mode that will be used, regardless of what [sync] mode was
* used in the outermost transaction). Default value: [`Default] (refer to
* {!sync_mode}.
*)
val read_committed_transaction :
?sync:sync_mode -> keyspace -> (keyspace -> 'a Lwt.t) -> 'a Lwt.t
* [ repeatable_read_transaction ks f ] runs [ f ] in a transaction .
* Two read operations with the same parameters performed in [ f ] 's scope
* are guaranteed to return the same results ( unless [ f ] itself wrote
* data ) , regardless of whether other transactions have committed data or
* not .
*
* Refer to { ! read_committed_transaction } for information on concurrent
* execution of nested transactions .
*
* Two read operations with the same parameters performed in [f]'s scope
* are guaranteed to return the same results (unless [f] itself wrote
* data), regardless of whether other transactions have committed data or
* not.
*
* Refer to {!read_committed_transaction} for information on concurrent
* execution of nested transactions.
* *)
val repeatable_read_transaction :
?sync:sync_mode -> keyspace -> (keyspace -> 'a Lwt.t) -> 'a Lwt.t
* [ ks ] returns the ID of the current and outermost
* transaction ( useful for logging and reporting ) , or None if not inside a
* transaction .
* transaction (useful for logging and reporting), or None if not inside a
* transaction. *)
val transaction_id : keyspace -> (int * int) option Lwt.t
* [ lock ks ~shared l ] acquire locks with names given in [ l ] for the DB
* keyspace [ ks ] . Each DB keyspace defines a different
* lock namespace ; therefore different [ keyspace ] values for the same
* underlying DB keyspace share the same namespace .
* The locks will be released automatically when the outermost transaction
* is committed or aborted . [ lock ] is a NOP unless inside a transaction .
*
* @param shared indicates whether shared or exclusive locks are to be
* acquired
* keyspace [keyspace_name ks]. Each DB keyspace defines a different
* lock namespace; therefore different [keyspace] values for the same
* underlying DB keyspace share the same namespace.
* The locks will be released automatically when the outermost transaction
* is committed or aborted. [lock] is a NOP unless inside a transaction.
*
* @param shared indicates whether shared or exclusive locks are to be
* acquired *)
val lock : keyspace -> shared:bool -> string list -> unit Lwt.t
* [ watch_keys ks table keys ] will make write transactions raise
* [ Dirty_data ] if a column belonging to any of the given keys is modified
* ( added , updated or deleted ) after the call to [ watch_keys ] .
*
* It is used to perform optimistic concurrency control as follows :
* { [
* let attempt ( ) =
* begin fun ks - >
* watch_keys ks accounts [ account_key ] > >
* lwt n = get_column ks accounts account_key " balance " > |=
* fst > |= int_of_string
* in
* put_columns ks accounts account_key
* [ { name = " balance " ; data = string_of_int ( n + 1 ) ;
* timestamp = No_timestamp ; } ]
* end in
* let rec retry_if_needed ( ) =
* try_lwt attempt ( ) with Dirty_data - > retry_if_needed ( )
* in
* ( * perform transaction
* [Dirty_data] if a column belonging to any of the given keys is modified
* (added, updated or deleted) after the call to [watch_keys].
*
* It is used to perform optimistic concurrency control as follows:
* {[
* let attempt () =
* read_committed_transaction ks begin fun ks ->
* watch_keys ks accounts [account_key] >>
* lwt n = get_column ks accounts account_key "balance" >|=
* fst >|= int_of_string
* in
* put_columns ks accounts account_key
* [ { name = "balance"; data = string_of_int (n + 1);
* timestamp = No_timestamp; } ]
* end in
* let rec retry_if_needed () =
* try_lwt attempt () with Dirty_data -> retry_if_needed ()
* in
* retry_if_needed ()
* ]}
* *)
val watch_keys : keyspace -> table -> string list -> unit Lwt.t
* [ watch_columns ks table l ] is similar to { ! watch_keys } , but instead of
* watching the whole keys , only the specified columns are considered , e.g.
* [ watch_keys ks table [ " key1 " , [ " col1 " , " col2 " ] ; " key2 " , [ " col2 " ] ] ] .
* watching the whole keys, only the specified columns are considered, e.g.
* [watch_keys ks table ["key1", ["col1", "col2"]; "key2", ["col2"]]]. *)
val watch_columns : keyspace -> table -> (string * string list) list -> unit Lwt.t
val watch_prefixes : keyspace -> table -> string list -> unit Lwt.t
* { 3 Read operations }
val get_keys :
keyspace -> table ->
?max_keys:int ->
string key_range -> string list Lwt.t
val exists_key : keyspace -> table -> string -> bool Lwt.t
val exist_keys : keyspace -> table -> string list -> bool list Lwt.t
* Count the keys in the given range : [ count_keys tx table range ] is
* functionality equivalent to [ get_keys tx table range > |= ]
* but somewhat faster , by a constant factor , and more memory - efficient .
* functionality equivalent to [get_keys tx table range >|= List.length]
* but somewhat faster, by a constant factor, and more memory-efficient. *)
val count_keys : keyspace -> table -> string key_range -> Int64.t Lwt.t
* [ get_slice tx table ? max_keys ? max_columns ? decode_timestamp
* key_range ? predicate column_range ] returns a data slice corresponding
* to the keys included in the [ key_range ] which contain at least one of
* the columns specified in the [ column_range ] and satisfy the
* [ predicate ] .
*
* If the key range is [ ` Discrete l ] and the column range is a [ Column_range ]
* the columns will be returned :
* * in lexicographic order , if the column range is not reverse
* * in reverse lexicographic order , if the column range is reverse
*
* For the sake of efficiency , if the key range is [ ` Continuous _ ] , the
* columns are selected :
* * in lexicographic order , if the key range is not [ reverse ]
* * in reverse lexicographic order , if the key range is [ reverse ]
*
* @param max_keys return no more than [ max_keys ] keys
* @param return no more than [ max_columns ] columns per key
* @param decode_timestamp whether to decode the timestamp ( default : false )
*
* key_range ?predicate column_range] returns a data slice corresponding
* to the keys included in the [key_range] which contain at least one of
* the columns specified in the [column_range] and satisfy the
* [predicate].
*
* If the key range is [`Discrete l] and the column range is a [Column_range]
* the columns will be returned:
* * in lexicographic order, if the column range is not reverse
* * in reverse lexicographic order, if the column range is reverse
*
* For the sake of efficiency, if the key range is [`Continuous _], the
* columns are selected:
* * in lexicographic order, if the key range is not [reverse]
* * in reverse lexicographic order, if the key range is [reverse]
*
* @param max_keys return no more than [max_keys] keys
* @param max_columns return no more than [max_columns] columns per key
* @param decode_timestamp whether to decode the timestamp (default: false)
* *)
val get_slice :
keyspace -> table ->
?max_keys:int -> ?max_columns:int -> ?decode_timestamps:bool ->
string key_range -> ?predicate:row_predicate -> column_range ->
(string, string) slice Lwt.t
* [ get_slice_values tx table key_range [ " col1 " ; " col2 " ] ]
* returns [ Some last_key , l ] if at least a key was selected , where [ l ] is
* an associative list whose elements are pairs containing the key and a list
* of value options corresponding to the requested columns ( in the order they
* were given to [ get_slice_values ] ) . A key is selected if :
* * it is specified in a [ ` Discrete l ] range
* * it exists in the given [ ` Continuous r ] range
* returns [Some last_key, l] if at least a key was selected, where [l] is
* an associative list whose elements are pairs containing the key and a list
* of value options corresponding to the requested columns (in the order they
* were given to [get_slice_values]). A key is selected if:
* * it is specified in a [`Discrete l] range
* * it exists in the given [`Continuous r] range *)
val get_slice_values :
keyspace -> table ->
?max_keys:int ->
string key_range -> column_name list ->
(key option * (key * string option list) list) Lwt.t
* Similar to [ get_slice_values ] , but returning the data and the
* timestamp in since the beginning of the Unix epoch .
* timestamp in microsends since the beginning of the Unix epoch. *)
val get_slice_values_with_timestamps :
keyspace -> table ->
?max_keys:int ->
string key_range -> column_name list ->
(key option * (key * (string * Int64.t) option list) list) Lwt.t
val get_columns :
keyspace -> table ->
?max_columns:int -> ?decode_timestamps:bool ->
key -> column_range ->
(column_name * (string column list)) option Lwt.t
val get_column_values :
keyspace -> table ->
key -> column_name list ->
string option list Lwt.t
val get_column :
keyspace -> table ->
key -> column_name -> (string * timestamp) option Lwt.t
* { 3 } Write operations
val put_columns :
keyspace -> table -> key -> string column list ->
unit Lwt.t
val put_multi_columns :
keyspace -> table -> (key * string column list) list -> unit Lwt.t
val delete_columns :
keyspace -> table -> key -> column_name list -> unit Lwt.t
val delete_key : keyspace -> table -> key -> unit Lwt.t
val delete_keys : keyspace -> table -> string key_range -> unit Lwt.t
* { 3 } Asynchronous notifications
* [ listen ] allows to receive notifications sent to the specified
* [ topic ] in the keyspace [ ks ] . Note that [ listen ] is not affected by
* surrounding transactions , i.e. , the subscription is performed even if
* the surrounding transaction is canceled .
* Note that subscriptions are per [ keyspace ] , not per keyspace name : it is
* possible to subscribe to different topics in two different [ keyspace ]
* objects which operate on the same DB keyspace .
*
* [topic] in the keyspace [ks]. Note that [listen] is not affected by
* surrounding transactions, i.e., the subscription is performed even if
* the surrounding transaction is canceled.
* Note that subscriptions are per [keyspace], not per keyspace name: it is
* possible to subscribe to different topics in two different [keyspace]
* objects which operate on the same DB keyspace.
* *)
val listen : keyspace -> string -> unit Lwt.t
* [ listen_prefix ks prefix ] allows to receive notifications sent to topics
* which are ( possibly improper ) suffixes of [ prefix ] in the keyspace [ ks ] .
* Note that [ listen_prefix ] is not affected by surrounding transactions ,
* i.e. , the subscription is performed even if the surrounding transaction
* is canceled .
*
* If a notification would match several regular topics and prefixes , only
* one notification is returned .
*
* Note that subscriptions are per [ keyspace ] , not per keyspace name : it is
* possible to subscribe to different topics in two different [ keyspace ]
* objects which operate on the same DB keyspace .
*
* which are (possibly improper) suffixes of [prefix] in the keyspace [ks].
* Note that [listen_prefix] is not affected by surrounding transactions,
* i.e., the subscription is performed even if the surrounding transaction
* is canceled.
*
* If a notification would match several regular topics and prefixes, only
* one notification is returned.
*
* Note that subscriptions are per [keyspace], not per keyspace name: it is
* possible to subscribe to different topics in two different [keyspace]
* objects which operate on the same DB keyspace.
* *)
val listen_prefix : keyspace -> string -> unit Lwt.t
val unlisten : keyspace -> string -> unit Lwt.t
val unlisten_prefix : keyspace -> string -> unit Lwt.t
val notify : keyspace -> string -> unit Lwt.t
val await_notifications : keyspace -> string list Lwt.t
* { 3 Backup }
type backup_cursor
val dump :
keyspace ->
?format:backup_format ->
?only_tables:table list ->
?offset:backup_cursor -> unit ->
(string * backup_cursor option) option Lwt.t
val load : keyspace -> string -> bool Lwt.t
module Raw_dump : RAW_DUMP with type db := db
val load_stats : keyspace -> Obs_load_stats.stats Lwt.t
val get_property : db -> string -> string option Lwt.t
val compact : keyspace -> unit Lwt.t
* [ compact_table ks table ? from_key ? to_key ( ) ] compacts the table between
* keys [ from_key ] and [ to_key ] ( inclusive , defaulting to the beginning / end
* of the table if not suppplied ) .
* keys [from_key] and [to_key] (inclusive, defaulting to the beginning/end
* of the table if not suppplied). *)
val compact_table :
keyspace -> table -> ?from_key:string -> ?to_key:string -> unit -> unit Lwt.t
val list_transactions : keyspace -> tx_info list Lwt.t
val changed_tables : keyspace -> tx_id -> string list Lwt.t
end
* DB operations with BSON - encoded columns : columns whose name begins with
* ' @ ' are BSON - encoded . All the extra functions in { ! S } are similar to those
* in { ! RAW_S } but decode / encode properly such columns .
* '@' are BSON-encoded. All the extra functions in {!S} are similar to those
* in {!RAW_S} but decode/encode properly such columns. *)
module type S =
sig
include RAW_S
* { 3 Read operations }
* Similar to { ! get_slice } , but decodes the BSON - encoded records in columns
* whose name begins with [ @ ] .
* whose name begins with [@]. *)
val get_bson_slice :
keyspace -> table ->
?max_keys:int -> ?max_columns:int -> ?decode_timestamps:bool ->
string key_range -> ?predicate:row_predicate -> column_range ->
(string, decoded_data) slice Lwt.t
val get_bson_slice_values :
keyspace -> table ->
?max_keys:int ->
string key_range -> column_name list ->
(key option * (key * decoded_data option list) list) Lwt.t
* Refer to { ! } .
val get_bson_slice_values_with_timestamps :
keyspace -> table ->
?max_keys:int ->
string key_range -> column_name list ->
(key option * (key * (decoded_data * Int64.t) option list) list) Lwt.t
val get_bson_columns :
keyspace -> table ->
?max_columns:int -> ?decode_timestamps:bool ->
key -> column_range ->
(column_name * (decoded_data column list)) option Lwt.t
val get_bson_column_values :
keyspace -> table ->
key -> column_name list ->
decoded_data option list Lwt.t
val get_bson_column :
keyspace -> table ->
key -> column_name -> (decoded_data * timestamp) option Lwt.t
* { 3 Write operations }
* Refer to { ! } .
* @raise Invalid_BSON_column if the data for any is not [ BSON x ] .
* @raise Invalid_BSON_column if the data for any @column is not [BSON x]. *)
val put_bson_columns :
keyspace -> table -> key -> decoded_data column list ->
unit Lwt.t
* Refer to { ! } .
* @raise Invalid_BSON_column if the data for any is not [ BSON x ] .
* @raise Invalid_BSON_column if the data for any @column is not [BSON x]. *)
val put_multi_bson_columns :
keyspace -> table -> (key * decoded_data column list) list -> unit Lwt.t
end
module type BACKUP_SUPPORT =
sig
type backup_cursor
val string_of_cursor : backup_cursor -> string
val cursor_of_string : string -> backup_cursor option
end
|
88e78424740a27a550dec1966b98709e7da26417a2de2fc9c545702bc44c6b98 | evrim/core-server | filesystem.lisp | Core Server : Web Application Server
Copyright ( C ) 2006 - 2008 , Aycan iRiCAN
;; This program is free software: you can redistribute it and/or modify
it under the terms of the GNU General Public License as published by
the Free Software Foundation , either version 3 of the License , or
;; (at your option) any later version.
;; This program is distributed in the hope that it will be useful,
;; but WITHOUT ANY WARRANTY; without even the implied warranty of
;; MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
;; GNU General Public License for more details.
You should have received a copy of the GNU General Public License
;; along with this program. If not, see </>.
(in-package :tr.gen.core.server)
;;+----------------------------------------------------------------------------
;; Filesystem abstraction as a service
;;+----------------------------------------------------------------------------
;;
;; Usage: create a filesystem service,
;;
;; (defparameter *fs*
;; (make-instance 'filesystem :root *project-docs-root* :label *project-name*))
;;
Second parameter must be a relative pathname ,
;;
;; (writefile *fs* #P"staff/introduction.txt" "Here we go...")
;; (readfile *fs* #P"staff/introduction.txt")
( list - directory * fs * # P"pictures/ " : recursive t )
;; /~sabetts/slurp.html
(defun slurp-stream5 (stream)
(let ((seq (make-array (file-length stream) :element-type 'character :fill-pointer t)))
(setf (fill-pointer seq) (read-sequence seq stream))
seq))
(defclass filesystem (local-unit)
((label :accessor filesystem.label :initarg :label :initform "")
(root :accessor filesystem.root :initarg :root :initform (error "Filesystem root must be set!"))))
security & validator layer
(defmacro with-guard ((fs filepath) &body body)
(let* ((errors (gensym)))
`(let ((,errors (list #'(lambda () (error "Filesystem null!"))
#'(lambda () (error "You must use relative paths!"))))
(ret (cond
((null ,fs)
(function car))
((and (pathname-directory ,filepath)
(not (eq :RELATIVE (car (pathname-directory ,filepath)))))
(function cadr))
(t (let ((res (progn ,@body)))
#'(lambda (x) (declare (ignore x)) #'(lambda () res)))))))
(funcall (funcall ret ,errors)))))
;; filesystem -> pathname -> IO String
(defmethod/unit readfile :async-no-return ((self filesystem) filepath)
(with-guard (self filepath)
(with-open-file (s (merge-pathnames filepath (filesystem.root self)))
(slurp-stream5 s))))
;; filesystem -> pathname -> data -> IO String
(defmethod/unit writefile :async-no-return ((self filesystem) filepath data)
(with-guard (self filepath)
(with-output-to-file (s (merge-pathnames filepath
(filesystem.root self)))
:if-exists :overwrite :if-does-not-exist :create
(write-sequence data s))))
;; filesystem -> pathname -> IO Bool
(defmethod/unit deletefile :async-no-return ((self filesystem) filepath)
(with-guard (self filepath)
(delete-file (merge-pathnames filepath (filesystem.root self)))))
;; filesystem -> pathname -> pathname -> IO Bool
(defmethod/unit movefile :async-no-return ((self filesystem) src dst)
(error "Not implemented yet."))
;; filesystem -> pathname -> IO [pathname]
(defmethod/unit ls :async-no-return ((self filesystem) filepath)
(with-guard (self filepath)
(cl-fad::list-directory (merge-pathnames filepath (filesystem.root self)))))
(defmethod/unit fold-directory :async-no-return ((self filesystem) filepath fun)
(with-guard (self filepath)
(cl-fad:walk-directory (merge-pathnames filepath (filesystem.root self))
fun
:directories t
:if-does-not-exist :error))) | null | https://raw.githubusercontent.com/evrim/core-server/200ea8151d2f8d81b593d605b183a9cddae1e82d/src/services/filesystem.lisp | lisp | This program is free software: you can redistribute it and/or modify
(at your option) any later version.
This program is distributed in the hope that it will be useful,
but WITHOUT ANY WARRANTY; without even the implied warranty of
MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
GNU General Public License for more details.
along with this program. If not, see </>.
+----------------------------------------------------------------------------
Filesystem abstraction as a service
+----------------------------------------------------------------------------
Usage: create a filesystem service,
(defparameter *fs*
(make-instance 'filesystem :root *project-docs-root* :label *project-name*))
(writefile *fs* #P"staff/introduction.txt" "Here we go...")
(readfile *fs* #P"staff/introduction.txt")
/~sabetts/slurp.html
filesystem -> pathname -> IO String
filesystem -> pathname -> data -> IO String
filesystem -> pathname -> IO Bool
filesystem -> pathname -> pathname -> IO Bool
filesystem -> pathname -> IO [pathname] | Core Server : Web Application Server
Copyright ( C ) 2006 - 2008 , Aycan iRiCAN
it under the terms of the GNU General Public License as published by
the Free Software Foundation , either version 3 of the License , or
You should have received a copy of the GNU General Public License
(in-package :tr.gen.core.server)
Second parameter must be a relative pathname ,
( list - directory * fs * # P"pictures/ " : recursive t )
(defun slurp-stream5 (stream)
(let ((seq (make-array (file-length stream) :element-type 'character :fill-pointer t)))
(setf (fill-pointer seq) (read-sequence seq stream))
seq))
(defclass filesystem (local-unit)
((label :accessor filesystem.label :initarg :label :initform "")
(root :accessor filesystem.root :initarg :root :initform (error "Filesystem root must be set!"))))
security & validator layer
(defmacro with-guard ((fs filepath) &body body)
(let* ((errors (gensym)))
`(let ((,errors (list #'(lambda () (error "Filesystem null!"))
#'(lambda () (error "You must use relative paths!"))))
(ret (cond
((null ,fs)
(function car))
((and (pathname-directory ,filepath)
(not (eq :RELATIVE (car (pathname-directory ,filepath)))))
(function cadr))
(t (let ((res (progn ,@body)))
#'(lambda (x) (declare (ignore x)) #'(lambda () res)))))))
(funcall (funcall ret ,errors)))))
(defmethod/unit readfile :async-no-return ((self filesystem) filepath)
(with-guard (self filepath)
(with-open-file (s (merge-pathnames filepath (filesystem.root self)))
(slurp-stream5 s))))
(defmethod/unit writefile :async-no-return ((self filesystem) filepath data)
(with-guard (self filepath)
(with-output-to-file (s (merge-pathnames filepath
(filesystem.root self)))
:if-exists :overwrite :if-does-not-exist :create
(write-sequence data s))))
(defmethod/unit deletefile :async-no-return ((self filesystem) filepath)
(with-guard (self filepath)
(delete-file (merge-pathnames filepath (filesystem.root self)))))
(defmethod/unit movefile :async-no-return ((self filesystem) src dst)
(error "Not implemented yet."))
(defmethod/unit ls :async-no-return ((self filesystem) filepath)
(with-guard (self filepath)
(cl-fad::list-directory (merge-pathnames filepath (filesystem.root self)))))
(defmethod/unit fold-directory :async-no-return ((self filesystem) filepath fun)
(with-guard (self filepath)
(cl-fad:walk-directory (merge-pathnames filepath (filesystem.root self))
fun
:directories t
:if-does-not-exist :error))) |
6ccdd483578e22af4afd1c97ecd92566c2d1d8dbbb480864af4cff1f9c221170 | Kappa-Dev/KappaTools | dynamicArray.mli | module DynArray:
functor (_:GenArray.GenArray) ->
GenArray.GenArray
| null | https://raw.githubusercontent.com/Kappa-Dev/KappaTools/5e756eb3529db9976cf0a0884a22676925985978/core/dataStructures/dynamicArray.mli | ocaml | module DynArray:
functor (_:GenArray.GenArray) ->
GenArray.GenArray
| |
dc2437e68a7bcd911633f0604bb9110feaeb148c816c70ccec6492ca2f0fc0b0 | mirage/colombe | domain.mli | type t =
| IPv4 of Ipaddr.V4.t
| IPv6 of Ipaddr.V6.t
| Extension of string * string
| Domain of string list
val compare : t -> t -> int
val equal : t -> t -> bool
val pp : t Fmt.t
module Decoder : sig
val ( or ) : ('a -> bool) -> ('a -> bool) -> 'a -> bool
val is_alpha : char -> bool
val is_digit : char -> bool
val is_dash : char -> bool
val is_dcontent : char -> bool
val ipv4_address_literal : Ipaddr.V4.t Angstrom.t
val ipv6_addr : Ipaddr.V6.t Angstrom.t
val address_literal : t Angstrom.t
val domain : t Angstrom.t
end
val of_string : string -> (t, [ `Msg of string ]) result
val of_string_exn : string -> t
val to_string : t -> string
val extension : string -> string -> (t, [ `Msg of string ]) result
type atom
val atom : string -> (atom, [ `Msg of string ]) result
val atom_exn : string -> atom
val a : string -> atom
module Peano : sig
type z = Z
type 'a s = S
end
type 'a domain =
| ( :: ) : atom * 'a domain -> 'a Peano.s domain
| [] : Peano.z domain
val unsafe_domain_of_list_exn : string list -> t
type 'a w
val domain : 'a domain w
val ipv4 : Ipaddr.V4.t w
val ipv6 : Ipaddr.V6.t w
val make : 'a w -> 'a -> (t, [ `Msg of string ]) result
val v : 'a w -> 'a -> t
| null | https://raw.githubusercontent.com/mirage/colombe/bbecbb17b581fa1db70a61de14efb51a66f30451/src/domain.mli | ocaml | type t =
| IPv4 of Ipaddr.V4.t
| IPv6 of Ipaddr.V6.t
| Extension of string * string
| Domain of string list
val compare : t -> t -> int
val equal : t -> t -> bool
val pp : t Fmt.t
module Decoder : sig
val ( or ) : ('a -> bool) -> ('a -> bool) -> 'a -> bool
val is_alpha : char -> bool
val is_digit : char -> bool
val is_dash : char -> bool
val is_dcontent : char -> bool
val ipv4_address_literal : Ipaddr.V4.t Angstrom.t
val ipv6_addr : Ipaddr.V6.t Angstrom.t
val address_literal : t Angstrom.t
val domain : t Angstrom.t
end
val of_string : string -> (t, [ `Msg of string ]) result
val of_string_exn : string -> t
val to_string : t -> string
val extension : string -> string -> (t, [ `Msg of string ]) result
type atom
val atom : string -> (atom, [ `Msg of string ]) result
val atom_exn : string -> atom
val a : string -> atom
module Peano : sig
type z = Z
type 'a s = S
end
type 'a domain =
| ( :: ) : atom * 'a domain -> 'a Peano.s domain
| [] : Peano.z domain
val unsafe_domain_of_list_exn : string list -> t
type 'a w
val domain : 'a domain w
val ipv4 : Ipaddr.V4.t w
val ipv6 : Ipaddr.V6.t w
val make : 'a w -> 'a -> (t, [ `Msg of string ]) result
val v : 'a w -> 'a -> t
| |
a299e1a785ea2dd32edfc2be66108fb07288c909d5aa8a04eb4be20cbfa0aa31 | wangsix/VMO_repeated_themes_discovery | converter.lisp |
;(in-package :common-lisp-user)
(load
(merge-pathnames
(make-pathname
:directory '(:relative "File conversion")
:name "csv-files"
:type "lisp")
*lisp-code-root*))
(load
(merge-pathnames
(make-pathname
:directory '(:relative "File conversion")
:name "humdrum-by-col"
:type "lisp")
*lisp-code-root*))
(load
(merge-pathnames
(make-pathname
:directory '(:relative "File conversion")
:name "midi-save"
:type "lisp")
*lisp-code-root*))
(load
(merge-pathnames
(make-pathname
:directory '(:relative "Pattern rating")
:name "musical-properties"
:type "lisp")
*lisp-code-root*))
(setq
*path&name*
(merge-pathnames
(make-pathname
:directory
'(:relative
"mozartK282Mvt2" "monophonic" "repeatedPatterns"
"schoenberg" "E"))
*music-data-root*))
(setq
csv-destination
(merge-pathnames
(make-pathname
:directory
'(:relative "csv") :name "sonata04-2" :type "csv")
*path&name*))
(setq
MIDI-destination
(merge-pathnames
(make-pathname
:directory
'(:relative "midi") :name "sonata04-2" :type "mid")
*path&name*))
(setq
dataset-destination
(merge-pathnames
(make-pathname
:directory
'(:relative "lisp") :name "sonata04-2" :type "txt")
*path&name*))
(progn
(setq *scale* 1000)
(setq *anacrusis* -1)
(setq
dataset
(sky-line-clipped
(kern-file2dataset-by-col
(merge-pathnames
(make-pathname
:directory
'(:relative "kern") :name "sonata04-2"
:type "krn")
*path&name*))))
(saveit
MIDI-destination
(modify-to-check-dataset dataset *scale*))
(write-to-file
(mapcar
#'(lambda (x)
(append
(list (+ (first x) *anacrusis*))
(rest x)))
dataset)
dataset-destination)
(dataset2csv
dataset-destination csv-destination))
| null | https://raw.githubusercontent.com/wangsix/VMO_repeated_themes_discovery/0082b3c55e64ed447c8b68bcb705fd6da8e3541f/JKUPDD-Aug2013/groundTruth/mozartK282Mvt2/monophonic/repeatedPatterns/schoenberg/E/script/converter.lisp | lisp | (in-package :common-lisp-user) |
(load
(merge-pathnames
(make-pathname
:directory '(:relative "File conversion")
:name "csv-files"
:type "lisp")
*lisp-code-root*))
(load
(merge-pathnames
(make-pathname
:directory '(:relative "File conversion")
:name "humdrum-by-col"
:type "lisp")
*lisp-code-root*))
(load
(merge-pathnames
(make-pathname
:directory '(:relative "File conversion")
:name "midi-save"
:type "lisp")
*lisp-code-root*))
(load
(merge-pathnames
(make-pathname
:directory '(:relative "Pattern rating")
:name "musical-properties"
:type "lisp")
*lisp-code-root*))
(setq
*path&name*
(merge-pathnames
(make-pathname
:directory
'(:relative
"mozartK282Mvt2" "monophonic" "repeatedPatterns"
"schoenberg" "E"))
*music-data-root*))
(setq
csv-destination
(merge-pathnames
(make-pathname
:directory
'(:relative "csv") :name "sonata04-2" :type "csv")
*path&name*))
(setq
MIDI-destination
(merge-pathnames
(make-pathname
:directory
'(:relative "midi") :name "sonata04-2" :type "mid")
*path&name*))
(setq
dataset-destination
(merge-pathnames
(make-pathname
:directory
'(:relative "lisp") :name "sonata04-2" :type "txt")
*path&name*))
(progn
(setq *scale* 1000)
(setq *anacrusis* -1)
(setq
dataset
(sky-line-clipped
(kern-file2dataset-by-col
(merge-pathnames
(make-pathname
:directory
'(:relative "kern") :name "sonata04-2"
:type "krn")
*path&name*))))
(saveit
MIDI-destination
(modify-to-check-dataset dataset *scale*))
(write-to-file
(mapcar
#'(lambda (x)
(append
(list (+ (first x) *anacrusis*))
(rest x)))
dataset)
dataset-destination)
(dataset2csv
dataset-destination csv-destination))
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.